1Phospholipase A2 and PhosphatidylinositolSpecific Phospholipase C Assays by HPLC and TLC with Fluorescent Substrate H. ...
12 downloads
1727 Views
23MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
1Phospholipase A2 and PhosphatidylinositolSpecific Phospholipase C Assays by HPLC and TLC with Fluorescent Substrate H. Stewart Hendrickson 1. Introduction Llpolytic enzymes have traditlonally been assayed by radlometrlc and t&-lmetric methods (I). RadIometrIc methods are quite sensitive but require expensive radlolabeled substrates and tedious separation of labeled substrate and products. In addition, the safe use of radioactive materials 1sof mcreasmg concern. Tltrlmetrtc assaysare contmuous and quite straightforward and use natural substrates but suffer from low sensltlvlty and are subject to condltlons that may alter the amount of free hydrogen Ions released Fluorescence-based assays have sensltlvltles that approach those of radtometrlc methods; although they require synthetic fluorescent-labeled substrates, they are often more convenient and rapid. For a recent review, see Hendrickson (2). We first used dansyl-labeled glycerol ether analogs of phosphatidylcholme as substrates for the assay of enzymes of the platelet-actlvatmg factor (PAF) cycle m peritoneal polymorphonuclear leukocytes (3). This became a general method for the assay of phosphollpase A2 (PLA,) (see Fig. 1; refs. 4 and 5). This method can be modified to assayother enzymes of the PAF cycle such as lyso-PAF acyltransferase, lyso-PAF acetyltransferase, and PAF acetylhydrolase (3) Smce the probe remains attached to the glycerol backbone, simultaneous assay of all of these enzymes IS possible. The method described here for the assay of PLA2 uses thin-layer chromatography (TLC) to separate products from substrate, and quantltatlon by fluorescent scanning. The use of high-pressure hquld chromatography (HPLC) with fluorescence detection IS included as an alternative to TLC. The assay IS speFrom
Methods m Molecular &o/ogy, Vol 109 Lipase and Phospholipase Protocols Edlted by M H Doohttle and K Reue 0 Humana Press Inc , Totowa, NJ I
Hendrickson
H20POjCH2CH2N(CH3)3 +
0 --CH2
S02NHH
HO 1
-H
+ H2OP03CH$IH2N(CH3)3 +
Fig 1 Reactronschemefor the assayof PLA, with dansyl-PC. cific for PLA2 since the substrate, with an ether lmkage at the sn-1 position of glycerol, ts not hydrolyzed by PLA,. Hydrolysis of the substrate by phosphohpases C or D present m crude enzyme preparattons will be apparent as additional products that will be seen by TLC or HPLC Phosphattdylmosttol-specific phospholipase C (PI-PLC) from Bacdlus cerexs catalyzes the hydrolysis of PI to a diglycertde and 1o-myo-inositol- 1,2(cychc)phosphate (6) The latter is subsequently slowly hydrolyzed by the same enzyme to 1o-myo-mosttol- l-phosphate. This enzyme also catalyzesthe release of a number of enzymes linked to glycosylphosphatidylmosttol membrane anchors (7) Several years ago we synthestzed 4-(l-pyreno)butylphosphoryl-l-myomosttol (pyrene-PI) as a substrate for the assay of PI-PLC from B. cereu~ (see Fig. 2; refs. 8 and 9) The method described here uses reverse-phase HPLC wtth fluorescence detectton to separate and quantitate the product released. The methods described here are well suited to the assay of crude enzyme preparattons since the presence of other phospholtpase acttvmes will be apparent. The methods are independent of the specific condtttons for the enzyme reaction, so a variety of detergents can be used. These assayscan also be automated by the use of an autosampler for HPLC and larger plates wtth multiple
Fluorescence-Based
Phospholipase Assays
H&
po3=
, PI-PLC I
H,CH2CH&H20H
Fig 2 Reactlon scheme for the assay of PI-PLC wrth pyrene-PI
lanes for TLC; they can thus be used to screen many enzyme samples and potential mhibltors. The TLC-based assayscan done m a qualitative manner by simply vlsuahzing the plates under an ultraviolet (UV) lamp 2. Materials 2.1. PL A2 Assay 1 PLA, buffer. 0.395 M NaCl, 66 nuW Tns, 13.2 mi!4 CaCl,, pH 7 0 (adjust with HCl) 2 PLA, substrate dansyl-PC, 1 n-J4 In CHCl, Dissolve 1 mg of dansyl-PC (cat no D-3765, Molecular Probes, Inc , Eugene, OR) m 1 23 mL of chloroform (see Note 1) Store m a brown bottle at -20°C (see Note 2) 3 Trlton X-100 solutlon, 10 mM Triton X-100 (cat no. T9284, Sigma, St. LOUIS, MO) m water 4 PLA, stock assay solution. place 100 pL of PLA, substrate (1 mMdansyl-PC) m a small test tube (10 x 75 mm) and dry under a stream of mtrogen and then under high vacuum for 10-15 mm to remove all traces of solvent Add 20 pL of Trlton X-100 solution (see Note 3) and 380 pL of PLAz buffer Vortex and somcate (bath-type somcator) repeatedly until the lipid 1s completely dissolved and the solution is optlcally clear. 4 TLC solvent* CHC13/CH30H/conc ammoma/water (90.54 5.5:2 [v/v]) 5 TLC plates. 10 x 10 cm, HPTLC plates, (cat. no. 60077, Analtech, Newark, DE). 6. Fluorescence scanner: densitometer (model CS9000, Shlmadzu) with fluorescence accessory, or other sultable Instrument for fluorescence scanning of TLC plates. 7 Quenching solvent* hexane/lsopropanol/acetlc acid (6:8: 1.6) 8. PLA, HPLC solvent hexane/lsopropanol/water (6 8.1.6)
Hendrickson
4 2.2. PI-PLC Assay
1. PI-PLC buffer. 50 mM2-(N-morpholmo)ethane sulfomc acid (MES, Sigma), pH 7 0 (adjust with NaOH) 2. PI-PLC substrate 1 tipyrene-PI m CHCls/CH,OH (2.1). Dissolve 0 5 mg of racemic 4-( 1-pyreno)butylphosphoryl- 1-myo-mositol (cat no P-3764, Molecular Probes) m 1 25 mL of solvent Store m a brown bottle at -20°C (see Note 2) 3. PI-PLC stock assay solution place 250 pL of PI-PLC substrate (1 mM pyrenePI) m a small test tube (10 x 75 mm) and dry under a stream of nitrogen and then under high vacuum for 10-15 min to remove all traces of solvent Add 200 yL of PI-PLC buffer. Vortex and sonicate (bath-type somcator) repeatedly until the lipid is completely dissolved and the solution is clear 4. PI-PLC HPLC solvent 5 mM tetrabutylammonmm dihydrogenphosphate (cat no 26,8 10-0, Aldrich, Milwaukee, WI) in acetomtrile/methanol/water (70 10.20)
2.3. HPLC Analysis 1 HPLC column for PLA, assay 15 cm x 4.6 mm, 5 pm spherical silica gel (cat no 85774, Waters, Milford, MAtprotect with a guard column. 2. HPLC column for PI-PLC assay’ 25 cm x 4.6 mm 5 pm Spherisorb ODS (cat. no. 583 12, Supelco, Bellefonte, PA)--protect with a guard column (see Note 4). 3. Fluorescence detector Kratos model 980 or other suitable detector 4. HPLC mstrument with autosampler (optional) and mtegrator/recorder
3. Methods 3.1. PLAl Assay 1 MIX 40 pL of PLA, stock assay solution with 60 pL of enzyme (containing the equivalent of about 2 ng of pure snake venom PLA2 (cat no 525 150, Calbiochem, La Jolla, CA) (see Note 5) m a 500~PL microcentrifuge tube (vortex) Incubate at room temperature. The final concentrations are 0.15 MNaCI, 0.1 &substrate, 0 2 rnA4 Triton X-100, 5 mMCaC12, 25 mMTris-HCl, pH 7 0 2 At various times over a period of 30-60 mm, remove 5-pL aliquots Spot directly on a TLC plate for TLC analysis, or add to 90 pL of quenchmg solvent m a 500~pL microcentrifuge tube for HPLC analysis (vortex) 3 For TLC analysis. dry the spots and develop the TLC plates m TLC solvent After the solvent has evaporated, scan the plates with a fluorescence densitometer (set excitation at 256 nm; measure emission above 400 nm [cutoff filter]). The Rr values for dansyl-PAF and lyso-dansyl-PAF are 0 35 and 0 15, respectively 4 For HPLC analysis centrifuge the quenched samples at top speedm a rmcrocenmfuge for several minutes to remove any precipitated protein Equilibrate the s&a gel HPLC column in PLAZ HPLC solvent at a rate of 1 ml/r&n Set the fluorescencedetector at excnahOn 256 nrn and emission >4 18 nm (cutoff filter). InJect 20 pL of sample onto the column, Elution times for dansyl-PC and lyso-dansyl-PC are about 6 and 19 min, respectively 5 Calculation of acttvtty. the mol fraction of product released is determined by dividmg the area of the lyso-dansyl-PC peak by the sum of the areas of the dansyl-
Fluorescence-Based
Phospholipase Assays
5
PC and lyso-dansyl-PC peaks Thts value times the mmal amount of substrate present in the assay (0 01 pmol) equals the amount of product released Plot the pmol of product released vs time to determine the mitral lmear rate (acttvtty, umol/min)
3.2. Pi-PLC Assay 1 Add 5 pL of PI-PLC (contammg the equivalent of 0 2-4 ng of pure enzyme (cat no P-6466, Molecular Probes) (see Notes 5 and 6) to 20 pL of PI-PLC stock assay solutton m a 500~uL microcentrifuge tube (vortex). Incubate at room temperature Fmal concentratton of substrate, 1 mM 2 At vartous times over a period of l&30 mm remove 5-uL altquots and dilute with 95 uL of PI-PLC HPLC solvent in 500~pL microcentrifuge tubes (vortex) Centrifuge these samples at top speed in a microcentrtfuge for several minutes to remove any prectpttated protein (see Note 7) 3 Equilibrate the ODS reverse-phase HPLC column m HPLC solvent at a rate of 1 mL/mm (see Note 4) Set the fluorescence detector at excitation 343 nm and emission >370 nm (cutoff filter) Inject 20 PL of sample onto the column. Elution times for pyrene-PI and pyrenebutanol are 2 4 and 6.2 mm, respectively 4 Calculatton of activity the mol fraction of product released is determmed by dtvtdmg the area of the pyrenebutanol peak by the sum of the areas of the pyrenePI and pyrenebutanol peaks. This value ttmes the untial amount of substrate present m the assay (0 025 pmol) equals the amount of product released Plot the pmol of product released vs time to determme the mttial linear rate (activity, pmol/min) 4. Notes Dertvatives of dansyl-PC are useful in the assay of other enzymes of lipid metaboltsm Lyso-dansyl-PC and dansyl-PAF (cat. no D-3766 and D-3767, respectively, Molecular Probes) can be used as substrates m assays of lyso-PAF acyltransferase, lyso-PAF acetyltransferase, and PAF acetylhydrolase (3) This solution 1sstable for a year or more tf protected from moisture and stored m a brown bottle at -20°C Before use, warm to room temperature and make sure the lipid ts completely dissolved Snake venom PLA, IS quite active in the presence of Trtton X- 100, but other PLA2s (parttcularly pancreattc PLA2) may be less active with this detergent. The pancreatic enzyme is best assayed using sodium cholate as a detergent Hexadecylphosphocholme (cat no H6722, Stgma) IS also a good detergent for other phosphohpases. The concentration of substrate and the ratto of substrate to detergent may be varied as destred The spectfic activity of pure snake venom PLA, in this assay with dansyl-PC is about 13 ymol/mm/mg Do not leave the reverse-phase ODS column in PI-PLC HPLC solvent (wtth tetrabutylammonmm dthydrogen phosphate) for any length of time without solvent running through; if so, the column will become plugged After use, tmmedtately wash the column with CHsOH/H,O (80.20)
6
Hendrickson 5 Phospholipases readily adsorb onto glass or plastic surfaces Dilute soluttons of PLA, and PI-PLC (
References 1. Reynolds, L J., Washburn, W N., Deems, R. A., and Dennis, E A (199 1) Assay strategies and methods for phospholtpases Methods Enzymol 197,3-23 2 Hendrickson, H S (1994) Fluorescence-based assays of hpases, phospholtpases, and other ltpolytx enzymes Anal Blochem 219, l-8 3. Schmdler, P W , Walter, R., and Hendrickson, H S (1988) Fluorophore-labeled ether lipids Substrates for enzymes of the PAF cycle m peritoneal polymorphonuclear leukocytes Anal Blochem 174,477-484 4 Hendrickson, H S , Kotz, K J , and Hendrtckson, E K (1990) Evaluation of fluorescent and colored phosphatidylcholme analogs as substrates for the assay of phosphohpase A, Anal Bzochem 185,80-83 5 Hendrickson, H. S. (1991) Phosphohpase A, assays with fluorophore-labeled lipid substrates Methods Enzymol 197,9&94 6 Bruzik, K S and Tsar, M -D (1994) Toward the mechamsm of phosphomosttidespectfic phospholtpase C Bloorg Med Chem 2,49-72 7 Low, M G and Saltiel, A R (1988) Structural and functional roles for glycosylphosphattdylmositol m membranes. Sczence 239,268-275 8 Hendrickson, E K , Johnson, J L., and Hendrickson, H S (1991) A fluorescent substrate for the assay of phosphattdylmosnol-specific phosphohpase C 4-( lpyreno)butylphosphoryl1-myo-inositol Bloorg Med Chem Lett 1,6 19-622 9 Hendrickson, H S , Hendrickson, E K , Johnson, J L , Khan, T H , and Chlal, H J (1992) Kinetics ofB cereus phosphatldylmositol-specific phospholtpase C with thiophosphate and fluorescent analogs of phosphatidylmosnol Bzochemlstry 3 1, 12,169-12,172
2 Fluorometric Phospholipase Assays Based on Polymerized Liposome Substrates Wonhwa Cho, Shih-Kwang and Lenka Lichtenbergova
Wu, Edward Yoon.
1. Introduction Phospholtpases are a drverse group of ltpolyttc enzymes wrth specrflcrties for dtfferent sites on the phosphohptd molecule (2) Based on the site of then hydrolytrc attack, they can be classrfted into several groups, among whtch phospholtpase A, (PLA,), phospholipase C (PLC), and phosphohpase D (PLD) have been the most extensrvely studied. Because of then crltlcal mvolvement n-rmany extra- and intracellular processes, a senstttve contmuous kmetrc assay for phospholrpase IS an essentral tool for many blologtcal studtes Among the vartous assays used for the different classes of phospholtpases (2), those based on fluorometry (3-7) serve as the most sensttrve type of contmuous assay. However, a maJority of current fluorometrtc methods rely on the use of synthetic phospholiptds containmg a fluorophore at the ~2-2 posrtion of the phospholtptd that restricts then use to the assay of PLA*. In order to measure the activity of many types of phospholtpases, we have recently developed a novel fluorometrrc assay utlhzmg polymertzed mixed lrposomes (7). Polymerized mixed hposomes are composed of a pyrene-labeled phosphohptd monomer Inserted mto a polymertzed phospholtptd matrix, the pyrenelabeled phospholiprd constitutes only a small mole percentage of the total polymerized mixed hposome substrate. In this system, the polymerized matrix is essentially inert, and only the monomer (unpolymerrzed) inserts are selectively hydrolyzed by the phosphohpase (8). For example, the PLA2 actrvtty From
Methods m Molecular Biology, Vol 109 Lfpase and Phospholfpase Protocols Edlted by M H Dooltttle and K Reue D Humana Press Inc , Totowa, NJ
7
Cho et a/.
Fig 1 SchematIc lllustratlons of fluolometrlc assays usmg polymerized mixed hposomes for PLA, (A) and PLC and PLD (B). F indicates a fluorescent label, such as pyrene, attached to either the acyl cham (A) or the polar head group (B) assay utlhzes a polymerized mixed hposome substrate that IS composed of lhexadecanoyl-2-( I-pyrenedecanoyl)-srt-glycero-3-phosphoglycerol (pyrene-PG) inserted into a polymerized matrix of 1,2-bls[ 12-(hpoyloxy) dodecanoyll-snglycero-3-phosphoglycerol (BLPG). The pyrene-PG Insert contams a pyrenedecanoyl fatty acid at the sn-2 posltlon, with the fluorescent pyrene molecule located at the methyl-termmal end of the fatty acid (see Fig. 1A); the fluorescence emtsslon Intensity of the pyrene moiety ts largely quenched by the lipolc acid moieties of the BLPG molecules. Using this substrate, PLA2 hydrolysis can be contmuously monitored by measuring an increase m pyrene fluorescence, since the hydrolyzed pyrene labeled-fatty acids are no longer quenched as they are removed from the llposome surface by serum albumin m the reaction mixture (see Fig. 1A). Alternatlvely, for measurement of PLC and PLD hydrolysis, a new Insert IS used where the phosphollpld monomer contams a pyrene-labeled head group; agam, quenchmg of the pyrene moiety by the polymerized phosphollpld matrix IS lost as the hydrolyzed pyrene moiety readily diffuses away from the llposome surfaces (see Fig. 1B). Thus, polymerized mixed llposomes serve as an extremely versatile assay system for different phosphollpases, since one can readily modify the structure of the polymerized matrix, and the pyrenelabeled phospholipid inserts, to create an ideal combmatlon of llposome surfaces and hydrolyzable substrates for a specific phosphollpase. Herein, we describe the synthesis of polymerlzable phosphollplds and pyrenelabeled phospholiplds, the preparation of polymerized mixed llposomes from these synthesized products, and the use of the prepared llposomes as substrates to fluorometrlcally monitor phosphollpase hydrolysrs
9
Polymerized Liposome Substrates 2. Materials 2.1. Synthesis of the Polymerized Phospholipid 1,2-bis[lZ-(lipoyloxy)-dodecanoy/l-sn-Glycero3-Phosphoglyceroi (BL PG)
Matrix,
1 12-hydroxydodecanotc acid, 3,4-dihydro-2H-pyran, p-toluenesulfonic actd monohydrate, dtcyclohexylcarbodnmtde (DCC), 4-(dtmethylammo)pyrtdme (DMAP), glycerol (Aldrtch, Mtlwaukee, WI) 2 L-a-glyceropl~ospl~orylchohne, 1. I cadmmm chloride adduct (Sigma, St Louts, MO) 3 Cabbage PLD IS prepared as follows The Inner ltght-green leaves of a Savoy cabbage (1 Kg) IS homogemzed wtth 200 mL of cold water for 5 mm The homogenate IS filtered and the filtrate IS centrifuged at 20,OOOg for 30 mm The supernatant IS kept at 55 “C for 5 mm and placed on tee for 5 mm The prectpttate 1s removed by centrtfugatton (20,OOOg for 30 min), the supernatant 1scooled to 0°C and 2 vol of acetone cooled to -15°C is added to the supernatant After 10 mm, the prectpttate containmg the active PLD IS collected by centrifugatton (20,OOOg for 30 mm) and used for transphosphattdylatton. The acetone power can be stored at -20°C for several months 4. PLD reaction buffer 0 1 M sodium acetate buffer, pH 5 6, 0 1 A4CaC12
2.2. Synthesis of Pyrene-Labeled Phospholipid Monomers (Inserts) Specific for the Measurement of Cytosolic PLA2 Activity 1 lo-(1-Pyreno)decanotc actd Eugene, OR) 2 Ltthtum alummum hydrtde, tsopropyltdene-sn-glycerol, Mtlwaukee, WI) 3 Cholme tosylate, arachtdomc
2.3. Preparation
(a k a l-pyrenedecanotc actd) (Molecular
Probes,
pyridme, mesyl chloride, sodtum hydrtde, 2,3phosphorus oxychlortde, trtethylamme (Aldrrch, actd (Sigma, St Louis, MO).
of the Polymerized
Mixed Liposome
Substrate
1 Macro extruder Ltposofast (Avestm, Ottawa, Canada) with 0.1 -mm polycarbonate filter (M&pore, Bedford, MA). 2 Polymenzatton buffer, 10 mMTris-HCI, pH 8.4,O 16 M KC1 3 Sephadex G-SO (Pharmacta, Uppsala, Sweden). 4. Mobile phase for Sephadex G-50, 10 mM HEPES buffer, pH 7.4 , 0.16 KC1
2.4. Kinetic Measurements 1 Spectrofluorometer equtpped with a thermostated cell holder and a magnettc stnrer. 2. 1-Hexadecanoyl-2-( 1-pyrenedecanoyl)-sn-glycero-3-phosphocholme (pyrene-PC), -phosphoethanolamme (pyrene-PE),-phosphoglycerol (pyrene-PG) (Molecular Probes) 3. N-( I-pyrenesulfonyl)-egg phosphattdyl ethanolamme (N-pyrene-PE) (Avanti, Alabaster, AL) 4 Fatty acid-free bovine serum albumin (BSA) (Bayer, Kankakee, IL)
70
Cho et al
5
Secretory PLA2 assay buffer 10 mMHEPES, pH 7 4,0 16 M KCI, 10 mMCaCl,, and 10 mMBSA 6 Cytosohc PLAz assay buffer 10 mMTns-HCI, pH 8.0,1 mA4CaCl,, and 10 mMBSA 7. PLC assay buffer 10 mMMES buffer, pH 6 0,O 1 n&‘ZrCl,, and 10 mA4CaClz 8 PLD assay buffer 10 mA4HEPES, pH 7 4,0 16 M KCl, and 10 mM CaClz
3. Methods
3.1. Synthesis of the Polymerized Phospholipici Matrix, 1,2-bis[12(lipoyloxy)=doctecanoyl;l-sn -Glycero-5 Phosphoglycerol(6 L PG) BLPG IS prepared from L-u-glycerophosphorylchohne by a four-step synthesis according to the procedure by Sadowmk et al. (9) with slight modlfications (7,s).
3.7.1. Synthews of 12-(Tetrahydropvranyloxy)Dodecanoic
Acid (TCA)
1 Suspend 10 mmol (2 16 g) of 12-hydroxydodecanolc acid m 20 mL of dry tetrahydrofuran 2 Add 17 mm01 (1 39 g) of 3,4-dihydro-2H-pyran and stir the mixture for 10 mm at room temperature 3 Add 0 1 mm01 (20 mg) of crystallme p-toluenesulfomc acid monohydrate and stir the mixture for an addItIona 2 h at room temperature 4 Evaporate the solvent and purify the product by slllca gel column chromatography usmg chloroform/methanol (20 1, v/v) as eluent. Check the product by thmlayer chromatography (TLC) (R,= 0 5 with the same solvent) Completely remove the solvent zn vacua
3.72. Synthesis of 1,2-Bis(lZ-Hydroxydodecanoyl)-snGlycero-3-Phosphocholine 1 Dissolve the purified 12-(tetrahydropyranyloxy)dodecanolc acid (TCA) m dry dtchloromethane (15 mL) and add DCC (2.6 mmoU4 mm01 of TCA) dissolved m dry duzhloromethane 2 Stir the reactlon mixture at room temperature until it gets cloudy (approx 5 mm), then add L-a-glycero-phosphorylcholme (1 mmol/4 mmol of TCA) and DMAP (2 6 mmol/4 mm01 of TCA) Stir the mixture at room temperature overnlght 3 Filter the reactlon mixture to remove dlcyclohexylurea, evaporate the solvent and purify the product by slhca gel column chromatography using chloroform/ methanol (5 1) first and then chloroform/methanol/water (65 25.4) Check the product by TLC Rf= 0 35 with chloroform/ methanol/water (65 25:4) 4 Dtvlde the product mto about 200 mg fractions, dissolve each fraction m methanol (2 mL) and add equlmolecular crystallme p-toluenesulfomc acid monohydrate Stir the mixture at room temperature for approx 1 5 h while checking the progress of the reactlon every 15 mm by TLC usmg chloroform/methanol/water (4 5 1) as developmg solvent (Rf = 0 3 for the product) The reaction must be completed within 2-2 5 h, otherwlse the hydrolysis of acyl groups of the phos-
Ii
Polymerized 1iposome Substrates
phohptd ~111 occur to a constderable degree. Use the crude product lmmedrately for the next step
3.1.3. Synthesis of 1,2-Bls[lZ-(lipoyloxy)Dodecanoyl]-sn-Glycero-3Phosphocholine (BL PC) 1. Dtssolve 6,8-drthrooctanotc acid (5 mmol/l mmol of TCA) m dry dtchloromethane and add DCC dtssolved in dry dichloromethane (3 mmoli5 mmol of 6,8dtthtooctanorc acid) 2 Stir the reactton mtxture at room temperature untrl tt gets cloudy (approx 5 mm), then add the crude product of the above reactton drssolved m dry dtchloromethane and DMAP (2 mmol/l mmol of TCA) Star the mixture overmght m the dark at room temperature 3 Filter the reaction mixture to remove dtcyclohexylurea, evaporate the solvent and purify the product by silica gel column chromatography usmg chloroform/ methanol (5.1, [v/v]) first to completely remove DMAP and unreacted 6,8dlthlooctanotc acid and then chloroform/methanol/water (65 25 4) Check the product by TLC R, = 0 45 wrth chloroform/methanol/water (65 25.4). The purtfied product (yellow sohd) should be dissolved m dtchloromethane and stored at
-20°C m the dark
3.7.4. Synthesis of BLPG 1 Suspend 50-100 mg of BLPC m ethyl ether (1 5 mL) m a small glass vial 2 Add 0 6 g of glycerol to 3 mL of 0 1 M sodium acetate buffer, pH 5 6, 0 1 A4 CaCl,, combme tt with the above BLPC solutton and vortex the mixture brrefly 3 Add approx 100 mL of cabbage PLD (approx 1 mg/ml) to the reactton mtxture and stir the mixture vrgorously for 1 5 h at room temperature 4. Evaporate ether from the reaction mixture and extract the aqueous layer wtth
chloroform
Dry the orgamc layer over anhydrous sodmm sulfate and evaporate
the solvent In vacua S Purify the product by sthca gel column chromatography using CHCl,/CH,OH (3 1) first and then chloroform/methanol/water (40 10.1)
6
1,2-bts[ 12-(lipoyloxy)-dodecanoyl]-sn-glycero-3-phosphatldlc
acid (BLPA) can
be synthesized by performing the PLD reaction m the absenceof glycerol
3.2. Synthesis of Pyrene-Labeled Phospholipid Monomers (Inserts) Specific for the Measurement of Cytosolic PLA2 Activity Cytosolrc PLA, (cPLA,) has htgh specificity for the arachidonyl motety m the m-2 posrtron of phospholtptds (20, II). Furthermore, cPLA, has both PLA, acttvtty and lysophosphohpase acttvrty and, as a result, tt hydrolyzes both sn- 1 and m-2 acyl esters tf 1,2-dtacyl-sn-glycero-3-phosphohptds are used as a substrate. Thus, a pyrene-labeled substrate for cPLA, must contain ~12-2arachtdonyl ester and a nonhydrolyzable group at sn- 1 posttton. l-O-( 1-pyrenedecyl)-2arachrdonyl-sn-glycero-3-phosphocholine (PAPC) IS a synthetic phospholtptd
12
Cho et al.
that meets this reqmrement. PAPC IS prepared from lo-(I-pyreno)decanolc acid by a five-step synthesis. 3.2.1. Synthesis of IO-( 1-Pyreno)Decanol Convert IO-( 1-pyreno)decanotc acid to an ethyl ester by refluxmg tts ethanol solutton for 4 h wtth 1 drop of concentrated HCI Dilute the mtxture with chloroform and wash the organic layer with 1 M solution of sodmm bicarbonate Dry the organic layer over anhydrous sodmm sulfate and evaporate the solvent Dtssolve the product m dry tetrahydrofuran, place the mixture on ice, addllthlum alummum hydride and stir the mtxture at 0°C for 30 mm and then at room temperature for 2 h Stop the reaction by coolmg the mrxture on Ice and adding water to the mtxture Extract the mixture wnh chloroform and purtfy IO-( 1-pyreno)decanol by stltca gel column chromatography using hexane/ethyl acetate (4.1, [v/v])
3 2 2. Synthesis of 1O-( I- Pyreno) Decanyl Mesyiate 1. Drssolve IO-( I-pyreno)decanol m 5 mL of dry pyrtdme and 5 ml of hexane Stn the mixture m a 25°C water bath and slowly add mesyl chloride (2 mmol/l mm01 of lo-( 1-pyreno)decanol) 2 Warm the water bath to 40°C stn the mixture for 1 h and check the progress of the reaction by TLC, R1 = 0.4 with hexane/ethyl acetate (2.1, v/v) 3 After the reaction 1s complete, dilute the mixture with 30 ml of hexane-benzene (1 1, v/v) and wash successtvely wtth water, 0 5 N HCl, water, 5% sodmm btcarbonate, and water (2X). 4 Dry the organic phase over anhydrous sodmm sulfate and evaporate the solvent Purify the product by sthca gel column chromatography usmg hexaneiethyl acetate (2.1, v/v)
3.2.3. Synthesis of l-O-[iO-(I-Pyreno)Decanyl]-sn-Glycerol Prepare a solutton of 0 12 g of sodmm hydride m 5 mL of dry benzene and slowly add 2 mmol of 2,3-tsopropyltdene-sn-glycerol Whtle sttrrmg at room temperature, add 1 5 mmol of lo-( I-pyreno)decanyl mesylate and heat the mixture to reflux for 4 h Cool the mixture m an Ice bath, add water to remove excess sodmm hydrtde and neutralize the mixture wtth 1 N HCl Dilute the mixture with 20 mL benzene and wash tt twice wtth 20 mL of methanol/water (1 1, [v/v]). Dry the orgamc phase over anhydrous magnesium sulfate, evaporate the solvent and drssolve the solid m 5 mL of methanol Add 20 mL of 10% HCl m methanol and heat the mtxture at 60°C for 30 min. Evaporate the solvent m vacua, apply the crude product dissolved m acetone/ hexane (1 9, [v/v]) onto a sthca gel column and elute stepwtse with 10, 20, and 30% acetone in hexane (v/v) Check the product by TLC, Rl = 0 4 wtth hexanel
Polymerized Liposome Substrates
13
acetone (7 3, [v/v])
3.2.4. Synthesis of l-O-(l-Pyrenedecyl)-Z-Hydroxysn -Glycero-3-Phosphocholine Combme 1 mmol of l-O-[ IO-( I-pyreno)decanyl]-sn-glycerol with 1 8 mmol of phosphorus oxychlorlde and 3 0 mmol trlethylamme m 5 ml of dry chloroform and stir the mixture at 0°C for 30 mm Add choline tosylate (1 8 mmol) and stir the mixture at 0°C for another 30 mm Check the progress of reaction by TLC, R, = 0 5 for the product with chloroform/
methanol/water (40 10 1, [v/v/v]) Quench the reaction by adding water and stirring the mixture at room tempera-
ture for IO mm Evaporate the solvent and purify the product on a sdlca gel column
with chloroform/methanol
Elute first
(5. I, [v/v]) and then with chloroform/methanol/water
(40 10 1) [v/v/v])
3 2.5. Synthesis of PAPC 1 Dissolve arachldomc acid m dry dlchloromethane (2 mmol of actd/l mmol of the above product) and add DCC dissolved m dry dlchloromethane (3 mmoli2 mmol of arachldomc acid) 2 Stir the mixture at room temperature until it gets cloudy (approx 5 mm), then add the above product dissolved m dnzhloromethane and DMAP (2 mmol of DMAPi 1 mmol of the above product) Stir the mixture at loom temperature overnight 3 Filter the reaction mixture to remove dlcyclohexylurea, evaporate the solvent and purify the product by slltca gel column chromatography Elute first with chloroform/methanol (5. I, [v/v]) to completely remove DMAP and unreacted fatty
acid and then chloroform/methanol/water
(65 25.4, [v/v/v]) Check the final prod-
uct by TLC; R, = 0 5 with chloroform/methanol/water (65 25 4, [v/v/v]) purified product IS dissolved m dlchloromethane and stored at -20°C
3.3. Preparation
of the Polymerized
Mixed Liposome
The
Substrate
Polymerrzed mixed hposomes are prepared by polymerlzmg pre-formed mixed llposomes of BLPG (or its denvatlves) and a pyrene-labeled phosphollpld. Although the composition of pyrene-labeled phosphollpld m polymerized mlxed hposomes can vary from 1 to 10% without affectmg the kinetic propertles of phosphollpases, a mmlmal composltlon (1 “A) 1s maintained for all polymerized mixed hposomes for kinetic consistency and economical reasons 1 To prepare 2 mL of 1 mMpolymerized mixed Iiposomes, mix 1 98 pmol of BLPG and 0 02 pmol of pyrene-labeled phosphohpld in a glass vial, evaporate the organic solvent with the stream of nitrogen gas and add 2 mL of IO mMTns-HCI buffer, pH 8 4, to the hptd film and vortex the dispersion for about 5 mln 2 Prepare large umlamellar hposomes by multiple extrusion (15X) of phospholipld
dlsperslon through 0 1-mm polycarbonate filter m a micro extruder Liposofast
14
Cho et al
3 Prepare polymerized mlxed hposomes by Incubating the mixed hposomes at 37°C fol24 h m the presence of 10 mM dlthlothreltol The degree of polymeflzatlon can be monitored by TLC and by the loss of the UV absorption at 333 nm (9) (see Note 1) 4 Separate the polymerized mixed hposomes from the reaction mixture on a short Sephadex G-SO column (1 x 10 cm) eqtuhbrated with 10 mMHEPES buffer, pH 7 4 contammg 0 16 KC1 Elute the hposomes with the same buffer, monitor the absorbance at 280 nm and collect the first peak elutmg at the void volume of the column 5 Determine the total phosphohpld concentration of hposomes by phosphate analy-
SIS (2.5) (see Note 2) 3.4. Kinetic Measurements All kmetlc measurements are performed at 37°C. The change m fluorescence mtenslty of pyrene-labeled phosphohplds m polymerized mixed hposomes IS measured as a function of time using a fluorescence spectrometer The excltatlon wavelength 1sset at 345 nm and the emlsslon wavelength at 380 nm. Spectral band width IS set at 5 nm for both excltatlon and emlsslon. The sample IS contained m a stirred, thermostated 1-cm path length quartz cuvet. 3.4.1
Secretory
PLA,
1 Add 2 mL of 10 mMHEPES buffel, pH 7 4, contammg 10 pMpolymerlzed mixed hposomes (e g , pyrene-PGiBLPG), 10 FM BSA, 0 16 M KCl, 0 1 mM EDTA to a quartz cuvet 2. Place the cuvette m the spectrometer and monitor the fluorescence intensity at 380 nm until the baseline 1s stabilized (approx 2 mm) 3. Add an ahquot of enzyme solution and incubate the mixture for a few minutes 4 Initiate the reaction by adding 10 FL of 2 MCaCl, solution to the final concentrationof lOmA
3 4.2
Cytosok
PLA2
In contrast to secretory PLA,s, cPLA,s shows extremely low actlvlty toward polymerized mixed hposomes, such as PAPUBLPG polymerized mixed hposomes. This 1s presumably owing to the fact that cPLA2 must penetrate mto the core of phosphohpld bilayer to pull a substrate molecule mto its active site, which IS largely prohibited m the polymenzed mixed hposome system On the other hand, cPLA, shows high activity toward PAPC m unpolymerized mixed hposomes of PAPUBLPG (see Chapter 4). Thus, PAPUBLPG ( 1:99, mol/mol) mixed hposomes are used as a substrate for cPLA,. As IS the case with the polymerized mixed hposome system, PAPC 1sselectively hydrolyzed m this system because cPLA2, owing to its high sn-2 specificity, shows essentially no detectable activity toward unpolymerized BLPG. To ensure the completely selective hydrolysis of PAPC, one can employ PAPC/D-BLPG mixed hposomes. D-BLPG can be synthesized from D-a-glycerophosphocholme as described for BLPG (see Note 3).
15
Polymerized Liposome Substrates
1 Add 2 mL of 10 mM Tns-HCI buffer, pH 8 0, contammg 1 mM CaCI,, 10 @I PAPUBLPG mixed hposomes and 10 @I BSA to a quartz cuvet 2 Place the cuvette m the spectrometer and momtor the fluorescence mtenslty at 380 nm until the baselme IS stablhzed (approx 2 mm) 3 Initiate the reactlon by addmg an ahquot of enzyme solution
3.4.3 PLC and PLD With commercially available N-pyrene-PE in polymerized mixed liposomes, one can measure the actlvlty of phosphatldylcholme-specific PLC and PLD. For PLC, N-pyrene-PEIBLPG polymerized mlxed hposomes are used as a substrate m which N-pyrene-PE 1sselectively hydrolyzed. For PLD reactions, Npyrene-PE/BLPA polymerized mixed liposomes are used as a substrate owing to relatively high activity of PLD toward polymerized BLPG molecules. For both assays,BSA IS not included. 1 For a PLC assay, add 10 pMN-pyrene-PEIBLPG polymerized mixed hposomes m 2 mL of 10 mM MES buffer, pH 6.0,O 1 nuI4 ZnCl,, 10 ti CaCl, to a quartz cuvet For PLD assays, use 10 @IN-pyrene-PEIBLPA polymerized mlxed llposomes m 10 mA4 HEPES, pH 7 4,0 16 MKCl, 10 mM CaCl, 2 Place the cuvet m the spectrometer and monitor the fluorescence mtenslty at 380 nm until the baseline is stabdlzed (approx 2 mm) 3 Initiate the reactlon by addmg an allquot of enzyme solution
3.4.4. Determination
of Rate Constants
1 The actlvlty (pmol/mm) of PLA2 for polymerized mixed hposomes IS calculated according to the followmg equation (7) Actlvlty = [pyrene-PL],
x (AF- A.FO) AF,nax
where [pyrene-PL], mdlcates the total concentration of pyrene-labeled phosphohpld (in pmol); AF, and AF, the fluorescence change per minute for nonenzymatic and enzymatic hydrolysis, respectively, AF,,,,, the maxlmal fluorescence change that IS measured by addmg an excess amount of enzyme (see Note 4) 2. The specific activity (pmol/mm/mg) IS determmed by divldmg the enzyme actlvIty by the amount of protein (mg) 3 Owing to the umque structural property of polymerized mixed hposomes m which only a small percentage of phospholipid m the hposome IS hydrolyzed, the kinetic pattern of hydrolysis of these hposomes IS, m general, simpler than that of the hydrolysis of conventlonal hposomes (13) Yet various factors, such as enzymeto-phosphohpld ratio, can slgmficantly affect the kinetic pattern for different phospholipases. Therefore, It 1srecommended that the range of the enzyme concentration wlthm which the activity IS directly proportlonal to the enzyme concentration be estabhshed first for each phosphohpase and Its best polymerized mlxed hposome substrate at a given concentration (1 e., 10 @4).
16
Cho et a/.
4. Notes 1 BLPG (and BLPC) molecules are prone to polymerlzatlon even m the absence of dlthlothreltol and at low temperature For this reason, a fresh BLPG solution IS prepared m every three months 2 Owmg to their chemical and mechanical stablhty, polymerized mlxed llposomes can be stored at room temperature for several weeks under argon and in the presence of 0 0 1% sodium azlde It has been notlced, however, that some phosphohpases show considerably altered activity toward these hposomes after elongated storage It 1stherefore recommended that polymerized mlxed hposomes are used within several days of preparation for the reproduclblllty of kinetic data 3 To design an assay system using polymerized mlxed hposomes for a newly dlscovered phosphohpase, one must first find a polymerized matrix that 1s reslstant to the hydrolysis by the enzyme and a pyrene-labeled insert that 1s rapidly hydrolyzed by the enzyme The derivatives of BLPG and other pyrene-labeled phospholipids (I e , pyrene-PA and pyrene-PS) (24) can be prepared by the PLD-catalyzed transphosphatldylatlon Specific actlvlty of phosphohpases for (polymerized) mlxed hposomes ranges from 0 5 to 1,000 mmol/mm/mg depending on the nature of enzyme (7) 4 Some phosphohpases show a short lag period (approx 10 s) before they 1each the steady state For these enzymes, the sequence of adding enzyme and cofactors can be varied to mmlmlze the lag If the lag persists, the mltlal velocity 1s measured after the reactlon reaches a steady state
References Waite, M (1987) The Phospholzpases, Plenum, New York Reynolds, L J , Washburn, W N , Deems, R A and Dennis, E A (199 I ) Assay strategies and methods for phosphohpases Methods Enzymol 197, 3-23 Radvanyl, F , Jordan, L , Russo-Mane, F , and Bon, C (1989) A sensltlve and contmuous fluorometrlc assayfor phosphohpaseA, using pyrene-labeled phosphohplds m the presenceof serumalbumm Anal Bzochem 177, 103-I 09 Thuren, T , Vlrtanen, J A , Vamlo, P , and Kmnunen, P K J (1983) Hydrolysis of 1-tnacontanyl-2-pyrene-l-yl)hexanoyl-sn-glycero-3-phosphochollne by human pancreatic phosphohpaseA, Chem Phy Llplds 33,283-292 Hendnkson, H S and Rauk, P N (198 1) Contmous fluorometrlc assayfor phosphollpase A2 with pyrene-labeled leclthms as a substrate Anal Blochem 116, 553-558
Kmkald, A R and Wllton, D C (1993) A continuous fluorescence dlplacement assay for phosphohpaseA, using albumm and medium chain phosphollpld substrates Anal Blochem 212, 65-70 Wu, S -K and Cho, W (1994) A contmuous fluorometric assay for phosphohpasesusing polymerized mlxed hposomes Anal Blochem 221, 152-l 59. Wu, S -K and Cho, W (1993) Use of polymerized llposomes to study mteractlons of phosphollpase A2 with blologlcal membranes Bzochemzstry 32, 13,902-13,908
Polymerized Liposome Substrates
17
9 Sadowmk, A , Stefely, J , and Regen, S L (1986) Polymerized hposomes formed under extremely mild condltlons. J Amer Ckem Sot 108,7789-7792 10 Clark, J. D , Lm, L -L., Knz, R W., Ramesha, C S., Sultzman, L A., Lm, A Y , Mllona, N., and Knopf, J. L. (1991) A novel arachldomc acid-selective cytosohc PLA, contains a Ca2’-dependent translocatlon domam with homology to PKC and GAP Cell 65, 1043-105 1 11 Sharp, J D , White, D L, Chlou, X G., Gooden, T, Gamboa, G C , McClure, D , Burgett, S , Hoskm, J., Skatrud, P L., Sportsman, J R , Becker, G W , Kang, L H , Roberts, E F , and Kramer, R M (199 1) Molecular clonmg and expresslon of human Ca*+-sensltlve cytosohc phosphohpase A, J Blol Ckem 266, 14,85@-14,853 12 Kates, M (1986) Techmques of Llpldology, Elsevler, Amsterdam 13 Jam, M K and Berg, 0 G. (1989) The kinetics of mterfaclal catalysis by phosphohpase A, and regulation of mterfaclal actlvatlon hopping versus scootmg Blocklm Bzopkys Actu 1002, 127-156 14 Smtko, Y , Yoon, E T , and Cho, W (1997) High Speclficlty of Human Secretory Class II Phosphohpase A, for Phosphatldlc Acid Blockem J 321,737-74 1
3 Triglyceride Fluorogenic
Lipase Assays Based on a Novel Alkyldiacyl Glycerol Substrate
Albin Herrnetter 1. Introduction Lipases are responsible for extracellular degradation and mtracellular metabolism of lipids m animals, plants, and microorganisms The conformational motif of all lipases whose three-dimensional structure has been determined IS characterized by an alp hydrolase fold (1). Most hpases utilize the catalytic triad Ser-His-Asp, with the serme residue actmg as the nucleophile in the mmal step of carboxyl ester hydrolysis, this active site serme is contamed withm the GlyXaa-Ser-Xaa-Gly consensus sequence common to most hpases (2,2) In humans and animals, triacylglycerols (and to a lesser extent diacyl- and monoacylglycerols) are the biological substrates of lipases Commensurate with their function, different triglyceride lipases are found m a variety of extracellular and intracellular locations. For example, lingual hpase, gastric hpase, pancreatic lipase, and bile salt-activated lipase are present m the gastromtestinal tract. Lipoprotein lipase and hepatic lipase are bound to the capillary endothelium and hydrolyze triacylglycerols m cnulatmg hpoprotems. Lipoprotem lipase and bile salt-activated hpase are also present m milk. Finally, lysosomal lipase and hormone-sensitive lipase are intracellular enzymes. Importantly, the different lrpases exhibit specific preferences for then triacylglycerol substrates, depending on chain length, optical and positional isomers, and the characteristics of the lipid/water interface (3,4) For instance, lipoprotem hpase and hepatic lipase express maximum activity only against certain lipoprotem classes ($6). Pancreatic hpase acts on mixed micelles contaming bile salt, although only in the presence of colipase (7,s). Moreover, enzyme activity may be enhanced by specific cofactors such as apohpoprotem CII for lipoprotein lipase (9) or colipase for pancreatic lipase. From
Methods
fn Molecular
Edited by M H Doohttle
L?/o/ogy,
Vol
109
Llpase
and K Reue 0 Humana
19
and
Phosphohpase
Press Inc , Totowa,
Protocols
NJ
20
Herrnetter
Impaument of hpase functton due, for example, to the absence of enzyme activity as a consequence of mutattons m the genes coding for the enzyme or its protein cofactor(s), may be associated with severe pathological phenotypes For instance, elevated plasma triglycerides associated wtth metabolic disorders such as type I hyperhpoprotememta results from the deficiency of hpoprotem hpase activity (10,12) The consequence of a deficiency m lysosomal actd ltpase IS cholesterol ester storage disease (12). Moreover, under pathological condmons, hpases may be found m an envnonment m which they usually do not occur and, as such, may represent markers of destructive organ processes For instance, as a consequence of pancreatttts, high levels of pancreatic hpases are often present n-t the blood (13). Determmatton of hpase acttvlty 1s routmely used for monitormg enzyme protem durmg tsolatton, purtficatlon, detectton, and characterization of natural and recombinant proteins, for studies of biologtcal enzyme functton, and for the screenmg of biologtcal samples for diagnosis m medtcme. A number of methods are available for the determmation of hpase acttvmes (#J&16), and include a variety of different substrate types (natural or synthetic triacylglycerols, radtoacttve or chromogenic llptds), as well as methods of substrate preparation (monodisperse and polydisperse substrates, phospholtptd vesicles or detergent micelles) Both substrate type and its preparation are cructal wtth respect to reproducibility and relevance of the measured data A htgh-performance lipase assay 1s expected to meet several criteria that are important for facility, quality, and selecttvity of the procedure (see Table 1) We have developed new fluorogemc trtacylglycerol analogs as substrates for a contmuous llpase assay that fulfills these requirements (1618). These substrates can be solubthzed m water containing fatty acid-free albumin Alternatively, stable lyophihsates of substrate/albumm complexes can be obtained commerctally and represent ready-to-use hpase substrates after dlssolutton m an appropnate aqueous buffer (17) In addmon, these fluorogernc substratescan be substituted for triacylglycerol m many types of standard substrate preparations, mcludmg detergent mtcelles, phosphohptd vesicles, emulsions, and orgamc solvents (18) The structure of these novel fluorogemc lipase substrates 1s an alkyldtacylglycerol m an enanttomerically pure form, as shown m Fig. 1. In posttions sn-1 or ~2-3, a hexadecyl residue is linked to glycerol by an ether bond, whtch prevents esterolysts of this bond by the hpase In posttton 92-2, glycerol is estertfied with the fluorescent molecule pyrenedecanotc acid. Finally, a dodecanoyl chain,
substituted at its omega-end with a fluorescence quencher (a trlmtrophenylammo residue), IS bound by an ester linkage to posttion sn-3 or sn- 1 of the glycerolipld In then Intact form, these substrates show only low fluorescence intensity due to mtramolecular resonance energy transfer. In the presence of a hpase, the fatty acid ester containing the quencher 1shydrolyzed and the fluorescent product, an
21
Lipase Assays Usmg Fluorogemc Substrates Table1 Requirements
for a High-Performance
Lipase Assay
Category I facllltatlon of the assay Fast results High throughput of samples Contmuous measurement Water-soluble substrates No radloactlvlty Category II quahty and selectlvlty of the assay High sensltlvlty High accuracy High reproduclblllty No detergent General apphcablhty to different reaction media Determmatlon of enzyme actlvlty under native condltlons No interference with nonspeclfic esterases
Fig 1 Chemical structure of the fluorogemc hpase substrate amlnododecanoyl-2-pyrenedecanoyl-3-0-hexadecyl-sn-glycerol
l-tnmtrophenyl-
alkylacylglycerol, IS formed. Thus, from the contmuous mcrease m fluorescence mtenstty, substrate hydrolysts can be monitored as a measure of ltpase activity, using a calibratton curve obtamed by plotting fluorescence mtenstties vs concentratton of an unquenched standard (pyrenedecanotc acid) (see Figs. 2 and 3) Under condtttons of nonltmttmg substrate concentrattons whtch depend on the reaction medium, enzyme actrvrty IS lmearly proportional to enzyme concentratton. The detetectton limit for pure lipases IS >5 ng depending on the lipase type, the stabthty of the hpase, and the quality of the enzyme preparation. For all animal hpases so far mvesttgated, there IS a very high stereopreference for the sn-1 posttton of the fluorogemc alkyldtacylglycerols, especially tf solubthzed m the presence of albumin (2618) Therefore, only the preferred enantromer, namely, 1-trinitrophenyl-ammo-dodecanoyl-2-pyrenedecanoyl- 3-O- hexadecyl-sn-glycerol, will be described as the hpase sub-
Herme tter
22
800 600
0 0 40 80 Standard concentration
120 160 [pmollml]
Fig 2 Caltbration plot for an unquenched standard fluorophore. Fluorescence mtensities at 400 nm are plotted agamst concentrations of pyrenedecanoic acid as a complex with albumm m PBS
600
400
200
0 0
1
2
3
4
6
Time I min
Fig 3 Plot of the change m fluorescence intensity due to the addition of lipase activity Fluorescence mtensity of substrate (lipid-albumm complex) was recorded at 400 nm and 37”C, followed by measurement of the time-dependent Increase of fluorescence mtensity (AI) at 37% after addition of 15 pL post-heparm serum strate m this chapter. Importantly, this long-chain trtacylglycerol analog 1s ltpase specific, we have tested esterases from porcme pancreas and various mrcroorgamsms and have found no hydrolytrc actrvtty using this substrate
Lipase
Assays
Using
Fluorogenic
Substrates
23
The features of this novel fluorogemc substrate that provide advantages compared with existmg techmques may be summarized as follows* 1 The substrate can be prepared m detergent-free form, or at submtcellar detergent concentration, and wtth a defined particle size m solutton (approxtmately 40 A) that does not disrupt membranes or affect hpoprotem structure Thus, hpase acttvmes can be measured under native condmons 2. The fluorogemc substrate/albumm complex IS avarlable as a water-soluble lyophtbsate that represents a ready-to-use hpase substrate after reconstttutlon m aqueous buffer The lyophlltsate IS very stable and easily stored 3 The use of radioactive substrates is avoided 4 The assay IS continuous and much more sensitive than the continuous tttrtmetrtc methods using ahphatic short-cham triglycerides as substrates 5 The fluorogemc substrate is lipase specific Other commonly used short-chain trtglycertdes (e g,. trtbutyrm, or carboxyhc acldp-mtrophenol esters) are not specific smce they are also hydrolyzed by esterases 6 A large number of samples can be analyzed in a short ttme when a fluorescence plate reader IS used
In this chapter, detatled protocols are provided for the preparation of the substrate and the appropriate standards used for quantitation of the hydrolyzed product. Also mcluded are methods for the determmation of hpase activtty from purified enzyme preparations or from biological samples (e g , serum or post-heparm serum.) Selective conditions are discussed for the detection of hpoprotem lipase and hepattc lipase based on measurements of enzyme activeties m buffers of different iomc strengths. A buffer system for the selective determmatton of pancreas ltpase activity m serum has recently been established m our laboratory (see Note 1).
2. Materials 2.1. Fluorescence
Standards
Tetrahydrofuran (analytical grade). Pyrenedecanorc acid, availatble from Molecular Probes (Eugene, OR, USA, or 2333 AA Leaden, The Netherlands), or from Lambda Probes (Krrchbach/ Stelermark, Austria). Bovine serum albumm, fatty-acid-free, fraction V (Boehrmger-Mannhelm, Mannhelm, Germany, or Sigma, Munchen, Germany) Buffer for hpase assay (see Subheading 2.3.) Trtton X-100, especially purified for membrane research (Boehrmger-Mannhelm) Alternatively, fluorescence standards can be purchased from PROGEN Biotechntk (Heidelberg, Germany) as stable lyophtltzed preparations of
pyrenedecanoic acid/albumin
complexes containing 0, 0.6, 1.2, and 2 4 nmol
pyrenedecanorc acid, respectively, with 16 mg of fatty actd-free albumin each, 2 4 nmol Trtton X- 100, and 300 mg starch as a stabilizer.
Hen-netter
24
2.2. Lipase Substrate 1 Buffer for hpase assay (see Subheading 2.3.) 2 Bovine serum albumm, Trtton X- 100, and tetrahydrofuran (see Subheading 2.1.) 3 Ltpase substrate (fluorogemc alkyldtacylglycerol) 1-truutrophenylammodo-decanoyl2-pyrenedecanoyl-3-0-hexadecyl-sn-glycerol (mol wt 1078) IS eastly soluble tn methylene chloride and tetrahydrofuran and soluble in ethanol, its absorptton spectrum ISthe sum of the mdtvtdual absorptton spectra of pyren-edecanotc acid (&,,, = 345 nm, E = 50,000) and tnnttrophenylammododecanotc acid (h,,, = 415 nm, E = 7000, E at 345 nm = 16,000), solvent methylene chloride) Accurate substrate concentratrons m organic soluttons are determmed from the absorbance at 415 nm (whtch momtors trmttrophenylamme absorptron) Purity of the alkyldtacylglycerol substrate can be determmed by thin-layer chromatography (I&= 0 7), using sthca gel plates and chloroform/ acetone/acetrc acrd (96 4 1, by vol ) as a solvent The alkyldracylglycerol substrate m methylene chloride solutton or m solvent-tree form IS stored at -20°C The chemtcal syntheses of the hptd 1sdescribed In ref. 16 4 Alternattvely, the alkyldtacylglycerol substrate can be purchased from PROGEN Btotechmk as a lyophthzed substrate/albumin complex A typical preparatton contams 60 nmol fluorogeruc alkyldracylglycerol, 60 nmol (approximately 4 mg) fatty actd-free albumm, 2 4 nmol Tnton X- 100, and 300 mg starch as a stabrhzer (accordmg to Zulkowsky, from Merck, Darmstadt, Germany), store m refrigerator (4°C)
2.3. Lipase Activity
Assay
1 A fluorometer, equipped wrth a cell holder (preferably with four cuvet posmons) that 1s water Jacketed for temperature control Suitable mstruments mclude the Perkm-Elmer LSSOB, Perkm Elmer, Uberlmgen, Germany, Shtmadzu RF-5301 PC, Shtmadzu, Kyoko, Japan, and Hitachi F-2000, Ntsset Sangyo, Toyko, Japan 2 Cuvets for fluorescence spectroscopy Suitable cuvets Include quartz cuvettes, 4 mL, d = 1 cm (Hellma, Mullhelm, Germany), or polyacrylate cuvets, 4 mL, d = 1 cm (cat no 2,3893, Merck) 3 Ltpaseassaybuffer Ltsted are recommendedbuffers for determmmgthe enzymatic actrvrty of somehpasesFor purtfied preparattonsof hpoprotemhpase,hepatrchpase, andpancreattchpase,use0 1MTns-HCI, pH 7 4, or phosphate-bufferedsahne(PBS), pH 7 4,0 2 g KCVL, 0 2 g KH,PO,/L, 8 g NaCl/‘L, 1 15g Na2HP04/L Thesebuffers alsowork well to assaytotal hpaseacttvtty m serumor post-hepannserumor tn cell culture supematants (seeNote 2) Addttton of 1 0 A4NaCl to thesebuffers ~111rnhrbrt hpoprotetnhpaseacttvrty but ~111not reducehepatrchpaseactrvtty A buffer suttablefor the specificassayof pancreatichpaseacttvtty hasrecentlybeendeveloped(seeNote 1)
3. Methods
3.1. Preparation
of Fluorescence
3 1 1. Preparation
of the Fluorescence
Standards
and Lipase Substrate
(Pyrenedecanoic
Aad) Standards
The followmg procedure can be used to prepare 30 standard samples contaming defined concentrations of unquenched fluorophore. These standards are
Lipase Assays Using Fluorogenic Substrates
25
used to create a cahbratlon plot to quantltate the amount of substrate hydrolyzed during the hpase assay (see Fig. 2). 1 Dissolve 480 nmol fatty acid-free bovine serum albumin (approx 32 mg) m 240 mL PBS or the same buffer used for the hpase assay (see Subheading 2.3. for examples of different hpase buffers) 2 Prepare four concentrations of pyrenedecanotc acid by dlssolvmg 0,O 6, 1 2 and 2 4 nmol of pyrenedecanotc acid m 200 uL tetrahydrofuran With constant sturmg at 37°C add each concentration of pyrenedecanolc acid to 60 mL of the albumm solutton prepared m step 1, The final concentration of pyrenedecanotc acid m these standards will be 0, 10, 20,40 pmol/mL; 2 mL of each standard 1s used to construct the calibration plot (see Subheading 3.3. and Fig. 2) These standards can be stored for 1 wk at 4°C 3 If detergents are present m the hpase assay, prepare the standards as descrtbed m step 2, except either supplement or replace the albumm solutton wtth the appropriate detergent (e.g , Trtton X- 100, alkylsulfobetam, octylglucostde, sodmm cholate, or deoxycholate). For supplementation, add 200 uL of the pyrenedecanolc actd/tetrahydrofuran solution to 60 mL of an albumm solution as prepared m step 1 that contains 0 04 mMTriton X-l 00 (see Note 4) For replacement, add 200 uL of the pyrenedecanolc actdftetrahydrofuran solutton to 60 mL of 0 2 mM Triton X- 100 m PBS 4 Alternattvely, lyophthzed pyrenedecanotc actd/albumm standards can be purchased commercially (see Subheading 2.1.) These preparations represent readyto-use standards after reconstitution in 2 mL of PBS or the same buffer used for the ltpase assay The final concentrattons of these standards are 0, 10, 20, and 40 pmol/mL or higher
3.1.2. Preparatron of the Lipase (Alkykiiacylglycerol) Substrate The followmg procedure can be used to prepare enough llpase substrate for 30 assays Once prepared, the substrate can be stored overmght at 4°C or 3 h at room temperature 1. Dissolve 120 nmol fatty acid-free bovme serum albumin (approx 8 mg) m 60 mL PBS or the same buffer used for the lipase assay (see Subheading 2.3. for examples of dtfferent hpase buffers). 2. To prepare a detergent-free substrate, dissolve 120 nmol of the fluorogemc alkyldtacylglycerol substrate rn 200 pL of tetrahydrofuran wtth constant sttrrmg at 37°C Add the substrate/tetrahydrofuran solution to the 60 mL albumm solution prepared in step 1 to gave a final concentration of 2 nmol/mL alkyldtacylglycerol Each hpase assay utilizes 2 mL of this substrate solutton 3 To prepare substrate supplemented with detergent and albumm, follow the same procedure descrtbed m step 2 except dissolve 240 nmol fluorogemc alkyldtacylglycerol substrate m 200 uL of tetrahydrofuran and add this solution to 60-mL albumm solution contammg 0 04 pA4 Trtton X- 100 The assay using this detergent supplement substrate is much more sensmve.
Herrnetter
26
4 To prepare substrate wtth detergent but no albumm, prepare the substrate as descrtbed tn step 2, except replace the albumm solution with the approprtate detergent (see Subheading 3.1.1. for examples of detergents that can be used) 5. Alternatively, a lyophilrzed preparation of the alkyldiacylglycerol/albumm substrate can be purchased commercrally (see Subheading 2.2.) This preparation represents a ready-to-use substrate after reconstttutton m the same buffer used for the ltpase assay For 30 ltpase assays, add the lyophtltsate contammg 240 nmol alkyldracylglycerol to 60 mL of lrpase buffer to gave a final concentratton of 4 nmol/mL for the albumm/detergent assay as descrtbed under step 3
3.2. Measurement of Fluorescence of the Fluorometer
Standards
and Calibration
Set monochromators to the followmg parameters excttatton wavelength, 342 nm, emtsston wavelength, 400 nm; exttatton and emmtssron sht wtdth, IO nm Brmg the cuvet holder to 37°C by setting the temperature of the ctrculatmg water bath (see Note 5) F1112 mL of each standard solutton mto cuvets and allow the standards to equibbrate to 37°C by keepmg them m the cuvet holder for 10 mm Check fluorescence mtenstty of the standard contammg the htghest fluorophore concentrattons at 37°C Attenuate or improve fluorescence signal by adJusting m-
strument sensitivity if fluorescence intensity IS too high or too low, respectively Measure
the fluorescence
mtenstttes
of all four standards
under the same
instument settings Generate a caltbratton curve by plotting fluorophore/mL (see Fig. 2)
fluorescence
intensity
versus pmol
3.3. Determination of Lipase Activity 3 3.1. General Method for the Assay of Lipases Using the Alkyldiacylglycerol Substrate The sensitivtty of the lipase assay using the substrate/albumm complex is highest when the fluorogemc alkyldtacylglycerol IS freshly injected into an albumin solutron followed by equihbration as described m Subheading 3.1.1. The detection hmtt for pure (e.g., recombmant) hpases 1s >5 ng depending on the type and quality of the enzyme smce many of these proteins are unstable (e.g., hpoprotem hpase or hepatrc hpase m pure form are unstable; m contrast, a microbial hpase from Chromobactenum vlscosum was found to be very stable). In most cases, hpase actrvttres as determined by the fluorescence method can be correlated with acttvmes obtained with radioactive trracylglycerols (M Duque, I. Wrcher, R. Zechner, F. Paltauf, and A Hermetter, unpublished results). Very low hpolyttc activmes that are undetectable using radiolabeled trracylglycerols can often be measured usmg the fluorogemc substrate.
1lpase Assays Using Fluorogenic Substrates
27
1 Fdl 2 mL of substrate solutions into cuvets and equlhbrate to temperature (see Note 4) by mcubatlon m the water-Jacketed cuvet holder for 10 mm 2. Before adding hpase, measure fluorescence intensity (that equals the blank actlvIty) for 1 mm under Instrument settings as optimized for the standards 3. Under the same instrument and temperature condttlons, add the hpase sample (between 10 and 50 pL volume), mix thoroughly for a few seconds and measure contmously the increase m fluorescence mtenslty (AI) for 5-10 mm (see Fig. 3 and Note 3) 4. From the recorded AI/mm of the hpase sample, subtract the AI/mm of the blank The resulting difference represents the fluorescence increase (AI/mm) due to the hydrolysis of the substrate This value can be converted to pmol of substrate hydrolyzed per mm by usmg the cahbratlon curve described m Subheading 3.2. and Fig. 2.
3 3.2. Considerations and Hepatlc Lipase
for the Selectwe Assay of Lipoprotein lipase
In aqueous buffer solutions, activities of isolated lipoprotein hpase and hepatlc hpase are additive when usmg the fluorogemc substrate. High sodmm chloride concentrations (1 IV) inhibit lipoprotein hpase actlvlty, but not hepatlc lipase activity,
similar
to that observed using the more traditional
racholabeled
trlolein substrate preparations. However, whereas the total hpase activity of postheparm serum 1salso due to both hpoprotem hpase and hepatic hpase, the activities
contributed
by these two enzymes are not additive
m this complex
blologlcal fluid m the absence of detergent (e.g., using 20 pL serum m 2 mL substrate solution). Although only hepatlc hpase activity is measured m the presence of 1 M NaCl (M Duque, R Zechner, F Paltauf, and A Herrnetter, unpublished results), the activity levels detected are often as high as the combined lipoprotem hpase and hepatlc hpase activity levels measured m the absence of salt This IS because hepatic lipase m serum is “activated” by salt under detergent-free conditions However, m the presence of detergent (e g , 0.04 ph4 Triton X- 100, see Note 4), this “actlvatlon” 1snot apparent so that the activity measured m 1MNaCl 1salways less than the total hpase activity measured without salt (unpublished observations). It should also be noted that measurement of total hpase activity and hepatic lipase activity m post-heparm serum 1ssensitive to the serum composltlon of the donor (e.g., lipids, hpoproteins, and heparm concentration m post-heparin serum; also see Note 2). Thus, routine
analysis of serum trlglycerldes
1s recommended
for interpretation
of
the measured hpase activity as determined by the fluorescence assay Finally, it should be emphasizedthat the fluorescence hpase assay described measureshpase actlvltles, even m complex blologlcal fluids, under nondlsturbmg condltlons Thus, the “actual” hpase activity is measured m its natural envlronment, and this environment may well affect the structural properties of the enzyme
28
Hermetter
itself and contrlbute to modulations of enzyme actlvlty due to the presence of endogenous components such as lipids, heparan sulfate proteoglycans and other components present In complex blologlcal samples
4. Notes 1 Aativity of pancreatic lipase can be measured m the absence of cohpase (16) However, the presence of the cofactor sigmficantly improves enzyme activrty (M Duque, F Paltauf, and A Hermetter, unpublished results) A high-sensitivity assay for the specific determmation of pancreatic hpase activity m the presence of other hpolytic enzymes (for example in serum) hasrecently been developed m our laboratory 2 Heparm at high concentrations mhtbits activity of hpoprotem hpaseand hepatic hpase In somecases,this might causedifficulties m assayinghpaseactivmes of heparmized cell culture supernatants(M. Duque and A Hermetter, unpublished results), Identification of heparm-bmdmgdomainsof hpoprotem hpasehave been reported m ref. 19, and references therem 3 Sensitivity is lower when standards and substrate solutions are prepared by reconstmmonof lyophihsatesm aqueousbuffer, asdescribedm Subheading 3.1. 4 Sensitivity and reproducibility can be increasedwhen the substrate (and standard) samples are solubillzed m aqueous buffer contammg albumin and submicellar concentrations of detergent (e g , 0 04 mM Triton X- 100, which ISa nomomc and “mild” amphiphile) Conversely, sensitivity may be high, but reproducibihty is lower when the substrate (and standard) samplesare solubihzed m detergents above thetr critical micellar concentrations (e g , 0 2 mM Triton X- 100) In addition, due to impurities, most detergentsshow high background fluorescenceif excited at 342 nm (1e , the excitation wavelength of the substrate) 5 The recommendedtemperature for the assayof most mammalianhpaseactivities IS37°C This temperature is especially important when assayinghpoprotem hpase and hepatic hpase activities m serum, since activity 1sgreatly reduced at lower temperatures usmg the assaysystem described herem Conversely, most microbial hpasescan be convemently assayedat room temperature
Acknowledgments Financial support by the Fonds zur Forderung der wlssenschaftllchen Forschung m Osterrelch (FWF), project F0107, IS gratefully acknowledged.
References 1 Ollis, D L , Cheah, E , Cygler, M , Dijkstra, B , Frolow, F , Franken, S M , Harel, M Remington, S.J., Silman, I , Verschueren, K. H. G., and Goldman, A (1992) The o/p hydrolase fold Protein Eng 5, 197-211 2 Brenner, S. (1988) The molecular evolutton of genesand proteins a tale of two sermes Nature 334, 528-530
3 Ransac, S , Carriere, F., Rogalska, E , Verger, R , Marguet, F , Buono, G , Plnho Melo, E , Cabral, J M S , Egloff, M -P E , van Tilbeurgh, H , and Cambillau, C
Lipase Assays Usmg Fluorogemc Substrates
4
5 6 7 8 9 10 11
12
13 14. 15 16.
17. 18.
19
29
(1996) The kmetrc:, spectticmes and structural features of hpases, in NA TO ASI Series, Molecular Dynamzcs of Blomembranes, vol 96 (Op den Kamp, J A F , ed ), Sprmger, Berlm, pp 265-304 Brockman, H L. (1984) General features of lipolysis reaction scheme, mterfactal structure and exper mental approaches, m Lzpases (Borgstrom, B and Brockman, H L , eds.), Elsevter, Amsterdam, pp. 346. Ohvecrona, G and Oltvecrona, T (1995) Trtglycertde hpases and atheroscleroSIS Cur-r Open Llpldozal 6, 291-305 Goldberg, I (1996 ) Ltpoprotem ltpase and hpolysis. central roles m hpoprotem metabohsm and atherogenests J Lipid Res 37, 693-707. Erlanson-Albertsson, C (1992) Pancreatic cohpase Structural and phystologlcal aspects. Blochun t1zophy.s Acta 1125, l-7 Verger, R (1984) Pancreatic hpases, m Llpases (Borgstrom, B and Brockman, H L , eds ), Elsevier, Amsterdam, pp 83-150 Smith, L C and Pownall, H J (1984) Lipoprotem hpase, m Lzpases (Borgstrom, B and Brockman, H L , eds ), Elsevter, Amsterdam, pp 346 Eckel, R H (1989) Lrpoprotem hpase: a multtfuncttonal enzyme relevant to common metabolic diseases N Engl J Med 320, 106G-1068 Brunzell, J D. (1’989) m The Metabolic Baszs of Znherzted Dzsease, 6th ed (Scrtver, C R , Beaudet, Al , Sly, W S , and Valle, D , eds ), Mac Graw-Hill, New York, pp 1165-l 180 Amens, D , Brockman, G , Knobhch, R , Megel, M , Ostlund Jr, R E , Yang, J W , Coates, P M , Conner, J A , Femman, S V , and Greten, H (1995) A 5’ sphceregion mutation and a dmucleotide deletion m the lysosomal acid hpase gene m two patients with cholestetyl ester storage disease J Lzpzd Res 36, 241-250 Ttetz, N W and Shuey, D F (I 993) Ltpase m serum - the elusive enzyme an overview Clan Chem 39,746-756 Hendrtckson, H. S (1994) Fluorescence-based assays of ltpases, phospholipases, and other hpolytic enzymes Anal Bzochem 219, l-8 Henderson, A. D , Richmond, W., and Elkeles, R S. (1993) Hepattc and ltpoprotem bpases selectively assayed m postheparm plasma Chn Chem 39, 2 18-223 Duque, M , Graupner, M , Stutz, H , Wtcher, I , Zechner, R , Paltauf, F , and Hermetter, A (1996) New fluorogemc trtacylglycerol analogs as substrates for the determmation and choral discrtmmation of hpase activtttes. J Lzpzd Res 37, 868-876 PCT apphcatton no EP 95/O 19 19 Zandonella, G., Haalck, L., Spener, F., Faber, K , Paltauf, F , and Hermetter, A (1995) Inversion of hpase stereospecificity for fluorogemc alkyldiacyl glycerols Effect of substrate solubiltsatton Eur J Bzochem 231, 50-55 Hata, A , Ridmger, D N , Sutherland, S , Emt, M , Shuhua, Z , Myers, R L , Ren, K , Cheng, T , Inoue, I , and Wilson, T E (1993) Bmdmg of lipoprotein ltpase to heparm Identtficatton of five crittcal residues m two dtstmct segments of the amino-terminal domain J Biol Ckem 267,2 1,499-2 1,504.
4 Purification and Assay of Mammalian Group I and Group Ila Secretory Phospholipase A2 Wonhwa Cho, Sang Kyou Han, Byung-In and Rajiv Dua
Lee, Yana Snitko,
1. Introduction Phospholipases A, (PLA,) are a family of ubiquitous lipolytic enzymes that are found both as intracellular and secretedproteins. Secretory PLA2s are small (14 kDa), homologous proteins that require milhmolar Ca2+for catalytic activity They can be classified mto at least four groups based on minor structural differences (1,2). In particular, two major classesof highly homologous secretory enzymes (class I and Ha) have been found m mammahan tissues. Mammalian class I PLA2s are synthesizedin the pancreas as pro-enzymes and activated by proteolytlc cleavage m the intestine (for review see ref. 3 and references therem) All known mammahan pancreatic PLA2s show strong sequence homology. The mam function of these pancreatic PLA2s 1sto digest dietary phosphohplds emulsified with bile juice (3). Recently, several lines of evidence have indicated that marnmahan pancreatic PLA,s are present m dlfferent tissues and might play other physiological roles, including cell surface receptor-mediated mflammatlon (4) Class IIa secretory PLA2s are synthesized and secreted by a variety of inflammatory cells mduced by mflammatory cytokines, such as tumor necrosis factor (TNF) and mterleukin-1 (IL-l) (for review, see ref. 5 and references therein). In particular, high levels of class IIa secretory PLA, have been found m the synovial fluid of patients with inflammatory arthritis and in the plasma of patients suffering from septic shock. Although these findings have implicated the class IIa secretory PLA2s m mflammatlon, questions still remam as to the source of these enzymesdetected at inflamed sites,their exact physlologlcal roles and the mechanism by which they interacts with certain types of cells. From
Methods Ed&d by
m Molecular Bfology, Vol 109 Llpase M H Doohttle and K Reue 0 Humana
31
and Phospholipase Protocols Press Inc , Totowa, NJ
Cho et al.
32
To fully understand the physiological functions and regulation of the two classes of mammahan secretory PLA2s, it is necessary to prepare a sufficient amount of pure protems and to quantttattvely assay then acttvtties The purification of these enzymes from natural sources 1s often hampered by the hmtted availabihty of tissues (1 e , human pancreas) and the low abundance of proteins, m particular class IIa PLA, To overcome these dtfficulttes as well as to perform systematic structure-function studies through mutattonal analyses, several forms of recombinant mammalian secretory PLA2s have been expressed m various cells (6-13), among which the expression m Escherzchzacolz and baculovnus-infected insect cells has been most efficient Herem, we describe the expression of human pancreatic PLA, (hp-PLA,) and human class IIa PLA, (hIIa-PLA,) using our bacterial expresston vector (pSH-hp) (21) and baculovirus expression vector (pYS-bv) (ZO), respectively We also describe two different assay methods for mammalian secretory PLA2s usmg amomc polymerized mixed ltposomes (14,25) and mixed micelles (16), respectively
2. Materials 2.1. Preparation
of Recombinant
Human Pancreatic
PLAl
1 The hp-PLA, expression vector (avatlable from author) 2 Lurta broth 10 g of Bactotryptone, 5 g of yeast extract (both from Fisher, Ptttsburgh, PA) and 10 g of NaCl in 1 L of deionized water, pH 7 4 3 Ampictllm (Sigma, St Louis, MO) 4 Isopropyl P-n-thiogalactopyranoside (IPTG) (Boehrmger Mannhelm, Indtanapolis, IN) 5 Cell lysts buffer 0 1 A4 Trts-HCl, pH 8 0,5 mA4 EDTA, 0 5% (v/v) Trtton X- 100 (Pierce, Rockford, IL) 6 5,5’-Dtthtobts(2-mtrobenzoic acid), sodmm sulfite (Aldrich, Milwaukee, WI) 7 2-Nttro-5-(sulfothto)-benzoate 1s synthesized from 5,5’-Dtthtobts(2-mtrobenzotc acid) as follows Dissolve 0 5 g of 5,5’-Dtthtobts(2-mtrobenzotc acid) m 50 mL of 1 Msodmm sulfite solution, adjust the pH to 7 5, and oxtdtze the solution with a slow stream of oxygen gas until the color of the solutton changes from orange to yellow The solutton IS then divided mto altquots and stored at -20°C The 2Nitro-5-(sulfothio)-benzoate solution IS stable for approx 6 mo 8 Refolding buffer 25 mM Trts-HCl, pH 8 0, 5 mM dodecylsucrose (Calbtochem, San Diego, CA), 10 mA4 CaCl,, 8 mM reduced glutathtone, 4 mM oxtdtzed glutathtone (both from Stgma) 9 Sephadex G-25, HtLoad 16/10 S Sepharose (Pharmacta, Uppsala, Sweden) 10 Medium pressure protem chromatography system wtth dual pumps and a UV detector (1 e , Pharmacla FPLC system) 11 Mobile phase for Sephadex G-25 25 mM Trts-HCl buffer, pH 8 0, 5 M urea (Ftsher, Pittsburgh, PA), 5 mA4 EDTA 12 Mobile phase for HtLoad 16110 S Sepharose A, 25 mA4 HEPES buffer, pH 8 0, B, 25 mM HEPES buffer, pH 8 0,O 5 M NaCl
33
Punficatmn and Assay of PLA, 2.2. Preparation
of Recombinant
Human Class Ila PLAP
1 2 3 4 5 6 7
The pYS-bv expression vector (available from author) Plasmid preparation kit, hpopolysacchande extraction kit (QIAGEN, Chatsworth, CA) St9 cells, serum-free TNM-FH medium (Invitrogen, San Diego, CA) BaculoGoldrM Transfectton krt (PharMmgen, San Diego, CA) 27’C Incubator SP-Sepharose FF, Mono S 5/5 (Pharmacia, Uppsala, Sweden) Mobile phase for SP-Sepharose. A, 10 mA4 borate buffer, pH 9 0, B, 10 mM borate buffer, pH 9 0, 1 MNaCl 8 Mobile phase for Mono S A, 25 mM HEPES buffer, pH 8 0, B, 25 mM HEPES buffer, pH 8 0,2 M NaCl
2.3. Assay of Mammalian
Secretory
Class I and Class Ila PLA2
1-Hexadecanoyl-2-( 1-pyrenedecanoyl)-sn-glycero-3-phosphoglycerol (pyrenePG) (Molecular Probes, Eugene, OR). 1,2-b~s[l2-(l~poyloxy)-dodecanoyl]-sn-glycero-3-phosphoglycerol (BLPG) IS synthesized as described m Chapter 2 Polymertzed mixed hposomes are prepared as descrtbed m Chapter 2 Fatty acid-free bovine serum albumm (BSA, Bayer, Kankakee, IL) Assay buffer 10 mM HEPES, pH 7 4,0 16 M KCl, 10 mA4 CaCl*, 10 mM BSA Spectrofluorometer equipped with a thermostated cell holder and a magnetic stirrer 1,2-dioctanoyl-sn-glycero-3-phosphoglycerol (diCsPG, Avanti, Alabaster, AL), Trrton X-100 (Pierce, Rockford, IL), sodium deoxycholate (DC, Sigma) To prepare 10 mL of Triton X-100 (2 mM)IDC (1 mM)IdiCsPG (0 5 mA4) mixed micelles* add 2 6 mg of dtC,PG dissolved m about 10 mL of chloroform to a round-bottomed flask and evaporate the solvent zlt vucuo Prepare 10 ml of 0.1 mA4 MOPS containing 10 mM CaCl*, 2 mA4 Triton X-100, and 1 mM DC and adjust the pH to 7 4 Add this solution to the lipid film and gently vortex the mixture until a clear solution appears 9 pH Stat mstrument equipped with a thermostated vessel and a magnetic stirrei
3. Methods 3.1. Preparation of Recombinant Human Pancreatic PLA2 Mammalian pancreatic PLAzs were ortgmally purtfied from pancreatic homogenates either by heat treatment or by using alkaline glycerol solutton for solubrlrzatlon. Currently, several pancreatic PLA,s, including bovine and porcme enzymes, are commerctally available. Also, highly efficient bacterial expresston vectors are available for human (II), bovine (7), and porcine (6) pancreattc PLA,s. The expression of hp-PLA2 using the pSH-hp vector constructed m our laboratory ISdescribed m this subheadmg. The pSH-hp plasmld has the coding sequence of hp-PLA, inserted m frame with the mmatlon codon of the T7 promoter-based pET2 la vector. Thus, fully mature hp-PLA, is
34
Cl70 et a/
expressed m E coli with Ala as its first ammo acid. As 1sthe case with other secretory PLA,s expressed m E colz, hp-PLA, 1s expressed as an mcluslon body that IS subsequently sulfonated, solublhzed m 8 A4 urea, and refolded under the condltlon that promotes the formation of dlsulfide bonds E colz stram BL2 1(DE3) IS used as a host for the expresslon of hp-PLA2. 1 Inoculate a 3 L Lurla broth contammg 100 mg/mL of amplclllm with 30 mL of overnight culture from a freshly-transformed single colony and grow It at 37°C 2 Add additional 0 2 g of amplcdlm when the absorbance of medmm at 600 nm reaches 0 2 3 Induce the cells with IPTG (final concentration, 0 5 mM) when the absorbance at 600 nm 1s 0 8 4 Incubate the culture for addltlonal 4 h at 37°C 5 Harvest the cells by centrlfugatlon (3,000g fol 10 mm) at 4°C 6 Resuspend the pellet m 50 mL of 0 1 A4 Tris-HCl buffer, pH 8 0 containing 5 mA4 EDTA, 0 5% (v/v) Trlton X-100 7 Lyse the resuspended cells by somcation with a pulse mode of 10 x 15 s. 8 Collect the pellet by centrlfugatlon (10,OOOg for 10 mm) at 4 OC 9 Resuspend the pellet with the same buffer and repeat the somcatlon and centrifugation 10 Solublllze the mcluslon body m 10 mL of 8 Murea solution contammg 0 3 M sodmm sulfite (pH 8 0) and stn the solution vigorously at room temperature for 30 mm I1 Add 2 mL of 25 mM 2-mtro-5-(sulfothlo)-benzoate solution and stir the mixture for 30 mm 12 Remove any msoluble matter by centrlfugatlon (35,000g for I h) at room temperature 13 Load the solublhzed protem onto a Sephadex G-25 column (2 5 x 20 cm) equlhbrated with 25 mM Tns-HCl buffer, pH 8 0, containing 5 M urea and 5 mM EDTA, and collect the first major peak (total volume of about 45 mL) 14 Initiate refolding of the sulfonated protein by slowly adding 100 mL of 25 mM Tns-HCl, pH 8 0, contammg 5 tidodecylsucrose, 10 mA4CaC12, 8 mA4reduced glutathlone, and 4 mA4 oxldlzed glutathlone over 2 h Keep the solution at room temperature for 20 h (see Note 1) 15 Dialyze the refolded protem solution against 4 L of 25 mM Tris-HCl buffer, pH 8 0, repeat dlalysls. 16 Remove any precipitate by passing through a small (2 5 Y 2 cm) Sephadex G-25 column equlhbrated with 25 mM HEPES buffer, pH 8 0 17 Load the clear solution onto a HlLoad 16110 S Sepharose column attached to a FPLC system 18 Elute the refolded protein with a linear gradient of NaCl from 0 to 0 5 A4 m 25 mM HEPES buffer, pH 8 0 (see Note 2) 19 Collect the major protein peak eluted with approx 0 25 MNaCl, dialyze against water, and lyophlhze The lyophlllzed hp-PLA, can be stored mdefimtely at -20°C without any detectable loss of activity.
Purification and Assay of PLA,
35
3.2. Preparation of Recombinant Human Class Ila PLA1. Human and rat class IIa PLA, have been purified from various sources tn small quantities. More recently, recombtnant forms of these proteins have been over-expressed tn bactertal cells (8,9), baculovirus-Infected St9 cells and mammahan cells (13) Unlike the expression of hp-PLA,, which yields a fully mature protem, the bacterial expression of hIIa-PLA2 entails the mutatton of the wild type sequence tn order to remove either the ammo-terminal methione residue or the ammo-termmal extension. Furthermore, the purification of expressed protein involves the solubthzation of mcluston body and the subsequent refolding of solubthzed protein. On the other hand, the expression of hIIa-PLA2 m baculovnus-infected Sf9 cells, albeit less eflictent tn terms of the level of protem productton, allows the expression of a fully folded mature protein. Our baculovtrus expression vector (pY S-bv) contains the signal sequence and coding sequence of hIIa-PLA, tn the pVL 1392 baculovtrus transfer vector and, thus, the expressed protein 1s secreted into the growth medium. Owing to tts htghly cattonic nature (isoelectric point > lo), hIIa-PLA2 can be easily enriched from the growth medium using a cation exchange column. 1 Prepare the pYS-bv plasmtd by a standard protocol In order to improve transfecnon efficiency, purify the DNA using a lipopolysaccharide extraction ktt 2 Grow Sf9 cells as monolayer cultures m serum-free TNM-FH medium (see Note 3) 3 Co-transfect viral DNA with the pYS-bv vector and incubate cells for 4 d at 27°C 4 Collect the supematant and use tt to amplify the vuus with multiplicity of mfecnon of 0 5-l After three cycles of amphficatton use the high-titer virus stock solutton for the protein expression 5 Seed I x 1O7St-9 cells onto twenty 10 cm-culture plates (total volume of medium, 200 mL) and infect them with the high-titer viral solution with a multtphctty of infection of 10 6 Incubate the cells for 3 d at 27°C. 7 Collect the supematant and remove any dislodged cells by centrtfugatton at 2,000g 8. Dialyze the supematant against deionized water (3 x 4 L) and then against 10 mA4 borate buffer, pH 9 0 (1 x 4 L) at room temperature. 9 Equilibrate SP-Sepharose column (5 x 10 cm) with 10 &borate buffer, pH 9 0 10 Load the supernatant onto the column, wash the column with 10 mA4 borate buffer, pH 9 0, until no further peak emerges. Elute the bound protem with 1 A4 NaCl m the same buffer 11 Dialyze the eluted protein solution against 25 mA4 HEPES buffer, pH 8 0 12. Equthbrate a Mono S 5/5 column with 25 mM HEPES buffer, pH 8 0 13 Load the protein solutton onto the column, and elute with a linear gradient of NaCl from 0 to 2 A4 m the same buffer 14. Collect the major protein peak eluted with approx 0 8 M NaCI, dialyze against water, and lyophilize The lyophtltzed hs-PLA, can be stored indefinitely at -2O’C without any detectable loss of acttvtty
36
Cho et al.
3.3. Assay of Mammalian Secretory Class I and Class Ila PLA2 Most of mammalian secretory PLA2s strongly prefer as a substrate anionic phosphohptd aggregates to electrically neutral ones. Among a wide variety of amomc phosphollpld aggregates used for the assay of mammalian secretory PLA2s, two convenient contmuous assaysusmg polymerized mixed hposomes and mixed mlcelles, respectively, are described m this subheading As described m Chapter 2, the fluorometrlc polymerized mixed llposome assay IS more versatile and more sensitive than the mlxed mlcelle assay (see Note 4) The latter allows, however, more rapid preparation of the assay mixture from components that are all commercially available 3.3.1.
Polymerized
Mixed
Llposome
Assay
1 Add 2 mL of 10 mM Tns-HCl buffer, pH 8 0, containing 0.16 A4 KCI, 0 1 n&I CaCI,, 10 mk4 pyrene-PG/BLPG mlxed hposomes, and 10 mA4 BSA to a quartz cuvet 2 Place the cuvet m the spectrofluorometer and monitor the fluorescence intensity at 380 nm until the baseline IS stablhzed (approx 2 mm). 3 Imtlate the reaction by adding an ahquot of enzyme solution
3.3.2. Mixed Ahcelles Assay 1 Place 2 mL of mixed mlcelles solution (Tnton X- 100 (2 n&Q/DC (1 mM)IdlCsPG (0 5 mM) m 0 1 n&I MOPS, pH 7 4, 10 mA4 CaCl,, and 0 16 A4 KCl) in a thermostated reaction vessel of a pH stat instrument 2 Once the baseline IS stabilized, initiate the hydrolysis by adding an ahquot of enzyme solution and monitor the release of fatty acid as a function of time 3.3 3. Determination
of Rate Constants
The activity (mmol/mm) of PLA, for polymerized mlxed llposomes IS calculated from the fluorescence change as described m Chapter 2. The PLA, activity toward mixed mlcelles IS directly determined from the mltlal slope of progress curve since the pH stat directly measures the concentration
of product
released. The specific activity (mmolimmlmg) IS determined by dlvldmg the enzyme actrvlty by the amount of protem (mg). 4. Notes 1 To prevent the protein preclpltatlon during the addition of the refolding buffer to the urea solution of sulfonated hp-PLA*, the refolding buffer must contam a nonlomc detergent, such as dodecanoylsucrose, and the addition be as slow as possible (approx 2 h) Once the refolding solutions are mixed, the protein preclpltatlon IS not slgmficant during the subsequent mcubatlon and dialysis The progress of refolding can be momtored by directly measuring the enzyme activity of ahquots of refolding mixture using pyrene-PG/BLPG as m Subheading 3.3.1.
Purification and Assay of PLA,
37
2 Durmg the chromatographrc separatton of refolded hp-PLA, using a HrLoad S Sepharose column, a minor shoulder peak IS observed Thts peak contains a mtxture of improperly processed protems which have Met, Val, and Trp, respectively, as a first ammo acid and exhtbtt lower PLA, activity Thus, these proteins must be carefully separated from the maJor peak protein Overall yield of purified hp-PLA, should be approx 5 mg of protem/L culture 3 To facthtate the purrficatton of secreted hs-PLA, from the growth medium, it 1s essential to use serum-free medmm The secreted hs-PLA, can be enriched from the medmm, with high efficiency, using an tmmobthzed heparm column A less expenstve canon-exchange column is used as an alternative m this protocol A typical yteld of purified hs-PLA, IS approx 1 mg/L culture 4 Although pyrene-PGiBLPG polymertzed mixed hposomes are a good substrate for most mammahan secretory PLA,, some PLA,s might have htgher acttvtty toward other polymertzed mixed ltposomes, such as pyrene-PA/BLPG polymerized mtxed ltposomes Also, some mutant proteins might have altered substtate specrfictty thereby preferring different pyrene-labeled inserts m polymertzed mixed hposomes
References 1 Hemrtkson, R. L , Krueger, E T , and Ketm, P S (1977) Ammo acid sequenceof phospholtpaseA2 from the venom of Crotalus adamanteus J Blol Chem 252, 4913-4921 2 Davidson, F F and Dennis, E A (1990) Evoluttonary Relatronshtpsand Imphcations for the Regulation of phospholtpasesA2 from snake venom to human secretedforms J Mel Evol 31,228-238 Wane, M (1987) The Phosphollpases,Plenum, New York Tohkm, M , Ktshmo,J , Ishtzakt, J andArtta, H (1993)J Bzol Chem268,286>287 1 Kudo, I , Murakamt, M , Hara, S , and moue, K. (I 993) Mammaltan non-pancreatic phosphohpaseA, Blochlm Brophys Acta 1170, 2 17-23 1 de Geus, P , van den Bergh, C. J , Kutper, 0 , Hoekstra, W P M , and de Haas,G H (1987) Expressionof porcine pancreatic phosphohpaseA2 Generation of active enzyme by sequence-specificcleavage of a hybrid protem from Escherlchla toll Nuclei Acids Res 15, 3733-3759 7 Deng, T , Noel, J P , and Tsar, M -D (1990) A novel expresstonvector for hrghlevel synthesisand secretion of foreign proteins m Escherzchzacolz. Overproduction of bovme pancreatic phospholtpaseA, Gene 93, 229-234 8 Franken,P A , van denBerg, L , Huang,J., Gunyuzlu, P , Lugtighetd,R B , VerheiJ,H M., and de Hass,G H (1992) Purtficatton and charactenzatronof a mutant human plateletphosphohpase A, expressedm Escherlchzacok Eur J Blochem 203,89-98 9 Othman, R , Worral, A, and Wrlton, D C (1994) Some properties of a human group Ha phosphohpaseA, expressedfrom a synthetic gene m Eschenchla co/l Bzochem Sot Trans 22,3 17s 10 Smtko, Y , Yoon, E T., and Cho, W (1997) High Specificity of Human Secretory ClassIIa PhospholtpaseA1 for Phosphatidtc Acid Bzochem J 321, 737-741
38
Cho et al.
11 Han, S -K., Lee, B -I , and Cho, W. (1997) Bacterial expression and charactertzanon of human pancreatic phosphohpase A, Bzochzm Blophys Acta, m press. 12 Murakamt, M , Nakatam, Y , and Kudo, I (1996) Type IIa secretory phospholipase A, associated wtth cell surfaces vta C-termmal heparm-bmdmg lysme resldues augments stimulus-mmated delayed prostagladm generation J Bzol Chem 271, 30,041-30,05 1 13 Weiss, .I, Inada, M , Elsbach, P., and Crowl, R M (1994) Structural determinants of the actton against Eschewhla colr of a human Inflammatory fluid phosphohpase A, m concert with polymorphonuclear leukocytes J Blol Chem 269, 26,33 l-26337 14 Wu, S -K and Cho, W (1993) Use of Polymerized Llposomes to Study Interactions of Phosphohpase A, with Blologtcal Membranes Bzochemlstry 32, 13,902-13,908 15 Wu, S -K and Cho, W (1994) A contmuous Fluorometrlc Assay for Phosphobpases Using Polymerized Mixed Liposomes Anal Bzochem 221, 152-159 16 Dua, R and Cho, W (1994) Inhibitton of Human Secretory Class IIa Phosphohpase A, by Heparm Eur J Bcochem 221,481490
5 Determination of Plasmalogen-Selective Phospholipase A2 Activity by Radiochemical and Fluorometric Assay Procedures Akhlaq A. Farooqui, Hsiu-Chiung and Lloyd A. Horrocks
Yang, Yutaka Hirashima,
1. Introduction Plasmalogens are a umque class of glycerophospholipids (2) characterized by the presence of a vinyl ether substrtuent at the m-l position of the glycerol backbone Found m all mammalian cells, these phosphohpids are especially abundant m brain and heart (I). However, while cholme plasmalogen IS enriched m heart tissue, brain ttssue is rich in ethanolamme plasmalogen Despite thetr ubtqurtous drstrrbutlon, little IS known about then role m mammalian metabolism These liptds may act as a reservoir for arachtdomc acid, the precursor for prostaglandms and thromboxanes. The vmyl ether lmkage of plasmalogen may also play an important role m protectmg cellular membranes against oxtdattve stresses (2,3). The breakdown of plasmalogen may be a receptor-mediated process related to stgnal transductron (4,s) Heart (6,7), brain (5,8), and kidney (9) contam a novel phosphohpase A, (PLA,) activity that hydrolyzes arachidonic acid from the SM-2position of plasmalogen. Thrs novel PLA2 has been purified from canme myocardmm (6,7), bovine brain (8), and renal proximal tubule (9). From each source, the purified enzyme differs with regard to kmetrc properties, substrate specrficlttes and response to detergents and various PLA, mhrbrtors. These diverse PLAz enzymes suggest that they may play dtstmctrve roles m response to various phystological and pathological conditions. The purpose of thus chapter IS to describe methods for determinmg plasmalogen-selective PLA, activity, which can be assayed by both radtochemical From
Methods Edlted
by
m Molecular M H Doohttle
Ecology, Vol 109 Llpase and Phospholipase and
K Reue
39
0 Humana
Press
Inc , Totowa.
Protocols NJ
Farooqul et al.
40 (10) and spectrofluorometrtc described below
2. Materials 2.1. Radiochemical
(12,12) procedures. Both of these procedures are
Assay
Unless otherwise specified, all chemicals are obtained tlfic Co , Pittsburgh, PA and stored at room temperature
5 6 7 8 9 10 11 12
from Fisher Sclen-
0 05 M KOH m methanol/benzene ( 1 1, [v/v]) Bovine heart lecithin (phosphatldylchohne) (Avant1 Polar LIpIds, Inc , Alabaster, AL) Ethyl formate, methanol, butanol, dlethyl ether, and acetomtrlle Chloroform All the chloroform used m this procedure should be redlstllled by fluxing over phosphorus pentoxide m a dlstlllatlon flask. Glacial ace& acid N,N’-Dimethyl-4-ammopyrldme (DMAP) (Aldrich Chemical, Milwaukee, WI) Recrystallize DMAP from chloroform/dlethyl ether (1 /l, [v/v]) before using Arachldonate and [3H]arachldonate can be purchased from Nu Chek Prep , Elysian, MN and DuPont-NEN, Boston, MA, respectively N,N’-Dlcyclohexylcarbodnmlde (DCC) (Aldrich Chem Co , Milwaukee, WI) Methanol/Water/Acetomtrlle (57123120, [v/v]), hexane/2-propanollwater (48 51 48 5/3, [v/v]), and hexane/2-propanol/water (46/46/8, [v/v]) Slllca gel G plates (20 x 20 cm) 50 pm, Analtech, Newark, DE Dynamax Macro-HPLC Silica column (21 4 mm x 25 cm), Ramm Instrument, Woburn, MA Econosll octadecyl silica column (10 mm x 25 cm), 10 mm particle size, Alltech Assoclatlon, Deerfield, IL
2.2. Nuorimetric
Assay
Unless otherwise specified, all chemicals are obtained from from Sigma (St. LOUIS, MO) and stored at room temperature. Bovine brain ethanolamme glycerophosphohpld, 100 mg (Doosan Serdary Laboratory, Englewood Chffs, NJ) 0 04 M Tns-HCl buffer, pH 7 6, store at 4°C 0 04 M Tns-HCl buffer, pH 7 6, containing 0 5 M NaCI; store at 4°C 0 04 M Tns-HCl buffer, pH 7 6, contammg 15 mg/mL sodium deoxycholate Store at 4°C 0 04 M Tns-HCl buffer, pH 7 6, containing bovine serum albumin (15 mg/mL), store at 4°C 0 04 A4 Tns-HCl buffer, pH 7 6, contammg 0 002 M CaCl, Store at 4°C Rhlzopus arrhlzus (R A ) hpase, 50,000 U/mL (Boehrmger Mannhelm, Indlanapolis, IN) Chloroform and methanol (Fisher Scientific Co, Pittsburgh, PA), including 2/l (v/v) and 4/l (v/v) chloroform/methanol mixtures
Plasmalogen-Selectwe 9 10
11 12 13 14 15 16 17
18 19
PLA,
41
Umstl acttvated SI~ICIC acid (200-325 mesh) (Clarkson Chem , Wtlhamsport, PA) Pour a 2 5 x 30 cm column and eqmhbrate m dtsttlled chloroform Silica gel G TLC plates (250 micron) 20 x 20 cm and 10 x 10 cm (Anatech, Newark, DE) 100 mL each of 65/25/4 (v/v) and 85/22/4 (v/v) chloroform/methanollammonlum hydroxtde Pyrene sulfonylchlortde (Molecular Probes, Eugene, OR), stored at -20°C Just before use, make 1 mL of a 1.72 mg/mL solutton m chloroform Trtethanolamme stored at room temperature Just before use, make 1 mL of a 32% solutton m methanol 0 02 MMOPS (3-[N-morpholmo] propane sulfomc actd) buffer, pH 7 4, contalnmg 5% bovme serum albumm, store at 4°C 0 02 A4 MOPS buffer pH 7 4, contammg 1% Trtton X- 100, store at 4°C 0 02 A4 MOPS buffer, pH 7 4, contammg 0 004 M EGTA Branson Somfier cell dtsruptor 185 UV ltght Perkm-Elmer L55 spectrofluortmeter.
3. Methods
3.1. Plasmalogen-Selective chemical Assay
PLA2 Activity
Determined
by a Radio-
The radtochemtcal assay procedure possesses the advantage of bemg htghly senstttve and fast. However, the preparatton of the radrolabeled plasmalogen substrate 1s laborious and costly, and can result tn low ytelds (23). Preparatron of the substrate ts described tn Subheading 3.1.1. and begtns by KOH hydrolysis of a mtxture of bovine heart choline glycerophospholiptds followed by the rsolatton of the resulttng lysoplasmenylcholtne fractton (descrrbed m Subheading 3.1.1.1.). The lysoplasmenylcholine ts then re-estertfed wtth radtolabeled arachadomc acid to yield the plasmenylcholme substrate (described tn Subheading 3.1.1.2.) The assay consists of determinmg the rate of radiolabeled arachadonate released after mcubatton with an enzyme source (descrtbed m Subheading 3.1.2.).
3 1.1 Preparation of the Radiolabled Substrate rH]Plasmenylcholine 3 1.1 1 PREPARATION OF LYSOPLASMENYLCHOLINE 1 Add 200 mL of 0 05 A4 KOH m methanol/benzene to 5 g of bovme heart phosphattdylcholtne (Choltne glycerophospholtptds) and star for 40 mtn at 40°C under a stream of nitrogen gas. The reactlon IS allowed to proceed until -98% of phosphattdylcholme has been hydrolyzed, as assessed by TLC (see Note 1) 2 Stop the reactton by addmg 50 mL of ethyl formate slowly and stir for another 15 mm at 40°C
Farooqu
42
et al
3 Evaporate the reaction mixture to almost dryness by rotary evaporation at ~37°C 4 Add 100 mL chloroform to the drred reaction mrxture and then agam evaporate the solution to dryness 5 Repeat step 4 again. 6 The resrdue IS extracted according to the Bhgh and Dyer method (24) Brtefly, add 200 mL of chloroform and 200 mL of methanol to the dried mixture, shake for a mmute, and then add 180 mL of water; shake well and let it settle mto two layers 7 Transfer the upper chloroform layer to a flask, and reextract the aqueous layer twice by 200 mL of chloroform at each time 8 Combme all the upper chloroform layers from each extraction and evaporate the solutton to dryness 9 Resuspend the drred reaction mixture m -10 mL of chloroform and apphed to tandem Dynamax Macro-HPLC sihca columns (each 2 1 4 mm x 25 cm) and elute with a hnear gradtent from 100% chloroform/O% methanol to 0% chloroform/ 100% methanol over 2 L at 10 mL/min. The ether-linked cholme lyso-phosphohpids are eluted at 60-70% of methanol 10 The lysoplasmenylcholme is then separated from other ether-lmked cholme lysophosphohptds by reverse phase HPLC uttlrzmg an Econosrl octadecyl sthca column (10 mm x 25 cm, 10 pm partrcle srze) wrth lsocratrc elutton usmg methanol/water/acetomtrrle (57/23/20, [v/v]) It IS stored at -20°C to -80°C under nitrogen (see Note 2) 3 1.1 2. LABELING THE RADIOACTIVE ISOTOPE AT THE m-2 POSITION OF LYSOPLASMENYLCHOLINE
1 Mix 34 mg of lysoplasmenylcholme (71 mmol) generated above with 70 mm01 of free arachidonate and 50 mCi of [3H]arachrdonate together m a 2 mL conical reaction veal and evaporate to dryness under a stream of N2 2 Placethe reactionvial with lipids andrecrystallized DMAP m a vacuum desiccatorm the presenceof phosphoruspentoxtde and evacuateat lessthan 50 mTorr overnight 3 Dissolve the lipids m the reaction vtai with 1 7 mL of chloroform and add 10 mg of dried recrystallized DMAP (80 mmol) to the lipid mtxture 4 Inmate the reaction by adding 4 mg of DCC (20 mmol, dtssolved in freshly dtstilled chloroform) Multtple Increments(10 addmons) of 0. I-O. 15mol equivalents (relattve to fatty acids) of DCC are addedevery 4 h with contmuously stirring The reactton should be kept away from light by covermg with alummumfoil 5 The reaction IS terminated by the addition of methanol, and the lipid phasedried under nitrogen The residue 1sextracted with 200 mL chloroform/methanol (l/l, [v/v]) After shakmgfor 1 mm, add 90 mL of water (13) Shake again and let the mtxture settlemto two layers Collect upperchloroform layer and dry under nitrogen 6 The radrolabeled plasmalogen IS purified from the reactron mrxture by HPLC employing a lmear gradient of hexane/2-propanollwater from 48 5148513to 461 46/S (v/v) at flow rate of 10 mL/mm and 4 h total duratron Retention ttmes unreacted DMAP, 55-60 min, m-2 phosphodresterplasmenylcholme isomer, 90 min, plasmenylcholme, 110-120 mm, lysoplasmenylcholme, 170-l 80 mm
Plasmalogen-Selective
43
PLA,
7 If large amounts of DMAP are present in the reaction extract, then tandem Dynamax Macro-HPLC stllca columns (each 21 4 mm x 25 cm), in combmatron with a lmear gradient from 100% chloroform/O% methanol to 0% chloroform/ 100% methanol at a flow rate of 10 mL/mm, are utilized to n-ntially purify plasmenylcholme. Purified radroactive plasmalogen can be stored under nitrogen at -20°C to -8O’C (see Note 2) 8 Alternatively, radioactive plasmatogen can be prepared by an enzymatic procedure from lysoplasmalogen (see Note 3)
3.1.2. PLA* Enzymlc Activity Assayed with ~H]Plasmenylcholine 1 Five to 50 mL of enzyme solution is mixed with 2 nuI4 [3H]plasmenylcholme (introduced by ethanohc mjection [lo mL]) tn an assay buffer adjusted to yield these final conditions 100 mMTris-HCI, 4 mMEGTA, 5% glycerol, pH 7 0, m a tinal volume of 200 mL Incubate at 37°C for 5 mm. 2 Stop the reaction by the addition of 100 mL of butanol, vortex, and centrifuge (1 OOOg, 10 mm) to break phases 3 The released [3H]fatty acid IS isolated by application of 25 mL of the butanol phase to channeled Silica Gel G plates, developed m petroleum ether/diethyl ether/acettc acid (70/30/l, [v/v]) 4 The [3H]fatty acid band IS scraped and quantified by liquid scmtlllatlon counting
3.2. Plasmalogen-Selective by Nuorimefric
/%A2 Activity
Defermined
Assay
The fluorometrrc plasmalogen-selective PLA2 assay 1s reasonably sensrtrve and mexpensrve, and does not require the use of radroacttvrty. Furthermore, better yields are obtained for the preparation of the fluorescent substrate as compared to the radiolabeled substrate described above. Despite of the major drawback of the bulky pyrene group at the ethanolamine head group of pyrene-labeled plasmalogen, thus assay procedure still provides several potentral advantages for the mitral mvestlgatton of plasmalogen-selectrve PLA,.
3.2.1. Preparation of the Fluorimetric Pyrene-Labeled Plasmenylcholine
32
Substrate
1.1 PURIFICATION OF ETHANOLAMINE PLASMALOGEN FROM BOVINE BRAIN MIXED ETHANOLAMINE GLYCEROPHOSPHOLIPIDS
1, 100 mg of bovine brain mixed ethanolamme glycerophosphohpids
IS drted under
a stream of N2
2 Add the followmg sequentially to the dried lipid. 4 mL of 0 5 M NaCl m 40 mA4 Tris-HCI, pH 7.6; 4 mLof sodium deoxycholate in 40 mM Tris-HCl, pH 7 6, (15 mg/mL), 6 mL of bovine serum albumin in 40 mMTris-HCI, pH 7 6, ( 15 mg/mL), 2 mL of 50 mMCaC1z m 40 mA4Tris-HCl, pH 7 6 Brmg the final volume to 20 mL with 40 mM Tris-HCl, pH 7 6
44
Farooqui et al
3 Vortex the mixture vigorously for 10 mm, and then probe somcate on ice for 3 mm using a 5 s pulse at each cycle 4 Initiate fatty acid hydrolysis by adding 6,000 U of R A hpase to the reaction mixture, fill up the reaction vial with N,, and gently stir for 4 h at room temperature The temperature should be mamtamed at room temperature 5 Stop the reaction by adding 4X total volume of chloroform/methanol (2/l, [v/v]) Shake well 6 Let it stand for 20 mm Transfer the lower (organic phase) phase to a flask, evaporate to dryness, and then dtssolve m -1 mL of chloroform. 7 Load the -1 mL of lipid from the previous step to a 25 g Umsil stlicic acid column (2 5 x 30 cm), previously equilibrated m 100% chloroform 8 Wash the column with 300 mL of chloroform Free fatty acids and other neutral lipids are eluted during this step 9 Elute the ethanolamme plasmalogen fraction by applying 500 mL of chloroform/ methanol (4/ 1, [v/v]) 10 Elute the lysophosphohpids by applymg 500 mL of methanol 11 Evaporate the ethanolamme plasmalogen eluate to dryness and then dissolve m -10 ml of chloroform contammg a few drops of methanol 12 Store the ethanolamme plasmalogen solution m a glass vial filled with N, 13 Determine the purity of ethanolamme plasmalogen by 2D TLC using a Silica G plate (20 x 20 cm) under the solvent system of chloroformimethanol/ammon~um hydroxide (6.512514, [v/v]), hydrolyze the TLC plate with concentrated HCl fumes before developing the second dimension 14 The TLC plate is sprayed with TNS solution or exposed to I2 vapor and lipid bands are visualized under UV light phosphatidylethanolamme, and lysophosphohpid 15 The plasmenylethanolamme, bands are identified, scraped, and quantified by phosphorus assay This preparation should have very minor amount of lysophosphohpid If the lysophosphohpid content is too high, repeat steps 7-10 again (see Note 4) I L.
LHtltLIIv~
rLHbMtlvYLt
I tlHIW-JLHNIIIVk
VVI I Ii
r
Ylitl\ltbULt-UI\1YL
~mLuHlUt
3 6 mmol of plasmenylethanolamme, dried under NZ, is mixed with 0.75 mL of pyrene sulfonylchloride m chloroform (1 72 mg/mL) m a test tube, 0 75 mL of a 0 32% solutton of trtethanolamme m methanol is added and then mixed well. The reaction test tube is filled with NZ, capped tight and then wrapped with alummum foil. Keep the reaction away from hght and Incubate for 4 h at room temperature Stop the reaction by drying the reaction mixture under a stream of N2 Redissolve the dried mixture wtth 0 3 mL of chloroform and apply on to a Silica G plate (20 x 20 cm) Develop the TLC plate under the solvent system of chloroform/methanol/ ammomum hydroxide (85/22/4, [v/v]) Visualize the plate under UV light, and identify the fluroescent pyrene-labeled plasmenylethanolamme band, scrap off the band Extract the lipid from the sthcic acid powder from the scraped band using 12 mL of methanol, repeat extraction two more times usmg 12 mL of methanol for each extraction
Plasmalogen-Selective
PLA,
45
7 Combme three extracts and evaporate to dryness 8 Redissolve the pyrene-labeled hptd with the smallest amount of chloroform needed, and store m a vial tilled wtth N,
3.2.2. PLA2 Enzymlc Activity Assay with Pyrene-Labeled
Plasmalogen
1 For each substrate, dry 74 mmol of pyrene-labeled plasmenylethanolamme under a stream of NZ, Add 345 yL of Hz0 to the drted ltptd and subject to probe somcatlon on Ice for 1 mm wtth 5 s-pulses at each cycle (For a substrate blank reactton, use 345 ul., of water wtthout the dried pyrene-labeled plasmalogen substrate ) 2 Add 74 uL, of 5% bovine serum albumm m 20 mM MOPS, pH 7 4,74 pL of 1% Trtton X-l 00 m 20 mM MOPS, pH 7 4, and 148 mL of 20 mM MOPS, pH 7 4, wtth 4 mM EGTA to the somcated substrate. MIX well 3 Start the reaction by the addition of 100 pL of an plasmalogen-specific PLA, enzyme source to the substrate, and substrate blank, solutions prepared above For the enzyme blank reaction, add 100 uL 20 mM of buffer to the substate Incubate the reactton m 37°C water bath for 2 h with gentle agltatron Stop the reactron by the addition of 4 mL of chloroform/methanol (2/l, [v/v]), vortex, add 159 pL of HI0 and vortex Centrtfuge the mtxture at 1OOOg for 10 mm Discard the upper phase, transfer 1 2 mL of the lower phase to each of two clean test tubes and dry under a stream of N, Redtssolve the two dried lower phase samples with 30 uL of chloroform each, spot each sample on a separate Stltca G plate (10 x IO cm) Subject one of the plates to acid hydrolysis by placing the plate in a tank contammg fumes of concentrated hydrochloric acid for 5 mm Be sure a fume hood IS used during this step 10 Develop both plates (one subjected to acid hydrolysis, the other not) under the solvent system of chloroform/methanol/ ammonmm hydroxide (65/25/4, [v/v]) 11 Identify the pyrene-labeled phosphoglyceroethanolamme band under UV light. Scrape off the band and extract with 2 mL of methanol 12 Read the fluorescence intensity at excttatlon and emlsslon of 340 and 376 nm, respectively
4. Notes 1 For TLC, use Silica G plates developed with chloroform/methanol/ammonium hydroxide (8512214, [v/v]) 2. Plasmalogen IS very unstable. It should be always stored under N2 at-20°C or-SO”C 3 Alternatively, radioactive plasmalogen can be prepared by biochemtcal procedure, by mcubatmg lysoplasmalogen with rat liver mrcrosomes (25). The mcubatlon condition consists of 2 mmol of lysoplasmalogen, 20 mC1 of 1-[14C] arachrdomc or oletc acid (56 mCt/mmol), and 1 6 mmol of unlabeled fatty acid m 0 1 A4 sodmm phosphate, pH 7 4, contammg 600 mmol of MgCl,, 6 mmol of CoA, 600 mmol of ATP and 60 mg of rat liver microsomes m a total volume of 4 mL After mcubatmg for 2 h, the reactron IS stopped by extracting the ltptd with
Farooqui et al.
46
chloroform/methanol (2/l, [v/v)], and labeled plasmalogen IS isolated by SI~ICIC actd column chromatography as described m the Subheading 3.2.1.1. 4 The purtty of plasmalogen IS defined by the amount of plasmalogen m the total ethanolamme phospholtptds If the purity IS less than 95%, repeat the whole procedure again wtth ltpase drgestton for 2.5 h
Acknowledgments Supported by grants NS-10165 and NS-29441 of Health, U.S Public Health Servtce.
from the National
Instrtutes
References 1 Horrocks, L A and Fu, S. C (1978) Pathway for hydrolysis of plasmalogens m bran-r Adv Exp Med Bzol 101,397-406. 2 Zoeller, R A , Morand, 0 H , and Raetz, C R (1988) A possrble role for plasmalogens m protectmg animal cells agamst photosenstttzed ktllmg J Bzol Chem 263, 11,590-l 1,596 3 Engelmann, B., Brautigam, C , and Thtery, J (1994) Plasmalogen phospholiptds as potential protectors against ltpid peroxtdatton of low denstty lrpoprotems
Blochem Bzophys Res Commun 204,1235-1242 4 Farooqut, A A , Wells, K., and Horrocks, L A (1995) Breakdown of membrane phospholtptds m Alzhetmer disease Involvement of excttatory ammo acid receptors Mol Chem Neuropath 25, 155-173. 5 Yang, H. C , Farooqm, A A., and Hot-rocks, L A. (1996) Plasmalogen-selecttve phosphohpase A2 and its role m stgnal transduction J LzpzdMedlat Cell Szgnall4,9-13 6 Hazen, S. L , Loeb, L. A., and Gross, R W (1991) Purtficatton and charactertzatron of cytosoltc phospholtpase A, acttvmes from canme myocardmm and sheep platelets Methods Enzymol 197,400-411. 7 Hazen, S L and Gross, R W (1992) Identtficatlon and characterization of human myocardtal phosphohpase A, from transplant rectptents suffering from end-stage tschemtc heart dtsease C~rc Res 70,486-495. 8 Farooqut, A A , Yang H C , and Horrocks, L. A (1995) Plasmalogens, phosphohpase A, and stgnal transductton Brazn Res Rev 21, 152-161 9 Portilla D and Dal G (1996) Purtficatton of a novel calcmm-Independent phospholipase A2 from rabbtt ktdney. J Bzol Chem 271, 15,45 l-15,457 10 Han, X. L , Zupan, L A, Hazen, S. L., and Gross, R W (1992) Semisynthesis and purtticatton of homogeneous plasmenylcholme molecular species. Anal Blochem 200, 119-l 24. 11 Htrashima, Y , Mtlls, J S., Yates, A. J , and Horrocks, L. A (1990) Phospholtpase A2 acttvtttes with a plasmalogen substrate in brain and m neural tumor cells a sensitive and spectfic assay using pyrenesulfonyl-labeled plasmenylethanolamme Blochlm Blophys Acta 1047,35-40 12 Yang, H. C., Farooqui, A A , and Horrocks, L A (1994) Effects of glycosamtnoglycans and glycosphmgohptds on cytosoltc phosphohpases A2 from bovme brain Blochem J 299,91-95
Plasmalogen-Selective
PLA,
47
13 Farooqur, A A and Horrocks, L A (1988) Methods for the determmatton of phosphohpases, hpases and lysophospholtpases m Neuromethods, vol. 7 (Boulton, G B and Horrocks, L A , eds ), Humana, Totowa, NJ, pp 179-209 14 Bhgh, E G and Dyer, W J (1959) A raped method of total hptd extraction and purtficatton Can J Blochem Physzol 37,911-917 15. Robertson, A F and Lands, W E (1962) Postttonal specttictttes m phosphohptd hydrolysis Blochemwtry 1, 804-8 10
6 Human Plasma Platelet-Activating Acetyl hydrolase Diana M. Stafforini
Factor
and Larry W. Tjoelker
1. Introduction The human plasma platelet-activatmg factor acetylhydrolase (PAF acetylhydrolase, 1 -alkyl-2-acetyl-glycerophosphocholine esterase, 1-alkyl-2acetyl-sn-glycero-3-phosphocholme acetohydrolase, EC 3 1 1 47) is a phosphobpase A2 activity discovered by its ability to hydrolyze PAF m serum derived from IgE-sensitized rabbits (see Fig. 1, and ref. I) The clonmg and characterization of the plasma PAF acetylhydrolase (2) resulted m its classification as a group VII phosphohpase AZ, based on its substrate specificity, ammo acid sequence, and calcium independence (3). This enzyme recognizes primarily one feature in phospholipid substrates. the type of acyl group at the second position of the glycerol backbone (4). For hydrolysis to occur, this group has to be no longer than nine methylene groups m length (see Fig. 1, and ref. 5) In addition, species contannng ~2-2 groups with oxidized terminal functions (i.e , an acidic or aldehydic group) are better substrates (see Fig. 1, and ref. 6) However, phosphohpids containing long acyl groups at the ~2-2 position, such as those found m plasma and organelle membranes, are not hydrolyzed (7). These combined features ensure that phospholipid components of cellular membranes and lipoprotems remain intact, while products of oxidation and fragmentation of these lipids are hydrolyzed. Thus, it would be more appropriate to refer to PAF acetylhydrolase as short/oxidized sn-2 phospholipid hydrolase An additional feature that differentiates the reaction catalyzed by the plasma PAF acetylhydrolase from most other phospholipase A2 reactions is its calcium independence (8). This indicates that PAF acetylhydrolase may act conFrom
Methods Edlted
by
m Molecular
Bology,
M H Doohttle
and
l/o/ 109 Lfpase and Phospholipase K Reue
49
0 Humana
Press
Inc , Totowa,
Protocols NJ
50 0 II Q-C-0
Stafform and noelker CH2
-CH I CH20
-
PAF acetylhydrolase -
R1,2
Hz0 f: + - r -0-CH2-CH2-N+
(332
-
R1.2
HO-CH
(CH,,,
0
o II CH20
-r
0-
+ -0-CH2-CH,-N+
F&-OH (CH3)3
0.
Where
R,
CH3
WH2h
n=15-17
:: R2
R3 %
0-C(CH2),
CH,
(CH,),CH,
n=O-8 X = COOH
P--h X,Y,Z
Y=CHO 2 = CH20H
Fg 1
tmuously, for example to scavenge substrates, rather than acutely m response to activation signals. PAF acetylhydrolase activity is inhibited by set-me esterase mhibitors such as drisopropylfluorophosphate, Pefabloc, and phenylmethylsulfonylfluoride (9) This is due to the presence of a GXSXG motif characteristic of lipases and esterases, which confers sensrtivity to nucleophihc agents like the ones mentioned above (10). Structural analogs of PAF have also been shown to act as substrates and/or to inhibit PAF acetylhydrolase activtty competitively (12). PAF receptor antagomstsare also relatively good mhibitors of this activity, provided that then structuremlTntcsthat of PAF (6) The cellular sources of the human plasma enzyme include liver cells (12) and macrophages (13). A PAF acetylhydrolase activity is present m the cytosohc fraction of a variety of mamrnahan tissues (2415). This activity belongs to a family of intracellular PAF acetylhydrolases, distmct from the plasma form. This chapter describes two methods to assaythe activity of the plasma form of PAF acetylhydrolase (16). In the first method, the rate of catalysts is dietated by the amount of enzyme added to the assay This method should be used when assaying fractions containing the recombinant enzyme, and when it is desired to determine the optimized, total activity m plasma or serum samples In the second method, substrate is rate limiting and enzyme 1sin excess (17). Thus, this is not a determination of enzyme activityperse, but it is a useful tool to assessthe ability of a plasma sample to degrade PAF under conditions that mimic those presumably found m VIVO. In addition to these assay methods, we describe a protocol to purify PAF acetylhydrolase from bacteria overexpressmg the cDNA encodmg this enzyme,
Plasma PA F Acetylhydrolase
51
This method is straightforward, and large quantities of PAF acetylhydrolase can qutckly and easily be obtained. The purified recombinant enzyme 1sfunctionally mdistmguishable from the PAF acetylhydrolase purrfied from human plasma, tt is stable for prolonged periods at 4°C and it can be used m btochemtcal, cellular, and physiological experiments 2. Materials 2.1. PAF Acetylhydrolase or Serum
Activity and Half-Life
of PAF in Plasma
1. PAF, I-Hexadecyl-2-acetyl-sn-glycero-3-phosphocholine (Avant1 Polar Lipids, Birmingham, AL) 2 [3H-acetyl]PAF and [3H-alkyl]PAF (New England Nuclear, Boston, MA) 3 Somcator (model 15 10,Braun) 4 HEPES buffer: 0 1 M, adJust the pH to 7 2 with 1 Mpotassmm hydroxide Store at 4°C 5 Acetic acid 10 A4 solution. Store at room temperature. 6 Sodium acetate 0 1 M. Store at room temperature. 7 Octadecylsihca gel cartridges (Baker, Phillipsburg, NJ) 8 Opti-Fluor (Packard, Downers Grove, IL). 9 Thm-layer chromatography plates silica Gel 60A (Whatman, Clifton, NJ) 10. Orgamc reagents chloroform/methanol (9 1), chloroform/methanol/acetic acid/ water (50.25 8 4)
2.2. Expression
of the Plasma Form of PAF Acetylhydrolase
1. Polymerase chain reaction (PCR) primers. Sense*5’-TATTC TAGAA TTATG ATACA AGTAT TAATG GCTGC TGCAA G-3’ Antisense. 5’-ATTGA TATCC TAATT GTATT TCTCT ATTCC TG-3’ PAF acetylhydrolase template for PCR plasmid sAH 406-3 (available from the authors, see ref. 2) dNTP stock solution (10X): 1.25 mM m Hz0 Store at -20°C PCR buffer stock solution (1 OX) 100 mM Tris-HCl, pH 8 4, 500 mM KCI, and 15 mMMgC12. Store at 4°C Tuq polymetase (Boehrmger Mannhelm, Indtanapolis, IN) Store at -20°C Expression vector pUC19 (New England Blolabs, Beverly, MA) The commercial vector should be modified by clonmg the E co2i trp promoter (18) into the EcoRI and .%%a1sites of the pUC 19 multiple cloning site. 7 Incubation medium: L Broth (19) with 0 1 mg/mL carbenicillin
2.3. Purification
of Recombinant
Plasma PAF Acetylhydrolase
1 Lysts buffer: 25 mMTrts-HCl, 20 mA43-(3-cholamidopropyl) dimethylammomol-propane sulfonate; (CHAPS, Sigma, St Louis, MO), 50 mA4 NaCI, 1 mA4 EDTA, 50 yg/mL benzamidme, pH 7.5. Store at 4°C. 2 Microfluidlzer (Micrtfluidtcs, Newton, MA)
52
Stafforini
and noelher
3. Pre-cast polyacrylamlde gels (Novex, San Dlego, CA) 4 S Sepharose Fast Flow and Blue Sepharose Fast Flow (Pharmacia, Uppsala, Sweden) 5. Buffer A 25 mM 2-(N-morpholmo)ethanesulfomc acid (MES, Sigma), 10 mM CHAPS, 1 mM EDTA, pH 4 9 Store at 4°C 6 Buffer B 25 mM MES, 10 n&Y CHAPS, 50 mM NaCI, 1 mJ4 EDTA, pH 5 5 Store at 4°C 7 Buffer C 25 mM Tns-HCI, 10 mA4 CHAPS, 0 5 M NaCl, 1 mM EDTA, pH 7 5 Store at 4°C
3. Methods 3.1. PA F Ace tylhydrolase
Assay
The most convenient assay for the determmatlon of PAF acetylhydrolase actlvlty utilizes 2-[3H-acetyl] PAF as substrate; the [3H]acetate generated by hydrolysis IS quickly and effclently separated from labeled substrate smce the product IS soluble m water, whereas the substrate is hpophlhc We separate substrate and product by reversed-phase column chromatography on disposable octadecylslhca gel cartridges; while the unreacted substrate binds to the column, the water-soluble [3H]acetate passes through Thus, the amount of radIoactIvIty released represents the amount of enzymatic actlvlty m a given fraction, whtch can be conveniently quantified by hquld scintlllatlon spectrometry (16). 3.1 1 Standard
Assay
Procedure
1 MIX 400 nmols of PAF (supplied m chloroform), with 4 5 ~CI of hexadecyl-2acetyl-sn-glyceryl-3-phosphorylcholme, l-O-[acetyl-3H(~] (supplied m ethanol) 2 Evaporate off the solvents (by a stream of nitrogen) and add 4 mL of HEPES buffer The final concentration of PAF m this stock solution 1s 0 1 mA4 3 Somcate for 5 mm at 4°C and 100 W, usmg a 4-mm needle probe m a Braun somcator Any unused substrate should be stored frozen at -20°C to avoid nonenzymatic hydrolysis, the frozen substrate can be stored for at least 1 wk Importantly, the somcatlon step must be repeated each time the substrate IS thawed Each time the substrate 1s prepared, duplicate ahquots should be counted to determine the specific radloactlvlty, our working solutions are 100 PM with respect to PAF and contam approximately 10,000 cpm/nmol 4 MIX IO-pL ahquots of the samples to be assayed (diluted m HEPES buffer, if necessary) with 40 pL of 0.1 mM [3H-acetyl]PAF m polypropylene tubes, at 4’C To ensure that substrate concentration IS not rate limiting, several different dllutlons of the sample should be assayed. The rate of product formation should be linear with increasing sample concentration If the substrate 1s present m excess To mmimlze substrate binding to the glass surface, glass tubes should be avoided 5 Incubate the mixtures for 30 mm at 37°C Imtlally, it 1s recommended that several time pomts be measured to ensure that the rate of product formation 1s linear with respect to time
Plasma PA F Acetylhydrolase
53
6 To stop the reaction, add 50 pL of acetlc acid followed by 1 5 mL of 0 1 M sodium acetate solution 7 Wash each octadecylslhca column with 3 mL of chloroform/methanol (1 2), followed by 3 mL of 95% ethanol, and finally, 3 mL of water (see Note 1) 8 Pass each reaction mixture through an octadecylslhca gel cartrldge and collect the filtrates m 15mL scmtlllation vials (see Notes 2 and 3) 9 Wash each assay tube with an additional 1.5 mL of sodium acetate solution, apply to the octadecylslhca gel cartridge, and combme this wash with the orlginal effluent (see Note 4) 10 Add 10 mL of Optl-Fluor and detennme the amount of radloactlvlty m a hquld scmtlllatlon counter (see Note 5) 11 Use the radiospecIfic actlvlty of the substrate determined in step 3 to calculate nmoles of acetate released per mm for each sample
3. I 2. Determinat/on
of the /-/a/f-Life of PAF in Plasma
of whole blood, plasma, or a plasma fraction to hydrolyze subsaturatmg concentrations of PAF, and to determine the half-hfe of exogenously added PAF m that sample. The determlnatlon of “actlvlty” under these conditions does not reflect the optimized abllIt IS sometimes
useful to determine
the ability
lty of the enzyme to catalyze hydrolysis,
which 1s the parameter
measured by
the enzyme assay described in Subheading 3.1.1. This assay rather measures the rate with which the enzyme gams accessto the added substrate, recogmzes It and then catalyzes tts hydrolysis This ISof crucial Importance m the case of PAF acetylhydrolase because the plasma subfractions with which the enzyme associates (hpoprotems) may be different from those to which the substrate(s) binds Thus, the rate of hydrolysis m this system IS much slower than that determined m an optimized enzyme assay,but it provides a reahstlc rate that reflects the overall reactlon rate and IS more representative of in vivo sltuatlons. 1 Prepare 100 PL of a PAF solution with a final concentration of 1p-1 @” M by mlxmg 1Oe7-1Oe5mols ofunlabeled PAF (10 mg/mL) with 5 pL of [3H-alkyl]PAF (0 1 $Y’JIL) 2 Dry the solvents under a stream of nitrogen. Then add 100 PL of 50 mMTns-HCI buffer (pH 7 5) and briefly somcate this solution at 4°C 3 Add 50 PL of the [3H-alkyl]PAF solution to 250 PL of plasma. 4. Remove 5O+L ahquots after 0,2,4,6,9, and 15 mm at 37°C and place each one m a microcentrlfuge tube contammg 62.5 pL of CHCI, and 125 yL of CH,OH to stop the reaction. This results m the formation of a Bligh-Dyer monophase (22) 5 Add approximately 40 nmol of PAF and lyso PAF as carriers and then break the phases by adding 62 5 PL of H,O and 62 5 pL of CHQ 6 Remove the lower phase after a brief centrlfugatlon step and dry It under nitrogen 7 Resuspend the extracted phosphollplds m 50 PL ofCHC1JCH70H (9 1). Spot the samples on thm layer chromatography plates that had been previously activated by heating at 100°C for I h
54
Stafforim and Tjoelker
8 Develop the plates usmg CHCl,/CH,OH/CH,COOH/H,O (50:25 8:4) 9 Scrape the spots correspondmg to PAF, lyso-PAF, and the rest of the lane and determine the amount of radroactivrty present m the scrapings after adding 5 mL of Opt]-Fluor (see Note 6)
3.2. Expression
of the Plasma Form of PAF Acetylhydrolase
Thrs section describes the strategy employed to generate a PAF acetylhydrolase expression vector from a previously isolated PAF cDNA (2). Thw cDNA clone and the resulting expresslonconstruct are available from the authors. 1 Design a pan of PCR ohgonucleottde prrmers to amphfy the cDNA region that encodes the desned polypeptrde To facilitate cloning of the product, include umque restrlctron endonuclease sues at the 5’ termmus of each prtmer (see Note 7). 2 To generate a PCR fragment, mix 100 ng of template cDNA (see Subheading 2.2.) wrth the PCR reactton mixture containing 1 ug of each prrmer, 0 125 mM dNTPs, 2 5 umts of Taq polymerase and 1X PCR buffer Program a thermal cycler to perform an mitral denaturatlon step of 94°C for 4 mm followed by 30 cycles of amphfkatton m which each cycle conststs of 1 mm at 94°C 1 mm at 60°C and 2 mm at 72°C (see Note 8) 3 Purify the PCR fragment by extraction wtth phenol and chloroform and drgest it and the expresston vector wrth restriction endonucleases to create compatible ends After agarose gel purtficatton, hgate the PCR product and expressron vector together and transform mto E colz (see Note 9) 4 Innoculate 500 mL of L Broth contammg 0 I mg/mL carbemcillm with an isolated, transformed colony Incubate for 18-20 h at 37’C on a rotatmg platform 5 Harvest cells by centrtfugatron at 6000g for 15 mm at 4’C The cell pellet can be stored at -70% or used rmmedrately
3.3. Purification
of Recombinant
Plasma PA F Acetylhydrolase
1 Resuspend 100 g of pelleted E colz in 200 mL of lysrs buffer and lyse by passmg three times through a mrcroflurdrzer at 15,000 PSI Remove solrds by centrrfugatron at 14,300g for 60 mm 2. Dilute the supernatant IO-fold in buffer A and load at 25 mL/min on an S Sepharose Fast Flow column (5 x 11 cm, 200 mL) equihbrated m buffer B 3 Wash the column wtth 1 L of buffer B and elute with 1 M NaCl. Collect 6-8 50-mL fracttons and adJust the pH to 7.5, wrth 0 5 mL of 2 A4 Trrs base Assay the fractions for PAF acetylhydrolase actrvtty 4 Pool the active fractions from the S Sepharose Fast Flow column and adjust the NaCl concentratton to 0 5 M 5. Load on a Blue Sepharose Fast Flow column (2.5 x 4 cm, 20 mL), equtlrbrated with buffer C, at a flow rate of 1 mL/min. 6 Wash the column wrth 100 mL of buffer C and elute at 4 mL/mm wrth 100 mL of buffer C contammg 3 MNaCl (see Notes 10 and 11) Pool the fractions contammg PAF acetylhydrolase actrvrty. Table 1 summarrzes typrcal purtficatron results
Plasma PAF Acetylhydrolase Table 1 Purification
of Recombinant
Fraction Bacterial lysate S Sepharose effluent Blue Sepharose effluent
55 Plasma
PAF Acetylhydrolase Purificatton,
Specific activity, u/i?@
Recovery, %
98 1,557 4,676
100
1
56 62
16 48
fold
“1 U = 1 pmol/mL/h
7 The purtfied enzyme IS stable for several weeks when stored at 4°C For longterm storage, aliquot, and place at -70°C
4. Notes 1 Another method for the separatton of released product from the hptd substrate is based on a solvent extractton and measurement of radtoactivrty m the aqueous phase (20) This procedure is slower than the one descrtbed m Subheading 3.1.1. and care must be taken to remove all CHCl, to avoid quenching of the hqmd scmtlllatton counting However, Mlwa et al have simphfled the above assay by substituting the solvent extraction with a precipitation step that separates excess labeled substrate from product (21) The precipitate IS formed after addition of albumm (which forms a complex with PAF) and trlchloroacetm acide. This avoids the use of costly solvents Following any change in procedure, one should verify that the apparent product is not contammated with substrate The effluent should be extracted mto CHCl, and examined by thm-layer liquid chromatography (23) or hrgh-performance hqurd chromatography (24) 2 When there are many samples, it IS convenient to use a multiplace vacuum mamfold to allow several samples to be processed simultaneously If only a few samples need to be assayed, one can get satisfactory results by manually pushing the product of the reaction through a syringe attached to an octadecylstlica gel cartridge 3. The amount of protein permissible in the solution to be apphed to the cartridges should be determined, since large amounts of protein will prevent bmdmg of PAF to the resin. This results m what appears to be high activity since the product becomes contaminated with substrate. This should be determined by carrying out mock assays contammg HEPES buffer Instead of sample, and terminating the reaction at zero time 4 The cartridges can be reused at least 10 times without loss of bmdmg capacity 5. We have used this assay for the determmatton of hydrolase activity m serum and plasma samples and found that both sources contain the same amount of acttvrty The collectron of plasma in EDTA, citrate, or heparm resulted m equal activities 6 In the half-life determmation assays, the amount of PAF hydrolyzed 1s determined by calculatmg the percentage of counts present in the PAF spot for all the time points tested Then, the percentage of PAF remaining 1s plotted on a log
Staffonni and ijoelker
56
scale versus time (linear scale) In human plasma, this usually gives pseudo-firstorder kinetics, and the half-life can then be calculated from this line. When designing PCR primers, the 5’ sense pnmer should contam a restriction enzyme recogmtlon site followed by a translation mltiatlon codon and the first 8-10 codons of the amplified region Expression may be enhanced by making this region as A/T-rich as possible through nucleotlde substitution at the third position ofcodons The 3’ antisense primer should contam a distinct restriction enzyme site preceded by a termmatlon codon and 8-10 codons at the 3’ end of the amphfied region When using Taq polymerase, the number of sequence errors introduced by the enzyme can be mmimlzed by mcreasmg the amount of template and reducing the number of cycles used to generate the product The integrity of the expression construct should be verified by restriction digestion and nucleotlde sequencing of the insert and IlgatedJunctlons There are a number of commercially available plasmids and E colz strains suitable for generatmg recombinant proteins The optimal expression system depends upon the protein being expressed and the scale of production required (25) The pUC vector with the trp promoter and the XL-l Blue strain of E co/z are suitable for small- and medium-scale expression of PAF acetylhydrolase Under the cell culture conditions described here, the trp promoter becomes actlvated due to tryptophan depletion m the medium during the course of the mcubatlon. For detailed mformatlon regardmg these systems, see mformatlon provided by the supplier (e.g , InVltrogen) 10 The Blue Sepharose Fast Flow step can be repeated to reduce the bacterial endotoxm content of the purified preparation 11 CHAPS can be toxic to blologlcal systems To remove the detergent, dialyze against buffer C
References Farr, R S , Cox, C P , Wardlow, M L , and Jorgensen, R J (1980) Prehmmary studies of an acid-labile factor (ALF) m human sera that inactivates platelet-actlvatmg factor (PAF) Clan Immunol Immunopathol 15,3 18-330 TJoelker, L W , Wilder, C , Eberhardt, C , Stafforim, D M., Dletsch, G , Schlmpf, B , Hooper, S , Trong, H L , Cousens, L S , Zimmerman, G A, Yamada, Y , McIntyre, T M , Prescott, S M , and Gray, P W (1995) Anti-inflammatory properties of a platelet-activating factor acetylhydrolase Nature 374, 549-552 Denms, E A (1997) The growing phosphohpase A2 superfamily of signal transduction enzymes Trends Bloch Scl 22, l-3 Staffonm, D M , Prescott, S M , and McIntyre, T M (1987) Human plasma platelet-actlvatmg factor acetylhydrolase Purification and propertles J Bzol Chem 262,42234230 Stremler, K E , Stafforml, D M , Prescott, S. M., Zimmerman, G A , and McIntyre, T M (1989) An oxidized derivative of phosphatldylcholme IS a substrate for the platelet-activating factor acetylhydrolase from human plasma J Blol Chem 264,533 1-5334
Plasma PAF Acetylhydrolase
57
6. Stremler, K E , Stafforml, D M., Prescott, S M , and McIntyre, T M. (1991) Human plasma platelet-activating factor acetylhydrolase Oxidatlvely-fragmented phosphohplds as substrates J Blol Chem 266, 11,095-l 1,103 7. Wardlow, M L , Cox, C P., Meng, K E , Greene, D E , and Farr, R S (1986) Substrate speclficlty and partial characterlzatlon of the PAF acylhydrolase m human serum that rapldly inactivates platelet-actlvatmg factor J Zmmunol 136, 3441-3446 8 Farr, R S., Wardlow, M. L., Cox, C P , Meng, K E , and Greene, D E. (1983) Human serum acid-labile factor IS an acylhydrolase that mactlvates platelet-actlvatmg factor. Federation Proc 42,3 120-3 122. 9 Stafformi, D M , McIntyre, T. M., Carter, M E., and Prescott, S M (1987) Human plasma platelet-actlvatmg factor acetylhydrolase* Assoclatton with hpoproteins and role m the degradation of platelet-actlvatmg factor J B~ol Chem 262,42 15-4222 10. TJoelker, L W , Eberhardt, C., Unger, J., Trong, H L , Znnmerman, G A , McIntyre, T M , Staffonm, D M., Prescott, S M., and Gray, P W (1995) Plasma platelet-actlvatmg factor acetylhydrolase 1s a secreted phosphollpase A, with a catalytic triad J Blol Chem 270,25,481-25,487. 11 Stafforim, D M , Prescott, S. M , Zimmerman, G A , and McIntyre, T M (1996) Mammahan platelet-actlvatmg factor acetylhydrolases Blochrm. Bzophys Actu 1301, 161-173 12 Satoh, K , Imatzuml, T -A , Kawamura, Y , Yoshlda, H , Hlramoto, M , Takamatsu, S , and Takamatsu, M (199 1) Platelet-actlvatmg factor (PAF) stunulates the productlon of PAF acetylhydrolase by the human hepatoma cell Ime, HepG2 J Clan Invest 87,476-48 I, 13 Stafformt, D M , Elstad, M R , McIntyre, T M , Zimmerman, G. A , and Prescott, S M (1990) Human macrophages secrete platelet-actlvatlng factor acetylhydrolase. .I. Bzol Chem 265, 9682-9687 14 Hatton, M , Aral, H , and Inoue. K. (1993) Purification and charactertzatlon of bovine bram platelet-actlvatmg factor acetylhydrolase. J Blol Chem 268, 18,748-l 8,753 15 Staffonm, D. M., Prescott, S M , Zimmerman, G A. and McIntyre, T M. (1991) Platelet-activating factor acetylhydrolase actlvlty m human &sues and blood cells Lqxds 26, 979-985 16 Stafforuu, D M , McIntyre, T M , and Prescott, S. M. (1990) Platelet-activating factor acetylhydrolase from human plasma Methods Enzymol 187, 344-357. 17 Stafforml, D M , Carter, M E , Znnmerman, G A , McIntyre, T M , and Prescott, S M (1989) Llpoprotems alter the catalytic behavior of the platelet-actlvatmg factor acetylhydrolase m human plasma Proc Nat1 Acad Scl USA 8,2393-2397 I8 Miozzan, G. F and Yanofsky, C (1978) Translation of the leader region of the Escherzchra co11tryptophan operon. J Bact 133, 1457-1466 19 Sambrook, J , Fntsch, E F , and Mamatls, T (1982) Molecular Clonzng A Laboratory Manual (Nolan, C , ed )$ Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York
58
Stafforini and Tjoelker
20 Blank, M L , Lee, T -C , Fitzgerald, V , and Snyder, F. (1981) A specific acetylhydrolase for 1-alkyl-2-acetyl-sn-glycero-3-phopshocholme (a hypotenstve and platelet-acttvating hptd) J. &ol Chem 256, 175-l 78 2 1. Miwa, M , Mryake, T , Yamanaka, T , Sugatam, J , Suzukt, Y , Sakata, S , Arakt, Y , and Matsumoto M (1988) Characterization of serum platelet-acttvating factor (PAF) acetylhydrolase: correlatton between defictency of serum PAF acetylhydrolase and respnatory symptoms m asthmattc children J Clm Invest 82, 19831991 22 Bhgh, E G and Dyer, W F (1959) A rapid method of total hprd extraction and purtficatton Can J Blochem Physlol 37,911-917 23 Mueller, H W., O’Flaherty, J T , and Wykle, R L (1983) Btosynthests of Platelet-actrvatmg factor m rabbrt polymorphonuclear neutrophtls J Btol Chem 258, 6213-6218 24 Brash, A R , Ingram, C. D , and Hams, T M (1987) Analysrs of a specific oxygenation reaction of soybean hpoxygenase-1 with fatty acids estertfied m phosphohprds Bzochemutty 26, 5465-547 1 25. LrlJestrom, P. and Garoff, H. (1994) Protem expresston, m Current Protocols zn Molecular Biology (Ausubel, F. M, Brent, R , Kmgston, R E , Moore, D. D , Setdman, J. G., Smtth, J., Struhl, K , eds ), Wiley, New York, pp 16 0.1-16 20 16
Assays for Pancreatic Triglyceride and Colipase
Lipase
Mark E. Lowe 1. Introduction The assay of pancreatic triglyceride hpase (PL) is done routinely m clmical laboratories and in research laboratories with an interest in this lipolytic enzyme. The assay requirements differ between these two settings. The clmical laboratory requires automated assays that are specific, sensitive, fast, and reproducible. Conversely, researchers interested in PL do not require automated assays, but need specific, sensittve, and reproducible assays that allow them the flexibility to vary assay conditions. Researchers may also require assays of colipase, a small pancreatic protem that is necessary for PL activity m the duodenum. These requirements have led to the development of many different PL assays, many suited only for the clinical laboratory. The remainder of the Introduction will discuss methods utihzed m both settmgs, and then two assays suitable primarily for the research laboratory are described m Subheadings 3.1. and 3.2., including the assay of colipase in Subheading 3.3. Regardless of the assay type chosen, it is important to understand what conditions within the assay system affect the measurement of PL activity. An overview of the assay components and condmons that must be considered are presented m Subheadings 1.1. and 1.5.; more complete discussions are presented m earlier reviews (1-3).
1.1. General Considerations There are four mam issues to consider when selecting an assay for PL or colipase. First, an appropriate substrate must be selected from a number of triglycerides and diglycerides that can be hydrolyzed by PL. In the research From
Methods
m Molecular
Edlted by M H Doollttle
B!ology,
Vol
109
Llpase
and K Reue 0 Humana
59
and
Phosphollpase
Press Inc , Totowa,
Protocols
NJ
60
Lowe
laboratory, methods that allow different substrates to be utthzed are preferable, whereas n-r the clmical laboratory, the substrate IS not varied and is chosen based on the other properties of the assay. Second, hpase substrates are generally hydrophobrc and thus m aqueous solutions form aggregates that may have vastly different physical properties. Because these differences can influence PL activity, the physical form of the substrate must be considered. Third, the condttions of the assay, mcludmg pH, tonic strength, calcium concentrations, and emulsifiers all affect the rate of hpolysis and must be optimtzed Finally, a suitable detection method must be selected that can quantitate the rate of PL hydrolysis.
1.2. Lipase Substrates PL assays are most often done with tnglycendes, but some assays designed for clnncal laboratories utilize diglycendes (4). The main reasons for using dtglycendes are then- increased solubihty rn water compared with tnglycendes and the ability to hydrolyze the products of the reaction further m coupled enzyme assays that produce colored or fluorescent products. These qualities are particularly suited for automated assay systems Despite then attractiveness, diglycendes have several drawbacks They are unstable, are more expensive than triglycerides, and are hydrolyzed by nonspecific esterases These properties hmtt the usefulness of dtglycendes Tnglycende is the substrate preferred m most assay systems A broad range of triglycerides is hydrolyzed by PL (5-7). Among these, tnolein is the most common PL substrate for several reasons. Tnolem as a substrate is highly specific for hpases since these enzymes are the only class of esterases able to hydrolyze long-chain acylglycerols at an oil-water interface, tnolem has the addttional property of being hquid at normal assay temperatures Two other triglycerides are also useful hpase substrates, tnoctanom and tnbutyrm. Both are liquid at room temperature and are readily hydrolyzed by PL The relative specific acttvtty of human PL against these three substrates IS 5 0.0.6*1 0 for tnbutyrin/tnoctanom/tnolem; thus, all these substrates are suitable for detection of PL activity (8) Trrbutyrm IS a partrcularly convement substrate. It can be dispersed m aqueous solutions by homogenization or rapid sttrrmg without added emulsifiers. Because of this property and the fact that it is a good hpase substrate, tributyrm is frequently employed m the research laboratory to quantitate PL activity. Researchers who choose trlbutyrm as a substrate m their PL assays must remember that tributyrm does not meet the definmon of a hpase substrate and may be hydrolyzed by esterases that are not hpases. If activity against trtbutyrm IS detected in a tissue extract or a partially purified hpase, the presence of a true hpase should be verified with triolem. Compounds with groups that absorb visible light or that fluoresce have also been developed as substrates for PL. These include fatty acid esters of 4methylumbelbferone or dimercaptopropanol (9,10). However, each lacks
Pancreatic Llpase and Colipase
61
spectfictty for PL because these synthettc substrates are also hydrolyzed by nonspectftc carboxylesterases. Recently, a fluorometric assay using lpyrenedecanoyl-2,3-dtoleyl glycerol was reported (9). This substrate was not hydrolyzed by nonspectfic leukocyte lrpases at alkahne pH where PL was opttmally acttve. Although thts substrate could be adapted for the clnncal laboratory, rt has limited usefulness in the research laboratory 1.3. Physical Stafe of the Substrate The preference of PL for msoluble substratespresents a umque problem. Trtglycertdes can exist in many dtfferent aggregated forms in water, including emulsrons,mrcelles, monolayers, and brlayers, m the caseof short-chain trtglycertdes, these more hydrophihc substrates can exist m water as drspersed monomers Studies of PL have shown that the rate of hydrolysis varres wtth the type of substrate and with Its phystcal state. Monomers are much poorer substratesthan aggregates of the same trlglycerrde (II). Even the physical properties of aggregated substratesaffect hpolysis. Benzonana and Desnuelle demonstrated 30 years ago that the rate of hydrolyses depended on the surface area of substrate Interface (12) Fme emulsions were hydrolyzed at faster rates than coarse emulsrons. Because of the important effects of the substrate on rates of hpolysls, tt IS crmcal to prepare the substrate in the same way for each assayand, when comparisons of acttvtty are made (for Instance, between native PL and a mutant recombinant hpase), to perform assayson the same day with a single stock emulston The phystcal state of the substrate may change during hydrolyses The most obvtous change IS the conversron of trrglycertdes to dtglycerrdes and free fatty acids. Dtglycerides are also substrates, but the hydrolyttc rate of drglycertdes may be stgmticantly dtfferent from that of triglycerrdes, and, if substanttal hydrolyses of dtglycerrdes occurs, the assay results may be difficult to interpret (23) For this reason, assaysshould be done with a large excessof trtglycerrde and over short time periods to prevent substanttal hydrolysis of dtglycerrdes. Often, It 1spreferable to measure mural rates. The release of free fatty acrds may pose addmonal drfficulttes. The longchain fatty actds released from trtolem have poor water solublhty and ~111 remain m the substrate interface This accumulatron of fatty actds in the mterface may affect the properties of the interface and influence hpolysts unless fatty acrd “acceptors” hke btle salts or albumin are present m the incubation By contrast, butyrlc actd and sodium butyrate are freely soluble m water and should not alter the quality of the oil-water interface. 1.4. Factors that Influence Lipolysis A number of compounds can mfluence the rate of hpolysts by PL Assay systems for PL often contam sodium chloride, calcmm chlortde, bile salts, or
62
Lowe
other emulsifiers, and proteins. All these compounds can affect the rate of hpolysls The exact mechanism of these effecters 1snot clearly understood, and there are differences of opmlon regarding possible mechanisms. Nevertheless, mvestlgators must be aware that these compounds can affect then results and care must be taken to keep these factors controlled. 1 4. I Sodium Chloride Although sodium chloride increases the rate of hydrolysis for triolem and tributyrin, the mechanism probably differs for each of these substrates. In the caseof trlolem, the salt may lower the apparent pKa of olelc acid, which allows a more quantitative titration. This explanation 1snot the entire answer because m the absence of sodium chloride llpolysis does not occur (1.4). It has been suggested that, m the absence of a counter ion, electrostatic repulsion by olelc acid prevents PL from binding at the substrate Interface. To complicate matters further, neither of these factors appears to explain the stimulation of trlbutyrm hydrolysis by sodium chloride. The released butyrlc acid 1swater soluble and should not produce mterfaclal charge effects, nor 1s the pKa of butyrlc acid affected by sodium chloride. Sodium chloride must have affects on the substrate or enzyme that have not been described. I 4.2. Calcium ions The mcluslon of calcnnn m PL assaybuffers has many effects on the reaction (1) Although calcium 1sgenerally not required for PL actlvlty, calcium 1snecessary when deoxycholate is m the assay mixture and reduces the mhlbltion by other bile salts and by free fatty acids The presence of calcium eliminates the lag time often seen after adding PL to a substratemixture Increasing concentrations of calcium improve the linearity of mltlal reaction rates for lipolysls. The mechanism by which calcium influences lipolysis 1snot understood. Many agree that a large portion of the affect IS through the formation of calcium soaps with free fatty acids, but the details of how calcium soaps alter hydrolysis are not known. In addition to bmdmg to fatty acids, calcium binds to PL. Calcium ions have been identified in the crystal structure of human PL, and calcium forms a complex with PL that readily absorbs to substrate interfaces (15). The role of the calcium bound to PL 1salso not defined, 1.4.3. Bile Salts Over100 years ago, the stimulation of fat digestion by bile acids was described (1,2,16). Since then, multiple investigations have suggested that the physlologlcal role of bile salts is to facilitate the absorption of fatty acids. Bile salts are not required for the m vitro hydrolysis of triglycerides, but under many assayconditions they promote hpolysls. Because bile saltsform mixed mlcelles
Pancreatic Lipase and Colrpase
63
with the reaction products of m viva hpolys~s, it has been suggested that bile salts remove free fatty acids, monoglycerides, and soaps from the Interface during m vitro reactions. There is also evidence to suggest that bile salts improve the binding of colipase and PL and that they prevent the denaturatron of the hpase at the oil-water interface. Perhaps the most important function of bile salts m the assay system is to inhibit PL activity. At higher concentrations, bile salts prevent the bmdmg of PL to substrate. Both binding and activity are restored by the addition of cohpase. The properties that allow colipase to restore lipolysts in the presence of bile salts are not understood, but this phenomenon distinguishes PL from other lipases and identifies PL activity m biologtcal samples. 1 4 4 Proteins The activating effect of albumin was described many years ago (2). At low concentrations (0 1 mg/l5 mL), albumm prevents denaturation of PL. As the amount of albumin is increased, Inhibition of PL occurs. Presumably, albumm bmds to the mterface and blocks the approach of PL. Other proteins may also mhibit lipolysis, and this phenomenon must be remembered when assays are done on complex biological samples. 1.4.5. Colipase As mentioned above, PL requires another pancreatic protem, cohpase, for activity in the presence of bile salts (2629) A complete discussion of this interesting protem is beyond the scope of this chapter, but several points should be made. Cohpase Interacts directly with PL and with the substrate interface. In doing so, cohpase probably anchors PL to an Interface, but mteracttons between the two proteins may have other functions as well. For Instance, interactions with cohpase may stabilize the active conformation of the enzyme. Colipase may influence the physical properttes of the substrate by changing the conformation or distribution of lipids in the interface. 1.5. Detection of Substrate Hydrolysis A number of methods have been developed to detect and quantitate hpolySE. They generally fall into one of three categories: (1) quantitation of the released fatty acids; (2) measurement of physical changes m the assay system (e.g., turbidity); and (3) detection of liberated colored or fluorescent products. A brief explanation of these different assay types, along with some examples, are described below. In Subheadings 3.1. and 3.2., two different assays are described in detail that quantitate the release of fatty acids. There are several examples of assaysbased on measuring physical changes m the system. Lipase can be measured on agar plates that contam trrbutyrin
(1,20). Activity IS estimated by determimng the area of clearmg around the sample or, alternatively, by mcludmg a pH indicator dye m the agar and measuring the area of color change caused by the released fatty acids and the subsequent decrease in pH. This method IS useful for screening a number of samples for activity or for screening colomes of yeast or bacteria for lipase production It has hmited usefulness for kmettc studies of lipase. The most widely employed method that takes advantage of physical changes in the assay system is turbidlmetry (21-23). This method is based on the clearmg of a trtolem (olive oil) emulsion caused by ongoing lipolysis. The rate of clearmg can be followed with a photometer and quantttated The assay IS less sensitive than methods that quantitate the release of fatty acids, and there are limitattons on the substratesthat can be assayedand on the concentration of the substrate used m the assaysystem. The latter hmitation may complicate kmetic analysis because the concentration of diglycerides generated by hpolys~s becomes sigmticant. Another physical method can be used that takes advantage of changes m lipid monolayers that accompany hpase bmdmg and hydrolysts; although this approach has been most often employed for phospholipase assays,it can also be used to measure hpase activity. In this assay, a monolayer of substrate is spread on an aqueous surface and the enzyme is injected mto the aqueous phase below the monolayer (24). During the course of the reaction several parameters can be momtored mcludmg surface pressure, potential, and radioactivity if radiolabeled substrates are tested. The techmque IS sensitive and requires very httle substrate. It also allows the properties of the mterface to be controlled and varied. Although the monolayer method IS useful for certain applications, it has several important limitations as a general hpase assay*it requires sophisticated mstrumentation that is not readily available; hpases can be readily denatured at oil-water interfaces; the relative substrate concentration ts low; and durmg the hpolysis of long-cham trtglycertdes, the products will remam m the mterface and can alter the physical properties of the Interface m ways that influence the rate of hpolysis. Methods that rely on the detection of liberated colored or fluorescent products are sensitive and fast and can be done with readily available equipment, such as spectrophotometers or fluortmeters (1,9,10). These methods are widely employed m clmical labs (see Table 1). They have limited use m a research laboratory because it is difficult to vary assay condrtlons and most of the chromogenic moieties are esters of phenols that are not specific for lipases, making them a poor choice for measuring hpase activity m complex biological samples containing many nonspecific esterases. The methods that quantitate the release of fatty acids have the most versatility and utility in the research laboratory The liberated fatty acids can be mea-
Pancreatrc Lipase and Colipase
65
Table 1 Commercially
Available
Pancreatic
Lipase Assays
Assay
Substrate
Form
Detection
Sigma Lipase-PSa MAS Lrpaseb WAKO LipaseC
Egg yolk diglycerides Trtolem Dilmoleoyl glyceride
Emulsion Emulsion Emulsion
Calorimetric Turbidometrrc UV
“Sigma, St LOUIS,MO *MedIcal Analytx Systems, CA ‘Wake Chenxals, Richmond, VA
sured m several ways Titration of the assay mixture after dilution with solvent or by nonaqueous titratton after a solvent extractron of the assay mixture was commonly employed m early studies of PL (1,2X26). Various indicators were used m these methods. These assays are insensitive and discontmuous, creatmg difficulties m data mterpretatton tf the reactton IS not linear. The release of radlolabeled fatty acids from trracylglycerol-contanung substrates is a sensttrve method that IS apphcable m many situations (27,28). The released fatty acids are separated from the unreacted trrglycerrdes and diglycerides by paper or thin-layer chromatography or by hquid-liquid extraction Thts IS also a dtscontmuous method that can give mtsleading results if the assay 1s not stopped while the reactron velocity 1s linear An Important hmttatron of this method is the mability to vary substrates because, for most mvestigators, the choices are restricted to commercrally available radtoacttve substrates, mainly triolem. Contmuous titratton with a pH-Stat coupled to an automatic burette and recorder 1s the most versatile method (29,30). It is indtspensable for mvestigations of PL kmettcs and allows the testing of a great variety of assay conditions. It is not as sensitive as radioactive techntques and 1s affected by factors that alter the free hydrogen ion concentratton. For instance, If triolem IS the substrate, the titration must be done at pH 8.0 or above At lower pH levels, progressrvely less long-chain fatty acid 1s titratable. The use of tributyrm m contmuous titrations overcomes this concern because >90% of butyrtc actd IS titratable above pH 6.0, and reactions can be followed at lower pH. Because of then- usefulness m the research laboratory, we will describe the radroactive and continuous tttratton methods m detail.
2. Materials All matertals and soluttons should be stored at room temperature erwise indrcated
2.1. Assay Using the pH-STAT
unless oth-
Method
1 pH meter connected with trtrator, automatrc burette, and recorder Suitable equrpment IS available from Radiometer (Copenhagen, Denmark) and consists of a
Lowe
66
2
3 4. 5
6
VIT 90 Video Titrator or TTT 80 wtth a recorder, an ABU91 autoburette, a SAM90 sample statton equipped wtth a microelectrode and propeller stirrer, a thermostatted reaction vessel (such as the E200 thermostatted sample rotor) connected to a ctrculatmg water bath heater, and a printer for recordmg results Similar equipment is avatlable from Mettler (OH) PL substrates, such as trtbutyrin, trtolein, trioctanom (see Note 1) These substrates can be obtained from vartous sources, such as Fluka (Buchs, Swttzerland) or Sigma (St. LOUIS, MO) Store at 4°C. Assay buffer A. 1 n-uWTris-HCI, pH 8 0, 0 15 A4 NaCl, 2 0 nu’r4 CaCl*, 4 mM taurodeoxycholate Store at 4’C Dounce homogenizor or bath somcator Cohpase stock solution 1 mg/mL colipase dissolved m 10 mMTrts-HCI, pH 8 0, 0 15 M NaCl Porcine cobpase can be obtained from Sigma or Boehrmger Mannhelm (Indtanapohs, IN) There is ltttle to no species specificity of colipase for PL so the pig coltpase can be used m PL assays of enzymes from other species Store m ahquots at -20°C or -70°C (avoid repeated freeze/thaw cycles) Tttrant 50 or 100 nuI4NaOH.
2.2. Assay Using the Radiometric
Method
1 Triolem (Sigma) Store at 4°C 2 Assay buffer B 30 mM Tris-HCl, pH 8 0, 1 0 mM CaCI,, 4 mA4 taurodeoxycholate Store at 4°C 3 Radiolabeled substrate- [3H] trtolem 18 4 Ci/mmol m toluene (DuPont-NEN, Boston, MA) Store at 4°C. 4 Cohpase stock solutton (see Subheading 2.1., step 5) 5 Extraction solvent. chloroform/methanol/heptane (12 5 14.0 10 0). Make fresh daily as needed (31) 6 Carbonate Solutton 50 mM sodium carbonate, pH 10 5
2.3. Colipase Assay 1 Materials needed to assay for colrpase are identical to the assays for pancreatic ltpase except for omitting the colipase stock solutton Either the pH-STAT or radiometric method can be used (see Subheading 3.3.). 2 PL stock solution’ 1 mg/mL purified pancreatic lipase dissolved m 10 mM TrisHCI, pH 8 0,O. 15 MNaCl, 1 mMCaC1,. Store altquoted at -70°C (avoid repeated freeze/thaw cycles). Porcme PL IS available from Sigma or BoehrmgerMannhelm. Human PL IS available from Sigma or CalBtochem (San Diego, CA) 3. Methods
3.7. Assay Using the pH-STAT
Method
1 Prepare the substrate soluhon by mixmg 0.5 mL of substrate, generally tributyrm, with 14 5 mL of assay buffer A (see Note 1). This prepares enough substrate for one reactton (total volume = 15 mL). MIX enough substrate solution to accommodate the number of assays that are planned The mixture can be emulsi-
Pancreatic
2
3
4
5 6
7
Lipase
and Colipase
67
fied by the use of a Dounce homogemzor (using 6-10 strokes) or, alternatively, by somcation m a bath somcator, or wrth a probe sontcator for 30 s, until a homogeneous emulsion develops. The em&ton is stable for 4-6 h, Turn on the pH-STAT and flush the burette accordmg to the manufacturer’s mstructrons. Turn on the ctrculattng water bath that mamtains the temperature of the thermostatted sample holder or reactron vessel. Generally, hpase assays are done at 37°C Add 15 mL of the substrate solutron to a 20-mL glass beaker or a simtlar size thermal Jacketed vessel (see Note 2). Place the beaker m a thermostatted sample holder, such as the E200 thermostatted sample rotor (Radiometer) Place the pH electrode, glass dehvery tip, and propeller stirrer mto the substrate solution. It 1s important to stir the solution rapidly (see Note 3) Add cohpase to the reaction For pancreatrc hpase assays, a two- to fivefold molar excess of cohpase 1s adequate (see Note 4) If the amount of PL 1s not known, then assays should be done at several different cohpase concentrattons to determine tf the cobpase added is m excess of pancreatic hpase in the sample If cohpase IS in excess, activtty should be linear with increasing amounts of the hpase added to the assay system Readjust the pH of the substrate solution to pH 8.0, with 1 NNaOH or 1 N HCI Start the titrator with automatic burette, containing the trtrant, and the recorder Add the lipase sample Up to 1 mL of sample volume can be added, and reasonable rates of achvrty can be betected with 50-100 ng of pancreatic lipase. Typically, reactions are run for 5-10 min and the mitral rate calculated from the lmear portton of the curve (see Subheading 3.4.)
3.2. Assay Using the Radiometric
Method
1 Add 2 0 pL of trtolem (1.56 umol) to 5 0 mL of assay buffer B in a glass test tube and vortex for 2 mm The concentration of triolem will be 0 3 12 mM 2. Transfer enough substrate solution for the number of assays to be done to a glass tube Allow 50 pL for each assay Add 30 uL of [3H]triolem to each ml of assay mix Somcate for 5 min m a bath somcator Alternatively, vortexmg for several minutes can be substituted for sonicatron. The emulsion will be milky whrte and will have a specific acttvtty of 3333 dpm/umol of fatty acid 3 Dilute the cohpase stock solution l-10 m assay buffer B 4. MIX 45 pL of-substrate solution with 2.5 uL ofcohpase (100 ug/mL) and wtth 2 5 pL of the hpase sample Under these conditions, 100-200 ng of PL gives a linear reactton rate over 10 mm and yreld easily detectable amounts of free fatty acids 5 Vortex the mtxture briefly and incubate at room temperature for the desired length of time, 5-10 mm is usually adequate, but longer mcubattons may be necessary tf the concentration of PL 1slow (see Note 5). Always include an assay blank where buffer is substituted for the PL solution 6 Stop the reaction by addmg 750 pL of the extraction solvent Vortex briefly, and then add 250 yL of the sodrum carbonate solution. Vortex vigorously to ensure complete mrxmg of the organic and aqueous phases.
68
Lowe
7 Centrifuge at room temperature for 5 mm at top speed m a table-top microfuge (approx 1OOOg)to break the phases (see Note 6) 8 Remove 100 pL from the top phase and count m a scmtillatlon counter
3.3. Colipase Assay Either assay can be adapted for measuring colipase. Simply add the PL standard (2 5 lrg for the pH-STAT assay method and 200 ng for the radiometric assay) to the reaction mtxture before adding the coltpase unknown. In both assays tt is Important to ensure that PL is present in excess by measurrng two different amounts of the colipase unknown. If PL 1s tn excess, the two values should be proportional to the amounts added.
3.4. Calculation
of Lipase Activity
1 Pancreatic hpase activtty levels are generally expressed as pmol of fatty acid released per mm If assaymg punfied hpase, this activity should be expressed per mg of hpase protem, m complex biological samples, the activity should be expressed per fluid volume (e g., serum or bile) or per total protem (e g , cell or tissue lysates) 2 Calculate the results m a pH-STAT assay using the following formula (see Note 7) (titrant concentrationp(mean slope or end volume/mm) amount of protein added 3 To calculate the results from the radiometric assay (pmol of fatty acid released per mm) use the following formula (see Note 8) (dpm counted)*(total volume m top phase) (3333). (volume of top phase counted)*(assay time m mm)
4. Notes The choice of substrate is dependent on the needs of the researcher, as discussed m Subheading 1. For example, whtle trtbutyrin affords the flexibdtty of assaying pancreattc PL at various pH levels, it 1shighly nonspecific and thus should be used only wtth pure enzyme preparations or samples free of esterolytic activity Conversely, whtle tnolem is specific to hpolytm activity, the assaymust be done at pH 8 0 or higher The use of agluss reaction vessel is Important: PL and coltpase bmd to the plasttc reaction vessels (e g , those provided by Radiometer) and should not be used A propeller stirrer is more efficient than a magnetic stirrer and IS preferred The molecular size of cohpase is about 20% of PL Thus, if 2 5 pg of PL is assayed, 2 5 l.tg of cohpase provides a 5-molar excess of cohpase Assays using only a smgle time point should be avotded to ensure that the reaction rate is lmear with time After centrifugation, a clear dtstmction between the upper aqueous phase and lower orgamc phase must be present; a white precipttate will form between the phases and should not be disturbed when takmg the upper phase for countmg
Pancrea t/c Llpase and Cohpase
69
7 Many pH-STAT tltrators will calculate both the slope and actlvlty 8 This equation assumes that all the free fatty actds are contained wlthm the top (aqueous) phase due to sapomficatlon by the sodmm carbonate solution However, for complete accuracy, the amount of olelc acid that partltlons to the top phase IS not lOO%, but closer to 75% This percentage can be emplncally determmed by addmg a small amount of radiolabeled olelc acid to the assay system described Subheading 3.2., add the extra&on solvent and sodmm carbonate solutions, mix, and break phases by centnfugatlon. Count 100 pL ofthe top phase, and use the total volume of the top phase to calculate the percentage of olelc actd remammg within the top (aqueous) phase compared with the total olelc acid mltlally added Use this percentage to correct for the amount of olelc acid that does not partition to the top phase used for counting
References 1. Brockerhoff, H a J , R G (1974) Llpases, m Lzpolyt~c E~zzyme~ (H a J , Brockerhoff, R.G , eds ), Academic Press, New York, pp 25-90 2 Desnuelle, P (1972) The hpases, m The Enzymes, vol VII, Academic Press, New York, pp 575-603 3 Wllhamson, T (1976) The Estimation of Pancreatic Llpase-a brief review Med Lab. Se1 33,265-279 4 Imamura S, H T , Aral T, Takao K, Misakl H,. (1989) An enzymatic method usmg 1,2-Dlglycende for pancreatic hpase test m serum Clm Chem 35, 1126-l 130 5 Yang, L -Y , Kuksls, A,, Myher, J J (1990) Lipolysls of menhaden 011 trlacylglycerols and the correspondmg fatty acid alkyl esters by pancreatic hpase m vitro a reexamination J Lzpld Research 31, 137-148 6 Savary, P (1971) The a&on of pure pig pancreatic llpase upon esters of long cham fatty acids and short cham primary alcohols Bzochzmcca Bzophyszca Acta 159,206-303 7 Brockerhoff, H (1970) Substrate speclficlty of pancreatic hpase Influence of the structure of fatty acids on the reactlvlty of esters. Bzochzm. Bzophys Acta 2 12,92-l 0 1 8 Rogalska, E , Cudrey, C , Ferrato, F and Verger, R. (1993) Stereoselectlve hydrolysis of tnglycendes by animal and mlcroblal hpases Chzralzty 5,24-30. 9 Salvayre, R., Negre, A, Radom, J , and Douste-Blazy, L (1986) Fluorometrlc Assay for Pancreatic Llpase Clan Chem 32, 1532-1536 10 Kurooka, S., Okamoto,S , and Hashlmoto, M (1977) A novel and smple colorrbetrlc assay for human serum hpase J Bzochem 81,361-369 11 Sarda, L. and Desnuelle, P (1958) Actlon de la hpase pancreatlque sur les esters en emulsion Blochlm Bzophys Acta 30,5 13-52 1 12 Benzonana, G and Desnuelle, P (1965) Etude cmetlque de l’actlon de la Ilpase pancreatlque sur des trllgycerides en emulsion Essal d’une enzymologl en mllleu heterogene Bzochlmzca Bzophyslca Acta 105, 12 l-l 36. 13 Lyktdls, A , Mouglos,V , and Arzoglou, P (1994) Pancreatic hpase assays with triglycerides as subsrate. contrlbutlon of each sequential reactlon to product formation Clm Chem 40.2053-2056
70
Lowe
14 Benzonana, G. and Desnuelle, P (1968) Actton of some effecters on the hydrolysis of long-cham triglycerides by pancreatic hpase Blochlmlca Blophyslca Acta 164,47,48
15 Wmkler, F. K , D’Arcy, A. and Hunziker, W. (1990) Structure of human pancreatic hpase Nature 343,77 l-774 16 Verger, R (1984) Pancreattc lipase, m Llpases (Borgstrom, B and Brockman, H L , eds ), Elsevier, Amsterdam, pp. 84-l 50 17 Borgstrom, B and Erlanson (1971) Pancreatic juice co-lipase. physiological importance. Blochlm Bzophys Acta 242,509-5 13 18 Borgstrom, B and Erlanson-Albertsson, C (1984) Pancreatic cohpase, m Lzpases (Borgstrom, B. and Brockman, H L , eds.), Elsevier, Amsterdam, pp 152-183 19 Erlanson-Albertsson, C ( 1992) Pancreatic colipase structural and physiological aspects Bloc&m Blophys Acta 1125, 1-7 20 Vernet, T , Ztomek, E , Recktenwald, A , Schrag, J D , de Montigny, C , Tessier, D C., Thomas, D. Y and Cygler, M. ( 1993) Cloning and expression of geotrtchum candidurn hpase II gene m yeast probing of the enzyme active site by site-directed mutagenests J BIOI Chem 268,26,2 12-26,219. 2 1 Vogel, W C and Zieve, L (1963) A raped and sensitive turbrdimetric method for serum hpase based upon differences between the hpases of normal and pancreatitis serum Clzn Chem 9, 168-172 22 Shthabr, Z. K. and Bishop, C. (1971) SimphIied turbidometric assay for lipase activity Clan. Chem 17, 1150-l 153 23 Neumann, U , Kaspar, P and Ziegenhorn, J (1984) Lrpases Pancreatic hpase Turbrdometnc method, m Enzymes 2 Esterases, Glycosldases, Lyases, Lzgases, vol 4 Methods of Enzymatzc Analyszs (Moss, D. W , ed ), Verlag Chemle, Basel, pp 26-34 24 Verger, R. (1980) Enzyme kmettcs of hpolysis. Methods Enzymol 64, 34 l-393 25 Memertz, H. (1971) Analytical procedures for free fatty acids Prog. Bzochem Pharm 6,3 17-367 26. Cherry, I. S and Crandall, L A (1932) The specificity of pancreatic hpase. its appearance m the bloood after pancreatic inJury Am J Physzol 100,266-273. 27 Kaplan, A (1970) A srmple radioactive assay for triglyceride lipase. Anal Biochem 33,2 18-225. 28 Marsh, D G and George, J M (1969) Importance of sulfhydryl groups for ltpolytic action m the isolated fat cell J Bzol. Chem 244, 138 1,1382. 29. Tietz, N. W and Reptque, E. V (1973) Proposed standard method for measurmg hpase activity m serum by contmuous samplmg techmque. Clm Chem 19, 1268-1275 30 Junge, W. (1984) Ltpases. Pancreatic ltpase. Tttrimetric method, m Enzymes 2 Esterases, Glycosldases, Lyases, Llgases, vol 4 Methods of Enzymatic Analysis (Moss, D. W., ed.), Verlag Chemte, Basel, pp 15-25. 3 1. Belfrage, P. and Vaughan, M (1969) Sample liqutd-liquid partition system for isolation of labelled oletc acid from mixture with glycerides J Lip Res lo,34 l-344
Bile Salt-Activated
Lipase
Chi-Sun Wang, Azar Dashti, and Deborah Downs 1. Introduction The presence of a redundant ltpolytic system of bile salt-activated ltpase (BAL) and pancreatic llpase results m the concerted action of these lipolytic enzymes during intestmal dietary fat digestion processes (I). Because of its wide substrate reactivity, BAL is Involved not only m the digestion of the major dietary fat, trtacylglycerol, but also other important minor dietary lipids such as fat-soluble vitamin esters and cholesterol esters. Because of the nutrttional importance of BAL, it 1sdesirable to be able to purify the enzyme for studying its functional properties Measurements of BAL activity are of Interest because they reflect various aspects of enzyme function, such as the regulation of the enzyme acttvtty by bile salt and by its substrates. In this chapter, we summarize the procedure for the assay, purification and expression of human BAL m E. coli.
2. Materials Unless otherwise stated, all chemicals were purchased from Sigma (St. Louis, MO) 2.1. Esterase
Assay
1 Stock substrate solutton (50 mMp-mtrophenyl acetate m acetomtrtle) dtssolve 906 mg ofp-mtrophenyl acetate m 100 mL of acetomtrtle This reagent IS stable for at least one year Store refrtgerated 2 Diluted substrate solutton (10 mA4p-mtrophenyl acetate m 20% acetomtnle) on
day of assay,dilute ahquotsof the stock substratesolution (5 mL) fivefold with 20 mL of dtsttlled water At the end of the day of assay discard the unused dtluted substrate solutton From
Methods E&ted
m Molecu/ar
by M H Doohttle
B/ology, and
Vol 709 Llpase and Phospholfpase K Fieue
71
0 Humana
Press
Inc , Totowa,
Protocols NJ
72
Wang et al.
3 Taurocholate (sodium salt) 20 mM dissolve 107 5 mg of taurocholate m 10 mL of dlstllled water Store refrigerated 4 Sodium phosphate buffer (0 15 M, pH 7 5) 5 Sand bath at 25°C 6 Spectrophotometer with temperature-controlled sample chamber
2.2. Lipase Assay
2 3 4.
5
6
7
8
9 10 11
Assay test tube 16 x loo-mm boroslllcate glass tubes with polypropylene screw caps (Fisher, Pittsburgh, PA) Multitube Vortexer S/P Multitube Vortexer (Amencan Scientific Products, McGaw Park, IL) Ammomum buffer. 50 mA4 NH,OH-HCl buffer, pH 8 5 Trloleoylglycerol stock solution 1s 10 mg/mL (11 3 mM) m heptane/lsopropanol, 3 7 (v/v). Store refrigerated m 50-mL ground glass stoppered tube and seal the stopper with paraffin tape to prevent evaporation Dloleoylphosphatldylcholme. stock solution IS 10 mg/mL (12 7 mM) m hexane Store refrigerated m 50-mL ground glass stoppered tube and seal the stopper with paraffin tape to prevent evaporation Glycerol tri[9,10(n)-3H]oleate (Amersham, Arlington Heights, IL) store the stock solution at a concentration of 50 pCl/mL m heptane/lsopropanol, 3.7 (v/v) Store refrigerated m 50-mL ground glass stoppered tube and seal the stopper with paraffin tape to prevent evaporation Twofold concentrated stock substrate solution to prepare the stock substrate solution place 1 mL of the stock solution of tnoleoylglycerol, 0 09 mL of dloleoylphosphatldylcholme, and 0 32 mL of glycerol trl[9,10(n)-3H]oleate ma heavy- walled 25-mL glass beaker Evaporate the solvent under a nitrogen stream m a hood Add 4 mL of ammonium buffer and emulsify the mixture using a W380 sonrcator (Heat Systems-Ultrasomcs, Farmmgdale, NY) at a settmg of 5 (50% maximum output) Emulsify the mixture for 30 s m an ice bath After coolmg, somcate the mixture for an addltlonal 30 s (see Note 1) Taurocholate solution (300 mA4 taurocholate m ammonium buffer) dissolve 1613 mg of sodium taurocholate to a final volume of 10 mL with ammonium buffer Store the solution m 1-mL ahquots at -20°C Llpase reaction-termmatlon mixture prepare chloroform/heptane/methanol stock solution at a volivol ratio of 5 4 5 6 Store at room temperature Sodium hydroxide solution (0 2 N) ScmtlSafe 30% LSC cocktail (Fisher)
2.3. Purification of BAL 2.3.1. Preparation of Whey from Human Milk 1 Human milk (store frozen m 200-250-mL aliquots) Human milk was obtamed from recrulted donors BAL of human milk 1s stable during storage at -20°C 2 Nylon membrane filter, 10 pm. Magna-R (MSI, Westboro, MA) 3 1 A4 CaCl, m dIstIlled water
73
Bile Salt-Actrvated Lipase 2 3.2. Heparin-Sepharose
AffWy Chromatography
1 Heparm-Sepharose (Pharmacia, Piscataway, NJ) packed on a Bto-Rad (Hercules, CA) glass column (1 5 x 20 cm) with a bed height of 15 cm 2 Trts-HCL buffer 50 mM, pH 8 0 3 Sodtum chloride solutlon~ 2 A4 NaCl m Tris-HCI buffer 4 Taurocholate 1 mM m Tris-HCI buffer 5 Dialysis buffer 1 mMTrrs-HCl, pH 8 0
2.3.3. Molecular Sieve Chromatography
with Sephacryl S-300 HR
1 Sephacryl S-300 HR (Pharmacia) packed on Bto-Rad glass column (2 5 x 120 cm) with bed height of 110 cm. 2 Elution buffer 50 mA4 Tris-HCI buffer (pH 8 0), 100 mM NaCI, 0.1% sodium aztde, and 1 mM taurocholate 3 Dialysis buffer 1 mMTris-HCl, pH 8 0
2.4. Expression of Human BAL in E. coli 2 4 I Transformation of 6121 (DE3) 1 TE-buffer 10 nut4 Tris-HCl and 1 mM EDTA (pH 8.0) 2 Expression vector (pET1 la-BAL) the BAL expression vector has been described previously (2,3) and IS available from our laboratory (Protein Studies Program, Oklahoma Medical Research Foundation, Oklahoma City, OK) The vector is harbored m DH5a cells. Dilute the isolated plasmid to 5 ng/pL m TE buffer 3 Expression host BL2 1(DE3, Novagen, Madison, WI) 4 S 0 C medium (Life Technologies, Grand Island, NY) 2% tryptone, 0 5% yeast extract, 10 mA4 NaCl, 2 5 mM KCl, 10 mN MgCl,, 10 mA4 MgSO,, and 20 mA4 glucose 5 ZB medium 10 g NZ Amine A, 5 g NaCl, 1000 mL drstilled water Autoclave for 30 mm Cool to 55°C then add 50 mg ampicillm Add 15 g Bacto-Agar (Difco, Detroit, MI) for makmg ZB-ampicillin plates.
2 4.2. Expression and Refoldrng of BAL from BL21 (DE3) 1 Isopropyl P-o-thiogalactopyranoside (IPTG) 100 mMprepared m distilled water Prepare immediately before using 2 Lysozyme 10 mg/mL m disttlled water. Prepare immedtately before using 3 DNase. Deoxyrrbonuclease I One vial contains 2000 U. Dissolve the DNase m 738 FL distilled water, 40 pL 4 MNaCI, 225 uL 4 5 MMgCI,. 4. TN buffer 50 mA4Trrs-HCl, pH 8 0, and 100 mMNaC1. 5 8 M urea prepare m 20 mMTris-HCI buffer, pH 8 0
3. Methods 3.1. Esterase Assay In our laboratory the assay of the esterase actlvrty of BAL IS performed using a Hewlett-Packard drode array spectrophotometer (Wtlmtngton, DE)
74
Wang et al
equipped with a Peltrer temperature control cell holder. The interface of the spectrophotometer with built-m software and an IBM- compattble personal computer allows the rapid calculation of the reaction rate. 1 Premcubate all reagents and buffer soluttons m a sand bath at 25°C (see Note 2) Place the BAL-contammg enzyme solutton in an ice bath 2 The assay IS performed m a 1 2-mL cuvet in an assay mtxture of 0 1 ml of the diluted stock substrate solution (10 mMp-mtrophenyl acetate in 20% acetomtrile), 0 1 mL taurocholate (20 mM), and an approprtate ahquot of the BALcontaining enzyme solutton (usually 2-10 pL) Mamtam the final assay volume at 1 mL by addmg an approprtate volume of 0.15 M sodmm phosphate Enzyme reactton ts mutated by the final addition of the enzyme solutton. The final concentratton ofp-mtrophenyl acetate is 1 mA4 and taurocholate 1s 2 mM. 3 The extmctton coeffictent of 11 5 x lo3 M/cm at 418 nm (4) IS utilized m the calculation of the reaction rate One unit of enzyme activity IS defined as the amount of enzyme that catalyzes the hydrolysis of 1 pmol/mm ofp-mtrophenyl acetate under this specified assay condmon (see Note 3)
3.2. Lipase Assay Perform the assay m screw-cap test tubes in duplicates or trtphcates 2 In each assay tube place 50 pL 2x concentrated substrate, 10 pL taurocholate solution, and 30 pL ammomum buffer, and last, add the enzyme solutron m a volume of 10 pL to urnlate the ltpolysts reactton (see Note 4) Prepare a set of blank tubes that contain 50 FL substrate, 10 lrL taurocholate solutron, and 40 pL ammomum buffer Place the screw caps on the test tubes and incubate the assay mtxtures m a 37’C water bath Shake at 45 oscillattons/mm for 1 h. Stop the reaction by adding 3 2 mL of the hpase termmation reaction mixture and 1.2 mL of 0 2 N NaOH solution Vortex the mixture using an S/P Multi-Tube Vortexer (American Scientific Products) at maximum speed for 2 mm Centrifuge the tubes at 9008 (JEC Centra-8R Centrifuge) for 20 mm at room temperature Transfer 1.2 mL of the upper aqueous phase (half of the total aqueous phase) to 20-mL boroslltcate glass scmttllatton vials (Fisher) containing 10 mL scmtillatlon cocktail 9. For determmatton of the total radloactivtty m the substrate, prepare vials containing 50 PL substrate, 0.6 mL 0.2 NNaOH, 0 6 mL methanol, and 10 mL scmtillatton cocktail 10 Count the radtoactivtty of the vials m a scmttllatton counter Ltpase acttvtty (pmol/mL/h) = [sample (dpm) - blank (dpm)] - specific acttvtty(dpm/pmol) x2 - sample volume (mL) The factor of 2 m the calculation is to account for only one-half of the aqueous phase of the extraction mixture being taken for counting. The final result should be divided by 0 929, which we have determined to be the fraction of oleate recovered m the upper aqueous phase of the extraction mixture.
Bile Salt-Activated
75
Lipase
3.3. Purification of Human Milk BAL Isolatron of BAL from pancreas 1s complrcated by proteolyttc drgestton durmg purrficatton. This digestron cannot be arrested with a serine protease mhibttor, such as drrsopropylfluorophosphate, since the mhtbttor also reacts with BAL (2) Thus, tt is more convenient to isolate the enzyme from human milk, m which proteolysts 1s not encountered. The procedure described here represents a modificatton of a previously reported purification procedure (51.
3.3.1. Preparatjon of Whey from Human Milk 1 Defrost 200-250 mL of frozen human milk at 4°C overnight 2 Add 5 mL of 1 M CaCl, to each 100 mL of human mtlk 3 Adjust the pH of the mtlk to 4.3 with slow dropwtse add&ton of 6 N HCl while stirrmg 4. Centrifuge the acidified human milk at 40,OOOg for 30 mm at 4°C 5 Collect the supernatant fraction and adJust to pH 8 0 with slow drop-wise addition of 4 N NaOH while sttrrmg (see Note 5) 6 Agam centrifuge the supernatant fraction at 40,OOOg and collect the supernatant fraction 7 Pass the supernatant fraction through a IO-pm nylon membrane filter wtth suction. When the membrane IS clogged, change to new membrane as necessary to allow completion of the filtermg process This processed whey 1s then used as startmg material for further purification of BAL
3.3.2. Heparin-Sepharose
Affinity Chromatography
1 Adjust the processed whey of human milk (200-250 mL) to 1 mM taurocholate by adding the appropriate amount of solid taurocholate Thts step stabilizes BAL durmg purification 2. Perform the heparm-Sepharose affnuty column chromatography at room temperature (approx 25°C) as described below 3. After prewashing the heparm-Sepharose column (bed volume 1 x 15 cm) with 200 mL of 2 MNaCl, further wash with 100 mL of taurocholate (1 mA4) tn TrisHCl buffer. 4. Apply the whey to the heparm-Sepharose column, and follow by washing with 100 mL of 1 mM taurocholate Collect the unretamed fractron in a beaker. 5. Elute BAL with a 400 mL, O-2 MNaCl gradient solution generated from 200 mL Tris-HCl buffer and 200 mL of 2 MNaCl. Collect the eluant from the column m 5-mL fractions with a fraction collector. 6. Momtor column fractions by measurement of esterase activity as described in Subheading 3.1. (usmg 5 pL of column fraction per assay) and absorbance at 280 nm A typtcal elution profile is shown m Fig. 1 7 Pool fractions contammg BAL esterase acttvtty BAL is eluted from the column wtth salt concentration at approximately 0 3 MNaCl of the gradient Usually SIX fractions are collected
Wang et al.
76
Tube
number
Fig 1 Elutlon profile of human milk BAL from heparm-Sepharose column details of the procedure are described in Subheading 3.3.2.
The
8 Dialyze the BAL-containing fraction against dialysis buffer (10 L) overmght and then lyophlhze 9 Regenerate the heparm-Sepharose column by washing with 2 MNaCl m Tns HCl buffer
3 3.3 Molecular Sieving Chromatography
with Sephacryl-300
1. Dissolve the lyophllysates from heparm-sepharose affinity chromatography generated from 400-500 mL of the processed whey (see Subheading 3.3.2.) m 3 mL of the elutlon buffer Apply to a Sephacryl S-300 HR column 2. Elute the column with 500 mL of the elution buffer at a flow rate of 18 mL/h Collect the eluate as 9-mL fractions with a fraction collector 3 Monitor the eluants with absorbance at 280 nm and also with esterase actlvlty (usmg 5 pL of column fractions per assay) A typical elutlon profile IS shown m Fig. 2. 4. Check the purity of the column fractions containing esterase activity with sodmm dodecyl-sulfate polyacrylamlde gel electrophoresls 5. Collect the fractions contammg pure BAL Discard the late fractions which contam a minor amount of BAL but contam a detectable amount of lactoferrm (molecular mass, 80,000 D) as a contaminant 6. Dialyze the purified BAL with the dlalysls buffer (10 L) at 4°C overnight and lyophlhze (see Note 6)
3.4. Expression
of human BAL in E. coli
The general approach for using T7 polymerase cloned genes IS described by Studier et al. (6)
3.4 1. Bacterial Transformation
to direct the expression
of
of BAL Express/on Construct
1 Add 1 pL of plasmld (5 ng/pL) to 20 pL of BL2 l(DE3) competent cells Gently swirl the tube to mix and then incubate the tube on Ice for 30 mm
Bile Salt-Activated
77
Llpase
Tube
number
Fig 2 Elutlon profile of human milk BAL from Sephacryl S-300 HR Partially purltied BAL from heparm-Sepharose affimty chromatography was used as starting material The detalls of the procedure are described m Subheading 3.3.3. 2. Place the tube m a 42°C water bath for 40 s to heat shock the cells, and then cool on ice for 2 mm 3. Add 80 pL of room temperature SOC media (Glbco-BRL, Galthersbulg, MD) to the tube and then Incubate m a water bath at 37’C while shaking at 225 Ipm for 1 h 4. Spread the transformation (25 and 75 PL ahquotsiplate) onto prewarmed ZB agar plates supplemented with 50 pg/mL amplclllm 5 Invert the plates and mcubate at 37°C overnight.
3 4.2. Express/on of Human BAL in E co11Inclusion Bodies Inoculate a single transformant (or approximately 20 pL of a frozen cell stock) into 100 mL of ZB medium supplemented with 50 pg/mL amplclllm Incubate the flask m a 37°C water bath, shaking at 225 rpm, overnight Inoculate 20 mL of the overnight culture into each of four flasks contammg 1 L of LB medium supplemented with 50 yglmL amplclllm with 20 mL of the overnight culture Incubate the flasks m a 37’C incubator, shaking at 180 osclllatlons/ mm, until the A600 reaches 0 6 (usually 2-2 5 h) Add 4 mL freshly prepared 100 mM isopropyl P-o-thiogalactopyranoside (0 4 mA4 final concentration) to each liter of LB culture To induce production of cloned BAL, incubate the flasks m a 37’C incubator, shaking at 225 osclllatlons/mm for 3 h Harvest the cells by centrlfugmg the cultures at 8OOOgfor 10 mm at 4°C using, for example, a JA- 10 rotor Discard the supernatants Invert the bottles and allow to dram Resuspend the pellet generated from each liter m 100 mL of TN buffer (two pellets per bottle) Add 2 mL of lysozyme to each bottle Stir the suspensions at 4°C for 10-I 5 mm Store the suspension at -20°C overnight Thaw the suspensions m a 37°C water bath and then add 1000 U of DNase to each bottle Stir the suspensions slowly at 4°C until no longer VISCOUS(usually 3MO mm)
Wang et al, 7 Pellet the mcluston bodtes by centrifuging at 13,000g for 20 mm at 4°C. Discard the supernatants then Invert the bottles and allow to dram 8 Wash the mcluston bodies (pellets) by resuspendmg each pellet m 500 mL of 1x TN, 0 05% Trtton X-100 To completely resuspend the pellets, it will be necessary to slowly stir at 4°C for 3@-60 mm. Incubate the suspenstons m a 37’C water bath for 15 mm. Pellet the mclusion bodies by centrtfugmg at 13,OOOg for 20 mm at 4’C Dtscard the supernatants then invert the bottles and allow to dram 9 Resuspend each pellet m 200 mL of lx TN, 0.05% Triton X-100 and pellet as before, ommmg the mcubation at 37°C 10. Resuspend each pellet m 100 mL of 1x TN buffer Stir at 4°C untrl the pellets are completely resuspended. Centrifuge the suspensions at 40,OOOg for 25 mm at 4°C Discard the supernatants and then invert the tubes and allow to dram 11 Resuspend the pellets in a total volume of 40 mL of 1x TN buffer and pellet as before 12 At this stage the mcluston bodtes may be stored at -20°C
3.4.2. Refolchng and Purification of BAL
2 3 4
5
6. 8
9
10 11.
Dtssolve the mcluston bodies m 20 mL of 8 Murea, 20 mMTris-HCl (pH 10 0), 1 mA4 taurocholate and 10 mM P-mercaptoethanol Carefully readJust the pH to 10 0 Slowly stir the mclusion bodies at room temperature for 15 mm, then at 4°C for 1 h. Centrifuge the solubthzed mclusion bodtes at 150,OOOgfor 40 mm at 4°C Transfer the supernatant to a clean flask. Add the supernatant to 180 mL of 8 M urea, 20 mA4 Tris-HCl, 1 mA4 taurocholate, and 10 nJ4 P-mercaptoethanol, pH 10 0 Add the supernatant dropwise to 2 L of 20 mA4 Tris-HCl, 2 nnt4 taurocholate, pH 10.0, with constant stirrmg. After all the solutton has been added to the buffer, turn the stir plate off and leave at room temperature for 20 mm Slowly stir the solutton and adJust the pH to 8.0 with HCl over a period of 30 mm Leave the solution at 4°C overnight (no stirring). Next day, measure enzyme acttvtty using the esterase assay. Concentrate the refolded BAL using a Mdhpore (Bedford, MA) concentrator equipped with a 30-K filter and 15-mm tubing Concentrate with a speed setting of 1000 to a final volume of approx 60 mL Measure activity using the esterase acttvtty assay Determine the amount of enzyme refolded by using a specific enzyme activity of 64 U/mg of pure enzyme (3) Further purtfy the refolded enzyme as described m Subheading 3.3.2. by heparm-Sepharose affinity chromatography.
4. Notes 1 It is dtfficult to standardize the emulstficatton of the hpase substrate by somcatton It IS desirable for each laboratory to determine the optimum length of time and energy output of each mdivtdual somcator for obtammg the maximum hpase acttvtty. 2. The esterase substrate, p-mtrophenyl acetate, undergoes slow nonenzymic hydrolyses in aqueous solution but 1sstable in nonaqueous acetomtrile Perform-
Bile Salt-Activated
3
4
5
6
Lipase
79
mg the assay at 25°C rather than at 37”C, retards the nonenzymtc hydrolyses of the substrate While the esterase assay IS not specific Just for BAL, BAL has a high esterasespectfic acttvtty, and the esterase assay 1s easy to perform, thus, the assay provides a rapid procedure for momtormg the progress of BAL purtticatlon Because the mtcellar btle salt can serve as fatty acid acceptor m the BAL-catalyzed hydrolysis of long-chant trtacylglycerols (6), the assay of BAL lrpase acttvtty does not tequtre the presence of serum albumin By contrast, the assay of ltpoprotein lipase requires the presence of bovine serum albumm as fatty actd acceptor (7) As soon as the precrpttates are removed from whey by centrtfugatton, It IS destrable to adJust the pH of the whey rmmedtately back to 8 0 to prevent the ttmedependent macttvatton of BAL For recovering the full acttvtty of purified BAL, It IS important to perform dtalySIS agamst a low concentratton of buffer solution prior to lyophtltzatlon
References Wang, C -H and Hartsuck, J A (1983) Bile salt-actrvated lipase A multiple function ltpolytrc enzyme Bzochzm Bzophys Acta 1166, 1-19 Baba, T , Downs, D , Jackson,K W , Tang, J , and Wang, C.-S (1991) Structure of human mtlk btle salt activated hpase Bzochemlstry 30, 500-5 10 Downs, D , Xu, Y -Y , Tang, J , and Wang, C.-S (1994) Proltne-rich domam and glycosylatton are not essentral for the enzymtc acttvtty of bile salt-acttvated hpase Kmettc studies of T-BAL, a truncated form of the enzyme, expressed m Eschertchta co11 Blochemlstry 33,7979-7985 Heller, M and Hanahan, D. J (1972) Erythrocyte membrane-bound enzymes ATPase, phosphatase and adenylate kmase m human, bovine and porcme erythrocytes Blochzm Blophys Acta 255,239-250 Wang, C -S and Johnson, K (1983) Purtficatton of human milk btle salt-acttvated hpase. Anal Blochem 133,457-46 1 Studter, F. W , Rosenberg, A H , Dunn, J J , and Dubendorff, J W (1990) Use of T7 RNA polymerase to dtrect expresston of cloned genes. Methods Enzymol 185, 60-89 Wang, C.-S , Hartsuck, J A., and Downs, D (1988) Kmettcs of acylglycerol sequenttal hydrolyses by human milk bile salt-acttvated hpase and effect of tautocholate as fatty acid acceptor Blochemlstry 27,4834-4840
Determining Lipoprotein Lipase and Hepatic Lipase Activity Using Radiolabeled Substrates Wronique Briquet-Laugier, and Mark H. Doolittle
Osnat Ben-Zeev,
1. Introduction Hepattc lipase (HL) and lipoprotein hpase (LPL) are two lrpolyttc enzymes that play an important role m the metabolism of circulatmg lrpoproteins Both enzymes catalyze the esterolysis of fatty actds present at the sn- l(3) position of trracylglycerols. HL IS functronal at the lumenal face of ltver smusolds, where tt is responsible for the hydrolysis of chylomtcrons remnants, IDL and HDL, HL ts also present m adrenal cortex and ovary, where it IS thought to contribute to HDL cholesterol uptake by these trssues (I). LPL, located at the capillary endothelmm of a number of extra-hepattc tissues, hydrolyzes cnculatmg trrglycerrde-rich lipoprotems (chylomlcrons and VLDL) (2). LPL and HL are closely related to pancreatic hpase (PL), an enzyme responsible for the hydrolyses of dietary triglycerides The three lipases comprise a gene famrly, with a high degree of ammo acid homology that suggests similar secondary and ternary patterns (3-5). Thus, the crystal structure of PL (6) has been used to establish common three dimensronal features for the entire gene family. A most obvious structural feature IS division of the lrpase molecule into two well resolved domams, Joined by a short spanning region. The NH2-termtnal domain contains the catalytic center composed of the serine triad (Ser-HtsAsp), and a “lid” covermg the entrance to the active site; this ltd presumably undergoes a conformational change upon acttvatton by ltptd substrates. The COOH-terminal domain appears to be important m substrate recogmtton and also contains heparm bmdmg sites (7-9). Despite these structural srmtlartttes, HL and LPL also display unique functional characterrstrcs; I.e., in contrast to From
Methods in Molecular Bology, Vol 109 Llpase and Phosphollpase Protocols Edlted by M H Doohttle and K Reue 0 Humana Press Inc , Totowa, NJ
82
Briquet-Laugler,
Ben-Zeev, and Doohttle
HL, LPL 1s activated by the cofactor apoC-II, and its catalytic activity IS inhlblted m high ~ornc strength solutions, such as 1 MNaCl. While LPL and HL are only marginally active against water-soluble esters, the enzymes are activated by the oil-water interface of lipid substrates. This phenomenon, long defined as “mterfaclal actlvatlon” (1U), has been m recent years attributed to conformatlonal changes such as opening of the hd structure, expansion of the hydrophobic surface around the active site, and selective stabllizatlon of the open conformation by the lipid substrate (II, 22). This chapter describes methods to assay HL and LPL activity using artificial substrates. Like natural hpoprotem substrates, artificial substrates must also present an all-water interface for enzyme actlvatlon to occur This 1s accompllshed by emulsifymg the trlolem substrate in the presence of phosphohpld Incorporation of tracer amounts of radlolabeled trlolem (glycerol tn[9,1 O(n)3H]oleate) m these preparations greatly enhances the sensitivity of the assay The release of free radlolabeled oleate by LPL and HL hydrolysis IS determined after a simple one-step liquid-liquid partition system for isolation of fatty acids free of unhydrolyzed substrate
2. Materials 2.1. Purification 2. I. 7 Materials
of Glycerol tri[9, 10(n)-3H]Olea te
1 A well-ventilated hood 2 Nitrogen tank equlped with pressure regulator 3 Chromaflex column 11 x 250 mm (Kontes, Vmeland, NJ) This column size IS adequate for the purlficatlon of 1 mmol (5 mC1) labeled trlolem 4 Glass wool 5 Siltca gel (60-200 mesh, Mallmnckrodt-Baker, St LOUIS,MO), store at room temperature 6 Florlsll (60-100 mesh, Fisher, Plttsburg, PA), store at room temperature 7 Petroleum ether (pet-ether) (Fisher); store at 4°C 8 Dlethyl ether (Fisher), store at 4OC. 9 Trlolein (Nu-Chek-Prep, Chicago, IL), store at 4°C 10. 5 mC1 Glycerol tn[9, 10(n)-3H]oleate, 5-20 Ci/mmol (Amersham, Arlington Heights, IL), store at -20°C 11. Benzene (Aldrich, Milwaukee, WI), store at room temperature
2.1.2. Solutions 1 Tnolem, 200 mg/mL m benzene. weigh desired amount of trlolem and calculate the volume according to the specn‘ic gravity (0 915 g/mL), add benzene to reach the desired concentratron For example, add 3 9 mL benzene to 1 g trlolem for a solution of 200 mg/mL, store at 4°C m a tightly closed glass vial 2 5% Dlethyl ether. 5 mL ether m 95 mL pet-ether, prepare freshly before use,
83
LPL and HL Assays 2.2. Preparation 2.2 1 Mater/a/s
of HL Substrate
1. Somcator (Branson Somfier 2.50, Danbury, CT) 2 Polypropylene tubes (12 x 75 mm). 3 Labeled trtolem: punfied Glycerol trt[9,10(n)-3H]oleate solution (approx 0 5 mCi/mL) (see Subheading 3.1.) or unpurified radtolabeled stock (5 mCt/mL) 4 Trtolem (Nu-Chek-Prep), store at 4°C 5 Benzene (Aldrich, Milwaukee, WI) 6 Lysoleclthm (L-a-lysophosphattdylcholme) (Sigma, St Louts, MO), store at -20°C 7. Chloroform (Fisher), store at room temperature. 8 Bovme serum albumin (BSA), crystallized (Pentex@ Bayer, Kankakee, IL) (see Note l), store at 4°C 9 Trts base (Sigma) 10. Stopping solution (see Subheading 2.4.1.). 11 Height-adJusting Jack (optional). 12 Sonicator encasement (optional)
2 2.2. Solutions 1 Unlabeled trtolem, 75 mg/mL m benzene (for preparation, see Subheading 2.1.3.) 2 Lysolectthm, 3 mg/mL Dtssolve powder m chloroform at 37’C; store at 4°C m a ttghtly closed glass vial Stock solution may become cloudy on storage In this case, heat solution briefly at 37°C prior to use 3 0 2 MTrts+HCl, pH 8 5; store at 4°C 4 4% BSA m 0 2 MTrts*HCl, pH 8.5; store at 4°C
2.3. Preparation of LPL Substrate 2 3.7 Preparation of LPL Substrate from a Glycerol Stock Emulsion 2 3.1 1 PREPARATION OF THE STOCK GLYCEROL EMULSION 1 Polytron homogenizer (I e , polytron PT 1020 350D, Brmkman, Switzerland) eqmped with a PTA 10s homogemzatton probe. 2 Labeled trtolem (seeSubheading 2.2.1.) 3 Unlabeled trtolem (seeSubheading 2.1.2.) 4 Lecithin (L-a-phosphattdylcholme), 100 mg/mL (Sigma); store at -20°C 5 Glycerol (spectrophotometrtc grade, anhydrous, J.T Baker, St LOUIS,MO), store at room temperature 6 Stopping solutton (see Subheading 2.4.1.). 7 Height-adJustmgJack (optional)
2.3 1.2. REPARATION OF “WORKING LPL SUBSTRATE”
FROM THE STOCK
GLYCEROL EMULSION
1 Glycerol stock emulsion (see Subheading 3.3.1.1.) 2 BSA, crystallized (Pentex) (seeNote 1); store at 4°C
84
Briquet-Laugier,
Ben-Zeev, and Doolittle
3 4 5 6
Tris base (Sigma) 0 2 M TrtsHCl, pH 8 0, store at 4°C 3% BSA m 0 2 MTris-HCl, pH 8 5, store at 4°C Source of apo-CII Rat serum is a good source of apoC-II, heat serum at 65°C for 10 mm to ehmmate endogenous hpolyttc activity Store m 0 5-l 0-mL ahquots at -20°C
2.3.2. Preparation of LPL Substrate by Sonication 2.3 2 1. MATERIALS 1 2 3 4 5 6 7 8 9 10 11
Somcator (Branson Somfier 250, Danbury, CT) Polypropylene tubes (12 x 75 mm) Labeled triolem (see Subheading 2.2.1.) Unlabeled trlolem (see Subheading 2.1.2.) Benzene (Aldrtch). Lecithm (L-a-phosphatidylcholme), 100 mg/mL (Sigma), store at -2O’C BSA, crystalhzed (Pentex) (see Note l), store at 4°C Tris-base (Sigma) Stopping solutton (see Subheading 2.4.1.) Height-adlustmgjack (optional) Sonicator encasement (optional).
2 3 2.2. SOLUTIONS 1 2 3 4
Unlabeled trtolem (see Subheading 2.1.2.) 0 2 MTris-HCl, pH 8.0, store at 4°C 10% BSA m 0 2 A4 Trts HCl, pH 8 0; store at 4°C Source of apo-CII (I e , rat serum, see Subheading 2.3.1.2.)
2.4. Assay of LPL or HL 2.4 I Preparing, Starting, and Stopping Assay Reactions 2 4.1 1 MATERIALS 1 Glass tubes 13 x 100 mm 2 Water bath set at 37°C 3 Ammoma (Mallmckrodt-Baker, St LOUIS, MO) or Sodium Barbital (Sigma) or Tris base (Sigma), for preparation of assay buffer (see Subheading 2.4.1.2.) 4 Chloroform (Fisher) 5 Methanol (Ftsher) 6. Heptane (Ftsher) 7 Reptpetter/dtspenser bottle (1 L) (i.e., Labindustries, CA) 2.4 1 2. SOLUTIONS 1 Sample dtlution buffer. low lomc strength, pH 7 O-8 0 buffer, whtch ~111 not affect the pH of the substrate solutton. For example, ammonia buffer (50 mM NH40H HCI, pH 8.0), barbital buffer (5 mA4Na barbital, pH 7 3), or Tris buffer (10 mM TrisHCl, pH 7 O-8 0), store buffers at 4°C.
LPL and HL Assays
85
2 Stopping solutron methanol-chloroform-heptane 1 41/l 2511 (v/v/v). MIX well and store m a trghtly closed glass bottle at room temperature
2.4.2. Extract/on of Free Fatty Acids 2 4 2 1 MATERIALS 1 Reprpetteridtspenser bottle (0 5 L) (I e , Labmdustrres) 2 Vortex, preferably adapted wrth platform for multiple tubes (Kraft Apparatus, Mmeola, NY) 3. Centrifuge wrth adaptors for 13 x 100 mm glass tubes. 4 Bortc acid (Sigma) 5 Potassmm carbonate K&O, (Frsher). 6 Sodmm hydroxide NaOH (Srgma). 7. Scmtrllatron vials (glass, 20 mL) 8. Scmtrllatton lrqmd smtable for counting aqueous soluttons (1 e , Ecohte, ICN, Berkeley, CA) 9 Ltqmd scmtrllatron counter
2.42 2 SOLUTIONS 1, 0.1 M borate-potassium carbonate buffer, pH 10 5 Dissolve boric actd and potassmm carbonate The startmg pH is acidic, therefore It ts suggested to adJust pH by addmon of soltd NaOH, or wrth a htghly conncentrated NaOH solutron (10 M), store at room temperature.
3. Methods 3.1. Purification
of Glycerol tri[9, 10(n)-3H]O/eate
Purtficatlon of glycerol trr[9, 10(n)-3H]oleate ts carried out to remove traces of labeled free fatty acids present m these commercial preparations. The purtfication becomes necessary if the background values (radioactivity of samples assayed m the absence of enzyme) are unacceptably high relative to the actrvrty of the samples to be assayed. Generally, we recommend purification of the labeled stock if the radtoactrvity of the assayed samples 1s less than twice the radroactrvrty of the background. The procedure 1s carried out for the enttre stock of glycerol trr[9, 10(n)-3H]oleate (usually 5 mCt) and, tf stored tightly closed at
-20°C the purtfied material matntamslow background values for up to one month The purtficatlon procedure must be cart-tedout m a ventilated hood becauseof the extreme volatrhty of the organic liqurds mvolved. It IS also important to line the hood with adsorbent pads that should be drscarded wtth radtoacttve waste at the end of the operation. The procedure IScarried out at room temperature. 1 To 5 mCi glycerol trr[9,1 O(n)-3H]oleate, add 0 25 mL unlabeled trrolem (see Subheading 2.1.2.). 2 Dry mrxture under a gentle stream of nitrogen to evaporate orgamc solvents (see Note 2)
86
Briquet-Laugier,
Ben-Zeev,
and Doohttle
3 While drying the tnolem, assemble the column 4 5 6 7 8 9 10.
Insert a plug of glass wool, add pet-ether and check for leaks F111column with pet-ether Slowly add 2 g Slhca gel When settled, add 0 2 g Florlsll Resuspend dried trlolem m 2 mL pet-ether Remove duplicate ahquots of 1 (JL mto vials filled with scmtlllatlon fluid and set aside to calculate the purlficatlon yield Apply mixture to column, and rinse the gel with 50 mL pet-ether Elute the tnolem with 100 mL. of 5% dlethyl ether, by collectmg fractions of approx 10 mL The collection can be done manually, there 1sno need for a fraction collector Measure radloactlvlty of first five fractions by counting 5-pL ahquots m scmtlllatlon fluld Pool the two fractions contammg the highest amount of radloactlvlty, dry solvent under nitrogen, and resuspend the tnolem m 10 mL benzene Measure radloactivlty and calculate the yield based on the mltlal amount of radloactmty applied (see step 6)
3.2. Preparation
of the HL Substrate
The procedure described below ts adapted from the protocol estabhshed by Twu et al. (13). In this method, the substrate 1s prepared in batches of 3 mL using 12 x 75 mm tubes, each batch sufficient for 30 reactions. We do not recommend changing the tube size or volume of substrate, smce it will affect the efficiency of sontcatlon In a 12 x 75 mm polypropylene tube, mix 100 yL trlolem (75 mg/mL), 100 pL lysoleclthm, and either 100 pL of purified glycerol tri[9,1 O-3H]oleate (see Subheading 3.1.), or 10 pL of the unpurified, commercial stock Dry under a gentle stream of nitrogen to evaporate organic solvent (see Note 2) Add 2 4 mL of 0.2 M Trls HCl, pH 8 5, and 0 1 mL of 4% BSA. Clamp the tube securely to a stand near the somcator, adjust the position of the tube so that the somcator tip reaches mto about a third of the level of the solution Immerse the tube mto a beaker filled with ice-water This 1seasily accomplished if the beaker IS placed on the platform of an adapting Jack, adJust the height of the beaker so that the ice-water level reaches the top of the trlolem solution Somcate at 1 g/force for 8 mm, pulsing the ultrasonic energy at setting 50% (I e , 50% duration of the pulse/s) The pulsing mode, together with the ice water bath, helps prevent heating of the solution during sonclatlon In the absence of an automated pulse cycle control, sonicate manually m on/off cycles of 30 s for a total of 8 mm In either case, the net somcatlon time will be 4 mm After somcatlon, remove the ice-water bath and lower the position of the tube, allowmg any remaining drops on the somcator probe to drip mto the solution. The emulsion has an opaque, milky appearance. Place the substrate on ice, and clean sonicator probe with stopping solution (see Subheading
2.4.1.)
Add to the substrate 0 5 mL of 4% BSA. Mix well and store substrate on ice if used on the same day, for overnight storage, the substrate can be frozen at -20°C
87
LPL and HL Assays 3.3. Preparation
of the LPL Substrate
The LPL substrate may be prepared in two manners In one procedure, an emulslon of radlolabeled trlolem, unlabeled tnolem and leclthm IS prepared m glycerol, this stock glycerol emulsion may be preserved for up to a month wlthout appreciable detenoratlon. From this stock, “workmg solutions” are prepared on the day of the assay, without the need to re-emuIs@ the substrate (24). In a second procedure, emulsions of radlolabeled tnolem, unlabeled tnolem and leclthm are prepared by somcatlon on the day of the assay, slmllar to the HL substrate described above.
3 3. I Preparation of LPL Substrate from a Glycerol Stock Emulsion 3 3 1.1 PREPARATION OF THE STOCK GLYCEROL EMULSION Unlike the HL substrate, which 1s prepared m fixed batches of 3 mL, the volume of the stock glycerol emulsion for the LPL substrate may be varied Using a 10 mm (PTA 10s) homogemzatlon probe, stock solutions ranging from 2 mL (sufficient for 240 assays) to 10 mL (1200 assays) can be prepared (see Table 1). The amount of stock substrate should depend on the estimated number of samples predicted to be assayed during a month. We do not recommend storage of the stock for periods longer than a month, because nonenzymatlc hydrolysis of the tnolem results m unacceptably high background radloactlvlty levels Accordmg to Table 1, mix the desired amounts of labeled tnolem, unlabeled tnolem, and lecithin, m a 20-mL glass scmtlllatlon vlal (see Note 3) Dry under a gentle stream of nitrogen until evaporation of the orgamc solvent 1s completed (see Note 2) Place the vial on a balance and add dropwlse the glycerol, to the weight specltied m Table 1 Record the weight of the glycerol added; this parameter ~111be needed to calculate the specific radloactlvlty ofthe trlolem substrate (see Subheading 3.5.1.2.) Fasten ~~1 to a stand close to the polytron homogemzer with the aid of clamps, and adjust the posItIon and height so that the polytron probe reaches about halfway mto the solution Immerse the vial mto an Ice-water bath. Homogemze for 5 mm at a settmg of 4 5 (this IS an mtermedlate speed for the Polytron PT1020 350D). When done, remove the ice-water bath, lower the vial and allow drops
remammg on the probe to dnp mto the emulsion The em&Ion
IS mltlally opaque, but
clarifies within a few hours, store at room temperature for 20-30 d (see Note 4) Clean polytron probe with stoppmg solution (see Subheading 2.4.1.)
3.3 1.2 PREPARATION OF “WORKING LPL SUBSTRATE” FROM THE GLYCEROL STOCK The “workmg substrate” 1s freshly prepared on the day of use. Determine the amount of substrate to be prepared accordmg to the number of assays needed. Refer to Table 2 for the volume of the mgredlents needed to prepare the determined amount of substrate.
88
Briquet-Laugier,
Table 1 LPL Substrate:
Preparation
Labeled TOa Not purlfiedh Purified’
of a Glycerol
Stock
Ben-Zeev, and Doohttle Emulsion
Unlabeled TOd
Leclthm”
Glycerol
mL
gram
072 108 144 180 216 252 288 324 360
2 50 3 75 5 00 6 25 7 50 8 75 1000 11 25 12 50
mL
mL
mL
0 10 0 15 020 0 25 0 30 0 35 0 40 0 45 0 50
1.0 15 20 25 30 35 40 45 50
0.6 09 1.2 15 18 21 24 27 30
0 0 0 0 0 0 0 0 0
Approx no of assays
240 360 480 600 720 840 960 1080 1200
OTO radlolabeled trlolem Refer to the appropriate column, dependmg whether stock was purltied or not “Nonpurified labeled TO Glycerol trl[9,10(n)-3H]oleate, 5 mCl/mL ‘Purified labeled tnolem, benzene solution, = 0 5 mCl/mL dUnlabeled tlolem, benzene solution 200 mg/mL “L-a-lecithin, hexane solution, 100 mg/mL 1 MIX the required amounts of 0 2 A4Trls HCl buffer, pH 8 0, and 3% BSA 2 Add the correspondmg amount of the glycerol stock (seeNote 5). MIX well 3 Add the required amount of apo C-II or serum MIX solution again and store on Ice
3.3 2. Preparation of LPL Substrate by Sonication 1 In a 12 x 75 mm polypropylene tube, mix 75 pL trlolem (200 mg/mL) and 10 pL leclthm (seeNote 6). Add either 100PL of purified glycerol trQ9,l O(n)-3H]oleate, or, if purification was omitted, 10 PL of the orlgmal radloactlve stock 2. Dry under a gentle streamof nitrogen to evaporate organic solvents (seeNote 2) 3 Add22mLO2MTr~s,pH80,and0.1mLof10%BSA 4. Somcate the substrateasdescribed m Subheading 3.2., steps 4-S 5 Add 0 45 mL of 10% BSA and 0 25 mL serum.Store substrateon ice (seeNote 7)
3.4. Assay of LPL and HL The assay of LPL and HL consists of first preparing dllutlons of the enzyme sample (purified hpases, tissue or cell lysates, postheparm serum, tissue culture media) m a total volume of 100 pL; 100 PL of the substrate 1sthen added, the solution mixed and finally incubated at 37OCfor 10-60 mm, depending on the acttvlty of the sample. The reaction 1s stopped, and the fatty acids are extracted free of unhydrolyzed substrate and counted It 1salways advisable to
LPL and HL Assays Table 2 LPL Substrate: from a Glycerol
89 Preparation of “Working Stock Emulsion
Solutions”
Number of assays Tris buffer” BSAb Glycerol stockC Serum mL mL mL mL 12 0.25 075 01 01 24 050 1 50 0.2 02 36 48 60 72 84 96 108 120
0.75
1 00 125 1.50 1.75 2.00 2.25 250
2.25 3.00 3 75 450 5 25 6.00 675 7.50
03 0.4 05 06 07 08 0.9
03 04 05 06 07 08 09
10
10
“0 2 A4Trls HCl, pH 8 0
h3%RSA rn0 2 M Trls-HCI,pH 8.0 ‘Radiolabeledtrlolememulsion,preparedaccordmgto Table 1
utilize different enzyme concentrattons at several time points to determine the linear range for the assay system. Since the LPL or HL substrate is prepared m a strong buffer (0.2 MTrrsHCI, pH 8.0-8.5), the buffer used to dilute the samples to 100 PL should be a low tome strength buffer, pH 7.0-8.0, that will not affect the pH of the assay (for examples of suitable buffers, see Subheading 2.4.1.2.). For HL assays, addrtron of NaCl to a final concentratron of 1 M in the 100 PL sample volume 1s recommended. This high tonic strength will inhibit LPL activity while slightly increasing HL acttvtty; indeed, salt sensitivity has been utilized to dtstmgutsh between the actrvitres of these two enzymes in a mixed populatton, i.e., postheparm plasma (see Table 3, comparmg the recommended assay condtttons of HL vs LPL) Detergents are htghly inhibitory in both assaysand should be used wrth caution. Then use becomes unavoidable when LPL or HL need to be extracted from cells or tissues; in these cases,use the smallest concentratton of detergent necessary for extraction, and assay the smallest amounts of the enzyme sample that will yield acceptable activity levels. For example, tf 0.2% deoxychohc acid 1sused m the extraction buffer, dilute the sample at least 20fold m the final assaymixture; tf 0.125% Trlton X-100 1sused in the extraction buffer, dilute the sample at least 50-fold. 3.4.7 Preparing, Starting, and Stoppmg Assay Reactions 1. Place rack with desired number of glass assaytubes (13 x 100mm) into an ice-water bath
Briquet-Laugler,
90
Ben-Zeev, and Doolittle
2 Add buffer and enzyme solutton to a total volume of 100 pL (see Note 8) The amount of enzyme solution to be added depends on the acttvtty of the sample The concentratton has to be htgh enough to enable accurate measurement of acttvny over background, yet low enough to ensure that the measured acttvtty IS wtthm the lmear range of the assay. When assaymg tissue homogenates or cell lysates, It IS often hard to achieve lmearity across a broad range of sample concentratrons for a variety of reasons (15-17) In thus case, the assay 1s most lmear when drlutmg the samples 50- to loo-fold m the sample volume, I e , add l-2 pL of the homogenate to 98-99 pL of low-tonic strength buffer before addmg substrate 3 For background measurements (enzyme blanks), add only 100 pL buffer (see Note 9) 4 Add 100 yl substrate, and vortex tubes brtefly 5 Incubate tubes m a 37°C water bath for a suitable perrod of trme (see Note 10). 5 Stop the reactton, remove the tubes from the water bath and add 3 25 mL stoppmg solutron (see Subheading 2.4.1.) For the processmg of many samples, thts 1s facthtated by the use of a repettttve dispenser (see Note 11)
3.4 2 Extract/on of Free Fatty Acids 1 Add 1 mL of 0 1 M potassmm carbonate-borate buffer, pH 10 5 (lake addmon of the stoppmg solutron, this step IS greatly facthtated by the use of a repetmve dtspenser ) 2 Vortex tubes vrgorously for I5 s, the use of a multt-tube vortex apparatus 1s highly recommended 3 Centrifuge tubes at 50~1OOOg for 10 mm at room temperature. After centrrfugatton, the upper and lower phases should be clear, and the Interface delmeated by a well-packed, whtte precrprtate of denatured protem If the upper phase IS cloudy, recentrlfugatton IS recommended 4 Carefully remove 1 mL of upper phase mto countmg vrals wtthout touching the whrte interface 5 Add 10 mL scmtrllatton hqutd, mix, and measure radtoacttvny m a scmttllatton counter
3.5. Converting
Radioactivity
into Milliunits
Activity
One mrllmmt (mu) of activity IS defined as one nanomole free fatty acrd (FFA) hydrolyzed per minute (nmol FFA/mm). This actrvtty roughly represents 1 ng of hpase mass. One unit (U) IS defined as the amount of hpase hydrolyzing one mlcromole FFA per hour (urn01 FFA/h) Generally, mu are used for reportmg actrvny levels m brologrcal samples, and U reserved for concentrated enzyme preparatrons. To convert radroactivrty to nmole FFA generated by enzymattc hydrolysis, a number of parameters need to be taken mto account, mcludmg the spectfic radroactrvrty of the trrolem substrate, the time of assay and a number of correction factors, as descrrbed below (see Subheading 3.5.2.)
3.5 1. Determining Specific Radioactwity of the Triolein Substrate The specttic radtoacttvtty (sp. rad.) of the substrate IS calculated for each new substrate batch, and represents the radtoacttvtty (cpm) per nmol trrolem.
LPL and HL Assays Table 3 Comparison Lipase
91
of the Assay Conditions
pH optimum of assay Effect of molar NaCl Reqmrement for a FFA acceptor Requtrement for protem cofactor
for Hepatic
Lipase
and Lipoprotein
Hepattc ltpase
Lipoprotem lipase
8 Shght strmulatron Yes No
8.5 Inhtbttton Yes Apo C-II
3 5 1 .l MEASURING TOTAL RADIOACTIVITY OF THE HL SUBSTRATE OR THE LPL SUBSTRATE
PREPARED BY SONCATION
1 The substrate emulsrons prepared by sontcatton are not vtscous Therefore, rt IS easy to remove 2-5 uL mto a counting vial, add 10 mL sctnttllatton fluid, and count radtoacttvtty 2 Convert the results mto cpm/mL and multiply by the total volume of the substrate (usually 3 mL) We recommend to use the average value of duplicate samples 3 5 1.2 MEASURING TOTAL RADIOACTIVITY OF THE LPL GLYCEROL STOCK
If the LPL substrate is prepared via the glycerol stock method, the specific radioactivity of the stock IS calculated Thus elrmmates the need to measure specific radtoacttvity of each new “working substrate.” However, as the glycerol stock IS very viscous and accurate removal of known volumes 1s rmposstble, small allquots of a known weight are used for the determmation of radloactivtty. Prepare upper phase by adding 3 25 mL stoppmg solutron (see Subheading 2.4.1.) and 1 mL 0 1 Mpotassium carbonate-borate buffer, pH 10.5, to each of three assay tubes (13 x 100 mm). Vortex and centrifuge for 5 mm at 5008 Set tubes aside, the upper phase ~111 be used in step 4 below On an analytical balance, tare three countmg vials Add one drop of the glycerol stock rnto each vial, and record the weight of each drop After weighing, add 1 mL of upper phase (prepared m step 1) to each of the counting vials contammg the glycerol drops MIX well Add 10 mL scmttllatton fluid and count radroactrvity Calculate the ratio cpm/g of glycerol stock for each sample Average the results Multiply the value obtained by the total wetght of the glycerol (seeSubheading 3.3.1.1., step 3) to obtain radroactrvtty of the total stock 3.5 1.3. DETERMINING SPECIFIC RADIOACTIVITY OF THE TRIOLEIN SUBSTRATE (SP RAD ) 1 Calculate the total amount of nmol trtolem m the substrate, considering the mol wt of trroleoylglycerol (885 64 g/mole) For example, m a 3 mL batch of HL substrate that contains 7 5 mg trrolem (see Subheading 3.2.), there are
92
Briquet-Laugier,
Ben-Zeev, and Doolittle
(7 5 x lo6 ng)/(885 64 ng/nmol) = 8 468 nmol In the same manner, m a 3 mL batch of LPL substrate prepared by sonication (see Subheading 3.3.2.), there are:
(15 x lo6 ng)/(885 64 ng/nmol) = 16,936 nmol 2. Dtvtde the total radtoacttvtty of the substrate by the total nmol trtolem The result IS the specific radloactlvlty (sp rad ), expressed m cpmlnmol (see Note 12)
3.5 2. Determining the Converslon
Factor (U)
The converston from radloacttvtty to nmol/mm has to take into account the fact that there are three FFA m the triolein molecule, and that only one out of 2 45 mL of upper phase was counted. In addmon, not all FFA are extracted into the upper phase, m fact, the effclency of extractton 1sonly 76% All these parameters, including sp.rad. of the trrolem substrate and assaytnne, are used to calculate a conversion factor K. K takes mto account the followmg:
sp rad. = determined for each substrate batch (see Subheading 3.5.1.) t = assay time 3 = converston factor from nmol trtolem to nmol FFA 2.45 = correction for total volume of upper phase (only 1 mL was counted) 0.76 = correction for efficiency of FFA extracted mto the upper phase. Based on these factors, K IS calculated using the followmg equation. K = (3 x 2 45)l(t x sp rad x 0 76) = 9 67/(t x sp. rad )
3.5.3 Converting Radioactivity into Milliunits 1 Determine the enzymatic hydrolysis (net cpm) of the assay samples by subtractmg the blank values (trtolein hydrolyses m the absence of enzyme sample). 2 Calculate nmol trrolem hydrolyzed/mm (mu)* mu = net cpm x K 3 To convert mu into units (ymol/h) U = mu x 60 mm/h x 1,000 nmo/pmol = mu x 60,000 4. Notes 1 Not all BSA products give satrsfactory results In our hands, thts particular Pentex@ BSA brand works well
2 Do not expect complete evaporatton of the solution, after the organic solvents evaporate, the trlolem remains as an 011at the bottom of the tube
3 We suggest to remove the lecithin with a tuberculin syrmge through the rubber cap of the stock solution, wlthout opening the cap This avolds evaporation of the solvent through repeated openings of the vial
LPL and HL Assays 4 Some nonenzymatic hydrolysis of this stock substrate occurs over ttme, resultmg m increased background radioactivity m the assay samples This may Interfere with assays of samples with low activity, if this IS a problem, we recommend to prepare smaller batches more frequently, or prepare LPL substrate by somcation (see Subheading 3.3.2.). 5 To aspirate the glycerol, cut the narrow edge of the tip to widen the opening; aspirate and dispense solution slowly, and rinse the tip a few times with the substrate mixture 6 As mentioned in Note 2, to prevent evaporation of the solvent, we do not recommend to open the rubber cap of the lecithin stock veal As removal of 10 pL with a tuberculm syringe is not accurate, we recommend to remove with the syrmge a small amount (30-50) uL of lecithm mto a glass tube, and accurately aspirate the 10 uL ahquot from this sample. Dtscard the remaining sample, do not return it to the stock vial. 7 We do not recommend to store the substrate prepared m this manner for prolonged periods of time; repeated freezing and thawing cycles might cause deterioration of the apo C-II m the serum. If substrate needs to be prepared m advance and frozen, we recommend not to add the serum prior to freezing, but to add it to the thawed substrate on the day of the experiment 8. We recommend adding first the buffer, which is usually a larger volume, followed by the enzyme solution 9. It IS Important to include “blank” assays because of the nonenzymatic hydrolysis of the substrate. This background activity will be substracted from the total activity to calculate enzymatic lipolysis 10. The assay tnne has to be withm a linear range of activity/mm, however we do not recommend assaying for longer than 60 mm even when low activity is expected, prolonged Incubations increase the lability of the enzyme and the nonenzymatic hydrolysis of the substrate 11 If needed, this IS a convenient step in the assay procedure to pause, however, avoid delays longer than l-2 h 12 Because of its high radiospecific activity, the contribution of the radiolabeled triolem to the total nmol of trrolen m the substrate IS negligible and can be disregarded
References 1 Bensadoun, A. and Berryman, D E. (1996) Genetics and molecular biology of hepatic hpase. Curr Open Llpldol 7, 77-81 2 Bensadoun, A (1991) Lipoprotein Lipase Annu Rev Nutr 11,2 17-237. 3 Kirchgessner, T. G., Svenson, K. L., Lusts, A J , and Schotz, M C. (1987) The sequence of cDNA encoding hpoprotem hpase J BIOI Chem 262, 8463-8466 4 Derewenda, Z S and Cambtllau, C. (1991) Effects of gene mutations m ltpoprotern hpase as interpreted by a molecular model of pancreatic lipase J Bzol Chem 266,23,112-23,119 5 Hide, W A , Chan, L , and LI, W -H. (1992) Structure and evolution of the hpase superfamily J Lzpld Res 33, 167-178.
94
Brquet-Laugier,
Ben-Zeev, and Doohttle
6 Wmkler, F K , d’Arcy, A , and Hunztker, W (1990) Structure of human pancreattc hpase Nature 343, 771-774 7 Wang, H , Davis, R C , Nlkazy, J , Seebart, K E , and Schotz, M C (199 1) Domam exchange Characterlzatron of a chimertc hpase of hepattc hpase and hpoprotem hpase Proc Nut1 Acad SCI 88, 11,290-l 1,294 8 Davis, R C , Wong, H , Ntkazy, J , Wang, K , Han, Q , and Schotz, M C (1992) Chimeras of hepattc bpase and lrpoprotem lrpase J Blol Chem 261, 21,49921,504 9 Wong, H , Davis, R C , Thuren, T , Goers, J W , Nrkazy, J , Wane, M., and Schotz, M. C (1994) Ltpoprotem hpase domam function J Bzol Chem 269, 10,319-10,323 10 Brockman, H L (1984) General features of hpolysts, m. Llpases (Borgstrom, B and Brockman, H L , ed ), Elsevter Sctence, Amsterdam, pp l-46 11 Brzozowskr, A M , Derewenda, U , Derewenda, Z S , Dodson, G G , Lawson, D M , Turkenburg, J P , Bjorkhng, F , Huge-Jensen, B , Patkar, S A , and Thrm, L (1990) A model for mterfaclal actlvatton m hpases from the structure of a fungal lipase-mhtbttor complex Nature 351,49 1494 12 Derewenda, U , Swenson, L , Wet, Y , Green, R , Kobos, P M , Joerger, R , Haas, M , and Derewenda, Z S (1994) Conformattonal lab&y of lipases observed m the absence of an oil-water interface chrystallographtc studtes of enzymes from the fungi Humlcola langulnosa and Rhlzopus delemar J Llpld Res 35,524-534 13 Twu, J S , Garfinkel, A S , and Schotz, M. C (1984) Hepattc lipase* purification and charactertzation Bzochzm Bzophys Acta 792,330-337 14 Nilsson-Ehle, P and Schotz, M C (1976) A stable, radtoacttve substrate emulsion for assay of hpoprotem hpase J Lzpld Res 17, 536-541 15. Vanmer, C , Ettenne, J , and Atlhaud, G (1986) Intracellular locahzation of hpoprotten hpase m adipose cells. Brochzm Bzophys Actu 875, 344-354 16 Vanmer, C , Deslex, S , Pradmes-Ftgueres, A , and Atlhaud, G (1989) Blosynthesis of hpoprotem hpase m cultured mouse adtpocytes I Characterlzatton of a specific antrbody and relattonshtps between the mtracellular and secreted pools of the enzyme J Bzol Chem 264, 13,199-13,205 17 Pradmes-Frgueres, A , Vanmer, C , and Atlhaud, G (1990) Ltpoprotem hpase stored m adtpocytes and muscle cells 1s a cryptic enzyme J Lzpzd Res 31, 1467-1476
10 Lysosomal
Acid Lipase
Assay and Purificat/on Martin Merkel, Anne-Christine and Detlev Ameis
Tilkorn, Heiner Greten,
introduction Lysosomal acid lipase (LAL, E.C 3 1 1 13) IS a hydrolase mvolved m the mtl acellular degradation of lipoproteins LAL was first described m fibroblasts (I), and since then found m all analyzed tissues with the exception of erythrocytes (2,3). The enzyme hydrolyzes cholesterol esters and trlacylglycerols endocytosed by the cells and transferred to the lysosomal pathway. Cholesterol released by this reaction equlhbrates with the cytoplasmlc cholesterol pool and contrlbutes to the regulation of mtracellular hpld metabolism by three mechamsms’ (1) free cholesterol reduces the actlvlty of 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA)-reductase, the key enzyme of cholesterol synthesis (4); (2) cholesterol activates its own esterlficatlon by acyl-CoA-cholesterol acyltransferase (5); and (3) cholesterol downregulates low-density llpoprotem receptor expression, which subsequently reduces cellular cholesterol uptake (6) Purlficatlon of LAL from various tissue sources has been documented In particular, human fibroblast (7) and liver (8) LAL were purified, and full-length cDNA clones were subsequently Isolated and analyzed (8,9). Two rare autosoma1 recessive disorders of metabohsm, Wolman’s disease (WD) and cholesterol ester storage disease (CESD), are caused by a deficiency of LAL (3) Whereas WD patients succumb to the disease at 6-12 mo of age, CESD often follows a bemgn clinical course. Both disorders are characterized by an extensive mtracellular storage of cholesterol esters and tnglycendes. Molecular genetic analyses have recently identified various mutations of LAL m WD and 1.
From
Methods Edlted by
in Molecular Bology, l/o/ 109 Llpase M H Doohttle and K Reue 0 Humana
95
and Phospholtpase Protocols Press Inc , Totowa, NJ
96
Merkel et al.
CESD pattents (10-12). A parttal deficrency of LAL activity has been proposed to lead to an accumulatton of cholesterol esters in vascular endothehal or smooth muscle cells. Furthermore, someCESD patients develop a premature atheroscleroSIS,suggesting a lmk between reduced LAL activity and atherosclerotic lessons (13). Clmical studieshave shown decreasedLAL actrvity m leukocytes of patients with premature coronary heart diseaseand cerebrovascular atherosclerosis(14,lS). However, the question of whether LAL represents an Independent risk factor for the development of premature atherosclerosrshas not been resolved conclusively A reproducible and sensmve assay for LAL activity m histologrcal spectmens, leukocytes, and cultured cells provtdes the basis not only for the dragnoSISof WD and CESD but also for clmrcal studies mvestrgating the relatronshlp between atherosclerosrs and LAL activity. Various methods with different substrate preparations have been described in the past. Radloactrvely labeled cholesterol esters or trlacylglycerols are wtdely used Synthetic fluorescent substrates such as 4-methylumbelhferyl oleate and p-mtrophenyl ester are avarlable, but they are also hydrolyzed by other esterasesand thus suffer from a lack of spectficrty. With these substrates, relatively high residual lipolyttc activities are found in ttssues from WD or CESD patients. A novel synthetic substrate, pyrene methyl laureate, seems to overcome these disadvantages and may prove useful for the screening of larger patrent groups (16). The amount of LAL released from lysosomes IS dependent on the detergent used to solublhze lysosomes (7J 7). Since substrates are typically prepared as microemulsions, phosphohprds and brie acids also influence enzyme activity. Other effects on enzyme activity are reviewed m Assmann and Seedorf (3). We descrrbe two enzyme assaysto measure LAL activity, using the phystologrcal substrates trracylglycerol and cholesterol oleate. Both assaysare labor intensive and not surted for automated procedures. Chromatographrc purttication of triacylglycerol and substrate preparation (I$), assay conditrons, and organic extraction of released fatty acrds are procedures adapted from assays for lrpoprotem lipase (18-20). The cholesterol oleate assay 1sbased on published methods (21,22) with modifications. Both assaysare htghly specttic and sensitive for LAL (see Fig. 1). Less than 0 02 mU of enzyme (about 5 ng purrfied protein) can reliably be detected. The triacylglycerol and cholesterol oleate assays are virtually linear up to 1 mU (250 ng protein) and 0 4 mu, respectively. As lrttle as l-2 mg of tissue or isolated lymphocytes from 10 mL of venous blood are sufficient for establishing the diagnosis of LAL deficiency. Detarled studies of the brochemlcal properties of LAL were posstble after purification of a small amount of apparently homogeneous enzyme from human liver (8). Enzyme kmetrcs obtamed with purified LAL are summarized m Fig. 2. Although the isolation of recombinant LAL from tissue culture medrum (see Chapter 18) or lmmunologtcal purrficatton methods are suitable for most pur-
97
Lysosomal Acid Lipase
r
ag E$ ga u2% r% 3s 3;
2-
0.7%1.3%
0.6%1.0%
1.1%1.6%
GM1606A
GM00663
GM06114 WD
2.6 GM03111 CESD
GM01566C I-Cdl
CCD-27
normal
Fig 1 Specifictty of the assays for lysosomal actd lipase. The hydrolyttc acttvtty of cell extracts of different cell lines was measured wtth triacylglycerol and cholesterol oleate as substrates GM 06144 and GM 01606A, Wolman’s dtsease, GM 00863 and GM 03 111, cholesterol ester storage dtsease (CESD), GM 01586C, I cell dtsease, CCD-27, normal skm fibroblasts Cell lmes were obtained from the Human Genetic Mutant Cell Repository (Camden, NJ) and from ATCC (Rockvtlle, MD) Numbers on top of the bars represent specific acttvity in percent of controls for each substrate One milhumt is equtvalent to the release of 1 nmol free fatty acid/mm For each cell type, the left-hand histogram is LAL activity measured using the triolein substrate, and the right-hand htstogram is acttvtty measured using the cholesterol oleate substrate poses, purrfication of unmodified enzyme from human ttssues may be necessary m special situations. We therefore describe a brochemtcal purtficatton strategy for L,AL from human liver. The first three steps involve extraction at pH 5.0, concanavalin A sepharose, and carboxymethyl sepharose chromatography; they are based on a partral purrficatron procedure described earlier (23) These steps are followed by chromatography usmg Phenyl-Superose, Mono S, and Superose- 12 gel filtratton.
2. Materials Unless stated otherwrse, chemtcals were purchased from Sigma (St. Louts, MO) or Merck (Darmstadt, Germany) at the highest available quality
2.1. Sample Preparation 1 Tissue homogenizer. e g., Polytron (Kinematica, Lucerne, Swttzerland), Somcator W225 (Ultrasonics, Farmmgdale, NY),
Merkel et al
98
cholesterol
oleat
/ 00 substrate
concentration
C (pMoUl)
Fig 2 RelatIonshIp of lysosomal acid hpase actlvlty and substrate concentratton Diagram with reciprocal substrate concentration and reaction speed (insert) Purified llpase was incubated with different substrate concentrations Enzyme activity IS expressed m nmol released fatty acids per mm and ml lysosomal hpase Cs, substrate concentration, V, reactlon velocity 2 3 4 5
Standard cell culture materials, supphes for drawmg venous blood. Phosphate-buffered saline (PBS), Flcoll-Paque Plus (Pharmacla, Upsala, Sweden) Cell detachmg buffer. 50 mMTns-HCl, pH 7.4,l WEDTA, pH 8 0,150 mMNaC1 Extraction buffer B. 10 mMsodlum acetate, pH 5 0,O 1 mM dlthlothreltol (DTT, Life Technologies, Galthersburg, MD), 1% v/v Trlton X-100 (Blo-Rad, Hercules, CA), 1 mMphenylmethy1 sulfonylfluortde (PMSF [Sigma], prepare 1 Mstock m isopropanol)
2.2. Triacylglycerol
Assay
1 Tn-[9,10 (n)-3H]-oleoylglycerol, 5 mC1, 1 Ci/mmol m toluene (Amersham, Arlmgton Heights, IL), triacylglycerol (Tnolem [Slgma]; dissolve at 100 mg/mL m benzene) 2 Slhca gel mesh (Bio-Rad), Florlsil (Merck), glass wool 3 Petrol ether, 5% (v/v) diethyl ether m petrol ether, benzene, glycerol (100% water-free) 4 0 109 M sodmm acetate, pH 5 0, 10% Trlton X- 100 5. Stop solution chloroform/methanol/heptane (vol/vol/vol = 341 385 273) 6 Borate buffer 3 09 g boric acid (0 1 w and 6.9 g K&O, (0 1 A4) in 500 mL water Prepare fresh weekly and store at 4°C. 7 Scmtlllatlon countmg fluid. e g , Aquasol (Packard, Gromng, Netherlands)
Lysosomal Acid Lipase 2.3. Cholesterol
99
Oleate Assay
1 Cholesterol-[l-‘4C]-oleate (50 ~CI, 50-62 mCt/mmol m toluene, Amersham), cholesterol oleate (Stgma, 10 mg/mL in hexane) 2 16 m&I phosphattdyl choline (Sigma, 12 5 mg/mL m chloroform) 3 0.1 MEDTA-NaOH, pH 7.4. 4 0 13 A4 sodmm acetate, pH 5 0, 10% Trtton X- 100 5 Stop solutton 0 1 mIt4 olerc acid (Sigma) in benzene/chloroform/methanol (vol/ vol/vol; 370 185 444) 6 0.3 A4 sodium hydroxide
2.4. Enzyme Purification
2 3 4
5 6
8. 9 10 11.
from Liver Tissue
Protemase mhtbttors Anttpam (1 pg/mL in water) and PMSF (1 mA4 in tsopropatrol) were from Sigma Chymostatm (1 ug/mL m DMSO), leupepttn (1 pg/mL m water), and pepstatm (0.1 ug/mL m ethanol) were from Boehrmger-Mannhetm (Mannhem, Germany) Extraction buffer A* 10 tisodtum acetate, pH 5.0,O. 1 mMDTT, protemase mhtbttors Extractron buffer B extraction buffer A contammg 1% v/v Trrton X- 100 Chromatography supplies* FPLC system with control unit, two pumps, 50- and IO-mL superloops, external pump LKB (Broma, Sweden) P 1, spectrophotometer UV M-II Batch sepharoses. concanavalm A sepharose and carboxymethyl (CM) sepharose CL-6B fast flow Water-coolable chromatography column XK 26/20 FPLC columns Phenyl-Superose HR 515, Mono S HR 5/5, Superose 12 HR lO/ 30, all avatlable from Pharmacta (Upsala, Sweden) Buffer C (for concanavahn A sepharose and CM sepharose chromatography) 20 mM sodtum acetate, pH 5 0,33% ethylene glycol, 1 mM DTT, protemase mhtbttors. Further addmons to buffer C vary from step to step as inctdated m Subheading 3. a-Methyl-a-o-mannopyranostde (methylmannostde, Sigma) Sterrle 500-mL vacuum filters (0 2- and 0 45-pm, Nalgene, Rochester, NY), Centrtcon- 10 (Amrcon, Beverly, MA) mrcroconcentrators Buffer D (for CM sepharose chromatography)* 20 mA4 sodmm acetate, pH 5 0, 3% ethylene glycol, 1 mJ4 DTT, proteinase mhtbttors Buffer E (for Phenyl-Superose chromatography). 20 mM sodium acetate, pH 5 0, 1 mM DTT, proteinase mhrbitors. Buffer F (for Mono S chromatography). buffer E contammg 25% ethylene glycol and 0 1% Trrton X-100 Buffer G (for Superose- 12 gel filtration)* buffer E contammg 25% ethylene glycol, 0.1% Trtton X-100, and 0 15 MNaCl without protemase mhrbttors
3. Methods 3.1. Preparation of Standards and Samples for LAL Assay Total protein obtamed by extraction of human liver tissue at pH 5.0 (see Subheading 3.7.1.) is used as a standard for enzyme assays Thrs standard IS stable for several months at -2OOC (see Note 1).
Merkel et al.
100 3.1.1. Preparation of Blood Samples
1 Draw 20 mL of venous blood mto EDTA tubes, keep on ice water, and process within 2 h. Do not freeze. 2 Dilute blood with 1 vol prechrlled PBS and mix well. 3. Ahquot 3 mL of Flcoll-Paque m IO-mL centrifuge tube Prepare in quadruphcate for each blood sample 4. Overlay 4 mL blood/PBS onto Frcoll-Paque 5 Centrifuge 30 mm at 4OOg, stop centrifugatron without brake to avotd agitation 6. Collect leukocytes between upper and middle layer (see Note 2). 7 Wash leukocytes three tunes with PBS, collect cells by centrif%gmg for 10 mm at l,OOOg 8 Lyse leukocyte pellet by resuspension m 200 yL extraction buffer B 9 Somcate with 6x l-mm pulses on Ice water with low energy (40 W). 10 Centrifuge m a microfuge at maximum speed for 10 mm at 4°C Il. Use 25 pLfor assay; store remainder of homogenate at -70°C until further use
3.1 2. Cell Culture Cell culture medium can be assayed without modrlicatrons It should be kept rn mind, however, that the half-lrfe of LAL in medmm at 37°C is ~2 h Confluent fibroblasts grown in 25-cm* flasks yreld suffictent extract for four assays. Assays of LAL activity m culture extracts are performed rn quadruplrcate. All steps are carried out on me using pre-chilled solutrons. 1 2 3 4 5. 6 7 8
Grow cells to confluence in 25-cm2 Petri dishes or flasks Remove culture medmm, wash monolayer of cells 3 times wtth 10 mL PBS Add 0 75 mL detachmg buffer and incubate for 5 min. Remove cells with rubber scraper and transfer to Eppendorf mtcrocentrrfuge tube Repeat steps 3 and 4, pool cell suspensions. Centrifuge 5 mm at 4°C m a microfuge to pellet cells Discard supernatant, resuspend cells m 200 pL extraction buffer B Sonication, assay and storage is performed as descrrbed m Subheading 3.1.1., steps 9-l 1
3.1.3. Tissue Samples 1 Collect tissue specrmen by brief centnfugation 2. To 10-50 mg of tissue, add 200 pL of extraction buffer B If only small ttssue amounts are available, extract I-5 mg of tissue m 25 pL buffer B. 3 Homogenize in a hand-held Teflon homogemzer 4 Sonicatton, assay and storage are performed as described m Subheading 3.1,1., steps !Wl.
3.2. Triacylglycerd Assay 3 2.1. Preparation of RadIoactive Substrate 1 Prepare a column for removal of free fatty acids from trracylglycerol substrate as follows (see Note 3) Slide 2 cm of a rubber tube onto the tip of a lo-mL glass
Lysosomal Acid Lipase
5 6 7 8 9 10
11
101
pipet (preferably with funnel at the upper end) and close rubber tube wtth a clamp, place 0 1 g of glass wool m the tip. Adjust plpet vertically on a stand and place m a hood rated for Isotope usage Fill column with petrol ether Pour 2 g of silica gel into pipet and allow to sedlment. Cover silica gel with 0.2 g of Florisil resin Add 8 mL of petrol ether to column and wash resin. Keep sdica gel and Florlsll covered with petrol ether Add 0 5 mL of trlacylglycerol (100 mg/mL) to 5 mC1 trl-[9,lO (n)-3H]oleoylglycerol and evaporate under a gentle stream of nitrogen. Resuspend lipids m 2 mL of petrol ether Load nonradloactlve/radloactlve trlacylglycerol mrx onto slltca column and wash with 50 mL petrol ether. Discard flowthrough. Elute with 50 mL of 5% dlethyl ether in petrol ether Collect IO-mL fractions in glass scintillation vials MIX vials and count 5 pL of each fraction m lo-mL scmtlllatton fluld Pool the two fractions containing the highest actlvlty, evaporate solvent under mtrogen, and resuspend in 10 mL of benzene Add 640 pL of nonradioactive trlacylglycerol (100 mg/mL) and dry carefully under mtrogen Add 25 g of glycerol Somcate with 6x l-mm pulses on ice water with an energy output of about 60 W, avold foaming of the substrate durmg somcation by adjusting the energy output and ensuring that the probe tip remams fully immersed m the hqutd This substrate stock IS stable for at least 4 weeks at room temperature
3.2.2. Assay Procedure 1 Place IO-mL glass tubes on ice, in duplicate for each sample Add 2 5-25 pL of sample, standards (see Subheading 3.1.) and blanks (water), and add 0.109 M sodium acetate, pH 5 0 to a total volume to 100 pL (see Note 4). 2 For 20 reactlons, mix 0 167 mL of substrate stock and 0 1 mL of 10% Trlton X100 with 1 78 mL of 0.109 M sodium acetate, pH 5.0 3. Start reaction by adding 100 pL substrate from step 2 to sample, vortex mix for 5 s. 4. Incubate for 30 mm at 37°C (see Note 5) 5. Stop reactlon by adding 3 25 mL of stop solution followed by 1 mL borate buffer 6 Vortex mix for 1 mm and centrifuge for 15 mm at 1,OOOg 7. Carefully remove 1 mL of upper phase and transfer to a scintillation vial Take care not to disturb the interphase since it contams most of the unhydrolysed triacylglycerol.
3.2 3. Converslon of cpm to Mdliunits 1. 1 mU IS defined as the release of 1 nmol free fatty acids per mm at 37°C 2 Weigh two drops of substrate stock on a microbalance, and count radIoactIvIty 10 mL of scmtdlation fluid 3 Calculate total activity of the substrate stock (cpm x g-’ x 25 12 g)
m
102
Merkel et al.
4 Determme specrtic acttvrty of the substrate stock (cpmntnol trracylglycerol) The stock contains 34 3 pM unlabeled trrolem and 5 @Z [3H]trtolem 5 Determine k (nmol x cpm-’ x mm-‘) by the formula 9 67 x T-r x spectftc acttvtty-‘, where T = assay time (generally 30 mm) A typical k 1s 2 6 x 10m5 nmol x cpm-’ x mm-’ Enzyme acttvtty IS converted to mrllmmts by the equation mU = k x cpm, where cpm IS the net sample cpm after subtractron of the assay blank
3.3. Cholesterol Oleafe Assay 3.3.1. Preparation of Radioacbve Substrate 1 To 250 ~CI Cholesterol-[l-‘4C]-oleate (53 9 mCt/mmol, Amersham), add 2 85 mL of nonradtoactrve cholesterol oleate (10 mg/mL) Add hexane to 10 mL This substrate stock solutron IS stable at -20°C 2 For 20 reactrons, add 200 pL of 16 mM phosphatrdyl cholme to 200 pL of substrate stock 3 Evaporate under nitrogen, add 0 5 mL of 0 1M EDTA, pH 7 4, and 1 5 mL of water 4 Somcate with 2x I-mm pulses m a 41°C water bath wtth an energy output of about 60 W This substrate working solutron 1s stable for 8 h at room temperature
3 3 2. Assay Procedure 1 Prepare dupltcate IO-mL glass tubes and place on ice Abquot 2 5-25 uL of sample, standards (see Subheading 3.1.) and blanks (water), and add 0 13 A4 sodmm acetate, pH 5 0 to a total volume of 200 pL (see Note 4) 2 Start reaction by adding 100 pL of substrate solutron (see Subheading 3.3.1., step 4) Vortex mtx for 5 s 3 Incubate for 30 mm at 37’C (see Note 5) 4 Stop reaction by first addmg 3 mL of stop solutton, and then 0.6 mL of 0.3 M sodrum hydroxrde 5 Vortex mix for 1 mm and centrtfuge for 15 mm at l,OOOg 6 Carefully remove 1 mL of upper phase and transfer to 10 mL of scmtrllatron fluid
3.3.3 ConversIon 1 2 3 4
of cpm to Mhmits
1 mU IS defined as the release of 1 nmol free fatty acids per mm at 37°C Count radroacttvrty of 0 2 mL substrate stock m IO-mL scmtrllatron fluid Determine total activity of the substrate stock (cpm/O 2 mL x 10 mL) Calculate spectfic acttvtty of the substrate stock (cpm/nmol cholesterol oleate) The stock contains 43.8 pM unlabeled cholesteryl oleate and 4 66 pM [‘4C]cholesteryl oleate 5 Determine k (nmol x cpm-’ x mm-‘) by the formula 2.93 x r” x specific actrvrty-r, where T = assay time (generally 30 mm) A typtcal k IS 2 4 x 10e5 nmol x cpm-’ x mm“ Enzyme actrvrty is converted to mrllmmts by the equation mU = k x cpm, where cpm IS the net sample cpm after subtractron of the assay blank
Lysosomal Acid Llpase 3.4. Purification
103
of LAL from Human Liver
All steps of the purtficatton are carrred out at 4°C unless stated otherwtse (see Note 6). All soluttons are prechilled on ice, and protemase mhtbttors are requned m all buffers except for the gel filtration buffer Smce the trtacylglycerol assay substrate is stable, tt 1s convement to use this substrate to monitor the purtficatton. The cholesterol oleate assay can then be used for confirmation once LAL IS puritied. Protein concentrattons can be determmed by different methods (e.g., Bradford assay or BCA assay) as long as Trtton X- 100 does not Interfere. Durmg the chromatographrc steps (except for Phenyl-Superose), protein concentrattons can be estrmated by measuring UV absorption at 280 nm. However, with buffers contammg Trtton X- 100, the hrgh absorbance of Tnton X- 100 at 280 nm must be considered Starting from 325 g of hver ussue, the yield of purified enzyme wrll be in the range of 40-50 ug A purrficatron factor of about 17,000 ts obtamed. Spectfic actlvitles typically are 3,500-4,000 mU/mg of protein. Ytelds are suffictent for baste btochemlcal studies, mcludmg pH optrma, substrate specrficlttes, or kmetic measurements Purtfied LAL from human liver IS observed m two active, glycosylated forms of 56 and 41 kDa. The mature protem has a molecular mass of 56 kDa, and a smaller form lacking 49 ammo-terminal ammo acids 1salso catalytrtally active For a further discussion of these LAL forms see Amers et al (8’.
3.4.1. Extract/on at pti 5.0 1 Mmce 325 g of lrver ttssue and suspend m 720 mLof Ice-cold extraction buffer A (see Note 7). 2 Homogemze trssue on Ice water with 3 x 1-mm pulses wtth a Polytron homogemzer (see Note 8). 3 Centrrfuge for 40 mm at 48,OOOg and 4°C Discard supernatant. 4 Resuspend pellets m 450 mL of extractlon buffer B 5 Repeat homogemzatton as In step 2 6 Centrtfuge for 40 mm at 48,OOOg and 4°C Collect supernatant on rce Avord floatmg fat cake 7 Resuspend, homogentze and centrtfuge pellets as described In steps 4-6 and pool supernatants.
3.4 2 Concanavalln
A Sepharose Chromatography
1. Prepare 160 mL of concanavalin A Sepharose by waslung the resm with 4 vol of each of the followmg buffers a Water b Buffer C contaming 0 5 M NaCl, 0 5% Trrton X- 100, and 375 m1I4 methylmannostde c 20 m&I sodrum acetate, pH 5.0. d Extractton buffer B Collect Sepharose after each step by centrlfugatlon at 1,OOOgand 4°C
Merkel et al.
104
2 Incubate 160 mL of concanavalm A sepharose with pooled supematants (900 mL) from Subheading 3.4.1. for 3 h wtth rotation at 4°C 3 Wash sepharose sequentially wtth a. 640 mL buffer C contammg 0 5 MNaCl and 0 5% Triton X-100 b 4x 600 mL buffer C c. 640 ml buffer C contammg 375 mM methylmannosrde 4 Elute bound proteins by mcubatmg with 200 mL buffer C contammg 0 3% Trrton X-100 and 375 mA4methylmannoslde for 5 mm at 37°C Repeat thts mcubation eight times using 200 mL buffer C for each mcubation (see Note 9) Combine eluates on Ice (1600 mL) and filter with 0.45 pm vacuum filter
3 4.3. Carboxymethyl
Sepharose Chromatography
1 Sediment 35 mL carboxymethyl Sepharose CL-6B fast flow (CM sepharose) m a XK 26/20 chromatography column fitted with close connectors. The column can be stored at 4°C if washed wtth 20% ethanol after use 2. Wash column wtth 350 mL of buffer C at a flow rate of 2 mL/min usmg an extermal pump such as the LKB PI (see Subheading 2.4.) Cool column wtth water at 4°C 3 Load the eluate of the concanavalm A Sepharose step (I 600 mL) overnight using the same pump at a flow rate of 2 mL/mm 4 Connect column to an PLC system avotding air bubbles m tubes and connectors and wash wtth 350 mL buffer D 5 Elute wtth a 300 mL O-Q.5 MNaCl gradrent m buffer D at 2 mL/mm and collect fractions on ice 6 Pool fractrons with the highest acttvtty (approx 100 mL, see Note 10)
3.4.4 Phenyi-Superose
Chromatography
1 Equthbrate Phenyl-Superose HR 5/5 column with buffer E at 0 25 mL/mm. 2 Load 50 mL of CM Sepharose eluate using a superloop 50 loadmg device Wash wtth 10 mL of buffer E contammg 33% ethylene glycol and 0 1% Trtton X- 100 at 0 25 mL/mm 3 Elute wtth a 25-mL gradient using a 12 5 mL lower ltmn of 33% ethylene glycol and 0.1% Triton X-100 m buffer E and a 12 5 mL upper ltmn of 60% ethylene glycol and 2% Trtton X-100 m buffer E Reduce flow accordmg to the back pressure of the column to about 0 1 mL/mm (see Note 11) 4 Repeat steps 1-3 with the remaining eluate from the CM Sepharose and pool fractrons with the htghest activity This typically yields about 16 mL
3.4.5 Mono S Chromatography 1 2 3 4.
Equtlibrate Mono S HR 5/5 column with buffer F at a flow rate of 0 25 mL/mm Load the total Phenyl-Superose eluate usmg the superloop 10 Wash column wtth 20 mL of buffer F at 0 4 mL/mm Elute with a 30-mL gradient from O-O 5 A4 NaCl m buffer F at 0 25 mL/mm Collect fractions of 1 mL on Ice
Lysosomal Acid Lipase kDa
105
M 31 32 33 34 35 36 37 36 39 M
20
30
40
fraction
50
Fig. 3. Mono S chromatography of lysosomal acid lipase. Enzymatic activities were determined with triacylglycerol as substrate; protein concentrations are indicated. Lysosomal acid lipase elutes between 0.25 and 0.3 MNaCl, corresponding to fractions 34-36. The insert shows a silver-stained SDS-PAGE with 6-uL aliquots of fractions 3 l-39. Lysosomal acid lipase is indicated by an arrow. 5. Pool the two fractions containing the highest activity which typically between 0.25 and 0.3 MNaCl (see Fig. 3 for comparison).
elute
3.4.6. Gel Filtration 1. Equilibrate Superose 12 HR lo/30 column with 100 mL of buffer G at a flow rate of 0.1 mL/min. 2. Concentrate the Mono S eluate to 200 pL total using Centriconmicroconcentrators. 3. Load concentrated Mono S eluate onto Superose 12 and develop column with 25 mL of buffer G at 0.1 mL/min. 4. Collect 0.4 ml-fractions on ice and assay for triacylglycerol hydrolysis immediately. LAL elutes between 13.2 and 14.8 mL. 5. For long-term storage, snap-freeze the purified LAL and store at -80°C.
4. Notes 1. LAL is very unstable at room temperature. All preparations and solutions should thus be kept on ice. The enzyme in tissue homogenate is stable at -20°C for up to 4 wk. All other forms (leukocyte or cell culture extracts, purified enzyme) should be processed immediately or stored at -70°C. 2. Remove serum first and then collect lymphocytes. Take care to collect as many cells as possible without too much Ficoll contamination.
Merkel et al.
106
3 The removal of free fatty acids from commerctal trtacylglycerol (steps l-6 III Subheading 3.2.1.) IS strongly recommended to obtam lower blanks Thus step IS
7 8 9 10.
11
not required for the cholesterol oleate assay To vertfy that the reaction rate is linear with respect to enzyme concentratton, several sample amounts should be used initially Imttally, It IS recommended that several assay time pomts be measured to ensure that the reactlon rate IS lmear Mamtammg low temperature IS very important (see Note 1) If possible, purtficanon should be carried out wtthout mterruptlon, since freezing and thawing of samples markedly decreases the enzyme yreld Human liver tissue should be obtained fresh durmg surgery and checked by a pathologrst to be free of disease. Storage at -80°C IS recommended A manual Teflon homogenizer can also be used. Homogemzatton by somcatron should not be used smce it IS not sufficient to disrupt liver tissue Elutron of LAL from the concanavalm A sepharose IS very inefficient tf performed at a shorter ttme or at a lower temperature Removal of Trtton X-100 and most of ethylene glycol 1s required to allow adsorption of LAL to the Phenyl-Superose The eluate of the CM Sepharose IS therefore highly unstable and should be stored Immediately at -80°C Each freezmg/thawmg decreases the yteld by about 30% Because of the strong absorbance of Trtton X-100 at 280 nm, UV momtormg of protein concentrattons 1snot possrble at thts step.
References 1 Goldstem, J L , Dana, S E , Faust, J R , Beaudet, A L , and Brown, M S (1975) Role of lysosomal acrd hpase m the metabohsm of plasma low densny hpoproterns J Blol Chem 250,8487-8795 2 Fowler, S D and Brown, W J (1984) Lysosomal actd ltpase, m Llpases (Borgstrom, B and Brockman, H L., eds ), Elsevrer, New York, pp 329-364 3 Assmann, G and Seedorf, U (1995) Acid hpase deficiency Wolman disease and cholesteryl ester storage drsease, m The Metabolic and lvlolecu!ar Bases oflnherzted Dzsease (Scrrver, C R , Beaudet, A L , Sly, W. S , and Valle, D , eds ), McGraw-Hill, New York, pp 2563-2587 4. Grl, G , Osborne, T F , Goldstem, J L , and Brown, M S (1988) Purlficatton of a protein doublet that bmds to SIX TGG-contammg sequences m the promotor for hamster 3-hydroxy3-methylglutaryl-CoA-reductase. J Bzol Chem 263, 19,00!&19,0 15 5 Cheng, D., Chang, C C Y , Qu, X , and Chang, T -Y (1995) Acttvahon of acylcoenzyme A*cholesterol acyltransferase by cholesterol or by oxysterol m a cellfree system J Brol Chem 270, 685-695. 6 Ginsberg, H N (1990) Llpoprotem physiology and its relattonshrp to atherogenesls Endocrlnol Metub Clan North Am 19, 21 l-228. 7 Sando, G N. and Rosenbaum, L M. (1985) Human lysosomal acid hpase/ cholesteryl ester hydrolase: purification and properttes of the form secreted by fibroblasts m mrcrocarrter culture .I BloZ. Chem 260, 15,186-l 5,193
Lysosomal Acid Lpase
107
8 Amels, D , Merkel, M , Eckerskorn, C., and Greten, H. (1994) Put&anon, charactertzatton and molecular cloning of human hepatic lysosomal actd bpase Eur J Blochem 219,905-914
9. Anderson, R A and Sando, G N (1991) Cloning and expresston of cDNA encoding human lysosomal acrd hpaseicholesteryl ester hydrolase J Blol Chem 266,22,479--22,484
10 Kbma, H , Ullrtch, K , Aslanidts, C., Fehringer, P , Lackner, K J., and Schmttz, G (1993) A spltce Junctton mutation causes deletion of a 72-base exon from the mRNA of lysosomal acid ltpase m a patient with cholesteryl ester storage disease. J Clin Invest 92, 2713-27 18 11 Anderson, R A., Byrum, R S., Coates, P. M , and Sando, G. N (1994) Mutattons at the lysosomal actd cholesteryl ester hydrolase gene locus in Wolman drsease. Proc Natl. Acad Scz USA 91,2718-2722
12 Amets, D , Brockmann, G , Knoblich, R , Merkel, M., Ostlund, R E , Yang, J W., Coates, P. M , Cortner, J A., Femman, S V., and Greten, H (I 995) A 5’ sphceregton mutatron and a dmucleottde deletion m the lysosomal acrd bpase gene m two pattents with cholesteryl ester storage disease J Llpld Res 36, 241-250 13. de Duve, C (1975) Explormg cells with a centrifuge Science 189, 186-I 94 14. Coates, P M , Langer, T , and Cortner, J A (1986) Genetic variation of human mononuclear leukocyte lysosomal acid lipase actlvlty. Relattonshtp to atherosclerosis Atheroscleroszs 62, 1l-20 15 Yatsu, F M , Hagemenas, F C., Manaugh, L C , and Galambos, T (1980) Cholesteryl ester hydrolase acttvtty m human symptomatic atherosclerosis Lzpzds 15, 1019-1022 16 Nbgre-Salvayre, A , Dagan, A , Gatt, S , and Salvayre, R (1993) Use of pyrenemethyl laurate for fluorescence-based determmatton of bpase activity m intact ltvmg lymphoblastold cells and for the dtagnosts of acid hpase deficiency Blochem. J 294, 885-891 17. Warner, T G , Tennant, L L , Veath, M. L., and O’Brten, J S (1979) An improved method for the isolation and assay of the acid bpase from human lrver Blochtm Bzophys Acta 572,201-210
18 Nllsson-Ehle, P and Schotz, M C. (1976) A stable, radioactive substrate emulsion for assay of lipoprotein lipase J Llpld Res, 17, 536-54 1. 19 Belfrage, I’ and Vaughan, M (1969) Simple liqutd-hqutd partmon system for ISOlatlon of labled oletc acid from mixtures with glycertdes. J Lzpld Rex lo,34 1-344. 20. Ntlsson, A , Landin, B., and Schotz, M. C (1987) Hydrolysis of chylomlcron polyunsaturated fatty actd esters J Lipid Res 28, 5 10-5 17. 2 1 Hoeg, J M , Demosky, S J , and Brewer, H. B. (1982) Charactertzatron of neutral and acid ester hydrolase m Wolman’s dtsease. Blochim Blophys Acta 711,59-65 22 Plttman, R C., Khoo, J C , and Steinberg, D (1975) Cholesterol esterase m rat adtpose ttssue and Its actlvatron by cycbc adenosine 3’5’-monophosphate-dependent protein kmase J Bzol Chem 250,4505-45 11. 23 SJoberg, E R , Hatton, J D., and O’Brren, J S. (1987) Purification and characterization of a second form of acid bpase in human liver. Blochem. J 248, 139-144
11 Hormone-Sensitive Lipase and Neutral Cholesteryl Ester Lipase Cecilia Holm and Torben 0sterlund 1. Introduction Hormone-sensttive lipase (HSL) catalyzes the rate-limiting step m the hydrolyses of stored triacylglycerols in adipocytes, i.e., the hydrolysis of trracylglycerol to dracylglycerol (for a recent review on HSL, see ref. I). It also catalyzes the hydrolysis of dracylglycerols and monoacylglycerols However, a second enzyme, monoglyceride lipase, 1srequired to obtain a complete degradation of monoacylglycerols (2) HSL is most abundantly expressed m adipose trssue, but is also expressed m sterordogemc and muscle ttssues (3,4). It has been proposed that the function of HSL m steroidogemc tissues IS to hydrolyze stored cholesteryl esters, m order to provrde free cholesterol for the synthesis of steroid hormones (5). However, at least wrth regard to testis, thts hypothesis has been questioned by the finding that HSL seems to be expressed m Sertoh cells and spermatids, rather than m the hormone-producmg Leydig cells (67). In muscle ttssuesHSL ISbelieved to function as a triglyceride lipase to release fatty acids for oxtdation wrthm the tissue. HSL also seems to be expressed m macrophages, at least m murme macrophages, in whtch several groups clearly have demonstrated the presence of HSL (8-10). The presence of HSL m human macrophages is more questionable, since attempts to demonstrate HSL in these cells have so far been unsuccessful (9) It is speculated that HSL m macrophages functrons as a cholesteryl ester ltpase m hydrolyzmg stored cholesteryl esters m the cytoplasm, i.e., tt catalyzes the first step of reverse cholesterol transport. HSL exhibits some distinct features compared with other known ltpases Most Importantly, its activity ts under hormonal and neural control through a From
Methods m Molecular Bology, Vol 109 Lipase and Phospholrpase Protocols Echted by M H Doohttle and K Reue 0 Humana Press Inc , Totowa, NJ
109
110
Ho/m and lasterlund
mecharnsm mvolvmg phosphorylation by cyclic adenosme monophosphate (CAMP)-dependent protem kmase (11,12). The phosphorylatron of HSL occurs as a result of a receptor-medtated increase m CAMP levels, leading to actrvanon of CAMP-dependent kinase. This kmase 1sbeheved to phosphorylate HSL at a single serme residue, the regulatory site (Ser-563 and Ser-552 in rat and human HSL, respectively) (#,13,14J The phosphorylatron by CAMP-dependent protein kmase results m Increased enzyme activity of HSL (111. Insulm, which IS the most Important antthpolytic hormone, prevents the increase m CAMP levels, mamly via activation of a phosphodresterase, PDE3B (15), and thereby counteracts acttvatron of HSL A second distinct feature of HSL is its substrate specrficity (16,27). In agreement with the proposed function of HSL n-r steroidogemc trssues and macrophages, rt IS an excellent cholesteryl ester lrpase and hydrolyzes cholesteryl esters and trtglycertdes at similar rates, Furthermore, HSL shows approximately 10 times higher activity against drglycerides than against trrglycerrdes It should also be noted that HSL IS a very good esterase with approximately two times higher hydrolytic actrvity against the ester substrate p-mtrophenylbutyrate (PNPB) than against Its preferred lipid substrate (17) The high hydrolytrc actrvrty of HSL against cholesteryl estersand ester substratesis interesting in view of the recently demonstrated structural relattonshrp between HSL and a superfamily of esterases and lipases, mcludmg acetycholmesterase, bile-salt-strmulated hpase, and several fungal lipases (28) A third unusual feature of HSL is Its ability to retam hydrolytic activity at low temperatures, a property that could be of crrtrcal survrval value in hibernators (24) Because of the broad substrate specificity described for HSL, several drfferent assay systems are available to monitor the activity of HSL These Include systemsbased on liprd emulsion substrates as well as water-soluble substrates, and both types wrll be described m this chapter. The hprd substrates used to assay HSL include triacylglycerol, diacylglycerol, and cholesteryl ester substrates. The prmcrple for these three assaysIS the same, namely, the release of [3H]olerc actd from phospholipid-stabrlrzed emulsions of the respectrve 3Hlabeled hpid substrate The [3H]olerc acrd is separated from remammg substrate as potassium [3H]oleate into the upper phase of a lrqmd-llqurd partrtron system and determined by liquid scmtrllation (26,19-21) Bovme serum albumm (BSA) is used as fatty acid acceptor for all three assays. A monoether analogue of d~oleoylglycerol-l(3)-mono-oleoyl-2-O-mono-oleylglycerolhas been synthesized m our laboratory and is the routme substrate used, smce it has several advantages (21). Among these are that substrate for monoglyceride lrpase is not formed from monoacylmonoalkylglycerol and that under the conditions used for the assay (pH 7.0 m the absence of apo CII) virtually no lipoprotem ltpase activity is measured. Both of these advantages are Important
/-is/!. and nCi3-i
117
when measuring HSL activity in crude tissue or cell extracts, smce these are often rich in monoglycerrde lipase and lipoprotein lipase activity. Using diacylglycerol (rather than triacylglycerol or cholesteryl ester) substrate optimazes the sensitivity of the assay, due to the substrate specificity of HSL (see p. 110). Ftnally, inhibition by detergent (from purified preparations of HSL) is less pronounced in assays based on dlacylglycerol, rather than triacyl-glycerol, as substrate. However, the only substrates that can be used to monitor the increase in enzyme activity that occurs on phosphorylatton of HSL by CAMP-dependent protein kmase in vitro are triacyglycerol and cholesteryl ester substrates with long fatty acids, such as trloletn and cholesterol oleate, respectively. To momtor esterase acttvity, rather than lipase activity, PNPB can be used at concentrations under which it is water soluble. The use of this assay for HSL has been adopted from earlter descriptions of the use of this substrate to measure lipoprotein lipase activity (22).
2. Materials 2.1. Assay of HSL Activity Using the Diacylglycerol Analog Mono-oleoyl-2-O-mono-oleylglycerol (MOM@ or Diolein (DO) as Substrate 1(3)-mono-[3H]oleoyl-2-O-mono-oleylglycerol ([‘HI-MOME) and l(3)-mono-oleoyl2-O-mono-oleylglycerol (MOME) are synthesrzed as described (22), The radioactive substance (~5 mCmmno1) is dissolved at 5 mg/mL m toluene, and the nonradioactive substance 1s dissolved at 50 mg/mL m heptane or hexane Stored at -20°C these are stable for at least 6 mo. When the blanks of the assay reach unacceptable levels (should be below 0 05% substrate hydrolyses), the substancescan be purified free from fatty acids formed through spontaneous hydrolysis usmg silicic acid chromatography (see Chapters 9 or 10 for sihca chromatography) A commercially avarlable alternative to MOME, providing the same sensitivity, although lower specificity, IS diolem (seeNote 1) Diolem [oleoyl-1 -14C] is commerctally available from Amencan Radlolabe1 Chemicals (St Louis, MO, cat no ARC 767, l-5 mClimmo1) and unlabeled 1,2dlolem is available from Sigma (St LOUIS, MO) and Nu Chek Prep (Elyslane, MN) Phosphatidylchohne (PC) and phosphatidyhnosnol (PI) are from egg yolk and soybean, respectively, and are obtained as methanol fractions from slhcic acid chromatography of a chloroform-methanol extract Alternatively, they are obtained from Sigma (cat. nos P3556 and P-5954, respectively) Dissolve in chloroform and make a 20 mg/mL solution with weight ratios of PC/PI of 3 1 Stored at -2O”C, they are stable for at least 12 mo 0 1 Mpotassium phosphate, pH 7 0 20% defatted BSA in 0.1 Mpotassmm phosphate, pH 7.0 Defatted BSA 1savailable from Boehrmger-Mannheim (Mannhelm, Germany, cat no 775 827) 20 mM potassium phosphate, 1 mM EDTA, 1 nuV dlthloerythritol and 0 02% defatted BSA, pH 7 0
112 6 7 8 9
Ho/m and 0sterlund ExtractIon mixture methanol/chloroform/heptane (10.9.7, see Note 2) 0 1 h4 potassium carbonate, 0 1 M boric acid, pH 10 5 Llqurd scmtlllatton solution. e g., Ready-Safe from Beckman Instruments (Fullerton, CA) Somfier, Branson (Danbury, CT,) Sonifier 250 or equivalent
2.2. Assay of HSL Activity
Using Triolein as Substrate
1 Trlolem [1-oleoyl-9,10-3H] ([3H]TO) IS available from Amersham (Buckmghamshlre, England; cat. no TRA 19 1, 5-20 Ci/mmol) and trlolem (TO) IS available from Sagma (cat no. T-7 140) The radioactive trlglycerlde IS dissolved at 5 mg/mL m toluene and the nonradloactlve triglyceride IS dissolved m heptane or hexane at 50 mg/mL Stored at -2O”C, these are stable for at least 6 mo. When the blanks of the assay reach unacceptable levels (should be below 0 05% hydrolysis), the substances can be purified free from fatty acids formed through spontaneous hydrolysis usmg slliclc acid chromatography 2 The remammg reagents required are those listed m Subheading 2.1., items 2-9
2.3. Assay of HSL/Neutra/ Cholesteryl Cholesterol Oleate as Substrate
Ester Lipase Activity
Using
Cholesteryl [ l-14C] oleate ([‘4C]CO) IS available from Amersham (cat no CFA 256,5@-62 mCl/mmol) and cholesteryl oleate (CO) IS avadable from Sigma (cat no C-9253) The radioactive substance IS dissolved at 5 mg/mL in toluene and the non-radloactlve substance IS dissolved m heptane or hexane at 5 mg/mL Stored at -2O”C, these are stable for at least 6 mo When the blanks of the assay reach unacceptable levels (should be below O.OS”/), the substances can be punfied free from fatty acids formed through spontaneous hydrolysis using SI~ICIC acid chromatography 2 The remaining reagents reqmred are those listed m Subheading 2-l., items 2-9
2.4. Assay of HSL Activity Using p-fVitropheny/butyrat
as Substrate
1 p-mtrophenyl butyrate (PNPB), available from Sigma (cat no P-9876) Store at -20°C. Light sensitive. 2 0 1 A4 NaH2P04, 0 9% NaCl, 1 mM dlthloerythntol, pH 7 25 3 Extraction mixture’ methanol/chloroform/heptane (10 9 7).
2.5. Sample Preparation 1 Tissue homogenization buffer 0 25 A4 sucrose, 1 mM EDTA, pH 7 0, 1 mM dlthiothreltol, 20 pg/mL leupeptm, 2 yg/mL antlpam, 1 pg/mL pepstatm
3. Methods 3.1. Assay of HSL Activity Using the Diacylglycerol Analog MOME or DO as Substrate Described below IS the assay for HSL activity using MOME as substrate. MOME is the routine substrate in our laboratory, for reasons described m Sub-
HSL and nCEH
113
heading 1. The descrrptron of the MOME assay IS followed by descriptions of the TO and cholesteryl ester lipase assay. Since the two latter assaysare very similar to the MOME assay, only the differences in these assayprocedures are described. Unless otherwise indicated, all steps are performed at room temperature wrth room-tempered buffers. The recommended amounts of HSL for each assay 1sgrven in mllliumts, based on the MOME activity. Exactly the same protocol as described below can also be used to prepare a dlolem substrate in place of the MOME substrate. Sample preparation IS described in Subheading 3.5. For each 4 mL substrate, 12.1 mg of MOME, mcluding 16 x lo6 cpm of [3H]MOME, and 0.6 mg of phospholipids are used. The final substrate concentration is 5 n-&f. 1 In a 4-mL glass veal (14 x 45 mm), mix unlabeled and labeled MOME plus phosphohpids (30 pL, 20 mg/mL of PC.PI, 3 1) and evaporate the solvents using a gentle stream of N2. 2 Transfer the vial with the solvent-free ltpids to a desiccator and leave under vacuum for at least 15 mm, to ensure the absence of restdual solvent 3 Add 2 mL of 0 1 M potassium phosphate, pH 7.0, and somcate for two cycles, each 1 mm in duration (2 x 1 mm) with a l-mm interval between cycles at a setting of l-2 The sonicator tip should be approx 1 cm below the surface durmg the somcation (see Notes 3 and 4). Add an additional 1 6 mL of 0 1 M potassium phosphate, pH 7.0, and contmue the sonicatlon for 4 x 30 s (with a 30 s interval between cycles) on ice After completed somcation, add 0 4 mL of 20% BSA m 0 1 A4 potasstum phosphate, pH 7.0. For each assay, mix in 13 x 100~mm glass tubes 100 uL substrate with 100 pL HSL sample (contammg 0 5-2 mU of HSL activity, 1.e , approx 2-10 ng of rat HSL) in 20 mMpotassium phosphate, 1 mMEDTA, 1 tidithioerythritol, 0 02% BSA, pH 7 0 Incubate for 30 min at 37’C without shaking (see Note 5) 7 Terminate the reaction by adding 3.25 mL of extraction mixture, followed by brief vortex (l-2 s). Add 1 05 mL of 0.1 M potassmm carbonate, 0.1 M bortc acid, pH 10 5, and vortex vigorously for 10 s 8. Centrifuge at SOOg for 20 min and use 1 mL of the upper phase (contammg the released fatty acids), for scmtillatton counting together with 10 mL of ReadySafe or other water miscible liquid scinttllant (see Note 6) 9 One umt ofenzyme activity is equivalent to 1 pmol of fatty acids released/mm at 37°C. Enzyme activity can be calculated knowing the partition coefficient ofpotassium oleate to the upper phase. This has been determined to be 1.9 (22”Q I e., 71 5% of the oletc acid is recovered in the upper phase (20), which has a total volume of 2 45 mL.
3.2. Assay of HSL Activity Using Triolein as Substrate For each 4 mL substrate,5.9 mg of TO, including 50 x 10” cpm of [3H]T0, and 0.6 mg of phopholipid are used. The final substrateconcentratton IS 1.67mA4. The
114
Holm and 0ssferlund
substrate ts prepared as described above under Subheading 3.1., except that at step 4, 1 mL (instead of 1.6 mL) IS added before the second somcatton, and at step 5, after somcatton IS completed, 1 mL of 20% BSA m 0 1 A4 potassmm phosphate, pH 7.0, IS added. For each assay,an HSL sample correspondmg to approx 5-20 mU of activity IS recommended. Varlattons m this assay allow determmatlon of the difference in acttvtty between unphosphorylated and phosphorylated HSL (see Note 7). 3.3. Assay of ML/Neutral Cholesteryl Ester Lipase Activity Using Cholesterol Oleate as Substrate For each 4 mL substrate, 1 17 mg CO, mcludmg 20 x IO6 cpm [3H]C0 (or [‘4C]CO), and 1 42 mg of phospholrptds are used The final substrate concentration 1s0.45 mA4.The substrate ISprepared as described m Subheading 3.1., except that the CO substrate IS heated to 37°C before both the first and second somcatton. Also, at step 4, 1 mL (Instead of 1.6 mL) of 0.1 M potassium phosphate, pH 7.0, ISadded before the second somcatton At step 5, 1 mL of 20% BSA in 0.1 h4 potassium phosphate, pH 7.0, IS added. For each assay, the authors recommend using an HSL sample correspondtng to approx 2-5 mU of activity 3.4. Assay of HSL Activity Using p-Nitrophenylbutyrate as Substrate PNPB, which IS soluble m water up to around l-l 5 mM (22,23), can be used to measure esterase, rather than hpase, actrvtty of HSL PNPB ts hydrolyzed by vu-tually all bpases and esterases,and PNPB-based assaysare therefore non-specific, which IS a major disadvantage of using this substrate when assaying crude tissue or cell preparations. Smce the assay uttltzmg PNPB as substrate ISa simple spectrophotometrlc assay, tt is less demanding with regard to both equipment and time for preparatton of the substrate than the assays based on lipid substrates described above We have performed kinetic studtes using PNPB as substrate and recombinant rat HSL as enzyme using the protocol descrtbed below HSL was found to display normal Mrchaehs-Menten kmetlcs against the PNPB substrate (Fig. l), i.e., there were no signs of mterfacral actrvatton, as has been observed with, for instance, the Humicola lanuglnosa hpase using the same substrate (23). V,,, was reached at around 1.5 mM and from the Lmeweaver-Burke double reciprocal plot, the K,, was determined to 0.59 nhl (see Fig. 1 and ref. 17) The fact that V,,, is not reached until 1.5 n-&I means m practical terms that IS difficult to perform the PNPB assay for HSL under V,,, condtttons and still be below the solubthty for PNPB Depending on the purpose of the PNPB assay, the concentration of PNPB has to be adjusted accordingly. Described below 1sa protocol to perform the PNPB assay for HSL, using a PNPB concentratron of 2 mM.
115
HSL and nCEH
l
40
-
.
35 -
.
0.5 -
/
0-r -5
0
5
10 l/PNPB
0
0.5
1.0
1.5
2.0
2.5
3.0
15 20
25
30
35
40
Il/mM)
3 5
4.0
4.5
5 0
PNPB ImM) Ftg. 1. HSL activity as a functron of PNPB concentration. The PNPB assay was performed as described m Subheading 3.4. using different PNPB concentrations and 16 ng of purified recombmant rat HSL (17). The Inset shows a Lmeweaver-Burke plot of the same data Dissolve 34 8 pL of PNPB m 1 mL of acetotutrtle (high-performance liquid chromatography [HPLC] grade) m a glass vial (enough for 100 assays, mcludmg blanks). Always prepare the substrate fresh. For each assay, add 10 pL of PNPB (m acetomtrrle) to 990 pL of 0 1 MNaHzPO,, 0 9% NaCl, 1 mMdrthtoerythrito1, pH 7.25, containmg approx 5 mU of HSL activity (approx 25 ng of rat HSL), and Incubate for 10 mm at 37°C (see Notes 8 and 9) Terminate the reaction by addmg 3 25 mL of extractron mixture and vortex vigorously for 10 s Centrifuge at 8OOg for 20 mm. Incubate for 3 mm at 42°C and measure the absorbance of the supernatant, contammg the released p-mtrophenol, at 400 nm. Use glass cuvettes, which have been thoroughly rinsed with ethanol for the spectrophotometric measurements. Enzyme activity can be calculated using Lambert-Beers law, employing an extmction coefficient of 12,000 for the product (p-mtrophenol; 22), or an
Ho/m and 0sferhnd
116 experimentally determmed phase IS 2 25 mL
extmctlon
coefficient.
The volume of the upper
3.5. Sample Preparation Samples of adtpose tissue to be used for HSL acttvtty measurements are prepared by homogemzatton m 0 25 A4 sucrose, 1 mA4EDTA, 1 mM dtthroerythrttol, 20 pg/mL leupeptm, 2 ug/mL anttpam and 1 pg/mL pepstatm, pH 7.0, m a glass homogemzer (use 2-3 vol of homogemzatton buffer per vol of ttssue) (26,19,24) Fat-free mfranatants are obtained by centrrfugatton at lOO,OOOg,at 4°C for 45 mm Approximately 70-80% of the HSL acttvtty IS recovered m the mfranatant, 15-25% in the floatmg fat cake and 5-l 0% m the pellet (16,24)
However,
one should keep in mmd that it has been shown that
HSL translocates from a cytosoltc location to the lipid droplet upon hpolytlc strmulatron of adtpocytes (25) Thus, there IS a possibility of having a dtstrtbutron different from the above depending on the prior hormone stlmulatton of the adrpocytes/adtpose tissue. In particular, stimulatron of adrpocytes with hpolyttc agents could lead to the dlstrrbutron of a larger fraction of the HSL pool to the fat cake It should also be mentioned that m 3T3-Ll cells, HSL has been shown to translocate to the pellet fraction m response to hpolyttc stimuli (26). Samples from tissues other than adipose tissue can also be prepared as described above. However, for most tissues a substantially larger part of the HSL pool distributes to the pellet fraction than IS the case for adipose tissue. For cells containing no, or very little, endogenous lipids, such as COS cells, we usually prepare homogenates as described above and analyze these for HSL activity
without
any prior centrifugatlon,
since a considerable
amount of the
HSL pool IS found rn the (msoluble) pellet fraction after a 10,OOOgcentrifugatlon of homogenates of COS cells, transtently expressing HSL. HSL ISdependent on the presence of reducing substances,such as dlthroerythritol, to retam full enzymattc activity (16) and IS reversibly inhrbtted m the absence of such compounds Because of this, dtthioerythritol should be included m all buffers used for the determination of HSL activity. HSL IS sensitive to proteolysts, and protease inhibitors should also be included m all crude preparations of HSL. The cocktail of protease inhibitors described m Subheaidng 2.5. is routinely used m our laboratory. Substancessuch as drisopropyl fluorophosphate (DFP) and phenylmethylsulfonyl fluoride (PMSF) should not be used as protease mhtbttors, since they also inhibit HSL activity. With regard to purified preparations of HSL, they always contain detergent, since the presence of detergent is necessary for the purrficatron of HSL from both adipose tissue and expression systems (16,117). Most detergents inhibit HSL activity; the only type of detergents we have consistently had good experrence with are detergents from the alkyl polyoxyethylene serves. A sec-
HSL and nCEH
117
ond problem with detergents 1s that the they are inhibitory m the HSL assays based on lipid substrates, smce they interfere with the enzyme-liptd tnteraction. This problem IS more pronounced with triacylglycerol substrates than wtth diacyl-glycerol substrates As an example, it can be menttoned that C,3E12, whtch is a detergent from the polyoxyethylene ether series (27), 1s non-inhtbttory at final concentrattons of less than 0.001% m the diacylglycerol assays, whereas the correspondmg value in the trtacylglycerol assays IS 0 0002%. If an HSL preparation must be dtluted prior to assay, the same buffer as used for the actual assay can be used (i.e., 20 mM potassium phosphate, 1 mM EDTA, 1 mM dtthioerythritol and 0.02% BSA, pH 7.0 for the ltptd substrate assays). Thts dilution should always be made tmmediately prior to the assay and HSL should never be stored or frozen in thts buffer.
4. Notes 1. The syntheses of the dtacylglycerol analogue, MOME, 1squote compltcated (22) and may not be feasible m every laboratory. Commercially available I ,2-dtolem can be used Instead, which provtdes the same sensrtivtty as MOME, although with a lower speclfictty smce monoolem 1sformed, whtch can be hydrolyzed by monoglycertde ltpase as well. The latter could create a problem when assaying for HSL m crude ttssue or cell homogenates, since they are often rtch m monoglycertde hpase activity. The authors have hmlted expertence with commerctally available hpid substrate components, smce all substrate hptds (mcludmg the phosphohptds) are synthestzed/purtIied m the authors’ laboratory (by Dr Lennart Krabisch) The dtfferent commercially available lipid and phospholtptd components ltsted in the protocols are all of high quahty and most of them have been tested in our laboratory. Equivalent compounds may be available from other manufacturers We recommend to routinely check the purtty of the hplds by thinlayer chromatography, smce IS tt important to keep blanks (free [3H]oleic acid) low The extractron mixture (20) should be prepared wtth high prectsion and from solvents of high punty (pro analyst), smce any deviations m its compositton will affect the partttton coeffictent of oleic actd m the system The addmon of oletc acid as carrier to the extractton mixture (3 g/L), ongmally described (29), ISnot routmely used in our laboratory, but only when analyzing series of samples known to have very low activtty The quality of the somcator and, especially, the somcator tip is of vital importance for the quality of the hpld substrates. The ttp (tttanmm) used m our laboratory has a dtameter of 3 mm The tip is exchanged as soon as cavmes appear or whenever the performance 1snot sattsfactory (see below) As a gutdeline, m our laboratory, where substrates are made every day, the somcator tip IS changed three to four ttmes per year It IS essential that the sonifier energy output 1s the same every time a substrate is prepared. The ttp should be cahbrated wtth the somfier agamst some pressure. The setting of l-2 for the Branson Sonifier 250, used m the preparation of the emulsified hpid substrates described, corresponds to 2.5-3 g of sonic pressure
For the beginner, the somcation step IS likely to be the bottle neck m performing HSL assays usmg the lipid substrates described m Subheadings 3.1.-3.3., since it requires experience and practice to create a perfect lipid emulsion Especially the emulsion of cholesterol oleate is difficult to make (see Subheading 3.3.) In the preparation of all the lipid substrates described, we have found it useful to put the somcator tip Just at the surface and somcate for about 5 s before the actual somcation is mltiated Thts releases the lipids from the bottom and facilitates the subsequent actual somcation, where the somcator tip should be approx 1 cm below the surface Bubbles should never be created during the somcation procedure Occasioanlly It happens that visible flakes of lipid remam after the completed somcation process One can attempt to emulsify this ltptd by extending the somcatton time by up to two additional 30-s periods If this does not help, the substrate should be discarded If there are repeated problems with the somcation, it IS most lrkely that the tip needs to be calibrated against sonic pressure (see Note 3) or that the tip IS cavitated and should be exchanged The substrate preparation described IS enough for about 36 assays, three blanks, and determmation of the specific activity of the substrate (3 x 25 pL substrate) If more substrate is needed, we never attempt to somcate a larger volume, but simply make more 4 mL ahquots of substrate, and combme them after the somcation has been completed It should also be pointed out that somcated hptd substrates should be prepared fresh and used withm 3-4 h of preparation (2 h for the cholesterol oleate substrate) The recommended amounts of HSL to be used m the different assays have been given in mU of activity (based on activity with MOME, Subheading 3.1.) and have been worked out most thoroughly for rat HSL, which has a specific activity of 2 15 U/mg protein (2 7) The different assays based on lipid substrates are under optimal conditions, 1 e purified preparations of HSL and nonmhibitory concentrations of detergents, with linear reaction rates at least up to 10% of substrate hydrolysis We recommend selecting an amount of enzyme actrvlty and mcubanon time to keep substrate hydrolysis below 10% For crude HSL preparations, the assay may be lmear m a more narrow range of enzyme concentrations and assay time due to the presence of endogenous lipids and other mhtbrtory compounds m the preparations, we strongly recommend checking the lmearity m these systems Regardmg the time-scale for the assays based on emulsified lipid substrates, a reasonable number of samples (= 100) can be processed m 2 5-3 h (excluding the time required for the liquid scmtillation counting) For the step mvolvmg the transfer of the 1 mL abquot of the upper phase to 10 mL of scmtillation solution, (Subheading 3.1., step 9), it is useful to have an automatic diluter, placed in a ventilated bench or hood This speeds up this step and muumizes the exposure of the worker to the solvents It should also be pointed out that as upper phase IS sampled from the assay tubes, the walls of the tubes should not be touched with the pipet tip/dilutor tip, since they are covered with a surface film of substrate The triolem assay described m Subheading 3.2. IS the routme assay for measurmg triglyceride bpase activity of HSL, and IS performed at the optimal pH for
HSL and nCEH
119
HSL, I e , 7 0 However, to momtor the difference m activity between unphosphorylated HSL and HSL phosphorylated by CAMP-dependent protein kmase, we routmely use a 0.5 mMtrtoIem substrate (Instead of 1 67 n-&I) at pH 8.3, since assaymg under these conditions has been found to opttmtze the difference m actrvrty between unphosphorylated and phosphorylated HSL (II) For these assays of HSL acttvatton, the TO substrate is prepared m 10 mMTrts-HCl, 5 mM NaCl, 0 5 mM EDTA, pH 8 3, and HSL is diluted m 10 mA4 Trts-HCI, 5 mM NaCl, 0 5 ISEDTA, 1 mMdrthroerythrtto1, 0 02% BSA The acttvny measured using these condmons IS usually about 35-40% of that measured using the condrttons described under Subheading 3.2. 8 Although HSL IS strictly dependent on the presence of reducing substances to retam full enzymatic activity, we have recently found rt possible and of great value to reduce the dtthroerythritol concentration m the PNPB assay from 1 to 0.1 mA4 The reason for this beneficial effect IS that dithtoerythrttol greatly mcreases the blank values m the PNPB assay 9 The PNPR assay IS linear for HSL amounts of up to 50 ng, correspondmg to about 10 mU of MOME actlvrty for rat HSL
References Langm, D , Helm, C , and Lafontan, M (1996) Adtpocyte hormone-sensitive hpase a maJor regulator of hptd metabolism Proc Nutr Sot 55, 93-109 Fredrrkson, G , Tornqvtst, H , and Belfrage, P (1986) Hormone-sensmve hpase and monoacylglycerol lipase are both required for complete degradation of adtpocyte trtacylglycerol Bzochlm Bzophys Acta 876, 288-293 Holm, C , Belfrage, P , and Fredrrkson, G (1987) Immunologrcal evidence for the presence of hormone-sensitive hpase m rat tissues other than adipose ttssue Blochem Biophys
Res Commun 148,99-105
Holm, C , Ktrchgessner, T G , Svenson, K. L , Fredrtkson, G., Ntlsson, S , Miller, C G , Shrvely, J E , Hemzmann, C , Sparkes, R C , Mohandas, T , Lusts, A J , Belfrage, P , and Schotz, M C (1988) Hormone-sensitive hpase Sequence, expression, and chromosomal locahzatton to 19 cent-q1 3 3 Sczence 241, 1503--1506 Yeaman, S. J. (1990) Hormone-sensitive ltpase - a multtpurpose enzyme m ltptd metabolrsm. Blochzm Bzophys Acta 1052, 128-I 32 Stenson Holst, L , Hoffmann, A M., Mulder, H , Sundler, F , Holm, C , Bergh, A , and Fredrrkson, G (1994) Localtzatron of hormone-sensttive lrpase to rat Sertolt cells and Its expression in developmg and degenerating testes FEBS Lett 355, 125-130 Stenson Holst, L., Langm, D , Mulder, H , Laurell, H., Grober, J., Bergh, A , Mohrenwelser, H W , Edgren, G., and Holm, C (1996) Molecular clonmg, genomtc orgamzatron, and expression of a testicular rsoform of hormone-senstttve ltpase Genomzcs 3544 1-447. Khoo, J C , Reue, K., Steinberg, D , and Schotz, M. C (1993) Expression of hormone-sensitive lease mRNA m macronhaees .!,z& Res 34. 1969-1974
120
Ho/m and Osterlund
9 Contreras, J A and Lasuncion, M A (1994) Essential differences m cholesteryl ester metabolism between human monocyte-derived and 5774 macrophages Artersloscler Thromb 14,443-452 10 Small, C A , Goodacre, J A , and Yeaman, S J (1989) Hormone-senstttve ltpase is responsible for the neutral cholesterol ester hydrolase activity m macrophages FEBS Lett. 247,205-208 11 Stralfors, P and Belfrage, P (1983) Phosphorylation of hormone-sensitive hpase by cyclic AMP-dependent protein kmase J Bzol Chem 258, 15,14&l 5,152 12 Strilfors, P , BJorgell. P., and Belfrage, P (1984) Hormonal regulation of hormone-senstttve ltpase m mtact adtpocytes. Identification of phosphorylated sites and effects on the phosphorylatlon by lrpolytlc hormones and msulm Proc Nut1 Acad Scl USA 81,3317-3321 13 Garton, A J , Campbell, D G , Cohen, P , and Yeaman, S J (1988) Primary structure of the site on bovine hormone-sensitive hpase phosphorylated by cychc AMP-dependent protein kmase FEBS Lett 229,68-72 14 Langm, D , Laurell, H , Stenson Holst, L , Belfrage, P , and Holm, C (1993) Gene organization and primary structure of human hormone-sensitive lrpase Possible sequence significance of a sequence homology with a lipase of Moraxella TA 144, an antarctic bacterium Proc Nat1 Acad Scz USA 90,4897+901 15 Degerman, E , Leroy, M J., Taira, M., Belfrage, P., and Mangamello, V. C (1996) A role for msulm-medrated regulation of cyclic guanosme monophosphate (cGMP)-mhtblted phosphodlesterase m the antiltpolytic action of msulm, m Dlabetes A4ellztu.s (LeRonh, D , Taylor, S I , and Olefsky, J M , eds ), LippmcottRaven, Philadelphia, pp 197-204 16 Fredrikson, G , Stralfors, P , Nilsson, N 0 , and Belfrage, P (198 1) Hormonesensitive lipase of rat adipose tissue Purification and some properties J Blol Chem 256,63 1 l-6320 17 Bsterlund, T , Damelsson, B , Degerman, E , Contreras, J A , Edgren, G , Davis, R C , Schotz, M C , and Holm, C (1996) Domain structure analysis of recombtnant rat hormone-sensitive hpase Bzochem J 319,4 11420 18 Contreras, J A , Karlsson, M , (dsterlund, T , Laurell, H , Svensson, A , and Holm, C (1996) Hormone-sensitive lipase is structurally related to acetylcholmesterase, bile salt-stimulated ltpase, and several fungal lipases Bulldmg of a three-drmenslonal model for the catalytic domain of hormone-sensitive hpase J Bzol Chem 271, 31,42631,430 19 Fredrikson, G , Stralfors, P , Ntlsson, N. 0 , and Belfrage, P (1981) Hormonesensitive lipase from adipose tissue of rat. Meth Enzymol 71, 637646 20 Belfrage, P and Vaughan, M (1969) Sample liquid-liquid partmon system for isolation of labeled olelc acid from mixtures with glycerides J Lzpid Res 10, 341-344 21 Tornqvist, H., BJOrgell, P, Krabisch, L , and Belfrage, P (1978) Monoacylmonoalkylglycerol as a substrate for dlacylglycerol hydrolase activity m adipose tissue J Llpld Res 19, 654-656 22 Shiral, K. and Jackson, R L. (1982) Lipoprotein hpase-catalyzed hydrolysis ofpmtrophenyl butyrate Interfacial actlvatlon by phospholiptd vesicles J Bzol Chem 257, 1253-1258
HSL and nCEH
121
23 Martmelle, M , Holmqmst, M , and Hult, K (1995) On the mterfactal acttvatton of Candlda antarctzca hpase A and B as compared with Humicola lanuglnosa llpase Blochim
Bzophys Acta 1258,272-276.
24. Frayn, K N., Langm, D., Holm, C., and Belfrage, P. (1993) Hormone-senstttve hpase‘ quantttatton of enzyme acttvtty and mRNA level m small btopsres of human adipose ttssue Clan Chum Acta 216, 183-l 89. 25 Egan, J J , Greenberg, A S , Chang, M.-K., Wek, S. A , Moos, Jr , M C , and Londos, C (1992) Mechanism of hormone-stimulated lipolysts m adtpocytes Translocatron of hormone-senstttve ltpase to the lipid storage droplet Proc Natf Acad Scl USA
89,8537-8541
26 Hirsch, A.H and Rosen, 0 M (1984) Ltpolyttc stimulation modulates the subcelhtlar dtstnbution of hormone-senstttve hpase m 3T3-Ll cells JLzprd Res. 25, 665-677 27 Holm, C , Schotz, M C , and Contreras, J A High-level baculovtral expression of hormone-sensitive hpase This volume [ 191
12 Lecithin-Cholesterol
Acyltransferase
Assay of Cholesterol Esterification and Phospholipase A2 Activities John S. Parks, Abraham
K. Gebre, and James W. Furbee
1. Introduction Lectthm:cholesterol acyltransferase (LCAT; EC 2 3 1.43) is a 67 kDa glycoprotem that is responsible for cholesterol esterification m plasma (I). LCAT has an important physiologrcal role m the maturation of nascent, discoidal high density lipoprotems (HDL) to mature, spherical HDL, through the generation of a cholesteryl ester (CE)-enriched core (2,3). The enzyme has also been mrplicated m the reverse cholesterol transport pathway, which results m the net transport of cholesterol from peripheral tissues back to the liver for excretion (I,#)). The central role of LCAT m these physiological processes IS supported by the findmg of plasma and tissue accumulation of free cholesterol and the presence of nascent, discoidal HDL particles m the plasma of familial LCAT-deficient subjects (5). The enzyme catalyzes two activities. a phospholrpase A1 (PLA.J reaction, whtch hydrolyzes the fatty acyl group from the ~2-2 position of phosphatidylcholine (PC) and a transacylase reaction, which catalyzes the transfer of the fatty acyl group from the acyl-enzyme complex to the 3-p hydroxyl group of cholesterol to form cholesteryl ester (CE) (6) The reaction IS activated by apohpoprotem A-I (apoA-I), the major apolipoprotem of HDL (7) The preferred hpoprotem substrate m plasma IS HDL, which contams the substrate lipids, cholesterol and PC, as well as the apoA-I cofactor (2,8). Esterification of cholesterol can also occur on low density lipoprotems (I). Two types of LCAT activity assaysare routmely used by mvestigators: the exogenous assay, which is a reflection of enzyme mass, and the endogenous From
Methods Edited
by
m Molecular
Bfology,
M H Doolrttle
and
l/o/ 709 Llpase and Phospholfpase K Reue
0 Humana
123
Press
Inc , Totowa,
Protocols NJ
Parks, Gerbe, and Furbee
124
assay,which measures cholesterol estertfication rate m plasma. The latter assay IS influenced by both the amount of enzyme and the type and amount of substrate hpoprotems m plasma. Both assayshave been used recently to characterize the plasma cholesterol estertfication rate and LCAT actlvrty of transgemc or gene targeted mice (P-22). Several types of exogenous substrates have been used to assayLCAT acttvtty, including proteoltposomes (IZ), mtcellar complexes, now referred to as recombmant HDL (rHDL) (13,14) and small unilamellar vesrcles (15) The advantage of these exogenous substratesover heat-mactrvated plasma as a substrate source (16) is control of the chemical composmon (r.e,, phospholiprd, cholesterol, and apollpoprotem) and the fatty acyl composrtion of the phospholtpld species Phospholtpld/ cholesterol vesicles have been shown to react poorly with LCAT compared to rHDL (I#), and require the addition of an actlvator protein to the assay. However, vesicles may be the preferred substrate particle tf one is interested m studying the effect of dtfferent proteins or peptides on LCAT actrvatlon. Proteoliposomes, another substrate parttcle that has been widely used to assay LCAT activity, are larger than rHDL, and in some cases, may be more heterogeneous and less reactive (17). This chapter will focus on the use of rHDL to measure cholesterol estertficatton and PLA,! activity as these particles are very reactive with LCAT, tend to be more homogeneous m size and chemical composmon when compared to proteohposomes, and have been well-characterized m previous studies (I&19). A simplified procedure for the measurement of the endogenous cholesterol esterifkation rate m plasma IS also presented. Albers et al (20) have previously published a descnpnon of the measurement of LCAT cholesterol estertfication actrvrty and mass. 2. Materials 2.1. Materials for Exogenous by LCAT 1 2 3 4 5 6 7 8. 9
10
Assay of Cholesterol
Esterification
Glass tubes, screw cap, 13 x 100 mm Shaking water bath, temperature controlled Argon or nitrogen Lyophtlizer Table top centrifuge. Thm layer chromatography plates, PE Silica G flextble plates (20 x 20 cm, 250 pm; Cat number 44 10 22 1, Whatman, Matdstone Kent, England) A thin-layer chromatography chamber and an iodine chamber Ltqutd scmtillatron cocktail (Bto-Safe& RPI, Mount Prospect, IL), vtals, and liquid scmtrllation counter Dralysrs tubing (6.4 mm wet diameter, 12-14 k molecular weight cut off) Organic solvents. Chloroform (Optima grade), methanol (HPLC grade), glacial
125
LCAT Assay
11
12 13
14 15 16 17. 18
19
acetic acid (ACS grade), hexane (Optima), dtethyl ether (Reagent, A CS ) (Ftsher Sctenttfic, Ptttsburgh, PA) Phosphattdylcholine (PC) stock I-palmttoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) (Sigma, St Louts, MO) in chloroform (5-10 mg/mL) Store at -20°C under argon atmosphere 1OX Trrs-buffered salme (TBS). 0 1 MTrts-HCl, 1.4 MNaCl, 0.1% EDTA, 0 1% NaN,, pH 7 4 Apoltpoprotem A-I solutton, 0 5-l 0 mg/mL m TBS. 0.01 A4 Trts-HCl, 0 14 A4 NaCl, 0 01% EDTA, 0 01% NaN,, pH 7 4 Apolipoprotem A-I can be isolated from plasma as described prevtously (21,22) or purchased from a suttable source such as Chemtcon Internattonal, Inc. (Temecula, CA) Sodium cholate (Srgma), 3 12 mg/mL m detomzed water Bovine serum albumin (essentially fatty actd free, Sigma), 12% rn TBS Store m -20°C freezer in small aliquots 100 n&’ P-mercaptoethanol, 7pL stock B-mercaptoethanol m 1 0 mL delomzed water. Make fresh dally Cholesterol, [14C], (51 mCt/mmol, 0 04 mCr/ml, 0.30 mg/mL, DuPont NEN, Boston, MA) Extraction solvent, chloroform methanol (1 2) contammg 25 pg each of free cholesterol and cholesterol oleate (Nu Chek Prep, Elystan, MN) per mL. Make fresh dally. 0.29% NaCl solution, 0 29 g/100 mL m detomzed water Store at room temperature in glass contamer
2.2. Materials for Exogenous
Assay of PLAl Activity by LCAT
1 Items 1-16 from Subheading 2.1., except that hexane and dtethyl ether (item IO) are not requtred for PLA, assay, 2 1-palm~toyl-[2-palm~toyl-9,10-3H(N)]-sn-glycero-3-phosphochol~ne (3H-DPPC), 42 Cr/mmol (Dupont) 3 Extraction solvent, chloroform. methanol (1:2) contammg 40 pg oletc acid (Srgma) per mL. Make fresh daily, 4 0 05% H,SO, solution, 0 272 mL concentrated sulfuric acid (spectfic gravity = 1 84) dtluted to 1000 mL in deromzed water. Store at room temperature m glass container.
2.3. Materials 1 2 3 4. 5
for Endogenous
Cholesterol
Esferification
by LCA T
Items 1-3, S-8, and 10 from Subheading 2.1. Orbital shaker Cholesterol, [7-3H(N)], 21 8 Cl/mmol (DuPont). Extraction solvent, chloroform: methanol (1 2) Make fresh dally 0 29% NaCl solutron, 0 29 g/100 mL in deiomzed water Store at room temperature in glass containei. 6. Free cholesterol enzymatic assay ktt (free cholesterol C krt, cat. no. 274-47 109, Wako, Richmond, VA).
126
Parks, Gerbe, and Furbee
3. Methods 3.1. Exogenous Assay of LCA T Cholesterol Esterification 3.1 1. Synthesis of rHDL (80:5:1 Molar Ratio of PC:Cholesterol:ApoA-I) 1 Pipette 4 0 mg (5 26 ymol) ahquot of PC stock mto screw cap tube. 2 Add 127 ,ug of stock soluhon “C-Cholesterol (423 pL, 16 9 ~CI, 0 329 pmol). 3 Dry solvent under mtrogen gas m a heatmg block at 35-4O“C and then lyophlllze sample for 1 h 4 Add 100 pL TBS to tube and vortex 5 Add 10 pL of 3 12 mg/mL Na cholate (7 2 pmol) to tube and vortex Gas the tube with argon or mtrogen and incubate in a 37°C water bath for 20 mm 6 Add 1 84 mg (0 0658 pmol) allquot of apoA1 to tube and enough TBS to make the final volume 0 5 mL Gas tube with argon or nitrogen. 7 Incubate the tube for another IO-15 mm at 37°C If solution does not clear, add another 5 yL 3 12 mg/mL of Na cholate and Incubate for an additional 15-20 mm at 37°C m the shaking water bath (see Note I) 8 After the solution has cleared, transfer the sample to a small dlalysls bag 9 Dialyze the sample SIX times m 1 L TBS m a cold room (4OC) m a closed contamer Purge each change of the TBS dialysis buffer with argon or nitrogen for 5 mm before dlalysls The first three dialysis steps may be 2-3 h m duration, the last three should be 10-12 h each 10 Transfer the rHDL to smtable storage tube, gas with argon and store at 4°C The cholesterol concentration of the recovered rHDL may be determined by countmg an allquot of the rHDL and usmg the specific activity of the 14C-cholesterol to calculate mass (I e., dpm/mL divided by dpm/pg= pg/mL) Further chemical and size charactenzatlon of the rHDL can be performed as needed (23-26) (see Note 2)
3 1.2. Measurement
of Cholesterol Esterif/catlon
1 Add 25 ,LJLof 12 % BSA to glass screw cap tube 2 Add 50 pL 10X TBS to the tube 3 Add enough delomzed water so that the final volume of the mcubatlon mixture after all addltlons IS 500 pL 4 Add 1.2 pg r-HDL cholesterol per mcubatlon 5 Place tubes on ice and purge with argon or nitrogen, and vortex brlefly 6 Incubate tubes at 37°C for 5 mm m shaking water bath Place tubes back on Ice 7. Add 10 FL of 100 mM /3-mercaptoethanol 8 Add the LCAT source, usually 5 PL plasma or 30-50 pL media from cells transfected with LCAT cDNA For control reactions, add TBS instead of plasma or media 9 Purge tubes with argon or nitrogen, vortex and place tubes m the 37°C shaking water bath for 5-60 mm (see Note 3) 10 After Incubation, put the tubes back on ice Add 1 9 mL of CHCl, MeOH( 1 2) contammg 20 pg/mL FC and CE to stop the LCAT reactlon and vortex sample 11 Add 0 63 mL CHCl, and vortex.
LCAT Assay
127
12 Add 0 63 mL of 0 29% NaCl and vortex 13 Splrt the phases by low speed centrtfugatton (120s1500 rpm) for 10-15 mm using a table top centrtfuge 14 Carefully aspirate the upper phase and dtscard. 1.5 Dry the lower phase under mtrogen and rmse the stdes of the tubes twice with a small volume (l-2 mL) of CHCls*MeOH(2 1) 16 Add 6-8 drops of CHC&.MeOH(2 l), vortex, and apply sample to a TLC plate TLC plates are heat activated for 30 min at 100°C Just ptror to sample applicatton 17 Saturate a filter paper (Whatman #2)-lined TLC tank wtth 70 30 2 (Hexane ether acettc acrd) for at least 30 mm before runnmg the TLC plates 18 Run the TLC plate unttl the solvent system reaches the top of the plate (2@-30 mm) 19 Dry the plate fat 10 mm, place the plate in an todme chamber and mark the ester and free cholesterol bands with a pencil once they become visible (Rf= 0 11 and 0 64 for free and esterrfied cholesterol, respectively) R,= (mtgratton distance of the band from the ortgm)/(dtstance from the ortgm to the solvent front) 20 After the iodine has subltmed from the TLC plate, cut out the free and estertfied cholesterol bands separately and place them into scmttllatton vials, add scmttllanon cocktatl and count radroacttvtty using a ltqutd scmttllatton counter 21 Calculate the fractional estertficatton as: dpm CE/(dpm FC + dpm CE) The fractional esterrficatton rate IS corrected for background actrvrty by subtractmg the fiacttonal esterrficatton rate of the control reaction The blank corrected fractional estertficatton rate IS then multtplted by the nmol of free cholesterol orlgmally m the mcubatron mtxture (i.e , 1 2 ug cholesterol = 3 1 nmol) to give the nmol CE formed during the mcubatron The nmol CE formed can then be normaltzed for mcubatton ttme and volume of LCAT source to give nmol CE formed/h/ml
3.2. Exogenous Assay of LCAT PLA2 Activity 3.2 1. Synthesis of rHDL (8O:l Molar Ratio of PC:ApoA-I) 1. Ptpet 4 0 mg (5 26 umol) ahquot of PC stock mto screw cap tube 2 Add 182 ~CI 3H-DPPC to the tube so that the spectfic acttvtty of the PC 1s approx 1OS dpm/pg. 3 Follow steps 3-10 m Subheading 3.1.1. 4 The phospholiptd concentratton of the recovered rHDL 1s determined by chemrcal assay (23) and an ahquot of the rHDL is counted using a ltqutd scmttllatton counter to calculate specific acttvtty of the PC Further chemical and size charactertzatton of the rHDL can be performed as needed (24,26)
3.2.2 Measurement of PLA2 Actwity 1, Add 25 PL of 12 % BSA to glass screw cap tube 2 Add 50 pL 10X TBS to the tube 3 Add enough deionized water so that the final volume of the mcubatton mixture after all additrons IS 500 uL 4 Add 25 pg r-HDL phosphohptd per mcubatton
Parks, Gerbe, and Furbee
9 10 11 12 13 14 15 16 17 18 19. 20
21
Place tubes on ice and purge with argon or mtrogen, and vortex brlefly Incubate tubes at 37°C for 5 mm m the shaking water bath Place tubes back on ice Add 10 pL of 100 mM P-mercaptoethanol. Add the LCAT source, usually 5 pL plasma or 50-l 50 FL media from cells transfected with LCAT cDNA For control reactions, add TBS Instead of plasma or media Purge tubes with argon or nrtrogen, vortex and place tubes m the 37°C shaking water bath for 60 mm Put the tubes back on ice, add 1 9 mL of CHCl, MeOH( I 2) contaimng 40 pg/mL olelc acid to stop the LCAT reaction and vortex sample Add 0 63 mL CHCI, and vortex. Add 0.63 mL of 0 05% H,SO, and vortex. Split the phases by low speed centnfugahon (1200-1500 rpm) for 10-15 mm usmg a table top centrifuge Carefully suction off the upper phase and discard. Dry the lower phase under mtrogen and rinse the sides of the tubes twice with a small volume (l-2 mL) of CHCI,.MeOH(2 1) Add 6-8 drops of CHCl,.MeOH(2. l), vortex, and apply sample to a TLC plate Saturate a filter paper (Whatman #2)-lmed TLC tank with 65 45.12 6 (chloroform* methanol acetic acid. water) for at least 3 h before running the TLC plates Run the TLC plate until the solvent system reaches the top of the plate (2.5-3 h) Dry the plate for 20 mm, place the plate m an lodme chamber and mark the fatty acid band (Rr= 0 33) with a pencil once it becomes vlslble After the lodme has subhmed from the TLC plate, cut out the fatty acid band and the origin (PC band) separately and place them mto scmtlllatlon vials, add scintlllatlon cocktail and count radIoactIvIty using a liquid scmtlllatlon counter (see Note 4) Calculate fractIona fatty acid (FA) hydrolysis as dpm FA/(dpm FA + dpm PC) The fiactlonal fatty acid hydrolyzed is corrected for background activity by subtractmg the fractIona fatty acid hydrolyzed m the control reactIon The blank corrected fractlonal fatty acid hydrolyzed IS then multiplied by the nmol of PC ongmally m the incubation mixture (I.e., 25 pg PC = 32 9 nmol) to give the nmol FA hydrolyzed dunng the mcubatlon The nmol FA hydrolyzed (1 e , PLA, activity) can then be normalized for mcubatlon time and volume of LCAT source to give nmol FA hydrolyzedklml (see Note 5)
3.3. Endogenous Cholesterol Esterification by LCAT 3.3.1. Measurement of Endogenous Cholesterol Esterifrcatton Rate 1 2. 3 4
Reactions are performed with 6 x 50 mm glass culture tubes (see Note 6) Add 4 x 1O5dpm 3H-cholesterol m ethanol to each assay tube (see Note 7) Evaporate the ethanol at 50°C under mtrogen Dilute a IO-yL ahquot of plasma to 50 pL with TBS, add to a 3H-cholesterol coated tube, and Incubate overmght at 4’C with vigorous shaking (highest settmg on a Thermolyne Roto MIX orbltal shaker, 450 rpm) 5 To mltlate esterlficatlon by LCAT, transfer a 25-PL allquot of plasma to another tube and Incubate it at 37°C for 2 h The remaining plasma (control) IS kept on Ice durmg the 2 h Incubation (see Note 8).
L CA T Assay
729
6. After incubation, put the tubes on ice, brmg sample volume to 500 pL with TBS and transfer sample to a 13 x 75-mm screw top tube 7 Add 1 9 mL of chloroform: methanol (1 2) to stop the reaction and vortex 8 Follow steps 11-20 m Subheading 3.1.2. 9 Calculate the fractional esterification as dpm CE/(dpm FC + dpm CE) The fractional estertfication rate is corrected for background activrty by subtractmg the fractional esteritication rate of the 4°C (control) reaction The blank corrected fractronal esterrfication rate can then multiphed by the nmol of free cholesterol m the plasma samples, determined by free cholesterol enzymatic assay, to give the nmol CE formed during the rncubation The nmol CE formed can then be normalized for mcubahon tnne and volume of plasma to give nmol CE formed/h/ml plasma.
4. Notes 1 The solution almost always clears with the origmal 10 pL of Na cholate However, PC spectes with polyunsaturated fatty acids are generally harder to clear and require more Na cholate 2 This procedure produces rHDL that are 4 8-5 0 nm diameter and contam two molecules of apoA-I per particle Other PC species result m greater size heterogeneity 3 These mcubation conditions result m substrate saturation while keepmg the fractional estertficatron rate ~0.2. Because LCAT acttvity is much higher m plasma than m media from transfected cells, 5 mm mcubatrons are necessary to keep fractional esterrficatron rates below 0.2 4 If a [ 14C]-PC species is substituted for 3H-DPPC m the rHDL preparation, the PC and FA fractions should be quantified with a wide open channel on the liquid scmtillation counter Radiolabeled [14C]-PC m the presence of silica gel shifts the i4C energy spectrum mto the 3H channel, resultmg in less apparent r4C radiolabel when dual channel (3H and 14C) counting IS used 5 Because background PLA, activity of LCAT IS higher than that for cholesterol estenfication, tt IS advisable to run duphcate or triphcate control tubes for a better estimate of the LCAT independent release of FA 6 Glass tubes must be used. The cholesterol appears to bmd irreversibly to plastic tubes 7 If the 3H-cholesterol IS older than several months, it should be repurified by TLC usmg the same neutral solvent system used in Subheading 3.1.2. 8 The reaction rate is typically linear from 0.5-2 h with normal human and mouse plasma, but a time course should be performed nntially to verify lmear range for specific samples used
Acknowledgments This work was supported by NIH grants HL 49373 and HL 54176 References 1 Glomset, J. A (1968) The plasma 1ecithm:cholesterol acyltransferase reaction J Lipid Res 9, 155-I 67.
130
Parks, Gerbe, and Furbee
2 Hamtlton, R .L , Wtlltams, M. C , Fteldmg, C.J , and Havel, R J (1976) Discolda1 bllayer structure of nascent high density ltpoprotems from perfused rat ltver J Clm Invest 58,667-680 3 Babtak, J , Tamacht, H , Johnson, F L , Parks, J S , and Rudel, L L (1986) Lectthm cholesterol acyltransferase-Induced modificattons of liver perfusate drscotdal high density ltpoprotems from African green monkeys. J Lzpzd Res 27, 1304-1317. 4 Fielding, C J and Fleldmg, P E. (1995) Molecular physiology of reverse cholesterol transport J Lipid Res 36,21 l-228 5 Glomset, J A , Norum, K R., and King, W (1970) Plasma hpoprotems in famtlla1 lecrthm cholesterol acyltransferase deficiency ltptd composition and reacttvtty m vitro J. Clzn Invest 49, 1827-1837 6 Jauhtamen, M and Dolphm, P J (1986) Human plasma lectthm-cholesterol acyltransferase. An elucidation of the catalyttc mechanism J Blol Chem 261, 7032-7043 7. Freldmg, C J , Shore, V G , and Fteldmg, P E (1972) A protem cofactor of lectthm cholesterol acyltransferase. Blochem Blophys Res Commun 46,1493-1498 8 Glomset, J A., Janssen, E T., Kennedy, R., and Dobbms, J (1966) Role of plasma lecrthm*cholesterol acyltransferase m the metaboltsm of high denstty hpoprotems J Llpld Res 7,638-648 9 Mehlum, A , Staels, B , Duverger, N , Tatlleux, A , Castro, G , Ftevet, C , Luc, G., Fruchart, J.-C , Oltvecrona, G., Skrettmg, G , Auwerx, J , and Prydz, H (1995) Ttssue-spectftc expresston of the human gene for 1ecrthm:cholesterol acyltransferase m transgemc mace alters blood ltptds, ltpoprotems and ltpases towards a less atherogemc profile Eur J Blochem 230, 567-575 10 Brousseau, M. E , Santamarina-FoJo, S., Zech, L A , Btrard, A M , Vatsman, B L , Meyn, S M , Powell, D , Brewer, H B., Jr , and Hoeg, J M ( 1996) Hyperalphahpoprotememta m human lectthm cholesterol acyltransferase transgemc rabbits In VIVO apohpoprotem A-I cataboltsm IS delayed m a gene dose-dependent manner. J Clm Invest 97, 1844-1851 11 Sakat, N , Vatsman, B L , Koch, C. A , Hoyt, R F , r , Meyn, S. M , Talley, G D , Paz, J A , Brewer, H B , Jr , and Santamarina-FoJo, S. (1997) Targeted dtsruptton of the mouse lectthmcholesterol acyltransferase (LCAT) gene - Generatton of a new animal model for human LCAT deficiency J Bzol Chem 272,750&-75 10. 12 Chen, C H and Albers, J J (1982) Charactertzatton of proteoliposomes contammg apoprotem A-I* a new substrate for the measurement of lectthm cholesterol acyltransferase activity. J Lzpzd Res. 23, 68&69 1 13 Matz, C E and Jonas, A, (I 982) Mlcellar complexes of human apoltpoprotem AI with phosphattdylcholmes and cholesterol prepared from cholate-lipid dlsperslons J BJO~ Chem 257,4535-4540. 14 Matz, C E and Jonas, A. (1982) Reaction of human lectthm cholesterol acyltransferase with synthetic mlcellar complexes of apolipoprotem A-I, phosphatldylcholme, and cholesterol J Blol Chem 257,454 l-4546
LCA T Assay
131
15 Aron, L , Jones, S , and Fielding, C J. (1978) Human plasma lecithm-cholesterol acyltransferase Characterrzatron of cofactor-dependent phosphohpase activity J Blol Chem. 253,722&7226 16 Stokke, K T and Norum, K R (1971) Determmatron of lecithm.cholesterol acyltransfer m human blood plasma Stand J. Clan Lab Invest 27, 2 l-27 17 Parks, J S , Bullock, B C , and Rudel, L L. (1989) The reactivrty of plasma phosphohpids with lecithm cholesterol acyltransferase 1s decreased m fish oil-fed monkeys J Brol Chem 264,2545-2551 18 Jonas, A (1986) Synthetic substrates of lectthm cholesterol acyltransferase. J Lipid Res 27, 689-698 19 Jonas, A (1991) Lecrthm-cholesterol acyltransferase m the metabolism of highdensrty hpoprotems Brochlm Blophys Acta 1084, 205-220 20 Albers, J J , Chen, C H., and Lacko, A. G (1986) Isolation, characterization, and assay of lecrthm-cholesterol acyltransferase Methods Enzymol 129, 763-783 21 Parks, J S and Rudel, L L (1979) Isolation and characterization of high density hpoprotem apoprotems m the non-human primate (vervet) J Blol Chem 254, 67 16-6723 22 Miller, K. R and Parks, J S (1997) Influence of vesicle surface composition on the mterfactal bmdmg of lecithm.cholesterol acyltransferase and apohpoprotem A-I J Llpld Res 38, 1094-l 102 23 Rouser, G , Fleischer, S , and Yamamoto, A (1970) Two dimensional thm layer chromatographic separation of polar lipids and determmation ofphospholipids by phosphorus analysis of spots Llplds 5,494-496 24 Lowry, 0 H , Rosebrough, N J., Farr, A L., and Randall, R J. (1951) Protein measurement with the Folm phenol reagent J Blol Chem 193,265-275 25 Auerbach, B J , Parks, J S., and Applebaum-Bowden, D (1990) A rapid and sensitive rmcro-assay for the enzymatrc determmation of plasma and hpoprotem cholesterol J Llpzd Res 31,738-742 26 Rainwater, D L., Andres, D W , Ford, A. L , Lowe, W F , Blanche, P J , and Krauss, R M (1992) Productron of polyacrylamide gradient gels for the electrophoretx resolution of lrpoprotems J Llpzd Res 33, 1876-l 88 1
13 Purification of Lipases and Phospholipases by Heparin-Sepharose Chromatography Akhlaq A. Farooqui
and Lloyd A. Horrocks
1. introduction In recent years heparin-Sepharose chromatography has revoluttomzed the purlficatton ofenzymes and macromolecules. This method utthzes the specific and electrostatic interactions of heparm with enzymes, growth factors, receptors and blood coagulation factors (1-3). The general scheme of heparmSepharose chromatography mvolves the covalent attachment of heparm to Sepharose. A crude tissue preparation 1sthen applied to the column, only those enzymes and macromolecules that specifically/electrostattcally interact with heparm are retamed on the column while the other protems having no affinity for heparm are washed out. The retamed enzymes and macromolecules can be eluted from the column either by the addttton of an excess of heparm to the equthbratmg buffer or by using substances such as salts or denaturants (2). Theoretically, the success of heparm-Sepharose chromatography depends largely upon how closely the condttions used in the experiment mimic the native btological interactions Heparm is a lmear, naturally occurrmg, highly sulfated glycosammoglycan with anticoagulant and antihpemic properties (4). It is characterized by the presence of 2-acetamide-2-deoxy-u-D-glucopyranosyl and a-o-glucopyranosyl-uromc acid residues contammg various proporttons of O-sulfate, N-sulfate and acetyl groups In the dtsaccharide repeating units of heparm, glucuromc acid and D-glucosamine are linked by a-1,4-glycostdtc hnkages (2). Heparm exists m a wide range of molecular weights (5-40 kDa) It IS highly negatively charged and appears to occur entirely m mast cells. Because of Its unique structure and surface charge dtstribution, heparm IS able to mteract strongly wtth many enzymes and macromolecules m two ways. a posttive, From
Methods in Molecular Bfology, Vol IO9 Lfpase and Phosphobpase Protocols Echted by M H Doohttle and K Reue 0 Humana Press Inc , Totowa, NJ
133
734
Farooqui and Horrocks Phospholipase
A,
,
Ca2+ -dependent
’ Ca2+ -independent
PLA, PLA,
A TAG-lipase
Phosphohpase
Lysophospholipase
D 4
Lipoprotem
Phospholipase
lipase
C
DAG-lipase 7 Phospholipase
A,
Fig 1 Interactions of heparin with hpasesand phosphohpases cooperative bmdmg, and specific binding (45) In posmve, cooperative bmdmg, heparm binds to a protein at different sites, and the affinity shown at each mdivtdual mteractmg site contributes to the overall affinrty of the heparm for its protein hgand An example of a posmve, cooperative interactron 1s that between heparin and a hpoprotem particle wtth several apohpoprotem molecules (6,7), In specific bmdmg, non-heparm glycosammoglycans cannot substitute for heparm, neither m their ability to bind spectfically to a protein, nor in their ability to exert a biological activity An example of a specific heparmprotem mteraction is the binding between heparm and anttthrombm III (2) When a protein is bound to heparm, its biological activity ts either enhanced or decreased; when heparm ISthen removed, the original activity of the protein is restored. This restorattve property plays an important role m the purtficatton of enzymes and growth factors by heparm-Sepharose chromatography Most lipases and phospholtpases AZ, C, and D interact with heparin (Fig. 1). This glycosammoglycan affects activities of these enzymes in a dose-dependent manner (8,9) Lipases and phospholipases AZ, C, and D contain Arg, Hts and Lys residues (10). Circular dichroism studies have indicated that these amino acids play an important role in the bmdmg of hpases and phosphohpases A,, C, and D to heparm (11-16). Interactions of basic ammo acids with heparm block the interfacial recognmon site by preventing iomc mteractions. Another possibihty is that heparm can bind to phosphohpid or neutral lipid substrate, and can interfere with the interaction between enzyme and substrate Ltpases and phosphohpases A,, C, and D have been successfully purified by heparm-Sepharose column chromatography (Table 1). Heparm-Sepharose is
Heparln-Sepharose
135
Chromatography
Table 1 Lipases and Phospholipases Purified by Heparin-Sepharose Chromatography Enzyme (reference)
Fold purificatton
1
10
2. 3 4
6250 7430
Dtacylglycerol ltpase (38) Trtacylglycerol hpase (I 7) Lipoprotein hpase (17) Phosphohpase A2 (12) 5 Phospholtpase AZ (39) 6. Phosphohpase A2 (22) 7 Phosphohpase A2 (21) 8 Phosphohpase C (13) 9 Phospholtpase C (40) 10 Phosphohpase C (40) 11 Phospholtpase D (28)
17 4
61 3 7 17 9
10
packed mto a column and washed with M-bed vol of the destred buffer. Crude of ltpolyttc enzymes are dralyzed agamst the equthbratmg buffer and applred to the heparm-Sepharose column. Enzymes that Interact wrth tmmobrhzed heparm are retained and all other proteins are washed out. The retained enzymes can be eluted from the column with a gradrent of NaCl or heparin (17-29) This chapter begins by describing several methods for the couplmg of heppreparations
arm to Sepharose, and procedures for determming
coupling
effictency.
As an
alternative to preparmg heparm-Sepharose m the laboratory, varrous affimty supports coupled to heparm are now commercrally avarlable, and some of these commercral preparations are hsted below. The chapter ends by descrrbing general procedures for enzyme purrficatron usmg heparm affimty chromatography u-rboth low pressure and high pressure (HPLC, FPLC) systems. 2. Materials 2.1. General Reagents 1 Heparm (Stgma, St LOUIS, MO) 2 Sepharose 4B (Srgma). 3 Cyanogen bromide, dtmethylformamide, trtethylamme, and cyanurtc chlortde (2, 4, &trtchloro- 1, 3, 5-trtazme) (Stgma) 4 Commerctally avatlable heparm-coupled supports heparm-Sepharose (Stgma), Afft-Gel heparm gel (Bto-Rad, Hercules, CA), hepartn-Toyopearl (TOSO, Tokyo, Japan), and HI-Trap heparm-Sepharose HPLC column (Pharmacra, Sweden). 5 All other reagents were purchased from Stgma
Farooqui and Horrocks
136 2.2. Cyanogen
Bromide Procedure
1 5 mL Sepharose 4B 2 Cyanogen bromide (0 25 g) in 0 5 mL of cold drmethylformamtde, should be freshly prepared 3 SNNaOH 4 Heparm ( 15 mg) m 15 mL of 0 1 M NaHC03 5 0 6 mL Trrethylamme 6 0 02 A4 Trts-HCl buffer, pH 7 0, containing 0 5 nuI4 EDTA. 7 0 02 MTns-HCl buffer, pH 7 0, contammg 0.05 mMEDTA and 0.05% sodium azrde.
2.3. Cyanuric 1 2 3 4 5. 6 7
Chloride
Procedure
5 mL Sepharose 4B 200 mL of 1 MNa2C03 Heparm (10 mg) m 0 5 mL 1 MNa,COs. Cyanurtc chloride (0 1 g) dissolved m 1 5 mL acetomtnle. Water.ethanol trrmethylamme (2 1 1, [v/v]) 0 05 M Trrs-HCI buffer, pH 7 0, containing 0.5 mM EDTA 0 05 MTrrs-HCl buffer, pH 7 0, containing 0 5 mJ4EDTA and 0.05% sodium azlde.
2.4. Protein-Dye-Binding
Reaction
1. Phosphate buffered salme (PBS 0 15 MNaCl m 10 &phosphate buffer, pH 7 2). 2 Heparm standards. Make up a series of 100 pL standards representmg O-10 mg heparm m PBS To each standard, add 200 pL of a bovine serum albumin (BSA) solution (100 mg/mL m PBS). Finally, add 0 5 mL of PBS to each standard to give a final volume of 0 8 mL containing 20 mg BSA and O-10 mg heparin 3 Bradford protem assay reagent (37) To make stock solutron, dissolve 100 mg Coomasste Brtlhant Blue G-250 m 50 n-J. 95% ethanol Add 100 mL of 85% phosphoric acid For working solution, dilute 150 mL stock solutron to 1 L with water
2.5. Calorimetric
Determination
of Heparin Bound to Sepharose
1 0 2% NaCl solution 2 Standard heparm solutton dissolve 16 6 mg heparm m 200 mL of 0 2% sodmm chloride (w/v) 3 Tolmdme blue solutton, 0 005% (freshly prepared) drssolve 25 mg tolmdme blue m 500 mL of 0 01 N HCI 4 Hexane (100 mL) 5 Absolute ethanol (50 mL)
2.6. Purification of Enzymes by Heparin Chromatography Using Low Pressure or High Pressure Systems (HPLC or FPLC) 1 Heparin-Sepharose or heparm coupled Toyopearl) 2 Pre-equrlibratron buffer* 0 02 A4 Tns-HCl
to other approprrate
supports
buffer, pH 7 4, store at 4°C
(e g ,
Heparin-Sepharose
Chromatography
137
3. Heparm elutton buffer. Heparm (1 mg/mL) m 0.02 MTns-WC1 buffer, pH 7.4 4. NaCl elution buffer O-l MNaCl m 0.02 MTris-HCl buffer, pH 7.4 @near gradient)
2.7. Regenerating
Heparin-Sepharose
1. 1 M NaCl in 0 1 M borate buffer, pH 9 8 2. 0 1 A4 borate buffer, pH 9 8 3, For storage of column. 2 A4 NaCl wash solution and 2 M NaCl contammg 0.1-0.02% thlmerosal or sodmm azlde
3. Methods 3.7. Atfachment of tfeparin to Solid Supports The ideal matrix for the attachment of heparm should be hydrophilic, inert, rigtd, spherical and stable to chemical and mlcroblal degradation Sepharose IS the trade name of the beaded agarose (a lmear polysaccharlde conslstmg of alternating residues of o-galactose and 3,6-anhydro-L-galactose) This matrix has been used extensively for the coupling of heparm. The major requirements for heparm lmmoblllzatlon are the synthesis of a stable linkage between heparin and the support matrix and, perhaps most Importantly, retention of specific heparin binding characteristics of the Immobilized heparin. Heparm has been coupled to Sepharose, Affi-Gel polyacrylamlde and Toyopearl gel by several procedures (2,3/I-32). Several factors affect the couplmg of heparin to the matrix They are the pH of the coupling buffer, temperature, reaction time, and amount of reacted heparm. Two methods are given below that can be used to Immobilize heparm to Sepharose 4B, the cyanogen bromide and cyanuric chloride procedures. The resulting heparinSepharose gel IS quite stable and can be autoclaved (see Note 1) 3. I. 1. Cyanogen Bromide Procedure 5 mL of Sepharose 48 IS washed twice with distilled water by decantatlon and suspended m 15 mL of dIstilled water 0 25 g of cyanogen bromide IS dissolved m 0 5 mL of cold dlmethylformamlde and added with stlrrmg to the Sepharose suspension on Ice The pH of the reactlon should be maintained between 10.5 and 11 5 with 5 NNaOH The reaction IS allowed to contmue with gentle stlrrmg until the pH remams nearly constant (approx l-l 5 h) This procedure should be performed m the fume hood. The suspension IS then poured over a fretted glass filter and the cyanogen bromlde-activated Sepharose 4B ts washed with 80 mL of water. This procedure should be performed m the fume hood. The Sepharose paste is then suspended in 15 mL of 0 1 M NaHCO, contammg 15 mg of heparin and the suspension IS stlrred slowly overmght at 4°C 0 6 mL of trlethylamme is then added to the suspension and stn-rmg is contmued for another 4 h
138
Farooqui and Horrocks
6 The heparm-Sepharose IS collected on a fretted glass filter and washed with 30 mL of water. 7. The heparin-Sepharose IS then suspended m an equal volume of buffer contammg 20 mA4 Tns-HCl buffer, pH 7 0, and 0.5 mM EDTA, and stored m the same buffer with 0 05% sodium azlde (see Note 2).
3.1.2. Cyanuric Chloride Procedure 1 5 mL of Sepharose 4B 1s washed five times with 15 mL of I M Na$O, and the excess of Na2C03 IS removed by drammg 2 10 mg of heparm dissolved m 0 5 mL of 1 M Na,C03 and 0 1 g of cyanurlc chloride suspended m I 5 mL of acetorutrlle are added to Sepharose 4B with constant shaking for 1 h at 65°C The pH IS mamtamed at 11 0 with 1 MNa,CO, The reaction mixture ~111turn yellow during the reaction (33) 3. The reactlon mixture IS filtered through a Buchner funnel with filter paper and washed with 50 mL of water-ethanol-tnmethylamme (2 1.1, [v/v]) 4. The heparin-Sepharose IS washed and stored m 50 n&I Tns-HCI buffer, pH 7 0, contammg 0 5 mM EDTA and 0 05% sodium azlde (see Note 2)
3.2. Determination of Heparin in Heparin-Sepharose Samples The heparm content of heparm-Sepharose can be estimated by determmmg the hexosamme, uranic acid or sulfate contents of the resm after couplmg. Using this method, these heparm constituents m the reaction mixture are determmed prior to coupling and are compared to the free heparm that is left m the supernatant and washing solution after couplmg. The difference 1staken as the amount of heparm bound to Sepharose (2). The amount of heparm m the heparm-Sepharose gel can also be directly determined potentlometrlcally by the tltratlon of heparm carboxyl groups (34). Given below are two procedures that can be used to quantltate the amount of heparin covalently bound to the support matrix. In the first method, the amount of heparm m the reaction mixture before and after couplmg IS determined by assessing the interference by heparm m the Bradford dye-binding assay for protems (36). This method 1sextremely sensitive, rapid, and mexpenslve, and It IS capable of dlstmgulshmg between heparm and other polysacchandes. In the second method, a colorlmetrlc determination of the heparm bound to the Sepharose matrix IS described using the dye-binding mteractlons of O-toluldme blue (35). 3 2.7 Protein-Dye-Binding
React/on
1 Prepare heparm standards (O-10 mg of heparm) m glass tubes as described m Subheading 2.4. For the preparation of unknown samples, add up to 0 6 mL of an unknown heparm solution mto glass tubes contammg 0 2 mL of 100 mg/mL bovme serum albumin; if ~0 6 mL of unknown solution IS used, make up the remammg volume with PBS
Heparin-Sepharose 2 3 4 5
Chromatography
139
To each tube, add 0 2 mL of Bradford protem assay reagent Vortex to mix well After 30 mm of mcubatlon at room temperature, read absorbance at 595 nm. Prepare a standard curve by plotting the percent decrease in color yield (DECOY) versus heparm (O-10 mg) m the standard solutions usmg the following equation DECOY (%) = Abs - Abs. I x 100, Abs
where Abs and Abs I are absorbances at 595 nm m the absence and presence of 1mg of heparm solution, respectively 6 Determine the concentration of heparm m the unknown solution by the standard curve
3.2.2. Calorimetric Determinatron of Heparin Bound to Sepharose Reagents 1 1O-70 pg of the standard heparm solution, or desired amounts of the slurry of heparm-Sepharose 4B, are added to 2 5 mL of 0.005% toluidme blue m a test tube 2 Each tube IS then diluted with 0.2% NaCl to a total volume of 5 mL 3 Vortex each tube for 30 s 4 Add 5 mL of hexane to each tube and vortex for another 30 s 5 Centrifuge at 1OOOgfor 3 mm to break phases 6 Remove an ahquot of the top aqueous layer, and dilute I 10 with absolute ethanol 7 After 30 mm mcubatlon at room temperature, read absorbance at 63 1 nm
3.3. Purification Chromatography
of Enzymes by Heparin-Sepharose/-Toyopearl
Success for the purlfkatlon of hpases and phospholipases by heparm affinIty chromatography depends upon the following requirements: (1) the protem to be isolated should bind m a reversible way to heparm with an affinity such that It can be retained on the heparm-Sepharose while the other proteins are washed away; (2) the enzymes should interact with heparm-Sepharose with an affinity allowing its elutlon by the free llgand or by other non-denaturmg agents, and (3) accompanymg proteins should not bmd to the matrix, or, tf retained, should not be eluted under the conditions used for the llpase or phosphohpase. Given below are are general procedures that can be used to develop specific methods for the purlficatlon of particular enzymes. Heparm affinity chromatography IS often used as the lmtlal step m a multi-step purification protocol for the Isolation of specific llpases and phosphohpases (e.g., see Chapters 14-l 6).
3.3 7 Purification of Enzymes by Low Pressure Hepann-Sepharose/ Toyopearl Column Chromatography. 1 Pre-equlhbrate the heparm-Sepharose column with at least 5-10X the bed volumes of pre-equlhbratmg buffer (e g , 20 m&I Tns-HCl, pH 7 4) at the flow rate of < 2X the bed vol/h.
Farooqui and Horrocks
140
2 Load the enzyme sample m the pre-equlhbratmg buffer at the flow rate of 0.5X the bed volume per hour Because of high bmdmg capacity of heparm-Sepharose, a large amount of protein can be loaded onto a small column so that the enzyme can be eluted m a small volume (see Note 3). 3 After loading the sample, wash the column with 4X the bed volumes of preequlhbratmg buffer at the flow rate of 1X the bed volume per hour 4 Elute the bound enzyme by either 1 mg/mL of heparin solution or a 0-l M NaCl linear gradrent In pre-equilibrating buffer at the flow rate of 1X bed vol/h If actlvlty IS not required, the bound enzyme can also be eluted by using denaturants such as guanidme-HCl or urea
3.3 2. Purification of Enzymes by High Pressure Heparin Sepharose Chromatography (HPLC or FPLC) 1 Pre-equilibrate the heparm-Sepharose column for 2 h using pre-equlllbratmg buffer (e g , 20 mMTns-HCI, pH 7.4) at the flow rate of 1 mL/mm 2 Load the enzyme m the pre-eqmhbratmg buffer at the flow rate of 1 mL/mm 3 After loading, wash the column with 4X bed volumes of pre-equlllbratmg buffer at the flow rate 1 mL/mm 4 Elute the bound enzyme by either 1 mg/mL of heparin solution or &l M NaCl linear gradient m pre-equilibrating buffer at the flow rate 1 mL/mm. This procedure results m separation of isoforms of enzymes (see Notes 4 and 5)
3.3.3. Regeneration
of Hepann-Sepharose
1 Wash the heparm-Sepharose column with 10X column volumes of 1 MNaCl m 0 1 M borate buffer, pH 9 8 2 Wash the column with 10X column volumes of 0 1 M borate buffer, pH 9 8 3 Wash the column with 10X column volumes of double distilled water 4 For immediate usage, equilibrate the column with the buffer of choice For storage, wash the column with 10X column volume of 2 M NaCl Store packed column uprrght with caps at 4°C m the presence of thimerosal or sodium azlde (0 01-0.02%) The gel should be stable for at least 2 yr m the presence of bacteriostatlc agents and proper buffer at neutral pH
4. Notes 1 Heparm-Sepharose can be sterilized by autoclavmg at pH 7 0 at 120°C It has excellent flow properties and packs well into columns Recently, the HlTrap heparm-Sepharose HPLC column 1s also avallable (Pharmacia). 2 The swollen heparm-Sepharose IS stable for at least 2 yr at 4°C m the presence of 0.02% merthlolate (thlmerosal), or 0.05% sodium azlde 3 Because of Its polymeric and polyamomc properties, the lmmoblllzed heparm has a high bmdmg capacity, and this allows the use of a small bed volume. As a result, enzymes are eluted from the column m small volumes with hrgh activity 4. The elution of lipases and phospholipases from heparm-Sepharose columns by heparin or other polyamomc polysaccharldes gives sharper peaks than elutlon by
Hepann-Sepharose
Chromatography
141
a salt gradtent 5 An important feature of heparm-Sepharose chromatography IS that it can resolve multiple forms (tsozymes of hpases and phospholipases). It IS not possible to separate the multtple forms of the above enzymes by ton-exchange and hydrophobtc chromatographies Multtple forms of phosphohpases A, (12) and phospholtpases C (13-16) can be separated eastly from crude extracts ustng heparm-Sepharose chromatography
Acknowledgments Supported by grants NS- 10165 and NS-29441 from the Natlonal Institutes of Health, U S. Pubhc Health Serwce. References 1 Farooqut, A A , Yang, H -C and Horrocks, L A (1994) Purtficatron of hpases, phospholtpases and kmases by heparm-Sepharose chromatography J Chromatogr A, 673, 149-158 2 Farooqur, A A and Horrocks, L A (1984) Heparm-Sepharose affinity chtomatography Adv Chromatogr 23, 127-147 3 Kan, M., Wang, F , Xu, J , Crabb, J W , Hou, J and McKeehan, W L (1993) An essentral heparin-bmdmg domam m the fibroblast growth factor receptor kmase Science 259, 1918-1921 Bourm, M -C and Lmdahl, U (1993) Glycosammoglycans and the regulatron of blood coagulatton. Blochem J 289,3 13-330. Zhou, F., Hook, T , Thompson, J A and Hook, M (1992) Heparm protein mteractions Exp Med Blol 313, 141-153 Glgll, M , Ghrselh, G , Tom, G , Naggt, A and Rlzzo, V (1993) A comparatrve study of low-denstty hpoprotein mteractton wrth glycosammoglycans Blochlm Blophys Acta 1167,211-217 7 Gomez-Coronado,
D , Saez, G T , Lasuncron, M A and Herrera, E (1993) Dtfferent hydrolytic efficrencles of adtpose ttssue hpoprotem hpase on very-lowdensity ltpoprotem subfracttons separated by heparm-Sepharose chromatography
Blochim Bzophys Acta 1167,70-78. 8 Dlcctanm, M B , Mtstry, M J , Hug, K and Harmony, J A. K (1990) Inhtbttton of phosphobpase A2 by heparm Blochlm Bzophys Acta 1046,242-248 9 Yang, H -C , Farooqut, A A. and Hot-rocks, L A (1994) Effects of glycosaml-
noglycans and glycosphmgoltptds on cytosohc phosphohpases A2 from bovme brain Blochem J 299, 91-95 10 Dtcclanm, M B., Ltlly-Stauderman, M., McLean, L R , Balasubramamam, A and Harmony, J A. K (199 1) Heparm prevents the binding of phosphohpase A2 to phosphohptd mtcells. Importance of the ammo-terminus Blochemlstry 30, 9090-9097.
11 Diccianm, M. B , McLean, L R., Stuart, W D , Mtstry, M J , Gil, C M and Harmony, J A K. (199 1) Porcine pancreatic phosphohpase A2 lsoforms dtfferenttal regulatton by heparm Blochim Bzophys Acta 1082, 85-93
142
Farooqui and Horrocks
12 Hayakawa, M , Kudo, I, Tomna, M and Inoue, K (1988) Purificatton and characterization of membrane-bound phospholtpase A, from rat platelets J Bzochem 103,263-266 13. Carter, H R , Wallace, M A and Fain, J N (1990) Purtficatton and charactertzatton of PLC-b,, a muscat-mm cholmergtc regulated phospholtpase C from rabbit brain membrane Bzochzm Bzophys Actu 1054, 119-128 14 Kawaguchi, H and Yasuda, H (1988) Prostacyclm btosynthests and phosphohpase activity m hypoxtc rat myocardmm. Czrc Res 62, 1175-l 18 1 15 Faber, A and Avtram, I (1992) Human neutrophtl cytosohc phospholtpase C. parttal characterizatton Blochzm Bzophys Acta 1128, 8-13 16 Banno, Y , Nakashtma, T , Kumada, T , Ebtsawa, K , Nomomura, Y and Nozawa, Y (1992) Effects of gelsolm on human platelet cytosolrc phosphomostttde-phospholtpase C tsoenzymes J Blol Chem 267,6488-6494 17 Cheng, C -F , Bensadoun, A , Bersot, T , Hsu, J S T. and Melford, K H (1985) Purtficatton and charactertzatton of human hpoprotem hpase and hepattc trtglycerode ltpase J Blol Chem 260, 10,72&l 0,727 18 Farooqut, A A , Rammohan, K W and Horrocks, L A (1989) Isolation, characterrzatton, and regulation of dtacylglycerol hpases from the bovme bram Ann N Y Acad Scz 559,25-36 19 Kim, D K , Kudo, I, FuJimori, Y , Mtzushtma, H , Masuda, M , Ktkucht, K , Iktzawa, K , and Inoue, K (1990) Detection and subcellular locahzatton of rabbit platelet phosphohpase A2 whtch preferenttally hydrolyzes an arachidonoyl restdues J Blochem 108,903-906 20 Kim, D K , Sub, P G and Ryu, S H (1991) Purtficatton and some properttes of a phosphohpase A, from bovine platelet Blochem Blophys Res Commun 174, 189-196 21 Kim, D K , Kudo, I and moue, K (1991) Purtficatron and charactertzation of rabbit platelet cytosohc phospholtpase A, Bzochlm Bzophys Acta 1083, 8&88 22 Murakamt, M , Kudo, I , Umeda, M , Matsuzawa, A , Takeda, M , Komada, M , FuJImorl, Y , Takahashi, K. and Inoue, K (1992) Detection of three distinct phospholtpases A2 m cultured mast cells. J Blochem 111, 175-l 8 1 23 Baldassare, J J , Henderson, P A and Fisher, G J (1989) Isolation and characterization of one soluble and two membrane-associated forms of phosphomosittdespectfic phospholtpase C from human platelets Bzochemzstry 28,60 1O-601 6 24 Shaw, K and Exton, J H. (1992) Identtlicatton m bovine liver plasma membranes of a Gg-acttvatable phosphomosmde phosphohpase C Bzochemzstry 31,6347-6354 25 Homma, Y , Emori, Y , Shtbasakt, F., Suzukt, K and Takenawa, T (1990) Isolation and charactertzation of a g-type phosphomostttde-specific phospholtpase C (PLC-g,) Bzochem J 269, 13-18 26 Okamura, S -1 and Yumashtta, S (1994) Purtfication and charactertzatton of phosphattdylcholme phospholtpase D from prg lung J Bzol Chem 269,3 1,207-3 1,2 13 27 Nakamura, S -1 , Kiyohara, Y , Jmnai, H , Hitomt, T , Ogmo, C , Yoshtda, K and Ntshtzuka, Y (1996) Mammaltan phospholipase D* phosphattdylethanolamme as an essential component Proc Nat1 Acad Scz USA 93,430(X-4304
Heparin-Sepharose
Chromatography
143
28 Steed, P M., Nagar, S and Wennogle, L P (1996) Phosphohpase D regulatron by a physrcal mteractton with the actm-bmding protein gelsolm. Bzochemzstry 35, 5229-5237 29 Massenburg, D , Han, J -S , Ltyanage, M , Patton, W A., Rhee, S G , Moss, J and Vaughan, M (1994) Actrvation of rat bram phospholrpase D by ADPrrbosylatron factors 1,5, and 6 Separation of ADP-rtbosylatton factor-dependent and oleate-dependent enzymes. Proc Nat1 Acad Scz USA 91, 11,718-l 1,722. 30. Schnaar, R L (1984) Immobtltzed glycoconmgates for cell recogmtron studres. Anal, Blochem 143, 1-13 31 Sasakr, H , Hayashr, A , Knagakt-Ogawa, H , Matsumo-To, I and Seno, N. (1987) Improved method for the rmmobilrzatron of heparm .I. Chromatogr 400, 123-I 32 32. Narayanan, S R., Kakodkar, S V and Crane, L J. (1990) “Glutaraldehyde-P”, a stable, reactive aldehyde matrtx for affinity chromatography. Anal Btochem 188, 278-284 33 Srrvastava, P N and Farooqut, A. A (1982) Heparm-sepharose affimty chromatography for purtficatron of bull semmal-plasma hyaluromdase. Brochem J 183, 53 l-537 34 Varshavaskaya, M. Ya , Klibanov, A L , Goldmacher, V S. and Torchtlm, V P (1979) A sample method for the determmatron of heparm content m heparmSepharose Anal Biochem 95,449-45 1. 35 Smith, P K , Mallra, A K and Hermanson, G. T (1980) Colorrmetrtc method for the assay of hepat m content m rmmobilized heparm preparatrons Anal Biochem 109,466473 36 Khan, M Y and Newman, S A (1990) An assay for heparin by decrease m color yteld (DECOY) of a protem-dye-bmdmg reactron Anal Blochem 187, 124-l 28 37 Bradford, M M. (1976) A rapid and senstttve method for the quantitatton of mrcrogram quantttres of protem utilizing the principle of protem-dye bmdmg Anal Blochem 72,248-254.
38 Farooqui, A. A , Taylor, W A. and Hot-rocks, L A. (1984) Separation of bovine bram mono- and dracylglycerol hpases by heparin-sepharose affinity chromatography Bzochem Blophys Res Commun 122, 1241-1246 39 Rehfeldt, W., Resch, K and Goppelt-Struebe, M (1993) Cytosolrc phospholrpase A2 from human monocytrc cells. characterrzatron of substrate specrficrty and Ca2+dependent membrane associatron. Blochem J 293,255-26 1 40 Zhou, C J , Akhtar, R A and Abdel-Latrf, A. A (1993) Purrfication and charactertzatron of phosphomosrtrde-specific phosphobpase C from bovme errs sphmcter smooth muscle Blochem J 289,40 l-409
Large-Scale Lipoprotein from Adipose Tissue Andre Bensadoun,
Lipase Purification
Jean Hsu, and Barry Hughes
1. Introduction Ltpoprotem lipase (LPL) plays a central role m hpoprotem metabolism. LPL is the major enzyme responsible for the hydrolysis of triglycertdes in VLDL and chylomicrons. Followmg hydrolysis of the triglyceride core of hpoprotems, some of the LPL molecules remam associated with chylomicron remnants and intermediate density lipoproteins (IDL) derived from VLDL There is now accumulatmg evidence that these hpase molecules may play a role m the removal of chylomicron remnants and IDL by the liver and other tissues (I-4) This second function of LPL is independent of its catalytic activity. This chapter presents a large scale purification of LPL from commercial sources of avian adipose tissues. The same procedure should be applicable to other tissues It employs two heparm-Sepharose steps and a concanavahn A-Sepharose affimty step. The Judicious use of detergents contribute to a high degree of purificatron wtth high recovery of catalytic activtty. The highly purified enzyme has a specific activity of approximately 10,000 mmoles fatty acid released/h /mg of protein. Earlier versions of this protocol have already been published (5,6),
2. Materials Store all materials and solutions at 4°C unless otherwise mdicated. Store organic solvents at room temperature in a well ventilated storage cabmet.
2.7. Acetone Powder Preparation
and Extraction
1 Commercial
frozen chicken adipose tissue on dry ice, purchase up to 6 kg (Pel Freeze, Rogers, AR) Cut the frozen tissue into 30 g pieces, package separately (in plastic wisp), and store at -2O’C From
Methods Edited
by
m Molecular M H Doohttle
Bology,
Vol 109 Llpase and Phosphollpase
and K Reue
0 Humana
145
Press
Inc , Totowa,
Protocols NJ
146
Bensadoun, Hsu, and Hughes
2 Exploston proof Waring blender with a stainless steel 1-L cup. 3 Acetone and ethyl ether (analytical grade). 4 Extraction buffer 1 2 A4 NaCl, 30% glycerol (w/v), 0 5 mM EDTA, 10 nuI4 CHAPS, 10 mM Na phosphate, pH 6.5 The detergent CHAPS, 3[(3-cholamtdopropyl)-dtmethylamomo]-1 -propane-sulfonat, can be purchased from Sigma (St Louts, MO). 5 Dialysis tubing with a 15 kDa mol wt cut off 6 Dtalysts buffer 10% glycerol (w/v), 0.5 mA4EDTA, 10 mMNaphosphate, pH 6 5.
2.2. Chromatography 1 Heparm Sepharose CL-6B and concanavalm A (Pharmacra, Uppsala, Sweden) 2 Columns with adapters Column dtmenstons should be chosen for bed sizes of 5 x 30 cm and 5 x 100 cm (first heparin-Sepharose columns); 2 6 x 30 cm (Concanavalm A column), and 2 6 x 90 cm (second heparm-Sepharose column) 3 A multichannel perlstalttc pump with a flow rate capacity of 300 mL/h per channel. 4 A 2-L capacity coarse stntered glass funnel for bulk washing of hepartn Sepharose CL-6B
2.2 1. First Heparin-Sepharose 1 2 3 4 5
Chromatography
Equtlibratton buffer A 0 3 MNaCl, 10% (w/v) glycerol, 10 mMNa phosphate, pH 6 5 Wash buffer A 0.7 MNaCl, 10% (w/v) glycerol, 10 mMNa phosphate, pH 6 5 Wash buffer B 10% (w/v) glycerol, 10 mMNa phosphate, pH 6 5. Wash buffer C 0.2% Trtton-X-100, 10% glycerol(w/v), Na phosphate, pH 6 5 Elutron buffer A 1 5 MNaCl, 30% (w/v) glycerol, 10 mMNa phosphate, pH 6 5, wtth 50 mA4 each of CaCl,, MgCl,, and MnC&.
2.2.2. Concanavalin
A-Sepharose
Chromatography
1, Con A equihbratton buffer 1 MNaCl, 5 mMNa phosphate, pH 6 5, with 50 n-&Z each of CaCl,, MgC&, and MnCI, 2 Con A elutton buffer. 1 A4 NaCl, 30% (w/v) glycerol, 0 2 A4 p-methyl-Dmannostde, 5 mM CHAPS, pH 7 0
2.2.3. Second Heparin-Sepharose 1. 2 3 4 5
Chromatography
Equtlibratton buffer B 0.5 MNaCl, 30% (w/v) glycerol, 10 mMNa phosphate, pH 6.5 Wash buffer D. 30% (w/v) glycerol, 10 mJ4Na phosphate, pH 6.5 Elutron buffer B: 1 5 MNaCl, 30% (w/v) glycerol, 10 mMNaphosphate, pH 6 5 Ammomum sulfate buffer 3.6 Mamtnonium sulfate, 5 mMNa phosphate, pH 6.5 Storage buffer 0 5 A4 NaCl, 40% (w/v) glycerol, 10 mM Na phosphate, pH 6 5 (see Note 1).
3. Methods The followmg procedure can be carried out conventently with 6 kg of adtpose tissue. The procedure descrtbed exhibits a high recovery of enzyme actlvtty and yields a highly purified enzyme preparation wtth high specific actlvtty
lipoprotein
Lipase Purification
147
(see below). The procedure consists of (1) the preparation of an acetone powder extract; (2) heparin-Sepharosechromatography; (3) concanalvalin A-Sepharose chromatography, and (4) a second heparm-Sepharose chromatography step. Fmally, the enzyme is concentrated by ammomum sulfate prectpttatton. Starting from 181 to 263 g of chtcken adtpose trssue, we found that the enzyme recovery was 38 f 12% with a specific activity of 10,988 f 5730 pmol fatty actd released/h/mg protein (for five separate preparations). By Comassie Blue or silver stanung after SDS polyacrylamide gel electrophoresis, a major band correspondmg to a molecular weight of 60,545 + 650 (n = 11) was tdenMed. Two very faint bands corresponding to molecular weights of 34,000 and 3 1,500 were also visible m overloaded gels. These minor components are probably degradation products since they cross-react with monoclonal antibodies to avian LPL. 3.1. Acetone Powder Preparation and Extraction 1 Process30 g of adipose tissue at one time. Homogemze the trssue(30 g) In 700 mL of --20°C acetonem a Warmg blender for 2 mm Pour the homogenate 2 3 4
5 6
7 8
9
10 11
onto a porcelain Buchner funnel, containing Whatman # 1 filter paper, under gentle vacuum (see Note 2) Rinse the filter with 500 mL of room temperature acetone. Rinse the tilter with 500 mL of room temperature ethyl ether Allow the filter to au dry under the fume hood before attempting to separate the acetone powder from the filter paper. Fmtsh drying the acetone powder m a vacuum desstcator contarnmg P,O, for 30 mm. Store the acetone powder m a desstcator at-20°C. The yreld IS about 0 5 g acetone powder/30 g adipose tissue (or about 100 g/6 kg of adipose tissue) Extract the LPL from the acetonepowder Use 20 mL of extraction buffer/O 5 g of acetone powder The extraction is conducted by gentle stnrmg m a beaker at 4°C for 3 h (see Note 3) After extraction, centrifuge the suspension at 13,OOOgfor 30 mm Re-extract the pellet with one half volume of Extraction Buffer and centrtfuge as described above Combme the two acetone powder extracts Store the extracts at -20°C or proceed wrth purlficatlon Dialyze the acetone powder extract against dialysis buffer. Dialyze in tubing with a 15 kDa molecular weight cut off until the conducttvtty reading IS equivalent to that of a solution containing 0 3 M NaCl, 10% glycerol (w/v), 10 mM Na phosphate, pH 6.5 Centrifuge the dtalysate at 13,700g for 30 mm at 4°C Decant the resultmg supernatant through four layers of cheese cloth.
3.2. First Heparin-Sepharose Chromatography All chromatographic steps are carried out at 4°C (e.g., n-ta cold box or room) unless otherwtse indicated.
148
Bensacioun, Hsu, and Hughes
1 Load no more than 1500 mL of the supematant at 180 mL/h onto three 5 x 30 cm heparm-Sepharose columns set up m parallel The columns are then eqmltbrated wrth 1500 mL equthbration buffer A At thts ttme, another 1500 mL of supematant can be loaded and equiltbrated (see Note 4) 2. Remove the heparm-Sepharose matrix m the columns and place mto a 2-L coarse smtered glass funnel 3 With gentle vacuum, wash the matrtx with the following volumes of buffer 15 L wash buffer A, 5 L of wash buffer B; 5 L wash buffer C, 3 L of wash buffer B, and 3 L of wash buffer A (see Note 5). 4 Transfer the matrix mto a smgle 5 x 100 cm column. Elute the bound LPL wtth elutton buffer A at a flow rate of approximately 5 mL/mm Collect 5-mL fracttons and monitor ltpase actrvtty (see Chapters 3 and 9 for LPL acttvtty assays) As soon as significant catalyttc acttvtty starts elutmg, connect the output of the heparm-Sepharose column to the concanavalm A-Sepharose column (see Subbeading 3.3.)
3.3. Concana valin A -Sepharose
Chromatography
1 The eluate of the heparm-Sepharose column IS transferred to a 2 6 x 30 cm of concanavalm A column that has been eqmltbrated wtth Con A Eqmltbratton Buffer (see Note 6) Continue the elutton of the first heparm-sepharose column with approx 1 2 L The transfer of eluate from the first to the second column can be interrupted every hour to momtor the presence of ltpase acttvny. 2 Once all the actlvtty has been loaded onto the lectm column, the column IS washed wtth 1 L of Con A equlllbratton buffer 3 At room temperature, elute the enzyme activity wtth Con A elutlon buffer at a flow rate of 120 mL/h (see Note 7) Collect 15-mL fracttons Place the column m close proxtmtty to a cold chest so that fractions can be collected at 4°C The fractions contammg ltpase acttvtty are between fracttons 9 and 33
3.4. Second Heparin-Sepharose
Chromatography
Eqmltbrate a 2.6 x 90 cm heparm-Sepharose column wtth equlhbratton buffer B The active fractions from the prevtous step are pooled, the NaCI, CHAPS, and glycerol content adjusted to final concentrattons of 0 5 M, 5 mM and 40% (w/v), respectively, and loaded onto the heparm-Sepharose column at 160 mL/h Wash the column wtth 500 mL of equthbratlon buffer B; 700 mL of wash buffer D, 300 mL of wash buffer C (see Subheading 2.2.1.), 300 mL of wash buffer D (see Note 8) Elute LPL from the column at 120 mL/mm wtth elutlon buffer B Collect 15-mL fractions Assay the fractions and pool the actrve fractions Expect the active fracttons between fracttons 30 and 50 Concentrate the fracttons by dtalyzmg the active pool agamst ammonmm sulfate buffer Centrtfuge the dtalyzed pool at 100,OOOg for 1 h at 4°C
Lipoprotein Lipase Punfzation
149
8. Carefully asptrate the supernatant and solubtltze the pellet m storage buffer Store ahquots at -70°C (see Notes 1 and 9)
4. Notes Glycerol (50% w/v) stabthzes LPL activity At -7O”C, the recovery of enzyme IS 97% after 10 d However, the concentration of glycerol m buffers IS ltmited by the vrscosity at 4°C LPL actrvtty IS also stabilized when bound to column matrtces (heparm-Sepharose or concanavalm A-Sepharose). Because of the orgamc solvents, it IS recommended that thts step IS done under a high capacity fume hood The presence of high NaCl concentration in the acetone powder extractmg buffer Increases the amount of LPL acttvtty extracted by sixfold when compared to extraction of acetone powders with the classical 0 025 A4 NH,OH solution (6) Titration of the NaCl concentration m the buffer shows that maximal extraction of activtty is observed at 1 2 M NaCl Addmon of 10 mM CHAPS m the 1 2 M NaCl contammg extracting buffer increases the yteld further by 1.8-fold At 4°C the pH optimum for enzyme stability in the presence of 30% glycerol (w/v) and 10 mA4 Na phosphate 1spH 6 5 The reason for usmg three large columns is to be able to load large volumes per hour (a total volume of 540 mL can be loaded per hour) In addition, the crude extract that is loaded onto the columns contams a high protein concentration which could contrtbute to non-specific bindmg to heparm-Sepharose and limit capacity Thus, the loadmg of the crude extract is interrupted by washmgs with equltbration buffer to mmtmize nonspecific bmdmg Washing of heparm-Sepharose columns with large volume of buffer IS essential to achieve a high degree of purity. For best enzyme recoveries, when using detergents m column washes it is essential to first wash the column with a buffer contammg no salt In the presence of both NaCl and detergents, some LPL is desorbed and appears m the wash In the concanavalm A-Sepharose step, divalent canons are included m the column equiltbration buffer and m the loadmg buffer. These are essential to mamtam the multtmeric concanavalm A reactivity for a-mannopyranosyl and a-glucopyranosyl In the elution step for the concanavalm A-Sepharose column, the mcluston of a-methyl-o-mannoside is not sufficient to achieve desorpuon of LPL Sodmm chloride at 1 M IS needed to achieve an effective elution If needed, this property can be exploited to design additional column washescontammg either htgh NaCl or mannoside The use of CHAPS IS avoided in the step preceding the ammomum sulfate prectpttation In the presence of detergents, LPL forms complexes which do not pellet m the presence of 3 6 h4 ammomum sulfate When starting with 6 kg of adtpose ttssue, this procedure yields 5-30 mg of highly purified enzyme which, when kept at -70°C m storage buffer, is stable for at least 4 yr with no appreciable loss of specific activity
150
Bensadoun, l-ku, and Hughes
References 1 Enerback, S and Gamble, J M ( 1993) Lipoprotein lipase gene expression physiologtcal regulators at the transcriptronal and post-translattonal level. Bzochlm Bu@zys Acta 1169, 107-125 2 Ohvecrona, T and Bengtsson-Ohvecrona, G (1993) Llpoprotem hpase and hepatrc hpase Curr Opm Lzpzdol 4, 187-196. 3 Santamarina-FoJo, S and Dugr, K A (1994) Structure, functron and role of hpoprotem lrpase m hpoprotem metabohsm. Curr Open Lzpldol 5, 117-125 4. Goldberg, I. J. (1996) Lrpoprotem hpase and hpolysls* central roles in ltpoprotem metabolism and atherogenesls J Lzpld Res 37,693-707 5 Cheung, A H , Bensadoun, A , and Cheng, C -F ( 1979) Dn-ect solrd phase radtonnmunoassay for chicken lrpoprotem lrpase Anal Blochem 94,346-357 6 Bensadoun, A, Ehnholm, C , Stemberg, D., and Brown, W V (1974) Purrficatton and characterrzatron of hpoprotem hpase from pig adipose tissue J Brol Chem 249,2220-2227.
15 Purification of Rat Hepatic Lipase Essentially of Apolipoprotein E and Apolipoprotein B
Free
Andre Bensadoun, Barry Hughes, Kristan Melford, Jean Hsu, and Dawn L. Braesaemle 1. Introduction Hepatic hpase (HL) is necessary for efficient clearance of trtglycertde-rich hpoprotems from plasma (I). In humans, HL defictency leads to the accumulation of triglyceride-rich intermediate density hpoprotems (IDL), LDL, and large HDL (2-4). Inhibition of hepatic lrpase in rats wtth spectfic antibodies to HL (5-12) causes similar changes m plasma hpoprotein patterns, with accumulation of IDL and chylomicron remnants in the low density ranges and mcreases m the large HDL subfractions. In isolated, perfused rat livers mhibition of hepatic lipase wtth antibodies or removal of HL by heparm perfusion reduces the uptake of chylomicron remnants (13). Fmally, recent studies with cultured hepatoma cells over-expressmg human HL (24) demonstrate a threefold mcrease m binding and uptake of /3-VLDL and chylomicron remnants when compared to non-transfected cells. Hence, several studies have shown that decreased HL activity mhibrts clearance of triglyceride-rich lipoprotems, while overexpression of HL facilitates clearance of these particles. The study of the molecular mechanisms whereby HL enhances trtglyceriderich lipoprotein removal necessitates the avatlabihty of htghly purified HL Since apolipoprotems are known to be determinants for the removal of hpoproteins by cells, It is particularly essential to insure that they are not present as contaminants m hpase preparations. Highly purified enzyme is also necessary for the generation of polyclonal antibodies for a number of applications mcludmg tmmunocytochemistry. In this chapter we summarize a procedure to purify HL from rat liver perfusate which yields HL free of apohpoprotem E (apo E) and apohpoprotein B (apo B). From
Methods Edlted by
m Molecular Biology, Vol 109 Lipase M H Doollttle and K Reue 0 Humana
151
and Phosphohpase Press
Inc , Totowa.
Protocols NJ
152
Bensadoun et al.
2. Materials 2.1. Materials for Liver Perfusion Store all solutions at 4°C. 1. Modified Krebs-Ringer-bicarbonate buffer is identical to the classical KrebsRinger-bicarbonate solution (15) except that it is supplemented with 20% (w/v) glycerol: NaCI, 119 mM (6.93 g/L); KCI, 10.3 mA4 (0.77 g/L); CaCl,, 5.5 mA4 (0.81 g/L); KH2P04, 2.6 mM(0.35 g/L); MgS04, 2.6 mM(O.3 1 g/L); glucose, 10 mM (1.8 g/L); NaHC03, 24.6 mM (2.1 g/L; glycerol, 20% w/v (378 g/L). All the components of the buffer are added individually with continuous stirring to deionized water with the exception of the bicarbonate. Bicarbonate is added just before use as follows: a 1.3% solution of NaHCO, is gassed with CO? for 1 h; 160 mL of this solution is added per liter of final buffer. The modified Krebs-Ringer-bicarbonate is gassed for 10 min with 5% CO,/95% O2 and the pH adjusted to 7.0-7.2. 2. Modified Krebs-Ringer-bicarbonate buffer supplemented with 20% (w/v) glycerol and 5 U/mL heparin (porcine intestinal) from Sigma (St. Louis, MO). 3. Materials added to perfusate ex tempo: TrysaloIR from Bayer (Kankakee, IL); CHAPS (3-[(3-cholamidopropyl)-dimethylamonio]1-propane-sulfonate), from Sigma; and n-decanoylsucrose from Calbiochem (Irvine, CA).
2.2. Materials for Chromatography Store all solutions at 4°C. 1. Columns with adaptors. Column dimensions should be chosen for bed sizes of 2.5 x 6.1 cm and 1 x 108 cm (for first and second heparin-Sepharose columns, respectively). 2. Medium-pressure liquid chromatograph with detector capable of monitoring UV absorbance at 280 nm (such as the Pharmacia FPLC system). 3. Stirred concentrating cell with a 30-kD cut off membrane, such as an Amicon PM-30 membrane (Beverly, MA). 4. Superose@ 6 HR 10/30, Superose @ 12 HR 10/30, HiLoad@ 26110 Q Sepharose@ HP, Heparin Sepharose@ CL-6B (Pharmacia, Uppsala, Sweden). 5. Dialysis buffer: 20 mA4 Tris-HCl, pH 7.2. 6. Buffer A: 20 mM Tris-HCl, pH 7.2,20% (w/v) glycerol. 7. Buffer A supplemented with 2.5 mM n-decanoylsucrose. 8. Buffer B: 20 mA4 Tris-HCl, pH 7.2, 20% (w/v) glycerol, 1 mM EDTA, 0.02% Na azide. 9. Buffer B supplemented with 2.5 mM n-decanoylsucrose. 10. Buffer B supplemented with 0.1% Triton N- 101 (Sigma). 11. Buffer B supplemented with 0.5 MNaCI. 12. Dilution buffer: using10 mMNa phosphate, pH 7.2, 5% (w/v) glycerol, 2.5 mA4 n-decanoylsucrose, 1 mA4 EDTA, 0.02% Na azide. 13. Protease inhibitor, PefablocR SC, 4-(2-aminoethyl)-benzenesulfonyl fluoride hydrochloride from Boehringer-Mannheim.
Hepatic Lipase Purification
153
14. Buffer C: 10 mMNaphosphate, pH 7.2, 10% (w/v) glycerol, 2.5 Mn-decanoylsucrose, 1 mM EDTA, 0.02% Na azide. 15. Buffer C supplemented with 0.1 % Triton N-101. 16. Buffer C supplemented with 0.9 M NaCI. 17. Buffer C supplemented with 1 M NaCl. 18. Centriprep 30TM units (Amicon) for centrifugal concentration, or ammonium sulfate buffer (3.6 A4 ammonium sulfate, 5 mM sodium phosphate, pH 7.2) for concentration by dialysis.
3. Methods A succession of chromatography stepson Q-Sepharose,heparin-Sepharose and gel permeation Superosematrices can be successfullyemployed to prepare highly purified HL free of apo E, apo B, and heparin from liver perfusates.Large amounts of immunoreactive apo B and apo E are present in rat liver pet&sates. Apo B and apo E measured by ELISA (27) account for 52 and 64% of the HL mass in liver permsate. This is decreasedto 0.0005% and 0.04%, respectively, for apo E and apo B after the second heparin Sepharosestep.The two apolipoproteins are not detectable after the SuperoseTM step, with ELISA having limits of detection of 0.0005% and 0.00 1% of HL mass(26), for the apo E and apo B assays,respectively. Moreover, whereas antithrombin III can easily be detectedin liver permsate by Western blotting, it is not detectable by the sameprocedure in the final preparation.
3.1. Liver Perfusa te 1. Perfuse the rat liver with 150 mL of modified Krebs-Ringer buffer free of heparin at 20 mL/min to remove blood elements. 2. Perfuse rat livers with 45 mL modified Krebs-Ringer bicarbonate buffer at 37°C containing 5 U of heparin per ml. Cell surface bound HL is released in the presence of heparin. The amount of HL which can be purified from each adult rat perfusate is approx 15-30 mg. 3. Add 5000 U of Trasylol, 123 mg of CHAPS, and 5 mg of n-decanoylsucrose/45 mL of perfusate (see Note 1). Keep perfusates on ice until all livers have been perfused. 4. Centrifuge perfusate in a large capacity rotor (e.g., a Sorvall GS3 rotor) for 30 min at 4°C at 13,000g to remove remaining blood cells. Store the perfusate at 70°C; HL activity is stable for 4 wk in perfusates stored at -70°C.
3.2. Q-Sepharose
Chromatography
The rationale for using a strong anion exchanger like Q-Sepharose as a first separation step was the expectation that due to the high density of negative charges on heparin, the HL-heparin complexes in perfusate would bind very tightly to this matrix. Indeed, HL is recovered quantitatively at this step and is eluted at 0.25 A4 NaCl whereas
heparin is eluted between
This provides a clear separation between HL and heparin.
1.1 and 1.2 M NaCl.
Bensadoun et al
154
In this Q-Sepharose chromatography step, from 1.5-2.5 L of perfusate can be convemently processed at one time All steps listed below are conducted at 4OC. 1 Concentrate the perfusate m a 2-L stlrred cell unit fitted with a 30-kDa cut off membrane to a volume of between 100 and 400 mL 2. Dialyze the concentrate against 25 vol of dialysis buffer for 3 h with four buffer changes At 3 h, adjust the n-decanoylsucrose concentration of the dialysate to 2.5 mM, assuming that all the mltlal detergent has been lost, and continue the dialysis for 3 h 3 Centrifuge the concentrated sample at 4°C for 15 mm at 36,000g. 4 Load the sample on a 2 6 x 10 cm prepacked HiLoad Q-Sepharose HR column equilibrated with buffer A supplemented with 2 5 mM n-decanoylsucrose at 3 mL/mm. 5 Wash the column with a mmlmum of 350 mL of buffer A 6 Elute HL with a 400 mL linear gradient from @-1 M NaCl m buffer A supplemented with 2 5 mM n-decanoyl sucrose. Collect 50, 8-mL fractions 7 Assay every other fraction (the assay for HL actlvlty IS described in Chapters 3 and 9) The active fractions should be between fractions 12 and 38 Pool active fractions.
3.3. First Heparin-Sepharose
Chromatography
1 Dilute the active pool with the addition of 2 vol of buffer B supplemented with 2.5 mM n-decanoylsucrose 2 Apply the diluted active pool to a 2 5 x 6 1 cm heparm-Sepharose column at 3 mL/mm. 3. Wash the column with the followmg buffers. 200 mL, buffer B, 100 mL, buffer B with 0.1 % Trlton N- 101, 200 mL, buffer B; 950 mL, buffer B with 0 5 M NaCl (see Note 2) 4 Elute the column with a two stage gradient. first 250 mL linear gradlent IS from 0.5-O 65 M NaCl m Buffer B supplemented with 2 5 mM n-decanoylsucrose, second 200 ml linear gradient 1sfrom 0.65-l 5 MNaCl m buffer B supplemented with 2.5 mMn-decanoylsucrose 5 Collect 90,5-n-J- fractions The active f&tlons are located between tiactlons 10 and 70
3.4. Second Heparin-Sepharose
Chromatography
1 Pool the fractions contammg HL activity and adJUst the NaCl molarlty to 0.3 M NaCl with dilution buffer. Add the protease inhibitor PefablocTM to a final concentration of 0 1 mM 2. Apply the sample to a 1 x 108 cm column containing heparm-Sepharose-CL-6B and equilibrated with Dilution Buffer at a flow rate of 1 mL/mm 3 Wash the column with the followmg buffers: 100 mL, buffer C, 150 mL of buffer C supplemented with 0 1% Trlton N-101,250 mL ofbuffer C supplemented with 0 5 A4 NaCl. 4 Elute the column with buffer C supplemented with 0.9 M NaCl
Hepatic Llpase Purification 3.5. Superose
155
Chromatography
1 Pool fracttons contammg HL activity and concentrate to a volume of 1 mL usmg centrifugal concentrators (Centriprep 30TM) As an alternative procedure, the HL preparatton can be concentrated by ammomum sulfate precipitation, by dialysmg the active fractions agamst ammomum sulfate buffer for 18 h at 4°C with three, lOO-mL changes The precipitated enzyme can then be separated by centrtfuganon at 100,OOOg for 1 h at 4°C When using precipitation to concentrate the enzyme, omit the n-decanoylsucrose from the elution buffer m the second heparm-Sepharose chromatography step (see Note 3) 2 Apply the concentrated enzyme m 1 mL of Buffer C supplemented with 1 A4 NaCl to an FPLC system of three 10 mm/30 cm HR SuperoseTM columns m series m the followmg order SuperoseTM 12/SuperoseTM 6/SuperoseTM 6 3. Elute the sample at 0 2 mL/mm with buffer C supplemented with 1 MNaCl. The fractions containing HL activity are pooled and stored at -70°C (see Note 4).
4. Notes 1 At a concentratton of 2.5 mh& n-decanoylsucrose can preserve 98% of the mltial HL catalytic activity after 24 h at 4°C With the same detergent, 93% of the initial activity is still present after 72 h N-decanoylsucrose has no effect on the assay system if the concentration is maintained below 0 4 m&4 2 Triton N-101 stabilizes HL catalytic activtty durmg enzyme purifications (16) However, because of its low critical micellar concentration, this detergent is dtfficult to remove from enzyme preparations 3 The presence of detergents in buffers is omitted when an ammonium sulfate precipitation is planned as a means of concentratmg enzyme preparations. In the presence of n-decanoylsucrose or Triton-N-101, HL forms complexes with the detergents which cannot be pelleted m the presence of 3 6 M ammonium sulfate. 4. Coomassie blue staining and silver staining of polyacrylamtde gels containing the purified HL preparattons show a major band at 55 kDa and a mmor faint band at 49 kDa These two forms may represent differentially glycosylated species Both forms cross react m Western blotting with nnmuno-affinity purified antiHL immunoglobulms. Goat antisera raised against rat HL purified by the above procedure yields immunoglobulms which do not crossreact by ELISA with immobilized rat ApoE or ApoB.
References 1 Jansen, H. and Hhlmann, W. C. (1985) Enzymology and physiological role of hepatic hpase Bzochem Sot Trans 13,24-26. 2. Hegele, R A , Vezma, C , MOOrJani, S , Lupien, P J , Gagne, C., Brun, L. D., Little, J. A., and Connelly, P. W., (1991) A hepatic lipase gene mutation associated with heritable hpolytic deticrency. J Clm Endocruzol Metab 72,730-732 3. Connelly, P W., Maguire, G. F , Lee, M and Little, J. A (1990) Plasma lipoproteins m familial hepatic hpase deficiency. Artenosclerosu 10,40-48
156
Bensadoun et al
4 Hegele, R A , Little, J A, Vezma, C , Maguu-e, G F , Tu, L , Wolever, T S , Jenkms,D J A , and Connelly, P W (1993) Hepatic hpase deficiency Chmcal, blochemlcal, and molecular genetic characterlstlcs Artenoscler. Thromb 13, 720-728 5 Goldberg, I J., Lee, N A , Patemit], J R , Jr., Gmsberg,H N , Lmdgren, F. T , and Brown, W V (1992) Llpoprotem metabohsm during acute mhlbltlon of hepatlc triglyceride hpase m the cynomologus monkey. J Clwz Invest. 70, 1184-l 192 6. KUUSI, T , Kmnunen, P K. J., and Nlkklla, E. A (1979) Hepatlc endothehal lipase antiserum influences rat plasma low and high density hpoprotems m VIVO. FEBS Lett 104,384-388 7 Jansen, H., van Tol, A and Hulsmann, W C (1980) On the metabohc function of heparm-releasable liver hpase Blochem Blophys Res Commun 92, 53-59 8 Grosser, J , Schrecker, 0 , and Greten, H (198 1) Function of hepatlc trlglycerlde lipase m hpoprotem metabolism J Llpzd Res 22, 437-442 9 Daggy, B P and Bensadoun, A (1986) Enrichment of apohpoprotem B-48 m the LDL density class followmg in vlvo mhlbltlon of hepatlc hpase Bzoehzm Bzophys Acta 877,252-26 1 10 Demacker, P. N. M , HiJmans, A G M , Stalenhoef, A F H , and van’t Laar (1988) Studies on the function of hepatlc hpase m the cat after lmmunologlcal blockade of the enzyme m vlvo Atheroscleroszs 69, 173-l 83 11 Murase, T and Itakura, H (198 1) Accumulation of mtermedlate density hpoprotem after Intravenous admmlstratlon of hepatlc triglyceride hpase antlbody m rats Atherosclerosu 39,293-300 12 Sultan, F , Lagrange, D , Jansen, H and Gngho, S (1990) Inhlbltlon of hepatlc hpase activity ImpaIrs chylomlcron remnant removal m rats Bzochzm Bzophlu Acta 1042, 150-152 13 Shafi, S , Brady, S E , Bensadoun, A and Havel, R J (1994) Role of hepatlc hpase m the uptake and processmg of chylomlcron remnants m rat liver J Lzpzd Res 35,709-720 14 JI, Z S , Lauer, S J , Fazlo, S , Bensadoun, A , Taylor, J M , and Mahley, R W (1994) Enhanced binding and uptake of remnant hpoprotems by hepattc hpasesecreting hepatoma cells m culture J B~ol Chem 269, 23,838-23,844. 15. Umbrelt, W W , Bums, R H , and Stauffer, J F. (1957) Manometrzc Technrques, Burgess, pp 149 16 Clsar, L A and Bensadoun, A (1985) Enzyme-hnked lmmunosorbent assay for rat hepatlc triglyceride llpase J Llpld Res. 26, 380-386 17 Brasaemle, D , Cornely-Moss, K , and Bensadoun, A (1993) Hepatic hpase treatment of chylomlcron remnants increases exposure of apolipoprotem E J Llpzd Res 34,455-465
16 High-Level Expression and Purification Hepatic Lipase from Mammalian Cells
of Human
John S. Hill 1. Introduction Through its ability to catalyze the hydrolysis of trtglycertdes and phospholipids, hepattc lipase (HL) has been shown to influence the metabolism of a broad range of ctrculatmg lrpoprotems (I) HL IS synthesized and secreted by hepatocytes and IS found bound, through an lomc interaction wrth heparan sulfate proteoglycans, to the lummal surface of endothelmm lmmg the liver smusolds (2). The detection of HL catalyttc activity m the ovary and adrenal gland, but not protein synthesis, suggeststhat HL IS transported and binds specttically to these tissues as well (3,4j. In addition, there 1s evidence to suggest that, independent of Its catalytx actrvny, HL can act as a bgand to facllrtate the uptake of remnant ltpoprotems through its mteractron with cell surface proteoglycans and/or cell surface receptors (5-S). Mature human HL IS a 476 amino acid glycoprotem with a calculated polypepttde molecular weight of 53,43 1; however, the purified denatured enzyme has an apparent mol wt of 65,000 owmg to the contribution of Nlinked carbohydrate (P-11) HL 1sa member of a hpase gene family which also includes lipoprotem hpase and pancreatic lipase (22-24). Ammo actd homology, mcludmg the conservatron of drsulfide brtdges among all three enzymes, suggests that they share stmrlar three-dimensional structures (25). The difficulty m obtaining large amounts of starting material as well as low protein yields associated with the purrficatton of HL from human postheparm plasma has hmtted the ability to make more detailed physical analyses of this enzyme. To obtain greater amounts of enzyme, the author has stably transfected human HL cDNA mto Chinese hamster ovary (CHO) cells (16). The From
Methods
m Molecular
Edlted by M H Doohttle
t?/ology,
Vol
109
Ljpase
and K Reue 0 Humana
157
and
Phospholipase
Press Inc , Totowa,
Protocols
NJ
158 secreted recombinant hpase IS harvested by collectmg the conditloned medmm from the cultured transfected cells. As described m Subheading 3., the culture medium IS subjected to a four-step column chromatography procedure consistmg of octyl-Sepharose, heparm-Sepharose, hydroxylapatlte and dextran sulfate-Sepharose. This procedure allows the purlficatlon of milligram quantltles of hepatlc hpase m a relatively short period of time The results of a typical purlficatlon from 3300 mL of medium from transfected CHO cells IS shown in Table 1 Following concentration of the final eluant, approx 0 5 mg of protein was obtained with an overall yield based on actlvlty of about 40% with a calculated HL specific acttvlty of 150 mmol/min/mg. This specific actlvlty IS similar to previous reports of HL purified from human postheparm plasma (2 7,18) and recombinant HL made by stably transfected rat hepatoma McA-RH7777 cells (19) Kinetic analysis of the purified enzyme with a trlolem emulsion substrate and an apparent K, of indicated an apparent V,,, of 1 4 _+0.3 mmol/mm/mg 16 _+2 mM (n = 3). The purified HL bound to heparm-Sepharose and eluted as a smgle peak with maximum elutlon at 0 7 A4 NaCl. This affinity for heparm IS consistent with previous reports for human HL (18,20). Thus, the properties of the recombinant enzyme were the functIona equivalent of the native enzyme. This chapter describes procedures for large scale production and punficatlon of recombinant HL that can be completed comfortably within five workmg days. The purification of sufficient quantities of this enzyme has enabled, for the first ttme, the determmatlon of its subumt structure. Usmg three mdependent methods, the analysts of purified human hepatic llpase has indicated that this enzyme IS catalytically active as a homodlmer (26). 2. Materials 1 HL expression construct. The construct used for the protocol presented here IS human HL that has been subcloned into the expression vector pcDNAl-neo (InVltrogen,
Carlsbad, CA) This construct is available from the author, or a suit-
able construct can be made by subclonmg the rat HL cDNA (available from American Type Culture CollectIon, Rockvllle, MD, ATCC # 87 190) mto any of a number of commercially
avallable
expresslon
vectors
(e g , InVltrogen,
Carlsbad, CA, Pharmacia, Uppsala, Sweden) 2 Chinese Hamster Ovary Pro-5 cells (American Rockville, MD, ATCC # CRL- 178 1)
Type Culture
Collection,
3 Tissue culture reagents: Dulbecco’s modified Eagle’s medium (DMEM),
fetal
bovine serum, pemclllm-streptomycin, sodium pyruvate, glutamme, non-essenteal ammo acids (Glbco BRL, Gaithersburg, MD) and Nutndoma, a serum substltute (Boehrmger Mannhelm, Indlanapolls, IN) Nutrldoma should be stored shielded from light at -20°C
4 Growth medmm for CHO cells DMEM serum, contammg penwllm-streptomycm,
supplemented with 10% fetal bovine sodmm pyruvate, glutamme, and non-
159
Purification of Human Hepatic Lipase Table 1 Purification
of Human
Culture medium Hydroxylapatlte flowthrough Dextran sulfateSepharose eluent HL concentrate
HL Secreted
Volume,
Protein,
mL
by HL-Transfected
CHO Cellsa
mg
Specific activity, mmol/mm/mg
Punficatlon, -fold
Recovery, %
3300 500
131 1 10
15 109
1 73
61
50
0 62
152
101
48
1
0 55
146
97
41
-
‘As described m the text, HL was purified using sequential chromatography, which consisted of 4 steps, octyl-Sepharo\e, heparm-Sepharose, hydroxylapatlte, and dextran sulphate-Sepharose The data presented are representative of several experimental purlticatlons The presence of Tnton N- 101 did not permit the measurement of activity present m the octyl- and heparm-Sepharose eluant fractions Specific activity IS expressed as mmol of free fatty acid released/mm/mg of protem Reproduced with permlsslon from ref. 26
5 6
7 8 9 10
11 12 13
14 15 16 17 18 19
essential amino acids In some cases, 1% Nutrldoma 1s substituted for fetal bovme serum (see Subheading 3.1.) lo-cm’ culture dishes and 225-cm* culture flasks (Costar, Cambridge, MA) 2X HEPES buffered salme (HBS). 40 mMHEPES, pH 6 95, 10 mM KCl, 1 5 mM Na2HP04, 10 mM glucose, and 0 25 A4 NaCl The HBS buffer 1s filter sterilized and stored frozen at -2O’C Genetlcm, G418 sulfate (Gibco-BRL, Galthersburg, MD) Heparin, sodium salt, from porcine intestinal mucosa (Sigma, St LOUIS, MO) Benzamidine (Sigma) Column chromatography matrices octyl-Sepharose CL-4B (cat no 17-079001) and heparm-Sepharose CL-6B (cat. no 17-0467-01) from Pharmacla; hydroxylapatite, DNA-Grade Blo-Gel HTP (cat no 130-0420) from BloRad (Hercules, CA) Chromatography columns. 2 5 x 30 cm, 1 x 10 cm (Pharmacla). Buffer A 5 m.U barbital, pH7 2,0 5 M NaCl, and 20% (w/v) glycerol Octyl sepharose elutlon buffer, 5 mA4 barbital buffer, pH 7 2, containing 0 35 A4 NaCl(20.45 g/L), 20% (w/v) glycerol and 1 2% Trlton N-101 Trlton N-101 can be purchased from Sigma Heparm Sepharose elutlon buffer: 1 M(58.4 g/L) NaCl, 20% (w/v) glycerol, 5 mM barbital, pH 7.2. Hydroxylapatlte equlllbratlon buffer. 0.01 M sodium phosphate, pH 7 2 20% (w/v) glycerol, 5 mA4 barbital, pH 7 2 Dextran sulfate wash buffer: 0 5 A4 NaCl, 5 mM barbital, pH 7 2 (see Note 9) Dextran sulfate elution buffer 1 A4 NaCl, 5 mM barbital, pH 7 2 (see Note 9) Filtration unit (capacity 50 mL) and YM-30 membranes (Amicon, Beverly, MA)
160
Hill
3. Methods 3.1. DNA Transfection
and Production
of Recombinant
Human HL
1 Chinese hamster ovary (CHO)-Pro5 cells are grown to 50% confluency m locm2 culture dishes m the presence of Dulbecco’s modified Eagle’s medium supplemented with sodmm pyruvate, glutamme, non-essential ammo acids, 10% fetal bovine serum and penictlhn-streptomycin (growth medmm). 2 To mediate the transfectton of CHO cells, co-precipitates of plasmrd DNA (I e , the HL expression construct) and CaPO, are prepared (see Note 1). For a single IO-cm2 dish, prepare the followmg m a 3 mL polypropylene tube: add 20 ug of plasmrd DNA to 450 uL of sterile water 3 Add dropwise, with gentle vortexmg of the plasmtd DNA solution, 500 mL of 2X HBS, pH 6 95 (see Note 2) 4 Add dropwtse, wtth gentle vortexmg, 50 pL of 2 5 M CaCl, 5. The calcmm phosphate-DNA mixture 1s then Incubated at room temperature for 30 mm before it 1s added to the 50% confluent CHO monolayer m the presence of 9 mL of growth medium 6 After an overnight mcubatton, the medium 1s changed, and selection mutated by addition of genetrcm (G418 sulfate) to the medium at a concentration of 500 ug/ mL (see Note 3) Change the media every other day until genettcm-resistant colonies are detected 7 Genetrcm-resistant colonies are selected and then separately expanded Cell clones expressing maximal quantities of HL may be identrfied by enzyme acttvtty (see Chapters 3 and 9 for HL acttvrty assays). 8 The highest expressing CHO cell clone is grown to confluency m sixteen T-225 flasks. The cell monolayers are washed with Dulbecco’s modified Eagle’s medium without fetal bovme serum, and mcubated wtth 35 ml/flask of fresh growth medium supplemented with 10 U/mL heparm and contaming 1% Nutrldoma m place of fetal bovme serum (see Note 4) 9 The medium 1s harvested and replaced every 24 h for a 10-d period (see Note 5). After centrrfugatron at 1OOOgfor 10 mm to remove cellular debris, the harvested medium IS stored at -70°C (see Note 6)
3.2. Purification of Recombinant Human HL 3 2.1. Octy/ Sepharose Chromatography 1 Three to four liters of thawed medium are mixed with NaCl and benzamtdme to a final concentration of 0 5 M and 0 5 mA4, respecttvely All purtficatron procedures are carrred out at 4’C 2 The medium IS loaded at a flow rate of 150 mL/h onto an octyl-Sepharose column (2 5 x 25 cm) previously equilibrated with 5 mA4 barbital buffer, pH 7 2, containing 0 5 MNaCl and 20% (w/v) glycerol (buffer A) 3 Followmg a wash with 800 mL of buffer A, the hpase 1s eluted wtth 700 mL of 5 mM barbital buffer, pH 7 2, containing 0 35 M NaCl, 20% (w/v) glycerol, and 1 2% Trtton N- 10 1 (see Note 7)
Puriflcatlon of Human Hepafic Lipase 3 2 2 Fvst Heparm-Sepharose
161
Chromatography
1 The eluate from the Octyl-Sepharose column is applied to a heparm-Sepharose column (2 5 x 20 cm) previously equlhbrated with buffer A 2 The column IS then washed with 800 mL of buffer A prior to elutlon with 500 mL of 1 M NaCI, 20% (w/v) glycerol, 5 mM barbital, pH 7 2 (see Note 8)
3.2.3 Hydroxylapatlte
Chromatography.
1 The hydroxylapatlte matrix IS prepared fresh each time. 700 mg 1sresuspended m 0 01 M sodium phosphate, pH 7 2 for 1 h. Pour the column and equlhbrate with this same buffer. 2 The eluted hpase from the hepalm Sepharose column IS passed through the equlllbrated 2 ml, hydroxylapatlte column to remove contammatmg protems 3 The column flowthrough IS collected and diluted with an equal volume of 20% (w/v) glycerol, 5 mM barbital, pH7.2
3.2 4 Second Heparin-Sepharose
Chromatography
(see Note 9)
1 The eluate from the hydroxylapatlte column IS applied to a heparm-Sepharose column (2.5 x 20 cm) previously equlhbrated with buffer A (see Note 10) 2 The column IS then washed with 800 mL of buffer A prior to elutlon with 500 mL of 1 M NaCl, 20% (w/v) glycerol, 5 mA4 barbital, pH 7.2 (see Note 8) 3 The collected eluant IS concentrated m an Amlcon filtration unit using a YM-30 membrane to a final volume of l-2 mL (see Note 11) In order to preserve enzyme actlvlty, ahquots of the purified enzyme should be stored m the presence of 20% (w/v) glycerol at -70°C Freeze-thaw cycles should be avoided
4. Notes 1 Transfectlon efficiency of mammahan cells will vary dependmg on various condltions Specifically, the quality and quantity of DNA and the specific cell type used are primary factors A higher purity of DNA will increase efficiency of transfection 2 The pH of 6 95 for the HBS solution has been optlmlzed for greatest transfectlon efficiency Small changes m pH can have a slgmficant effect on the formatlon of a CaP04-DNA precipitate 3 The time required to select stably transfected cells can sometimes be reduced by re-plating the cells after transfectlon at a lower density m the presence of selective medium 4 Nutrldoma 1s a serum substitute that IS used to mmlmlze contammatrng serum proteins that affect the subsequent purlficatlon protocol 5 After several days of continuous cell culture, cells are more vulnerable to peeling off the flask Care must be taken during media changes so that the cell monolayer IS not agitated. 6. To further protect the hpase from proteolytlc degradation, addltlonal protease inhibitors mav be added before the medium IS frozen for storage.
HI/l
162
7 To regenerate the octyl-Sepharose column, the matnx IS removed from the column
8 9
10
11
and washed with 10 L dlstdled water before it 1splaced m 6 M urea Wash again with an additional 10 L of water. Equilibrate in buffer A before loading the column To regenerate the heparm-Sepharose column, remove matrix from column and place in 3 A4NaCl Wash with 4 L of &stilled water before equihbratmg m buffer A Ongmally, dextran sulfate-Sepharose chromatography was used as the last punficatlon step (16) However, smce dextran sulfate-Sepharose IS not commercially available, we have replaced this step by a second heparm-Sepharose chromatography step with no detectable loss m either the purity or yield of HL If glycerol does not interfere with subsequent enzyme studies, washing and elutlon buffers for the second heparm-Sepharose column should be supplemented with glycerol to a final concentration of 20%, glycerol will help stabilize HL actlvlty Membranes used In filtration units should be carefully inspected for perforations before use to avoid losses
References Ohvecrona, T , and Bengtsson-Ollvecrona, G. (1993) Llpoprotem lipase and hepatlc hpase Curr Opm Llpldol 4, 187-196 Kuusl, T , Nlkklla, E A , Virtanen, I , and Kmnunen, P K J (1979) Localization of the heparm-releasable hpase ln situ in the rat liver. Blochem J 181,245-246 Doohttle, M H , Wong, H., Davis, R C , and Schotz, M C (1987) Synthesis of hepatlc lipase m liver and extrahepatlc tissues J Lzpzd Res 28, 1326-1334 Hixenbaugh, E A , Sullivan, T R , Strauss, J F , III, Laposata, M , Komaromy, M , and Paavola, L G (1989) Hepatlc hpase m the rat ovary Ovaries cannot synthesize hepatlc lipase but accumulate it from the circulation J Biol Chem 266,4222-4230
Dlard, P., Malewlak, M.-I , Lagrange, D , and Gngho, S (1994) Hepatic llpase may act as a llgand In the uptake of chylomlcron remnant-like particles by ISOlated rat hepatocytes Brochem J 299, 889-894 NykJaer, A , Nielson, M , Lookene, A., Meyer, N , RPrlgaard, H , Etzerodt, M , Belslegel, U , Olivecrona, G., and Ghemann, J (1994) A carboxy-terminal fragment of llpoprotem hpase binds to the low density hpoprotem receptor-related protein and mhlblts hpase-mediated uptake of llpoprotem m cells J Bzol Chem 269, 3 1,747-3 1,755 Kounnas, M Z , Chappell, D A, Wong, H , Argraves, W S., and Strickland, D K (1995) The cellular mternahzatlon and degradation of hepatlc hpase 1s medlated by low density hpoprotem receptor-related protem and requires cell surface proteoglycans. J Blo( Chem. 270,9307-93 12 Krapp, A., Ahle, S , Kersting, S., Hua, Y., Kneser, K., Nielsen, M , Ghemann, J , and Belslegel, U (1996) Hepatlc hpase mediates the uptake of chylomicrons and b-VLDL mto cells via the LDL receptor-related protein (LRP) J Lipid Res 37,926-936 Stahnke, G , Sprengel, R , Augustm, J , and Will, H (1987) Human hepatlc tnglycerlde lipase* cDNA cloning, ammo acid sequence and expression m a cultured cell lme Dlfferentlatlon 35,45-52.
Purification of Human Hepabc Llpase
163
10 Datta, S , Luo, C -C , Li, W -H , Vantumen, P., Ledbetter, D. H , Brown, M. A , Chen, S -H , LUI, S -W , and Chan, L (1988) Human hepatic hpase. Cloned cDNA sequence, restriction fragment length polymorphisms, chromosomal localization, and evolutionary relationships with hpoprotem bpase and pancreatic hpase J Bzol Chem. 263, I 107-l 110 11 Martin, G A , Busch, S J , Merideth, G D., Cardin, A D , Blakenship, D T , Mao, S. J T , Rechtm, A E , Woods, C. W , Racke, M M , Schafer, M P , Fitzgerald, M. C., Burke, D M., Flanagan, M. A , and Jackson, R L. (1987) Isolation and cDNA sequence of human postheparm plasma hepatic triglyceride hpase J Lslol Chem 263, 10,907-10,914. 12 Ben-Zeev, 0 , Ben-Avram, C M., Wong, H., Nikazy, J , Shively, J E , and Schotz, M C (1987) Hepatic lipase. a member of a family of structurally related lipases Bzochzm. Biophys Acta 919, 13-20. 13 Kirchgessner, T G , Chaut, J.-C , Hemzmann, C., Etienne, J , Guilhot, S , Svenson, K., Amens, D , Pilon, C., D’Auriol, L , Andalibi, A , Schotz, M C., Gallbert, F , and Lusts, A. J (1989) Organization of the human hpoprotem hpase gene and evolution of the hpase gene family. Proc Nat1 Acad Scz USA 86,9647-965 1 14 Hide, W A., Chan, L , and LI, W -H (1992) Structure and evolution of the hpase superfamily J Lzpzd Res 33, 167-178. 15 Derewenda, Z S and Cambillau, C. (1991) Effects of gene mutations m lipoprotem and hepatic hpases as interpreted by a molecular model of the pancreatic triglyceride hpase J Bzol Chem 266,23,112-23,119 16 H111,J S., Davis, R. C , Yang, D , Wen, J , Philo, J. S , Poon, P H , Phillips, M L , Kempner, E. S , and Wong, H. (1996) Human hepatic hpase subunit structure determmatmn J. Bzol Chem 271, 22,93 l-22,936 17 Ikeda, Y , Takagi, A., and Yamamoto, A. (1989) Purification and characterization of lipoprotem lipase and hepatic triglyceride hpase from human postheparm plasma. productron of monospecific antibody to the mdividual hpase Bzochzm Bzophys Acta 1003,254-269
18 Cheng, C F , Bensadoun, A , Bersot, T., Hsu, J S T , and Melford, K H. (1985) Purificatton and characterization of human hpoprotem hpase and hepatic triglyceride lipase. .J B~ol. Chem 260, 10,720-10,727 19 Ji, Z -S , Lauer, S J , Fazio, S., Bensadoun, A , Taylor, J M , and Mahley, R W (1994) Enhanced bmdmg and uptake of remnant hpoprotems by hepatrc hpasesecreting hepatoma cells in culture J Bzol Chem. 269, 13,429-13,436 20 Dichek, H L, , Parrott, C., Ronan, R., Brunzell, J D , Brewer, H B , Jr., and Santamarina-FoJo, S (1993) Functional charactertzation of a chimeric lipase genetically engmeered from human lipoprotem hpase and human hepatic lipase J LzpzdRes
34, 1393-1401
High-Level Baculoviral Expression of Hormone-Sensitive Lipase Cecilia Holm and Juan Antonio Contreras 1. Introduction The limited availability of purified hormone-sensitive hpase (HSL) has been one of the major obstacles in workmg with this enzyme The low tissue abundance (approx 1 pg HSL/g adtpose tissue) and the labile and hydrophobic character of HSL, are the major difficulties encountered in its purification (1,2). The cDNA clomng of HSL from several species (3-s) opened up the possibilities of establishing expression systems for HSL, to express and purify large amounts of recombinant enzyme. Initial attempts m our laboratory to express HSL, and fragments thereof, m Escherichza colz were unsuccessful, as HSL was found m mclusion bodies and attempts to renature the enzyme failed Instead, we turned to the eukaryotic expression system based on baculovnus and insect cells, which proved to be a very suitable system for large-scale expression of HSL (6). In this system, approximately 40 mg HSL is produced per liter of suspension culture, with virtually no loss m the spectfic activity of the enzyme compared to the native HSL present m adipose tissue homogenates (Fig. 1). In fact, the enzyme purified to homogeneity from the baculovnus expression system has been shown to have properties indistmguishable from those of HSL purified from adipose tissue (6). The baculovirus/insect cell expression system was introduced in the early 1980s and has been used for the successful production of a large number of eukaryottc proteins, mcludmg several hpases (6-II). In this system, a heterologous gene(s) is overexpressed under control of the strong polyhedrm promoter of the baculovnus strain Autographa calzfornzca nuclear polyhedrosis vn-us (AcNPV). Polyhedrm is the major protein of the homogenous matrix that From
Methods in Molecular Biology, Vol 109 Lpase Edlied by M H Doohttle and K Reue 0 Humana
165
and Phospho/ymse Protocols Press Inc , Totowa, NJ
166
Ho/m and Contreras
+
HSL
Fig. 1. Western blot analysis of recombinant rat HSL. Material corresponding to 1 mU of HSL activity from the different purification steps and 1 mU of HSL activity from a 110,OOOg infranatant from rat adipose tissue (I) were subjected to Western blot analysis using a polyclonal rabbit antibody directed against rat adipose tissue HSL. The 84-kDa band corresponding to HSL is indicated. The intensity of the bands is similar in all lanes, indicating a similar specific activity for rat adipose tissue HSL and recombinant rat HSL.
surrounds the virus particles to form occlusion bodies during the late phase of the infectious cycle. Polyhedrin accounts for up to 5&75% of cellular proteins in a baculovirus-infected cell, and the occlusion bodies can easily be observed under a phase-contrast microscope in the nuclei of cells infected with AcNPV. Polyhedrin is essential for horizontal transmission of the virus, but not for replication and secondary infection, and is therefore dispensable under tissue culture conditions. This allows the replacement of the polyhedrin encoding region of the viral DNA with the gene of interest, which is then expressed in high amounts. The different steps in the generation of a recombinant baculovirus include the construction of a suitable transfer vector, the co-transfection of this, together with wild-type baculovirus DNA, into insect cells (usually Sf9 cells) and the isolation of recombinant baculovirus by means of plaque-assay. The transfer vector carries the gene of interest flanked by sequencesthat allow a homologous recombination event in the polyhedrin locus of the wild-type baculovirus DNA, to form recombinant virus DNA. In the last years, a large number of transfer vectors have been developed, opening up a number of interesting possibilities to simplify the purification steps of the expressedprotein (fusion proteins, histidine tags, and so on). Owing to the low frequency of homologous recombination events, the visual screening for occlusion body-negative plaques was, during the early days of baculoviral expression, a quite tedious step in the generation of recombinant baculovirus. However, many kits are now commercially available to facilitate
Expression of ML
167
the lsolatlon of recombinant baculovn-us. Most of these utilize improved vanants of baculovlrus DNA, where a lethal deletion has been introduced, which IS rescued upon homologous recombmatlon with the transfer vector. The use of lethally deleted AcPNV DNA results in recombmatlon efficlencles of close to 100%. A second improvement that has been introduced into the AcPNV DNA to further facilitate the selection of recombinant virus 1sthe Insertion of a pgalactosidase (ZacZ) gene under the control of the polyhedrin promoter This allows for color-selection on plates contammg the P-galactosldase substrate Xgal. One commercially available kit, which combines these two improvements and which we have found to work very satisfactory, IS the BaculoGold System from PharMmgen. This kit has been used m our laboratory to, for instance, generate recombinant baculovnus for human HSL. Human HSL 1sexpressed m Sf9 cells to similar levels as rat HSL, for which recombinant baculovu-us was generated before any Improved versions of AcPNV DNA was available The protocols related to the generation of recombinant baculovlrus DNA described m this chapter have been adopted from the BaculoGold System from PharMmgen The purification scheme for recombinant HSL (6) has been adopted from previous descrlptlons of the purification of HSL from rat and bovine adipose tissue (I, 22,13). After detergent solublllzatlon, anion-exchange chromatography on Q-Sepharose is employed, followed by hydrophobic interaction chromatography on Phenyl-Sepharose. For purposes which require highly concentrated enzyme, or exchange of the detergent, a second amon exchange chromatography IS performed. The protocols will be given for the purlficatlon of recombinant rat HSL, and the differences m the purlficatlon scheme that we have found necessary to Introduce for the successful purification of recomblnant human HSL will be described in the final section (see Note 6). 2. Materials 2.1. Generation and Isolation of Recombinant Baculovirus 2.7.7. Construction of Recombinant Transfer Vector 1 pVL1392/1393 and other transfer vectors are available from PharMmgen (San Diego, CA) The compatibility of transfer vectors from dealers other than PharMmgen with the BaculoGold kit has to be checked. The authors have, for Instance, successfully used the pBlueBacHls vector from Invltrogen (San Dlego, CA) together with the BaculoGold kit 2 The cDNA of interest, preferably devoid of most of the 5’-untranslated sequences, and contammg restrlctlon sites compatible with the polylinker region of the tlansfer vector at its ends Whether or not the mltlatlon ATG codon of the cDNA needs to be included depends on the choice of the transfer vector AlternatIvely, DNA constructs described here are available from the authors.
168
Ho/m and Contreras
3 Reagents for standard DNA cloning techniques and plasmld preparation Good quahty plasmld DNA can be prepared using Qlagen maxipreps kits (Qlagen Gmbh, Hllden, Germany).
2.1 2. Cotransfectlon of Transfer Vector and Baculowrus DNA into Spodoptera frugiperda (Sf9) Cells 1 BaculoGold Transfectlon Kit (PharMmgen) 2 EX-CELL 401 medium with L-glutamme (JRH Biosciences, Lenexa, KS, USA) 3 EX-CELL 401 medium with L-glutamme, 10% fetal bovine serum (Glbco-BRL, Galthersburg, MD) and (optional) 100 U/mL pemclllm/streptomycm (Glbco-BRL) 4 Sf9 cells m log phase. Sf9 cells can be obtained from PharMmgen, American Type Culture Collection (Rockvllle, MD) and other dealers
2.1.3. Isolation of Recombinant Baculovirus by Plaque-Assay 1 SeaPlaque agarose (FMC, Rockland, ME) 2 Neutral red (Sigma, St. Louis, MO) stock solution filter-stenhzed
2.2. Large-Scale
Production
and Purification
0 5 % neutral red m water,
of HSL
2.2.1 Large-Scale Production of HSL in Suspension Cultures of Sf9 Cells 1 2 3 4
Shakmg incubator (Lab-Line Instruments Inc , model no. 3258 or 4628 or equivalent) 500 mL autoclavable Erlenmeyer flasks (cat no 256 10, Corning, NY) High titer recombinant baculovlrus stock (l-2 x lo8 pfu/mL) EX-CELL 401 medium with L-glutamme (JRH Blosclences) with (optlonal) 10% fetal bovine serum and 100 U/mL penicillm/streptomycm (Glbco-BRL)
2.2.2 Purification of HSL 1 Homogemzatlon buffer 0 25 M sucrose, 1 mM EDTA, 1 mA4 dlthloerythntol, 20 pg/mL leupeptm, 1 pg/mL pepstatm, 2 pg/mL antlpam, pH 7 0 2 C13E12 or other detergent from the alkyl polyoxyethylene ether group (Sigma, Fluka, Buchs, Switzerland, Bachem, Buberndorf, Switzerland, Calblochem, La Jolla, CA). 3 Branson Somfier 250 (Danbury, CT) or equivalent 4. Dlalysls buffer. 20 mM Tns-acetate, 20% glycerol, 1 mM dlthloerythntol, 0 2% C,,E,,, 2 pg/mL leupeptm, pH 7 5 5. Q-Sepharose FF (Pharmacla Biotech, Uppsala, Sweden). 6. Buffer A. 50 mMTns-acetate, pH 7 5,20% glycerol, 1 mMdithloerythrlto1, 0 2% C13hz
7 Buffer B: 0.3 MNa-acetate m buffer A, pH 7 0 8 Phenyl-Sepharose CL-4B (Pharmacla Blotech) 9 Buffer C 0 1 M NaH2P04, pH 7 4, 0 8 M NaCl, 1 n-&Z dlthloerythntol, C,,E,,, 10% glycerol
0 005%
Expression of HSL
169
10. Buffer D 5 mA4 potassium phosphate, pH 7 4, 2 M NaCl, 2% C,,E,,, 1 mM dithloerythntol, 10% glycerol 11 Buffer E: 5 mMNaH,PO,, pH 7 4, 1 mMdlthloerythnto1, 0 2% C,,E,,, 50% glycerol
3. Methods 3.1. Generation and Isolation of Recombinant Baculovirus 3. I. 7. Construction of Recombinant Transfer Vector Using standard molecular biology techniques, construct the recombinant transfer vector by msertmg the relevant cDNA into a sultable transfer vector Check the integrity of the construct by DNA sequencmg and prepare good quahty plasmld DNA usmg, for Instance, Qlagen maxtpreps. Our constructs for the expresslon of rat and human HSL, respectively, in the baculovirus system were generated by insertion of the respective full length cDNAs mto the multiple cloning site of the baculovnus transfer vector pVL1393. The efficiency of protem expresslon may be hampered by long 5’ untranslated regions. Therefore, virtually all of these regions were eliminated from the cDNAs prtor to the clomng mto pVL1393, by means of restrIctIon enzyme cleavage and a standard PCR method, respectively. 3.1.2. Cotransfection of Transfer Vector and Baculovws into Spodoptera frugiperda (Sf9) Cells
DNA
Sfp cells, m log phase, are co-transfected using the BaculoGold TransfectionKit (PharMmgen), as described by the manufacturer, except that EXCELL 401 medium, instead of TMN-FH medium, IS used throughout the procedure (see Note 1) 3.1.3 Isolation of Recombinant Baculovirus by Plaque-Assay To isolate individual recombmant baculovnus, a plaque assay IS performed according to a modification of the procedure described m (14): I
2 3.
4. 5
In 35-mm plates, seed 1 x lo6 cells m 1 5-2 mL of medium (cells should be m exponential growth phase) Let them settle on a leveled surface for 20-30 mm at room temperature (cells should be 30-50% confluent) Replace the medium with fresh medium and Incubate at 27°C for 90 mm. MeanwhIle, prepare 2% agarose in 1X PBS and autoclave for 30 mm (1 mL of 2% agarose IS required per plate) Place at 37°C Also place an equivalent volume of complete medium (with 10% fetal bovme serum) at 37°C Prepare serial dilutions of the virus stock 10e2, 10M3,10m4,and IOF Remove the medium from the cells completely and overlay the cells with 200 pL of the correspondmg vnus stock dilution, addmg it gently to prevent damage of the monolayer Incubate for 1 h at room temperature (plates can be gently rocked every 15-20 mm)
170
Holm and Contreras
6 MIX equal volumes of the 2% agarose solution and the complete medium prewarmed to 37°C. Keep the mrx m a beaker with clean water at 37”C, to prevent the agarose from solldlfymg 7. Remove the virus moculum completely with a mlcroplpet and overlay the cells carefully with 2 mL of the agarose/medmm soluhon (plpeting gently down the wall of the plate). 8 Place the plates on a leveled table and allow the agarose to cool for 15-20 mm 9 When the agarose is sohdlfied, overlay It with 1 ml of complete medium (this IS not only to prevent the agarose from drying, but also to provide the cells with nutrients, which may be essential for the development of good plaques) 10 incubate 3-5 dat 27T 11. Dilute the neutral red stock solution 1 20 with sterile PBS 12 Add 1 mL of the neutral red dilution to each plate and incubate 2-4 h at room temperature 13 Remove the neutral red and incubate the plates m the dark until the plaques become visible (white plaques on a red background), this takes approx 2 h, but they can be incubated overnight 14. Pick mdivldual plaques by takmg a plug of agarose with a sterile Pasteur plpet Place the agarose plug contammg one mdlvldual plaque m a sterile Eppendorf tube with 500 JJL of medmm and incubate overnight on a rocking table, to elute the virus from the agarose
3.2. Large-Scale Production and Purification 3.2.1. Large-Scale Product/on of HSL m Suspension Cultures of Sf9 Cells
of HSL
Individually picked baculovn-us plaques are amplified as described by the BaculoGoldSystem manufacturer (PharMmgen) or In several steps as described m (14). For large-scale production of HSL, Sf9 cells are grown m suspension cultures m autoclavable polycarbonate Erlenmeyer flasks (100 mL culture/ 500-mL flask) in EX-CELL 401 medium supplemented with 10% fetal bovine serum (see Note 2). Cells, at a density of 2 x 106/mL, are infected with high titer recombinant baculovlrus stock (see Note 3) at a multlphcity of infection (MOI) of at least five (usually 5-10) and incubated m an incubator with orbital shaking (110-20 rpm) at 27°C. At 60 h post-infection, cells are harvested and processed as described below, since at this time point the production of active HSL was found to be maximal (Fig. 2). 3.22. Punficat/on of HSL Described below 1sthe large-scale purification of recombinant rat HSL from a total of 12 L of culture, corresponding to approx 500 mL of homogenate (6). The different chromatography procedures are performed in a conventional manner, using the Gradi-Frac system from Pharmacla. All steps are performed
Expression of HSL
171
7
-7 ‘T’
’
50
60 70 60 Time (hours posttnfection)
90
1 ‘0
Fig.2. Time-course for the productton of active rat HSL by 99 ceils infected with recombinant baculovuus Sf9 cells in suspension culture were infected at a density of 2 x lo6 cells/ml and a MO1 of 10 At the indicated times post infection, cells were harvested, homogenized and assayed for HSL acttvtty and total protein concentratton Points represent the average of tnphcate determmattons; tnphcates varied by less than 10% at 1OT, unless otherwise indicated. The sample can be frozen and kept at -8OOC after the homogenization (see Subheading 3.2.2.1., step l), or after each chromatographic procedure. 3.2.2.1
DETERGENT
SOLUBILIZATION
1 Harvest the cells by centrtfugatton at 1200g for 10 mm at 4°C. Homogenize the cell pellets on ice m 3 vol of homogenizatton buffer, using 20 strokes with a glass pestle m a glass homogenizer 2 Solubrhze the homogenate by addmg C, 3E,2 to 1% and NaCl to 10 mM, followed by sontcatlon on ice for 3-4 mm m 30-s pulses at setting l-2 (see Note 4) 3 Remove msoluble material by centrifugatton at 10,OOOgfor 10 mm at 4’C 4 Dialyze the supernatant overnight at 4°C against 3 x 5 L of dialysis buffer 3 2 2.2 ANION-EXCHANGE
CHROMATOGRAPHY
(Q-SEPHAROSE)
1 Pack a 5 x 15 cm column with Q-Sepharose FF m 1 A4 Trrs-HCl, pH 7 5, and equthbrate wtth this buffer unttl pH 1sneutral. 2. Equilibrate wtth 10-20 vol of buffer A 3 Load the dialyzed sample, followed by washing with 2 vol of buffer A, at 6 mL/mm 4. Apply a 400 mL gradient from O-O. 15 M sodium acetate m buffer A, pH 7 0 (O50% buffer B), followed by a 400 mL plateau at 0 1 Msodnun acetate m buffer A (33% buffer B). 5 Elute HSL from the column by a second gradrent (800 mL) from 0 154 3 A4 sodium acetate m buffer A, pH 7.0 (50-100% buffer B) and collect 25-28-mL fractrons. HSL elutes reproducrbly at 0.2 M sodium acetate (60-70% buffer B)
772
Ho/m and Contreras
6 Analyze the fractions by SDS-PAGE and (opttonal) HSL acttvtty (using a dtacylglycerol substrate) (15) Pool the HSL-contaming fractions, avoid the most Impure fractions at the end of the HSL peak The purity of the pooled material at this stage IS usually approx 20% Add protease mhlbltors to the enzyme pool (20 pg/mL leupeptm, 1 pg/mL pepstatm and 2 pg/mL antipam). Proceed rmmedrately wtth the hydrophobtc mteractton chromatography or store at -80°C 3 2 2 3 HYDROPHOBIC INTERACTION CHROMATOGRAPHY ( PHENYL-SEPHAROSE) Pack a 2 6 x 12 mL with Phenyl-Sepharose CL-4B m buffer C Eqmhbrate with (exactly) 20 vol buffer D, followed by (exactly) 10 vol buffer C. Add NaCl to 0 8 A4 to the pooled enzyme from above (see Subheading 3.2.2.2.) and apply rt to the column at a flow rate of 6 mL/mm Wash with 10 vol of buffer C Elute HSL with a 200 mL linear gradrent from 100% buffer C to 100% buffer E at a flow rate of 3 mL/mm, followed by 2 vol of buffer E The elutron point of HSL IS less reproductble for this column than for the anion exchange chromatography column (Subheading 3.2.2.2.), but rt IS usually at the very end of the gradient, or even m buffer E Collect 15-mL fractions durmg the elutton Analyze the fractions by SDS-PAGE and (optional) HSL actrvtty (using a dracylglycerol substrate) (15) and pool HSL based on the results from the SDSPAGE analysis to obtain a protein purity of >95% 3 2.2 4. ANION-EXCHANGE CHROMATOGRAPHY In order to concentrate the pooled material from above (Subheading 3.2.2.3.) and/or exchange the detergent, a second amon exchange chromatography on Q-Sepharose FF can be carried out. This IS performed as described above (Subheading 3.2.2.2.), with the followmg modrficatrons. n-r step 4, the glycerol concentration IS lowered to 5% m buffer A and B (i.e. the first gradrent and the plateau IS omrtted) and at step 5 the enzyme IS eluted directly with buffer B. Typically, we apply 15% of the total materral from Subheading 3.2.2.3. to a 1 x 3 8 cm column, which IS run at 1.5 mL/mm (see Notes 5 and 6). 4. Notes 1 The EX-CELL 401 medium has been developed for serum-free culttvatron of insect cells Prehmmary results indicate that the productron of HSL IS at least as high m the absence, as m the presence, of fetal bovine serum 2 We have described the large-scale productron of HSL m suspensron cultures of St9 cells Alternative systems for large-scale productron of proteins m insect cells, include spinner culture systems and bloreactors. The authors have no extensive experrence wrth these systems, but a btoreactor system, with a maximal culture volume of 15 L, 1scurrently being set up m the authors’ laboratory 3 In our experience, baculovu-us stocks can be stored at 4°C for several years wtthout any significant loss m titer However, tt IS recommended to regularly check the trter of vnus stocks using the plaque assay, and to keep an alrquot of the stock
Expression of HSL
173
at -80°C In additton, tt 1s recommended to extract the DNA from recombmant baculovu-us as a precautton agamst the loss of the virus stock. 4 Owmg to the amphlphthc character of HSL detergent must be present throughout the put&anon scheme, and also during subsequent studtes and analyses of the purified protein Most commercially available detergents have been tested wtth regard to their effect on the enzyme activity of HSL. Detergents from the alkyl polyoxyethylene group are especially useful for work with HSL and HSL activity shows a high tolerance to the length of the alkyl carbon and oxyethylene group of this type of detergents With regard to purification of HSL, the only detergent used routinely m the authors’ laboratories 1s C13E12 C,,E,, 1s a polydisperse preparation of alkyl polyoxyethylenes with the indicated average compostnon, C = alkyl carbons, E = oxyethylene units. Unfortunately, detergents of this type are no longer available from Berolkeml AB, Stenungssund, Sweden Similar alkyl polyoxyethylene ethers are available from other dealers The authors have good experience with all tested variants of polyoxyethylene ethers with regard to their behavior with the purtfied enzyme, but recommend types with similar numbers of alkyl carbons and oxyethylene units to C,,E,, for protocols described m Subheadings 3.2.2.1.-3.2.2.3. With regard to the purification steps in Subheading 3.2.2.4., the detergent concentration orlgmally used has been successfully reduced from 0 2-O 008%, whtch IS very close to the crrttcal micellar concentration for Ci3Et2 The detergent has also been exchanged for shorter versions of C13E12, CsE, (0 4%) and CsE,(O 35%), and for CHAPS (9 mA4), without any loss in the recovery of active enzyme CHAPS (a zwitteriotuc bile-salt derived detergent) IS one of the few detergents, besides the alkyl polyoxyethylene ethers, that can be used together with HSL and has, m our hands, shown quite reproducible results However, the solublhty of HSL appears to be lower m CHAPS than in the alkyl polyoxyethylene detergents, a problem which IS evtdent at HSL concentrations of several mg/mL, especially on freezmg/thawmg 5 The purified enzyme preparations resulting from the protocols in Subheading 3.2.2.3. (m 5 mMNaH,P04, pH 7 0, 1 mMdithloerythrttol,O 2% C,,E,* and 50% glycerol) and in Subheading 3.2.2.4. (50 mMTris-acetate, 0 3 MNa-acetate, pH 7.0, 1 nuVdithloerythrno1, 5% glycerol, and either 0 2% C,3E12, 0 008% C,3E,, or 9 mA4 CHAPS) retam more than 85% of then activity upon storage at -80°C for 4 mo Higher glycerol concentrations (up to 50%) added to fully purified enzyme did not improve the stabthty. It 1svery important to keep the enzyme at -80°C smce the stability is considerably reduced upon storage at -20°C It IS also important to keep the enzyme preparations frozen m small ahquots, since repeated freezing and thawing reduces the stability of HSL 6. The described puriticatton scheme can, after some modifications, be employed also for recombmant human HSL For reasons which are unclear, the capacity of the Q-Sepharose column is three to four times lower for human HSL compared to rat HSL, and the human enzyme elutes at a higher salt concentration than rat HSL The starting material for the large-scale purification of human HSL, accordmg to the described scheme, 1s typically 150 mL of homogenate With
Holm and Contreras
174
regard to the column steps in Subheading 3.2.2.2., the same flow rates and the same stze columns are used for human HSL However, there are modtfications to the buffers used Buffer B contams 1 MNa-acetate (Instead of 0 3 M) The first gradient IS from 0 to 0.2 A4 sodmm acetate, followed by a plateau at 0.2 M Durmg the second gradient, from 0.2-l M sodium acetate, human HSL elutes around 0 6 M sodium acetate The later elution of human HSL affects the purity of the enzyme adversely and m order to obtam homogenous enzyme, tt IS necessary to pool the eluted fracttons over a narrow range and strtctly according to thetr purtty as Judged by SDS-PAGE. This affects the overall recovery of purified human HSL, such that tt IS usually between 25 and 30%, Instead of 40% as observed wtth the rat enzyme (6). The Phenyl-Sepharose chromatography IS performed as descrtbed m Subheading 3.2.2.3., except that buffer C contams 1 A4 NaCl (instead of 0 8 M) to ensure complete bmdmg of the human enzyme to the column Finally, m Subheading 3.2.2.4., half as much enzyme IS loaded onto the column and 1 M sodium acetate 1sused in the elutton buffer (buffer B)
References 1 Fredrtkson, G , StrBlfors, P , Ntlsson, N. O., and Belfrage, P (1981) Hormonesenstttve hpase of rat adipose tissue Purtficatton and some properties J Bzol Chem. 256,63 1 l-6320. 2 Holm, C , Fredrtkson, G , and Belfrage, P. (1986) Demonstratton of the amphiphrhc character of hormone-sensmve lrpase by temperature-Induced phase separation m Trtton X-l 14 and charge-shift electrophorests. J Bzol. Chem 261, 15,659-15,661 3 Holm, C , Kirchgessner, T. G , Svenson, K. L., Fredrtkson, G., Ntlsson, S., Miller, C G , Shtvely, J E., Hemzmann, C., Sparkes, R. C., Mohandas, T., LUSIS, A. J., Belfrage, P , and Schotz, M. C (1988) Hormone-sensmve lipase. Sequence, expresston, and chromosomal localization to 19 cent-q1 3 3 Sczence241, 1503-1506. 4 Langm, D , Laurell, H., Stenson Holst, L , Belfrage, P., and Holm, C (1993) Gene orgamzatton and primary structure of human hormone-sensitive ltpase: Posstble sequence stgnificance of a sequence homology wtth a ltpase of Moraxella TA144, an antarctic bacterium Proc Nat1 Acad Scl US A. 90,4897-4901 5. LI, Z , Sumlda, M , Bnchbauer, A., Schotz, M C., and Reue, K. (1994) Isolatton and characterization of the gene for mouse hormone-senstttve hpase. Genomzcs 24,259-265 6 (asterlund, T , Damelsson, B., Degerman, E , Contreras, J A , Edgren, G , Davts, R. C , Schotz, M C , and Holm, C (1996) Domain structure analysts of recombrnant rat hormone-sensrttve hpase. Brochem J. 319, 4 1 l-420 7 Thtrstrup, K., Cam&e, F., HJOI%, S., Rasmussen, P B , Woldike, H , Nielsen, P F , and Them, L (1993) One-step purification and charactertzation of human pancreatic hpase expressed m insect cells. FEBS Lett 327, 79-84 8 Sheriff, S , Du, H., and Grabowskt, G A. (1995) Characterizatton of lysosomal actd ltpase by site-directed mutagenesis and heterologous expression J Bzol Chem. 270, 27,766-27,772.
9. Amets, D. High level baculovtral expression of lysosomal acid hpase. This volume [20].
Expression of HSL
175
10 Jennens, M L. and Lowe, M E (1995) Rat GP-3 is a pancreattc hpase wtth kinetic properttes that differ from cohpase-dependent pancreattc hpase J Lzpzd Res 36, 2374-2382 11 DiPersto L P , Ktssel J A., and Hut D Y (1992) Purtficatton of pancreattc cholesterol esterase expressed m recombmant baculovtrus-Infected St9 cells Protezn Expr 3, 114-120 12 Ndsson, S., and Belfrage, P (1986) Purtficatton of hormone-senstttve hpase by high-peformance ton exchange chromatography Anal Blochem 158, 399407 13 Nilsson, S , Helm, C., and Belfrage, P (1989) Rapid purtficatron of detergentsolubtllzed bovine hormone-sensitive hpase by high performance hydrophobtc mteractton chromatography Biomed Chromatogr 3, 82-87 14 Kmg, L A and Possee,R D (1992) The Baculovirus ExpresszonSystem A Laboratory Guzde Chapman & Hall, London, pp 106125 15 Holm, C and (dsterlund, T Hormone-sensitive hpaseand neutral cholesteryl ester hpase This volume [ 161
High-Level Baculoviral Acid Lipase
Expression
of Lysosomal
Anne-Christine Tilkorn, Martin Merkel, Heiner Greten, and Detlev Ameis 1. Introduction LysosomaI acid hpase (LAL, EC 3.1.1.13) 1sa hydrolase essential for the mtracellular degradation of liplds derived from plasma ltpoprotems (I), LAL 1s synthesized m most cells and tissues of the human body, mcludmg fibroblasts, macrophages and lymphocytes. Although LAL activity is easily detected m these tissues, detailed physlologlcal studies have been hindered by low levels of tissue expression. Moreover, blochemlcal purlficatlon strategies have suffered frorn the mstablllty of the hpase such that structural and functional features of LAL have not been investigated to any great extent. Short-time expresslon systems generating recombinant enzyme m encaryotic cells, while suitable for studying effects of mutations of enzyme actlvltles (2), are limited by their low efficiency of enzyme production precluding purlficatton and blochemical analysis of LAL. Attempts to express LAL m bacteria failed due to precipitation of heterologous protein in mcluslon bodies In addition, bacterial expression systems may not be suitable to produce enzymatlcally active LAL since bacterial cells do not provide co- and posttranslational modlficatlons necessary for enzyme activity. In contrast, transient protein expression in insect cells mediated by baculovn-al vectors 1scharacterized by high levels of recombinant protein production with suitable posttranslational modlficatlon (3), allowing purlficatlon of expressed protein from cell extracts or culture supernatants The authors have developed a baculovlral expression system and have produced high amounts of enzymatically active LAL m insect cells. The expression vector utilizes the leader sequenceof human placental alkaline phosphatase (Fig. l), which efficiently directs nascent polypeptldes from rlbosomes to the From
Methods E&ted by
rn Molecular M H DoolWe
Biology, Vol 109 Lfpase and K Reue 0 Humana
777
and Phosphobpase Protocols Press Inc , Totowa, NJ
178
Tilkorn et al.
pAPLALBacHK-3
AmpR
Ftg 1 Vector map of pAPLALBacHis used for generatmg recombtnant baculovn-us pAPLALBacHis contains the srgnal sequence of alkahne phosphatase (hatched) derived from pSEAP which IS fused m frame to the coding regton of LAL A carboxytermmal extension of six hlstrdine residues is added to allow affintty chromatography on Nrckel-NTA agarose endoplasmtc reticulum in insect cells (4). During the authors’ study It was shown that a considerable amount of expressed heterologous lipase IS secreted into the medium. The enzyme can subsequently be purrfied from tissue culture medium by a single-step nickel-affimty chromatography. Brochemical features, e. g., specific activity of m vitro expressed LAL, was found to be stmtlar to LAL purified from human hver, tndtcatmg that neither an ammotermmal modrficatron (Fig. 2) nor a polyhtstrdme tag at the carboxytermmus of the protein stgmficantly modify the overall structure of the LAL protem.
2. Materials 2.1. Expression 27.1. Construction of the Express/on Vector 1 Standard PCR reagents and Vent polymerase (New England Btolabs, Beverly, MA) 2 Prtmers for ampltficatton of LAL* LAL227D-Nco I 5’-ACT GCC ATG GGC TGT CGA TCC TGA AAC AAA CAT G-3’ LAL1345U-HIS-Not I 5’-ACG TGC GGC CGC TCA GTG ATG GTG ATG GTG ATG CTG ATA TTT CCT CAT TAG ATT-3’ 3 BacPAK8 plasmtd vector (Clontech, Palo Alto, CA)
179
Expressron of LAL
Ser
Leu
Gly
11e
Ile
Pro'Trp'Ala
TCC
CTG
GGC
ATC
ATC
CCA
TGG
GCT
Val
Aep
Pro
Glu
Thr
GTG
GAT
CCT
GAA
ACA
NcoI
Fig. 2 Ammo-termmal protein and DNA sequence and processmg of recombmant LAL. Due to PCR overlap cloning and the restrrctton site NcoI used during the clonmg, the ammotermmus of recombmant LAL deviates form the wild-type hpase The processmg site of alkaline phosphatase signal sequence is indicated by an arrow. Protem microsequencmg of purified recombinant LAL has shown that the ammotermmus contains a four residue extension of Ile-Ile-Pro-Trp The altered ammo-terminus did not affect enzyme specific activity Wild-type LAL starts wtth Ala1 4 5 6 AP4 API 7
LAL cDNA m plasmtd hLAL 4/l (5) This construct 1savailable from the authors Alkaline phosphatase (AP) signal sequence. pSEAP plasmtd (Clontech) Primers for amplification of alkalme phosphatase signal pepttde 1D-Bgl II 5’-AGC TAG ATC TGC CAT GCT GGG GCC CTG CAT GCT G-3’ lSU-iVco I 5’ AAT TCC ATG GGA TGA TGC CCA GGG AGA GCT GTA G-3’ Standard reagents for subcloning of DNA fragments mcluding restriction enzymes, T4-DNA hgase, and Escherzchza colz XL-l blue competent cells 8 DNA Plasmtd Max1 preparation kit (QIAGEN, Santa Clartta, CA)
2 1.2. Cell Culture and Cotransfection 1 Standard cell culture materials including flasks, dishes and rubber scrapers 2. St9 cells (Invitrogen, Carlsbad, CA), TClOO Medium (Life Technologies, Gatthersburg, MD). 3 Fetal bovine serum (Life Technologtes) and penicillin-streptomycm 100x stock (Life Technologtes) 4 Complete St9 cell medmm used throughout this study is TClOO/lO% FBS/ 100 U/mL pemctllm, 100 U/mL streptomycin (TClOO/FBS/PS). 5 5-mL Polystyrene tubes (Falcon, Becton Dickinson, Franklin Lakes, NJ) 6 BacPAK6, Bsu 36 I-digested (Clontech). 7 APLALBacHis vector (7.8-kb) at a concentration of 500 ng/uL in TE 8 Lipofectm (Life Technologies), diluted 1.10 m TC 100 without serum or anttbtottcs
2.1.3. Plaque Put-if/cation 1 SeaKem agarose (FMC, Rockland, ME) 2 Phosphate-buffered saline (PBS) 140 mMNaC1, 27 mM KCl, 8 mA4 Na2HP0,, 1 5 mA4 KH,P04, pH 7.3 3 Stain. neutral red (Sigma, St Louts, MO) at a concentratton of 1 mg/mL in PBS, filter sterilize and store at 4°C m the dark.
Tilkorn et al
780 2 1 4. PCR Analysis of Recombrnant Virus Stocks
1 Lys~s buffer 50 mM Tns-HCl, pH 8 0, 10 mA4 EDTA, 5% P-mercaptoethanol, 0 4% sodium dodecyl sulfate (SDS) 2 Protemase K (Boehrmger Mannhelm) at a concentration of 10 mg/mL m 10 nut4 Trrs-HCl, pH 8 0 Predigest protemase K for 2 h at 37°C 3 Phenol chloroform (50.50) equilibrated with 100 mM Trrs-HCl, pH 8 0 4 3 A4 sodium acetate, pH 5 2 5 TE-Buffer 10 mMTris-HCl, pH 8 0, 1 mMEDTA 6 Primers for PCR amplification Bacl 5’-ACC ATC TCG CAA ATA AAT AAG -3’ Bac2 5’-ACA ACG CAC AGA ATC TAG CG -3’
2.1 5. Vws Ampllflcatlon
and Express/on
1 Insect X-Press Medmm (Browhttaker, 2 Pluromc F-68 (Ltfe Sciences)
Experiments
Walkersvrlle,
MD)
2.2. Purification 1 Nickel-NTA resin and 5-mL columns (Qtagen) 2 Ethylene glycol (Merck, Darmstadt, Germany) and Tnton X- 100 (Bra-Rad, Hercules, CA) 3 Equilibration buffer 50 mMNaH,P04, pH 7 0,300 mMNaCl,20 mMrmrdazole, 0 1% (v/v) Trtton X-100, 25% (v/v) ethylene glycol 4 Wash buffer. 50 mMNaH,PO,, pH 6 5,300 mMNaC1,20 mMrmidazole, 0 1% Trrton X- 100, 25% ethylene glycol 5 Elution buffer 50 mA4NaH2P04, pH 4 5,300 mMNaCl,20 mMrmtdazole, 0 1% Trrton X- 100, 25% ethylene glycol
3. Methods The baculovu-us
system
described
here exploits
the alkaline
phosphatase
signal sequence (Fig. 1) to express LAL at concentrations of about 15 pg/mL m tissue culture medium. Time-course experiments have determined a viral infection of 4 d as the optlmal time to harvest expressed protem (Fig. 3)
3.7. Expression 3.1.1. Construction of the Expression Vector A PlALBacHls 1 Set up PCR amplificatron reactron I with hLAL 4/l as template DNA Primers are LAL227D-Nco I and LAL1345U-His-Not1 Use Vent-Polymerase for PCR (see Note 1) Figure 1 Illustrates detarls of vector construction 2 Set up amphficatron reactton II usmg pSEAP as the template DNA PCR primers are AP4 1D-BglII and AP 11 SU-NcoI 3. Gel purtfy the PCR products I and II using a Qraex DNA gel extraction system 4. Perform restriction enzyme digests with NcoI and Not1 for PCR product I, and with BglII and NcoI for PCR product II. Digest BacPAK8 with BglII and NotI.
Expression of LAL
181
kDa 200 2; 66
31
21
Fig. 3. Time-course to determine recombinant LAL production in baculovirus infected Sf9 cells. Cultures were infected simultaneously, and spent media were collected at the indicated time points and assayed for triacylglycerol hydrolysis. An infection of 4 d was found to be optimal for maximum enzyme production.
5. Heat denatnraterestriction digestsfor 20 min at 65°C to inactivate endonucleases. 6. Ligate PCR products I and II with BacPAK8 at a molar ratio of 3:3: 1. Ligation is performed at 16°C for 18 h. 7. Transform E. cob XL-l blue competent cells with ligation reaction. 8. Grow colonies in 5-mL cultures and extract plasmid DNA by mini preparation. 9. Run restriction digests to verify directional cloning. Additionally, it is recommended that the resulting construct be sequencedto verify the correct reading frame of the construct and to detect any mutations that might arise during the PCR amplification. 10. Prepare sufficient quantity of resulting construct for cotransfection using the DNA plasmid maxi-preparation kit following manufacturer’s instructions.
3.1.2. Cell Culture and Cotransfection 1. Dilute plasmid DNA to 100 ng/uL with TE. 2. Seed35mm dish with 1.5 x lo6 Sf 9 cells and incubate for 1 h at 27°C. 3. Remove medium and washtwice with 2 mL of TC 100. Use TC 100 medium without serum and antibiotics throughout the cotransfection. Keep the cells in 2 mL of TC 100 during the preparation of the cotransfection mixture.
Tilkorn et al.
782
4 Mix 0 5 pg of the plasmld construct and 5 pL of BacPAK6 vu-al DNA (Bsu36 I digest) m a final volume of 50 pL 5 Add 50 pL of a 1’ 10 dilution of bpofectm m TCl 00 and mix gently. Incubate at room temperature for 15 mm. 6 Replace the medium with 1.5 mL of fresh TC 100 7 Add the cotransfectton mixture dropwise to the dishes and gently swirl 8 Incubate at 27°C for 5 h. 9 Remove the transfection supernatant and add 3 mL of TClOO contammg 10% FBS and PS (TC 100/l O%/FBS/PS). 10 Harvest supernatant 4 d after transfection. This vnus stock IS termed passage 1 (PI) of APLAL-BacHis
3 7 3 Plaque Punficat/on 1 Seed three 35-mm dishes with 1 5 x lo6 St9 cells each 2 While the cells attach to the plates, dilute the P 1 virus stock to 1O-r, 1Oe2,and 1Oe3in TClOO/lO% FBS/PS 3 Add the diluted virus stocks to the St9 cells and incubate for 1 h at 27°C 4 Prepare 50 mL of 5% agarose m H,O and sterilize by autoclavmg Equilibrate the agarose at 50°C 5. Add 450 mL of TC 100110% FBS/PS to the agarose (final concentration IS 0 5% agarose) and keep at 45°C 6 Remove vnus moculum from the cells, Overlay cells gently with 3 mL of the 0 5% agarose/TClOO/lO% FBS/PS solution 7 Let the agarose overlay solidify for 10 mm before returning the dishes to the incubator. Incubate dishes upside-down on a water-saturated paper towel for 5 d 8 Prepare a neutral red agarose overlay 0.5% agarose in PBS, add neutral red (1 mg/mL) to a final concentration of 50 pg/mL 9 Add 2 mL of the neutral red agarose overlay to each dish, let solidify and mcubate inverted dishes overnight at 27°C 10 Inspect the dishes for virus plaques daily and pick well separated plaques by using the wide-mouth side of a sterile Pasteur pipet 11 Transfer virus-agarose plugs to 500 pL of TC lOO/lO% FBS/PS 12. Elute the virus for 18 h at 4’C
3.1.4. PCR Analysis of Recombinant
Viral DNA
1 Infect 35-mm dishes with 50 J.JLof virus eluate m 3 mL TClOO/lO%FBS/PS. 2 Harvest the the supernatant after 4 d and store for further ampllficatton at 4°C 3 Scrape cells off the dish and transfer to 15 mL Falcon tube Pellet the cells for 5 min at lO(r2OOg 4 Resuspend the cell pellet m 250 pL of TE buffer 5 Add 250 pL lysis buffer and 12 5 pL protemase K solution, and incubate at 50°C for 30 mm with occastonal mixmg 6 Add 500 pL of phenol chloroform (50.50). 7 Mix extensively by mversion Do not vortex mix, smce this may shear DNA
Expression of LAL
183
8 Spm m a mtcrofuge at max. speed for 2 min 9. Transfer the aqueous phase to a fresh tube and repeat the extractton twtce 10. Transfer the aqueous phase to a fresh tube and add 50 pL of 3 M sodmm acetate, pH 5 2 and 1 mL of ethanol MIX by mvertmg the tube 11. Keep at -20°C for 2 h A DNA prectpttate should be vtsible at thts pomt 12 Pellet the DNA m a microfuge for 15 mm. 13. Wash DNA pellet with 0 5 mL of 75% ethanol, mix and pellet the DNA Repeat the ethanol wash once 14 Dry DNA pellet for 2 h at room temperature and dissolve DNA overnight m 500 pL of TE buffer at 4°C 15 Use 5 PL of DNA as template for amplification reactions usmg standard PCR condmons with the followmg oligonucleotide primer pans Pan 1’ Bat 1 and LAL 1345UHis-Not I Pan 2 LAL 227D-Bgl II and Bac2 Pan 3. Bacl and Bac2
3.1.5. Virus Amplification and Express/on Inoculate lo6 cells with 1 mL of the supernatant from vtrus plaque amplification (step 2 m Subheading 3.1.4.). 2 Add 10 mL of TC 1OO/lO% FBS/PS and incubate for 1 h at 27’C. 3 Add another 30 mL of TCI OO/lO%/FBS/PS to the cells and Incubate 4 to 6 d at 27 “C (see Note 2) 4. Harvest the medmm and centrifuge at lOQ--200g at 4°C for 5 min 5 Store at 4°C; thts stock 1s called the P2 virus stock (see Note 3) 6 Add 5 mL of a high titer virus stock, preferably after two rounds of amphficatton
7 8 9
10 11 12.
(viral titers will be m the range of 107-1010pfu/mL) to lo6 exponenttally growmg St9 cells m 175-cm* tissue culture flasks. Add 10 mL of TC 10011O%/FBS/PS and Incubate for 1 h at 27°C Remove virus moculum and replace by 24 mL of protein-free Insect-Xpress medium contaming 0.5% Pluromc F68 and pemctllm/streptomycm Incubate for 4 d at 27°C. Harvest the medium and centrtfuge for 5 mm at 1000 rpm and 4 ‘C Add 8 mL of ethylene glycol and 32 pL Triton X-100 to a final concentration of 25% ethylene glycol and 0 1% Triton X-100 (see Note 4) Store at -20°C until purification
3.2. Purification Owmg to a carboxyterminal six-histtdine tract attached m frame to the ltpase protein, affinity chromatography on Nickel-NTA agarose IS possible. A single-
step purification of recombmant LAL yields an apparently homogeneous enzyme (Fig. 4). The highly purlfied lipase may then be employed m structural studies. Structure-function relatlonships can also be assessedusing site directed mutagenesis and expression clonmg of mutant enzymes.
184
Tikorn et al.
0
12 Time
3
4
5
after
infection
(days)
6
7
Fig 4 SDS-PAGE of recombmant LAL expressed m baculovuus Infected St9 cells Media contammg LAL were supplemented wtth ethylene glycol and Trrton X-100, and purified on Nickel-NTA agarose The samples were run on 12 5% SDS-PAGE under reducing condmons Lane 1, 10 uL (6 pg of protem) of medium prior to purtficatton, lane 2, 30 uL of Nickel-NTA eluate (660 ng of protein), lane M, molecular weight standards The apparent M, of recombmant LAL (arrow) is 50 kDa
1. Thaw tissue culture medtum containing LAL on ice 2 For about 32 mL of spent medium, use 3 mL of Ntckel-NTA agarose for affimty chromatography 3 Transfer Nickel-NTA agarose to a 50-mL Falcon tube and wash with 10 vol of equtltbratton buffer Repeat wash step once and keep agarose slurry on ice 4. Add medmm containing expressed LAL to Nickel-NTA agarose and gently rock on a horizontal platform or lateral shaker for 2 h at 4°C 5 Transfer agarose matrix to a 5-mL column and wash the matrtx seven ttmes wrth 6 mL of wash buffer 6. Elute LAL stepwtse by adding 2 mL elutton buffer to the column Repeat elutton twtce more with 2 mL buffer for a total of three ttmes Collect eluates on ice 7 Store eluates at -2O’C Analyze IO-20 PL of eluates on SDS-PAGE, and stain with silver nitrate for maximum sensitivity (see Fig. 4 for comparrson)
4. Notes 1. PCR amplifications using 7’aq polymerase followed by subclonmg and DNA sequence determmatton have repeatedly shown point mutations due to problems wrth polymerase fidelity Vent polymerase has been accordingly tested, and mutatron rates were found to be srgmficantly lower It IS thus exclusively used throughout our PCR amphficattons for cloning and vector constructtons 2. Ttme-course experiments wtth APLAL-BacHts have shown a linear increase m LAL acttvtty up to 4 d after transfectton. Since acttvtttes are maintained reasonably well, any ttme point between d 4 and 6 1s acceptable for obtammg htgh
Expression of LA1
185
yields of LAL However, d 4 is generally preferred for harvestmg spent medta smce after that time point considerable lys~s of mfected St9 cells leads to release of intracellular proteins and consequent contammatron of culture supernatants 3 The ttter of the P2 virus stock typically IS too low to allow simultaneous moculatton of a large number of St9 cells A second round of vnus ampltticatton IS therefore required To determine the titer of the virus stock, perfom plaque assays (see Subheading 3.1.3.) with dtluttons of 10e4, 10T5,and 10m6of the vu-us stock Plaque assay should be set up m duplicates to allow precise determmatlon of viral titers. 4. Previous chromatographrc purtficatton of LAL from human liver tissue (see Chapter IO) has shown that ethylene glycol and Trtton X-100 are essentral to stabilize enzyme preparations LAL 1s strongly hydrophobic, and mteracttons wtth plastic surfaces are mnumtzed by both substances
References 1 Assmann, G and Seedorf, U (1995) Acid hpase deficiency Wolman Dtsease and Cholesteryl Ester Storage Disease, m The Metabok and Molecular Bases of Znherzted Dzsease (&river, C R , Beaudet, A L , Sly, W S , and Valle, D , eds.), McGraw-Hill, New York, pp 2563-2587. 2 Anderson, R. A. and Sando, G. N. (1991) Cloning and expression of cDNA encodmg human lysosomal acid ltpase/cholesteryl ester hydrolase. J Bzol Chem 266, 22,479-22,484 3 Kuroda, K , Geyer, H., Geyer, R , Doerfler, W , and Klenk, H D (1990) The
oltgosacchartdes of influenza vn-us hemagglutmm expressed m Insect cells by a baculovtrus vector tirology 174,4 18-429 4 Mroczkowski, B S , Huvar, A , Lernhardt, W , Mtsono, K , Ntelson, K , and Scott, B (1994) Secretton of thermostable DNA polymerase using a novel baculovnus vector J Blol Chem 269, 13,522-13,528 5 Amers, D., Merkel, M., Eckerskorn, C , and Greten, H (1994) Purtficatron, characterrzatlon and molecular cloning of human hepattc lysosomal acid hpase Eur J Blochem 219,905-914
19 One-Step Purification and Biochemical Characterization of Recombinant Pancreatic Lipases Expressed in Insect Cells Sofiane Bezzine, Francine Ferrato, Wronique Lopez, Alain de Caro, Robert Verger, and Frederic Carri&re 1. Introduction The baculovtrus expresston system is very convenient to produce recombinant pancreatic llpases and mutants thereof, m substantial amounts ( 1O-50 mg of enzyme per liter of culture) for structure-function studtes (see also Chapters 17, 18, and 20 m this volume). Using the naturally occurring leader sequence, recombinant enzymes are secreted by Insect cells and are easy to purify in a one-step procedure when insect cells are grown in a serum-free medium In the present chapter, we describe m detail the expression and puriticatton protocols based on the results obtained with the classical human pancreatic hpase (HPL) and updated from the original method first reported by Thirstrup et al. (I). A cDNA clone encoding the complete sequence of HPL was subcloned mto the baculovtrus transfer vector pVL1392 and used for cotransfectmg Spodoptera frugiperda insect cells (Sf9) with wild-type Autographa calzfornzca nuclear polyhedrosts virus (AcMNPV) DNA. A smgle recombinant protein (50 kDa) secreted by St9 cells is detectable in the culture medium 24 h post-mfection usmg both anti-HPL polyclonal antibodies and a pH-stat measurement for hpase activity. The expression level reaches 40 mg of enzyme per L after 6 d postmfection. A single cattomc exchange chromatography 1s sufficient to obtain a highly pure recombinant HPL (rHPL) as demonstrated by N-terminal ammo acid sequencing, ammo actd composttion, carbohydrate analysts, and mass spectrometry. These analyses mdtcate that mature HPL polypepttde is produced with the correct processmg of the signal pepttde and a homogeneous glycosylation pattern. The highly purified mateFrom
Methods in Molecular Biology, Vol 109 Ltpase and Phosphohpase Protocols Edlted by M H Doollttle and K Reue 0 Humana Press Inc , Totowa, NJ
187
188
Bezzme et al
real obtained displays btochemtcal properttes stmrlar to those of the nattve enzyme (nHPL). One should be aware, however, that insect cells release mtracellular proteases upon cell lysts due to the viral mfectron and that the recombinant protein can become degraded We have illustrated this point by followmg the time course for expression of an HPL mutant (HPL(-lid)) by Trzchoplusra rzz insect cells. These studies have revealed that m most of the cases, It IS very important to collect and purify the recombinant enzyme from insect cell cultures harvested before significant cell lysts occurs. The direct kmettc characterrzatron of recombmant enzymes present m the crude culture medmm, therefore, IS not recommended, and many studies performed with crude culture medium which have appeared in the literature must be considered with cautron.
2. Materials 1 Baculovuus transfection krt, either from Invitrogen, Carlsbad, CA (MaxBacTM) or PharMmgen, San Diego, CA (BaculoGoldTM), mcludmg the baculovn-us transfer vector pVLl392, the linearized genomrc DNA from Autographa calzfornzca nuclear polyhedrosls virus (AcMNPV), and a catromc lrposome solutton for cotransfection 2 Insect cells from Spodopteru frugzperdu (Si-9) or Trzchoplusza nz (High FiveTM, BTI-TN-SB l-4 clone, Invttrogen) 3 Culture media for insect cells TNM-FH medium (Sigma, St Louis, MO) supplemented with 10% foetal calf serum (BroWhrttaker, Walkersville, MD) and 1% of an antibiotic-antimycotic solution (Life Technologres, Garthersburg, MD) contammg 10000 U/mL perucilhn G, 10000 ug/mL streptomycin and 25 ug/mL amphotericm B (Fungizone@), SF-900 II (Life Technologies) and EX-CELL 400TM serum-free media supplemented with 0 5% of the above mentioned antibiotic-antimycotic solutron and 0 1% Pluromc F-68 (10% stock solution from Srgma) 4 Agarose for plaque assays (cell culture grade, PharMmgen) 5 Plasticware for cell culture Petri dishes (60- and loo-mm diameter, cell culture grade), 6-well plates and 175cm* culture flasks 6 One liter screw-capped Erlenmeyer flasks equrpped with a 0 22-urn filter 7 Incubator (27°C) equipped with an orbital shaker (1 e , Multitron, Infors, Allentown, PA) 8. Centrrfuge with a rotor for 250 mL flasks and freeze-drier 9 Dialysis membrane with a 25-30-kDa cut-off 10 Millipore filters (0 8- and 0 45+m, Milllpore, Bedford, MA) 11 FPLC chromatograph (Pharmacra, Uppsala, Sweden) mcludmg a GP-250 programmer, two P-500 pumps, a UV detector momtormg absorbance at 280 nm and a FRAC 100 collector 12 Mono S HR5/5 cation-exchange column (Pharmacta). 13 FPLC mobrle phase for Mono S A, 10 mM MES (2-[N-morpholmolethanesulfomc acid) buffer, pH 6 5; B, 10 mM MES buffer, 0 5 MNaCl, pH 6 5
Purification of Recornbinan t Pancreatic Lipases
189
14 pH-stat tltratlon umt (Radiometer, Westlake, OH) mcludmg a thermostated and mechanically stirred reaction vessel (TTA SO), a pH-meter (PHM82), a tltrator (TTT60), an autoburette (ABUSO) for 0 1 N NaOH delivery and a recorder 15. Pancreatic llpase substrate. trlbutyrm and trioctanom (purum grade, Fluka, Ronkonkoma, NY) 16 Bile salts’ Sodrum taurodeoxycholate (NaTDC, Sigma) 17 Buffer for the standard assay of pancreatic hpase 0.28 mM Tns-HCl, 150 mA4 NaCl, 1 4 mM CaCl,, 4 mM NaTDC, pH 8 0 18 Pancreatic hpase cofactor. porcine cohpase (Boehrmger Mannhelm, Indlanapohs, IN) 19 Rabbit anti-HPL polyclonal antibodies for western blot analysis (see Chapter 22 m this volume)
3. Methods 3.1. Production of Recombinant Virus Stocks A cDNA clone for HPL was obtained from human placenta mRNA by PCR technology (2) based on the complete sequence of HPL, including signal peptlde (2) A I,4 10 bp BamHI fragment contammg the entlre codmg region of HPL was subcloned mto the pVL 1392 transfer vector. Restrlctlon enzyme digestions, ligatlons, transformation ofB cob by electroporatlon and plasmld purification were performed according to standard protocols (3). Before insect cell cotransfectlon, It 1simportant to purify the baculovlrus transfer vector using CsCl-gradient ultracentnfugatlon, or alternatlvely, using DNA purlficatlon systems such as Wlzard@Mmlpreps or Midlpreps columns (Promega, Madison, WI). 1 The insect cell cotransfectlon
can be performed according to the mstructlons
pro-
vided by the suppliersof the Baculovirus transfectlonkit (4,5j Onecotransfectlon requires 1 pg of lmear AcMNPV DNA and 3 pg of recombinant pVL1392 mixed into catlomc Ilposomes, and added to a 60-mm Petri dish contammg 2 x 1O6 Sf9 cells grown m TNM-FH medium 2 The resulting culture supernatant is collected when all the cells lyse (approx 7 d post-mfectlon) When using the BaculoGold TMtransfectlon kit from Pharmmgen, a recombinant virus selection from the culture supernatant 1s not mandatory The lmearlzed AcMNPV DNA used for cotransfectlon contains a lethal deletion that IS only restored upon genetic recombmatlon, and accordmgly, only recombinant baculovuuses are viable When using the Invltrogen transfectlon kit, a mixture of recombinant and wild-type viruses 1s obtained and a plaque purlflcatlon 1s reqmred to Isolate the recombmant virus. 3 Plaque purification (for more details, see ref. 4) fresh monolayers of 5 x 1O6Sf9 cells m IOO-mm plates are infected with the cotransfectlon supernatant at various IO-fold dllutlons and then overlald with complete TNM-FH medium contammg 1 5% agarose After 6 d, recombinant plaques are identified as occluslon-negatlve (absence of polyhedrm mslde the cell nucleus) usmg a light microscope The presumed recombinant plaques are excised through the agarose layer usmg ster-
190
Bezzine et al.
ile Pasteur pipets and the agarose samples are used to infect 6-well plates containing 1 x lo6 Sf9 cells per well After 5 d, the correspondmg vuus DNA is purified and subjected to a PCR reaction with reverse and forward primers as previously described (6,7), m order to identify recombmant baculovnuses Usually, two rounds of plaque purification are required to ensure that recombinant virus stock is free of weld-type vuus 4 Vnus stocks the acquisition of large scale high titer vnus stocks usually requires two to three additional stages of mfectton after cotransfection m order to increase the stock volume, but it is our experience that high titer (lo’-10’ plaque-forming units per mL of culture, pfu/mL) can be obtained when infecting fresh cells with the cotransfectlon supernatant This observatton IS useful for a rapid screening for recombinant protein expression Vnus titer can be estimated using a standard plaque assay (for more details, see ref 4), but the end-pomt dllutlon assay is more easy to handle and gives good results. This latter assay is well described m the book by O’Reilly et al (s), which also provides a sample Microsoft Excel spreadsheet for the titer calculatrons.
3.2. Expression
of rHPL in Spodoptera
frugiperda
Cells
Using a 27°C incubator equipped with an orbital shaker set at lo&120 rpm, St9 cell suspensions are grown up to a concentration of l-2 x IO6 cells/ml m 250 mL SF-900 II medium using a lOOO-mL screw-capped Erlenmeyer flask An moculum of the recombinant Baculovn-us encodmg rHPL is added to the cell suspension at a multiplicity of infection of approx 10 pfu/cell. Six hours post-mfection, the cell suspension is transferred to a sterile 250 mL centrifuge flask and the cells are pelleted at 500g for 5 mm at 27°C The cell pellet is gently resuspended m 250 mL of fresh SF-900 II medmm and the cell suspension IS replaced m the Erlenmeyer flask Samplmg is performed each day for 7 d m order to check cell viabtlny and measure hpase production After centrifugation of the sample to remove cells and debris, an ahquot is stored at -20°C for SDS-PAGE analysis and tmmunoblottmg Lipase activity m insect cell culture supematant is measured potentiometrically at pH 8 0 and 37°C using the pH-stat techmque. The standard assay conditions consist of a mechanically stirred emulsion of 0 5 mL tributyrm m a thermostated reaction vessel containing 14.5 mL of the buffer 0 28 mMTris, 150 mMNaC1, 1 4 mM CaC12, 4 mM NaTDC. Colipase 1s added before the sample, at a twofold molar excess The automatic titration of the fatty acid released on tributyrin hydrolysis IS carried out by addition of 0 1 NNaOH One hpase unit (U) represents one pmole of butyric acid released per min The specific activity of the native human pancreatic hpase (nHPL) IS 8000 U/mg under these standard assay condmons. A time-course experiment of rHPL expression in insect cells IS shown m Fig. 1 (upper panel) The activity can be directly measured from the culture medium using trtbutyrm as substrate and the amount of active enzyme estimated from the specific activity of nHPL The concentration of rHPL accumulatmg in the medium reached a maxrmal level of 40 pg/mL after 6 d. A sharp decrease m cell
Purification of Recombinant Pancreatic Lipases
191
Days post-infection 0
I
2
3
4
5
6
7
Fig. 1. Time-course expression of rHPL in Spodopterafrugiperda cells. The Sf9 cells were infected with a recombinant Baculovirus containing the HPL cDNA. Each day after the infection, an aliquot of the culture medium was recovered and tested for rHPL expression using lipase activity measurements (upper panel). Aliquots of the culture medium were also subjected to electrophoresis (middle panel) and immunoblot analysis (lower panel). Lanes 2-7 correspond to d 2-7 after infection. The subsequent two lanes contain purified rHPL obtained after cationic exchange chromotograhy on Mono S column and nHPL purified from human pancreatic juice. viability is usually observed between d 3 and 4 (data not shown). This period corresponds to the beginning of cell lysis due to the viral infection. Figure 1 (lower panel) shows the analysis of rHPL secretion by SDS-PAGE and immunoblotting performed in parallel to the lipase activity measurements. The electrophoresis was performed on 12 % SDS-polyacrylamide gels. Two gels were
Bezzine et al.
192
run m parellel One gel was stained with Coomasste blue and the second gel was transferred onto mtrocellulose membrane (9) for Western blot analysis using rabbit polyclonal annbodies raised against nHPL purtfied from human pancreatic jutce (IO) The detection of the bound antibodies was done with an anttrabbtt IgG-peroxtdase conjugate and 4-chloro 1-naphtol as substrate The protein patterns obtained from both SDS-PAGE and mmmnoblottmg closely follow the activity measurements The rHPL 1s clearly the major protein observed m the culture medmm samples, showing a molecular mass of approx 50 kDa At d 4 the background level of other proteins Increases, mdtcatmg cell lysts It IS a recomended to harvest the culture supernatants 3 days post-mfectton m order to carry out a one-step purtficatton of rHPL (see Notes 1 and 2)
3.3. One-Step Purification
of rHPL
Cultures of recombmant Baculovnus-infected St9 cells are harvested after 3 d and cells are pelleted by centrifugation at 10,OOOgfor 10 mm at 4°C The culture supernatant is lyophilyzed for 24 h (see Note 3) The dry material IS dtssolved ma mmtmum volume of distilled water A volume of water correspondmg to 10% of the mmal culture volume is usually requn-ed to completely dtssolve the powder The solution is dialyzed three times against 10 mM MES buffer, pH 6 5, at 4°C Prtor to chromatography, the solution is sequentially passed through 0 8 pm and 0 45 Mtlhpore filters The Mono S HR 5/5 column is equlhbrated m 50 mMNaC1, 10 mA4MES buffer, pH 6 5 (10 % buffer B). The flow rate is adjusted to 1 mL/mm whtle mamtammg a pressure of less than 3 MPa The solution contammg rHPL is loaded onto the Mono S HR 515 column usmg the injection loop and the lipolytic activity is assayed m the eluant m order to check the absence of non-bound hpase After sample mjectton, a lmear NaCl concentratton gradient IS applied mcreasmg over 60 mm from 50 mM (10% buffer B) to 175 mMNaC1 (35% buffer B) m 10 mM MES buffer, pH 6 5 Figure 2A shows the protem elutlon profile recorded spectrophotometrically at 280 nm and the hpase activtty measured by the pH-stat method m all fracttons collected. rHPL elutes at approx 8&90 mM NaCl. An average recovery of approx 90-95% of the rHPL hpolyttc activity IS usually observed when poolmg the fractions correspondmg to the single protein peak observed m Fig. 2A.
3.4. Biochemical Characterization of rHPL In contrast to most pancreatic enzymes, which are secreted as proenzymes and further activated by proteolytic cleavage m the small intestine, HPL 1s directly secreted as an active enzyme (20). The mature protein consists of a 449 ammo acid polypepttde (2,11) mcludmg a high mannose or complex type glycan chain N-linked to Asn 166 (22,13). The SDS-PAGE and tmmuno-
Purification of Recombinant Pancreatic Lipases
193
A
N&l 150 IlIM
-.
05
E
I
/
t
i
i 5000 . i-‘. 4000B Gg. ,300o ::C. 2. *z
01.
i
lb
io
io
Ii0
i
40
5
80
/
,60
/ / 40
I i 8 9 8 B 2. 9 b
5 0t~~'~I~"'I'~~'I~~~',~~
10
1s
20
Time (min)
Fig. 2 Purlficatlon of rHPL expressed m Baculovirus-infected Insect cells (A) Pure rHPL was obtained usmg FPLC and a single purification step on a Mono S HR 5/5 column Protein elutlon was recorded by measurmg absorbance at 280 nm and hpolytlc actlvlty was assayed m all the collected fractions using the pH-stat technique and trlbutyrin as substrate. The fractions containing rHPL activity were pooled and further subJected to HPLC analySIS(B) on a reverse-phase column These data are reproduced from (I) with permlsslon blottmg analysis of the purified rHPL shows a single band of approx 50 kDa that migrates slightly faster than the nHPL (Fig. 1).
194
Bezzine et al.
The isoelectric point of rHPL 1sfound to be 7.5, which IS identical to the p1 of the major nHPL rsoform (data not shown) as prevrously reported (14-16) A sample of the purified rHPL (250 pL contammg 125 pg rHPL) from the Mono S column has been analyzed by HPLC. The sample was injected onto a Vydac 2 14TD54 reverse-phase C4 HPLC column (0 46 x 25 cm) equthbrated at 30°C at a flow rate of 1.5 mL/mm with 0.1 % TFA in 20 % (v/v) acetomtrile The concentratton of acetonitrrle in the elutmg solvent was raised to 70 % (v/v) over 25 mm, and absorbance measured at 280 nm As shown m Fig. 2B, the purified rHPL eluted with a retention ttme of 16.2 mm, correspondmg to 48.4% acetomtrtle The HPLC analysts revealed that the rHPL recovered from the Mono S column is at least 98% pure on a protein basis The material elutmg m the main peak was collected and concentrated to 60 pL by vacuum centrifugatton. Amino acid sequence analysts on this sample was carried out by automated Edman analysis using an Applied Btosystem Model 470A gas-phase sequencer (17). The single N-terminal sequence obtained, KEV(C)YERLG(C)FSDDS, 1s identical to the N-terminal sequence of the mature nHPL (2), confirmmg that the rHPL signal peptide 1scorrectly processed m insect cells. No degradation products are observed either by HPLC analysts or by N-terminal ammo acid sequencing Ammo acid composrtron analysis was carried out by hydrolysis of 50 pg rHPL with 6 A4 HCl for 24 h at 110°C as prevrously described (18). Carbohydrate composition analysrs was carried out by hydrolysis of 50 pg rHPL with 2 M HCl for 1, 2, and 4 h at lOO”C, and monosaccharrdes were separated on a CarboPac PA1 (Dronex, Sunyvale, CA) column (4 x 250 mm) eluted with 14 mA4 NaOH. The monosaccharrdes were detected by pulsed amperometric detection (Dionex, PAD detector). The amount of monosaccharides was corrected to time zero of hydrolysis and calculated as nmol of monosaccharide per nmol of protein. The ammo acid composition confirmed that rHPL conststs of 449 amino acid residues correspondmg to a molecular mass of 49,505 KDa. Carbohydrate analysis revealed the presence of 2.59 nmol mannose , 1.61 nmol N-acetyl glucosamme and 0.69 nmol fucose per nmol of rHPL. These results suggest the followmg N-linked glycosylation pattern : Asn’66-GlcNAc(Fuc)GlcNAc-Man(Man), m whtch the glycan chain 1sonly the core of the classtcal N-linked polysaccharide. This short-chain glycosylation pattern 1scommonly observed with Sfp insect cells (19). An electrospray mass spectrum of rHPL was recorded on an API III LC/MS/ MS system (Perkin-Elmer Sctex mstrument). The triple quadrupole mstrument has a mass-to-charge (m/z) range of 2,400 and 1s fitted with an articulated, pneumatrcally-assisted electrospray (also referred to as ion-spray) interface and an atmosphertc pressure tomzatton source. Sample mtroductton was done by a syringe infusion pump (Sage mstruments, Cambridge, MA) through a fused
Purification of Recombinant Pancreatic Lipases
195
rHPL - ESMS
+52
50,543 Da
x75
No
025
950
975
100u
1025
IUW
1075
11~1l1
II25
Mass to charge ratio (Da/z) Fig 3 ESMS spectrum of purified rHPL The mass spectrum drsplays a serves of multrply protonated molecular Ions. The molecular werght of rHPL was determined as 50,543 amu or Da These data are reproduced from (I) with permrssron capillary (75 pm 1.d.) with a liqutd flow-rate set at 0.5-l FL/mm The mstrument m/z scale was cabbrated wrth selected (covering m/z 50--2,400) ammomum adduct Ions of poly(propylene glycols) (PPG’s) under unit resolutton. The accuracy of mass measurements is generally better than 0.02 % using thts technique. The electrospray mass spectrum (ESMS) of the purified rHPL 1s shown in Fig. 3. It displays a series of ions corresponding to multiply protonated molecular tons (45+ to 58+). The determined molecular mass (50,543 kDa) is consistent wtth the theoretrcal value of the polypepttde (49,505 kDa) takmg mto account the presence of the proposed N-linked glycan cham (+ 1,038 kDa)
3.5. Kinetic Comparison
of rHPL and nHPL
Using tributyrm as substrate, the specific activity of both rHPL and nHPL was mvestrgated as a functton of pH in the presence of micellar concentratton of bile salts (2 mA4NaTDC) and a two-fold molar excess of coltpase. As shown m Fig. 4A, both enzymes display a similar behavrour with an opttmal specific activity of 12,000 U/mg reached m the pH range 7.0-7 5 One of the charactertsttc properties of nHPL is an absolute reqmrement for cohpase to be active on an emulstfied triglycerrde substrate in the presence of micellar concentrattons of bile salts. The bile salt coating of triglyceride globules prevents the pancreatic hpase adsorption and acttvtty at the lipid-water interface. However, the hpase-anchormg capacity of cohpase present m the
196
Bezzine
5
7
6
8
9
IO
11
e- ---- -_______ ----____ 7 2
4
et al
PH
0 n
I
Sodium
taurodeovpcholate
(m&I)
Ftg 4 Kinetic compartson of rHPL and nHPL (A) effect of pH on the specific acttvity of rHPL and nHPL usmg tributyrm as substrate (B) Inhibition by NaTDC and cohpase effect The hpase specific acttvtty is measured with the pH-stat techmque at 37°C The final assay volume consists of 15 mL contammg 0 5 mL tributyrm, 14 5 mL of 0 28 mMTris, 150 mMNaC1, 1 4 mMCaC1, and various concentrations of NaTDC The assay contams between 1 pg and 5 pg enzyme and a two-fold molar excess of cohpase The experiments correspondmg to panel A were performed usmg 2 mM NaTDC, and the experiments correspondmg to panel B were performed at pH 8 0 exocrme secretion of pancreas counteracts this effect through the formation of a specific 1.1 complex with lipase that factlttates its adsorptton at bile saltcovered liptd-water mterfaces (2U-22). As shown tn Fig. 4B rHPL and nHPL
display similar propertles with respect to their mhlbltlon by bile salts and their
Purification of Recombinant Pancreatic Lipases
197
reactivatton by cohpase. In the absence of cohpase, both rHPL and nHPL are mhtbtted by bile salt concentrations above the crmcal mtcellar concentration (approx 1 mM NaTDC) In the presence of coltpase, the mhtbttton by bile salt of both rHPL and nHPL is supressed 3.6. Expression and Purification of Additional Recombinant Pancreatic Lipases The expression and purification procedure described m the present chapter has been applied with successm the case of the coypu pancreatic lipase (23,24) and several chimeric mutants designed by domain exchange between HPL and the pancreatic ltpase-related protein 2 from guinea pig, GPLRP2 (25). GPLRP2 is characterized by the presence of a mini-lid domam of 5 amino acid residues m place of the full-length lid domain of 23 residues that controls accessto the active srte of HPL (26) Two mutants (HPL(-lid)) and GPLRP2(+ltd)) were constructed by exchanging the lid domains between HPL and GPLRP2, and a third mutant was obtained by substttutmg the C-termmal domain of GPLRP2 with the HPL C-terminal domain (N-GPLRP2/C-HPL chimera). Figure 5 shows the purification and molecular mass determmations performed with the three mutants, Their purification required only some slight modtticattons of the standard cattomc exchange chromatography The pH of the MES buffer was adjusted to 5.5, 6.5, and 6.5 for the puriticatton of GPLRP2(+ltd), HPL(lid) and N-GPLRP2 / C-HPL chimera, respectively The Mono S HR 5/5 column was mitially equthbrated m 10 mMMES buffer without NaCl. GPLRP2(+hd), HPL(-lid), and N-GPLRP2IC-HPL chimera were eluted at 130, 120, and 90 mA4 NaCl, respectively. The purified N-GPLRP2/C-HPL chimera proved suitable for crystallogenesis and its crystal struture was solved at 2.4 A resolution (27) 3.7. Expression
of HPL(-lid) in Trichoplusia
ni Cell
1 Using a 27°C Incubator, Tmhoplusza nz cell monolayers are grown up to 5 x 1O7 cells/l 7.5-cm* culture flask, m 25 mL EX-CELL 400TM medium 2. An moculum of the recombmant Baculovn-us encodmg HPL(-hd) is added to the cell culture at a multiplicity of infection of approx 10 pfu/cell 3 Six hours post-mfectton, the culture supernatant is removed by aspiration and replaced by 25 mL of fresh EX-CELL 400TM medium 4 Cell viability IS observed every day for 7 d using a dissectmg mrcroscope with a magnification of 20-40X Baculovnus mfectron of Trzchoplusza nz cells is clearly visible as a change from tibroblasttc to spherrcal appearance. 5 Sampling of the culture supernatant IS performed every day for 7 d m order to measure hpase production by lipolytic activity measurements, ELISA, SDSPAGE and rmmunoblottmg analysis For these later experiments, an ahquot of each sample is stored at -20°C 6 Lipase activity m insect cell culture supernatant is measured potentiometrically at pH 7.5 and 37°C usmg the pH-stat techmque. The optimal assay condmons of
Bezzine et al. , 100
198 0.6 t
t o.sA B
z
0.4-
a
03'
8 ! e p
1 B
LDMS
16%
[I
*
- HPL
(-lid)
5 24k.4
- 75
12118 1
48412: 7
5+
oz' O,I-
9 0
# 0
-10
10
t 20
30
Time
(min)
40
50
60
IOGCQ
, 300
- 50 pI .m : - 25
s 3
2oooa
Molecular
0.6 ,
2v h .Z
4+
3Owo
4oMw)
mass / charge
\
:
D
&Jou
(Da/z) 100
ESMS GPLRPZ (+lid) 498226
c( B
0.3-
8 g
w-
e g
O.l-
s
,
-I50
I
2 s 8 I c
-loo
I
0 -40
-50 I -7.0
I 0
I 20
I 40
Time
(min)
I 60
0
I 80
2
100
49500
49600
49700
49800
Molecular
49900
5woO
501Ofl 502M)
mass (Da) 100
ESMS N-GPLRPLIC-HPL - 75
P 8 2 e 51 2
0,3I
-200
02* -100
O-l0 -80
-60
, -40
I -20
Time
, 0
I 20
(min)
I 40
I 60
6 80
0
E 2 8
- 50
d
- 25
9 z 47200
I 47400
t 47600
I 47800
Molecular
I 48000
, 48200
f 48400
0 48600
mass (Da)
Fig 5 Punficatron of recombinant HPL(-lid), GPLRP2(+hd) and N-GPLRP2 / C-HPL chrmera expressed in baculovuus-mfected insect cells Pure proteins were obtained as descrtbed usmg a smgle punticatron step of cation exchange chromatography on a Mono S HR 5/5 column The elutron profiles, using a NaCl concentratron gradient, were recorded by measurmg absorbance at 280 nm (panels A,C,E) The punfied protems were analyzed by mass spectrometry The average molecular mass of HPL(-lid) (48,453 rt 19 kDa) was expenmentally determined using laser desorptron mass spectrometry (LDMS, panel B) which displays a series of muhrple protonated molecular Ions (+1 to +5) The GPLRP2(+hd) (panel D) and N-GPLRP2 / C-HPL chimera (panel F) molecular masses were determined usmg electro-spray mass spectrometry (ESMS) and reconstructed mass spectra These data are reproduced from (25) with pernussron
sv h .% a Y 9 E 3 2
199
Purification of Recombinant Pancreatic Lipases
0
1
2
3
4
5
6
7
8
Days post-infectkm
Fig. 6. Time-course expression of HPL(-lid) by Trichoplusiu ni cells. Upper panel, immunoblot showing the production and degradation of HPL(-lid) versus days post-infection. Lower panel, the concentration of expressed HPL(-lid) estimated from ELISA test and enzymatic activity measurements. The specific activity of HPL(-lid) is 57OU/mg. HPL(-lid) consist of a mechanically stirred emulsion of 0.5 mL trioctanoin in a thermostated reaction vessel containing 14.5 mL of 0.28 mMTris, 150 mMNaC1, 1.4 mA4 CaCl*, 0.5 rnMNaTDC. Colipase is added before the sample, at a twofold molar excess. The automatic titration of the fatty acid released on trioctanoin hydrolysis is carried out by addition of 0.1 N NaOH. One lipase unit (U) represents one pmole of octanoic acid released per min. The specific activity of HPL(-lid) is 570 U/mg under the above mentioned assay conditions. 7. HPL(-lid) production is also followed by a sandwich ELISA using rabbit antiHPL polyclonal antibody and a biotinylated mouse anti-HPL monoclonal antibody (mAb 146) as described in Chapter 22 by De Caro et al. A time-course experiment of HPL(-lid) expression in Trichoplusia ni cells is shown in Fig. 6. The activity can be directly measured from the culture superna-
200
Bezzme
et al
tant usmg trioctanom as substrate and the concentration of active enzyme (pgl mL) IS estimated based on the specific actwlty of HPL(-hd) The concentratton of HPL(-lid) whtch accumulated m the medium reaches a maxtmal level of 27 pg/mL at 6 d postmfectton, followed by a rapid decrease m the hpolyttc acttvtty, which IS completely suppressed at d 8 A stmtlar time-course profile IS observed using ELISA, except at d 8 where an immunological detectton of HPL(-lid) degradation products is stall nottced Figure 6 (upper panel) shows the analysts of HPL(-hd) secretton revealed by tmmunoblottmg The electrophorests was performed on a 12% SDS-polyacrylamide gel, followed by transfer onto mtrocellulose membrane for tmmunoblottmg usmg rabbit anti-HPL polyclonal antibodies A band, with a molecular mass close to 48 kDa, and correspondmg to HPL(-hd) IS clearly observed starting from d 2 post-mfection After d 3 post-mfectton, there IS a clear increase m the amount of low molecular mass degradation products of HPL(-lid) as revealed by antt-HPL polyclonal antibodies (see Note 4) The degradation of HPL(-lid) contmues with ttme whereas a sharp decrease m cell viabtltty IS observed (data not shown).
4. Notes 1 As mentioned m the case of rHPL productton, tt 1srecommended to harvest the culture supematants 3 d post-mfection m order to successfully carry out a one-step purtficatton procedure Even though the productton yield can be doubled at d 5 or 6 (see Fig. 6B), the elutton profile from the Mono S column 1s more complex when degradation products and mtracellular proteins are present mto the culture supematant Consequently, highly purtfied hpase 1s difficult to obtain usmg a single purn‘icatton step 2 The vtrus moculum also contains degradatton products of the recombinant hpase and intracellular proteins resultmg from cell lysts Accordingly, it 1s very tmportant to change the culture medium once insect cells have been Infected The culture medium 1s eastly exchanged m the case of a cell monolayer, since the cell suspension may be spun down at 500g wtth preservatton of high cell viabihty 3 Concentration and dtalysis The lyophtlyzatton IS a convement way to concentrate the culture medium since recombmant pancreatic hpases are stable under freeze-drying condttlons (100% recovery of hpolytic activity) However, the dtalysts that follows must be carried out wtth caution The osmottc pressure 1s very high and the dtalysts bag must be securely fastened 4 The time-course expresston of HPL(-hd) by Trlchoplusza nz Insect cells shown in Fig. 6 Illustrates the degradatton of the recombmant enzyme due to the release of proteases upon cell lysts Thts may produce serious dtfficulttes since mncttonal sites of pancreattc hpase, such as the hd domam, are particularly sensmve to proteolyttc cleavage whtch can drastically affect the kmettc properties of pancreatic hpases (25)
Acknowledgments We are grateful to our colleagues Kenneth Thlrstrup, Slv HJorth, Poul Rasmussen, Per Nielsen, Esper Boel, and Lars Thim from Novo Nordlsk A/S (Bagsvaxd, Denmark) for their collaboration tn developmg the baculovlrus
Purification of Recombinant Pancreatic Lipases
201
expression system for the production of recombinant pancreatic hpases. This research was carried out with financial support of the BRIDGE-T-llpase and BIOTECH G programmes of the European Commumtles under contracts no BIOT-CT90-0181 (SMA), no BIOT-CT91-0274(DTE), no. BI02-CT94-3013, and no. BI02-CT94-304 1. References
9.
10 I1 12 13
14 15
Thlrstrup, K , Carr&e, F., Hjorth, S , Rasmussen, P B , Woldlke, H , Nielsen, P F , and Them, L (1993) One-step purification and characterlzatlon of human pancreatic hpase expressed in Insect cells FEBS lett 327, 79-84 Lowe, M E., Rosemblum, J L , and Strauss, A W (1989) Clonmg and characterlzatlon of human pancreatic lipase cDNA J B~ol Chem 264, 20,042-20,048 Sambrook, J , Fntsch, E F. and Maniatls, T. (1989) Molecular clonzng, Vols. 1,2 and 3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York MAXBACTM, Baculovlrus Expresslon System* a manual of methods for baculovlrus vectors and insect cell culture procedures, version 1 5 5 , Invltrogen Corp ed , San Diego, pp l&48 Gruenwald, S and Hertz, J (1993) Baculovwus Expression Vector System Procedures and Methods Manual, Pharmmgen, San Dlego, pp 1-73 Malltschek, B and Schartl, M (1991) Rapld ldentlflcatton of recombmant baculovlruses using PCR BzoTechnzques 11(2), 177,178 Webb, A C , Bradley, M K , Phelan, S A , Wu, J Q., and Gehrke, L (1991) Use of the polymerase chain reactlon for screemng and evaluation of recombmant baculovlrus clones BzoTechnzques 11(4), 512-519 O’Rellly, D R , Miller, L. K., and Luckow, V A (1994) m Baculovzrus Expresszon Vectors A Laboratory Manual, Oxford Umverslty Press, Oxford, pp 132-l 34 Towbm, H , Staehelm, T , and Gordon, J (1979) Electrophoretlc transfer of protems from polyacrylamide gels to mtrocellulose sheets Procedure and some appllcatlons. Proc Nat1 Acad Scr USA 76,435&4354 De Caro, A , Flgarella, C , Amlc, J., Mlchel, R., and Guy, 0 (1977) Human pancreatlc hpase. a glycoprotem Bzochzm Bzophys Acta 490,4 114 19 Wmkler, F. K., d’ Arty, A , and Hunzlker, W. (1990) The structure of human pancreatic lipase Nature 343, 77 l-774 Plummer, T H and Sarda, L. (1973) Isolation and characterlzatlon of the glycopeptldes of porcme pancreatic hpases L, and L,.J Bzol Chem 248,7865-7869 Fournet, B , Leroy, Y , Montreull, J., De Caro, J., Rovery, M , Van Kulk, J A , and Vhegenthart, J.F G (1987) Primary structure of the glycans of porcine pancreatic lipase Eur J Blochem 170,369-371 Lee, P. C (1978) Comparative studies of canine cohpase and hpases from bovme, porcine, canine, human and rat pancreases. Comp Brochem Physzol 60B, 373-378 Sternby, B and Borgstrom , B (198 1) Comparative studies on the ablhty of pancreatic collpases to restore activity of lipases from different species Comp Bzochem Physzol 68B, 15-18.
Bezzine et al
202
16 Lessmger, J M , Tavridou, A , Arzoglou, P., and Ferard, G (1992) Interest of usmg a purtfied, stable and commutable preparation of human pancreattc hpase m indirect assay Anal Lett 25(8), 1453-1468 17. Them, L , Hansen, M. T , and Soerensen, A R. (1987) Secretton of human msulm by a transformed yeast cell. FEES Lett 212,307-3 12 18 Them, L , Thomsen, J , Christensen, M , and Joergensen, K H (1985) The ammo acid sequence of pancreatic spasmolyttc polypepttde Bzochlm Blophys Acta 827, 410-418 19 Aeed, P A. and Elhammer, A P. (1994) Glycosylatton of recombinant prorenm m insect cells * the insect cell lme Sf9 does not express the mannose 6-phosphate recogmtton signal. Blochemzstry 33, 8793-8797 20 Mayhe, M F , Charles, M , Gache, C , and Desnuelle, P (1971) Isolatton and partial tdenttfication of a pancreatic cohpase. Biochlm Bzophys Acta 229,286-289 21 Borgstrom, B and Erlanson, C (1971) Pancreatic Juice co-ltpase. physiological importance Blochim Blophys Acta 242,509-5 13 22 Van Ttlbeurgh H., Egloff M P , Martinez C , Rugam N , Verger R , and Cambtllau C (1993) Interfactal activation of the hpase-procoltpase complex by mixed mlcelles revealed by X-ray crystallography. Nature 362, 814-820 23 Thu-strup, K., Verger, R , and Carriere, F (1994) Evidence for a pancreatic hpase subfamily wtth new kmettc properties. Bzochemzstry 33, 2748-2756 24. Thnstrup, K., Cam&e, F , HJorth, S , Rasmussen, P B , Ntelsen, P F , Ladefoged, C , Thim, L., and Boel, E (1995) Cloning and expression in insect cells of two pancreatic hpases and a procoltpase from Myocastor coypus Eur J Blochem 227, 186-193 25 Carriere, F , Thnstrup, K , HJorth, S , Ferrato, F , Nielsen, P F , Withers-Martinez, C , Cambillau, C., Boel, E , Them, L , and Verger, R (1997) Pancreattc hpase structure-function relattonshtps by domain exchange Blochemlstry 36,239-248 26 HJorth, A , Cam&-e, F., Cudrey, C , Woldike, H , Boel, E , Lawson, D M , Ferrato, F , Cambtllau, C., Dodson, G G., Thim, L , and Verger, R (1993) A structural domain (the hd) found m pancreatic hpases 1s absent m the guinea pig (phospho)hpase Bzo-
chemistry 32,4702-4707. 27 Withers-Martinez, C., Cam&e, F., Bourgeois, D., Verger, R., and Cambtllau, C (1996) A pancreatic lipase with a phospholipase Al acttvtty crystal structure of a chtmenc pancreatic hpase-related protein 2 from guinea pig. Structure 4, 1363-1374.
Modulation of the Expression Level of Human Acidic Lipases by Various Signal Peptides Stepham Canaan, Liliane Dupuis, Mireille Rivi&e, and Catherine Wicker-Planquart
Robert Verger,
1. Introduction Mammalian acidic hpases belong to a family of lipases that share the ability to mamtain activity under acidic conditions. This family includes pre-duodenal lipases and lysosomal lipase and shows no sequence homology with other known lipase families (1,2). Human gastric lipase (glycerol ester hydrolase, EC 3.1.1.3, HGL) is secreted by chief cells of the fundic part of the stomach (3) where it inmates the digestion of triacylglycerols (4). Human lysosomal acid hpase (HLAL , EC 3.1.1.13) hydrolyzes cholesteryl esters and triglycerides that are delivered to the lysosomes by low density hpoprotem receptormedtated endocytosrs (5). In order to produce high yields of both acid llpases, several groups have used the baculovnus insect cell expression system The reported yields of proteins produced m insect cells, however, vary widely from 1 to 1220 mg/L (68). This expression system takes advantage of the fact that the polyhedrm gene, which is expressed at a high level during the late stages of infection, is not essential for infection or replication of the virus and is controlled by an extremely efficient promoter (polyhedrm can account for up to 50% of the cell protein mass in the terminal stages of infection) (9). Other advantages of the baculovirus system are its ability to secrete heterologous protein and to carry out most of the post-translational processing events that occur m mammalian cells. However, it appears unlikely that the mannose 6-phosphate mediatedtargeting pathway of lysosomal enzymes is operative m insect cells (10).
From
Methods m Molecular Bology, Vol 109 Llpase and Phosphollpase Protocols Edlted by M H Doohttle and K Reue 0 Humana Press Inc , Totowa, NJ
203
204
Canaan et al
As described m this chapter, we have used signal peptldes derived from heterologous secretory protems to optimize the expresslon and secretion levels of the acid hpases. The optimal signal peptldase cleavage site at the signal peptlde/llpase junction was evaluated according to the method of von Heijne (II). Recombinant baculoviruses are generated by replacmg the polyhedrm gene with a foreign gene through homologous recombmatlon. Polymerase Chain Reactlon (PCR) analysis of recombinant baculovlrus DNA, purified from viral stock, was performed m order to check the presence of the recomblnant vn-us. 2. Materials 1 Human stomach and liver mRNAs (Clontech, CA), avlan myeloblastosls VIII.IS reverse transcnptase (Apphgtne, lllklrch, France), Taq polymerase (Perkm-Elmer), Geneclean (Blo 101, Ozyme, France), pMOS Blue T plasmld (Amersham), PCR apparatus microprocessor controlled mcubatlon system Crocodile II (ApphgCne) 2 Transfer vector PVL 1392 (Invltrogen) 3 Primers for HLAL or HGL coding regions (see Subheading 3.). 4 BTI-TN-SBl-4 insect cells (Invltrogen), Ex-cellTM 401 (JRH Sciences, Lenexa, USA), BaculoGold’” vu-us (Pharmmgen), Grace’s medium (Pharmmgen) 5 Protemase K (Boehrmger Mannhelm) 6 Trlbutyroylglycerol (Fluka), Sodium taurodeoxycholate (NaTDC) and 4-methylumbelhferyl heptanoate (4-MUH, Sigma), pH stat (TTT 80 Radiometer), Fluoroskan II apparatus (Labsystems)
3. Methods 3.1. Synthesis
of HGL and HLAL cDNAs
1 First strand cDNA 1s synthesized from human stomach mRNA (HGL) or hver mRNA (HLAL) The cDNA synthesis reactlon contains 1 pg RNA from appro-
priate source,20 U of reversetranscnptase,0 4 mM ohgo d(T) 12-18,O 5 mA4of each dNTP, 50 mM Tns/HCl, pH 8 3, 6 mM MgCl, and 40 mM KCl. Incubate this reaction at 37°C for 60 mm 2 PCR amplify the HGL and HLAL codmg regions (1 2 kb pairs) usmg gene-speclfic primers containing restriction enzyme recogmtion sequences to facilitate cloning The primers for HGL are j’GAGGAAACTGCAGGTCC3’ (&I site) and 5’AATTCTTTGGATCCAGAACTACT3’ (BamHI site), primers for HLAL are S’AGGACAGATCTCCAGAATGAAAATGCG3’ (BglII site) and 5’CTGATC CATGGTACACAGCTCAAG3’ (NcoI site) Perform PCR using a program of 30 s denaturatlon (94”C), 1 mm annealing (52’C) and 2 mm extension (72’C) for a total of 30 cycles 3 Digest the PCR fragment correspondmg to the coding region of HGL with PstI and BamHI Isolate the digested PCR products by electrophoresls and excise from an agarose gel, followed by purlficatlon on Geneclean accordmg to manufacturer’s instructions
Acidic Llpases with Heterologous Signal Peptldes
205
4 Legate gel-purtfied PCR product corresponding to HGL coding regton into pUCl8 plasmld cleaved wtth PstI and BumHI Ligate gel-purified HLAL fragment mto pMOS Blue T plasmtd Transform hgatton mixtures into bactertal cells (I e , Esclzemha toll stram JM 83) Select and screen recombinant clones by restrlctlon digest analysis. To confirm that errors were not made during PCR amphficatlon, the HGL and HLAL inserts may be sequenced by the Sanger
dtdeoxy chain termmatton method (12).
3.2. Construction of HGL and HLAL Variants with He terologous Signal Pep tides We have mvesttgated the effect of the substttution of the HGL signal pepttde (SP) by the signal pepttdes origmatmg from honeybee mehttm and human pancreatic lipase (HPL) on the production and secretion of HGL In the case of HLAL, which remains mtracellularly locahzed when expressed wtth tts own signal peptide, we hoped to drive its secretion outside the Insect cell by replacing HLAL signal pepttde by the HPL signal pepttde The strategy used to produce HGL and HLAL molecules with heterologous peptides IS described below This process first requires generation of a signal pepttde-ltpase gene hybrid DNA fragment by PCR This IS accomplished using ohgonucleotide primers contammg the signal pepttde sequence and a 3’ primer correspondmg to the 3’ end of the HGL or HLAL fragments produced m Subheading 3.1. Next, &id DNA fragments are digested wtth enzymes correspondmg to unique sites present m the primer sequences, and ligated mto the correspondmg sites m approprtate plasmtd vectors. This strategy may also be adapted for additional signal peptide-hpase combmations than those described here
3.2.1. HGL-Signal Peptide Fusions The meltttm signal pepttde was fused to mature HGL (constructton Mel-SP/ HGL) by PCR. The two oligonucleotides used were 5’AATTCTTTG GATCCAGAACTACT3’ (correspondmg to the 3’ sequence of HGL and contammg a BamHI restriction sate) and j’TTGTACTGCAGATGAAATTCTTA GTCAACGTTGCCCTTGTTTTTATGGTCGTGTACATTTCTTAC ATCTATGCGTTGTTTGGAAAATTACATCC3’ (correspondmg to the mehttm SP and containing a Pstlrestriction site). The other constructton (HPLSP/HGL) codmg for the human pancreatic hpase signal peptide, followed by the 3 first residues of HPL (Lys-Glu-Val), was fused to the HGL gene startmg from Lys 4 through Lys 379 (see Table 1). For this constructton, we used ohgonucleotides “GAACTCTGCAGATGCTGCCACTTTGG3’ (wtth Pst I restriction site) and 5’GTTCGAGCTTAACTTCTTTTCCTGC3’ (wtth AluI restriction site) for the synthesis of the HPL moiety, and ohgonucleotides 5’AATTCTTTGGATCCAGAACTACT3’ (with BamHI restrictton site) and
Canaan
et al
Table 1 Nucleotide Sequences and Deduced Aminoacid Sequences of the HGL and HLAL Constructions with Various Signal Peptides from HGL, HLAL, Melittin, and HPL HGL-SP/HGL
:
HGL-SP
HGL -1 +I.
-19
MWLLLTMASLISVLGTTHGLFGKLH ATGTGGCTGCTTTTAACAATGGCAAGTTTGATATCTGTACTGGGGACTACACATGGTTTGTTTGG~TTACAT
Mel-SP/HGL
:
IMelittm-SP
HGL
-21 -1 +1 MKFLVNVALVF M V V Y ISYIYAL F ATGAAATTCTTAGTCAACGTTGCCCTTGTTTTTATGGTCGTGTACATTTCTTACATCTATGCGTTGTTTGG~TTACAT
HPL-SP/HPL/HGL
:
HPL-SP
K
HPL -
-16 -1 +1 MLPLWT LSLLLGAVAGKEVKLH ATGCTGCCACTTTGGACTCTTTCACTGCTGCTGGGAGCAGTAGCAGG~G~GTT~GTTACAT
HLAL-SP/HLAL
G
HGL -
+3
14
HLAL
-21 -1 +1 MKMRFLGLVVCLVLWTLHSEGSGG ATGAAAATGCGGTTCTTGGGGTTGGTGGTCTGTTTGGTTCTCTGGACCCTGCATTCTGAGGGGTCTGGAGG~CTGACA
-16
H
:
HLAL-SP
HPL-SP/HPWHLAL
L
:
HPL-SP
HPL -1 +1 t3
K
L
T
HLAL -
+4
MLPLWTLSLLLGAVAGKEVKLT ATGCTGCCACTTTGGACTCTTTCACTGCTGCTGGGAGCAGTAGCAGG~G~GTT~CTGACA
OSPstands for slgnal peptlde. We have numbered the residues that are located at the hmge between either signal peptlde and mature protein or between two mature proteins
5’TTGGACAGCTGCATCCTGGAAGCCC3’ (with PvuII restrictton site) for the synthesis of the HGL moiety. In all cases, the htghest probabilities for a cleavage site were calculated according to von Heijne (11). The accuracy of this method is estimated to be approx 75-80 % for eukaryotrc protems. The final weight- matrixes (W) were calculated for possible cleavage sites in each construction (Table 2) The highest W value corresponds to the most probable cleavage site. We found that the cleavage probability was more likely when the three first ammo acids of human pancreatic lipase (KEV) were used instead of those of HGL (LFG).
207
Acidic Lipases with Heterologous Signal Peptides Table 2 Final Weight-Matrix for the Prediction
Values of the Most Probable
Construction
Potentialcleavagesiteposition
HGL-SP/HGL Mel-SP/HGL HPL-SPIHPLIHGL HPL-SP/HGL HPL-SP/HPL/HGL HPL-SP/HPL/HLAL HPL-SPIHLAL HLAL-SPIHLAL HLAL-SP/HLAL
between HGL-SP and HGL between Mel-SP and HGL between HPL-SP and HPL between HPL-SP and HGL between HPL and HGL between HPL-SP and HPL between HPL-SP and HLAL accordmg to Anderson (13) according to Amens (14)
Cleavage
Site
W H Y A A E A A E L
G A G G V G G G T
I I I I I I I / I
L L K L K K S S A
F F E F L E G G V
+3 6 +4 5 +10 I
+9 I -2 9 +10 I
+96 +6 1 -4 8
The final weight-matrix W was calculated accordmg to von Hqne’s rule The highest W value 1s taken as the predIctIon for the location of the slgnal peptlde cleavage
The HPL moiety correspondmg to HPL-SP followed by the three fn-st ammo acids of HPL was purified and digested with PsA and AluI and ligated with the PvuII and BarnHI digested HGL fragment, followed by ligatron with the &I-BarnHI digested pUC 18 vector. Finally, the 1 2-kb pair synthetic hybrtd genes coding for HPL-SP/HGL and Mel-SP/HGL were cloned by ligation mto the PstI and BamHI sites of transfer vector PVL 1392. 3 2 2 HLAL-Signal
Peptlcie
Fusions
The length of the HLAL natural putative signal peptide has been reported to be either 21 ammo acids (13) or 27 ammo acids (14) When abgnmg HLAL sequence with that of HGL, the putative signal peptide cleavage point occurs between ammo actds 2 1 and 22 (13). On the other hand, the assignment of the first ammo acid of mature HLAL protein to the 28th residue was supported by purification and N-termmal sequence analysis of HLAL m human liver (14) However, a proteolytic degradation during purification can account for this latter observatron. We decided to align both sequences and to begin the sequence of mature HLAL at residue number 22. Moreover, the site of cleavage between ammo acids 21 and 22 1s more probable according to the von Heijne’s predictive rule (21) than a cleavage between amino acids 27 and 28 (see Table 2)
The HPL-SP/HLAL constructton(seeTable 1) encoding the HPL signal peptide followed by the first three residues of HPL fused to HLAL from Lys 4 through Gln 37 was realized using ohgonucleotides “GAACTAGATCTATGCTGC CACTTTGGACTCTTTCACTGCTGCTGGGAGCAGTAGCAGGAAAAG
208
Canaan et al.
AAGTTAAACTGACAGCTGTGGAT3’ (with Bgl IIrestrlction site) and 5’GAG GAAATATCAGTGAAAGCGGCCGCTGAGC3’ (with Not Z restrlctlon site) The cleavage probability was again more likely between the HPL-SP and the three first ammo acids of HPL (KEV) than those of HLAL (SGG) (see Note 1). The HPL-SP/HLAL construction was directly Inserted into the BgZII and Not1 restriction sites of the transfer vector PVL 1392. All constructions were subjected to sequence analysis.
3.3. Cell Culture and Transfection To produce viral stocks expressing the desired recombinant hpase, insect cells are cotransfected with the recombinant transfer vectors and BaculoGoldTM vn-us. BaculoGoldTM IS a modified VII-US, deleted of an essential part of Its genome m the neighborhood of the polyhedrm locus. Co-transfectlon of the virus and the recombinant transfer vector reslethally deleted BaculoGoldTM cues the lethal deletion of this virus DNA and results m a recombination efficiency which 1s virtually 100%. Seed a 35 mm tissue culture plate with 0.6 x lo6 log phase BTI-TN-SB 1-4 cells m Ex-cellTM 40 1 medium Allow the cells to attach for 30 mm Mix 0.2 pg of viral DNA (BaculoGold TM DNA) with 2 pg recombinant baculovnus transfer vector DNA Incubate for 5 mm at room temperature before addmg 0 35 mL of transfectlon buffer (125 WHEPES, pH 7 1, 125 mA4 CaCl,, 140 mMNaC1) Vortex the mixture vigorously Durmg this incubation period, remove the medmm from the plate and replace with 0 35 mL of fresh Grace’s medmm with 10% fetal calf serum Add 0 35 mL transfectlon mixture dropwlse to the plate Incubate the plate at 27°C for 4 h Followmg the mcubatlon period, asplrate the medium from the cotransfectlon plate and replace with 3 mL of fresh Ex-cellTM 40 1 medium Continue to incubate the cells at 27°C until all the cells have lysed (this usually takes 7 d) After complete cell lysls, harvest the medmm, which constitutes the P, (passage 1) vxus stock, and store at 4°C The P, vu-us stock is next used to Infect 5 x lo6 cells m a 75 cm2 flask, and the culture 1sincubated at 27°C for 5-7 d The supernatant (approx 20 mL) constltutes the P2 moculum The P, recombinant vuus stock IS amplified once more by mfectmg lo&200 mL of BTI-TN-5B 1-4 cells seeded at a density of 1-2 x lo6 cells/ml with 5 mL of P, stock A high titer vu-us stock (P3) 1s then harvested The P3 virus stock 1s used m acid llpase productlon experiments. Usually, a 10s300-mL spmner flask seeded at a density of l-2 x lo6 cells/ml 1s infected with P, vu-us stock at a multlphclty of infection of three. The supernatants contaming the recombmant lipases are obtained 3 d later after pelleting the infected cells by centrlfugatlon
Acidic Lipases with Heterologous
Signal Peptides
209
1383-i107887%---602-
Fig. 1. PCR analysis of recombinant viruses. Standards (base pair numbers, bp) are indicated in the left margin. Lane 1: molecular mass markers. PCR products from a mixture of wild-type baculovirus DNA and recombinant viral DNA (lane 2), pure AcMNPV viral DNA (838 bp, lanes 3 and 4) , or pure recombinant virus (1400 bp, lane 5).
3.4. Purification
of Recombinant
Virus
1, Pellet P, virus (250 yL) by centrifugation at 3000g for 3 min. 2. Add 250 pL 20 % polyethylene glycol in 1 MNaCl to the supernatant and incubate at room temperature for 30 min. 3. Centrifuge at 14000 rpm for 10 min at room temperature, and remove all media from the pellet. 4. To the pellet, add 33 pL of sterile water and 3.3 pL of Proteinase K (5-10 mg/mL). Incubate the final mixture at 50°C for 1 h. 5. Extract with an equal volume of phenol-chloroform (l:l), and precipitate the DNA by addition of l/l 0 vol 3 M sodium acetate, 1.6 uL glycogen, and 2 vol of 100% ethanol, Incubate at -20°C for at least 20 min, and pellet by centrifugation at 14,000 rpm for 15 min at 4°C. Dry the DNA pellet in a speed-vacuum evaporator and resuspend in 3.3 pL of sterile water. 6. The resulting viral DNA preparation may be analyzed for the presence of the desired insert by PCR followed by agarose gel electrophoresis. The following primers, which are complementary to the polyhedrin locus and are compatible with the PVL 1392 transfer vector, are used: forward primer 5’TTT ACTGTTTTCGTAACAGTTTTG3’ and reverse primer 5’CAACAACGC ACAGAATCTAG3’. The PCR mixture consists of 10 yL 10X Tuq polymerase buffer, 2 pL 10 mA4 dNTP mixture, 64.2 uL sterile water and 0.6 pL Tuq polymerase. The mixture (7.68 pL) is transferred to small Eppendorf tubes and 0.66 pL of each primer (100 ng/uL) and 1 yL of purified DNA is added. The PCR program consists of: 1 cycle of 30 s at 94°C 30 cycles of 30 s denaturation (94”Q 1 min annealing (55’C), and 2 min extension (72’C). Following the last cycle, a final 72°C extension step is performed for 7 min.
210
Canaan et a/, Samples are analysed by agarose gel electrophorests (see Fig. 1) When amphfied without insert, a fragment of 838 bp 1s obtained from AcMNPV wild-type DNA followmg agarose gel electrophorests (Fig. 1, lanes 3 and 4) The size of the PCR product 1s expected to be about 2000 bp when the hpase gene 1s inserted m the polyhedrm locus (Fig. 1, lane 5)
3.5. Lipase Activity
Measurements
1 Collect supernatants of HGL or HLAL infected cells 3 d after mfectlon 2 Measure total llpase activity potentiometrically using a short-chain trlacylglycerlde substrate (trtbutyroylglycerol) at 37°C using a pH-stat Activity of recombinant and natural HGL should be measured at pH 5 7 or 6 0, respectively, and that of HLAL should be measured at pH 5 5. The standard assay conditions consist of a mechanically stirred emulsion of 0 5 mL trtbutyrm, 14 5 mL 0 9% NaCl (w/v), 0 01% BSA (w/v), and 2 mMNaTDC (for more detail, see ref. 2.5 and chapters m this volume) One unit of HGL activity corresponds to the release of 1 pmole of butyrlc acid per minute (see Notes 2 and 3) 3 Alternatively, the weak hpase acttvtty present m the supernatant and pellet of infected Insect cell cultures can be evaluated with greater sensmvtty using the fluorogemc substrate 4-methylumbelhferyl heptanoate (CMUH) For this assay, BTI-TN-5B l-4 msect cells are grown m a 6 well microtiter plate (1 OScells/well) as a monolayer at 27°C and infected with recombinant baculovnus at a multtphctty of mfectton of three The cells are washed with the culture medium (3 mL) 4 h after mfectton 60 h after mfection, the cells are aspirated with a pipette and separated from the medium by centrifugation (5OOg, 10 mm) The cell pellet is further washed twice m 50 mA4 Trts-HCl, pH 7 and then treated m 50 n&’ Trts HCl, pH 7 0 contammg 10 mM l3-mercaptoethanol, 0 25% Trlton X 100, and 1 mA4EDTA by ultrasonic irradlatton at 4°C using a macro tip (20 s; 3 fold, 4’C) The somcates are centrifuged (8OOg, 15 mm), and the supernatant (20 to 100 pL) used for the hydrolytic acttvtty determmation Enzyme assay (200 PL final volume) 1s performed m 0 2 M succmate pH 4 5 by using 2 mM of 4-MUH dissolved m ethanol and the fluorescence mtensny is quantified on a Fluoroskan II apparatus (17) 25 nun after substrate addltton (see Note 4) For representative activny measurements using this method see Table 3
4. Notes 1 Substttutmg the signal peptlde of two acid hpases by HPL-SP resulted m an increased efficiency m the secretion The N-terminal protein sequence analysis (KLHPGS ) of recombinant HGL prepared from insect cells infected with HPLSP/HGL indicated that the cleavage site did not occur at the expected posmon (HG/LFGKLH), but three ammo acids downstream (16) Cleavage at this latter position was, however, unprobable, when predicted accordmg to von Heime’s rule (Table 2) This could reflect either the occurrence of a N-terminal proteolytlc digestion or an mcorrect cleavage site by the signal peptldase from insect cells However, the N-terminal protein sequence of recombmant HGL prepared from insect cells infected with HGL-SP/HGL 1s correct (LFGKLHPGS )
Acidic Lipases with Heterologous Slgnal Peptides Table 3 Lipase Activity in the Supernatant with HLAL-SP/HLAL, HPL-SP/HLAL, Viruses 1 Product released from 4-MUH Supernatants HLAL-SP/HLAL HPL-SP/HLAL Pellets HLAL-SP/HLAL HPL-SP/HLAL HGL-SP/HGL HPL-SP/HGL
211
or the Pellet of insect Cells Infected HGL-SP/HGL, and HPL-SP/HGL Time (mm) 10
25
(nmoles) 2.2 29 8
45 45 3
14 1 95.7
0.8 0.6 2.4 2.9
09 1.2 70 53
83 4.7 186 20 8
BTI-TN-SBl-4 insect cells were grown m a 6-well mrcrotnerplate( 105cells/well) asa monolayer at 27°C m Excel1 40.5 medmm They were Infected with a recombmant baculovlrus at a moi of 5 The cells were washed with the same culture medium (3 mL) at 4 h after mfectlon Culture medium and cell pellet were collected 60 h followmg mfectlon and assayed for hpase actlvlty with 4-MUH as substrate at various times after the addition of the substrate (1, 10, and 25 mm) The amounts of product released from 4-MUH m the supernatant of cells infected with HGL-SP/ HGL and HPL-SPIHGL were not Indicated, as they reached a plateau after 1 mm of reaction with the substrate
2 Supernatants of HGL-SP/HGL Infected cells harvested three days after mfectron exhrbrted a total hpase actrvrty of 18 U/lo6 cells when measured using a trtbutyrm substrate. Supernatantsfrom HPL-SPIHGL infected cells exhibited a twofold higher activity (36 U/IO6 cells) This increase in hpase activity was due to increased enzyme secretion (16) Surprrsmgly, expresston In the baculovrrus system of Mel-SP/HGL drd not result m any detectable HGL actrvrty in the supernatant. This absence of acttvrty in the supernatant of infected cells correlated wtth the lack of any tmmunoreacttve material m the cell supernatant (16). However, the protein accumulated wtthm the Insect cells (16). Thus could indrcate an mcorrect signal pepttde cleavage, resulting m an unproper targettmg of the protem along the secretory pathway 3 No standardized procedure has been estabhshedyet for the assay of HLAL on triglyceride and cholesterol esters We attempted to measureHLAL acttvlty by using the HGL test condmons on trrbutyroylglycerol. However, when HLAL was expressedm the insect cell system with Its own homologous srgnal pepttde, no actrvrty could be detected in the supernatant of the cell culture, while a weak activity (0 9 U/108cells) was detectable in the pellet using trrbutyroylglycerol as substrate When HLAL-SP was substrtutedby HPL-SP we were able to detect m the supematanta hpaseactrvtty of 4 U/10* cells on trtbutyrm as substrate.
212
Canaan et al.
4 Using the 4-MUH fluorogemc substrate, we have been able to detect a weak actrvtty m the supernatant of the insect cells infected by the HLAL-SP/HLAL recombtnant virus (14.1 nmoles of released MU/lOS cells), which differed stgmficantly from the value measured m the supernatant of non infected cells The fusion of HLAL variant with the HPL-SP resulted m a sevenfold mcrease of the 4-MUH hydrolytic actrvlty in the cell supernatant (95.7 nmoles of released MU/lo5 cells) A weak acttvny was also detected in both pellets of HLAL-SP/HLAL (8 3 nmoles of released MU/lo5 cells) and HPL-SPHLAL (4 7 nmoles of released MU/lo5 cells) infected cells, which probably represents the HLAL about to be secreted
Acknowledgments Fmanclal support was obtained from the CEE (BIOTECH program, BI02CT94-3013 and BIO 2-CT94-3041) and from the Instltut de Recherche Jouvemal (Fresnes, France)
References 1 Petersen, S B. and Drablos, F (1994) A sequence analysis of hpases, esterases and related proteins m, Lzpases. Their bzochemzstry, structure and appkcatzon, (Woolley P and Petersen S , eds ), Cambridge Umverstty Press, UK, pp 23-48. 2. Aoubala, M , Carrtbre, F , Ransac, S , Verger, R , and de Caro, A. (1995) Nouveaux regards sur les bpases digestives Regards sur la Blochlmle 2, 13-22 3 Moreau, H , Laugler, R., Gargourt, Y , Ferrato, F , and Verger, R (I 988) Human preduodenal hpase ISentirely of gastric mndtc origin Gastroenterology 95,122 1-1226 4 Cam&e, F , Barrowman, J A., Verger, R., and Laugter, R (1993) Secretion and contrrbution to ltpolysts of gastric and pancreatic ltpases durmg a test meal m humans Gastroenterology 105, 876-888 5 Goldstein, J L., Dana, S. E., Faust, J. R , Beaudet, A L , and Brown, M S (1975) Role of lysosomal acrd hpase in the metabolrsm of plasma low density llpoprotems J Blol Chem 250,8487-8795 6 Marorella, B., Inlow, D., Shauger, A , and Harano, D (1988) Large scale Insect cell culture for recombinant protein productron Bzotechnology 6, 1406-14 10 7 Caron, A W , Archambault, L and Massie, B (1990) Hugh level recombmant protem productton m btoreactors using the baculovnus-Insect cell expression system Bzotechnol Bloeng 36, 1133-I 140. 8 Sheriff, S , Du, H , and Grabowski, G A. (1995) Characterization of lysosomal acid llpase by site-directed mutagenesis and heterologous expression J Bzol Chem 270,27,766-27,772 9 Luckow, V A and Summers, M D (1988) Trends in the development of baculovnus expression vectors Biotechnology 6,47-55 10 Aeed, P A and Elhammer, A P. (1994) Glycosylatton of recombinant prorenm m insect cells. the insect cell line Sfp does not express the mannose 6-phosphate recognition signal. Bzochemzstry 33, 8793-8797 11 von HelJne, G (1986) A new method for predtctmg signal sequence cleavage sites Nucl AC Res 14,4683-4690
Acidic Llpases with Heterologous Signal Peptldes
213
12 Sanger, F., Ntcklen, S , and Coulson, A R. (1977) DNA sequencmg wtth chamterminating mhlbttors Proc Nat1 Acad Scz USA 74, 5463-5467 13 Anderson, R. A and Sando, G N. (1991) Clonmg and expresston of cDNA encoding human lysosomal actd hpase/cholesteryl ester hydrolase Stmtlttartes to gastrtc and hngual hpases J Bzol Chem 266, 22,479-22,484 14 Amets, D., Merkel, M , Eckerskorn, C , and Greten, H (1994) Purtficatton, characterlzatton and molecular clonmg of human hepattc lysosomal actd ltpase Eur J Blochem 219,905-914 15 Gargourt, Y , Pteronl, G , Rtvtere, C , Saumbre, J -F , Lowe, P A , Sarda, L , and Verger, R ( 1986) Kinetic assay of human gastrtc hpase on short- and long-chain trtacylglycerol emulsrons Gastroenterology 91, 9 19-925 16 Wicker-Planquart, C , Canaan, S , Rtvtere, M., Dupms, L , and Verger, R (1996) Expression m insect cells and purtficatton of a catalytrcally acttve recombmant human gastrtc hpase Protean Eng 9, 1225-1232 17. Negre, A. E , Salvayre, R S , Dagan, A., and Gatt, S (I 985) New fluorometrtc assay of lysosomal hpase and its apphcatton to the dtagnosts of Wolman and cholesteryl ester storage dtseases Clznzca Chzmzca Acta 149, 8 1-88
21 lmmunodetection of Lipoprotein Production, Immunoprecipitation, Blotting Techniques
Lipase: Antibody and Western
Mark H. Doolittle and Osnat Ben-Zeev 1. Introduction Lipoprotem hpase (LPL) is an N-linked glycoprotem of approximately 57 kDa that is synthesized by a number of tissues, including white and brown adipose tissue, heart, skeletal muscle, neonatal liver and brain (1,2). In these tissues, LPL is synthesized by parenchymal cells and secreted to the surface of endothehal cells where it is bound by heparan sulfate proteoglycans. EndotheIral-bound LPL hydrolyzes triglycerides from the core lipids of chylomicrons and very low density lipoproteins, liberating free fatty acids that can be utilized by the subjacent tissue for storage or oxidation. Changes m tissue LPL activity m response to physiological stimuli (e.g., feeding and fasting) and to hormonal effecters (e.g , msulm and catecholamines) have been correlated to changes in mRNA levels (3,4, protein syntheSIS(5), posttranslatlonal processmg and secretion (6), and enzyme turnover (2). Studies like these require direct exammation of the LPL protein by specific antibodies, using techniques including ELISA (7,8), immunocytochemrstry (% II), and immunoprecipitation (6,12,13). This latter technique is typically used m conjunction with SDS polyacrylamide gel electrophoresis (PAGE); the specific LPL band is then visualized by autoradiography or Western blotting techniques. Among the techniques used for LPL detection, immunoprecipitation IS the only method that permits isolation and concentration of the protein prior to visualization. This IS an obligatory step when the abundance of the protem is too low to provide a strong signal agamst a low background. In addition, immunoprecipitation is relatively quantitative and can be used to isolate proteins from small sample sizes. From
Methods Edited
by
m Molecular
Biology,
M H Doohttle
and
Vol 109 Lfpase and Phospholrpase
K Reue
215
0 Humana
Press
Inc , Totowa,
Protocols NJ
216
Doolittle and Ben-Zeev
In this chapter, we describe our procedure for LPL lmmunopreclpitatlon and Western blot analysis. The chapter begins with methods for the productlon of LPL antibody, isolation of immune IgG, and production of affinitypurified antibody. It continues with methods for the productlon of IgG Fab fragments and an IgG lmmunomatrix. The chapter concludes with methods for LPL lmmunopreclpltatlon and its detection followmg SDS PAGE and Western blotting techniques. A flow chart summarlzmg these protocols 1s presented in Fig. 1.
2. Materials 2.1. Preparation
of LPL Antigen and Chicken Immunization
1 A protem concentration
device, such as a high-pressure
ultrafiltration
apparatus
(Amlcon,
Beverly, MA) or centrifugal concentrators through selective membranes (e g , Centrlprep 30TM tubes from Amicon, Beverly, MA) 2. Purified LPL, 1 mg, a convenient source 1sbovine milk LPL, commercially avallable from Sigma (St Louis, MO), store at 4°C
3
10% SDS m water; store at room temperature
4 PBS (phosphate-buffered NaCl; store at 4°C
saline). 10 mM sodium phosphate, pH 7 2, 0 15 A4
5 Freund’s complete and incomplete adjuvant (Sigma); store at 4°C 6 Glass syringes (l-2 mL capacity) 7 Syringe needles, 18-20 gage
2.2. Screening
LPL Antibody
1 ELISA microtiter plates 2 Recommended* ELISA plate reader, such as the Model 450 Microplate Reader (Blo-Rad, Hercules, CA) 3 0.1 M KHC03, pH 9.5; store at 4°C 4 ELISA blockmg buffer 10 mMpotasslum phosphate, pH 7 4,0 15 MNaCl, 10 mg/mL BSA, store at 4°C. 5. ELISA wash buffer. 10 mM potassium phosphate, pH 7 4, 0.15 M NaCl, 0 01% Trlton X-100, 1 mg/mL BSA, store at 4°C 6 ELISA Sample Buffer 10 mM potassium phosphate, pH 7 4, 1 M NaCl, 0 01% Trlton X-100, 1 mg/mL BSA, store at 4°C. 7 Blotmylated anti-chicken IgG (Pierce, Rockford, IL), store lyophlhzed powder at 4°C After restoration m water, add an equal volume of glycerol and store m aliquots at -20°C 8. 0 1 M sodmm citrate, pH 4 5, store at 4°C 9 Horseradish peroxidase-conjugated streptavldm (HRP-streptavldm, Glbco-BRL, Galthersburg, MD), store at 4°C (do not freeze) 10 O-phenylenediamme dlhydrochlorlde (OPD; Glbco BRL, Galthersburg, MD), store m powder form at -20°C Prepare a 10 mg/mL stock m 0.1 M sodium cltrate, pH 4.5, on the day of use, store on ice
277
LPL hrwnodetection bovme LPL 311 t ,mmumze laymg hen\ 311-313 + isolate IgG from egg Volks 314
Isolate LPL specific antlbody 3 I5
cells or ttssues
+ produce Fab fragments 316\
detergent lysdte ; 323
,m;ftr,,
ant,-?&
IgG
LPL mvnunoprec~p~tat~on 324 c SDS PAGE 331 c Western blot aulya 332 -333
Fig 1. Flow chart descrrbmg the nnmunodetectron of LPL as presented in thus chapter. Numbers under each entry mdtcate the sectton contammg the pertment techmques 11 3%H,O,. 12 4 N H,SO, and 0 8 N H#O,;
store at room temperature
2.3. Chicken IgG Purification 1 EGGstractTM yolk purtfication system available from Promega, Madtson, WI (cat no G26 10) or, m Its absence 2 Dextran sulfate, M W 500,000 (Pharmacta, Uppsala, Sweden) 3 1 M CaC12, store at room temperature 4 Ammonmm sulfate m powder form and as a saturated solutron, store at room temperature.
Doohttle and Ben-Zeev
218
5. DEAE Affi-Gel Blue resin (BtoRad, Hercules, CA); store at 4°C 6 DE buffer. 1 M urea m 15 mMTrts-HCl, pH 8.0; store at 4°C 7. DE/NaCl buffer. DE buffer containing 0 15 MNaCl, store at 4°C
2.4. Affinity
Purification
of LPL Antibody
Purified LPL, 4-5 mg (see Subheading 2.1.). 2 Cyanogen bromide (CNBr)-activated Sepharose 4B (Pharmacta, Uppsala, Sweden), store at 4°C 3 0. I M NaHCO,, 0 1% SDS; store at room temperature 4 1 M ethanolamme-HCI, pH 8 0 or 0 1 MTris-HCl, pH 8 0, store at 4°C 0 1 M sodturn acetate, pH 4 0, 0.5 MN&l, store at 4°C 5. 6 0 1 M Tris-HCl, pH 8 0, 0 5 M NaCl, store at 4°C 10 mM Trts-HCI, pH 7.4, store at 4°C 8 10 mMTrts-HCl, pH 7.4, 1 MNaCl; store at 4°C 9 1 M Trts-HCl, pH 8 0; store at 4°C 10 0.2 M glycme, pH 2 7, store at 4°C
2.5. Production
of Fab Fragments
Aftimty purified LPL antibody (see Subheading 3.1.5. for its preparation) Immobtltzed papam (Pierce, Rockford, IL cat. no 20341), store at 4°C 0 1 M sodium phosphate buffer, pH 7 0, store at 4’C 0 5 M EDTA, pH 7 0, store at 4°C. Cysteme-HCI, store powder at 4°C Prior to use, prepare a stock of 0.5 g/mL m water, store on Ice 6 Fab dtalysrs buffer. 0.2 M sodmm phosphate buffer, pH 7.0, 10 mM EDTA, store at 4°C 7 Fab digestion buffer (prepare before use): 0 2 M sodmm phosphate buffer, pH 7.0, 10 mM EDTA, 20 mM cysteme-HCI For 40 mL, combine 4 mL 0 1 M sodium phosphate buffer, pH 7 0, 0 8 mL 0 5 M EDTA, pH 7 0, and 281 pL cysteme-HCl stock. Readjust pH to 7 0 with NaOH before brmgmg to final volume, store on ice 8. Concentrated (70 rnM) cysteme-HCI solution (prepare before use) 0.2 M sodrum phosphate buffer, pH 7 0, 10 mMEDTA, 70 mA4cysteme-HCl For 15 mL, combrne 1 5 mL 0.1 M sodium phosphate buffer, pH 7.0, 0 3 mL 0 5 M EDTA, pH 7 0, and 369 pL cysteme-HCI stock Readjust pH to 7 0 before brmgmg to final volume, store on ice 1 2 3 4 5.
2.6. Preparation
of Staph A
1 Staph A, purchased as a lyophtltzed cell powder of Staphylococcus aureus (Cowan strain) (Sigma, cat. no P 9151); store powder at-20°C 2 SDS wash buffer: 0.1 MTrts-HCl, pH 7.2,2% SDS, 20 mM dtthtothrettol, store at room temperature Use wtthm several days 3 Triton wash buffer: 0.1 M Tris-HCI, pH 7.2, 3% Trtton X-100, 0.1% N-lauroyl sarcosme (sodium salt), store at 4°C
219
L PL lmmunodetection 4 PBS (phosphate-buffered
2.7. Preparation
saline); see Subheading
2.1.
of lmmunomatrix
1 Staph A (see Subheading 3.2.1. for its preparatton) or Protein A-Sepharose (Sigma). Store Staph A at -70°C and Protem A-Sepharose at 4°C 2 Rabbit anti-chicken IgG (ImmunoPure @ from Pterce, Rockford, IL cat. no. 3 1104), store at 4°C 3 0.2 M sodium borate buffer, pH 9 0; store at 4°C 4 Dtmethyl pimeltmtdate-2HCl (Pierce, Rockford, IL cat no 20060), store at -20°C with dessrcant 5 Ethanolamme; store at room temperature 6 0 1 Mglycme-HCl, pH 3 0, store at 4°C 7 0 1 MTrts-HCI, pH 8 0, store at 4°C 8 Thtmerosal (Sigma), store powder at room temperature
2.8. Preparation
of the LPL Sample for lmmunoprecipitation
1 Sample 1ys1.s buffer 50 mM NH,OH-HCl buffer, pH 8 0, 0 2% deoxycholate (sodium salt), 10 U/mL heparm, store at 4°C Make fresh every two weeks 2. 10% SDS m water, store at room temperature 3 20% (w/v) Triton X-100 m water. Mix at room temperature on a rotating verttcal wheel for several hours (or overmght) to dtssolve completely, store at 4°C
2.9. LPL lmmunoprecipitation 1 Fab fragments of chicken anti-LPL anttbody, (see Subheading 3.1.6. for its preparation), store at -70°C 2 5 MNaCl m water; store at room temperature 3. 1 MTris-HCl, pH 7.5, store at 4°C. 4 Rabbit anti-chicken IgG immunomatrtx (see Section 3 2 2 for its preparation), store at -70°C 5 Immuno wash buffer 50 mM Tris-HCl, pH 7 5, 3% Triton X-100, 0 3% SDS, 0.1% N-lauroyl sarcosme (sodmm salt), 0.15 M NaCl, store at 4°C 6 Dtssoctatton buffer 50 mM sodmm phosphate buffer, pH 5 7, contammg 0 5% SDS, store at room temperature 7 Glycerol Concentrate 50% glycerol, 5% B-mercaptoethanol, 0 01% bromopheno1 blue, prepare on day of the experiment by mtxmg together 850 pL 60% glycerol, 50 pL l3-mercaptoethanol, and 100 PL 0 1% btomophenol blue
2.10. SDS Polyacrylamide
Gel Electrophoresis
1 A vertical slab gel electrophoresis unit, such as the PROTEAN 11 xi Verttcal Electrophorests Cell (Bto-Rad, Hercules, CA) 2 Acrylamtde and N, N’-methylene-his-acrylamtde, electrophorests grade (Bto-Rad) 3 Stock acrylamlde solution (40 1) bring 40 g acrylamide and 1 g N, N’-methylene-bts-acrylamtde to 100 mL with water Filter and store at 4°C 4 1 5 ~WTrts-HCI, pH 8 9, store at 4°C
220
9
10
11
12 13 14
2.11.
’
Doolittle
and Ben-Zeev
0 5 A4 Trrs-HCl, pH 6 6, store at 4’C 10% SDS m water, store at room temperature N,N,N’,N’-tetramethylethylenedlamlne (TEMED) from Bio-Rad, store at 4°C Ammonium persulfate (Bto-Rad) prepare a 60 mg/mL solution m water Store the powder at 4°C and the 60 mg/mL solution at -20°C 7% or 9% acrylamide gel solution (60 mL) For a 7% gel solution, combme the followmg ingredients 10 5 mL stock acrylamtde solution, 33 3 mL water; 15 mL of 1 5 MTrts-HCl, pH 8 9,0 6 mL of 10% SDS, 0.6 mL of60 mg/mL ammonium persulfate, and 21 pL TEMED For a 9% acrylamtde gel solution, use the same recipe except reduce the volume of water to 30 3 mL and increase the volume of stock acrylamide solution to 13 5 mL Cast the gel immediately as the solution will polymerize m approx 15-20 mm at room temperature Stacking gel solution For 30 mL, combme the followmg ingredients 22 5 mL water, 3 mL acrylamtde solution, 3 75 mL 0 5 MTrts-HCl, pH 6 6,0.33 mL 10% SDS, 0 3 mL 60 mg/mL ammomum persulfate, 30 uL TEMED This solution will polymerize in approx 5-10 mm at room temperature Molecular weight standards; e g , Rainbow@ coloured protein molecular weight markers, high molecular weight range (Amersham, Arlington Heights, IL cat no RPN 756), store at -20°C. Dtssocratron buffer (see Subheading 2.9.) Glycerol concentrate (see Subheading 2.9.) SDS PAGE runnmg buffer 0 38 A4 glycme, 0 05 A4 Tris base, 0 1% SDS (do not adJust pH), store at room temperature
Western
Blot
Transfer
1 A Western transfer apparatus, such as the Trans-Blot@ Semi-Dry Transfer Cell (Bto-Rad) 2 A power supply for the transfer apparatus; tf using a semi-dry system, the power supply should have a current range up to l-2 amps, such as the Power Pa@ 200 (Bto-Rad) 3 Protein-bmdmg membrane, such as PVDF or mtrocellulose (Pierce, Rockford, IL) 4 Blotting paper (about 4 mm thick), such as the extra thick filter paper from BioRad (cat no 1703960) 5 Methanol (analytical grade) 6 10X stock of western transfer buffer 0 25 M Tris base, 1 92 A4 glycme (do not adJust pH), store at room temperature
2.12.
Western
Blot
Detection
1 Casem hydrolysate (ICN Btomedtcals, Aurora, OH cat no 101290) 2 Western blocking buffer 50 mA4Tris-HCl, pH 7 5,2% casem hydrolysate, 0 1% Tween-20 (or Trtton X-100) Heat this solution to 60°C to solubihze the casem hydrolysate, readjust pH to 7.5 and then filter Store in lOO-mL aliquots at 20°C When needed, thaw the ahquots in a 60°C water bath to resolubihze the casem hydrolysate Cool to room temperature before using
L PL /mmunodetect~on
221
3 PBS-T PBS (see Subheading 2.1.) wtth 0 1% Trrton X-100, store at 4°C 4 Affimty purified LPL anttbody (see Subheading 3.1.5.) Dilute to a concentratron of 0 34 4 pg/mL wrth PBS-T, store at -20°C or at 4°C with 0 0 1% thrmerosal 5 1OX stock of western wash buffer. 0.1 MTrrs-HCl, pH 7 5,5% Trrton X- 100,5% N-lauroyl sarcosme (sodrum salt), 0 5% SDS, 10 mM EDTA A 1X working solutron contams 1 MNaCl* brmg 100 mL of 10X stock and 58 4 g of NaCl to 1 L 6 Btotmylated rabbrt anti-chicken IgG (see Subebading 2.2.). 7 HRP-streptavrdm (see Subheading 2.2.) 8 Chemrlummescent substrate, such as SuperSrgnala Chemrlummescent substrate from Pierce (Rockford, IL), store at 4°C 9 Clear plastic sheet protector. 10 Photographic film, such as Hyperfilm-ECL (Amersham, Arlmgton Heights, IL cat no RPN 3 114)
3. Methods 3.1. Production
of LPL Antibody
The productron of LPL antibody 1s hindered by the high degree of crossspecies homology m the LPL sequence. Given the almost complete sequence conservation among mammals (2), LPL antibody production is better accomplished in chickens, whose LPL sequence exhibits only 75% homology to the mammmaltan spectes (14). An abundant source of antigen IS bovine milk LPL, which can be obtained commercially in pure form Thts presents an advantage, constdermg that maculation does not elicit an immune response m every chicken. In our experience, approxtmately one m four chickens produce an adequate level of antibodtes It 1s important to note that native bovine LPL stimulates very little response; the antigen has to be denatured, most likely exposing new epttopes that are burled within the native LPL structure. The use of chickens for LPL antibody production offers an addrtional benefit since antibodies can be Isolated from egg yolks. This nonmvasive approach represents an appealing alternative to bleeding, offers easier monitoring of the antigenic response, and permits selection of only those eggs that contam a high antibody titer.
3 1.7. Preparation of LPL Antigen LPL is marketed as a suspension, approx 1 mg sulfate. Smce we utthze SDS as the denaturant, be diluted to avoid formation of salt precipitates tion is dialyzed to remove the ammonium sulfate, of the protem. For materials, see Subheading 2.1.
m 4 mL of 3.8 A4 ammomum the suspension must mittally After denaturatton, the solufollowed by reconcentratton
1 Dilute LPL suspension at least fivefold m water, and centrrfuge the solutron for 10 mm at 10,OOOg to remove any remaining precipitate.
222
Doolittle and Ben-Zeev
2. Slowly, while stlrrmg, add SDS from the 10% stock solution to a final concentrat1on of 0 1% 3 Dialyze LPL for 24 h against 2 L of PBS contammg 0 1% SDS, change the buffer at least once during this period (see Note 1). 4 Concentrate the LPL solution to about 0 5 mg/mL by usmg ultrafiltration or centrifugal concentrators If the latter are used, centrifuge at 1,200g for no longer than 15 mm to avoid drying of the membrane If orlgmal volume 1s larger than the capacity of the tube, add remaining solution after the first centrifugatlon, spm for 5-mm periods until the remammg volume 1sno more than 2-3 mL
3.1.2. Chicken Immunization The primary response to nnmumzatlon 1svery weak, and elicits mamly production of IgM. However, the response is dramatically Increased when a boost
of antigen 1sreintroduced mto the prlmed chickens 3 to 4 wk later. The peak response occurs 1&15 d followmg the boost, and high levels of antibody (pnmarlly IgG) persist for approx 2-3 wk While subsequent boosts can be given, m our experience secondary and tertiary boosts resulted m low antibody yields, not warranting the cost of mamtammg the chickens It 1sImportant to use only healthy chickens that are laying dally. As ammalto-animal variability in antibody response 1soften encountered, plan to lmmumze at least 4 to 6 chickens. For materials, see Subheading 2.1. 1 For each hen, use 100 pg of LPL antigen per immunization The LPL antigen (see Subheading 3.1.1.) needs to be at a concentration of about 0 5 mg/mL so that each chicken ~111 receive about 0.2 mL of antigen It 1sbest to hmlt the volume of antigen used, since this volume will be doubled when mlxed with adjuvant Too much adjuvant can be very Irritatmg, causing serious mflammatlon and tlssue necrosis at the site of mJectlon 2 Determine the volume of antigen to be inJected. Add an equal volume of complete Freund’s adjuvant to a glass test tube (see Note 2) While vortexmg, add the antigen to the tube and continue to vortex vigorously until a thick emulsion develops (see Note 3) 3 Take up the emulsion m a small glass syrmge fitted with an 18-20-gage needle Inject the emulsion subcutaneously m the dorsal neck region of the chicken Be sure that the needle slides Just under the outermost layer of skin, which IS very thm m chickens The emulsion should be easily Injected mto this subcutaneous space with no discomfort to the animal, if it 1s difficult to inject, the needle 1s inserted too deeply. It IS best if several injection sites are utilized to dehver the full volume of antigen 4 Three to 4 wk later, rennmunize the chlckens using an antigen emulsion prepared with incomplete Freund’s adjuvant as described m step 2 Use inJectIon sites separate from the ones used for the mltlal lmmumzatlon.
1PL Immunodetectlon
223
5 Egg collection should start 2-3 d prtor to the first tmmumzation, and contmue throughout the primary and secondary immumzation pertods unttl 4-5 wk after the boost Collect eggs daily and wrap eggs mdtvtdually m paper towels Label both the egg and wrapper with the date and chicken number (see Note 4), store eggs at 4°C.
3. I .3. Screening for LPL Antibody The initial screening of crude egg yolks 1scumbersome, yet the antigemc response needs to be determined prior to embarking on costly and laborious IgG purification procedures. The difficulty is both technical, due to the VISCOSity of the yolk, and biochemical. The latter is caused by nonspecific bmdmg of yolk lipids to LPL, creating a false-positive response when antibody production is assessed.To partially solve the viscosity problem, yolks are diluted in TBS. To overcome the false-positive results when testing for antibody bmdmg, studies are carried out with yolk samples spanning the entire immumzation interval. Thus, pre-immune yolk samples will provide a baseline against which the antigemc response will be assessed(see Fig. 2). 3 1.3.1
PREPARATION OF EGG YOLKS FOR IMMUNOASSAYS
For materials, see Subheading
2.2.
1 Select at least one pre-immune egg, and one egg from each 556 d interval spannmg the entire collection period 2 Wearing gloves, crack each egg and dtscard the egg white The separation can be factlitated by using an egg separator, available commercially or supplied by Promega (Madison, WI) along with the IgG purificatton ktt Allow the yolk to slide mto a 50-mL calibrated conical tube 3 Assess the yolk volume and dtlute 1.1 (v/v) m TBS Stir the suspension with a plastic spatula or a glass rod Keep suspensions at 4°C After removing the necessary samples for antibody testing (see Subheading 3.1.3.2.), store suspenstons at -20°C until combmmg with the rest of the yolks chosen for further purification
3 1 3.2 ASSESSING CATALYTIC INHIBITION OF LPL
Few chickens will generate antibodies affecting catalytic activity. However, we do recommend testing for mhtbition of activity, the procedure is short and, if inhibition is detected, there is no need for further bmdmg studies to determine antigenic response. For materials, see Subheading 2.2. 1 Incubate an aliquot of highly active LPL (such as purified bovine milk LPL) with 10,20, and 40 pL of each yolk emulsion (see Note 5) m a final volume of 100 pL The assay can be carried out many low ionic-strength buffer, pH 7.0-8 0, such as
barbital (5 mMNa barbital, pH 7 2) Tris-HCI (10 n-J4pH 7 4) or NH,OH-HCl
Doolittle and Ben-Zeev
224
0
10
20
30
30
50
60
70
80
days after first qectton
Fig 2 A typical nnmune response m chickens followmg nnmumzatton with bovine milk LPL The data were obtained by ELISA The time Interval contammg the eggs selected for IgG isolation IS Indicated. (50 mA4, pH 8 0) Gently shake the LPL-anttbody mixture for 60 mm at 4°C A control LPL sample without yolk extract should be mcluded 2 Add 100 pL of substrate emulsion and assay enzyme activity at 37°C (see Chapters 3 or 9) Determme degree of real antigemc response by comparmg mhibition of activtty between the pre-immune, primary, and post-boost samples (see Note 6)
3.1.3.3 Assessing LPL-Ant/body Bindmg Even tf no effect on LPL catalyttc acttvity 1s observed, tt is likely are that antibodies that bind to the LPL protein were produced. One method to determine LPL-antibody bmdmg is by enzyme-linked nnmunoassay (ELISA). The procedure below is a modification of the assay developed by Goers et al. (7). For materials, see Subheading 2.2. Coat wells of a 96-well mtcrotiter plate with denatured bovine LPL (see Subheading 3.1.1.) diluted to 0 3 pg/mL m 0 1 MKHCO,, pH 9 5 Add 100 pL of denatured LPL to each well, incubate overnight at 4°C Remove antigen and block nonspecific bmdmg sites with ELISA blocking buffer, use 200 uL per well Mix gently on a shaking platform for 2-3 h at room temperature Wash plate 3 times with ELISA wash buffer Add 24 pL egg yolk suspension to 376 pL ELISA sample buffer From this solution, prepare two 1.2 serial drlutions by combinmg 200 pL sample and 200 yL ELISA sample buffer If aftimty purified LPL antibody is available, it should be included as an nnmune standard* prepare 1:2 serial diluttons in ELISA Sample Buffer, starting from 256 ng IgG/mL down to 0 5 ng IgG/mL. Place 100 pL of immune standard, blank buffer, or yolk sample per well The final sample volumes of each yolk suspension will be 6, 3, and 1 5 pL It IS rec-
L PL lmmunodetection
7.
8 9
10.
225
ommended to apply each sample m duplicate. A suggested layout of an ELISA plate is shown m Fig. 3 Cover plate and Incubate overnight at 4°C. Wash plate 5 times with ELISA wash buffer Incubate overnight at 4°C with biotmylated antr-chicken IgG (see Subheading 2.2.), diluted l/15,000 m ELISA wash buffer (see Note 7) Wash plate 5 times with ELISA wash buffer. Add 100 uL per well of HRP-streptavidm, diluted l/2,500 m ELISA wash buffer. Incubate for 2 h on a shaking platform Wash plate 5 ttmes with ELISA Wash Buffer Prepare developing solution by mtxmg 1 1 mL OPD stock solution, 44 pL of 3% H,Oz and 0 1 M sodmm citrate pH 4.5 to a final volume of 11 mL. Add 100 pL/well, shake plate gently and allow color to develop for 3-4 mm Stop development with 4 N H,SO,, 25 pLl well. Determine absorbance at 495 nm, preferably in an ELISA reader If color IS too strong (above 1.5 OD&, dilute with 0.8 N H,SO,. To determine net absorbance, use the absorbance of the pre-immune samples as background The use of the immune standard permits an approximate quantitation of the LPL-specific antibody per yolk Even m the absence of a standard, the ELISA results should be used to determine which chicken gave the best immune response, and to choose the yolks with the highest titer (see Fig. 2)
3.1.4. Purification of Chicken /gG The EGGstractTM purification system provided by Promega, Madison, WI (cat. no. G2610) offers a rapld purification procedure, with high yields and a high degree of IgG purity. If the Promega kit 1snot available, we present here a protocol
based on Loecken and Roth (15). 2.3.
For materials, see Subheading
1. Separate yolks from egg whites (see Subheading 3.1.1.3.) and collect them m a volumetric cylinder 2. Add 4 vol TBS. Mix well and centrifuge 20 mm at 1,2OOg, room temperature. 3. Filter supernatant through 4 layers of gauze To each 1 L supernatant, add 60 mL of 15% Dextran sulfate and 150 mL of 1 M CaCl,. Let mixture stand at room temperature for 30 mm. Centrifuge as above. 4. Filter supernatant through gauze, wash pellets with TBS (half of the ortgmal volume used m step 2), and centrifuge as above Combine both supernatants. 5 Add solid ammonmm sulfate to the combmed supernatants to a final concentration of 30% (w/v). Let stand for 30 min at room temperature, then centrifuge for 20 mm at 2,500g 6 Dissolve protein pellet in 15 mL TBS per yolk, e.g , tf 10 yolks were used, dtssolve pellet m 150 mL TBS. Measure total volume Add slowly, with stirrmg, one-half of that volume of saturated ammomum sulfate Let mixture stand at room temperature for 30 mm, then centrifuge for 20 mm at 2,500g. 7 Dtssolve pellet m DE buffer (10 mL per yolk) Dialyze agamst 4 L of DE buffer overnight at 4°C. If the dtalysate remams cloudy, remove particulate material by centrifuging at 4°C for 10 mm at 10,OOOg
226
Doolittle and Ben-Zeev
Yolk samples (@/well) Yolk samples (jUvel1) Yolk samples (pIhell)
Fig. 3 Suggested layout of an ELISA plate for LPL-antlbody bmdmg studies. The upper two rows contam IgG standard and blanks, and the rest of the plate 1s divided mto 12 clusters of 6 wells, each containing serial dilutions of the yolk sample The q sign denotes a duphcate of the sample above. 8 Prepare a column of DEAE Affi-Gel Blue in DE buffer (4 mL of restn per yolk) Apply yolk protein, and wash column with at least five bed-volumes of DE buffer or until no more protein 1seluted (check absorbance at 280 nm) Elute IgG with DE/ NaCl buffer, collectmg 1 5 mL fractions Pool peak fractions (1 OD,,, = 0.7 mg/mL) 9. Dialyze the IgG overnight against TBS and store at -20°C.
3.7.5. Affinity Purification of LPL Ant/body Isolation of LPL specific antlbodies from IgG 1s faclhtated by the commercial availability of purified LPL, since the latter can be lmmoblllzed on a solid matrix. LPL-specific antlbodles are allowed to bmd, unbound antibodies are washed away, and the specific antibodies are then eluted 3.1 5 1 COUPLING LPL TO ACTIVATED BEADS A number of activated beads are commercially available. We present a method using cyanogen bromide (CNBr)-activated Sepharose, with the coupling protocol based on mstructlons by the manufacturer For materials, see Subheading 2.4. 1. Denature 4-5 mg bovine milk LPL as described m Subheading 3.1.1., except dialysis should be performed m 0 1 MNaHCO,, 0 1% SDS 2 Weigh out 1 g CNBr-activated powder and suspend m 1 M HCl Place the slurry on a smtered glass filter and wash with 1 M HCl Use approximately 200 mL, added m aliquots, followed by washmg with an equal volume of water 3 Transfer the gel mto a capped tube and mix with the LPL solution on a rotating vertical wheel for 1 h at room temperature (see Note 8).
L PL lmmunodetectlon
227
4 Spur the gel slurry at low speed (500g) for 5 mm, decant the supernatant, add 5 gel volumes of 0.1 M NaHCO,, 0.1% SDS and repeat the spm to wash away excess hgand. 5 Block remammg reactive groups by Incubating the gel m 20 mL of I A4 ethanolamine-HCl, pH 8 0 or 0 1 M Trts-HCl, pH 8 0 Rotate for 2 h 6 Transfer the slurry onto a smtered glass funnel and wash with 2-3 gel volumes of 0 1 M NaHC03 to remove residual SDS Then wash the gel (mmimum 5 gel volumes) with at least three cycles of alternating pH: 0 1 Msodmm acetate buffer, pH 4 0 containing 0 5 M NaCl, followed by 0.1 M Tris-HCl buffer, pH 8 0 contammg 0 5 M NaCl Addition of NaCl to the buffers mmimizes formatton of protem aggregates 7 Wash the gel with TBS. For storage up to several months (4°C) add 0 01% sodium aztde or 0 0 1% thimerosal 3.1 5 2 IMMUNOAFFINITY PURIFICATION OF LPL ANTIBODIES For materials,
see Subheading
2.4.
1 Load the LPL-bound gel onto a column (e g., 0 6 x 10 cm) Wash the beads wrth 5 bed volumes of TBS 2 Pass the purified IgG over the column For maximum bmdmg, recycle flowthrough once through the column (see Note 9) 3 Wash the column with 20 bed volumes of TBS, followed by at least 10 bedvolumes of 1 A4NaCl m 10 mM Trts-HCl, pH 7 4 Momtor elutton of protein by absorbance at 280 nm, and contmue washing until no more protein IS eluted 4 Wash the column with 5 bed volumes of 10 mM Trts-HCl, pH 7 4 5 Place tubes contammg 0 175 mL of 1 M Trts-HCl, pH 8 0 into a fraction collector Elute the LPL antibodies with 0.2 M glycme, pH 2.7. Collect fractions of 1 mL The presence of 1 M Tris-HCl will neutralize the pH, preventing prolonged exposure of the antibodies to acid pH Monitor protem elution by absorbance at 280 nm Pool the peak fractions and measure the final protein concentratton (1 OD,,, = 0 7 mg/mL) 6. Measure mhibttion of LPL activtty or antibody bmdmg by ELISA using total IgG, flow-through from the tmmunoaffinity column and the affinity-purified ant1 LPL (see Subheading 3.1.3.3.). Thts will allow evaluation of the column perfomance and establish the LPL antibody titer
3.1.6. Product/on of Fab Fragments One of the most common techniques to isolate LPL 1s nnmunoprecipitatton. Since thts technrque utilizes antibody for binding to an insoluble matrix, the sample released after immunoprecipitation contains both LPL and the chicken IgG When this sample IS subjected to Western blotting, detectton of LPL 1s accompltshed by using the LPL antibody m combmatton with biotmylated rabbtt anti-chtcken IgG (see Subheading 3.3.). The latter antibody wtll also detect the chtcken IgG used for LPL immunoprecipitatton. Stnce the chicken IgG heavy chain (55 kDa) mtgrates to a position similar to that of LPL (57 kDa), tts
228
Doolittle and Ben-Zeev
signal ~111 Interfere with LPL vlsuahzatlon. To solve this problem, the chicken IgG used for nnmunopreclpltatlon is substituted with the corresponding Fab (acronym for “fragment antigen binding”). These fragments are produced by proteolytlc cleavage of IgG, and their reduced size will not interfere with LPL detection Proteolytlc digestion with papam IS suitable for generation of Fabs from chicken IgG. The principal sites of papam cleavage are found on the ammoterminal side of the dlsulfide bonds that hold the two heavy chains together (see Note 10). Therefore, papain dlgestlon releases two antigen bmding domains and one Fc fragment. Under the reducing condltlons used for SDS PAGE, the Fab domain breaks up mto a light chain (about 20 kDa) and a heavy chain fragment (approx 25 kDa). In addition, the Fc portion breaks up mto two fragments (approx 25 kDa) The avallabihty of lmmoblhzed papain allows efficient separation of the enzyme from the digested IgG. The protocol described below IS based on the manufacturer’s guidelines (Pierce, Rockford, IL), and the quantities specified allow cleavage of l-2 mg chicken IgG. For materials, see Subheading 2.5. 1 If IgG is too dilute (< 0 8 mg/mL),
concentrate at 4°C (see Subheading
3.1.1., step 4)
2 Dialyze overnight against 2 L of Fab dlalysls buffer at 4°C 3 Place 0.5 mL papam slurry mto a capped tube. To wash the gel, add 4 mL Fab digestion buffer, mix and separate the gel by centrlfugatlon at 4°C for 5 mm at 500g Repeat this washing process twice 4 Add 0.25 mL of concentrated (70 mM) cysteme-HCI solution per mL of chicken IgG 5 Add the IgG to the papam slurry, and Incubate ovemlght at 37°C on a rotating vertical wheel or m a shaking water bath 6 To stop the reaction, add 10 pL of 1 M Tris-HCl, pH 7 5, per ml of IgG Mix slurry and then centrifuge for 5 mm at 5OOg, remove supernatant, which now contains the Fabs 7. To assess the complete papam cleavage of IgG, subJect a sample to SDS PAGE and stain by Coomassle Blue, silver stain, or Western blotting, for Western analysis, use blotmylated rabbit antichicken IgG (see Subheading 3.3.)
3.2. LPL lmmunoprecipitation The lmmunopreclpltatlon of LPL 1s accomphshed m two stages: m the first stage, LPL 1s bound by Fab fragments; the second stage utilizes mununomatrlx to isolate the LPL/Fab complexes (see Fig. 1). In this section, preparation of the nnmunomatrlx 1s first described, beginning with the unrnunoabsorbant Staph A. The two most popular IgG lmmunoabsorbants are inactivated Staphylococcus aureus cells (called Staph A) or Protein A-Sepharose. The cell wall of S. aureus contains Protein A which tightly binds the Fc portion of IgG from sev-
229
LPL lmmunodetectlon
era1 species, mcludmg rabbit, but not chicken (16). The use of either Staph A or Protein A-Sepharose as an nnmunoabsorbant 1sa personal preference Staph A 1srelatively mexpenslve and forms a tight pellet after centnfugatlon, nevertheless, to eliminate potential background problems and non-specific binding, it needs to be extensively washed prior to use Protein A-Sepharose, on the other hand, can be used wtthout prior washmg and generally gives very clean lmmunopreclpitates; unfortunately, it 1s expensive and does not form a tight pellet after centnfugation. This loose pellet 1smore difficult to manipulate and can lead to sample loss. 3 2.1. Preparation of Staph A Staph A can be purchased as either formalm-treated cells or as a lyophlhzed preparation Although this section describesthe processmgof lyophlhzed cells, the sameprocedure can be applied to prepare formalm-treated cells We generally prepare a large quantity (10 g) of Staph A at one time, as it stores well at -70°C For materials, see Subheading 2.6. 1 Divide 10 g of lyophlhzed cell powder into four 2 5-g allquots (see Note 11) Transfer eachahquot into a 50 mL cappedcentrifuge tube 2 Add 25 mL of SDS wash buffer to each tube. Resuspend the cell powder thoroughly, first with a teflon rod and then by vigorous vortex mlxmg 3. Cap the tube and place m a bollmg water bath for 10 mm 4. Centrifuge the slurry at 12,000g for 5 mm at room temperature Discard the supernatant, and resuspend each pellet m another 25 mL of SDS wash buffer 5 Repeat steps 3 and 4 until five washes in SDS wash buffer are completed 6 Resuspend each Staph A pellet m 25 mL Trlton wash buffer Do not boll Centrifuge the slurry at 12,OOOg for 5 mm at 4’C to pellet out the Staph A (see Note 12) 7 Repeat step 6 until three washes m Triton wash buffer are completed 8 In a similar manner, wash the Staph A pellet twice more m PBS 9 Resuspend each Staph A pellet m PBS to a total volume of 25 mL Dlvlde into
lo-mL ahquots and one of these aliquots mto 1 ml fractions, which 1sa convemerit size for an average lmmunopreclpltatlon
experiment
One ml of this prepa-
ration binds 1 mg of rabbit IgG. StoreStaphA at -70°C (seeNote 13). 3.2.2. Preparation of Immunomatr/x We use the term immunomatrlx to describe a reagent made by covalently cross-lmkmg IgG to a solid lmmunoabsorbant such as Staph A or Protein ASepharose As the heavy chain of rabbit IgG (53 kDa) used in the lmmunopreclpltation migrates Just below LPL (57 kDa), large amounts of rabbit IgG can cause distortion m the pertinent region of the gel. The crosslmkmg ensures that a mmlmum of IgG will be released when LPL IS liberated from the Immunoprecipitate after treatment with SDS.
230
Dooliftle and Ben-Zeev
Although the IgG can be cross-linked to either Staph A or Protein ASepharose, we describe below the preparation of a Staph A lmmunomatrlx using 1 mg of rabbit IgG. This procedure can be scaled up to prepare larger quantities For materials, see Subheading 2.7. 1 Add 1 mL Staph A to one mg of rabbit ant+chicken IgG (see Note 14). The bmdmg of IgG to Staph A should be done at a pH of 7 O-9.0, suitable buffers are 10 mA4 Hepes, pH 8 0, or PBS 2 Incubate the IgG with Staph A for 60 min at 4°C with gentle mixing 3 Centrifuge the Staph A at 12,000g for 5 mm at 4°C Wash pellet two times with 10 mL of 0 2 M sodium borate buffer, pH 9.0, by resuspendmg the pellet with a pipette, avoid formation of excessive bubbles durmg the resuspension 4 After the final wash, resuspend the pellet m 10 ml of sodium borate buffer, pH 9.0 (see Note 15). Remove a small aliquot of the unmunomatrlx (approx 500 yL) and set aside (see step 8) To the suspension, add solid dlmethylplmehmldate2HCl to a final concentration of 20 mA4 Adjust the pH of the solution up to 9 0 with NaOH Incubate at room temperature for 90 mm with gentle mixing 5. Stop the crosslmkmg reaction by adding ethanolamme to a final concentration of 20 mM(see Note 16) Centrifuge the nnmunomatrlx at 12,000g for 5 mm at 4°C and resuspend the pellet m 10 mL of 0 2 M sodium borate buffer, pH 9 0, contaming 20 mM ethanolamme (see Note 17) Incubate at 4°C for 2 h 6 Wash the lmmunomatrix once with 10 mL of water Resuspend the pellet m IO mL of 0.1 A4glycine-HCl, pH 3 0, and centrifuge nnmedlately, resuspend the pellet m 10 mL of 0 1 MTns-HCl, pH 8 0 7 Wash lmmunomatrlx two more times m 10 mL PBS Resuspend the pellet with 1 mL PBS to give a final concentration of lmg IgG per mL of slurry 8. Remove 50 pL of the mununomatrlx Centrifuge this sample and the one obtained before crosslmkmg (see step 4) Resuspend the Staph A pellet m 30 pL dlssoclatlon buffer (see Subheading 2.9.) Centrifuge to pellet the Staph A, and remove the supernatant Add 20 pL of Glycerol Concentrate (see Subheading 2.9.) Analyze by SDS PAGE (see Subheading 3.3.1.) and stain the gel with Coomassle Blue. The heavy chain of IgG (55 kDa) should only be vlslble m the sample taken before crosslmkmg 9 Store the Staph A mimunomatrlx at -70°C If the immunomatrix IS prepared with Protein A-Sepharose, store at 4°C with 0 01% thnnerosal
3.2.3 Preparation of Sample for LPL lmmunoprecipitation It 1simportant to determine if the LPL antibody binds to native or denatured LPL. Generally, antibodies that do not inhibit LPL actlvlty (see Subheading 3.1.3.2.) but are detected by ELISA (see Subheading 3.1.3.3.) will bmd best to denatured LPL. If this ts the case,the sample proteins should be denatured with SDS prior to lmmunopreclpltatlon. After denaturatlon, Trlton X- 100 (or NP40) 1sadded m order to sequester SDS within Trlton mlcelles; this ensures that
LPL lmmunodetection
231
the antibodies added for immunoprecrpttation ~111not be damaged by SDS denaturatron For materials, see Subheading 2.8. 1 Homogemze or somcate cell or tissue samples m sample lysrs buffer (see Note 18) We generally prepare l&20% (w/v) lysates Centrifuge the sample (12,000g) for 10 mm at 4°C to remove nuclei and msoluble debrts If the antibody detects native LPL, these homogenates can be used directly for LPL mnnunoprectpttatton. 2 Measure LPL activity and protem concentration LPL activtty IS used to determme the amount of sample required for tmmunoprecipttatton (see Subheading 3.2.4.), and the protein concentatton is used to determme the amount of SDS required for complete denaturatton 3 Add a volume of 10% SDS so that the SDS protein weight ratto is at least 2 1, e.g., tf the sample contams 500 yg of protein, add 1 mg of SDS (10 pL of 10% SDS) Place the sample m a botlmg water bath for at least 2 mm 4 After coolmg the sample to room temperature, add a volume of 20% Trtton X100 so that the TrttonSDS ratio is at least 7: 1; e g , tf the sample contains 1 mg of SDS, add 7 mg of Trtton (35 pL of 20% Triton) 5 Centrtfuge the sample m a microfuge for 5 mm (see Note 19) Remove the supernatant into a fresh tube
3.2 4. lmmunoprecipitation The amount of sample used for tmmunoprectpttatton can be estimated by LPL acttvtty. Based on reported values for LPL specific acttvtty, 10 mU equate roughly to 10 ng LPL. Thts amount of LPL 1sreadily detected by Western blot techniques
using chemtluminescent
substrates
(see Note 20) In the procedure
given below, 20 mU of actrvtty are Initially used for immunoprecipttatton; thts permits the orrgmal sample to be split into two identical samples (see Note 21). For materials, see Subheading 2.9. 1 Into a microfuge tube, place sample containing 20 mU of LPL acttvtty From the 5 M NaCl and 1 A4 Trts-HCl, pH 7 5 stock solutions, add suffictent volumes to give final concentrations of 1 Mand 50 mM, respectively Mix well and add antiLPL Fab (see Subheading 3.1.6.). A good startmg point is to add 5 pg Fab to 20 mU of LPL acttvtty However, the amount of Fab needed to quantttattvely bind LPL should be determmed empirically for each batch of antrbody This can be done by incubating Increasing amounts of sample with a constant amount of Fab to determine the mmmal amount needed to quantttattvely bmd all the LPL. After adding Fab, mix well and incubate overnight (16-20 h) at 4°C 2 Add rabbit anttchtcken IgG tmmunomatrtx A good starting pomt IS to add 50 pL immunomatrlx (I e., 50 pg rabbit antrchicken JgG) to 5 ,ug Fab Again, however, tt IS best to determine empirically the amount needed to quantttattvely bmd the Fab/LPL complexes Incubate for 2 h at 4°C with constant gentle mtxmg (see Note 22)
232
Doolittle and Ben-Zeev
After mcubatron with mrmunomatrix, add 50 pL of Staph A (see Note 23). Centrifuge the samples m a microfuge (approx 12,OOOg) for 2-5 mm Gently aspirate the supernatant without disturbing the pellet Add 1 mL of immuno wash buffer, and resuspend the pelh=t with a plastic Pasteur pipette Repeat steps 3 and 4, again usmg 1 mL of tmuno wash buffer Repeat steps 3 and 4 using 1 mL water After removing the final wash, re-centrifuge the pellets briefly and aspirate any remaining water Add 65 uL of drssoclatlon buffer and resuspend pellet completely. Resuspension of the pellets is facilitated by placmg a 200 pL tip mto the mrcrofuge tube and vortexmg, hold your finger 0.5-l 0 cm above the tip so it will not be propelled from the tube during mrxmg 10 Place tubes m a botlmg water bath for 2 mm 11 Centrifuge for 2-5 mm to pellet the lmmunomatrix Remove 30 pL of the supernatant mto two fresh microfuge tubes (see Note 24) Discard the pellet 12 Add 20 pL of Glycerol Concentrate
3.3. Western Blot Analysis Western blot analysts is the method of choice to examme steady-state levels of LPL protein wtthm tissues or cells (see Fig. 4) In this procedure, LPL immunoprecrprtates are subjected to SDS PAGE and the protems on the gel transferred over to a protein-bindmg membrane. The resulting “blot” is probed first with chtcken LPL antibody, and then probed with rabbit anti-chicken IgG that is conjugated with biotm. The biotm 1sthen used to bmd streptavtdm that 1scoqugated to horseradish peroxtdase (HRP). Finally, HRP 1sused to convert a chemtlummescent substrate mto a light-emittmg product. Photographic film is used to record the Image. 3 3.1. SDS Polyacrylamide Gel Electrophoresis For materials, see Subheading 2.10. 1. Pour a 7% or 9% separating gel In a 7% gel, LPL migrates to the bottom third of the gel, m a 9% gel, it migrates to the middle We use 7% gels when analyzing small differences of 2-3 kDa; for instance, after digestion with endoglycosidases (see Fig. 4) 2 Pour a stacking gel 3 Prepare a molecular weight standard by combmmg I5 pL of Rambow@ colored molecular weight markers, 15 pL dissociation buffer and 20 JJL of glycerol concentrate 4 Prepare an LPL standard by combmmg 1 pL of 5-10 pg/mL purified LPL, 29 pL dissociation buffer and 20 pL of glycerol concentrate 5 Load standards and samples. For unused lanes, add 50 uL of sample buffer (30 pL dlssoclatron buffer and 20 pL of glycerol concentrate)
LPL lmmunodetection
233
Fig. 4. Immunoprecipitated LPL subjected to Western blot analysis. LPL was immunoprecipitated from lysates of murine brown adipocytes containing 20 mU activity, as described in Methods, section 3.2. The immunoprecipitate was split into two equal aliquots, one of which was treated with 2.5 mU endoglycosidase (endo) H. Both samples were subjected to SDS PAGE and Western blot analysis. Mammalian LPL contains two glycan chains. Endo H cleaves glycans only of the high mannose type, characteristic of glycoproteins within the endoplasmic reticulum. After translocation to the Golgi, the chains are further processed and become endo H resistant. The 57 kDa and 55 kDa bands represent LPL containing Golgi-processed glycan chains; the 52 kDa band represents LPL with only high mannose chains. 6. Run the gel using SDS Running Buffer at a constant current that produces a starting voltage of 80-90 V. Stop the run when the bromophenol blue line migrates to the end of the gel. LPL will migrate between the bovine serum albumin (66 kDa) and ovalbumin (46 kDa) markers.
3.3.2. Western Blot Transfer For materials,
see Subheading
2.11.
1. For each gel, one sheet of PVDF (or nitrocellulose) membrane and 4 sheets of blotting paper are needed. Cut membrane and blotting paper to the dimensions of the separating gel (see Note 25). 2. Soak membranes in methanol for a few seconds, and then place in Western transfer buffer. The membrane is highly hydrophobic and will tend to float in aqueous buffers. To keep it submerged, add the blotting paper on top of the membrane to weigh it down. Add enough buffer to cover blotting paper. Soak for at least 10 min before using. 3. Construct a “sandwich” beginning with two sheets of blotting paper, membrane, gel, and ending with two sheets of blotting paper. It is important not to trap air bubbles between the layers, since this will affect transfer. It is convenient to assemble the layers under buffer, and move the completed sandwich to the transfer apparatus. Orient the sandwich so that the membrane side is closest to the bottom
234
Doolittle and Ben-Zeev
(+) plate of a semt-dry transfer apparatus or to the cathode (+) plate of a tank transfer apparatus 4. Running conditions vary with the type of transfer buffer, molecular weight of the protein and the transfer apparatus used. Using the equipment and matertals descrtbed m Subheading 2.11., LPL wtll be transferred to the membrane after 30 mm at a constant voltage of 20 V.
3.3.3 Western Blot Detection For materials, see Subheading 2.12. 1 Remove the membrane from the transfer apparatus and submerge m Western blockmg buffer m a suitably sized glass or plastic container (see Note 26). Incubate at room temperature for 30 mm on a shaking platform 2 Pour off the Western blockmg buffer, and add the LPL antibody diluted to 0 3-O 4 pg/ml m PBS-T (see Note 27) Cover the contamer and incubate at 4°C for 12-18 h (i.e., overnight) on a shakmg platform 3 Remove the antibody solutton, and rmse the membrane with distrlled water. This IS done by adding water to the container, swnlmg for several seconds, and pourmg off the excess liquid, repeat 4-6 times 4 Add Western wash buffer and incubate at room temperature for 5 mm on a shakmg platform Rmse with dtsttlled water as m step 3 and agam add Western wash buffer Repeat wash cycle for a total of four times After last wash, rinse wtth distilled water and drain off excess hquid. 5 Add btotmylated rabbit anti-chicken IgG diluted 1 5000 m PBS-T Incubate at room temperature for 30 mm on a shaking platform. 6 Wash the membrane as m step 4 7 Add HRP-streptavidm (see Subheading 2.12.) diluted to 1 5000 m PBS-T. Incubate at room temperature for 10 mm on a shaking platform. 8 Wash the membrane as in step 4. At this pomt, the mcubatton time in Western wash buffer can be reduced to 2 mm but repeat the wash cycle for a total of five times. 9 After rmsmg well m distilled water, dram off excess liquid and add the chemtlummescent substrate Use enough substrate so that the surface is completely wetted and does not dry out Incubate for 5 min at room temperature 10 With the aid of tweezers, remove the membrane and dram excess substrate by touching an edge to tissue paper Place the membrane between a clear plastic sheet protector; remove any trapped an bubbles. 11 Expose membrane to photographic film. Start with an exposure time of 10 s However, exposure times can vary from 1 s up to several mmutes.
4. Notes 1 SDS IS added to both the LPL solution and dialysis buffer, since tt does not easily cross the dtalysts membrane Failure to add SDS to the LPL solutton prior to dialyses results m substantial LPL loss, probably through aggregatton and adherence to the dtalysts membrane
LPL lmmunodetection
235
2. Complete Freund’s adjuvant is a non-metabohzable 011containing inactivated M tuberculosu, before usmg the adjuvant, be sure to resuspend the bacteria by vortexmg or shaking Incomplete Freund’s adjuvant used for the boost does not contain bacteria 3. The emulsion should be opaque white and have a very thick consistency It should not disperse when a drop IS placed on the surface of water. 4 Since mununizatlons may disrupt the egg-laying routine, make sure all the eggs are collected m a timely manner before they could be damaged by the hen 5 Although vlscoslty 1s reduced, It is still difficult to aspirate small volumes from these emulsions; trimmmg off the ends of microplpettmg tips will facihtate sampling small volumes 6 Inhlbltlon of actlvlty will be apparent m all egg samples, includmg the preimmune, due to the dllutlon of the radlolabeled substrate by yolk lipids Therefore, a real lmmunogemc response will be detected only by comparrng mhlbltlon at different stages of the immune response. 7 The actual dllutlon is l/30,000 since the antibody 1s stored m glycerol as a 50% solution 8. Do not use a magnetic stirrer as it may damage the agarose beads 9. Save 0.5 mL of the IgG load and of the flow-through for LPL binding studies 10 Rabbit or human Fab fragments can also be generated by pepsin cleavage However, we found pepsin to be unsuitable for chicken Fab production as It caused complete proteolytlc digestion of the IgG. 11 Wear mask and gloves when weighing Staph A powder as it may still contain viable cells 12 Once resuspended m Triton Wash Buffer, the Staph A slurry can be stored at 4°C overnight 13 Staph A can be freeze-thawed several times with no adverse effects on IgG bmdmg. However, storage at temperatures higher than -70°C limits its shelf hfe 14 Protein A-Sepharose 1s used at a ratio of 1 ml of packed beads per 2 mg of antibody Incubate as a slurry with gentle rocking for 60 mm (do not bmd the IgG to the Protem A-Sepharose using a column format, since an IgG gradient will form) Centrifuge the Plotem A-Sepharose at 3000g to pellet 15. Any buffer can be used that does not contam primary ammes For example, phosphate, carbonate, HEPES, tnethylamme, and N-ethyl morpholmeacetic acid buffers are suitable. Avoid Trls buffers 16 20 mA4 Trls and lysme buffers may also be used to stop the reaction 17 The crosslmked nnmunomatrlx takes on a cake-like (or crumbly) consistency Be sure to resuspend all pieces as throughly as possible Passing the lmmunomatrlx through an 20-gage needle can help disperse the pellet; be careful to avoid excessive bubbles. 18 The sample lys~s buffer IS compatible with the assay for LPL activity This buffer contams a small amount (0.2%) of deoxycholate that: will solublhze membranes and release cryptic LPL However, if the sample will not be assayed for LPL activity, the cells or tissues can be directly somcated m 0 5% SDS, 50 mM Tris-
236
19
20
21
22
23
24
25
26
27
Doohttle and Ben-Zeev HCI, pH 7 5 (Somcation IS used to shear released DNA that would otherwtse be present as a vtscous mass m the lysate ) Generally, after SDS denaturatton, a pellet 1snot discernable However, this step IS to ensure that any msoluble maternal wtll be removed prior to immunoprectpitation The value of 10 mU 1s a suggested starting point for nnmunoprecipttation However, if little or no actrvtty 1s detected, the amount of sample required to give acceptable signals will have to be empntcally derived When the origmal sample IS split, one can be retained as a control (no treatment), and the second can be treated wtth enzymes such as endoglycostdases These analyses can be useful m determmmg the state of glycan posttranslational processing that mark the passage of LPL through the ER and Golgt compartments Constant mtxmg can be accomphshed by placmg the samples on a rocker platform or on a rotating vertical wheel Be sure that the mtxmg does not cause excessive formation of bubbles Because of the crumbly conststency of the unmunomatrtx, this extra amount of Staph A IS added just prior to the first centrtfugation This firms up the pellet so that removal of the supernatant 1s more easily accompltshed At thts point, 2 5 mU of endoglycostdase H can be added to one of the 30-pL ahquots. Incubate overnight (12-16 h) at 37”C, and then add 20 PL of glycerol concentrate The sample IS now ready for SDS PAGE Always use clean gloves when handlmg membranes and blotting paper A pan of tweezers wtth flattened ttps are very useful to pick up membranes Whtle PVDF is less brittle, mtrocellulose can be used as well In thts and all subsequent steps, add enough hqutd to the container so that the membrane IS totally submerged and free floating If more than one membrane IS to be processed at one time, tt IS best to use a separate container for each membrane Use the affinity-purified LPL antibody that has not been treated with papain for this application, Fabs are not needed In our experience, the diluted antibody solutton can be used repeatedly While the signal mtensny decreases slowly with use, we have had good results with anttbody that has been reused for over 20 apphcattons
References 1 Garfinkel, AS and Schotz, M.C (1987) Ltpoprotem Lipase, m, Plasma Lzpoprotezns (Gotto, A M , Jr., ed ) Elsevter Sctence Publtshers B V , Amsterdam, pp 335-357 2 Bensadoun, A (1991) Ltpoprotem hpase Annu Rev Nutr 11,217-237 3 Ong, J M , Ktrchgessner, T G , Schotz, M C , and Kern, P A. (1988) Insulm increases the synthettc rate and messenger RNA level of hpoprotem hpase m ISOlated rat adipocytes. J Blol Chem 263, 12,933-12,938 4 Enerback, S., Semb, H., Tavermer, J , BJursell, G , and Obvecrona, T (1988) Tissue-specific regulation of gumea pig hpoprotem hpase, effects of nutritional state and of tumor necrosis factor on mRNA levels m adipose ttssue, heart and liver Gene 64,97-106.
I DL lmmunodetectlon
L,
5
6
7 8
9
10
11
12
13 14
1.5 16
237
Saffart, B , Ong, J. M , and Kern, P A (1992) Regulatton of adipose tissue ltpoprotern hpase gene expresston by thyroid hormone m rats J Lzpzd Res 33, 24 l-249 Doolntle, M H , Ben-Zeev, 0 , Elovson, J , Martin, D C , and Ktrchgessner, T G (1990) The response of hpoprotem lrpase m feeding and fastmg Evtdence of post-translattonal regulatton. J Brol Chem 265, 4570-4577 Goers, J W., Pedersen, M. E , Kern, P A , Ong, J , and Schotz, M C (1987) An enzyme-lmked tmmunoassay for ltpoprotem ltpase. Anal Blochem 166, 27-35 Peterson, J , FuJimoto, W Y , and Brunzell, J D (1992) Human ltpoprotem ltpase relattonshrp of acttvrty, heparm affimty, and conformatron as studted wtth monoclonal anttbodtes J Lzpzd Rex 33, 1165-l 170 Camps, L , Gbfvels, M , Rema, M , Walhn, C , Vllaro, S , and Olrvecrona, T (1990) Expression of ltpoprotem ltpase m ovaries of the guinea pig BIOI Repr od 42,9 17-927 Vrlaro, S , Ramtrez, I , Bengtsson-Oltvecrona, G , Oltvecrona, T , and Llobera, M (1988) Ltpoprotem ltpase in liver Release by heparm and tmmunocytochemlcal localtzatton Blochzm Bzophys Acta 959, 1O&l 17 Camps, L , Rema, M , Llobera, M , Bengtsson-Oltvecrona, G , Oltvecrona, T , and Vtlaro, S (1991) Ltpoprotem ltpase m lungs, spleen, and lrvet synthesis and drstrrbutton J Llpld Res 32, 1877-l 888. Dooltttle, M H , Martin, D C , Davis, R C , Reuben, M A, and Elovson, J (1991) A two-cycle tmmunoprectpttatton procedure for reducmg nonspectfic protem contamrnatton Anal Bzochem 195, 364-368 Ben-Zeev, 0 , Stahnke, G , LIU, G , Davts, R C , and Dooltttle, M H (1994) Ltpoprotem ltpase and hepatrc ltpase* The role of asparagme-linked glycosylatton in the expression of a functional enzyme. J Lzpzd Res 35, 15 1 l-l 523 Cooper, D A , Stem, J. C , Strteleman, P J , and Bensadoun, A (1989) Avtan adipose ltpoprotem ltpase* cDNA sequence and recrprocal regulatron of mRNA levels m adrpose and heart Brochlm Blophys Acta 1008, 92-101, Loeken, M R and Roth, T F (1983) Analysis of maternal IgG subpopulattons whrch are transported mto the chicken oocyte Immunology 49, 2 l-27 Harlow, E and Lane, D (1988) Antzbodzes A Laboratory Manual Cold Sprmg Harbor Laboratory, Cold Spring Harbor.
22 Immunological
Characterization of Digestive Lipases
Alain De Caro, Sofiane Bezzine, Vbronique Lopez, Mustapha Aoubala, Cdcile Daniel, Robert Verger, and Frbd&ic Carri&e 1. Introduction In humans, the dtgestton of dtetary trtacylglycerols is mediated by two mam enzymes, a gastrtc lipase which is secreted by the chief cells of the fundtc mucosa and which acts m the stomach as well as the intestine, and a pancreatic lipase which contributes to the lipid digestion only m the duodenum (Z-3) In order to overcome the mhibitory effect of bile-salts present in the mtestmal lumen, pancreatic hpase specifically requires the presence of a small pancreatic cofactor (colipase) which acts as an anchor for pancreatic lipase (4). Gastric and pancreatic hpases belong to two drstmct structural famihes and display very different btochemlcal and kinetic properttes. The pancreatic hpase family also includes lipoprotem hpase and hepattc hpase (S-7). The gastric hpase family, defined also as the actdx lipase family (8-169, mcludes lingual, pharyngeal and lysosomal hpases These lipases share no sequence homology with the pancreatic hpase family. Monoclonal antibodies are useful tools for the investigation of the physiological role and structural charactertsttcs of the human pancreatic (HPL) and gastric (HGL) hpases. In this chapter, we describe the production and use of anti-HGL and anti-HPL polyclonal (pAb) and monoclonal (mAbs) antibodies as probes for epitope mapping. We also describe the development of two sensitive and specific enzyme-linked tmmunosorbent assays(ELISA) for measuring HGL and HPL, respectively, in the duodenal contents where both enzymes are present (3).
From
Methods in Molecular Ebology, Vol 109 Lipase and Phosphollpase Protocols Edited by M H Doohttle and K Reue 0 Humana Press Inc , Totowa. NJ
239
240
De Caro et al,
2. Materials 2.1. Production
of mAbs to Human Gastric and Pancreatic
Lipases
1, Anttgens: Human gastrrc ltpase-HGL prepared from gastrtc Juice by the sequential use of Mono S (Sulfopropyl cation exchanger, Pharmacta) and Mono Q (Dtethyl ammoethyl anion exchanger, Pharmacta) chromatographies (11) Human pancreatic hpase- HPL prepared by chromatography on DEAE-cellulose amon-exchanger and CM-Sepharose cation-exchanger followed by gel filtration on Ultrogel AcA-54 (12) 2 Phosphate-buffered salute (PBS). 137 mMNaC1,2 7 mA4KCl,80 mMNa,HPO,, pH74 3 Freund’s complete adJuvant (ICN Biomedicals, Costa Mesa, CA) 4 Glass syrmges, I mL capacity 5 Nonsecretmg mouse myeloma cell lure P3 X63 Ag8 653 (Amertcan Type Culture Collectton, Rockvllle, MD) 6 Polyethylene glycol 1500 (Boehrmger Mannhelm, Indtanapolts, IN) 7 Hypoxanthme-ammopterm-thymidme (HAT) medmm (Life Sciences, Gatthersburg, MD) 8 Mrcrotiter tissue culture plates (I e , Falcon, Becton Dickenson, Frankhn Lakes, NJ) 9 Murme peritoneal feeder layers prepared as described (14).
2.2. ELfSA for Screening Anti-Lipase mAbs Unless statedotherwise, the buffers hstedbelow were used for all ELISA procedures Buffers were prepared and filtered through 0.22~pm M&pore filters 1 96-well mlcrotiter polyvinylchloride (PVC) plates (Maxtsorb, Nunc) 2 Coatmg buffer, PBS 3 Washing buffer. PBS containing bovine serum albumin (BSA) (5 g/L) and Tween 20 (0 5 g/L) 4 Saturating buffer PBS contammg BSA (5 g/L). 5 Pure native HGL (500 rig/well) for assay of anti-HGL mAbs, or pure anti-HPL pAb (500 rig/well) for assay of anti-HPL mAbs 6 Horse radish peroxidase (HRP)-conJugated anti-mouse unmunoglobulm (Sigma, St Louis, MO). 7 Peroxtdase substrate solution orthophenylene dtamtne (Sigma) (0 4 g/L) m 0 05 A4 sodium phosphate/citrate, pH 5 0, contammg fresh hydrogen peroxide (0 4%) 8 Stop solution* 0 5 M sulfuric acid 9 Automatic 96-well plate spectrophotometer (1 e , Dynatech MR 5000). 10 (Optional) Mouse mAb tsotypmg ktt (Amersham, Arlmgton Heights, IL)
2.3. Purification 1 2 3 4 5
of mAbs
Ascttes fluid from positive hybridomas (see Subheading 3.3.) Stainless steel filter holder and filters (AP 25 prefilters, Mtlltpore, Bedford, MA) 50% saturated ammonium sulfate Protein A-Sepharose CL-4B column, 16 x 110 mm (Pharmacta, Uppsala, Sweden) Column equilibration buffer 20 mM borate, pH 8 8, 2 5 MNaCl
Immune-Characterization of Lipases
247
6 Ab elutton buffer, 50 mMsodmm &rate, pH 4 5 (for IgG2b subclass Abs) or pH 5.0 (for IgG 1 subclass Abs) 7. Dtalysts buffer: PBS containing 0.02% sodmm aztde 8. Centriprep 30 concentrators (Amicon, Berverly, MA). 9 0 22-pm filters (Mtlhpore)
2.4. Preparation 1 2 3 4 5 6 7
8 9 10 11. 12
of Anti-HGL
and Anti-HPL pAbs
Native HGL or HPL, 1 mg/mjectton Freund’s complete adjuvant 0 1 MMes buffer, pH 6.5 Aft?-gel 10 and glass column, 1 5 x 3 5 cm (BtoRad, Hercules, CA) Rotary wheel for end-over-end rotation 0 5 M glycmamtde, pH 7 5 (Sigma) PBS. 0.2 Mglycme-HCl buffer at pH 2.2 and pH 2 4 50% saturated ammonmm sulfate. Trts-buffered salme (TBS)* 25 mA4 Trts-HCI, pH 7 4, 150 mM NaCl, prepared wtth and wtthout the addition of 0.2% Trnon X 100. 1 MTrts-HCI, pH 9 0 Amtcon ultrafiltratton cell with YM30 Dtaflo membrane
2.5. Epitope Mapping
of Native Lipases
1 2 3 4 5 6 7 8. 9. 10 11 12 13
Maternal for ELISA as listed in Subheading 2.2. mAbs to be tested Dialysis buffer for Fab preparations. 0.1 Msodmm bicarbonate, pH 8.0,2 mA4EDTA P-mercaptoethanol Papam solutton, 25 mg/mL (Sigma). 20 mM lodoacetamide 10 mM sodmm btcarbonate, pH 8 0 DEAE-Trtsacryl column (11 x 100 mm). Column equihbration buffer, 10 mA4 sodmm bicarbonate, pH 8 0. Centrtprep 30 concentrators (Amicon) 0 22-pm Milhpore filters PBS HPLC supplies System Gold chromatograph (or equivalent) with Spherogel TSK SW3000 column (7.5 x 600 mm) coupled to a TSK SW precolumn (7 5 x 7.5 mm) (Beckman Instruments, Fullerton, CA) 14 0.2 M sodmm phosphate buffer, pH 6 8. 15 Molecular size standards for HPLC ribonuclease, carbomc anhydrase, ovalbumm, serum albumin, alcohol dehydrogenase
2.6. Mapping Epitopes Along the Primary Structure of HGL and HPL 1 Purified HGL or HPL, sodtum NaCl.
1 mg/mL
m 60 mM sodium bicarbonate,
pH 8 8,
De Caro et al.
242
2 Proteolytic agents. TPCK-treated trypsm, TLCK-treated chymotrypsm, or cyanogen bromide (Sigma) 3 Protease inhtbttors: 4-(2-ammoethyl)-benzene sulfonyl fluoride (for trypttc cleavages, Pefabloc), or phenylmethyl sulfonyl fluoride (for chymotrypsm cleavages, Sigma) 4 Materials for SDS-PAGE and Western blotting 5 Nrtrocellulose membrane BA 83 type, 0 45 pm (Schleicher and Schuell, Keene, NH) 6 Ultrogel AcA-54 column (1 5 x 200 cm) 7 Speed-vat concentrator 8 70% performic acid (for cyanogen bromide cleavages)
2.7. Quantitative ELISA for Measuring Contents 2.7.7. Biotin-Labe/ing of rnAbs 1. 2 3 4 5
HGL and HPL in Duodenal
Ant{-HGL mAb or anti-HPL mAb mAb dialysis buffer 20 mM borate, pH 8 8, 150 mM NaCl a-ammo caproic N-hydroxysuccmimide ester D biotm, 10 mg/mL (Sigma) N,N-dtmethyl formamide. PBS
2.7 2 Double SandwIth ELISA 1 Captor Ab* anti-HGL pAb solution or anti-HPL pAb solution (5 yg/mL) 2 Standard solutions HGL-4) 6 to 36 ng/mL, or HPLg 3-10 ng/mL 3 Washing buffers. HGL ELISA-PBS containing 0 05% Tween 20, HPL ELISAPBS containing 0 05% Tween 20, 1 mA4phenylmethyl sulfonyl fluoride, and 2 mM benzamrdme (Sigma) 4 Saturating buffer PBS containing 3% skimmed dry milk. 5 Streptavldm-peroxidase (Sigma) 6 Peroxidase substrate and stop solutions (see Subheading 2.2.)
3. Methods 3.1. Production
of mAbs by Hybridoma
1 Prepare pure antigen as described (21,12) Suspend 100 l.rg antigen solution m 100 pL of PBS and emulsify with 100 PL of complete Freund’s adluvant 2 Immunize young female BALB/c mice (two per antigen) with 200 pL of the above mixture by subcutaneous inJection Perform a second inJection within 10 d of the first injection. 3 Two weeks after the second qection, bleed the mice and test the serum m a direct bmdmg ELISA assay (see Subheading 3.2.) 4 Select the mouse serum wtth the highest antibody titer, and inject subcutaneously 100 pg of pure antigen dissolved in 200 pL of PBS. 5 Ten days later, perform three fusion-primmg mtraperitoneal mJecttons of 50 pg of HGL or HPL m PBS at I-d Intervals.
243 6 The fuston of spleen cells from tmmumzed mice with a myeloma cell lme is performed by the procedure of Galfre et al. (13) and Kohler and M&em (24) The spleen is harvested one day after the final inJectton and a spleen cell suspension prepared by gently teasing the spleen while holding tt with a pair of forceps m a petri dish. 7 The resulting cell suspenston IS fused with non-secreting mouse myeloma P3 X63 Ag8 653 (14,15). Cell fuston is performed usmg polyethylene glycol 1500, follwed by seeding hybrtdomas into 6-well mtcrotiter tissue culture plates contaming murme peritoneal macrophages as a feeder layer. The hybrtdomas are grown in HAT selective medium. Ten days after the fusion, 180 pL of the culture supernatant is removed from each well to test the anti-hpase activity m a dtrectbinding ELISA (see Subheading 3.2.)
3.2. ELISA for Screening Anti-Lipase mAbs The screening of hybridoma supernatants is carried out by performmg sohd phase immune-assays using 96-well microtiter PVC plates. For screenmg anti-HGL mAbs, a simple sandwich ELISA is performed in which HGL is directly adsorbed to the PVC plate (16). For screening anti-HPL mAbs, a double sandwich ELBA is performed, m which HPL is mdirectly fixed through the pAb previously adsorbed to the PVC plate (17). For screening antt-HGL mAbs, coat the PVC plate with 500 ng of pure native HGL per well, m 50 l.tL coating buffer. Incubate overmght at 4°C For screening anti-HPL mAbs, coat the PVC plate with 500 ng of pure anti-HPL pAb (captor antibody) per well. Saturate the remammg free sites with saturating buffer (200 ltL per well) for 2 h at room temperature Add HPL (500 ng per well) to the PVC-pAb coated plate and incubate I h at 37’C (see Note 1) Rinse plate three times with washmg buffer For both HGL and HPL ELISAs, add hybrtdoma supernatants (50 uL) to each well and incubate for 1 h at room temperature. Rmse three ttmes m washing buffer. Incubate 1 h at room temperature in horseradish peroxldase (HRP)-comugated antimouse mununoglobulm diluted 1. 10,000. Rinse three ttmes m washing buffer, Detect mAb producing hybrtdomas with addition of the peroxidase substrate solution and mcubatton at room temperature for 10-20 mm Stop the reaction with the addition of 0.5 M sulfuric actd solution (50 pL per well) Measure the optical density (OD) at 492 nm usmg an automatic 96-well plate spectrophotometer. The antibody class of the various anti-hpase mAbs may be determined using a mouse mAb tsotypmg kit according to the manufacturer’s mstructtons, with serial dtluttons of culture supernatants of each clone
In our studies, seven anti-HGL mAbs (4-3, 1342,25-4,35-2, 53-27, 8315, and 218-13) were selected and found to react m the simple sandwich ELISA. These mAbs showed different binding properties with HGL adsorbed on a PVC plate (16). Four anti-HPL mAbs (81-23, 146-40,315-25, and 320-
De Car0 et al.
244
24) were found to react m the sample sandwich ELISA, while mAb 248-3 1 did not (17) However, all five antibodies interacted with HPL m the double sandwich ELISA. These results can be explained by the fact that the epttope recognized by mAb 248-3 1 1s located m a hydrophobic regton m contact wtth the PVC plate and therefore not accesstble to the antibody. An alternattve explanation might be that a conformattonal change (denaturatlon) may have occurred during HPL adsorptton to the PVC plate, resulting m the loss of the recogmtton site. In the case of proteins wtth functtonal hydrophobic regtons, such as lrpolyttc enzymes, the double sandwich ELISA mvolvmg specific pAbs adsorbed on PVC plates as the first layer therefore ytelds randomly oriented antlgemc regions which optimize the second antibody recogmtion. As determined using a mAb rsotypmg kit, all mAbs tested m our studtes belong to the IgG 1 class wtth a K light chain except the anti-HGL mAb 13-42 and the anttHPL mAb 248-3 1 which are of the IgG2b tsotype.
3.3. Purification
of mAbs
Postttve hybrtdomas are cloned usmg the ltmttmg dtlutton technique. For ascttes productton, 2.5 x lo6 hybrtdoma cells are injected mtraperttoneally to BALB/c mice The mAbs are purtfied from mouse ascetic flutds according to the followmg procedure Filter the ascite fluid using a Milhpore prefilters
Precipitate with 50% saturated ammonium
stamless steel filter holder with AP 25
sulfate
Equilibrate the Protem A-Sepharose CL4B column (16 x 110 mm) with 20 mM borate buffer, pH 8 8, contammg 2 5 M sodium chloride Apply the protein solution to the column at a flow rate of 15 mL/h at room temperature and extensrvely wash the column wrth the same buffer Elute the antibodies at a flow rate of 120 mL/h with 50 mA4sodmm citrate, pH 4 5 or 5 0 for anttbodies of the IgG2b or IgGl subclasses, respectively. Monitor the absorbance at 280 nm Dialyze the fractions contammg the antrbodres agamst PBS contaming 0 02% sodium azrde Concentrate to 4 mg/mL using Centriprep 30 concentrators (Amicon), filter through 0 22-urn M&pore filters, and store at -20°C m small ahquots (see Note 2). For subsequent runs, regenerate the column wrth three column volumes of 20 mM sodium citrate, pH 3 0, and then re-equrhbrate the column wtth the startmg buffer.
3.4. Preparation
and Purification
of Anti-HGL and Anti-HPL pAbs
1. Immunize rabbits with native HGL or HPL accordmg to the followmg protocol On day 0, mlect subcutaneously 1 mg of antigen m 0 5 mL Freund’s complete adJuvant Three weeks later, perform mtramuscular mlectrons into the footpads every 10 d for 1 mo using 1 mg of antrgen m 0 5 mL Freund’s incomplete adlu-
Immuno-Characterization
2
3 4 5
6 7 8 9 10
11
of Llpases
245
vant A final mjectton IS gtven mtravenously m the ear one week before the sacrtfice of animals and contams 0 5 mg antigen m PBS. One week after each booster tnJectton, test the sera for antt-hpase reacttvtttes by performmg ELISA (Subheading 3.2.) and tmmunoblottmg assays The rabbit ant+hpase pAb IS purtfied using a column of the approprtate tmmobtlazed hpase. MIX about 16 mg of pure ltpase m 0.1 M Mes buffer, pH 6.5, wtth 7 mL of swollen Affi-Gel 10 equthbrated m the same buffer Rotate the mixture u-t a stoppered vessel end-over-end for 4 h at 4°C Centrtfugc at 2000g for 10 min and ehmmate the supernatant Saturate any remammg active groups wtth a solutton of 0 5 A4 glycmamtde (pH 7 5) Let tt stand for 4 h Transfer the gel mto a glass column (1 5 x 3 5 cm) and wash successively with 50 mL of PBS, 50 mL of 0 2 M glycme-HCI buffer (pH 2 2), and finally with 100 mL of PBS (see Note 3) To purify specific anti-ltpase pAb, precipitate sera with 50% saturated ammomum sulfate Centrifuge at 1OOOOgfor 30 min, and solubtltze the pellet m TBS Dialyze the protem solutton against the same buffer Apply the solutton on the mrmobthzed-HGL column, previously eqmhbrated with TBS Incubate under rotattve agttation (18 runs per mm) during 4 h at 4°C Wash the column successtvely wtth TBS, with 25 mM Trts-HCI, pH 7 4, contaming 0 5 MNaCl and 0 2 % Trtton X 100, and then again wtth the mtttal TBS until zero absorbance at 280 nm IS reached Elute the pAb (1 .O-mL fractions) wtth 0 2 M glycme-HCl, pH 2 4, at 4°C and at a flow rate of 25 mL/h Immediately neutralize each fractton with 200 yL of 1 M Trts-HCl, pH 9 0 Monitor absorbance at 280 nm Pool the fractions contammg antibodies, dialyze against PBS, and concentrate to about 3 mg/mL on an Amtcon ultrafiltration cell using YM 30 Dtaflo membrane Store the purified anttbodtes at -20°C m small altquots (see Note 2).
3.5. Epitope Mapping Epitope mapping
of Native Lipases
studies with native ltpases using two different methods are
described. With the first method (detailed m Subheading 3.5.1.), the ability of various mAbs to recognize different epnopes on the enzyme is determined usmg the ELBA double-antibody bmdmg test (ELISA additwity test) imtially developed by Friguet et al.( 18). With the second method (detailed m Subheading 3.5.2.), the antigen spectticity of antilipase mAbs is studied by competitive bmdmg
of Fab fragments to the ltpase and by analysis of Fab-lrpase complexes
usmg gel filtration HPLC as described by Rugam (19). 3.5 1. ELISA Double-Antibody
Binding Test
1 Titrate each mAb by performing a dtrect ELISA m whtch mcreasmg amounts of each mAb (0.125 to 2 pg per well) are incubated with a fixed amount of ltpase (2 to 5 ng per well) previously coated on the microplate Perform the ELISA
246
De Caro et al.
expertments as described in Subheading 3.2. for the screening of mAbs Establish a tttratton curve for each mAb, the mAb concentratton which gtves the maximal signal corresponds to the saturatton of all the accessible epitopes Use this mAb concentratton for the cotttratton of the mAbs m pans 2 Mix two specific mAbs at a molar ratio of 1 1 prior to the mcubation with ltpase adsorbed to the PVC plate Perform all possible pairs of mAbs 3 F111the wells of mtcrottter plates by addmg 50 pL of the mAb mixtures Express the competttton between anttbodies for the antrgen by means of the additivny indexes AI (28) which characterizes each pan of specific antibodies, usmg the formula AI = 100 (2 -- A,+2 AI +A2
1)
where A1+2 is the absorbance obtained in the ELISA with the mixture of two mAbs, and A, and A2 are the absorbances obtamed with each single mAb, respectively This mdex (expressed as a percentage) makes it possible to evaluate the simultaneous bmdmg of two mAbs to the antigen (see Note 4)
We have used this method to characterize anti-HGL mAbs We found that the anti-HGL mAbs (4-3, 25-4, 35-2, and 83-15) recognize overlapping epitopes belonging to the same antigemc region of the native enzyme (16), whereas the epitope of mAb 2 18-13 is located m the 3-D structure close to this antigemc region. For HPL, the mAbs can be classified mto two groups of antibodies directed against two different antigenic determinants: group I mcludes three mAbs (81-23,3 15-25, and 320-24) and group II consists of mAb 146 40 (17). Since mAb 248-31 did not react in a simple ELISA with adsorbed HPL, it was not possible to localize its epitope by thustechnique. 3.5.2. Characterization of Llpase-Fab Complexes Using Gel Ftltratlon HPLC 3.5 2 1, PREPARATION OF FAB FRAGMENTS Anti-HPL fragment antigen binding (Fab) are prepared from each mAb as described by de La Fourmere (20). 1 Dialyze the antibodies (l-10 mg/mL) against 0.1 M sodium bicarbonate, pH 8 0, containing 2 mM EDTA overnight 2 Add D-mercaptoethanol (final concentatton 10 mM) to the protein solution and leave for 20 mm at 37°C 3 Dilute papam solution (25 mg/mL) 1O-fold with 0.1 A4 sodium bicarbonate, pH 8 0, containing 2 mMEDTA and 10 mA4l3-mercaptoethanol Leave for 20 mm at 37°C 4 Incubate immunoglobulms with papain (the enzyme to protein ratio 1s 1.100, w/w) for 4 h at 37°C under mild agitation in a nitrogen atmosphere 5 Stop the proteolysis by adding iodoacetamide at a final concentration of 20 mM Leave the mixture to react for 1 h at 4°C under mild agitation and mtrogen
Immune-Characterization of Lipases
247
6. Dialyze the protein solution agamst 10 mM sodmm bicarbonate, pH 8.0 7. Equdlbrate a DEAE-Trisacryl column (11 x 100 mm) m 10 mM sodmm blcarbonate, pH 8 0 Apply the proteolysls mixture to the column at a flow rate of 20 mL/h, and collect fractions of 1.0 mL contammg the Fab fragments which pass through the column. Concentrate to 2 mg/mL using Centrlprep 30 concentrators and pass through 0.22 pm Milhpore filters
3.5.2.2. ANALYSIS OF FAB-HPL COMPLEXES USING GEL FILTRATION HPLC 1 Form Fab-HPL binary complexes by incubating HPL and Fab in a 1 1 molar ratlo for 1 h at 37°C In PBS. Form Fab-HPL ternary complexes by mixing HPL with pairs of Fab (HPL/Fabl/Fab2 molar ratio*l/l/l). 2. Analyse the bmary and ternary complexes by performmg gel filtration HPLC with a Beckman System Gold chromatograph (or equivalent apparatus) Equilibrate a Beckman Spherogel TSK SW 3000 column (7.5 x 600 mm) coupled to a Beckman TSK SW precolumn (7 5 x 7 5 mm) with 0.2 M sodium phosphate buffer, pH 6.8. 3 Apply the samples of the binary complex Fab-HPL mixture (0 1 nmol/O 1 nmol) and ternary complex (Fab l/HPL/Fab2) mixture (0.1 nmol/O. 1 nmol/O 1 nmol) 4 Perform the protem elutlon with the same buffer at a flow rate of 1 mL/mm, under a pressure of 0.6 kPS1 Monitor absorbance at 230 nm. The chromatographic behavlour of each protein component 1s characterized by its retention time, measured at the mflexion point of the ascendmg part of the elutlon peak and expressed m mm. The column is calibrated with a mixture of 11 6 nmoles of ribonuclease, 6 45 nmoles of carbonic anhydrase, 4 4 nmoles of ovalbumm, 2.2 nmoles of serum albumin and 1 nmole of alcohol dehydrogenase, m 100 pL of the same phosphate buffer. 5 From the comparison of the retention times of the Fab fragments and the Fabantigen complexes it 1spossible to assessthe molecular size of the Fab-antigen complexes formed To normalize the results of the gel filtration chromatography, a new addltlvlty index (AI,) has been defined for a pair of Fabs as follows AI, = T1 -Tx T1
x 100
-T2
T, 1s the retention time for a given pan- of Fabs, T2 is the mmlmal retention time of a ternary complex (HPL and two Fabs) and T, IS the maximal retention time of a binary complex (HPL and one Fab). If the two Fabs bmd to the same sate, T, will be equal to T1 and AI, will be equal to zero. If, on the contrary, the two Fabs bmd independently at separate sites, T, will be equal to Tz and AI, will be equal to 100% (see Note 5).
3.6. Mapping of Epitopes Along the Primary Sequence of HGL and HPL Epitope mapping may also be performed using the peptide mappmg method described by Wilson and Smith (21). Briefly, HGL and HPL are subjected to
248
De Caro et al
limited proteolysts wtth trypsm (22) and chymotrypsm (23), respectively. The products are separated by SDS-PAGE and electrophorettcally transferred onto mtrocellulose or glassybond membranes for Western blotting and N-terminal ammo acid sequence analysis, respectively.
3.6.1. Epitope Mapping of HGL Fragments Resulting from a Tryptic Cleavage 1 Incubate HGL (lmg/mL) in 60 mM sodium bicarbonate, pH 8 8, containing 80 mA4 NaCl with TPCK-treated trypsin at a final concentration of 4% (w/w) for 3 h at 25°C 2 Stop the proteolysis by adding 4-(2-ammoethyl)-benzene sulfonyl fluorrde, a specific serme protease inhibitor, at a final concentration of 1 mM 3 Resolve tryptic fragments by SDS-PAGE and transfer to nitrocellulose membrane using standard protocols 4 Perform immunoblot experiments with anti-HGL mAbs using standard methods to determine eprtopes recognized by specific mAbs (see Note 6)
3.6.2. Epitope Mapping of Recombinant HPL Mutants The use of recombmant mutant hpase molecules has been helpful m the charactertzatton of the immunoreacttvity of specttic mAbs toward specific structural domarns. For example, we have studied the nnrnunoreactivity of anttHPL mAbs towards HPL structural domains using three mutants: N-HPL, HPL(-lid) and a N-GPLRP2/C-HPL chimera, produced by msect cells using the baculovn-us expression system (24) N-HPL (Bezzme, S et al., manuscript m preparation) consists of the N-termmal domain of HPL (Lys’-Phe335) HPL (-lid) has the GPLRP2 mini-lid of 5 amino acid residues, instead of 23 residues in classical HPL, and the chimera is made of the N-terminal domain of the gumea pig pancreatic hpase related protein 2 (GPLRP2) and the C-termmal domain of HPL (24). Western blot analysis of these different mutants showed that none of the four mAbs (81-23, 14&40, 315-25, and 32&24) cross-reacted with GPLRP2, which shares 64% ammo acid identity with HPL On the other hand, the 81-23, 31525, and 32&24 mAbs recognized the N-GPLRP2/C-HPL chnnera but not N-HPL. We deduced that these three mAbs are directed against the C-terminal domain of HPL. The 14MO mAb recognized N-HPL and HPL(-lid), but no reactivity was observed with the N-GPLRP2/CHPL chimera. These results allowed us to conclude that the epttope recognized by the 146-40 mAb 1s located within the N-termmal domam of HPL, but not within the hd domam (Cy~*~~-Cys~~‘).
3.6.3. Epltope Mappmg of HPL Fragments Resulting from a Chymotryp tic Cleavage To confirm the above hypothesis, epttope mapping of HPL was also carried out by producing the C-terminal domain by chymotrypttc cleavage at the Phe 335-Ala 336
Immune-Characterization
of Llpases
249
peptlde bond (23). A more precise localization of the antlgenic region of the three mAbs (8 l-23,3 15-25, and 320-24) was performed after cyanogen bromide cleavage of the C-terminal domain, which contains a single methlonme residue (Met 3g7). The preparation and the cyanogen bromide cleavage of the C-termmal domain were performed according to the followmg procedure. 1 Incubate HPL ( lmg/mL) in 60 mMammomum
bicarbonate buffer, pH 8.5, with TLCK-treated chymotrypsm (enzyme/substrate, 1.100, w/w) for 18 h at 25°C. Stop the proteolysls by adding phenylmethylsulfonyl fluoride (PMSF), at a final concentration of 2 r&t (23). 2 Equilibrate an Ultrogel AcA-54 column (1 5 x 200 cm) with the same buffer. Load the proteolytlc mixture and collect the fractions (1 5 mL) at a flow rate of 12 mL/h Concentrate the eluate contaming only the C-termmal domam ( 14 kDa) using a Speed-Vat concentrator. 3 Incubate the C-terminal domain (5-l 0 nmol) m 70% perfornuc acid with 180fold molar excess of cyanogen bromide for 24 h at room temperature Stop the reaction m 5 volumes of cold water and freeze-dry using a Speed-Vat concentrator 4 Analyze the resultmg peptldes on 10% Tns-Tncme polyacrylamlde gel using the Schtigger and von Jagow’s procedure (25)
When HPL was submitted to chymotryptlc cleavage, we observed a posrtrve reactivity of these three mAbs with the purified C-terminal domain We can now confirm that epitopes recognized by mAbs 81-23, 315-25, and 320-24 are located m the C-terminal domain (Ala336-Cys44g)(Fig. 1B) The two fragments (7 and 4 kDa estimated by SDS/PAGE) generated by cyanogen bromide cleavage of the C-terminal domain did not immunoreact with the three mAbs. Theseresults indicate that the cleavage of the Met 397-Val3g8 bond induces the loss of nnmunoreactivity. It appears that the epltope recognized by the 8 l-23,3 15-25, and 320-24 mAbs is located around Met3g7in the C-terminal domain (Fig. 1B). 3.7. Quantitative ELBA for Measuring in Duodenal Con tents 3.7.1. Biotin-Labeling of mAbs
HGL and HPL
Blotm labeling of mAbs IS performed using a modification of the procedure previously described by Guesdon et al. (27). 1 Dialyze solutions of mAbs overnight at 4OC against 20 mM borate buffer, pH 8 8, containing 150 nul4 NaCl 2 Prepare a solution of e-ammo caprolc N-hydroxysuccmlmide ester D blotin (10 mg/mL) m N, N-dlmethylformamlde Add 6 PL of this solution to a mAb solutlon (1 mg/mL) correspondmg to 5.8% (w/w) of blotm.
De Caro et al
250 A 4-3/25-4/35-2/83-15ll3.42
I4
IO
53-27/218-13
55
61
227
236
244
77')
B 146-40 h
I
81-23/315-251320.24 I ,
\
P
P
ChTl
I
5
221
7
ChTl
212
315
CNBr
340
787
402
440
Fig 1. (A) Schematic representation of the prtmary sequence of HGL adapted from Bodmer et al (28) showing the tryptic cleavage sites (T1)(22) Two anttgemc regions (N and C terminal) are defined based on the second tryptic cleavage site and are shown as white and shaded bars, respectively. (B) Diagram of the primary sequence of HPL adapted from Wmkler et al (29) The arrows show the chymotryptic cleavage sites (ChT)(I7). The N-terminal domain (white bar) as well as the C-termmal domam (shaded bar) are indicated In both representations, ammo acid sequences, determined using the Edman degradation technique, are indicated m boldface letters and those deduced from the cDNA sequence are indicated m italic letters Brackets and boldtype numbers above the protein representation have been used to Indicate the mAbs that recognize the correspondmg fragments. 3 Incubate the reaction mixture m the dark, at room temperature for 20 mm with stirring 4 Stop the reaction by adding ammonium chlortde to a final concentration of 0.1 A4 Immediately dialyze at 4’C against PBS Distribute ahquots of mAbbtotin conjugate (25 pL) into Eppendorf tubes and store at -20°C. 5 Check the capacity of biotmylated mAb to immunoreact with HGL using a simple sandwich ELISA with native HGL directly coated to the wells of the PVC microplates In our hands, no decrease m the antigen bmdmg capacity of antiHGL mAb has been observed as a result of biotm conmgation.
immune-Charactenzatlon
of Lipases
251
All posstble combmattonsof anti-HGL pAb with our five mAbs have been tested m a double sandwich ELISA (26). The most sensitive ELISA, able to detect HGL concentrations down to 1 ng/mL, was made of pAb as the captor antibody (coating antibody) coupled wtth the mAb 35-2 as the detector antibody (antibody-brotm conjugate). Since HGL concentrations in duodenal contents are m the range 10 to 100 pg/mL (3), the senstttvtty of the above ELISA is well adapted for the quantitation of HGL form this source, as described m Subheading 3.7.2. 3.7 2
1 DOUBLE SANDWICH ELBA
PROCEDURE FOR HGL
A double sandwich ELISA similar to that described m Section 3.2 for the screening of mAbs was performed to measure the HGL m duodenal contents (26) For this assay, pAb is used as captor Ab, and mAb-btotin conjugate is used as the detector antibody. 1 Fill each well with 50 uL of anti-HGL pAb solution at 5 pg/mL (250 ngiwell) 2 Rinse twtce wrth washing buffer (PBS contatnmg 0 05% Tween 20) 3 Fill each well wtth 200 pL of saturating buffer (PBS contammg 3% (w/v) skimmed dry milk) Incubate at 37°C for 2 h 4 Wash three times for 5 mm with washing buffer. 5 Fill each well wrth 50 PL of standard solutton of HGL (0.636 ng/mL) or samples from human duodenal contents, diluted as much as l/900, l/l 800, l/2700, l/8100, and l/16200 with the washing buffer Wells contammg buffer wtthout HGL or duodenal contents serve as controls. For each dtlutton, two wells are filled with 50 yL of the diluted samples The same procedure is followed wtth the diluted reference solution of HGL Keep at 37’C for 1 h 6. Wash three ttmes for 5 mm with washing buffer 7 Fill each well wrth 50 PL of brotmylated mAb at 2 5 pg/mL (125 rig/well) Keep at 37°C for 1 h 8. Wash three trmes for 5 mm wtth washing buffer 9. Fill each well with 50 pL of streptavtdm peroxtdase diluted wtth washing buffer at l/1000. Incubate at 37’C for 45 mm 10 Wash three times for 5 mm with washing buffer 11 Fill each well with 50 uL of the peroxidase substrate solution Incubate in the dark at room temperature for 15 min. 12 Stop the reaction by adding 50 uL of 0 5 MH,SO, and read tmmedtatly the optrcal density at 492 nm A typical reference curve is presented m Fig. 2A
The reproductbility of the HGL ELISA as well as the possible mterfetence with duodenal components has been studied by performing two sets of expertments using either known amounts of HGL in the washing buffer, or known amounts of HGL m a complete hqutd test meal (Shak Iso, Sopharga Laboratories, France) The stmilartty between the two titration curves suggests that, even m the presence of large amounts of nutrients, there 1sno dtfference m the tmmunoreacttvtty of the selected pan of antibodies.
252
De Car0 et al
03
HGL ( ng . mL’ ’ )
1,2--
~7 -
O&iJJ5#3+
0.19767X
-7.67
10JXz
.
I-
O& O&
HPL ( ng . rnK ’ )
Fig 2 Reference curves of ELISA performed with purified HGL (A) and purified HPL (B) assayedas desmbed in Subheading 3.7.2. R correlation coefkent
Known amounts of pure HGL were also added to asplrates from duodenal contents(containing some endogenousHGL), andthe HGL levels measuredby ELISA ranged between 84 and 110% of the added amounts (26). The good correlation between expected and measured concentrations of duodenal HGL indicates that duodenal components, such as bile salts,do not Interfere with the unmunoassay.
Immuno-Characterizatron
of Lipases
253
Finally, the HGL values determined by means of the ELISA and the enzymatic test, usmg standard pH stat titration (3), show the existence of a good correlation (Y = 0 95) between these two independent determmations (26) 3 7 2.2 QUANTITATIVE ELISA FOR MEASURING HPL IN DUODENAL CONTENTS
A stmtlar double sandwich ELISA was set up for measuring the HPL levels m duodenal contents, wtth minor changes as described below. 1 Fill each well with 50 uL of anti-HPL pAb at 5 pg/mL (250 rig/well) 2 After saturation and washing, add 50 pL of standard HPL sol&tons (rangmg from 0 3 to 10 ng/mL) or samples from human duodenal contents, dtluted as much as l/36,000, l/108,000, l/216,000, 11432,000 with the washmg buffer contammg 1mM phenylmethyl sulfonyl fluortde and 2 mA4 benzamtdme The two serene protease inhibttors are added to prevent degradatton of pAb adsorbed to the PVC plate by pancreatic proteases 3 F111each well with 50 pL of anti-HPL mAb 14640 btotm conlugate (detector antibody) at 0 25 pg/mL (12.5 rig/well) 4 Wash and develop as described for the HGL assay m Subheading 3.7.2.1.
A typical reference curve IS presented m Fig. 2B. It is advisable to mclude a reference curve on each plate for higher accuracy Smce the HPL levels m the duodenal contents are m the order of 300 ug/mL, the successive dilutions of the duodenal samples must be performed carefully Moreover, the duodenal samples collected in viva are usually viscous and it is recommended that they be weighed before dilution m the presence of protease mhibitors Known amounts of pure HPL have been addedto aspiratesfrom duodenal contents(contaming some endogenousHPL), and the HPL levels measured by ELISA ranged between 90 and 115% of the added amounts. The good correlation between expected and measured concentrations of duodenal HPL indicates that duodenal components, such as bile salts,do not interfered with the immunoassay. In conclusion, we have developed two sensitive ELISA for measurmg HGL and HPL levels m duodenal contents during a test meal. These measurements are complementary to those performed by enzymatic methods, using the pH stat titration technique. A compartson of the methods reveals that higher values are sometimes achieved with the ELISA, most likely resultmg from the fact that the lipases are Inhibited or partly inactivated m duodenal samples although stall immunoreactive. 4. Notes 1. Unltke the simple sandwtch ELISA, the use of pAb m a double sandwrch ELBA results m the random ortentation of the various epttoptc regions of HPL 2 At this pomt, tt IS possible to check the purity of the IgG preparattons by SDS/ polyacrylamtde gel electrophoresrs (7.5%)
254
De Cam et al.
3 More than 90% of the initial amount of HGL becomes covalently coupled to the gel 4 According to Frtguet et al. (18), if the two mAbs have the same spectficity and bmd randomly at the same anttgemc sate, Ai+* will be equal to the mean value of A, and A,, and then AI will be equal to zero (competitive bmdmg) Conversely, if the two mAbs bind independently at two different antigemc sites (additive bmdmg), A1+2 will be equal to the sum of A, and A, and then, AI will be equal to 100. Values of AI rangmg from zero to 100 will indicate that the two mAbs bmd to closely associated overlapping epitopes (partially additive bmdmg). 5 Using this new index, we have confirmed the previous classification of four mAbs mto two groups (I and II) based on the ELISA addmvity test of Frtguet et al (28). Group I includes three mAbs (81-23,3 15-25, and 320-24) and group II consists of mAb 146-40 Furthermore, tt was possible to identify mAb 2483 1 as constitutmg a distmct group (III), since it forms ternary complexes with HPL and Fabs belonging to either group I (mAbs 8 l-23,3 15-25, and 320-24) or group II (mAb 146-40). 6. The results of the immunoblottmg experiments carried out with trypttc HGL fragments showed that our anti-HGL mAbs can be divided mto two groups (22) The first group comprises five mAbs (4-3, 13-42, 25-4, 35-2, and 83-15) which recognized only the epitopes located m the N-terminal end of HGL The second group contains two mAbs (53-27 and 2 18-I 3) which immunoreacted only with the C-terminal end of HGL (Figure 1A) From ELISA additivity test and immunoblottmg data, it appears that two anttgemc regions of the HGL located respectively m the N and C terminal ends are relatively near m the 3D structure of the enzyme.
Acknowledgments We are grateful to Professor Michel Hirn for his help tn rarsmg ant+HGL and anti-HPL mAbs and for fiuttful discussions This work was supported by the BRIDGE-T-Lipase Program of the European Commumttes under Contract BIOT-CT 9 10274 (DTEE) and by BIOTECH G-Program BIO 2-CT94-304 1.
References 1 Gargouri, Y , Moreau, H , and Verger, R (1989) Gastric lipases biochemical and phystologtcal studies Brochzm Bzophys Acta 1006, 255-271 2. Hamosh, M (1990) Lingual and gastric lipases Their role in fat digestion (Hamosh, M , ed.), CRC, Boca Raton, pp. 127-177 3. Cart&e, F , Barrowman, J A , Verger, R , and Laugier, R (1993) Secretion and contributton to hpolysis of gastric and pancreatic ltpases during a test meal m humans Gastroentevology 105, 876-888 4. Erlanson-Albertsson, C. (1992) Pancreatic colipase. Structural and physiological aspects Bzochzm Bzophys Acta 1125, l-7 5 Petersen, S. B and Drablos, F (1994)m Lipases. Their biochemistry, structure and application (Woolley, P and Petersen, S. eds.), Cambridge Umversity Press, England, pp 23-48
lmmuno-Characterizatron
of Lipases
255
6 van Ttlbeurgh, H , Roussel, A , Lalouel, J -M , and Cambdlau, C (1994) Llpoprotem lipase Molecular model based on the pancreatic hpase X-ray structure consequences for heparm binding and catalysts. J Blol Chem 269,462&4633. 7. Carriere, F., Verger, R , Lookene, A., and Oltvecrona, G. (1995) zn Interface between Chemistry and Btochemtstry. Ltpase structures at the interface between chemistry and biochemistry (Jollbs, P. and Jornvall, H., eds ), Btrkhauser Verlag Basel, Switzerland, pp. 3-26 8 Anderson, R A and Sando, G. N. (1991) Clonmg and expression of cDNA encoding human lysosomal acid ltpase/cholesteryl ester hydrolase J Blol Chem 266, 22,479-22,484 9. Amets, D , Merkel, M., Eckerskorn, C , and Greten, H (1994) Purification, charactertzatton and molecular clomng of human hepatlc lysosomal actd ltpase Eur J Bzochem 219,905-914 10. Carriere, F., Gargourt, Y., Moreau, H , Ransac, S., Rogalska, E., and Verger, R (1994) in Ltpases: Then structure, biochemistry and appltcatton. (Wooley, P and Petersen, S B , eds ), Cambridge University Press, Cambrtdge, England, pp. 181-205 11 Moreau, H., Abergel, C , Carribre, F., Ferrato, F., Fontectlla-Camps, JC , Cambillau, C , and Verger, R. (1992) Isoform purtficatton of gastrtc ltpases towards crystallizatton J. A401 B~ol 225, 147-153 12. De Caro, A, Ftgarella, C., Amtc, J., Mtchel, R, and Guy, 0. (1977) Human pancreatic ltpase* a glycoprotein Blochlm Blophys Acta 490, 4 1l-4 19 13. Galfre, G , Howe, S C , Milstem, C., Butcher, G. W , and Howard, J C (1977) Antibodies to maJor histocompattbility antigens produced by hybrid cell lmes Nature 266, 550-552 14 Kohler, G and Mtlstein, G. (1975) Contmuous cultures of fused cells secretmg antibody of predefined specificity Nature 256,495497 15 Kearney, J. F , Radbruch, A , Ltesegang, B., and Rajewkt, K. (1979) A new mouse myeloma cell lme that has lost unmunoglobulm expression but permns the construction of antibody-secretmg hybrid cell 1lnes.J Zmmunol 123, 1548-l 550 16 Aoubala, A , Daniel, C , De Caro, A , Ivanova, M. G., Hirn, M., Sarda, L , and Verger, R. (1993) Epttope mapping and immunomacttvatlon of human gastric ltpase using five monoclonal anttbodies.Eur J Biochem 211, 99-104 17 Aoubala, M , de la Fourmere, L , Douchet, I., Abousalham, A , Damel, C., Hun, M , Gargourt, Y , Verger, R., and De Caro, A (1995) Human pancreatic lipase. importance of the hinge region between the two domains, as revealed by monoclonal antibodies J Biol Chem 270, 3932-3937. 18 Fnguet, B , Chaffotte, A F , DJavadr-Ohamance, L , and Goldberg, M E ( 1985) Measurements of the true affimty constant m solution of anttgen-antibody complexes by enzyme-linked immunosorbent assay J Immunol Meth 77,305-3 19 19 Rugam, N., Dezan, C., Bellon, B , and Sarda, L. (1991) Antigen spectfictty of anticoltpase monoclonal antibodies characterization of colipase-Fab complexes using gel filtration high-performance liquid chromatography. Blochem Blophys Res Comm 177,126-733.
De Caro et al.
256
20 de La Fourn&e, L , Bose-Bierne, I , Bellon, B , and Sarda, L. (1989) Inhlbltory properties and antlgemc speclflclty of monoclonal antibodies to pancreatic cohpase Bzochlm Bzophys Acta 998, 158-166 2 1 Wilson, J. E and Smith, A. D. (1985) Monoclonal antibodIes against rat brain hexokmase Utlllzatlon m epltope mapping studies and estabhshment of structure-function relatlonshlps J Bzol Chem 260, 12,838-12,843 22 Aoubala, A , Bomcel, J , B&court, C , Verger, R , and De Caro, A (1994) Tryptic cleavage of gastric hpases location of the smgle dlsulfide bridge. Bzochzm Bzophys Acta 1213, 319-324 23 Bousset-Risso, M., Bonicel, J , and Rovery,M (1985) LImited proteolysls of porcme pancreatic hpase Lab&y of the Phe 335-Ala 336 bond towards chymotrypsm Febs Lett.182, 323-326. 24 Camkre, F , Thlrstrup, K , HJorth, S , Ferrato, F , Nielsen, P , Withers-Martmez, C , Camblllau, C , Boel, E , Them, L , and Verger, R (1997) Pancreatic llpase stucture-function relationships by domain exchange Bzochemzstry 36, 239-248 25 Schagger, H., and von Jagow, G. (1987) Tncme-sodium dodecyl sulfate-polyacrylamlde gel electrophoresls for the separation of protems m the range from 1 to 100 kDa. Anal Blochem 166,368-379. 26 Aoubala, M , Douchet, I, Laugler, R , Hirn, M , Verger, R , and De Caro, A (1993) Purification of human gastric llpase by mununoaffimty and quantlficatlon of this enzyme m the duodenal contents using a new ELISA procedure. Bzochzm Bzophys Acta 1169, 183-188 27 Guesdon, J L , TCrnynck, T., and Avrameas, S (1979) The use of avldm-blotm interaction in untnunoenzymatic techniques J Hzstoch Cytochem 8, 113 l-l 139 28 Bodmer, M W , Angal, S., Yarranton, G T , Hams, T J R , Lyons, A , King, D J , Pltrom, G , RlvlBre, C , Verger, R., and Lowe, P A (1987) Molecular clonmg of a human gastric hpase and expression of the enzyme m yeast Bzochzm Blophys
Acta 909,237-244 29 Winkler, F K , d’Arcy, A , and Hunzlker, atic lipase Mature 343, 771-774
W. (1990) Structure of human pancre-
23 Determining Lipase Subunit Structure by Sucrose Gradient Centrifugation Osnat Ben-Zeev
and Mark H. Doolittle
1. Introduction The llpase gene family comprises three vertebrate genes, lipoprotein lipase (LPL), hepatic lipase (HL) and pancreatic llpase (PL), that are derived from a common ancestral gene While these lipases are functionally related, considerable evidence indicates that LPL and HL share a higher degree of structural homology than either shares with PL (1-4). For example, it has been established by a number of different methods that LPL and HL are functionally active as homodimers, while PL is active as a monomer (S-9) However, there are discrepancies reported in the literature, namely the findings of monomeric functional units of LPL and HL by Ikeda et al. (10) and Schoonderwoerd et al. (II), the latter concludmg that the functional unit of rat HL m the liver is a monomer, while m adrenal gland and ovary it might be a dimer. The attainment of proper subunit structure is an important event m llpase maturation The consensus view is that newly-synthesized LPL is translocated into the endoplasmic reticulum (ER) as an inactive protein, most likely m the monomeric form (124.5). In the ER, the nascent protein undergoes a number of co-translational and post-translational modifications leading to proper foldmg and assembly mto the native dimeric form. As various physiological changes, naturally-occurrmg mutations, or engineered perturbations may affect the formation of active dimers (1620), determining the lipase subunit structure becomes an important factor m the study of lipase function A simple method of determmmg lipase subunit structure, even m crude preparations, is rate-zonal centrtfugation usmg sucrose density gradients. In this method, particles (e.g., proteins) are separated by differences m then sedimentation rate (21-23). This rate is determined by the particle’s size, shape From
Methods m Molecular Btology, Vol 109 Lipase and Phosphollpase Protocols E&ted by M H Doollttle and K Reue 0 Humana Press Inc , Totowa, NJ
257
258
Ben-Zeev and Doolittle
and density as well as the properties of the centrifugatton medium (density and viscosity) and the applied centrifugal force. The apparent centrifugal force experienced by a particle of volume V and of density d when centrifuged at an angular velocity of w radians/second 1s Vdrw2, where r 1s the distance of the particle from the center of rotation and (I) = 27c+(revoluttons /min)/60 However, thts apparent centrifugal force is opposed by the buoyant force, Vpr&, where p is the density of the medium and Vp is the weight of the liquid displaced by the particle. Thus, the net centrifugal force is given as V(d - p)ro2. If the parttcle 1sassumed to be spherical with a radius R, and is moving with a velocity v, then by Stoke’s law the frictional force opposmg motion is 6nRqv, were q is the viscosity of the medium. If the particle is not spherical (globular), then an “asymmetry” factor a must be added, and thus the frictional force is 6rRqva. At a constant veloctty, the centrifugal force is equal to the frictional force: V(d- p) r co*= 6xRnva This equation can be rewritten as
For spherical particles, a = 1 and V can be substituted with 4/37cR3: v=-.
2R2 9
d-Per,2 17
From this equation, it is evident that the sedimentation rate will be more affected by particle size (the square of the radius) than by its density, which IS a first order variable. However, thts direct relationshtp will change for particles deviating stgmficantly from a globular shape, when the “asymmetry” factor IS no longer negligible. When d = p , v is 0, and the particle reaches its isopycmc point. In rate-zonal centrifugation, p is always kept less than d. A simple linear gradient suffices for most apphcattons of rate-zonal centrifugation. The density at the light end of the gradient ISusually determmed by the need to support the sample. At the heavy end, the density should be less than that of the least dense particle m the sample, otherwise the pattern obtained after centrifugation will be confounded by isopycnic banding A lmear gradient of 5--20% sucrose has been found to be suitable for rate-zonal separation of most biological macromolecules. Sucrose IS the most widely used gradient material because of its solubtlity, transparency and low cost In this chapter, we describe the general procedure to determme hpase molecular size by ratezonal centrifugation using sucrose gradients
Determining Lipase Subunit Structure 2. Materials 2.7. Equipment
for Running
259
Sucrose Gradients
1 An ultracentrrfuge equipped with a swingmg bucket rotor, such as the Beckman SW 41 Ti The tube capactty should be 12-13 mL 2. Thin-wall, transparent tubes such as Ultra-Clear’M (Beckman, 14 x 89 mm) 3. Gradient maker apparatus In the absence of a commercial apparatus, a simple lmear density gradrent maker IS easy to assemble Two flat-bottom vessels of equal volume are connected together at their base via a short piece of tubing. One of the vessels IS fitted wrth a stirrer and an exrt port through whrch the gradient emerges The apparatus IS placed on a magnetic stirrer The exit tubmg should be narrow to avoid formatron of large drops, and should be connected to a perrstaltlc pump to create a slow flow rate. 4 Optronal. a fractionatron apparatus for collectmg density gradients In Its absence, fractions can be collected manually from the top of the gradrent tube 5 Spectrophotometer capable of monitoring absorbance at 340 nm 6 Refractometer to measure sucrose concentratron
2.2. Molecular Weight Markers Two kinds of markers are employed: internal, included with the sample, and external, run at the same trme III a separate centrifuge tube. 2 2. I Internal Molecular Weight Markers 1 Glucose-&phosphate dehydrogenase (G-6-PDH, 114,000 kDa) The lyophllrzed powder (Stgma, St LOUIS, MO) 1ssolubmzed m water (2000 U/mL) and stored m 100 n-IL aliquots at -70°C 2 Malrc dehydrogenase (MDH, 74,000 kDa), IS purchased as a suspensron m 3 M ammonmm sulfate (Srgma) and stored at 4°C
2.2.2. External Molecular Weight Markers These can be purchased from Pierce (Rockford, IL) and solubillzed m water, store at -20°C. 1 Cytochrome C (12,500 kDa), 5 mg/mL 2 Ovalbumm (45,000 kDa), 10 mg/mL. 3 Catalase (240,000 kDa), 10 mg/mL.
2.3. Solutions 2.3.1. Gradlent Stock Solutlons It 1simportant to add detergent to all gradient solutions. Either deoxycholate (0.2%) or Trlton X-100 (0.1%) are satisfactory (see Note 1). 1 4% deoxycholate (sodmm salt) m water; store at room temperature for no longer than 10 d Alternatrvely, 20% (v/v) Trrton X- 100 m water. MIX at room tempera-
260
2 3 4 5.
Ben-Zeev and Doolittle ture on a vertical rotating wheel for several hours (or overnight) to dissolve completely; store at 4°C Heparm (Srgma) Prepare a stock solutron of20,OOO U/mL m water, store at-20°C Ammoma-detergent buffer. 50 n-&f NH,OH-HCl buffer, pH 8 1, contammg 10 U/mL heparm and erther 0 2% deoxycholate or 0 1% Triton X-100, store at 4°C for no longer than a week 5% sucrose solution. drssolve 5 g sucrose m ammonia-detergent buffer to a final volume of 100 mL, store at 4°C; prepare weekly 20% sucrose solution dissolve 20 g sucrose m ammonia-detergent buffer to a final volume of 100 mL, store at 4°C; prepare weekly
2.3 2. Buffers for the Assay of Internal Markers 1 For assay of G-6-PDH 55 mM Trts-HCl, pH 7 8, contammg 3 3 mM MgCl,, store at 4°C. 2 For assay of MDH 40 m,V Tris-H2S04, pH 7 5, store at 4°C
2 3.3 Substrates for the Assay of Internal Markers All substrates (Sigma)
are solubtltzed
tn water and stored at -20°C.
1 For G-6-PDH assay. 0 1 M glucose &phosphate (G6P) and 6 mM mcotmamrde adenme dmucleotide phosphate (NADP) 2 For MDH assay 27 mM oxaloacetate (OAA) and 6 mM mcotmamide ademne dmucleotide, reduced form (NADH)
2.3.4. Reagents for Protein Determination BCA protein method (26).
assay kit (Pierce,
Rockford,
IL) or reagents for the Lowry
3. Methods
3.1. Preparation
of Sucrose Gradients
1 Place a small strrrmg bar m the chamber containing the exit port (mlxmg chamber) Clamp the tubing connectmg the two chambers of the gradient maker Connect the tubing emerging from the extt port to a peristaltic pump 2 Fill the distal chamber of the gradrent maker wtth 5 9 mL of 5% sucrose solutron (see Subheading
2.3.1.).
3 Open connecting clamp briefly to allow liqutd to fill the tubing, and reclamp A small amount will leak into the mixing chamber, remove liquid with a Pasteur pipet and place It back mto the distal chamber. 4 Fill mixing chamber with 5 9 mL of20% sucrose solutron (see Subheading 2.3.1.) 5 Activate magnetrc stirrer to medium speed and remove connectmg clamp (see Note 2) Make sure that no air IS trapped m the connecting tubmg, thus would impede the flow from the distal chamber. 6. With strrrer constantly mixing, start perrstaltic pump Introduce the gradrent mto the centrifuge tube with minimum disturbance, by touchmg the end of the tubing
Determimng Llpase Subunit Structure
261
leading from the gradlent maker on to the wall of the tilted tube, close to the tube bottom, and ailowmg the stream of llqurd to run down gently As the gradlent emerges, keep the tubrng Just above the rising meniscus 7 Store gradients at 4°C up to 8-10 h, free of vlbratlons (see Note 3)
3.2. Preparation
and Running
of Samples
The sample to be analyzed can be either from crude lysates or from punfied preparations. The range of protein concentratton m the sample should be 2-10 mg/mL. A suitable buffer for homogemzatlon of cell samples 1s the ammonium-detergent solution (see Subheading 2.3.1.) For LPL, it has been shown that inclusion of heparin and detergent in the homogemzatlon buffer ensures maximal solublhty and “unmasking” of hpase activity (16,2#) Internal markers are enzymes, and thus can be added directly to the lipase sample. ARer centrifugatlon, the position of these markers m the gradient will be identified by assaying enzymatic activity External markers are a mtxture of purified proteins with disparate molecular weights, and must be run on a gradlent separate from samples. 1 Prepare lipase samples with Internal markers* to 450 pL sample, add 35 pL G-6PDH, and 1.5 pL MDH (see Subheading 2.2.1.); mix well 2 Prepare external markers mix 40 pL cytochrome C, 20 pL ovalbumm and 40 pL catalase with 400 pL of ammoma-detergent buffer (see Subheading 2.2.2.) 3 Apply samples slowly to the wall of the tube, very close to the gradient top This can be done with either a syrmge or a narrow plpet tip 4. Pair tubes by balancing wlthm 0 02 g Alternatively, for a SIX place rotor, balance tubes 1,3,5 and 2,4,6 wlthm 0 02 g. Tubes should be filled up to wlthm 2 mm of the top. Ammonia-detergent buffer can be used for balancing (see Note 4).
5 Run gradients for 22 h at 40,000 rpm (200,OOOg) at 4°C The centrifuge rotor should be accelerated and decelerated slowly 6. Remove tubes from the bucket and keep refrigerated, even during fraction collection (see Note 5) If a fractlonatlon device IS not avallable, remove, starting from the top, fractions of 45@-500 pL usmg a mlcropipeter; withdraw hquid slowly, keeping the tip at the edge of the meniscus Place fractions mto prechilled
mlcrocentrlfuge
tubes (fractionation of 480 pL will usually yield 26 samples)
3.3. Analysis of Samples Separated by Gradient Centrifugation 3.3.1.
Determination
of Lipase
Activity
1 To 10 pL (or less) of each fraction, add buffer to a final volume of 100 pL The hpase assay can be carried out in any low iomc-strength buffer, pH 7 O-8 0, such as barbital (5 mMNa barbital, pH 7.2), Trls HCl(l0 mA4pH 7 4), or NH,OH HCl (50 mh4, pH 8 0) 2 Add 100 pL of substrate emulsion and assay enzyme actlvlty at 37°C (see Chapter 9 m this volume on lzpoprotein lzpase and hepatzc lzpase and Chapter 7 on pancreatzc lzpase for details on the assay procedure)
262
Ben-Zeev and Doohttle
3.3 2. Determination of Lipase Mass Lipase mass can be detected m the gradtent fractions by various procedures such as ELISA and Western blotting. If the latter is used, mix 3 vol of sample with 1 vol of SDS sample solutron. The latter 1sprepared by adding 1 mL of 10% SDS, 0 1 mL of B-mercaptoethanol and 0.4 mL of 0.1% bromophenol blue to 1 25 g glycerol. For further details on Western blotting, see Chapter 21. 3.3.3. Assay of Internal Markers Kinetic reactions of both marker enzymes are carried out at room temperature, by monitoring the change in absorbance at 340 nm for 3 mm. In the absence of a plot recorder, tabulate absorbance at 20-s intervals. Calculate change rn absorbance as a function of time (AA/mm) by choosmg only the linear part of the slope. The procedures for the assay of G-6-PDH and MDH given below are based on Olive et al. (25) and Johnson et al. (26), respectively. 3.3.3.1
GLUCOSE-6-PHOSPHATE
DEHYDROGENASE
Into a 3 mL curvette, add 2 7 mL of G-6-PDH assay buffer, 0.1 mL G6P, and 0.1 mL NADP (see Subheadings 2.3.2. and 2.3.3.). Begin the reaction by adding 20 pL sample and monitor increase m absorbance with time (see Note 6). In a gradient comprismg 26 fractions, G-6-PDH activity will usually be found in fractions 1l-16, with the peak around fraction 13 3 3.3.2
MALIC DEHYDROGENASE
Into a 3-mL curvette, add 2 8 mL of MDH assaybuffer, 40 pL OAA, and 0.1 mL NADH (see Subheadings 2.3.2. and 2.3.3.; also see Note 7). Begm the reaction by adding 20 PL sample and momtor decrease m absorbance at 340 nm. In a gradient comprising 26 fractions, MDH activity will usually be found m fractions 8-13, with the peak around fraction 10. There is no need to assay all the gradient fractions. 3.3.4. Analysis of External Markers Determine protein concentration of the fractions from the gradient tube contaming the external markers either by the BCA Protem Assay or by the Lowry method (27). The size for sample analysis should be 50-100 pL. Cytochrome C is usually m fractions 4-5 (its red color 1sdistinguishable by the naked eye), ovalbumm m fraction 7 and catalase m fractions 2 l-22. 3.3.5. Sucrose Concentration
Measurements
In order to generate a calibration curve, it is advisable to measure the sucrose concentrations of the recovered gradient fractions The sucrose concentration 1s directly related to the refractive index and is measured with the aid of a
263
Determimng Llpase Subutxt Structure 250,000
-
mahc dehydrogenase
6
7
8
9
10 11 12 13 14 15 16 17 18
% sucrose(w/w) Fig 1, Sedimentation of molecular size markers in a 5-20% sucrose gradrent Gradients were run for 22 h at 200,OOOg. Molecular mass of the standard proteins were plotted against the sucrose concentrations of their peak fractions Standard molecular masses (in daltons) were cytochrome C, 12,500; ovalbumm, 45,000, malic dehydrogenase, 74,000, glucose-6-phosphate dehydrogenase, 114,000; and catalase, 240,000 refractometer. In a simple refractometer, a drop of solution (20 PL) 1s placed on a graduated prism and the light refraction is measured by a reticle; some retitles read both refractive index and percent sucrose (w/w)
3.4. Presentation
of Gradient Profiles
The molecular size of each marker is plotted relative to its migration m the gradient. Although the absctssa can be represented by fraction number, results from multiple gradient tubes can be combined when the fraction number is substituted by the refractive index (or percent sucrose). In this manner, small shifts m fraction numbers due to uneven collectton between gradtents are normalized. Construct a standard curve by plottmg molecular mass against refractive index (or percent sucrose), as shown in Fig. 1.
3.5. Determining
Lipase Molecular
Mass
Use the standard curve to determine hpase molecular mass. Under the conditions described m this chapter, functional LPL and HL sediment as dtmers, whereas active PL sedtments as a monomer. The molecular mass of LPL is m excellent agreement with its expected size deduced by ammo acid sequence combmed with an estimate of its carbohydrate size; HL and PL agree within 16% and 22% of their expected sizes (28-32) (see Table 1). Thus, while thts
method might be less accurate than purely analytical methods utilizing isolated proteins,
it IS very suitable
for determining
subunit
structure
withm
Ben-Zeev and Doolittle
264
Table 1 Comparison of Expected Lipase Molecular Mass with Values Obtained by Density Gradient Centrifugation Lease LPL HL PL
Expected ma&, Daltons
Obtamed mass!, Daltons + SD
107,500 119,800 52,800
109,300 * 5,600 (8) 103,000 + 7,000 (3) 64,500 f 1,700 (3)
“Expected hpase molecular masses were deduced from the ammoacidsequence combined with an estimated mass of 1,700 Da/glycan cham, human LPL, HL, and
PL contain2,4, and 1 glycancham,respectively hExtracts of CHO cells expressmg human LPL, HL, and PL were subjected to rate zonal centrlfugatlon as described m this chapter Numbers m parenthesis rep-
resentthe numberof determinations
crude preparations and can easily dlstmguish aggregated states
between monomers,
dlmers, or
4. Notes While both deoxycholate and Triton X- 100 are satisfactory, 0 2% deoxycholate is msoluble m NaCl concentrations greater than 0.75 A4and is thus not suitable for gradients run m high salt The stirrer speedshould be vigourous enough to ensureproper mixmg, but not so excessive asto causewhirlpoolmg that would stgmficantly change the height of the liquid m the mixing chamber. A common scheduleis to prepare the gradient at room temperature to mmimize vlscostty, then, while the sampleis prepared, allow the gradients to cool to 4°C Allow approx 1 h to reach temperature equillbrmm For swing-out rotors, all buckets must be attached even if lessthan a full complement of samples1srun Gradients kept free from vibration and at constant temperature (usually on ice) will normally show little deterloratlon over a few hours The volume of the fraction to be assayedcan vary It is important to assaysmall enough quantities to obtam a linear slopeof absorbanceper time The absorbanceat time 0 should be around 1 0 OD, and ~111decreasewhen MDH is added If the mtttal OD 1sabove 1 0, decreasethe volume of NADH added
References 1 Knchgessner,T G , Chuat, J -C , Hemzmann,C , Etienne, J , Gullhot, S , Svenson, K , Amens,D., Prlon, C , d’Aurio1, L , Andahbi, A , Schotz, M C , Gallbert, F., and Lusts, A J (1989) Orgamzation of the humanhpoprotem hpasegeneand evolution of the hpasegene family Proc Nat1 Acad Scl 86,9647-965 1 2 Derewenda, Z S , and Cambillau, C (1991) Effects of genemutations in hpoprotem hpaseasinterpreted by a molecular model of pancreatic hpase J Bzol Chem 266,23,112-23,119
Determining Llpase Subunit Structure
265
3 Hide, W A , Chan, L., and Li, W -H. (1992) Structure and evolution of the lipase
superfamily. J LzpzdRes 33, 167-178 4 van Tilbeurgh, H , Roussel, A., Lalouel, J -M , and Cambillau, C (1994) L~poprotem hpase*molecular model basedon the pancreatic hpase X-ray structure consequencesfor heparm bmdmg and catalysis J B~ol Chem 269,4626-4633 5 Garfinkel, A S., Kempner, E S., Ben-Zeev, O., Nikazy, J , James, S J , and Schotz, M C (1983) Lipoprotem hpase: Size of the functional unit determmedby radiation mactrvatron. J Lzpza’Res 24, 775-780 6 Osborne, J. C , Jr, Bengtsson-Ohvecrona, G , Lee, N S , and Olivecrona, T (1985) Studies on mactivation of hpoprotem hpase role of the dimer to monomer dissociation. Bzochemzstry 24, 5606-56 11. 7 Ohvecrona, T , Bengtsson-Ohvecrona, G , Osborne, J C , Jr, and Kempner, E S (1985) Molecular size of bovine hpoprotem hpase as determined by radiation mactivation J Blol Chem 280, 6888-6891 8 Hill, J S., Davis, R. C., Yang, D , Wen, J , Philo, J S , Poon, P H , Philhps, M L , Kempner, E S , and Wong, H (1996) Human hepatic lipase subunit structure determmation. J. Blol Chem 271,22,93 l-22,936. 9 Rovery, M , Boudouard,M , andBianchietta,J (1978)An improvedlargescaleprocedure for the purification of porcinepancreatichpaseBlochlm Blophys Acta. 525,373-379 10 Ikeda, Y , Takagi, A , and Yamamoto, A (1989) Purification and characterization of lipoprotein lipase and hepatic triglyceride lipase from human postheparm plasma, production of monospecific antibody to the mdividual hpase Blochlm Blophys Acta. 1003,254-269 11 Schoonderwoerd, K , Horn, M L , Luthjens, L. H , Vieira van Bruggen, D , and Jansen,H (1996) Functional molecular massof rat hepatlc llpase m liver, adrenal gland and ovary is different Blochem J 318, 463467 12 Vanmer, C , and Arlhaud, G (1989) Biosynthesis of hpoprotem hpasem cultured mouseadypocytes II Processmg,subunit assembly,and mtracellular transport J Blol Chem 264, 13,206-13,216 13 Ben-Zeev, 0 , Doohttle,M H , Davis, R C , Elovson,J., andSchotz,M C ( 1992)Maturation of liporoteinlipase expressionof full catalytic activity requiresglucosetrimming but not translocationto the as-Golgi compartmentJ Blol Chem 267,62 196227 14 Carroll, R., Ben-Zeev, 0 , Doohttle, M. H., and Severson,D. L. (1992) Activation of hpoprotem lipase m cardiac muscleby glycosylation requires trlmmmg of glucose residuesin the endoplasmicreticulum Bzochem J 285, 639-696 15 Park, J -W , Oh, M -S , Yang, J -Y , Park, B -H , Rho, H -W , Lim, S -N , Jhee, E -C , and Kim, H -R (1995) Glycosylation, dimerization, and heparm affinity of hpoprotem hpase rn 3T3-Ll adipocytes Blochzm Blophys Acta 1254,45-50 16 Vanmer, C , Deslex, S., Pradmes-Figueres,A , and Ailhaud, G (1989) Biosynthesis of lipoprotem hpase m cultured mouseadipocytes I. Characterization of a specific antibody and relationships betweenthe mtracellular and secretedpools of the enzyme. J Blol Chem 264, 13,199-13,205 17 Doohttle, M H , Ben-Zeev, O., Elovson, J , Martin, D , Kirchgessner, T , and Schotz, M C (1990) Post-translational regulation of lipoprotein hpase during feeding and fasting J Blol Chem 265,457@-4577
266
Ben-Zeev and Doolittle
18. Davis, R C , Ben-Zeev, 0 , Martin, D , and Doolittle, M H (1990) Combined hpase defictency m the mouse* lipase transcription, translation and processing J Bzol Chem 265, 17,96&17,966 19 Bergo, M , Oltvecrona, G., and Olivecrona, T (1996) Forms of lipoprotein hpase in rat tissues. m adipose tissue the proportion of Inactive hpase increases on fastmg Bzochem J 313,893-898 20 BUS&, R , Martinez, M., Vtlella, E , Pognonec, P , Deeb, S., Auwerx, J , Rema, M , and Vdaro, S (1996) The mutation Gly 142- Glu m human lipoprotein hpase produces a mtssorted protein that IS dtverted to the lysosomes J BIOI Chem 271, 2139-2146 2 1 Sheeler, P (198 1) Centzfugatzon zn Bzology and Medical Science John Wiley and Sons, New York. 22 Hmton, R , and Dobrota, M (1976) Den&y Gradzent Centrzfugatlon North-Holland Pubhshmg Company, Amsterdam. 23 Price, C A (1982) Centrzfugatzon zn Dens@ Gradients Academtc Press, New York, London. 24 Atlhaud, G (1990) Cellular and secreted hpoprotem ltpase revtstted Clan Blochem
23,343-347
25 Ohve, C , and Levy, H. R (1975) Glucose-6-phosphate dehydrogenase from Leuconostoc mesenteroldes Methods Enzymol 41, 196201 26 Johnson, H S., and Hatch, M D (1970) Properties and regulation of leaf mcottnamrde-adenme dinucleotrde phosphate - malate dehydrogenase and “malrc” enzyme m plants with the Ct4-dtcarboxyhc acid pathway of photosynthesis. Blochem J 119,273-280
27 Lowry, 0 H , Rosenbrough, N J , Farr, A L , and Randall, R J (195 1) Protein measurement with the Folm phenol reagent J. Blol Chem 193,265-275 28 Wton, K. L , Ku-chgessner, T G , Lusts, A. J , Schotz, M C , and Lawn, R M (1987) Human lipoprotein lipase complementary DNA sequence Science 235, 1638-1641. 29 Amets, D , Stahnke, G , Kobayasht, J , McLean, J , Lee, G , Buscher, M , Schotz, M C , and Will, H (1990) Isolation and charactertzatton of the human hepatrc hpase gene J Blol Chem 265,6652-6555 30 Lowe, M E , Rosenblum, J L , and Strauss, A W (1989) Cloning and characterization of human pancreattc hpase cDNA. J Blol Chem 264,20,042-20,048 3 1 Ben-Zeev, 0 , Stahnke, G , LIU, G , Davis, R C , and Doolittle, M. H. (1994) Lrpoprotem lipase and hepatic lipase. the role of asparagme-linked glycosylatron in the expression of a functional enzyme J Lzpid Res 35, 15 1 l-l 523, 32. Canalias, F., Vtsvrkts, A., Thtoudellet, C., and Stest, G (1994) Stable expression of enzymattcally active human pancreatrc hpase m V79 cells. purlficatron and charactertzation of the recombmant enzyme Clm Chem 40, 125 l-l 257
24 Detecting Ligands Interacting with Lipoprotein
Lipase
Sivaram Pillarisetti 1. Introduction The primary role for lipoprotem hpase (LPL) is hydrolysis of triglycerides m chylomtcrons and very low density lipoprotems (VLDL). This enzyme has also been implicated m the process of atherogenests (for reviews see refs. I and 2). Additional enzymatic acttvmes of LPL include retmyl ester hydrolysis and fatty acid ethyl ester synthesis (3,4). Recent studies from several laboratories suggest that LPL may have roles unrelated to its enzymatic activity. For example, LPL increases lipoprotem bmdmg to matrix and hpoprotem bmdmg and uptake by cells, a function that does not appear to require catalytic activity Since LPL has domains that interact with lipid, apoB, and cell surface molecules, it has been suggested that LPL forms a bridge between hpoprotems and cell surfaces (see refs m 2) This bridging function has been postulated to play a role m the accumulatton of lipoproteins by cells m VWO. LPL also interacts with several protems, both apo- and non-apohpoprotems, m vitro. The physiological significance of many of these mteractions has not yet been elucidated. Although apoCI1 and apoE affect LPL activity, no evtdence for direct protein-protein mteractions has been demonstrated. If such interactions occur, they might require the presence of lipid The proteins thus far identified to interact with LPL zn vitro include heparan sulfate proteoglycans, VLDL receptor, LDL receptor, LDL receptor related protein (LRP), gp330, apohpoprotem B and alpha 2 macroglobulm (5-12). More recent results suggest that LPL can mediate monocyte bmdmg to extracellular matrix (121, m part by binding to cell surface proteoglycans. It has also been shown that endothehal cells are polarized for LPL binding (17). Thus, techniques aimed at studying the mteractions of LPL with other molecules are important
From
Methods Edlted
by
m Molecular
&ology,
M H Doohttle
and
Vol 109 Llpase and Phospholtpase K Reue
267
0 Humana
Press
Inc , Totowa,
Protocols NJ
268
Pillansettl
tools that are needed to further elucidate the role of this enzyme m lipid metabolism and atherosclerosis. LPL, a dlmer of identical subunits, 1s very unstable even under physlologlcal condltlons This instability makes labeling of LPL and studies on its properties and its interactions difficult The rate of inactivation depends on the pH, the salt concentration and the temperature (13,14) Successful labeling techniques, therefore, must be extremely gentle. Llpases can be labeled with lz51, blotm, or fluorescent probes (1548) Radiolodmatlon IS the most commonly used procedure for labelmg hpases and lodinated hpases are useful m both physiological and cell biological studies. We have recently developed a blotmylatlon procedure for LPL and have employed the blotmylated hpase to identify proteins interacting with LPL using the technique of llgand blotting Here we present protocols for the radlolodination and blotmylatlon of LPL that have been optimized m our laboratory to cause mmlmal mactlvatlon; the small amount of inactive LPL resulting from the labellmg reactions are then removed by heparm-Sepharose chromatography. In addition, various procedures are given for detecting molecules interacting with LPL, mcludmg cell surface bmdmg of LPL, LPL affinity chromatography, hgand blotting, and a solid phase plate assay
2. Materials 2.1. Radioiodina Unless specified LOUIS, MO
tion otherwise,
all chemicals
are available
from Sigma,
St
1 Buffer 1 10 mMTris-HCL, pH 7 4 (see Note 1) 2 Buffer 2 10 mA4 Tns-HCl, pH 7 4 containing 0 5 M NaCl and 2 mg/mL bovme serum albumin 3 Buffer 3, as buffer 2, with 0 75 M NaCl 4 Buffer 4 as buffer 2, with 1 5 MNaCl 5 D-glucose Prepare fresh by dlssolvmg 3 6 mg m 1 mL of buffer 1 6 Lactoperoxldase 2 25 mg/mL in 300 pL of buffer 1 7 Glucose oxldase 1 mg/mL m buffer 1 8. Stop/quench solution 16 5 mg sodium azlde and 16 5 mg potassium iodide dlssolved m 10 mL of buffer 1, 9. LPL. 250-500 yglmL (see Note 2) Purified bovine LPL IS commercially avallable from Sigma 10 Iodine Na[‘251] solution (Amersham, Arlington Heights, IL), 100 mCl/mL (3 7 GBq/mL) 11 Heparm affinity gel Afflgel heparm (Blo-Rad, Hercules, CA) or heparmSepharose (Pharmacla, Upsala, Sweden) 12 3-mL columns Econo columns (Blo-Rad)
Ligands Interacting with LPL
269
2.2. Bio tiny/a tion I 2 3 4
Buffers l-4 as in Subheading 2.1. Affigen-heparin (approx 1 mL for 200 mg LPL) LPL: 250-500 pg/mL (see Subheading 2.1.) Btotm (long arm) as the N-hydroxysuccmlmlde ester: (BNHS, Vector Laboratortes, Burlingame, CA). Prepare btotm solution just before use by dtssolvmg 1 33 mg of btotm m 50 pL of dtmethyl sulfoxtde and diluting to 1 mL wtth phosphate buffered salme (PBS, 10 nnI4 sodium phosphate, pH 7 2,0.15 M NaCl).
2.3. Visualization
of Biotinylated Proteins by Avidin
1 2 3 4.
P-BSA: PBS contaming 3% BSA. Avrdm-horseradish peroxtdase conjugate (Bto-Rad). Wash solutton. PBS contammg 0 3% BSA and 0.05% Tween-20. Developmg solutton* Dissolve 30 mg of 4-chloro-1 -naphthol m 10 mL Ice-cold methanol and mix with 40 mL of PBS 5 Stop solutton: PBS contammg 5 rmI4 EDTA. 6 Nttrocellulose membrane 7. Dot blotting apparatus (optional)* Hybrr-Dot mamfold (Life Technologtes, Gatthersburg, MD)
2.4. Detection of Ligands Interacting with LPL 2.41. Cell Surface Bindmg of Labeled LPL 1 Serum-free cell culture medmm containmg 3% BSA. Chill to 4°C for use in cell bmdmg studies 2 Labeled LPL prepared as described m Subheading 3.2. or 3.3. 3 Cell culture medium contammg 3% BSA and 10-50 U/mL heparm.
2.4 2. LPL Affmlty Chromatography 1 2. 3 4
LPL, purified (see Subheading 2.1.) Cyanogen bromide-activated Sepharose 4B (Pharmacia) or Affi-Prep 10 (Bra-Rad) N-acetylated heparm Low salt protem-loading buffer Trts-HCI, pH 7 4 contammg 0 1% detergent (CHAPS or octylglucoside) and 10% glycerol. 5 Elutton buffer 0 2-2 0 MNaCl gradient
2.4.3. Ligand Blotting 2.4 3.1. PREPARATION OF CELL MEMBRANES 1 Phosphate buffered salme (PBS): 10 m&I sodium phosphate, pH 7 2, 0 15 M NaCl 2 Homogemzation buffer: 5 mM HEPES, pH 7 4, 50 mM manmtol, 1 mM each of benzamtdme hydrochlortde and phenylmethylsulfonylfluoride (PMSF), 10 pg/mL leupeptin.
Pillarisett/
270
3 1 MCaCl, 4 HEPES buffered salme (HBS). 20 mA4 HEPES, pH 7 4, 0 15 M NaC1, 1 mA4 PMSF, 0 5% octylglucoslde, 0 5% CHAPS Adjust pH with NaOH 2 4 3 2 DEAE-CELLULOSE
CHROMATOGRAPHY
1 20 mMHEPES, pH 7 4,0 1 mMEDTA, 1 mMPMSF, 1% octylglucoslde, 1% CHAPS. 2 Dialysis buffer 20 mM HEPES, pH 7 4, 0 1 mM EDTA, 1 mM PMSF, 0 1% octylglucoslde, 0.1% CHAPS 3 DEAE-cellulose column equihbratlon buffer* 20 mA4 HEPES, pH 7 4, 0 1 mA4 EDTA, 1 m/V PMSF, 0.1% CHAPS 4 DEAE-cellulose column elutlon buffer equihbratlon buffer (see step 3 above) containing 0 15 MNaCl (first step elutlon) or 0.25 MNaCl (second step elutlon). 2 4 3.3. LIGAND BLOTTING 1 Reagents for SDS-PAGE 2 Nltrocellulose or Immobrlon membrane (M&pore) 3 Semi-dry blotting system, such as the Mllltpore Semi-Dry blottmg system (Mllhpore) 4 Coomassle blue R250 (for Immobllon), or India mk or Amldo black (for mtrocellulose) 5 P-BSA (see Subheading 2.3) 6 Wash solution (see Subheading 2.3.) 7 Radlolabeled- or blotmylated-LPL (prepared as described m Subheadings 3.1. and 3.2.)
2 4.4. Solid-Phase Plate Assay 1 96-well mIcrotIter plates 2 Radiolabeled or blotmylated LPL (prepared as described m Subheadings 3.1. and 3.2.) 3 Coating buffer 10 mA4 Tns-HCl, 0 15 M NaCl 4 BSA coatmg buffer 10 mM Tns-HCI, 0 15 M NaCl, 1% BSA 5 0 1 N NaOH (for assays with radlolodmated LPL) 6 Avldm-horseradlsh peroxldase (Blo-Rad, for assays with blotmylated LPL) 7 O-phenylenedlamme dlhydrochlorlde (for assays with blotmylated LPL) 8 Microtiter plate reader (for assays with blotmylated LPL)
3. Methods 3.1. Radioiodination 1, Prior to the start of iodmatlon, prepare a 3-mL column of heparm-affimty gel and equlhbrate with buffer 2 at 4’C Keep the column at 4°C until use 2 Reactions and subsequent heparm-gel chromatography should be performed rn a fume hood designated for lodmatlon To 1 ml of LPL add 200 FL of p-o glucose, 10 JJL of lactoperoxldase and 1 mC1 (10 pL) of Na[‘2SI] MIX by mverslon and add 10 pL of glucose oxldase MIX and incubate for 8-10 mm on Ice (see Note 3)
Ligands Interacting with LPL
271
3 Add 5 mL of potassium lodidelsodmm azlde stop solutlon and mix to quench the reaction 4 Brmg the heparm-gel column to the hood and load lodmated LPL Wash the column successively with 10 vol each of buffers 2 and 3 This ~111 remove free lodme as well as inactivated LPL 5 Elute active rodmated LPL with buffer 4. Collect 1 mL fractions and count approximately 10 pL m a Gamma counter Fractions containing radloactlvlty are pooled and stored m ahquots at -70°C This protocol usually generates LPL with a specific actlvlty of 1000-2000 cpm/ng of protem (see Note 4) lzsI-LPL should be used within l-2 wk of preparation (see Note 5)
3.2. Biotinylation Although iodmated hpases are widely used m cell blologlcal experiments, their use IS limited because of mactlvatlon of the enzyme upon storage, and problems associated with y-radiation. Blotin IS a small 244 Da vitamin found m tlssues and blood that binds with high affinity to avidm and streptavldm (19). Since blotin 1s a small molecule, it can be conjugated to many proteins without altering the biologlcal activities of proteins. Although biotm-avldm technology has been applied to a wide variety of protems, very few of these are enzymes (29) The brotm IS linked covalently to free ammo groups on proteins, which often leads to inactivation of enzymes. For LPL and hepatlc hpase, the E-NH, groups of lysmes are postulated to play a role m bmdmg cellular heparan sulfate proteoglycans (20,21) The followmg protocol, which does not alter these properties, can be used to blotmylate both LPL and hepatlc llpase 1 Prepare a 3-4 mL Affigel-heparm column as m step 1 of Subheading 3.1. 2 MIX purified LPL (100-200 yg/mL m 10 mMTns-HCl, pH 7.4, contammg 0 5 M NaCl) with blotm (25-SO-fold molar excess). Incubate the reactlon at 4°C for 10 mm on a rocker Biotm at higher concentrations mhlblts LPL activity 3 Load blotmylatlon mixture onto the heparm-agarose column Wash the column successively with buffers 2 and 3 to remove free blotm and the unbound protein 4 Elute the column with buffer 4 Collect 0 75 mL fractions 5 Assay an ahquot (25 pL) of each fraction for LPL activity using a (3H)trlolem emulsion (see Chapter 9 and ref. 22) Because NaCl concentrations >O 75 M mhlblt LPL achvlty, fractions should be diluted at least fourfold before enzyme assay 6 An ahquot of each fraction can be analyzed for blotmylatlon by dot blotting followed by avldm development as described m Subheading 3.3. Alternatively, fractions can be analyzed by SDS polyacrylamlde gel electrophoresls (PAGE) followed by transfer to a mtrocellulose membrane and avldm development
3.3. Visualization
of Biotinylated
Proteins by Avidin
1 Incubate nitrocellulose membranes containing biotinylated LPL (obtained either by dot- or Western blotting) m P-BSA for 1 h at 37°C or overmght at 4°C
272
Pillarisetti
2 Incubate the membrane m P-BSA containmg a thousand-fold diluted avldmhorseradtsh peroxtdase for 1 h at room temperature followed by washing three ttmes (10 min each, with gentle rocking) at room temperature with PBS contammg 0 3% BSA and 0 05% Tween-20 3 Add developing solutton (see Subheading 2.3.) to the mtrocellulose membrane above and incubate at room temperature protected from light exposure Blotmylated protems are vrsuahzed by development of a dark purple color The reaction may be stopped by removing from the developing solution and mcubatmg m PBS contammg 5 mA4 EDTA Alternatively, chemrlummescent substrates can be utlhzed (see Chapter 2 1).
3.4. Detection of Ligands Interacting with LPL LPL mteractlon
with proteins can be assessed etther by ligand blotting
or
sohd phase plate (96-well) assay. The use of the latter is limited to studymg LPL mteractlon
with purtfied proteins. Ligand blotting
IS especially
useful m
ldentlfying LPL bmdmg proteins m crude extracts or partially purified membranes. Alternatively, LPL affinity chromatography may be performed to ISOlate protems that mteract with LPL. Other approaches include crosslmkmg LPL to its ligand and analyzmg crosslmked complexes by SDS-PAGE (23) A change m the relative mobility of labeled LPL wrll indicate Its assocratlon with the protein of interest. A drawback of thusmethod ISthat LPL often aggregates. Crosslinking can generate LPL-LPL complexes m addrtion to LPL-protein complexes, thus obscuring the conclusions. All these protocols have successfully been used to study interaction
3.4 1. Cell-Surface
between protems of interest with LPL.
Binding of Labeled LPL
To determine rf LPL binding sitesare presenton cell surfaces,mitral experiments should be petiormed to assessthe specificity and afftmty of LPL bmdmg to cells. Several cells can internalize and degrade LPL at 37°C (24). Thus it IS necessary to
perform binding experimentsat 4°C or at 16OCto block cellular metabolic processes. 1 Remove culture medmm and wash cells three times with serum-free medium containing 3% BSA 2. Add fresh cold medmm contammg 3% BSA (medmm/3% BSA) and Incubate at 4OC for 15 mm to chill the cells 3 Add labeled LPL (0 01-10 pg/mL) m medium/3%BSA and mcubate with gentle rocking for 2 h at 4°C. 4 Remove unbound LPL and wash wells three times with medmm/3%BSA 5 Cell surface bound LPL IS released by incubation with medmm/3%BSA contammg heparm (10-50 U/mL) for 15 mm at 4°C Released LPL may be assessed by radroactrvtty (‘*‘I) or colortmetric detection (btotmylated LPL). The same expertment IS performed in the presence of excess unlabeled LPL (lO-50-fold) to determine specific bmdmg.
Ligands interacting with LPL
273
3.4.2. LPL Affinity Chromatography LPL affinity chromatography has been used to identify proteoglycans, as well as nonproteoglycan proteins, from adtpocytes and endothehal cells that bind LPL (23,26-28). Proteoglycans bind LPL via their glycosammoglycan side chains In thustechnique, crude cell lysates or parttally purified cell extracts ate passed through an LPL affimty column, and bound proteins are eluted with htgh salt 1. Prepare LPL affimty resin by couplmg purtfied LPL to cyanogen bromtde-acttvated Sepharose 4B or Aft?-Prep 10 gel using manufacturer’s mstructtons Use 0.4-l mg LPL/mL of gel (see Note 6). 2 Load protems onto LPL-affinity resin m loading buffer containing detergent and glycerol (see Note 7) 3. Elute bound protems with a gradient of 0.2-I 0 MNaCl or by step elutton 4. Analyze eluted proteins by SDS-PAGE followed by silver staming. Bound proteins may also be analyzed by ligand blottmg (see Subheading 3.4.3.3.) wtth radiotodmated- or btotmylated-LPL.
3.4.3. Ligand Blotting Ligand blotting may be performed with crude extracts either before or after partial purtticatton or cell fractlonatton. Depending on the abundance of the protein, the stgnal produced by crude extracts may be very weak It IS therefore advisable to partially purify the extract biochemically or, if the LPL bmding component is locahzed to a parttcular cellular compartment, perform subcellular fractionation before proceeding with hgand blotting. Two simple procedures to partially purify a cell extract are described in Subheadings 3.4.3.1. and 3.4.3.2. 3 4.3.1 PREPARATION OF PLASMA MEMBRANES If the purpose 1sto identify cell surface proteins that bind to LPL, a fraction enriched in plasma membranes may be prepared. We have previously used a procedure (27) that was modified from the method of Lm et al. (31) to prepare plasma membrane from endothelial cells. 1. Wash endotheltal cells (two T- 175 flasks) with PBS, scrape, and collect the cells by centrtfugation at 1OOOgfor 5 mm 2 Suspend the cell pellet in 3 mL of homogemzation buffer (Subheading 2.4.3.1.) and homogemze by passage through 21- and 25-gage needles (three ttmes each) followed by brief (30 s) somcation. 3. Add 30 uL of CaCl,. Mix well and centrifuge at 11,OOOg for 1 mm to pellet aggregated mtcrosomal membranes. 4 Centrifuge the supernatant at 370,OOOg for 8 min m a fixed angle rotor 5. Resuspend the resulting plasma membrane pellet in 200 uL of HBS contammg octylglucostde and CHAPS and extract protems for 2-4 h at 4°C The extract
274
Pillarisetti may be further centrrfuged to remove undtssolved residue prior to SDS-PAGE and hgand blottmg
3.4.3 2 PARTIAL PURIFICATION BY DEAE-CELLULOSECHROMATOGRAPHY If the purpose IS to identify non-proteoglycan LPL binding proteins, cell extracts may be purified by DEAE cellulose chromatography. Proteoglycans and nucleic acids have high affimty for DEAE-cellulose and are eluted at salt concentrattons >0.4 M NaCl (32) Incubate confluent monolayers of cells with 20 ti
HEPES, pH 7 4, contammg 0 1 mA4EDTA, 1 mMPMSF, 1% octyl glucoslde and 1% CHAPS for 4 h at 4°C (-10 mL buffer for a T-175 flask). Centrifuge at 10,OOOgfor 10 mm to remove cell debris, and dialyze the superna-
tant agamst HEPES dtalysrs buffer containmg 0 1% octylglucoslde CHAPS (Subheading 2.4.3.2.)
and 0 1%
Load dialyzed extract onto a DEAE-cellulose column equilibrated with column
equlhbratron buffer Collect the effluent and washcolumn with the samebuffer as m step 3 above Elute successivelywith column elutlon buffer contammg0 15 A4NaCl and 0 25 A4NaCl Measure protem by absorbanceat 280 nm Analyze protein-contammgfractions by SDS-PAGE. Proteoglycansmay be elutedwith 0 4 Mor higher salt contammg buffers
3 4 3 3 LIGAND BLOTTING Ligand blotting using avtdm development IS descrtbed below Because protem-protein mteractton often depends on nattve conformatron of the protein, it IS necessary to minimize the denaturatton other than that caused by the SDSPAGE itself. Boilmg of the sample should be avoided Non-reducing condrttons should be considered inmally 1 Transfer proteins from SDS polyacrylamlde gels to mtrocellulose or Immobllon membrane (SDS polyacrylamlde gel electrophoresls IS described m some detail m Chapter 21 and extensively m ref. 33) The advantage of Immobllon IS that proteins can be stamed on the membranewith Coomassleblue R250 and can be compared to bands developed by hgand bmdmg Note that Immobllon membranesare relatively hydrophobic and shouldbe wetted with 100%methanol prior to treatment with water (seemanufacturer’s mstruchons) If mtrocellulose membranes are used,proteins can be stainedwith Amldo black or India mk (34) The composrtton of transfer buffers and the time of transfer varies depending on the transfer system used We routinely use a Mlllipore Semi-Dry blotting system with an average transfer time of 45-90 mm depending on the thicknessof the gel 2 Followmg transfer, incubate the membrane for l-2 h at room temperature or overnight at 4°C m PBS containing 3% BSA to block bmdmg sites(see Note 8) 3 Dilute blotmylated or lodmated LPL with cold P-BSA to a final concentration of l-2 pg/mL (note however, that the effective dilution dependson the extent of
Ligands Interacting with LPL
275
labelmg). Incubate mtrocellulose membrane with LPL for 4 h at 4°C with gentle rockmg 4 Remove buffer containing LPL and wash the membrane at 4°C wtth PBS contaming 0.3% BSA and 0.05% Tween-20 (five times, 5 mm each) If todmated LPL 1sused for blotting, wash the membrane until the radioacttvtty m washes 1s substanttally reduced (I e., to approx 1000 cpm) 5 Membranes used with ‘251-LPL are wrapped with plasttc for autoradtography Membranes used with btotmylated-LPL can be developed wdh the avidm-horse radish peroxrdase method described m Subheading 3.3. or by usmg chemiluminescent substrates
3.4.4. Solid Phase Plate Assay The sohd phase plate assay IS suitable for studying purified protean of Interest
LPL interaction
with a
1 Coat the wells of a 96-well microtiter plate with potential LPL bmdmg proteins (l-50 pg/mL) (such as apohpoprotems or partrally purtfied cell extracts) drluted m coatmg buffer (Subheading 2.4.4.) for 16 h at 4°C 2. Remove unbound protem and incubate protein coated wells for 16 h at 4°C m coating buffer contammg 1% BSA. 3 Add ‘251-LPL or biotinylated LPL in BSA coating buffer and incubate at 4°C for 16 h It IS advisable to perform mmal experiments in the presence of calcmm and magnesium (2 n-&each) m case the LPL-protem mteractton requires dtvalent cations 4 Remove unbound LPL and wash wells three times wtth BSA coatmg buffet If 12’I-LPL IS used, solubrltze bound radroacttvrty with 0 1 NNaOH and count, If biotmylated LPL IS used, Incubate the wells with lOOO-fold diluted avidm-horseradtsh peroxtdase m P-BSA for 1 h at room temperature Remove unbound avtdin and wash wells three times. Add 100 pL substrate solution contammg o-phenylenedtamine dthydrochloride After 20 mm at room temperature, measure absorbance at 492 nm m a microtiter plate reader
4. Notes 1 Buffers for radtorodmatton should be stored at 4’C, except the Na’2sI solutron Enzymes are stable at -70°C for several weeks Repeated freezing and thawing should be avoided 2 LPL purified from heparm-agarose columns and frozen m elutton buffer contammg 1.5 M NaCl can be used dtrectly for todmatton without removal of salt 3 Longer mcubations produce LPL with htgh specific labeling, but also lead to greater inactivatron. 4 To determine the amount of ‘25I mcorporated mto protein, dilute an ahquot of ‘251-LPL contammg 50,000-100,000 cpm wtth PBS contammg 0.1% albumin (final volume 400 pL) and add 100 uL 50% trrchloroacettc acid Incubate on Ice for 30 min and centrifuge for 15 mm at 10,OOOg Count an ahquot of the supernatant. >95% radloactlvlty IS preclpltable for freshly lodmated LPL
276
Pillarise tti
5 If not used Immediately, ‘*%LPL should be repurified to remove free rodme prior to use m experiments. Thus 1s done by gel tiltratron on Sephadex G-25 columns Pharmacia PD- 10 columns are ideal for this (see manufacturer’s mstructtons) 6 To prevent glycosammoglycan binding domains in LPL from mteractmg with affimty gel, rt may be useful to first incubate LPL with heparm (N-acetylated heparin, 1 h, 4°C) prior to couplmg to Sepharose (29,301 Followmg coupling the LPL-gel may be washed with high salt buffers (2 M or greater) to remove bound heparm. 7 Detergent is Included in loading buffer for LPL-affinity chromatography to mnumize nonspecific protein bmdmg to the resin 8 Blocking the membrane with milk products should be avoided as these may contam mactive lipases
References 1 Ohvecrona, G and Ohvecrona, T (1995) Triglyceride SIS. Curr. Open Llpldol
hpases and atherosclero-
6,291-305
2. Goldberg, I. J. (1996) Lrpoprotem lipase central roles in lipoprotem metabolism and atherosclerosis J Lrpld Res 37,693-707 3 Blaner, W S , Obumke, J C., Kurlandsky, S B., Al-Hatden, M , Ptantedosi, R , Deckelbaum, R. J., and Goldberg, I J (1994) Lipoprotem hpase hydrolysis of retmyl ester. J Blol. Chem 269, 16,559-16,565 4 Tsqita, T. and Okuda, H (1994) Fatty acid ethyl ester synthesizing activity of lipoprotem hpase. J Bzol Chem 269, 5884-5889 5 Berryman, D E and Bensadoun, A (1995) Heparan sulfate proteoglycans are prtmarily responsible for the maintenance of enzyme activity, bmdmg, and degradation of hpoprotem hpase m Chinese hamster ovary cells J Blol Chem. 270,24535-2453 1 6 Argraves, K M , Battey, F. D., MacCalman, C D , McCrae, K R , Gafvels, M , Kozarsky, K F , Chappell, D A , Strauss, J. F III, and Strickland, D K. (1995) Very low density lipoprotem receptor mediates the cellular catabohsm of hpoprotern lrpase and pro urokinase activator/inhibitor complexes J Blol Chem. 270, 26,550-26,557 7 Medh, J D., Bowen, S L., Fry, G L , Pladet, M , Andracki, M , Inoue, I., Lalouel, J M , Strickland, D K , and Chappell, D. A (1996) Lipoprotein hpase binds to low density hpoprotem receptor and induces receptor-mediated catabolism of very low density lipoproteins m vitro. J. BzoE Chem 271, 17,073-l 7,080. 8 Beisiegel, U., Weber, W , and Bengtsson-Ohvecrona, G (1991) Lipoprotem hpase enhances the bmdmg of chylomrcrons to low density ltpoprotem receptor-related protein. Proc Nat1 Acad Scz US A 88,8342-8346 9 Kounnas, M Z , Chappel, D , Strickland, D. K and Agraves, W. S (1993) Glycoprotein 330, a member of the LDL-receptor family binds hpoprotem lipase m vitro J Bzol Chem. 268, 14,17614,181 10 Srvaram, P , Chat, S Y., Curttss, L. K , and Goldberg, I J. (1994) An ammotermmal fragment of apolrpoprotem-B binds to hpoprotem llpase and may facthtate its binding to endothehal cells. J Bzol Chem 269, 9409-9412,
Llgands Interacting with LPL
277
11. Vtlella, E., Joven, J., Ohvecrona, G , Sttgbrand, T., and Jensen, P E (1994) Bmdmg of hpoprotem hpase to alpha2 macroglobulin. Ann NYAcad See. 737,5 1O-5 13. 12 Obumke, J C , Paka, S , Pillartsettt, S., and Goldberg, I. J (1997) Ltpoprotem lipase can function as a monocyte adhesion protem Arterzo T/womb Vast Biol 17, 1414-1420. 13 Osborne J C, Bengtsson-Oltvecrona, G., Lee, N , and Ohvecrona, T (1985) Studtes on macttvation of lipoprotein hpase Role of dtmer to monomer dlssoctatton Blochem J. 245606-56 11. 14 Paterson, J , Fujtmoto, W and Brunzell, J. D (1992) Human hpoprotem lipase Relationship of acttvtty, heparm aftimty, and conformatton as studied with monoclonal anttbodtes. J Lzpzd Res 33, 1165-l 170 15 Wallmder, L , Bengtsson, G., and Oltvecrona, T (1979) Rapid removal to the liver of mtravenously iqected lipoprotein lipase. Bzochzm Bzophys Acta, 575, 166-171. 16. Cheung, A.H., Bensadoun, A., and Cheng, C. F. (1979) Solid phase radtonnmunoassay for chicken LPL Anal Blochem 94,346-357. 17 Stms, M F , Maxfield, F. R , and Goldberg, I J. (1992) Polarized bmdmg of bpoprotem lipase to endothelial cells. Arterzo Thromb 12, 1437-1446. 18 Sivaram, P Wadhwam, S W., Klein, M G., Sasakt, A , and Goldberg, I J (1993) Btotmylation of lipoprotein hpase and hepatic triglyceride ltpase Application m the assessment of cell bmdmg sites Anal Blochem 214, 5 I I-5 16 19 Bayer, E. and Wtlcheck, M. (1990) Protein Biotinylation Methods Enzymol. 184, 138-160. 20 Berryman, D E. and Bensadoun, A (1993) Site directed mutagenesis of putative heparin bmdmg domains ofavtan hpoprotem hpase J Blol. Chem 268,3272-3276 21. Davis, R C , Wong, H., Ntkazy, J., Wang, K , Han, Q , and Schotz, M (1992) Chtmeras of hepatic hpase and lipoprotein hpase* Domain locabzation of enzyme specific properties. J Biol Chem 267, 2 1,499-2 1,504 22 Nilsson-Ehle, P. and Schotz, M. C (1976) A stable, radioactive substrate emulston for assay of lipoprotein bpase. J Lzpld Res 17, 536-54 1. 23 Saxena, U , Klein, M. G , and Goldberg, I J (1991) Identification and characterizatron of a endothehal cell surface lipoprotein hpase receptor J Bzol Chem 266, 17,516-17,521. 24 Bensadoun, A (1991) Lipoprotein ltpase Ann Rev Nutrz 11, 2 17-237 25 Cisar, L A, Hoogewerf, A. J , Cupp, M , Rapport, C A, and Bensadoun, A. (1989) Secretion and degradation of ltpoprotem hpase in cultured adipocytes, Binding of bpoprotem lipase to membrane heparan sulfate proteoglycans IS necessary for degradation. J Blol Chem 264, 1767-1774 26 Misra, K B , Kim, K C , Cho, S , Low, M. G , and Bensadoun, A (1994) Pun& cation and charactertzation of adipocyte heparan sulfate proteoglycans with affinity for ltpoprotem ltpase. J. Blol Chem 269,23,838-23,844. 27 Sivaram, P , Klein, M G and Goldberg, I. J. (1992) Identrficatton of a heparm releasable lipoprotem ltpase binding protein from endothebal cells. J Bzol Chem. 267, 16,517-16,522
278
Pillansettl
28 Sasakt, A , Sivaram, P , and Goldberg, I J. (1993) Lipoprotem hpase bmdmg to adtpocytes. evidence for the presence of heparm sensitive bmdmg protem Amer J Physzol 265, E88@-E888 29 Parthasarathy, N , Goldberg, I J Sivaram, P , Mulloy, B , Folry, D and Wagner, W. D (1994) Ohgosaccharide sequences of endothehal cell surface heparan sulfate proteoglycans with affimty for hpoprotem hpase J. Bzol Chem 269,22,39 l-22,396. 30 Parthasarathy, N., Goldberg, I J , Prllarrsetti, S , et al (1996) Isolatton of heparmderived oligosacchartdes contammg 2-O-sulfated hexuromc acids by LPL affimty chromatography J Blochem Bzophys Meth 32, 27-32 3 1 Lm, P H , Selmfreund, R. H , Wakschull, E , and Warton, W. (1988) Rapid tsolanon of plasmalemma from A43 1 cells charactertzation of epidermal growth factor receptor Anal Bzochem 168,30&305 32 Hascall, V C., Calabro, A , Midura, R J , and Yanagtshrta, M. (1994) Isolation and charactertzation of proteoglycans. Meth Enzymol 230, 39cr-417. 33 Walker, J M (1994) Gradient polyacrylamide gel electrophorests of proteins. Meth Mel Blol 32, 35-38
34. Hancock, K and Tsang V (1983) India mk stammg of proteins on nitrocellulose. Anal Blochem
133, 157-162
25 Monolayer Techniques
for Studying Lipase Kinetics
Stephane Ransac, Margarita and Robert Verger
Ivanova,
Ivan Panaiotov,
1. Introduction Kmettc analyses of lipases and phosphohpases must take mto account the fact that these enzymes generally catalyze then reactions at a lipid-water mterface as opposed to catalysts m a monophasic aqueous environment This chapter discusses the application of an important tool m the kmetic modelmg of these unique enzymes, the monolayer technique. The purpose of this chapter IS to give an overview of kmettc modeling as applied to mterfacial enzyme hpolysts, a brief discussion of the monolayer technique for studymg hpase kinetics, and some applications of the monolayer techmque to study substrate composition and stereoselectivity, hpolytic mhtbitors, mterfaclal bmdmg and acylglycerol synthesis. 1.1. Why Use Lipid Substrates in a Monolayer System? Lipids have been classified by Small (11 depending on how they behave m the presence of water (Fig. 1). This makes it possible to dtstmguish between polar (e.g., acylglycerols) and apolar lipids (e.g., hydrocarbon, carotene). The polar lipids can be further subdivided mto three classes Class I consists of those lipids which do not swell m contact with water and form stable monomolecular films (these mclude triacylglycerols, diacylglycerols, phytols, retmols, vitamin A, K and E, waxes and numerous sterols). The class II lipids (which include phosphohptds, monoacylglycerols, and fatty acids) spread evenly on the surface of water, but since they become hydrated, they swell and form welldefined lyotropic (liquid crystallme) phases such as liposomes. The class III lipids (such as lysophospholipids and bile salts) are partly soluble m water and form unstable monomolecular films, and beyond the critical micellar concentration level, micellar solutions. From
Methods m Molecular Bmlcgy, Vol 109 Lpase and Phosphohpase Protocols Edited by M H Doollttle and K Reue 0 Humana Press Inc , Totowa, NJ
279
Ransac et al.
280
Do not form nwnomolecular
films
Hydrocarbons, carotene, cholestan, etc...
- Imized fatty a& Lysophospholipids l
Fig. 1. A classification of biological lipids based upon their interaction in aqueous systems. (Adapted from Small (I/).
The monolayer is a suitable model system to study enzymatic reactions carried out at interfaces in a heterogeneous medium. A new field of investigation was opened in 1935 when Hughes (2) used the monolayer technique for the first time. He observed that the rate of the phospholipase A-catalyzed hydrolysis of a lecithin film, measured in terms of the decrease in surface potential, decreased considerably when the number of lecithin molecules per square centimeter increased. Since this early study, several laboratories have used the monolayer technique to monitor lipolytic activities, mainly with glycerides and phospholipids as substrates. There are at least five major reasons for using lipid monolayers as substrates for lipolytic enzymes (3-7): (i) It is easy to follow the course of the reaction monitoring one of several physicochemical parameters characteristic of the monolayer film such as surface pressure, potential, and density; (ii) Importantly, it is possible with lipid monolayers to vary and control the interfacial quality, that depends on the nature of the lipids forming the monolayer, the orientation and conformation of the molecules, the molecular and charge densities, the water structure, the viscosity, as well as other properties. Also, with the monolayer technique, it is possible to transfer the film from one aqueous subphase to another. (iii) Using the surface barostat balance, the lipid packing
Aholayer
Techniques
281
of a monomolecular film of substrate molecules can be maintained at a constant pressure during the course of hydrolysis making it possible to obtain accurate presteady state kinetic measurements with mmimal perturbation caused by the increasing amounts of reaction products. (iv) The monolayer technique IS highly sensitive and very little lipid is needed to obtain kinetic measurements. This advantage is critical m the case of synthetic or rare lipids Because of this advantage, a new phosphohpase A, has been discovered using the monolayer techruque as an analytical tool (8). (v) Inhibition of hpase activity by water-msoluble substrate analogs can be precisely estimated using a zero order trough and mixed monomolecular films m the absence of any synthetic, non-physiological detergent Thus, the monolayer technique is suitable for modelmg m viva situations 1.2. Kinetic Models for Interfacial Enzymatic Lipolysis 1 2.7. Kinetics in the Presence of Substrate Only One of the mam assumptions rmphcitly underlying the classical MichaehsMenten model is that the enzymatic reaction must take place in an isotropic medium (i.e., both the enzyme and the substrate must be present m the same phase). This model therefore cannot be used as it stands to study hpolytic enzymes acting mainly at the interface between a water phase and an insoluble lipid phase. In prmciple, the mechamsm of the chemical reactions carried out at the interfaces of a heterogeneous medium depend strongly on mterfacial orgamzation, steric coordmation and the physical interaction between reacting molecules. These chemical mteractions are influenced by the processes of adsorption and desorption, convection and molecular diffusion of the reacting molecules and products of the reaction, etc. One or any combmation of these processes may be rate determinmg. Various models were proposed m order to adapt the Michaelis-Menten kinetic scheme to interfactal lipolySIS. In the simplest model, described by Verger et al. (9), an instantaneous solubihzation of the products of the reaction is assumed (Fig. 2). It is based on the idea that an enzyme/substrate complex might be formed at the mterface. The model consists of two successive steps. The first one IS a reversible penetration of a water soluble enzyme (E) mto the lipid substrate at the mterface The enzyme IS fixed at the interface by an adsorption-desorption molecuIar mechanism. One formal consequence of this stage is the dimensional change m enzyme concentration. The penetration stage (adsorption) sometimes, but not always, mvolves enzyme activation (via the openmg of the amphiphilic lid covermg the active site, for example). This penetration step, leading to a more favorable energy state of the enzyme (E*) is followed by a two dimensional Michaelis-Menten kmetic scheme. The enzyme m the
Ransac et al.
282
Fig. 2. Proposed model for lipase kinetics at interfaces (Adapted from Verger et al. /3,9/).
E* binds a substrate molecule S to form the E*S complex followed by its decomposition. The products of reaction P are soluble in the water phase, desorb instantaneously away and induce no change with time in the physicochemical properties of the interface. An important conceptual detail should be emphasized here : to be consistent with the fact that the enzymecatalyzed reaction occurs at the interface, the concentration of E*, E*S, and S must be expressed as surface concentration units. Resolving the kinetic equations corresponding to the presented model (Fig. 2) together with the equation of mass-conservation at steady state conditions, the following expression for the concentration P of the product released with interface
time t is obtained:
1+kd+s
kPf
K,ti
(1)
where t is the interfacial Michaelis-Menten constant. t, and t2 are the induction times, describing the establishment of the penetration-desorption and the interfacial Michaelis-Menten steady states,respectively. A and Vare the total interfacial area and volume of the system, respectively. If we assume a rapid equilibrium between E* and E*S as compared to E and E*, then Equation 1 can be simplified as:
Monolayer Techniques
283
The mduction time t reflects essenttally the establishment of the penetration-desorptton equtltbrmm (9) and 1sthe mtercept of the asymptote with the time axis. We have to note however, that some experimental data do not fit with this model (J&11) Some lag ttmes were called “catastrophtc lag time.” They are characterized by the fact that after a certain time of low hydrolytic rate, a short acceleratmg phase leads to a high reaction rate. This sudden increase m hydrolyttc rate 1saccompamed by a concomitant increase m hpase bmdmg to the interface Furthermore, these lag times are dependent upon the presence of products m the interface (10). The rate of product release, in the stattonary state, can be written as follows:
(3)
For detimtions of the parameters m the above equations, see refs. 9,12,13. A more complex kmettc model has also been proposed that takes mto account the mterfacial accumulation and reorganization of the msoluble products of the reaction (14). An important simplification can be made m the monolayer condttion. In monolayer systems, A/V has a very low value (approx 1 cm-‘) and hence a limited number of all enzyme molecules present m bulk solutton are adsorbed at the interface (E >> (E* + E*S) ). Wrth this assumptton applied to Equation 3, we obtain the followmg stmpltfied expression for the rate of hydrolysts at steady state: ,jm=dll= kt EG=Q,,&S dt
K;* PV
(4)
where v, 1sthe rate of hydrolysis of the monolayer, and Q, is a global kmettc constant, called “interfacial quality” (9) taking mto account the influence of the physico-chemical properties of the Interface on the enzyme activtty. In the case of the hydrolyses of lipid parttcles (emulsion for lipases or hposomes for phosphohpase AZ), where all the enzyme is bound to these particles, (E << (E* + E*S) A/V), Equation 3 can be simphfied (9):
Ransac et al
284 VP=@= ht dt i&s
&S=Q,, ,CoS
where vP 1sthe rate of hydrolysis of the particles, and QP 1san overall kmettc constant 1.2.2. Kinteics in the Presence of a Competitive inhibitor Kinetic models accountmg for the competttlve mhibition m the presence and absence of detergent (12) and for trreverstble inacttvation (15) have also been developed. With the monolayer technique, we are usually working without detergent. The rate of product formatton, m the stattonary state, in the presence of a competittve mhtbitor (see Fig. 3), can be written as follows*
where I is a hpase competitive mhtbttor. The mmtmal change that can be made at increasing mhibttor concentrattons 1sto mamtam constant the sum of inhibitor and substrate (I+S) when varying the inhibitory molar fraction Ta = I/(I+S), i.e., to progressively substitute a molecule of substrate by a molecule of mhtbttor. Under these condmons, the above equation becomes.
With the hypothesis of tdenttcal molecular area for the substrate and the inhibitor, this rate can be simplified as:
v=dP&& dt
1-a
a@-1)+&(1++)+*
(*)
This equation fits perfectly with the experimental data obtained m the presence of competitive mhtbttors (16). Vartattons of the relative velocity as a func-
285
Monolayer Techniques
Fig. 3. Proposed model for competitive Verger et al. (3,121).
inhibition
at interfaces (Adapted from
tion of the inhibitor molar fraction are described in Fig. 4A. Ransac et al. (12)
proposed to plot a velocities ratio defined as: R, = x = velocity in the presence of an inhibitor with K; = KL and AI = As v2 velocity in the presence of an inhibitor with KI* f KG and AI f As
(9)
This ratio (R,,) varies linearly with the inhibitor molar fraction (To) (Fig. 4B) and, under the same hypothesis of Equation 8, can be written as:
The slope of theselines (Fig. 4B) is a function of the ratio K*I/K*M, and has been coined by Ransac et al. (12) Z and named the “inhibitory power” of the molecule tested.Concerning the ToSo,which is the molar fraction of inhibitor which reduces the enzymeactivity to 50%, it can been written as: ct50=
~ 1 2+z
(11)
2. Materials 1. “Zero-Order” Trough: Several types of troughs have been used to study enzyme kinetics. The simplest of these is made of TeflonTM, rectangular-shaped (Fig. 5A) but gives nonlinear kinetics (I 7,18). To obtain rate constants, a semilogarithmic transformation of the data is required. This drawback was overcome by a new trough design (“zero
Ransac et al
286
0
us0
07.
04
Inhibitor
InhIbItor
06
molar
fraction:
molar
fraction:
08 c(
a
Fig 4 (A) Relattve enzyme velocity as a functton of the mterfactal molar ratto of mhtbttor (a) (From Ransac et al /I2/) (B) Ratio between velocittes vI and v2 from panel A as a function of the mterfactal molar ratto of mhtbttor (a) (From Ransacet al /12h order” trough, Fig. SB), conststmgof a substratereservoir and a reaction compartment contammgthe enzyme solutton (19) The two compartmentsare connected to eachother by a narrow surfacecanal madem etched glass The klnetrc recordings obtained with this trough are lmear, unhke the nonlinear plots obtamed with the usual one-compartmenttrough. The surface pressurecan be maintained constant automattcally by the surface barostat method descrtbedm (29). Fully automated monolayer systemsof this kmd are now commercially available (KSV, Helsmkt, Finland), and have beenfound to have many advantages 2 Medmm-Chain Ltptd as Substrate. In order to use the monolayer technique for hpase kmetlcs, one necessarycondmon 1sthat the substrate must be msoluble
287
Monolayer Techniques
“First order” trough
“Zero order” trough Fig. 5. Comparison of lipase kinetic obtained with a “first-order” trough (A) and a “zero order” trough (B). (Adapted from Verger et al. (19j). into the aqueous subphase, and form stable monomolecular films. The enzymatic hydrolysis of short or medium-chain lipid substrates yielding water soluble products can be easily interpreted on the base of Equation 1 and Equation 3. A typical example is the didecanoylglycerol, which forms perfectly stable film up to 32 mN/m and both products, monoacylglycerol and fatty acid, desorb rapidly into the aqueous subphase. In the case of the trioctanoylglycerol, the dioctanoylglycerol, formed during the first lipolysis step could transitively remain in the film and be either further hydrolyzed or solubilized. In the case of short or medium-chain lipid substrate when the reaction products are water soluble, the enzymatic hydrolysis can also be followed at constant area A by measuring the fall of surface density (I) detected by the radioactive method (20,21)
288
Ransac et al
or of surface pressure (x) (22) The mam objection IS related to the fact that the state of the monolayer changes durmg the reaction and the kinetic constants (k,/k,, keM, and k,,J are not true constants 3 Long-Chain Lipid as Substrate* In the case of long-chain lipid substrate such as diolem, for which the reaction products are msoluble and remain m the monolayer, the rate of the barrier movement is much slower than the corresponding rates obtained with short and medium-chain lipid such as dicaprtn The main reason for such a difference is that oleoyl products are not very soluble in the aqueous subphase, and hence the rate of the barrier movement does not directly reflect the enzymatic activtty Other factors contributing to delayed barrier movement are the posstble molecular reorganization of the ltpolyttc products at the interface (P* -+ P**) together with product inhibition The complete kinetic treatment of such a model will require the mtroductton of addtttonal kinetic equations describmg the slow desorption process (P* + P), the possible reorgamzatton process (P* + P**) and product mhibttion However, satisfactory kmetic modeling taking these factors into consideration is not feasible at this time since even m the simplest situation of water soluble ltpolytic products the mtrmstc mterfacial hydrolytic kinettc constant IK*M cannot as yet be experimentally determined This IS the reason why we prefer to use the uutial model (Fig. 2) and Equation 4 to estimate the global kinetic constant Q, We have developed a method m our laboratory for studymg the hydrolysis of long chain lipid monolayers mvolvmg controlled surface density (5,6) A large excess of serum albumin has to be present m the aqueous subphase in order to solubihze the hpolytic products This step was found not to be rate hmitmg The linear kinetics obtained with natural long chain phosphohptds were quite similar to those previously described m the case of short chain phosphohpids using a “zero order” trough with the barostat technique (19) Another way of using long chain lipid monolayers IS based on the unique properties of P-cyclodextrin (P-CD) A study on the desorption rate of insoluble monomolecular films of oletc actd, monoolem, 1,2-diolem, 1,3diolem and trtolem at the argon/water interface by the water-soluble P-CD has been published (23) The desorption of the water msoluble reaction products (oletc acid and monoolem) probably involves the complexation of the single acyl chain tnto the P-CD cavtty and desorptton into the aqueous phase of the soluble oleic acid/P-CD and monoolem/P-CD complexes (23). In the case of monolayers of multiple acyl chain molecules such as diolein and triolem, no detectable change tn the surface pressure occurred after P-CD injection The surface rheological dtlatattonal properties of the monolayers of dtolein and trtolem m the presence of P-CD in the subphase were studied The elasticity of the diolein monolayer remamed unchanged, whereas the decrease m the surface elasticity of the triolem film was attrtbuted to the formation of a water-msoluble triolen@-CD complex With the ‘tunmg fork’ model, one acyl chain of triolem can be included m the P-CD cavtty. Sche-
Monolayer Techniques
OH
B
Fig 6 Representatton of P-CD actlon of monomolecular films Diagram of the watersoluble olelc a&/&cyclodextnn mcluslon complex (A) No complex formatlon between 1,2-dlolein and P-CD (B). Inclusion of a single acyl chain having the tuning fork type conformatlon of triolem mto the P-CD cavity (C) Inclusion of a smgle acyl cham havmg the tunmg fork type conformation of tnolem into the P-CD cavity (From Laurent et al. (23fi matlc models have been proposed to attempt to explain the complexation of these liplds by P-CD at the argon/water Interface (see Fig. 6) In addltlon to the above results, the presence of P-CD m the water subphase makes it possable for the first time to perform kmetic measurements of the hpase hydrolysis rates of long-cham glycerides formmg monomolecular films
Ransac et al.
290
u
Substrate
b
Inactivator
Soluble
products
Fig. 7. Principle of the methodfor studying enzymaticlipolysis of mixed monomolecular films (From Pitroni et al. [24/). 3. Methods 3.1. Mixed Monolayers as Lipase Substrates Most studies on lipolytic enzyme kinetics have been carried out in vitro with pure lipids as substrates. Virtually all biological interfaces are composed of complex mixtures of lipids and proteins. The monolayer technique is ideally suited for studying the mode of action of lipolytic enzymes at interfaces using controlled mixtures of lipids. There exist two methods of forming mixed lipid monolayers at the air-water interface: either by spreading a mixture of waterinsoluble lipids from a volatile organic solvent, or by injecting a micellar detergent solution into the aqueous subphase covered with preformed insoluble lipid monolayers. A new application of the “zero-order” trough was proposed by Pieroni and Verger (24) for studying the hydrolysis of mixed monomolecular films at constant surface density and constant lipid composition (Fig. 7). A TeflonTM barrier was placed transversely over the small channel of the “zero-order” trough in order to block surface communications between the reservoir and the reaction compartment. The surface pressure was first determined by placing the platinum plate in the reaction compartment, where the mixed film was spread at the required pressure. Surface pressure was then measured after switching the platinum plate to the reservoir compartment, where the pure substrate film was subsequently spread. The surface pressure of the reservoir was equalized to that of the reaction compartment by moving the mobile barrier. The barrier between the two compartments was then removed in order to allow the sur-
Monolayer Techniques faces to communicate. The enzyme was then injected into the reaction compartment and the kinetics was recorded as described (19). The main purpose of this study was to describe the influence of lecithin upon lipolysls of mixed monomolecular films of tr~octanoylglycerol/didodecanoyl-phosphat~dyIcholme by pancreatic lipase m order to mimic some physlologlcal situations. The authors used a radlolabeled pancreatic hpase (5-thio-2-mtro [ 14C] benzoyl hpase) to determine the influence of the film composltron on the enzyme penetration (adsorption) and/or turnover at the interface. Of spectal interest 1sthe concept of Scow et al (25,2/j), according to which triacylglycerol hydrolysis can be taken to be the first step in lateral flow lipid transport in cell membranes. Llpolytlc activity was enhanced three- to fourfold m the presence of cohpase, an effect which was attributed to the increase m the enzyme turnover number. When a pure trlacylglycerol film was progressively diluted with leclthin, the mmlmum specific actlvlty of lipase exhIbited a bell-shaped curve: a mixed film contammg only 20% trioctanoylglycerol was hydrolyzed at the same rate as a monolayer of pure tnacylglycerol. The mam conclusion drawn from this study was that considerable activation or mhlbltlon may result as a function of the hpld composltlon, hpld packing, and surface defects m mlxed films. 3.2. Inhibition of Lipases Acting on Mixed Substrate/Inhibitor Monomolecular
Films
It is now becoming clear from the abundant hpolytlc enzyme literature that any meaningful interpretation of mhlbltlon data has to take mto account the kinetics of enzyme action at the lipid-water Interface. Usmg the method described m Subheading 3.1., mixed substrate/mhlbltor monomolecular films may be formed to study the lipase inhibition As illustrated m Fig. 3, Ransac et al (12) have devised a kinetic model, which 1sapplicable to water msoluble competitive inhibitors, m order to quantitatively compare the results obtamed at several laboratories Furthermore, with the kinetic procedure developed, It was possible to make quantitative comparisons with the same mhlbltor placed under various physlco-chemical situations, i.e., mlcellar or monolayer states. Adding a potential competltlve mhlbltor to the reaction medium can lead to paradoxical results Usually, variable amounts of inhrbltor are added, at a constant volumic concentration of substrate. The specific area and the mterfaclal concentration of substrate are continuously modified accordingly. In order to mmlmlze modlficatlons of this kind, It was proposed to mamtam constant the sum of Inhibitor and substrate (I+S) when varying the mhlbitory molar fraction (a = I/[I+S]), i.e., to progressively substitute a molecule of substrate by a molecule of mhlbltor (27). This 1sthe minimal change that can be made at increasmg mhlbltor concentrations. Of course, wtth this method, the classical kmetlc procedure based upon the Michaelis-Menten model is not valid because both mhlbltor and substrate concentrations vary simultaneously and Inversely. How-
292
Ransac et al.
ever, by measuring the inhibitory power (Z), as described by Ransac et al (12) or X1(50) (the molar fraction of mhtbttor that reduces the enzyme velocity to half its Initial value, as used by Jain et al. (28), it 1sposstble to obtain a normalized estimation of the relative efficiency of vartous potential mhibitors. This method has been successfully used for the studies on the mhibmon on phosphohpase A2 by substrate analogs (16). Covalent mhibitton of lrpases have also been performed with the mixed film method Inhibitors used were serme reagents (phosphonates /29/ or tetrahydrolipstatin (151) or cysteine reagents (dodecyl dithto-5-[2-mtrobenzoic acid][l5]). 3.3. lnterfacial Binding and Film Recovery Using the monomolecular film technique, several investigators have reported that an optimum occurs m the velocity-surface pressure profile The exact value of the optrmum vartes considerably with the particular enzyme/ substrate combmation used Qualttative interpretations have been given to explam this phenomenon. The first hypothesis, proposed by Hughes (2) and supported by later workers (30,31) was that a packing dependent orientation of the substrate may be one of the factors on which the regulation of hpolysls depends. Of special interest is the recent approach by Peters et al (32) on the structure and dynamics of 1,2-sn-dipalmttoylglycerol monolayers undergoing two phase transitions at 38.3 and 39 8 A2 per molecule. The first transition is unique for dtacylglycerol molecules and is driven by a reorganization of the headgroups causing a change in the hydrophobicity of the oil-water interface X-ray diffraction studies of different mesophases shows that m the two highest pressure phases, the alkyl chains pack m an hexagonal structure relaxing to a distorted-hexagonal lattice in the lowest pressure phase with the alkyl chains tttled by -14” in a direction close to a nearest neighbor direction Another interpretation was put forward by Esposito et al. (331, who explained the surface pressure opttmum m terms of changes m the ltpase conformation upon adsorption at the Interface, resulting m an optimal conformation at intermediate values of the interfacial free energy (film pressure). It was suggest that lower and higher values of surface pressure would lead to macttve forms either because of denaturation or because the conformational changes m the enzyme structure are not sufficiently marked. This view was challenged by Verger et al. (3) and Pattus et al. (34). Using radiolabeled enzymes, these authors showed that the observed maxima in the velocity-surface pressure profile disappear when they are correlated with the mterfacial excess of enzyme. Indeed, the mam drfference between the monolayer and the bulk system lies m the mterfacial area to volume ratios which differ from each other by several orders of magnitude. In the monolayer system,this ratio is usually about 1 cm-‘,
Monolayer Techniques
293
depending upon the depth of the trough, whereas m the bulk system tt can be as high as 1O5cm-‘, depending upon the amount of lipid used and the state of lipid dispersion. Consequently, under bulk conditions, the adsorption of nearly all the enzyme occurs at the interface, whereas with a monolayer only one enzyme molecule out of one hundred may be at the interface (18). Owmg to this situation, a small but unknown amount of enzyme, responsible for the observed hydrolysis rate, IS adsorbed on the monolayer. In order to crrcumvent this llmitation, different methods were proposed for recovermg and measurmg the quantity of enzymes adsorbed at the interface (35-38). After performing velocity measurements, Momsen and Brockman (37) transferred the monolayer to a piece of hydrophobic paper and the adsorbed enzyme was then assayed titrimetrically. After correcting for blank rate and subphase carry-over, the moles of adsorbed enzyme were calculated from the net velocity and the specific enzyme activity. In assaysperformed with radioactive enzymes (35), the film was aspirated by inserting the end of a bent glass capillary into the liquid memscus emerging above the ridge of the TeflonTM compartment walls. The other end of the same capillary was dipped into a 5-mL counting vial connected to a vacuum pump. As radioactive molecules dissolved m the subphase were unavoidably asptrated with the film constituents, the results had to be corrected by counting the radioactivity m the same volume of aspirated subphase. The difference between the two values, which actually expressed an excessradioactivtty existing at the surface, was attributed to the enzyme molecules bound to the film. Smce it is possible with the monolayer techmque to measure the enzyme veloctty expressed in pmol ucrnM2*mm* and the interfacial excessof enzyme m mg/cm2, it is.easy to obtain an enzymatic specific activity value, which can be expressed as usual in pm01 ’ mu-’ * mg-r . Using radiolabeled 5,5’-dithiobis(2-nitrobenzoic acid) (DTNB), Gargouri et al. (39) investigated the interactions between covalently labeled [14C]TNBhuman gastric hpase ([r4C]TNB-HGL) and monomolecular ltpid films. It is worth noting that [14C]TNB-HGL is an inactive enzyme, and moreover, to facilitate detectron, that the [ i4C]TNB-HGL concentrations used by Gargouri et al. (39) to study its binding to monomolecular films were about 40 times higher than the usual catalytic concentrations of HGL. Under these conditions, the existence of a correlation between the increase m surface pressure and the amount of protein bound to the interface was the only possible conclusion which could be drawn by the authors. They showed that m the presence of egg PC films, the total amounts of surface bound [i4C]TNB-HGL decreased linearly as the initial surface pressure increased; whereas, using hpase substrates such as dicaprin films, the amounts of surface bound inactive [r4C]TNB-HGL remained constant at variable surface pressures (39).
294
Ransac et al
The ELISA/btotm-streptavtdm system has been found to be as senstttve as the use of radtolabeled proteins (40) In addttton, btotmylatton preserves the btological acttvtties of many proteins. Using this labeling procedure, Aoubala et al. (41) recently developed a spectfic double sandwich ELISA to measure the human gastric hpase (HGL) levels of duodenal contents.An other applicatton of this method was to develop a senstttve sandwich ELISA, using the biotmstreptavldm system,and to measure the amount of surface-bound HGL and anttHGL monoclonal anttbodtes (mAbs) adsorbed to monomolecular hpid films. The detection limit was 25 pg and 85 pg in the caseof HGL and mAb, respecttvely. By combmmg the above sandwich ELISA technique with the monomolecular film technique, tt was possible to measure the enzymatic acttvtty of HGL on 1,2-dtdecanoyl-sn-glycerol monolayers as well as to determine the correspondmg mterfacial excessof the enzyme (38) The HGL turnover number increased steadily with the ltptd packmg. The specific activities determined on dtcaprin films spread at 35 mN/m were found to be m the range of the values measured under optimal bulk assay condmons, using trtbutyrm emulston as substrate (I e., 1000 urn01 . mint * mg-t of enzyme). At a given llpase concentratton m the water subphase, the mterfactal bmdmg of HGL to the non hydrolyzable egg yolk phosphatrdylcholme monolayers was found to be ten times lower than m the case of dicaprm monolayers (38). However, we have to keep m mmd that the surface bound enzyme Includes not only those enzyme molecules directly involved m the catalysts but also an unknown amount of protein present close to the monolayer. These enzyme molecules were not necessarily involved m the enzymatic hydrolysis of the film 3.4. Stereoselectivity of Lipases is Confrolled by Surface Pressure Lipases, which are bpolytic enzymes acting at the ltptd/water interface, drsplay stereoselectivity towards acylglycerols and other esters (4244). As stated m the mtroductton, btologtcal lipids, which self-organize and orientate at mterfaces, are chn-al molecules, and then chtraltty is expected to play an important role m the molecular mteractrons between proteins and btomembranes. The most unusual aspect of acylglycerol hydrolysis catalyzed by pure hpases 1sus particular stereochemistry (45-53). Under phystologtcal condtttons, many other hydrolases, such as phospholipases, proteases,glycosidases and nucleases, encounter only one optical antipode of their substrates.Lrpases, on the contrary, can encounter both choral forms of their substrates as well as molecules which are prochtral This unique situation calls for some fundamental clartficatton, since the phystologtcal consequences of lrpase stereopreferences are not known. Membrane-like lipid structures, such as monolayers, provide attractive model systems for mvestigatmg to what extent lipolyttc acttvittes depend upon the chtrahty and other phystcochemtcalcharactenstrcsof the lipid/water interface.
295
Monolayer Technqfes
$Lio; l--\*:1tG--. 1001
.
t
h
g E
a0 -
sn -1
40-
Lipoprotein
Lipase
1
0
sn -3
. .
-I
Candida . ,
* .
antarctica . I
B Lipase i
I
C . . _ :. . .
sn -1 Human
20 0
10
gastric Lipase 1 7 I * , 20 30 40
Surface
? 0
pressure
Mucor maehei I . , 10 20
Lipase I . 30
I 40
-i
(mN.rr~‘~)
Frg 8 Kmettc resolutrons of 1,2-rat-dtcapnn wrth hpoprotem hpase, Cundldaantarctzca B lrpase, human gastric lipase and Rhlzomucormzehezlipase All the reactions were performed rn a single compartment trough The enantromenc excess% was measured at 50% yteld, 1.e, when the bamer had moved halfway acrossthe trough (From Rogalska et al (49fi The mechanism whereby an enzyme differentiates between two antipodes of a chn-al substrate may be influenced by phystcochemtcal factors such as the temperature (54,55), the solvent hydrophobicity (56-59) or the hydrostattc pressure (60), that can affect the stereoselecttvtty of the reaction To achieve a measurable Impact of hydrostatrc pressure on a protein m a bulk solutton, however, high pressures of the order of 3 kbar need to be used and momtormg the enzyme acttvtty under these condttions IS difficult On the other hand, the surface pressure IS easy to manipulate and its effects on the enzyme acttvtty can be readily controlled. Rogalska et al. (49) investigated the assumptton that the stereoselectivity, which IS one of the basic factors mvolved m enzymatic catalysts, may be pressure-dependent. When working wrth bulk soluttons, the external pressure 1s not a practtcal varrable because lrqurds are highly mcompresstble, whereas the monolayer surface pressure 1s easy to manipulate To estabbsh the effects of the surface pressure on the stereochemtcal course of the enzyme action, during which optical activity 1s generated m a racemtc substrate msoluble m water, the authors developed a method with which the
Ransac et al. enantlomenc excessof the residual substratecan be measured m monomolecular films. With all four hpases tested (Rhzzomucor mzehez hpase, hpoprotein hpase, Candzda antarctzca B lipase and human gastric hpase), low surface pressures enhanced the stereoselectivity (see Fig. 8) whereas decreasing the catalytic actlvity. This finding, which to our knowledge is unprecedented, should help to elucidate the mode of action of water-soluble enzymeson water-insoluble substrates In another study, Rogalska et al. (61) presentedthe results of an extensive comparative study on the stereoselectivity of 23 lipasesof animal and microbial origin. Contrary to previous studies on hpase-acylglycerol choral recognition where racemic or prochiral substrateswere used, the substrateschosen here were three optically pure dicaprm isomers. The monomolecular film technique was chosen as a particularly appropriate method for use in choral recognition studies (62-67) To establish the effects of the surface pressure on the stereochemical course of the enzyme action, Rogalska et al. (61) used as lipase substrates optically pure dicaprm enantiomers 1,2-sn-dicaprm, 2,3-sn-dicaprm and 1,3-sn-dicaprm, spread as monomolecular films at the air/water interface. The two former isomers are optically active antipodes (enantiomers), forming stable films up to 40 mN/m, while the latter one is a prochlral compound, which collapses at a surface pressure of 32 mN/m. To our knowledge, this 1sthe first report on the use of three dia-cylglycerol isomers as hpase substratesunder identical, controlled physicochemical conditions. In this study, the authors showed that the regioselectivity, as well as the stereoselectivity, which are main factors involved m hpolytic catalysis of acylglycerols, are surface-pressure-dependent.The hpasestested displayed highly typical behavior, characteristic of each enzyme,which allowed them to classify the hpasesinto groups on the basis of. 1)enzyme velocity profiles as a function of the surface pressure, 11)their preferences for a given diacylglycerol isomer, quantified using new parameters colt-redas stereoselectivity index, vicmlty index, and surface pressurethreshold. The general findmg which was true of all the enzymes tested, was that the three substratesare clearly differentiated, and the differentiatton is more pronounced at high interfacial energy (low-surface pressure). This finding supports the hypothesis that lipase conformational changes resulting from the enzyme-surface interaction affect the enzyme spectfictty. Generally speaking, the stereopreference for either position sn-1 or ~2-3 on acylglycerols is mamtained in the case of both dt- and triacylglycerols. We link this effect to the assumedhpase conformational changesinvolving the active site, occurring upon the enzyme-interface mteraction. 3.5. Acylglycerol Synthesis Catalyzed by Cutinase Using the Monomolecular Film Technique When enzymatic catalysts takes place in systems with a low water content, the resulting thermodynamic equilibrium favors synthesis over hydrolysis.
Monolayer Techniques
297
Hydrolytic enzymes can therefore be used to catalyze the formation of ester bonds in these systems. Among the hydrolytic enzymes, hpases have been widely used to perform esterification or transesterification reactions. Lipid monolayers have been used recently as hpase substrates wtth the monomolecular film technique. Melo et al (68) adapted the monomolecular film technique for use m the synthesis of oleoyl acylglycerols (monoolein, diolem and triolem) as schematically shown m Fig. 9. The water subphase was replaced by glycerol and a stable film of oleic acid was imttally spread on its surface. This method makes it possible to study and perform ester synthesis m a new and ortgmal system involving a specific array of self organized lipid substrate molecules. The authors continuously recorded the surface pressure and furthermore estrmated the acylglycerol synthesis after film recollectron and HPLC analysts, at the end of the experiment. A purified recombinant cutmase from Fusanum solani (69) was used as a biocatalyst in this study. More than 50% of the oleic acid film was acylated after seven minutes of reaction. The surface pressure applied to the monomolecular film acts as a physical selectivity factor, since acylglycerol synthesis can be steered so as to produce either diolein or triolem. Acknowledgements Research was carried out with financial support from the BRIDGE-T-Lrpase (contract BIOT-CT91-0274 DTEE) and BIOTECH-G-Lipase (contracts BI02CT94-304 1 and BI02-CT94-3013) programs of the European Union as well as the CNRS-IMABIO prolect. References 1 Small, D. M (1968) A classificationof brologxal lrprds based upon then mteractron m aqueous systems
J Amer 011 Chemtsts Sot 45, 108-l 19
2 Hughes,A (1935) The action of snakevenoms on surface films Blochem J 29, 43 7-444 3. Verger, R and de Haas, G H (1976) Interfacral enzyme kmetrcs of bpolys~s Annual Review Bzophys Bloeng 5,77-l 17 4 Verger, R (1980) Enzyme kmetics of lipolysts. Methods m Enzymology 64,340-392 5 Verger, R and Pattus, F. (1982) Lrprd-protem mteracttons m monolayers Chem
Phys Lcpids 30, 189-227
6 Ransac,S.,Moreau, H., Riviere, C , andVerger, R. (199 1)Monolayer techniques for studying phospholipase
kmettcs. Methods Enzymol
197,49-65
7 PiCroni,G.,Gargouri,Y , Sarda,L., andVerger,R. (1990)Interactionsof hpaseswith lrptd monolayers Facts and questrons Adv Collozd Interface Scl 32,341-378. 8. Verger, R., Ferrato, F., Mansbach, C M., and Pitroni, G (1982) Novel intestinal phospholtpase A2: Purtfication and some molecular characterrstrcs Blochemlstry 21,6883-6889.
Ransac et al.
3 Reaction O(
time = 0
8oMonoolern
synthesis
7ca
(< 1.0 mN.m-1) m?
folem and 1 nolern syntheu
n; c
@
@PLC analysis)
Fig. 9. Steps occurring in a first-order trough after the spreading of an oleic acid monolayer (2) over a glycerol subphase containing cutinase (1). Monoolein synthesis (4).Diolein and triolein synthesis (5). Film recovery (6) and HPLC analysis (7). Open ovals stand for oleic acid ; solid ovals, monoolein ; stippled ovals, diolein ; diagonally striped ovals, triolein. Surface pressures are indicated by the slopes of the arrows on the right-hand side. The platinum plate is depicted as a thick vertical bar. Acylglycerol molecules are indicated by an arrow (From Melo et al. /68fi.
Monolayer Techniques
299
9. Verger, R , Mteras, M C E , and de Haas, G H (1973) Actton of phosphohpase A at mterfaces J Blol Chem 248,4023-4034 10. Wteloch, T , Borgstrom, B , Pterom, G., Pattus, F., and Verger, R. (1982) Product acttvatton of pancreatic hpase Ltpolyttc enzymes as probes for lipid/water mterfaces J Blol Chem 257, 11,523-l 1,528 11 Ransac, S., Rogalska, E , Gargourt, Y., Deveer, A M T J , Paltauf, F , de Haas, G H , and Verger, R (1990) Stereoselecttvtty of lipases 1 Hydrolysis of enanttomerrc glyceride analogues by gastrtc and pancreatic hpases A kmettc study using the monomolecular film techmque J Bzol Chem 265, 20,263-20,270 12. Ransac, S , Rrvicre, C , Gancet, C , Verger, R , and de Haas, G H (1990) Competitive mhtbmon of lipolyttc enzymes. I. A kinetic model applrcable to watermsoluble competitive mhibttors Blochtm Blophys Acta 1043, 57-66 13. Ransac, S (1991) Modulatton des acttvttes (phospho)ltpasiques Mise en ceuvre de la techntque des films monomoleculau-e pour l’etude d’mhtbtteur specttiques et la dctermmation de la stCrCo-selectivite des enzymes ltpolytiques Thesis, Umversity of Atx-Marseille II 14. Raneva, V , Ivanova, T , Verger, R , and Panaiotov, I (1995) Comparatrve kmetics of phosphohpase A2 action on hposomes and monolayers of phosphatidylcholme spread at the an-water interface Colloids Surfaces B Bzomterfaces 3,357-369 15 Ransac, S , Gargouri, Y , Moreau, H , and Verger, R (199 1) Inactivation of pancreatic and gastric hpases by tetrahydrolipstatm and alkyl-dithto-5-(2-mtrobenzotc acid) A kinetic study with 1,2-didecanoyl-sn-glycerol monolayers Eav J Blochem 202,395-400 16 Ransac, S , Deveer, A M T J , Rivitre, C , Slotboom, A J., Gancet. C , Verger, R , and de Haas, G H. (1992) Competttive mhtbttton of lipolytic enzymes V A monolayer study usmg enanttomeric acylammo analogs of phosphohpids as potent competitive mhibttors of porcme pancreatic phospholtpase A2 Blochzm Blophys Acta 1123,92-100 17 Dervrchtan, D. G (197 1) Methode d’etude des reacttons enzymatiques sur une interface Bzochwzce 53, 25-34 18. Zografi, G , Verger, R , and de Haas, G. H (1971) Kmetrc analysis of the hydrolysis of lecithm monolayers by phosphohpase A Chem Phys Lzpplds 7, 185-206 19 Verger, R and de Haas, G H (1973) Enzyme reactions m a membrane model 1 A new techmque to study enzyme reactions m monolayers Chem Phys Lzpzds 10, 127-136 20 Bangham, A D and Dawson, R M C (1960) The physical requirements for the action of Penzczllzum notatum phosphohpase B on ummolecular films of lectthm Bzochem J 75, 133-138 21 Dawson, R. M C (1966) The hydrolyses of ummolecular films of 32P-labelled lecithm, phosphattdylethanolamme and phosphattdylmositol with phospholtpase A (Naya naja venom). Blochem J 98,35c-37c 22 Jagockt, J W , Law, J H , and Kezdy, F J, (1973) The kmettc study of enzyme action on substrate monolayers Pancreatic hpase reactions. J B~ol Chem 248, 580-587 23 Laurent, S., Ivanova, M G , Pooch, D , Gratlle, J , and Verger, R. (1994) Interactions between P-Cyclodextrm and insoluble glyceride monomolecular films at the argon/water interface . application to hpase kmettcs. Chem Phys Lzpzds 70,35-42
300
Ransac et al.
24 Prtrom, G and Verger, R (1979) Hydrolysis of mixed monomolecular films of triglycertde/lectthm by pancreatic hpase J Bzol Chem 254, 10,090-10,094 25 Scow, R O., Blanchette-Mackte, E. J., and Smith, L C (1976) Role of captlary endothelmm m the clearance of chylommrons. A model for lipid transport from blood by lateral diffusion in cell membranes Czrc Res 39, 149-163. 26 Scow, R O., Desnuelle, P.and Verger, R (1979) Lipolysts and hpid movement m a membrane model. Action of hpoprotem hpase J Blol Chem 2546456-6463 27 de Haas, G., van Oort, M., Dtjkman, R , and Verger, R (1989) Phosphohpase A2 mhibttors : Monoacyl, monoacylammo-glucero-phosphocholines. Btochemical Society Transacttons, London 28. Jain, M. K and Berg, 0 G (1989) The kmetics of mterfactal catalysis by phospholipase A2 and regulatton of mterfactal activation hopping versus scootmg Blochlm Bzophys Acta 1002, 127-156. 29 Marguet, F , Douchet, I., Cavaher, J F , Buono, G., and Verger, R (1998) Interfacial and/or molecular recogmtton by hpases of monomolecular films of chnal organophosphorus glyceride analoguesv Chzralq, submitted 30. Smaby, J M , Muderhwa, J M , and Brockman, H L. (1994) Is lateral phase separatton required for fatty acid to sttmulate hpases m a phosphattdylcholme Interface. Bzochemistry 33, 1915-I 922 3 1. Muderhwa, J. M. and Brockman, H L. (1992) Lateral ltptd dtstrtbution 1sa maJor regulator of hpase activity Implications for hpid-mediated signal transduction J Blol Chem 267,24,184-24,192 32 Peters, G H , Toxvaerd, S , Larsen, N. B., BJarrnholm, T , Schaumburg, K , and KJaer, K. (1995) Structure and dynamics of liptd monolayers imphcatrons for enzyme catalysed llpolysis. Nature Struct Bzology 2, 395-40 1. 33. Esposito, S , SCmCrtva, M , and Desnuelle, P (1973) Effect of surface pressure on the hydrolysis of ester monolayers by pancreatic lipase Blochrm Bzophys Acta 302,293-304. 34 Pattus, F , Slotboom, A J., and de Haas, G H (1979) Regulatton of phosphoh-
pase A2 acttvtty by the lipid-water Interface. a monolayer approach. Blochemlstry 13,2691-2697. 35 Rtetsch, J , Pattus, F , Desnuelle, P., and Verger, R (1977) Further studtes of
mode of action of lipolytic enzymes. J Biol Chem 252,43 1343 18 36 Bhat, S G. and Brockman, H. L. (1981) Enzymattc Synthesis/Hydrolysrs of Cholesteryl Oleate m Surface Ftlms. J BzoE. Chem 256,3017-3023 37 Momsen, W E and Brockman, H. L (1981) The adsorption to and hydrolyses of 1,3-dtdecanoyl glycerol monolayers by pancreattc ltpase. Effect of substrate packmg density J Bzol Chem 256,69 13-6916 38. Aoubala, M , Ivanova, M , Douchet, I , de Caro, A , and Verger, R. (1995) Interfacial bmding of human gastric lipase to hptd monolayers, measured wtth an ELISA. Brochemrstry 34, 10,78fG10,793 39 Gargouri, Y ., Moreau, H., Pterom, G , and Verger, R (1989) Role of a sulfhydryl group in gastrtc hpases A bindmg study using the monomolecular-film technique Eur J. Blochem 180,367-371
Monolayer Techtxques
301
40 Guesdon, J. L , Ternynck, T., and Avrameas, S (1979) J Hzstoch Cytochem 8, 1131-1139
4 1 Aoubala, M , Douchet, I , Laugier, R , Hun, M , Verger, R , and de Caro, A (1993) Purlficatton of human gastric hpase by lmmunoaffimty and quanttficatton of this enzyme m the duodenal contents using a new ELISA procedure. Bzochzm Bzophys Acta 1169, 183-188. 42. Brockerhoff, H and Jensen, R.G. (1974) L~polyttc Enzymes, m Lzpases (Brockerhoff, H. and Jensen, R G , eds ), Academtc Press, New York, pp 25-175 43. Hamosh, M. (1984) Lingual hpase, m Lzpases (Borgstrom, B. and Brockman, H L., eds.), Elsevier, Amsterdam, pp 50-81. 44. Chen, C -S and Sth, C J (1989) General aspects and optimization of enantioselective biocatalysis m organic solvents The use of hpases. Angew Chem Znt Engl 28,695-707 45 Morley, N , Kuksis, A , and Buchnea, D (1974) Hydrolysis of synthetic trtacylglycerols by pancreatic and lipoprotein hpase Lzpzds 9,48 l-488 46. Akesson, B., Gronowitz, S., Herslof, B., Michelsen, P , and Ohvecrona, T (1983) Stereospectfictty of different lipases. Lipids 18, 3 13-3 18. 47. Jensen, R. G., Galluzzo, D. R., and Bush, V J. (1990) Selectivity 1san important characteristic of hpases (acylglycerol hydrolases) Bzocatalyszs 3, 307-3 16 48 Rogalska, E , Ransac, S , and Verger, R (1990) Stereoselectivity of hpases II Stereoselective hydrolysis of triglycerides by gastric and pancreatic bpases J Biol. Chem 265,20,27 l-20,276 49 Rogalska, E , Ransac, S , and Verger, R (1993) Controlling hpase stereoselectivity wa the surface pressure. J Blol Chem 268,792-794 50 Huh, K and Norm, T (1992) Enantioselectlvity of some hpases. control and predtctton. Pure and Appl Chem 64, 1129-l 134. 51. Holmquist, M., Martinelle, M., Berglund, P., Clausen, I G., Patkar, S , Svendsen, A., and Huh, K. (1993) Lipases from Rhizomucor mlehet and Humicola lanugmosa Modification of the Iid covering the active site alters enantloselecttvity. J Protem Chem 12,74%757 52 Rogalska, E., Cudrey, C , Ferrato, F , and Verger, R (1993) Stereoselective hydrolysis of triglycerides by animal and mtcroblal hpases Chiralzty 5,24-30 53 Cernia, E., Delfini, M., Magrt, A. D., and Palocct, C. (1994) Enzymattc catalysis by lipase from Candlda cylmdracea, enantiomeric activity evaluation by H 1 and Cl3 NMR Cell. Mol Brol. 40, 193-199 54. Holmberg, E. and Huh, K. (199 1) Temperature as an enantioselective parameter m enzymic resoluttons of racemic mixtures Bzotechnol Lett 13, 323-326 55. Lam, L K., Hui, R. A H. F , and Jones, J B. (1986) Enzymes in organic synthesis 35 Stereoselective pig liver esterase catalysed hydrolyses of 3-substituted glutarate dtesters. Optimtzation of enantiomerrc excess vza reactton condmons control. J Org Chem 51,2047-2050 56 Panda, S and Dordlck, J S (199 1) Substrate structure and solvent hydrophobicity control lipase catalysis and enantioselectivlty in organic media. J Am Chem Sot 113,2253-2259.
Ransac et al.
302
57 Wu, S H , Guo, Z W , and Slh, C J (1990) Enhancing the enantloselectlvlty of Candlda llpase catalyzed ester hydrolysis via noncovalent enzyme modlficatlon. J Am Chem Sot 112, 199&l 995 58 Maton, M , Asahara, T , and Ota, Y (1991) Reaction condltlons influencing posltlonal speclficlty mdex (PSI) of mlcroblal llpases J Ferment Bzoeng 72,4 134 15 59 Makamura, K , Takebe, Y , Kltayama, T , and Ohno, A (199 1) Effect of solvent structure on enantioselectlvlty of hpase catalyzed transesterlticatlon Tetrahedron
lett 32, 4941-4944 60 Kamat, S. V , Beckman, E. J , and Russell, A J. (1993) Control of enzyme enantloselectlvlty with pressure changes m supercritical fluoroform J Am Chem Sot 115,8845-8846 61 Rogalska, E., Nury, S , Douchet, I , and Verger, R. (1995) Llpase stereoselectlvlty and regloselectlvlty toward three Isomers of dicaprm A kmetlc study by the monomolecular film technique Chzralzty 7, 505-5 15 62 Baba, N , Tahara, S , Yoneda, K , and Iwasa, J (1991) Llpase-catalyzed enantloselectlve acylatlon of 2-O-benzyl- 1,3- propanedlol with unsaturated fatty acid trlfluoroethyl esters m orgamc solvent Chem Express 6, 423426 63 Bohm, C , Mohwald, M , Lelserowltz, L , and Als-Nielsen, J (1993) Influence of chlrahty on the structure of phosphohpld monolayers Bzophys J 64, 553-559 64 Andelman, D. and Orland, H (1993) Choral discrlmmatlon m solutions and m Langmmr monolayers J. Am Chem Sot 115, 12,322-12,329 65 Harvey, N. G , MlraJovsky, D , Rose, P L , Verblar, R., and Arnett, E M (1989) Molecular recogmtlon m choral monolayers of stearoylserme methyl ester J Am Chem Sot 111, 1115-1122. 66 Dvolaitzky, M and Guedeau-Boudevtlle, M -A (1989) Choral dlscrlmmatlon m the monolayer packing of hexadecylthlophospho-2-phenylglycmol with two choral centers m the polar head group Langmuzr 5, 1200-1205 67 Landau, E M., Levanon, L , Leiserowitz, L , Lahav, M , and Saglv, J (1985) Transfer of structural mformatlon from Langmulr monolayers of three dlmenslonal growing crystals Nature 318, 353-356 68. Melo, E. P , Ivanova, M G., Aires-Barros, M R , Cabral, J M. S , and Verger, R (1995) Glyceride synthesis catalyzed by cutmase usmg the monomolecular film technique. Bzochemzstry 34, 16 15-l 62 1 69 Lauwereys, M., de Geus, P , de Meutter, J , Stanssens, P , and Matthyssens, G (199 1) Clonmg, expression and characterlzatlon of cutmase, a fungal llpolytlc enzyme GBF monogr 16,243-25 1
26 Efficient Immobilization
of Phospholipase
A2
Wonhwa Cho and Zhen Shen 1. Introduction Immobilized enzymes have been widely used for biomedical and mdustrlal appllcatlons. Smce phosphohpase A2 (PLA,; E.C 3 1 1.4) catalyzes the hydrolysis of a wide range of phosphollpid aggregates, lmmoblhzed PLA, should also have potentral blomedlcal appllcatlons For instance, a novel therapy for hypercholesterolemla has been recently developed that utlllzes lmmobillzed PLA2 contained m an extracorporeal shunt, based on the finding that human serum low density lipoprotein modified by lmmobihzed PLAz was removed from the cn-culatlon by liver more rapidly than unmodified low denslty ltpoprotem (I). Also, munobillzed PLA, has been used to study the mechanism of mterfaclal actlvatlon of PLA, (2,3) To date, the lmmoblhzatlon of PLA2 has been carried out primarily with cobra venom enzymes using two different couplmg methods; the couplmg through the E-ammo group of lysmes and the couplmg through the carboxyl groups of asparatates and glutamates (3) These lmmobllization methods, however, often lead to a significant loss of enzymatic activity of PLA,, thereby hmltmg the apphcatlon of lmmoblllzed PLA2. For instance, when the E-ammo groups are coupled to a solid support, the couplmg yield IS high but the activity of lmmobillzed enzyme toward aggregated phosphollpld substrates decreases drastically, which has been ascribed to the modlficatlon of the lysyl residues that play critical roles m the mteractlon of PLA*s with anionic interfaces. On the other hand, the couplmg of protein carboxyllc groups to the solid support 1shampered by a lower coupling yield and modification of catalytically important residues. To Improve the efficiency of PLA2 lmmoblhzation, we have developed a novel two-step method which involves the site-specific acylatlon of PLA, prior to lmmobillzation (4). This approach 1s based on our previous fmdmg that acyloxyFrom
Methods
m Molecular
Bology,
l/o/
109
Edlted by M H Doohttle and K Reue
303
Llpase
0 Humana
and
Phosphol/pase
Press Inc , Totowa,
Protocols
NJ
ChoandShen
304
mtrobenzolc acid derivatives can spectfically acylate the lysmes of PLA,s that are mvolved m the mteractlon with anionic interfaces (5,6). The resulting acylated PLA,s are up to 250 times more active than the nonacylated enzyme toward phospholtpld btlayers. The immobtlizatlon of acylated PLAz offers great advantages over conventtonal mnnobllizatton methods m that the acylanon not only dramatically enhances the enzymatic activity of immobihzed PLA2, but also protects critical lysmes from undesired modtticatton durmg the immobiltzation. Herein, we describe the method to prepare tmmobtltzed acylated PLA, usmg a monomeric PLAz from the venom of Agkmtrodon pzscrvorus pzsczvorus (App-D49). This simple immoblhzation method IS generally applicable to most secretory PLA+, smce the mterfaclal bmdmg surface of many of these enzymes contam lysme resrdues
2. Materials 2.7. Purification 1. 2 3. 4
of App-D49
Lyophihzed Agkzstrodon plscworus pwworus venom (Sigma, St LOUIS, MO) Sephadex G-50, SP-Sepharose FF (Pharmacla, Uppsala, Sweden) Mobile phase for Sephadex G-50. 10 mM Trrs-HCl, pH 7 4,O. 1 MNaCl Mobrle phase for SP-Sepharose A, 25 mMHEPES, pH 8 0,O 1 MNaCl, B, 25 mM HEPES, pH 8 0,l MNaCl
2.2. Synthesis of 4-Nitro-3-Octanoyloxybenzoic
Acid (NOB)
1 3-hydroxy-4-mtrobenzorc acrd, N,N-dusopropylethylamine, octanoyl chloride and Merck srlica gel grade 60 (Aldrich, Mdwaukee, WI) 2 [l-‘4C]-octanolc acid; 50 mCr/mmol (Amencan Radrolabeled Chemicals, St LOUIS, MO)
2.3. Preparation
of Lys-7, IO-Dioctanoylated
App-D49
1, 2 3 4
Acylation buffer: 0.1 M Trts-HCI, pH 8.0, 5 nuI4 CaCl, Sephadex G-25 (Pharrnacia, Uppsala, Sweden) Vydac semi-preparatrve reverse-phase C4 column (Ramm, Wobum, MA) High performance hqurd chromatography (HPLC) system wrth dual pumps and a UV detector 5 Mobile phase for Sephadex G-25. 5% aqueous acetrc acrd (v/v). 6. Mob11 phase for C4. A, 0.15% aqueous trtfluoroacetrc acid, B, 0 15% trrfluoroacetrc acid in acetonitrrle 2-propanol(3 7, v/v)
2.4. Immobilization
of Lys-7,70-Dioctanoy/ated
App-D49
1 l,l’-Carbonyldumrdazole-actrvated 6% crosshnked beaded agarose [Reactr-Gel (6x)] (Prerce, Rockford, IL) 2. Couphng buffer 0 1 A4 borate buffer, pH 9 0
Immobilization of PLA,
305
3. Methods 3.1. Purification of AppD49 The venom of eastern cottonmouth, Agkistrodon pzsczvoruspisczvorus, contams two monomeric PLA+, Asp-49 PLA2 (App-D49) and Lys-49 PLA,, and a dimeric PLA, (7). App-D49 ISpurified from the lyophlhzed venom by a twostep chromatographic procedure. Dtssolve the lyophthzed venom (1.5 g) m 15 mL of 10 mMTns-HCI, pH 7.4,O 1 M NaCl and remove any insoluble material by centrifugatton (15,OOOg for 5 mm) Load the supernatant onto a Sephadex G-50 column (5 x 200 cm) equtltbrated and eluted wtth the same buffer solutton. Two protein peaks will emerge which correspond to dtmertc and monomertc PLA, with apparent molecular weights of 28,000 and 14,000, respectively Pool the fractions contammg the monomertc enzymes, dialyze the solutron against water and lyophthze the solutton. Dissolve the lyophrhzed monomeric enzymes in 5 mL of 25 mMHEPES, pH 8.0, 0 1 MNaCl Load the solution onto a SP-Sepharose column (2.5 x 20 cm) equilibrated m the same buffer solutton Develop the column with the linear gradient of mcreasmg NaCl concentratton from 0.1 to 1 M m the same buffer. App-D49 elutes as a first major protem peak with about 0 7 MNaCl Pool the fracttons contammg App-D49, dialyze the solutton against water and lyophrhze the solutton. The typical yield of App-D49 IS 50 mg of protemg of venom. The lyophtlized App-D49 can be stored mdefimtely at -20°C wtthout any detectable loss of acttvtty
3.2. Synthesis
of 4-Nitro-3-Octanoyloxybenzoic
Acid (NOB)
1 Dissolve 3-hydroxy-4-mtrobenzoic acid (183 mg, 1.O mmol) and NJ-dusopropylethylamme (259 mg, 2 2 mmol) m 2 mL of dry tetrahydrofuran. 2 Add this solutton dropwise to a sttrred solution of octanoyl chloride (163 mg, 1 0 mmol) m 10 mL of dry tetrahydrofuran at 0°C. 3 Slowly warm the mixture to room temperature and stir tt overnight 4 Remove the prectpttate by filtration and wash the filtered solid wtth three IO-mL allquots of ether 5, Combme the filtrate, evaporate the solvent zn vucuo and re-dissolve the residue in 50 mL of ether/hexane, 2 1 (v/v). 6. Wash the organic layer with two 50-mL altquots of 10 mM HCI and with two 50-mL aliquots of water, dry the layer over anhydrous sodmm sulfate, and finally evaporate the solvent m vacua 7 Fracttonate the residue by flash chromatography using Merck srlica gel 60 and hexane-ether-acetrc acrd, 20 10.1 (v/v/v) and momtor the fractions by thin-layer chromatography using the same solvent. Rf= 0 44 for the product
ChoandShen
306
8 Pool the appropriate fractions and evaporate the solvent m vacua 9 Recrystalhze the product from hexane-ethyl acetate, 10 1 (v/v), mp 142-143°C 10 Radlolabeled NOB can be synthesized from [ 1-‘4C]-octanolc acid m a similar manner In this case, [l-‘4C]-octanolc acid IS converted mto [I-‘4C]-octanoyl chloride by treating It first with oxayl chloride
3.3. Preparation
of Lys-7, IO- Dioc tanoylated
App-D49
1 Dissolve 10 mg of App-D49 (0 7 mmol) m 100 ml of 0 1 MTns-HCl, pH 8 0, 5 mkf CaCl* 2. Add 60 mg of NOB (and a trace amount of [14C]-NOB) dissolved m 1 ml of acetomtrile to the enzyme solution with gentle mixing and incubate the mixture until all NOB are hydrolyzed (the solution turns bright orange) (see Note 1) 3 Lyophihze the solution and re-dissolve the residue m a mmlmal volume of 5% aqueous acetic acid 4 Load the solution onto a Sephadex G-25 column (2 5 x 20 cm) equilibrated and eluted with 5% aqueous acetic acid to remove reagents Pool the protein fractions elutmg first from the column and lyophlhze the solution. 5 Re-dissolve the lyophlhzed protein m 1 mL of solvent A (0 15% aqueous trlfluoroacetlc acid) and Inject it to a reverse-phase C4 column (1 x 25 cm) equlhbrated with solvent A m a HPLC system 6. Develop the column m a binary gradlent system conslstmg of solvent A and solvent B (0.15% trifluoroacetlc acid m acetomtrile:2-propanol(3:7, v/v) Pool the fractions correspondmg to each peak and dilute them with HZ0 and lyophlhzed them Lys-7, IO-dioctanoylated App-D49 elutes from the column as a third major protein peak preceded by unmodrfied App-D49 and a mixture of monoacylated App-D49 7 Determine the specific radloactlvlty of dloctanoylated App-D49 by measuring the radIoactivity of a known amount of protein
3.4. immobilization
of Lys-7, IO-Dioctanoylated
App-D49
1 Wash 1 mL of React]-Gel (6X) extensively with cold deionized water and dlsperse the gel m 2 mL of 0.1 M borate buffer, pH 9 0 (see Note 2) 2. Incubate 2 8 mg of dloctanoylated PLA2 (0.2 mmol) with the gel dispersion for 2 h at room temperature with gentle agltatlon (see Note 3) 3 After the couplmg, Incubate the gel m 1 0 Methanolamme buffer, pH 9 0, for 3 h to block all remammg reactive groups. 4 Wash the gel extensively with cold deionized water and finally store It m 0.16 M KC1 solution contammg 0.02% sodium azlde at 4°C 5 Determine the coupling yield of dloctanoylated PLA2 by measuring the radloactlvlty of the weighed gel.
3.5. Evaluating the Activity of lmmobilired App-D49 All kinetic experiments are performed as described m Chapters 2 and 4. The concentration of lmmoblllzed PLA2 IS determined by measurmg the radloactlvtty of the gel added to the reactlon mixture (see Note 4).
hmr~obi//zation of PLA,
307
4. Notes 1 Lys-7 and Lys- 10 are selectively acylated by NOB under these conditions Lys7, lo-dioctanoylated App-D49 IS a maJor acylated form and IS thus easily purtfied from the reactton mixture The Identity of Lys-7,10-dioctanoylated App-D49 can be confirmed by the ammo-termmal Edman degradation of purified protein 2 The 6% agarose gel has an exclusion limit of 4 x 1O6daltons Thus, small phosphohpid aggregates, such as micelles and small umlamellar vesicles should be able to freely diffuse into the gel matrix Larger aggregates, such as large umlamellar vesicles might have hmited access to the gel matrix To use the tmmobtltzed acylated PLA, for the hydrolysis of these aggregates, a gel with larger pore size should be used for tmmobihzation 3 In general, the coupling yield for acylated PLA:! IS lower than that for nonacylated PLA, under the same condition due to the reduced number of surface lysmes available for couplmg However, the elongated couplmg of acylated PLA* with the gel considerably increases the yield without impairmg the activity of unmobihzed enzyme 4 Immobilized acylated enzymes can be recovered from the reaction mixture and re-used multiple times without any significant loss of catalytic activity
References 1 Labeque, R , Mullon, C J P , Ferreira, J. P M , Lees, R. S , and Langer, R (1993) Enzymatic modification of plasma low density hpoprotems m rabbits A potential treatment for hypercholesterolemia Proc Nat1 Acad Scl USA 90,3476-3480 2 Lombardo, D. and Dennis, E. A. (1985) Immobilized phospholipase A2 from cobra venom J Bzol Chem 260, 16,114-16,121 3. Ferretra, J. P M., Sastsekharan, R , Louie, 0 , and Langer, R. (1993) Influence of chemtstry m immobdlzatton of cobra venom phosphohpase A,* Implication as to mechanism Blochemlstry 32,8098-8 102. 4 Shen, Z and Cho, W (1995) Highly Efficient Site-Specific Immobilization of Phospholipases A2 J Lzpzd Res 36, 1147-l 15 1 5 Cho, W , Tomasseli, A Cl , Hemrikson, R. L , and Kezdy, F J (1988) The Chemical Basis for Interfacial Activation of Monomeric Phosphohpase A2 J Bzol Chem 263,11,237-l 1,241 6 Shen, Z., Wu, S -K., and Cho, W (1994) Effects of Specific Fatty-Acid Acylatton of Phosphollpase A2 on Its Interfacial Binding and Catalysis. Blochemzstry 33, 11,598-l 1,607 7 Maraganore, J M , Merutka, G., Cho, W., Welches, W , Kezdy, F J , and Hemrikson, R L (1984) A New Class of Phospholtpase A, with Lysme m Place of Aspartate 49: Functional Consequences of Calcium and Substrate Bmdmg. J Blol Chem 259, 13,839-13,843
27 An Introduction to Internet Resources for the Molecular and Genetic Analysis of the Lipases Karen Reue 1. Introduction In recent years, cDNA and genomlc DNA clones have been Isolated for many of the mammahan hpases and phosphohpases described m this volume. These DNA clones have provided essential tools for the analysis of llpase expression, structure, and function. In addition, DNA sequence analysis has generated a wealth of mformatlon about hpase protein and gene structure, including nucleotlde and ammo acid sequence, exon/intron orgamzatlon, chromosome localization, phylogenetlc relationships among hpases, and the elucldatlon of hpase mutations that underlie hpase deficiencies and dyshpldemlas Much of the information derived from the molecular and genetic charactenzatlon of genes and proteins has been deposited mto electronic databases. With the advent of widespread access to the Internet, researchers throughout the world can contribute to and retrieve mformatlon from a wide array of databases that are contmuously updated to include the most recent findings. The goal of this chapter 1sto provide an overview of some of the established onlme databases that provide access to nucleic actd and protem sequences, DNA reagents, gene mapping data, mutations and phenotype mformatlon, and available animal models. An mtroduction to applications for the analysis of nucleic acid and protein sequences 1s also included. Specifically, this chapter lists the addresses and key features of several databases that are of general interest and utdity, and provides guidelmes and practical tips for using selected web sites Given the vastnessof the resourcestogether with the rate at which they grow and evolve, this chapter 1sby no meanscompresenslve, but rather IS intended as a starting point to encourage further exploration (see Note 1) From
Methods
m Molecular
EdIted by M H Doohttle
Biology,
Vo/
109
and K Reue
309
Lfpase
0 Humana
and
Phospholipase
Press Inc , Totowa,
Protocols
NJ
310 2. Materials Followmg IS a list of selected World Wide Web resources for btologtsts, wtth an emphasis on molecular and genetic analysts. Several of the sites listed contain a collectron of linked databases and/or software appltcattons that are not listed mdividually but are descrtbed m the Methods sectron. 1 American Type Culture Collection-http./Jwww atcc.org. An onlme catalog of recombinant DNA molecules, libraries, vectors, oligonucleotldes, and bacterial hosts 2. ExPASy Molecular Biology Server-http.J/expasy.hcuge ch The ExPASy Molecular Biology server of the Geneva University Hospital and the University of Geneva is dedicated to the analysis of protein and nucleic acid sequences Particularly
3
4
5.
6
7
8
9
important and umque are the tools and software
packages for protem
modeling, detection of protein motifs and patterns, and two-dimensional polyacrylamlde gel electrophoresis database GenBank-http JJwwwncbi nlm tnh govJWebJSearch/Index html GenBank represents the archetypal searchable nucleic acid sequence database Also accessible through NCBI (see below) The Genome Database-http /Jgdbwww gdb org. A database for human gene mapping maintamed at The John Hopkms Urnversity Notable for its integration of genetic and physical mapping data, as well as listings of available DNA clones and amplimers. Human Gene Mutation Database--http://www.cf ac.ukJuwcm/mg/hgmdO.html (note that the final digit before “html” is a “zero”). The HGMD mamtamed at the Institute of Medical Genetics at the University of Wales College of Medicme is a catalog of known mutations m human genes and the correspondmg disease states Human-Mouse Dysmorphology Database-http Jlwww hgmp.mrc.ac uk/ DHMHDJdysmorph html A triad of linked databases which allow retrieval of gene mapping and human-mouse synteny information for specific diseases or syndromes through searches performed using phenotype or chromosome locatron I.M.A.G.E. Consortium-http*/Jwww-bio llnl.govJbbrp/rmageJimage.html. The I M A G.E (Integrated Molecular Analysis of Genomes and their Expression) Consortium is a resource for human and mouse expressed sequence tag (EST) clones produced by the Merck-Washington Utuversity EST Project. The Jackson Laboratory Mouse Genome Informatics-http*J/www mformatics Jax.org The Jackson Laboratory is home to mouse genome mformatics databases including the Mouse Genome Database, Gene Expression Database, and Encyclopedia of the Mouse Genome which serve as a definmve resource for mformation on mouse genes, DNA probes, and genetic maps. Mouse and Rat Research Home Page--http IJwww cco.caltech.edu/-mercer/ htmlsJrodent_page html. This web site maintained at the Califorma Instnute of Technology provides lmks to sites contammg a wide array of mformation for the use of rodents in biomedical research, mcludmg genome mformatrcs, anatomy and physiology, laboratory animal suppliers, useful references, and mterestmg facts about rodents in medical and popular use.
311
Internet Resources
10. National Center for Biotechnology Information (NCBI)-http //www ncbl nlm nih gov The NCBI at the U.S National Library of Medicme, Natlonal Instttutes of Health IS perhaps the most well established network site for sequence searches and comparisons NCBI provides an array of searchable nucleotlde and protein sequence databases which are updated daily Additional resources include links to Onlwze MendeLan Inheritance zn Man, the Molecular kfodellng Database, and Gene Map of the Human Genome 1 I Online Mendelian Inheritance in Man (OMIM)-http //www3 ncbl nlm.mh,gov/Omlm The electromc version of McKusick’s Mendehan Inheritance m Man which contains information on human genetic disorders mcludmg descriptions of disease phenotypes, clmical synopsis, allellc variants, and gene map posltlon Entries also provide direct links to several databases for information on protein and DNA sequence, gene map posItIon, and Medlme cltatlons 12. PCR Jump Station-http://www.apollo.co uk/a/pcr A high quahty compendium of sites and software tools relating to every aspect of PCR and mcludmg PCR protocols, applications, references, and software tools for primer design. 13 TBASE-http //www.gdb,org/Dan/tbase/tbase.html. TBASE IS a searchable database mamtamed at the Johns Hopkins Umverslty School of Medlcme that catalogs transgemc/targeted mutations in mouse and other organisms
3. Methods This section will describe the utility of specific databases and applications for retrieval and analysis of data in four areas: (1) genome mformatlcs (gene sequence, gene map posltion, mutation information); (2) DNA reagents (genomlc and cDNA clones, expressed sequence tags, PCR primers); (3) protein analysis (primary sequence analysis, secondary structure predictlon, protem modeling, two-dlmenslonal polyacrylamide gel electrophoresls patterns); and (4) experimental animal models (transgemc and knock-out mouse models, human-mouse synteny). Throughout this section, the names of web sites corresponding to those listed in Subheading 2. are indicated by boldface, words or phrases that may be selected from menus at particular web site are indicated by italics, and words entered by the user are indicated with quotation marks. The information provided m this sectlon 1sintended to serve as a practical guide that 1sbest utlhzed by following the instructions m the text while accessing the appropriate web sites on the Internet (see Note 2). 3.1. Genome lnformatics 3.1.1. DNA Sequence Data Retrieval and Analysis Direct access to virtually all published, and much unpublished, DNA sequence data from nearly any experlmental
organism
National Center for Biotechnology Information
is avatlable through the
(NCBI). Databases acces-
312
Reue
sable from the NCBI homepage Include the GenBank DNA sequence database, dbEST (database of expressed sequence tags), dbSTS (database of sequence tagged sites), and BLAST (Basic Local Alignment Search Tool). Genbank contams genomlc and cDNA sequence data for orgamsms rangmg from bacteria to humans. The database of expressed sequence tags (ESTs) contains short sequence tags (typically 200-300 bp) dertved from randomly selected human and mouse cDNAs which are being isolated in the pursuit of all expressed genes. The database of sequence tagged sites (STSs) contains markers which have been localized to a particular chromosomal location on the genetic map. BLAST IS a program for comparing a sequence of interest with all seqeunces in a specified database. Some guldelmes for utlllzlng several of these resources are presented below 1 Access the NCBI home page at the address specified III Subheading 2. The NCBI menu displays a hst of nearly two dozen items that allow lmmedlate and seamless mterfacmg with the specified databases or appltcatlons (see Fig. 1) To locate a particular DNA sequence m one of the nucleic acid databases, select Searchng GenBank A screen ~111appear offermg optlons for Text and Stmilarlty searching of GenBank, dbEST, and dbSTS. Choose the lmk for text searchmg of GenBank When prompted, specify the desired search parameters (I e , locus name, author name, accession number, or other key words) and the version of GenBank you would like to search (choices include the most recent version of the full GenBank database, or a smaller collectlon of recent submissions that have not yet been incorporated mto the full database, referred to as GenBank update, or a combmation of the two). The results of the search will momentarily be displayed m abbrevlated format with a smgle line descrlptlon of each entry The mdivldual entrles can be vlewed m their entirety by simply selectmg the desired file Each file includes extensive annotatlon about the sequence mcludmg the locus name and accession number, source of the cloned DNA, features of the sequence, and related pubhcatlons 2 To obtain DNA sequence from expressed sequence tags or sequence tagged sites, choose the dbEST or dbSTS lmk from either the NCBI home page or from the Text and Slmllanty searchmg prompt as described m step 1 above Results for dbEST and dbSTS searches are returned m a format slmllar to that for GenBank searches. Many of the EST sequences are redundant with sequences m GenBank, but others represent previously umdentified sequences, presumably derived from novel gene transcripts. A unique and useful feature of DNA clones contained m dbEST 1s that most are avallable for a nominal fee directly from a single source (see Subheading 3.2.) Although the EST clones do not typIcally contam fulllength cDNA sequences, they can be employed as probes for analysis of correspondmg mRNA levels, or for screenmg DNA hbrarles 3 To search for slmllarltles between a known nucleotlde or protein sequence and all other sequences present m databases such as GenBank or the SWISS-PROT protein sequence database (described m Subheading 3.3. below), an excellent
313
Internet Resources
1011 National
Welcome
Librarv
to NCBI
National Center for Biotechnobgy Information
of Medicine
/ National
Other
What’s New (Cn3D for Mac 68K) l Prosrams and Activities l NCBI Newsletter l Service Addresses 0 User Comments
NCBI
Institutes
of Health
Resources
l
GenBank
Sequence
0 Gene Man of the Human Genome l UniGene: Uniaue Human Gene Seauence Collection l OMIT: Online Mendelian Inheritance in Man l dbEST: Database of Exnressed Seauence Taes l dbGSS: Database of Genome Survev Seauences l dbSTS: Database of Seauence Tagged Sites l Electronic PCR l MMDB: Molecular Modellins Database l NCBI Taxonomy l ORF Fmder l Human/Mouse Homolorrv Mans
Database
0 Overview l Searching GenBank l Submittine Seauences O&g&&t
NCBI
Services l l l l
Entrez Search Svstem BLAST Seauence Similarity Searching E-mail Servers Anonvmous FI’P
Revised March
NCBI
Research l l l l
Research Proiects Seminar Schedule Staff Biblioarauhy Full Text of Selected Staff Publications
13.1997
Disclaimer
Fig. 1. National Center for Biotechnology Information (NCBI). The NCBI home page (http://www.ncbi.nlm.nih.gov) provides access to numerous databases concerned with genome informatics, including GenBank, UniGene, dbEST, dbSTS, and OMIM (see Subheading 3.1. in the text). In addition, NCBI services include BLAST sequence similarity alignment tool, the Entrez literature citation search tool, and information about NCBI research and publications. Each of the choices preceded by a bullet may be accessed by selecting the corresponding text; the six buttons at the top of the page may also be used for quick access to databases including Entrez, BLAST, and OMIM. method is through the BLAST series of programs (2). Select BLAST sequence similarity searching from the NCBI page, and choose either a basic BLAST search or an advanced BLAST search (see Note 3). Next select one of the five BLAST programs that is appropriate for the combination of nucleotide and/or protein query sequences to be compared with particular databases. Choose blastn to perform direct comparisons of a nucleotide query sequence with nucleotide
314
Reue databases. Choose blastp for comparison of a protein query sequence with protem sequence databases It 1s also possible to compare a nucleottde query sequence with protein database sequences. The blastx module performs translation of a nucleottde query sequence mto all SIX frames (1.e , from both strands) and compares the resulting protein sequences to a protein database Two additional variations are tblastn, which compares a protein query sequence against a nucleotide sequence database dynamically translated mto all SIX reading frames, and tblastx, m which the 6 frame translations of a nucleotide query are compared with the SIX frame translations of a nucleotide database The BLAST program output includes a series of one-line descriptions of database matches with a correspondmgp value to indicate the slgmficance of the sequence match Followmg the hst of matches are the actual sequence ahgnments mdicatmg the positions within both query and database sequences to assist m determining potential biological slgmficance for the matches (see Note 4).
3 1.2. Gene Mutation and Mapping Data A good startmg point for learning about mutations and mapping data for a particular gene or disease IS the Online Mendelian Inheritance in Man (OMIM) database, a catalog of human genes and genetic disorders This database represents a searchable and regularly updated version of the print classic, Mendelian Inheritance m Man OMIM provides mformation and references concernmg enzyme biochemistry and classification, organization and chromosomal localization of the correspondmg gene, allehc variants associated with a particular disease, and a clmical synopsis. Directly linked to OMIM entries are correspondmg pages from databasesdedicated to gene mapping and mutation, including the Genome Database and the Human Gene Mutation Database, as described below 1 Access OMIM from the NCBI home page, and select Search the OA4IMDatabase Search terms are typtcally text strings such as the name of a spectfic gene or protein (1 e , “hpoprotem lipase”), or of a particular clmical condition (I e , “hyperhpoprotememia”) The search result displays a list of all entries contammg the search terms ranked m order of best fit to the query terms. Select the file of interest and a display page will appear listing mformatlon about the gene locus (gene name, symbol, and chromosomal locahzation), followed by an mdex of topics covered m the OMIM text, and then the text itself. The text display 1s divided mto several sections including a general description of the protem properties, allehc variants, clinical synopsis, animal models, and references The chmcal synopsis of some diseases includes audto or video images to demonstrate charactertstic features References throughout the text occur m hypertext, and when selected ~111 display abstracts of the papers cited Lmks to additional databases correspondmg to the same query may be performed by selecting the appropriate button at the top of the page (for example, see steps 2 and 3 below)
Internet Resources
375
2 Although the OMIM provides an excellent overview of mapping and mutation data for most entries, tf additional mformation is desired it may be accessed easily usmg some of the buttons that appear above the OMIM text and provide links to databases such as the Genome Database (GDB) and Human Gene Mutation Database (HMGD), Medlme, and protein and DNA sequence databases (see Note 5) For example, selectmg the GDB button from an OMIM entry will automatically pull up the corresponding GDB file for more detailed Information about gene localization, with an emphasis on mtegratmg genetic and physical mappmg data The GDB entries also include gene polymorphtsms and a catalog of DNA segments that have been cloned or amphfied by PCR (described m detail under DNA Reagents, Subheading 3.2.) 3 The Human Gene Mutation Database (HGMD) can be accessed by selectmg the HGMD button from OMIM This database contains a comprehensive list of mutations m catalogued genes orgamzed on the basis of the molecular nature of the mutation, i.e. insertions/deletions, mtssense/nonsense point mutations, sphcmg and regulatory mutations, duplications, repeat expansions, and rearrangements. The data are presented m tabular form with mformatton about the nucleotide and amino acid codon alterations, associated disease state, and a reference to the first literature report of the particular mutation (for an example, see Fig. 2) Importantly, HGMD entries are scrutmtzed to ensure conststency of ammo acid and nucleottde sequence numbermg, and to prevent duplication of entries due to reports of recurrent mutations 4. The UniGene database, accessible from the NCBI home page, provides a somewhat unique view of the position of genes in the human genome UmGene (Unique Human Gene Sequence Collectton) is a dataset of sequences derived from sources mcludmg GenBank and dbEST in which related sequences have been grouped mto more that 55,000 ‘clusters’, such that sequence redundancy has been eliminated and each cluster represents a unique gene The organization and localization of transcript sequences mto unique gene clusters is important m eluctdatmg the molecular basis for disease phenotypes, for revealing relationships between genes, and defining genetic synteny between humans and other organisms The UmGene data can be accessed m two ways* on the basis of chromosome location (by selecting ideograms representing chromosomes l-22, X, or Y), or by a text search for a specific transcript cluster Output from the first method is a list of transcript clusters displayed in order correspondmg to their physical order along the chromosome Addmonal detail for each lme of this output may be obtained by selecting the line of interest. Output from a text search appears as a tile listing known fUnctiona information for the translation product of the transcript, tissue expression data, genetic, and (where available) physical mapping mformation, and a list of the correspondmg transcrtpt sequences This kind of mformation is valuable for tdentificatton of genes based on their map position, as m the elucidatton of mutations underlying genetic disorders by positional clonmg. 5 A key resource for genome mformattcs m the mouse is available from The Jackson Laboratory Mouse Genome Informatics page, which maintains the Mouse
Reue
316 Lipase, hepatic Gene symbol : LIPC GDB : 119366 Location 1% Nucleotide
substitutions
HGMD
options -
External
links -
:
Deutsche Forschnngsgemeinschaft
- Missense/nonsense HGMD
HGMD
search
Search OMIM
HGMD
cDNA seauence
Disease
state
Reference
Nucleotide
Amino
193
AAT-AGT
Am-Ser
Hepatic lipase deficiency
1
267
TCC-‘ITC
Ser-Phe
Hepatic lipase deficiency
1
Thr-Met
Hepatic lipase deficiency
2
ACG-ATG
home
GDB entry
Codon
383
acid
helo
References 1 - Hegele
(1991) Biochem.
Biophys.
2 - Hegeie (199 1) .I. Clin. Endocrinol.
Res. Commun. Metab.
179, 78
72, 730
Fig. 2. Human Gene Mutation Database (HGMD). Data shown was retrieved by searching the HGMD for “hepatic lipase” and then selecting mutations of the Mssense/ nonsense category for display (http://www.cf.ac.ukwcmlmg/searchJ119366.html; see Subheading 3.1.2. in the text). As shown, output includes amino acid codon and nucleotide sequence information for known mutations, the associated disease phenotype, and the initial literature citation for each mutation. Genome Database (‘GD), Gene Expression Database, and Encyclopedia of the Mouse Genome. The MGD contains sections on Genes, Markers, and Phenotypes; Probes and Clones; PCR Primers; Mammalian Homology; Maps and Mapping Data; and Combined Mouse/Human Phenotypes (a combination of the Mouse Locus Catalog and Online Mendelian Inheritance in Man). Armed with a small bit of information (i.e., gene name or symbol, chromosome, phenotype, author, and so on) it is possible to retrieve existing information on each of topics listed above. For example, to learn about map position, phenotype, mutations, and available probes for hepatic lipase, begin by selecting Mouse Genome Database from the Genome Informatics page, and then choosing Genes, Markers, and Phenotypes from the MGD menu. Enter “hepatic lipase” in the Name field and choose Retrieve. A file delineating the gene symbol and map position appears.
Internet Resources
317
Selecting the highlighted gene symbol (Hpl) retrieves a graphic representation of the map location, known mutant alleles, and a list of hyperlinks to other secttons of the MGD (see Fig. 3) Selecting the lmk to Probes and Clones wtll display a ltst of available DNA probes, each of which is further documented m a tile descrlbmg the probe and provrdmg contact persons for obtammg the probe, selecting the lmk to Phenotype (MLC) wtll display text from the Mouse Locus Catalog with hypertext references, selectmg the Mammalzan ffomolog!J lmk will provide the known map positions of the gene m humans and other mammahan species The MGD also contams two gene mappmg applicattons that can be downloaded and run on the user’s own computer* the Encyclopedia of the Mouse Genome, a genetic lmkage map of the mouse genome complete with graphic displays of mdrvrdual chromosomes, and MapManager, a Macmtosh application for use m the analysts of results generated m genetic mappmg experiments (3) The Gene Expresszon Database, still under development, currently provrdes text and Images of gene expression by anatomical site and developmental stage Eventually, a three-dimenstonal atlas of gene expressron m mouse tissues will be constructed
3.2. DNA Reagents Several electronic databases contam rnformatron for obtaining DNA reagents for standard molecular btology appltcations mcludmg cDNA and genomic clones, bacterial and yeast artifictal chromosome (BAC and YAC) clones, and PCR primers. Sources of these DNA reagents include mdrvtdual mvesttgators, genome project laboratones, and non-profit distributors such as the American Type Culture Collection. 1. The American
Type Culture Collection (ATCC) is an established source of DNA reagents which have been submitted by mdrvrdual mvesttgators for drstrtbutron without restriction for a nominal fee. Recently, the ATCC has also become a distributor of human and mouse cDNA clones derived from The Institute for Genomtc Research (TIGR) (4), and from the Integrated Molecular Analysis of Genome Expresston (I M A G E ) Consortrum coordmated by the Lawrence Livermore National Laboratory (5) TIGR and I M A G E Consortrum are rich sources of nearly 300,000 human cDNA clones; m addition, more than 50,000 mouse cDNA clones are also avadable from the I M A G E consortium To obtain EST clones generated by the 1.M A G E. Consortmm and TIGR, locate the
desired sequence by performmg searches of dbEST or UmGene as described m Subheading 3.1.1. The sequence file for each clone contams an rdentrfication
number that can then be used to order the clone from ATCC for a nominal fee Ordering mformatron can also be obtained at the web sites for TIGR and I M A G.E Consortmm 2 Tradttronally, the chief source of mformation for obtammg DNA reagents from a specific mvestrgator has been the address provided m the correspondmg pubbcatron The process ofobtammg such mformatron has now been made more convenient with its mcluston in electromc databases. The Genome Database (described
318
Genes. Query
Markers Results
and PhenotvDes
-- Details
Type Gene Symbot “pl Name hepam lipase Chromosome. 9 Accession Number MGD-MRK-10920 Modilication date 1/21/1997 EM POSition (Source ):
. 390(MGD) . 39 0 (Chromosome Comrltee)
Fig. 3. Mouse Genome Database (MGD). A query of “hepatic lipase” was used in the and Phenotypes section of the MGD to retrieve the information shown (http://www.informatics.jax.org/bin/fetch-marker?9934; see Subheading 3.1.2. in the text). The top panel concisely lists the gene symbol (HpZ), chromosome number (9), and map position in centimorgan units (39.0) from both the MGD stored value and the Chromosome Committee reports. The position ofHpZ with respect to other chromosome 9 markers is shown in the diagram at right. The middle panels contain information about nomenclature, classification of the corresponding protein, and known alleles, including induced mutations. The bottom panel provides links to related information including DNA probes, marker mapping data, phenotype, and mammalian homology. Genes, Markers,
lnterff et Resources ln Subheading 3.1.2.) IS notable m provtdmg a detailed list of DNA reagents available for a particular gene, mcludmg the spectfic portion of the gene each contams or hybridtzes wtth, and in provrdmg mformatlon regarding the accessrbtltty/restrtcttons for use of the reagent, and contact data for the corresponding mvestigator In addition, the Genome Database lists PCR prrmer sets (“amphmers”) for ampltficatton of specific gene segments, mcludmg allele specific primers for detection of polymorphtsms (see Fig. 4) As descrtbed m Subheading 3.1.2., the Mouse Genome Database also provides mvestrgator contact name for obtaining mouse DNA clones 3. In cases where DNA clones corresponding to a region of Interest are not avatlable, or for appbcations employing the polymerase cham reaction, information on PCR prrmer sequences and conditrons may be useful. As descrtbed above, some PCR primer sets are included in the Genome Database and in the Mouse Genome Database. However, in many cases, it IS necessary to design PCR primers tarlored to a specific application. In planmng PCR experiments, a useful resource IS the PCR Jump Station, which contains informatton on all aspects of PCR (theory, protocols, enzymes, applications, references), as well as links to PCR-related databases and software. Of particularly htgh quahty IS the primer design program Przmer3 (6) that IS avarlable at this web sate m the PCR Software section This program desrgned at MIT allows selection of primers from user entered nucleotlde sequence and allows specification of numerous parameters mcludmg PCR product size range, minima and maxtma for primer melting temperature, GC content, salt concentration, and self complementarity
3.3. Protein Analysis The ExPASy Molecular
Biology Server at the Geneva University Hospital and Umverstty of Geneva IS among the most comprehensive collecttons of database lmks and software tools publicly available for protem analysts The SWISS-PROT protein sequence database maintamed here IS noteworthy for the emphasis placed on complete annotation of entrtes (mcludmg protein function, domain structure, post-translational modification, genetic variants), minimal redundancy, and its integration with a vartety of protein analytical and modelmg tools Once a protein sequence has been located in SWISS-PROT (or
entered by the user), analysis may be performed at the primary, secondary, and tertiary structure levels as described below.
3.3.1. Protein Primary Structure Analysis 1. To retrieve protein sequence, enter the SWISS-PROT database from the ExPASy home page, and perform a search for the protein of interest by supplymg criteria such as key words, accession number, or author When search results are dlsplayed, select the file of Interest. The correspondmg SWISS-PROT file dtsplay will Include standard reference mformatlon and sequence data, as well as text describing protem activtty, tissue sates of expression, regulatory features, and
Reue
320 r/Gene
LIPC
Fig. 4. Genome Database (GDB). The GDB entry for hepatic lipase was retrieved as described in Subheading 3.1.2. (http://www.gdb.org/gdb-bin/genera/genera/hgd/Gene?! action=query&-EntitySym=Gene&displayName=LIPC). A portion of the resulting display shown here contains information about the human gene name (LIPC) and map position (chromosome 15q23), followed by a list of DNA reagents including cDNA clones, genomic DNA clones, and PCR primers pairs (“amplimers”). Information about how to acquire the DNA reagents listed from appropriate investigators can be retrieved by selecting the underlined marker or clone name.
Internet Resources related proteins In some cases the sequence data mcludes annotation of ammo acid residues comprtsmg known or putative functional domains, and protein variants associated with altered structure/activity For example, the SWISS-PROT entry for hpoprotem lipase includes a list of more than three dozen protein variants which have been associated with disorders of triglyceride metabolism Data on each variant includes position of altered amino acids, correspondmg nucleotide sequence changes, phenotype, and a lmk which will display the entire sequence of the variant protein with altered ammo acids highlighted 2 For direct comparison of a particular protem sequence with other known sequences, blastp (described m Subheading 3.1.1.) is a straightforward place to begin An alternative to standard sequence similarity search algorithms IS available with PropSearch, a program which searches for structural homologs using a ‘properties’ approach rather than a strict ammo acid identity calculation (7) Another useful tool for identification of sequences with similarity to a protem of interest IS SWISS-SHOP, a program that automatically retrieves and delivers new sequences related to a specified field of interest (1 e., “hpolytic enzymes”) As new entries are added weekly to the SWISS-PROT database, a BLAST ahgnment and text search are routmely run to identify those with sequences, protein motifs, or keywords similar to the specified protem(s) of interest Matching entries are then automatically sent to the mvestigator by e-marl 3 To calculate chemico-physical properties of a specific protem based on primary ammo acid sequence, select TOOLS from the ExPASy home page Next select the program of interest and when prompted for protem sequence, provide the SWISS-PROT accession number, or copy/paste protem sequence from another tile mto the specified region Programs for the analysis of chemico-physical properties mclude the followmg. ProtParam displays ammo acid composition and extmction coefficient, ProtScaZe provides a representation of ammo acid sequence on a hydrophobicity, hydrophihcity, or other specified scale, Compute pI/MWdetermmes the theoretical p1 and molecular weight; and PeptrdeMass calculates masses of peptides and their posttranslational modifications A large variety of additional protem analytical tools may be accessed through the TOOLS lmk from the ExPASy home page The tools for analysis of primary protein sequence data are largely focused on comparisons between protein sequences, identification of defined protem motifs, and prediction of conformational properties associated with specific functions. Some of the tools and their applications are described m steps 4 and 5 below 4. To identify general protem functional motifs within a primary ammo acid sequence, additional programs available on the TOOLS page may be utilized For example, Szgnalp predicts signal peptide cleavage sites, NetOglyc predicts Olinked glycosylation sites, and Coils and Palrcoll both predict coiled regions Perhaps one of the most generally useful offerings m this area IS PSORT, a program which screens for a variety of protein sorting signals and localization sites, including signal sequence, transmembrane regions, glycosylation sites, CAAX motifs, myrrstoylation sites, and targeting sequences for mitochondria, peroxi-
somes, and the nucleus To increase the value of predictions made through PSORT, calculations for several of the properties are performed by multiple algorithms and results of each are presented side-by-stde to allow the mvesttgator to weigh the data and make an mformed mterpretatton Finally, an apphcation known as Protezn Colourer quickly translates the ammo acid sequence of a protein mto a series of colors correspondmg to actdtc, basic, hydrophobic, and cysteme/methionme residues 5 To identify spectahzed protein patterns or motifs within a protein of interest, choose ScanProszte from the TOOLS page The apphcation of ScanProszte to the sequence of hpoprotem lipase, for example, identifies several putatrve functional motifs mcludmg N-linked glycosylation sites, an N-myristoylation site, several phosphorylatton sites, and the ltpase serme active site Alternatively, the PROSITE dictionary of protein sites and patterns (accessible directly on the ExPASy home page, rather than through the TOOLS link) may be searched directly to identify families of proteins containing common sequence or functional motifs For example, a query specifying the conserved hpase acttve site sequence “Gly-X-Ser-X-Gly” returns a text on triglyceride hpases describing functton, distrtbutton, conservation of active site sequence, and an annotated hst of several hpases contammg this motif, mcludmg several mammalian and bacterial proteins
3 3.2. Protein Secondary Structure Prediction Among the programs available through the ExPASy TOOLS link are several methods for predtctron of protein secondary structure The majority of these programs are easy to use, requtrmg only the input of primary ammo acrd sequence, and return the analysts either m real time or via ematl. However, the different algorithms vary in the degree of documentation and rn the parameters used m calculatton of secondary structure. Below are a few examples. 1 The nnPredzct program offers one of the most rapid analyses and simplest output format for protein secondary structure prediction based on primary amino acid sequence. A two-layer, feed-forward neural network 1s employed to predict the secondary structure type for each residue in an ammo acid sequence (8) Access the nnPredzct program from the TOOLS sectron of the ExPASy home page, and when prompted, supply the program wtth the protein sequence of interest, either by specifying the SWISS-PROT accession number or by pasting in ammo acid sequence. The nnPredzct program will run and display a secondary protein structure predrctron consisting of an assignment of each ammo actd to ‘H’ (helix), ‘E’ (strand), or ‘-’ (no prediction) configurations 2 The PredzctProtezn program contains a series of subprograms that allow the predtction of several parameters such as solvent accessibility and transmembrane topology, as well as the more typical assignment of helical, extended, and loop conformattons This web site provides extensive documentation describing the method of prediction employed, which utilizes evolutionary information and
323
Internet Resources
computer neural networks (9). Select PredxtProtern from the TOOLS sectlon of the ExPASy home page, and enter protein sequence when prompted The results of the predlctlon include a conformation prediction for each amino acid accompanied by probability values for each of the structure posslbllitles to aid in evaluation of the predicted structures. 3. A third algorithm for protein secondary structure predlctlon IS SOPMA (Self Optimized Predictlon Method from Alignments) (IO). The program IS accessed and run as described m steps 1 and 2 above SOPMA simultaneously calculates the probablhty of helices, sheets, turns, cools, bends, and bridges m a primary ammo acid sequence using four Independent methods, and reports the results from each method together with a consensus sequence (see Fig. 5)
3.3.3. Protein Tertiary Structure Prediction As described m the preceding Subheadings, databases and algorithms for the analysis
of protein
primary
and secondary
structure
are extensive.
Although far less information is available at the tertiary structural level, databases for experimentally solved protem structures and 3D protem modeling programs are both available. The complexity of protem modeling algorithms and data interpretation precludes an m-depth discussion here; the followmg is included as a very basic introduction to the types of tools that are available
on-line.
1 To view available three-dimensIona images of proteins, select S?%‘IJCY3DIMAGE from the ExPASy home page This database contains Images of both experimentally elucidated structures and well accepted theoretlcal protein models To retrieve the model for a speclf”c protein, provide the appropriate key words or accesslon number when prompted Vlewing tools, which are required to visualize the images, may be downloaded directly from the SWISS3DIMAGE introductory page, and can be used to view Images m mono and stereo Until the solvmg of crystal structures progresses from an art to a more routine laboratory procedure, the relatively small number of entries m 3D structure databases ~111 continue to be a maJor hmltatlon for general use Theoretlcal modeling IS therefore the primary option for the majority of proteins (see steps 2 and 3) 2 Several modeling programs have been designed to allow predIction of protein tertiary structure based on known structures of related proteins. The SwzssModel application, accessible from the ExPASy home page, models protems based on comparison with related proteins for which structures have been solved experlmentally (11,12) To submit a protem sequence for modelmg, choose the First Approach mode and enter the sequence to be modeled by providing the SWISS-PROT accesslon number or by pasting m the protem sequence. Several hours later, the modeling results are returned via e-mall. The results consist of a listing of molecular coordmates and a descrlptlon of protems upon which the model 1s based. For example, a model of human lipopro-
324
Reue
1 10 20 30 40 50 60 I I I I I I I IBCP-Webserver~SKWnTLAVWLQSLTASRGCVAAADQRRDFID~S~~~E~D~~~ Gibratmthod HHHHHBHEHHHHHHHHHHHHHE~EHHBHHHHHH~~H~CCCCCC~~CCCCC Levln method CCCCEEEEEEEEBBHHCCCCCCTCCCHHCCCCSCCCCSCCCCCSSCCECCCCCCC~H~C~C DPMmethod CCHHHHEEEEEHEEEHCBCTTCCCCCHEHHHHHCEHBH SOPMA predict HHHHHHHHHHHHHHSHCCCCCCCCHH~~HECCTTEEEECCEHHECCHHBCCCCCHXCTT~ Consensus CCHHHHHHHHHHHHHHCCCCCCCCCH~HCCHC~CECC~HCCCCCCCHCC~CCCCC IBCP-Web serverAESVATCHFNHSSKTFEMH(;WTVTGMYESWVPKLVAAtYH Gibratmethod ECHEEEEECCCCCCEEEEEECCEEECCCCHHCB HHHHHHHHCCCCCCEEEEEEEHHCHCC Levin method CHCCHCCCCCCCCCCEEEBBCSEECCCHHHH~HHHHEHHHCTTCSCFXECCCCSCC~ HHCEHCCCCTTTCCEEEEEEZEBEECBECCEECHBBEHHBHC~CEEEEEEHHHHHHC DPM method SOPMApredict CHHHHEEEC!MCCTEEEEETTCEEEBBEEEECCHSEEEHHEHCCCCCKEEEHEHTTCCCC Consensus CHCEHCCCCCCCCCEEEEEECCEECCECHBCCBBHHBBHHCCCCC~~~~HHCCCC IBCP-Web seaxer Gibratmethod Levln method DPMmethod SOPMA preduzt Consensus
YPVSAGrmaVDQWARFINWMEEEFNYPLDNVBLLCYSLGAT CEECCCCEEEECEHHHHHHHHHHHHHCCCBBHH HEHHHHHHHBHEHBBHBHHCCCZEFJZEE CCCCTTCHHHHHHHEHHBHHHHHHHHHCCTSCCEEEECCHEHCHHEHHHHHECTCCC!EEE CCCCCCCCCEETCCEHHEEHHHHHHHCCCCCCECCCC CCCETHHHHHHHHHHHHHHHHHHHHHCCCCCHHHHHTCCHEEEHHHHBCCCCTTHEEEET CCCCCCCHHHHHHHHHHHHHHHHHHHCCCCCCBHHH~CHHH~HHHHCCHCCCCE~EE
Fig 5 Protein secondary structure predlctlon using SOPMA (Self Optlmlzed Predlctlon Method from Alignments). The human hpoprotem llpase ammo acid sequence wasretrieved from SWISS-PROT (accesslonnumber PO6858)and entered asthe query sequencefor SOPMA (http*/lwww ibcp-fr/serv-pred html, see Subheading 3.3.2. in the text) A portlon of the results are shown here, with the single letter ammo acid sequenceof hpoprotem hpase at the top, ahgned with structures predlcted by four different algonthms--G~brat method, Levm method, DPM method, and SOPMA predict (IO) The final hne representsa consensusstructure In the predlcted structure, H = helix, E = sheet, C = coil, and S = bend tern hpase was constructed by comparison to the structure of the most closely related protein for which molecular coordmates have been determmed, human pancreatic hpase (see Note 6) 3 The molecular coordinate data obtained with modelmg programs must be mterpreted m order to generate a physical model This may be accomphshed with applications such as Swzss-PdbVzewer, which IS lmked to Swiss-Model and accessiblefrom the ExPASy TOOLS page Swiss-PdbVlewer can be usedto perform homology modeling, to superimposeprotems, and to analyze active sites (13) The processrequired for each of these analyses1sbeyond the scope of this chapter, but IS beautifully documented m a step-by-step tutorial available from the Swiss-PdbVlewer page The user ISguided through the processof downloading the software (available for both Macintosh and PC platforms), entermg data, and viewing resulting models There are even plans for an ‘Art Gallery’ of protem structures
325
Internet Resources 3 3.4. Analysis of Two-Dimensional
Gel Nectrophoresis
Patterns
A rather unique offering on the ExPASy home page IS the SWISS ZDPAGE database of two-dtmensional polyacrylamide gel electrophorests patterns from a vartety of tissues and cell lures. 2D maps are avatlable for human liver, plasma, red blood cells, platelets, cerebrospmal flutd, lymphoma, erythroleukemta, HepG2 and macrophage-like cell lines, as well as yeast and E colz. 1 To view a 2D PAGE map from a parttcular cell or tissue type, open the SWISS 2DPAGE iink on the ExPASy home page, choose 20 PAGE Map Selectton, and then select the icon representing the map of interest. 2D gel maps can be viewed m large or small format, with spots correspondmg to proteins of known Identity highlighted. Selecting one of the htghlighted spots produces a display showmg the identity of the protein, molecular weight, p1, posttlonal variants, data on expression levels under vartous conditions (1 e , “increased expression during liver regeneratton”), and a hnk to the correspondmg SWISS-PROT entry Alternatively, tt is possible to search for the posttton of a protein of interest on the 2D maps by entering a key word. If the protein has been identified on any of the 2D maps, results will be displayed to Indicate on which 2D map(s) the protem has been identified, and other data as above. 2 As an alternative to searching for proteins on the 2D maps avatlable m SWISS2DPAGE, programs provtded m the TOOLS section of ExPASy (see Subbeading 3.3.1.) assist m the tdenttticatton of proteins based on PI, molecular weight, ammo acid composttton, and sequence tag mformatton. For example, Tagldent (previously GuessProt) ~111 identify proteins from the SWISS-PROT database whtch are closest to a given pI and molecular weight range, or identify proteins with a sequence tag Stmtlarly, Multzldent will suggest possible identitles of a protem based on PI, molecular weight, ammo acid composttton, and pepttde mass fingerprmtmg data AACompIdent allows putative tdenttticatton based on ammo acid composttion These programs may be used to help identify spots on 2D PAGE by provtdmg observed p1, molecular weight, and any other appropriate information available (see Note 7) 3 Technical mformatton from the Electrophorests Laboratory at Geneva Umversity Hospital for performing 2D PAGE IS also accessible through SWISS2DPAGE It is posstble to download detailed protocols for both analytical and preparative 2D PAGE, including sections on sample preparation, producing nnmobiltzed pH gradients for first dtmenston electrophorests, SDS PAGE as second drmenston, protem detectton, protein blotting onto membranes, and microsequencing Also described IS a software package for analysts of2D PAGE patterns
3.4. Experimental
Animal Models
As dtscussed tn Subheading 3.3.2., the Mouse Genome Database and related resources at the Jackson Laboratory provide a nearly comprehenstve coverage of mouse genome mformattcs, including information about naturally occurrmg and induced mutations. Additional noteworthy sttes that focus on mutant mouse
models and then- relationship to human disease are described below. (For a descrlptlon of existmg mouse strains with induced mutations in hpase genes, see Chapter 30 in this volume.) 1. TBASE 1s a searchable database of transgemc and targeted mutations m the mouse and other selectedexperlmental ammals(fruit fly, pig, and rat). This IS a powerful database owmg to both the extensive documentatton for each entry and the more than two dozen search parameters that can be specified to tdenttfy models that meet specific crtterta. The search parameters mclude standard key words (I e , name of the mutant mouse lme or gene Involved), methodologtcal factors (type and properties of the DNA vector used, identtty of embryonic stem cell lme and blastocyst strain, and method of DNA mtroductton mcludmg mtcromjectron, electroporatton, retrovtral mfectton, aggregatton), genettc parameters (homologous or non-homologous recombmatton, mtegratton sue), and phenotyptc features of the mutant mice (overall phenotype, altered or wild-type phenotype m heterozygotes, occurrence of lethality m embryonic, permatal, and postnatal periods, and potenttal appltcattons of the resulting mutant model) Thus, m addrtion to simple searches for mouse lines carrying transgenes or knock-outs m a parttcular gene of interest, tt IS possible to Identify mutants m unspectfied genes that produce a phenotype of interest, mutants derived using a technology of interest (i e , usmg YAC or retroviral DNA vectors), DNA vectors producing expresston m a desired set of tissues or developmental stages, or models with a potenttal appltcatton of interest (1 e , as a model m which to test anti-obestty drugs, or to examme the regulation of blood glucose levels) The TBASE home page also mcludes lmks to a glossary of terms used m molecular mouse genetics, as well as announcements for conferences and workshops, pertment books and laboratory manuals, and information on facilities for productton of transgemc/targeted mouse lines 2 The Human-Mouse Dysmorphology Database is a resource for mformatton on animal models of human disease and mouse/human genettc synteny Thts site consists of three lmked databases a catalog of non-chromosomal malformatron syndromes m humans known as the London Dsymorphology Database, the Mouse Malformatton Database, and the Mouse/Human Chromosome Homology Database Searches may be performed by specifying clmtcal features or chromosome locattons, human or mouse syndromes located at a chromosome region homologous with a corresponding chromosome region m the other species may also be identified This database 1s therefore useful for tdentlticatton of mouse models for specific human syndromes, and to carry out homology searches for the purpose of gene mapping. As more and more genes are mapped as part of the human genome project, mformatton m this database may become very useful m posltional cloning of mouse mutations 3 An additional general resource for btomedical researchers uttlizmg rodent models IS the Mouse and Rat Research Home Page. This site IS a collectton of lmks to dozens of databases pertinent to rodent models Links are orgamzed by subject and include Genome Informattcs, Nomenclature, Anatomy, Development,
327
Internet Resources
Physiology, Laboratory Animal Supphers, Cell Lines, Technical Guides and Protocols, and Software Many of the mouse sites described in thts chapter, such as the Jackson Laboratory and TBASE, can be accessed from this page 4.
Notes
1. To find additional topics not covered here, several searchable catalogs of resources on the World Wide Web are available Commonly used search engines mclude Yahoo (http:liwww.yahoo.com), Lycos (http.//www lycos corn), and Alta Vista (http.//wwwaltavista digital.com). In addition, several gateways lusting multiple servers of Interest to biomolecular researchers have been compiled, mcludmg Molecular Biology Gateway to the WWW (http.lfwww almac net/al gateway shtml), Yahoo-Science:Blology (http llwww yahoo com/Science/Biology), Amos’ WWW links (http://hcuge.ch/www/amos-www-links html), Pedro’s Biomolecular Research Tools (http*//www.pubhc tastate edu/-Pedro/ rt-1 html), and Bio-wURLd (http*//www ebi ac uk/htbin/bwurld pl) 2 This chapter assumes that the user already has access to the mternet and a working knowledge of using a web browser to navigate to a specific address. If additional
3.
4
5
6
7
background
infortnatlon
IS desn-ed, guidance on connecting
to the
World Wide Web and usmg network browsers may be found in several excellent articles and books aimed at biologists (14-16) The latter two books also contam in-depth treatments on the use of some of the specific resources descrtbed m this chapter. A baste BLAST search uses the default settings for search parameters and IS recommended as the best starting point If too few or too many results are returned, an advanced search with custom settmgs for search parameters may be performed. Help in setting search parameters is available in an onlme instruction manual Durmg peak user hours, completion of a BLAST search may require sigmficant computing ttme Rather than wan on-lure until the computations are completed, it is advisable to leave an e-mad address where results can be sent Most web sites described m this chapter can be accessed several ways. For example, in addition to the link through OMIM, GDB and HMGD home pages can be reached at the addresses specified in Subheading 2. As cauttoned by the authors of the Swiss-Model application, users should be mindful that the result of any modelmg procedure IS non-experimental and therefore must be interpreted with care. When performmg searches with programs such as Tagldent or Multlldent, beware that huge numbers of entries may fit the p1 and molecular weight parameters specified for a protem of Interest. Thus, it is advisable to narrow down the pI and molecular weight range as much as possible m the mltlal query.
Acknowlegments Support from the National Instrtutes of Health (HL-2848 1) and the American Heart Assocration (Estabhshed Investigator) are gratefully acknowledged.
328
Reue
References 1 Gerhold, D and Caskey, C T (1996) It’s the genes’ EST access to human genome content BioEssays l&973-98 1 2 Altschul, S F., Gtsh, W., Mtller, W , Myers, E W , and Ltpman, D J (1990) Basic local alignment search tool J Mel Bzol 215,403-410. 3 Manly, K F (1993) A Macintosh program for storage and analysts of expertmental genetic mapping data Mammal Genome 4, 303-3 13 4 Adams, M D. et al (1995) Initial assessment of human gene diversity and expression patterns based upon 83 mtlhon nucleottdes of cDNA sequence accumulated through April 28, 1995 Nature 377 (Suppl.), 3-174 5 Lennon, G., Auffray, C , Polymeropoulos, M , and Bento Soares, M (1996) The I M A G E Consortium An mtegrated molecular analysis of genomes and then expression. Genomzcs 33, 15 l-l 52 6 Rozen, S and Skaletsky, H J. (1996) Primer3 Code avatlable at http /wwwgenome wi mtt edu/genome_software/other/prtmer3 html 7 Hobohm, U. and Sanders,C (1995) A sequenceproperty approach to secondary protem databasesJ Mel Blol 251, 39@399 8 Kneller, D G , Cohen, F E , and Langrtdge, R (1990) Improvements in protein secondary structure preduction by an enhancedneural network J Mol. Blol 214, 171-182. 9 Rost, B and Sander, C (1994) Combmmg evolutionary mformatton and neural networks to predict protein secondary structure. Protezns. 19, 55-72. 10 GeourJon, C and Deleage, G. (1995) SOPMA Stgmficant tmprovements m protein secondary structure predtctton by predtctton from multiple alignments Comput Applzc Bzoscz 11,681&684 11. Pettsch, M. C (1995) Protem modeling by email Bzo/Technol 13, 658 12 Pettsch, M C (1996) Promod and Swtss-Model Internet-based tools for automated comparattve protein modellmg Blochem Sot Trans 24, 274 13. Guex, N and Pensch,M C (1996) Swiss-PdbViewer A fast and easy-to-usePDB viewer for Macmtosh and PC Protem Data Bank Quarterly Newsletter 77, 7 14 Harper, R. (1995) World Wade Web resourcesfor the btologtst Trends Genet 11, 223-228 15 Bishop, M J (1994) Gutde to Human Genome Computmg Academrc Press, San Diego, CA 16 Swmdell, S R , Miller, R R , and Myers, G S A (1996) Internet for the Molecular Btologtst ISBS, Portland, Oregon
28 Techniques for the Measurement Lipase Messenger RNA Gouri Ranganathan
of Lipoprotein
and Philip A. Kern
1. Introduction This chapter describes the measurement of lipoprotein hpase (LPL) mRNA levels m adipose tissue and muscle. Many investigators measure LPL m human biopsy samples, where only a small amount of tissue is available, requirmg sensitive measurement techniques. In addition, the descriptron of low levels of LPL expression in tissues such as liver, where it may play an important role m remnant lipoprotem uptake (I), also requires sensitive methods, Therefore, this chapter will concentrate on the use of competitive reverse transcriptase-polymerase chain reaction (RT-PCR) for the quantrtation of relatively low levels of LPL mRNA. Only brief mention will be made of Northern blotting and RNase protection assays,since these established methods are well described m commonly available laboratory manuals. 1.7. Overview of mRNA Quantitation. The choice of method for mRNA quantrtatton rests largely on the level of mRNA expression by a particular tissue, and therefore the sensmvrty required of the assay. With regard to LPL, if one needs to quantitate LPL mRNA m adipose tissue, and if adipose tissue 1s m relatively abundant supply (>l g), then Northern blottmg should yield excellent results. Much discussion often surrounds the issue of precision of the mRNA quantitation. In our experience, we do not believe that quantitative RT-PCR offers any distinct increase m precision over Northern blotting or RNase protection assaysif the latter are performed well, and the data analyzed properly. For all methods of RNA quantitation, it is essential to obtain high quality RNA from the sample and we use the method of Chomczynski and Sacchi (2). From
Methods Edited by
KI Molecular Bology, Vol 109 Lipase M H Doohttle and K Reue 0 Humana
329
and Phospholipase Protocols Press Inc , Totowa, NJ
330
Ranganathan
and Kern
Regardless of the method used to quantltate RNA, one must express the mRNA data m terms of an mternal standard. Since RNA extractlon efficiency varies from sample to sample, one cannot assume that the extraction of RNA ~111be equal from two samples of equal cell number, or equal tissue mass. Therefore, relative abundance of a specific mRNA must be expressed m relatlon to some constltutive standard. So called “housekeepmg” mRNAs are commonly measured, mcludmg actin, tubulm, and glyceraldehyde phosphate dehydrogenase (GAPD). Other investigators have used an adlpocyte specific marker such as aP2 (31, or have normalized their data to total RNA. The measurement of a “housekeepmg” mRNA during Northern blotting by slmultaneously probing (or reprobing) a blot with another cDNA 1s a simple and precise method, and allows quantltatlon of the signal from both messagesusmg densltometry on the same blot. The disadvantage of this techmque lies m the assumption that the “housekeepmg” gene is not altered by experimental treatments For example, when studies were performed to examme the regulation of LPL mRNA levels by dexamethasone treatment zn vztm, we found that dexamethasone also altered the mRNA levels of y-actm (4). Normahzmg data to total RNA IS another valid technique, since most cellular RNA IS non-messenger RNA, and therefore unlikely to change with most mampulatlons. The quantltatlon of RNA by the O.D. at 260 nm, however, 1snot suffclently precise for some cn-cumstances. To obtam better precision, one should run the RNA samples on a gel and identify the 28s and 18s RNA species by ethidlum bromide staining. This image can be scanned and quantitated to achieve a high level of precision. 1.2. mRNA Quantitation by Competitive PCR RT-PCR is a powerful method to measure mRNA expressed at relatively low levels, or when the available tissue sample is small The primer sites are chosen to span an mtron (see Fig. 1) In this way, If genomlc DNA 1spresent as a minor contaminant m RNA samples, the presence of an mtron will result in a large PCR product that will not interfere with the ldentlficatlon or quantltatlon of properly spliced mRNA The 3’ primer 1sused to reverse transcribe sample mRNA to cDNA This cDNA 1s then amplified using PCR. Competltlve RT-PCR makes use of coamplification of a template having the same primer sites as the target sequence, and competes with the target sequence for primer binding and amphfication. This template and the target sequence are dlstingulshed by size separation on an agarose gel. A template for quantltation of human LPL mRNA is commercially available (see Subheadings 2. and 3.). This template 1s designed w1t.h the same primer sites as the human LPL cDNA and contams nucleotides 1261-1281, and 1516-1536 of LPL cDNA, but also contams an
337
LPL and mRNA Quantdation PlllllCSl) 1261-1281
/
A
/
// /
/
1516-1536 4RJmer2
pq
C
Rmlerl)
pz-j
I I 23 base
4 Rlamz
msatlm
Fig 1 Strategy for quantttation of LPL mRNA by competmve RT-PCR (A) Human LPL gene arrows indicate the location of the primers on different exons (B) Human LPL cDNA arrows indtcate the prtmer binding sites, resultmg m a 277-bp PCR product C. Human LPL RNA standard thts standard has tdenttcal prtmer bmdmg sites but also contains an msertion of 23 bases, resultmg m a 300-bp PCR product
insertion of 23 bases wlthm the template (see Fig. 1). The resultmg PCR products from the competitor and native LPL mRNA are 300 bp and 277 bp, and can be separated on a 2% agarose gel. For non-human LPL mRNA quantltatlon, a different LPL RNA standard should be used which contams appropriate primer sites that span an mtron (see Note 1). 2. Materials 2.1. Reverse
Transcription
1. Reverse transcriptase (SuperScrtptTM II, Gibco-BRL) 2 5X first strand synthesis buffer. 250 mMTns-HCl, pH 8 3,375 mkKCI,15
mA4MgClz
Ranganathan
332
and Kern
3 0 1 mA4Dlthlothreltol 4 dNTP mix. 10 mM solution of each dATP, dTTP ,dCTP, and dGTP at pH 7 5 LPL 3’ specrfic primer (5’-CTGCAAATGAGACACTTTCTC-3’), 20 PM, or ohgo dT-20 mer 6 l-l 0 pg RNA sample 7. RNasm RNase mhlbltor (28 U/pL, Promega). 8 Gene specific template, 1.e , human LPL Gene Amphmer PAW 109 RNA (Perkm Elmer, Norwalk, CT) 9 Sterile water
2.2. Polymerase Chain Reaction (PCR) 1 Tuq DNA polymerase (Glbco-BRL) 2 3 4 5
10X PCR buffer 200 mM Tns-HCl, pH 8 4, 500 mM KCl. 50 mA4 MgCl, dNTP mix IOmM solution of each dATP, dTTP, dCTP, and dGTP at pH 7.0 LPL specific 5’ and 3’ primers, 5 PM. 5’ primer sequence, 5’-GAGATTTCT CTGTATGGCACC-3’, 3’ primer sequence given m Subheading 2.1., step 5 6 Sterile water 7 Thermocycler
2.3. Analysis and Quantitatiun 1. 2 3 4
of PCR Products
Ultrapure agarose (Glbco-BRL) Tns/borate/EDTA (TBE) buffer. 45 mA4 Tris, 45 mA4 borate, I mM EDTA 10 mg/mL ethldlum bromide dye solution. Gel scanner (Imagestore 5000, UltravIolet Products, Ltd San Gabriel, CA, or Eagle Eye, Stratagene, or equivalent)
3. Methods The use of competltlve reverse transcrlptase coupled with the polymerase chain reaction (RT-PCR) to quantltate LPL mRNA has been described prevlously (S-7). l-5 ng of total RNA from adipose trssue IS added to Increasing quantltles of a commercially available cRNA standard that contains primer sites for human LPL These primer sites are located at nucleotldes 1261 to 128 1 (GAGATTTCTCTGTATGGCACC), and 15 16 to 1536 (CTGCAAATG AGACACTTTCTC), of the LPL cDNA. These primers span an rntron m the LPL gene to prevent amplification of contammatmg genomic DNA during the PCR reactlon. PCR with the commercially avallable competmg RNA (cRNA) standard generates a product that 1s 23 nucleotides longer than the PCR product generated from native human LPL mRNA
3.7. Reverse
Transcriptase
Reaction
The reverse transcrlptase reactlon to synthesize smgle stranded cDNA uses either a specific 3’ primer (15 16- 1536 of hLPL cDNA) or ohgo dT-20 mer to prime cDNA synthesis.
LPL and mRNA Quantitation
333
1 The reaction IS carried out m a total volume of 10 uL and can be conveniently performed m 0 2 mL thermocycler tubes. Combine 2 0 pL 5X first strand buffer, 0 5 PL RNase mhrbltor, 1 )IL 10 mMdNTP mix, 1.0 pL DTT, 0 125 uL reverse transcriptase (25 U), 1 0 pL RNA sample, 1 0 uL gene ampltmer RNA standard (individual reacttons should be performed contaming 2 x 105, 1 0 x 105, 0 5 x 105, and 0 25 x IO5 coptes), 1 0 ,uL of 3’ prrmer (20 CUM),and 2.375 uL sterile water In the 1.O pL RNA sample, we use l-5 ng of total RNA from adipose tissue or 5-50 ng of RNA from muscle tissue. Controls contammg no RNA or no reverse transcrtptase should also be performed in parallel (see Note 2). 2 Incubate at 42°C for 30 mm, followed by heating at 95°C for 5 mm to denature the reverse transcrtptase The resulting cDNA 1s used for PCR as described in Subheading 3.2.
3.2. Polymerase Chain Reaction (PM) 1 The reactron IS performed m thermocycler tubes tn a volume of 50 uL To 10 uL of reverse transcnptase reaction product, add 5 pL 1OX PCR buffer, 2.0 PL 50 mA4MgCl,, 1 pL 5’ pruner (5 p~I4), 1 uL 3’prtmer (5 p&I), 1.OuL dNTP mtx (1 tisolutton ofeach), 0 25 uL Taq DNA polymerase (5 U&L), and 29.75 pL stenle water 2 Perform PCR for 35 cycles wtth 30 s denaturatton at 95°C 30 s annealing at 55°C and 60 s elongatton at 72°C
3.3. Analysis and Quanfifafion of PCR Products 1. Analyze the PCR products by separation on a 2 5% agarose gel The ampltficatton products derived from the competttor and native LPL RNA are 300 and 277 bp, respectively 2 Stain the gel m ethtdtum bromide solution prepared by addmg 10 uL of the stock solutton (10 mg/mL) to 100 mL of water for 20 mm, followed by destammg m water for 30 mm 3 The resulting ethrdmm bromide-stained gel can be Imaged using a vartety of imaging and scanning devices. We have used an Imagestore 5000 scanner, and analyzed the tmage using the Gelbase/Gelblot software (Ultravtolet Products, San Gabrtel, CA) Other scannmg devices, such as the Stratagene Eagle Eye, can also be used. 4. Plot the ratto of LPL product/cRNA standard agamst the number of coptes of cRNA added, to yield the equtvalence point between cRNA and LPL mRNA This IS Illustrated in Fig. 2.
4. Notes 1 The method described here uses prrmers and cRNA standard that are specrfic to human LPL The same procedures can be employed for rat LPL, but the prtmers and cRNA must be spectfic for rat LPL. As described by us previously (7), a cRNA standard was constructed by RT-PCR of a 306 bp rat LPL sequence (nt 1303-1608) and cloned mto the transcription vector pGEM4Z (Promega). An internal deletton of 19 nucleottdes was made by cutting this plasmid with Pstl
334
Ranganathan
and Kern
LPL cRNA (10’
A
Captes)
125 63 31
Heart
16 06
,
rnRW
1 35 nglreecllon
’
CRNA
EDL 6 rlg/‘m3mn
,
mRNP
’
CRkA
11
0
5
cRNA
6
10
(iO*
15
20
25
Copies)
/
--* -- iHeart
Soteus
EDL
Fig. 2. Example of quantitative RT-PCR of LPL mRNA in rat muscle. (A) Equal quantities of total RNA were added to increasing quantities of rLPL cRNA, followed by RT and PCR. The resulting image was quantitated, and the ratio of cRNA/mRNA was plotted against the amount of cRNA added. (B) Quantitation of LPL mRNA in rat muscle using quantitative RT-PCR. (From: Ong, et al. ( 1994) Regulation of muscle LPL. J. Lipid Rex 35,1542-l 55 1.)
LPL and mRNA Quantitation followed by rehgatton The transcript derived from this construct has 19 nucleotides deleted as confirmed by sequence analysis The primer sites for RT-PCR are located between nucleottdes 1303-1322, and 1589-1608 of rat LPL cDNA, this region spans an intron m the rat LPL gene thus avoiding ampltfication of genomtc DNA during PCR 2 Reverse transcnption coupled with PCR IS a highly sensitive techmque that allows detection of RNA transcripts from virtually any gene, mcludmg mRNA species of very low abundance. The high degree of sensmvity together with the necesstty for many mampulattons of samples and reagents, creates a risk for contammation. To control for the potential occurrence of cross contammatton between samples and reagent, a blank (contammg no RNA) should be mcluded to check punty of reagents during the reverse-transcnptase reactton, and during PCR. If contammation becomes a problem, the buffers and plasttcware can be treated wtth UV light for 15-30 mm If this does not correct the problem, all the reagents being used wtll need to be replenished We include controls contammg only the cRNA or only the sample with each specimen to control for errors m handling References 1 Betstegel, U , Weber, W , and Bengtsson-Ohvecrona, G (1991) Ltpoprotem hpase enhances the binding of chylomtcrons to low density hpoprotem receptor-related protein Proc Nat1 Acad Scz. USA 88, 8342-8346. 2 Chomczynski, P and Saccht, N (1987) Single-step method of RNA isolatton by acid guanidmmm thiocyanate-phenol-chloroform extraction Analyt Blochem 162, 156-159 3. Hotamtshgil, G S , Arner, P , Caro, J F., Atkinson, R L , and Spiegelman, B M (1995) Increased adipose tissue expression of tumor necrosis factor-Alpha m human obesity and msulm resistance. J Chn Invest 95, 240%24 15 4 Ong, J M., Simsolo, R. B , Saffart, B., and Kern, P A (1992) The regulation of hpoprotein hpase gene expression by dexamethasone in isolated rat adtpocytes. Endocrznology 130,23 1 Q-23 16 5 Siebert, P D and Larrick, J W (1992) Competitive PCR. Nature 359,557,558 6 Wang, A M , Doyle, M. V., and Mark, D. F (1989) Quantitatton of mRNA by the polymerase chain reaction Proc Natl. Acad Scl USA 86,97 17-972 1 7. Ong, J M., Stmsolo, R B., Saghizadeh, M , Pauer, A., and Kern, P A (1994) The expression of hpoprotem hpase m rat muscle: regulation by feeding and hypothyroidism J LpdRes 35, 1542-1551
29 In Vitro Transcription and Translation of Lipoprotein Lipase Gouri Ranganathan
and Philip A. Kern
1. Introduction LPL 1s regulated post-transcriptionally in response to several hormones. Post-translational regulation occurs m response to feedmg (1,2). Glycosylatlon of LPL at the first N-lmked glycosylation site is essential for catalytic actlvlty and secretion (3). A number of studies have demonstrated the Importance of glycosylatlon using mhlbltors of glycosylatlon, and inhibitors of glycoprotem transfer from the RER to the Golgi (45). Additional insight can be obtained from studies of the cidlcld mouse, which expresses large amounts of inactlve LPL and HL protein due to a recessive mutation not mvolving the structural genes for LPL or HL (67). Thus, the cld mutation appears to either interfere with LPL and HL oligosaccharlde processing, or with transport from the RER to the Golgi. We have described the regulation of LPL at the level of translation m response to several physlologlc condltlons. Catecholammes have long been known to inhibit the activity of LPL m adipocytes, and this inhibition IS of physiologic importance in the mobilization of adipose tissue lipid m response to fasting and exercise (8,9). In primary cultures of rat adlpocytes, LPL synthetic rate was inhibited by catecholamines more than fivefold within 30 mm of addition of epinephrine to the medium, with no change m LPL mRNA levels (10). As demonstrated in recent studies, the mhlbitlon of LPL translation m response to catecholammes 1sdue to the expression of a 30 kDa RNA binding protein that bmds to the 3’ UTR of the LPL mRNA (11,12). In addition to epmephrme, increased levels of LPL translation were found m adlpocytes from hypothyroid rats, and this high level of LPL translation was maintained when treated with epinephrine (13) This increased LPL translation, and the msenFrom
Methods Edtted
by
in Mo/ecular
Bology,
M H Dooltttle
and
Vol 109 Llpase and Phospholipase K Reue
337
0 Humana
Press
Inc , Totowa,
Protocols NJ
Ranganathan
338
and Kern
sitivity of hypothyroid adipocytes to epmephrme, is due to the absence of the 30 kDa bmdmg protein discussed above (14). All of these studies have relied heavily on m vitro transcrtption of the LPL cDNA, and the m vrtro translation of this RNA species mto LPL protein. In this chapter, we describe the methods employed in m vitro transcription and translation of LPL. We have performed m vitro transcription of hpoprotem hpase (LPL) using the bacteriophage T7, T3 or SP6 promoter driven transcription system. The LPL cDNA was cloned downstream of the specific promoter in the multiple clomng site. For most studies, we have used the transcription vector pGEM-4Z (Promega Corp ) to synthesizetranscripts for m vitro translation This vector is designed to allow synthesis of RNA complementary to either strand of the template by performing transcription reactlons from the appropriate bacteriophage promoter The resultmg LPL transcripts are translated to protein using a cell free protein synthesizmg system. The most common cell-free systemsuse rabbit reticulocyte lysates or wheat germ extracts and wtll yield full length polypeptide products The reticulocyte lysate system IS favored for translating larger size transcripts and when the translation reaction is followed by post translational processmg usmg microsomal membranes We use nuclease-treated rabbit reticulocyte lysate in our experiments involving translation of LPL (11,12,1#). 2. Materials 2.1. In Vitro Transcription All solutrons are prepared from RNase-free molecular grade reagents. 1OX transcription buffer 400 mM Tris-HCl, 60 mkf MgCl,, 20 mA4 spermldme HCl, 50 mk! NaCl. RNase inhibitor (RNasm, 28 U/pL, Promega, Madison, WI) NTP mix (25 mMmlx of each ATP, UTP, CTP, and GTP, Boehrmger Mannhelm, Indianapolis, IN) Linearized DNA template (l-2 rig/reaction) The human LPL construct described here is available from the authors T7 or SP6 polymerase (10 U/nL, Boehrmger Mannhelm) The choice of which polymerase to use is determined by the orientation of the DNA template within the transcription vector Sterile RNase-free water (Available from Promega,or may be prepared by treating with 0 2% diethylpyrocarbonate, followed by autoclavmg) RNase-free DNase (10 U/pL, Boehrmger Mannhelm) Phenol saturated with TE buffer, pH 4.3 (Fisher Scientific, Pittsburgh, PA)
2.2. In Vitro Translation 1 Rabbit reticulocyte lysate, nuclease treated (Promega). 2 I mM methionme-free ammo acid mix (Promega)
In Vitro Transcription and Translation 3 4 5 6 7
339
RNasm RNase mhlbltor (28 U/pL, Promega) Transcript dissolved m water (0.1-O 2 mg, prepared as described m Subheading 3.1.) [35S]-methlonme (1200 Wmmol) at 10 mCl/mL Sterile RNase-free water (see Subheading 2.1., step 6) DNase I (Promega)
3. Methods Plasmld vectors containing specific recogmtlon sequences for bacterial T7 and SP6 polymerases are used. The desired cDNA sequences are cloned mto the multiple clomng site of these vectors. Some of the transcrlptlon vectors most commonly used by us are pGEM2 (Promega) and pSP64 (Boehrmger Mannhelm). As described previously (11,12), we have used human LPL cDNA to derive transcripts to be used m m vitro translation assays.To generate a transcript of human LPL encoding nucleotides l-2435 (15), this region of LPL 1scut out of the plasmid and dn-ectionally cloned mto the transcription vector pGEM2. The pGEM2 vector IS constructed with T7 and SP6 polymerase recognltlon sequences on either side of the multiple clonmg site. The LPL-pGEM2 plasmid is linearized by restriction dlgestion at the 3’ end of the insert, and 1 pg of plasmld DNA 1sused m the transcription reaction If the LPL cDNA 1snot available m a vector with suitable restllciton sites, then the appropriate region of LPL cDNA should be amplified using PCR with the addition of appropriate restriction sites. The addition of, for example, Hind111and BamHI sites onto the 5’ and 3’ ends ~111facihtate convement clonmg mto the pGEM vector 3.1. In Vitro Transcription The m vitro transcription reaction can be set up using reagents supplied commercially m kit form (Boehringer Mannhetm), or can be assembled using the reagents listed m Subheading 2. (see Note 1). All of the buffers or reagents must be prepared from RNase-free molecular grade chemicals. 1 The reaction 1sperformed m a volume of 20 yL Mix 2 0 pL 10X tlanscrlptlon 2 3
4 5
buffer, 0 5 pL RNasin (14-20 U), 8 0 pL NTP mix, 1 pL linearized DNA template (l-2 pg), 2 pL (20 U) T7 or SP6 polymerase, and 7.5 PL water Incubate at 37°C for 60 mm Following transcription, analyze 1 pL of the reaction on a 1% formaldehyde agarose gel (26) The human LPL template encodmg nucleotldes l-2435 will generate a transcript of 2435 bases Digest the DNA template used to derive the transcript with RNase-free DNase (20 U) for 20 mm Extract the transcript with an equal volume of phenol, followed by ethanol preclpltatlon (16) This reactlon generally yields 10-l 5 pg of transcript
Rangana than and Kern
340 3.2. In Vitro Translation
In vitro translation of LPL transcripts 1sperformed using the rabbit retlculocyte m vitro translation system (see Note 2). The rabbit reticulocyte lysate concentrate supplied by the manufacturer (Promega) can be used at a concentration range varying from 70 to 50% without much loss m translation efficiency. We have performed all of the zn v&-o translation experiments for LPL using nuclease treated lysate at a concentration of 50%. 1 The reaction 1sperformed m a volume of 25 pL (see Note 3) Add 12 5 pL rabbit retlculocyte lysate (nuclease-treated) to a mlcrofuge tube contammg 0 5 pL RNasm (15-25 U), 1 0 pL of transcript (0 l-O.2 pg), 1.O pL of 1 mM ammo acid mix (methlonme-free), 3.8 pL [3sS]-methlonme (3 8 ~CI), and 6 2 pL of sterile water 2 Incubate at 30°C for 60 mm (see Note 4). 3 After translation, analyze the products by SDS-polyacrylamlde gel electrophore~1s. LPL, which is 49 kDa prior to glycosylatlon, will resolve at the middle of a 10% SDS polyacrylamlde gel A small format protem gel electrophoresls apparatus (such as Blo-Rad mml-Protein electrophoresls cell) is a convement system on which to separate zrzvitro translation products (see Note 5) 4 The gel should be fixed, treated with enhancer, and dried using a gel dryer The gel 1sthen exposed to film, and resulting image analyzed using a gel scanner.
4. Notes 1 Commercially avadable kits (1 e., from Promega) also permit coupled m vitro transcription and translation m a single reactlon tube While the coupled reactions are more convement, this system is recommended only if it 1snote necessary to control the amount of transcript used to program translation. 2 Many factors effect translation efficiency of specific mRNAs and these should be considered when setting up translation reactions For example, the optimal RNA concentration varies for particular transcripts and should be determined empmcally Other factors that influence translation are 5’-capping of transcript the presence or absence of the poly (A) tall If the translation efficiency IS low, one may need to optimize the concentrations of K’ and Mg*+ 3 The reaction volume for translation can be easily expanded to 100 pL by proportionately increasing each reactant 4. A range of mcubatlon times may be employed to determine lmearlty of the translation reaction with time
5 The products of the reactlon are not glycosylated Mlcrosomes can be added to the reaction to study post-translational processing.
References 1. Doolittle, M H , Ben-Zeev, 0 , Elovson, J., Martin, D., and Klrchgessner, T G (1990) The response of lipoprotein llpase to feeding and fasting Evidence for posttranslational regulation. J Bzol Chem 265, 457W577
In Vitro Transcription and Translation
341
2. Ong, J M. and Kern, P A (1989) Effect of feeding and obesity on llpoprotem hpase activity, lmmunoreactive protein, and messenger RNA levels m human ad]pose tissue. J Clm. Invest 84, 305-3 11 3 Semenkovich, C. F., Luo, C.-C , Nakamshi, M K , Chen, S.-H , Smith, L C., and Chan, L (1990) In vitro expresslon and ate-specific mutagenesis of the cloned human lipoprotem lipase gene Potential N-linked glycosylatlon site asparagme 43 IS important for both enzyme actlvlty and secretion J Blol Chem 265,5429-5433 4 Slmsolo, R B., Ong, J M., and Kern, P A. (1992) The characterlzatlon of llpoprotem llpase activity, secretion, and degradation at different steps of post-translatIona processmg in primary cultures of rat adlpocytes J Llpzd Res 32, 1777-1784. 5 Ben-Zeev, O., Doolittle, M. H , Davis, R C , Elovson, J , and Schotz, M C (1992) Maturation of lipoprotein lipase Expression of fill catalyhc activity requxes glucose tmnmmg but not tmnslocafion to the as-Golgl compartment J Bzol Chem 267,62 19-6227 6 Ohvecrona, T., Chemlck, S. S., Bengtsson-Ohvecrona, G , Patemltl, J. R., Brown, W V , and Scow, R 0 (1985) Combined lipase deficiency (cld/cld) in mice. Demonstration that an inactive form of lipoprotein hpase IS synthesized.J, Blol Chem 260,2552-2557 7 Oka, K , Yuan, J G , Senda, M., Maslbay, A. S , Oasba, P. K., Masuno, H , Scow, R 0 , Patemitt, J R., Jr, and Brown, W. V. (1989) Expresslon of lipoprotem llpase gene in combmed hpase deficiency. Bzochlm Bzophys. Acta 1008,35 l-354. 8. Eckel, R H. (1987) Adipose tissue lipoprotein llpase, m Lzpoprotew Ltpase (Borensztajn, J , ed ), Evener, Chrcago,.pp. 79-132. 9 Deshales, Y , GCloen, A., Paulm, A., Marette, A. and Bukowieckl, L J (1993) Tissue-specific alterations m lipoprotein llpase activity m the rat after chronic mfuslon of Isoproterenol. Harm Metab Res 25, 13-16 10 Ong, J. M , Saffari, B., Slmsolo, R. B , and Kern, P. A. (1992) Epmephrme mhlbits hpoprotem hpase gene expresston m rat adlpocytes through multiple steps m posttranscrlptional processing. Mol Endocnnol 6, 61-69 11 Yukht, A, Davis, R C , Ong, J M , Ranganathan, G., and Kern, P A (1995) Regulation of lrpoprotem llpase translation by epinephrme m 3T3-Ll cells importance of the 3’ untranslated region. J Clan. Invest. 96, 2438-2444. 12. Ranganathan, G., Vu, D , and Kern, P. A. (1997) Translational regulation of llpoprotem lipase by epmephrme mvolves a transacting binding protein mteractmg with the 3’ untranslated region. J Biol. Chem 272,25 15-25 19 13 Saffan, B., Ong, J. M., and Kern, P A. (1992) Regulation of adipose tissue lipoprotem hpase gene expresslon by thyroid hormone m rats J Lipid Res 33, 24 l-249 14 Kern, P. A , Ranganathan, G , Yukht, A., Ong, J. M., and Davis, R (1996) The translational regulation of lipoprotem lipase by thyroid hormone IS via a cytoplasmlc represor that interacts with the 3’ untranslated region. J Lipid Rex 37,2332-2340 15 Wlon, K L , Klrchgessner, T G., LUSIS, A. J., Schotz, M. C , and Lawn, R. M (1987) Human hpoprotem lipase complementary DNA sequence Sczence235 1638- 164 1 16 Sambrook, J., Fritsch, E. F., and Mamatls, T. (1989) Extraction, purification, and analysis ofmessenger RNA from eukaryotic cells, m Molecular Clomng A Laboratory Manual (Nolan, C., ed.), Cold Spring Harbor Laboratory Press, Plamview, NY, pp. 7 l-7 87.
Induced Lipase Mutations in the Mouse Clay F. Semenkovich 1. Introduction Genetic manipulation of the mouse has simplified the study of mammalian hpases and phospholipases at the level of whole animal physiology Many insights mto llpase biology derived from reductionist systemssuch as cultured cells have been confirmed using induced mutations m mice But these animals have also provided new informatlon and represent a valuable resource for testing discrete hypotheses in intact animals. 1.1. Overview
of Transgenic
and Knockout
Technology
There are two general types of engineered mouse models, transgenic mice (1) and mice with targeted inactivations of specific genes (more commonly known as “knockout” mice). In the former, a gene of interest is injected into fertilized eggs. These eggs are implanted into pseudopregnant females (treated to mimic the hormonal milieu of pregnancy). Some of the offspring carry the injected transgene The number of copies of the gene varies widely The level of expression of the transgene correlates roughly with the number of copies incorporated mto the genome, 1.e.mice carrying 10 or 20 copies of a transgene usually have higher levels of expression than mice with 1 or 2 copies The transgene is present in the DNA of every cell of these mice. Whether or not the transgene 1s expressed m a particular cell depends on the promoter contained in the transgemc construct injected into the fertilized eggs. The promoter IS the DNA sequence at the 5’ end of a gene which causesexpression by interacting with transcription factors. DNA from the chicken actm promoter and the CMV immediate early gene promoter direct ubiquitous expression of transgenes. DNA from the LCAT promoter, the albumin promoter, and the muscle creatine kmase promoter direct tissue-specific expression; m these From
Methods Edrted
by
m Molecular
Biology,
M H Doohttle
and
Vol 109 Llpase and Phosphollpase K Reue
343
0 Humana
Press
Inc , Totowa,
Protocols NJ
344
Semenkovich
examples, lrver expression for the LCAT and albumin promoters, and skeletal muscle and heart for the creatine kmase promoter. Integratton of transgenes can occur anywhere m the genome. This may dtsrupt the function of other genes at the integration sate.Therefore, analysis of more than one founder mouse is necessaryto enhance confidence that observed phenotypes are due to overexpression of the transgene and not simply because of disruption of a function encoded at the transgene integratton site. Although transgemc mice are the product of fairly random mtegration m the genome, knockout mice are generated by targetmg a piece of DNA to a known site m the genome utihzmg the process of homologous recombmation. A fragment of genomic mouse DNA 1smodified to contam a foreign gene (usually the neomycin resistance gene) subsequently used for positive selection This marker is placed so that it disrupts the coding region of the gene of interest but still allows the retention of several kilobases (kb) of native gene structure on both sides of the marker. This DNA (the targeting vector) 1stransfected mto embryonic stem (ES) cells, undifferentiated cultured cells derived from the blastocysts of mace.In a fraction of the cells, targeting DNA replaces native DNA by homologous recombination. The cells m which this has occurred are selected by culturing m the presence of neomycin, and confirmation of the targeting event IS confirmed by Southern blotting or related techniques (see Subheading 3.3.). Targeted ES cells are injected mto the blastocysts of mice, offspring (chtmeric mice) are bred with wildtype mice to demonstrate germlme transmission of the mutatton, and these offsprmg (heterozygous or +/- at the gene targeted if the gene IS located on an autosome) are bred with each other to generate homozygous (-/-) animals. Modification of this technique allows subtle mutations of specific genes (2). 1.2. Existing Transgenic and Knockout Models There are now at least seven mouse models addressing ltpase physiology. The phenotypes of some of these experimental models have been replicated m different laboratones. The models are begmnmg to be used m studies of atherosclerosis, gene therapy, muscle physiology, vrtamm metabolism, macronutrient metabohsm, and other issues. These animals are also being crossed with other established mutant mice to generate new models. 1 2 1. Transgenic Mice Expressing Human Lipoprotein Lipase (LPL) Three separate groups have generated mice expressing human lipoprotem hpase with similar results. Shimada and colleagues (3) injected fertilrzed eggs with a construct containmg the chicken actm promoter and the human LPL cDNA. Human LPL was expressed m essentially all mouse tissues. Expression was considerable m the heart, skeletal muscle, krdneys, adipose tissue, and
Induced Llpase Mutations
345
lung. Compared to control mice, postheparm LPL activity was 1 7-fold higher m heterozygotes and 2.6-fold higher m homozygotes. Total triglyceride levels and VLDL trrglycerrdes were lower m transgemcs compared to controls m fasting mice after eating a control chow diet and after 10% sucrose feeding for three weeks. Total cholesterol levels and LDL cholesterol were also lower m transgemcs as compared to controls after eating a 1.25% cholesterol/0.5% cholate/l5% fat diet for two weeks. Retinyl palmitate tolerance testing showed that chylomicron remnant clearance was more rapid m transgemcs compared to controls. Induction of experimental diabetes with streptozotocm in thusmodel is assocrated with less hypertriglyceridemia and hypercholesterolemia compared to diabetic wildtype mice (4). These animals have also been bred with low density lipoprotein (LDL) receptor knockout mice, a model which readily develops diet-induced atherosclerosis. Overexpression of the human LPL transgene m LDL receptor knockout mice reduces atherosclerosis (5), consistent wrth an anti-atherogenic role for LPL. Two additional groups have also expressed human LPL m transgemc mice, one using the CMV immediate-early gene promoter (6) and the other the mouse metallothionem promoter (7). Human LPL expression in different tissues was more restricted m both of these models as compared to the Shimada mouse, but the major sites of expression were similar. Both groups also demonstrated decreased VLDL and resistance to diet-induced dysliptdemia m the presence of the human LPL transgene. None of the three groups detected changes m HDL cholesterol m LPL transgemcs 1.2.2. LPL Knockout Mice Two independent groups have inactivated the mouse LPL gene with stmilar results. Coleman and colleagues (81 used a targeting vector designed to disrupt the carboxyl-terminus of the mouse LPL protein. LPL homozygotes (--I--) mamfest no LPL enzyme activity, serum triglycerides of greater than 13,000 mg/dl, and absent HDL cholesterol. These animals are born alive but die within the first 48 hours after birth. Animals are cyanotic and manifest pulmonary pathology at the time of death. Heterozygotes are viable and fertile. These animals have lower LPL enzyme activity and higher triglycerides than wildtype mice Triglyceride elevations are due to increases m VLDL particles. HDL levels are no different m +/compared to +/+ animals. Experimental drabetes m the LPL +/- mice substantially exacerbates their dyshpidemia (9). Weinstock et al., using a vector targeting a different region of the mouse LPL gene, generated a knockout mouse (10) that confirmed the findings of the Coleman mouse. These mvesttgators also demonstrated impaired VLDL clear-
346
Semenkowch
ante m LPL +/- mice, and crossed LPL defictent mice with a muscle-specific LPL transgemc mouse (see Subheading 1.2.3.) Some progeny of the latter cross expressed LPL activity only in muscle yet were vtable, confirmmg the concept that permatal death in -/- mice 1sowing to LPL deficiency 7.2.3. Muscle-Specific L PL Transgemc Mice Levak-Frank and colleagues (11) generated a mouse expressing human LPL only m muscle tissue by using the promoter for the muscle creatme kmase gene. Three independent founders were used to generate transgemc mouse lines for study. These founders expressed low, medium, and high levels of LPL activity m skeletal muscle and heart with expression roughly tenfold higher m skeletal muscle. In the lme with the highest expresston, LPL enzyme activity in skeletal muscle was 24-fold higher than controls. Cn-culatmg triglycerides were decreased m the transgemcs, but plasma free fatty acids were not mcreased. The most strikmg phenotype was seen m the hne with the highest expresston. These animals failed to gain weight normally, had no adtpose ttssue, and had decreasedmuscle massdue to a myopathy. Theseannnals die prematurely probably becauseof respiratory msufficiency causedby decreasedrespiratory muscle mass. These muscle-specific LPL transgemc mice have been used to study the role of LPL m a-tocopherol metabolism (12) a-Tocopherol content m skeletal muscle varies directly wtth the level of LPL expression m these transgemc mice. 1.2.4 Transgenic Mice Expressing Human Hepatic Llpase (HL) Busch and colleagues, using a metallothronem promoter, generated a mouse transgemc for human hepatic hpase (13). After Injecting cadmmm to induce the transgene, human HL expression was detected m liver, heart, kidney, brain, testes, ovaries, and adrenals. Essentially all of the human protein produced by this transgene was heparin-releasable. In mice, most HL circulates and ts not bound to heparm-sensttive sites. The results m this model strongly support the concept that this species-specific dtfference m HL biology is mtrinsic to the protem itself Feeding these mice an atherogernc diet contammg zinc (to actrvate the promoter) resulted m decreasesm HDL cholesterol m concert with decreasedcholesterol content in the aortas of these mice Lower HDL cholesterol concentrattons were associated with a smaller HDL particle that retamed apohpoprotem AI as its major apoprotein. 1.2.5. Hepatic Lipase (HL) Knockout Mice Homamcs et al. (14) macttvated hepatic lipase by dtsruptmg exon 4 of the mouse HL gene. HL mRNA is absent m the hver and plasma HL acttvity is absent m HL -/- ammals. Total and HDL cholesterol levels as well as phos-
Induced Lipase Mutations
347
phohptds are elevated m these mace but there is no effect on stattc triglyceride levels When these ammals are fed a high fat, high cholesterol diet, the increase m VLDL and remnant hpoprotems is far less than in control mice. In addmon, HDL cholesterol levels Increase m the HL -/- mice after high fat feeding; the same dtetary challenge decreasesHDL cholesterol m HL +/+ mrce HL --- mace have been used to express human HL by adenovnus-mediated gene transfer (1.5). Nmety-seven percent of human HL expressed using an adenovnus m HL -/- mace is heparin-releasable, confirmmg the studtes of human HL in transgemc mice (13). Adenoviruses have been used to perform structure-function studies of lipases m these HL -/- mice (16). 7.2 6 Bile Salt-Activated
Lipase (BAL) Knockout Mice
Howles et al. (17) disrupted exon 4 of the gene for bile salt-activated hpase (pancreatic cholesterol esterase)usmg homologous recombmatlon m mace Bile salt-activated hpase (BAL) knockout mice (-/-) had no expression of the BAL protem m pancreatic homogenates. Pancreatic extracts from -/-- mice mamfested a substantially decreased ability to hydrolyze cholesteryl esters m the presence of bile acids. Serum cholesterol levels were similar m BAL +/+ and -/--mice. Even m the setting of a high fat/high cholesterol duet,BAL -/- mice aborbed free cholesterol normally Cholesteryl ester absorptton was impaired in BAL -/- mice. 1.2.7. Transgemc Mice Expressing Human Lecithin:Cholesterol Transferase (L CA T)
Acyl
Three different groups have generated mice expressing human LCAT. Vaisman et al. (18) mlected fertibzed eggs with a 6 2 kb fragment contammg all of the human LCAT exons and introns as well as 0.9 and 1.1 kb of the 5’ and 3’ flanking regions, respectively. Human LCAT mRNA was expressed mostly m liver. Three separate founders were used to establish separate lines carrying between 15 and 120 copies of the human LCAT gene These ammals had appropriately Increased LCAT mass and enzyme activity. Compared to controls, LCAT transgemcs manifested increased concentrations of total cholesterol, HDL cholesterol, apoA-I, apoA-II, and apoE. There was no effect of the transgene on triglycerides. Francone and colleagues (19) used the mouse albumin enhancer/promoter or 0.6 kb of the human LCAT 5’ flanking region to drive expression of human LCAT m mice. Like the Vaisman mouse, these mice expressed human LCAT m liver, had increased LCAT activity, and hrgher cn-culatmg concentrattons of total cholesterol and HDL cholesterol. Mehlum et al. (20) used 1.9 kb of the human LCAT 5’ flanking region and 0.9 kb of the 3’ flanking region to express human LCAT m transgemc mice.
348
Semenkovich
Agam, human LCAT mRNA was detected mostly m liver, and LCAT enzyme activity was substantially higher m transgenic animals compared to controls. However, the phenotype of these animals was somewhat different than the Vaisman and Francone mice. Fasting triglycerides were lower m transgemcs compared to controls; LPL enzyme acttvity was not different between transgemcs and controls but HL activity was higher in the LCAT transgemcs. VLDL and LDL cholesterol levels were lower m the transgenics HDL cholesterol levels as well as apoA-I and apoA-II levels were higher m the transgemc mice. 7.3. Methodology for Working with Transgenic and Knockout Mouse Models In addition to the above mouse models, new models are contmually being generated. This chapter will describe the methods required for estabhshmgand mamtaming a small mouse colony, preparmg DNA from animals, genotypmg by polymerase cham reaction (PCR), and determining the ltptd phenotype of mice. 2. Materials 1. Tail DNA dtgestton buffer 0 1 MNaCl, 10 mMTris-HCI, pH 8 0,2.5 mMEDTA, 0.5% SDS, 0.1 mg/mL proteinase K Proteinase K (Boehrmger Mannhelm, cat. no 1373 196) IS supplied as a solution stored at 4°C It 1sadded to the digestion buffer tmmediately before use 2 7 5 M ammonmm acetate 3. Absolute ethanol (stored at -20°C). 4 70% ethanol (stored at -2O’C). 5 Oligonucleottdes for polymerase chain reaction (PCR). 6 PCR reagents (Perkin Elmer Corporation)* 10X Gene-Amp PCR buffer II, 25 mM MgCl* , dATP, dCTP, dGTP, dTTP (each at 10 n-&j’, AmphTaq DNA polymerase 7 10X TBE buffer 0 9 MTrts-HCl (pH 8.0), 0.9 M boric acid, 0.02 M EDTA 8. Agarose I (Midwest Sctenttfic, cat no. 0710-500) 9. DNA dye .0.25% bromphenol blue, 0.25% xylene cyan01 FF, 30% glycerol m water 10 Methoxyflurane (Metofane), mhalatton anesthetic for veterinary use (PttmanMoore, Mundelem IL). 11 Borostlicate glass capillary tubes, heparnnzed (Baxter, Deerfield, IL, cat no. B 4416-20) 12 FPLC buffer = 150 mMNaC1, 1 mM EDTA (pH 7 4), 0 02% NaN, 13 Assay ktts for determmation of lipid concentrations (Sigma, St. LOUIS, MO) Trtglyceride reagents (cat no. 339-lo), cholesterol reagents (cat no 352-20).
3. Methods 3.1. Establishing a Mouse Colony Establishing a small mouse colony for subsequent study IS straightforward but requires preparation and consultatton with the local ammal care facility.
Induced Lipase Mutatrons
349
Protocols outlmmg expertmental plans and approprtate provtston for humane treatment of mice must be approved by the local animal care supervisory commntee before mice will be accepted m shrpment from another mstttutton. Wtth the exception of shipments from certain known repositories of mutant mice (such as the Jackson Laboratones), mice accepted from other investigators should be quarantined after arrival. These animals should be placed m cages with sentinel mice for 21 d. Sentmel mace are subsequently sacrtficed and examined by the veterinarian for mouse pathogens such as mouse hepatitis vn-us, lymphocytic chortomeningitis virus, polyoma vn-us, sendal vn-us, pneumonia vn-us of mice, mycoplasma pulmoms, K-virus, and others This procedure not only protects the mouse colomes at the accepting instttutlon, but 1s also important for generation of reliable data. Several Infections m mammals have protean effects on lipid metaboltsm. Depending on the experimental question to be addressed, induced mutant mice are bred with other mice carrymg the same mutatton, mace carrying a different induced mutation, or with mice from an inbred strain with specific known charactertsttcs such as susceptibility to diet-induced atherosclerosis (e.g., C57BL6/J). 1 Pace a single male in the same cage with a single female. Sexing IS performed by
exammmg the perineum. The most raprd means of distmgulshmg males and females is based on the distance between the urethra and the rectum This drstance IS greater m males dueto the presence of subcutaneous testes The presence of a vaginal plug Indicates that fertrlrzation has occurred but these plugs can also fall out so we do not routinely examine females after mating 2 Move breeding males a new cage with a new partner once females have clearly been impregnated and before birth (see Note 1). The gestatron period for mice IS 19-2 1 d Females are notrceably pregnant by d 14-I 6 of gestation. 3 Leave newborn pups undisturbed for 1 wk (see Note 2) 4 Subject pups to “toemg and tatling” on d 7 of life Toemg is the amputation of single digits for subsequent animal identification Tailing IS the removal of a small portion of the mouse tail for preparation of DNA to be used for genotypmg
3.2. Preparation
of Mouse Tail DNA
1. Grasp pups gently by the skm at the back of the neck with the ventral surface facing the mvesttgator 2 Using tine, sharp sctssors, amputate the most lateral digit on the right foreleg 3. Amputate one cm of the same animal’s tar1 and place it in a previously prepared sterile mtcrofuge tube containing 0 5 mL of tall DNA digestton buffer and labeled wrth the cage number and “Pup #l”. 4. Repeat the procedure for the next mouse except amputate the next most medial digit Mice have four functronal digits on each foreleg so single toe cuts at the forelegs can drstingmsh 8 separate animals m a cage For larger Inters, use combinations of foreleg cuts or toe cuts at the hmdlegs. Animals tolerate this proce-
Semenkovich
350
5 6 7 8 9 10 11
dure well and are readtly accepted by nursing mothers afterwards Other techniques for animal identification are available, but the above described technique is reliable and economical Incubate mouse tails m digestion buffer at SOY overnight with intermittent gentle vortexing Extract once with an equal volume of phenohchloroform, then once with an equal volume of chloroform To the aqueous phase add 0 5 vol of 7 5 M ammomum acetate and 2 5 vol of absolute ethanol Vortex the mixture. Place tubes at-70°C for at least 30 mm, then centrifuge at 4°C m a microcentrrfuge at the maxtmum setting Remove the supematant wtth a sterile ptpet Wash the visible DNA pellet twice with cold 70% ethanol. Dry the DNA using a combination centrifuge/vacuum device, then drssolve it in O5mLof10mMTrrs-HCl,pH80,OlmMEDTA Estimate DNA concentratron by determining the absorbance of the solution at 260 nm usmg a standard spectrophotometer (1 0 D. umt represents -50 pg of double-stranded DNA) A 1 cm segment of mouse tail typically yields l&50 ug of genomtc DNA
3.3. Genotype Analysis by PCR Animals are genotyped by PCR (see Note 3), which requires oligonucleotide primers specific for the model of interest. Many mstrtutions mamtarn olrgonucleottde syntheses facrhties. Oligonucleotides are also available at low cost from commercial sources (e.g., Operon, Alameda, CA, http://www.operon.com) In the case of the LPL knockout mouse generated by Coleman, the upstream primer corresponds to mouse LPL exon 8 (5’-TTT ACA CGG AGG TGG ACA TCG GA) and the downstream prrmer corresponds to a region near the 3’ termenus of the neomycin reststance cassette (S-TCG CCT TCT ATC GCC TTC TTG AC). For PCR reactions mvolvmg other prrmers, optimal reaction conditions (e.g., magnestum concentration and annealing temperature) will differ from those indicated below. 1 Adjust the concentration of ohgonucleottdes to 50 pg/mL m sterile water using a spectrophotometer (1 0 D unit represents 30 pg of single-stranded DNA). 2 To each of several sterile mrcrofuges tube add 10X PCR Buffer (2 5 pL), 25 mM MgCl (2 pL), dATP (0 5 uL), dCTP (0 5 pL), dGTP (0 5 pL), dTTP (0 5 pL), upstream prtmer (0 5 pL), downstream primer (0.5 pL), sterile drsttlled water (16 5 pL), and Tuq polymerase (0 5 pL) For large scale genotypmg, make a master mix of the above components and ahquot 24 pL to each tube 3 To each assay tube add Mouse Tall DNA (1 yL). 4 To one tube (the negatrve control), add 1 pL of water (instead of mouse tail DNA) 5 Overlay each mixture wrth a drop of mmeral 011. 6 Subject each tube to PCR m a standard thermal cycler programmed with the followmg parameters 94” for 5 mm (one cycle), 94’ for 1 mm, 50” for 2 mm, 72” for 3 mm (30 cycles), 4” (soak file)
Induced Lipase Mutations
351
7 Mix 0 8% (w/v) agarose m 1X TBE, then boll the mixture briefly using a hotplate or microwave oven 8. Cool the mixture to 55°C m a water bath, then pour it mto a horizontal gel casting apparatus and wait for the gel to solidify. 9. Load gel lanes with the products of PCR reactions (mlxed with l/6 vol of DNA dye) and electrophorese with size standards 10. Stain gels with ethldium bromide and photograph on a UV light box Heterozygous LPL deficient animals are identified by the presence of a -600 bp PCR amplification product
3.4. Weaning and Subsequent Breeding 1 Wean mice, 1.e remove them from the nursing mother, at d 21 of life 2 Place males and females in separate cages. Most institutions limit the number of mice allowed per standard small cage to 4 or 5 Slblmg males mamtamed together since birth can be safely housed in the same cage. However, males from different litters or males previously used for breeding are best kept in separate cages since they tend to fight (see Note 4). 3 Mate males and females beginning at age 8 wk (see Note 5). Age 8-l 2 wk is also a suitable age for the determmatlon of fasting lipids and hpoprotems to determme the phenotype of mice
3.5. Blood Collection and Lipid Analysis The easiest way to obtain blood for lipid analysis is from the mouse retroorbital plexus. A common alternative IS vempuncture of the tall vem but m some inbred strains (such as C57BL6/J) the caliber of this vein IS very small. 1 Remove food from animals for 4 h (see Note 6) 2 Place a mouse m a Jar containing gauze freshly soaked with metofane, a safe, rapld-actmg Inhalant anesthetic Mice lose consciousness m one to 2 min 3 Remove the mouse from the Jar the instant movement stops and before breathing 1s affected. 4 Grasp the mouse with the left hand and apply gentle pressure so that the eyes protrude slightly 5. Insert a heparmlzed capillary tube gently behind the lateral aspect of the right eye. After the tube quickly fills with blood, remove the tube and allow the animal recover (see Note 7) 6 Transfer the contents of the capillary tube to a sterile mlcrofuge tube on ice 7 After the blood has clotted, centrifuge samples at 300 g for 5 minutes 8 Removed the serum and store it on ice The typlcal yield from a single capdlary tube is 25 yL If more serum is required several tubes can be collected (see Note 8) 9 Assay serum the day of collection (see Note 9) for total lipids using reagents provided m kit form from Sigma. Accurate lipid determmatlons can be made on as lrttle as one or 2 pL of serum Assay at least two separate volumes to ensure that increasing the input serum yields a proportionate increase m signal Each
Semenkovich
352
assay requires the generation of a standard curve at the time of the assay For triglycertdes, absorbance 1s measured at 540 nm, for cholesterol, absorbance is measured at 500 nm Values for both are less reliable m the setting Of pUndICe (an occasional side effect of some experimental diets) 10 If necessary, determine the hpoprotem phenotype by separation of lipoprotems using size exclusion chromatography (21) For this technique, pool equal volumes of serum from several animals with the same genotype A mnumum of 250 pL is required for most FPLC systems such as the BioRad Biologrc System (cat. no 750-0005) equipped wtth a Superose column Equilibrate the column with FPLC buffer, Inject the serum sample, and collect 5G60 0.5-mL fractions Assay each fractton as descrtbed above for triglyceride and cholesterol content With thts assay, large particles such as VLDL are eluted from the column first followed
by IDL,
LDL,
then HDL
4. Notes 1 Female mice are apparently very suscepttble to impregnatton m the immediate post-partum period However, we have not had much success mating females immediately after birth and It is our impression that pup mortality IS higher when males are kept m the same cage wtth nursing females It is possible to transfer pups to another nursing mother to allow the postpartum female access to a breeding male, but pups are not always accepted by the surrogate mother. 2 Even m wildtype mice, perinatal mortality is high It IS not uncommon for a perfectly healthy, large litter to be born one day, nurse normally the same day, and then be absent from the cage the next day with only remnants of a few dead pups remammg m the cage This observation, indicatmg that the mother killed and ate the pups, identtfles an unsuitable breeder Once this occurs twice with the same female, we no longer use these females for breeding 3 Mice can also be genotyped by Southern blotting but thts technique is cumbersome It is also probably unnecessary since models are characterized by Southern blotting at the time of their origmal description. It is useful to make “mixed mutant” mice to address specific experimental questions. These mixtures can include “double knockouts ” For example, we have recently moved the LPL +/- mutation mto the low density hpoprotem receptor knockout background and verified the genotype of these animals by PCR This requires separate genotypmg at both the LPL and LDLR loci usmg oltgonucleotides specific for each gene 4 If space or cost become critical, tt IS posstble to house males from different htters or males prevtously used as breeders m the same cage The animals will fight, but m most cases, a dommant male quickly emerges and the fighting stops 5 Females can probably breed at age 6 wk. Some males will not be suitable for breedmg until they are older than 8 wk. Regardless of age, some breeding pairs show no interest m generating progeny We change partners if no pups appear by 6 wk 6 There is evidence that fasting for longer than 4 h m mice can elevate lipids but m our hands thts effect is very modest and not always observed,
Induced Llpase Mutations
353
7 Although retro-orbltal
bleeding requires practice, ammals tolerate it extremely well Blrndness IS rare lfthe technique IS carried out properly If ammals wake up durmg the procedure, they can be lmmedlately returned to the metofane chamber. Animals should not be left m metofane unsupervised. This anesthetic will cause respiratory depresslon and death after a sufficient period of time 8 The total blood volume of an adult mouse IS about 1 ml which represents about 500 pL of serum. Therefore, one capillary tube of blood (approx 50 pL) represents 2 5% of the clrculatmg blood volume of the mouse. In chronic studies, blood drawing should probably be hmlted to 50 pL or less per week to decrease the physlologlc stress Imposed on the animal 9 Trlglycerldes should be assayed first. If hpoprotems are to be determined by FPLC, samples should not be frozen since this treatment disrupts hpoprotems If only total hplds are to be determined, it 1s possible to freeze samples for later assay However even at -70°C, triglycerides decrease wlthm one week of storage Cholesterol 1s more stable than triglycerides However, even with cholesterol samples, prolonged storage before assay 1s undesirable because of the posslblhty of bacterial contammatlon. We routinely measure total lipids and run FPLC columns the day of serum collection. FPLC fractions (kept at 4°C overnight) are assayed the followmg day for triglyceride and cholesterol content 10. We originally used two Superose 6 columns m series to enhance hpoprotem separation We now use a single column with slmllar resolution of llpoprotem peaks
References 1. Breslow, J, L (1994) Lipoprotein metabolism and atherosclerosis susceptlblllty m transgemc mice Curr Opm Llprdol 5, 175-184 2 Bronson, S K and Smlthles, 0 (1994) Altering mace by homologous recombmatlon usmg embryonic stem cells J Biol Chem 269,27,155-27,158 3. Shlmada, M , Shimano, H , Gotoda, T , Yamamoto, K., Kawamura, M , Inaba, T , Yazakl, Y , and Yamada, N (1993) Overexpresslon of human llpoprotem llpase m transgemc mice Resistance to diet-induced hypertrlglycerldemla and hyper cholesterolemla J Bzol Chem. 268, 17,924-17,929 4 ShImada, M , Ishlbashl, S., Gotoda, T , Kawamura, M , Yamamoto, K , Inaba, T , Harada, K., Ohsuga, J , Perrey, S , Yazakl Y , and Yamada, N (1995) Overexpression of human hpoprotem hpase protects dlabetlc transgemc mice from diabetic hypertriglycerldemla and hypercholesterolemia Arterloscl Thromb Vast Blol 15, 1688-1694 5. Shlmada, M , Ishlbashl, S, Inaba, T , Yagyu, H , Harada, K , Osuga, J , Ohashl, K , Yazakl, Y., and Yamada, N (1996) Suppression of dret-induced atherosclerosis m low density hpoprotem receptor knockout mice overexpressmg hpoprotem hpase. Proc Nat1 Acad Scz USA 93,7242-7246 6 Lm, M.-S , Junk, F R , LeBoeuf, R.C., Henderson, H., Castellam, L. W , LUSIS, A J , Ma, Y., Forsythe, I J , Zhang, H , Kirk, E , Brunzell, J. D , and Hayden, M R (1994) Alteration of lipid profiles m plasma of transgemc mice expressing human lipoprotein lipase. J Blol Chem 269, 11,417-l 1,424
354
Semenkovich
7. Zstgmond, E., Scheffler, E., Forte, T , Potenz, R , Wu, W , and Chan, L Transgenic mice expressmg human ltpoprotetn lrpase drtven by the metallothmem promoter. A phenotype associated wtth Increased permatal tty and reduced plasma very low denstty ltpoprotem of normal stze J &of
(1994) mouse mortalChem
269, 18,757-18,766 8. Coleman, T , Setp, R L., Gamble, J M , Lee, D , Maeda, N , and Semenkovtch,
9
10
11.
12.
13.
14.
15
16.
17
18
C F (1995) COOH-terminal dtsruptlon of hpoprotem hpase m mace IS lethal m homozygotes, but heterozygotes have elevated trtglycertdes and impaired enzyme activity .I Bzo1 Chem 170, 12,5 l&12,525 Coleman, T , Setp, R L , Maeda, N , and Semenkovtch, C F (1995) Targeted macttvation of murme ltpoprotem hpase. Diabetes (Suppl 1) 44,44A Wemstock, P H., Brsgaier, C L , Aalto-Setala, K , Radner, H , Ramakrtshnan, R , Levak-Frank, S , Essenburg, A D , Zechner, R , and Breslow, J L. (1995) Severe hypertrtglycertdemta, reduced high denstty lrpoprotem, and neonatal death m hpoprotem hpase knockout mace Mtld hypertrtglycertdemta wtth Impaired very low density ltpoprotem clearance m heterozygotes J Clm Znvest 96,2555-2568 Levak-Frank, S , Radner, H , Walsh, A, Stollberger, R., Kmppmg, G , Hoefler, G , Sattler, W , Wetnstock, P H , Breslow, J L , and Zechner, R (1995) Muscle-specific overexpressron of hpoprotem hpase causesa severe myopathy characterized by prohferation of nntochondria and peroxtsomes m transgemc mace J Clzn invest 96,976-86 Sattler, W , Levak-Frank, S , Radner, H , Kostner, G. M., and Zechner, R. (1996) Muscle-specific overexpresston of ltpoprotem lrpase m transgemc mace results m increased a-tocopherol levels m skeletal muscle Brochem J 318, 15-l 9 Busch, S J , Barnhart, R L , Martm, G. A., Fitzgerald, M C , Yates, M T , Mao, S J T , Thomas, C E , and Jackson, R L (1994) Human hepattc trtglycertde ltpase expression reduces hrgh density lipoprotem and aorttc cholesterol m cholesterol-fed transgemc mice J Blol Chem 269, 16,37616,382 Homamcs, G E , de Stlva, H. V , Osada, J , Zhang, S H , Wong, H., Borensztqn, J , and Maeda, N (1995) Mild dysliprdemra m mace followmg targeted macttvanon of the hepattc ltpase gene. J Bzol Chem 270,2974-2980 Applebaum-Bowden, D , Kobayashr, J., Kashyap, V S , Brown, D R , Berard, A , Meyn, S , Parrott, C., Maeda, N., Shamburek, R , Brewer, H B , Jr , and Santamarina-FoJo, S (1996) Hepattc ltpase gene therapy m hepattc hpase-defictent mice Adenovuus-mediated replacement of a hpolytrc enzyme to the vascular endothelmm J Clan Invest 97, 799-805 Kobayasht, J , Applebaum-Bowden, D , Dug], K A, Brown, D R , Kashyap, V S., Parrott, C , Duarte, C., Maeda, N , and Santamarina-FOJO, S (1996) Analysts of protein structure-function m vivo. Adenovirus-mediated transfer of hpase ltd mutants m hepatrc ltapse-deficient mice. J &ol Chem 271, 26,296--26,301 Howles, P. N , Carter, C P , and HUI, D. Y (1996) Dietary free and estertfied cholesterol absorptton m cholesterol esterase (btle salt-sttmulated ltpase) genetargeted mace J Blol Chem 271,7196-7202 Vatsman, B L , Klein, H.-G., Rouis, M., Berard, A M., Kmdt, M R , Talley, G D., Meyn, S. M., Hoyt, R F., Jr, Marcovma, S. M., Albers, J. J., Hoeg, J M ,
Induced Lipase Mutations
355
Brewer, H B , Jr , and Santamarina-Fojo, S (1995) Overexpresston of human lecrthrn-cholesterol acyltransferase leads to hyperalphalrpoproternemra m transgenic mice J Bd Chem 270, 12,269-12,275 19 Francone, 0 L , Gong, E. L., Ng, D S , Fielding, C J., and Rubin, E M (1995) Expresston of human lecrthm-cholesterol acyltransferase m transgemc mice Effect of human apohpoprotein AI and human apohpoprotein AI1 on plasma hpoprotem cholesterol metabohsm J Clzn Invest 96, 144@-1448 20 Mehlum, A , Staels, B , Duverger, N., Tatlleux, A , Castro, G , Flevet, C , Luc, G., Fruchart, J -C , Ohvecrona, G., Skrettmg, G , Auwerx, J , and Prydz, H. (1995) Ttssue-specttic expressron of the human gene for lecrthm.cholesterol acyltransferase m transgemc mice alters blood hprds, hpoprotems and hpases toward a less atherogemc profile Eur J Blochem 230,567-575 2 1 Jrao, S , Cole, T G , Kitchens, R T , Pfleger, B , and Schonfeld, G (1990) Genetic heterogenetty of lipoprotems m inbred strains of mice* analysis by gel-permeation chromatography Metabohsm 39, 155-l 60