C o n t r i b u t o r s to Volume 164 Article numbers are in parentheses followingthe names of contributors. Affiliation...
24 downloads
1323 Views
78MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
C o n t r i b u t o r s to Volume 164 Article numbers are in parentheses followingthe names of contributors. Affiliations listed are eurr~L
STEVENAEo (10), Department of Chemistry,
Yale University, New Haven, Connecticut 06511 ANDREA BARTA(24), lnstitutfftr Biochemie, Universitdt Wien, A-1090 Vienna, Austria ANDREAS BARTETZKO (44), Max-Planck-lnstitut J~r Molekulare Genetik, Abt. Wittman, D-IO00 Berlin 33 (Dahlem), Federal Republic of Germany N. V. BELITSINA(43), A. N. Bakh Institute of Biochemistry, Academy of Sciences of the USSR, Moscow, USSR EGBERT BOEr~MA (2), Fritz-Haber-Institut der Max-Planck-Gesellschafl, D-1000 Berlin 33, Federal Republic of Germany ALEXEY A. BOODANOV (29), A. N. Belozersky Laboratory of Molecular Biology and Bioorganic Chemistry, Moscow State University, Moscow 119899, USSR ANGELA BORDEN (46), Department of Experimental Biology, Roswell Park Memorial Institute, Buffalo, New York 14263 MILOSLAV BOUBLIK (3), Roche Institute of Molecular Biology, Roche Research Center, Nutley, New Jersey 07110 RICHARD BRIMACOMBE (19), Max-PlanckInstitut fi~r Molekulare Genetik, Abt. Wittmann, D-IO00 Berlin 33 (Dahlem), Federal Republic of Germany MELISSA A. BUCK (36), NINCDS, National Institutes of Health, Bethesda, Maryland 20892 V. N. BusnuEv (9), Institute of Experimental Cardiology, Cardiology Research Center of the USSR Academy of Medical Sciences, 121552 Moscow, USSR DAVID G. CAMP (26), Department of Biochemistry and Biophysical Sciences, University of Houston, Houston, Texas 77004 PAULINE A. CANN (34), Department of BiD-
logical Chemistry, UCLA School of Medicine, University of California, Los Angeles, Los Angeles, California 90024 MALCOLM S. CAPEL (7, 37), Biology Department, Brookhaven National Laboratory, Upton, New York 11973 Lx-MINa CHANGCHIEN(16, 17), Wadsworth Center for Labs and Research, New York State Department of Health, Empire State Plaza, Albany, New York 12201 C. CmARUTTrNI (20), Institut de Biologie Physico-Chimique, Laboratoire de Chimie Cellulaire, 75005 Paris, France NINA V. CmCHKOVA(29), A. N. Belozersky Laboratory of Molecular Biology and Bioorganic Chemistry, Moscow State University, Moscow 119899, USSR JAN CHRISTIANSEN(30, 49), Department of Clinical Chemistry, Bispebjerg Hospital, DK-2400 Copenhagen NF,, Denmark ROBERT CONRAD (16), Department of Biology, Indiana University, Bloomington, Indiana 47405 BARRY S. COOPERMAN(23, 36), Department of Chemistry, University of Pennsylvania, Philadelphia, Pennsylvania 19104 GARY R. CRAVENI (16, 17, 37), Laboratory of Molecular Biology and Department of Genetics, University of Wisconsin, Madison, Wisconsin 53706 ALBERT E. DAHLBERG(47), Section of BiDchemistry, Division of Biology and Medicine, Brown University, Providence, Rhode Island 02912 DIPAK B. DATTA (17, 37), Department of Botany, University of Wisconsin, Madison, Wisconsin 53706 INGRID C. DECKMAN(13), Smith, Kline & 'Deceased.
xiii
xiv
CONTRIBUTORS TO VOLUME 164
French Research Laboratories, Molecular Genetics Research and Development, King of Prussia, Pennsylvania 19406 H.-Y. DENG (11), Clayton Foundation Biochemical Institute, Chemistry Department, University of Texas, Austin, Texas 78712 ROBERT DENMAN (25), Institute for Basic Research in Developmental Disabilities, Staten Island, New York 10314 DAVID E. DRAPER (13, 14), Department of Chemistry, Johns Hopkins University, Baltimore, Maryland 21218 JAN EGEBJERG (49), Biostructural Chemistry, Kemisk Institut, Aarhus Universitet, 8000 Aarhus C, Denmark MANs EHRENBERG(42), Department of Molecular Biology, University of Uppsala, S- 751 24 Uppsala, Sweden MOHAMED ETTAYEm (46), Department of Experimental Biology, Roswell Park Memorial Institute, Buffalo, New York, 14263 A. EXPERT-BEzANtTON(20), Institut Jacques Monod-C.N.R.S., Laboratoire de Photobiologie Moleculaire, 75251 Paris Cedex 05, France ANTONIO FOCELLA (25), Department of Chemistry, Hoffmann-LaRoche Inc., Nutley, New Jersey 07110 JOACmM FRANK (1), Wadsworth Center for Laboratories and Research, New York State Department of Health, and School of Public Health, State University of New York at Albany, Albany, New York 12201 BETTY FREEBORN (10), Department of Chemistry, Yale University, New Haven, Connecticut 06511 ROVER GARRETT (30, 49), Department of Biostructural Chemistry, Kemisk Institut, Aarhus Universitet, 8000 Aarhus C, Denmark UTE GEIGENMOLLER (45), Max*Planck-Institut far Molekulare Genetik, Abt. Wittman, D-1000 Berlin 33 (Dahlem), Federal Republic of Germany DANIEL T. GEWIRTH (10), Department of Molecular Biophysics and Biochemistry,
Yale University, New Haven, Connecticut 06511 DOHN G. GLITZ (34), Department of Biological Chemistry and Molecular Biology Institute, UCLA School of Medicine, University of California, Los Angeles, Los Angeles, California 90024 LARRY GOLD (27), Department of Molecular, Cellular and Developmental Biology, University of Colorado, Boulder, Colorado 80309 H. U. GORINGER (50), Max-Planck-Institut far Molekulare Genetik, Abt. Wittmann, D-IO00 Berlin 33 (Dahlem), Federal Republic of Germany A. T. G u D t o v (9), Institute of Protein Research, Academy of Sciences of the USSR, 142292 Pushchino, Moscow Region, USSR JAMES F. HAINFELD (3), Biology Department, Brookhaven National Laboratory, Upton, New York 11973 GEOROE HARAUZ(2), Department of Molecular Biology and Genetics, University of Guelph, Guelph, Ontario, N1G 21 W Canada BOYD HARDESTY(11), Clayton Foundation Biochemical Institute, Chemistry Department, University of Texas, Austin, Texas 78712 DIETER HARTZ (27), Department of Molecular, Cellular and Developmental Biology, University of Colorado, Boulder, Colorado 80309 JOHN E. HEARST(22), Department of Chemistry, University of California, Berkeley, Berkeley, California 94720 HANS A. HEUS (12), Department of Biochemistry, Leiden University, 2333 AL Leiden, The Netherlands WALTER E. HILL (26), Department of Chemistry, University of Montana, Missoula, Montana 59812 PAUL W. HUBER (31), Department of Chemistry, University of Notre Dame, Notre Dame, Indiana 46556 DAVID K. JEMIOLO (47), Biology Depart-
CONTRIBUTORS TO VOLUME 164
ment, Vassar College, Poughkeepsie, New York 12601 ROZA MARIA KAMP (38), Max-Planck-Institut far Molekulare Genetik, Abt. Wittman, D-IO00 Berlin 33 (Dahlem), Federal Republic of Germany JOANNE M. KEAN (14), Division of Biophysics, School of Hygeine and Public Health, Johns Hopkins University, Baltimore, Maryland 21218 ALEXEYM. KOPYLOV(29), A. N. Belozersky Laboratory of Molecular Biology and Bioorganic Chemistry, Moscow State University, Moscow 119899, USSR JOACHIM KRIEG (39), Freidrich MiescherInstitut, CH-4002 Basel, Switzerland ERNST KUECHLER (24), lnstitut far Biochemie, Universitdt Wien, A-1090 Vienna, Austria C. G. KURLAND(42), Department of Molecular Biology, University of Uppsala, S-751 24 Uppsala, Sweden APOSTOLOS KYRIATSOULIS(19), I Medizinische Klinik der Johannes, Gutenberg Universitdit, D-6500 Mainz, Federal Republic of Germany LANCE G. LAING(15), Department of Chemistry, Johns Hopkins University, Baltimore, Maryland 21218 LINDA S. LASATER(34), Department of Biological Chemistry, UCLA School of Medicine, University of California, Los Angeles, California 90024 NEOCLES B. LEONTIS (10), Chemistry Department, Bowling Green State University, Bowling Green, Ohio 43403 ARNOLD LIEBMAN (25), Department of Chemistry, Hoffmann-LaRoche Inc., Nutley, New Jersey07110 ROLF LIETZKE(18), Max-Planck-Institutfar Molekulare Genetik, Abt. Wittmann, D-IO00 Berlin 33 (Dahlem), Federal Republic of Germany ROLAND LILL (41), Department of Biological Chemistry, School of Medicine, University of California, Los Angeles, Los Angeles, California 90024
XV
SAMUEL E. LIPSON (22), CODON, South
San Francisco, California 94080 DAVID MALAREK (25), Department
of Chemistry, Hoffmann-LaRoche Inc., Nutley, New Jersey 07110 PETER MALY (19), Biochemisches Institut der Universitdt Zftrich, CH-8057 Zarich, Switzerland VALSAN MANDIYAN (3), Roche Institute of Molecular Biology, Roche Research Center, Nutley, New Jersey 07I 10 ALEXANDER S. MANKIN (29), A. N. Belozersky Laboratory of Molecular Biology and Bioorganic Chemistry, Moscow State University, Moscow 119899, USSR DAVID S. MCPHEETERS(27), Division of Biology, California Institute of Technology, Pasadena, California 91125 DANESH MOAZED (33), Thimann Laboratories, University of California, Santa Cruz, Santa Cruz, California 95064 PETER B. MOORE (10), Department of Chemistry, Yale University, New Haven, Connecticut 06511 EDWARD A. MORGAN (46), Department of Experimental Biology, Roswell Park Memorial Institute, Buffalo, New York 14263 KNUD H. NIERHAUS (8, 18, 44, 45), Max-
Planck-Institut ff~r Molekulare Genetik, Abt. Wittmann, D-IO00 Berlin 33 (Dahlem), Federal Republic of Germany CONCEPCION R. NIER~S (37), Laboratory of Molecular Biology, University of Wisconsin, Madison, Wisconsin 53706 KAYOKO NISHI (48), Department of Biological Chemistry, School of Medicine, University of California, Davis, Davis, California 95616 HARRY F. NOLLER (32, 33), Board of Studies in Biology, University of California, Santa Cruz, Santa Cruz, California 95064 PETRA NOWOTNY (8), Max-Planck-Institut )~r Molekulare Genetick, Abt. Wittmann, D-IO00 Berlin 33 (Dahlem), Federal Republic of Germany VOLKER NOWOTNY (8), Max-Planck-Institut far Molekulare Genetik, Abt. Witt-
xvi
CONTRIBUTORS TO VOLUME 164
Planck-Institut J~r Molekulare Genetik, mann, D-IO00 Berlin 33 (Dahlem), FedAbt. Wittmann, D-IO00 Berlin 33 (Daheral Republic of Germany lem), Federal Republic of Germany KELVIN NORSE (25), Department of BioJAMES M. ROBERTSON(40), Thimann Labochemistry, Roche Institute of Molecular ratories, University of California, Santa Biology, Roche Research Center, Nutley, Cruz, Santa Cruz, California 95064 New Jersey 07110 JOACHIM SCrINIER (48), Department of BioO. W. ODOM (11), Clayton Foundation Biological Chemistry, School of Medicine, chemical Institute, Chemistry Department, University of California, Davis, Davis, University of Texas, Austin, Texas 78712 California 95616 JAMES OFENOAND(25), Department of BioIVAN N. SHATSKY(5), A. N. Belozersky Labchemistry, Roche Institute of Molecular oratory of Molecular Biology and BioorBiology, Roche Research Center, Nutley, ganic Chemistry, Moscow State UniverNew Jersey 07110 sity, 117234 Moscow, USSR YASUNARI OGIHARA(51), Kihara Institute, CURT D. SIOMUND(46), Department of ExYokohama City University, Yokohama perimental Biology, Roswell Park Memo232, Japan rial Institute, Buffalo, New York 14263 ANDR~E R. OLIVIER (39), Friedrich EVOENY A. SKRIPraN (29), A. N. Belozersky Miescher-Institut, CH-4002 Basel, SwitLaboratory of Molecular Biology and zerland Bioorganic Chemistry, Moscow State UniGARY J. OLSEN (53), Department of Microversity, Moscow 119899, USSR biology, University of Illinois, Urbana, IlliA. S. SPIRIN (28, 43), Institute of Protein nois 61801 Research, Academy of Sciences of the HELEN McKuSFdE OLSON (34), Department USSR, 142292 Pushchino, Moscow Reof Biological Chemistry, UCLA School of gion, USSR Medicine, University of California, Los MICHAEL J. R. STARK (47), Leicester BioAngeles, Los Angeles, California 90024 centre, University of Leicester, Leicester, GERRIT T. OOSTERGETEL(3), Roche InstiEngland tute of Molecular Biology, Roche Research ROLE STEEN (47), Department of Molecular Center, Nutley, New Jersey 07110 Biology, Biomedicum, University of UppHARALD PAULSEN (40), Botanisches Instisala, S-751 24 Uppsala, Sweden tut, Universit~t Mf2nchen, D-8000 Mfmchen 19, Federal Republic of Germany GONTER STEINER (24), Allg. Krankenhaus, II. Med. Universitdtsklinik, A-1090 ANASTASIA PROMBONA (51), Max-PlanckVienna, Austria Institut far Molekulare Genetik, Abt. Wittmann, D-1000 Berlin 33 (Dahlem), Fed- SETH STERN (33), Thimann Laboratories, eral Republic of Germany University of California, Santa Cruz, Santa Cruz, California 95064 MICHAEL RADERMACHER (1), Wadsworth Center for Laboratories and Research, WOLFGANG STIEGE (19), Max-Planck-InstiNew York State Department of Health, Altut f~r Molekulare Genetik, Abt. Wittmann, D-IO00 Berlin 33 (Dahlem), Fedbany, New York, 12201 eral Republic of Germany V. RAMAKRISHNAN (7), Biology Department, Brookhaven National Laboratory, GEORG STOFFLER(4, 35), InstitutfarMikroUpton, New York 11973 biologie der Medizinische Fakultd~t, Universiti~t Innsbruck, A-6020 Innsbruck, BERNHARD REDL (4), Institut far MikrobioAustria logie der Medizinische Fakult,~t, Universitdt Innsbruck, A-6020 Innsbruck, Austria MARINA STOFFLER-MEILICKE(4, 35), MaxPlanck-Institut ~ r Molekulare Genetik, HANS-JORG RHEINBERGER (45), Max-
CONTRIBUTORS TO VOLUME 164
Abt. Wittmann, D-IO00 Berlin 33 (Dahlem), Federal Republic of Germany ALAP R. SUBRAMANIAN(51), Max-PlanckInstitut fi~r Molekulare Genetik, Abt. Wittmann, D-IO00 Berlin 33 (Dahlem), Federal Republic of Germany GRACE SUN (10), Department of Chemistry, Yale University, New Haven, Connecticut 06511 WILLIAM E. TAPPRICH (26), Division of Biology and Medicine, Brown University, Providence, Rhode Island 02912 ANCHALEE TASSANAKAJOHN(26), Department of Chemistry, Ramkamhangu University, Bangna, Bangkok 10260, Thailand GEORGE THOMAS (39), Friedrich MiescherInstitut, CH-4002 Basel, Switzerland ROBERT TRAUT (27), Department of Biological Chemistry, School of Medicine, University of California, Davis, Davis, California 95616 MARIN VAN HEEL (2), Fritz-Haber-lnstitut der Max-Planck-Gesellschafi, D-IO00 Berlin 33, Federal Republic of Germany PETER H. VAN KNIPPENBERG (12), Department of Biochemistry, Leiden University, 2333 AL Leiden, The Netherlands BARBARA J. VAN STOLK (32), Thimann Laboratories, University of California, Santa Cruz, Santa Cruz, California 95064 JAILAXMI V. VARTIKAR(13), Department of Chemistry, Johns Hopkins University, Baltimore, Maryland 21218 VICTOR D. VASILIEV(5), Institute of Protein Research, Academy of Sciences of the USSR, 142292 Pushchino, Moscow Region, USSR ADRIANA VERSCHOOR (1), Wadsworth Center for Laboratories and Research, New York State Department of Health, Albany, New York 12201 BIRTE VESTER (49), Biostructural Chemistry, Kemisk Institut, Aarhus Universitet, 8000 Aarhus C, Denmark HELGA VOSS (8), Max-Planck-lnstitut fi2r Molekulare Genetik, Abt. Wittmann,
xvii
D-IO00 Berlin 33 (Dahlem), Federal Republic of Germany TERENCE WAGENKNECHT (1), Wadsworth Center for Laboratories and Research, New York State Department of Health, Albany, New York 12201 R. WAGNER (50), Institut fflr Physikalische Biologie, Universitlit Dftsseldo~ D-4000 D~sseldorf 1, Federal Republic of Germany JOSEPH S. WALL (3), Biology Department, Brookhaven National Laboratory, Upton, New York 11973 JAN WALLECZEK (4), Max-Planck-lnstitut fiir Molekulare Genetik, Abt. Wittmann, D-IO00 Berlin 33 (Dahlem), Federal Republic of Germany MICHAEL S. WATERMAN(52), Departments of Mathematics and Molecular Biology, University of Southern California, Los Angeles, California 90089 MARKUS WEDDE (45), Max-Planck-lnstitut J'fir Molekulare Genetik, Abt. Wittmann, D-IO00 Berlin 33 (Dahlem), Federal Republic of Germany CARL J. WEITZMANN(36), Roche Institute of Molecular Biology, Nutley, New Jersey 07110 SUSANA. WHITE (14), Department of Chemistry, Yale University, New Haven, Connecticut 06511 ERIC WICKSTROM (15), Department of Chemistry, University of South Florida, Tampa, Florida 33620 WOLFGANG WINTERMEYER(40, 41), Instirut fftr Physiologische Chemie, Universitdt Witten/Herdecke, D-5810 Witten, Federal Republic of Germany H. G. WITTMANN(6), Max-Planck-lnstitut fi~r Molekulare Genetik, Abt. Wittmann, D-1000 Berlin (Dahlem), Federal Republic of Germany BRIGITTE WITTMANN-LIEBOLD(38), Max-
Planck-Institut f~r Molekulare Genetik, Abt. Wittmann, D-IO00 Berlin 33 (Dahlem), Federal Republic of Germany PAUL L. WOLLENZIEN(2 l), E. A. Doisy De-
XVlll
CONTRIBUTORS TO VOLUME 1 6 4
partment of Biochemistry, St. Louis University Medical School, St. Louis, Missouri 63104 IRA G. WOOL (31), Department of Biochemistry and Molecular Biology, The University of Chicago, Chicago, Illinois 60637 A. YONATH (6), Max-Planck-Unitfor Structural Molecular Biology, D-2000 Hamburg 52, Federal Republic of Germany, and Wiezmann Institute of Science, Rehovot, Israel
M. M. YusuPov (28), Institute of Protein
Research, Academy of Sciences of the USSR, 142292 Pushchino, Moscow Region, USSR G. Z. YUSUPOVA(TNALINA)(43), Institute of Protein Research, Academy of Sciences of the USSR, 142292 Pushchino, Moscow Region, USSR GLADYS ZENCHOFF (25), Department of Chemistry, Hoffmann-LaRoche Inc., Nutley, New Jersey 07110
Preface The overwhelming structural complexity of ribosomes continues to present a great technical challenge to those who study these interesting ribonucleoprotein particles. Ribosomologists have responded over the years by inventing a wide range of novel biochemical, physicochemical, and genetic approaches, many of which have found widespread application outside the ribosome field. The most recent period of research in this area is no exception as is reflected in the contents of this volume. Among the notable advances that we have seen during this time are a vastly sharpened understanding of the structure of ribosomal RNA and how it may participate in the translation process, major accomplishments in the area of ribosome structure, and the emergence of the ribosome as an evolutionary chronometer. This volume supplements some of the recent ones in this series dealing with various aspects of protein synthesis (XXX, LIX, LX, and 101). Much of the methodology relating to the function of ribosomes in translation, the preparation and characterization of ribosomes and their constituent parts, their interaction with other translational components (protein factors, aminoacyl-tRNAs, mRNAs, nucleotides, etc.), and the properties of cellfree translating systems is to be found in these volumes. Also presented are a number of methods used for the characterization of the changes that occur in ribosomes when they react with other components in the translational system. In this rapidly moving area of research, many procedures are continually being modified and improved, and new methodologies are being developed which allow for more incisive analyses and elaboration of more detailed, reliable information regarding the structure of the particle, its component proteins and ribonucleic acids, and its diverse functional states. This volume includes a variety of methods involving electron microscopy and other biophysical techniques, such as crystallography, neutron scattering, and NMR, procedures for the analysis of protein-RN A or RNARNA interactions by cross-linking, the use of chemical, enzymatic, and immunological probes, as well as functional, kinetic, and genetic approaches for the study of this ribonucleoprotein. These methodologies will contribute to the continued progress toward the elucidation of the structure, function, and regulatory processes that affect this most important complex cellular component, the ribosome. HARRY F. NOLLER, JR. KIVIE MOLDAVE xix
METHODS IN ENZYMOLOGY EDITORS-IN-CHIEF
Sidney P. Colowick and Nathan 0. Kaplan
VOLUMEVIII. Complex Carbohydrates Edited by ELIZABETH F. NEUFELD AND VICTOR GINSBURG VOLUME
IX. CarbohydrateMetabolism
Edited by WILLIS A. WOOD VOLUME
X. Oxidation and Phosphorylation
Edited by RONALD W. ESTABROOK AND MAYNARD E. PULLMAN VOLUME
XI. Enzyme Structure
Edited by C. H. W. HIRS VOLUME
XII. Nucleic Acids (PartsA and B)
Edited by LAWRENCE GROSSMAN AND KIVIE MOLDAVE VOLUME
XIII. Citric Acid Cycle
Edited by J. M. LOWENSTEIN VOLUME
XIV. Lipids
Edited by J. M. LQWENSTEIN VOLUME
XV. Steroidsand Terpenoids
Edited by RAYMOND B. CLAYTON VOLUME
XVI. Fast Reactions
Edited by KENNETH KUSTIN VOLUME
XVII. Metabolism of Amino Acids and Amines (PartsA and B)
Edited by HERBERT TABOR AND CELIA WHITE TABOR .. xx111
xxiv
METHODS INENZYMOLOGY
VOLUME XVIII. Vitamins and Coenzymes(PartsA, B, and C) Edited MCDONALD B. MCCORMICKANDLEMUEL D. WRIGHT VOLUME XIX. Proteolytic Enzymes Edited ~~GERTRUDE E. PERLMANNANDLASZLOLORAND VOLUME XX. Nucleic Acids and Protein Synthesis(Part C) Editedby KIVIEMOLDAVEANDLAWRENCEGROSSMAN VOLUME XXI. Nucleic Acids (Part D) Editedby LAWRENCEGROSSMANANDKIVIEMOLDAVE VOLUME XXII. Enzyme Purification and RelatedTechniques Editedby WILLIAM B. JAKOBY VOLUME XXIII. Photosynthesis(Part A) Editedby ANTHONYSANPIETRO VOLUME XXIV. Photosynthesisand Nitrogen Fixation (Part B) Editedby ANTHONY SANPIETRO VOLUME XXV. Enzyme Structure(Part B) EditedbyC. H.W. HIRSANDSERGEN.TIMASHEFF VOLUME XXVI. Enzyme Structure(Part C) EditedbyC. H. W. HIRSANDSERGEN.TIMASHEFF VOLUME XXVII. Enzyme Structure(Part D) Editedby C. H. W. HIRSANDSERGEN.TIMASHEFF VOLUME XXVIII. Complex Carbohydrates(Part B) Editedby VICTORGINSBURG VOLUME XXIX. Nucleic Acids and Protein Synthesis(Part E) Editedby LAWRENCEGROSSMANANDKIVIEMOLDAVE VOLUME XXX. Nucleic Acids and Protein Synthesis(Part F) Editedby KIVIEMOLDAVEANDLAWRENCEGROSSMAN VOLUME XXXI. Biomembranes(Part A) Editedby SIDNEYFLEISCHERANDLESTERPACKER
METHODSINENZYMOLOGY
xxv
VOLUME XxX11. Biomembranes(Part B) Edited ~~SIDNEYFLEISCHERANDLESTERPACKER VOLUME XxX111. Cumulative SubjectIndex Volumes I- XXX Edited ~~MARTHAG.DENNISANDEDWARD A. DENNIS VOLUME XXXIV. Affinity Techniques(Enzyme Purification: Part B) Editedby WILLIAM B. JAKOBY AND MEIRWILCHEK VOLUME XXXV. Lipids (Part B) Editedby JOHN M. LOWENSTEIN VOLUME XXXVI. Hormone Action (Part A: SteroidHormones) Editedby BERT W. O'MALLEYANDJOELG.HARDMAN VOLUME XXXVII. Hormone Action (Part B: PeptideHormones) Editedby BERT W. O'MALLEYANDJOELG.HARDMAN VOLUME XXXVIII. Hormone Action (Part C: Cyclic Nucleotides) Editedby JOELG.HARDMANANDBERT W. O'MALLEY VOLUME XxX1X. Hormone Action (Part D: IsolatedCells, Tissues,and
OrganSystems) Editedby
JOELG.HARDMANANDBERT
W. O'MALLEY
VOLUME XL. Hormone Action (Part E: Nuclear Structureand Function) Editedby BERT W. O'MALLEYANDJOELG.HARDMAN VOLUME XLI. CarbohydrateMetabolism (Part B) Edited by W. A. WOOD VOLUME XLII. CarbohydrateMetabolism (Part C) Edited by W. A. WOOD VOLUME XLIII. Antibiotics Edited by JOHN H. HASH VOLUME XLIV. Immobilized Enzymes Editedby KLAUSMOSBACH VOLUME XLV. Proteolytic Enzymes(Part B) Editedby LASZLO LORAND
xxvi
METHODSINENZYMOLOGY
VOLUME XLVI. Affinity Labeling Edited ~~WILLIAM B. JAKOBY AND MEIR WILCHEK VOLUME XLVII. Enzyme Structure(Part E) EditedbyC. H.W. HIRSANDSERGEN.TIMASHEFF VOLUME XLVIII. Enzyme Structure(Part F) EditedbyC. H. W. HIRSANDSERGEN.TIMASHEFF VOLUME XLIX. Enzyme Structure(Part G) EditedbyC. H.W. HIRSANDSERGEN.TIMASHEFF VOLUME L. Complex Carbohydrates(Part C) Editedby VICTORGINSBURG VOLUME LI. Purine and Pyrimidine NucleotideMetabolism Editedby PATRICIA A. HOFFEEANDMARYELLENJONES VOLUME LII. Biomembranes(Part C: Biological Oxidations) Editedby SIDNEYFLEISCHERANDLESTERPACKER VOLUME LIII. Biomembranes(Part D: Biological Oxidations) Editedby SIDNEYFLEISCHERANDLESTERPACKER VOLUME LIV. Biomembranes(Part E: Biological Oxidations) Editedby SIDNEYFLEISCHERANDLESTERPACKER VOLUME LV. Biomembranes(Part F: Bioenergetics) Editedby SIDNEYFLEISCHERANDLESTERPACKER VOLUME LVI. Biomembranes(Part G: Bioenergetics) Editedby SIDNEYFLEISCHERAND LESTER PACKER VOLUME LVII. Bioluminescenceand Chemiluminescence Editedby MARLENE A. DELUCA VOLUME LVIII. Cell Culture Editedby WILLIAM B. JAKOBYANDIRAPASTAN VOLUME LIX. Nucleic Acids and Protein Synthesis(Part Editedby KIVIEMOLDAVEANDLAWRENCEGROSSMAN
G)
xxvii
METHODSINENZYMOLOGY VOLUME LX. Nucleic Acids and Protein Synthesis(Part H) Editedby KIVIEMOLDAVEANDLAWRENCEGROSSMAN VOLUME 6 1. Enzyme Structure(Part H) EditedbyC. H. W. HIRSANDSERGEN.TIMASHEFF VOLUME 62. Vitamins and Coenzymes(Part D) Editedby DONALD B. MCCORMICKANDLEMUEL
D. WRIGHT
VOLUME 63. Enzyme Kinetics and Mechanism (Part A: Initial Rate and
Inhibitor Methods) DANIEL L. PURICH
Editedby
VOLUME 64. Enzyme Kinetics and Mechanism (Part B: Isotopic Probes
and Complex Enzyme Systems) DANIEL L. PIJRICH
Editedby
VOLUME 65. Nucleic Acids (Part I) Editedby LAWRENCEGROSSMANANDKIVIEMOLDAVE VOLUME 66. Vitamins and &enzymes (Part E) Editedby DONALD B. MCCORMICKANDLEMUEL
D. WRIGHT
VOLUME 67. Vitamins and Coenzymes(Part F) Editedby DONALD B. MCCORMICKANDLEMUEL
D. WRIGHT
VOLUME 68. RecombinantDNA Edited by RAY Wu VOLUME 69. Photosynthesisand Nitrogen Fixation (Part C) Editedby ANTHONYSANPIETRO VOLUME 70. Immunochemical Techniques(Part A) Editedby HELENVANVUNAKISANDJOHN J. LANGONE VOLUME 7 1. Lipids (Part C) Editedby JOHN M. LOWENSTEIN VOLUME 72. Lipids (Part D) Editedby JOHN M. LOWENSTEIN
...
xxvlll
METHODSINENZYMOLOGY
VOLUME 73. Immunochemical Techniques(Part B) Editedby JOHN J. LANGONEANDHELENVANVUNAKIS VOLUME 74. Immunochemical Techniques(Part C) Editedby JOHN J. LANGONEANDHELENVANVUNAKIS
75. Cumulative Subject Index Volumes XxX1, XxX11,
VOLUME
XXXIV-LX Editedby
EDWARDA.DENNISANDMARTHAG.DENNIS
VOLUME 76. Hemoglobins Edited by ERALDO ANTONINI, CHIANCONE
LUIGI ROSSI-BERNARDI, AND EMILIA
VOLUME 77. Detoxication and Drug Metabolism Editedby WILLIAM B. JAKOBY VOLUME 78. Interferons(Part A) Editedby SIDNEYPESTKA VOLUME 79. Interferons(Part B) Editedby SIDNEYPESTKA VOLUME 80. Proteolytic Enzymes(Part C) Editedby LASZLO LORAND VOLUME 81. Biomembranes(Part H: Visual Pigmentsand Purple Mem-
branes,I) Editedby
LESTERPACKER
VOLUME 82. Structural and Contractile Proteins (Part A: Extracellular Matrix) Editedby LEON W. CUNNINGHAMANDDIXIE W. FREDERIK~EN VOLUME 83. Complex Carbohydrates(Part D) Editedby VICTORGINSBURG VOLUME 84. ImmunochemicaI Techniques (Part D: Selected Immunoassays) Editedby JOHN J. LANGONEANDHELENVANVUNAKIS
METHODSINENZYMOLOGY
xxix
VOLUME 85. Structural and Contractile Proteins(Part B: The Contractile
Apparatusand the Cytoskeleton) Editedby DIXIE W. FREDERIKSEN ANDLEON W. CUNNINGHAM VOLUME 86. Prostaglandinsand ArachidonateMetabolites Editedby WILLIAM E.M. LANDS AND WILLIAM L. SMITH VOLUME 87. Enzyme Kinetics and Mechanism (Part C: Intermediates,
Stereochemistry,and Rate Studies) DANIEL L. PURICH
Editedby
VOLUME 88. Biomembranes(Part I: Visual Pigments and Purple Mem-
branes,II) Editedby
LESTERPACKER
VOLUME 89. CarbohydrateMetabolism (Part D) Editedby WILLIS A. WOOD VOLUME 90. CarbohydrateMetabolism (Part E) Editedby WILLIS A. WOOD VOLUME 9 1. Enzyme Structure(Part I) EditedbyC. H.W. HIRS ANDSERGEN.TIMASHEFF VOLUME 92. Immunochemical Techniques(Part E: Monoclonal Antibod-
ies and GeneralImmunoassayMethods) JOHN J. LANGONEANDHELENVANVUNAKIS
Editedby
VOLUME 93. Immunochemical Techniques(Part F: Conventional Anti-
bodies,Fc Receptors,and Cytotoxicity) JOHN J. LANGONEANDHELENVANVUNAKIS
Editedby
VOLUME 94. Polyamines Editedby HERBERTTABORANDCELIAWHITETABOR VOLUME 95. Cumulative SubjectIndex Volumes 6 1- 74,76 - 80 Editedby EDWARD A. DENNISANDMARTHAG.DENNIS VOLUME 96. Biomembranes[Part J: MembraneBiogenesis:Assemblyand
Targeting(GeneralMethods; Eukaryotes)] Editedby
SIDNEYFLEISCHERANDBECCAFLEISCHER
xxx
METHODSINENZYMOLOGY
VOLUME 97. Biomembranes [Part K: Membrane Biogenesis:Assembly
and Targeting(Prokaryotes,Mitochondria, and Chloroplasts)] Editedby
SIDNEYFLEISCHERANDBECCAFLEISCHER
VOLUME 98. Biomembranes(Part L: Membrane Biogenesis:Processing
and Recycling) Editedby
SIDNEYFLEISCHERAND
BECCA FLEISCHER
VOLUME 99. Hormone Action (Part F: Protein Kinases) Editedby JACKIE D. CORBINANDJOELG.HARDMAN VOLUME 100.Recombinant DNA (Part B) Editedby RAY WV, LAWRENCEGROSSMAN,ANDKIVIEMOLDAVE VOLUME 101.RecombinantDNA (Part C) Editedby RAY WV, LAWRENCEGROSSMAN,ANDKIVIEMOLDAVE
102. Hormone Action (Part G: Calmodulin and CalciumBinding Proteins) Editedby ANTHONY R. MEANSANDBERT W. O'MALLEY
VOLUME
VOLUME 103.Hormone Action (Part H: NeuroendocrinePeptides) Editedby P. MICHAELCONN VOLUME 104.Enzyme Purification and RelatedTechniques(Part C) Editedby WILLIAM B. JAKOBY VOLUME 105.OxygenRadicalsin Biological Systems Editedby LESTERPACKER VOLUME 106.PosttranslationalModifications (Part A) Editedby FINN WOLD AND KIVIE MOLDAVE VOLUME 107.Posttranslational Modifications(PartB) Editedby FINN WOLDAND KIVIEMOLDAVE VOLUME 108. Immunochemical Techniques (Part G: Separation and
Characterizationof Lymphoid Cells) Editedby GIOVANNIDISABATO,JOHNJ.LANGONE,AND HELENVANVUNAKIS VOLUME 109.Hormone Action (Part I: PeptideHormones) Editedby LUTZBIRNBAUMERANDBERT W. O'MALLEY
METHODSINENZYMOLOGY
xxxi
VOLUME 110.Steroidsand Isoprenoids(Part A) Edited UPJOHN H. LAWANDHANSC.RILLING VOLUME 111.Steroidsand Isoprenoids(Part B) Edited ~~JOHNH.LAWANDHANSC.RILLING VOLUME 112.Drug and Enzyme Targeting(Part A) Edited ~~KENNETH J. WIDDERANDRALPHGREEN VOLUME 113. Glutamate, Glutamine, Glutathione, and Related Com-
pounds Editedby
ALTON MEISTER
VOLUME 114.Diffraction Methodsfor Biological Macromolecules(Part A) Edited by HAROLD W. WYCKOFF, C. H. W. HIRS, AND SERGE N. TIMASHEFF VOLUME 115.Diffraction Methodsfor BiologicalMacromolecules(Part B) Edited by HAROLD W. WYCKOFF, C. H. W. HIRS, AND SERGE N. TIMASHEFF VOLUME 116.Immunochemical Techniques(Part H: Effectersand Media-
tors of Lymphoid Cell Functions) Editedby GIOVANNI DI SABATO,JOHN J. LANGONE, AND HELEN VAN VUNAKIS VOLUME 117.Enzyme Structure(Part J) EditedbyC. H. W. HIRSANDSERGEN.TIMASHEFF VOLUME 118.Plant Molecular Biology Editedby ARTHUR~EISSBACH AND HERBERT WEISSBACH VOLUME 119.Interferons(Part C) Editedby SIDNEYPESTKA VOLUME 120.Cumulative SubjectIndex Volumes 8 1- 94,96 - 101 VOLUME 121. Immunochemical Techniques(Part I: Hybridoma Technol-
ogy and Monoclonal Antibodies) JOHN J. LANGONEANDHELENVANVUNAKIS
Editedby
VOLUME 122.Vitamins and &enzymes (Part G) Editedby FRANKCHYTILANDDONALD B. MCCORMICK
xxxii
METHODSINENZYMOLOGY
VOLUME 123.Vitamins and &enzymes (Part H) Editedby FRANKCHYTILANDDONALD B. MCCORMICK VOLUME 124.Hormone Action (Part J: NeuroendocrinePeptides) Editedby P. MICHAELCONN VOLUME 125.Biomembranes(Part M: Transport in Bacteria,Mitochon-
dria, and Chloroplasts:GeneralApproachesand Transport Systems) Editedby
SIDNEY FLEISCHER AND BECCAFLEISCHER
VOLUME 126. Biomembranes(Part N: Transport in Bacteria,Mitochon-
dria, and Chloroplasts:Protonmotive Force) Editedby
SIDNEYFLEISCHERAND
BECCAFLEISCHER
VOLUME 127.Biomembranes(Part 0: Protons and Water: Structureand Translocation) Editedby
LESTERPACKER
VOLUME 128. Plasma Lipoproteins (Part A: Preparation,Structure, and Molecular Biology) Editedby JERE P. SEGRESTANDJOHN J. ALBERS VOLUME 129.PlasmaLipoproteins(Part B: Characterization,Cell Biology,
and Metabolism) JOHN J. ALBERSANDJERE P. SEGREST
Editedby
VOLUME 130.Enzyme Structure(Part K) EditedbyC. H. W.HIRSAND SERGEN.TIMASHEFF VOLUME 131.Enzyme Structure(Part L) EditedbyC. H. W. HIRSAND SERGEN.TIMASHEFF VOLUME 132. Immunochemical Techniques (Part J: Phagocytosisand
Cell-MediatedCytotoxicity) Editedby
GIOVANNIDISABATOANDJOHANNESEVERSE
VOLUME 133.Bioluminescenceand Chemiluminescence(Part B) Editedby MARLENEDELUCAANDWILLIAM D. MCELROY VOLUME 134.Structuraland Contractile Proteins(Part C: The Contractile
Apparatusand the Cytoskeleton) RICHARD B. VALLEE
Editedby
METHODSINENZYMOLOGY
... xxxm
VOLUME 135.Immobilized Enzymesand Cells(Part B) Editedby KLAUS MOSBACH VOLUME 136.Immobilized Enzymesand Cells (Part C) Editedby KLAUS MOSBACH VOLUME 137.Immobilized Enzymesand Cells (Part D) Editedby KLAUSMOSBACH VOLUME 138.Complex Carbohydrates(Part E) Editedby VICTORGINSBURG VOLUME 139. Cellular Regulators(Part A: Calcium- and Calmodulin-
Binding Proteins) Editedby
ANTHONY R. MEANSAND P. MICHAELCONN
VOLUME 140.Cumulative SubjectIndex Volumes 102- 119, 121- 134 VOLUME 141.Cellular Regulators(Part B: Calcium and Lipids) Editedby P. MICHAELCONNANDANTHONY R. MEANS VOLUME 142.Metabolism of Aromatic Amino Acids and Amines Editedby SEYMOURKAUFMAN VOLUME 143.Sulfur and Sulfur Amino Acids Editedby WILLIAM B. JAKOBYAND OWENGRIFFITH VOLUME 144. Structural and Contractile Proteins (Part D: Extracellular
Matrix) Editedby
LEON W. CUNNINGHAM
VOLUME 145. Structural and Contractile Proteins (Part E: Extracellular
Matrix) Editedby
LEON W. CUNNINGHAM
VOLUME 146.PeptideGrowth Factors(Part A) Editedby DAVID BARNES AND DAVID A. SIRBASKU VOLUME 147.PeptideGrowth Factors(Part B) Editedby DAVIDBARNESANDDAVID A. SIRBASKU VOLUME 148.Plant Cell Membranes Editedby LESTERPACKERANDROLANDDOUCE
xxxiv
METHODSINENZYMOLOGY
VOLUME 149.Drug and Enzyme Targeting(Part B) Edited ~~RALPHGREENANDKENNETH J. WIDDER VOLUME 150.Immunochemical Techniques(Part K: In Vitro Models of B and T Cell Functions and Lymphoid Cell Receptors) Editedby GIOVANNI DI SABATO VOLUME 151. Molecular Geneticsof Mammalian Cells Editedby MICHAEL M. GOTTESMAN VOLUME 152.Guide to Molecular Cloning Techniques Editedby SHELBY L. BERGERANDALAN R. KIMMEL VOLUME 153.Recombinant DNA (Part D) Editedby RAY Wu ANDLAWRENCEGROSSMAN VOLUME 154.Recombinant DNA (Part E) Editedby RAY WV ANDLAWRENCEGROSSMAN VOLUME 155.RecombinantDNA (Part F) Edited by RAY WV VOLUME 156. Biomembranes(Part P: ATP-Driven Pumps and Related Transport: The Na,K-Pump) Editedby
SIDNEYFLEISCHERANDBECCAFLEISCHER
VOLUME 157. Biomembranes(Part Q: ATP-Driven Pumps and Related
Transport:Calcium, Proton, and PotassiumPumps) Editedby
SIDNEYFLEISCHERANDBECCAFLEISCHER
VOLUME 158.Metalloproteins(Part A) Editedby JAMES F. RIORDANANDBERT
L. VALLEE
VOLUME 159.Initiation and Termination of Cyclic NucleotideAction Editedby JACKIE D. CORBINANDROGER A. JOHNSON VOLUME 160.Biomass(Part A: Celluloseand Hemicellulose) Editedby WILLIS A. WOOD AND SCOTT T. KELLOGG VOLUME 161.Biomass(Part B: Lignin, Pectin,and Chitin) Editedby WILLIS A. WOODANDSCOTT T. KELLOGG
METHODSINENZYMOLOGY
xxxv
VOLUME 162. Immunochemical Techniques (Part L: Chemotaxis and
Inflammation) Editedby
GIOVANNI DI SABATO
VOLUME 163. Immunochemical Techniques (Part M: Chemotaxis and
Inflammation) Editedby
GIOVANNI DI SABATO
VOLUME 164.Ribosomes Editedby HARRY F. NOLLER,JR.ANDKIVIEMOLDAVE VOLUME 165.Microbial Toxins: Tools for Enzymology Editedby SIDNEYHARSHMAN VOLUME 166.Branched-ChainAmino Acids Editedby ROBERTHARRISANDJOHN R. SOKATCH VOLUME 167.Cyanobacteria Editedby LESTERPACKERANDALEXANDERN.GLAZER VOLUME 168. Hormone Action (Part K: NeuroendocrinePeptides)(in
preparation) P. MICHAELCONN
Editedby
VOLUME 169.Platelets:Receptors,Adhesion,Secretion(PartA) (in prepa-
ration) Editedby
JACEKHAWIGER
VOLUME 170.Nucleosomes(in preparation) Editedby PAUL M. WASSARMANANDROGER D. KORNBERG VOLUME 171. Biomembranes(Part R: TransportTheory: Cellsand Model
Membranes)(in preparation) Editedby
SIDNEYFLEISCHERANDBECCAFLEISCHER
VOLUME 172.Biomembranes(Part S: Transport Theory: Membrane Iso-
lation and Characterization)(in preparation) Editedby
SIDNEY FLEISCHER AND BECCAFLEISCHER
[ 1]
IMAGE PROCESSING
OF SINGLE RIBOSOMES IMAGED
BY
EM
3
[ 1] Studying Ribosome Structure by Electron
Microscopy and Computer-Image Processing
By JOACHIM FRANK, MICHAEL RADERMACHER, TERENCE WAGENKNECHT, and ADRIANA VERSCHOOR Introduction T o date, the most detailed knowledge o f ribosomal morphology has been obtained by the combination o f electron microscopy and single-particle averaging ~-3 and three-dimensional (3-D) reconstruction methods. The term single-particle averaging refers to a m e t h o d whereby m a n y (e.g., several hundred) images o f a macromolecular structure appearing in a characteristic orientation are averaged after precise correlation alignment. Thus, this m e t h o d is equivalent to the averaging, by Fourier techniques, o f a micrograph showing a flat, two-dimensional protein crystal. 4-6 The averaging is required because the individual images o f a macromolecular structure obtained in the electron microscope contain a large a m o u n t o f noise, allowing the significant part o f the image to be extracted only from a set o f repeated measurements. Because o f the presence o f systematic variations a m o n g the individual projections o f a structure, e.g., due to variations in orientation or a m o u n t o f staining, a multivariate statistical analysis is frequently necessary before a meaningful average (or several averages) can be formed. 7,8 In the m e t h o d o f single-particle 3-D reconstruction, 9,'° the macromolecule is reconstructed in three dimensions from a large n u m b e r o f projections. In the variant o f this m e t h o d most viable for structure research, these
J. Frank, W. Goldfarb, D. Eisenberg,and T. S. Baker, Ultramicroscopy 3, 283 (1978). 2j. Frank, A. Verschoor, and M. Boublik, Science 214, 1353 (1981). 3j. Frank, A. Verschoor,and T. Wagenknecht, in "New Methodologiesin Studies of Protein Configuration" (T. T. Wu, ed.), p. 36. Van Nostrand-Reinhold, New York, 1985. 4 H. P. Erickson and A. Klu~, Philos. Trans. R. Soc. London, Ser. B 261, 105 (1970). 5p. N. T. Unwin and R. Henderson, J. Mol. Biol. 94, 425 (1975). 6 L. A. Amos, R. Henderson, and P. N. T. Unwin, Prog. Biophys. Mol. Biol. 39, 183 (1982). 7M. van Heel and J. Frank, Ultramicroscopy 6, 187 (1981). s j. Frank and M. van Heel, J. Mol. Biol. 161, 134 (1982). 9 W. Hoppe, J. Gassmann, N. Hunsmann, J. Schramm, and M. Sturm, Hoppe-Seyler's Z. Physiol. Chem. 355, 1483 (1975). lo W. Hoppe and R. Hagerl, in "Computer Processingof Electron MicroscopeImages" (P. W. Hawkes, ed.), p. 127. Spfinger-Vedag Berlin, Federal Republic of Gcrmany, 1980. METHODS IN ENZYMOLOGY, VOL. 164
Copyright © 1988 by Academic Press, Inc. All l~hts of~produclion in any form reaerved.
4
ELECTRON MICROSCOPY
[ 1]
projections come from different particles lying in, or brought into, different orientations providing a wide range of viewing directions. H-m In principle, electron crystallographic techniques6,15are capable of providing structural data on ribosomes. 16,17However, a resolution comparable to that obtained by single-particle reconstruction has not been achieved, mainly because large, well-ordered crystals of ribosomes or ribosomal subunits have been difficult to grow. Electron Microscopy Currently, most electron microscopy studies of ribosomes are done using any one of several modifications of the method of negative staining first developed by Valentine and Green. m Immunoelectron microscopic studies of ribosomes are usually done on specimens that axe sandwiched, along with stain, between two layers of carbon? 9-2~ These so-called double-carbon layer preparations give improved contrast for antibodies bound to ribosomes or ribosomal subunits as compared to the single-carbon layer preparations. Fortunately, these same methods of negative staining can be used to obtain images suitable for the application of single-particle imageprocessing techniques. We have found that, under the proper conditions, the double-carbon layer methods give the most consistent results and provide the most detailed information on the interiors of the particles, whereas the single-layer regions yield better defined outlines of the particles, which are therefore more easily aligned by correlation methods. We prefer the methods described by Tischendorf et al. 2~,22and Boublik et al., ~9 mainly because they usually result in a large proportion of the grid surface being double-layered. II A. Verschoor, J. Frank, M. Radermacher, and T. Wagenknecht, J. Mol. Biol. 178, 677 (1984). 12 M. Radermacher, T. Wagenkneeht, A. Verschoor, and J. Frank, J. Microsc. 141, RPI (1985). ~3M. Radermaeher, T. Wagenkneeht, A. Verschoor, and J. Frank, J. Microsc. 146, 113 (1987); E M B O J. 6, 1107 (1987). t4 G. Harauz and F. P. Ottensmeyer, Ultramicroscopy 12, 309 (1984). t5 R. Henderson and P. N. T. Unwin, Nature (London) 257, 28 (1975). t6 W. Kiihlbrandt and P. N. T. Unwin, J. Mol. Biol. 156, 439 (1982). 17A. Yonath, Trends Biochem. Sci. 9, 227 (1984). ~s R. C. Valentine and M. Green, J. Mol. Biol. 27, 615 (1967). ~9M. Boublik, W. Hellman, and A. K. Kleinschmidt, Cytobiologie 14, 293 (1977). 2o j. A. Lake, J. Mol. Biol. 105, 131 (1976). 2t G. W. Tisehendoff, H. Zeiclahard~ and G. St6ttler, Mol. Gen. Genet. 134, 187 (1974). 22 G. St0mer and M. StOtiler-Meilieke, in "Modern Methods in Protein Chemistry" (H. Tsehesehe, ed.), p. 409. de Gruyter, Berlin, Federal Republic of Germany, 1983.
[ 1]
IMAGE PROCESSING OF SINGLE RIBOSOMES IMAGED BY
EM
5
The conditions required for single-particle averaging and three-dimensional reconstruction are, however, more stringent than those for simple visual analysis of images. Ideally, the particles should be identically stained, they should be embedded in stain (as opposed to just being surrounded by a ring of stain24), and they should not be flattened or collapsed. The double-layer preparations are clearly superior to the single-layer preparations in fulfilling the first of these criteria. However, micrographs obtained with the double-layer technique often contain a very thin layer of stain appearing as a ring of high density surrounding the particles and the particles appear larger than those in the single-layer preparations, implying that some particle flattening may have occurred; we do not analyze micrographs that exhibit these characteristics. We have obtained the highest resolutions with specimens which were prepared by one of the double-carbon layer procedures and in which the stain layer is thick, at least in the immediate vicinity of the particles. In micrographs of this type the stain thins out gradually with distance from the boundaries of the particles such that in areas where the particles are clustered together the stain appears almost uniformly distributed over the grid surface. It should be pointed out that the methodology for obtaining the desired staining characteristics has not been perfected, and often many grids have to be prepared and examined before a suitable set of micrographs is obtained. In order to attain the highest resolution it is desirable to minimize the electron dose applied to the specimen. However, we often observe severe specimen drift (detectable in the optical diffraction patterns of the carbon support films25) when attempting minimal dose microscopy on specimens prepared by the double-carbon layer techniques. It is not unusual to encounter regions of the grid from which virtually all of the micrographs arc unusable because of drift. In order to increase the stability of the specimen so as to minimize drift, we do not use "naked" grids when applying the specimen and carbon support films but, instead, the grids are coated with a thick carbon film densely packed with holes. Only those regions of the micrographs in which the sandwiched specimen is suspended over the holes in the thick carbon film are considered for further analysis. An optimal dose for negatively stained specimens6,26,27 is about 23 Deleted in proof. 24 H. Oettl, R. Hegerl, and W. Hoppe, J. Mol. Biol. 163, 431 (1983). 25 j. Frank, Optik 30, 171 (1969). 26 p. N. T. Unwin, J. Mol. Biol. 87, 657 (1974). 27 T. S. Baker and D. A. Goodenough, J. Cell Biol. 96, 204 (1983).
6
ELECTRON MICROSCOPY
[ 1]
1000 el/nm 2 which, fortunately, can be achieved at medium magnifications (e.g., 40,000-50,000X) without significant loss of signal-to-noise ratio due to electron shot noise. 2s It is feasible to use even lower doses (100 el/nm 2) by recording a pair of micrographs, one at the desired dose and a second at a higher dose and containing sufficient power to determine the translational and rotational alignment parameters for each particle which can then be applied to the low-dose micrograph images. 29 The latter approach might be required, for example, in the analysis of unstained frozen-hydrated ribosomes or subunits. Digitization and Selection of Images The electron micrograph is digitized with a microdensitometer into an array of optical density (OD) values, which are stored on a magnetic tape and read into the computer. 3° In the experimentally important OD range, the OD measured in a given picture clement (pixel) indexed j, p(ri) is proportional to the electron intensity I(rj) at that location. For bright field images of sufficiently thin biological particles obtained in the conventional transmission electron microscope with appropriate defocus, the contrast, i.e., the local variation of the electron intensity A/j ---/j - i relative to the mean intensity i, is a measure of the projected potential distribution. A/j and thus the local OD variation Apj -- pj --/~, is roughly proportional to the total projected mass at location j.31 One of the crucial prerequisites for the image to be interpreted as a projection of the object is that the defocus range be properly selected, such that all spatial frequencies up to the significant resolution (see below) lie essentially in one contrast transfer band. An incorrect choice of focus causes certain spatial frequency bands to be suppressed or transferred with false contrast. 32 Although restoration techniques can be used to correct 2s K. H. Downing and D. A. Grano, Ultramicroscopy 7, 381 (1982). 29 M. Kessel, J. Frank, and W. Goldfarb, J. Supramol. Struct. 14, 405 (1980). 3oj. Frank, in "Advanced Techniques in Electron Microscopy" (J. K. Koehler, ed.), p. 215. Springer-Verlag, Berlin, Federal Republic of Germany, 1973. 31 The transfer of structural information from the object into the image is governed by the phase-contrast transfer theory. The relationship between object projection and image contrast is straightforward only in the resolution range considered here (> 2 nm) and only when a number of simplifying assumptions are made. Among these are that the object is thin, and that its interaction with the electrons can be described as a simple phase shift ("pure phase object"). For details, see, e.g., F. Lenz, in "Electron Microscopy in Material Science" (U. Valdr6, ed.), p. 542. Academic Press, New York, 1971. 32 F. Thon, Z. Naturforsch. 21a, 476 (1966).
[ 1]
IMAGE PROCESSING OF SINGLE RIBOSOMES IMAGED BY
EM
7
images having incorrectly placed transfer bands, a3-35 it has proved more practical to select "good" images from a large number of experimental mierographs with varying quality. Other experimental parameters affecting the quality of the image are axial astigmatism and drift. 25 Microgmphs that are to be analyzed are therefore routinely checked in the optical diffractometer for proper defocus and absence of controllable aberrations. 36 In order for details in the range of 2 n m in size--which have been proved to be reproducible in averaged projections of ribosomal subunits prepared by the negative staining technique2--to be represented in the digitized image, the scanning step of the microdensitometer should be equivalent to a value of 0.5 to 0.7 nm. The factor of between 2 and 1.5 × over the 1 n m step theoretically required provides a safety margin that prevents deterioration of image resolution in computational steps requiring interpolation; e.g., image rotation. Although programs for automatic selection of particles from micrograph fields have been d e v e l o p e d , 37-39 interactive cursor-controlled selection by means of a graphics terminal is the most efficient procedure. After this selection, the particle images exist as a set of arrays {pi(rj), j = 1 . . . P} stored in separate files on the disk of the computer, pi(rj) stands for the OD value of the jth pixel in the/th image. The need to scale micrographs arises in many applications, e.g., averaging of projections selected from different micrographs, comparison of different specimens, and 3-D reconstruction from a large number of projections. The scaling procedure is based on the known properties of bright field_images of weak phase objects. 4° Under these conditions, the contrast AIj/I is independent of the mean intensity I. Consequently, when two particles (p~j and P2j, J = 1 . . . P} are selected from different micrographs, comparable density values are obtained by
plj=plj/pl;
p2j = p2j-//~2
(1)
where/~l and/S2 are the mean densities measured by averaging portions of the micrographs that do not contain particles. 33 W. Hoppe, Acta Crystallogr. A 26, 414 (1970). O. Kfibler, M. Hahn, and J. Seredynski, Optik 51, 171 (1978). 35 T. A. Welton, Adv. Electron. Electron Physics 48, 37 (1979). 3~ B. V. Johansen, Princ. Tech. Electron Microsc. 5, 114 (1975). 37 j. Frank and T. Wagcnknecht, Ultramicroscopy 12, 169 (1984). 3s M. van Heel, Ultramicroscopy 7, 331 (1981). 39 D. W. Andrews, A. H. C. Yu, and F. P. Ottensmeyer, Ultramicroscopy 19, 1 (1986). 4o F. Lenz, in "Electron Microscopy in Material Science" (U. Valdr~, ed.), p. 542. Academic Press, New York, 1971.
8
ELECTRON MICROSCOPY
[ 1]
Alignment of Images The objective of the alignment procedure 1,2 is to determine coordinate transformations Ci ----TiRj (Ti translation, Ri rotation matrix) such that N
P
~ [pt(Cir/) - pl,(Crrj)] 2 ~= rain
(2)
i> i' j - - 1
where N is the number of images. This objective is achieved, to a good approximation, through application of an iterative procedure. First, the error sum, or Euclidean distance P
ET, = ~ [pi(C; rj) - pr(rj)] 2
(3)
j--I
is minimized between each image p~ and a suitably chosen "typical" reference image, denoted by p,. Subsequently, E~ = ~ [pi(C] rj) - p° (rj)] 2
(3a)
j-I
where the new reference p ° (rj) -- 1/N Y~_ ~p~(C~ rj) is the average after the first cycle. This procedure is repeated several times until the error sum E~o of Eq. (3a) or a similar measure of discrepancy no longer shows a significant change. Similarly, as for molecular search methods of X-ray crystallography, 4~ the minimization of the error sum for two images p~(r) and p2(r) is achieved by maximizing a function
x(c) = fa pl(Cr)p2(r) dr
(4)
which is obtained by integration over the image domain A. ~ C ) is closely related to the two-dimensional cross-correlation function (CCF), which is used for translation search only (see below). For increased speed, the three-dimensional search (with respect to x, y, and ~b) is split into a two-dimensional search of translation (x,y) yielding T and a one-dimensional search of rotation (angle ~b) yielding R.l'~2 Optimal alignment of an image set may be achieved by combining four basic techniques (Fig. 1). Initially, the time-saving decoupling of rotation and translation searches is accomplished by centration 13 (A) or by the use of a translation-invariant rotation search (B). ~ Subsequently, the transla41 E. Lattman, this series, Vol. 115, p. 55. 42 R. Langer, J. Frank, A. Feltynowski, and W. Hoppe, Ber. Bunsenges. Phys. Chem. 74, 1120 (1970).
[1]
IMAGE PROCESSING OF SINGLE RIBOSOMES IMAGED BY
A
EM
9
B
CENTER PARTICLE BY 2-D CROSS-CORRELATION WITH A CENTERED, LOW-PASS FILTERED DISK
SEARCH ORIENTATION BETWEEN ACFs OF PARTICLES
C
D
SEARCH ORIENTATION BETWEEN CENTERED PARTICLES ("DIRECT METHOD")
•
ALIGN BY 2-D CROSS-CORRELATION
FIG. 1. Four components of the single-particle alignment procedure (see text).
tion and rotation parameters are refined by alternation between "direct" rotational alignment (C) 2,43and two-dimensional cross-correlation ( D ) . t'44 Examples for common search strategies are, in operator notation to be read from right to left, • . . [C o D] o [C o D] o [C o D] o [C o A]
and
(5) • . . [D o C] o [D o C] o [D o C] o [D o B]
Starting from the right, each term in brackets stands for one alignment pass that uses the average of the previous pass as reference. As stated above, the initial reference is an original, unaveraged image deemed typical. When several dissimilar types of projections are known to be present, several reference images must be tried for each image, and the selection of the appropriate class is then made on the basis of the highest cross-correlation coefficient (multireference alignment45'4*). Both translational and rotational searches are done by fast Fourier techniques. The values of the translation parameters are determined from 43 M. Steinkilberg and H. Schramm, Hoppe-Seyler's Z. Physiol. Chem. 361, 1363 (1980). 44j. Frank, in "Computer Processing of Electron Microscope Images" (P. W. Hawkes, ed.), p. 187. Springer-Verlag, Berlin, Federal Republic of Germany, 1980. 45 M. van Heel, J.-P. Bretaudiere, and J. Frank, Proc. Int. Congr. Electron Microsc., lOth 1, 563 (1982). 46 M. van Heel, Proc. Fur. Congr. Electron Microsc., 8th 2, 1317 (1984).
10
ELECTRON MICROSCOPY
[ 1]
• (r') = fA pl(r + r')p2(r) dr
(6)
the CCF:
where r' is the argument vector describing the translation between the two images p~ and P2. For the fast computation of the CCF the Fourier theorem is exploited47: O(r') -- ~ - ~ ( 3 ~ (r)]3~*[P2(r)]}
(7)
where 3~ and 3~-~ denote the forward and reverse Fourier transformations, respectively, and the asterisk stands for formation of the complex conjugate. /~(r) and P2(r) are derived from the original images (defined by domain A0 by padding into a field A2 whose size is large enough to avoid circular overlapS:
.~(r) = fp(r)
r ~ Al
r ~ A2
(8)
The value of the constant c is chosen to be equal to the mean of the pixels along the boundary of A~ to minimize the density step. (For bright field images, the mean of all pixels lying within A~ may be used instead with little practical difference.) The vector pointing from the origin of the CCF to its maximum is the vector by which Pu is translated relative to pt. For the computation of a rotational search function R(C~) -- fA W(I r I)f~(C+r)f2(r) dr,
(9)
where C+ is the probing rotation matrix and I41(Irl) a weighting function, the two functionsf~ and f2 to be matched are represented on a polar grid by reinterpolation from the cartesian grid, and the Fourier theorem is used, for increased speed, to compute one-dimensional CCFs along each polar coordinate ring?4 The rotational search function ("rotation function") is then obtained by weighted summation over all one-dimensional CCFs A~')(q~); r = [rl:
R(dp) -- ~, W(r) A(lf(q~)
(10)
¢
(see Crowther,4s where a similar simplification is used). The weighting function is chosen such that ring zones whose contributions are most sensitive to rotation receive highest weights. For algorithm C above (Fig. 1), the functionsft and f2 in Eq. (9) are the images themselves, whereas in +7G. D. Bergland, I E E E Spectrum p. 41 (1969). 48 R. A. Crowther, Int. Sci. Rev. Ser. 13, 10 (1972).
[1]
I M A G E P R O C E S S I N G OF SINGLE RIBOSOMES I M A G E D BY
EM
11
algorithm B the autocorrelation functions (ACF) of the images are used instead, and the search extends over only half the angular range. The rotational search may result in several peaks of comparable size. In particular, algorithm B (Fig. 1) leads to an intrinsic 180-degree ambiguity due to the centrosymmetry of the ACF. Such ambiguities are resolved by computing the CCF for each orientation, and then selecting the rotation angle that produces the maximum CCF peak.49 Averaging After alignment (denoted by the final cumulative coordinate transformations CD, projections relating to the same viewing directions may be averaged: N
p(rj) =
1/N ~
p,(C~'rj),
(11)
i--I
which results in an image p(rj) with greatly reduced noise contributions (by the factor Nm). As the sum of Eq. (11) is formed, the so-called variance map 2 is also computed N
v(rj) ---- E
[Pi(CTrj) -- p(rj )]2
(12)
i--I
This map is very informative as it gives an account of the location of regions where high discrepancies occur among images. This typically happens near the stain boundaries and at sites of the particle where positional changes of flexible components are encountered (Fig. 2). Resolution and Reproducibility of Averaged Projections Data obtained by single-particle averaging techniques lack an in-built resolution measure, in contrast to those obtained from crystals, for which diffraction orders can be counted. For determining the reproducible resolution ("cross-resolution"), two independently derived averages are compared in Fourier space: if F~(k) and F2(k) are the Fourier transforms of such averages, the differential phase residual2
"~I/2
A-~k, Ak)= [~'l[Adp(k)]2[]F'(k)]+[F2(k)[][ [~ak, [IFl(k)l + Ie2(k)l]
(13)
J
49 H. P. Zingsheim, D. C. Neugebauer, F. J. Barrantes, and J. Frank, Proc. Natl. Acad. Sci. U.S.A. "17, 952 (1980).
12
ELECTRON MICROSCOPY
[ 1]
a
b
Fro. 2. Averaging of the crown view of the 50S ribosomal subunit from E. coil [A. Verschoor, J. Frank, and M. Boublik, J. Ultrastruct. Res. 92, 180 (1985)]. (a) Portion of micrograph field from single-layer preparation. Scale bar 50 nm. (b) Examples of selected images (first six frames), and average and variance images (seventh and eighth frames, respectively; N = 60). The average image and variance map are displayed with a limiting resolution of 3 nm. Inspection of the variance map (final frame in b) shows that the singlelayer preparation permits a large amount of variation in the position of the L7/LI2 stalk (arrow) and in the amount of peripheral staining. The tip of the stalk has a low contrast and so low variance despite its large positional variation.
with A~b(k)----phase[Fl(k)]- phase[F2(k)] is computed by summation over rings k + A/c, k = Ikl in the Fourier plane, and plotted as a function of ring radius k. Although the entire curve is needed to accurately describe the reproducibility of the averages, it is convenient to state a tingle figure, k45, for which Ad~(k45, Ak) = 45 ° (Fig. 3). It must be stressed that in electron microscopy of stained specimens, the global equivalent to Eq. (13) obtained by summation from 0 to km~5° is not very informative, since the structure factor F(k) falls off, and the phase difference between two transforms increases rapidly, as a function of k. In addition to the phase residual of Eq. (13), another differential measure of cross-resolution, the Fourier ring correlation (FRC), 5~,52 is fre5o p. N. T. Unwin and A. Klu& J. Mol. Biol. 87, 641 (1974). 51 W. O. Saxton and W. Baumeister, J. Microsc. 127, 127 (1982). ~2M. van Heel, W. Keegstra, W. Schutter, and E. F. J. van Bruggen, in "Structure and Function of Invertebrate Respiratory Proteins" (E. J. Wood, ed.), p. 69. Harwood, 1982.
[ 1]
I M A G E P R O C E S S I N G OF SINGLE RIBOSOMES I M A G E D BY
Phase Residual
EM
13
•
AO
60
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
1
. . . . . . . . . . . . . . . . . . . . . . . . .
40'
20.
1)4o
'1)2o
A-'
FI~. 3. Resolution determination by phase residual analysis. The particle analyzed is the 50S ribosomal subunit from E. coli prepared by the double-carbon layer method, showing the crown view.t3 (a) Phase residual plot obtained with two independent subset averages (N = 245 each). The 45* limit is reached for a resolution of 2.3 nm (arrow). (b) The two subset averages and the total average (N = 490) limited to the resolution found in (a), displayed as a contoured halftone representation.
quently used: FRC(k, Ak) - -
E F| (k)F2(k)} {[k'ak]
Here the resolution is defined as the spatial frequency for which FRC(k~t, Ak) = [2 Ak/(~k,~t)] 1/2
(14)
(15)
14
ELECTRON MICROSCOPY
[ 1]
Comparisons of k45 and k~t for selected data sets indicate, however, that k~tlt is as a rule larger, and A$(k~it, Ak) is larger than 80 °, suggesting that the FRC criterion may be too liberal for the purpose of resolution estimation.53,54 Statistical Significance of Averages The statistical significance of structural features in an averaged image can be assessed by applying standard statistical tests to the individual image elements) ,55 Assuming Gaussian statistics and that the individual images used to compute the average were correctly aligned, the standard error of the mean for the jth picture element of the average is Em[/~(ri)] = [v(rj)/N] 1/2
( 16)
where v(rj) is the variance map introduced before in Eq. (12). The standard error of the difference between two averaged picture elements is given by Ed [/~1(r~,/~2(rk)] = IV1( r j ) / N 1 + v2(rk)/N2] 1/2
(17)
(N1 and N2 are the numbers of images averaged in each case). The two picture elements may be different elements from a single average (pl ffi/72; j ~ k) or corresponding elements from two different averages (p~ * P2; j - k). The latter case occurs in studies where it is desired, e.g., to map the location of an antibody or other macromolecule (label) bound to a ribosomal subunit by quantitatively comparing averaged images of the labeled and control subunits. Ideally, the only significant differences between corresponding pixels in the two averages will occur at the location of the bound label. As a rule of thumb, we consider a difference between two averaged picture elements to be significant if it exceeds the standard error by a factor of at least three; this factor corresponds to a significance level of 0.2%. It is usually necessary to scale the ODs when comparing averages obtained from different micrographs (see Digitization and Selection of Images). Differences between averages that are strongly dependent upon the scaling parameters should be viewed with suspicion. It should be emphasized that statistically significant differences among averages obtained from different micrographs do not necessarily corre53 M. Radermacher, J. Frank, and C. A. Mannella, Proc. Annu. Meet. Electron Microsc. Soc. Am., 44th, p. 140 (1986). J. Frank, M. Radermacher, T. Wagenknccht, and A. Verschoor, Ann. N.Y. Acad. Sci. 483, 77 (1986). 55 H. P. Zingsheim, F. J. Barrantes, J. Frank, W. H~inicke, and D. C. Neugebauer, Nature (London) 299, 81 (1982).
[1]
IMAGE PROCESSING OF SINGLE RIBOSOMES IMAGED BY
EM
15
spond to genuine differences in macromolecular structure. The detected differences could be due, for example, to variation in the mode of staining in the micrographs. When averaged images of modified (e.g., labeled) and control specimens are being compared, ambiguities of this type can be avoided by analyzing micrographs consisting of a mixture of the two specimen types. It is sometimes feasible, using the technique of correspondence analysis (see following section), to distinguish the two populations present in a tingle micrograph. 3 Alternatively, the aligned images of a mixed population can be averaged and a variance map [Eq. (12)] computed; the differences detected by comparing the two homogeneous populations will be visible in the variance map of the mixed population, provided that the optical density differences due to the label are significantly larger than the random deviations in density due to noise among the images. 56 If there is reason to suspect that the individual images used to compute an average were not correctly aligned, then nonparametric statistical tests may be applied to check the validity of features in the average imageY These tests are quite general, making no assumption on the validity of the statistics of the noise.
Multivariate StatisticalAnalysis Images aligned by the methods sketched out above may not represent particleshaving preciselythe same state of preservation or distributionof stain. Flexible components may occur in differcntpositions. "Rocking" movements around thc characteristicorientation may produce variations in the particle'sprojected appearance. For screening the images without reference to a preconceived model of the structure,correspondence analysis,58,59 a branch of multivariatc statisticalanalysis, is used in the way introduced by van Heel and FrankV,8:the basic philosophy of thisapproach isthat aligned images containing P pixclscan be described as vectors in R ~, a P-dimensional vector space, since, by virtue of the alignment, pixcls fallingonto the same grid point refer to the same absolute location in the molecule's coordinate system. Thc end points of thc vectors dcscribing the images form a "cloud." Points lying closely together belong to images that are closely similar. Thus, the structureof the point cloud (i.e.,itsshape and internalstructure) 56T. Wagenknecht and J. Frank, Biochemistry 23, 3383 (1984). 57W. H~inicke,J. Frank, and H. P. Zingsheim, J. Microsc. 133, 223 (1983). 5sL. Lebart, A. Morineau, and K. M. Warwick, "Multivariate DescriptiveStatistical Analysis." Wiley,New York, 1984. ~9j. p. Benzecri, in "Methodologies of Pattern Recognition" (S. Watanabe, ed.), p. 35. Academic Press, New York, 1969.
ELECTRON MICROSCOPY
16
[ 1]
reflects the existence and relative configurations of classes among the images. The multivariate statistical analysis provides a means for identifying, describing, and separating these classes in a quantitative way. In correspondence analysis of aligned particle projections pi(rj), a matrix with the general element f/J=
N
Pi(rfl P
(18)
E E p,(r,)
i--lj--I
is created. Based on a chi-squared distance metric, a covariance matrix with the general term N
Sjj, = E ft'(:J)l/2(fiJ/f]°:J
-
i-I P
1)(f'J')lY2(ftJ'/fi'f'J"-
1)
(19)
N
Y,-= Ef J; j-i
;:.J= F_,Y,J t-i
is formed. The row vectors {f0; J = 1 . . . P) are referred to as image profiles. The chi-squared metric ensures that the multivariate analysis is independent of the scaling of the individual images. Specifically, brightfield images taken of the same object with different exposures differ by a scalar factor only, and are thus represented by the same point. The matrix S of Eq. (19) is analyzed for its eigenvectors, or factors. These factors form a new set of basis vectors (~mj;J = 1 . . . P) in the P-dimensional vector space, which are ranked by the size of their eigenvalues, with the first factor pointing in the direction of largest extension of the data cloud, the second pointing in the direction of largest extension orthogonal to the first, and so forth. Thus these factors may be used to represent the dispersion or shape of the cloud formed by the rescaled images (f0;J - 1 . . . P}, originally in R e, in a space with greatly reduced dimensionality. In this space, each image is described by a rr6~-tupel of coordinates, (x~,; m - 1 . . . m~O. A new, condensed representation (reconstitution) of the images may be obtained in the form of linear combinations of the m , ~ high-ranking factors59: m~
#i(rj) = ~
Iqj.,%.j
(20)
m--O
The vectors {e~j =f.~mj; J---- 1 . . . P} may be thought of as eigenim-
[ 1]
IMAGE PROCESSING OF SINGLE RIBOSOMES IMAGED BY
EM
17
ages,~°,6~and the sum in Eq. (20) has a close analogy to a Fourier synthesis from a limited number of orders of reflections. The expression in Eq. (20) can also be formed over any subset of factors, selectively omitting contributions from those factors that express structurally irrelevant features; e.g., variations in the amount and spatial distribution of peripheral staining. 62 To describe the shape of the point cloud formed by the image profile vectors in R e, and to define and isolate homogeneous subsets of the images, one of three methods of interpretation based on the factorial coordinates may be used: (1) inspection of 2-D factor maps, e.g., xi~ versus x,~; (2) identification of dusters and classification; and (3) nonlinear mapping. Which of these methods will be most informative and effective in isolating subsets depends on the type of variations present in the projection set. If strong clustering or a predominant trend occurs, one or two factor maps may be sufficient to identify classes of images (Fig. 4a). If, however, the clusters are separated or stretched in three or more dimensions, then the factor maps may be difficult to interpret. A similar problem arises in the analysis of data exhibiting continuous variationsn especially if linked to a continuous value range of a single parameter (such as tilt angle of a cylindrical particle about the cylinder's axis) n which require determination of the seriation of the data.H The methods dealing with these problems, classification and nonlinear mapping, will be briefly outlined below. Identification of Clusters and Classification Through the alignment of an image series and the subsequent multivariate statistical analysis of the resulting aligned image set, the data are in a form (as points in an up to 8-dimensional vector space, which is the number of factors often used in practice) that allows a variety of clustering procedures to be carried out. The objective is to find clusters, or compact accumulations of points, and to characterize these in terms of their compactness and relative positions. According to their relative locations, the initial clusters can be grouped into classes in a hierarchical manner, and thus the determination of the hierarchy of class associations is required for a full description of the data structure. This second step of cluster analysis is termed classification. Once clusters and classes have been identified, characteristic "average" 6o j._p. Bretaudiere and J. Frank, J. Microsc., 144, 1 (1986). 6~ M. van Heel, in "Pattern Recognition in Practice" (E. S. Gelsema and L. N. Kanal, eds.), Vol. 2. North-Holland, Amsterdam, 1985. 62 j. Frank, A. Verschoor, and M. Boublik, J. Mol. Biol. 161, 107 (1982).
18 a
ELECTRON MICROSCOPY : .......
=,. . . . . . .
. .......................
.( .................
[ I]
-E: ...............................
~ - - - l - - ~ - ~
2 "~ •.1
.: . . . . .
•. \
I ,
,
-e.ele
• I
~ i
G
1 • . . . . . . l ~". . . . . . . . . . . . . . . . . . . . . . . . . . .
,
"~pe ~._
*
i
v
I0 • . "
-0.011
II
i
lira
:
o
0 e1
ll?, %, , " ~"
I1
?:3
M
~'
...ca. : ( " a a " ~ . . . . . . le.~-t) "
./;
. e/.o
! ~ ; : . :
~t I "R"
-0.004
r 9"6
,2
O " ~K .t';~; .........
6 " (~
:
/ ~
: :
2 20
2
~ .................
;J
0o
6F~ 6
7 . '
3 2S
.......
4-~ 6
0.003
a 4 ~ /
:
:
! I ~i~ "
. ~
0.011
: "
L
0.810
F~o. 4. Correspondence analysis and classification of the overlap view range exhibited by the 70S ribosome from E. coliP A total of 204 images were included in this analysis. All results were independently reproduced with a second data set comprising 177 images. (a) Correspondence analysis map of factor 1 versus 2, with assignment of clusters following Diday's multiple partitioning method. Each image is represented by a symbol that stands for the cluster it belongs to. The symbols (1 through 9, A through Z, * beyond Z) follow the ranking of the cluster, cluster 1 being the most populous. The images occur ordered along factor I according to the orientation of the ribosome on the specimen grid.ss For the meaning of the classes l, I], and IH, see (c). The images representative for the 11 clusters with memberships of five and above are shown at the bottom. They were obtained by reconstitution using 8-dimensional cluster center coordinates. ~°(Orientation changes reflected by factor 1 are thought to be produced by rotation of the particle about an axis ronghly vertical in this figure.) (b) Hierarchical ascendant classification dendrngram showing the successive merging
[1]
IMAGE PROCESSING OF SINGLE RIBOSOMES IMAGED BY EM
19
C
III
II
6
4
i
i
?
9
I
I 8
I 10
5
II
1
11
3
2
III
of classes, starting from the 11 most populous clusters, according to the principle of minimum increase of intraclass variance. The distances in v e r t i ~ direction of the dendrogram reflect the distances between aggregated classes. The most sensible cutting level, indicated by a dashed line in (c) generates three classes. These classes are demarcated in (a) by solid lines and are marked by Roman numerals I, II, III. The result indicates that three more or less stable orientations are assumed by the particle in the overlap range of views. The views corresponding to these orientations are typified by the reconstituted class center images I, II, and III shown at the bottom.
20
ELECTRON MICROSCOPY
[1]
images may be computed by using class center coordinates in the reconstitution formula of Eq. (20). As van Heel observes,63 the exact determination of an optimal partitioning of a data set consisting of N points into a given number of compact classes requires a number of trial computations on the order of N!.. Since this number is impractically large for all practical cases, only algorithms for finding local optima have been given in the literature. Of the numerous algorithms proposed, two (discussed in Ref. 58) have been explored and found useful in the analysis of electron microscopic data: hierarchical ascendant classification (HAC) with minimum added variance as merging criterion, 64 and the method of clustering about moving centers combined with multiple cross-partitioning used by Diday. 65 van Heel 45,61,63,66 uses HAC throughout the analysis, starting with the original points as "classes," plus a postprocessing procedure designed to reduce the residual misclassification. Frank et aL 67 use Diday's variant of the method of clustering about moving centers, followed by HAC at the stage where stable clusters have been found. As an example for the application of these techniques, we show the classification67 of the overlap views6s of the 70S ribosome from Escherichia coli (Fig. 4).
Nonlinear M a p p i n g The objective of nonlinear mapping is to display a point distribution that is formed in a three- or higher dimensional space onto a 2-D map such that interpoint distances are optimally preserved. Thus the resulting 2-D map allows the clustering as well as the seriation of the data to be analyzed.69,70 The points in the m~-dimensional space spanned by the factors are first linearly projected onto a 2-D map. Their projected positions are iteratively changed such that the differences between the Euclidean distances in the 2-D map dii, and those in the higher-dimensional space t~ii,are
63 M. van Heel, Ultramicroscopy 13, 165 (1984). S. C. Johnson, Psychometrika 32, 241 (1967). 65 E. Diday, Rev. Fr. Inf. Rech. Oper. 6, 61 (1972). M. van Heel and M. St6fller-Meilicke, EMBO J. 4, 2389 (1985). 67 j. Frank, J.-P. Bretaudiere, J.-M. Carazo, A. Verschoor, and T. Wagenknecht, J. Microsc. 150, 949 (1988). 6a A. Verschoor, J. Frank, T. Wagenknecht, and M. Boublik, J. Mol. Biol. 187, 581 (1986). 69 M. Radermacher and J. Frank, Ultramicroscopy 17, 117 (1985). ToM. Radermacher and J. Frank, Ultramicroscopy 19, 75 (1986).
[ 1]
IMAGE PROCESSING OF SINGLE RIBOSOMES IMAGED BY
EM
21
minimized according to an error criterion E: 1 E-
iv
,,
E
E
'<"
'
(21)
i
The distances are defined by =
(22a)
(It, ira - - X t , m ) 2 1
and d,e =
t)
[x~° - x~')] 2
(22b)
with x~~ = 2-D map coordinates of/th point. The weights flee in Eq. (21) are introduced to weight the distances according to their importance:
if,,, = (~,;,)"
(23)
The choice of a = 0 is appropriate if a clustering of the data is to be expected, and if the short-range relations within a cluster are thought to be of minor importance. The choice of a = 1 is appropriate in situations where short-range relations are to be reflected. However, any value between these two extremes can be used. Experience has shown 69 that rapid convergence is achieved when a = 0 is chosen in a first pass and a > 0 in a refinement pass that uses the map of the first pass as starting distribution. The minimization of E of Eq. (21) is done by the method of steepest descent, which is an iterative algorithm.
D a t a Collection for Three-Dimensional Reconstruction If projections are available over a sufficiently large portion of the hemispherical angular range, the object can be reconstructed in three dimensions. Methods of data collection and reconstruction are viable only if they allow the radiation dose to be minimized. When the negative staining technique is used, the dose should not exceed 2000 e/nm2. 26,27 In practice, this means that in the 3-D reconstruction, data from many different particles must be combined, so that each particle is allowed to be exposed only once, contributing a single projection to the reconstruction. Two methods of data collection and 3-D reconstruction fulfilling this requirement have been described, both of which make use of some type of naturally occurring random orientations of the ribosomal particles:
22
ELECTRON MICROSCOPY
[ 1]
FIG. 5. Principle of two data collection methods that rely on random orientations of a particle, illustrated by the use of synthetic images: (a) Quasi-cylindrical particle occurring in random orientations on the specimen grid (example, prokaryotic 30S ribosomal subunit). A 0 ° view of this field contains a random sample of the 360 ° single-axis projection range. (b) Particle occurring in a unique orientation but with random in-plane azimuths (example, prokaryotic 50S ribosomal subunit). A 60 ° view of this field contains a random sample of a
completeconicalprojectionrange. 1. random orientations of a particle with approximately cylindrical shape, whose axis of rotation lies parallel to the specimen grid (Fig. 5a) H, and 2. random in-plane orientations of a particle that possesses a preferred orientation with respect to the plane of the specimen grid (Fig. 5b). 1,12,13 In the first method, an image of the untilted specimen grid furnishes a large range of views, related by rotation about a single axis, which may be ordered by application of multivariate statistical analysis. However, this method has the serious disadvantage of requiring some independent information, e.g., data from additional tilt experiments, so that angles can be assigned to these views for the purpose of the 3-D reconstruction. The second method, used in the reconstruction from a single-exposure, random conical-tilt series, avoids these problems of angle assignment: a pair of micrographs is taken, one of the tilted (e.g., by 60 °), and one of the untilted specimen grid. The first image, which contains a conical range of projections, is used in the reconstruction, while the sole purpose of the second image is to establish the azimuthal angles, and thereby the precise placement of each tilted image on the theoretical cone. Tilt Axis Determination The direction of the tilt axis is determined by comparing distances between pairs of equivalent points in the image of the tilted and untilted specimen.13
[1]
IMAGE PROCESSING OF SINGLE RIBOSOMES IMAGED BY
EM
23
If I is the length of such a line in the 0 ° image, l' the corresponding line in the tilted image, and d the tilt angle, then the angle a that the tilt axis forms with l in the 0* view is: a = arcsin { .(ll~lln'~ 1/2}
(24a)
and with l' in the tilted view:
(12 _ 1,2 1/2
(24b)
To achieve a high accuracy in the determination of this angle, between 380 (for n = 20 points) and 1560 (for n = 40 points) lines are compared and the results averaged. The accuracy of the determination depends on (1) the tilt angle, since for small angles the length differences are very small; (2) the accuracy of the measurements; and (3) the angle that the line l or l' forms with the actual tilt axis. A satisfactory accuracy is obtained when the tilt angle is larger than 30 °, and the angle between the tilt axis and line l (or line l') is between 20 ° and 70". A program calculating the direction of the tilt axis should allow a m i n i m u m length for l (or 1') to be specified so that the lengths may be measured with an accuracy of at least 2%. Alignment of a Tilt Series Here we will give the principles of alignment for the images in both single-axis and conical-tilt series. A detailed theory for the alignment of a single-axis tilt series is given by Guckenberger. 71 Its principle can be described as follows. Electron micrographs are orthogonal projections of the object, i.e., the projection plane is perpendicular to the direction of projection. For the purpose of aligning the projections to a c o m m o n origin, each image of the tilt series is first stretched by l/cos O, thus creating a set of inclined projections, i.e., projections that all lie parallel to the same plane of the object's coordinate system. These inclined projections are serially aligned by the 2-D cross-correlation procedure described earlier. The translations found in this alignment are mapped back into the coordinate systems of the orthogonal projections and these original projections are shifted accordingly. The alignment of a conical-tilt series proceeds in a similar way. ~3 Inclined projections are again created by stretching the images by 1/cos O 71 p. Guckenberger,
Ultramicroscopy9,
167 (1982).
24
ELECTRON MICROSCOPY
[ 1]
where O is the (fixed) tilt angle. These projections are serially aligned. For each pair of successive projections, the second projection is rotated, by the angular difference determined relative to the first one; the two projections are cross-correlated; and finally the second projection in its unrotated, unstretched version is shifted by the vector found. Both alignment schemes suffer from accumulation of errors, as they both work in a serial manner. This problem can be overcome by aligning the projections always i n sets of three and shifting them by an averaged amount, or by using a similar strategy that effectively reduces the number of steps in one complete alignment cycle. In any case, it is necessary to repeat the alignment several times until no further significant shifts are found. T h r e e - D i m e n s i o n a l Reconstruction In the 3-D reconstruction step, Gilbert's weighted back-projection method 72 is preferred to the iterative methods 73 for its computational efficiency. After a simple back-projection, the reconstructed object ~(r) is subjected to a 3-D Fourier filtration [3-D weighting function W3(k)]: p(r) = 3:-1{ W3(k ) ~(~(r)))
(25)
Equivalent to this procedure is the 2-D Fourier filtration of the individual projections [2-D weighting functions Wz(k)] p(r) -- ~-'(W2(k) ~(p(r)))
(26)
followed by back-projection. The choice of weighting functions W3(k) or W2(k) is determined by the geometry of data collection (single-axis tilt versus conical) and the angular spacing of the projections (even versus random). Data with random spacing can be converted into evenly spaced data by averaging over equal angular intervals. Such a data reduction increases the speed of computation but results in some loss of resolution. Weighting Weighting functions for the various geometries arc given below. Although many different weighting functions can be found in the literature, they differ mainly in the way in which an implicit low-pass filtration or 72p. F. C. Gilbert, J. Theor. Biol. 36, 105 (1972). 73G. T. Herman, "Image Reconstructionfrom Projections." AcademicPress, New York, 1980.
[1]
IMAGE PROCESSING OF SINGLE RIBOSOMES IMAGED BY
EM
25
resolution limitation is realized. None of the weighting functions given here contains any limitation in resolution. Rather, this limitation has to be imposed in a separate step, either prior to the reconstruction, by applying a 2-D filter function to the Fourier transform of each projection, or after the reconstruction, by applying a 3-D filter function to the Fourier transform of the 3-D volume. This latter approach offers a much greater flexibility, since a large choice of low-pass filter functions is available and these can be varied in the last step for the interpretation of the results. In the following we assume that x and y are coordinates in the specimen plane, and z is the coordinate perpendicular to the specimen plane. Furthermore, we assume that y is the direction of the tilt axis in the single-axis tilt series. The transformation from the coordinate system of the object to that of the ith projection with azimuth ~bi and tilt angle Oi is assumed to be r~O = a y ( o , ) • R z ( ~ , ) "r
(27)
with r, object coordinates; r t0, projection coordinates (projection plane x to, yto); Ry, rotation around y-axis; Rz, rotation around z-axis. Although the historical development proceeded in the opposite direction, we will first give the weighting function appropriate for arbitrary, entirely irregular angular sampling 12 and will then show how the functions for regular and single-axis data collection follow from this under appropriate assumptions: N'
Wa(x*,y*,z*) = 1 / ~ D sinc[~tDz*(0]
(28a)
i--I
with x*,y*,z* cartesian coordinates in the 3-D Fourier coordinate system of the object; z *to, z*-coordinate in the coordinate system of the Fourier transform of projection Pi; D, object diameter. The 3-D weighting function for a conical geometry (0 fixed) with equal azimuthal angular increments is independent of the azimuth74: Wa(r*,c~*,z* ) = ½(r . 2 s i n 2 0 - - z . 2 c o s 2 O) 1/2
(28b)
where r* = (x*2+ y,2)1/2, ~b*, and z* are cylindrical coordinates in the object's 3-D Fourier transform. The equivalent 2-D weighting function in the planes corresponding to the 2-D Fourier transform of the single projections isTM W2(x*tO,y*O~) ffi y*O~ sin 0
(28c)
where x.tO, y.t0 are the coordinates in the section of the 3-D Fourier space 74 M. Radermacher and W. Hoppe, Proc. Int. Congr. Electron Microsc., 9th 1, 218 (1978).
26
ELECTRON MICROSCOPY
[ 1]
that corresponds to the projection p~. [The latter weighting function can be calculated from Eq. (28a) by assuming D ~ oo, O constant, and ~b continuous.] The 2-D weighting function for single-axis tilting with equal angular i n c r e m e n t s is 72
W2 = x*
(28d)
Resolution of the Reconstruction The theoretical resolution of a 3-D reconstruction, which depends on the number of projections, may be calculated for equal angular increments in both the single-axis and the conical-tilting schemes. Both formulas are derived by using Shannon's sampling theorem, which states in essence that two measurements must be available for each resolution element. Applied to Fourier space this means that no two neighboring sampling points should be spaced farther apart than 1/D, where D is the diameter of the reconstruction volume. In the case of conical tilting, the volume is assumed to be spherical (diameter, D) and, in the case of single-axis tilting, it is assumed to be cylindrical (diameter of cylinder D), concentric with the tilt axis. The formula linking the number of projections N with the resolution for single-axis tilting is (according to the formula of Crowther et al., 75 modified to account for the accessible angular range76) N = n ( D / d ) . 2(0/n)
(29a)
where tr is the maximum available tilt angle; i.e., the tilt angles range from - d to + d. For conical tilting the formulas a r e 77 N = 2 n ( D / d ) sin d
for N even
N = n / 2 ( D / d ) tan 0116 cos2 d - (d/D)2] m
(29b) for N odd
(29c)
Both formulas determine only the resolution in the directions where the 3-D structure is fully sampled. In the conical-tilting geometry a double cone with vertex angle 90 ° - d is missing, while in the single-axis geometry a double wedge with an angle 90 ° - d is missing. Besides producing artifacts, the gaps in the angular coverge cause an elongation of the image point, which can be expressed by a factor q, the resolution ratio, 7s that has 75 R. A. Crowther, D. J. DeRosier, and A. Klug, Proc. R. Soc. London, Ser. A 317, 319 (1970). 76j. Frank and M. Radermaeher, in "Advanced Techniques in Biological Electron Microseopy" (J. K. Koehler, ed.), p. 1. Springer-Verlag, Berlin, Federal Republic of Germany, 1986. 77 M. Radermaeher and W. Hoppe, Proc. Eur. Congr. Electron Microsc., 7th 1, 132 (1980). 78 The original term used for this quantity, elongation factor, will not be used here.
[ 1]
IMAGE PROCESSING OF SINGLE RIBOSOMES IMAGED BY
EM
27
to be applied to the resolution calculated with the formulas given above. The resolution ratios are q~ =
( O + sin 0 cos ~)l/2 -- sin 0 cos
for single-axis tilting
(30a)
and / 3. . . .-. . sin 2 0 \ 1/2 qxz = t 2sin2O )
for conical tilting
(30b)
In a reconstruction from a conical-tilt series only two resolution values have to be considered, namely that given b y Eq. (29b,c) in the plane perpendicular to the cone axis, and a value resulting from application of the factor qxz ofEq. (30b) in the direction of the cone axis (Fig. 6). In a reconstruction from a single-axis tilt series the resolution is different in all three axial directions. If y is the tilt axis and z is the direction perpendicular to the specimen, Eq. (29a) provides the resolution in the x-direction, and this value multipled by the factor q= provides the resolution in the z-direction. The resolution in the direction of the tilt axis is equal to the resolution in the original micrographs, unaffected by other variables. The formulas given above are valid for regular geometries. In a reconstruction from a series of projections with statistical angular distribution, the formulas for the resolution ratios are still valid, and there are still two (in the conical case) or three (in the single-axis case) different resolutions to be distinguished. However, in this situation, the formulas of Eq. (29) may only be used as estimates, by assuming even angular increments that reflect
a
Z
b
~
xis tilting
~
conrcoq tilting
0 I
0
I
i
i
i
i
i
i
~0
20
30
~0
so
60
70
i
80 [deg]
FIG. 6. knisotropy of resolution in the reconstructed object. (a) Approximate appearance of a point spread function (PSF) for conical-tilt geometry. In the z direction, the PSF is elongated by a spread factor whose size depends on the tilt angle O. (b) Resolution ratio as a function of the tilt angle for single-axis and conical tilting. From Radermacher and Hoppe. 77
28
ELECTRON MICROSCOPY
[ 1]
the average spacing. Moreover, Eqs. (29) and (30) furnish theoretical values that do not take into account any sources of limitation other than the number of projections. Additional limitations can be imposed by factors such as the resolution of the micrograph, the accuracy of the angle determination, the precision of the alignment, and the consistency of the particle set. A reliable way to determine the resolution actually achieved is by a phase residual calculation. The set of projections is split arbitrarily into two subsets, and two independent reconstructions are calculated. These are then compared in Fourier space by computing the phase residual, similarly as in 2-D averaging techniques. Such a resolution determination is the most objective measure, as it does not make any assumption about the accuracy of any step in the reconstruction process. R e p r e s e n t a t i o n of R e c o n s t r u c t e d Particles The reconstructed volume is first represented as a series of slices. Most informative are halftone representations with overlayed contours of equal density (Fig. 7a). Representations rendering the 3-D shape of the particle are obtained either by physical model building 79 or by computer-generated "solid" modeling. 8°-s2 In either case, an appropriate density threshold delineating the particle boundary must first be selected. For a negatively stained specimen, the boundary can be distinguished on a contour plot of a slice as a region where the steepest change in reconstructed density occurs 1 (arrow c in Fig. 7a). For solid modeling in the computer, the distance of the surface defined by the density threshold is determined as it appears from a given viewing direction (Fig. 8). The distance values, determined by scanning through the volume, are stored in an array referred to as the z-buffer. The z-buffer, when displayed with inverted contrast, already provides a crude representation of the object's surface, with bright areas representing regions of the object close to the viewer and dark areas representing those farther away. The impression of looking at a solid model is greatly enhanced by the addition of shading based on the information in the z-buffer. Any three adjacent points in the z-buffer define a triangular facet, which forms a certain angle to the viewing direction. The cosine-shading algorithm, 83 which we have found very effective, assigns to each pixel the value of the 79 D. J. DeRosicr and A. Klug, Nature (London) 217, 130 (1968). 8°G. T. Herman and H. K. Liu, Comput. Graph. Image Proc. 9, 1 0979). 81 M. van Heel, Ultramicroscopy U , 307 (1983). 82 M. Radermacher and J. Frank, J. Microsc. 136, 77 (1984). 83 H. Gourard, IEEE Trans. Comput. C-20, 623 (1971).
[ 1]
IMAGE PROCESSING OF SINGLE RIBOSOMES IMAGED BY E M
29
FIG. 7. Three-dimensional reconstructions of the two subunits of the E. coli ribosome, and the choice of threshold used for the solid modeling (scale bars 10 nm). (a-e) 30S subunit at 3 nm resolution as determined from randomly oriented particles (cf. Fig. 5a). From Verschoor et al. H (a) Central section through reconstructed volume. The contour levels marked b, c, d, and e were used as threshold values in the surface representations (b)-(e), respectively. (b-e) Surface representations generated by levels identified in (a). The model (c) is generated by a level that lies midway in the range of steepest slope, and is thought to best approximate the boundary between stain and ribonucleoprotein mass. (f) Surface representations showing different views of the 50S subunit at 3 nm resolution as determined by the single-exposure, random conical-tilt reconstruction method. From Radermacher et al.t3 cosine o f this angle, simulating the a p p e a r a n c e o f a reflective surface. T h e intensities o f the shading are m i x e d with the halftone representation o f the inverted z-buffer for i m p r o v e d d e p t h simulation. T h e best results are o b t a i n e d with a m i x t u r e ratio o f 5 0 : 5 0 (Fig. 7 b - f ) . Software A n u m b e r o f m o d u l a r software systems specialized for electron m i c r o scopic data processing exist t h a t i n c o r p o r a t e m o s t or all o f the algorithms
30
ELECTRON MICROSCOPY R
/~
tz
[1]
R°
0
FI~. 8. Principle of the surface representation algorithm. For a given viewing direction (line originating from observer at 0) a reference plane is constructed (R or R') whose position defines the part of the surface to be represented: in position R, the object is cut by the plane, resulting in the invisibility of a portion $2 of the surface. In position R', the complete surface $1 + $2 will be visualized. The surface is found by scanning the volume leftward from the reference plane until a voxel equal to or larger than the threshold value is encountered. The distance traveled (e.g., tm or te), which is stored in the z-buffer, is used as the basis for the surface representation. From Frank et al. 3 described: SPIDER, s4 developed by our group in Albany, SEMPER, s5 I M A G I C , s6 and EM. $7 (So far, to o u r knowledge, the S E M P E R system lacks the multivariate statistical analysis features.) These packages are characterized by possessing a set o f "basic" c o m m a n d s (such as "Fouriert r a n s f o r m " or " W i n d o w " ) as well as high-level language elements enabling conditional j u m p s , register operations, iterative execution o f p r o g r a m sections, procedure definitions, a n d hierarchical calling. A complex task such as a 3-D reconstruction o f biological particles f r o m micrographs involves a large n u m b e r o f separate processing steps. T o give an example, the case o f the reconstruction f r o m a r a n d o m conical projection set ~2,13 involves 26 such steps, which are listed below. These are either realized as interactive operations (I), single c o m m a n d s (S), or procedures (P) containing a n u m b e r o f single c o m m a n d s : (P)
1. Reduce digitized micrographs (of tilted and untilted specimen) to display size s4 j. Frank, B. Shimkin, and H. Dowse, Ultramicroscopy6, 343 (1981). s5 W. O. Saxton, T. J. Pitt, and M. Homer, Ultramicroscopy4, 343 (1979). s6 M. van Heel and W. Keegstra, Ultramicroscopy 7, 113 (1981). s7 R. Hegefl and A. Althauer, Ultramicroscopy 9, 109 (1982).
[ 1]
IMAGE PROCESSING OF SINGLE RIBOSOMES IMAGED BY
(I) (I) (P) (P) (P) (P) (P)
2. 3. 4. 5. 6. 7. 8.
(P) (S) (P)
9. 10. 11.
(P)
12.
(P)
13.
(P) (P)
14. 15.
(P)
16.
(P)
17.
(S)
18.
(S)
19.
(S) 20. (S) 21. (S) 22. (S) 23. (P) 24. (P) 25. (P) 26.
EM
31
Window particles from reduced micrographs Window background areas for contrast normalization Determine contrast scaling parameters Window particles from original micrograph Center particles Prepare 0 ° alignment reference Perform rotational/translational alignment, store rotation angles Average aligned 0 ° particle images Prepare new reference from average Perform rotational/translational alignment, store sum of angles from steps 8 and 11 Average aligned 0 ° particle images to obtain two subaverages + total average Determine cross-resolution from the two subaverages using phase residual analysis Center tilted particle images Translationally align tilted particle images (repeat several times) Transfer angles from rotational alignment of the untilted particles into headers of files containing tilted particle images Split tilted particle set into two sets (#1 and #2), interlaced according to azimuthal angles Apply Fourier weighting function to set #1 of tilted particle images Apply Fourier weighting function to set #2 of tilted particle images Apply Fourier weighting function to complete set of tilted particle images Back-project weighted set #1 resulting in reconstruction #1 Back-project weighted set #2 resulting in reconstruction #2 Back-project weighted complete set resulting in reconstruction #3 Determine cross-resolution between reconstructions #1 and #2 using phase residual analysis Filter reconstruction #3 to resolution determined in step 24 Create representations of the reconstructions (slice by slice, surface, etc.)
Each of the processing steps marked as a procedure contains a number of operations performed by single commands. As an example for the opera-
32
ELECTRON MICROSCOPY
[1]
tions contained within a procedure, we describe the actions performed by the centering procedure listed as step 6 above. This procedure, named QCUCENT in the SPIDER system, centers each particle of a 0 ° projection set of particles by cross-correlation with a blurred version of a disk. At the same time, the procedure creates a series of small control files that are used to check the performance of the procedure and for documentation. A selection list that contains flags indicating "good" or "bad" particles controls the actions of QCUCENT; for "bad" particles, the procedure merely produces a blank control output file. (beginning of the procedure) Get input data: (name of the image set (first image number in image set (last image number (selection list (name to be given to control output images (32 X 32) (name to be given to output images (name to be given to document file receiving shift parameters (radius of circular disk (contrast polarity of images [dark particles on bright background ( - 1) or opposite (+ 1)] Create blank image of size 32 × 32 Create image of circular disk Scale image of disk to positive or negative contrast Low-pass filter disk (loop over all images): Look in selection list if image is to be used (if no): Copy blank image into control output file with current image number control output image (if yes): Mask image with smooth circular mask (Gaussian falloff) Cross-correlate image with blurred circular disk Determine center of gravity of cross-correlation peak Shift image by offset of CCF peak to CCF center ---}output image Store resulting shift vector ---, document file Reduce centered image to a size of 32 X 32 Contrast-enhance reduced centered image ~ control output image (end of procedure)
[1]
IMAGE PROCESSING OF SINGLE RIBOSOMES IMAGED BY
EM
33
Fortran programs for correspondence analysis have been published by Lebart et al. ss,ss Of particular interest in our application are programs that perform the stochastic approximation developed by Lebart et al. for large
data matrices. 5s The programs implementing the method of clustering about moving centers, Diday's method of finding stable clusters, as well as hierarchical ascendant classification are also found in Ref. 88. However, it should be noted that these programs were developed for general purposes, and that a major effort is needed to interface these with image-processing software. Extension of M e t h o d s - - Future Prospects The field of application of the techniques described above is not limited to separate reconstructions of the various ribosomal panicles. For instance, one purpose of 2-D comparisons of structures of different ribosomal particles has been the attempt to correlate morphologically conserved or nonconserved features among prokaryotic and eukaryotic, and more recently archaebacterial, ribosomes,s9 Clearly, future attempts at interkingdom comparisons must be based on quantitative comparisons of 3-D reconstructed (and aligned in three dimensions) subunits and monosomes from organisms from the various phyla. It may be possible to assess gains or losses of ribonucleoprotein mass in specific areas (e.g., the "lobes" of the small subunit), if (1) the particles are reconstructed from demonstrably analogous views (with analogous direction of collapse or flattening, if any), and (2) the species chosen for reconstruction have ribosomal subunits demonstrably representative for their kingdoms. From the latter requirement, given the considerable size and shape variations of the eukaryotic 60S subunit (and thus the 80S monosome), it is obvious that the variations within a kingdom must be assessed quantitatively before interkingdom comparisons can be attempted. In addition to this goal of obtaining parallel reconstructions of the various ribosomal particles, a potentially much more important application involves localizations of functional domains, mappings of individual r-proteins and portions of rRNA, and ligand-binding sites, in other words, 3-D immunoelectron microscopy (IEM). Formerly, the only 3-D information on localization of a bound antibody came from micrographs in which the site could be recognized on two or more different views whose approxis8 L. Lebart, A. Morineau, and N. Tabard, "Techniques de la Description Statistique." Dunod, Paris, 1977. s9 j. A. Lake, Prog. Nucleic Acid Res. Mol. Biol. 30, 163 (1983).
34
ELECTRON MICROSCOPY
[ 1]
mate relationship was known (e.g., the crudely orthogonal crown and kidney views of the 50S subunit). Discounting the possibility that antibody and ribosomal particle are partially overlapped in projection, the investigator mapped his best guess of the site onto the surface of his visually derived model, thus compounding the error in assignment. The 3-D implementation of IEM, for which a monospecific ligand is essential, could exploit labeled particles in a single well-defined view to enable determination in three dimensions of the site of the label. Around this site would appear a blur representing the free end of the Fab fragment of the IgG (or other ligand) in all of its possible orientations, but the increase in density at the actual binding site should be significant.9° In addition to indirect labeling by means of an antibody, direct localization of certain sites in three dimensions should become feasible. Localization of the P site on the 30S subunit, performed through cross-linking of a tRNA to the 16S rRNA, has been attempted in two dimensions through averaging and statistical evaluation of difference maps (Wagenknecht et al., unpublished observations), but unfortunately the 30S subunit has proved a particularly ditficult subject for 3-D investigation. It may be feasible to determine the binding sites of the initiation and elongation factors in three dimensions, once means are devised for producing stable complexes of the necessary ribosomal and nonribosomal components. Although the effect expended in such a reconstruction would be considerable, these methods appear to be the most promising approach presently available. The possibility of cocrystallizing particle and ligand exists, but for many complexes this may never be feasible. One additional development may enable a determination of the closeto-native structure of a ribosomal particle. Frozen-hydrated electron microscopy91'92'93 obviates both the use of a negative stain (with its denaturing effects) and the need for air drying (leading to some degree of collapse of the particle). Because images of ice-embedded specimens have low contrast and signal-to-noise ratio, the methods for 2-D averaging and 3-D reconstruction described above will require modification to increase their sensitivity, particularly at the crucial stages of particle alignment, before they can be successfully applied to this type of data. Nevertheless, the extra effort required to record and analyze low-dose ice images should prove justified, both by providing a standard against which the degree of preser9o See J. Frank, P.-Y. Sizaret, A. Verschoor, and J. Lamy, Proc. Annu. Meet. Electron Microsc. Soc. Am., 41st p. 282 (1983). 9~ K. A. Taylor and R. M. Glaeser, Science 186, 1036 (1974). 92 M. Adrian, J. Dubochet, J. Lepault, and A. D. McDowall, Nature (London) 308, 32 (1984). 93 T. Wagenknecht, R. Grassucci, and J. Frank, J. Mol. Biol. 199, 137 (1988).
[2]
IMAGE ANALYSIS OF RIBOSOMAL SUBUNITS
35
vation of particles from negatively stained preparations can be assessed and also by revealing for the first time the structure of the native ribosomal particle as it is investigated by other, non-EM techniques. Acknowledgments This work was supported, in part, by a grant of the National Instituteof Health 1RO1 GM 29169 and a sharedinstrumentationgrant of the National ScienceFoundation831345.
[2] S t a t i s t i c a l I m a g e A n a l y s i s o f E l e c t r o n M i c r o g r a p h s Ribosomal Subunits B y G E O R G E H A R A U Z , E G B E R T BOEKEMA,
of
and M A R I N VAN H E E L
Electron microscopy in combination with computer-image analysis represents a very direct method for determining the structure of biological macromolecules. Crystallographic techniques allow the determination of structure to higher resolution; however, for large macromolecular assemblies such as ribosomes, sufficiently large and perfect crystals are extremely difficult to obtain. Thus, electron microscopy of individual biological macromolecules has been developing as an alternative or complement to the traditional crystallographic approaches. Ribosomal structure has been extensively probed by electron microscopy. ~-7 However, since electron images are very noisy, agreement on even low-resolution models of ribosome structure has been slow in developing, s The visual interpretation of micrographs is a subjective process that varies from observer to observer, especially concerning those details at the limits of the attainable resolution. Our research has focused on establishing a precise methodology based on computerized image analysis and pattern recognition to enhance the visibility of statistically signifi-
H. G. Wittmann, Annu. Rev. Biochem. 52, 35 (1983). 2 G. St6ffier and M. St6fller-Meilicke, Annu. Rev. Biophys. Bioeng. 13, 303 (1984). 3 V. D. Vasiliev, O. M. Selivanova, and S. N. Ryazantsev, J. Mol. Biol. 1711, 561 (1983). 4 A. P. Korn, D. Elson, and P. Spitnik-Elson, Eur. J. CellBiol. 31, 325 (1983). 5 N. A. Kiselev, E. V. Orlova, V. Ya. Stel'mashchuk, V. D. Vasiliev, O. M. Selivanova, V. P. Kosykh, A. I. Pustovskikh, and V. S. Kirichuk, J. Mol. Biol. 169, 345 (1983). 6 j. Lake, J. Mol. Biol. 161, 89 (1982). 7 j. Lake, J. Mol. Biol. 105, 131 (1976). s O. Meisenberger, I. Pilz, M. St6fller-Meilicke, and G. St6ffier, Biochim. Biophys. Acta 781, 225 (1984).
METHODS IN ENZYMOLOGY, VOL. 164
Copyright© 1988by AcademicPress,Inc. All rightsof reproductionin any formreserved.
[2]
IMAGE ANALYSIS OF RIBOSOMAL SUBUNITS
35
vation of particles from negatively stained preparations can be assessed and also by revealing for the first time the structure of the native ribosomal particle as it is investigated by other, non-EM techniques. Acknowledgments This work was supported, in part, by a grant of the National Instituteof Health 1RO1 GM 29169 and a sharedinstrumentationgrant of the National ScienceFoundation831345.
[2] S t a t i s t i c a l I m a g e A n a l y s i s o f E l e c t r o n M i c r o g r a p h s Ribosomal Subunits B y G E O R G E H A R A U Z , E G B E R T BOEKEMA,
of
and M A R I N VAN H E E L
Electron microscopy in combination with computer-image analysis represents a very direct method for determining the structure of biological macromolecules. Crystallographic techniques allow the determination of structure to higher resolution; however, for large macromolecular assemblies such as ribosomes, sufficiently large and perfect crystals are extremely difficult to obtain. Thus, electron microscopy of individual biological macromolecules has been developing as an alternative or complement to the traditional crystallographic approaches. Ribosomal structure has been extensively probed by electron microscopy. ~-7 However, since electron images are very noisy, agreement on even low-resolution models of ribosome structure has been slow in developing, s The visual interpretation of micrographs is a subjective process that varies from observer to observer, especially concerning those details at the limits of the attainable resolution. Our research has focused on establishing a precise methodology based on computerized image analysis and pattern recognition to enhance the visibility of statistically signifi-
H. G. Wittmann, Annu. Rev. Biochem. 52, 35 (1983). 2 G. St6ffier and M. St6fller-Meilicke, Annu. Rev. Biophys. Bioeng. 13, 303 (1984). 3 V. D. Vasiliev, O. M. Selivanova, and S. N. Ryazantsev, J. Mol. Biol. 1711, 561 (1983). 4 A. P. Korn, D. Elson, and P. Spitnik-Elson, Eur. J. CellBiol. 31, 325 (1983). 5 N. A. Kiselev, E. V. Orlova, V. Ya. Stel'mashchuk, V. D. Vasiliev, O. M. Selivanova, V. P. Kosykh, A. I. Pustovskikh, and V. S. Kirichuk, J. Mol. Biol. 169, 345 (1983). 6 j. Lake, J. Mol. Biol. 161, 89 (1982). 7 j. Lake, J. Mol. Biol. 105, 131 (1976). s O. Meisenberger, I. Pilz, M. St6fller-Meilicke, and G. St6ffier, Biochim. Biophys. Acta 781, 225 (1984).
METHODS IN ENZYMOLOGY, VOL. 164
Copyright© 1988by AcademicPress,Inc. All rightsof reproductionin any formreserved.
36
ELECTRON MICROSCOPY
[2]
cant structural features in electron images of isolated biological macromolecules,9,~°thereby pushing back the frontier of argumentability. Improving the Signal-to-Noise Ratio of Electron Micrographs Electron micrographs of macromolecules are noisy due to a number of factors: (1) Biological specimens are extremely sensitive to bombardment by electrons. Radiation-induced structural alterations include evaporation of light atoms, translocation of atoms, and ultimately disintegration. (2) Images are formed by electrons impinging on a photographic emulsion. This "electron counting" process is essentially a Poisson statistical one, with the associated uncertainty being the sqfiare root of the number of quanta detected. (3) Heavy atom salts (e.g., uranyl acetate) are commonly used to provide image contrast by negative staining, but .the random distribution of stain and the formation of stain crystallites during electron exposure is yet another source of noise. It is impossible in any experimental situation to eliminate all noise factors at once. Low-dose electron microscopy preserves the specimen, but the recorded images are very noisy since fewer electrons are used to form them. With increasing electron doses, radiation damage increases significantly. Sophisticated techniques such as cryoelectron microscopy can only reduce the rate of destruction by a factor of no more than 10, and also give images with low contrast which are not easily interpreted. Alternative methods of specimen preparation which do not require negative stain, e.g., glucose embedding, also result in low-contrast images. Thus, even under the best possible conditions, the signal-to-noise ratio of electron micrographs will be poor. An improvement of the signal-to-noise ratio of electron images can be achieved by a posteriori image processing. The restoration of noise-degraded images is a topic that has received much attention in many fields.l~ In electron microscopy, the conceptually simplest and most suitable approach to image improvement is that of image averaging. 5,~2-16In a set of many noisy images of an object, the noise at any position varies from 9 M. van Heel and J. Frank, Ultramicroscopy 6, 187 (1981). ~oM. van Heel, Ultramicroscopy 13, 165 (1984). i~ W. K. Pratt, "Digital Image Processing" Wiley, New York, 1978. ~2D. L. Misell, "Image Analysis, Enhancement, and Interpretation," North-Holland, Amsterdam, 1978. 13p. N. T. Unwin and R. Henderson, J. Mol. Biol. 94, 425 (1975). 14j. Frank, W. Goldfarb, D. Eisenberg, and T. S. Baker, Ultramicroscopy 3, 283 (1978). ~5j. Frank, A. Verschoor, and M. Boublik, Science 214, 1353 (1981). ~6M. van Heel and M. St0fller-Meilicke, EMBOJ. 4, 2389 (1985).
[2]
IMAGE ANALYSIS OF RIBOSOMAL SUBUNITS
37
FIG. 1. Electron micrograph of 50S ribosomal subunits.
image to image, but the desired feature information is the same. By averaging together these noisy images, the reproducible signal is enhanced with respect to the random background noise. In analyzing electron micrographs of isolated biological macromolecules (Fig. 1), there are two problems concerning particle orientation which must first be overcome, since we can only obtain meaningful averages of images that are very similar. First of all, individual particles lie at all angles and positions on the specimen support film and must first be brought into register both rotationally and translationally. Second, biological macromolecules may assume more than one stable position on the support, thus providing essentially different projections through the object. The analysis of mixed populations of images requires the use of multivariate statistical
38
ELECTRON MICROSCOPY
[9.]
analysis and classification techniques. 9,~°,~6 In this chapter, we shall describe the stepwise application of these powerful image-processing tools to electron micrographs of the 50S ribosomal subunit of Escherichia coli. Data Preparation Isolated 50S subunits were prepared for electron microscopy on a single-layer carbon film by the method of Valentine and negatively contrasted with 1% uranyl acetate. ~7Electron micrographs used in this chapter were taken on a Philips EM 400 at an instrumental magnification of 60,000 and an accelerating voltage of 100 kV. Each specimen area was not preilluminated prior to being micrographed, to minimize the total electron dose. The electron micrographs were digitized using a Datacopy (Datacopy Corporation, Mountain View, CA) digitizing camera, controlled by an IBM personal computer. This process renders the information on the film into a form suitable for manipulation by a computer. Typically, entire micrographs were digitized in 1728 X 2240 picture elements (pixels). The scanning step (pixel size) was 32/zm, and so each pixel corresponds to a square area of 0.53 nm size at the object level. The digitized data were copied to a VAX 11/780 computer (Digital Equipment Corporation) via magnetic tape. There, analyses of digitized images were performed in the framework of the IMAGIC image processing system, ~8 which is a general purpose, interactive, and user-oriented image analysis software package. Selection and P r e t r e a t m e n t of Molecular Projections A typical electron micrograph is shown in Fig. 1. All distinct particles that were not overlapping or in close contact with other particles were selected interactively from each digitized micrograph using a raster-scan image display system in conjunction with a joystick-controlled cursor. ~8At least a few hundred individual molecules must be selected to achieve statistical significance of the results. In this instance, a total of 1956 images were obtained from 15 micrographs. Although at present we do the particle selection interactively, larger populations of molecules can be handled using automated particle selection algorithms. 19,2°At this stage, each indi17 R.C. Valentine, B. M. Shapiro, and E. R. Stadmann, Biochemistry7, 2143 (1968). t8 M. van Heel and W. Keegstra, Ultramicroscopy7, 113 (198 l). t9 M. van Heel, Ultramicroscopy8, 331 (1982). 2o j. Frank and T. Wagenknecht, Ultramicroscopy 12, 169 (1984).
[2]
IMAGE ANALYSIS OF RIBOSOMAL SUBUNITS
39
vidual macromolecule and its immediate background are represented as a square array of n × n numbers; n is 72 in this example, but generally n ranges from 48 to 96, depending on the size of the object and the desired resolution. The many single molecular images must be pretreated by band-pass filtering to suppress the very low and very high spatial frequencies. The very high spatial frequencies represent mostly noise and their contribution can thus be weighted down at this early stage. The very low spatial frequencies also represent unwanted information, e.g., gradual fluctuations in the average densities which depend largely on the amount and uniformity of specimen staining. The frequency limits of band-pass filtering generally vary from specimen to specimen. For our ribosome images, we have determined empirically that a low frequency cutoff of about 13 nm and a high-frequency cutoff of about 1.3 nm are reasonable. Moreover, the lowfrequency components (but not the high) are set to a fraction of their original values (typically 1.5%) so that they can be easily restored at a later stage if needed. After band-pass filtering to enhance only the important structural information, the particles are surrounded by a circular mask to cut away unnecessary background. Finally, the images are standardized by (1) "floating" within this mask to a zero average density, and by (2) multiplication of each pixel by a factor (different for each image) to normalize the variance.16 Alignment of Images within the Plane Isolated macromolecules exhibit a full range of rotational orientations in the plane of the support film. Furthermore, the particle is not yet precisely centered in its image, and a translation in the plane is also required to bring all particles into register. To achieve this registration, we use a computerized alignment algorithm (Fig. 2) based on the use of cross-correlation functions. 2~-23 The alignment process requires first the selection of a reference image with respect to which all other molecular images will be aligned. In the case of the 50S ribosomal subunit, the predominant projection view in electron micrographs is the "crown" view; to a much lesser extent, a "kidney" view is exhibited. Therefore, we choose as an initial reference a well-preserved, 21 W. O. Saxton and J. Frank, Ultramicroscopy 2, 219 (1977). 22 j. Frank, in "Computer Processing of Electron Microscope Images" (P. W. Hawkes, ed.), p. 187. Springer-Verlag~ Berlin, Federal Republic of Germany, 1980. 23 M. Steinkelberg and H. J. Schramm, Hoppe-Seyler's Z. Physiol. Chem. 361, 1363 (1980).
40
EL1RCTRONMICROSCOPY
/• /I
[9.]
REFERENCE~~m~m~m~m~m~m~m~m
IMAGE
<~l.
[ <,'~oo;. I I
"6,,-',o 0 m ~ ~ ~ 3 6 o RCF
ROT.ALIGNED
/
i
FT2D
-~ shift I'~
REFERENCE I~,
!I FT2D1
f
ALIGNED
IMAGE
S
FIG. 2. Schematic of single particle alignment process. Cyl. coos, cylindrical coordinates; FTm, FTm, Fourier transform, one-dimensional, two-dimensional; RCF, rotational correlation function; rot. align., rotational alignment; transl., translational; CCF, cross-correlation function.
canonical crown view (Fig. 3a). The particle is centered within the image, masked by interactive contouring ~8 (Fig. 3b) and thresholded within the mask (Fig. 3c) to reduce the effects of any remaining background and of negative stain within the particle. Rotational alignment between a molecular image and the chosen reference image is achieved by searching for a maximum in the rotational correlation function (RCF). The image and reference are both converted from their usual representation in Cartesian coordinates to one in cylindrical coordinates, and the cylindrical images are then Fourier transformed in
[2]
41
IMAGE ANALYSIS OF RIBOSOMAL SUBUNITS
a
i?
iilii~
~ !!ii!iii
i:!!i i~!ii!iiii ¸~¸
b
c
~!
d
FIG. 3. (a) A single noisy image selected as the initial reference. Dark areas represent stain, while light areas represent protein (or absence of stain). (b) The image in (a) contoured to reduce the effectof the remaining background. (c) The image in (b) thresholded within the contour to reduce the effectof negative stain within the particle. The fight areas remaining represent predominantly structural information. (d) An intermediate sum of the 20 images which correlate best with the image in (c); used as a new referencein another alignment in order to refine further alignment parameters. the tangential direction. The resulting series of one-dimensional Fourier transforms are conjugate multiplied with each other, and the RCF is obtained by integrating the inverse Fourier transform of this product over the radial coordinate. The molecular image is rotated by the angle 0 at which the RCF function is found to have its maximum. Following the rotational alignment, translational alignment is performed by searching for the position of the maximum in the cross-correlation function (CCF). The rotated molecular image and the reference image are Fourier transformed, and the two-dimensional Fourier transforms are conjugate multiplied by each other. The CCF is obtained from this product by inverse Fourier transforming. The rotated molecular image is shifted by ( - A x, - A y) to the position of maximum translational overlap. The value of this peak overlap is called the cross-correlation coefficient (CCC). The sequence of rotational and translational alignment is normally repeated once more to refine the rotation angle and shift parameters. 23 When the entire data set has been aligned with respect to the initial noisy reference, a smaller set of 20 or so molecular images is selected on the basis of the cross-correlation peak height, i.e., those molecules most similar to the reference after alignment. These selected images are then averaged together to give a better, less noisy reference (Fig. 3d), and the double alignment process is repeated again with the original images and using this new reference. R e f i n e m e n t of Alignments This method of aligning images is very sensitive and can deal with noisy images in which the motif may be even more obscured than in Fig. 3a. 2~,23
42
ELECTRON MICROSCOPY
[2]
As with any computational tool, though, it must be carefully applied. For example, the form of band-pass filtering of the data has a strong effect on the success of the alignment. If the alignment is not good, a refinement of the band-pass filter parameters is indicated. The most important factor affecting the results of an alignment is the choice of reference image. Here, a distinct crown view has been chosen as an initial reference. Since this reference still contains noise, repeating the alignments with "better" references will bring the images into better positions relative to each other. A second reference is therefore made from the average of the 20 or so images that correlate best with this first reference. Clearly, these images will "look like" each other, as will the average. Since we have a great deal of a priori knowledge of the low-resolution structure of the ribosome, we have a good idea of the sort of structure we expect to see in the end. However, with a macromolecule of initially unknown structure, it is not clear which projection view is most suitable as an initial reference image and we are faced with a "bootstrapping" problem which can only be solved iteratively. We shall return to this point in the discussion on multireference alignment. Multivariate Statistical Analysis of Mixed Populations For flat, disklike molecules such as glutamine synthetase ~4(glutamateammonia ligase), the two-dimensional alignment process is sufficient to analyze the entire population, since all molecular images have now been brought into a similar orientation. However, most molecules present more than one projection, and thus some means must be developed to determine and extract the predominant and characteristic views. Multivariate statistical analysis techniques are powerful tools for dealing with mixed populations of macromolecular images. 9,16,24-28 In particular, correspondence analysis (a special form of principal components analysis) is used to extract relevant information from the mixed data set. Each image of n × n pixels can be thought of as representing a point in n X n dimensional space, and the entire set of images forms a cloud in this space. Correspondence analysis determines a new, rotated coordinate system in which the first axis represents the direction of greatest interimage variance, the second axis the direction of largest remaining interimage variance, and 24 j. Frank, A. Verschoor, and M. Boublik, J. Mol. Biol. 161, 107 (1982). 25 j. Frank and M. van Heel, J. Mol. Biol. 161, 134 (1982). 26 M. M. C. Bijlholt, M. van Heel, and E. F. J. van Bruggcn, J. Mol. Biol. 161, 139 (1982). 27 j. Frank and A. Vcrschoor, J. Mol. Biol. 178, 696 (1984). 2s A. Verschoor, J. Frank, and M. Boublik, J. UItrastruct. Res. 92, 180 (1985).
[2]
IMAGE ANALYSIS OF RIBOSOMAL SUBUNITS
43
so on. The cloud of images can now be described with respect to this new coordinate system. More precisely, each of the aligned images can be expressed as a linear combination of the predominant, independent eigenimages extracted from the set (Fig. 4a). The first eigenimage (with chisquared metrics) points at the center of mass of the full data set. Subsequent eigenimages describe decreasing amounts of the interimage variance
Fro. 4. (a) The data set of 1956 aligned images is decomposed by correspondence analysis into eigenimages which represent the principal components of interimage variation. The first eigenimage points to the center of mass of the full data set. The second, third, fourth, and fifth eigenimages describe 6.2, 4.9, 1.9, 1.7, and 1.4% of the total interimage variance, respectively, whereas the twenty-fourth eigenimage describes only 0.8%. All 24 eigenimages account for 34.2% of the total interimage variance. (b) Binary mask generated from the total sum of 1956 aligned images, defining the image area active in correspondence analysis. The total sum is a blurry image which indicates those regions within the image area within which the pixels belong (usually) to the molecule and not to negative stain or carbon support film.
44
ELECTRON MICROSCOPY
[2]
of the data set, and in our case soon represent predominantly noise. By disregarding these higher order components, and only considering the significant ones (typically of the order of 6 to 24), the images can be considered as points in a much smaller (than n × n) dimensional space. We have thus achieved a very large reduction in the amount of data to be analyzed as well as a significant amelioration of the effect of noise. The eigenimages of Fig. 4a can often be interpreted in terms of structural features that they describe. The lower order eigenimages typically comprise lower spatial frequency information than the higher order ones. The first eigenimage points to the overall average of the full data set. Eigenimage 2 describes predominantly the shape difference between crown and kidney views, while eigenimage 3 represents internal density modulations. Eigenimage 4 has strong density in the region of the L7/L12 stalk, indicating presence or absence of the stalk. Eigenimage 5 seems to show that the stalk can move up and down. Before performing correspondence analysis, the aligned images must first be pretreated to mask off image areas not representing relevant structural information. 26,27 In other words, we want to compare only those image areas in which the 50S subunit usually lies, and not the surrounding negative stain in which it is embedded. To do this, a mask is formed from the sum of all of the aligned molecules. The region of interest is contoured interactively using a display program, ~8 and a mask image is generated containing l s inside the contour and 0s outside it (Fig. 4b). This mask defines those pixels which are active during correspondence analysis, and which ultimately contribute to the classification statistics. Classification The data compression achieved by correspondence analysis in turn facilitates the grouping together of those images that are most similar, despite the high noise present in them. In our example, each image of 72 × 72 pixels is at this stage represented by only 24 components rather than 5184. We use an automatic hierarchical classification algorithm 1° in which similar images are initially merged together to form classes; these are themselves grouped further together to form larger and larger classes until finally one class containing all of the images is obtained. The classification procedure is usually stopped, however, when a predetermined number of classes (typically from 30 to 60) is obtained. (The number of final classes is chosen so that each class contains of the order of 30 to 40 members.) This partitioning is indicated with the 50S subunit because this particle assumes a relatively small number of positions on the support film, and we would like to find these positions regardless of their relative occurrence. 1°
[2]
IMAGE ANALYSIS OF RIBOSOMAL SUBUNITS
45
During the classification, about 15% of the aligned population is initially rejected (on the basis of their large variance contribution) as representing either misaligned molecules or uncharacteristic images which appear rarely. There are also some "bad" classes which have a high internal variance; either they have few members, or their members are poorly aligned. These classes, too, are discarded. Of most interest in subsequent analyses are the "good" classes, composed of images which are most similar to each other. The aligned images in each class are summed together to give an "average" image with an enhanced signal-to-noise ratio. In these sums, sources of random noise such as variations in the stain distribution around the molecules, radiation-induced structural alterations, and variations in the background carbon support film are averaged out and become less significant compared to the common signal. The class averages thus represent the most commonly occurring projection views with high statistical significance, and indicate directions which we must explore further. In our example of the E. coli 50S subunit, the two-dimensional map of factorial coordinate 2 versus coordinate 3 (Fig. 5) suggests a rough decomposition of the data set into three major groups. Individual class sums representative of each group are shown in Fig. 6. We interpret these as representing different projections of the subunit: two types of crown views and one type of kidney view. One of the differences between the two crown views is the form of the the bulge on the right-hand side of the particle (the L 1 protuberance). This is already a significant result, since previously we were not able to distinguish these subtle differences in the original noisy images. However, the map also indicates that there may be a continuous transition between these extremes, and the hierarchical ascendant classification algorithm elucidated some other minor class averages in addition to the major ones. By this stage, we have some knowledge of the extent and type of heterogeneity in the input data.
Multireference Alignment In the next step of the analysis, a number of class averages (generally from 2 to 12, but 8 in this example) from the data set are selected and used as references, along with their mirror views, in a new set of alignments. These new references are less noisy than the original ones, and this results in a better alignment. Moreover, the new references represent trends in the data set which we want to explore. These trends are due to interparticle variability in specific structural features as well as to the different positions of the macromolecule on the support film. Mirroring the references elimi-
46
ELECTRON MICROSCOPY
.. • .
-..-'.':':.:-.'-t- :..
~.¢',~
" "a-.'.~
.: "
[2]
*-
...~l-!..~1~
.
-$,'
.... - . . ~ . ~ , ~ , ~ . ~ ~ "~Y'G':
•
•
•
•"
~.,g~.i-"/',
i .. ...
..
-.
•
": d: f-.
•
•
"•...":'"
•
"
•#t
.'"
"
•
"
• •
...
..
.~f.
;.
°
"
•
°
°
•
-.
,~,
,b
•
.°
j.-. -.
•
-.s,
"
•
.-
-."
.
.
•
... "..c. ~
-:..~.~..-".;-
:...
::.-,•
$,--,:
.
. . . . •
Fio. 5. Correspondence analysis map of factorial coordinates 3 (vertical axis) versus 2 (horizontal axis). Each image is represented as a dot, and the entire population forms a cloud. There are two major subpopulations, blending into a more diffuse third group.
nates bias in the alignment: the particle usually has only one preferred face of attachment to the support, but may occasionally lie on its other side• In multireference alignment, each macromolecular image is aligned with respect to e a c h new reference in turn. The CCC is a measure both of the goodness of alignment and of the noisy macromolecule's similarity to
FIG. 6. Classes representative of the three groups seen on the correspondence analysis map.
[2]
IMAGE ANALYSIS OF RIBOSOMAL SUBUNITS
47
the particular reference. The alignment parameters giving the highest CCC are the ones finally used to rotate and shift this particular image. The final data set is now better aligned because the reference images are less noisy and are also varied, consistent with the heterogeneity of the input images. The newly aligned data set can now undergo correspondence analysis and classification again. The class sums obtained after this refinement step are the ones finally studied in detail. Figure 7 shows some of the final class sums of the 50S subunit, selected
F16, 7. Partitioning of the population of 1956 images into classes; those with a low intraclass variance are selected for final analysis. The two crown views (a and b) are predominant (forming about two-thirds of the classes). The remaining classes appear to be views intermediate between the crown and kidney (c-g). In the final two crown classes (h and i), the L7/L12 stalk lies in different positions, spanning a distance of over 2 nm.
48
ELECTRON MICROSCOPY
[9.]
on the basis of low intraclass variance and representing the varied characteristic views of the 50S subunit in this population. Previous studies based solely on visual interpretation have defined only two main views, namely, crown and kidney. Our statistical analysis of a large number of particles shows that more views may exist in this electron microscopical preparation. The two types of crown views are the most commonly occurring (about two-thirds of the population), but to a lesser extent we also have kidney views and other views of the subunit appearing to lie in slightly different positions on the support film. The series of seven class sums (Fig. 7a-g) show the 50S subunit apparently rotating from the crown to the kidney view; the LT/L12 stalk gradually becomes weaker in density and eventually disappears, while the L 1 protuberance (on the right-hand side) and the notch between it and the central protuberance become progressively more pronounced. Interestingly, there are no pairs of classes which are mirror views of each other. The sensitivity of correspondence analysis is exemplified by the subtle difference between two crown class averages (Fig. 7h and i) which differ only in the position of the flexible LT/L12 stalk. This flexibility, as well as the variability of the Ll protuberance, have been subjects of previous and independent studies6,7,28and are important to keep in mind when attempting to understand the three-dimensional structure of the 50S subunit. At this stage, however, the computational work is over and we must now revert to our own (human) interpretational abilities to decide whether interclass differences are due to flexibility of structural features or to different positions of the macromolecule on the support film. A more detailed biological analysis will thus appear elsewhere. Visually, the quality of the class averages is much better than of the original images. Objectively, the reproducible resolution between two pairs of similar classes is typically 2.2 to 2.4 nm, determined by the Fourier ring correlation method. 16 Between any two original images of a class, the reproducible resolution is about 6 nm, indicating the significant improvement achieved by image averaging. Concluding Remarks The information content of electron micrographs can be enhanced significantly by a posteriori image processing. We have described and demonstrated powerful techniques for analyzing noisy electron images of isolated macromolecules. The fundamental principle underlying each step of the analysis is the reduction of the effect of noise, whether by band-pass filtering, principal components analysis, or averaging similar images to provide better references for alignment. This approach has allowed us to
[3]
STRUCTURAL ANALYSIS OF RIBOSOMES
49
determine objectively both flexibility of certain structural features and the potential existence of numerous distinct projection views in normal electron microscopical preparations of the E. coli 50S ribosomal subunit. With direct three-dimensional reconstruction techniques, 29-33 these projections can be used to obtain the three-dimensional structure of the subunit. • Acknowledgments We thank Professor H. G. Wittmann and Mr. H. Gewitz of the Max-Planck-Institut for Molecular Genetics for the 50S ribosomal subunits, and Professor E. Zeitler for comments on the manuscript. George Hamuz was the recipient of a Postdoctoral Fellowship from the Medical Research Council of Canada. 29 G. Harauz and F. P. Ottensmeyer, Ultramicroscopy 12, 309 (1984). 3o A. Verschoor, J. Frank, M. Radermacher, T. Wagenknecht, and M. Boublik, J. Mol. Biol. 178, 677 (1984). 31 G. Harauz and M. van Heel, in "Pattern Recognition in Practice" (E. S. Gelsema and L. N. Kanal, eds.), Vol. 2, p. 279. North-Holland, Amsterdam, 1986. 32 G. Harauz and M. van Heel, Optik 73, 146 (1986). 33 M. van Heel, Ultramicroscopy 21, 111 (1987).
[3] S t r u c t u r a l A n a l y s i s o f R i b o s o m e s b y S c a n n i n g Transmission Electron Microscopy B y MILOSLAV BOUBLiK, G E R R I T T. OOSTERGETEL, VALSAN M A N D I Y A N , JAMES F. H A I N F E L D , a n d JOSEPH S. W A L L
The potential of high-resolution transmission electron microscopy (TEM) for the determination of the morphology of ribosomes and topographical mapping of their components and functional sites has been demonstrated elsewhere in this volume [4]. This chapter focuses on those features of dark-field scanning transmission electron microscopy (STEM) which make this technique uniquely suited to the quantitative structural analysis of ribosomes and other sensitive biological specimens.l The major advantage of the dedicated STEM is the separation of the components that affect resolution and contrast (Fig. 1). The probe-forming components (field emission gun, condenser lens, aperture, deflection coils, and objective lens) are all above the specimen, leaving the space below the specimen free for optimization of detectors (annular detectors for elastic scattering, J. S. Wall, in "Introduction~o Analytical Electron Microscopy" (J. J. Hren, J. I. Goldstein, and D. C. Joy, eds.), pp. 333-342. Plenum, New York, 1979.
METHODS IN ENZYMOLOGY,VOL. 164
Copyright© 1988by AcademicPress,Inc. Allrightsof reproductionin any form reserved.
[3]
STRUCTURAL ANALYSIS OF RIBOSOMES
49
determine objectively both flexibility of certain structural features and the potential existence of numerous distinct projection views in normal electron microscopical preparations of the E. coli 50S ribosomal subunit. With direct three-dimensional reconstruction techniques, 29-33 these projections can be used to obtain the three-dimensional structure of the subunit. • Acknowledgments We thank Professor H. G. Wittmann and Mr. H. Gewitz of the Max-Planck-Institut for Molecular Genetics for the 50S ribosomal subunits, and Professor E. Zeitler for comments on the manuscript. George Hamuz was the recipient of a Postdoctoral Fellowship from the Medical Research Council of Canada. 29 G. Harauz and F. P. Ottensmeyer, Ultramicroscopy 12, 309 (1984). 3o A. Verschoor, J. Frank, M. Radermacher, T. Wagenknecht, and M. Boublik, J. Mol. Biol. 178, 677 (1984). 31 G. Harauz and M. van Heel, in "Pattern Recognition in Practice" (E. S. Gelsema and L. N. Kanal, eds.), Vol. 2, p. 279. North-Holland, Amsterdam, 1986. 32 G. Harauz and M. van Heel, Optik 73, 146 (1986). 33 M. van Heel, Ultramicroscopy 21, 111 (1987).
[3] S t r u c t u r a l A n a l y s i s o f R i b o s o m e s b y S c a n n i n g Transmission Electron Microscopy B y MILOSLAV BOUBLiK, G E R R I T T. OOSTERGETEL, VALSAN M A N D I Y A N , JAMES F. H A I N F E L D , a n d JOSEPH S. W A L L
The potential of high-resolution transmission electron microscopy (TEM) for the determination of the morphology of ribosomes and topographical mapping of their components and functional sites has been demonstrated elsewhere in this volume [4]. This chapter focuses on those features of dark-field scanning transmission electron microscopy (STEM) which make this technique uniquely suited to the quantitative structural analysis of ribosomes and other sensitive biological specimens.l The major advantage of the dedicated STEM is the separation of the components that affect resolution and contrast (Fig. 1). The probe-forming components (field emission gun, condenser lens, aperture, deflection coils, and objective lens) are all above the specimen, leaving the space below the specimen free for optimization of detectors (annular detectors for elastic scattering, J. S. Wall, in "Introduction~o Analytical Electron Microscopy" (J. J. Hren, J. I. Goldstein, and D. C. Joy, eds.), pp. 333-342. Plenum, New York, 1979.
METHODS IN ENZYMOLOGY,VOL. 164
Copyright© 1988by AcademicPress,Inc. Allrightsof reproductionin any form reserved.
50
[3]
ELECTRON MICROSCOPY
SCANNINGTRANSMISSION ELECTRONMICROSCOPE-STEM ELECTRON SOURCE (FieldEmissionGun)~/ OBJECTIVE . ~ LENS- - ~ _ ~
CONVENTIONAL TRANSMISSION ELECTRONMICROSCOPE-TEM ELECTRON SOURCE i HotFilament)
..... SPI;CIMEN ------~
/ o%SER o%c,vE
DETECTOR~ DETECTI~I~
DETECTOR ,
<~
APERTURE FILM
FIG. 1. Comparison of the image-forming system in scanning transmission and conventional transmission electron microscope.
energy loss spectrometer for inelastic scattering). Thus, every electron emerging from the specimen can be counted with an appropriate detector to convey information about the specimen volume irradiated at that instant. In the conventional TEM, on the other hand, there is only a single imaging channel with a very limited acceptance angle, restricted to minimize lens aberrations. This means that a conventional TEM operated in the dark-field mode can utilize only - 5 % of the available elastically scattered electrons and none of the unscattered or inelastically scattered electrons (for references see Wall and Hainfeld 2) unless equipped with an energy filter. To compensate for this loss, the specimen dose must be roughly 20 times higher in the dark-field TEM for the same signal-to-noise ratio (S/N) as in STEM. The high contrast of dark-field mode and the superior S/N associated with the STEM annular detector make it possible to visualize unstained freeze-dried ribosomal particles and rRNAs at very low radiation dose (1 electron/AZ). Specimens prepared in this way are free of the main resolution-limiting effects of the conventional TEM, staining, distortion by air-drying, and to a considerable extent, radiation damage. By elimination of staining it becomes possible to relate image intensity directly to the local projected mass of the specimen and thus to obtain quantitative data on the molecular mass and mass distribution within a single macromolecule. 2 j. S. Wall and J. F. Hainfeld, Annu, Rev. Biophys. Biophys. Chem. 15, 355 (1986).
[3]
STRUCTURAL ANALYSIS OF RIBOSOMES
51
Materials and Methods
Ribosomes and Ribosomal Subunits Prokaryotic (70S) and eukaryotic (80S) monosomes were prepared as described) ,4 Ribosomal subunits of Escherichia coli were obtained from monosomes by dialysis against buffer with low Mg2+ (1 m M magnesium acetate, 20 m M Tris-HCl, pH 7.8, 100 m M NH4C1, l0 m M 2-mercaptoethanol) and by separation by sucrose density gradient centrifugation.5 Monosomes from eukaryotes were dissociated in the presence of 0.5 m M puromycin in high-salt buffer (50 m M Tris-HC1, pH 7.6, 0.5 M KC1, 2 m M magnesium acetate, 10 m M 2-mercaptoethanol) and the ribosomal subunits were separated by sucrose density gradient centrifugation. Ribosomal particles were stored in small aliquots in l0 m M Tris-HC1 or N-2hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES)-KOH, pH -7.6, 100 mMNH4C1 or KC1, 10 mMmagnesium acetate, l0 m M 2-mercaptoethanol at - 70 °.
Ribosomal rRNAs Prokaryotic and eukaryotic rRNAs were extracted from ribosomal particles by the standard phenol procedure and alcohol precipitation. The purity and integrity of rRNA molecules was checked by agarose gel electrophoresis. They were stored in small aliquots in distilled water at - 2 0 °.
Ribosomal Proteins Escherichia coli ribosomal proteins were isolated and purified from 30S subunits according to Zimmermann.6 The purity of proteins was confirmed by two-dimensional gel electrophoresis. Specimen Preparationfor STEM Deposition. For quantitative imaging it is essential to maintain clean working conditions. All solutions were prepared from deionized water which was processed through Millipore Milli-Q Reagent Grade Water System and distilled. Final concentrations of ribosomal particles in the solution (usually 10-20 m M HEPES-KOH, pH 7.6, 50-100 raM KC1 or 3 N. Brot, E. Yamasaki, B. Redfield, and H. Weissbach, Biochem. Biophys. Res. Commun. 40, 698 (1970). 4 G. E. Brown, A. J. Kolb, and W. M. Stanley, Jr., this series, Vol. 30, p. 368. 5 G. Traub, S. Mizushima, C. V. Lowry, and M. Nomura, this series, Vol. 20, p. 391. 6 R. A. Zimmermann, this series, Vol. 59, p. 551.
52
ELECTRON MICROSCOPY
[3]
NH4CI, 2 - 1 0 m M magnesium acetate) were in the range of 0.1-0.3 OD2~o. However, for rRNAs deposited from solutions with salt concentration below 1 # M or from distilled water, the concentrations were raised to 1.00D2~0 for sufficient specimen adsorption. The best reproducibility of specimen deposition was obtained by the "wet-film" technique. 7 In this technique a thin ( - 2 0 A) carbon film, evaporated onto the surface of a freshly cleaved NaC1 single crystal, was floated off the NaCI block onto a clean water surface. A small portion of the film was picked up from above by a titanium support grid (75 X 300 # m mesh) previously coated with holey carbon film. The grid, with the attached droplet of water, was inverted and washed several times with distilled water or with buffer. Each wash was followed by a partial blot of the grid keeping the carbon film always covered with a layer of solution. Ribosomal particles or rRNAs (in the final dilution) in a volume o f - 5/zl were gently injected below the surface of the droplet using an Eppendorf tip. After about 1 min adsorption at room temperature the grid was washed 4 - 6 times by droplets of water or 20-60 m M ammonium acetate. A volatile buffer was used to permit processing of the specimens for mass determination. Specimen conformation after adsorption appears not to be significantly affected by changes in buffer composition, s Mass determination of the specimen required a mass standard. We used tobacco mosaic virus (TMV) as an internal standard because of its well-established morphological parameters. TMV was deposited onto the grid as described above before or after specimen deposition. Freeze-Drying. The specimen for freeze-drying was wicked to the thinnest layer possible without drying and then rapidly frozen in liquid nitrogen slush to avoid specimen damage by ice-crystal formation. The frozen sample was transferred to a holder filled with liquid nitrogen in a special specimen transport cartridge mounted in a stainless steel chamber. When most of the liquid nitrogen in the holder had evaporated, the chamber was evacuated, first with a sorption pump, then with an ion pump to less than 10-s torr. The initial temperature was - 1 5 0 °. The specimen was warmed up at a rate of I °/min until the pressure in the freeze-drying system increased to 10-7 tort. The temperature was then held constant at approximately - 9 5 ° to prevent the system pressure from exceeding 10-7 torr. Completion of the freeze-drying, usually overnight, was indicated by a drop of pressure below 10-8 torr and the resumption of the 1°/min wanning. The holder was withdrawn into the transfer cartridge, sealed, and transferred under vacuum into the STEM cold stage ( - 160 °). 7 j. S. Wall, J. F. Hainfeld, and K. Chung, Proc. Annu. Meet. Electron Micros¢. Soc. Am., 43rdp. 716 (1985). s G. T. Oostergetel, J. S. Wail, J. F. Hainfeld, and M. Boublik, Proc. Natl. Acad. Sci. U.S.A. 82, 5598 (1985).
[3]
STRUCTURAL ANALYSIS OF RIBOSOMES
53
Electron Microscopy The high-resolution ( 2 - 3 A) dedicated STEM developed at Brookhaven National Laboratory has a field emission gun that operates at 40 keV at 10-~° to 10-~2 A beam current. The gun is located in a separate ionpumped vacuum chamber maintained below 10-~0 torr. The objective lens has a l-mm focal length and is cooled to approximately - 170 ° by helium gas. The specimen is held at - 1 6 0 * to eliminate contamination and to minimize mass loss due to electron irradiation. The electron dose is 1 e/m 2 at a magnification of 50,000× and about 30 e/A 2 at 250,000×. Scans are controlled digitally and detector signals are stored in a digital frame buffer (digital memory that holds one TV frame) under direction of a VAX 11-750 computer. This computer also supports additional terminals for image analysis. Image data are available immediately for analysis or stored digitally on magnetic tape.
Computer Image Analysis The availability of small computers interfaced with video graphics allows efficient analysis of electron micrographs. The applied computer imaging system developed at Brookhaven National Laboratory is described elsewhere.9 Digital frame buffers permit an image of 512 × 512 pixel resolution to be displayed and rapidly changed in contrast, brightness, and color. The system performs pan (image~movement), zoom, and marking of individual macromolecules with circles, rectangles, or any arbitrary shape drawn interactively with a track ball-controlled cursor, and displays coordinates and alphanumerics. Quantitative analysis of electron micrographs of unstained freeze-dried ribosomal particles and rRNAs includes particle counting and distribution, length and area measurements, determination of molecular weight and mass per unit length, calculation of apparent radius of gyration) topographical mapping, radial distributions of density within macromolecular complexes, ~° pattern recognition and correlation between isolated structures for model building, and/or phylogenetic studies. Applications
Mass Measurement The linearity of the STEM imaging process makes the direct measurement of particle mass relatively straightforward (for references see Wall 9 j. F. Hainfeld, J. S. Wall, and E. Desmond, Ultramicroscopy8, 263 (1982). 1oA. C. Steven, J. F. Hainfeld, B. L. Trus, P. M. Steinert, and J. S. Wall, Proc. Natl. Acad. Sci. U.S.A. 81, 6363 (1984).
54
ELECTRON MICROSCOPY
[3]
and Hainfeld2). After marking out the region of the image with the particle of interest by circles for compact particles such as ribosomes and ribosomal subunits, or by boxes or arbitrary areas for rRNAs, one has to subtract the background value of the carbon support and correct the obtained net intensity of scattered electrons by a calibration factor. The calibration factor of the STEM is a constant that is calculated for each specimen by using an internal mass standard, usually TMV. The accuracy of the STEM mass measurement depends on the size and thickness of particles, carbon support noise, and counting statistics of the scattered electrons. Measured standard deviation for large compact particles such as monosomes or large ribosomal subunits (MW - 1.5-4.5 X 106) is below 5%, for small ribo-
FIG. 2. Molecular mass measurement by the circle subroutine. The numbered circles enclose individual unstained, freeze-dried 50S E. coli ribosomal subunits selected for mass measurement. The first particle (without number) has an additional annulus around the circle which is used to calculate local background. Boxes denote the segments of tobacco mosaic virus (TMV) used for calibration (for details, see Applications). Bar is 0.1 #m.
[3]
STRUCTURAL ANALYSIS OF RIBOSOMES
55
somal subunits ( M W = 0 . 7 - 1 . 5 X 106) about 10%, and for tRNAs (MW - 2.5 × 104) 12%. The low molecular mass of individual ribosomal proteins (in average - 15 kDa) and their poorly defined shape excludes them, at present, from mass measurement. An example of STEM image processing for mass determination by the circle subroutine, described in detail elsewhere,9 is shown in Fig. 2. The numbered circles mark individual 50S ribosomal subunits selected for mass measurement. The intensity of scattered electrons within the circles was corrected by subtraction of the averaged background scattering. The elongated particles marked with boxes are TMV used as internal standard for calculation of an absolute scale factor. The overall view (Fig. 3a) displays dark-field images of unstained freeze-dried 50S ribosomal subunits of E. coli with the values of their molecular mass [in kilodaltons (kDa)] obtained by the circle subroutine. Since the digitized image with x and y coordinates for each particle is
! i~ii:~I:!i
,, ~,~,
,
~:,~i ~''~
FIG. 3. STEM images of unstained freeze-dried 50S E. coli subunits (a) with the values of their molecular mass (kDa) as obtained by the circle subroutine. Bar O. 1/zm. Arrow in the gallery of enlarged images of the subunits (b) points to the "crown" region. Bar is 0.01 #m.
56
ELECTRON MICROSCOPY
[3]
FIG. 4. Molecular mass measurement by the arbitrary area subroutine. Contour lines drawn around the extended complex structure of the unstained, freeze.dried 28S rRNA molecule encompass the area for mass measurement with less background noise than the circles (Fig. 2). Bar is 0.05/zm.
stored in the computer memory, any selected particle can be retrieved at any time for additional analysis. The enlarged images in the gallery (Fig. 3b) enable resolution of the characteristic structural features in the preferential crown view of the 50S E. coli subunits established by the conventional TEM. Molecular weights of the 30S E. coli subunits and the 16S and 23S rRNA were obtained in a similar way H with a good agreement with the known composition data of the particles. However, for elongated and branched molecules such as rRNAs, more accurate values of molecular weights can be obtained by the arbitrary area routine, demonstrated in Fig. 4 on a sample of 28S rRNA from baby hamster kidney (BHK) cells large ribosomal subunit. The arbitrary area routine is more elaborate, but circle replacement by contour lines around the complex structure of rRNAs includes substantially less background noise. Moreover, the method of arbitrary area is convenient for the determination of mass distribution within a structurally complex macromolecule and for the calculation of mass per unit length (M/L). i1 M. Boublik, N. Robakis, W. Hellmann, and J. S. Wall, Eur. J. Cell Biol. 27, 177 (1982).
[3]
STRUCTURAL ANALYSIS OF RIBOSOMES
57
Mass Distribution within a rRNA Molecule and Mass per Unit Length Application o f the arbitrary area routine to the determination of mass distribution within the r R N A molecule has to be done with extreme care. Figure 5 illustrates use o f this procedure on the example o f B H K cell 28S r R N A molecule. In distilled water or in very low ionic strength (up to 10 # M ) the r R N A molecules are extended and their conformation appears to be formed by a main backbone with several side branches and forks (Fig. 5a). The molecule can be divided into an arbitrary n u m b e r o f segments (1 - 18 in Fig. 5b) and the mass o f each segment within the enclosed area can be calculated as described above. The length o f each segment can be measured directly on highly enlarged electron micrographs. The values o f
FXG.5. Mass distribution within the resolvablestructural segments ofrRNA molecule.(a) 28S rRNA from BHK cells in water; (b) the same molecule divided into 18 structural segments for mass determination. Bar is 0.05/lm.
58
[3]
ELECTRON MICROSCOPY TABLE I MASS DISTRIBUTIONWITHIN A 28S rRNA MOLECULE
Number"
Mass (Da)
Length (~)
M/L (Da/~,)
rP
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18
127,000 68,000 67,000 108,000 66,000 108,000 337,000 17,000 75,000 1,000 69,000 123,000 94,000 175,000 10,000 334,000 115,000 59,000
200 153 170 270 200 255 748 1O0 170 306 170 374 170 375 100 748 204 153
635 444 394 400 660 424 451 170 441 444 406 329 553 467 100 447 564 386
5 4 3 3 5 3 4 1 4 4 3 3 4 4 1 4 5 3
Numbers refer to enclosed segments of the molecule shown in Fig. 5b. b The number of strands based on a value of 125 Da/~, for a single strand of RNA derived from 2.8 A axial rise per residue for A-RNA double helices. 12
mass (M) and length (L) are listed in Table I, together with the M/L ratio. The value of M/L can be used for calculation of the average number of rRNA strands in the cross-section of each segment. The number of the strands (n) in Table I is based on the value of 125 Da/A for a single strand of RNA derived from 2.8 A axial rise per residue for A-RNA double helices. 12
Radius of Gyration Knowledge of the shape and mass distribution within a ribosomal particle and/or RNA molecule makes it possible to determine the center of gravity and the value of radius of gyration (Ro). Apparent values of Ro were calculated from the distribution of the measured intensities of scattered electrons after subtracting the contribution from the support carbon 12W. Saenger,
in "Principles of Nucleic Acid Structure." Springer-Verlag, New York, 1984.
[3]
STRUCTURAL ANALYSIS OF RIBOSOMES
59
film8:
where Ii is the intensity in pixel i, Ib is the intensity due to scattering from the support film (background noise), and Ri is the distance from pixel i to the center of gravity. These apparent values are equivalent to the radius of gyration of the mass distribution projected onto the plane of the support carbon film. Usually about 50 particles are measured for obtaining statistically meaningful results. The values of R~ for the ribosomal subunits obtained by STEM (e.g., 68 _+ 1.4 A for the E. coli 30S subunit) are in agreement with the data from hydrodynamic techniques (for references, see Kearney and Moore~3). The values of RG for isolated rRNAs were considerably larger than those of the corresponding ribosomal subunits and very much dependent on the ionic strength of the buffer solution? For example, Ro for 28S rRNA from BHK cells changed from 600 _+ 150 ~, in distilled water to 240 + 30 ~, in 60 m M ammonium acetate, pH 7.0, and to 160 _ 25 A in 30 m M Tris-HC1, pH 7.6, 20 mM MgC12, 360 mMKC1 (ribosome reconstitution buffer). The values of R~ are of particular importance to the studies of ribosomal particles because they make it possible to compare morphological parameters of individual ribosomes and their components obtained under the stringent conditions of electron microscopy (dehydration, radiation exposure) with those obtained from hydrodynamic and spectroscopic techniques in which the total specimen is studied in the fully hydrated state and in a variety of buffer conditions.
Monitoring the Conformational Changes in rRNAs Apart from the well-established effects of unfolding caused by low Mg2+ concentration (below 1 raM) and protein depletion by high-salt concentrations, the conformation of ribosomes and ribosomal subunits as determined by TEM is not affected by moderate changes of ionic strength. Ribosomal RNAs, on the other hand, undergo distinct conformational transitions, from an extended form in distilled water to tightly packed coil in the reconstitution buffer. Imaging of these conformational changes, demonstrated in Fig. 6a-c, was accomplished by STEM and the wet-film deposition technique.7 The major advantage of this procedure is that the rRNAs are deposited without the structural distortion by denaturation and stretching forces inherent in conventional TEM monolayer spreading tech13 K. R. Kearney and P. B. Moore, J. Mol. Biol. 170, 381 (1983).
60
ELECTRON MICROSCOPY
[3]
FIo. 6. STEM images of unstained freeze-dried BHK cell 28 rRNA molecule (a) in water, (b) in 60 mM ammonium acetate, pH 7.0, (c) in 30 mM Tris-HCl, pH 7.6, 360 mM KCI, 20 mM MgC12, and (d) corresponding 60S ribosomal subunits in 60 mM ammonium acetate, pH 7.0, and 2 mM magnesium acetate. TMV (tobacco mosaic virus) was used as an internal reference for mass measurements. Bar is 0.05 #m.
[3]
STRUCTURAL ANALYSIS OF RIBOSOMES
61
niques for nucleic acids. 14,~s Although the rRNA molecules in distilled water (Fig. 6a) appear extended (Ro = 600 ___150 A), their length is only about one-fourth of that in the fully extended denatured state. This observation is consistent with the physicochemical data which suggest the presence of intramolecular double-stranded stems and single-stranded loops, with resulting shortening of the rRNA molecules. With increasing ionic strength (Fig. 6b and c) the structure of 28S rRNA becomes more complex and compact. However, the RNA molecules still remain considerably more extended than the corresponding 60S ribosome subunits (P~ = 87 ___4 A) under comparable ionic conditions (Fig. 6d). These results are important for studies of the assembly process of the ribosome and nucleic acid- protein interactions. Interactions of rRNAs with Ribosomal Proteins Protein-free deposition of rRNAs under nondenaturing conditions by the wet-film technique and mass analysis enabled us to visualize and analyze rRNA-protein interactions and, ultimately, to use this procedure for studying the process of ribosome assembly. The potential of our approach is demonstrated by the interaction of 16S E. coli rRNA and protein $4, the first protein to bind to the 16S rRNA in the reconstitution of the 30S subunit. The complex of 16S rRNA and $4 was prepared by incubation (at 42* for 1 hr) of 16S rRNA in 30 m M Tris-HC1, pH 7.3, 330 m M KCI, 20 m M MgC12, 1 m M dithiothreitol (DTT) with a threefold excess of protein $4. The complex was pelleted through a 15% sucrose cushion in the above buffer at 30,000 rpm for 16 hr. The pellet was suspended in 10 m M H E P E S - K O H , pH 7.4, 60 m M KC1, 0.5 m M MgCI2, 1 m M DTT, dialyzed exhaustively against the same buffer with 3 - 4 changes of solutions, and subjected to STEM analysis (Fig. 7). The purpose of transferring the complex to a solution of lower ionic strength was to reduce the effect of salt on the conformation of rRNAs, s Figure 7a shows free 16S rRNA molecules deposited from distilled water. Although the molecules appear extended (Ro = 300 + 50 A), their length is about 1200 A, approximately one-fourth of that in the fully extended denatured state. With increasing ionic strength (Fig. 7b), the conformation of 16S rRNA appears more complex and more compact (RG = 136 ___ 20 ~,). The interaction of 16S rRNA with $4 under similar conditions (Fig. 7c) reduces the value o f R o by about 20% (R~ = 112 ___20 ~,). Figure 7d shows the complex of 16S rRNA with $4 deposited after exhaustive dialysis against water, and serves as a simple control. The molecules of the complex ~4A. K. Kleinsehmidt, this series, Vol. 12, p. 361. ~5H. J. VoUenweider, M. J. Sogo, and T. Koller, Proc. Natl. Acad. Sci. U.S.A. 72, 83 (1975).
62
ELECTRON MICROSCOPY
[3]
FIG. 7. STEM images of unstained freeze-dried 16S E. coli rRNA deposited from (a) distilled water; (b) from l0 mM HEPES-KOH, pH 7.4, 60 mM KC1, 0.5 mM MgC'I2; (c) complex of 16S rRNA with protein $4 deposited from 10 mM HEPES-KOH, pH 7.4, 60 mM KC1, 0.5 mM MgC12; and from distilled water (d). Bar is 0.05 gin.
[3]
STRUCTURAL ANALYSISOF RIBOSOMES
63
in distilled water appear more extended than in the buffer (Fig. 7c) but considerably more compact than free 16S rRNA in water (Fig. 7a). The results of these initial experiments (coiling and changes of RG) suggest involvement of $4 in the conformational changes of 16S rRNA during the first assembly step of the 30S E. c o l i subunit. However, structural details such as the number and location of the $4 binding sites to the 16S rRNA cannot, at present, be determined. Concluding R e m a r k s Dedicated STEM is uniquely suited to high-resolution structural studies on ribosomes and other biological macromolecules. High efficiency in collection of scattered electrons in the STEM dark-field mode makes it possible to visualize unstained freeze-dried ribosomes and their components without the main resolution-limited artifacts of staining and distortion by air-drying and radiation inherent in the conventional TEM. The linearity of the relationship between scattering cross-section and molecular weight can be utilized for the determination of the molecular mass of ribosomes and their constituents, mass distribution within the particles, and calculation of the apparent radius of gyration. Protein-free deposition of unstained freeze-dried rRNA molecules improved significantly the visualization of their conformation and made it possible to initiate high-resolution studies of RNA-protein interactions and the process of ribosome assembly. Supplementation of STEM with an electron energy loss spectrometer ~6 and application of computer image averaging and multivariate statistical analysis of electron micrographs ~7-2° provide additional highly specific and quantitative information on three-dimensional structure, mass, and element distribution in the ribosome for topographical and phylogenetic studies. Acknowledgments The Brookhaven STEM Biotechnology Resource is supported by NIH grant No. RR01777. Support for J. S. Wallwas providedby USDOE. The authors gratefullyacknowledge Dr. P. Furcinittifor his assistancein computerprogrammingand the excellenttechnical assistanceof K. Elmorc,W. Hellmann,F. Jenkins, and F. Kito. ~6M. Boublik,G. T. Oostergetel,D. C. Joy,J. S. Wall,J. F. Hainfeld,B. Frankland,and P. F. Ottensmeyer,Ann. N. Y. Acad. Sci. 463, 168 (1986). i7j. Frank, A. Verschoor,and M. Boublik,J. MoL Biol. 161, 107 0982). is A. Verschoor,J. Frank, M. Radermacher,T. Wagenknecht,and M. Boublik,J. MoL Biol. 178, 677 (1984). ~9A. Verschoor,J. Frank, and M. Boublik,J. Ultraswuct. Res. 92, 180 (1985). 2oA. Verschoor,J. Frank, T. Wagenknecht,and M. Boublik,J. MoL Biol. 187, 581 (1986).
64
ELECTRON MICROSCOPY
[4]
[4] Identification of Protein-Protein Cross-Links within the Escherichia coli Ribosome by Immunoblotting Techniques By GEORG STOFFLER,BERNHARD REDL, JAN WALLECZEK,and MARINA STOFFLER-MEILICKE Introduction P r o t e i n - p r o t e i n cross-linking has always been considered an important technique for elucidating the topography o f ribosomal proteins within intact ribosomal particles) -6 Most o f the p r o t e i n - p r o t e i n cross-links described for the ribosomal subunits o f Escherichia coli have been obtained by T r a m and co-workers, using 2-iminothiolane as the cross-linking reagent, v,s However, when other topographical methods, e.g., immunoelectron microscopy9 or neutron scattering,~° began to develop a picture o f the ribosomal protein arrangement within the 30S subunit o f E . coli, it became evident that m a n y o f the reported p r o t e i n - p r o t e i n cross-links are incompatible with the topographical model o f the small ribosomal subunit (discussed in Ref. 10). One cause for these discrepancies could possibly be a misidentification o f the members o f some o f the cross-linked protein pairs. We have developed methods for the unambiguous identification o f the members o f a cross-linked protein pair by immunoblotting procedures, using antibodies specific for single ribosomal proteins. These techniques can be used for the analysis o f cross-links obtained with both cleavable or T. A. Bickle, J. W. B. Hershey, and R. R. Traut, Proc. Natl. Acad. Sci. U.S.A. 69, 1327 (1972). 2 L. C. Lutter, F. Ortanded, and H. Fasold, FEBSLett. 48, 288 0974). 3 C. Cleggand D. Hayes, Eur. J. Biochem. 42, 21 (1974). 4 L. Lutter, U. Bode, C. G. Kurland, and G. St6fller,Mol. Gen. Genet. 129, 167 (1974). 5H. Peretz, H. Towbin, and D. Elson, Eur. J. Biochem. 63, 83 (1976). 6 A. Expert-Bezan¢on,D. Barritanlt, M. Miler, M. F. Gu6dn, and D. H. Hayes, J. Mol. Biol. 112, 603 (1977). 7 j. W. Kenny, J. M. Lambert, and R. R. Traut, this series, Vol. 59, p. 534. s R. R. Traut, D. S. Tewari, A. Sommer, G. R. Gavino, H. M. Olson, and D. G. Glitz, in "Structure, Function and Genetics of Ribosomes" (B. Hardesty and G. Kramer, eds.), p. 286. Spdnger-Verlag,Heidelberg,Federal Republic of Germany, 1986. 9 G. St6itler and M. St6ttler-Meilicke, in "Structure, Function and Genetics of Ribosomes" (B. Hardesty and G. Kramer, eds.), p. 28. Springer-Verlag,Heidelberg,Federal Republic of Germany, 1986. ~0p. B. Moore, M. Capel, M. Kjeldgaard, and D. M. Engelman, in "Structure, Function and Genetics of Ribosomes" (B. Hardesty and G. Kramer, eds.), p. 87. Springer-Vedag,Heidelberg, Federal Republic of Germany, 1986. METHODS IN ENZYMOLOGY, VOL. 164
Copyright © 1988 by Academic Press, Inc. All rights of reproduction in any form reserved.
[4]
IDENTIFICATION OF P R O T E I N - P R O T E I N CROSS-LINKS
65
noncleavable cross-linking reagents, and at the same time they allow a rough quantitation of the extent of cross-linking. Here we shall give examples of the different immunoblotting procedures used for the identification of protein pairs cross-linked within the 50S ribosomal subunits of E. coli, using either cleavable 2-iminothiolane or noncleavable dimethyl suberimidate as the cross-linking reagent. Cross-Linking and Analysis of Cross-Linked Proteins by OneDimensional Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis and Immunoblotting 50S subunits from E. coli are isolated as described. H,12 Cross-linking with 2-iminothiolane and subsequent extraction of the ribosomal proteins follows the procedure of Kenny et al. 7 Cross-linking with dimethyl suberimidate is done according to the procedure of Bode et al. 13 and ribosomal proteins are extracted with acetic acid. 14 For a first screening, proteins extracted from cross-linked and uncrosslinked 50S ribosomal subunits are subjected to one-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to nitrocellulose by electroblotting. The nitrocellulose blots are then incubated with antisera specific for each of the individual ribosomal proteins of the 50S subunit of E. coli, and immunoreactive protein bands can subsequently be visualized by immunostaining (Fig. l a). Untreated total ribosomal protein of the 50S subunit (TPS0) gives a single band, corresponding to the unmodified protein (Fig. la, lane 1). A cross-linked protein pair will give rise to a new band with a higher molecular weight as compared to the uncross-linked protein (Fig. la, lanes 2-6). Materials and Solutions
Separation gel: 15% acrylamide (w/v), 0.4% N, N'-methylenebisacryamide (MBA) (w/v), 0.375 M Tris-HCl, pH 8.8, 0.1% sodium dodecyl sulfate (SDS) (w/v). All gel solutions are degassed for l0 rain. Polymerization is initiated by addition of 25 gl tetramethylenediamine (TEMED) and 100 gl of a freshly prepared solution of ammonium persulfate (10%, v/v) to 30 ml of the gel solution. Stacking gel I: 4.5% acrylamide (w/v), 0.12% MBA (w/v), 0.125 M H M. Noll, B. Hapke, M. H. Schreier, and H. Noll, J. Mol. Biol. 75, 281 (1973). ,z I. Hindennach, G. St6fller, and H. G. Wittmann, Eur. J. Biochem. 23, 7 (1971). 13 U. Bode, L. C. LuRer, and G. StOfller, F E B S Lett. 45, 232 (1974). 14 S. J. S. Hardy, C. G. Kurland, P. Voynow, and G. Mora, Biochemistry 8, 2897 (1969).
66
ELECTRON MICROSCOPY
1
2 3 4 5
6
•
[4] 1
2
3
b Fro. 1. Immunoblot obtained from one-dimensional SDS-polyacrylamidegels by incubation with anti-L19 (a) and scan thereof(b). Lane l, l0/zg TP50; lanes 2-6, 10, 5, 2.5, 1.25, and 0.625/zg TP50 extracted from ribosomes, cross-linkedwith 2-iminothiolane. (b) Lanes 1, 2, and 3 were scanned at 525 nm in a Quick Scan Jr., TCL, Helena Laboratories.The closed arrowheads indicate the position of protein L l9, the open arrowheads that of the main cross-link protein band, which contains approximately 30% protein Ll9, as calculated from the scan of lane 3. Note that there are additional, fainter, cross-linkprotein band(s) above the main band, the yield of which is below 5%. t
Tris-HC1, p H 6.8, 0.1% SDS (w/v). Polymerization: 7 . 5 / d T E M E D and 75/zl 10% a m m o n i u m persulfate per 7.5 ml gel solution. Sample buffer I: 8 M urea, 0.25 M T r i s HC1, p H 6.8, 0.18 M S D S , 0.01 M ethylenediaminetetraacetic acid (EDTA), 0.006 M glycerol, 5% 2-mercaptoethanol (v/v), 0.25 m g / m l b r o m p h e n o l blue. W h e n the cleavable reagent 2-iminothiolane was used, 2-mercaptoethanol was omitted from the sample buffer. Electrophoresis buffer (pH 8.5): 0.025 M Tris, 0.192 M glycine, 0.1% SDS (w/v). Transfer buffer I: 0.025 M Tris, 0.190 M glycine, 0.001 M EDTA, 0.1% SDS (w/v), 20% methanol (v/v). Incubation buffer: 10 m M potassium phosphate, p H 7.4, 0.9% NaC1 (w/v), 0.2% N-lauroylsarcosine. Incubation buffer containing 1% bovine serum albumin (BSA).
[4]
IDENTIFICATION OF PROTEIN-PROTEIN CROSS-LINKS
67
Washing buffer: 150 m M NaCI, 10 m M Tris-HC1, pH 7.8, 100 m M MgC12" 6H20, 0.5% Tween 20. Veronal-acetate buffer: 0.396 M sodium barbital, 0.143 M sodium acetate (anhydrous); the pH is adjusted to 9.6 with acetic acid. Staining solution: 0.01% nitrobluetetrazolium (w/v), 0.05% 5-bromo4-chloro-3-indolyl phosphate (w/v), 4 m M MgCl2 in veronal acetate buffer. Acrylamide, MBA, SDS, N-lauroylsarcosine, BSA, bromphenol blue, nitrobluetetrazolium, 5-bromo-4-chloro-3-indolyl phosphate, and antigoat IgG alkaline phosphatase conjugate are obtained from Sigma, and nitrocellulose BA83 is from Schleicher & Schtill. Procedure
One-dimensional SDS-PAGE is carried out essentially according to Laemmli. 15 A 2.5 cm stacking gel is cast on top of a 15% separation gel (1.5 m m thick and 10 cm high). TP50 extracted from cross-linked and uncross-linked ribosomal subunits is dissolved in sample buffer I and applied to the gel ( 1 0 - 5 0 # g per slot). When proteins cross-linked with 2-iminothiolane are analyzed, no mercaptoethanol is added to the sample buffer, in order to avoid cleavage of the disulfide bonds that connect the cross-linked proteins. Electrophoresis is carried out at 15 mA until the bromphenol blue marker reaches the bottom of the gel (approximately 12- 14 hr). The electrophoretic transfer of the proteins to the nitrocellulose is performed as described by Towbin et al.16 After electrophoresis, the gels are equilibrated in transfer buffer I for 20 min. Nitrocellulose sheets are wetted thoroughly by floating them on transfer buffer I. Electrotransfer is performed in an LKB Transphor chamber in transfer buffer I for 4 hr (6 V/cm), either in the cold room (4°) or under water cooling. Transfer of proteins from polyacrylamide gels (PAG) to the nitrocellulose sheets is controlled (1) by staining the gels after the transfer with Coomassie Brilliant Blue and (2) by reversibly staining the proteins transferred onto the nitrocellulose with toluidine blue. 17 Alternatively, one nitrocellulose sheet can be stained irreversibly with amido black (see legend to Fig. 4). The optimal blotting time has to be determined experimentally. The temperature as well as the source of the ribosomal proteins has an influence on the blotting time. msU. K. Laemmli, Nature (London) 227, 680 (1970). 16H. Towbin, T. Staehelin, and G. Gordon, Proc. Natl. Acad. Sci. U.S.A. 76, 4550 (1979). t7 H. Towbin, H. P. Ramjou6, H. Kuster, D. Liverani, and G. Gordon, Z Biol. Chem. 257, 12709 (1982).
68
ELECTRON MICROSCOPY
[4]
After blotting, the nitrocellulose sheets are first equilibrated in incubation buffer (15 min) and subsequently incubated for 45 min in incubation buffer containing 1% BSA, in order to saturate additional protein-binding sites. The blots are then incubated overnight with the different antisera specific for each of the individual ribosomal proteins of the 50S subunit of E. coli. The optimal dilution has to be determined for each antiserum; the antisera from sheep used in this study were routinely diluted 1 : 1000 in incubation buffer containing 1% BSA. Next, the blots are intensively washed with washing buffer (4 × 15 min), incubated for 5 min in incubation buffer containing 1% BSA, and then for 2.5 hr with the anti-goat IgG alkaline phosphatase conjugate (diluted 1 : 1000 in incubation buffer conraining 1% BSA). The blots are again extensively washed with washing buffer, rinsed with distilled water, and equilibrated with veronal-acetate buffer, pH 9.6 (5 min). The immunoreactive bands are stained with staining solution and the enzyme reaction is stopped by rinsing the blots with distilled water. For the immunostaining reaction, a large variety of detection systems can be used. We have also obtained reproducible results with peroxidase-conjugated second antibody ~s as well as with the biotinstreptavidin system, using the peroxidase preformed complex. ~9 Evaluation of the Immunoblots Obtained from One-Dimensional SDS-PAGE TP50s extracted from cross-linked and uncross-linked ribosomal subunits are routinely analyzed in adjacent lanes on the immunoblots. Crosslinking of a protein to another protein will give rise to an additional band, exhibiting a higher molecular weight than the uncross-linked protein. An immunoblot obtained with anti-L19 is shown in Fig. la, and we use this example to describe a cross-linked pair analysis in detail. The yield of a given cross-linked protein complex can be determined by scanning the immunoblots densitometrically and by evaluating the height of the different peaks on the scan. Thus the yield of the main cross-link band seen with anti-Ll9 amounts to approximately 30% (Fig. l b). The titers of our antisera are such that we can detect 0.1 - 1% of a given protein in a cross-linked complex. In order to determine which protein has been cross-linked to protein L 19, the molecular weight of the cross-link is determined, using a calibra~sE. R. Dabbs, R. Hasenbank, B. Kastner K.-H. Rak, B. Wartusch, and G. Strfller, MoL Gen. Genet. 192, 301 (1983). t9 For the biotin-streptavidin system we follow the protocol of the supplier (Amersbam), from whom we purchased the biotinylated second antibody and the preformed complex.
[4]
IDENTIFICATION OF P R O T E I N - P R O T E I N CROSS-LINKS
69
tion curve which has been obtained by using ribosomal proteins as molecular weight standards and plotting their mobility versus their known molecular weights according to Weber and Osborne. 2° Thus, the molecular weight of the main cross-link band obtained with anti-L 19 was determined to be approximately 27,250. If we subtract the known molecular weight of protein L19 (13,002) from this value, we obtain the approximate molecular weight (l 4,250) of the protein cross-linked to L 19. There are several ribosomal proteins having molecular weights close to 14,250; however, the candidates possibly cross-linked to protein L19 can be further reduced by examining the immunoblots obtained with antisera against these candidates, and asking the following questions: (1) Have the candidates been cross-linked to another protein at all, that is, do the immunoblots show a high-molecular-weight cross-link band? (2) Is the cross-link band of the same molecular weight as the one found for protein L19? (3) If candidate(s) have been found which show a cross-link band of approximately the molecular weight in question, is the amount of crosslinking of the candidate(s) approximately the same as that observed with protein L 19? By evaluating all immunoblots in this way, we find two proteins, namely L14 and L25, that reveal a cross-linked protein band with approximately the same molecular weight as observed with protein Ll9. The known molecular weights of the single proteins (13,541 for L14 and 10,694 for L25) as well as the amount of cross-linking (-25% for Ll4 and - 15% for L25, as compared to - 3 0 % for L19) suggest that protein L14 is crosslinked to L19. In order to further substantiate this finding, blots are made from one and the same SDS-PAG and incubated with the three antisera, namely anti-L 14, anti-Ll 9, and anti-L25 (Fig. 2). These immunoblots clearly show that the band obtained after cross-linkage and seen with anti-Ll4 migrates into exactly the same position as the one obtained with anti-L19, whereas the band obtained with anti-L25 migrates into a slightly higher position. Thus these immunoblots show that L14 and L 19 are the members of this cross-linked protein pair. However, the data do not exclude the possibility that protein L25 is also cross-linked to L19 (note the width of the crosslinked protein band seen with anti-L 19). In the case of ambiguous results, separation of ribosomal proteins in different electrophoretic systems (e.g., 5 - 20% or 15-25% SDS-polyacrylamide gradient gels) proved to be useful, since cross-linked protein complexes may migrate with different mobilities, depending on the different
2o K. Weber and M. Osborne, J. Biol. Chem. 244, 4406 (1969).
70
ELECTRON MICROSCOPY
1
2
a
1
2
b
[4]
2
I
c
FIG. 2. Immunoblot obtained from one-dimensional SDS-PAGs by incubation with (a) anti-L14, (b) anti-L19, and (c) anti-L25. Lane 1, 5/Lg TPS0 from E. coil; lane 2, 5/tg TPS0 extracted from subunits, cross-linked with 2-iminothiolane. Note the change in migration behavior of the uncross-linked proteins due to the cross-linking procedure.
electrophoretic conditions. If analyses of immunoblots made from one-dimensional SDS-PAG do not suffice for unambiguous identification of the proteins cross-linked to each other, a more precise identification can be achieved by immunoblotting from two-dimensional SDS-PAG. Immunoblotting from Diagonal SDS-Polyacrylamide Gels When 2-iminothiolane is the cross-linking reagent, we separate the proteins by diagonal electrophoresis, and the blots obtained thereof are treated with a mixture of two antisera. In the diagonal clectrophoresis, originally used by Sommer and Traut, 2' the ribosomal proteins are sepa2] A. Sommer and R. R. Trout, Proc. Natl. Acad. Sci. U.S.A. 71, 3946 (1974).
[4]
IDENTIFICATION OF PROTEIN-PROTEIN
CROSS-LINKS
71
rated under identical electrophoretic conditions in the first and in the second dimension. However, 2-mercaptoethanol is used to cleave the cross-link after separation of the proteins in the first dimension. Thus in the second dimension, all proteins that have not been cross-linked will migrate in a diagonal line on the two-dimensional gel, while proteins that had been members of a cross-linked complex will migrate below this diagonal (Fig. 3a). Proteins that have been cross-linked to each other will migrate on one vertical line on the two-dimensional gel, and they can be visualized by incubation of the blots with a mixture of two antisera (Fig. 3c). Solutions Stacking gel II: 15% acrylamide (w/v), 0.4% MBA (w/v), 0.125 M Tris-HC1, pH 6.8, 0.1% SDS. Polymerization: 10/~1 TEMED and 30 pl 10% ammonium persulfate per 5 ml gel solution. All other solutions are the same as described above. Procedure For the first dimension, 30- 50 pg of TP50 from cross-linked subunits is separated on a mini-slab gel 1 m m thick and a total of 7.5 cm in length (5.5 cm separation gel and 2.0 cm stacking gel), which is prepared with the same solution as described above. Electrophoresis is for 2 hr at 180 V and 30 mA. Prior to separation of proteins in the second dimension, the cross-links are cleaved by incubating the gel for 30 min at 65 ° in electrophoresis buffer containing 3O/o 2-mercaptoethanol (v/v). In order to remove 2-mercaptoethanol (which will hinder polymerization of the gel used for the second dimension) and to adjust the pH to that of the stacking gel in the second dimension, the gel is then incubated 3 X 10 min in electrophoresis buffer adjusted to pH 6.8 with 1 MHC1. Lanes are cut from the gel and are ready for polymerization on top of the gel used for the second dimension. For the second dimension, the gel is 2 m m thick and a total of 12.5 cm in length. First, a 7.5 cm separation gel and a 2.5 cm stacking gel I are cast, using the standard solutions described above. The remaining 2.5 cm is used for embedding the lane cut from the one-dimensional gel in stacking gel II. The stacking gel polymerizes so quickly (within 1 min) that TEMED and ammonium persulfate have to be added to each gel separately just prior to use. It is important that no air bubbles are underneath the gel lane. A capillary pipet (1 m m in diameter) is polymerized into the stacking gel II in order to form a slot, into which 5 pl of 0.02% basic fuchsin (w/v) can be applied as tracking dye. Electrophoresis is for 12- 14 hr (15 mA) at room temperature, until the tracking dye reaches the bottom of the gel.
72
ELECTRON MICROSCOPY ®
[4] 'Ist Dim.
®
N3 ~3
3
b~
FIG. 3. Two-dimensional diagonal PAG and immunoblots of TPS0, extracted from ribosomal subunits cross-linked with 2-iminothiolane. (a) Gel, showing a large number of faint protein spots below the diagonal. (b-d) Immunoblots, incubated with (b and e) anti-L9 and anti-L28 and (d) anti-L2, anti-L9, and anti-L28 simultaneously. In (b) cleavage of the cross-links was prevented after the first dimension by omitting the incubation step in electrophoresis buffer containing 3% 2-mercaptoethanol. On the diagonal there are two clear protein spots (indicated by arrowheads) in addition to proteins L9 and L28, indicating that the two proteins are contained in at least two cross-Iin~. The immunoblot in (e) demonstrates that proteins L9 and L28 are members of a cross-linked pair, since the two proteins (arrows) appear on a vertical line below the diagonal. (Note on the diagonal some residual cross-linked material that has not been cleaved.) The presence of a second protein spot below the diagonal at the same level as protein L9 (arrow) indicates that protein L9 is a member of a second cross-finked protein pair. This latter cross-link is identified by the immunoblot shown in (d): two protein spots are seen on a vertical line below the diagonal (arrow) at the same level as proteins L2 and L9.
[4]
IDENTIFICATION OF P R O T E I N - P R O T E I N CROSS-LINKS
73
Immunoblotting of the diagonal gels is performed exactly as described above for the one-dimensional SDS-PAGs. An unambiguous identification of the members of a cross-linked protein pair is achieved by incubating the immunoblot with a mixture of two antisera: The two proteins derived from the cross-link will migrate on the same vertical line below the diagonal (Fig. 3c). If the two proteins cross-linked to each other have the same molecular weight, only a single protein spot will be seen below the diagonal. Immunoblotting of Two-Dimensional Polyacrylamide Gels If a noncleavable cross-linking reagent like DMS is being used and immunoblots from one-dimensional PAGE do not suffice to identify the members of a cross-linked protein pair, immunoblotting from two-dimensional PAG has also proved to be useful. Different two-dimensional gel electrophoresis systems have been used22~3; here we describe the application of the system of Geyl et al. 23 Solutions
One-dimensional separation gel: 4% acrylamide (w/v), 0.1% MBA (w/v), 0.057 M Bis-Tris, 6 M urea, 5 m M EDTA. The pH is adjusted to 5.0 with acetic acid. For polymerization, 35/~1 TEMED and 100/A 7% ammonium persulfate (v/v) are added per 10 ml gel solution. Upper reservoir one-dimensional electrophoresis buffer: 10 m M BisTris acetate, pH 4.0. Lower reservoir one-dimensional electrophoresis buffer: 180 m M 130tassium acetate, pH 5.0. Sample buffer II: 6 M urea, 10 m M dithiothreitol in 10 m M Bis-Tris acetate, pH 4.0. Two-dimensional separation gel (pH 4.2): 18% acrylamide (w/v), 0.48% MBA (w/v), 6 M urea, 5.4% acetic acid (v/v), 50 m M KOH. Polymerization: 0.6 ml TEMED and 4 ml 7% ammonium persulfate (v/v) per 100 ml two-dimensional separation gel. Two-dimensional electrophoresis buffer: 0.186 M glycine adjusted to pH 4 with acetic acid. Transfer buffer II: 8 M urea, 0.7% acetic acid (v/v). Procedure
The one-dimensional separation gel is poured into silicon-coated glass tubes (0.5 cm × 9 cm) and is overlayed with 4 M urea, which is removed 22 L. J. Mets and L. Bogorad, Anal Biochem. 57, 200 (1974). 23 D. Geyl, A. Brck, and K. Isono, Mol. Gen. Genet. 181, 309 (1981).
74
ELECTRON MICROSCOPY
[4]
with tissue paper after polymerization. One hundred micrograms of lyophilized TPS0 (dissolved at 2 mg/ml in sample buffer II is placed on top of the one-dimensional gels. Bis-Tris acetate, l0 mM, pH 4.0, is used as electrophoresis buffer in the upper reservoir and 180 m M potassium acetate, pH 5.0, in the lower reservoir. Electrophoresis is toward the cathode, starting at 1 mA/tube. After 30 min the current is increased to 4 mA/tube. One tube is loaded with basic fuchsin (0.5 mg/ml) in sample buffer II as tracking dye. Electrophoresis is carded out at room temperature until the fuchsin reaches the bottom of the gels (approximately 7 hr). Following electrophoresis, the gel is removed from the glass tube with the help of a syringe filled with water. The gel is directly polymerized on top of the gel used for the second dimension, which is prepared with two-dimensional separation gel solution (10 X 10 cm and 1.5 m m thick). Electrophoresis is carried out at l0 ° toward the cathode for 14-16 hr at 100 V in two-dimensional electrophoresis buffer using basic fuchsin as tracking dye (0.05 mg/ml in 50% glycerol). After electrophoresis, the gels are removed from the two-dimensional chamber and are equilibrated in transfer buffer II. The nitrocellulose sheets are floated on transfer buffer II and placed on top of the two-dimensional gels. Electrotransfer is performed in an LKB Transphor chamber at 10 ° for 4 hr (6 V/cm) using transfer buffer II. Protein transfer is controlled as described above. Incubation with antisera specific for individual ribosomal proteins and immunodetection is performed as described above for onedimensional SDS gels. Immunoblots obtained from two-dimensional PAG and incubated with anti-L9 and anti-L28, respectively, are shown as examples in Fig. 4. In addition to the unmodified protein that is stained by the specific antibody, an additional spot is stained on the two immunoblots (Fig. 4c and d), representing a cross-linked protein pair. The cross-linked protein complexes stained with both anti-L9 and anti-L28 are located at the same positions on the two immunoblots. Thus the results obtained from immunoblotting of two-dimensional PAG confirm those obtained from onedimensional SDS-PAGE, namely that proteins L9 and L28 have been cross-linked to each other.
Conclusion The powerful technique of protein-protein cross-linking for the analysis of the topography of ribosomal proteins within the ribosomal subunits has recently been criticized, since many of the results seemed incompatible with other topographical data. Here we have presented a new identification
[4]
IDENTIFICATION OF P R O T E I N - P R O T E I N CROSS-LINKS
lst.Dim.-
75
Q
E -o c (',4
®
~--Lt
¢
FIG. 4. Two-dimensional PAGs and immunoblots. TP50, 100/zg, extracted from ribosomal subunits that had been cross-linked with DMS, is separated by two-dimensional PAGE, according to Geyl et al. 2a (a) gel; (b) nitrocellulose blot, stained with amido black; (c and d) immunoblots, incubated with (c) anti-L9 and (d) anti-L28. For stainin& the blot in (b) was incubated for 10 min in a solution containing 0.1% amido black (w/v), 4596 methanol (v/v), and 10% acetic acid (v/v); the blot was destained in 90% methanol (v/v) and 2% acetic acid (v/v).
technique, using antisera against individual ribosomal proteins and imm u n o b l o t t i n g for the u n a m b i g u o u s identification o f the m e m b e r s of a cross-linked protein pair. This approach is especially valuable if noncleavable cross-linking reagents are being used. O u r results show that the migration behavior o f some p r o t e i n s - - d u e to
76
ELECTRON MICROSCOPY
[5]
the cross-linking procedure--is altered during electrophoresis (see Fig. 2a and b), whereas their antigenic properties remain uneffected. This alteration of the mobility of proteins would explain why the analysis of the members of a cross-linked protein pair solely on the basis of their electrophoretic mobility may easily lead to a misidentification of one or both of the components. Clearly, the use of specific antibodies is superior to this latter method, and in addition it allows a rough estimation of the amounts of cross-linking. Acknowledgments We are grateful to R. Brimacombe for critically reading the manuscript, to R. AlbrechtEhrlich for preparation of the figures, to H. G. Wittmann for his constant interest and
support,and to R. Hasenbankfor typingthe manuscript.
[5] E l e c t r o n M i c r o s c o p y S t u d i e s o f R i b o s o m a l R N A B y IVAN N . SHATSKY and VICTOR D. VASILIEV
Electron microscopy (EM) has been successfully used to study the structural organization of ribosomal RNA. (1) Comparative EM studies of the stepwise disassembly and reassembly of ribosomal subunits have shown that rRNA plays a key role in the organization of ribosome structure. The capability of both the high molecular weight 16S and 23S rRNAs to specifically fold, without ribosomal proteins, into compact particles of a unique shape has been directly demonstrated at the final step of these studies. A close relationship between the morphology of the naked rRNAs in the compact conformation and the spatial distribution of RNA within ribosomal subunits has been established by a combination of EM and neutron scattering techniques. 1 This suggests that many tertiary R N A RNA contacts of the ribosome can occur in naked rRNA under appropriate ionic conditions. Recently, the first tertiary structure model of 16S RNA has been constructed, taking its secondary structure as a starting point. 2 The overall shape of this model is very reminiscent of the asymmetric Y-shaped molecules of the naked 16S RNA in compact conformation. 1 (2) Immunoelectron microscopy (IEM) has permitted the study of the i V. D. Vasiliev, I. N. Serdyuk, A. T. Gudkov, and A. S. Spirin, in "Structure, Function and Genetics of Ribosomes" (B. Hardesty and G. Kramer, eds.), p. 128. Spfingvr-Verlag, New York, 1986. 2 A. Expert-Bezancton and P. L. Wollenzien, J. Mol. Biol. 184, 53 0985). METHODSIN ENZYMOLOGY,VOL. 164
English translation copyright © 1988 by AcademicPress, Inc.
76
ELECTRON MICROSCOPY
[5]
the cross-linking procedure--is altered during electrophoresis (see Fig. 2a and b), whereas their antigenic properties remain uneffected. This alteration of the mobility of proteins would explain why the analysis of the members of a cross-linked protein pair solely on the basis of their electrophoretic mobility may easily lead to a misidentification of one or both of the components. Clearly, the use of specific antibodies is superior to this latter method, and in addition it allows a rough estimation of the amounts of cross-linking. Acknowledgments We are grateful to R. Brimacombe for critically reading the manuscript, to R. AlbrechtEhrlich for preparation of the figures, to H. G. Wittmann for his constant interest and
support,and to R. Hasenbankfor typingthe manuscript.
[5] E l e c t r o n M i c r o s c o p y S t u d i e s o f R i b o s o m a l R N A B y IVAN N . SHATSKY and VICTOR D. VASILIEV
Electron microscopy (EM) has been successfully used to study the structural organization of ribosomal RNA. (1) Comparative EM studies of the stepwise disassembly and reassembly of ribosomal subunits have shown that rRNA plays a key role in the organization of ribosome structure. The capability of both the high molecular weight 16S and 23S rRNAs to specifically fold, without ribosomal proteins, into compact particles of a unique shape has been directly demonstrated at the final step of these studies. A close relationship between the morphology of the naked rRNAs in the compact conformation and the spatial distribution of RNA within ribosomal subunits has been established by a combination of EM and neutron scattering techniques. 1 This suggests that many tertiary R N A RNA contacts of the ribosome can occur in naked rRNA under appropriate ionic conditions. Recently, the first tertiary structure model of 16S RNA has been constructed, taking its secondary structure as a starting point. 2 The overall shape of this model is very reminiscent of the asymmetric Y-shaped molecules of the naked 16S RNA in compact conformation. 1 (2) Immunoelectron microscopy (IEM) has permitted the study of the i V. D. Vasiliev, I. N. Serdyuk, A. T. Gudkov, and A. S. Spirin, in "Structure, Function and Genetics of Ribosomes" (B. Hardesty and G. Kramer, eds.), p. 128. Spfingvr-Verlag, New York, 1986. 2 A. Expert-Bezancton and P. L. Wollenzien, J. Mol. Biol. 184, 53 0985). METHODSIN ENZYMOLOGY,VOL. 164
English translation copyright © 1988 by AcademicPress, Inc.
[5]
ELECTRON MICROSCOPY OF r R N A
77
topography of rRNA within the ribosome, and has already provided the locations of the ends and of several internal sites of the rRNA chain on the surface of the ribosomal subunits. 3 Such data are requisite to finding the mutual arrangement of the functional centers and the mode of rRNA folding in situ. Here we describe techniques for EM studies of the naked rRNAs and for the rRNAs within the ribosome. EM
Studies of the Naked r R N A s
Principle The experimental task is to find the ionic conditions at which the rRNA becomes maximally compact and to visualize it in such a state. The rRNA readily changes its conformation. Therefore, procedures for preparing rRNA for EM must exclude the possibility of any change in initial ionic conditions. The technique of freeze-drying and high-resolution shadow casting4 was found to be adequate. Numerous experiments with ribosomal subunits and their protein-deficient derivatives give evidence that fast freezing fixes without distortion the object structure which exists in solution. In principle, the method provides resolution comparable to that of negative staining.
Volatile Salts and Alcohol Requirements Resolution in shadow casting strongly depends on the amount of salts remaining on the supporting film which can result in a background on micrographs. A high concentration of salts lead to the "disappearance" of the object. On the other hand, and this should be specially emphasized, washing of the preparation adsorbed on the supporting film with water or with solutions, differing from that in which the rRNA is to be studied, can lead to the destruction of the tertiary structure existing prior to the washing. In any case, if washing is used there always remains uncertainty as to whether the conformation of rRNA observed by EM corresponds to the one actually existing in the original solution. This imposes limitations on the composition of the solution. In particular, due to high KC1 concentration, rRNA can hardly be visualized by EM after evaporation reconstitution buffer. Therefore an ammonium acetate buffer containing alcohol is used. Methanol or ethanol are added in a 5% (v/v) concentration (l M). Ethanol (1 M) and methanol (2 M) essentially stabilize the association of 3 J. B. Prince, R. R. GutelI, and R. A. Garrett, Trends Biochem. Sci. 9, 359 (1983). 4 V. D. Vasiliev and V. E. Kotelinasky, this series,Vol. 59, p. 612.
78
ELECTRON MICROSCOPY
[5]
c
e~ o
O >
Sedimentation
FIa. 1. A typical sedimentation pattern of the 23S rRNA preparation in buffer EM II. A dimer fraction appears with a sedimentation coefficient of s~0,w = 49S.
ribosomal subunits. 5 We have also found that, in the presence of alcohol, the ribonucleoprotein derivatives of the 30S subunit and the naked 16S and 23S RNAs become more compact than in the presence of only Mg2+. For example, in a buffer containing 10 m M Mg2+, the addition of 1 M ethanol raises the sedimentation coefficient of 23S RNA by 15%. It should be noted that this ethanol concentration is several times lower than that (> 20%, v/v) at which stimulation of some ribosomal functions and conformational changes in ribosomes caused by alcohol are observed. 6 In our experiments, a 30 to 50 m M ammonium acetate buffer containing 1 M ethanol was used. Increasing magnesium acetate and polyamine concentrations in different ratios was added to this buffer, up to the appearance of a dimeric fraction on the sedimentation patterns (Fig. 1). A further increase in magnesium concentration leads to rapid aggregation. Spermine, spermidine, putrescine, and cadaverine were tested as compacting agents. The highest sedimentation coefficient for 23S RNA was obtained by the addition of spermidine.
Buffers and Reagents EM I: 30 mMNI-I4C1, 6 mMmagnesium acetate, 1 Methanol, pH 7.5 EM II: 50 m M NH4C1, 10 m M magnesium acetate, 2 m M spermidine, 1 M ethanol, pH 7.5 Spermidine trihydrochloride was obtained from Sigma 5 A. S. Spirin and E. B. Lishnevskaya, FEBS Lett. 14, 114 (1971). 6 C. Bernabeu, D. Vazqucz, and J. P. G. BaUesta, FEBSLett. 99, 251 (1979).
[5]
ELECTRON MICROSCOPY OF r R N A
79
Isolation of rRNA 16S RNA is obtained from 30S subunits by splitting off the proteins in 3 M LiC1 with 4 M urea 7 followed by phenol deproteinization in the presence of sodium dodecyl sulfate. 23S RNA is obtained by 5-30% sucrose gradient centrifugation (Spinco SW-27 rotor, 26,000 rpm, 20 hr 5 °) of the total RNA. The total RNA is obtained from once-pelleted, unwashed 70S ribosomes by splitting off the proteins in 3 M LiC1 with urea. 7 The isolated 16S and 23S RNAs are reprecipitated three times in an ethanol-50 m M ammonium acetate mixture (pH 5.5), 2:1 (v/v), and stored at - 10 °.
Preparation of Samples Ethanol-precipitated rRNA is pelleted by low-speed centrifugation. The 16S and 23S RNA pellets are dissolved in buffers EM I and EM II, respectively at concentrations of 0.25-1.00 A2eJml, heated for 10 min at 40 °, and cooled to room temperature. After 1 - 2 hr the solution is clarified by centrifugation at 20,000 g for 15 min and used for sample preparation? The surface of the copper block, kept at 4 °, was moistened with water or alcohol and covered with a thin Teflon film (5/tm thick) on which a drop of the solution was applied. A copper grid covered with a carbonized microplastic net with holes of 2 - 5 #m and a supporting carbon film 20 thick is allowed to float on the drop of solution for 1 - 5 min. Then the grid is removed with forceps, the excess solution is sucked off with filter paper, and the grid is plunged into a Dewar flask with liquid nitrogen. The cooling rate is about 200°/sec. Several such grids are fixed onto a special holder in the liquid nitrogen itself and then transferred to a vacuum chamber. Shadow casting with tungsten-tantalum or tungsten-rhenium using an electron gun is done in an oil-free high vacuum. The equipment, preparation of supporting carbon films, and procedure have been described in detail previously.4
Comments 1. Solutions have been found that satisfy the requirements of the EM preparation technique in which compact specific folding of the rRNA chain takes place. The sedimentation coefficient of 16S RNA in buffer EM I and that of 23S RNA in buffer E M I I are 21.5 +_ 0.5 and 34.0 + 0.5 S, respectively. [S 2o.w ° is calculated taking into account the viscosity of 1 M 7 S. I. S. Hardy, C. G. Kurland, P. Voynow, and G. Mora, Biochemistry 8, 2897 (1969).
80
ELECTRON MICROSCOPY
[5]
ethanol. The viscosity of buffers EM I and EM II was 1.235 centiPoise (cP).] However, it is possible that these conditions are not optimal and rRNA can acquire a more compact conformation in solution. 2. Application of the described technique to the study of naked rRNA provides evidence that it actually allows visualization of the molecules in the conformation that exists in solution. Figure 2 presents micrographs of the 16S and 23S RNA in their compact forms. A comparison shows that their folding into compact three-dimensional structures is specific for each of them. When the conditions and the technique are strictly observed, the results are readily reproducible with one exception. As conditions for maximal compactness of the RNA are close to those where aggregation begins, it is difficult to obtain sizable fields free of aggregates, and these are seen in variable amounts in different experiments. 3. The conformation of rRNA is extremely sensitive to the solution composition and to the technique of sample preparation. If washing of samples prior to freezing is done, it is actually the secondary and not the tertiary structure of rRNA that is observed, regardless of whether shadow casting and conventional EM or high-resolution scanning transmission EM of an unshadowed sample are used. s
I E M Studies of rRNA Topography
General Strategy This method is based on the chemical modification of selected points in RNA by reagents containing a hapten residue, reconstitution of ribosomal subunits from the modified RNA and total ribosomal protein, and, finally, localization of the modified site of RNA by IEM with the use of haptenspecific antibodies. In general, there are only two sites in the intact RNA that are capable of selective modification: the Y-terminal ribose and 5'-terminal phosphate groups. This does not mean, however, that it is impossible to introduce the hapten into an internal site of the RNA chain. One of the possible approaches is based on formation of specific single cuts within internal sites of RNA species with stable macromolecular structures. Such cuts can offer additional Y-cis-glycol or 5'-phosphate groups that can subsequently be used for modification and localization. Below, we shall present one example of such an "internal" modification.
s M. Boublik, N. Robakis, and W. Hellmann, Eur. 3. Cellt~iol. 27, 177 (1982).
[5]
ELECTRON MICROSCOPY OF r R N A
81
FIG. 2. Micrographs of rRNAs prepared by the freeze-drying and high-resolution shadow-casting technique. (a) 16S RNA prepared from EM I. (b) 23S RNA prepared from EM II.
82
ELECTRON MICROSCOPY
[5]
Preparation of Ribosomal Subunits Labeled by Hapten at the 3'-End of RNA and Formation of Immunocomplexes
Principle Modification of the 'Y-terminal ribose of RNA presents no difficulty. The reaction is very simple and proceeds with high specificity. It involves periodate oxidation of the 3'-cis-glycol followed by treatment with ligands carrying aliphatic amino or hydrazide groups. Different authors have successfully employed different haptens: l-N-[p-(fl-~lactosyl)benzyl]-6-aminohexylamine (LBA), 9 2,4-dinitrophenylethylenediamine (DNP-ethylenediamine),l° and N-(?-2,4-dinitrophenyl)aminobutyric acid hydrazide.l The experimental procedure for modification with the first of these reagents are presented in Scheme I.
CHzOH '
OH
OH
k
CHzOH v
Loc
s
I. H2N-(CHz)6-NH2
Lac-O--~CHO
Loc--O-~CH
2. NaBH4
z - NH
~(CH~)6NH~
SCHEME 1. (a) General formula of phenyl-p-D-lactosides: NH2, CH2NH(CH2)~NH 2. (b) Synthesis of LBA.
R = CHO,
NO 2,
Materials and Reagents Sodium periodate and sodium borohydride were obtained from Merck LBA is prepared according to the method described in Ref. 9 Antibodies against fl-D-lactosides are prepared and purified as described in Ref. 9 9 I. N. Shatsky, L. V. Mochalova, M. S. Kojouharova, A. A. Bogdanov, and V. D. Vasiliev, J. MoL Biol. 133, 501 (1979). ~oH. Olson and D. G. Glitz, Proc. NatL Acad. Sci. U.S.A. 76, 3769 (1979). " M. St6fller-Meilicke, G. St6fller, O. W. Odom, A. Zinn, G. Kramer, and B. Hardesty, Proc. NatL Acad. Sci. U.S.A. 78, 5538 (1981).
[5]
ELECTRON MICROSCOPY OF r R N A
83
Buffers I: 10 m M Sodium acetate, 100 mMNaC1, pH 5.0 II: 100 m M Sodium borate, pH 9.0 III: 20 m M Tris-HC1, pH 7.8, 20 m M MgC12, 200 m M NH4CI, 2 m M dithiothreitol IV:I0 m M Tris-HCl, pH 7.8, 5 m M MgC12, 50 mMNH4C1 V: 10 m M Tris-HC1, pH 7.4, 5 m M MgC12, 50 m M NH4C1
Modification of the 3'- Terminal Ribose of rRNAs Modification of rRNA (23S, 16S, or 5S) is carried out at a concentration of 2 0 - 3 0 A26ounits/ml in buffer I containing a 1000-fold molar excess of NalO4 for 1 hr at 20 ° in the dark. The oxidized RNA is precipitated by ethanol, dissolved in the same buffer to a concentration of 100-150 A26o units/ml, and treated with 0.1% ethylene glycol (final concentration) to remove the excess NalO4. After incubation for 30 rain at 0 ° the RNA is reprecipitated twice using ethanol. The pellet is dried briefly under reduced pressure to remove the ethanol and dissolved in buffer II at a concentration of 2 0 0 - 300 A26o units/ml. (In the case of 5S RNA the indicated RNA concentrations can be 10 to 20 times lower.) LBA is added to a final concentration of 0.025 M and the reaction mixture is allowed to stand for 3.5 hr at 0 °, then NaBH4 in water (10 mg/ml) is added to a final concentration of 1 mg/ml. After standing for another hour at 0 °, the reaction is quenched by addition of 0.25 vol 1 M sodium acetate, pH 5.0. The RNA is reprecipitated three times with ethanol and used for reconstitution of the 30S subunits (16S RNA) or 50S subunits (23S or 5S RNAs).
Reconstitution and Purification of the 30S Subunits Reconstitution of the 30S subunits from the modified 16S RNA and the total 30S ribosomal protein is performed under conditions described by Traub et al. 12 with minor modifications. After reconstitution the subunits are precipitated in a Beckman Ti-50 rotor at 40,000 rpm for 4 hr and the pellet is suspended in "activation buffer" (buffer III). The 30S subunits are clarified by low-speed centrifugation, incubated for 20 min at 40°, 13 and finally purified by sedimentation on a 15 to 30% sucrose gradient prepared with the same buffer (SW-27 rotor, 22,000 rpm, 16 hr). Fractions from the "light" half of the peak are pooled and the subunits are precipitated by addition of 0.7 vol ethanol. 12p. Traub, S. Mizushima, C. V. Lowry,and M. Nomura, this series, Vol. 20, p. 391. 13A. Zamir, R. Maskin, and D. Elson, J. Mol. Biol. 60, 347 (1971).
84 A26°
ELECTRON MICROSCOPY
0
30S
b
30S
30S
/YV
o.5
1-
t
3
9
15
I
4os//
I
3
I
I
9
[5]
I
40S ~
IgG
I
15
9
15
Volume (ml) FIo. 3. Sucrose gradient sedimentation of reconstituted 30S subunits containing Y-modified 16S RNA after incubation with hapten-speciflc antibodies. (a) Control 30S subunits with nonmoditied 16S RNA. (b) 30S subunits with modified 16S RNA + antibodies. (e) 30S subunits with modified 16S RNA + antibodies in the presence of 0.05 M hapten. From Shatsky e t al. 9
Reconstitution and Purification of the 50S Subunits Reconstitution of 50S subunits from the modified 23S RNA (+ nonmodified 5S RNA) or 5S RNA (+ nonmodified 23S RNA) and the total 50S ribosomal protein is done basically as recommended by Nierhaus and Dohme ~4with one modification: 23S RNA is isolated from 70S ribosomes rather than from 50S subunits.
Formation of lmmunocomplexes Modified subunits are dissolved in and dialyzed against buffer IV. For analytical experiments when subunits are to be checked for successful labeling with hapten or its accessibility on the ribosomal surface, one A~0 unit of modified 30S subunits or two A~o units of 50S subunits in 0.05 ml buffer IV are preheated for 5 min at 37* and mixed with various amounts of the hapten-specific IgG (usually from 125 to 500 pmol of adsorbent-purified antibodiesg). The total assay volume is then adjusted to 0.1 ml. The mixture is incubated for 3 min at 37 °, cooled, maintained on ice for 2 hr, and then analyzed by centrifugation on a 5 to 20% sucrose gradient (Beckman SWo27.1 or SW-41 Ti rotor). This analytical step is necessary to determine the optimal antibody/subunit ratio for maximal yield of immunodimers. For large-scale preparation the amounts of subunits and antibodies can be increased 10 to 20 times and the final volume of the ~4K. H. Nierhaus and F. Dohme, this series, Vol. 59, p. 443.
[5]
ELECTRON MICROSCOPY OF r R N A
85
incubation mixture is increased up to 0.3 ml. For EM the selected gradient fractions should be freed of sucrose. This is performed by passage of fractions of 0.5 ml through a 0.8 × 5 cm column of BioGel P-100. Typical sedimentation patterns are presented in Fig. 3. Preparation of 30S Ribosomal Subunits Labeled by D N P - H a p t e n at the 5'-End of 16S RNA The reaction studied by Mishenina et aL 15 with a number of short oligonucleotides and poly(U) and extended by us 16 to natural RNAs is employed to attach the hapten to the 5'-terminal phosphate group of RNA (Scheme II). Below, this reaction is described for the preparation of 30S
Ro-~.-o. + Nn,C~C~N. MO,~t'-(t'~') RO-.~-K.F.~-'-(~MO~ ONO~ dr o~, R=I6S RNA
SCHEME 2. Amidation reaction of the 16S RNA 5'-terminal phosphate group by D N P ethylenediamine.
subunits labeled with hapten at the 5'-end of 16S RNA. However, it can be applied to any RNA and the yield of the reaction remains high, regardless of the molecular weight of the RNA. The reaction is very specific and does not proceed at all with internucleotide phosphodiester groups or purine and pyrimidine bases. It is carried out in organic solvents. This rules out the use of hydrophilic haptens. Instead, the hydrophobic ligand, DNPethylenediamine, is employed for this purpose. Also, some problems arise when RNA treated with organic solvents is used in reconstitution experiments. After such treatment, RNA acquires an inactive conformation and loses its competence for reconstitution. Therefore, we had to develop a special procedure to restore the active conformation of the 5'-modified RNA; such a procedure may be of general interest. Materials and Reagents
Triphenylphosphine and 2,2'-dipyridyl disulfide (Merck) are recrystallized twice from petroleum ether DNP-ethylenediamine is prepared as described in Ref. 16 ~s G. F. Mishenina, V. V. Samukov, and T. N. Shubina, Bioorg. Khim. 5, 886 (1979). ]6 L. V. Mochalova, I. N. Shatsky, and A. A. Bogdanov, Bioorg. Khim. 8, 239 (1982).
86
ELECTRON MICROSCOPY
[5]
Antibodies against DNP-haptens are prepared as described by Mochalova eta[. 17 Alternatively, antisera from Miles can be used after purification by affinity chromatography Solvents used include dimethylformamide and ethyl acetate
Buffers V: 15 m M Sodium citrate, pH 7.2, 150 m M NaC1 VI: 30 m M Tris-HCl, pH 7.5, 300 m M KC1 VII: 1 m M Potassium phosphate, pH 7.0
Modification of the Y-Terminal Phosphate Group of l 6S RNA 16S RNA isolated from 30S subunits by deproteinization with phenol is dialyzed against buffer V overnight, the excess salts being removed by dialysis against water for 3 hr. The sodium salt of 16S RNA thus obtained is lyophilized and dissolved in water to a concentration of 20 mg/ml. Amidation of the 5'-phosphate with DNP-ethylenediamine is carried out according to the method described by Mishenina et al.15 with some modifications.~6 One hundred microliters of DNP-ethylenediamine (5-10/zmol) in dimethylformamide is added to 10/zl of 16S RNA ( 3 - 6 A2~o units) in water at 5 °. Then 2,2'-dipyridyl disulfide (50 pmol) and triphenylphosphine (50/tmol) are alternately added to this mixture in small portions for 2 hr at 20 ° in the dark. Ten volumes of cold ethyl acetate saturated with anhydrous NaC104 are added to isolate the 16S RNA from the reaction mixture. It is allowed to stay for several hours at - 20 °. (Usually at this step from 25 to 50% of 16S RNA is lost, and this loss should be taken into account when calculating the initial amount of 16S RNA that is necessary for the whole experiment.) The modified 16S RNA is pelleted by low-speed centrifugation and washed several times with NaC104/ethyl acetate. Finally, the 16S RNA is dissolved in water and precipitated twice with ethanol. If necessary, the RNA can be purified additionally by LiCI precipitation. For this, the ethanol-precipitated 16S RNA is dissolved in water and mixed with an equal volume of 6 M LiC1. The resulting mixture is kept at 0 ° overnight. The Li/16S RNA is pelleted by centrifugation and Li+ is replaced by K + by dialysis overnight against buffer VI.
Reactivation of 5'-Modified 16S RNA and Its Reconstitution into 30S Subunits 16S RNA modified at the 5'-end as described above cannot be reconstituted into 30S subunits. This is a result of a considerable, if not total, ,7 L. V. Mochalova, I. N. Shatsky, A. A. Bogdanov, and V. D. Vasiliev, J. Mol. Biol. 159, 637 (1982).
[5]
A 26c
ELECTRON
o
i 3os
MICROSCOPY
OF rRNA
b
87
c
3os
24S~ 30S
-
0.5
I I
I 2
I 3
I
2
3
4
I I
I 2
I 3
I 4
Volume (ml)
FI~. 4. Sedimentation of the reconstituted modified and unmodified 30S subunits. (a) 30S subunits reconstituted from unmodified 16S RNA; (b) particles reconstituted from the DNP-modified 16S RNA; (c) particles reconstituted from the DNP-modified 16S RNA after heating for 3 rain at 100". A 10 to 30% sucrose gradient in reconstitution buffer was used. Centrifugation was done on a Beckman SW-50.1 rotor, 48,000 rpm, 4 hr. From Mochalovaet aL 17
denaturation o f the initial macromolecular structure o f 16S RNA because o f treatment with organic solvents. The only procedure that leads to a partial restoration o f the active conformation o f 16S R N A is based on that of Barritault et al,18 16S R N A in buffer VI is dialyzed against buffer VII for 3 hr, heated at 100 ° for 3 min, and then slowly cooled to r o o m temperature. After such an "annealing" the 16S R N A is dialyzed against the appropriate solution that is necessary for 30S reconstitution in vitro. The reconstitution is carded out according to the procedure described above. Annealed 16S R N A has, to a large extent, a restored capacity (to 6 0 - 7 0 % ) to interact with ribosomal proteins and to form 30S subunits (see Fig. 4). Dimer Formation
I m m u n o c o m p l e x e s 3 0 S - I g G - 3 0 S are obtained just as described above for 30S subunits labeled at the 3'-end o f 16S RNA. P r e p a r a t i o n o f 5S r R N A L a b e l e d b y H a p t e n at a n I n t e r n a l P o s i t i o n o f Its P o l y n u c l e o t i d e C h a i n Principle
Here we describe one o f the approaches whereby the hapten residue can be introduced into an internal position o f a polyribonucleotide chain. 5S ,s D. Barritault, M. F. Guerin, and D. H. Hayes, Eur. J. Biochem. 98, 567 (1979).
88
ELECTRON MICROSCOPY
[5]
ribosomal RNA proves to be suitable for this purpose. A single cut can be introduced into this molecule between residues C3s and A39 or A39 and U4o. The large fragment of 5S RNA after its separation from the small one is modified by the DNP-hapten at its 5'-end. After annealing of the nonmodified small fragment and the modified large one, the reassociated 5S RNA is readily incorporated into 50S subunits by in vitro reconstitution. This turns out to be possible because the modified single-stranded region of 5S RNA does not seem to be responsible either for incorporation of 5S RNA into the 50S subunit or its function, t9-2~ Materials and Reagents Nuclease S~ is from Biolar, USSR For other materials, see the preceding section
Buffers VIII: 20 m M Sodium acetate, 10 m M NaC1, 2 m M ZnCI2, 4 m M MgC12, pH 4.5 IX: 20 m M Tris-HC1, pH 7.5, 200 m M KCI, 10 m M MgCI2 Buffer GFS: 0.5 m M ammonium acetate, 0.5% SDS, 1 m M ethylenediamine tetraacetic acid (EDTA) Electrophoresis buffer (EB) I: 50 m M Tris-H3BO3, pH 8.3, 2 m M EDTA EB II: 40 m M Tris, 10 m M EDTA, pH 7.3
Procedure One hundred A260 units of 5S RNA are digested with 2000 units of SI nuclease in 2 ml of buffer VIII at 25 ° for 5 rain. The digest is fractionated by 7.5% polyacrylamide/7 M urea gel electxophoresis. Gel composition: 0.375% bisacrylamide, 7.12% acrylamide in EB I. Before loading on the gel, samples are dissolved in buffer I containing 7 M urea, bromphenol blue, and xylene cyanole. Electrophoresis is carried out at 500 V. 5S RNA and its 41- and 79-nucleotide-long fragments (products of digestion of 5S RNA with ribonuclease TI) can be employed as markers. The bands are detected by UV-shadowing and fragments are eluted from the corresponding gel pieces with buffer GFS + 0.5 vol of H20-saturated phenol. (The phenol layer should completely cover the gel.) Elution is performed for 8 hr with shaking. The fragments are precipitated with ethanol and addi19N. Delihas, J. Dunn, and V. A. Erdmann, F E B S L e t t . 58, 76 (1975). 20R. Monier, in "Ribosomes" (M. Nomura et al., eds), p. 141. Cold Spring Harbor Lab., Cold Spring Harbor, New York, 1974. 2t L. Zagorska, J. Van Duin, H. F. Noller, B. Pace, K. D. Johnson, and N. R. Pace, J. Biol. Chem. 259, 2798 (1984).
[5]
ELECTRON MICROSCOPYOF rRNA
89
tionally freed from acrylamide contamination by precipitation with 0.2 M CaC12 (final concentration). The Ca precipitate is dissolved in 10 m M EDTA, pH 7.2, and reprecipitated twice with ethanol. Modification of the large fragment at the 5'-phosphate group by D N P ethylenediamine is carried out as indicated in the preceding section. To reassociate the fragments into D N P - 5 S RNA, 3.2 A26o units of the 5S RNA small fragment and 6.0 A260 units of the DNP-modified large fragment are slowly cooled for 1.5 hr in 0.6 ml of buffer IX from 60 ° to 0 °, followed by ethanol precipitation. Assembly of the fragments into DNP-5S RNA is checked by 7.5% polyacrylamide gel electrophoresis in EB II with 5S RNA as marker. Reconstitution of 50S ribosomal subunits containing D N P - 5 S RNA and preparation of immunocomplexes are performed as described above. EM Technique Negative staining is used exclusively in IEM. There are three modifications: the droplet, single carbon layer, and double carbon layer techniques. 22 The latter is usually applied. It is assumed to be the best for revealing both the ribosomal subunits and the antibody molecules, which are different in thickness. However, we have obtained good results using the droplet and single carbon layer techniques. In the droplet technique the preparation is deposited on the surface of the supporting carbon film as described above (see EM Studies of the Naked rRNAs). The grid is then lowered with forceps onto the drop of 1 to 2% aqueous solution of uranyl acetate. After 1 to 5 rain the grid is removed, the solution is sucked offwith filter paper, and dried. With the use of the single carbon layer technique staining is done as in Ref. 22. It is convenient to use a simple micromanipulator for gentle lowering and lifting of the forceps clamping the mica. In general, three-dimensional localization of the IgG binding site requires its localization in at least two different projections. However, there are cases when this is not necessary. Figure 5 shows an example of fine staining of the 30S- IgG- 30S complex with the droplet technique. Both of the 30S subunits in the complex are in equivalent intermediate enantiomorphic projections. 23 However, the morphology of the 30S subunit is such that these projections are sufficient for three-dimensional localization of the binding site of the antibody molecule.
22j. A. Lake,this series,Vol. 61, p. 250. 23V. D. Vasiliev,Acta Biol. Med. Germ. 33, 779 (1974).
90
ELECTRON MICROSCOPY
[5]
Fro. 5. Two reconstituted 30S subunits containing Y-modified 16S RNA bound by a hapten-specific antibody molecule. Negative staining by the droplet method. From Shatsky et al. 9
The experiments on mapping the 3'-ends of 23S RNA and 5S R N A 24'25 and the Y- and 5'-ends of the template polynucleotide26 have shown that the single carbon layer technique also reveals distinctly the antibody molecules both in the 50S-IgG-50S and 70S-IgG-70S complexes, where the difference in the thickness of IgG and the ribosomal particle is even greater than in the 30S-IgG-30S complex. At the same time, in our opinion, the single carbon layer technique reveals ribosome fine structure better than that obtained with the double carbon layer technique. Comments The approach described above for studying ribosomal RNA topography can be also employed to localize other RNA components of the translational apparatus. Thus, the position of the ends of the mRNA segment on the ribosomal surface has been determined and some important conclusions on mRNA binding site organization have been d r a w n . 26 This hapten approach to IEM also has some advantages over IEM methods utilizing antibodies raised directly against a ribosomal component.
24 I. N. Shatsky, A. G. Evstatleva, T. F. Bystrova, A. A. Bogdanov, and V. D. Vasiliev, F E B S Lett. 122, 251 (1980). 25 I. N. Shatsky, A. G. Evstafieva, T. F. Bystrova, A. A. Bogdanov, and V. D. Vasiliev, F E B S Left. 121, 97 (1980). 2+A. G. Evstatieva, I. N. Shatsky, A. A. Bogdanov, Y. P. Semenkov, and V. D. Vasiliev, E M B O J. 2, 799 (1983).
[5]
ELECTRON MICROSCOPY OF rRNA
91
The haptens can also be employed to localize protein components of r i b o s o m e s . 27,2s
That the hapten has only a single antigenic determinant and a flexible connection between the antibody molecule and the ribosome provides advantages to the hapten approach over the traditional one. The method of modification of the 5'-phosphate groups, described here in detail, broadens significantly our potential to introduce not only hapten residues but also fluorescent and affinity labels into RNA molecules. There are some problems concerning the modification of RNA at internal positions of its polynucleotide chain that prevent the method described above from being generally applied. The most promising approach has been proposed by Gayda et al. 29 and is based on the use of short complementary oligodeoxyribonucleotides and ribonuclease H to produce specific single cuts in the internal sites of RNA species with a stable macromolecular structure.
27 M. StOtfler-Mcilicke, B. Epe, K. G. Steinh~user, P. Woolley, and G. StOitler, FEBS Lett. 163, 94 (1983). 2s M. St6fller-Meilicke, B. Epe, P. Woolley, M. Lotti, J. Littlechild, and G. St6mer, Mol. Gen. Genet. 197, 8 (1984). 29 G. Z. Gayda, A. Y. Spounde, E. A. Skripkin, V. K. Kagramanova, V. D. Veyko, N. V. Chichkova, and A. A. Bogdanov, Bioorg. Khim. 8, 1052 (1982).
[6]
CRYSTALLOGRAPHIC
STUDIES ON RIBOSOMES
95
[6] C r y s t a l l o g r a p h i c a n d I m a g e R e c o n s t r u c t i o n S t u d i e s on Ribosomal Particles from Bacterial Sources By A. YONATH and H. G. WITTMANN
Introduction Diffraction methods are the most powerful techniques for reliable elucidation of molecular structures. Such structural information is essential for detailed understanding of mechanisms of biological processes, including protein biosynthesis. Application of diffraction techniques is dependent on the availability of crystalline material. Because of the enormous size, the instability and flexibility of ribosomes, and the intricate and asymmetric nature of their structure, the in vitro growth of three- and two-dimensional crystals seemed, until recently, to be a formidable task. Nevertheless, procedures for crystallization of intact ribosomal particles have been developed recently, and structural analysis of several systems is currently being performed. In this chapter we discuss two techniques: X-ray crystallography and three-dimensional image reconstruction. Progress in structural studies of particles as large and as complex as ribosomes hinges on the correlation of the crystallographic data with electron microscopy. The large size of ribosomal particles, which is an obstacle for crystallographic studies, permits direct investigation by electron microscopy. Thus, electron microscopy can provide a useful tool for rapid evaluation and refinement of crystallization conditions. Using electron microscopy, the initial steps of crystallization can be detected and the tendency of native and modified particles to crystallize can be followed rather quickly, in contrast to the long time needed for the growth of large three-dimensional crystals. Results from electron microscopy can also be used to locate and orient the particles within the crystals and models obtained by three-dimensional image reconstruction may facilitate extraction of phase information. Thus, structure determination by three-dimensional image reconstruction from twodimensional sheets is justified not only in its own right, but also because of its expected contribution to the determination of phases needed for crystallographic analysis. Ribosomes from several eukaryotic species may, under special conditions, organize in vivo into two-dimensional sheets. Therefore they seem to be suitable objects for in vitro crystallization. On the other hand, ribosomes from prokaryotes provide a system for crystallization which is independent of in vivo events. They are smaller and have been characterized biochemiMETHODS IN ENZYMOLOGY, VOL, 164
C ~ t © 1988 by Academic Press, Inc. All rights of reproduction in any form reserved,
96
OTHER BIOPHYSICAL METHODS
[6]
cally in much greater detail than those from eukaryotes. In addition, they can be produced in high purity and large quantity. For effective crystallographic studies, a constant supply of crystallizable material is essential. Suitable sources are those from which one can obtain reproducibly high-quality ribosomes in sufficient amounts for refinement of the crystallization conditions as well as for the production of large crystals needed for data collection. It was found that for the crystallization particles, virtually all preparations of active material yield crystals or twodimensional sheets. These include the whole 70S ribosomes of Bacillus stearothermophilus and E. coli, the 30S subunits of Thermus thermophilus and E. coli, and 50S subunits ofB. stearothermophilus and Halobacterium marismortui. However, because of the intricate nature of the particles, the exact conditions for the growth of well-ordered large crystals still must be varied for each ribosomal preparation. Some details of the preparation are given below. Cells of B. stearothermophilus (strains 799 and NCA-1503) are grown in 50-hter fermenters 1'2 and those of H. marismortui 3 in fermenters of 100 liters. 4,5 The bacteria are harvested in early log phase by continuous flow centrifugation and stored at - 8 0 °. Ribosomes are prepared by differential centrifugation after grinding the cells with alumina powder. Ribosomal subunits are separated in a Til 5 zonal rotor. The subunits of B. stearothermophilus are pelleted either by high-speed centrifugation or by precipitation with 10% polyethylene glycol 6000 followed by low-speed centrifugation, whereas those of H. marismortui are concentrated by ultracentrifugation. It is crucial that the preparation not be frozen at any stage of preparation. The integrity and the biological activity of the ribosomal particles are defined by three criteria: (1) migration profiles in sucrose gradients, obtained by centrifugation in a SW60 rotor; (2) two-dimensional gel electrophoresis of ribosomal proteins using the procedures6'7 for B. stearothermophilus and H. marismortuL respectively; (3) activity in protein biosynthesis ' V. A. Erdmann, S. Fahnestock, K. Higo, and M. Nomura, Proc. NatL Acad. Sci. U.S.A. 68, 2932 (1970). 2 A. Yonath, J. Mfissig, B. Tesche, S. Lorenz, V. A. Erdmann, and H. G. Wittmann, Biochem. Int. 1,428 (1980). 3 M. Ginzburg, L. Sachs, and B. Z. Ginzburg, J. Gen. Physiol. 55, 187 (1970). 4 M. Mevarech, H. Eisenberg, and E. Neumann, Biochemistry 16, 3781 (1977). 5 A. Shevack, H. S. Gewitz, B. Hennemann, A. Yonath, and H. G. Wittmann, F E B S Lett. 184, 68 (1985). 6 D. Geyl, A. BOok, and K. Isono, MoL Gen. Genet. 181, 309 (1981). 7 L. P. Visentin, C. Chow, A. T. Matheson, M. Yaguchi, and F. Rollin, Biochem. £ 130, 103 (1982).
[6]
CRYSTALLOGRAPHIC STUDIES ON RIBOSOMES
97
using the poly(U) system according to Nierhaus and co-workers8,9 for B. stearothermophilus and H. marismortui, respectively. Three-Dimensional Image Reconstruction Electron microscopy enables direct imaging of biological structures at a macromolecular level. Image reconstruction permits determination of three-dimensional structures from periodically ordered arrays. Combined with electron microscopy, image reconstruction is useful for determination of structures of large biological macromolecules and assemblies at moderate resolution. Three-dimensional image reconstruction has been developed recently, has grown in popularity, and is now considered a standard procedure. It involves averaging, by Fourier transformation, of images obtained by electron microscopy of tilt series of periodically organized identical objects. The principles of this method have been described.~° There are several limitations to three-dimensional image reconstruction and to visualization of single particles by electron microscopy. These arise from the difficulties of preserving biological specimens in the microscope vacuum, from radiation damage, and from the influence of the staining procedure on the resulting model. However, there is a fundamental difference between structural analysis by electron microscopy and by three-dimensional image reconstruction. Whereas visualization of isolated particles is rather subjective, three-dimensional image reconstruction is based on diffraction and thus is inherently of a more objective character. Furthermore, it is conceivable that isolated particles tend to lie on grids in a few preferred orientations. As a result of the contact of the particles with the flat grids, their projected views are likely to be somewhat distorted. In contrast, particles within the crystalline sheets are held together by interparticle contacts. These contacts construct a network which may stabilize the conformation of the particles and decrease, or even eliminate, the influence of the flat surfaces of the grids. The advantages of three-dimensional image reconstruction from ordered two-dimensional sheets can be demonstrated in the cases of the 80S ribosomes from lizards |t and the 50S ribosomal subunits from B. stearothermophilus. ~2 For both, the reconstructed models are of the same size and contain the features observed by visualization or reconstruction of 8 K. H. Nierhaus, K. Bordasch,and H. E. Homann, J. MoL Biol. 74, 584 (1973). 9H. Saruyamaand K. H. Nierhaus, FEBS Lett. 183, 390 (1985). ~oSee, for example, L. A. Amos, R. Henderson, and P. N. T. Unwin, Prog. Biophys. Mol. Biol. 39, 183 (1985). n R. A. Milligan and P. N. T. Unwin, Nature (London) 319, 693 (1986). ~2A. Yonath, K. R. Leonard, and H. G. Wittmann, Science 236, 813 (1987).
98
OTHER BIOPHYSICAL METHODS
[6]
single particles by electron microscopy, but at the same time show key features (e.g., a long tunnel) which could not be detected otherwise. The subjects for three-dimensional image reconstruction are either two-dimensional sheets or thin sections of embedded three-dimensional crystals. These are stained with the same materials used for conventional electron microscopy. For the elucidation of the external contour of particles, two-dimensional sheets are studied mainly unstained or negatively stained with inert materials. In contrast, thin sections of embedded crystals must be positively stained and, when reconstructed, yield information about the distribution of the stain within the studied object. Still, there are boundary cases. Not all negative stains are truly inert. Some, such as uranyl acetate, interact with selected compounds, e.g., rRNA, of the particles. On the other hand, positive stains, which should reveal the internal distribution of the material with which they interact, may contrast preferentially selected parts of the ribosomal particles according to the extent of their accessibility. Reconstruction from unstained specimens is best since it is free from the stain influence, thus giving rise to models whose boundaries are determined by differences in contrast. Furthermore, such studies may show the internal distribution of various compounds of the particles. In addition, the diffraction patterns of unstained specimens usually extend to higher resolution than the comparable stained ones. Unfortunately, this procedure cannot be applied to two-dimensional sheets which have been grown in the presence of salts, since on cooling the excess salt crystallizes on the grids and prevents visualization of the two-dimensional sheets. In favorable cases the influence of the staining procedure is minimal. One example may be the tunnel of the large ribosomal subunits. It is clearly resolved in all reconstructions of salt-grown sheets of the 50S subunits of B. stearothermophilus, independent of the staining material, t2 as well as in the reconstructed model of the unstained sheets from chick embryos.11 Three-dimensional image reconstruction has been successfully applied to some interesting biological systems including two-dimensional sheets and thin sections of crystals of ribosomal particles. 11-19 However, because ~3j. A. Lake and H. S. Slayter, J. Mol. Biol. 66, 271 (1972). 14 p. N. T. Unwin, J. Mol. Biol. 132, 69 0979). 15 R. A. Milligan and P. N. T. Unwin, J. CellBiol. 95, 648 (1982). ~6R. A. Million, A. Brisson, and P. N. T. Unwin, Ultramicroscopy 13, 1 (1984). 17W. Kuhlbrandt and P. N. T. Unwin, J. Mol. Biol. 156, 431 (1980). ~s K. R. Leonard, T. Arad, B. Tesche, V. A. Erdmann, H. G. Wittmann, and A. Yonath, Electron Microsc. 1982 3, 9 (1982). 19L. O'Brien, K. Shelley, J. Towtighi, and A. McPherson, Proc. Natl. Acad. Sci. U.S.A. 77, 2260 (1980).
[6]
CRYSTALLOGRAPHIC STUDIES ON RIBOSOMES
99
the order of the two-dimensional sheets is expressed only in a plane, because the objects are viewed in projection rather than in three dimensions, and because the data obtained by tilting are limited (data above a certain tilt angle, the "missing cone," and the (001) reflections are always absent), this technique alone is bound to provide only partial structural information. In Vivo Grown Two-Dimensional Sheets of Ribosomal Particles from Eukaryotes
This article focuses on ribosomal particles from prokaryotes. Because the first objects to be studied by three-dimensional image reconstruction were naturally occurring two-dimensional sheets from eukaryotic ribosomes, a brief description of results obtained from these systems is given below. Under special stressful conditions (such as cooling, lack of oxygen, and hibernation) ribosomes of some eukaryotic species (lizard, chicken, amoeba, and human) associate with each other in vivo to form periodic objects such as helices and two-dimensional ordered layers) 1,13-17,19-23 Furthermore, a semi-in vitro procedure for crystallization of ribosomes from chick embryos subjected to cold treatment has been developed in cell suspensions.tS,24 These sheets and helices are usually made of whole ribosomes and consist of relatively large unit cells. Furthermore, the ribosomes which comprise these sheets are bound to membranes, which may introduce noise when investigated by electron microscopy. In spite of these unfavorable properties, and because until recently there were no other systems of periodically packed ribosomal particles, they have been subjected to threedimensional image reconstruction studies and have yielded useful low-resolution (55- 120 A) information. Sizes of several ribosomal particles have been determined, either directly from the reconstructed particle or indirectly from the unit cell parameters. Thus, the minimum size of the large subunit in brains of senile humans can be derived from lattices which consist of unit cells as small as 130 × 130 A.~9 Information was also derived about the distribution of materials within the particles. It was observed that the rRNA-rich regions are concentrated in the interior of the ribosomes as well as in the interface area between the large and small subunits. For lizard ribosomes a narrow elongated (150-200 A length) region of low density has been detected. This region originates near the 2oB. Byers,J. Mol. Biol. 26, 155 (1967). 21y. Kress, M. Wittner, and R. M. Rosenbaum,J. CellBiol. 49, 773 (1971). 22C. Taddei,Exp. CellRes. 70, 285 (1972). 23M. Barbieri,J. Supramol. Struct. 10, 349 (1979). 24M. Barbieri,J. Theor. Biol. 91, 545 (1982).
100
OTHER BIOPHYSICAL METHODS
[6]
subunit interface and passes through the rRNA-rich core to a point close to the membrane attachment site. It was assigned to be a channel which may provide a path for the nascent polypeptide.H Tetramers are the building units of membrane-bound double layers of whole ribosomes from oocytes of the lizard Lacerta sicula as well as in the ordered sheets of early chick embryos formed in vivo and in cell suspensions) i,~4,~7In both systems, the large ribosomal subunits are located in the center of the tetramer and are involved in the contacts within and between tetramers.
In Vitro Growth of Two-Dimensional Sheets of Ribosomal Particles from Prokaryotes Most of the two-dimensional sheets from prokaryotic ribosomal subunits have been grown in vitro from low-molecular-weight alcohols by vapor diffusion in hanging drops. 25-2s Recently, mixtures of salts and alcohols have been used for the growth of two-dimensional sheets in depression slides or on electron microscopy grids.29-3~ Because only a small fraction of the particles in the crystallization medium comprises the twodimensional sheets, these cannot be separated from the rest of the crystallization mixture. Thus, evidence for the integrity of the ribosomal particles in the sheets may be obtained indirectly by testing the biological activity and the migration profile of the entire crystallization medium. The reconstructed model of the 50S particles from Bacillus stearothermophilus at 30 A resolution ~2shows substantially more detail (Figs. 1 and 2). It includes several projecting arms which are arranged radially near the presumed interface with the 30S subunit, around a cleft which turns into a Y-shaped tunnel of up to 25 A in diameter, in which the longest distance is 100- 120 A. This tunnel spans the particle and may provide the path taken 23M. W. Clark, M. Hammons, J. A. Langer, and J. A. Lake, J. Mol. Biol. 135, 507 (1979). 26j. A. Lake, in "Ribosomes: Structure, Function and Genetics" (G. Chambliss, G. R. Craven, J. Davies, K. Davies, L. Kahan, and M. Nomura, eds.), p. 207. University Park Press, Baltimore, Maryland, 1980. 27M. W. Clark, K. R. Leonard, and J. A. Lake, Science 216, 999 (1982). 2s T. Arad, K. R. Leonard, H. G. Wittmann, andA. Yonath, EMBOJ. 3, 127 (1984). 29T. Arad, J. Piefke, S. Weinstein, H. S. Gewitz, A. Yonath, and H. G. Wittmann, Biochimie 69, 1001 (1987). 30j. Piefke, T. Arad, I. Makowski, H. S. Gewitz, B. Hennemann, A. Yonath, and H. G. Wittmann, FEBS Lett. 209, 104 (1986). 3mA. Yonath, M. A. Saper, and H. G. Wittmann, in "Structure, Function and Genetics of Ribosomes" (B. Hardesty and G. Kramer, eds.), p. 112. Springer-Verlag, Heidelberg, Federal Republic of Germany, 1986. 32Deleted in proof.
[6]
CRYSTALLOGRAPHIC STUDIES ON RIBOSOMES
101
FIG. 1. Computer graphic display of the outline of the reconstructed model of the 50S ribosomal subunit at 30 A resolution. (a) A side view of the model. The entire particle and part of a second one are shown. The arrow (i)points at the crystalcontact between the two particles.(×) marks the approximate axis around which the model was turned to obtain the view shown in (b).(b) The model shown in (a)rotatedabout the (X) axis.(f)points at the cleft between the projectingarms, at the sitewhere itturns into the tunnel. The exitof the tunnel is marked (c).(c) A view into the tunnel from the cleft.
by the nascent polypeptide chain. 12 When only the resolution features of up to 55 A are included in the reconstructions of the 50S particles, the overall shape of the 50S particle is almost spherical and it contains only two thick, short arms. In this respect it resembles the models derived from visualization of isolated particles) TM A tunnel in a similar location was also detected in the reconstructions of the whole 70S ribosome for B. stearothermophilus at 47 A resolution. Other interesting details which were revealed by the three-dimensional reconstruction of the 70S ribosomes include an empty space in the interface of the two subunits large enough to accommodate the components of protein biosynthesis (e.g., tRNA and elongation factors), as well as a groove on the small subunit, rich in RNA, which may be the binding site for the mRNA. 29
33 For a review, see H. G. Wittmann, Annu. Rev. Biochem. 52, 35 (1983). 34 For a review, see G. Chambliss, G. R. Craven, J. Davies, K. Davies, L. Kahan, and M. Nomura (eds.), "Ribosomes: Structure, Function and Genetics." University Park Press, Baltimore, Maryland, 1980.
102
OTHER BIOPHYSICAL METHODS
[6]
FIG. 2. The model viewed in a projection which resembles models derived from electron microscopy of single particles.
Thin Sections of Embedded Three-Dimensional Crystals When no two-dimensional sheets or large three-dimensional crystals are available, three-dimensional microcrystals may be used for obtaining some three-dimensional information. Since microcrystals are too thick for direct investigation by electron microscopy, they may be sectioned into thin sections. These are positively stained and used for image reconstruction studies. The information obtained from such analysis is somewhat
[6]
C R Y S T A L L O G R A P H I C STUDIES ON RIBOSOMES
103
limited by the lower resolution of the sectioned material and by difficulties in determining the exact sectioning direction. Furthermore, the interpretation of the images is hampered by uncertainty as to the factors governing the stain distribution within the particle, whose chemical nature is not completely defined. In spite of these unfavorable factors, some valuable information concerning the internal distribution of the ribosomal components has been obtained from three-dimensional image reconstruction of thin sections of embedded three-dimensional crystals. Furthermore, in principle, the reconstructed images of the positively stained portions of particles may be incorporated within the outer boundaries obtained from three-dimensional image reconstruction of two-dimensional sheets. Three-dimensional image reconstruction studies on positively stained thin sections of three-dimensional crystals of the large ribosomal subunits from B. stearothermophilus ~s,31indicate that most of the ribosomal RNA is located in two domains in the core of the particle, whereas the proteins are located closer to the surface. This is in agreement with results obtained from unstained two-dimensional sheets of ribosomes from chick embryos and Lacerta sicula. ~,~5 Crystallography of Ribosomal Particles X-Ray crystallography is the only direct method for the determination of complete three-dimensional structures. Inherently, crystallographic studies are not affected by the limitations imposed by other diffraction techniques. About 30-60% of the volume of three-dimensional crystals of biological macromolecules is occupied by solution. Moreover, in contrast to the need to evacuate samples for investigation by electron microscopy, during crystallographic data collection the crystals are kept at high relative humidity, conditions under which a native conformation is likely to be preserved. In addition, the objects studied by X-ray crystallography are periodically arranged in three dimensions, whereas three-dimensional image reconstruction is performed on two-dimensional sheets which lie on flat grids in a specific manner. The geometrical properties of measuring devices--X-ray cameras, detectors, and diffractometersm used for crystallographic studies permit rotations in space. Hence, the three-dimensional crystals are investigated throughout the whole sphere of reflection rather than from a limited tilt series used for image reconstruction. X-Ray structure determination of macromolecules has recently advanced rapidly, especially in the effectiveness in collecting, processing, and analyzing crystallographic data. Consequently, the structure of several
104
OTHER BIOPHYSICAL METHODS
[6]
large biomolecular assemblies have been determined) s-41 However, full crystallographic structure analysis is still a lengthy stepwise procedure, requiring a high level of sophistication, much effort, resources, and advanced technology. A description of the basic concepts of structure determination of biological macromolecules by X-ray crystallography is beyond the scope of this chapter. The reader is advised to consult several excellent books? 2-4S Here we discuss the potential application of X-ray crystallography to structural determination of ribosomal particles. Crystal Growth
Three-dimensional crystal of intact ribosomal particles were grown only after an intensive systematic exploration of crystallization conditions and the development of an innovative experimental procedure for fine control of the content and volume of the crystallization drop. ~ Once the crystallization method was developed, it was found to be reproducible and crystals of 70S ribosomes from E. coli 47, 30S ribosomal subunits from Thermus thermophilus, as well as of 50S ribosomal subunits from B. stearothermophilus 4s-53 and from H. rnarismortul~'54'55 have been obtained. For each crystal form the quality of the crystals depends, in a manner not yet fully characterized, on the procedure used in preparation of the ribosomal subunits and on the bacterial strain.
35T. Richmond, J. T. Finch, B. Rushton, D. Rhodes, and A. Klug~ Nature (London) 311, 533 (1984). 36 C. Abad-Zapatero, S. S. Abdel-Maguid, J. E. Johnson, A. G. W. Leslie, I. Rayment, M. G. Rossmann, D. Suck, and T. Ysuldhar, Nature (London) 286, 33 (1980). 37 j. E. Anderson, M. Ptashne, and S. C. Harrison, Nature (London) 316, 596 (1985). 3s j. Deisenhofer, O. Epp, K. Mild, R. Huber, and H. Michel, Nature (London)318, 618 (1985). 39 I. A. Wilson, J. J. Skehel, and D. C. Wiley, Nature (London) 289, 366 (1981). 4o j. M. Hogle, J. Mol. Biol. 160, 663 (1982). 4t L. Liljas, T. Unge, A. Jones, K. Fddborg, S. Lovgren, U. Skoglund, and B. Strandberg, J. Mol. Biol. 159, 93 (1982). 42 j. p. Glusker and K. N. Trueblood, "Crystal Structure Analysis." Oxford University Press, Oxford, England, 1972. 4ac. R. Cantor and P. R. Schimmel, "Biophysical Chemistry," Part II, Chap. 13, p. 687. Freeman, San Francisco, California, 1980. 44 T. L. Blundell and L. N. Johnson, "Protein Crystallography," Academic Press, New York, 1976. 45 H. W. Wyckoff, C. H. W. Hirs, and S. N. Timasheff(eds.), this series, Vols. 114 and 115. A. Yonath, J. MOssig, and H. G. Wittmann, J. CellBiochem. 19, 629 (1982). 47 H. G. Wittmann, J. M0ssig, H. S. Gewitz, J. Piefke, H. J. Rheinberger, and A. Yonath, FEBSLett. 146, 217 (1982).
[6]
CRYSTALLOGRAPHIC STUDIES ON RIBOSOMES
105
It was observed that there is a correlation between crystallizability and biological activity. So far, inactive ribosomal particles could not be crystallized. Moreover, in spite o f the natural tendency o f ribosomes to disintegrate, all crystallized particles retain their biological activity, even for several months, in contrast to the short life time o f isolated ribosomes in solution. This property accords well with the hypothesis that, when external conditions (e.g., hibernation) d e m a n d prolonged storage o f potentially active ribosomes in living organisms, temporary periodic organization occurs in vivo. 24'56 All three-dimensional crystals from intact ribosomal particles have been grown by a c o m m o n technique used in protein crystallography, namely vapor diffusion. 57,5s It is based on a slow increase in the concentration o f the crystallizing material (protein or nucleic acid) by controlled evaporation o f the solvent in the crystallization drop. This is achieved in closed systems by equilibrating small droplets o f the crystallizing solution, which also contains a precipitant, with reservoirs o f solutions of higher concentration o f the precipitant. For the crystallization o f ribosomal particles from eubacteria this procedure was somewhat modified. Because these particles fall apart at high salt concentrations, volatile organic solvents were used as precipitants. The crystallization droplets, which contain no precipitant or an extremely small quantity o f it, are equilibrated with a reservoir containing the precipitant as well as an inert salt. In this way, crystallization is facilitated by the diffusion o f the organic solvent into the
4s A. Yonath and H. G. Wittmann, Biophys. Chem. 29, 17 (1988). 49A. Yonath, B. Tesche, S. Lorenz, J. Miissig, V. A. Erdmann, and H. G. Wittmann, FEBS Lett. 154, 15 (1983). 50A. Yonath, Trends Biochem. Sci. 9, 227 (1984). 5~A. Yonath, H. D. Bartunik, K. S. Bartels, and H. G. Wittmann, J. Mol. Biol. 177, 201 (1984). 52A. Yonath, M. A. Saper, I. Makowsld, J. Mfissig, J. Pietl~e,H. D. Bartunik, K. S. Bartels, and H. G. Wittmann, J. Mol. Biol. 187, 633 (1986). s3 S. D. Traldaanov,M. M. Yusupov, S. C. Agalarov, M. B. Garber, S. N. Ryazanlscv, S. V. Tischenko, and V. A. Shirokov, FEBS Lett. 2, 319 (1987). 54I. Makowsld, F. Frolow, M. A. Saper, H. G. Wittmann, and A. Yonath, J. Mol. Biol. 193, 819 (1987). 5s M. Sh0ham, H. S. Gewitz, B. Hennemann, J. Piefke,J. MfLssig,T. Arad, H. G. Witlmann and A. Yonath, FEBSLett. 208, 321 (1986). 56A. Liljas, Prog. Biophys. Mol. Biol. 40, 161 (1982). s7 D. R. Davies and D. M. Segal, this series, Vol. 22, p. 266. ss A. MePhearson, in "Methods of Biochemical Analysis" (D. Glick, ed.), Vol. 23, p. 249. Wiley (Interscience),New York, 1976.
106
OTHER BIOPHYSICAL METHODS
6-9 p.I Hanging drop
Hole
/
..
_c_
[6]
Glass plate
~ ,:,
/
e,r, d,s
ii]i]iiiiiiiiiiii::iiiiiiiiiiiiiiii ::::::i' a
~.,
~
,,I ~ l O m l
~--
reservoir
.----X-roy
capillary
Ilcm
-- Crystallizing column 15- 25/zl ~ I0 ml reservoir
b
t 25cm''
FIG. 3. (a) The crystallization system used for vapor diffusion in hanging drops on glass plates. (b) The crystallization system used for vapor diffusion in capillaries.
drop simultaneously with evaporation of water from it. 59 Two different crystallization systems were assembled: (1) hanging drops on glass plates, used mainly for survey since it leads to the growth of microcrystals, and (2) liquid columns in X-ray capillaries (Fig. 3), in which large crystals are obtained. Growing crystals from alcohols imposes many technical difficulties in handling, data collection, and heavy-atom derivatization. This is one reason for using ribosomal particles from Halobacterium. These partis9 A. Yonath, G. Khavitch, B. Tesehe, J. Miissig, S. Lorenz, V. A. Erdmann and H. G. Wittmann, Biochem. Int. 5, 629 (1982).
[6]
CRYSTALLOGRAPHIC STUDIES ON RIBOSOMES
107
cles are stable and active at high salt concentrations and provide a system for crystallization from salts or less volatile compounds. 5,55 For ribosomal particles, as for many other biological systems, it was observed that there is an inverse correlation between the rate of crystal growth and the internal order of the crystals. This correlation is especially pronounced for crystals from halophilic ribosomes, since these grow very quickly, occasionally within a few hours. Attempts to increase the size of the crystals while enhancing their internal order by slowing down the crystallization process have been successful for the halophilic ribosomes. Whereas at very high salt concentrations only disordered microcrystals could be grown, larger and better ordered crystals were obtained as a result of a drastic reduction in the concentration of KC1 in the crystallization mixture as well as in the reservoir (Fig. 4). 31,54,55However, application of similar procedures to B. stearothermophilus has so far failed, probably because ribosomes from this source are less stable, and, upon slowing down the crystallization process, they deteriorate before they are able to aggregate and form proper nucleation centers. 59 Seeding is a procedure in protein crystallography for increasing the size of crystals. It is an extremely delicate procedure but, at the same time, rewarding. The crystal chosen for seeding is harvested from the crystallization mixture in a solution with slightly higher concentration of the precipitant and washed twice in this solution to dissolve micronucleation sites. After removing the washing solution, the crystal is transferred to a drop with a fresh crystallization mixture which has already been equilibrated with the proper reservoir. Application of seeding technique was not possible for the crystals grown from the 50S subunits of B. stearothermophilus. In contrast, this was the ultimate way for obtaining ordered crystals from the same particles from H. marismortui. Advantage has been taken of the major role played by the Mg 2+ concentration in crystallization of ribosomal particles. It was found that three-dimensional crystals of 50S ribosomal subunits from B. stearothermophilus grow in relatively low Mg 2+ concentration, whereas the production of two-dimensional sheets requires a high Mg2+ concentration, at which growth of three-dimensional crystals is prohibited. Similarly, for spontaneous crystal growth of 50S subunits from H. marismortui, the lower the Mg2+ concentration is, the thicker the crystals are. With these points in mind, a variation of the standard seeding procedure has been developed. Thin crystals of the 50S subunits from H. marismortui grown spontaneously under the lowest possible Mg 2+ concentration are transferred to mixtures in which the Mg2+ concentration is so low that the transferred crystals dissolve, but after several days new microcrystals can be observed. These reach their maximum size after 3 - 4 weeks, are very well ordered, and 10- to 30-fold thicker than the original seeds (Fig. 4).
FIG. 4. Growth of large, ordered thrvv-dimensional crystals of the 50S ribosomal subunits from H. marismortui by vapor diffusion at 19°. (Bar length =- 0.2 mm.) (a) Microcrystah obtained within 1-2 days from 7-8% polyethylene glycol, in the presence of 2.5 M KCI,
[6]
CRYSTALLOGRAPHIC STUDIES ON RIBOSOMES
109
The process of crystal growth is initiated by nucleation. Although many biological molecules and complexes have been crystallized, little is known about the mechanism of nucleation. Theoretical models have been developed for the nucleation of crystals of small molecules. 6°,61 However, most of the data currently available concerning the process of nucleation of crystals of biological systems are based on rather indirect evidence, such as monitoring aggregation under crystallization conditions by scattering techniques. 62 Crystals of ribosomal particles provided an excellent system for direct investigation of nucleation. In this study, the crystallization process was interrupted before the formation of mature crystals, and the crystallization medium was examined by electron microscopy. It was found that the first step in crystal growth is nonspecific aggregation and that nucleation starts by a rearrangement within the aggregates. 59 A severe limitation in crystallographic data collection is the shape of the crystals. So far, all crystals of ribosomal particles have one very thin dimension which corresponds to the longest unit cell edge (see below). They grow either as thin needles (50S particles from B. stearothermophilus) or thin plates (same particles from H. marismortut). It is conceivable that, under microgravity conditions, well-ordered crystals with isotropic dimen-
0.5 M NH+C1, 0.15-0.20 M MgCI2, and 10 mM spermidine in the crystallization mixture (pH 5.0-5.2), and equilibrated against 3.0 M KCI, 9% polyethylene glycol, 0.5 M NH+CI, and 0.20 M MgCI2. (b) Crystals obtained within 2-3 days in droplets containinga lower KC1 concentration than used in (a). The droplet of 4-5% polyethylene glycol, in the presence of 1.2-1.7 MKCI, 0.5 M NH4CI, 0.10 M MgC12, and 10 mM spermidine in the crystallization mixture (pH 5.0-5.6), was equilibrated against 3.0 M KCI, 9% polyethylene glycol, 0.5 M NH4C1, and 0.10 M MgCI2. (c) Crystals obtained within 3-5 days from droplets similar to those used for (b), equilibrated with reservoirs of lower KC1 concentrations. The droplet of 4-5% polyethylene glycol, in the presence of 1.2 MKCI, 0.5 M NH+CI, 0.05-0.10 M MgCI2, and 10 mM spermidine in the crystallization mixture (pH 5.0-5.6), was equilibrated against 1.7 M KCI, 9% polyethylene glycol, 0.5 M NH4CI, and 0.10 M MgCI2. Insert: An X-ray diffraction pattern taken perpendicular to the thin axis of the crystals, obtained under conditions described in Fig. 6. (d) Crystals obtained by seeding of crystals from (c) in a crystallization drop containing 5% polyethylene glycol, 1.2 M KC1, 0.5 M NH+C1, and 0.03 M MgCIz, at pH 5.6, which was equilibrated with 7% polyethylene glycol, 1.7 M KCI, 0.5 M NH4CI, and 0.03 M MgC12, pH 5.6. Seeds were small, well-shaped crystals, transferred in a stabilization solution of 7% polyethylene glycol in 1.7 M KC1, 0.5 M NH4CI, and 0.05 M MgC12,at pH 5.6. Insert: An X-ray dit~etion pattern taken perpendicular to the thin axis of the crystals, obtained under conditions described in Fig. 6. 60j. W. Gibbs, "Collected works ofJ. W. Gibbs," p. 55. Longmans, Green, New York, 1928. 6~A. C. Zettlemoyer, "Nucleation." Marcel Dekker, New York, 1969. 62Z. Kam, H. B. Shore, and G. Feher, J. Mol. Biol. 123, 539 (1978).
110
OTHER BIOPHYSICAL METHODS
[6]
sions will be obtained. Thus, attempts to grow crystals of ribosomal particles in a space shuttle are currently underway.
Progress of Crystallographic Analysis Synchrotron radiation provides the most intense, intrinsically parallel X-ray beam. Thus it permits diffraction patterns to be obtained with short exposures and allows beams of arbitrary size by use of slits. Synchrotron radiation is essential for crystallographic data collection from crystals of ribosomal particles. This is due to the large unit-cell dimensions (Table I), the shape of the crystals (see above), their fragility, and their relatively short life times. Using synchrotron radiation, the unit-cell parameters of three crystal systems have been determined and interpretable data have been collected. Thus, crystallographic studies are currently being performed on crystals from the small ribosomal subunits from Thermus thermophilus as well as from the large ribosomal subunits from B. stearothermophilus and
H. marismortui. It was observed that between - 20 ° and 4 ° all crystal forms are stable in the synchroton X-ray beam for a few hours. However, the reflections with resolution better than 20 .~ decay within a few minutes of irradiation. This imposed serious experimental constraints. To eliminate crystal" damage, crystals were aligned only visually and each of them produced only 1 or 2 rotation photographs. Thus, more than 260 crystals (of 50S subunits from H. marismortuO were used in order to collect a presumably full set of data. In contrast, crystals which were immersed in viscous solutions, mounted on tiny glass rods or spatulas, flashed cooled, and irradiated at cryotemperature (around - 180 °) show hardly any radiation damage even after hours in the synchrotron X-ray beam. Thus complete data sets could be collected from tingle crystals. (A. Yonath, H. Hope, K. von Buehlen, F. Frolow, C. Kratky, I. Makowski, and H. G. Wittmann, manuscript in preparation.) Initially, crystals from the 50S subunits of B. stearothermophilus were obtained directly in X-ray capillaries by vapor diffusion of 4 ° from mixtures of methanol and ethylene glycoP 1,52 as long pointed needles which may reach the size of 1.5 × 0.3 × 0.2 m m (Fig. 5). Since most of them grew with one of their faces adhering to the walls of the capillaries, it was possible to irradiate them without removing the original growth solution. This was essential since any handling of these crystals is virtually impossible. Although most of the crystals grew with their long axes parallel to the capillary axis, a fair number grew in different directions. Thus, it was possible to determine the unit-cell constants (Table I) and to obtain dif-
.<
.<
.< .<
cK
-~
.<
~.<.<.<
E 0
m exl h, < ,,.] <
x
~'x
xx
x
xx
xx
0
0 <
+~ ~o
0 Z
x h'
x
x
xxx
XXXXXX XNN
XX
~-~
8~
Z <
¢..q
'~
1 12
OTHER BIOPHYSICAL METHODS
[6]
Fla. 5. (a) Crystals of the 50S ribosomal subunits from B. stearothermophilus grown in 0.5 mm X-ray capillaries by vapor diffusion at 4*. Bar length = 0.2 ram. CryslaUi7ation mixture of 20 #1 50S ribosomal subunits (10-20 mg/ml) in H-I buffer, 2 10 mMspermine, 1% methanol, 10 m M HEPES or glycine buffer, pH 8.4, was equilibrated with a reservoir of 12% methanol, 12% ethylenediol, 0.5 M NaC1, pH 8.4. (b) X-Ray diffraction patterns from crystals similar to those shown in (a), obtained at - 4 * with synchrotron radiation (A1 station at CHESS/CORNELL University operating at 5 GeV, current 30-40 mA) with 0.3 mm collimated X-ray beam (2 = 1.55 A), on a HUBER precession camera equipped with a He path. Exposure time = 3 rain, crystal-to-film distance = 200 ram. (Left) 1* rotation photograph of Okl zone, 680 × 920 A; (Right) 1* rotation photograph of h01 zone, 360 × 920 A.
[6]
CRYSTALLOGRAPHIC STUDIES ON RIBOSOMES
1 13
fraction patterns from all of the zones (Fig. 5) without manipulating the crystals. Oriented arcs and distinct spots, with spacings similar to those measured from diffuse diffraction patterns of ribosome gels and extracted rRNA, s3-65 and extending to 3.5 A, have been detected on several diffraction patterns of single crystals as well as on those of samples containing large numbers of microcrystals. For aligned crystals the average arc length is ___30 °. Such patterns may arise from partial orientation of the nucleic acid component within the particle. Recently we have developed procedures for growing crystals from this source (i.e., 50S subunits from B. stearothermophilus) using nonvolatile materials. Currently we can grow well-shaped crystals under conditions similar to the physiological ones. These crystals grew from very low concentrations of polyethylene glycol, in the presence of the ions which are essential for their activity and integrity. The crystals, shaped as wide needles (0.3 × 0.1 × 0.05 ram) are packed rather densely in cells of a = 280 A, b = 385 A, and c = 526 A, diffract to better than 11 ~,, and show moderate degree of mosaic spread (1 - 1.5°). Crystallographic data were collected at cryogenic temperature from crystals soaked in viscous solutions of polyethelene glycol containing an antifreeze (ethylene glycol). These conditions were suitable for native crystals, for crystals of the mutated ribosomes (missing protein BL11, see below), and for a complex containing the 50S subunits as well as lys-tRNA + polyLys (18-20mers). Crystals of the 50S subunits from H. marismortui grow at 19 ° by vapor diffusion and seeding as thin plates with a maximum size of 0.6 × 0.6 × 0.2 m m (Fig. 4). Although fragile, they can be manipulated. Among the crystals of the ribosomal particles, they are the most ordered and rigid. They diffract to a resolution of better than 6 A (Fig. 6). They have relatively small, compactly packed unit cells (of 214 × 306 × 594 A, Table
(c) Electron micrographs of positively stained (2% uranyl acetate) thin sections of crystals similar to those shown in (a) that have been fixed in 0.2% glyceraldehyde and embedded in resin ERL 4206. Optical diffraction patterns are inserted. (Right) Micrograph showing the characteristic "open" packing of this crystal form. The orthogonal choice of axes corresponds to the 680 × 920 A zone observed in the X-ray diffraction patterns. Lattice spacing calculated from optical diffraction: 670 × 850 A. (Left) Section approximately perpendicular to that shown on the right. Repeat distances measured from optical diffraction: 330 × 1050 A. This corresponds to the hOl zone (360 × 920 A) in the X-ray patterns. 63A. Klug, K. C. Holmes, and J. T. Finch, J. Mol. Biol. 3, 87 (1961). 64G. Zubay and M. H. F. Wilkins, J. Mol. Biol. 2, 105 (1960). 63R. Langridge and K. C. Holmes, J. Mol. Biol. 5, 611 (1962).
114
OTHER BIOPHYSICAL METHODS
[6]
h FI~. 6. (a) A crystal of the 50S ribosomal subunits of H. marismortui obtained under similar conditions of Fig. 4(d). (b,c) 1" rotation patterns of a crystal shown in (a) aligned along the major crystallographic axes. The patterns were obtained at 4* with synchrotron radiation (X31 station at EMBL/DESY operating at 5 GeV, initial current 60-80 mA). The X-ray beam of wavelength 1.48 A was collimated by vertical and horizontal slits (0.3 × 0.3 mm). Exposure time = 45 min, crystal to film distance = 150 mm. (b) Okl zone; (c) hk0 zone (obtained at a spindle setting at 90* away from the left pattern).
I), in contrast to the open structure o f the large crystals ofB. stearothermophilus (Table I and Fig. 5). Crystallographic data have been collected from crystals o f these subunits, from their complex with t R N A + p o l y P h e ( 1 8 - 2 0 m e r s ) , and from crystals soaked in solutions o f 11-gold or tetrairidium clusters (see below). In all cases crystals were immersed in an inert hydrocarbon, m o u n t e d on tiny glass spatulas, and flash-cooled in a stream o f liquid nitrogen at 8 5 - 9 0 K.
The Phase Problem T o represent a three-dimensional structure by Fourier synthesis it is necessary to sum all the waves (reflections) present in the diffraction pattern o f the crystal. Each reflection is characterized by its direction,
[6]
C R Y S T A L L O G R A P H I C STUDIES ON RIBOSOMES
1 15
intensity, and phase. What keeps it from being a trivial computational problem is that phases cannot be directly observed. The most common method in protein crystallography to derive phases is multiple isomorphous replacement (MIR). For application of this method, a set of at least two heavy-atom derivatives has to be prepared. These are crystals isomorphous to the native ones but including an additional electron-dense compound which must sit in one or a few specific sites at the same locations in each unit cell. The compounds commonly used for heavy-atom derivatization in conventional protein crystallography contain heavy metals, such as platinum, mercury, and gold. Heavy-atom derivatives are obtained by soaking the native crystals in a solution containing such a compound, or by binding of a heavy-atom ligand to a specific group on the protein prior to its crystallization. For an object as large, asymmetric, and complex as the 50S ribosomal subunit, it is necessary to use extremely dense and compact compounds. Heavy-atom dusters are most suitable for this purpose. However, due to its size and complexity, the surface of the ribosomal subunit is a composite of a variety of potential interaction sites for such clusters. Therefore, on soaking in solutions of a heavy-atom cluster, the latter may be attached to multiple sites on the ribosomes and complicate phase determination or make it impossible. Thus, in order to obtain usable heavy-atom derivatives, these clusters should be covalently bound to a few specific sites on the ribosomal particles. This may be achieved by direct interaction of a heavyatom cluster with chemically active groups such as SH or the ends of rRNA 66 on the intact particles prior to crystallization, or by covalent attachment of a cluster to tailor-made carriers which bind to one or a few specific sites on ribosomes. An example of a suitable candidate for this purpose is a gold duster, Ault(CN)3[P(C6H4CH2NH2)317, in which the gold core has a diameter of 8.5 A. This compound has been prepared as a monofunctional labeling reagent. 67,68 Appropriate carriers may be antibiotics,69 DNA oligomers complementary to exposed single-stranded rRNA regions,7° and Fab molecules specific to ribosomal proteins. Since most of the interactions of these materials are characterized biochemically, the crystallographic location of 66O. W. Odom, Jr., D. R. Robbins, J. Lynch, D. Dottavio-Martin, G. Kramer, and B. Hardesty,Biochemistry 19, 5947 (1980). 67H. Yangand P. A. Frey,Biochemistry 23, 3863 (1984). 6aW. Jahn and S. Weinstein,unpublishedobservations. 69K. H. Nierhausand H. G. Wittmann,Naturwissenschafien 67, 234 (1980). 7oW. E. Hill, B. E. Tapprich,and B. Tassanakajohn,in "Structure,Functionand Geneticsof Ribosomes" (B. Hardesty and G. Kramer, eds.). Springer-Veflag, Heidelberg, Federal Republic of Germany, 1986.
116
OTHER BIOPHYSICAL METHODS
[6]
the heavy-atom compounds will not only be used for phase determination but will also reveal the location of specific sites on the ribosomes. Alternatively, these clusters may be attached to chosen sites on isolated ribosomal components which will subsequently be incorporated into particles in which they are missing. A mutant of B. stearothermophilus which lacks protein L1 1 was obtained by growing cells in the presence of thiostrepton at 60 ° (see above). The 50S mutated ribosomal subunits crystallize in two and three dimensions under the same conditions as, and are isomorphous to, those obtained from the 50S ribosomal subunits of the wild type.~t This shows that L l l, the missing protein, is not involved in crystal forces in the native crystals. Furthermore, binding of N-ethylmaleimide to the SH group of protein L1172 does not reduce the activity and crystallizability of the reconstituted modified particles. 7a Phase information may also be obtained by neutron diffraction, as performed for the nucleosomes,TM and by direct methods. As mentioned above, results of electron microscopy are invaluable for phase determination. The model of the 50S particle, obtained by three-dimensional image reconstruction, could be placed in the crystallographic unit cell using crystal-packing information derived from the electron micrographs of thin sections of the same crystals (Fig. 5), as performed for nucleosomes and viruses. 75,~6In addition, the application of real- and reciprocal-space rotation s e a r c h e s 77 should be feasible by taking advantage of the noncrystallographic symmetry within the asymmetric units. A model obtained at medium resolution could be used, together with high-resolution information obtained from crystallographic studies of isolated individual ribosomal components, for iterative phase determination by molecular replacement methods,77 assuming that the conformations of crystallized isolated components are sufficiently similar to their conformations within the particle.
7~A. Yonath,M. A. Saper,F. Frolow,I. Makowski,and H. G. Wittmann,J. Mol. BioL 192, 161 (1986). 7~ M. Kimura, unpublished observations. 73 S. W¢instcin, unpublished observations. 74 G. A. Bcnfly, A. Lewit-Bcnfly, J. T. Finch, A. D. Podjarny, and M. Roth, J. M o L Biol. 176, 55 (1984). 75 j. E. Johnson and C. Hollingshcad, J. Ultrastruct. Res. 74, 223 (1981). 74 j. T. Finch, L. C. Lutter, D. Rhodes, R. S. Brown, B. Rushton, M. Levitt, and A. Klug, Nature (London) 269, 29 (1977). 7~ M. G. Rossmann, "Molecular Replacement Method: A Collection of Papers on the Use of Non-Crystallographic Symmetry." Gordon & Breach, New York, 1972.
[7]
SMALL SUBUNITQUATERNARYSTRUCTURE
1 17
Concluding Remarks The methods of crystallography and high-resolution three-dimensional image reconstruction have been introduced recently to the field of ribosomes. However, all elements that should assure the success of these techniques have already been demonstrated. Furthermore, a vast amount of knowledge, concerning the chemical, biological, physical, and genetic properties of ribosomes, from which structure analysis should benefit enormously, has been accumulated. It is expected that the results of the structural studies will lead to a better understanding of the role of ribosomes in protein biosynthesis.
[7] N e u t r o n - S c a t t e r i n g T o p o g r a p h y o f P r o t e i n s o f t h e Small Ribosomal Subunit B y MALCOLM S. CAPEL a n d V. RAMAKRISHNAN
The quaternary organization of the proteins of the Escherichia coli small ribosomal subunit has been investigated by nearly every possible experimental approach, including immunoelectron microscopy,' bifunctional chemical cross-linking) fluorescence energy transfer, 3 and neutron scattering.4-6 The results of all of these different mapping efforts are surprisingly consistent with one another, and provide a nearly complete understanding of the quaternary organization of the proteins of the 30S ribosomal subunit. 7,8 In this chapter we describe the low-angle neutronscattering methods we have employed to determine the three-dimensional configuration of the proteins of the 30S ribosomal subunit of E. coli. The basic strategy for data collection and analysis has been discussed before in ' G. St6mer and M. St6ttier-Meilicke, Annu. Rev. Biophys. Bioeng. 13, 303 (1984). 2 j. M. Lambert, G. Borleau, J. A. Cover, and R. R. Traut, Biochemistry 22, 3913 (1983). 3 K. H. Huang, R. H. Fairelough, and C. R. Cantor, J. Mol. Biol. 145, 443 (1975). 4 V. R. Ramakrishnan, S. Yabuki, I.-Y. Sillers, D. G. Schindler, D. M. Engelman, and P. B. Moore, J. Mol. Biol. 153, 595 (1981). 5 V. R. Ramakrishnan and P. B. Moore, J. Mol. Biol. 153, 719 (1981). 6 V. R. Ramakrishnan, M. S. Capel, M. Kjeldgaard, D. M. Engelman, and P. B. Moore, J. Mol. Biol. 174, 265 (1984). 7 p. B. Moore, M. S. Opel, M. Kjeld~aard, and D. M. Engelman, Biophys. J. 49, 13 (1986). s p. B. Moore, M. S. Capel, M. Kjeld~aard, and D. M. Engelman, in "Structure, Function and Genetics of Ribosomes" (B. Hardesty, ed.). Springer-Verlag, New York, in press. METHODS IN ENZYMOLOGY, VOL. 164
Copyright © 1988 by Academic Press, Inc. All rights of reproduction in any form reserved.
[7]
SMALL SUBUNITQUATERNARYSTRUCTURE
1 17
Concluding Remarks The methods of crystallography and high-resolution three-dimensional image reconstruction have been introduced recently to the field of ribosomes. However, all elements that should assure the success of these techniques have already been demonstrated. Furthermore, a vast amount of knowledge, concerning the chemical, biological, physical, and genetic properties of ribosomes, from which structure analysis should benefit enormously, has been accumulated. It is expected that the results of the structural studies will lead to a better understanding of the role of ribosomes in protein biosynthesis.
[7] N e u t r o n - S c a t t e r i n g T o p o g r a p h y o f P r o t e i n s o f t h e Small Ribosomal Subunit B y MALCOLM S. CAPEL a n d V. RAMAKRISHNAN
The quaternary organization of the proteins of the Escherichia coli small ribosomal subunit has been investigated by nearly every possible experimental approach, including immunoelectron microscopy,' bifunctional chemical cross-linking) fluorescence energy transfer, 3 and neutron scattering.4-6 The results of all of these different mapping efforts are surprisingly consistent with one another, and provide a nearly complete understanding of the quaternary organization of the proteins of the 30S ribosomal subunit. 7,8 In this chapter we describe the low-angle neutronscattering methods we have employed to determine the three-dimensional configuration of the proteins of the 30S ribosomal subunit of E. coli. The basic strategy for data collection and analysis has been discussed before in ' G. St6mer and M. St6ttier-Meilicke, Annu. Rev. Biophys. Bioeng. 13, 303 (1984). 2 j. M. Lambert, G. Borleau, J. A. Cover, and R. R. Traut, Biochemistry 22, 3913 (1983). 3 K. H. Huang, R. H. Fairelough, and C. R. Cantor, J. Mol. Biol. 145, 443 (1975). 4 V. R. Ramakrishnan, S. Yabuki, I.-Y. Sillers, D. G. Schindler, D. M. Engelman, and P. B. Moore, J. Mol. Biol. 153, 595 (1981). 5 V. R. Ramakrishnan and P. B. Moore, J. Mol. Biol. 153, 719 (1981). 6 V. R. Ramakrishnan, M. S. Capel, M. Kjeldgaard, D. M. Engelman, and P. B. Moore, J. Mol. Biol. 174, 265 (1984). 7 p. B. Moore, M. S. Opel, M. Kjeld~aard, and D. M. Engelman, Biophys. J. 49, 13 (1986). s p. B. Moore, M. S. Capel, M. Kjeld~aard, and D. M. Engelman, in "Structure, Function and Genetics of Ribosomes" (B. Hardesty, ed.). Springer-Verlag, New York, in press. METHODS IN ENZYMOLOGY, VOL. 164
Copyright © 1988 by Academic Press, Inc. All rights of reproduction in any form reserved.
118
OTHER BIOPHYSICALMETHODS ~j--Scattered
j/ ~r...... J
[7]
Neutrons
;-Sam,e
J
[
Entrance S l i t ~
........
..............
c--2D Detector FIG. 1. Basicschemefor a small-anglescatteringexperiment. 20=i. denotesthe minimum observable scattering angle for a given geometry, determined by collimation parameters, sample to detector distance, and beam stop size.Collimator slits consist of disks of cadmium, and the beam stop is a cylinder of boron nitride, backed by cadmium. The sample is contained in a cylindrical quartz cell.
this series, 9,~° so we shall concentrate on improvements in biochemical methods, instrumentation, and data analysis. The essential scheme of a solution neutron-scattering experiment is presented in Fig. 1. Neutrons from a divergent source are collimated by a series of circular slits, and impinge upon the sample. Neutrons scattered by the sample are detected by a two-dimensional position-sensitive detector, while unscattered neutrons (the direct beam), are blocked by an opaque beam stop. The function that one measures from such an experiment is I(q), where q = 4zt sin(20)/2, 20 is the scattering angle, and 2 is the maximum of the wavelength distribution of the incident neutron beam. The scattering vector q is inversely related to distances in real space. Thus larger objects require a knowledge of I(q) at smaller values of q. The smallest value of q that one can measure is a function of the incident wavelength and the degree of collimation of the incident beam. However, the flux delivered on the sample is inversely related to the extent of collimation (narrowness) of the beam. Therefore, the accuracy of the measured scattered signal deteriorates with increasing collimation, unless the measurement time is greatly extended. There is, therefore, a tradeoff between collimation requirements and beam intensity that must be evaluated for each experiment. 9 p. B. Moore and D. M. Engelman, this series, Vol. 59, p. 629. iop. B. Moore, this series, Vol. 59, p. 639.
[7]
SMALL SUBUNIT QUATERNARY STRUCTURE
119
The total excess I(q) (obtained by subtracting solvent, cell, and background scattering) is modulated by component terms arising from interference between neutrons scattered from all nuclei within and between individual 30S subunits of the sample. Only that component of I(q) generated by interference between neutrons scattered from nuclei within the two labeled proteins, of a single 30S ribosome is germane to interprotein distance measurements. This term is frequently called the interference function and will be denoted by I~(q). All other component I(q) are considered sources of noise, including the term due to interference between neutrons scattered from centers in different 30S subunits, the interparticle interference term. The interference function is extracted from scattered intensity data by a strategy involving isotopic labelling of pairs of proteins within the 30S ribosomal subunit. The strategy exploits the considerable difference in the neutron-scattering lengths of hydrogen and deuterium. In the past, pairs of proteins, labeled by deuterium, were reconstituted into 30S particles, composed of otherwise hydrogenated protein and 16S rRNA. Scattering measurements were made in buffer containing 56.8% D20, which is the contrast match-point for hydrogenated 30S ribosomes. At the match-point, that component of the total scattering signal due to the labeled protein pair is maximized, since the scattering of the ribosome as a whole is on the average equal to that of solvent and thereby minimized. We have recently reversed the labeling strategy in order to increase the signal-to-noise ratio of our scattering measurements by minimizing incoherent scattering due to hydrogen. In this case, pairs of hydrogenated proteins are reconstituted into otherwise deuterated 30S subunits, and scattering measurements taken in 100% D20. This procedural change provides a substantial gain in the statistical quality of scattering measurements, but incurs a huge penalty in the form of increased D20 utilization. Briefly, the procedure is as follows: (1) E. coli cells are grown in normal (hydrogenated) media, or perdeuterated media; (2) 30S ribosomal subunits from both cultures are then purified on zonal sucrose gradients~°; (3) proteins from hydrogenated and perdeuterated subunits are separated to purity by a combination of ion-exchange and reversed-phase high-performance liquid chromatographyt~,~2; (4) hydrogenated and perdeuterated purified proteins are recombined such that only the protein pair of interest is isotopically labeled; (5) finally, 30S particles are reconstituted, using unlabeled 16S rRNA. Actually, for each interprotein distance, four differ11A. R. Kerlavage, C. J. Weitzmann, T. Hasan, and B. S. Cooperman, J. 255 (1983). 12M. S. Capel, D. Datta, C. R. Nierras, and R. Craven, this volume [37].
Chromatogr. 266,
120
OTHER BIOPHYSICAL METHODS
[7]
ent reconstituted 30S particles are required: (1) one in which both proteins of interest are isotopically labeled; (2) one in which none of the proteins are labeled; and (3 and 4) particles in which only one of the two proteins of the pair are labeled. In the following we discuss technical improvements in scattering measurements and detail procedures whereby scattering information [in the form oflz(q)] is used to construct models of the spatial arrangement of the proteins of the 30S subunit. Sample Handling
Scattering buffer: 0.5 m M magnesium acetate, 50 m M KC1, 10 m M Tris, pH 7.5, 1 mMdithiothreitol, 100% 1)20 filtered to 0.4/zm. All salts are deuterium-exchanged prior to formulation by dissolution in 100% I)20, followed by lyophilization. Most of the interprotein distance measurements have involved samples that were pelleted directly into aluminum cells. Procedures involved in these measurements are detailed elsewhere in this series. 13 Since the aluminum of the cells scatters significantly at very small angles, we used sets of cells that were accurately matched with respect to their scattering power at low angle. Surface properties of the aluminum of a given cell were found to have a large effect on its scattering function. Therefore, care was taken in handling and cleaning the cells, so as not to perturb their scattering behavior. Scattering measurements involving very long inte~rotein distances are vulnerable to corruption by differences in the scattering of aluminum ceils, even when matched cells are used. In addition, methodological changes required for distance measurements involving proteins whose binding to 30S subunits is reversible have mandated the use of ribosome solutions rather than pellets in scattering measurements (see below). For these reasons we now use quartz sample cells. The scattering of quartz at low angle is much less than aluminum and is fiat in the small-angle region down to at least 0.005 A-1 in q. Cylindrical quartz cells, with an internal diameter of 13 m m and a depth of 6 m m (total volume 0.9 ml) are now used in all measurements. The depth and diameter of the quartz cells were chosen such that the same mass of 30S subunits could be placed in the neutron beam as with pelleted samples, without substantial loss of signal due to reduced sample transmission. t3 D. M. Engelman, this series, Vol. 59, p. 656.
[7]
SMALL SUBUNIT QUATERNARY STRUCTURE
121
Previous interprotein distance measurements involved deuterium labeling in a hydrogen "background" 30S particle. The E. coli strain MRE600 was used as the source for all deuterated material due to its tolerance for I)20. The strain HPR13 was the source for 16S rRNA and the background proteins, since high-quality 16S rRNA was readily obtained from this strain because it is deficient in major RNase activities. Because we now employ hydrogen labeling in an otherwise perdeuterated 30S particle, MRE600 serves as the source of background protein and 16S rRNA. We have found that a large fraction ( - 50%) of the 30S particles reconstituted from perdeuterated MRE600 16S rRNA and protein irreversibly dimerize when pelleted. We therefore employ ultrafiltration rather than centrifugation to concentrate 30S subunits prior to cell loading. Sucrose gradient fractions containing reconstituted 30S particles ~° are concentrated to - 4 ml with a UM2 filter (Amicon). The optical densities of all samples needed for a given distance determination are measured to better than 1% precision, and an aliquot containing a fixed mass of 30S subunit from each sample is further concentrated to 0.5 ml with a Centricon-30 microconcentrator (Amicon). Concentrates are then exhaustively dialyzed against scattering buffer. Dialyzed samples are pipetted into pretarred 1.5 ml Eppendorf microcentrifuge tubes and weighed. The volumes of the all samples (determined gravimetrically, assuming a density of 1.1 for pure D20) are all adjusted to 1.0 ml with scattering buffer from the final dialysis bath. Air exposure of all samples must be minimized so as not to perturb the D20 concentration by exchange with airborne moisture. Volume-adjusted samples are then pipetted into quartz cells for scattering measurements. All procedures from dialysis to cell loading are carried out at 6 °, in order to minimize temperature changes which promote outgassing in the sample, with concomitant formation of gas bubbles inside loaded sample cells. Neutron Source and Instrumentation
Early neutron-scattering measurements were made at the H4S instrument at the High Flux Beam Reactor (HFBR) at Brookhaven National Laboratory. This instrument provided neutrons with a wavelength of 2.36 A, with a wavelength spread AA/2 of about 0.01. However, small angle experiments can be accomplished using a beam with a much broader wavelength distribution (which effectively increases the incident flux) before smearing problems become unmanageable. It became apparent that this instrument was far from ideal for the solution scattering measurements we envisioned.
122
OTHER BIOPHYSICAL METHODS
Neutron
Beryllium
Guides
•
1-19
Multiloyer Monochromotor
Cavity
[7]
Sample Axis or Sample Changer
\ \ H9-B \\
~
Co,,~motor
~
H~'u',~d
\\ \\
C Beam--~
A Beam
~
/
2D Detector
~v-
Im Hg-A
Fro. 2. Diagram of the H9b small-angle neutron facility at the High Flux Beam Reactor of Brookhaven National Laboratory.
In 1981 a new small angle spectrometer was commissioned at the cold moderator station (H9B) of the HFBR) 4 A schematic of the spectrometer is shown in Fig. 2. At the H9 station, fast neutrons from the reactor core interact with a volume of liquid hydrogen, the cold moderator, which is maintained at a temperature of 20 K. Inside the cold moderator, neutrons experience multiple inelastic collisions with hydrogen nuclei, a process that effectively "cools" the neutrons, so that their wavelength distribution is shifted toward the higher wavelengths that are optimal for small-angle scattering experiments over spatial range subtended by biomolecules. The moderated neutron beam then passes through a beryllium filter which removes neutrons of wavelength less than 3.96 A. The neutron beam is transported by nickel-coated glass neutron guides to the monochromator cavity. Here, neutrons of a particular wavelength are selected by a synthetic multilayer monochromator, 15 which provides a beam with a wavelength spread (A2/2) of about 0.1. The beam is then collimated by a series of concentric cadmium slits, before impinging on the sample. Neutrons scattered by the sample pass through a helium-filled snout and are detected by a two-dimensional position-sensitive array. The detector, which is 50 × 50 cm in size, incorporates advanced electronics that combine high spatial resolution with high efficiency)6 A photograph of the instrument is shown in Fig. 3. z4D. K. Schneider and B. P. Schoenborn, in "Neutrons in Biology" (B. P. Schoenborn, ed.). Plenum, New York, 1984. ~5A. M. Saxena, J. Appl. Crystallogr. 19, 123 (1986). ~6B. P. Schoenborn, J. Sehefer, and D. K. Schneider, Nucl. Instrum. Methods Phys. Res., Sect. A 252, 180 (1986).
[7]
SMALL SUBUNIT QUATERNARY STRUCTURE
123
Flo. 3. Photograph of the H9 scattering spectrometer. The housing of the reactor vessel is visible to the right. The technician is standing next to the chamber containing the multilayer monochromator.
Several features of the H9B spectrometer combine to make it far superior to the H4S instrument. The cold source permits the use of longer wavelengths, which in turn relaxes the collimation requirements for a given experiment. Combined with the increased wavelength spread of the monochrometer, these changes result in a higher incident beam intensity at the sample. The physical dimensions of the H9 detector mean that a larger range o f q can be measured from a given detector position. The net effect of these improvements is a gain in flux by a factor of 5 - 10. An added result is that longer interprotein distances can be measured conveniently, and short ones can be measured more accurately than before. D a t a Collection and Analysis The strategy for data collection and analysis is shown schematically in Fig. 4. Scattered intensities and transmissions are measured for the various labeled samples, buffer, empty cell, and blocked-beam background. The raw data for each of these measurements exist as two-dimensional arrays representing the number of counts in each detector element. The raw data are then radially integrated, about the beam center, to give the scattered
124
OTHER BIOPHYSICALMETHODS (TRANSMISSIONS) + ERRORS
(INTENSITIES) + ERRORS
(
[7]
CONCENTRAT|ONq~ + ERROR~ /
DIFFERENCE PROGRAMS
( I
+ COVARIANCE MATRIX
+
)
INVERSION PROGRAM
+ Px(r ) ~'~ SECOND MOMENTS ) + ERRORS
MAPPING PROGRAM ADII OF GYRATION + ERRORS
//
FIo. 4. Schematic diagram of data collection and analysis for measurement of interprorein distances by neutron diffraction. Data inputs include transmission measurements, radially averaged scattered intensifies, and ribosome concentrations. Differenceprograms calculate interference functions. Sine-Fourier inversion of interference functions to obtain P(r) distribution functions follows.Finally, a large set of the P(r) second moments is used as input to mapping programs to obtain centroid coordinates and the radius of gyration of each small subunit protein. intensities as a function o f q [i.e., I(q)]. T h e next step in data analysis is to use these intensities to obtain the corrected Ix(q) signal for the protein pair under consideration (see below). The form o f Ix(q) is determined by the distance between the centers o f mass o f distribution o f hydrogen sites in the labeled pair o f proteins, as well as details the two distribution functions and their relative orientation. The Fourier sine transform o f Ix(q) function gives a function P(r), which is the distribution o f all vector lengths connecting nonexchangeable hydrogen sites between the labeled pair. The second m o m e n t o f P(r) is related to the interprotein distance as follows: 17 M o = Ri: + R f + d .2.,
~7P. B. Moore and E. Weinstein, J. Appl. Crystallogr. 12, 321 (1979).
(1)
[7]
SMALL S U B U N I T Q U A T E R N A R Y S T R U C T U R E
125
where M o is the second m o m e n t of P(r), Ri and Rj are the radii of gyration of the two labeled proteins, and d o is the distance between the centers of mass of the two proteins. Since the distance between the two proteins is related to the center of mass coordinates of the proteins by the relation d 2 = (xi - xi) 2 + ( Y i - yj)2 _ ( z i _ zj)2
(2)
Eq. (l) relates the second moments to the positions and radii of gyration of the proteins. Thus if one accumulates enough measured second moments, then it is possible to solve for the positions and radii of gyration using Eq. (l). This approach is rigorous as it does not involve any assumptions about the shapes of the proteins. Extraction o f the Interference Signal
The interference function is deconvoluted from the total scattered signal by one of two ways. In the first case, where both of the proteins of interest bind irreversibly to the 30S subunit, reconstituted 30S subunit preparations (1) and (2) are mixed in equimolar ratio to yield a "'signal" mixture, as are preparations (3) and (4) to produce a "noise" mixture. Ix(q) is obtained by subtracting the I(q) measured for noise mixture from that measured for signal mixture, after correlation for various systematic noise and background effects. Ix(q) = k j . ( q ) + kblb(q) + kele(q) + khlh(q) + /~Im(q) k~ = B J B . kb = -- C~ B J CbBb k, = - [ v d v , - ( C d C b ) ( V d V , ) l kh = - ( B J B , , , ) ( 1 - C J C b + k , ) k~=-(k.+kb+k¢+k,+kh)
(3)
where I, is the scattering function of the signal mixture, Ib is the scattering function of the noise mixture, I., Ih, and Im are the buffer, blocked beam, and empty cell scattering functions, respectively. B,, Bb, Be, Ba, and Bm are the corresponding transmitted intensities of signal, noise, buffer, blocked beam, and empty cell. The variables in V are volumes and those in C are the corresponding concentrations of 30S subunits determined by optical density, following intensity measurements. In the situation wherein one or both of the proteins of interest manifests reversible binding to the 30S subunit, the above procedure yields a null signal. In this case, I~(q) for the pair is obtained by separately measuring the I(q) for all four reconstituted 30S preparations mentioned above. I~(q) is then obtained by subtracting the sum of the corrected I(q) from
126
OTHER BIOPHYSICAL METHODS
[7]
preparations (3) and (4) from the sum of the I(q) of preparations (1) and (2).
I~(q) = kaI.(q) + kblb(q) + kclc(q) + kdld(q) + kele(q) + khlh(q) k a = gra/fag
a
k b = nm/Cbn b kc = - Bm/CoB~
(4)
kd = --B.,/CdBd ko = ( B J B . ) ( -
1/C~ + - 1/Cb + -- l / C ~ + -- 1/Cd)
kh=-(k,+lq,+k~+kd+k,) A problem arises in this method for obtaining Ix(q), in that it does not perfectly eliminate the interparticle interference term. !s,19 In order to help compensate for this fact, ribosomal subunit concentrations are reduced by a factor of 20 in all scattering measurements, in comparison to those operative in the first (mixed) method. With both the mixed and unmixed methods the errors in the parameters of Eqs. (3) and (4) are calculated with a first-order error propagation. 5
Fourier Inversion of the Interference Signal The distribution ofinterprotein distances, P(r) is related to the interference signal Ix(q) by the relation
P(r) = --~ 2r fo ®qI~(q) sin(qr) dq Ix(q) --
f
P(r) sin(qr) dr qr
(5) (6)
The problem is that I~(q) is not measured over the entire range of q but rather over some interval ql and o.2, so that the integral in Eq. (3) cannot be evaluated directly. For a given sample-to-detector distance, the lower limit is determined by the collimation conditions and the size of the beam stop, and the upper limit is determined by the size of the area detector used. When q is known over a limited range, it is still possible to determine P(r) accurately by indirect Fourier transformation methods. These methods rely on the fact that if the particle being studied has a maximum dimension d, then P(r) is nonzero only in the range 0 -< r -- d. One can assume that P(r) can be expanded in terms of independent is W. Hoppe,J. Mol. Biol. 78, 581 (1973). 19D. M. Engelman and P. B. Moore,Proc.NatL Acad. Sci. U.S.A.69, 1997(1972).
[7]
SMALL SUBUNIT QUATERNARY STRUCTURE
127
functions q~.(r) which are nonzero only in the range 0 -< r <-- d: nmax
P(r) =- 2~ a.q~.(r)
(7)
n--1
so that nml~t
Ix(q) = '~ a,,B,,(q)
(8)
n--I
where the functions B.(q) are the transforms of ~b.(r), given by B.(q) =
fo d
q~.(r)
sin(qr) dr qr
(9)
The best values of the coefficients a. can be determined by a linear least squares fit to the observed function Ix(q). This involves minimizing the residual R given by
l[
._
R = ~ . . a--~. 2 Ix(q,)-- .-rE anBn(q')
]
(10)
Minimization of R results in a system of linear equations which can be solved for the coefficients a,. Once the coefficients are known, the length distribution function P(r) can be calculated. Further, quantities such as the second moment of P(r) and its associated error can be calculated directly from the coefficients a.. The choice of ~bn(r) = 8zcr sin(nnr/d) is particularly appropriate both for ease of computation, and because these functions are related in a natural way to the information content present in the scattering curve (for a detailed discussion of the latter point, see Ref. 16). This method works well when the smallest q for which Ix(q) has been measured is less than zc/d. The number of functions nmx that are used in the expansion is related to the maximum value of q measured; n=~, = qm.xd/n. The second moment Mij is related directly to the coefficients by 8d4
M 0 - x2i(0)
~ 1 a , (z~2n2 _ 6 ) ( - 1)n+ 1 n3
(11)
The error in M 0 can also be evaluated from a. and the covariance matrix for an .20 Although this method works satisfactorily in the great majority of cases, there are occasionally data sets that do not behave well. In principle, P(r) 20 p. B. Moore, J.
Appl. Crystallogr. 13, 168 (1980).
128
OTHER BIOPHYSICAL METHODS
[7]
for these experiments must be nonnegative. Occasionally, a measured data set will produce a P(r) that has significant negative excursions, due to various systematic noise effects. In these cases, one can evaluate the best a, subject to the constraint that P(r) -> 0. 5 The algorithm that determines the locations of the individual proteins from the second moments of the length distribution function is very sensitive not only to the moments themselves, but also to the errors associated with them. For this reason, an error analysis on the second moment is absolutely crucial. The precision error in the second moment that is returned by the indirect Fourier transformation program does not reflect the true error for the following reasons. The analysis depends on the choice of d, the maximum length in the distribution of distances from points in one protein to points in the other. For a given measurement, d is not known a priori. What is done in practice is that the reduced x 2 and the second moment are determined for a range of d values. There is generally a range of d for which x 2 is about the same. In this region, the second moment M e has a range M1 to M2. The overall uncertainty in M Uis given by 5 o~ = tr,~ + (3//2 --M~)2/12 (12) Yet another uncertainty comes from the fact that, due to systematic errors, not all data sets give the same value of reduced x ~. Those data sets that contain such error are less reliable than those that do not, and this uncertainty should be reflected in the error for the second moment. This results in a modification of the error for the second moment as follows: oa = max(l, xa)t72 + (M 2 -- Mr) 2
(13)
The final estimates for the second moment and errors are used in the next step of the analysis, which is to determine actual positions and radii of gyration of the individual proteins. Model Building
Equations (1) and (2) provide the basis for model building based on the second moments, since they relate to second moments directly to the positions and radii of gyration of the proteins. A model can be found by determining the coordinates and radii of gyration that minimize So =
~
[ M o. - ( R 2 + R 2 + (xi -- xi) 2 + (Y~- yj)2 + (z, - zj)2}] (14)
U
This minimization, which involves a nonlinear least squares optimization, is done by the use of Marquardt's algorithm. 2~ One knows a p r i o r i that the 2t p. R. Bevington, "Data Reduction and Error Analysis for the Physical Sciences." McGrawHill, New York, 1969.
[7]
SMALL SUBUNIT QUATERNARY STRUCTURE
129
radii of gyration for the proteins cannot be smaller than those obtained under t h e assumption that the proteins are anhydrous spheres and given their known molecular weights. Accordingly, it is useful to prevent the model from converging on nonphysical values of radii of gyration by constraining the radii of gyration to be greater than the anhydrous sphere values. This is done b y adding penalty terms to the function to be minimized 5,2°,22 so that one now minimizes the function t~
S=S0 + ~ (Ri_goi),
a>0
(15)
where t~ is a positive constant, and R0t is the radius of gyration of the ith protein if it were an anhydrous sphere. We have also included a provisional upper-bound constraint on the radii of gyration equal to three times the lower bound constraint. Provided that one starts with initial guesses for the radii of gyration that are larger than Roi, the algorithm will always yield final estimates that are larger than the lower limit, and less than the upper-bound constraint. In the absence of constraints, nonphysical values for the radii of gyration are often obtained, owing to the fact that the radii of gyration are small compared to the distances between proteins, and their squares are usually of the same magnitude as the errors in the second moments. The errors in the coordinates and radii of gyrations would be obtained in a straightforward way from the minimization routine if no contraints were operative. In practice, about one-half of the radii of gyration are near the limits to which they are constrained. Thus the errors are evaluated by a Monte Carlo procedure, s The model that results from the analysis of the real second moments M o is used to calculate a set of ideal M o values. Then a large number of sets of M o values are generated, assuming that each of the second moments are normally distributed about the ideal with a standard deviation that equals the actual error estimates. Each of these trial data sets is then solved by the model building program, and the values of the parameters obtained for each are used to calculate a distribution mean and standard error. Current Model Figure 5 presents two views of the current model including all proteins except $2 l, contained within contours representing the shape of the 30S subunit, as interpreted by St6tiler and St6ftler-Meihcke.~ About 90 different interprotein distance measurements, made over a span of a decade, are involved in the construction of this map. The average of the uncertainties 22y. Bard, "Nonlinear Parameter Estimation." Academic Press, New York, 1974.
130
OTHER BIOPHYSICAL METHODS
[7]
FI6. 5. Two views of the current model of the structure of the 30S ribosomal subunit. Contours are the subunit shape as interpreted by the Berlin group.' Correlation between neutron map and the shape was obtained by reference to immunoelectron microscopic data and by maximizing the "containment" of ribosomal proteins by the shape contours.
in the coordinates of all proteins is around 10 .At along all three axes. The aggregate error of the map is well within the range of expected errors calculated by Monte Carlo modeling, given the precision of the individual measurements used in constructing the map. Individual proteins are represented as spheres whose volumes are determined by molecular weight, assuming a fixed partial specific volume (anhydrous) of 0.71. The neutron map was aligned with the shape contours by correlating it with the immunoelectron microscopy map.1 Note that all proteins are well confined by the shape contours. None of the calculated positions results in significant collision between different proteins (i.e., we do not map two different proteins into the same position). The calculated aggregate radius of gyration for 30S proteins is 71 A, which agrees exceptionally well with recent experimental measurements. 23 The neutron map is highly consistent with the mapping of surface-exposed antigenic determinants of ribosomal proteins constructed by both the Berlin ~ and UCLA 24 groups. Furthermore, interprotein spatial 23 V. Ramakrishnan, Science 231, 1562 (1986). 24 j. A. Lake, Annu. Rev. Biochem. 54, 507 (1985).
[8]
PREPARATION OF 5 0 S FOR NEUTRON SCATTERING
131
relationships within the map are congruent with the results of bifunctional chemical cross-linking studies, with the notable exception of cross-links involving protein S 13.a Acknowledgments We wish to express our deep appreciation to Drs. P. B. Moore and D. M. Engelman, in whose laboratories this work was carried out. This work was supported by NIH grants AI 09167 to P. B. Moore and A120466 to P. B. Moore and D. M. Engelman, and by the Office of Health and Environmental Research of the United States Department of Energy.
[8] P r e p a r a t i o n a n d A c t i v i t y M e a s u r e m e n t s o f Deuterated 50S Subunits for Neutron-Scattering Analysis
By
PETRA NOWOTNY, VOLKER NOWOTNY, HELGA Moss,
and KNUD H. NIERHAUS Ribosomes are heterogeneous particles with respect to the neutron scattering-length densities of their components. Because of the different proton contents of these components the scattering-length density of ribosomal proteins is less than that of RNA. In order to obtain ribosomal subparticles of like density we homogenized protein and RNA by means of differential deuteration. Both rRNA and protein fractions are prepared from cells grown under different 020 concentrations, so that both fractions adopt a scattering density of near 100% D20. From these deuterated fractions a 50S subunit is reconstituted which is now homogeneous for the neutron beam. If this homogeneous 50S subunit is transferred to a buffer of near 100% D20, it becomes "invisible" to the neutron beam ("glassy ribosome"). This system allows two kinds of measurements to be made using neutron scattering: (1) Integration of one protonated protein permits the measurement of shape parameters of this protein in situ. (2) The integration or binding of two protonated components enables us to measure the distance of mass centers of the respective components. A detailed discussion of the concept of the "glassy ribosome" can be found elsewhere, l V. Nowotny, R. P. May, and K. H. Nierhaus, in "Structure, Function and Genetics of Ribosomes" (B. Hardesty and G. Kramer, eds.). Springer-Verlag, Berlin, Federal Republic of Germany, 1986. METHODS IN ENZYMOLOGY, VOL. 164
Copyright© 1988by AcademicPress,Inc. All n4~htsof reproductionin any formr--,~ervcd.
[8]
PREPARATION OF 5 0 S FOR NEUTRON SCATTERING
131
relationships within the map are congruent with the results of bifunctional chemical cross-linking studies, with the notable exception of cross-links involving protein S 13.a Acknowledgments We wish to express our deep appreciation to Drs. P. B. Moore and D. M. Engelman, in whose laboratories this work was carried out. This work was supported by NIH grants AI 09167 to P. B. Moore and A120466 to P. B. Moore and D. M. Engelman, and by the Office of Health and Environmental Research of the United States Department of Energy.
[8] P r e p a r a t i o n a n d A c t i v i t y M e a s u r e m e n t s o f Deuterated 50S Subunits for Neutron-Scattering Analysis
By
PETRA NOWOTNY, VOLKER NOWOTNY, HELGA Moss,
and KNUD H. NIERHAUS Ribosomes are heterogeneous particles with respect to the neutron scattering-length densities of their components. Because of the different proton contents of these components the scattering-length density of ribosomal proteins is less than that of RNA. In order to obtain ribosomal subparticles of like density we homogenized protein and RNA by means of differential deuteration. Both rRNA and protein fractions are prepared from cells grown under different 020 concentrations, so that both fractions adopt a scattering density of near 100% D20. From these deuterated fractions a 50S subunit is reconstituted which is now homogeneous for the neutron beam. If this homogeneous 50S subunit is transferred to a buffer of near 100% D20, it becomes "invisible" to the neutron beam ("glassy ribosome"). This system allows two kinds of measurements to be made using neutron scattering: (1) Integration of one protonated protein permits the measurement of shape parameters of this protein in situ. (2) The integration or binding of two protonated components enables us to measure the distance of mass centers of the respective components. A detailed discussion of the concept of the "glassy ribosome" can be found elsewhere, l V. Nowotny, R. P. May, and K. H. Nierhaus, in "Structure, Function and Genetics of Ribosomes" (B. Hardesty and G. Kramer, eds.). Springer-Verlag, Berlin, Federal Republic of Germany, 1986. METHODS IN ENZYMOLOGY, VOL. 164
Copyright© 1988by AcademicPress,Inc. All n4~htsof reproductionin any formr--,~ervcd.
132
OTHER BIOPHYSICAL METHODS
[8]
The preparation procedures and activity measurements are summarized in the tabulation below, and the methods are described accordingly. References are given for those techniques which have been previously described in detail. Preparation and Activity Measurement of the Ribosomal Components Protonated components Fermentation2 Isolation of ribosomal subunits2 Isolation2 and separation of rRNA (23S + 5S rRNA) Isolation of the total proteins of the 50S subunit (TP50) Isolation of single proteins Deuterated components Fermentation Isolation of ribosomal subunits Isolation and separation of (23S + 5S) rRNA Preparation of TP50 Determination of the concentration of isolated proteins Reconstitution procedure Activity measurements Poly(U)-dependent poly(Phe) synthesis assay Peptidyltransferase assay
Preparation of Protonated Components The fermentation of protonated Escherichia coli cells (D10; RNase I-, Met-, tel A-), the isolation of ribosomal subunits, and the isolation of the total rRNA fraction have been described elsewhere in this series. 2 Separation of 23S and 5S rRNA
Materials 70% (v/v) Phenol: freshly distilled phenol is stored at - 2 0 ° in 10-ml portions; before use 4.3 ml of glass-distilled water is added per portion Bentonite-SF (Serva, Heidelberg, FRG; Cat. No. 14515) 2 K. H. Nierhaus and F. Dohme, this series, Vol. 59, p. 443.
[8]
PREPARATION OF 5 0 S FOR NEUTRON SCATTERING
133
Sodium dodecyl sulfate (SDS; Bio-Rad, Richmond, CA; Cat. No. 161-0301) RNA buffer: 10 m M Tris-HC1, pH 7.6 (4°), 50 m M KCI, 1% (v/v) ethanol Sucrose (BRL, Bethesda, MD; Cat. No. 5503UB) 5% (w/v) sucrose in RNA buffer 20% (w/v) sucrose in RNA buffer Ethanol T~oM4 buffer: 10 m M Tris-HC1, pH 7.5 (4°), 4 m M magnesium acetate Procedure. The (23S + 5S) rRNA is isolated by phenol extraction from 50S subunits containing intact 23S RNA. Sterilized tubes and pipets are used in all steps, and the whole procedure is performed at 4 °. 0.1 volume of 10% (w/v) SDS, 0.05 volume of 2% (w/v) bentonite and 1.2 volume 70% phenol are added to 50S subunits (concentration up to 400 A26ounits/ml). The mixture is shaken vigorously for 8 min and centrifuged for 10 min at 10,000 g. The aqueous phase (upper phase) is mixed with 1 volume of 70% phenol, shaken for 5 min, and centrifuged. The aqueous phase is extracted a third time. One to 2 ml of the RNA-containing aqueous phase is layered onto a sucrose gradient (5-20% sucrose in RNA buffer, SW27 rotor). After centrifugation (17 hr at 20,000 rpm) the gradient is pumped out and the optical density is recorded at 290 rim. 23S and 5S rRNA-containing fractions are pooled and precipitated at - 2 0 * overnight by addition of 2 volumes ethanol. After centrifugation (30 min at 10,000 g) the RNA pellets are resuspended in Tt0M4 buffer at a concentration of about 200 A260 units/ml for the 23S rRNA and about 20 A26o units/ml for the 5S rRNA. The concentrations are measured and the rRNA solutions are stored at - 8 0 ° in small portions. Preparation of the Total Proteins (TP50) from the Large Subunit This method is a modification of that previously described. 3 Materials Magnesium acetate, 1 M Glacial acetic acid Bentonite-SF (Serva, Heidelberg, FRG; Cat. No. 14515) Dowex l-XS, 20-50 mesh Acetone
3 H. Schulze and K. H. Nierhaus, E M B O J . 1, 609 (1982).
134
OTHER BIOPHYSICAL METHODS
[8]
Rec4-6U buffer: 20 m M Tris-HC1, pH 7.5 (4°), 4 m M magnesium acetate, 400 m M NH4CI, 2 m M 2-mercaptoethanol, 6 M urea. The buffer is mixed with bentonite-SF (1 g per liter), stirred at 4 ° for 1 hr, and filtered through two layers of Selecta filters (Schleicher & Schuell, Dassel, FRG; 595 1/2, diameter 240 mm), and stored at 4 ° for up to 3 weeks. Alternatively, the 6 M urea solution may be passed through a Dowex ion-exchange column (5 × 30 cm) and then the salts are added Rec4 buffer: same as Rec4-6U but without urea. Therefore the washing procedure with bentonite is omitted
Procedure. Two volumes of glacial acetic acid are added to the 50S suspension (made 0.1 M Mg 2+ by addition of 0.1 volume of magnesium acetate). The mixture is stirred for 45 min at 0 ° and centrifuged at 10,000 g for l0 min at 4 °. Five volumes of acetone are added to the protein supernatant. The precipitated proteins are collected by centrifugation at 10,000 g for 10 min. The pellet is dried under vacuum and dissolved in Rec4-6U buffer to a final concentration of about 200 equivalent units per milliliter (1 equivalent unit of protein is the amount of protein extracted from 1 A26o unit of 50S subunits). The solution is dialyzed overnight against a 200-fold volume Rec4-6U buffer, and four times (each for 45 min) against a 200-fold volume Rec4 buffer. The solution is centrifuged at 6000 g for 5 min, the optical density at 230 nm is determined, and the solution is stored in small portions at - 8 0 °. The following relationships are an approximation: 1 A23o unit of a TP50 solution is equivalent to 220/zg and also to l0 equivalent units (eu) of TPS0.
P r e p a r a t i o n of Single Proteins The proteins of the large ribosomal subunit are separated by conventional chromatographic techniques. 4 We also apply an additional protocol for the protein isolation: the proteins are prefractionated with the LiCl-split technique,4 and we isolate proteins by ion-exchange and reversed-phase high-performance liquid chromatography (HPLC). Various buffer systems are applied. In all cases gradient systems are used. The isolated proteins 4 G. Wystup, H. Teraoka, H. Schulze, H. Hampl, and K. H. Nierhaus, Eur. Z Biochem. 100, 101 (1979).
[8]
PREPARATION OF 50S FOR NEUTRON SCATTERING
135
remain active with respect to their ability to assemble into active 50S subunits~ (total reconstitution). Materials Reversed-phase chromatography Trifluoroacetic acid (TFA; Fluka, Buchs, Switzerland) 2-propanol acetonitrile Buffer A: 0. 1% TFA in water Buffer B: 0.1% TFA in 2-propanol or acetonitrile. The organic solvents used for the HPLC separations are of LiChrosolv grade (Merck, Darmstadt, FRG). Reversed-phase separations are performed on a Nudeosil 300-C4 column (size 250 × 16 mm, pore size 300 A, particle size 7 #m). Guard column: size 30 )< 16 m m (packed with support from Macherey & Nagel, D~iren, FRG). Ion-exchange chromatography Buffer A: 20 m M HEPES, 5 M urea, 2 m M methylamine in water Buffer B: 1 M KC1 added to buffer A. The urea solution is passed through a Dowex ion-exchange column (see above). Ion-exchange chromatography separations were performed on an Ultropac TSK CM-3SW column (size 150 × 21.5mm, particle size 10/zm). Guard column: size 75X 21.5 mm (purchased from LKB, Munich, FRG).
Procedure. Aqueous buffers are filtered through a 0.45/zm type HAWP filter (Millipore, Molsheim, France). The proteins are eluted with a flow rate of 5 - 8 ml/min using gradients4b from 0% B to 100% B. The gradient shape is adapted to the separation problem. The absorption is measured at 230 nm. After HPLC separation, the following steps are performed: The pooled protein fractions obtained with urea-containing solvents are extensively dialyzed against double-distilled water and lyophilized. Protein fractions from the reversed-phase separation are dried directly. The dried proteins are dissolved in Rec4-6U buffer, dialyzed first against 100 volumes of that buffer for 12 hr, and then four times for 45 min against 100 volumes of Rec4 buffer. All dialysis steps are performed at 4 °. Handling of
4~p. Nowotny, H. Eckardt, V. Nowotny, and R. M. Kamp, Chromatographia, in press (1988). 4b R. M. Kamp, A. Bosserhoff, D. Karnp, and B. Wittman-Liebold, J. Chromatogr. 317, 181 (1984).
136
OTHER BIOPHYSICAL METHODS
[8]
the purified proteins with respect to purity check and characterization are described in detail in Ref. 4. Preparation of Deuterated Components Fermentation Materials M3 minimal medium: Glucose 40% (w/v) in 84% I)20 or 76% D20, respectively, sterilized at 120* for 20 rain in an autoclave Salt solution5 for a 100-liter fermenter: 150 g NaC1, 200 g (NH4)2SO4, 650 g KH2PO4, 1000 g K2HPO4, pH 7.2, sterilized as above MgC12 solution: 10 g/100 ml 100 liters 84% or 76% D20-water mixture. The exact D20 concentration has to be adjusted with pure I)20 and measurement is controlled with a density measurement. We use a Paar DMA 60 densitometer (Graz, Austria), which allows readings to at least 5 significant digits Procedure. Sterilized 40% glucose, 0.6 ml, in 84% or 76% D20 is added to 50 ml deuterated sterilizeql M3 medium and 0.12 ml 10% (w/v) MgC12 is added. The medium is inoculated with 4 ml solution ofE. coli strain MRE 600 in glycerol and shaken overnight at 37*. This ciJlture is then used to inoculate a deuterated M3 medium of 84% or 76% D20. The culture is added to 450 ml M3 medium with the respective D20 content after addition of 6 ml 40% glucose. The solution is supplemented with 1.2 ml 10% MgC12. The culture is grown for 8 hr and then poured into 100 liters D20 M3 medium with the respective D20 concentration supplemented with 100 ml 10% MgClz solution and 1 liter of 40% glucose. The solution is stirred (1000 ~ m ) and kept at 37 °. The fermenter (Bioengineering, Switzerland) is not aerated to reduce contamination of the I)20 with water vapor from air. The outlet is cooled to reduce a loss of I)20 vapor. Under these conditions the cells grow with generation times of about 1 - 1.5 hr. The fermentation is stopped at an optical density of 1.5 A~5o units per ml (usually reached after 8 - 1 0 hr). The medium is pumped through pipes surrounded by ice-water as a cooling device and the cells are pelleted with a Padberg centrifuge. The medium is collected and recycled. With this procedure 300-400 g (wet weight) cells is obtained with one
P. B. Moore, this series, Vol. 59, p. 639.
[8]
PREPARATION OF 50S FOR NEUTRON SCATTERING
137
fermentation. The cells are collected in a plastic bag, shock frozen, and stored at - 80 °. Recycling of Used D20 Media The media are distilled with a 50-liter Buechi (Buechi, Switzerland) rotavapor and further purified by pumping them through a Millipore Super Q device several times until a resistance of 10,Mf~ is reached. The D20 concentration is reduced after one fermentation by less than 1% D20. This loss is compensated for by the addition of 100% D20 before the next fermentation. Preparation of Deuterated Ribosomal Subunits
Materials Dissociation buffer: 1 0 r a m K2HPO4-KH2PO4, pH 7.5, 1 m M MgCI2, 6 m M 2-mercaptoethanol 40% sucrose (w/v) in dissociation buffer 50% sucrose (w/v) in deionized water Aluminum oxide (Alcoa, Serva, Heidelberg, FRG; Cat. No. 12293) Tl0MloNi0oSH~ buffer: 10 m M Tris-HC1, pH 7.5, 10 m M MgC12, 100 m M NH4C1, 6 m M 2-mercaptoethanol
Procedure. The entire procedure is carded out at 4 °. For the preparation of 70S ribosomes the cells are washed with dissociation buffer (2 ml per gram of cells). The pelleted cells (10 rain at 10,000 g) are mixed with aluminum oxide (Alcoa, 2 g per gram of cells) and ground in a Retsch mill KM I (Retsch, Haar, FRG) for 45 min. One batch (300-400 g) of cells is used. Dissociation buffer is added (1.5 ml per gram of cells). The paste is homogenized for l0 min in the mill. Aluminum oxide is removed by centrifugation (10 min at 10,000 g), and the supernatant is withdrawn. The pelleted aluminum oxide is suspended in dissociation buffer (1.0 ml per gram of cells) and is ground for about 10 min in the Retsch mill until the paste becomes homogeneous. The aluminum oxide is again removed (10 min at 10,000 g). Both supernatants are combined and the cell debris is removed by low-speed centrifugation (60 min at 30,000 g). From the supernatant of this step (S-30) the ribosomes are collected via high-speed centrifugation (14 hr at 27,000 rpm; 45Ti). The ribosomes are suspended in dissociation buffer (0.3 ml per gram of cells). The ribosome solution is divided into portions of about 10,000 A260 units each and stored at - 80°. Usually 200- 300 A26o units of 70S ribosomes are obtained per gram of cells. The subunits are separated with a
138
OTHER BIOPHYSICAL METHODS
[8]
zonal run in a B15Ti zonal rotor containing a hyperbolic gradient6 (1600 ml from 6 to 38% sucrose) made from dissociation buffer and 40% sucrose in dissociation buffer. After centrifugation (17 hr at 23,000 rpm) the gradient is pumped out with 50% sucrose in deionized water. Fractions (about 18 ml) containing either small or large subunits are pooled. The subunits are collected via a centrifugation step (22 hr at 38,000 rpm; 45Ti). The pellet of each tube is suspended in 4 ml T~oM~oN10oSH6buffer for the 50S subunit and 2 ml of the same buffer for the 30S subunit by gently shaking in the cold room (4 °). The suspension is cleared by centrifugation (5 min at 10,000 g). Its optical density at 260 nm is measured. The subunit suspension is shock frozen in large portions (10 ml) and stored at - 8 0 °. Isolation of Deuterated (23S + 5S) rRNA The procedure follows the one described above for protonated material. However, special care is taken to obtain maximal yields. Thus, the phenol phase obtained after the first phenol extraction is washed with one volume of TtoM4 buffer which is also used to wash the phenol phases of the second and third phenol extractions. Both aqueous phases obtained after the third phenol extraction (plus washing step) are combined. This modification increases the yield significantly, which reaches 80-90% of the input amount of 50S material. Isolation of Deuterated T P 5 0 Escherichia coli strain KI 2 (D 10) is used for the isolation of protonated TP50. However, we have to use the strain MRE 600 for the isolation of the deuterated TP50, since it grows better in a D20-containing medium. 50S subunits derived from MRE 600 cells which were harvested at 1.5 A65o units per ml contain RNases which destroy the large rRNA during the reconstitution process. Therefore, the RNases have to be removed from the 50S subunits by washing with LiC1 as described below before the total proteins are extracted. Materials 5 M LiTloM~o buffer: 5 M LiC1, 10 m M magnesium acetate, 10 m M Tris-HCl, pH 7.5 (washed with bentonite as described above for Rec4-6U buffer) T~oM~0buffer: 10 m M magnesium acetate, 10 m M Tris-HC1, pH 7.5 6 E. F. Eickenberry, T. A. Biekle, R. R. Traut, and C. A. Price, Eur. J. Biochem. 12, 113 (1970).
[8]
PREPARATION OF 50S FOR NEUTRON SCATTERING
139
Procedure. 50S subunits in TloMtoN~0oSH6 buffer are diluted with TtoMl0 buffer and LiTtoMlo buffer to a final concentration of 100 A26o units/ml and a LiC1 concentration of 0.3 M. This solution is kept at 0 ° for 2 hr. A centrifugation step (7 hr at 40,000 rpm; 45Ti) at 0 ° collects the washed 50S subunits. The supernatant is discarded and the subunits are suspended to a final concentration of about 600 A26o units/ml. A 0.1 volume of 1 M magnesium acetate and 2.2 volumes of glacial acetic acid are added to this suspension. The rest of the procedure follows that described above for protonated material. The yield for the TP50 is (with the approximation 1 A23o unit of TP50 - 10 eu of TP50) in the range of 60-75% of the input amount of 50S subunits.
Determination of the Concentration of an Isolated Protein Two methods are employed: (1) determination of the total nitrogen content in small protein samples, 7 and (2) absorption measurement around 230 nm. 8 Materials
Phenol reagent: 2% phenol, 0.1% sodium nitroprusside in water (this solution can be kept for several weeks at 4 °) Alkaline hypochlorite: 20 m M NaOC1, 2.5 M NaOH (the titer of the hypochlorite solution is controlled iodometrically after preparation; this solution is stable at 4 °) Nitrogen standard: 10 m M (NH4)2SO4 in glass-distilled water is kept in tightly sealed glass bottles KPh buffer: 10 m M potassium phosphate, pH 7.5, 4 m M magnesium acetate, 400 m M KCI BSA standard: l0 mg bovine serum albumin in 100 ml KPh buffer HC104: 72% solution Procedure. Glassware and pipets have to be intensively cleaned. Wash them with hot tap water, immerse them in a solution of hot tap water (about 50 °) with solid K O H (1 M final concentration) for 1 hr, and rewash them with tap water, 10% acetic acid, and finally glass-distilled water at least six times. In order to remove traces of nitrogen-containing components, we extensively dialyze the protein solution against a 100-fold volume of KPh buffer at least four times for 45 min. The samples ( 1 0 - 5 0 p l protein solution with an optical density of about 1 A23o unit/ml) are diluted in 100 pl of KPh buffer, and 25 pl HC104 solution is added. The samples are heated at 215 ° for 1 hr in a thermostat-
L. Jaenicke, Anal. Biochem. 61, 623 0974). B. Ehresmann, P. Imbault, and J. H. Weil, Anal. Biochem. 54, 454 (1973).
140
OTHER BIOPHYSICAL METHODS
[8]
ted aluminum block with 4 cm deep holes which hold the Duran test tubes 0 4 × 100 mm). After cooling, 500al glass-distiUed water is added. To start the color reaction 450/~1 phenol reagent is added and then 200250 ]zl NaOCl solution (containing 320 ag NaOC1). After 20 min the absorption is recorded at 614 nm. A buffer sample is treated the same way and used as a control. To reduce error measure at least four different amounts of a given protein solution (for example 10, 25, 40, 55/~l). A nitrogen standard curve is determined from 5, 10, 15, 20, and 25 ]zl of the nitrogen standard solution (equivalent to 140, 280, 420, 560, and 700 ng nitrogen, respectively), and a BSA standard curve plotted from corresponding inputs of the BSA standard solution. The slopes (m) of the regression lines are calculated for the curves: the nitrogen standard curve (m~; A614 reading versus nanograms nitrogen input), the BSA standard c u r v e [ m 2 ; A614reading versus microliters BSA input; the relative nitrogen content of BSA is taken as 15.8% (w/w)], and the sample curve (m3; A614 reading versus microliters sample input), m 2 and m~ are used to calculate the recovery R (as percentage). The measured concentration of BSA is [BSA]= - -
m2 X 100
ml × 15.8 [ng/lzl]
Division by the input concentration [BSA]i multiplied by 100 gives the recovery R in percent. R = ([BSA]=/[BSA]i) × 100 Since m3/m I is the measured nitrogen content of the sample, the protein mass per milliliter (My) is obtained by Mp-
m a x 104 m~ X %N X R [/~g/ml]
The value %N from the ribosomal protein under observation is obtained from the sequence data (see Table I). The Mp values of a sample solution with a concentration of 1 A2aounit per ml (Mp/A230) are given in Table I. The method outlined above yielded absolute values which were compared to a simple absorption measurement. This method s was developed for measuring protein concentrations in protein-RNA mixtures. The protein content is determined by measuring the absorbances at 228.5 and 234.5 nm. The difference between these values (AA =A22a.5-A2u.5) is related to the protein concentration. We have determined that a AA of I is equivalent to 312 ag protein/ml in KPh buffer. The results of both methods are expressed as micrograms per A23o unit in Table I. Although the UV method yields reproducible results, we assume that the nitrogen
[8]
PREPARATION OF 508 FOR NEUTRON SCATTERING
141
determination gives the correct values. Therefore, the latter were used to calculate the molar extinction coefficient at 230 nm (E23o, see Table I). Since we use the term "equivalent unit" (eu) for the input estimates of proteins, we calculate the volume of a ribosomal protein solution which contains 1 eu. One equivalent unit is 36 × Mr × 10-6 gg, assuming that 1 A260 unit of 50S subunits corresponds to 36 pmol. The concentration of the ribosomal protein solution under observation is AA × 312 × 10-3 gg/#l. Therefore, 1 eu is present in 36 × 10-6 Mr 312)< AA X 10-3 X F
36 X 10 - 3 X M r
312XAAXF
K AA/tl
The factor F is the ratio of the results from the nitrogen determination and that of the UV measurement. F and K are presented in Table I for the individual ribosomal proteins. Reconstitution P r o c e d u r e The optimal molar ratio of rRNA to TP50 is determined for each preparation. Ratios of about 1:1.2 with protonated TP50 and ratios of 1:1.2 to 1:1.8 with deuterated TP50 are usually obtained. The slight overstoichiometry of the proteins in the latter case is due to the LiCl-washing procedure described above. Materials Rec4 buffer: 20 m M Tris-HCl, pH 7.5, 4 m M magnesium acetate, 0.2 m M ethylenediaminetetraaceticacid (EDTA), 400 m M NH4C1, 2 m M 2-mercaptoethanol Rec4 adaptation buffer: 110 mMTris-HC1, pH 7.5, 4 mMmagnesium acetate, 0.2 m M EDTA, 4 M NH4C1, 2 m M 2-mercaptoethanol T2oM4o0N4oo buffer: 400 m M magnesium acetate, 400 m M NH4CI, 20 m M Tris-HC1, pH 7.5 Rec20 buffer: same as Rec4, but with 20 m M magnesium acetate 40% sucrose in Rec20 buffer D-Rec20(K) buffer: 2 0 r a m Tris-DCl, pD 7.9, 20 m M MgC12, 400 m M KC1 in 100% D20
Procedure. RNA dissolved in the T~oM4 buffer has to be adapted to the reconstitution milieu with respect to the ion concentrations. For this purpose, 9 parts of RNA solution is mixed with l part of the Rec4-adaptation buffer. RNA solutions of concentrations exceeding 250 A26o units/ml tend to become very viscous under Rec4 ion milieu on ice and are thus stored during the assay preparation period at room temperature. For optimizing
,~
~
~
~
~
~i
--,,6--
~
--
(--i
--
..-;
~
w~
I"-
c~
0
v
~
~v+~
~+~
~ " ~ ~"
~
~
z
v ~'~
Z
oo
~1~
~
~
I" ~
~
~
~
~1~
~o
r-
~-
oo
~,~
',0
/~.
~'-
~'~
I~ -
oc~
(~
o~
t--
r~
~6
oo
~
~
o~
oo
o
Z L~ Z 0
i--
c,
v-;
o6
v
v
v
~.÷I~÷I~÷~÷I~
v
÷I~ v
v
0
A~
v~
144
OTHER BIOPHYSICAL METHODS
[8]
the amounts of TP50 a pilot reconstitution is performed. A single assay contains 2.5 A260 units (23S + 5S) RNA and various amounts of proteins (from 2.5 to 4 eu TP50) in 100/d of Rec4 buffer. For neutron experiments 1600A26o units of deuterated (23S + 5S) RNA are reconstituted with proteins in a volume of 60 ml. If one or both of the protonated proteins belong to the group of rRNA binding proteins 9,9a (Ll, L2, L3, L4, (L5), L7/L12, L9, Ll0, Ll l, L14, L15, Ll6, L17, LI8, L20, L22, L23, L24, L25, L28, L29), the following three-step procedure is applied. In the first step, 1600 A26o units of rRNA are mixed with optimal amounts of the rRNA binding protein(s) in a volume of 60 ml minus the volume containing the optimal amounts of deuterated TP50. If one (or both) of the protonated proteins is a nonbinding protein it is added in a 5to 10-fold molar excess over rRNA. The deuterated RNA and protonated protein mixture is incubated for 15 rain at 44 °. For the second step, the optimal amount of deuterated TP50 is added, yielding a total volume of 60 ml. The mixture is incubated for 15 rain at 37 ° which allows for a slow but ordered assembly, ~° and a further incubation follows (44 ° for 30 min), still under Rec4 conditions. For the third step, the Mg 2+ concentration is raised to 20 m M by the addition of 2.54 ml of T2oM~oN4oo buffer and an incubation is performed at 50 ° for 90 min. After the reconstitution process, the sample is layered on a zonal gradient made from 6 to 40% sucrose in Rec20 buffer and centrifuged (B 15Ti rotor, 17 hr at 20,000 rpm). The fractions containing the 50S material are pooled and the 50S subunits collected with a centrifugation step (24 hr at 38,000 rpm; 45Ti rotor). The pelleted material is suspended in about 700/zl D-Rec20(K) buffer. The tubes should be dried with pieces of filter paper to remove any remaining zonal buffer droplets before addition of the deuterated buffer. The samples are dialyzed four times against 20 ml of D-Rec20(K) buffer. The samples are transferred to 3-ml sample containers which are tightly closed to exclude water exchange, and shock-frozen in liquid nitrogen. Prior to the neutron measurements, D-Rec20(K) buffer is added to the samples in order to yield a volume of more than 1120/zl. The samples are centrifuged for 10 min in a table-top centrifuge to remove aggregated material. The supernatant is carefully withdrawn and 1100/zl is transferred into the measuring quartz cell. The remaining material is used for activity 9 R. Roehl and K. H. Nierhaus, Proc. Natl. Acad. Sci. U.S.A. 79, 729 (1982). 9a M. Herold and K. H. Nierhaus, J. BioL Chem. 262, 8826 (1987). io M. Herold, V. Nowotny, E. R. Dabbs, and K. H. Nierhaus, MoL Gen. Genet. 203, 281 (1986).
[8]
PREPARATION OF 50S FOR NEUTRON SCATTERING
145
measurements and the determination of concentration (A26o/ml). The neutron-scattering experiment is described elsewhere.H Activity Measurements The isolated native subunits are tested with the poly(U)-dependent poly(Phe) synthesis system, as are the reconstituted subunits from the pilot reconstitution experiments. The samples for neutron experiments are tested using the peptidyltransferase assay before and after exposure to the neutron beam. This assay is chosen because it is performed at 0 °, thus preventing a possible reactivation of the measured samples during the assay. Poly(U)-Dependent Poly(Phe) Synthesis
Materials Energy mix: 62.5 m M Tris-HC1, pH 7.8, 8.5 m M magnesium acetate, 160 m M NH4C1, 9 m M ATP, 0.3 m M G T P , 30 m M phosphoenolpyruvate, 24 m M 2-mercaptoethanol TloM~oSI-I6buffer: l0 m M Tris-HC1, pH 7.5, l0 m M magnesium acetate, 6 m M 2-mercaptoethanol Pyruvate kinase (Boehringer Mannheim, FRG; Cat. No. 128 163; 1 mg per milliliter of water) Bulk tRNA from E. coli, 20 mg per milliliter Poly(U)-[14C]Phe mix: 500/zM Phe with 100,000 clam [~4C]Phe (500 Ci/mol) and 100 #g poly(U) per 20/A S 150 enzymes in Tl0MtoSI-I6buffer2 30S subunits in T~0MtoNl0oSI-I6 (10 m M Tris-HC1, l0 m M magnesium acetate, 100 m M NH4C1, and 6 m M 2-mercaptoethanol) Glass filters No. 6, diameter 23 m m (Schleicher & Schuell, Dassel, FRG) BSA solution, l g/100 ml water Trichloroacetic acid (TCA), 5% (w/v) Ether-ethanol, 1 : 1 Scintillation cocktail Ready Solv EP (Beckman, Munich, FRG; Cat. No. 158 729)
Procedure. Poly(U) mix sufficient for all 30 assays of one experimental run is freshly prepared: Poly(U)- [14C]Phe mix Energy mix
600 pl 600/d
" K. H. Nierhaus, R. Lietzke, R. P. May, V. Nowotny, H. Schulze, K. Simpson, P. Wurmbach, and H. B. Stuhrmann, Proc. Natl. Acad. Sci. U.S.A. 80, 2889 (1983).
146
OTHER BIOPHYSICAL METHODS
S 150 enzymes (optimized for each preparation) plus T~0M~oSH6buffer Pyruvate kinase tRNA 30S subunits (30 A2~ounits) in TloMIoNIooSH6 buffer plus TioMloN10oSI-I~ Poly(U) mix
[8]
950/zl 90 pl 60 pl
100 #1 2400/A
To 80/zl poly(U) mix a 40/zl aliquot of the reconstitution assay solution containing 1 A2~o unit of reconstituted particles is added. The final concentrations are 20 m M Tris-HC1, pH 7.8, 11 m M magnesium acetate, 160 m M NH4C1, 5 m M 2-mercaptoethanol, 83.33/zM phenylalanine, 1.5 m M ATP, 0.05 m M GTP, and 5 m M phosphoenolpyruvate. In addition the 120/zl assay solution contains 100/zg poly(U), 3/zg pyruvate kinase, and 40/tg bulk tRNA from E. coll. After incubation (30 ° for 45 min) 1 drop of BSA solution and 2 ml 5% TCA are added. The samples are heated for 15 min at 90 °C. The polymerized material (longer than Phe4) is collected on glass filters. The filter-adsorbed material is washed twice with 5% TCA and with ether: ethanol (1 : 1). The filters are counted in 4 ml of Readi Solv EP scintillation cocktail. Peptidyltransferase Assay Materials
Ion mix: 1.5 M KC1, 160 m M Tris-HC1, pH 7.8, 40 m M magnesium acetate Ac[3H]Leu-tRNA: bulk tRNA is taken and charged with [3H]Leu. The tRNA mixture is then acetylated 12and stored in small portions (50/zl/tube) with 50,000 cpm//d Ethyl acetate 0.3 M sodium acetate in water saturated with MgSO4, pH 5.5 (at room temperature) Puromycin (Serva, Heidelberg, FRG; Cat. No. 33835) solution: 1 mg/ml in ethanol Ethanol Procedure. For each assay a mix is prepared of 40/tl ion mix, 40/zl H20 with 50,000 cpm Ac[3H]Leu-tRNA (about 1 #1) and 1 A26o unit of 50S particles diluted in 80/zl of Rec20 buffer. The reaction starts with the ~2A. L. Haenni and F. Chapcvill¢, Biochim. Biophys. Acta 114, 135 (1966).
[8]
PREPARATION OF 50S FOR NEUTRON SCATTERING
147
addition of 80/zl puromycin solution. The assay is incubated for 45 min at 0 °. The addition of 150#l of 0.3 M sodium acetate solution stops the reaction. The reaction product is extracted with ethyl acetate. One milliliter ethyl acetate is added to each sample and mixed vigorously (Vortex) for more than 30 sec. After 5 min at 0 ° (phase separation), 700/~l of the upper organic phase is carefully withdrawn, added to 5 ml of a scintillation cocktail, and counted. A sample with native 50S subunits serves as the 100% value; as a blank we take a sample of native 50S where 80 ~l ethanol was added instead of the puromycin solution. Usually, the native 50S subunits convert 40 to 50% of the input radiolabeled material to Ac[aH] Leu-puromycin. Yields and Etiiciencies
Escherichia coli cells are grown in a 100-liter fermenter containing deuterated medium. Each fermentation yields 300 to 400 g cell material. From l g of cells we isolate about 300 A2~o units of crude 70S ribosomes. The separation of the ribosomes is done via zonal centrifugation. Each zonal run is loaded with 10,000 A2~o units of the crude 70S and yields 2,400 A260units of 50S subunits and l, 100,4260 units of 30S. From the 50S subunits the (23S + 5S) rRNA yield is near 80%, whereas only 60 to 70% of the TPS0 can be recovered. The D 2 0 content of the 84% D20 medium is decreased to 83% after fermentation and recycling; it can be raised again to 84% by addition of 6.25 liters of 100% D20 per 100 liters. Likewise, the 76% medium falls to 75% and is raised to 76% again by addition of 4.2 liters of pure D20 per 100 liters. Nucleic acids from the 76% fermentation and proteins from the 84% fermentation batch show a match point at about 90% on the D20 scale. This value allows a contrast variation. 13 The D20 content in the measured sample can easily be varied above and below this 90% value, which would be impossible with buffer solutions, if the particles would match at 100% D20.
For the preparation of one particle, we start with deuterated 1600 `426o units of (23S + 5S) rRNA (67 mg) and the optimal amounts of TP50 (about 2000 eu TPS0; 200 .423o = 44 mg protein). After the separation of unbound material and the collection of reconstituted 50S subunits from the zonal purification run, we find recoveries of 500 to 700 -426o units of 50S subunits (30 to 45 mg), which are diluted to a volume of 1.1 ml and then measured with the camera D11 at the Institut von Laue-Langevin, Grenoble, France. The activities of the measured particles are between 50 and 100% that of native 50S subunits. 13K. Ibel and H. B. Stuhrmann, J. Mol. Biol. 93, 55 (1975).
148
OTHER BIOPHYSICAL METHODS
[9]
[9] Nuclear Magnetic Resonance Techniques for Studying Structure and Function of Ribosomes B y V. N. BUSHUEV and A. T. GUDKOV
The ribosome is a multicomponent ribonucleoprotein complex. Its importance in protein biosynthesis and its very complex structure have given rise to numerous studies of ribosomes using different techniques and approaches (see, for example, Refs. 1 and 2). Nonetheless, many details of the structure and function of the ribosome are not well understood and require further investigation. Although high-resolution nuclear magnetic resonance (NMR) spectroscopy finds increasing applications in biology,3,4 until recently it had not been used for studies of the ribosome. The physical principles on which NMR spectroscopy is based are given in numerous monographs and reviews3-6 and are outside the scope of this paper. It should be noted, however, that most progress has been reached in NMR studies of proteins with Mr up to 20,000. Such a situation is primarily due to the complicated interpretation of NMR spectra for large proteins. An increase in the mass (number of amino acid residues) leads to an increase in the number of signals with the result that peaks overlap and dipolar line broadening occurs because of the large correlation time for such proteins. Calculations have shown that, for proteins with Mr 500,000 (if considered to be in a compact spherical form), the linewidth must be more than 100 Hz. 4 Therefore narrow lines in NMR spectra of large proteins can indicate internally mobile protein segments or amino acid residues. The existence of such mobile segments in high-molecular-mass proteins and complexes including ribosomes has been shown. 7- l0 I G. Chambliss et al. (eds.), "Ribosomes: Structure, Function and Genetics." University Park Press, Baltimore,Maryland, 1980. 2This series, Vols. 29, 30, 59, 60, and elsewherein this volume. 3I. D. Campbelland C. M. Dobson,Methods Biochem. Anal. 25, 1 (1979). 40. Jardetzloland G. C. K. Roberts, "NMR in MolecularBiology."AcademicPress, New York, 1981. s K. Wfithrich,"NMR in BiologicalResearch:Peptidesand Protein." North-Holland,Amsterdam, 1976. 6G. Wagner,Q. Rev. Biophys. 16, 1 (1983). J. L. De Wit, M. A. Hemninga,and T. J. Schaafsma,J. Magn. Reson. 31, 97 (1978). s R. Perham, H. Duckworth,R. Jaenicke,and G. C. K. Roberts,Nature (London) 292, 474 (1981). 9T. R. Tritton,FEBS Lett. 120, 141 (1980). ,o V. N. Bushuev,M. L. Metsis, A. D. Morozkin, E. K. Ruuge, N. F. Sepetov, and V. E. Koteliansky,FEBSLett. 189, 276 (1985). METHODS 1N ENZYMOLOGY, VOL. 164
English translation copyright © 1988 by Academic Press, Inc.
[9]
N M R STUDIES OF RIBOSOMES
149
In the case of compact and very tight protein packing in ribosomes, it is impossible to use NMR for studies of such large ribonucleoprotein (RNP) complexes ( - 2.5 X 10*) due to the very broad fines in the NMR spectra. However, in ~H NMR spectra of ribosomes there are narrow lines which are attributed to ribosomal proteins and this permits the use of NMR techniques for the study of some proteins in the ribosome. Materials 70S ribosomes and their subunits were prepared from Escherichia coli MRE 600.~,~2 The L7/L12 proteins were isolated from 50S subunits.t3 50S particles deprived of L7/L12 proteins were obtained by treatment of intact subunits with 50% ethanol. ~4 The complex of L7/LI2 proteins with LI0 protein was isolated from the mixture of individual proteins ~5 by gel filtration using a Sephadex G-100 column. Elongation factor G (EF-G) was prepared from E. coli MRE 600 according to Rohrbach et al. ~6 Uncleavable GTP analogs, [3H] GMPPCP and [3H]GMPPNHP, were from Amersham (England). Buffer. Sodium phosphate, 1 or 2 raM, pH 7.4-7.6 (without correction for isotopic effect) with l0 m M MgC12 and 50 to 175 m M KC1 in heavy w a t e r (2H20).
Sample Preparation The association of ribosomal subunits (percentage of 70S ribosomes) in the samples was checked in an analytical ultracentrifuge UCA-10 (USSR) equipped with absorption optics. Samples where subunit association was less than 80% were not studied. Ribosomes and their subunits were transferred into heavy water either by dialysis or using small (1.5- 2 ml) columns of Sephadex G-25, the latter procedure being timesaving and more economical. The protein complex (LT/L12)4-L10 was transferred into heavy water by dialysis, or using Sephadex G-25 columns, or by dissolving in 2H20 after lyophilization from sodium phosphate buffer with 100-150 m M potassium chloride. In all three cases the NMR spectra were identical. *~ M. I. Lerman, A. S. Spirin, L. P. Gavrilova, and V. F. Golov, J. Mol. Biol. 15, 268 (1966). t2 L. P. Gavrilova, D. A. Ivanov, and A. S. Spirin, J. Mol. Biol. 16, 473 (1966). 13 W. M611er, A. Groene, C. Terhorst, and R. Amons, Eur. £ Biochem. 25, 5 (1972). t4 E. Hamel, H. Koka, and T. Nakamoto, J. Biol. Chem. 247, 805 (1972). 15 A. T. Gudkov, L. G. Tumanova, S. Y. Venyaminov, and N. N. Khechinashvili, FEBSLett. 93, 215 (1978). 16 M. S. Rohrbach, M. E. Demsey, and J. W. Bodley, J. Biol. Chem. 249, 5094 (1974).
150
OTHER BIOPHYSICALMETHODS
[9]
Ribosomal complexes with EF-G were obtained according to InoueYokosawa et al. ~7 and Lin et al. ~s The amount of ribosomal complexes with EF-G and the uncleavable GTP analog was determined by nitrocellulose filter binding techniques~8; the yield was about 50-60%. NMR Measurements ~H NMR spectra were recorded in Bruker WH-360 and Bruker WM-500 spectrometers operating at 360 and 500 MHz, respectively, in the Fourier transform mode, using standard 5-ram ampoules at 22"-27". Chemical shifts were measured in parts per million downfield from the internal reference. 2,2-dimethyl-2-silapentane sodium sulfate. Since the ribosomal ~H NMR spectrum exhibits broad resonance lines (more than 1 kHz), a wide spectral width from 20,000 up to 30,000 Hz was utilized to obtain qualitative spectra and the computer block size was 32K. A 70* flip angle was applied. The cross-saturation method was used to reveal sharp resonances of highly mobile components in the ribosomal spectra. ,9.2o The cross-saturation experiments were performed in the homonuelear gated decoupling mode. A presaturation pulse for 1 sec was applied at a frequency corresponding to the HDO solution signal. A 70* sampling pulse was applied after the saturation pulse. The concentration of 70S ribosomes and their subunits was between 5 and 20 mg/ml. Depending on the concentration, the number of scans was between 2,000 and 60,000. 1H N M R Spectra of Ribosomes and T h e i r Subunits The ~H NMR spectra of E. coli 30S and 50S subunits and 70S ribosomes (Fig. 1A-C) represent a superposition of sharp and broad (wider than 1 kHz) lines, indicating the difference between the mobilities of amino acid side chains of several proteins. Sharp resonance lines are due to the protons of the amino acids belonging to those parts of the polypeptide chain of the protein which exhibit a significantly higher mobility than the motion of the particle as a whole. A full set of spectra for all the individual ribosomal proteins facilitated a preliminary analysis of the ribosomal ~H NMR spectra and this, together with the known data on the structure of ribosomes, t permitted us to single 17 N. Inoue-Yokosawa, C. Ishikawa, and Y. Kaziro, J. Biol. Chem. 249, 4321 (1974). 18 L. Lin and J. W. Bodley, J. Biol. Chem. 251, 1795 (1976). 19K. Akasaka, M. Konrad, and K. Goody, FEBS Lett. 96, 287 (1978). 2o K. Akasaka, J. Magn. Reson. 51, 14 (1983).
[9]
N M R STUDIES OF RIBOSOMES
151
/ B
t
12
I0
8
6
4
1
• 2
~
1 0
i
_ l -2
J
~ -4
8 ppm) FIG. 1. 360-MHz IH NMR spectra of ribosomal subparticles at 22 °. (A) 30S subunits, 7 mg/ml, 5700 transients; (B) 50S subunits, 10 mg/ml, 3100 transients; (C) 70S ribosomes, 10 mg/ml, 3000 transients; (D) 50S subunits without LT/L12 proteins, 5.3 mg/ml, 55,000 transients. From Gudkov et al. n
out those proteins for which sharp signals in the ribosomal spectra are most probable. In the case of 30S subunits the sharp lines in their spectra, from a logical standpoint, may be due to S1 protein. The spectra of intact 30S subparticles and those of particles lacking S 1 protein testify in favor of this assumption. 2t Removal of this protein leads to a significant decrease of the intensity of sharp lines in the spectra of 30S subunits, though they do not disappear completely. Consequently, besides S1 protein in the 30S particle there must also be mobile parts in other proteins. The most mobile proteins of the 50S subunit are L7/L12 proteins, 22 four copies of which are present in the particles. 23 Removal of these proteins is readily performed and does not lead to a significant injury of the 50S subparticles. '4 In the spectrum of 50S particles lacking the LT/L12 proteins the intensity of sharp signals is essentially suppressed (cf. Fig. 1B and D) and the ratios between the intensities of different lines are changed. 21 C. A. Cowgill, B. G. Nickols, J. W. Kenny, P. Butler, E. M. Bradbury, and R. R. Traut, J. Biol. Chem. 259, 15257 (1984). 22A. T. Gudkov, G. M. Gongadze, V. N. Bushuev, and M. S. Okon, F E B S Lett. 138, 229 (1982). 23S. J. S. Hardy, Mol. Gen. Genet. 140, 253 (1975).
152
OTHER BIOPHYSICAL METHODS
[9]
This is a direct indication that these proteins are the most mobile in the subunit. It should be noted (Fig. 1 A and B) that the sharp signals in the spectra of 50S particles have a higher intensity than those in the spectrum of the small subunit. This is evidence that the 50S particle contains more amino acid residues exhibiting a higher independent mobility than the ribosomal particle as a whole. Comparison of the spectra of 70S ribosomes (Fig. 1C) with the spectra of 30S (Fig. 1A) and 50S (Fig. 1B) subunits reveals that the spectrum of 70S ribosomes virtually coincides with that of 50S particles. This is seen clearly from a comparison of the spectra of 50S particles and of 70S ribosomes (Fig. 2C and D) in which the broad component is suppressed by cross-saturation. Consequently, the principal contribution to the sharp resonance signals in the IH NMR spectrum of 70S ribosomes is from the same proteins as in the spectrum of 50S subunits, i.e., from L7/L12 proteins, while the contribution from S 1 protein of the small subunit is insignificant.
Phe
Phe 54 30
•
J 7.5
x8
I 6.5
I 3
I 2
I 1
J 0
8 (ppm) FIG. 2. 360-MHz ~H NMR spectraat 22 °. (A) L7/LI2 proteins, 3 mg/ml; (B) (L7)4-L10 complex, 2 mg/ml; (C) 50S subunits, I0 mg/ml; (D) 70S ribosomes, I0 mg/ml. Spectra C and D were obtained in a gated decoupling mode; the presaturation pulse was applied for 1 sec at a frequency (f2) corresponding to the tEK) signal. From Gudkov et a[.22
[9]
N M R STUDIES OF RIBOSOMES
153
Since the subunits are almost fully associated with each other (from sedimentation data), and signals from the 30S and 50S subunits must be present in the spectrum of 70S ribosomes, it may be asserted that interaction of the ribosomal subunits leads to no significant changes of the most mobile ribosomal protein component. This primarily concerns L7/L12 proteins, while S l protein as a mobile component of the 30S subunit may prove to be less mobile in the 70S ribosomes than in the subunlt. To understand the basis of such a high mobility of L7/LI2 proteins in the ribosomes there must be knowledge of their structural features. It is known that L7/L12 proteins in solution form a stable dimer 13 and that its structure is symmetric.24 Dimerization results from interaction of the Nterminal segment of L7/LI2 proteins,25 while the globular C-terminal moiety in the dimer is free and takes no part in the dimerization. L7/L12 proteins form a complex with L10 protein26 through which they are attached to the ribosome. Spectral analysis of the dimer of L7/LI 2 protein and of the pentameric complex (L7)4-L10 (Fig. 2A and B) reveals that only signals from L7 protein are present in the spectrum of the complex. This may be explained both by the lower molar concentration of L 10 protein in the complex and by broadening of all the signals from L10 protein in the complex. When protein L7/L12 is attached to L10 protein the signals from the amino acid residues in the N-terminal segment undergo the most changes. Signals from the ring protons of residue Phe 3° (7.3 ppm), from the methyl groups of residues Met 14, Me¢ 7, Met 26, and of the N-terminal Ac-Ser~(2 ppm) are broadened to such an extent that they are not observed in the spectrum of the complex. The least changed are signals of residues in the C-terminal globular segment, for example, Phe ~, high-field signals (0.63 and 0.72 ppm), and resonances from the e-CH2 (3 ppm) groups oflysine residues. Of the 13 lysine residues in the protein only two (Lys4 and Lys29)27 are in the N-terminal segment taking part in the dimerization. Thus, in the complex of L10 and L7/L12 the globular part of L7/LI 2 protein is mobile and does not participate in the interaction with L10. We arrive at the same conclusion from a comparison of the spectra of L7/L12 dimers, their complex with Ll0, the spectra of 50S particles and of 70S ribosomes. A comparison of the spectra (Fig. 2B-D) of the pentameric complex (L7)4-L10 with the spectra of 50S subunits and 70S ribosomes points to their extraordinary identity even in detail. Consequently, in the 24 V. N. Busheuv, N. F. Sepetov, and A. T. Gudkov, FEBSLett. 178, 101 (1984). 25 A. T. Gudkov and J. Behlke, Fur. J. Biochem. 90, 309 (1978). 26 A. T. Gudkov, L. G. Tumanova, G. M. Gongadze, and V. N. Bushuev, FEBSLett. 109, 34 (1980). 27 C. Terhorst, W. M611er, R. Laursen, and B. Wittmann-Liebold, FEBS Lett. 28, 325 (1972).
154
OTHER BIOPHYSICAL METHODS
[9]
spectra of 50S and 70S particles the C-terminal globular segment of L7 protein also represents a highly mobile domain. Since the spectra of the 50S subparticles and of the 70S ribosomes are almost identical, the conclusion may be drawn that L7/L12 proteins (at least their C-terminal segment) do not participate in association of the ribosome subunits and that in the absence of translation factors and of messenger RNA they exhibit a high mobility within the ribosomes. Effect of Elongation Factor on the Structure of Proteins L7/L12 in the Ribosome Since L7/L 12 proteins have a considerable intramolecular mobility in the ribosome (see above) and affect the function of the elongation factors (for a review, see Ref. 28), it would be interesting to follow the influence of the factors on the properties of L7/L 12 proteins in the ribosome. EF-G is the best suited for this task, since together with the uncleavable GTP analogs it forms quite a stable complex with the ribosome) 7 The spectrum of EF-G in solution (Fig. 3F) has broader and less well resolved lines than the L7/L 12 spectrum in the ribosome (Fig. 3A and Fig. 2C,D). The spectrum of the 50S subunit with added EF-G is an additive sum of their spectra. This is confirmed by the difference spectra (Fig. 3E) obtained by subtraction of the 50S subunit spectrum (Fig. 3A) from the spectrum of the 50S subunit with EF-G (Fig. 3B) which virtually coincides with the EF-G spectrum in solution (Fig. 3F). This result shows that there is no interaction of EF-G with the 50S subunits in the absence of GTP, and this is in line with the known data. There are some changes in the spectrum of 50S subunits as a result of addition of EF-G and GMPPNHP in the range of 0.6- 1.4 ppm. Most of the Val, Leu, lie, and Thr methyl group signals are located in this range. These changes are seen more distinctly in the difference spectrum (Fig. 3D). The positive signals in the spectrum (Fig. 3D) are from the contribution of EF-G. Some of the L7/L12 signals in the spectrum (Fig. 3D) became negative as the intensity of these signals decreased after the interaction of ribosomes with the EF-G and GMPPNHP. Consequently, the interaction of subunits with EF-G leads to immobilization of the proteins L7/L12. The binding of EF-G to the 70S ribosome exerts a much greater effect on the L7/L12 spectrum in situ (Fig. 4). The addition of EF-G to the 70S ribosomes, even without the uncleavable analog of GTP, leads to changes in the narrow signals of L7/L12 analogous to those occurring in the 50S 2sA. Liljas,Prog. Biophys. Mol. Biol. 40, 161 (1982).
[9]
N M R STUDIES OF RIBOSOMES
155
f
fi'// i i
[
9
]
I
7
I
I
I
5
L
3
I
\,
i
I
I
0
Ij
-
8 (ppm) FIG. 3. 500-MHz proton NMR spectra at 27 °. (A) 50S subunits, 7.2 mg/ml; (B) the same as A, but with EF-G; (C) the same as A, but with EF-G and GMPPNHP; (D) C minus A difference spectrum; (E) B minus A difference spectrum; (F) spectrum of EF-G. Spectra A - C are normalized to the same ribosomal subparticle concentration as that of the 50S.
particles with EF-G and the GTP analog (Fig. 4D, compare also with Fig. 3D). This indicates that the 70S ribosomes interact weakly with EF-G without GTP, whereas the 50S particles do not interact at all. Such an interaction of the 70S ribosome with EF-G has been shown also by other approaches.~S Addition of EF-G and the GTP analog to 70S ribosomes leads essentiaUy to a decrease in L7/L12 signal intensity in the NMR spectrum (Fig. 4C). This can be seen clearly from the difference spectrum (Fig. 4E) obtained by subtraction of the 70S ribosome spectrum (Fig. 4A) from that of the complex (Fig. 4C). After GMPPNHP addition, virtually all the lines become broader; this is expressed in reversed signals (they become negative) in the Fig. 4E difference spectrum. The positive component in the Fig. 4E spectrum is lower than that in the Fig. 4D spectrum. This can be explained by immobilization of not only L7/L 12 proteins but also of EF-G after formation of the complex between EF-G, ribosomes, and the uncleavable GTP analog.
156
OTHER BIOPHYSICAL METHODS
[9]
c
1
9
I
I
7
I
I
I
5
I
3
I
I
I
I
0
I
-I
8 (ppm) FIG. 4. 500-MHz proton NMR spectra. (A) 70S ribosomes, 18 mg/ml; (B) the same as A, but with EF-G; (C) the same as A, but with EF-G and GMPPNHP; (D) B minus A difference spectrum; (E) C minus A difference spectrum. Spectra A - C are normalized to the same ribosomal concentration as that of the 70S.
In the ternary complex of EF-G, ribosomes, and GMPPNHP, the L7/LI2 proteins are the first to change. This is seen from a comparison of the difference spectrum (Fig. 4E) and the spectrum of the L7 dimer (Fig. 2D). In the spectrum (Fig. 4E) there are signals characteristic for L7 protein, namely those from ring protons of Phe 54 (7.2 ppm), signals in the high field (0.63 and 0.72 ppm), and a number of resonances from methyl groups of apolar amino acids (1.4, 1.2, 0.9 ppm) and also the ~-CHz group of lysine (3 ppm). Immobilization of L7/L12 proteins in the ribosome cannot be explained by direct interaction of EF-G with these proteins. In such a case, the effect of EF-G on the mobility of L7/L12 in the 50S subunit as well as in the 70S ribosome would be equal. Neither is there any interaction of EF-G with the pentameric complex of (L7/L 12)4-L 10. It must be considered also that, despite the binding of EF-G in the proximity of the L7/L 12 stalk,z9 it is known that EF-G interacts with the ribosome (though not so well) without L7/L123° and even with 23S RNA. 31 29A. S. Girshovich, T. V. Kurtsldmlia, Y. A, Ovchinnikov, and V. D. Vasiliev, F E B S Lett. 130, 54 (1981). 3oV. E. Koteliansky, S. P. Domogatsky, A. T. Gudkov, and A. S. Spirin, F E B S Left. 73, 6 (1977). 3~A. S. Girshovich, E. S. Bochkareva, and A. T. Gudkov, FEBSLett. 159, 99 (1982).
[9]
N M R STUDIES OF RIBOSOMES
157
More probably the interaction of EF-G with L7/LI 2 and, as a result, their immobilization is a consequence of some essential eonformational changes in the ribosomal components after EF-G binding. It should be noted that a very distinct result of interaction was observed for the ternary complex, EF-G-ribosome-uncleavable GTP analog, i.e., this pertains to the functional state of L7/L12 in the ribosome after EF-G binding, but before GTP hydrolysis. There is a possibility of obtaining a complex of the ribosome with EF-G and GDP in the presence of fusidie acid, i.e., to study the complex after GTP hydrolysis. Unfortunately, the numerous resonance signals in the ~H NMR spectrum of fusidic acid prevent a reliable interpretation of the ribosomal ~H NMR spectra in the presence of fusidic acid. At the same time, limited proteolysis of the ribosomal complex with EF-G indicates that proteins L7/L 12 change their conformation in the complex with the uncleavable GTP analog and return to their initial state after GTP hydrolysis in the presence of fusidic acid and EF-G. 32 Since the studied complexes with GTP and EF-G are functional, it can be assumed, from the totality of data, that the ribosome and/or its components in the process of translocation undergo structural changes, at least in the L7/L12 domain, and after translocation and GTP hydrolysis the ribosome returns to the initial state.
Summary The following conclusions can be drawn from the use of NMR techniques for studies of ribosomes: 1. The majority of ribosomal proteins are rigidly fixed within the particles, and the most mobile components in the isolated ribosome are L7/L 12 proteins from the large subunit. 2. Interaction of EF-G with ribosomes results in some changes in ribosomal domains, and, particularly, immobilization of L7/L12 proteins takes place. The changes may pertain to the translocation reaction, since complexes with ribosomes, EF-G, and GTP are functional. The results of these studies using IH NMR show that structural studies with this technique are limited as only a few proteins express their resonances in the 1H NMR spectra (S 1, L7/L12). At the same time such studies are not exhaustive, since only the simplest samples were studied (ribosomes, the ribosomal complex with EF-G). Complexes with other ligands (tRNA, EF-Tu) have not yet been studied. It is also possible to enhance the resolution of ~H NMR techniques with the help of deuterated factors, 32 A. T. Gudkov and G. M. Gongadze, F E B S Left. 176, 32 (1984).
158
OTHER BIOPHYSICAL METHODS
[ 10]
ribosomes, and proteins, and to adapt the use of NMR to other nuclei (e.g., the use of fluorinated labels or incorporation of fluoroamino acids into the proteins). Many other approaches using NMR in biology have still to be explored. Therefore it is hoped that the use of NMR techniques will prove to be very useful in studies of the different functional steps of protein biosynthesis.
[10] P r e p a r a t i o n o f 5 S R N A - R e l a t e d M a t e r i a l s f o r Nuclear Magnetic Resonance and Crystallography Studies B y PETER B. MOORE, STEVEN ABO, BETTY FREEBORN, DANIEL T. GEWIRTH, NEOCLES B. LEONTIS, a n d GRACE SUN
For the past several years, we have been investigating the structure of 5S RNA and its protein complexes using NMR and crystallography. Both of these techniques are notorious for the rate at which they consume materials. A typical sample of 5S RNA for IH NMR, for example, contains 20 mg of RNA, and a serious investigation may require dozens of samples. The fact that NMR is nondestructive, and that samples can be reused is helpful, but the need for large amounts of material remains. In this context, bacterial strains capable of overproducing the materials of interest are more than a mere convenience. They make experiments possible which differ qualitatively from those an investigator with finite resources would seriously contemplate if dependent on wild-type strains only. Below are described the techniques we use for purifying and manipulating 5S RNA and its various nucleolytic fragments, taking advantage of the availability of 5S RNA-overproducing strains. (Those interested in preparing 5S RNA from wild-type strains may consult Refs. 1 and 2, which have appeared earlier in this series, or a recent publication from this laboratory. 3) All the preparations described yield NMR-scale quantities of end product.
i R. Monier and J. Feunteun, this series, Vol. 20, p. 494. 2 R. A. Zimmermann, this series, Vol. 59, p. 551. 3 M. J. Kime and P. B. Moore, Nucleic Acids Res. 10, 4973 (1982).
METHODSIN ENZYMOLOGY,VOL. 164
Copyrisht© 1988byAcademicPress,Inc. Allfightsofreproductionin any formreserved.
158
OTHER BIOPHYSICAL METHODS
[ 10]
ribosomes, and proteins, and to adapt the use of NMR to other nuclei (e.g., the use of fluorinated labels or incorporation of fluoroamino acids into the proteins). Many other approaches using NMR in biology have still to be explored. Therefore it is hoped that the use of NMR techniques will prove to be very useful in studies of the different functional steps of protein biosynthesis.
[10] P r e p a r a t i o n o f 5 S R N A - R e l a t e d M a t e r i a l s f o r Nuclear Magnetic Resonance and Crystallography Studies B y PETER B. MOORE, STEVEN ABO, BETTY FREEBORN, DANIEL T. GEWIRTH, NEOCLES B. LEONTIS, a n d GRACE SUN
For the past several years, we have been investigating the structure of 5S RNA and its protein complexes using NMR and crystallography. Both of these techniques are notorious for the rate at which they consume materials. A typical sample of 5S RNA for IH NMR, for example, contains 20 mg of RNA, and a serious investigation may require dozens of samples. The fact that NMR is nondestructive, and that samples can be reused is helpful, but the need for large amounts of material remains. In this context, bacterial strains capable of overproducing the materials of interest are more than a mere convenience. They make experiments possible which differ qualitatively from those an investigator with finite resources would seriously contemplate if dependent on wild-type strains only. Below are described the techniques we use for purifying and manipulating 5S RNA and its various nucleolytic fragments, taking advantage of the availability of 5S RNA-overproducing strains. (Those interested in preparing 5S RNA from wild-type strains may consult Refs. 1 and 2, which have appeared earlier in this series, or a recent publication from this laboratory. 3) All the preparations described yield NMR-scale quantities of end product.
i R. Monier and J. Feunteun, this series, Vol. 20, p. 494. 2 R. A. Zimmermann, this series, Vol. 59, p. 551. 3 M. J. Kime and P. B. Moore, Nucleic Acids Res. 10, 4973 (1982).
METHODSIN ENZYMOLOGY,VOL. 164
Copyrisht© 1988byAcademicPress,Inc. Allfightsofreproductionin any formreserved.
[ 10]
5S MATERIALS FOR N M R AND CRYSTALLOGRAPHY
159
Growth of H B 101/pKK5-1 Most of the 5S RNA we use is the product of the overproducing plasmid pKK5-1 which carries the rrnB 5S cistron. 4 For routine production of 5S RNA it is grown in Escherichia coli HB101 using a supplemented L broth as the medium.
Medium (concentration/liter) Bactotryptone Yeast extract NaCI Glucose 1 N NaOH (to set medium to pH 7.4) Adenosine Uridine 0.2% amipicillin
10 g 5g 10 g 1g 1 ml 0.2 g 0.2 g 10 ml
Ampicillin hydrolyzes if autoclaved. Stock solutions are made up, sterilized by filtration, and can be stored for up to 1 week at 4*. AmpiciUin should be added to media only after they have cooled following autoclaving, and media containing ampicillin should not be stored for more than a day or two prior to use. The adenosine and uridine required are dissolved in a modest amount of water, sterilized by filtration, and, like the ampicillin, added to the medium after it has cooled. The medium includes ampicillin to maintain the plasmid in the host, the plasmid being a cartier of a gene for ampicillin resistance, a gene the host lacks. The supplementation with adenosine and uridine ensures that the ability of the cells to synthesize RNA during overproduction is not limited by the supply of precursors. Stocks of HB 101/pKK5-1 are maintained at - 80 ° as glycerol freezes. It is best to start cultures from single colonies picked from L broth-ampicillin plates inoculated with aliquots of the frozen stocks. Cells are grown at 37 ° until the optical density of the culture reaches 1.5 at 550 nm (about 10 9 cells/ml). At that point 50 mg/liter of chloramphenicol is added to stimulate overproduction. We find that 4 hr of"growth" following the addition of chloramphenicol gives the best yield of 5S RNA. These procedures work satisfactorily for production runs in a 2001 fermentor. tSN Labeling of 5S R N A The information extractable from the physical study of macromolecules can be increased substantially if the molecules of interest can be 4j. Brosius, Gene27, 161 (1984).
160
[ 10]
OTHER BIOPHYSICAL METHODS
labeled with stable isotopes such as 2H, ~3C,or ~SN. Since substitution levels often must exceed 50% at the locations of interest to be useful, and since heavily enriched precursors are costly, the expense of preparing labeled macromolecules is a major barrier to their use. The benefits of using overproducing strains in this context are obvious. A 10-fold overproducer makes a $500 experiment out of one which would otherwise cost $5000 in isotopes. We have done a number of experiments using 5S RNA uniformly labeled with ~SN. Cells are grown on a minimal medium where the sole source of nitrogen is a cheap, 'SN-containing compound. The one we use is 99% 15N-enriched NH4CI (MSD Isotopes, St. Louis, MO), which currently costs $80/g. The RNA derived from these cells is, of course, 99% 'SN labeled at all positions. HB101, the "normal" host for pKK5-1, does not grow on minimal media. In order to take advantage of pKK5-1 for 15N labeling, it must be transduced into a host which is prototrophic. The one we use is E. coli NG135 which carries the markers strA, gal-$165, and recA 56. 5 The recA trait is important since it reduces the probability that recombination will take place between the plasmid and the chromosome of the host. pKK5-1 DNA was purified from HBI01/pKK5-1 and transduced into NGI35 using standard methods? Transductants were selected on ampicillin-containing plates. The only difficulty in carrying out the transfer of pKK5-1 from HB 101 to NG135 arises from the fact that HB101-produced DNA is restricted by NG135. In order to get a reasonable number of transductants, about 100 times the amount of plasmid DNA called for in standard protocols is required. We have found that glycerol freezes of NG135/pKK5-1 made from cultures grown on minimal medium are not viable while those made with cells grown on broth are. The first step in growing this strain, therefore, is to plate the glycerol freeze material on minimal plates containing ampicillin. A single colony is then used to start the overnight culture.
lSN Medium (concentration~liter) KH2PO4 Na2HPO4 15NH4C1 NaC1 20% glucose
3g 6g 0.3 g 0.5 g 20 ml
5 N. D. F. Grindley and C. M. Joyce, Proc. Natl. acad. Sci. U.S.A. 77, 7176 (1980). 6 T. Maniatis, E. F. Fritsch, and J. Sambrook, "Molecular Cloninig A Laboratory Manual." Cold Spring Harbor Lab., Cold Spring Harbor, New York, 1982.
[ 10]
5 S MATERIALS FOR N M R AND CRYSTALLOGRAPHY
1 M MgSO4" 7H20 0.2% ampicillin 0.01 M CaCI2
161
1.0 ml 10 ml 10 ml
The glucose, MgSO4, and CaCI2 solutions must be autoclaved separately. Ampicillin solution is added to the medium after cooling, as usual. The pH of the medium should be about 7.5. The overnight culture is grown in the medium described above except that 1 g/liter of 14NH4C1 is used instead of ~SNH4C1. The day the full-scale culture is to be grown, the cells in the overnight culture are spun down and resuspended in the isotope-containing medium. The level of NH4C1 in this medium is just adequate to support the growth and overproduction required. Cells are allowed to grow at 37 ° until the optical density at 550 nm is 1.5. Chloramphenicol (50 mg/ liter) is then added to induce plasmid replication and overproduction. Two hours of incubation after chloramphenicol addition seems optimal in this case. We find that NG135 must be grown on a shaker. NG135 cells appear to be killed when they are.as vigorously aerated and agitated as they would be in a fermentor. We grow 10 to 20 liters at a time. Purification of 5S R N A The preparation of 5S RNA from chloramphenicol-treated pKK5-1containing cells is straightforward. The cells are broken open; any of the standard methods will do. The ribosomes and cell debris are removed by centrifugation, and the RNA in the supernatant is isolated by phenol extraction. The 5S component of the resulting RNA mixture is purified by chromatography. The protocol outlined below is the one we use for largescale preparations.
Cell Rupture Solutions 10× A: 1 M NH4C1, 0.1 M magnesium acetate, 5 × 10-3 M ethylenediaminetetraacetic acid (EDTA), 3 m M 2-mercaptoethanol, 0.2 M Tris-HC1, pH 7.5 A: the same as above diluted 10-fold with H20 , the pH reset to 7.4, and the mercaptoethanol concentration maintained at 3 m M A convenient tool for breaking bacteria is a device called a "Bead Beater" (Biospec Products, P.O. Box 722, Bartlesville, OK 74005). This instrument is a small, cheap, anaerobic ball mill which uses glass beads as the working abrasive. One hundred and fifty grams of frozen cell paste is thawed in 67 ml of
162
OTHER BIOPHYSICAL METHODS
[ 10]
10X A, 200 mg of lysozyme is added, and the mixture allowed to incubate at 4". The reaction is stopped after 30 rain by the addition of 2 ml of 10% sodium deoxycholate, and a few crystals (about 1 mg) of DNase are added, enough to reduce the viscosity to manageable proportions once the cells have ruptured. A single loading consists of the slurry plus 85 ml of 0.1to 0.11-mm diameter glass beads topped off with additional buffer if necessary to fill the chamber. (The chamber must be full to prevent protein denaturation due to foaming.) The jacket surrounding the chamber is filled with ice and five 30-see cycles of beating carded out. The cell suspension is rinsed out of the chamber using 60 ml of A and centrifuged at slow speed (8,000 rpm for 25 rain, at 4*) to remove the beads and cell debris. The pellets are resuspended in A, subjected to a second round of disruption in the Bead Beater, and centrifuged as before. The supernatants from the two cycles are pooled, and the ribosomes spun out in an ultracentrifuge. Two hours of centrifugation in a Ti60 rotor at 60,000 rpm (4°) suffices. The supernatant contains the products of overproduction. The ribosomal pellet is usually discarded because the amount of 5S RNA it represents is too small to be worth recovering. The glass beads can be reused. After extensive washing with water to remove cell debris, the beads are soaked in 1 N HC1 overnight, and then rinsed with water until the pH returns to neutrality. The beads are then put through an overnight soak in 1 N NaOH followed by a water rinse until the pH again returns to neutrality. They are stored after drying in an oven.
Phenol Extraction Solutions Phenol: "Liquified phenol," the standard commercial product, is redistilled to remove the water it contains, and a variety of colored oxidation products. We keep the fraction which distills between 178" and 182". (Boiling chips are essential to prevent bumping.) The redistilled material is a solid at room temperature, and can be stored in glass bottles at - 2 0 " . It is melted when needed in boiling water, or in a water bath. It must be equilibrated with the buffer to be used in the extraction procedure. A separatory funnel is useful for this purpose. Once equilibrated, and saturated with buffer it remains a liquid at room temperature. Equilibrated phenol is prepared fresh every time it is required. SSC-EDTA: 0.15 MNaC1, 15 m M s o d i u m citrate, 15 mMEDTA, pH 7.0. SDS: 10% (w/v) sodium dodecyl sulfate (Pierce) in SSC-EDTA.
[ 10]
5S MATERIALS FOR N M R AND CRYSTALLOGRAPHY
163
The RNA contained in the centrifugal superuatant is isolated by phenol extraction. Any of the standard protocols for phenol extraction will work. We do it in the following manner. To the postribosomal supernatant is added 0.1 volumes of SDS solution, and a volume of phenol equal to the volume of the supernatant. The mixture is shaken vigorously for 1 min. We often do this in a l-liter glass bottle with a frosted glass stopper. The suspension is then centrifuged at a few thousand rpm for a minute or two to break the phenol-water emulsion. The upper, aqueous layer is removed, and saved in another bottle on ice. An equal volume of SSC-EDTA is added to the phenol layer, and the mixture shaken, centrifuged, and the water phase saved as before. The two water phases are pooled, and phenolextracted twice more. The nucleic acid in the resulting protein-free solution is recovered by adding 2 volumes of 95% ethanol. The ethanolic solution is allowed to stand for about 1 hr at - 2 0 ° to encourage complete precipitation of RNA. The precipitate is collected by centrifugation at 5000 g for 15 min at 4 °. The RNA pellet is taken up in S-200 buffer (see below), and can be stored indefinitely in that buffer at - 2 0 °. Chromatography Solutions
S-200 buffer: 0.15 M NaCI, 0.1 M sodium acetate, 1% (v/v) methanol, with the pH set to 5.0 using acetic acid The fractionation of crude, low-molecular-weight RNA is conveniently done by chromatography on columns packed with Sephacryl S-200 (Pharmacia). 7 A 5 × 100 cm column is poured and equilibrated with S-200 buffer. A sample in 20 ml or less is applied to the column, and the chromatography carried out at room temperature. We collect 100 16-ml fractions. The RNA elution profile can be monitored by reading the optical density of the undiluted fractions at 300 or 305 nm. A typical example is shown in Fig. 1. When running at rates of around 150 ml/hr, these columns will fractionate up to 10,000 A2~o,m of crude RNA without loss of performance. The resolving power of these S-200 columns degrades after a period of use. The degradation is particularly rapid if the samples being run contain the slightest amount of poorly solubilized material. Columns can be regenerated by washing the Sephacryl according to the manufacturer's instructions. The column is unpacked and the Sephacryl suspended in 0.2 N NaOH at room temperature. The column is then repacked in alkali, and a 7T. H. Kao and D. M. Crothers,Proc. Nate. Acad. Sci. U.S.A. 77, 3360 (1980).
164
[ 10]
OTHER BIOPHYSICAL METHODS
25
c
o
tO CM v
20
>,-
---- 15 Z
p0
5 / x . t / PO
,
I ~ " T ,~ I 40 60 FRACTION NUMBER
, 80
FIG. 1. Chromatography of low-molecular-weight RNAs from HBI01/pKK5-1 on Sephacryl S-200. Several thousand A2~o,m of low-molecular-weight RNA were applied to a 5 × 100 cm column of Sephacryl S-200 and eluted with S-200 buffer (see text). The RNA was derived from HB 10 I/pKK5-1 cells following overproduction as described elsewhere. Sixteenmilliliter fractions were collected. The peak at fraction 60 is 5S RNA. The peak at fraction 70 is tRNA.
bed volume or two of S-200 buffer run through it. The column can be used as soon as the pH returns to 5.0. The yield of 5S RNA at the end of the sequence of steps just outlined can be as high as 7.5 nag (150 A26om) per gram wet weight of cells, which is about 20 times the total amount of 5S RNA present in the ribosomes derived from same amount of starting material. (The yield from cells grown on minimal medium is substantially less, about 2.5 mg/liter of starting medium.) The column product is recovered by ethanol precipitation, and redissolved in S-200 buffer. 5S RNA is stored in this buffer at - 2 0 °. It is exclusively in the A form.
Preparation of Fragment 1
Buffers IX: 0.1 MKC1, 5 m M MgC12, 50 mMtris, 90 m M b o r i c acid, pH 7.8 Fragment buffer: 0.1 M NaCI, 3 m M MgCI2, 0.1 g/liter NAN3, 10 m M cacodylic acid, pH 6.0
[ 10]
5S MATERIALS FOR N M R ANI) CRYSTALLOGRAPHY
165
Limited digestion of 5S RNA with RNase A leads to the production of a fragment of the molecule consisting of bases (1- 11, 69-120) of the parent sequence,s The molecule is called fragment 1, and has a structure similar to that of the same sequences in the parent molecule? The protocol for making this material is as follows. 5S RNA is precipitated with ethanol, and brought up in 1X at a concentration of 20 A26om / m l (nominally 1 mg/ml). The solution is left on ice until the temperature is below 4 °. RNase A is then added at levels between 20 and 0.5 #g/ml. The mixture is allowed to incubate for 45 rain on ice. Digestion is terminated by making the solution 0.1% in SDS, and immediately extracting it with phenol. Three extractions are done to ensure complete removal of the enzyme. The main cleavage points in the 5S sequence under the conditions just described are after C-I 1, and C-68. What is controlled by variation of the RNase concentration is the degree to which the fragment produced is also cleaved at the 87- 89 loop. The lower the enzyme concentration, the larger the fraction of molecules in the preparation unclcaved in that loop. The "penalty" for reduced cleavage in the loop is the appearance of molecules in the population whose cleavage point is to the 5' side of C-68. One chooses the RNase level according to the needs of the experiment for which the preparation is being made. Fragment 1 is purified from other components in the digestion mixture by chromatography on Sephadex G-75 in fragment buffer (Fig. 2). The temperature of the column is critical for this purification. If it is too low, the resolution of the column will be poor. If it is too high the strands of the product will begin to dissociate. A reasonable compromise is 37 °. A 2.5 × 100cm (jacketed) column will suffice to purify the products of a 2000 A26onmdigestion. Fractions (5.5 ml) are collected. The buffers used in these columns must be degassed, and then maintained at or above the column temperature to prevent the destruction of the column bed due tO the formation of gas bubbles. The yield of fragment 1 is typically 250-300 A26om per 1000 A26onmof5S RNA digested. Preparation of Fragment 2
Buffer Fragment 2 buffer: 0.1 M KC1, 10 m M magnesium acetate, 50 m M Tris-HC1, 90 m M boric acid, pH 7.8 8 s S. Douthwaite, R. A. Garrett, R. Wagner, and J. Feunteun, Nucleic Acids Res. 6, 2453 (1979). 9 M. J. Kime and P. B. Moore, FEBSLett. 153, 199 (1983).
166
[ 1 O]
OTHER BIOPHYSICAL METHODS
Z5 otO 20 od >o~ Z t.tJ ~3
j
b-13.
°
--//
t
20
~"~
I
~
]
t
40 60 FRACTION NUMBER
I
80
FIG. 2. Chromatography of a fragment 1 digest on SephadexG-75. One thousand A26o.. of intact 5S was digested at a weight ratio of RNA to R_Nas¢A of 100:1 under the conditions described in the text for the production of fragment 1. The ethanol-precipitable products of this digestion were chromatographed on a 2.5 × 100 cm column of Sephadcx G-75 at 37" and 5.5 ml fractions were collected. The elution profile is shown. The peak at fraction 45 is
fragment 1. By careful adjustment of the conditions of RNase A digestion a second fragment of 5S RNA can be isolated in reasonable yield. It comprises bases 15- 36 and bases 4 4 - 6 5 of the parent sequence. We call this oligonucleotide fragment 2. It includes most of helix II and all of helix III of native 5S RNA. 10 5S RNA is precipitated with ethanol and brought up in Fragment 2 buffer at a concentration of 20 A ~ o , J m l . RNase A is added at a concentration of 1.1 gg/ml, and the mixture incubated at 0* for 45 rain. Digestion is then terminated by phenol extraction, and the product purified by Sephadex chromatography exactly as described for fragment 1. A typical elution profile is shown in Fig. 3. Both fragment 1 and fragment 2 are produced in such a digest. The fragment 1 component is only slightly nicked in the 87,88,89 loop. Partial Denaturation and Reconstitution of F r a g m e n t 1
Buffers EDTA buffer: 0.1 M NaCI, 2 m M EDTA, 10 m M 2-~r-morpholinoethanesulfonic acid (MES), pH 6 ~oN. B. Leontisand P. B. Moore,Biochemistry 25, 5736 (1986).
[ 10]
5S MATERIALS FOR N M R AND CRYSTALLOGRAPHY
167
1
15 E ¢::: O cO ) - 10 I-Z LI.I C~
2
_J I-O_ 0
,,I
20
i l l
60 40 FRACTION NUMBER
I
80
Flo. 3. Chromatographyof a fragment2 digest on Sephadex(3-75. One thousand A2~o of intact 5S RNA was digestedat a weight ratio of RNA to RNase A of 1000:1 under the ionic conditions described for the preparation of fragment 2. The elution profile of the ethanol-precipitableproducts of this digestionare shown. The conditionsfor chromatography were those used for the purificationof fragment 1 (see text). The first (unnumbered)peak is a partial digestionproduct we have not yet characterized.The peak marked "1" is fragment 1. The peak marked "2" is fragment2 material. Reconstitution buffer: 0.1 M KC1, 5 m M MgClx, 10 mMN-2-hydroxyethylpiperazine-N'2-ethanesulfonic acid (HEPES), pH 7 Fragment 1 preparations contain four covalent species we call "strands." Strand I is bases 69-120. Strand II is bases 88 (or 89)-120. Strand III is bases 6 9 - 8 7 , and strand IV is bases 1-11. Fragment 1 preparations are mixtures of the complexes of strands I with IV, and of strands II, III, and IV. When fragment 1 is heated, especially in the absence of Mg 2+, strand III tends to dissociate from the (II,III,IV) complex. This fact can be taken advantage of in a number of ways. It can be used as a method of separating the (I,IV) form of the complex from the (II,III,IV) version. It can also be exploited as a means of producing partially labeled fragment by taking advantage of the fact that (II,IV) readily recombines with III to reconstitute fragment 1. Fragment 1 is precipitated with ethanol and taken up in EDTA buffer. It is then applied to a Sephadex G-100 column equilibrated with the same buffer. Chromatography is carried out at 300-35 ° using warm, degassed EDTA buffer as the eluant. Figure 4 shows a typical elution profile. The performance of this column is crucially dependent on the monovalent
168
OTHER BIOPHYSICAL METHODS
[ 1 0]
I+IX
0.5
"tI, l v I 0.4 E
c
O O ro
c3 o
0.3
0.2
tin)
O.1
~--4/
t
50 70 90 FRACTION NUMBER
Fro. 4. Chromatography of fragment 1 on Sephadex G-100 in EDTA. A preparation of fragment 1 obtained by digesting 5S RNA with RNase A at a weight ratio of 800:1 was applied to a 2.5 3< 100 cm column of Sephadex G-100 in 0.1 MNaCl, 2 m M EDTA, 10 m M MES, pH 6, at 35 °. Then 5-ml fractions were collected and read. The peak at fraction 62 is fragment uncleared at the 87,88,89 loop, i.e., the complex of strands I and IV. The peak at fraction 72 consists of molecules containing bases 1- 11, 89-120, strands IV and II, and the third peak, the one at fraction 90, is strand III, bases 69-87.
cation used in the buffer. Na + works; K + does not. The products are recovered by ethanol precipitation as usual. Samples of the (II,IV) complex and strand III are dialyzed (separately) into reconstitution buffer in the cold. They are then mixed to produce a solution which is 12.00D2e e m / m l in II,IV and 8.00D2~o nm/ml in strand III. The mixture is heated at 60 ° for 10 min, and then allowed to cool to room temperature for 45 min. The product is recovered by ethanol precipitation and purified by chromotography on Sephadex G-75 following the protocol prescribed for the initial purification of fragment 1. The material regenerated in this way has normal gel electrophoretic mobility, binds L25 normally, and gives a standard proton NMR spectrum, n 11 D. T. Gewirth, S. R. Abo, N. B. Leontis, and P. B. Moore,
Biochemistry26, 5213 (1987).
[10]
5S MATERIALS FOR N M R
A N D CRYSTALLOGRAPHY
I
I
I
[
L 40
I
I 60
169
I
I
0.4
m
0.3E
c 0 0
0.2-
0.1-
\ I
0
L 20
I
80
FRACTION NUMBER F]o. 5. Chromatography of fragment 1 on Sephadex G-75 in urea. A preparation of fragment 1 like the one used in the experiment depicted in Fig. 4 was dissolved in dissociation buffer, and chromatographed on a 2.5 × 100 em column of Sephadex G-75 at 50*. Then 5.5-ml fractions were collected and read. The oligonucleotide components of the fragment 1 preparation elute in order of molecular weight: strand I (bases 69-120), strand II (bases 89-120), strand III (bases 69-87), and strand IV (bases 1- 11). Reproduced with permission from M. J. Kime, D. T. Gewirth, and P. B. Moore [Biochemistry23, 3559 (1984). Copyright 1984 American Chemical Society.]
Total Dissociation of Fragment 1 Strands
Buffer Dissociation buffer: 8 M urea, 50 m M NaCI, 1 m M E D T A , 10 m M cacodylate, p H 6.0 F r a g m e n t 1 dissociates entirely in urea buffers at elevated temperatures.t2 F r a g m e n t 1 is precipitated with ethanol a n d taken up in dissociation buffer. T h e solution is e h r o m a t o g r a p h e d on Sephadex G-75 or (3-100 in the same buffer at 50*. A typical elution profile is shown in Fig. 5. T h e strands are recovered by ethanol precipitation. 12 M. J. Kime, D. T. Gewirth, a n d P. B. Moore,
Biochemistry23,
3559 (1984).
170
OTHER BIOPHYSICAL METHODS
[ 10]
Analytical Gels
Solutions Acrylamide-Bis: 20% (w/v) acrylamide, 1% (w/v) bisacrylamide 10× TBE: 25 m M EDTA, 500 m M Tris-HC1, 500 mMboric acid, pH 8.3 Persulfate: 10% (w/v) ammonium persulfate 10X 5S: 50 m M magnesium acetate, 1 M KC1, 500 m M Tris-HC1, 900 m M boric acid, pH 7.6 The standard method for examining the products of the manipulations described above is acrylamide gel electrophoresis. We run two kinds of gels for routine use, one which permits 5S and its protein complexes to run intact, and a second which is urea containing, and displays the oligonucleotides a sample contains. The native gel mixture contains 50 ml of acrylamide-Bis, 10 ml of 10X 5S, 80 #1 of tetramethylethylenediamine (TEMED), 0.5 ml of persulfate, and enough water to bring the total volume to 100 ml. We usually pour slab gels which are 170 × 170 X 1.5 ram. RNA, 0.1 to 0.3 OI:)26o m, is loaded per lane. The running buffer is 10× diluted 10-fold. Gels are run at 3 V/cm for 16 hr at room temperature using bromphenol blue as the marker dye. The current which runs through these gels is high. In order to keep the pH constant it is necessary to recirculate the running buffer. The composition of the denaturing gel mix is 60 ml of acrylamide-Bis, 10 ml of 10× TBE, 48 g urea, 80 #l of TEMED, and 0.5 ml of persulfate. (The volume of this mixture is about 100 ml.) The loading of these gels is the same as that of the native gels. We usually run them at 15 V/cm at room temperature using 10× TBE diluted l:10 as the running buffer. Bromphenol blue and xylene cyanole are good marker dyes. The electrophoresis is complete in 3 to 4 hr under these conditions. The results of the electrophoresis can be visualized in a number of ways. A gel can be quickly examined by placing it on a TLC plate containing fluorescent dye and illuminating the gel with a hand-held UV lamp which emits at 254 rim. The RNA-containing bands appear as shadows against a bright background. (Wear glasses to protect your eyes from UV light while inspecting your gel!) Gels can be stained for RNA using methylene blue. The gel is soaked in 10% acetic acid for l0 or 15 min, and then transferred into 0.4% methylene blue, 0.2 M acetate, pH 4.7. An hour of staining with agitation is sufficient. The gel is then destained in tap water by diffusion. Usually it can be read fairly well after a few hours of destaining with several changes of water. The stain solution can be reused many times. The sensitivity of methylene blue staining is quite high, higher than
[ 10]
5S MATERIALSFOR NMR AND CRYSTALLOGRAPHY
171
the shadowingmethod; 0.5/tg of RNA in a 1-cm wide band is easily detected. Methylene blue does not stain protein. A dye which will stain protein, but not RNA is Coomassie blue. We use a 0.025% solution of Coomassie blue in a 50: 50 mixture of 7% acetic acid and ethanol. The staining takes several hours, and destaining is by diffusion into ethanol-acetic acid solution. One microgram of protein is readily visualized. Ifa protein which binds to 5S RNA or one of its fragments is added to a lane with RNA in it, the electrophoretic mobility of the RNA on native gels is altered, a fact which provides a simple assay for this interaction. The presence of both protein and RNA in the complex is readily proven using the RNA and protein staining methods described here. 5S-Binding Ribosomal Proteins Fortunately, our work has consumed ribosomal proteins at a rate of less than 50 mg/species/year. The reason this fact is fortunate is that as far as we are aware there are no strains which overproduce any ribosomal protein to an appreciable degree. The techniques for preparing ribosomal proteins are in rapid flux today due to the introduction of high-performance liquid chromatography (HPLC) methods into the field. Below is described a more traditional ion-exchange approach to purifying the 5S-binding proteins from E. coli. It is slower than HPLC methods, if all that is needed is 10 mg of material. On the other hand, unlike HPLC, it is easy to scale up; 50 mg preparations of single proteins are readily accomplished. The three 5S binding proteins of E. coli, LS, L18, and L25, can be purified either from 50S subunit protein or from the protein of 70S particles. The ion-exchange procedures we use for purifying ribosomal proteins are detailed in Vol. 59 of this series, t3 and will be briefly summarized here. Protein is extracted from subunits or whole ribosomes by the LiC1-urea method, and the protein dialyzed exhaustively against 6 M urea, 30 m M methylamine, 6 m M 2-mercaptoethanol, adjusted to pH 5.6 with acetic acid ("Start 5.6"). In a recent run, the protein from 550,000 O D ~ o m of 70S ribosomes (about 12 g of protein) was loaded onto a 1-liter column of carboxymethyl-cellulose (CMC, Whatman CM-52) and eluted with a linear, 0.02 to 0.15 M NaC1 gradient whose total volume was 22 liters. By 0.15 M NaC1, all the 5S proteins are offthe column. Figure 6 shows the elution profile which results when a CMC column with lower loading (5 nag protein/ml of column volume) is run with a gradient of the same slope as described above extending past 0.25 M NaCI. The solid trace shows the elution of 70S protein (OD2ao nm), and the broken ,3 p. B. Moore,this series,Vol. 59, p. 639.
172
OTHER
--
BIOPHYSICAL
METHODS
[ 1 O]
00~0m
....... 3H-CP M
L1
'1
,.
L3
iil
°
o
L19 L22
L?4
•
~
|"
: ~
:,i
0
5o
)0o
,~o
2oo 250 30o FRACTION NUMBER
: . .
,,
55o
, ..........
4oo
45o
FIG. 6. The elution profiles of 70S protein and 50S protein from CMC compared. Nonradioactive 70S protein was mixed with a small amount of ~H-labeled 50S protein, and the mixture resolved by chromatography on CIVICat pH 5.6 in 6 M urea, as described in the text. The NaC! concentration was increased finearly during the elution, and ran from 0 to 0.25 M across the span represented in the figure. 70S protein was detected by its absorption at 230 nm. 50S protein was detected by its radioactivity. The identities of the 50S components in a number of peaks are indicated. 5S-binding proteins arc designated by numbers enclosed in a box.
line trace 50S protein (all counts). The identities of the 50S proteins contributing to a number of the peaks is given. L5 elutes free of all other proteins, as does L25. It is our practice to purify both fractions further by chromatography on Sephadex G-100 in Start 5.6. Following this step, both are sufficiently pure to use for physical studies. L 18 elutes in a mixture which includes three other 50S proteins and $4. $4 is enough larger than LI 8 and the other 50S protons in this fraction that Sephadcx G-100 chromatography will remove it cleanly from the mixture. The fractionation of the four 50S proteins is more tedious. The mixture is dialyzed into 6 M urea, 20 m M phosphoric acid-methylaminc, pH 7.0, 6 m M 2-mercaptoethanol ("Start 7"). It is then run on CMC in the same buffer system. The loading used is the same as that for the initial column. If the first step requires a l-liter column, the pH 7 step does as well. The elution is carded out using a linear gradient of NaC1 running from 0.075 to 0.15 M with about the same slope as the initial pH 5.6 column. Three peaks will be detected at 230 nm. The order of elution is L13 first, followed by L22, and then L18, and L19 as a single peak. The L 1 8 - L I 9 mixture can be resolved on phosphocellulose, but we prefer to do it using reversed-phase HPLC. We use a SynChropak RP-P column (Cl8). The solvent system is 0.1% trifluoroacetic acid in water: 0.1% triflu-
[ 10]
5S MATERIALS FOR N M R AND CRYSTALLOGRAPHY
17 3
oroacetic acid in acetonitrile. A full description of the application of HPLC methods to the purification of ribosomal proteins may be found elsewhere in this volume, t4 In order to make use of these proteins, they must first be renatured. L25 is dialyzed into 0.1 MKC1, 10 m M Tris-HC1, pH 7.5, at 4 °. Indeed, L25 recovers its native conformation upon dialysis into almost any physiological buffer, t5 (L25 denatures below pH 6.0.) The other two proteins are more difficult to handle. First they are dialyzed against 6 M guanidine, 6 m M 2-mercaptoethanol, 20 m M cacodylate, pH 7.0, and then dialyzed into 1 M KCI, 6 m M 2-mercaptoethanol, 10 m M cacodylate, pH 7.0. What appears to be important is that the proteins be kept at high ionic strength while the denaturant is removed. Following the second dialysis, the proteins can be transferred into any buffer one wishes by further dialysis. Renatured L5 is quite unstable. It cannot be frozen in physiological buffers unless it is made 50% in glycerol first. Renatured L 18 is more forgiving than renatured L5; it can be frozen and thawed in the absence of glycerol. Concentrated solutions of L 18, however, like similar solutions of L25, tend to form precipitates of (presumably) denatured protein at a slow rate upon incubation at room temperature. Using biuret as a means for estimating protein concentrations, we find that a 1 mg/ml solution of L18 has an optical density of 0.42 at 276 nm, and that a similar solution of L25 has an optical density of 0.38 at the same wavelength. Both these values are close to those one would estimate for these proteins on the basis of their amino acid compositions, taking standard values for the extinction coefficients of the aromatic amino acids, and using their known molecular weights. (We have not measured an extinction coefficient for L5, but calculation based on amino acid composition suggests that a 0.1% solution of L5 should have an extinction coefficient of about 0.7 at 280 nm.) The extinction coefficient of 5S RNA at 260 nm is 8.474 × 105 M - t cm-I. t6 For the smaller fragments of 5S RNA, we estimate concentrations form extinction at 260 nm using the extinction coefficient of the intact molecule multiplied by the ratio of the molecular weights of intact 5S RNA and the fragment in question. Preparation of Samples for N M R
and Crystallization
N M R samples for proton work are typically0.2 to 0.5 ml in volume, and the molecule of interestmust be present at a concentration around 14B. S. Cooperman, C. J. Weitzmann, and M. A. Buck,this volume [36]. 15M. J. Kime, R. G. Ratcliffe,P. B. Moore,and R. J. P. Williams, Eur. J. Biochem. 116, 269 (1981). 16R. Osterberg,B. Sjoberg,and R. A. Garrett, Eur. J. Biochem. 116, 481 (1976).
174
OTHER BIOPHYSICAL METHODS
[ 11 ]
1 mM. Since neither 5S RNA nor its proteins are particularly robust, we transfer them into the buffer in which we wish to study them by dialysis at a stage where the concentration is of the order of a tenth of that desired for the final sample. Concentration is achieved by ultrafdtration. A disposable, centrifugal ultrafdtration device has become available in the past few years which is well suited for this purpose. The device is called the Centricon and is manufactured by Amicon. It permits one to concentrate 3 ml down to less than 100 gl, if necessary, with acceptably low losses. Both fragment 1 and its complex with L25 crystallize readily under a wide range of conditions. 17 Samples suitable for crystallization are much less concentrated than those used in NMR. A typical preparation for crystallization has an RNA concentration of 100 OD260, J m l . The ionic conditions are varied to meet the particular purposes of the experimenter, but typically would be 0.1 M KCI, 4 m M magnesium acetate, 5 m M TrisHCI, pH 7.4. Again dialysis is the preferred way of establishing the ionic conditions in a sample. Acknowledgments This work has been supported by grants from the National Institutes of Health to P.B.M. (AI-09167, GM-22778, and GM-32206).
17 S. S. Abdel-Meguid, P. B. Moore, and T. A. Steitz, J. Mol. Biol. 171,207 (1983).
[ 11 ] F l u o r e s c e n c e L a b e l i n g a n d I s o l a t i o n o f L a b e l e d RNA and Ribosomal Proteins B y O . W . O D O M , H . - Y . D E N G , a n d BOYD H A R D E S T Y
The development of highly sensitive fluorimeters to measure steadystate intensity and lifetime of fluorescence coupled with computerized data analysis has vastly enhanced the utility of fluorescence techniques for investigation of systems of biological origin. Estimation of the distance between an energy donor fluorophore and an acceptor by nonradiative energy transfer has proven to be particularly useful. This technique has been used extensively to analyze the structure and function of ribosomes during the reaction steps of protein synthesis. The size of ribosomes, about 220 A in diameter, is well suited to the distances that can be measured by nonradiative energy transfer, about 20 to 80 A with commonly used METHODS IN ENZYMOLOGY,VOL. 164
Copyright© 1988by AcademicPress, Inc. Allfightsofreproductionin any formreserved.
174
OTHER BIOPHYSICAL METHODS
[ 11 ]
1 mM. Since neither 5S RNA nor its proteins are particularly robust, we transfer them into the buffer in which we wish to study them by dialysis at a stage where the concentration is of the order of a tenth of that desired for the final sample. Concentration is achieved by ultrafdtration. A disposable, centrifugal ultrafdtration device has become available in the past few years which is well suited for this purpose. The device is called the Centricon and is manufactured by Amicon. It permits one to concentrate 3 ml down to less than 100 gl, if necessary, with acceptably low losses. Both fragment 1 and its complex with L25 crystallize readily under a wide range of conditions. 17 Samples suitable for crystallization are much less concentrated than those used in NMR. A typical preparation for crystallization has an RNA concentration of 100 OD260, J m l . The ionic conditions are varied to meet the particular purposes of the experimenter, but typically would be 0.1 M KCI, 4 m M magnesium acetate, 5 m M TrisHCI, pH 7.4. Again dialysis is the preferred way of establishing the ionic conditions in a sample. Acknowledgments This work has been supported by grants from the National Institutes of Health to P.B.M. (AI-09167, GM-22778, and GM-32206).
17 S. S. Abdel-Meguid, P. B. Moore, and T. A. Steitz, J. Mol. Biol. 171,207 (1983).
[ 11 ] F l u o r e s c e n c e L a b e l i n g a n d I s o l a t i o n o f L a b e l e d RNA and Ribosomal Proteins B y O . W . O D O M , H . - Y . D E N G , a n d BOYD H A R D E S T Y
The development of highly sensitive fluorimeters to measure steadystate intensity and lifetime of fluorescence coupled with computerized data analysis has vastly enhanced the utility of fluorescence techniques for investigation of systems of biological origin. Estimation of the distance between an energy donor fluorophore and an acceptor by nonradiative energy transfer has proven to be particularly useful. This technique has been used extensively to analyze the structure and function of ribosomes during the reaction steps of protein synthesis. The size of ribosomes, about 220 A in diameter, is well suited to the distances that can be measured by nonradiative energy transfer, about 20 to 80 A with commonly used METHODS IN ENZYMOLOGY,VOL. 164
Copyright© 1988by AcademicPress, Inc. Allfightsofreproductionin any formreserved.
[11]
SEPARATION OF RIBOSOMAL PROTEINS AND t R N A s
175
probes. Individual ribosomal proteins or rRNAs can be labeled, then reconstituted into active ribosomes, and probes can be covalently linked to tRNA at a number of specific sites. Several excellent articles 1-a describe in detail the instrumentation, techniques, and data analysis used for distance measurement by nonradiative energy transfer. These aspects will not be treated here. Rather, the focus will be directed toward what in most experimental situations is the most troublesome factor that may compromise the reliability of the measurements. This is incomplete pairing between donor and acceptor probes and spurious positioning of the probes. These conditions may be generated by incomplete or nonspecific labeling, respectively. In many experimental situations, incomplete pairing can be dealt with by determining energy transfer from fluorescence lifetime data. Under favorable circumstances, a two-exponential function can be fit to a fluorescence decay curve so that fluorescence lifetime of the quenched and unquenched species can be evaluated directly, and we have used this approach? Also, increased fluorescence from the energy acceptor can be used with the decrease in donor fluorescence intensity in some circumstances3 However, the most direct and generally the most satisfactory approach is to avoid the problem by using completely, and specifically, labeled components. Techniques for obtaining such ribosomal proteins and tRNAs are described below. Labeling P r o c e d u r e s Precautions must be taken throughout the labeling and isolation procedure to use reagents, solvents, and glassware that are as free as possible of contaminating fluorescent material and degradative enzymes. In this laboratory, distilled water is passed through a deionizing column and then a column of activated charcoal before it is redistilled in glass. Where possible, plastic containers are avoided for solution storage. Glassware washed with detergent is rinsed with hot ethanol before it is used. Eppendorf tips and tubes are never reused. Plastic gloves are worn throughout the labeling procedure to avoid both fluorescent and enzymatic contamination. When working with low concentrations oftRNA or 5S RNA and always with 16S RNA or 23S RNA, glassware is baked at 150 ° for 24 hr to reduce nuclease contamination. 1j. R. Lakowicz, "Principles of Fluorescence Spectroscopy." Plenum, New York, 1983. 2 C. R, Cantor and T. Tao, Proced. Nucleic Acid Res. 2, 31 (1971). 3 R. H. Fairclough and C. R. Cantor, this series, Vol. 48, p. 347. 4 D. Robbins, O. W. Odom, Jr., J. Lynch, G. Kramer, B. Hardesty, R. Liou, and J. Ofengand, Biochemistry 20, 5301 (1981). 5 B. Epe, K. G. Steinhliuser, and P. Woolley, Proc. Natl. Acad. Sci. U.S.A. 80, 2579 (1983).
176
[ 11 ]
OTHER BIOPHYSICALMETHODS TABLE I E. coli Ribosomal Proteins with Cysteine Residues* Large subunit
Small subunit
number
Cysteine position
Total amino acids
2 5 6 10 II b 14 17 27 b 28 b 31
5,187 86 124 70 38 21, 84 100 52 4 16,18,37,40
272 178 176 165 141 123 127 84 77 62
L
S
Cysteine
number
position
Total amino acids
Ib 2 4 8 11 12 13b 14 17b 18 21 b
292,349 86 31 126 69,120 26, 33, 52, 103 84 63 58,63 10 22
557 240 203 129 128 123 117 98 83 74 70
° Work of B. Wittmann-Liebold and co-workers, summarized in B. Wittmann-Liebold, Adv. Protein Chem. 36, 56 (1984). b Mutant E. coli strains have been isolated by Dabbs~4O with ribosomes lacking these proteins or
carrying a defective protein that can easily be removed from the ribosome, as described further in the text.
Labeling of Proteins Reaction of cysteine thiol with a maleimide derivative of a fluorescent probe provides a specific reaction for labeling a ribosomal protein. At pH 7.0 maleimides show a high degree of selectivity for sulfhydryl groups of proteins. 6 Alkyl halides such as iodoacetamide derivatives also can be used, but these provide lower sulfhydryl group specificity, n A number of Escherichia coli ribosomal proteins have one or a small number of cysteine residues as indicated in Table I and thus provide a basis for probe attachment at a specific site. 821, 7 L11, 8 81, 9 L27, and L28 have been successfully labeled in this laboratory. A typical labeling procedure involves incubation of 1 mg of the homogeneous ribosomal protein in 200/tl of 7 M guanidine-HC1, 10 m M N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES)/KOH, pH 7.0, with 1 m M of the fluorogenic maleimide 6G. E. Means and R. E. Feeney, "Chemical Modification of Proteins," pp. 105-118. Holden-Day, San Francisco, California, 1964. O. W. Odom, E. R. Dabbs, C. Dionne, M. Mfiller, and B. Hardesty, Eur. J. Biochem. 142, 261 (1984). s H.-Y. Deng, O. W. Odom, and B. Hardesty, Fur. J. Biochem. 156, 497 (1986). 90. W. Odom, H.-Y. Denf, A. R. Subramanian, and B. Hardesty, Arch. Biochem. Biophys. 230, 178 (1984).
[ 1 1]
SEPARATION OF RIBOSOMAL PROTEINS AND tRNAs
177
derivative at 37 ° for 30 min. Excess labeling reagent is inactivated by adding glutathione to a final concentration of 10 raM, then the sample is passed over a Sephadex G-25 column equilibrated with 7 M urea, 20 m M HEPES/KOH, pH 7.5. Guanidine-HCl and inactivated excess labeling reagent are separated from the labeled protein. Finally, the protein is dialyzed against 30 m M Tris-HCl, pH 7.4, 500 m M KC1, 20 m M magnesium acetate, 1 m M dithiothreitol (30S proteins) or 20 m M Tris-HC1, pH 7.4, 400 m M NH4C1, 4 m M magnesium acetate, 4 m M 2-mercaptoethanol (50S proteins), and then frozen in small aliquots and stored at - 80 ° until used. If the labeled protein is to be purified by high-performance liquid chromatography (HPLC) it is dialyzed against 0.1% trifluoroacetic acid (TFA) in water. For determining stoichiometry of labeling, the protein is digested with proteinase K (50#g/ml in 10 m M Tris-HC1, pH 7.4, 100 m M NH4CI, 10 m M magnesium acetate, 5 m M 2-mercaptoethanol for 30 min at 37 °) and the absorbance due to the fluorophore is compared with that of a standard solution of the cysteine derivative of the probe, to obtain probe concentration. 7 Protein concentration is usually determined by the Amido Black method, ~° using bovine serum albumin as a standard.
Labeling of RNAs Ribosomal RNAs and tRNAs can be labeled at their Y-terminal ends by oxidation of the ribose with periodate, followed by reaction of the resulting dialdehyde with hydrazides or thiosemicarbazides, one molecule of which appears to add to both aldehydes to form a morpholine structure) ~Oxidation of 5S ribosomal RNA or tRNA with periodate is accomplished by incubation at a concentration of 50 A2~/ml or less with 0.09 M sodium periodate in 0.1 M sodium acetate, pH 5.0, for 90 rain at room temperature in the dark. t2 At the end of the incubation KC1 is added to a final concentration of 0.2 M, then the reaction solution is allowed to stand on ice for 10 min before the potassium periodate precipitate is removed by centrifugation for 5 min at 10,000 g. The supernatant is passed over a Sephadex G-25 column equilibrated with 0.1 M sodium acetate, pH 5.0, to remove remaining periodate. 16S or 23S ribosomal RNA is oxidized under somewhat milder conditions by incubating with 0.09 M sodium periodate in 0.1 M sodium phosphate, pH 7.0, for 2 hr at 0 ° in the dark at concentrations of no more than 200 or 400 A260 units/ml, respectively) 2 KC1 is then added and the precipitate of potassium periodate is removed as 10W. Schaffner and C. Weissmann, Anal. Biochem. 56, 502 (1973). 1~F. Hansske, M. Sprinzl, and F. Cramer, Bioorg. Chem. 3, 367 (1974). t20. W. Odom, D. J. Robbins, J. Lynch, D. Dottavio-Martin, G. Kramer, and B. Hardesty, Biochemistry 19, 5947 (1980).
178
OTHER BIOPHYSICAL METHODS
[ 1 1]
described for 5S RNA and tRNA, followed by passage over Sephadex G-25 equilibrated with 0.05 M sodium phosphate, pH 7.0, to remove remaining periodate. Labeling of the oxidized RNAs with fluorescein 5'-thiosemicarbazide (FTS) as an example is as follows, n Oxidized 5S RNA or tRNA in 0.1 M sodium acetate, pH 5.0, is incubated with 2 m M FTS in the dark for 2 hr at room temperature, followed by three extractions with equal volumes of 70% phenol to remove most of the unreacted labeling reagent. Then the sample is made 0.1 M in KC1 and precipitated with two volumes of 95% ethanol at - 2 0 °. The ethanol precipitation is repeated twice, after which the sample is dissolved in 10 m M Tris-HCl, pH 7.4, 4 m M magnesium acetate, and frozen at - 8 0 °. Oxidized 16S RNA, in 0.05 M sodium phosphate, pH 7.0, is incubated for 1 hr in the dark at room temperature with 2 m M FTS. Oxidized 23S RNA, in 0.05 M sodium phosphate, pH 7.0, is incubated in the dark for 2 hr at 0 ° with 2 m M F r S . The labeled 16S and 23S RNA samples are then treated as described for labeled 5S RNA and tRNA except that, just prior to ethanol precipitation, two volumes of 0.1 M KC1 is added. This dilution is necessary to prevent precipitation of sodium phosphate by the ethanol. After ethanol precipitation, 23S RNA is dissolved in l0 m M Tris-HC1, pH 7.4, 4 m M magnesium acetate, and 16S RNA in 30 m M Tris-HC1, pH 7.4; both are stored at - 80 °. In addition to the 3' end, tRNA can be specifically labeled at various other sites by reaction with, or removal of, modified bases that have unusual chemical reactivity. Procedures have been developed for replacing dihydrouracils of various tRNAs ta or the wybutine base adjacent to the anticodon of yeast t R N A ) TM for reacting the amino group of the X base in the extra loop of some E. coli tRNAs with isothiocyanates ~ and for reacting thiouridine and, in some cases, pseudouridine with fluorescent alkyl bromides ~6a7 or iodoacetamide derivatives. ~s The procedure for replacing dihydrouracil depends on the labilization of this base by NaBH4 reduction to ureidopropanol, ~9which is hydrolyzed from the tRNA under acidic conditions, as is the wybutine base. 13 The resulting aldehydic C-1 atom of the ribose can then react with amine or hydrazine derivatives. Yeast and E. coli tRNA ~e, which can be used with 13W. Wintermeyer, H.-G. Schleich, and H. G. Zachau, this series, Vol. 59, p. 110. 14O. W. Odom, B. B. Craig, and B. A. Hardesty,Biopolymers 17, 2909 (1978). 15j. A. Plumbridge, H. G. Btiumert, M. Ehrenberg, and R. Rigler, Nucleic Acids Res. 8, 827 (1980). 16C. H. Yang and D. $611,J. Biochem. (Tokyo) 73, 1243(1973). 17C. H. Yang and D. $611,Biochemistry 13, 3615 (1974). 18A. E. Johnson, H. J. Adkins, E. A. Matthews, and C. R. Cantor, J. Mol. Biol. 156, 113 (1982). 19p. Cerutti and N. Miller, J. Mol. Biol. 26, 55 (1967).
[ 11 ]
SEPARATION OF RIBOSOMAL PROTEINS AND t R N A s
179
the convenient artificial messenger, polyuridylic acid, both contain two dihydrouracils, at positions 16 and 172o and 16 and 20, 2t respectively. The procedure used in this laboratorY for replacement of dihydrouracil is a modification of the published procedure. 13 tRNA (10-20 Az6o/ml) is reduced with 10mg/ml NaBH4 in 0 . 2 M Bicine [N,N-bis(2hydroxyethyl)glycine], pH 9.0, for 45 min at ambient temperature. During the reduction the pH is maintained at 9.0 by addition of small amounts of acetic acid. At the end of the incubation, excess NaBH4 is destroyed by adding acetic acid to a final pH of 5.0, followed by ethanol precipitation of the reduced tRNA. The labeling of reduced tRNA Pbcwith 7-diethylaminocoumarin-3-carbohydrazide (DCCH), as an example, is as follows. Deacylated tRNA Phc or AcPhe-tRNA in 0.1 M sodium acetate, pH 4.3, is incubated for 2 hr at 37 ° with 2 m M DCCH, added from a 50 m M stock solution in dimethylformamide. At the end of the incubation period, the solution is made 0.1 M in Tris-HCl, the pH is adjusted to 6.0-6.5 with KOH, and the sample is extracted twice with equal volumes of 70% phenol to remove excess DCCH, followed by three ethanol precipitations to remove residual phenol. The labeling with DCCH is usually incomplete, and unlabeled, singly labeled, and a small amount of the doubly labeled tRNA species are separated by reversed-phase chromatography, as described in the next section. Separation and Purification P r o c e d u r e s HPLC was carried out with a Beckman system which included a 421 controller unit for generating elution gradients and a 165 variable wavelength detector with which absorption was monitored at two wavelengths simultaneously. The reversed-phase column was #Bondapak C~s (3.9 m m × 30 cm) from Waters Associates, Milford, MA. R i b o s o m a l Proteins
The labeling of sulfhydryl groups of ribosomal proteins is frequently incomplete and it is desirable to remove unlabeled protein. Of the methods used in this laboratorY, the best involves HPLC in 0.1% trifluoroacetic acid (TFA) over a/tBondapak C18 reversed-phase column. This procedure also has been used to purify unlabeled ribosomal proteins) 2a3 The column is 20u. L. RajBhandaryand S. H. Chang, J. Biol. Chem. 243, 598 (1968). 21B. G. Bah'elland F. Sanger,FEBSLett. 3, 275 (1969). 22A. R. Kerlavage,C. J. Weitzmann,T. Hasan, and B. S. Cooperman,J. Chromatogr. 266, 225 (1983). ~3R. M. Kamp, A. Bosserhoff,D. Kamp, and B. Wittmann-Liebold,J. Chromatogr. 317, 181 (1984).
180
[ 11]
OTHER BIOPHYSICAL METHODS I
0.3
...............
._
1~02
,
~ . °.......
, "'"'"'""+"
u;ul ~ - z 0.1
t
""" ""
.°,*beled
1
O0
..... '......... "*........ '-430
I
2o
1'+
labeled
A
131111 {lg ¢~" O0 (Zl I111
0 o
8
16 24 ELUTION VOLUME, ml
32
40
T'
0
FIG. I. Separation o f E . coli ribosomal protein $21 labeled with fluorescein 5'-maleimide from unlabeled protein. Unlabeled $21 (25/Jg) was m i x e d with labeled S21 (25/Jg) a n d applied in 0.1% a q u e o u s T F A to the C~s c o l u m n described in the text. T h e c o l u m n h a d been equilibrated with the s a m e solution. Elution was with a nonlinear gradient o f aeetonitrile in a n a q u e o u s solution containing 0.1% TFA, as shown. Flow rate was 1 m l / m i n .
equilibrated with 0.1% TFA in water and the labeled protein is dialyzed against this same solution prior to loading. Elution is with a gradient of acetonitrile in an aqueous solution containing 0.1% TFA. Most ribosomal proteins elute between 25 and 50% acetonitrile.2z Labeled derivatives typically elute somewhat later than the unlabeled forms. Separation of unlabeled $21 from $21 labeled with fluorescein 5'-maleimide is shown in Fig. 1. The unlabeled species is eluted at about 25.5%, and the labeled species at about 29.5%, acetonitrile. Up to 0.5 mg of protein has been chromatographed under these conditions with little or no loss in resolution. The fractions from HPLC containing labeled protein are evaporated to dryness (Savant Speedvac concentrator), redissolved in 20 m M Tris-HC1, pH 7.5, 7 M urea, and finally dialyzed against 30 m M Tris-HC1, pH 7.4, 500 m M KC1, 20 m M magnesium acetate, 1 m M dithiothreitol (30S proteins) or 20 m M Tris-HC1, pH 7.4, 400 m M NH4CI, 4 m M magnesium acetate, 4 m M 2-mercaptoethanol (50S proteins). Ribosomal RNA
Labeling ratios approaching unity are usually obtained for 16S and 23S RNA, lessening the need for purification. However, 5S RNA often gives incomplete labeling. The procedure described below for tRNA probably would be applicable to 5S RNA but has not yet been tested with this material.
[ 11 ]
SEPARATION OF RIBOSOMAL PROTEINS AND t R N A s
181
tRNA
To our knowledge, the use of Cls reversed-phase HPLC for separation of tRNAs has not been described previously, although it has been used for separating oligodeoxynucleotides,u It appears to represent a significant improvement over several other methods. Chromatography on benzoylated DEAE-cellulose (BD-cellulose) 25,26and RPC-5 chromatography13,~8-27 are frequently used. Although both of these methods involve hydrophobic interactions and the latter is referred to as reversed-phase chromatography, a large portion of the energy involved in binding of tRNA to such columns is due to ionic interactions of the negatively charged phosphate groups of tRNA with the positively charged nitrogen atoms of the BD-cellulose and RPC-5 material. The following procedure appears to separate tRNA species solely on the basis of hydrophobic interactions, presumably involving interaction with the bases of the RNA. Purines have more hydrophobic character than pyrimidines.28 Hartwick et aL 2s developed a procedure for separating ribonucleoside monophosphates on a Ci8 column, the order of elution being CMP, UMP, GMP, and AMP. This report prompted the investigation of the interaction of tRNA with C~8. A /zBondapak C~s column is equilibrated with 20 mM Tris-acetic acid (pH 5- 7 depending on the application), 10 mM magnesium acetate, and 0.4 M NaC1. tRNA samples are applied in the same solution. The column is developed with a methanol gradient between 0 and 60% in a solution containing the salt at the same concentrations. Figure 2 shows the elution profile of unlabeled deacylated yeast tRNA z*e and its acetylated aminoacylated form. Deacylated tRNA l~e elutes from the column at about 22% methanol and Ac[14C]Phe-tRNA at about 28% methanol. Both are eluted as relatively sharp peaks which are well separated. No radioactivity is detected in the first peak. Also shown in Fig. 2 by arrows 1 and 2 are the approximate positions at which E. coli deacylated tRNA ~ and AcPhe-tRNA elute. Unacetylated Phe-tRNA also can be separated from deacylated tRNA. It is eluted at a slightly lower methanol concentration than AcPhe-tRNA at approximately the position indicated by arrow 3. Although BD-cellulose has been used to separate E. coli Phe-tRNA from deacylated tRNAme,29 24 H.-J. Fritz, R. Belagaje, E. L. Brown, R. H. Fritz, R. A. Jones, R. G. Lees, and H. G. Khorana, Biochemistry 17, 1257 (1978). 25 I. C. Gillam, S. Milward, D. Blew, M. Von Tigerstrom, E. Wimmer, and G. M. Tener, Biochemistry 6, 3043 (1967). 26 W. Wintermeyer and H. G. Zaehau, FEBS Left. 18, 214 (1971). 27 R. L. Pearson, J. F. Weiss, and A. D. Kelmers, Biochim. Biophys. Acta 228, 770 (1971). 28 R. A. Hartwiek, S. P. Assenza, and P. R. Brown, J. Chromatogr. 186, 647 (1979). 29 K. L. Roy, A. Bloom, and D. $611, Proced. Nucleic Acid Res. 2, 524 (1971).
182
[ 11]
OTHER BIOPHYSICALMETHODS I
I
I
I
I
I
I
I
'
48,
ti
A
I
I
. . . . . . . . ..~ 4 4
0.8
I
2
i
t
3 ~
/:
0.6
24 d
12
o.,o 0
0
......J: . J ij 8
....... 16
24
32 40 ELUTION VOLUME.ml
48
56
64
FIG. 2. Separation of deacylatedyeast tRNA~ from Ac[14C]Phe-tRNA.Forty A2~ounits of Ac[14C]Phe-tRNA (specific activity 100 mCi/mmol) in 20 mM Tris-acetic acid, pH 5.0, 0.4 MNaCI, 10 mM magnesiumacetate were appliedto the C,8 column equilibratedwith the same solution. Elution was with a gradient of a solution containing 20 mM Tris-acetic acid, pH 5.0, 0.4 M NaCI, 10 mM magnesium acetate, 60% methanol. The gradient shown is expressed as final percentage of methanol. Absorbance of 290 nm was monitored continuously. Fractions of 4 ml were collectedand radioactivitywas determinedwith 10-#1aliquots by scintillationcounting in diphenyloxazole-toluenecounting fluid containing 5% Bio-Solve. Arrows 1 and 2 indicate the approximateelution positions of E. coil deacylatedtRNA~ and AcPhe-tRNA, respectively.Arrow 3 indicates the approximation elution position of yeast Phe-tRNA. separation by the procedure described here provides considerably cleaner resolution of the two species. Shown in Fig. 3 is the separation of deacylated DCCH-labeled tRNA ~ from DCCH-labeled AcPhe-tRNA. The tRNA was labeled with D C C H by the procedure indicated above, then chromatographed on the Cts column, followed by aminoacylation, acetylation, and finally rechromatography on the C~8 column. A small a m o u n t of unlabeled deacylated tRNA and unlabeled AcPhe-tRNA present in the preparation are eluted at about 22 and 28% methanol, respectively. The DCCH-labeled deacylated tRNA is eluted with 34% methanol whereas the DCCH-labeled AcPhe-tRNA is eluted with 37% methanol. BD-cellulose, by contrast, gave no resolution of this pair. The large peak of UV-absorbing material at the beginning of the gradient is ATP, which was coprecipitated with the tRNA by ethanol following the aminoacylation reaction. Figure 4A shows the separation of yeast tRNA Ph* species that are generated during the labeling procedure in which the wybutine base is replaced with proflavine. Yeast t R N A w was labeled with proflavine at
0
[11]
SEPARATION OF RIBOSOMAL PROTEINS AND t R N A s 0.36
0.32
;
i
i
,
!
•
I
'
I
'
I
I
183
I
!
48
-
40 0.28
-
.....................
...-"''"
~
"" ....
:-
32
A
0
0.20 o
24
)
t~w 0.16
>-
of,.) zz
I>
IZlm
(z: ~ 2
(2_
0
,6 ~
0,12
OO
I-
o,)¢n ~m < <
~
0.08
8 0.04 0
0
0
8
16
24
32 40 48 56 E L U T I O N V O L U M E , ml
64
72
80
8e
96
0
Flo. 3. Separation of yeast deacylated DCCH-labeled tRNA T M from Ac[t4C]Phe-tRNA labeled with DCCH. DCCH-labeled tRNA v~ that had been isolated by reversed-phase HPLC was aminoacylated, then aeetylated. A sample containing 7 A26o units of this DCCH-labeled AcPhe-tRNA in 20 m M Tris-acetic acid, pH 6.0, 0.4 M NaCI, 10 m M magnesium acetate was applied to the Cts column equilibrated with the same solution. Elution at a flow rate of 1 ml per minute was performed with the methanol gradient shown. Absorbance was monitored continously at 260 n m and at 430 nm, near the absorbance maximum of DCCH. Fractions of 4 ml were collected and 20-/d aliquots counted for radioactivity as described in the legend to Fig. 2.
position 37 by the procedure developed by Wintermeyer et al. 13 then loaded on the Cls column as described for Fig. 3. Four prominent peaks are detected by UV absorption due to the nucleic acid. Three of these (peaks 2, 3, and 4) contain proflavine at a stoichiometry of about 1 : 1 with the tRNA whereas peak 1 is unlabeled tRNA. Wintermeyer and Zachau3° used chromatography on RPC-5 to achieve partial separation of two proflavine-labeled species which they identified as a- and fl-anomers resulting from addition of proflavine to C-1 of the ribose residue at position 37. These correspond to peaks 2 and 3 in Fig. 4A. The identity of the fourth peak seen in Fig. 4A is not known. For use in fluorescence experiments peak 2 would have been collected separately; however, to demonstrate the separation that can be obtained with the system described here, peaks 2 and 3 were combined, aminoacylated with [~4C]phenylalanine, acetylated, and then rechromatographed on the Cts column. The results are shown in Fig. 3o W. Wintermeyer and H. G. Zachau, Eur. J. Biochem. 98, 465 (1979).
i.2
36
I
A
2
30
1.0
24
0.8
T
4
,8 ; EE_ o~ ~UJLU .04
•"
!
./
C,,~U
o
i
t
112 w
i
~m mm
\, li \
t
< <0.2
•
•
, O
I
J....
E}
J------,------L 16
i
I
. . . . . 24
I
..~ 32
I
I
| 40
I
I
I 48
I 56
I
|
I0
I 64
,
I
.
%% 0
I
72
I
/%
22.5
30
I
......... . . . . . . . . . . . . . . . . . . . . . . . . . ,....."
l8.0
i °f g
ii ............................
0.6
,
o_ 1 3 5 x
P
_~ 9o
• .0.4 ww |
<<
~: 4 5
I 0
.,/',
, O
16
24
32 ELUTION
40 VOLUME, ml
40
56
.
. .... '
?~0
FIG. 4. Separation of yeast deacylated t R N A ~ e. (A) Twenty-four A 2 ~ 0 units of t R N A ~ which had been labeled with proflavine were applied in 20 m M Tris-acetate acid, pH 7.2, 0.4 M NaCI, 10 m M magnesium acetate to the Cms column equilibrated with the same solution. Elution at a flow rate of I ml per minute was with the methanol gradient shown. Absorbance at 260 or 450 nm was monitored continuously. (B) Thirteen A260 units of the combined first two proflavine-labeled peaks (peaks 2 and 3) from A were aminoacylated, acetylated, and reapplied to the column under the same conditions as in A. Elution was with the methanol gradient shown. Absorbance was monitored continuously at 260 and at 450 nm. Fractions of 4 ml were collected and 20-gl aliquots of those indicated were counted for radioactivity as described in the legend to Fig. 2.
[ 11]
SEPARATION OF RIBOSOMAL PROTEINS AND t R N A s
185
4B. Complete separation of the two AcPhe-tRNA species (peaks 2B and 3B) from the deacylated forms (peaks 2A and 3A) is achieved, as indicated by association of radioactivity only with the second pair of peaks, 2B and 3B. Furthermore, the data appear to indicate that the peak 2 anomer is aminoacylated more efficiently than the peak 3 species. The slightly different methanol percentage at which the deacylated proflavine-labeled tRNA ~ elutes in Fig. 4A and B is due to the different shape of the methanol gradient in the two cases. For a given gradient the elution positions are very reproducible. General Comments about tRNA Separation Procedure
Up to 40 A26ounits of tRNA have been applied to the C~s column with no loss of resolution. At a flow rate of 1 ml per minute most separations require only 1-2 hr. Recoveries are generally in the range of 80-90%. Only slight dependence on pH is noted between pH 5.0 and 7.2. The columns used are readily available commercially, which apparently is not true of the RPC-5 columns. The methanol gradient can be continfied at least to 45%. Some doubly labeled tRNA species elute near this concentration (not shown). Labeled tRNAs not eluted by 45% methanol probably would chromatograph better on a less hydrophobic column such as C s, since the tRNA may precipitate at higher methanol concentrations. We have not tested the effectiveness of the chromatographic procedure for isolation of various naturally occurring species of tRNA; however, probably it would be useful for this purpose. For example, tRNA v~ from which the wybutine has been excised elutes around 16% methanol (Fig. 4A) while tRNA ~ containing wybutine elutes around 22% methanol (Fig. 2). This indicates that manipulation of the methanol concentration in the approximate range of 14-22% probably would allow significant fraetionation of many tRNAs. Reconstitution of Labeled Components into Ribosomes
Incorporation of labeled ribosomal RNAs into functional ribosomes is performed by the total reconstitution technique. For 30S total reconstitution, the procedure used is that of Traub and Nomura a~ as modified by Hardy et al. 32 and, for 50S total reconstitution, the procedure of Nierhaus and Dohme 33 as modified by Schulze and Nierhaus ~ is used. The only 31 p. Traub and M. Nomura, Proc. NatL Acad. Sci. U.S.A. 59, 777 (1968). 32 S. J. S. Hardy, C. G. Kurland, P. Voynow, and G. Mora, Biochemistry& 2897 (1969). 33 K. Nierhaus and F. Dohme, this series, Vol. 59, p. 443. H. Schulze and K. H. Nierhaus, EMBOJ. 1,609 (1982).
186
OTHER BIOPHYSICAL METHODS
[ 11]
modification of these procedures is that labeled RNA is substituted for unlabeled RNA. Labeled proteins may be incorporated into ribosomal subunits either by total reconstitution or, in most cases, more efficiently by direct addition to subunits that lack the protein of interest. Efficient incorporation of the labeled protein usually does require that the subunits or total protein mixture be deficient in that protein, which can be accomplished by several strategies. In some cases, affinity chromatography using antibodies against the protein of interest may be useful. Because of the strong interaction between S 1 and RNA, it can be selectively removed from 30S subunits by passing them over a poly(U)-Sepharose column equilibrated with 20 m M Tris-HC1, pH 7.5, 1 M N H 4 C 1 , 20 ~ magnesium acetate, 5 m M 2-mercaptoethanol. 35 Dr. Eric Dabbs 36 has isolated a series ofE. coli K12, strain A l9, mutants a7-4° that either totally lack a single protein or contain the protein in altered form that can be readily removed from the ribosomal subunit. The normal proteins from these deficient ribosomes can be extracted and used with a labeled protein for total reconstitution. In most cases the labeled protein will bind directly to the ribosomal subunits that lack the mutant protein. This technique has been used for incorporation of labeled Sl, 9 S21, 7 and L11 s into 30S and 50S subunits, respectively. For example, labeled $21 can be incorporated by adding it to $2 l-deficient 30S subunits in 10 m M Tris-HCl, pH 7.4, 100 m M NH4C1, l0 m M magnesium acetate, 5 m M 2-mercaptoethanol, followed by a 10-min incubation at 37o. 7 30S missing both proteins S1 and S21 can be obtained by passing 30S(-$21) obtained from the S21 mutant over the poly(U)-Sepharose column. 7 Both S21 and Sl labeled with different fluorophores can be incorporated into the same 30S particle for energy transfer studies. Labeled deacylated tRNA I've or AcPhe-tRNA is bound specifically to the ribosomal P site and labeled AcPhe-tRNA is bound specifically to the ribosomal P or A site by the methods of Wurmbach and Nierhaus. 41 Enzymatic binding of Phe-tRNA with either GTP or its nonhydrolyzable analogs is performed as previously described.42 35 A. R. Subramanian, P. Rienhardt, M. Kimura, and T. Suryanarayana, Eur. J. Biochem. 119, 245 (1981). 36 E. R. Dabbs, Laboratory for Molecular and Cell Biology, P.O. Box 30947, Braamfontein 2017, South Africa. 37 E. R. Dabbs, J. Bacteriol. 140, 734 (1979). 3s E. R. Dabbs, R. Hasenbank, B. Kastner, K.-H. Rak, B. Wartusch, and G. St6ffier, Mol. Gen. Genet. 192, 301 (1983). 39 E. R. Dabbs, J. Bacteriol. 144, 603 (1980). 4o E. R. Dabbs, in "Structure, Function and Genetics of Ribosomes" (B. Hardesty and G. Kxamer, eds.), p. 733. Springer-Verlag, New York, 1986. 41 p. Wurmbach and K. H. Nierhaus, Proc. Natl. Acad. Sci. U.S.A. 20, 5301 (1981). 42 W. Rychlik, O. W. Odom~ and B. Hardesty, Biochemistry 22, 85 (1983).
[ 11 ]
SEPARATION OF RIBOSOMAL PROTEINS AND t R N A s
187
Materials and General M e t h o d s All fluorescent probes used were obtained from Molecular Probes, Inc., Junction City, OR. Proteinase K, a product of E. Merck, was purchased through Beckman Instruments, Irvine, CA. Ribosomal RNA was extracted with phenol from E. coli K12, strain A19, ribosomal subunits. 33 23S and 5S RNA were separated by chromatography on Sephadex G-100. 33 The growth of E. coli and preparation of ribosomal subunits have been described. 12 Purified ribosomal subunits $21, LI 1, L27, and L28 were a gift from Dr. H. G. Wittman. 43 In some cases, purified ribosomal proteins were obtained by HPLC on a pBondapak C~s reversed-phase column by the method of Keflavage et al. 22 Ribosomal protein S1 was obtained by passage of 30S subunits over a poly(U)-Sepharose column followed by DEAE-cellulose chromatography as previously described. 35 The total proteins from the 30S subunit were isolated as described by Traub and Nomura 3~ and those from the 50S subunit as described by Schulze and Nierhaus. 34 Total protein mixtures lacking $21 or L 11 were obtained from ribosomal subunits isolated from the strains provided by Dr. E. Dabbs. a6,4° The mutants are designated VT442 ($21), 39 and AM68 (L11). 37 The 50S subunit of the L 11 mutant is devoid of L 11 while $21 must be selectively removed from the 30S subunit of the $21 mutant by a high-salt wash as previously described. 7 50S subunits missing L27 and L28 were also obtained from mutants AM 105 as and AM81, 37 respectively. Purified tRNA ~ from yeast and E. coli were obtained from Sigma, St. Louis, MO. Yeast tRNA ~e was aminoacylated as previously described44 except that a 0.5 M KC1 salt wash of ribosomes was used as the source of synthetase instead of the postribosomal supernatant. E. coli tRNA Phe was aminoacylated as described previously. 4 Acetylation of Phe-tRNA was with acetic acid hydroxysuccinimide ester by the method of Rappoport and Lapidot. 45 Acknowledgment This work was supported by Grants No. PCM81-12248 and DMB84-10063 from the National Science Foundation.
43 H. G. Wittmann, Max-Planck-Institut ffir Molekulare Genetik, Ihnestrasse 63-73, D-1000 Berlin 33 (Dahlem), Federal Republic of Germany. 44 B. Hardesty, W. McKeehan, and W. Culp, this series, Vol. 20, p. 316. 45 S. Rappolaort and Y. Lapidot, this series, Vol. 29, p. 685.
188
OTHER
BIOPHYSICAL
METHODS
[ 12]
[1 2] I s o l a t i o n a n d C h a r a c t e r i z a t i o n of Colicin Fragments of Bacterial 16S Ribosomal RNA By PETER H. VAN KNIPPENBERG and HANS A. HEUS Ribosomal RNAs are complex molecules that elude detailed analysis of their structures by physical techniques. Nevertheless, by the method of comparative sequence analysis highly sophisticated models of their secondary structures have been proposed. 1 These models are dominated by a multitude of stem-loop structures (hairpins). We have chosen to study in detail a particular hairpin structure near the 3' end of bacterial 16S rRNA (Fig. 1). This region is of special interest because (1) it is supposed to bind m R N A during initiation of protein biosynthesis through base pairing) (2) two adjacent Nt,N~-dimethyladenosines, conserved throughout nature, 3 are unmodified in kasugamycin-resistant (ksgA) bacteria, 4 and (3) one can cleave the 16S rRNA molecule at the site indicated in Fig. 1 with the bacteriocins colicin E3 and cloacin DF 135,6 and isolate the resulting "colicin fragment." This paper describes the large-scale purification of the colicin fragment from Escherichia coli ribosomes and illustrates its usefulness for physical studies. Essentially the same procedure can be followed to isolate colicin fragments from other bacteria. Some of the properties of these fragments will be described. Materials Bacterial Cells Escherichia coli wild-type MRE600 cells were purchased from Public Health Service, UK. Kasugamycin-resistant strains (ksgA) were grown in LB medium containing per liter: 10 g tryptone, pH 7.0, 5 g yeast extract, 8 g NaCI, 100 mg kasugamycin (Sigma). Cells were harvested at an optical
R. R. Gutell, B. Weiser,C. R. Woese,and H. F. Noller,Prog. Nucleic Acid Res. MoL BioL 32, 155 (1985). 2j. Shine and L. Dalgarno, Proc. Natl. Acad. ScL U.S.A. 71, 1342(1974). 3p. H. van Knippenberg, J. M. A. van Kimmenade, and H. A. Heus,Nucleic Acids Res. 12, 2595 (1984). 4T. L. Helser,J. E. Davies,and J. E. Dahlberg, Nature (London), New Biol. 233, 12 (1971). s C. M. Bowman,J. E. Dahlberp,T. Ikemura, J. Konisky,and M. Nomura, Proc. Natl. Acad. Sci. U.S.A. 68, 964 (1971). 6F. K. De Graaf, H. G. D. Niekus, andJ. Klootwijk,FEBSLett. 35, 161 (1973). METHODS IN ENZYMOLOGY, VOL. 164
Copyright © 1988 by Academic Press, inc. All rights of reproduction in any form r~erved.
[ 12]
COLICIN FRAGMENTSOF 16S rRNA
189
I
in eukaryotes U ~
1400 i
):8
1500 j
A-U C-
IACACACCGmCmCCGt~IA
?AAGUCC~UAACAAGGUI ~CUCCUUAo. 1'
cross-link to wobble bose
A-U A-
colicin E3 cloacin OF13
' ' Shine and Dalgarno (prokaryotes)
FIG. 1. The 3' end domain of E. coil 16S ribosomal RNA. Nucleotides in boxes are conserved. For other details, compare text and P. H. van Knippenberg, in "Structure, Function and Genetics of Ribosomes" (B. Hardesty and G. Kramer, eds.). Spdnger-Vedag, New York, 1986.
density of 0.7-0.9 at 620 nm, washed once with STB10, and stored at - 8 0 °.
Buffers Standard buffer (STBx): 10 m M Tris-HCl, pH 7.6, x m M magnesium acetate, 60 m M NH4CI, 7 m M 2-mercaptoethanol RNA buffer: 0.1 M sodium acetate, pH 5.5 HPLCx buffer: 20 m M NaH2PO+'H20, 20 m M Na2HPO4" 12H20, 10x m M KC1 To prevent RNA degradation by contaminating RNases, buffers and plastic materials were autoclaved. HPLC buffers were filtered through Millipore filters (pore size 0.45 #m) before autoclaving. Sucrose solutions were treated with 0.1 mg/ml bentonite. Tubing, rotors, cuvettes, etc. were immersed in a 0.6% diethyl pyrocarbonate (Sigma) solution for at least 20 min and rinsed with sterile water. Methods
Isolation of Ribosomes Escherichia coli cells were ground with alumina (alumina: ceils = 2 : 1 w/w) in the presence of 0.2 nag DNase I (Boehringer Mannheim) per 50 g
190
OTHER BIOPHYSICAL METHODS
[ 12]
cells at 4 °. An $30 extract was obtained by centrifugation at 30,000 g for 1 hr. Ribosomes were isolated from the $30 extract by centrifugation at 105,000 g for 3 hr, washed with 1 M NH4CI in STB10, and stored in STB10 at - 8 0 o.
Gel Electrophoresis Low-molecular-weight RNA was run on 0.8 × 9 cm cylindrical gels containing 12% acrylamide and N,N'-methylenebisacrylamide (19.5 : 0.5, w/w) in a buffer containing 40 m M Tris-acetate, pH 7.6, 20 m M sodium acetate, 2 m M ethylenediaminetetraacetic acid (EDTA), and 0.1% sodium dodecyl sulfate (SDS). Gels were preelectrophoresed at 4 ° for 30 min at 5 mA/gel in the same buffer and run at 9 mA/gel for 2.5-3 hr until the bromphenol blue marker reached the bottom of the gel. Gels were immersed in 7% acetic acid for several hours and scanned at 260 nm with a Gilford 2600 spectrometer.
Sephadex G-150 Column Chromatography Sephadex G-150 (Pharmacia) was preswollen in RNA buffer as recommended by the manufacturer and autoclaved at 110 °. Low-molecularweight RNA was fractionated on a 3 × 35 cm column at a speed of 25 ml/ hr with 30 cm H20 pressure.
5'-32p-Labeling of Colicin Fragment RNA samples containing 0.05 A260 units colicin fragment were lyophilized and dissolved in a labeling mix containing 1/zl 10× C buffer (500 m M Tris-HC1, pH 9.0, 10 m M MgC12, 50 m M dithiothreitol), 5 gl H 2 0 , 1 gl T4 polynucleotide kinase (BRL, 1 unit/gl), 3 gl [?-32p]ATP (Amersham, 10/~Ci//tl; 3000 Ci/mmol). Incubation was for 30 min at 37 °. Determination of the D e g r e e of 165 r R N A Cleavage Before the start of a large-scale purification, the degree of cleavage of 16S rRNA is determined in a pilot experiment. Five A2~ounits of high-saltwashed ribosomes in 20/zl STBI0 buffer are incubated with 0.05/zg cloacin DFI3 (heat-activated for 10 rain at 90*) for 45 min at 42 °. Note that bacteriocin cleavage requires intact 70S ribosomes7 and that the Mg 2+ concentration should be at least 10 mM. The sample is mixed with an equal volume of formamide and electrophoresed on cylindrical gels of 12% 7 T. Boon, Proc. Natl. Acad. Sci. U.S.A. 69, 549 (1972).
[ 12]
COLICIN FRAOMENTSOF 16S rRNA
E tO ~4
191
55 rRNA tRNA = colicin rogrnent
e43
.13
migration
FIG. 2. Scansat 260 nm of cylindricalgelscontainingthe RNA of ribosomestreatedwith cloacinDFI 3 (uppertracing)and of untreatedribosomes(lowertracing). polyacrylamide. A control sample of ribosomes incubated in the absence of bacteriocin is included. Figure 2 shows a scan (Gilford 2600 spectrophotometer) of the sample and control gel at 260 nm. The high-molecularweight RNAs have barely penetrated the gel and the peaks represent (from left to right), 5S rRNA, tRNA, and colicin fragment. The percentage cleavage is calculated as % Cleavage
surface colicin fragment peak 14~ surface 5S rRNA peak X --._ × 100%
In the experiment in Fig. 2 the percentage cleavage is 54%. In our hands this number may vary from 20 to 70% for E. coli, depending on the batch of ribosomes. Ribosomes from the ksgA mutant ofE. coli show a comparable sensitivity to cloacin DF13. Ribosomes from a batch of commercial Bacillus stearothermophilus were virtually uncleaved by the bacteriocin, but bacteria grown in our laboratory were good substrates (40-90% cleavage). During all steps of the isolation of the colicin fragment, an aliquot is used to check its presence and the yield by gel electrophoresis. Large-Scale Purification of Colicin F r a g m e n t Ribosomes, 40,000 to 65,000 A260 units (from 200-250 g E. coli), are subdivided into portions of approximately 12,000 A26o units (1,000 A26o units/ml). One portion at a time is incubated for 60 min at 42 ° with 0.6rag (60pl) cloacin DFI3. At the end of the incubation period an
192
OTHER BIOPHYSICAL METHODS
[ 12]
aliquot is saved for dectrophoretic determination of the extent of cleavage as above. The remainder is diluted with 48 ml of STB0 buffer to bring the final concentration of Mg2+ to 2 mM. Six milliliters of 45% sucrose in STBI is added and the sample is layered on a 10-45% sucrose gradient in STBI buffer in the BXV zonal rotor of a MSE superspeed centrifuge spinning at a speed of 3,000 rpm. Rotor speed is increased to 27,000 rpm and centrifugation is continued for 22 hr. After returning the speed to 3,000 rpm, the contents of the rotor is pumped out with 50% sucrose in STB1 and fractionated into 70 fractions of 20 ml each. The fractions containing 30S subunits (hatched area in Fig. 3) are pooled and precipitated with 2 volumes of ice-cold ethanol. The precipitate is collected by centrifugation and dissolved in 20 ml RNA buffer. Twenty milliliters of buffer-saturated phenol is added and the mixture is stored at - 8 0 °. All 30S preparations in phenol are combined and SDS is added to 1%. After shaking, the water layer is separated and extracted two more times with phenol in the presence of 1% SDS. Residual phenol is removed by chloroform extraction, whereafter the RNA is precipitated with ethanol. The precipitate is dissolved in 0.1 M sodium acetate, pH 5.5 (20 ml for 10,000 A26ounits of 30S subunits). The colicin fragment is separated from the bulk of the ribosomal RNA by centrifugation on 5 - 20% sucrose gradients in RNA buffer using either swinging bucket rotors (Spinco SW27, 200 A260units of RNA per bucket, 16 hr at 25,000 rpm) or a zonal rotor (MSE superspeed BXV rotor, 10,000
E
C 0 ¢JO
o
0 Jo .o o
i
10
30
510
i'
70
fraction number
FxG. 3. Optical density (at 260 nm) profile of a sucrose gradient run of cloacin-treated and dissociated ribosomes in a zonal rotor. The hatched region (30S particles) was pooled for further processing.
[ 12]
COLICIN FRAGMENTSOF 16S rRNA
193
E tO tO
o tO JO =.. 0 e~ 0
-.~
sedimentation
FIG. 4. Sucrose gradient centrifugation in a swinging bucket rotor (SW27) of RNA obtained from cleaved 30S ribosomes. Fractions C and D were used for further purification.
A26o units of RNA per run, 48 hr at 27,000 rpm). A typical profile of a separation on a SW 27 rotor is shown in Fig. 4. Fractions C and D of the gradient are combined, the RNA is precipitated with ethanol as before, and dissolved in 4 ml RNA buffer. Each portion (approximately 160 A260units of RNA) is loaded separately on a Sephadex G-150 column (3 × 35 era), equilibrated with RNA buffer, and eluted. The separation profile is shown in Fig. 5. The colicin fragment peak is collected, concentrated by ethanol precipitation, and washed several times by ethanol precipitation. Gel electrophoretic analysis of the final product is shown in Fig. 6. Occasionally, total RNA from cloacin-treated 70S ribosomes was applied directly to a zonal sucrose gradient centrifugation without prior separation of the subunits. Figure 7 shows the optical density profile of such a gradient and indicates the positions of colicin fragment and 5S RNA as analyzed by gel electrophoresis. The further separation of colicin fragment and 5S RNA requires the application of HPLC (compare below). The yields in various steps during a typical preparation are shown in Table I. The percentage cleavage in this experiment was 55%. Theoretically this would mean that about 360 A2~ounits of colicin fragment was present
194
E t-
OTHER BIOPHYSICAL METHODS
[ 12]
0.6-
O
LO t~
0.4 u tO
e0
.I0 0
J
0.2
0
lb
2b
3b fraction
sb
number
FIG. 5. Sephadex G-I50 column chromatography of RNA from fractions C and D in Fig. 4. The left-most peak is high-molecular-weight RNA eluting with the void volume and the peak at fraction 36 is coliein fragment.
in the cleaved ribosomes and hence that the final recovery of pure fragment was roughly 22% in this experiment. This material is sufficient and suitable for one-dimensional IH NMR experiments in the imino proton and aromatic region (see Ref. 8 and below). However, contaminating material (probably polysaccharide) originating from the Sephadex G-150 column makes the RNA unsuitable for NMR in the sugar and methyl proton region. In our current method for
E o
~0 u £3
£3 O
migration
FIG. 6. Gel electrophoretic analysis of the colicin fragment obtained from the Sephadex G-150 column in Fig. 5. s H. A. Heus, J. M. A. van Kimmenade, P. H. van Knippenber~ C. A. G. Haasnoot, S. H. de Bruin, and C. W. Hilbers, £ Mol. Biol. 170, 939 (1983).
[ 12]
COLICIN FRAGMENTS OF 16S r R N A
12-
195
-120 e-
E
E
c O LD
8
80
~0
<
m c
J~ t~
I0
o L -
lb
'ab fraction
'
sb
'
7b
c
oII
number
FIG. 7. Sucrose gradient centrifugation in a zonal rotor of total RNA extracted from cloacin DFl3-treated 70S ribosomes. The positions of colicin fragment and 5S RNA, as analyzed by gel electrophoresis of the fractions is indicated. large-scale preparation, the Sephadex c o l u m n has therefore been replaced by preparative H P L C . Separation by Preparative HPLC Low-molecular-weight R N A is dissolved in 2 ml H P L C 0 buffer and 1 ml is loaded on a Macherey and Nagel D E A E 500-10 c o l u m n (run by a L K B H P L C 2 1 5 0 - 2 1 5 2 apparatus) with H P L C 0 buffer at a speed o f l m l / m i n . T h e R N A is separated b y running a H P L C 3 0 - H P L C 7 0 graTABLE I YIELDSAT VARIOUSSTEPSDURINGA TYPICAL ISOLATIONOF COLICINFRAGMENTFROM Escherichia coli
Step
Yield (/126ounits)
E. call cells (240 g)
Washed ribosomes 30S ribosomes after zonal separation RNA from phenol-extracted 30S RNA from sucrose gradient (fractions C and D, Fig. 4) Colicin fragment from Sephadex G- 150 column
65,000 11,770 9,350 232 80
196
OTHER BIOPHYSICAL METHODS
[ 12]
E tO ¢'4
U
E L..
0
.t~ 0
1'O
2'o frQction
3'o
number
Fx~. 8. HPLCpurificationof partiallypure colicinfragmentobtainedby zonal centrifugation (Fig. 7). dient for 1 hr at 1 ml/min, followed by a 20 min HPLC70-100-100 gradient to wash contaminating higher-molecular-weight RNA from the column. The colicin fragmem is resolved in one peak as can be seen in Fig. 8. Fractions of 2.5 ml are collected. Colicin fragment-containing fractions are precipitated with ethanol, dissolved in 500 gl H20, and dialyzed twice against 250 ml H20. Dialysis, like separation of low-molecular-weight RNA on HPLC, is crucial to obtaining pure fragment suitable for taking NMR spectra covering the entire spectral range. Analysis of the Purity of the Colicin F r a g m e n t Analysis of the final product is done by SDS-gel electrophoresis on cylindrical gels followed by scanning of the gel with UV light (Fig. 6). Although the purity of the colicin fragment may also be checked by gel electrophoresis and autoradiography of 5'-32p-labeled RNA, such an analysis is a hazardous criterion for purity since especially high-molecularweight RNA contaminants may escape detection (compare below).
[ 12]
COLICIN FRAGMENTS OF 16S rRNA
Isolation of 32p-Labeled Colicin
197
Fragment
For certain experiments (e.g., probing structure by enzymes or chemicals, or to determine the sequence) very small amounts of colicin fragment labeled with 32p suffice. Colicin fragment, 0.05 to 0.5 A26o units, can be isolated by running aliquots of cleaved ribosomes on 12% polyacrylamide gels and eluting the colicin fragment band with 1 M NaC1 (1 - 2 hr at room temperature). After phenol and chloroform extraction the RNA is precipi-
Fzo. 9. Autoradiogram of purified 5'-riP-labeled colicin fragments. Left lane, fragment from a ksgA mutant of E. coli. Right lane, fragment from wild.type E. coli. For an explanation of the difference in mobility, compare R. van Charldorp, H. A. Heus, and P. H. van Krdppenberg, Nucleic Acids Res. 9, 267 (1981), from which this figure is reproduced.
198
OTHER BIOPHYSICAL METHODS
[12]
tated twice with ethanol. Fragment, 0.05 A26o units, is labeled with [y-32p]ATP and T4 polynucleotide kinase. No prior phosphatase treatment is required since the fragment contains a free 5'-OH end. Labeling at the 3' end is done using 5'-[32P]pCp and T4 RNA ligase. Note that in this case the length of the fragment is extended by one nucleotide. Labeled RNA (either 3' or 5') is electrophoresed on a 20% polyacrylamide slab gel (20 × 20 × 0.1 cm) in 7 M urea at 300 V for 4 hr. The gel is briefly exposed to a Fuji X-ray film, locating the position of the fragment. The appropriate segment of the gel is cut out, eluted with 1 M NaC1 (60 min at room temperature), and precipitated with ethanol. Figure 9 gives an example of labeled RNA preparations obtained in this way. Such preparations may sometimes appear slightly degraded. Properties of Colicin Fragments
Melting Characteristics Colicin fragments display, as expected, a main melting transition corresponding to the 3' terminal helix shown in Fig. 1. In the past, w e 9'1°
Ox ,,, ~ . o -
0.0
~
1;
7
.
'
/\1~"\.1/" //~.
~
3'0
"
'
5'0
'
'
\
\
~'
7'0
'
9'0
Temp. (°C) 10. Differential optical melting curves of colicin fragments of wild-type Escherichia coli( ), Bacillus stearothermophilus ( - - - ) and Agrobacterium tumefaciens (--" ~). Reproduced from van Knippenberg and HeusJ 2 ~.
9 R. van Charldorp, H. A. Heus, and P. H. van Knippenberg, Nucleic Acids Res. 9, 4413
0980.
~oH. A. Heus, L M. A. van Kimmenade, and P. H. van Knippcnberg, Nucleic Acids Res. l l , 203 (1981).
[ 12]
COLICIN FRAGMENTSOF 16S rRNA
199
TABLE II MELTING TEMPERATURES (Tm) OF HAIRPINSa
Colicin fragment
E. coil wild type
E. coli mutant
B. stearothermophilus wild type
B. stearothermophilus mutant A. tumefaciens Bacillus subtilis
Na + concentration (M)
Technique
Tm (*C)
0.015 0.200 0.015 0.215 0.015 0.200 0.015 0.215 0.015 0.200 0.015 0.015 0.015 0.015
UV optics UV optics Calorimetry Calorimetry UV optics UV optics Calorimetry Calorimetry UV optics UV optics Calorimetry UV optics UV optics UV optics
52 73.5 55 74 57 76 60 76.5 69.5 77 70 71 60 60
a Reproduced from van Kippenberg and Heus.~2
published additional sharp transitions that could not readily be explained. We know that in those studies these transitions were caused by impurities in the sample. Erroneously we assumed that, when a preparation ofcolicin fragment displayed only one radioactive band after electrophoresis of a sample that was 5'-32p-labeled, the fragment was pure. Figure 10 illustrates the melting profiles (displayed as the first derivative, AA/ATversus 7) of preparations that were pure as determined by UV scanning of cylindrical gels. Table II shows Tm values obtained by UV melting and microcalorimetry with various colicin fragments from a number of bacterial strains. The destabilizing effect of adenosine dimethylation on the structure of the hairpin is clearly demonstrated.
High-Resolution IH NMR The use of IH NMR in the study of the structure and dynamics of RNA molecules is well established.~I The presence of a double-stranded region is evidenced by low-field resonances due to imino protons of the base pairs. Such studies require some 200- to 300-gl samples with a concentration of approximately 1 raM. For the colicin fragment, this means approximately 3 - 5 mg (75-125 A2~o units of RNA). Figure 11 illustrates the spectra at 500 MHz of fragments obtained from wild-type E. coli and from its kasugamycin-resistant derivative. The assignments of the peaks were H A. Heerschap, C. A. G. Haasnoot, and C. W. Hilbers, Nucleic Acids Res. 10, 6981 (1982).
200
OTHER BIOPHYSICAL METHODS
6-C 6 A-U 2 U -68/9
5 16
G-C~
0-6 3
.II
C-67 A - U 1? A - U
8
7
A
I
9
2 wild type
~ 1'5
[ 12]
14
. , ~mutant
1'3
12' '
li
ppm FIG. 11. Five hundred megahertz 'H NMR spectra of colicin fragments obtained from wild type and a ksgA strain of E. coll. Arrows indicate shifts of resonances due to absence of methyl groups on the two neighboring adenosines in the hairpin loop. Insert gives assignmerits based on NOE. Reproduced from Heus et aL8
based on nuclear Overhauser effects (NOEs). Details of these studies and of experiments with fragments from B. stearothermophilus have been reported elsewhere. 8,12 The use of the E. coli colicin fragment for studies of the interaction with the initiation factor 3 (IF3) has also been described. 13
12p. H. van KnippenberB and H. A. Heus, J. Biomol. Struct. Dynam. 1, 371 (1983). 1~E. Wickstrom, H. A, Heus, C. A. G. Haasnoot, and P. H. van Knippenberg, Biochemistry 25, 2770 (1986).
[ 13]
RIBOSOMAL PROTEIN- RNA INTERACTIONS
[ 13] P h y s i c a l S t u d i e s o f R i b o s o m a l Interactions By
203
Protein-RNA
DAVID E. DRAPER, INGRID C. DECKMAN, and
JAILAXMI V. VARTIKAR
Introduction Specific RNA-protein interactions have long been recognized as an essential feature of ribosome assembly and function. Molecular details of these interactions have been difficult to obtain, and studies of R N A protein complexes have lagged far behind analogous work on D N A protein interactions. The availability of synthetic RNA fragments from in vitro transcription I now makes it possible to ask how size or sequence variants of an RNA affect protein binding, and spectroscopic studies of relatively small ribosomal (r) protein 2- RNA complexes are feasible. To undertake physical studies of r-protein-RNA complexes, methods for measuring the thermodynamics of the interactions and for discriminating specific from nonspecific binding are essential. Typical binding constants are on the order of l0 7 M -1, which means that protein and RNA concentrations of less than - 1 pA4 must be used for binding constant measurements. Intrinsic tryptophan or tyrosine fluorescence of proteins is frequently useful in this range, but of the r-proteins we have tested so far, none shows an adequate change in fluorescence intensity upon binding rRNA. Therefore we have had to rely on methods which physically separate radioactively labeled r-protein-rRNA complex from the free components. In this article we discuss three such methods, and point out potential artifacts in detecting specific interactions. The work we describe deals with r-protein $4 binding a specific site on the a mRNA, 3 but should be applicable to other r-protein interactions with rRNA or mRNA fragments. Filter Assay for Binding The nitrocellulose filter assay is probably the most rapid and widely used method for detecting protein-nucleic acid interactions. Protein is incubated with radioactively labeled RNA, and rapidly filtered through a i D. E. Draper, S. A. White, and J. M. Kean, this volume [ 14]. 2 Abbreviations used: r-protein, ribosomal protein; TCA, trichloroacetic acid; D T r , dithiothreitol. 3 I. C. Deckman and D. E. Draper, Biochemistry24, 7860 (1985). METHODS IN ENZYMOLOGY, VOL. 164
Copyright© 1988 by AcademicPress,Inc. All fightsof reproductionin any formr~ervcd.
204
P R O T E I N - R N A INTERACTIONS
[ 13]
nitrocellulose membrane. In an ideal case, the protein binds tightly to the membrane, and any RNA bound to the protein is retained as well and detected by scintillation counting. The assay does not always work this way: complexes of r-proteins with large rRNAs, for instance, are not retained by the filter. 4's It should be emphasized that the assay is a nonequilibrium method. Protein and RNA-protein complex are physically removed from solution over a period of time, which has the potential of perturbing the position of the equilibrium. However, equilibrium binding constants have been obtained by this method for a number of D N A protein and RNA-protein complexes.6-9
Purification of r-Proteins We use the standard r-protein preparation developed by Kurland et al., l°,t~ with some modifications to adapt the chromatography step to high-performance liquid chromatography (HPLC). 70S ribosomes from 50-70 g of Escherichia coli MRE 600 are prepared as described, t° and extracted with acetic acid without separating subunits. H The protein is dialyzed first against 15% acetic acid, and then against column buffer [6 M urea (BRL Ultrapure), 20 mMdisodium phosphate, 0.5 mMdithiothreitol (DTT), adjusted to pH 5.6 with methylamine]. The protein is loaded onto a preparative cation-exchange HPLC column (Bio-Rad TSK SP-5-PW, 21.5 × 150 mm), and eluted with a 500-ml gradient from 0 to 0.4 M KC1 in column buffer. The gradient is pumped at 0.5 ml/min by two Bio-Rad HPLC pumps controlled by an Apple computer with software and hardware furnished by Interactive Microwave. Protein peaks are detected by absorbance at 230 nm in an Isco UA-5 flow monitor, equipped with a 2-mm HPLC flow cell. Proteins are identified by electrophoresis with authentic r-protein standards in two different acrylamide gel systems [SDS-urea (pH 8.0) and acetic acid-urea (pH 4.5)]. Fractions containing a desired protein are pooled, diluted by about a factor of two with column buffer containing no KC1, and rerun on a smaller version of the same cation-exchange HPLC column (7.5 × 75 mm) using a shallower gradient over the appropriate salt range. $4 obtained this way was better than 95% 4 j. Schwarzbauer and G. R. Craven, Nucleic Acids Res. 9, 2223 0981). 5 j. Schwarzbauer and G. R. Craven, this series, Vol. 59, p. 583. 6 M. Yams and P. Berg, J. Mol. Biol. 28, 479 (1967). 7 A. D. Riggs, H. Suzuki, and S. Bourg~is, J. Mol. Biol. 48, 67 (1970). 8 D. C. Hinlde and M. J. Chamberlin, J. Mol. Biol. 70, 157 (1972). 9 j. Carey, V. Cameron, P. deHaseth, and O. C. Uhlenbeck, Biochemistry 22, 2601 (1983). ~0C. G. Kurland, this series, Vol. 20, p. 379. H C. G. Kurland, S. J. S. Hardy, and G. Mora, this series, Vol. 20, p. 381.
[13]
RIBOSOMAL PROTEIN-RNA INTERACTIONS
205
pure as determined by a densitometer scan ofa Coomassie Blue stained gel. The protein is stored at - 7 0 ° in the column elution buffer. Two methods can be used to concentrate the protein, if necessary. The peak fractions from the ion-exchange column can again be diluted and loaded onto the same column, but eluted with column buffer containing 0.5 M KC1 to obtain a sharp, concentrated peak of protein. We have also used acetone precipitation to concentrate small volumes of $4 protein without loss of RNA binding activity. An aliquot of protein in column buffer (with or without KC1), kept on ice, is diluted with 5 volumes of ice cold acetone. After 15 rain at 0 ° the precipitate is centrifuged, dried, and resuspended in a small volume of column buffer. The precipitation is essentially quantitative.
Preparation opS S-Labeled RNA mRNA or rRNA fragments containing the r-protein binding site are prepared by T7 RNA polymerase transcription of cloned DNA. Preparation of T7 RNA polymerase and plasmid DNA containing a T7 promoter have been described) We have found asS to be a convenient isotope for labeling the RNA fragments. Sufficiently high specific activities are obtained without the problems with radiation damage associated with 32p. 35S-labeled RNA can be used for more than a month, where 32p-labeled RNA is badly degraded in less than 2 weeks. To carry out a transcription, add the following components in order to a 1.5-ml plastic centrifuge tube: H20 to make 100/~1 final volume 20~tl 5X buffer (200raM Tris, 4 0 r a M MgC12, 125raM NaC1, 25 m M DTT, pH 7.6) 10 #1 NTPs (from stock of 10 m M each ATP, CTP, UTP, GTP) 40 units placental RNase inhibitor (Promega Biotec) 3/~g linear DNA template 1 #Ci [ot-3~S]ATP (-400 Ci/mmol) 1.5/~g T7 RNA polymerase Incubation is for 1 hr at 37*. If adequate precautions are taken in preparing RNase-free, sterile solutions, the RNase inhibitor is not necessary. The efficiency of nucleotide incorporation into transcripts is checked by precipitating an aliquot of the reaction with tdchloroacetie acid (TCA). Dilute 3/A of the reaction into 50/~1 of 0.5 mg/ml tRNA, 0.1 M sodium pyrophosphate, 40 m M ethylenediaminetetraacetie acid (EDTA). Add 450/~1 of ice-cold 10% TCA. Let the mixture sit on ice for 10 rain, and then suction filter through a 2.4-cm glass fiber filter (Whatman GF/C)
206
PROTEIN- RNA INTERACTIONS
[ 13]
prewetted with a solution of 0.1 M sodium pyrophosphate and 1 M HC1. After filtering the sample, rinse the filter several times with 10% TCA, then once with the pyrophosphate-HC1 wetting solution, and finally with 95% ethanol. Dry for I 0 rain at 100 ° and count in 3 ml of scintillation fluid. For comparison, spot l/zl of reaction directly onto a glass filter, then dry and count as for the filtered samples. Typically, 50-70% of the ATP is incorporated into TCA-precipitable material. To purify the RNA easily and quickly, we use a disposable "NENSorb" reversed-phase column (New England Nuclear). Dilute the transcription reaction with 100/zl of 100 mMTris, l0 m M triethylamine, 1 m M E D T A ajusted to pH 7.6 with HCI (buffer A), and load onto a column which has been previously rinsed with 3 ml methanol followed by 1 ml buffer A. Rinse the column with 1 ml Buffer A, then 1 ml of water, and elute the RNA with 300/A 50% ethanol. Precipitate the RNA by adding 20/zl of 3 M sodium acetate and 400/A absolute ethanol, and leave the mixture on ice for I hr. Then centrifuge the RNA (3 min in a microcentrifuge), dry the pellet under vacuum, and resuspend in 100/d l0 m M Tris, 1 m M Na2EDTA, pH 7.6. The integrity of the RNA is checked by electrophoresis of the transcript on a 0.8 m m - 20 cm acrylamide-urea denaturing gel. 12 About 4/zl of a transcription reaction contains sufficient RNA to be seen by ethidium bromide staining. The gel can also be exposed directly to X-ray film; about 105 cpm of 35S are sufficient to expose preflashed film overnight. Generally the full-length transcript is the only product visible on the gel, and we usually make no attempt to purify the RNA further.
Filter-Binding Assay To carry out a tiltration using the filter-binding assay, the protein and RNA are renatured separately, incubated together under the desired conditions, and filtered. Plastic Eppendorf-type tubes are used for the incubations, and glass micropipets for making protein and RNA dilutions. Protein Renaturation. A series of protein dilutions is made into the 6 M urea protein column buffer. For each assay, 1/zl protein at the appropriate concentration is diluted into 20/zl of 350 m M KC1, 30 m M Tris, 10 m M 2-mercaptoethanol, pH 7.6, and incubated at 37 ° for 30 min. RNA Renaturation. The RNA transcript is diluted into TMK buffer (30 m M Tris, 350 m M KC1, 20 m M MgC12, pH 7.6) to a final concentration of 600- 1000 cpm//tl, and warmed to 65* for 5 rain. Complex Formation and Filtration. After letting the protein and RNA cool to room temperature for at least 5 rain, the binding assays are pre12A. Maxarnand W. Gilbert, this series,Vol. 65, p. 499.
[ 13]
RIBOSOMAL PROTEIN-RNA INTERACTIONS
207
I00 -
75 c ~D
< Z
50
g~
25
rr"
I
I
I
I
2
5
4
Is4], × ,o~M FIG. 1. Typical S 4 - R N A binding isotherms. Filler-binding assays were carried out in 2 m M MgC12, 350 m M KC1, 30 m M Tris, p H 7.6, at 4", using an ot m R N A fragment. The two curves were obtained with two different preparations o f the same RNA. (@) K = 1 × 107 M - t , rm = 0.75; (O) K = 1 × 107 M - t , rm = 0.56.
pared by adding 24 #1 buffer (adjusted to give the final desired concentrations of MgC12, KC1, and Tris) and 5 gl RNA to the protein. After a 10-min incubation at the assay temperature, 50 #1 of the reaction is removed and pipetted directly onto a 25-mm nitrocellulose membrane sitting on a fritted glass disk under suction (Millipore HAWP or S&S BA85 filters give similar results). Before filtration, the filters are degassed in buffer of the same final salt concentrations as the assay. The filter is dried at 100 ° for 20 min, and counted in 3 ml of scintillation fluid. For each group of assays performed under a particular set of conditions, two controls are run in duplicate. One is filtration of a complete reaction mix with the protein replaced by the 6 M urea protein column buffer; this gives the background level of RNA retention by the filter (usually 8 - 12%). The other control is to count 5 gl of the renatured RNA which has been pipetted directly onto a filter. Typical titrations are shown in Fig. 1.
Factors Affecting the Assay Under most conditions, less than 100% of the input RNA is retained on the filter at high protein concentrations; usually some lower value, referred to as the "retention efficiency," is attained. This is evident in the data shown in Fig. 1. The reason for this is not understood, but is commonly observed among both RNA and DNA binding proteins, s,9,~3 In our studies ~3 C. P. Woodbury, Jr., and P. H. von Hilapel,
Biochemistry22, 4730
(1983).
208
PROTEIN- RNA INTERACTIONS
[ 13]
of the S 4 - a m R N A complex, the efficiency ranges from 25 to 90%, depending on the conditions. For any one RNA preparation and set of binding conditions, the retention efficiency is quite reproducible from day to day. Different RNA preparations vary in retention efficiency, though the same binding constants are measured (Fig. 1). Others working with small synthetic RNA helices have also noted that retention efficiencies vary between preparations, and presume that trace impurities affect the assay. 9 We have looked at several variables which might influence the assay efficiency as follows. Filtration Volume and Filter Washes. With some protein- nucleic acid systems, it is possible to rinse the filter with buffer once or several times to reduce the background of nonspecifically bound RNA. In some cases the rinsing also affects the retention of complex and distorts the shape of the titration curve, s Table I shows the effect of successive 50-#1 aliquots of buffer applied to the filter after the initial 50-gl reaction. The complex is clearly very sensitive to washing. This observation suggested that the assay volume filtered might affect the retention; perhaps a large volume would have the same effect as a subsequent wash. Reactions from 25 to 150#1 were tested, all having the same concentration of protein and same total amount of RNA (Table I). Very little effect is seen. Filtration Rate. The rate at which the binding assay is pulled through the filter does not affect the retention efficiency at total filtration times up
TABLE I EFFECTS OF FILTRATION VOLUME AND FILTER RINSES ON COMPLEX R E T E N T I O N a
Number of 50-/zl rinses
Percent retention
Assay volume ~1)
Percent retention
0 1 2 4
33 17 14 8.5
25 50 75 100
24 31 30 34
a Filter-binding assays were carded out as described in the text, using $4 and a mRNA in TMK buffer. In the first group, filtration of the 50-/~1 incubation mix was followed by the indicated number of 50-/tl rinses of TMK buffer at 10-see intervals. In the second set, the same concentration of $4 and ~ e same total amount of RNA were filtered in different volumes.
[ 13]
RIBOSOMAL PROTEIN RNA INTERACTIONS -
209
TABLE II BUFFERCOMPOSITIONAND TEMPERATURE EFFECTS ON FILTER RETENTION EFFICIENCIESa Temperature (°C)
[KCII (raM)
[MgC12](mM)
rm
4 4 4 37 4
175 350 600 350 350
2 2 2 2 20
0.78 0.65 0.28 0.35 0.40
a Filter-binding assays were carded out as described in the text; all assays contained 30 m M "Iris, pH 7.6, besides the indicated salts. The maximum filter retention, rm, was found from a double reciprocal plot of the binding data as described.
to 15 sec. This observation also suggests that the position of the proteinRNA equilibrium does not shift significantly during filtration. Buffer Composition and Temperature. The retention efficiency depends on the temperature and composition of the buffer filtered. This is illustrated by the data in Table II. In general, increasing urea, increasing salt, and increasing temperature all decrease the retention. At very high salt (>0.6 M KC1) the retention starts to increase with salt concentration. There is no correlation between retention efficiency and equilibrium constant. Among protein-nucleic acid interactions which have been carefully studied by filter-binding assays, there is substantial variation in the filter retention efficiency and the sensitivity of the retained complex to subsequent buffer washes.S,9 This probably reflects the fact that each protein interacts with nucleic acids and nitrocellulose differently, and emphasizes that control experiments need to be done for each binding protein studied. Renaturation of Components. The standard protocol for renaturing r-proteins and rRNA from denaturing solvents has been to dilute into a high-salt buffer (such as TMK: 30 m M Tris, 20 m M MgC12, 350 m M KC1, pH 7.6) and warm to - 4 2 ° . 14,t5 We have performed a series of binding curves with $4, using different RNA and protein renaturation conditions but assaying for binding in TMK buffer at a low temperature (4 °) to trap any partially renatured components. The data are summarized in Table ~4p. Traub and M. Nomura, J. Mol. Biol. 40, 391 (1969). 15 S. H. Tindall and K. C. Aune, Biochemistry 20, 4861 (1981).
210
eROTEIN- RNA INTERACTIONS
[ 13]
TABLE III EFFECTS OF RENATURATION CONDITIONS ON COMPLEX FORMATION a
RNA [MgC12] (raM)
$4 protein [MgCI2I (raM)
KOuM-')
0 20 20
0 0 20
3.5 25 20
a Protein and RNA were renatured separately in 350 m n KCI, 30 m M Tris, pH 7.6, and the indicated MgCI2 concentration, at 37* for 30 min (protein) or 65* for 30 rain (RNA), and the filter-binding assay carried out in TMK buffer at 4".
III. We can omit M g 2+ from the protein renaturation buffer and still obtain identical binding results. However, Mg 2+ dearly aids RNA renaturation and recognition of $4. This requirement for Mg 2+ in renaturation may be peculiar to the a mRNA. Mg 2+ does not induce any new structures in tRNA,16 and monovalent salts and Mg 2+ are interchangeable in enhancing renaturation of 5S rRNA.17
Calculation of Binding Constants In calculating an equilibrium constant from a set of filter binding assays, there are two variables to fit to the data: the equilibrium constant and the filter retention efficiency. (A potential third variable is the stoichiometry of the complex, discussed below.) There are several well-known graphical methods for determining best-fit values. Here we describe the procedure we have found best suited to filter-binding data: (1) The cpm retained on the filter at each protein concentration is converted to the fractional retention, r, by first subtracting the background RNA retention, and then dividing by the total number of cpm applied to the filter. (2) The reciprocal of the fractional retention is plotted as a function of the reciprocal of the protein concentration, for the five or six titration points at highest protein concentration. This plot should give a straight line with an intercept at l/rm, where rm is the extrapolated retention at infinite protein concentration. (3) The double reciprocal plot can be used to determine the le p. E. Cole, S. K. Yang, and D. M. Crothers, Biochemistry 11, 4358 (1972). ,7 E. G. Richards, R. Lecanidou, and M. E. Geroch, Eur. J. Biochem. 34, 262 (1973).
[ 13]
RIBOSOMAL PROTEIN- RNA INTERACTIONS
21 1
equilibrium constant K as well as the maximum retention, but data obtained at low protein concentrations are heavily weighted in this kind of plot. Instead, we use a simple graphics program to display the titration data on a microcomputer. The program superimposes on the data a hyperbolic titration curve calculated from the equation: e = Ro(r/r,,) + (r/r,,)[K(1 - r/r,)]
The curve is generated by stepping through evenly spaced values of r between 0 and r,, to find the protein concentration, P, at each point. In most cases the total RNA concentration, Ro, is much less than the input protein concentration, and the first term can be neglected. The calculation assumes that only one protein binds per RNA molecule; the situation where the binding stoichiometry is to be determined as well is discussed below. A nonlinear least squares program is then used to fit a hyperbolic curve to the data. After an initial guess is made at the binding constant K, a small correction factor to be added to K, a, is calculated using the formula a~---
- E 4Ai (A0 2
where Ai = P#(I + KPi) 2 and Li = [r,,KP#(1 + KPi)] -'- ri. Pi and ri are the protein concentration and retention at each titration point. The procedure is repeated with the corrected value of K until a is suitably small. Visual inspection of how well the data fit the curve is important. As an alternative to using a double reciprocal plot to estimate rm, the least squares fitting can be repeated with a series of r,, values, and the value giving the smallest sum of squares, ~(Li)2, used. A program carrying out these calculations and graphics displays in Microsoft Basic on the Macintosh computer is available from the authors.
Binding Stoichiometry
The filter-binding assays described above use a large excess of protein over RNA, and calculations assume that only one protein binds per RNA molecule. This assumption should be tested, of course; higher protein-toRNA binding ratios may indicate nonspecific binding. Partially inactive preparations of protein or RNA may also affect the apparent binding stoiehiometry. To determine the RNA protein stoichiometry, the filterbinding assay already described is used, only with approximately stoiehiomettle concentrations of RNA relative to protein. For these titrations it is convenient to prepare RNA of 10- to 100-fold lower specific activity. The RNA specific activity is found from the specific activity of the ATP in the
PROTEIN- RNA INTERACTIONS
212
I00
[ 13]
-
.2 .rE O
E
50
O IE
*~
25-
0'.2 [ $ 4 ] , p.M
0,4
Fro. 2. Stoichiometry of the S4-cx mRNA complex. ¢x mRNA fragment, 2.9 X 10-7 M, was titrated with $4 protein. The upper curve was calculated with K ==2 X 107 M -~ (found in titrations with very low RNA concentrations) and assuming one $4 binds per RNA molecule. The lower curve was calculated with the same K but assuming 50% of the protein is inactive in binding. [Reprinted with permission from Deckman and D r a i n . 3 Colwright © 1985, American Chemical Society.]
transcription reaction and the number of A residues in the transcript. TM In superimposing a binding curve on the data, the RNA concentration must of course be inserted in the equation for Po. An example is shown in Fig. 2. If the data do not fit a single site binding isotherm, further interpretation can be difficult. For instance, filter-binding data cannot distinguish protein only 50% active in binding from the case of two binding sites on the RNA molecule. If there are multiple sites, RNA molecules with one, two, or more proteins bound may be retained on the filter at different (unknown) efficiencies. These complications, and methods for dealing with them, have been described in detail by Woodbury and von Hippel.m3
Does the Complex Exchange or Dissociate? It is useful to measure the complex association and dissociation rates as a check for irreversible aggregation of RNA and protein. Rates of the order ,s Under the RNA polylllerase reaction conditions recommended here, the incorporation of [O~-35S]ATP and [¢~-32PlATP into RNA transcripts is identical. ~5S incorporation can therefore be used in calculating the concentration of RNA transcripts.
[ 13]
RIBOSOMAL PROTEIN- RNA INTERACTIONS
213
of 0.1 sec-~ and slower can be measured in a filter-binding experiment. Association rates are measured by simply mixing the components and filtering aliquots at various times. Dissociation rates can be measured by a "concentration jump" experiment, i.e., diluting the binding assay rapidly, filtering aliquots at different times, and observing the approach to a new equilibrium. By choosing an initial protein concentration giving about half to two-thirds of the maximum retention, a five to tenfold dilution gives a new equilibrium value very close to the background retention. Alternatively, unlabeled competitor RNA can be added in large molar excess over the protein, so that once dissociation takes place reassociation with labeled RNA is unlikely. Because we have had problems with high background retention of RNA at the higher RNA concentrations required for competition, dilution has been the better method. Both the association and dissociation of the S 4 - m R N A complex are fast, and essentially complete in the time it takes to filter the first time point, - 10 sec. If the association rate is diffusion controlled (/q ~- 107 M sec- ~for a protein the size of $4 ~9) and the reaction is carried out at 10-7 M protein, the association will be 50% complete in less than 1 sec. Since the S 4 - m R N A equilibrium constant is 2 × l0 T M -~, the dissociation rate should be 0.5 sec-~, a factor of three to four faster than detectable by filter binding. Thus the association rate cannot be much slower than the diffusion controlled limit. Sucrose gradient sedimentation, gelpermeation chromatography, and gel electrophoresis have been commonly used to separate r-protein-rRNA complexes from free protein (see following discussions); these techniques require minutes to hours to perform. 2° If the rapid association and dissociation kinetics of $4 apply generally, determinations of r-protein binding stoichiometry or affinity by these methods will be biased by dissociation of the complex during the experiment.
Nonspecific Binding Artifacts In measuring the $4 affinity for a series of 16S rRNA fragments by the filter binding assay described here (i.e., the retention of a low concentration of labeled RNA by a large excess of protein), we found that the apparent affinity decreases as the fragment is lengthened in some cases. 16S rRNA, for instance, binds more weakly than an rRNA fragment containing bases 1 to 559, and the affinity is much lower than that measured by other techniques (Table IV). Others observed that complexes of $4 or other ~9R. A. Albcrtyand G. G. Hammes,J. Phys. Chem. 62, 154 (1958). 20R. A. Zimmermann,this series,Vol. 59, p. 551.
PROTEIN- R N A INTERACTIONS
214
[ 1 3]
TABLE IV S4-RNA BINDINGCONSTANTSDETERMINEDBYDIFFERENTMETHODSa Binding constant K (#M-l) RNA ct139 16S rRNA 5' 16S domain tRNA 23S fragment
Filter assay (labeled RNA)b 20 4 13 0.06 2.3
Filter assay (labeled $4)~
Sucrose gradient d
18
25 50
Competition e 38
a Binding constants were all determined in TMK buffer at 4°. The tRNA binding constant was measured at several lower salt concentrations and the affinity extrapolated to the ionic strength ofTMK, tx139 RNA is a 190 base RNA fragment containing the first 139 bases of the tx operon transcript. The 5' 16S domain contains bases 1-559 of the 16S rRNA, and the 23S fragment encompasses 844-1347 of the 23S rRNA. b Filter binding assays performed as described in the text and Fig. 1, looking for the retention of labeled RNA by an excess of protein. Binding constants are from I. C. Deckman and D. E. Draper, £ MoL Biol. 196, 313 (1987), and unpublished data ofJ. V. Vartikar and D. E. Deckman. c From Ref. 4. The measurement was of loss of pH]S4 from filters with increasing concentrations of 16S rRNA. d Sucrose gradient sedimentation of RNAs with [3H]$4, as described in the text and Fig. 4A. Competition between the ol mRNA fragment and "16S" rRNA, as shown in Fig. 4B. The calculation presumes 16S rRNA binding constant determined by sucrose gradient sedimentation.
r i b o s o m a l proteins with intact 16S r R N A are n o t retained o n filters, a n d b i n d i n g constants were estimated b y m e a s u r i n g the decrease in labeled protein b o u n d to filters with increasing r R N A concentrations. 4,5 ( N o t e that these assays required a p p r o x i m a t e l y stoichiometric a m o u n t s o f R N A a n d protein.) W e explain these results in the following way. W i t h relatively short R N A fragments, the specific S 4 - R N A c o m p l e x is retained o n the nitrocellulose filter a n d a hyperbolic titration is o b t a i n e d at protein concentrations t o o low to i n d u c e nonspecific R N A binding. W i t h very large fragments (or intact 16S r R N A ) the specific c o m p l e x does n o t b i n d to filters ( p e r h a p s because the R N A s u r r o u n d s the protein a n d prevents c o n t a c t with the filter). Therefore retention o f R N A is observed o n l y at higher c o n c e n t r a t i o n s o f protein, where a significant level o f nonspecific b i n d i n g takes place.
[ 13]
RIBOSOMAL PROTEIN- RNA INTERACTIONS
215
Gel Mobility Shift Assay Because of a suggestion that protein-nucleic acid complexes might have unusually slow dissociation rates when trapped in an acrylamide gel matrix) ~ we attempted to detect specific S 4 - m R N A complexes by gel electrophoresis. We started with basically the same protocol as originally used by Gardner and Revzin to detect CAP protein-DNA complexes.22 Renaturcd protein and RNA were equilibrated in TMK buffer as for a filter-binding assay, but including 10% glycerol. The sample was loaded onto a 10 cm × 0.8 mm, 6% acrylamide gel made either in 160 m M Tris, 10 m M sodium acetate, 1 m M EDTA (made pH 8.0 with acetic acid) or the same buffer diluted by a factor of four. Tracking dye was omitted from samples, but run in side lanes on the gel. Gels were run at 150 V; in some trials 300 V was used for 5 min to quickly separate bound and free RNA. A typical autoradiogram is shown in Fig. 3A. A second, slower moving RNA band was observed only at the higher protein concentrations. The band of free RNA steadily decreased in intensity with increasing protein concentration. Presumably the RNA-protein complex has dissociated during electrophoresis, leaving a smear of RNA through the gel. Using the amount of free RNA to estimate a binding constant consistently gave K ~ 3 × l0 s M -l, independent of the clectrophoresis conditions. This is nearly an order of magnitude lower than the specific binding affinity determined from filter binding experiments. In addition, the same experiment repeated with another mRNA fragment known to bind nonspecifically (Table IV) gave identical results (Fig. 3B). We conclude that the specific S 4 - a mRNA complex dissociates too rapidly to be detected by this technique, even if the complex is electrophoresed rapidly into the gel. Nonspecific binding is enhanced in the lower salt buffer used for the running buffer, which may account for its detection. Our results agree with those of Revzin et al., 23 who recently concluded that the gel matrix does not slow the dissociation of a protein-DNA complex. Sucrose Gradient Assay Sedimentation and gel permeation chromatography have also been used in the past to detect roprotein binding to rRNA. 2°34 These methods have advantages over electrophoresis in that a wider range of salt concenzl M. Fried and D. M. Crothcrs, Nucleic Acids Res. 9, 6505 (1981). 2z M. M. Gardner and A. Revzin, Nucleic Acids Res. 9, 3047 (1981). z3 A. Revzin, J. A. Ceglark, and M. M. Gardner, Anal. Biochem. 153, 172 (1986). 24 M. Moug¢l, B. Ehrcsmann, and C. Ehresmann, Biochemistry 25, 2756 (1986).
216
PROTEIN- RNA INTERACTIONS
I
2
[ 13]
3
4
5
6
7
2
3
4
5
6
A
I
B
Fro. 3. Gel electrophoresis of the S4-RNA complexes. (A) Complex with a mRNA. Lanes 1-7 contained 0, 0.07, 0.14, 0.23, 0.34, 0.51, and 0.68 gMS4, respectively. The RNA concentration was 0.23 #M. (B) Complex with LI7 RBS RNA (see Table IV). Lanes 1-6 contained 0, 0.031, 0.063, 0.28, 0.25, and 0.63 g M $4, respectively. The RNA concentration was 0.16 gM.
trations can be used, and the RNA or protein concentrations can be more readily estimated. (At the beginning of electrophoresis the protein and RNA are concentrated into a thin band of unknown concentration.) While the technique has been used to obtain qualitative evidence for specific interactions in the past, it should be possible to make quantitative measurements as well. Draper and von Hippel have demonstrated that the distribution of labeled binding protein in a sucrose gradient after sedimentation with various concentrations of a large DNA could be used to obtain a good estimate of the equilibrium binding constant. 25 Since the slower sedimenting protein is continually "shed" and left behind as the complex 25 D. E. Draper and P. H. yon Hippel, Biochemistry 18, 753 (1978).
[ 13]
RIBOSOMAL PROTEIN - R N A INTERACTIONS
217
moves through the gradient and reequilibrates with the lower concentrations of protein remaining, calculation of the binding constant must take into account not only the amount of protein remaining with the DNA peak at the end of the run, but also the distance of sedimentation. Sedimentation can be used as a binding assay only when the proteinRNA complex has a significantly greater S value than the protein alone; this limits its application to r-protein binding rRNA fragments larger than - 5S. However, once the binding constant for a large RNA is determined, the relative affinity of small fragments may be found in a competition type experiment. In this section, we show how the $4 affinities for 16S rRNA and a mRNA can be found by these techniques.
Preparation of [3H]-S4 [3H]$4 is prepared by reductive methylation of protein lysines with formaldehyde and [3H]sodium cyanoborohydride,u To label purified $4, dialyze 100/A of $4 ( - 50 gg, 2 nmol) overnight against 0.2 M boric acid, 0.25 M KC1, 6 m M p-mercaptoethanol, adjusted to pH 8.4 with NaOH. Add 5/ll ofa 1:3200 dilution of 37% formaldehyde into the same borateKCI buffer (about a 5 fold molar excess over protein lysines). Let sit for 5 rain at room temperature. Resuspend 1 mCi [3H]sodium cyanoborohydride (Amersham, 10 Ci/mm specific activity) in 30/zl of 0.5 M KOH. Add 15/A of this to the protein solution (a 2 - 3 molar excess over formaldehyde). After 20 rain at room temperature, the mixture is dialyzed against a number of changes of 0.35 M KC1, 20 m M Tris, 6 m M fl-mercaptoethanol, pH 7.6, to remove unreacted cyanoborohydride. (A microdialysis apparatus from Health Products, Inc., with - 1 0 0 gl wells, was used.) A 1/A sample of the protein is counted once or twice a day until no further change in the number of counts per minute is seen, about three days. This procedure methylates only one lysine per two to ten $4 molecules, but the specific activity is high enough that only 1- 10 n M protein need be used in the sedimentation experiments.
Large-Scale RNA Transcriptions To obtain sufficient RNA for the sucrose gradient, the transcription reaction mix is scaled up to 0.5 or 1.0 ml. The reaction is exactly the same as described above for preparing 35S-labeled RNA, only the [a-3SS]ATP is omitted. The reaction mix is loaded directly onto a 1.6 )< 50 cm Superose 12 column (Pharmacia), and the RNA eluted at 0.6 ml/min with 0.1 M NaC1, 20 m M Tris, pH 7.6) Pooled fractions from the RNA peak yield 8 A26ounits of transcript per milliliter of reaction.
218
PROTEIN- RNA INTERACTIONS
[ 13]
Determining the Absolute $4-16S rRNA Affinity First prepare 5.0 ml sucrose gradients, using a linear gradient of 5 -20% sucrose (Sigma, RNase-free grade), appropriate buffer (e.g., TMK buffer used in the filter binding assays), and 30 pg/ml BSA (to reduce loss of protein). Equilibrate at the desired temperature. Then prepare the protein-RNA complex, renaturing each component separately as described for a filter binding assay. A final concentration of about 1 p M RNA is appropriate if a final binding constant of about 107 M -~ is expected. BSA is added to 30/lg]ml in the final reaction mix. Renaturation of RNA at the higher concentrations required for these assays sometimes leads to aggregation; in particular we have noticed that 16S rRNA and some larger fragments tend to dimerize when heated at 65 ° in TMK buffer. Aggregation does not occur when renaturation is carried out at 40 ° in TMK. A pair of control gradients, comparing the sedimentation profiles of renatured and nonrenatured RNA, is a good idea. Equilibrated RNA-protein complex, (50-100/d) is layered on top of the sucrose gradient, and the gradient centrifuged until the RNA is about halfway down the tube. In a Beckman SW55 rotor, 40,000 rpm for 4.5 hr at 5 o is appropriate for 16S rRNA (see Fig. 4). The tube is punctured, 5 drop fractions collected into scintillation vials, and the sample counted in 3 ml of"Ready Gel" (Beckman) plus 0.2 ml water. The product of the equilibrium constant (K) and the concentration of protein binding sites on the RNA (L) is given by KL
-i]-']
where P/Po is the fraction of protein migrating with the RNA, and n is the number of fractions the RNA peak has migrated. (For the purposes of calculation, the volume of a fraction should be the same as the volume of the layered sample.) The formula was derived by supposing that each time the protein-RNA complex migrates one fraction further into the gradient, free and bound protein have equilibrated, leaving some of the protein behind. As the peak of RNA moves down the gradient it broadens, which affects protein binding in two ways: As the RNA is diluted it binds protein more weakly, but as the peak broadens free protein has a higher chance of rebinding RNA. The two effects tend to cancel over a wide range of sedimentation conditions. A much more detailed justification of this equation is given in Ref. 19. The method makes several assumptions. First, an excess of protein binding sites over the protein is assumed; using r-proteins labeled by reductive methylation, protein concentrations of 1 10 n M can be used to -
[ 13]
RIBOSOMAL PROTEIN- RNA INTERACTIONS
219
200
200
A
== 15°
~ 150
E ~ 100
~. 100
•-~ 5 0 oO
8
50
10
20
30
40
50
0
Fraction number
10
20
30
40
50
Fraction number
FIG. 4. Sucrose gradient sedimentation of [3H]$4 with ribosomal and messenger RNA. The protein-RNA complexes were prepared as described in the text, and sedimented for 4.5 hr at 40,000 rpm, 5 °. Sedimentation is from leit to right. (A) With 0.5 # M "16S" rRNA; (B) with 1.0 g M "16S" rRNA and 1.0 g M of a 190 base RNA fragment containing the first 139 bases of the a mRNA transcript. The "16S" RNA used in these experiments was made by T7 RNA polymerase transcription and covers bases 1- 1509 of the 16S rRNA.
measure binding constants greater than 108 M - L Second, equilibration of the protein-RNA complex must be rapid compared to the time of sedimentation. As shown by attempts to measure association and dissociation rates by the filter binding assay, this is true for $4 protein. Formation of the complex must not have a very large change in molar volume, or the position of the equilibrium will be influenced by the pressure developed during sedimentation. Again, this is usually not a problem for proteinnucleic acid complexes. Of course the binding constant calculated depends on how many protein binding sites per RNA are assumed. The sedimentation profile of $4 with 16S rRNA shown in Fig. 4A gives a binding affinity of 2.5 × 107 M -t, assuming one site per RNA (Table IV).
Determining the Relative Affinity of S4 for 16S rRNA and a mRNA In Fig. 4B the same sucrose gradient experiment as in Fig. 4A is repeated, except with the addition of ot mRNA as well as 16 S rRNA. The concentration of rRNA used is sufficient to carry along - 9 0 % of the $4 protein in the absence of the mRNA, so the slower moving peak of protein is due to competition [for $4 binding] by the more slowly sedimenting mRNA. From the mass action law, the ratio of the two binding constants is given by KdK
= (P,/P
)(RJRO
where (P~/Pz) is the ratio of protein bound to RNAs 1 and 2, and Rt and R2 are the initial concentrations of the two RNAs.
220
PROTEIN- R N A INTERACTIONS
[ 13]
Comparison of Different Methods The results we have presented here show that a good deal of caution is needed in developing an assay for specific r-protein-RNA binding. Since r-proteins tend to be basic, it is not surprising that promiscuous binding to a variety of RNAs is observed, and in some assays this binding may overwhelm the detection of specific complexes. Certainly the gel mobility shift assay is measuring nonspecific binding only. $4 affinities for five RNAs, measured by several different methods, are summarized in Table IV. Affinities measured by the sucrose gradient technique tend to be high, this is probably a systematic error reflecting approximations used in calculating the binding constant. 25 However, the 16S rRNA affinity measured by filter retention of labeled RNA by $4 is much too low and is comparable to nonspecific binding of other large RNA fragments. As discussed above, the specific comples of $4 with very large RNAs is apparently not retained by filters, while nonspecific S4-RNA complexes and specific $4 complexes with RNAs less than - 600 bases are retained. The apparent nonspecific binding affinity detected in the filter retention assay varies by over an order of magnitude depending on the RNA, the affinity is not a simple function of the RNA length (J. V. Vartikar, unpublished observations). We conclude that the filter retention assay is useful, but one has to be aware that (1) specific and nonspecific complexes of protein with the same RNA may be detected with widely different efficiencies, and (2) the level of competing nonspecific binding may change dramatically as the endpoints of the RNA fragment change. The sucrose gradient assay described here is probably easier to interpret, as it depends only on the reequilibration of protein and protein-RNA complexes during the time of the sedimentation run. Although the absolute affinities measured may be systematically off by a factory of two or three, changes in affinity with RNA sequence or buffer composition should be accurately detected. The relative affinity of a small RNA fragment and a large RNA for a protein should also be measured accurately in competition experiments. The simplicity of the sucrose gradient assays and the unambiguous interpretation of the results should make them a useful complement to filter binding asays for quantitative studies. Acknowledgments This work was supported by NIH grant GM29048, and D.E.D. acknowledges the support of a Research Career Development Award (CA 01081).
[ 14]
RIBOSOMALRNA FRAGMENTS
221
[ 14] P r e p a r a t i o n o f S p e c i f i c R i b o s o m a l R N A F r a g m e n t s By DAVID
E.
D R A P E R , SUSAN
A.
WHITE,
and JOANNE M.
KEAN
Introduction In recent years major advances have been made in delineating the secondary structures of the large ribosomal RNAs (rRNA), both by phylogenetic comparisons, ~,2 and by structure-mapping techniques.3 While this work is a major advance in defining the rRNA secondary structures, much remains to be done in understanding the RNA tertiary folding and the functional significance of different structures. Physical studies of rRNA fragments may be helpful in this regard. Series of fragments of different sizes can be used to define r-protein binding sites, and small fragments are more amenable to spectroscopic and thermodynamic techniques which can give specific information about structural features. Studies of the 49-base colicin fragment from the 3' end of the 16S rRNA, for instance, have been important in defining its RNA hydrogen bonding, stability, and interactions with proteins? We describe here two general techniques for preparing fragments of the large ribosomal RNAs. A hybridization selection scheme cuts the desired fragment out of purified rRNA. This method is inconvenient for preparing large amounts of RNA, but preserves modified bases in the sequence. The second method is in vitro transcription of the RNA from a DNA template. This method is suitable for preparing large quantifies of RNA, and can also be used to prepare a series of sequence variants. RNA fragments we have prepared for studies of the central domain of the 16S rRNA will be described. Hybrid Selection Principle This method is illustrated in Fig. 1. The rRNA sequence of interest is cloned into a single-stranded phage DNA, which is then used to protect that region of rRNA from nuclease digestion. The D N A - R N A fragment H. F. Noller and C. R. Woese, Science 212, 403 (1981). 2 R. R. Gutell, B. Weiser, C. R. Wocse, and H. F. Noller, Prog. Nucleic Acid Res. Mol. Biol. 32, 155(1985). 3 B. J. Van Stolk and H. F. Noller, this volume [32]; S. Stern, D. Moazed, and H. F. NoUer
[33]. 4p. H. van Knippenbergand H. A. Heus,this volume[12]. METHODS IN ENZYMOLOGY, VOL. 164
Copyright© 1988by AcademicPress,Inc. All rightsof reproductionin any formreserved.
222
~
PROTEIN- RNA INTERACTIONS
T! RNosel, ~ - ~ " ~
IBSrRNA ~
ssoo
f
..-.--.~--
8-0 ' %HCONH~..__ t ÷
[ 14]
/3=P_AT
P
,,.0.
-N'
FIG.I. SchemeforpreparingrRNAfragmentsbyhybridizationselection.[Reprinted with permission from Rean et al. 8 Copyright © 1985, American Chemical Society.] See text for explanation.
hybrid is end-labeled and the strands separated. The possible end points of the fragment are limited only by the sequence of cloned DNA and the use of T~ nuclease (G-specific) for the digestion. Both phage DNA and rRNA are easy to purify, and in principle 1- 10 nmol preparations of almost any sequence should be possible. For reasons described below, the strand separation step must be done in relatively dilute volumes, which limits the convenient size of a preparation to ~ 1 nmol. Cloning in f d Phage DNA fragments containing appropriate rRNA sequences have been obtained from the plasmid pKK3535, containing the entire rrnB cistron2 Because of initial difficulties with the stability of cloned inserts in singlestranded DNA phage, we have used the fd cloning vectors containing antibiotic-resistance genes developed by Hemuann et al., 6 and propagated these by transformation into HB 101 or other bacterial strains resistant to filamentous phage infection. Preparation of DNA restriction fragments and their ligation into linearized phage RF DNA are carded out by standard cloning techniques.7 Candidate clones are screened by testing phage DNA for hybridization to [3H]rRNA. In the case of a 340-bp FnuDII DNA fragment covering bases 528-867 in the 16S rRNA sequence, the DNA could be cloned into the SmaI site of fdl06 only in the orientation giving hybridization (phage F61), and these clones deleted the inserted DNA very rapidly? Other fragments covering J. Brosius, T. Dull, D. D. Sleeter, and H. F. Noller, J. Mol. Biol. 148, 107 (1981). 6 R. Herrmann, IC Neugebauer, E. Pirkl, H. Zentgraf, and H. Schaller, Mol. Gen. Genet. 177, 231 (1980). T. Maniatis, E. F. Fritsch, and J. Sambrook, "Molecular Cloning: A Laboratory Manual." Cold Spring Harbor Lab., Cold Spring Harbor, New York, 1982. s j. M. Kean and D. E. Draper, Biochemistry 24, 5052 (1985).
[ 14]
RIBOSOMAL R N A FRAGMENTS
223
the 16S rRNA cloned in either orientation with equal frequency (e.g., the HindlII fragment from 82-649) and were much more stable. We have also made stable clones of the 5' 614 base pairs of the 16S rRNA gene and a 500-base pair fragment of the 23S rRNA gene in M 13 derivatives. We do not know why the FnuDII fragment is deleterious to cell growth. To test phage for the insertion of DNA fragments, transformed cells are plated on agar, and individual colonies grown in 3 ml broth. A 0.5-ml aliquot of culture is extracted with an equal volume of phenol-chloroform (1 : 1), then with ether, and ethanol precipitated after adding sodium acetate to 0.3 M. The DNA pellet is resuspended in 50 gl TNE buffer (0.4 M NaCI, 20 m M Tris, 1 m M Na:EDTA, pH 8.0), 20,000 cpm of [3H]rRNA (prepared according to Dennis and Nordan 9) added, and incubated at 65 ° for 4 hr. Then 10gg of pancreatic RNase in 0.5 ml of TNE is added and incubated for 30 min at 37". The solution is filtered with suction through a 25-mm nitrocellulose membrane (Millipore. HAWP or S&S BA85). The filter is rinsed five times with 1-ml aliquots of TNE and then with 95% ethanol. Finally, the filter is counted in 3 ml of scintillation fluid and compared to a control hybridization to which no DNA was added.
Hybridization Selection Growth and Preparation of Phage DNA. We found that the ribosomal sequence inserted in phage F61 rapidly deleted when it was propagated in bacteria growing in broth. The problem was not as severe with clones of other rRNA sequences we constructed, but still bothersome, and phage yields were usually low. M9 medium, 7 with 0.4% glycerol substituted for the glucose, gave good yields of phage (> 10 ~ phage/ml) and deletions accumulated only very slowly. To prepare phage, Escherichia coli HB 101 is transformed with the phage replicative form + and plated on standard agar with the appropriate antibiotic (colonies do not form on minimal agar). The next day individual colonies are picked and grown in M 9 glycerol medium with vigorous aeration at 37 o. After ~ 24 hr of growth, the cells are pelleted and the supernatant is made 3% in polyethylene glycol (Sigma, MW 8000) and 3% in NaC1. The precipitated phage are pelleted (20 min at 10,000 rpm in 500-ml bottles) after sitting in the cold for several hours. Finally, the phage are resuspended in 50 m M "Iris (pH 8.0) and banded in a CsC1 step gradient prepared exactly as described by Yamamoto et al. 1oPhage from 2 liters of culture are layered in a 6-ml volume on 9 p. p. Dennis and D. H. Nordan, J. Bacteriol. 128, 28 (1976). to K. R. Yamamoto, B. M. Alberts, R. Benziger, L. Lawhorne, and G. Treiber, Virology 40, 732 (1970).
224
PROTEIN- RNA INTERACTIONS
[ 14]
top of 19 ml of CsC1 (density range 1.39-1.25 g/ml) and spun at 35,000 rpm and 8* in a Beckman type 55 rotor. The phage are precipitated from the CsCI by adding 0.1 volume of 30% polyethylene glycol, and resuspended in 50 m M "Iris, 2.5 m M Na2EDTA. The solution is extracted twice with phenol saturated with the same buffer; the first extraction is warmed to 65 ° , while the second is at room temperature. After extracting with ether twice, the phage DNA is precipitated with 0.1 volume 7.5 M ammonium acetate and 2.5 volumes ethanol. The yield is 2 - 5 mg DNA per liter of culture. Preparation ofrRNA. Crude ribosomal RNAs are obtained from preparations of ribosomal proteins, either by acetic acid 11or LiCit 2 extractions of ribosomes. The rRNA, in 50 m M sodium acetate, I m M E D T A , 1% SDS (pH 5.0) is phenol extracted twice and ethanol precipitated. The 16S and 23S rRNAs can be separated by chromatography on a DEAE column using a 0.3 to 0.5 MNaC1 gradient, in 0.1 M Tris, pH 7.6. Hybridization and Labeling Conditions. Phage DNA and rRNA are annealed in 0.4 M NaC1, 10 m M Tris, 1 m M Na2EDTA at 65". DNA concentrations o f - 1 p M are used, with a 1.2- to 1.5-fold excess ofrRNA. At these concentrations the hybridization is complete within 20 min. Unhybridized RNA is then degraded with 6000 units/ml of Tt RNase, incubated at 37 ° for 2 hr. The best yield of fragment is obtained if the RNase is inactivated by a further 1.5 hr digestion with 100/tg/ml proteinase K and 0.5% SDS. The entire reaction ( 1 - 2 ml) is then run over a 1.6 × 45 cm Sephacryl S-500 gel filtration column (Pharmacia) equilibrated with 10 m M Tris, 1 m M Na2EDTA, 0.2 Msodium acetate, pH 7.6. The D N A rRNA hybrid elutes near the void volume, and is precipitated with 3 volumes of ethanol. At this point the RNA is usually end-labeled with 32p for structure mapping or protein binding studies. The hybrid labels satisfactorily, but not as efficiently as tRNA or other small RNAs. This may be because the large amount of single-stranded DNA is inhibitory, and the RNA ends may not be very accessible in the hybrid. 5'- and 3'-end-labeling are accomplished according to standard RNA labeling protocols ([),-32p]ATP and polynucleotide kinase, or cytidine [32p]bisphosphate and T4 RNA ligase, respectively),t3 About 20 pmol is labeled in a 30-/tl volume. 3'-End-labeling requires prior dephosphorylation, using calf intestinal phosphatase (15 min at 55 ° in 50 m M Tris, pH 8.0) followed by heat inactivation t~ C. G. Kurland, S. J. S. Hardy, and G. Mora, this series,Vol. 20, p. 381. ~2 j. A. Litflechildand A. L. Malcolm, Biochemistry 17, 3363 (1978). t3 j. M. D'Alcssio, in "Gel Elcctrophoresis of Nucleic Acids" (D. Rickwood and B. D. Haines, cds.),p. 173. IRL Press, Oxford, England, 1981.
[ 14]
RIBOSOMALRNA FRAGMENTS
225
(45 min at 65 °, with 10 m M E D T A added), phenol extraction, and ethanol precipitation. After labeling the hybrid is precipitated with 15/zl ammonium acetate and 135/zl ethanol. Denaturing Gel Filtration of Hybrids. The dried precipitate is taken up in 40gl of 0.1 M HEPES, 2 m M Na2EDTA, pH 7.6, 10/zl of 10% SDS added, then 0.2 ml formamide (formamide is first stirred with Bio-Rad AG 501-X8 ion exchanger and filtered, to obtain a conductivity > l05 ohm/ cm). In this buffer the strand separation temperature is - 35 °, but once the hybrid is melted renaturation in the low salt is very slow at room temperature. Thus the hybrid is heated to 65 ° for 5 min, and then applied to a Sephacryl S-500 gel filtration column (1 X 25 cm) equilibrated with 80% formamide, l0 m M HEPES, 1 m M Na2EDTA, pH 7.6, run at room temperature. The DNA elutes in 8 - 9 ml followed by the labeled RNA in a broad peak at - 15 ml. The RNA is concentrated by precipitation with 0.1 volume 3 M sodium acetate, 3.5 volumes ethanol, and - 5 0 / t g carrier RNA. Much higher concentrations of hybrid can be kept denatured in the 80% formamide buffer for long times at room temperature, but a limiting factor is the capacity of the column. Under the low salt conditions required, the DNA concentration inside the column cannot exceed - 2 OD2so/ml. If higher concentrations are loaded, the peak broadens and resolution is lost. A 1 X 25 cm column can handle about 160 #g hybrid (50 pm of fd phage DNA), and the pooled RNA fragment fractions have a concentration less than l0/zg/ml for the 345-bp fragment (10 pmol/ml). The difficulty of recovering the RNA from such a dilute solution without added carrier makes optical studies of these RNA fragments only marginally practical. Denaturing Gel Electrophoresis of Hybrids. Better resolution of the full-length RNA fragment from the low background of degraded RNA is obtained by electrophoresis of the hybrid. After denaturing the hybrid in forrnamide, the solution is applied to a 4-cm slot in a 2-mm thick × 20-cm long acrylamide-urea gel (5% acrylamide, 50% urea, in 40 m M Tris, 40 m M sodium acetate, 1 m M Na2EDTA, to pH 8.0 with acetic acid). The gel is run at 150 V for 3 hr. Similar results have been obtained with acrylamide- formamide gels. ~4The labeled RNA can be autoradiographed, the band excised, and the RNA extracted by the "freeze and squeeze" technique) 3 Attempts to scale up the procedure to higher hybrid concentrations were unsuccessful. Only partial denaturation is obtained, probably because the hybrid initially concentrates into a thin band in the gel and renatures during electrophoresis. 14 T. Maniatis and A. Efstratiadis, this series, Vol. 65, p. 299.
226
PROTEIN- R N A INTERACTIONS
[ 1 4]
In Vitro Transcription Principle Cloning vectors containing promoters for SP6, T3, and T7 phage promoters, as well as the phage RNA polymerases, are commercially available. These systems were designed for the preparation of single-stranded hybridization probes, but they can equally well be used to make rRNA sequences for physical studies. The approach is to prepare plasmid DNA containing an rRNA sequence in between a phage promoter and a convenient restriction site. After the plasmid is linearized with the restriction enzyme, run-off transcription provides the rRNA fragment. Use of a phage promoter rather than an E. coli promoter has two advantages. First, the promoter is not expressed in vivo, avoiding the possible deleterious consequences of synthesizing ribosome fragments in the cell. Second, some of the phage polymerases are easy to purify in large quantities. Since the phage T7 RNA polymerase has been expressed at very high levels in E. coil it is currently the best choice when RNA is to be made for physical studies, and this article will deal only with it. Except for some minor changes in reaction conditions, we have obtained very similar results with the SP6 RNA polymerase. Sequence Constraints There are limitations on the 5' and 3' sequences which can be transcribed. All strong T7 promoters in T7 DNA begin transcription with the sequence pppGGGAGA. 15 Weaker promoters in the phage DNA show some variation from this sequence, though pyrimidines are found infrequently. Table I shows several variant T7 promoter sequences we have used. Sequences 1 through 4 all give 60-70% incorporation of triphosphates into RNA transcripts within 30 min, using an excess of RNA polymerase, 0.1 mg/ml linear DNA, 1 m M of each NTP, and the reaction conditions described below. Sequences 4 and 5 are poor promoters (< 20% incorporation under similar conditions), apparently because of an extremely high level of abortive initiation, producing short transcripts (the behavior of sequence 5 is further discussed below). It appears that base 6 of the transcript should be a purine to obtain a high level of nucleotide incorporation, while transcription is relatively insensitive to the bases at positions 3 through 5. The 3' end of the transcript is affected by the requirement for a restriction site to linearize the plasmid. Enzymes leaving a 3' overhang at the 15j. j. Dunn and F. W. Studier, £ Mol. Biol. 166, 477 (1983).
[ 14]
RIBOSOMALRNA FRAGMENTS
227
TABLE I 5' TRANSCRIPT SEQUENCES FROM T7 PROMOTERSa I. 2. 3. 4. 5.
pppGGGAGACC... ppLC,-~JCCUGGA... pppGGCAGAUC... pppGC.,-GUCUCG... pppGGGAUCUC ...
a T h e five sequences were transcribed using the s a m e strong T7 p r o m o t e r sequence at positions - 17 to -- 1. P r o m o t e r sequences 4 a n d 5
were significantly poorer than the consensus sequence 1 (see text). Underlining indicates positions of homology with sequence 1. Sequence 1 was obtainedfromthe plasmid pT7-1 (US Biochemicals),sequence2 from pAR2369 (kindly provided by F. W. Studier), and sequences 3 through 5 by insertion of synthetic DNA into the StuI site of pAR2369. DNA terminus should be avoided, as a significant level of spurious, very long transcripts is obtained, perhaps because the polymerase can initiate at such a terminus. In our experience, a 5' overhanging end gives clean transcription, but usually a mix of transcripts of length n and n - 1 nucleotides is obtained. This is a serious problem if the transcript is to be 3'-end-labeled for structure mapping experiments. Our experience with different restriction enzymes is summarized in Table II. Stable secondary structure in the transcribed RNA does not seem to affect transcription. The plasmid pBA21 codes for a very stable 23-base hairpin helix at the 5' terminus of the transcript (see below), but similar levels of nucleotide incorporation are obtained with a 16-nucleotide transcript lacking the hairpin, and 23 or 230 base transcripts containing it.
Cloning To illustrate the use of transcription for preparing rRNA fragments, we describe two series of fragments we have made to examine the role of a single-base bulge in 16S rRNA structure and protein recognition. The cloning strategies we used are shown in Fig. 2. Enzyme digestions and transformation of bacteria are standard techniques and described in detail elsewhere. 7 Plasmids Coding for an Extended Hairpin from 16S rRNA. We wished to study the structure and protein binding properties of the extended hairpin at bases 655-755 in the 16S rRNA sequence. We had previously
228
PROTEIN- RNA INTERACTIONS
[ 14]
TABLE II 3' TERMINI OF T7 RNA POLYMERASETRANSCRIPTSa
DNA 3' terminus 5' GGG 3' CCC 5' GGG 3' CCC 5' CGT 3' GCA 5' GAT 3' CTA 5" GC 3' CGAGT 5' GG 3' CCCTAG 5' GG 3' CCCTAG 5' CT 3' GAGATC a
Source
Transcdpt length (bases)
Abundance of n, n - 1 length transcripts
SmaI
23
1, <0.05
Sinai
143
1, <0.1
RsaI
110
1, 0.2
EcoRV
117
1, 0.1
DdeI
122
1, 0.1
BamI
200
1, 1.2
BamI
488
1, 1
XbaI
494
1, 2
Transcripts were prepared as described in the text, Y-end-labeled with cytidinep2P]bisphosphate and T4 RNA ligase, and partial digests with T~ RNase run on sequencing gels. The presence of multiple ends shows up as "shadow" bands in the sequence. Gel autoradiograms were scanned in a densitometer to measure intensities.
observed unusually high ethidium affinity at a sequence adjacent to a single-base bulge (base A747), and suspected that the bulged base might be responsible for the enhanced affinity. 16 Others have suggested that singlebase bulges may be important for protein-RNA recognition, 17 and the protein S15 probably recognizes the region surrounding this bulge. 18,~9 Thus we wanted to prepare this hairpin sequence with and without A747. The following steps gave us the desired plasmid clones: 1. A HindlII-SalI DNA fragment covering the region (bases 648826) was obtained from a plasmid carrying the rrnB operon, pKK3535, 5 and cloned into the polylinker of pT7-2, a plasmid carrying the phage T7 promoter followed by a set of unique restriction sites (US Biochemicals). 16j. M. Kean, S. A. White, and D. E. Draper, Biochemistry 24, 5062 (1985). 17 D. Peattie, S. Douthwaite, R. A. Garrett, and H. F. Noller, Proc. Natl. Acad. ScL U.S.A. 78, 7331 (1981). ,s R. MOiler, R. A. Gatrett, and H. F. Noller, J. Biol. Chem. 254, 3873 (1979). 19 R. A. Zimmermann and K. Singh-Bermann, Biochim. Biophys. Acta 563, 422 (1979).
[ 14]
229
RIBOSOMAL R N A FRAGMENTS
A
Hind lll-Hoe BI frogment Sinai rRNA bosee 649-734)[linker
l(,6s
PTZ .
~
[GGGAGACCGGAAGCTT .
. . .
#
GGCGGCCCCGGGCGAGCT~ Smo I Soc I
Hind TIT
cut with SmoI,SocI phosphotose ligote
with
pCTGGAcGAAGACTGATATCAGCT i
i
i
i
i
i
i
i
GACCTGC
PT7 •
~
I
. , . ~ . /
f6S
i
rRNA
'GGGAGACGGGAAGGTT. . . .
i
J i
i
i
i
0
i
i
TCTGACTATAGp
648-753 ~
Doses
I
CGCOGTGGACG(A)AGACTGAGG~Eco ATR AV TG
B PT7 I~IGGGGT
~
CGGGGG
Stul
Stool 9
cut with StuI, SmoZ phosphatose
ligote with p G T C T C G A G T T T T C G N A G A C C C
.............
~
CAGAGCTCAAAAG
.... ~
TCTG
p
PT7 I--'---~GG G T O TO GAG T T T T O G(N) A G A CG G G G G
(x.....
Xho~
SmoZj/)
cut withStagT transcription
GU
pppGGGUGUGGA i
i
i
i
i
L
i
i
i
GGGAGAGGU U U (N)
FIG. 2. Schemes for preparing clones ofrRNA fragments and variants. (A) Preparation of a piasmid coding for the S 15 binding region of 16S rRNA. (B) Preparation of an RNA hairpin reproducing a helix with a singly-base bulge in the S15 binding region of 16S rRNA. The vector shown is a derivative of pAR2369 (provided by F. W. Studier), a pBR322 derivative containing a T7 promoter immediately followed by a unique StuI restriction site. See text for a discussion of the cloning protocols.
230
PROTEIN- R N A INTERACTIONS
[ 14]
2. The pT7-2 derivative was then digested with HaelII (GG'CC) to give a large number of fragments. This collection of fragments was ligated with a 10 fold molar excess of a linker containing a SmaI restriction site (d(CCCC'~), obtained from New England Biolabs), and digested with SmaI. Subsequent digestion with HindlII, followed by ligation with the pT7-2 plasmid previously cut with HindlII and SmaI, should result in only two different DNA fragments cloned. The desired plasmid was obtained with low efficiency (1 out of 12 candidates tested). Subsequent experiments showed that much better efficiency is obtained with a 50100 tool ratio of linker to HaelII fragments, and a slight molar excess of dephosphorylated vector over fragments. 3. The new plasmid clone (priSM, see Fig. 2A) was digested with Sinai and Sad and a synthetic DNA fragment inserted. One strand of the synthetic DNA carried the complete rRNA sequence, while the other had a single base deletion ofA747. Replication of the ligated plasmid should give two different sequence plasmids. After transforming the ligation mixture, plasmid DNA was purified from the bacteria and retransformed, to ensure the isolation of bacteria containing only one plasmid sequence. DNA from individual colonies was screened for the presence or absence of an MboII site (GAAGA), indicating the presence or absence of A747. About equal numbers of both sequences were found.
Preparation of DNA Coding for a Small RNA Helix. To carry out more detailed studies of the effects of a single-base bulge on RNA helix conformation, we wished to prepare a short RNA molecule reproducing the sequence around A747. The easiest approach was to design an RNA hairpin and clone the appropriate synthetic DNA sequence. The desired hairpin is shown in Fig. 2B. The first and last three bases were chosen to give T7 RNA polymerase promoter activity and a restriction site, respectively. The remainder of the sequence duplicates 6 bp of the S 15 binding region and provides a hairpin loop. To investigate the role of the bulge base in altering helix structure, we wanted to prepare helices with different bulged bases, and with no bulge. Preparation of the appropriate DNA involved the following steps: 1. DNA sequences were prepared on an automated synthesizer. One of the two strands coded for the "bulgeless" helix, with the other had a mixture of all four bases at the bulge site. The two strands were separately phosphorylated with polynucleotide kinase and then hybridized. 2. The DNA fragment was ligated between the StuI and SmaI sites of a plasmid containing the T7 promoter. Notice that the two Gs of the StuI site are the first two bases of the transcript. 3. After transformation into bacteria, plasmid DNA was isolated and
[ 14]
RIBOSOMAL R N A FRAGMENTS
231
retransformed. Individual colonies were grown up and their plasmid DNA tested for the presence of SmaI and XhoI restriction sites. Plasmids having inserts were transcribed and the RNA sequenced, by the following protocol. Crude plasmid DNA is isolated from 1 ml of bacterial culture by a standard alkaline lysis protocol.2° The plasmid is digested with restriction enzyme (SmaI in this case) for 1 hr in 50/zl with 50 ng of pancreatic ribonuclease (previously boiled to denature DNases). The reaction is run over a "NENSorb" (New England Nuclear) reversed-phase column2~ to remove nucleases and other contaminants. After precipitating and drying the DNA the following components are added to the tube: 2/zl of 5 X buffer (200 m M Tris, 40 m M MgCI2, 125 m M NaCI, 25 m M DTT, pH 7.6) 2 pl H20 2 pl NTPs (5 m M each ATP, CTP, and UTP, and 1 m M GTP) 2 pl [y-32P]GTP ( - 8 #Ci; freshly made from 32PO4 and GTP enzymatically with the Promega Biotec "GammaPrep" system) 1 pl placental RNase inhibitor (Promega Biotec) 1 #1 (0.7/tg) T7 RNA polymerase (see purification below) After 30 min incubation at 37 ° the reaction is precipitated with ethanol. There is sufficient end-labeled transcript for five lanes on a sequencing gel, using an overnight exposure of the film. For unknown reasons, only plasmids with N -- C, N -- T, or N deleted were obtained. To prepare N -- A, the lower strand was synthesized with a T opposing "N," and this hybrid used. About half the colonies contained plasmid coding for the helix with a bulged A (pBA21).
Transcription Conditions For preparing large quantities of rRNA fragments for physical studies, we wanted to find optimum conditions for obtaining the maximum number of transcripts per DNA in a minimum volume. The following sections describe the factors we have found important. Preparation of DNA. The transcription reaction and subsequent purification proceed best if the DNA is very clean and free from contaminating RNA. The protocol we use avoids ribonucleases and includes steps to remove small RNAs:
20 H. C. Birnboim and J. Doly, Nucleic Acids Res. 7, 1513 (1979). 21 D. E. Draper, I. C. Deckman, and J. V. Vartikar, this volume [13].
232
PROTEIN- R N A INTERACTIONS
[14]
1. Bacteria are grown and lysed by the lysozyme-alkali procedure described in Maniatis et al. 7 Before the isopropanol precipitation a phenol-chloroform extraction is included (10 ml each per 200 ml solution). 2. The 2-propanol pellet is resuspended in 10 raM Tris, 1 m M Na2EDTA and made 0.5 M in NaC1. Material precipitating between 4 and 10% polyethylene glycol is saved (allowing at least 1 hr on ice after each addition of polyethylene glycol), resuspended in the same Tris-EDTA buffer, and made 2.5 M in ammonium acetate. After I hr on ice the precipitated RNA is pelleted, and the remaining nucleic acids precipitated with 2.5 volumes of ethanol. 3. Small RNAs are separated from the plasmid by gel filtration on a Sephacryl S-500 (Pharmacia) column equilibrated in 0.2 M sodium acetate, 20 raM Tris, 1 m M Na2EDTA, pH 7.6. A column 1.6 X 50 cm is adequate for - 4 mg plasmid. 4. Remaining large RNA and chromosomal DNA are removed by ion-exchange chromatography on RPC-5 resin. 22 We use a 1 X 10 cm column (HR10/10, Pharrnacia) pumped at 2 - 3 ml/min with HPLC pumps (Bio-Rad). The column buffer is 20 m M Tris, 1 m M Na2EDTA, pH 7.6, with either 0.4 (A) or 2.0 (B) M NaC1. The plasmid elutes in a 30-ml gradient between 10 and 15% buffer B. T7 R N A Polymerase. T7 RNA polymerase is purified from the overproducing strain BL21 (pAR1219), 23 kindly supplied to us by F. W. Studier. The purification protocol was provided to us by J. J. Dunn and F. W. Studier, and involved chromatography on SP-trisacryl (LKB) and a DEAE-HPLC column (Bio-Rad). To assay for RNA polymerase activity, add in order to a small plastic tube: 11 #1 H20 4 #1 5 X buffer (200 m M Tris, 40 mMMgC12, 125 m M NaC1, 25 m M DTT, pH 7.6) 2 pl NTPs (10 m M each GTP, ATP, CTP and UTP) I pl linear DNA with T7 promoter, 1 mg/ml [e.g., pT7-1 (US Biochemicals) cut with RsaI] 1 M1[a-35S]ATP (-0.01 MCi) 1 #1 fraction to be assayed
22 R. D. Wells, S. C. Hardies, G. T. Horn, B. Klein, J. E. Larson, S. K. Neuendorf, N. Panayotatos, R. K. Patient, and E. Selsing, this series, Vol. 65, p. 327. 23 p. Davanloo, A. H. Rosenberg, J. J. Dunn, and F. W. Studier, Proc. Natl. Acad. Sci. U.S.A. 81, 2035 (1984).
[14]
RIBOSOMAL RNA FRAGMENTS
233
Incubate for 30 min at 37 °, and then assay for trichloroacetic acid-precipitable radioactivity as described elsewhere. 21 Reaction Conditions. To find optimum conditions for carrying out transcriptions, we have measured incorporation of [a -35S] ATP into different RNA transcripts under various conditions. An excess of RNA polymerase was used in the reactions (0.36/~M), and the DNA, NTPs, and NaCI concentrations varied. The most important results are shown in Fig. 3A I
I
I
I
A
60-
•
pTT-I-Rso I
13_ I-<
g
40-
o o o. o c
20
t
2'o
pBA21-Smel,
[DNA] x I0
go
80
20
[DNA], /.tg/ml 60 13I-<
g
40
o
8
sat
20
r
i
i
I
2
3
NTPs, mM each
FIG. 3. Optimum conditions for transcription with T7 RNA polymerase. The DNA pT7-1-Rsal gives a 291-base transcript from the normal T7 promoter sequence; pBA21Sinai gives a 23-base transcript from a T7 promoter altered in the last three nuclcotides of the normal sequence (sequence 5 of Table I). All assays were carried out in 20 gl with 0.72 Mg T7 RNA polymerase. (A) Influence of DNA concentration on nueleotide incorporation. Note that pBA21-SrnaI DNA is 10 times more concentrated than pT7-l-RsaI DNA. NTP concentrations were 1 raM. (B) Influence of NTP concentrations on transcription. DNA concentrations were 20/zg/ml (pT7-1 -RsaI) or 1 mg/ml (pBA21-SmaI).
234
PROTEIN- R N A INTERACTIONS
[14]
and B. Using 1 m M of each NTP, the maximum incorporation obtained is 60-70% with the normal T7 promoter sequence. For the 291-base transcript shown, ~ 500 transcripts are made per DNA molecule. The plasmid pBA21, which contains a different sequence promoter (sequence 5 in Table I), is less efficiently transcribed and a maximum of 20% incorporation is obtained; this occurs when the DNA concentration is about equal to the RNA polymerase concentration. About 130 transcripts per DNA are obtained with this sequence. 24 Figure 3B shows that the optimum concentration of NTPs is about 1 m3~ each. Higher concentrations become quite inhibitory with both promoters tested; by 3 m M very little transcription is obtained. The inhibition is probably due to chelation of Mg 2+ by the NTPs. zs Raising the MgCl2 concentration to 12 m M allows 2 m M each NTP to be used in the reaction and still obtain - 50% incorporation. Higher concentrations of MgC!z and NTPs did not give significantly greater yields of transcripts. The transcription reaction is relatively insensitive to NaC1 concentration. We see only a small (~ 20%) decrease in transcription at salt concentrations greater than 100 m M or less than 25 m M (data not shown).
Purification of Fragments Transcribed RNA is easily purified from the transcription components by loading the transcription reaction directly onto a gel filtration column. A 1.6 X 50 cm Superose 12 column (Pharmacia)gives excellent resolution of RNA transcripts up to - 120 bases (Fig. 4A). RNA from this column usually shows a single band after electrophoresis on a denaturing acrylamide gel. Further purification is possible by chromatography on a DEAE column in the presence of 6 M urea (Fig. 4B). Transcripts differing in length by a single nucleotide can be resolved up to - 3 0 base lengths. Resolution declines substantially for longer RNAs. For the 117-base transcript shown in Fig. 4, overloaded gels did detect RNAs o f - 100 bases that were unresolved until the full-length molecule. 24Note that the pBA21-SmaI sequence contains four As, seven Gs, and six each of the pyrimidines. Thus, 20% incorporation of A in full-length transcripts requires 35% incorporation of G. HPLC analysis of transcription reactions with this promoter show that the polymerase incorporates more nucleotides into short oligonucleotides, two to five nucleotides in length, than into the full-length 23mer. Sequencing gels run with [a-35S]ATP-labeled transcripts show only 23mer. Thus, the oligonucleotides are probably the result of abortive initiation at the 5' end of the transcript (A first occurs at position 8). The overall consumption of GTP during the reaction must therefore be much higher than 3596, and may limit the total incorporation somewhat. The stability of the polymerase during the longer incubations required with this weak promoter may also be limiting. 2s j. F. Million, D. R. Groebe, G. W. Witherell, and O. C. Uhlenbeck, Nucleic Acids Res. 15, 8783 (1987).
[ 14]
RIBOSOMAL RNA FRAGMENTS
235
A
1.5
.7% anscript
e~ 1.0 c3 o
DNA
0.5
I
3 time, hours
1.5
B z
,~. 1.0 to
o
a o - 0 . 4 ~,~.=-,
0.5 -0.2
6b time, rain FIG. 4. Purification of 117-base RNA transcripts derived from bisulfite-generated sequence variants of the S15 binding region (C. Disimone and D.E. Draper, unpublished observations). (A) G-el filtration on a 1.6 X 50 cm Superose 12 column. Transcript, 0.5 ml, was loaded onto the column and eluted with 0.1 M NaCI, 20 m M Tris, pH 7.6, pumped at 0.6 ml/min. The plasmid DNA has been cut with DdeI, generating 8 fragments, which accounts for DNA eluting in two positions. (B) DEAE ion-exchange chromatography of RNA fractions pooled from a Sepharose 12 column. The column is a Bio-Rad DEAE-5-PW, 7.5 X 75 ram, pumped with a gradient of NaCl in 6 M urea, 20 m M Tris at 0.4 ml/min. The equivalent of 0.25 ml of transcription reaction was loaded.
Transcriptionfrom Single-Stranded Templates Uhlenbeck and co-workers have described the use of synthetic, partially single-stranded DNA for transcribing short RNA sequences with T7 RNA polymerase. 25 The synthesis from a single-stranded template is very efficient, and the sequence of the last few bases is not constrained by the need for a restriction site. The method generally works very well, but we have found a surprising artifact in transcribing very stable RNA hairpins. Figure
236
PROTEIN- R N A INTERACTIONS
[ 14]
uUucGRGCC Uu RGCUCGG
T uU UCGRGCC C UURGCUCG6 FIG. 5. Autoradiogram of RNA transcription using synthetic DNA. The RNA transcripts have been run out on a 20% acrylamide, 50% urea gel. Electrophoresis is from left to fight. See text for details of template sequence and reaction conditions; the top lane is transcription from a partially single-stranded template, and the bottom lane transcription from a fully double-stranded template. The arrows indicate transcription products which were sequenced and found to be the "bulgeless" and "bulged" hairpin helices (upper and lower structures, respectively).
5 shows transcription from the two synthetic DNA templates 5'TAATACGACTCACTATAG 3' 3'ATTATGCTGAGTGATATCCGAGCI'AAAAAGCq'GCGG5' 5 ' T A A T A C G A C T C A C T A T A ~ C G A T T I T I ' C G A C G C C 3' Y A T I ' A T ~ G A G T G A T A T C ' C G A G C q ' A A A A A G C q ' ~ 5'
The two templates both code for the same 19-base RNA hairpin containing a single base bulge, also shown in Fig. 5. Reaction conditions were the same as described for transcription of plasmid DNA, using 1/~M concentration of template, l / t M T7 RNA polymerase, and incubating for 1 hr at 37 °. [tz-32p]GTP was included in the reactions, samples were run on 50% urea, 20% polyacrylamide gels, and the gel autoradiographed. The partially single-stranded template clearly gives a great deal of spurious transcription. Similar "ladders" of longer transcripts are obtained when a completely single-stranded template is used (not shown). The double-stranded template gives a major product, indicated by the lower arrow in Fig. 5. Sequencing of this product shows that it is the expected hairpin with single base bulge. This product was also identified in the transcription from partially single-stranded DNA. The most abundant single product in this transcription, however, turns out to be an 18-base transcript in which base
[ 14]
RIBOSOMALRNA FRAGMENTS
237
16, the single base bulge in the hairpin structure, has been deleted (upper arrow in Fig. 5). We have repeated this observation with templates coding for the same hairpin with bulges in three different positions; in each case the major product is the hairpin with the bulged base deleted. Partially single-stranded DNA templates coding for RNAs with less stable secondary structures give predominantly the expected product, with much less of the spurious "ladder," as described by others. 25 These results suggest that very stable secondary structure in the DNA template affects the accuracy of T7 RNA polymerase transcription. If transcription were completely processive, the secondary structure of the template might affect the rate of transcription, but not its accuracy; once the polymerase reaches base 16 the DNA hairpin should be melted and there would be no reason for the polymerase to skip the "bulge" base in preference to others. We presume therefore that the polymerase frequently dissociates (at least partially) from the template during transcription, allowing the DNA hairpin to reform, and that reassociation of the polymerase-nascent transcript-template complex may take place at the wrong site. Multiple dissociations and reassociations may account for the "ladder" of transcripts longer than the template. Whatever the mechanism, it is clearly necessary to characterize the transcription products carefully. Precautions To Avoid RNase Contamination
In all the protocols described here, precautions should be taken to avoid RNase contamination. These include using autoclaved or sterile-filtered buffers, glassware baked at 180 °, and plasticware baked at 100 ° overnight. Very pure water (e.g., that obtained from a Millipore "MilliQ" system) also helps prevent metal ion contamination. With these precautions, RNAs of better than 90% purity can be prepared by T7 RNA polymerase transcription, and addition of RNase inhibitors is unnecessary. For transcription of 100-base RNAs, we have obtained a purified yield of about 8 A260units RNA per milliliter of transcription reaction. Very short transcripts are obtained in somewhat lower yield. Thus, milligram quantities of virtually any rRNA sequence or sequence variant can be prepared for physical studies.
Acknowledgments W e thank Chris Disimone and Sarah Morse for prodding some of the data on T7
transcription presented here, and Dr. F. W. Studier for generously providing us with bacteria strains. This work was supported by NIH grants GM29048 and GM37005, and D.E.D. is supported by a Research Center Development Award (CA01081).
238
PROTEIN- R N A INTERACTIONS
[ 15]
[15] P h y s i c a l S t u d i e s o f t h e I n t e r a c t i o n o f Escherichia coli T r a n s l a t i o n a l I n i t i a t i o n F a c t o r 3 P r o t e i n w i t h Ribosomal RNA B y ERIC WICKSTROM a n d LANCE G . LAING
Introduction Control of gene expression comprises the central problem of cancer, viral infection, hypertension, contraception, muscular dystrophy, developmental anomalies, arthritis, and other autoimmune diseases. Gene expression is controlled at the levels of transcription and translation. Proteinnucleic acid interactions are the agents of regulation, and Escherichia coli translational initiation factor 3 protein (IF3) is one of the simplest systems to study in order to obtain a detailed and fundamental understanding of protein-nucleic acid interactions in the regulation of translation. IF3 catalyzes the binding o f natural and synthetic mRNAs to 30S ribosomal subunits, accelerates the association and dissociation rates of aminoacyltRNAs and initiator tRNA to 30S ribosomal subunits, and promotes the dissociation of 70S ribosomes into 50S and 30S ribosomal subunits.t IF3 is an RNA helix-destabilizing protein, with sequence specificity for the initiation codon AUG, and a conserved sequence near the 3' end of 16S ribosomal RNA. 2 Hence, elucidating the mechanism of bacterial IF3 interaction with rRNA is a good model for studying the control of translation in higher organisms. Protein-protein cross-linking, RNA-protein cross-linking, and immunoelectron microscopy studies indicate that IF3 binds in the cleft of the 30S ribosomal subunit, bridging from the head of the subunit to the platform, in close proximity to the 3' end of 16S rRNA on the platform (Fig. 1). The 3' end of 16S rRNA appears to be essential for IF3 binding, but no 30S ribosomal protein has been identified as essential for IF3 binding) Filter-binding assays with IF3 and homopolynucleotides indicated no apparent sequence specificity at low ionic strength, and an RNA binding site size of 14 + 1 nucleotides,3 while at physiological ionic
1C. O. Gualerzi, C. L. Pon, R. T. Pawlik, M. A. Canonaco, M. Paci, and W. Wintermeyer, in "The Structure, Function and Genetics of Ribosomes" (B. Hardesty, ed.), p. 621. SpringerVerlag, Berlin, Federal Republic of Germany, 1986. 2 E. Wickstrom, Nucleic Acids Res. 11, 2035 (1983). 3 E. Wickstrom, R. W. Tyson, G. Newton, R. Obert, and E. E. Williams, Arch. Biochem. Biophys. 200. 296 (1980). METHODS IN ENZYMOLOGY, VOL. 164
Copyright © 1988 by Academic Press, Inc. All rights of reproduction in any form reserved.
[ 15]
IF3 - RNA INTERACTIONS
239
1=-3
25 -
g:-IMD
FI~. 1. The bacterial small ribosomal subunit, showing the location of the 3' terminus of 16S rRNA and the binding domain of IF3.
strength or above, IF3 binds very weakly to homopolynucleotides:,5 However, equilibrium dialyses and filter-binding assays at physiological ionic strength or above demonstrated that IF3 binds specifically to the initiation codon AUG, 6 while nuclease mapping revealed that IF3 binds specifically to a 13-nucleotide sequence, 5'-GUCGUAACAAGGU-3', nucleotides 1492-1505 in the 3' terminal 49-nucleotide cloacin DR 13 fragment of 16S rRNA, 2 which is virtually conserved in all forms of life, from bacteria to humans, in both mitochondrial and cytoplasmic ribosomes. 7 The specificity of the latter interaction is underlined by the fact that IF3 protects the cloacin fragment from nucleases even in the presence of a large excess of tRNA; in contrast, ribosomal protein S1 does not protect the cloacin 4 E. Wickstrom, FEBSLett. 128, 154 (1981). s B. F. Schmidt, K. Twombly, L. J. Mengle, and T. Schleich, Arch. Biochem. Biophys. 290, 207 (1985). 6 E. Wickstrom, Biochim. Biophys. Acta 349, 125 (1974). 7 p. H. van Knippenberg, J. M. A. van Kimmenade, and H. A. Heus, Nucleic Acids Res. 12, 2595 (1984).
240
PROTEIN- R N A
INTERACTIONS
[ 15]
fragment from nucleases under the same conditions) Thus, IF3 binding to the cloacin fragment is consistent with the observed domain of IF3 binding on the 30S ribosomal subunit. Chemical probes of 16S rRNA secondary structure in low-salt-washed 30S ribosomal subunits, which still contain IF3,9 nuclease mapping of the cloacin fragment in the presence of IF3, 2 and spectroscopic studies of the cloacin fragment alone t° implied that Fig. 2A is the probable structure of the cloacin fragment at physiological ionic strength and temperature in the presence of IF3. On the other hand, nuclease mapping of the cloacin fragment alone, 2 and chemical probing at a variety of temperatures H agreed with Fig. 2B at lower temperatures. This discrepancy probably means that the extra four base pairs in Fig. 2B exchange too rapidly at room temperature to be detected spectroscopically. Physical studies of the IF3-cloacin fragment system, using the techniques described below, revealed interesting molecular details of the interaction. When combined with nuclease mapping and chemical probe results, the physical data made it possible to propose a simple model wherein IF3 interacts with the most highly conserved residues in the cloacin fragment.~2 Preparation of Ribosomes and IF3 All preparative steps were carried out at 4 °, and all lysis and chromatography solutions contained 50gg/ml phenylmethylsulfonyl fluoride (Sigma) to inhibit proteolysis, and 1.0 m M dithiothreitol to prevent oxidation of reduced cysteine side chains, unless otherwise stated. IF3 activity was assayed for stimulation of f[35S]Met-tRNA binding to 70S ribosomes programmed by AUG essentially as described by Hershey et al. ~3 IF3 concentrations were estimated by both the Coomassie Blue assay ~4and by i ~ _ 2 •013 The molecular weight of IF3, 20,530, and numbering of E28oamino acid residues were based on the.nucleotide sequence of the gene. 15 8 E. Wickstrom, Biochim. Biophys. Acta, 868, 265 (1986). 9 C. R. Woese, L. J. Magrum, R. Gupta, R. B. Siegel, D. A. Stahl, J. Kop, N. Crawford, J. Brosius, R. Gutell, J. J. Hogan, and H. F. Noller, Nuclei Acids Res. 8, 2275 (1980). 1o H. A. Heus, J. M. A. van Kimmenade, P. H. van Knippcnbcrg, C. A. G. Haasnoot, S. H. de Bruin, and C. W. Hilbcr, J. Mol. Biol. 170, 939 (1983). 11 H. A. Heus and P. H. van Knippcnberg, unpublished observations (1985). 12E. Wickstrom, H. A. Heus, C. A. G. Haasnoot, and P. H. van Knippcnbcr~ Biochemistry 25, 2770 (1986). ~3j. W. B. Hershey, J. Yanov, and J. L. Fakunding, this series, Vol. 60, p. 3. 14M. M. Bradford, Anal. Biochem. 72, 248 (1976). is C. Sacerdot, G. Fayat, P. Dessen, M. Springer, J. A. Plumbridge, M. Grunberg-Manago, and S. Blanquet, EMBO J. 1, 311 ( 1982 ).
[ 15]
IF3- RNA INTERACTIONS
241
G-C 20-A-U U'G~.~O__] G-C C-G C-G A-U
m
10
1A_U~. ~ 40
A G
m~A m~A G-C G-C 20-A-U U.G-30 G-C C-G C-G A-U G A-U G A U-A C G-C ~U 40 G-C m 10 A-U 5' GUCGUAACA CCUUA 3' m2G
B FIG. 2. A and B are alternative structures of the 49-nucleotide 3' terminal cloacin DFI3 fragment of 16S rRNA (from Ref. 2). Nucleotides protected by IF3 from single-strand-specific nucleases are underlined in structure A; those attacked more readily by single-strand-specific nucleases in the presence of IF3 are indicated by arrows. Numbering starts at the 5' end of the fragment, which is residue 1494 of 16S rRNA? ° Boxed regions are evolutionarily conserved. 7
Tight couple ribosomes were prepared from E. coli RR 1 cells, freshly grown to mid-log phase in 1 liter of L broth at 37 °. The cells have sedimented for 10 min at 8 krpm in a Sorvall GS-3 rotor, then resuspended in 30 ml of 10 m M Tris-HCl, pH 7.4, 10 m M magnesium acetate, 100 m M NH4C1 (buffer A), and lysed by the addition of lysozyme to
242
PROTEIN- R N A INTERACTIONS
[ 15]
1.7 mg/ml, sodium deoxycholate to 0.5%, and DNase I to 0.2 mg/ml. The suspension was stirred for 10 min following each addition. The cell lysate was sedimented for 20 min at 15 krpm in a Sorvall SA-600 rotor, and the supernatant fraction was saved. The pellet was resuspended in 10 ml of buffer A and sedimented once more. The second supernatant fraction was combined with the first and the mixture was added to a pair of screwtop bottles for the Beckman 70 Ti rotor. Each 20-ml supernatant fraction was underlaid with 8 ml of buffer A containing 20% glycerol and sedimented for 8 hr at 50 krpm. The supernatant fraction was saved as a source of aminoacylating enzymes, and the ribosome pellet was resuspended in buffer A containing either 50% glycerol (for intact low-salt ribosomes at a source of cloacin fragment) or 1.0 M NH4C1 (to release initiation factors). The ribosomes resuspended in 50% glycerol were stored in 1.5-ml vials at - 80 °. The ribosomes resuspended in high salt were underlaid with buffer A containing 1.0 M NH4C1 and 30% glycerol, then sedimented for 8 hr at 50 krpm in a Beckman 70 Ti rotor. The supernatant fraction was used as a source of crude IF1 and IF2, prepared according to Hershey et aL, ~3 and the pellet of salt-washed ribosomes was resuspended in buffer A containing 50% glycerol and stored in 0.5-ml aliquots at - 8 0 °. IF3 is overproduced 10- to 50-fold in E. coli RR1 transformed by the plasmid pB5-57, which contains a 3.7 kb PstI fragment including the E. coli infC gene, inserted into the PstI site of pBR322) 6 The latter cell line was grown in 4-liter cultures of L broth containing 50/zg/ml ampicillin (Sigma) at 37 ° in a rotary incubator. When the culture reached an optical density of 0.8 at 600 nm, cells were harvested by sedimentation for 10 min at 8 krpm in a Sorvall GS-3 rotor. Cell pellets were resuspended in 120 ml of buffer A and lysed as described above, with the addition of 1.0 MNH4C1 to release IF3 from ribosomes at the time of cell lysis. Streptomycin-HC1 (Sigma) was immediately added to the lysate plus pellet wash to 1% (w/v) in order to precipitate all ribosomes and nucleic acids. The suspension was sedimented for 20 rain. at 15 krpm in a Sorvall SA-600 rotor, leaving cellular proteins in the supernatant fraction. At this point, IF3 is the second most distinct band of a 150/0polyacrylamide Laemmli 17gel of crude lysate, after the lysozyme used to lyse the cells. IF3 is then purified by ion-exchange chromatography on phosphocellulose. The 1 MNH4C1 present in the 150 ml oflysate was diluted to 0.3 M b y the addition of 350 ml of 10 m M Tris-HCl, pH 7.4, containing 10% glyc16p. Lestienne, J. Dondon, J. A. Plumbridge, J. G. Howe, J.-F. Mayaux, M. Springer, S. Blanquet, J. W. B. Hershey, and M. Grunberg-Manago, Eur. J. Biochem. 123, 483 (1982). t7 U. K. Laemmli, Nature (London) 227, 680 (1970).
[ 15]
IF3- RNA INTERACTIONS
243
erol (buffer B), in order to allow binding of the supernatant proteins to phosphocellulose (Whatman P-11). The diluted supernatant proteins were combined with a slurry of 200 ml preequilibrated P- 11, stirred for 15 min, and sedimented for 10 rain at 5 krpm in a Sorvall GS-3 rotor, after which the supernatant fraction was discarded. The P-I 1 was reslurried and packed into a 2.6 × 20 cm column, followed by 30 ml of centrifuge bottle rinses with buffer B. The column was washed with 1 liter of buffer B containing 0.3 M NH4CI, until the A2so returned to baseline. The column was then eluted with a l-liter gradient of 0.3- 1.0 M NH4C1 in buffer B. Lysozyme, the most prominent component, eluted in a broad peak between 0.5 and 0.7 M NH4CI, while IF3 eluted in a diffuse peak between 0.7 and 0.8 M NH4C1. Fractions containing IF3 activity and detectable bands on a polyacrylamide gel were diluted with two volumes of 10 mM TrisHC1, pH 7.4, 6.0 M urea, 1.0 m M ethylenediaminetetraacetic acid (EDTA), 10% glycerol (buffer C) to reduce the NH4CI concentration and partially denature the IF3. The dilute IF3 pool was applied to a 0.6 × 10 cm column of P- 11 equilibrated in buffer C containing 0.1 M NH4C1, and the column was washed with 25 ml of the same buffer. The column was then eluted with a 100-ml gradient of0.1-0.5 M NH4C1 in buffer C, yielding an IF3 peak which eluted between 0.16 and 0.22 M NH4C1. The IF3 peak fractions were diluted with two volumes of 10 m M Na2HPO4, pH 7.4, 1.0 mM EDTA, 5% glycerol (buffer D) and applied to a 0.6 × 2 cm column of P-11, which was then washed with 5 ml of buffer D, and the concentrated IF3 was eluted from the column with 1.0 M KCI in buffer D, yielding 5 mg IF3 in the first two 0.5-ml fractions. IF3 is essentially homogeneous at this point (Fig. 3). Rabbit polyclonal antiserum against IF3, ~athe kind gift of Dr. J. W. B. Hershey, cross-reacted with both an old IF3 standard isolated from E. coli MRE 60019 and with the overproduced recombinant IF3 described above, following Western blotting from a Laemmli ~7gel onto nitrocellulose and staining with horseradish peroxidase conjugated to goat anti-rabbit IgG (Bio-Rad Kit No. 170-6500) (Fig. 4). IF3 from E. coli MRE 600 was primarily the long form, while that from the recombinant overproducing strain was primarily the short form. Including phenylmethylsulfonyl fluoride in all the lysis and chromatography buffers did not lead to any greater yield of long form. It is possible that cloning the IF3 gene into an inducible, higher copy number plasmid might allow a greater yield of the long form. Samples which have been stored at --80 ° for several months after
msj. G. Howe and J. W. B. Hershey, J. Biol. Chem. 256, 836 (1981). 19 E. Wickstrom, FEBS Lett. 128, 154 (1981 ).
244
[ 15]
PROTEIN- RNA INTERACTIONS .50 .4O
.3G
g .20
.10 ._++
q " ~2
4
6
e
IO
12
Dislonee from top of gel, em FI~. 3. Denaturing polyacrylamide gel electrophoresis of purified IF3. A 2.0 #g sample of IF3 was analyzed on a 15% polyaerylamide-SDS gel, stained with Coomassie Blue, destalned, then scanned at 580 nm.
preparation should be assayed prior to use to ensure that experiments are not carried out with IF3 which has lost significant activity. P r e p a r a t i o n of the 3' Terminal Cloacin F r a g m e n t of 16S r R N A The 49-nucleotide 3' terminal of 16S rRNA, residues 1494-1542, 2° was prepared according to Baan et al. 21 Three thousand six hundred A260 units of salt-washed fight couple ribosomes in 2.5 ml of buffer A were cleaved by the addition of 0.5 ml of 0.3 mg/ml heat-activated cloacin DF13 in buffer A. 22 The solution was incubated for 45 rain at 43 °, then applied to a 0.2-0.8 M sucrose gradient in 10 m M Tris-HC1, pH 7.4, 10 m M magnesium acetate, 100 mMNH4C1 (buffer E) to separate 50S and 30S ribosomal subunits, and sedimented for 5 hr at 25 krpm in a Beckman SW 27 rotor. The gradients were fractionated, and the 30S ribosomal subunit peak was deproteinized with phenol to isolate digested 16S rRNA. The RNA in the aqueous phase was precipitated with ethanol, pelleted, redissolved in 0.1 M sodium acetate, pH 5.5, 1.0 m M EDTA, 0.5% SDS, applied to a 0.15-0.6 M sucrose gradient in the latter buffer, and sedimented for 40 hr at 25 krpm in a Beckman SW 27 rotor at 15 °. The 3S 20j. Brosius, M. L. Palmer, P. J. Kennedy, and H. F. Noller, Proc. Natl. Acad. Sci. U.S.A. 75, 4801 (1978). 21 R. A. Baan, R. van Charldorp, E. van Leerdam, P. H. van Knippenberg, L. Bosch, J. F. M. de Rooij, and J. H. van Boom, FEBSLett. 71, 351 (1976). 22 F. K. de Graffand P. Klaascn-Boor, Eur. J. Biochem. 73, 107 (1977).
[ 15]
I F 3 - RNA INTERACTIONS
245
FIG. 4. Western blot of purified IF3. Left lane, IF3 purified from E. coli MRE 600. ~9 Right lane, IF3 purified from E. coil RR1/pBS-57.
246
PROTEIN- RNA INTERACTIONS
[ 15]
RNA peak at the top of the gradient was pooled and precipitated with ethanol. Final purification was by preparative slab gel electrophoresis on a 0.15 × 12 X 14 cm slab gel of 12% acrylamide, 0.6% bisacrylamide in 7.0 M urea, 50 m M Tris-H3BO3, pH 8.3, 1.0 m M EDTA, which was run for 4 hr at 200 V. RNA bands were detected by ultraviolet fight shadowing over a fluorescent chromatography plate. In this system, the fragment travels slightly move slowly than xylene cyanole FF. The fragment was extracted into 0.5 M ammonium acetate, 10 m M EDTA, 0.5% SDS, then precipitated with three volumes of ethanol and redissolved in the latter buffer. Absorption spectra indicated a yield of 0.90 A~o units. Concentrations were determined spectrophotometrically using an extinction coefficient of 3.8 × 10S/Mcm at 260 nm. Equimolar Footprinting In order to estimate the association constant for IF3 binding to the cloacin fragment when only picomoles of sample were available, equimolar mixtures of IF3 and cloacin fragment were prepared at increasing dilution in a buffer of physiological ionic strength and pH, then digested with nudease S~ at 37 °. Parallel digests without IF3 were carried out at the same dilutions to control for concentration effects on nuclease S~ attack. The degree of protection or greater susceptibility of particular nucleotides due to bound IF3, which is called footprinting, was assumed to be due to the proportion of IF3/cloacin fragment complex, assuming one to one stoichiometry: IF3 + RNA ~ IF3. RNA
(1)
At equilibrium, the concentrations of product and reactants should give the association constant: K = [IF3- RNA]/[IF3][RNA]
(2)
For the case where IF3 and cloacin fragment RNA are equimolar, at an input concentration where the IF3 and the cloacin fragment are half bound and half dissociated, the complex concentration on the top of Eq. (2) cancels one of the terms on the bottom, yielding K = 1/[IF3] = 1/0.5[IF3]o---2/[IF3]o
(3)
The result is that the association constant is twice the inverse of the starting IF3 or RNA concentration, and the dissociation is half of the starting IF3 or RNA concentration. The cloacin DF13 cleavage leaves the 3' fragment with a 5'-OH. To obtain labeled fragment, the 5'-OH was phosphorylated with D,-31P]ATP (New England Nuclear) using 0.1 unit/ml polynucleotide kinase (BRL) in
[ 15]
IF3- RNA INTERACTIONS
247
10 mM Tris-HC1, pH 7.4, 15 m M magnesium acetate, 15 m M 2-mercaptoethanol, and incubating for 30 min at 37 °. Labeled fragment was purified by preparative slab gel electrophoresis as above, and eluted as above. Nuclease digests were done in 2.0 gl of 40 m M Tris-acetic acid, pH 7.4, 100 m M NaC1, 1.0 m M magnesium acetate, 1.0 m M ZnSO4 for 5 min at 37 °, unless otherwise indicated. Typically, 1-2 pmol of [5'-a2p]RNA, 1 - 2 X 105 dpm, plus 10ag mixed E. coli tRNA (Plenum) were digested with 20 units of nuclease Sl (BRL), or 0.02 units ofRNase Tl (Sankyo), or 10 pg of pancreatic RNase A (Pharmacia). For footprinting reactions including IF3, the protein was preincubated with the RNA for 5 min at 37 ° before adding the nuclease. Base hydrolysis reactions were done in 2.0 al of 25 m M Na2COa, pH 9.2, for 5 rain at 90 °, with the same amounts of cloacin fragment and tRNA as above. All reactions were terminated with one volume of 9.0 Murea, 10 mMEDTA, pH 8, 0.05% xylene cyanole FF, 0.05% bromphenol blue, and analyzed on a prerun 0.15 X 33 X 40 cm gel of 20% acrylamide, 0.67% bisacrylamide in 7.0 M urea, 50 mM TrisH3BOa, pH 8.3, 1.0 m M EDTA. The samples were electrophoresed for 4 - 5 hr at 900 V, then a second set of samples were applied, and the gel run for an additional 4 - 5 hr at 900 V. Following electrophoresis, gels were autoradiographed with Kodak XRP-5 film backed by du Pont Cronex Lightning-Plus screens at --70 ° for 1-2 days. Nuclease mapping with nuclease S~, RNase A, and RNase T1 confirmed the sequence and structure of the fragment.2 A typical equimolar footprinting analysis appears in Fig. 5. When IF3 and the eloacin fragment were both initially 0.7 aM, potentiation of nuclease S~ attack on some nucleotides was seen, and protection of others occurred. When IF3 and the cloacin fragment were both initially 0.14 aM, the footprinting effects were roughly half as strong as before, and when the reactants started out at 0.028 aM, only slight footprinting effects could be detected. From Eq. (3) then, the dissociation constant is thus close to half of 0.14aM, and the association constant is close to 1.4 X 107/M. The precision of this technique may be improved by using a larger number of concentrations, and by quantitating autoradiogram bands with a densitometer. Circular Dichroism Titrations In previous investigations, excellent agreement was observed between filter-binding assays and circular dichroism (CD) titration as independent measurements of IF3 binding to RNA. 3,4,23Both the cloacin fragment and 23T. Schleich, E. Wickstrom, K. Twombly, B. Schmidt, and R. W. Tyson, Biochemistry 19, 4486 (1980).
248
PROTEIN- R N A INTERACTIONS OH
T1
t
2
3
4
5
6
B OH
c
U
m
6A Z
T!
I
2
3
4
5
6
-
G 1530G
G G 1520C
[ 15]
_~
U G C ---0- --'C m ~ A
--
mX G G
1510
153o,
-
A U
-
G
-
C C
-
A
--
A
--
U
-
G
-
G
-
u
-
c
-
1520 c
-
m5~
A
-
m62A
A-
C-
1500. A ,a _
B
-
G
-
m2G
_
G
-
G
-
A
-
U
-
O
Oo
G_ O 1510 C
-
c
-
)tl
A
-
O
FIG. 5. Equimolar footprinting of IF3 on the cloacin fragment. Lane OH, base hydrolysis of 0.7 # M cloacin fragment; lane TI, RNase T= hydrolysis of 0.7 pMcloaein fragment; lane 1, nuclease S= hydrolysis of 0.7 # M cloacin fragment; lane 2, same as lane 1, plus 0.7 pM IF3; lane 3, same as lane 1, but diluted to 0.14/tM cloacin fragment; lane 4, same as lane 3, plus O.14 #M IF3; lane 5, same as lane 1, but diluted to 0.028 pM cloaein fragment; lane 6, same as lane 5, plus 0.028 pM IF3. (A) Second loading; (B) first loading.
IF3 have strong overlapping troughs and peaks below 250 nm, but only the cloacin fragment has a significant peak above 250 nm. Hence, one may independently observe the effect of IF3 addition on the RNA 268-nm peak, and reasonably expect that the observed decrease in circular
[ 15]
I F 3 - RNA INTERACTIONS
249
dichroism upon IF3 binding to an RNA is proportional to the amount of IF3 bound, if one continues the titration to a clear end point. Absorption spectra were recorded on an IBM 9420 spectrophotometer. CD spectra were recorded from 320 to 220 nm on a Jasco J-500A spectropolarimeter in a 0.6-ml, 1.0-cm pathlength cylindrical cell (NSG-Percision Cells) in a thermostatted cell holder. If the amount of sample available is less than 0.05 A26o units, the Jasco 90-/zl microcell may be used, since the cell holder includes focussing optics which send the entire fight beam through the microcell, rather than just losing most of the light beam by masking the microcell. CD measurements were made at 25 ° on 0.150.25/zM cloacin fragment solutions in buffers D and E, to which were added aliquots of IF3 for subsequent spectra, until well past the saturation point. All measurements were corrected for dilution; CD magnitudes are reported as Ae, per molar centimeter per residue. Titration curves of dilution-corrected RNA CD peak magnitudes versus total IF3 concentrations were fitted to models using the nonlinear least-squares multiparameter fit procedure of the SAS package (SAS Institute), run on an IBM 3081 mainframe. For hyberbolic CD titration curves, IF3 binding to the cloacin fragment was assumed to be noncooperative, and fitted to a Scatchard 24 plot; fitting was attempted for both one and two IF3 molcules per RNA. For sigmoid titration curves, cooperative as well as noncooperative models were tested. 25 Given the sensitivity of the instrument, CD titrations should give useful data for calculating association constants up to 10S/M. Buffer E is the standard assay buffer for ribosome and initiation factor activity, ~3except that the [Mg 2+] is 1 m M rather than 5 mM. Physiological [Mg 2+] is usually around 1 mM, 26 and we wished to minimize the likelihood of protein/RNA aggregation. This buffer is also very similar to the buffer used for equimolar footprinting of IF3 on the cloacin fragment, described above, except that NH4C1 was substituted for NaC1, and 1 m M ZnSO4 was left out. Buffer D is the same low-salt phosphate buffer used in measurements of IF3 binding to poly(A) by filter binding 3 and CD titration. 4 No peak flattening, large redshifts, or turbidity were observed in either buffer, which implies that aggregation did not occur. The shapes of the spectra in both buffers were virtually the same, but the spectra in the more physiological buffer E had a lower peak magnitude than the spectra in the low-salt buffer D lacking divalent metal cations. Although Mg 2+
24G. Scatchard,Ann. N.Y. Acad. Sci. 51,660 (1949). 25j. D. McGheeand P. H. von Hippel, J. Mol. Biol. 86, 469 (1974). 26R. K. Gupta and R. D. Moore,J. Biol. Chem. 255, 3987 (1980).
250
PROTEIN- RNA INTERACTIONS
[ 15]
stabilizes helical structures, it does not necessarily increase the CD magnitude. Titration of the peak CD of the cloacin fragment by addition of IF3 in the physiological Tris buffer E, where the interaction is primarily nonionic and sequence specific, is shown in Fig. 6. For comparison, raising the sample temperature to 37 ° decreased the peak CD magnitude by 13%, and at 50 ° the magnitude was reduced by 30%. The 19% reduction in CD magnitude at the end point correlates by interpolation to raising the temperature to about 41 ° in the absence of IF3, in which case the extra four base pairs of Fig. 2B would be fully melted, the nine base pairs of Fig. 2A would still be intact, and single-stranded regions would be less stacked. The titration displayed a hyperbolic decay curve with an apparent end point of one IF3 per RNA. The curve was best fit by assuming that only one IF3 bound per cloacin fragment, yielding an association constant of 1.80 + 0.05 X 107/M, corresponding to a free energy of binding of - 9 . 9 _+ 0.3 kcal/mol. The best fit association constant for this titration agreed well with the estimate of 1.4 × IOT/Mfrom equimolar footprinting, implying a lack of competition with tRNA for binding to IF3. The association constant was close to that for IF3 binding to 30S subunits, 5.8 X 10?/M, under
E 0
d <1 4.5
4q
o11 0:2 0'.3 o14 ols ole 0.7 [IF3], pM
FIG. 6. IF3 titrationof 0.15 #M cloacin fragmentRNA circulardichroismat 268 nm in 10 mM Tris-HC1,pH 7.4, 100 mM NH4CI, 1.0 mMmagnesiumacetate, 1.0 mM dithiothmitol, 596glycerol(physiologicalTris bufferE) at 25°. The smoothcurve representsthe best fit of the data to a hyperbolictitration curve whichassumesone IF3 bound per RNA, with an associationconstantof 1.8 × 10?/M.
[ 15]
IF3- RNA INTERACTIONS
25 1
~o\ 8
°\o •
¢J E
7
~ " ~ °"-
°
°
6
o o12 o14 0'.8 0'.8
1'.2
[IF3], pM FIG. 7. IF3 titration of 0.25 pM cloacin fragment RNA circular dichroism at 268 nm in 10 mM Na2HPO4, pH 7.4, 1.0 mM EDTA, 1.0 mM dithiothreitol, 5% glycerol (low-salt phosphate buffer D) at 25 °. The smooth curve represents the best fit of the data to a sigmoidal titration curve which assumes two IF3 molecules bound per RNA, with an intrinsic association constant of 1.7 × 106/Mfor each one, and a cooperativity constant of 33 for the binding of the second IF3 to an IF3-RNA complex. s i m i l a r c o n d i t i o n s . 27 A trial assumption of two IF3 molecules per cloacin
fragment, binding independently, gave a poorer fit, with an association constant for each IF3 of 8.10 _ 0.65 × 107/M. IF3 titration of the peak CD of the cloacin fragment by addition of IF3 in the low-salt phosphate buffer D, where the interaction is primarily ionic and nonspecific, appears in Fig. 7. The 35% reduction in CD magnitude, almost twice as much as in buffer E, implies complete disruption of secondary structure, as we have seen before for homopolynucleotides in low-salt phosphate buffer.4,23 At this low ionic strength, IF3 binding is not sequence specific, so IF3 molecules cover the entire oligonudeotide, resulting in thorough melting, as opposed to the partial destabilization seen in physiological Tris buffer, where only one IF3 binds per cloacin fragment. The peak CD declined sigmoidally, with an apparent end point of two IF3 molecules per RNA, unlike the in vivo situation, where only one IF3 binds per ribosome. The titration curve was best fit by assuming independent binding of one IF3 and cooperative binding of a second IF3 to 27j. Weiel and J. W. B. Hershey, Biochemistry20, 5859 (1981).
252
PROTEIN- RNA INTERACTIONS
[ 15]
each cloacin fragment. The fitting routine yielded an intrinsic association constant of 1.7 +_ 0.7 X 106/M for each IF3, correspondingto a free energy change of - 8 . 5 ___3.5 kcal/mol, and a cooperativity constant of 33 + 6, corresponding to a free energy change o f - 2 . 1 + 0.4 kcal/mol. These results agree well with IF3 titration of poly(rA) CD in the same low-salt phosphate buffer, which was fit by an intrinsic association constant of 1.3 + 0.8 X 106/M for each IF3 and a cooperativity constant of 25 + 7. 4 Proton Magnetic R e s o n a n c e M e a s u r e m e n t s High-field IH N M R spectra of IF3 elucidated some aspects of its tertiary structure. Tyr-71, Tyr-109, Lys-112, Arg-114, and His-139 are essential for function, and Cys-66 is very close to the RNA binding site. 2s High-field IH N~V[R spectra of the cloacin fragment hydrogen bonding imino protons characterized the stable bonds at 1 5 A - U 3 4 through 2 2 G C27) ° A study of their complex was expected to yield details of their interaction. Spectra at 500 MHz were recorded at 24 ° on a Bruker ~rM-500 spectrometer equipped with an Aspect 2000 minicomputer, operating in the Fourier transform mode. Chemical shifts were measured relative to the solvent water peak and converted to the 2,2-dimethyl-2-silapentane 5-sulfonate standard using temperature and salt calibration curves. To suppress excitation of the strong water peak in samples dissolved in IH20 , a semiselective pulse was used, in combination with an alternate delay acquisition. 29 Free induction decays were apodized by an exponential function causing extra line broadening of 8 Hz. For samples dissolved in 2H20 , the residual IHO2H signal was presaturated by a gated irradiation of 0.5 sec on the IHO2H resonance. These spectra were given a Gaussian-Lorentzian transformation for resolution enhancement, GB = 0.15 and LB = 7. The aromatic region of the IF3 2H20 spectrum in 25 r n ~ r Na2HPO4, pH 7.5, 100 mA/NaC1, 1.0 rn34EDTA, 1.0 m_Mdithioerythritol, a physiological phosphate buffer (Fig. 8A), was more complex than the spectrum one would obtain from an equimolar mixture of aromatic amino acids) ° For example, the resonances of Tyr-107 C-3,C-5 protons were shifted upfield to 6.7 ppm, indicating the ring current influence of a nearby aromatic residue. The methyl proton resonances of IF3 were shifted upfield) 2,29 The upfield shifts in the aromatic and methyl resonances are characteristic features of a extensively folded protein with a high degree of 2sM. Paci, C. Pon, M. Lammi, and C. Gualerzi, J. Biol. Chem. 259, 9628 (1984). 29C. A. G. Haasnootand C. W. Hilbers, Biopolymers 22, 1259(1983).
[ 15]
I F 3 - RNA INTERACTIONS
.
.
.
.
I
A
.
.
.
253
.
.
.
i
Tyr-75 I
HiS C-2
J
8;o
. . . . .
!
,Tyr.107 His Phe
p~m
Zb
.
.
.
.
.
.
~io
Fla. 8. Five-hundred megahertz IH NMR spectra in 2H20 at 24 ° of (A) 0.2 mM IF3 in 25 mM Na2HPO4, pH 7.5, 100 mM NaC1, 1.0 mM EDTA, 1.0 mM dithioerythdtol (physiological phosphate buffer) (312 scans); (B) 0.12 mM IF3 +0.12 mM cloacin fra_~,mentin 2.0 mM sodium cacodylate, 15 mM Na2HPO4, pH 7.3, 98 mM NaCl, 0.6 mM EDTA, 0.6 mM dithioerythdtol, prepared by mixing equimolar amounts of solutions in A and C (2000 scans); (C) 0.3 mM cloacin fragment in 5.0 mM sodium cacodylate, pH 5.5, 95 mM NaC1 (5580 scans). Assignments axe from Paci et al. 28 Arrow in B indicates location of position of missing Tyr- 107 resonances.
254
PROTEIN- RNA INTERACTIONS
[ 15]
secondary and tertiary structure. 3° During the course of this work, Paci et reported the 400 and 500 MHz ~H NMR spectra of IF3, which appear to be identical to the spectra in Fig. 8A. We have adopted their peak assignments, which are supported by pH titrations, chemical modification studies, and decoupling experiments, although assignment of tyrosine residues is still tentative. The aromatic region of the cloacin fragment 2H20 spectrum in 5.0 m M sodium cacodylate, pH 5.5, 95 m M NaC1, appears in Fig. 8C. There was significant overlap between cloacin fragment peaks and IF3 peaks. The samples from Fig. 8A and C were mixed in the appropriate proportions to yield an equimolar solution of cloacin fragment and IF3, 0.12 m M each in 2.0 m M sodium cacodylate, 15 m M Na2NPH4, pH 7.3, 98 m M NaC1, 0.6 m M EDTA, 0.6 m M dithioerythritol. At these concentrations, 98% of the RNA and protein molecules would be complexed with each other, assuming the IF3/cloacin fragment association constant of 1.8 × I 0 7 / M calculated above for the CD titration in physiological Tris buffer E. This was an approximation, since the buffer mixture in this experiment was similar to buffer E in ionic strength and pH, but was buffered by phosphate instead of Tris, had sodium for its major cation instead of ammonium, and lacked Mg2+. The aromatic region of the IF3/cloacin fragment 2H20 spectrum (Fig. 8B) did not show much broadening of either protein or RNA resonances. This indicates high mobility of the residues, which could be the result of a short lifetime for the complex. The resonances of the six Phe residues and Tyr-75, which do not seem to be essential for IF3 activity, seemed to be unaffected by complexing with the cloacin fragment. However, one of the doublets of Tyr-107, which is involved in IF3 binding to 30S ribosomal subunits, disappeared, either by shifting under the Phe resonances, or by broadening beyond recognition. These results were in excellent agreement with those of Paci et aL 3~ for IF3 binding to deuterated 30S ribosomal subunits, consistent with the specificity of IF3 binding to the cloacin fragment. Whether IF3 undergoes a major conformational change upon binding to the cloacin cannot be determined yet from these one-dimensional spectra. The low-field imino proton region of the cloacin fragment ~H20 spectrum in 1.0 ~ sodium cacodylate, 25 m M Na2HPO4, pH 7.0, 61.5 m M NaC1, 1.0 m M EDTA (Fig. 9A) showed nine resonances of water-exchangeable hydrogen-bonded protons, which were previously assigned by al. 2s
3oK. WtRhrich, in "NMR in Biological Research: Peptides and Proteins." Elsevier, Amsterdam, 1976. 3mM. Paci, C. Pon, and C. Gualerzi, J. Biol. Chem. 260, 887 (1985).
[ 15]
IF3 - RNA INTERACTIONS
i
T
I
I
r
i
i
t
I
~
t
i
I
r
255
T
T
I
r
i
I
18
21
A
19-
22
! I
1~t
r
19b
16
! 12
lt3
'
111
'
1'0
PPM
F]o. 9. Five-hundred megahertz IH NMR spectra in ~H20 at 24 ° of(A) 0.7 mM cloacin fragment in 1.0 mM sodium cacodylate, 25 mMNa2HPO4, pH 7.0, 61.5 mMNaCI, 1.0 mM EDTA containing 5% 2H20 (4100 scans), with peaks numbered according to base pairs in Fig. 1; (B) 0.12 mM IF3 + 0.12 mM cloacin fragment in 5.0 mM sodium cacodylate, pH 7.0, 95 mM NaCI containing 8% 2H20 (3800 scans);(C) same as B, but with 1.0 MNaCI (1500 scans).
nuclear Overhauser effects to eight of the base pairs, 1 5 A - U 3 4 through 22G-C27, in Fig. 2A) ° In the imino proton spectrum of the IF3/cloacin fragment complex in 5.0 m M sodium cacodylate, pH 7.0, 95 m M NaCI (Fig. 9B), most of the cloacin fragment resonances were still present, implying that the helix was still intact. All of the resonances showed some
256
PROTEIN- R N A INTERACTIONS
[ 1 S]
broadening, which was probably due both to the greater molecular weight of the IF3/cloacin fragment complex, more than twice that of the cloacin fragment, and to enhanced imino proton exchange. However, the 20AU29 resonance almost disappeared from the spectrum, while the peaks belonging to the 19U-G30 protons were substantially broadened, and the 22G-C27 resonance shifted upfield beneath the 18G-C31 resonance. These effects were also observed with the cloacin fragment alone upon raising the temperature. ~° There are two reasonable explanations for these observations. First, some part of the IF3 which comes in close contact with these base pairs might accelerate 19U-G30 and 20A-U29 imino proton exchange with water, and perturb the environment of 22G-C27. Second, IF3 binding to the cloacin fragment might destabilize the central and upper parts of the helix. At present we cannot distinguish between these two possibilities. Proton NMR studies of the binding of E. coli tRNA r~e to elongation factor Tu, its natural interaction partner, showed a similar effect on the U - G base pair in the amino acid acceptor stem oftRNAVhe. 32 When the NaCl concentration of the IF3/cloacin fragment mixture was raised to 1 M (Fig. 9C), the broadening of the 19U-G30 and 20A-U29 resonances was not reversed, nor was the upfield shift of the 22G-C27 resonance, as one would expect if IF3 binding to the cloacin fragment were primarily ionic and nonspecific, as it is at low ionic strength. The failure of 1 M NaC1 to reverse the effects of IF3 on the cloacin fragment resonances implies that IF3 interaction with the cloacin fragment is largely nonionic and sequence specific at physiological ionic strength and above, which was also found in the nuclease mapping s t u d y . 2 However, this interpretation must be considered tentative, since at this stage we lack detailed information on the influence of ionic strength on RNA imino proton resonances in the absence of protein. Elucidation of the tertiary structure of IF3, and the details of its interaction with the cloacin fragment will require two-dimensional NMR analysis, using COSY spectra to assign through-bond nearest neighbors, and NOESY spectra to assign through-space nearest neighbors. 33 Discussion The equimolar footprinting, CD titration, and NMR experiments implied that IF3 destabilizes the secondary structure of the cloacin fragment upon binding, and that IF3 binding to the cloacin fragment is probably one 32 C. W. Hilbers, A. Heerschap, J. A. L. I. Waiters, and C. A. G. Haasnoot, in "Nucleic Acids: The Vectors of Life" (B. Pullrnann and J. Jortner, eds.), p. 427. Reidel, New York, 1983. 33 A. D. Kline, W. Braun, and K. WOthdch, J. Mol. Biol. 189, 377 (1986).
[ 15]
IF3- RNA INTERACTIONS
257
of its predominant interactions with 30S ribosomal subunits. The existence of some other weak interactions was indicated in sedimentation studies of IF3 binding to 30S subunits lacking the colicin fragment, ~ and cross-linking experiments implied an additional IF3 interaction near nucleotide 800 of 16S rRNA. 35 Our observations suggest that IF3 binding alters secondary structure in the 3' terminus of 16S rRNA in 30S ribosomal subunits, thus changing the 30S subunit conformation, in accord with some models for IF3 function. Studies of IF3 binding to the mutant unmethylated cloacin fragment 36 and mutant 30S ribosomal subunits are underway. Preliminary probes of both the normal and unmethylated mutant cloacin fragment with diethyl pyrocarbonate, in the presence and absence of IF3, suggest that IF3 also sequesters A25 and A26 in the loop of the hairpin. 37 Taking account of the nuclease mapping, equimolar footprinting, CD, NMR, and chemical probe studies of IF3 binding to the cloacin fragment, a detailed model for the interaction was formulated. 2 IF3 appears to interact specifically with those residues conserved throughout evolution, namely G 1 - U l 3 , the base pairs 19U-G30 and 20A-U29, the hairpin loop residues m2G23-m62A26, and G36-A38. 7 Perhaps a eukaryotic ribosomal protein or protein exists which interacts with the same conserved residues and shares some of the functions of prokaryotic IF3. Many of these residues became more accessible to solvent upon IF3 binding, making some nucleotides, Gl, G3, C8, Gl l, Ul3, G24, G30, G36, and G37, more susceptible to single-strand-specific nucleases, or broadening the iminoproton resonances of the conserved base pairs. A few nucleotides, U2, A6, A7, A9, A10, U19, m62A25, and m~2A26, were sequested from nuclease or chemical attack. The intricacy and specificity of the interaction were indicated by the observation that a given residue may be sequestered by IF3 while its immediate neighbor or base pair partner is made more accessible. Assuming an A form structure for the cloacin fragment, the 13 nucleotides of the 5' leg are about 3.5 nm long, and the hairpin is about 3.0 nm high, adding up to 6.5 nm in the most extended form possible. With a radius a gyration of 1.5 nm and an axial ratio of 3.5, ! IF3 is at most 10.5 nm long and 3.0 nm wide. Hence, IF3 is most than large enough to bind to the conserved residues of the cloacin fragment, from the 5' end to the top of the 34 M. Laughrea, J. Dondon, and M. Grunberg-Manago, FEBSLett. 91, 265 (1978). 35 C. Ehresmann, H. Moine, M. Mougei, J. Dondon, M. Grunberg-Manago, J.-P. Ebel, and B. Ehresmann, Nucleic Acids Res. 14, 4803 (1986). 36 B. Poldermans, C. P. J. J. van Buul, and P. H. van Knippenberg, J. Biol. Chem. 254, 9090 (1979). 37 H. A. Heus, E. Wickstrom, and P. H. van Knippenberg, unpublished observations (1985).
25 8
PROTEIN- RNA INTERACTIONS
[ 16]
hairpin, with room left over to bridge the cleft of the 30S ribosomal subunit. Previous work led us to think that physical studies might reveal details of changes in the secondary structures of IF3 and the 16S rRNA 3' terminal cloacin fragment, and that such phenomena might be used to quantitate the strength of IF3 binding to the cloacin fragment. The results presented above verify these expectations, and encourage pursuit of the molecular details of this and other protein- nucleic acid interactions by the techniques described above. Acknowledgments We thank Drs. H. A. Heus, C. A. G. Haasnoot, and P. H. van Knippenbergfor their collaborationon tH magneticresonancestudiesand Dr. MarianneGrunberg-Managofor the plasmidpB5-57. Thisworkwas supportedby NationalInstitutesof HealthgrantsGM-28408, GM32024, and RR-01554, a European MolecularBiologyOrganizationshort-term fellowship, and a USF FacultyResearchand CreativeScholarshipgrant to E. W.
[ 16] I s o l a t i o n o f F r a g m e n t s o f R i b o s o m a l Recognize rRNA
By L I - M I N G
CHANGCHIEN,
Proteins That
RICHARD CONRAD, and GARY R. CRAVEN
The bacterial ribosome can be viewed as an intricate network of intramolecular and intermolecular interactions which are involved in the process of self-assembly. The former is represented by the folding of the constituent protein and RNA moieties into their unique three-dimensional structure, and the latter is achieved by the recognition and bonding between these structures, which may be subdivided into three obvious classifications: protein- protein, protein- RNA, and R N A - RNA interactions. The 30S subunit contains 21 proteins and one molecule of RNA, while the 50S subunit contains 32 proteins and two molecules of RNA. ~ Studies on the interactions between ribosomal proteins (r-proteins) and rRNA, as well as specific roles of individual proteins in further assembly (especially their interactions with other proteins) and the functions of the complete ribosome, have become possible after the development of the in vitro reconstitution systems for 30S and 50S ribosomes. 2-4 About half of the ribosomal H. G. Wittmann,Annu. Rev. Biochem. 51, 155 (1982). 2 p. Traub and M. Nomura,J. Mol. Biol. 40, 391 (1969). 3M. Nomuraand V. A. Erdmann,Nature (London) 228, 744 (1970). 4 T. Dohmeand K. H. Nierhaus,J. Mol. Biol. 107, 585 (1976). METHODS IN ENZYMOLOGY, VOL 164
Copyright© 1988by AcademicPress,Inc. All fightsof reproductionin any form reserved.
25 8
PROTEIN- RNA INTERACTIONS
[ 16]
hairpin, with room left over to bridge the cleft of the 30S ribosomal subunit. Previous work led us to think that physical studies might reveal details of changes in the secondary structures of IF3 and the 16S rRNA 3' terminal cloacin fragment, and that such phenomena might be used to quantitate the strength of IF3 binding to the cloacin fragment. The results presented above verify these expectations, and encourage pursuit of the molecular details of this and other protein- nucleic acid interactions by the techniques described above. Acknowledgments We thank Drs. H. A. Heus, C. A. G. Haasnoot, and P. H. van Knippenbergfor their collaborationon tH magneticresonancestudiesand Dr. MarianneGrunberg-Managofor the plasmidpB5-57. Thisworkwas supportedby NationalInstitutesof HealthgrantsGM-28408, GM32024, and RR-01554, a European MolecularBiologyOrganizationshort-term fellowship, and a USF FacultyResearchand CreativeScholarshipgrant to E. W.
[ 16] I s o l a t i o n o f F r a g m e n t s o f R i b o s o m a l Recognize rRNA
By L I - M I N G
CHANGCHIEN,
Proteins That
RICHARD CONRAD, and GARY R. CRAVEN
The bacterial ribosome can be viewed as an intricate network of intramolecular and intermolecular interactions which are involved in the process of self-assembly. The former is represented by the folding of the constituent protein and RNA moieties into their unique three-dimensional structure, and the latter is achieved by the recognition and bonding between these structures, which may be subdivided into three obvious classifications: protein- protein, protein- RNA, and R N A - RNA interactions. The 30S subunit contains 21 proteins and one molecule of RNA, while the 50S subunit contains 32 proteins and two molecules of RNA. ~ Studies on the interactions between ribosomal proteins (r-proteins) and rRNA, as well as specific roles of individual proteins in further assembly (especially their interactions with other proteins) and the functions of the complete ribosome, have become possible after the development of the in vitro reconstitution systems for 30S and 50S ribosomes. 2-4 About half of the ribosomal H. G. Wittmann,Annu. Rev. Biochem. 51, 155 (1982). 2 p. Traub and M. Nomura,J. Mol. Biol. 40, 391 (1969). 3M. Nomuraand V. A. Erdmann,Nature (London) 228, 744 (1970). 4 T. Dohmeand K. H. Nierhaus,J. Mol. Biol. 107, 585 (1976). METHODS IN ENZYMOLOGY, VOL 164
Copyright© 1988by AcademicPress,Inc. All fightsof reproductionin any form reserved.
[16]
RIBOSOMAL PROTEIN FRAGMENTS THAT BIND r R N A
259
proteins have been shown to be capable of independent and specific recognition of different regions of the rRNA molecules, and many different approaches have been taken to identify the regions of the rRNAs which the individual ribosomal proteins bind. 5-s However, relatively little effort has been made to establish the domains of the proteins responsible for interactions with the rRNA. We have been working to develop chemical and enzymatic cleavage techniques to produce fragments of ribosomal proteins which retain specific binding activities for rRNA. Once these fragments are found, the question can be asked, "Are any further functional roles of these proteins lost with the cleaved-off portion?" Our investigationsT M and studies from other laboratories t5-17 have shown that individual ribosomal proteins can be cleaved to produce smaller polypeptides capable of specific RNA association, and that often further functional activities in assembly and translation are lost.
Generation of Ribosomal Protein Fragments by Proteolytic Digestion Solutions RB (reconstitution buffer): 30 m M Tris-HC1 (pH 8.0), 20 m M magnesium acetate, 335 m M KC1, 1 mMdithiothreitol (DTT) TU- 1: 30 m M Tris-HC1 (pH 8.0), 8 M urea, 1 m M DTT TU-2:30 m M Tris-HCl (pH 8.0), 6 M urea TM: 30 m M Tris-HCl (pH 7.4), 20 m M magnesium acetate, 1 m M DTT TMA-I: 10 m M Tris-HC1 (pH 7.4), 10 m M magnesium acetate, 30 m M NH4CI, 1 m M DTT 5 R. Zimmermann, in "Ribosomes: Structure, Function and Genetics" (G. Chambliss, G. Craven, J. Davies, K. Davis, L. Kahan, and M. Nomura, eds.), p. 135. University Park Press, Baltimore, Maryland, 1980. 6 R. A. Garrett and H. F. Noller, J. Mol. Biol. 132, 637 (1979). 7 C. Zweib and R. Bdmacombe, Nucleic Acids Res. 6, 1755 (1979). 8 D. Moazed, S. Stern, and H. F. Noller, J. Mol. Biol. 187, 399 (1986). 9 L.-M. Changchien and G. R. Craven, J. Mol. Biol. 108, 381 (1976). 10L.-M. Changchien and G. R. Craven, J. Mol. Biol. 125, 43 (1978). 11 L.-M. Changchien, J. Schwarzbauer, M. Cantrell, and G. R. Craven, Nucleic Acids Res. 5, 2789 (1978). 12L.-M. Changchien and G. R. Craven, Nucleic Acids Res. 13, 6343 (1985). ~ J. Schwarzbauer and G. R. Craven, Nucleic Acids Res. 13, 6767 (1985). 14L.-M. Changchien and G. R. Craven, Nucleic Acids Res. 14, 1957 (1986). 15V. Newberry, M. Yaguchi, and R. A. GarrY, Eur..I.. Biochem. 76, 51 (1977). 16j. Bruce, E. J. Firpo, and H. W. Schaup, Nucleic Acids Res. 4, 3327 (1977). 17 V. Newberry, J. Brosius, and R. Garrett, Nucleic Acids Res. 5, 1753 (1978).
260
PROTEIN- RNA INTERACTIONS
[ 16]
T M A - 2 : 1 0 m M Tris-HC1 (pH 7.4), 0.5 m M magnesium acetate, 50 m M NH4C1 TMK: 30 m M Tris-HC1 (pH 7.4), 20 m M magnesium acetate, 500 m M KC1, 1 m M DTT Fragments of ribosomal proteins can be obtained by digestion of either free proteins or rRNA-protein complexes with proteolytic enzymes in various buffers. The digestion of free proteins in RB (see above) usually requires much lower concentrations of enzymes (protein : enzyme ratio of 100- 200: 1) than that for digestion of r R N A - protein complexes (complex : enzyme ratio of 5 - 20: 1). However, we find it advisable to prepare fragments from rRNA-protein complexes, as most fragments of ribosomal proteins generated in free solution are inactive in their rRNA-binding ability. Preparation of 16S RNA - Protein Complexes
In order to obtain a sufficient amount of fragment for chemical characterization and functional studies, it is usually necessary to prepare large quantities of 16S RNA-protein complexes for digestion experiments. Preparation of these complexes is performed by a modification of the procedure of Held et al. 18 The purified ribosomal proteins are dialyzed overnight against TU-1 to ensure the pH is over 7, then for 12 to 16 hr against TMK. Routinely, 37.5 nmol (500 OD26o units) of 16S RNA in 8 ml of TM is preincubated at 42 ° for 10 min and then mixed with a twofold molar excess of protein(s) in 16 ml of TMK. This mixture is then incubated at 42 ° for 30 min, cooled to 4 °, and centrifuged at 30,000 g for 10 min to remove any precipitate which might have been present. R N A protein complexes are isolated by pelleting through a 10 to 15 ml cushion of 10% sucrose in RB or TMA-1 for 16 hr at 100,000 g in 25 ml capped tubes (50.2Ti rotor). The pelleted complexes are dissolved in TMA-2, then dialyzed into RB at 40. It has been our experience that the pellet does not readily dissolve directly in RB. Proteolytic Digestion of 16S RNA - Protein Complexes
We have conducted a survey of the effect of many commercially available proteolytic enzymes on 16S RNA-protein complexes and have found that three enzymes--trypsin, chymotrypsin, and proteinase K - consistently give us the most desirable results. In addition, inhibitors are available for these enzymes which lessen the complication for subsequent isolation of fragments from the complexes. Usually, a series of experiments ~s W. A. Held, S. Mizushima, and M. Nomura, J. Biol. Chem. 248, 5720 (1973).
[ 16]
RIBOSOMAL PROTEIN FRAGMENTS THAT BIND r R N A
261
is carried out for a particular r-protein complex with each enzyme to optimize the time and molar ratio of protease to complex for digestion in terms of fragment production. Occasionally a digestion will be allowed to proceed beyond the point at which the amount of fragment peaks or plateaus in order to eliminate intact protein present, greatly simplifying the subsequent purification process. The enzymes are added to the complex solution from a stock solution in RB. It is essential that the enzyme preparation used be completely free of other hydrolytic enzyme activities, especially RNases. The digestion reactions are usually carded out at room temperature in RB for 2 to 3 hr, at an enzyme : complex molar ratio of l : 5 - 20. The reactions are stopped by the addition of one of three inhibitors: soybean trypsin inhibitor for trypsin (a twofold molar excess over enzyme, in RB)~9; 2-nitro-4-carboxyphenyl-N, N-diphenyl carbamate for chymotrypsin (0.1 volume of a 5 m M solution in 30 m M Tris-HCl (pH 7.6), initially dissolved in a minimum amount of 0.4 M Tris-base)2°; and phenylmethylsulfonyl fluoride for proteinase K (0.1 volume of a l0 m M solution in RB-40% 2-propanol). 2~ Reaction mixtures are cooled and pelleted through sucrose cushions exactly as in the preparation of the original complex. Supernatant is removed by aspiration and the pellets are dissolved in TU-2. Protein is extracted by the method of Hardy et al. 22 Preparation of Fragments of Ribosomal Proteins by Chemical Cleavage We have experimented with several chemical techniques for the fragmentation of ribosomal proteins and have found four cleavage procedures that produce biochemically functional fragments.
Chemical Cleavage at the Peptide Bond of Cysteine after Cyanylation with 2-Nitro-5-thiocyanobenzoic Acid Reagent Solutions Protein Buffer: 0.2 M Tris-acetate (pH 8.0), 4 M guanidine-HC1, 1 m M DTT 2-Nitro-5-thiocyanobenzoic acid (NTCB, Eastman, MW224.19) stock: 5 mg/ml (22.3 mM) in 0.2 M Tris-acetate (pH 8.0), 4 M guanidine-HC1 19j. Kunitz, J. Gen. Physiol. 30, 291 (1947). 20 B. F. Erlanger and F. Edel, Biochemistry 3, 346 (1964). 2~ D. E. Farney and A. M. Gold, J. Am. Chem. Soc. 85, 997 (1963). 22 S. Y. S. Hardy, C. G. Kurland, P. Voynow, and G. Mora, Biochemistry 8, 2897 (1969).
262
PROTEIN- RNA INTERACTIONS
[ 16]
10 m M NaOH Cleavage buffer: 0.2 M Tris-HC1 (pH 9.0), 4 M guanidine-HC1 Storage buffer: 30 m M Tris-HC1 (pH 8.0), 6 M urea, 1 m M DTT Treatment of ribosomal proteins with NTCB is carried out according to the procedure of Jacobson et al. 23 with slight modifications. Purified ribosomal protein is first dialyzed against 5% acetic acid for 24 hr (3 changes) and lyophilized. Lyophilized protein is dissolved in protein buffer at a level of 1 - 1.2 mg/ml, and the protein solution is incubated at 37 ° for 30 rain to ensure elimination of aggregate formation. Cyanylation of protein is initiated by the addition of a 5-fold excess of NTCB over total thiol present in solution (the contribution of the protein is often negligible compared to that of the DTT) and the pH of the solution is maintained at 8.0 by the addition of the NaOH solution. The reaction is allowed to continue at room temperature for 15 rain and terminated by the addition of an equal volume of glacial acetic acid. The sample is diaiyzed against 5% acetic acid and lyophilized. Cleavage of the derivatized protein is carried out by resuspending the lyophilized protein, now cyanylated, in cleavage buffer at 37 ° for 14 hr or longer, and terminated by the addition of an excess of 2-mercaptoethanol, followed by dialysis against 5% acetic acid and lyophilization. In order to maximize cleavage of protein without damaging the biochemical activity of fragments, it is necessary to study the time course of the cleavage reaction for each protein as well as the binding activity of fragments from several time points before large quantities of fragments are prepared. Thus, initially the lyophilates from several points in a time course will be dissolved in the sample buffer for a particular analysis system (we often use acid-urea polyacrylamide electrophoresis) and analyzed. Once optimal conditions are determined, the final cleavage products are resuspended and stored frozen at - 7 0 ° in storage buffer.
Cleavage at the Tryptophanyl Peptide Bond with a Mixture of Dimethyl Sulfoxide and Hydrogen Bromide Reagent Solutions Protein solvent: 2 parts glacial acetic acid, 1 part 12 N HCI containing 3.33 mg/ml of phenol (as scavenger for tyrosine modification) Dimethyl sulfoxide (DMSO, obtained from Fluka) Hydrobromic acid (HBr, obtained from Fluka), 48% in water 23 G. R. Jacobson, M. H. Schaffer, G. R. Stark, and T. C. Vanaman, J. Biol. Chem. 248, 6583 (1973).
[16]
RIBOSOMAL PROTEIN FRAGMENTS THAT BIND r R N A
263
Reduction solution: 30 m M Tris-HCl (pH 8.0), 4 M guanidine-HC1, 2 m M DTT, 10% 2-mercaptoethanol Storage buffer, as in previous section Cleavage of the tryptophanyl peptide bond of ribosomal proteins can be achieved using the method of Savige and Fontana. 24 Lyophilized r-protein (-20 mg) is dissolved in 6 ml of the protein solvent and 50/tl of DMSO is added. The reaction mixture is allowed to stand for 30 rain at room temperature, after which 200 #l of 48% HBr and another 50/d of DMSO are added. The reaction is allowed to continue for another 30 min at room temperature. Cleavage is terminated by the addition of 4 ml of distilled water. The solution is then dialyzed against 5% acetic acid overnight and lyophilized. Exposure of the protein to the reaction mixture for this time usually gives optimal cleavage (40 to 60% depending on different proteins). The use of longer reaction time always results in nonspecific cleavage. The products of this cleavage reaction are inactive in the binding to rRNA, presumably due to oxidation of methionine in protein. 25 A long reduction with a relatively high concentration of 2-mercaptoethanol is found to be necessary to restore the rRNA binding activity of the DMSOHBr reaction products. Reduction of the DMSO-HBr cleaved protein is achieved by dissolving in reduction solution and incubating at 37 ° for 48 hr in a sealed test tube followed by dialysis against storage buffer. This can be frozen until further use.
Cleavage of the Asparaginylglycyl(Asn-Gly) Peptide Bond with Hydroxylamine Reagent Solutions 4.5 M LiOH (filtered to remove undissolved material) Reaction solution: 0.8 M Tris, 2 M hydroxylamine, 4 M guanidineHC1. Prepared as follows: 2.78 g of hydroxylamine and 7.64 g ofguanidineHC1 are weighed into a 25-ml beaker. About 5 ml of the 4.5 M LiOH solution is then added slowly with vigorous stirring. Tris, 1.94 g, is added after hydroxylamine and guanidine-HC1 have completely dissolved and stirring continues until the solution becomes clear. The pH of the solution is then adjusted to 9.0 with 4.5 M LiOH and water is added to bring a final volume to 20 ml. (The
24 W. E. Savige and A. Fontana, this series, Vol. 47, p. 459. 25 L. Daya-Grossjean, J. Reinbolt, O. Pongs, and R. A. Garrett, F E B S Lett. 44, 253 (1974).
264
PROTEIN-RNA INTERACTIONS
[ 16]
high concentration of Tris in the solution is required to maintain steady pH of the solution during the incubation period.) Storage buffer, as in previous sections Asn-Gly peptide bond cleavage by hydroxylamine is performed by a modification of the procedure of Bornstein and Balian36 The lyophilized protein is dissolved in the reaction solution and the cleavage reaction is carried out at 45 ° for 2 hr. A large liquid volume is used for convenience of monitoring the pH of the solution, which is checked with a pH meter at intervals of 30 min and maintained at 9 by the addition of the LiOH solution. The reaction is terminated by the addition of 0.1 volume of glacial acetic acid and the sample is dialyzed overnight against 5% acetic acid. The cleavage products are lyophilized, then dissolved in storage buffer, and frozen till used. We have found that incubation for 2 hr is optimal for generation of biochemically active fragments although longer incubation (up to 4 hr) increases the efficiency of cleavage without the noticeable occurrence of nonspecific fragmentation.
Cyanogen Bromide Cleavageof Proteins Reagent Solutions Reaction solvent: 70% formic acid (0.795 dilution of 88% reagent) Cyanogen bromide stock(s): 1- 10 mg/ml cyanogen bromide (CNBr, obtained from Aldrich) in reaction solvent The general technique is to dissolve the protein, which has been lyophilized out of 5% acetic acid, in the reaction solvent, then to add various levels of CNBr stock and let the mixture react at room temperature. The reaction is stopped at various times by diluting five times with water and freezing, then lyophilizing. We routinely use 12- or 40-ml conical Pyrex tubes for these purposes, using 0.5 or 2 ml as a rea~ion volume. These are very convenient in terms of durability for freezing before lyophilization. The lyophilates are dissolved in storage buffer or a buffer required for a subsequent analysis. Previous work utilizing the CNBr technique has usually had the goal of generating fragments of a fixed size for use as molecular weight standards or to generate peptides for fingerprinting or sequence analysisY These have had no need to preserve the biological activity of the fragments obtained. The classical procedure for this technique has been to incubate the protein with a 5 to 250 times excess of CNBr to methionine residues in 26 p. Bornstein and G. Balian, this series, Vol. 47, p. 132. 27 E. Gross, this series, Vol. 11, p. 238.
[ 16]
RIBOSOMALPROTEIN FRAGMENTS THAT BIND rRNA
265
acid (usually either 700/0 formic acid or 0.1 MHC1) at room temperature or above for - 24 hr, ending the reaction by dilution and freeze-drying. These conditions were found to be unsatisfactory in generating r-protein fragments with rRNA-binding activity, and so the concentration and time of reaction were varied, with the resultant products being tested for any binding ability by rebinding and pelleting RNA complexes as described earlier. A third variable, the concentration of the acid in the reaction solvent, which was lowered in a previous s t u d y , 28 w a s not tested by us. We have found that the conditions that favor generation of fragments retaining biological activity yield only partial digestion of the protein. A further conundrum is that optimal conditions for one protein are not the same as those for another--that 2 hr at a 500: l ratio works for one protein and 30 min at 10: 1 is best for another. Each individual protein must be tested through several time-dosage combinations. Purification of F r a g m e n t s Purification of fragments is required after fragmentation of ribosomal proteins to separate the fragments from each other and from intact protein. On occasion, some enzymatic digestions yield only a single fragment of any appreciable size; this makes for an optimistic outlook on isolation of pure fragment, as only two components are involved--the fragment and the intact protein. The complexity of the fragment mixture increases geometrically with the number of possible cut sites, as none of the cleavages is t00% efficient, and all possible partial cleavage products arc generated. This is especially true for chemical cleavage because relatively short incubation times are used to prevent nonspecific cleavage and inactivation of functional fragments. In the past we have employed ion-exchange (CMcellulose) and gel filtration (Sephacryl S-200) column chromatography to purify ribosomal protein fragments. The introduction of reversed-phase high-performance liquid chromatography (HPLC) has added a further capability for purification, and we have recently begun to use commercially available C~8 HPLC (Synchropak RP-P) columns for this purpose. We have also started to modernize our ion-exchange system in terms of speed and efficiency (Bio-Rad SP-5-PW column). Separations of protein fragments with these columns are rapid and very convenient. A typical separation is shown in Fig. l with $4 and its larger hydroxylamine fragment on a Sephacryl S-200 column. The smaller fragment was separable on a Ct8 RP-HPLC c o l u m n . 14
2s H. J. Cahnmann, R. Arnon, and M. Sela, J. Biol. Chem. 240, PC2762 (1965).
a
A
B
$4-
-$4 - $ 4 fragment (I-124) - $ 4 fragment (125- 205)
b 0.8
E 0,6 OJ
U.I Z ,~ 0 . 4 ¢n n," 0 O0
B
P
0.2
L_
,
20
40
I
6O
8O
I00
I
120
\
f --
140
I
160
i,,,
I
180
200
FRACTION NUMBER FIG. 1. (a) SDS-polyacrylamide gel electrophoresis of $4 before (lane A) and after (lane B) hydroxylamine cleavage. (b) Separation of protein $4 and its larger hydroxylamine fragment (1 - 124) by a Sephacryl S-200 column. The column dimensions were 2.5 X 125 cm. The flow rate was 19 ml/hr and the volume of each fraction was 3.0 ml. The volume of the applied sample was 5.5 ml. From Changchien and CravenJ 4
[ 16]
RIBOSOMALPROTEIN FRAGMENTS THAT BIND rRNA
267
R e p r e s e n t a t i v e Results Historically, our work began by isolating a fragment of r-protein S4 (203 aa residues) produced by trypsin digestion of an $ 4 - 16S RNA complex? This fragment, which was missing its 46 N-terminal amino acid residues, retained the ability to specificaUy bind 16S rRNA, but lost the ability to assemble proteins S 1, $2, S 10, S 18, and $21 into a ribonucleoprotein (RNP) particle. We next utilized NTCB cleavage to cut off a smaller section (1 - 30) from the N-terminus of $4; this larger fragment regained the ability to assemble all proteins, but the particle so assembled was still deficient in tRNA binding. ~° Further work with $4 has shown that removing residues 168-203 leaves enough activity for complete assembly, but that the RNP particle produced is slightly less compact, having a sedimentation coefficient slightly lower (28S) than a reconstituted 30S standard. 12 In additional cutting off of the C-terminus of $4, a hydroxylamine cleavage at residues 124- 125 yielded an actively binding fragment.14 Figure 2 shows the binding isotherms for this fragment to 16S and 23S RNA. Complete investigation of this fragment is still proceeding, as is investigation of an even smaller piece generated by CNBr cleavage. An interesting result stemming from one experiment involved cleavage of S13 (117 aa residues) at its Cys-84 residue. ~3 In this case, the smaller (84- 117) fragment retained 16S RNA-specific binding ability but lost its ability to interact specifically with ribosomal protein S 19. The use of proteolytic enzyme digestion has proved to be useful for the study of particular proteins by our group and others. 9,~5,16 Intuitively, it may seem that this approach would be much better in terms of defining the "minimum RNA-binding region," in much the same way nucleolytic enzymes can be used to define a protein "footprint" on bound RNA or DNA. The analogy is not strictly applicable, since the folding of polypeptide chains is not analogous to the base-pairing and hai~in-looping of nucleic acids. If the domains of various functions are folded from regions separated in the primary sequence, these domains can be cleaved from one another, but with some proteins it is possible that a cut away from the active site of that protein will destabilize the conformation of the rest. Because of this, digestion of accessible parts of a bound protein can destroy the binding ability of the remainder of that protein, releasing it to free solution. Upon isolation of the complex, no fragments are observable in the protein extract, even though the protein of interest is being digested away. In addition to this, occasionally the compactness of a particular protein- RNA complex sterically blocks the action of a particular protease. This problem can in some cases be alleviated by partially denaturing the complexes with urea at a low level. Figure 3 demonstrates some cleavages
268
PROTEIN- R N A INTERACTIONS
[ 16]
A
I/5 i 1.0 ~C
2
0.8
4
Z
tr O~
12
16x IOI M "l
V[A]
0.6
13
(D iii ..J
8
U
'"
0.4
0
0.2 E~ Z
0
m
B
Z UJ
1.0
0
rr a.
0.8
O0 uJ ..J
0.6
0
04 0.2
t
2
3
4
5
6
7
8
9
MOLES PROTEIN / MOLES RNA IN RECONSTITUTION FxG. 2. Binding isotherms of hydroxylamine cleavage products of protein $4 to 16S RNA and 23S RNA. The binding studies of protein $4 fragment 1 - 124 to 16S RNA (O) and to 23S RNA (A) are illustrated in A. The insert in A is a double reciprocal plot of the binding data to 16S RNA. (B) The binding data for protein $4 fragment 125-203. From Changchien and Craven. 14
generated by three enzymes on protein $4 in complex with 16S RNA, each for 90 and 180 min. As observed, the action of each protease is different from the other two, not only in terms of fragments generated, but in terms of the course of digestion as well, due to their widely varying specificities. All the major fragments (molecular weights range from 22,500 to 14,400) have strong binding activity for 16S RNA. The use of CNBr on several different proteins has yielded diverse conditions and results. For example, the cleavage of $7 with CNBr, using
[ 16]
RIBOSOMAL PROTEIN FRAGMENTS THAT BIND r R N A
269
ABCDEFGHI
FIG. 3. SDS-polyacrylamide gels of reconstituted 16S RNA-protein S4 complex after treatment with different proteolytic enzymes. 16S RNA-protein $4 complex (complex) was digested with trypsin (complex : enzyme -- 10: 1), chymotrypsin (complex: enzyme = 5: l), or proteinase K (complex: enzyme = 5 : 1) in reconstitution buffer for different periods of time at 28 °. The digestion was terminated by the addition of inhibitor, and complexes were isolated as described in the text. Lane A, mixture of marker proteins; Lane B, complex; Lane C, complex treated with trypsin for 90 rain; Lane D, complex treated with trypsin for 180 min; Lane E, complex treated with chymotrypsin for 90 rain; Lane F, complex treated with chymotrypsin for 180 rain; Lane G, complex treated with proteinase K for 90 rain; Lane H, complex treated with proteinase K for 180 rain; Lane I, marker proteins. Marker proteins are ovalbumin (MW 43,000), carbonate dehydratase (MW 29,000), soybean trypsin inhibitor (MW21,000), myoglobin (MWI7,200), lactalbumin (MWI4,200), and aprotinin (MW 6,512). an extremely short cleavage time, with a fairly low level o f C N B r : M e t residues (30 m i n at - 5 : 1) has p r o d u c e d several b i n d i n g fragments. L o n g e r exposure, even for 1 hr, does n o t increase the absolute yield o f " a c t i v e " fragments, a l t h o u g h it does reduce the a m o u n t o f larger fragments; while increasing the level o f C N B r 5- o r 1 0 - f o l d is disastrous, yielding n o active
270
PROTEIN- RNA INTERACTIONS
[ 17]
fragments. Application of this cleavage technique to protein $4 requires the use of a high ratio of CNBr : Met (> 500: 1) and a 2-hr reaction period to yield a high percentage of a complete cleavage product which is still active in binding. Activity is lost with the extension of reaction time beyond this point.
[ 17] I s o l a t i o n o f K i n e t i c I n t e r m e d i a t e s in in Vitro Assembly of the Escherichia coli Ribosome Using Cibacron Blue F3GA By DIPAK B. DATTA, LI-MING CHANGCHIEN, and GARY R. CRAVEN In vitro self-assembly of a functional subcellular structure from its dissociated components has been commonly used to elucidate the probable pathway by which the structure assembles in vivo. For a complex structure such as the Escherichia coli ribosome which contains 3 species of RNA and more than 50 different proteins, the study of such an assembly mechanism has been especially intriguing. To elucidate the details of the assembly process several different approaches have been taken. For example, single components have been omitted from the assembly mixture~; assembly with chemically modified proteins 2 or ribosomal RNAs 3 (rRNAs) has been attempted; accessibility of proteins in partially assembled particles to chemical modifying agents has been studied4; and thermodynamic intermediates in the assembly process have been isolatedJ ,5 In all these cases, the assembly intermediates are thermodynamically stable particles which do not provide any clear picture of the kinetic order of addition of the proteins to the growing particle. If we are to gain further insight into the mechanism of ribosome assembly, we must develop techniques which will permit the isolation of many more intermediate particles in the kinetic pathway of assembly. We have therefore sought chemical reagents that might block the addition of proteins to rRNA during in vitro ribosome assembly. We reasoned that, as
M. Nomura and W. A. Held, in "Ribosomes"(M. Nomura, A. Tissieres,and P. Lengyel, eds.), p. 193.Cold Spring Harbor Lab., Cold Spring Harbor, New York, 1974. 2L. Daya-Grojean,J. Reinbolt, O. Pongs, and R. A. Crarr~, FEBSLett. 44, 253 (1974). 3p. L. Schendeland G. R. Craven, NucleicAcids Res. 3, 3001 (1976). 4L.-M. Changchien and G. R. Craven, J. Mol. Biol. 113, 103 (1977). 5K. H. Nierhaus, in "Ribosomes:Structure, Function and Genetics" (G. Chambliss, G. R. Craven, J. Davies, K. Davis, L. Kahan, and M. Nomura, cds.), p. 267. University Park Press, Baltimore, Maryland, 1980. METHODS IN ENZYMOLOGY, VOL. 164
Copyright © 1988 by Academic Press, Inc. All fights ofteproducdon in any form reserved.
270
PROTEIN- RNA INTERACTIONS
[ 17]
fragments. Application of this cleavage technique to protein $4 requires the use of a high ratio of CNBr : Met (> 500: 1) and a 2-hr reaction period to yield a high percentage of a complete cleavage product which is still active in binding. Activity is lost with the extension of reaction time beyond this point.
[ 17] I s o l a t i o n o f K i n e t i c I n t e r m e d i a t e s in in Vitro Assembly of the Escherichia coli Ribosome Using Cibacron Blue F3GA By DIPAK B. DATTA, LI-MING CHANGCHIEN, and GARY R. CRAVEN In vitro self-assembly of a functional subcellular structure from its dissociated components has been commonly used to elucidate the probable pathway by which the structure assembles in vivo. For a complex structure such as the Escherichia coli ribosome which contains 3 species of RNA and more than 50 different proteins, the study of such an assembly mechanism has been especially intriguing. To elucidate the details of the assembly process several different approaches have been taken. For example, single components have been omitted from the assembly mixture~; assembly with chemically modified proteins 2 or ribosomal RNAs 3 (rRNAs) has been attempted; accessibility of proteins in partially assembled particles to chemical modifying agents has been studied4; and thermodynamic intermediates in the assembly process have been isolatedJ ,5 In all these cases, the assembly intermediates are thermodynamically stable particles which do not provide any clear picture of the kinetic order of addition of the proteins to the growing particle. If we are to gain further insight into the mechanism of ribosome assembly, we must develop techniques which will permit the isolation of many more intermediate particles in the kinetic pathway of assembly. We have therefore sought chemical reagents that might block the addition of proteins to rRNA during in vitro ribosome assembly. We reasoned that, as
M. Nomura and W. A. Held, in "Ribosomes"(M. Nomura, A. Tissieres,and P. Lengyel, eds.), p. 193.Cold Spring Harbor Lab., Cold Spring Harbor, New York, 1974. 2L. Daya-Grojean,J. Reinbolt, O. Pongs, and R. A. Crarr~, FEBSLett. 44, 253 (1974). 3p. L. Schendeland G. R. Craven, NucleicAcids Res. 3, 3001 (1976). 4L.-M. Changchien and G. R. Craven, J. Mol. Biol. 113, 103 (1977). 5K. H. Nierhaus, in "Ribosomes:Structure, Function and Genetics" (G. Chambliss, G. R. Craven, J. Davies, K. Davis, L. Kahan, and M. Nomura, cds.), p. 267. University Park Press, Baltimore, Maryland, 1980. METHODS IN ENZYMOLOGY, VOL. 164
Copyright © 1988 by Academic Press, Inc. All fights ofteproducdon in any form reserved.
[17]
TEMPORAL SEQUENCE OF RIBOSOMAL ASSEMBLY
271
S03H
~ L\
03H
'[
'1 0
.I HN
SO3H
N N
( CI
FIo. 1. A planar diagram of the molecular structure of Cibacron Blue F3GA. From left to right there are four parts in the molecule: the sulfonated anthraquinone, the sulfonated benzene, the triazine ring containing the active chlorine, and the terminal sulfonated benzene.
about half of the ribosomal proteins can directly bind the appropriate rRNA, there might be a set of rules followed by all or most of them for associating with the developing protein-RNA complex during assembly. We therefore looked for a generalized inhibitor of protein-RNA interactions. This search led us to investigate the triazine dye Cibacron Blue F3GA as a potential candidate for such an inhibitor. Cibacron Blue F3GA is a complex sulfonated aromatic dye (see Fig. l) that has been found to bind to a large number of nucleotide-binding enzymes.6 This observation has led to the development of the method of dye-ligand affinity chromatography for the purification of enzymes of the kinase, oxidoreductase, synthetase, and transferase classes. These enzymes will bind to a column of agarose or Sepharose that has been chemically bonded with Cibacron Blue; most of them can be eluted with a very low concentration of their respective nucleotide cofactors or with salts at high ionic strength. There is substantial evidence that the dye specifically binds to a domain on the protein called the "dinucleotide fold. ''7 The high flexibility of the structure of the dye molecule probably helps it mimic the structures of different nucleotides and reinforces its binding to the dinucleotide fold of the proteins. Using a column of Cibacron Blue-bound agarose, we have shown that all E. coli ribosomal proteins, when free in solution, bind to the column even in the presence of the high salt concentrations in the reconstitution buffers used in these experiments. We have also shown that when the proteins are part of ribosomes, they do not bind to the column under 6 p. Dean and D. Watson, J. Chromatogr. 165, 301 (1979). E. Stellwagon, R. Cass, S. Thompson, and M. Woody, Nature (London) 257, 716 (1975).
272
PROTEIN-RNA INTERACTIONS
[ 17]
comparable conditions--and that ribosomes are mostly excluded from such a column) In light of these observations, we correctly reasoned that the free dye might inhibit in vitro ribosome assembly if it were prebound to the proteins. Using the following methodology, we discovered some kinetic intermediates in the 30S and 50S ribosome assembly. Preparation of Materials Solutions RB-30 (reconstitution buffer for 30S ribosomal subunits): 30 m M Tris-HCl (pH7.6), 0.33M KC1, 20raM magnesium acetate, 0.5 m M dithiothreitol (DTT) RB-30K: 30 m M Tris-HCl (pH 7.6), 0.5 M KC1, 20 m M magnesium acetate, 0.5 m M DTT RB-30N: 30 m M Tris-HC1 (pH 7.6), 20 m M magnesium acetate, 0.5 m M DTT RB-50 (reconstitution buffer for 50S ribosomal subunits): 20 m M Tris-HC1 (pH 7.4), 0.4 M NH4C1, 4 m M magnesium acetate, 0.5 m M DTT TM: 10 m M Tris-HC1 (pH 7.5), 10 m M magnesium acetate TM-4:l0 m M Tris-HC1 (pH 7.5), 4 m M magnesium acetate Cibacron Blue Stock Solution. A 13.33 m M solution of Cibacron Blue F3GA (Pierce & Co.) is incubated with a 10-fold molar excess of lysine in 20 m M Tris-HC1 (pH 7.5) at 44 ° for l hr for covalent modification of the dye at the site of its C1- component. Unmodified dye may covalently react with lysine groups at its binding site in the proteins. Alternatively Cibacron Blue-C1 can be hydrolyzed to Cibacron Blue-OH by NaOH treatment at 60 ° as described by Moe and Piszkiewicz. 9 Free Cibacron Blue (-C1 or - O H ) , although soluble in water, is not dialyzable in purely aqueous solutions. To facilitate future studies on dye-protein-binding properties, we tested solutions of various organic solvents in water for their effects on dialyzability of the dye. A solution of 250/0 (v/v) dioxane in water was found to give a reasonably good rate of dialysis of the dye. Therefore the aqueous solution of the dye to be used as a stock solution is made 25% in dioxane. The stock solution contains 10 m M Cibacron Blue, 250/0(v/v)dioxane, 20 m M Tris-HC1 (pH 7.5)(and 100 m M lysine if applicable). The final concentration of dioxane in the a D. Datta, L.-M. Changchien, and G. R. Craven, Nucleic Acids Res. 14, 4095 (1986). 9 j. G. Moe and D. Hszkiewicz, Biochemistry 18, 2810 (1979).
[17]
TEMPORAL SEQUENCE OF RIBOSOMAL ASSEMBLY
273
reaction mixtures has no effect on ribosome rcconstitution? ° Freshly prepared dye solution is always used. Ribosomal Subunits. The 70S ribosomes and their subunits are prepared following the procedures of Craven and Gupta, ~ and stored in TM at --70 ° . 30S Proteins. Total protein (TP-30) is extracted from the 30S ribosomes with acetic acid, ~2 then dialyzed sequentially against solutions of 30 m M Tris (unneutralized), 3 M urea, 0.5 m M DTT and 20 m M TrisHC1 (pH 8), 6 M urea, 0.5 m M DTT. It is stored in the latter solution at - 7 0 °" 50S Proteins. Total protein (TP-50) is extracted from the 50S ribosomes with acetic acid as in the TP-30 preparation; the rest of the procedure of TP-50 preparation follows the method ofNowotny et al.13 Proteins are stored in RB-50 at - 7 0 ° in aliquots. Ribosomal RNAs. 16S RNA is prepared by phenol extraction of 30S ribosomes. ~4 For preparation of intact 23S RNA, it is necessary to deproteinize 70S ribosomes with phenol and to isolate the 23S RNA by two successive preparative bentonite-treated sucrose gradient centrifugations. Pure 23S RNA from the appropriate peak fractions of the second centrifugation is precipitated by ethanol and dissolved in TM-4. 5S RNA is prepared by the method of Erdmann and Doberer? 5 All RNA solutions are stored in TM-4 at - 7 0 °. Procedures
Method of Reconstitution Prior to reconstitution experiments, the TP-30 solution is dialyzed against RB-30K buffer. The high-salt concentration of this buffer prevents precipitation of proteins when urea is removed. The dialyzed TP-30 is then diluted with RB-30N buffer to bring the KC1 concentration down to the normal level of 0.33 M. The RNAs and proteins are taken separately in 1.5 ml each of the appropriate reconstitution buffer. The RNA solution is heated to 42 ° for 10 rain and cooled to 0 ° before use. For the 30S reconstitution system, 80D26o units of 16S RNA are taken against 2.40D23o units ~0M. A. Cantrell, Ph.D. thesis. University of Wisconsin, Madison, 1977. i1 G. R. Craven and V. Gupta, Proc. Natl. Acad. Sci. U.S.A. 63, 1329 (1970). ~2S. Y. S. Hardy, C. G. Kurland, P. Voynow, and G. Mora, Biochemistry 8, 2897 (1969). ~3V. Nowotny, H.-J. Rheinberger, K. Nierhans, B. Tesche, and R. Amils, Nucleic Acids Res. 8, 989 (1980). 14 p. Traub, S. Mizushima, C. V. Lowry, and M. Nomura, this series, Vol. 20, p. 391. 15 V. A. Erdmann and H. G. Doberer, Mol. Gen. Genet. 114, 89 (1971).
274
PROTEIN- RNA INTERACTIONS
[ 17]
of TP-30. For the 50S reconstitution system, 8 OD26o units of a 1 : 1 mixture of 23S and 5S RNAs are taken against 2 OI)23o units of TP-50. The RNA: protein ratio in both systems is 1 : 2. To slow down the rate of self-assembly all experiments are performed at 0 °. The mixtures are incubated for 1 hr and then cleared by centrifugation at 10,000 g for 20 min in a Beckman JA-20 rotor. The RNA-protein complexes are pelleted by ultracentrifugation through a 15-ml cushion of 12% sucrose in appropriate reconstitution buffer at 100,000 g for 17 hr in a Beckman Type 50.2 Ti rotor.
Electrophoretic Analysis RNA-protein pellets are taken up in 100/zl of a solution of 10 m M Tris-HC1 (pH 7.5), 1 m M etl~ylenediaminetetraacetic acid, 8 M Urea, 0.5 m M DTT, treated with RNase, and analyzed for proteins by polyacrylamide gel electrophoresis (PAGE). One-dimensional PAGE is performed following the method of Voynow and Kurland.~6 Two-dimensional PAGE is performed as previously reported ~7 except that a small-sized gel (0.2 i.d. × 12.7 cm) is used in the first dimension and the thickness of the second-dimensional gel is 0.15 cm. Is
Inhibitory Molar Ratio of Dye: Ribosomal Proteins A series of experiments was done with increasing ratios of dye: proteins. Cibacron Blue was added to a solution of proteins in reconstitution buffer in appropriate aliquots, immediately followed by addition of the appropriate RNAs. Reconstitution was allowed to proceed for 1 hr. Unassembled protein:dye complexes were found to tend to aggregate; the low-speed centrifugation (described above) was essential to remove these. Any remaining such complexes, especially at high concentrations of Cibacron Blue, formed a blue ring around the RNA-protein pellet following ultracentrifugation. This ring was carefully removed with a swab stick. The RNA-protein pellets were analyzed for proteins by one-dimensional PAGE. Some typical results are shown in Fig. 2. It clearly shows that at the moderate dye:protein molar ratios of 40:1 to 100:1, all proteins are prevented from incorporation into a ribonucleoprotein complex. The corresponding dye:RNA ratios are 80:1 to 200:1. The proteins with the highest affinity for their respective RNAs compared to their affinity for the dye are $8, L1, and L24. 16p. Voynow and C. G. Kurland, Biochemistry 10, 517 (1971). 17L.-M. Changchien and G. R. Craven, J. Mol. Biol. 125, 43 (1978). ~8A. Lin, E. Collatz, and I. G. Wool, Mol. Gen. Genet. 144, 1 (1976).
[17]
275
TEMPORAL SEQUENCE OF RIBOSOMAL ASSEMBLY
SS, S9, SI2, SI4,: SI6,
sfe~
TP-50
0
II
21
52
57
42
47
55
105
MOLES DYE / MOLES TP-50 PROTEIN FIG. 2. One-dimensional PAGE analysis of 30S reconstitution intermediates formed in the presence of Cibacron Blue. T P - 30 proteins were treated with the dye at the dye: protein
molar ratio shown, immediately followed by the addition of 16S RNA, all at 0". The RNA-protein complexeswere isolated and analyzed as describedin the text. From Datta et al.s
Temporal Sequence of Ribosome Assembly From the above experiments, the minimum dye:protein molar ratio required to inhibit most proteins from assembly into ribosomes is found to be 50: 1. Subsequently the dye is used at this ratio to inhibit assembly at desired time points. A series of reconstitution mixtures is made and the dye added to the mixtures at various times after R N A - p r o t e i n mixing. The R N A - p r o t e i n complexes are isolated as described above. (The R N A protein pellets have a faint blue coloration especially at longer times of incubation.) Typical two-dimensional analyses for the 50S reconstitution system are shown in Fig. 3. The gels clearly show a time-dependent appearance of proteins in the intermediate particles. From a large number of such analyses, a kinetic sequence of ribosome assembly can be constructed. Our construction of such assembly sequences for E. coli 30S and 50S ribosome reconstitutions is shown in Fig. 4.
Possible Protein-Stripping Effect on Preformed Particles A possible pitfall in the use of Cibacron Blue as the inhibitor of ribosome assembly is that at relatively high concentrations it may start strip-
276
[ 17]
PROTEIN- RNA INTERACTIONS
8M Urea, pH 4.5
)
SDS pH7.1
FIo. 3. Two-dimensional PAGE analysis of 50S reconstitution intermediates isolated following addition of Cibacron Blue at different times during assembly. For the 0 time experiment, the dye was added to the proteins immediately prior to the addition of the RNA. A dye: protein molar ratio of 50 : l was used. From Datta et al.S
[17]
TEMPORAL SEQUENCE OF RIBOSOMALASSEMBLY 30S
ASSEMBLY,(7'
[ S8 $4 S5 S6 SIS ]
50S ASSEMBLY,O* STAGE I
<2
[s7sg/sIIst3sIBs,7 SZOI
[LI L24L$ LIO LII L7 LI2 L23 I
<2
STAGE2
[L9 LIBLtSLm I
<2
<2
<2
<2
[s2s3s,os,,,2]
277
sTAoE4 [L'L"L,L91L22L2L2,L29L2]
Fro. 4. Proposedtemporal sequenceof 30S and 50S ribosomeassembly. From Datta et al. 8
ping some proteins off the ribonucleoprotein particles. To determine the extent of this effect, a series of experiments was done in which the ribosomes, or more appropriately the RI (reconstitution intermediate) particles, in their appropriate reconstitution buffers, were treated with increasing concentrations of the dye at the same dye: protein molar ratios as used to find the effective ratio for assembly inhibition. For 30S ribosomes a ratio up to 50:1 does not show any significant stripping effect. For 50S ribosomes much higher ratios have no stripping effect. The RI particles of both 30S and 50S systems show resistance to protein stripping up to ratios of greater than 50: I. Therefore a dye: protein molar ratio of about 50: 1 can be safely used to inhibit i n v i t r o ribosome assembly and isolate the kinetic intermediates. Concluding R e m a r k s A judicious use of Cibacron Blue F3GA can make it a simple and valuable tool in isolating kinetic intermediates in the assembly pathway of ribosomes and other systems where interactions between a nucleic acid and multiple proteins are involved. The isolation and analysis of such intermedimes should further our understanding of biological assembly mechanisms.
278
PROTEIN-RNA INTERACTIONS
[18]
[18] T o t a l R e c o n s t i t u t i o n o f 7 0 S R i b o s o m e s f r o m Escherichia coli B y R O L F LIETZKE a n d I ~ U D
H. NIERHAUS
Ribosomes consist of two subunits, both of which can be reconstituted from their separated ribosomal RNA and r-protein moieties to fully active subunits in vitro. 1,2 The conditions for the total reconstitution of the 30S and 50S subunits, respectively, are different despite the evidence from in vivo studies which favors cooperative processes 3 probably caused by common genetic control. However, at least the 50S assembly does not seem to be coupled to that of the 30S subunit via a feedback inhibition, since a severe assembly defect of the 50S subunit does not hamper the 30S assembly in vivo. 4 For the study of possible interdependences between the assemblies of both subunits as well as for structural and functional analyses (e.g., neutron scattering) a method is desirable which allows the total reconstitution of both subunits in one test tube. Here we describe the total reconstitution of the 70S ribosome from Escherichia coli. Assembly interdependences of the subunits could not be observed, but cannot yet be strictly excluded. In the two-step incubation procedure the assembly of the 30S subunit occurs completely in the first step, whereas the 50S reconstitution requires the conditions of the second step in addition. Two counteracting effects determined the reconstitution optimum for 70S ribosomes in the second step: On one hand the temperature sensitivity of the reconstituted 30S particles, on the other hand the temperature and Mg2+ requirements of the 50S reconstitution. The superposition of both effects yields the optimal conditions for the 70S reconstitution. The conditions are identical to those of the 50S reconstitution except that the incubation temperature of the second step is reduced from 50 ° to 47 °. Furthermore, TP70 (total protein from 70S ribosomes) from tightly coupled ribosomes should be used rather than a TP70 preparation derived from crude 70S ribosomes. The reconstitution efficiency for 70S ribosomes is 60 to 85%.
P. Traub and M. Nomura, J. MoL Biol. 40, 391 (1969). 2 F. Dohme and K. H. Nierhaus, J. MoL BioL 107, 585 (1976). 3 H. Nashimoto and M. Nomura, Proc. Natl. Acad. Sci. U.S.A. 67, 1440 (1970). 4 M. Herold, V. Nowotny, E. R. Dabbs, and K. H. Nierhaus, Mol. Gen. Genet. 203, 281 (1986). METHODS IN ENZYMOLOGY, VOL. 164
Copyright© 1988by AcademicPress.Inc. All riots ofreproduedonin any form reserved.
[18]
TOTAL RECONSTITLITION OF 70S RIBOSOMES
279
P a r a m e t e r s Influencing Total Reconstitution of 70S Ribosomes The 50S reconstitution is studied in Table I (experiment l) in the presence of 30S components. Comparison of assay 1 with the control (assay 5) reveals that the additional presence of 16S rRNA does not affect the 50S reconstitution (78% activity in both cases). In contrast, equimolar amounts of TP70 derived from crude 70S ribosomes yielded only marginal activity (6%, assay 2), which could be increased to 36% by increasing the TP70 amounts (assay 3). A further increase in the amount of TP70 had a detrimental effect on the 50S reconstitution (not shown). Interestingly, the equivalent activity was found even when no native 30S subunits were added to the poly(Phe)-synthesizing system (34%, assay 4). This is a first indication that, in principle, the total reconstitution of 70S ribosomes is possible. Surprisingly, the total reconstitution of 70S ribosomes could be increased significantly if(TP50 + TP30) were used instead of TP70 (Table I, experiment 2; compare assays 1 and 2). The use of (23S + 5S + 16S) rRNA derived from subunits yields reconstitution efficiencies equivalent to that of the total rRNA (TrRNA). Furthermore, the reconstitution of 30S subunits already occurs in the first step of two-step procedure (assay 3). As in the 50S case, the 30S assembly is not affected by the additional presence of (23S + 5S) rRNA (compare assays 6 and 4), whereas the additional presence of TPS0 clearly impairs the 30S assembly (assays 6 and 5). The TP50-induced inhibition is nullified by the simultaneous presence of (23S + 5S) rRNA (assays 5 and 3). The improved reconstitution efficiency of (TPS0 + TP30) over crude TP70 could be due to impurities (RNases, etc.) in the crude TP70 preparation, since the 70S pellet obtained from the $30 crude extract 5 has a green color (membrane debris), whereas the pelleted subunits derived from the pooled fractions of a zonal run (sucrose gradient 6 to 37%) 5 are transparent and colorless. Therefore, we tried a TP70 preparation from tightly coupled ribosomes which had been subjected to two successive zonal runs. 6 Figure 1 demonstrates that excellent activities were obtained with TrRNA and TP70 from tightly coupled ribosomes, and equimolar amounts of TP70 to TrRNA are optimal. Finally, we determined the optimal Mg2+ concentration and incubation temperature in the second step for 70S reconstitution. Therefore, a mixture of TrRNA, TP30, and TPS0 was subjected to a standard 1-step incubation (4 m M M g 2+, 400 m M N H 4 +, 20 min at 44°). Then the Mg 2+ concentraK. H. Nierhaus and F. Dohme, this series, Vol. 59, p. 443. 6 H.-J. Rheinberger, U. Geigenmffller, and K. H. Nierhaus, this volume [45].
9~
C~
D~
÷
z
÷+1111
f~
÷
0
f-
E~
÷÷÷~÷
0
÷
÷
°° 0
.°
++1+1
..
,.
÷÷÷
÷
r~ ~Q t~ r~
Jr
÷
+~
+++
C3
~
8 Z
Jr
÷÷÷÷~
8
I.i
~f~ 8
<
~b
~J
[18]
TOTAL RECONSTITUTIONOF 70S RIBOSOMES
281
o
cx_ >.
I
,
1
0.5 1.5 TP70 (equivalentunits} FIo. 1. Optimization of TP70 for the total reconstitution of 70S ribosomes. The standard two-step procedure for 50S reeonstitution was used. 2 TrRNA, 3.75 A260 units, was incubated with the indicated amounts of TP70 and tested for poly(Phe)-synthesis activity as described. 7 Both TrRNA and TP70 were derived from tightly coupled ribosomes. One equivalent unit is the amount of TP70 extracted from 1 Azro unit of 70S ribosomes.
tion was increased to 10.5, 13.5, 17, or 20 m M and a second incubation followed at various temperatures from 37 to 55 ° for 90 min (Fig. 2). Before measuring the poly(Phe)-synthesizing activity at 20 ° for 60 min, all assays were adjusted to 20 m M Mg 2+. Figure 2A shows the eti~ciency of the 70S reconstitution. When an excess of native 50S subunits is added to the poly(Phe)-synthesizing system the 30S reconstitution is measured (Fig. 2B) and vice versa (Fig. 2C). Figure 2D depicts a control reconstitution of 50S subunits from TP50 and (23S + 5S) rRNA. All curves have a pronounced maximum except in Fig. 2B where the activity is independent of both the chosen Mg 2+ concentrations and the temperatures up to 44*. Above that temperature, the activity decreases thus showing the instability of the reconstituted 30S subunits at elevated temperatures. Between 13 and 20 m M the Mg 2+ concentrations hardly affect the 50S reconstitution (Fig. 2C). Here the temperature optimum is 50 °, the same as in the standard system (Fig. 2D). In contrast, the reconstitution of 70S ribosomes [Fig. 2A, no addition of native subunits to the poly(Phe)-synthesizing system] shows a marked optimum at 47 ° and a nearly symmetrical shape of the curve. The shape
282
PROTEIN- R N A INTERACTIONS
A 70S reconstitutJon
~
G N
B +50S:30S reconstJtution
i
i
L
I
[ 18]
C +30S:SOSreconstitution
I
~ control: SOSreconstitution F" measurecl/computecl 70S reconstitution
37
td
~/~ ~7 50
SS 37 td t~/~ /~7 SO SS tempePQture of the se¢0ndstep [°C]
FIG. 2. Mg2+ and temperature dependence of the total reconstitution of 70S ribosomes (A) and its subunits (B and C) in the second step. A 100-/d aliquot contained 3.75 A26ounits of TrRNA and equimolar amounts of (TP50 + TP30). After the two-step reconstitution, 2 × 40/tl [containing 1 A26o unit of (23S + 5S) rRNA and 0.5 ATx,o unit of 16S rRNA] were tested for poly(Phe) synthesis (60 rain at 20*). The Mg2+ concentrations in the second step were 10.5 (O), 13.5 (A), 17 ~ and 20 mM (0). (B) Test for the active 30S subunits formed; it is the same as A except that 1 A26ounit of native 50S subunits was added to the poly(Phe)synthesizing system. (C) Test for active 50S subunits formed; it is the same as A except that 1 A:6o unit of native 30S subunits was added to the poly(Ph¢)-synthesizing system. (D) Control reconstitution of 50S subunits from (23S + 5S) rRNA and TPS0. (E) 20 m M Mgz+ curve from A (It) and a 70S formation curve ((3) calculated from the 20 m M curves of B and C. For further details see text.
can be easily explained by superimposing the curves of Fig. 2B and C. The synthesis of a polypeptide requires both subunits. If, for example, only 40% of the input material of one subunit is assembled to native particles and 100% of that of the other, the measured activity cannot surmount 40%. Furthermore, if an inactive fraction of one subunit is formed which nevertheless can associate with the complementary one, then the relative amounts of the active subunits formed have to be multiplied in order to obtain the relative amount of protein-synthesizing 70S ribosomes. This has been done in Fig. 2E: The maximal value of the 30S curves is set at "1," and the smaller values are set at proportionally smaller numbers. These numbers are multiplied with the corresponding cpm values of the 20 m M Mg 2+ curve in Fig. 2C, and we obtain a curve (Fig. 2E, open circles) which is very similar to the measured one (closed circles).
[18]
TOTAL RECONSTITUTION OF 70S RIBOSOMES
283
Materials and Procedure for the Total Reconstitution of 70S Ribosomes
Materials Tightly coupled 70S ribosomes: Isolation from Escherichia coli K12, strain A 19 or D 10, as described6 30S and 50S ribosomal subunits: Isolation according to Nierhaus and Dohme5 16S rRNA, (23S + 5S) rRNA, and TrRNA in T~0M4 buffer: Isolation as described for (23S + 5S) rRNA 5 TP30, TP50, and TP70 in Rec4 buffer: Isolation as described for protonated TP507 T~oM4 buffer: 10 m M Tris-HC1, pH 7.5, 4 m M magnesium acetate Rec4 buffer: 20 m M Tris-HCl, pH 7.5, 4 m M magnesium acetate, 400 m M NH4CI, 2 mM 2-mercaptoethanol, 0.2 m M ethylenediaminetetraacetic acid (EDTA) Rec20 buffer: Same as Rec4 except 20 mM magnesium acetate and 1 mM EDTA Rec4 adaptation buffer: 110 mMTris-HC1, pH 7.5, 4 mMmagnesium acetate, 0.2 mM EDTA, 4 M NH4CI, 2 m M 2-mercaptoethanol
Procedure. The preparation procedures of the ribosomal materials used in this paper are referenced above. In the following we describe the reconstitution of 70S ribosomes from TrRNA and TP70. It is important to isolate TP70 from tightly coupled ribosomes which have been subjected twice to a zonal centrifugation.6 TrRNA, 3.75 A26ounits in TioM4 buffer, is mixed with 0.1 volume of the Rec4 adaptation buffer to achieve the ionic milieu of the Rec4 buffer. Then Rec4 buffer and optimal amounts of TP70 (usually equimolar amounts) in Rec4 buffer are added to a final volume of 100 pl. After the first-step incubation (20 min at 44°), 4/tl of 0.4 M magnesium acetate is added, which raises the Mg2+ concentration to 20 mM, and this is followed by the second-step incubation (at least 90 min at 47°). Two 40-pl aliquots per reconstitution assay are transferred to the poly(Phe)-synthesizing system 7 without adding native subunits (unless there are special reasons, e.g., Fig. 2B and C). In the experiment reported here, the incubation for the poly(Phe) synthesis was performed at 20 ° for 60 rain instead of the normal conditions of 37 ° for 45 min in order to prevent heat-dependent assembly events during the incubation for the poly(Phe) synthesis. The efficiency of the 70S reconstitution is 60 to 85%, i.e., 60 to 85% of the input material forms active 70S ribosomes as compared to native 70S ribosomes. 7 p. Nowotny, V. Nowotny, H. Voss, and K. H. Nierhaus, this volume [8].
[ 19]
INTRA-RNA AND R N A - PROTEIN CROSS-LINKING
[ 19] I n t r a - R N A Techniques
287
and RNA-Protein Cross-Linking i n E s c h e r i c h i a coli R i b o s o m e s
By R I C H A R D
BRIMACOMBE, W O L F G A N G STIEGE, APOSTOLOS KYRIATSOULIS, and PETER M A L Y
Cross-linking techniques offer a direct approach for the determination of neighborhoods between the various components of complex macromolecular systems. In our laboratory we have for some years been engaged in the development of such techniques for application to the study of Escherichia coli ribosome structure, and, in this article, we describe the methods which we are currently using both for the determination of neighborhoods between different regions of the ribosomal RNA (intra-RNA cross-linking) as well as for establishing contacts between the RNA and individual ribosomal proteins (RNA-protein cross-linking). Since the usefulness of the data is proportional to the degree of precision with which the sites of cross-linking can be localized, we set ourselves from the outset the goal of analyzing cross-link sites at the nucleotide level on the ribosomal RNA. In both types of cross-linking study (intra-RNA and RNA-protein), it was the development of techniques for the isolation of cross-linked complexes appropriate for this purpose which proved to be the most difficult problem far more time-consuming than for instance the search for suitable crosslinking reagents m and we will devote a corresponding amount of discussion to a description of these techniques. Before beginning, however, it is necessary to summarize very briefly some general considerations (see Refs. 1 and 2 for a more detailed discussion) which have a direct influence on the experimental strategies that can be applied in cross-linking studies of this nature. The analysis of a cross-link site on the ribosomal RNA involves at some stage a partial nuclease digestion procedure to generate RNA fragments containing the various cross-links, and this is followed by some kind of RNA sequence determination on the individual isolated cross-linked complexes. If the cross-link site analysis is to be pursued unambiguously to the nucleotide level, then the cross-links must be left intact throughout the whole experimental procedure. In other words, an irreversible cross-linking mR. Brimacombe, J. Atmadja, A. Kyriatsoulis, and W. Stiege, in "Structure, Function and Genetics of Ribosomes" (B. Hardesty and G. Kramer, eds.), p. 184. Springer-Verlag, Berlin, Federal Republic of Germany, 1986. 2 R. Brimacombe, in "3-D Structure and Dynamics of RNA" (P. H. van Knippenberg and C. W. Hilbers, eds.), p. 239. Plenum, London, 1986. METHODSIN ENZYMOLOGY,VOL. 164
Copyright© 1988by AcademicPress,Inc. Allrightsof reproductionin any formreserved.
288
CROSS-LINKING AND AFFINITY-LABELING METHODS
[ 19]
agent is required. This in turn implies, however, that conventional end-labeling techniques for the subsequent analysis of the RNA are precluded, at least in the case of intra-RNA cross-linking experiments. Here, the isolated cross-linked complexes consist either of two distinct RNA fragments connected by the cross-link, or of a single RNA fragment in which the crosslink forms a closed loop. End labeling of the former type of complex would give rise to two labels, whereas the latter type of complex could not be sequenced within the closed loop. We therefore use ribosomes that are uniformly labeled with 32p, and the sequence determinations are made with classical fingerprinting techniques. In fact it is also more convenient to use the same uniformly labeled substrates for the RNA-protein cross-linking studies, since covalently linked RNA-protein complexes are often difficult to end-label satisfactorily. Uniform labeling has the added advantage that any impurities or cross-contaminations in the cross-linked complexes can be quantitatively assessed, and, since the nucleotide sequences of the E. coli ribosomal RNA molecules are known, 3,4 the RNA fingerprint data can be interpreted rapidly and unambiguously, provided that the RNA fragments in the isolated cross-linked complexes are of a suitable length (in practice approximately 30- 200 nucleotides). Finally, there is the question of the substrate used for the cross-linking reaction itself. Our objective is the study of the structure of the ribosomal RNA in situ in the ribosome, and we therefore use ribosomal subunits, ribosomes, or even growing E. coli cell cultures as substrates for the crosslinking reactions. This imposes restrictions on the type of cross-linking agents that can be usefully applied; in particular some intra-RNA crosslinking agents can only be used satisfactorily with isolated RNA as substrate (see [21] and [22], this volume). In the ensuing sections we begin with a description of our method for isolating 32p-labeled E. coli ribosomal subunits as substrates for both intraRNA and R N A - p r o t e i n cross-linking studies. Next, we deal with the intra-RNA cross-linking methodology, and describe the cross-linking reactions, the partial nuclease digestion conditions, the isolation of cross-linked complexes by gel electrophoresis, and the fingerprint analysis of the individual products. This is followed by a corresponding section on R N A protein cross-linking methodology, including in this case descriptions of the cross-linking reagents, assessment of the extent of reaction and identification of the proteins involved in the cross-linking, the partial nuclease 3 j. Brosius, M. L. Palmer, P. J. Kennedy, and H. F. Noller, Proc. Natl. Acad. Sci. U.S.A. 75, 4801 (1978). 4 j. Brosius, T. J. Dull, and H. F. Noller, Proc. Natl. Acad. Sci. U.S.A. 77, 201 (1980).
[19]
INTRA-RNA AND RNA-PROTEIN CROSS-LINKING
289
digestion conditions, isolation of the cross-linked complexes by a new stepwise procedure, and finally fingerprint analysis and protein identification with the individual isolated complexes. Preparation of 32p-Labeled Ribosomal Subunits s Twenty-five-milliliter cultures of E. coli MRE 600 are grown at 37 ° overnight in a shaker bath in a medium consisting of 20 m M Tris-HC1, pH 7.8, 20 m M NH4C1, 30 mMMgSO4, 0.3 mMCaCl2, 400 mMglycerol, and 0.2% vitamin-free casamino acids (Difco). A l-ml aliquot of this overnight culture is used to inoculate the labehng culture, which is made in 50 ml of the same medium containing 20 mCi of ortho [32p] phosphate (cartier free). It is important that the glassware used is first washed with chromic acid, to eliminate the phosphate residues left by commercial detergents. The culture is grown at 37 ° with shaking, and incorporation of the isotope is measured by taking 50-gl aliquots at intervals and centrifuging them in a table centrifuge; the 32p radioactivity in 5 gl of the supernatant is compared with that in 5 gl of the sample prior to centrifugation, which gives a direct measure of the fraction of the isotope still remaining in the medium. When 70-80% of the radioactivity has been incorporated (after 3 - 4 hr incubation), the cells are spun off by two successive centrifugations (10,000 rpm, l0 min, Sorvall HB4 rotor) into a single 30-ml plastic centrifuge tube. The pellet is washed with l0 m M Tris-HC1, pH 7.8 containing 1 m M magnesium acetate ("sonication buffer"), centrifuged again, and then suspended in 3.5 ml of sonication buffer. The centrifuge tube conraining the suspension is placed in a beaker of ice water and sonicated with a Branson sonifier. Five 30-sec pulses are given, with a l-min pause between each. Two microliters of deoxyribonuclease I (Sigma, 1 mg/ml)' is added, and the suspension immediately centrifuged (10,000 rpm, 15 min). The supernatant from this spin containing the ribosomes is loaded directly onto a 10-40% sucrose gradient in l0 mMTris-HC1, pH 7.8, 50 mMKC1, 0.3 m M magnesium acetate, 6 m M 2-mercaptoethanol, using a Beckman SW 25 or equivalent rotor (centrifuge tube volume 50-60 ml), and the gradient is centrifuged for 18 hr at 18,000 rpm and 4 °. The gradient is fractionated, the radioactivity measured, and fractions containing 30S and 50S subunits are respectively pooled. The subunits are precipitated by increasing the magnesium concentration to 5 m M followed by addition of 2 volumes of ethanol. After 2 hr at --20 ° the subunits are spun off (10,000 rpm, 30 min), and resuspended in 0.5 ml of "storage buffer," 5 W. Stiege, C. Zwieb, and R. Brimacombe, Nucleic Acids Res. 10, 7211 (1982).
290
CROSS-LINKING AND AFFINITY-LABELING METHODS
[ 1 9]
consisting of 25 m M triethanolamine-HC1, pH 7.8, 5 m M magnesium acetate, 50 m M KC1, and 6 m M 2-mercaptoethanol. The suspensions are dialyzed for 3 hr against high-salt buffer (20 m M triethanolamine-HC1, pH 7.8, 20 m M magnesium acetate, 400 m M NH4CI, 6 m M 2-mercaptoethanol), and the subunits are then activated6 by incubating them, still in their dialysis bags, at 37 ° for 15 min in a beaker containing the high-salt buffer. Finally, the dialysis is continued overnight against several changes of the storage buffer. This method of preparation is very rapid, gives well-separated subunits containing intact RNA, and involves a minimal exposure to radiation. The usual yield of 30S subunits from the procedure is - 3 A26ounits, containing 1.5 X 10 9 counts/min Cerenkov radioactivity, the corresponding yield of 50S subunits being about twice as much. Since the storage buffer is free of primary amines, the subunit preparations are suitable for use directly with any of our cross-linking reagents, with the exception of bis(2chloroethyl)methylamine (see below). In the latter case, the final dialysis is made against storage buffer in the absence of mercaptoethanol (for 50S subunits), or against 25 m M sodium cacodylate, pH 7.2, 5 m M magnesium acetate, and 50 m M KCI (for 30S subunits). Intra-RNA Cross-Linking The successive steps in an intra-RNA cross-link analysis are summarized schematically in Fig. 1, and are discussed in the following sections.
Cross-Linking Reactions The most effective methods that we have found for introducing intraRNA cross-links into ribosomes are (1) direct ultraviolet irradiation 7,s and (2) treatment with the bifunctional alkylating agent bis(2-chloroethyl)methylamine, "nitrogen mustard" (EGA Chemic).5,9 For ultraviolet irradiation the ribosomal subunits in storage buffer (see previous section) are diluted to a concentration of 5 A26o units/ml, and the solution is placed in a Petri dish or similar container so that it forms a layer approximately 1-mm thick. The irradiation is carried out at 4* for 2 to 6 min in an apparatus consisting of four horizontally parallel-mounted Sylvania G8T5 germicidal lamps, set 5 cm apart from each other. The 6 I. Ginzburg, R. Miskin, and A. Zamir, £ Mol. Biol. 79, 481 (1973). 7 W. Stiege, C. Glotz, and R. Brimacombe, Nucleic Acids Res. 11, 1687 (1983). s j. Atmadja, R. Brimacombe, H. BlOcker, and R. Frank, Nucleic Acids Res. 13, 6919 (1985). 9 j. Atmadja, W. Stiege, M. Zobawa, B. Greuer, M. Osswald, and R. Brimacombe, Nucleic Acids Res. 14, 659 (1986).
[ 19]
INTRA-RNA AND R N A - PROTEIN CROSS-LINKING
291
32p-labeled E. eoli cells
Isolation of ribosomal subunits
C r o s s - l i n k i n g by in vivo i r r a d i a t i o n
Cross-linking by irradiation or
Isolation of cross-linked subunits
treatment with nitrogen mustard
[
P a r t i a l d i g e s t i o n with cobra venom n u c l e a s e
D i g e s t i o n of ribosomal p r o t e i n s with p r o t e i n a s e K
1 S e p a r a t i o n of int!a-RNA c r o s s - l i n k e d complexes by two-dimensional gel e l e c t r o p h o r e s i s
E x t r a c t i o n of i n d i v i d u a l complexes from gel
I Ribonuclease T 1 f i n g e r p r i n t
Ribonuclease A f i n g e r p r i n t
Secondary digestion with
Secondary dzgest • i on with
ribonuclease A
l
ribonuclease T I
,1 Position of cross-link site deduced from oligonucleotide data
FI~. 1. Experimental ~eps in an intra-RNA cross-~nk site analysis.
292
CROSS-LINKING AND AFFINITY-LABELING METHODS
[ 19]
sample is held at a distance of 4 - 6 cm from the lamps, which at this distance deliver an energy o f - 2 5 Joules/m 2 sec. After irradiation the subunits are transferred to a centrifuge tube and precipitated with ethanol. [Ethanol precipitation is a "standard" procedure in this and the following sections; two volumes of ethanol are added, the solution is kept for 1.52 hr at - 2 0 °, and the precipitated subunits (or RNA) are collected by centrifugation at 10,000 rpm for 30 min in a swing-out rotor. Samples in salt-free buffers are made 100 m M in solution acetate before addition of ethanol.] The ultraviolet cross-linking can also be carried out "in vivo.-1o In this case a 32p-labeled E. coli cell culture (25 ml) is spun down (cf. previous section), and immediately resuspended in 2 ml or 1 m M magnesium chloride, l0 m M Tris-HCl, pH 7.8. The suspension is irradiated in a 2-ram thick layer for 6 min, as just described, and the cells are then disrupted by sonication and the ribosomal subunits isolated as in the previous section. Cross-linking with the nitrogen mustard reagent is effected simply by incubating the ribosomal subunit solution (5-10 A26o units/ml) with the reagent for 1 hr at 37°; a 100 m M solution of nitrogen mustard is freshly prepared in the same buffer as the subunits, and is added to the latter so as to give a final reagent concentration of 1 - 3 raM. The subunits must be in a buffer that is free of 2-mercaptoethanol, and, as noted in the previous section, we use sodium cacodylate buffer for 30S subunits and storage buffer for 50S subunits. (The cacodylate buffer gives marginally better results, but, for reasons which we have not been able to determine, the 50S subunits become hypersensitive to nuclease contamination in this buffer.) The cross-linking reaction is terminated by adding a solution of cysteamine (1 M) to a final concentration of 20 times that of the cross-linking reagent, and incubating for a further 15 min at 37 °. The subunits are then precipitated with ethanol. No subunit aggregation or dimer formation is observed under these cross-linking conditions. Estimation of the yield in an intra-RNA cross-linking procedure is very difficult. Although a gel system has been described ~ for separating certain classes of cross-linked molecules in intact 16S RNA, we know of no way of estimating the overall amount of cross-linking that has taken place. Choosing a suitable reagent concentration or irradiation time is therefore an empirical process, based on the results obtained in the subsequent steps (see below). The conditions just described are designed to give relatively low levels of cross-linking, in order both to simplify the patterns of digestion products, as well as to maximize the probability that each observed lo W. Stiege, J. Atmadja, M. Zobawa, and R. Brimacombe, J. MoL Biol. 191, 135 (1986). 1~p. L. Woilenzien and C. R. Cantor, J. Mol. Biol. 159, 151 (1982).
[ 19]
INTRA-RNA AND R N A - PROTEIN CROSS-LINKING
293
cross-link is the first cross-linking event in any individual molecule. The possibility of introducing artifacts is thus kept to a minimum, although it must be remembered that artifacts can never be entirely excluded in any cross-linking or chemical modification study. As a corollary to this, it should be noted that it is inadvisable to try to "force" any cross-linking system; if the desired cross-link can only be obtained by drastically raising the reagent concentration (or irradiation time), then the resulting analysis will not only be complicated by many unwanted side reactions, but there will also be a high risk that conformational artifacts have been introduced.
Partial Nuclease Digestion The purpose of the partial nuclease digestion is to reduce the crosslinked RNA to fragments of a size suitable for analysis. That is to say, the fragments must be long enough to enable the sequence to be located unambiguously in the 16S or 23S RNA, but not so long that the position of the cross-link site is "lost." By far the most effective enzyme for this purpose is the double-strand specific nuclease from cobra venom, ~2used in conjunction with intact cross-linked ribosomal subunits as substrate. The enzyme is commercially available, or can be prepared from crude cobra (Naja naja oxiana) venom, and it gives a clear and reproducible pattern of RNA fragments) 3 The ethanol-precipitated cross-linked subunits (see previous section) are dried briefly under vacuum to remove traces of ethanol, and are taken up in 10 m M Tris-HC1, pH 7.8, 1 m M MgC12, 20 m M NH4CI (30 #1 per A260unit). A suitable quantity of enzyme (evaluated by a series of preliminary experiments with unlabeled ribosomal subunits) is added, and the solution is incubated at 37 ° for 60 min. Next, ethylenediaminetetraacetic acid (EDTA) is added to give a final concentration of 6 mM, together with a fresh solution of proteinase K (Merck) to a concentration of 1 mg/ml, and incubation is continued for 10 min at 37 °. The solution is then made 0.3% in SDS, incubated for a further 10 min, and loaded directly onto the polyacrylamide gel (see next section) for separation of the RNA fragments. This procedure avoids ethanol precipitation of the digested sample, in contrast to our older procedure, 5 a factor which improves the clarity of the gel separation, particularly in the case of samples cross-linked with nitrogen mustard. 9 Not more than about 2 A26ounits should be applied to a single gel slot, and the additions of EDTA, sodium dodecyl sulfate (SDS), and proteinase K should be made with small volumes from concentrated solutions, to keep the increase in sample volume to a minimum. 12 S. K. Vassilenko and V. C. Ryte, Biokhimiya (Moscow) 40, 578 (1975). ,3 S. K. Vassilenko, P. Carbon, J. P. Ebel, and C. Ehresmann, J. Mol. Biol. 152, 699 (1981).
294
CROSS-LINKING AND AFFINITY-LABELING METHODS
[ 19]
Cross-linked complexes that are still inconveniently large after this procedure can, if present in sufficiently good yield, be subjected to a second partial digestion step after the gel electrophoresis (see below). Procedures for this type of digestion, involving the use of ribonucleases TI and H or cobra venom, have already been published in detail, 5,7,s and for reasons of space will not be repeated here. In general it is important to carry out these second digestions in the presence of a defined amount (e.g., 50 #g) of unlabeled carrier RNA, using an enzyme concentration that has been tested in preliminary experiments immediately beforehand. In contrast, in our experience, none of the three enzymes (T1, H, or cobra venom nuclease) is very suitable for the first partial digestion if deproteinized 16S or 23S RNA is used as substrate, since the products formed are either too heterogeneous (under mild conditions) or too selective (under harder conditions). Ribonuclease T~ for example was found in our earlier experiments ~4to digest everything away except for RNA fragments derived from the most stable hairpin loops in the ribosomal RNA. This has the consequence that the observed yield of any particular cross-link after electrophoretic isolation of the cross-linked fragments is strongly influenced by the digestion conditions used. 7,8
Gel Elec
