Methods in Enzymology Vol 460: Chemokines, Part A

METHODS IN ENZYMOLOGY Editors-in-Chief

JOHN N. ABELSON AND MELVIN I. SIMON Division of Biology California Institute of Technology Pasadena, California, USA Founding Editors

SIDNEY P. COLOWICK AND NATHAN O. KAPLAN

Academic Press is an imprint of Elsevier 525 B Street, Suite 1900, San Diego, CA 92101-4495, USA 30 Corporate Drive, Suite 400, Burlington, MA 01803, USA 32 Jamestown Road, London NW1 7BY, UK First edition 2009 Copyright # 2009, Elsevier Inc. All rights reserved No part of this publication may be reproduced, stored in a retrieval system or transmitted in any form or by any means electronic, mechanical, photocopying, recording or otherwise without the prior written permission of the publisher Permissions may be sought directly from Elsevier’s Science & Technology Rights Department in Oxford, UK: phone (+44) (0) 1865 843830; fax (+44) (0) 1865 853333; email: permissions@ elsevier.com. Alternatively you can submit your request online by visiting the Elsevier web site at http://elsevier.com/locate/permissions, and selecting Obtaining permission to use Elsevier material Notice No responsibility is assumed by the publisher for any injury and/or damage to persons or property as a matter of products liability, negligence or otherwise, or from any use or operation of any methods, products, instructions or ideas contained in the material herein. Because of rapid advances in the medical sciences, in particular, independent verification of diagnoses and drug dosages should be made For information on all Academic Press publications visit our website at elsevierdirect.com ISBN: 978-0-12-374908-6 ISSN: 0076-6879 Printed and bound in United States of America 09 10 11 12 10 9 8 7 6 5 4 3 2 1

CONTRIBUTORS

Sarah Able Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom Antonio Alcami Centro de Biologı´a Molecular Severo Ochoa (Consejo Superior de Investigaciones Cientı´ficas-Universidad Auto´noma de Madrid), Cantoblanco, Madrid, Spain, and Department of Medicine, University of Cambridge, Cambridge, United Kingdom Paola Allavena Department of Immunology and Inflammation, IRCCS Istituto Clinico Humanitas, Rozzano (Milan), Italy Mee Y. Bartee Division of Cardiovascular Medicine, Department of Medicine and Department of Molecular Genetics and Microbiology, University of Florida, Gainesville, Florida, USA Adit Ben-Baruch Department of Cell Research and Immunology, George S. Wise Faculty of Life Sciences, Tel Aviv University, Tel Aviv, Israel Paolo Bianchi Laboratory of Molecular Gastroenterology, IRCCS Istituto Clinico Humanitas, Rozzano (Milan), Italy Emma Blair Department of Chemistry, and Division of Immunology, Infection and Inflammation, Glasgow Biomedical Research Center, Glasgow University, Glasgow, United Kingdom Raffaella Bonecchi Laboratory of Leukocyte Biology, Department of Translational Medicine, University of Milan, IRCCS Istituto Clinico Humanitas, Italy Elena M. Borroni Laboratory of Leukocyte Biology, Department of Translational Medicine, University of Milan, IRCCS Istituto Clinico Humanitas, Italy James R. Broach Department of Molecular Biology, Princeton University, Princeton, New Jersey, USA xiii

xiv

Contributors

Chiara Buracchi Laboratory of Leukocyte Biology, Department of Translational Medicine, University of Milan, IRCCS Istituto Clinico Humanitas, Italy Erbin Dai Department of Medicine, University of Florida, Gainesville, Florida, USA John F. DiPersio Division of Oncology, Siteman Cancer Center, Washington University School of Medicine, St. Louis, Missouri, USA Patrick Dorr Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom Pieter C. Dorrestein Skaggs School of Pharmacy and Pharmaceutical Science, University of California, San Diego, La Jolla, California, USA Marco Erreni Department of Immunology and Inflammation, IRCCS Istituto Clinico Humanitas, Rozzano (Milan), Italy Barry J. Evans Department of Pathology, Anatomy and Cell Biology, Thomas Jefferson University, Philadelphia, Pennsylvania, USA Marco Fabbri Department of Immunology and Inflammation, IRCCS Istituto Clinico Humanitas, Rozzano (Milan), Italy Nobutaka Fujii Department of Chemogenomics, Graduate School of Pharmaceutical Sciences, Kyoto University, Sakyo-ku, Kyoto, Japan Kerry B. Goralski Department of Pharmacology, Faculty of Medicine, and College of Pharmacy, Faculty of Health Professions Dalhousie University, Halifax, Nova Scotia, Canada Gerard J. Graham Division of Immunology, Infection and Inflammation, Glasgow Biomedical Research Center, Glasgow University, Glasgow, United Kingdom Paul Griffin Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom J. Silvio Gutkind Oral and Pharyngeal Cancer Branch, National Institute of Dental and Craniofacial Research, National Institutes of Health, Bethesda, Maryland, USA

Contributors

xv

Amy-Joan L. Ham Department of Biochemistry, Vanderbilt University School of Medicine, Nashville, Tennessee, USA Tracy M. Handel Skaggs School of Pharmacy and Pharmaceutical Science, University of California, San Diego, La Jolla, California, USA Karen E. Hedin Department of Immunology, College of Medicine, Mayo Clinic, Rochester, Minnesota, USA Richard Horuk Department of Pharmacology, UC Davis, Davis, California, USA Becky Irvine Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom Neil Isaacs Department of Chemistry, Glasgow Biomedical Research Centre, Glasgow University, Glasgow, United Kingdom Ian James Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom Tom Kershaw Cell Biology Unit, MRC Laboratory for Molecular Cell Biology, and Department of Cell and Developmental Biology, University College London, London, United Kingdom Kimberly N. Kremer Department of Immunology, College of Medicine, Mayo Clinic, Rochester, Minnesota, USA Ashok Kumar Endocrine Research Unit, Mayo Clinic, Rochester, Minnesota, USA Luigi Laghi Laboratory of Molecular Gastroenterology, IRCCS Istituto Clinico Humanitas, Rozzano (Milan), Italy Meizhang Li Neuroinflammation Research Center, Department of Neurosciences, Lerner Research Institute, Cleveland Clinic, Cleveland, Ohio, USA Sergio A. Lira Immunology Institute, Mount Sinai School of Medicine, New York, New York, USA

xvi

Contributors

Liying Liu Department of Medicine, University of Florida, Gainesville, Florida, USA Massimo Locati Department of Translational Medicine, University of Milan, IRCCS Istituto Clinico Humanitas, Via Manzoni, Rozzano (Milano), Italia Alexandra R. Lucas Division of Cardiovascular Medicine, Department of Medicine and Department of Molecular Genetics and Microbiology, University of Florida, Gainesville, Florida, USA Malcolm Macartney Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom Colin Macaulay Division of Cardiovascular Medicine, University of Florida, Gainesville, Florida, USA Roy Mansfield Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom Alberto Mantovani Department of Translational Medicine, University of Milan, IRCCS Istituto Clinico Humanitas, Via Manzoni, Rozzano (Milano), Italia Adriano Marchese Department of Pharmacology, Stritch School of Medicine, Loyola University Chicago, Maywood, Illinois, USA Mark Marsh Cell Biology Unit, MRC Laboratory for Molecular Cell Biology, and Department of Cell and Developmental Biology, University College London, London, United Kingdom Andrea P. Martin Immunology Institute, Mount Sinai School of Medicine, New York, New York, USA Daniel Martin Oral and Pharyngeal Cancer Branch, National Institute of Dental and Craniofacial Research, National Institutes of Health, Bethesda, Maryland, USA David Maussang Leiden/Amsterdam Center for Drug Research, Division of Medicinal Chemistry, Faculty of Sciences, Vrije Universiteit Amsterdam, Amsterdam, The Netherlands Clare McCulloch Department of Chemistry, and Division of Immunology, Infection and Inflammation, Glasgow Biomedical Research Center, Glasgow University, Glasgow, United Kingdom

xvii

Contributors

Grant McFadden Department of Molecular Genetics Florida, Gainesville, Florida, USA

and

Microbiology,

University

of

Pauline McLean Department of Chemistry, and Division of Immunology, Infection and Inflammation, Glasgow Biomedical Research Center, Glasgow University, Glasgow, United Kingdom Dana McIvor Division of Cardiovascular Medicine, University of Florida, Gainesville, Florida, USA Raymond L. Mernaugh Department of Biochemistry, Vanderbilt University School of Medicine, Nashville, Tennessee, USA Tsipi Meshel Department of Cell Research and Immunology, George S. Wise Faculty of Life Sciences, Tel Aviv University, Tel Aviv, Israel Detlef Michel Institute of Virology, Ulm University Clinic, Ulm, Germany Ken Miller Pfizer GRD-Groton Laboratories, Groton, Connecticut, USA James Mills Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom Massimilliano Mirolo Laboratory of Leukocyte Biology, Department of Translational Medicine, University of Milan, IRCCS Istituto Clinico Humanitas, Italy Ganesh Munuswamy-Ramanujam Division of Cardiovascular Medicine, Department of Medicine and Department of Molecular Genetics and Microbiology, University of Florida, Gainesville, Florida, USA Carolyn Napier Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom Iva Navratilova Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom Manuela Nebuloni Pathology Unit, L. Sacco Institute of Medical Sciences, University of Milan, Milan, Italy

xviii

Contributors

Nicole F. Neel Department of Cancer Biology, Vanderbilt University School of Medicine, Nashville, Tennessee, USA Bruno Nervi Division of Oncology, Siteman Cancer Center, Washington University School of Medicine, St. Louis, Missouri, USA Robert J. B. Nibbs Division of Immunology, Infection and Inflammation, Glasgow Biomedical Research Center, Glasgow University, Glasgow, United Kingdom Morgan O’Hayre Skaggs School of Pharmacy and Pharmaceutical Science, University of California, San Diego, La Jolla, California, USA Shinya Oishi Department of Chemogenomics, Graduate School of Pharmaceutical Sciences, Kyoto University, Sakyo-ku, Kyoto, Japan Fabio Pasqualini Laboratory of Leukocyte Biology, Department of Translational Medicine, University of Milan, IRCCS Istituto Clinico Humanitas, Italy James E. Pease Leukocyte Biology Section, National Heart and Lung Institute, Imperial College London, London, United Kingdom Stephen C. Peiper Department of Pathology, Anatomy and Cell Biology, Thomas Jefferson University, Philadelphia, Pennsylvania, USA Manos Perros Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom Dayanidhi Raman Department of Cancer Biology, and Veterans Affairs Medical Center, Vanderbilt University School of Medicine, Nashville, Tennessee, USA Pablo Ramirez Division of Oncology, Siteman Cancer Center, Washington University School of Medicine, St. Louis, Missouri, USA Richard M. Ransohoff Neuroinflammation Research Center, Department of Neurosciences, Lerner Research Institute, Cleveland Clinic, Cleveland, Ohio, USA Michael P. Rettig Division of Oncology, Siteman Cancer Center, Washington University School of Medicine, St. Louis, Missouri, USA

Contributors

xix

Alan Riboldi-Tunniclife Department of Chemistry, Glasgow Biomedical Research Centre, Glasgow University, Glasgow, United Kingdom Ann J. Richmond Department of Cancer Biology, and Veterans Affairs Medical Center, Vanderbilt University School of Medicine, Nashville, Tennessee, USA Graham Rickett Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom Harriet Root Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom Remo C. Russo Department of Biochemistry and Immunology, Instituto de Ciencias Biologicas, Universidade Federal de Minas Gerais, Belo Horizonte, Brazil, and Laboratory of Leukocyte Biology, Department of Translational Medicine, University of Milan, IRCCS Istituto Clinico Humanitas, Italy Elna van der Ryst Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom Jiqing Sai Department of Cancer Biology, and Veterans Affairs Medical Center, Vanderbilt University School of Medicine, Nashville, Tennessee, USA Catherina L. Salanga Skaggs School of Pharmacy and Pharmaceutical Science, University of California, San Diego, La Jolla, California, USA Benedetta Savino Laboratory of Leukocyte Biology, Department of Translational Medicine, University of Milan, IRCCS Istituto Clinico Humanitas, Italy Andreas Schreiber Institute of Virology, Ulm University Clinic, Ulm, Germany Limin Shang Immunology Institute, Mount Sinai School of Medicine, New York, New York, USA Nathalie Signoret Centre for Immunology and Infection, Department of Biology and Hull York Medical School, University of York, York, United Kingdom Olivia L. Sims Department of Immunology, College of Medicine, Mayo Clinic, Rochester, Minnesota, USA

xx

Contributors

Christopher J. Sinal Department of Pharmacology, Faculty of Medicine, Dalhousie University, Halifax, Nova Scotia, Canada Martine J. Smit Leiden/Amsterdam Center for Drug Research, Division of Medicinal Chemistry, Faculty of Sciences, Vrije Universiteit Amsterdam, Amsterdam, The Netherlands Gali Soria Department of Cell Research and Immunology, George S. Wise Faculty of Life Sciences, Tel Aviv University, Tel Aviv, Israel Nagarajan Vaidehi Division of Immunology, Beckman Research Institute of the City of Hope, Duarte, California, USA Abel Viejo-Borbolla Centro de Biologı´a Molecular Severo Ochoa, (Consejo Superior de Investigaciones Cientı´ficas-Universidad Auto´noma de Madrid), Cantoblanco, Madrid, Spain, and Immunology Institute, Mount Sinai School of Medicine, New York, New York, USA Henry F. Vischer Leiden/Amsterdam Center for Drug Research, Division of Medicinal Chemistry, Faculty of Sciences, Vrije Universiteit Amsterdam, Amsterdam, The Netherlands Zixuan Wang Department of Pathology, Anatomy and Cell Biology, and Department of Surgery, Thomas Jefferson University, Philadelphia, Pennsylvania, USA Sile`ne T. Wavre-Shapton Molecular Medicine NHL1, Imperial College, South Kennigton, London, United Kingdom Mike Westby Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom Jinming Yang Department of Cancer Biology, and Veterans Affairs Medical Center, Vanderbilt University School of Medicine, Nashville, Tennessee, USA Yanshi Zhu Department of Chemistry, Glasgow Biomedical Research Centre, Glasgow University, Glasgow, United Kingdom

PREFACE

Chemokines and chemokine receptors are the eyes and ears of the immune system, and under normal healthy conditions they guide the migration of leukocytes within the body to areas of assault or injury. Of course, this system can be broken, corrupted, compromised, and led astray in a variety of ways. Immune cells can attack their own tissues leading to autoimmune diseases such as rheumatoid arthritis and multiple sclerosis. Many pathogens have evolved ways to ‘‘blind’’ the immune system, thus allowing them to go undetected and propagate freely. Viruses such as HIV-1 have been shown to use specific transmembrane chemokine receptors as one path to cellular entry and infection. The progression of cancer can even be aided by the good intentions of immune system–mediated vascularization. The list goes on, and hence the scientific community has long realized the importance of understanding and eventually being able to manipulate this complex system. As a result, the number of papers addressing chemokines and chemokine receptors has grown exponentially over the last decade. In 1997, Richard Horuk edited volumes 287 and 288 of the Methods in Enzymology series on chemokines and chemokine receptors, putting together the first comprehensive practical guide to studying these molecules. Since then many new technologies and methodologies have been designed and implemented in the study of these proteins. Volumes 460 and 461 of Methods in Enzymology seek to compile and highlight these recent methods, explain their importance, and clearly describe in detail the protocols necessary for successful experimental reproduction. Volume 460 focuses on studying the roles of chemokines and chemokine receptors in disease states, atypical chemokine receptors, and chemokine signaling, as well as chemokine related proteins from pathogens. Volume 461 deals with the assays and methods used to study structure and function of these proteins and to characterize their ultimate goal of cell migration. These methods span a wide spectrum of multidisciplinary techniques, from new spectroscopic advances to in situ cell-selective protein expression to devices designed to mimic the conditions of flow present in blood vessels where in situ leukocyte migration occurs. Many of the authors from the first volumes have returned in the present work to build upon the foundation they laid over a decade ago. In addition,

xxi

xxii

Preface

many newer researchers have pitched in and lent their expansive expertise to the cause. Compilations like this are assembled by the immense efforts of many individual researchers and we emphatically offer our thanks and gratitude to all of the authors who contributed to making these volumes a reality. TRACY M. HANDEL AND DAMON J. HAMEL

METHODS IN ENZYMOLOGY

VOLUME I. Preparation and Assay of Enzymes Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN VOLUME II. Preparation and Assay of Enzymes Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN VOLUME III. Preparation and Assay of Substrates Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN VOLUME IV. Special Techniques for the Enzymologist Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN VOLUME V. Preparation and Assay of Enzymes Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN VOLUME VI. Preparation and Assay of Enzymes (Continued) Preparation and Assay of Substrates Special Techniques Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN VOLUME VII. Cumulative Subject Index Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN VOLUME VIII. Complex Carbohydrates Edited by ELIZABETH F. NEUFELD AND VICTOR GINSBURG VOLUME IX. Carbohydrate Metabolism Edited by WILLIS A. WOOD VOLUME X. Oxidation and Phosphorylation Edited by RONALD W. ESTABROOK AND MAYNARD E. PULLMAN VOLUME XI. Enzyme Structure Edited by C. H. W. HIRS VOLUME XII. Nucleic Acids (Parts A and B) Edited by LAWRENCE GROSSMAN AND KIVIE MOLDAVE VOLUME XIII. Citric Acid Cycle Edited by J. M. LOWENSTEIN VOLUME XIV. Lipids Edited by J. M. LOWENSTEIN VOLUME XV. Steroids and Terpenoids Edited by RAYMOND B. CLAYTON xxiii

xxiv

Methods in Enzymology

VOLUME XVI. Fast Reactions Edited by KENNETH KUSTIN VOLUME XVII. Metabolism of Amino Acids and Amines (Parts A and B) Edited by HERBERT TABOR AND CELIA WHITE TABOR VOLUME XVIII. Vitamins and Coenzymes (Parts A, B, and C) Edited by DONALD B. MCCORMICK AND LEMUEL D. WRIGHT VOLUME XIX. Proteolytic Enzymes Edited by GERTRUDE E. PERLMANN AND LASZLO LORAND VOLUME XX. Nucleic Acids and Protein Synthesis (Part C) Edited by KIVIE MOLDAVE AND LAWRENCE GROSSMAN VOLUME XXI. Nucleic Acids (Part D) Edited by LAWRENCE GROSSMAN AND KIVIE MOLDAVE VOLUME XXII. Enzyme Purification and Related Techniques Edited by WILLIAM B. JAKOBY VOLUME XXIII. Photosynthesis (Part A) Edited by ANTHONY SAN PIETRO VOLUME XXIV. Photosynthesis and Nitrogen Fixation (Part B) Edited by ANTHONY SAN PIETRO VOLUME XXV. Enzyme Structure (Part B) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME XXVI. Enzyme Structure (Part C) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME XXVII. Enzyme Structure (Part D) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME XXVIII. Complex Carbohydrates (Part B) Edited by VICTOR GINSBURG VOLUME XXIX. Nucleic Acids and Protein Synthesis (Part E) Edited by LAWRENCE GROSSMAN AND KIVIE MOLDAVE VOLUME XXX. Nucleic Acids and Protein Synthesis (Part F) Edited by KIVIE MOLDAVE AND LAWRENCE GROSSMAN VOLUME XXXI. Biomembranes (Part A) Edited by SIDNEY FLEISCHER AND LESTER PACKER VOLUME XXXII. Biomembranes (Part B) Edited by SIDNEY FLEISCHER AND LESTER PACKER VOLUME XXXIII. Cumulative Subject Index Volumes I-XXX Edited by MARTHA G. DENNIS AND EDWARD A. DENNIS VOLUME XXXIV. Affinity Techniques (Enzyme Purification: Part B) Edited by WILLIAM B. JAKOBY AND MEIR WILCHEK

Methods in Enzymology

VOLUME XXXV. Lipids (Part B) Edited by JOHN M. LOWENSTEIN VOLUME XXXVI. Hormone Action (Part A: Steroid Hormones) Edited by BERT W. O’MALLEY AND JOEL G. HARDMAN VOLUME XXXVII. Hormone Action (Part B: Peptide Hormones) Edited by BERT W. O’MALLEY AND JOEL G. HARDMAN VOLUME XXXVIII. Hormone Action (Part C: Cyclic Nucleotides) Edited by JOEL G. HARDMAN AND BERT W. O’MALLEY VOLUME XXXIX. Hormone Action (Part D: Isolated Cells, Tissues, and Organ Systems) Edited by JOEL G. HARDMAN AND BERT W. O’MALLEY VOLUME XL. Hormone Action (Part E: Nuclear Structure and Function) Edited by BERT W. O’MALLEY AND JOEL G. HARDMAN VOLUME XLI. Carbohydrate Metabolism (Part B) Edited by W. A. WOOD VOLUME XLII. Carbohydrate Metabolism (Part C) Edited by W. A. WOOD VOLUME XLIII. Antibiotics Edited by JOHN H. HASH VOLUME XLIV. Immobilized Enzymes Edited by KLAUS MOSBACH VOLUME XLV. Proteolytic Enzymes (Part B) Edited by LASZLO LORAND VOLUME XLVI. Affinity Labeling Edited by WILLIAM B. JAKOBY AND MEIR WILCHEK VOLUME XLVII. Enzyme Structure (Part E) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME XLVIII. Enzyme Structure (Part F) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME XLIX. Enzyme Structure (Part G) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME L. Complex Carbohydrates (Part C) Edited by VICTOR GINSBURG VOLUME LI. Purine and Pyrimidine Nucleotide Metabolism Edited by PATRICIA A. HOFFEE AND MARY ELLEN JONES VOLUME LII. Biomembranes (Part C: Biological Oxidations) Edited by SIDNEY FLEISCHER AND LESTER PACKER

xxv

xxvi

Methods in Enzymology

VOLUME LIII. Biomembranes (Part D: Biological Oxidations) Edited by SIDNEY FLEISCHER AND LESTER PACKER VOLUME LIV. Biomembranes (Part E: Biological Oxidations) Edited by SIDNEY FLEISCHER AND LESTER PACKER VOLUME LV. Biomembranes (Part F: Bioenergetics) Edited by SIDNEY FLEISCHER AND LESTER PACKER VOLUME LVI. Biomembranes (Part G: Bioenergetics) Edited by SIDNEY FLEISCHER AND LESTER PACKER VOLUME LVII. Bioluminescence and Chemiluminescence Edited by MARLENE A. DELUCA VOLUME LVIII. Cell Culture Edited by WILLIAM B. JAKOBY AND IRA PASTAN VOLUME LIX. Nucleic Acids and Protein Synthesis (Part G) Edited by KIVIE MOLDAVE AND LAWRENCE GROSSMAN VOLUME LX. Nucleic Acids and Protein Synthesis (Part H) Edited by KIVIE MOLDAVE AND LAWRENCE GROSSMAN VOLUME 61. Enzyme Structure (Part H) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME 62. Vitamins and Coenzymes (Part D) Edited by DONALD B. MCCORMICK AND LEMUEL D. WRIGHT VOLUME 63. Enzyme Kinetics and Mechanism (Part A: Initial Rate and Inhibitor Methods) Edited by DANIEL L. PURICH VOLUME 64. Enzyme Kinetics and Mechanism (Part B: Isotopic Probes and Complex Enzyme Systems) Edited by DANIEL L. PURICH VOLUME 65. Nucleic Acids (Part I) Edited by LAWRENCE GROSSMAN AND KIVIE MOLDAVE VOLUME 66. Vitamins and Coenzymes (Part E) Edited by DONALD B. MCCORMICK AND LEMUEL D. WRIGHT VOLUME 67. Vitamins and Coenzymes (Part F) Edited by DONALD B. MCCORMICK AND LEMUEL D. WRIGHT VOLUME 68. Recombinant DNA Edited by RAY WU VOLUME 69. Photosynthesis and Nitrogen Fixation (Part C) Edited by ANTHONY SAN PIETRO VOLUME 70. Immunochemical Techniques (Part A) Edited by HELEN VAN VUNAKIS AND JOHN J. LANGONE

Methods in Enzymology

xxvii

VOLUME 71. Lipids (Part C) Edited by JOHN M. LOWENSTEIN VOLUME 72. Lipids (Part D) Edited by JOHN M. LOWENSTEIN VOLUME 73. Immunochemical Techniques (Part B) Edited by JOHN J. LANGONE AND HELEN VAN VUNAKIS VOLUME 74. Immunochemical Techniques (Part C) Edited by JOHN J. LANGONE AND HELEN VAN VUNAKIS VOLUME 75. Cumulative Subject Index Volumes XXXI, XXXII, XXXIV–LX Edited by EDWARD A. DENNIS AND MARTHA G. DENNIS VOLUME 76. Hemoglobins Edited by ERALDO ANTONINI, LUIGI ROSSI-BERNARDI, AND EMILIA CHIANCONE VOLUME 77. Detoxication and Drug Metabolism Edited by WILLIAM B. JAKOBY VOLUME 78. Interferons (Part A) Edited by SIDNEY PESTKA VOLUME 79. Interferons (Part B) Edited by SIDNEY PESTKA VOLUME 80. Proteolytic Enzymes (Part C) Edited by LASZLO LORAND VOLUME 81. Biomembranes (Part H: Visual Pigments and Purple Membranes, I) Edited by LESTER PACKER VOLUME 82. Structural and Contractile Proteins (Part A: Extracellular Matrix) Edited by LEON W. CUNNINGHAM AND DIXIE W. FREDERIKSEN VOLUME 83. Complex Carbohydrates (Part D) Edited by VICTOR GINSBURG VOLUME 84. Immunochemical Techniques (Part D: Selected Immunoassays) Edited by JOHN J. LANGONE AND HELEN VAN VUNAKIS VOLUME 85. Structural and Contractile Proteins (Part B: The Contractile Apparatus and the Cytoskeleton) Edited by DIXIE W. FREDERIKSEN AND LEON W. CUNNINGHAM VOLUME 86. Prostaglandins and Arachidonate Metabolites Edited by WILLIAM E. M. LANDS AND WILLIAM L. SMITH VOLUME 87. Enzyme Kinetics and Mechanism (Part C: Intermediates, Stereo-chemistry, and Rate Studies) Edited by DANIEL L. PURICH VOLUME 88. Biomembranes (Part I: Visual Pigments and Purple Membranes, II) Edited by LESTER PACKER

xxviii

Methods in Enzymology

VOLUME 89. Carbohydrate Metabolism (Part D) Edited by WILLIS A. WOOD VOLUME 90. Carbohydrate Metabolism (Part E) Edited by WILLIS A. WOOD VOLUME 91. Enzyme Structure (Part I) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME 92. Immunochemical Techniques (Part E: Monoclonal Antibodies and General Immunoassay Methods) Edited by JOHN J. LANGONE AND HELEN VAN VUNAKIS VOLUME 93. Immunochemical Techniques (Part F: Conventional Antibodies, Fc Receptors, and Cytotoxicity) Edited by JOHN J. LANGONE AND HELEN VAN VUNAKIS VOLUME 94. Polyamines Edited by HERBERT TABOR AND CELIA WHITE TABOR VOLUME 95. Cumulative Subject Index Volumes 61–74, 76–80 Edited by EDWARD A. DENNIS AND MARTHA G. DENNIS VOLUME 96. Biomembranes [Part J: Membrane Biogenesis: Assembly and Targeting (General Methods; Eukaryotes)] Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 97. Biomembranes [Part K: Membrane Biogenesis: Assembly and Targeting (Prokaryotes, Mitochondria, and Chloroplasts)] Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 98. Biomembranes (Part L: Membrane Biogenesis: Processing and Recycling) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 99. Hormone Action (Part F: Protein Kinases) Edited by JACKIE D. CORBIN AND JOEL G. HARDMAN VOLUME 100. Recombinant DNA (Part B) Edited by RAY WU, LAWRENCE GROSSMAN, AND KIVIE MOLDAVE VOLUME 101. Recombinant DNA (Part C) Edited by RAY WU, LAWRENCE GROSSMAN, AND KIVIE MOLDAVE VOLUME 102. Hormone Action (Part G: Calmodulin and Calcium-Binding Proteins) Edited by ANTHONY R. MEANS AND BERT W. O’MALLEY VOLUME 103. Hormone Action (Part H: Neuroendocrine Peptides) Edited by P. MICHAEL CONN VOLUME 104. Enzyme Purification and Related Techniques (Part C) Edited by WILLIAM B. JAKOBY

Methods in Enzymology

xxix

VOLUME 105. Oxygen Radicals in Biological Systems Edited by LESTER PACKER VOLUME 106. Posttranslational Modifications (Part A) Edited by FINN WOLD AND KIVIE MOLDAVE VOLUME 107. Posttranslational Modifications (Part B) Edited by FINN WOLD AND KIVIE MOLDAVE VOLUME 108. Immunochemical Techniques (Part G: Separation and Characterization of Lymphoid Cells) Edited by GIOVANNI DI SABATO, JOHN J. LANGONE, AND HELEN VAN VUNAKIS VOLUME 109. Hormone Action (Part I: Peptide Hormones) Edited by LUTZ BIRNBAUMER AND BERT W. O’MALLEY VOLUME 110. Steroids and Isoprenoids (Part A) Edited by JOHN H. LAW AND HANS C. RILLING VOLUME 111. Steroids and Isoprenoids (Part B) Edited by JOHN H. LAW AND HANS C. RILLING VOLUME 112. Drug and Enzyme Targeting (Part A) Edited by KENNETH J. WIDDER AND RALPH GREEN VOLUME 113. Glutamate, Glutamine, Glutathione, and Related Compounds Edited by ALTON MEISTER VOLUME 114. Diffraction Methods for Biological Macromolecules (Part A) Edited by HAROLD W. WYCKOFF, C. H. W. HIRS, AND SERGE N. TIMASHEFF VOLUME 115. Diffraction Methods for Biological Macromolecules (Part B) Edited by HAROLD W. WYCKOFF, C. H. W. HIRS, AND SERGE N. TIMASHEFF VOLUME 116. Immunochemical Techniques (Part H: Effectors and Mediators of Lymphoid Cell Functions) Edited by GIOVANNI DI SABATO, JOHN J. LANGONE, AND HELEN VAN VUNAKIS VOLUME 117. Enzyme Structure (Part J) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME 118. Plant Molecular Biology Edited by ARTHUR WEISSBACH AND HERBERT WEISSBACH VOLUME 119. Interferons (Part C) Edited by SIDNEY PESTKA VOLUME 120. Cumulative Subject Index Volumes 81–94, 96–101 VOLUME 121. Immunochemical Techniques (Part I: Hybridoma Technology and Monoclonal Antibodies) Edited by JOHN J. LANGONE AND HELEN VAN VUNAKIS VOLUME 122. Vitamins and Coenzymes (Part G) Edited by FRANK CHYTIL AND DONALD B. MCCORMICK

xxx

Methods in Enzymology

VOLUME 123. Vitamins and Coenzymes (Part H) Edited by FRANK CHYTIL AND DONALD B. MCCORMICK VOLUME 124. Hormone Action (Part J: Neuroendocrine Peptides) Edited by P. MICHAEL CONN VOLUME 125. Biomembranes (Part M: Transport in Bacteria, Mitochondria, and Chloroplasts: General Approaches and Transport Systems) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 126. Biomembranes (Part N: Transport in Bacteria, Mitochondria, and Chloroplasts: Protonmotive Force) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 127. Biomembranes (Part O: Protons and Water: Structure and Translocation) Edited by LESTER PACKER VOLUME 128. Plasma Lipoproteins (Part A: Preparation, Structure, and Molecular Biology) Edited by JERE P. SEGREST AND JOHN J. ALBERS VOLUME 129. Plasma Lipoproteins (Part B: Characterization, Cell Biology, and Metabolism) Edited by JOHN J. ALBERS AND JERE P. SEGREST VOLUME 130. Enzyme Structure (Part K) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME 131. Enzyme Structure (Part L) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME 132. Immunochemical Techniques (Part J: Phagocytosis and Cell-Mediated Cytotoxicity) Edited by GIOVANNI DI SABATO AND JOHANNES EVERSE VOLUME 133. Bioluminescence and Chemiluminescence (Part B) Edited by MARLENE DELUCA AND WILLIAM D. MCELROY VOLUME 134. Structural and Contractile Proteins (Part C: The Contractile Apparatus and the Cytoskeleton) Edited by RICHARD B. VALLEE VOLUME 135. Immobilized Enzymes and Cells (Part B) Edited by KLAUS MOSBACH VOLUME 136. Immobilized Enzymes and Cells (Part C) Edited by KLAUS MOSBACH VOLUME 137. Immobilized Enzymes and Cells (Part D) Edited by KLAUS MOSBACH VOLUME 138. Complex Carbohydrates (Part E) Edited by VICTOR GINSBURG

Methods in Enzymology

xxxi

VOLUME 139. Cellular Regulators (Part A: Calcium- and Calmodulin-Binding Proteins) Edited by ANTHONY R. MEANS AND P. MICHAEL CONN VOLUME 140. Cumulative Subject Index Volumes 102–119, 121–134 VOLUME 141. Cellular Regulators (Part B: Calcium and Lipids) Edited by P. MICHAEL CONN AND ANTHONY R. MEANS VOLUME 142. Metabolism of Aromatic Amino Acids and Amines Edited by SEYMOUR KAUFMAN VOLUME 143. Sulfur and Sulfur Amino Acids Edited by WILLIAM B. JAKOBY AND OWEN GRIFFITH VOLUME 144. Structural and Contractile Proteins (Part D: Extracellular Matrix) Edited by LEON W. CUNNINGHAM VOLUME 145. Structural and Contractile Proteins (Part E: Extracellular Matrix) Edited by LEON W. CUNNINGHAM VOLUME 146. Peptide Growth Factors (Part A) Edited by DAVID BARNES AND DAVID A. SIRBASKU VOLUME 147. Peptide Growth Factors (Part B) Edited by DAVID BARNES AND DAVID A. SIRBASKU VOLUME 148. Plant Cell Membranes Edited by LESTER PACKER AND ROLAND DOUCE VOLUME 149. Drug and Enzyme Targeting (Part B) Edited by RALPH GREEN AND KENNETH J. WIDDER VOLUME 150. Immunochemical Techniques (Part K: In Vitro Models of B and T Cell Functions and Lymphoid Cell Receptors) Edited by GIOVANNI DI SABATO VOLUME 151. Molecular Genetics of Mammalian Cells Edited by MICHAEL M. GOTTESMAN VOLUME 152. Guide to Molecular Cloning Techniques Edited by SHELBY L. BERGER AND ALAN R. KIMMEL VOLUME 153. Recombinant DNA (Part D) Edited by RAY WU AND LAWRENCE GROSSMAN VOLUME 154. Recombinant DNA (Part E) Edited by RAY WU AND LAWRENCE GROSSMAN VOLUME 155. Recombinant DNA (Part F) Edited by RAY WU VOLUME 156. Biomembranes (Part P: ATP-Driven Pumps and Related Transport: The Na, K-Pump) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER

xxxii

Methods in Enzymology

VOLUME 157. Biomembranes (Part Q: ATP-Driven Pumps and Related Transport: Calcium, Proton, and Potassium Pumps) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 158. Metalloproteins (Part A) Edited by JAMES F. RIORDAN AND BERT L. VALLEE VOLUME 159. Initiation and Termination of Cyclic Nucleotide Action Edited by JACKIE D. CORBIN AND ROGER A. JOHNSON VOLUME 160. Biomass (Part A: Cellulose and Hemicellulose) Edited by WILLIS A. WOOD AND SCOTT T. KELLOGG VOLUME 161. Biomass (Part B: Lignin, Pectin, and Chitin) Edited by WILLIS A. WOOD AND SCOTT T. KELLOGG VOLUME 162. Immunochemical Techniques (Part L: Chemotaxis and Inflammation) Edited by GIOVANNI DI SABATO VOLUME 163. Immunochemical Techniques (Part M: Chemotaxis and Inflammation) Edited by GIOVANNI DI SABATO VOLUME 164. Ribosomes Edited by HARRY F. NOLLER, JR., AND KIVIE MOLDAVE VOLUME 165. Microbial Toxins: Tools for Enzymology Edited by SIDNEY HARSHMAN VOLUME 166. Branched-Chain Amino Acids Edited by ROBERT HARRIS AND JOHN R. SOKATCH VOLUME 167. Cyanobacteria Edited by LESTER PACKER AND ALEXANDER N. GLAZER VOLUME 168. Hormone Action (Part K: Neuroendocrine Peptides) Edited by P. MICHAEL CONN VOLUME 169. Platelets: Receptors, Adhesion, Secretion (Part A) Edited by JACEK HAWIGER VOLUME 170. Nucleosomes Edited by PAUL M. WASSARMAN AND ROGER D. KORNBERG VOLUME 171. Biomembranes (Part R: Transport Theory: Cells and Model Membranes) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 172. Biomembranes (Part S: Transport: Membrane Isolation and Characterization) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER

Methods in Enzymology

xxxiii

VOLUME 173. Biomembranes [Part T: Cellular and Subcellular Transport: Eukaryotic (Nonepithelial) Cells] Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 174. Biomembranes [Part U: Cellular and Subcellular Transport: Eukaryotic (Nonepithelial) Cells] Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 175. Cumulative Subject Index Volumes 135–139, 141–167 VOLUME 176. Nuclear Magnetic Resonance (Part A: Spectral Techniques and Dynamics) Edited by NORMAN J. OPPENHEIMER AND THOMAS L. JAMES VOLUME 177. Nuclear Magnetic Resonance (Part B: Structure and Mechanism) Edited by NORMAN J. OPPENHEIMER AND THOMAS L. JAMES VOLUME 178. Antibodies, Antigens, and Molecular Mimicry Edited by JOHN J. LANGONE VOLUME 179. Complex Carbohydrates (Part F) Edited by VICTOR GINSBURG VOLUME 180. RNA Processing (Part A: General Methods) Edited by JAMES E. DAHLBERG AND JOHN N. ABELSON VOLUME 181. RNA Processing (Part B: Specific Methods) Edited by JAMES E. DAHLBERG AND JOHN N. ABELSON VOLUME 182. Guide to Protein Purification Edited by MURRAY P. DEUTSCHER VOLUME 183. Molecular Evolution: Computer Analysis of Protein and Nucleic Acid Sequences Edited by RUSSELL F. DOOLITTLE VOLUME 184. Avidin-Biotin Technology Edited by MEIR WILCHEK AND EDWARD A. BAYER VOLUME 185. Gene Expression Technology Edited by DAVID V. GOEDDEL VOLUME 186. Oxygen Radicals in Biological Systems (Part B: Oxygen Radicals and Antioxidants) Edited by LESTER PACKER AND ALEXANDER N. GLAZER VOLUME 187. Arachidonate Related Lipid Mediators Edited by ROBERT C. MURPHY AND FRANK A. FITZPATRICK VOLUME 188. Hydrocarbons and Methylotrophy Edited by MARY E. LIDSTROM VOLUME 189. Retinoids (Part A: Molecular and Metabolic Aspects) Edited by LESTER PACKER

xxxiv

Methods in Enzymology

VOLUME 190. Retinoids (Part B: Cell Differentiation and Clinical Applications) Edited by LESTER PACKER VOLUME 191. Biomembranes (Part V: Cellular and Subcellular Transport: Epithelial Cells) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 192. Biomembranes (Part W: Cellular and Subcellular Transport: Epithelial Cells) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 193. Mass Spectrometry Edited by JAMES A. MCCLOSKEY VOLUME 194. Guide to Yeast Genetics and Molecular Biology Edited by CHRISTINE GUTHRIE AND GERALD R. FINK VOLUME 195. Adenylyl Cyclase, G Proteins, and Guanylyl Cyclase Edited by ROGER A. JOHNSON AND JACKIE D. CORBIN VOLUME 196. Molecular Motors and the Cytoskeleton Edited by RICHARD B. VALLEE VOLUME 197. Phospholipases Edited by EDWARD A. DENNIS VOLUME 198. Peptide Growth Factors (Part C) Edited by DAVID BARNES, J. P. MATHER, AND GORDON H. SATO VOLUME 199. Cumulative Subject Index Volumes 168–174, 176–194 VOLUME 200. Protein Phosphorylation (Part A: Protein Kinases: Assays, Purification, Antibodies, Functional Analysis, Cloning, and Expression) Edited by TONY HUNTER AND BARTHOLOMEW M. SEFTON VOLUME 201. Protein Phosphorylation (Part B: Analysis of Protein Phosphorylation, Protein Kinase Inhibitors, and Protein Phosphatases) Edited by TONY HUNTER AND BARTHOLOMEW M. SEFTON VOLUME 202. Molecular Design and Modeling: Concepts and Applications (Part A: Proteins, Peptides, and Enzymes) Edited by JOHN J. LANGONE VOLUME 203. Molecular Design and Modeling: Concepts and Applications (Part B: Antibodies and Antigens, Nucleic Acids, Polysaccharides, and Drugs) Edited by JOHN J. LANGONE VOLUME 204. Bacterial Genetic Systems Edited by JEFFREY H. MILLER VOLUME 205. Metallobiochemistry (Part B: Metallothionein and Related Molecules) Edited by JAMES F. RIORDAN AND BERT L. VALLEE

Methods in Enzymology

xxxv

VOLUME 206. Cytochrome P450 Edited by MICHAEL R. WATERMAN AND ERIC F. JOHNSON VOLUME 207. Ion Channels Edited by BERNARDO RUDY AND LINDA E. IVERSON VOLUME 208. Protein–DNA Interactions Edited by ROBERT T. SAUER VOLUME 209. Phospholipid Biosynthesis Edited by EDWARD A. DENNIS AND DENNIS E. VANCE VOLUME 210. Numerical Computer Methods Edited by LUDWIG BRAND AND MICHAEL L. JOHNSON VOLUME 211. DNA Structures (Part A: Synthesis and Physical Analysis of DNA) Edited by DAVID M. J. LILLEY AND JAMES E. DAHLBERG VOLUME 212. DNA Structures (Part B: Chemical and Electrophoretic Analysis of DNA) Edited by DAVID M. J. LILLEY AND JAMES E. DAHLBERG VOLUME 213. Carotenoids (Part A: Chemistry, Separation, Quantitation, and Antioxidation) Edited by LESTER PACKER VOLUME 214. Carotenoids (Part B: Metabolism, Genetics, and Biosynthesis) Edited by LESTER PACKER VOLUME 215. Platelets: Receptors, Adhesion, Secretion (Part B) Edited by JACEK J. HAWIGER VOLUME 216. Recombinant DNA (Part G) Edited by RAY WU VOLUME 217. Recombinant DNA (Part H) Edited by RAY WU VOLUME 218. Recombinant DNA (Part I) Edited by RAY WU VOLUME 219. Reconstitution of Intracellular Transport Edited by JAMES E. ROTHMAN VOLUME 220. Membrane Fusion Techniques (Part A) Edited by NEJAT DU¨ZGU¨NES, VOLUME 221. Membrane Fusion Techniques (Part B) Edited by NEJAT DU¨ZGU¨NES, VOLUME 222. Proteolytic Enzymes in Coagulation, Fibrinolysis, and Complement Activation (Part A: Mammalian Blood Coagulation Factors and Inhibitors) Edited by LASZLO LORAND AND KENNETH G. MANN

xxxvi

Methods in Enzymology

VOLUME 223. Proteolytic Enzymes in Coagulation, Fibrinolysis, and Complement Activation (Part B: Complement Activation, Fibrinolysis, and Nonmammalian Blood Coagulation Factors) Edited by LASZLO LORAND AND KENNETH G. MANN VOLUME 224. Molecular Evolution: Producing the Biochemical Data Edited by ELIZABETH ANNE ZIMMER, THOMAS J. WHITE, REBECCA L. CANN, AND ALLAN C. WILSON VOLUME 225. Guide to Techniques in Mouse Development Edited by PAUL M. WASSARMAN AND MELVIN L. DEPAMPHILIS VOLUME 226. Metallobiochemistry (Part C: Spectroscopic and Physical Methods for Probing Metal Ion Environments in Metalloenzymes and Metalloproteins) Edited by JAMES F. RIORDAN AND BERT L. VALLEE VOLUME 227. Metallobiochemistry (Part D: Physical and Spectroscopic Methods for Probing Metal Ion Environments in Metalloproteins) Edited by JAMES F. RIORDAN AND BERT L. VALLEE VOLUME 228. Aqueous Two-Phase Systems Edited by HARRY WALTER AND GO¨TE JOHANSSON VOLUME 229. Cumulative Subject Index Volumes 195–198, 200–227 VOLUME 230. Guide to Techniques in Glycobiology Edited by WILLIAM J. LENNARZ AND GERALD W. HART VOLUME 231. Hemoglobins (Part B: Biochemical and Analytical Methods) Edited by JOHANNES EVERSE, KIM D. VANDEGRIFF, AND ROBERT M. WINSLOW VOLUME 232. Hemoglobins (Part C: Biophysical Methods) Edited by JOHANNES EVERSE, KIM D. VANDEGRIFF, AND ROBERT M. WINSLOW VOLUME 233. Oxygen Radicals in Biological Systems (Part C) Edited by LESTER PACKER VOLUME 234. Oxygen Radicals in Biological Systems (Part D) Edited by LESTER PACKER VOLUME 235. Bacterial Pathogenesis (Part A: Identification and Regulation of Virulence Factors) Edited by VIRGINIA L. CLARK AND PATRIK M. BAVOIL VOLUME 236. Bacterial Pathogenesis (Part B: Integration of Pathogenic Bacteria with Host Cells) Edited by VIRGINIA L. CLARK AND PATRIK M. BAVOIL VOLUME 237. Heterotrimeric G Proteins Edited by RAVI IYENGAR VOLUME 238. Heterotrimeric G-Protein Effectors Edited by RAVI IYENGAR

Methods in Enzymology

xxxvii

VOLUME 239. Nuclear Magnetic Resonance (Part C) Edited by THOMAS L. JAMES AND NORMAN J. OPPENHEIMER VOLUME 240. Numerical Computer Methods (Part B) Edited by MICHAEL L. JOHNSON AND LUDWIG BRAND VOLUME 241. Retroviral Proteases Edited by LAWRENCE C. KUO AND JULES A. SHAFER VOLUME 242. Neoglycoconjugates (Part A) Edited by Y. C. LEE AND REIKO T. LEE VOLUME 243. Inorganic Microbial Sulfur Metabolism Edited by HARRY D. PECK, JR., AND JEAN LEGALL VOLUME 244. Proteolytic Enzymes: Serine and Cysteine Peptidases Edited by ALAN J. BARRETT VOLUME 245. Extracellular Matrix Components Edited by E. RUOSLAHTI AND E. ENGVALL VOLUME 246. Biochemical Spectroscopy Edited by KENNETH SAUER VOLUME 247. Neoglycoconjugates (Part B: Biomedical Applications) Edited by Y. C. LEE AND REIKO T. LEE VOLUME 248. Proteolytic Enzymes: Aspartic and Metallo Peptidases Edited by ALAN J. BARRETT VOLUME 249. Enzyme Kinetics and Mechanism (Part D: Developments in Enzyme Dynamics) Edited by DANIEL L. PURICH VOLUME 250. Lipid Modifications of Proteins Edited by PATRICK J. CASEY AND JANICE E. BUSS VOLUME 251. Biothiols (Part A: Monothiols and Dithiols, Protein Thiols, and Thiyl Radicals) Edited by LESTER PACKER VOLUME 252. Biothiols (Part B: Glutathione and Thioredoxin; Thiols in Signal Transduction and Gene Regulation) Edited by LESTER PACKER VOLUME 253. Adhesion of Microbial Pathogens Edited by RON J. DOYLE AND ITZHAK OFEK VOLUME 254. Oncogene Techniques Edited by PETER K. VOGT AND INDER M. VERMA VOLUME 255. Small GTPases and Their Regulators (Part A: Ras Family) Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 256. Small GTPases and Their Regulators (Part B: Rho Family) Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL

xxxviii

Methods in Enzymology

VOLUME 257. Small GTPases and Their Regulators (Part C: Proteins Involved in Transport) Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 258. Redox-Active Amino Acids in Biology Edited by JUDITH P. KLINMAN VOLUME 259. Energetics of Biological Macromolecules Edited by MICHAEL L. JOHNSON AND GARY K. ACKERS VOLUME 260. Mitochondrial Biogenesis and Genetics (Part A) Edited by GIUSEPPE M. ATTARDI AND ANNE CHOMYN VOLUME 261. Nuclear Magnetic Resonance and Nucleic Acids Edited by THOMAS L. JAMES VOLUME 262. DNA Replication Edited by JUDITH L. CAMPBELL VOLUME 263. Plasma Lipoproteins (Part C: Quantitation) Edited by WILLIAM A. BRADLEY, SANDRA H. GIANTURCO, AND JERE P. SEGREST VOLUME 264. Mitochondrial Biogenesis and Genetics (Part B) Edited by GIUSEPPE M. ATTARDI AND ANNE CHOMYN VOLUME 265. Cumulative Subject Index Volumes 228, 230–262 VOLUME 266. Computer Methods for Macromolecular Sequence Analysis Edited by RUSSELL F. DOOLITTLE VOLUME 267. Combinatorial Chemistry Edited by JOHN N. ABELSON VOLUME 268. Nitric Oxide (Part A: Sources and Detection of NO; NO Synthase) Edited by LESTER PACKER VOLUME 269. Nitric Oxide (Part B: Physiological and Pathological Processes) Edited by LESTER PACKER VOLUME 270. High Resolution Separation and Analysis of Biological Macromolecules (Part A: Fundamentals) Edited by BARRY L. KARGER AND WILLIAM S. HANCOCK VOLUME 271. High Resolution Separation and Analysis of Biological Macromolecules (Part B: Applications) Edited by BARRY L. KARGER AND WILLIAM S. HANCOCK VOLUME 272. Cytochrome P450 (Part B) Edited by ERIC F. JOHNSON AND MICHAEL R. WATERMAN VOLUME 273. RNA Polymerase and Associated Factors (Part A) Edited by SANKAR ADHYA VOLUME 274. RNA Polymerase and Associated Factors (Part B) Edited by SANKAR ADHYA

Methods in Enzymology

xxxix

VOLUME 275. Viral Polymerases and Related Proteins Edited by LAWRENCE C. KUO, DAVID B. OLSEN, AND STEVEN S. CARROLL VOLUME 276. Macromolecular Crystallography (Part A) Edited by CHARLES W. CARTER, JR., AND ROBERT M. SWEET VOLUME 277. Macromolecular Crystallography (Part B) Edited by CHARLES W. CARTER, JR., AND ROBERT M. SWEET VOLUME 278. Fluorescence Spectroscopy Edited by LUDWIG BRAND AND MICHAEL L. JOHNSON VOLUME 279. Vitamins and Coenzymes (Part I) Edited by DONALD B. MCCORMICK, JOHN W. SUTTIE, AND CONRAD WAGNER VOLUME 280. Vitamins and Coenzymes (Part J) Edited by DONALD B. MCCORMICK, JOHN W. SUTTIE, AND CONRAD WAGNER VOLUME 281. Vitamins and Coenzymes (Part K) Edited by DONALD B. MCCORMICK, JOHN W. SUTTIE, AND CONRAD WAGNER VOLUME 282. Vitamins and Coenzymes (Part L) Edited by DONALD B. MCCORMICK, JOHN W. SUTTIE, AND CONRAD WAGNER VOLUME 283. Cell Cycle Control Edited by WILLIAM G. DUNPHY VOLUME 284. Lipases (Part A: Biotechnology) Edited by BYRON RUBIN AND EDWARD A. DENNIS VOLUME 285. Cumulative Subject Index Volumes 263, 264, 266–284, 286–289 VOLUME 286. Lipases (Part B: Enzyme Characterization and Utilization) Edited by BYRON RUBIN AND EDWARD A. DENNIS VOLUME 287. Chemokines Edited by RICHARD HORUK VOLUME 288. Chemokine Receptors Edited by RICHARD HORUK VOLUME 289. Solid Phase Peptide Synthesis Edited by GREGG B. FIELDS VOLUME 290. Molecular Chaperones Edited by GEORGE H. LORIMER AND THOMAS BALDWIN VOLUME 291. Caged Compounds Edited by GERARD MARRIOTT VOLUME 292. ABC Transporters: Biochemical, Cellular, and Molecular Aspects Edited by SURESH V. AMBUDKAR AND MICHAEL M. GOTTESMAN VOLUME 293. Ion Channels (Part B) Edited by P. MICHAEL CONN

xl

Methods in Enzymology

VOLUME 294. Ion Channels (Part C) Edited by P. MICHAEL CONN VOLUME 295. Energetics of Biological Macromolecules (Part B) Edited by GARY K. ACKERS AND MICHAEL L. JOHNSON VOLUME 296. Neurotransmitter Transporters Edited by SUSAN G. AMARA VOLUME 297. Photosynthesis: Molecular Biology of Energy Capture Edited by LEE MCINTOSH VOLUME 298. Molecular Motors and the Cytoskeleton (Part B) Edited by RICHARD B. VALLEE VOLUME 299. Oxidants and Antioxidants (Part A) Edited by LESTER PACKER VOLUME 300. Oxidants and Antioxidants (Part B) Edited by LESTER PACKER VOLUME 301. Nitric Oxide: Biological and Antioxidant Activities (Part C) Edited by LESTER PACKER VOLUME 302. Green Fluorescent Protein Edited by P. MICHAEL CONN VOLUME 303. cDNA Preparation and Display Edited by SHERMAN M. WEISSMAN VOLUME 304. Chromatin Edited by PAUL M. WASSARMAN AND ALAN P. WOLFFE VOLUME 305. Bioluminescence and Chemiluminescence (Part C) Edited by THOMAS O. BALDWIN AND MIRIAM M. ZIEGLER VOLUME 306. Expression of Recombinant Genes in Eukaryotic Systems Edited by JOSEPH C. GLORIOSO AND MARTIN C. SCHMIDT VOLUME 307. Confocal Microscopy Edited by P. MICHAEL CONN VOLUME 308. Enzyme Kinetics and Mechanism (Part E: Energetics of Enzyme Catalysis) Edited by DANIEL L. PURICH AND VERN L. SCHRAMM VOLUME 309. Amyloid, Prions, and Other Protein Aggregates Edited by RONALD WETZEL VOLUME 310. Biofilms Edited by RON J. DOYLE VOLUME 311. Sphingolipid Metabolism and Cell Signaling (Part A) Edited by ALFRED H. MERRILL, JR., AND YUSUF A. HANNUN

Methods in Enzymology

xli

VOLUME 312. Sphingolipid Metabolism and Cell Signaling (Part B) Edited by ALFRED H. MERRILL, JR., AND YUSUF A. HANNUN VOLUME 313. Antisense Technology (Part A: General Methods, Methods of Delivery, and RNA Studies) Edited by M. IAN PHILLIPS VOLUME 314. Antisense Technology (Part B: Applications) Edited by M. IAN PHILLIPS VOLUME 315. Vertebrate Phototransduction and the Visual Cycle (Part A) Edited by KRZYSZTOF PALCZEWSKI VOLUME 316. Vertebrate Phototransduction and the Visual Cycle (Part B) Edited by KRZYSZTOF PALCZEWSKI VOLUME 317. RNA–Ligand Interactions (Part A: Structural Biology Methods) Edited by DANIEL W. CELANDER AND JOHN N. ABELSON VOLUME 318. RNA–Ligand Interactions (Part B: Molecular Biology Methods) Edited by DANIEL W. CELANDER AND JOHN N. ABELSON VOLUME 319. Singlet Oxygen, UV-A, and Ozone Edited by LESTER PACKER AND HELMUT SIES VOLUME 320. Cumulative Subject Index Volumes 290–319 VOLUME 321. Numerical Computer Methods (Part C) Edited by MICHAEL L. JOHNSON AND LUDWIG BRAND VOLUME 322. Apoptosis Edited by JOHN C. REED VOLUME 323. Energetics of Biological Macromolecules (Part C) Edited by MICHAEL L. JOHNSON AND GARY K. ACKERS VOLUME 324. Branched-Chain Amino Acids (Part B) Edited by ROBERT A. HARRIS AND JOHN R. SOKATCH VOLUME 325. Regulators and Effectors of Small GTPases (Part D: Rho Family) Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 326. Applications of Chimeric Genes and Hybrid Proteins (Part A: Gene Expression and Protein Purification) Edited by JEREMY THORNER, SCOTT D. EMR, AND JOHN N. ABELSON VOLUME 327. Applications of Chimeric Genes and Hybrid Proteins (Part B: Cell Biology and Physiology) Edited by JEREMY THORNER, SCOTT D. EMR, AND JOHN N. ABELSON VOLUME 328. Applications of Chimeric Genes and Hybrid Proteins (Part C: Protein–Protein Interactions and Genomics) Edited by JEREMY THORNER, SCOTT D. EMR, AND JOHN N. ABELSON

xlii

Methods in Enzymology

VOLUME 329. Regulators and Effectors of Small GTPases (Part E: GTPases Involved in Vesicular Traffic) Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 330. Hyperthermophilic Enzymes (Part A) Edited by MICHAEL W. W. ADAMS AND ROBERT M. KELLY VOLUME 331. Hyperthermophilic Enzymes (Part B) Edited by MICHAEL W. W. ADAMS AND ROBERT M. KELLY VOLUME 332. Regulators and Effectors of Small GTPases (Part F: Ras Family I) Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 333. Regulators and Effectors of Small GTPases (Part G: Ras Family II) Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 334. Hyperthermophilic Enzymes (Part C) Edited by MICHAEL W. W. ADAMS AND ROBERT M. KELLY VOLUME 335. Flavonoids and Other Polyphenols Edited by LESTER PACKER VOLUME 336. Microbial Growth in Biofilms (Part A: Developmental and Molecular Biological Aspects) Edited by RON J. DOYLE VOLUME 337. Microbial Growth in Biofilms (Part B: Special Environments and Physicochemical Aspects) Edited by RON J. DOYLE VOLUME 338. Nuclear Magnetic Resonance of Biological Macromolecules (Part A) Edited by THOMAS L. JAMES, VOLKER DO¨TSCH, AND ULI SCHMITZ VOLUME 339. Nuclear Magnetic Resonance of Biological Macromolecules (Part B) Edited by THOMAS L. JAMES, VOLKER DO¨TSCH, AND ULI SCHMITZ VOLUME 340. Drug–Nucleic Acid Interactions Edited by JONATHAN B. CHAIRES AND MICHAEL J. WARING VOLUME 341. Ribonucleases (Part A) Edited by ALLEN W. NICHOLSON VOLUME 342. Ribonucleases (Part B) Edited by ALLEN W. NICHOLSON VOLUME 343. G Protein Pathways (Part A: Receptors) Edited by RAVI IYENGAR AND JOHN D. HILDEBRANDT VOLUME 344. G Protein Pathways (Part B: G Proteins and Their Regulators) Edited by RAVI IYENGAR AND JOHN D. HILDEBRANDT VOLUME 345. G Protein Pathways (Part C: Effector Mechanisms) Edited by RAVI IYENGAR AND JOHN D. HILDEBRANDT

Methods in Enzymology

xliii

VOLUME 346. Gene Therapy Methods Edited by M. IAN PHILLIPS VOLUME 347. Protein Sensors and Reactive Oxygen Species (Part A: Selenoproteins and Thioredoxin) Edited by HELMUT SIES AND LESTER PACKER VOLUME 348. Protein Sensors and Reactive Oxygen Species (Part B: Thiol Enzymes and Proteins) Edited by HELMUT SIES AND LESTER PACKER VOLUME 349. Superoxide Dismutase Edited by LESTER PACKER VOLUME 350. Guide to Yeast Genetics and Molecular and Cell Biology (Part B) Edited by CHRISTINE GUTHRIE AND GERALD R. FINK VOLUME 351. Guide to Yeast Genetics and Molecular and Cell Biology (Part C) Edited by CHRISTINE GUTHRIE AND GERALD R. FINK VOLUME 352. Redox Cell Biology and Genetics (Part A) Edited by CHANDAN K. SEN AND LESTER PACKER VOLUME 353. Redox Cell Biology and Genetics (Part B) Edited by CHANDAN K. SEN AND LESTER PACKER VOLUME 354. Enzyme Kinetics and Mechanisms (Part F: Detection and Characterization of Enzyme Reaction Intermediates) Edited by DANIEL L. PURICH VOLUME 355. Cumulative Subject Index Volumes 321–354 VOLUME 356. Laser Capture Microscopy and Microdissection Edited by P. MICHAEL CONN VOLUME 357. Cytochrome P450, Part C Edited by ERIC F. JOHNSON AND MICHAEL R. WATERMAN VOLUME 358. Bacterial Pathogenesis (Part C: Identification, Regulation, and Function of Virulence Factors) Edited by VIRGINIA L. CLARK AND PATRIK M. BAVOIL VOLUME 359. Nitric Oxide (Part D) Edited by ENRIQUE CADENAS AND LESTER PACKER VOLUME 360. Biophotonics (Part A) Edited by GERARD MARRIOTT AND IAN PARKER VOLUME 361. Biophotonics (Part B) Edited by GERARD MARRIOTT AND IAN PARKER VOLUME 362. Recognition of Carbohydrates in Biological Systems (Part A) Edited by YUAN C. LEE AND REIKO T. LEE

xliv

Methods in Enzymology

VOLUME 363. Recognition of Carbohydrates in Biological Systems (Part B) Edited by YUAN C. LEE AND REIKO T. LEE VOLUME 364. Nuclear Receptors Edited by DAVID W. RUSSELL AND DAVID J. MANGELSDORF VOLUME 365. Differentiation of Embryonic Stem Cells Edited by PAUL M. WASSAUMAN AND GORDON M. KELLER VOLUME 366. Protein Phosphatases Edited by SUSANNE KLUMPP AND JOSEF KRIEGLSTEIN VOLUME 367. Liposomes (Part A) Edited by NEJAT DU¨ZGU¨NES, VOLUME 368. Macromolecular Crystallography (Part C) Edited by CHARLES W. CARTER, JR., AND ROBERT M. SWEET VOLUME 369. Combinational Chemistry (Part B) Edited by GUILLERMO A. MORALES AND BARRY A. BUNIN VOLUME 370. RNA Polymerases and Associated Factors (Part C) Edited by SANKAR L. ADHYA AND SUSAN GARGES VOLUME 371. RNA Polymerases and Associated Factors (Part D) Edited by SANKAR L. ADHYA AND SUSAN GARGES VOLUME 372. Liposomes (Part B) Edited by NEJAT DU¨ZGU¨NES, VOLUME 373. Liposomes (Part C) Edited by NEJAT DU¨ZGU¨NES, VOLUME 374. Macromolecular Crystallography (Part D) Edited by CHARLES W. CARTER, JR., AND ROBERT W. SWEET VOLUME 375. Chromatin and Chromatin Remodeling Enzymes (Part A) Edited by C. DAVID ALLIS AND CARL WU VOLUME 376. Chromatin and Chromatin Remodeling Enzymes (Part B) Edited by C. DAVID ALLIS AND CARL WU VOLUME 377. Chromatin and Chromatin Remodeling Enzymes (Part C) Edited by C. DAVID ALLIS AND CARL WU VOLUME 378. Quinones and Quinone Enzymes (Part A) Edited by HELMUT SIES AND LESTER PACKER VOLUME 379. Energetics of Biological Macromolecules (Part D) Edited by JO M. HOLT, MICHAEL L. JOHNSON, AND GARY K. ACKERS VOLUME 380. Energetics of Biological Macromolecules (Part E) Edited by JO M. HOLT, MICHAEL L. JOHNSON, AND GARY K. ACKERS VOLUME 381. Oxygen Sensing Edited by CHANDAN K. SEN AND GREGG L. SEMENZA

Methods in Enzymology

xlv

VOLUME 382. Quinones and Quinone Enzymes (Part B) Edited by HELMUT SIES AND LESTER PACKER VOLUME 383. Numerical Computer Methods (Part D) Edited by LUDWIG BRAND AND MICHAEL L. JOHNSON VOLUME 384. Numerical Computer Methods (Part E) Edited by LUDWIG BRAND AND MICHAEL L. JOHNSON VOLUME 385. Imaging in Biological Research (Part A) Edited by P. MICHAEL CONN VOLUME 386. Imaging in Biological Research (Part B) Edited by P. MICHAEL CONN VOLUME 387. Liposomes (Part D) Edited by NEJAT DU¨ZGU¨NES, VOLUME 388. Protein Engineering Edited by DAN E. ROBERTSON AND JOSEPH P. NOEL VOLUME 389. Regulators of G-Protein Signaling (Part A) Edited by DAVID P. SIDEROVSKI VOLUME 390. Regulators of G-Protein Signaling (Part B) Edited by DAVID P. SIDEROVSKI VOLUME 391. Liposomes (Part E) Edited by NEJAT DU¨ZGU¨NES, VOLUME 392. RNA Interference Edited by ENGELKE ROSSI VOLUME 393. Circadian Rhythms Edited by MICHAEL W. YOUNG VOLUME 394. Nuclear Magnetic Resonance of Biological Macromolecules (Part C) Edited by THOMAS L. JAMES VOLUME 395. Producing the Biochemical Data (Part B) Edited by ELIZABETH A. ZIMMER AND ERIC H. ROALSON VOLUME 396. Nitric Oxide (Part E) Edited by LESTER PACKER AND ENRIQUE CADENAS VOLUME 397. Environmental Microbiology Edited by JARED R. LEADBETTER VOLUME 398. Ubiquitin and Protein Degradation (Part A) Edited by RAYMOND J. DESHAIES VOLUME 399. Ubiquitin and Protein Degradation (Part B) Edited by RAYMOND J. DESHAIES VOLUME 400. Phase II Conjugation Enzymes and Transport Systems Edited by HELMUT SIES AND LESTER PACKER

xlvi

Methods in Enzymology

VOLUME 401. Glutathione Transferases and Gamma Glutamyl Transpeptidases Edited by HELMUT SIES AND LESTER PACKER VOLUME 402. Biological Mass Spectrometry Edited by A. L. BURLINGAME VOLUME 403. GTPases Regulating Membrane Targeting and Fusion Edited by WILLIAM E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 404. GTPases Regulating Membrane Dynamics Edited by WILLIAM E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 405. Mass Spectrometry: Modified Proteins and Glycoconjugates Edited by A. L. BURLINGAME VOLUME 406. Regulators and Effectors of Small GTPases: Rho Family Edited by WILLIAM E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 407. Regulators and Effectors of Small GTPases: Ras Family Edited by WILLIAM E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 408. DNA Repair (Part A) Edited by JUDITH L. CAMPBELL AND PAUL MODRICH VOLUME 409. DNA Repair (Part B) Edited by JUDITH L. CAMPBELL AND PAUL MODRICH VOLUME 410. DNA Microarrays (Part A: Array Platforms and Web-Bench Protocols) Edited by ALAN KIMMEL AND BRIAN OLIVER VOLUME 411. DNA Microarrays (Part B: Databases and Statistics) Edited by ALAN KIMMEL AND BRIAN OLIVER VOLUME 412. Amyloid, Prions, and Other Protein Aggregates (Part B) Edited by INDU KHETERPAL AND RONALD WETZEL VOLUME 413. Amyloid, Prions, and Other Protein Aggregates (Part C) Edited by INDU KHETERPAL AND RONALD WETZEL VOLUME 414. Measuring Biological Responses with Automated Microscopy Edited by JAMES INGLESE VOLUME 415. Glycobiology Edited by MINORU FUKUDA VOLUME 416. Glycomics Edited by MINORU FUKUDA VOLUME 417. Functional Glycomics Edited by MINORU FUKUDA VOLUME 418. Embryonic Stem Cells Edited by IRINA KLIMANSKAYA AND ROBERT LANZA

Methods in Enzymology

xlvii

VOLUME 419. Adult Stem Cells Edited by IRINA KLIMANSKAYA AND ROBERT LANZA VOLUME 420. Stem Cell Tools and Other Experimental Protocols Edited by IRINA KLIMANSKAYA AND ROBERT LANZA VOLUME 421. Advanced Bacterial Genetics: Use of Transposons and Phage for Genomic Engineering Edited by KELLY T. HUGHES VOLUME 422. Two-Component Signaling Systems, Part A Edited by MELVIN I. SIMON, BRIAN R. CRANE, AND ALEXANDRINE CRANE VOLUME 423. Two-Component Signaling Systems, Part B Edited by MELVIN I. SIMON, BRIAN R. CRANE, AND ALEXANDRINE CRANE VOLUME 424. RNA Editing Edited by JONATHA M. GOTT VOLUME 425. RNA Modification Edited by JONATHA M. GOTT VOLUME 426. Integrins Edited by DAVID CHERESH VOLUME 427. MicroRNA Methods Edited by JOHN J. ROSSI VOLUME 428. Osmosensing and Osmosignaling Edited by HELMUT SIES AND DIETER HAUSSINGER VOLUME 429. Translation Initiation: Extract Systems and Molecular Genetics Edited by JON LORSCH VOLUME 430. Translation Initiation: Reconstituted Systems and Biophysical Methods Edited by JON LORSCH VOLUME 431. Translation Initiation: Cell Biology, High-Throughput and Chemical-Based Approaches Edited by JON LORSCH VOLUME 432. Lipidomics and Bioactive Lipids: Mass-Spectrometry–Based Lipid Analysis Edited by H. ALEX BROWN VOLUME 433. Lipidomics and Bioactive Lipids: Specialized Analytical Methods and Lipids in Disease Edited by H. ALEX BROWN VOLUME 434. Lipidomics and Bioactive Lipids: Lipids and Cell Signaling Edited by H. ALEX BROWN VOLUME 435. Oxygen Biology and Hypoxia Edited by HELMUT SIES AND BERNHARD BRU¨NE

xlviii

Methods in Enzymology

VOLUME 436. Globins and Other Nitric Oxide-Reactive Protiens (Part A) Edited by ROBERT K. POOLE VOLUME 437. Globins and Other Nitric Oxide-Reactive Protiens (Part B) Edited by ROBERT K. POOLE VOLUME 438. Small GTPases in Disease (Part A) Edited by WILLIAM E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 439. Small GTPases in Disease (Part B) Edited by WILLIAM E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 440. Nitric Oxide, Part F Oxidative and Nitrosative Stress in Redox Regulation of Cell Signaling Edited by ENRIQUE CADENAS AND LESTER PACKER VOLUME 441. Nitric Oxide, Part G Oxidative and Nitrosative Stress in Redox Regulation of Cell Signaling Edited by ENRIQUE CADENAS AND LESTER PACKER VOLUME 442. Programmed Cell Death, General Principles for Studying Cell Death (Part A) Edited by ROYA KHOSRAVI-FAR, ZAHRA ZAKERI, RICHARD A. LOCKSHIN, AND MAURO PIACENTINI VOLUME 443. Angiogenesis: In Vitro Systems Edited by DAVID A. CHERESH VOLUME 444. Angiogenesis: In Vivo Systems (Part A) Edited by DAVID A. CHERESH VOLUME 445. Angiogenesis: In Vivo Systems (Part B) Edited by DAVID A. CHERESH VOLUME 446. Programmed Cell Death, The Biology and Therapeutic Implications of Cell Death (Part B) Edited by ROYA KHOSRAVI-FAR, ZAHRA ZAKERI, RICHARD A. LOCKSHIN, AND MAURO PIACENTINI VOLUME 447. RNA Turnover in Bacteria, Archaea and Organelles Edited by LYNNE E. MAQUAT AND CECILIA M. ARRAIANO VOLUME 448. RNA Turnover in Eukaryotes: Nucleases, Pathways and Analysis of mRNA Decay Edited by LYNNE E. MAQUAT AND MEGERDITCH KILEDJIAN VOLUME 449. RNA Turnover in Eukaryotes: Analysis of Specialized and Quality Control RNA Decay Pathways Edited by LYNNE E. MAQUAT AND MEGERDITCH KILEDJIAN VOLUME 450. Fluorescence Spectroscopy Edited by LUDWIG BRAND AND MICHAEL L. JOHNSON

Methods in Enzymology

xlix

VOLUME 451. Autophagy: Lower Eukaryotes and Non-Mammalian Systems (Part A) Edited by DANIEL J. KLIONSKY VOLUME 452. Autophagy in Mammalian Systems (Part B) Edited by DANIEL J. KLIONSKY VOLUME 453. Autophagy in Disease and Clinical Applications (Part C) Edited by DANIEL J. KLIONSKY VOLUME 454. Computer Methods (Part A) Edited by MICHAEL L. JOHNSON AND LUDWIG BRAND VOLUME 455. Biothermodynamics (Part A) Edited by MICHAEL L. JOHNSON, JO M. HOLT, AND GARY K. ACKERS (RETIRED) VOLUME 456. Mitochondrial Function, Part A: Mitochondrial Electron Transport Complexes and Reactive Oxygen Species Edited by WILLIAM S. ALLISON AND IMMO E. SCHEFFLER VOLUME 457. Mitochondrial Function, Part B: Mitochondrial Protein Kinases, Protein Phosphatases and Mitochondrial Diseases Edited by WILLIAM S. ALLISON AND ANNE N. MURPHY VOLUME 458. Complex Enzymes in Microbial Natural Product Biosynthesis, Part A: Overview Articles and Peptides Edited by DAVID A. HOPWOOD VOLUME 459. Complex Enzymes in Microbial Natural Product Biosynthesis, Part B: Polyketides, Aminocoumarins and Carbohydrates Edited by DAVID A. HOPWOOD VOLUME 460. Chemokines, Part A Edited by TRACY M. HANDEL AND DAMON J. HAMEL

C H A P T E R

O N E

Chemokines in Human Breast Tumor Cells: Modifying Their Expression Levels and Determining Their Effects on the Malignancy Phenotype Gali Soria, Tsipi Meshel, and Adit Ben-Baruch Contents 1. Introduction 2. Modifying Chemokine Expression in Breast Tumor Cells 2.1. Transfection (microporation) procedures: MCF-7, T47D, and MDA-MB-231 cells 2.2. Tumor cell handling after microporation 2.3. Determination of transfection outcome 3. Establishment of Primary Local Breast Tumors and Pulmonary Metastases 3.1. Formation of primary tumors by T47D cells 3.2. Formation of pulmonary metastases by MDA-MB-231 cells Acknowledgments References

4 5 5 8 9 9 10 12 15 15

Abstract Chemokines have been recently recognized as important regulators of breast malignancy; however, much remains unknown regarding their roles in this disease. Improved understanding of chemokine contribution to breast cancer often requires studies in which the expression levels of chemokines by the tumor cells are modified (increased or decreased). In addition, it is essential to determine the roles of various chemokines in experimental in vivo model systems of breast cancer, using hormone-dependent or -independent human breast tumor cells (such as MCF-7, T47D and MDA-MB-231 cells). Since investigators often encounter difficulties in implementing these techniques in their studies of breast cancer, we hereby provide a detailed description of microporation approaches for modifying chemokine expression levels in human breast tumor cells, and of the measures

Department of Cell Research and Immunology, George S. Wise Faculty of Life Sciences, Tel Aviv University, Tel Aviv, Israel Methods in Enzymology, Volume 460 ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)05201-X

#

2009 Elsevier Inc. All rights reserved.

3

4

Gali Soria et al.

required for establishment of xenograft models of primary tumors and of metastasis by such cells. In the breast malignancy context, the guidelines presented herein should enable researchers in the field to establish essential means for determination of chemokine roles in this disease.

1. Introduction A large body of evidence indicates that chemokines are major regulators of malignancy, acting at many different levels to reduce or to promote tumor development and/or progression (Ben-Baruch, 2006a). Chemokine activities in malignancy are mediated primarily by their ability to induce chemotaxis of leukocytes, endothelial cells, and/or the tumor cells. Indeed, it is known that specific chemokines chemoattract to tumor sites leukocyte subpopulations that may promote antitumor activities (such as Th1 cells or natural killer cells), while other chemokines are responsible for large quantities of deleterious tumor-associated macrophages (TAM) at tumor sites (Allavena et al., 2007; Ben-Baruch, 2006a; Soria and Ben-Baruch, 2008; Vandercappellen et al., 2008). In parallel, specific chemokines upregulate endothelial cell migration and proliferation, therefore promoting angiogenesis, whereas other chemokines have powerful angiostatic properties (BenBaruch, 2006a; Salcedo and Oppenheim, 2003; Strieter et al., 2006). Another very important activity of chemokines is induction of tumor cell invasion and migration, thereby playing key roles in dictating site-directed metastasis formation (Ben-Baruch, 2006a, 2007; Zlotnik et al., 2006). Chemokines can execute such multifaceted roles in malignancy because they are expressed by cells of the tumor microenvironment, and in many cases also by the tumor cells themselves. As such, they can affect through autocrine pathways the ability of the cancer cells to express tumorpromoting functions, and can also act in paracrine manners on host cells, thereby influencing their roles in malignancy. Of the various malignant diseases, breast cancer has attracted the attention of many researchers, whose joint efforts have provided improved insights into the roles of chemokines in disease development and progression (Ben-Baruch, 2006a,b, 2007; Soria and Ben-Baruch, 2008; Zlotnik et al., 2006). However, our understanding of chemokine roles in breast cancer is only at its beginning, and extensive research is required in order to enable improved use of chemokines for diagnostic, prognostic, or therapeutic purposes in this disease. To enable better elucidation of the roles played by specific chemokines in breast malignancy, it is necessary to define the autocrine and paracrine effects of tumor-cell–derived chemokines. Such analyses are enabled by studies modulating chemokine expression levels in the tumor cells, either

Chemokine Expression and Effects in Breast Cancer

5

increasing them by overexpression or reducing them by different measures, such as siRNA. In parallel, it is important to determine the effects of chemokine expression levels on tumor growth and metastasis in animal model systems. This can be done by using breast tumor cells that express chemokines endogenously, or alternatively with cells whose chemokine expression levels were modified by appropriate measures. Many researchers find it difficult to reach high transfection yields in breast cancer cells, including the routinely used MCF-7, T47D, and MDAMB-231 cells. In addition, investigators often encounter difficulties in establishing tumors of hormone-dependent human breast tumor cells, or pulmonary metastases. To comply with the needs of investigators in the field, we hereby provide detailed methods for successful modification of chemokine expression levels in human breast tumor cells, by microporation. Thereafter, we describe the procedures of forming primary xenograft tumors by human breast tumor cells in the mammary fat pad of mice, and producing ‘‘experimental’’ pulmonary metastases in female mice.

2. Modifying Chemokine Expression in Breast Tumor Cells In this part, we provide the optimal conditions and procedures for modifying chemokine expression in human breast tumor cells, by microporation. Microporation is a unique electroporation technology using a pipette tip as an electroporation space (http://www.microporator.com). The protocols include microporations of the MCF-7 and T47D hormone-dependent human breast carcinoma cell lines, and of the MDAMB-231 cells that are hormone independent (for details on the cells, please consult the guidelines of the American Type Culture Collection [ATCC]). Using microporation, a high success rate of over 60 to 80% transient transfection can be achieved in the above mentioned breast tumor cells with a variety of vectors, including HA or GFP-tagged vectors coding for chemokines. If selection-carrying vectors are used, one can proceed to establishment of cell populations stably overexpressing the chemokines. Alternatively, the same transfection conditions could be used with the pSUPER vector for expression of short interfering RNA; however, in this case it is essential to have a selective marker that would enable formation of stable transfectants.

2.1. Transfection (microporation) procedures: MCF-7, T47D, and MDA-MB-231 cells Based on our experience, we recommend using the microporation technology in order to transfect the above mentioned breast tumor cells. The MicroPorator (MP-100 MicroPorator) and its accompanying devices and

6

Gali Soria et al.

materials are manufactured by Digital Bio (Seoul, Korea) (http://www. microporator.com). The manufacturer’s instructions include recommended conditions for microporation of a variety of cell types, including MCF-7, T47D, and MDA-MB-231 cells. Nevertheless, we have performed careful calibrations for microporation of MCF-7 and T47D cells, leading to improved transfection yields and cell survival rates (please see below). Accordingly, we provide detailed microporation conditions for these two cell lines. For MDA-MB-231 cells, we describe one of the three conditions that were recommended by the manufacturer, which we found highly suitable in terms of transfection yields and cell viability. 2.1.1. Required materials Devices and materials of the microporation apparatus Digital Bio (http:// www.microporator.com) provides the main device (MP-100 MicroPorator), Pipette Station, MicroPorator pipettes, gold-tips, microporation tubes, and buffers (Buffer R, resuspension buffer; Buffer E, electrolytic buffer). Additional materials


Cells of interest: MCF-7, T47D, and MDA-MB-231 cells can all be obtained from the American Type Culture Collection (ATCC).
DNA of interest: DNA of high quality (endotoxin-free plasmid DNA) is recommended, although lower-grade DNA would also allow reasonable yields of transfection.
Growth medium: The growth medium for the cells contains DMEM supplemented with 10% FCS and 2% glutamine. Antibiotics (e.g., penicillin, streptomycin, nystatin) could be used during cell growth, but should be avoided in the microporation stage (see Section 2.1.2). Although MCF-7 and T47D cells are hormone dependent, in most laboratories they are routinely grown in culture without estrogen (17b-estradiol, E2) or progesterone. Under these conditions, the cells are highly proliferative, and respond well to a variety of stimuli without hormone supplementation. However, the growth of these cells in in vivo xenograft models depends exclusively on estrogen (see Section 3). Please note that in specific studies there may be a need, or interest, to perform experiments in cells that were stimulated by the relevant hormones, estrogen or estrogen þ progesterone. In such case, the cells are routinely grown without the hormones, and are then exposed to a cycle of stimulation by the hormones. Cells undergoing hormonal treatment should be grown in phenol-red free medium, supplemented by charcoalstripped serum. For cell growth with estrogen only, the hormone (E8875, Sigma Aldrich, St. Louis, MO) is added at 10–8 or 10–9 M, for 3 to 7 consecutive days (conditions used vary by laboratory). The culture medium (phenol-red free, including charcoal-stripped serum) should be

Chemokine Expression and Effects in Breast Cancer

7

replaced daily. For estrogen þ progesterone stimulation, the cells are cultured first with estrogen for 1 day (as above), and for additional 2 days in the presence of estrogen þ progesterone (progesterone: P6149, Sigma), both at 108 M. As before, the medium (phenol-red free, including charcoal-stripped serum) should be replaced daily. Other reagents



Trypsin-EDTA solution (trypsin 0.25%, EDTA 0.05%) Caþþ and Mgþþ-free PBS1

Disposables



1.5-ml (Eppendorf) and 10-ml tubes 6 and 10-cm tissue culture plates

2.1.2. Tumor cell preparation for microporation One day prior to microporation Culture the cells in a 10 cm tissue culture plate with fresh growth medium. The cells should reach 60 to 80% confluency on the microporation day. On the day of microporation You will need warm trypsin solution for cell removal from growth plates. You also need warm growth medium for trypsin neutralization, and for the microporation procedure (See note at the end of the paragraph). Therefore, prewarm an aliquot of the trypsin solution and of the growth medium at 37 . Following microporation, you will need to transfer the cells from each microporation tube to a tissue culture plate with growth medium containing serum and supplements. For T47D cells, use a 6 cm tissue culture plate with 3 ml medium for each microporation; for MCF-7 and MDA-MB-231 cells, use a 10 cm tissue culture plate with 8 ml of medium for each microporation. Prepare such plate/s in advance, in a humidified 37 , 5% CO2 incubator. Note: Do not add antibiotics (e.g., penicillin, streptomycin, nystatin) to the growth medium, which is added to the cells prior to microporation. The antibiotics can be added afterward to the collecting tissue culture plates, used at the end of the microporation stage. Prior to the microporation step itself, prepare the cells together with the DNA. To this end, trypsinize the cells with trypsin-EDTA solution, neutralize the trypsin by antibiotic free, serum-containing growth medium. The procedure described below is suitable for one transfection of 1.2  106 cells: Pellet your pool of tumor cells at 1200 rpm (140g) for 7 min at room temperature (RT). Count the cells and pellet 1.2  106 cells in 1.5 ml (Eppendorf ) tube at 2000 rpm (400g) for 3 min at RT. Following cell washing

8

Gali Soria et al.

in 1 ml of Caþþ and Mgþþ-free PBSx1, resuspend the cell pellet in 120 ml buffer R (107 cells/ml). Add 5 mg of plasmid DNA into the 1.5 ml tube and gently pipette the cells up and down. Avoid storing the tube longer than 15 to 30 min at RT, as this would reduce transfection efficiency and cell viability. 2.1.3. Microporation The microporations are done in 10-ml or 100-ml gold-tips, which are inserted into the microporation tube. The size of the tip, whether 10 ml or 100 ml, depends on the amount of cells undergoing microporation, according to the manufacturer’s instructions. For example, for microporation of 1.2  106 cells, use a 100-ml gold-tip. Please note that you first need to prepare the microporation apparatus and set up the pulse conditions. Only then can you proceed to perform the microporation step itself.


Preparation of the microporation apparatus: To prepare the apparatus, add 3 ml of Buffer E into the microporation tube. Then set up the pulse conditions of the pipette station, as follows: For MCF-7 cells: pulse voltage, 1100; pulse width, 20; pulse number, 2. For T47D cells: pulse voltage, 1100; pulse width, 20; pulse number, 2. For MDA-MB-231 cells: pulse voltage, 1350; pulse width, 20; pulse number, 2.
Performing the microporation: The following details are suitable for each microporation of 1.2  106 cells by a 100-ml gold-tip: Mix the cell-DNA mixture gently with a standard pipette, and then aspirate the cell-DNA mixture using the MicroPorator pipette carrying the gold-tip. Avoid air bubbles during pipetting (the smallest air bubble would induce a spark that will ruin the transfection). Afterward, insert the MicroPorator pipette into the Pipette Station and press the Start button on the LCD panel. When the high-voltage button turns red, press it to transfect by the MicroPorator. After the pulse, immediately transfer the cell sample into the 6-cm plate (for T47D cells) or 10-cm plate (for MCF-7 and MDAMB-231 cells) that was prepared in advance with warm growth medium (can include antibiotics).

2.2. Tumor cell handling after microporation Immediately after the microporation, rock the plates gently to ensure even distribution of the cells. Next, incubate the plate at 37 in a humidified CO2 incubator. In transient transfections, checking the chemokine expression 2 days after microporation is advised. For establishment of cell populations that express the vector in a stable fashion, add the appropriate antibiotic 1 or 2 days after the microporation, as applicable.

9

Chemokine Expression and Effects in Breast Cancer

CCL5 extracellular expression (OD–450 nm)

1.4 1.2

*

1 0.8 0.6 0.4 0.2 0

pE-GFP

pE-GFP-CCL5

Figure 1.1 Overexpression of CCL5 in MCF-7 human breast carcinoma cells. MCF-7 cells were transfected with pE-GFP or pE-GFP-CCL5 vectors, following the procedures detailed above. Stable transfectants of both cell types were cultured under similar conditions for 24 h in serum-free medium.The expression of secreted CCL5 was determined in cell supernatants of stable transfectants by ELISA assays, using coating and detecting antibodies to GFP.The high expression levels of CCL5 in pE-GFP-CCL5 transfectants, as compared to the pE-GFP control transfected cells, were confirmed by ELISA assays with coating and detecting antibodies to CCL5 (data not shown). The analyses were done at the linear range of absorbance (*p ¼ 0.03).

2.3. Determination of transfection outcome According to the vectors used for transfection, and whether overexpression or downregulation of chemokine expression was performed, chemokine expression in the transfected cells can be determined in several ways. Although this chapter does not discuss in detail the methods for determination of transfection outcome, we would like to note that chemokine expression could be evaluated by ELISA assays, Western blots, FACS analyses, and/or confocal analyses (e.g., if a GFP-carrying vector was used). Accordingly, Fig. 1.1 shows the overexpression of CCL5 in stable MCF-7 transfectants, determined by ELISA.

3. Establishment of Primary Local Breast Tumors and Pulmonary Metastases In this section, we provide detailed description of the methods for establishment of primary tumors and pulmonary metastases in xenograft model systems using human breast cancer cells. Procedures are given for two cell types, T47D and MDA-MB-231. (See note concerning MCF-7 cells.

10

Gali Soria et al.

For details on the cells, consult the guidelines of the American Type Culture Collection [ATCC].)


T47D cells: When the appropriate conditions are used, these hormonedependent human breast cancer cells give a high yield of primary local tumors in the mammary fat pad of female mice. However, due to their relatively mild aggressiveness, these cells do not form metastases.

Note: Similar to T47D cells, tumor formation by MCF-7 cells is highly dependent on estrogen supplementation. In essence, it is expected that the procedure for in vivo tumor formation by MCF-7 cells would follow the guidelines of T47D cells. Nevertheless, laboratories use different variants of these cells, such as the MCF-7-ras cells (expressing activated ras oncogene), which form tumors in the absence of exogenous estrogen and form pulmonary metastases as well (Karnoub et al., 2007; Orimo et al., 2005).


MDA-MB-231 cells: These are highly metastatic, hormone-independent human breast carcinoma cells. In procedures of intravenous injection of the tumor cells, these cells form ‘‘experimental’’ pulmonary metastasis (in contrast to ‘‘spontaneous’’ pulmonary metastases, which are derived from the primary tumor) with very high yield.

To elucidate the roles of chemokines in tumor growth and metastasis formation, many different measures could be taken. Between others, they include overexpression of chemokines or of chemokine knock-down in the tumor cells, as described above. In these cases, one should consider the use of vectors in which the transcription of the chemokine can be controlled in vivo.

3.1. Formation of primary tumors by T47D cells As indicated above (Section 2.1.1), although T47D cells are hormonedependent, they are usually kept in culture without estrogen/progesterone supplementation. Under these conditions, the cells proliferate and respond well to a variety of stimuli. In case of need or interest, estrogen (with or without progesterone) can be added to the cells (as described in Section 2.1.1). In contrast, the in vivo growth of T47D cells is strictly dependent on estrogen supplementation. Therefore, 9 to 10 days prior to tumor cell injection, the mice have to be implanted with estrogen pellets (details follow). In addition, the cells are injected together with matrigel, shown to be extremely useful in establishing xenografts by many human cancer cell lines (Mullen et al., 1996). The matrigel is a solubilized tissue basement membrane matrix rich in extracellular matrix proteins, which was originally isolated from the Engelbreth-Holm-Swarm (EHS) mouse tumor.

Chemokine Expression and Effects in Breast Cancer

11

3.1.1. Required materials Mice and supplementary material for tumor cell injection







Mice: Female SCID mice, 6 to 8 weeks of age (e.g., CB-17-SCID-BG mice, Harlan, Indianapolis, IN, catalog no. 2CB17BG25). Estrogen pellets: 17b-estradiol, 60-day–release pellets of 1.7 mg/pellet (Innovative Research of America, Sarasota, FL) Trochar: 10-gauge (MP-182, Innovative Research of America) Matrigel (FAL356234, BD Biosciences) Growth medium and trypsin-EDTA solution (as above) PBS1

Disposables


1.5-ml (Eppendorf ) tubes, 10-ml round-bottom tubes, 1 ml-syringes, needles (25 gauge)

3.1.2. Mice handling prior to tumor cell inoculation Maintain a colony of female SCID mice under specific pathogen-free (SPF) conditions. This includes autoclaved water and food, and filtered cages. Let mice acclimatize for 3 to 5 days prior to implantation of estrogen pellets. The implantation of the pellets is performed 9 to 10 days prior to injection of the tumor cells. The pellets are implanted with trochar to the lateral side of the neck of the mouse. To this end, put the estrogen pellet in a standing position on the needle of the trochar away from sharp edge. Press the trochar gently, so that the estrogen pellet would be stable in this position (if the trochar is pointed downward, the pellet should not fall). Hold the trochar with your stronger hand. With the other hand, lift skin on the lateral side of the neck of the mouse and insert the trochar. When the pellet contacts the skin, twist the trochar sideways and insert pellet. 3.1.3. Tumor cell preparation One day prior to tumor cell injection A day before tumor cell injection, you need to pre-prepare both the matrigel and the cells. The matrigel forms a highly viscous gel above 10 . To avoid this gel formation, the matrigel should be kept cold throughout the experimental stages. To this end, put the matrigel 1 day prior to the injection at 4 . Also, cool to 4 all the necessary equipments (syringes, needles, pipettes, etc.). T47D cells should be cultured 1 day before their injection in 10-cm tissue-culture plates with fresh growth medium, so that they will reach 60 to 80% confluency on the injection day.

12

Gali Soria et al.

On the day of tumor cell injection T47D cells are injected at concentration of 5  105 cells/100 ml, 100 ml/mouse in a suspension that contains matrigel. The procedure provided below is suitable for injection to 20 mice. Note that the amounts of cells and matrigel that are given below are suitable for 40 mice: They were calculated in a large excess due to a considerable loss of material at the time of cell injection. On the whole, you would need 2  107 cells. On the day of cell injection, prewarm an aliquot of the culture medium and the trypsin-EDTA solution. Trypsinize the cells, neutralize the trypsin with serum-containing growth medium, and centrifuge the cells at 1200 rpm (140g) for 7 min at 4 . Next, resuspend the pelleted cells in growth medium and after counting them, transfer 2  107 cells to a 10-ml round bottom tube. Pellet the cells by centrifugation as above, wash them with 10 ml PBS 1, aspirate the PBS, and transfer the resuspended cells to 4 . Adjust the volume to 2 ml with fresh and ice-cold PBS 1, and mix the cell suspension with 2 ml of ice-cold matrigel. The resulting cell-matrigel mixture would be at a final concentration of 5  106 cells/ml. To avoid warming of the cell-matrigel mixture, and due to its high viscosity, aliquoting the cell-matrigel mixture into several aliquots is advised. In the specific example given previously, the cells can be aliquoted to eight 1.5-ml (Eppendorf) tubes, each containing 500 ml of the cell-matrigel mixture. Keep the tubes on wet ice until injection.

3.1.4. Tumor cell inoculation to mice Tumor cell injection is done subcutaneously at the mammary fat pad. Mix gently one aliquot of cell-matrigel mixture. Draw 100 ml of the mixture into 1-ml syringe without a needle. Then, add a 25-gauge needle, and inject cells slowly (5 to 6 s) to the lower-right mammary fat pad of the mouse. 3.1.5. Determining tumor growth and survival Tumors start developing within several days following tumor cell injection (Fig. 1.2A), at times in proximity to the abdomen surface, and in others internally. Follow tumor establishment daily, feeling the developing tumors with your fingertips. Determine the lag period until tumor appearance and survival of the mice. The size of the tumors in three dimensions can be determined by calibrated caliper in excised tumors, after sacrificing the mice.

3.2. Formation of pulmonary metastases by MDA-MB-231 cells 3.2.1. Required materials Mice and supplementary material for tumor cell injection


Mice: Female SCID mice, 6 to 8 weeks of age (e.g., CB-17-SCID-BG mice, Harlan, Indianapolis, IN, catalog no. 2CB17BG25)

13

Chemokine Expression and Effects in Breast Cancer

% Mice with tumors

A

120 100 80 60 40 20 0

0

5

B

10 Days

15

20

C Mouse no.

Number of metastases *

1 2 3 4 5 6 7

>300 >300 240 211 138 134 +++

Figure 1.2 Formation of primary tumors and pulmonary metastases by human breast carcinoma cells in female SCID mice. (A) Formation of primary tumors in the mammary fat pad of female SCID mice byT47D cells. T47D cells were injected subcutaneously to the mammary fat pads of five female SCID mice, in concentrations of 5  105 cells/100 ml, 100 ml per mouse. Tumor formation was followed daily. (B) Formation of pulmonary metastases in female SCID mice by MDA-MB-231 cells. MDA-MB-231 cells were injected intravenously to the tail vein of seven female SCID mice, in concentrations of 7.5  105 cells/100 ml, 100 ml per mouse. The mice were sacrificed 21 days after tumor cell inoculation. Metastases were counted following injection of india ink solution. *In all cases, micrometastases were present, but they were not counted. þþþA mouse in which only micrometastases were detected. (C) White pulmonary metastases detected against the black background of india ink^stained lung.



Growth medium and trypsin-EDTA solution (as above) PBS 1

Other materials



India ink solution (15% india ink, 85% water, 3 drops NH4OH/100 ml) Feket’s solution (300 ml 70% ethanol, 30 ml 37% formaldehyde, 5 ml glacial acetic acid)
Lamp (to warm the mice) and restraining tube (for holding the mice) Disposables:


10 ml round bottom tubes, 1-ml syringes, needles (25 gauge)

14

Gali Soria et al.

3.2.2. Mice handling prior to tumor cell inoculation Maintain a colony of female SCID mice under specific pathogen-free (SPF) conditions. This includes autoclaved water and food, and filtered cages. Let mice acclimatize for 3 to 5 days prior to tumor cell injection. 3.2.3. Tumor cell preparation One day prior to tumor cell injection One day prior to tumor cell injection, transfer the MDA-MB-231 tumor cells into a 10-cm tissue culture plate with fresh growth medium, to reach 60 to 80% confluency on the day of injection. On the day of tumor cell injection The MDA-MB-231 cells are injected at a concentration of 7.5  105 cells/100 ml, 100 ml/mouse. The procedure provided in the following is suitable for injection of 20 mice. On the whole, you would need a total of 1.5  107 cells; however, preparing extra cells, such as a total of 2  107 cells, is advisable. On the day of tumor cell injection, prewarm an aliquot of culture medium and the trypsin-EDTA solution. Following cell trypsinization, neutralize the trypsin with serum-containing growth medium, and centrifuge the cells at 1200 rpm (140g) for 7 min at 4 . Next, resuspend the cell pellet with 5 ml of growth medium and count the cells. Transfer 2  107 cells to a 10-ml round-bottom tube and pellet the cells by centrifugation at 1200 rpm for 7 min at 4 . Wash the cells with 10 ml PBS 1 and aspirate the PBS, and then add fresh PBS 1 to a final volume of 2.7 ml, leading to final cell concentration of 7.5  106 cells/ml. Keep the cells on ice until injection of the tumor cells.

3.2.4. Tumor cell inoculation to mice The MDA-MB-231 cells are routinely injected intravenously. To this end, warm mice with a lamp until they rub their faces and veins are visible. Following gentle cell mixing, load a syringe with the cells, and tap the bubbles out. Place mouse in restraining tube, pulling gently on the tail until taut, rub the tail with 70% alcohol, and inject the tumor cells into the tail vein. Wipe with tissue. 3.2.5. Determining formation of pulmonary metastases Upon intravenous injection, MDA-MB-231 cells give rise to a large number of pulmonary metastases. One cannot detect metastases without sacrificing the mice; therefore, you need to follow the mice daily and sacrifice them when they weaken, that is, when their fur is not shiny and their appearance seems abnormal. A heavy load of metastases usually develops within 3 weeks after tumor cell injection (Fig. 1.2B).

Chemokine Expression and Effects in Breast Cancer

15

For determination of pulmonary metastases, sacrifice the mice according to local procedures; avoid neck dislocation. Pulmonary metastases are detected by intratracheal injection of india ink solution, which stains the lungs black, leaving the white metastases visible (Fig. 1.2C). To this end, the trachea of the dead animal should be dissected free from the surrounding structures (e.g., by putting tweezers under the trachea). The india ink solution (2 to 4 ml) should be injected via the trachea into the lungs until each of the lobes is inflated and stains black. Dislocate the lungs and wash the india ink in double-distilled water. Next, place the lungs in fresh Feket’s solution for 24 h at RT. In parallel to weighing the lungs, count white metastases against the black color of the lung background. Please note that when a heavy metastatic load is obtained, some of the metastases may merge together, and counting may be difficult. In such a case, a binocular may be of assistance, enabling a certain degree of discrimination between the merging metastases.

ACKNOWLEDGMENTS The research relevant to this paper was supported by The Israel Science Foundation; The Israel Cancer Association; The Ela Kodesz Institute for Research on Cancer Development and Prevention; The Federico Foundation.

REFERENCES Allavena, P., Sica, A., Solinas, G., Porta, C., and Mantovani, A. (2007). The inflammatory micro-environment in tumor progression: The role of tumor-associated macrophages. Crit. Rev. Oncol. Hematol. 67, 11438–11446. Ben-Baruch, A. (2006a). The multifaceted roles of chemokines in malignancy. Cancer Metastasis Rev. 25, 357–371. Ben-Baruch, A. (2006b). ‘‘Pro-malignancy and putative anti-malignancy chemokines in the regulation of breast cancer progression.’’ In Veskler, Barbara A., ed., Focus on Immunology Research, pp. 1–46. Nova Science Publisher, New York. Ben-Baruch, A. (2007). Organ selectivity in metastasis: Regulation by chemokines and their receptors. Clin. Exp. Metastasis 25, 345–356. Karnoub, A. E., Dash, A. B., Vo, A. P., Sullivan, A., Brooks, M. W., Bell, G. W., Richardson, A. L., Polyak, K., Tubo, R., and Weinberg, R. A. (2007). Mesenchymal stem cells within tumour stroma promote breast cancer metastasis. Nature 449, 557–563. Mullen, P., Ritchie, A., Langdon, S. P., and Miller, W. R. (1996). Effect of Matrigel on the tumorigenicity of human breast and ovarian carcinoma cell lines. Int. J. Cancer 67, 816–820. Orimo, A., Gupta, P. B., Sgroi, D. C., Arenzana-Seisdedos, F., Delaunay, T., Naeem, R., Carey, V. J., Richardson, A. L., and Weinberg, R. A. (2005). Stromal fibroblasts present in invasive human breast carcinomas promote tumor growth and angiogenesis through elevated SDF-1/CXCL12 secretion. Cell 121, 335–348. Salcedo, R., and Oppenheim, J. J. (2003). Role of chemokines in angiogenesis: CXCL12/ SDF-1 and CXCR4 interaction, a key regulator of endothelial cell responses. Microcirculation 10, 359–370.

16

Gali Soria et al.

Soria, G., and Ben-Baruch, A. (2008). The inflammatory chemokines CCL2 and CCL5 in breast cancer. Cancer Lett. 267, 281–285. Strieter, R. M., Burdick, M. D., Mestas, J., Gomperts, B., Keane, M. P., and Belperio, J. A. (2006). Cancer CXC chemokine networks and tumour angiogenesis. Eur. J. Cancer 42, 768–778. Vandercappellen, J., Van Damme, J., and Struyf, S. (2008). The role of CXC chemokines and their receptors in cancer. Cancer Lett. 267, 226–244. Zlotnik, A., Yoshie, O., and Nomiyama, H. (2006). The chemokine and chemokine receptor superfamilies and their molecular evolution. Genome Biol. 7, 243.

C H A P T E R

T W O

CCR5 Pharmacology Methodologies and Associated Applications Roy Mansfield,* Sarah Able,* Paul Griffin,* Becky Irvine,* Ian James,* Malcolm Macartney,* Ken Miller,† James Mills,* Carolyn Napier,* Iva Navratilova,* Manos Perros,* Graham Rickett,* Harriet Root,* Elna van der Ryst,* Mike Westby,* and Patrick Dorr* Contents 1. Introduction 2. CCR5 Signaling Assays and Application to Quantify and Characterize Ligand-Dependent Agonism, Antagonism, and Inverse Agonism 2.1. CCR5-mediated Ca2þ signaling 2.2. CCR5 cellular internalization assay 2.3. Application of CCR5 receptor internalization assay to investigate antagonist-dependent functional receptor occupancy in vivo (clinical trials) 2.4. GTP-associated CCR5 inverse agonism assay 2.5. cAMP-response-element-luciferase reporter gene assay 3. CCR5-Associated Ligand-Binding Assays 3.1. Radiolabeled CCR5 chemokine-binding assays 3.2. Radiolabeled antagonist-binding and -dissociation assays 3.3. Real-time ligand binding using Biacore technology 3.4. Real time HIV-1 gp120-CCR5 binding assay 3.5. Application of gp120 binding to characterize functional occupancy in vitro 4. Surrogate In Vitro Antiviral Assays 4.1. HIV-1 gp160-CCR5–mediated cell–cell fusion assay 4.2. Antiviral assays 5. CCR5 Site-Directed Mutagenesis and Ligand Docking Studies 5.1. Structural model generation 5.2. CCR5 site-directed mutagenesis

* {

18

19 19 24

25 28 30 33 33 34 34 35 37 38 38 40 43 44 45

Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom Pfizer GRD-Groton Laboratories, Groton, Connecticut, USA

Methods in Enzymology, Volume 460 ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)05202-1

#

2009 Elsevier Inc. All rights reserved.

17

18

Roy Mansfield et al.

5.3. Transfection of HEK Ga15 cells with pIRESneo-CCR5 (various isoforms) and pCRE-luc 5.4. CRE-Luc reporter assay 5.5. Example results/data 6. Non-HIV Indications–Associated Studies, Human CCR5 Knock-In Mice 6.1. Vector construction for hCCR5 knock-in 6.2. Transfection and human CCR5 knock-in mouse generation 6.3. Materials References

45 46 46 48 48 49 50 52

Abstract The G protein–coupled chemokine (C-C motif ) receptor, CCR5, was originally characterized as a protein responding functionally to a number of CC chemokines. As with chemokine receptors in general, studies indicate that CCR5 plays a role in inflammatory responses to infection, although its exact role in normal immune function is not completely defined. The vast majority of research into CCR5 has been focused on its role as an essential and predominant coreceptor for HIV-1 entry into host immune cells. Discovery of this role was prompted by the elucidation that individuals homozygous for a 32 bp deletion in the CCR5 gene do not express the receptor at the cell surface, and as a consequence, are remarkably resistant to HIV-1 infection, and apparently possess no other clear phenotype. Multiple studies followed with the ultimate aim of identifying drugs that functionally and physically blocked CCR5 to prevent HIV-1 entry, and thus provide a completely new approach to treating infection and AIDS, the world’s biggest infectious disease killer. To this end, functional antagonists with potent anti–HIV-1 activity have been discovered, as best exemplified by maraviroc, the first new oral drug for the treatment of HIV-1 infection in 10 years. In this chapter, the specific methods used to characterize CCR5 primary pharmacology and apply the data generated to enable drug discovery, notably maraviroc, for the treatment of HIV infection and potentially inflammatory-based indications, are described.

1. Introduction The CCR5-associated methods included in this chapter are described in fine detail to enable their various subtleties to be captured as far as possible for the reader, especially where the method in question is subject to failure due to minor changes in assay conditions. As the predominant application of CCR5 research is toward the discovery of agents to treat HIV infection, CCR5-associated virology methodologies are included. Where helpful for the reader, specific reagent volumes and working conditions are also described as ‘‘typical’’ in order to help their transfer to practical laboratory

CCR5 Primary Pharmacology Methods and Applications

19

situations. Where such fine details are captured elsewhere, an outline is given with the associated citation for the sake of brevity. Where methods and applications are described, but not available for transfer to third-party laboratories due to their proprietary nature, a citation and overview of the method are described. Example data, results, and application for specific methods are also described or cited both for purposes of providing information per se as well as to enable assay setup in independent laboratories where applicable or desired. The antagonists and agonists either discovered or used to exemplify the methods and associated applications or results are described in Table 2.1 with specific citation for each provided in the text.

2. CCR5 Signaling Assays and Application to Quantify and Characterize Ligand-Dependent Agonism, Antagonism, and Inverse Agonism Chemokine interaction with CCR5 initiates several events. The receptor associates with G proteins, leading to activation of signaling processes, that is, changes in receptor conformation, G-protein interaction and GTP binding, and intracellular Ca2þ redistribution and receptor internalization. A number of cognate/endogenous CC chemokines (see Table 2.2) bind to CCR5 with different affinities and abilities to activate the receptor (Blanpain et al., 2003). Discovery and characterization of novel, noncognate ligands, including quantification of their inhibitory (i.e., antagonistic) potencies can be determined using the various assays developed to measure chemokine-induced CCR5 signaling. The methods can be applied to show the qualitative functional binding of a ligand (i.e., agonism, inverse agonism, and functional antagonism), and the quantification in potency (i.e., EC50 [agonists]) or IC50 [antagonists]).

2.1. CCR5-mediated Ca2þ signaling This method was adapted from a previous reported methodology (Combadiere et al., 1996), and a summary with application for drug discovery has been reported (Dorr et al., 2005b; Napier et al., 2005). A CCR5 agonist would be expected to trigger a cascade of intracellular signaling events that may lead to activation of the target cell. Conversely, a functional antagonist or inverse agonist of the receptor would bind without triggering an intracellular signal to prevent attachment of the cognate chemokines and subsequent signaling events. Agonists bind to the CCR5 receptor to induce a signal transduction cascade provoking, among other events, redistribution of intracellular Ca2þ from the endoplasmic reticulum (i.e., Ca2þ flux). Ca2þ flux can be measured by the increase in fluorescence of an intracellular dye

Table 2.1 CCR5 antagonists described in this chapter CCR5 antagonist: status/application

Structure and general chemotype

Maraviroc (UK-427857): Approved drug for the F treatment of HIV-1 infection (Dorr et al., F 2005b; Dorr and Perros, 2008; Fatkenheuer et al., 2008)

N N H N

N

N

O

Tropane azole N

PF-232798: Phase 2 (Dorr et al., 2008)

N H N

N

O

N

O F Tropane imidazipiperidine

UK-484900: Eexperimental CCR5 antagonist and inflammatory indications tool

N N H N

N

N

O O

O F Tropane imidazipiperidine

N

PF-501606: Experimental antagonist and docking standard.

O N

N

O N O

N

Tropane imidazopiperidine

x

Table 2.1 (continued) CCR5 antagonist: status/application

Structure and general chemotype N

UK-396794: Experimental CCR5 antagonist O (Dorr et al., 2005a; Haworth et al., 2007)

N H N

N

O

Tropane benzimidazole

Me

UK-433370: Experimental CCR5 antagonist (Dorr et al., 2005a)

F

N N

H N

F

N

N

O

Tropane azole N

O

UK-438235: Experimental CCR5 antagonist (Haworth et al., 2007)

N

N H N

N

Tropane benzimidazole O

SCH-C Former clinical candidate (Tsamis et al., 2003a)

N

N+

O−

N

O N

Br Bis-piperidine

(continued)

22

Roy Mansfield et al.

Table 2.1 (continued) CCR5 antagonist: status/application

Structure and general chemotype N

UK-107543: CCR5 HTS hit (agonist) (Dorr et al., 2005b)

N

N

N

Imidazopyridine

Table 2.2 Cognate ligands for CCR5 Systematic ligand name

Original ligand name

CCL3 CCL4 CCL5

MIP-1a (macrophage inflammatory protein 1a) MIP-1b (macrophage inflammatory protein 1a) RANTES (regulated on activation, normally T -cell expressed and secreted)

CCL7 CCL8 CCL14 CCL3L1

MCP-2 (monocyte chemoattractant protein 1) HCC-1 (Haemofiltrate CC chemokine 1) LD78b

resulting from its combination with intracellular Ca2þ released from the ER. This can be monitored in real time using a fluorescent laser imaging plate reader (FLIPR) or an equivalent workstation technology. This allows a real-time assay of agonist and antagonist effects on CCR5-mediated Ca2þ flux in HEK-293 cells expressing the human chemokine receptor. 2.1.1. CCR5 stable transfected cell culture and preparation for calcium signaling assays CCR5 stably transfected cells, such as CHO or HEK-293 cells, are prepared in an appropriate cell culture medium to a density of 1  106 cells/ml. Suitable aliquots of this cell suspension (e.g., 100 ml for a 96-well, plate-based assay) are transferred into every well of poly-D-lysine plates

23

CCR5 Primary Pharmacology Methods and Applications

FLIPR-compatible plates and incubated overnight in a growth incubator (humidified 5% (v/v) CO2 incubator at 37 ) to ensure cell adhesion. 2.1.2. Calcium dye preparation and cell dye loading for calcium signaling assays A Calcium Plus KitTM dye is dissolved in 10 ml Ca2þ flux buffer (see Section 6.3) before adding 90 ml of the same buffer to create the final working solution. The media from the plated cells is removed and the adherent cells washed twice by removal of culture medium and replacement with 2  100 ml PBS into each well. The PBS is removed and the adherent cells are incubated with dye preparation (100 ml/well) and left gently rocking for 3 h. The dye is then aspirated and the plates washed three times with Ca2þ flux buffer, prior to addition of additional buffer (160 ml) immediately before the Ca2þ flux assay is undertaken. 2.1.3. Ca2þ flux assay Antagonist dilutions (20 ml, at appropriate concentrations) are added to designated wells of the dye-loaded cell plate after 30 s into a prewritten fluorescence program, to examine agonist activity. Chemokines (20 ml to enable testing at the predetermined EC50 at final assay concentration [FAC]) are added to each well after 4 min. Buffer–buffer and MIP-1b–buffer controls are performed to establish contribution of the artifact signal. 2.1.4. Example data and results The profile of maraviroc in this assay is shown in Fig. 2.1 as an example of a functional CCR5 antagonist. 1000 nM maraviroc

13,000

16 nM maraviroc

Fluorescent counts

12,000

4 nM maraviroc

11,000

Vehicle control

10,000 9000 8000 7000 6000 5000

Maraviroc 0

50

RANTES 100

150

200 250 Time (s)

300

350

400

450

Figure 2.1 Effect of RANTES (CCR5 agonist) and maraviroc (CCR5 functional antagonist) on recombinant CCR5-mediated Ca2þ signaling in HEK cells. The dynamic change in fluorescence after the addition of maraviroc (marked) is shown, as well as subsequent addition of agonist RANTES as marked 4 min later.

24

Roy Mansfield et al.

2.2. CCR5 cellular internalization assay To enable characterization of ligand binding with association to agonism or antagonism, it is necessary to see if test compounds induce CCR5 internalization or not. A method for this has been summarized with application in reported drug discoveries (Dorr et al., 2003b, 2005b). Antiviral activity by CCR5 cognate chemokines is mediated by internalization of receptor, whereas antagonists block the receptor and stabilize a conformation that is not recognizable by CCR5-tropic (R5) HIV-CD4 complex. CCR5internalization–mediated antiviral activity has been reported to lead to HIV-1 resistance through tropism shift (Mosier et al., 1999), although the viruses used in such studies are associated with random tropism shift per se (i.e., shift to CXCR4 without CCR5 antagonist selection pressure) (Westby et al., 2004, 2007). A tropism shift to escape antagonist antiviral activity has not been observed to date in clinical or preclinical studies (Dorr and Perros, 2008). In light of the low and variable levels of CCR5 expression on primary cells, 300.19/R5 cells (an internalization-competent recombinant human CCR5 expressing mouse pre–B-cell line) can be used for quantitative preclinical pharmacology studies. Cell surface CCR5 levels are measured using a human CCR5-specific monoclonal antibody, with an associated labeled secondary antibody to enable fluorescenceactivated cell sorting (FACS) technology (alternatively, the primary antibody can be custom labeled). Endogenous CCR5 agonists and the CXCR4 agonist stromal derived factor 1a (SDF-1a) can be used as positive and negative CCR5 internalization controls, respectively. 2.2.1. Cell culture and reagent preparation 300.19/R5 cells (mouse pre–B-cell line, recombinantly expressing human CCR5) are cultured in a DMEM medium and adjusted to a cell density of 5  106/ml by dilution in the same medium. Anti-CCR5 antibody (2D7see Section 6.3) is diluted 1:10 in 0.5% (w/v) BSA/PBS. Antibody IgG2a (isotype control for the assay, see Section 6.3) is similarly diluted. The anti2D7 phycoerythrin (PE)–labeled, goat anti-mouse secondary antibody (see Section 6.3) is used at a 1:20 dilution in 0.5% (w/v) BSA/PBS. RANTES and SDF-1a (or any other cognate chemokine, see Section 6.3) is dissolved in PBS (100 mM), and then further diluted from a 1-mM final assay concentration (FAC) in cell culture medium. 2.2.2. FACS Assay 300.19/R5 cells (100 ml) at 5  106 cells/ml are added to each assay tube. Antagonists or chemokine controls (10 ml) are added to appropriate assay tubes to enable profiling (usually at 100 nM or below in situ). The tubes are incubated 37 for 45 min to enable CCR5 internalization. The samples are centrifuged (1500 rpm in a benchtop centrifuge) and washed twice in 0.5%

CCR5 Primary Pharmacology Methods and Applications

25

(w/v) BSA/PBS (100 ml). Washed samples are resuspended in 40 ml of the same buffer. Anti-CCR5 antibodies or isotype controls are then added to the samples followed by incubation for 45 min at 4 to enable antibody binding to CCR5. The samples are washed once in 0.5% (w/v) BSA/PBS, followed by the addition of 75 ml phycoerythrin (PE)–goat, anti-mouse secondary antibody with incubation at 4 for 45 min in the dark to enable binding. The samples are subsequently centrifuged (1500 rpm in a benchtop centrifuge for 5 min), washed twice in 0.5% (w/v) BSA/PBS (100 ml) and resuspended in 1% (v/v) formaldehyde/PBS (1 ml) for fixing. The fixed cells are processed using suitable instrumentation (e.g., Becton Dickinson FACScalibur), using excitation/emission wavelengths of 488 nm/530 nm, respectively. 2.2.3. Example results/data Figure 2.2 highlights the data generated from this method as plotted by fluorescence overlays showing chemokine induction of CCR5 cellular internalization. The plots highlight that agonism results in receptor internalisation and that antagonists do not induce this event. This method can also be modified by the addition of a ‘‘wash-and-chase’’ phase where cells are washed following a period of incubation with antagonists (for a set period) and then progressed to chemokine-induced internalization studies with FACS analysis. This enables the functional offset of the antagonist to be characterized and used to compare various antagonists. Figure 2.3 highlights this application with the experimental antagonist UK-484900 (Table 2.1), highlighting prolonged blockade of chemokine-induced CCR5 internalization, following removal (by cell washing) of exogenous antagonist and a 2-h incubation prior to chemokine addition.

2.3. Application of CCR5 receptor internalization assay to investigate antagonist-dependent functional receptor occupancy in vivo (clinical trials) As part of drug clinical development, it is becoming increasingly important to ensure that compounds under evaluation induce the desired mechanismassociated pharmacology in humans. The FACS-based CCR5 internalization assay has been adapted to enable functional CCR5 occupancy studies in humans. Placebo versus maraviroc (i.e., CCR5 antagonist)-dependent inhibition of MIP-1b–mediated CCR5 internalization (i.e., functional occupancy) can be assessed in CD4 T lymphocytes prepared from whole-blood citrate CPT (cell preparation tubes) samples taken from healthy volunteers participating in a clinical study designed to investigate CCR5 occupancy in vivo. The difference in CCR5 expression on the cell surface in the presence of high concentration exogenously supplied maraviroc treated (total CCR5) versus untreated (maximum internalization) peripheral

26

Roy Mansfield et al.

A

B 80

Control SDF-1a RANTES + 2 hr media RANTES

Control SDF-1a RANTES

Counts

4 ⬚C

Counts

37 ⬚C

80

0 100

101

102 103 Fluorescence C

104

0 100

80

102 103 Fluorescence

104

Control SDF-1a 10 nM UK-427857 100 nM UK-427857

Counts

37 ⬚C

101

0 100

101

102 103 Fluorescence

104

Figure 2.2 Effect of maraviroc on 300.19 cell surface CCR5 levels (anti-CCR5 antibody^dependent cell population fluorescence). Isotype control fluorescence counts (y-axis) is depicted in grey. RANTES (100 nM)-induced reduction of CCR5 is shown by a reduction in fluorescence (green line in 2A) relative to parallel experiments using the negative control ligand SDF-1a (red line in 2A). Reemergence of CCR5 at the cell surface is apparent following a 2-h incubation period post addition of RANTES (blue line, 2A). RANTES-induced reduction in cell population fluorescence is reduced at 4 (2B) highlighting internalization to be an active biological process. Maraviroc did not affect cell population fluorescence at10 nM or 100 nM (blue and green lines, respectively, in 2C), as also seen for the negative control SDF-1a (red line). (From Dorr P., and Perros, M. (2008). CCR5 inhibitors in HIV therapy. Expert Opin. Drug Discov.3, 1^16; Dorr, P., et al. (2005). Maraviroc (UK-427,857), a potent, orally bioavailable, and selective smallmolecule inhibitor of chemokine receptor CCR5 with broad-spectrum anti-human immunodeficiency virus type1activity. Antimicrob. Agents Chemother.49,4721^4732.)

blood lymphocytes (PBLs) subjected to MIP-1b challenge, gives estimate of the proportion of free CCR5 present on the cell surface at any given plasma concentration of maraviroc. These data can then be used to estimate the degree of receptor occupancy obtained at different doses (and exposures) of maraviroc, or indeed any other CCR5 antagonist in clinical evaluation.

27

CCR5 Primary Pharmacology Methods and Applications

Counts

A

Counts

B

Counts

C

120 100 80 60 40 20 0 100 120 100 80 60 40 20 0

120 100 80 60 40 20 0

101

102 FL2-H

103

104

100

101

102 FL2-H

103

104

100

101

102 FL2-H

103

104

Figure 2.3 Prolonged inhibition of UK-484900 (antagonist)-dependent inhibition of chemokine-induced CCR5 internalization in 300.19 cells. Flourescence plot overlays of a representative FACS experiment with human CCR5 expressed on 300.19/R5 cells. Fluorescence units are shown on the x-axis, and cell counts on the y-axis. UK-484,900 is assayed at 1000 nM, 100 nM, and 10 nM (f3A, B, and C, respectively). Cells are treated with RANTES in the presence of the compound (depicted in black), following compound removal and wash (pink), or a further 1.5-h incubation (orange).Vehicle control is depicted in green.Total fluorescence (no RANTES) is depicted in red, and the isotype negative control is depicted in blue.

2.3.1. Dosing and sampling regimen CCR5 antagonists such as maraviroc versus placebo are dosed to volunteers at known levels for the purpose of evaluating dose-occupancy correlation. Blood samples are then taken (into citrate-CPT tubes, 4 ml) at intervals after dosing to evaluate occupancy. The residual CCR5receptor expression on CD4 positive lymphocyte populations is determined by FACS analysis of processed sodium citrate CPT anticoagulated whole-blood samples.

28

Roy Mansfield et al.

2.3.2. Sample preparation and FACS analysis Peripheral blood lymphocyte–rich plasma samples are isolated by centrifugation of CPT tubes at 1550g for 25 min at room temperature (RT) in a swing-out–rotor bench centrifuge. The buffy coat layer of cells is resuspended in the plasma. Each cell-enriched plasma sample (250 ml) is pipetted into three separately labeled 12  75–mm polystyrene roundbottomed tubes (Tube 1 [isotype control], Tube 2 [maraviroc-stabilized CCR5], and Tube 3 [test sample]). An aliquot (50 ml) of CCR5 stabilizing solution (see Section 6.3) is added to Tube 2, while PBS (1% (w/v) BSA) (50 ml) is added to Tubes 1 and 3, before briefly vortexing on a medium setting for 2 s and incubating at 37 for 30 min. All tubes are centrifuged at 400g for 5 min to isolate cells. Aliquots (15 ml) of MIP-1b (100 nM) are added to all tubes, and then gently vortexed on a medium setting for 2 s to resuspend pellet in fluid. The tubes are then incubated uncapped for 45 min in a growth incubator to enable CCR5 internalization. Aliquots (1 ml) of 0.5% (v/v) paraformaldehyde in PBS are added to each tube, followed by vortex (2 s) and incubation (10 min) in the dark at RT to fix the cells. Cells are washed with PBS/centrifugation (400g for 5 min) prior to antibody addition (50 ml—MsIgG R-phycoerythrin [PE], isotype control [Tube 1]; anti-CCR5 2D7, PE labeled, maraviroc stabilized and test samples [Tubes 2 and 3]). All tubes are then vortexed (2 s) and incubated for 20 min in the dark at RT, washed with PBS/BSA as before, with resuspension in 0.5 ml of 1%(v/v) paraformaldehyde by vortexing (2 s). Samples can be stored at 2 to 8 until FACS analysis as described above. 2.3.3. Example results/data The PBL population CCR5-mediated fluorescence profile and MIP-1b– induced effect to reduce this signal through receptor internalization on the cells taken from human volunteers are highlighted in Fig. 2.4. The effect of blockade of this agonist-induced internalization is used to measure the functional occupation of maraviroc in clinical studies, and example data highlighting the dynamic dose-occupancy relationship is highlighted in Fig. 2.5.

2.4. GTP-associated CCR5 inverse agonism assay CCR5 interacts with multiple G-protein species in recombinant cells, following binding of the various endogenous agonist ligands (Mueller et al., 2002, 2006; Mueller and Strange, 2004a, 2004b; Peltonen et al., 1998). MIP-1b–dependent stimulation of GTP can be examined using a radiolabeled nonhydrolyzable form of GTP (gS-GTP) exactly as described by (Haworth et al., 2007) to characterize the inverse agonism mechanism

29

CCR5 Primary Pharmacology Methods and Applications

Maraviroc plus chemokine

Vehicle plus chemokine 60

40

CCR5

30 20 10

Cell counts

Cell counts

50

50 40

CCR5

30 20

:

10 103 102 101 PE-dependent fluorescence

104

102 103 101 PE-dependent fluorescence

104

Figure 2.4 CCR5 occupancy assay in/ex vivo. FACS analysis of PBLs blockade of chemokine (MIP-1b)-induced CCR5 internalization by maraviroc in ex vivo PBMCs, as measured by PE-conjugated anti-CCR5-Mab (2D7) fluorescence measurements on a FACS technology platform.The presence of maraviroc inhibits MIP-1b^induced CCR5 internalization compared tovehicle. Analysis of placebo versus maraviroc dosed samples using this methodology enabled the dynamic functional occupancy of CCR5 to be profiled (Fig. 2.5).

% CCR5 functional occupancy

120 100 100 mg

80

25 mg

60

3 mg 10 mg

40

Placebo

20 0

0

10

20

30 Time (h)

40

50

60

Figure 2.5 Dynamic functional occupancy of CCR5 in humans by maraviroc blood sample for assay of CCR5-internalization on isolated PBMCs taken at times indicated following single dose to healthy volunteers. Data are mean  SD for each cohort. Note that 20% of 2D7-anti-CCR5^recognized CCR5 is not internalized by MIP-1b, leading to an apparent occupancy level of 20% for placebo-dosed human volunteers.

that is measurable in recombinant systems which underpins the functional antagonism of antiviral CCR5 inhibitors (Dorr et al., 2005b; Strizki et al., 2001). GTP binding to CCR5 is measured based on previously described methods ( Jansson et al., 1999; Labrecque et al., 2005). These can also be adapted to a time-resolved fluorometric assay, using a Europium (Eu3þ) labeled gS-GTP to avoid use of radioactivity.

30

Roy Mansfield et al.

2.4.1. Membrane preparation and GTP-binding assay CCR5 stable transfected HEK-293 cells are cultured to a confluency between 50 and 70% in standard culture medium (e.g., DMEM), typically in a 225-cm2 flask. Cells are washed once with PBS. The PBS is removed and the cells dislodged by rapping the side of the culture flask in the presence of 10 ml culture medium, harvested by centrifugation (350g for 10 min). Pelleted cells are resuspended in 15 ml lysis buffer (see Section 6.3), and homogenized with a handheld homogenizer (5 to 10 s on ice, three to four times). The homogenate is centrifuged at 40,000g for 30 min at 4 . The membranous pellet is resuspended in a minimal volume of lysis buffer (see Section 6.3) prior to estimation of protein concentration (e.g., Bradford microassay). Membrane aliquots (50 ml at 500 mg/ml) are added to designated wells of a 96-well assay plate. GTP binding is measured using a Delfia GTP-binding assay kit (see Section 6.3), according to the manufacturer’s protocol, with a ‘‘preoptimized’’ GTP assay buffer (see Section 6.3). Assay buffer (50 ml) is added to the plate wells prior to incubation at RT for 30 min with gentle rotary shaking. MIP-1b and test compounds are diluted in 50 mM HEPES buffer, pH 7.4, over a desired concentration range. The test compound is added and incubated at RT for 30 min prior to the addition of 10 ml GTP-Eu3þ (100 nM FAC). The reaction is incubated for a further 30 min at 37 before washing with 300 ml/well of ice-cold wash buffer (supplied with assay kit) and reading immediately at 615 nm using an appropriate plate reader. Basal GTP binding is calculated from the mean values obtained for vehicle control-designated wells (50 mM HEPES, pH 7.4). The effect of MIP-1b and the test compound on GTP incorporation is measured for each well (and meaned), with percent stimulation relative to vehicle control calculated. Nonspecific binding (NSB) is subtracted (NSB is determined as the background binding of GTP to the assay plate in the absence of membranes). 2.4.2. Example data and results Vicriviroc, maraviroc, and its analogues UK-396794 and UK-438235 show the classic inverse agonist profile of small concentration-dependent reductions in GTP-binding assays, compared to relatively large agonist-stimulated increase in binding as previously reported (Dorr et al., 2005b; Haworth et al., 2007; Strizki et al., 2001). This is depicted in the case of maraviroc in Fig. 2.6.

2.5. cAMP-response-element-luciferase reporter gene assay The cAMP-response-element-luciferase (CRE-luc) plasmid codes for a cAMP response element upstream of a luciferase reporter gene. HEKGa15 cells can be transiently cotransfected with the CRE-luc

31

CCR5 Primary Pharmacology Methods and Applications

1600

Stimulated/basal GTP binding (%)

1400 MIP-1b MIP-1

1200 1000 800 600 400 200 0

Maraviroc 3

6

10

30 60 100 Ligand concentration (nM)

300

600

1000

Figure 2.6 Inverse agonism of CCR percent by maraviroc. Stimulation of GTP binding to membrane preparations from CCR5-expressing HEK-293 cells by MIP-1b(pink line and data points), and UK-427,857 (blue line and data points). Data points represent the ratio of GTP binding in the presence of ligand over basal levels of GTP binding in vehicle control assays.

construct and a plasmid encoding the human CCR5 receptor. The transfected cells are stimulated with forskolin to activate adenylate cyclase, and increase intracellular cAMP to enable an assay window. The cAMP binds to its response element, which activates transcription of the luciferase reporter gene, leading to an increase in measured luminescence. The CCR5 receptor is a Gi-linked GPCR when expressed in an appropriate background, and agonism inhibits adenylate cyclase, reducing the intracellular cAMP concentration and thus decreasing the luminescence signal. The effect of preincubation with antagonists on the dose–response curve to MIP-1b, and therefore its functional activity at the CCR5 receptor can thereby be investigated. 2.5.1. Transient transfections and assay plate preparation Bulk preparations of human CCR5 receptor DNA (in the expression vector pIRESneo) and CRE-luc plasmid DNA (see Section 6.3) are used for transfections. HEKGa15 cells are cultured in standard medium (see Section 6.3), and passaged at 90% confluency using cell dissociation solution. Cells are transfected at 50 to 80% confluency in T75 flasks, using

32

Roy Mansfield et al.

lipofectamine (Plus) reagent. OptiMEM reduced serum medium is used in all transfection procedures. Two solutions are prepared for each transfection: Solution 1 ¼ 4 mg human CCR5 receptor DNA, 2.5 mg CRE-luc DNA, 45 ml Plus reagent, 0.75 ml OptiMEM; and Solution 2 ¼ 22.5 ml lipofectamine, 0.75 ml OptiMEM. Solution 1 is incubated at RT for 15 min. Solutions 1 and 2 are then mixed and incubated at RT for 15 min, before the addition of 7 ml OptiMEM. The flasks containing the cells for transfection are removed from the incubator and the media removed. The cells are washed in 10 ml OptiMEM, and the DNA/lipofectamine/OptiMEM mix (Solutions 1 and 2) added. The flasks are incubated in a growth incubator overnight. For cell plate preparation, DMEM medium without phenol red, supplemented with 10% (w/v) dialysed FCS, is used in the cell plate preparation. Media is removed from the transfected cells and each flask is washed once in 10 ml PBS. Cell dissociation solution is added (2 ml) and the flasks incubated at RT for up to 5 min. The flasks are tapped to dislodge the cells, and approximately 8 ml media (as above) added. The cells are pelleted by centrifugation at 1000g for 5 min. The cells are resuspended in fresh media and plated out (90 ml) into 96-well plates (2.5  104 cells/well), and are left to adhere overnight in a growth incubator. 2.5.2. CRE-luc assay To inhibit phophodiestrase activity and enable cAMP detection accordingly, isobutylmethylxanthine (500 mM in DMSO) is diluted to 1 mM in 0.1% (w/v) BSA/PBS to make the antagonist diluent. Test compounds e.g., maraviroc are diluted in antagonist diluent to 10x final assay concentration. MIP-1b is prepared at 36 mM in 0.1% (w/v) BSA/PBS, and aliquoted for freezing/use. MIP-1b is then diluted in 0.1% (w/v) BSA/PBS to 12 final assay concentration. Forskolin (1 mM in DMSO) is diluted to 3.6 mM in 0.1% (w/v) BSA/PBS to give a FAC of 300 nM. Test compounds (10 ml) are added to the cell and incubated at 37 for 30 min, prior to addiction of MIP-1b and forskolin (10 ml each). The plates are mixed gently, and incubated at 37 for 5 h. After equilibration to RT for 10 min. SteadyGlo luciferase (see Section 6.3) is prepared according to manufacturer’s instructions, added (100 ml/well), and incubated at RT for 10 to 15 min before reading luminescence on an appropriate plate reader with data transfer system to determine percent of cAMP inhibition values. 2.5.3. Example results/data Maraviroc at 1, 3, and 10 nM, caused a dose-dependent rightward shift of the dose–response curve to MIP-1b, together with a marked suppression of the maximum response, indicative of insurmountable antagonism (Fig. 2.7). The maraviroc pKb is determined following an assumption of hemiequilibrium conditions, and a double reciprocal regression is then constructed, and the slope of the line is used to calculate the Kb. The pKb

33

% Fitted max of control curve

CCR5 Primary Pharmacology Methods and Applications

150

Control 1 nM UK-427, 857

100

3 nM UK-427, 857 10 nM UK-427, 857

50 0 −12 −50

−11

−10

−9

−8

−7

−6

Log10 [MIP-1b]M

Figure 2.7 Effect of maraviroc on MIP-1b dose^response curveDose^response in the absence and presence of 1, 3, and 10 nM of former. Each data point represents the mean of n ¼ 4 experiments. In each experiment, the mean of duplicate wells is calculated.

value of maraviroc is determined as 9.4 (95% confidence interval 9.01– 9.75). A more detailed description of analysis of this type has been comprehensively reported for CCR5 (Kenakin et al., 2006; Watson et al., 2005b).

3. CCR5-Associated Ligand-Binding Assays The affinity of CCR5 ligands including antagonists with therapeutic potential can be characterized in terms of their potency in a range of binding assays, and also to examine relevant kinetic properties such as physical and functional receptor dissociation rates. This can be used for compound characterisation, or comparison in order to guide a synthetic program.

3.1. Radiolabeled CCR5 chemokine-binding assays Radiolabeled cognate chemokine-binding assays to recombinant CCR5 (membranes and whole cells) has been extensively reported to a level of detail that would enable straightforward setup in an independent laboratory. Classic membrane-filter binding assays were originally developed and reported by Combadiere et al. (1996), and described in detail to enable the characterization of specific CCR5 antagonist such as maraviroc by Dorr et al. (2005b) and Napier et al. (2005), and the bicyclics SCH-C and SCH-D (vicriviroc) by Strizki et al. (2001, 2005) and Tagat et al. (2004). Modification to enable homogenous assays using scintillation proximity assay technology for greater screening amenity has also been reported for the characterization of aplaviroc (Watson et al., 2005b). These and signaling assays have been applied across CCR5 isoforms in order to select

34

Roy Mansfield et al.

appropriate species to examine the mechanistic toxicology of CCR5 antagonists (Mosley et al., 2006; Napier et al., 2005).

3.2. Radiolabeled antagonist-binding and -dissociation assays Physical association and dissociation studies for maraviroc have been reported in fine detail by Napier et al. (2005). These include competition studies where excess unlabeled maraviroc is used to prevent reassociation of 3H-maraviroc in ligand-binding experiments (either isolated membrane preparations or intact recombinant CCR5-expressing cell lines). Data from such experiments highlighted the slow physical dissociation of maraviroc (T1/2 ¼ 16 h; see Napier et al., 2005)). This is a phenomenon that appears to be consistent for CCR5 antagonists and no freely reversible antagonists have been reported to date. Intriguingly, experiments that assess functional offset by gp120 offset or chemokine on-set assays (Dorr et al., 2005a; Watson et al., 2005a) imply even longer antagonist dissociation, or more strictly, receptor recovery. For gp120 binding, this may be a consequence of this glycoprotein linking to CCR5 clusters rather than single receptors for infection, and so antagonist dissociation may be required from each CCR5 molecule prior to a gp120accepting formation can be adopted, or that antagonist dissociation is followed by a period of CCR5 being in a nonfunctional conformation, or both.

3.3. Real-time ligand binding using Biacore technology Biacore offers a technology platform that can monitor the binding of ligands to receptors and monitor interactions based on induced changes in the refractive index. This enables interactions to be monitored in real time, rather than by sampling at time points, and avoid the use of radiolabeled ligands. 3.3.1. Immobilization of 1D4 monoclonal antibody on a CM4 surface The monoclonal antibody 1D4 (see Section 6.3) is immobilized on a CM4 sensor chip using standard amine-coupling chemistry. HBS-N (10 mM Hepes, 0.15 M NaCl, pH 7.4) is used as the running buffer. The carboxymethyl dextran surface requires activation with a 12-min duration injection of a 1:1 ratio of 0.4 M 1-ethyl-3-(3-dimethylaminopropyl) carbodimide hydrochloride (EDC):0.1 M N-hydroxy succinimide (NHS). The antibody is coupled to the surface with a 15-min injection of 1D4 diluted in 10 mM sodium acetate (pH 5.0). Remaining activated groups are blocked with a 7-min injection of 1 M ethanolamine (pH 8.5). To obtain a 1D4 surface density of approximately 12,000 RU, immobilization is performed at 30 using Biacore S51.

CCR5 Primary Pharmacology Methods and Applications

35

3.3.2. Ligand binding to receptors CCR5 is solubilized as described previously (Navratilova et al., 2006) and captured by 1D4 immobilized on surfaces within a CM4 chip at densities equating to approximately 4000 RU (the running buffer consists of 50 mM Hepes, pH 7.0, 150 mM NaCl, 0.02% (w/v) CHS, 0.1% (w/v) DOM, 0.1% (w/v) CHAPS, and 50 nM DOPC/DOPS [7:3]). Small-molecule CCR5 compounds are dissolved in dimethyl sulfoxide (DMSO) and diluted into 50 mM HEPES (pH 7.0), 150 mM NaCl, 0.02% (w/v) CHS, 0.1% DOM, 0.1% CHAPS, and 50 nM DOPC/DOPS (7:3) to concentrations of 1 to 20 mM. These solutions are then serially diluted threefold in running buffer to produce the concentration series for each inhibitor. The receptor surfaces are stabilized by at least eight start-up buffer blanks before injecting a compound. To reference for drift, two blank injections are performed between analyte injections. Compounds are injected at a flow rate of 30 ml/min, and the association and dissociation phases are monitored for 1 and 10 min, respectively. The receptor surfaces are not regenerated between analyte injections. Instead, the injections are performed from lowest to highest concentrations and the data are normalized for the maximum binding capacity as described previously (Navratilova et al., 2006). 3.3.3. Example data and results Antagonist binding to solubilized CCR5 is highlighted in Fig. 2.8. The compounds are injected over freshly prepared CCR5 surfaces in increasing concentrations. All binding responses are globally fitted with a 1:1 interaction model that used a different maximum binding capacity (Rmax) for each analyte injection and data are normalized for Rmax. The compounds highlighted in Fig. 2.8 show their relative CCR5 affinities and physical association and dissociation rates.

3.4. Real time HIV-1 gp120-CCR5 binding assay CCR5 antagonists bind the receptor and stabilize a conformation that is unable to bind the HIV-1 gp120-CD4 complex. The method detailed in the following requires preparation of a crude gp120-containing extract to enable an empiric assay for IC50 determination, although commercially available sources of purified or semipurified gp120 also generate signals in this assay albeit to a lesser extent (Rickett et al., 2003). The requirement for gp120 preparations to enable a sufficiently high signal to noise in this assay reduces the ability of the assay to resolve/differentiate compounds of IC50 potencies less than 20 nM. Other limitations are the empiric nature of the screen and limited scope for kinetic validation. However, this assay is amendable to high throughput screening, and has utility for scrutinizing the molecular interaction for inhibitors of HIV-1 gp160-CCR5–mediated

36

Normalised response (% Rmax)

Roy Mansfield et al.

120 100 80 60 40 20 0

Maraviroc ka = 1.1 (±0.1) ⫻ 105 M−1s−1 kd = 6.0 (±0.2) ⫻ 10−4 s−1 KD = 25.0 (±4.0) ⫻ 10−9 M t1/2 = 1165 s 0

50

100

150

200

250

300

120 100 80 60 40 20 0

UK-438235−40 ka = 3.5 (±0.1) ⫻ 104 M−1s−1 kd = 7.1 (±0.1) ⫻ 10−4 s−1 KD = 2.0 (±0.1) ⫻ 10−8 M t1/2 = 976 s 0

50

100

150

200

250

300

10 8 6 4 2 0

UK-107543 (agonist) ka = 1.14(7)E + 06 kd = 0.27(2) KD = 2.40(20)E − 07 t1/2 = 2.56721178 0

50

100

150

200

250

Time(s)

Figure 2.8 Profile of small molecule antagonist and agonist binding in Biacore. Graphs highlighting association and dissociation of various CCR5 ligands as measured by dynamic change in refractive index on Biacore.

cell–cell fusion (Fig. 2.9), which better resemble the HIV-1 entry process in infection, and is now the favored screen for HTS (Dorr et al., 2003a), but does not define the specific interaction blocked by inhibitory compounds. 3.4.1. Preparation and assay of soluble recombinant gp120 CHO cells stably transfected with the HIV-1 gp120 expression vector pEE14.1 (see Section 6.3) are cultured in 200-ml roller bottles for 4 days, which is replaced by 200 ml DMEM-S medium with 1% (w/v) FCS for 3 days prior to supernatant harvest for gp120 preparation. The cell supernatant is concentrated by ultrafiltration and empirically quantified in the assay described in the following using a Europium-labeled, anti–HIV-1 gp120 IgG antibody (see Section 6.3) in the time-resolved fluorescence immunoassay (TRFIA). 3.4.2. Inhibition of soluble recombinant HIV-1 gp120 (Ba-L strain) binding to CCR5 by TRFIA This assay is performed as essentially as described by (Dobbs et al., 2001), and is depicted in Fig. 2.9. HEK-293 cell aliquots (100 ml at 1  106 cells/ml) are plated into poly-D-lysine–coated plates and incubated in a growth incubator overnight. A 1:1 mix of soluble recombinant human CD4 (sCD4, diluted to 4.5 nM in culture medium; see Section 6.3) and HIV-1

37

CCR5 Primary Pharmacology Methods and Applications

gp120-sCD4-CCR5 binding

gp160-CCR5 cell-cell fusion gp160

Eu-cryptate

TAT

CHO

anti-gp120

TAT CD4

gp120 CCR5

sCD4

Hela P4

CCR5 b-Gal

+

b-Gal

Figure 2.9 Cartoon depictions of gp120-sCD4-CCR5 binding and gp160-CCR5 cell^ cell fusion assays.

gp120 (e.g., Ba-L strain) are incubated at RT for 15 min before its addition to PBS-washed cells, in the presence of dilutions of maraviroc to enable IC50 determination. The assay plates are incubated at 37 for 1 h and washed. Eu3þ labeled anti-gp120 antibody (1/500 dilution in assay buffer; see Section 6.3) is added to each well (50 ml) and incubated 1 h. The plate is washed three times with assay buffer, prior to the addition of enhancement solution (200 ml/well; see Section 6.3) and measurement of Eu3þ fluorescence. Nonspecific binding is taken as the fluorescence measured for gp120 incubated with cells in the absence of preincubation with sCD4. The data can be used to examine dose–response for compound-dependent inhibition of HIV gp120-sCD4 complex binding to CCR5 as shown for maraviroc in Fig. 2.10.

3.5. Application of gp120 binding to characterize functional occupancy in vitro CCR5 antagonists have slow physical dissociation from the receptor, as measured using radiolabeled antagonist competition assay. To investigate the more clinically relevant endpoint of dynamic compound stabilization of HIV-1 ‘‘unrecognizable’’ conformation (i.e., time required for receptor to become amenable for HIV-gp120 binding following antagonist onset), a wash-and-chase modification of the gp120 assay can be undertaken. This also offers the advantage of cross-compound comparisons, without the need for custom radiolabeling of each antagonist. The methodology is essentially the same, except that the following a 30min period of antagonist association (period in excess of the tritiated antagonist binding to a steady-state signal (various compounds, data not shown), the assay plates

38

Roy Mansfield et al.

100 90 80

% Inhibition

70 60 50

Fusion gp120

40 30 20 10 0 0.001

0.01

0.1

1

10

100

1000

[Maraviroc] (nM)

Figure 2.10 Dose^response curves for maraviroc-dependent inhibition of gp120sCD4 binding to CCR5, and gp160-CCR5 cell^cell fusion maraviroc-dependent inhibition of gp120 binding to CCR5 (red) and gp160-CCR5^mediated cell^cell fusion (black).

containing confluent, nonexpanding cell populations are washed three times in PBS to remove all exogenous antagonist, incubated for a set period (e.g., overnight), prior to completion of the assay for IC50 determination. The assay is run without the wash step, where exogenous antagonist is present throughout the assay in parallel. Control studies (unpublished) have shown that the wash-and-chase steps do not alter compound potency per se. The IC50 ratio for gp120-binding inhibition for assays run under non-wash versus wash-and-chase gives an indication of the functional occupancy of a given antagonist (as exemplified for PF-232798 in Fig. 2.11), and enable comparisons of different antagonists as previously reported (Dorr et al., 2005a, 2008).

4. Surrogate In Vitro Antiviral Assays The role of CCR5 as a coreceptor important in antiviral drug discovery has led to de novo assay developments that are of a bespoke nature. The novelty of CCR5 as an antiviral target has also led to the development of new surrogate antiviral assays, and modifications of infectious virus-based antiviral assays. These are described in the following in no particular order.

4.1. HIV-1 gp160-CCR5–mediated cell–cell fusion assay A high-throughput fully automated HIV-1 envelope or gp160-CCR5– dependent cell–cell fusion assay (fusion assay) has been previously reported in detail, and shown to be highly predictive of antiviral activity, with a

39

% Inhibition gp120-sCD4 binding

CCR5 Primary Pharmacology Methods and Applications

120 100 80 60 40

No wash

20 0

Wash and chase 0.1

1

10

100

1000

10000

[PF-232798] (nM)

Figure 2.11 Functional offset of PF-232798 from CCR5 as measured by a wash-andchase gp120-sCD4^binding assay. Dose^response curves for PF-232798^dependent inhibition of gp120-sCD4 binding to CCR5 in the presence of exogenous dosed antagonist (no wash) and when removed and incubated for 24 h (wash and chase).

greater correlation to antagonist potency in primary cell-based antiviral assays (deemed the most reliable predictor of efficacy in humans from a pharmacology perspective), than either the chemokine or gp120-binding assays (Bradley et al., 2004; Dorr et al., 2003a). This has enabled extensive screening for CCR5 ligands (and inhibitors against other cell-entry–associated targets), without the need to use hazardous systems such as infectious HIV preparations or radioligands. The fusion assay is depicted in Fig. 2.9, and requires functional complete viral envelope protein gp160, which is naturally processed into two linked subunits, gp120 and gp41. To enable quantitative evaluation of the process, the HeLaP4 cells express a b-galactosidase reporter gene under the control of HIV-1-LTR, while the gp160expressing CHO cells also expressed the HIV-1 transcriptional activator Tat. Fusion between the two cell lines allows soluble Tat from the CHOgp160 cells to transactivate the HIV-1 LTR present in the HeLaP4, leading to the expression of b-galactosidase. The level of b-galactosidase is determined using the fluorogenic substrate 4-methylumbelliferyl-galactopyranoside (MUG). b-galactosidase cleaves MUG to generate fluorescent 4-methylumbelliferone. Inhibition of cell–cell fusion reduces fluorescent signal levels in this assay relative to mock-treated controls, to enable dose– response evaluation (see Fig. 2.10). The methods and application of this method have been described in fine detail (Bradley et al., 2004) and are not included here for the sake of brevity. This assay can also be modified to become a direct antiviral assay by supplanting the CHO cell line with CCR5-tropic whole HIV virus (predetermined titer). However, correlation studies with antiviral activity of CCR5 antagonists in primary

40

Roy Mansfield et al.

cell–based assays with infectious virus show no advantage in the use of virus versus CHO cells in this reporter assay (unpublished data, Pfizer GRD), highlighting the advantage of the cell–cell fusion system in terms of safety and assay amenability.

4.2. Antiviral assays A range of antiviral assays have been used to profile CCR5 antagonists ranging from systems using ex vivo native cells, through to proprietary high throughput recombinant systems as described in detail by Petropoulos et al. (2000), which are commercially available for compound screening (PhenoSenseTM assay) or for determination of HIV coreceptor usage (i.e., tropism) of patient HIV samples (TrofileTM assay). The details of these assays are not described here in light of their proprietary nature. The principles of their use and general methodologies in the field of CCR5 research are outlined in Dorr et al. (2005b) and Westby et al. (2007). In light of the notorious difficulty yet high importance in establishing cross-laboratory consistency with native cell–based antiviral assays, and their general utility in establishing target exposure levels in patients for dose setting in clinical trials, fine details in these methods are described. 4.2.1. CCR5-associated primary cell–based antiviral assays: Peripheral blood lymphocytes and monocyte-derived macrophages HIV-1 replicative systems Cell preparation: Peripheral blood lymphocytes Peripheral blood lymphocytes (PBLs) are typically prepared in convenient batch sizes using buffy coats from individual donors or combined from two to four HIV- and HBV-seronegative donors. Each buffy coat is diluted in an equal volume of PBS and mixed. From this, 30 ml is layered onto 20 ml of Ficoll-Paque in 50 ml centrifuge tubes, followed by centrifugation for 30 min at 1000g at RT. The PBLs are harvested at the Ficoll–plasma interface. The PBLs are washed twice in PBS by centrifugation for 10 min at 500g at 4 . Contaminating erythrocytes are lysed by adding 9 ml sterile water, stored at 4 , to the resuspended PBL pellet, followed immediately by 1 ml of RT 10  Hanks Buffered Saline. PBS is added to a final volume of 45 ml and the PBLs are pelleted by centrifugation for 10 min at 100g at 4 . The pellet is washed twice more in PBS at 4 prior to resuspension and pooling of pellets from other tubes in 30 ml RPMI cell culture medium at RT. Cells can be pooled, and if required, frozen (liquid nitrogen storage) from individual donors at this stage. Cell viability is determined, such as by trypan blue exclusion. Only cell suspensions showing greater than 95% viability are typically used in antiviral assays. The cell suspensions are adjusted to 1  106 cells/ml by the addition of fresh RT RPMI cell culture medium containing 1.5 mg/ml phytohemaglutinin (PHA) to enable enhanced

CCR5 Primary Pharmacology Methods and Applications

41

CCR5 expression to facilitate viral entry, aliquoted into 50 ml cultures and incubated for 3 days in a growth incubator, prior to counting for viral expansion or antiviral assays. Cell preparation: Monocyte-derived macrophages Harvested buffy coats (single donors) are diluted with an equal volume of DPBS and layered in 30-ml aliquots onto an Accuspin tube prior to centrifugation for 30 min at RT (1000g). Harvested monocyte-derived macrophages (MDMs) are washed three times in approximately 50 ml PBS and centrifuged for 10 min at 750g prior to resuspension in RPMI growth medium. Monocytes are adjusted to 1.0  105/well (200 ml) in a 96-well plate and incubated in a growth incubator for 1 h (to enable MDM-selective adhesion). The supernatant is discarded from the cells, and plates are washed twice with 200 ml RT PBS, prior to addition of fresh cell culture medium (200 ml) and incubated for 7 days prior to antiviral assay in a growth incubator. Antiviral assay: PBL cultures PBLs are infected for 1 h at 37 with a predetermined volume of virus calculated to give an equal amount of HIV-1 reverse transcriptase (RT) activity per virus stock. Infected cells are washed and added to assay plates (e.g., 7.2  104 cells/well [200 ml] for a 96-well plate) containing serial dilutions of test compounds (in RPMI culture medium and DMSO 0.1% (v/v) FAC). After 5 to 7 days of incubation, the cultures are examined visually with a microscope for evidence of cytotoxicity and viral replication and compound-dependent inhibition is quantified by measuring RT activity (see the following). Antiviral assay: MDM cultures MDMs are used after 7 days in culture (to enable full differentiation). The supernatant is replaced with 50 ml of either compound preparation or vehicle (RPMI medium containing DMSO at 0.1% (v/v) FAC). Cells are transferred to a growth incubator for 1 h, and then 50 ml of pretiter virus stock (see the following) is added prior to return to the incubator for 3 h. Following removal of medium, plates are washed five times using 200 ml of RT PBS per well prior to readdition of test compounds and vehicle at 2  FAC equivalent. A further 50 ml of cell culture medium are added to all wells and plates transferred to a growth incubator for 7 days. After this period, culture supernatant is harvested from the assay plates and tested directly in the HIV-1 RT detection assay as a surrogate of HIV-1 replication for compound susceptibility profiling and quantification (i.e., IC50 and IC90). Reverse transcriptase assay RT activity is quantified in culture supernatants using and appropriate assay kit such as the Quan-T-RT assay (see Section 6.3) (Amersham Pharmacia Biotech). Assay reagent sufficient for the whole assay is prepared based on the following reagent volumes

42

Roy Mansfield et al.

per well: 50ml H2O; 19 ml assay buffer; 10 ml primer/template bead/scintillant complex, and 1 ml [3H]TTP. The mixture is vortexed to ensure full suspension of the beads, and 80 ml are transferred to each well of a 96-well Isoplate, to which 20 ml culture supernatant or standard is added and mixed by pipetting. The plate is sealed and incubated at 37 for 1 h in a growth incubator to allow incorporation of the tritiated thymidine triphosphate into the primer/template by the virus RT enzyme. The reaction is terminated with the addition of the supplied stop solution (EDTA) containing 1% (w/v) SDS) to inactivate HIV-1. Light emission (SPA bead-driven from kit) is measured in a scintillation counter (results recorded as cpm). Samples are considered positive for virus if the cpm value is fourfold greater than that of the uninfected cell control. An RT standard curve (Quant-T kit; see Section 6.3) ranging from 0 to 10 mU/ml is prepared in culture medium and treated in the same manner as the test material. Expansion and storage of HIV-1 stocks HIV-1 isolates (laboratory and primary origin; see Section 6.3) can progress through a typical methodology as follows to supply virus of sufficient titer for antiviral assay: Typically, an aliquot (0.5 ml) of isolate sample is added to a 15-ml conical centrifuge tube, prior to the addition of 1.0  107 PBLs, in RT RPMI growth medium. Following incubation for 1 h in a growth incubator, the infected cells are pelleted by centrifugation at 225g for 10 min, and resuspended in a small volume of RPMI medium at RT. The resuspended cells are transferred to a T75 tissue culture flask and diluted up to a final volume up to 50 ml with RPMI growth medium containing IL-2 (enhances proliferation and CCR5 expression) at 10 ng/ml. The cells are reincubated for 3 to 4 days. After this, 25 ml of the spent medium is removed and replaced with 30 ml fresh growth medium containing IL-2 (10 ng/ml). Following, 3 4 days incubation as before, 20 ml of the supernatant is assayed for reverse transcriptase (RT) activity for evidence of replication as described above. Counts above 2000 cpm are deemed sufficiently high to enable CCR5 antagonist antiviral testing. Supernatants with counts less than 2000 cpm/20 ml supernatant in the RT assay are typically further expanded by replacement of half the culture medium with fresh, and addition of a further 1  107 PBL cells, with a further 3- to 4-day incubation and RT assay until counts of more than 2000 cpm are achieved. HIV-1 resistance to CCR5 antagonists This has become a rapidly growing research field that cannot be detailed to the level as for more direct CCR5 pharmacology- and virology-associated methodologies. However, this important preclinical and clinical field has been included in a recent review with citations of key methodologies and applications included (Dorr and Perros, 2008). The methodology for viral passage for generating

43

CCR5 Primary Pharmacology Methods and Applications

120 100

% Inhibition

80

MVC plus MVC Res CC185

60

MVC plus start CC185 PF-232798 plus start CC185 PF-232798 plus MVC Res CC185

40 20 0 −20 1.0E-11

1.0E-10

1.0E-09

1.0E-08

1.0E-07

[Antagonist] (M)

Figure 2.12 Antiviral dose^response curves highlighting activity of PF-232798 against laboratory-generated MVCRES HIV-1 isolate CC1/85. All data points are from parallel PBL cultures using RT activity as measurement of HIV-1 replication. Inhibition is measured versus vehicle-dosed control cultures. MVC retained expected activity against passaged control start cultures of HIV-1 isolate CC1/85 (blue line and data points), and is inactive against MVC-passaged isolate (red line and data points). PF-232798 shows retention of activity against both passaged isolates (green and pink lines and data points). Graphs highlighting association and dissociation of various CCR5 ligands as measured by dynamic change in refractive index on Biacore.

laboratory-resistant CCR5 antagonist HIV strains and examining crossresistance has been extensively detailed and exemplified (Westby et al., 2007). Example results and data Figure 2.12 shows the dose–response curves for CCR5 antagonist profiling in PBL-based antiviral assays, using a laboratorygenerated maraviroc-resistant (MVCRES) isolate generated by long-term serial passage in gradually increasing maraviroc concentrations (Dorr et al., 2008; Westby et al., 2007). This has been used to show the potential of second-generation CCR5 antagonists to retain activity against laboratory generated MVCRES isolates (see Fig. 2.12).

5. CCR5 Site-Directed Mutagenesis and Ligand Docking Studies The techniques for visualizing ligand-GPCR interactions are significantly hampered by the insolubility of the receptors, and the associated difficulties involved in crystal formation for x-ray diffraction. To investigate the molecular interactions between CCR5 antagonists and specific amino

44

Roy Mansfield et al.

acids of the CCR5 receptor, and to support a computer-assisted docking model of maraviroc and other CCR5 antagonists into the presumed binding pocket, a CCR5 site-directed mutagenesis–based approach can be used. By homology modeling with bovine rhodospin, a structurally characterized GPCR (Palczewski et al., 2000), amino acid residues that are presumed to form the CCR5 equivalent of the retinol-binding pocket of bovine rhodopsin can be identified. This region of the CCR5 receptor has been widely identified as the binding site for CCR5 antagonists and numerous models reported, including an excellent cross-template study (Kondru et al., 2008). Although all such studies have been retrospective (i.e., visual models generated following antagonist design and established SARs), the structural information has highlighted receptor–ligand interactions that might be the driving various SARs observed. The example cited here shows the use of structural information on the CCR5 program and various antagonists, and specifically its application to rationalize the SAR associated with crossand nonoverlapping activity against laboratory generated MVCRES virus (strain CC1/85). This strain, in common with all HIV-1 isolates that eventually acquire resistance to maraviroc following in vitro passage or prolonged clinical exposure, gains cell entry through maraviroc-occupied CCR5 rather than via CXCR4 (Dorr and Perros, 2008; Westby et al., 2004, 2007).

5.1. Structural model generation Following site-directed mutagenesis of selected residues in CCR5 the interaction of antagonists with a selected residue can be determined in terms of change in functional affinity. For this, the EC50 of chemokine (e.g., MIP-1b)-induced signaling is determined, and compared to that measured for wildtype receptor. For this, expression plasmids encoding the CCR5 isoforms can be individually cotransfected into HEK cells in combination with a plasmid encoding a CRE-dependent luciferase reporter gene. Following elevation of intracellular cAMP levels by exposure to forskolin (a nonspecific activator of adenylate cyclase), CCR5 signaling is subsequently measured by MIP-1b–induced agonism of the receptor, which reduces of intracellular cAMP levels due to CCR5 Gi protein coupling. Intracellular levels of cAMP can be assessed following luciferase expression as a result of cAMP-dependent induction of the cre-luc reporter plasmid. Antagonistdependent inhibition of MIP-1b–induced signaling of each CCR5 isoform is thus enabled through IC50 measurement. The change in IC50 values for each mutant can be compared to wildtype to gain insight into which residues in the putative binding pocket formed an interaction with a given antagonist. The very general rule is that interaction is proportional to the loss in IC50 against the mutated residue as compared to wildtype. The MIP-1b–dependent reduction of cAMP levels is deemed to be a consequence of CCR5 signaling, in light of this chemokine being a highly specific cognate ligand for this

CCR5 Primary Pharmacology Methods and Applications

45

receptor, and the absence of such signaling being seen in the absence of recombinant receptor, and complete inhibition seen at high doses of applied CCR5 antagonist. Computer-assisted docking using this ‘‘IC50-shift’’ parameter of antagonists requires an initial dock of a test compound of known crystal structure and rigidity, with following docks of test compounds thereafter. Site directed mutagenesis studies as reported here run against this compound resulted in a loss in potency for the Y108A and E283A mutants. This enabled an overlay and subsequent docking of other CCR5 antagonists such as maraviroc, vicriviroc, and PF-232798 into the modeled putative binding pocket of CCR5 using a Pfizer software package (FLOPS, Flexes Ligands Optimizing Property Similarity). Similar packages are reported with this type of utility (Kondru et al., 2008; Tsamis et al., 2003b).

5.2. CCR5 site-directed mutagenesis Mutant CCR5 isoforms made de novo or sourced directly are cloned into an appropriate expression plasmid, such as pIRESneo (see Section 6.3 section). For de novo mutations and the desired mutation (e.g., glutamic acid 283, alanine (E283A)) is constructed using polymerase chain reaction (PCR)– based site directed mutagenesis methodology with the wildtype CCR5encoding pIRESneo plasmid as the substrate DNA source, and mutant-specific primer pairs for E283A. The PCR is run according to a manufacturer’s instructions (e.g., Quikchange mutagenesis kit; see Section 6.3). Parent template wildtype CCR5 DNA is removed by digestion using methylasedependent Dpn-1 endonuclease (part of Quikchange kit), leaving amplified mutant CCR5. The retained DNA preparations containing the CCR5 point mutations are transformed into XL-1 blue supercompetent E. coli (according to associated kit instructions) and incubated overnight on plates containing LB agar supplemented with 100 mg/ml ampicillin at 37 . Resulting colonies are expanded (e.g., 5 ml cultures of LB broth containing 100 mg/ml ampicillin at 37 overnight). Plasmid DNA is purified from the E. coli cultures using a Miniprep kit (see Section 6.3) according to the manufacturer’s protocol and the insert verified using restriction digest with EcoRV. Cultures associated with the expected restriction pattern are replated. Confirmed sequencevalidated clones are bulked up (e.g., 200 ml culture), DNA extracted, and quantified by UV spectroscopy (using maxi prep kit; see Section 6.3) for large-scale plasmid purification and HEK cell transfection.

5.3. Transfection of HEK Ga15 cells with pIRESneo-CCR5 (various isoforms) and pCRE-luc This method is a modification of the CRE-luc assay described above, with the following modifications: Solution 1 contains 7.5 mg CCR5 construct, 2.5 mg pCRE-luc reporter plasmid (see Section 6.3), 45 ml lipofectamine

46

Roy Mansfield et al.

plus reagent, and 800 ml optimem (see Section 6.3). Solution 2 contains 22.5 ml lipofectamine and 800 ml optimem. Transfected cells are washed with prewarmed (37 ) optimem (10 ml) and growth media (20 ml) prior to incubation overnight in a growth incubator and trypsin-EDTA treatment (1 ml supplied reagent; see Section 6.3) incubation for 2 min at RT, media resuspension, to 3  105 viable cells/ml. Cells are plated at 90 ml/well in 96-well, white opaque plates, incubated overnight prior to functional (CRE-luc) assay.

5.4. CRE-Luc reporter assay The CCR5-associated CRE-luc assay was described above. This can be undertaken for mutants versus wildtype to measure the effect of the mutation on the IC50 value. Loss in potency is implicated with a loss in binding at the mutation site. The docking pattern is computed accordingly.

5.5. Example results/data The data from such studies enable overlays of various antagonists based on an initial dock into CCR5, and can be validated using functional inhibition studies comparing compound potency for mutated versus wildtype receptor. This is exemplified in Fig. 2.13A where maraviroc and analogues in the monocyclic tropane series show an inhibitory potency loss against CCR5 signaling following Y108A and E283A mutation. The resultant docks respectably show the hydrophobic and ionic interactions at these residues by the phenyl and amine moieties of maraviroc. Similar interactions are seen with the tropane antagonist PF-232798 (Fig. 2.13B). A dock of the bispiperidine (i.e., bicyclic) CCR5 antagonist SCH-C is shows no equivalent interaction with Y108 (Fig. 2.13c), consistent with previous reports, highlighting this residue to be relatively unimportant in enabling interaction with CCR5 (Tsamis et al., 2003a). Comparative docks with other templates within the tropane series of CCR5 antagonists can be made to highlight differential occupation potentially underpinning the SAR required to enable activity against the laboratory generated MVCRES HIV-1 CC1/85, which has evolved resistance through multiple envelope mutation to enable entry via maraviroc-occupied CCR5 (Westby et al., 2004, 2007). The overlays highlight the additional spatial occupation by the imidazopiperidine group of PF-232798 (and UK-484900; see Table 2.1) around the ECL2 region, which is believed to stabilize CCR5 in a conformation that MVCRES HIV-1 CC1/85 cannot bind. This represents highly specific SAR, as close-in analogue benzimidazole tropanes such as UK-396794 and UK-438235 (see Table 2.1 and Fig. 2.13D) are inactive against MVCRES HIV-1 CC1/85 (Dorr et al., 2005a; Dorr and Perros, 2008; Westby et al., 2005).

47

CCR5 Primary Pharmacology Methods and Applications

A ECL2

E283 Y108

C

B E283

E283

Y108

Y108

D E283

Y108

UK-433370 (cyclopropyl-triazole): inactive against MVCRES HIV-1 CC185

UK-396794 (benzimidazole): inactive against MVCRES HIV-1 CC185

PF-232798 (imidazopiperidine) active against MVCRES HIV-1 CC185

Figure 2.13 Computer-assisted docks of CCR5 antagonists and HIV resistance SAR. Computer-modeled docking of maraviroc (green) into the transmembrane pocket of CCR5, highlighting hydrophobic interaction between the maraviroc phenyl moiety with the tyrosine (Y) 108, and the ionic interaction between the tropane basic amine and the glutamic acid (E) 283 (A). Overlaps between maraviroc and PF-232798 (purple) and the bicyclic CCR5 antagonist SCH-C (yellow) are highlighted in (B) and (C), respectively. The extracellular loop 2 (ECL2) hinge region of CCR5 is highlighted. SAR associated with antiviral activity of CCR5 antagonists in the tropane series against laboratory-generated MVCRES HIV-1 CC185, with the requirement of differential occupancy at the ECL2 hinge region (specifically achieved by the imidazopiperidine substituent) highlighted, is shown in (D). Maraviroc is depicted in green and test compounds are depicted in purple. Full structures of compounds are shown inTable 2.1.

48

Roy Mansfield et al.

6. Non-HIV Indications–Associated Studies, Human CCR5 Knock-In Mice CCR5 is a chemokine receptor, and has subsequently been investigated as a potential target against a wide range of predominantly inflammatory disorders. Such studies have been driven by expression studies in disease states and pharmacogenomic data highlighting positive, negative, or neutral correlation with diseases. Animal models using CCR5 ligands have also inferred association of CCR5 antagonism with efficacy against various disorders. Reviews on the potential of CCR5 antagonist for treatment of non-HIV diseases include Turner et al. (2007) and Wells et al. (2006). Preclinical evaluation of the utility of CCR5 antagonists against non-HIV diseases would be greatly facilitated by a highly potent and selective murine CCR5 antagonist. Unfortunately, no such tool has been reported, and compounds in current clinical HIV programs are highly selective for primate isoforms, and are devoid of activity against rodent species CCR5. To this end, a human CCR5 knock-in mouse has been constructed, where the human ORF supplants the murine ORF to ensure expression, and physiological role is as analogous to wildtype as possible. This, together with the identification of UK-484900 as a highly potent and selective human CCR5 antagonist with equivalent primary and selectivity pharmacology to maraviroc, coupled a PK profile (and dosing regime) in mice that ensures free compound exposure to be equivalent to maraviroc as seen in HIV-1 associated clinical practice (i.e., 100% functional CCR5 blockade), and has enabled a model for studying antagonist efficacy in various murine disease models (Dorr, 2008). Further validation has shown that hCCR5 is activated by murine chemokines (same EC50 as for human chemokines), and this is inhibited by hCCR5 antagonists. This validation of the model and utility in non-HIV diseases has recently been reported by (Dorr, 2008).

6.1. Vector construction for hCCR5 knock-in To generate a knock-in CCR5 mouse model, homologous recombination is used to replace the murine CCR5 gene with its human orthologue. Only the coding sequence of the human gene is inserted; thus the recombinant locus retains all mouse CCR5 cis-regulatory sequences and is expected to express the human CCR5 gene with the same cell specificity. The neomycin-resistance cassette used for targeting into ES cells is flanked by loxP sites and placed immediately after the stop codon (see Fig. 2.14). Therefore, the only permanent alteration of the locus is a 34 bp loxP site left after subsequent CRE-mediated recombination (Sauer and Henderson,

loxP

Spe

Stop

Human CCR5

Neomycin resistance

Xbol

3 kb Murine genomic DNA

BamH1 Sca

Kpn

ATG

loxP

3.5 kb Murine genomic DNA

Not1

49

CCR5 Primary Pharmacology Methods and Applications

Figure 2.14 CCR5 knock-in miceçtarget vector. Neomycin resistance cassette used for targeting into ES cells by homologous recombination with murine orthologue^ flanking regions (in situ) for human CCR5 (ORF-only) knock-in mice generation.The selection, excision, and marker restriction sites are shown.

1988). To achieve the seamless insertion of the human coding sequence into the mouse locus, the 50 arm of the targeting vector is constructed by overlapping PCR. The reverse oligo used to amplify the 3 kb of the murine genomic sequence upstream of the ATG includes 10 bp of the human coding sequence (Table 2.3). Likewise, the forward oligo used to amplify the human cDNA incorporated 30 bp of mouse genomic sequence at its 50 end, while the reverse primer contains a BamH1 cloning site, the loxP sequence, and stop codons. To complete the seamless junction at the ATG, another PCR is performed, which uses these two products as template to make a shorter product that bridges the mouse and human sequences. The full-length 50 homology arm is then assembled using naturally occurring restriction sites. The 30 homology arm is also made by PCR, using oligos that included a second loxP site in the forward primer. The completed homology arms are cloned into the pJNS2 vector containing PGKneomycin phosphotransferase for positive selection and the HSV thymidine kinase gene for negative selection. All products should be sequenced to ensure accuracy of the PCR.

6.2. Transfection and human CCR5 knock-in mouse generation The linearized targeting vector is electroporated into E14 129 ES cells (Hooper et al., 1987). Targeted clones can be identified by Southern blot using a 50 probe generated by PCR using oligos 585F/1521R and a 30 probe is made using oligos 9570F/10524. Targeting the 50 is determined by Sca1digestion (wt ¼ 6.5 kb, targeted ¼ 5.8 kb) and 30 targeting by Spe1 digestion (wt ¼ 11, targeted ¼ 7.5). Heterozygous animals carrying the targeted human allele are bred to mice expressing Cre recombinase under control of the E2A promoter (Lakso et al., 1996) to remove the neomycinresistance cassette, and then bred to homozygosity for the human CCR5, with cell surface expression checked in target cells (e.g., splenocytes, PBLs, etc.) using FACS technology as described above. These mice are available from Pfizer-GRD and are used in various academic laboratories as tools to investigate the potential of CCR5 antagonists to treat diverse inflammatory diseases.

50

Roy Mansfield et al.

Table 2.3 Oligos used to build CCR5 KI vector

CCR5-10254R CCR5-9570F CCR5-585F CCR5-1521R CCR5-Kpn1755F CCR5-Not9496R CCR5-50 arm-R hCCR5-50 F hCCR5-50 R

CATGATCTTCTTCATTCTCC TCCTTGCATTTCACTCTAGC GGAACTTGAGAATATCATCC GATTTGAAGGTAACAGAGCG ATGGTACCATTGGTGTCTGGGATAAAGC ATAAGAATGCGGCCGCTCCAGCATTCTGCAGATCCACC GATAATCCATCCTGCAAGAG CCTATGAATAAATAAAAGAC GTCTTTTATTTATTCATAGGCTCTTGCAGGATGGATTA TCAAGTGTCAAGTCCAATCTATGAC TTGGATCCATAACTTCGTATAATGTATGCTATACGAA GTTATTCATCATCACAAGCCCACAG

hCCR5 30 arm-F

ATATTTCCTGCTCCCCAGTG ATACTCGAGATAACTTCGTATAGCATACATTATACGAAGT TATCCTGGTTGACTTTTGTGTATCACGTAG

hCCR5-690R muCCR5-4697-F

CCTCTTCTTCTCATTTCG CACTACTCATTCTTTCTGGC

6.3. Materials Most materials described as reagents can be sourced from various commercial suppliers. Bespoke materials (and their final preparation) used in the methods are listed in the following against each method section number, with associated supplier. 2.1. CCR5-associated Ca2þ signaling—Ca2þ flux buffer and assay reagents: One bottle HANKS balanced salts powder (Sigma), 1.6 ml of 1 M CaCl2 (Sigma), 10 ml of 1 M HEPES, pH 8 (Sigma, cat no. H-0763), made up to 1 l with sterile water and adjusted to pH 7.4 with hydrochloric acid (HCl). Calcium Plus Kit (Molecular Devices). 2.2. Receptor internalization signaling assay—Assay buffer: RPMI (10% FBS) (RPMI, Gibco Invitrogen Corporation), RANTES and SDF-1a (R&D Systems, Becton Dickinson), FACScalibur (Cell Quest Software). Mouse antihuman CCR5 monoclonal antibodies: 2D7 (Pharmingen). Isotype control antibodies: mouse IgG2a, (Pharmingen). Secondary PE-labeled antibody: PE-labeled goat anti-mouse antibody (Sigma). Sodium citrate CPT (4-ml draw) blood tubes (Becton Dickinson). Sample processing tubes (12  75-mm polystyrene round bottomed) and caps (push fit) (Sarstedt Ltd). Reagents: MIP-1b working solution (R & D systems, 100 nM MIP-1b) aliquots stored frozen at – 70 . CCR5 stabilizing solution (600 nM maraviroc in PBS), stabilizing control solution (PBS), CCR5 MsIgG R-phycoerythrin 2D7 antiCCR5 antibody (Pharmingen) (PE-labeling by custom order).

CCR5 Primary Pharmacology Methods and Applications

51

2.4. GTP-associated CCR5 inverse agonism assay—Delfia GTPbinding kit (Perkin Elmer). Assay buffer: 50 mM HEPES, pH 7.4, containing 1 mM GDP, 10 mM MgCl2, 100 mM NaCl, and 100 mg/ ml saponin. MIP-1b (R & D Systems). Lysis buffer: 20 mM HEPES in purified water, containing 1 mM CaCl2, one tablet COMPLETETM protease inhibitors per 50-ml lysis buffer (BoehringerMannheim) adjusted to pH 7.4 (2 M HCl). 2.5. CRE-luciferase (CRE-Luc) reporter gene assay—Steady Glo Luciferase reagent (Promega). pCRE-luc, Pathdetect CRE cis reporting system (Stratagene). IBMX (Sigma). Human recombinant MIP-1b (R&D Systems). Forskolin (Sigma). 3.3. Real-time ligand binding using Biacore technology—Biacore 2000 and S51 optical biosensors, CM4 sensor chips, and the aminecoupling kit (Biacore AB). 1D4 antibody (University of British Columbia). The human chemokine receptor CCR5 is overexpressed in Cf2Th canine thymocyte cells as described previously (Mirzabekov et al., 1999); the cells are propagated by the National Cell Culture Center and contain a C-terminal linear C9 peptide tag (TETSQVAPA) that is recognized by the 1D4 monoclonal antibody (Oprian et al., 1987). Lipids (synthetic phospholipid blend [Dioleoyl] DOPC: DOPS [7:3, w/w]), Mini-Extruder kit, and polycarbonate filters (100 nm) (Avanti Polar Lipids). 3.4. HIV gp120 binding assay—pEE14.1 (Ba-L strain, Lonza Biologics). Human-soluble CD4 (Immunodiagnostics). Europium-labeled anti–HIV-1 gp120 IgG antibody (AALTO). Enhancement solution (EG&G Wallac). Wash buffer, Dulbecco’s PBS (Gibco). 4.2.1. CCR5-associated primary cell–based antiviral assays, peripheral blood lymphocytes (PBLs) and monocyte-derived macrophages (MDMs) HIV-1 replicative systems—HIV-1 isolates and strains and MT-2 cells: AIDS Reagent Project (NIBSC, Potters Bar, Herts, UK). All antiviral drug susceptibility assays are performed in RPMI 1640 medium, containing 10% v/v heat inactivated FCS, 2 mM L-glutamine, and antibiotics (1 U/ml penicillin and 0.1 mg/ml streptomycin). Phytohaemagglutinin (PHA), 1.5 mg/ml (Murex, Abbott Laboratories). Human recombinant interleukin2 (IL-2), 10 ng/ml (R&D Systems). QuanT RT kits (Amersham Pharmacia Biotech). 5. CCR5 site-directed mutagenesis and ligand docking studies— Plasmid pIRES neo (Clontech) pCRE-luc (Stratagene). Quikchange Site-Directed Mutagenesis kit (Stratagene). EcoRV (R&D Systems). QIAprep 8 Miniprep KitCat and QIAfilter Plasmid Maxi Kit (Qiagen). One ShotÒ TOP10 chemically competent cells E. coli (Invitrogen). HEK Ga15 cells (Aurora). HEK cell media: Dulbecco’s Modified Eagles Medium (DMEM) supplemented with 10% fetal calf serum, 2 mM

52

Roy Mansfield et al.

L-glutamine, sodium pyruvate, HEPES, nonessential amino acids, and blasticidin. DMEM (Dulbecco’s), with/without phenol red (Invitrogen). Blasticidin (Invitrogen R21001). OptiMEM 1 (Invitrogen). Lipofectamine reagent (Invitrogen). Plus reagent (Invitrogen). Steady Glo Luciferase reagent (Promega). pCRE-luc, Pathdetect CRE cis reporting system (Stratagene). IBMX (Sigma). 6. Non-HIV indications–associated studies, human CCR5 knock-in mice—Animals are housed in an AAALAC-accredited facility and handled according to Pfizer global research guidelines complying with the U.S. Public Health Service policy for the care and use of laboratory animals. PCR is carried out using Expand HighFidelity polymerase (Roche, Laval, QC, Canada).

REFERENCES Blanpain, C., Doranz, B. J., Bondue, A., Govaerts, C., De Leener, A., Vassart, G., Doms, R. W., Proudfoot, A., and Parmentier, M. (2003). The core domain of chemokines binds CCR5 extracellular domains while their amino terminus interacts with the transmembrane helix bundle. J. Biol. Chem. 278, 5179–5187. Epub 2002 Dec 3. Bradley, J., Gill, J., Bertelli, F., Letafat, S., Corbau, R., Hayter, P., Harrison, P., Tee, A., Keighley, W., Perros, M., Ciaramella, G., Sewing, A., et al. (2004). Development and automation of a 384-well cell fusion assay to identify inhibitors of CCR5/CD4-mediated HIV virus entry. J. Biomol. Screen 9, 516–524. Combadiere, C., Ahuja, S. K., Tiffany, H. L., and Murphy, P. M. (1996). Cloning and functional expression of CC CKR5, a human monocyte CC chemokine receptor selective for MIP-1(alpha), MIP-1(beta), and RANTES. J. Leukoc. Biol. 60, 147–152. Dobbs, S., Perros, M., and Rickett, G. A. (2001). An assay method for determining whether an agent is capable of mudlating the interaction of CCR5 with gp120. Dorr, P., and Perros, M. (2008). CCR5 inhibitors in HIV therapy. Expert Opinion for Drug Discovery 3, 1–16. Dorr, P., Corbau, R., Pickford, C., Rickett, G., Macartney, M., Griffin, P., Dobbs, S., Irvine, R., Westby, M., and Perros, M. (2003). Evaluation of the mechanism underlying the anti-HI activity of a series of experimental CCR5 antagonists. on. 43rd Annual Interscience Conference Antimicrobial Agents and Chemotherapy. Sept 14-17 2003, Poster, Chicago, F1466. Dorr, P., and Perros, M. (2008). CCR5 inhibitors in HIV therapy. Expert Opinion for Drug Discovery 3, 1345–1361. Dorr, P., Rickett, G., and Perros, M. (2003). A method for identifying CCR5 receptor antagonists by measuring residency time. Patent Ref. US20040023845 A1. Dorr, P., Todd, K., Irvine, B., Robas, N., Thomas, A., Fidock, M., Sultan, H., Mills, J., Perrucio, F., Burt, C., Rickett, G., Perkins, H., et al. (2005a). Site-Directed Mutagenesis Studies of CCR5 Reveal Differences in the Interactions between the Receptor and Various CCR5 Antagonists. In ‘‘45th Interscience Conference on Antimicrobial Agents and Chemotherapy,’’ Washington DC, USA. Dorr, P., Westby, M., Dobbs, S., Griffin, P., Irvine, B., Macartney, M., Mori, J., Rickett, G., Smith-Burchnell, C., Napier, C., Webster, R., Armour, D., et al.

CCR5 Primary Pharmacology Methods and Applications

53

(2005b). Maraviroc (UK-427,857), a potent, orally bioavailable, and selective smallmolecule inhibitor of chemokine receptor CCR5 with broad-spectrum anti-human immunodeficiency virus type 1 activity. Antimicrob. Agents Chemother. 49, 4721–4732. Dorr, P., Westby, M., McFadyen, L., Mori, J., Davis, J., Perruccio, F., Jones, R., Stupple, P., Middleton, D., and Perros, M. (2008). PF-232798, a Second Generation Oral CCR5 Antagonist. 15th Conference on Retroviruses and Opportunistic Infections, pp. 3–6. Boston. (Boston). February, 2008. Abstract 737. Dorr, P. (2008). Maraviroc outlook in HIV and non-HIV diseases. HIV-Infection and Organ Transplantation Symposium University Medical Center Hamburg-Eppendorf Hamburg, Germany. Haworth, B., Lin, H., Fidock, M., Dorr, P., and Strange, P. G. (2007). Allosteric effects of antagonists on signalling by the chemokine receptor CCR5. Biochem. Pharmacol. 74, 891–897. Epub 2007 Jun 26. Hooper, M., Hardy, K., Handyside, A., Hunter, S., and Monk, M. (1987). HPRT-deficient (Lesch-Nyhan) mouse embryos derived from germline colonization by cultured cells. Nature 326, 292–295. Jansson, C. C., Pohjanoksa, K., Lang, J., Wurster, S., Savola, J. M., and Scheinin, M. (1999). Alpha2-adrenoceptor agonists stimulate high-affinity GTPase activity in a receptor subtype-selective manner. Eur. J. Pharmacol. 374, 137–146. Kenakin, T., Jenkinson, S., and Watson, C. (2006). Determining the potency and molecular mechanism of action of insurmountable antagonists. J. Pharmacol. Exp. Ther. 319, 710–723. Epub 2006 Jul 20. Kondru, R., Zhang, J., Ji, C., Mirzadegan, T., Rotstein, D., Sankuratri, S., and Dioszegi, M. (2008). Molecular interactions of CCR5 with major classes of small-molecule anti-HIV CCR5 antagonists. Mol. Pharmacol. 73, 789–800. Epub 2007 Dec 20. Labrecque, J., Anastassov, V., Lau, G., Darkes, M., Mosi, R., and Fricker, S. P. (2005). The development of an europium-GTP assay to quantitate chemokine antagonist interactions for CXCR4 and CCR5. Assay Drug Dev. Technol. 3, 637–648. Lakso, M., Pichel, J. G., Gorman, J. R., Sauer, B., Okamoto, Y., Lee, E., Alt, F. W., and Westphal, H. (1996). Efficient in vivo manipulation of mouse genomic sequences at the zygote stage. Proc. Natl. Acad. Sci. USA 93, 5860–5865. Mirzabekov, T., Bannert, N., Farzan, M., Hofmann, W., Kolchinsky, P., Wu, L., Wyatt, R., and Sodroski, J. (1999). Enhanced expression, native purification, and characterization of CCR5, a principal HIV-1 coreceptor. J. Biol. Chem. 274, 28745–28750. Mosier, D. E., Picchio, G. R., Gulizia, R. J., Sabbe, R., Poignard, P., Picard, L., Offord, R. E., Thompson, D. A., and Wilken, J. (1999). Highly potent RANTES analogues either prevent CCR5-using human immunodeficiency virus type 1 infection in vivo or rapidly select for CXCR4-using variants. J. Virol. 73, 3544–3550. Mosley, M., Pullen, S., Botham, A., Gray, A., Napier, C., Mansfield, R., and Holbrook, M. (2006). The molecular cloning and functional expression of the dog CCR5. Vet Immunol. Immunopathol. 113, 415–420. Epub 2006 Jun 27. Mueller, A., Mahmoud, N. G., Goedecke, M. C., McKeating, J. A., and Strange, P. G. (2002). Pharmacological characterization of the chemokine receptor, CCR5. Br. J. Pharmacol. 135, 1033–1043. Mueller, A., Mahmoud, N. G., and Strange, P. G. (2006). Diverse signalling by different chemokines through the chemokine receptor CCR5. Biochem. Pharmacol. 72, 739–748. Epub 2006 Jul 17. Mueller, A., and Strange, P. G. (2004a). CCL3, acting via the chemokine receptor CCR5, leads to independent activation of Janus kinase 2 ( JAK2) and Gi proteins. FEBS Lett. 570, 126–132. Mueller, A., and Strange, P. G. (2004b). The chemokine receptor, CCR5. Int. J. Biochem. Cell. Biol. 36, 35–38.

54

Roy Mansfield et al.

Napier, C., Sale, H., Mosley, M., Rickett, G., Dorr, P., Mansfield, R., and Holbrook, M. (2005). Molecular cloning and radioligand binding characterization of the chemokine receptor CCR5 from rhesus macaque and human. Biochem. Pharmacol. 71, 163–172. Epub 2005 Nov. 18. Navratilova, I., Dioszegi, M., and Myszka, D. G. (2006). Analyzing ligand and small molecule binding activity of solubilized GPCRs using biosensor technology. Anal. Biochem. 355, 132–139. Epub 2006 May 15. Oprian, D. D., Molday, R. S., Kaufman, R. J., and Khorana, H. G. (1987). Expression of a synthetic bovine rhodopsin gene in monkey kidney cells. Proc. Natl. Acad. Sci. USA 84, 8874–8878. Palczewski, K., Kumasaka, T., Hori, T., Behnke, C. A., Motoshima, H., Fox, B. A., Le Trong, I., Teller, D. C., Okada, T., Stenkamp, R. E., Yamamoto, M., and Miyano, M. (2000). Crystal structure of rhodopsin: A G. protein-coupled receptor. Science 289, 739–745. Peltonen, J. M., Pihlavisto, M., and Scheinin, M. (1998). Subtype-Specific Stimulation of [S-35]Gtp-Gamma-S Binding by Recombinant Alpha(2)-Adrenoceptors. European Journal of Pharmacology 355, 275–279. Petropoulos, C. J., Parkin, N. T., Limoli, K. L., Lie, Y. S., Wrin, T., Huang, W., Tian, H., Smith, D., Winslow, G. A., Capon, D. J., and Whitcomb, J. M. (2000). A novel phenotypic drug susceptibility assay for human immunodeficiency virus type 1. Antimicrob. Agents Chemother. 44, 920–928. Rickett, G., Dobbs, S., Griffin, P., Dorr, P., Hitchcock, C., and Perros, M. (2003). Development of a high throughput time resolved immunoassay to support discovery of HIV-1 entry inhibitors. 43rd Annual Interscience Conference on Antimicrobial Agents and Chemotherapy, Abstract F-1461. Sauer, B., and Henderson, N. (1988). Site-specific DNA recombination in mammalian cells by the Cre recombinase of bacteriophage P1. Proc. Natl. Acad. Sci. USA 85, 5166–5170. Strizki, J. M., Tremblay, C., Xu, S., Wojcik, L., Wagner, N., Gonsiorek, W., Hipkin, R. W., Chou, C. C., Pugliese-Sivo, C., Xiao, Y., Tagat, J. R., Cox, K., et al. (2005). Discovery and characterization of vicriviroc (SCH 417690), a CCR5 antagonist with potent activity against human immunodeficiency virus type 1. Antimicrob. Agents Chemother. 49, 4911–4919. Strizki, J. M., Xu, S., Wagner, N. E., Wojcik, L., Liu, J., Hou, Y., Endres, M., Palani, A., Shapiro, S., Clader, J. W., Greenlee, W. J., Tagat, J. R., et al. (2001). SCH-C (SCH 351125), an orally bioavailable, small molecule antagonist of the chemokine receptor CCR5, is a potent inhibitor of HIV-1 infection in vitro and in vivo. Proc. Natl. Acad. Sci. USA 98(22), pp. 12718–12723. Tagat, J. R., McCombie, S. W., Nazareno, D., Labroli, M. A., Xiao, Y., Steensma, R. W., Strizki, J. M., Baroudy, B. M., Cox, K., Lachowicz, J., Varty, G., and Watkins, R. (2004). Piperazine-based CCR5 antagonists as HIV-1 inhibitors. IV. Discovery of 1-[(4,6-dimethyl-5-pyrimidinyl)carbonyl]-4-[4-[2-methoxy-1(R)-4-(trifluoromethyl) phenyl]ethyl-3(S)-methyl-1-piperaz inyl]-4-methylpiperidine (Sch-417690/Sch-D), a potent, highly selective, and orally bioavailable CCR5 antagonist. J. Med. Chem. 47, 2405–2408. Tsamis, F., Gavrilov, S., Kajumo, F., Seibert, C., Kuhmann, S., Ketas, T., Trkola, A., Palani, A., Clader, J. W., Tagat, J. R., McCombie, S., Baroudy, B., et al. (2003a). Analysis of the mechanism by which the small-molecule CCR5 antagonists SCH351125 and SCH-350581 inhibit human immunodeficiency virus type 1 entry. J. Virol. 77, 5201–5208. Tsamis, F., Gavrilov, S., Kajumo, F., Seibert, C., Kuhmann, S., Ketas, T., Trkola, A., Palani, A., Clader, J. W., Tagat, J. R., McCombie, S., Baroudy, B., et al. (2003b). Analysis of the mechanism by which the small-molecule CCR5 antagonists SCH-

CCR5 Primary Pharmacology Methods and Applications

55

351125 and SCH-350581 inhibit human immunodeficiency virus type 1 entry. J. Virol. 77, 5201–5208. Turner, J. E., Steinmetz, O. M., Stahl, R. A., and Panzer, U. (2007). Targeting of Th1-associated chemokine receptors CXCR3 and CCR5 as therapeutic strategy for inflammatory diseases. Mini Rev. Med. Chem. 7, 1089–1096. Watson, C., Jenkinson, S., Kazmierski, W., and Kenakin, T. (2005a). The CCR5 receptorbased mechanism of action of 873140, a potent allosteric noncompetitive HIV entry inhibitor. Mol. Pharmacol. 67, 1268–1282. Watson, C., Jenkinson, S., Kazmierski, W., and Kenakin, T. (2005b). The CCR5 receptorbased mechanism of action of 873140, a potent allosteric noncompetitive HIV entry inhibitor. Mol. Pharmacol. 67, 1268–1282. Epub 2005 Jan. 11. Wells, T. N., Power, C. A., Shaw, J. P., and Proudfoot, A. E. (2006). Chemokine blockers-therapeutics in the making? Trends Pharmacol. Sci. 27, 41–47. Epub 2005 Nov. 28. Westby, M., Smith-Burchnell, C., Hamilton, D., Robas, N., Irvine, B., Fidock, M., Mills, J., Perruccio, F., Mori, J., Macartney, M., Barber, C., Dorr, P., et al. (2005). UK-427,857resistant Primary Isolates are Susceptible to Structurally-related CCR5 Antagonists. In ‘‘12th Conference on Retroviruses and Opportunistic Infections,’’ Boston, MA. Westby, M., Smith-Burchnell, C., Mori, J., Lewis, M., Mosley, M., Stockdale, M., Dorr, P., Ciaramella, G., and Perros, M. (2007). Reduced maximal inhibition in phenotypic susceptibility assays indicates that viral strains resistant to the CCR5 antagonist maraviroc utilize inhibitor-bound receptor for entry. J. Virol. 81, 2359–2371. Westby, M., Smith-Burchnell, C., Mori, J., Lewis, M., Whitcomb, J., Petropoulos, C., and Perros, M. (2004). In vitro Escape of R5 Primary Isolates from the CCR5 Antagonist, UK-427,857, is Difficult to Achieve and Involves Continued Use of the CCR5 Receptor. In ‘‘XIII International HIV Drug Resistance Workshop,’’ Tenerife.

C H A P T E R

T H R E E

CXCR4 and Mobilization of Hematopoietic Precursors Michael P. Rettig, Pablo Ramirez, Bruno Nervi, and John F. DiPersio Contents 1. Introduction 2. HSPC Mobilizing Agents that Target the CXCL12/CXCR4 Axis 3. Donor Selection for HSPC Mobilization 3.1. Selection of mice for HSPC mobilization 3.2. Selection of humans for HSPC mobilization 4. Flow Cytometric Enumeration of Mobilized HSPCs 4.1. Flow cytometric enumeration of murine HSPCs 4.2. Flow cytometric enumeration of human HSPCs 5. Dosing and Kinetics of HSPC Mobilization by G-CSF and Plerixafor 5.1. G-CSF 5.2. Plerixafor 6. Flow Cytometric Analysis of CXCR4 Expression on Human CD34þ Subsets 6.1. Evaluation of cell surface CXCR4 on human CD34þ cell subsets 7. Functional Characterization of Mobilized HSPCs 7.1. In vitro assays of differentiation 7.2. Transmigration assays 7.3. Transplantation assays for mouse and human HSPCs 8. Concluding Remarks Acknowledgment References

58 59 64 64 64 65 65 65 66 66 67 69 70 73 73 73 74 80 80 80

Abstract The binding of the chemokine [C-X-C motif ] ligand 12 (CXCL12 or stromal cell– derived factor 1a [SDF-1a]) constitutively produced by bone marrow stromal cells and osteoblasts, to the CXC receptor (CXCR) 4, a transmembrane chemokine receptor expressed on hematopoietic stem and progenitor cells (HSPCs),

Division of Oncology, Siteman Cancer Center, Washington University School of Medicine, St. Louis, Missouri, USA Methods in Enzymology, Volume 460 ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)05203-3

#

2009 Elsevier Inc. All rights reserved.

57

58

Michael P. Rettig et al.

has emerged as a key signal for HSPC trafficking to and from the bone marrow. Disruption of CXCL12/CXCR4 signaling causes leukocytosis, with the release of HSPCs, neutrophils, and lymphocytes into the peripheral blood. Although mobilized peripheral blood has become the preferred source of stem cells for both autologous and allogeneic transplantation, the optimum strategy for obtaining mobilized products from donors is the subject of ongoing study. Granulocyte colony–stimulating factor (G-CSF) and plerixafor (AMD3100) are two agents used clinically to induce HSPC mobilization by disruption of the CXCL12/CXCR4 interaction. This chapter describes current procedures used to phenotypically and functionally characterize murine and human HSPCs mobilized by G-CSF or plerixafor.

1. Introduction The majority of hematopoietic stem and progenitor cells (HSPCs) reside in the bone marrow in a highly organized microenvironment consisting of marrow stromal cells, osteoblasts, osteoclasts, and other extracellular matrix proteins (e.g., collagens, fibronectins, proteoglycans) (Adams and Scadden, 2006; Kiger et al., 2000; Kollet et al., 2007; Wilson and Trumpp, 2006; Xie and Spradling, 2000). HSPCs express a number of cell surface molecules such as lymphocyte function–associated antigen-1 (LFA-1), very late antigen 4 (VLA-4), CXCR4, CXCR2, CD44, CD62L, and CD117 (c-kit) that mediate their adherence in the bone marrow (BM) microenvironment (Adams and Scadden, 2006; Lapidot et al., 2005; Wilson and Trumpp, 2006). These interactions play important roles in regulating HSPC trafficking, as well as self-renewal, proliferation, and differentiation processes (Kiel and Morrison, 2008; Wilson and Trumpp, 2006). Under normal conditions, a small number of HSPCs circulate in the peripheral blood. However, the number of circulating HSPCs can be increased 10- to 100-fold with administration of chemotherapy and/or cytokines in a process termed ‘‘stem cell mobilization’’ (Bensinger et al., 2009; Papayannopoulou and Scadden, 2008; Winkler and Levesque, 2006). Mobilized HSPCs can be collected by large-volume apheresis techniques in numbers sufficient for use in hematopoietic stem cell transplants, and upon reinfusion, are capable of homing to the BM cavity and regenerating the full array of hematopoietic lineages. Compared to BM, use of peripheral blood stem cells in hematopoietic stem cell transplantation results in more rapid hematologic reconstitution, reduced hospitalization costs, and avoids the risks of general anesthesia and discomfort with a BM harvest (Group, 2005). Because of these advantages, the use of mobilized HSPCs over marrow as a stem cell source continues to increase such that greater than 95% of

CXCR4 and Mobilization

59

autologous transplants and 75% of allogeneic hematopoietic stem cell transplants in adults are currently being performed with mobilized HSPCs (Bensinger et al., 2009). The optimal method for mobilization of HSPCs remains a subject of investigation. Although various agents have been used to mobilize HSPCs, only granulocyte colony-stimulating factor (G-CSF) (filgrastim, NeupogenÒ , Amgen, Thousand Oaks, CA), granulocyte-macrophage colony-stimulating factor (GM-CSF) (sargramostim, LeukineÒ , Bayer Healthcare Pharmaceuticals, Seattle, WA), stem cell factor (ancestim, StemgenÒ , Amgen, Thousand Oaks, CA, available in Canada and New Zealand only), and plerixafor (Mozobil, AMD3100, Genzyme Corporation, Cambridge, MA) are approved clinically for use in stem cell mobilization (Bensinger et al., 2009). Currently, G-CSF is the most commonly used agent to induce HSPC mobilization. However, because optimal mobilization requires from 4 to 6 days of G-CSF administration, donors may experience significant inconvenience, including bone pain, fatigue, headache, and nausea. Furthermore, while no long-term sequelae have been confirmed with short-term G-CSF, there are reports of serious acute toxicities related to its use as well as concerns that it can induce genetic and epigenetic modifications in HSPCs (Hernandez et al., 2005; Nagler et al., 2004; Shapira et al., 2003; Tigue et al., 2007). Accordingly, a less toxic, more rapid, and yet efficient method for collection of HSPCs from donors is still required and would represent a clear advance.

2. HSPC Mobilizing Agents that Target the CXCL12/CXCR4 Axis Targeted disruption of the interaction between CXCR4 and CXCL12 has received considerable attention since it may provide a method to efficiently and rapidly mobilize HSPCs from the BM into the periphery as well as inhibiting the metastatic process and HIV-1 infection (Burger and Peled, 2009; Grande et al., 2008; Khan et al., 2007; Uy et al., 2008). CXCL12 is a chemokine constitutively produced at high levels in the BM by stromal cells such as osteoblasts, endothelial cells, and a subset of reticular cells (Calvi et al., 2003; Dar et al., 2005; Imai et al., 1999; Jung et al., 2006; Ponomaryov et al., 2000). It is a potent chemoattractant for HSPCs and has been shown to regulate cell adhesion, survival, and cell-cycle status (Peled et al., 1999; Sugiyama et al., 2006; Watt and Forde, 2008). Interestingly, CXCL12 gene polymorphism has been proposed as a conditional factor for human CD34þ stem cell mobilization, with the presence of the SDF1-30 A allele as a predictive factor of good CD34þ cell mobilization (Benboubker

60

Michael P. Rettig et al.

et al., 2001). More recently, a second receptor, CXCR7, was identified that binds CXCL12 with an affinity that is approximately 10-fold higher than the affinity for CXCR4 (Balabanian et al., 2005a; Burns et al., 2006). Although the role of CXCR7 in CXCL12-dependent chemotaxis is not fully understood, there is evidence that CXCR7 lacks intrinsic chemotactic activity toward CXCL12, and functions instead by sequestering CXCL12 and modifying CXCR4 signaling (Boldajipour et al., 2008; Hartmann et al., 2008; Sierro et al., 2007). CXCR4 is a member of the large family of seven transmembrane domain receptors coupled to heterotrimeric Gi proteins and functions as a coreceptor for HIV-1 cell entry (Bleul et al., 1996; Feng et al., 1996; Fredriksson et al., 2003; Loetscher et al., 1994; Oberlin et al., 1996). Both CXCL12 (Bleul et al., 1996; Oberlin et al., 1996) and macrophage migrating inhibiting factor (MIF) (Bernhagen et al., 2007) are ligands for CXCR4. The binding of CXCR4 to CXCL12 results in activation of multiple signal transduction pathways ultimately triggering chemotaxis (Busillo and Benovic, 2007; Kucia et al., 2004). Targeted disruption of either CXCL12 or CXCR4 is lethal in mice, resulting in very similar developmental defects, including the failure of HSPC migration from the fetal liver to the BM, defects in lymphoid and myeloid hematopoiesis, and cerebellar dysgenesis (Ma et al., 1998; Nagasawa et al., 1996; Tachibana et al., 1998; Zou et al., 1998). Furthermore, wildtype mice transplanted with CXCR4-deficient progenitor cells have high circulating levels of HSPCs, indicating poor retention in the BM (Christopher et al., 2009; Ma et al., 1999). Finally, multiple preclinical and clinical studies have shown that pharmacologic interference in the axis between marrowderived CXCL12 and CXCR4 expressed on HSPCs using various CXCR4 modulators, including antagonist, peptide agonist, and modified CXCL12 analogues stimulate HSPC mobilization in a target-dependent manner (Nervi et al., 2006; Pelus, 2008). There are three potential mechanisms to explain how CXCR4 could regulate HSPC mobilization: (1) downregulation of cell surface CXCR4 by internalization or proteolysis, (2) disruption of the CXCL12 chemokine gradient between the BM and plasma, and (3) receptor antagonism via direct blocking of the CXCR4/CXCL12 interaction (Table 3.1). Decreased expression of CXCR4 on mobilized HSPCs has been reported following administration of G-CSF (Christopher et al., 2009; Dlubek et al., 2006; Levesque et al., 2003; Oelschlaegel et al., 2007; Semerad et al., 2005), a CXCL12 analogue (met-SDF-1b) (Shen et al., 2001; Yang et al., 1999), and CXCL12-derived peptide agonists (CTCE-0021, CTCE-0214) (Faber et al., 2007; Pelus et al., 2005; Zhong et al., 2004). Since native CXCL12 itself downregulates CXCR4 expression but does not result in significant mobilization (Haribabu et al., 1997; Orsini et al., 1999;

Class

Growth factor

Growth factor

Bicyclam

Peptide

Peptide

CXCL12 analog

Compound

G-CSF

Pegylated G-CSF

Plerixafor

T140

T134

Met-SDF1b

CXCR4 agonist

CXCR4 antagonist

CXCR4 antagonist

Granulocyte expansion/ activation, protease release, and cleavage of adhesion molecules, downregulation of CXCL12 in osteoblasts Granulocyte expansion/ activation, protease release and cleavage of adhesion molecules, downregulation of CXCL12 in osteoblasts CXCR4 antagonist

Mechanism

Table 3.1 CXCR4-mediated mobilization of murine HSPC

SC IV

10 mg/kg 300 mg

SC

IV

3 mg/kg 5 mg/kg

SC

SC

25 mg

5 mg/kg

SC

Route

250 mg/kg/ day x 5 days

Dose

48 h

1h

1–2 h

1–3 h

3–6 h

Day 3

Day 5

HSPC peak mobilization

(continued)

Broxmeyer et al., 2005 Ramirez et al., 2008 Abraham et al., 2007 Iyer et al., 2008 Shen et al., 2001

de Haan et al., 2000

Molineux et al., 1990

Reference

CXCL12 peptide analog CXCL12 peptide analog Sulfated polysaccharide

CTCE0021 CTCE0214 FucS IV

75 mg 100 mg/kg

CXCR4 agonist

Disruption of CXCL12 chemotactic gradient

IV

SC

Route

25 mg/kg

Dose

CXCR4 agonist

Mechanism

1.5 h

4h

1h

HSPC peak mobilization

Pelus, et al., 2005 Zhong et al., 2004 Sweeney et al., 2002

Reference

G-CSF, granulocyte colony-stimulating factor; Met-SDF, N-terminal methionine stromal cell---derived factor; FucS, sulfated polysaccharide fucoidan; IV, intravenous; SC, subcutaneous; n.d., not determined.

Class

Compound

Table 3.1 (continued)

CXCR4 and Mobilization

63

Signoret et al., 1997, 1998), it is generally believed that a threshold level of CXCR4 downregulation may be required for these agents to induce HSPC mobilization (Busillo and Benovic, 2007; Kucia et al., 2004). Concerning the second mechanism whereby CXCR4 could modulate HSPC mobilization, studies have shown that disruption of the CXCL12 gradient between the BM and the peripheral blood by the administration of sulfated polysaccharides (Sweeney et al., 2002) or adenovirus expressing CXCL12 (Hattori et al., 2001) results in an increase in circulating CXCL12 and HSPC mobilization. More relevant physiologically, recent studies have shown that a key step in G-CSF–induced HSPC mobilization is loss of CXCL12 expression by osteoblasts in the BM (Christopher et al., 2009; Katayama et al., 2006; Semerad et al., 2005). Since similar results were observed following mobilization of mice with Flt3L or stem cell factor (Christopher et al., 2009), this loss of osteoblast-produced CXCL12 may represent a common pathway in cytokine-induced mobilization. Finally, several CXCR4 antagonists have been described, of which plerixafor (Broxmeyer et al., 2005; Liles et al., 2003; Uy et al., 2008), T140 (Abraham et al., 2007), and T134 (Iyer et al., 2008) have been shown to rapidly mobilize HSPCs. Additional evidence for the critical role that CXCR4 plays in leukocyte trafficking has been obtained from patients with the genetic immunodeficiency syndrome WHIM (warts, hypogammaglobulinemia, infections, myelokathexis). WHIM syndrome is a rare congenital immunodeficiency disorder characterized by susceptibility to human papilloma virus infectioninduced warts, B-cell lymphopenia and hypogammaglobulinemia, chronic noncyclic neutropenia, and BM myeloid hyperplasia with apoptosis (Gorlin et al., 2000; Gulino, 2003). Most cases of WHIM syndrome have been linked to autosomal dominant mutations in CXCR4, all of which truncate the C-terminal tail of CXCR4 (Balabanian et al., 2005b; Gulino et al., 2004; Hernandez et al., 2003). Multiple studies have demonstrated that loss of the intracellular tail of CXCR4 prevents its internalization and desensitization in response to CXCL12 (Balabanian et al., 2005b; Gulino et al., 2004; Kawai et al., 2005). This loss of homologous desensitization leads to long-lasting activation of G-proteins and sustained functional activity of the chemokine receptor as evidenced by increased chemotaxis to CXCL12, F-actin polymerization, intracellular calcium release, and endothelial adhesion (Balabanian et al., 2005b, 2008; Gulino et al., 2004). Since CXCL12 is expressed constitutively at high levels in the BM, it is not surprising that WHIM leukocytes preferentially traffic to the marrow. In fact, expression of the WHIM-type mutated CXCR4 in healthy human CD34þ cells enhances their chemotactic response to CXCL12 and BM engraftment in immunodeficient mice (Kawai et al., 2007).

64

Michael P. Rettig et al.

3. Donor Selection for HSPC Mobilization 3.1. Selection of mice for HSPC mobilization Mice aged 8 weeks or older are used for mobilization experiments. When purchased from commercial vendors or obtained from outside sources, we allow the mice to acclimate to our facility for at least 1 week before use. All animal use should be in accordance with the guidelines of each individual’s Institutional Animal Care and Use Committee, the Federal Animal Welfare Act, and conform to recommendations in the Guide for the Care and Use of Laboratory Animals (Institute of Laboratory Animal Resources, National Research Council, National Academy of Sciences, 1996). Similar to humans, there is a wide variation in the magnitude of HSPC mobilization by different inbred strains of mice in response to G-CSF. Following treatment of mice with 200 mg/kg/d G-CSF for 5 days, Roberts et al. (1997) observed a 10-fold range in the number of circulating progenitor cells between different inbred strains of mice, with the mobilization efficacy roughly aligning in the following order: DBA > 129Sv > BALB/c ¼ SJL > C57Bl/6 ¼ C3H/He. Similarly, Broxmeyer and colleagues (2005) reported that the combination of G-CSF and plerixafor induced significantly greater mobilization of HSPCs in DBA mice compared with either C57Bl/6 or C3H/He. Although the exact mechanism/s for this large interstrain variation remains unresolved, both genetic determinants and the size of the stem cell pool play a role in the efficiency of mobilization by G-CSF (reviewed in Herbert et al., 2008). Because of the broad variability in mobilization efficiency by different strains of mice, it is preferable to test at least two strains of mice that differ in responsiveness to G-CSF when setting up mobilization experiments (Herbert et al., 2008).

3.2. Selection of humans for HSPC mobilization At our institution, eligible donors are between the ages of 18 and 70 years inclusive with evidence of adequate organ function (left ventricular ejection fraction more than 40%, formal pulmonary function testing showing a forced expiratory volume in 1 s [FEV1], more than 50% of predicted and a diffusing lung capacity for carbon dioxide [DLCO], more than 40% of predicted [corrected for hemoglobin]), a serum creatinine clearance of more than 40% of normal, a total bilirubin less than two times normal or absence of hepatic fibrosis/cirrhosis, no evidence of a severe central or peripheral neurologic abnormality, no evidence of active infection, be HIV negative, and have an Eastern Cooperative Oncology Group (ECOG) performance status of 0 or 1. Donors must give written consent in accordance with the Declaration of Helsinki on a study approved by the Human Studies

CXCR4 and Mobilization

65

Committee at Washington University. In the case of studies involving plerixafor, the Food and Drug Administration (FDA) approved the study under an investigator-held investigational new drug application.

4. Flow Cytometric Enumeration of Mobilized HSPCs Previous chapters in this journal (Hawley et al., 2006; Lin and Goodell, 2006) and elsewhere (Ema et al., 2006; Fukuda and Pelus, 2008; Herbert et al., 2008; Robinson and van Os, 2008) provide current procedures used to phenotypically characterize and isolate candidate human and murine HSPCs. The reader is referred to these publications for detailed methodology. In the following, we first briefly summarize the most common phenotypes used to characterize murine and human HSPCs.

4.1. Flow cytometric enumeration of murine HSPCs Among the subsets that define hematopoietic stem cells, CD34 c-kitþ Sca-1þ lineage marker (CD34KSL) cells are regarded as one of the populations that have the highest enrichment of HSPCs in adult mouse BM (Giebel and Punzel, 2008; Weissman and Shizuru, 2008). More recently, Morrison and colleagues (Kiel et al., 2005) have used markers from the SLAM family—CD150, CD244, and CD48—to differentiate stem cells from more committed progenitor cells. The most primitive murine stem cells were found to reside within the CD150þCD244–CD48– subpopulation.

4.2. Flow cytometric enumeration of human HSPCs The enumeration of cells that express the cell surface marker CD34 present on human HSPCs is used to assess the adequacy of stem cell numbers for hematopoietic stem cell transplantation. In humans, the CD34þ cell population contains progenitors committed to the myeloid, erythroid, megakaryoid, and lymphoid lineages, as well as primitive progenitors and stem cells capable of long-term reconstitution (Giebel and Punzel, 2008; Weissman and Shizuru, 2008). Although no adequate threshold exists, a minimum of 2.0  106 CD34þ cells/kg body weight is used by many centers to ensure adequate neutrophil recovery after transplant (Gandhi et al., 1999; Montgomery and Cottler-Fox, 2007; Tricot et al., 1995). Additionally, 5  106 CD34þ cells/kg has been considered by some to be the optimal target as it results in faster platelet recovery post transplant (Bensinger et al., 1995; Brown et al., 1997; Weaver et al., 1995).

66

Michael P. Rettig et al.

5. Dosing and Kinetics of HSPC Mobilization by G-CSF and Plerixafor 5.1. G-CSF 5.1.1. Mobilization of murine HSPCs by G-CSF Mice are typically mobilized with recombinant human G-CSF (Amgen, Thousand Oaks, CA) diluted in phosphate buffered saline (PBS) with 0.1% low endotoxin bovine serum albumin (BSA, Sigma) and administered by daily subcutaneous injection for 5 days at a dose of 250 mg/kg (Molineux et al., 1990). Although the mechanism by which G-CSF induces HSPC mobilization remains controversial, the absence of a mobilization response in CXCR4–/– BM chimeras indicates the absolute dependence of this chemokine receptor in G-CSF–induced HSPC mobilization (Christopher et al., 2009). Pegylated-G-CSF (pegfilgrastim, Neulasta, Amgen, Inc) is a longerlasting variant of G-CSF and was approved by the FDA in the USA to prevent prolonged neutropenia following chemotherapy for nonhematological malignancies (Kroschinsky et al., 2008). The 33-h plasma half-life of pegfilgrastim is substantially longer than the 4- to 6-h half-life of G-CSF due to decreased serum clearance (Zamboni, 2003). Peak mobilization of murine CFU-GM and CAFC by pegfilgrastim is observed 3 days after a single subcutaneous injection of 25 mg (de Haan et al., 2000). 5.1.2. Mobilization of human HSPCs by G-CSF When G-CSF is used alone for human HSPC mobilization, the recommended dose is 10 mg/kg subcutaneous daily (either as a bolus or continuous infusion) beginning at least 4 days before the first apheresis session and continued until the last apheresis session (Gazitt et al., 1999) (Neupogen [filgrastim]). Circulating CD34þ stem cell levels usually peak on the 5th day of G-CSF (Lane et al., 1995). Administration of G-CSF at a dose of at least 10 mg/kg/day for 5 days is usually required to achieve the mobilization goal of 5  106 CD34þ cells/kg of recipient body weight, a dose considered suitable for reproducible, rapid, and consistent engraftment of both neutrophils and platelets (Henon et al., 1992; Schmitz et al., 1996). Although the Food and Drug Administration (FDA) approved pegfilgrastim for the prevention of prolonged neutropenia after chemotherapy for nonhematological malignancies, its potential as a mobilizing agent is still being explored. In healthy donors, a single dose of 12 mg pegfilgrastim has been shown to mobilize CD34þ stem cells with a similar magnitude and kinetics as standard G-CSF (Hill et al., 2006; Kroschinsky et al., 2005).

CXCR4 and Mobilization

67

High-dose GCSF was investigated as a primary mobilization regimen throughout the 1990s (Kobbe et al., 1999; Sheridan et al., 1994; Zeller et al., 1996). Although seldom used today for primary mobilization, high-dose GCSF regimens are occasionally employed for remobilization (Boeve et al., 2004; Wang et al., 2007). Doses ranging from 16 to 32 mg/kg subcutaneous daily to 12 to 16 mg/kg subcutaneous twice daily have been considered as high-dose regimes (Bensinger et al., 2009).

5.2. Plerixafor 5.2.1. Mobilization of murine HSPCs by plerixafor Plerixafor (Genzyme, Cambridge, MA) is supplied as a sterile isotonic aqueous solution at 10 mg/ml. Broxmeyer and colleagues (2005) showed that a single-dose administration of 5 mg/kg subcutaneous plerixafor induces rapid mobilization of hematopoietic progenitor cells (HPCs) and long term repopulating cells to the blood of mice, with maximal mobilization of the HSPCs occurring 1 h postinjection. In agreement with these published results, we found that treatment of 129  B6 F1 mice with subcutaneous plerixafor results in rapid mobilization of white blood cells (WBC) and HPCs, with peak CFU-GM levels achieved 3 h after a single injection of 5 mg/kg plerixafor (Ramirez et al., 2008). Furthermore, we reported that repetitive subcutaneous injection of 5 mg/kg plerixafor to mice every 24 h results in a similar mobilization of progenitors (CFU-GM) after each injection (Nervi et al., 2009). Similar data were generated by Hubel et al. (2004) using normal human volunteers. These data demonstrate that subcutaneous plerixafor can be given daily resulting in similar kinetics and magnitude of progenitor mobilization with no obvious tachyphylaxis. In a separate series of experiments, we tested the efficacy of murine HSPC mobilization following intravenous administration of 1, 3, or 5 mg/kg plerixafor (Ramirez et al., 2008). Analysis of the dose–response relationship indicated that intravenous plerixafor resulted in more rapid mobilization (peak 1 h) than subcutaneous administration. Doses higher than 3 mg/kg intravenous plerixafor were lethal to the mice. 5.2.2. Mobilization of human HSPCs by plerixafor The FDA approved plerixafor for use in combination with G-CSF to mobilize HSPCs in patients with non-Hodgkin’s lymphoma and multiple myeloma undergoing autologous transplantation in December 2008. Subcutaneous injection of 240 mg/kg plerixafor is initiated after the patient has received 10 mg/kg/day G-CSF for 4 days, followed by leukapheresis beginning 11 h after drug treatment (MOZOBIL [plerixafor injection]).

68

Michael P. Rettig et al.

We recently published results from a Phase II study evaluating the safety and efficacy of plerixafor for CD34þ stem cell mobilization in allogeneic transplantation (Devine et al., 2008). Twenty-five donors were treated with a single subcutaneous dose of 240 mg/kg plerixafor and underwent apheresis 4 h later, with collection of enough stem cells for transplant (defined as >2  106 CD34þ cells/kg) in two-thirds of the donors. Twenty patients with hematologic malignancies received plerixafor-mobilized stem cell products with no adverse events. Although the CD34þ doses obtained were lower than that observed with a standard G-CSF mobilization regimen, the plerixafor-mobilized allografts functioned well and promoted rapid and durable multilineage hematopoiesis in the recipients. In our Phase II study discussed above, only 16 of the first 24 donors mobilized with subcutaneous plerixafor (240 mg/kg) collected the minimal required target of 2  106 CD34þ cells/kg in a single apheresis (Devine et al., 2008). Based on preliminary data suggesting higher (twofold) and earlier (1 h vs. 3 h) progenitor mobilization in mice after intravenous versus subcutaneous dosing of plerixafor (Ramirez et al., 2008), we amended our trial and began testing the safety and efficacy of increasing doses of intravenous plerixafor (80, 160, 240, 320, 400, and 480 mg/kg over 30 min) on the kinetics and magnitude of allogeneic HSPC mobilization. In an ongoing Phase I safety evaluation of intravenous plerixafor, allogeneic related donors are initially mobilized with increasing doses of intravenous plerixafor. After 4 days of drug clearance, the same donors are then mobilized with a single subcutaneous dose of 240 mg/kg plerixafor, and collected cells are used as a source of stem cells for transplantation. Consistent with our hypothesis, patients treated intravenously with 240 mg/kg plerixafor had higher peak levels of CD34þ cells/ml blood at every time point evaluated compared to the same plerixafor dose administered subcutaneously (Rettig et al., 2008). Furthermore, we have noted a clear dose–response effect of increasing doses of intravenous plerixafor. Of the seven donors who received 320 mg/kg intravenous plerixafor, all achieved peak levels of CD34/kg greater than 20 CD34/ml (range 22 to 38/ml), a level that we as well as others have shown is highly correlated with achieving more than 2  106 CD34/kg after a single apheresis (Bensinger et al., 2009; Pusic et al., 2008). Since no related dose-limiting toxicity has yet been determined, we plan to complete the final two intravenous dose cohorts (400 mg/kg and 480 mg/kg). These encouraging studies suggest that intravenous plerixafor may be a more effective mobilizing agent with a low side effect profile. We predict, based on this preliminary data, that the optimal dose of intravenous plerixafor will result in similar rates of achieving 2  106 CD34/kg after a single apheresis procedure compared to G-CSF in less time (4 h vs. 5 days).

CXCR4 and Mobilization

69

6. Flow Cytometric Analysis of CXCR4 Expression on Human CD34þ Subsets A variety of cell types express the CXCR4 receptor, including peripheral blood lymphocytes (B cells and T cells), monocytes, neutrophils, pre–B cells, mast cells, CD34þ HPCs, endothelial cells, intestinal and alveolar epithelial cells, astrocytes, microglia, and neurons (Khan et al., 2007). CXCR4 receptors cycle continuously to and from the cell surface in a ligand-independent manner, with the majority of CXCR4 being stored in an intracellular pool (Busillo and Benovic, 2007; Marchese et al., 2008; Zhang et al., 2004). The function of these large stores of intracellular CXCR4 remains unclear. In our recently published Phase II study evaluating the safety and efficacy of plerixafor for CD34þ stem cell mobilization in allogeneic transplantation (Devine et al., 2008), eight normal donors were mobilized sequentially with plerixafor and G-CSF. These donors initially received one subcutaneous injection of 240 mg/kg plerixafor, followed by leukapheresis beginning 4 h after drug treatment. After 10 days of drug clearance, the same donors were mobilized with 5 days subcutaneous injection of 10 mg/kg/day G-CSF, and leukapheresed on day 5. Interestingly, we found via flow cytometry that plerixafor mobilized a unique population of CD34dim cells which were present in 3- to 10-fold higher numbers compared to G-CSF mobilized CD34þ cells (Rettig et al., 2008). We further characterized CD34 immunoselected cells obtained after plerixafor or G-CSF mobilization of normal human donors by staining for CD34-APC and CD45RA-FITC. This staining and gating approach has allowed us to separate CD34þ cells in plerixafor mobilized products into three separate subsets (only two in G-CSF mobilized grafts), with the CD34dimCD45RAþ subset relatively specific to plerixafor compared to G-CSF mobilized products (Fig. 3.1). Of interest, two of the key molecules responsible for stem cell homing, retention, and trafficking, CXCR4 and VLA-4, were significantly overexpressed in the CD34dimCD45RAþ subset compared to the CD34þCD45RA– and CD34þCD45RAþ cells (Fig. 3.1). Others have shown that CD34þCD45RAþ cells represent more committed progenitors (reviewed in Blom and Spits, 2006; Weissman and Shizuru, 2008), with two different CD34dimCD45RAþ progenitor cell subsets having been described in the literature (Blom et al., 2000; Freud et al., 2005). Ongoing studies in the lab are further characterizing the CD34dimCD45RAþ progenitor cell subset preferentially mobilized by plerixafor. Below we describe in detail our method to purify and phenotype these different CD34þ stem cell subsets.

70

Michael P. Rettig et al.

Plerixafor

G-CSF 15.7

21

62.9

16.7 CD34

CD34

A

80.8

2.34

CD45RA

CD45RA

% of max

% of max

B

CXCR4

CXCR4

% of max

% of max

C

VLA-4

VLA-4

CD45RA−CD34+ CD45RA+CD34+ CD45RA+CD34dim

Figure 3.1 Coexpression of CD45RA on human CD34þ cells identifies the CD34dim subset. (A) Healthy donors were treated with a single injection of 240 mg/kg AMD3100 or given 10 mg/kg/day G-CSF for 5 days. CD34þ cells from leukapheresis products were purified by CD34 immunoselection using an autoMACS device and the expression of CD34 and CD45RA was evaluated by flow cytometry. CD45RAþCD34dim cells are enriched in AMD3100-mobilized products. (B-C) CD45RAþCD34dim cells from AMD3100-mobilized products express high levels of surface CXCR4 (B) and VLA-4 (C).

6.1. Evaluation of cell surface CXCR4 on human CD34þ cell subsets Aliquots of leukapheresis products are obtained in evacuated tubes coated with ethylene-diaminetetra-acetic acid (EDTA) or sodium heparin after informed consent in conformity with a human subjects protocol approved by an institutional review board. Rapid processing of samples is particularly important, since surface expression of CXCR4 may increase with time due to release from intracellular stores (Forster et al., 1998; Shalekoff and Tiemessen, 2001). Cold (4 ) storage stabilizes human CD34þ cells.

CXCR4 and Mobilization

71

1. Pass leukapheresis product through 30 mm nylon mesh (Miltenyi PreSeparation Filters, #130-041-407) into a sterile 50 ml conical tube to remove cell clumps. Dilute cells by adding 20 to 30 ml of cold running buffer ( phosphate-buffered saline supplemented with 0.5% bovine serum albumin and 2 mM EDTA, stored at 4 ). 2. Perform a viable cell count on a hemacytometer. 3. Pellet cells at 300g for 5 min at 4 . 4. To prepare the cells for magnetic selection, decant supernatant and resuspend the cell pellet in a final volume of 300 ml of running buffer per 108 cells. 5. Isolate CD34þ cells by positive selection using a CD34 Microbead Kit (cat. no. 130-046-702, Miltenyi Biotec, Auburn, CA) and autoMACS Separator (Miltenyi Biotec) according to the manufacturer’s instructions. Set aside an aliquot of 106 cells immediately before application to the autoMACS separator to use a pre-sort control for flow cytometry. Run sample through the autoMACS separator using the ‘‘posseld’’ (doublepositive selection) program and collect both the positive (enriched CD34þ cells) and negative (CD34– cells) fractions. 6. Perform a viable cell count on both the positive and negative fractions using a hemacytometer. After CD34 positive selection of 6 ml of leukapheresis material, we typically obtain 5  106 and 2  106 CD34þ cells from G-CSF (10 mg/kg/day  5 days) and plerixafor (240 mg/kg subcutaneous) mobilized donors, respectively. 7. Label tubes and aliquot cells for flow cytometry as described in Table 3.2. Approximately 10  105 CD34– cells (negative sort) are used per tube to setup the instrument (compensation controls). In contrast, because of the limited number of CD34þ cells obtained, we usually only aliquot 0.5 to 1  105 CD34þ cells (positive sort) per tube for the gating controls (fluorescence minus one controls) and experimental sample. All samples are placed in a final volume of 100 ml of running buffer for flow cytometry analysis. Negative gating controls are analyzed to establish the level of background fluorescence resulting from autofluorescence and nonspecific antibody binding. Furthermore, fluorescence minus one gating controls are preferred over isotype controls because isotype controls are not always matched to the concentration of the test monoclonal antibody (mAb). Extracellular staining of cells is performed as described in Table 3.2 by the addition of the following antihuman monoclonal antibodies (all obtained from BD Biosciences): CD4-FITC (clone RPA-T4, cat. no 555346), CD4-PE (clone RPA-T4, cat. no. 555347), CD4-APC (clone RPA-T4, cat. no. 555349), CD45RA-FITC (clone HI100, cat. no. 555488), CXCR4-PE (clone 1D9, cat. no. 551510), and CD34-APC (clone 581, cat. no. 555824). The amount of antibody added to each sample

72

Michael P. Rettig et al.

Table 3.2 Staining setup for evaluation of CXCR4 on CD34þ cell subsets Tube no.

Sample

No. cells (105)

Compensation controls 1 CD34– 10 2 CD34– 10 3 CD34– 10 4 CD34– 10 Gating controls 5 CD34þ 0.5 6 CD34þ 0.5 7 CD34þ 0.5 Experimental samples 8 pre 10 9 CD34– 0.5 10 CD34þ 10

FITC

PE

Viability

APC

— CD4 — —

— — CD4 —

7-AAD 7-AAD 7-AAD 7-AAD

— — — CD4

— CD45RA CD45RA

CXCR4 — CXCR4

7-AAD 7-AAD 7-AAD

CD34 CD34 —

CD45RA CD45RA CD45RA

CXCR4 CXCR4 CXCR4

7-AAD 7-AAD 7-AAD

CD34 CD34 CD34

7-AAD, 7-amino-actinomycin D; APC, allophycocyanin; FITC, fluorescein isothiocyanate; PE, phycoerythrin.

is adjusted according to the number of cells used per the manufacturer’s instructions. Since CD34þ cells are immunoselected using the antihuman CD34 clone QBEND/10, post-sort analyses of CD34 expression must be performed using a separate mAb clone. The APC-conjugated anti-CD34 clone 581 provides a very bright signal that can be easily distinguished from the negative gating control. Additionally, the mAb most commonly used to study cell surface CXCR4 expression, clone 12G5, does not bind in the presence of plerixafor (Khan et al., 2007). Clone 12G5 binds to an epitope on the second extracellular loop of CXCR4 that overlaps the plerixafor binding site on the extracellular loop 2 and the adjacent transmembrane segment TM4. Therefore, we use a separate clone, 1D9, which is not inhibited by plerixafor. The epitope recognized by antibody 1D9 is contained within the N-terminus of CXCR4 (Forster et al., 1998). 1. Incubate samples for 30 min at 4 in the dark. 2. Remove unreacted antibodies by washing the cells twice in 3 ml of running buffer. After the final wash, decant the supernatant and resuspend the cells in 300 ml of running buffer. Keep samples on ice until analysis. 3. We assess cell viability concomitantly with flow cytometry evaluation of stained cells by the addition of 7-amino-actinomycin D (cat. no. 559925, BD Biosciences). 4. Analyze the samples on a flow cytometer equipped for excitation wavelengths of 488 and 633 nm.

CXCR4 and Mobilization

73

7. Functional Characterization of Mobilized HSPCs 7.1. In vitro assays of differentiation In vitro assays of differentiation have been developed to quantify murine and human HSPC content (Sutherland et al., 1989). In short-term colonyforming cell (CFC) assays, test samples are cultured in a semisolid matrix supplemented with nutrients and cytokines for 2 weeks at 37 . During this culture period, CFCs proliferate and produce discrete cell clusters or colonies of morphologically recognizable daughter cells that can be quantified by light microscopy. Based on the selection of the appropriate media and culture conditions, CFC assays can be used to quantify myeloid multipotential progenitors (CFU-GEMM and CFU-GM) and lineage-restricted progenitors of the erythrocyte (CFU-E and BFU-E), granulocyte (CFU-G), monocyte-macrophage (CFU-M), megakayocyte (CFU-Mk), and B-cell (CFU–pre-B) lineages. The standardized short-term colony assays discussed above easily quantify lineage-committed progenitors, but are not adequate for the detection of more primitive HSPCs. Two assays, the cobblestone-area–forming-cell (CAFC) assay (de Haan et al., 2002) and the long-term culture-initiating cell (LTC-IC) assay (Lemieux et al., 1995; Sutherland et al., 1991), have been developed to measure more primitive stem cell frequencies. Both the CAFC and LTC-IC assays rely on adherent stromal cells for hematopoietic support and are quantified in vitro based on their capacity to generate myeloid cells for at least 5 weeks of culture. Additionally, the LTC-IC assay can be used in a quantitative manner by limiting dilution analysis to provide an estimate of the primitive cell pool within a product (Coulombel, 2004). The reader is referred to previous chapters in this series (Broxmeyer et al., 2006) and elsewhere (Miller et al., 2008; van Os et al., 2008) for detailed descriptions of the CFC, CAFC, and LTC-IC procedures (see also www.stemcell.com/technical/manuals.asp).

7.2. Transmigration assays Trafficking of HSPCs to the BM following transplantation is believed to be a critical step for hematopoietic reconstitution. Studies by Voermans et al. (2001) showed that enhanced in vitro migration of human CD34þ cells to CXCL12 was associated with improved in vivo hematopoietic recovery. Since CXCL12-induced migration is not dependent on CXCR4 expression levels alone (Voermans et al., 2001), and treatment with plerixafor, G-CSF or other mobilizing agents that target the CXCL12/CXCR4 interaction alter CXCL12 signaling, others and we often test the ability of

74

Michael P. Rettig et al.

mobilized HSPCs to migrate to CXCL12 using transwell migration assays. We perform these assays according to the protocol described elsewhere by Fukuda and Pelus (2008).

7.3. Transplantation assays for mouse and human HSPCs Long-term repopulating stem cells are defined by their ability to self-renew and to differentiate into mature cells of all hematopoietic lineages. The definitive assay for stem cell activity in a test sample is the complete and sustained (>6 months) reconstitution of all hematopoietic lineages in irradiated recipients by transplanted HSPCs (Herbert et al., 2008; Purton and Scadden, 2007). The most common type of transplantation assay used to measure murine primitive stem cell activity is the competitive repopulation assay (Harrison, 1980). This assay measures the functional potential of an unknown ‘‘test’’ source of HSPCs (e.g., mobilized grafts) against a set known number of whole BM cells. The competing cells ensure the survival of lethally irradiated recipients transplanted with a low number of test HSPCs and allow quantification of the reconstitution activity. For donor versus host identification in transplantation assays, investigators commonly use C57BL/6 (B6) mice congenic for the CD45 (Ly5, common leukocyte antigen) locus to discriminate among the three potential sources of stem cells (test cells, competitor BM cells, and the host). We routinely use C57BL/6 (CD45.2þ) as recipients, congenic C57BL/6 (CD45.1þ) mice for mobilization, and hybrid C57BL/6 (CD45.1þCD45.2þ) mice as BM donors. The number of repopulating units (RU) in the test sample is then determined by measuring the contribution of the test sample to donor chimerism at various time points after transplantation (Harrison et al., 1993; Purton and Scadden, 2007; Yuan et al., 2005). The value of the repopulating unit is indicative of the amount of repopulating activity within the test sample. Although determination of the repopulating unit provides important information about the overall function of a test sample, it does not provide information on the quantity of primitive stem cells within the graft. The frequency of stem cells in an unknown test sample can be determined by performing limiting dilution competitive repopulation assays. In these studies, a series of dilutions of the test source are again competed against a set number of competing BM cells. The number of mice negative for reconstitution in each test cell dose is determined, and the frequency of HSPCs (competitive repopulating units, CRU) is estimated using Poisson statistics (Purton and Scadden, 2007; Szilvassy et al., 1989, 1990; Taswell, 1981). The most definitive test of long-term hematopoietic stem cells potential is the serial transplantation assay (Purton and Scadden, 2007). In this assay, the test sample is transplanted into sequential serial transplant recipients, and

CXCR4 and Mobilization

75

the ability of the transplanted population to sustain hematopoiesis is determined. Since the limiting dilution competitive repopulation assay can be used to incorporate all three types of the long-term repopulating stem cell assays discussed above (RU, CRU, and serial transplantation), we will describe the assay in greater detail in the following. 7.3.1. Limiting dilution competitive repopulation assay Wildtype C57BL/6J (CD45.2þ) and a congenic strain of C567BL/6 that have the CD45.1 gene (B6.SJL-PtPrc*Pep3BoyJ) are obtained from The Jackson Laboratory (Bar Harbor, ME). Hybrid C57BL/6J  B6.SJLPtPrc*Pep3BoyJ F1 (CD45.1þ/CD45.2þ heterozygous) are bred at our animal facility. The Ly5/CD45 antigen is expressed on all hematopoietic cells except erythrocytes, and polymorphism between CD45.1 and CD45.2 provides a quick and convenient method for detecting donor cells within leukocytes of recipients using flow cytometric techniques. All mice are 8 to 10 weeks old and sex-matched. Wildtype C57BL/6J (CD45.2þ) recipients are exposed to a lethal dose of total body irradiation from 12 to 24 h before transplantation. Since irradiation toxicity levels can be variable between institutions, it is preferable that all investigators assess the level of radiation that their mice can tolerate without any morbidity and mortality. Typical irradiation doses range for C57BL/6 mice range from 1000 cGy to 1100 cGy TBI. At least 16 to 20 mice are irradiated per experiment. Low-density mononuclear cells (LDMNCs) are isolated from mobilized B6.SJL-PtPrc*Pep3BoyJ (CD45.1þ) mice using murine lympholyte (Cedarlane Laboratories, Burlington, Ontario, Canada). Approximately 2  107 total LDMNCs are needed to inject at least four mice at a minimum of three different cell doses. For plerixafor, we typically treat 20 to 25 CD45.1þ B6 donor mice with 5 mg/kg subcutaneous plerixafor and harvest peripheral blood 3 h later. For GCSF, we treat 10 to 15 CD45.1þ B6 donor mice with G-CSF (250 mg/kg/day) for 5 days and harvest peripheral blood 4 h after the last injection of G-CSF. Isolate BM cells aseptically from C57BL/6J  B6.SJL-PtPrc*Pep3BoyJ F1 (CD45.1þ/CD45.2þ) mice. We sacrifice 1 CD45.1þ/CD45.2þ B6 BM donor mouse for every 15 to 20 lethally irradiated CD45.2þ B6 mice undergoing transplantation. LDMNCs from mobilized CD45.1þ B6 mice are mixed with unfractionated CD45.1þ/CD45.2þ B6 competitor BM cells. At least four mice at a minimum of three different cell doses should be evaluated to allow statistical comparison of test (CD45.1þ) cell engraftment between treatment groups at limiting dilution (Purton and Scadden, 2007). Most investigators inject between 2 to 5  105 competing BM cells per mouse. However, the number of LDMNCs injected per mouse is variable between institutions

76

Michael P. Rettig et al.

and each mobilizing agent. For plerixafor and G-CSF mobilized grafts, we and others (Broxmeyer et al., 2005) have set the ratio of donor (CD45.1þ) blood cells to competitor (CD45.1þ/CD45.2þ) BM cells as the number or LDMNCs in three, two, or one donor mice to a constant number of 5  105 competitor BM cells (CD45.1þ/CD45.2þ). For example, at a 3:1 ratio, we mix the number of LDMNCs obtained from the peripheral blood of three donor mice (CD45.1þ) with 5  105 competitor BM cells (CD45.1þ/CD45.2þ). Others mix 5  105 competitor BM cells with 2  106, 1.5  106, or 1  106 LDMNCs to yield LDMNC to BM ratios of 4:1, 3:1, or 2:1, respectively (Fukuda et al., 2007). Pilot experiments are recommended to obtain the range of LDMNCs required to achieve durable test sample engraftment. Four B6 (CD45.2þ) mice that received 1000 cGy TBI and 5  105 competitor BM cells (CD45.1þ/CD45.2þ) without donor test cells were used as controls. Hematopoietic repopulation is evaluated monthly for at least 6 months to demonstrate long-term multilineage reconstitution in the CD45.1þ and CD45.1þ/CD45.2þ donor cell subsets. Multilineage analysis is performed on the blood by flow cytometry using antimouse monoclonal antibodies against CD45.1, CD45.2, and the lineage markers B220 (B lymphoid), CD3 (T lymphoid), Mac1 (monocyte/macrophage), and Gr1 (granulocyte). At least 20,000 events are acquired on a flow cytometer. Since myeloid progenitors and their progeny have short half-lives compared to lymphoid progeny, it is important to demonstrate myeloid reconstitution in the test-cell subset following transplantation. Furthermore, Bryder et al. (2004) demonstrated that the RB6-8C5 mAb detecting Gr-1 also binds to a subpopulation of CD3þCD8þ T cells present in the peripheral blood. Therefore, granulocyte reconstitution should be defined as Gr-1þ cells negative for expression of T-cell markers like CD3. The percentage of chimerism is calculated based on flow cytometry data as follows: % chimerism ¼ (% test donor cells)  100 / (% test donor cells þ % competitor cells). Most investigators consider that primitive stem cells are present in the test donor cells when the percent chimerism is greater than 1% for all myeloid (granulocytes and macrophages), B-lymphoid, and T-lymphoid lineages at 6 months after transplantation. The number of repopulating units (RU) in test donor cells is calculated according to the method of Harrison et al. (1993) as follows: % chimerism ¼ (% chimerism)  (no. of competitor cells/105) /(100 – % chimerism). One RU is defined as the amount of repopulating activity in 105 BM cells from wildtype mice (Ema et al., 2006; Purton and Scadden, 2007). In limiting dilution assays, the frequency of competitive repopulating units (CRU) among test donor cells is estimated on the basis of Poisson statistics; the ranges of CRUs are given as 95% confidence intervals. StemCell Technologies has developed a program, L-Calc, to aid in the data analysis of limiting dilution assays. This software is free to download from

CXCR4 and Mobilization

77

the company website. Of note, CRU and RU are different (Ema et al., 2006; Purton and Scadden, 2007). CRU measures the quantity of HSPCs, whereas RU measures the functional quality of HSPCs. Furthermore, since short-term repopulating cells can reconstitute multiple lineages for at least 16 weeks, most researchers determine RU and CRU values from data collected at least 6 months post-transplantation. It should be noted, that noncompetitive primary transplantation assays can be performed to mimic how transplants are performed clinically. In a noncompetitive transplant, test cells (typically 1 to 2  106) are injected into lethally irradiated congenic recipients in the absence of competing BM cells. Although the primary endpoint in noncompetitive transplants is the time to recovery of peripheral blood neutrophils, platelets, and hemoglobin, donor chimerism can also be determined as described. 7.3.2. Secondary transplantation Wildtype C57BL/6J (CD45.2þ) recipients are exposed to a single dose of lethal (1000 cGy) total body irradiation from a 37Cesium source at a rate of 95 cGy/minute 12 to 24 h before transplantation. Primary recipient mice are sacrificed at 6 months post-transplant and the contents of their femurs are pooled within the respective treatment groups. Pooled BM cells (1  106) are injected via the tail vein using a 27-gauge needle in 0.2 ml of PBS within 12 h after irradiation of C57BL/6J (CD45.2þ) recipients. If possible, at least 10 secondary recipients should be injected with BM cells harvested from the primary recipients. The proportions of CD45.2 donor and CD45.1 competitor cell engraftment in the secondary recipients were measured at 2, 6, 14, and 27 weeks using the same methods. Tertiary transplantations were carried out in the same manner. 7.3.3. Immune-deficient mouse models to study human stem cell–repopulation capacity Several xenotransplantation models have been developed as surrogate assays of human HSPC activity, with the majority relying on the use of different strains of immunodeficient mice with various degrees of residual innate immunity. Nonobese diabetic (NOD) mice crossed with severe combined immunodeficient (SCID) mice represent the most accepted and widely used immune-deficient animal for quantitative comparison of human HSPC activity (Cashman et al., 1997; Larochelle et al., 1996; Pflumio et al., 1996). NOD/SCID mice stringently engraft only primitive human hematopoietic stem cells (scid-reconstituting cells [SRC]) that repopulate the BM with predominantly CD34þCD19þ pro-B cells exhibiting a poor capacity to terminally differentiate, and to a lesser degree, myeloid cells. In contrast to the SRC, more committed human progenitor populations are able to engraft NOD/SCID mice back-crossed with the b2-microglobulin–null

78

Michael P. Rettig et al.

(b2mnull) allele (Kollet et al., 2000, 2001). These NOD/SCIDbmnull mice exhibit a more absolute immunodeficiency than NOD/SCID mice and have virtually no NK cell function. In fact, compared to NOD/SCID controls, NOD/SCIDb2mnull mice support a greater than 10-fold higher level of SRC frequency upon transplantation of small numbers (8  104 cells) of human cord–blood mononuclear cells and become reconstituted with lymphoid CD45þCD19þ cells (no T cells) and myeloid CD45þCD33þ cells. This enhanced SRC frequency in NOD/SCIDbmnull mice is caused by the increased engraftment of human myeloid and lymphoid short term repopulating hematopoietic cells (Eaves et al., 2001; Glimm et al., 2001). Two major limitations of the NOD/SCIDbmnull xenograft model are their poor reproduction rate and short life span (approximately 6 months due to accelerated thymic lymphomagenesis). One alternative to using NOD/SCIDbmnull mice for measuring human HSPC activity is to treat NOD/SCID mice with a monoclonal antibody (mAb) against the interleukin-2 receptor bchain (IL-2Rb, CD122). The anti-CD122 mAb eradicates CD122-expressing cell populations, including NK cells and macrophages that mediate a negative effect on human engraftment. Compared to NOD/ SCIDb2mnull mice, anti-CD122 treated NOD/SCID mice exhibit a nearly threefold greater human cell engraftment upon transplantation of human cord–blood mononuclear cells (McKenzie et al., 2005). A second alternative to using NOD/SCIDb2mnull mice in SRC assays is to use NOD/SCID mice harboring a complete null mutation of the interleukin 2 receptor common g chain (NOD/SCID/gcnull) (Ito et al., 2002; Shultz et al., 2005). Similar to NOD/SCID-b2mnull mice, NOD/SCID/gcnull mice have reduced activities and numbers of NK cells. However, unlike NOD/SCID-b2mnull mice, NOD/SCID/gcnull mice can survive long term (15 months) because they do not develop thymic lymphomas, have a reproduction rate similar to normal wildtype mice, and exhibit multilineage engraftment of mature and functional CD3þCD4þ and CDþCD8þ T cells, Igþ B cells, NK cells, monocytes/macrophages, and plasmacytoid dendritic cells following transplantation of human CD34þ HSCs. Furthermore, since NOD/SCID/gcnull mice require no anti-CD122/IL-2Rb monoclonal antibody treatment for human cell engraftment, they provide a significant cost advantage over NOD/SCID mice. NOD/LtSz-Prkdcscid/Prkdcscid (NOD/SCID), NOD/LtSz-Prkdcscid/ Prkdcscidbmnull (NOD/SCID-b2mnull), and NOD.Cg-Prkdcscid Il2rgtm1Wjl/ SzJ (NOD/SCID/gcnull) mice are obtained from Jackson Laboratories (Bar Harbor, ME), and bred at our animal facility. NOD/SCID mice are known to be ‘‘leaky,’’ and sometimes develop mouse CD3þ T cells that can impede human cell engraftment. Therefore, we screen the peripheral blood of all NOD/SCID mice by flow cytometry with antimouse monoclonal antibodies (CD45, CD3, and DX5) and eliminate any mice exhibiting more than 1% CD3þ T cells.

CXCR4 and Mobilization

79

All immunodeficient mice are housed in a specific pathogen-free facility in sterile microisolator cages, and given autoclaved food and water ad libitum. All manipulations are performed aseptically on a laminar flow bench. We condition 8- to 10-week-old NOD/SCID, NOD/SCIDb2mnull, and NOD/SCID/gcnull mice with 300 cGy, 300 cGy, and 250 cGy of single-dose total body g irradiation (TBI), respectively, using a Shepard Mark IV Cesium137 irradiator. However, since irradiation toxicity levels can be variable between institutions, it is preferable that each investigator assesses the level of radiation that their mice can tolerate without any morbidity and mortality. Typical irradiation doses range from 250 cGy to 300 cGy TBI. NOD/SCID mice treated with anti-CD122 antibody are given injections of 200 mg purified antibody into the intraperitoneal cavity immediately after irradiation. The anti-CD122 monoclonal antibody generated from the hybridoma cell line TM-b1 can be purchased from Bio Express Inc. (West Lebanon, NH). Human mobilized peripheral blood mononuclear cells and purified CD34þ cells are injected via the tail vein using a 27-gauge needle in 0.2 ml of PBS within 12 h after irradiation. A range of human MNC (106 to 40  106 cells) or purified CD34þ cells (2  104 to 1  106 cells) are injected into quadruplicate mice at a minimum of three different doses per donor to allow direct statistical comparison of human cell engraftment between treatment groups at limiting dilution. Control mice are irradiated but do not receive human cells. Ten to 12 weeks after transplantation, BM (femurs and tibias), spleen, and peripheral blood are recovered, single cell suspensions prepared, and numbers of total nucleated cells are determined using a hemacytometer. The appropriate dilution of antibodies, as titered against human or mouse peripheral blood mononuclear cells, are incubated with 1 to 5  105 cells for 30 min at 4 and then washed two times in phosphate-buffered saline (PBS) plus 0.5% bovine serum albumin. At least 10,000 events are acquired on a flow cytometer. Antimouse CD45 and antihuman CD45 mAb are used to determine the number of mouse and human hematopoietic cells, respectively. Engrafted mouse BM is further analyzed for the frequency of human B-lymphoid cells (CD20-FITC, CD19-PE), myeloid cells (CD14FITC, CD33-PE), T-lymphoid cells (CD4-FITC, CD8-PE), and primitive HSPCs (CD34-FITC, CD38-PE). All antibodies are purchased from Becton Dickinson (San Diego, CA). To accurately set up the cytometer, we mix equal numbers of BM cells from a control, untransplanted immunodeficient mouse with human PBMCs. These control samples are then stained individually with antihuman CD45 and antimurine CD45 or simultaneously with the antihuman CD45/antimurine CD45-lineage cocktails described.

80

Michael P. Rettig et al.

The proportion of human cells in each mouse is calculated as follows: % huCD45þ ¼ [no. huCD45þ/(no. huCD45þ þ no. muCD45þ)]. Mice are considered engrafted when at least 1% of human CD45þ cells are detected in the mouse BM. Short-term human reconstitution potential is measured by sacrificing and analyzing mice 6 weeks after transplantation. Levels of human engraftment are reported as the mean  SD for mice grouped according to transplanted cell numbers and compared using a Student’s t-test. SCID repopulating cell (SRC) analysis is performed using the single-hit model and Poisson statistics at limiting dilution with 95% confidence intervals. Typically, data from three limiting dilution experiments are pooled and analyzed using L-Calc software (Stem Cell Technologies; free software download).

8. Concluding Remarks Disruption of CXCL12/CXCR4 signaling is a critical step in HSPC mobilization by G-CSF, plerixafor, and additional agents in development. We (Devine et al., 2008; Hess et al., 2007; Rettig et al., 2008) and others (Fruehauf et al., 2006; Jin et al., 2008; Pelus and Fukuda, 2008) have found intrinsic differences between HSPCs mobilized with plerixafor and G-CSF, including differences in cell surface markers, cell cycle, gene expression profiles, and NOD/SCID repopulating capacity. The optimum strategy for obtaining mobilized peripheral blood from donors is the subject of ongoing study.

ACKNOWLEDGMENT This work was supported by Genzyme Corporation.

REFERENCES Abraham, M., Biyder, K., Begin, M., Wald, H., Weiss, I. D., Galun, E., Nagler, A., and Peled, A. (2007). Enhanced unique pattern of hematopoietic cell mobilization induced by the CXCR4 antagonist 4F-benzoyl-TN14003. Stem Cells 25, 2158–2166. Adams, G. B., and Scadden, D. T. (2006). The hematopoietic stem cell in its place. Nat. Immunol. 7, 333–337. Balabanian, K., Lagane, B., Infantino, S., Chow, K. Y., Harriague, J., Moepps, B., Arenzana-Seisdedos, F., Thelen, M., and Bachelerie, F. (2005a). The chemokine SDF-1/CXCL12 binds to and signals through the orphan receptor RDC1 in T lymphocytes. J. Biol. Chem. 280, 35760–35766. Balabanian, K., Lagane, B., Pablos, J. L., Laurent, L., Planchenault, T., Verola, O., Lebbe, C., Kerob, D., Dupuy, A., Hermine, O., Nicolas, J. F., Latger-Cannard, V.,

CXCR4 and Mobilization

81

et al. (2005b). WHIM syndromes with different genetic anomalies are accounted for by impaired CXCR4 desensitization to CXCL12. Blood 105, 2449–2457. Balabanian, K., Levoye, A., Klemm, L., Lagane, B., Hermine, O., Harriague, J., Baleux, F., Arenzana-Seisdedos, F., and Bachelerie, F. (2008). Leukocyte analysis from WHIM syndrome patients reveals a pivotal role for GRK3 in CXCR4 signaling. J. Clin. Invest. 118, 1074–1084. Benboubker, L., Watier, H., Carion, A., Georget, M. T., Desbois, I., Colombat, P., Bardos, P., Binet, C., and Domenech, J. (2001). Association between the SDF1-30 A allele and high levels of CD34(þ) progenitor cells mobilized into peripheral blood in humans. Br. J. Haematol. 113, 247–250. Bensinger, W., Appelbaum, F., Rowley, S., Storb, R., Sanders, J., Lilleby, K., Gooley, T., Demirer, T., Schiffman, K., and Weaver, C. (1995). Factors that influence collection and engraftment of autologous peripheral-blood stem cells. J. Clin. Oncol. 13, 2547–2555. Bensinger, W., Dipersio, J. F., and McCarty, J. M. (2009). Improving stem cell mobilization strategies: Future directions. Bone Marrow Transplant. 43, 181–195. Bernhagen, J., Krohn, R., Lue, H., Gregory, J. L., Zernecke, A., Koenen, R. R., Dewor, M., Georgiev, I., Schober, A., Leng, L., Kooistra, T., Fingerle-Rowson, G., et al. (2007). MIF is a noncognate ligand of CXC chemokine receptors in inflammatory and atherogenic cell recruitment. Nat. Med. 13, 587–596. Bleul, C. C., Farzan, M., Choe, H., Parolin, C., Clark-Lewis, I., Sodroski, J., and Springer, T. A. (1996). The lymphocyte chemoattractant SDF-1 is a ligand for LESTR/fusin and blocks HIV-1 entry. Nature 382, 829–833. Blom, B., Ho, S., Antonenko, S., and Liu, Y. J. (2000). Generation of interferon alphaproducing predendritic cell (Pre-DC)2 from human CD34(þ) hematopoietic stem cells. J. Exp. Med. 192, 1785–1796. Blom, B., and Spits, H. (2006). Development of human lymphoid cells. Annu. Rev. Immunol. 24, 287–320. Boeve, S., Strupeck, J., Creech, S., and Stiff, P. J. (2004). Analysis of remobilization success in patients undergoing autologous stem cell transplants who fail an initial mobilization: Risk factors, cytokine use and cost. Bone Marrow Transplant. 33, 997–1003. Boldajipour, B., Mahabaleshwar, H., Kardash, E., Reichman-Fried, M., Blaser, H., Minina, S., Wilson, D., Xu, Q., and Raz, E. (2008). Control of chemokine-guided cell migration by ligand sequestration. Cell 132, 463–473. Brown, R. A., Adkins, D., Goodnough, L. T., Haug, J. S., Todd, G., Wehde, M., Hendricks, D., Ehlenbeck, C., Laub, L., and DiPersio, J. (1997). Factors that influence the collection and engraftment of allogeneic peripheral-blood stem cells in patients with hematologic malignancies. J. Clin. Oncol. 15, 3067–3074. Broxmeyer, H. E., Orschell, C. M., Clapp, D. W., Hangoc, G., Cooper, S., Plett, P. A., Liles, W. C., Li, X., Graham-Evans, B., Campbell, T. B., Calandra, G., Bridger, G., et al. (2005). Rapid mobilization of murine and human hematopoietic stem and progenitor cells with AMD3100, a CXCR4 antagonist. J. Exp. Med. 201, 1307–1318. Broxmeyer, H. E., Srour, E., Orschell, C., Ingram, D. A., Cooper, S., Plett, P. A., Mead, L. E., and Yoder, M. C. (2006). Cord blood stem and progenitor cells. Methods Enzymol. 419, 439–473. Bryder, D., Sasaki, Y., Borge, O. J., and Jacobsen, S. E. (2004). Deceptive multilineage reconstitution analysis of mice transplanted with hemopoietic stem cells, and implications for assessment of stem cell numbers and lineage potentials. J. Immunol. 172, 1548–1552. Burger, J. A., and Peled, A. (2009). CXCR4 antagonists: Targeting the microenvironment in leukemia and other cancers. Leukemia 23, 43–52. Burns, J. M., Summers, B. C., Wang, Y., Melikian, A., Berahovich, R., Miao, Z., Penfold, M. E., Sunshine, M. J., Littman, D. R., Kuo, C. J., Wei, K., McMaster, B. E., et al. (2006). A novel chemokine receptor for SDF-1 and I-TAC

82

Michael P. Rettig et al.

involved in cell survival, cell adhesion, and tumor development. J. Exp. Med. 203, 2201–2213. Busillo, J. M., and Benovic, J. L. (2007). Regulation of CXCR4 signaling. Biochim. Biophys. Acta 1768, 952–963. Calvi, L. M., Adams, G. B., Weibrecht, K. W., Weber, J. M., Olson, D. P., Knight, M. C., Martin, R. P., Schipani, E., Divieti, P., Bringhurst, F. R., Milner, L. A., Kronenberg, H. M., et al. (2003). Osteoblastic cells regulate the haematopoietic stem cell niche. Nature 425, 841–846. Cashman, J., Bockhold, K., Hogge, D. E., Eaves, A. C., and Eaves, C. J. (1997). Sustained proliferation, multi-lineage differentiation and maintenance of primitive human haemopoietic cells in NOD/SCID mice transplanted with human cord blood. Br. J. Haematol. 98, 1026–1036. Christopher, M. J., Liu, F., Hilton, M. J., Long, F., and Link, D. C. (2009). Suppression of CXCL12 production by bone marrow osteoblasts is a common and critical pathway for cytokine-induced mobilization. Blood doi: 10.1182/blood-2008-10-184754. Coulombel, L. (2004). Identification of hematopoietic stem/progenitor cells: strength and drawbacks of functional assays. Oncogene 23, 7210–7222. Dar, A., Goichberg, P., Shinder, V., Kalinkovich, A., Kollet, O., Netzer, N., Margalit, R., Zsak, M., Nagler, A., Hardan, I., Resnick, I., Rot, A., et al. (2005). Chemokine receptor CXCR4-dependent internalization and resecretion of functional chemokine SDF-1 by bone marrow endothelial and stromal cells. Nat. Immunol. 6, 1038–1046. de Haan, G., Ausema, A., Wilkens, M., Molineux, G., and Dontje, B. (2000). Efficient mobilization of haematopoietic progenitors after a single injection of pegylated recombinant human granulocyte colony-stimulating factor in mouse strains with distinct marrow-cell pool sizes. Br. J. Haematol. 110, 638–646. de Haan, G., Bystrykh, L. V., Weersing, E., Dontje, B., Geiger, H., Ivanova, N., Lemischka, I. R., Vellenga, E., and Van Zant, G. (2002). A genetic and genomic analysis identifies a cluster of genes associated with hematopoietic cell turnover. Blood 100, 2056–2062. Devine, S. M., Vij, R., Rettig, M., Todt, L., McGlauchlen, K., Fisher, N., Devine, H., Link, D. C., Calandra, G., Bridger, G., Westervelt, P., and Dipersio, J. F. (2008). Rapid mobilization of functional donor hematopoietic cells without G-CSF using AMD3100, an antagonist of the CXCR4/SDF-1 interaction. Blood 112, 990–998. Dlubek, D., Drabczak-Skrzypek, D., and Lange, A. (2006). Low CXCR4 membrane expression on CD34(þ) cells characterizes cells mobilized to blood. Bone Marrow Transplant. 37, 19–23. Eaves, C., Glimm, H., Eisterer, W., Audet, J., Maguer-Satta, V., and Piret, J. (2001). Characterization of human hematopoietic cells with short-lived in vivo repopulating activity. Ann. N. Y. Acad. Sci. 938, 63–70; discussion 70–71. Ema, H., Morita, Y., Yamazaki, S., Matsubara, A., Seita, J., Tadokoro, Y., Kondo, H., Takano, H., and Nakauchi, H. (2006). Adult mouse hematopoietic stem cells: Purification and single-cell assays. Nat. Protoc. 1, 2979–2987. Faber, A., Roderburg, C., Wein, F., Saffrich, R., Seckinger, A., Horsch, K., Diehlmann, A., Wong, D., Bridger, G., Eckstein, V., Ho, A. D., and Wagner, W. (2007). The many facets of SDF-1alpha, CXCR4 agonists and antagonists on hematopoietic progenitor cells. J. Biomed. Biotechnol. 2007, 260–265. Feng, Y., Broder, C. C., Kennedy, P. E., and Berger, E. A. (1996). HIV-1 entry cofactor: Functional cDNA cloning of a seven-transmembrane, G protein–coupled receptor. Science 272, 872–877. Forster, R., Kremmer, E., Schubel, A., Breitfeld, D., Kleinschmidt, A., Nerl, C., Bernhardt, G., and Lipp, M. (1998). Intracellular and surface expression of the HIV-1

CXCR4 and Mobilization

83

coreceptor CXCR4/fusin on various leukocyte subsets: Rapid internalization and recycling upon activation. J. Immunol. 160, 1522–1531. Fredriksson, R., Lagerstrom, M. C., Lundin, L. G., and Schioth, H. B. (2003). The G-protein-coupled receptors in the human genome form five main families. Phylogenetic analysis, paralogon groups, and fingerprints. Mol. Pharmacol. 63, 1256–1272. Freud, A. G., Becknell, B., Roychowdhury, S., Mao, H. C., Ferketich, A. K., Nuovo, G. J., Hughes, T. L., Marburger, T. B., Sung, J., Baiocchi, R. A., Guimond, M., and Caligiuri, M. A. (2005). A human CD34(þ) subset resides in lymph nodes and differentiates into CD56bright natural killer cells. Immunity 22, 295–304. Fruehauf, S., Seeger, T., Maier, P., Li, L., Weinhardt, S., Laufs, S., Wagner, W., Eckstein, V., Bridger, G., Calandra, G., Wenz, F., Zeller, W. J., et al. (2006). The CXCR4 antagonist AMD3100 releases a subset of G-CSF–primed peripheral blood progenitor cells with specific gene expression characteristics. Exp. Hematol. 34, 1052–1059. Fukuda, S., Bian, H., King, A. G., and Pelus, L. M. (2007). The chemokine GRObeta mobilizes early hematopoietic stem cells characterized by enhanced homing and engraftment. Blood 110, 860–869. Fukuda, S., and Pelus, L. M. (2008). Transmigration of human CD34þ cells. Methods Mol. Biol. 430, 55–75. Gandhi, M. K., Jestice, K., Scott, M. A., Bloxham, D., Bass, G., and Marcus, R. E. (1999). The minimum CD34 threshold depends on prior chemotherapy in autologous peripheral blood stem cell recipients. Bone Marrow Transplant. 23, 9–13. Gazitt, Y., Freytes, C. O., Callander, N., Tsai, T. W., Alsina, M., Anderson, J., Holle, L., Cruz, J., Devore, P., McGrath, M., West, G., Alvarez, R., et al. (1999). Successful PBSC mobilization with high-dose G-CSF for patients failing a first round of mobilization. J. Hematother. 8, 173–183. Giebel, B., and Punzel, M. (2008). Lineage development of hematopoietic stem and progenitor cells. Biol. Chem. 389, 813–824. Glimm, H., Eisterer, W., Lee, K., Cashman, J., Holyoake, T. L., Nicolini, F., Shultz, L. D., von Kalle, C., and Eaves, C. J. (2001). Previously undetected human hematopoietic cell populations with short-term repopulating activity selectively engraft NOD/SCID-beta2 microglobulin-null mice. J. Clin. Invest. 107, 199–206. Gorlin, R. J., Gelb, B., Diaz, G. A., Lofsness, K. G., Pittelkow, M. R., and Fenyk, J. R. Jr. (2000). WHIM syndrome, an autosomal dominant disorder: Clinical, hematological, and molecular studies. Am. J. Med. Genet. 91, 368–376. Grande, F., Garofalo, A., and Neamati, N. (2008). Small molecules anti-HIV therapeutics targeting CXCR4. Curr. Pharm. Des. 14, 385–404. Group, S. C. T. C. (2005). Allogeneic peripheral blood stem-cell compared with bone marrow transplantation in the management of hematologic malignancies: An individual patient data meta-analysis of nine randomized trials. J. Clin Oncol. 23, 5074–5087. Gulino, A. V. (2003). WHIM syndrome: A genetic disorder of leukocyte trafficking. Curr. Opin. Allergy Clin. Immunol. 3, 443–450. Gulino, A. V., Moratto, D., Sozzani, S., Cavadini, P., Otero, K., Tassone, L., Imberti, L., Pirovano, S., Notarangelo, L. D., Soresina, R., Mazzolari, E., Nelson, D. L., et al. (2004). Altered leukocyte response to CXCL12 in patients with warts hypogammaglobulinemia, infections, myelokathexis (WHIM) syndrome. Blood 104, 444–452. Haribabu, B., Richardson, R. M., Fisher, I., Sozzani, S., Peiper, S. C., Horuk, R., Ali, H., and Snyderman, R. (1997). Regulation of human chemokine receptors CXCR4. Role of phosphorylation in desensitization and internalization. J. Biol. Chem. 272, 28726–28731. Harrison, D. E. (1980). Competitive repopulation: A new assay for long-term stem cell functional capacity. Blood 55, 77–81.

84

Michael P. Rettig et al.

Harrison, D. E., Jordan, C. T., Zhong, R. K., and Astle, C. M. (1993). Primitive hemopoietic stem cells: Direct assay of most productive populations by competitive repopulation with simple binomial, correlation and covariance calculations. Exp. Hematol. 21, 206–219. Hartmann, T. N., Grabovsky, V., Pasvolsky, R., Shulman, Z., Buss, E. C., Spiegel, A., Nagler, A., Lapidot, T., Thelen, M., and Alon, R. (2008). A crosstalk between intracellular CXCR7 and CXCR4 involved in rapid CXCL12-triggered integrin activation but not in chemokine-triggered motility of human T lymphocytes and CD34þ cells. J. Leukoc. Biol. 84, 1130–1140. Hattori, K., Heissig, B., Tashiro, K., Honjo, T., Tateno, M., Shieh, J. H., Hackett, N. R., Quitoriano, M. S., Crystal, R. G., Rafii, S., and Moore, M. A. (2001). Plasma elevation of stromal cell-derived factor-1 induces mobilization of mature and immature hematopoietic progenitor and stem cells. Blood 97, 3354–3360. Hawley, R. G., Ramezani, A., and Hawley, T. S. (2006). Hematopoietic stem cells. Methods Enzymol. 419, 149–179. Henon, P. R., Liang, H., Beck-Wirth, G., Eisenmann, J. C., Lepers, M., Wunder, E., and Kandel, G. (1992). Comparison of hematopoietic and immune recovery after autologous bone marrow or blood stem cell transplants. Bone Marrow Transplant. 9, 285–291. Herbert, K. E., Levesque, J. P., Haylock, D. N., and Prince, H. M. (2008). The use of experimental murine models to assess novel agents of hematopoietic stem and progenitor cell mobilization. Biol. Blood Marrow Transplant. 14, 603–621. Hernandez, J. M., Castilla, C., Gutierrez, N. C., Isidro, I. M., Delgado, M., de las Rivas, J., Ferminan, E., Garcia, J. L., Ocio, E. M., del Canizo, M. C., and San Miguel, J. F. (2005). Mobilisation with G-CSF in healthy donors promotes a high but temporal deregulation of genes. Leukemia 19, 1088–1091. Hernandez, P. A., Gorlin, R. J., Lukens, J. N., Taniuchi, S., Bohinjec, J., Francois, F., Klotman, M. E., and Diaz, G. A. (2003). Mutations in the chemokine receptor gene CXCR4 are associated with WHIM syndrome, a combined immunodeficiency disease. Nat. Genet. 34, 70–74. Hess, D. A., Bonde, J., Craft, T. P., Wirthlin, L., Hohm, S., Lahey, R., Todt, L. M., Dipersio, J. F., Devine, S. M., and Nolta, J. A. (2007). Human progenitor cells rapidly mobilized by AMD3100 repopulate NOD/SCID mice with increased frequency in comparison to cells from the same donor mobilized by granulocyte colony stimulating factor. Biol. Blood Marrow Transplant. 13, 398–411. Hill, G. R., Morris, E. S., Fuery, M., Hutchins, C., Butler, J., Grigg, A., Roberts, A., Bradstock, K., Szer, J., Kennedy, G., Morton, J., and Durrant, S. (2006). Allogeneic stem cell transplantation with peripheral blood stem cells mobilized by pegylated G-CSF. Biol. Blood Marrow Transplant. 12, 603–607. Hubel, K., Liles, W. C., Broxmeyer, H. E., Rodger, E., Wood, B., Cooper, S., Hangoc, G., Macfarland, R., Bridger, G. J., Henson, G. W., Calandra, G., and Dale, D. C. (2004). Leukocytosis and mobilization of CD34þ hematopoietic progenitor cells by AMD3100, a CXCR4 antagonist. Support Cancer Ther. 1, 165–172. Imai, K., Kobayashi, M., Wang, J., Shinobu, N., Yoshida, H., Hamada, J., Shindo, M., Higashino, F., Tanaka, J., Asaka, M., and Hosokawa, M. (1999). Selective secretion of chemoattractants for haemopoietic progenitor cells by bone marrow endothelial cells: A possible role in homing of haemopoietic progenitor cells to bone marrow. Br. J. Haematol. 106, 905–911. Ito, M., Hiramatsu, H., Kobayashi, K., Suzue, K., Kawahata, M., Hioki, K., Ueyama, Y., Koyanagi, Y., Sugamura, K., Tsuji, K., Heike, T., and Nakahata, T. (2002). NOD/ SCID/gamma(c)(null) mouse: An excellent recipient mouse model for engraftment of human cells. Blood 100, 3175–3182.

CXCR4 and Mobilization

85

Iyer, C. V., Evans, R. J., Lou, Q., Lin, D., Wang, J., Kohn, W., Yan, L. Z., Pulley, S., and Peng, S. B. (2008). Rapid and recurrent neutrophil mobilization regulated by T134, a CXCR4 peptide antagonist. Exp. Hematol. 36, 1098–1109. Jin, P., Wang, E., Ren, J., Childs, R., Shin, J. W., Khuu, H., Marincola, F. M., and Stroncek, D. F. (2008). Differentiation of two types of mobilized peripheral blood stem cells by microRNA and cDNA expression analysis. J. Translational Med. 6, 39. Jung, Y., Wang, J., Schneider, A., Sun, Y. X., Koh-Paige, A. J., Osman, N. I., McCauley, L. K., and Taichman, R. S. (2006). Regulation of SDF-1 (CXCL12) production by osteoblasts; a possible mechanism for stem cell homing. Bone 38, 497–508. Katayama, Y., Battista, M., Kao, W. M., Hidalgo, A., Peired, A. J., Thomas, S. A., and Frenette, P. S. (2006). Signals from the sympathetic nervous system regulate hematopoietic stem cell egress from bone marrow. Cell 124, 407–421. Kawai, T., Choi, U., Cardwell, L., DeRavin, S. S., Naumann, N., WhitingTheobald, N. L., Linton, G. F., Moon, J., Murphy, P. M., and Malech, H. L. (2007). WHIM syndrome myelokathexis reproduced in the NOD/SCID mouse xenotransplant model engrafted with healthy human stem cells transduced with C-terminus–truncated CXCR4. Blood 109, 78–84. Kawai, T., Choi, U., Whiting-Theobald, N. L., Linton, G. F., Brenner, S., Sechler, J. M., Murphy, P. M., and Malech, H. L. (2005). Enhanced function with decreased internalization of carboxy-terminus truncated CXCR4 responsible for WHIM syndrome. Exp. Hematol. 33, 460–468. Khan, A., Greenman, J., and Archibald, S. J. (2007). Small molecule CXCR4 chemokine receptor antagonists: Developing drug candidates. Curr. Med. Chem. 14, 2257–2277. Kiel, M. J., and Morrison, S. J. (2008). Uncertainty in the niches that maintain haematopoietic stem cells. Nat. Rev. Immunol. 8, 290–301. Kiel, M. J., Yilmaz, O. H., Iwashita, T., Terhorst, C., and Morrison, S. J. (2005). SLAM family receptors distinguish hematopoietic stem and progenitor cells and reveal endothelial niches for stem cells. Cell 121, 1109–1121. Kiger, A. A., White-Cooper, H., and Fuller, M. T. (2000). Somatic support cells restrict germline stem cell self-renewal and promote differentiation. Nature 407, 750–754. Kobbe, G., Sohngen, D., Bauser, U., Schneider, P., Germing, U., Thiele, K. P., Rieth, C., Hunerliturkoglu, A., Fischer, J., Frick, M., Wernet, P., Aul, C., et al. (1999). Factors influencing G-CSF–mediated mobilization of hematopoietic progenitor cells during steady-state hematopoiesis in patients with malignant lymphoma and multiple myeloma. Ann. Hematol. 78, 456–462. Kollet, O., Dar, A., and Lapidot, T. (2007). The multiple roles of osteoclasts in host defense: Bone remodeling and hematopoietic stem cell mobilization. Annu. Rev. Immunol. 25, 51–69. Kollet, O., Peled, A., Byk, T., Ben-Hur, H., Greiner, D., Shultz, L., and Lapidot, T. (2000). beta2 microglobulin-deficient (B2m(null)) NOD/SCID mice are excellent recipients for studying human stem cell function. Blood 95, 3102–3105. Kollet, O., Spiegel, A., Peled, A., Petit, I., Byk, T., Hershkoviz, R., Guetta, E., Barkai, G., Nagler, A., and Lapidot, T. (2001). Rapid and efficient homing of human CD34(þ) CD38(-/low)CXCR4(þ) stem and progenitor cells to the bone marrow and spleen of NOD/SCID and NOD/SCID/B2m(null) mice. Blood 97, 3283–3291. Kroschinsky, F., Holig, K., and Ehninger, G. (2008). The role of pegfilgrastim in mobilization of hematopoietic stem cells. Transfus. Apheresis Sci. 38, 237–244. Kroschinsky, F., Holig, K., Poppe-Thiede, K., Zimmer, K., Ordemann, R., Blechschmidt, M., Oelschlaegel, U., Bornhauser, M., Rall, G., Rutt, C., and Ehninger, G. (2005). Single-dose pegfilgrastim for the mobilization of allogeneic CD34þ peripheral blood progenitor cells in healthy family and unrelated donors. Haematologica 90, 1665–1671.

86

Michael P. Rettig et al.

Kucia, M., Jankowski, K., Reca, R., Wysoczynski, M., Bandura, L., Allendorf, D. J., Zhang, J., Ratajczak, J., and Ratajczak, M. Z. (2004). CXCR4-SDF-1 signalling, locomotion, chemotaxis and adhesion. J. Mol. Histol. 35, 233–245. Lane, T. A., Law, P., Maruyama, M., Young, D., Burgess, J., Mullen, M., Mealiffe, M., Terstappen, L. W., Hardwick, A., and Moubayed, M. (1995). Harvesting and enrichment of hematopoietic progenitor cells mobilized into the peripheral blood of normal donors by granulocyte-macrophage colony-stimulating factor (GM-CSF) or G-CSF: Potential role in allogeneic marrow transplantation. Blood 85, 275–282. Lapidot, T., Dar, A., and Kollet, O. (2005). How do stem cells find their way home? Blood 106, 1901–1910. Larochelle, A., Vormoor, J., Hanenberg, H., Wang, J. C., Bhatia, M., Lapidot, T., Moritz, T., Murdoch, B., Xiao, X. L., Kato, I., Williams, D. A., and Dick, J. E. (1996). Identification of primitive human hematopoietic cells capable of repopulating NOD/SCID mouse bone marrow: Implications for gene therapy. Nat. Med. 2, 1329–1337. Lemieux, M. E., Rebel, V. I., Lansdorp, P. M., and Eaves, C. J. (1995). Characterization and purification of a primitive hematopoietic cell type in adult mouse marrow capable of lymphomyeloid differentiation in long-term marrow ‘‘switch’’ cultures. Blood 86, 1339–1347. Levesque, J. P., Hendy, J., Takamatsu, Y., Simmons, P. J., and Bendall, L. J. (2003). Disruption of the CXCR4/CXCL12 chemotactic interaction during hematopoietic stem cell mobilization induced by GCSF or cyclophosphamide. J. Clin. Invest. 111, 187–196. Liles, W. C., Broxmeyer, H. E., Rodger, E., Wood, B., Hubel, K., Cooper, S., Hangoc, G., Bridger, G. J., Henson, G. W., Calandra, G., and Dale, D. C. (2003). Mobilization of hematopoietic progenitor cells in healthy volunteers by AMD3100, a CXCR4 antagonist. Blood 102, 2728–2730. Lin, K. K., and Goodell, M. A. (2006). Purification of hematopoietic stem cells using the side population. Methods Enzymol. 420, 255–264. Loetscher, M., Geiser, T., O’Reilly, T., Zwahlen, R., Baggiolini, M., and Moser, B. (1994). Cloning of a human seven-transmembrane domain receptor, LESTR, that is highly expressed in leukocytes. J. Biol. Chem. 269, 232–237. Ma, Q., Jones, D., Borghesani, P. R., Segal, R. A., Nagasawa, T., Kishimoto, T., Bronson, R. T., and Springer, T. A. (1998). Impaired B-lymphopoiesis, myelopoiesis, and derailed cerebellar neuron migration in CXCR4- and SDF-1–deficient mice. Proc. Natl. Acad. Sci. USA 95, 9448–9453. Ma, Q., Jones, D., and Springer, T. A. (1999). The chemokine receptor CXCR4 is required for the retention of B lineage and granulocytic precursors within the bone marrow microenvironment. Immunity 10, 463–471. Marchese, A., Paing, M. M., Temple, B. R., and Trejo, J. (2008). G protein–coupled receptor sorting to endosomes and lysosomes. Annu. Rev. Pharmacol. Toxicol. 48, 601–629. McKenzie, J. L., Gan, O. I., Doedens, M., and Dick, J. E. (2005). Human short-term repopulating stem cells are efficiently detected following intrafemoral transplantation into NOD/SCID recipients depleted of CD122þ cells. Blood 106, 1259–1261. Miller, C. L., Dykstra, B., and Eaves, C. J. (2008). Characterization of mouse hematopoietic stem and progenitor cells. Curr. Protoc. Immunol. 22, Unit 22B 2. Molineux, G., Pojda, Z., and Dexter, T. M. (1990). A comparison of hematopoiesis in normal and splenectomized mice treated with granulocyte colony-stimulating factor. Blood 75, 563–569. Montgomery, M., and Cottler-Fox, M. (2007). Mobilization and collection of autologous hematopoietic progenitor/stem cells. Clin. Adv. Hematol. Oncol. 5, 127–136.

CXCR4 and Mobilization

87

MOZOBIL (2008). Plerixafor Injection. (Package insert) Genzyme Corporation. Nagasawa, T., Hirota, S., Tachibana, K., Takakura, N., Nishikawa, S., Kitamura, Y., Yoshida, N., Kikutani, H., and Kishimoto, T. (1996). Defects of B-cell lymphopoiesis and bone-marrow myelopoiesis in mice lacking the CXC chemokine PBSF/SDF-1. Nature 382, 635–638. Nagler, A., Korenstein-Ilan, A., Amiel, A., and Avivi, L. (2004). Granulocyte colonystimulating factor generates epigenetic and genetic alterations in lymphocytes of normal volunteer donors of stem cells. Exp. Hematol. 32, 122–130. Nervi, B., Link, D. C., and DiPersio, J. F. (2006). Cytokines and hematopoietic stem cell mobilization. J. Cell Biochem. 99, 690–705. Nervi, B., Ramirez, P., Rettig, M. P., Uy, G. L., Holt, M. S., Ritchey, J. K., Prior, J. L., Piwnica-Worms, D., Bridger, G., Ley, T. J., and Dipersio, J. F. (2009). Chemosensitization of AML following mobilization by the CXCR4 antagonist AMD3100. Blood doi: 10.1182/blood-2008-06-162123. Neupogen (1991–2006). Filgrastim. (Package insert) Amgen Inc., Thousand Oaks, CA. Oberlin, E., Amara, A., Bachelerie, F., Bessia, C., Virelizier, J. L., Arenzana-Seisdedos, F., Schwartz, O., Heard, J. M., Clark-Lewis, I., Legler, D. F., Loetscher, M., Baggiolini, M., et al. (1996). The CXC chemokine SDF-1 is the ligand for LESTR/fusin and prevents infection by T-cell-line–adapted HIV-1. Nature 382, 833–835. Oelschlaegel, U., Bornhauser, M., Boxberger, S., Kroschinsky, F., Illmer, T., Hoelig, K., Calandra, G., Ehninger, G., and Platzbecker, U. (2007). Kinetics of CXCR-4 and adhesion molecule expression during autologous stem cell mobilisation with G-CSF plus AMD3100 in patients with multiple myeloma. Ann. Hematol. 86, 569–573. Orsini, M. J., Parent, J. L., Mundell, S. J., Marchese, A., and Benovic, J. L. (1999). Trafficking of the HIV coreceptor CXCR4. Role of arrestins and identification of residues in the C-terminal tail that mediate receptor internalization. J. Biol. Chem. 274, 31076–31086. Papayannopoulou, T., and Scadden, D. T. (2008). Stem-cell ecology and stem cells in motion. Blood 111, 3923–3930. Peled, A., Petit, I., Kollet, O., Magid, M., Ponomaryov, T., Byk, T., Nagler, A., Ben-Hur, H., Many, A., Shultz, L., Lider, O., Alon, R., et al. (1999). Dependence of human stem cell engraftment and repopulation of NOD/SCID mice on CXCR4. Science 283, 845–848. Pelus, L. M. (2008). Peripheral blood stem cell mobilization: New regimens, new cells, where do we stand. Curr. Opin. Hematol. 15, 285–292. Pelus, L. M., Bian, H., Fukuda, S., Wong, D., Merzouk, A., and Salari, H. (2005). The CXCR4 agonist peptide, CTCE-0021, rapidly mobilizes polymorphonuclear neutrophils and hematopoietic progenitor cells into peripheral blood and synergizes with granulocyte colony-stimulating factor. Exp. Hematol. 33, 295–307. Pelus, L. M., and Fukuda, S. (2008). Chemokine-mobilized adult stem cells: Defining a better hematopoietic graft. Leukemia 22, 466–473. Pflumio, F., Izac, B., Katz, A., Shultz, L. D., Vainchenker, W., and Coulombel, L. (1996). Phenotype and function of human hematopoietic cells engrafting immune-deficient CB17-severe combined immunodeficiency mice and nonobese diabetic–severe combined immunodeficiency mice after transplantation of human cord blood mononuclear cells. Blood 88, 3731–3740. Ponomaryov, T., Peled, A., Petit, I., Taichman, R. S., Habler, L., Sandbank, J., ArenzanaSeisdedos, F., Magerus, A., Caruz, A., Fujii, N., Nagler, A., Lahav, M., et al. (2000). Induction of the chemokine stromal-derived factor-1 following DNA damage improves human stem cell function. J. Clin. Invest. 106, 1331–1339. Purton, L. E., and Scadden, D. T. (2007). Limiting factors in murine hematopoietic stem cell assays. Cell Stem Cell 1, 263–270.

88

Michael P. Rettig et al.

Pusic, I., Jiang, S. Y., Landua, S., Uy, G. L., Rettig, M. P., Cashen, A. F., Westervelt, P., Vij, R., Abboud, C. N., Stockerl-Goldstein, K. E., Sempek, D. S., Smith, A. L., et al. (2008). Impact of mobilization and remobilization strategies on achieving sufficient stem cell yields for autologous transplantation. Biol. Blood Marrow Transplant. 14, 1045–1056. Ramirez, P. A., Rettig, M., Holt, M., Ritchey, J. K., and DiPersio, J. F. (2008). Rapid mobilization of long term repopulating hematopoietic stem cells (HSC) with AMD15057, a small molecule inhibitor of VLA4; synergism with AMD3100 and G-CSF. Blood 112, 229:615a. Rettig, M. P., Shannon, W. D., Ritchey, J., Holt, M., McFarland, K., Lopez, S., Gabriel, J., and DiPersio, J. F. (2008). Characterization of human CD34þ hematopoietic stem cells following administration of G-CSF or plerixafor. Blood 112, 1192:3476a. Roberts, A. W., Foote, S., Alexander, W. S., Scott, C., Robb, L., and Metcalf, D. (1997). Genetic influences determining progenitor cell mobilization and leukocytosis induced by granulocyte colony-stimulating factor. Blood 89, 2736–2744. Robinson, S. N., and van Os, R. P. (2008). Mobilization of hematopoietic stem and progenitor cells in mice. Methods Mol. Biol. 430, 31–53. Schmitz, N., Linch, D. C., Dreger, P., Goldstone, A. H., Boogaerts, M. A., Ferrant, A., Demuynck, H. M., Link, H., Zander, A., and Barge, A. (1996). Randomised trial of filgrastim-mobilised peripheral blood progenitor cell transplantation versus autologous bone-marrow transplantation in lymphoma patients. Lancet 347, 353–357. Semerad, C. L., Christopher, M. J., Liu, F., Short, B., Simmons, P. J., Winkler, I., Levesque, J. P., Chappel, J., Ross, F. P., and Link, D. C. (2005). G-CSF potently inhibits osteoblast activity and CXCL12 mRNA expression in the bone marrow. Blood 106, 3020–3027. Shalekoff, S., and Tiemessen, C. T. (2001). Duration of sample storage dramatically alters expression of the human immunodeficiency virus coreceptors CXCR4 and CCR5. Clin. Diagn. Lab. Immunol. 8, 432–436. Shapira, M. Y., Kaspler, P., Samuel, S., Shoshan, S., and Or, R. (2003). Granulocyte colony stimulating factor does not induce long-term DNA instability in healthy peripheral blood stem cell donors. Am. J. Hematol. 73, 33–36. Shen, H., Cheng, T., Olszak, I., Garcia-Zepeda, E., Lu, Z., Herrmann, S., Fallon, R., Luster, A. D., and Scadden, D. T. (2001). CXCR-4 desensitization is associated with tissue localization of hemopoietic progenitor cells. J. Immunol. 166, 5027–5033. Sheridan, W. P., Begley, C. G., To, L. B., Grigg, A., Szer, J., Maher, D., Green, M. D., Rowlings, P. A., McGrath, K. M., and Cebon, J. (1994). Phase II study of autologous filgrastim (G-CSF)-mobilized peripheral blood progenitor cells to restore hemopoiesis after high-dose chemotherapy for lymphoid malignancies. Bone Marrow Transplant. 14, 105–111. Shultz, L. D., Lyons, B. L., Burzenski, L. M., Gott, B., Chen, X., Chaleff, S., Kotb, M., Gillies, S. D., King, M., Mangada, J., Greiner, D. L., and Handgretinger, R. (2005). Human lymphoid and myeloid cell development in NOD/LtSz-scid IL2R gamma null mice engrafted with mobilized human hemopoietic stem cells. J. Immunol. 174, 6477–6489. Sierro, F., Biben, C., Martinez-Munoz, L., Mellado, M., Ransohoff, R. M., Li, M., Woehl, B., Leung, H., Groom, J., Batten, M., Harvey, R. P., Martinez, A. C., et al. (2007). Disrupted cardiac development but normal hematopoiesis in mice deficient in the second CXCL12/SDF-1 receptor, CXCR7. Proc. Natl. Acad. Sci. USA 104, 14759–14764. Signoret, N., Oldridge, J., Pelchen-Matthews, A., Klasse, P. J., Tran, T., Brass, L. F., Rosenkilde, M. M., Schwartz, T. W., Holmes, W., Dallas, W., Luther, M. A., Wells, T. N., et al. (1997). Phorbol esters and SDF-1 induce rapid endocytosis and down modulation of the chemokine receptor CXCR4. J. Cell Biol. 139, 651–664.

CXCR4 and Mobilization

89

Signoret, N., Rosenkilde, M. M., Klasse, P. J., Schwartz, T. W., Malim, M. H., Hoxie, J. A., and Marsh, M. (1998). Differential regulation of CXCR4 and CCR5 endocytosis. J. Cell Sci. 111(Pt 18), 2819–2830. Sugiyama, T., Kohara, H., Noda, M., and Nagasawa, T. (2006). Maintenance of the hematopoietic stem cell pool by CXCL12-CXCR4 chemokine signaling in bone marrow stromal cell niches. Immunity 25, 977–988. Sutherland, H. J., Eaves, C. J., Eaves, A. C., Dragowska, W., and Lansdorp, P. M. (1989). Characterization and partial purification of human marrow cells capable of initiating long-term hematopoiesis in vitro. Blood 74, 1563–1570. Sutherland, H. J., Eaves, C. J., Lansdorp, P. M., Thacker, J. D., and Hogge, D. E. (1991). Differential regulation of primitive human hematopoietic cells in long-term cultures maintained on genetically engineered murine stromal cells. Blood 78, 666–672. Sweeney, E. A., Lortat-Jacob, H., Priestley, G. V., Nakamoto, B., and Papayannopoulou, T. (2002). Sulfated polysaccharides increase plasma levels of SDF-1 in monkeys and mice: Involvement in mobilization of stem/progenitor cells. Blood 99, 44–51. Szilvassy, S. J., Humphries, R. K., Lansdorp, P. M., Eaves, A. C., and Eaves, C. J. (1990). Quantitative assay for totipotent reconstituting hematopoietic stem cells by a competitive repopulation strategy. Proc. Natl. Acad. Sci. USA 87, 8736–8740. Szilvassy, S. J., Lansdorp, P. M., Humphries, R. K., Eaves, A. C., and Eaves, C. J. (1989). Isolation in a single step of a highly enriched murine hematopoietic stem cell population with competitive long-term repopulating ability. Blood 74, 930–939. Tachibana, K., Hirota, S., Iizasa, H., Yoshida, H., Kawabata, K., Kataoka, Y., Kitamura, Y., Matsushima, K., Yoshida, N., Nishikawa, S., Kishimoto, T., and Nagasawa, T. (1998). The chemokine receptor CXCR4 is essential for vascularization of the gastrointestinal tract. Nature 393, 591–594. Taswell, C. (1981). Limiting dilution assays for the determination of immunocompetent cell frequencies. I. Data analysis. J. Immunol. 126, 1614–1619. Tigue, C. C., McKoy, J. M., Evens, A. M., Trifilio, S. M., Tallman, M. S., and Bennett, C. L. (2007). Granulocyte-colony stimulating factor administration to healthy individuals and persons with chronic neutropenia or cancer: An overview of safety considerations from the Research on Adverse Drug Events and Reports project. Bone Marrow Transplant. 40, 185–192. Tricot, G., Jagannath, S., Vesole, D., Nelson, J., Tindle, S., Miller, L., Cheson, B., Crowley, J., and Barlogie, B. (1995). Peripheral blood stem cell transplants for multiple myeloma: Identification of favorable variables for rapid engraftment in 225 patients. Blood 85, 588–96. Uy, G. L., Rettig, M. P., and Cashen, A. F. (2008). Plerixafor, a CXCR4 antagonist for the mobilization of hematopoietic stem cells. Expert Opin. Biol. Ther. 8, 1797–804. van Os, R. P., Dethmers-Ausema, B., and de Haan, G. (2008). In vitro assays for cobblestone area-forming cells, LTC-IC, and CFU-C. Methods Mol. Biol. 430, 143–57. Voermans, C., Kooi, M. L., Rodenhuis, S., van der Lelie, H., van der Schoot, C. E., and Gerritsen, W. R. (2001). In vitro migratory capacity of CD34þ cells is related to hematopoietic recovery after autologous stem cell transplantation. Blood 97, 799–804. Wang, S., Nademanee, A., Qian, D., Dagis, A., Park, H. S., Fridey, J., Smith, E., Snyder, D., Somlo, G., Stein, A., Rosenthal, J., Falk, P., et al. (2007). Peripheral blood hematopoietic stem cell mobilization and collection efficacy is not an independent prognostic factor for autologous stem cell transplantation. Transfusion 47, 2207–2216. Watt, S. M., and Forde, S. P. (2008). The central role of the chemokine receptor, CXCR4, in haemopoietic stem cell transplantation: Will CXCR4 antagonists contribute to the treatment of blood disorders? Vox Sang 94, 18–32. Weaver, C. H., Hazelton, B., Birch, R., Palmer, P., Allen, C., Schwartzberg, L., and West, W. (1995). An analysis of engraftment kinetics as a function of the CD34 content

90

Michael P. Rettig et al.

of peripheral blood progenitor cell collections in 692 patients after the administration of myeloablative chemotherapy. Blood 86, 3961–3969. Weissman, I. L., and Shizuru, J. A. (2008). The origins of the identification and isolation of hematopoietic stem cells, and their capability to induce donor-specific transplantation tolerance and treat autoimmune diseases. Blood 112, 3543–3553. Wilson, A., and Trumpp, A. (2006). Bone-marrow haematopoietic-stem-cell niches. Nat. Rev. Immunol. 6, 93–106. Winkler, I. G., and Levesque, J. P. (2006). Mechanisms of hematopoietic stem cell mobilization: When innate immunity assails the cells that make blood and bone. Exp. Hematol. 34, 996–1009. Xie, T., and Spradling, A. C. (2000). A niche maintaining germ line stem cells in the Drosophila ovary. Science 290, 328–330. Yang, O. O., Swanberg, S. L., Lu, Z., Dziejman, M., McCoy, J., Luster, A. D., Walker, B. D., and Herrmann, S. H. (1999). Enhanced inhibition of human immunodeficiency virus type 1 by Met-stromal-derived factor 1beta correlates with downmodulation of CXCR4. J. Virol. 73, 4582–4589. Yuan, R., Astle, C. M., Chen, J., and Harrison, D. E. (2005). Genetic regulation of hematopoietic stem cell exhaustion during development and growth. Exp. Hematol. 33, 243–250. Zamboni, W. C. (2003). Pharmacokinetics of pegfilgrastim. Pharmacotherapy 23, 9S–14S. Zeller, W., Gutensohn, K., Stockschlader, M., Dierlamm, J., Kroger, N., Koehne, G., Hummel, K., Kabisch, H., Weh, H. J., Kuhnl, P., Hossfeld, D. K., and Zander, A. R. (1996). Increase of mobilized CD34-positive peripheral blood progenitor cells in patients with Hodgkin’s disease, non-Hodgkin’s lymphoma, and cancer of the testis. Bone Marrow Transplant. 17, 709–713. Zhang, Y., Foudi, A., Geay, J. F., Berthebaud, M., Buet, D., Jarrier, P., Jalil, A., Vainchenker, W., and Louache, F. (2004). Intracellular localization and constitutive endocytosis of CXCR4 in human CD34þ hematopoietic progenitor cells. Stem Cells 22, 1015–1029. Zhong, R., Law, P., Wong, D., Merzouk, A., Salari, H., and Ball, E. D. (2004). Small peptide analogs to stromal derived factor-1 enhance chemotactic migration of human and mouse hematopoietic cells. Exp. Hematol. 32, 470–475. Zou, Y. R., Kottmann, A. H., Kuroda, M., Taniuchi, I., and Littman, D. R. (1998). Function of the chemokine receptor CXCR4 in haematopoiesis and in cerebellar development. Nature 393, 595–599.

C H A P T E R

F O U R

Double-Label Nonradioactive In Situ Hybridization for the Analysis of Chemokine Receptor Expression in the Central Nervous System Meizhang Li and Richard M. Ransohoff Contents 92 93 93 94 94 95 95 96 97 98 98 99 101 102

1. Introduction 2. Basic Protocol for ISH (Using Digoxygenin-Labeled Probe) 2.1. Equipment and reagent 2.2. Tissue preparation 2.3. Total RNA purification 2.4. First-strand cDNA synthesis 2.5. cDNA clones of chemokine receptors 2.6. Generation of ISH probe by in vitro transcription 2.7. Hybridization 2.8. Posthybridization washing 2.9. Development of ISH signals 2.10. Controls 3. Comments References

Abstract Chemokines are a family of mainly-secreted proteins, traditionally associated with regulation of leukocyte trafficking during host defense and pathological immune/inflammatory reactions. All chemokines signal to G protein-coupled receptors. Recent studies show that chemokines and their receptors are also expressed by neuroepithelial cells, and govern developmental, physiological and pathological processes through actions towards these cells, as well as infiltrating and resident hematopoietic cells. Understanding chemokine action at the tissue level therefore requires defining which cells express chemokine receptors. At a first level of approximation (and lacking appropriate

Neuroinflammation Research Center, Department of Neurosciences, Lerner Research Institute, Cleveland Clinic, Cleveland, Ohio, USA Methods in Enzymology, Volume 460 ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)05204-5

#

2009 Elsevier Inc. All rights reserved.

91

92

Meizhang Li and Richard M. Ransohoff

immunohistochemical reagents) this determination can be made by in situ hybridization (ISH), which localizes mRNA expression for chemokines and their receptors at the cellular level. Here we provide a protocol for ISH and demonstrate its application for localizing mRNA encoding two chemokine receptors, CXCR4 and CXCR7 in murine CNS tissues.

1. Introduction In the central nervous system (CNS), chemokines and chemokine receptors are constitutively or inducibly expressed in neurons (Belmadani et al., 2005; Hermann et al., 2008; Khan et al., 2008; Lu et al., 2002), astrocytes (Carter et al., 2007; van Heteren et al., 2008; Zheng et al., 2008), microglia (Biber et al., 2002; Cardona et al., 2006; Huang et al., 2005), and oligodendrocyte lineage cells (Dziembowska et al., 2005; Kadi et al., 2006; PadovaniClaudio et al., 2006). In this regard, chemokines represent an inherent system that helps establish and maintain CNS homeostasis (Li and Ransohoff, 2008). The healthy CNS is an immune activity–free site, which peripheral leukocytes do not enter freely due to the unique structure of the blood–brain barrier (BBB) (Ransohoff et al., 2003). Furthermore, dendritic cells (DCs) as the key antigen-presenting cells in both adaptive immunity and autoimmunity, are absent from the healthy CNS (Pashenkov and Teleshova, 2003). Thus, aberrant invasion of peripheral leukocytes into the CNS is a cardinal feature of neuroinflammation-mediated human brain disorders. Multiple sclerosis (MS) is a neuroinflammation-mediated demyelinating disease. Previous studies demonstrated expression of chemokines and chemokine receptors in CNS lesions in MS tissue sections (Srensen et al., 2002; Trebst et al., 2003; Mahad et al., 2004; Kivisa¨kk, et al., 2004). In a mouse model of inflammation-mediated demyelination, experimental autoimmune encephalomyelitis (EAE), expression of chemokines was reproducibly and specifically increased (Ransohoff et al., 1997). Detailed analyses further supported the hypothesis that chemokines regulated the recruitment of peripheral leukocytes into the CNS (Huang et al., 2000; Lu et al., 2002; Mahad et al., 2003) during neuroinflammation. In addition, chemokines potentially mediate local cellular pathogenesis in the lesion sites of EAE (Carlson et al., 2008; Sunnemark et al., 2005). Unfortunately, very few chemokine receptor antibodies are suitable for application in immunohistochemical evaluation of murine CNS tissues. Falsepositive results are more the rule than the exception. To further explore the roles of chemokine receptors in mouse models of CNS diseases, we applied double-label nonradioactive in situ hybridization (double ISH) to evaluate the expression of chemokine receptors in various cell types (Fig. 4.1). ISH also provides a useful method to establish the cellular sources of chemokine receptor expression (Ransohoff et al., 1997).

93

Double-Label Nonradioactive In Situ Hybridization

A

B

C

D

E

F

F F⬘

Figure 4.1 Detection of CXCR4 and CXCR7 mRNA expression in healthy ventral spinal cord by double-fluorescent ISH. Double-fluorescent ISH was performed with digoxygenin-labeled antisense CXCR4 probe (red, developed with Texas red) and CXCR7 (green, developed with tyramide-fluorescein). Colocalization of CXCR4 and CXCR7 in a neuron was indicated by arrows. (A) CXCR7; (B) CXCR4; (C) DAPI; (D) CXCR7 and CXCR4; (E) CXCR7, CXCR4, and DAPI. An area was shown by both low power (F) and high power (F0 ). Scale bars: 0.4 cm ¼ 25 mm.

2. Basic Protocol for ISH (Using DigoxygeninLabeled Probe) 2.1. Equipment and reagent 1. 2. 3. 4.

Moist chamber Hybridization oven TRIzol Reagent (Invitrogen, Carlsbad, CA) Hybri-Well Press-Seal hybridization chamber (Sigma, St.Louis, MO)

94

Meizhang Li and Richard M. Ransohoff

5. SuperScript III First-strand synthesis system for reverse transcription polymerase chain reaction (Invitrogen, Carlsbad, CA) 6. TOPO TA cloning kit (Invitrogen, Carlsbad, CA) 7. TSA Fluorescein system (PerkinElmer, Massachusetts, MA) 8. DIG RNA labeling mix (Roche, Indianapolis, IN) 9. Biotin RNA labeling mix (Roche, Indianapolis, IN) 10. Fluorescein RNA labeling mix (Roche, Indianapolis, IN) 11. Superfrost Plus microscope slides (Fisher, Pittsburgh, PA) Solutions are prepared with autoclaved 1% (v/v) diethyl pyrocarbonate water (DEPC-water). All glassware is washed in DEPC water and baked at 125 to 150 overnight.

2.2. Tissue preparation 1. All tissue preparation is done with gloves to avoid RNase contamination. To purify high-quality total RNA, fresh tissues are needed. 2. Paraffin-embedded tissues: Tissues are dissected from experimental animals and fixed in 10% (w/v) formalin (Fisher, Pittsburgh, PA) for at least 5 days at room temperature (RT). Paraffin-embedded tissues are prepared by a histology service (housed either in a clinical pathology department or research department core facility). Sections are collected on Superfrost Plus microscope slides at a thickness between 5 to 30 mm. One slide from each block is stained with hematoxylin and eosin (H&E) for histology correlation. Slides can be kept in histology box at RT for quite a long time. Sections need to be deparaffinization before hybridization. Briefly, slides are baked at 65 for 15 min until the paraffin is melted and immediately immersed in staining trays through two changes of fresh xylene (10 min for each) with gentle mixing. For rehydration, slides are passed twice through 100, 95, and 75% ethanol, respectively, and rinsed once in 1 PBS. 3. Paraformaldehyde (PFA) fixed tissues: Animals are sacrificed and perfused with 4% (w/v) PFA. Brains and spinal cords are removed from animals and fixed in 4% PFA at 4 overnight, following treatment with 15 to 30% (w/v) sucrose for 1 to 3 days at 4 . Tissues are embedded in Tissue-Tek O.C.T. Compound (Sakura). Next, 15 to 30 mm tissue sections are collected on the Superfrost Plus microscope slides by cryosectioning. Slides are dried at RT and baked at 50 for 30 min before hybridization. 4. Frozen tissues: Fresh tissues are directly frozen on dry ice and sectioned by cryosectioning.

2.3. Total RNA purification Homogenize 50 mg of tissue in 1 ml of TRIzol Reagent by using a 1-ml tip and leave at RT for 5 to 10 min. Add 0.2 ml of chloroform and vortex. Centrifuge the sample at 12,000 rpm for 15 min. Transfer the supernatant

Double-Label Nonradioactive In Situ Hybridization

95

carefully in a clean 1.5 ml-Eppendorf tube. Precipitate the total RNA by adding 0.5 ml of isopropanol and centrifuge the sample at 12,000 rpm for 15 min. Wash the total RNA pellet once with 75% ethanol. Spin the sample at 12,000 rpm for 15 min and completely remove the residual ethanol. Use 100 ml RNase-free water to dissolve the total RNA. Remove 2 ml sample for OD260/280 measurement. The OD260/280 for purity RNA should be between 1.99 and 2.1. Alternatively, check the total RNA quality on a 1.2% (w/v) agarose gel, using ethidium bromide staining and UV light to visualize ribosomal RNA bands.

2.4. First-strand cDNA synthesis Use SuperScript III first-strand synthesis system (Invitrogen) and follow the protocol provided by the manufacturer to synthesize the first-strand cDNA. Briefly, prepare 10 ml of mix (including 1 ml 50 mM oligo (dT)20, 1 ml 10 mM dNTP, and 1 mg total RNA in 8 ml RNase-free water). Incubate 10 ml mix at 65 for 5 min and place on ice for at least 1 min. Prepare another 10 ml of reaction buffer according the following recipe: 10  RT buffer, 2 ml 25 mM MgCl2, 4 ml 0.1 M DTT, 2 ml RNase inhibitor (40 U/ml), 1 ml SuperScript III RT (200 U/ml), 1 ml Add this reaction buffer to the 10-ml mix and incubate at 50 for 50 min. Stop the reaction at 85 for 5 min and chill on ice. Finally, add 1 ml of RNaseH and incubate the reaction at 37 for 20 min.

2.5. cDNA clones of chemokine receptors 1. Design specific PCR primers for chemokines or chemokine receptors. 2. Use 0.5 ml first-strand DNA as PCR template to amplify the expression fragments of chemokines or chemokine receptors in a 25-ml PCR reaction described in the following:       

Water, 18.85 ml 10  PCR buffer, 2.5 ml 10 nM dNTP, 0.4 ml 20 nM forward primer, 0.50 ml 20 nM reverse primer, 0.50 ml 50 mM MgCl2, 0.75 ml DNA polymerase (1 U/ml), 0.5 ml

Run the PCR reactions in a thermal cycler by denaturing at 95 for 1 min; anneal at 58 , 1 min; and extend at 72 , 1.5 min, for a total 30 cycles.

96

Meizhang Li and Richard M. Ransohoff

3. After PCR, remove 5 ml PCR product to run a 1.2% agarose gel and check the PCR amplification. 4. Set up a TOPO cloning reaction by following the standard protocol provided by the manufacturer. Briefly, prepare 6 ml of reaction mix (1.0 ml fresh PCR product, 3 ml salt solution, 3 ml water, 1 ml TOPO vector), and incubate the reaction at RT for 5 min. 5. Mix 2 ml TOPO cloning reaction with competent Escherichia coli cells and mix gently. 6. Incubate the competent cells on ice for 30 min and heat-shock for 30 s at 42 . 7. Add 250 ml S.O.C. medium (recipe for 1000 ml of S.O.C. medium is described in the following) and shake the competent cells at 37 for 1 h. Bacto-tryptone (Becton, Dickinson and Company, USA), 20 g Bacto-yeast extract (Becton, Dickinson and Company, USA), 5 g NaCl, 0.5 g 1 M KCl, 2.5 ml Add water, 1000 ml Note: Adjust pH to 7.0 with 10 M NaOH, autoclave to sterilize, and add 20 ml of sterile 1 M glucose immediately before use. 8. Spread 10 to 100 ml cells on 100 mg/ml ampicillin agar plates, and incubate plates at 37 overnight. 9. Randomly pick 10 colonies to culture the bacteria and prepare plasmid DNAs. Verify the cDNA plasmid clones by restriction enzyme (RE) analysis or sequencing.

2.6. Generation of ISH probe by in vitro transcription 1. Digest 10 mg plasmid DNA with an appropriate RE at 37 for 1 h. Check the plasmid DNA digestion in 1.2% agarose gel. Note: Set up two digestion reactions in 1.5-ml Eppendorf tubes. One is for antisense labeling and another for sense-control labeling. 2. Precipitate linearized DNA by adding one-ninth volume of 3 M NaOAc, pH 4.8, and two volumes of 100% ethanol. 3. Spin down at 4 for 15 min. Wash the pellet once with 70% ethanol. 4. Resuspend the pellet in 50 ml RNase-free water. 5. Prepare a 50 ml IVT reaction described as follows: 10  reaction buffer, 5 ml 0.1 M DTT, 5 ml Digoxygenin-UTP mix, 2.5 ml RNAsin, 10 units RNA polymerase (T3, T7, or Sp6), 90units Linearized plasmid DNAs, 1 to 2.5 mg RNase-free water, up to 50 ml

97

Double-Label Nonradioactive In Situ Hybridization

Incubate the IVT reaction at 37 for 1 to 2 h. After that, remove 5 ml IVT reaction to check the labeling in a 1.2% agarose gel. Note: Fluorescein-12-UTP or Biotin-16-UTP mix can be used for double labeling. 6. Stop the IVT reaction by adding 50 ml of stop buffer. 7. Precipitate probe rRNA with one-ninth volume of 3 M NaOAc, pH 4.8, and two volumes of 100% ethanol at –80 for at least 30 min. 8. Centrifuge at 12,000 rpm at 4 for 15 min and discard the supernatant. 9. Wash the pellet with 80% ethanol, centrifuge at 4 for 10 min, and discard the supernatant. 10. Dry the pellet at RT for 5 min and suspend the pellet in 50 to 100 ml of RNase-free water.

2.7. Hybridization 1. Fix the slides in 4% PFA at RT for 30 min. 2. Wash the slides twice (5 min each time) with DEPC-1 PBS at RT. 3. Treat the slides with 50 mg/ml proteinase K (Sigma) in PK buffer (see following recipe for 50 ml) at RT for 10 to 15 min. Stock solution

Volume added

1 M Tris-HCl, pH 7.5 2.5 ml 0.5 M EDTA 0.5 ml DEPC water 47 ml 4. 5. 6. 7.

Final concentration

50 mM Tris-HCl, pH7.5 5 mM EDTA –

Rinse the slides once with DEPC-1 PBS at RT. Fix the slides in 4% PFA at RT for 30 min. Wash the slides twice (5 min each time) with DEPC-1 PBS at RT. Prepare 50 ml of prehybridization buffer as indicated in the following, and prehybridize the slides at 60 for 3 4 h. Stock concentration

Volume added

Final concentration

Formamide 20 SSC 50 mg/ml yeast tRNA (Sigma) 100 mg/ml heparin 100 Denhardt’s solution 10% Tween 20 (Sigma) 10% CHAPS (Sigma) 0.5 M EDTA DEPC water

25 ml 12.5 ml 0.3 ml 50 ml 0.5 ml 0.5 ml 0.5 ml 0.5 ml 10.2 ml

50% 5 SSC 0.3 mg/ml 100 mg/ml 1 Denhardt’s solution 0.1% 0.1% 5 mM –

98

Meizhang Li and Richard M. Ransohoff

8. Cover the slides by hybridization chambers and add 100 ml prehybridization buffer with 1 to 2 mg/ml probe rRNA into the chambers. Slides are kept in a moist chamber and further hybridized at 60 for overnight.

2.8. Posthybridization washing Note: After hybridization, using RNase-free buffers is not necessary. 1. Discard the hybridization chambers and wash the slides in 1 SSC at 60 for 10 min. 2. Wash the slides twice in 2 SSC at 37 for 30 min each, followed by a wash with 1.5 SSC at 60 for 10 min. 3. Treat tissue sections with 0.1 mg/ml RNase A (Sigma) in 2 SSC at 37 for 30 min. 4. Wash the slides in 2 SSC at RT for 10 min. 5. Wash the slides twice in 0.2 SSC at 60 for 30 min each. 6. Wash the slides once in 0.2 SSC at RT for 15 min. 7. Wash the slides three times in PBT buffer, 0.1% (v/v) Triton X-100 (Sigma) in 1 PBS, at RT for 15 min each. 8. Block the tissue sections in 20% (v/v) heat-inactivated sheep serum in PBT buffer for 4 h at RT.

2.9. Development of ISH signals 1. Incubate the slides with goat antidigoxygenin antibody conjugated with AP (alkaline phosphatase) diluted 1:2000 in 20% heat-inactivated sheep serum in PBT buffer at 4 overnight. 2. Wash the slides three times in PBT at RT for 30 min each. 3. Wash the slides twice with alkaline phosphatase buffer (AP) (recipe for 500 ml follows) at RT for 5 min each. Stock concentration Volume added

Final concentration

1 M Tris, pH 9.5 1 M MgCl2 5 M NaCl 20% Tween-20

50 ml 25 ml 10 ml 2.5 ml

Water

412.5 ml

100 mM Tris, pH 9.5 50 mM MgCl2 100 mM NaCl 0.1% Tween-20 5 mM Levamisole –

4. Prepare 50 ml of AP buffer with 50 ml NBT (BioRad) and 175 ml BCIP (BioRad).

Double-Label Nonradioactive In Situ Hybridization

99

Note: 80 mg/ml stock NBT (nitro blue tetrazolium chloride) is prepared in 70% (v/v) dimethyl formamide (Sigma); 60 mg/ml stock BCIP (5-bromo-4-chloro-3-indolyl phosphate, toluidine salt) is prepared in 100% dimethyl formamide. 5. Develop the ISH signals for 2 to 10 h at RT in the dark. 6. Wash the slides twice with 1 PBS at RT for 10 min each. 7. Fix the slides at RT for 15 min and mount the slides in 50% glycerol with 1 PBS.

2.10. Controls It is essential to generate control hybridizations for each ISH experiment to enable data interpretation. Such controls must address both technical and biological variability. Positive controls using housekeeping genes such as beta-actin or GAPDH are employed to verify the presence of hybridizable mRNA that is detectable by ISH. Sense probes or sections from gene knockout mice or control mice (in disease model experiments) are useful to exclude unspecific signals. Initial screening of all slides is performed by an observer blinded to genetics, treatment, or illness status of the animal from which the specimen was derived; probe identity; and probe polarity. 2.10.1. Special ISH protocols Double ISH 1. Follow the basic protocol (described above) to label two different ISH probes. For example, one is labeled with digoxygenin and another is labeled with fluorescein. 2. Prepare the hybridization buffer with both probes (1 to 2 mg/ml) and hybridize at 60 overnight. 3. Follow the basic protocol (described above) to wash the slides and block with 20% heat-inactivated sheep serum in PBT buffer at 4 overnight. 4. Incubate the slides with sheep anti–digoxygenin-AP at 4 for overnight. 5. Wash the slides three times in PBT buffer at RT for 30 min each. 6. Wash the slides twice in AP buffer at RT for 5 min each. 7. Develop the slides with NBT/BCIP until the desired signal is observed. Note: A sense control probe is helpful to confirm the right hybridization signals. For most chemokine receptors, a cell type–dependent signal pattern is desired. 8. Wash the slides three times in 1 PBS at RT for 5 min each. 9. Inactivate the AP in TE (100 mM Tris-HCl, pH 7.5, 50 mM EDTA) at 85 for 10 min. 10. Wash the slides three times in 1 PBS at RT for 5 min each. 11. Wash the slides once in PBT at RT for 10 min each.

100

Meizhang Li and Richard M. Ransohoff

12. Block the slides with 20% heat-inactivated sheep serum in PBT at RT for 1 h. 13. Incubate the slides with goat anti–fluorescein-AP antibody diluted 1:3000 in 20% heat-inactivated sheep serum in PBT at 4 overnight. 14. Wash the slides three times in PBT at RT for 30 min each. 15. Wash the slides twice in AP buffer at RT for 5 min each. 16. Develop the second ISH signal with 50 ml INT (BioRad) and 175 ml BCIP at RT for 3 to 4 h. Note: 40 mg/ml INT (2-[4-iodophenyl]-3-[4-nitrophenyl]-5-phenyltetrazolium chloride) is prepared in 70% (v/v) dimethyl formamide. To obtain good double ISH signals, the weaker probe should be developed first. 17. Fix the slides at RT for 15 min and mount in 50% glycerol with 1 PBS. Fluorescent double ISH

1. Follow the double ISH protocol (described above) to hybridize the slides with two different probes that are labeled by either digoxygenin or fluorescein. 2. After hybridization, wash the slides by following the basic ISH protocol (described above). 3. Incubate the slides with sheep anti-digoxygenin-AP at 4 overnight. 4. Wash the slides three times in PBT buffer at RT for 30 min each. 5. Wash the slides three times in AP buffer (pH 7.6) at RT for 5 min each. 6. Dissolve one Fast Red tablet (Roche) in 2 ml of AP buffer (pH7.6) and filter the solution through a 0.45-mm filter (Millipore, Cork, Ireland). 7. Incubate the slides with Fast Red solution in dark for 3 to 4 h until the desired signal is obtained. Note: The single antisense ISH developed by NBT/BCIP (positive control) and sense ISH (negative control) developed by Fast Red are helpful in evaluating the specific signal. 8. Wash the slides three times in PBT buffer at RT for 30 min each. 9. Block the slides with 20% heat-inactivated sheep serum in PBT at RT for 1 h. 10. Incubate the slides with sheep anti-fluorescein-POD (peroxidase) (Roche) 1:5000 in PBT at 4 overnight. 11. Wash the slides three times in PBT buffer at RT for 30 min each. 12. Dilute tyramide-fluorescein (1:50) in the amplification buffer supplied in the TSA Fluorescein system. 13. Incubate the slides with diluted tyramide-fluorescein at RT for 10 to 15 min.

Double-Label Nonradioactive In Situ Hybridization

101

14. Wash the slides three times in PBT buffer at RT for 5 min each. 15. Wash the slides three times in 1 PBS at RT for 5 min each. 16. Mount the slides in VECTASHIELD mount medium with or without DAPI (Vector Laboratory, Burlingame, CA). ISH and immunohistochemistry (IHC)

1. Follow the basic protocol (described above) to complete the nonfluorescent ISH first. 2. Fix the slides in 4% PFA at RT for 30 min. 3. Wash the slides three times in PBT at RT for 5 min each. 4. Incubate the slides in 3% H2O2 (hydrogen peroxide) at RT for 30 min to inactivate the AP. 5. Wash the slides three times in PBT at RT for 5 min each. 6. Block the slides with 10% heat-inactivated goat serum at RT for 30 min. 7. Incubate the primary antibody at 4 for overnight. 8. Wash the slides three times in PBT at RT for 5 min each. 9. Incubate the secondary antibody conjugated with biotin at RT for 1 h. 10. Wash the slides three times in PBT at RT for 5 min each. 11. Wash the slides three times in 1 PBS at RT for 5 min each. 12. Incubate the slides in ABC complex solution at RT for 1 h. ABC complex is made using the ABC Elite Kit (Vector Laboratory). Make the solution at least 30 min before use. 13. Wash the slides three times in 1 PBS at RT for 5 min each. 14. Incubate the slides in DAB (Sigma) solution with 0.01% H2O2 for 5 to 10 min. To make DAB (3, 30 -diaminobenzidine) solution, two DAB tablets are dissolved into 30 ml of 1 PBS supplemented with 10 ml H2O2. 15. Wash the slides three times in 1 PBS at RT for 5 min each. 16. Fix the slides for 15 min at RT and mount slides in 50% glycerol in 1 PBS.

3. Comments Given their wide-ranging biology in the CNS, chemokine receptors have been extensively investigated. The critical issue of the cellular source(s) of chemokine receptors in the CNS cannot, in most cases, be addressed by the direct IHC approach. The remaining options are ISH, use of transgenic mice with reporter genes expressed from chemokine receptor promoters, or flow cytometry using CNS tissue lysates.

102

Meizhang Li and Richard M. Ransohoff

REFERENCES Belmadani, A., Tran, P. B., Ren, D., Assimacopoulos, S., Grove, E. A., and Miller, R. J. (2005). The chemokine stromal cell-derived factor-1 regulates the migration of sensory neuron progenitors. J. Neurosci. 25, 3995–4003. Biber, K., Dijkstra, I., Trebst, D., De Groot, C. J., Ransohoff, R. M., and Boddeke, H. W. (2002). Functional expression of CXCR3 in cultured mouse and human astrocytes and microglia. Neuroscience 112, 487–497. Cardona, A. E., Pioro, E. P., Sasse, M. E., Kostenko, V., Cardona, S. M., Dijkstra, I. M., Huang, D., Kidd, G., Dombrowski, S., Dutta, R., Lee, J. C., Cook, D. N., et al. (2006). Control of microglial neurotoxicity by the fractalkine receptor. Nat. Neurosci. 9, 917–924. Carlson, T., Kroenke, M., Rao, P., Lane, T. E., and Segal, B. (2008). The Th17-ELRþ CXC chemokine pathway is essential for the development of central nervous system autoimmune disease. J. Exp. Med. 205, 811–823. Carter, S. L., Mu¨ller, M., Manders, P. M., and Campbell, I. L. (2007). Induction of the genes for Cxcl9 and Cxcl10 is dependent on IFN-gamma but shows differential cellular expression in experimental autoimmune encephalomyelitis and by astrocytes and microglia in vitro. Glia 55, 1728–1739. Dziembowska, M., Tham, T. N., Lau, P., Vitry, S., Lazarini, F., and Dubois-Dalcq, M. (2005). A role for CXCR4 signaling in survival and migration of neural and oligodendrocyte precursors. Glia 50, 258–269. Hermann, G. E., Van Meter, M. J., and Rogers, R. C. (2008). CXCR4 receptors in the dorsal medulla: Implications for autonomic dysfunction. Eur. J. Neurosci. 27, 855–864. Huang, D., Han, Y., Rani, R. M., Glabinski, A., Trebst, C., Srensen, T., Tani, M., Wang, J., Chien, P., O’Bryan, S., Bielecki, B., Zhou, Z. L., et al. (2000). Chemokines and chemokine receptors in inflammation of the nervous system: Manifold roles and exquisite regulation. Immunol. Rev. 177, 52–67. Huang, D., Wujek, J., Kidd, G., He, T. T., Cardona, A., Sasse, M. E., Stein, E. J., Kish, J., Tani, M., Charo, I. F., Proudfoot, A. E., Rollins, B. J., et al. (2005). Chronic expression of monocyte chemoattractant protein-1 in the central nervous system causes delayed encephalopathy and impaired microglial function in mice. FASEB J. 19, 761–772. Kadi, L., Selvaraju, R., de Lys, P., Proudfoot, A. E., Wells, T. N., and Boschert, U. (2006). Differential effects of chemokines on oligodendrocyte precursor proliferation and myelin formation in vitro. J. Neuroimmunol. 174, 133–146. Khan, M. Z., Brandimarti, R., Shimizu, S., Nicolai, J., Crowe, E., and Meucci, O. (2008). The chemokine CXCL12 promotes survival of postmitotic neurons by regulating Rb protein. Cell Death Differ. 15, 1663–1672. Kivisa¨kk, P., Mahad, D. J., Callahan, M. K., Sikora, K., Trebst, C., Tucky, B., Wujek, J., Ravid, R., Staugaitis, S. M., Lassmann, H., and Ransohoff, R. M. (2004). Expression of CCR7 in multiple sclerosis: Implications for CNS immunity. Ann. Neurol. 55, 627–638. Li, M., and Ransohoff, R. M. (2008). Multiple roles of chemokine CXCL12 in the central nervous system: A migration from immunology to neurobiology. Prog. Neurobiol. 84, 116–131. Lu, M., Grove, E. A., and Miller, R. J. (2002). Abnormal development of the hippocampal dentate gyrus in mice lacking the CXCR4 chemokine receptor. Proc. Natl. Acad. Sci. USA 99, 7090–7095. Mahad, D. J., and Ransohoff, R. M. (2003). The role of MCP-1 (CCL2) and CCR2 in multiple sclerosis and experimental autoimmune encephalomyelitis (EAE). Semin. Immunol. 15, 23–32.

Double-Label Nonradioactive In Situ Hybridization

103

Mahad, D. J., Trebst, C., Kivisa¨kk, P., Staugaitis, S. M., Tucky, B., Wei, T., Lucchinetti, C. F., Lassmann, H., and Ransohoff, R. M. (2004). Expression of chemokine receptors CCR1 and CCR5 reflects differential activation of mononuclear phagocytes in pattern II and pattern III multiple sclerosis lesions. J. Neuropathol. Exp. Neurol. 63, 262–273. Padovani-Claudio, D. A., Liu, L., Ransohoff, R. M., and Miller, R. H. (2006). Alterations in the oligodendrocyte lineage, myelin, and white matter in adult mice lacking the chemokine receptor CXCR2. Glia 54, 471–483. Pashenkov, M., and Teleshova, N. (2003). Inflammation in the central nervous system: The role for dendritic cells. Brain Pathol. 13, 23–33. Ransohoff, R. M., Kivisa¨kk, P., and Kidd, G. (2003). Three or more routes for leukocyte migration into the central nervous system. Nat. Rev. Immunol. 3, 569–581. Ransohoff, R. M., Tani, M., Glabinski, A. R., Chernosky, A., Krivacic, K., Peterson, J. W., Chien, H. F., and Trapp, B. D. (1997). Chemokines and chemokine receptors in model neurological pathologies: Molecular and immunocytochemical approaches. Methods Enzymol. 287, 319–348. Srensen, T. L., Trebst, C., Kivisa¨kk, P., Klaege, K. L., Majmudar, A., Ravid, R., Lassmann, H., Olsen, D. B., Strieter, R. M., Ransohoff, R. M., and Sellebjerg, F. (2002). Multiple sclerosis: A study of CXCL10 and CXCR3 co-localization in the inflamed central nervous system. J. Neuroimmunol. 127, 59–68. Sunnemark, D., Eltayeb, S., Nilsson, M., Wallstro¨m, E., Lassmann, H., Olsson, T., Berg, A. L., and Ericsson-Dahlstrand, A. (2005). CX3CL1 (fractalkine) and CX3CR1 expression in myelin oligodendrocyte glycoprotein-induced experimental autoimmune encephalomyelitis: kinetics and cellular origin. J. Neuroinflammation 2, 17. Trebst, C., Staugaitis, S. M., Kivisa¨kk, P., Mahad, D., Cathcart, M. E., Tucky, B., Wei, T., Rani, M. R., Horuk, R., Aldape, K. D., Pardo, C. A., Lucchinetti, C. F., et al. (2003). CC chemokine receptor 8 in the central nervous system is associated with phagocytic macrophages. Am. J. Pathol. 162, 427–438. van Heteren, J. T., Rozenberg, F., Aronica, E., Troost, D., Lebon, P., and Kuijpers, T. W. (2008). Astrocytes produce interferon-alpha and CXCL10, but not IL-6 or CXCL8, in Aicardi-Goutie`res syndrome. Glia 56, 568–578. Zheng, J. C., Huang, Y., Tang, K., Cui, M., Niemann, D., Lopez, A., Morgello, S., and Chen, S. (2008). HIV-1-infected and/or immune-activated macrophages regulate astrocyte CXCL8 production through IL-1beta and TNF-alpha: Involvement of mitogen-activated protein kinases and protein kinase R. J. Neuroimmunol. 200, 100–110.

C H A P T E R

F I V E

Expression of Chemokines and Chemokine Receptors in Human Colon Cancer Marco Erreni,* Paolo Bianchi,† Luigi Laghi,† Massimiliano Mirolo,§ Marco Fabbri,* Massimo Locati,‡ Alberto Mantovani,‡ and Paola Allavena* Contents 1. Introduction 2. Materials and Methods 2.1. Cell culture and tissue collection and processing 2.2. TaqMan Low Density Array 2.3. Quantitative real-time RT-PCR (Q-PCR) 2.4. Enzyme-linked immunosorbent assay 2.5. Statistical analysis 3. Results 3.1. TaqMan Low Density Array analysis of eight colon cancer samples 3.2. CCL3, CCL4, and CXCL8 expression in colon cancer 3.3. Regulation of CXCL8 expression in colon cancer cell lines 3.4. CXCL8 correlation with OPN and SPARC 4. Discussion Acknowledgments References

106 108 108 108 109 110 110 110 110 112 115 116 117 119 119

Abstract Human colorectal cancer (CRC), the second largest cause of tumor-related death in Western countries, represents a paradigm for the now well-established connections between inflammation and cancer. In this study, we investigated

* { {

}

Department of Immunology and Inflammation, IRCCS Istituto Clinico Humanitas, Rozzano (Milan), Italy Laboratory of Molecular Gastroenterology, IRCCS Istituto Clinico Humanitas, Rozzano (Milan), Italy Department of Translational Medicine, University of Milan, IRCCS Istituto Clinico Humanitas, Via Manzoni, Rozzano (Milano), Italia Laboratory of Leukocyte Biology, Department of Translational Medicine, University of Milan, IRCCS Istituto Clinico Humanitas, Italy

Methods in Enzymology, Volume 460 ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)05205-7

#

2009 Elsevier Inc. All rights reserved.

105

106

Marco Erreni et al.

which inflammatory mediators are mostly expressed in the microenvironment of human CRC. The RNA profile of a large panel of inflammatory genes, in particular chemokines and chemokine receptors, was analyzed in eight surgical tumor samples and in paired normal tissues from CRC patients. We employed an ‘‘inflammatory gene card’’ (TaqMan Low Density Array by Applied Biosystem), designed by our group, containing probes for 24 chemokines and 17 chemokine receptors. Several chemokines were strongly upregulated in the tumor microenvironment, most frequently CCL4 and CCL5, chemotactic for monocytes/ macrophages and T cells, and the corresponding receptors CCR1 and CCR5; the angiogenic chemokines CXCL1 and CXCL8, and the receptor CXCR2. The antiangiogenic chemokines CXCL9 and CXCL10 were also expressed, but in the absence of the receptor CXCR3. Selected results have been confirmed in a larger number of samples. The levels of mRNA CXCL8 were significantly associated with the levels of osteopontin, a matrix-associated protein that shares with chemokines important functions such as induction of cell migration and survival, and modulation of the neoangiogenesis. Overall these results could be helpful to identify the most relevant inflammatory pathways present in CRC tumors and to build a solid rationale for future therapeutic interventions based on anti-inflammatory strategies.

1. Introduction Links between cancer and inflammation were first suggested in the 19th century on the basis of observations that tumors often arise at sites of chronic inflammation and that inflammatory cells are present in the biopsied samples from tumors (Mantovani et al., 2001). Epidemiological studies have shown that chronic inflammation predisposes individuals to various types of cancer, including microbial infections, autoimmune diseases, and inflammatory conditions of unknown origin. The hallmarks of cancer-related inflammation include the presence in tumor tissues of inflammatory cells and soluble mediators such as chemokines, cytokines and prostaglandins, tissue remodeling, and angiogenesis (Coussens and Werb, 2002; Karin, 2006; Mantovani, 2005; Mantovani et al., 2008). Chemokines are chemotactic cytokines that cause the direct migration of leukocytes and are induced by inflammatory cytokines, growth factors, and pathogenic stimuli. Many human cancers have a complex chemokine network that regulates the extent and phenotype of the infiltrating leukocytes, as well as have an effect on tumor growth, survival, migration, and angiogenesis (Balkwill, 2004). The pattern of chemokine-receptor and ligand expression in a tissue is generally correlated with the numbers and types of infiltrating cells that are present in the tumor microenvironment (Balkwill, 2004; Karin and Greten, 2005; Rossi and Zlotnik, 2000). The influence of the immune response in the behavior of neoplasia has been extensively investigated. There is little doubt that adaptive immune

Chemokines and Receptors in Human Colon Cancer

107

cells, especially cytotoxic CD8þ T-cell effectors, have the potential to limit tumor progression (Dunn et al., 2004). The protective function of CD8þ T cells has been demonstrated in patients with melanoma, ovarian, and colorectal cancer (CRC) (Coukos et al., 2005; Taylor et al., 2007). Recently, Galon and colleagues (Galon et al., 2006; Pages et al., 2005) demonstrated that the presence of a strong immune-cell infiltrate is associated with the absence of early metastatic processes, which include vascular emboli, lymphatic invasion, and perineural invasion, demonstrating a beneficial effect of the host’s immune response. On the other hand, the persistence of active innate immune responses (i.e., chronic inflammation) at tumor sites has been more frequently associated with poor clinical outcome (Balkwill, 2004; Coussens and Werb, 2002; Dunn et al., 2004; Karin, 2006; Mantovani, 2005; Mantovani et al., 2001, 2008). The links between inflammation and cancer promotion are especially strong in human colorectal carcinoma (CRC), the second largest cause of cancer-related death in Western countries. Patients with inflammatory bowel disease, both ulcerative colitis and Crohn’s disease, are at increased risk of developing colorectal cancer. Even precancerous tissues show signs of inflammation. Accordingly, treatment with nonsteroidal anti-inflammatory agents decreases the incidence of colon cancer, and the mortality that results from it (Bertagnolli, 2003). The contribution of macrophages to CRC development is quite controversial. Bailey et al. (2007) demonstrated that the increase of macrophages number in all areas within the tumor correlated with advanced tumor stage. In contrast, Forssell et al. (2007) showed that in CRC, macrophages are localized principally at the tumor front and positively influenced prognosis. These contrasting results may be explained by the ‘‘macrophages balance hypothesis,’’ proposed by our group, to convey the idea that macrophages may inhibit or stimulate tumor growth according to their functional polarization and state of activation (Mantovani et al., 2002, 2004; Pollard, 2004). While M1-polarized macrophages, activated by IFNg and bacterial products such as LPS, usually have tumoricidal activity, M2 macrophages, differentiated in the presence of Th2 cytokines (IL-4, IL-13) or IL-10, most frequently are not cytotoxic, favor tumor cell proliferation and the angiogenic switch, and lead to tumor progression and invasion (Mantovani et al., 2008). In this context, it is clear that inflammatory mediators, such as chemokines, cytokines, and growth factors play a pivotal role in the recruitment of the inflammatory infiltrate and in the buildup of the tumor microenvironment. In this study, we investigated the expression of chemokines and chemokine-receptors in surgical samples of human CRC. We analyzed the mRNA profile using a customized TaqMan Low Density Array (Lu et al., 2008). The results show a strong upregulation of chemokines and chemokine-receptors, indicating the pivotal role of these inflammatory mediators in the growth and progression of CRC.

108

Marco Erreni et al.

2. Materials and Methods 2.1. Cell culture and tissue collection and processing Thirty colon cancer samples and corresponding normal tissues were obtained via surgical resection from the Department of Gastroenterology, Istituto Clinico Humanitas IRCCS, Rozzano, Milan. The samples were immediately treated with RNAlater (Ambion) for 24 h at 4 , and subsequently dried and stored at –80 . All patients consented to the study. CRC cell lines HCT116, HT29, and SW620 were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (Lonza, BioWhittaker), 2 mM Ultraglutamine1 (Lonza, BioWhittaker), and 100 U/ml penicillin/streptavidin (Lonza, BioWhittaker) at 37 in 5% CO2. Total RNA was isolated both from tissue specimens and cell lines using TRI Reagent (Ambion). Total RNA was quantified by Nanodrop Spectrophotometer ND-1000 and its quality was examined by 1.5% agarose gel electrophoresis. 2mg of total RNA were reverse-transcribed using the High-Capacity cDNA Archive kit (Applied Biosystems) according to the manufacturer’s instructions.

2.2. TaqMan Low Density Array Eight colon cancer samples and their corresponding normal tissues were used for low-density array (LDA) analysis. The LDA contains eight sampleloading lines, each connected by microchannel to 48 miniature reaction chambers for a total of 384 wells per card. Gene-specific exon-spanning primers and TaqMan probes were factory-designed and embedded in each well. We chose 96 genes from Applied Biosystems Assays-on-DemandTM Gene Expression Products: five housekeeping genes (HPRT, 18S, GAPDH, B2M, ACTB) and 91 inflammation-related genes. The LDA in this study was configured into four identical 96-gene sets (two samples in duplicate). A total of 100 ml of reaction mixture with 100 ng of cDNA template and 50 ml 2  of TaqMan Universal PCR Master Mix (Applied Biosystems) was added to each line of LDA after vortex and brief centrifugation. Each reaction cell contained 1 ml of reaction mixture with 1 ng of mRNA. LDA were sealed with a TaqMan LDA sealer (Applied Biosystems) before centrifugation. The PCR amplification was performed in the microfluidic card sample block of an ABI PrismÒ 7900HT Fast Real-Time PCR System (Applied Biosystems). The amplification protocol was used as follows: 2 min at 50 to activate uracil-DNA glycosylase (Forssell et al. 2007), 10 min at 94.5 (activation), 40 cycles of denaturation at 97 for 30 s, and annealing and extension at 59.7 for 1 min. The relative amount of each target gene

Chemokines and Receptors in Human Colon Cancer

109

mRNA to the mean of the five housekeeping genes (HPRT, 18S, GAPDH, B2M, and ACTB) was calculated as 2–DCt, where DCt ¼ Ct – Ctmean of housekeeping genes. The fold-change of each target gene mRNA to the corresponding normal tissue was calculated as 2–DDCt, where DDCt ¼ DCttarget gene in tumor tissue – DCttarget gene in normal tissue. The threshold cycle Ct was automatically given by the SDS2.2 software package (Applied Biosystems).

2.3. Quantitative real-time RT-PCR (Q-PCR) Several genes were further analyzed via the SYBR Green-based Q-PCR assay in an additional 30 colon cancer samples and corresponding normal tissue. 18S was used as an internal control to normalize samples. All genespecific exon-spanning primers were domestically designed. The sequences are indicated in the following: 18S: Forward: 50 CGC CGC TAG AGG TGA AAT TC 30 Reverse: 50 CTT TCG CTC TGG TCC GTC TT 30 CCL3: Forward: 50 TGC AAC CAG TTC TCT GCA TC 30 Reverse: 50 AAT CTG CCG GGA GGT GTA 30 CCL4: Forward: 50 TTA CTA TGA GAC CAG CAG CCT CT 30 Reverse: 50 CAG CAC AGA CTT GCT TGC TT 30 OPN: Forward: 50 CGC AGA CCT GAC ATC CAG T 30 Reverse: 50 GGC TGT CCC AAT CAG AAG G 30 SPARC: Forward: 50 GTG CAG AGG AAA CCG AAG AG 30 Reverse: 50 TGT TTG CAG TGG TGG TTC TG 30 CXCL8: Forward: 50 CTG CGC CAA CAC AGA AAT TA 30 Reverse: 50 TTG AAG AGG GCT GAG AAT TCA 30 Each PCR reaction of 25 ml consisted of a 4-ml aliquot of each cDNA (40 ng mRNA for target genes and 1 ng mRNA for 18S gene), 0.2 mM forward and reverse primers and 12.5 ml of Power SYBR Green PCR Master Mix (Applied Biosystem). The Q-PCR program follows: 2 min at 50 , 10 min at 95 , 40 cycles of 15 s at 95 , and 1 min for 60 . The melting curve analysis was carried out at 95 for 15 s, 60 for 15 s, and 95 for 15 s. Each sample was amplified in triplicate in 96-well PCR microplates on an ABI PrismÒ 7900HT Fast Real-Time PCR System (Applied Biosystems). Data analysis followed the same protocol as that in LDA.

110

Marco Erreni et al.

2.4. Enzyme-linked immunosorbent assay CXCL8 levels in cell-line supernatants were measured using human IL-8 DuoSet ELISA Development System (R&D Systems). Cells were cultured in six-well plates at a concentration of 500,000 cells/well and treated with TNFa (10 ng/ml) alone or in combination with TGFb (2 ng/ml) at 37 in 5% CO2. After 24 h, supernatants were collected, filtered using 0.2 mm cellulose-acetate syringe filters (Albet-Jacs), and stored at –20 . The IL-8 DuoSet ELISA Development System (R&D Systems) was used for CXCL8 detection. Briefly, a 96-well flat bottom microplate (Costar) was coated with 4 mg/ml of captured antibody, diluted in Reagent Diluent (R&D Systems) (0.1% BSA, 0.05% Tween 20 in PBS, pH 7.2–7.4) at 4 O/N. Each well was washed in Washing Buffer (0.05% Tween 20, PBS, pH 7.2–7.4) and blocked with 1% BSA in Washing Buffer for 2 h at RT. Wells were washed three times and then 50 ml of sample were added to each wells and incubated for 2 h at RT. Each sample was analyzed in duplicate and threefold serial dilutions in Reagent Diluent were performed. A standard curve was performed using recombinant CXCL8, using twofold serial dilution in Reagent Diluent and a high standard point of 2 ng/ml. Each well was then washed in washing buffer and incubated with 50 ml of detection antibody for 2 h RT. Next, 50 ml of streptavidin-HRP were added to each well for 20 min at RT. Development was performed using the 3,30 ,5,50 tetramethyl-benzidine (TMB) Liquid Substrate System (SIGMA), and reaction was blocked by H2SO4 2N. The amount of CXCL8 was evaluated by optical density using the VersaMax microplate reader (Molecular Devices) set to 450 nm.

2.5. Statistical analysis The StatsDirect software was applied for the statistical analysis. The significance of differential gene expression among normal and tumor tissues were determined using the nonparametric Mann-Whitney U-test. A p-value of less than 0.05 was considered statistically significant. Simple linear regression analysis was used to determine mRNA correlation among the target genes.

3. Results 3.1. TaqMan Low Density Array analysis of eight colon cancer samples To investigate the role of chemokines and their receptors in colon cancer tissues, we performed a large screening of inflammation-related genes in eight human colon cancer samples and corresponding normal tissues, using the TaqMan Low Density Array (Applied Biosystem), customized with

111

Chemokines and Receptors in Human Colon Cancer

91 inflammation-related genes, selected by us, and 5 housekeeping genes. Among the 91 inflammation-related genes, 24 were chemokines and 17 were chemokine-receptors. Table 5.1 shows an overview of the results from eight samples of CRC tumors. The data are expressed as relative to each utologous normal tissue (adjacent colonic mucosa). Considering a fold-change greater than two, several ligands were upregulated. Among CC chemokines, CCL1, CCL3, CCL4, CCL7, CCL20, CCL25, and CCL26 were more frequently transcribed compared to normal tissues. The corresponding receptors, CCR8 Table 5.1 Overview: Expression of chemokine system in microenvironment of human CRC samples Stage1 Stage2 Stage2 Stage3 Stage3 Stage3 Stage4 Stage4 CCL1 CCL11 CCL14/15 CCL17 CCL18 CCL2 CCL20 CCL21 CCL25 CCL26 CCL3 CCL4 CCL7 CCL8 CCR1 CCR3 CCR5 CCR6 CCR8 CMKLR1 CXCL1 CXCL10 CXCL9 CXCR3 CXCR4 CXCL8 CXCR2 CXCL12

4

3

1

0

3

2

6

28

0

1

2

0

0

0

0

0

1

0

1

0

0

0

6

1

1

0

0

1

30

0

0

1

1

0

1

4

2

1

12

1

0

1

0

0

2

0

3

0

0

6

0

0

3

0

2

42

1

0

1

0

0

0

0

0

20

0

582

3

0

0

28

694

4

0

2

3

761

134

3

143

5

0

1

1

8

1

26

0

4

1

0

1

3

0

22

1

1

3

2

1

4

0

7

0

0

0

0

0

0

0

6

0

1

0

0

1

1

0

1

1

0

3

1

0

0

0

0

0

1

0

1

0

0

1

1

0

1

3

2

0

0

0

0

2

4 0

5 0

6 0

2 1

8 0

3 0

2 3

3 1

2

3

2

1

10

1

28

9

7

2

0

1

1

1

410

9

6

1

0

1

0

1

10

6

1

4

0

1

1

0

0

1

1

0

1

1

1

0

3

3

4

24

13

11

447

4

1492

1

0

4

3

3

10

3

34

0

0

0

0

0

0

0

0

0

mRNA of chemokines and receptors from CRC tumors were analyzed via a customized TaqMan Low Density Array. Data are expressed relative to autologous normal tissues. Grey box depicts a fold equal or greater than two. Eight tumor samples representative of various clinical stages are shown.

112

Marco Erreni et al.

and CCR6, were also upregulated, but others, CCR1 and CCR5, were less than 2. Among CXC chemokines, high levels of CXCL1 and CXCL8 and the corresponding receptor CXCR2 were found. High levels of CXCL9 and CXCL10 were also found, but not their receptor CXCR3. Surprisingly, the chemokine CCL2, frequently produced by several tumor types including CRC, or the constitutive chemokine CXCL12, were not upregulated. To better appreciate the configuration of the chemokine system in the normal colonic mucosa, the data were analyzed relative to the mean of the five housekeeping genes customized in the LDA. Two representative cases are presented in Fig. 5.1. Panels A and B show the mRNA levels of chemokines and receptors in one early-stage tumor, while Panels C and D show levels in an advanced stage tumor, respectively. The normal colonic mucosa (white bars) expresses several chemokines; CCL2, CCL5, CCL14/CCL15, CCL20, CCL21, and CXCL12 are expressed most frequently. Some of these chemokines were further upregulated in tumor samples (black bars), but not always reach the cut-off of twofold. Other chemokines such as CCL3, CCL4, and CXCL9, CXCL10, and especially CXCL8 were more selectively overexpressed in the tumor tissue. Among chemokine receptors, CXCR4 and CXCR7—both binding CXCL12—were found in the normal mucosa, while in the tumor tissue several receptors were upregulated, including CCR1 and CCR5, both binding CCL3 and CCL4, and CXCR2, recognizing CXCL8. We further decided to investigate the expression of these specific ligands in a larger series of CRC samples.

3.2. CCL3, CCL4, and CXCL8 expression in colon cancer To confirm the data obtained by the TaqMan Low Density Array, we further investigated mRNA expression of CCL3 and CCL4 in another 20 colon cancer tissues and their corresponding normal tissue. As shown in Fig. 5.2A, there is a significant increase in CCL3 expression in tumor samples compared with the normal colonic mucosa (p ¼ 0.05). CCL4 median expression is higher in tumor tissues, but this difference is at the limit of significance ( p ¼ 0.07). Moreover, there is higher amount of CCL4 than CCL3, both in normal and tumor tissue. Subsequently, we focused our attention on CXCL8, since it has been extensively demonstrated that this ligand is strongly overexpressed in various tumor types. We then investigated CXCL8 mRNA expression in 30 colon cancer tissues and corresponding normal mucosa: as shown in Fig. 5.2C, there is a strong significant increase in CXCL8 expression in tumor tissues (p < 0.0001).When compared to CCL3 and CCL4, CXCL8 shows the same mRNA expression in normal mucosa, but its expression is markedly higher in tumor samples. Both for CCL3, CCL4 and CXCL8 there is no significant correlation with tumor stage (data not shown).

A

B

Arbitrary units

C

C

0

0.005

0.010

0.015

0.020

0.025

0

0.025

0.050

0.075

0.100

0.125

0.2 0.150

0.3

0.4

C

1

C

R

C

C

L1

2

L3

R

C

C

C

C

L2

C

C

C

3

C

R

L4

C

C

4

L7

R

C

C

C

C

L5

R

5

C

C

R

C

C

R

7

C

C

R

8

C

C

R

L1 C

C

R

L2 C

X

C

R

1 C

X

C

R

Chemokine receptors

6

Chemokines

2 C

X

C

R

3 C

X

C

R

4 C

X

C

R

6 C

X

C

7

C

R M

K

LR

L8 L11 L13 L15 L16 L17 L18 L19 L20 L21 L22 L25 L26 L1 L8 L9 L10 L12 C C C C C C C C C C C C C C C C C C C ;C C C C C C C C C C CX CX CX X X C C 4 L1 C C

C

C

C

C

Early stage tumor

1

C

D

C

C

0

0.0025

0.0050

0.0075

0.0100

0.0125

0.0150

0.0175

1

L2

R

C

C

C

C

L1

0.0200

0

0.02

0.04

0.06

0.08

0.10

0.12

0.52

C

C

C

2

C

R

L3

C

C

C

L4

C

L5

3

C

R

C

R

C

4

L7

C

C

C

C

C

R

5 C

C

R

C

C

R

7 C

C

R

8 C

C

R

L1 C

C

R

L2 C

X

C

R

1 C

X

C

R

Chemokine receptors

6

Chemokines

2 C

X

C

R

3 C

X

C

R

4 C

X

C

R

6 C

X

C

7 C

R

M

K

LR

L8 L11 L13 L15 L16 L17 L18 L19 L20 L21 L22 L25 L26 L1 L8 L9 L10 L12 C C C C C C C C C C C C C C C C C C C ; C C C C C C C C C C CX CX CX X X C C 4 L1 C C

C

C

Advanced stage tumor

1

Tumor

Normal

Figure 5.1 ExpressionofmRNAforchemokinesandchemokine receptorsintwotumorsamples from CRCpatients,analyzedbyacustomized TaqMan Low DensityArray. Results in left panels refer to an early-stage tumor (Stage 2); right panel refers to an advanced-stage tumor (Stage 4). Chemokine ligands are depicted in panels A and C, and receptors in panels B and D. Shown are the mRNA levels relative to the mean of the five housekeeping genes customized in the LDA in the normal autologous colonic mucosa (white bar) and in the tumor tissue (black bar).

Arbitrary units

Arbitrary units Arbitrary units

114

Marco Erreni et al.

p = 0.05

A

CCL3

0.0016 Arbitrary units

0.0014 0.0012 0.0010 0.0008 0.0006 0.0004 0.0002 0.0000 Normal

Tumor p = 0.07

B

CCL4 0.0018

Arbitrary units

0.0016 0.0014 0.0012 0.0010 0.0008 0.0006 0.0004 0.0002 0.0000

Normal p < 0.0001

C

Arbitrary units

Tumor CXCL8

0.206 0.106 0.006 0.005 0.004 0.003 0.002 0.001 0.000 Normal

Tumor

Figure 5.2 Expression of mRNA of CCL3 (panel A), CCL4 (panel B), and CXCL8 (panel C), in CRC tumor samples and in adjacent normal colonic mucosa analyzed by RT-PCR. Statistical significance is shown. CCL3 and CXCL8 expression in tumors is significantly different from normal tissues.

115

Chemokines and Receptors in Human Colon Cancer

3.3. Regulation of CXCL8 expression in colon cancer cell lines Three CRC tumor cell lines were studied for the expression of CXCL8 mRNA and protein secretion. The cell lines SW620 and HT29 secreted low but detectable levels of CXCL8 constitutively, while HCT116 cells did not. An increased production was obtained upon stimulation with TNFa and TGFb, two mediators frequently found at the tumor site. Accordingly, mRNA levels were increased in TNFa/TGFb-stimulated cells. Surprisingly, TNFa stimulation alone increased mRNA levels in SW620 and HT29 cells, but not protein production (Fig. 5.3). A

CXCL8 7

NT TNFa TNFa + TGFb

6

ng/ml

5 4 2.0 1.5 1.0 0.5 0 HCT116

HT29

CXCL8

B

Fold change

SW620

10 9 8 7 6 5 4 3 2 1 0 HCT116

SW620

HT29

Figure 5.3 Regulation of CXCL8 in tumor cells lines derived from human CRC. Protein levels (panel A) were measured by a commercial ELISA in cell supernatants; mRNA levels (panel B) were analyzed by RT-PCR. Cells were either untreated (medium), or stimulated with TNFa (20 ng/ml) and TGFb (20/ ng/ml) for 24 h for protein expression or 6 h for mRNA.

116

Marco Erreni et al.

3.4. CXCL8 correlation with OPN and SPARC Among the most expressed genes in the LDA, we found osteopontin (OPN) and Secreted Protein Acidic and Rich in Cysteine (SPARC). It has been demonstrated that osteopontin is not only a matrix protein, but has also chemotactic activity for leukocytes, and is involved, together with CXCL8, in prostate cancer recurrence. Both OPN and SPARC contribute to the deposition and remodeling of the extracellular matrix (ECM) and to the development of angiogenesis, a function shared by CXCL8 as well. We therefore investigated the expression of OPN and SPARC in CRC samples, and their relationship with CXCL8. As shown in Fig. 5.4, there is a significant increase in both mRNA OPN (Fig. 5.4A) and SPARC (Fig. 5.4B) in tumor tissues compared to normal mucosa ( p < 0.0001). Interestingly, we found a significant linear correlation between mRNA OPN and CXCL8 A

C

OPN P < 0.0001

0.020

0.015 0.015

0.005 0.0025

OPN

Arbitrary units

0.010

0.0020

0.010

0.0015 0.005

0.0010

P = 0.001

0.0005 0

0 Normal

B

0

Tumor

0.2

0.3

CXCL8

D

SPARC P < 0.0001

0.08

0.07 0.02 0.0100

0.06

SPARC

Arbitrary units

0.1

0.0075

0.04

0.0050 0.02

P = 0.9

0.0025 0

0 Normal

Tumor

0

0.1

0.2

0.3

CXCL8

Figure 5.4 Expression of mRNA of osteopontin (OPN) (panel A) and SPARC (panel B) in CRC tumor samples, and in adjacent normal colonic mucosa analyzed by RTPCR. Statistical significance is shown. Both OPN and SPARC are significantly more expressed in tumor samples. Panels C and D show the linear regression analysis of CXCL8 and OPN (C) or SPARC (D). mRNA CXCL8 significantly correlates with mRNAOPN in the tumor tissues.

Chemokines and Receptors in Human Colon Cancer

117

expression in tumor tissues ( p ¼ 0.001) (Fig. 5.4C), while there was no correlation between CXCL8 and SPARC ( p ¼ 0.9) (Fig. 5.4D).

4. Discussion In this study, we have investigated the chemokine system in samples of human colorectal tumors. To obtain a global view of which chemokines and receptors are overexpressed in the tumor microenvironment, we have used a customized TaqMan Low Density Array containing probes for 24 ligands and 17 receptors. Several CC and CXC chemokines were strongly upregulated in tumor samples compared to the paired normal colonic mucosa. Interestingly, a number of chemokines were constitutively expressed also in the normal tissue, such as CCL2, CCL20, and CXCL12. The significance of their expression in normal colonic mucosa is likely explained by the abundant presence, at this site, of immune effectors of both innate and adaptive immunity, to maintain the local homeostasis. These chemokines were not or only slightly elevated in tumor samples. In contrast, other ligands, such as the inflammatory cytokines CCL3, CCL4, CXCL8, and a few others, were significantly increased compared to the normal counterpart tissue. CCL3 and CCL4 are chemotactic for monocytes/macrophages and T cells, the major components of tumor-infiltrating leucocytes in colorectal tumors, as well as in other tumor histotypes. Of note, while the subset of CD8þ T cells has been defined as protective antitumor effectors in CRC and their number associated with better prognosis (Galon et al., 2006), the role of macrophages is more ambiguous. Some studies on different tumor types, have described divergent result reporting a correlation with a favorable clinical outcome (Bailey et al., 2007; Forssell et al