(NAS Colloquium) Genetic Engineering of Viruses and Viral Vectors

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

TABLE OF CONTENTS

i

PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA

Table of Contents

Papers from a National Academy of Sciences Colloquium: Genetic Engineering of Viruses and Viral Vectors

Genetic engineering of viruses and of virus vectors: A preface Peter Palese and Bernard Roizman Site-specific integration by adeno-associated virus R.Michael Linden, Peter Ward, Catherine Giraud, Ernest Winocour, and Kenneth I.Berns Oncogenic potential of the adenovirus E4orf6 protein Mary Moore, Nobuo Horikoshi, and Thomas Shenk Adenovirus-mediated interleukin-12 gene therapy for metastatic colon carcinoma Manuel Caruso, Khiem Pham-Nguyen, Yok-Lam Kwong, Bisong Xu, Ken-Ichiro Kosai, Milton Finegold, Savio L.C.Woo, and Shu-Hsia Chen The function of herpes simplex virus genes: A primer for genetic engineering of novel vectors Bernard Roizman The application of genetically engineered herpes simplex viruses to the treatment of experimental brain tumors Samita S.Andreansky, Bin He, G.Yancey Gillespie, Liliana Soroceanu, James Markert, Joany Chou, Bernard Roizman, and Richard J.Whitley Replication-defective herpes simplex virus vectors for gene transfer in vivo Peggy Marconi, David Krisky, Thomas Oligino, Pietro L.Poliani, Ramesh Ramakrishnan, William F.Goins, David J.Fink, and Joseph C.Glorioso A deletion mutant in the human cytomegalovirus gene encoding IE1491aa is replication defective due to a failure in autoregulation Edward S.Mocarski, George W.Kemble, John M. Lyle, and Richard F.Greaves Human cytomegalovirus US3 impairs transport and maturation of major histocompatibility complex class I heavy chains Thomas R.Jones, Emmanuel J.H.J.Wiertz, Lei Sun, Kenneth N.Fish, Jay A.Nelson, and Hidde L.Ploegh Epstein-Barr virus vectors for gene delivery to B lymphocytes Erle S.Robertson, Tadamasa Ooka, and Elliott D.Kieff

11287 11288–11294 11295–11301 11302–11306

11307–11312 11313–11318

11319–11320

11321–11326

11327–11333

11334–11340

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

TABLE OF CONTENTS

Genetically engineered poxviruses for recombinant gene expression, vaccination, and safety Bernard Moss Applications of pox virus vectors to vaccination: An update Enzo Paoletti Negative-strand RNA viruses: Genetic engineering and applications Peter Palese, Hongyong Zheng, Othmar G. Engelhardt, Stephan Pleschka, and Adolfo García-Sastre Foreign glycoproteins expressed from recombinant vesicular stomatitis viruses are incorporated efficiently into virus particles Matthias J.Schnell, Linda Buonocore, Evelyne Kretzschmar, Erik Johnson, and John K.Rose Specific infection of CD4+ target cells by recombinant rabies virus pseudotypes carrying the HIV-1 envelope spike protein Teshome Mebatsion and Karl-Klaus Conzelmann Alphavirus-based expression vectors: Strategies and applications Ilya Frolov, Thomas A.Hoffman, Béla M.Prágai, Sergey A.Dryga, Henry V.Huang, Sondra Schlesinger, and Charles M.Rice Early events in poliovirus infection: Virus-receptor interactions Vincent R.Racaniello Efficient transfer, integration, and sustained long-term expression of the transgene in adult rat brains injected with a lentiviral vector Luigi Naldini, Ulrike Blömer, Fred H.Gage, Didier Trono, and Inder M.Verma Use of virion DNA as a cloning vector for the construction of mutant and recombinant herpesviruses S.Monroe Duboise, Jie Guo, Ronald C.Desrosiers, and Jae U.Jung Development of HIV vectors for anti-HIV gene therapy Eric Poeschla, Pierre Corbeau, and Flossie Wong-Staal A stable human-derived packaging cell line for production of high titer retrovirus/vesicular stomatitis virus G pseudotypes Daniel S.Ory, Beverly A.Neugeboren, and Richard C.Mulligan Cell-surface receptors for retroviruses and implications for gene transfer A.Dusty Miller Immunization with DNA vaccines encoding glycoprotein D or glycoprotein B, alone or in combination, induces protective immunity in animal models of herpes simplex virus-2 disease William L.McClements, Marcy E.Armstrong, Robert D.Keys, and Margaret A.Liu Fusigenic viral liposome for gene therapy in cardiovascular diseases Victor J.Dzau, Michael J.Mann, Ryuichi Morishita, and Yasufumi Kaneda

ii

11341–11348 11349–11353 11354–11358

11359–11365

11366–11370

11371–11377

11378–11381 11382–11388

11389–11394

11395–11399 11400–11406

11407–11413 11414–11420

11421–11425

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

GENETIC ENGINEERING OF VIRUSES AND OF VIRUS VECTORS: A PREFACE

11287

This paper serves as as introduction to the following papers, which were presented at a colloquium entitled “Genetic Engineering of Viruses and of Virus Vectors,” organized by Bernard Roizman and Peter Palese (Co-chairs), held June 9–11, 1996, at the National Academy of Sciences in Irvine, CA.

Genetic engineering of viruses and of virus vectors: A preface

PETER PALESE* AND BERNARD ROIZMAN† *Department of Microbiology, Mount Sinai School of Medicine, 5th Avenue at 100th Street, New York, NY 10029; and †The Marjorie B.Kovler Viral Oncology Laboratories, The University of Chicago, 910 East 58th Street Chicago, IL 60637 Give me a firm spot on which to stand, and I will move the earth. Archimedes Nearly two centuries ago, Jenner used a live virus of another species to combat smallpox—one of the most lethal human pathogens known. In the intervening years, science has provided the tools to produce by design in the laboratory other live viruses capable of protecting against their more lethal siblings. We have learned to attenuate human pathogenic viruses by passage in nonhuman hosts, by cultivation at lower temperature, and by the genetic engineering of mutations in viral genomes. Science has not yet ablated the misery of human infectious disease. Indeed, as measured in terms of health costs, human diseases caused by human immunodeficiency virus, influenza, and the herpesviruses account for a very significant portion of the total costs. While efforts designed to eliminate other infectious diseases from human society continue, other uses for viruses emerged. They stem from four considerations. First, viruses attack cells they recognize by specific receptors that are present on cell surfaces. Second, viruses evolved by borrowing and modifying cellular genes. Yet, all viruses depend on specific cellular functions for their replication or survival in their hosts. Some of the functions required by viruses for their replication are expressed in most cells, some only in dividing cells, and some only in highly differentiated cells. Third, viruses form two groups (those that infect organs at or near a portal of both entry and exit), multiply efficiently, and ultimately are eliminated by the immune response, and those that remain after infection are in a latent state for the life of the host. Last and perhaps foremost, for the past two decades, molecular and genetic tools became available to construct novel viruses that never existed before and, in most instances, lack the evolutionary advantages that would permit them to survive in nature. These considerations serve as the foundation of the idea that it should be possible to construct highly modified, attenuated, viruses that target specific cells and to introduce into the targeted cells desired functions deliberately incorporated into the viral genomes. These functions include the potential to selectively destroy cancer cells by “hit-and-run” viruses that in this instance would be eliminated by the immune system once their task is done, or to establish lifelong latency concomitant with the expression of a cellular gene necessary for the survival of the infected cell. As the accompanying reports indicate, the development of magic bullets is far along, but we are not there yet. A decade ago, reports on genetic engineering of viruses would have focused on the development of better vaccines to prevent infections by our natural enemies—the viruses and microorganisms that prey on us. It is a reflection of the development of virology over the last decade that we are beginning to think of our ancient foes as our friends.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

SITE-SPECIFIC INTEGRATION BY ADENO-ASSOCIATED VIRUS

11288

This paper was presented at a colloquium entitled “Genetic Engineering of Viruses and of Virus Vectors,” organized by Bernard Roizman and Peter Palese (Co-chairs), held June 9–11, 1996, at the National Academy of Sciences in Irvine, CA.

Site-specific integration by adeno-associated virus

(parvovirus/gene therapy/targeted integration/DNA replication/recombination) R.MICHAEL LINDEN*, PETER WARD*, CATHERINE GIRAUD*, ERNEST WINOCOUR†, AND KENNETH I.BERNS*‡ *Department of Microbiology, Hearst Microbiology Research Center, Cornell University Medical College, 1300 York Avenue, New York, NY 10021; and †Department of Molecular Genetics, Weizmann Institute of Science, Rehovot 76100, Israel ABSTRACT Adeno-associated virus (AAV) has attracted considerable interest as a potential vector for gene delivery. Wild-type virus is notable for the lack of association with any human disease and the ability to stably integrate its genome in a site-specific manner in a locus on human chromosome 19 (AAVS1). Use of a functional model system for AAV DNA integration into AAVS1 has allowed us to conclude that the recombination event is directed by cellular DNA sequences. Recombinant junctions isolated from our integration assay were analyzed and showed characteristics similar to those found in latently infected cell lines. The minimal DNA signals within AAVS1 required for targeted integration were identified and shown to contain functional motifs of the viral origin of replication. A replication mediated model of AAV DNA integration is proposed. The human parvovirus, adeno-associated virus (AAV), has aroused considerable interest as a potential vector for human gene therapy. Among favorable properties of the virus are its lack of association with any human disease (1), the wide range of cell lines derived from different tissues which can be infected (2), and the ability of the virus to integrate into the genome of the infected cell to establish a latent infection (3). The latter property appears to be unique among mammalian viruses for two reasons. The first is that integration can occur in nondividing cells (4, 37), albeit at a lesser frequency than in dividing cells. Second, AAV integration occurs at a specific site in the human genome, on the q arm of chromosome 19 between q13.3 and qter (5–9). For several years our laboratory has studied the mechanism underlying the site specificity of AAV DNA integration. To date, a number of experiments have been initiated to address the feasibility of gene transfer with AAV. In preliminary experiments nondividing cells [hematopoetic progenitor cells (10), neurons (11), photoreceptor cells (12), etc.] were shown to be stably transduced by these recombinant AAV vectors. The majority of vectors used have contained the inverted terminal repeats (ITR) as the only genetic information from wild-type AAV. These vectors do not integrate in a site-specific manner. Knowledge of the mechanisms leading to site-specific integration may lead to a superior class of AAV-based vectors. In cell culture AAV does not undergo productive infection unless there is a coinfection with a helper adeno- (13, 14) or herpesvirus (15, 16). Rather, the virus penetrates to the nucleus where the viral genome is uncoated (K.I.B. and S. Adler, unpublished data). Little viral gene expression occurs, and that which does serves to repress further viral gene expression and to inhibit most viral DNA synthesis. In place of productive viral infection, the viral genome is integrated to establish a latent infection (2, 3, 17). The virus is maintained in the latent state indefinitely, thus perpetuating the viral genetic information. However, superinfection of the latently infected cell with adeno- or herpesvirus activates the viral genome, leading to viral gene expression and to rescue and replication of the viral genome with subsequent production of viral progeny (18). Cells in culture can also be made permissive for AAV-productive infection in the absence of helper adenoor herpesviruses by exposure to genotoxic chemicals or radiation (19–21). Because of its usual dependence on a helper virus for productive infection, AAV was originally considered to be defective. Our current model of the replication of the virus is that AAV has evolved to perpetuate its genetic information by the establishment of latency. When the cell is stressed, the AAV genome is activated to produce new progeny to leave the cell to seek a new host. Our original studies mapped the specific site of integration (AAVS1) to a position on the q arm of chromsome 19 (8). An 8-kb fragment which contained the integration site was cloned and the 5
approximately 4 kb were sequenced (7). The sequence contained several interesting features: (i) an open reading frame (ORF) that was expressed in several tissues at low levels detectable using reverse transcription-PCR (no match was found with ORFs representing known proteins); (ii) a higher than expected frequency of direct repeats of dodecanucleotides both upstream and downstream of the ORF; (iii) an overall GC content of 65% which rose to 82% upstream of the ORF in the first 1 kb; and (iv) a 35-mer which was repeated in tandem 10 times. This minisatellite sequence is found at about 60 sites in the human genome, all of which occur on the q arm of chromosome 19 (22). However, none of these features of AAVS1 was sufficiently distinctive to indicate uniqueness of the preintegration site within the the human genome. The possibility existed that the unique aspect of the specific site of integration was not in the sequence but in some higher order structure of the chromatin structure of 19 q. To resolve the question of whether the specificity lay in the sequence, we have moved AAVS1 to another site in the cell. Our assumption was that if the determining factor was the sequence, the viral genome would integrate regardless of the location of AAVS1. To move the sequence we made use of an Epstein-Barr virus-based shuttle vector (p220.2; ref. 23) which could either be replicated extrachromosomally in a cell cycle-dependent manner in mammalian cells or as a plasmid in Escherichia coli. For persistence in a latent state in mammalian cells, p220.2 is dependent on the presence of the Epstein-Barr origin of DNA replication (oriP) that functions in the presence of EBNA1, the only viral gene product required to initiate replication at oriP. AAVS1 was inserted into the shuttle vector,

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact. Abbreviations: AAV, adeno-associated virus; ITR, inverted terminal repeats; RBS, Rep binding site; TRS, terminal resolution site. ‡To whom reprint requests should be addressed.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

SITE-SPECIFIC INTEGRATION BY ADENO-ASSOCIATED VIRUS

11289

which was then transfected into human C17 cells (293 cells which constitutively express EBNA1). Pools of hygromycin-resistant C17 clones containing the shuttle vector (hygromycin serves as a selective marker for p220.2) were isolated and grown up. On average the clones contained 50–100 copies of the shuttle vector per cell. The cloned cells were infected with AAV and after 48 hr plasmid DNA was isolated and transfected into E. coli. The only colonies to form were those containing the selectable marker of the shuttle vector (ampR which is carried by p220.2). The fraction of such colonies which hybridized to an AAV probe was considered a reflection of the frequency with which AAV had integrated into the shuttle vector. Data are summarized in Fig. 1 (24). AAV did integrate into the shuttle vector which contained the entire 8.2 kb of AAVS1. By sequential deletion analysis it was possible to map the sequences required to direct site-specific integration to the first 510 nt of AAVS1. Thus, it was possible to conclude that AAV site-specific integration was determined by the DNA sequence on 19 q and that the critical sequence was contained within the first 510 bases of the AAVS1 sequence. To delineate the critical signal sequences within the first 510 bases of AAVS1, a brief review of the molecular genetics and biology of AAV replication is required. Within the 4.7-kb genome there are two ORFs; the one in the right half of the genome encodes the three structural proteins; the ORF in the left half of the genome encodes four regulatory proteins, Reps 78, 68, 52, and 40, with overlapping amino acid sequences. (The Rep designation is used because a frame shift mutation anywhere within the ORF blocks DNA replication) (25). There are two promoters (at map positions 5 and 19) in the left half of the genome and both spliced and unspliced forms of the two transcripts are translated to synthesize the four Rep proteins. Reps 78 and 68 have essentially identical phenotypes and are involved in all phases of the AAV life cycle. These phenotypes depend on the physiological state of the cell. In the absence of helper virus (i.e., the nonpermissive state) Rep 68/78 represses AAV gene expression and inhibits viral DNA synthesis. It is required for site-specific integration and affects expression of a number of cellular genes, most by down regulation (26). In the presence of helper virus (i.e., the permissive state) Rep 68/78 is required for AAV gene expression and transactivates expression of the structural proteins; it is also required for viral DNA replication and rescue of the integrated viral genome. Interestingly, it inhibits expression of the helper adenovirus early genes (M.A.Labow and K.I.B., unpublished data). The AAV genome contains an ITR of 145 nt (Fig. 2). The first 125 nt constitute an overall palindrome interrupted by two smaller internal palindromes of 21 nt, one immediately on either side of the overall axis of symmetry. When folded on itself to optimize potential base pairing, the palindromic sequence forms a T-shaped structure. The long stem of the T-shaped structure contains an RBS. When Rep binds to the ITR it interacts with at least one of the cross arms of the T (or small internal palindrome) and can make a site-specific nick between nt 124 and 125 (27). After nicking, Rep is covalently bound to the 5
side of the nick and can function as a helicase (28). The ITR is the cis-active signal in the nonpermissive state for the negative regulation of gene expression and DNA replication. In the permissive state the ITR enhances gene expression, serves as the ori for DNA replication, and is required for rescue of the viral genome from the integrated state. Thus, it was of interest to note that the 510 nt of AAVS1 sufficient to direct site-specific integration contained both an RBS and TRS in the appropriate orientation with a comparable spacing between them. A third signal of potential interest was a hexanucleotide homologous to an enhancer of meiotic gene conversion (M26) in fission yeast (29). This sequence was also present at approximately the same position (relative to RBS and TRS) at one end of the AAV genome. Biochemical experiments had shown that Rep 68 could bind at the RBS in AAVS1 and that oligomeric complexes of Rep could link the ITR of AAV to the corresponding sequences in AAVS1 (30). It was also shown in vitro that bound Rep could nick the sequence

FIG. 1. AAVS1-derived target sequences cloned into p220.2 are graphically displayed. Boxes represent different fragments from AAVS1. Gray boxes highlight the 510-bp fragment sufficient as a target for integration. Average recombination frequencies are indicated for each subfragment. They were calculated as the fraction of E. coli colonies which hybridized to an AAV-specific probe. This fraction was considered to represent the frequency with which AAV had integrated into the shuttle vector. The data were taken from ref. 24.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

SITE-SPECIFIC INTEGRATION BY ADENO-ASSOCIATED VIRUS

11290

at AAVS1 TRS and initiate unidirectional DNA synthesis (31). To directly demonstrate that the putative signal sequences in AAVS1 were actually required for site-specific integration, a number of genetic analyses were performed (32). These are summarized in Fig. 3. Insertion of DNA fragments representing those portions of the 510 nt containing the TRS and RBS into the shuttle vector assay were required for sitespecific integration; M26 was not. In further experiments, creation of mutations involving 2 or 3 nt in RBS or TRS were shown to block sitespecific integration. Thus, we have directly demonstrated that defined signal sequences are required to direct site-specific integration. In additional experiments we have found that a 33-nt oligonucleotide containing these two signal sequences is sufficient to direct the integration process. It is of interest to note that these signals in the context of AAV constitute the minimal origin of DNA replication

FIG. 2. An AAVITR is shown. The figure represents the T-shaped structure resulting from the palindromic sequence folded on itself to optimize potential base pairing. The stem contains a Rep binding site (RBS) and a terminal resolution site (TRS). Although the M26 sequence does not seem to play a direct role in site-specific integration, there are data which suggest that M26 may play a general role in destabilizing AAVS1 and thus may contribute indirectly to the integration reaction (32). Insertion of the 510-nt fragment into the shuttle vector led to rearrangement of the vector sequences in the C17 cells which was independent of the presence of AAV infection. Deletion of the sequences containing M26 has led to stabilization of the shuttle vector in C17 cells. Whether M26 has a comparable effect at the chromosomal level is unknown; there is at least one fragile site on the q-arm of 19 and it has been extremely difficult to map this region, because both cosmids and yeast artificial chromosomes have been very unstable. Structures of a number of the recombinants produced using the shuttle vector assay have been determined (Table 1) (33). About 20% of the recombinants contained an intact AAV

FIG. 3. Construct used for the genetic analysis to determine the recombination signals sufficient and necessary are indicated. The top panel represents subclones generated from the 510-bp fragment sufficient for AAV integration indicated in Fig. 1. Boxes [gray (Upper) and empty (Lower)] indicate known DNA signals identified within the 510-bp sequence. Nucleotide numbers indicated are given with respect to AAVS1. M26, enhancer of meiotic gene conversion in fission yeast; CRE, cyclic AMP response element; Sp1, transcription factor Sp1 consensus sequence; TRS, terminal resolution site; RBS, Rep binding site. (Lower) Synthetic oligonucleotides cloned into the shuttle vector p220.2. Recombination frequencies indicated are calculated as described in the text as well as in Fig. 1. Data were taken from ref. 32.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

SITE-SPECIFIC INTEGRATION BY ADENO-ASSOCIATED VIRUS

11291

genome in which the junctions with vector DNA occurred within the ITR. In every case, a portion of the ITR had been deleted. In 2 instances (out of 20) the integrant was more than unit length AAV, stretching from one partial ITR through the ITR at the other end of the genome which had been elongated to form a head-to-tail junction with a portion of a second viral genome that extended to map position 5. These two recombinants were quite interesting, because when the recombinant plasmid was transfected into 293 cells infected with adenovirus, the AAV integrant was rescued and replicated to make progeny virions. Most of the remainder of the recombinants contained less than a full-length viral genome. In most cases the AAV sequences missing were from the part of the AAV genome encoding the REP genes. The integrated DNA sequence extended from a point within the internal AAV sequence through the ITR at the 3
end of the genome, which again had been elongated to form a head-to-tail junction and then extended in another sequence to map position 5 (as in the two full-length inserts described above). The large number of integrants with head-to-tail junctions suggests a circular intermediate, which could be the result of a limited form of rolling circle replication. Of particular note was that one junction between viral and vector sequences always involved AAVS1 sequences, frequently near RBS; but the other junction between viral and vector DNAs seemed to never occur within AAVS1. Probing the recombinants with oligonucleotides from the upstream AAVS1 sequences demonstrated that in a majority of cases the AAVS1 sequence immediately upstream of the integration event had been rearranged. Rearrangement of flanking cellular sequences in chromosomal integration has been reported, as has been rearrangement of viral sequences.

FIG. 4. A model for AAV DNA replication is shown. (I) Replication proceeds by single-strand displacement. (II) After reaching the end of the template strand AAV dimers can be produced (IIA) by folding of the two free ends to form hairpin structures. To be able to prime a second round of replication, the replication apparatus has to switch template strands onto the folded ITR containing the free 3
OH group. Alternatively, the TRS can be nicked by Rep (IIB), allowing elongation from the nick creating a structure similar to step I.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

SITE-SPECIFIC INTEGRATION BY ADENO-ASSOCIATED VIRUS

11292

FIG. 5. Model for AAV site-specific DNA integration. Parallel lines in the AAV molecules indicate that the sizes of DNA structures in the figure are not drawn in their actual proportions. A thick grey line indicates the newly synthesized strand; the dashed line indicates the displaced strand of AAVS1. (I) Complex formation between AAV and AAVS1 is mediated by Rep 68/78. (II) Introduction of a strand-specific nick at the TRS in AAVS1 by rep 68/78 and assembly of cellular replication factors. (III) DNA synthesis by single-strand displacement originating at the TRS is followed by template strand switch onto the displaced strand. (IV) A second strand switch occurs onto AAV creating a link between AAVS1 and AAV sequences. (V) After synthesis of AAV DNA sequences a third template strand switch back onto AAVS1 results in a second link between viral and host DNA sequences. (VI) Repair of DNA structures containing noncomplementary strands by cellular enzymes results in integrated copies of AAV DNA within AAVS1. This figure is taken from ref. 32.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

SITE-SPECIFIC INTEGRATION BY ADENO-ASSOCIATED VIRUS

11293

A model for the integration process has been developed (32). Because of the involvement of Rep proteins, RBS and TRS, it appears likely that viral DNA replication and localized DNA replication within AAVS1 are involved in integration. AAV DNA replication involves a single strand displacement mechanism (Fig. 4) (for a review, see ref. 34). A major feature of AAV replication is the ability of the elongating strand to switch templates (35). Replication initiates from the ITR in the folded state which serves as both the ori and the primer. When the template strand is fully copied, the 3
end of the newly synthesized strand can fold on itself and begin synthesis of a second new strand, this time using the first daughter strand as the new template (i.e., by switching templates). It is suggested that the intrinsic tendency of a Rep-mediated replication complex to switch template strands is also the underlying mechanism in the generation of aberrant AAV DNA particles and defective interfering particles. If the first hairpin structure created by the initial priming event has not been resolved, continuing synthesis will lead to a double stranded, dimeric form of AAV DNA (in Fig. 4IIA). Resolution of the hairpin structures is achieved by Rep cleavage at TRS (Fig. 4IIB). This leads to transfer of the original hairpin sequence from parental to daughter strand and creates a 3
OH to serve as a primer for repair of the 5
end of the parental strand. In vivo, AAV DNA replication requires a co-infection with a helper virus, usually adenovirus. In vitro, it is possible to observe replication of full-length AAV DNA using an extract from uninfected HeLa cells (i.e., from nonpermissive cells) which has been supplemented with purified Rep 68 (36). A significant question was whether the only important adenovirus helper effect on AAV DNA replication was to allow synthesis of sufficient amounts of Rep. The fact that in vitro AAV DNA replication is greatly enhanced by the substitution of extracts from adenovirus-infected cells for those from uninfected cells proves this hypothesis incorrect. The major consequence of using the extract from adenovirus-infected cells is to enhance the ability of the elongating DNA strand to remain on the original template. Use of uninfected cell extract leads to premature strand switching and the consequent interruption of the normal replication process with the synthesis of defective DNA molecules (35). We believe that the enhanced probability of strand switching during DNA synthesis in the absence of a helper virus coinfection plays a major role in the integration process. A model for the integration process must take into account the following properties. (i) Involvement of RBS and TRS. (ii) Rearrangement of the AAVS1 sequences at one junction. (iii) Presence of head-to-tail AAV junctions, (iv) Despite the requirements for very distinct integration signals (RBS and TRS) a model must account for the observation that integration junctions observed are scattered within ca. 1 kb of AAVS1 downstream of RBS and TRS. A simplified model which can account for these features is shown in Fig. 5. An oligomeric complex of Rep binds to the RBS on AAVS1 and to the RBS in the AAV ITR, thus linking a circularized duplex AAV molecule to AAVS1. This represents a protein (Rep) mediated alignment of the recombination partners AAV and AAVS1, initiating the nonhomologous recombination event observed. Rep then introduces a nick into the AAVS1 TRS. DNA synthesis initiates, displacing a single strand of AAVS1. The extension of replication determines the location of a junction with AAV subsequently formed (see requirement iv mentioned above). It should be noted that the displaced single strand is circular because Rep is covalently bound to the 5
end and presumed to be still bound to the RBS. After limited extension the elongating strand switches to the displaced single strand as the template; note that copying of the displaced circular AAVS1 sequence leads to inversion of the sequence. When it reaches the end of the displaced strand (close to the RBS as observed in the shuttle vector model system), the elongating strand again switches templates, now onto the circular AAV DNA. After synthesis proceeds on the AAV template, the elongating strand reaches RBS where Rep is bound and the strand again switches to a new template on AAVS1 (alternatively onto p220.2 in the shuttle vector system). Eventually the single-strand gap involving the inserted AAV sequence and the inverted AAVS1 sequence is repaired. Undoubtedly, this model is simplified, but we believe that it is consistent with many of the features observed in AAV integration. The proper conjunction of RBS and TRS required for integration is present only once in the data concerning the human genome in GenBank, likely explaining the apparent presence of only a single site for specific AAV integration. However, RBS has been noted at multiple sites in the human genome; in 14/15 cases analyzed, it appears in the 5
-untranslated regions of characterized genes; therefore, indicating a cellular counterpart of the Rep protein with possible regulatory functions, which also recognizes RBS. In addition it seems likely that AAV has evolved to take advantage of one copy of this recognition signal sequence. Our current knowledge of the requirements for site-specific AAV DNA integration, together with our proposed model for an integration mechanism, may help in the design of improved AAV-based vectors for gene therapy. At this point it can be concluded that the Rep protein is an absolute requirement for the site specificity of AAV DNA integration. Finally, we propose that the full AAV ITR may not be necessary for targeted integration. Rather, it is possible that integrity of the ITR is only required for efficient rescue of integrated proviruses, a function not necessary, or even desirable, for stable, long term gene delivery. This work was supported by a grant from the National Institute of Allergy and Infectious Diseases (AI22251) and by a grant from the National Institute of General Medical Sciences (GM50032). R.M.L. was supported in part by a fellowship from the Norman and Rosita Winston Foundation. 1. Blacklow, N.R., Hoggan, M.D., Kapikian, A.Z., Austin, J.B. & Rowe, W.P. (1968) Am. J. Epidemiol. 88, 368–378. 2. Berns, K.I., Pinkerton, T.C., Thomas, G.F. & Hoggan, M.D. (1975) Virology 68, 556–560. 3. Cheung, A.K., Hoggan, M.D., Hauswirth, W.W. & Berns, K.I. (1980) J. Virol. 33, 739–748. 4. Podsakoff, G., Wong, K.K., Jr., & Chatterjee, S. (1994) J. Virol. 68, 5656–5666. 5. Kotin, R.M. & Berns, K.I. (1989) Virology 170, 460–467. 6. Kotin, R.M., Siniscalco, M., Samulski, R.J., Zhu, X.D., Hunter, L., Laughlin, C.A., McLaughlin, S., Muzyczka, N., Rocchi, M. & Berns, K.I. (1990) Proc. Natl. Acad. Sci. USA 87, 2211–2215. 7. Kotin, R.M., Linden, R.M. & Berns, K.I. (1992) EMBO J. 11, 5071–5078. 8. Kotin, R.M., Menninger, J.C., Ward, D.C. & Berns, K.I. (1991) Genomics 10, 831–834. 9. Samulski, R.J., Zhu, X., Xiao, X., Brook, J.D., Housman, D.E., Epstein, N. & Hunter, L.A. (1991) EMBO J. 10, 3941–3950. 10. Zhou, S.Z., Cooper, S., Kang, L.Y., Ruggieri, L., Heimfeld, S., Srivastava, A. & Broxmeyer, H.E. (1994) J. Exp. Med. 179, 1867–1875. 11. Kaplitt, M.G., Leone, P., Samulski, R.J., Xiao, X., Pfaff, D.W., O’Malley, K.L. & During, M.J. (1994) Nat. Genet. 8, 148–154. 12. Ali, R.R., Reichel, M.B., Thrasher, A.J., Levinski, R.J., Kinnon, C., Kanuga, N., Hunt, D.M. & Bhattacharya, S.S. (1996) Hum. Mol. Genet. 5, 591– 594. 13. Atchison, R.W., Casto, B.C. & Hammon, W. (1965) Science 149, 754–756. 14. Hoggan, M.D., Blacklow, N.R. & Rowe, W.P. (1966) Proc. Natl. Acad. Sci. USA 55, 1467–1471. 15. Buller, R.M., Janik, J.E., Sebring, E.D. & Rose, J.A. (1981) J. Virol. 40, 241–247. 16. Weindler, F.W. & Heilbronn, R. (1991) J. Virol. 65, 2476–2483.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

SITE-SPECIFIC INTEGRATION BY ADENO-ASSOCIATED VIRUS

11294

17. Handa, H., Shiroki, K. & Shimojo, H. (1975) J. Gen. Virol. 29, 239–242. 18. Hoggan, M.D., Thomas, G.F. & Johnson, F.B. (1972) Continuous “Carriage” of Adenovirus Associated Virus Genomes in Cell Cultures in the Absence of Helper Adenovirus (North-Holland, Amsterdam). 19. Yakobson, B., Koch, T. & Winocour, E. (1987) J. Virol. 61, 972–981. 20. Yakinoglu, A.O., Heilbronn, R., Burkle, A., Schlehofer, J.R. & zur Hausen, H. (1988) Cancer Res. 48, 3123–3129. 21. Yakobson, B., Hrynko, T.A., Peak, M.J. & Winocour, E. (1989) J. Virol. 63, 1023–1030. 22. Das, H.K., Jackson, C.L., Miller, D.A., Leff, T. & Breslow, J.L. (1987) J. Biol. Chem. 262, 4787–4793. 23. Yates, J.L., Warren, N. & Sugden, W. (1985) Nature (London) 313, 812–815. 24. Giraud, C., Winocour, E. & Berns, K.I. (1994) Proc. Natl. Acad. Sci. USA 91, 10039–10043. 25. Hernonat, P.L., Labow, M.A., Wright, R., Berns, K.I. & Muzyczka, N. (1984) J. Virol. 51, 329–339. 26. Labow, M.A., Graf, L.H., Jr., & Berns, K.I. (1987) Mol. Cell. Biol. 7, 1320–1325. 27. Im, D.S. & Muzyczka, N. (1990) Cell 61, 447–457. 28. Im, D.S. & Muzyczka, N. (1992) J. Virol. 66, 1119–1128. 29. Schuchert, P., Langsford, M., Kaslin, E. & Kohli, J. (1991) EMBO J. 10, 2157–2163. 30. Weitzman, M.D., Kyostio, S.R., Kotin, R.M. & Owens, R.A. (1994) Proc. Natl. Acad. Sci. USA 91, 5808–5812. 31. Urcelay, E., Ward, P., Wiener, S.M., Safer, B. & Kotin, R.M. (1995) J. Virol. 69, 2038–2046. 32. Linden, R.M., Winocour, E. & Berns, K.I. (1996) Proc. Natl. Acad. Sci. USA 93, 7966–7972. 33. Giraud, C., Winocour, E. & Berns, K.I. (1995) J. Virol. 69, 6917–6924. 34. Berns, K.I. (1996) in Parvoviridae: The Viruses and Their Replication, eds. Fields, B.N., Knipe, D.M. & Howley, P.M. (Lippincott-Raven, Philadelphia), Vol. 2, pp. 2173–1220. 35. Ward, P.J. & Berns, K.I. (1996) J. Virol. 70, 4495–4501. 36. Ward, P., Urcelay, E., Kotin, R., Safer, B. & Berns, K.I. (1994) J .Virol. 68, 6029–6037. 37. Russell, D.W., Miller A.D. & Alexander, I.E. (1994) Proc. Natl. Acad. Sci. USA 91, 8915–8919.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

ONCOGENIC POTENTIAL OF THE ADENOVIRUS E4ORF6 PROTEIN

11295

This paper was presented at a colloquium entitled “Genetic Engineering of Viruses and of Virus Vectors,” organized by Bernard Roizman and Peter Palese (Co-chairs), held June 9–11, 1996, at the National Academy of Sciences in Irvine, CA.

Oncogenic potential of the adenovirus E4orf6 protein

MARY MOORE, NOBUO HORIKOSHI, AND THOMAS SHENK * Howard Hughes Medical Institute, Department of Molecular Biology, Princeton University, Princeton, NJ 08544–1014 ABSTRACT The group C adenovirus E4orf6 protein has previously been shown to bind to the p53 cellular tumor suppressor protein and block its ability to activate transcription. Here we show that the E4orf6 protein blocks the induction of p53-mediated apoptosis when AT6 cells, which harbor a temperature-sensitive p53, are shifted to the permissive temperature. The E4orf6 protein does not, however, prevent the induction of apoptosis in p53-deficient H1299 cells by treatment with tumor necrosis factor α and cycloheximide. The E4orf6 protein also cooperates with the adenovirus E1A protein to transform primary baby rat kidney cells, and it cooperates with the adenovirus E1A plus E1B 19-kDa and E1B 55-kDa proteins to increase the number of baby rat kidney cell transformants and enhance the rate at which they arise. The level of p53 is substantially reduced in transformed cells expressing the E4orf6 protein in comparison to adenovirus transformants lacking it. The E4orf6 gene also accelerates tumor formation when transformed baby rat kidney cells are injected subcutaneously into the nude mouse, and it converts human 293 cells from nontumorigenic to tumorigenic in nude mice. In addition to the well-studied E1A and E1B oncogenes, group C adenoviruses harbor a third oncogene, E4orf6, which functions in some respects similarly to the E1B oncogene. Although adenoviruses are not known to be associated with tumorigenesis in humans, some human adenovirus serotypes can directly induce tumors in rats or hamsters, and all serotypes tested can transform cultured rodent cells (reviewed in refs. 1 and 2). Candidate viral oncogenes were first identified as the genes that are always retained in cells transformed by group C adenoviruses. Most of the viral genome is lost from cells transformed by these viruses, which include adenovirus types 2 and 5; only the E1A and E1B genes are consistently retained. The E1A and E1B genes were subsequently confirmed to be both necessary and sufficient for transformation by mutational analysis of the viral genome and transfection experiments employing the cloned genes. More recent work has provided a detailed mechanistic explanation for the transforming ability of these viral genes (reviewed in refs. 1 and 2). The E1A proteins bind to a number of cellular growth-regulatory proteins and modulate their function. Most notably, E1A proteins bind to the retinoblastoma tumor suppressor protein and its family members (3), freeing the cellular S phase-specific transcription factor E2F (4) and deregulating the control of cell cycle progression (5). The E1A proteins generally stabilize p53 and induce apoptosis when introduced into cells (6). The E1B proteins cooperate with E1A to transform cells at least in part by preventing the apoptotic response (7). The E1B 55-kDa protein binds to p53 and interferes with its ability to activate transcription (8–10), presumably blocking its ability to induce apoptosis. The E1B 19-kDa protein, which is related to the Bcl-2 family of cellular proteins (11), prevents the induction of apoptosis by a variety of inducers, including p53 (7, 12). Either one of the two E1B proteins is sufficient to cooperate with E1A to transform cells (12). We have recently shown that the adenovirus E4orf6 protein, like the E1B 55-kDa protein, can bind to p53 both in vitro and in extracts from infected cells (13). Whereas the E1B 55-kDa protein binds to the amino-terminal activation domain of p53, the E4orf6 protein binds near the carboxyl terminus of the protein, close to its oligomerization domain. Nevertheless, like the E1B 55-kDa protein, the E4orf6 protein efficiently blocks the ability of p53 to activate transcription (13). p53 activates transcription, at least in part, by contacting a constituent of the basal transcriptional machinery, TAFII31, through its aminoterminal transcriptional activation domain (14, 15). The E4orf6 protein blocks the interaction of p53 with TAFII31, even though it does not appear to directly contact the aminoterminal activation domain of p53 (13). Here we describe several biological consequences of the E4orf6 interaction with p53. E4orf6 protein can block the induction of apoptosis by p53, but it does not exhibit transforming activity when expressed in the absence of other adenovirus proteins in rat cells. It can, however, cooperate with the E1A proteins to transform rat cells, it can enhance transformation by the E1A plus E1B proteins, and it can enhance the oncogenicity of virus-transformed cells in nude mice. Thus, group C adenoviruses contain a third oncogene that appears to function in some respects similarly to the E1B gene.

MATERIALS AND METHODS Plasmids. The cytomegalovirus immediate early promoter was utilized to express the E1A (pCMVE1A), E1B 19-kDa (pCMV19K), or E1B 55-kDa (pCMV55K) coding region; each of these constructs has been described elsewhere (16, 17). The simian virus 40 early promoter/ enhancer was utilized to express the E1A coding region in pSVE1A (18). The plasmid pXhoI-C (19) contains the leftmost 15.5% of the adenovirus 5 genome, including the E1A and E1B genes with their endogenous promoters. An E4orf6-specific cDNA was prepared from mRNA by reverse transcription, amplified by PCR, cloned, and sequenced. The E4orf6 coding region was expressed either from the cytomegalovirus immediate early promoter (pCMV34K) (13) or from the mouse mammary tumor virus long terminal repeat (MMTV LTR) (pMMTVE4orf6). The E2A coding region was also expressed from the MMTV LTR (pMMTVE2A). Apoptosis Assay. Cells were transfected with the pCMVE4orf6 expression plasmid (13) using Lipofectamine (GIBCO/BRL) 24 hr before inducing apoptosis. H1299 cells (20), which express no p53, were treated with human tumor

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact. Abbreviations: TNF, tumor necrosis factor; TUNEL, terminal deoxynucleotidyltransferase-mediated UTP end labeling. *To whom reprint requests should be addressed. e-mail: [email protected].

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

ONCOGENIC POTENTIAL OF THE ADENOVIRUS E4ORF6 PROTEIN

11296

necrosis factor (TNF)-α (10 ng/ml) and cycloheximide (30 µg/ml) for 7 hr. AT6 cells (21), which express a temperature-sensitive p53 allele, were placed at 32°C for 3 days for the induction of apoptosis. Cells were then harvested, apoptotic cells were identified by terminal deoxynucleotidyltransferase-mediated UTP end labeling (TUNEL) assay (22, 23), and expression of the E4orf6 protein was detected by immunofluorescence using the E4orf6-specific RSA3 antibody and Texas red-coupled donkey anti-mouse IgG. Transformation Assay. Primary Fischer baby rat kidney cells were prepared as described (17). Cells were transfected by the calcium phosphate technique (24) and maintained in medium with 5% fetal calf serum. Transformed cultures were stained with Giemsa stain, and foci that were 4 mm or greater in diameter were counted at 30 days after transfection. Three independent experiments were performed for each plasmid combination. Five pCMVE1A/pCMVE4orf6 transformants, five pXhoC/MMTVE4orf6 transformants, and five pXhoC/ CMVE4orf6 transformants were cloned and maintained as continuous cell lines. Selection of 293 Cell Lines Expressing E4orf6 Protein. The 293 human embryonic kidney cell line expresses the adenovirus E1A and E1B genes (25). The 293 cells were transfected with pMMTVE4orf6 and pMMTVE2A together with the pBabePuro puromycin-resistance marker (26) by the calcium phosphate technique. Clones were selected and maintained in medium containing 10% delipidated calf serum plus puromycin at 1 µg/ml. Protein Analysis. For analysis of proteins by immunoprecipitation followed by Western blotting, cells were lysed in RIPA buffer (50 mM Tris·HCl, pH 7.4/150 mM NaCl/1% Triton X-100/0.1% SDS/1% sodium deoxycholate) and normalized for protein concentration, and specific proteins were immunoprecipitated with RSA3 (E4orf6-specific monoclonal antibody, ref. 27), 421 (p53-specific monoclonal antibody, ref. 28), or 2A6 (E1B 55-kDa-specific monoclonal antibody, ref. 29). The immunoprecipitates were subjected to electrophoresis in an SDS-containing polyacrylamide gel, and proteins were transferred to an Immobilon membrane (Millipore), which was then incubated with E4orf6- or p53specific monoclonal antibody. Reactive protein species were detected by enhanced chemiluminescence (ECL; Amersham). To assay proteins by immunofluorescence, cells were grown on coverslips. The coverslips were washed in phosphate-buffered saline and fixed in 100% methanol. The fixed calls were then incubated with an E4orf6-, E1B 55-kDa-, or p53-specific antibody followed by reaction with a secondary antibody conjugated with either fluorescein isothiocyanate (FITC) or tetramethylrhodamine B isothiocyanate (TRITC) and were examined with a confocal microscope. The half-life of p53 in transformed baby rat kidney cells was determined by pulse-chase analysis (30). PCR Amplification of cDNAs. Total cell RNA was prepared from transformed baby rat kidney cells, treated with RNase-free DNase I (1 unit/µg of RNA) (GIBCO/BRL), and subjected to reverse transcription with Superscript II polymerase (GIBCO/BRL) using a 3
-E4orf6specific primer (P3, 5
-AATCCCACACTGCAGGGA-3
). The cDNA was then amplified with KlenTaq DNA polymerase (CLONTECH) in a PCR using P3 primer and a 5
-E4orf6-specific primer (P2, 5
-CGGCGCACTCCGTACAGT-3
). To control for the presence of DNA that might have survived treatment of the RNA preparations with DNase I, a second amplification was performed on each sample with a primer from the promoter region of the plasmid used to express the E4orf6 mRNA (P1, 5
-CGGTAGGCGTGTACG-3
) and the P3 primer. Tumor Induction. Transformed cells were injected subcutaneously into 6- to 8-week-old female Swiss 3T3 nude mice (Taconic Laboratories) and assayed by palpation until a tumor was detected. Animals that did not develop a tumor were sacrificed on day 110.

RESULTS The Adenovirus E4orf6 Protein Blocks p53-Induced Apoptosis. Since the adenovirus E4orf6 protein can bind to p53 and block its ability to activate transcription (13), we tested whether the E4orf6 protein could prevent apoptosis induced by p53. We employed AT6 cells for the assay. These cells lack an endogenous p53 gene and harbor an ectopic temperature-sensitive p53 allele (21). They grow normally when maintained at the nonpermissive temperature but undergo apoptosis when p53 function is restored by shifting to the permissive temperature. AT6 cells were transfected with a plasmid expressing the E4orf6 gene under control of the cytomegalovirus immediate early promoter; 24 hr later the cultures were shifted to the permissive temperature, and the cultures were assayed for apoptosis after incubation for 72 hr at 32°C. Transfected cells expressing the E4orf6 protein were identified by immunofluorescence using an E4-specific monoclonal antibody, and apoptotic cells were identified by using the TUNEL assay (22, 23). In this assay, chromatin is treated in situ with terminal deoxynucleotidyltransferase to label 3
-OH ends of DNA with biotin-dUTP, followed by reaction with fluorescein-labeled avidin to identify cells with fragmented DNA. In the confocal micrograph displayed in Fig. 1A, E4orf6-specific immunofluorescence is represented by the red signal and DNA fragmentation is monitored with the green signal. The red nuclei from transfected cells expressing the E4orf6 protein display little yellow signal (yellow results from the overlap of green and red signals), whereas the nuclei of cells that do not express the E4orf6 protein display a green signal indicative of DNA fragmentation, a hallmark of apoptosis. Expression of the E4orf6 protein (red signal) and expression of DNA fragmentation (green signal) are mutually exclusive, indicating that the viral protein protects against p53-induced apoptosis in AT6 cells. It is noteworthy that the green apoptotic nuclei in Fig. 1A appear to be much smaller than the red E4orf6-expressing nuclei that were protected from apoptosis. However, examination of cells by phase-contrast microscopy (data not shown) revealed that nuclei undergoing apoptosis had not shrunk to a considerable extent. Rather, the green signal indicative of DNA fragmentation was limited to subdomains within apoptotic nuclei. Presumably the nuclear shrinkage that is characteristic of apoptosis would be observed at later times after the induction of p53. We also tested the ability of the E4or6 protein to protect against the induction of apoptosis in H1299 cells that do not express p53. H1299 cells were transfected with the E4orf6-expressing plasmid, and 24 hr later the cultures were treated for 7 hr with TNF-α (10 ng/ml) and cycloheximide (30 µg/ml) to induce apoptosis. In the confocal micrograph shown in Fig. 1B, the E4orf6 protein is identified by immunofluorescence (red signal) and DNA fragmentation is marked by the TUNEL assay (green signal). In this case, overlapping green and red signals (yellow signal) are evident, indicating that the E4orf6 protein does not protect cells from the induction of p53-independent apoptosis by TNF-α. As noted above, nuclei undergoing apoptosis have not shrunk, and the yellow signal generated by DNA fragmentation was limited to subdomains within the nuclei whose boundaries are demarcated by the E4orf6-specific immunofluorescence (red signal). E4orf6 Cooperates with E1A and E1B to Transform Rat Cells. The E1B proteins cooperate with E1A proteins to transform rodent cells at least in part by blocking apoptosis (7). Since the E4orf6 protein, like E1B proteins, can block p53-mediated apoptosis, we explored the possibility that it might contribute to oncogenesis. Primary baby rat kidney cells were

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

ONCOGENIC POTENTIAL OF THE ADENOVIRUS E4ORF6 PROTEIN

11297

used for transformation assays. In the first assay (Fig. 2A), expression of the E4orf6 gene was controlled by the mouse mammary tumor virus promoter; and in the subsequent four assays (Fig. 2B), E4orf6 expression was controlled by the cytomegalovirus major immediate early promoter. All assays produced the same result. The E4orf6 protein alone was unable to induce the formation of transformed colonies, and the E1A proteins alone produced either no foci (Fig. 2A) or a limited number of foci (Fig. 2B) that were commonly flat in appearance and generally could not be cloned (data not shown). Rare E1A transformants that can be propagated have been shown to contain mutant p53 genes (31) that can cooperate with E1A to transform baby rat kidney cells by blocking the induction of apoptosis by wild-type p53 (7). Transfection with plasmids expressing the E1A plus E4orf6 proteins produced severalfold more colonies than E1A alone. Many of these foci were multilayered, and these cells could be cloned and propagated. E1A/E4orf6 transformants grew somewhat more slowly but were morphologically indistinguishable from E1A/E1B transformants. When assayed by Western blotting, E1A/E4orf6 transformants contained very low to nondetectable levels of E4orf6 protein (Fig. 3A, lanes 1–3), but E4orf6 mRNA was detected in four additional clones of E1A/E4orf6-transformed cells when assayed by reverse transcription followed by PCR amplification (Fig. 3B). Furthermore, the E1A/E4orf6 transformant that was examined contained substantially less p53 than cells transformed with the E1A plus E1B 19-kDa and E1B 55-kDa (E1B19,55) proteins (Fig. 3C, lanes 2 and 3).

FIG. 1. The adenovirus E4orf6 protein prevents p53-dependent apoptosis. An E4orf6 expression plasmid was transfected into H1299 cells (A) or AT6 cells (B). H1299 cells were treated with human TNF-α and AT6 cells were shifted to 32°C to induce apoptosis. Apoptotic cells were detected by assaying DNA fragmentation with the TUNEL assay (green signal), and expression of the E4orf6 protein was detected by indirect immunofluorescence (red signal). The yellow signal marks nuclei that are positive for expression of E4orf6 protein and for DNA fragmentation. (×250.)

FIG. 2. The E4orf6 protein is an oncoprotein. Primary baby rat kidney cells were transfected with plasmids expressing the indicated adenovirus proteins and assayed for the formation of foci 30 days later. Cells receiving both E1B proteins were transfected with a plasmid containing the intact E1B transcription unit controlled by its own promoter, while cells receiving only the E1B 19-kDa or E1B 55-kDa protein received plasmids carrying cDNAs controlled by the cytomegalovirus major immediate early promoter. (A) Two 10-cm plates of cells were assayed for colony formation in response to the indicated adenovirus proteins. Expression of the E4orf6 protein was controlled by the mouse mammary tumor virus promoter, and E1A expression was controlled by the simian virus 40 early promoter. (B) Eight 10-cm plates in four independent experiments were assayed for colony formation. Expression of the E4orf6 and E1A proteins was controlled by the cytomegalovirus major immediate early promoter. (C) Three 10-cm plates of cells were assayed for colony formation. Cells received either the same amount (1xE4) or twice as much E4 as E1B expression vector (2xE4). All expression plasmids contained the cytomegalovirus major immediate early promoter. The E4orf6 protein enhanced transformation by the E1A plus E1B 55-kDa proteins or by E1A plus E1B 19-kDa and E1B 55-kDa (E1B19,55) proteins (Fig. 2). The total number of colonies was increased by a factor of about 1.5 to 2.5; but, more significantly, colonies arose and grew more rapidly. For example, on day 10 after transfection, E1A/E1B 19,55 transformants averaged <0.5 mm in diameter, whereas E1A/ E1B19,55/E4orf6 transformants averaged 1.5 mm in diameter. At 14 days, transformants lacking E4orf6 protein averaged 2.0 mm in diameter and those containing it averaged 3.5 mm in diameter. Further, E4orf6 protein-containing transformants generally produced multilayered colonies that grew markedly

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

ONCOGENIC POTENTIAL OF THE ADENOVIRUS E4ORF6 PROTEIN

11298

taller—i.e., had more layers of cells—than colonies lacking it. E1A/E1B19,55/E4orf6 transformants contained substantial quantities of E4orf6 protein (Fig. 3A, lanes 5–7), considerably more than was found in E1A/E4orf6 transformants (Fig. 3A, lanes 1–3). But, like E1A/E4orf6 transformants, E1A/ E1B19,55/E4orf6 transformants exhibited substantially reduced levels of p53 in comparison with E1A/E1B19,55 transformants (Fig. 3C, lanes 4–8).

FIG. 3. The steady-state level of p53 in E1A/E1B-transformed baby rat kidney cells is substantially reduced when the E4orf6 protein is present. (A) Extracts were prepared from E1A/E4orf6 transformants (lanes 1–3), E1A/E1B19,55/E4orf6 transformants (lanes 5–7), E1A/E1B19,55 transformants (lanes 8 and 9), and adenovirus-infected 293 cells (lane 4). Immunoprecipitations were performed with antibody to E4orf6 protein (RSA3), and E4orf6 protein was detected in immunoprecipitates by Western blot assay using the same antibody. Bands corresponding to the E4orf6 protein, E4orf6/7 protein (which is also recognized by the RSA3 antibody), and the immunoglobulin light chain (IgG) are identified. (B) Total cell RNA was prepared from four E1A/E4orf6 transformants (lanes 2–5) that did not contain detectable amounts of E4orf6 protein and from one E1A/ E1B19,55/E4 transformant (lane 1) that expressed an easily detectable level of the E4orf6 protein. RNA samples were treated with DNase I, and cDNAs were prepared and amplified by PCR using primers that could detect E4-specific RNA (upper gel) or primers that were specific for DNA that might have survived the DNase I treatment (lower gel). (C) Extracts were prepared from baby rat kidney cells (BRK, lane 1), an E1A/E4orf6 transformant (lane 2), E1A/ E1B19,55 transformants (lanes 3, 7, and 8), and E1A/E1B19,55/E4orf6 transformants (lanes 4–6). Immunoprecipitations were performed with antibody to p53 (421), and p53 was detected in immunoprecipitates by Western blot assay using the same antibody. Bands corresponding to the p53 and the immunoglobulin heavy chain (IgG) are identified. Curiously, the E4orf6 protein did not cooperate with the E1A plus E1B 19-kDa proteins in the transformation assay. Rather, the E4orf6 protein somewhat reduced the number of foci produced by E1A plus E1B 19-kDa protein (Fig. 2 B and C). The inhibition was not due to promoter competition, since the total amount of cytomegalovirus major immediate early promoter was held constant by inclusion of a plasmid containing the promoter with no insert in transfections that did not receive the E4orf6 expression plasmid in the experiment displayed in Fig. 2C. The lack of cooperation suggests that the E1B 19-kDa and E4orf6 proteins might function similarly in the transformation assay—i.e., block E1A-induced apoptosis; but the reason for the apparent interference by the E4orf6 protein in the assays receiving E1A and E1B 19-kDa proteins is unclear. Two E1A/E1B19,55 baby rat kidney cell transformants and two E1A/E1B19,55/E4 transformants were tested for their ability to induce tumors in athymic Swiss nude mice (Table 1). Both transformants expressing the E4orf6 protein produced tumors at the site of injection that were detected by palpation on day 28. One of the cell lines lacking the E4orf6 protein produced detectable tumors after an extended delay (84 days), and the other did not generate tumors during the period of observation (110 days). In similar experiments, the tumorigenic potential of a derivative of human 293 cells that contained the adenovirus E1A/E1B19,55/E2A genes was compared with derivatives of 293 cells that also contained the E4orf6 gene (Table 1). As had been reported for 293 cells previously (32), injection of 5×106 cells lacking E4orf6 protein failed to induce tumors during a 110-day period that animals were monitored. In contrast, three independently derived 293 cell lines containing the E4orf6 protein produced tumors at the site of injection. Four solid tumors were subjected to histopathological examination, and as expected, they were composed of poorly differentiated epithelial cells. E4orf6 protein could be detected by Western blot assay in the 293 cell derivatives containing the E4orf6 gene (Fig. 4A, lanes 2 and 3); and, as was found for rat cell transformants, the level of p53 was substantially reduced in cells containing the E4orf6 protein (Fig. 4B). The association of E4orf6 protein with other proteins in these cells was examined by immunoprecipitation from a cell extract using E4orf6-, E1B-55-kDa-, or p53-specific monoclonal antibodies followed by Western

Table 1. Tumor induction in Swiss nude mice Cell line No. of cells Baby rat kidney E1A/E1B#1 2×106 E1A/E1B#2 2×106 E1A/E1B/E4#1 2×106 E1A/E1B/E4#2 2×106 Human 293 E1A/E1B/E2A 5×106 E1A/E1B/E2A/E4#1 5×106 E1A/E1B/E2A/E4#1 2×106 E1A/E1B/E2A/E4#2 2×106 E1A/E1B/E2A/E4#2 1×106 E1A/E1B/E2A/E4#2 3×105 5×106 E1A/E1B/E2A/E4#3

Tumor frequency

Day tumors first detected

5/5 0/2 5/5 3/3

84 — 28 28

0/3 2/2 2/2 2/2 2/2 0/1 2/2

— 21 21 21 28 — 21

Cells were injected subcutaneously. E1B designates the E1B 19-kDa and E1B 55-kDa proteins, and E4 designates the E4orf6 protein. The E4orf6 coding region was expressed under control of the cytomegalovirus immediate early promoter in both baby rat kidney and 293 cell derivatives. Tumors arose at the site of injection, and were generally 2–3 mm in diameter when they were first detected by palpation. Negative animals were sacrificed on day 110.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

ONCOGENIC POTENTIAL OF THE ADENOVIRUS E4ORF6 PROTEIN

11299

blot assay of the immunoprecipitate using an E4orf6-specific antibody (Fig. 4C). The E4 protein was co-immunoprecipitated by the E1B 55kDa-specific antibody, consistent with earlier reports that the two proteins exist in a complex (33). The E4orf6 protein was also coimmunoprecipitated with the p53-specific antibody, as predicted by our earlier work (13). Curiously, while protein immunoprecipitated by the E4orf6-specific antibody migrated as a single band, the protein interacting with the E4orf6 antibody in the Western blot that was coimmunoprecipitated with either the E1B 55-kDa protein or p53 migrated as a doublet (Fig. 4C, lanes 1 and 2). The doublet was consistently seen in multiple experiments; and, while direct immunoprecipitation with E4orf6-specific antibody produced only the slower-migrating component of the doublet (Fig. 4C, lane 3), the faster-migrating band was consistently the major species when assayed by coimmunoprecipitation with p53. Further, the faster-migrating species was the major E4orf6-specific product present in tumor cells (Fig. 4A, lanes 4 and 5), raising the possibility that this species of E4orf6 protein is selected during tumorigenesis. The doublet does not result from differential phosphorylation of the E4orf6 protein (data not shown). As yet we do not understand the basis for the differential migration of the E4orf6 species. Possibly the doublet is produced by proteolysis within the cell extract; alternatively, it could be a variant of the E4orf6 protein that contributes to its oncogenic potential.

FIG. 4. Expression of E4orf6 protein reduces the steady-state level of p53 in 293 cells. (A) Extracts were prepared from 293 cell derivatives containing the E4orf6 gene (lanes 2 and 3), tumors produced in nude mice by E4orf6-containing cells (lanes 4 and 5), and adenovirus-infected 293 cells (lane 6). Immunoprecipitations were performed with antibody to E4orf6 protein (RSA3), and E4orf6 protein was detected in immunoprecipitates by Western blot assay using the same antibody. Bands corresponding to the E4orf6 protein and E4orf6/7 protein (which is also recognized by the RSA3 antibody) are identified. (B) Extracts were prepared from a 293 cell derivative expressing the E4orf6 protein (lane 2) and from a tumor produced in a nude mouse by the E4orf6-expressing cell line (lane 4). Immunoprecipitations were performed with antibody to p53 (421), and p53 was detected in immunoprecipitates by Western blot assay using the same antibody. Bands corresponding to the p53 and the immunoglobulin heavy chain (IgG) are identified. (C) An extract was prepared from a 293 cell derivative expressing the E4orf6 protein. Aliquots of the extract were immunoprecipitated with antibody to the E1B 55-kDa protein (α-E1B 55), antibody to p53 (α-p53), or antibody to the E4orf6 protein (α-E4orf6), and E4orf6 protein was detected in immunoprecipitates by Western blot assay using RSA3 antibody. The Half-Life of p53 and Its Intracellular Location Are Altered in the Presence of the E4orf6 Protein. Normally, wild-type p53 is localized to the nucleus and has a half-life of 15–30 min (30, 34), whereas p53 is excluded from the nucleus in cells transformed by group C adenoviruses, and it is stabilized so that it has a half-life of about 10 hr (35). The stabilization of p53 results from the action of the E1A protein, and it can occur in the absence of the E1B 55-kDa protein when E1A cooperates with the H-ras oncogene to transform cells (6). The relatively low steady-state level of p53 in E1A/ E1B19,55/E4orf6 transformants as compared with E1A/ E1B19,55 transformants (Figs. 3C and 4B) suggested that p53 was not stabilized in the presence of the E4orf6 protein. Therefore, we performed a pulse-chase analysis to compare the halflife of p53 in transformed baby rat kidney cells in the presence and absence of E4orf6 protein (Fig. 5). The half-life of p53 was greater than 2 hr in the absence of E4orf6 protein. In the transformants containing the E4orf6 gene, the cells appeared to contain two pools of p53 with different stabilities. The major p53 species had a half-life of about 5 min, and the minor p53 species had a half-life of greater than 2 hr. In addition to reducing the stability of p53, the E4orf6 protein altered the localization of p53 in transformed cells. In 293 cells lacking the E4orf6 protein, p53 was localized predominantly in discrete, intensely fluorescent, cytoplasmic bodies adjacent to the nucleus (Fig. 6A), as has been described previously for cells transformed by group C adenoviruses (35–37). The dense cytoplasmic bodies are located in close proximity to the centrosome in interphase cells (38). Many p53-containing cytoplasmic bodies were observed in 293 cells (Fig. 6A), and many fewer cytoplasmic bodies were evident in cells containing the E4orf6 protein. In these cells p53 was substantially localized to the nucleus, where it exhibited an uneven, spotty fluorescence (Fig. 6C). However, some cells in

FIG. 5. The E4orf6 protein reduces the half-life of p53 in adenovirus-transformed cells. E1A/E1B-transformed ( ` ) and E1A/ E1B/ E4-transformed ( ` ) baby rat kidney cells were labeled for 60 min with [35S]methionine followed by chase periods, after which immunoprecipitations were performed with the p53-specific monoclonal antibody 421. After electrophoresis, radioactivity in p53-specific bands was quantified using a PhosphorImager. At the start of the chase (time 0), E1A/E1B and E1A/E1B/E4 transformants contained 1.36×106 cpm and 2.66×106 cpm, respectively, in p53-specific bands.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

ONCOGENIC POTENTIAL OF THE ADENOVIRUS E4ORF6 PROTEIN

11300

clonal populations of transformed cells containing the E4orf6 gene continued to exhibit cytoplasmic bodies containing p53, and we believe this is due to the fact that not all cells in these cultures express the E4orf6 protein at a high level (Fig. 6G). This could also explain the two populations of p53 observed in the half-life analysis (Fig. 5). The p53 with the short half-life could reside in cells with a high level of E4orf6 protein, whereas the long-lived p53 could be located in cells with less E4orf6 protein. We do not yet know the reason why individual cells in clonal populations appear to accumulate quite different amounts of nuclear E4orf6 protein. The E1B 55-kDa protein, which binds to p53, exhibited the same change in localization within 293 cells—i.e., it moved from the cytoplasmic body in the absence of E4orf6 protein to the nucleus in its presence (data not shown).

FIG. 6. The E4orf6 protein alters the location of p53 in 293 cells. E1A/E1B/E2A-containing 293 cells (A, B, E, and F) were compared with E1A/E1B/E2A/E4-containing 293 cells (C, D, G, and H). These cell lines were tested for tumorigenicity, and the results are shown in Table 1, where the E4orf6-containing cells are designated cell line #1. Indirect immunofluorescent staining with the monoclonal antibody 421 identified p53 (A and C) and E4orf6 protein was localized with the monoclonal antibody RSA3 (E and G). A fluorescent, nucleic acid-binding dye (Yo-yo) was used to counterstain nuclei (B, D, F, and H) that are examined by immunofluorescence. (×600.) DISCUSSION Our experiments demonstrate that the adenovirus E4orf6 protein has oncogenic potential. It can cooperate with the adenovirus E1A protein to transform baby rat kidney cells, and it can enhance transformation by the E1A protein plus E1B proteins (Fig. 2). Dobner and colleagues (M.Nevels, S. Rubenwolf, H.Schuett, T.Sprussl, H.Wolf, and T.Dobner, personal communication) have observed similar effects of the E4orf6 protein in transformation experiments. Further, the E4orf6 protein can accelerate tumor formation when transformed baby rat kidney cells are injected subcutaneously into the nude mouse, and it converts human 293 cells from nontumorigenic to tumorigenic in nude mice (Table 1). A role for the E4orf6 protein in oncogenesis was missed in early studies with group C adenoviruses that identified the E1A and E1B genes as the viral oncogenes. Although several early studies described the presence of E4-specific mRNAs in addition to the E1A and E1B species in adenovirus-transformed rat and hamster cells (e.g., refs. 39–41; reviewed in ref. 42), a role for E4 in transformation was discounted because it was not always present in cells transformed by adenovirus types 2 and 5 and because cloned E1A and E1B genes were sufficient for transformation. Our results indicate that, although it is not essential for transformation by adenovirus, the E4orf6 protein contributes to the transformed phenotype of a cell when it is present. Since the E4orf6 protein can cooperate with E1A proteins to transform cells (Fig. 2), one might ask why E1A/E4orf6 transformants, lacking an E1B gene, are not obtained when rodent cells are transformed by adenoviruses. The relative locations of the E1A, E1B, and E4 genes on the viral chromosome might favor retention of the adjacent E1A and E1B genes and loss of the E4 gene, which resides at the other end of the linear adenovirus chromosome. There is evidence suggesting that the viral genome is circularized during lytic replication (43), and circularization or oligomerization of the viral chromosome by recombination prior to integration could link the E1A gene as tightly to the E4orf6 as to the E1B gene. Nevertheless, it remains possible that the relative positions of the three oncogenes on the viral chromosome favor retention of the E1A and E1B genes. Alternatively, the E1A proteins might cooperate more efficiently with E1B proteins than with the E4orf6 protein in transformation assays. E1A/E4orf6 transformants produced smaller colonies than E1A/E1B transformants; and, when they were cloned, E1A/E4orf6-transformed rat cells initially grew more slowly than E1A/ E1B-transformed rat cells. With continued passage, both gene combinations produced cell lines with similar growth characteristics, but the cells with the E1A plus E4orf6 genes have presumably undergone selection for mutations in cellular genes that result in more rapid growth. The initially slow growth of E1A/E4orf6 transformants and the potential to more efficiently coselect E1A and E1B genes probably explain why E1A/E1B transformants, rather than E1A/E4orf6 transformants, are routinely isolated after infection of rodent cells. The E4orf6 protein very likely cooperates with the E1A proteins to transform cells through its ability to bind p53 and alter its function (13). The E4orf6 protein blocks the ability of p53 to activate transcription, at least in part by interfering with its ability to bind to the TAFII31 subunit of transcription factor TFIID, and the physical interaction is presumably also responsible for the ability of the E4orf6 protein to block p53-mediated apoptosis (Fig. 1). The ability to block transcriptional activation and apoptosis mediated by p53 can explain how the E4orf6 protein, like the E1B proteins, cooperates with the E1A protein to transform cells. However, since the E1B proteins and the E4orf6 protein appear to function similarly, antagonizing the activity of p53, it is not clear why the E4orf6 protein enhances transformation by E1A plus E1B (Fig. 2) or why it influences tumorigenesis in nude mice (Table 1). Perhaps the E1B proteins do not completely neutralize the activity of p53, and the enhancing effects of the E4orf6 protein result from its ability to dramatically lower the level of p53 in comparison with the levels present in E1A/E1B transformants (Figs. 3 and 4), an effect that is consistent with the earlier observation that p53 levels are enhanced when cells are infected with a mutant adenovirus that is unable to produce the E4orf6 protein (44). As yet, we do not know how the E4orf6 protein influences p53 levels. The protein might displace E1B from p53, but p53 levels appear to be regulated by

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

ONCOGENIC POTENTIAL OF THE ADENOVIRUS E4ORF6 PROTEIN

11301

the E1A protein and not the association of p53 with the E1B 55-kDa protein (6). Since the E1B and E4orf6 proteins bind at different sites on p53, the E1B 55-kDa and the E4orf6 proteins might interact simultaneously with the residual low level of p53 that accumulates in the presence of the E4orf6 protein. The combination of adenovirus proteins might more completely inactivate p53 than either viral gene product alone. It is also possible that the altered localization of p53 in the presence of E4orf6 (Fig. 6) modifies the oncogenic properties of adenovirus-transformed cells. It has been shown that E1A/E1B-transformed 3Y1 rat cells containing a low steady-state level of the E1B 55-kDa protein form tumors more rapidly in nude mice than transformants with high levels of the transforming protein (36). 3Y1 transformants with relatively low levels of the E1B 55-kDa protein do not accumulate p53 in cytoplasmic bodies; rather, they contain nuclear p53 (36), just as we have observed for transformants containing the E4orf6 protein (Fig. 6). It seems contradictory that the E4orf6 protein can cooperate with the E1A protein to transform cells (Fig. 2), presumably by blocking E1Ainduced apoptosis (Fig. 1), while cells infected with mutant viruses lacking only the E1B 19-kDa protein undergo extensive apoptosis (45–47). The mutant viruses contain wild-type E4 genes and should express the E4orf6 protein in the cells undergoing apoptosis. However, the E1A protein has been shown to induce apoptosis through a p53-independent pathway (48, 49) in addition to the p53-dependent pathway. The p53independent apoptosis might be induced indirectly by the E1A protein; that is, it might be caused by another adenovirus gene product whose expression is activated by the E1A protein. The E1B 19-kDa protein can block both p53-dependent and p53-independent apoptosis induced by the E1A protein. In contrast, the E4orf6 protein can prevent p53-induced apoptosis, but not apoptosis mediated by TNF-α in the absence of p53 (Fig. 1). So, if the p53-independent apoptosis seen in infected cells is due to a viral protein whose expression is induced by E1A protein, then one can propose an explanation for the inability of the E4orf6 protein to prevent apoptosis in virus-infected cells. Presumably, the E4orf6 protein antagonizes p53-dependent apoptosis induced directly by E1A, but it does not prevent p53-independent apoptosis induced indirectly by the E1A protein when it activates another apoptosis-promoting viral gene in adenovirus-infected cells. Many adenovirus vectors that are being considered for gene delivery in humans contain the E4orf6 coding region. Given the ability of this protein to alter p53 function (13) and its oncogenic potential demonstrated here, it would be prudent to remove this coding region from gene transfer vectors. We thank D.A.Haber for AT6 cells, A.Teresky for instruction and help in mouse injections, J.Goodhouse and H.Zhu for assistance with confocal microscopy, and Y.Shen for helpful discussions on transformation assays. This work was supported by grants from the National Cancer Institute (CA41086) and the Cystic Fibrosis Foundation (Z998). T.S. is an American Cancer Society Professor and an Investigator of the Howard Hughes Medical Institute. 1. Nevins, J.R. & Vogt, P.K. (1996) in Fields Virology, eds. Fields, B.N., Knipe, D.M. & Howley, P.M. (Lippincott-Raven, New York), pp. 310–343. 2. Shenk, T. (1996) in Fields Virology, eds. Fields, B.N., Knipe, D.M. & Howley, P.M. (Lippincott-Raven, New York), pp. 2111–2148. 3. Whyte, P.Buchkovich, K.J., Horowitz, J.M., Friend, S.H., Raybuck, M., Weinberg, R.A. & Harlow, E. (1988) Nature (London) 334, 124–129. 4. Bagchi, S., Raychaudhuri, P. & Nevins, J.R. (1990) Cell 62, 659–669. 5. Nevins, J.R. (1992) Science 258, 424–429. 6. Lowe, S.W. & Ruley, H.E. (1993) Genes Dev. 7, 535–545. 7. Debbas, M. & White, E. (1993) Genes Dev. 7, 546–554. 8. Sarnow, P., Ho, Y.-S., Williams, J. & Levine, A.J. (1982) Cell 28, 387–394. 9. Yew, P.R. & Berk, A.J. (1992) Nature (London) 357, 82–85. 10. Yew, P.R., Liu, X. & Berk, A.J. (1994) Genes Dev. 8, 190–202. 11. Chiou, S.-K., Tseng, C.-C., Rao, L. & White, E. (1994) J. Virol. 68, 6553–6566. 12. Rao, L., Debbas, M., Sabbatini, P., Hockenbery, D., Korsmeyer, S. & White, E. (1992) Proc. Natl. Acad. Sci. USA 89, 7742–7746. 13. Dobner, T., Horikoshi, N., Rubenwolf, S. & Shenk, T. (1996) Science 272, 1470–1473. 14. Lu, H. & Levine, A.J. (1995) Proc. Natl. Acad. Sci. USA 92, 5154–5158. 15. Thut, C.J., Chen, J.-L., Klemm, R. & Tjian, R. (1995) Science 267, 100–104. 16. Horikoshi, N., Usheva, A., Chen, J., Levine, A.J., Weinmann, R. & Shenk, T. (1995) Mol. Cell. Biol. 15, 227–234. 17. White, E. & Cipriani, R. (1990) Mol. Cell. Biol. 10, 120–130. 18. Findlay, C.A., Hinds, P.W. & Levine, A.J. (1989) Cell 57, 1083–1093. 19. Logan, J., Pilder, S. & Shenk, T. (1984) Cancer Cells 2, 527–532. 20. Brower, M., Carney, D.N., Oie, H.K., Gazdar, A.F. & Minna, J.D. (1986) Cancer Res. 46, 798–806. 21. Maheswaran, S., Englert, C., Bennett, P., Heinrich, G. & Haber, D.A. (1995) Genes Dev. 9, 2143–2156. 22. Gavrieli, Y., Sherman, Y. & Ben-Sasson, S.A. (1993) J. Cell Biol. 119, 493–501. 23. Zhu, H., Shen, Y. & Shenk, T. (1995) J. Virol. 69, 7960–7970. 24. Wigler, M., Pellicer, A., Silverstein, S., Axel, R., Urlaub, G. & Chasin, L. (1979) Proc. Natl. Acad. Sci. USA 76, 1373–1376. 25. Graham, F.L., Smiley, J., Russel, W.C. & Nairn, R. (1977) J. Gen. Virol. 36, 59–72. 26. Morgenstern, J.P. & Land, H. (1990) Nucleic Acids Res. 18, 3587–3596. 27. Ornelles, D.A. & Shenk, T. (1991) J. Virol. 65, 424–439. 28. Harlow, E., Pim, D.C. & Crawford, L.V. (1981) J. Virol. 37, 564–573. 29. Sarnow, P., Sullivan, C.A. & Levine, A.J. (1982) Virology 120, 510–517. 30. Oren, M., Maltzman, W. & Levine, A.J. (1981) Mol. Cell. Biol. 1, 101–110. 31. White, E. (1993) Genes Dev. 7, 2277–2284. 32. Gallimore, P.H., McDougall, J.K. & Chen, L.B. (1977) Cell 10, 669–678. 33. Sarnow, P., Hearing, P., Anderson, C.W., Halbert, D.N., Shenk, T. & Levine, A.J. (1984) J. Virol. 49, 692–700. 34. Reich, N.C., Oren, M. & Levine, A.J. (1983) Mol. Cell. Biol. 3, 2143–2150. 35. Zantema, A., Schrier, P.I., Davis-Olivier, A., van Laar, T., Vaessen, R.T.M.J. & van der Eb, A.J. (1985) Mol. Cell. Biol. 5, 3084–3091. 36. van den Heuvel, S.J.L., van Laar, T., Kast, W.M., Melief, C.J. M., Zantema, A. & van der Eb, A.J. (1990) EMBO J. 9, 2621–2629. 37. Zajdel, M.E.B. & Blair, G.E. (1988) Oncogene 2, 579–584. 38. Brown, C.R., Doxsey, S.J., White, E. & Welch, W.J. (1994) J. Cell. Physiol. 160, 47–60. 39. Esche, H. (1982) J. Virol. 41, 1076–1082. 40. Flint, S.J., Gallimore, P.H. & Sharp, P.A. (1975) J. Mol. Biol. 96, 47–68. 41. Flint, S.J. & Sharp, P.A. (1976) J. Mol. Biol. 106, 749–771. 42. Flint, S.J. (1980) in DNA Tumor Viruses, ed. Tooze, J. (Cold Spring Harbor Lab. Press, Plainview, NY), pp. 547–575. 43. Weiden, M.D. & Ginsberg, H.S. (1994) Proc. Natl. Acad. Sci. USA 91, 153–157. 44. Grand, R.J., Grant, M.L. & Gallimore, P.H. (1994) Virology 203, 229–240. 45. Pilder, S., Logan, J. & Shenk, T. (1984) J. Virol. 52, 664–671. 46. Subramanian, T., Kuppuswamy, M., Gysbers, J., Mak, S. & Chinnadurai, G. (1984) J. Biol. Chem. 259, 11777–11783. 47. White, E., Grodzicker, T. & Stillman, B.W. (1984) J. Virol. 52, 410–419.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

ADENOVIRUS-MEDIATED INTERLEUKIN-12 GENE THERAPY FOR METASTATIC COLON CARCINOMA

11302

48. Subramanian, T., Tarodi, B. & Chinnadurai, G. (1995) Cell Growth Diff. 6, 131–137. 49. Teodoro, J.G., Shore, G.C. & Branton, P.E. (1995) Oncogene 11, 467–474.

This paper was presented at a colloquium entitled “Genetic Engineering of Viruses and Virus Vectors,” organized by Bernard Roizman and Peter Palese (Co-chairs), held June 9–11, 1996, at the National Academy of Sciences in Irvine, CA.

Adenovirus-mediated interleukin-12 gene therapy for metastatic colon carcinoma (gene transfer/cytokines/recombinant adenoviral vectors) MANUEL CARUSO*†, KHIEM PHAM-NGUYEN*, YOK-LAM KWONG*, BISONG XU*, KEN-ICHIRO KOSAI‡, MILTON FINEGOLD‡, SAVIO L.C. WOO*†, AND SHU-HSIA CHEN*§ Departments of *Cell Biology and ‡Pathology, †Howard Hughes Medical Institute, Baylor College of Medicine, Houston, TX 77030 ABSTRACT Recombinant adenoviral mediated delivery of suicide and cytokine genes has been investigated as a treatment for hepatic metastases of colon carcinoma in mice. Liver tumors were established by intrahepatic implantation of a poorly immunogenic colon carcinoma cell line (MCA-26), which is syngeneic in BALB/c mice. Intratumoral transfer of the herpes simplex virus type 1 thymidine kinase (HSV-tk) and the murine interleukin (mIL)-2 genes resulted in substantial hepatic tumor regression, induced an effective systemic antitumoral immunity in the host and prolonged the median survival time of the treated animals from 22 to 35 days. The antitumoral immunity declined gradually, which led to tumor recurrence over time. A recombinant adenovirus expressing the mIL-12 gene was constructed and tested in the MCA-26 tumor model. Intratumoral administration of this cytokine vector alone increased significantly survival time of the animals with 25% of the treated animals still living over 70 days. These data indicate that local expression of IL-12 may also be an attractive treatment strategy for metastatic colon carcinoma. Metastatic colon carcinoma is the second leading cause of death from malignancy in the United States. Eighty percent of the patients who die of colon cancer have metastases in the liver (1). Once hepatic metastases occur, surgery and chemotherapy are the only currently available treatment modalities, and the mean survival time is only 37 months (2). Therefore, the development of alternative treatments for metastases of colon cancer is needed to improve the clinical outcome of patients. Cancer immunotherapy is an approach that has been widely investigated in different types of tumor, the goal of which is to stimulate host immune response against the cancer cells. Because of its well established immunomodulating activities in stimulating the growth and the activation of T cells as well as natural killer (NK) cells, recombinant interleukin (IL)-2 was first tested in patients for this purpose. A severe limitation of such treatment in patients is the toxicity associated with high doses of systemic recombinant IL-2 administration. Cytokine secretion in the vicinity of the tumor can potentially minimize the toxicity associated with systemic cytokine administration, which could be achieved by the transfer and expression of various cytokine genes directly in the tumor cells (3). In the ex vivo gene therapy or “cancer vaccine” approach, cancer cells are isolated from patients, transduced with various gene vectors and expanded in vitro. After irradiation, the cells are transplanted autologously to enhance the patient’s immune response against the tumor. This strategy is not only laborious, but the treatment is also individualized as cancer cells need to be cultured and expanded from each patient for therapeutic purposes. A more attractive strategy is to deliver the cytokine genes in vivo. The retroviral vector is commonly used for the ex vivo approach, but its low titer limits its application by in vivo delivery. The recombinant adenoviral vector is characterized by high titers and is capable of efficient gene transfer into a variety of cell types in vivo. The use of recombinant adenoviral vectors in immunotherapy of metastatic colon carcinoma is reported.

MATERIALS AND METHODS Cell Culture. MCA-26 cells, a chemically induced colon carcinoma line derived from BALB/c mouse (4), was grown and maintained in high glucose MEM/HAMF12. The 293 cells (adenoviral E1-transformed human embryonic kidney) (5) were maintained in DMEM. All cell lines were supplemented with 10% fetal calf serum (GIBCO), 2 mM glutamine, 100 unit/ml penicillin, and 100 mg/ml streptomycin. Recombinant Adenoviral Vectors. Construction of replication-defective adenoviral vectors containing the tk and murine (m)IL-2 gene under the transcriptional control of the Rous sarcoma virus long terminal repeat (ADV/tk and ADV/mIL-2) has been reported previously. A replication-defective adenoviral vector containing the mIL-12 cDNA under the transcriptional control of the Rous sarcoma virus long terminal repeat promoter (ADV/mIL-12) was constructed and plaque purified as followed. The cDNA from both mIL-12 subunits were cloned by RTPCR from total RNA obtained from pockweed mitogen stimulated mouse splenocytes. To ensure correct nucleotide sequence, the entire cDNA was subsequently sequenced. The two cDNA were then linked to the encephalomyocarditis virus internal ribosome entry site that was obtained from the pCITE-1 vector (Novagen). The fragment p40-internal ribosome entry site-p35 was inserted into the E1 deleted adenovirus backbone pAd.1/Rous sarcoma virus (6). The recombinant adenovirus, ADV/mIL-12, was generated by cotransfection with pBHG10 (7) into 293 cells. The viral titer [plaque-forming units (pfu)/ml] was determined by plaque assay in 293 cells (8). Functional Analysis of ADV/mIL-12. One million MCA-26 seeded in a six-well plate were infected with an ADV/mIL-12

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact. Abbreviations: IL, interleukin; m, murine; IFN, interferon; NK, natural killer; HSV-tk, herpes simplex virus type 1 thymidine kinase; CTL, cytotoxic T-lymphocyte; m.o.i., multiplicity of infection; pfu, plaque-forming unit. §To whom reprint requests should be addressed.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

ADENOVIRUS-MEDIATED INTERLEUKIN-12 GENE THERAPY FOR METASTATIC COLON CARCINOMA

11303

or a control adenovirus ADV/β-galactosidase at different multiplicity of infection (m.o.i.) in a total volume of 0.5 ml. After 2 hr, the viral supernatant was replaced with 2.5 ml of medium. Then, two days after, the supernatant was collected and tested for mIL-12 bioactivity. One ml of supernatant was added to 106 splenocytes from naive mice in a total volume of 2 ml. After 48 hr the supernatant was collected and analyzed for interferon (IFN)-γ release by ELISA (Endogen, Cambridge, MA). Establishment and Treatment of Hepatic Metastasis Model of Colon Carcinoma. Metastatic colon carcinoma was induced in the liver by intrahepatic implantation of 5×104 MCA-26 cells at the tip of the left lateral liver lobe of 8- to 12-week-old syngeneic BALB/mice (HarlanSprague-Dawley). At day 7, various titers of recombinant adenoviral vectors were injected intratumorally in 50 µl of 10 mM Tris·HCL (pH 7.4)/1 mM MgCl2/10% (vol/vol) glycerol/Polybrene (20 µg/ml). All experiments were performed in accordance with the animal guidelines at Baylor College of Medicine. Cytotoxic T-Lymphocyte (CTL) Assay. Viable splenocytes were isolated from various animal treatment groups at different time points after primary hepatic tumor inoculation. In vitro stimulation was performed for 5 days in 24-well plates, each well containing 6×106 splenocytes, recombinant mIL-2 (20 units/ml) and 5×105 MCA-26 cells that had received 15,000 rad (150 Gy) of radiation. Effector cells were co-incubated with Cr51 (150 µCi for 5×106) labeled target cells for 4 hr at 37°C in different effector and target cell ratios. Parental MCA-26 cells were used as target cells for the CTL assay. After incubation, the radioactivity of 100 µl of the supernatant was counted in a gamma counter. The percentage of specific cytolysis was calculated as (experimental release— spontaneous release)/(maximum release—spontaneous release)×100. Total radioactivity present in target cells was analyzed by lysing the cells with 10% SDS. Data represent the mean of triplicate cultures and were analyzed by logistic regression. Morphological and Histopathological Analyses of Hepatic Tumors. Fourteen days after various gene therapy treatments, the animals were sacrificed and tumor volume was calculated according to the formula V=A×B2 (A=largest diameter; B=smallest diameter). For histopathological analysis, livers from euthanized animals of various treatment groups were collected and cut in the middle at the site of the original tumor inoculation. The tissue was then fixed in 10% buffered formalin and stained with hematoxylin and eosin for histopathological analysis. Long-Term Survival Analyses. The tumor-bearing animals were treated with various recombinant vectors and kept for observation. Days of death were recorded and the results were analyzed statistically using a logrank test (9).

RESULTS Suicide Gene Therapy for Liver Metastases of Colon Cancer. The gene encoding herpes simplex virus type 1 thymidine kinase (HSVtk) is the most widely investigated suicide gene for cancer therapy. Unlike the mammalian thymidine kinases, HSV-tk efficiently phosphorylates nucleosidic analogs such as acyclovir or ganciclovir (10). The monophosphate form is subsequently converted into the di- and triphosphate forms by cellular kinases. The triphosphate is the toxic form of the nucleosidic analog, as it can be incorporated into elongating DNA in the dividing cells that results in cell death (11–13). This suicide gene therapy strategy for the treatment of hepatic metastases of colon cancer was investigated in rodent models. The regression of pre-established liver metastases after intratumoral injection of retrovirus-producer cells expressing HSV-tk followed by ganciclovir treatment has been reported (14). Infection of cancer cells after intratumoral injection of retroviral supernatant is low (15), although the grafting of virus producer-cells led to the transduction of up to 10% of the cells inside the tumor (14–16). To overcome the low in vivo transduction efficiency of the retrovirus, recombinant adenoviral vectors have been used to transfer the HSVtk gene into tumor cells. This approach, evaluated in mice, was very efficient in mediating the regression of a variety of tumors (17–20). In a mouse liver metastasis model of colon carcinoma, better than 80% of tumor regression was achieved after the suicide gene treatment (18). However, such extensive tumor destruction was not sufficient to yield significant survival benefit as compared with control vector treated mice (Fig. 1). Relapse of the hepatic tumors or the presence of disseminated metastases in other organs accounted for this lack of extended survival. Combination Suicide and IL-2 Gene Therapy for Hepatic Metastases of Colon Carcinoma. Adenoviral mediated gene transfer of mIL-2 into the tumor was synergistical with HSV-tk and induced a systemic antitumor immunity that resulted in the further regression of the hepatic tumor as well as protection against distant site challenges of parental tumor cells (18). The antitumor immunity was attributed partly to the activation and proliferation of tumor specific CD8+ cytotoxic T lymphocytes. Animals treated with ADV/tk and ADV/mIL-2 lived significantly longer than those treated with ADV/tk or ADV/mIL-2 alone (Fig. 1). The control animals died between day 15 and day 30, while 60% of the animals were still alive at day 35 after combination treatment. The mean survival time has been increased from 22 days in the control-treated animals to 35 days in animals treated with both the HSV-tk and the mIL-2 vectors, and the results are statistically significant (P<0.03). In this model, ADV/mIL-2 treatment alone did not improve the long-term survival of the animal, as it did not cause regression of the hepatic tumors (10). After combination gene treatment, the antitumor immunity in the animals waned gradually over time (Fig. 2), resulting in the death of the animals due to tumor, recurrence in the liver and at distant sites. The antitumoral effect in the animals after combination treatment was mediated by a CTL response that could no longer be detected at day 38 (Fig. 2). To achieve long-term

FIG. 1. Long-term survival of animals after the combination treatment. ADV/mIL-2+ADV/tk. Seven days after intrahepatic cancer cells injection, the tumor -bearing animals were divided into four treatment groups: ` ) ADV/β-galactosidase (5×108 pfu), n=4; ( ` ) ADV/mIL-2 (3×108 pfu), n=4; (∆) ADV/tk (5×108 pfu), n= 5; and () ADV/tk (5×108 pfu)+ADV/mIL-2 (3×108 pfu), n= 5. All the animals received ganciclovir treatment 12 hr after virus injection and were observed for survival over time, (logrank test, P< 0.03).

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

ADENOVIRUS-MEDIATED INTERLEUKIN-12 GENE THERAPY FOR METASTATIC COLON CARCINOMA

11304

protection against tumor recurrence and metastases, it is imperative for the protective immunity to be maintained. Therefore, identification of other cytokines that can enhance and prolong antitumor immunity is critically important to improve the efficacy of this therapeutic approach.

FIG. 2. Cellular immune response in animals after ADV/tk (5× 108 pfu) ( ` ) or ADV/tk (5×108 pfu)+ADV/mIL-2 (3×108 pfu) () treatments as measured by CTL assay. The splenocytes were isolated from various treatment groups at days 17, 24, 31, and 38 after tumor cell inoculation. The percentage of cell lysis is represented by the average lysis of splenocytes from four animals±SD. IL-12 Mediated Gene Therapy of Metastatic Colon Carcinoma. IL-12 is known to enhance the cytolytic activity of a number of immune effector cells including NK cells, lymphokine-activated killer cells, T cells and macrophages (21–24). It also stimulates the proliferation of activated NK and T cells (21, 23, 25). IL-12 is mainly produced by antigen-presenting cells (26) such as monocytes and macrophages, B cells, and dendritic cells (27) and it promotes cellular immune response by facilitating the proliferation and activation of TH1 cells (28). The antitumor activity of IL-12 is mainly mediated by IFN-γ produced by T cells and NK cells (29–31) and it has also been shown to inhibit angiogenesis through the IFN-inducible protein 10 (32, 33). IL-12 is a heterodimeric 70-kDa (p70) cytokine composed of two subunits of 40 kDa (p40) and 35 kDa (p35), and the association of both subunits is required for full biologic activity of the cytokine. To coexpress the two subunits in the same adenoviral vector, the two cDNAs were linked by the internal ribosome entry site element of the encephalomyocarditis virus and inserted into the E1 region of the adenoviral vector. Recombinant adenovirus was generated by the cotransfection into 293 cells with the plasmid harboring the bicistronic mIL-12 gene and pBHG10 (7), and individual plaques were expanded in 293 cells (8). To demonstrate the functionality of ADV/mIL-12, the colon cancer cell line MCA-26 was transduced at different m.o.i., and the supernatants were incubated with splenocytes from naive BALB/c mice to induce the release of IFN-γ. As shown by ELISA (Fig. 3), a strong IFN-γ production by the transduced cells was observed after ADV/ mIL-12 transduction, and the concentrations ranged from 7.9 ng/ml at 200 m.o.i. to 21.7 ng/ml at 1000 m.o.i. The antitumoral properties of ADV/mIL-12 were assessed in the colon carcinoma MCA-26 model. Tumors were generated in the liver as described above, and animals with tumor sizes of 4×4 to 5×5 mm2 were selected for subsequent experimentation. One animal group received intratumoral injection of ADV/mIL-12 at 5×108 pfu and another group was treated with 5×108 pfu of a control adenovirus ADV/DL312. Two weeks after viral inoculation, animals were sacrificed and liver tumors were harvested for macroscopic and microscopic analysis (Fig. 4). The mean tumor volume in the control group was 910±134 mm3 (mean±SD). In the mIL-12 vector treated group, the mean tumor volume was substantially reduced to 205±107 mm3 (mean±SD). Upon histopathological examinations, the animals that were treated with ADV/DL312 had large nodules of actively growing undifferentiated carcinoma cells (Fig. 5A). Very few or no cancer cells remained in the animals treated with ADV/mIL-12 (Fig. 5B). The tumors were replaced by fibrosis associated with a strong inflammatory response. The infiltrating cells appeared to be predominantly lymphocytes with some macrophages and neutrophils.

FIG. 3. In vitro characterization of ADV/mIL-12. Supernatants from ADV/mIL-12 ( ` ) or ADV/β-galactosidase () MCA-26 cells infected at different m.o.i. were harvested and cocultured with splenocytes to induce the release of IFN-γ. The IFN-γ production was quantitated by ELISA. To assess the treatment outcome, animals treated with ADV/mIL-12 were studied for their long-term survival (Fig. 6). Control animals treated with buffer or with ADV/DL312 died between day 25 and day 38 after tumor cell inoculation. The animals treated with ADV/mIL-12 survived significantly longer with 25% of the animals (3 out of 12) still alive after 70 days. The survival time of the animals was increased by mIL-12

FIG. 4. Tumor volume analysis after intratumoral injection of ADV/mIL-12. Seven days after intrahepatic cancer cell injection, the tumor-bearing animals were divided into two treatment groups: ADV/DL312 (5×108 pfu); n=4 and ADV/ mIL-12 (5×108 pfu); n=7. Animals were sacrificed 2 weeks after adenoviral injection for tumor volume measurement (ANOVA test, P<0.0001).

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

ADENOVIRUS-MEDIATED INTERLEUKIN-12 GENE THERAPY FOR METASTATIC COLON CARCINOMA

11305

vector treatment alone, which is statistically significant (P< 0.0001).

FIG. 5. Histopathological analysis of hepatic tumors after ADV/ mIL-12 treatment. (A) Section of a tumor from a control mouse injected with buffer. Undifferentiated cancer cells are dividing actively and infiltrate the liver without any inflammatory response. (B) Section of a tumor from a treated mouse injected with ADV/mIL-12 (5×108 pfu). No cancer cells remain. Instead there is a vigorous inflammatory response composed mainly by lymphocytes and macrophages. The ducts (upper right) represent a site where the tumor had adhered to pancreas and are pancreatic ductules. (×200.) DISCUSSION Suicide gene therapy for the treatment of liver metastases of colon carcinoma has been evaluated in rodent models using retroviral and adenoviral vectors. In both cases, partial tumor regression has been observed after ganciclovir treatment. However, the animals did not live significantly longer due to the recurrence of hepatic tumors or disseminated metastases in other organs. Addition of the ADV/mIL-2 vector in the treatment protocol induced an effective systemic antitumoral immunity in the host that significantly prolonged the survival of the tumorbearing animals. This antitumoral immunity waned with time and eventually led to tumor recurrence and animal death. IL-12, a cytokine mainly produced by antigen-presenting cells, has shown powerful antitumoral activity against various tumors in subcutaneous models (24, 26, 36– 39). Renal adenocarcinoma (RENCA), melanoma (B16), reticulum cell sarcoma (M5076), sarcoma (MCA-105 and MCA-207), and Lewis lung carcinoma and colon carcinoma (MC-38 and CC-26) respond to recombinant IL-12 administration, leading to long-term animal survival in some cases. Several clinical trials for cancer treatment have already been started, and preliminary results in one trial showed severe toxicity: 15 out of 17 patients experienced serious adverse events affecting multiple organ systems (gastrointestinal tract bleeding, asthenia, and hepatotoxicity), and two patients died (37). In vivo gene therapy is one strategy to avoid the toxicity associated with systemic delivery of recombinant IL-12. Intratumoral injection of ADV/mIL-12 can lead to cytokine expression in the vicinity of the tumor and enhance the antitumoral immunity in the host.

FIG. 6. Long-term survival of animals after ADV/mIL-12 treatment. Seven days after intrahepatic cancer cells injection, the tumor bearing animals were divided into three treatment groups () Buffer; n=4 ( ` ) ADV/DL312 (5×108 pfu); n=7 ( ` ) ADV/ mIL-12 (5× 108 pfu); n=12. The animals were observed for survival over time (logrank test, P<0.0001). We constructed a recombinant adenoviral vector in which mIL-12 was cloned in the E1 deleted region. The cDNA from the two subunits, linked with an internal ribosome entry site, was efficiently transcribed from the Rous sarcoma virus promoter and produced bioactive mIL-12. Intratumoral injection of ADV/mIL-12 alone yielded substantial or complete hepatic tumor regression of the poorly immunogenic MCA-26 colon carcinoma. This treatment was able to significantly prolong the survival of tumor-bearing animals, with 25% of the treated mice still living after 70 days. This tumoricidal effect appeared to be even more potent than the combination treatment with ADV/tk and ADV/mIL-2. NK cells are an important type of effector cells that are presumed to play a role in the surveillance of cancer and in the control of metastases. Mouse liver contains a large proportion of NK cells that can be potent cytotoxic effector cells against tumors after stimulation with mIL-12 (38, 39). These cells can lyse NK-sensitive and NK-resistant tumor targets as shown by in vitro cytotoxicity assay (38, 39). After intraperitoneal injection of an adenovirus expressing mIL-12, Bramson et al. (40) detected some NK activity in the splenocyte and in the lung effector cell population against the NK-sensitive cell line YAC-1 at day 2 after adenoviral injection. These cells act for a short period of time, and they are subsequently replaced by tumor-specific CTL (41). IL-12 is a strong activator of both NK and CTL, which could be contributing factors to the tumoricidal activities in our model. One way to increase the CTL activity, which we are currently investigating, is to combine the ADV/mIL-12 treatment with ADV/mIL-2 and ADV/tk. Indeed, several other groups have reported the synergistic effect of IL-12 and IL-2 to generate cytotoxic activity in T cells and in NK cells (42–45). This additional treatment can potentially enhance the antitumoral efficacy of IL-12 and induce a long-lasting systemic antitumoral immunity. The results obtained with a poorly immunogenic tumor are encouraging for the further development of in vivo gene therapy as a treatment modality for metastases from colon cancer in humans. We thank Doberta Bell for the preparation of this manuscript. The work was supported in part by National Cancer Institute Grant CA-70337–01 (to S.H.C.). M.C. is an Associate and S.L.C.W. is an Investigator of the Howard Hughes Medical Institute.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

ADENOVIRUS-MEDIATED INTERLEUKIN-12 GENE THERAPY FOR METASTATIC COLON CARCINOMA

11306

1. Dreben, J.A. & Niederhuber, J.E. (1993) in Current Therapy in Oncology, ed. Niederhuber, J.E. (Decker, St. Louis), pp. 426–431. 2. Dreben, J.A. & Niederhuber, J.E. (1993) in Current Therapy in Oncology, ed. Niederhuber, J.E. (Decker, St. Louis), pp. 389–395. 3. Pardoll, D.M. (1995) Annu. Rev. Immunol. 13, 399–415. 4. Corbett, T.H., Griswold, D.P., Roberts, B.J., Peckham, J.C. & Schabel, F.M., Jr. (1975) Cancer Res. 35, 2434–2439. 5. Graham, F.L., Smiley, J., Russell, W.C. & Nairn, R. (1977) J. Gen. Virol. 36, 59–72. 6. Fang, B., Eisensmith, R.C., Li, X.H.C., Finegold, M.J., Shedlovsky, A., Dove, W. & Woo, S.L.C. (1994) Gene Ther. 1, 247–254. 7. Bett, A.J., Haddara, W., Prevec, L. & Graham, F.L. (1994) Proc. Natl. Acad. Sci. USA 91, 8802–8806. 8. Graham, F.L. & Prevec, L. (1991) in Methods in Molecular Biology: Gene Transfer and Expression Protocols, ed. Murray, E.J. (Human Press, Clifton, NJ), Vol. 7, pp. 109–128. 9. Cox, D.R. & Oakes, D. (1984) in Analysis of Survival Data, eds. Cox, D.R. & Hinkley, D.V. (Chapman & Hall, New York), pp. 91–139. 10. Elion, G.B. (1983) J. Antimicrob. Chemother. 12, 9–17. 11. Nishiyama, Y. & Rapp, F. (1979) J. Gen. Virol. 45, 227–230. 12. Furman, P.A., McGuirt, P.V., Keller, P.M., Fyfe, J.A. & Elion, G.B. (1980) Virology 102, 420–430. 13. Davidson, R.L., Kaufman, E.R., Crumpacker, C.S. & Schnipper, L.E. (1981) Virology 113, 9–19. 14. Caruso, M., Panis, Y., Gagandeep, S., Houssin, D., Salzmann, J.-L. & Klatzmann, D. (1993) Proc. Natl. Acad. Sci. USA 90, 7024–7028. 15. Short, M.P., Choi, B.C., Lee, J.K., Malick, A., Breakefield, X.O. & Martuza, R.L. (1990) J. Neurosci. Res. 27, 427–433. 16. Ram, Z., Culver, K., Walbridge, K.W., Blaese, R.M., & Oldfield, E.H. (1993) Cancer Res. 53, 83–88. 17. Chen, S.-H., Shine, H.D., Goodman, J.C., Grossman, R.G. & Woo, S.L.C. (1994) Proc. Natl. Acad. Sci. USA 91, 3054–3057. 18. Chen, S.-H., Li Chen, X.H., Wang, Y., Kosai, K.-I., Finegold, M.J., Rich, S.S. & Woo, S.L.C. (1995) Proc. Natl. Acad. Sci. USA 92, 2577–2581. 19. O’Malley, B.W., Chen, S.-H., Schwartz, M.R. & Woo, S.L.C. (1995) Cancer Res. 55, 1080–1085. 20. Eastham, J., Chen, S.-H., Sehgal, I., Timme, T., Hall, S., Woo, S.L.C. & Tompson, T. (1996) Hum. Gene Ther. 7, 515–523. 21. Kobayashi, M., Fitz, L., Ryan, M., Hewick, M., Clark, S.C., Chan, S., Loudon, R., Sherman, F., Perussia, B. & Trinchieri, G. (1989) J. Exp. Med. 170, 827–845. 22. Naume, B., Gately, M. & Espevik, T. (1992) J. Immunol. 148, 2429–2436. 23. Robertson, M.J., Soiffer, R.J., Wolf, S.F., Manley, T.J., Donahue, C., Young, D., Herrmann, S.H. & Ritz, J. (1992) J. Exp. Med. 175, 779–788. 24. Wolf, S.A., Temple, P.A., Kobayashi, M., Young, D., Dicig, M., Lowe, L., Dzialo, R., Fitz, L., Ferenz, D., Hewick, R.M., Kelleher, K., Herrmann, S.H., Clark, S.C., Azzoni, L., Chan, S.H., Trinchieri, G. & Perussia, B. (1991) J. Immunol. 146, 3074–3081. 25. Gately, M.K., Wolitzky, A.G., Quinn, P.M. & Chizzonite, R. (1992) Cell. Immunol. 143, 127–142. 26. D’Andrea, A., Rengaraju, M., Valiante, N.M., Chehimi, J., Kubin, M., Aste, M., Chan, S.H., Kobayashi, M., Young, D., Nickbarg, E., Chizzonite, R., Wolf, S.F. & Trinchieri, G. (1992) J. Exp. Med, 176, 1387–1398. 27. Heufler, C., Koch, F., Stanzl, U., Topar, G., Wysocka, M., Trinchieri, G., Enk, A., Steinman, R.M., Romani, N. & Schuler, G. (1996) Eur. J. Immunol. 26, 659–668. 28. Trinchieri, G. (1993) Immunol. Today 14, 335–338. 29. Brunda, M.J., Luistro, L., Warrier, R.R., Wright, R.B., Hubbard, B.R., Murphy, M., Wolf, S.F. & Gately, M.K. (1993) J. Exp. Med. 178, 1223–1230. 30. Brunda, M.J., Luistro, L., Hendrzak, J.A., Fountoulakis, M., Garotta, G. & Gately, M.K. (1995) J. Immunother. 17, 71–77. 31. Nastala, C.L., Edington, H.D., McKinney, T.G., Tahara, H., Nalesnik, M.A., Brunda, M.J., Gately, M.K., Wolf, S.F., Schreiber, R.D., Storkus, W.J. & Lotze, M.T. (1994) J. Immunol. 153, 1697–1706. 32. Voest, E.E., Kenyon, B.M., O’Reilly, M.S., Truitt, G., D’Amato, R.J. & Folkman, J. (1995) J. Natl. Cancer Inst. 87, 581–586. 33. Sgadari, C., Angiolillo, A.L. & Tosato, G. (1996) Blood 87, 3877–3882. 34. Tahara, H., Zeh, H.J., Storkus, W.J., Pappo, I., Watkins, S.C., Gubler, U., Wolf, S.F., Robbins, P.D. & Lotze, M.T. (1994) Cancer Res. 54, 182–189. 35. Zitvogel, L., Tahara, H., Robbins, P.D., Storkus, W.J., Clarke, M.R., Nalesnik, M.A. & Lotze, M.T. (1995) J. Immunol. 155, 1393–1403. 36. Martinotti, A., Stoppacciaro, A., Vagliani, M., Melani, C., Spreafico, F., Wysocka, M., Parmiani, G., Trinchieri, G. & Colombo, M.P. (1995) Eur. J. Immunol. 25, 137–146. 37. Lamont, A.G. & Adorini, L. (1996) Immunol. Today 17, 214– 217. 38. Hashimoto, W., Takeda, K., Anzai, R., Ogasawara, K., Sakihara, H., Sugiura, K., Seki, S. & Kumagai, K. (1995) J. Immunol. 154, 4333–4340. 39. Takeda, K., Seki, S., Ogasawara, K., Anzai, R., Hashimoto, W., Sugiura, K., Takahashi, M., Masayuki, S. & Kumagai, K. (1996) J. Immunol. 156, 3366–3373. 40. Bramson, J., Hitt, M., Gallichan, W.S., Rosenthal, K.L., Gauldie, J. & Graham, F.L. (1996) Hum. Gene Ther. 7, 333–342. 41. Kos, F.J. & Engleman, E.G. (996) Immunol. Today 17, 174–176. 42. Gately, M.K., Warrier, R.R., Honasoge, S., Carvajal, D.M., Faherty, D.A., Connaughton, S.E., Anderson, T.D., Sarmiento, U., Hubbard, B.R. & Murphy, M. (1994) Int. Immunol. 6, 157–167. 43. Soiffer, R.J., Robertson, M.J., Murray, C., Cochran, K. & Ritz, J. (1993) Blood 82, 2790–2796. 44. Rossi, A.R., Pericle, F., Rashleigh, S., Janiec, J. & Djeu, J.Y. (1994) Blood 83, 1323–1328. 45. Vagliani, M., Rodolfo, M., Cavallo, F., Parenza, M., Melani, C., Parmiani, G., Forni, G. & Colombo, M.P. (1996) Cancer Res. 56, 467–470.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

THE FUNCTION OF HERPES SIMPLEX VIRUS GENES: A PRIMER FOR GENETIC ENGINEERING OF NOVEL VECTORS

11307

This paper was presented at a colloquium entitled “Genetic Engineering of Viruses and of Virus Vectors,” organized by Bernard Roizman and Peter Palese (Co-chairs), held June 9–11, 1996, at the National Academy of Sciences in Irvine, CA.

The function of herpes simplex virus genes: A primer for genetic engineering of novel vectors BERNARD ROIZMAN The Marjorie B.Kovler Viral Oncology Laboratories, The University of Chicago, 910 East 58th Street, Chicago, IL 60637 ABSTRACT Herpes simplex virus vectors are being developed for delivery and expression of human genes to the central nervous system, selective destruction of cancer cells, and as carriers for genes encoding antigens that induce protective immunity against infectious agents. Vectors constructed to meet these objectives must differ from wild-type virus with respect to host range, reactivation from latency, and expression of viral genes. The vectors currently being developed are (i) helper free amplicons, (ii) replication defective viruses, and (iii) genetically engineered replication competent viruses with restricted host range. Whereas the former two types of vectors require stable, continuous cell lines expressing viral genes for their replication, the replication competent viruses will replicate on approved primary human cell strains. Herpes simplex viruses (HSV) and particularly HSV-1 are potential vectors for several applications in human health. These include (i) delivery and expression of human genes to central nervous system (CNS) cells, (ii) selective destruction of cancer cells, and (iii) prophylaxis against infections with HSV and other infectious agents. The properties of wild-type virus are fundamentally antithetical to such applications. HSV-1 is highly destructive to infected cells. In addition, HSV-1 is generally spread by contact of the tissues containing virus of one individual with mucous membranes of an uninfected individual. The virus multiplies at the portal of entry, infects sensory nerve endings innervating the site of multiplication, and is transported retrograde to the nucleus of sensory neurons. The sequence of events beyond this point are less well known. In experimental animal systems, the virus multiplies in some neurons but establishes a latent state in others. In a fraction of those infected, the virus periodically reactivates from latent state. In these neurons the newly replicated virus is transported anterograde, usually to a site at or near the portal of entry into the body, where it may cause a localized lesion. In immunosuppressed individuals, the lesions caused both by initial infection and recrudescences tend to be more extensive and persist longer than in immunocompetent individuals (reviewed in refs. 1 and 2). To serve as vectors, the viral genotype must be extensively altered to fit the objective of the vector. For example, to deliver and express human genes in the CNS, the desirable properties of HSV are its ability to establish latent infections and the huge coding capacity of the viral genome. The undesirable property is the capacity of the virus to commit the cell to destruction very early in infection. For selective destruction of cancer cells, the desirable property is the capacity of the virus to destroy cells. The undesirable properties are the wide host range of the wildtype virus and the capacity of the virus to reactivate from latent state. Each application therefore requires a different kind of vector and, in principle, different kinds of genetic engineering. The purpose of this report is to summarize our knowledge of the molecular biology of HSV-1 relevant to experimental design of viral vectors.

FIG. 1. Sequence arrangement in HSV DNA and distribution of viral genes in the HSV genome. The filled quadrangles represent terminal sequence ab and ca inverted and repeated internally to yield b

a

c

. See ref. 1 and Table 1 for details of genome structure and gene function. The latency associated transcripts (LATs) map within inverted repeats flanking UL. Genome Structure and Gene Content The genome structure and current gene content of HSV-1 are summarized in Fig. 1. Exclusive of the variable number of repeats of the terminal a sequence, the HSV-1 genome is approximately 152 kbp in size (3, 4). The genome consists of two long stretches of quasi-unique sequences, unique long sequence (UL) and unique short sequence (US), flanked by inverted repeats. UL is flanked by the sequence ab and its inversion b

a

, approximately 9 kbp each, whereas US is flanked by the sequence a

c

and its inversion ca, 6.5 kbp each (5, 6). Thus, the HSV genome contains 15 kbp of DNA sequences (b

a

c

), which represent inverted repeats of terminal regions inserted between UL and US domains. The a sequence varies in size and may be present in multiple copies adjacent to the ba sequence, but only in a single copy at the

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact. Abbreviations: HSV-1, -2, herpes simplex virus 1 and 2; ICP, infected cell protein; gB, gC, gD, etc., glycoproteins B, C, D, etc.; UL, unique long sequence; US, unique short sequence; LAT, latency associated transcripts; ORF, open reading frame; CNS, central nervous system.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

THE FUNCTION OF HERPES SIMPLEX VIRUS GENES: A PRIMER FOR GENETIC ENGINEERING OF NOVEL VECTORS 11308

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

THE FUNCTION OF HERPES SIMPLEX VIRUS GENES: A PRIMER FOR GENETIC ENGINEERING OF NOVEL VECTORS

11309

terminus of the genome next to the c sequence and contains signals for cleavage of unit length DNA from concatemers and packaging of the DNA in preformed capsids (reviewed in ref. 1). HSV-1 is known to express at least 84 different polypeptides whose open reading frames (ORFs) are distributed as indicated in Fig. 1 (refs. 4 and 7–15; P.L.Ward and B.R., unpublished data; Y.Chang, G.Campadelli-Fiume, and B.R., unpublished data). Of this number, five ORFs, mapping in the inverted repeats, are present in two copies per viral genome. In addition to the ORFs listed in Fig. 1, infected cells contain

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

THE FUNCTION OF HERPES SIMPLEX VIRUS GENES: A PRIMER FOR GENETIC ENGINEERING OF NOVEL VECTORS

11310

transcripts from genome domains not known to specify proteins. These include the LATs discussed below and an RNA (OriSRNA) derived by transcription of the two of the three origins of viral DNA synthesis mapping in inverted repeats (16, 17). The ORFs form several groups whose expression is coordinately regulated in a cascade fashion. The α genes are expressed first, functional α proteins are required for the expression of β genes, and both functional α proteins and viral DNA synthesis mediated by β proteins are required for (γ2), or enhance (γ1), the expression of late or γ genes (18, 19). Whereas α proteins perform regulatory functions or prevent a host response to infection, the function of β proteins is the management of the nucleic acid metabolism and viral DNA synthesis in the infected cell, as well as posttranslational modification of proteins made earlier and later in infection. The γ proteins are largely the structural components of the virions (reviewed in ref 1). Since 1982 (20, 21) techniques have been available to delete or insert DNA sequences at specific sites. These studies have revealed the existence of ORFs that are expressed and the rather unexpected finding that 45 of the 83 ORFs specifying diverse proteins are dispensable for viral replication in at least some cells in culture. A list of the ORFs and the functions expressed by the gene products are shown in Table 1. The 38 ORFs that cannot be deleted without ablating the capacity of the virus to replicate include four genes specifying surface glycoproteins, two regulatory proteins [infected cell proteins no. 4 (ICP4) and no. 27 (ICP27)], seven proteins required for the synthesis of viral DNA, proteins required for assembly of the capsid, structural proteins, and proteins whose functions are not yet known. The 45 accessory ORFs, which are not required for viral replication in cells in culture, specify 11 proteins involved in entry, sorting, and exocytosis of virus (glycoproteins C, E, G, I, J, K, M; membrane proteins UL11, UL20, UL24, UL43), 2 protein kinases (UL13, US3), 2 proteins that preclude host response to infection (α47 and γ134.5), 3 regulatory proteins (α0, α22, US1.5), 5 proteins that augment the nucleotide triphosphate pool or repair DNA (thymidine kinase, dUTPase, ribonucleotide reductase, DNase, uracil glycosylase), 1 protein that causes the degradation of mRNA after infection (UL41), and numerous other proteins whose functions are not known (detailed references in ref. 1).

The Role of Selected Viral Genes in Viral Replication The reproductive cycle of HSV has been described in detail elsewhere (1). The objective of viral replication is efficient, rapid synthesis and dissemination of viral progeny. In the process, the infected cell dies. Viral replication consists of a series of events very tightly regulated both positively and negatively. To accomplish its objectives, the virus brings into the newly infected cell several proteins packaged in the virion tegument (a layer of proteins located between the capsid and the envelope; see ref. 22), whose functions are best described as creating the environment for initiation of viral replication). One, designated as VP16 or α gene trans-inducing factor (αTIF) induces the transcription of α genes by cellular RNA pol II and accessory factors, whereas another encoded by UL41 causes the degradation of cytoplasmic RNAs (23–25). The major regulatory protein ICP4 made after infection acts both negatively by binding to high-affinity sites on viral DNA and positively by an as yet unknown mechanism (reviewed in ref. 1). The hypothesis that ICP4 is directly involved in transcription is based on reports that it binds TATA box-binding protein and transcription factor IIB, and on the evidence that after the onset of DNA synthesis, it is a component of γtranscriptons— nuclear stuctures containing newly synthesized viral DNA, RNA polymerase II, ICP22, and a cellular protein known as L22 or EAP and that is normally present in nucleoli and ribosomes and binds small RNA molecules (ref. 26; R.Leopardi, P.L.Ward, W.Ogle, and B.R., unpublished work). ICP27 has multiple functions, but primarily it regulates posttranscriptional processing of RNA (27). ICP22 also appears to be a transcriptional factor; it is required for the expression of the α0 gene and also of a subset of γ genes and is a component of the γtranscriptons (ref. 28; R.Leopardi, P.L.Ward, W.Ogle, and B.R., unpublished work). Among other proteins that regulate the replicative cycle is UL13, a protein kinase known to mediate the phosphorylation of ICP0, ICP22, and other proteins (ref. 28; W.Ogle, K.Carter, and B.R., unpublished work). The function of another viral protein kinase, US3, is less clear (1). The functions of γ134.5 and α47 genes are of particular interest. γ134.5 appears to have at least two functions. One function of γ134.5 is to preclude the shutoff of protein synthesis caused by activation of the protein kinase RNA-dependent kinase and, ultimately, by the phosphorylation of the α subunit of the translation initiation factor eIF-2 (29). The carboxyl-terminal domain of γ134.5 required for this function is homologous to the corresponding domain of the mammalian protein GADD34—one of a set of proteins induced in growth arrest as a consequence of differentiation, serum deprivation, or DNA damage. Human GADD-34, or a chimeric gene consisting of the amino terminal domain of γ134.5 and the carboxyl terminus of GADD-34, effectively replaces the γ134.5 gene in the context of the viral genome (30). The second function of the γ134.5 enables the virus to multiply efficiently in a number of tissues, but particularly in the CNS of experimental animal systems (31, 32). The argument that this function of γ134.5 is independent of the function of the protein to preclude the phosphorylation of eIF-2α is based on the observation that viruses carrying GADD-34 in place of γ134.5 are not blocked in protein synthesis; they are nevertheless attenuated (32). α47 binds the complex of TAP1/2 and thereby precludes the transport of peptides for presentation to CD8+ cells (33).

The Function of Viral Genes in Latency To date the only domain of the viral genome shown to be expressed during latency maps in the inverted repeats flanking UL (16). The RNAs described to date consist of two populations. The low abundance population arises from an 8.3-kbp domain. The two abundant RNAs, of 2 and 1.5 kb respectively, and known by the acronym LAT, appear to be stable introns that accumulate in abundant amounts in nuclei of neurons harboring latent virus. Deletion of the upstream promoter or of the sequences encoding LATs has little effect on the establishment or maintenance of the latent state, but reduces the efficiency of latent virus to reactivate (1). LATs may be harbingers of neurons capable of reactivating than viral products required for establishment of latency. Given the multitude of viral accessory genes whose function is to render viral replication and dissemination more efficient, the notion that the virus depends solely on the cellular factors for dissemination seems unlikely. Recent studies have shown that the genome domain transcribed during latency contains ORF-0 and ORF-P, whose expression is repressed by ICP4, inasmuch as mutagenesis of the high-affinity binding site at the transcription initiation site of ORF-P led to the derepression of both genes (12). The virus carrying the derepressed gene is attenuated in experimental animal systems (mice) and underexpresses α0 and α22 proteins (34, 45). In addition, ORF-P protein colocalizes and binds to a protein (p34), which is a component of the SF2/ASF splicing factor (45). The role of ORF-P in latency is not known.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

THE FUNCTION OF HERPES SIMPLEX VIRUS GENES: A PRIMER FOR GENETIC ENGINEERING OF NOVEL VECTORS

11311

Genetic Engineering of Novel Viral Genomes The two major techniques for construction of novel viruses depend on genetic recombination in infected or transfected cells. The first technique was based on the observation that transfection of cells with intact viral DNA and mutated fragment will result in a small fraction of the progeny carrying the mutated sequence (20, 21). To specifically select this population, the procedure first involved the insertion at or near the target for deletion by recombination through flanking sequences of the viral thymidine kinase as a selectable marker. Only the progeny of transfection, which carries the viral thymidine kinase gene, would multiply in thymidine kinase minus cells overlaid with appropriate medium. In the second step, the inserted thymidine kinase was deleted along with adjacent target sequences by recombination through flanking sequences with a mutated DNA sequence. In this instance, only thymidine kinase minus progeny would break through efficiently in cells overlaid with medium containing bromouracil deoxyriboside. A minor variant of this technique based on gene inactivation by random insertion of the mini-µu phage has the disadvantage in that the mini-µu DNA sequence is quite large and troublesome to remove (21). The second procedure involves transfection of cells with overlapping cosmids containing appropriate insertions or deletions. Expression of genes contained in cosmids leads eventually through recombination to the reconstruction of full-length viral genomes. This procedure is less efficient, but the progeny of transfection need not be subjected to selection for the isolation of the desired genotype (35) Both procedures suffer from gene rearrangements as a result of transfection. To link a specific genotype to the observed phenotype, it is essential to determine whether the wild-type phenotype is restored by the repair of the deleted sequences with a small DNA fragment. It is estimated that as much as 30% of the recombinants made by the techniques described above contain additional mutations detected only after the restoration of the missing sequence.

Requirements and Design of Viral Vectors Vectors for delivery of cellular genes to CNS must not express viral genes that cause the infected cell to make cytotoxic viral proteins or that induce an immune response, which may damage the recipient cells. A huge literature describes attempts to obtain long-term expression of reporter genes in experimental animals, particularly mice. A potentially suitable vector for this type of application is based on construction of defective genomes, i.e., genomes that are unable to replicate in the recipient cells. In recent years, two different types of defective recombinant viruses have emerged. The first is based on defective HSV genomes, which arise spontaneously by recombination and are amplified during serial passage at high multiplicities (36). The defective genome subunit (the amplicon) consists minimally of the terminal a sequence and an origin of viral DNA synthesis. In virions, these unit are arranged head-to-tail. HSV-1 amplicons have long been shown to express efficiently cellular genes incorporated into them (37). Amplicons do not encode viral proteins and must therefore be supplied with both viral structural proteins and proteins required for viral DNA synthesis and exocytosis in order to be made. In theory, amplicons could accommodate as much as 150 kbp of DNA. In practice, three problems exist. First, until recently, amplicons were contaminated with helper DNA. Second, the amounts of amplicons made are not readily controllable and the usual yields are several orders of magnitude lower than those of wild-type infectious virus. Third, amplicons tend to be unstable on serial passage because the smaller the amplicon, the greater is its selective advantage (38). Of these problems, only the first one has been solved, since a helper virus incapable of packaging has been constructed (39). A significant potential problem is the rescue of the helper virus by recombination with the amplicon, which would enable the helper to package. The second approach is based on construction of viruses lacking essential genes. The essential genes deleted singly or in combination include α4, α22, α27, UL48 (α gene transinducing factor or VP16), and UL41 (40). Deletion of the inverted repeats (b

a

c

) and of stretches of genes not essential for viral replication in cell culture (e.g., US except for US6, α22, and α47), and large stretches of UL (UL2, UL3, UL4, UL10, UL11, UL43, UL43.5, UL45, UL46, UL47, UL55, UL56) could make space for insertion of at least 40 kbp of DNA. By necessity, the debilitated recombinant virus must be grown in cell lines expressing the deleted viral genes. This type of vector also presents several problems. Foremost is that some of the selected genes targeted for deletion perform a multiplicity of functions. For example, they may be both transactivators and repressors, and they normally block the cells from programmed cell death triggered by viral gene expression (41). It could be predicted therefore that sooner or later the recipient cell will cease functioning because of slow but ultimately fatal expression of viral genes. Other problems, perhaps more readily surmountable, include potential for recombination between the defective viral genomes and viral genes resident in the cell genome and the stability of the cell lines. In neither model is reactivation from latency a problem inasmuch as the viruses are unable to replicate. Whereas gene therapy may require delivery of therapeutic genes to a significant fraction of cells that normally express them or could serve as surrogate expressors, cancer therapy requires complete destruction of cancer cells. Theoretically, for selective destruction of cancer cells, it should be sufficient to introduce a defective viral genome expressing a factor that is excreted in abundant amounts and toxic only for cancer cells. Theory not withstanding, viruses that infect or at least selectively multiply and destroy tumor cells are likely to have a therapeutic advantage. In experimental animal systems several genetically engineered viruses appear to have met at least the initial requirements for further development (32). The mutations that render the viruses attenuated fall into three categories. The first set encodes enzymes (e.g., thymidine kinase, ribonucleotide reductase, etc.) involved in nucleic acid metabolism and that would not be available in neurons but would be available to the virus in dividing tumor cells. The second category are genes encoding proteins (e.g., γ134.5), which disable the capacity of the virus to replicate in CNS for reasons not well understood, as described earlier in the text (reviewed in ref. 32). Lastly, deletion of inverted repeats (b

a

c
) in itself grossly debilitates HSV-1 (42, 43). Irrespective of the set of genes involved for attenuation, it will be virtually impossible to introduce virus in all cancer cells. As in the case of defective viruses, even replicating viruses will have to carry and express factors that induce immune response or activate pro-drugs selectively in cancer cells. The use of recombinant viruses for prophylaxis against viral infection requires mutants that are genetically stable, incapable of replicating in CNS, incapable of spreading in immunocompromised individuals, unable to reactivate, not transmissible from immunized individual to contacts, but immunogenic and protective against disease caused by subsequent infection. A large number of defective viruses have been proposed for immunization on the grounds that although they cannot produce infectious progeny and fundamentally make proteins only in the set of initially infected cells, the presentation to the immune system of viral antigens made in these cells is superior to that of subunit vaccines (e.g. ref. 44). The central issue is the immunogenic mass required for effective immunity and whether such a mass could be achieved by progeny of a replication-defective virus. Secondary issues are the stability of

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

THE FUNCTION OF HERPES SIMPLEX VIRUS GENES: A PRIMER FOR GENETIC ENGINEERING OF NOVEL VECTORS

11312

the cell lines expressing the complementing viral genes, rescue of the defective virus by recombination, and qualification of transformed cell lines for administration of virus along with cellular DNA to healthy individuals. The construction of replicating virus is not less daunting, and parallels in many respects the construction of recombinant viruses for cancer therapy.

Conclusions Development of genetic engineering evolved pari passu with our knowledge of viral gene content and function and is at a point where, subject to constraints imposed by the size of the virion, the construction of virtually any vector is feasible. The outstanding issues are not the construction of viral vectors, but rather (i) delivery of recombinant viruses to appropriate cells, (ii) regulation of expression of the gene carried by the viral vector, and (iii) regulatory issues related to qualification of continuous cell lines, which express complementing viral genes for replication of defective vectors. Theoretically, it should be possible to create viruses that carry surface protein destined for receptors present only on a specific set of cells, but this is not yet feasible. The problems associated with regulation of gene expression are particularly vexing because the available size for packaging genes in the viral genome is too small to accommodate the genomic versions rather than the cDNA version of most cellular genes of interest. As a consequence, alternative splicing to produce isoforms of cellular proteins and natural regulation of gene expression may not be feasible. The third issue arises from the difficulty of purifying virus away from cell debris which contains cellular DNA. Since only continuous cell lines are likely to express stably viral genes complementing replication defective viruses, it would be necessary to define the requirements for the qualification of such cell lines for production of viruses intended for human use. Considering the progress of the past 10 years, the solution of these problems should not be far behind. I thank P.L.Ward, N.Markovitz, and A.E.Sears for their advise and assistance in the generation of Table 1. These studies were aided by grants from the National Cancer Institute (CA47451) and the National Institute for Allergy and Infectious Diseases (AI124009), and the U.S. Public Health Service. 1. Roizman, B. & Sears, A.E. (1996) in Fields Virology, eds. Fields, B.N., Knipe, D.M., Howley, P., Chanock, R.M., Hirsch, M.S., Melnick, J.L., Monath, T.P. & Roizman, B. (Lippincott-Raven, Philadelphia), 3rd Ed., pp. 2231–2295. 2. Whitley. R.J. (1996) in Fields Virology, eds. Fields, B.N., Knipe, D.M., Howley, P., Chanock, R.M., Hirsch, M.S., Melnick, J.L., Monath, T.P. & Roizman, B. (Lippincott-Raven, Philadelphia), 3rd Ed., pp. 2297–2342. 3. Kieff, E.D., Bachenheimer, S.L. & Roizman, B. (1971) J. Virol. 8, 125–132. 4. McGeoch, D.J., Dalrymple, M.A., Davison, A.J., Dolan, A., Frame, M.C., McNab, D., Perry, L.J., Scott, J.E. & Taylor, P. (1988) J. Gen. Virol. 69, 1531–1574. 5. Sheldrick, P. & Berthelot, N. (1975) Cold Spring Harbor Symp. Quant. Biol. 39, 667–678. 6. Wadsworth, S., Jacob, R.J. & Roizman, B. (1975) J. Virol. 15, 1487–1497. 7. Baradaran, K., Dabrowski, C.E. & Schaffer, P.A. (1994) J. Virol. 68, 4251–4261. 8. Barker, D.E. & Roizman, B. (1992) J. Virol. 66, 562–566. 9. Carter, K.L. & Roizman, B. (1996) J. Virol. 70, 172–178. 10. Cho, J. & Roizman, B. (1986) J. Virol. 57, 629–637. 11. Georgopoulou, U., Michaelidou, A., Roizman B. & Mavromara-Nazos, P. (1993) J. Virol. 67, 3961–3968. 12. Lagunoff, M. & Roizman, B. (1994) J. Virol. 68, 6021–6028. 13. Liu, F. & Roizman, B. (1991) J. Virol. 65, 206–212. 14. Ward, P.L., Barker, D.E. & Roizman, B. (1996) J. Virol. 70, 2684–2690. 15. Martinez, R., Shao, L., Bronstein, J.C., Weber, P.C. & Weller, S.K. (1996) Virology 215 152–164. 16. Stevens, J.G., Wagner, E.K., Devi-Rao, G.B., Cook M.L. & Feldman, L.T. (1987) Science 235, 1056–1059. 17. Hubenthal-Voss, J., Starr, L. & Roizman, B. (1987) J. Virol. 61, 3349–3355. 18. Honess, R.W. & Roizman, B. (1974) J. Virol. 14, 8–19. 19. Honess, R.W. & Roizman, B. (1975) Proc. Natl. Acad. Sci. USA 72, 1276–1280. 20. Post, L.E. & Roizman, B. (1981) Cell 25, 227–232. 21. Roizman, B. & Jenkins, F.J. (1985) Science 129, 1208–1218. 22. Roizman, B. & Furlong, D. (1974) in Comprehensive Virology, eds. Fraenkel-Conrat, H. & Wagner, R.R. (Plenum, New York), Vol. 3, pp. 229–403. 23. Batterson, W. & Roizman, B. (1983) J. Virol. 46, 371–377. 24. McKnight, J.L.C., Kristie, T.M. & Roizman, B. (1987) Proc. Natl. Acad. Sci. USA 84, 7061–7065. 25. Read, G.S. & Frenkel, N.J. (1993) Virology 46, 498–512. 26. Smith, C.A., Bates, P., Rivera-Gonzalez, R., Gu, B. & DeLuca, N.A. (1993) J. Virol. 67, 4676–4687. 27. Smith, I.L., Hardwicke, M.A. & Sandri-Goldin, R.M. (1992) Virology 186, 74–85. 28. Purves, F.C., Ogle, W.O. & Roizman, B. (1993) Proc. Natl. Acad. Sci. USA 90, 6701–6705. 29. Chou, J., Chen, J.-J., Gross, M. & Roizman, B. (1995) Proc. Natl. Acad. Sci. USA 92, 10516–10520. 30. He, B., Chou, J., Liebermann, D.A., Hoffman, B. & Roizman, B. (1996) J. Virol. 70, 84–90. 31. Chou, J., Kern, E.R., Whitley, R.J. & Roizman, B. (1990) Science 252, 1262–1266. 32. Andreansky, S.S., Bin, H., Gillespie, G.Y., Soroceanu, L., Markert, J., Roizman, B. & Whitley, A.J. (1996) Proc. Natl. Acad. Sci. USA 93, 11313– 11318. 33. Hill, A., Jugovic, P., York, I., Russ, G., Bennink, J., Yewdell, J., Ploegh, H. & Johnson, D. (1995) Nature (London) 375, 411–415. 34. Lagunoff, M., Randall, G. & Roizman, B. (1996) J. Virol. 70, 1810–1817. 35. van Zijl, M., Quint, W., Braire, J., de Rover, T., Gielkens, A. & Berns, A. (1988) J. Virol. 62, 2191–2195. 36. Frenkel, N., Jacob, R.J., Honess, R.W., Hayward, G.S., Locker, H. & Roizman, B. (1975) J. Virol. 16, 153–167. 37. Kwong, A.D. & Frenkel, N. (1985) Virology 142, 421–425. 38. Kwong, A.D. & Frenkel, N. (1984) J. Virol. 51, 595–603. 39. Fraefel, C., Song, S., Lim, I., Lang, P., Yu, L., Wang, Y., Wild, P. & Geller, A.I. (1996) J. Virol., in press. 40. Marconi, P., Krisky, D., Oligino, T., Poloani, P.L., Ramakrishnan, R., Goins, W.F., Fink, D.J. & Glorioso, J.C. (1996) Proc. Natl. Acad. Sci. USA 93, this issue. 41. Leopardi, R. & Roizman, B. (1996) Proc. Natl. Acad. Sci. USA 93, 9583–9587. 42. Meignier, B., Longnecker, R. & Roizman, B. (1988) J. Infect. Dis. 158, 602–614. 43. Meignier, B., Martin, B., Whitley, R.J. & Roizman, B. (1990) J. Infect. Dis. 162, 313–322. 44. Nguyen, L.H., Knipe, D.M. & Finberg, R.W. (1992) J. Virol. 66, 7067–7072. 45. Bruni, R. & Roizman, B. (1996) Proc. Natl. Acad. Sci. USA 93, 10423–10427.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

THE APPLICATION OF GENETICALLY ENGINEERED HERPES SIMPLEX VIRUSES TO THE TREATMENT OF EXPERIMENTAL BRAIN TUMORS

11313

This paper was presented at a colloquium entitled “Genetic Engineering of Viruses and Virus Vectors,” organized by Bernard Roizman and Peter Palese (Co-chairs), held June 9–11, 1996, at the National Academy of Sciences in Irvine, CA.

The application of genetically engineered herpes simplex viruses to the treatment of experimental brain tumors SAMITA S.ANDREANSKY*†, BIN HE‡, G.YANCEY GILLESPIE§, LILIANA SOROCEANU§, JAMES MARKERT§, JOANY CHOU‡, BERNARD ROIZMAN‡, AND RICHARD J.WHITLEY*†¶` Departments of *Pediatrics, †Microbiology, §Neurosurgery, and ¶Medicine, University of Alabama at Birmingham, Birmingham, AL 35233; and ‡The Marjorie B. Kovler Viral Oncology Laboratories, University of Chicago, Chicago, IL 60637 ABSTRACT Due to lack of effective therapy, primary brain tumors are the focus of intense investigation of novel experimental approaches that use vectors and recombinant viruses. Therapeutic approaches have been both indirect, whereby vectors are used, or direct to allow for direct cell killing by the introduced virus. Genetically engineered herpes simplex viruses are currently being evaluated as an experimental approach to eradicate malignant human gliomas. Initial studies with γ134.5 mutants, R3616 (from which both copies of the γ134.5 gene have been deleted) and R4009 (a construct with two stop codons inserted into the γ134.5 gene), have been assessed. In a syngeneic scid mouse intracranial tumor model, recombinant herpes simplex virus can be experimentally used for the treatment of brain tumors. These viruses and additional engineered viruses were subsequently tested in human glioma cells both in vitro and in vivo. Using a xenogeneic scid mouse intracranial glioma model, R4009 therapy of established tumors significantly prolonged survival. Most importantly, long-term survival was achieved, with histologic evidence that R4009 eradicated intracranial tumors in this model. Furthermore, the opportunity to evaluate γ134.5 mutants that have enhanced oncolytic activity, e.g., R8309 where the carboxyl terminus of the γ134.5 gene has been replaced by the murine homologue, MyD116, are considered. Malignant gliomas are the most common primary brain tumors of humans, accounting for 30% of all primary central nervous system (CNS) tumors in adults; they are divided into two types: (i) anaplastic astrocytoma and (ii) glioblastoma multiforme. Primary malignant brain tumors in the United States are estimated to occur at an incidence of 14.7 per 100,000 people, and 10,000–15,000 new cases are diagnosed annually (1, 2). Multimodal approaches, such as surgery, radiation, and chemotherapy, have only extended median survival rate of patients with malignant gliomas from 14 weeks to 1 year and the 5-year survival rate for glioblastoma multiforme, the most malignant of gliomas, is still 5.5% or less (3, 4). The disease is characterized by local tumor recurrence with relentless re-growth, causing neurologic dysfunction and ultimately death. Thus, treatment of malignant gliomas remains a difficult therapeutic challenge. While substantial progress has been made in understanding the molecular biology of tumors, its translation to significantly improved clinical outcome has not occurred. Malignant gliomas are ideal candidates for molecular based therapies as: (i) metastases are rare, (ii) imaging studies allow precise monitoring of outcome, and (iii) delivery techniques allow for targeting of therapeutics. In the recent years, various investigators have pursued two approaches for treatment of CNS tumors: vector therapy and direct virus therapy. The first approach uses vectors (both viral and nonviral) to insert immune-stimulating or drug susceptibility genes, including the herpes simplex virus thymidine kinase gene (HSV-tk) (5–33), into tumor cells as summarized in Table 1. These vectors generally do not have significant direct effects on the tumor cells, but act as a means for inserting a genetic message into the cell. The success of such an approach depends on at least two factors: (i) the selection of the correct gene for transfer, and (ii) the selection of the correct vector for in vivo use. Most vector therapy studies use either retroviruses or adenoviruses for gene delivery. Each of these vectors has significant theoretical disadvantages, including lack of replication and inadequate long-term gene expression (34).

Table 1. Examples of virus-based vectors for experimental brain tumor therapy Virus vectors Genes used Examples* (ref.) Retrovirus Suicide genes HSV-tk/ganciclovir (5) Cytokines Interleukin 2 (23) Adenovirus Suicide genes HSV-tk/ganciclovir (15) Tumor suppressor genes p53 (33) Suicide genes Native HSV-tk/ganciclovir (13) Herpesvirus *Among others.

The second approach uses genetically engineered viruses to directly kill tumor cells. To date, modified herpes simplex viruses (HSVs) have been the mainstay of experimental viral therapy for malignant gliomas. This latter approach uses the inherent cytopathic effects attendant with cell destruction, which results from the normal life cycle of the virus and possible additional contributions from the native host immune response to achieve tumor cell destruction. An ideal candidate for direct virus therapy should be avirulent, replication competent, and oncolytic, yet maintain susceptibility to existing antiviral therapies. The status of such approaches is summarized below.

Direct Virus Therapy As noted, virus therapy of brain tumors has chiefly used genetically engineered HSV, summarized in Table 2; nevertheless, this discussion will focus on the use of genetically engineered γ134.5 negative HSV as an experimental therapeutic agent for CNS tumors. HSV is a neurotropic DNA virus

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact. Abbreviations: CNS, central nervous system; HSV, herpes simplex virus; pfu, plaque-forming unit. ` To whom reprint requests should be addressed at: Suite 616 ACC, The Children’s Hospital of Alabama, 1600 7th Avenue South, Birmingham, AL 35233.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

THE APPLICATION OF GENETICALLY ENGINEERED HERPES SIMPLEX VIRUSES TO THE TREATMENT OF EXPERIMENTAL BRAIN TUMORS

11314

with a well-defined segmented genome. It is ubiquitous in the adult population as evidenced by the fact that 90% of people over 30 years of age have acquired antibodies to HSV, indicating prior infection. Wild-type HSV is capable of replicating in both neurons and glia, resulting in necrotizing encephalitis and widespread hemorrhagic necrosis usually localized to the inferiomedial portion of the temporal lobe. However, certain genetically engineered HSV lack neurovirulence and, thus, may be safe for direct intratumoral administration. The rationale for using modified HSV as experimental antiglioma agents has resided in the fact that these viruses retain the ability to replicate in dividing tumor cells but are avirulent in the surrounding terminally differentiated cells of the CNS (which lack enzymes required for virus replication). This selectivity of recombinant HSV can be exploited as a means to destroy tumors without injuring adjacent normal brain tissue.

Table 2. Examples of genetically engineered HSVs for experimental brain tumor therapy Examples* (ref.) Genetic site Thymidine kinase deficient mutants dlsptk (35) Thymidine kinase proficient mutants DNA polymerase AraAr9, AraAr13 (36) Ribonucleotide reductase hrR3 (37) R3616 and R4009 (38) γ134.5 G207 (39) Ribonucleotide reductase and γ134.5 *Among others.

Genetically engineered HSV studied for glioma therapy have included mutations in viral thymidine kinase, DNA polymerase, ribonucleotide reductase, and the γ134.5 gene (13, 35–42). Optimization of the therapeutic index has been a fundamental goal of studies of these genetically engineered HSV. Tumoricidal effects in vitro and in vivo in multiple glioma models (mouse, rat, and human glioma cell lines and human glioma explants) are demonstrable. In vivo models include tumor size reduction in subrenal capsules and flank cutaneous implants, but, more importantly, increased survival and tumor cures in intracranial implant models. These effects are reproducible in vivo for both immunedeficient (scid and nude) (35, 36, 38, 39) and immune-competent models (mice and rats) (13, 40–42). However, limitations to some mutants exist, namely lack of efficacy (DNA polymerase mutants); resistance to the two predominant HSV therapeutics in clinical use, acyclovir and ganciclovir (thymidine kinase negative mutants); retained capacity to induce encephalitis (thymidine kinase and DNA polymerase mutants); lack of an acceptable animal model due to significant differences in human and mouse or rat susceptibility to genetically engineered HSV (ribonucleotide reductase mutants); and potential loss of susceptibility of tumor cells previously treated with alkylating agents (ribonucleotide reductase mutants). Perturbations in the Expression of the HSV γ134.5 Gene: Background. We have used molecular-based strategies for the treatment of experimental gliomas utilizing genetically engineered HSV with perturbed expression of the γ134.5 gene in murine models. The goal of these studies is to combine decreased neurovirulence of genetically engineered viruses with direct virus cytotoxicity for malignant cells. The product of the γ134.5 gene appears responsible for the neurovirulence of HSV and is essential for the replication of HSV in the CNS (43). Murine intracerebral inoculation of viruses deleted in γ134.5 (R3616) or with stop codons in both the copies of this gene (R4009) resulted in plaqueforming unit (pfu)/LD50 values in excess of 107 as compared with the wild-type gene (HSV-1) or the restored virus (HSV-1 F[R]), which produced pfu/LD50 values<102.5. This observation prompted an extensive evaluation of the natural history of these viruses in both murine and guinea pig models, using the classical portals of entry for HSV infection of humans (44). These viruses have significantly decreased capacities to induce disease in ocular and genital models of mice and guinea pigs and also have a reduced potential to establish latency and be reactivated. In human cell lines, the resulting protein of this gene prevents a cellular stress response that ordinarily occurs with the onset of viral DNA synthesis (45). Thus, the lack of γ134.5 causes premature shut off of host protein synthesis due to phosphorylation of translation initiation factor eIF-2α by the activated protein kinase PKR (46). Knowledge of the phenotypic properties of R3616 and R4009 provided a foundation for evaluating these mutants for in vitro and in vivo therapy of malignant gliomas. Initially, both the viruses were tested in vitro against a variety of rat, mouse, and human glioma cell lines, revealing several important findings: (i) R3616 and R4009 were incapable of replicating in rat glioma and other rat tumor cells and, thus, were not oncolytic; (ii) R3616 and R4009 were lytic in mouse glioma cells; (iii) human glioma cells were susceptible to these engineered HSV. The replication competence of R3616 and R4009 in the murine and human cells defined peak titers of 103 and 105 pfu/ml, respectively, 24 hr postinfection. These observations led to the development of both syngeneic and xenogeneic murine models for the evaluation of these viruses. The Syngeneic Intracranial Glioma Model. Recognizing the work of others investigators, an intracranial syngeneic model of malignant glioma in scid mice was established to compare the effectiveness of experimental therapy with R3616 and R4009. The MT539MG glioma cell line, established from a spontaneous glioma from a VM/Dk (H-2b) mouse, was used to establish intracranial tumors, as previously described (38). Briefly, graded concentrations of tumor cells were stereotactically inoculated into the right caudate nucleus and animal survival was determined. A dose-response curve of 16, 22, and 39 days in median survival of mice was observed for 105, 104, and 103 number of tumor cells injected, respectively. This led in the selection of a standard dose of 5–10×104 MT539MG cells per mouse inoculum for subsequent studies because it resulted in a reproducible and useful median survival of 22 days and 100% lethality by 25 days. The efficacy of R3616 and R4009 as therapy for gliomas was tested in three series of experiments as previously described (38). At first, tumor cells and R3616 or R4009 were admixed and stereotactically inoculated simultaneously at various concentrations in a Winn-type assay. Mice receiving 105 MT539MG cells mixed with 2×105 or 2×108 pfu of R3616 survived for a median of 20 and 26 days, respectively (PetoWilcoxon analysis, P<0.009 and P<0.002, respectively). In parallel experiments, when 2.5×103 or 2.5×105 of R4009 were mixed with 5×104 MT539MG cells and implanted intracranially, the median survival rate increased to 24 and 30 days, respectively, as compared with 22 days for the animals receiving saline (P<0.001). In the second experiment, tumor cells were implanted and allowed to divide over 3 days before direct intratumoral inoculation of the genetically engineered HSV at various multiplicities of infection (virus particles per total number of tumor cells implanted). The median survival of the treated animals increased from 15 days (saline treated) to 21 days when R3616 therapy was delayed until 72 hr after implantation (P<0.0067). Similarly, intratumoral injection of R4009 resulted in a prolongation in median survival days from 21 days (salinetreated) to 30 days. Neither assay yielded any long-term survivors and tumor growth was the cause of death in all mice. Finally, the increased survival of glioma-bearing animals was proven attributable to engineered HSV. Oncolytic effects of direct virus therapy were reversed by administering ganciclovir intraperitoneally daily from days −1 and 5 days relative to tumor-virus injection (day 0). Tumor-bearing animals treated with ganciclovir at 50 mg/kg intraperitoneally and R4009 survived for a similar duration as tumor-bearing animals

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

THE APPLICATION OF GENETICALLY ENGINEERED HERPES SIMPLEX VIRUSES TO THE TREATMENT OF EXPERIMENTAL BRAIN TUMORS

11315

receiving saline, having a median survival of 19 days. In contrast, mice that received MT539MG cells exposed to 2.5× 106 pfu of R4009 virus per cell and given daily intraperitoneal injections of saline survived significantly longer with a median survival rate of 32 days. Notably, from a safety perspective, intracranial injection of up to 2.5×106 pfu of either R3616 or R4009 into scid mice had no discernible effect over a 90-day observation period. In contrast, intracranial injection of 103 pfu of the wild-type HSV-1(F) resulted in 100% mortality within 7 days of inoculation with significant encephalitic necrosis of their brain tissue, strengthening the argument that the γ134.5 deletion viruses are safe for experimental therapy of CNS tumors. Attempts to explant HSV from brain tissue of all animals were uniformly unsuccessful. Furthermore, histopathology of sequential brain sections harvested at 15 and 30 days postvirus inoculation did not demonstrate encephalitis. Together these studies indicate that γ134.5 HSV can be used experimentally for the treatment of brain tumors without the requirement for alternative therapies (antiviral drugs) or the risk of encephalitis in the scid intracranial glioma model. Additionally, when compared with R3616, R4009 more efficiently destroyed tumor cells in vitro and extending survival of animals in vivo, an effect most likely due to the enhanced replication competence of R4009 (38). The Xenogeneic Intracranial Glioma Model. R3616 and R4009 were next evaluated in human glioma cells both in vitro and in vivo. Additionally, other viruses with γ134.5 mutations tested in vitro included R939 (stop codon at the carboxyl terminus), and R908 (41-codon deletion in frame after codon 72). For each specific mutation, repaired viruses were constructed [R3616(R), R939(R), and R908(R)] to demonstrate the restoration of the wild-type phenotype, confirming that the observed biologic properties were attributable to the mutations. These experiments used two established human glioma cell lines, U251MG (from a patient with glioblastoma multiforme) and D54MG (from a patient with anaplastic astrocytoma). Normal CNS cells such as human astrocytes were also used for in vitro analyses. Replication competence of the genetically engineered viruses was established in the human cells. All the γ134.5 negative viruses replicated in both the glioma cell lines with the average yield ranging from 102 pfu/ml for R3616 to 105 pfu/ml for R4009 (24 hr postinfection). As demonstrated with replication in the murine glioma cells, the titers of the engineered HSV were less than wild-type HSV-1(F), 106 pfu/ml. Analyses of viral proteins by immunoblotting with an antibody to the immediate early protein ICP27 demonstrated significant amounts of virus specific proteins. Analysis of viral DNA by in situ hybridization with a biotinylated HSV probe confirmed efficient viral DNA replication in human glioma cells when infected with the engineered HSV. These findings were comparable to that seen in glioma cells when infected with the wild-type or the restored viruses. The direct cytolytic effect of these engineered viruses was measured quantitatively in vitro on malignant cells by the alamarBlue assay (Accumed, Westlake, OH), which assesses cell viability. As compared with the maximum cell viability (100%), reductions in alamarBlue dye conversion produced by the virus-induced cell lysis were generated as a function of the multiplicity of infection. All the human glioma cell lines tested were sensitive to the cytotoxic effects of the engineered HSV. Importantly, the γ134.5 altered viruses required >1000-fold more virus for cell killing of human astrocytes obtained from normal human cerebral cortical tissue. A series of in vivo experiments were performed to establish the effects of these genetically engineered viruses. First, to confirm the absence of neurovirulence, all genetically engineered viruses were evaluated by intracerebral injections, resulting in LD50>107 pfu—data similar to earlier observations with R3616 and R4009. Second, tumor development in the xenogeneic scid mouse model was assessed histopathologically following the inoculation of 106 D54MG cells into the CNS. Three days later, the animals were killed and the distribution of the tumor was ascertained by histopathologic examination of fixed brain tissue. As shown in Fig. 1, a large tumor mass can be observed in the right hemisphere at the site of injection, with smaller masses in the dorsal portion of the third ventricle and in the lateral ventricle. For the in vivo therapeutic glioma model, R4009 was selected since it extended survival of animals in the syngeneic murine model longer than R3616. Both U251MG and D54MG cells were used as intracranial glioma xenograft with 106 glioma cells implanted as described previously. Untreated scid mice injected intracranially with U251MG cells had an average median survival rate of 34 days, whereas mice receiving D54MG cells became moribund at a more rapid rate with an average median survival of 20 days. Tumors produced by D54MG are more aggressive than U251MG tumors, providing an opportunity to compare the effects of R4009 on slow-growing versus more rapid-growing tumors in the same host strain. Notably, both human tumors were less aggressive in vivo than the murine tumor previously studied. Both Winn-type and delayed-treatment studies were performed. In the Winn-type assay, 1 or 10×106 pfu of R4009 were mixed with 106 U251MG tumor cells before injection. In these studies, the median survival time increased from 33 days

FIG. 1. Photomicrographs of hematoxylin/eosin (HE)-stained D54MG-induced gliomas in C.B.-17 scid/scid mice killed 21 days posttumor induction. (A) Coronal section demonstrating a large tumor mass in the right hemisphere at the site of injection, with smaller masses in the dorsal portion of the third and lateral ventricles. (B) Higher magnification of the large tumor mass; arrowheads indicate area of necrosis, palisaded by tumor cells.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

THE APPLICATION OF GENETICALLY ENGINEERED HERPES SIMPLEX VIRUSES TO THE TREATMENT OF EXPERIMENTAL BRAIN TUMORS

11316

in saline-treated control animals to 48 and 49 days, respectively. Importantly, long-term survivors (>75 days) accounted for 20 and 30% of the U251MG-bearing mice. Likewise, when the more aggressive D54MG cells were admixed with the virus and implanted intracranially, R4009 significantly prolonged survival at 0.5×106 and 5.0×106 pfu of virus injected. Compared with the median survival of 18 days for control (animals receiving 106 D54MG glioma cells mixed with an equivalent volume of saline), all tumor-bearing animals treated with the lower pfu of R4009 survived and 40% of mice that received the higher pfu of R4009 were long-term survivors.

FIG. 2. Kaplan-Meier survival plots for scid mice injected intracranially with 106 D54MG human glioma cells, followed by R4009 inoculation 5 days later into the tumor bed. Mice were randomized into groups of 10, reoperated upon, and injected intratumorally with saline ( ` ) or 1×106 pfu ( ` ) or 1×107 pfu ( ` ) R4009. Survivors were killed 80 days after viral inoculation. Since Winn-type assays are less stringent models for demonstrating antitumor effects, delayed treatment was undertaken to more closely mimic clinical therapy. Thus, when U251MG cells were implanted and inoculated with the virus 5 days later, median survival times increased to 36 and 56 days for 1 and 10 multiplicity of infection, respectively, as compared with saline-treated animals (33 days). Some of the virustreated animals (25%) were long-term survivors, whereas all the saline-treated animals died. Since D54MG glioma cells killed mice at a much more rapid pace than U251MG cells, the inocula of R4009 administered 5 days after induction of the tumors was increased. Although these mice survived significantly longer (P<0.015) than the mock-treated control mice, the 2-fold higher dose did not increase the number of longterm survivors (only 10% in either group with HSV-treated tumors). The survival of treated and control animals is displayed in Fig. 2. Third, the kinetics of virus replication in the U251MG tumor were evaluated. Animals bearing U251MG gliomas were injected intracranially with 106 or 107 R4009 5 days after tumor induction. Brain tissue was harvested at 3, 7, and 11 days postinfection and an HSV replication assay was performed. Virus was detected 3 days postinoculation, with peak viral recovery occurring approximately around 7 days. HSV-1(F) was used as positive control but none survived beyond day 6. Fourth, detailed examination of tissue specimens was performed to assess status of the tumor. Moribund animals (saline-treated) and longterm, tumor-bearing survivors (virus-treated) were killed, and brain tissues were fixed and subjected to routine hematoxylin/eosin staining. The saline-treated, tumor-bearing brains revealed large, space-occupying tumors, whereas survivors killed at 75–80 days had no evidence of discernible tumors. Hematoxylin/eosin-stained coronal sections of brains of treated mice with tumor resolution appeared relatively normal, as shown in Fig. 3. Surprisingly, when assayed for virus, some of the brains from long-term survivors harbored residual HSV, suggesting that replicating (gliotic) astrocytes may provide a reservoir for virus replication in an otherwise mitotically quiescent tissue. The architecture of the surrounding brain appeared normal. This observation may be unique to scid mice, which are unable to elicit normal immune response to control the viral infection. Similar studies using a γ134.5 deletion mutant derived from strain 17 demonstrated no recovery of replicating virus in immune competent mice bearing melanomas (42). However, persistent HSV infection in normal brain tissues is clearly of concern. Since the γ134.5 deletion viruses retain the HSV thymidine kinase gene, they remain susceptible to acyclovir or ganciclovir. Theoretically, antiviral treatment can commence after a significant oncolytic effect has been achieved but before toxicity to brain parenchyma occurs. (The engineered HSVs are sensitive to acyclovir with an EC50 value of 0.5 µg/ml, which is consistent with known susceptibility of HSV.) Engineered Viruses with Enhanced Oncolytic Activity: Homologous Cellular Genes. When cells of human origin, such as neuroblastoma, human foreskin fibroblasts (HFS), and HeLa, are infected with HSV having perturbed expression of γ134.5, host protein synthesis ceases with the onset of DNA replication. In contrast, infection of Vero cells results in sustained protein synthesis (45–48). Host protein shut off has been mapped to the carboxyl terminus of γ134.5 gene (48). A stretch

FIG. 3. Photomicrographs of hematoxylin/eosin-stained D54MG tumors treated with 1×107 pfu of R4009 from long-term survivors killed at 80 days. (A) Coronal section of whole brain showing tumor regression. (B) Higher magnification indicates that the normal architecture of the brain was intact.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

THE APPLICATION OF GENETICALLY ENGINEERED HERPES SIMPLEX VIRUSES TO THE TREATMENT OF EXPERIMENTAL BRAIN TUMORS

11317

of 64 amino acids at the carboxyl terminus domain of the gene is homologous to a corresponding stretch of a murine protein, MyD116, and a hamster protein, GADD34 (48–51). MyD116 represents a subset of myeloid differentiation primary response genes (50) and GADD34 is the hamster homologue of MyD116 that is expressed during DNA damage and growth arrest (51). Viruses constructed with the substitution of the homologous region of the MyD116 at the carboxyl terminus of the γ134.5 gene are unable to cause premature shut off of total protein synthesis in infected human cells (52). This may be advantageous for tumor therapy, since R8309 allows continued protein synthesis while maintaining decreased neurovirulence. Replication competence of R8309 was assessed in the aforementioned human glioma cell lines, U251MG and D54MG. Replication peaked at 48 hr postinfection at 4×106 pfu/ml in U251MG cells and 2×104 in D54MG cells (multiplicity of infection of 1). The alamarBlue cytotoxicity assay revealed that R8309 effectively lysed tumor cells in vitro. An in vivo CNS toxicity assay performed in scid mice resulted in a pfu/LD50 ratio>2.65×106 pfu. To assess the effectiveness of R8309 on established tumors, virus was injected in scid mice with D54MG gliomas. Two doses of R8309, 2.65×106 pfu and 2×105 pfu, were used and resulted in a median survival rate increase from 19 days in control animals to 26 days at 2×105 pfu of R8309. The higher inoculum of virus was not associated with a significant increase in survival. The KaplanMeier survival plots for these studies appears in Fig. 4.

Conclusion Over the past 10 years, many investigative teams have attempted to use viruses as either indirect or direct modalities for the treatment of experimental brain tumors. Indeed, the use of retrovirus-transformed cells that contain the gene for HSV thymidine kinase followed by ganciclovir therapy is currently under investigation in human trials (5). Such studies are grounded in the recognition that ganciclovir selectively kills those cells that are capable of metabolizing this drug, namely because of expression of HSV thymidine kinase. These landmark studies provide a basis for novel approaches to the treatment of the most common and uniformly fatal tumor of the CNS. The clinical effectiveness of this approach remains to be established. Even if efficacious, alternative approaches to the management of brain tumors will be necessary. The utilization of engineered HSV viruses provide an alternative approach to brain tumor therapy. The seminal recognition of the role of the γ134.5 gene in neurovirulence is essential to the development of safe viruses for intracerebral administration (43). Furthermore, the data summarized indicate for the first time to our knowledge, that engineered HSV viruses can confer long-term survival with uniform tumor reduction after the establishment of malignant human gliomas in the CNS of scid mice. These survivors have no evidence of residual tumor, although a small percentage have persistent virus, a concern that will require further investigation. Regardless, the observation of long-term survival with tumor eradication is a landmark in experimental CNS antitumor therapy.

FIG. 4. Kaplan-Meier survival plots of C.B.-17 scid/scid mice injected intracranially with D54MG human glioma cells and treated 5 days later with 2×105 pfu ( ` ) of R8309. The control animals were injected with saline (` ). In these studies, an enhanced survival effect was best illustrated by a virus containing stop codons in the γ134.5 gene. The use of such a virus in human studies must be carefully considered as revertants are theoretically likely to occur, resulting in a virulent virus with the potential for causing encephalitis. Thus, our future efforts will explore genetically engineered viruses that represent specific gene deletions or foreign gene inserts to avoid the potential for such reversion. One such example is the generation of a virus that contains the MyD116 sequence. This virus has enhanced in vivo antitumor activity that is currently explored to optimize its activity. A few comments are in order about requirements for the evaluation of experimental viral therapeutics. Studies such as the ones described above require further validation before progressing to human therapies. First, extensive histopathological and immunohistochemical evaluations of treated CNS tissues are necessary to confirm absence of tumor and residual HSV. Second, the selection of the proper animal models and associated tumor cells are of paramount importance. Clearly, selection of an animal system that is not permissive for HSV replication (i.e., the rat) can lead to erroneous conclusions. Similarly, the utilization of cells that do not parallel human tumors can similarly lead to irrelevant conclusions. Third, the development of models that most closely mimic human disease is most desirable. Winn-type assays provide excellent screening methods but do not provide conditions more analogous to human tumors. Finally, before evaluating any HSV construct in humans, detailed assessment of virulence in the Aotus trivargatus will be mandatory. Aotus is exquisitely sensitive to HSV (53) and provide a highly stringent model to assess neurovirulence of candidate therapeutic HSV for malignant brain tumors. Perturbations in the expression of the γ134.5 gene provide a foundation for future experimental viral therapy of malignant gliomas. Fundamental to the development of human therapeutics is the requirement for enhanced knowledge of the behavior of these viruses in biologic systems. Application of this knowledge to devising successful therapeutic for the treatment of brain tumors may provide an opportunity to extend substantially lifespan of patients with malignant gliomas. The studies performed at The University of Alabama at Birmingham were supported by an unrestricted grant in infectious diseases from Bristol-Myers Squibb and grants from the National Institute of Allergy and Infectious Diseases (AI 24009), the National Cancer Institute (CA 13148), the Department of Energy (DE-FGO5– 93ER61654), and the State of Alabama. The studies performed at the University of Chicago were aided by grants from the National Cancer Institute (CA 47451) and the National Institute of Allergy and Infectious Diseases (AI 24009) of the U.S. Public Health Service. 1. Levine, A.L., Sheline, G.E. & Gutin, P.H. (1989) in Cancer: Principles and Practice of Oncology, eds. Devita, V.T., Hellman, S. & Rosenberg, S.A. (Lippincott, Philadelphia), pp. 1557–1611. 2. Schoenberg, B.S. (1983) in Oncology of the Nervous System, eds. Walker, M.D. (Nijhoff, Boston), pp. 1–30. 3. Mahaley, M.S., Jr., Mettlin, C, Natarajan, N., Laws, E.R., Jr., & Peace, B.B. (1989) J. Neurosurg. 71, 826–836. 4. Walker, M.D., Green, S.B., Byar, D.P., Alexander, E., Jr., Batzdorf, U., Brooks, W.H., Hunt, W.E., MacCarty, C.S., Mahaley, M.S., Jr., Mealey, J., Jr., Owens, G., Ransohoff, J.D.,

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

THE APPLICATION OF GENETICALLY ENGINEERED HERPES SIMPLEX VIRUSES TO THE TREATMENT OF EXPERIMENTAL BRAIN TUMORS

11318

Robertson, J.T., Shapiro, W.R., Smith, K.R., Jr., Wilson, C.B. & Strike, T.A. (1980) N. Engl. J. Med. 303, 1323–1329. 5. Culver, K.W., Ram, Z., Wallbridge, S., Ishii, H., Oldfield, E.H. & Blaese, R.M. (1992) Science 256, 1550–1552. 6. Mullen, C.A., Kilstrup, M. & Blaese, R.M. (1992) Proc. Natl. Acad. Sci. USA 89, 33–37. 7. Aoki, T., Tashiro, K., Miyatake, S., Nakano, T., Oda, Y., Kikuchi, H. & Honjo, T. (1992) Proc. Natl. Acad. Sci. USA 89, 3850–3854. 8. Oldfield, E.H., Ram, Z., Culver, K.W., Blaese, R.M. & DeVroom, H.L. (1993) Hum. Gene Ther. 4, 39–69. 9. Takamiya, Y., Short, M.P., Moolten, F.L., Fleet, C., Mineta, T., Breakefield, X.O. & Martuza, R.L. (1993) J. Neurosurg. 79, 104–110. 10. Yu, J.S., Wei, M.X., Chiocca, E.A., Martuza, R.L. & Tepper, R.I. (1993) Cancer Res. 53, 3125–3128. 11. Ram, Z., Culver, K.W., Wallbridge, S., Frank, J.A., Blaese, R.M. & Oldfield, E.H. (1993) J. Neurosurg. 79, 400–409. 12. Trojan, J., Johnson, T.R., Rudin, S.D. & Ilan, J. (1993) Science 259, 94–97. 13. Boviatsis, E.J., Scharf, J.M., Chase, M., Harrington, K., Kowall, N.W., Breakefield, X.O. & Chiocca, E.A. (1994) Gene Ther. 1, 323–331. 14. Chen, S.H., Shine, H.D., Goodman, J.C., Grossman, R.J. & Woo, S.L.C. (1994) Proc. Natl. Acad. Sci. USA 91, 3054–3057. 15. Perez-Cruet, M.J., Trask, T.W., Chen, S.H., Goodman, J.C., Woo, S.L.C., Grossman, R.G. & Shine, H.D. (1994) J. Neurosci. Res. 39, 506–511. 16. Raffel, C., Culver, K., Kohn, D., Nelson, M., Siegel, S., Gillis, F., Link, C.J. & Villablanca, J.G. (1994) Hum. Gene Ther. 5, 863–890. 17. Wu, J.K., Cano, W.G., Meylaerts, S.A., Qi, P., Vrionis, F. & Cherington, V. (1994) Neurosurgery 35, 1094–1102. 18. Huber, B.E., Austin, E., Richard, C.A., Davis, S.T. & Good, S.S. (1994) Proc. Natl. Acad. Sci. USA 91, 8302–8306. 19. Kim, J.H., Kim, S.H., Brown, S.L. & Fraytag, S.O. (1994) Cancer Res. 54, 6053–6056. 20. Mullen, C.A., Coale, M.M., Lowe, R. & Blaese, R.M. (1994) Cancer Res. 54, 1503–1506. 21. Weichselbaum, R.R., Hallahan, D.E., Beckett, M.A., Mauceri, H.J., Lee, H., Sukhatme, V.P. & Kufe, D.W. (1994) Cancer Res. 54, 4266–4269. 22. Asai, A., Miyagi, Y., Hashimoto, H., Lee, S.H., Mishima, K., Sugiyama, A., Tanaka, H., Mochizuki, T., Yasuda, Y. & Kuchino, Y. (1994) Cell Growth Differ. 5, 1153–1158. 23. Ram, Z., Wallbridge, S., Heiss, J.D., Culver, K.W., Blaese, R.M. & Oldfield, E.H. (1994) J. Neurosurg. 80, 535–540. 24. Tepper, R.I. & Mul, J.J. (1994) Hum. Gene Ther. 5, 153–164. 25. Yagi, K., Hayashi, Y., Ishida, N., Obayashi, M., Ohshi, N., Mizuno, M. & Yoshida, M. (1994) Biochem. Int. 32, 167–171. 26. Resnicoff, M., Sell, C., Rubini, M., Coppola, D., Ambrose, D., Baserga, R. & Rubin, R. (1994) Cancer Res. 54, 2218–2222. 27. Van Meir, E.G., Polverini, P.J., Cazin, V.R., Su Huang, H.J., de Tribolet, N. & Cavenee, W.K. (1994) Nat. Genet. 171–176. 28. Colombo, B.M., Benedetti, S., Ottolenghi, S., Mora, M., Pollo, B., Poli, G. & Finocchiaro, G. (1995) Hum. Gene Ther. 6, 763–772. 29. Tjuvajev, J., Gansbacher, B., Desai, R., Betattie, B., Kaplitt, M., Matei, C., Koutcher, J., Gilboa, E. & Blasberg, R. (1995) Cancer Res. 55, 1902– 1910. 30. Wei, M.X., Tamiya, T., Hurfuord, R.K.J., Boviatis, E.J., Tepper, R.I. & Chiocca, E.A. (1995) Hum. Gene Ther. 6, 437–443. 31. Redekop, G.J. & Naus, C.C.G. (1995) J. Neurosurg. 82, 83–90. 32. Van Meir, E.G., Huang, H.J., de Tribolet, N. & Cavenee, W.K. (1995) Proc. Natl. Acad. Sci. USA 92, 1008–1012. 33. Badie, B., Drazan, K.E., Kramer, M.H., Shaked, A. & Black, K.L. (1995) Neurolog. Res. 17, 209–216. 34. Martuza, R.L. (1993) in Molecular Genetics of Nervous System Tumors, eds. Levine, A.J. & Schmidek, H.H. (Wiley-Liss, New York), pp. 381–386. 35. Martuza, R.L., Malick, A., Markert, J.M., Ruffner, K.L. & Coen, D.M. (1991) Science 252, 854–856. 36. Markert, J.M., Malick, A., Coen, D.M. & Martuza, R.L. (1993) Neurosurgery 32, 597–603. 37. Mineta, T., Rabkin, S.D. & Martuza, R.L. (1994) Cancer Res. 54, 3963–3966. 38. Chambers, R., Gillespie, G.Y., Soroceanu, L., Andreansky, S., Chatterjee, S., Chou, J., Roizman, B. & Whitley, R. (1995) Proc. Natl. Acad. Sci. USA 92, 1411–1415. 39. Mineta, T., Rabkin, S.D., Yazaki, T., Hunter, W.D. & Martuza, R.L. (1995) Nat. Med. 1, 938–943. 40. Jia, W.G.J., McDermott, M., Goldie, J., Cynader, M., Tan, J. & Tufaro, F. (1994) J. Natl. Cancer Inst. 86, 1209–1215. 41. Kaplitt, M.G., Tjuvajev, J.G., Leib, D.A., Berk, J., Pettigrew, K.D., Posner, J.B., Pfaff, D.W., Rabkin, S.D. & Blasberg, R.G. (1994) J. Neuro-Oncol. 19, 137–147. 42. Randazzo, B.P., Kesari, S., Gesser, R.M., Alsop, D., Ford, J., Brown, S.M., Maclean, A. & Fraser, N.W. (1995) Virology 211, 94–101. 43. Chou, J., Kern, E.R., Whitley, R.J. & Roizman, B. (1990) Science 250, 1262–1266. 44. Whitley, R., Kern, E.R., Chatterjee, S., Chou, J. & Roizman, B. (1993) J. Clin. Invest. 91, 2837–2843. 45. Chou, J. & Roizman, B. (1992) Proc. Natl. Acad. Sci. USA 89, 3266–3270. 46. Chou, J., Chen, J.J., Gross, M. & Roizman, B. (1995) Proc. Natl. Acad. Sci. USA 92, 10516–10520. 47. Chou, J., Poon, A.P.W., Johnson, J. & Roizman, B. (1994) J. Virol. 68, 8304–8311. 48. Chou, J. & Roizman, B. (1994) Proc. Natl. Acad. Sci. USA 91, 5247–5251. 49. McGeoch, D.J. & Barnett, B.C. (1991) Nature (London) 353, 609. 50. Lord, K.A., Hoffman-Liebermann, B. & Liebermann, D.A. (1990) Nucleic Acids Res. 18, 2823. 51. Fornace, A.J., Jr., Nebert, D.W., Hollander, M.C., Leuthy, J.D., Papathanasiou, M., Fargnoli, J. & Holbrook, N.J. (1989) Mol. Cell. Biol. 9, 4196– 4203. 52. He, B., Chou, J., Liebermann, D.A., Hoffman, B. & Roizman, B. (1996) J. Virol. 70, 84–90. 53. Meignier, B., Martin, B., Whitley, R.J. & Roizman, B. (1990) J. Infect. Dis. 162, 313–322.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

REPLICATION-DEFECTIVE HERPES SIMPLEX VIRUS VECTORS FOR GENE TRANSFER IN VIVO

11319

This paper was presented at a colloquium entitled “Genetic Engineering of Viruses and of Virus Vectors,” organized by Bernard Roizman and Peter Palese (Co-chairs), held June 9–11, 1996, at the National Academy of Sciences in Irvine, CA.

Replication-defective herpes simplex virus vectors for gene transfer in vivo (gene therapy/neurons/latency) PEGGY MARCONI*, DAVID KRISKY*, THOMAS OLIGINO*, PIETRO L.POLIANI†, RAMESH RAMAKRISHNAN*†, WILLIAM F.GOINS*, DAVID J.FINK*†, AND JOSEPH C.GLORIOSO*‡ *Department of Molecular Genetics and Biochemistry, University of Pittsburgh School of Medicine, Pittsburgh, PA 15261; and †Department of Neurology, University of Pittsburgh School of Medicine, and Veterans Affairs Medical Center, Pittsburgh, PA 15261 Herpes simplex virus 1 has a number of biological features which suggest that it could be engineered as a vector for direct transfer of therapeutic genes to neurons. These features include (i) its natural ability to establish life-long latency, a state in which the viral genome is not integrated, lytic genes are quiescent, and the metabolic functioning of the host cell is apparently undisturbed; (ii) the expression of latencyassociated transcripts (LATs) driven by neuron-specific, latency-active promoter (LAP) elements, which may prove useful in expressing transgenes from latent viral genomes; and (iii) the observation that replication-defective mutants created by the deletion of essential genes retain the ability to establish a latent state in the nervous system (1). In addition, many of the 81 herpes simplex virus (HSV) genes are not required for viral replication in cell culture and may conveniently be deleted to provide space for incorporation of substantial foreign DNA, and almost all viral genes are contiguous units, making genetic manipulation feasible. The virus can also be grown to high titer, and viral infectivity is very efficient. The major impediments to the development of HSV-effective vectors relate to residual cytotoxicity of defective vectors and the limited duration of transgene expression. Even replication-incompetent mutant viruses are cytotoxic, readily killing neurons in vitro, and with the exception of the HSV LAP elements, viral and foreign promoters appear to come under control of the virus’ ability to rapidly induce mechanisms of promoter shutoff. Two different types of HSV-based gene delivery systems have been developed. The first type consists of genetically engineered genomic vectors, which may be deleted in genes required for the virus to replicate in postmitotic cells such as neurons or may be completely replicationdefective, requiring complementation for vector propagation. The second type of HSV-based vector system, referred to as amplicons, uses defective helper-virus mutants for packaging concatemeric plasmids containing an HSV origin of DNA synthesis and a packaging sequence. We have focused our efforts on the development of replication-defective genomic vectors. The “first generation” defective genomic vectors were deleted in the single essential immediate early (IE) gene encoding ICP4 (e.g., d120) (2). These vectors can be propagated in ICP4-complementing cell lines, but on infection of neurons, viral gene expression is aborted at the level of IE gene expression. Although these vectors are of reduced pathogenicity and can be used to efficiently transfer and transiently express reporter genes in brain (see below), they are toxic to neurons in culture, producing cytopathic effects such as cytoplasmic blebbing, host cell DNA fragmentation, and chromosomal aberrations (3). It is presumed that residual cytotoxicity results from the expression of HSV gene products, because UV-irradiated viral particles are not toxic and interferon treatment to disrupt IE gene expression markedly reduces cytotoxicity. Although deletion of the gene coding for ICP4 aborts the expression of both early and late viral genes, the other four immediate early gene products and ICP6, the ribonucleotide reductase large subunit, are overexpressed in the absence of ICP4. ICP4, ICP0, ICP27, and ICP22 have all been shown to be toxic in stable transfection assays (4), so deletion of these genes in combination may be required to eliminate toxicity. UL41, although not an IE gene product, is present in the virion and is responsible for shutoff of host cell protein synthesis through destabilization of host cell mRNA (5); in addition, UL41 many reduce transgene expression from HSV vectors. ICP6 and ICP47 do not appear to contribute to viral toxicity, and indeed, ICP47 expression may prove to be an asset because it contributes to escape from host immune surveillance (6). To date we have succeeded in constructing the required complementing cell line and producing vectors in which all five targeted genes have been deleted in various combinations, although we have not produced a single mutant lacking all the targeted genes (Table 1). The deleted genes include those encoding ICP0, ICP4, ICP27, ICP22(US1.5), and UL41; one mutant has been deleted for all IE genes except those coding for ICP0 and ICP47 and shows substantially reduced cytotoxicity on infection of Vero cells at multiplicities of infection up to 50. Infection with this vector results in both vector persistence without genome integration and sustained transgene expression, and it does not block cell division. Cortical neurons in culture infected with either the triple-deleted (THZ.2) and quadruple deleted (THZ.3) vectors show substantial neuronal survival up to 2 weeks, in contrast to the singly deleted ICP4− vector SHZ.1, which kills these cultured cells within 24 hr. Experimental studies in rats have demonstrated relatively efficient and robust transient transgene expression in brain after direct intracranial inoculation with a number of different vectors. Although singly deleted viruses are toxic to neurons in culture, animals uniformly survive direct injection of these replication-defective or incompetent vectors into brain with only minor pathologic evidence of cell loss. Reporter genes under the control of herpes simplex viral (gC) or other viral human cytomegalovirus IE, mammalian neurofilament, or

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact. Abbreviations: HSV, herpes simplex virus; LAT, latency-associated transcript; LAP, latency-active promoter; IE, immediate early; HCMV, human cytomegalovirus. ‡To whom reprint requests should be addressed at: Department of Molecular Genetics and Biochemistry, University of Pittsburgh School of Medicine, E1240 Biomedical Science Tower, Pittsburgh, PA 15261. e-mail: [email protected].

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

REPLICATION-DEFECTIVE HERPES SIMPLEX VIRUS VECTORS FOR GENE TRANSFER IN VIVO

11320

neuron-specific enolase) promoters placed in various sites in these vectors all demonstrate robust transient transgene expression peaking 2–3 days after inoculation but disappearing by 1 week after inoculation. The loss of transgene expression is not due to elimination of latent virus from brain. Latent HSV genomes can be demonstrated by PCR analysis up to 1 year after inoculation (11), and the number of persisting genomes determined by quantitative competitive PCR does not change between 1 and 8 weeks after inoculation (12). The time course of transgene expression is similar to that of viral replication, despite the fact that these vectors are incapable of replicating in brain and early viral genes (e.g., gB) remain undetectable; by the time latency would normally be established, transgene expression is silenced.

Table 1. Recombinant HSV vectors Gene deletions Virus name KOS321 None KHZ:tk tk− d120 ICP4− SHZ.1 ICP4−, tk− DHZ.1 ICP4−, ICP22− 5dL1.2 ICP27− D0Z.1 ICP0−, ICP27− THZ.2 ICP4−, ICP22−, ICP27− T.2 ICP4−, ICP22−, ICP27− S0Z.1 ICP4−, UL41− T0Z.1 ICP4−, ICP22−, ICP27−, UL41− THZ.3 ICP4−, ICP22−, ICP27−, UL41− T.3 ICP4−, ICP22−, ICP27−, UL41−

Transgenes, locus::promoter gene None tk::HCMV-lacZ None tk::HCMV-lacZ ICP22::HCMV-lacZ None ICP0::ICP0-lacZ ICP22::HCMV-lacZ None UL41::ICP0-lacZ UL41::ICP0-lacZ ICP22::HCMV-lacZ None

Cell survival*, % 0 0 2 2 18–30 N.D. N.D. 55–80 60–90 N.D. N.D. 60–90 N.D.

Source 7 8 2 9 Unpublished data 10 Unpublished data Unpublished data Unpublished data Unpublished data Unpublished data Unpublished data Unpublished data

*Cytotoxicity studies were performed in our lab and are expressed as the percentage of Vero cells that survive 48 hr after infection at a multiplicity of infection of 3. HCMV, Human cytomegalovirus; N.D., not done.

Latent vector genomes like latent wt virus continue to produce HSV LATs detectable by in situ hybridization and by reverse transcriptionPCR, long after transgene expression is no longer detectable. Therefore, one strategy we have pursued is the use of the LAP element to drive transgene expression. Two different LAP sequences have been identified. LAP1 is a TATA-box containing promoter but lies 700 bp upstream of the 5
end of the LAT intron, whereas the weaker LAP2 element lies directly upstream of LAT and is homologous to mammalian housekeeping gene promoters. Vectors with the reporter gene inserted into the native LAT intron, and therefore lying downstream of both LAP1 and LAP2, continue to express lacZ detectable by reverse transcription-PCR at 4 weeks after inoculation. Others have demonstrated that the LAP1 element loses its activity when transported to an ectopic locus within the viral genome (13), but we have found that LAP2-driven lacZ expression is detectable by reverse transcription-PCR for at least 2 weeks after direct inoculation into the brain. Several strategies, including constitutive autoenhancing and drug-inducible enhancer elements, that we have engineered into transiently expressing HSV vectors might be applied to increase the low level of persistent transgene expression achieved with this promoter. A surprising finding that has emerged recently in studies of the multiply deleted viruses is that there appears to be a “failure” of remaining IE gene shutoff in these vectors, with HCMV-driven transgene expression persisting in a similar fashion. The triply deleted (THZ.2) vector continues to express ICP0 RNA for 2 weeks after intracranial inoculation and in vitro in cultures of cortical neurons. With this vector, lacZ expression driven by the HCMV IE promoter can be detected at 4 weeks both in vivo and 2 weeks in vitro. This suggests that in addition to reduced cytotoxicity, the multiply deleted vectors may provide a platform for long-term gene expression by allowing a variety of promoters to escape the natural silencing mechanism characteristic of HSV latency. The HSV vectors described above are substantially improved both in terms of cytotoxicity and transgene expression. Viral IE gene deletion mutants that express only the transgene and the IE ICP47 gene should be highly effective for gene transfer without toxicity for brain. Moreover, infected neurons should be greatly protected from immune recognition by the action of the ICP47 gene product. 1. Fink, D., DeLuca, N., Goins, W. & Glorioso, J. (1996) Annu. Rev. Neurosci. 19, 265–287. 2. DeLuca, N.A., McCarthy, A.M. & Schaffer, P.A. (1985) J. Virol. 56, 558–570. 3. Johnson, P.A., Miyanohara, A., Levine, F., Cahill, T. & Friedmann, T. (1992) J. Virol. 66, 2952–2965. 4. Johnson, P. A, Wang, M.J. & Friedmann, T. (1994) J. Virol. 68, 6347–6362. 5. Oroskar, A. & Read, G. (1989) J. Virol. 63, 1897–1906. 6. York, I., Roo, C., Andrews, D., Riddell, S., Graham, F. & Johnson, D. (1994) Cell 77, 525–535. 7. Schaffer, P.A., Carter, V.C. & Timbury, M.C. (1978) Virology 27, 490–504. 8. Rasty, S., Goins, W.F. & Glorioso, J.C. (1995) Methods Mol. Genet. 7, 114–130. 9. Mester, J.C., Pitha, P. & Glorioso, J.C. (1995) Gene Ther. 3, 187–196. 10. McCarthy, A.M., McMahan, L. & Schaffer, P.A. (1989) J. Virol. 63, 18–27. 11. Fink, D.J., Sternberg, L.R., Weber, P.C., Mata, M., Goins, W.F. & Glorioso, J.C. (1992) Hum. Gene Ther. 11–19. 12. Ramakrishnan, R., Fink, D.J., Guihua, J., Desai, P., Glorioso, J.C. & Levine, M. (1994b) J. Virol. 68, 1864–1870. 13. Lokensgard, J.R., Bloom, D.C., Dobson, A.T. & Feldman, L.T. (1994) J. Virol. 68, 7148–7158.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

A DELETION MUTANT IN THE HUMAN CYTOMEGALOVIRUS GENE ENCODING IE1491AA IS REPLICATION DEFECTIVE DUE TO A FAILURE IN AUTOREGULATION

11321

This paper was presented at a colloquium entitled “Genetic Engineering of Viruses and Virus Vectors,” organized by Bernard Roizman and Peter Palase (Co-chairs), held June 9–11, 1996, at the National Academy of Sciences in Irvine, CA.

A deletion mutant in the human cytomegalovirus gene encoding IE1491aa is replication defective due to a failure in autoregulation EDWARD S.MOCARSKI*†, GEORGE W.KEMBLE‡, JOHN M.LYLE*, AND RICHARD F.GREAVES*§ *Department of Microbiology and Immunology, Stanford University School of Medicine, Stanford, CA 94305–5402; and ‡Aviron, Mountain View, CA 94043 ABSTRACT Human cytomegalovirus (CMV) replication begins with the expression of two regulatory proteins, IE1491aa and IE2579aa, produced from differentially spliced transcripts under control of the ie1/ie2 promoter-enhancer. A deletion mutation removing all 406 IE1491aa-specific amino acids was engineered into the viral genome and this mutant (RC303∆Acc) was propagated on an IE1491aa-expressing human fibroblast cell line (ihfie1.3). RC303∆Acc failed to replicate on normal human fibroblasts at low multiplicities of infection (mois). At mois >3 plaque-forming units per cell, virus replication and production of progeny were comparable to wild type. However, at mois between 0.01 and 1, mutant virus replicated slowly on normal fibroblasts, a pattern that suggested initiation of productive infection required multiple hits. Replication of RC303∆Acc correlated with the ability to express IE2579aa, consistent with a role for IE1491aa in positive autoregulation of the ie1/ie2 promoter-enhancer and with data suggesting that virion transactivators compensate for the lack of IE1491aa under high moi conditions, ie1-deficient CMV should be completely avirulent, suggesting its utility as a gene therapy vector for hematopoietic progenitors that are normal sites of CMV latency. Human cytomegalovirus (CMV), a herpesvirus with a very large, 235-kbp genome and a coding capacity that exceeds 220 ORFs (1, 2), is recognized for its ability to cause acute disease in the immunocompromised host and in the developing fetus (3). Productive replication is believed to depend upon expression of two nuclear phosphoproteins, IE1491aa and IE2579aa, expressed prominently as α (IE) gene products during infection. Both proteins share 85 amino-terminal amino acids (aa) due to alternative splicing and polyadenylylation (4–6) of transcripts initiating at a strong promoter-enhancer (7, 8). Based on functional assays, both are believed to play key transcriptional regulatory roles during replication (for review, see ref. 9). IE2579aa is likely to be responsible for the switch from α to β gene expression (10–12) as well as for the shutoff of the ie1/ie2 promoter via a specific cis-repression signal to which it binds (13, 14). IE1491aa was originally identified as the “major immediate early” protein (15) and appears to play a role in activation of viral and cellular gene expression, alone or in combination with IE2579aa (10, 11, 16, 17). IE1491aa has been assigned an autoregulatory role during replication, exhibiting a capacity to transactivate expression from the ie1/ie2 promoter-enhancer via NF- B sites (16, 17). Evidence has supported a role for IE1491aa in the transactivation of other cellular promoter elements, including the E2F (18) and NF-βA (19) binding sites, the CCAAT box (20), and additional less-defined sites (21, 22). IE1491aa also exhibits the capacity to augment transactivation in combination with the strong heterologous transactivator, IE2579aa, without having any effect by itself, on a number of different simple promoters (10, 11, 21, 23). Although not necessarily related to its role in gene regulation, IE1491aa has also been reported to localize to metaphase chromatin (24) and to block adenovirus E1a-induced apoptosis (25). Direct investigation of the role that IE1491aa plays during viral replication requires ie1-deficient viral mutants. Here, a deletion that removes all IE1491aa-specific coding sequences is used to demonstrate an important role for this protein during viral replication in culture. The phenotype we observe is consistent with a failure of ie1-deficient virus to activate expression from the ie1/ie2 promoter-enhancer and thereby ensure sufficient levels of IE2579aa for initiation of productive replication. While critical at low multiplicities of infection (mois), infection at intermediate to high mois compensates for the lack of IE1491aa, suggesting that transactivators in the virion tegument (26, 27) can function in place of this α gene product. The growth characteristics of mutant virus suggests potential use as a replication-impaired human-specific vector that can deliver genes to hematopoietic progenitor cells.

MATERIALS AND METHODS Viruses and Cells. The Towne strain of CMV was propagated in human fibroblasts (HFs) prepared from newborn foreskin and maintained in DMEM (GIBCO/BRL) supplemented with 10% NuSerum (Collaborative Research), amino acids and antibiotics as previously described (28). IE1491aa− expressing ihfie1.3 cells were derived from HFs by transduction with a murine retrovirus vector N2/CMV-IE (29) and selecting cells in medium containing Geneticin (GIBCO/ BRL) at 400 µg/ml followed by immortalization with the retroviral vector LXSN16E6E7 (30) as previously described (28). Following outgrowth, ihfie1.3 cells were carried in the absence of Geneticin, but continued to express constitutive levels of IE1491aa based on antibody-detection methods (unpublished observations). Stocks of recombinant viruses RC303∆Acc and Towne/Tol11 1.1 were propagated and plaque assayed on ihfie1.3 and HF cells, respectively, except where noted in the text. All mois of mutant virus were calculated from stock titers on ihfie1.3 cells and all virus stocks were prepared from infected cells exhibiting maximal cytopathic effects by sonication in a 1:1 mixture of cells in medium (at 106 cells per ml) and autoclaved nonfat milk.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact. Abbreviations: CMV, cytomegalovirus; moi, multiplicity of infection; wt, wild type; HF, human fibroblast; hpi, hours postinfection. †To whom reprint requests should be addressed. e-mail: [email protected]. §Present address: Department of Medicine, Cambridge University, Cambridge CB2 2QQ, United Kingdom.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

A DELETION MUTANT IN THE HUMAN CYTOMEGALOVIRUS GENE ENCODING IE1491AA IS REPLICATION DEFECTIVE DUE TO A FAILURE IN AUTOREGULATION

11322

Transfection. PacI-digested cosmids Tn23, Tn26, Tn44, Tn45, Tn46, Tn47, Tn51, and Tol11 (10 µm each) (31) were mixed with 2 µg of Sal-digested pON303∆Acc (or pON303) (16, 32). To construct RC303Acc or Towne/Tol11 1–1, 10 µg of the pON303∆Acc- or pON303containing cosmid mixtures were used to transfect 106 ihfie1.3 cells by the calcium phosphate precipitation technique as described (31). DNA Blot Hybridization and Immunoblot Analyses. Total infected cell DNA was isolated (33) from infected HF or ihfie1.3 cells; 1 µg was digested with EcoRI, ClaI, or BamHI (New England Biolabs) using the manufacturer’s recommended conditions and was transferred to Hybond-N+ (Amersham) before hybridization with [32P]dCTP (Amersham) random-primed radiolabeled pON303 or pON2307 (an exon 4specific probe) (34). Immunoblot analysis was performed according to published protocols using human CMV-seropositive antiserum, murine monoclonal antibodies CH443 (specific for exon 4; unpublished results) and CH160 (specific for exon 2; ref. 35), renamed 1203 (Goodwin Institute, Ft. Lauderdale, FL), or rabbit polyclonal antibody raised against the glutathione S-transferase fusion protein carrying aa 232– 400 of IE1491aa from exon 4. Horseradish peroxidase-conjugated goat anti-human IgG, goat anti-rabbit IgG, and goat anti-mouse IgG (Vector Laboratories) were used as secondary antibodies and blots were developed using the Enhanced Chemiluminescence System (Amersham) according to the manufacturer’s protocol.

RESULTS Construction of RC303∆Acc. Recombinant viruses were constructed from seven Towne strain cosmids (Tn23, Tn26, Tn44, Tn45, Tn46, Tn47, and Tn51) and one Toledo strain cosmid (Tol11) (31) that formed an overlapping set except for a 15-bp gap between Tn51 and Tol11 (170,506–170,520) as depicted in Fig. 1. This gap was bridged with either pON303∆Acc (16) or pON303 (32), resulting in the production of either ie1-deficient RC303∆Acc or wild-type (wt) Towne/ Tol11 1.1 (Fig. 1). We used established transfection conditions for generation of recombinant CMV (31). SalI-linearized plasmid was added in a molar amount equivalent to an individual of PacI-linearized cosmids and cotransfection of this mixture was carried out on ihfie1.3 cells to complement IE1491aa in trans. When the genome structure of the resulting recombinants was analyzed, two of five independent pools arising from the pON303∆Acc-containing set carried a uniform population of the expected mutant, and two pools made with pON303 contained the expected Towne/Toledo wt chimera (31). Blot hybridization of EcoRIdigested DNA from mutant RC303∆Acc and wt Towne/Tol11 1.1 transfection pools and from plaque pure RC303∆Acc produced the expected patterns (Fig. 2). Hybridization with pON303 probe revealed a 10-kbp EcoRI fragment in the wt virus, which was reduced to 8.6 kbp in the mutant (Fig. 2A). An ie1 exon 4 probe (pON2307) hybridized with the 10-kbp fragment in Towne/ Tol11 1.1 but failed to hybridize with any fragment in the mutant. A 3.9-kbp ClaI fragment containing ie1 was reduced to 2.5 kbp as a result of the deletion (Fig. 2B). After evaluation of BamHI digests (data not shown) and EcoRI and ClaI digests, we concluded that the two independent RC303∆Acc isolates and two independent Towne/Tol11 1.1 isolates exhibited no differences outside of the 1.4-kbp deletion that had been engineered into the mutant virus.

FIG. 1. Construction of ie1-deficient CMV, RC303∆Acc. (Upper) CMV genome depicted with viral regulatory gene (9) loci represented by small arrows. Expanded below is a partial restriction site map of the SalI fragment (nt 168,817–176,218) containing the ie1/ie2 region depicted as five exons (solid thick lines and arrows) that give rise to the predominant α proteins, IE1491aa (exons 1–4) and IE2579aa (exons 1–3 and 5) via alternative splicing and polyadenylylation site usage. Protein-coding sequences are depicted as open boxes and enhancer regions are depicted as a hatched boxes. (Lower) The plasmids and cosmids used in construction of recombinant viruses RC303∆Acc and Towne/Tol11 1.1. Plasmids, pON303 (32), and pON303∆Acc (16) as well as sequence endpoints of cosmids, Tn51 and Tol11, are depicted. The region of sequence divergence between strains Towne and Toledo (2) is indicated by stippling above cosmid Tol11. All nucleotide sequence coordinates are based on the strain AD169 genome sequence (1).

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

A DELETION MUTANT IN THE HUMAN CYTOMEGALOVIRUS GENE ENCODING IE1491AA IS REPLICATION DEFECTIVE DUE TO A FAILURE IN AUTOREGULATION

11323

FIG. 2. Analysis of RC303∆Acc genome structure and stability. (A) Restriction digest and DNA blot hybridization analysis of mutant following transfection (RC303∆Acc Tfxn) and plaque-purification (RC303∆Acc) compared with wild-type (Towne/Tol11 1–1) transfection stock. The left three lanes show ethidium bromide-stained EcoRI digests of products resolved in a 0.5% agarose gel. The middle and right three lanes show an autoradiogram of a DNA blot of EcoRI digests hybridized with an ie1/ie2 region probe, pON303G (16), and an ie1 exon 4 specific probe, pON2307 (34), respectively. (B) Restriction digest and blot hybridization analysis of mutant DNA from complementing ihfie1.3 cells (RC303∆Acc) or DNA made from noncomplementing HF cells following one (RC303∆Acc HFp1) or two (RC303∆Acc HFp2) successive passages. The left four lanes show ethidium bromide-stained ClaI digests resolved in a 0.5% agarose gel. The middle and right four lanes show an autoradiogram of a DNA blot of ClaI digests hybridized with pON303G and the ie1 exon 4-specific probe, pON2307 (34), respectively. The three other pools.harvested following cotransfection of cosmids and pON303∆Acc each contained wt virus that showed pON303 and exon 4 hybridization patterns similar to Towne/Tol11 1.1 (data not shown). The ie1 cDNA resident in ihfie1.3 cells did not appear to recombine into mutant virus based on the failure to detect the novel, intronless exon 4-specific DNA species that would have been generated. Furthermore, recombination between homologous regions of the virus and cDNA resident in the ihfie1.3 cells would have disrupted the differential splicing necessary to produce to IE2579aa, which we assume would result in a replication defective virus. The presence of wt in some pON303∆Acccontaining transfection pools was most likely to have resulted from a 430-bp overlap (170,521–170,951) between pON303∆Acc and Tol11 (Fig. 1). This background of wt virus suggests that efficient homologous recombination can occur with as little as 400 nucleotide overlap between input DNA fragments. RC303∆Acc Growth on Complementing and Noncomplementing Cells. To determine whether mutant virus was capable of productive infection of cells lacking the ie1 gene, serial 10-fold dilutions of the progeny from ihfie1.3 cells were used to infect complementing and noncomplementing cells in parallel. Mutant virus failed to grow in any of four replicate experiments when 106 normal HF cells were exposed to mois <0.01 (as determined by plaque assay on ihfie1.3 cells) but retained the ability to form plaques on 106 ihfie1.3 cells at mois as low as 0.000001 (data not shown). At an moi of 3 or greater, growth of four different plaque isolates of the mutant was remarkably similar in both cell types, producing progeny at levels comparable to those of wt virus at 96 hours postinfection (hpi) (Fig. 3). When wt Towne growth was compared on both cell types in a separate experiment, there were no differences observed at 24, 48, or 72 hpi (data not shown). At mois between 0.01 and 1.0, in noncomplementing cells mutant virus exhibited a sharp increase in number of plaques and these required approximately three times longer (21 days versus 7 days in complementing cells) to appear. Comparison of titers of four independent RC303∆Acc plaques from one transfection pool as determined on complementing cells and noncomplementing cells is shown in Table 1. Although mutant virus exhibited a linear relationship between dilution and ability to form plaques on ihfie1.3 cells, plaque formation on noncomplementing HFs appeared to be nonlinear with respect to dilution, with a 10-fold dilution of stock producing an 100-fold decrease in plaque formation. Consistent with the slow growth and nonlinear relationship between input dose and plaque formation, mutant virus exhibited a plaquing efficiency on HF that was much lower (5×10−4 to 3×10−3

FIG. 3. Growth of RC303∆Acc and Towne/Tol11 1.1 in complementing ihfie1.3 (open symbols) and noncomplementing HF (solid symbols) cells. Cell cultures were exposed to RC303∆Acc (circles) or Towne/Tol11 1–1 (squares) at an moi of 3. Cells infected with the ie1-deficient mutant were harvested at 24, 48, 72, and 96 hpi and cells infected with wt were harvested at 96 hpi. Titers of progeny in all cultures were determined by plaque assay on ihfie1.3 cells.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

A DELETION MUTANT IN THE HUMAN CYTOMEGALOVIRUS GENE ENCODING IE1491AA IS REPLICATION DEFECTIVE DUE TO A FAILURE IN AUTOREGULATION

11324

relative to ihfie1.3 cells) such that only 10–200 plaques formed at an moi of 0.02–0.05 and these took nearly 3 weeks to grow. This behavior suggested that IE1491aa was necessary under low moi conditions and that in the absence of this protein multiple independent virus particles were required to initiate infection. Thus, virion structural proteins might have compensated for the absence of IE1491aa at higher mois. This growth pattern also raised the possibility that IE1491aa made in the complementing cells might have been carried over to noncomplementing cells in the inoculum or that the ie1 cDNA might have been transduced by mutant virus during propagation on ihfie1.3 cells.

Table 1. RC303 Acc plaque assay on complementing and noncomplementing cells ihfie 1.3* HF† RC303∆Acc Plaque 1 5.0×107‡ 1.8×105 7 1.0×104 Plaque 2 2.2×10 Plaque 3 2.3×107 2.0×104 7 3.6×10 1.1×105 Plaque 4

Ratio§ 278 2200 1150 327

*Stained at 7 days postinfection, samples exhibited a linear dilution of infectivity. †Stained at 21 days postinfection, samples exhibited a nonlinear dilution suggesting multiple hit kinetics (data not shown). ‡Titer (plaque-forming units per ml). §Ratio (HF/ihfie 1.3) of input needed to produce 10–200 plaques on 106 cells.

To determine whether the growth of-mutant virus in noncomplementing cells was a result of IE1491aa carry-over in the inoculum or a result of reacquisition of the ie1 gene by the virus, two sequential passages of RC303∆Acc were carried out on HF cells at an moi of 0.5, and progeny viral DNA was evaluated by blot hybridization. IE1491aa contamination in the inoculum would have quickly been eliminated by successive passages on HF cells. Despite the fact that progeny accumulated more slowly in noncomplementing cells and took approximately three times as long to reach peak levels, the total amount of viral DNA that could be recovered from noncomplementing cells was comparable to that recovered from complementing cells (Fig. 2B). Analysis of BamHI and EcoRI digests (data not shown) further demonstrated an absence of alterations in genome structure or of DNA fragments that would suggest an overgrowth of virus that acquired ie1 cDNA from complementing cells. Given the ability of mutant virus to propagate through successive rounds on HF cells, contamination with IE1491aa could not account for the ability of mutant to grow on noncomplementing cells. Expression of IE2579aa by RC303∆Acc Is Dependent upon moi. To directly evaluate the stage of mutant virus replication that was disrupted at low mois, expression of IE1491aa and IE2579aa was compared following infection of HFs at mois of 5 and 0.5 using either RC303∆Acc or wt Towne virus. Towne exhibits growth properties similar to Towne/Tol11 recombinants on HF cells (31). We used a murine monoclonal antibody CH160 that recognizes an epitope within the common amino terminus of these proteins (35). Due to the deletion of exon 4 sequences, mutant virus failed to produce any IE1491aa, whereas wt virus produced readily detectable levels of this protein very early during infection. At an moi (5 plaque-forming units per cell) that resulted in a replication pattern similar to wt, mutant virus produced a pattern of IE2579aa expression similar to wt (Fig. 4A); however, at an moi (0.5 plaque-forming units per cell) that results in inefficient plaque formation and slow growth, expression of IE2579aa was not detected in RC303∆Acc-infected HF cells (Fig. 4B). Thus, inefficient growth correlated with failure to produce detectable levels of IE2579aa following infection. The identity of the IE1491aa species was confirmed by analysis with exon 4 specific antibody (data not shown). Interestingly, the relative proportion of IE1491aa and IE2579aa accumulating during infection with wt virus was also influenced by the moi, with both appearing to accumulate together at high moi, but with IE1491aa appearing much earlier than IE2579aa at the lower moi. When mutant virus expression of β and γ proteins (ppUL44,

FIG. 4. Immunoblot analysis of proteins expressed by RC303∆Acc (Left) and Towne (Right). (A) Detection of IE1491aa and IE2579aa with exon 2-specific monoclonal antibody CH160 at 2, 4, 6, 8, 12, 24, 48, and 96 hpi with an moi of 5. (B) Detection of IE1491aa and IE2579aa with CH160 at 4, 8, 24, 48, 96, 144, and 192 hpi with an moi of 0.5. (C) Detection of γ proteins reactive with pooled human CMV-seropositive sera at 2, 4, 6, 8, 12, 24, 48, and 96 hpi with an moi of 5.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

A DELETION MUTANT IN THE HUMAN CYTOMEGALOVIRUS GENE ENCODING IE1491AA IS REPLICATION DEFECTIVE DUE TO A FAILURE IN AUTOREGULATION

11325

ppUL83, ppUL57, and ppUL32) was evaluated at an moi of 0.5, all failed to accumulate in HF cell lysates examined up to 192 hpi (data not shown), a pattern that was consistent with inefficient growth and slow spread of this virus. Even at high moi, accumulation of γ proteins, ppUL32, ppUL83, and ppUL44 were delayed in RC303∆Acc-infected HF cells compared with a Towne control (Fig. 4C). Thus, RC303∆Acc exhibited a very strong moi dependence for accumulation of IE2579aa, a regulatory protein that is likely to be essential for productive replication. This very early block to expression of IE2579aa is consistent with our prediction that autoregulation of the ie1/ie2 promoter-enhancer via the cellular transcription factor NF- B is an important IE1491aa function (16, 17). Other activities of IE1491aa may also be disrupted in RC303∆Acc, but not manifest as strong an impact on viral replication as this autoregulatory function.

DISCUSSION RC303∆Acc is a severely replication defective CMV mutant whose phenotype reveals a role for IE1491aa in productive replication as was predicted from transient assays (16, 17). In culture, IE1491aa is required for successful replication at mois of <0.01, but this requirement may be overcome when sufficient numbers of viral particles are used to initiate infection. The moi-dependent expression of IE2579aa by RC303∆Acc provides further evidence of the importance of IE1491aa in regulating levels of ie2 expression and replication under conditions where virion transactivators are likely to be limiting. The behavior of ie1-deficient CMV parallels the behavior of herpes simplex virus ICP0 (Vmw110) mutants (36) and predicts a very important role for IE1491aa in the naturally infected human host (37). It is formally possible that IE1491aa fulfills a function analogous to ICP0 (38). These predictions can be tested by inoculation of human tissue implants in SCID-hu mice (39) or by evaluating latency and reactivation properties in granulocyte-macrophage progenitors (40). Many studies (26, 27, 32, 41) consistently suggested that CMV, like other herpesviruses, carries virion tegument functions responsible for transactivation of α genes. IE1491aa is not a virion protein (unpublished data) and cannot account for the ability of inactivated viral particles to transactivate the ie1/ie2 promoter-enhancer (32). The moi-dependent growth properties of IE1491aa-deficient virus support a role for two tegument proteins ppUL82 (pp71) (27) and ppUL69 (26), in transactivation of the ie1/ie2 promoter-enhancer, although experiments testing the ability of these gene products or UV-inactivated virions will be needed to address this issue more directly. It appears that CMV may encode two different classes of proteins capable of transactivating α gene expression: (i) one packaged into the virion and (ii) one, IE1491aa, expressed immediately upon entering cells. In the absence of IE1491aa, virion transactivators alone may not be able to initiate replication at low mois. Whether IE1491aa can compensate for virion transactivators remains to be determined when mutants disrupting UL82 or UL69 become available. In transient assays, a putative minor ie2 protein, IE2425aa (42), may transactivate expression of the ie1/ie2 promoter-enhancer, but this would not account for the properties of RC303∆Acc described here. A range of factors, particularly those found in serum (43), that increase levels of cellular transcription factors also stimulate expression from the ie1/ie2 promoter-enhancer during cell growth or differentiation. All of our experiments were carried out at high serum concentrations in actively growing HF cells that may have reduced the requirement for IE1491aa. Studies using resting, serum-starved HF cells are under way. Our comparison of mutant viral growth on complementing and noncomplementing cells (Fig. 3) showed that complementing cells provided a slight advantage to replication even at high mois and suggested that IE1491aa may play additional roles subsequent to α gene activation. Finally, both IE1491aa and IE2579aa are able to block adenovirus E1a-induced apoptosis (25). We did not observe any dramatic alteration in the phenotype of cells infected with RC303∆Acc that would be consistent with any increased tendency toward apoptosis. An appreciation of how a balance is struck between all of these factors will require considerable additional work in different cell types as well as in different growth and differentiation states. While the highly passaged, candidate vaccine strain, Towne, is attenuated and fails to reactivate in the immunosuppressed transplant recipient (44), strain Toledo, a virus that has undergone a limited number of passages in cell culture, maintains a level of virulence that can be observed after inoculation of susceptible individuals (45). These virulence differences may be attributed to the loss of a large genomic segment in highly passaged strains (2). The strategy reported here would allow the derivation of avirulent, replication defective mutant virus from any strain of CMV. The mutant virus we have described places 13 kbp of unique sequence from strain Toledo into a Towne background. Although replication defective, this recombinant contains a large array of viral genes that are not present in Towne. As a vaccine, this would be expected to induce a broader ranging immune response but be completely safe even in immunocompromised individuals. Accumulating evidence suggests that hematopoietic progenitors in bone marrow are important sites of viral latency (40, 46). Cultured granulocyte-macrophage progenitors can support latent infection with either the Towne or Toledo strains and infection is characterized by restricted, latency-specific gene expression (34, 47). Productive viral replication can be induced when these cells are cocultivated with permissive fibroblasts for an extended period of time (40), suggesting that cellular growth or differentiation state may play an important role in the balance between latency and reactivation. By removing ie1 exon 4, RC303∆Acc disrupts the antisense CMV-latency specific transcript expressed in granulocyte-macrophage progenitors. We are currently evaluating the ability of the ie1 mutant to latently infect this cell type and to reactivate following cocultivation with ihfie1.3 cells. Recombinant CMV lacking IE1491aa may be an appropriate avirulent vector to introduce genes into hematopoietic progenitors without a risk of reactivation or dissemination. We thank Kirsten Lofgren and Tai-An Cha for providing sequence information on the cosmid ends, Danushka Formankova for immunoblot analysis, and Maria Kirichenko for performing plaque assays. We particularly appreciate the contribution of Jiake Xu who purified the glutathione S-transferase fusion protein from pON2307 and raised ie1 exon-4 specific rabbit antiserum. We acknowledge Mark Penfold, Mark Prichard, Barry Slobedman, Dirk Dittmer, Jiake Xu, and Cynthia Bolovan for helpful comments on the manuscript. Some of the experiments reported here were carried out by E.S.M. at Aviron, a company to which he serves as a scientific advisor. This work was supported by U.S. Public Health Service Grant R01 AI33852. 1. Chee, M.S., Bankier, A.T., Beck, S., Bohni, R., Brown, C.M., Cerny, R., Horsnell, T., Hutchison, C.A.I., Kouzarides, T., Martignetti, J.A., Preddie, E., Satchwell, S.C., Tomlinson, P., Weston, K.M. & Barrell, B.G. (1990) Curr. Top. Microbiol. Immunol. 154, 125–170. 2. Cha, T.A., Tom, E., Kemble, G.W., Duke, G.M., Mocarski, E.S. & Spaete, R.R. (1996) J. Virol. 70, 78–83. 3. Alford, C.A. & Britt, W.J. (1995) in Fields Virology, eds. Fields, B.N., Knipe, D.M. & Howley, P.M. (Lippincott-Raven, New York), pp. 2493–2534. 4. Stenberg, R.M., Witte, P.R. & Stinski, M.F. (1985) J. Virol. 56, 665–675. 5. Stenberg, R.M., Thomsen, D.R. & Stinski, M.F. (1984) J. Virol. 49, 190–199. 6. Stenberg, R.M., Depto, A.S., Fortney, J. & Nelson, J.A. (1989) J. Virol. 63, 2699–2708.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

A DELETION MUTANT IN THE HUMAN CYTOMEGALOVIRUS GENE ENCODING IE1491AA IS REPLICATION DEFECTIVE DUE TO A FAILURE IN AUTOREGULATION

11326

7. Thomsen, D.R., Stenberg, R.M., Goins, W.F. & Stinski, M.F. (1984) Proc. Natl. Acad. Sci. USA 81, 659–663. 8. Boshart, M., Weber, F., Jahn, G., Dorsch-Hasler, K., Fleckenstein, B. & Schaffner, W. (1985) Cell 41, 521–530. 9. Mocarski, E.S. (1995) in Fields Virology, eds. Fields, B.N., Knipe, D.M. & Howley, P.M. (Lippincott-Raven, New York), pp. 2447–2492. 10. Malone, C.L., Vesole, D.H. & Stinski, M.F. (1990) J. Virol. 64, 1498–1506. 11. Stenberg, R.M., Fortney, J., Barlow, S.W., Magrane, B.P., Nelson, J.A. & Ghazal, P. (1990) J. Virol. 64, 1556–1565. 12. Pizzorno, M.C., O’Hare, P., Sha, L., LaFemina, R.L. & Hayward, G.S. (1988) J. Virol. 62, 1167–1179. 13. Lang, D. & Stamminger, T. (1993) J. Virol. 67, 323–331. 14. Macias, M.P. & Stinski, M.F. (1993) Proc. Natl. Acad. Sci. USA 90, 707–711. 15. Stinski, M.F. (1978) J. Virol. 26, 686–701. 16. Cherrington, J.M. & Mocarski, E.S. (1989) J. Virol. 63, 1435– 1440. 17. Sambucetti, L.C., Cherrington, J.M., Wilkinson, G.W.G. & Mocarski, E.S. (1989) EMBO J. 8, 4251–4258. 18. Margolis, M.J., Pajovic, S., Wong, E.L., Wade, M., Jupp, R., Nelson, J.A. & Azizkhan, J.C. (1995) J. Virol. 69, 7759–7767. 19. Hunninghake, G.W., Monks, B.G., Geist, L.J., Monick, M.M., Monroy, M.A., Stinski, M.F., Webb, A.C., Dayer, J.M., Auron, P.E. & Fenton, M.J. (1992) Mol. Cell. Biol. 12, 3439–3448. 20. Hayhurst, G.P., Bryant, L.A., Caswell, R.C., Walker, S.M. & Sinclair, J.H. (1995) J. Virol. 69, 182–188. 21. Hagemeier, C., Walker, S.M., Sissons, P.J. & Sinclair, J.H. (1992) J. Gen. Virol. 73, 2385–2393. 22. Walker, S., Hagemeier, C., Sissons, J.G. & Sinclair, J.H. (1992) J. Virol. 66, 1543–1550. 23. Lukac, D.M., Manuppello, J.R. & Alwine, J.C. (1994) J. Virol. 68, 5184–5193. 24. LaFemina, R.L., Pizzorno, M.C., Mosca, J.D. & Hayward, G.S. (1989) Virology 172, 584–600. 25. Zhu, H., Shen, Y. & Shenk, T. (1995) J. Virol. 69, 7960–7970. 26. Winkler, M., Schmolke, S., Plachter, B. & Stamminger, T. (1995) Scand. J. Infect. Dis. Suppl. 99, 8–9. 27. Liu, B. & Stinski, M.F. (1992) J. Virol. 66, 4434–4444. 28. Greaves, R.F., Brown, J.M., Vieira, J. & Mocarski, E.S. (1995) J. Gen. Virol. 76, 2151–2160. 29. Roy, N. (1993) Ph.D. thesis (Cornell Univ. School of Med., New York). 30. Halbert, C.L., Demers, G.W. & Galloway, D.A. (1991) J. Virol. 65, 473–478. 31. Kemble, G., Duke, G., Winter, R. & Spaete, R. (1996) J. Virol. 70, 2044–2048. 32. Spaete, R.R. & Mocarski, E.S. (1985) J. Virol. 56, 135–143. 33. Spaete, R.R. & Frenkel, N. (1982) Cell 30, 295–304. 34. Kondo, K., Xu, J. & Mocarski, E.S. (1996) Proc. Natl. Acad. Sci. USA 93, 11137–11142. 35. Plachter, B., Britt, W., Vornhagen, R., Stamminger, T. & Jahn, G. (1993) Virology 193, 642–652. 36. Stow, N.D. & Stow, E.C. (1986) J. Gen. Virol. 67, 2571–2585. 37. Cai, W., Astor, T.L., Liptak, L.M., Cho, C., Coen, D.M. & Schaffer, P.A. (1993) J. Virol. 67, 7501–7512. 38. Stow, E.C. & Stow, N.D. (1989) J. Gen. Virol. 70, 695–704. 39. Brown, J.M., Kaneshima, H. & Mocarski, E.S. (1995) J. Infect. Dis. 171, 1599–1603. 40. Kondo, K., Kaneshima, H. & Mocarski, E.S. (1994) Proc. Natl. Acad. Sci. USA 91, 11879–11883. 41. Stinski, M.F. & Roehr, T.J. (1985) J. Virol. 55, 431–441. 42. Baracchini, E., Glezer, E., Fish, K., Stenberg, R.M., Nelson, J.A. & Ghazal, P. (1992) Virology 188, 518–529. 43. Stamminger, T., Fickenscher, H. & Fleckenstein, B. (1990) J. Gen. Virol. 71, 105–113. 44. Plotkin, S.A., Smiley, M.L., Friedman, H.M., Starr, S.E., Fleisher, G.R., Wlodaver, C., Dafoe, D.C., Friedman, A.D., Grossman, R.A. & Barker, C.F. (1984) Lancet i, 528–530. 45. Plotkin, S.A., Starr, S.E., Friedman, H.M., Gonczol, E. & Weibel, R.E. (1989) J. Infect. Dis. 159, 860–865. 46. Minton, E.J., Tysoe, C., Sinclair, J.H. & Sissons, J.G. (1994) J. Virol. 68, 4017–4021. 47. Kondo, K. & Mocarski, E.S. (1995) Scand. J. Infect. Dis. Suppl. 99, 63–67.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

HUMAN CYTOMEGALOVIRUS US3 IMPAIRS TRANSPORT AND MATURATION OF MAJOR HISTOCOMPATIBILITY COMPLEX CLASS I HEAVY CHAINS

11327

This paper was presented at a colloquium entitled “Genetic Engineering of Viruses and of Virus Vectors,” organized by Bernard Roizman and Peter Palese (Co-chairs), held June 9–11, 1996, at the National Academy of Sciences in Irvine, CA.

Human cytomegalovirus US3 impairs transport and maturation of major histocompatibility complex class I heavy chains THOMAS R.JONES*†, EMMANUEL J.H.J.WIERTZ‡, LEI SUN*, KENNETH N.FISH§, JAY A.NELSON§, AND HIDDE L.PLOEGH‡ *Department of Molecular Biology, Infectious Diseases Section, Wyeth-Ayerst Research, Pearl River, NY 10965; ‡Center for Cancer Research, Massachusetts Institute of Technology, Cambridge, MA 02139; and §Department of Molecular Microbiology and Immunology, Oregon Health Sciences University, Portland, OR 97201 ABSTRACT The human cytomegalovirus (HCMV) early glycoprotein products of the US11 and US2 open reading frames cause increased turnover of major histocompatibility complex (MHC) class I heavy chains. Since US2 is homologous to another HCMV gene (US3), we hypothesized that the US3 gene product also may affect MHC class I expression. In cells constitutively expressing the HCMV US3 gene, MHC class I heavy chains formed a stable complex with β2-microglobulin. However, maturation of the N-linked glycan of MHC class I heavy chains was impaired in US3+ cells. The glycoprotein product of US3 (gpUS3) occurs mostly in a high-mannose form and coimmunoprecipitates with β2-microglobulin associated class I heavy chains. Mature class I molecules were detected at steady state on the surface of US3+ cells, as in control cells. Substantial perinuclear accumulation of heavy chains was observed in US3+ cells. The data suggest that gpUS3 impairs egress of MHC class I heavy chains from the endoplasmic reticulum. Human cytomegalovirus (HCMV) causes serious disease in congenitally infected infants and immunocompromised/ immunosuppressed adults (1). As is common to other members of the family herpesviridae, HCMV causes latent or persistent viral infections. However, this state has not been well characterized for HCMV. Virus derived from such latent or persistent infections can be responsible for the HCMV-associated disease state in immunocompromised or immunosuppressed patients. One requirement for viruses that exhibit a latent or persistent phase is that they encode mechanism(s) that manipulate the host’s immune surveillance system (2). Viruses encode proteins that target and modulate many different aspects of the host’s immune system (3). A target common to many of these viruses are the major histocompatibility complex (MHC) class I antigens (4, 5). Class I products play a central role in recognition and subsequent lysis by cytotoxic T lymphocytes (6), a key component of the cellular arm of the human immune system. For example, adenoviruses encode proteins that repress the transcription of class I heavy chain genes (7) or that can bind to and retain class I heavy chains in the endoplasmic reticulum (ER) (8, 9). The herpes simplex virus type 1 US 12 gene product, called ICP47, binds to the MHC-encoded TAP peptide transporter and prevents the delivery of cytosolic antigenic peptides to assembling class I molecules in the ER (10–12). Murine cytomegalovirus encodes multiple functions that affect class I expression, either at the level of synthesis or expression at the cell surface (13– 15). Epstein-Barr virus affects presentation of certain peptides by MHC class I complexes (16). In that case, a cis-acting Gly-Ala repeat within the viral Epstein-Barr virus-encoded nuclear antigen 1 (EBNA-1) protein is an inhibitory signal that prevents its antigenic processing, thus affecting the yield of EBNA-1-derived peptides to be presented. HCMV causes posttranslational down-regulation of MHC class I heavy chains (17–19). In HCMV-infected cells, class I heavy chains show unusually rapid turnover (t1/2=20 min or less) and are degraded early in the course of their biosynthesis, proceeding no further than the ER (17, 19). Through the analysis of defined deletion mutants of HCMV, we recently identified two HCMV early genes, US11 and US2, each of whose products was sufficient to cause increased turnover of MHC class I heavy chains (ref. 20; T.R.J. and L.S., unpublished results). US11 encodes a type I membrane glycoprotein that resides in the ER and causes the rapid dislocation of newly synthesized class I heavy chains from the ER to the cytosol, where they are degraded by the proteasome (21). A second gene whose expression results in destabilization of class I heavy chains is US2 (T.R.J. and L.S., unpublished results). US2 is member of a gene family that also contains US3, a gene adjacent to US2 in the HCMV genome (22). Given the homology between the proteins encoded by US2 and US3, it was of interest to determine whether US3 also affected the expression of MHC class I heavy chains. Unlike US2, whose expression begins at early times after infection (T.R.J. and L.S., unpublished results), US3 is transcribed abundantly under immediate-early conditions and at lower levels at early and late times after infection, due to multiple negative regulatory mechanisms (23–26). In contrast to US2, expression of US3 does not destabilize heavy chains, but maturation and transport to the cell surface of MHC class I heavy chains are impaired. We show that a US3 gene product forms a complex with β2microglobulin-associated class I heavy chains, which accumulate predominantly in the ER of US3+ cells.

MATERIALS AND METHODS DNA Sequence. The numbering system of Chee et al. (22) was used for the HCMV AD169 DNA sequence (GenBank accession no. X17403). Virus and Cells. HCMV AD169 was obtained from the American Type Culture Collection and propagated. RV47, a US2 and US3 deletion mutant of HCMV, has been described (27). The origin and growth of human foreskin fibroblast cells

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact. Abbreviations: HCMV, human cytomegalovirus; MHC, major histocompatibility complex; ER, endoplasmic reticulum; GST, glutathione S-transferase. †To whom reprint requests should be addressed at: Building 205, Room 276, Wyeth-Ayerst Research, Pearl River, NY, 10965. email: [email protected].

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

HUMAN CYTOMEGALOVIRUS US3 IMPAIRS TRANSPORT AND MATURATION OF MAJOR HISTOCOMPATIBILITY COMPLEX CLASS I HEAVY CHAINS

11328

and U373-MG astrocytoma (U373) control cells were as described (20). Both the US2+ and US3+ cell line used in this study, originally designated 55–310 cells and 5–214 cells (respectively) in laboratory records, were derived from U373 cells. To obtain these cell lines, HCMV US2 and US3 genes were cloned into plasmids such that their expression was under the control of the HCMV major immediate-early promoter. The US2 open reading frame was cloned as a 0.776-kb BanII-XhoI DNA fragment (bases 193,779–193,003) in vector pIEsp-puro (20), to yield pIEspUS2-puro. The US3 open reading frame was cloned as a 0.638-kb AvaII-SacII DNA fragment (bases 194,700–194,062) in vector pIEpuro (20), to yield pIEpuro-US3(AS). Stably transfected US2+ and US3+ cell lines were obtained via transfection of these plasmids and selection in puromycin-containing medium as described (20). Glutathione S-Transferase (GST)-US3 Fusion Protein. A GST-US3 fusion protein was made using a modified vector, pGST-Nco (provided by I.Mohr, Wyeth-Ayerst Research, Pearl River, NY). Using the polymerase chain reaction, the region of the US3 gene representing the region encoding amino acids 33–112 (22) was amplified in a manner that resulted in the insertion of a 5
NcoI and a 3
EcoRI sites to facilitate directional cloning between those same sites in pGST-Nco vector. After transfection into Escherichia coli DH5, expression of the GST-US3 fusion protein was induced with isopropyl β-D-thiogalactoside. After sonication of the induced bacteria, the fusion protein was located in the pellet fraction, then solubilized, and electroeluted from SDS/ polyacrylamide gels. Antibodies. Rabbit polyclonal antisera reactive with HCMV US2 and US11 proteins have been described (ref. 20; T.R.J. and L.S., unpublished results). Polyclonal antisera reactive with HCMV US3 protein was derived from New Zealand White rabbits immunized with the GST-US3 fusion protein (Cocalico Biologicals, Reamstown, PA). Rabbit polyclonal antisera designated anti-HC, which reacts free MHC class I heavy chains, has been described (17). Murine monoclonal antibodies W6/32 (28), specific for a conformation-dependent epitope on the heavy chain of human MHC class I proteins, and Ber-T9, specific for the human transferrin receptor, were purchased from Dako. Murine monoclonal antibody TP25.99 (29), specific for a conformation-independent epitope on MHC class I heavy chains, was obtained from S.Ferrone (New York Medical College, Valhalla, NY). BBM.1 monoclonal antibody recognizes both free and heavy chain-associated human β2microglobulin (30). Anti-vertebrate actin monoclonal antibody clone C4 was purchased from Boehringer Mannheim. Metabolic Labeling, Immunoprecipitation, and Immunoblot Analysis. Metabolic labeling, immunoprecipitation, and immunoblot techniques were done as described (20). Where indicated, the mild detergent digitonin (Boehringer Mannheim) was used for cell lysis (1% final concentration) and in all immunoprecipitation steps (0.2% final concentration). Digitonin was dissolved in buffer containing 25 mM Hepes (pH7.2)/10 mM CaCl2. For pulse-chase experiments, 1 ml of complete medium containing 2× unlabeled methionine/ cysteine was added directly to the radioactive pulse medium and incubation was continued until the proper harvest time. Radioiodination of cell surface proteins was done with sodium 125I (New England Nuclear) according to standard protocols (31). Endoglycosidase H and N-glycosidase F digestions were done for 18 hr at 37°C after immunoprecipitation using the recommended conditions (Boehringer Mannheim). Immunofluorescence Microscopy. In some experiments, expression of MHC class I molecules was detected by immunofluorescence microscopy as described (20), except that the blocking step with human serum was omitted. Fixed cells were treated sequentially with TP25.99 primary antibody and fluorescein isothiocyanate-conjugated goat anti-mouse IgG (Pierce) secondary antibody. Confocal immunofluorescence microscopy was performed as described (32), except that TP25.99 monoclonal antibody was used to detect MHC class I heavy chains. The dye 3,3
-dihexyloxacarbocyanine iodide (DiOC6[3]) (Molecular Probes) was used to stain the ER as described (33). These samples were visualized using a Leica confocal laser scanning microscope. Class I heavy chain fluorescence was quantified using the QUANTIMET 500 fluorescence analysis program (Leica).

RESULTS Expression and Characterization of US3 Gene Products. The open reading frames of the HCMV US2 and US3 genes

FIG. 1. Genome location and expression from HCMV US3. (A) Relative location of US2, US3, and US11 in the HCMV genome. (B) Uninfected US3+ cells or U373 control cells were metabolically radiolabeled for 2 hr (lanes P) then chased in medium containing excess unlabeled amino acids for 3 hr (lanes C). Human foreskin fibroblasts were infected with either HCMV wild-type AD169 or mutant RV47 at a multiplicity of infection of 3 and radiolabeled from 3 to 7 hr after infection. Immunoprecipitation was done with US3 antibody. (C) US3+ cells were metabolically radiolabeled in pulse-chase fashion as indicated prior to immunoprecipitation, using US3 antibody, and glycosidase treatment. For control purposes, an immunoprecipitation from pulse-labeled U373 control cells is shown. gpUS3, 22-kDa US3 glycoprotein; *, 18-kDa US3 product; **, deglycosylated US3 protein; EH, endoglycosidase H digestion; NG, N-glycosidase F digestion.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

HUMAN CYTOMEGALOVIRUS US3 IMPAIRS TRANSPORT AND MATURATION OF MAJOR HISTOCOMPATIBILITY COMPLEX CLASS I HEAVY CHAINS

11329

encode proteins of 200 and 187 amino acids, respectively (22). These proteins have similar hydrophilicity profiles and contain hydrophobic regions near their N and C termini that likely correspond to a signal sequence and transmembrane domain, respectively. Furthermore, the HCMV US3 gene product is homologous to the US2-encoded protein. By Lipman-Pearson alignment, these proteins show 22% identity, or 50% homology by scoring conservative amino acid changes (data not shown). The fact that the US2 product down-regulates expression of MHC class I heavy chains suggests that US3 could also alter class I expression. The strategy employing phenotypic analysis of progressive deletion mutants of HCMV used to identify the role of US11 and US2 in class I heavy chain down-regulation would not have identified a similar phenotype caused by US3, since US3 lies between US2 and US11 (Fig. 1A) (ref. 20; T.R.J. and L.S., unpublished results). Therefore, effects of US3 were directly analyzed in stably transfected U373 cells. These cells are permissive for HCMV replication and have been used to confirm the role of the HCMV US11 and US2 genes in turnover of MHC class I heavy chains (ref. 20; T.R.J. and L.S., unpublished results).

FIG. 2. Western blot analysis of US2+ and US3+ cell proteins probed with TP25.99 monoclonal antibody (A), US3 antibody (B), actin antibody (C), or US2 antibody (D). hc, Class I heavy chains; gpUS3, US3 glycoprotein; gpUS2, US2 glycoprotein.

FIG. 3. Stability of MHC class I proteins. US2+ cells, US3+ cells, and U373 control cells were metabolically radiolabeled for a 20-min pulse and then chased for the indicated time (min) in medium containing excess unlabeled amino acids. Immunoprecipitations were done with anti-HC antibody (A), W6/32 monoclonal antibody (B), or BBM.1 monoclonal antibody (C). Lanes 1–12 and 13–18 are from different SDS/PAGE. hc, Class I heavy chains; b2m, β2-microglobulin. US3 was cloned in a HCMV major immediate-early promoter-based vector so that it would be constitutively expressed in stably transfected cells. Cell lines expressing US3 were identified by Western blot analysis using US3 antisera. Numerous US3+ colonies were obtained, with no indication of detrimental effects of constitutive US3 expression. In radio-labeling-immunoprecipitation experiments, expression of US3 in transfected cells resulted in at least two polypeptides of 22 kDa and 18 kDa (Fig. 1B). These proteins comigrated with proteins detected in HCMV (wild type)-infected cells but were

FIG. 4. Impaired maturation of MHC class I heavy chains in US3+ cells. U373 control cells or US3+ cells were metabolically radiolabeled for a 1-hr pulse and then chased for the indicated time (hr) in medium containing excess unlabeled amino acids. (A and B) Immunoprecipitation with W6/32 monoclonal antibody. (C) Immunoprecipitation with Ber-T9 monoclonal antibody. After immunoprecipitation, proteins were either untreated (−), or digested with either endoglycosidase H (EH) or Nglycosidase F (NG). hc, Class I heavy chains; TfR, transferrin receptor.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

HUMAN CYTOMEGALOVIRUS US3 IMPAIRS TRANSPORT AND MATURATION OF MAJOR HISTOCOMPATIBILITY COMPLEX CLASS I HEAVY CHAINS

11330

not observed in cells infected with a HCMV mutant from which US3 had been deleted. However, the relative abundance of the 22-kDa US3 protein was much greater in transfected cells than in infected cells. The reason for this difference has not been investigated but may be related to differential splicing reported in HCMV-infected cells (23). The 22-kDa US3 gene product is an N-linked glycoprotein (gpUS3), since it is sensitive to both N-glycosidase F and endoglycosidase H treatment (Fig. 1C). US3 reveals three consensus N-linked glycosylation sites, but only one is within a hydrophilic domain (residue 59) (22). In the 2-hr chase lanes, about 50% of the remaining gpUS3 remains sensitive to endoglycosidase H, indicative of a slow conversion to a form containing complex glycans. The experiments depicted in Fig. 1, as well as other independent experiments using shorter pulse times (data not shown), demonstrate that gpUS3 has a short half-life (about 1 h), similar to gpUS2 and gpUS11 (ref. 20; T.R.J. and L.S., unpublished results). US3 and MHC Class I Heavy Chain Expression. Expression of US2- and US11-encoded proteins result in extremely low steady-state levels of MHC class I heavy chains by immunoblot analysis (ref. 20; T.R.J. and L.S., unpublished results). In Fig. 2, US3+ cells were compared with U373 control cells and US2+ cells. In contrast to US2+ cells, near wild-type steady-state levels of MHC class I heavy chains were detected in US3+ cell lines (Fig. 2A). However, the mobility of the major form of class I heavy chain was slightly increased in US3+ cells compared with U373 control cells. In pulse-chase experiments (Fig. 3), a progressive slight reduction in free heavy chains was observed in US3 +and U373 control cells, coincident with increasing amounts of β2-microglobulin associated heavy chains. Consistent with previous results (T.R.J. and L.S., unpublished results), free class I heavy chains were rapidly degraded in US2+ cells and only small amounts of β2microglobulin-associated heavy chains were detected. Unlike US2, expression of US3 has no detectable effect on the stability of MHC class I heavy chains. Furthermore, association of β2-microglobulin with class I heavy chains appeared to proceed normally in US3+ cells. Impaired Maturation of Class I Heavy Chains. The altered mobility of class I heavy chains in US3+ cells suggested that processing of class I heavy chains was altered by gpUS3. In U373 control cells, β2-microglobulin-associated MHC class I heavy chains were partially endoglycosidase H-sensitive at the end of the 1-hr pulse but were fully endoglycosidase H-resistant after a 2-hr chase (Fig. 4A). In US3+ cells, class I heavy chains were largely endoglycosidase H-sensitive, even after a 2-hr chase. By extending the chase period, we observed that in US3 + cells there was a protracted, but steady, conversion of heavy chains to endoglycosidase H-resistant forms (Fig. 4B). After a 6-hr chase, some 50% of class I heavy chains retained endoglycosidase H sensitivity. Maturation of a control membrane glycoprotein, the transferrin receptor, is unaltered in US3+ cells (Fig. 4C). Thus, maturation of glycoproteins is not generally affected in US3+ cells; the effects of US3 are specific for MHC class I heavy chains. Localization and State of Class I Heavy Chains. Addition of complex glycans to glycoproteins (and the attendant conversion to endoglycosidase H-resistance) occurs in the medial-and trans-Golgi (34). The slow maturation of class I heavy chains in US3+ cells suggested that ER to Golgi trafficking of class I heavy chains is impaired. Confocal immunofluorescence microscopy revealed intense perinuclear staining for class I heavy chains in US3+ cells but not in U373 control cells (Fig. 5A and C). The fluorescence pattern in US3+ cells was similar to that observed when using the dye DiOC6[3] under conditions that label the ER (33) (Fig. 5B). In a sampling of 100 cells, there was 17-fold more ER-localized fluorescence in US3+ cells, compared with U373 control cells, when probed for class I heavy chains. Thus, the predominant location of the impaired class I heavy chains is the ER in US3+ cells. Immunofluorescence microscopy of nonpermeabilized cells indicated that substantial amounts of class I heavy chains were on the surface of both US3+ cells and U373 control cells, while cell surface heavy chains were not detected in US2+ cells (Fig. 6). Since cell surface staining appeared similar for U373 control cells and US3+ cells, and given our observation that US3+ cells contain a substantial amount of endoglycosidase

FIG. 5. Confocal immunofluorescence microscopy. (A and C) TP25.99 monoclonal antibody was used to localize MHC class I heavy chains. (B and D) ER staining with the dye DiOC6[3]. The same field is shown in both panels. (A and B) US3+ cells. (C and D) U373 cells.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

HUMAN CYTOMEGALOVIRUS US3 IMPAIRS TRANSPORT AND MATURATION OF MAJOR HISTOCOMPATIBILITY COMPLEX CLASS I HEAVY CHAINS

11331

H-sensitive heavy chains, it was of interest to know the nature of the class I heavy chains that were on the cell surface of US3+ cells. Immunoprecipitation experiments on 125I-surface-labeled cells, revealed that class I heavy chains present on the surface of both US3+ and U373 control cells were entirely endoglycosidase H-resistant and, in US3+ cells, were reduced by about 2-fold (Fig. 7). No 125I-labeled gpUS3 was detected on the cell surface. The difference in mobility of surface-labeled class I molecules observed in US3+ cells, compared with U373 control cells, is consistent with selective escape of certain class I alleles from US3-mediated retention. Preliminary results from isoelectric focusing analysis of such immunoprecipitates confirms this suggestion (data not shown).

FIG. 6. Immunofluorescence of fixed, but nonpermeabilized, U373 control cells (A), US3+ cells (B), or US2+ cells (C). TP25.99 monoclonal antibody was used to determine the presence of cell surface MHC class I heavy chains. Association of Class I Heavy Chains and gpUS3. The cumulative data imply that US3 impairs egress of class I heavy chains from the ER. A possible direct association between gpUS3 and class I heavy chains was investigated in immunoprecipitation experiments (Fig. 8). US3+ and U373 control cells were metabolically labeled and then lysed with either digitonin lysis buffer or the standard lysis buffer containing sodium deoxycholate, sodium dodecyl sulfate, and Nonidet P-40. From the digitonin extracts, class I heavy chains could be recovered for each cell line using either anti-HC antibody or W6/32 antibody but not with the US3 antibody. When using W6/32 antibody, a 22-kDa protein coprecipitated with heavy chains from US3+ cells but not from U373 control cells or from either cell line with anti-HC antibody (Fig. 8, lanes 1, 3, 7, and 9). This 22-kDa protein comigrated with authentic gpUS3 (Fig. 8, lane 12). In the presence of ionic detergents (standard lysis buffer), class I heavy chains and β2-microglobulin, but not the 22-kDa protein, were immunoprecipitated by W6/32 antibody from the US3+ cell extract (data not shown). A reimmunoprecipitation was performed to confirm the identity of the 22-kDa coprecipitating protein. First, W6/32 antibody was used to recover class I heavy chains and associated proteins from digitonin-lysed cells. Then, standard lysis buffer (containing sodium deoxycholate, sodium dodecyl sulfate, and Nonidet P-40) was added to this immunoprecipitate to dissociate heavy chains from the associated 22-kDa protein, followed by immunoprecipitation using US3 antibody (Fig. 8, lanes 4–5 and 10–11). The 22-kDa protein coprecipitating with class I molecules from US3+ cells could be recovered with US3 antibody and comigrated with authentic gpUS3. Thus, this confirms the identity of the coprecipitating protein as gpUS3. We were unable to recover gpUS3 with US3 antibody from the digitonin lysis buffer extracts of US3+ cells, although it readily coprecipitated from that extract with W6/32 antibody (Fig. 8, lanes 8 and 9) and could be recovered from the standard lysis buffer extract with US3 antibody (Fig. 8, lane 12). Therefore, it is possible that there is very little free

FIG. 7. Maturation state of cell surface MHC class I heavy chains. Cell surface proteins of US3+ or U373 cells were radioiodinated and immunoprecipitated with either W6/32 monoclonal antibody or US3 polyclonal antibody. Subsequently, the extracts were either untreated (−) or digested with endoglycosidase H (+). hc, Class I heavy chains; b2m, β2-microglobulin.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

HUMAN CYTOMEGALOVIRUS US3 IMPAIRS TRANSPORT AND MATURATION OF MAJOR HISTOCOMPATIBILITY COMPLEX CLASS I HEAVY CHAINS

11332

gpUS3 in US3+ cells. Its association with class I heavy chains, and possibly with other yet to be identified polypeptides, is rapid and results in immunological shielding of epitopes recognized by US3 antibody.

FIG. 8. Coprecipitation of MHC class I heavy chains and gpUS3. U373 cells or US3+ cells were metabolically radiolabeled for 2.5 hr and lysed with either 1% digitonin lysis (DIG) buffer or standard lysis buffer (SLB) as indicated. Proteins were immunoprecipitated with anti-HC antibody (HC) (lanes 1 and 7), US3 antibody (US3) (lanes 2, 6, 8, and 12), or W6/32 monoclonal antibody (W6) (lanes 3, 4, 9, and 10). In some cases, a reimmunoprecipitation from digitonin extracts was done (lanes 4–5 and 10–11). W6/32 monoclonal antibody was used first step, then the immunoprecipitate was exposed to standard lysis buffer (10 min at 37°C), and the released proteins were recovered from the supernatant and immunoprecipitated with US3 antibody (lanes 5 and 11). Proteins immunoprecipitated in the first step but not released to the supernatant during the exposure to standard lysis buffer were electrophoresed also (lanes 4 and 10). hc, Class I heavy chains; gpUS3, US3 glycoprotein; b2m, β2-microglobulin. DISCUSSION Herein we describe the effects of the product encoded by the HCMV US3 gene, a glycoprotein homologous to that encoded by US2, on expression of MHC class I products. By comparison of stably transfected cell lines that express either US2 or US3, we demonstrated that, in contrast to US2, expression of US3 does not cause rapid turnover of class I heavy chains. Instead, gpUS3 was found associated with β2microglobulin-complexed class I heavy chains and inhibited their maturation and transport to the cell surface. Confocal immunofluorescence microscopy indicated that class I heavy chains accumulated predominantly in the ER in US3+ cells. Thus, HCMV encodes at least three proteins that posttranslationally down-regulate MHC class I expression and, presumably, function. The major US3 gene product detected in US3+ cells is a glycoprotein containing endoglycosidase H-sensitive glycans and with a relatively short intracellular half-life (t1/2=1 hr), as was also observed for US2 and US11 (T.R.J. and L.S., unpublished results). The US11 glycoprotein (gpUS11) is an ER-resident protein (21). At present, the intracellular location of gpUS3 has not been determined directly. However, its association with the ER-retained class I heavy chains, and its endoglycosidase H sensitivity, imply that gpUS3 is an ER-resident protein. HCMV gpUS3 is functionally similar to adenovirus E3–19K gene product, although there is no homology between them. The hydropathy profile of US3 is suggestive of a type I membrane protein, such as E3–19K. US3 and E3–19K are similarly-sized and contain high-mannosetype N-linked glycans. E3–19K is an early gene product that binds and retains class I heavy chains in the ER, thus preventing transport to the cell surface and resulting in decreased recognition and lysis by specific cytotoxic T cells (8, 9, 35–38). Unlike gpUS3, which has a short halflife, the E3–19K glycoprotein is stable (8, 9). This difference may be functionally relevant, adding a dimension of complexity to the dynamic equilibrium between class I molecules and the respective viral gene products. Because at early times after infection US3 acts on heavy chains simultaneous with US2 and US11, the interplay among US2, US3, and US11 is likely to be a complicated affair. In any case, significant downregulation of class I molecules can be accomplished even in the face of the short half-life these HCMV gene products. The efficiency of ER retention is influenced by the affinity of the viral protein for the various class I alleles. For example, E3–19K binds to some MHC class I molecules more strongly than to others (39, 40). This also seems to be the case for gpUS3. Over the course of 6 h, maturation of some heavy chains occurs resulting in almost normal cell surface expression of class I at steady state in US3+ cells (Fig. 6 and 7). Our data indicate that heavy chains from the class I alleles expressed in our US3+ cells may not be retained in the ER to the same extent. Evidence for this is 2-fold. (1) Conversion to endoglycosidase H resistance of only the lower but not the upper band of the heavy chain doublet in US3+ cells immunoprecipitated with W6/32 antibody was detected (Fig. 4B). In U373 control cells, conversion to endoglycosidase H resistance of both bands was detected. (2) Surface-labeled heavy chains in US3+ cells have reduced mobility in SDS/PAGE compared with those from U373 control cells (Fig. 7). Combined, these results are consistent with the possibility that not all class I alleles are affected equally by US3. Multiple genes that act to down-regulate MHC class I expression or function may be common to herpesviruses, which engage in an extended relationship with their host. This is especially true for cytomegaloviruses, with their prolonged replication cycles. Murine cytomegalovirus encodes at least two proteins that affect the expression of class I molecules through posttranslational mechanism(s) (15). One gene has been localized to a 6.8-kb region of the MCMV genome and is expressed at early times after infection. This gene functions in a manner similar to US3, in that it causes class I heavy chains to be retained in the ER (15). A second MCMV gene expressed at later times after infection results in the reduction of cell surface class I molecules by an unknown mechanism (15). Why should cytomegaloviruses require multiple MHC class I interactive proteins? In vivo, the requirement for multiple class I downregulatory functions may be reflective of the varied cell types that are infected by HCMV. Alternatively, perhaps all three genes are expressed during in vivo infection, as they are in cultured fibroblasts. In the latter, US2 and US11 are expressed at both early and late times after infection, while US3 is expressed at immediate-early time and at reduced levels at early-late times (refs. 20, 23, and 24; T.R.J. and L.S., unpublished results). Thus, the normal biosynthetic pathway of MHC class I heavy chains is altered throughout infection by HCMV in cultured fibroblasts. Since US3 expression precedes that of US11 and US2, the former may provide an important immunoevasion function to the newly infected cell by preventing effective presentation of immediate-early epitopes and interruption by T cells of the replicative cycle at that point. It was demonstrated that expression from US3 is negatively regulated at early-late times after infection by cellular repressor proteins (26). If abundance or physical state of these

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

HUMAN CYTOMEGALOVIRUS US3 IMPAIRS TRANSPORT AND MATURATION OF MAJOR HISTOCOMPATIBILITY COMPLEX CLASS I HEAVY CHAINS

11333

cellular repressor proteins vary among the different cell types infected by HCMV, then expression kinetics of US3 will be altered concominantly, with effects of gpUS3 on class I heavy chains not limited to the first few hours after infection. One may speculate that class I heavy chains that are retained in the ER by gpUS3 are subsequently attacked by either gpUS11 or gpUS2. Although not formally tested, this may not be the case. gpUS2 and gpUS11 readily exert their effect on free heavy chains (T.R.J. and L.S., unpublished results), and their attack on β2-microglobulin-associated heavy chains is detected shortly after this association (21). Furthermore, gpUS11 has been shown to cause destabilization of newly synthesized heavy chains upon completion of polypeptide synthesis by dislocating them from the ER to the cytosol, probably by reverse transport through the ER translocation complex (21). gpUS2 acts in a similar fashion (E.J.H.J.W., H.L.P., and T.R.J., unpublished results). Therefore, the mechanism of action of these proteins may require class I heavy chains that remain in close association with, or in the proximity of, the translocation complex. In the presence of gpUS3, there are no apparent defects in a very early step of class I biosynthesis, namely, association with β2-microglobulin (Fig. 3). The apparent half-time for this association can vary widely, from less than 5 min to 4 hr for some heavy chain alleles (41, 42). Thus, it is unlikely that heavy chains retained by gpUS3 would still be in the proximity of the translocation complex. Further experiments are required to determine the susceptibility of gpUS3-retained class I heavy chains to gpUS2 or gpUS11 function to properly assess the role of US3 in HCMV infection. This manuscript is dedicated to the memory of Yakov (Yasha) Gluzman, a mentor and colleague. We thank S.Ferrone for the generous gift of TP25.99 monoclonal antibody. H.L.P. and J.A.N. are supported by funding from the National Institutes of Health (Grants NIH-AI-33456 and NIH-AI-21640, respectively). E.J.H.J.W. is on leave from the National Institute of Public Health and Environmental Protection (Bilthoven, The Netherlands) and further supported by a Talent Stipendium of The Netherlands Organization for Scientific Research and a long-term fellowship from the European Molecular Biology Organization. 1. Alford, C.A. & Britt, W.J. (1990) in Virology, eds. Knipe, D.M. & Fields, B.N. (Raven, New York), 2nd Ed., pp. 1981–2010. 2. Oldstone, M.B.A. (1991) J. Virol. 65, 6381–6386. 3. Gooding, L.R. (1992) Cell 71, 5–7. 4. Maudsley, D.J. & Pound, J.D. (1991) Immunol. Today 12, 429–431. 5. McFadden, G. & Kane, K. (1994) Adv. Cancer Res. 63, 117–209. 6. Townsend, A. & Bodmer, H. (1989) Annu. Rev. Immunol. 7, 601–624. 7. Schrier, P.I., Bernards, R., Vaessen, R.T.M.J., Houweling, A. & Van der Eb, A.J. (1983) Nature (London) 305, 771–775. 8. Andersson, M., Paabo, S., Nilsson, T. & Peterson, P.A. (1985) Cell 43, 215–222. 9. Burgert, H.-G. & Kvist, S. (1985) Cell 41, 987–997. 10. York, I.A., Roop, C., Andrews, D.W., Riddell, S.R., Graham, F.L. & Johnson, D.C. (1994) Cell 77, 525–535. 11. Hill, A., Jugovic, P., York, I., Russ, G., Bennink, J., Yewdell, J., Ploegh, H. & Johnson, D.C. (1995) Nature (London) 375, 411–415. 12. Fruh, K., Ahn, K., Djaballah, H., Sempe, P., van Endert, P.M., Tampe, R., Peterson, P.A. & Yang, Y. (1995) Nature (London) 375, 415–418. 13. Del Val, M., Hengel, H., Hacker, H., Hartlaub, U., Ruppert, T., Lucin, P. & Koszinowski, U.H. (1992) J. Exp. Med. 176, 729–738. 14. Campbell, A.E. & Slater, J.S. (1994) J. Virol. 68, 1805–1811. 15. Thäle, R., Szepan, U., Hengel, H., Geginat, G., Lucin, P. & Koszinowski, U.H. (1995) J. Virol. 69, 6098–6105. 16. Levitskaya, J., Coram, M., Levitsky, V., Imreh, S., Steigerwald-Mullen, P.M., Klein, G., Kurilla, M.G. & Masucci, M.G. (1995) Nature (London) 375, 685–688. 17. Beersma, M.F.C., Bijlmakers, M.J.E. & Ploegh, H.L. (1993) J. Immunol. 151, 4455–4464. 18. Warren, A.P., Ducroq, D.H., Lehner, P.J. & Borysiewicz, L.K. (1994) J. Virol. 68, 2822–2829. 19. Yamashita, Y., Shimokata, K., Saga, S., Mizuno, S., Tsurumi, T. & Nishiyama, Y. (1994) J. Virol. 68, 7933–7943. 20. Jones, T.R., Hanson, L.K., Sun, L., Slater, J.S., Stenberg, R.M. & Campbell, A.E. (1995) J. Virol. 69, 4830–4841. 21. Wiertz, E.J.H.J., Jones, T.R., Sun, L., Bogyo, M., Geuze, H.J. & Ploegh, H.L. (1996) Cell 84, 769–779. 22. Chee, M.S., Bankier, A.T., Beck, S., Bohni, R., Brown, C.M., Cerny, R., Horsnell, T., Hutchinson, C.A., Kouzarides, T., Martignetti, J.A., Preddie, E., Satchwell, S.C., Tomlinson, P., Weston, K. & Barrell, B.G. (1990) Curr. Top. Microbiol. Immunol. 154, 125–169. 23. Weston, K. (1988) Virology 162, 406–416. 24. Tenney, D.J. & Colberg-Poley, A.M. (1991) J. Virol. 65, 6724– 6734. 25. Biegalke, B.J. (1995) J. Virol. 69, 5362–5367. 26. Thrower, A.R., Bullock, G.C., Bissell, J.C. & Stinski, M.F. (1996) J. Virol. 69, 91–100. 27. Jones, T.R. & Muzithras, V.P. (1992) J. Virol. 66, 2541–2546. 28. Barnstable, C.J., Bodmer, W.F., Brown, G., Galfre, G., Milstein, C., Williams, A.F. & Ziegler, A. (1978) Cell 14, 9–20. 29. D’Urso, C.M., Wang, Z., Cao, Y., Tatake, R., Zeff, R.A. & Ferrone, S. (1991) J. Clin. Invest. 87, 284–292. 30. Brodsky, F.M. & Parham, P. (1982) J. Immunol. 128, 129–135. 31. Harlow, E. & Lane, D., eds. (1988) in Antibodies: A Laboratory Manual (Cold Spring Harbor Lab. Press, Plainview, NY). 32. Fish, K.N., Britt, W. & Nelson, J.A. (1996) J. Virol. 70, 1855– 1862. 33. Terasaki, M. (1994) in Cell Biology: A Laboratory Handbook, ed. Celis, J.E. (Academic, Orlando, FL), pp. 381–386. 34. Kornfield, R. & Kornfield, S. (1985) Annu. Rev. Biochem. 54, 631–664. 35. Burgert, H.-G., Maryanski, J.L. & Kvist, S. (1987) Proc. Natl. Acad. Sci. USA 84, 1356–1360. 36. Andersson, M., McMichael, A. & Peterson, P.A. (1987) J. Immunol. 138, 3960–3966. 37. Tanaka, Y. & Tevethia, S.S. (1988) Virology 165, 357–366. 38. Hermiston, T.W., Tripp, R.A., Sparer, T., Gooding, L.R. & Wold, W.S.M. (1983) J. Virol. 67, 5289–5298. 39. Severinsson, L., Martens, I. & Peterson, P.A. (1986) J. Immunol. 137, 1003–1009. 40. Beier, D.C., Cox, J.H., Vining, D.R., Cresswell, P. & Engelhard, V.H. (1994) J. Immunol. 152, 3862–3872. 41. Krangel, M.S., Orr, H.T. & Strominger, J.L. (1979) Cell 18, 979–991. 42. Hill, A., Takiguchi, M. & McMichael, A. (1993) Immunogenetics 37, 95–101.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

EPSTEIN-BARR VIRUS VECTORS FOR GENE DELIVERY TO B LYMPHOCYTES

11334

This paper was presented at a colloquium entitled “Genetic Engineering of Viruses and of Virus Vectors,” organized by Bernard Roizman and Peter Palese (Co-chairs), held June 9–11, 1996, at the National Academy of Sciences in Irvine, CA.

Epstein-Barr virus vectors for gene delivery to B lymphocytes

ERLE S.ROBERTSON*, TADAMASA OOKA†, AND ELLIOTT D.KIEFF*‡ *Virology Program, Departments of Microbiology and Molecular Genetics and Medicine, Harvard Medical School, Boston, MA 02115; and †Laboratoire de Virologie, Moléculaire, Faculté de Médecine R.Laënnec, Université Lyon 1, C.N.R.S-UMR30, Rue Guillaume Paradin, 69372 Lyon, Cedex 08, France ABSTRACT Basic research in Epstein-Barr virus (EBV) molecular genetics has provided means to maintain episomes in human cells, to efficiently deliver episomes with up to 150 kbp of heterologous DNA to human B lymphocytes, and to immortalize human B lymphocytes with EBV recombinants that can maintain up to 120 kbp of heterologous DNA. Episome maintenance requires an EBV nuclear protein, EBNA1, whereas immortalization of cells with EBV recombinants requires EBNA1, EBNA2, EBNA3A, EBNA3C, EBNALP, and LMP1. EBV-derived vectors are useful for experimental genetic reconstitution in B lymphocytes, a cell type frequently used in establishing repositories of human genetic deficiencies. The ability of EBV-infected cells to establish a balanced state of persistence in normal humans raises the possibility that cells infected with EBV recombinants could be useful for genetic reconstitution, in vivo. The Epstein-Barr virus (EBV) genome has yielded reagents that have been useful in vector design. Genetic engineering of specifically mutated EBV recombinants has also had a major impact on basic EBV research and is useful for experimental genetic reconstitution in human cells. The purpose of this article is to review previous work, indicate potential utilities and liabilities, and describe recent experiments that should enable intensive investigation of an under explored and important part of the EBV genome. EBV is similar in its replication to other herpes viruses and many of the genetic approaches have substantial precedence in alpha herpes virus research. However, EBV also differs from alpha herpes viruses in that it establishes latency in and alters the growth of human B lymphocytes (for reviews, see refs. 1 and 2). These properties derive in large measure from a unique set of genes that encode nuclear and integral membrane proteins that have been given the acronyms, EBNAs (EBV nuclear antigens) and LMPs (latent membrane proteins). In initiation of latent infection in B lymphocytes, EBV first expresses EBNALP and EBNA2. EBNA2 upregulates the EBNA promoter leading to a longer primary transcript from which EBNALP, EBNA2, EBNA3A, EBNA3B, EBNA3C, and EBNA1 transcripts are derived (Fig. 1). EBNA2 also activates the LMP1 and LMP2 promoters. These proteins act in concert to alter B-lymphocyte growth and enable the maintenance of the EBV genome as a multicopy episome in a state of latent infection. Each of these proteins expressed in latently infected cells, with the exception of EBNA1, has epitopes that are presented on the B-cell surface in the context of common class I major histocompatibility complex (MHC) molecules and are recognized by immune human cytotoxic T lymphocytes. This high level of cytotoxic T-cell recognition and the ability of latently infected cells to shift between full latent gene expression with cell proliferation and an EBNA1 only type of latent infection that is immunologically privileged enables latently infected cells to achieve a balanced state of long-term persistence in humans. This state of long-term persistence could be useful for genetic reconstitution. Orip/EBNA1-Based Vectors. The first EBV-derived reagents useful in vector development were EBNA1 and orip (5). Based on the knowledge that the EBV genome persists in latently infected cells as a multicopy episome (6), the EBV DNA cis-acting factor responsible for episome persistence was identified by screening for an EBV DNA sequence that would enable a heterologous plasmid with an expression cassette for toxic drug degradation to efficiently transform latently infected cells to toxic drug resistance. Plasmids containing an EBV DNA segment, designated plasmid origin or orip, transformed EBV-infected cells with higher efficiency than plasmids without the EBV DNA. Expression of EBNA1 is all that is required to enable an orip-containing plasmid to be maintained in cells without the rest of the EBV genome. Two molecules of EBNA1 bind to a 30-bp palindrome that is tandemly repeated 21 times and to a neighboring dyad repeat of the same sequence. In the presence of EBNA1, the dyad repeat is a bidirectional replication origin, while the tandem repeats enhance transcription from the episome and terminate DNA replication. The episome copy number varies and persistence in dividing cells over multiple divisions is dependent on continuous selection. Over time the episome DNA can integrate into chromosomal DNA (1). Amplicon (Orip/EBNA1/orilyt/Terminal Repeat)-Based Vectors. Orip-containing plasmids have been further modified into amplicons that can be expanded and packaged into EBV in cells containing a replication-competent EBV genome that are permissive for EBV replication. The strategy is similar to that developed for herpes simplex virus (7). An EBV DNA lytic replication origin is all that is necessary for a plasmid to replicate when lytic EBV infection is induced. Linear head to tail concatemers are produced from the template plasmid DNA. The presence of the EBV terminal repeat sequence in the plasmid DNA enables the linear DNA concatemers to be packaged into virions and cleaved into head-full linear DNA molecules of 150–200 kbp. The addition of an EBNA1 expression cassette to the amplicon enables the packaged DNA to persist as an episome in infected human cells. The multiple tandem repeats of the original packaged plasmid DNA tend to persist in the infected cells as a head-full-size episome. Since all of the necessary components of the amplicon contain less than 10 kbp, the payload of heterologous DNA sequence(s) can be as large as 170 kbp. There is therefore ample space to include promoters for gene expression at the appropriate level in human B lymphocytes. Several genes or a large human gene in its own regulatory environment can be efficiently delivered

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact. Abbreviations: EBV, Epstein-Barr virus; EBNA, EBV nuclear antigen; BL, Burkitt lymphoma; LCL, lymphoblastoid cell line. †To whom reprint requests should be addressed, e-mail: [email protected].

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

EPSTEIN-BARR VIRUS VECTORS FOR GENE DELIVERY TO B LYMPHOCYTES

11335

to B lymphocytes. P3HR-1 cells are a suitable packaging cell lines since the endogenous EBV genome is transformation-incompetent and replication-competent. Although the assembly and transfection of very large amplicons into a latently infected lymphoblast packaging cell lines is inefficient, successful transfectants can be selected by using an amplicon-based positive selection marker and the transfected cells can be expanded in large amounts and fully characterized (1, 5). Such cell lines tend to be stable over several months of continuous positive selection. The induction of lytic replication results in amplification and packaging of linear concatemers of the amplicon. The endogenous EBV genome is also packaged into virus. Although the host range of EBV and of the amplicon packaged virus, in culture, is limited to B lymphocytes, EBVtransformed B lymphocytes are derived from genetically deficient humans to retain immortal cell lines with the specific genetic deficiency. Amplicon-based vectors can, therefore, be used for experimental reconstitution of genetic deficiencies in these cells, in vitro. EBV amplicons have recently been used to correct the TAP1 or 2 deficiency in B lymphoblasts derived from patients with type 1 diabetes (8). In a substantial fraction of cases, restoration of TAP1 expression corrected the abnormally low class I MHC expression that is characteristic of type 1 diabetes. An amplicon vector has also been used to correct an enzymatic defect (9).

FIG. 1. Schematic of the region of the Raji genome showing the E3C deletion, and the two B958 cosmids SalIC and EcoRIB, which overlap at the region of EBNA3C and EBNA1. The coordinates for the cosmids are based on the B958 genome (3, 4). The principal limitations of EBV-amplicon-based systems are their restricted host range, the production of replication competent endogenous EBV by the packaging cell line, and the possible effect of EBNA1 on cell growth. EBNA1 is a sequence-specific DNA binding protein that has transcriptional transactivating effects; an effect on transcription of cell genes could have important biological consequences. EBV amplicons packaged in P3HR-1 cells are mixed with P3HR-1 EBV. Although the P3HR-1 EBV cannot immortalize primary human lymphocytes, P3HR-1 is replication-competent and encodes all proteins that are important in EBV-mediated cell growth transformation except for EBNA2 and EBNALP. The EBV host range could likely be expanded by modification of the glycoprotein composition of the EBV outer envelope encoded by the packaging cell line. Gp350 is a highly specific ligand for CD21 that is abundantly expressed only on B lymphocytes. Modification of the ligand determinant or inclusion of other glycoproteins could broaden the host range. Gp350 can for example be incorporated into envelopes along with glycoproteins of varicella zoster virus (10). Recombinant EBV-Based Vectors: Positive Selection Markers. Recent strategies for evaluating the effects of site-specific mutations in the viral genome have enabled a focused assessment of the role of specific genes and intragenic elements in primary B-lymphocyte growth transformation and in lytic EBV infection. The favored approach has been to introduce an EBV DNA fragment with a selectable marker into latently infected cells along with an expression vector for the Z immediate early transactivator of lytic EBV replication (1). Z induces lytic infection and the replicating EBV genome can recombine with the transfected EBV DNA fragment. The progeny virus could then be harvested and plated onto lymphocytes at a low multiplicity, and recombinant infected cells could be identified by genetic selection or marker-specific PCR (11–13). One strategy is to transfect a cell carrying a wild-type latent EBV genome with a mutated EBV DNA fragment carrying an expression vector for a gene that encodes an enzyme that inactivates a toxic drug (11, 12, 14–16). Progeny virus can then be used to infect primary B lymphocytes or a non-EBV-infected continuous B-cell line such as an EBV-negative Burkitt lymphoma (BL) cell line. Cells infected with the recombinant EBV can then be positively selected by growing the infected cells in the presence of the toxic drug (11, 12, 14–16). An advantage of this strategy is that mutations can be made in a gene that is essential for primary B-lymphocyte transformation and the mutant progeny genome can be positively identified by infection of BL cells and by plating of the infected cells under selective conditions (11, 12, 16). The weakness of the BL-cell approach is that BL cells are less susceptible to EBV infection than primary B lymphocytes. Further, reactivation of lytic infection from BL cells is more difficult than from primary B lymphocytes (11, 12, 16). Recombinant EBV-Based Vectors: Marker Rescue for Transformation. The favored approach for most recombinant EBV molecular genetic analyses has been to use cells infected with the replication-competent but transformation-incompetent P3HR-1 EBV strain as the parent for positive selection by marker rescue of transformation. The P3HR-1 EBV genome is deleted for a DNA segment that includes the last two exons of EBNALP and the EBNA2 exon (16, 17). Recombination of P3HR-1 EBV with a transfected wild-type EBV DNA fragment spanning the EBNALP and EBNA2 deletion was, therefore, readily identified by the unique ability of the recombinant progeny virus to transform primary B lymphocytes into long-term lymphoblastoid cell lines (LCLs). The recombinant viral DNA can be characterized in the resultant LCL clones. Virus replication can be induced in these clones and the properties of the recombinant virus can be assayed on infection of new primary B lymphocytes. This has been a simple and relatively reproducible marker rescue strategy so that the efficiency of marker rescue of various specifically mutated EBNALP/ EBNA2 DNA fragments can be compared with wild-type DNA after the initial transfection into P3HR-1 cells. Null mutations in EBNALP/EBNA2 can be inferred by the consistent inability of several isogenic DNA fragments to marker rescue transforming virus in controlled experiments. Recombinant EBV-Based Vectors: Second Site Homologous Recombination to Construct Specific Mutations at any Site in the EBV Genome Other Than EBNALP/EBNA2. Surprisingly, the same marker rescue of transformation strategy could be used to select for recombination at any other site in the EBV genome. A nonlinked second cotransfected EBV DNA fragment was incorporated into at least 10% of the P3HR-1 genomes that had recombined with the EBNA2 and EBNALP DNA fragment (18). EBV second-site recombinants that had acquired a mutation that did not interfere with transformation were readily derived since a total of 103 marker-rescued recombinants could be obtained from a single transfection and

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

EPSTEIN-BARR VIRUS VECTORS FOR GENE DELIVERY TO B LYMPHOCYTES

11336

more than 102 were recombinant at the site of the second cotransfected EBV DNA segment. Since P3HR-1 EBV is wild type at all sites other than the EBNALP/EBNA2 deletion, P3HR-1 EBV can also be used to transcomplement and rescue nontransforming mutations at second sites (18, 19). Thus, using this approach, specific mutations could be introduced anywhere in the genome except for nontransforming mutations within the EBNALP/EBNA2 DNA fragment (20). Recombinant EBV-Based Vectors: EBV Cosmid or F-Factor-Derived Clones to Reconstruct Intact or Mini-Transforming EBV Genomes. Based on the observations that the pseudorabies virus genome can be reconstructed from overlapping clones of pseudorabies virus DNA, EBV genomes have been largely or completely reconstructed from overlapping cosmid clones of EBV DNA. After futile attempts to obtain lytic infection with overlapping EBV DNA cosmids in noninfected cells, P3HR-1 EBV-infected cells were used so that the endogenous P3HR-1 EBV could provide lytic replication and packaging functions in trans (17, 21, 22, 23). By checking seven sites characteristic of the transfected cosmid cloned EBV DNAs, it was found that approximately 10% of the resulting transforming recombinants were composed of only transfected cosmid DNA (20). The frequency of incorporation into recombinants of any single transfected EBV DNA fragment was twice as high with overlapping cosmid transfection as with second-site recombination (24). Most interestingly, a 12-kbp deletion in the transfected EBV DNA was much more frequently incorporated into recombinant genomes than occurred by second-site recombination (20). A much larger deletion was engineered by deleting from the transfected EBV DNA most of the 58 kbp of DNA between the EBNA1 and LMP1 open reading frames (Fig. 1). Only three overlapping cosmids were necessary for constituting this deleted EBV genome. More than 20% of the transforming recombinants that arose after transfection of P3HR-1 EBV-infected cells with the three cosmid EBV DNA clones had markers indicative of only the transfected EBV DNAs. A further variation of this strategy is to assemble transformation competent, replication incompetent, mini-EBV genomes from several cosmid clones of EBV DNA cotransfected into cells carrying the P3HR-1 EBV or to assemble similar genomes in Escherichia coli as an Ffactor-based plasmid that can then be packaged in cells carrying the P3HR-1 EBV (13, 23, 24). Both approaches have demonstrated that noncoding exons and introns of the long EBNA transcript and most of the lytic genes between EBNA1 and LMP1 can be deleted (13, 23, 25). An analysis of all the deletions made in the EBV genome demonstrates that the residual complexity of the genome required for transformation of a B lymphocyte in vitro is approximately 48 kbp, or 26% of the genome (14, 25–31). The construction of mini-transforming EBV genomes with large segment(s) of heterologous DNA could be independent of P3HR-1 since direct transformation of primary B lymphocyte with a cosmid DNA should be feasible given the small residual complexity of the transforming EBV genome. Progress will likely continue to be driven by the need for more efficient molecular genetic analyses in basic EBV research. Mini-EBV genomes are potentially useful to make EBV recombinants that include 100–110 kbp of heterologous DNA; such mini-EBV genomes could ultimately have a place in genetic reconstitution. Mini-EBV genomes carrying a human gene or gene complex could be used to immortalize primary B cells of an individual suffering from a particular genetic defect. Transforming mini-EBV genomes would be unable to replicate and spread. Their particular utility as opposed to EBNA1/ orip-based approaches resides in the role of the EBNAs and LMPs in achieving a dynamic balance between renewal of latently infected cells and their destruction by immune T lymphocytes in normal humans. EBV-infected primary B lymphocytes would be expected to be long-lived latently infected lymphoblasts similar to those in natural EBV infection. EBV infection is largely nonpathogenic and almost all adults harbor EBV. In EBV-infected humans, latently infected cells constitute 1 in 10−5 to 10−6 circulating B lymphocytes and appear to be more prevalent in tonsils and other lymphoid organs. A substantial number of latently infected cells can persist over a long time. The persistence of latently infected cells in normal humans appears to be dependent on the ability of EBV-infected cells to be maintained in a dynamic balance between an EBNA1-only type of latency, which is nonproliferative but immunologically “privileged,” and an EBNALP, 2, 3A, 3B, 3C, LMP1, and LMP2 type of latency in which the cells are driven to proliferate but are subject to immune surveillance. The switch between the two types of latency appears to be dependent on the activity of the Wp/Cp promoter for EBNALP, 2, 3A, 3B, and 3C transcription, with the EBNA1-only promoter being a downstream default promoter. Regulation of the two types of latency could in theory be achieved by replacing the Wp/Cp EBNA promoter with a pharmaco-logically regulated promoter. Since each old world primate has an endogenous EBV-related agent, experimental studies, in vivo, are feasible. The relationship of EBV with malignancies is an important problem despite the very low frequency of EBV-related malignancy in normal people. Latently infected cells could be physically contained in a filter-bound unit, in vivo; this might assure an extra margin of safety against escape of these cells from immune surveillance. Specific hereditary defects that can be corrected through the release of wild-type protein into the peripheral circulation are the most likely targets for mini-EBV-transformed cell reconstitution. Correction of disorders in non-B lymphocytes is considerably more complicated since EBNA2 interacts with the B-cell-lineage-specific transcription factor PU.1 in achieving regulated EBV gene expression. EBV Genes Essential for Primary B-Lymphocyte Growth Transformation. The central objective of most EBV-recombinant-based experimentation has been for genetic analysis of the role of EBV genes in latent growth transforming infection. The first marker rescue of transformation experiments from P3HR-1 cells demonstrated the importance of the EBNA2 open reading frame and of the last two exons of EBNALP in primary B-lymphocyte growth transformation (7, 21, 32). Subsequent extensive mutagenesis analyses of the EBNA2 open reading frame leave only seven prolines near the amino terminus, the domain that interacts with EBNA2 response element specific cellular DNA binding proteins RBPJkappa and PU.1, and the carboxyl-terminal acidic transactivating domain as being important for primary B-lymphocyte growth transformation (6, 7, 21, 33, 34). Thus, recombinant-EBV-based EBNA2 genetic analyses indicate that EBNA2 is essential for transformation because of its role as a transcriptional transactivator. EBNA2 binds to cellular transcription factors that recognize specific DNA sequences; EBNA2 then assembles basal and activated transcription components at nearby promoter sites. Using second-site homologous recombination, the effect of a single nonsense mutation in EBNA3A, EBNA3B, or EBNA3C has been evaluated. LCLs infected with an EBV recombinant with a stop codon inserted at aa 109 in the EBNA3B reading frame arose at the expected frequency indicating from the start that EBNA3B is not critical for growth transformation of primary B lymphocytes in the context of an otherwise normal EBV genome. The LCLs infected with the EBNA3B stop codon recombinant were indistinguishable in their growth from wild-type-recombinant-infected LCLs and were similar in their response to activation of lytic EBV infection. These experiments demonstrate that the last 829 codons of EBNA3B are not important in primary B-lymphocyte infection or growth transformation in vitro (19). The dispensability of EBNA3B in tissue culture highlights a

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

EPSTEIN-BARR VIRUS VECTORS FOR GENE DELIVERY TO B LYMPHOCYTES

11337

limitation of these transformation assays. EBNA3B engenders strong cytotoxic T-cell responses in humans and is unlikely to have persisted in the viral genome unless it is important role in viral infection in vivo (1, 2). In contrast to EBNA3B, stop codons inserted into the EBNA3A reading frame after codon 302 or into the EBNA3C reading frame after codon 365 only resulted in transforming recombinants when the recombinant-infected cells were coinfected with P3HR-1 EBV, which can provide wild-type EBNA3s in trans (24). Mutant EBNA3A recombinant EBV coinfected LCLs rapidly lost the mutant EBNA3A gene through secondary recombination between the mutant EBNA3A and wild-type EBNALP and EBNA2 EBV recombinant and the coinfecting P3HR-1 EBV genome (which is wild type for EBNA3A and deleted for EBNALP and EBNA2). These data suggest that EBNA3A is important in primary B-lymphocyte growth transformation and that expression of the first 302 amino acids has a negative effect on cells so that there is selection against its retention (24). Transfections of P3HR-1 infected cells with an F-factor-derived plasmid containing the known transforming regions of the EBV genome and a frameshift mutation in codon 304 of EBNA3A has provided additional evidence for a critical role in that almost all LCLs that arose were either coinfected with P3HR-1 EBV or were recombinant and wild type at EBNA3A (25). Two LCLs were isolated that lacked wild-type EBNA3A, indicating that the last 640 amino acids of EBNA3A are not absolutely essential for the maintenance of LCL growth. An EBV recombinant with EBNA3C mutated by a nonsense codon insertion after codon 365 was extensively tested for its ability to transform primary B lymphocytes with or without added P3HR-1 to provide wild-type EBNA3C in trans. LCLs containing the mutant EBNA3C arose only when P3HR-1 was provided in trans (86 coinfected versus 0 singly infected). These results indicate that the last 627 codons of EBNA3C are critical for primary B-lymphocyte growth transformation (24). Biochemical data indicate that the EBNA3s are modulators of transcription of cell and viral genes that have RBPJkappa binding sites (35). The integral membrane protein LMP1 is also essential for primary B-lymphocyte growth transformation. EBV recombinants with a stop codon after codon 9 or 84 could only transform primary B lymphocytes when wild-type LMP1 was provided in trans by P3HR-1 coinfection. The mutant open reading frame recombinants expressed N-terminally truncated LMP1s initiated at internal methionines. When virus was transferred from the open reading frame stop codon recombinant LCLs to primary B lymphocytes, mutant recombinant genomes only initiated growth transformation when wild-type LMP1 was encoded in trans by P3HR-1 coinfection (271 coinfected versus 0 singly infected). Thus, these results indicate a stringent requirement for wild-type LMP1 in primary B-lymphocyte growth transformation (29–31). In contrast, deletion of aa 2–7, 6–17, or 18–24 from the 20-aa amino-terminal cytoplasmic domain had at most (with the 6–17 deletion) a 10-fold reducing effect on primary B-lymphocyte growth transformation efficiency; the resultant LCLs were similar to wild-type LCLs in their growth. The 6– 17 deletion removes all of the strongly basic amino acids from the amino-terminal cytoplasmic domain and adversely affects LMP1 patching in the plasma membrane. These results are most consistent with the important role for the amino-terminal cytoplasmic domain being to anchor the first transmembrane domain (29). The LMP1 open reading frame is 386 codons and the last transmembrane domain ends with aa 187. Insertion of a stop codon after codon 231 resulted in an EBV recombinant than can transform primary B lymphocytes with wild-type efficiency, at least as measured by growth on fibroblast feeders. In contrast, EBV recombinants with a stop codon inserted after codon 187 could only be recovered in LCLs when wild-type LMP1 was provided by coinfecting P3HR-1 genomes (0 singly infected versus 29 P3HR-1 EBV complemented clones on passage of five mutant recombinants). Similar results were obtained with or without fibroblast feeders (31). These results indicate that the first 44 aa of the carboxyl-terminal cytoplasmic domain may include an effector domain that is critical for primary Blymphocyte growth transformation (31). More recent studies of this 44-aa domain using a yeast two-hybrid screen indicated that this region interacts with tumor necrosis factor receptor-associated factors, which appear to be a crucial link to B-lymphocyte growth transformation and NFkB activation (36). Other than EBNA1, which has not been investigated because of its obvious importance for episome maintenance, most of the rest of the EBV genome has been shown to be unimportant for primary B-lymphocyte growth transformation. LMP2, EBERs, and BARF0, which are transcribed in latent EBV infection, as well as BHRF1 and BCRF1, which are transcribed early or late in EBV replication have been specifically mutated and found to be unimportant for primary B-lymphocyte growth transformation. BHRF1 was of interest because of its similarity to bcl2 and BCRF1, because of its near identity to IL10. The BCRF1 deletion interestingly included the Cp alternative EBNA promoter and the deletion had no adverse effect on EBV infection in primary B lymphocytes (1, 2, 22, 26, 28, 37, 38). Derivation of a New Packaging Cell Line Useful for Specific Mutagenesis of the Central Part of the EBV Genome and for the Generation of Replication-Incompetent Recombinants. Raji, one of the earliest derived EBV-infected BL-derived cell lines, has an endogenous EBV genome that is defective in both transformation and lytic replication. Raji may be superior to P3HR-1 as a packaging cell line because of the inability of the endogenous virus to replicate in newly infected cells. The Raji EBV genome is deleted for a 3-kbp DNA segment that includes most of the EBNA3C open reading frame. Raji is also deleted for a 2.7-kbp DNA segment that encodes most of the major singlestrand DNA binding protein that is an essential early lytic DNA replication protein. This second deletion also includes a second early open reading frame of unknown function and part of the LMP2 open reading frame. Surprisingly, transfection of Raji cells with an expression vector for the major single-stranded DNA binding protein has sufficed for productive virus replication after treatment of Raji cells with inducers of lytic infection. However, the resultant virus has not been previously tested in primary B-lymphocyte transformation assays (39). Based on the previous recombinant EBV molecular genetic experiment with a EBNA3C stop codon mutation, the Raji virus should be substantially more than 90% deficient in cell growth transformation. Depending on the amount of virus produced from Raji cells, there may be detectable residual transforming activity. Further, the Raji genome may have mutations in other essential transforming genes. However, if the nontransforming phenotype is due to the EBNA3C deletion, Raji cells could be quite useful for recombinant EBV-based genetic analyses of EBNA3C and surrounding genes in much the same way that the P3HR-1 EBV genome has been particularly useful for analyses of the EBNALP and EBNA2 genes. We therefore transfected Raji cells with EBV DNA fragments that included EBNA3C, induced lytic EBV infection, and assayed the resultant virus stocks for the ability to transform primary B lymphocytes.

MATERIALS AND METHODS Cell Lines. B958 EBV is wild type for EBNA3C (1,3,4). Raji TK−, Raji R19, and Raji R30 are deleted for most of the EBNA3C open reading frame (3, 4). B-lymphocyte cell lines were cultured in RPMI 1640 medium containing 10% fetal bovine serum, Gentamicin (10 µg/ml), and 2 mM glutamine.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

EPSTEIN-BARR VIRUS VECTORS FOR GENE DELIVERY TO B LYMPHOCYTES

11338

Primary B cells were processed from healthy adult donors (13, 23). Cosmid Transfections. Cosmids SalIC and EcoRIB DNA was digested with restriction enzymes to release the EBV DNA from the vector and 25 µg of each DNA was phenol/ chloroform-extracted, ethanol-precipitated, and resuspended in 400 µl of RPMI 1640 medium containing 10% fetal bovine serum. pSVNaeZ (25 µg) and 15 million Raji cells were added for electroporation at 250 V and 960 µF. The transfected cells were transferred to 10 ml of complete medium and incubated at 37°C in 5% CO2/95% air for 5 days. Infection of Primary B Lymphocytes. Human primary B lymphocytes were infected with 0.45-µm (pore size) filtered culture supernatant from Raji cells 5 days after electroporation. Virus was incubated with 10 million T-cell-depleted B cells for 2 h at 37°C. Infected cells were plated in complete medium with 15% fetal bovine serum and 2 mM glutamine in 96-well plates at 50,000 cells per well (13, 23). Each well was fed with 100 ml of complete medium after 7 days. PCR Analyses. Primers flanking the BALF2 deletion (positions 163,978–166,635) corresponded to the B958 sequence of positions 163,739–163,761 (forward primer) and 166,758– 166,779 (reverse primer). The EBNA3C deletion (positions 99,126–102,118) primers were forward primer, positions 98,890–98,910, and reverse primer, positions 102,227–102,250 (3, 4). All primers were purchased from GIBCO/ BRL. The primers that amplify across the BALF2 deletion amplified a 383-bp DNA fragment and the primers that amplify across the EBNA3C deletion amplified a 368-bp fragment (3, 4). Immunoblot and Southern Blot Analyses. Expression of EBV antigens was evaluated by electrophoresis of denatured LCLs proteins in 8% SDS/PAGE gels and immunoblot analysis with a human polyclonal sera that recognizes latent and lytic antigens or with a monoclonal antibody that recognizes EBNA3C (35). For Southern blots, 15 µg of infected-cell DNA was digested with KpnI restriction enzyme and the fragments were size-fractionated by loading onto a 0.6% agarose gel and electrophoresed (13, 23). DNA was transferred to an activated nylon membrane (GeneScreenPlus; NEN) and was hybridized with a [32P]dCTP-labeled HindE probe.

RESULTS AND DISCUSSION Marker Rescue of Transformation from Raji Cells Using Cosmid DNAs That Overlap the EBNA3C Deletion. To test whether Raji cells are highly deficient in primary B-lymphocyte transformation as a result of the EBNA3C deletion, Raji cells converted to stable expression of the single-strand DNA binding protein (BALF2) were transfected with SalIC and EcoRIB EBV DNA fragments. Two EBV DNA fragments were transfected into the converted Raji cells because SalIC ends only 3 kbp downstream of the EBNA3C gene and EcoRIB starts only 3 kbp upstream of the EBNA3C gene. In previous second-site homologous recombination experiments in P3HR-1 cells, SalIC was substantially less efficient in homologous replacement of EBNA3C than in replacement of EBNA3B or EBNA3A and this was attributed to the shorter flanking homology with EBNA3C (Fig. 1). The Z immediate early transactivator was cotransfected into the Raji cell to induce lytic EBV infection. The resultant virus was harvested and used to infect primary human B lymphocytes. Clones of transformed cells arose at a very low efficiency. From three Raji cell transfection and primary B-lymphocyte infection experiments, 3, 10, and 10 clones of transformed cells were obtained and most grew out into long-term lymphoblastoid cell lines. In contrast, no transformants were obtained from the same BALF2-converted Raji cells that were transfected with Z and no cosmid DNA. The Raji-derived LCLs were initially similar to other wild-type LCLs but their growth slowed over the first 6 months in culture compared with the wild-type LCLs and six of the LCLs did not survive for 6 months in culture. This could be due to the inability of the Raji virus to replicate and spread among the initially infected primary B lymphocytes. PCR analysis across the BALF2 deletion site amplified a 383-bp DNA fragment indicative of the specific Raji deletion (Fig. 2A). Thus, the LCLs are transformed with a Raji-derived EBV. The EBNA3C deletion was also analyzed by PCR and these analyses indicated that the LCLs did not have the deletion of EBNA3C that is characteristic of Raji cells. The wild-type fragment of 3.4-kbp fragment characteristic of wild-type DNA would not be amplified under these conditions but the 368-bp deletion DNA fragment was amplified from the parental Raji cell line and not from the LCLs (Fig. 2B). These data are compatible with replacement of the deletion with wild-type EBNA3C DNA in the Raji-EBV-derived LCLs. Genomic Analysis of LCL DNAs Around EBNA3C. Southern blot analysis was done on a KpnI digest of the total cell DNA. The labeled EBV HindE DNA fragment that includes the EBNA3C open reading frame hybridized to 2.6-kbp and 0.7-kbp KpnI fragments that are characteristic of wild-type EBNA3C in the digest of wild-type B958 derived LCL DNA but not in the parental Raji EBV DNA. Each of the LCLs infected with the Raji recombinant virus had the 2.6-kbp and 0.7-kbp fragments characteristic of wild-type EBNA3C DNA (Fig. 3, compare lanes L1–L6 with lanes RTK, R19, and B95). The Southern blot and PCR data confirm that the LCL-infected marker rescued virus derived from Raji cells has wild-type and not mutant EBNA3C. The Rescued LCLs Express EBNA3C but not BALF2. The LCLs were analyzed for expression of the 135-kDa major single-strand DNA binding protein by Western blot analysis with a human polyclonal serum. As expected, the LCLs and the RTK- Raji cells had no detectable p135 while p135 was readily detected in a B958 LCL and in the Raji cell lines that had been converted to BALF2 expression (39) (Fig. 4A). Also, EBNA3C was detected in each of the LCLs and in the B958-derived LCLs and was absent from RTK- Raji, from each of the BALF2-converted Raji cell lines, and from the EBV-negative BL cell line BJAB (Fig. 4B; compare lanes L1–L6 and lane B95). These experiments demonstrated that

FIG. 2. PCR analysis of Raji LCLs showing the amplification of a DNA fragment across the BALF2 deletion and across the EBNA3C deletion in Raji cells. (A) Lanes: L1–L16, amplification from LCL DNAs; RTK-, from the parental Raji cell line DNA; P3, P3 DNA as a negative control; PO, primer-only control. The DNA fragment indicative of the BALF2 deletion 383 bp in size is seen in the representative lanes containing the Raji genome. (B) Amplification of the DNA fragment 368 bp in size representative of the EBNA3C Raji deletion junction (lanes were similar to those in A; R19, from the parental Raji cell line stably maintaining the BALF2 gene). Approximate sizes were determined by the X174 RsaI DNA markers.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

EPSTEIN-BARR VIRUS VECTORS FOR GENE DELIVERY TO B LYMPHOCYTES

11339

the LCLs that arose after infection with virus from the EBV DNA SalIC- and EcoRIB-transfected Raji cells express levels of EBNA3C similar to a wild-type-EBV-infected LCLs. EBNA1 maps 7 kbp away from EBNA3C in the transfected EcoRIB fragment. Each of the six LCLs that was transformed by Raji recombinant virus had the EBNA1 encoded by the transfected EcoRIB fragment; EBNA1 encoded by the transfected EcoRIB fragment is identical in size to that in the B958-transformed LCL (from which the EcoRIB fragment was cloned) and is considerably larger than the Raji EBNA1 (compare lanes L1–L6 with lanes RTK-, R19, and B95; Fig. 4). These data indicate that a substantial part of the transfected EcoRIB DNA has recombined with the endogenous Raji genome.

FIG. 3. Southern blot of LCL DNAs digested with KpnI restriction enzyme for comparison with the wild-type Raji TKparental cell lines and the B958 DNA as control DNA from which the SalIC and EcoRIB cosmids were cloned (3, 4, 19). The HindE probe hybridizes to KpnI DNA fragments of 17.3 kbp, 2.6 kbp, 0.7 kbp, and 0.14 kbp across the EBNA3 region (3, 4). Fragments were fractionated on a 0.6% agarose gel, transferred to GeneScreenPlus nylon membrane, and then probed with [32P]dCTP-labeled HindE fragment. Markers used were λ DNA digested with HindIII as shown on the left. The arrows on the right indicate the appropriate KpnI fragments rescued in the LCLs. These experiments describe a new packaging cell line for the construction of EBV recombinants. The cell line differs from previous packaging cell lines in that the endogenous EBV genome is not wild type for transformation or replication. The latently infected Raji cells have been rendered fully competent for lytic infection by complementation with a stably transfected expression vector for an essential early gene, BALF2, that is partially deleted from the endogenous Raji genome. Although the BALF2-converted Raji cells were previously shown to produce virions (39), to our knowledge, these experiments are the first proof that such cells can produce virions capable of infecting B lymphocytes. The small numbers of virus recombinants that have so far been characterized are still deleted for BALF2, as is anticipated from previous experiments in which replicating herpes simplex virus genomes very rarely if ever recombined with chromosomally integrated viral genes. The frequency of recombination is less than 1 in 105 in situations in which the integrated DNA lacks a lytic replication origin and has no homology to the infecting viral DNA (40). The BALF2 DNA is presumed to be integrated and lacks a lytic replication origin; but, the endogenous Raji EBV genome has 2.6 kbp of the BALF2 open reading frame. Recombination may therefore occur with a low frequency.

FIG. 4. Immunoblot analysis of cell lysate from LCLs compared with the BALF2 stably expressing cell lines R19 and R30 parental cell lines. Lanes, L1–L6, LCLs; R19 and R30, parental Raji cell lines; B95, cell lysate from a B958 LCL wild type for BALF2 (gp135); BJ, cell lysate from an EBV negative B lymphoma cell line. An 8% SDS/ PAGE gel was loaded, and samples were electrophoresed, then transferred to nitrocellulose membrane, and probed with a human polyclonal antiserum that recognizes the gp135 lytic antigen. (B) Similar immunoblot probed with monoclonal antibody A10 against the EBNA3C viral antigen (35). Bio-Rad broad-range prestained protein markers were used as standards. The arrows on the right indicate the appropriate protein. (C) Immunoblot of cell lysates from the LCLs (lanes L1–L6) for comparison of the EBV latent antigens to that of the parental strains RTK- and R19 (lanes RTK- and R19) and that of a B958 LCL (lane B95). The membrane was probed with a human polyclonal antiserum for detection of EBV latent antigens. The latent antigens are indicated by the arrows on the right. Prestained protein markers were used as standards. The Raji recombinant system should be particularly useful for the genetic analysis of EBNA3C and of surrounding genes. The data so far simply indicate that the endogenous Raji genome can be transcomplemented by BALF2 and will produce biologically active virus when the SalIC and EcoRIB EBV DNA fragments are transfected into Raji cells; the transforming virus that results has markers from the transfected DNA, including EBNA3C, which is known to be deleted from Raji and to be important for primary B-lymphocyte growth transformation. Thus, the simplest interpretation of the data is that the transfected DNA provides wild-type EBNA3C to the transformation-marker-rescued recombinants. However, the limited analyses that have been done indicate that the recombinants have much more than EBNA3C from the transfected EBV DNA. Transformation marker rescue from Raji has not yet been shown to be specifically dependent on an intact EBNA3C open reading frame. The power of the system in more precisely evaluating the importance of EBNA3C and of specific residues in EBNA3C will come from improvements in the efficiency of transformation marker rescue and from a reduction in the size of the marker rescuing DNA fragment. Now that the first recombinants have

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

EPSTEIN-BARR VIRUS VECTORS FOR GENE DELIVERY TO B LYMPHOCYTES

11340

been made in a Raji-EBV-genome-based packaging cell system, further experiments should specifically address these issues. This work was supported by Grant CA47006 from the National Cancer Institute of the United States Public Health Service. E.S.R. is supported by a fellowship from the Leukemia Society of America. 1. Kieff, E.D. (1995) in Virology, eds. Fields, B.N., Howley, P., Knipe, D., Chanock, R., Melnick, J., Monath, T., Roizman, B. & Straus, S. (Raven, New York), 3rd Ed., pp. 2343–2396. 2. Rickinson, A.B. & Kieff, E.D. (1995) in Virology, eds. Fields, B.N., Howley, P., Knipe, D., Chanock, R., Melnick, J., Monath, T., Roizman, B. & Straus, S. (Raven, New York), 3rd Ed., pp. 2397–2446. 3. Baer, R., Bankier, A.T., Biggin, M.D., Deininger, P.L., Farrell, P.J., Gibson, T.J., Hatfull, G., Hudson, G.S., Satchwell, S.C., Séguin, C., Tuffnell, P.S. & Barrell, B.G. (1984) Nature (London) 310, 207–211. 4. Farrell, P.J. (1992) Genetic Maps ed. O’Brien, S.J. (Cold Spring Harbor Lab. Press, Plainview, NY), 6th Ed., pp. 1.120–1.133. 5. Sugden, B., Marsh, K. & Yates, J. (1985) Mol. Cell. Biol. 5, 410–413. 6. Lindahl, T., Adams, A., Bjursell, G., Bornkamm, G.W., Kascha-Dierich, C. & Jehn, U. (1976) J. Mol. Biol. 102, 511–530. 7. Kwong, A.D. & Frenkel, N. (1985) Virology 142, 421–425. 8. Wang, R, Li, X., Annis, B. & Faustman, D.L. (1995) Hum. Gene Ther. 6, 1005–1017. 9. Banerjee, S., Livanos, E. & Vos, J.H. (1995) Nat. Med. 1, 1303–1308. 10. Lowe, R.S., Keller, P.M., Ellis, R.W., Davison, A., Kieff, E. & Morgan, A. (1987) in Vaccines 87, eds. Chanock, R., Lerner, R., Brown, F. & Ginsberg, H. (Cold Spring Harbor Lab. Press, Plainview, NY), pp. 364–367. 11. Marchini, A., Longnecker, R. & Kieff, E. (1992) J. Virol. 66, 4972–4981. 12. Marchini, A., Kieff, E. & Longnecker, R. (1993) J. Virol. 67, 606–609. 13. Robertson, E.S., Tomkinson, B. & Kieff, E. (1994) J. Virol. 68, 1449–1458. 14. Lee, M.A., Kim, O.J. & Yates, J.L. (1992) Virology 189, 253–265. 15. Lee, M.A. & Yates, J.L. (1992) J. Virol. 66, 1899–1906. 16. Marchini, A., Cohen, J., Wang, F. & Kieff, E. (1992) J. Virol. 66, 3214–3219. 17. Cohen, J.I., Wang, F., Mannick, J. & Kieff, E. (1989) Proc. Natl. Acad. Sci. USA 86, 9558–9562. 18. Tomkinson, B. & Kieff, E. (1992) J. Virol. 66, 780–789. 19. Tomkinson, B. & Kieff, E. (1992) J. Virol. 66, 2893–2903. 20. Tomkinson, B., Robertson, E.S., Yalamanchili, R., Longnecker, R. & Kieff, E. (1993) J. Virol. 67, 7298–7306. 21. Hammerschmidt, W. & Sugden, B. (1989) Nature (London) 340, 393–397. 22. Miller, G., Robinson, J., Heston, L. & Lipman, M. (1994) Proc. Natl. Acad. Sci. USA 71, 383–387. 23. Robertson, E.S. & Kieff, E. (1995) J. Virol. 69, 983–993. 24. Tomkinson, B., Robertson, E.S. & Kieff, E. (1993) J. Virol. 65, 6765–6771. 25. Kempes, B., Pich, D., Zeidler, R., Sudgen, B. & Hammerschmidt, W. (1995) J. Virol. 69, 231–238. 26. Longnecker, R., Miller, C.L., Tomkinson, B. & Kieff, E. (1993) J. Virol. 67, 2006–2013. 27. Mannick, J.B., Cohen, J.L., Birkenbach, M., Marchini, A. & Kieff, E. (1991) J. Virol. 65, 6826–6837. 28. Marchini, A., Tomkinson, B., Cohen, J. & Kieff, E. (1991) J. Virol. 65, 5991–6000. 29. Izumi, K.M., Kaye, K.M. & Kieff, E.D. (1994) J. Virol. 68, 4369–4376. 30. Kaye, K.M., Izumi, K.M. & Kieff, E. (1993) Proc. Natl. Acad. Sci. USA 90, 9150–9154. 31. Kaye, K.M., Izumi, K.M. & Kieff, E. (1995) J. Virol. 69, 675–683. 32. Cohen, J.I. & Kieff, E. (1991) J. Virol. 65, 5880–5885. 33. Wang, F., Tsang, S., Kurilla, M.G., Cohen, J.I. & Kieff, E. (1990) J. Virol. 64, 3407–3416. 34. Yalamanchili, R., Tong, X., Grossman, S.R., Johannsen, E., Mosialos, G. & Kieff, E. (1994) Virology 204, 634–641. 35. Robertson, E., Grossman, S., Johannsen, E., Miller, C., Lin, J., Tomkinson, B. & Kieff, E. (1995) J. Virol. 69, 3108–3116. 36. Mosialos, G., Birkenbach, M., Yalamanchili, R., VanArsdale, T., Ware, C. & Kieff, E. (1995) Cell 80, 1–20. 37. Swaminathan, S., Tomkinson, B. & Kieff, E. (1991) Proc. Natl. Acad. Sci. USA 88, 1546–1550. 38. Swaminathan, S., Hesselton, R., Sullivan, J. & Kieff, E. (1993) J. Virol. 67, 7406–7413. 39. Decaussin, G., Leclerc, V. & Ooka, T. (1995) J. Virol. 69, 7309–7314. 40. Rice, S.A. & Knipe, D.M. (1990) J. Virol. 64, 1704–1715.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

GENETICALLY ENGINEERED POXVIRUSES FOR RECOMBINANT GENE EXPRESSION, VACCINATION, AND SAFETY

11341

This paper was presented at a colloquium entitled “Genetic Engineering of Viruses and of Virus Vectors,” organized by Bernard Roizman and Peter Palese (Co-chairs), held June 9–11, 1996, at the National Academy of Sciences in Irvine, CA.

Genetically engineered poxviruses for recombinant gene expression, vaccination, and safety BERNARD MOSS* Laboratory of Viral Diseases, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892– 0445 ABSTRACT Vaccinia virus, no longer required for immunization against smallpox, now serves as a unique vector for expressing genes within the cytoplasm of mammalian cells. As a research tool, recombinant vaccinia viruses are used to synthesize and analyze the structure-function relationships of proteins, determine the targets of humoral and cell-mediated immunity, and investigate the types of immune response needed for protection against specific infectious diseases and cancer. The vaccine potential of recombinant vaccinia virus has been realized in the form of an effective oral wild-life rabies vaccine, although no product for humans has been licensed. A genetically altered vaccinia virus that is unable to replicate in mammalian cells and produces diminished cytopathic effects retains the capacity for high-level gene expression and immunogenicity while promising exceptional safety for laboratory workers and potential vaccine recipients. On May 14, 1776, an English country physician named Edward Jenner inoculated 8-year-old James Phipps with cowpox virus isolated from the infected hand of Sarah Nelmes, a milkmaid (1). Jenner demonstrated that the boy was resistant to smallpox and the new procedure became known as vaccination (L. vacca cow) to distinguish it from variolation, an older and far more risky procedure of inoculation with small amounts of the smallpox (variola) virus itself. Although vaccination was met with some initial skepticism (Fig. 1), it was widely adopted. Cowpox virus was later superseded by vaccinia virus, a closely related virus that may have been isolated from a horse (2) and that produced a milder vaccination reaction. Despite the profound differences in human virulence of variola, vaccinia, and cowpox viruses, they are now known to belong to the same Orthopoxvirus genus, accounting for their ability to cross protect. Jenner accurately predicted “that the annihilation of the Small Pox, the most dreadful scourge of the human species, must be the final result of this practice [vaccination]” (cited in ref. 3). The last endemic case of smallpox occurred in 1977, bringing to an end the ravages wrought by smallpox over the past 3000 or more years (3). In 1980, the Assembly of the World Health Organization declared smallpox eradicated and recommended the discontinuation of smallpox vaccination. Ironically, that year also marked the application of recombinant DNA technology to vaccinia virus (4, 5), providing the means for genetically engineering poxviruses and developing them as expression vectors and candidate vaccines against unrelated infectious diseases (6, 7). Molecular Biology of Poxviruses. The study of poxviruses has been motivated by a desire to understand the unique replication program of these large complex genetic systems (8). An appreciation of the molecular biology of poxviruses was crucial for their rational development as expression vectors (9). The ability of poxviruses to replicate entirely within the cytoplasm of the infected cell, even though they have DNA genomes, is the most distinctive feature of the members of this family. Detailed information regarding poxviruses was derived mainly from studies with vaccinia virus, although the basic features apply to other family members as well. Infectious vaccinia virus particles are brick-shaped, 300–400 nm in diameter with lipoprotein membranes that surround a complex core structure containing a linear and nearly 200,000-bp duplex DNA molecule. Numerous virus-encoded enzymes, including a multisubunit DNAdependent RNA polymerase, a transcription factor, capping and methylating enzymes, and a poly(A) polymerase, are packaged within the virus core and enable particles to synthesize translatable mRNAs with typical eukaryotic features after entry into a cell (Fig. 2). Initially, only the early genes are transcribed: they encode proteins involved in stimulation of the growth of neighboring cells, defense against host immune responses, replication of the viral genome, and transcription of the intermediate class of viral genes. The progeny viral DNA molecules serve as templates for the sucessive expression of intermediate and late genes. The three temporal classes of genes have promoters with distinctive sequence elements (10–12) that are recognized by specific viral proteins (13), providing the basis for a programmed cascade mechanism of gene regulation (Fig. 2). Upon synthesis of the late structural proteins, infectious virus particles are assembled and some are wrapped with an additional Golgiderived membrane (14, 15), are transported to the periphery of the cell (16, 17), bud through the plasma membrane, and either remain attached to the cell surface (18) or are released into the medium (19). The externalized forms of vaccinia virus mediate cell-to-cell spread. Genetic Engineering of Poxviruses. The DNA molecules of many viruses are infectious, i.e., a complete round of replication occurs after transfection of the naked genome into the cell. Poxviral DNA is not infectious, however, because the viral genome is not transcribed by cellular enzymes, and therefore, viral proteins are not made. Most strategies for genetically engineering poxviruses have employed homologous DNA recombination in infected cells, a process that occurs naturally during the replication of poxviruses (20–22). Genetic engineering of poxviruses has provided a way to study their biology and to express foreign genes. Early examples of the former include marker transfer for mapping the thymidine kinase (TK; ref. 23) and DNA polymerase (24) genes and temperature-sensitive mutations (25, 26), as well as the deletion of nonessential genes such as the TK (7) and

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact. Abbreviations: CTL, cytotoxic T lymphocytes; MHC, major histocompatability complex; MVA, modified vaccinia virus Ankara; TK, thymidine kinase; IL, interleukin. *To whom reprint requests should be addressed at: National Institutes of Health, Building 4, Room 229, 4 Center Drive, MSC 0445, Bethesda, MD 20892–0445.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

GENETICALLY ENGINEERED POXVIRUSES FOR RECOMBINANT GENE EXPRESSION, VACCINATION, AND SAFETY

11342

vaccinia virus growth factor (27). Techniques have been developed that permit precise gene sequence alterations (28), inducible regulation of gene expression (29–31), and the targeting of temperature-sensitive mutations (32). These technical developments have greatly facilitated the correlation of poxvirus biochemistry and genetics.

FIG. 1. English engraving by James Gilray, 1802, suggesting the alarm that greeted the introduction of the smallpox vaccine (from the National Library of Medicine). Because poxviruses replicate in the cytoplasm and use their own transcription systems, poxvirus promoters and continuous open reading frames are required for expression of foreign genes. The time and level of gene expression is regulated by the choice of an early, intermediate, or late promoter. A commonly used DNA sequence contains tandem early and late promoters allowing a continuous moderate level of gene expression (9). The highest levels of expression have been obtained with strong natural or synthetic late or early/late promoters (refs. 33 and 34; S.Chakrabarti, J.Sisler, and B.M., unpublished results). The precise sequence of thymidines TTTTTNT serves as a transcription termination signal specifically for vaccinia virus early genes (35); if such a sequence happens to be present within a foreign gene to be regulated by an early promoter, the run of thymidines can be altered by changing the codon usage (36). General methods for the production of recombinant poxviruses employ plasmid transfer vectors that contain an expression casette, consisting of a poxvirus promoter with adjacent restriction endonuclease sites for foreign gene insertion, flanked by poxvirus sequences that direct recombination to the desired locus (9, 37). The relatively high frequency of homologous recombination (approximately 0.1%) makes it possible to screen virus plaques by DNA hybridization or for expression of the desired foreign gene product (38). Nevertheless, selection or general screening procedures are quite helpful. By targeting the foreign gene to the TK locus, recombinant viruses can be selected by their TKnegative phenotype in TK-deficient cells (9). Alternatively, the transfer vector may enable the cointegration of an antibiotic selection marker (39– 42) or a reporter gene allowing color screening due to β-galactosidase (43, 44) or β-glucuronidase (45) synthesis. The reversal of host range restriction (46) or plaque phenotype (47) has also been used. A recently devised procedure involves the complementation of a defect in extracellular virus production so that all plaques contain recombinant virus (48). Although the large size of poxvirus genomes would seem to make in vitro ligation of foreign genes technically daunting, this approach has been used successfully (49–51). The strategy involves (i) cutting the vaccinia virus genome at a unique restriction endonuclease site, (ii) religating the two halves of the genome with the recombinant gene between them, transfecting the ligated DNA into cells that have been infected with a helper virus: either a temperature-sensitive vaccinia virus mutant or an avian poxvirus. This approach does not require intermediate cloning in Escherichia coli and is useful in conjunction with polymerase chain reaction amplification of genes or screening large cDNA libraries or for very large segments of DNA. In this regard, the vaccinia virus genome can tolerate the addition of at least 25,000 bp of additional DNA (49, 52). Presumably, this quantity could be doubled by deleting DNA not required for replication in cultured cells. Since vaccinia virus is the prototype poxvirus and infects a wide range of cells and experimental animals, it was the first member of the family employed for expression studies. Other poxviruses have been developed as vectors, primarily because of advantages associated with their restricted host ranges, and will be considered in subsequent sections. Vaccinia Virus-Bacteriophage Hybrid Systems. Because of their high efficiency and stringent promoter specificity, the

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

GENETICALLY ENGINEERED POXVIRUSES FOR RECOMBINANT GENE EXPRESSION, VACCINATION, AND SAFETY

11343

single-subunit DNA-dependent RNA polymerase of bacteriophage T7 (53) and of related bacteriophages T3 (54) and SP6 (55) have been used for expression of selected genes in vaccinia virus expression vectors. Recombinant vaccinia viruses containing the gene encoding the bacteriophage polymerase, regulated by a vaccinia virus promoter, have been constructed. There are three basic versions of the system. In one, cells are infected with the recombinant vaccinia virus and then transfected with a plasmid containing the bacteriophage promoter regulating a foreign gene (53). In another version, the bacteriophage promoter regulated foreign gene is incorporated into a second recombinant vaccinia virus and expression obtained by coinfection with a recombinant vaccinia virus that encodes the T7 RNA polymerase gene (56) or by infecting cell lines that stably express the T7 RNA polymerase (57). Finally, there are inducible versions in which both the bacteriophage polymerase and expressed gene are in the same recombinant vaccinia virus allowing single infection protocols (58, 59).

FIG. 2. Infectious cycle of vaccinia virus (from ref. 8, with permission). Because of its simplicity and versatility, the transfection system has been widely used for analytical studies. In some cases, the same recombinant plasmid can be used for expression in both the vaccinia virus hybrid system and E. coli, as well as for in vitro transcription and translation. With liposome carriers, the transfection efficiency is very high and most cells express the desired gene (60). The level of expression can be enhanced by employing the untranslated leader sequence of encephalomyocarditis virus to provide cap-independent translation (61). This transient system is ideal for screening the effects of large numbers of mutations or for cDNA libraries as discussed below. The double infection and the inducible systems are appropriate if large numbers of cells are used. In a recent configuration of the inducible system (59), the recombinant vaccinia virus contains (i) the E. coli lac repressor gene under control of a vaccinia virus early/late promoter for continuous repressor synthesis; (ii) the T7 RNA polymerase gene under control of a vaccinia virus late promoter and E. coli lac operator; and (iii) the gene to be expressed under control of a T7 promoter and lac operator. Because both the T7 polymerase and the T7 promoter-controlled genes are regulated by lac operators, control is very stringent providing an induction of more than 10,000-fold. Another modification of this system employs a thermolabile repressor, so that expression occurs upon temperature elevation rather than after addition of inducer, providing an advantage especially for fermentation technology. Synthesis of Proteins in Cell Culture. Several characteristics of vaccinia virus contribute to its wide use as an expression system. These include (i) relatively simple methods of recombinant virus construction, (ii) a wide choice of cell types, (iii) cytoplasmic expression eliminating special requirements for nuclear processing and transport of RNA, and (iv) relatively high expression levels. As anticipated, proteins synthesized by vaccinia virus vectors are processed and transported in accord with their primary structure and the inherent capabilities of the host cell. Although vaccinia virus vectors have been primarily used for expression in fully permissive mammalian and avian cells, the system has also been extended to nonpermissive amphibian cells (62–64). Transient expression, by DNA transfection of infected cells, can be accomplished either using vaccinia virus promoters (65) or the hybrid vaccinia virus-T7 system described above. Generally, the expression level is considerably higher than that of conventional eukaryotic transfection systems. Applications of this transfection system are very diverse and, for example, have included analysis of protein-protein interactions (66), epitope mapping of monoclonal antibodies (67), cell fusion (68), and expression of ion channels (69, 70). Complex structures, such as infectious RNA virus particles, have been assembled by transfecting several plasmids simultaneously (71–73). The transfection system also provides a useful method for functional screening of cDNA libraries, as shown by the recent identification of the human immunodeficiency virus coreceptor fusin gene (74). To harvest protein from large quantities of cells, the gene of interest needs to be integrated into a recombinant vaccinia

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

GENETICALLY ENGINEERED POXVIRUSES FOR RECOMBINANT GENE EXPRESSION, VACCINATION, AND SAFETY

11344

virus (75). High levels of recombinant protein have been obtained using strong synthetic vaccinia virus promoters (34) or the hybrid vaccinia virus-T7 system (59). The latter is preferred if the expressed protein is toxic to either the virus or cells. The hybrid vaccinia virus-T7 system has recently been adapted to Chinese hamster ovary cells, which are normally not permissive for vaccinia virus (76). Determination of Targets of Humoral and Cell-Mediated Immunity. If recombinant vaccinia viruses that express one or more genes of another microorganism are used to immunize animals, the antiserum can be tested for neutralizing activity. This approach eliminates the need to purify the protein in a native state, which may be difficult as in the case of membrane proteins (77, 78). Genetic engineering can be used to enhance the immune response, for example, by converting a secreted protein into one that is membrane-anchored (79). Immunization with recombinant vaccinia viruses also provides a convenient way to produce monoclonal antibodies to native gene products without having to purify them (80, 81). Recombinant vaccinia viruses are extensively used to induce CD8-bearing cytotoxic T lymphocytes (CTLs) in animals or to determine the targets of CTLs in vitro. Intracellular expression allows the antigen to be processed and presented in association with matched major histocompatability complex (MHC) class I molecules for recognition. For the determination of targets, autologous or MHC-matched cells are infected with a recombinant vaccinia virus that expresses a protein of interest, preferably under control of an early or early/late promoter (82). Alternatively, the recombinant virus can also express the appropriate MHC molecule. The target cells are then loaded with chromium and chromium release is measured after incubation with effector lymphocytes from an experimental animal (83–85) or human (86, 87). B cells, immortalized with Epstein-Barr virus, have been used as autologous cells from individuals. CTL epitopes can be located by expressing truncated proteins, prior to fine mapping with small peptides (87, 88). The hybrid vaccinia virus-T7 transfection system can be used to express CTL target proteins, avoiding the task of constructing new recombinant viruses (89). Vaccinia vectors are also used to induce CD4-bearing CTLs and analyze the presentation of endogenous antigens with MHC class II molecules (90–93). Protection Against Experimental Infections. The numerous examples, in which immunization of experimental animals (from mouse to chimpanzee) with recombinant vaccinia viruses that express one or more genes of a DNA or RNA virus have provided partial or complete protection against disease caused by challenge, are referenced elsewhere (94–96). In many cases, protection was correlated with neutralizing antibody against viral envelope proteins expressed by the recombinant vector. In other cases, vaccination provided a priming effect and protection was associated with an anamnestic antibody response, as when chimpanzees were inoculated with a recombinant vaccinia virus that expresses hepatitis B surface antigen (97). In some cases, protection may be due to induction of CTLs (98–103). Smallpox vaccine was usually administered intradermally and other routes were thought to be less immunogenic (104). Good immunogenicity also follows intradermal inoculation of recombinant vaccinia virues. However, when intradermal and intranasal inoculations of recombinant vaccinia viruses that express influenza and respiratory syncytial virus envelope glycoproteins were compared, the latter route provided better local immunity and protection against an upper respiratory infection (105–107). Mucosal immunity also has been achieved by intestinal inoculation with recombinant vaccinia virus (108, 109). Coexpression of interleukin (IL) 5 and IL-6 reportedly enhances mucosal IgA production (110, 111). Tumor Immunization. The ability of poxviruses to induce strong CTL responses has led to consideration of their use as cancer vaccines. Recombinant vaccinia viruses that express viral antigens (101, 112) or cellular tumor-associated antigens (113–116) have provided prophylactic and therapeutic effects against experimental tumors. Cytokines (IL-2 and IL-12) and/or costimulatory molecules (B7–1 and B7–2) may enhance the immune effects in model systems (117, 118). Attenuated and Nonreplicating Vectors. At the site of percutaneous inoculation with vaccinia virus, a nonimmune individual typically develops a papule that becomes vesicular and pustular reaching a maximum size in 8–10 days. The pustule dries and the scab separates within 14–21 days. The local lymph nodes may feel tender and there may be some fever. In young children, eczema vaccinatum and encephalitis are serious but infrequent complications; in adults disseminated or progressive vaccinia may occur if there is a severe immunodeficiency (119, 120). Safety issues have been raised because of the possibilities of accidental laboratory infections and side effects of vaccination. In the United States, the immunization practices advisory committee (121) recommended that laboratory work with vaccinia virus be carried out under biosafety level 2 conditions; those that have direct contact with the virus are advised to receive a smallpox vaccination at 10-year intervals. In the United Kingdom, however, vaccination of laboratory workers is recommended only under special circumstances (122). Several approaches have been taken to enhance the safety of vaccinia virus. During the smallpox era, highly attenuated vaccinia virus strains were developed (3). One of these, modified vaccinia virus Ankara (MVA), was passaged more than 500 times in chicken embryo cells, lost the ability to replicate in mammalian cells, became apathogenic even for immunodeficient animals, and was administered without apparent incident to about 120,000 humans including many who were considered a poor risk for the conventional smallpox vaccine (123, 124). Further studies showed that multiple genomic deletions had occurred (125) and that virus replication was blocked at a late stage of morphogenesis in mammalian cells, importantly leaving synthesis of viral proteins unimpaired (126). Marker transfer experiments suggest that multiple gene defects need to be corrected for efficient replication of MVA in mammalian cells (M.Carroll and B.M., unpublished results). Consequently, MVA is useful as an expression vector while providing a high degree of safety. For this reason, recombinant MVAs that express T7 RNA polymerase have been constructed (127, 128). At the National Institutes of Health, work exclusively with MVA is permitted at biosafety level 1 without vaccination. Despite its inablity to replicate, recombinant MVA has proven to be highly immunogenic and effective in protecting against influenza, parainfluenza and simian immunodeficiency virus infections in mouse or monkey models (129–131). Varied degrees of attenuation can be achieved by deletion of one or more genes not required for replication in tissue culture (132–139). These include viral genes involved in nucleotide metabolism, host interactions, and extracellular virus formation. NYVAC, a derivative of the Copenhagen strain of vaccinia virus with multiple deletions and impaired replication in human cells, has provided protective immunity againtst Japanese encephalitis virus in swine (140, 141). Another attenuation approach involves the expression of genes designed to enhance the host response to vaccinia virus. Recombinant vaccinia viruses that encode IL-2 have diminished pathogenicity for immunodeficient mice (142, 143) and immunocompetent monkeys (144, 145). The mechanism involves the rapid clearance of virus by natural killer and other cells secreting interferon-γ (146, 147). Recombinant vaccinia viruses that express interferon-γ are also attenuated (148, 149). The stability of such viruses in vivo needs to be examined, since loss of the IL-2 or interferon-γ gene would restore virulence.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

GENETICALLY ENGINEERED POXVIRUSES FOR RECOMBINANT GENE EXPRESSION, VACCINATION, AND SAFETY

11345

Some members of the poxvirus family have a naturally restricted host range, which can provide increased safety. Avian poxviruses were initially considered as vectors for birds (150–152) since they do not replicate in mammals. Subsequent studies, however, indicated that expression of recombinant genes occurs in mammalian cells and that immune responses are induced in mammals (153). For unknown reasons, canarypox virus appears to be superior to fowlpox virus in this regard (154, 155). Raccoon poxvirus (156), capripox virus (157), and swinepox virus (158) vectors also have been made. Veterinary Vaccine Trials. Recombinant poxviruses are capable of protectively immunizing animals against diseases of veterinary importance. Examples include the use of vaccinia virus recombinants to protect cattle against vesicular stomatitis virus (159) and rinderpest (160, 161), chickens against influenza virus (162), and raccoons and foxes against rabies virus (163–166). The recombinant vaccinia virus expressing the rabies virus glycoprotein was administered in bait form for immunization of wild animals and protective immunization with reduced incidence of rabies has been demonstrated in large field tests in Belgium (167). Examples of the use of other poxvirus vectors for veterinary purposes include a raccoon poxvirus vector to protect raccoons against rabies virus (156); a capripoxvirus vector to protect cattle against rinderpest (168); swinepox vectors to protect pigs against Aujeszky disease (pseudorabies) (158); fowlpox vectors to protect chickens against influenza virus (169), Newcastle disease virus (152, 170–172), and infectious bursal disease virus (173); canarypox virus to protect dogs against canine distemper virus (154); and pigeonpox virus vectors to protect chickens against Newcastle disease virus (174). Human Vaccine Trials. Phase 1 clinical trials, to test the safety and immunogenicity of a recombinant vaccinia virus expressing the human immunodeficiency virus 1 (HIV-1) envelope gene, were conducted in the United States (175– 177). No serious side effects were encountered in healthy subjects that received percutaneous inoculations. Humoral and cell-mediated immune responses were higher in previously unvaccinated individuals and were enhanced after a booster injection with gp160 protein. Although an improvement could be made with regard to the level of expression achieved with the first-generation vaccinia vector, the prime-boost strategy provided both humoral and cell-mediated immunity. In China, a recombinant vaccinia virus that expresses the major Epstein-Barr virus membrane glycoprotein was immunogenic when administered to infants and young children and apparently delayed or prevented natural infection over a period of 16 months (178). Clinical tests of two recombinant canarypox viruses have been reported. The first, conducted in France, described the inoculation of a canarypox virus that expressed the rabies glycoprotein. Antibody was detected, although the titer was not as high as that obtained with a licensed rabies vaccine (179). The second, conducted in the United States, involved a recombinant that expressed the HIV-1 glycoprotein. No antibody response was detected after two subcutaneous inoculations; however, both humoral and cell-mediated immune responses were found after a gp160 protein booster injection, suggesting that priming had occurred (180). Present and Future Considerations. Poxviruses are transcription machines, encoding and packaging proteins required for synthesis of mRNA in the cytoplasm of an infected cell. For this reason, as well as the ability to integrate large amounts of DNA into the viral genome and to infect a wide variety of cells, recombinant vaccinia viruses have become valuable laboratory research tools. The popularity of the vector system exists despite the cytopathic effects of the virus and the special precautions required to work with a class 2 infectious agent. The adaptation of a highly attenuated vaccinia virus strain that has lost the ability to produce infectious progeny in mammalian cells addresses these concerns. Basic research on poxviruses and innovations, such as the vaccinia virus-bacteriophage T7 system, have greatly increased the level of recombinant gene expression; elucidation of the mechanisms that perturb host cell macromolecular synthesis and other intracellular processes may lead to further improvements in the vector system. The role of vaccinia virus in the eradication of smallpox suggests that poxviruses could have important uses as recombinant vaccines. Excellent field results, with a wild-life recombinant vaccinia virus rabies vaccine, fully support this idea. Other veterinary vaccine applications also seem promising. The relatively few human clinical studies that have been carried out suggest that the immunogenicity of the vaccine may need to be enhanced in some cases. Safety is an important consideration leading to the goal of effective “nonreplicating” vectors. Avian poxviruses and genetically altered strains of vaccinia virus, which meet this stringent criterion, need to be directly compared for efficacy. Although existing immunity to vaccinia virus may restrict the replication of vaccinia virus vectors and decrease the immune response to the recombinant protein, smallpox vaccination was largely stopped more than 15 years ago so this is becoming less of a concern with the passage of time. Should more than one poxvirus-based vaccine be developed, then their simultaneous administration as a mixture or a polyvalent virus would avoid the problem associated with immunity to the vector. 1. Jenner, E. (1798) in An Inquiry Into the Causes and Effects of the Variolae Vaccinae, A Disease Discovered in Some of the Western Countries of England, Particularly Near Gloucestershire, and Known by the Name of the Cow Pox, London, ed. Camac, C.N. B. (Dover, New York), pp. 213–240. 2. Baxby, D. (1977) J. Infect. Dis. 136, 453–455. 3. Fenner, F., Henderson, D.A., Arita, I., Jezek, Z. & Ladnyi, I.D. (1988) Smallpox and Its Eradication (W.H.O., Geneva). 4. Wittek, R. & Moss, B. (1980) Cell 21, 277–284. 5. Wittek, R., Cooper, J., Barbosa, E. & Moss, B. (1980) Cell 21, 487–493. 6. Panicali, D. & Paoletti, E. (1982) Proc. Natl. Acad. Sci. USA 79, 4927–4931. 7. Mackett, M., Smith, G.L. & Moss, B. (1982) Proc. Natl. Acad. Sci. USA 79, 7415–7419. 8. Moss, B. (1996) in Poxviridae: The Viruses and Their Replication, eds. Fields, B.N., Knipe, D.M. & Howley, P.M. (Lippincott-Raven, Philadelphia), Vol. 2, pp. 2637–2671. 9. Mackett, M., Smith, G.L. & Moss, B. (1984) J. Virol. 49, 857–864. 10. Davison, A.J. & Moss, B. (1989) J. Mol. Biol. 210, 749–769. 11. Davison, A.J. & Moss, B. (1989) J. Mol. Biol. 210, 771–784. 12. Baldick, C.J., Keck, J.G. & Moss, B. (1992) J. Virol. 66, 4710–4719. 13. Moss, B. (1993) in Vaccinia Virus Transcription, eds. Conaway, R. & Conaway, J. (Raven, New York), pp. 185–205. 14. Hiller, G. & Weber, K. (1985) J. Virol. 55, 651–659. 15. Schmelz, M., Sodeik, B., Ericsson, M., Wolffe, E.J., Shida, H., Hiller, G. & Griffiths, G. (1994) J. Virol. 68, 130–147. 16. Stokes, G.V. (1976) J. Virol. 18, 636–643. 17. Cudmore, S., Cossart, P., Griffiths, G. & Way, M. (1995) Nature (London) 378, 636–638. 18. Blasco, R. & Moss, B. (1992) J. Virol. 66, 4170–4179. 19. Payne, L.G. (1980) J. Gen. Virol. 50, 89–100. 20. Fenner, F. & Comben, B.M. (1958) Virology 5, 530–548. 21. Sam, C.K. & Dumbell, K.R. (1981) Ann. Virol. 132E, 135–150. 22. Nakano, E., Panicali, D. & Paoletti, E. (1982) Proc. Natl. Acad. Sci. USA 79, 1593–1596. 23. Weir, J.P., Bajszar, G. & Moss, B. (1982) Proc. Natl. Acad. Sci. USA 79, 1210–1214. 24. Jones, E.V. & Moss, B. (1984) J. Virol. 49, 72–77. 25. Condit, R.C., Motyczka, A. & Spizz, G. (1983) Virology 128, 429–443. 26. Ensinger, M.J. & Rovinsky, M. (1983) J. Virol. 48, 419–428. 27. Buller, R.M.L., Chakrabarti, S., Moss, B. & Frederickson, T. (1988) Virology 164, 182–192.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

GENETICALLY ENGINEERED POXVIRUSES FOR RECOMBINANT GENE EXPRESSION, VACCINATION, AND SAFETY

11346

28. Falkner, F.G. & Moss, B. (1990) J. Virol. 64, 3108–3111. 29. Fuerst, T.R., Fernandez, M.P. & Moss, B. (1989) Proc. Natl. Acad. Sci. USA 86, 2549–2553. 30. Rodriguez, J.F. & Smith, G.L. (1990) Virology 177, 239–250. 31. Zhang, Y. & Moss, B. (1991) Proc. Natl. Acad. Sci. USA 88, 1511–1515. 32. Hassett, D.E. & Condit, D.E. (1994) Proc. Natl. Acad. Sci. USA 91, 4554–4558. 33. Patel, D.D., Ray, C.A., Drucker, R.P. & Pickup, D.J. (1988) Proc. Natl. Acad. Sci. USA 85, 9431–9435. 34. Davison, A.J. & Moss, B. (1990) Nucleic Acids Res. 18, 4285– 4286. 35. Yuen, L. & Moss, B. (1987) Proc. Natl. Acad. Sci. USA 84, 6417–6421. 36. Earl, P.L., Hügin, A.W. & Moss, B. (1990) J. Virol. 64, 2448–2451. 37. Earl, P.L. & Moss, B. (1991) in Generation of Recombinant Vaccinia Viruses, eds. Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A. & Struhl, K. (Greene & Wiley, New York), Vol. 2, pp. 16.17.1–16.17.16. 38. Piccini, A., Perkus, M.E. & Paoletti, E. (1987) Methods Enzymol. 153, 545–563. 39. Franke, C.A., Rice, C.M., Strauss, J.H. & Hruby, D.E. (1985) Mol. Cell. Biol. 5, 1918–1924. 40. Falkner, F.G. & Moss, B. (1988) J. Virol. 62, 1849–1854. 41. Boyle, D.B. & Coupar, B.E.H. (1988) Gene 65, 123–128. 42. Isaacs, S.N., Kotwal, G.J. & Moss, B. (1990) Virology 178, 626–630. 43. Chakrabarti, S., Brechling, K. & Moss, B. (1985) Mol. Cell. Biol. 5, 3403–3409. 44. Panicali, D., Grzelecki, A. & Huang, C. (1986) Gene 47, 193–199. 45. Carroll, M.W. & Moss, B. (1995) BioTechniques 19, 352–355. 46. Perkus, M.E., Limbach, K. & Paoletti, E. (1989) J. Virol. 63, 3829–3836. 47. Rodriguez, J.F. & Esteban, M. (1989) J. Virol. 63, 997–1001. 48. Blasco, R. & Moss, B. (1995) Gene 158, 157–162. 49. Merchlinsky, M. & Moss, B. (1992) Virology 190, 522–526. 50. Scheiflinger, F., Dorner, F. & Falkner, F.G. (1992) Proc. Natl. Acad. Sci. USA 89, 9977–9981. 51. Pfleiderer, M., Falkner, F.G. & Dorner, F. (1995) J. Gen. Virol. 76, 2957–2962. 52. Smith, G.L. & Moss, B. (1983) Gene 25, 21–28. 53. Fuerst, T.R., Niles, E.G., Studier, F.W. & Moss, B. (1986) Proc. Natl. Acad. Sci. USA 83, 8122–8126. 54. Rodriguez, D., Zhou, Y., Rodriguez, J.-R., Durbin, R.K., Jiminez, V., McAllister, W.T. & Esteban, M. (1990) J. Virol. 64, 4851–4857. 55. Usdin, T.B., Brownstein, M.J., Moss, B. & Isaacs, S.N. (1993) BioTechniques 14, 222–224. 56. Fuerst, T.R., Earl, P.L. & Moss, B. (1987) Mol. Cell. Biol. 7, 2538–2544. 57. Elroy-Stein, O. & Moss, B. (1990) Proc. Natl. Acad. Sci USA 87, 6743–6747. 58. Alexander, W.A., Moss, B. & Fuerst, T.R. (1992) J. Virol. 66, 2934–2942. 59. Ward, G.A., Stover, C.K., Moss, B. & Fuerst, T.R. (1995) Proc. Natl. Acad. Sci. USA 92, 6773–6777. 60. Rose, J.K., Buonocore, L. & Whitt, M.A. (1991) BioTechniques 10, 520–525. 61. Elroy-Stein, O., Fuerst, T.R. & Moss, B. (1989) Proc. Natl. Acad. Sci. USA 86, 6126–6130. 62. Yang, X.-C, Karschin, A., Labarca, C., Elroy-Stein, O., Moss, B., Davidson, N. & Lester, H.A. (1991) FASEB J. 5, 2209–2216. 63. Petit, d. L., Koothan, T., Liao, D. & Malinow, R. (1995) Neuron 14, 685–688. 64. Wu, G.-Y., Zou, D.-J. & Cline, H.T. (1995) Neuron 14, 681–684. 65. Cochran, M.A., Mackett, M. & Moss, B. (1985) Proc. Natl. Acad. Sci. USA 82, 19–23. 66. Mizukami, T., Fuerst, T.R., Berger, E.A. & Moss, B. (1988) Proc. Natl. Acad. Sci. USA 85, 9273–9277. 67. Keil, W. & Wagner, R.R. (1989) Virology 170, 392–407. 68. Ashorn, P., Berger, E.A. & Moss, B. (1990) J. Virol. 64, 2149–2156. 69. Leonard, R.J., Karschin, A., Jayashree-Aiyar, S., Davidson, N., Tanouye, M.A., Thomas, L., Thomas, G. & Lester, H.A. (1989) Proc. Natl. Acad. Sci. USA 86, 7629–7633. 70. Rich, D.P., Anderson, M.P., Gregory, R.J., Cheng, S.H., Paul, S., Jefferson, D.M., McCann, J.D., Klinger, K.W., Smith, A.E. & Welsh, M.J. (1990) Nature (London) 347, 358–363. 71. Schnell, M.J., Mebatsion, T. & Conzelmann, K.-K. (1994) EMBO J. 13, 4195–4204. 72. Whelan, S.P.J., Ball, L.A., Bar, J.N. & Wertz, G.T.W. (1995) Proc. Natl. Acad. Sci. USA 92, 8388–8392. 73. Collins, P.L., Hill, M.G., Camargo, E., Grossfeld, H., Chanock, R.M. & Murphy, B.R. (1995) Virology 92, 11563–11567. 74. Feng, Y., Broder, C.C., Kennedy, P.E. & Berger, E.A. (1996) Science 272, 872–877. 75. Barrett, N., Mitterer, A., Mundt, W., Eibl, J., Eibl, M., Gallo, R.C., Moss, B. & Dorner, F. (1989) AIDS Res. Hum. Retroviruses 5, 159–171. 76. Ramsey-Ewing, A. & Moss, B. (1996) J. Biol. Chem. 206, 984–993. 77. Elango, N., Prince, G.A., Murphy, B.R., Venkatesan, S., Chanock, R.M. & Moss, B. (1986) Proc. Natl. Acad. Sci. USA 83, 1906–1911. 78. Earl, P.L., Robert-Guroff, M., Matthews, T.J., Krohn, K., London, W.T. & Moss, B. (1989) AIDS Res. Hum. Retroviruses 5, 23–32. 79. Langford, D.J., Edwards, S.J., Smith, G.L., Moss, B., Kemp, D.J., Anders, R.F. & Mitchell, G.F. (1986) Mol. Cell. Biol. 6, 3191–3199. 80. Yilma, T., Ristow, S.S., Moss, B. & Jones, L. (1987) Hybridoma 6, 329–335. 81. Malvoisin, E. & Wild, F. (1990) J. Virol. 64, 5160–5162. 82. Townsend, A., Bastin, J., Gould, K., Brownlee, G., Andrew, M., Coupar, B., Boyle, D., Chan, S. & Smith, G. (1988) J. Exp. Med. 168, 1211–1224. 83. Bennink, J.R., Yewdell, J.W., Smith, J.W., Moller, C. & Moss, B. (1984) Nature (London) 311, 578–579. 84. Yewdell, J.W., Bennink, J.R., Smith, G.L. & Moss, B. (1985) Proc. Natl. Acad. Sci. USA 82, 1785–1789. 85. Bennink, J.R. & Yewdell, J.W. (1990) Curr. Topics Microbiol. Immunol. 163, 153–184. 86. McMichael, A.J., Michie, C.A., Gotch, F.M., Smith, G.L. & Moss, B. (1986) J. Gen. Virol. 67, 719–726. 87. Walker, B.D., Flexner, C., Paradis, T.J., Fuller, T.C., Hirsch, M.S., Schooley, R.T. & Moss, B. (1988) Science 240, 64–66. 88. Earl, P., Koenig, S. & Moss, B. (1991) J. Virol. 65, 31–41. 89. Eisenlohr, L.C., Yewdell, J.W. & Bennink, J.R. (1992) J. Immunol. Methods 154, 131–138. 90. Zarling, J.M., Moran, P.A., Lasky, L.A. & Moss, B. (1986) J. Virol. 59, 506–509. 91. Morrison, L.A., Lukacher, A.E., Braciale, V.L., Fan, D. & Braciale, T.J. (1986) J. Exp. Med. 163, 903–921. 92. Polydefkis, M., Koenig, S., Flexner, C., Obah, E., Gebo, K., Chakrabarti, S., Earl, P.L., Moss, B. & Siliciano, R.F. (1990) J. Exp. Med. 171, 875–887. 93. Jaraquamada, D., Marti, M. & Long, E.O. (1990) J. Exp. Med. 172, 947–954. 94. Moss, B. (1991) Science 252, 1662–1667. 95. Cox, W.I., Tartaglia, J. & Paoletti, E. (1992) in Poxvirus Recombinants as Live Vaccines, eds. Binns, M.M. & Smith, G.L. (CRC, Boca Raton, FL), pp. 123–162. 96. Flexner, C. & Moss, B. (1996) in Vaccinia Virus as a Live Vector for Expression of Immunogens, eds. Woodrow, G.C. & Levine, M.M. (Dekker, New York), in press.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

GENETICALLY ENGINEERED POXVIRUSES FOR RECOMBINANT GENE EXPRESSION, VACCINATION, AND SAFETY

11347

97. Moss, B., Smith, G.L., Gerin, J.L. & Purcell, R.H. (1984) Nature (London) 311, 67–69. 98. Jonjic, S., del Val, M., Keil, G.M., Reddehase, M.J. & Kozinowski, U.H. (1988) J. Virol. 62, 1653–1658. 99. Hany, M., Oehen, S., Schulz, M., Hengartner, H., Mackett, M., Bishop, D.H.L., Overton, H. & Zinkernagel, R.M. (1989) Eur. J. Immunol. 19, 417– 424. 100. Miyazawa, M., Nishio, J. & Chesebro, B. (1992) J. Virol. 66, 4497–4507. 101. Earl, P.L., Moss, B., Wehrly, K., Nishio, J. & Chesebro, B. (1986) Science 234, 728–731. 102. Kulkarni, A.B., Connors, M., Firestone, C.Y., Morse, H.C. & Murphy, B.R. (1993) J. Virol. 67, 1044–1049. 103. Kulkarni, A.B., Morse, H.C., III, Bennink, J.R., Yewdell, J.W. & Murphy, B.R. (1993) J Virol. 67, 4086–4092. 104. Galasso, G.J., Karzon, D.T., Katz, S.L., Krugman, S., Neff, J. & Robbins, F.C. (1977) J. Infect. Dis. 135, 131–186. 105. Small, P.A., Smith, G.L. & Moss, B. (1985) Vaccines 85, 175–176. 106. Renegar, K.B. & Small, P.A. (1991) J. Virol. 65, 2146–2148. 107. Meitin, C.A., Bender, B.S. & Small, P.A. (1991) Vaccine 9, 751–756. 108. Kanesaki, T., Murphy, B.R., Collins, P.L. & Ogra, P.L. (1991) J. Virol. 65, 657–663. 109. Meitin, C., Bender, B. & Small, P., Jr (1994) Proc. Natl. Acad. Sci. USA 91, 11187–11191. 110. Ramsay, A.J., Husband, A.J., Ramshaw, I.A., Bao, S., Matthaei, K.I., Koehler, G. & Kopf, M. (1994) Science 264, 561–563. 111. Ramsay, A.J. & Kohonen-Corish, M. (1993) Eur. J. Immunol. 23, 3141–3145. 112. Lathe, R., Kieny, M.P., Gerlinger, P., Clertant, P., Guizani, I., Cuzin, F. & Chambon, P. (1987) Nature (London) 326, 878–880. 113. Bernards, R., Destree, A., McKenzie, S., Gordon, E., Weinberg, R.A. & Panicali, D. (1987) Proc. Natl. Acad. Sci. USA 84, 6854–6858. 114. Estin, C.D., Stevenson, U.S., Plowman, G.D., Hu, S.L., Sridhar, P. & Hellstrom, I. (1988) Proc. Natl. Acad. Sci. USA 85, 1052–1056. 115. Kantor, J., Irvine, K., Abrams, S., Kaufman, H., Dipietro, J. & Schlom, J. (1992) J. Natl. Cancer Inst. 84, 1084–1091. 116. Roth, J., Dittmer, D., Rea, D., Tartaglia, J., Paoletti, E. & Levine, A.J. (1996) Proc. Natl. Acad. Sci. USA 93, 4781–4786. 117. Rao, J.B., Chamberlain, R.S., Bronte, V., Carroll, M.W., Irvine, K.R., Moss, B., Rosenberg, S.A. & Restifo, N.P. (1996) J. Immunol. 156, 3357– 3365. 118. Chamberlain, R.S., Carroll, M.W., Bronte, V., Hwu, P., Warren, S., Yang, J.C., Nishimura, M., Moss, B., Rosenberg, S.A. & Restifo, N.P. (1996) Cancer Res. 56, 2832–2836. 119. Lane, J.M., Ruben, F.L., Neff, J.M. & Millar, J.D. (1969) N. Engl. J. Med. 281, 1201–1208. 120. Redfield, R.R., Wright, D.C., James, W.D., Jones, T.S., Brown, C. & Burke, D.S. (1987) N. Engl. J. Med. 316, 673–676. 121. Katz, S.L. & Broome, C.V. (1991) Morb. Mortal. Wkly. Rep. 40, 1–10. 122. Advisory Committee on Dangerous Pathogens and Advisory Committee on Genetic Modifications (1990) Vaccination of Laboratory Workers Handling Vaccinia and Related Poxviruses Infectious for Humans (HMSO Publications Center, London). 123. Mayr, A., Hochstein-Mintzel, V. & Stickl, H. (1975) Infection 3, 6–14. 124. Hochstein-Mintzel, V., Hänichen, T., Huber, H.C. & Stickl, H. (1975) Zbl. Bakt. Hyg. 230, 283–297. 125. Meyer, H., Sutter, G. & Mayr, A. (1991) J. Gen. Virol. 72, 1031–1038. 126. Sutter, G. & Moss, B. (1992) Proc. Natl. Acad. Sci. USA 89, 10847–10851. 127. Wyatt, L.S., Moss, B. & Rozenblatt, S. (1995) Virology 210, 202–205. 128. Sutter, G., Ohlmann, M. & Erfle, V. (1995) FEBS Lett. 371, 9–12. 129. Sutter, G., Wyatt, L.S., Foley, P.L., Bennink, J.R. & Moss, B. (1994) Vaccine 12, 1032–1040. 130. Wyatt, L.S., Shors, S.T., Murphy, B.R. & Moss, B. (1996) Vaccine, in press. 131. Hirsch, V.M., Fuerst, T.R., Sutter, G., Carroll, M.W., Yang, L.C., Goldstein, S., Piatak, M., Jr., Elkins, W.R., Alvord, W.G., Montefiori, D.C., Moss, B. & Lifson, J.D. (1996) J. Virol. 70, 3741–3752. 132. Buller, R.M.L., Smith, G.L., Cremer, K., Notkins, A.L. & Moss, B. (1985) Nature (London) 317, 813–815. 133. Buller, R.M., Chakrabarti, S., Cooper, J.A., Twardzik, D.R. & Moss, B. (1988) J. Virol. 62, 866–877. 134. Edwards, K.M., Andrews, T.C., Van Savage, J., Palmer, P.S. & Moyer, R.W. (1988) Microb. Pathog. 4, 325–333. 135. Kotwal, G.J., Hügin, A.W. & Moss, B. (1989) Virology 171, 579–587. 136. Child, S.J., Palumbo, G., Buller, R.M. & Hruby, D. (1990) Virology 174, 625–629. 137. Lee, S.L., Roos, J.M., McGuigan, L.C., Smith, K.A., Cormier, N., Cohen, L.K., Roberts, B.E. & Payne, L.G. (1992) J. Virol. 66, 2617–2630. 138. Isaacs, S.N., Kotwal, G.J. & Moss, B. (1992) Proc. Natl. Acad. Sci. USA 89, 628–632. 139. Moore, J.B. & Smith, G.L. (1992) EMBO J. 11, 1973–1980. 140. Tartaglia, J., Perkus, M.E., Taylor, J., Norton, E.K., Audonnet, J.C., Cox, W.I., Davis, S.W., Vanderhoeven, J., Meignier, B., Riviere, M., Languet, B. & Paoletti, E. (1992) Virology 188, 217–232. 141. Konishi, E., Pincus, S., Paoletti, E., Laegreid, W.W., Shope, R.E. & Mason, P.W. (1992) Virology 190, 454–458. 142. Flexner, C., Hügin, A. & Moss, B. (1987) Nature (London) 330, 259–262. 143. Ramshaw, A., Andrew, M.E., Phillips, S.M., Boyle, D.B. & Coupar, B.E.H. (1987) Nature (London) 329, 545–546. 144. Flexner, C., Moss, B., London, W.T. & Murphy, B.R. (1990) Vaccine 8, 17–22. 145. Ruby, J., Brinkman, C., Jones, S. & Ramshaw, I. (1990) Immunol. Cell Biol. 68, 113–117. 146. Karupiah, G., Blanden, R.V. & Ramshaw, I.A. (1990) J. Exp. Med. 172, 1495–1503. 147. Karupiah, G., Coupar, B.E.H., Andrew, M.E., Boyle, D.B., Phillips, S.M., Müllbacher, A., Blanden, R.V. & Ramshaw, I.A. (1990) J. Immunol. 144, 290–298. 148. Yilma, T., Anderson, K., Brechling, K. & Moss, B. (1987) Vaccines 87, 393–396. 149. Kohonen-Corish, M.R.J., Long, N.J.C., Woodhams, C.E. & Ramshaw, I.A. (1990) Eur. J. Immunol. 20, 157–161. 150. Taylor, J., Weinberg, R., Kawaoka, Y., Webster, R.G. & Paoletti, E. (1988) Vaccine 6, 504–508. 151. Boyle, D.B. & Coupar, B.E.H. (1988) Virus Res. 10, 343–356. 152. Taylor, J., Edbauer, C., Rey-Senelonge, A., Bouquet, J.-F., Norton, E., Goebel, S., Desmettre, P. & Paoletti, E. (1990) J. Virol. 64, 1441–1450. 153. Taylor, J., Weinberg, R., Languet, B., Desmettre, P. & Paoletti, E. (1988) Vaccine 6, 497–503. 154. Taylor, J., Trimarchi, C., Weinberg, R., Languet, B., Guillemin, F., Desmettre, P. & Paoletti, E. (1991) Vaccine 9, 190–193. 155. Taylor, J., Weinberg, R., Tartaglia, J., Richardson, C., Alkhatib, G., Breidis, D., Appel, M., Norton, E. & Paoletti, E. (1992) Virology 187, 321–328. 156. Esposito, J.J., Knight, J.C., Shaddock, J.H., Novembre, F.J. & Bauer, G.M. (1988) Virology 167, 313–316. 157. Romero, C.H., Barrett, T., Evans, S.A., Kitching, R.P., Gershon, P.D., Bostock, C. & Black, D.N. (1993) Vaccine 11, 737–742. 158. van der Leek, M.L., Feller, J.A., Sorenson, G., Isaacson, W., Adams, C.L., Borde, D.J., Pfeiffer, N., Tran, T., Moyer, R.W. & Gibbs, E.P.J. (1994) Vet. Rec. 134, 13–18. 159. Mackett, M., Yilma, T., Rose, J.K. & Moss, B. (1985) Science 227, 433–435. 160. Yilma, T., Hsu, D., Jones, L., Owens, S., Grubman, M., Mebus, C., Yamanaka, M. & Dale, B. (1988) Science 242, 1058–1061. 161. Giavedoni, L., Jones, L., Mebus, C. & Yilma, T. (1991) Proc. Natl. Acad. Sci. USA 88, 8011–8015. 162. Chambers, T.M., Kawaoka, Y. & Webster, R.G. (1988) Virology 167, 414–421.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

GENETICALLY ENGINEERED POXVIRUSES FOR RECOMBINANT GENE EXPRESSION, VACCINATION, AND SAFETY

11348

163. Wiktor, T.J., Macfarlan, R.I., Reagan, K.J., Dietzschold, B., Curtis, P., Wunner, W.H., Kieny, M.P., Lathe, R., Lecocq, J.P., Mackett, M., Moss, B. & Koprowski, H. (1984) Proc. Natl. Acad. Sci. USA 81, 7194–7198. 164. Blancou, J., Kieny, M.P., Lathe, R., Lecocq, J.P., Pastoret, P.P., Soulebot, J.P. & Desmettre, P. (1986) Nature (London) 322, 373–375. 165. Rupprecht, C.E., Wiktor, T.J.A., Johnston, D.H., Hamir, A.N., Dietzschold, B., Wunner, W.H., Glickman, L.T. & Koprowski, H. (1986) Proc. Natl. Acad. Sci. USA 83, 7947–7950. 166. Brochier, B., Kieny, M.P., Costy, F., Coppens, P., Baudilin, B., Lecocq, J.P., Languet, B., Chappuis, G., Desmettres, P., Afiademanyo, K., Libois, R. & Pastoret, P.-P. (1991) Nature (London) 354, 520–522. 167. Brochier, B., Costy, F. & Pastoret, P.P. (1995) Vet. Microbiol. 46, 269–279. 168. Romero, C.H., Barrett, T., Chamberlain, R.W., Kitching, R.P., Fleming, M. & Black, D.N. (1994) Virology 204, 425–429. 169. Webster, R.G., Kawaoka, Y., Taylor, J., Weinberg, R. & Paoletti, E. (1991) Vaccine 9, 303–308. 170. Boursnell, M.E., Green, P.F., Samson, A.C., Campbell, J.I., Deuter, A., Peters, R.W., Millar, N.S., Emmerson, P.T. & Binns, M.M. (1990) Virology 178, 297–300. 171. Boursnell, M.E., Green, P.F., Campbell, J.I., Deuter, A., Peters, R.W., Tomley, F.M., Samson, A.C., Chambers, P., Emmerson, P.T. & Binns, M.M. (1990) J. Gen. Virol. 71, 621–678. 172. Edbauer, C., Weinberg, R., Taylor, J., Rey-Senelonge, A., Bouquet, J.-F., Desmettre, P. & Paoletti, E. (1990) Virology 179, 901–904. 173. Bayliss, C.D., Peters, R.W., Cook, J.K., Reece, R.L., Howes, K., Binns, M.M. & Boursnell, M.E. (1991) Arch. Virol. 120, 193–205. 174. Letellier, C., Burny, A. & Meulemans, G. (1991) Arch. Virol. 118, 43–56. 175. Cooney, E.L., Collier, A.C., Greenberg, P.D., Coombs, R.W., Zarling, J., Arditti, D.E., Hoffman, M.C., Hu, S.L. & Corey, L. (1991) Lancet 337, 567–572. 176. Graham, B.S., Belshe, R.B., Clements, M.L., Dolin, R., Corey, L., Wright, P.F., Gorse, G.J., Midthun, K., Keefer, M.C., Roberts, N.J., Schwartz, D.H., Agosti, J.M., Fernie, B.F., Stablein, D.M., Montefiori, D.C., Lambert, J.S., Hu, S.L., Esterlitz, J.R., Lawrence, D.N. & Koff, W.C. (1992) J. Infect. Dis. 166, 244–252. 177. Cooney, E.L., McElrath, M.J., Corey, L., Hu, S.L., Collier, A.C., Arditti, D., Hoffman, M., Coombs, R.W., Smith, G.E. & Greenberg, P.D. (1993) Proc. Natl. Acad. Sci. USA 90, 1882– 1886. 178. Gu, S.Y., Huang, T.M., Ruan, L., Miao, Y.H., Lu, H., Chu, C.M., Motz, M. & Wolf, H. (1995) Dev. Biol. Stand. 84, 171–177. 179. Cadoz, M., Strady, A., Meignier, B., Taylor, J., Tartaglia, J., Paoletti, E. & Plotkin, S. (1992) Lancet 339, 1429–1432. 180. Pialoux, G., Excler, J.L., Riviere, Y., Gonzalez-Canali, G., Feuillie, V., Coulaud, P., Gluckman, J.C., Matthews, T.J., Meignier, B., Kieny, M.P. & et al. (1995) AIDS Res. Hum. Retroviruses 11, 373–381.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

APPLICATIONS OF POX VIRUS VECTORS TO VACCINATION: AN UPDATE

11349

This paper was presented at a colloquium entitled “Genetic Engineering of Viruses and Virus Vectors,” organized by Bernard Roizman and Peter Palese (Co-chairs), held June 9–11, 1996, at the National Academy of Sciences in Irvine, CA.

Applications of pox virus vectors to vaccination: An update

(vaccinia/fowlpox/canarypox/NYVAC vaccinia) ENZO PAOLETTI Delmar, NY 12054 ABSTRACT Recombinant pox viruses have been generated for vaccination against heterologous pathogens. Amongst these, the following are notable examples. (i) The engineering of the Copenhagen strain of vaccinia virus to express the rabies virus glycoprotein. When applied in baits, this recombinant has been shown to vaccinate the red fox in Europe and raccoons in the United States, stemming the spread of rabies virus infection in the wild. (ii) A fowlpox-based recombinant expressing the Newcastle disease virus fusion and hemagglutinin glycoproteins has been shown to protect commercial broiler chickens for their lifetime when the vaccine was administered at 1 day of age, even in the presence of maternal immunity against either the Newcastle disease virus or the pox vector. (iii) Recombinants of canarypox virus, which is restricted for replication to avian species, have provided protection against rabies virus challenge in cats and dogs, against canine distemper virus, feline leukemia virus, and equine influenza virus disease. In humans, canarypox virus-based recombinants expressing antigens from rabies virus, Japanese encephalitis virus, and HIV have been shown to be safe and immunogenic. (iv) A highly attenuated vaccinia derivative, NYVAC, has been engineered to express antigens from both animal and human pathogens. Safety and immunogenicity of NYVAC-based recombinants expressing the rabies virus glycoprotein, a polyprotein from Japanese encephalitis virus, and seven antigens from Plasmodium falciparum have been demonstrated to be safe and immunogenic in early human vaccine studies. The notion that the work of Edward Jenner could be carried on after the successful global eradication of smallpox as a human infectious disease was provided by early descriptions of the engineering of vaccinia virus to express foreign genes (1, 2). Thus, by splicing genes from heterologous pathogens into the vaccinia virus vector one could immunize against that cognate pathogen. The 14 years since those publications were an exciting period where numerous strains of vaccinia were engineered to express a variety of antigens from a myriad of bacterial, viral, and parasitic pathogens with subsequent evaluation of the recombinants in both animal models as well as target species. Initial safety concerns of vaccinia virus vectors have been addressed by the use of highly attenuated replication-deficient strains of the virus as well as the engineering of host range-restricted pox viruses such as canarypox virus that, while restricted for productive replication to avian species, have been shown to effectively vaccinate nonavian targets. The initial studies on vaccinia virus were extended to other members of the pox virus family so as to provide species specific vectors. An example of this is the engineering of fowlpox-based vectors for use as recombinant vaccines in the poultry industry. Much information has been gained through this period and today some commercial success has been evidenced by the licensing of several products in the veterinary field. Today, in addition to continued work in this area for vaccines, pox virus-based vectors remain as eminent tools for studying the parameters of immune induction and new fields of endeavor are being investigated such as in cancer immunotherapy. This paper will provide an update, albeit incomplete, of ongoing research with pox virus-based vectors.

Vaccinia-Rabies Glycoprotein G Recombinant A vaccinia recombinant expressing the rabies virus glycoprotein was an early example of a successful pox virus vector useful in immunization (3). The vector was constructed by the insertion of the encoding cDNA for the rabies virus glycoprotein in the thymidine kinase locus of the Copenhagen strain of vaccinia virus. Disruption of the thymidine kinase locus allowed a biochemical selection of the recombinant as well as an attenuated phenotype to the vector. This recombinant has received a conditional commercial license in both Europe and in the United States. The recombinant is administered as a live vaccine in baits for oral uptake by foxes in Europe and by raccoons in the United States. Extensive seeding of large geographic regions has provided field safety and efficacy. More recently, vaccine baits for controlling an epizootic of rabies in coyotes and grey fox in Texas has involved the seeding by air of more than 40,000 square miles with this recombinant vaccine.

Fowlpox Virus-Based Recombinants The engineering of fowlpox virus-based vectors has direct application for recombinant vaccines in the poultry industry. Fowlpox virus is a pathogen in poultry. Attenuated fowlpox virus vaccines have been used for decades in the poultry industry to prevent wild-type virus infection. These attenuated fowlpox vaccine strains provide starting material for further construction of recombinant vaccines. The vector approach in poultry is confronted by issues similar to the general vaccine discipline and specifically to the vector approach. One such issue is how will preexisting maternal immunity influence the outcome of vaccination with a recombinant vector approach. In the poultry industry, this problem is generally twofold since the mother is immune to both the pathogen whose genes are to be expressed in the vector and to the fowlpox vector itself. The results of such a situation are detailed in ref. 5, where a fowlpox virus recombinant expressing the hemagglutinin neuraminidase and the fusion glycoproteins of Newcastle disease virus (NDV) are studied. A single inoculation in specific

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact. Abbreviations: NDV, Newcastle disease virus; JEV, Japanese encephalitis virus; PRV, Pseudorabies virus; FeLV, feline leukemia virus; CTL, cytotoxic T lymphocyte.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

APPLICATIONS OF POX VIRUS VECTORS TO VACCINATION: AN UPDATE

11350

pathogen-free birds at 1 day of age provided hemagglutinin-inhibiting antibodies that were maintained for the 8-week test period, which is the lifespan of a commercial broiler. Protective immunity was demonstrated against a combined intramuscular velogenic NDV challenge and a respiratory NDV challenge. Significantly, vaccination of commercial broiler chickens that retained a level of maternal immunity against both NDV and the vector resisted a subsequent challenge against both a lethal intramuscular NDV challenge, as well as a virulent fowlpox virus challenge. However, the NDV-specific immune response was at a reduced level. A fowlpox virus recombinant expressing NDV glycoproteins has received commercial licensure in the United States.

Avipox Virus Vectors in Nonavian Species Members of the Avipox genus such as fowlpox and canarypox are distinguished by their host restriction for replication to avian species. It was discovered that inoculation of avipox-based recombinants into mammalian cells resulted in expression of the foreign gene and that inoculation into mammals resulted in the induction of protective immunity (6, 7). This surprising finding provided a significant safety profile to these vectors. Immunization could be affected in the absence of productive replication while eliminating the potential for dissemination of the vector within the vaccinate and, therefore, the spread of the vector to nonvaccinated contacts or to the general environment. For reasons still not understood, it was demonstrated that a recombinant canarypox vector was a 100 times more efficient than a comparable fowlpox vector in inducing protective immunity and similar to a thymidine kinase-disrupted replication competent vaccinia virus vector (8). Numerous examples have now been provided demonstrating the safety, immunogenicity, and protective efficacy of canary-pox-based recombinants in both experimental animal models and target species. A prime example has used canarypox-based recombinants expressing the rabies virus glycoprotein G. Rabies virus infection and immunization are issues for both veterinary and human medicine. A great deal of information is available in rabies virus immunization, experimental animals and target species are readily available for study, and the parameters of successful immunization are understood. The safety and immunogenicity of a canarypox-based rabies glycoprotein recombinant was demonstrated in a number of nonavian species (9). Protection of vaccinated experimental animals or target species cats and dogs was demonstrated. To appreciate the duration of immunity that could be engendered by vaccination with a canarypox-based recombinant, naive beagles were vaccinated by a single subcutaneous dose of the vaccine followed by rabies challenge with rabies virus. All vaccinated dogs seroconverted with maximal titers at 1 month. At various times after vaccination, a subset of dogs was challenged. At 6 and 12 months postvaccination, all dogs vaccinated with a single dose of the vaccine resisted challenge that was lethal to all the control animals. At 24 months after vaccination, 11 of 12 vaccinated dogs survived challenge with similar protection observed at 36 months postvaccination (10). These studies demonstrated that a single vaccination was immunogenic and that a protective immune response was primed such that recall as long as 3 years later was protective against a rabies virus challenge in the target species. Successful vaccination in the presence of rabies-specific maternal antibodies was demonstrated in the following experiment using beagles. A worst scenario situation was established wherein pregnant bitches with immunity to rabies were revaccinated 2 weeks before whelping to maximize the antirabies antibody titers transferred from the bitch to the offspring. At 2 weeks after birth, the pups were vaccinated with a single dose of a canarypox-based rabies vaccine recombinant. Serological responses were followed to monitor either the decay of maternal antibodies in the nonvaccinated control pups or the effect on antibody titers on the pups vaccinated in the presence of maternal antibodies. At 3 months, immunity was challenged by inoculation of live rabies virus in the temporal muscle. The maternal antibody titer in the unvaccinated pups decayed with the expected kinetics. Pups vaccinated with the recombinant virus showed a slight increase in rabies virus neutralizing titer at 2 weeks postvaccination that fell to undetectable levels at the time of challenge. In a vaccine dose-dependent fashion, pups immunized in the presence of maternal immunity survived the rabies virus challenge that was lethal to all the nonvaccinated pups (10). This study demonstrated that young animals could be successfully vaccinated in the presence of maternal immunity. The concept of using a nonreplicating avipox virus vector, a canarypox-based rabies recombinant, has been evaluated for safety and immunogenicity in human clinical studies (11, 12). Rabies naive healthy adult volunteers were inoculated with increasing doses of the recombinant in a schedule including a boost at 1 and 6 months. For comparison, the standard inactivated human diploid cell rabies vaccine was used. All inoculations with the recombinant canarypox vaccine were well-tolerated with only mild and short-lived reactions at the inoculation site reported. In these two clinical trials, induction of antirabies immune responses were demonstrated, and it was demonstrated that canarypox recombinants could be used either by themselves or in a protocol wherein the priming vaccination with the vector could be followed by a booster with the inactivated rabies vaccine. Although the immune responses to the experimental canarypox recombinant were comparable but not demonstrated to be superior to those obtained with the standard inactivated rabies vaccine, it perhaps is not surprising given the relative low doses of the recombinant vaccine used in these studies and the comparison with an optimized and highly immunogenic licensed vaccine. Other examples demonstrating the utility of canarypox virus-based vectors for veterinary species have been provided. Canarypox virus recombinants expressing the measles virus fusion and hemagglutinin glycoproteins have been used to vaccinate dogs. Comparison of these recombinants with vaccinia virus vectors expressing the same genes were shown to provide similar levels of immune response and protection against a challenge with the related Morbilli virus, canine distemper (13). Construction of specific canine distemper virus recombinants expressing the fusion and hemagglutinin have been evaluated in the highly susceptible ferret model and dog host and were demonstrated to provide protection against challenge (unpublished data). Canarypox-based recombinants expressing the hemagglutinin from equine influenza virus were shown to be immunogenic when inoculated in horses and provided protection against a naturally occurring equine influenza virus infection (14). Two canarypox virus-based recombinants were constructed, each expressing the entire gag gene and either the intact subgroup A envelope of feline leukemia virus (FeLV) or a modified version of the envelope from which the putative immunosuppressive region was deleted (15). These recombinants were evaluated for protective efficacy in kittens of 8–9 weeks of age. Two inoculations of the recombinants at 5 and 2 weeks before challenge failed to induce measurable FeLV neutralizing antibodies. Nevertheless, 50% of the cats receiving the mutated envelope recombinant and 100% of the cats receiving the intact envelope recombinant were protected against an oronasal challenge with the FeLV-A/Glasgow-1 isolate. Protection was assessed by evaluating p27 antigenimea, detecting FeLV antigen in blood smears, and the attempted recovery of infectious FeLV. This was the first description of

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

APPLICATIONS OF POX VIRUS VECTORS TO VACCINATION: AN UPDATE

11351

a successful immunization against a retrovirus provided by pox virus-based recombinants. The above observations provided an impetus to further investigate the potential of canarypox-based vectors for immunization against other retrovirus with particular attention on the lentiviruses with focus on HIV, the causative infectious agent of AIDS. The entire envelope protein of the human T-cell leukemia/lymphoma virus type I was expressed in a canarypox virus vector. Two inoculations of the recombinant vaccine candidate were administered to rabbits. Five months after the last inoculation, the animals were exposed to a human T-cell leukemia type-I cell associated challenge from a primary culture of the bou isolate. The animals were protected. The protected animals were again challenged 5 months after the initial challenge exposure with 5 ml of blood from an infected rabbit. Immunity failed this relatively large challenge exposure. Of interest in these studies (16) was the observation that if a subunit envelope booster was administered in alum after the priming vaccination with the canarypox recombinant protection was not obtained. Interpretation of this observation can lead to interesting speculation. Other interesting observations using canarypox-based recombinants expressing antigens from either HIV-I or II, as well as simian immunodeficiency virus, have been reported. In laboratory rodents, induction of both humoral immunity as well as cytotoxic T lymphocyte (CTL) can readily be demonstrated (17). Recombinants expressing HIV-II gag, pol, or envelope genes have been evaluated in macaques in several studies with some level of protection described (18, 19). Significant and raising concerns for those involved in vaccine development correlates of protective immunity are not revealed in these studies. Multiple immunization allowing for the maturation of the immune response is suggested by some studies (20). An intriguing observation was the cross protection against HIV-II challenge in monkeys vaccinated with HIV-1 recombinant pox viruses (21). A likely interpretation of this data is the induction of and protection by cross-reactive CTL. However, the basis of this cross protection is currently unknown. A series of recombinant canarypox virus-based recombinants expressing an increasing complexity of HIV-I strain MN antigens have been constructed and evaluated in human clinical trials for both safety and immunogenicity. The earliest of these studies in HIV seronegative healthy adult volunteers have been reported (22). A vaccine regimen providing the best results to date involve one or two doses of the recombinant canarypox virus vector followed by one or two doses of an adjuvanted recombinant envelope subunit. The induction of binding, HIV neutralizing, and both CD4 and CD8 CTL have been reported (22–24). More recent data using the more complex recombinants and higher doses of vaccine in a vector prime/subunit antigen boost protocol have demonstrated better levels of neutralizing antibody induction and a more complex reactivity of CTL to multiple HIV antigens. Further comparison of separate phase I trial data a prime/boost protocol using the canarypox vector fares favorably when compared with a prime boost protocol using a replication competent vaccine vector as a primer (unpublished data). In this light, the failure of the canarypox vector to replicate in the mammalian host provides advantage over the replication competent vaccinia virus vector. The general safety profile of the HIVI canarypox recombinants in human volunteers is similar to that observed with the canarypox recombinants expressing the rabies virus glycoprotein discussed above.

Attenuated Vaccinia-Based Vector: NYVAC The global smallpox eradication program was made possible by several biological features of the pathogen and the vaccine. The pathogen had only a single host for infection and propagation—man. There were no animal reservoirs from which the pathogen could recrudesce. Defined outbreaks of the infection could be circumscribed and contained by vaccination. Vaccinia, the vaccine, could be produced efficiently and at low cost in regional centers. The ability to retain potency of the vaccine as a freeze-dried preparation allowed storage and transport to remote regions of the globe. The successful smallpox eradication program, however, was not without vaccine-associated risk. Vaccine reactogenicity with some severe or lethal outcomes was associated with the vaccine in general and specifically higher rates of adverse events were evidenced in certain populations or with certain vaccine strains or preparations. Early attempts to manufacture the vaccine under more defined and regulated laboratory conditions were abandoned with the success of the eradication effort. The known reactogenicity of the vaccinia vaccine was therefore a concern to be addressed when the virus was proposed as a vector for new engineered vaccines. This concern has been addressed in several ways such as the provision of naturally host-restricted vectors described above or by the targeted attenuation of existing vaccine strains. This approach is demonstrated by the engineering of the NYVAC strain of vaccinia virus. The Copenhagen strain of vaccinia was chosen as a vaccine substrate. The entire DNA sequence of the genome was established (25). With this information and the extant knowledge of virulence-related and other genetic functions related to host range replication competency unwanted genetic information was precisely deleted from the vaccinia virus genome. The resultant vector, NYVAC, was highly attenuated as demonstrated in a series of studies in animal surrogates (26). Intracranial inoculation of newborn or young adult mice demonstrated a very favorable dose range compared with either the parent or other vaccine strains, and significantly no disseminated viral infection was observed in immunocompromised hosts. In numerous tissue culture cells of human origin, the vector was shown to be highly debilitated for replication consistent with the deletion of host range genes. The modified NYVAC vector, while highly attenuated, retained the ability to induce protective immune responses to foreign antigens in a fashion similar to the thymidine kinase mutant of the parent strain. A number of examples using the NYVAC vector as a recombinant vaccine delivery system have been provided in animal model systems and in target species including humans. A series of NYVAC recombinants were generated to express glycoproteins from Pseudorabies virus (PRV) and the immunity afforded by these recombinants was evaluated in the target species of PRV infection, the pig. PRV neutralizing antibodies were induced following two intramuscular inoculations 28 days apart. The NYVAC recombinant expressing the PRV glycoprotein gp50 induced levels of PRV neutralizing antibodies and afforded protection against a virulent oronasal PRV challenge that was comparable to vaccination with inactivated PRV vaccine (27). The advantage of a recombinant vaccine is that one is allowed to discriminate between a naturally infected versus vaccinated animal since the recombinant vaccine displays a defined subset of the antigens of the pathogens. This discrimination allows the agricultural industry to properly track infections and cull infected herds. A NYVAC-based recombinant expressing two hemagglutinin glycoproteins of the A1 and A2 equine influenza serotypes induced hemagglutinin inhibiting antibodies when inoculated into horses and afforded significant protection when the vaccinated horses became exposed to a natural equine influenza virus infection (14). The polyprotein of Japanese encephalitis virus (JEV) encoding prM/M, E, and NS1 was expressed in NYVAC recombinants and the vector used to vaccinate swine, a major natural host of JEV infection and a reservoir for mosquito transmis-

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

APPLICATIONS OF POX VIRUS VECTORS TO VACCINATION: AN UPDATE

11352

sion of the virus to man. Hemagglutinin-inhibiting and JEV-neutralizing antibodies were induced on vaccination. The nonvaccinated challenged animals succumbed to JEV infection, whereas the vaccinated group had levels of JEV challenge viremia insufficient to be transmitted by mosquitoes (28) Both a NYVAC- and a canarypox-based Japanese encephalitis recombinant are currently being evaluated in human clinical trials. A NYVAC vector has been engineered to express the rabies glycoprotein gene. In mice, cats, and dogs, the recombinant was shown to be safe and to provide protection against a lethal rabies virus challenge. The recombinant is now being evaluated in phase I human clinical trials for safety and immunogenicity. Pox virus vectors have been used to determine the immunogenic potential of antigens from Plasmodium spp. in an effort to understand the design of an effective vaccine against malarial infections. In this regard a NYVAC vector reconstituted with the K1L host range gene was constructed to express intact or mutated forms of the circumsporozoite protein of Plasmodium berghei. Vaccination of the target host, the mouse, induced both binding antibody and CTL. Vaccinated and control mice were challenged either by the intravenous injection of sporozoites or by allowing infected mosquitoes to feed on the subjects. Protection was scored as the absence of blood stage parasetemia as determined by microscopic analysis of blood films from individual mice from 5–15 days after challenge. In a number of challenge experiments, 80% protection was obtained. This is to be compared with the consistent 100% level of protection obtained by vaccination with irradiated sporozoites. Protection in the recombinant virus-immunized mice apparently did not correlate with antibodies but a good correlation was established between CTL and protection. In vivo antibody depletion of CD8+ T cells before challenge abrogated protection (29). With this data as an inducement, a complex NYVAC-based recombinant was constructed to express multiple antigens from P. falciparum. To address the multiple stages of the parasite life cycle, multiple antigens from the various stages were used. Thus, a recombinant expressing seven parasite antigens was provided. This recombinant was evaluated in rodents and in monkeys where safety and immunogenicity were established (30). This recombinant is now being evaluated in clinical trials where the vaccinated subjects are exposed to the bites of infected mosquitoes. Appearance of parasites in the blood of the infected volunteers will terminate the challenge followed by administration of antimalarial drugs to thwart further replication of the parasite. Since ethical and medical considerations require treatment on appearance of blood-stage parasites, only the antisporozoite and liver-stage immunity engendered by the vaccine can be evaluated. Full evaluation of bloodstage and transmission-blocking immunity cannot be evaluated in this limited clinical setting. To date, all the above-mentioned abstracted data provided from human clinical trials using NYVAC-based vectors have described a good safety profile and the induction of some level of immunity to the expressed heterologous antigens.

Other Applications of Pox Virus-Based Vectors The use of pox virus-based vectors as recombinant vaccines for heterologous bacterial, viral, or parasitic pathogens was the first practical application of this technology deriving from the fact that vaccinia virus was an established vaccine. However, the pox virus vectors can be looked at as general delivery systems for genes for other applications. For example, these vectors can be used in vitro to stimulate and expand CTL reactivities from the peripheral blood of chronically infected or tumor-bearing individuals (31). The antigen-specific stimulation and expansion of such cultures might provide some therapeutic benefit when reintroduced to the donor patient. For cancer immunotherapy, numerous pox virus-based recombinants expressing tumor-associated antigens or biological response modifiers have been described (32). Of particular note, recombinants expressing the carcinoembryonic antigen were shown to elicit both antibody and cellular immune responses in mice and monkeys and to protect mice from tumor cell challenge (33, 34). Whether vaccinia or canarypox-based recombinants expressing the carcinoembryonic antigen will have any therapeutic benefit is currently being investigated in the clinic in patients with colorectal carcinomas. A recent publication (4) reported the protection of mice vaccinated with a p53 expressing recombinant against challenge with an isogenic and highly tumorigenic mouse fibroblast tumor cell line expressing high levels of a mutant human p53 but lacking endogenous murine p53. Expression of the mutant form of p53 in the recombinant virus was not essential since the wild-type p53 afforded similar efficacy. This may be an important observation since p53 is an attractive target for cancer immunotherapy. Mutations of p53 represent the most common genetic changes demonstrated in human tumors.

Discussion The excitement of the 1982 proposal to use pox virus-based vectors as heterologous vaccines and the ensuing years of extensive pursuit of this idea have provided numerous working examples in laboratory animal model systems as well as in target species. In the veterinary field, products have now been licensed for commercialization and a significant number of clinical studies have been and continue to be pursued for both infectious diseases, ex vivo therapies, and cancer immunotherapy. The immediate future looks to be as exciting as the recent past. 1. Panicali, D. & Paoletti, E. (1982) Proc. Natl. Acad. Sci. USA 79, 4927–4931. 2. Mackett, M., Smith, G.L. & Moss, B. (1982) Proc. Natl. Acad. Sci. USA 79, 7415–7419. 3. Kieny, M.P., Lathe, R., Drillien, R., Spehner, D., Skory, S., Schmitt, D., Wiktor, T., Koprowski, H. & Lecocq, J.P. (1984) Nature (London) 312, 163– 166. 4. Roth, J., Dittmer, D., Rea, D., Tartaglia, J., Paoletti, E. & Levine, A.J. (1996) Proc. Natl. Acad. Sci. USA 93, 4781–4786. 5. Taylor, J., Christensen, L., Gettig, R., Goebel, J., Bouquet, J.-F., Mickle, T.R. & Paoletti, E. (1996) Avian Dis. 40, 173–180. 6. Taylor, J. & Paoletti, E. (1988) Vaccine 6, 466–468. 7. Taylor, J., Weinberg, R., Languet, B., Desmettre, P. & Paoletti, E. (1988) Vaccine 6, 497–503. 8. Taylor, J., Trimarchi, C., Weinberg, R., Languet, B., Guillemin, F., Desmettre, P. & Paoletti, E. (1991) Vaccine 9, 190–193. 9. Taylor, J., Meignier, B., Tartaglia, J., Languet, B., VanderHoeven, J., Franchini, G., Trimarchi, C. & Paoletti, E. (1995) Vaccine 13, 539–549. 10. Taylor, J., Tartaglia, J., Rivière, M. & Paoletti, E. (1994) Dev. Biol. Stand. 82, 131–135. 11. Cadoz, M., Strady, A., Meignier, B., Taylor, J., Tartaglia, J., Paoletti, E. & Plotkin, S. (1992) Lancet 339, 1429–1432. 12. Fries, L.F., Tartaglia, J., Taylor, J., Kauffman, E.K., Meignier, B., Paoletti, E. & Plotkin, S. (1996) Vaccine 14, 428–434. 13. Taylor, J., Weinberg, R., Tartaglia, J., Richardson, C., Alkhatib, G., Briedis, D., Appel, M., Norton, E. & Paoletti, E. (1992) Virology 187, 321–328. 14. Taylor, J., Tartaglia, J., Moran, T., Webster, R.G., Bouquet, J.-F., Quimby, F.W., Holmes, D., Laplace, E., Mickle, T. & Paoletti, E. (1992) Proceedings of the Third International Symposium on Avian Influenza (Univ. of Wisconsin Extension Duplicating Serv., Madison), pp. 311– 335. 15. Tartaglia, J., Jarrett, O., Neil, J.C., Desmettre, P. & Paoletti, E. (1993) J. Virol. 67, 2370–2375. 16. Franchini, G., Tartaglia, J., Markham, P., Benson, J., Fullen, J., Wills, M., Arp, J., Dekaban, G., Paoletti, E. & Gallo, R.C. (1995) AIDS Res. Hum. Retroviruses 11, 307–313. 17. Cox, W.I., Tartaglia, J. & Paoletti, E. (1993) Virology 195, 845–850.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

APPLICATIONS OF POX VIRUS VECTORS TO VACCINATION: AN UPDATE

11353

18. Franchini, G., Robert-Guroff, M., Tartaglia, J., Aggarwal, A., Abimiku, A., Benson, J., Markham, P., Limbach, K., Hurteau, G., Fullen, J., Aldrich, K., Miller, N., Sadoff, J., Paoletti, E. & Gallo, R.C. AIDS Res. Hum. Retroviruses 11, 909–920. 19. Andersson, S., Makitalo, B., Thorstensson, R., Franchini, G., Tartaglia, J., Paoletti, E., Putkonen, P. & Biberfeld, G. I (1996) J. Infect. Dis., in press. 20. Myagkikh, M., Alipanah, S., Markham, P.D., Tartaglia, J., Paoletti, E., Gallo, R.C., Franchini, G. & Robert-Guroff, M. (1996) AIDS Res. Hum. Retroviruses 12, 985–992. 21. Abimiku, A.G., Franchini, G., Tartaglia, J., Aldrich, K., Myagkikh, M., Markham, P.D., Chong, P., Klein, M., Kieny, M.-P., Paoletti, E., Gallo, R.C. & Robert-Guroff, M. (1995) Nat. Med. 1, 321–329. 22. Pialoux, G., Excler, J.-L., Rivière, Y., Gonzalez-Canali, G., Feuillie, V., Coulaud, P., Gluckman, J.-C., Matthews, T.J., Meignier, B., Kieny, M.-P., Gonnet, P., Diaz, I., Méric, C., Paoletti, E., Tartaglia, J., Salomon, H., Plotkin, S., and The AGIS Group and L’Agence Nationale de Recherche sur le SIDA (1995) AIDS Res. Hum. Retroviruses 11, 373–381. 23. Egan, M.A., Pavlat, W.A., Tartaglia, J., Paoletti, E., Weinhold, K.J., Clements, M.-L. & Siliciano, R.F. (1995) J. Infect. Dis. 171, 1623–1627. 24. Fleury, B., Janvier, G., Pialoux, G., Buseyne, F., Robertson, M.N., Tartaglia, J., Paoletti, E., Kieny, M.P., Excler, J.L. & Rivière, Y. (1996) J. Infect. Dis., in press. 25. Goebel, S.J., Johnson, G.P., Perkus, M.E., Davis, S.W., Winslow, J.P. & Paoletti, E. (1990) Virology 179, 247–266. 26. Tartaglia, J., Perkus, M.E., Taylor, J., Norton, E.K., Audonnet, J.-C., Cox, W.I., Davis, S.W., VanderHoeven, J., Meignier, B., Rivière, M., Languet, B. & Paoletti, E. (1992) Virology 188, 217–232. 27. Brockmeier, S.L., Lager, K.M., Tartaglia, J., Rivière, M., Paoletti, E. & Mengeling, W.L. (1993) Vet. Microbiol. 38, 41–58. 28. Konishi, E., Pincus, S., Paoletti, E., Laegreid, W.W., Shope, R.E. & Mason, P.W. (1992) Virology 190, 454–458. 29. Lanar, D.E., Tine, J.A., de Taisne, C., Seguin, M.C., Cox, W.I., Winslow, J.P., Ware, L.A., Kauffman, E., Gordon, D., Ballou, W.R., Paoletti, E. & Sadoff, J.C. (1996) Infect. Immun. 64, 1666–1671. 30. Tine, J.A., Lanar, D.E., Smith, D., Wellde, B.T., Schultheiss, P., Ware, L.A., Kauffman, E., Wirtz, R.A., de Taisne, C., Hui, G.S. N., Chang, S.P., Church, P., Kaslow, D.C., Hoffman, S., Guito, K.P., Ballou, W.R., Sadoff, J.C. & Paoletti, E. (1996) Infect. Immun., in press. 31. Tartaglia, J., Taylor, J., Cox, W.I., Audonnet, J.-C., Perkus, M.E., Radaelli, A., de Giuli Morghen, C., Meignier, B., Rivière, M., Weinhold, K.J. & Paoletti, E. (1993) AIDS Res. Rev. 3, 361–378. 32. Perkus, M.E., Tartaglia, J. & Paoletti, E. (1995) J. Leukocyte Biol. 58, 1–13. 33. Kantor, J., Irvine, K., Abrams, S., Kaufman, H., DiPietro, J. & Schlom, J. (1992) J. Natl. Cancer Inst. 84, 1084–1091. 34. Kantor, J., Irvine, K., Abrams, S., Snoy, P., Olsen, R., Greiner, J., Kaufman, H., Eggensperger, D. & Schlom, J. (1992) Cancer Res. 52, 6917–6925.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

NEGATIVE-STRAND RNA VIRUSES: GENETIC ENGINEERING AND APPLICATIONS

11354

This paper was presented at a colloquium entitled “Genetic Engineering of Viruses and of Virus Vectors,” organized by Bernard Roizman and Peter Palese (Co-chairs), held June 9–11, 1996, at the National Academy of Sciences in Irvine, CA.

Negative-strand RNA viruses: Genetic engineering and applications

PETER PALESE *, HONGYONG ZHENG, OTHMAR G.ENGELHARDT, STEPHAN PLESCHKA, AND ADOLFO GARCÍA-SASTRE Department of Microbiology, Mount Sinai School of Medicine, 1 Gustave L.Levy Place, New York, NY 10029 ABSTRACT The negative-strand RNA viruses are a broad group of animal viruses that comprise several important human pathogens, including influenza, measles, mumps, rabies, respiratory syncytial, Ebola, and hantaviruses. The development of new strategies to genetically manipulate the genomes of negative-strand RNA viruses has provided us with new tools to study the structurefunction relationships of the viral components and their contributions to the pathogenicity of these viruses. It is also now possible to envision rational approaches—based on genetic engineering techniques—to design live attenuated vaccines against some of these viral agents. In addition, the use of different negative-strand RNA viruses as vectors to efficiently express foreign polypeptides has also become feasible, and these novel vectors have potential applications in disease prevention as well as in gene therapy.

DNA-Containing Viruses Among animal viruses, DNA-containing viruses were the first to become amenable to genetic engineering techniques. This breakthrough was achieved for simian virus 40 when a cloned cDNA copy was transfected into cells, resulting in the formation of infectious virus (see Table 1). Transfected mutated cDNA molecules gave rise to defined mutant viruses (1). A second methodology involving the use of homologous recombination allowed, for the first time, the rescue of large DNA-containing viruses such as herpes viruses (2). In this approach, intact herpes viral DNA as well as cloned DNA flanked by viral sequences was transfected into cells. Homologous recombination between the cloned DNA and the wild-type genome can occur, and novel viruses can be selected under appropriate conditions. For example, recombinants with DNA fragments containing a viral thymidine kinase gene can be selected in appropriate cell lines and media, and viruses lacking a thymidine kinase can be isolated in the presence of nucleoside analogs (e.g., Ara T). This general technique allows the successful construction of viral variants of herpes viruses, and similar procedures have been developed for pox viruses (3, 4) and other DNA-containing viruses including adenoviruses (5) and parvoviruses (6). Finally, strategies have been developed to generate infectious as well as mutant viruses by transfecting cosmids containing overlapping portions of large viral genomes. Viruses arise via recombination between the cosmids. This system was successfully used to rescue infectious herpes simplex 1 viruses (7), cytomegaloviruses (8) and Epstein-Barr viruses (9) from their respective cosmids.

Positive-Strand RNA Viruses RNA-containing viruses belong to a variety of families with diverse replication strategies. Unique among the RNA viruses are the retroviruses, whose replication involves a double-stranded DNA phase, making these viruses an easy target for genetic manipulation. Transfection of full-length cDNA molecules leads to the establishment of replicating virus particles and integration of the viral genetic information into the host genome (10). The engineering of retroviral genomes has become one of the most successful genetic approaches in modern virology and is central to the study both of viral gene expression and of protein structure-function analysis. In addition, retrovirus constructs are among the most widely used vectors for gene transfer and gene therapy (11). Most of the other positive-strand RNA viruses are also amenable to genetic engineering approaches (Table 1). In the case of the small and medium sized positive-strand RNA viruses, full-length genomic RNA has been shown to be infectious when transfected into cells. Plus-strand RNA serves as mRNA for the synthesis of viral proteins as well as template for viral RNA replication. Thus, transfection of cloned DNA of poliovirus RNA (or of cDNA-derived RNA) into permissive cells results in the formation of infectious virus particles (12). Remarkably successful have been studies using Sindbis viruses and Semliki forest virus (13, 14). The cDNA-derived RNAs of these positive-strand RNA viruses can be used to efficiently rescue infectious viruses, thus allowing an extensive analysis of the promoter elements of the viral RNAs as well as structure-function studies of the viral proteins. Furthermore, these viruses have received increased attention because of their potential for expressing copious amounts of heterologous genes via recombinant constructs. Up to 108 molecules of heterologous protein per cell have been expressed using these systems.†

Introduction of cDNA-Derived RNA into a Negative-Strand RNA Virus (Influenza Virus) The life cycle of negative-strand RNA viruses differs from that of the other RNA viruses in many ways. Specifically, the genomic RNA of negative-strand RNA viruses is not infectious, and infectious virus particles must also deliver their own RNA-dependent RNA polymerase into the infected cell to start the first round of virus-specific mRNA synthesis. Thus, approaches different from those used for positive-strand RNA viruses had to be developed to allow the rescue of

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact. Abbreviations: RNP, ribonucleoprotein; HA, hemagglutinin; NA, neuraminidase, VSV, vesicular stomatitis virus. *To whom reprint requests should be addressed, e-mail: ppalese@ smtplink.mssm.edu. †Belli, B.A., Polo, J.M., Driver, D.A., Latham, E., Banks, T.A., Chang, S.M.W. & Dubensky, T.W., Jr., National Academy of Sciences Colloquium on Genetic Engineering of Viruses and of Virus Vectors, June 9–11, 1996, Irvine, CA, no. 1. (abstr.).

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

NEGATIVE-STRAND RNA VIRUSES: GENETIC ENGINEERING AND APPLICATIONS

11355

genetically engineered viruses of these virus families (Table 1). Site-specifically altered influenza viruses were first obtained by reconstituting in vitro a biologically active ribonucleoprotein complex (made of synthetic RNA and purified nucleoprotein and polymerase proteins) and then transfecting the complex into helper virus-infected cells (Fig. 1) (15). The helper virus provides in trans the viral proteins required for amplification of the synthetic RNP complex. Subsequent reassortment of the synthetic gene and helper virus-derived RNA segments, followed by selection for the reassortant (transfectant) virus, allows the introduction of site-specific changes into the genome of influenza viruses (16). Selection of the transfectant virus can be achieved by choosing host range or temperature-sensitive mutants as helper viruses. Alternatively, antibody preparations specific for the viral surface proteins can be used to select against the helper virus or for these novel viral constructs. Following such protocols, six of the eight genes [PB2, hemagglutinin (HA), neuraminidase (NA), NP, M and NS] of influenza A viruses and the HA of an influenza B virus have now successfully been altered by genetic engineering methods (17–22).

Table 1. Genetic engineering of animal viruses Prototype viruses Type of genome dsDNA Simian virus 40, herpes, adenovirus, poxvirus ssDNA ssRNA Plus-sense RNA

Adeno-associated virus (AAV) Retrovirus

Strategies Transfection of cDNA; homologous recombination using cloned DNA and intact viral DNA or helper viruses; transfection of cosmids containing viral genes Transfection of plasmids containing AAV genes Transfection of infectious cDNA

Picornavirus, Semliki forest virus, Sindbis virus

Transfection of cDNA-derived infectious RNA

Influenza virus, rhabdovirus, parainfluenza virus, bunyavirus

Transfection of reconstituted ribonucleoprotein in the presence of helper virus; rescue of virus from cDNA clones transcribed in vitro or in vivo in the presence of helper virus or of viral polymerase proteins expressed intracellularly in trans —

Minus-sense RNA

dsRNA

—

ds, Double stranded; ss, single stranded.

Plasmid-Based Reverse Genetics System for Influenza Virus A method was recently developed to reconstitute a biologically active influenza virus RNP complex within a cell rather than in vitro. This alternative approach avoids the need to purify viral proteins and to transfect an RNA-protein complex into cells; instead, this method involves the transfection of plasmids. The first plasmid contains a human polymerase I promoter and a hepatitis delta virus-derived ribozyme sequence which flank the synthetic influenza virus gene. The polymerase I-driven plasmid is cotransfected into human cells with polymerase IIresponsive plasmids expressing in trans the viral PB1, PB2, PA, and NP proteins. Such a system involving the use of five plasmids allows the amplification and expression of a synthetic influenza virus gene and takes advantage of the convenience of plasmid transfections as compared with RNP transfections (23). Using this approach, it was possible to rescue a synthetic NA gene into a recombinant influenza A virus. A synthetic HA gene has also been rescued by this novel technique (Fig. 2) (A.G.-S., unpublished results). It should be noted, however, that this plasmid-based reverse genetics system still relies on the presence of a helper virus which provides the genetic backbone into which the plasmidderived gene can be introduced.

Chimeric Influenza Viruses Expressing Foreign Epitopes or Polypeptides The development of methods to rescue synthetic RNAs into the genomes of influenza viruses allowed the construction of chimeric viruses expressing a variety of foreign epitopes. Specifically, epitopes derived from HIV, plasmodia, or lymphocytic choriomeningitis virus proteins were successfully expressed in either the HA or the NA of different influenza viruses (16, 24). Such constructs were shown to induce a potent B-cell and/or T-cell response against the foreign epitope in experimental animal systems. Specifically, Li et al. (25) gen

FIG. 1. A reverse genetics system for the rescue of infectious influenza viruses containing cDNA-derived RNA. The method allows the substitution of one of the eight genomic RNA segments of the virus by a synthetic RNA. A biologically active viral ribonucleoprotein complex (RNP) is made in vitro by mixing cDNA-derived RNA with purified viral nucleoprotein and polymerase proteins. The RNPs are transfected into cells which have been previously infected with an influenza helper virus. Using a selection method, viruses containing the genetically engineered RNP (transfectant viruses) can be isolated.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

NEGATIVE-STRAND RNA VIRUSES: GENETIC ENGINEERING AND APPLICATIONS

11356

erated a recombinant influenza virus that expressed a CD8+ T-cell epitope derived from the circumsporozoite (CS) protein of Plasmodium yoelii in its HA. Mice immunized with this transfectant virus made a vigorous cytotoxic T lymphocyte response against this epitope (25). By boosting mice with a recombinant vaccinia virus expressing the CS protein, it was possible to achieve protective immunity (60%) against challenge with live P. yoelii sporozoites. Additional protective immune responses were generated by immunizing mice with transfectants expressing B-cell-specific epitopes located in the repeat region of the CS protein of P. yoelii. Up to 80% of immunized mice were immune to challenge with one hundred P. yoelii sporozoites (26).

FIG. 2. A plasmid-based reverse genetics system for the rescue of infectious influenza viruses containing a genetically engineered segment. Cells are transfected with four plasmids that are able to express the viral NP and polymerase (PB2, PB1, and PA) proteins from a cellular polymerase II-responsive promoter (pol II). An additional plasmid which contains, for example, the HA open reading frame flanked by the 5
and 3
noncoding regions of the viral RNA segment (black boxes) is cotransfected. The HA plasmid is able to express an HA-specific viral RNA by transcription from a polymerase I-responsive promoter (pol I) followed by the ribozyme (RZ)-mediated cleavage of the transcript. The HA-specific RNA segment is intracellularly complexed with the NP and polymerase proteins to form RNPs that can be rescued into a transfectant virus if the cells are also infected with an influenza helper virus. Selection of the transfectant viruses can be performed by using neutralizing antibodies against the HA protein of the helper virus. Foreign epitopes can be inserted into several sites on the HA molecule of influenza viruses, and most conveniently into the stalk region of the NA. In fact, stretches of more than 80 foreign amino acids have been successfully inserted into the stalk region of the NA (27, 28) (S.Itamura, personal communication). Although some of these constructs show interesting biological properties, this approach of epitope grafting has its limitations in terms of the size and the nature of the epitope that can be expressed (since the chimeric protein may affect the viability of the recombinant virus). A generic approach to the expression of foreign proteins is the construction of bicistronic genes which can be packaged into infectious particles. The foreign gene can replace the open reading frame of one of the influenza virus genes and the respective influenza virus protein is then translated from an internal ribosome entry site (IRES element) on the genetically engineered gene. Alternatively, the foreign protein can be translated from an internal IRES sequence. Expression of several foreign polypeptides was achieved in this way (16, 29). However, many constructs did not result in viable viruses (unpublished results). Attempts are currently being made to identify the factors which determine the limitations of this approach. The second method for the expression of foreign proteins takes advantage of autoproteolytic elements placed within a fusion protein. For example, a virus was constructed that expresses a fusion protein consisting of the full-length chloramphenicol acetyltransferase (CAT) protein, the 2A protease of foot and mouth disease virus, and the viral NA (30). This virus was stably passaged and expressed copious amounts of CAT protein in infected cells. However, in all cases of the fusion protein constructs, the foreign protein contains a 16-amino acid extension derived from the 2A protease which may alter the biological properties of the foreign protein.

Rescue of Infectious Rabies Virus from cDNA Like the segmented negative-strand RNA viruses, the Mononegavirales group packages its own RNA-dependent RNA polymerase into virus particles to initiate viral RNA synthesis. Thus, naked RNA alone is unable to drive the replication cycle. Several approaches were taken to rescue model and full-length RNAs. First, a Sendai virus-like RNA transcript was amplified and expressed by transfecting the naked model RNA into Sendai virus-infected cells (31). This experiment suggests that complementation in trans by the viral polymerase complex is required for the amplification and expression of the viral RNA-like reporter gene. Subsequently, in a remarkable study, Schnell et al. (32) succeeded in constructing a plasmid that expresses a full-length rabies virus RNA transcript from a T7 RNA polymerase promoter. The plasmid DNA containing this viral insert was transfected into cells infected with a recombinant vaccinia virus expressing the T7 polymerase. Three other plasmids expressing the rabies virus N, P and L proteins were also cotransfected into these cells. In this recombinant vaccinia virus-driven system, the presence of the viral polymerase complex and of a full-length viral RNA (in plus sense) led to the formation of recombinant rabies virus. This system has been elegantly exploited to study the promoter elements of rabies virus RNA and to elucidate the interaction of this interesting virus with cells (33). Surprisingly, cells infected with a mutant lacking the virus’ only glycoprotein (G) were still able to bud from the cell surface, albeit at a 30-fold lower efficiency (34). This experiment revealed that the surface protein G exhibits an intrinsic exocytotic activity. The system was further developed to show that a hybrid G/HIV-1 glycoprotein was able to form pseudotypes with the “G-less” particle, thus changing the host range by restricting infection to CD4+ cells. This experiment clearly demonstrates that genetic engineering can redirect the host range and cell tropism of rabies viruses. This should prove helpful for the development of novel vaccines as well as for gene therapy.

Rescue of Other Nonsegmented Negative-Strand RNA Viruses An effective DNA transfection system has also been developed for another rhabdovirus, vesicular stomatitis virus (VSV) (35, 36) (Fig. 3). Again, the polymerase complex (N, P, and L proteins) was expressed in cells from plasmids transcribed by a T7 RNA polymerase-containing vaccinia virus recombinant. Recombinant VSVs expressing an additional transcriptional unit were rescued and high-expression levels of heterologous proteins were achieved (37). In a dramatic experiment, the authors were able to construct a recombinant VSV expressing the CD4 protein. This protein was packaged at levels of up to 30% of the G protein itself, and the recombinant particle had an 18% greater length than wild-type virus due to the extra gene. These results illustrate that VSV is an effective vector to express foreign proteins at high levels, and that the virus is tolerant to the insertion of novel transcriptional units. Reverse genetics systems have also been developed for paramyxoviruses. In the case of measles virus, a cell line constitutively

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

NEGATIVE-STRAND RNA VIRUSES: GENETIC ENGINEERING AND APPLICATIONS

11357

expressing T7 polymerase and the measles N and P proteins has been used for the rescue of infectious virus from full-length clones (38) and vaccinia virus-based systems have allowed the rescue of respiratory syncytial virus (39) and of Sendai viruses (40, 41).

FIG. 3. Reverse genetics systems for the rescue of infectious nonsegmented negative-strand RNA viruses from cDNA. Transcriptionally competent viral RNPs are made by cellular expression of the viral proteins N, P, and L. This can be achieved by a variety of methods, including vaccinia virus-driven expression and/or complementing cell lines constitutively expressing T7 polymerase and viral proteins. The full-length viral RNA can be provided by transfecting plasmids expressing antigenomic or genomic RNA or by directly transfecting naked RNA (plus-sense or minus-sense). The intracellularly assembled RNPs are transcribed and replicated by the viral polymerase complex (N, P, and L proteins) generating infectious viruses. Most of the earlier systems developed for the nonsegmented viruses used the intracellular expression of antigenomic plus-sense RNA as the template to initiate the replication cycle. Either the plus-sense RNA was transcribed by the T7 polymerase expressed by a vacciniarecombinant virus (32, 35, 36, 39–41), or transcription was driven by the T7 polymerase which was permanently expressed in cells (38). Recently, an important series of experiments showed that intracellular expression of a full-length transcript generated infectious Sendai virus regardless of whether the plus-sense or the minus-sense RNA was transcribed (41). Success appears to have come from fine tuning the system in terms of the concentration of the polymerase components (N, P, and L proteins) and from constructing plasmids giving rise to transcripts with 5
and 3
ends identical to those of the wild-type RNA. Optimization of the system also involved the use of the vaccinia virus inhibitors, cytosine arabinoside and rifampicin. These compounds reduced the cytotoxicity of vaccinia virus and resulted in a dramatic increase of the expression levels of a Sendai virus RNA-like reporter gene. Most interesting was the finding that recovery of infectious Sendai virus was also possible by transfecting naked RNA. The efficiency of recovery appeared to be lower using plus-sense RNA than the genomic minus-sense RNA (41). The latter results involving the use of naked RNAs extend the earlier findings that transfection of naked model RNAs alone results in the efficient amplification and expression of these minigenes in cells infected with Sendai virus (31), respiratory syncytial virus (42) or parainfluenza virus 3 (43, 44). In the future, improvements in the transfection systems to generate novel viruses with ease will provide us with even better tools for the study of negative-strand RNA viruses.

Perspective The ability to genetically alter negative-strand RNA viruses has already enhanced this field of virology and may have a major influence on future developments in vaccines, gene therapy, cancer treatment, and manufacture of biologicals. First, structure-function studies of individual viral genes are now possible in the context of an infectious virus for a number of negative-strand RNA virus families. These groups consist of many medically important viruses including measles, mumps, respiratory syncytial, parainfluenza, influenza, and bunyaviruses. In the recent past, we tried to take a reductionist approach in virology; viral genes were studied in isolation by cloning and expressing them in different systems. The pendulum has now swung back in the other direction as we ask questions about how viral genes and gene products interact with host cell components and the host in general. This can best be done by studying genetically defined viruses and subjecting them to directed mutational analysis. These viral constructs are then available for biochemical analysis as well as for studying replication and growth in tissue culture or experimental animals. Obviously, structure-function studies of viral genes also include the analysis of promoter elements and other noncoding sequences. Second, genetically engineered negative-strand RNA viruses should become candidates for use as live virus vaccines. Genetically engineered influenza viruses with changes in coding or noncoding sequences may induce immune responses which are longer-lasting and more protective than those generated by conventional influenza virus vaccines. In the case of respiratory syncytial and parainfluenza viruses, a recombinant DNA approach may be the only rational strategy, since the Jennerian approach has not resulted in acceptable vaccine candidates. Thus, tools are now available to design a new generation of vaccines for the medically important negative-strand RNA viruses. Third, negative-strand RNA viruses may become useful vectors for the expression of foreign genes. Recombinant influenza viruses (16), rabies viruses (45), and VSV (37) have been used to express additional protein sequences or foreign genes. Packaging limitations and restrictions due to the length or the nature of the foreign gene are not yet defined for negative-strand RNA virus constructs, nor do we have sufficient information about the stability of these viruses once their genome structures have been extensively altered. These uncertainties notwithstanding, there is a major advantage in the use of negative strand RNA viruses as vectors (or as vaccines). These viruses do not go through a DNA phase and thus cannot transform cells by integrating their genetic information into the host cell genome. Furthermore, homologous recombination has never been observed for any of the negative-strand RNA viruses. Thus, replication-incompetent viral constructs grown in complementing cell lines should be free of contaminating virus generated by a recombinational event. In terms of safety, these properties weigh heavily in favor of negative-strand RNA virus vectors. Novel viruses expressing foreign genes may serve prophylactically as vaccines, or they may play a role in gene therapy when a transient expression would be beneficial. The latter may be the case in cancer therapy, which could require a targeted infection followed by the induction of a lethal cytopathic effect. Repeated administration of negative-strand RNA viruses may not be feasible in this situation because of the host’s immune response. However, the choice of different

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

NEGATIVE-STRAND RNA VIRUSES: GENETIC ENGINEERING AND APPLICATIONS

11358

antigenic variants (as is possible with influenza viruses) may overcome this limitation. Finally, the highly efficient expression of viral and foreign proteins via negative-strand RNA virus vectors may have additional biotechnological applications. It is possible that defective RNA constructs could be used for genetic immunization. This form of vaccination would resemble DNA vaccination (46) in that the defective particle would go through many replication rounds and persist without spreading to neighboring cells. Such RNA replicons may have interesting biological properties since the efficiency of infection should be comparable to that of whole viruses. Also, replication competent viral vectors may help in the manufacture of large quantities of biological reagents, since the quantities expressed by negative-sense RNA viruses can be high. It is also possible that purification of expressed proteins could be made easier if they were incorporated into extracellular virus particles. The solutions to many of the issues discussed here will depend on the continuing success of basic science and the development of novel strategies to study viruses. Our horizons must expand and include the analysis not only of the viruses but also of their interactions with the host cell. Only by continuing to study these fundamental processes may we hope to reap the benefits offered to us by these new opportunities. Work done in this laboratory was supported by National Institutes of Health grants to P.P. 1. Goff, S.P. & Berg, P. (1976) Cell 9, 695–705. 2. Post, L.E. & Roizman, B.R. (1981) Cell 25, 227–232. 3. Panicalli, D. & Paoletti, E. (1982) Proc. Natl. Acad. Sci. USA 79, 4927–4931. 4. Mackett, M., Smith, G.L. & Moss, B. (1982) Proc. Natl. Acad. Sci. USA 79, 7415–7419. 5. Jones, N. & Shenk, T. (1978) Cell 13, 181–188. 6. Samulski, R.J., Chang, L. & Shenk, T. (1989) J. Virol. 63, 3822–3828. 7. Cunningham, C. & Davison, A.J. (1993) Virology 197, 116–124. 8. Kemble, G., Duke, G., Winter, R., Spaete, R. & Mocarski, E.S. (1996) J. Virol. 70, 2044–2048. 9. Cohen, J.I., Wang, F., Mannick, J. & Kieff, E. (1989) Proc. Natl. Acad. Sci. USA 86, 9558–9562. 10. Wei, C.-M., Gibson, M., Spear, P.G. & Scolnick, E.M. (1981) J. Virol. 39, 935–944. 11. Mulligan, R.C. (1993) Science 260, 926–932. 12. Racaniello, V.R. & Baltimore, D. (1981) Science 214, 916–918. 13. Rice, C.M., Levis, R., Strauss, J.H. & Huang, H.V. (1987) J. Virol. 61, 3809–3819. 14. Liljestrom, P., Lusa, S., Huylebroeck, D. & Garoff, H. (1991) J. Virol. 65, 4107–4113. 15. Enami, M., Luytjes, W., Krystal, M. & Palese, P. (1990) Proc. Natl. Acad. Sci. USA 87, 3802–3805. 16. García-Sastre, A. & Palese, P. (1995) Biologicals 23, 171–178. 17. Subbarao, E.K., Kawaoka, Y. & Murphy, B.R. (1993) J. Virol. 67, 7223–7228. 18. Enami, M. & Palese, P. (1991) J. Virol. 65, 2711–2713. 19. Li, S., Xu, M. & Coelingh, K. (1995) Virus Res. 37, 153–161. 20. Yasuda, J., Bucher, D.J. & Ishihama, A. (1994) J. Virol. 68, 8141–8146. 21. Castrucci, M.R. & Kawaoka, Y. (1995) J. Virol. 69, 2725–2728. 22. Barclay, W.S. & Palese, P. (1995) J. Virol. 69, 1275–1279. 23. Pleschka, S., Jaskunas, S.R., Engelhardt, O.G., Zürcher, T., Palese, P. & García-Sastre, A. (1996) J. Virol. 70, 4188–4192. 24. Castrucci, M.R., Hou, S., Doherty, P.C. & Kawaoka, Y. (1994) J. Virol. 68, 3486–3490. 25. Li, S., Rodrigues, M., Rodriguez, D., Rodriguez, J.R., Esteban, M., Palese, P., Nussenzweig, R.S. & Zavala, F. (1993) Proc. Natl. Acad. Sci. USA 90, 5214–5218. 26. Rodrigues, M., Li, S., Murata, K., Rodriguez, D., Rodriguez, J.R., Bacik, I., Bennick, J.R., Yewdell, J.W., García-Sastre, A., Nussenzweig, R.S., Esteban, M., Palese, P. & Zavala, F. (1994) J. Immunol. 153, 4636–4648. 27. Castrucci, M.R. & Kawaoka, Y. (1993) J. Virol. 67, 759–764. 28. Luo, G., Chang, J. & Palese, P. (1993) Virus Res. 29, 141–153. 29. García-Sastre, A., Muster, T., Barclay, W.S., Percy, N. & Palese, P. (1994) J. Virol. 68, 6254–6261. 30. Percy, N., Barclay, W.S., García-Sastre, A. & Palese, P. (1994) J. Virol. 68, 4486–4492. 31. Park, K.H., Huang, T., Correia, F. & Krystal, M. (1991) Proc. Natl. Acad. Sci. USA 88, 5537–5541. 32. Schnell, M.J., Mebatsion, T. & Conzelmann, K.-K. (1994) EMBO J. 13, 4195–4203. 33. Mebatsion, T. & Conzelmann, K.-K. (1996) Proc. Natl. Acad. Sci. USA 93, 11366–11370. 34. Mebatsion, T., König, M. & Conzelmann, K.-K. (1996) Cell 84, 941–951. 35. Lawson, N.D., Stillman, E.A., Whitt, M.A. & Rose, J.K. (1995) Proc. Natl. Acad. Sci. USA 92, 4477–4481. 36. Whelan, S.P.J., Ball, L.A., Barr, J.N. & Wertz, G.T.W. (1995) Proc. Natl. Acad. Sci. USA 92, 8388–8392. 37. Schnell, M.J., Buonocore, L., Kretzschmar, E., Johnson, E. & Rose, J.K. (1996) Proc. Natl. Acad. Sci. USA 93, 11359–11365. 38. Radecke, F., Spielhofer, P., Schneider, H., Kaelin, K., Huber, M., Dotsch, C., Christiansen, G. & Billeter, M.A. (1995) EMBO J. 14, 5773–5784. 39. Collins, P.L., Hill, M.G., Camargo, E., Grosfeld, H., Chanock, R.M. & Murphy, B.R. (1995) Proc. Natl. Acad. Sci. USA 92, 11563–11567. 40. Garcin, D., Pelet, T., Calain, P., Roux, L., Curran, J. & Kolakofsky, D. (1995) EMBO J. 14, 6087–6094. 41. Kato, A., Sakai, Y., Shioda, T., Kondo, T., Nakanishi, M. & Nagai, Y. (1996) Genes Cells 1, 569–579. 42. Collins, P.L., Mink, M.A. & Stec, D.S. (1991) Proc. Natl. Acad. Sci. USA 88, 9663–9667. 43. De, B.P. & Banerjee, A.K. (1993) Virology 196, 344–348. 44. Dimock, K. & Collins, P.L. (1993) J. Virol. 67, 2772–2778. 45. Conzelmann, K.-K. (1996) J. Gen. Virol. 77, 381–389. 46. McClements, W.L., Armstrong, M.E., Keys, R.D. & Liu, M.A. (1996) Proc. Natl. Acad. Sci. USA 93, 11414–11420.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

FOREIGN GLYCOPROTEINS EXPRESSED FROM RECOMBINANT VESICULAR STOMATITIS VIRUSES ARE INCORPORATED EFFICIENTLY INTO VIRUS PARTICLES

11359

This paper was presented at a colloquium entitled “Genetic Engineering of Viruses and of Virus Vectors,” organized by Bernard Roizman and Peter Palese (Co-chairs), held June 9–11, 1996, at the National Academy of Sciences in Irvine, CA.

Foreign glycoproteins expressed from recombinant vesicular stomatitis viruses are incorporated efficiently into virus particles MATTHIAS J.SCHNELL, LINDA BUONOCORE, EVELYNE KRETZSCHMAR, ERIK JOHNSON, AND JOHN K.ROSE* Departments of Pathology, Cell Biology, and Biology, Yale University School of Medicine, 310 Cedar Street, New Haven, CT 06510 ABSTRACT In a previous study we demonstrated that vesicular stomatitis virus (VSV) can be used as a vector to express a soluble protein in mammalian cells. Here we have generated VSV recombinants that express four different membrane proteins: the cellular CD4 protein, a CD4-G hybrid protein containing the ectodomain of CD4 and the transmembrane and cytoplasmic tail of the VSV glycoprotein (G), the measles virus hemagglutinin, or the measles virus fusion protein. The proteins were expressed at levels ranging from 23–62% that of VSV G protein and all were transported to the cell surface. In addition we found that all four proteins were incorporated into the membrane envelope of VSV along with the VSV G protein. The levels of incorporation of these proteins varied from 6–31% of that observed for VSV G. These results suggest that many different membrane proteins may be co-incorporated quite efficiently with VSV G protein into budding VSV virus particles and that specific signals are not required for this coincorporation process. In fact, the CD4-G protein was incorporated with the same efficiency as wild type CD4. Electron microscopy of virions containing CD4 revealed that the CD4 molecules were dispersed throughout the virion envelope among the trimeric viral spike glycoproteins. The recombinant VSV-CD4 virus particles were about 18% longer than wild type virions, reflecting the additional length of the helical nucleocapsid containing the extra gene. Recombinant VSVs carrying foreign antigens on the surface of the virus particle may be useful for viral targeting, membrane protein purification, and for generation of immune responses. Vesicular stomatitis virus (VSV) is the prototypic rhabdovirus and is among the simplest of the enveloped animal viruses (reviewed in ref. 1). VSV has been an important model system in part because it grows rapidly to very high titers and can be prepared in large quantities. The VSV genome is an 11, 161 nucleotide negative-strand RNA that is tightly encased in the nucleocapsid (N) protein. The nucleocapsid is packaged as a 35-turn helix within membrane-enveloped, bullet-shaped particles. Two virally encoded proteins, L and P, form a polymerase that is packaged in the virion. This polymerase is required for transcription of the genome to generate five subgenomic mRNAs encoding the five structural proteins and for replication of full-length genomes. The two other viral proteins are the matrix protein (M) and the glycoprotein (G). M protein probably bridges between the nucleocapsid and the short cytoplasmic domain of the transmembrane G protein. G protein forms trimeric spikes on the virion surface and is responsible for binding a cell surface receptor and for membrane fusion to initiate infection. We reported recently that VSV can be used as a genetically stable, high-level expression vector (2). Here we have investigated VSVs ability to express cellular and viral membrane proteins and we have also examined the incorporation of these proteins, into the viral membrane. Incorporation of foreign viral spike glycoproteins into the envelope of recombinant VSV particles might allow development of a new generation of killed virus vaccines or retargeting of virus particles to specific cell types. Also, expression of other membrane proteins from the VSV genome and their subsequent incorporation into the virions could yield large quantities of the expressed protein in highly purified form for structural or functional studies. Because of these potential applications, we are especially interested in understanding the factors governing membrane protein incorporation into VSV particles. By generating VSV recombinants expressing foreign envelope proteins, we are able to achieve high-level expression of foreign membrane proteins at the same time that the VSV proteins are being made. This system allows us to examine the structural requirements for foreign protein incorporation into VSV particles. Previous studies have shown that the envelope proteins of several other viruses can be incorporated into the envelope of VSV particles when VSV and a second virus are propagated in the same cells. This phenomenon of pseudotype formation is well known (reviewed in ref. 3), but the extent of foreign envelope protein incorporation into VSV has not been examined in detail. Also, the cellular CD4 protein expressed from a vaccinia vector was found to be incorporated into VSV particles at a low level of about 60 molecules per virion, and no preference was seen for a chimeric CD4 carrying the transmembrane and cytoplasmic domains of VSV G protein (4). In contrast, a study of HIV envelope protein incorporation into VSV particles lacking G protein indicated a requirement for the cytoplasmic tail of G on the HIV envelope protein (5). These studies complemented earlier studies showing a lower efficiency of incorporation of G proteins with truncated tails into the VSV G ts mutant lacking the G protein (6). Here, using recombinant VSVs expressing very high levels of foreign membrane proteins, we have been able to quantitate both the expression levels of the foreign proteins and their incorporation into VSV particles. We conclude that there is significant extra space in the VSV envelope that can, in many cases, accommodate large amounts of foreign membrane proteins.

MATERIALS AND METHODS Plasmid Construction. A plasmid expressing the positive strand RNA complement of the VSV genome with a site for foreign gene expression (pVSV-XN1) was described previ

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact. Abbreviations: VSV, vesicular stomatitis virus; HIV, human immunodeficiency virus; wt, wild type; BHK cells, baby hamster kidney cells; N, nucleocapsid; M, matrix; G, glycoprotein; H, hemagglutinin; F, fusion. *To whom reprint requests should be addressed. e-mail: jrose@ biomed.med.vale.edu.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

FOREIGN GLYCOPROTEINS EXPRESSED FROM RECOMBINANT VESICULAR STOMATITIS VIRUSES ARE INCORPORATED EFFICIENTLY INTO VIRUS PARTICLES

11360

ously (2). This plasmid contains unique XhoI and NheI sites flanked by VSV transcription start and stop signals. VSV constructs encoding the human CD4, human CD4 with the VSV G transmembrane and cytoplasmic domains (CD4G), measles virus fusion (F), and measles virus hemagglutinin (H) proteins, were generated as follows. Each gene was excised from the appropriate plasmids with XhoI and XbaI and ligated to pVSV-XN1 that had been cleaved with XhoI and NheI. The inserts were obtained from pBS-CD4 encoding CD4 (7) or pBS-CD4G encoding a chimeric molecule with the transmembrane and cytoplasmic domains of CD4 replaced with those from the VSV G protein. The measles F protein gene was subcloned from pe∆5F1 (8) and the measles H protein gene was subcloned from peH1 (8). The plasmids encoding the measles proteins were generously provided by Roberto Cattaneo (University of Zurich). The resulting plasmids were called pVSV-CD4, pVSV-CD4G, pVSV-MF, or pVSV-MH. Recovery of VSV Recombinants. Baby hamster kidney cells (BHK-21, American Type Culture Collection) were maintained in DMEM supplemented with 5% fetal bovine serum. Cells on 10-cm dishes (80% confluent) were infected at a multiplicity of 10 with vTF7–3 (9). After 1 h, plasmids encoding the N, P, and L proteins and the appropriate recombinant antigenomic RNA were transfected into the cells using TransfectACE (10), as described (2). Plasmid amounts were 10 µg of the respective full length plasmid (VSV-CD4, VSV-CD4G, VSV-MF, VSV-MH), 3 µg pBS-N, 5 µg pBS-P, and 2 µg pBS-L. Subsequent steps were performed as described (2). Preparation and Analysis of Protein from Recombinant VSV. For metabolic labeling of the VSV proteins, BHK cells on a 3.5-cm plate (80% confluent) were infected with recombinant or wild type (wt) VSV at a multiplicity of infection of 20. After 4 h cells were washed with DMEM— methionine and incubated for 1 h at 37°C in 1 ml of DMEM lacking unlabeled methionine and containing 100 µCi (1 Ci= 37 GBq) of [35S]methionine. For immunoprecipitation, SDS was added to a 0.2% final concentration in the cell lysates, and the medium samples were adjust to 1% Nonidet-40 and 0.2% SDS. Samples were incubated at 4°C overnight in the presence of specific antisera, and immune complexes were precipitated with excess fixed Staphylococcus aureus (Pansorbin; Calbiochem). Cell extracts (2% of the total) and radioimmunoprecipitation were analyzed by SDS/10% polyacrylamide gel and detected with a Phosphorlmager (Molecular Dynamics). For metabolic labeling of recombinant and wt VSV virions, a monolayer of BHK cells (80% confluent) on a 3.5-cm dish was infected with a multiplicity of infection of 20. After 2 h cells were washed with DMEM—methionine and incubated overnight at 37°C in 1.5 ml of DMEM +3% FCS lacking unlabeled methionine and containing 200 µCi of [35S]methionine. Cell debris and nuclei were removed by centrifugation at 1,250×g for 5 min, and virus was pelleted from the medium through 10% sucrose at 38,000 rpm in a Beckman SW41 rotor for 1 h. Virus pellets were resuspended in 50 µl or 10 mM Tris·HCl, pH 7.4 and 10 µl was analyzed by SDS/PAGE. Immunofluorescence Microscopy. Cells on 3.5-cm plates were infected for 4 h, fixed in 3% paraformaldehyde, and stained with mAb I1 to the VSV GI protein (11) a mAb OKT4 (12) to CD4, a polyclonal rabbit antibody directed against the VSV G protein cytoplasmic domain (13), or polyclonal rabbit antibodies directed against the measles H or F proteins (8), followed by fluorescein isothiocyanate-conjugated goat antimouse antibody (Jackson ImmunoResearch) or by fluorescein isothiocyanate-conjugated goat anti-rabbit antibody (Jackson ImmunoResearch). Cells were examined by indirect immunofluorescence using a Nikon Microphot-FX microscope equipped with a 40× planapochromat objective. Electron Microscopy and Immunogold Labeling. Virus particles from infections performed in 10-cm dishes were recovered from cultures by first pelleting cell debris at 1,500×g for 10 min. The virus was then concentrated and purified by centrifugation twice through 20% sucrose (20% sucrose in 1× TBE, pH 7.5) at 120,000×g for 60 min. Virus samples were absorbed onto carbon-coated grids for 5 min and then blocked with 1% BSA in PBS for 30 min at room temperature. The grids were then placed on a 50-µl drop of anti-VSV G mAb I1 (11) or antiCD4 mAb OKT4 (12) diluted 1:50 in PBS containing 1% BSA. After 1 h excess antibody was removed by placing grids sequentially onto five 50-µl drops of 1% BSA in PBS for 2 min each time. The grids were then placed on a 50-µl drop of goat anti-mouse IgG (Fc) labeled with 15nm gold particles (AuroProbe, Amersham). Unbound gold conjugates were removed by five sequential 2-min washes with PBS. The virusImmunogold complexes were then negative stained by incubation the grids for 4 min on 50-µl drops of 2% phosphotungstic acid (pH 7.5). Excess stain was removed and the grids were air dried. Images of viruses were obtained with a Zeiss EM910 electron microscope.

RESULTS We previously described the recovery of a recombinant VSV expressing the bacterial chloramphenicol acetyl transferase from a extra transcription unit inserted into an infectious clone of VSV. Chloramphenicol acetyl transferase expression employed the VSV vector pVSVXN1 in which a new transcription unit and cloning site were inserted between the G and L genes of VSV (1). In the present study we have used this same vector to derive recombinant VSVs expressing four different membrane proteins that are transported to the plasma membrane and we have examined their incorporation into the membrane of particles budding from the cell surface. Expression of CD4 and CD4G in VSV. In initial studies we used the gene encoding the cellular membrane protein CD4 (14) or a CD4G chimeric protein in which the transmembrane and cytoplasmic domains of CD4 were replaced with the corresponding domains of VSV G protein (Fig. 1). We cloned the sequences encoding the CD4 or CD4G proteins in the vector pVSV-XN1. Recovery of recombinant VSVs expressing the CD4 or CD4G proteins from plasmid DNA was obtained using published techniques (2). After initial recovery of recombinant viruses, expression of CD4 epitopes on the cell surface was verified by indirect immunofluorescence of infected cells for each recombinant (data not shown). We next determined the protein expression level in BHK cells infected with each recombinant. We infected BHK cells at a multiplicity of 20 for 4 h and labeled with [35S]methionine for 1 h. Because

FIG. 1. Schematic diagram of VSV G protein and the other membrane proteins expressed from recombinant VSVs. VSV G, CD4, CD4 with the VSV G transmembrane domain and cytoplasmic tail, measles H protein, and measles F1 and F2 proteins are illustrated. The left side of the diagram represents the cytoplasmic side of the plasma membrane. Sites of N-linked glycan addition are indicated by ` .

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

FOREIGN GLYCOPROTEINS EXPRESSED FROM RECOMBINANT VESICULAR STOMATITIS VIRUSES ARE INCORPORATED EFFICIENTLY INTO VIRUS PARTICLES

11361

VSV shuts down host cell protein synthesis, the viral and additional encoded proteins can be visualized without immunoprecipitation. The results in Fig. 2A show, that in addition to the VSV N, P, M, G, and L proteins, new proteins of the size expected for CD4 and CD4G were seen. Quantitation of protein expression (correcting for methionine content) showed that CD4, and CD4G were expressed at about 25–30% of the level of VSV G protein. The identities of the CD4 and CD4G proteins were confirmed by immunoprecipitation with antibodies directed against CD4 or against the VSV G tail. The CD4-specific antibody immunoprecipitated both the CD4 and CD4G proteins (Fig. 2B, lanes 1 and 2). The faster migrating CD4G band results from the shorter VSV G tail of 29 amino acids compared with the CD4 tail of 38 amino acids. The presence of the G tail in the CD4G construct was also confirmed with VSV G tail-specific antibody that immunoprecipitated the CD4G protein in addition to VSV G protein (Fig. 2B, lane 4), but not the CD4 protein (lane 3). Both CD4 and CD4G are Incorporated at High Levels into VSV Particles. To determine if the CD4 and CD4G proteins were incorporated into VSV particles, we labeled infected cells with [35S]methionine, purified labeled VSV by sedimentation through 10% sucrose and then examined the proteins present by SDS/PAGE. The results in Fig. 2C show that both the CD4 and CD4G proteins were present in the purified virions. Quantitation using the PhosphorImager (correcting for the lower methionine content in CD4 and CD4G) showed that both CD4 and CD4G were present in virions at a level of 23–25% of VSV G. Therefore, the level of protein incorporation appears to correspond roughly to the level of synthesis relative to VSV G protein and no specific signals are required at least for coincorporation of CD4 into virions with VSV G protein. Quantitation from several experiments indicated that the ratios of G to N proteins in the CD4 or CD4G viruses were not decreased and in fact were slightly increased when compared with wt virus. Thus it appears that CD4 or CD4G proteins are not displacing G but might rather be filling in free space between the VSV G trimers. This quantitation was also verified using virus purified by rate zonal sedimentation (data not shown). Electron Microscopy Shows CD4 and CD4G Distributed Over the Virion Surface. Although biochemical analysis of purified virions showed incorporation of CD4 and CD4G into VSV, it was unclear if every particle contained the foreign protein or if there were changes to the structure of VSV virions as a result of the inclusion of an additional gene and protein. To address these questions directly, purified wt VSV, VSV-CD4, and VSV-CD4G virions were examined by electron microscopy using Immunogold-coupled antibodies and negative stain (Fig. 3). A and B show wt VSV stained with anti-G antibodies and anti-CD4 antibodies respectively. The anti-G antibodies are clearly reacting with the virion surface while the anti-CD4 antibodies do not. B and C show the VSV-CD4 virus reacting with the anti-G or the anti-CD4 antibodies, and E and F show the same for the VSV-CD4G virus. These results confirm the incorporation of CD4 and CD4G into the virion membrane. In addition, CD4 and CD4G appeared to be present in all particles and in an even distribution over the virion surface. These results indicate that CD4 is inserted among the VSV G trimers and is not present in a subset of particles or clustered at one site on the virion. VSV Recombinants are Longer. The length of the bullet-shaped VSV particles is known to be determined by the length of the helical nucleocapsid containing the RNA, since the shorter RNA genomes of defective interfering particles are packaged into truncated particles (15). As can be seen in Fig. 3, VSV-CD4 or VSV-CD4G virions were longer then wt VSV. In Fig. 4 the lengths of VSV and VSV-CD4 particles are compared using particles that have been aligned. VSV virions were found to be a uniform 170 nm long, while the VSV-CD4 virions were 200 nm long. This 18% increase in length corresponds reasonably well to the increase in genome size for the VSV-CD4 construct that has an insert of 1,800 nucleotides added to a genome that was originally 11,161 nucleotides.

FIG. 2. Expression of CD4 and CD4G from recombinant VSVs and their incorporation into VSV virions. (A) Cells infected with VSV wt, VSV-CD4, or VSV-CD4G were labeled with [35S]methionine and cell lysates were fractionated directly by SDS/PAGE. Positions of the VSV proteins, CD4 and CD4G are indicated. (B) SDS/PAGE of immunoprecipitates of cell lysates prepared with antibodies directed against the extracellular domain of CD4 protein (lanes 1 and 2) or the VSV G protein cytoplasmic domain (lanes 3 and 4). (C) SDS/PAGE of purified virions labeled with [35S]methionine. Images of labeled proteins were generated by a PhosphorImager (Molecular Dynamics).

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

FOREIGN GLYCOPROTEINS EXPRESSED FROM RECOMBINANT VESICULAR STOMATITIS VIRUSES ARE INCORPORATED EFFICIENTLY INTO VIRUS PARTICLES

11362

FIG. 3. Electron microscopy of Immunogold-labeled recombinant VSVs. Purified wt VSV (A and B), VSV-CD4 (C and D), or VSV-CD4G (E and F) particles were negative stained after labeling with a mAb directed against VSV G (A, C, and E) or CD4 (B, D, and F) followed by gold-labeled goat anti-mouse IgG particles. The bar represents 100 nm. Reduced Titers and Virus Quantities of Recombinants Expressing CD4 Proteins. Titers of recombinant VSVs expressing CD4 or CD4G proteins were typically lower than wt titers by at least one log, while VSV-chloramphenicol acetyl transferase viruses grew to normal wt titers (1). To analyze the replication cycle of the recombinant CD4 and CD4G viruses more carefully, a one step growth curve was performed. BHK cells were infected simultaneously at a multiplicity of 20 to allow synchronous infection of all cells. After removing unadsorbed virus, virus growth was monitored by plaque assay (Fig. 5). Both recombinant viruses replicated at a rate similar to wt VSV, but in both cases the final titer was reduced ten-fold or more compared with wt. The total yield of virus protein from the same number of infected cells was lower by about a factor of three for the recombinants. The even greater reduction in titer suggested that particles released had a lower specific infectivity than wt virus. The cloning strategy used to generate VSV-CD4G left an extra transcription termination signal UAUGAAAAAAA (16, 17) preceding the normal transcription stop-start signal just before L. If this upstream signal were used it might cause extensive termination without reinitiation and result in a strong inhibition of L protein expression. This could explain the slower growth of the CD4G virus compared with the CD4 virus as well as the reduced expression of L protein (Fig. 2A, lane 3). Expression of Measles Virus Glycoproteins in VSV Recombinants. Because the cellular CD4 protein was incorporated well into VSV virions, we then wished to determine if glycoproteins from another virus could also be expressed in VSV recombinants and incorporated into the VSV viral envelope. For these experiments we chose measles virus, a negative strand RNA virus from the distantly related paramyxovirus group. Measles virus encodes two glycoproteins, H and F, that

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

FOREIGN GLYCOPROTEINS EXPRESSED FROM RECOMBINANT VESICULAR STOMATITIS VIRUSES ARE INCORPORATED EFFICIENTLY INTO VIRUS PARTICLES

11363

are expressed from separate mRNAs and have molecular weights different from any VSV proteins permitting quantitation without immunoprecipitation. The H protein is a type II membrane protein (N terminus is cytoplasmic) with an apparent molecular mass of 80 kDa while the F protein is a type I protein that is cleaved from a precursor of 61 kDa to F1 and F2 proteins of 41 and 20 kDa. Stick diagrams of the proteins are shown in Fig. 1.

FIG. 4. Size comparison of VSV wt and VSV-CD4 particles. Images of VSV or VSV-CD4 particles were excised from electron micrographs and displayed so that the sizes could be compared directly. Lengths including the surface spikes are shown by the bars. VSV recombinants expressing measles H and F proteins were generated with the same starting vector used for the CD4 and CD4G proteins. The VSV recombinant expressing measles H protein (VSV-MH) was recovered easily and grew to wt VSV titers, while the VSV expressing F protein (VSV-MF) grew slowly and to much lower titers. We do not have an explanation for the slow growth of this recombinant, but several independent isolates showed the same phenotype of slow growth suggesting that it was due to the F gene and not to some secondary mutation picked up in the recovery.

FIG. 5. One step growth curve of recombinant VSV. BHK cells were infected (multiplicity of infection=20) for 30 min with VSV wt, VSV-CD4 or VSV-CD4G and unabsorbed virus was removed by washing the cells twice with PBS. Complete medium was added and samples were collected at the indicated times postinfection. Virus titers were determined by plaque assays on BHK cells. Expression of the measles proteins by VSV-MH and VSV-MF was analyzed by infecting BHK cells with recombinants and labeling with [35S]methionine. As shown in Fig. 6, the VSV-MH virus generated a new protein band at 80 kDa and the VSV-MF virus encoded a new protein of about 41 kDa running just ahead of the VSV N protein (45 kDa). The H protein was synthesized at a level of 62% of G while the F1 protein was synthesized at a level of 46% of G (after correcting for methionine content). The identity of these proteins was verified by immunoprecipitation with antibodies specific for measles F and H proteins and with markers of measles proteins generated from HeLa cells infected with measles virus. Expression of both proteins on the cell surface was also verified by indirect immunofluorescence microscopy (data not shown). The F2 protein is typically a diffuse band of 18–20 kDa and was not visible on this gel. We also determined that both F and H proteins were found in purified virions (Fig. 6, lanes 1 and 2), with H present at level of 31% of G while F1 was present at 6% the level of G. The fact that the measles F protein was found in lower amounts in the virions compared with the other proteins may be explained by previous results showing that only a small fraction of F protein reaches the cell surface (8). Therefore the majority would not be available for inclusion in budding VSV virions.

DISCUSSION Incorporation of one or more foreign glycoproteins into the envelope of a virus may potentially be useful for targeting viruses to specific cells and for the development of a new generation of vaccines. We have reported here that both viral and nonviral proteins can be incorporated at high levels along with the VSV glycoprotein into the envelope of VSV. This high level incorporation is achieved by expressing the foreign proteins from genes inserted directly into the VSV genome,

FIG. 6. Expression of measles virus glycoproteins from VSV recombinants and their incorporation into VSV particles. Lysates from [35S]methionine-labeled cells infected with VSV-MF (lane 3), or VSV-MH (lane 4) analyzed by SDS/PAGE. [35S]Methionine-labeled virions from VSV-MF (lane 1) or VSV-MH (lane 2) infected cells analyzed by SDS/PAGE. Positions of the VSV proteins, and measles F1 and H proteins are indicated. Images of labeled proteins were generated by a PhosphorImager (Molecular Dynamics).

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

FOREIGN GLYCOPROTEINS EXPRESSED FROM RECOMBINANT VESICULAR STOMATITIS VIRUSES ARE INCORPORATED EFFICIENTLY INTO VIRUS PARTICLES

11364

and does not require the presence of specific signals on the foreign proteins. It is important to discuss these results in the context of the extensive literature on rhabdovirus assembly. The budding of VSV particles at the plasma membrane involves an interaction of the helical nucleocapsid containing the genome, the matrix protein, and the membrane-spanning glycoprotein. The matrix protein is able to bind to the plasma membrane independently (18, 19), can cause vesiculation of the plasma membrane (20), and may serve as a bridge between the cytoplasmic tail of the glycoprotein and the helical nucleocapsid. A temperature-sensitive mutant of the VSV glycoprotein is still able to bud particles lacking the G protein, but at a 10–20-fold reduced efficiency (21, 22), while temperature-sensitive mutations in the matrix protein block budding completely (21). A recombinant rabies virus (also in the rhabdovirus family) lacking the glycoprotein gene, buds bullet-shaped particles completely lacking G protein, but at a 30-fold reduced level (23). These results suggest that cooperative interactions of nucleocapsid, matrix, and glycoprotein are required to promote efficient rhabdovirus budding. Deletions of the cytoplasmic tail of the VSV G protein (6) or in the rabies G protein tail (23) reduce the efficiency of glycoprotein incorporation into the virus particle suggesting an important interaction occurring through the glycoprotein tail, presumably with the matrix protein. The results presented here illustrate that VSV particles can incorporate several unrelated foreign membrane proteins into the viral envelope at levels up to 30% of G protein itself. In no case did incorporation of the foreign protein reduce the level of VSV G relative to nucleocapsid or matrix proteins, suggesting that there is extra space in the envelope for incorporation of the foreign proteins. In the case of CD4, electron microscopy showed that the foreign proteins are dispersed among the VSV spikes. Because both cellular and foreign viral proteins with unrelated sequences are incorporated into the VSV envelope, there cannot be specific signals involved in assembly of these foreign proteins into the VSV membrane. In fact, substitution of the CD4 transmembrane and cytoplasmic domains with those from VSV G did not increase the level of CD4 incorporation into the VSV particle. We therefore favor a model in which many proteins on the cell surface can be passively trapped in the budding VSV particle. Early studies showed that many cellular plasma membrane proteins are found at low levels in VSV particles, while others are excluded (24). Also the generation of VSV pseudotypes carrying foreign envelope proteins shows that some foreign proteins can be incorporated into the viral membrane (3). In our studies, the foreign proteins are being expressed at extremely high levels from the VSV genome and their high level of incorporation into particles is presumably the result of their presence at high concentrations on the plasma membrane. The recombinant expressing the measles F protein deserves special comment because this virus grew slowly (maximal titers of 107/ml) and lost expression of the F protein after only three passages. We have not seen loss of foreign gene expression with the other VSV recombinants even after much more extensive passaging. With the VSV-MF recombinant there is apparently a strong selective pressure to eliminate the F protein expression, presumably because the protein interferes with some aspect of VSV replication. Mutations that eliminate F expression are apparently selected rapidly. Plasma membrane proteins that are not incorporated into VSV particles are presumably excluded from regions of virus budding because of steric constraints such as large cytoplasmic domains, association with large cytoplasmic proteins, or association with domains enriched in specific lipids. Earlier results from our laboratory showed that the HIV envelope protein was largely excluded from budding VSV particles (5). Only an HIV envelope protein carrying the VSV G cytoplasmic domain was incorporated efficiently suggesting that the G domain was able to provide a specific assembly signal. We have confirmed and extended that result using a recombinant VSVs expressing the HIV envelope or an HIV envelope G chimeric protein from an extra gene (E.J. and J.K.R., unpublished results). Although many foreign proteins can likely be incorporated into VSV particles, it is also likely that a significant amount of VSV G protein is required to promote particle formation efficiently. As a result, the amount of space available for foreign proteins may be limited. Preliminary results attempting to increase the level of CD4 incorporation using a new VSV vector in which CD4 is expressed at higher levels than VSV G have not resulted in increased CD4 incorporation into particles. In a study related to ours, it was reported that CD4 could be incorporated into avian leukosis virus particles at relatively high levels (25), although in that study it was found that CD4 bearing the cytoplasmic domain of the avian leukosis virus envelope proteins was not incorporated as well as CD4, apparently because of competition with the avian leukosis virus envelope protein itself (25). One important remaining question is whether foreign proteins can ever completely substitute for VSV G in assembly. An earlier study on VSV (murine leukemia virus) pseudotype formation employing a temperature sensitive VSV G mutant concluded that this would not be possible because some VSV G protein appeared to be required to nucleate VSV assembly (26). However, results showing incorporation of the HIV-G chimeric protein into virions lacking VSV G suggest that this may be possible if the appropriate signals are appended to the proteins to be incorporated (5). M.J.S. received support from an AIDS Infektionsforschungs fellowship from the Deutsches Krebsforschungszentrum. This work was also supported by National Institutes of Health Grant R37AI24345 to J.K.R. 1. Wagner, R.R. & Rose, J.K. (1996) in Rhabdoviridae: The Viruses and Their Replication, eds. Fields, B.N. & Knipe, D.M. (Lippincott-Raven, New York), Vol. 1, pp. 1121–1136. 2. Schnell, M.J., Buonocore, L., Whitt, M.A. & Rose, J.K. (1996) J. Virol. 70, 2318–2323. 3. Závada, J. (1982) J. Gen. Virol. 63, 15–24. 4. Schubert, M., Joshi, B., Blondel, D. & Harmison, G.G. (1992) J. Virol. 66, 1579–1589. 5. Owens, R.J. & Rose, J.K. (1993) J. Virol. 67, 360–365. 6. Whitt, M.A., Chong, L. & Rose, J.K. (1989) J. Virol. 63, 3569–3578. 7. Shaw, A.S., Amrein, K.E., Hammond, C., Stern, D.F., Sefton, B.M. & Rose, J.K. (1989) Cell 59, 627–636. 8. Cattaneo, R. & Rose, J.K. (1993) J. Virol. 67, 1493–1502. 9. Fuerst, T.R., Niles, E.G., Studier, F.W. & Moss, B. (1986) Proc. Natl. Acad. Sci. USA 83, 8122–8126. 10. Rose, J.K., Buonocore, L. & Whitt, M.A. (1991) BioTechniques 10, 520–525. 11. Lefrancois, L. & Lyles, D.S. (1982) Virology 121, 168–174. 12. Reinherz, E.L., Kung, P.C., Goldstein, G. & Schlossman, S.F. (1979) Proc. Natl. Acad. Sci. USA 76, 4061–4065. 13. Guan, J.L., Cao, H. & Rose, J.K. (1988) J. Biol. Chem. 263, 5306–5313. 14. Maddon, P.J., Dalgleish, A.G., McDougal, J.S., Clapham, P.R., Weiss, R.A. & Axel, R. (1986) Cell 47, 333–348. 15. Holland, J.J. (1990) in Defective Viral Genomes, eds. Fields, B.N. & Knipe, D.M. (Raven, New York), Vol. 1, pp. 151–166. 16. Rose, J.K. (1980) Cell 19, 415–421. 17. Rose, J.K. & Schubert, M. (1987) in Rhabdovirus Genomes and Their Products, ed. Wagner, R.R. (Plenum, New York), pp. 129–166. 18. Chong, L.D. & Rose, J.K. (1993) J. Virol. 67, 407–414.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

FOREIGN GLYCOPROTEINS EXPRESSED FROM RECOMBINANT VESICULAR STOMATITIS VIRUSES ARE INCORPORATED EFFICIENTLY INTO VIRUS PARTICLES

19. Chong, L.D. & Rose, J.K. (1994) J. Virol. 68, 441–447. 20. Justice, P.A., Sun, W., Li, Y., Ye, Z., Grigera, P.R. & Wagner, R.R. (1995) J. Virol. 69, 3156–3160. 21. Knipe, D.M., Baltimore, D. & Lodish, H.F. (1977) J. Virol. 21, 1149–1158. 22. Schnitzer, T.J. & Lodish, H.F. (1979) J. Virol. 29, 443–447. 23. Mebatsion, T., Konig, M. & Conzelmann, K.K. (1996) Cell 84, 941–951. 24. Lodish, H.F. & Porter, M. (1980) Cell 19, 161–169. 25. Young, J.A., Bates, P., Willert, K. & Varmus, H.E. (1990) Science 250, 1421–1423. 26. Witte, O.N. & Baltimore, D. (1977) Cell 11, 505–511.

11365

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

SPECIFIC INFECTION OF CD4+ TARGET CELLS BY RECOMBINANT RABIES VIRUS PSEUDOTYPES CARRYING THE HIV-1 ENVELOPE SPIKE PROTEIN

11366

This paper was presented at a colloquium entitled “Genetic Engineering of Viruses and Virus Vectors,” organized by Bernard Roizman and Peter Palese (Co-chairs), held June 9–11, 1996, at the National Academy of Sciences in Irvine, CA.

Specific infection of CD4+ target cells by recombinant rabies virus pseudotypes carrying the HIV-1 envelope spike protein TESHOME MEBATSION AND KARL-KLAUS CONZELMANN * Department of Clinical Virology, Federal Research Centre for Virus Diseases of Animals, Paul-Ehrlich-Strasse 28, D-72076 Tübingen, Germany ABSTRACT A recombinant rabies virus (RV) mutant deficient for the surface spike glycoprotein (G) gene was used to study the incorporation of envelope proteins from HIV-1 expressed from transfected plasmids. A hybrid HIV-1 protein in which the cytoplasmic domain was replaced with that of RV G was incorporated into the virus envelope and rescued the infectivity of the RV mutant. The RV (HIV-1) pseudotype viruses could infect only CD4+ cells, and their infectivity was neutralized specifically by anti-HIV-1 sera. In contrast to the chimeric protein, wild-type HIV-1 envelope protein or mutants with truncated cytoplasmic domains failed to produce pseudotyped particles. This indicates the presence of a specific signal in the RV G cytoplasmic domain, allowing correct incorporation of a spike protein into the envelope of rhabdovirus particles. The possibility of directing the cell tropism of RV by replacement of the RV G with proteins of defined receptor specificity should prove useful for future development of targetable gene delivery vectors. The host range of viruses is determined primarily by the interaction of viral envelope glycoproteins with specific proteins on the host cell surface that act as receptors. This interaction is very often species-specific and, in some cases, even tissue-specific. As a result, some viruses, like retroviruses, have a quite limited host range, whereas others, such as rhabdoviruses, can infect a variety of cell types including in many cases cells of human, animal, and insect origin. Developing means for redefining the receptor specificity of viral particles would have numerous applications in basic research and clinical application. On the one hand, this might allow better infection of cells of therapeutic interest that are poorly amenable to retrovirus infection, such as hepatocytes or early hematopoietic progenitors. On the other hand, this would also allow targeting of specific cell types in complex cell populations. In the in vivo situation, the availability of targeting methods should, for example, permit the development of new gene therapy models. Alteration of the tropism of viruses by incorporation of a foreign envelope protein, however, is hampered in most virus systems by the fact that the presence of the viral spike protein(s) is required also to drive the viral assembly and budding process (for review, see ref. 1). Retroviruses represent one example where this does not apply (2, 3). In the past, retroviral vectors deficient for the spike glycoprotein gene (env) have been used to generate pseudotype viruses carrying foreign proteins in their envelopes, predominantly the vesicular stomatitis rhabdovirus (VSV) G protein. As expected, the pseudotype viruses exhibit the expanded host range of the foreign glycoprotein (4–6). Since incorporation of the heterologous spike proteins is apparently nonspecific, low titers of infectious pseudotype viruses are usually obtained, representing the major drawback in clinical application. Another group of viruses that are able to bud in the absence of their viral spike glycoprotein are the rhabdoviruses (7) which include VSV and rabies virus (RV). Rhabdoviruses have a single negative strand RNA genome of 11,000–12,000 nt and replicate in the cytoplasm (8). Virus assembly and budding takes place at the cell membrane where the viral ribonucleoprotein complex is enwrapped into an envelope containing an internal matrix protein and the single transmembrane spike glycoprotein (G) (9). By applying a system that allows genetic engineering of RV (10, 11), we could recently recover a recombinant RV mutant deficient for the G gene and demonstrate that, in the absence of G protein, bulletshaped spikeless rhabdovirus particles are released from the infected cells (7). In the same study, we could also confirm that, similar to VSV G (12) and in contrast to retroviruses (13), the cytoplasmic domain of the RV G protein contributes considerably to sorting and incorporation of the protein into the viral envelope. Moreover, previous studies confined to a temperature-sensitive G protein mutant of VSV (tsO45) have indicated that the cytoplasmic domain of VSV G protein is sufficient for directing a foreign protein, the HIV-1Env, into VSV (14). In the present study, we exploited the G deficiency of a recombinant RV mutant to confirm that the RV G cytoplasmic tail provides a signal allowing specific incorporation of HIV-1 Env, expressed from transfected plasmids, into the envelope of virus particles and to verify that no residual G protein is required to initiate rhabdovirus pseudotype formation. The generated RV(HIV) pseudotype particles possess the tropism of HIV-1 in that they can infect HeLa cells expressing the major HIV receptor CD4, but not CD4− HeLa cells. The transient Gdeficient RV mutant system provides a versatile and safe tool to rapidly analyze incorporation and function of a wide range of surface protein constructs. Moreover, since foreign genes in RV and VSV genomes are highly stable (15, 16), recombinant rhabdoviruses represent promising candidates for future development of targetable, nonintegrative viral vectors for delivery of therapeutic or protective genes.

MATERIALS AND METHODS Cells, Viruses, cDNA, and Antibodies. The following reagents were obtained through the AIDS Research and Reference Reagent Program (National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda). HeLa CD4+ and HeLa CD8+ cells were from Richard Axel (17), and human anti-HIV-1 immune globulin was from Alfred Prince (18, 19). The recombinant vaccinia virus vTF73, ex

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact. Abbreviations: RV, rabies virus; SAD, Street-Alabama-Dufferin strain of RV; VSV, vesicular stomatitis virus; G, glycoprotein. *To whom reprint requests should be addressed, e-mail: klaus. [email protected].

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

SPECIFIC INFECTION OF CD4+ TARGET CELLS BY RECOMBINANT RABIES VIRUS PSEUDOTYPES CARRYING THE HIV-1 ENVELOPE SPIKE PROTEIN

11367

pressing T7 RNA polymerase (20), was kindly provided by T. Fuerst and B.Moss, and the HIV-1 (NL-43) gp160 cDNA was from W.Garten and H.-D.Klenk (Institute of Virology, University of Marburg, Germany). The G-deficient Street-Alabama-Dufferin RV mutant, SAD ∆G, was recovered and propagated after deletion of the entire G protein coding region from a full-length RV cDNA in cells expressing RV G from a transfected plasmid in the vaccinia/T7 polymerase system (7). Construction of Expression Plasmids. An expression plasmid encoding wild-type HIV-1 Env (pEnv) was generated by insertion of the BbsI-XhoI-Klenow fragment spanning the entire gp160 coding region from the HIV NL-43 cDNA in the EcoRV site of pT7T (21). To replace the HIV cytoplasmic domain, an HpaI site (underlined) was introduced by PCR using a primer (5
GCTCTAGACTAGTTAACTATAGAAAGTACAGC-3
) overlapping the transmembrane/ cytoplasmic domain-encoding region and a second primer (5
-AACAATTACACAAGCTTAAT-3
) spanning an upstream unique HindIII site (underlined) of the Env cDNA. An HpaI site was also introduced by PCR (5
-AAGTCGACCGTTAACAGAAGAGTCAATCGATCA-3
) upstream of the pT7T-G sequence encoding the RV SAD B19 G cytoplasmic tail. After ligation of the HIV-derived HindIII-HpaI fragment and the G-derived HpaI-PstI fragment, the construct was used to replace the sequence downstream of HindIII in pEnv to yield pEnv-RVG. The removal of an HpaI fragment of pEnv resulted in pEnv-∆107; the encoded protein possessed a deletion of 107 amino acids adjacent to the transmembrane domain (see Fig. 1). The Env construct possessing a carboxyl-terminal truncation (pEnv-44) was generated by introduction of a translational stop codon (complementary sequence underlined) into the cytoplasmic tail-encoding sequence of pHIV-Env by PCR mutagenesis using a primer with the sequence 5
ACGAATTCATTAGTTCACTAATCGAATG-3
. Expression of Envelope Proteins. BSR cells were first infected with vTF7–3 at a multiplicity of infection of 5. After 1 hr of infection, cells were transfected with CsCl-purified plasmids by using the Stratagene mammalian transfection kit as described (21). To adjust the level of cell surface expression, various concentrations of plasmid DNA were used for transfection (see below). After incubation for 16 hr, cells were fixed with 4% paraformaldehyde and incubated at 4°C for 30 min with human anti-HIV-1 IgG (1:500 dilution) or a monoclonal antibody directed against RV G protein (diluted 1:100). Cells were stained with fluorescein isothiocyanate-conjugated goat anti-human IgG or goat antimouse IgG (Dianova, Hamburg, Germany). For double staining, rhodamine-conjugated goat anti-mouse IgG (Dianova) was used in combination with fluorescein isothiocyanate-conjugated goat anti-human IgG. Complementation of SAD ∆G with Envelope Proteins. BSR cells were infected at a multiplicity of infection of 1 with SAD ∆G phenotypically complemented with RV G protein and were then superinfected with vTF7–3. Plasmids encoding the spike proteins, pT7T-G, pEnv, pEnv-∆107, pEnv-44, and pEnv-RVG (1, 7.5, 5, 3, and 3 µg, respectively) were then transfected as described above. After incubation at 37°C for 24 hr, cell culture media were harvested and cleared of cell debris. To determine the infectious titers of pseudotype viruses, supernatants were serially diluted and used for inoculation of confluent monolayers of CD4+ or CD8+ HeLa cells. After 24 hr of infection cells were fixed with 80% acetone and expression of RV nucleoprotein was examined by direct immunofluorescence after staining with an fluorescein isothiocyanateconjugate directed against RV nucleoprotein (Centocor). Sucrose Gradients and Western Blotting. Supernatants from complementation experiments (approximately 6×106 cells) were harvested 24 hr after transfection, and virions were pelleted through a 10% sucrose cushion at 19,000 rpm in a Beckman SW 41 rotor. Pellets were resuspended in TEN buffer (10 mM Tris, pH 7.4/50 mM NaCl/1 mM EDTA), layered on continuous 10–50% sucrose gradients, and centrifuged at 27,000 rpm in an SW 41 rotor for 1 hr. Virus proteins from 12 equal gradient fractions were resolved by SDS/PAGE and transferred to nitrocellulose membranes using a semidry transfer apparatus (Hoefer). After incubation with a blocking solution (2.5% dry milk/0.05% Tween 20 in PBS), the blot was incubated overnight with a mixture of human HIV-1 IgG (1:10,000) and rabbit sera raised against purified RV G protein (S72, 1:20,000), RV ribonucleoprotein complex (S50, 1:20,000) or a peptide deduced from the the RV matrix protein sequence (M1–B4, 1:10,000) in PBST. After three successive washes in PBST, the blot was incubated for 2 hr with a mixture of peroxidaseconjugated goat anti-human and goat anti-rabbit IgG (Dianova) diluted 1:10,000 in PBST. The blot was washed as above, stained with an Enhanced Chemiluminescence Western blot detection kit (Amersham) for 1 min, and exposed to x-ray films (Biomax MR, Kodak).

RESULTS The HIV-1 env protein is synthesized as a precursor (gp160) that is cleaved during transport to the plasma membrane into two noncovalently associated subunits, gp120, which is involved in binding to the HIV receptor, and gp41, which contains the membrane anchor and a carboxyl-terminal cytoplasmic domain of 150 amino acids (22, 23). To determine the influence of both sequence and length of the cytoplasmic domain on formation of RV(HIV) pseudotypes, various cDNA constructs resulting in altered cytoplasmic domains were prepared in the expression plasmid pT7T (21), which is under the control of the T7 RNA polymerase promoter. Starting from a plasmid encoding the authentic HIV-1 NL-43 Env protein (pEnv), we prepared a construct that encodes a protein in which the entire Env cytoplasmic domain is replaced by the 44 amino acid cytoplasmic domain of RV G (EnvRVG). To investigate whether the considerable length of the HIV Env cytoplasmic domain may affect incorporation into RV particles, two other plasmids encoding proteins with short Env cytoplasmic domains, similar in length to that of RV G, were constructed. Env-44 represented a protein with a carboxyl-terminally truncated cytoplasmic domain, whereas in pEnv-∆107 an internal deletion removed the membrane-proximal 107 amino acids and fused the carboxyl-terminal 43 residues to the membrane anchor domain (Fig. 1). Transient Expression of Glycoproteins. To analyze expression of the recombinant glycoproteins on the cell surface, which represents a prerequisite for incorporation into RV particles, plasmids were transfected into BSR cells that had been infected with the recombinant vaccinia virus vTF7–3 providing T7 RNA polymerase (20). Surface expression was compared by indirect immunofluorescence with human anti-HIV IgG (18) after transfection of equal amounts of protein-encoding plasmids. Interestingly, compared with the authentic HIV-Env, the level of cell surface expression was higher for all Env constructs with modified cytoplasmic domains (data not shown). To obtain similar levels of expression, the amounts of the plasmids in transfection experiments were therefore adjusted. After transfection of 7.5 µg pT7T-Env and of 5, 3, and 3 µg of pEnv-∆107, pEnv-44, and pEnv-RVG, respectively, surface fluorescence intensity and the number of expressing cells were similar. Representative micrographs are shown in Fig. 2. By double labeling cells expressing both RV G and each of the plasmids encoding an Env protein, no differences in the distribution of proteins on the cell surface were observed (data not shown). We next determined whether the introduced mutations affected the function of the HIV envelope proteins in attachment to the HIV receptor and induction of membrane fusion. The adjusted amounts of plasmids were transfected into HeLa

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

SPECIFIC INFECTION OF CD4+ TARGET CELLS BY RECOMBINANT RABIES VIRUS PSEUDOTYPES CARRYING THE HIV-1 ENVELOPE SPIKE PROTEIN

11368

cells constitutively expressing the major HIV receptor, CD4 (CD4+ HeLa, ref. 17), and that had been infected with vTF7–3. At 14 hr after transfection, each mutant caused formation of syncytia equivalent to that produced by the HIV-Env protein (Fig. 3). In addition, analysis of 35Slabeled proteins from cell extracts and media had revealed correct proteolytic cleavage of mutant precursors to generate gp120 (data not shown). Taken together, these results indicated correct transport to the cell surface, proteolytic processing, and fusogenicity of the mutants.

FIG. 1. Organization of wild-type and hybrid envelope proteins. The amino acid sequence of part of the transmembrane domains (underlined) and of the entire cytoplasmic domains of mutants and wild-type proteins are shown. Rescue of SAD ∆G by Engineered Env Protein Mutants. The construction and recovery of a G-deficient RV mutant lacking the entire G gene (SAD ∆G) were described previously (7). Stocks of phenotypically complemented SAD ∆G were produced in BSR cells expressing RV G from transfected pT7T-G. Upon inoculation of noncomplementing BSR cell cultures, infection was restricted to the cells initially infected by the G-complemented particles and was not able to spread through the monolayers. The supernatants obtained from such cultures contained spikeless rhabdovirus particles that could not infect fresh BSR cells (7). As for BSR cells, infection of HeLa cells was found to require the presence of the viral spike protein. To determine whether any of the mutant Env proteins could rescue the infectivity of SAD ∆G, BSR cells were infected with both Gcomplemented SAD ∆G and vTF7–3 and were then transfected with plasmids encoding wild-type or hybrid Env proteins or, as a control, were transfected with RV G. After incubation for 24 hr, the supernatants were collected and the infectivity of virus particles was determined on HeLa CD4+ and HeLa CD8+ cells by direct immunofluorescence. RV G protein rescued the infectivity of SAD ∆G for both cell lines, regardless of the presence of CD4 at the cell surface (Fig. 4 A and B). In addition, rescue was observed in one of the four Env protein constructs, Env-RVG, which is the Env protein possessing the cytoplasmic tail of RV G. In contrast to RV G, however, particles complemented with Env-RVG could only infect CD4+ HeLa cells (Fig. 4 E and F) and their infectivity could be specifically neutralized by anti-HIV-1 serum (data not shown). This indicates that infection is mediated by the hybrid Env protein. Compared with RV G, the infectious titers obtained with Env-RVG were in average 25 times lower (Table 1). No fluorescent cells were observed after complementation of SAD ∆G with the wild-type Env or the constructs possessing the short gp41 cytoplasmic tails, indicating that the presence of defined sequences of the RV G tail is required for specific incorporation into the viral envelope.

FIG. 2. Surface expression of envelope protein constructs. Cells were infected with vTF7–3 and transfected with plasmids encoding Env (A), Env-∆107 (B), Env-44 (C), Env-RVG (D), or RV G (E) (7.5, 5, 3, 3, and 1 µg, respectively). (F) Mock-transfected cells. Sixteen hours after transfection, cells were processed for indirect immunofluorescence as described. FIG. 3. Fusion activity of envelope protein constructs. CD4+ HeLa cells were infected with vTF7–3 and transfected with pEnv (A), pEnv∆107 (B), pEnv-44 (C), pEnv-RVG (D), and pT7T-G (E) by using the amounts of plasmids determined to yield similar surface expression of proteins (see Fig. 2). (F) Mock-transfected cells. Syncytium formation is shown after an incubation of 14 hr at 37°C. Protein Composition of RV(HIV) Pseudotype Viruses. To verify the incorporation of the Env-RVG protein into the envelope of SAD ∆G particles, virions were purified by velocity centrifugation in continuous 10–50% sucrose gradients. The protein composition of gradient fractions was analyzed by Western blotting with a combination of sera directed against

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

SPECIFIC INFECTION OF CD4+ TARGET CELLS BY RECOMBINANT RABIES VIRUS PSEUDOTYPES CARRYING THE HIV-1 ENVELOPE SPIKE PROTEIN

11369

RV proteins and anti-HIV IgG. Both the peak of infectivity and the majority of virus proteins were found in fractions 6 and 7 for particles pseudotyped with RV G or Env-RVG (Fig. 5). In addition to RV nucleoprotein, phosphoprotein, and matrix protein, RV(Env-RVG) pseudotype particles contained a protein reacting with the anti-HIV serum and migrating at 37 kDa. This corresponds well to the size predicted for the hybrid subunit composed of the HIV gp41 extracellular and transmembrane domains fused to the RV G cytoplasmic tail. In addition, a faint band of high molecular weight, which should correspond to the gp120 subunit, was identified. Since shedding of the gp120 subunit from virus particles during sucrose gradient centrifugation is apparently notorious (24), this finding was not unexpected. In contrast to Env-RVG, which was the only construct able to rescue infectivity of SAD ∆G, no HIV-related proteins could be detected in virions generated in the presence of the wild-type or the other mutant Env proteins (data not shown). Taken together, these results confirmed true incorporation of the hybrid EnvRVG protein and revealed the requirement of the RV G cytoplasmic tail to promote this process.

FIG. 4. Rescue of the infectivity of SAD ∆G by engineered Env proteins. BSR cells were infected with G-complemented SAD ∆G and vTF7–3 and transfected with Env protein-coding plasmids. At 24 hr after transfection, supernatants were used to inoculate monolayers of CD4+ and CD8+ HeLa cells. Cells were then fixed after 24 hr of incubation and examined by direct immunofluorescence with a conjugate directed against RV nucleoprotein. (A and B) RV G. (C and D) HIV-Env. (E and F) Env-RVG. For A and B, 100 µl and for C-F 1 ml of the respective supernatant from 106 transfected BSR cells was used for inoculation. FIG. 5. Protein composition of pseudotype particles. SAD ∆G particles phenotypically complemented with RV G protein or EnvRVG were analyzed by velocity centrifugation in 10–50% sucrose gradients and Western blotting. Infectivity and the majority of virus proteins are located in gradient fractions 6 and 7. In addition to the RV nucleoprotein (N), phosphoprotein (P), and matrix protein (M), RV(HIV) pseudotype viruses contain a gp41-derived chimeric transmembrane subunit protein of 37 kDa (“gp41”) and the gp120 subunit.

Table 1. Rescue of SAD G by recombinant spike proteins Titers of infectious pseudotype particles per ml* Spike protein CD4+ HeLa cells Env 0 Env-∆107 0 Env-44 0 Env-RVG 1×103−4×103 RV G 2×104−1×105 0 Mock

CD8+ HeLa cells 0 0 0 0 3×104−2×105 0

*Titers were determined by counting fluorescing cells, assuming that nucleoprotein-expressing cells result from infection with one SAD ∆G particle. Titer ranges result from four independent experiments.

DISCUSSION The possibility of generating recombinant RV pseudotype viruses with altered cell specificity was suggested by several previous observations. The recent availability of a defined, recombinant RV mutant lacking the entire G gene revealed that the only viral surface protein, or part of it, is not required to drive budding of particles from the cell surface membrane. In addition, the cytoplasmic tail of RV G was found to considerably contribute to sorting of G spikes into the virions (7). Finally, a temperature-sensitive VSV mutant containing at nonpermissive temperature only carboxyl-terminal VSV G protein fragments (25) was successfully rescued by a chimeric HIV Env protein possessing the VSV G cytoplasmic tail. This indicated that the G cytoplasmic domain sequence might be even sufficient to direct foreign proteins into virions (14). The data presented here demonstrate that the cytoplasmic tail of the RV G contains a signal sufficient and necessary to direct a chimeric HIV Env spike protein, Env-RVG, into the envelope of “rabies” virus particles in the absence of G or of parts of it. In contrast to RV, which is able to infect all culture cells analyzed so far, the tropism of the pseudotype particles is restricted and is obviously determined by the specificity of the incorporated spike protein and its interaction with the HIV-1 CD4 receptor complex. This implies that, in contrast to RV, which enters cells after receptor-mediated endocytosis and fusion of membranes in acidic lysosomes, RV(HIV) pseudotype membranes should fuse with the cell surface membrane at neutral pH. Subsequent successful viral replication and protein expression could be monitored directly. As a consequence of the genetic deficiency for a spike protein, infection was restricted to the primarily infected cells, allowing direct determination of the yield of infectious pseudotype viruses. In contrast to Env-RVG, wild-type HIV-1 Env or the two constructs with Env-derived cytoplasmic tails identical or similar in length to that of G were not capable to rescue the infectivity of SAD ∆G particles, although they were proteolytically processed and expressed at the cell surface and also

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

SPECIFIC INFECTION OF CD4+ TARGET CELLS BY RECOMBINANT RABIES VIRUS PSEUDOTYPES CARRYING THE HIV-1 ENVELOPE SPIKE PROTEIN

11370

induced syncytium formation in CD4+ HeLa cells in a level comparable to that of Env-RVG. Thus, rather than the length of 44 amino acids, the specific sequence of the RV cytoplasmic tail is required to promote or to allow incorporation of spikes into the viral envelope. This is strongly supported by preliminary data on an additional Env mutant capable of rescuing the infectivity of SAD ∆G. The mutant has a cytoplasmic tail of 65 amino acids, the carboxyl terminus of which corresponds to the sequence of the RV G tail. As suggested by the ability of the G protein from another lyssavirus serotype to replace RV G (26) and by comparison of available lyssavirus G sequences, the critical motif might be located in the carboxyl-terminal region of the tail in which 7 of 14 residues are conserved with regard to other lyssaviruses (unpublished data). As demonstrated recently, similar to VSV G (27), RV G protein possesses an independent exocytosis activity (7) and, in the presence of G, the yield of rhabdovirus particles is augmented. As estimated from the gradient analyses, an approximately 5-fold higher amount of particles complemented with G compared with RV(HIV) pseudotype particles was observed. Although substantial amounts of Env-RVG spikes were incorporated into the particles, as shown directly by the presence of the anchored, gp41-derived chimeric 37 kDa subunit (Fig. 5), the infectious titers differed by a factor of 20–25. Since the infectivity of viruses is largely governed by the features of their spike proteins and the interaction with receptors, the discrepancy in infectious titers may not directly reflect the efficiency by which the hybrid protein can substitute for RV G in formation of infectious virions. It is not known so far whether oligomerization has an influence on the putative interaction of the cytoplasmic tail with internal virus proteins. Similar to the RV spike (28), HIV-Env may probably form trimers (29). The successful incorporation of Env-RVG suggests that this protein may present the tail(s) in an appropriate configuration. Incorporation of the monomeric cellular glycoprotein CD4 into VSV tsO45 has been reported previously (30). However, particles containing CD4, or a chimeric CD4 with the VSV cytoplasmic tail, were observed only at permissive temperature, suggesting that VSV G protein is required for incorporation of CD4 into VSV. Our results verified that a recombinant rhabdovirus can be generated whose tropism is exclusively determined by a foreign surface glycoprotein incorporated specifically into the viral envelope. Due to the transient nature of the assay, the described system should provide a versatile and, most importantly, a safe tool in determining whether other glycoproteins might be able to direct rhabdovirus vectors to specific target cells. We thank Veronika Schlatt and Karin Kegreiss for perfect technical assistance. This work was supported by Grants BEO 21/0310118A and 0311171 from the Bundesministerium für Bildung, Wissenschaft, Forschung und Technologie. 1. Simons, K. & Garoff, H. (1980) J. Gen. Virol. 50, 1–21. 2. Delchambre, M., Gheysen, D., Thines, D., Thiriart, C., Jacobs, E., Verdin, E., Horth, M., Burny, A. & Bex, F. (1989) EMBO J. 8, 2653–2660. 3. Gheysen, D., Jacobs, E., deForesta, F., Thiriart, C., Francotte, M., Thines, D. & DeWilde, M. (1989) Cell 59, 103–112. 4. Dong, J., Roth, M.G. & Hunter, E. (1992) J. Virol. 66, 7374– 7382. 5. Burns, J.C., Friedmann, T., Driever, W., Burrascano, M. & Yee, J.-K. (1993) Proc.Natl. Acad. Sci. USA 90, 8033–8037. 6. Yee, J.K., Miyanohara, A., LaPorte, P., Bouic, K., Burns, J. & Friedman, T. (1994) Proc. Natl. Acad. Sci. USA 91, 9564–9568. 7. Mebatsion, T, König, M. & Conzelmann, K.-K. (1996) Cell 84, 941–951. 8. Rose, J.K. & Schubert, M. (1987) in The Rhabdoviruses, ed. Wagner, R.R. (Plenum, New York), pp. 129–166. 9. Wagner, R.R. & Rose, J.K. (1996) in Fields Virology, eds. Fields, B.N., Knipe, D.M., Howley, P.M., Chomock, R.M., Melnick, J.L., Monath, T.P., Roizman, B. & Straus, S.E. (Lippincott-Raven, Philadelphia), pp. 1121–1135. 10. Schnell, M.J., Mebatsion, T. & Conzelmann, K.-K. (1994) EMBO J. 13, 4195–4203. 11. Conzelmann, K.-K. (1996) J. Gen. Virol. 77, 381–389. 12. Whitt, M.A., Chong, L. & Rose, J.K. (1989) J. Virol. 63, 3569–3578. 13. Hunter, E. (1994) Semin. Virol. 5, 71–83. 14. Owens, R.J. & Rose, J.K. (1993) J. Virol. 67, 360–365. 15. Schnell, M.J., Buonocore, L., Whitt, M.A. & Rose, J.K. (1996) J. Virol. 70, 2318–2323. 16. Mebatsion, T., Schnell, M.J., Cox, J.H., Finke, S. & Conzelmann, K.-K. (1996) Proc. Natl. Acad. Sci. USA 93, 7310–7314. 17. Maddon, P.J., Dalgleish, A.G., McDougal, J.S., Clapham, P.R., Weiss, R.A. & Axel, R. (1986) Cell 47, 333–348. 18. Prince, A.M., Reesink, H., Pascual, D., Horowitz, B., Hewlett, I., Murthy, K.K., Cobb, K.E. & Eichberg, J.W. (1991) AIDS Res. Hum. Retroviruses 7, 971–973. 19. Prince, A.M., Horowitz, B., Baker, L., Shulman, R.W., Ralph, H., et al. (1988) Proc. Natl. Acad. Sci. USA 85, 6944–6948. 20. Fuerst, T.R., Niles, E.G., Studier, F.W. & Moss, B. (1986) Proc. Natl. Acad. Sci. USA 83, 8122–8126. 21. Conzelmann, K.-K. & Schnell, M.J. (1994) J. Virol. 68, 713–719. 22. Wain-Hobson, S., Sonigo, P., Danos, O., Cole, S. & Alizon, M. (1985) Cell 40, 9–17. 23. Willey, R.L., Bonifacino, J.S., Potts, B.J., Martin, M.A. & Klausner, R.D. (1988) Proc. Natl. Acad. Sci. USA 85, 9580–9584. 24. Schneider, J., Kaaden, O., Copeland, T.D., Orozlan, S. & Hunsmann, G. (1986) J. Gen. Virol. 67, 2533–2538. 25. Metsikkö, K. & Simons, K. (1986) EMBO J. 5, 1913–1920. 26. Mebatsion, T., Schnell, M.J. & Conzelmann, K.-K. (1995) J. Virol. 69, 1444–1451. 27. Rolls, M.M., Webster, P., Balba, N.H. & Rose, J.K. (1994) Cell 79, 497–506. 28. Gaudin, Y., Tuffereau, C., Segretain, D., Knossow, M. & Flamand, A. (1992) Virology 187, 627–632. 29. Gelderblom, H.R. (1991) AIDS 5, 617–638. 30. Schubert, M., Joshi, B., Blondel, D. & Harmison, G.G. (1992) J. Virol. 66, 1579–1589.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

ALPHAVIRUS-BASED EXPRESSION VECTORS: STRATEGIES AND APPLICATIONS

11371

This paper was presented at a colloquium entitled “Genetic Engineering of Viruses and of Virus Vectors,” organized by Bernard Roizman and Peter Palese (Co-chairs), held June 9–11, 1996, at the National Academy of Sciences in Irvine, CA.

Alphavirus-based expression vectors: Strategies and applications

(RNA replicon/protein production/nucleic acid vaccines/gene therapy) ILYA FROLOV, THOMAS A. HOFFMAN, BÉLA M.PRÁGAI, SERGEY A.DRYGA, HENRY V.HUANG, SONDRA SCHLESINGER, AND CHARLES M.RICE * Department of Molecular Microbiology, Washington University School of Medicine, 660 South Euclid Avenue, St. Louis, MO 63110–1093 ABSTRACT Alphaviruses are positive-strand RNA vi-ruses that can mediate efficent cytoplasmic gene expression in insect and vertebrate cells. Through recombinant DNA technology, the alphavirus RNA replication machinery has been engineered for high-level expression of heterologous RNAs and proteins. Amplification of replication-competent alphavirus RNAs (replicons) can be initiated by RNA or DNA transfection and a variety of packaging systems have been developed for producing high titers of infectious viral particles. Although normally cytocidal for vertebrate cells, variants with adaptive mutations allowing noncytopathic replication have been isolated from persistently infected cultures or selected using a dominant selectable marker. Such mutations have been mapped and used to create new alphavirus vectors for noncytopathic gene expression in mammalian cells. These vectors allow long-term expression at moderate levels and complement previous vectors designed for short-term high-level expression. Besides their use for a growing number of basic research applications, recombinant alphavirus RNA replicons may also facilitate genetic vaccination and transient gene therapy. Alphaviruses are enveloped positive-strand RNA viruses that have served as model systems for studies in virology and cell biology (for review, see refs. 1 and 2). Over the past 10 years, the alphavirus RNA replication and packaging machinery has been adapted for expression of heterologous RNAs and proteins in animal cells (for reviews, see refs. 3–6). As transient expression systems, alphaviruses offer several advantages. These include (i) a broad range of susceptible host cells including those of insect, avian, and mammalian origin; (ii) high levels of cytoplasmic RNA and protein expression without splicing; and (iii) the facile construction and manipulation of recombinant RNA molecules using full-length cDNA clones from which infectious RNA transcripts can be generated by in vitro transcription. Two principal strategies are being employed for expression of heterologous sequences: (i) engineering infectious recombinant RNAs that express additional subgenomic RNAs and (ii) replacement of the structural genes to produce self-replicating RNA “replicons” that can be packaged into infectious particles using defective helper RNAs or packaging cell lines. In addition, incorporation of heterologous ligands or receptors into the virion envelope may eventually allow targeting of engineered alphavirus RNAs to specific cell types. This overview briefly discusses the background, methodology, and applications of these alphavirus vector systems, which range from high-level protein production in cell culture to the induction of protective immunity in animals.

The Alphavirus Lifecycle The alphavirus particle contains a single genomic RNA complexed with 240 molecules of a basic capsid protein (C), surrounded by a lipid bilayer containing 240 E1E2 envelope glycoprotein heterodimers. Both the nucleocapsid and the envelope are organized with T=4 icosahedral symmetry (see ref. 7). Alphaviruses can infect a variety of cell types and appear to be able to use more than one cell surface receptor (2). After entry (1), the genomic RNA initially serves as an mRNA for translation of the viral nonstructural proteins (nsPs) required for initiation of viral RNA amplification. RNA replication occurs via synthesis of a full-length minus-strand intermediate that is used as the template for synthesis of additional genome-length RNAs and for transcription of a plus-strand subgenomic RNA from an internal promoter (Fig. 1). This subgenomic RNA, which can accumulate to levels approaching 106 molecules per cell, is the mRNA for translation of the structural proteins. The synthesis of minus, plus, and subgenomic RNAs is temporally regulated via proteolytic processing of nonstructural polyprotein replicase components by a virusencoded protease residing in the C-terminal region of nsP2 (8, 9). The structural proteins are initially translated as a polyprotein (NH2-C-E3-E2–6K-E1-COOH) that is processed coand posttranslationally to produce the mature products. Cleavage at the C-E3 site is mediated by a chymotrypsin-like protease activity residing in the C-terminal portion of the C protein. E3 and E2 are initially made as a precursor (called PE2 or P62) that is processed by a furin-like activity late during release of the virus from infected cells. Envelope glycoproteins E1 and PE2, separated by signal peptidase cleavages, form a heterodimer that migrates through the secretory pathway to the plasma membrane. In the cytoplasm, C-protein subunits complex with the genome RNA to form a nucleocapsid that matures by budding through the plasma membrane, acquiring a lipid bilayer envelope with embedded viral glycoproteins.

Infectious Alphavirus cDNA Clones Studies on the use of alphaviruses as vectors have required the recovery of infectious replication-competent RNA transcripts from cDNA clones. Functional full-length cDNA clones from which infectious RNA transcripts can be synthesized have been reported for SIN (10), SFV (11), VEE (12), and Ross River virus (13). These clones have proven of great value for basic studies on alphavirus replication, including the definition of RNA elements important for RNA replication, subgenomic

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact. Abbreviations: C protein, capsid protein; nsP, nonstructural protein; CAT, chloramphenicol acetyltransferase; DHRNA; defectivehelper RNA; PAC, puromycin acetyltransferase. *To whom reprint requests should be addressed, e-mail: rice@borcim. wustl.edu.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

ALPHAVIRUS-BASED EXPRESSION VECTORS: STRATEGIES AND APPLICATIONS

11372

RNA transcription, and genome RNA packaging (2) (see Fig. 1). Since the alphaviruses are positive-strand RNA viruses, virion-associated proteins are not required for initiation of the replication cycle. Capped RNA transcripts, produced by in vitro transcription with SP6 or T7 polymerase, are typically used to transfect tissue culture cells, usually a continuous hamster kidney line (BHK) or secondary chicken embryo fibroblasts. RNA transfection is facilitated by DEAE-dextran, cationic liposomes, or electroporation. In the latter method, efficiencies can approach 100% for BHK cells (11).

FIG. 1. Alphavirus replication cycle. Translated regions of alphavirus genomic and subgenomic RNAs are shown as boxes with the nonstructural proteins and structural proteins (STRUCTURAL) indicated as open and lightly shaded boxes, respectively. Cis-acting sequences important for replication and transcription are shown (small, checkered boxes) as is the sequence in the nonstructural region important for encapsidation (solid box). The start site for subgenomic mRNA transcription on the (−) strand genome-length RNA template is indicated by an arrow. Translation initiation (aug) and termination signals (trm) are indicated by open triangles and solid diamonds, respectively (from ref. 4). Although less efficient than transfection of full-length RNAs, alphavirus replication can also be initiated by transfection of plasmid DNA (14, 15). In this case, full-length 5
-capped RNAs are transcribed in the nucleus using a polymerase II promoter and transported to the cytoplasm, the site of primary translation and RNA amplification.

Replication and Packaging-Competent Vectors Several approaches have been taken for independent expression of heterologous genes using the alphavirus RNA replication machinery. The identification of the SIN subgenomic RNA promoter element allowed the construction of RNAs with additional subgenomic RNA promoters (Fig. 2). Recombinant RNAs containing two promoters for subgenomic mRNA synthesis are referred to as double subgenomic RNA vectors (dsSIN) (16–18). Heterologous sequences, expressed via a second subgenomic mRNA, can be located either 3
or 5
to the structural protein genes. These vectors are both replication and packaging competent and allow the rapid recovery of high-titered infectious recombinant virus stocks usually in the range of 108–109 plaque-forming units/ml. In initial studies (16), dsSIN recombinants were engineered to express bacterial chloramphenicol acetyltransferase (CAT), a truncated form of the influenza hemagglutinin (HA), or minigenes encoding two distinct immunodominant cytotoxic T-cell (CTL) HA epitopes. Infection of murine cell lines with these recombinants resulted in the expression of 106– 107 CAT polypeptides per cell and efficient sensitization of target cells for lysis by appropriate major histocompatibility complex (MHC)restricted HA-specific CTL clones in vitro. In addition, priming of an influenza-specific T-cell response was observed after immunizing mice with dsSIN recombinants expressing either truncated HA or the immunodominant influenza CTL epitopes. This system allows the generation of high-titered recombinant virus stocks in a matter of days and has been useful for mapping and mutational analysis of class I MHC-restricted T-cell epitopes expressed via the endogenous pathway of antigen processing and presentation (19, 20). Because of packaging constraints and instability of larger inserts upon passaging, this approach is primarily useful for short (<2 kb) heterologous sequences. In other studies, dsSIN recombinants have been used to express the Japanese encephalitis virus (21) and rubella virus (22) stuctural proteins, to deliver a single chain antibody for intracellular immunization against tick-borne encephalitis (23), to map the domain of GLUT-4, the insulin-regulatable glucose transporter, which is responsible for efficient intracellular sequestration (24), to study structure-function aspects of ras-like GTP-binding proteins involved in vesicular transport (25–29), and to probe the interplay between viral and cellular genes involved in apoptotic cell death (30, 31). Another interesting application has been for gene expression studies in mosquito cells and mosquitoes (32). Engineered dsSIN recombinants have been used to follow virus spread in whole mosquitoes (33) and to express antisense RNAs or viral proteins that are capable of specifically inhibiting replication (34–36) and transmission (37) of heterologous viruses and may be useful for studies of normal mosquito gene function via antisense RNA-mediated inhibition.

Alphavirus RNA Replicons The prototype replication-competent, but packaging-defective, alphavirus RNA replicon was developed by replacing the SIN structural genes with the CAT gene (38) (Fig. 3, upper-left section). In cells transfected with this SIN recombinant RNA, CAT is expressed rapidly and up to 108 CAT polypeptides are produced per transfected cell by 16–20 h. CAT expression could be regulated by inclusion of a ts

FIG. 2. Double subgenomic RNA vectors. Infectious alphavirus vectors that contain both the replication machinery and the structural proteins. Heterologous gene products are expressed by synthesis of a second subgenomic mRNA. For other symbols see Fig. 1. Adapted from ref. 4.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

ALPHAVIRUS-BASED EXPRESSION VECTORS: STRATEGIES AND APPLICATIONS

11373

mutation blocking RNA synthesis. Similar RNA replicons have also been developed for SFV (39) and VEE (R.Johnston, personal communication).

FIG. 3. Packaging of replicons by cotransfection of DHRNAs expressing the alphavirus structural proteins. See the text for details. Since these RNA replicons do not encode structural proteins, they are incapable of spread and the level of heterologous product synthesized in transfected cells is directly related to the transfection efficiency of the recombinant RNA. Conditions for efficient RNA transfection using either cationic liposomes or electroporation have been determined for only a few cell types, which limits the usefulness of these vectors for high-level production or experiments where expression in every cell is required.

Packaging Systems The utility of the alphavirus replicon expression systems has been markedly improved by development of a series of defective helper RNAs that allow efficient packaging of RNA replicons (39, 40). Defective-helper RNAs (DHRNAs) are designed to contain the cis-acting sequences required for replication as well as the subgenomic RNA promoter driving expression of the structural protein genes. Packaging of SIN replicons is achieved by efficient cotransfection of BHK cells with both RNAs by electroporation (11) (Fig. 3). Replicase/ transcriptase functions supplied by the vector RNA lead not only to its own amplification but also act in trans to allow replication and transcription of the helper RNA. This results in synthesis of structural proteins that can package the replicon with >108 infectious particles per ml (5×109 infectious particles per electroporation) being produced after only 16–24 h. Such stocks can be used, without further phenotypic selection, to infect cells for expression studies or high-level protein production. Current experience suggests that it should be possible to package replicons containing at least 5 kb of heterologous sequence. A spectrum of DHRNAs have been characterized that differ in their ability to be packaged (39–41; Fig. 4). Some DHRNAs that allow packaging of the replicon as well as themselves are useful under conditions where extensive amplification by passaging is advantageous (Fig. 4A) (41). Other DHRNAs allow efficient packaging of replicons but are packaged very poorly themselves (Fig. 4B) (40). These latter helpers are useful for applications where expression of the viral structural proteins and virus spread are not desired. A potential problem with the helper-free “one-way” packaging strategy just described is that recombination can occur between replicon and helper RNAs to produce wild-type virus (43, 44). One approach to minimize this possibility is to use two DHRNAs, one that expresses the capsid protein and a second that expresses the viral glycoproteins (I.F., unpublished results; Fig. 5). The capsid protein, expressed independently, accumulates at high levels, but to achieve similar levels of viral glycoprotein expression retention of the 5
terminus of the capsid protein mRNA, which acts as a translational enhancer, is required (see below). Deletions in the capsid protein gene that preserve both the 5
terminus (the enhancer region) and the 3
half (the sequences that code for the autoprotease activity) but eliminate the region that binds RNA produce high levels of glycoprotein expression from a second DHRNA (I.F. and S.S., unpublished results). Capsid protein genes from heterologous alphaviruses can also be used to enhance translation of the glycoproteins and should further reduce the probability of wild-type virus generation via recombination. In addition to packaging of alphavirus RNA replicons by cotransfection with DHRNAs, continuous packaging cell lines have been developed that express a DHRNA under the control of a nuclear promoter (I.F. and S.S., unpublished results). Such cells may be useful for rescuing transfected RNA replicons, titering packaged replicons, and production of large quantities of packaged replicon stocks by lowmultiplicity passage.

The Alphavirus Translational Enhancer In the course of studying the expression of proteins by alphavirus replicons, it was noticed that the level of heterologous protein expression was much lower than that observed for the authentic C protein. This observation led to the discovery of a translational enhancer in the C-protein coding region (45, 46). A series of C-lacZ fusion constructs localized the element to the 5
portion of the subgenomic RNA encoding the Nterminal region of the C protein (45, 46). Subsequent studies strongly suggest that an RNA element in this region of the subgenomic RNA enhances translation of the C protein in alphavirus-infected, but not uninfected, cells (45, 47). SINlacZ replicons that lack this region express 50 µg of β-ga

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

ALPHAVIRUS-BASED EXPRESSION VECTORS: STRATEGIES AND APPLICATIONS

11374

lactosidase per 106 BHK cells, whereas cells infected with replicons containing the enhancer element accumulate 10- to 20-fold higher levels (650 µg of β-galactosidase per 106 cells; refs. 45 and 46).

FIG. 4. Bipartite and “helper-free” packaging strategies for alphavirus replicons. (A) Cotransfection with this DHRNA containing a 5
tRNA and cis-acting packaging signal (bold cross; ref. 42) leads to efficient packaging of both replicon and DHRNA (40). The 5
tRNA enhances both DHRNA replication (40) and packaging (E.Frolova, I.F., and S.S., unpublished results). Such bipartite alphavirus stocks form plaques and can be amplified by multiple rounds of passaging. (B) Using DHRNAs that lack the 5
tRNA and packaging signal, selective packaging of the replicon RNA is obtained. This method is used to produce “one way” vectors essentially free of packaged helper RNA. Such high levels of expression necessitate that the heterologous protein be expressed as a C-protein fusion. Besides the incorportion of a site for specific proteolytic cleavage in vitro, several stratagies have been tried or are envisioned to produced high-level expression of unfused product in vivo. One strategy employs the C-protein autoprotease activity that cleaves at the C-PE2 junction and requires limited downstream PE2 sequences (46) (Fig. 6). Alternatively, to produce heterologous proteins without additional N-terminal residues, a ubiquitin monomer can be inserted in-frame between between C and the heterologous product. Such constructs are cleaved efficiently in vivo by the host enzyme ubiquitin carboxyl-terminal hydrolase (see ref. 8 and citations therein).

Effects of Alphavirus Infection on Host Cell Biology In nature, alphaviruses are transmitted to vertebrate hosts by mosquitoes. Insect vectors become chronically infected without apparent deleterious consequences. As mentioned earlier, this property has allowed SIN vectors to be used for studies requiring prolonged gene expression in whole mosquitoes. In the vertebrate host, however, the biology of virus infection is quite different. Replication is rapid to achieve titers high enough for efficient transmission before virus-specific immune reponses neutralize infectivity and clear infection. In some aspects, cell culture growth properties reflect these biological differences. In permissive vertebrate cells, virus infection results in the rapid shut off of host mRNA translation, takeover of the translational machinery by viral mRNAs, production of high titers of infectious virus, and cell death within 12–24 h. In contrast, the rate of virus replication in mosquito cells is slower, often with minimal effects on the insect cell and persistent infections are readily established. For some applications, high expression levels and rapid shut off of host mRNA translation can be advantageous. For instance, alphavirusexpressed proteins can be metabolically labeled and analyzed directly without the need for specific antisera.

Noncytopathic Gene Expression in Mammalian Cells For applications requiring long-term expression and minimal pertubation of vertebrate host cell biology, alphavirus-induced shut-off of host mRNA translation and cell death are undesirable. It has been possible to select for changes in the alphavirus replication machinery that allow persistent noncytopathic replication in vertebrate cells. One strategy has been to establish a persistent infection of BHK cells with SIN (72). One month later, a variant (SIN-1) was isolated by plaque purification. SIN-1 can readily establish persistent infection of naive BHK cells, suggesting that the SIN-1 genome contains appropriate adaptive mutations. These adaptive changes have recently been identified and are being incorporated into SIN vectors (S.A.D. and S.S., unpublished results). A second strategy has been to use a dominant selectable marker, puromycin acetyltransferase (PAC; ref. 48), to select for adapted SIN replicons (I.F., T.A.H., B.M.P., M.Lippa, S.S., and C.M.R., unpublished results). This approach is outlined in Fig. 7. SIN replicons, lacking the structural genes and capable of expressing PAC, were transfected into BHK-21 cells by electroporation. After recovery, puromycin was added at sufficient levels to inhibit translation in untransfected cells. In transfected cells, SIN expression of PAC allows continued translation of viral mRNAs and replication. But SIN replication also leads to shut off of host mRNA translation and eventual cell death (see ref. 49) and the majority of the cells will die, either as a consequence of SIN replication or puromycin sensitivity. Surviving cells (10−6) must have undergone some change, either in host or viral components, that prevent cell death and allow continued expression of PAC. Given the high mutation rate of RNA viruses when compared with host DNA replication, it seemed most likely that changes in the SIN machinery will be responsible for such an adaptation. This has turned out to be the case and multiple puromycin-resistant cell lines harboring adapted replicons have been obtained and characterized. In two of these cell lines, S1 and S24, the adaptive mutation maps to the nsP2 gene. Incorporation of this change into the replicon genome produces vector RNAs that have no observable effect on host translation and are able to establish long-term replication and expression in BHK cells. Using double subgenomic RNA promoter constructs, electroporation and puromycin selection can be used to quickly establish cell populations or clonal cell lines expressing heterologous RNAs and proteins (Fig. 7) (I.F., E.Agapov, and C.M.R., unpublished results).

Host Range and Targeting Infection While alphaviruses replicate in a variety of tissues, there are substantial differences in tissue tropism for a particular alphavirus or among alphaviruses (50). Unfortunately, little is known about the viral determinants, cognate cell surface receptors, and intracellular environments that modulate entry and replication. For example, SIN replicates efficiently in

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

ALPHAVIRUS-BASED EXPRESSION VECTORS: STRATEGIES AND APPLICATIONS

11375

fibroblasts (20) and muscle but poorly in lymphoid cells (B.D. Lindenbach and C.M.R., unpublished results). In contrast, VEE readily infects lymphoid cells and engineered VEE vaccine vectors can elicit protective mucosal immune reponses (51). Most alphaviruses replicate in neurons, although the efficiency of replication and cytotoxicity differ depending upon the virus strain and the differentiated state of the neuron (52, 53). In terms of choosing a particular alphavirus expression system, these differences are worth noting but the optimal vector for a given application is best determined empirically.

FIG. 5. Cotransfection of two DHRNAs to diminish production of wild-type virus via recombination. Packaging is accomplished by cotransfection of two DHRNAs with the expression replicon. One DHRNA (Helper 1) expresses the C protein and a second DHRNA (Helper 2) is designed for high-level expression of the virion glycoproteins. Helper 2 uses a deleted version of the C-protein coding region that is still able to function as a translational enhancer and an autoprotease but is defective for packaging. For transient gene therapy in vivo, it would be advantageous to target engineered alphavirus RNAs to specific cell types. One approach is to modify the viral envelope. Such modified viruses must be competent for assembly and release from transfected cells but unable to bind and enter the normally wide range of host cells that the virus usually infects. A functional heterologous ligand or binding domain displayed on the virion surface would allow selective virus binding to target cells expressing the cognate binding partner. Once bound, the engineered virus must still be able to efficiently enter the cell and initiate replication.

FIG. 6. Alphavirus vectors for high-level protein expression. In SINrep504 (I.F. and A.A.Kolykhalov, unpublished results) replicons, heterologous protein coding regions are fused, in-frame, downstream of the C-PE2 cleavage site. Rapid autoproteolytic cleavage by the chymotrypsin-like C protease releases the foreign gene product. Experiments along these lines have been undertaken using SIN (54, 55). Since a high-resolution structure is not available for the SIN virion or the E1E2 heterodimer, a random mutagenesis strategy was used to identify sites in the viral glycoproteins permissive for insertion of an 11-amino acid protective epitope (called “4D4”) from Rift Valley fever virus. Random insertion libraries were derived by treating plasmid DNA with DNase I or methidiumpropyl-EDTA-Fe(II) and permissive insertion sites were mapped in the E3, E2, 6K, and E1 proteins (ref. 54 and unpublished data). Insertions near the N terminus of the E2 glycoprotein or in an internal region of E2 resulted in 4D4 epitope expression on the virion surface and elicited a partially protective immune response against lethal Rift Valley fever virus challenge (54). These full-length random insertion libraries are now being used to identify permissive insertion sites for other peptides and larger functional domains that are compatible with recovery of infectious virus. In the case of the Rift Valley fever virus epitope library, replacement of the 4D4-encoding oligonucleotide in the full-length random insertion library with another oligonucleotide can be accomplished in a single step and was used to identify a cluster of sites in the E3 protein permissive for insertion of an 81-residue heterologous peptide (S. London and C.M.R., unpublished results). Similar experiments are in progress for the gp120-binding domain of CD4, protein G, the measles virus receptor (CD46), and single-chain antibodies (S.A.D., E.Mendez, C.M.R., and S.S., unpublished results). Besides modifying the alphavirus packaging machinery, heterologous packaging systems may also prove useful for delivering engineered alphavirus RNAs. Pseudotypes are readily produced during encapsidation of retrovirus RNAs and it may be possible to modify the retrovirus packaging machinery to allow selective packaging and targeting (see ref. 56) of heterologous RNAs. Other strategies may be useful for extending the range of susceptible host cells. For vesicular stomatitis virus, the G glycoprotein mediates attachment and infection of many cell types. Remarkably, expression of the G glycoprotein by an SFV replicon leads to the production of low titers of infectious virus-like particles (57, 58).

Other Applications Besides reporters such as β-galactosidase and CAT, alphavirus replicons have been used to express a variety of RNA and

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

ALPHAVIRUS-BASED EXPRESSION VECTORS: STRATEGIES AND APPLICATIONS

11376

protein products in cell culture (3–6). Some published examples include the hepatitis B virus pregenome RNA (59), the papillomavirus 16 capsid protein (60), the neurokinin receptor (61), the human immunodeficiency virus glycoproteins (62), and the hepatitis C virus glycoproteins (63, 64).

FIG. 7. Strategy for selecting adapted replicons for noncytopathic gene expression in mammalian cells. A SIN replicon expressing the PAC gene is used to transfect BHK cells followed by puromycin selection. At low frequency, surviving puromycin-resistant (purR) foci appear and are cloned. RNA from these cell lines is screened for adaptative mutations in the SIN replicon by transformation of naive BHK cells to puromycin resistance at high frequency. Adaptive mutations are then cloned and mapped by making chimeras with the parental replicon. Modified dsSIN vectors, which include the adaptive mutations and the PAC gene, allow rapid production of BHK cell lines expressing heterologous genes without deleterious effects on the host cell. Given their efficient production of heterologous antigens, engineered alphavirus RNAs also have significant potential for in vivo applications (16, 51, 54, 65, 66) including vaccination against primate immunodeficiency viruses (67). Various delivery strategies are just beginning to be explored. As described above, infectious particles containing either double subgenomic RNAs or packaged RNA replicons could be used. In the case of constructs expressing alphavirus structural proteins, which have the potential to spread in vivo, safety issues related to alphavirus pathogenicity remain a major concern. Even using the best “helper-free” packaging system, packaged replicons are likely to include low levels of packaged helper RNA or recombinant wild-type virus (43, 44). Additional safeguards, such as mutations in the spike glycoproteins that require activation by in vitro proteolysis (68) or the use of packaging machinery from highly attenuated alphaviruses (51, 69, 70), may help to diminish the possibility of pathogenic consequences. Alternatively, genetic immunization or transient gene therapy could be accomplished using DNA or RNA constructs lacking the structural proteins. In the case of DNA, a nuclear promoter can be used to drive expression of replication-competent SIN RNA replicons after transfection with DNA (14, 15). Although less stable than DNA, RNA delivery should also be considered since this would result in only transient exposure to the nucleic acid minimizing the possibility of integration and undesirable mutagenic consequences (65, 71). In addition, replicons can be engineered to express multiple subgenomic RNAs allowing coexpression of several protective antigens along with cytokines or other immunomodulators to enhance the generation of desired immune responses. We thank our collaborators and colleagues, past and present, who have contributed to the development of Sindbis virus-based alphavirus vectors. Special thanks also go to Kaveh Ashrafi, Peter J.Bredenbeek, Joel M.Dalrymple, Jean Dubuisson, Arash Grakoui, Teryl K.Frey, Ute Geigenmuller-Gnirke, Chang S.Hahn, Young S.Hahn, Alexander A.Kolykhalov, Robin Levis, Guangpu Li, Brett D.Lindenbach, Steven D.London, Alan L.Schmaljohn, Barabara Weiss, and Cheng Xiong. Work from our laboratories has been supported by grants from the Public Health Service (AI24134, All 1377, and AI26763), the Monsanto/Washington University Biomedical Research Contract, and the Pew Memorial Trust. B.M.P. is a Visiting Professor on leave from Albert Szent-Györgyi Medical University, Department of Microbiology, Szeged, Hungary. 1. Garoff, H., Wilschut, J., Liljeström, P., Wahlberg, J.M., Bron, R., Suomalainen, M., Smyth, J., Salminen, A., Barth, B.U., Zhao, H., Forsell, K. & Ekström, M. (1994) Arch. Virol. Suppl. 9, 329–338. 2. Strauss, J.H. & Strauss, E.G. (1994) Microbiol. Rev. 58, 491–562. 3. Berglund, P., Tubulekas, I. & Liljeström, P. (1996) Trends in Biotech. 14, 130–134. 4. Bredenbeek, P.J. & Rice, C.M. (1992) Semin. Virol. 3, 297–310. 5. Olkkonen, V.M., Dupree, P., Simons, K., Liljeström, P. & Garoff, H. (1994) Methods Cell Biol. 43, 43–53. 6. Piper, R.C., Slot, J.W., Li, G., Stahl, P.D. & James, D.E. (1994) Methods Cell Biol. 43, 55–78. 7. Cheng, R.H., Kuhn, R.J., Olson, N.H., Rossmann, M.G., Choi, H.K. , Smith, T.J. & Baker, T.S. (1995) Cell 80, 621–630. 8. Lemm, J.A., Rümenapf, T., Strauss, E.G., Strauss, J.H. & Rice, C.M. (1994) EMBO J. 13, 2925–2934. 9. Shirako, Y. & Strauss, J.H. (1994) J. Virol. 185, 1874–1885. 10. Rice, C.M., Levis, R., Strauss, J.H. & Huang, H.V. (1987) J. Virol. 61, 3809–3819. 11. Liljeström, P., Lusa, S., Huylebroeck, D. & Garoff, H. (1991) J. Virol. 65, 4107–4113. 12. Davis, N.L., Willis, L.V., Smith, J.F. & Johnston, R.E. (1989) Virology 171, 189–204. 13. Kuhn, R.J., Niesters, H.G.M., Hong, Z. & Strauss, J.H. (1991) Virology 182, 430–441. 14. Dubensky, T.W., Jr., Driver, D.A., Polo, J.M., Belli, B.A., Latham, E.M., Ibanez, C.E., Chada, S., Brumm, D., Banks, T.A., Mento, S.J., Jolly, D.J. & Chang, S.M. (1996) J. Virol. 70, 508–519. 15. Herweijer, H., Latendresse, J.S., Williams, P., Zhang, G., Danko, I., Schlesinger, S. & Wolff, J.A. (1995) Hum. Gene Ther. 6, 1161–1167. 16. Hahn, C.S., Hahn, Y.S., Braciale, T.J. & Rice, C.M. (1992) Proc. Natl. Acad. Sci. USA 89, 2679–2683. 17. Hertz, J.M. & Huang, H.V. (1992) J. Virol. 66, 857–864. 18. Raju, R. & Huang, H.V. (1991) J. Virol. 65, 2501–2510. 19. Hahn, Y.S., Hahn, C.S., Braciale, V.L., Braciale, T.J. & Rice, C.M. (1992) J. Exp. Med. 176, 1335–1341. 20. Lovett, A.E., Hahn, C.S., Rice, C.M., Frey, T.K. & Wolinsky, J.S. (1993) J. Virol. 67, 5849–5858. 21. Pugachev, K.V., Mason, P.W., Shope, R.E. & Frey, T.K. (1995) Virology 212, 587–594. 22. Chen, J.P., Miller, D., Katow, S. & Frey, T.K. (1995) Arch. Virol. 140, 2075–2084. 23. Jiang, W., Venugopal, K. & Gould, E.A. (1995) J. Virol. 69, 1044–1049. 24. Piper, R.C., Tai, C., Slot, J.W., Hahn, C.S., Rice, C.M., Huang, H.V. & James, D.E. (1992) J. Cell Biol. 117, 729–743. 25. Li, G. & Stahl, P.D. (1993) Arch. Biochem. Biophys. 304, 471–478. 26. Li, G. & Stahl, P.D. (1993) J. Biol. Chem. 268, 24475–24480.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

ALPHAVIRUS-BASED EXPRESSION VECTORS: STRATEGIES AND APPLICATIONS

11377

27. Li, G., Barbieri, M.A., Colombo, M.I. & Stahl, P.D. (1994) J. Biol. Chem 269, 14631–14635. 28. D’Souza-Schorey, C., Li, G., Colombo, M.I. & Stahl, P.D. (1995) Science 267, 1175–1178. 29. Li, G., Barbieri, M.A. & Stahl, P.D. (1995) Arch. Biochem. Biophys. 316, 529–534. 30. Cheng, E.H.Y., Levine, B., Boise, L.H., Thompson, C.B. & Hardwick, J.M. (1996) Nature (London) 379, 554–556. 31. Levine, B., Goldman, J.E., Jiang, H.H., Griffin, D.E. & Hardwick, J.M. (1996) Proc. Natl. Acad. Sci. USA 93, 4810–4815. 32. Higgs, S., Powers, A.M. & Olson, K.E. (1993) Parasitol. Today 9, 444–452. 33. Olson, K.E., Higgs, S., Rice, C.M., Carlson, J.O. & Beaty, B.J. (1994) Insect Biochem. Molec. Biol. 24, 39–48. 34. Gaines, P.J., Olson, K.E., Higgs, S., Powers, A.M., Beaty, B.J. & Blair, C.D. (1996) J. Virol. 70, 2132–2137. 35. Powers, A.M., Olson, K.E., Higgs, S., Carlson, J.O. & Beaty, B.J. (1994) Virus Res. 32, 57–67. 36. Powers, A.M., Kamrud, K.I., Olson, K.E., Higgs, S., Carlson, J.O. & Beaty, B.J. (1996) Proc. Natl. Acad. Sci. USA 93, 4187–4191. 37. Olson, K.E., Higgs, S., Gaines, P.J., Powers, A.M., Davis, B.S., Kamrud, K.I., Carlson, J.O., Blair, C.D. & Beaty, B.J. (1996) Science 272, 884–886. 38. Xiong, C., Levis, R., Shen, P., Schlesinger, S., Rice, C. & Huang, H.V. (1989) Science 243, 1188–1191. 39. Liljestrom, P. & Garoff, H. (1991) Bio/Technology 9, 1356–1361. 40. Bredenbeek, P.J., Frolov, I., Rice, C.M. & Schlesinger, S. (1993) J. Virol. 67, 6439–6446. 41. Geigenmuller-Gnirke, U., Weiss, B., Wright, R. & Schlesinger, S. (1991) Proc. Natl. Acad. Sci. USA 88, 3253–3257. 42. Weiss, B., Nitschko, H., Ghattas, I., Wright, R. & Schlesinger, S. (1989) J. Virol. 63, 5310–5318. 43. Raju, R., Subramaniam, S.V. & Hajjou, M. (1995) J. Virol. 69, 7391–7401. 44. Weiss, B.G. & Schlesinger, S. (1991) J. Virol. 65, 4017–4025. 45. Frolov, I. & Schlesinger, S. (1994) J. Virol. 68, 8111–8117. 46. Sjoberg, E.M., Suomalainen, M. & Garoff, H. (1994) Bio/ Techology 12, 1127–1131. 47. Sjoberg, E.M. & Garoff, H. (1996) J. Gen. Virol. 77, 1323–1327. 48. de la Luna, S., Soria, I., Pulido, D., Ortin, J. & Jiménez, A. (1988) Gene 62, 121–126. 49. Frolov, I. & Schlesinger, S. (1994) J. Virol. 68, 1721–1727. 50. Johnston, R.E. & Peters, C.J. (1996) in Alphaviruses, eds. Fields, B.N., Knipe, D.M. & Howley, P.M. (Raven, New York), pp. 843–898. 51. Davis, N.L., Brown, K.W. & Johnston, R.E. (1996) J. Virol. 70, 3781–3787. 52. Griffin, D.E., Levine, B., Tyor, W.R., Tucker, P.C. & Hardwick, J.M. (1994) Arch. Virol. Suppl. 9, 31–39. 53. Griffin, D.E., Levine, B., Ubol, S. & Hardwick, J.M. (1994) Ann. Neurol. 35, S23–S27. 54. London, S.D., Schmaljohn, A.L., Dalrymple, J.M. & Rice, C.M. (1992) Proc. Natl. Acad. Sci. USA 89, 207–211. 55. Dubuisson, J. & Rice, C.M. (1993) J. Virol. 67, 3363–3374. 56. Young, J.A.T., Bates, P., Willert, K. & Varmus, H.E. (1990) Science 250, 1421–1423. 57. Rolls, M.M., Webster, P., Balba, N.H. & Rose, J.K. (1994) Cell 79, 497–506. 58. Rolls, M.M., Haglund, K. & Rose, J.K. (1996) Virology 218, 406–411. 59. Huang, M. & Summers, J. (1991) J. Virol. 65, 5435–5439. 60. Heino, P., Dillner, J. & Schwartz, S. (1995) Virology 214, 349–359. 61. Lundstrom, K., Mills, A., Buell, G., Allet, E., Adami, N. & Liljeström, P. (1994) Eur. J. Biochem. 224, 917–921. 62. Paul, N.L., Marsh, M., McKeating, J.A., Schulz, T.F., Liljestrom, P., Garoff, H. & Weiss, R.A. (1993) AIDS Res. Hum. Retroviruses 9, 963–970. 63. Dubuisson, J., Hsu, H.H., Cheung, R.C., Greenberg, H., Russell, D.R. & Rice, C.M. (1994) J. Virol. 68, 6147–6160. 64. Lin, C., Lindenbach, B.D., Prágai, B., McCourt, D.W. & Rice, C.M. (1994) J. Virol. 68, 5063–5073. 65. Zhou, X.Z., Berglund, P., Rhodes, G., Parker, S.E., Jondal, M. & Liljeström, P. (1994) Vaccine 12, 1510–1514. 66. Zhou, X.Z., Berglund, P., Zhao, H.X., Liljestrom, P. & Jondal, M. (1995) Proc. Natl. Acad. Sci. USA 92, 3009–3013. 67. Mossman, S.P., Bex, F., Berglund, P., Arthos, J., Oneil, S.P., Riley, D., Maul, D.H., Bruck, C., Momin, P., Burny, A., Fultz, P.N., Mullins, J.I., Liljestrom, P. & Hoover, E.A. (1996) J. Virol. 70, 1953–1960. 68. Salminen, A., Wahlberg, J.M., Lobigs, M., Liljeström, P. & Garoff, H. (1992) J. Cell Biol. 116, 349–357. 69. Davis, N.L., Powell, N., Greenwald, G.F., Willis, L.V., Johnson, B.J.B., Smith, J.F. & Johnston, R.E. (1991) Virology 183, 20–31. 70. Davis, N.L., Brown, K.W., Greenwald, G.F., Zajac, A.J., Zacny, V.L., Smith, J.F. & Johnston, R.E. (1995) Virology 212, 102–110. 71. Johanning, F.W., Conry, R.M., LoBuglio, A.F., Wright, M., Sumerel, L.A., Pike, M.J. & Curiel, D.T. (1995) Nucleic Acids Res. 23, 1495–1501. 72. Weiss, B., Rosenthal, R. & Schlesinger, S. (1980) J. Virol. 33, 463–474.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

EARLY EVENTS IN POLIOVIRUS INFECTION: VIRUS-RECEPTOR INTERACTIONS

11378

This paper was presented at a colloquium entitled “Genetic Engineering of Viruses and of Virus Vectors,” organized by Bernard Roizman and Peter Palese (Co-chairs), held June 9–11, 1996, at the National Academy of Sciences in Irvine, CA.

Early events in poliovirus infection: Virus-receptor interactions

VINCENT R.RACANIELLO * Department of Microbiology, Columbia University College of Physicians and Surgeons, 701 West 168th Street, New York, NY 10032 ABSTRACT The interaction of poliovirus with its cell receptor initiates conformational changes that lead to uncoating of the viral RNA. Three types of genetic analyses have been used to study the poliovirus-receptor interaction: (i) mutagenesis of the poliovirus receptor (PVR), (ii) selection of viral mutants resistant to neutralization with soluble PVR, and (iii) selection of viral variants adapted to use mutant PVRs. The results of these studies show that a small portion of the first immunoglobulin-like domain of PVR contacts viral residues within a deep depression on the surface of the capsid that encircles the fivefold axis of symmetry. Viral capsid residues that influence the interaction with PVR are also found in locations such as the capsid interior that cannot directly contact PVR. These mutations might influence the ability of the capsid to undergo receptor-mediated conformational transitions that are necessary for high-affinity interactions with PVR. All viruses initiate infection of susceptible cells by first binding to a cell surface receptor. For some viruses, the cell receptor plays an active role in the uncoating of the viral genome, whereas for others the receptor is nothing more than a tether that concentrates virus particles on the cell surface and directs them toward disassembly pathways. For example, the uncoating of influenza viruses is triggered by the acidification of the endocytic vesicles that bring the virus into the cells (1). Adenovirus is brought into the endocytic pathway by its cell receptor, where it is dismantled in a process that does not appear to require the receptor (2). Some enveloped viruses fuse with cell membranes at neutral pH; the interaction with the cell receptor may trigger conformational changes in viral glycoproteins that convert them to fusogenic forms (3). The interaction of poliovirus with receptor-bearing cells leads to the production of the conformationally altered A particle (4), which is believed to be an intermediate in cell entry (5). The determination of the three-dimensional structure of the viral capsid (6) and identification of the cell receptor for poliovirus (7) have lead to studies aimed at understanding how virus-receptor interactions lead to uncoating of the viral RNA.

Poliovirus and Its Cell Receptor The poliovirus capsid consists of 60 copies of each of the four viral polypeptides VP1, VP2, VP3, and VP4, arranged with icosahedral symmetry. All three serotypes of poliovirus utilize a cell surface receptor called the poliovirus receptor (PVR), which is a novel member of the immunoglobulin superfamily, to initiate infection of cells (7). The PVR polypeptide contains an N-terminal signal sequence, three extracellular immunoglobulin (Ig)-like domains, a transmembrane domain, and a cytoplasmic tail. Alternative splicing produces two mRNAs encoding polypeptides of 392 and 417 amino acids that differ in the lengths of their cytoplasmic domains. Both forms of PVR function as receptors for poliovirus. The predicted molecular size of the two polypeptides is 43 or 45 kDa, although posttranslational modification in HeLa cells produces a predominant species of 80 kDa (8). Two human genes related to PVR, PRR1 and PRR2, have been identified, although it is not known whether the encoded polypeptides function as poliovirus receptors (9, 10). A mouse homolog, MPH, does not bind poliovirus (11), including strains that are adapted to grow in mice (Y.Dong and V.R.R., unpublished data). The cellular functions of PVR, PRR1, PRR2, and MPH are unknown, although like many members of the Ig superfamily, they may play a role in cell adhesion and recognition. The cytoplasmic domain of one isoform of PVR is phosphorylated at serine, possibly by calcium/calmodulin kinase II (12), and several protein kinases bind to and phosphorylate the cytoplasmic domain of MPH (Y.Dong and V.R.R., unpublished data). Identification of these protein kinases should provide clues about the normal role of PVR and MPH in the cell.

PVR AND THE UNCOATING OF VIRAL RNA Shortly after poliovirus binds to cell surface PVR, it releases its RNA genome into the cytoplasm. PVR is likely to play a role in the uncoating step, as suggested by its ability to induce dramatic structural changes in the virus particle. When poliovirus is bound to cells at 37°C, a large proportion of the virus is eluted as a conformationally altered form known as the A particle (4). These particles contain infectious RNA, but they differ from native virus in their sedimentation coefficient (135 S compared with 160 S for native virions), their increased sensitivity to detergent and proteinases, and the absence of VP4 (5). The N terminus of VP1, normally on the interior of the virion, has been translocated to the surface, making the capsid hydrophobic. Conversion of poliovirus to 135S particles can also be accomplished in solution by incubation with detergent extracts of insect cells expressing PVR (13) or with soluble PVR released into the culture medium from expressing cells (14). It is likely that PVR is sufficient for 135S particle formation, although this possibility has not yet been tested with the purified protein. The A particle has been proposed to be an essential intermediate in the entry of poliovirus into cells (5). The N terminus of VP1 may form an amphipathic helix that inserts into the cell membrane, producing a pore through which the viral RNA may leave the capsid. To determine the role of 135S particle formation in poliovirus replication, we took advantage of the observation that A particles are not formed at temperatures below 33°C (15) and determined whether poliovirus could replicate at 25°C (A.Dove and V.R.R., unpublished data). Our findings indicate that wild-type Mahoney strain of

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact. Abbreviations: PVR, poliovirus receptor; ca, cold adapted. *e-mail: [email protected].

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

EARLY EVENTS IN POLIOVIRUS INFECTION: VIRUS-RECEPTOR INTERACTIONS

11379

poliovirus type 1 (P1/Mahoney) is unable to grow at 25°C, but cold-adapted (ca) mutants are readily selected at this temperature. Ca mutants replicate efficiently at 25°C without forming 135S particles (they do form 135S particles at 37°C). The Ca phenotype maps to a central region of the viral RNA encoding nonstructural proteins, suggesting that the block to replication in wild-type P1/Mahoney is past the stage of cell entry — possibly RNA replication, proteolytic processing, or even assembly. In support of this hypothesis, when the entry steps are bypassed by transfection of viral RNA into cells, ca viral RNA replicates at 25°C, but wt RNA does not. These results suggest that the formation of 135S particles is not required for poliovirus replication. The altered particle might be a stable end product that is readily detected; the true intermediate in RNA uncoating might be an earlier particle, perhaps less stable than 135S particles, that represents a less-drastic PVR-induced conformational change. The ability to study a productive poliovirus infection at 25°C, in the absence of 135S particle formation, should enable the identification of such structural changes. We are left with the question of why so many nonfunctional 135S particles are formed. The answer is not known, but 135S particle formation has been studied mainly in cultured cells; in vivo, where the accessibility and/or level of cell receptors might be limited, fewer A particles may be generated.

PVR Sequences That Control Virus Binding To fully understand how the poliovirus-PVR interaction initiates cell entry, a detailed picture of how the virus and receptor combine is required. Ultimately, resolution of a virus-receptor complex will be needed, but the results of genetic analyses have provided some insight into the interaction. The binding site for poliovirus appears to be contained within domain 1, which can bind poliovirus when expressed on the cell surface either alone or linked to other domains from CD4, the intracellular cell adhesion molecule ICAM-1, or MPH (for review, see ref. 16). Virus does not bind as well to domain 1 as it does to native PVR, suggesting that domains 2 and 3 contribute to the interaction, either directly or by influencing the structure of domain 1. Several laboratories have mutagenized PVR domain 1 to identify the putative contact point, and the results show that three main sites are important for poliovirus binding (Fig. 1): (i) the C-C
loop through the C strand, (ii) the border of the D strand and the D-E loop, and (iii) the G strand. A mutation at the beginning of the F strand also reduces virus binding, probably by altering domain structure. Mutagenesis of other loops and strands has not revealed other regions that are important for binding. These studies indicate that the C
-C ridge is likely to be the main part of PVR that contacts poliovirus. The homologous part of CD4 plays a major role in the interaction with human immunodeficiency virus type 1 (for review, see ref. 18). The D-E loop of domain 1 may also contact poliovirus, but the G strand is more distant and not likely to be directly involved with the binding site. Consistent with this hypothesis is the observation that substitution of PVR residues 70–100, which contains the C
-C ridge (Fig. 1) into the corresponding region of MPH produces a chimeric receptor that can be recognized by type 1 but not types 2 and 3 poliovirus (Y.Lin and V.R.R., unpublished data). This result suggests that the poliovirus binding site on PVR is contained with this 30-amino acid segment, although contribution of conserved MPH residues to poliovirus binding cannot be excluded. The three serotypes of poliovirus contact PVR slightly differently, a conclusion also drawn from studies of a G-strand mutation (Fig. 1) that abrogates binding of types 1 and 2 but not type 3 poliovirus (19).

FIG. 1. Structural model of PVR domain 1 (17). The locations of three mutations that influence poliovirus binding are shown as letters: d (amino acid 82, Gln replaced with Phe), g (amino acid 56, insertion of Val-Asp-Phe), and i (amino acid 99, LeuGly replaced with ProGlu-Thr-Asn). The β-strands are lettered A-G. Viral Capsid Sequences That Regulate Receptor Binding When the three-dimensional structures of rhinovirus and poliovirus were solved, a 1.2-nm-deep 1.5-nm-wide channel was noted surrounding the prominent peak at the fivefold axis of symmetry of the particle (6, 20). This channel was called the canyon and was proposed to be the receptor binding site for rhinovirus 14 (20). A model of the interaction of HRV-16 with its soluble receptor, ICAM-1, indicates that ICAM-1 does bind in the canyon (21). Evidence that the canyon is the receptor binding site in poliovirus comes from the study of two types of viral mutants: soluble receptor resistant (srr) mutants and viruses adapted to utilize mutant PVRs. Detergent-solubilized PVR expressed in insect cells converts poliovirus to 135S particles, neutralizing its infectivity (13). Poliovirus mutants resistant to neutralization with soluble PVR have been selected that possess a range of binding defects to PVR (22, 23). Each srr mutant contains a single mutation, located on the surface or the interior of the capsid. The surface mutations (Fig. 2) are located in the canyon and may form part of the contact site for PVR. Mutation at any one of eight residues decreases the binding affinity of poliovirus for PVR, indicating that multiple points in the virus-receptor interface contribute to binding. Mutations at internal capsid residues also reduce binding affinity. These residues are not likely to contact the receptor directly but may affect the ability of the virus to bind to PVR with high affinity by altering the flexibility of the capsid. The proximity of several of the internal mutations near a hydrocarbon binding pocket that appears to contain sphingosine (24) is consistent with this hypothesis. This pocket is believed to regulate the ability of the capsid to undergo receptor-mediated structural transitions (24).

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

EARLY EVENTS IN POLIOVIRUS INFECTION: VIRUS-RECEPTOR INTERACTIONS

11380

FIG. 2. α-Carbon trace of the poliovirus type 1 Mahoney protomer (6). Upper left, a single protomer viewed from the side; lower right, two neighboring protomers shown in different colors, viewed from the outside of the particle. The fivefold, twofold, and threefold axes of symmetry, the VP1 BC loop, the canyon floor, and canyon wall are labeled. Sphingosine (sph) in the hydrocarbon-binding pocket is shown as blue spheres, srr mutations are shown as a white line labeled contact region, and adapting mutations are shown as yellow spheres and their amino acid residues are given (e.g., 1095, residue 95 of VP1). Additional information on capsid sequences that control receptor interaction comes from the analysis of viral variants that are adapted to grow on cells expressing mutant forms of PVR that do not bind wild-type 1 poliovirus (25). PVR mutants d, g, and i (Fig. 1) were constructed by substituting residues of PVR with corresponding amino acids from MPH (17). Stable mouse L-cell lines expressing d, g, or i mutants cannot bind poliovirus, but viral variants were isolated that can utilize the mutant PVRs to infect cells. These adapted viruses can still use wild-type PVR to infect cells and, therefore, possess an expanded receptor recognition. Sequence analyses and site-directed mutagenesis identified three sites of mutation that are responsible for the adapted virus phenotype (Fig. 2). Every adapted mutant contained a change at VP1 position 95 from Pro to Ser or Thr; when either amino acid is introduced into wild-type virus by site-directed mutagenesis, viruses are produced that can use all three mutant receptors. Position 95 of VP1 is located in the B–C loop at the fivefold axis of symmetry, distant from the putative receptor contact site defined by srr mutations (Fig. 2). Although it is possible that this portion of the capsid also contacts PVR, the lack of allele specificity of the VP1–95 adapting mutation suggests that this residue is not likely to contact the mutated portions of PVR. This sequence might instead modulate the flexibility of the capsid and its ability to accommodate mutant receptors, a mechanism consistent with the absence of allele specificity. Substitution of the entire VP1 B–C loop with the sequence from the mouse-adapted type 2 Lansing strain (P2/Lansing) enables P1/Mahoney to recognize an unidentified receptor in mice that cannot be used by the wild-type virus (26, 27). In this case, the VP1 B– C loop of P2/Lansing loop may directly contact the mouse receptor, or it may impart to the capsid the flexibility to recognize a new receptor. A second adapting mutation is a change from Val to Ile at VP1 amino acid 160. This amino acid is located at the interface between protomers (the capsid subunit consisting of one copy each of VP1, VP2, VP3, and VP4), near the hydrophobic binding pocket of VP1. This mutation is not allele specific and might also act by influencing the flexibility of the capsid. The VP1–160 mutation also allows P1/Mahoney to recognize a receptor in mice, thereby causing disease in that host. The mouse-adapted P2/Lansing strain contains an Ile at amino acid 1160; curiously, it can use the g receptor but not the d and i receptors. A third adapting mutation, a change from His to Tyr at VP2 amino acid 142, is located on the canyon wall near the receptor binding site defined by the srr mutations. This mutation is allele-specific and will only correct the defect conferred by the d and g mutations, which are adjacent in PVR (Fig. 1). The nature of the amino acid at this location in the capsid may influence the contact point with PVR. The type 3 Leon strain of poliovirus Y at VP2–142 can only bind the d receptor. These studies emphasize the serotype-specific differences in the interaction of poliovirus with PVR.

Does PVR Require a Cofactor? A mAb directed against HeLa cells that blocks the binding of poliovirus to HeLa cells in a serotype-specific manner (28) recognizes an isoform of the lymphocyte homing receptor CD44H (29). This cell surface molecule is not a receptor for poliovirus, because expression of CD44H cDNA in PVR-negative mouse L cells does not confer the ability to bind poliovirus. Because the protein recognized by this mAb is restricted to certain tissues that are susceptible to poliovirus infection, it was suggested that CD44 might be a determinant of poliovirus tissue tropism (28). However, the results of growth curve analyses indicate that all three poliovirus serotypes multiply normally in cells that express PVR but not CD44, and the addition of CD44 by stable transformation has no effect on virus multiplication. Furthermore, the binding affinity constant for all three poliovirus serotypes is identical in the presence or absence of CD44 (M.Bouchard and V.R.R., unpublished data). We conclude that CD44 is not required for poliovirus replication in cell culture. CD44H and PVR may be associated in the cell membrane, and the anti-CD44 mAb may block poliovirus binding by its proximity to the virus binding site on PVR.

Summary The results discussed herein suggest an hypothesis for how the interaction of poliovirus with PVR might initiate uncoating of

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

EARLY EVENTS IN POLIOVIRUS INFECTION: VIRUS-RECEPTOR INTERACTIONS

11381

the viral RNA. Contact between the virus and receptor occurs through capsid residues in the canyon and the C
-C ridge on domain 1 of PVR. High-affinity binding is probably dependent on the nature of the contact residues in the virus and the receptor and on capsid residues at the protomer interface and in the interior that allow the capsid to conform to the receptor. Because the contact points in the canyon are located at the protomer interface, above the hydrocarbon-binding pocket, the interaction with PVR may destabilize the interface and weaken the affinity of sphingosine for the pocket. As additional PVR molecules bind to the capsid, sphingosine may be released, leading to complete destabilization of the capsid. The RNA might then emerge from a portal at the protomer interface. Crystallographic resolution of the virusreceptor complex will be required to demonstrate precisely how the virus and receptor interact. Whether or not PVR, either in soluble form or associated with membranes, is sufficient to drive RNA uncoating can also be determined experimentally. Finally, the location in the cell at which the uncoating event occurs must be identified. These experiments will provide clues about how cell receptors participate in the uncoating of an icosahedral virus. Work cited from my laboratory has been supported by the National Institutes of Health and the American Cancer Society. 1. White, J. (1994) in Cellular Receptors for Animal Viruses, ed. Wimmer, E. (Cold Spring Harbor Lab. Press, Plainview, NY), pp. 281–301. 2. White, J. (1990) Annu. Rev. Physiol. 52, 675–697. 3. Greber, U., Willetts, M., Webster, P. & Helenius, A. (1993) Cell 75, 477–486. 4. Joklik, W.K. & Darnell, J.E. (1961) Virology 13, 439–447. 5. Fricks, C.E. & Hogle, J.M. (1990) J. Virol. 64, 1934–1945. 6. Hogle, J.M., Chow, M. & Filman, D.J. (1985) Science 229, 1358–1365. 7. Mendelsohn, C., Wimmer, E. & Racaniello, V.R. (1989) Cell 56, 855–865. 8. Bernhardt, G., Bibb, J.A., Bradley, J. & Wimmer, E. (1994) Virology 199, 105–113. 9. Eberl, F., Dubreuil, P., Mattei, M.G., Devilard, E. & Lopez, M. (1995) Gene 159, 267–272. 10. Lopez, M., Eberl, F., Mattei, M.G., Gabert, J., Birg, F., Bardin, F., Maroc, C. & Dubreuil, P. (1995) Gene 155, 261–265. 11. Morrison, M.E. & Racaniello, V.R. (1992) J. Virol. 66, 2807– 2813. 12. Bibb, J.A., Bernhardt, G. & Wimmer, E. (1994) J. Virol. 68, 6111–6115. 13. Kaplan, G., Freistadt, M.S. & Racaniello, V.R. (1990) J. Virol. 64, 4697–4702. 14. Zibert, A., Selinka, H.-C., Elroy-Stein, O. & Wimmer, E. (1992) Virus Res. 25, 51–61. 15. Gómez Yafal, A., Kaplan, G., Racaniello, V.R. & Hogle, J.M. (1993) Virology 197, 501–505. 16. Racaniello, V.R. (1995) in Human Enterovirus Infections, ed. Rotbart, H.A. (Am. Soc. Microbiol., Washington, DC), pp. 73–93. 17. Morrison, M.E., Yuan-Jing, H., Wien, M.W., Hogle, J.W. & Racaniello, V.R. (1994) J. Virol. 68, 2578–2588. 18. Ryu, S., Kwong, P.D., Truneh, A., Porter, T.G., Arthos, J., Rosenberg, M., Dai, X., Xuong, N., Axel, R., Sweet, R.W. & Hendrickson, W.A. (1990) Nature (London) 348, 419–426. 19. Harber, J., Bernhardt, G., Lu, H.-H., Sgro, J. & Wimmer, E. (1995) Virology 214, 559–570. 20. Rossmann, M.G., Arnold, E., Erickson, J.W., Frankenberger, E.A., Griffith, J.P., Hecht, H.-J., Johnson, J.E. & Kamer, G. (1985) Nature (London) 317, 145–153. 21. Olson, N.H., Kolatkar, P.R., Oliveira, M.A., Cheng, R.H., Greve, J.M., McClelland, A., Baker, T.S. & Rossmann, M.G. (1993) Proc. Natl. Acad. Sci. USA 90, 507–511. 22. Kaplan, G., Peters, D. & Racaniello, V.R. (1990) Science 250, 1596–1599. 23. Colston, E. & Racaniello, V.R. (1994) EMBO J. 13, 5855–5862. 24. Filman, D.J., Syed, R., Chow, M., Macadam, A.J., Minor, P.D. & Hogle, J.M. (1989) EMBO J. 8, 1567–1579. 25. Colston, E.M. & Racaniello, V.R. (1995) J. Virol. 69, 4823–4829. 26. Martin, A., Wychowski, C., Couderc, T., Crainic, R., Hogle, J. & Girard, M. (1988) EMBO J. 7, 2839–2847. 27. Murray, M.G., Bradley, J., Yang, X.F., Wimmer, E., Moss, E.G. & Racaniello, V.R. (1988) Science 241, 213–215. 28. Shepley, M.P., Sherry, B. & Weiner, H.L. (1988) Proc. Natl. Acad. Sci. USA 85, 7743–7747. 29. Shepley, M.P. & Racaniello, V.R. (1994) J. Virol. 68, 1301–1308.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

EFFICIENT TRANSFER, INTEGRATION, AND SUSTAINED LONG-TERM EXPRESSION OF THE TRANSGENE IN ADULT RAT BRAINS INJECTED WITH A LENTIVIRAL VECTOR

11382

This paper was presented at a colloquium entitled “Genetic Engineering of Viruses and of Virus Vectors,” organized by Bernard Roizman and Peter Palese (Co-chairs), held June 9–11, 1996, at the National Academy of Sciences in Irvine, CA.

Efficient transfer, integration, and sustained long-term expression of the transgene in adult rat brains injected with a lentiviral vector LUIGI NALDINI *, ULRIKE BLÖMER, FRED H.GAGE, DIDIER TRONO †, AND INDER M.VERMA The Salk Institute for Biological Studies, P.O. Box 85800, San Diego, CA 92186–5800 ABSTRACT We describe the construction of a safe, replication-defective and efficient lentiviral vector suitable for in vivo gene delivery. The reverse transcription of the vector was found to be a rate-limiting step; therefore, promoting the reaction inside the vector particles before delivery significantly enhanced the efficiency of gene transfer. After injection into the brain of adult rats, sustained long-term expression of the transgene was obtained in the absence of detectable pathology. A high proportion of the neurons in the areas surrounding the injection sites of the vector expressed the transduced β-galactosidase gene. This pattern was invariant in animals sacrificed several months after a single administration of the vector. Transduction occurs by integration of the vector genome, as it was abolished by a single amino acid substitution in the catalytic site of the integrase protein incorporated in the vector. Development of clinically acceptable derivatives of the lentiviral vector may thus enable the sustained delivery of significant amounts of a therapeutic gene product in a wide variety of somatic tissues. Gene therapy is a promising new form of medicine because of its potential to reverse the genetic causes of several innate and acquired diseases (1, 2). The currently available methods of gene delivery suffer from several major limitations that curtail the realization of these high expectations. Nonviral methods are inefficient and only attain a transient expression of the transgene, while no viral vector yet offers a satisfactory combination of efficacy of gene transfer, sustained transgene expression, and biosafety (3, 4). Adenoviral vectors allow highly efficient delivery of the transgene in most tissues in vivo, but its expression is transient. This is mostly due to the immune response against the transduced cells, which also express a low level of viral proteins (5–9). Vectors derived from oncoretroviruses, such as the Moloney leukemia virus (MLV), integrate the transgene in the genome of the target cells without transferring any viral gene, two properties considered crucial for the sustained expression of the transgene (10). These prototypic retroviral vectors, however, are severely restricted in their potential targets, as they only transduce cells that divide shortly after infection (11). Consequently, they are most often employed in demanding ex vivo protocols of gene transfer (12–16). Furthermore, transcriptional shutoff of the transgene after reimplantation in vivo of the transduced cells is frequently observed (17, 18). We have previously described a human lentivirus (HIV)-based vector that can transduce nondividing cells. As the particles are pseudotyped with the envelope of the vesicular stomatitis virus (VSV), the vector can serve to introduce genes into a broad range of tissues and can be used in vivo (19). Furthermore, we demonstrate that in vivo gene transfer is dependent on a functional integrase protein and that transgene expression is sustained for several months without detectable pathology. These characteristics suggest that lentiviral vectors could play a major role in the arena of gene therapy.

MATERIALS AND METHODS Plasmid Construction. The construction of the HIV-derived plasmids pCMV∆R9, pHR
-CMVLacZ, and pHR
-CMVLucif has been described (19). Plasmid pCMV∆R8.2 was derived from pCMV∆R9 by substituting, for a 2.7-kbp SalI-BamHI fragment, a 0.5-kbp SalI-NotI fragment (obtained by a PCR that added to the proviral HIV-1 NL4–3 DNA sequence, at the end of the vpu gene, a stop codon in the env reading frame followed by a NotI site) and a 0.85-kbp NotI-BamHI fragment from pHR
, containing a NotI linker introduced at the BglII site 7620 in the HIV-1 HXB2D sequence, the Rev responsive element and the splice acceptor site for the second exon of the tat and rev genes. The construction deletes nucleotides 6308–7611 of the HIV-1 NL4–3 genome, encompassing a large portion of the env coding sequence, from the packaging plasmid. Its remaining HIV-1 sequences are derived from plasmid pR7 (20) [nucleotides 708–1506 and 7620–9416 in the HXB2D sequence (21)] and NL4.3 (nucleotides 1507– 6307). Plasmid pMD.G drives the expression of the VSV.G reading frame from the human cytomegalovirus immediateearly promoter (hCMV) and contains β-globin sequences upstream (exons 2 and 3, intervening sequence 2) and downstream (polyadenylylation site) of it. All plasmids contain the simian virus 40 origin of replication in the backbone. Production and Assays of Vectors. Human kidney 293T cells (1.5×106) were plated on 10-cm plates and transfected the following day with 15 µg of pCMV∆R8.2, 20 µg of either pHR
plasmid, and 5 µg of pMD.G by calcium phosphate DNA precipitation (22). Conditioned medium was harvested 62 hr after transfection, cleared of debris by low-speed centrifugation, filtered through 0.45-µm filters, and assayed for p24 Gag antigen by ELISA (DuPont). For transduction of rat 208F fibroblasts, cells were infected overnight with serial dilutions of vector stock in culture medium supplemented with 8 µg of polybrene per ml. After medium replacement, the cells were further incubated for 36 hr, and expression of β-galactosidase (β-gal) was scored by 5-bromo-4-chloro-3-indolyl β-D-galac

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact. Abbreviations: MLV, Moloney leukemia virus; VSV, vesicular stomatitis virus; hCMV, human cytomegalovirus immediate-early promoter; β-gal, β-galactosidase. *Present address: Somatix Therapy Corporation, 850 Marina Village Parkway, Alameda, CA 94501. †To whom reprint requests should be addressed, e-mail: didier_trono@ qm.salk.edu

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

EFFICIENT TRANSFER, INTEGRATION, AND SUSTAINED LONG-TERM EXPRESSION OF THE TRANSGENE IN ADULT RAT BRAINS INJECTED WITH A LENTIVIRAL VECTOR

11383

toside (X-Gal) staining. Titers were calculated by counting the number of foci of blue cells per well and dividing it by the dilution factor. Expression of luciferase was assayed by washing the cultures twice with TBS (50 mM Tris·HCl, pH 7.8/130 mM NaCl/10 mM KCl/5 mM MgCl2), extracting them with 0.5% Nonidet P-40 in TBS containing 1 mM dithiotreithol, and measuring luminescence in a luminometer. Concentrated vector stocks were prepared by ultracentrifugation of conditioned medium at 50,000×g for 90 mm, resuspension of the pellets in a small volume (half percent of the starting volume of medium) of TBS containing 10 mM MgCl2, pooling, and incubation with or without 0.1 mM of each of the four deoxynucleotides (dNTPs), 3 mM spermine, and 0.3 mM spermidine for 2 hr at 37°C. After dilution in TBS, the vector particles were concentrated by a second ultracentrifugation, and the final pellet was resuspended in a very small volume (half thousandth of the starting volume of medium) of sterile saline containing 4 µg of polybrene per ml. Resuspension of the second pellet required prolonged incubation and pipetting. Stocks were stored frozen at −80°C and titered before and after freezing. MLV-based β-gal vector was similarly produced by the transient transfection into 293T cells of a plasmid driving the MLV gag and pol genes from the hCMV promoter (the vector pLNL-CMVLacZ, which carries the same β-gal expression cassette as the HIV-based vector) and the pMD.G plasmid. Before injection, all batches of vector were tested for the absence of replication-competent virus by infecting HeLa cells at high multiplicity of infection (HeLa P4 cells, which express CD4 and contain an integrated LacZ gene driven by the HIV long terminal repeat), obtained from the American Type Culture Collection stock (23), and HeLa cells previously transduced with a lentiviral vector carrying a different reporter gene and selected for its expression. The transduced cells were passaged two to three times, and the conditioned medium was tested for transfer of the markers to virgin 208F fibroblasts or for β-gal-inducing activity on P4 cells. In Vivo Delivery of Vectors and Immunostaining of Sections from the Injected Brains. All animal procedures were performed according to an institution-approved protocol and under strict biological containment. Adult female Fischer 344 rats were anesthetized (ketamine, 44 mg/kg; acepromazine, 0.75 mg/kg; and xylazine, 4 mg/kg, in 0.9% NaCl i.p.) and positioned in a stereotactic head frame. After midline incision of the skin, holes were drilled in the appropriate locations in the skull with a dental bur, and a 5-µl Hamilton syringe with needle was used to slowly inject 2 µl of vector suspension in sterile saline into the striatum (AP +0.2, ML±3.5, DV −4.5) and hippocampus (AP −3.5, ML 3.0, DV −4.0) bilaterally. Holes were then filled with bone wax, the incision was sutured, and the animals were returned to their cages. For assessing transduction, the rats were deeply anesthetized and perfused with 4% cold paraformaldehyde and 0.2% glutaraldehyde intracardially. The brains were removed, post-fixed at 24 hr, saturated in 30% sucrose, and sectioned on a freezing microtome (50-µm serial sections). For light microscopy, sections were incubated with rabbit anti-β-gal antibodies (1:1000; Cortex Pharmaceuticals, Irvine, CA) and stained using avidinbiotin-peroxidase (Vectastain ABC Elite; Vector Laboratories) and diaminobenzidine. For immunofluorescence labeling, mouse monoclonal anti-NeuN and guinea pig anti-GFAP antibodies, secondary antibodies coupled to the fluorescent markers CY5, dichlorotriazinyl amino fluorescein, and Texas Red were also used, and the mounted sections were analyzed by confocal scanning laser microscopy (Bio-Rad model MRTC600). Fluorescent signals were collected, digitally color enhanced, and superimposed.

FIG. 1. Schematic of the generation of lentiviral vector. The relevant portions of the three plasmids cotransfected into 293T cells are depicted at the top; their contribution to the vector particles harvested in the transfectant conditioned medium are depicted at the bottom. pCMV∆R8.2, the packaging construct, provides all vector proteins but the envelope. The viral genes are expressed from the hCMV promoter and the insulin polyadenylylation site. Proviral 5
leader and Ψ sequences have been deleted together with a large portion of the env gene. A translation stop codon was inserted upstream of the remaining env segment. The major 5
splice donor site (SD) has been conserved. pHR
, the transducing vector, provides the vector genome. The viral long terminal repeats (LTRs) and the Ψ sequence are indicated. The gag gene is truncated after 350 bp and is out of frame (×), and it follows the Rev responsive element (RRE) and a splice acceptor site (SA). The position of a hCMV-driven expression cassette for the β-gal cDNA (LacZ) is shown. pMD.G encodes the heterologous VSV envelope that pseudotypes the vector. The hCMV promoter drives the VSV.G reading frame, which has β-globin sequences upstream (exons 2 and 3, intervening sequence 2) and downstream [poly(A) site].

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

EFFICIENT TRANSFER, INTEGRATION, AND SUSTAINED LONG-TERM EXPRESSION OF THE TRANSGENE IN ADULT RAT BRAINS INJECTED WITH A LENTIVIRAL VECTOR

11384

RESULTS Generation of High-Titer Lentiviral Vector with Improved Biosafety. The lentiviral vector is produced by the transient transfection of three plasmids into human kidney 293T cells (Fig. 1). Two complementary constructs were derived from the HIV-1 proviral DNA. The packaging construct expresses all HIV trans-acting proteins but the envelope from heterologous transcription signals. The transducing vector, pHR
, retains all HIV cis-acting sequences required for its transfer to the target cell, now framing an expression cassette for the transgene. The Escherichia coli β-gal gene and the firefly luciferase gene driven by the hCMV promoter were used as reporter genes in this study. A novel packaging plasmid, pCMV∆R8.2, was constructed to improve the biosafety of the vector. It was derived from the previously described plasmid pCMV∆R9 by deletion of 1.4 kbp from the env gene sequence, downstream of the (functional) vpu gene, and substitution with an inframe stop codon. The deletion of env sequences did not affect the yield or the transduction efficiency of the vector particles. The third plasmid, pMD.G, encodes the heterologous VSV envelope and is used for pseudotyping the particles generated by the other two constructs. High-titer stocks were obtained by pelleting the vectors from the transfectants conditioned medium by two rounds of ultracentrifugation at 50,000×g for 90 min, as described for VSV.G-pseudotyped MLV vectors (24). Vector yield averaged 50% for each centrifugation step, both measured as p24 Gag equivalent and as transducing units in 208F rat fibroblasts. The overall yield of the protocol was 25%, with an increase in transducing titer of three orders of magnitude. As the transfectant conditioned medium contained, on average, 4×105 transducing units/ml, titers of 2–4×108 transducing units/ml were routinely achieved. When normalized to the content of p24 Gag antigen, the transducing activity of the vector was not affected by the centrifugation steps, averaging 4500 transducing units per ng of p24 in 208F fibroblasts. The absence of replication-competent virus from all vector stocks was proven by the lack of spreading or mobilization of reporter genes from transduced cells (see Materials and Methods). Transduction Is Enhanced by Promoting Intraparticle Reverse Transcription. We previously showed that the HIV-based vector is less efficient in cells arrested in G0 than in cells growing or arrested in G1/S or G2. This became more marked the longer the culture had been in G0 and correlated with a progressive block in reverse transcription of the vector genome (19). We decided to test whether promotion of the reaction inside the vector particle, as described by Zhang et al. (25) for the HIV virus, would enhance its transducing activity. Upon incubation with a mixture of the four dNTPs and the polyamine spermine and spermidine for 2 hr at 37°C, the transduction of a luciferase reporter gene increased 2-fold in growing 208F fibroblasts and up to 5-fold in G0-arrested cells, becoming independent of the length of growth-arrest of the culture (Fig. 2). We then tested whether a similar effect was observed in the transduction of terminally differentiated cells in vivo. High Efficiency of Transduction by the Lentiviral Vector of Rat Brain Neurons in Vivo. Stocks of lentiviral β-Gal vector, matched for the content of p24 Gag antigen, were incubated with or without dNTPs and polyamines for 2 hr at 37°C before injection. β-Gal MLV-based vector, pseudotyped with the VSV envelope, was also treated with the dNTPs and matched for transducing activity on 208F cells. Vector suspension (2 µl) was injected into the corpus striatum and hippocampus of both sides of the brain of anesthetized adult female Fisher rats. Groups of three animals each were sacrificed at increasingly longer time intervals (2 weeks, 6 weeks, 3 months) from a single vector administration. Transduction rate was assessed for each injected brain by serial cryostatic sectioning, and immunostaining of each sixth section for β-gal. The relative proportion of transduced cell types was estimated by immunofluorescence costaining of representative sections with antibodies directed against β-gal and cell type-specific markers and confocal microscope analysis.

FIG. 2. Transduction is enhanced by promoting reverse transcription inside the lentiviral vector before infection. Rat 208F cells were plated at low density and either infected the following day (Growing) or grown to confluence, switched to medium containing 5% calf serum and 2 µM dexamethasone (11), and further incubated for the indicated number of weeks before infection (G0 x weeks, where x=number of weeks) with lentiviral luciferase vector preincubated with or without dNTPs and polyamines. Transduction was scored by comparing luminescence in cell extracts 48 hr after infection with both vectors. Plotted is the mean±SEM increase in transduction by the treated vector over the level induced by the untreated vector, calculated from infections performed at three different multiplicities of infection over a hundred-fold range in a typical experiment. In the cells arrested in G0, the transduction by the untreated vector was 28% (G0 1 week), 18% (G0 2 weeks), and 13% (G0 3 weeks) of that scored in growing cells.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

EFFICIENT TRANSFER, INTEGRATION, AND SUSTAINED LONG-TERM EXPRESSION OF THE TRANSGENE IN ADULT RAT BRAINS INJECTED WITH A LENTIVIRAL VECTOR

11385

FIG. 3 . Immunohistochemical staining for β-gal of sections from the corpus striatum (Left) or the hippocampus (Right) of rat brains injected with a single dose of β-gal vector 2 weeks or 3 months before. The viral parent of the injected vector is indicated on the left, as also is the pretreatment of vector with dNTPs and polyamines. The HIV integrase mutant carries a single amino acid replacement in the catalytic site (D64V), which severely reduces the activity of the enzyme incorporated in the vector. Note the lower magnification in the three bottom rows. The lentiviral vector achieves an efficient gene transfer into cells of typical neuronal morphology; the transduction is significantly enhanced by the pretreatment with dNTPs and is abolished by the integrase mutation. No change in the pattern and density of β-gal-expressing cells is observed even after 3 months. In contrast, the MLV-derived vector shows a poor gene transfer, exclusively in cells of glial morphology, and no expression is detected after 3 months. The sections shown are representative of those obtained in the proximity of each injected site in all animals in the experimental group. One of every six serial sections from the injected brains was stained, and transduced cells could be detected in up to six stained sections, for the lentiviral vector treated with dNTPs.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

EFFICIENT TRANSFER, INTEGRATION, AND SUSTAINED LONG-TERM EXPRESSION OF THE TRANSGENE IN ADULT RAT BRAINS INJECTED WITH A LENTIVIRAL VECTOR

11386

FIG. 4. Immunofluorescence staining for β-gal and the neuronal marker NeuN of sections from the corpus striatum (Upper) and the hippocampus (Lower) of a rat brain injected 6 weeks earlier with lentiviral β-gal vector pretreated with dNTPs. Shown are confocal microscope images obtained from each individual staining (Middle and Right) and their overlap (Left). A significant fraction of the neurons in the area surrounding the injection site expresses the transgene. A conspicuous fraction of cells was reproducibly transduced by the lentiviral vector around the injection site, and cells expressing β-gal could be detected up to several millimeters away from it, as shown in Fig. 3 A, B, I, and J. The majority of transduced cells showed neuronal morphology and, when costained for immunofluorescence, expressed the neuronal marker protein NeuN (ref. 26; Fig. 4). Treatment of the lentiviral vector with dNTPs before delivery enhanced significantly its transduction rate in vivo (Fig. 3, compare A and B with C and D). An estimate of the average density of transduced cells indicated at least a 2-fold increase (data not shown). The MLV-based vector displayed a comparatively poor transduction rate (Fig. 3 E and F). Cells transduced by the MLV vector were smaller and different from those predominantly stained in lentiviral-injected brains and looked like oligodendrocytes and astrocytes. As expected, none could be found by immunofluorescence analysis that expressed β-gal together with the neuronal marker NeuN (data not shown). Long-Term Expression of the Transgene in Vivo with No Detectable Pathology. The pattern and the estimated density of cells expressing β-gal in the injected areas did not change appreciably with the time elapsed since administration of the lentiviral vector. This remained true for 3 months, the longest time examined (Fig. 3 I and J). Occasionally, some detectable tissue damage in the injection site was observed at the earlier times after injection, possibly related to local bleeding, but the majority of the examined tissues were remarkably unaffected by the delivery and expression of the transgene, as also seen by hematoxylin and eosin staining (data not shown). Furthermore, the distribution of glial cells was not altered in the injected areas, as documented by immunofluorescent staining for the expression of the astrocytic marker glial fibrillary acidic protein (data not shown). In brains injected with the MLV-based vector and examined at late times after administration, almost no cells were detected that still expressed the transgene (Fig. 3 K and L). Transduction in Vivo Occurs by Integration of the Transgene. To verify whether transduction in vivo occurs by integration of the transgene, we used a β-gal vector incorporating a mutant form of integrase carrying a single amino acid substitution (D64V) in the catalytic site. The generation and biological properties of this mutation, both in the context of the HIV virus and the lentiviral vector, have been described (27),(19). While the mutation severely decreases the activity of the enzyme in vitro and in vivo, it has no detectable effect on the preceding steps of the infection pathway, including particle budding, entry into the target cell, reverse transcription, and nuclear import. It did, though, reduce transduction by the β-gal vector in vitro to a residual activity <2% of that of the wild-type. For testing its effect in vivo, a concentrated stock of vector incorporating the mutant enzyme was prepared as above, matched to the wild-type for content of p24 Gag antigen, and injected into the brain of three rats. In all injected sites, examined either after 2 or 6 weeks, from none to a couple of rare cells could be detected expressing β-gal, providing genetic evidence that expression of the transgene in vivo depends on its integration (Fig. 3 G and H).

DISCUSSION The design of a viral vector system relies upon the segregation in the viral genome of cis-acting sequences involved in its transfer to target cells from trans-acting sequences encoding the viral proteins. The prototype vector particle is assembled by viral proteins expressed from constructs stripped of all cis-acting sequences. These sequences are instead used to frame the expression cassette for the transgene driven by an heterologous promoter. As the particle will transfer only the latter construct, the infection process is limited to a single round without spreading. The safety and efficiency of an actual vector system depends on the extent to which this ideal, complete segregation of cis- and trans-acting functions is obtained.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

EFFICIENT TRANSFER, INTEGRATION, AND SUSTAINED LONG-TERM EXPRESSION OF THE TRANSGENE IN ADULT RAT BRAINS INJECTED WITH A LENTIVIRAL VECTOR

11387

In the case of HIV, several sequences have been implicated by deletion studies in the encapsidation and dimerization of viral RNA. In contrast to MLV, where the Ψ sequence, located in the 5
-untranslated leader downstream of the major splice donor site, strongly contributes to RNA packaging, the role of the corresponding region in the HIV genome seems more to discriminate genomic from spliced transcripts than to promote efficient encapsidation (28–30). Additional, and possibly more important, sequences have been identified in the transcribed long terminal repeats and 5
leader sequences upstream of the major splice donor site (31–35). A major caveat, however, is that reconstitution of the packaging function has not yet been reported by juxtaposition of the identified sequence(s) to heterologous RNA (36). Thus, the packaging signal of HIV is either highly sequence-specific or, more likely, multipartite and distributed over a rather large stretch of its 5
sequence (37). Several features of the HIV-derived packaging plasmid described here prevent its transfer to the target cells. The combined modifications of the 5
end delete or disrupt all structural motifs to date implicated in RNA encapsidation and dimerization, with the possible exception of the 5
portion of the gag sequence (30, 38, 39). Recently, McBride and Panganiban (35) reported the encapsidation efficiency of HIV-1 transcripts carrying deletions of the 5
leader sequence; relative to the wild-type counterpart, it was reduced to <0.1 for transcripts derived from a construct comparable to pCMV∆R8.2 and to <0.02 in the presence of competing wild-type RNA (35). Furthermore, the deletion of both long terminal repeats and of the primer binding site from the packaging plasmid would prevent reverse transcription and integration of any encapsidated transcript not recombined with the vector RNA. The transducing vector, on the other hand, is endowed with a full complement of the cis-acting sequences not identified until now, which allows its proficient transfer to the target cell. It is well recognized that the retroviral infection is an inefficient process. Once the content of virions is delivered inside the target cell, uncoating, reverse transcription, interaction with cytoplasmic chaperones and the nuclear import machinery, and maturation to an integrationcompetent complex take place. These events, the mechanism of which is still poorly understood, can result in degradation and arrest at a stable intermediate, as well as integration of the viral genome (40). Partial reverse transcripts have been detected in HIV and MLV virions (41–43). Recently, it was shown that viral DNA synthesis can be promoted inside intact HIV-1 particles by exposure to dNTPs and magnesium chloride and that the efficiency of the reaction can be increased by the addition of the polyamine spermine and spermidine (25, 44, 45). The resulting HIV-1 virions exhibit an increased infectivity in primary T lymphocytes infected before activation, a setting in which reverse transcription was previously demonstrated to be a rate-limiting step (46–48). The stimulation of reverse transcription inside virions was also shown to increase the transduction efficiency of MLV-based retroviral vectors in dividing targets (49). Here, we find that it significantly augments the efficacy of gene transfer mediated by the lentiviral vector. This effect was most pronounced in nondividing cells and could also be observed in vivo. Performing such in vitro reverse transcription reactions before injecting the vector may be critical for some nonproliferating targets that maintain low cytoplasmic pools of dNTPs (50, 51). The crucial advantage of the lentiviral vector is its integration in the genome of nondividing cells. This was proven here by the dependence of the transduction on the incorporation of a functional integrase in the vector. At least in the case of the brain, the only tissue studied so far, this provides for long-term sustained expression of the transgene. No decrease in the extent of β-gal immunoreactivity was observed even 3 months after a single vector administration. Given the recent report of predominant transgene-directed immune responses in animals transduced with adenoviral vectors (52), it remains to be determined whether the brain represents an immune haven, as long suspected, or whether the adenoviral proteins expressed by the transduced cells played a critical adjuvant role. Retroviruses are thought to select, through poorly understood mechanisms, active chromatin sites for the integration of their genome (40). This may explain why gene delivery methods based on MLV-derived vectors often suffer from the transcriptional shutoff of the transgene, as was observed in this study, when the transduced cells return to a nonproliferating status and presumably revise their pattern of chromatin expression. The ability of the lentiviral vector to integrate in nondividing cells may allow for the selection of stably open chromatin sites, thus ensuring against the transcriptional silencing of the transgene. The high prevalence of neurons observed among the transduced cell types in the brain may be due both to the neurotropism of the envelope of the VSV, a rhabdovirus (53), and to a preferential expression of the hCMV promoter in neurons, as recently observed with transgenic animals (54). It may also reflect preferential long-term expression in nondividing cells, for the reasons discussed above. A major issue now concerns the biosafety of the lentiviral vector. The novel feature of the packaging plasmid described in this paper precludes the generation of wild-type HIV viruses, even by unlikely rearrangement and recombination events, given the actual absence of most of HIV env sequences in all three plasmids. In the previously described plasmid pCMV∆R9, the env reading frame was blocked by insertion of a linker containing multiple stop codons. The use of a separate plasmid encoding a heterologous envelope makes it extremely unlikely that a replication-competent recombinant be generated. This would require multiple recombination events between different plasmids and/or endogenous retroviral sequences, including recombination between nonhomologous sequences. Careful scrutiny and improvement of the vectorproducing system, including evaluation of the minimal set of viral genes required for efficient packaging of the vector and generation of stable packaging systems better amenable to monitoring, are now required. We are extremely grateful to R.Pomerantz and colleagues for communicating their results before publication. We thank members of the Verma, Gage, and Trono laboratories for helpful suggestions. L.N. was supported by the American-Italian Cancer Foundation, and U.B. was supported by the Deutsche Forschungsgemeinschaft (DFG). This work is supported by grants from the National Institutes of Health and the American Cancer Society (I.M.V.), U.S. Public Health Service Grant AI37510 (D.T.); National Institutes of Health Grants AG10435 and 08514 and Hollfelder Foundation (F.H.G.); and the H.N. and Frances Berger Foundation (D.T., I.M.V., and F.H.G.). I.M.V. is an American Cancer Society Professor of Molecular Biology and D.T. is a Pew Scholar. 1. Mulligan, R.C. (1993) Science 260, 926–932. 2. Verma, I. (1994) Mol. Med. 1, 2–3. 3. Crystal, R.G. (1995) Science 270, 404–410. 4. Leiden, J.M. (1995) New Engl. J. Med. 333, 871–873. 5. Yang, Y., Li, Q., Ertl, J. & Wilson, J.M. (1994) Proc. Natl. Acad. Sci. USA 91, 4407–4411. 6. Yang, Y., Ertl, J. & Wilson, J.M. (1994) Immunity 1, 433–442. 7. Dai, Y., Schwarz, E.M., Gu, D., Zhang, W.-W., Sarvetnick, N. & Verma, I.M. (1995) Proc. Natl. Acad. Sci. USA 92, 1401–1405. 8. Knowles, R.M., Hohneker, K.W., Zhou, Z., Olsen, J.C., Noah, T.L., Hu, P.-C., Leigh, M., Engelhardt, J.F., Edwards, L.J., Jones, K.R., Grossman, M., Wilson, J.M., Johnson, L.G. & Boucher, R.C. (1995) New Engl. J. Med. 333, 823–831. 9. Kremer, E.J. & Perricaudet, M. (1995) Br. Med. Bull. 51, 31–44. 10. Miller, A.D., Miller, D.G., Garcia, J.V. & Lynch, C.M. (1993) Methods Enzymol. 217, 581–599.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

EFFICIENT TRANSFER, INTEGRATION, AND SUSTAINED LONG-TERM EXPRESSION OF THE TRANSGENE IN ADULT RAT BRAINS INJECTED WITH A LENTIVIRAL VECTOR

11388

11. Miller, D.G., Adam, M.A. & Miller, A.D. (1990) Mol. Cell. Biol. 10, 4239–4242. 12. Dai, Y., Roman, M., Naviaux, R.K. & Verma, I.M. (1992) Proc. Natl. Acad. Sci. USA 89, 10892–10895. 13. Blaese, R.M., Culver, K.W., Miller, A.D., Carter, C.S., Fleisher, T., Clerici, M., Shearer, G., Chang, L., Chiang, Y., Tolstoshev, P., Greenblatt, J.J., Rosenberg, S.A., Klein, H., Berger, M., Mullen, C.A., Ramsey, W.J., Muul, L., Morgan, R.A. & Anderson, W.F. (1995) Science 270, 475–480. 14. Bordignon, C., Notarangelo, L.D., Nobili, N., Ferrari, G., Casorati, G., Panina, P., Mazzolari, E., Maggioni, D., Rossi, C., Servida, P., Ugazio, A.G. & Mavilio, F. (1995) Science 270, 470–475. 15. Kohn, D.B., Weinberg, K.J., Nolta, J.A., Heiss, L.N., Lenarski, C., et al. (1995) Nat. Med. 1, 1017–1023. 16. Grossman, M., Radar, D.J., Muller, D.W.M., Kolansky, D.M., Kozarsky, K., Clark, B.J.I., Stein, E.A., Lupien, P.J., Brewer, H.B., Raper, S.E. & Wilson, J.M. (1995) Nat. Med. 1, 1148– 1154. 17. Scharfmann, R., Axelrod, J.H. & Verma, I.M. (1991) Proc. Natl. Acad. Sci. USA 88, 4626–4630. 18. Palmer, T.D., Rosman, G.J., Osborne, W.R.A. & Miller, A.D. (1991) Proc. Natl. Acad. Sci. USA 88, 1330–1334. 19. Naldini, L., Blomer, U., Gallay, P., Ory, D., Mulligan, R., Gage, F.H., Verma, I.M. & Trono, D. (1996) Science 272, 263–267. 20. Trono, D., Feinberg, M.B. & Baltimore, D. (1989) Cell 59, 113–120. 21. Ratner, L., Haseltine, W., Patarca, R., Livak, K.J., Starcich, B., Josephs, S.F., Donan, E.R., Rafalski, J.A., Whitehorn, E.A., Baumeister, K., Ivanoff, L., Petteway, S.R., Pearson, M.L., Lautenberger, J.A., Papas, T.S., Gharayeb, J., Chang, N.T., Gaho, R.C. & Wong-Staal, F. (1985) Nature (London) 313, 277–284. 22. Chen, C. & Okayama, H. (1987) Mol. Cell. Biol. 7, 2745–2752. 23. Charneau, P., Mirambeau, G., Roux, P., Paulous, S., Buc, H. & Clavel, F. (1994) J. Mol. Biol. 241, 651–662. 24. Burns, J.C., Friedman, T., Driever, W., Burrascano, M. & Yii, J.-K. (1993) Proc. Natl. Acad. Sci. USA 90, 8033–8037. 25. Zhang, H., Dornadula, G. & Pomerantz, R.J. (1996) J. Virology 70, 2809–2824. 26. Mullen, R.J., Buck, C.R. & Smith, A.M. (1992) Development (Cambridge, U.K.) 116, 201–211. 27. Leavitt, A.D., Robles, G., Alesandro, N. & Varmus, H.E. (1996) J. Virol. 70, 721–728. 28. Lever, A., Gottlinger, H., Haseltine, W. & Sodroski, J. (1989) J. Virol. 63, 4085–4087. 29. Aldovini, A. & Young, R.A. (1990) J. Virol. 64, 1920–1926. 30. Luban, J. & Goff, S.P. (1994) J. Virol. 68, 3784–3793. 31. Kim, H.-J., Lee, K. & O’Rear, J.J. (1994) Virology 198, 336–340. 32. Vicenzi, E., Dimitrov, D.S., Engelman, A., Migone, T.-S., Purcell, D.F.J., Leonard, J., Englund, G. & Martin, M.A. (1994) J. Virol. 68, 7879–7890. 33. Geigenmuller, U. & Linial, M.L. (1996) J. Virol. 70, 667–671. 34. Paillart, J.-C., Skripkin, E., Ehresmann, B., Ehresmann, C. & Marquet, R. (1996) Proc. Natl. Acad. Sci. USA 93, 5572–5577. 35. McBride, M.S. & Panganiban, A. (1996) J. Virol. 70, 2963–2973. 36. Berkowitz, R.D., Hammarskjöld, M.-L., Helga-Maria, C., Rekosh, D. & Goff, S.P. (1995) Virology 212, 718–723. 37. Kaye, J.F., Richardson, J.H. & Lever, A.M.L. (1995) J. Virol. 69, 6588–6592. 38. Buchschacher, G.L.J. & Panganiban, A.T. (1992) J. Virol. 66, 2731–2739. 39. Parolin, C., Dorfman, T., Palú, G., Göttlinger, H. & Sodroski, J. (1994) J. Virol. 68, 3888–3895. 40. Coffin, J.M. (1990) in Virology, eds. B.N.Fields & D.M.Knipe (Raven, New York), pp. 1437–1500. 41. Trono, D. (1992) J. Virol. 66, 4893–4900. 42. Lori, R., di Marzo Veronese, F., De Vico, A.L., Lusso, P., Reitz, M.S., Jr., & Gallo, R.C. (1992) J. Virol. 66, 5067–5074. 43. Zhu, J. & Cunningham, J.M. (1993) J. Virol. 67, 2385–2388. 44. Zhang, H., Zhang, Y., Spicer, T.P., Abbott, L.Z., Abbott, M. & Poiesz, B.J. (1993) AIDS Res. Hum. Retroviruses 9, 1287–1296. 45. Zhang, H., Zhang, Y., Spicer, T., Henrard, D. & Poiesz, B. (1995) J. Virol. 69, 3675–3682. 46. Zack, J.A., Haislip, A.M., Krogstad, P. & Chen, I.S.Y. (1992) J. Virol. 66, 1717–1725. 47. Gao, W.-Y., Cara, A., Gallo, R.C. & Lori, F. (1993) Proc. Natl. Acad. Sci. USA 90, 8925–8928. 48. Meyerhans, A., Vartanian, J.-P., Hultgren, C., Plikat, U., Karlsson, A., Wang, L., Eriksson, S. & Wain-Hobson, S. (1994) J. Virol. 68, 535–540. 49. Zhang, H., Duan, L.-X., Dornadula, G. & Pomerantz, R.J. (1995) J. Virol. 69, 3929–3932. 50. Cohen, A., Barankiewica, J., Lederman, H.M. & Gelfand, E.W. (1983) J. Biol. Chem. 258, 12334–12340. 51. McCormick, P.J., Danhauser, L.L., Rustum, Y.M. & Bertram, J.S. (1983) Biochem. Biophys. Res. Comm. 755, 36–40. 52. Tripathy, S.K., Black, H.B., Goldwasser, E. & Leiden, J.M. (1996) Nat. Med. 2, 545–550. 53. Wagner, R.R. (1987) in Rhabdovirus Biology and Infection: An Overview, ed. Wagner, R.R. (Plenum, New York), pp. 9–74. 54. Baskar, J.F., Smith, P.P., Nilaver, G., Jupp, R.A., Hoffmann, S., Peffer, N.J., Tenney, D.J., Colberg-Poley, A.M., Ghazal, P. & Nelson, J.A. (1996) J. Virol. 70, 3207–3214.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

USE OF VIRION DNA AS A CLONING VECTOR FOR THE CONSTRUCTION OF MUTANT AND RECOMBINANT HERPESVIRUSES

11389

This paper was presented at a colloquium entitled “Genetic Engineering of Viruses and of Virus Vectors” organized by Bernard Roizman and Peter Palese (Co-chairs), held June 9–11, 1996, at the National Academy of Sciences in Irvine, CA.

Use of virion DNA as a cloning vector for the construction of mutant and recombinant herpesviruses (γ-2 herpesvirus/gene transfer/viral oncogenesis/T lymphocyte) S.MONROE DUBOISE, JIE GUO, RONALD C.DESROSIERS, AND JAE U.JUNG * Department of Microbiology and Molecular Genetics, New England Regional Primate Research Center, Harvard Medical School, Southborough, MA 01772–9102 ABSTRACT We have developed improved procedures for the isolation of deletion mutant, point mutant, and recombinant herpesvirus saimiri. These procedures take advantage of the absence of NotI and AscI restriction enzyme sites within the viral genome and use reporter genes for the identification of recombinant viruses. Genes for secreted engineered alkaline phosphatase and green fluorescent protein were placed under simian virus 40 early promoter control and flanked by NotI and AscI restriction sites. When permissive cells were cotransfected with herpesvirus saimiri virion DNA and one of the engineered reporter genes cloned within herpesvirus saimiri sequences, recombinant viruses were readily identified and purified on the basis of expression of the reporter gene. Digestion of recombinant virion DNA with NotI or AscI was used to delete the reporter gene from the recombinant herpesvirus saimiri. Replacement of the reporter gene can be achieved by NotI or AscI digestion of virion DNA and ligation with a terminally matched fragment or, alternatively, by homologous recombination in cotransfected cells. Any gene can, in theory, be cloned directly into the virion DNA when flanked by the appropriate NotI or AscI sites. These procedures should be widely applicable in their general form to most or all herpesviruses that replicate permissively in cultured cells. Large DNA viruses, such as the orthopoxviruses and herpesviruses, are useful as gene transfer vectors, because they can easily accommodate substantial amounts of additional DNA in their genomes (1–3). Accessory genes unnecessary for replication of these viruses can be eliminated to modulate the virus’ properties and to help ensure their safety. In the case of herpesviruses, persistence of the viral genetic information may be useful for some applications where continued foreign gene expression is desirable. We have been manipulating the genetic information of herpesvirus saimiri (HVS) to obtain a better understanding of its natural life cycle and to use it as a gene transfer vector for experimental vaccine and therapeutic strategies. HVS infection is endemic and apparently apathogenic in squirrel monkeys (Saimiri sciureus; refs. 4–6). The virus is extremely oncogenic, however, in other nonhuman primates, producing fulminant T-cell lymphoproliferative diseases (7, 8). HVS is the prototypic and best characterized γ-2 herpesvirus (Rhadinovirus; refs. 9 and 10). The only known human γ-2 herpesvirus, the recently discovered human herpesvirus 8, or Kaposi sarcoma associated herpesvirus, shows greatest homology with HVS and shares a similar genomic organization (11, 12). Studies on the mechanisms of HVS oncogenicity are expected to contribute to the understanding of Kaposi sarcoma and possibly other disorders believed to be associated with human herpesvirus 8 infection (13–15). Previous characterization of HVS oncogenesis has demonstrated that sequences near the left end of the viral genome are unnecessary for viral replication but essential for oncogenesis and in vitro transformation of common marmoset lymphocytes (16–19). This region contains an oncogene designated as saimiri transforming protein (STP; refs. 20 and 21). The complete nucleotide sequence of HVS subgroup A strain 11 has revealed other open reading frames that possibly contribute to the transforming capacity of the virus (22). Among these are genes encoding a viral cyclin related to cyclin D1 (23, 24), a homolog of the superantigen of mouse mammary tumor virus (25), a CD-59 homolog (26), a G protein-coupled receptor homologous to the cellular interleukin 8 receptor (27), a Bcl-2 homolog (28), and an interleukin 17 homolog (29, 30). Striking sequence differences have been noted between viruses in subgroup A and the more oncogenic subgroup C in the region of the genome containing the STP oncogene (20, 21). Highly oncogenic subgroup C isolates of HVS immortalize human and rhesus monkey T lymphocytes in vitro (31, 32), and they contain a divergent STP gene (20, 21) and a unique gene encoding tyrosine kinase interacting protein (Tip), which interacts with the major T-cell tyrosine kinase Lck (33–35). Construction of replication-competent deletion mutant viruses allows in vitro and in vivo assessments of the contribution of these genes to viral induced transformation. Nononcogenic deletion mutants of HVS may also provide a basis for development of γ-2 herpesvirus gene transfer vectors capable of persistently infecting lymphoid cells. In contrast to other γ herpesviruses such as Epstein-Barr virus that fail to grow permissively in cell culture systems, HVS is capable of productive lytic infection of cultured New World primate monolayer cells (36). This greatly facilitates the generation of mutant and recombinant viruses. Progress has recently been reported in cell culture production of human herpesvirus 8 (37), but procedures for serial propagation, production in large quantities, and for genetic manipulation of human herpesvirus 8 have not been defined. In the work reported here, we describe methods that have significantly facilitated selection of mutant and recombinant HVS strains with the potential for use as nononcogenic HVS gene transfer vectors. We also report direct cloning of a replaceable foreign gene expression cassette into HVS. The methods described

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact. Abbreviations: HVS, herpesvirus saimiri; STP, saimiri transforming protein; Tip, tyrosine kinase interacting protein; SEAP, secreted engineered alkaline phosphatase; GFP, green fluorescent protein; SV40, simian virus 40. *To whom reprint requests should be addressed at: New England Regional Primate Research Center, Harvard Medical School, P.O. Box 9102, Southborough, MA 01772–9102. e-mail: jjung@warren. med.harvard.edu.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

USE OF VIRION DNA AS A CLONING VECTOR FOR THE CONSTRUCTION OF MUTANT AND RECOMBINANT HERPESVIRUSES

11390

should have general utility for genetic manipulation of other herpesviruses.

MATERIALS AND METHODS Cell Culture, Virus, and Virion DNA. Herpesvirus saimiri strain C-488 was propagated in low passage (<30 passages) owl monkey kidney cells (OMK 637) grown in minimal essential medium (MEM) supplemented with penicillin, streptomycin, L-glutamine, and 10% (vol/ vol) heat-inactivated fetal bovine serum (GIBCO/BRL). Tests of reporter plasmid expression were conducted in COS-1 cells cultivated in Dulbecco’s modified Eagle’s medium with high glucose supplemented with 10% fetal bovine serum, penicillin, streptomycin, and L-glutamine. Virion DNA was prepared by removing cell debris from supernatants of infected OMK cells by low-speed centrifugation, pelleting the virus by centrifugation at 40,000×g for 2 hr in an SS-34 rotor, disrupting the virus at 60°C for 2 hr in lysis buffer (10 mM Tris, pH 8.5/1 mM EDTA/1% sarkosyl/0.1 mg of proteinase K per ml), and then extracting the aqueous solution first with an equal volume of phenol and then twice with chloroform. All pipetting was done with sterile tips that were cut to facilitate manipulation of intact viral genomes without significant shearing. Virion DNA prepared in this manner was sufficiently pure and intact for use in transfection of OMK cells for selection of desired recombinant viruses. Reporter Plasmid Construction. Reporter gene expression cassettes contained either secreted engineered alkaline phosphatase (SEAP) or green fluorescent protein (GFP) from Aequorea victoria under the control of the simian virus 40 (SV40) early promoter and enhancer. Polymerase chain reaction (PCR) using Vent polymerase (New England Biolabs) was employed to amplify components of the expression cassettes from commercially available plasmids and to add selected restriction enzyme sites. SV40 early promoter, enhancer, and polyadenylylation elements with a NotI site available for insertion of a reporter gene were amplified from a modified pSVβ (CLONTECH) from which the LacZ reporter had been eliminated by NotI digestion and ligation to produce a reporterless vector. The 5
primer, CGCGGTACCGATATCGCCGGCGCGCCGGTACAGCTTGTGGAATGTGTGTCA, added KpnI, EcoRV, SgrAI, and AscI restriction sites while the 3
primer, CGCTCTAGAGCTCACGTGGCGCGCCGGCGGATAAAAACCTCCCACACCT, added XbaI, SacI, PmlI, AscI, and SgrAI sites. Digestion of the PCR product with KpnI and XbaI allowed cloning of the control elements into corresponding sites in pNEB193 (New England Biolabs). The SEAP reporter was amplified from pBC12/PL/SEAP (Tropix, Bedford, MA) using primers that added flanking NotI sites. Primers used were AGAGAATTCGCGGCCGCATATCGTCGACAAGCTTCTGC and CAGTCTAGAGCGGCCGCGGGTTAACCCGGGTGCGCGGCG. NotI-digested PCR product was cloned into the NotI site of the vector containing SV40 control elements to produce the plasmid pSV40/SEAP. The similar GFP expression cassette was constructed by deleting the SEAP gene from the expression cassette with SalI and SmaI and inserting GFP from pGFP (CLONTECH) digested with SalI and StuI. Reporter function was tested by DEAE-dextran-mediated transfection into COS-1 cells (38), followed by assay of expression at 48–72 hr posttransfection. SEAP production and secretion was detected by liquid scintillation counter measurement of chemiluminescence produced in assays of cell culture medium using Phospha-Light reagents (Tropix, Bedford, MA) according to the manufacturer’s recommendations. GFP production was detected visually by observation of bright green fluorescence produced at an excitation wavelength of 495 nm using an Olympus IMT-2 fluorescence microscope. Gene Deletion Plasmid Construction. A 3.6-kb plasmid clone (p488PX) of a PstI/XbaI fragment derived from the left end of the herpesvirus saimiri group C strain 488 genome and containing the STP-C488 oncogene has been described (21). This PstI/XbaI fragment was transferred into pNEB193. A 508-bp deletion, including 273 bp of STP-C488, was introduced by replacement of a SpeI/EcoRV fragment (nucleotides 1318– 1825 of HVS-C488) with an XbaI/EcoRV fragment from pSV40/SEAP containing the SEAP expression cassette. Similarly, a deletion in the Tip gene (nucleotides 1226–454 of HVS-C488) was made by replacement of a StuI/HpaI fragment (nucleotides 879–438) with the SV40/SEAP cassette in a PmlI/EcoRV fragment. Transfections and Isolation of Recombinant HVS. Production of recombinant HVS by mixed transfection of infectious virion DNA and linearized plasmid containing specific mutations has been described (18, 19). In this study, mutant virus containing a deletion in STP-C488 was produced by homologous recombination in subconfluent monolayers of OMK cells cotransfected by Ca2+ coprecipitation of virion DNA and deletion plasmid at a molar ratio of 1:200. Plasmid DNA for transfection was linearized with FspI, which was then heat-inactivated at 65°C for 20 min. Transfected cells were incubated in MEM with 10% fetal bovine serum at 37°C until the cell monolayer was completely destroyed by the cytopathic effect of virus replication at 10–12 days after transfection. Serial 10-fold dilutions in MEM of virus produced from transfections were added to individual wells (0.3 ml per well) of 48-well tissue culture plates (Corning). At 10–12 days after infection, wells showing cytopathic effect were identified microscopically to be tested further for evidence of reporter gene expression from recombinant virus. Individual wells containing virus were assayed for SEAP production using the Phospha-Light chemiluminescent assay (Tropix) performed in opaque 96-well microtiter plates read in a MicroBeta scintillation counter (Wallac, Gaithersburg, MD). SEAP expressing HVS recombinant virus was purified by selection of SEAP-positive wells at high dilution during repeated limiting dilution passages of the virus. To produce virus containing the STP-C488 deletion, but with the SEAP reporter removed, recombinant virion DNA was digested with either NotI or AscI. After restriction enzymes were heat-inactivated at 65°C for 30 min, virion DNA was ligated overnight with T4 ligase (Takara Shuzo, Kyoto) and then transfected into OMK cells. The resultant SEAP negative virus was purified by limiting dilution as described above. To demonstrate rescue of wild-type phenotype, DNA from virions of the STP-C488 deletion virus was used for cotransfection with linearized wild-type p488PX plasmid, followed by limiting dilution purification of SEAP negative virus with STP-C488 restored. By OMK cell cotransfection of virion DNA from SV40/SEAP expressing Tip deletion virus along with linearized pSV40/GFP, replacement of the SEAP expression cassette with the GFP cassette via homologous recombination was performed. GFP expressing Tip deletion virus was isolated by limiting dilution and microscopic screening for GFP fluorescence. Direct Cloning into STP-Deleted Herpesvirus Saimiri. To demonstrate use of virion DNA directly as a cloning vector, virion DNA prepared from recombinant HVS∆STP/SV40-SEAP was digested with AscI to remove the SEAP expression cassette. The plasmid pSV40/GFP was similarly digested with AscI. AscI was subsequently heat-inactivated at 65°C for 30 min. The digested viral DNA was further treated with heat-killed phosphatase (Epicentre Technologies, Madison, WI) to dephosphorylate the viral vector DNA ends. Digested and dephosphorylated viral DNA was incubated overnight with 100-fold molar excess of SV40/GFP insert DNA and T4 DNA ligase. As a control, an identical mixture except without ligase added was incubated in parallel. The ligation mixture

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

USE OF VIRION DNA AS A CLONING VECTOR FOR THE CONSTRUCTION OF MUTANT AND RECOMBINANT HERPESVIRUSES

11391

and the control mixture were then transfected into subconfluent OMK cells, which were observed beginning at 6 days by fluorescence microscopy for the appearance of cells producing GFP. Virus from the transfections was serially diluted in MEM and placed in individual wells of 48-well plates (Corning) for isolation of the GFP-expressing virus. Individual wells containing virus from each transfection were assessed microscopically for GFP expression and by chemiluminescent assay for SEAP expression.

RESULTS Isolation of a HVS Recombinant Using a SEAP Reporter as a Selection Marker. An SV40 early promoter-driven SEAP expression cassette was designed for insertion into cloned HVS genes considered likely to be nonessential for virus replication. One such gene, the STPC488 oncogene, was targeted for deletion by inserting the SV40/SEAP reporter in place of a 508-bp SpeI/EcoRV fragment (including most of the STP gene) in a 3.6-kb plasmid clone. The selection method for the recombinant virus is illustrated in Fig. 1. As indicated, cotransfection of OMK cells with infectious virion DNA together with linearized plasmid containing the SV40/SEAP expression cassette in the STP-C488deleted region resulted in homologous recombination producing STP-C488 deleted virus expressing the reporter gene. To assure purification of recombinant virus, limiting dilution plating onto OMK monolayers was serially repeated 7 times. In the first passage at a dilution of 10−7, 10% of wells contained SEAP-positive virus. Enrichment for SEAP positive recombinant virus at each step resulted in only SEAP-positive virus being detected by passage 3. Removal of the Exogenous Expression Cassette from STP-C488-Deleted HVS. The SV40/SEAP expression cassette was designed to contain restriction enzyme recognition sites not present in the HVS genome. AscI sites flanking the complete expression cassette and NotI sites flanking the SEAP gene were included to allow removal of either the entire expression cassette or the reporter gene only. The ability to remove foreign control elements and genes conveniently is useful for a variety of applications. Ectopic expression of a reporter gene or presence of a foreign promoter could inadvertently result in an altered phenotype. Overnight digestion of virion DNA containing SV40/SEAP at the STPC488 locus with either AscI or NotI followed by heat inactivation of the enzyme and overnight ligation of the viral DNA resulted in production of

FIG. 1. Method for STP-C488 deletion mutant isolation by homologous recombination. A and N indicate AscI and NotI recognition sites, respectively.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

USE OF VIRION DNA AS A CLONING VECTOR FOR THE CONSTRUCTION OF MUTANT AND RECOMBINANT HERPESVIRUSES

11392

uniformly SEAP-negative virus (see Fig. 1 for schematic). The success of this manipulation suggested that the AscI and NotI restriction sites may also be useful for direct cloning approaches for construction of HVS gene transfer vectors. Replacement of the SV40/SEAP Expression Cassette in Recombinant HVS Using Homologous Recombination or Direct Cloning Strategies. Fig. 2 illustrates alternative strategies for the use of nononcogenic HVS deletion mutant viruses containing SV40/SEAP for construction of gene transfer vectors. Homologous recombination can clearly be used to replace the SEAP expression cassette with another expression cassette essentially by the same procedure used for selection of the STP-C488-deleted recombinant virus (Fig. 1). In this case, however, loss of SEAP expression serves as the selection marker. To demonstrate the general applicability of this procedure for gene replacement, we employed an additional deletion mutant virus, HVS∆Tip/SV40-SEAP. Replacement of the SV40/SEAP reporter in the HVS∆Tip/ SV40-SEAP virus with the comparable SV40/GFP cassette by homologous recombination was performed as outlined in Fig. 2A. Approximately 2% of the wells plated in the first limiting dilution passage after the mixed transfection showed strong green fluorescence. Also, this homologous recombination method was similarly used to restore the wild-type STPC488 gene to the STP-deleted recombinant virus (marker rescue). Insertion of a foreign gene (GFP) into the HVS∆STP/ SV40-SEAP virus was achieved by direct cloning into the AscI sites of virion DNA as described in Materials and Methods and illustrated in Fig. 2B. An SV40/GFP expression cassette was directly inserted as an AscI fragment into virion DNA and transfected into OMK cells. Virus produced by transfection of the ligation mixture was diluted and plated in multiwell plates such that there was less than one infectious particle per well. SEAP and GFP expression was assessed for each infected well (Table 1). SEAP activity was completely eliminated by AscI digestion. From a total of 40 virus infected wells that we observed, cells from 36 wells fluoresced brightly green (Fig. 3 and Table 1). Ligase activity endogenous in the OMK cells was also apparently capable of mediating insertion of SV40/GFP at reduced efficiency under the conditions of high molar excess of insert to virion DNA that was provided; in the assessment of the control (ligase omitted) transfection, GFP-producing virus was detected in 7 (21%) of the 33 wells assessed, while the remaining 26 wells (79%) were SEAP-negative and GFP-negative, indicating that the virus in these wells was derived from self-ligation of the AscI-digested virus (Table 1). The results clearly indicate that the SEAP reporter gene alone or the entire SV40/SEAP expression cassette can be removed directly from virion DNA and that it is possible to directly clone expression cassettes into the AscI sites of the recombinant virus.

Table 1. Reporter assays at passage 1 of transfectants following restriction enzyme digestion and ligation manipulations of recombinant HVS/ STP-C488/SV40/SEAP virion DNA Treatment conditions SEAP-negative, % GFP-positive, % NotI digestion and ligation with no insert 100 NT AscI digestion and ligation with no insert 100 NT AscI digestion, dephosphorylation, and ligation with excess SV40/GFP AscI-digested 100 90 insert AscI digestion, dephosphorylation, and incubation with excess SV40/GFP 100 21 AscI-digested insert, but no T4 ligase NT, not tested.

DISCUSSION Identification and isolation of recombinant herpesviruses can be greatly facilitated by use of an appropriate selection method. Advantageous properties of SEAP and GFP reporters

FIG. 2. Two methods for introduction of foreign genes into HVS deletion mutants: (A) homologous recombination and (B) direct cloning. A and N indicate AscI and NotI restriction sites, respectively.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

USE OF VIRION DNA AS A CLONING VECTOR FOR THE CONSTRUCTION OF MUTANT AND RECOMBINANT HERPESVIRUSES

11393

have been previously reported (39–41). Application of each of these selection markers to the process of identifying recombinant HVS is a significant advance compared with methods previously used to isolate deletion mutants of HVS or other herpesviruses (1, 18, 19). Assay for SEAP requires only a minute sample of culture medium for a rapid and sensitive test. Assay of cell-free supernatant for SEAP may also be useful for detecting recombinant viruses with minimal lytic activity. Use of GFP requires no sampling and no additional reagents. The level of GFP expression was sufficient in the HVS recombinants to produce a fluorescent signal that was readily detected microscopically. While the wild-type Aequorea GFP used was more than adequate in intensity to detect fluorescence, variants are now available that are brighter, have different excitation and/or emission spectra, and are optimized in codon usage for maximum expression in mammalian cells (42–45). Both SEAP and GFP provide the opportunity for reduction of the time required for recombinant virus identification and isolation. Early detection of recombinants is possible before extensive cytopathic effect is observed and does not disturb the continued growth of the virus to high titers.

FIG. 3. Expression of GFP cloned directly into STP-C488-deleted HVS digested with AscI. OMK cells infected with HVS∆STP/SV40-GFP are shown illuminated with (A) visible light, (B) visible and 495-nm light, and (C) 495-nm light only. Positive selection of SEAP or GFP aids in isolation of initial recombinant HVS and then provides in the purified recombinant the equally useful negative selection tool, loss of the reporter, for isolation of marker-rescued virus or other recombinants as desired. We are currently using these procedures to isolate HVS strains with point mutations in STP and Tip and to isolate HVS recombinants capable of expressing antigens of other organisms for the purpose of vaccination. Inclusion of unique restriction sites flanking the reporter gene in recombinant HVS greatly facilitates subsequent genetic manipulation and allows use of virion DNA directly as a cloning vector. Similar direct cloning into a large DNA virus, a baculovirus, has been reported (46). Simple removal of the reporter gene may be desirable for some in vivo applications. The NotI and AscI sites were intentionally positioned to allow removal of the reporter gene open reading frame alone, or in combination with the promoter and poly(A) elements. Any gene with or without a promoter can in theory be cloned directly into the virion DNA when flanked by the appropriate NotI or AscI sites. To our knowledge, this is the first report of direct cloning into a herpesvirus. The procedures outlined here are expected to be particularly flexible for a variety of applications. We thank J.Newton, T.Connors, and A.Hampson for manuscript preparation. This work was supported by Public Health Service Grants CA31363 and AI38131 and Grant RR00168 from the Division of Research Resources. 1. Glorioso, J.C., DeLuca, N.A. & Fink, D.J. (1995) Annu. Rev. Microbiol. 49, 675–710. 2. Ward, P.L. & Roizman, B. (1994) Trends Genet. 10, 267–274. 3. Smith, G.L. & Moss, B. (1983) Gene 25, 21–28. 4. Melendez, L.V., Daniel, M.D., Hunt, R.D. & Garcia, F.G. (1968) Lab. Anim. Care 18, 374–381. 5. Falk, L.A., Wolfe, L.G. & Deinhardt, F. (1972) J. Natl. Cancer Inst. 48, 1499–1505. 6. Desrosiers, R.C. & Falk, L.A. (1982) J. Virol. 43, 352- 356. 7. Melendez, L.V., Hunt, R.D., Daniel, M.D., Fraser, C.E.O., Barahona, H.H., Garcia, F.G. & King, N.W. (1972) in Oncogenesis and Herpesviruses, eds. Biggs, P.M., de The, G. & Payne, L.N. (IARC, Lyons, France), pp. 451–461. 8. Fleckenstein, B. (1982) Biochim. Biophys. Acta 560, 301–342. 9. Fleckenstein, B. & Desrosiers, R.C. (1982) in The Herpesviruses, ed. Roizman, B. (Plenum, New York), pp. 253–332. 10. Jung, J.U. & Desrosiers, R.C. (1994) in Encyclopedia of Virology, eds. Webster, R. & Granoff, A. (Saunders, Philadelphia), pp. 614–622. 11. Chang, Y., Cesarman, E., Pessin, M.S., Lee, F., Culpepper, J., Knowles, D.M. & Moore, P.S. (1994) Science 266, 1865–1869. 12. Moore, P.S., Gao, S.J., Dominguez, G., Cesarman, E., Lungu, O., Knowles, D.M., Garber, R., Pellett, P.E., Mcgeoch, D.J. & Chang, Y. (1996) J. Virol. 70, 549–558. 13. Cesarman, E., Chang, Y., Moore, P.S., Said, J.W. & Knowles, D.M. (1995) N. Engl. J. Med. 332, 1186–1191. 14. Soulier, J., Grollet, L., Oksenhendler, E., Cacoub, P., Cazals-Hatem, D., Babinet, P., d’Agay, M.-F., Clauvel, J.-P., Raphael, M., Degos, L. & Sigaux, F. (1995) Blood 86, 1275–1280. 15. Said, J.W., Chien, K., Takeuchi, S., Tasaka, T., Asou, H., Cho, S.K., de Vos, S., Cesarman, E., Knowles, D.M. & Koeffler, H.P. (1996) Blood 87, 4937–4943. 16. Desrosiers, R.C., Silva, D.P., Waldron, L.M. & Letvin, N.L. (1986) J. Virol. 57, 701–705. 17. Desrosiers, R.C., Bakker, A., Kamine, J., Falk, L.A., Hunt, R.D. & King, N.W. (1985) Science 228, 184–187. 18. Desrosiers, R.C., Burghoff, R.L., Bakker, A. & Kamine, J. (1984) J. Virol. 49, 343–348. 19. Murthy, S.C.S., Trimble, J.J. & Desrosiers, R.C. (1989) J. Virol. 63, 3307–3314. 20. Biesinger, B., Trimble, J.J., Desrosiers, R.C. & Fleckenstein, B. (1990) Virology 176, 505–514. 21. Jung, J.U., Trimble, J.J., King, N.W., Biesinger, B., Fleckenstein, B.W. & Desrosiers, R.C. (1991) Proc. Natl. Acad. Sci. USA 88, 7051–7055. 22. Albrecht, J.-C., Nicholas, J., Biller, D., Cameron, K.R., Biesinger, B., Newman, C., Wittmann, S., Craxton, M.A., Coleman, H., Fleckenstein, B. & Honess, R.W. (1992) J. Virol. 66, 5047–5058.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

USE OF VIRION DNA AS A CLONING VECTOR FOR THE CONSTRUCTION OF MUTANT AND RECOMBINANT HERPESVIRUSES

11394

23. Nicholas, J., Cameron, K.R. & Honess, R.W. (1992) Nature (London) 355, 362–365. 24. Jung, J.U., Stäger, M. & Desrosiers, R.C. (1994) Mol. Cell. Biol. 14, 7235–7244. 25. Yao, Z., Maraskovsky, E., Spriggs, M.K., Cohen, J.I., Armitage, R.J. & Alderson, M.R. (1996) J. Immunol. 156, 3260–3266. 26. Rother, R.P., Rollins, S.A., Fodor, W.L., Albrecht, J.-C., Setter, E., Fleckenstein, B. & Squinto, S.P. (1994) J. Virol. 68, 730–737. 27. Ahuja, S.K. & Murphy, P.M. (1993) J. Biol. Chem. 268, 20691– 29694. 28. Smith, C.A. (1995) Trends Cell Biol. 5, 344. 29. Yao, Z., Painter, S.L., Fanslow, W.C., Ulrich, D., Macduff, B.M., Spriggs, M.K. & Armitage, R.J. (1995) J. Immunol. 155, 5483–5486. 30. Yao, Z., Fanslow, W.C., Seldin, M.F., Rousseau, A.-M., Painter, S.L., Comeau, M.R., Cohen, J.I. & Spriggs, M.K. (1995) Immunity 3, 811–821. 31. Biesinger, B., Müller-Fleckenstein, I., Simmer, B., Lang, G., Wittman, S., Platzer, E., Desrosiers, R.C. & Fleckenstein, B. (1992) Proc. Natl. Acad. Sci. USA 89, 3116–3119. 32. Mittrucker, H.-W., Müller-Fleckenstein, I., Fleckenstein, B. & Fleischer, B. (1992) J. Exp. Med. 176, 909–913. 33. Biesinger, B., Tsygankov, A.Y., Fickenscher, H., Emmrich, F., Fleckenstein, B., Bolen, J.B. & Broker, B.M. (1995) J. Biol. Chem. 270, 4729–4734. 34. Jung, J.U., Lang, S.M., Friedrich, U., Jun, T., Roberts, T.M., Desrosiers, R.C. & Biesinger, B. (1995) J. Biol. Chem. 270, 20660–20667. 35. Jung, J.U., Lang, S.M., Jun, T., Roberts, T.M., Veillette, A. & Desrosiers, R.C. (1995) J. Virol. 69, 7814–7822. 36. Daniel, M.D., Silva, D. & Ma, N. (1976) In Vitro 12, 290–294. 37. Renne, R., Zhong, W.D., Herndier, B., Mcgrath, M., Abbey, N., Kedes, D. & Ganem, D. (1996) Nat. Med. 2, 342–346. 38. Cullen, B.R. (1987) Methods Enzymol. 152, 684–704. 39. Berger, J., Hauber, J., Hauber, R., Geiger, R. & Cullen, B.R. (1988) Gene 66, 1–10. 40. Cullen, B.R. & Malim, M.H. (1992) Methods Enzymol. 216, 362–368. 41. Chalfie, M., Tu, Y., Euskirchen, G., Ward, W.W. & Prasher, D.C. (1994) Science 263, 802–805. 42. Cubitt, A.B., Heim, R., Adams, S.R., Boyd, A.E., Gross, L.A. & Tsien, R.Y. (1995) Trends Biochem. Sci. 20, 448–455. 43. Heim, R. & Tsien, R.Y. (1996) Curr. Biol. 6, 178–182. 44. Rizzuto, R., Brini, M., De Giorgi, F., Rossi, R., Heim, R., Tsien, R.Y. & Pozzan, T. (1996) Curr. Biol. 6, 183–188. 45. Crameri, A., Whitehorn, E.A., Tate, E. & Stemmer, W.P.C. (1996) Nat. Biotechnol. 14, 315–319. 46. Ernst, W.J., Grabherr, R.M. & Katinger, H.W.D. (1994) Nucleic Acids Res. 22, 2855–2866.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

DEVELOPMENT OF HIV VECTORS FOR ANTI-HIV GENE THERAPY

11395

This paper was presented at a colloquium entitled “Genetic Engineering of Viruses and of Virus Vectors,” organized by Bernard Roizman and Peter Palese, Co-chairs, held June 9–11, 1996, at the National Academy of Sciences in Irvine, CA.

Development of HIV vectors for anti-HIV gene therapy

(lentivirus/T cell/packaging cell line/vesicular stomatitis virus glycoprotein G) ERIC POESCHLA*, PIERRE CORBEAU*, AND FLOSSIE WONG-STAAL*†‡ Departments of *Medicine and †Biology, Mail Code 0665, University of California at San Diego, 9500 Gilman Drive, La Jolla, CA 92093– 0665 ABSTRACT Current gene therapy protocols for HIV infection use transfection or murine retrovirus mediated transfer of antiviral genes into CD4+ T cells or CD34+ progenitor cells ex vivo, followed by infusion of the gene altered cells into autologous or syngeneic/allogeneic recipients. While these studies are essential for safety and feasibility testing, several limitations remain: long-term reconstitution of the immune system is not effected for lack of access to the macrophage reservoir or the pluripotent stem cell population, which is usually quiescent, and ex vivo manipulation of the target cells will be too expensive and impractical for global application. In these regards, the lentivirus-specific biologic properties of the HIVs, which underlie their pathogenetic mechanisms, are also advantageous as vectors for gene therapy. The ability of HIV to specifically target CD4+ cells, as well as non-cycling cells, makes it a promising candidate for in vivo gene transfer vector on one hand, and for transduction of non-cycling stem cells on the other. Here we report the use of replication-defective vectors and stable vector packaging cell lines derived from both HIV-1 and HIV-2. Both HIV envelopes and vesicular stomatitis virus glycoprotein G were effective in mediating high-titer gene transfer, and an HIV-2 vector could be cross-packaged by HIV-1. Both HIV-1 and HIV-2 vectors were able to transduce primary human macrophages, a property not shared by murine retroviruses. Vesicular stomatitis virus glycoprotein G-pseudotyped HIV vectors have the potential to mediate gene transfer into non-cycling hematopoietic stem cells. If so, HIV or other lentivirus-based vectors will have applications beyond HIV infection.

Quantitative Aspects of HIV Pathogenesis and the Strategy of Gene Therapy A remarkably quantitative model of the natural history of HIV infection has now coalesced from recent studies (1–10). Although a complete picture of pathogenesis is not yet at hand, there is every reason to believe that continuous, high-level viral replication is central to disease causation. Much insight has been gained from the ability to directly quantitate the virion genome itself in blood (1–4, 8, 9) and in tissues (5, 6), as opposed to following indirect surrogate markers or outgrowth of virus in culture. These studies have consolidated a new paradigm: Before the recent application of newer assays with higher sensitivity and dynamic range (e.g., branched-chain DNA, quantitative reverse transcription-PCR, in situ PCR), a model of long-term true microbiologic latency espousing little in vivo replication still held considerable sway. The new estimates reveal a furiously destructive process behind a facade of apparent clinical latency: approximately 1010 virions produced per day, 140 viral generations per year, a t1/2 for productively infected T cells of 1.6 days and for virions of about 6 hr, and a daily turnover of 109 infected CD4+ T cells; the latter rate estimate may exceed the normal turnover by several logs (1, 3, 4, 7). The numbers tie replication directly to pathogenesis and fit well with our understanding of quasi-species diversity in the lentivirinae, the subgroup of the family Retroviridae to which HIV-1 and HIV-2 belong. Characteristic properties of lentiviruses include high genetic complexity and incubation periods of months to many years before disease development (11). However, the two most singular features of lentiviral infections compared with those caused by other retroviruses are extent of replication within the host (1, 3, 4, 12) and the capacity to infect non-dividing or even postmitotic cells. For example, all lentiviruses infect terminally differentiated macrophages in vivo. HIV-1 viral RNA load, even a single initial measurement, has now been shown to correlate well with the prognosis for subsequent CD4+ lymphocyte depletion and disease development (2). It is thus reasonable to surmise that inhibition of viral replication can delay or prevent disease development. Emerging data with presently available combinations of antiretroviral agents targeted at the viral reverse transcriptase and protease suggest utility in some patients (13). Long-term outcomes with respect to viral load, development of multiply resistant virus, or disease status, however, have not yet been ascertained with these combinations. There is a general consensus that it is desirable to initiate therapy early, after infection, to forestall irreversible damage of virus to the immune system, e.g., by depleting the repertoire of immune cells. However, because therapy likely needs to be sustained for the life of the individual, strategies that confer long-term antiviral effects, such as gene therapy, would be important therapeutic options. Antiviral gene therapy, also termed intracellular immunization, aims to reconstitute the immune system with genetically altered cells that resist infection. Two key determinations are the choice of antiviral genes and the choice of gene delivery vehicles into relevant target cells.

Antiviral Genes The emergence of resistance mutants during antiviral drug monotherapy arises from three ineluctable realities: (i) the large number of HIV virions produced daily (1, 3, 4), (ii) the inherent variability yielded by RNA virus replication (11), and (iii) the inability of available drugs to completely suppress

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact. Abbreviations: VSV-G, vesicular stomatitis virus glycoprotein G; GFP, green fluorescent protein; LTR, long terminal repeat. ‡To whom reprint requests should be addressed, e-mail: fwongstaal@ ucsd.edu.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

DEVELOPMENT OF HIV VECTORS FOR ANTI-HIV GENE THERAPY

11396

replication (14). When viewed in the context of the quantitative properties of HIV infection in vivo, the apparently inevitable development of resistance following drug monotherapy illustrates a potential advantage for gene therapy of HIV disease. By virtue of their action through Watson-Crick base pairing, only nucleic acids (antisense molecules and ribozymes) can presently be prospectively targeted at specific sites within the approximately 10-kb HIV genome, which are widely or universally conserved in natural isolates (15, 16). Such regions are likely to be less susceptible to escape mutations that simultaneously preserve viability. Furthermore, genes that target these multiple sites can be combined to virtually eliminate the possibility of virus escape, akin to the concept of multidrug combinations, but still delivered in a single vector. Basic science investigations of steric interaction are also the fundamental source for protease inhibitors, the most potent anti-HIV drugs yet, which are among the first clinically effective drugs developed from precise knowledge of three-dimensional protein structure. Molecular prediction is, however, more versatile and more specific with nucleic acid-based therapies. Ribozymes are small, catalytic antisense RNAs that bind and cleave specific sites in target RNAs (17, 18). Cleavage, a cis reaction in the natural setting, can be engineered to occur in trans and results through the action of a central region containing secondary structure that is not base-paired with the substrate. The cleavage products are rapidly degraded in cells. The catalytic mechanism (one ribozyme molecule can cleave many substrate molecules in succession) may provide an advantage over antisense approaches. Our laboratory has concentrated on the hairpin ribozyme (19–27); other groups have employed hammerhead ribozymes for antiviral studies (28–31). Using Moloney murine leukemia virus-based retroviral vectors for delivery, hairpin ribozymes have been shown to confer protection from HIV-1 infection of T-cell lines, primary T cells, and macrophage-like progeny of CD34+ hematopoietic progenitor cells (19–25). The use of two ribozymes targeting the long terminal repeat (LTR) and env genes of HIV-1, each fused to an RNA decoy [the RRE (rev response) element), resulted in a potent antiviral vector that effectively inhibits replication of diverse clades of HIV-1 (F.W.-S. and A.Gervaix, unpublished data). Recently, a ribozymemediated inhibition of SIVmac was demonstrated in tissue culture (26). Furthermore, transduction of Rhesus macaque cord blood-derived CD34 + cells with this ribozyme conferred viral resistance to both the T cells and macrophage progenies (F.W.-S., M.Heush, G.Kraus, M.Rosenzweig, and P.Johnson, unpublished data). Application of this ribozyme to the SIVmac model, currently the most relevant animal model of AIDS pathogenesis, may allow testing of antiviral efficacy in vivo. In addition, a phase I trial for use of autologous T cells transduced with two hairpin ribozymes that cleave conserved sites in the HIV-1 LTR and pol has received FDA approval to enroll patients.

Gene Transfer Options This and other ongoing gene therapy trials using anti-HIV molecules (32) entail the relatively cumbersome and expensive procedures of Tcell leukapheresis, ex vivo transduction with the Moloney murine leukemia virus vector, ex vivo expansion, and infusion of transduced cells (Fig. 1). The approach is feasible and currently necessary for proof-of-concept studies, but is not likely to be practical or comprehensive enough for routine use. In particular, it does not access the macrophage reservoir, an important component of the in vivo burden. While reconstitution with CD34+ hematopoietic progenitor cells has obvious advantages, the ability to reconstitute HIV-1-infected individuals, who exhibit complex derangements of hematopoiesis, remains uncertain. If stem cell therapy proves workable for HIV disease, transduction of the most primitive precursor, probably a subset within the CD34+, CD38− population, has the most chance of success. Targeting this subset and converting from cumbersome ex vivo transduction processes to direct in vivo gene delivery are central goals.

Lentiviral Vectors Lentiviral vectors have attracted interest with respect to both of these aims. The capacity of lentiviruses to infect non-cycling cells probably resides in the ability of the lentiviral preintegration complex to traverse an intact nuclear envelope through the nuclear targeting properties of both the p17Gag protein and the accessory protein Vpr (33, 34). This property, which is not shared by oncoretroviruses or Moloney murine leukemia virus-derived retroviral vectors, has spurred efforts to develop lentiviral-based gene therapy vectors. The practical goal to which such investigations aspire is stable transfer of genes to rare (and rarely dividing) stem cells and to postmitotic cells in the hematopoietic, nervous, and other body systems. Other properties of HIV vectors may be particularly desirable for treatment of HIV infection. First, vector systems employing an HIV envelope may allow direct lineage-specific targeting to CD4+ T cells and to non-cycling macrophages and glial cells in vivo. Second, rescue of the vector in vivo by patients’ HIV-1 may result in an effective amplfication of the vector through several cycles before lack of selection pressure results in reverse transcription-derived mutations. Third, the tat and rev regulatory cycles may be exploited to achieve inducible expression of delivered genes. These combined features could elevate gene transfer efficiency to the realm of in vivo therapy. Notable progress has recently been made with an HIV-1-based system employing vesicular stomatitis virus G protein (VSV-G)pseudotyped HIV-1 vectors (35); titers exceeding 105/ml and delivery of a lacZ marker gene to post-mitotic cells (neurons) in rodent brain were reported. This system relies upon transient transfection to generate the vector because expression of VSV-G lyses the producer cells. Although other gene transfer vectors can transduce nondividing cells (e.g., adenovirus vectors), other limitations, chiefly the lack of a stable, consistent genomic integration mechanism, limits their applicability. Adeno-associated virus has been reported to integrate at a specific locus in chromosome 19, but proof of integration and stable gene transfer by engineered vectors in non-dividing cells remains elusive (36). Other lentiviral vector systems have been studied (37–44). All are derived from HIV-1. Several use wild-type replication-competent helper virus as the source of virion proteins, and some represent simple pseudotyping of an env gene-mutated full-length provirus by VSV-G (37). In general, two problems have been troublesome in this field: (i) vector titers, with the exception of Naldini et al. (35), have been low (101–103) or not reported and (ii) stable packaging lines have been difficult to develop for these viruses, which have more genes and much more complex genetic regulation schemes than the simple retroviruses such as Moloney murine leukemia virus. Carrol et al. (42) reported the first packaging cell lines derived from HIV-1. However, the HXBc2-derived packaging construct expressed a defective Vpr protein, which may interfere with the normal karyophilic properties of the HIV pre-integration complex (33, 34), and the lines expressed predominantly unprocessed gag/pol precursor. Our focus with lentiviral vectors has been 3-fold. First, we are experimenting with both the native HIV envelopes for lineage-specific gene delivery and with pseudotyped particles because of their higher stability and potential to transduce CD4-negative stem cells. Second, we have concentrated on

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

DEVELOPMENT OF HIV VECTORS FOR ANTI-HIV GENE THERAPY

11397

HIV-2, as well as HIV-1. Vector systems derived from HIV-1 and HIV-2 inevitably raise safety concerns. However, HIV-1 displays nearly uniform lethality in humans, whereas HIV-2 is now documented to be less pathogenic (45). In addition, for delivery of anti-HIV-1 genes to treat HIV, a system based solely upon HIV-1 will be self-inactivating in direct proportion to the efficacy of the antiviral gene. HIV-2KR, the infectious molecular clone from which we have derived components for both HIV-1 and HIV-2-based gene transfer systems, was cloned from the human clinical isolate HIV-2PEI (46). HIV-2KR replicates to high titers in T-cell lymphoblastoid lines, primary human macrophages and peripheral blood lymphocytes. KR is able to infect pig-tailed macaques in vivo and induce transient viremia, as well as protective immunity against disease causation by a highly pathogenic HIV-2 strain (HIV-2EHO), but has itself proven completely apathogenic, as well as unrecoverable by culture at more than 2 years of follow-up following high-dose intravenous challenge (D. Looney, G.Kraus, W.Morton, F.W.S., J.McClure and S.L. Hu, unpublished data).

FIG. 1. Gene transfer options for HIV gene therapy. Third, we have explored the stable expression in trans of HIV-1 and HIV-2 structural and accessory proteins to develop packaging cell lines from these viruses. Stable expression of viral structural proteins has proven considerably more elusive for HIV than in murine retroviral systems, presumably because of the complexity of HIV genetic regulation (e.g., the Tat and Rev axes) and because of the toxicity of the HIV proteins. The HIV envelopes (the duotropic HIV-1MN has been used for the HIV-1 system) can be used for CD4-specific targeting from these lines. For broad target-cell specificity, the VSV-G protein, recently shown to have numerous advantages for virion particle stability and extended host range (35, 47), can be used in transient packaging. This paper describes our progress in developing stable cell lines capable of expressing the full complement of HIV-1 and HIV-2 proteins in trans and the development of HIV-based vectors that can be packaged in these lines or by pseudotyping with VSV-G.

Packaging Cell Lines To devise HIV-1MN and HIV-2KR packaging constructs to supply HIV proteins in trans, deletions of 37 and 61 bp respectively were made in the regions between the major 5
splice donor and the gag gene initiation codon (Fig. 2A). These deletions alone rendered both HIV-1MN and HIV-2KR proviruses replication-defective but able to express wild-type levels of structural proteins. A stable HIV-1MN packaging cell line was then derived from HeLa cells by cotransfecting the 37-bp psi-deleted provirus with a neo-R containing plasmid and selection in G418. A single cell clone that produced a high level (approximately 20 ng/ml) of p24, designated Ψ422, was isolated and further characterized. For HIV-2KR, a plasmid modified by the 61-bp psi-deletion, replacement of the 3
LTR with the bovine growth hormone polyadenylylation signal and inclusion of a downstream neoR expression cassette was transfected into COS-1 cells. After selection in G418, clones producing 300–700 ng/ml of p26 were isolated. Both the HIV-1 and HIV-2 packaging cell lines produced no replicating virus as measured by long-term cocultivation with permissive T-cell lines and transfer of supernatant to LTR β-galactosidase indicator cells; reversetranscription-PCR and RNAase protection assays showed that the psi-deleted proviruses were not packaged efficiently into particles. However, expression of a high level of viral proteins was maintained through over 6 months in culture. Electron microscopy revealed production of viral particles with fully mature lentiviral morphology for both HIV-1 and HIV-2 packaging lines. Details of these results will be reported elsewhere.

Vectors HIV-1 and HIV-2 based lentiviral vectors were constructed according to the scheme illustrated in Fig. 2B. The 5
LTR was

Table 1. Transduction capacity of HIV-1MN packaging cell lines expressing HIV-1 and HIV-2 gpt vectors Target cell Titer,* transducing units/ml Cell supernatant Ψ422 (packaging line) HeLa-T4 0 Vector-transfected HeLa HeLa-T4 0 Clone 1 (HIV-1 vector) HeLa-T4 2.3×104 HeLa 0 Clone 2 (HIV-1 vector) HeLa-T4 5.4×104 HeLa 0 Clone a (HIV-2 vector) HeLa-T4 1.2×104 HeLa 0 Clone b (HIV-2 vector) HeLa-T4 1.1×104 HeLa *Average titer from three experiments.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

DEVELOPMENT OF HIV VECTORS FOR ANTI-HIV GENE THERAPY

11398

linked sequentially to the 5
leader including the psi region, a short portion of the p17 region of the gag gene, the respective rev response element (RRE), an internally promoted marker gene and the 3
LTR. Marker genes used in these studies included xanthine-guanine phosphoriboxyl transferase (gpt), neomycin phosphotransferase (neoR), Escherichia coli β-galactosidase (lacZ) green fluorescent protein (gfp) (48, 49), and the Streptomyces hindustanus phleomycin resistance gene (she ble). In some vectors an element from Mason-Pfizer monkey virus previously shown to substitute for Rev-RRE-mediated activity in HIV mRNAs nuclear transport was included instead of the RRE (50).

FIG. 2. General scheme for construction of packaging and vector plasmids. Vector Packaging and Transduction HIV-1 and HIV-2 vectors were transfected into the producer cell lines and the cells were doubly selected for stable expression of viral proteins and vectors. Clones of these stable cell lines were also generated, and titers of the transducing vector in the supernatants were measured. As shown in Table 1, both HIV-1 and HIV-2 vectors were packaged in the HIV-1MN packaging cell line Ψ422. Titers of 10e4 to 10e5 were achievable. These vectors were able to transduce terminally differentiated primary macrophages, in contrast to murine retrovirus vectors, which failed to do so (P.C.G.Kraus, F.W.-S., unpublished work). With the HIV-2KR packaging line, transfection of an HIV-2 neoR vector yielded titers of 10e3 to 10e4 (Table 2). These titers are two to three logs higher than previously reported values of the stable HIV-1 packaging line. It is not clear whether it is the choice of the packaging constructs (both HIV-1MN and HIV-2KR contain coding sequences for all of the accessory genes, and both are duotropic for T cells and monocytes) or that of the producer cells which allowed expression of high titers of infectious vectors. Pseudotyped HIV-2 vectors were generated by transient triple cotransfection of a packaging construct with an additional deletion in the env gene, the vector plasmid, and a plasmid encoding VSV-G under control of the hCMV promoter (kindly supplied by T.Friedman, Uuniversity of California, San Diego). Production of 10e5 or higher titers of the pseudotyped vectors was observed. A vector expressing GFP as a reporter gene gave similar titers (E.P. and F.W.S., unpublished work). Experiments to determine if these vectors can transduce non-cycling CD34+/CD38− cells in culture, or long-term repopulating cells in in vivo animal models are in progress.

Table 2. Transducing titer of HIV-2 neoR vectors produced from HIV-2KR packaging cell clone on U937 cells Exp. Titer, transducing units/ml Mean 1 1.3×10e4 1.8×10e4 2 8.5×10e3 3.2×10e4 3 Perspectives Our current understanding of AIDS pathogenesis affirms the central role of HIV in both disease initiation and progression. Recent studies on virus dynamics in patients under chemotherapy (1), as well as long-term prospective studies of plasma viral burden in patients that progress to disease at different rates (2) support a virus threshold hypothesis for disease progression. It is now also recognized that insidious damage inflicted by the virus upon the immune system occurs from the onset of infection, underscoring the importance of early intervention in infected individuals. Although recent clinical results from trials of combinations of antiviral agents, including the potent protease inhibitors, have been encouraging, whether such therapy can be sustained lifelong without recument problems of toxicity, viral resistance, and economics is unclear. Gene therapy has been considered by many to be an attractive strategy for conferring long-term therapeutic benefits. Gene therapy for HIV infection, however, faces experimental obstacles common to gene therapy and genes that are intrinsic to the nature of HIV infection in particular. The extreme inefficiency of transducing hematopoietic progenitor cells that would give rise to long-term repopulation of multilineage progeny cells in animals is a general frustration. For HIV infection, the need to access the nonproliferative macrophage target cell reservoir, the uncertainty of whether bone marrow derived hematopoiesis may be impaired in adult AIDS patients, and the lack of high-titer vectors that allow in vivo targeting are additional concerns. The ability of HIV vectors to both target CD4+ cells in vivo and transduce non-cycling cells may help resolve some of these issues. E.P. is a recipient of a National Institutes of Health Physician-Scientist Award. The work described here is supported by the National Institutes of Health SPIRAT award to F.W.-S. and the University of California, San Diego Center for AIDS Research. 1. Perelson, A.S., Neumann, A.S., Markowitz, M., Leonard, J.M. & Ho, D.D. (1996) Science 271, 1582–1586. 2. Mellors, J.W., Rinaldo, C.R., Gupta, P., White, M.R., Todd, J.A. & Kingsley, L.A. (1996) Science 272, 1167–1170. 3. Ho, D.D., Neumann, A.U., Perelson, A.S., Chen, W., Leonard, J.M. & Markowitz, M. (1995) Nature (London) 373, 123–126. 4. Wei, X.P., Ghosh, S.K., Taylor, M.E., Johnson, V.A., Emini, E. A., et al. (1995) Nature (London) 373, 117–123. 5. Pantaleo, G., Graziosi, C., Demarest, J.F., Butini, L., Montroni, M., et al. (1993) Nature (London) 362, 355–358.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

DEVELOPMENT OF HIV VECTORS FOR ANTI-HIV GENE THERAPY

11399

6. Embretson, J., Zupanic, M., Ribas, J.L., Burke, A., Racz, P., et al. (1993) Nature (London) 362, 359–362. 7. Coffin, J. (1995) Science 267, 483. 8. Piatak, M., Saag, M.S., Yang, L.C., Clark, S.J., Kappes, J.C., et al. (1993) Science 259, 1749–1754. 9. Ho, D.D., Moudgil, T. & Alam, M. (1989) N. Engl. J. Med. 321, 1621–1625. 10. Ho, D.D. (1996) Science 272, 1124–1125. 11. Coffin, J.M. (1992) Curr. Top. Microbiol. Immunol. 176, 143–164. 12. Coffin, J.M. (1993) in Reverse Transcriptase, eds. Skalka, A. & Goff, S. (Cold Spring Harbor Lab. Press, Plainview, NY), pp. 445–479. 13. Saag, M.S., Holodniy, M., Kuritzkes, D.R., O’Brien, W.A., Coombs, R., et al. (1996) Nat. Med. 2, 625–629. 14. Richman, D.D. (1994) AIDS Res. Hum. Retroviruses 10, 901–905. 15. Poeschla, E.M. & Wong-Staal, F. (1995) in AIDS Clinical Review 1995/96, eds. Volberding, P. & Jacobsen, M.A. (Dekker, New York), pp. 1–45. 16. Yu, M., Poeschla, E. & Wong-Staal, F. (1994) Gene Ther. 1, 13–26. 17. Symonds, R.H. (1992) Annu. Rev. Biochem. 61, 641–671. 18. Poeschla, E. & Wong-Staal, F. (1994) Curr. Opin. Oncol. 6, 601–606. 19. Ojwang, J., Hampel, A., Looney, D., Wong-Staal, F. & Rappaport, J. (1992) Proc. Natl. Acad. Sci. USA 89, 10802–10806. 20. Yu, M., Ojwang, J., Yamada, O., Hampel, A., Rappaport, J., Looney, D. & Wong-Staal, F. (1993) Proc. Natl. Acad. Sci. USA 90, 6340–6344. 21. Yamada, O., Yu, M., Yee, J.-K., Kraus, G., Looney, D. & Wong-Staal, F. (1994) Gene Ther. 1, 38–45. 22. Yu, M., Leavitt, M., Maruyama, M., Yamada, O., Young, D., Ho, A. & Wong-Staal, F. (1995) Proc. Natl. Acad. Sci. USA 92, 699–703. 23. Leavitt, M.C., Yu, M., Yamada, O., Kraus, G., Looney, D., Poeschla, E. & Wong-Staal, F. (1994) Hum. Gene Ther. 5, 1115–1120. 24. Yu, M., Poeschla, E.M., Yamada, O., De Grandis, P., Leavitt, M.C., Heusch, M., Yee, J.-K., Wong-Staal, F. & Hampel, A. (1995) Virology 206, 381–386. 25. Yamada, O., Leavitt, C., Yu, M., Kraus, G. & Wong-Staal, F. (1994) Virology 205, 121–126. 26. Heusch, M., Kraus, G., Johnson, P. & Wong-Staal, F. (1996) Virology 216, 241–244. 27. Leavitt, M.C., Yu, M., Wong-Staal, F. & Looney, D. (1996) Gene Ther., 3, 599–606. 28. Sarver, N., Cantin, E.M., Chang, P.S., Zaia, J.A., Ladne, P.A., Stephens, D.A. & Rossi, J.J. (1990) Science 247, 1222–1225. 29. Weerasinghe, M., Liem, S.E., Asad, S., Read, S.E. & Joshi, S. (1991) J. Virol. 65, 5531–5534. 30. Dropulic, B., Lin, N.H., Martin, M.A. & Jeang, K.T. (1992) J. Virol. 66, 1432–1441. 31. Rossi, J., Elkins, D., Zaia, J. & Sullivan, S. (1992) AIDS Res. Hum. Retroviruses 8, 183–189. 32. Nabel, G., Fox, B., Post, L., Thompson, C. & Woffendin, C. (1994) Hum. Gene Ther. 5, 79–92. 33. Heinzinger, N.K., Bukinsky, M.I., Haggerty, S.A., Ragland, A.M., Kewalramani, V., Lee, M.A., Gendelman, H.E., Ratner, L., Stevenson, M. & Emerman, M. (1994) Proc. Natl. Acad. Sci. USA 91, 7311–7315. 34. Stevenson, M., Brichacek, B., Heinzinger, N., Swindells, S., Pirruccello, S., Janoff, E. & Emerman, M. (1995) Adv. Exp. Med. Biol. 374, 33–45. 35. Naldini, L., Blömer, U., Gallay, P., Ory, D., Mulligan, R., Gage, F.H., Verma, I.M. & Trono, D. (1996) Science 272, 263–266. 36. Goodman, S., Xiao, X., Donahue, R.E., Moulton, A., Miller, J., Walsh, C., Young, N.S., Samulski, R.J. & Nienhuis, A.W. (1994) Blood 84, 1492– 1500. 37. Akkina, R., Walton, R., Chen, M.-C., Li, Q.-X., Planelles, V. & Chen, I. (1996) J. Virol. 70, 2581–2585. 38. Poznansky, M., Lever, A., Bergeron, L., Haseltine, W. & Sodroski, J. (1991) J. Virol. 65, 532–536. 39. Parolin, C., Dorfman, T., Palu, G., Gottlinger, H. & Sodroski, J. (1994) J. Virol. 68, 3888–3895. 40. Richardson, J.H., Kaye, J.F., Child, L.A. & Lever, A.M. (1995) J. Gen. Virol. 76, 691–696. 41. Buchschacher, G.L., Jr., & Panganiban, A.T. (1992) J. Virol. 66, 2731–2739. 42. Carrol, R., Lin, J.-T., Dacquel, E.J., Mosca, J.D., Burke, D.S. & St. Louis, D.C. (1994) J. Virol. 68, 6047–6051. 43. Rizvi, T.A. & Panganiban, A.T. (1993) J. Virol. 67, 2681–2688. 44. Shimada, T., Fuji, H., Mitsuya, H. & Nienhuis, A.W. (1991) J. Clin. Invest. 88, 1043–1047. 45. Marlink, R., Kanki, P., Thior, I., et al. (1994) Science 265, 1587–1590. 46. Talbott, R., Kraus, G., Looney, D. & Wong-Staal, F. (1993) Proc. Natl. Acad. Sci. USA 90, 4226–4230. 47. Lin, S., Gaiano, N., Culp, P., Burns, J.C., Friedmann, T., Yee, J.K. & Hopkins, N. (1994) Science 265, 666–669. 48. Chalfie, M., Tu, Y., Euskirchen, G., Ward, W.W. & Prasher, D.C. (1994) Science 263, 802–805. 49. Heim, R., Cubitt, A.B. & Tsien, R.Y. (1995) Nature (London) 373, 663–664. 50. Bray, M., Prasad, S., Dubay, J.W., Hunter, E., Jeang, K.T., Rekosh, D. & Hammarskjold, M.L. (1994) Proc. Natl. Acad. Sci. USA 91, 1256–1260.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

A STABLE HUMAN-DERIVED PACKAGING CELL LINE FOR PRODUCTION OF HIGH TITER RETROVIRUS/VESICULAR STOMATITIS VIRUS G PSEUDOTYPES

11400

This paper was presented at a colloquium entitled “Genetic Engineering of Viruses and of Virus Vectors,” organized by Bernard Roizman and Peter Palese (Co-chairs), held June 9–11, 1996, at the National Academy of Sciences in Irvine, CA.

A stable human-derived packaging cell line for production of high titer retrovirus/vesicular stomatitis virus G pseudotypes (retrovirus vector/gene therapy/293 cells/transient transfection) DANIEL S.ORY *, BEVERLY A.NEUGEBOREN †, AND RICHARD C.MULLIGAN †‡ Whitehead Institute for Biomedical Research, and Department Biology, Massachusetts Institute of Technology, Cambridge, MA 02142 ABSTRACT We have generated a human 293-derived retroviral packaging cell line (293GPG) capable of producing high titers of recombinant Moloney murine leukemia virus particles that have incorporated the vesicular stomatitis virus G (VSV-G) protein. To achieve expression of the retroviral gag-pol polyprotein, the precise coding sequences for gag-pol were introduced into a vector which utilizes totally nonretroviral signals for gene expression. Because constitutive expression of the VSV-G protein is toxic in 293 cells, we used the tetR/VP 16 transactivator and tet° minimal promoter system for inducible, tetracycline-regulatable expression of VSV-G. After stable transfection of the 293GPG packaging cell line with the MFG.SnlsLacZ retroviral vector construct, it was possible to readily isolate stable virus-producing cell lines with titers approaching 107 colony-forming units/ml. Transient transfection of 293GPG cells using a modified version of MFG.SnlsLacZ, in which the cytomegalovirus IE promoter was used to drive transcription of the proviral genome, led to titers of 106 colony-forming units/ml. The retroviral/VSV-G pseudotypes generated using 293GPG cells were significantly more resistant to human complement than commonly used amphotropic vectors and could be highly concentrated (>1000fold). This new packaging cell line may prove to be particularly useful for assessing the potential use of retroviral vectors for direct in vivo gene transfer. The design of the cell line also provides at least theoretical advantages over existing cell lines with regard to the possible release of replication-competent virus. Currently, retroviral-mediated gene transfer is widely utilized to obtain efficient transduction of mammalian cells in vitro, and to date, has been the gene transfer method of choice for clinical protocols aimed at the evaluation of ex vivo strategies for gene therapy (1). While standard murine-based retroviral vectors are well suited for use in such ex vivo applications, the vectors have found only limited use in strategies involving direct in vivo gene transfer (1). One major limitation of the commonly used vector/packaging cell systems is the inability to easily purify and concentrate the large amounts of virus often needed for direct in vivo gene transfer applications. A second limitation relates to the sensitivity of virus with amphotropic host range to inactivation by human serum (2–4). A final limitation of all murine-based vectors is their inability to integrate in quiescent cells (5, 6). One recent advance that may prove to be important for the eventual use of retrovirus vectors for direct in vivo gene transfer was the demonstration that it is possible to generate retrovirus vector particles which have incorporated the vesic ular stomatitis virus G (VSV-G) protein (7). The resulting VSV-G/retroviral pseudotypes possessed the wide host range of VSV and could be highly concentrated without loss of biological activity (8). This finding follows very early studies which had demonstrated the capacity of retroviruses and VSV to form viral pseudotypes upon coinfection of cells with both viruses (9). In the recent work, the procedure used to generate virus involved the use of transient transfection techniques to express the VSV-G protein, since the constitutive expression of significant levels of VSV-G in most cells is toxic. However, this method of virus production significantly limits the evaluation of the potential applications of the viral pseudotypes, since only small amounts of virus can be easily produced. To overcome these difficulties, we have generated a stable human-derived cell line which constitutively expresses the necessary retroviral proteins for packaging and provides for large amounts of the VSV-G protein by inducible expression. We describe here the manner in which the cell line was constructed and some of the characteristics of the virus that is generated from the cells.

MATERIALS AND METHODS Cell Lines and Drug Selections. Adenovirus 5-transformed human embryonic kidney 293 cells (10) were obtained from B. Panning (Whitehead Institute). The 293 cells were grown in 293 growth medium containing Dulbecco’s modified eagle medium (DMEM) (GIBCO/ BRL), 10% (vol/vol) inactivated fetal bovine serum (IFS) (Sigma), 2 mM L-glutamine (GIBCO/BRL), and 50 units/ml penicillin and streptomycin (GIBCO/BRL). Drug selections in transfected 293 cells were performed at 2 µg/ml puromycin (Sigma), 0.3 mg/ml G418 (GIBCO/ BRL) and 100 µg/ml Zeocin (Invitrogen). All growth media, except where noted, was supplemented with 1 µg/ml tetracycline. NIH 3T3 cells (ATCC CRL 1658) were grown in DMEM containing 10% (vol/vol) calf serum (Sigma), and 50 units/ml penicillin and streptomycin. Mus dunni cells were grown in DMEM containing 5% (vol/vol) calf serum (Sigma), and 50 units/ml penicillin and streptomycin.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact. Abbreviations: VSV-G, vesicular stomatitis virus G; CMV, cytomegalovirus; HCMV, human CMV; cfu, colony-forming unit; RT, reverse transcriptase; IFS, inactivated fetal bovine serum; RCV, replication-competent virus; MuMLV, Moloney murine leukemia virus; IE, immediate early. *Present address: Cardiovascular Division, Washington University School of Medicine, 660 South Euclid Avenue, St. Louis, MO 63110. †Present address: Howard Hughes Medical Institute, The Children’s Hospital, and Department of Genetics, Harvard Medical School, Boston, MA 02115. ‡To whom reprint requests should be sent at the present address: Howard Hughes Medical Institute, The Children’s Hospital, Boston, MA 02115.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

A STABLE HUMAN-DERIVED PACKAGING CELL LINE FOR PRODUCTION OF HIGH TITER RETROVIRUS/VESICULAR STOMATITIS VIRUS G PSEUDOTYPES

11401

Plasmid Constructs. The plasmid pBC.tTA (see Fig. 1) was constructed from pBC12/cytomegalovirus (CMV)/interleukin 2 (11) by replacement of the interleukin 2 sequences (bp 756–1439) with the tet transctivator gene from pUHD10–1 (12). To construct pMDtet.G (Fig. 1), the 1.6-kb EcoRI fragment from pSVGL (13) containing the VSV-G gene was cloned into the EcoRI cloning site in pMD.tet which is within exon 3 of the genomic human β-globin sequence. pMDtet was constructed with a 0.47-kb XhoI-BamHI fragment from pUHC 13–3 (12), which contains the tet operator and minimal human cytomegalovirus (HCMV) enhancer-promoter sequences, a 1.34-kb BamHI-XbaI fragment from pUCMdβs(R)S (14) that includes the genomic human β-globin sequences from the BamHI site in exon 2 through 690 bp in the 3
untranslated region, and a 3.06-kb XbaI-XhoI fragment from pSL301 (Invitrogen). To construct pMD.gagpol (see Fig. 1), PCR was performed with pCRIPenv− (15) using the following pairs of primers: 5
CGGAATTCATGGGCCAGACTGTTACC-3
and 5
-AGCAACTGGCGATAGTGG-3
, 5
-CGGAATTCTTAGGGGGCCTCGCGG-3
and 5
ACTACATGCTGAACCGGG-3
. The PCR products were digested with EcoRI and XhoI and with EcoRI and HindIII, respectively, to generate 0.94-kb EcoRI-XhoI and 0.94-kb HindIII-EcoRI fragments. These fragments were ligated with the 3.3-kb XhoI-HindIII fragment from pCRIPenv − and with pUC19, which had been linearized with EcoRI and calf intestinal phosphatase treated, to produce pUC19.gagpol. The 5.2-kb EcoRI fragment from pUC19.gagpol was cloned into the EcoRI cloning site in pMD to yield pMD.gagpol. pMD was constructed with the 3.1-kb EcoRI-BamHI fragment from pBC12/CMV/interleukin 2 that includes the pXF3 backbone and HCMV enhancer-promoter region and the previously described 1.34-kb BamHIXbaI fragment derived from pUCMdβs(R)S. The 3.1-kb EcoRI-BamHI and 1.34-kb BamHI-XbaI fragments were ligated after the EcoRI and XbaI overhangs were blunt-ended by Klenow treatment. The plasmids pJ6Ωpuro and pJ6Ωbleo conferring resistance to puromycin and bleomycin (and zeocin), respectively, were kindly provided by J.Morgenstern (16). The plasmid pSV2neo confers resistance to G418 (17). Retroviral Vectors. MFG.SnlsLacZ (see Fig. 1) was kindly provided by O.Danos (18). This vector is a derivative of MFG (19) in which mutations have been introduced at nucleotides 412 (A to T), 429 (T to A), and 631 (C to T) [nucleotide 625 of the Moloney murine leukemia virus (MuMLV) sequence]. These substitutions produce the sequence, ATGGGCCCGGGGTAG, thereby preventing expression of the Nterminal portion of gag that would otherwise be expressed by the vector. The ∆U3nlslLacZ retroviral vector was constructed by precise replacement of the U3 region in the 5
long-terminal repeat of MFG.SnlsLacZ with the HCMV enhancer-promotor (bp −671 to −2) (20). For the construction of ∆U3nlsLacZ, a 701-bp fragment encoding the HCMV promoter was generated by PCR with the pMD plasmid as the template with the pair of primers, 5
-GGGCCCAAGCTTCCCATTGCATACGTTGTATC-3
and 5
GGACTGGCGCCGGTTCACTAAACGAGCTC-3
, creating a 5
HindIII site and a 3
KasI site. The PCR product was digested with HindIII and KasI to yield a 677-bp fragment. The 91-bp KasI-StyI was isolated from the 3
long-terminal repeat of MFG (19). The 253-bp StyI-EagI and the 4994-bp EagI-ScaI fragments were isolated from MFG.SnlsLacZ, and the backbone for ∆U3nlsLacZ is a 2.65-kb HindIII-SmaI fragment from pUC18. DNA Transfection. Stable transfection of 293 cells was performed by the calcium phosphate precipitation method (22) with 5 µg pBC.tTA, 5 µg pMDtet.G, and 1 µg pJ6Ωpuro. For all stable and transient transfections, plasmid DNA was prepared by double banding on CsCl density gradients (23). Cells (1.5×106) were plated on 60-mm dishes in 4 ml 293 growth media the night before transfection. Chloroquine (final concentration, 25 µM) and tetracycline (final concentration, 1 µg/ml) were added to the media 5 min before transfection. The media was changed 7 h posttransfection. The transfected cells were plated 48 h posttransfection by limiting dilution in media containing puromycin and tetracycline and independent clones were isolated. 293 G cells were always grown in 293 growth medium supplemented with tetracycline and puromycin (293G growth medium). Stable transfection of the 293G cells was performed by the calcium phosphate precipitation method with 10 µg pMD.gagpol linearized with ScaI and 2 µg pSV2neo. Cells (2×106) were plated on 60-mm dishes in 4 ml 293G media the night before transfection. Chloroquine (final concentration, 25 µM) was added to the media 5 min before transfection. The media was changed 7 h posttransfection. The transfected 293G cells were plated by limiting dilution 48 h posttransfection in 293G growth medium supplemented with G418 and independent clones were isolated. 293GPG cells were grown in 293G growth medium supplemented with G418 (293GPG medium). Stable transfection of the 293GPG cells with MFG.SnlsLacZ was performed by the calcium phosphate precipitation method with 12.5 µg MFG.-SnlsLacZ linearized with AseI and 2.5 µg pJ6Ωbleo linearized with AflIII. Cells (4×106) were plated on 60-mm dishes in 4 ml 293GPG media the night before transfection. The media was changed 9 h posttransfection. The transfected 293GPG cells were plated by limiting dilution 48 h posttransfection in 293GPG media supplemented with zeocin and independent clones were isolated. Transient transfections with 293GPG cells were performed on 60-mm dishes where 4–5×106 cells were plated the night before in 4 ml 293 growth medium. Four micrograms of ∆U3nlsLacZ was diluted into 300 µl OptiMEM (GIBCO/ BRL) and incubated at room temperature for 30 min with 25 µl lipofectamine (GIBCO/BRL) diluted into 300 µl OptiMEM. The DNA-lipofectamine mixture was diluted into 2.4 ml OptiMEM and layered on top of the 293GPG cells, which had been rinsed 30 min before transfection and had media replaced with 2 ml OptiMEM. Seven to 8 h posttransfection, 2 ml 293 media was added, and the media was changed at 24 h with 2.5 ml 293 media. The supernatant was harvested at 72 h and viral titers determined as described below. Analysis of VSV-G Expression in Transfected Cells. The pMDtet.G and pBC.tTA cotransfected clones were screened for inducible VSV-G expression by plating each clone in parallel into two 35-mm tissue culture dishes at 50% confluence. The following day one plate was rinsed twice with 2 ml 293G media without tetracycline and maintained in this media. At 48 h the postnuclear cellular lysates were prepared and the paired samples run on a 7.5% SDS/PAGE under reducing conditions. The gels were transferred onto nitrocellulose (0.45 mm; Schleicher & Schuell) with a semidry electroblotter (Owl Scientific, Woburn, MA). Western blot analysis was performed by using a murine monoclonal anti-VSV-G IgG (Sigma) at a dilution of 1:800 and a peroxidase-conjugated F(ab
)2 fragment donkey anti-mouse IgG (Jackson ImmunoResearch Laboratories) was used at a dilution of 1:10,000. Detection by chemiluminescence was performed using commercially available reagents (Renaissance; New England Nuclear). Assays For Reverse Transcriptase (RT) and β-Galactosidase Activity. 293G cells transfected with pMD.gagpol were screened for RT activity in the culture medium of subconfluent clones growing in 24-well culture dishes as described (24). Cells were stained for βgalactosidase activity as described (25). Viral Titers, Virus Concentration, and Stability of Virus to Human Serum. To determine viral titers, NIH 3T3 cells were plated at 1×105 cells per well in 6-well culture dishes 16 h before infection and incubated for 24 h with serial dilutions of

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

A STABLE HUMAN-DERIVED PACKAGING CELL LINE FOR PRODUCTION OF HIGH TITER RETROVIRUS/VESICULAR STOMATITIS VIRUS G PSEUDOTYPES

11402

viral supernatants containing 8 µg/ml polybrene (Sigma). Viral titer was determined as the average number of cells with blue nuclei (βgalactosidase-producing cells) per 20 1-mm2 fields (2–3×104 cells) multiplied by a factor to account for plate size, dilution of viral stock, and division of target cells in tissue culture wells. Viral supernatants harvested either from stable virus-producing cell lines or transiently transfected cells were concentrated by ultracentrifugation (8). The stability of the GPGnlsLZ pseudotyped retrovirus and the ΨCRIPLacZ amphotropic retrovirus was determined in normal human serum. Twenty microliters virus harvest, which was diluted 1:5 in 20 mM Hepes buffer (pH 7.0), 10 µl of PBS, or 10 µl of Gal(α1–3)galactose (final concentration, 10 mg/ml) (Dextra Laboratories, Reading, U.K.), and 20 µl of fresh normal human serum, heat-inactivated human serum, or IFS were mixed on ice and then incubated at 37°C for 1 h (26). Heat inactivation of the human serum was carried out at 56°C for 1 h. The virus-serum mixture was diluted in 1.5 ml DMEM with 8 µg/ml polybrene. Serial dilutions of the virus-serum mixture were incubated with NIH 3T3 cells in 6-well dishes as described above to determine viral titers. Relative titers (percent) were determined for fresh and heatinactivated human serum treatment as compared with IFS treatment. Helper Virus Assay. Retroviral stocks were assayed for replication-competent virus (RCV) by a vector rescue assay (27). Mus dunni cells with a stably integrated MFGLacZ (MDZ), were plated at a 2×105 cells per 10-cm dish. The following day the MDZ cells were infected with viral stocks that were 0.45 µM filtered and to which 8 µg/ml polybrene was added. The media was changed at 24 h and again 3 days later. The 24-h MDZ supernatant was harvested and passed through a 0.45 µM filter, 8 µg/ml polybrene was added, and the supernatant was overlayed on naive Mus dunni cells, which were plated the day before at 4×105 cells per 10-cm dish. Twenty-four hours later the supernatant was removed and the cells supplied with normal media. The following day the cells were stained for β-galactosidase activity. The entire plate was scanned with a light microscope (×4 phase objective) for the presence or absence of LacZ expressing cells (blue cells). To determine the sensitivity of the assay, graded dilutions of a titered 4070A amphotropic virus stock (Tektagen, Malvern, PA) were used in place of the test virus. The assay was shown to be able to detect one particle of 4070A per 8 ml supernatant.

RESULTS General Strategy for Construction of Packaging Cell Line. Although most previously described retroviral packaging cell lines have been derived from murine cell lines (15, 28–30), we chose to use the human-derived cell line 293 (10) as the parental cell line for our studies for several reasons. First, in contrast to murine cells, human cells do not harbor a large number of endogenous retroviral genomes nor express endogenous viral-like RNAs that may contribute to the generation of replication-competent virus through recombination events involving packaged vector sequences (31–33). In addition, retrovirus vectors produced from human cells have been shown to be resistant to the mechanisms of virus inactivation involving natural antibodies and complement that occur when virus derived from murine cells is exposed to human serum (2, 4). Finally, 293 cells can be transiently transfected at high efficiency, a property potentially useful for generating small quantities of high titer virus in a rapid fashion (22). Because the high-level constitutive expression of VSV-G is toxic to cells, we employed the tetracycline-regulatable gene expression system of Gossen and Bujard (12) to provide for the inducible expression of VSV-G. The expression construct used to express the VSV-G protein, pMDtet.G (Fig. 1), contains a minimal CMV immediate early (IE) promoter to which seven tet operator sequences (12) are linked upstream, and an intervening sequence and poly(A) site from the human β-globin gene. For expression of the tet/VP16 transactivator (12), we used the vector pBC.tTA, which utilizes the full CMV IE promoter and an intervening sequence and poly(A) signal from the rat insulin II gene (Fig. 1). The tet/VP16 transactivator binds to the tet operator sequences in the promoter region of pMDtet.G and activates transcription of VSVG from the minimal CMV promoter (12). Transcription is suppressed in the presence of tetracycline and is activated when tetracycline is removed from the media.

FIG. 1. Schematic diagrams of plasmid and retroviral constructs. The construction of pBC.tTA, pMDtet.G, and pMD.gagpol is detailed in Materials and Methods. The pBC.tTA construct encodes the VP16-tet transactivator fusion protein. In pMDtet.G expression of the VSV-G protein is under the control of the inducible tet°/CMV minimal promoter sequences. The pMD.gagpol construct encodes the MuLV gag-pol sequences. MFG.SnlsLacZ is a replication-defective retroviral vector with splice donor (SD) and splice acceptor (SA) sites in which a nuclear localizing LacZ (nlsLacZ) has been cloned into the ATG of the env gene (19). ∆U3nlsLacZ encodes a nuclear localizing β-galactosidase under the control of the HCMV enhancerpromoter. For expression of the MuMLV gag-pol sequences, we used the expression vector pMD, which employs the CMV IE promoter and an intervening sequence and poly(A) site from the human β-globin gene for expression of inserted sequences (Fig. 1). Notably, this vector contains no retroviral sequences. A segment of the MuMLV genome that precisely encodes gag-pol was then inserted into the vector (see Fig. 1). These design features help to minimize the overlap of sequences between different vectors and the packaging cell sequences that can often occur, and which have been previously shown to contribute to the formation of RCV (34, 35) In comparison to pCRIPenv−, the construct used in the generation of ΨCRIP cells (15), pMD.gagpol generated significantly higher levels of RT activity during transient transfection of 293 cells (data not shown). The overall scheme for generating the 293GPG packaging cells is shown in Fig. 2. The first step in the generation of the cells was the isolation of a 293-derived cell line that expressed VSV-G. Rather than sequentially introduce the pMDtet.G and pBC.tTA constructs into cells, we chose to simultaneously introduce both constructs via a tripartite cotransfection with a selectable marker in the hopes of providing a natural selection for integrants that express an acceptable level of VSV-G in the repressed state. Having identified a clone of cells that express high levels of VSV-G in the absence of tetracycline and low basal levels in the presence of tetracycline, the pMD.gagpol vector was then introduced by cotransfection into the cells. Candidate packaging cell lines were then screened for high RT levels in the media as described below.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

A STABLE HUMAN-DERIVED PACKAGING CELL LINE FOR PRODUCTION OF HIGH TITER RETROVIRUS/VESICULAR STOMATITIS VIRUS G PSEUDOTYPES

11403

FIG. 2. Strategy for generation of pseudotyped packaging cell line. 293 cells were cotransfected with pBC.tTA and pMDtet.G. Clones were screened by Western blot analysis for induction of VSV-G expression. The 293G clone was transfected with pMD.gagpol and clones were screened by RT activity. The 293GPG clone demonstrated the highest level of RT activity and was used to generated stable producer cell lines. Construction of a 293-Derived Cell Line Which Expresses VSV-G in an Inducible Fashion. To generate a cell line capable of expressing VSV-G, 293 cells were cotransfected by calcium phosphate precipitation techniques with equimolar amounts of pBC.tTA and pMDtet.G (Fig. 1) and with a plasmid encoding resistance to puromycin as a selectable marker. The pBC.tTA-and pMDtet.G-transfected cells were then cultured in media containing puromycin and 1 µg/ml tetracyline during selection (to prevent expression of the VSV-G). Seventy-two independent drug-resistant clones were subsequently isolated and screened by removal of tetracycline from the growth medium. Western blot analysis identified 12 clones that exhibited high levels of VSV-G expression in the absence of tetracycline, yet low or no detectable VSV-G expression in the presence of tetracycline (data not shown). The 293 clone chosen for further study, termed 293G, demonstrated particularly high levels of VSV-G expression per mg of cellular protein, comparable to twice the amount of VSV-G expressed after transient transfection with pMD.G (Fig. 3A). The two VSV-G bands detected in de-repressed 293G cells (Fig. 3A, lane 3) represent the completely glycosylated (upper band) and an incompletely glycosylated (lower band) form of VSV-G. Treatment of the postnuclear cellular lysate from the 293G cells with N-glycosidase F demonstrates a single unglycosylated VSV-G band (Fig. 3A, lane 9). The observation of incomplete glycosylation of VSV-G in the 293G cells suggests that the extremely high level of expression of VSV-G may overwhelm the capacity of the cells for glycosylation or that the large quantity of VSV-G protein may stimulate intracellular recycling with deglycosylation (36). The high-level expression of VSV-G observed after transfection with the VSV-G expression constructs was consistently associated with significant morphologic changes in the cells. In transiently transfected 293 cells (data not shown) and in derepressed 293G cells, we observed formation of large multinucleated syncytia of cells, the appearance of which correlated precisely with VSV-G expression (Fig. 3B). The VSVG protein has a putative fusagenic domain spanning amino acids 123 to 137 (37), which facilitates fusion between the membrane of the enveloped virus and the plasma membrane of target cell. The high-level cell surface expression of VSV-G in our transient and stable cell lines may promote fusion of plasma membranes of adjacent cells in response to local pH changes (38).

FIG. 3. Induction of VSV-G expression in 293G and 293GPG cell lines. (A) Western blot analysis of SDS/PAGE (7.5%) of cell lysates (10 µg/lane) from 293 cells (lane 1), 293G cells (lanes 2, 3, and 9), and 293GPG cells (lanes 4, 5, and 10). Lanes 6, 7, 8, and 11 show 5 µg, 10 µg, 20 µg, and 10 µg of cell lysate from 293 cells transiently transfected with pMD.G, respectively. Tet (+) indicates growth in the presence of tetracycline (1 µg/ml) and Tet (−) indicates growth for 48 hours in the absence of tetracycline. NGF (+) indicates treatment with 2 units N-glycosidase F (Boehringer Mannheim) for 24 h at 37° C before analysis. (B) Morphology (×100 field) of 293G (a and b) and 293GPG (c and d) cells grown in the presence of tetracycline (1 µg/ml) (a and c) and in the absence of tetracycline (b and d) for 72 h. Prominent syncytia formation is observed in 293G (b) and 293GPG (d) cells after induction of VSV-G expression. Construction of a Packaging Cell Line Which Expresses Both VSV-G and MuMLV gag-pol. To generate a stable cell line which expresses both VSV-G and gag-pol, pMD.gagpol was linearized at the ScaI site and introduced into 293G cells along with a plasmid encoding resistance to neomycin, using calcium phosphate transfection techniques. Sixty-nine G418-resistant clones (15) were isolated, and each culture supernatant was screened for the level of RT activity. Twenty-four positive clones with RT activity equivalent to or greater than that of ΨCRE (15) were identified on an initial screen (data not shown). The clone selected for further study, 293GPG, released 25-fold more RT activity than that released by ΨCRE and ΨCRIP (15) and 10-fold more activity than that released by Anjou 65 cells (22) (Fig. 4). Removal of tetracycline from the growth medium of 293GPG cells demonstrated the continued presence of inducible VSV-G expression by Western

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

A STABLE HUMAN-DERIVED PACKAGING CELL LINE FOR PRODUCTION OF HIGH TITER RETROVIRUS/VESICULAR STOMATITIS VIRUS G PSEUDOTYPES

11404

blot analysis (Fig. 3A) and by the formation of syncytia (Fig. 3B).

FIG. 4. RT activity of supernatant from 293GPG clone. 293GPG cells were grown to 75% confluence in 60-mm dishes, the media was changed, and supernatant was harvested 24 h later. RT assay was performed as described. Supernatants from RT reaction cocktail without supernatant (Blank) and 293 cells are negative controls. Supernatants from ΨCRE, ΨCRIP, and Anjou 65 cells are positive controls. Supernatant from the 293GPG cells was diluted 1:5, 1:10, 1:25, 1:50, and 1:100 as indicated. Production and Characteristics of Recombinant Virus from 293GPG Cells. To examine the capacity of the 293GPG cells to produce high titers of recombinant retrovirus vectors, the cells were cotransfected with the retroviral vector MFG.-SnlsLacZ, linearized by AseI, and a plasmid encoding resistance to zeocin (16). Sixteen independent drug-resistant clones were isolated. The clones were then cultured in tetracyclinefree media and the Supernatants were harvested at 96 h and were used to infect NIH 3T3 cells for determination of viral titer by 5bromo-4-chloro-3-indolyl β-D-galactoside (X-Gal) staining. Three of the clones, termed GPGnlsLZ2, GPGnlsLZ3, and GPGnlsLZ4, generated virus with titers of 107 colony forming units (cfu)/ml. To further determine the optimal time for virus harvest after removal of tetracycline, Supernatants from the three previously selected clones were collected serially at successive time points (Fig. 5). Maximal virus production per 24-h period was shown to occur between 48 and 96 h after removal of tetracycline. Because 293 cells have been shown to yield efficient transient gene expression after transfection (22), we next examined the ability to harvest high titer virus after transient transfection of the cells with a retroviral vector. Although, as shown above, cells stably transfected with the MFG.S vector yielded high titers of virus, preliminary transient transfection studies with the MFG.S vector yielded titers of only 105 cfu/ ml (data not shown). Based on the studies of others (39), which indicated the high transcriptional activity of the CMV IE promoter after transient transfection of 293 cells, we generated a derivative of MFG.S, termed ∆U3nlslLacZ, in which the enhancer-promoter region of the 5
long-terminal repeat was replaced with the complete CMV IE promoter in such a way that transcription would initiate at the proper viral start site (Fig. 1). Using this construct in conjunction with lipofectamine transfection, we were able to obtain an average efficiency of transfection of the 293GPG cells of 40%. More importantly, when virus was harvested 24–72 h after transfection, titers exceeding 106 cfu/ml were obtained (Table 1). To determine whether virus produced from 293GPG cells could be efficiently concentrated, a large amount of culture supernatant was generated from the GPGnlsLZ2 and GPGnlsLZ3 clones. The pseudotyped virus, initially possessing titers of 1.6×106 cfu/ml, could be concentrated by ultracentrifugation >1000-fold to achieve titers of >109 cfu/ml with 65–67% recovery of the infectious viral particles (Table 1). Virus produced from the GPGnlsLZ cell lines were examined for the presence of RCV using a sensitive assay involving a Mus dunni cell line which harbors a highly transmissible retroviral genome encoding LacZ (21). Helper virus assays performed on unconcentrated viral supernatants as well as supernatants from transient transfections demonstrated that the retroviral stocks generated from the packaging cells were free of RCV (Table 1). It was not possible to perform cocultivation-based helper virus assays on the 293GPG-derived producer cell lines, since cocultivation of the cells with the Mus dunni indicator cells led to extensive cell fusion (data not shown). Finally, because retroviruses produced from human cells are known to be resistant to inactivation by human serum (2, 4), we investigated the extent to which the viral pseudotypes produced from the 293GPG packaging cell line were resistant to inactivation by serum. Amphotropic virus from a ΨCRIPLZ producer clone and pseudotyped virus from the GPGnlsLZ4 clone were incubated with human serum, and the relative titers of each virus stock were then determined. The titer of the amphotropic virus was reduced by 250-fold after incubation with human serum, but not after incubation with heat-inactivated human serum (Fig. 6). In contrast, incubation of the VSV-G/retrovirus pseudotypes with human serum resulted in only a 5-fold reduction in titer. In light of the demonstrated role of natural human antibodies directed against proteins carrying Gal(α1–3)galactose terminal carbohydrates in the virus inactivation process (3, 4), we next

FIG. 5. Time course of VSV-G pseudotyped virus production by GPGnlsLZ clones. Clones GPGnlsLZ2, GPGnlsLZ3, and GPGnlsLZ4 were grown to 95% confluence in 100-mm dishes in tetracycline (1 µg/ml). Cells were rinsed and placed in 5 ml growth media without tetracycline. Supernatants were harvested and replaced with fresh media (no tetracycline) at 24 intervals. Supernatants were titered on NIH 3T3 cells. Titer is expressed as cfu/ml. Times indicate the period after tetracycline removal during which viral production was assessed.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

A STABLE HUMAN-DERIVED PACKAGING CELL LINE FOR PRODUCTION OF HIGH TITER RETROVIRUS/VESICULAR STOMATITIS VIRUS G PSEUDOTYPES

11405

examined the inactivation of virus exposed to human serum in the presence of an excess of Gal(α1–3)galactose. In the case of amphotropic virus, incubation with 10 mg/ml Gal(α1–3)galactose completely blocked virus inactivation, while in the case of the VSV-G/retroviral pseudotypes, the titer was unaffected. (Fig. 6).

Table 1. Viral titers from 293GPG and GPGnlsLZ producer cells Retroviral vector* Producer cells GPGnlsLZ2§ GPGnlsLZ3 GPGnlsLZ4 Concentrated GPGnlsLZ2¶ Concentrated GPGnlsLZ3` 293GPG (18)** ∆U3nlsLZ 293GPG (18) ∆U3nlsLZ 293GPG (20) ∆U3nlsLZ ∆U3nlsLZ 293GPG (20)

Viral titer, units/ml† 1.2×107 9.8×106 8.4×106 5.4×109 3.4×109 2.8×106 3.0×106 1.1×106 2.5×106

Helper virus assay‡ — — — ND ND — — ND ND

*nlsLacZ virus produced by transient transfection with ∆U3nlsLZ. †nlsLacZ virus titers determined on NIH 3T3 cells. ‡Helper virus assay performed using Mus dunni LacZ mobilization assay. Less than one amphotropic 4070A virus particle per milliliter was able to be detected by this method. ND, not determined. §Twenty-four hour viral supernatant harvest after removal of tetracycline from growth media (72- to 96-hr collection for GPGnlsLZ2, 48- to 72-hr collection for GPGnlsLZ3, and 72- to 96-hr collection for GPGnlsLZ4). ¶Unconcentrated titer was 1.6×106, virus was concentrated >3300-fold with 65% total virus recovery. ` Unconcentrated titer was 1.6×106, virus was concentrated >3200-fold with 67% recovery of total virus. **Numbers in parentheses indicate cell passage at time of transfection.

DISCUSSION The 293GPG packaging cell line described above possesses a number of features that should greatly facilitate the further evaluation of the potential applications of retroviral vectors. Most importantly, the cell line makes it possible both to generate stable virus-producing cell lines which produce very high titers of VSV-G/retroviral pseudotypes and to generate virus rapidly by transient transfection techniques. Because of the ability of the pseudotypes to be efficiently concentrated, it will now be feasible to generate the large amounts of extremely high titer (>109 cfu/ml) virus critical for examining the potential utility of retroviral vectors for in vivo infection and the ability to transduce cells refractory to infection by standard vectors. While the virus produced from 293GPG cells is not fully resistant to human serum, it is significantly more resistant than amphotropic virus generated from murine cells. Based on our Gal(α1–3)galactose blocking studies, we believe that the residual sensitivity of the virus pseudotypes to human serum may be due to natural IgM antibodies known to react against VSV (26). Cosset et al. (40) have recently described another human-derived packaging cell line capable of producing recombinant retrovirus that appears to be fully resistant to inactivation by human serum. In those studies, however, either the amphotropic envelope or an envelope derived from the virus RD 114 (41) was used rather than the VSV-G protein. Another potentially useful packaging cell line for the production of VSV G/retroviral pseudotypes has recently been described by Neinhuis and coworkers (42). That cell line makes use of murine cells and a strategy for the regulated expression of VSV-G similar to the one we have employed.

FIG. 6. Sensitivity to human serum of viruses produced by ΨCRIPLZ and GPGnlsLZ4 producer cell lines. Viruses produced from amphotropic ΨCRIPLZ producer cells and VSV-G pseudotyped GPGnlsLZ4 producer cells were incubated for 1 h at 37°C with fresh human serum (HS) and heat-inactivated human serum (IHS) in the presence and absence of 10 mg/ml Gal (α1–3)galactose. Surviving titers of LacZ virus were determined by infection of NIH 3T3 cells. The serum sensitivity assay was performed twice, and averaged relative titers for HS and IHS treatment versus IFS treatment are shown. As a consequence of the use of the VSV-G protein as the determinant of the host range of virus produced by the 293GPG cell line, the packaging cell line exhibits several somewhat unusual properties relative to other packaging cell systems. First, while the expression of VSV-G in 293GPG cells is tightly regulated by tetracycline, the cells nevertheless express sufficient levels of VSV-G to yield titers of 103 cfu/ml in the presence of tetracycline. One concern that has not yet been fully evaluated is that the low levels of VSV-G expression in the presence of tetracycline may lead to the gradual loss of packaging function with the prolonged culture of the cells due to a growth selection against VSV-Gexpressing cells. While we have observed that viral titers exceeding 106 cfu/ml can still be obtained by transient transfection after 20 passages of the cells, the prolonged passage of any working stock of the cells should probably be avoided. A second novel property of the cells is that, in addition to spontaneously fusing upon induction of VSV-G expression, the cells also promote the fusion of target cells with which they are cocultivated. While this property of the packaging cells makes the use of cocultivation techniques for achieving the highly efficient transduction of cells impractical, it is hopeful that the ability to generate highly concentrated virus stocks will compensate for this limitation. Another interesting property of 293GPG cells is the potential susceptibility of stable virus-producing cell lines generated from the cells to superinfection by the virus produced from the same cells. Although the titers of virus released from the cells in the presence of tetracycline are low, we do not yet know the extent to which reinfection of virus-producing cells may occur. Finally, because the packaging cells are routinely maintained in media containing tetracycline, puromycin, and G418, other selectable markers must be used for stably introducing vector constructs into the cells. In addition to zeocin, we have also

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

A STABLE HUMAN-DERIVED PACKAGING CELL LINE FOR PRODUCTION OF HIGH TITER RETROVIRUS/VESICULAR STOMATITIS VIRUS G PSEUDOTYPES

11406

successfully used hygromycin and histidinol (43) selections with the 293G and 293GPG cells. Most of the problems related to the generation of RCV by different retroviral packaging cell lines can be practically eliminated through the use of specific vectors (34, 35) and/or the practice of isolating clonal virus producing cell lines and screening the cell lines for helper. Nevertheless, several of the design features of the 293GPG packaging cell line may also provide at least some theoretical advantages over existing cell lines with regard to the possibility of release of RCV. One problem with all existing murine-based packaging cell lines is the presence of both endogenous retroviral DNA sequences (31, 33) and retroviral-like RNAs (44) that are efficiently packaged and transmitted to cells, and may contribute to the generation of helper virus under certain conditions. Another issue relates to the potential of different packaging cell lines to give rise to helper virus due to the overlap of sequences between the particular vector used and the precise packaging sequences present in the packaging cell line (34, 35). A more global inherent defect in the design of all murine and human-derived packaging cell lines is the ability of retroviral RNAs which lack packaging sequences to be packaged, albeit at low efficiency, and transmitted to cells (40). Even in the case of third generation packaging cells (15), it has been possible to observe the transmission of viral packaging functions to recipient cells. Cosset et al., for example, have recently documented and quantitated the transfer of both gag and env encoding genomes derived from both a packaging construct used to generate ΨCRIP cells (15) and a construct used in the generation of the human-derived FLY cell line (40), another third generation packaging cell line. In our laboratory’s unpublished studies with ΨCRE/ΨCRIP cells and the parental MFG vector, which contains an extended gag ORF (19), we have also obtained data consistent with the transfer of packaging functions and the possible emergence of helper virus in the context of high titer cross-infections employed to generate complex populations of virus-producing cells. The design of the 293GPG cells may be relevant to each of the above issues. In the construction of the 293GPG cell line, we have used only the precise viral sequences necessary to encode gag-pol and an expression vector that utilizes totally nonretroviral sequences. We have also utilized totally nonretroviral sequences to provide for the host range of the virus produced from the cells rather than use conventional retroviral env gene expression constructs. Depending on the vector used in conjunction with 293GPG cells, this design feature of the cells may reduce the probability of undesirable recombination events. More significantly, it is hopeful that the removal of all extraneous viral sequences in the transcript used to express gag-pol and the use of nonretroviral transcripts encoding VSV-G will reduce the efficiency with which those transcripts can be packaged and transmitted to cells, relative to that which occurs with conventional third generation packaging cell transcripts. This hypothesis will need to be tested directly. We thank Dr. Jean Schaffer for helpful discussions and critical review of this manuscript. D.S.O. is supported by a National Institutes of Health Physician Scientist Award (HL02910). Support for this work was also provided for by a Program of Excellence in Molecular Biology Grant from the National Heart, Lung, and Blood Institute (HL41484). 1. Mulligan, R.C. (1993) Science 260, 926–932. 2. Takeuchi, Y., Cosset, F.-L.C., Lachmann, P.J., Okada, H., Weiss, R.A. & Collins, M.K.L. (1994) J. Virol. 68, 8001–8007. 3. Takeuchi, Y., Porter, C.D., Strahan, K.M., Preece, A.F., Gustafasson, K., Cosset, F.-L., Weiss, R.A. & Collins, M.K.L. (1996) Nature (London) 379, 85–88. 4. Rother, R.P., Fodor, W.L., Springhorn, J.P., Birks, C.W., Setter, E., Sandrin, M.S., Squinto, S.P. & Rollins, S.A. (1995) J. Exp. Med. 182, 1345–1355. 5. Roe, T., Reynolds, T.C., Yu, G. & Brown, P.O. (1993) EMBO J. 12, 2099–2108. 6. Lewis, P.F. & Emerman, M. (1994) J. Virol. 68, 510–516. 7. Emi, N., Friedmann, T. & Yee, J.-K. (1991) J. Virol. 65, 1202– 1207. 8. Burns, J.C., Friedmann, T., Driever, W., Burrascano, M. & Yee, J.-K. (1993) Proc. Natl. Acad. Sci. USA 90, 8033–8037. 9. Zavada, J. (1972) J. Gen. Virol. 15, 183–191. 10. Grahm, F., Smiley, R. & Nairu, R. (1977) J. Gen. Virol. 36, 59. 11. Cullen, B.R. (1986) Cell 46, 973–982. 12. Gossen, M. & Bujard, H. (1992) Proc. Natl. Acad. Sci. USA 89, 5547–5551. 13. Rose, J.K. & Gallione, C. (1981) J. Virol. 39, 519–528. 14. Sadelain, M., Wang, C.H., Antoniou, M., Grosveld, F. & Mulligan, R.C. (1995) Proc. Natl. Acad. Sci. USA 92, 6728–6732. 15. Danos, O. & Mulligan, R.C. (1988) Proc. Natl. Acad. Sci. USA 85, 6460–6464. 16. Morgenstern, J.P. & Land, H. (1990) Nucleic Acids Res. 18, 1068. 17. Southern, P.J. & Berg, P. (1982) J. Mol. Appl. Genet. 1, 327–341. 18. Berns, A.J., Clift, S., Cohen, L.K., Donehower, R.C., Dranoff, G., Hauda, K.M., Jaffee, E.M., Lazenby, A.J., Levitsky, H.I. & Marshall, F.F. (1995) Hum. Gene Ther. 6, 347–368. 19. Riviere, I., Brose, K. & Mulligan, R.C. (1995) Proc. Natl. Acad. Sci. USA 92, 6733–6737. 20. Boshart, M., Weber, F., Jahn, G., Dorsch-Hasler, K., Fleckenstein, B. & Schaffner, W. (1985) Cell 41, 521–530. 21. Dranoff, G., Jaffee, E., Lazenby, A., Golumbek, P., Levitsky, H., Brose, K., Jackson, V., Hamada, H., Pardoll, D. & Mulligan, R.C. (1993) Proc. Natl. Acad. Sci. USA 90, 3539–3543. 22. Pear, W.S., Nolan, G.P., Scott, M.L. & Baltimore, D. (1993) Proc. Natl. Acad. Sci. USA 90, 8392–8396. 23. Sambrook, J., Fritsch, E.F. & Maniatis, T.T. (1989) Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Lab. Press, Plainview, NY), 2nd Ed. 24. Goff, S., Traktman, P. & Baltimore, D. (1981) J. Virol. 38, 239–248. 25. Lim, K. & Chae, C.-B. (1989) BioTechniques 7, 576–579. 26. Beebe, D.P. & Cooper, N.R. (1981) J. Immunol. 126, 1562–1568. 27. Osbourne, W.R.A., Hock, R.A., Kaleko, M. & Miller, A.D. (1990) Hum. Gene Ther. 4, 609–615. 28. Miller, A.D. & Buttimore, C. (1986) Mol. Cell. Biol. 6, 2895– 2902. 29. Mann, R., Mulligan, R.C. & Baltimore, D. (1983) Cell 33, 153–159. 30. Markowitz, D., Goff, S. & Bank, A. (1988) J. Virol. 62, 1120– 1124. 31. Scadden, D.T., Fuller, B. & Cunningham, J.M. (1990) J. Virol. 64, 424–427. 32. Cosset, F.L., Girod, A., Flamant, F., Dryand, A., Ronfort, C., Valsesia, S., Molina, R.M., Faure, C., Nigon, V.M. & Verdier, G. (1993) Virology 193, 385–395. 33. Purcell, D.F.J., Broscius, C.M., Vanin, E.F., Buckler, C.F., Neinhuis, A.W. & Martin, M.A. (1996) J. Virol. 70, 887–897. 34. Miller, A.D. & Rosman, G.J. (1989) BioTechniques 7, 982–990. 35. Miller, A.D. (1990) Hum. Gene Ther. 1, 5–14. 36. Hebert, D.N., Foellmer, B. & Helenius, A. (1995) Cell 81, 425–433. 37. Zhang, L. & Ghosh, H.P. (1994) J. Virol. 68, 2186–2193. 38. Blumenthal, R.A., Bali-Puri, A., Walter, A., Corell, D. & Eidelman, O. (1987) J. Biol. Chem. 262, 13614–13619. 39. Finer, M.H., Dull, T.J., Qin, L., Farson, D. & Roberts, M.R. (1994) Blood 83, 43–50. 40. Cosset, F.-L., Takeuchi, Y., Battini, J.-L., Weiss, R.A. & Collins, M.K.L. (1995) J. Virol. 69, 7430–7436. 41. Reeves, R.H. & O’Brien, S.J. (1984) J. Virol. 52, 164–171. 42. Yang, Y., Vanin, E.F., Whitt, M.A., Fornerod, M., Zwart, R., Scheiderman, R.D., Grosveld, G. & Neinhuis, A.W. (1995) Hum. Gene Ther. 6, 1203– 1213. 43. Hartman, S.C. & Mulligan, R.C. (1988) Proc. Natl. Acad. Sci. USA 85, 8047–8051. 44. Torrent, C., Bordet, T. & Darlix, J.L. (1994) J. Mol. Biol. 240, 434–444.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

CELL-SURFACE RECEPTORS FOR RETROVIRUSES AND IMPLICATIONS FOR GENE TRANSFER

11407

This paper was presented at a colloquium entitled “Genetic Engineering of Viruses and of Virus Vectors,” organized by Bernard Roizman and Peter Palese (Co-chairs), held June 9–11, 1996, at the National Academy of Sciences in Irvine, CA

Cell-surface receptors for retroviruses and implications for gene transfer A.DUSTY MILLER Fred Hutchinson Cancer Research Center, 1100 Fairview Avenue North, Room C2–023, Seattle, WA 98109 ABSTRACT Retroviruses can utilize a variety of cell-surface proteins for binding and entry into cells, and the cloning of several of these viral receptors has allowed refinement of models to explain retrovirus tropism. A single receptor appears to be necessary and sufficient for entry of many retroviruses, but exceptions to this simple model are accumulating. For example, HIV requires two proteins for cell entry, neither of which alone is sufficient; 10A1 murine leukemia virus can enter cells by using either of two distinct receptors; two retroviruses can use different receptors in some cells but use the same receptor for entry into other cells; and posttranslational protein modifications and secreted factors can dramatically influence virus entry. These findings greatly complicate the rules governing retrovirus tropism. The mechanism underlying retrovirus evolution to use many receptors for cell entry is not clear, although some evidence supports a mutational model for the evolution of new receptor specificities. Further study of factors that govern retrovirus entry into cells are important for achieving high-efficiency gene transduction to specific cells and for the design of retroviral vectors to target additional receptors for cell entry. Many features make retrovirus vectors a good choice for gene transfer into animal cells. Most importantly, these vectors integrate efficiently into the target cell genome to promote stable gene transfer, and integration is precise with respect to the virus genome, resulting in unrearranged transfer of the desired genes. The only other integrating vector is derived from adeno-associated virus, but integration is inefficient (1) and appears not to be precise with respect to the viral genome (2). In addition, retroviral vectors can transduce both dividing and non-dividing cells, although this is true of vectors derived from HIV (3) and not the commonly used vectors derived from murine leukemia viruses, which require cell division (4). Furthermore, retrovirus vectors can be designed to eliminate all viral protein coding regions without affecting gene transfer rates, and can be made in the absence of replication-competent virus by using retrovirus packaging cell lines, which supply all of the viral proteins required for vector transmission. Gene transfer and expression mediated by such replication-incompetent vectors is called transduction to differentiate this process from virus infection followed by further virus replication. A key consideration in retroviral vector design is the source of the viral envelope (Env) protein present on vector virions, because this protein binds to specific cell-surface proteins and is the primary determinant of the range of cells that can be transduced by the vector. The name of the virus or the virus group from which the Env protein was derived will be referred to as the pseudotype of the vector. Naturally occurring retroviruses can use a variety of different proteins for cell entry, although in general individual retroviruses appear to recognize a single receptor. Utilization of additional cell-surface proteins for vector entry has been achieved by incorporation of polypeptides into the Env protein to alter its receptor binding properties or by replacement of the retroviral Env protein with surface proteins from other viruses. These alterations can allow targeting of particular cells that express specific proteins or an expansion of the range of cells that can be transduced by targeting broadly expressed proteins. In this paper I will review the factors that govern retrovirus binding and entry into cells and implications for the design of retroviral vectors.

Virus Interference Early evidence that retroviruses use multiple receptors for cell entry came from studies of virus interference. Infection of a cell by a replication-competent retrovirus results in synthesis of a retroviral Env protein that binds to the receptor used for virus entry. This effectively blocks entry of the original virus and other retroviruses that target the same receptor, whereas entry of retroviruses that use different receptors is unaffected. Interference between retroviruses has been shown to occur at the level of virus entry into cells and not at some other step in the virus life cycle. By interference analysis, retroviruses that infect human cells have been assigned to eight groups that use different receptors on human cells (Table 1). The genes encoding these receptors are scattered on different chromosomes (Table 1), indicating that the receptors are different proteins.

Cloned Retrovirus Receptors In 1984 CD4 (previously called T4) was identified as a receptor for HIV-1, and became the first known retrovirus receptor (12, 13). Since then, six additional retrovirus receptors have been identified and their cDNAs cloned (Table 2). All except CD4 appear to be sufficient for entry of the corresponding retroviruses by the criteria that expression of these receptors in nonpermissive cells renders the cells susceptible to infection. In contrast, CD4 transfer into nonpermissive mouse cells does not allow infection by HIV. HIV binds to all cells that express CD4, but another factor is required for HIV entry. Recently, a coreceptor for T-cell tropic HIV-1 strains has been found and was named fusin to indicate its presumed role in virus entry following HIV-1 binding to CD4 (14). Expression of the human CD4 and fusin proteins in mouse cells renders the cells susceptible to HIV-1 infection, whereas either protein alone is insufficient. Even

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact. Abbreviations: MLV, murine leukemia virus; AM-MLV, amphotropic MLV; MoMLV, Moloney MLV; CHO, Chinese hamster ovary; GALV, gibbon ape leukemia virus; FeLV, feline leukemia virus.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

CELL-SURFACE RECEPTORS FOR RETROVIRUSES AND IMPLICATIONS FOR GENE TRANSFER

11408

more recently, a second protein related to fusin and previously named CC-CKR-5 has been found to be a coreceptor for macrophage-tropic HIV-1 strains (15, 16).

Table 1. Retrovirus interference groups in human cells Virus Description Interference group 1 RD114 Cat endogenous virus SNV Avian spleen necrosis virus BaEV Baboon endogenous virus SRV-1 Simian retrovirus SRV-2 Simian retrovirus SRV-3 (MPMV) Simian retrovirus SRV-4 Simian retrovirus SRV-5 Simian retrovirus PO-1-Lou Spectacled langur retrovirus SMRV Squirrel monkey retrovirus 2 MLV-A Amphotropic murine leukemia virus 3 MLV-X Xenotropic murine leukemia virus 4 FeLV-C Feline leukemia virus 5 FeLV-B Feline leukemia virus SSAV Simian sarcoma-associated virus GALV Gibbon ape leukemia virus 6 BLV Bovine leukemia virus 7 HTLV-1 Human T-cell leukemia virus HTLV-2 Human T-cell leukemia virus ChTLV Chimpanzee T-cell leukemia virus STLV Simian T-cell leukemia virus 8 HIV-1 Human immunodeficiency virus HIV-2 Human immunodeficiency virus SIV Simian immunodeficiency virus

Human chromosome that encodes receptor 19

8 2

17

12

Interference data are from Sommerfelt and Weiss (5), and for SNV, from Kewalramani et al. (6). Chromosome localization data are from the following references: group 1 (7), group 2 (8), group 5 (9), group 7 (10), and group 8 (11).

These results, showing that two proteins are required for HIV-1 entry, raise the possibility that coreceptors are required for entry of other retroviruses. However, their detection will require the identification of nonpermissive cells for which transfer of the known receptors does not render the cells susceptible to infection. Some retroviruses have a very wide host range; thus, if other proteins are required for entry of these viruses, functional homologs of these coreceptors must be widely distributed in cells from many species. Two of the cloned retrovirus receptors, Ram1 and Glvr1, are closely related at the protein sequence level (21, 22, 24), and both are sodiumdependent phosphate transporters (23). These proteins are members of a large family of known and presumptive phosphate transporters from many organisms (Fig. 1). However, Ram1 and Glvr1 are clearly distinct since the genes encoding these proteins are located on different chromosomes in humans and mice (8, 9, 30, 31) and they show very different patterns of expression in animal tissues (23). In addition, these proteins serve as receptors for distinct groups of viruses in human cells (Table 1).

The 10A1 Retrovirus Can Use Either of Two Receptors for Cell Entry Studies of cloned retrovirus receptors and most virus interference data suggested that individual retroviruses bind to a single protein for entry into cells. When different viruses bind to the same receptor, they typically show reciprocal interference; that is, infection of cells by either virus blocks entry by the other virus. The finding of nonreciprocal interference between some retroviruses complicated this picture. In the example shown (Table 3), transduction by a vector with an amphotropic, a 10A1, or an ecotropic pseudotype was measured in NIH 3T3 mouse cells infected with amphotropic MLV (AM-MLV), 10A1 MLV, Moloney MLV, or no virus. A typical pattern of interference for viruses that use different receptors for cell entry is shown by the amphotropic and ecotropic viruses, where ecotropic vector transduction is blocked by the presence of ecotropic MoMLV in the target cells, but is unaffected by the presence of amphotropic virus, and ampho

Table 2. Cloned retrovirus receptors Receptor Retrovirus Human immunodeficiency virus CD4 Fusin, CC-CKR-5 (coreceptors)

Type* TM1 TM7

Simian immunodeficiency virus Murine ecotropic retrovirus Murine amphotropic retrovirus Gibbon ape leukemia virus Bovine leukemia virus Avian leukosis virus type A Feline immunodeficiency virus

TM1 TM14 TM10–13 TM10–13 TM1 TM1 TM4

CD4 Rec1 Ram1 Glvr1 Blvr Tva CD9

ND, not determined; LDL, low density lipoprotein. *TM followed by a number indicates the number of transmembrane domains in the protein.

Function Immune recognition G protein-coupled chemokine receptors Immune recognition Basic amino acid transport Phosphate transport Phosphate transport ND LDL receptor-like protein Signaling protein?

Refs. 12, 13 14–16 17 18–20 21–23 23, 24 25, 26 27 28, 29

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

CELL-SURFACE RECEPTORS FOR RETROVIRUSES AND IMPLICATIONS FOR GENE TRANSFER

11409

tropic vector transduction is blocked by the presence of AM-MLV, but is unaffected by the presence of ecotropic MoMLV. Nonreciprocal interference is displayed by the amphotropic and 10A1 viruses, where 10A1-pseudotype vector transduction is unaffected by the presence of amphotropic virus in the target cells, but amphotropic vector transduction is blocked by the presence of 10A1 virus. These data suggested that 10A1 virus can enter cells by using a different receptor than that used by amphotropic virus, and that 10A1 virus can also bind to the amphotropic receptor and block amphotropic virus entry (Fig. 2).

FIG. 1. Dendrogram of amino acid sequence similarities among phosphate transporters. Distances between sequences were computed by the Genetics Computer Group program PILEUP. Overall sequence identity for the branch point at the far left is about 21%. Sequences were obtained from GenBank: hRam1, L20852; rRam1, L19931; cRam1, U13945; hGlvr1, L20859; cGlvr1, U13946; mGlvr1, M73696; B0222.2 and B0222.3, U50312; YG04, P45268; M. thermoauto trophicum ORF, S08522; Pho4, M31364; YB8I, P38361; PitA, P37308; PitB, P43676; PitH, P41132; Pit, U15187. Given that 10A1 virus can bind to Ram1, we tested the ability of Ram1 to mediate entry of the 10A1-pseudotype LAPSN vector. We also tested Glvr1 due to its similarity to Ram1 and thus the possibility that Glvr1 was the alternative receptor for entry of 10A1 virus. We found that expression of human Ram1, rat Ram1, human Glvr1, or mouse Glvr1 rendered Chinese hamster ovary (CHO) cells susceptible to 10A1pseudotype LAPSN vector transduction (Table 4). Thus, 10A1 virus can bind and enter cells by using either of two different retrovirus receptors. Amphotropic virus can enter CHO cells expressing human or rat Ram1, but not those expressing human or mouse Glvr1 (data not shown). These results explain the nonreciprocal interference observed between 10A1 and amphotropic retroviruses.

Table 3. Nonreciprocal interference between 10A1 and amphotropic retroviruses LAPSN pseudotype Vector titer, FFU/ml 3T3 3T3+ AM-MLV Amphotropic 5×106 40 10A1 7×106 6×106 Ecotropic 3×106 2×106

3T3+ 10A1 3 2×102 2×106

3T3+ MoMLV 4×106 6×106 40

The LAPSN vector encodes alkaline phosphatase and neomycin phosphotransferase. LAPSN vector with an amphotropic, 10A1, or ecotropic pseudotype was made by using PA317 retrovirus packaging cells, wild-type 10A1 virus, or PE501 packaging cells, respectively. Transduction was measured by staining cells for alkaline phosphatase 2 days after exposure to the vectors. Data are from Miller and Chen (32).

Some Receptors Can Promote Entry of Retroviruses That Normally Utilize Independent Receptors In human cells, gibbon ape leukemia virus (GALV) exclusively uses Glvr1 for entry and amphotropic retrovirus exclusively uses Ram1. These facts are reflected in the assignment of these viruses to separate interference groups for human cells (Table 1). However, analysis of the hamster homolog of Ram1 shows that it can function as a receptor for GALV or amphotropic retrovirus (34). In addition, certain chimeric receptors made between Ram1 and Glvr1 can also function as receptors for both viruses (Fig. 3). In this example, the hybrid receptor RRG promotes transduction by GALV or amphotropic pseudotype vectors with efficiencies similar to those found for GALV vector transduction of cells expressing the normal human Glvr1 receptor (GGG) or amphotropic vector transduction of cells expressing the normal rat Ram1 (RRR) receptor. Thus, the ability of retroviruses to utilize certain receptor homologs for entry, and therefore the interference pattern of these

FIG. 2. Nonreciprocal interference between 10A1 and amphotropic retroviruses.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

CELL-SURFACE RECEPTORS FOR RETROVIRUSES AND IMPLICATIONS FOR GENE TRANSFER

11410

retroviruses, will depend on the specific receptors expressed in the target cells.

Table 4. A 10A1-pseudotype retroviral vector can utilize Ram1 or Glvr1 for cell entry Species Vector titer, FFU/ml Receptor Ram-1 Human 1×106 Rat 3×105 Glvr-1 Human 6×105 Mouse 7×105 None <500 Retrovirus receptor cDNAs were expressed by using the retroviral vector LXSN. CHO cells were seeded at 2×104 per well (d=3.5 cm) in multiwell dishes on day 1. On day 2, cells were cotransfected with 2.5 µg of β-galactosidase expression plasmid and 2.5 µg of the receptor expression construct. On day 3, one set of dishes was stained for β-galactosidase to assess transfection efficiency, whereas the other set was infected with 2 µl of the LAPSN vector pseudotyped with the 10A1 retrovirus in the presence of 50% medium conditioned by CHO cells. On day 4, cells were stained for alkaline phosphatase and foci of stained cells were counted. Transfection efficiencies were similar for all constructs, as measured by β-galactosidase staining. Data are from Miller and Miller (33).

Retrovirus Interactions with Homologous Receptor Proteins from Other Species Are Complex Limitations to retrovirus entry into cells from different species are due to variable expression of the receptor or its homologs, or to amino acid sequence differences or posttranslational modifications in the receptor homologs in different species that inhibit virus binding or entry. The former mechanism for virus resistance is primarily applicable to different cells from the same organisms that express variable levels of the receptor. An example of this is provided by HIV, which for entry requires the CD4 receptor that is found primarily on T lymphocytes and not on cells from many other tissues. Many examples of the latter mechanism of virus resistance have been found for cells from different species, in which a receptor homolog is expressed but is nonfunctional. For example, ecotropic retroviruses infect rodent cells, but do not infect human cells, even though human cells express a homolog of the murine ecotropic receptor that is 87% identical to the mouse protein. In this case, only two amino acid changes are required to convert the human protein into a functional receptor, or to render the mouse protein nonfunctional as an ecotropic retrovirus receptor (35, 36). Other examples of virus restriction in different species are provided by viruses that utilize Pit receptor family members for entry. A simple example is the restriction of GALV entry into mouse cells, which, like the restriction to ecotropic virus infection of human cells, is not due to lack of receptor homolog expression, but to minor changes in mouse Glvr1 compared with human Glvr1. A more complicated example is provided by 10A1 receptor usage in different species. As noted above, 10A1-pseudotype virus can use human Ram1 or human Glvr1 to enter CHO cells (Table 4) and to enter human cells (32). However, in rat cells 10A1 virus infection does not block GALV-pseudotype vector transduction (Table 5), showing that 10A1 cannot bind to or enter cells by using the rat GALV receptor. Indeed, 10A1 has the same interference properties as amphotropic retrovirus in rat cells, and thus uses the amphotropic virus receptor for entry. Thus, 10A1 virus behaves like an amphotropic virus in rat cells, but like a combination of an amphotropic virus and GALV in human cells. Therefore, the interference and receptor utilization properties of 10A1 virus depends on the cell type used for the analysis.

Env Amino Acid Sequence Is Not Predictive of Receptor Utilization It is not clear how retroviruses have evolved to utilize such a diverse group of receptors for entry into cells. One possibility is that mutations in the Env protein promote weak binding and entry through interaction with new receptors, and if the new receptor specificity is beneficial for virus survival, selective pressure favors further mutations that promote more efficient

FIG. 3. GALV- and amphotropic-pseudotype vector transduction of cells expressing hybrid Ram-1/Glvr-1 receptors. CHO or NIH 3T3 cells were seeded in 3.5-cm dishes at 2×104 cells per dish. On day 2, hybrid constructs cloned in the retroviral vector LXSN were cotransfected (1:1) with a plasmid encoding β-galactosidase (2.5 pig each). Parallel dishes were stained for β-galactosidase, whereas the other set was infected with the retroviral vector LAPSN pseudotyped by amphotropic Env [LAPSN(PA317)] or a GALV Env [LAPSN(PG13)] at a multiplicity of infection of about 2. Cells were stained for alkaline phosphatase activity on day 5. Values are the number of vector-transduced (alkaline phosphatase-positive) foci divided by the number of β-galactosidase positive foci. Results are averages of duplicate dishes. The experiment was performed three times with similar results. Data are from Miller and Miller (33).

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

CELL-SURFACE RECEPTORS FOR RETROVIRUSES AND IMPLICATIONS FOR GENE TRANSFER

11411

utilization of the new receptor. Another model involves replacement of portions of the retroviral Env protein with portions of cellular proteins that recognize other cell-surface proteins. For example, incorporation of a portion of the erythropoietin protein into an existing Env protein might allow the erythropoietin receptor to function as a new target for retrovirus binding and entry. This model for acquisition of new receptor specificities parallels the process of retrovirus acquisition of cellular oncogenes. Just as oncogenes can improve retrovirus replication and survival, the ability to utilize new receptors for cell entry should improve the survival potential of a retrovirus. In addition, the existence of cellular proteins that bind cell-surface molecules with high affinity seems a more likely source for the development of radically altered retrovirus receptor specificities compared with random Env mutations.

Table 5. 10A1-pseudotype LAPSN vector can use the amphotropic receptor, but not the GALV receptor, for entry into 208F rat cells Vector titer, FFU/ml LAPSN pseudotype 208F 208F+AM-MLV 208F+GALV 10A1 1×107 500 1×107 Amphotropic 2×106 200 2×106 GALV 2×105 2×105 100 LAPSN vector with a 10A1, amphotropic, or GALV pseudotype was made by using wild-type 10A1 virus, PA317 retrovirus packaging cells, or PG13 packaging cells, respectively. Transduction was measured by staining cells for alkaline phosphatase 2 days after exposure to the vectors. Data are from Miller and Chen (32).

Predictions of the model for alteration of retrovirus receptor utilization by incorporation of cellular genes is that retroviruses that utilize similar receptors should contain more closely related Env proteins than retroviruses that use other receptors, and Env proteins should contain regions of similarity with cellular proteins. A comparison of Env proteins from several retroviruses shows that retroviruses that use different receptors can be more highly related than those that use the same receptor (Fig. 4). For example, GALV, 10A1, and subgroup B feline leukemia virus (FeLV-B) all can use Glvr1 as a receptor, but FeLV-B is more closely related to FeLV-A and FAIDS, which use different receptors, than it is to GALV or the 10A1 virus. Likewise, the 10A1 virus is more closely related to the polytropic (MoMCF; Moloney mink cell focusforming virus), xenotropic (NZB), and ecotropic (FrMLV, MoMLV, and AKV) retroviruses than to GALV or FeLV-B. The same overall dendrogram is obtained even if one compares only the 200 amino acids at the amino termini of the processed Env proteins that are directly involved in receptor binding (not shown). Comparison of these amino terminal receptor-binding regions of the Env proteins from viruses in the FeLV, MLV, and GALV groups reveals a similar amino acid framework surrounding two variable regions, with no common features in the variable regions that would predict the receptor utilization pattern (37). In addition, no similarities have been found between regions of retroviral Env proteins and already sequenced cellular proteins. Thus, the data to date favor a mutational origin for new receptor specificities rather than a model involving acquisition of cellular proteins that can bind new cell-surface receptors. The mutational model can explain the diversity in Env sequences among viruses that recognize the same receptor as the result of convergent evolution of different parental retroviruses. Another argument in favor of a mutational model for acquisition of new receptor specificities is the finding that small changes in a virus Env protein can result in a new receptor specificity. For example, no more than six amino acid changes are required to convert an amphotropic Env, which targets Ram1, to one having the receptor utilization properties of 10A1 virus, which targets Ram1 or Glvr1 for entry (32, 38). However, because Ram1 and Glvr1 are related proteins, this change does not represent a dramatic switch in receptor specificity, and it will be interesting to see if minor amino acid changes in Env proteins can result in more dramatic changes in receptor utilization.

FIG. 4. Dendrogram of amino acid similarities between different retroviral Env proteins. Distances between sequences were computed by the Genetics Computer Group program PILEUP. Overall sequence identity for the branch point at the far left is about 42%. Sequences were obtained from GenBank: FAIDS, feline AIDS virus, M18247; FeLV-A, feline leukemia virus subgroup A, M12500; FeLV-B, feline leukemia virus subgroup B, X00188; 10A1, 10A1 MLV, M33470; AM-MLV, M33469; MoMCF, Moloney mink cell focus-forming virus, J02254; NZB, NZB MLV, K02730; FrMLV, Friend MLV, Z11128; MoMLV, J02255; AKV, AKV MLV, J01998; and GALV, M26927. Endogenous Synthesis of Env Protein Can Block Retrovirus Entry Retrovirus receptors can be rendered nonfunctional due to blockade by Env protein synthesized by a replication-competent retrovirus. This is the basis for the virus interference discussed above. Interference with receptor function can also result from synthesis of Env proteins from endogenous retroviruses or fragments of retroviruses that are inherited in animals. A well-documented example of this phenomenon involves the Fv-4 locus in mice (39), the phenotype of which is due to a truncated endogenous ecotropic retrovirus that is missing the gag and part of the pol genes, but which contains an intact env gene. Synthesis of this endogenous env gene product in mouse tissues blocks infection and leukemia caused by ecotropic retroviruses by blocking the ecotropic retrovirus receptor. Other examples of this phenomenon have been found for avian leukosis viruses in chickens (40) and for MCF viruses in mice (41).

Hamster Cells Secrete a Factor That Blocks Retrovirus Infection and a Similar Factor Is Found in Hamster Serum CHO cells are resistant to infection by many retroviruses. In most cases, this resistance can be abrogated by prior treatment of the cells with the glycosylation inhibitor tunicamycin. The resistance to GALV and amphotropic retrovirus infection is due to a secreted protein factor that blocks infection (42). Thus, addition of CHO cell-conditioned medium to CHO cells that have been made susceptible to infection by treatment with tunicamycin blocks infection by GALV and amphotropic viruses. In contrast, addition of the conditioned medium does not block infection of tunicamycin-treated CHO cells by an ecotropic retrovirus, showing that the medium is not simply toxic, and that the effect is specific for retroviruses with particular Env proteins. Interestingly, the CHO cell-

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

CELL-SURFACE RECEPTORS FOR RETROVIRUSES AND IMPLICATIONS FOR GENE TRANSFER

11412

conditioned medium does not block amphotropic vector transduction of human or mouse cells, nor does it block transduction of CHO cells made susceptible to amphotropic vector transduction by prior introduction of genes expressing human or rat Ram1 (21, 22), indicating that the factor can bind to and block the hamster receptor but not the human or rat receptors. Hamster serum contains a similar factor that can block retrovirus infection of tunicamycin-treated CHO cells (Table 6). Addition of 5% serum from Chinese hamsters completely blocked transduction by an amphotropic vector, and 12.5% serum from Syrian hamsters also significantly inhibited transduction. In contrast, addition of 25% fetal bovine serum had no effect on transduction of tunicamycin-treated CHO cells by the amphotropic vector. Like the CHO cell-conditioned medium, the hamster sera had no effect on amphotropic vector infection of HeLa human cells (Table 6), indicating a species specificity for the factor. Thus, hamster serum contains a similar, potentially identical, inhibitor of retrovirus infection to that secreted from CHO cells. Based on the principle of virus interference, the factor could be a fragment of an Env protein that is secreted from cells and blocks infection by binding to the virus receptor. Alternatively, it could be a normal cellular protein that naturally interacts with the phosphate transporter that serves as a receptor for GALV and amphotropic viruses resulting in a block to infection.

Receptor Glycosylation Can Affect Retrovirus Entry Retroviral interference can by reversed by inhibitors of glycosylation that affect Env processing and subsequent binding to virus receptors (44). In addition, inhibitors of glycosylation can have direct effects on a retrovirus receptor to modulate infection. For example, the ecotropic retrovirus receptor homolog on Mus dunni cells functions as a receptor for most ecotropic retroviruses with the exception of MoMLV. Tunicamycin treatment renders the cells susceptible to infection by MoMLV, and alteration of a single amino acid in the Mus dunni receptor to prevent glycosylation at that site results in a receptor that promotes MoMLV infection (45). Thus, subtle changes in receptor glycosylation can have a major effect on the ability of a retrovirus to utilize the receptor for cell entry.

Vector Pseudotypes Available for Gene Transfer Applications Given the complicated factors that govern retrovirus entry into cells from different tissues and different species, it is helpful that there are a wide range of retrovirus packaging cell lines that are available for production of retroviral vectors with different pseudotypes. Approximate host ranges of packaging cells derived using mammalian retroviruses are shown in Table 7. A listing of specific packaging cell lines can be found in ref. 46. The best vector pseudotype for a given application will be further influenced by the specific target tissue and the expression of suitable levels of receptors with proper posttranslational modifications to allow efficient virus entry. For example, Glvr1 is overexpressed compared with Ram1 in hematopoietic cells (23), and vectors with a GALV pseudotype have been found to transduce hematopoietic cells more efficiently than the same vectors with an amphotropic pseudotype (47, 48).

Table 6. Hamster sera inhibit amphotropic vector infection of tunicamycin-treated CHO cells but not HeLa cells Additional serum Vector titer, CFU/ml Inhibition, % Target cells CHO None 1×103 Chinese hamster (5%) <10 >99 Syrian hamster (12.5%) 35 97 Fetal bovine (25%) 2×103 HeLa None 3×105 Chinese hamster (5%) 2×105 Syrian hamster (12.5%) 3×105 The indicated target cells were plated at 105 per 6-cm dish on day 1, infected with an amphotropic-pseudotype vector carrying the neo gene on day 2 in the presence of culture medium containing 5% FBS (no additional serum), 5% FBS plus 5% Chinese hamster serum, 5% FBS plus 12.5% Syrian hamster serum, or 5% FBS plus 25% additional FBS, and G418-resistant colony formation was measured. Inhibition is reported only when >50%. Data are from Miller and Miller (43).

Conclusions Retroviruses utilize a diverse set of proteins for cell entry. Single proteins are apparently required for binding and entry of most retroviruses, although two proteins are required for HIV. Although virus entry is dependent on the level of receptor expression in particular cells, there are many other factors that govern utilization of a receptor or its homologs in different species. Subtle alterations in the amino acid sequence of receptor homologs in different species can dramatically affect virus entry, either as a direct result of changes in the primary amino acid sequence or as an indirect result of altered protein modifications such as glycosylation. Indeed, restricted virus host range is not generally due to a lack of expression of homologous receptor proteins, but is more often related to minor alterations in these proteins. In addition, soluble proteins secreted by some cells and present in some animals, and retroviral Env proteins synthesized from replication-competent viruses or from endogenous virus sequences, can block receptor utilization. These are all important considerations in the design of retroviral vectors for gene transfer in cultured cells and in animals. Recently it has become clear that certain retroviruses can use more than one receptor for entry into some cell types, and some receptors can promote entry of retroviruses that normally utilize different receptors in other cells. These results seriously complicate attempts to classify retroviruses into groups based on receptor utilization, as determined by interference analysis, because these groupings depend on the particular receptors expressed on the cell type used for the analysis. In fact, this problem was appreciated long before the molecular basis for this phenomenon was determined (49). Further development of retroviral vectors for gene transfer applications has involved the incorporation of Env proteins

Table 7. Host range of selected retrovirus packaging cells Ecotropic Amphotropic Target cells Mouse + + Rat + + Hamster — +/− Rabbit — + Mink — + Cow — +/− Cat — + Dog — + Monkey — + Human — + — +/− Chicken

GALV — + + + + + + + + + +

RD114 — — —

10A1 + + + +

+ + + +

+ + + +

The ability of vectors from the indicated packaging cells to transduce target cells from the indicated species is shown as + if the cells can be transduced, − if the cells cannot be transduced, and as +/− if there is poor transduction or if there is variable transduction of different cells from the indicated species. These evaluations are only intended as a general guide because there are many factors that can influence transduction rates, including the particular animals from within each species that are the source of the target cells.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

CELL-SURFACE RECEPTORS FOR RETROVIRUSES AND IMPLICATIONS FOR GENE TRANSFER

11413

from other virus families, such as the vesicular stomatitis virus G protein (3, 50) and efforts to alter the receptor specificity of existing retroviral Env proteins by the incorporation of peptide or antibody domains that can bind to other cell-surface proteins (51, 52). An understanding of the principles governing cell entry by naturally occurring retroviruses will help in the design and application of these strategies. A fascinating aspect of retroviruses is their utilization of diverse proteins for cell entry. The analysis presented here favors a mutational basis for retrovirus evolution to utilize new receptors, rather than acquisition and expression of cellular proteins that naturally bind to cellsurface receptors, but more information is needed to resolve this issue. Perhaps analysis of additional naturally occurring retroviruses and their receptors will reveal a clear example of acquisition of a cellular gene that enables utilization of a new cell-surface receptor for entry. Answers to these questions have important implications for the design of retroviral vectors with novel receptor specificities, and for the evolution of retroviruses, which are important agents of disease in humans and in animals. I thank Michael Emerman and Greg Wolgamot for comments on this manuscript. This work was supported by grants from the National Heart, Lung, and Blood Institute and the National Institute of Diabetes and Digestive and Kidney Diseases of the National Institutes of Health. 1. Halbert, C.L., Alexander, I.E., Wolgamot, G.M. & Miller, A.D. (1995) J. Virol. 69, 1473–1479. 2. Kotin, R.M. & Berns, K.I. (1989) Virology 170, 460–467. 3. Naldini, L., Blomer, U., Gallay, P., Ory, D., Mulligan, R., Gage, F.H., Verma, I.M. & Trono, D. (1996) Science 272, 263–267. 4. Miller, D.G., Adam, M.A. & Miller, A.D. (1990) Mol. Cell. Biol. 10, 4239–4242. 5. Sommerfelt, M.A. & Weiss, R.A. (1990) Virology 176, 58–69. 6. Kewalramani, V.N., Panganiban, A.T. & Emerman, M. (1992) J. Virol. 66, 3026–3031. 7. Sommerfelt, M.A., Williams, B.P., McKnight, A., Goodfellow, P.N. & Weiss, R.A. (1990) J. Virol. 64, 6214–6220. 8. Garcia, J.V., Jones, C. & Miller, A.D. (1991) J. Virol. 65, 6316–6319. 9. Kaelbling, M., Eddy, R., Shows, T.B., Copeland, N.G., Gilbert, D.J., Jenkins, N.A., Klinger, H.P. & O’Hara, B. (1991) J. Virol. 65, 1743–1747. 10. Sommerfelt, M.A., Williams, B.P., Clapham, P.R., Solomon, E., Goodfellow, P.N. & Weiss, R.A. (1988) Science 242, 1557–1559. 11. Isobe, M., Huebner, K., Maddon, P.J., Littman, D.R., Axel, R. & Croce, C.M. (1986) Proc. Natl. Acad. Sci. USA 83, 4399–4402. 12. Dalgleish, A.G., Beverley, P.C., Clapham, P.R., Crawford, D.H., Greaves, M.F. & Weiss, R.A. (1984) Nature (London) 312, 763–767. 13. Klatzmann, D., Champagne, E., Chamaret, S., Gruest, J., Guetard, D., Hercend, T., Gluckman, J.C. & Montagnier, L. (1984) Nature (London) 312, 767–768. 14. Feng, Y., Broder, C.C., Kennedy, P.E. & Berger, E.A. (1996) Science 272, 872–877. 15. Deng, H., Liu, R., Ellmeier, W., Choe, S., Unutmaz, D., Burkhart, M., Di Marzio, P., Marmon, S., Sutton, R.E., Hill, C.M., Davis, C.B., Peiper, S.C., Schall, T.J., Littman, D.R. & Landau, N.R. (1996) Nature (London) 381, 661–666. 16. Dragic, T., Litwin, V., Allaway, G.P., Martin, S.R., Huang, Y., Nagashima, K.A., Cayanan, C., Maddon, P.J., Koup, R.A., Moore, J.P. & Paxton, W.A. (1996) Nature (London) 381, 667–673. 17. Sattentau, Q.J., Clapham, P.R., Weiss, R.A., Beverley, P.C., Montagnier, L., Alhalabi, M.F., Gluckman, J.C. & Klatzmann, D. (1988) AIDS 2, 101– 105. 18. Albritton, L.M., Tseng, L., Scadden, D. & Cunningham, J.M. (1989) Cell 57, 659–666. 19. Kim, J.W., Closs, E.I., Albritton, L.M. & Cunningham, J.M. (1991) Nature (London) 352, 725–728. 20. Wang, H., Kavanaugh, M.P., North, R.A. & Kabat, D. (1991) Nature (London) 352, 729–731. 21. Miller, D.G., Edwards, R.H. & Miller, A.D. (1994) Proc. Natl. Acad. Sci. USA 91, 78–82. 22. van Zeijl, M., Johann, S.V., Closs, E., Cunningham, J., Eddy, R., Shows, T.B. & O’Hara, B. (1994) Proc. Natl. Acad. Sci. USA 91, 1168–1172. 23. Kavanaugh, M.P., Miller, D.G., Zhang, W., Law, W., Kozak, S.L., Kabat, D. & Miller, A.D. (1994) Proc. Natl. Acad. Sci. USA 91, 7071–7075. 24. O’Hara, B., Johann, S.V., Klinger, H.P., Blair, D.G., Rubinson, H. , Dunn, K.J., Sass, P., Vitek, S.M. & Robins, T. (1990) Cell Growth Differ. 1, 119–127. 25. Ban, J., Portetelle, D., Altaner, C., Horion, B., Milan, D., Krchnak, V., Burny, A. & Kettmann, R. (1993) J. Virol. 67, 1050–1057. 26. Ban, J., Truong, A.T., Horion, B., Altaner, C., Burny, A., Portetelle, D. & Kettmann, R. (1994) Arch. Virol. 138, 379–383. 27. Bates, P., Young, J.A. & Varmus, H.E. (1993) Cell 74, 1043– 1051. 28. Hosie, M.J., Willett, B.J., Dunsford, T.H., Jarrett, O. & Neil, J.C. (1993) J. Virol. 67, 1667–1671. 29. Willett, B.J., Hosie, M.J., Jarrett, O. & Neil, J.C. (1994) Immunology 81, 228–233. 30. Gazdar, A.F., Oie, H., Lalley, P., Moss, W.W. & Minna, J.D. (1977) Cell 11, 949–956. 31. Adamson, M.C., Silver, J. & Kozak, C.A. (1991) Virology 183, 778–781. 32. Miller, A.D. & Chen, F.C. (1996) J. Virol. 70, 5564–5571. 33. Miller, D.G. & Miller, A.D. (1994) J. Virol. 68, 8270–8276. 34. Wilson, C.A., Farrell, K.B. & Eiden, M.V. (1994) J. Virol. 68, 7697–7703. 35. Albritton, L.M., Kim, J.W., Tseng, L. & Cunningham, J.M. (1993) J. Virol. 67, 2091–2096. 36. Yoshimoto, T., Yoshimoto, E. & Meruelo, D. (1993) J. Virol. 67, 1310–1314. 37. Battini, J.L., Heard, J.M. & Danos, O. (1992) J. Virol. 66, 1468–1475. 38. Ott, D. & Rein, A. (1992) J. Virol. 66, 4632–4638. 39. Gardner, M.B., Kozak, C.A. & O’Brien, S.J. (1991) Trends Genet. 7, 22–27. 40. Robinson, H.L., Astrin, S.M., Senior, A.M. & Salazar, F.H. (1981) J. Virol. 40, 745–751. 41. Bassin, R.H., Ruscetti, S., Ali, I., Haapala, D.K. & Rein, A. (1982) Virology 123, 139–151. 42. Miller, D.G. & Miller, A.D. (1992) J. Virol. 66, 78–84. 43. Miller, D.G. & Miller, A.D. (1993) J. Virol. 67, 5346–5352. 44. Rein, A., Schultz, A.M., Bader, J.P. & Bassin, R.H. (1982) Virology 119, 185–192. 45. Eiden, M.V., Farrell, K. & Wilson, C.A. (1994) J. Virol. 68, 626–631. 46. Miller, A.D., Miller, D.G., Garcia, J.V. & Lynch, C.M. (1993) Methods Enzymol. 217, 581–599. 47. von Kalle, C., Kiem, H.P., Goehle, S., Darovsky, B., Heimfeld, S., Torok-Storb, B., Storb, R. & Schuening, F.G. (1994) Blood 84, 2890–2897. 48. Bauer, T.R., Miller, A.D. & Hicksein, D.D. (1995) Blood 86, 2379–2387. 49. Chesebro, B. & Wehrly, K. (1985) Virology 141, 119–129. 50. Burns, J.C., Friedmann, T., Driever, W., Burrascano, M. & Yee, J.K. (1993) Proc. Natl. Acad. Sci. USA 90, 8033–8037. 51. Kasahara, N., Dozy, A.M. & Kan, Y.W. (1994) Science 266, 1373–1376. 52. Somia, N.V., Zoppe, M. & Verma, I.M. (1995) Proc. Natl. Acad. Sci. USA 92, 7570–7574.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

IMMUNIZATION WITH DNA VACCINES ENCODING GLYCOPROTEIN D OR GLYCOPROTEIN B, ALONE OR IN COMBINATION, INDUCES PROTECTIVE IMMUNITY IN ANIMAL MODELS OF HERPES SIMPLEX VIRUS-2 DISEASE

11414

This paper was presented at a colloquium entitled “Genetic Engineering of Viruses and Virus Vectors,” organized by Bernard Roizman and Peter Palese (Co-chairs), held June 9–11, 1996, at the National Academy of Sciences in Irvine, CA.

Immunization with DNA vaccines encoding glycoprotein D or glycoprotein B, alone or in combination, induces protective immunity in animal models of herpes simplex virus-2 disease (herpes simplex virus/nucleic acid/glycoprotein) WILLIAM L.MCCLEMENTS, MARCY E.ARMSTRONG, ROBERT D.KEYS, AND MARGARET A.LIU* Department of Virus and Cell Biology, Merck Research Laboratories, West Point, PA 19486 ABSTRACT DNA vaccines expressing herpes simplex virus type 2 (HSV-2) full-length glycoprotein D (gD), or a truncated form of HSV-2 glycoprotein B (gB) were evaluated for protective efficacy in two experimental models of HSV-2 infection. Intramuscular (i.m.) injection of mice showed that each construction induced neutralizing serum antibodies and protected the mice from lethal HSV-2 infection. Dose-titration studies showed that low doses (≤1 µg) of either DNA construction induced protective immunity, and that a single immunization with the gD construction was effective. The two DNAs were then tested in a low-dosage combination in guinea pigs. Immune sera from DNA-injected animals had antibodies to both gD and gB, and virus neutralizing activity. When challenged by vaginal infection with HSV-2, the DNA-immunized animals were significantly protected from primary genital disease. Genital infections caused by herpes simplex viruses (HSV) continue to present serious public health problems. In the United States, it is estimated that approximately 500,000 individuals become infected each year (1), adding to an infected population of between 40 and 60 million (2). A vaccine that prevented or ameliorated primary infection and thereby reduced transmission of HSV would be of great use in controlling this epidemic. Many different approaches have been used to develop such a vaccine. Early attempts using killed virus or viral extracts were largely unsuccessful (reviewed in refs. 2 and 3). In recent years, the major emphasis has been on subunit vaccines composed of recombinantly expressed viral proteins (3, 4). Used prophylactically, they are highly effective in experimental animal infection (5–7), but efficacy may depend on formulation with novel adjuvants not yet licensed for general human use. Live attenuated (8, 9) and replication-deficient (10) virus vaccines have shown promise in animals studies; however, concerns about the safety of infection with live HSV may limit broad acceptance for human use. An alternate approach has used recombinant adeno (11, 12), vaccinia (13–15), or varicella-zoster (16) viral vectors to deliver HSV antigens. Many of the safety concerns about HSV infection are avoided, whereas the advantage of in vivo expression of the immunogen is maintained. Unfortunately, other concerns about safety (17) and efficacy (18, 19) may limit the general use of these vaccines. The recent demonstrations in mice (20–23) and guinea pigs (24) that injection of DNA elicited protective immunity has suggested a new approach to developing vaccines for genital herpes. The concept of DNA immunization grew from the observation in mice that i.m. injection of DNA encoding a reporter gene resulted in the in vivo expression of the reporter in myocytes near the injection site (25). Ulmer et al. (26) first demonstrated the efficacy of DNA immunization against viral infection using an influenza virus-infection model in mice. Injection of DNA encoding the influenza A virus nucleoprotein induced both humoral and cell-mediated immune responses, and protected the mice from lethal challenge. These findings were extended to other species for influenza (27, 28) and to other disease targets including bovine herpes (29), rabies (30), leishmaniasis (31), malaria (32), rabbit papilloma (33), and lymphocytic choriomeningitis virus (34). The advantages of DNA immunization are simplicity, in vivo expression, and a common method for delivery and expression of diverse antigens. Cloned antigens can be manipulated by standard recombinant DNA methodology. In vivo expression is accomplished without the need for live infection or the construction of viral vectors, and the expressed protein or epitopes thereof have the potential to enter the major histocompatibility class I pathway and elicit CD8+ cytotoxic Tlymphocyte responses (26, 35). Immunization with a cloned gene offers the same specificity as a recombinantly expressed protein subunit vaccine without the complex manufacturing and formulation procedures sometimes required to ensure the immunogenicity of recombinantly expressed proteins. Antigens expressed in vivo may have a native conformation, undergo posttranslational modification, and therefore may contain epitopes for presentation to B cells, superior to those supplied exogenously. Additionally, because DNA immunization uses a common method for antigen delivery it is a potentially useful way to assemble and test multicomponent vaccines (28). In an effort to determine the feasibility of developing a multicomponent DNA vaccine for genital herpes, we have begun evaluating a two-component vaccine. We cloned the HSV-2 full-length glycoprotein D (gD) and a truncated form of glycoprotein B (gB) into DNA vaccine vectors where highlevel expression was under the control of the human cytomegalovirus immediate-early-protein promoter (36, 37). These DNA constructions were evaluated individually for induction of protective immunity in a mouse lethal-infection model. Unlike previous studies with HSV-1 gD or gB DNA (20, 23), or HSV-2 gD DNA (22), where multiple immunizations with high doses of DNA were used, we have titrated the DNAs to try to determine minimal effective doses,

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact. Abbreviations: HSV, herpes simplex virus; FBS, fetal bovine serum; RD, rhabdomyosarcoma; gD, glycoprotein D; gB, glycoprotein B; GMT, geometric mean titers.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

IMMUNIZATION WITH DNA VACCINES ENCODING GLYCOPROTEIN D OR GLYCOPROTEIN B, ALONE OR IN COMBINATION, INDUCES PROTECTIVE IMMUNITY IN ANIMAL MODELS OF HERPES SIMPLEX VIRUS-2 DISEASE

11415

and we tested the effect of a single immunization. Having established that low doses of DNA were effective in the mouse model, we then tested the prophylactic effect of a low-dosage combination of these DNAs in the guinea pig vaginal-infection model. Genital disease in guinea pigs closely resembles that in humans (38, 39), and the model has been widely used to test potential vaccines (5, 6) and antiviral chemotherapies (40) for genital herpes.

MATERIALS AND METHODS Viruses and Cells. Vero, baby hamster kidney (BHK)-21, and rhabdomyosarcoma (RD) cells, and HSV-2 strain MS were obtained from the American Type Culture Collection. HSV-2 strain Curtis was obtained from Andre Nahmias (Emory University, Atlanta). Virus was routinely prepared by infection of nearly confluent Vero or BHK cells with a multiplicity of infection of 0.1 at 37°C in a small volume of cell culture medium without serum. After 1 hr, virus inoculum was removed and cultures were re-fed with high glucose DMEM (BioWhittaker) supplemented with 2% heat inactivated fetal bovine serum (FBS), 2 mM L-glutamine, 25 mM Hepes, 50 units/ml penicillin, and 50 µg/ml streptomycin (all GIBCO/ BRL). Incubation was continued until cytopathic effect was extensive; usually for 24–48 hr. Cell-associated virus was collected by centrifugation at 1800×g for 10 min at 4°C. Supernatant virus was clarified by centrifugation at 640×g for 10 min at 4°C, and stored at −70°C. Mice and Guinea Pigs. Female BALB/c mice (Charles River Breeding Laboratories) and female Duncan Hartley guinea pigs (Harlan Sprague Dawley) were maintained and used in accordance with the Institutional Animal Care and Use Committee approved protocols. Cloning and DNA Preparation. HSV-2 strain Curtis DNA, used as template for polymerase chain reactions (PCR), was prepared from nucleocapsids isolated from infected Vero cells (41). An 1182-bp fragment encoding the gD precursor gene was amplified by PCR (PerkinElmer/Cetus) using synthetic oligonucleotide primers (Midland Certified Reagent, Midland, TX), which corresponded to 5
and 3
end-flanking sequences for the HSV-2 gD gene and contained BglII restriction sites. A 2121-bp sequence encoding the amino terminal 707 aa of HSV-2 gB was amplified by PCR. Primers corresponding to the 5
flanking sequence, and complementary to nucleotides 2110–2121 (42) were used to generate BglII restriction sites flanking the coding sequence, and to add the termination codon TAA immediately after nucleotide 2121. BglIIdigested PCR-amplified fragments were ligated into vectors V1J or V1Jns (36, 37). Escherichia coli DH5α (GIBCO/ BRL) was transformed according to the manufacturer’s specifications. Candidate plasmids were characterized by restriction mapping, and the vector-insert junctions were sequenced using the Sequenase DNA sequencing kit, version 2.0 (United States Biochemical). The gD-coding sequence, originally cloned in V1J, was subcloned into V1Jns. For simplicity, the final gD and truncated gB plasmid constructions were designated gD-2 and ∆gB-2, respectively. Large-scale DNA preparations were essentially as described (36). Expression of Recombinant Proteins. Plasmid DNA was precipitated onto RD cells (ATCC CCL136) by the calcium phosphate method using Pharmacia CellPhect Kit reagents according to the manufacturer’s instructions, except that 5 or 15 µg of DNA per well were used. After 48 hr, cell lysates were resolved by electrophoresis and then transferred to nitrocellulose membranes. Immunoblots were processed with an antiHSV gD monoclonal antibody (Advanced Biotechnologies, Columbia, MD) or sheep anti-HSV-2 antiserum (ViroStat, Portland, ME) and developed with an enhanced chemiluminescence detection kit (Amersham). Immunization. In all cases, DNA dose refers to the total amount of DNA injected per animal per round of immunization; one-half of the total was delivered to each injection site. Mice were anesthetized by i.p. injection of a mixture of 2 mg ketamine HCl (Aveco, Fort Dodge, IA) and 0.2 mg xylazine (Mobley, Shawnee, KS) in saline. The hind legs were shaved with electric clippers and washed with 70% ethanol. Each quadriceps muscle was injected with 50 µl of DNA diluted into sterile saline just prior to use. Control animals were shamimmunized with saline or vector DNA. Mice were 5–6 weeks old at the time of the first immunization. Guinea pigs, weighing 400–550 g at the time of the first immunization, were anesthetized by subcutaneous injection of 22 mg ketamine plus 5 mg xylazine/kg. The hind legs were washed with 70% ethanol and each quadriceps muscle was injected i.m. with 100 µl of DNA or saline. Serology. Sera were assayed for HSV-specific responses in ELISAs using either HSV glycoproteins partially purified from HSV-2 Curtisinfected BHK cell lysates (mouse sera) or recombinantly expressed gD and ∆gB purified from recombinant baculovirus-gD-and baculovirusgB-infected SF21 cultures (guinea pig sera). Recombinant viruses were constructed using the BacPAK Baculovirus Expression System (CLONTECH) pBacPAK8 transfer vector and Bsu361-digested BacPAK6 virus and gD and ∆gB coding sequences from gD-2 and ∆gB-2, respectively. Glycoproteins from HSV-2 or baculovirus-gD-infected cultures were purified by Lentil Lectin Sepharose chromatography (Pharmacia) essentially as described (43). Truncated gB was purified from clarified culture medium adjusted to 0.1 mM MnCl2, 0.5% Nonidet P-40, batch adsorbed at room temperature to Lentil Lectin Sepharose 4B, and eluted as described. For the ELISA, glycoproteins were diluted to 5 µg/ml total protein in 50 mM carbonate buffer (pH 9.5), 100 µl per well was applied to Maxi-sorb 96-well plates (Nunc) and allowed to absorb at 4°C overnight. All subsequent incubations were carried out in 100 µl volumes for 1 hr at room temperature and plates were washed four times with phosphate buffered saline (PBS, pH 7.2), with or without one distilled water wash between steps. Dilution buffer (920 mM Tris·HCl, pH 7.5/137 mM NaCl/2.7 mM KCl/0.5% gelatin/0.05% Tween 20) was used as a blocking agent, as well as for the serial dilution of immune sera and the dilution of alkaline phosphatase-labeled goat anti-mouse (Boehringer Mannheim) or goat anti-guinea pig (Accurate Chemicals) IgG. The ELISA was developed with 1 mg/ml p-nitrophenylphosphate in 10% diethanolamine (pH 9.8), 0.5 mM MgCl·6 H20 at 37° C, and optical absorbance was read at 405 nm. Serum dilutions were scored as positive if the OD405 signal exceeded by more than 3 SD the mean OD405 signal (six replicates) of sera from sham-immunized mice at the same dilution, or if the OD405 signal exceeded by >0.1 OD unit, the signal of the guinea pig’s preimmune serum at the same dilution. The reciprocal of the last sample dilution scored positive was taken as the endpoint titer. Individual endpoint titers were used to calculate geometric mean titers (GMT). For purposes of calculation, sera negative at the lowest dilution tested were assigned endpoint titers equal to the reciprocal of the next lower dilution if the dilution series had been extended. ELISA titers are HSV-specific as originally shown by lack of measurable ELISA titer in sera from naive or saline-immunized animals, and by the lack of reaction of immune sera with antigen prepared from mock-infected BHK cell lysates. Neutralization Assays. Sera from DNA- or saline-immunized animals were heat inactivated at 56°C for 30 min prior to serial dilution in DMEM/2% heat-inactivated FBS. Fifty microliters of each dilution were delivered to duplicate wells in a sterile polypropylene, 0.5 ml 96-well plate (Marsh Biomedical Products, Rochester, NY). HSV-2 stocks were diluted to 4000 plaque forming units (pfu)/ml and 50 µl of virus was added to sample wells and the plate incubated

*To whom reprint requests should be addressed, e-mail: margaret_ [email protected].

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

IMMUNIZATION WITH DNA VACCINES ENCODING GLYCOPROTEIN D OR GLYCOPROTEIN B, ALONE OR IN COMBINATION, INDUCES PROTECTIVE IMMUNITY IN ANIMAL MODELS OF HERPES SIMPLEX VIRUS-2 DISEASE

11416

overnight at 4°C. Guinea pig complement (Cappel) was diluted 1:4 in DMEM/2% heat-inactivated FBS and 50 µl was added to each sample well. After a 1-hr incubation at 37°C, 100 µl of serum-free medium was added and then each reaction mixture was used to infect confluent Vero cells in 12-well cluster plates (Costar) incubated for 1 hr at 37°C. Inocula were aspirated, monolayers were overlaid with 1 ml of 1×MEM containing 5% heat-inactivated FBS, 1×basal medium Eagle vitamins, 10 mM L-glutamine, 25 units/ml penicillin, 25 µg/ml streptomycin, 12.5 mM Hepes, 0.5% carboxymethylcellulose and plates were incubated at 37°C for 48 hr. Monolayers were stained with 1% basic fuchsin in 50% methanol/10% phenol and the number of plaques determined. A serum dilution was considered neutralization-positive if plaque numbers were ≤50% of those obtained in parallel control assays using pooled sera from saline-immunized control mice or preimmune serum from the same guinea pig at the same dilution. Statistical Analysis. Mouse survival data were analyzed using the log-rank test in the SAS procedure LIFETEST (44). Guinea pig daily lesion scores were analyzed by the two-tailed Student’s t test. For comparison of overall disease among groups of guinea pigs, mean lesion scores were analyzed by the Kruskal-Wallis test followed by a multiple comparison test at the P<0.05 significance level.

RESULTS Cloning and in Vitro Expression of Cloned Proteins. The coding sequences for full-length gD and the amino-terminal 707 aa of gB were cloned from HSV-2 strain Curtis viral DNA by PCR methods into the eukaryotic expression vectors V1J or V1Jns (36, 37) and were designated gD-2 and ∆gB-2, respectively. The plasmids were characterized by restriction mapping and sequence analysis of the vector-insert junctions. Over the regions sequenced, the gD clone was identical with that published for HSV-2 strain G (45) and the gB clone sequence was identical with that published for HSV-2 strain 333 (42). The ability of gD-2 or ∆gB-2 plasmids to express the encoded protein was demonstrated by transient transfection of RD cells (not shown). Immunoblot analysis of gD-2 DNA-transfected RD cell lysates with an antiHSV-2 gD monoclonal antibody detected a protein with a molecular weight of approximately 60 K not present in mock-transfected RD cell lysates. Immunoblot analysis of conditioned medium from ∆gB-2 DNA-transfected RD cells and cell lysates with sheep anti-HSV-2 antiserum detected a protein with an apparent molecular weight of 106 K not present in controls, and found that a majority of the protein was in the medium. The observed size was consistent with a 707 aa truncated form of gB and, because this truncation deleted the transmembrane and cytoplamic domains from HSV-2 gB (46), the expressed protein was not expected to be cell associated. Serology of Mice Immunized with gD- or gB-Expressing DNA. The biological effects of immunization with gD-2 or ∆gB-2 DNA were first investigated in separate dose titration experiments in mice. Animals were immunized by i.m. injection of DNA or were sham-immunized with saline at weeks 0 and 7. Sera obtained at week 10 were assayed in an HSV-specific ELISA. Table 1 shows the seroconversion results and reports the GMT±SEM attained for each dose group. In these assays, pooled sera from the saline-injected control mice were used as the negative controls. The results indicated that injection of each DNA construction resulted in gene expression in vivo and the induction of substantial antibody responses, even at low doses. At the lowest dose tested, 0.8 µg of gD-2 DNA, eight of nine immunized mice developed detectable antibody responses. Representative sera from both gD-2 DNA- and ∆gB-2 DNA-immunized animals were surveyed for HSV-2 (strain Curtis) neutralizing activity at dilutions of 1:10, 1:100, and 1:1000. Fifteen sera from mice injected with doses of gD-2 DNA, ranging from 3.1 to 100 µg, were tested; 13 were neutralization-positive at 1:10; of those, 11 were also positive at 1:100, and of those, 5 were positive at the 1:1000 dilution. The two negative sera (from the 50 µg dose group) also had low ELISA endpoint titers (log10≤2.00 and 2.52, respectively). A more limited survey of sera from the animals immunized with 30 µg of ∆gB-2 DNA found that of three sera tested, all were positive at 1:10, two at 1:100, and none at 1:1000. These results indicated that immunization with either DNA construction was capable of inducing HSV-2 neutralizing antibodies in mice.

Table 1. Effect of DNA immunization on antibody development in mice No. seropositive No. sera tested DNA dose, µg* gD-2 200 9 9 100 10 10 50 9 10 25 8 8 12.5 10 10 6.3 10 10 3.1 10 10 1.6 7 10 0.8 8 9 Saline ∆gB-2 30 10 10 10 10 10 3 10 10 1 10 10 Saline

GMT(log10)

±SEM

4.44 4.69 4.38 4.26 4.15 4.21 3.89 2.56 3.75 (0.48)†

0.22 0.31 0.33 0.23 0.30 0.33 0.18 0.35 0.43

4.88 4.58 4.47 4.18 (0.48)†

0.16 0.18 0.15 0.15

*Dose given at weeks 0 and 7; sera obtained at week 10. †By convention, pooled sera from saline-injected mice were defined as negative at all dilutions tested and assigned endpoint titers equal to the reciprocal of the next lower dilution had the series been extended; in these cases 1:3.

Effect of DNA Immunization on Lethal Infection of Mice. Immunized and control (saline-injected) mice were challenged by i.p. injection of HSV-2 and observed daily for survival. Fig. 1A shows the effect of gD-2 DNA immunization on survival; significant protection from death (P<0.001) was achieved for each dose. Eighty-two of eighty-six gD-2 DNA-immunized mice survived challenge. The survival results for the ∆gB-2 DNA-immunized mice are in Fig. 1B. Although ∆gB-2 DNA did not appear to be as effective as gD-2 DNA, significant protection from death was found for each dose tested (P<0.01 for the 30, 10, and 3 µg groups, and P=0.027 for the 1 µg group). Thus, low dose immunization with either gD-2 or ∆gB-2 DNA induced antibody responses in mice which protected them from lethal HSV-2 infection. However, while the protection from death was significant, infection was not completely prevented. During the observation period, some animals exhibited transient morbidity: failure to groom, failure to thrive, or a hunched posture. Infection was confirmed in some animals by the detection of antibodies to nonstructural HSV proteins in convalescent sera (not shown). Sham immunization with saline was used as the control in dose titrations. To confirm that protection was dependent upon the HSV coding sequence rather than injection of DNA per se, groups of 10 mice were immunized with either 12.5 or 1.6 µg of gD-2 DNA, or 12.5 µg of vector V1J DNA. Ten weeks after a single immunization, sera were analyzed by ELISA. The logic GMT (±SEM) for the group injected with 12.5 µg of gD-2 DNA was 3.89 (±0.97) and that for the 1.6 µg group was 2.49 (±1.20). None of the sera from mice immunized with vector DNA were seropositive; the log10 GMT of 0.48 was

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

IMMUNIZATION WITH DNA VACCINES ENCODING GLYCOPROTEIN D OR GLYCOPROTEIN B, ALONE OR IN COMBINATION, INDUCES PROTECTIVE IMMUNITY IN ANIMAL MODELS OF HERPES SIMPLEX VIRUS-2 DISEASE

11417

background. Fig. 2 reports the survival data for these animals following i.p. challenge at 11 weeks. Both groups immunized with gD-2 DNA were significantly protected from death compared with those immunized with the vector (P<0.001). Survival of the vector-injected animals was similar to that found for the saline-injected animals in the experiments summarized in Fig. 1. These results confirmed that protection was dependent upon the gD coding sequence. Furthermore, they showed that protective immunity could be established with a single injection of gD-2 DNA. Additional studies in mice (not shown) and guinea pigs (not shown) comparing plasmids ∆gB-2 or gD-2 with vector, or with control plasmids that expressed influenza viral proteins, also found that protection was dependent on the presence HSV protein-coding sequences.

FIG. 1. The effect of DNA immunization on the survival of mice infected by i.p. injection with HSV-2. Mice were immunized twice with gD-2 (A) in a 2-fold dilution series, with ∆gB-2 (B) in a half-log dilution series, or with saline. The doses (in µg) are indicated on the figure. The numbers of mice in each group are noted in Table 1. Mice were challenged by i.p. injection with 0.25 ml (105.7 pfu) of a clarified stock of HSV-2 strain Curtis, and were observed for 3 weeks for signs of disease and survival.

FIG. 2. The effect of immunization with gD-2 DNA or vector DNA on the survival of mice infected by i.p. injection with HSV-2. Mice were immunized with 12.5 µg () or 1.6 µg of gD-2 (`), or with 12.5 µg ( ` ) of vector V1J. Viral challenge was as described in Fig. 1. Serology of Guinea Pigs Immunized with a Mixture of gD-and gB-Expressing DNA. The lethal-infection model was useful for confirming the in vivo activity of the gD-2 and ∆gB-2 DNA, and for establishing that low DNA doses were effective; however, this infection model may not be relevant to human disease. Therefore, the guinea pig vaginal-infection model was used to assay the effects of immunization with a combination of low doses of gD-2 and ∆gB-2 DNA. Seven guinea pigs were immunized with a DNA mixture containing 3 µg of gD-2 DNA and 10 µg of ∆gB-2 DNA at weeks 0 and 6; 14 control guinea pigs were sham-immunized with saline. Sera, obtained at 9 weeks, were analyzed for anti-gD and anti-gB antibodies using antigen-specific ELISAs. Results are shown in Table 2. All of the DNA-immunized animals developed ELISA titers to both gD and gB; individual endpoint titers were ≥300. None of the sham-immunized animals were positive at the lowest dilution

Table 2. Effect of immunization with a combination of gD-2 and gB-2 DNA on antibody development in guinea pigs No. positive sera log10 ELISA GMT (±SEM) Immunization No. of animals Anti-gD Anti-gB Anti-gD Anti-gB gD-2+ ∆gB-2 DNA 7 7 7 2.62 (0.14) 3.05 (0.20) 14 0 0 0.48 (0)* 0.48 (0)* Saline *For purposes of GMT calculation, sera negative at all dilutions tested were assigned an endpoint titer equal to the reciprocal of what would have been the next lower dilution had the dilution series been extended; in this case 1:3.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

IMMUNIZATION WITH DNA VACCINES ENCODING GLYCOPROTEIN D OR GLYCOPROTEIN B, ALONE OR IN COMBINATION, INDUCES PROTECTIVE IMMUNITY IN ANIMAL MODELS OF HERPES SIMPLEX VIRUS-2 DISEASE

11418

(1:30) tested. The results indicated that both DNAs in the mixture were expressed. These sera were also assayed for HSV-2 neutralizing antibodies. Immune sera from all seven DNA-immunized animals were neutralization-positive at a 1:10 dilution, six of seven at 1:100, two at 1:1,000, and none at 1:10,000. None of four randomly-selected representative sera from the sham-immunized control animals were positive at dilutions of 1:10 or 1:100. Effect of DNA Immunization on Vaginal Infection of Guinea Pigs. At 10 weeks, all of the DNA-immunized and 8 of the shamimmunized guinea pigs were challenged by the introduction of HSV-2 strain MS into the vagina. As a control for any effect the manipulations used in the infection procedure might have on the scoring of external disease, the remaining six sham-immunized animals were mock-infected using an inoculum prepared from mock-infected Vero cells. The severity of the primary disease was assessed by the lesion scoring system described in the legend to Fig. 3. The course of primary disease is summarized in Fig. 3 by reporting the mean daily lesion scores on days 3–14 following infection. All animals in the infected control group developed severe external disease. From day five onward, this group’s scores were significantly higher than those of the DNA-immunized or the mock-infected control groups (P<0.01). In contrast, none of the DNAimmunized animals developed severe disease, and the scores for this group were statistically indistinguishable from those of the mock-infected group. The overall primary disease, as measured by the means of all lesion scores, was significantly lower for the DNA-immunized group compared with the infected control group (P<0.001), but was not significantly different from the mock-infected control group (P=0.92). The scores for the mock-infected group were taken as the experimental background (see Discussion). The DNA-immunized animals were further distinguished from the infected controls in that none of them developed signs of systemic disease. In contrast, six of the eight sham-immunized-infected guinea pigs showed signs of severe systemic infection: five retained urine on 2 or more days, one developed partial paralysis of the hind limbs, and five animals became moribund during the observation period and required euthanization (Fig. 3). None of the mock-infected animals showed signs of systemic disease. This challenge study indicated that immunization with low doses of DNAs that encode HSV-2 full-length gD and a truncated form of gB protected guinea pigs from HSV-2-induced primary genital disease.

DISCUSSION Our data show that immunization with DNA encoding full-length HSV-2 gD or a truncated form of HSV-2 gB induced immune responses in mice and protected them from lethal challenge with HSV-2, and that a combination of these two DNAs protected guinea pigs from primary genital disease. It had been shown previously that multiple immunizations with much higher doses of gD DNA or gB DNA could induce protective immunity in mouse- (20–22) and guinea pig (24)-HSV-infection models. In contrast, our study has found that protective immunity could be induced with low doses of DNA, and in the mouse model with only a single immunization. When gD-2 DNA was titrated over a 250-fold concentration range in mice, all doses tested induced serum antibodies and protected mice from lethal infection. The level of protection induced by the 0.8-µg dose could not be distinguished statistically from that induced by the highest dose tested. In subsequent titration studies, we found that a single injection of as little as 50 ng of gD DNA could induce detectable antibody responses, although doses of 500 ng were required to obtain consistent seroconversion (unpublished observations), and that a single immunization with 1.6 µg of gD-2 DNA protected mice from lethal i.p. challenge (Fig. 2). Titration of ∆gB-2 DNA in mice showed that two immunizations of as little as 1 µg resulted in significant protection. Recently, Bourne et al. (24) reported that guinea pigs could be successfully immunized with high doses of DNA. Three 250-, 100-, or 50µg injections of an HSV-2 gD expression vector (similar to our gD-2 construction) resulted in significant protection from vaginal challenge with HSV-2. We had found previously that guinea pigs immunized twice with 100 µg of ∆gB-2 DNA either alone or in combination with 100 µg gD-2 DNA were significantly protected from primary genital disease and subsequent recurrence (unpublished data). The success of lowdosage immunizations in the mouse model suggested testing a low-dosage combination in guinea pigs. For this study, 10 µg of ∆gB-2 DNA was chosen because we had found previously that this amount gave only partial protection from vaginal challenge (unpublished data). The 3 µg gD-2

FIG. 3. The effect of immunization with gD-2 and ∆gB-2 DNA in combination on preventing primary HSV-2-induced genital disease in guinea pigs. Immunized and sham-immunized guinea pigs were infected by application of HSV-2 strain MS to the vagina and external genital skin. One hour prior to infection, the vaginal closure membrane was ruptured with a saline moistened cotton swab. The vagina and external skin were then swabbed with 0.1 N NaOH. Virus was introduced using a cotton swab dipped into a clarified HSV-2 MS-infected Vero cell lysate diluted in tissue culture medium to 106.7 pfu/ml. The swab was inserted into the vagina, twisted back and forth five times, then removed and wiped over the external genitalia. To ensure infection, virus application was repeated 1 hr later. For the mock-infected group, the inoculum was prepared from mock-infected Vero cells. Animals were caged randomly and evaluated daily by observers blinded to the study groups. On day 3, the vagina was swabbed with a moistened calcium alginate swab, which was eluted into 2 ml of virus transport medium (Carr-Scarborough Microbiological, Stone Mountain, GA). Infection was confirmed by reisolation of virus, a positive response in the HERPCHEK kit (DuPont), or appearance of symptomatic disease and the development of antibodies to nonstructural HSV proteins. The severity of external disease was quantified using a visual scoring system adapted from that described by Stanberry et al. (38). Numerical scores were assigned to specific disease signs using the following scale: 0, no disease; 1, redness or swelling; 2, several (≤3) small vesicles; 3, several (≤3) large vesicles; 4, large ulcers with maceration. Scores of 0.5, 1.5, 2.5, and 3.5 were assigned to disease of intermediate severity. Daily mean lesion scores were calculated by dividing the sum of a group’s lesion scores by the number of observations. In the case of death during the observation period, the final score assigned to that animal was carried through to the end of the observation period. Animals were immunized with 3 µg of gD-2 +10 µg of ∆gB-2 and challenged with HSV-2 ( ` ) n=7, sham-immunized with saline and challenged with HSV-2 () n=8, or sham-immunized and mock-infected ( ` ) n=6.*, Three animals euthanized; †, two animals euthanized

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

IMMUNIZATION WITH DNA VACCINES ENCODING GLYCOPROTEIN D OR GLYCOPROTEIN B, ALONE OR IN COMBINATION, INDUCES PROTECTIVE IMMUNITY IN ANIMAL MODELS OF HERPES SIMPLEX VIRUS-2 DISEASE

11419

DNA dose was chosen to be lower than any dose previously tested by us in guinea pigs. The detection of neutralizing serum antibodies, and responses to both gD and gB by ELISA, indicated that these levels of DNA were effective. Furthermore, the combination at this dose was highly effective in preventing primary genital disease. Following challenge, control animals developed severe disease characterized by high lesion scores and the systemic involvement; in contrast, the DNA-immunized guinea pigs were nearly free of disease. Mean lesion scores for the DNA-immunized group were statistically indistinguishable from background. This background was established by inclusion of a mockinfected control group. The assignment of non-zero scores to some control animals on some observation days (Fig. 3) was likely the result of the slight irritation caused by the infection procedure. There was no evidence that these scores were due to HSV infection transmitted from infected cage mates; all mock-infected control animals were HSV seronegative 4 weeks after the challenge (data not shown). The extent of disease in those DNA-immunized animals which did develop lesions was lower than that seen in the infected control animal. The highest score attained by any DNA-immunized animal was 2.0 on 2 successive days. In contrast, seven of the eight infected controls were scored 4.0 on 2 or more successive days. It has been postulated that due to competition for DNA uptake or expression, or antigen competition, immunization with DNAs in combination might result in reduced responses to the individual components. The combination of gD-2 and ∆gB-2 DNA did not appear to compromise the response to either component. Moreover, the protection achieved with this low-dosage combination was as good as, or better than, that seen in similar challenge studies using 100-µg doses of gD-2 DNA or ∆gB-2 DNA alone (unpublished observations). Because the combination of gD-2 and ∆gB-2 DNA could induce responses to the broader spectrum of epitopes contained in two separate antigens, it had the potential to be more effective than either component alone. The results are consistent with the combination being more effective than the individual components; however, that cannot be concluded from this study because the comparison was not made directly. Further titrations of gD-2 DNA and ∆gB-2 DNA, both individually and in combination, are in progress to address the question directly, and to establish minimallyeffective doses. Because of the small number of surviving control guinea pigs, latent infection and recurrent disease could not be evaluated. It has been shown with protein subunit vaccines (5, 6) and recently with high-dose DNA immunization (24) that significant reduction in primary genital disease also resulted in reduced latent infection and decreased recurrence. The extent of protection against primary disease found in the study presented here suggests that prophylactic immunization with a low-dose combination of gD and ∆gB-2 DNA would be effective against recurrence; experiments to evaluate this are ongoing. We have not yet identified which DNA-induced immune responses are protective in our challenge models. Injection of gD-2 or ∆gB-2 DNA, individually or in combination, induced substantial neutralizing serum antibody titers, which may fully account for the protection observed. Others have shown by passive transfer that antibody alone can be protective in some mouse infection models (47, 48). However, DNA immunization has the capacity to elicit cell-mediated, as well as humoral immune responses (26, 35). Recently, Manickan et al. (20) showed that in mice immunized with HSV-1 gB DNA, a CD4+ cytotoxic T-lymphocyte response protected the animals from zosteriform infection with HSV-1. We have detected antigen-specific lymphoproliferative responses in mice and guinea pigs immunized with the gD-2 or ∆gB-2 DNA, but have not yet shown the induction of cytotoxic T lymphocytes (unpublished observations) and cannot rule out a contribution of cell-mediated immunity to the protection observed in these studies. The relative protective roles of humoral and cell-mediated immunity induced by immunization with gD-2 and ∆gB-2 DNA are yet to be defined and may depend on the infection model used. We have demonstrated that immunization with low doses of DNA was highly effective in generating protective immunity in two animal models of HSV infection and we found, in mice, that a single immunization was protective. (Single immunizations have not been evaluated in the guinea pig model.) These results suggest that simple i.m. injection has the potential to be an efficient form of DNA delivery, and support the feasibility of developing DNA vaccines for human use where low dose and limited numbers of injections are desirable characteristics. We also found that the combination of gD-2 and ∆gB-2 DNA induced immune responses to both proteins and was effective in preventing HSV-2induced mucosal disease. This result supports the concept that multivalent vaccines can be made by simply combining DNAs, and provides a starting point for the development of such a vaccine for genital herpes. To date, gD and gB have been the focus of DNA vaccine development (20, 22–24) just as they have been for protein subunit vaccines (reviewed in ref. 3). However, the inherent simplicity of DNA immunization should allow the rapid identification of additional immunogens for inclusion in multivalent DNA vaccines for HSV-induced disease. It is now possible to scan the genomes of complex pathogens for novel immunogens (49) and readily test their capacity to elicit protective immunity. As potentially useful immunogens are identified, they can be easily evaluated in the context of an existing DNA vaccine. Using DNA immunization as both a discovery tool and as a method of delivering combinations of antigens should expedite the development of vaccines with greater potency and breadth of protection. Clearly this approach needs extensive evaluation before clinical efficacy and safety are demonstrated, but these early results with the combination of gD-2 and ∆gB-2 DNA are encouraging. We wish to thank Mr. Timothy Schofield (Merck Research Laboratories Biometrics Department) for statistical analyses of the data. 1. Roizman, B. (1991) Rev. Infect. Dis. 13, Suppl. 11, S892–S894. 2. Whitley, R.J. & Meignier, B. (1992) in Vaccines: New Approaches to Immunological Problems, ed. Davies, J.E. (Butterworth-Heinemann, Boston), pp. 223–254. 3. Burke, R.-L. (1993) Semin. Virol. 4, 187–197. 4. Burke, R.L. (1991) Rev. Infect. Dis. 13 (Suppl. 11), S906–S911. 5. Stanberry, L.R., Bernstein, D.I., Burke, R.L., Pachl, C. & Myers, M.G. (1987) J. Infect. Dis. 155, 914–920. 6. Stanberry, L.R., Myers, M.G., Stephanopoulos, D.E. & Burke, R.L. (1989) J. Gen. Virol. 70, 3177–3185. 7. Sanchez-Pescador, L., Burke, R.L., Ott, G. & Van Nest, G. (1988) J. Immunol. 141, 1720–1727. 8. Whitley, R.J., Kern, E.R., Chatterjee, S., Chou, J. & Roizman, B. (1993) J. Clin. Invest. 91, 2837–2843. 9. Meignier, B., Longnecker, R. & Roizman, B. (1988) J. Infect. Dis. 158, 602–614. 10. Farrell, H.E., McLean, C.S., Harley, C., Efstathiou, S., Inglis, S. & Minson, A.C. (1994) J. Virol. 68, 927–932. 11. McDermott, M.R., Graham, F.L., Hanke, T. & Johnson, D.C. (1989) Virology 169, 244–247. 12. Gallichan, W.S., Johnson, D.C., Graham, F.L. & Rosenthal, K.L. (1993) J. Infect. Dis. 168, 622–629. 13. Wachsman, M., Aurelian, L., Smith, C.C., Lipinskas, B.R., Perkus, M.E. & Paoletti, E. (1987) J. Infect. Dis. 155, 1188–1197. 14. Aurelian, L., Smith, C.C., Wachsman, M. & Paoletti, E. (1991) Rev. Infect. Dis. 13 (Suppl. 11), S924–S930. 15. Cantin, E.M., Eberle, R., Baldick, J.L., Moss, B., Willey, D.E., Notkins, A.L. & Openshaw, H. (1987) Proc. Natl. Acad. Sci. USA 84, 5908–5912. 16. Heineman, T.C., Connelly, B.L., Bourne, N., Stanberry, L.R. & Cohen, J. (1995) J. Virol. 69, 8109–8113.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

IMMUNIZATION WITH DNA VACCINES ENCODING GLYCOPROTEIN D OR GLYCOPROTEIN B, ALONE OR IN COMBINATION, INDUCES PROTECTIVE IMMUNITY IN ANIMAL MODELS OF HERPES SIMPLEX VIRUS-2 DISEASE

11420

17. Lane, J.M., Ruben, F.L., Neff, J.M. & Millar, J.D. (1969) N. Engl. J. Med. 281, 1201–1208. 18. McDermott, M.R., Smiley, J.R., Brais, P.L.J., Rutazroga, H.E. & Brenenstock, J. (1984) J. Virol. 51, 747–753. 19. Cooney, E.L., Collier, A.C., Greenberg, P.D., Coombs, R.W., Zarling, J., Arditti, D.E., Hoffman, M., Hu, C.S.L. & Corey, L. (1991) Lancet 337, 567–572. 20. Manickan, E., Rouse, R.J.D., Yu, Z., Wire, W.S. & Rouse, B.T. (1995) J. Immunol. 155, 259–265. 21. Manickan, E., Yu, Z., Rouse, R.J.D., Wire, W.S. & Rouse, B.T. (1995) Viral Immunol. 8, 53–61. 22. Kriesel, J.D., Spruarce, S.L., Daynes, R.A. & Araneo, B.A. (1996) J. Infect. Dis. 173, 536–541. 23. Ghiasi, H., Cai, S., Slanina, S., Nesburn, A.B. & Wechsler, S.L. (1995) Antiviral Res. 28, 147–157. 24. Bourne, N., Stanberry, L.R., Bernstein, D.I. & Lew, D. (1996) J. Infect. Dis. 173, 800–807. 25. Wolff, J.A., Malone, R.W., Williams, P., Chong, W., Acsadi, G., Jani, A. & Felgner, P.L. (1990) Science 247, 1465–1468. 26. Ulmer, J.B., Donnelly, J.J., Parker, S.E., Rhodes, G.H., Felgner, P.L., Dwarki, V.J., Gromkowski, S.H., Deck, R.R., DeWitt, C.M., Friedman, A., Hawe, L.A., Leander, K.R., Martinez, D., Perry, H.C., Shiver, J.W., Montgomery, D.L. & Liu, M.A. (1993) Science 259, 1745–1749. 27. Fynan, E.F., Webster, R.G., Fuller, D.H., Haynes, J.R., Santoro, J.C. & Robinson, H.L. (1993) Proc. Natl. Acad. Sci. USA 90, 11478–11482. 28. Donnelly, J.J., Friedman, A., Martinez, D., Montgomery, D.L., Shiver, J.W., Motzel, S.L., Ulmer, J.B. & Liu, M.A. (1995) Nat. Med. 1, 583–587. 29. Cox, G.J.M., Zamb, T.J. & Babiuk, L.A. (1993) J. Virol. 67, 5664–5667. 30. Xiang, Z.Q., Spitalnik, S., Tran, M., Wunner, W.H., Cheng, J. & Ertl, C.J. (1994) Virology 199, 132–140. 31. Xu, D. & Liew, F.Y. (1994) Vaccine 12, 1534–1536. 32. Sedegah, M., Hedstrom, R.C., Hobart, P. & Hoffman, S.L. (1994) Proc. Natl. Acad. Sci. USA 91, 9866–9870. 33. Donnelly, J.J., Martinez, D., Jansen, K.V., Ellis, R.W., Montgomery, D.L. & Liu, M.A. (1996) J. Infect. Dis. 713, 314–320. 34. Yokoyama, M., Zhang, J. & Whitton, J.L. (1995) J. Virol. 69, 2684–2688. 35. Wang, B., Ugen, K.I., Srikantan, V., Agadjanyan, M.G., Dang, K., Refaeli, Y., Sato, A.I., Boyer, J., Williams, W.V. & Weiner, D.B. (1993) Proc. Natl. Acad. Sci. USA 90, 4156–4160. 36. Montgomery, D.L., Shiver, J.W., Leander, K.R., Perry, H.C., Friedman, A., Martinez, D., Ulmer, J.B., Donnelly, J.J. & Liu, M.A. (1993) DNA Cell Biol. 12, 777–783. 37. Shiver, J.W., Perry, H.C., Davies, M.-E., Freed, D.C. & Liu, M.A. (1996) in DNA Vaccines, eds. Liu, M.A., Hilleman, M.R. & Kurth, R. (N.Y. Acad. Sci., New York), Vol. 772, pp. 198–208. 38. Stanberry, L.R., Kern, E.R., Richards, J.T., Abbott, T.M. & Overall, J.C., Jr. (1982) J. Infect. Dis. 146, 397–404. 39. Stanberry, L.R. (1994) Semin. Virol. 5, 213–219. 40. Bravo, F.J., Stanberry, L.R., Kien, A.B., Vogt, P.E. & Kern, E.R. (1993) Antiviral Res. 21, 59–72. 41. Denniston, K.J., Madden, M.J., Enquist, L.W. & Vande Woude, G. (1981) Gene 15, 365–378. 42. Stuve, L.L., Brown-Shimer, S., Pachl, C., Najarian, R., Dina, D. & Burke, R.L. (1987) J. Virol. 61, 326–335. 43. Pachl, C., Burke, R.L., Stuve, L.L., Sanchez-Pescador, L., Van Nest, G., Masiarz, F. & Dina, D. (1987) J. Virol. 61, 315–325. 44. Lee, E.T. (1980) Statistical Methods for Survival Data Analysis (Lifetime Learning Publications, Belmont, CA), pp. 122–156. 45. Lasky, L.A. & Dowbenko, D.J. (1984) DNA (N.Y.) 3, 23–29. 46. Bzik, D.J., Debroy, C., Pederson, N.E. & Person, S. (1986) Virology 155, 322–333. 47. Dix, R.D., Pereira, L. & Baringer, J.R. (1981) Infect. Immun. 34, 192–199. 48. Balachandran, N., Bacchetti, S. & Rawls, W.E. (1982) Infect. Immun. 37, 1132–1137. 49. Barry, M.A., Lai, W.C. & Johnston, S.A. (1995) Nature (London) 377, 632–635.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

FUSIGENIC VIRAL LIPOSOME FOR GENE THERAPY IN CARDIOVASCULAR DISEASES

11421

This paper was presented at a colloquium entitled “Genetic Engineering of Viruses and of Virus Vectors,” organized by Bernard Roizman and Peter Palese (Co-chairs), held June 9–11, 1996, at the National Academy of Sciences in Irvine, CA.

Fusigenic viral liposome for gene therapy in cardiovascular diseases

VICTOR J.DZAU*, MICHAEL J.MANN*, RYUICHI MORISHITA†, AND YASUFUMI KANEDA‡ *Research Institute and Department of Medicine, Harvard Medical School and Brigham and Women’s Hospital, Boston, MA 02115; †Department of Geriatric Medicine, Osaka University School of Medicine, Osaka 565, Japan; and ‡Institute for Molecular and Cellular Biology, Osaka University, Osaka 565, Japan ABSTRACT To improve the efficiency of liposome-mediated DNA transfer as a tool for gene therapy, we have developed a fusigenic liposome vector based on principles of viral cell fusion. The fusion proteins of hemagglutinating virus of Japan (HVJ; also Sendai virus) are complexed with liposomes that encapsulate oligodeoxynucleotide or plasmid DNA. Subsequent fusion of HVJliposomes with plasma membranes introduces the DNA directly into the cytoplasm. In addition, a DNA-binding nuclear protein is incorporated into the HVJ-liposome particle to enhance plasmid transgene expression. The fusigenic viral liposome vector has proven to be efficient for the intracellular introduction of oligodeoxynucleotide, as well as intact genes up to 100 kbp, both in vitro and in vivo. Many animal tissues have been found to be suitable targets for fusigenic viral liposome DNA transfer. In the cardiovascular system, we have documented successful cytostatic gene therapy in models of vascular proliferative disease using antisense oligodeoxynucleotides against cell cycle genes, double-stranded oligodeoxynucleotides as “decoys” to trap the transcription factor E2F, and expression of a transgene encoding the constitutive endothelial cell form of nitric oxide synthase. Similar strategies are also effective for the genetic engineering of vein grafts and for the treatment of a mouse model of immune-mediated glomerular disease.

Vector Development Construction of Fusigenic Viral Liposome. Although human gene therapy trials have been initiated, the clinical efficacy of these therapies has not been clearly demonstrated (1). It has been suggested that the limited success of current gene therapy trials may result in part from inadequacies of the DNA delivery systems (1). Improvements of viral and nonviral vector systems for gene therapy are being pursued actively. The development of novel viral vectors, such as pseudotype retrovirus vector (2), adenoviral vector of low antigenicity (3), and adenoassociated virus) vector, has been reported. More recently, the lentivirus vector appears to be promising for transducing nondividing cells (4). Similarly, new lipid formulations designed to increase the efficiency of transfection are being developed (5). Other novel delivery systems include lipopolyamine-based gene delivery (6), targeted gene delivery systems (7), and devices for particle bombardment (8). We have focused our efforts on the development of a fusigenic liposome that is a hybrid vector between viral and nonviral technologies (Fig. 1; ref. 9). Hemagglutinating virus of Japan (HVJ; also Sendai virus) is a paramyxovirus that is 300 nm in diameter and contains two distinct glycoproteins (hemagglutinating neuroaminidase and fusion protein) in its envelope, which are involved in cell fusion (10). This virus is capable of fusing with the cell membrane at neutral pH, and these fusion properties can therefore be exploited to facilitate the introduction of DNA directly into cell cytoplasm, avoiding lysosomal degradation. Hemagglutinating neuroaminidase is required for viral particle binding to receptors consisting of sialoglycoproteins or sialolipids; hemagglutinating neuroaminidase then catalyzes the removal of sugars by its neuroaminidase activity. Fusion protein interacts with the lipid bilayer of cell membranes to induce cell fusion. Fusion protein is produced in an inactive form (F0) and is activated by proteolytic cleavage to the fusion polypeptides F1 and F2, which are held together by a disulfide bridge. The hydrophobic region of F1 can interact with cholesterol to induce cell fusion. Although liposomes themselves have no receptors for the virus, a direct interaction of F1 polypeptide with lipid is likely to play an important role in the ability of HVJ particles to fuse with liposomes (11). Several attempts have been made to incorporate DNA into the HVJ envelope itself (12) or into fusion products of HVJ with red blood cell ghosts (13), but these approaches were plagued by low trapping efficiency and/or low transduction efficiency. Since DNA can be efficiently encapsulated into liposomes (14), we turned to incorporation of HVJ envelope proteins into these liposomes. We first encapsulated DNA into liposomes consisting of phosphatidylcholine and cholesterol that were prepared via vortexing or reverse-phase evaporation. The trapping efficiency of DNA into such liposomes is 10–30%, so that 400–600 molecules of plasmid DNA and more than half million copies of 20-mer oligonucleotides were enclosed into one liposome particle. We then fused the liposomes with UV-inactivated HVJ to form fusigenic viral liposomes containing DNA (400–500 nm in diameter). HVJ-liposomes can fuse with plasma membranes, and fusion is completed within 10–30 min at 37°C. This short HVJ-liposome incubation time is particularly suited for in vivo gene therapy. In contrast, gene transfer by cationic liposomes generally requires a much longer incubation time of 5–20 hr. Indeed, we have shown that exposure of rat carotid artery to HVJliposomes containing fluorescein isothiocianate-labeled oligodeoxynucleotides (ODNs) for 10 min results in the uptake of fluorescence by 30– 50% of cells within the vessel wall. Other advantages of HVJ-liposome-mediated delivery are the introduction of molecules directly into the cytoplasm and avoidance of degradation in the endosome and lysosome. In fact, when fluorescein isothiocianate-ODN was introduced into vascular smooth muscle cells (VSMCs) using HVJ-liposomes, fluorescence was detected in cell nuclei within 5 min, and the fluorescence remained prominent in the nuclei for at least 72

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact. Abbreviations: HVJ, hemagglutinating virus of Japan; ODN, oligodeoxynucleotide; VSMC, vascular smooth muscle cell; AS, antisense; PCNA, proliferating cell nuclear antigen; cdc2, cell division cycle 2; ec-NOS, endothelial cell NO synthase.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

FUSIGENIC VIRAL LIPOSOME FOR GENE THERAPY IN CARDIOVASCULAR DISEASES

11422

hr (15). In contrast, after direct transfer of fluorescein isothiocianate-ODN to VSMCs without the HVJ lipsome, fluorescence was observed in cytoplasmic compartments but not in the nucleus. Furthermore, the fluorescence was no longer detectable at 24 hr after direct fluorescein isothiocianateODN application.

FIG. 1. Procedure of gene transfer by HVJ-liposome. Current gene transfer methods are also limited by the low level of expression of the transgene. We have found that cointroduction of plasmid DNA with a nuclear protein, high mobility group-1, can enhance transgene expression in animal tissues (16, 17). High mobility group-1 protein is a nonhistone DNA-binding protein of 28 kDa. It is reported that high mobility group-1 is required for the bending or looping of DNA and for enhancing transcription by specific recognition of cruciform DNA (18). An advantage of the HVJ-liposome is the capacity for such cointroduction of both DNA and proteins via their incorporation into the same particle. Indeed, we have recently cointroduced RNase H with antisense (AS) ODN for angiotensin converting enzyme in vivo into injured rat carotid artery. We observed that the AS effect was augmented 3-fold with the addition of RNase H (unpublished data). Thus, HVJ-liposomes have been useful for DNA transfer in various tissues in vivo, resulting in functional gene expression or gene suppression (Table 1). Advantages of Fusigenic Viral Liposome. Efficient transfection of oligonucleotides, plasmid DNA, and proteins. The HVJ-liposome can encapsulate DNA up to 100 kbp. We have succeeded in transducing cosmid DNA (45 kbp) containing the thymidine kinase gene into cultured mouse cells (19). Recently, full-length cDNA of human Ducchene muscular dystrophy gene was introduced in vivo using HVJ-liposomes, resulting in its expression in skeletal muscle and diaphragm of the mdx mouse (20). When AS ODN to basic fibroblast growth factor was transfected into VSMCs using HVJ-liposomes and compared with cationic lipid transfection or direct ODN transfer without any vector, the concentration of AS basic fibroblast growth factor required to reduce cellular DNA synthesis by 75% was approximately 0.1 µM, 10 µM, and 20 µM, respectively (21). Thus, the HVJ-liposome is an effective method for ODN and plasmid DNA transfer. Ribozymes have also been efficiently introduced into cells using HVJ-liposomes, and the vector has also been useful for the introduction of recombinant proteins IgG and IgM (ref. 20 and unpublished data). Penetration of the vector into tissues in vivo. Efficient in vivo transfer and expression of transgenes have been observed in cells of the tunica media of intact rabbit carotid arteries after filling the lumen with HVJ-liposomes containing the trans

Table 1. In vivo gene transfer by HVJ-liposome Gene product Organ Liver Rat and mouse Insulin Rat Renin, HBsAg Rat LacZ Kidney Rat TGF-β, PDGF SV40-large tag Heart Rat TGF-β, HSP70, Mn-SOD, Bcl-2 Skeletal muscle Mouse Rat Rat Artery Rat Rabbit Lung Rat Patellar ligament Rat Brain Rat Eye Mouse and Monkey Skin Rat Testis Mouse

Duration of gene expression 7–14 days 7 days >4 weeks 7 days >2 weeks >2 weeks

Dystrophin Luciferase Decorin

2 weeks >4 weeks >2 weeks

SV40, ACE, c-NOS, p21, ANP p53

>2 weeks >2 weeks

TGF-β, PDGF, LacZ

>2 weeks

LacZ

>4 weeks

LacZ

>2 weeks

LacZ

>2 weeks

LacZ

7–10 days

CAT

>8 months

HBsAg, hepatitis B surface antigen; TGF-β, transforming growth factor β; PDGF, platelet-derived growth factor; SV40, simian virus 40; HSP70, heat shock proteins 70; SOD, superoxide dismutase; ACE, angiotensin converting enzyme; c-NOS, constitutive NO synthase; ANP, atrial natriuretic protein; and CAT, chloramphenicol acetyltransferase.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

FUSIGENIC VIRAL LIPOSOME FOR GENE THERAPY IN CARDIOVASCULAR DISEASES

11423

gene for 10 min under 150 mmHg (1 mmHg=133 Pa). Thus, in contrast to adenoviral vectors, this vector appears to penetrate readily the intimal layer to reach the tunica media. Our observation that the interstitium of the tunica media is stained upon incubation with liposomes without HVJ containing Evans blue dye suggests that this penetrating ability is conferred primarily by the liposome. Subsequent cell fusion and intracellular delivery of DNA is mediated by HVJ fusion proteins. Our liposome consists of the negatively charged phosphatidylserine, in addition to phosphatidylcholine and cholesterol. The presence of this negative charge may play an important role in enhancing transmigration into the vessel wall, and we are currently varying the composition of the liposome to test its effect on tissue penetration. It is our observation that negatively charged liposomes generally do not work well for DNA transfer into cultured cells in vitro. However, the converse may be true of in vivo gene transfer. Recently, we developed cationic HVJ-liposomes, and compared their gene transfer efficacy with those for anionic HVJliposomes and cationic lipids (Lipofectamine; GIBCO/ BRL) in vitro and in vivo. Cationic HVJ-liposomes and Lipofectamine are much more efficient than anionic HVJ-liposomes for achieving luciferase gene expression in vitro. In contrast, negatively charged HVJ-liposomes are most efficient for in vivo transfection of liver and skeletal muscle. No apparent toxicity and low antigenicity. Thus far, using HVJ-liposomes, we have not observed significant cell damage in vitro, nor have we detected target organ dysfunction in vivo. Up to 1010–1011 HVJ lipsome particles have been injected in vivo into the portal veins of 8-weekold mice without any detectable toxicity (22). However, the fate of the HVJ proteins and the virion, as well as that of the lipids, must be analyzed more precisely before the application of HVJ-liposomes for human clinical trial. Furthermore, the effectiveness of UV light for the complete inactivation of HVJ must be documented carefully. We have also examined the antigenicity of HVJ-liposomes in vivo. Low titers of antibodies against HVJ could be detected 1 week after injection of the HVJ-liposome into the portal vein of the rat. When HVJ-liposomes containing marker genes were injected into the portal veins of rats that had received a prior injection of empty HVJ-liposomes 7 days earlier, the marker gene expression was not attenuated, compared with rats undergoing primary HVJ-liposome transfection. Clearly, much more work has to be done to study the immunogenicity of the HVJliposome complex and to define the effect of repeated injections in vivo. Improvement of current vector system. The transient nature of gene expression is a major limitation of the current HVJ-liposome system. Recently, we have succeeded in achieving longer term gene expression in vivo using the self-replicating apparatus of Epstein-Barr virus (ref. 22 and unpublished data). A plasmid containing the Ori P sequence and the EBNA-1 coding region derived from Epstein-Barr virus was constructed, and the luciferase gene, expressed under the control of chicken β-actin promotor, was cloned into this vector. Luciferase gene expression in cultured human cells (HeLa and KEK-293) increased with cell division after HVJ-liposome transfection with this vector. Southern blot analysis of episomal DNA in these cells indicated that the transgene replicated autonomously in the nucleus. However, this plasmid could not replicate autonomously in rodent cells but was retained in the nucleus. When this Epstein-Barr virus replicon vector was introduced into rat liver using HVJ-liposomes, luciferase gene expression was detected for >4 weeks, although the level gradually decreased. To enhance tissue-specific expression, the transgenes encapsulated into HVJ-liposomes have now been designed to be driven by cell typespecific promoters. We have succeeded in achieving gene expression in the liver by the use of the mouse albumin promoter or the rat pyruvate kinase promotor, and the endothelin promotor may also allow endothelial cell specific transgene expression in vivo.

Application of Fusigenic Virus Liposome to Gene Therapy of Cardiovascular Diseases Vascular Proliferative Disease (e.g., Restenosis). AS strategy. Balloon angioplasty is one of the major therapeutic approaches to coronary artery stenosis. Restenosis, however, occurs in 30–40% of patients after angioplasty. A major component of restenosis is neointimal hyperplasia, which is characterized primarily by abnormal growth and migration of VSMCs. Multiple growth factors are involved in the stimulation of VSMC growth. Cell cycle progression to cell division is ultimately regulated by cell cycle regulatory genes. We have therefore developed a strategy to inhibit abnormal growth of VSMC in vivo by suppressing the expression of cell cycle regulatory proteins. Indeed, we reported that the combination of AS ODN against proliferating cell nuclear antigen (PCNA) and cell division cycle 2 (cdc2) kinase inhibited serumstimulated VSMC proliferation in vitro (23, 24). Similarly, the combinations of AS cdc2 kinase/AS cyclin B1 and AS cdc2 kinase/AS cyclin-dependent kinase 2 completely inhibited serum-stimulated DNA synthesis. Since neointima formation is initiated by an acute phase of medial smooth muscle cell replication, we transfected AS ODN to PCNA and cdc2 kinase via HVJ-liposomes into balloon-injured rat carotid arteries in vivo. As shown in Fig. 2, neointima formation was completely inhibited for 2 weeks after AS ODN transfer, and the inhibitory effect was sustained up to 8 weeks after a single transfection. However, no inhibitory effect was observed after transfection with control sense ODN. Combinations of AS ODN with cdc2 kinase/cyclin B1 and AS with cdc2 kinase/ cyclin-dependent kinase 2 also resulted in suppression of neointimal hyperplasia in this experimental model of vascular proliferative disease. Transcriptional factor decoy strategy. The transcriptions of PCNA, cdc2 kinase, and c-myc and c-myb protooncogenes are activated by a common transcriptional factor, E2F. In quiescent VSMCs, E2F forms a protein complex with retinoblastoma gene product, RB. Upon growth stimulation, the RB protein is phosphorylated, and E2F is subsequently released

FIG. 2. Long-term suppression of neointima formation by AS-cdc2 kinase and AS-PCNA. Uninjured rat carotid artery (Upper Left), injured rat carotid artery without protein-liposome (Lower Left), injured rat carotid artery treated with proteinliposome containing 15 µM sense ODNs for both molecules (Upper Right), and injured rat carotid artery treated with proteinliposome containing 15 µM AS ODNs (Lower Right) were shown. At 2 weeks after transfection, rats were killed and vessels were fixed with 4% paraformalehyde.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

FUSIGENIC VIRAL LIPOSOME FOR GENE THERAPY IN CARDIOVASCULAR DISEASES

11424

from the complex. E2F then binds to the promoter region of the above cell cycle genes and activates their transcription. The consensus sequence TTTCGCGC is the binding site for E2F. Our strategy for inhibition of cell proliferation is the intracellular delivery of doublestranded ODN containing the TTTCGCGC sequence to act as a decoy to trap the released E2F (25). We synthesized a 14-mer as well as a 30mer double-stranded ODN containing the consensus sequence and demonstrated that both are effective E2F based on competitive gel-shift assay. Using HVJ-liposomes, E2F decoy ODN was then introduced into cultured VSMCs, and it completely inhibited serum-stimulated growth. This growth inhibition was accompanied by reductions in PCNA and cdc2 kinase levels in these VSMCs. In contrast, mismatched decoy showed no inhibitory effect. Based on these in vitro results, we examined the effect of E2F decoy on the prevention of neointimal hyperplasia in vivo. E2F decoy was transduced into balloon-injured rat carotid arteries using HVJ-liposomes. Our results demonstrated a marked suppression of neointimal formation at 2 weeks after balloon injury. In contrast, mismatched, scrambled, or progesterone responsive element decoy had no effect on neointimal development. Interestingly, we observed that a single administration of E2F decoy resulted in a sustained inhibition of neointimal formation up to 8 weeks after the treatment. Gene transfer approach. Using HVJ-liposomes, we also attempted to inhibit neointimal formation by plasmid DNA gene transfer (26). Several studies had suggested NO could inhibit neointimal formation. For example, NO inhibited VSMC growth and migration in vitro. Systemic administration of a NO synthase inhibitor accelerated atherosclerotic lesion formation and impaired vascular reactivity. We therefore postulated that overexpression of endothelial cell NO synthase (ec-NOS) is an effective gene therapeutic strategy. Accordingly, we transfected balloon-injured rat carotid arteries with an expression vector containing the ec-NOS gene. Four days after HVJ-liposome-mediated ec-NOS gene transfer into injured rat carotid arteries, significant levels of ec-NOS protein expression were detected. Consequently, NO production in the injured artery was enhanced by ec-NOS gene transfer. Two weeks after ec-NOS gene transfer, histological analysis revealed a 70% reduction in neointimal area as compared with the nontransfected injured artery (26). In contrast, no inhibition of neointima formation was observed in injured vessels undergoing control vector transfection. Since NO has multiple effects on the vessel wall, including vasorelaxation, inhibition of platelet aggregation, prevention of leukocyte adhesion, and suppression of VSMC growth and migration, we propose that our strategy to augment NO production may be an effective and practical approach to the gene therapy of restenosis. Another important consideration for the therapy of restenosis is reendothelialization of the injured artery. Although several factors are known to stimulate endothelial cell growth, we have recently found that hepatocyte growth factor is a more potent accelerator of endothelialization than either vascular endothelial cell growth factor or basic fibroblast growth factor. In addition, unlike basic fibroblast growth factor, hepatocyte growth factor does not stimulate VSMC growth. We are therefore developing a strategy to prevent restenosis via the inhibition of VSMC growth using an AS, decoy, or NOS gene transfer approach in combination with the stimulation of endothelial cell growth by hepatocyte growth factor gene transfer. Genetic engineering of vein grafts resistant to atherosclerosis. Saphenous vein grafts are the most commonly used bypass conduits for the treatment of occlusive vascular disease. However, up to 50% of vein grafts fail within a period of 10 years, primarily as a result of accelerated graft atherosclerosis. When grafted into arteries, veins are subjected to increased intraluminal pressure and undergo adaptive wall thickening. This thickening, however, involves neointimal hyperplasia, and this neointimal layer is believed to form the substrate for the aggressive atherosclerotic disease that eventually causes graft failure. We therefore hypothesized that a cytostatic strategy to prevent the hyperplastic response to the acute injury of grafting would redirect the biology of vein graft adaptation away from neointimal hyperplasia and toward medial hypertrophy (27). Rabbit jugular vein was isolated and transfected with AS ODN against PCNA and cdc2 kinase using HVJliposomes. The transfected vein was then grafted into the carotid artery. Neointima formation inhibited in the AS ODN-treated vein grafts for up to 10 weeks after surgery. In response to cell-cycle arrest with AS ODN, the genetically engineered vein grafts developed hypertrophy of the medial layer. When the rabbits were fed a high-cholesterol diet, accelerated atherosclerotic changes, characterized by plaque formation and macrophage infiltration, developed in the untreated and control ODN-treated grafts. In contrast, neither plaque formation nor significant macrophage infiltration was observed in any of the AS ODN-treated grafts, despite cholesterol feeding. These results establish the feasibility of developing genetically engineered bioprostheses that are resistant to failure and better suited to the long-term treatment of occlusive vascular diseases. Treatment of glomerulosclerosis. We have also used E2F decoy oligonucleotide to ameliorate the changes seen in an animal model of mesangial proliferative nephritis. Injection of anti-Thy-1 antibody, which specifically injures glomerular mesangial cells, results in a proliferative glomerular lesion. We demonstrated that intrarenal arterial perfusion of HVJ-liposome complexes containing 14-mer E2F doublestranded decoy ODN inhibited anti-Thy-1-induced mesangial cells proliferation, as documented by BrdUrd incorporation and total glomerular cell counts. Furthermore, this decoy treatment prevented histopathologic changes in the glomeruli that closely mimic the mesangioproliferative nephritis seen in IgA nephropathy and in some forms of focal glomerular sclerosis.

Future Direction The fusigenic viral liposome appears to be an effective tool for gene transfer and therapy. Our current system is an HVJ-liposome complex, but other viral fusion proteins may be applicable. In addition, in forming fusigenic liposome complexes, purified or recombinant fusion polypeptides may be used instead of the entire viral envelope. Since the system is a hybrid between viral and nonviral vectors, safety issues must be considered. It will be necessary to test the safety of UV-inactivated HVJ itself, as well as the safety of the liposome and the immunogenicity of the HVJ-liposome complex. HVJ-liposomes may be useful for short-term and local gene therapy. Modifications of this system will be necessary to permit high levels of stable expression of the transgene for clinical therapy. 1. Marshall, E. (1995) Science 265, 1050–1055. 2. Hopkins, N. (1993) Proc. Natl. Acad. Sci. USA 90, 8759–8760. 3. Yang, Y., Nunes, F.A., Berencsi, K., Furth, E.E., Gonczol, E. & Wilson, J.M. (1994) Proc. Natl. Acad. Sci. USA 91, 4407–4411. 4. Naldini, L., Blomer, U., Gallay, P., Ory, D., Mulligan, R., Gage, F.H., Verma, I.M. & Trono, D. (1996) Science 272, 263–267. 5. Goyal, K. & Huang, L. (1995) J. Liposome Res. 5, 49–60. 6. Remy, J.-S., Kickler, A., Mordvinov, V., Shuber, F. & Behr, J.-P. (1995) Proc. Natl. Acad. Sci. USA 92, 1744–1748. 7. Wagner, E., Plank, C., Zatloukal, K., Gotten, M. & Birnstiel, M.L. (1992) Proc. Natl. Acad. Sci. USA 89, 6099–6102. 8. Cheng, L., Ziegelhoffer, P.R. & Yang, N.-S. (1993) Proc. Natl. Acad. Sci. USA 90, 4455–4459. 9. Kaneda, Y. (1994) in Cell Biolab: A Laboratory Handbook, ed. Celis, J.E. (Academic, New York) Vol. 3, pp. 50–57. 10. Okada, Y. (1993) Methods Enzymol. 221, 18–41.

About this PDF file: This new digital representation of the original work has been recomposed from XML files created from the original paper book, not from the original typesetting files. Page breaks are true to the original; line lengths, word breaks, heading styles, and other typesetting-specific formatting, however, cannot be retained, and some typographic errors may have been accidentally inserted. Please use the print version of this publication as the authoritative version for attribution.

FUSIGENIC VIRAL LIPOSOME FOR GENE THERAPY IN CARDIOVASCULAR DISEASES

11425

11. Nakanishi, M., Uchida, T., Sugawa, H., Ishiura, M. & Okada, Y. (1985) Exp. Cell Res. 159, 399–409. 12. Wu, P., de Fiebre, C.M., Millard, V.J., Elmstrom, K., Gao, Y. & Meyer, E.M. (1995) Neurosci. Lett. 190, 73–76. 13. Sugawa, H., Uchida, T., Yoneda, Y., Ishiura, M. & Okada, Y. (1985) Exp. Cell Res. 159, 410–418. 14. Schaeffer-Ridder, M., Wong, Y. & Hoffschneider, P.H. (1982) Science 215, 215–217. 15. Kaneda, Y., Morishita, R. & Tomita, N. (1995) J. Mol. Med. 73, 289–297. 16. Kaneda, Y., Iwai, K. & Uchida, T. (1989) Science 243, 375–378. 17. Kaneda, Y., Iwai, K. & Uchida, T. (1989) J. Biol. Chem. 264, 12126–12129. 18. Lilley, J.M. (1992) Nature (London) 357, 282–283. 19. Kaneda, Y., Uchida, T., Kim, J., Ishiura, M. & Okada, Y. (1987) Exp. Cell Res. 173, 56–69. 20. Yanagihara, I., Inui, K., Dickson, G., Piper, T., Kaneda, Y. & Okada, S. (1996) Gene Ther. 3549–3553. 21. Kaneda, Y., Morishita, R. & Dzau, V.J. (1996) Ann. N.Y. Acad. Sci. in press. 22. Sugden, B., Marsh, K. & Yates, B. (1995) Mol. Cell Biol. 5, 410–413. 23. Morishita, R., Gibbons, G.H., Ellison, K.E., Nakajima, M., Zhang, L., Kaneda, Y., Ogihara, T. & Dzau, V.J. (1993) Proc. Natl. Acad. Sci. USA 90, 8474–8478. 24. Morishita, R., Gibbons, G.H., Ellison, K.E., Nakajima, M., von der Leyen, H., Zhan, L., Kaneda, Y., Ogihara, T. & Dzau, V.J. (1994) J. Clin. Invest. 93, 1458–1464. 25. Morishita, R., Gibbons, G.H., Horiuchi, M., Willison, K.E., Nakajima, M., Zhang, L., Kaneda, Y., Ogihara, T. & Dzau, V.J. (1995) Proc. Natl. Acad. Sci. USA 92, 5855–5859. 26. Von der Leyen, H., Gibbons, G.H., Morishita, R., Lewis, N.P., Zhang, L., Nakajima, M., Kaneda, Y., Cooke, J.P. & Dzau, V.J. (1995) Proc. Natl. Acad. Sci. USA 92, 1137–1141. 27. Mann, M., Gibbons, G.H., Kernoff, R.S., Diet, F.P., Tsao, P.S., Cooke, J.P., Kaneda, Y. & Dzau, V.J. (1995) Proc. Natl. Acad. Sci. USA 92, 4502– 4506.