ADVANCES IN GENETICS VOLUME 20 Edited by E. W. CASPARI Department of Biology University of Rochester Rochester, New York...
4 downloads
381 Views
28MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
ADVANCES IN GENETICS VOLUME 20 Edited by E. W. CASPARI Department of Biology University of Rochester Rochester, New York
1979
ACADEMIC PRESS A Subsidiary
NEW YORK SAN FRANCISCO LONDON of
Harcourt Brace Jouanouich, Publishers
COPYRIGHT @ 1979, BY ACADEMIC PRESS, INC. ALL RIGHTS RESERVED. N O PART O F THIS PUBLICATION MAY B E REPRODUCED OR TRANSMITTED IN ANY FORM OR BY ANY MEANS, ELECTRONIC OR hlECHANICAL, INCLUDING PHOTOCOPY, RECORDING, OR ANY INFORMATION STORAGE AND RETRIEVAL SYSTEM, WITHOUT PERMISSION IN WRITING FROM T HE PUBLISHER.
ACADEMIC PRESS,INC.
11 1 Fifth Avenue, N e w York, New York 10003
United Kingdom Edition published by ACADEMIC PRESS, INC. (LONDON) LTD. 24/28 Oval Road, London N W 1 7DX
LIBRARY OF CONGRESS CATALOG
CARD
NUMBER:47-30313
ISBN 0-12-017620-3 PRINTED IN THE UNITED STATES O F AMERICA
79808182
9 8 7 6 5 4 3 2 1
CONTRIBUTORS TO VOLUME 20 Numbers in parentheses indicate the pages on which the authors’ contributions begin.
URSULAK. ABBOTT(217),Department of Avian Sciences, University of California, Davis, California 9561 6 MULKHR. AHUJA (1271, Genetics Institute, Justus-Liebig University, Giessen, West Germany JOHN R. MCCARREY (217),Department of Avian Sciences, University of California, Davis, California 9561 6 VEDPALSINGH MALIK(371, Research Laboratories, The Upjohn Company, Kalamazoo, Michigan 49001 ELIZABETHS . RUSSELL(357), The Jackson Laboratory, Bar Harbor, Maine 04609 CHRISTOPHSCHOLTISSEK (11, Znstitut fiir Virologie, Justus-LiebigUniuersitat, Giessen, Frankfurterstr. 107, 6300 Giessen, West Germany GEORGED. SNELL (2911, The Jackson Laboratory, Bar Harbor, Maine 04609 INDRA K. VASIL (1271, Department of Botany, Uniuersity of Florida, Gainesville, Florida 3261 1 VIMLA VASIL (127), Department of Botany, University of Florida, Gainesville, Florida 3261 1
vii
ERRATUM Advances in Genetics, Volume 19 David D. Perkins and Edward G. Barry, The Cytogenetics of Neurospora
Page 209 Within Figure 18C the label T(1R; IIR14637 x Normal should be changed to read: T(IR; IIR)4637 x T(IR; IIRlSTL76
ix
INFLUENZA VIRUS GENETICS Christoph Sc holtisse k lnstitut fur Virologie. Justus.Liebig.Universitat.
Giessen. West Germany
I . Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . I1. Nomenclature and Structure of Influenza Viruses . . . . . . . . . . A . Nomenclature . . . . . . . . . . . . . . . . . . . . . . . . . . B . Structure and Number of Virus-Specific Proteins . . . . . . . . . 111. The Segmented Genome of Influenza Viruses . . . . . . . . . . . . IV . Base Sequence Studies on Individual RNA Segments . . . . . . . . A.VirionRNA . . . . . . . . . . . . . . . . . . . . . . . . . . . B. Complementary RNA . . . . . . . . . . . . . . . . . . . . . . . V . Synthesis of Viral RNA and Its Regulation . . . . . . . . . . . . . VI . Temperature-Sensitive Mutants . . . . . . . . . . . . . . . . . . A. Number of Recombination Groups . . . . . . . . . . . . . . . . B . Defects in Biological Functions . . . . . . . . . . . . . . . . . VII . Assignment of RNA Segments to Gene Functions . . . . . . . . . . VIII . Genetic Basis for the Antigenic Variability of Influenza Viruses . . . A. Antigenic Shift . . . . . . . . . . . . . . . . . . . . . . . . . . B . Antigenic Drift . . . . . . . . . . . . . . . . . . . . . . . . . . IX . Some Practical Applications . . . . . . . . . . . . . . . . . . . . . A . The New Pandemic Strain ( H l N l ) from 1977 . . . . . . . . . . B . Host-Range Recombinants . . . . . . . . . . . . . . . . . . . . . C . Host-Range Mutants . . . . . . . . . . . . . . . . . . . . . . . D . Amantadine Resistance as a Genetic Marker . . . . . . . . . . . E . Possible Application of Recombinants and Temperature-Spnsitive Mutants for Production of Live Vaccines . . . . . . . . . . . . . X . Concluding Remarks . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . .
.
.
. . . . .
. . .
1 2 2 3 3 4 4 5 6 7 7 8 12 13 16 18 21 21 23 24 25
26 27 28
I. Introduction
Influenza is still an unresolved problem mainly because the agent causing the disease exhibits a high antigenic variability. which is 1 ADVANCES I N GENETICS. Yo1. 20
Copyright 0 1979 by Academic Press. Inc . All rights of reproduction in any form reserved ISBN 0-12-017620-3
2
CHRISTOPH SCHOLTISSEK
unique for this virus family. With most other viruses, people become infected only once during their life and thereafter are immune against a second infection. For the latter viruses, only a very limited number of serotypes exist that are antigenically stable. Therefore in recent years the molecular genetic basis for the antigenic variation of influenza viruses has been studied extensively. Several review articles have appeared on this matter (Sugiura, 1975; Palese, 1977; Scholtissek, 1978; Webster and Bean, 1978). Because of the unusual structure and behavior of the influenza genome, these viruses became more and more attractive for geneticists. Since the field is in a stage of rapid development, it seems worthwhile again to sum up the most recent findings about the genetics of influenza viruses. Thus, this chapter will deal only briefly with what is known about the structure of the virion and the various gene products. Emphasis will be laid on temperaturesensitive mutants and on the structure of the RNA segments in terms of base sequence, variable and constant genes and regions within genes, which might explain the antigenic variability of the various influenza strains. Some new possibilities for practical applications of influenza genetics will be mentioned at the end of this article. II. Nomenclature and Structure of Influenza Viruses
A. NOMENCLATURE Influenza viruses are divided into types A, B, and C according to serological differences of their nucleocapsid proteins, which can be regarded as group-specific antigens. This review will concentrate mainly on influenza A viruses, which are subdivided according to the serological properties of their surface glycoproteim hemagglutinin (HA) and neuraminidase (NA). Thus the human influenza A virus strains are numbered through according to the various pandemic prototype strains with HO, H1, H2, and H3 (formerly AO, A l , etc.). “H” stands for hemagglutinin, and the numbered designation means that the various strains do not cross-react serologically in the hemagglutinin-inhibition test. Animal influenza strains are marked according to the species from which they were isolated, e.g., Hsw for swine, Heq for equine, Hav for avian. The strains are further classified by the serological properties of their neuraminidases ( N l , N2, etc.). According to the WHO report (Chanock et al., 19721, also the year and place, and number of isolation should be indicated. Thus the correct nomenclature of the prototype isolate of the
INFLUENZA VIRUS GENETICS
3
pandemic in 1933134 is AIPW8134 (HONl), for which the trivial name PR8 will be used. AND NUMBER OF VIRUS-SPECIFIC PROTEINS B. STRUCTURE
The two influenza virus glycoproteins located at the surface of the virus particles are the hemagglutinin (HA) and neuraminidase (NA), which are embedded in a lipid bilayer. This lipid bilayer is derived from the host cell during virus maturation at the cytoplasmic membrane by a budding process. At the inside of the bilayer the matrix (MI protein is located it surrounds a helical structure composed of the nucleoprotein (NP) and three minor proteins (Pl, P2, P3) (for reviews, see Choppin and Compans, 1975; Rott and Klenk, 1977). The singlestranded viral RNA (vRNA) segments are embedded into this nucleocapsid, which exhibits RNA polymerase activity. This enzyme complex synthesizes exclusively complementary RNA (cRNA) (for a review, see Simpson and Bean, 1975). Thus, in the virion, 7 virusspecific proteins can be recognized. In virus-infected cells at least one additional virus-coded protein is found, which is not incorporated into the virion and, therefore, is called nonstructural (NS) protein (for a review, see Scholtissek and Klenk, 1975). All together, we have to expect a minimum of 8 genes on the influenza genome. 111. The Segmented Genome of Influenza Viruses
During the early genetic work on influenza viruses by Burnet and Hirst and their collaborators, a n unexpectedly high rate of recombination between different strains was observed. It was already suggested a t this time that the influenza viruses might have a segmented genome. This mkans that recombinants were formed by reassortment of individual RNA molecules that behave like chromosomes [for early reviews, see Burnet (1959) and Hirst (1962)l. Further evidence in favor of a segmented genome came from observations on multiplicity reactivation (Henle and Liu, 1951) and on stepwise inactivation of influenza virus RNA by specific chemicals (Scholtissek and Rott, 1964). Even under the most cautious conditions influenza virus RNA could be isolated only as a heterogeneous mixture of molecules (Pons and Hirst, 1968; Duesberg, 19681,which could be resolved by polyacrylamide gel electrophoresis in the presence of 6 M urea (Floyd et al., 1974) into 8 individual segments (Pons, 1976; Palese and Schulman, 1976a; Bean
4
CHRISTOPH SCHOLTISSEK
and Simpson, 1976; Scholtissek et al., 1976; McGeoch et al., 1976; Rohde et al., 1977). An example of such an electrophoregram of fowl plague virus [A/FPV/RostocW34 (HavlNl)] RNA is given in Fig. 1. With influenza B viruses, 8 segments were also resolved (Ritchey et al., 1976a). McGeoch et al. (1976) have presented evidence by T1oligonucleotide fingerprints that each of the 8 bands seen in the electrophoregram consists of a unique RNA molecule. The molecular weights of the RNA segments are between 3 x lo5 and 1 x lo6. Since the molecular weights of the 8 viral proteins are between 2.5 x lo4 (M and NS) and 9 x lo4 (P proteins), it has been suggested that each segment consists of a single gene (Skehel, 1972; Pons, 1976; Inglis et al., 1976).A more detailed assignment of the various RNA segments to specific viral proteins will be given below (see Fig. 1). IV. Base Sequence Studies on Individual RNA Segments
A. VIRIONRNA Relatively little is known as yet about the exact base sequence of the various RNA segments, although this field is in rapid development. Earlier studies on influenza virus RNA have revealed that the vRNA carries at its ti’-terminuS pppAp (Young and Content, 1971) and at its 3’-end uridine (Lewandowski et al., 1971). In a recent analysis it has been demonstrated that the sequence of the first 13 nucleotides at the 5’-end is the same for all 8 individual vRNA segments of different influenza A strains. Thereafter, a triplet was found, which varies for most of the segments, followed by at least 6 U residues. Thus the sequence of the first 22 nucleotides, except for the triplet in positions 14 to 16, is identical in all segments. The sequence originally published by Skehel and Hay (1978af has to be corrected in positions 9 and 10 as found by Barry et al. (1979). Thus, there is now agreement that the sequence at the 5’-end of the FPV vRNA segments is as follows: UAG GAG GUA 5’AGUAGAAACAAGGAGAUUUUUU UAG GUG
The triplet UAG in positions 14 to 16 was found in RNA segments 1to 3, the triplet GAG in segment 4, the triplet GUA in segment 5 , etc.
INFLUENZA VIRUS GENETICS
5
FIG. 1. Polyacrylamide gel electrophoresis of 32P-labeledvRNA of fowl plague virus (FPV), strain “Rostock” (HavlN1).The virus was grown in primary chick embryo cells in the presence of 32P-orthophosphate.It was purified, and its isolated RNA was separated by electrophoresis on a polyacrylamide slab gel in the presence of 6 M urea. The RNA is visualized by exposure of a n X-ray film to the gel (Scholtissek et al., 1976). The RNA segments are numbered according to their migration rates, segment 1 (Pol 1)being the slowest moving one. Pol 1,polymerase 1 gene; Ptra, transport gene; Pol 2, polymerase 2 gene; HA, hemagglutinin gene; NP, nucleoprotein gene; NA, neuraminidase gene; M, matrix protein gene; NS, nonstructural protein gene. (By courtesy of V. von Hoyningen.)
(Skehel and Hay, 1978a; Moss et al., 1978; Smith et al., 1978; Barry et al., 1979). Also the sequence at the 5’-terminus of the 8 segments of an influenza B virus was determined by Skehel and Hay (1978a). Except for the positions 11,13, and 22, they are the same as found for the two influenza A strains.
B. COMPLEMENTARY RNA The segments of the 5’-terminusof the in uitro products (mRNAs) of the virion transcriptase reaction have been determined (Skehel and Hay, 1978a). The sequence of the first 12 nucleotides is the same for all 8 segments of fowl plague virus (FPV) and another influenza virus A strain (X-31): 5’-AGCAAAAGCAGG. . . . Since all RNA segments have to be transcribed into cRNA, and cRNA again into vRNA, it is reasonable to assume that the recognition for the enzyme complex is at the very beginning of the 5’-termini,
6
CHRISTOPH SCHOLTISSEK
which are the same for all 8 segments. There is also a certain similarity between the 5‘-termini of the vRNA and cRNA segments: 8 out of 12 bases in that sequence are identical. Two different types of virus-specific complementary RNA can be isolated from the cytoplasm of infected cells (Hay et al., 1977b). (1) One type contains at its 3’-terminus poly(A) and a 5’-terminal 7-methylguanosine in cap structures (Krug et al., 1976) and is found exclusively on polysomes. This cRNA can be regarded as the viral messenger RNA (mRNA), which is translated into viral proteins. After removal of the poly(A), the remaining cRNA segments are somewhat smaller as compared with the corresponding vRNA segments. Furthermore, when hybridized to vRNA these cRNA segments do not protect the total length of the corresponding vRNA segments against digestion with S1 nuclease. The RNA sequences accessible to S1 nuclease attack were the first 28 nucleotides (as determined for segments 5,6, and 7 of FPV) located at the 5’-terminus of the vRNA. These data suggest that close to this position a termination signal for the synthesis of viral mRNA should be located (Hayet al., 1977a; Skehel and Hay, 1978a). (2) The second type of cRNA does not contain poly(A) at its 3’-terminus, and is not located at the polysomes. The size of these cRNA segments is identical with that of the vRNA segments isolated from virus particles. It is assumed that this type of cRNA functions as a template for the synthesis of vRNA (Hay et al., 1977b). V. Synthesis of Viral RNA and Its Regulation
This matter has been reviewed recently by Skehel and Hay (1978b). Therefore, only the most important data on the synthesis of viral RNA will be summarized here. As the first step after adsorption, penetration, and uncoating, mRNA is synthesized by the RNA polymerase complex found in virus particles. This type of synthesis of cRNA is called the primary transcription (Bean and Simpson, 1973; Taylor et al., 1977). This cRNA messenger migrates to the polysomes, where it is translated into viral proteins. Thereafter, both species of cRNAs and some vRNA could be detected in infected cells. The peak of synthesis of total cRNA precedes that of vRNA (Scholtissek and Rott, 1970; Taylor et al., 1977). Of the two different types of cRNA found in the cytoplasm, the predominant species is the cRNA containing poly(A) at the 3’-terminus (mRNA), which is synthesized presumably by premature termination (see above). The various seg-
INFLUENZA VIRUS GENETICS
7
ments are present in unequal amounts, and their quantities correlate with the capacity to synthesize the corresponding viral proteins (Hayet al., 1977b; Etkind et al., 1977; Bosch et al., 1978; Inglis et al., 1978). Thus, the synthesis of viral proteins is regulated on the level of the availability of mRNA. In the other species of cRNA, which does not contain poly(A) a t the 3’-terminus and is not found on polysomes, the various segments are present in equimolar amounts (Hay et al., 1977a,b). In the presence of cycloheximide only mRNA is synthesized, but not the other cRNA species (template RNA) (Hay et al., 1977b1, and as a consequence also no vRNA (Scholtissek and Rott, 1970; Pons, 1973). This suggests that, for the synthesis of template RNA (i.e., to read through beyond the premature termination signal), synthesis of virus-coded protein is required (Skehel and Hay, 1978b). For the transcription of viral RNA the continued transcription of cellular DNA seems to be necessary, since the synthesis of vRNA can be inhibited by actinomycin D or a-amanitin (Scholtissek and Rott, 1970; Rott and Scholtissek, 1970; Pons, 1973,1977; Lamb and Choppin, 1977; Spooner and Barry, 1977; Hay et al., 197713; Taylor et al., 1977). The exact mechanisms involved in the regulation of vRNA synthesis and the production of the two types of cRNA are not yet known. VI. Temperature-Sensitive Mutants
For a virus with a limited number of genes, it can be assumed that at least some of their gene products might exhibit more than one function. By isolating and studying as many independently isolated temperature-sensitive (ts) mutants as possible, not only the exact number of recombination groups, but also the potential multifunctional properties of a certain gene product should be recognizable. Thus, a mutation in a certain region of the gene might abolish one function, leaving the other function(s) intact and vice versa. A. NUMBER OF RECOMBINATION GROUPS Ts mutants of influenza A viruses were isolated first by Simpson and Hirst (1968) and subsequently by many other groups (Mackenzie, 1970; Mills and Chanock, 1971; Sugiura et al., 1972; Ueda, 1972; Hirst, 1973; Mackenzie and Dimmock, 1973; Markushin and Ghendon, 1973; Ghendonet al.,1973,1975; Scholtisseket al., 1974; Sugiuraet al., 1975; Spring et al., 1975b; Scholtissek and Bowles, 1975; Nakajima and Sugiura, 1977; Almond et al., 1977). Since different influenza A strains
8
CHRISTOPH SCHOLTISSEK
were investigated and in many instances the biological defects were either not clearly defined or could not be related to a certain RNA segment, a comparison of the various recombination-complementation groups obtained by the various groups was rendered very difficult. Hirst (1973) found 8 recombination groups with the WSN (HON1) strain without characterizing them extensively in biological terms. The ts mutants of the WSN strain isolated by Sugiura et al. (1972, 1975) can be placed into 7 clearly defined recombination groups, since the ts defects can be correlated to the various RNA segments (Ritchey and Palese, 1977). Ts mutants of 6 recombination groups of FPV isolated in our laboratory (Scholtissek et al., 1974; Scholtissek and Bowles, 1975), also have been assigned to corresponding RNA segments (Scholtissek et al., 1976) and, therefore, can be compared directly to those described by Sugiura et al. (1972, 1975). Almond et al. (1977) and recently also Konnecke and Scholtissek (1979) isolated a ts mutant of FPV, which could be correlated to RNA segment 8. Such a group had not been found previously. Thus, there is no doubt that there exist 8 different groups, which is in agreement with the number of RNA segments found in virus particles and the number of virus-specific proteins (gene products).
FUNCTIONS B. DEFECTSIN BIOLOGICAL Attention has to be paid to the fact that comparable recombination groups are numbered by the various laboratories in different ways. Furthermore, the numbering of the RNA segments (genes) is different from that of the recombination groups. Therefore, it is time now to find a generally acceptable nomenclature, one that includes a definition of the influenza virus genes on the basis of the specific functions exerted by their gene products. However, such a definition has to be left for a n international committee. In this chapter, comparison of the various genes and recombination groups has been done on the basis of rescue experiments using ts mutants, the defects of which can be assigned to specific RNA segments (Scholtissek et al., 1976; Ritchey and Palese, 1977; Almond et al., 1977). Although many ts mutants have been studied biologically, in the following pages the biological defects of ts mutant groups of only two different influenza A strains [FPV (HavlN1) and WSN (HONl)] can be compared directly (Sugiura et al., 1972, 1975; Krug et al., 1975; Ueda and Kilbourne, 1976; Mowshowitz and Ueda, 1976; Palese, 1977; Ritchey and Palese, 1977; Scholtissek et al., 1974, 1976; Scholtissek
INFLUENZA VIRUS GENETICS
9
and Bowles, 1975; Scholtissek, 1978; Almond et al., 1977). A summary is presented in Table 1. Ts mutants of group I of FPV correspond to group I11 mutants of WSN. They have a defect in the synthesis of virus-specific RNA: After shifting the temperature from the permissive to the nonpermissive one, synthesis of both types of viral RNA (cRNA as well as vRNA) is inhibited in cells infected with all mutants of this group so far tested (Scholtissek et al., 1974; Scholtissek and Bowles, 1975; Krug et al., 1975; Palese et al., 1977a). One ts mutant of group I1 of FPV, which has been studied in more detail, is identical in its phenotype to mutants of group I (Scholtissek and Bowles, 1975). A corresponding ts mutant of the WSN strain seems to have a defect only in the synthesis of vRNA, but not of cRNA. However, the synthesis of the former has been determined only indirectly; therefore this defect is still somewhat questionable (Krug et al., 1975; Ritchey and Palese, 1977). Recombination group 111of FPV corresponds to group I of WSN. For the gene product of this recombination group it is quite clear that it has more than one function. Two ts mutants of FPV of this group have a defect in the transport of the polymerase complex from the nucleus to the cytoplasm. Virus-specific RNA synthesis itself is not impaired a t the nonpermissive temperature. Another mutant belonging to this group (ts 236) is, in its phenotype, identical to mutants of group 1 (Scholtissek and Bowles, 1975). Again another ts mutant (ts 18)of FPV of group I11 has been found recently (Heller and Scholtissek, 1979) to belong to this group. It has no defect in viral RNA synthesis at the nonpermissive temperature, although the RNA polymerase activity cannot be detected in cell extracts under these conditions. After double infection with ts 18 and other ts mutants of the same group, plaques are found at the nonpermissive temperature; however, these plaques cannot be passaged at 40°C (Scholtissek and Bowles, 1975). This appears to be a n intracistronic complementation of the corresponding gene product. A ts mutant of WSN belonging to this group was found to be unable to synthesize vRNA as well as cRNA after shifting up the temperature (Krug et al., 1975). Ts mutants belonging to group IV have a defect in synthesizing a functional neuraminidase at the nonpermissive temperature. The corresponding ts mutants of the WSN strain contain a heat-labile enzyme and are not released from MDBK cells under restrictive conditions. They form clusters of virus particles at the cell surface, which can be broken up by external neuraminidase. Therefore, it has been suggested
TABLE 1 Correlation between Temperature-Sensitive (ts) Defects, Recombination Groups, and Number of RNA Segments according to Their Electrophoretic Migration Rates on Polyacrylamide-Urea Gels of Two Influenza A Viruses" FPV Rostock (HavlN1) Ts defects cRNA synthesis Transport, cRNA synthesis cRNA synthesis Hemagglutinin synthesis Nucleoprotein function, vRNA synthesis, maturation (?) Neuraminidase synthesis Nonstructural protein
Recombination POUP
WSN (HONl) Segment No.
Segment No.
Recombination group
;
111 I1 VI V
I 111 I1 V VI
5
5
IV VIII
6 7 8
6
2l 3 4
x
3 4
7
8
I
IV VII -
Ts defects
cRNA synthesis cRNA synthesis vRNA synthesis (?) Hemagglutinin synthesis Nucleoprotein function, vRNA synthesis 1?) Heat-labile neuraminidase Matrix protein -
(' The arrows indicate that RNA segment 1 of FPV corresponds in function to RNA segment 2 of WSN and vice versa, as determined by corresponding rescue experiments.
INFLUENZA VIRUS GENETICS
11
that the function of the neuraminidase is the release of the virus from the cell surface (Palese et al., 1974). A corresponding ts mutant of FPV infecting chick embryo cells seems not to behave in this way. Its neuraminidase, once synthesized, is heat stable. Virus particles are released a t 40"C, which form normal plaques a t 33"C, but not at 40°C (Scholtissek and Bowles, 1975). There is certainly a qualitative and quantitative difference between these two mutants concerning the neuraminidase activity, so that the functional significance of this enzyme still remains open for discussion. Ts mutants of group V of FPV correspond to ts mutants of group VI of WSN (see Table 1). They have a defect in synthesizing a functional hemagglutinin under restrictive conditions. The ts mutant of WSN studied in more detail does not synthesize any hemagglutinin glycoprotein at the nonpermissive temperature, and virus particles are not released to the supernatant (Ueda and Kilbourne, 1976). A corresponding ts mutant of FPV (ts 227) still produces an uncleaved hemagglutinin under restrictive conditions (Scholtissek and Bowles, 1975). This molecule at 40°C is synthesized on the rough endoplasmic reticulum, and glucosamine and mannose are incorporated into the oligosaccharide side chains. However, this molecule is not transported to the smooth membranes, and no fucose and galactose are incorporated. Thus ts 227 has a defect in migration from the rough to the smooth membranes, which seems to be a presupposition for cleavage and completion of the carbohydrate side chains (Lohmeyer and Klenk, 1979). Ts mutants of group VI of FPV correspond to group V of WSN (see Table 1). After infection with one of the ts mutants of FPV of this group, synthesis of all virus-specific products is normal at 40°C (ts 191, while with another mutant of this group (ts 81 synthesis of specifically vRNA is impaired after shifting the temperature from the permissive to the nonpermissive one (Scholtissek and Bowles, 1975; Scholtissek, 1978). A corresponding mutant of WSN also seems to have a defect in vRNA synthesis (Krug et al., 1975; Ritchey and Palese, 1977). The gene product involved is the nucleoprotein (Ritchey and Palese, 1977; Harms et al., 1978). Here is another example of a gene product having at least two different functions: one function in promoting vRNA synthesis and another function presumably active in virus maturation. The biological defect of a ts mutant of WSN (group VII) with a lesion in the gene coding for the matrix protein has not yet been rigorously defined in biological terms (Ritchey and Palese, 1977). The same holds true for a ts mutant of FPV with a lesion in the gene coding for the nonstructural protein (group VIII; Almond et al., 1977). Another ts
12
CHRISTOPH SCHOLTISSEK
mutant with a lesion in the gene coding for the nonstructural protein obtained from a recombinant between FPV and virus N was found to synthesize almost normal yields of all gene products at 40"C,but no infectious virus (Konnecke and Scholtissek, 1979). VII. Assignment of RNA Segments to Gene Functions
Because of the correlation between the number of RNA segments and the virus-specific proteins with their individual molecular weights, it had been suggested that each RNA segment consists of a single gene (Pons, 1976; Ingliset al., 1976). For the final assignment of each RNA segment to a corresponding gene function and viral protein, three independent methods have been developed. These methods will be described only briefly, since they have been elaborated already in other review articles (Palese, 1977; Scholtissek, 1978). One method takes advantage of the observation that the migration rates of the RNA segments and of the proteins in polyacrylamide gels of various influenza strains are different. By forming recombinants between suitable parent strains and by comparison of the various migration patterns of the RNA segments and the corresponding proteins of these recombinants with those of the parents, a n assignment of the various RNA segments, and a t the same time of the proteins to the one or the other parent, can be achieved (Palese and Schulman, 1976a,b; Ritchey et al., 1976b; Schulman and Palese, 1976; Zazimko and Gorev, 1976; Palese et al., 1977a,b; Ritchey and Palese, 1977; Racaniello and Palese, 1978; Almond et al., 1977; Almond, 1977; Kendal et al., 1977, 1978a; Ueda et al., 1978). Another method uses for the assignment the molecular hybridization of labeled vRNA segments with a surplus of nonlabeled cRNA of specific recombinants. These specific recombinants were obtained by double infection of chick embryo cells at 40°C with ts mutants of FPV with a known biological defect and other prototype strains that do not form plaques on chick embryo cells. All plaque formers obtained under these conditions are specific recombinants that have replaced at least the defective gene of FPV. By molecular hybridization the various RNA segments of a specific recombinant can be assigned to the one or the other parent, and correspondingly the biological ts defect (= function) to the one or the other RNA segment (Scholtissek et al., 1976, 1977b, 1978a-d; Rohde et al., 1977). By fingerprinting the various proteins of the recombinants, they can be assigned unequivocally to the corresponding RNA segments (see Fig. 1 ) (Harms et al., 1978). By a third method the translation of cRNA into virus-specific pro-
INFLUENZA VIRUS GENETICS
13
teins in uitro is used for the assignment either directly (Etkind et aZ., 1977; Mikhejeva et al., 1978) or after hybridization of the unfractionated mixture of cRNA with a specific vRNA segment (Inglis et al., 1977). By the mixture of cRNA most of the viral proteins are synthesized in recognizable amounts. After hybridization with a specific vRNA segment production of the one or the other viral protein is blocked, since double-stranded RNA does not function as template for protein synthesis. It has to be stressed here that it is not possible to conclude from the order of migration of a certain RNA segment on polyacrylamide gels that it codes for a specific protein (for summary, see Table 2). Hence, for example, RNA segment 5 of the PR8 strain codes for the NP, while segment 6 codes for the NA protein. With the Hong Kong strain (A/Hong Kong/1/68, H3N2) the order of migration of these two segments is the other way around (Palese and Schulman, 1976b). The same holds true for FPV and the equi 2 (A/equine/Miami/l/68, Heq2Neq2) strains (Fhhde et al., 1977). The order of migration of RNA segments 1and 2 of FPV and virus N is the other way around as found for the Singapore (A/Singapore/l/57, H2N2) or PR8 strains (Scholtissek et al., 1978b,c). Two FPV variants have reversed orders of migration concerning segments 2 and 3 (Almond et al., 1977). Although with the influenza A strains so far tested RNA segment 4 always codes for the HA protein, with influenza B viruses it is segment 5 (Racaniello and Palese, 1978; Ueda et al., 1978). Although there is a certain correlation between the molecular weights of the RNA segments and their migration rates on polyacrylamide gels, a few point mutations can affect the migration rates markedly (see Fig. 2). On the other hand, by changing the experimental conditions the order of migration of two segments can be reversed (Cox and Kendal, 1978). Desselberger and Palese (1978) have reevaluated recently the molecular weights of the RNA segments of various influenza strains after destroying any secondary structure of the RNA by glyoxal. Under these conditions the molecular weights of the genes coding for the P proteins, NP, M, and NS were highly conserved, while the molecular weights of the genes coding for HA and NA varied considerably among the various strains. VIII. Genetic Basis for the Antigenic Variability of Influenza Viruses
When a n influenza virus is multiplying in a n organism, production of antibodies is induced against all virus-specific antigens. However,
TABLE 2 Correlation between vRNA Segments of Various Influenza A Strains to Corresponding Gene Functions" Influenza A strain vRNA Equi 2 segments* (Heq2Neq2)
HA NA NP M NS
Hong Kong (H3N2)
PR8 (HON1)
Ptra Pol 1 Pol 2 HA
Ptra Pol 1 Pol 2 HA
WSN (HON1) Ptra Pol 1 Pol 2 HA NP NA
FM1 (HlN1) Ptra Pol 1 Pol 2 HA NP NA
NAx:: NP
M
NS
M
NS
M NS
M
NS
Singapore (H2N2)
Virus N (Hav2Neql) Pol 1
Pol 2 HA NP NA M NS
Pol 2 HA
NP
NA
M
NS
FPVRostock (HavlN1)
FPVDobson vRNA (HavlN1) segments*
Pol 1
Pol 1 Pol 2
HA NP NA
HA NP NA
M
NS
M
NS ~
'' For the designation of the various gene functions or gene products see legend of Fig. 1.Ptra corresponds to P3 in the nomenclature of
Palese (1977); Pol 1 to P1, and Pol 2 to P2. The arrows indicate where the functions of the corresponding RNA segments are reversed. The vRNA segments are numbered according to their electrophoretic migration rates on polyacrylamide-urea gels, number 1 being the slowest moving one. These segments have not yet been clearly resolved.
INFLUENZA VIRUS GENETICS
15
FIG. 2. Polyacrylamide gel electrophoresis of =P-labeled vRNA of A/USSR/90/77 ( H l N l ) and A/FM/1/47 (HlNl). For experimental details see Fig. 1.The data were taken from Scholtissek et al. (1978a).
only those antibodies directed against the two exposed surface glycoproteins hemagglutinin and neuraminidase will react with the newly infecting virus and have protective properties. The other viral antigens are surrounded by the lipid bilayer and, therefore, are not accessible to antibodies. Only antibodies against the viral receptor hemagglutinin will neutralize the infectivity, while those directed against the neuraminidase may interfere with the spread of the virus in the organism. Therefore, the antigenic variability is concerned only with the surface components of influenza viruses. Two different types of antigenic variation can be recognized: the antigenic drift and the antigenic shift. 1. It is assumed that during antigenic drift the immune system of the host selects for spontaneous mutations in the genes coding for the hemagglutinin andfor for neuraminidase in such a way that a given prototype strain changes its antigenicity successively. Thus, new human influenza strains evolve that still exhibit a certain serological
16
CHRISTOPH SCHOLTISSEK
cross-reaction in the hemagglutination and/or neuraminidase inhibition test with the preceding strain. This antigenic change, however, is enough to overcome the immune barrier, and, hence, the new strain is able to start an epidemic. 2. After longer intervals of about 10 to 20 years an antigenically completely new influenza subtype suddenly occurs to which the population has no immunity and which does not cross-react a t all with the preceding strain in the hemagglutinin-inhibition test. Such a strain can then start a worldwide pandemic by which most of the human population becomes infected. This second type of antigenic variation is called antigenic shift. The idea is that such a shift strain evolves by reassortment, this means by exchange of at least the total gene coding for the hemagglutinin (for a review, see Webster and Laver, 1975). Such a shift is facilitated by the segmented genome of the influenza virus. Thus, a common host might become doubly infected with the prevailing pandemic human strain and another influenza virus, derived, for example, from an animal reservoir. The immune system of man now will select for a new recombinant that carries at least the gene coding for the hemagglutinin of the animal influenza virus while retaining the genes responsible for the host range and pathogenic properties in man. For the neuraminidase gene, corresponding mechanisms have to be assumed. In the laboratory recombinants can be obtained easily by reassortment after double infection of a suitable host with two different influenza strains (for a review, see Sugiura, 1975; Webster and Laver, 1975). Thus recombinants were isolated between human and animal influenza A and between influenza B strains, but never between influenza A and a B strain, although there is a low but significant base-sequence homology between the RNAs of influenza A and B strains (Scholtissek and Rott, 1969; Scholtissek et al., 1977a).
A. ANTIGENIC SHIFT If the concept of the anitgenic shift as mentioned above is correct, one should expect that the genetic information (= base sequence) of at least the HA gene of the new strain should be different from the preceding pandemic strain, while that of most of the other genes should be identical. This concept can be tested by molecular hybridization investigating the various labeled RNA segments of one of the pandemic strains and hybridizing them with the cRNA of the preceding and following pandemic strains. An example is given in Table 3. The 32P-labeledvRNA segments of the Singapore (H2N2) strain, which
17
INFLUENZA VIRUS GENETICS
TABLE 3 Percent Base Sequence Homology between 3ZP-LabeledvRNA Segments of the Singapore (H2N2) Strain and cRNA of Other Prototype Influenza A Strains" 32P-Labeledsegments of the Singapore strain cRNA of PR8 (HON1) FM1 (HlN1) Singapore (H2N2) Hong Kong (H3N2) Swine (HswN1) FPV (HavlN1)
1
2
3
4
5
6
7
8
96 98 100 98 91 67
72 70 100 96 73 82
75 76 100 97 76 72
24 24 100 24 30 28
92 94 100 97 88 77
26 29 100 96 29 26
94 97 100 98 97 88
95 98 100 98 97 88
Data taken from Scholtissek et al. (1978~).
caused the pandemic in 1957, were hybridized with a surplus of cRNA of the Singapore strain (homologous hybridization = 100% RNase resistance), of the pandemic strain from 1947, FM1 (A/FM/1/47; HlNl), and of the pandemic strain Hong Kong from 1968 (H3N2). It can be seen that the base sequence homology between RNA segments 1, 5 , 7, and 8 of the Singapore strain and FM1 is close to 1OWo, while the homology to the other segments is significantly lower. These data are compatible with the reassortment theory that the Singapore strain is derived from the preceding pandemic strain by keeping 4 RNA segments and replacing the gene coding for HA and three other genes during recombination. The strain from which the HA and the other three genes are derived is not yet known. The Hong Kong strain has 7 RNA segments almost identical with the corresponding ones of the Singapore strain, while only the gene coding for the HA is completely different. Thus, also the Hong Kong strain seems to have evolved by reassortment from the preceding pandemic virus, keeping 7 genes of the preceding pandemic strain (Scholtissek et al., 1978~). There is a serological and structural relationship between the hemagglutinins of the Hong Kong strain, and the equi 2 virus and the duck Ukraine (A/ducWUkraine/l/63, Hav7Neq2) virus strain (Laver and Webster, 1973). The base-sequence homology between RNA segment 4 (HA gene) of the duck Ukraine virus and the Hong Kong strain was found to be 92% (Scholtissek et al., 1978~).Thus, it is concluded that these two viruses have a close ancestor concerning the gene coding for the HA. By oligonucleotide analysis of the RNA of two avian influenza A viruses (Hav6N2 and HavGNav4) isolated in nature it was shown that these two strains presumably also are related by a recombinational event. At least two of their genes were almost identical, while the
18
CHRISTOPH SCHOLTISSEK
residual genes exhibited significant differences in their oligonucleotide fingerprints. Furthermore, it was shown that animals in nature can be doubly infected with influenza strains (Desselberger et al., 1978). The earlier pandemic strains also have been studied by this technique. The swine influenza (A/swine/1976/31; HswlN1) virus isolated in 1931 is believed to be a survivor of the Spain pandemic strain from 1918119. This strain, the PR8 (HON1) pandemic strain from 1933134, and the FM1 virus exhibit a base-sequence homology between all 8 segments of almost 100% indicating that these pandemic strains presumably have not evolved by reassortment but are derived from each other only by very strong drift (Scholtissek et al., 197713). This view is strengthened by the fact that, although there is no cross-reaction in the hemagglutination-inhibition test between these strains (Davenport et al., 1960), common precipitin lines can be obtained by monospecific antisera against their hemagglutinins (Schild, 1970; Baker et al., 1973). It should be stressed here that in principle it is possible to change the serological properties of a protein sharply by one single-point mutation if, for example, a cysteine is exchanged or a proline is introduced into a region of a n a-helix in this protein by mutation. The immune system always will select for exactly such mutations, although they might occur very rarely. B. ANTIGENIC DRIFT After we have recognized that human influenza strains do drift, it is important to find a mechanism by which this drift can be explained, and also we have to explain the large number of serologically completely different influenza strains. Relevant in this context are two facts. 1. We can divide the 8 distinct genes of the influenza viruses into two groups. One group consists of genes that among all influenza A strains exhibit a relatively high base-sequence homology in the range of 50-100%. All genes coding for the viral proteins located inside the lipid bilayer belong to this group. The other group consists of genes coding for the surface glycoproteins hemagglutinin and neuraminidase. As long as there is no serological cross-reaction between strains concerning these gene products, the base sequence homology is about 30% for the hemagglutinin (HA) and about 20% for the neuraminidase (NA) genes (Scholtissek et al., 1976, 1977b, 1 9 7 8 ~ ) . 2. If the cRNAs of two strains, which exhibit the same low basesequence homology of about 30% to RNA segment 4 (HA gene) of a
INFLUENZA VIRUS GENETICS
19
third strain, are mixed prior to hybridization no increase in the RNase-resistant fraction is found. The same is true for the NA gene. This means that the homologous regions of the HA and NA genes between the various influenza strains are always identical and they totally overlap (Scholtissek et aZ., 1977a). These data suggest that the genes coding for the surface glycoproteins consist of a relatively small conserved region or regions that might be responsible for the functional integrity of the gene product, like receptor activity for HA, while the larger, highly variable region might be involved in the serological specificity of the gene products. This would mean that there would not be many mutations allowed within the conserved region; otherwise the function of the gene product would be abolished and the virus would be unable to multiply. However, within the variable region many mutations are allowed, since they do not interfere with the function of these gene products. If this concept is correct, one should expect that the melting profile of the residual 30% homologous RNA of the HA gene between two influenza viruses not cross-reacting serologically in their hemagglutinins should be rather sharp and the melting point rather high. On the other hand, if two influenza virus strains cross-react serologically in their hemagglutinins and therefore the base sequence homology of their RNA segments 4 is relatively high, the melting profile should be less sharp and the melting point relatively low because of many mismatched regions in the variable part. As shown in Table 4, this prediction is correct: For example, the melting point of the RNA segment 4 hybrid between FPV and A/turkey/England/63 (HavlNav3) is only 74"C, although the base sequence homology is 90%, while the corresponding melting point with virus N Wchicken/Germany/N/49; HavSNeql) is 77"C, but the basesequence homology is only 27%. With the hybrid with Nturkeyf Oregon/71 (HavlNavB), the differences are even more obvious. For the neuraminidase gene corresponding values were obtained (Table 4). These data are in contrast to those obtained with the other group of genes, the gene products of which are group-specific antigens and are highly conserved. Here the melting points of the hybrid molecules are always sharp and high (Table 4) (Scholtissek, 1979). By these data the antigenic drift can be explained by many spontaneous mutations in the variable part of the genes coding for the surface glycoproteins and selection by the immune system. In this way even within a year a virus might have drifted to such an extent that it can overcome the immune barrier of the host. After many years finally a strain might evolve that does not cross-react serologically at all and
TABLE 4 Base-Sequence Homology between 32P-Labeled vRNA Segments of Fowl Plague Virus (A/FPV/RostocW34 HavlN1) and cRNA of Different Influenza A Strains" Percent base-sequence homology.(melting point, "C) vRNA segments of FPV (gene products) cRNA of
1 (Pol 1)
4 (HA)
5 (NP)
6 (NA)
7 (M)
FPV (HavlN1) AJTurkey/Englandi63 (HavlNav3) A/Turkey/Oregoni71 (HavlNav2) A/Chicken/Germany/"N/49 (Hav2Neql) A/PlU8/34 (HON1) A/Singapore/l/57 (H2N2)
100 (870)
-b
100 (86.5") 90 (74")
100 (89") -
100 (86") -
100 (88.5")
-
43 (68")
-
-
-
-
27 (77")
-
-
90 (780)
30 (76") 31 (77")
75 (75.5")
15 (77.5")
a1 (720) -
-
-
a7 (810)
'' Expressed as percent RNase-resistant radioactivity after hybridization under saturation conditions, and melting points (in parentheses) of homologous and heterologous hybrid RNA in l x SSC in the presence of l% formaldehyde (Scholtissek et a1., 1976). The error width of the method is ? lo. * Dash indicates not done.
INFLUENZA VIRUS GENETICS
21
has a completely different base-sequence homology in the variable region. Such an end product of an antigenic drift would be a new influenza virus prototype. IX. Some Practical Applications
A. THE NEWPANDEMIC STRAIN (HlN1) FROM 1977 In 1977, a new pandemic strain was isolated in the USSR (AIUSSW 90/77, H l N l ) , which carries surface glycoproteins cross-reacting serologically with those of the pandemic strain prevailing between 1947 (FM1) and 1957 (Loy),before the new pandemic Singapore strain appeared (Zhdanovet al., 1978; Kendal et al., 1978b). The question now arises whether the former H l N l strain survived somewhere as such, or whether by recombination it changed its host range and, after about 30 years, by a second recombination with the prevailing pandemic strain regained its original host range and pathogenicity. Such a strain could now infect adults and children who never had contact with an H l N l virus before. This problem has been attacked using the technique of molecular hybridization. Figure 2 demonstrates that the RNA migration patterns of the new USSR strain and the FM1 virus from 1947 are quite different, indicating that there are at least some differences in base sequence. However, when the base-sequence homology is determined, 100% homology was found between all segments of these two strains when the normal hybridization technique was employed. Only when the hybrid molecules were heated close to the melting point in the presence of formaldehyde prior to RNase treatment could small differences in the genes coding for the HA and NA, but not of the other genes, be discovered (Table 5 ) . By this heating procedure any mismatched regions within a hybrid molecule will form a nucleation point for melting, which will be fixed by formaldehyde so that presumably even some point mutations will be recognized. It is shown in Table 5 that these differences can be seen only with the isolate from 1947 (FM1) and from 1957 (A/Loy/4/57,HlNl), but not with the FW strain isolated in 1950 (AIFort WarredMO, H l N l ) . Melting profiles of several RNA segments clearly have demonstrated that the new USSR strain is genetically almost identical with the FW strain, but can be differentiated from the FM1 and Loy strain. The greatest differences were found in the genes coding for the hemagglutinin and neuraminidase (Scholtissek et al., 1978a). Nakajima et al. (1978) came to identical conclusions by comparing oligonucleo-
22
CHRISTOPH SCHOLTISSEK
TABLE 5 Base-Sequence Homology between A/USSW90/77, AJFMi1/47, AIFWIli50, and A/Loyl4157"~~ CountsilO min after hybridization and RNase digestion 32P-labeledsegments of USSR cRNA of USSR FMI FW LOY
1
213
4
5
6
7
8
400 430 400 410
1290 1220 1290 1240
1210 1070 1220
430 420 440 420
2740 2380 2700 2480
1550 1550 1530 1540
1890 1810 1880 1850
1010
" The data were taken from Scholtissek et al. (1978a). 'All belong to the serotype H1N1. The base sequence homology is expressed as RNase-resistant radioactivity after hybridization of the 32P-labeled vRNA segments of the USSR strain. The hybrids were heated to 75°C in 1 x SSC containing 1%formaldehyde prior to RNase digestion in 2 x SSC.
tide maps of the vRNAs of the new pandemic H l N l strains of 1977 with those isolated in 1947 (FMl), 1950 (FW), and 1956 (A/C/1/56). The minimum number of base changes among large oligonucleotides of total vRNA of various isolates of 1950 and 1977 were between 5 and 9, while the minimum base changes compared to the isolates of 1947 and 1956 were in the range of 30. However, with this latter technique only a rather small fraction of the total genome is being analyzed (between 5 and 25%, depending on the size of the RNA molecule). This makes a quantitative evaluation somewhat difficult for such genes, which are supposed to have hot spots of mutation like the HA- and NA-RNA segments. Nevertheless, the techniques described here are sensitive enough to unravel differences in base sequence between influenza strains within a drift (e.g., FM1 -+ FW + Loy). However, it is still an open question how the FW strain could survive in nature for 27 years without further drift. It should be mentioned, however, that significant antigenic drifts so far are to be found only with human influenza strains, not with animal viruses. One observation is important in this context: As shown in Fig. 2, the RNA patterns of the FM1 and the USSR strains are different in respect to four RNA segments, although these two strains are highly related in all segments in terms of their base sequences (Table 5). There is no significant difference in the RNA pattern between the FW and USSR strain (Scholtissek et al., 1978a). Similar observations in respect to the RNA patterns have been done with several swine influenza viruses isolated from pigs and man; and it has been suggested to use such comparative studies as an epidemiological tool (Palese and Ritchey,
INFLUENZA VIRUS GENETICS
23
1977a; Hinshaw et al., 1978): If two RNA patterns of different isolates of the same subtype are absolutely identical, there is a high probability that they are also genetically identical. If the patterns are different, however, the differences in the base sequence have to be quantitated by another method. B. HOST-RANGE RECOMBINANTS As mentioned above, one possible mechanism for the survival of a human pandemic strain in a n animal reservoir would be to change by recombination the host range, and by a second recombination after many years the strain might reappear in the original host. This problem has been studied in our laboratory using FPV as a model system. Recently it was shown that ts mutants of FPV carrying a defect in the gene coding for the NP could not be rescued by the Hong Kong virus, while rescue with other prototype strains was possible. These experiments were performed on chick embryo cells, and it was concluded that the gene coding for the NP of the Hong Kong virus in any combination with segment 4 of FPV would not be compatible for these host cells (Scholtissek and Bowles, 1975). Therefore, the rescue experiments were repeated on MDCK cells, on which FPV also forms plaques (Scholtissek and Murphy, 1978). After double infection of MDCK cells with ts 19 or ts 81 of FPV, which have a defect in segment 5 , and Hong Kong a t 39°C plaque formers were indeed obtained that could be purified and did not form plaques on chick embryo cells. One of these isolates (81/HO), which carries the hemagglutinin of FPV, was studied in more detail. It synthesized normal yields of viral RNA polymerase and cRNA in chick embryo cells; however, only little hemagglutinin or neuraminidase were produced. Thus, this recombinant of FPV had lost its capacity to multiply on the original host of the wild type. At the same time pathogenicity for fowl also was lost. This recombinant was then used for a second recombination with completely unrelated influenza A strains, like the equine 2 (Heq2Neq2) strain or virus N (HavBNeql). After double infection of chick embryo cells with 81/HO and the above-mentioned prototype strains, which each by itself does not form plaques on these host cells, again plaque formers were obtained. These new recombinants had mixed genomes, carrying segments of all three parent strains; for example, one isolate carried segment 1 of the Hong Kong virus, segments 2 , 3 , 5 , 6 ,and 8 of virus N, and segments 4 and 7 of FPV. This isolate also had regained pathogenic properties for fowls. For comparison, a recombinant with the same gene constellation, except for segment 1, which was also
24
CHRISTOPH SCHOLTISSEK
derived from FPV, was still completely apathogenic for fowls (Scholtissek et al., 1978b). Thus, if we can change the host range by recombination in the test tube, and regain the original host range by a second recombination, why should nature not take advantage of this possibili ty? Schulman and Palese (1977) recently found the neuraminidase (NA) of the WSN (HON1) strain to be responsible for the cleavage of the hemagglutinin (HA) into HA1 and HA2 and therefore for plaque formation on MDBK cells. Thus, if by recombination a strain that normally does not form plaques on MDBK cells gains the NA gene of the WSN strain, it is converted to a plaque former on this host. Here the situation is the opposite of that described for the FPV system. By ts king over the NA gene from the WSN virus a strain can gain a new host range. C. HOST-RANGE MUTANTS Since host range can be affected by recombination, it might be expected that also mutations influence host range. Therefore the ts mutants of FVP available in our laboratory were studied also on MDCK cells, on which the wild-type FPV forms plaques. During this investigation it was found that all four ts mutants studied with a lesion in the polymerase 1 gene (see Fig. 1) were either unable to form plaques a t the permissive temperature on MDCK cells or formed only minute plaques ( G 0.1 mm in diameter) after 6 days’ incubation a t 33°C. The same was found with the two ts mutants studied carrying a lesion in the transport gene (see Fig. 1).Revertants of these ts mutants, which were isolated from plaques formed at 40°C on chick embryo cells, again were able to form normal plaques like the wild type. This covariation of the t s character and the host range phenotypes suggests that the mutation responsible for these two phenotypes is the same. Ts mutants of the other recombination groups formed normal plaques on MDCK cells at 33°C (Scholtissek and Murphy, 1978). Almond (1977) has studied recently a variant of FPV, that was adapted to form plaques on BHK cells (Dobson strain). The gene responsible for this kind of host-range mutation was found to be the P2 gene (Almond et al., 19771,which corresponds to the polymerase 2 gene (see Fig. 1 and Table 2). It is interesting to note that all these hostrange mutations are somehow correlated with subunits of the RNA polymerase complex. For MDCK cells the mutations seem to be located exclusively in the genes coding for the polymerase 1 and the transport
INFLUENZA VIRUS GENETICS
25
proteins, but not polymerase 2 protein, whereas for BHK cells, host range might be correlated rather with the polymerase 2 gene. Obviously more mutants of these types should be tested before one can generalize such a concept. However, if this concept is correct, we have to assume that a host-specificfactor is involved in viral RNA synthesis. This would also explain the specific sensitivity of influenza multiplication to actinomycin D (Barry et d., 19621, pretreatment of the host cell by UV irradiation (Barry, 19641, a-amanitin (Rott and Scholtissek, 19701, and removal of the cell nucleus (Follet et al., 1974; Kelley et al., 1974). [For more detailed reviews on this matter, see Scholtissek and Klenk (1975) and Scholtissek (19781.1
D. AMANTADINE RESISTANCE AS
A
GENETIC MARKER
There exist a number of drugs by which virus multiplication can be inhibited, and drug-resistant mutants have been isolated. For example, influenza virus multiplication can be affected by amantadine (1adamantanamine) in a very early step, presumably during uncoating (Davis et al., 1964; Kato and Eggers, 1969; Dourmashkin and Tyrrell, 1974; Skehel et al., 1977). There is a great variation in the susceptibility of different influenza strains against this drug (Davies et al., 1964; Neumayer et al., 1965; Schild and Sutton, 19651, and amantadineresistant variants can be isolated by passaging sensitive strains in the presence of the drug (Cochran et al., 1965; Oxford et al., 1970). More recently it has been shown that amantadine resistance can be used as a genetic marker (Tuckova et al., 1973; Appleyard and Marber, 1975). If it is possible to determine which gene or gene constellation is important for the transfer of resistance, one should be able to understand the mechanism of action. Appleyard (1977) has shown recently, using a plaque-reduction test with recombinants between several sensitive and resistant strains, that amantadine resistance is not connected with either of the surface antigens. As found by Lubeck et al. (1978) and Hay et al. (1979) with human influenza strains, amantadine resistance is correlated with the gene coding for the M protein. If the effect of amantadine is tested in a single-cycle experiment, various strains are found to be highly sensitive, which in the plaque-reduction test were completely resistant like, for example, FPV (Scholtissek and Faulkner, 1979). Thus amantadine may exert its inhibiting effect on different steps in virus multiplication, which might be controlled by different genes.
26
CHRISTOPH SCHOLTISSEK
E. POSSIBLE APPLICATION OF RECOMBINANTS AND TEMPERATUREFOR PRODUCTION OF LIVEVACCINES SENSITIVE MUTANTS Several recombinants between the avirulent PR8 (HON1) strain and the virulent H3N2 strain were found to be apathogenic for man. There seems to be a correlation between loss of pathogenicity and number of genes derived from PR8 in the recombinants (Florent et al., 1977). Six such recombinants have been analyzed to date for their gene constellation, except for the gene coding for the M protein (Oxford et al., 1978). A more thorough study on the correlation between the gene constellation and pathogenicity was performed with recombinants of FPV (Scholtissek et al., 1977c; Rott et al., 1978). It was found that loss of pathogenicity depends on the parent strain from which the corresponding RNA segment(s1 is derived as well as which RNA segmentis) is exchanged. Thus, there does not exist a specific gene or genes responsible for pathogenicity, but the gene constellation determines pathogenicity, which is different for different virus strains. In the recombination system of the virulent A/turkey/Ontario/7732/ 66 (Hav5Nav6) strain and the avirulent A/WSN/33 (HONl) strain, all seven recombinants carrying segments 3 and 5 (P2 and NP) of the turkey strain were found to be virulent, while in all four avirulent recombinants, both these segments were from WSN (Bean and Webster, 1978; Webster and Bean, 1978). In a defined system in which both parents did not exhibit neurovirulence for mice, like FPV and A/England/l/61 (H2N2), neurovirulent recombinants could be obtained (Vallbracht et al., 1979) for which the specific gene constellation involved in neurovirulence has been determined (Rott et al., 1978). On the other hand, recombination between two strains highly pathogenic for fowls (FPV and A/turkey/England/ 63; HavlNav3) led to the isolation of completely apathogenic recombinants, for which the gene constellation is known (Rott et al., 1979). For two strains that are genetically relatively little related, for example, FPV and PR8 (Scholtissek et al., 19761, it is relatively easy to find a correlation between the gene constellation and pathogenicity of recombinants, since only a few of the theoretically possible 254 recombinants are compatible for a certain tissue culture cell or host. With the highly related strains like FPV and turkey England (HavlNav31, many of the possible recombinants are compatible for primary chick embryo cells and fowls, and, therefore, it is almost impossible to find a clear correlation between gene constellation and loss of pathogenicity. Thus, there exists the possibility of obtaining recombinants that might be used as live vaccines, starting with either one pathogenic and
INFLUENZA VIRUS GENETICS
27
one apathogenic strain or with two highly pathogenic viruses. On the other hand, recombination with two apathogenic parents can lead to highly virulent isolates, which emphasizes the danger of producing recombinants. The lack of a specific marker gene and the lack of any rule for finding apathogenic recombinants makes it extremely difficult to search for live vaccine strains for man. Temperature-sensitive (ts) mutants might also be used for vaccination, since they are supposed to grow to sufficiently high titers in the upper respiratory tract (32"-34"C) to stimulate local and systemic immunity, whereas in the lower respiratory tract (37°C)these mutants do not multiply. Chanock and his colleagues have isolated several ts mutants that are suitable for this purpose, since the reversion rate is low enough, and the genes carrying the ts lesion can be transferred easily by recombination to other influenza strains (Mills and Chanock, 1971; Murphy et al., 1972, 1973, 1975, 1976, 1978a,b; Spring et al., 1975a,b). The location of ts mutations of one of these recombinants has been found to be in the genes coding for the P3 and NP (Palese and Ritchey, 1977b). Another similar approach is the isolation of cold-adapted influenza strains. Such strains might also be used for recombination with prevailing pandemic strains for the production of live vaccines (Maassab, 1967, 1969, 1975; Maassab et al., 1978). A genetic analysis of the original parent cold-adapted strain and recombinants thereof has been performed recently (Spring et al., 1977a,b; Kendal et al., 1977). These strains have multiple ts and non-ts lesions and therefore are unlikely to revert to the parent wild type. None of the proposed vaccines are yet in use; however, they are being investigated in trials on animals or volunteers.
X. Concluding Remarks
Influenza viruses have one very remarkable prQperty that is not shared with most of the other viruses; that is their high antigenic variability, by which the virus is able to overcome the immune system of the host. In this chapter mechanisms have been proposed by which the two types of variation, the antigenic drift and shift, might be explained on a molecular level: The genes coding for the surface glycoproteins have in addition to a small highly conserved region(s) a relatively large highly variable region(s1. The conserved part of these genes presumably is involved in the functional integrity of the gene
28
CHRISTOPH SCHOLTISSEK
product; this means receptor function for the hemagglutinin and enzyme activity for the neuraminidase. In this region most mutations would lead to loss of the function. The variable parts of the genes are assumed to be involved in the immunological properties of their gene products. Mutations in these regions will not affect the function. In this way the gene products can drift finally to such an extent that serologically completely unrelated surface glycoproteins evolve within a rather short time. This kind of evolution is facilitated by the segmented genome, since, if these genes were part of a large RNA molecule, many mutations in one region might have polar effects on the neighboring genes. In any case, the creation of antigenically new strains by reassortment (shift) could not be expected in viruses with an unsegmented genome. Recently, two other virus families carrying single-stranded RNA have been found to have a segmented genome, the bunya and arena viruses. It remains to be tested whether the genes coding for their glycoproteins also are composed of variable and conserved regions and whether the model proposed for influenza viruses can be generalized. Viruses having a segmented genome like influenza seem to have an advantage over those containing an unsegmented genome, since the former have a simple mechanism to overcome the immune barrier of their hosts. However, viruses with a segmented genome have to develop a method for selecting the correct number and order of RNA segments to form infectious progeny. In this sense a segmented genome might be disadvantageous for a virus. Up to now the mechanisms by which the various segments of influenza viruses are selected and packaged is not known. It is, therefore, interesting to note that a putative partial heterozygote has been isolated recently, which carries segments 3 and 6 of FPV as well as of virus N. It is assumed that this partial heterozygote has a defect in the mechanism of selecting the right number of RNA segments (Scholtissek et al., 1978d). For studying this phenomenon more such heterozygotes will be needed.
ACKNOWLEDGMENTS The work from the author’s laboratory discussed in this chapter was supported by the Sonderforschungsbereich 47. I thank Dr. R. Rott and Dr. R. R. Friis for many stimulating discussions and for help during the preparation of the manuscript.
REFERENCE s Almond, J. W. (1977). A single gene determines the host range of influenza. Nature (London) 270, 617-618. Almond, J. W., McGeoch, D., and Barry, R. D. (1977). Method for assigning
INFLUENZA VIRUS GENETICS
29
temperature-sensitive mutants of influenza viruses to individual segments of the genome. Virology 81, 62-73. Appleyard, G. (1977). Amantadine-resistance as genetic marker for influenza viruses. J . Gen. Virol. 36, 249-255. Appleyard, G., and Maber, H. B. (1975). A plaque assay for the study of influenza virus inhibitors. J . Antimicrob. Chemother. 1, Suppl., 49-53. Baker, N., Stone, H. O., and Webster, R. G. (1973). Serological cross-reactions between the hemagglutinin subunits of HONl and H l N l influenza virus detected with monospecific antisera. J . Virol. 11, 137-140. Barry, R. D. (1964). The effects of actinomycin D and ultraviolet irradiation on the production of fowl plague virus. Virology 24, 563-569. Barry, R. D., Ives, D. R., and Cruickshank, J. G. (1962). Participation of deoxyribonucleic acid in the multiplication of influenza virus. Nature (London) 194, 1139-1140. Barry, R. D., Almond, J. W., Inglis, S. C., and Mahy, B. W. J. (1979). The structure of the influenza virus genome. Symp. Mol. Bwl. Influenza Hepatitis Viruses, 1978 (in press). Bean, W. J., and Simpson, R. W. (1973). Primary transcription of the influenza virus genome in permissive cells. Virology 56, 646-651. Bean, W. J., and Simpson, R. W. (1976). Transcriptase activity and genome composition of defective influenza virus. J . Virol. 18, 365-369. Bean, W. J., and Webster, R. G. (1978). Phenotypic properties associated with influenza genome segments. In “Negative Strand Viruses and the Host Cell” (B. W. J. Mahy and R. D. Barry, eds.), pp. 685-692. Academic Press, New York. Bosch, F. X., Hay, A. J., and Skehel, J. J. (1978). RNA and protein synthesis in a permissive and an abortive influenza virus infection. In “Negative Strand Viruses and the Host Cell” (B. W. J. Mahy and R. D. Barry, eds.), pp. 465-474. Academic Press, New York. Burnet, F. M. (1959). Genetic interactions between animal viruses. In “The Viruses” F. M. Burnet and W. M. Stanley, eds.), Vol. 3, pp. 275306. Academic Press, New York. Chanock, R. M., Cockburn, W. C., Davenport, F. M., Dowdle, W. R., Fazekas de St. Groth, S., Fukuzai, H., Kilbourne, E. D., Schild, G. C., Schulman, J. L., Sohier, R., Soloviev, V. D., Tumova, B., Webster, R. G., Zakstelskaya, L. J. A,, and Zhdanov, V. M. (1972). A revised system of nomenclature for influenza viruses. Bull. W.H.O. 45,119-124. Choppin, P. W., and Compans, R. W. (1975). The structure of influenza virus. I n “The Influenza Viruses and Influenza” (E. D. Kilbourne, ed.), pp. 15-51. Academic Press, New York. Cochran, K. W., Maassab, H. F., Tsunoda, A,, and Berlin, B. S. (1965). Studies on the antiviral activity of amantadine hydrochloride. Ann. N . Y.Acad. Sci. 130,432-439. Cox, N. J., and Kendal, A. P. (1978). Effect oftemperature on the order ofelectrophoretic migration of influenza virus neuraminidase and nucleoprotein genes in acrylamide gels lacking denaturing agents. J . Gen. Virol. 40, 229-232. Davenport, F. M., Rott, R., and Schafer, W. (1960). Physical and biological properties of influenza virus components obtained after ether treatment. J . Erp. Med. 112,767782. Davis, W. L., Grunert, R. R., Haff, R. F., McGahen, J. W., Neumayer, E. M., Paulshock, M., Watts, J. C., Wood, T. R., Herrmann, E. C., and Hoffmann, C. E. (1964). Antiviral activity of 1-adamantanamine (amantadine). Science 144, 862-863. Desselberger, U., and Palese, P. (1978).Molecular weights of RNA segments of influenza A and B viruses. Virology 88, 394-399. Desselberger, U., Nakajima, K., Alfino, P., Pedersen, F. S., Haseltine, W. A., Hannoun,
30
CHRISTOPH SCHOLTISSEK
C., and Palese, P. (1978). Biochemical evidence that “new” influenza virus strains in nature may arise by recombination (reassortment).Proc. Natl. Acad. S C LU.S.A. . 75, 3341-3345. Dourmashkin, R. R., and Tyrrell, D. A. J. (1974). Electron microscopic observations on the entry of influenza virus into susceptible cells. J . Gen. Virol 24, 129-141. Duesberg, P. H. (1968). The RNAs of influenza virus. Proc. Natl. Acad. SCL.U.S.A. 59, 930-937. Etkind, P. R., Buchhagen, D. L., Herz, C., Broni, B. B., and Krug, R. M. (1977). The segments of the influenza mRNA. J . Virol. 22, 34G-352. Florent, G., Lobmann, M., Beare, A. S., and Zygraich, H. (1977). RNAs of influenza virus recombinants derived from parents of known virulence for man. Arch. Virol. 54, 19-28. Floyd, R. W., Stone, M. P., and Joklik, W. K. (1974). Separation of single-stranded ribonucleic acids by acrylamide-agarose-urea gel electrophoresis. Anal. Riochem. 59, 599-609. Follett, E. A. C., Pringle, C. R., Wunner, W. H., and Skehel, J. J. (1974). Virus replication in enucleated cells: Vesicular stomatitis virus and influenza virus. J . Virol. 13, 394-399. Ghendon, Y. Z., Markushin, S. G., Marchenko, A. T., Sitnikov, B. S., and Ginzburg, V. P. (1973). Biochemical characterization of fowl plague virus ts mutants. Virology 55, 305- 3 19. Ghendon, Y.Z., Markushin, S. G., Blagavezhenskaya, 0. V., and Genkina, D. B. (1975). Study of fowl plague virus RNA synthesis in temperature-sensitive mutants. Virology 66, 454-463. Harms, E., Rohde, W., Bosch, F., and Scholtissek, C. (1978). Biochemical studies on influenza viruses. 11. Assignment of gene functions to RNA segments 5, 7, and 8 of fowl plague virus and virus N. Virology 86, 413-422. Hay, A. J., Abraham, G., Skehel, J. J., Smith, S. C . , and Fellner, P. (1977a). Influenza virus messenger RNAs are incomplete transcripts of the genome RNAs. Nucleic Acids Res. 4, 4197-4209. Hay, A. J., Lomniczi, B., Bellamy, A. R., and Skehel, J. J. (1977b). Transcription of the influenza virus genome. Virology 83, 337-355. Hay, A. J.,Kennedy, N. C . T., Skehel, J. J., and Appleyard, G . (1979). The matix protein gene determines amantadine-sensitivity of influenza viruses. J . Gen. Virol. 42, 189- 191. Heller, E., and Scholtissek, C. (1979). In preparation. Henle, W., Liu, 0. C. (1951). Studies of host-virus interactions in the chick embryoinfluenza virus system. VI. Evidence for multiplicity reactivation. J . Exp. Med. 94, 305-322. Hinshaw, V. S., Bean, W. J., Webster, R. G., and Easterday, B. C. (1978). The prevalence of influenza viruses in swine and the antigenic and genetic relatedness of influenza viruses from man and swine. Virology 84, 51-62. Hirst, G. K. (1962). Genetic recombination with Newcastle disease virus, poliovirus and influenza. Cold Spring Harbor Symp. Quant. Biol. 27, 303-309. Hirst, G. K. (1973). Mechanism of influenza virus recombination. I. Factors influencing recombination rates between temperature-sensitive mutants of strain WSN and the classification of mutants into complementation-recombination groups. Virology 55, 81-93. Inglis, S. C., Carroll, A. R., Lamb, R. A,, and Mahy, B. W. J. (1976). Polypeptides specified by the influenza virus genome. 1. Evidence for eight distinct gene products specified by fowl plague virus. Virology 74, 489-503.
INFLUENZA VIRUS GENETICS
31
Inglis, S. C., McGeoch, D. J., and Mahy, B. W. J. (1977). Polypeptides specified by the influenza virus genome. 2. Assignment of protein coding functions to individual genome segments by in uitro translation. Virology 78, 522-536. Inglis, S. C., Conti, G., and Mahy, B. W. J. (1978). Control of influenza virus polypeptide synthesis. In “Negative Strand Viruses and the Host Cell” (B. W. Mahy and R. D. Barry, eds.), pp. 239-248. Academic Press, New York. Kato, N., and Eggers, H. J. (1969). Inhibition of uncoating of fowl plague virus by 1-adamantanamine hydrochloride. Virology 37,632-641. Kelly, D. C., Avery, R. J., and Dimmock, N. J. (1974). Failure of an influenza virus to initiate infection in enucleate BHK cells. J . Virol. 13, 1155-1161. Kendal, A. P., Cox, N. J., Murphy, B. R., Spring, S. B., and Maassab, H. F. (1977). Comparative studies of wild-type and ‘cold-mutant’ (temperature sensitive) influenza viruses: Genealogy of the matrix (M) and non-structural (NS) proteins in recombinant cold-adapted H3N2 viruses. J . Gen. Virol. 37, 145- 159. Kendal, A. P., Cox, N. J., Spring, S. B., and Maassab, H. F. (1978a). Biochemical characteristics of recombinant viruses derived at sub-optimal temperatures: Evidence that ts-lesions are present in RNA segments l and 3, and that RNA l codes for the virion transcriptase enzyme. In “Negative Strand Viruses and the Host Cell” (B. W. J. Mahy and R. D. Barry, eds.), pp. 733-743. Academic Press, New York. Kendal, A. P., Noble, G. R., Skehel, J. J., and Dowdle, W. R. (1978b). Antigenic similarity of influenza A (HlN1) viruses from epidemics in 1977-78 t o “Scandinavian” strains isolated in epidemics of 1950-51. Virology 89, 632-636. Konnecke, I., and Scholtissek, C. (1979). In preparation. Krug, R. M., Ueda, M., and Palese, P. (1975). Temperature-sensitive mutants of influenza WSN virus defective in virus specific RNA synthesis. J . Virol. 16, 790796. Krug, R. M., Morgan, M. M., and Shatkin, A. J. (1976). Influenza viral messenger RNA contains internal N6-methyladenosine and 5’-terminal 7-methylguanosine in cap structures. J . Virol. 20, 45-53. Lamb, R. A,, and Choppin, P. W. (1977). Synthesis of influenza virus polypeptides in cells resistant to alpha-amanitin: Evidence for the involvement of cellular RNA polymerase I1 in virus replication. J . Virol. 23, 8 1 6 8 1 9 . Laver, W. G., and Webster, R. G. (1973). Studies on the origin ofpandemic influenza. 111. Evidence implicating duck and equine influenza viruses as possible progenitors of the Hong Kong strain of human influenza. Virology 51, 383-391. Lewandowski, L. J., Content, J., and Leppla, S. H. (1971). Characterization of the subunit structure of the ribonucleic acid genome of influenza virus. J . Virol. 8, 701- 707, Lohmeyer, J., and Klenk, H. D. (1979).A mutant of influenza virus with a temperaturesensitive defect in the posttranslational processing of the hemagglutinins. Virology 93, 134-145. Lubeck, M. D., Schulman, J. L., and Palese, P. (1978). Susceptibility of influenza A viruses to amantadine is influenced by the gene coding for M protein. J . Virol. 28, 710-716. Maassab, H. F.(1967). Adaptation and growth characteristics of influenza virus a t 25°C. Nature (London) 213,612-614. Maassab, H. F. (1969). Biologic and immunologic characteristics of cold adapted influenza virus. J . Immunol. 102, 145-157. Maassab, H. F. (1975). Properties of influenza virus “cold” recombinants. In “Negative Strand Viruses” (B. W. J. Mahy and R. D. Barry, eds.), Vol. 2, pp. 755-763. Academic Press, New York.
32
CHRISTOPH SCHOLTISSEK
Maassab, H. F., Spring, S. B., Kendal, A. P., and Monto, A. S . (1978). Biologic characteristics of influenza virus recombinants derived at suboptimal temperatures. In “Negative Strand Viruses and the Host Cell” (B. W. J. Mahy and R. D. Barry, eds.), pp. 721-732. Academic Press, New York. McGeoch, D., Fellner, P., and Newton, C. (1976). Influenza virus genome consists ofeight distinct RNA species. Proc. Natl. Acad. Sci. U.S.A. 73, 3045-3049. Mackenzie, J. S. (1970). Isolation of temperature-sensitive mutants and the construction of a preliminary genetic map of influenza virus. J . Gen. Virol. 6,63-75. Mackenzie, J. S., and Dimmock, N. J. (1973). A preliminary study of physiological characteristics of temperature-sensitive mutants of influenza virus. J . Gen. Virol. 19, 51-63. Markushin, S. G., and Ghendon, Y. Z. (1973). Genetic classification and biological properties of temperature-sensitive mutants of fowl plague virus. Acta Virol. Engl. Ed. 17, 369-376. Mikhejeva, A., Melnikov, S., Ginzburg, V., and Ghendon, Y. (1978). Isolation and purification of influenza virus mRNA coding for M protein. Virology 84, 227-229. Mills, J. V., and Chanock, R. M. (1971). Temperature-sensitive mutants of influenza virus. I. Behavior in tissue culture and in experimental animals. J . Infect. Dis. 123, 145- 157. Moss, B., Keith, J. M., Gershowitz, A,, Ritchey, M. B., and Palese, P. (1978). Common sequences at the 5’ ends of the segmented RNA genomes of influenza A and B viruses. J . Virol. 25, 312-318. Mowshowitz, S . L., and Ueda, M. (1976). Temperature-sensitive virion transcriptase activity in mutants of WSN influenza virus. Arch. Virol. 52, 135-141. Murphy, B. R., Chalub, E. G., Nusinoff, S. R., and Chanock, R. M. (1972). Temperaturesensitive mutants of influenza virus. 11. Attenuation of ts recombinants for man. J . Infect. Dis. 126, 170-178. Murphy, B. R., Chalub, E. G., Nusinoff, S. R., Kasel, J., and Chanock, R. M. (1973). Temperature-sensitive mutants of the ts-1 [El influenza A recombinant (H3N2) virus in man. J . Infect. Dis. 128, 479-487. Murphy, B. R., Spring, S . B., Richman, D. D., Tierney, E. L., Kasel, J., and Chanock, R. M. (1975). Temperature-sensitive mutants of influenza virus. VII. Transfer of the ts-1 [El lesions to a wild type influenza virus with the HONl surface antigens. Virology 66,533-541. Murphy, B. R., Tierney, E. L., Spring, S. B., and Chanock, R. M. (1976). Temperaturesensitive mutants of influenza A virus. XI. Transfer of ts lesions in the Hong Kong/68-ts-l [A] virus to the influenza NUdord72 wild type. J. Infect. Dis. 134, 577- 584. Murphy, B. R., Wood, F. T., Massicot, J. G., Spring, S. B., and Chanock, R. M. (1978a). Temperature-sensitive mutants of influenza virus. XV. The genetic and biological characterization of a recombinant influenza virus containing two ts lesions produced by mating two complementing, single lesion t s mutants. Virology 88, 231-243. Murphy, B. R., Wood, F. T., Massicot, J. G., and Chanock, R. M. (1978b). Temperaturesensitive mutants of influenza virus. XVI. Transfer of the two ts lesions present in the Udorn/72-ts-l A2 donor virus to the Victorid3/75 wild type virus. Virology 88, 246251. Nakajima, K., and Sugiura, A. (1977). Isolation of an influenza virus temperaturesensitive mutant of a new recombination-complementation group. Virology 78, 365-3 74. Nakajima, K., Desselberger, U., and Palese, P. (1978). Recent human influenza A
INFLUENZA VIRUS GENETICS
33
(HlN1) viruses are closely related genetically to strains isolated in 1950. Nature (London) 274, 3 3 6 3 3 9 . Neumayer, E. M., Haff, R. F., and Hoffmann, C. E. (1965). Antiviral activity of amantadine hydrochloride in tissue culture and in ovo. Proc. SOC.Exp. Biol. Med. 119, 393-396. Oxford, J. S., Potter, C. W., and Logan, I. S. (1970). Passage of influenza strains in the presence of amino-adamantane. Ann. N . Y . Acad. Sci. 173, 300-313. Oxford, J. S., McGeoch, D. J., Schild, G. C., and Beare, A. S. (1978). Analysis of virion RNA segments and polypeptides of influenza A virus recombinants of defined virulence. Nature (Lonabn) 273, 7 7 a 7 7 9 . Palese, P. (1977). The genes of influenza virus. Cell 10, 1-10, Palese, P., and Ritchey, M. B. (1977a). Polyacrylamide gel electrophoresis of the RNAs of new influenza virus strains: An epidemiological tool. Znt. Syrnp. Influenza Zrnrnunization, 2nd, 1977. Deu. Biol. Stand. 39, 411-415. Palese, P., and Ritchey, M. B. (1977b). Live attenuated influenza virus vaccines. Strains with temperature-sensitive defects in P 3 protein and nucleoprotein. Virology 78, 183- 191. Palese, P., and Schulman, J. L. (1976a). Differences in RNA patterns of influenza A viruses. J . Virol. 17, 87G884. Palese, P., and Schulman, J. L. (1976b). Mapping of the influenza virus genome: Identification of the hemagglutinin and the neuraminidase genes. Proc. Natl. Acad. Sci. U.S.A. 73, 2142-2146. Palese, P., Tobita, K., Ueda; M., and Compans, R. W. (1974). Characterization of temperature-sensitive influenza virus mutants defective in neuraminidase. Virology 61, 397-410. Palese, P., Ritchey, M. B., and Schulman, J. L. (1977a).P1 and P3 proteins of influenza virus are required for complementary RNA synthesis. J . Virol. 21, 1187-1195. Palese, P., Ritchey, M. B., and Schulman, J. L. (1977b). Mapping of the influenza genome. 11. Identification of the P1, P2 and P3 genes. Virology 76, 1 1 6 1 2 1 . Pons, M. W. (1973). The inhibition of influenza virus RNA synthesis by actinomycin D and cycloheximide. Virology 51, 120-128. Pons, M. W. (1976). A reexamination of influenza single- and double-stranded RNA by gel electrophoresis. Virology 69, 78G792. Pons, M. W. (1977). Early RNA synthesis in influenza virus-infected cells. Virology 76, 855-859. Pons, M. W., and Hirst, G. K. (1968). Polyacrylamide gel electrophoresis of influenza virus RNA. Virology 34, 385-388. Racaniello, R., and Palese, P. (1978). The genes of influenza virus: Analysis of influenza B virus strains. Zn “Negative Strand Viruses and the Host Cell” (B. W. J. Mahy and R. D. Barry, eds.), pp. 27-36. Academic Press, New York. Ritchey, M. B., and Palese, P. (1977). Identification of the defective genes in three mutant groups of influenza virus. J . Virol. 21, 119G1204. Ritchey, M. B., Palese, P., and Kilbourne, E. D. (1976a). RNAs of influenza A, B, and C viruses. J . Virol. 18,7 3 a 7 4 4 . Ritchey, M. B., Palese, P., and Schulman, J. L. (1976bf. Mapping of the influenza genome. 111. Identification of the genes coding for nucleoprotein, membrane protein and nonstructural protein. J . Virol. 20, 307-313. Rohde, W., Harms, E., and Scholtissek, C. (1977). Biochemical studies on influenza viruses. I. Comparative analysis of equine 2 virus and virus N genes and gene products. Virology 79, 393-404.
34
CHRISTOPH SCHOLTISSEK
Rott, R., and Klenk, H.-D. (1977). Structure and assembly of viral envelopes. In “Virus Infection and the Cell Surface” (G. Poste and G. L. Nicolson, eds.), pp. 47-81. Elsevier, Amsterdam. Rott, R., and Scholtissek, C. (1970). Specific inhibition of influenza replication by a-amanitin. Nature (London) 228, 56. Rott, R., Scholtissek, C., Klenk, H.-D., and Orlich, M. (1978). Structure and pathogenicity of influenza viruses. I n “Negative Strand Viruses and the Host Cell” (B. W. J. Mahy and R. D. Barry, eds.), pp. 653-662. Academic Press, New York. Rott, R., Orlich, M., and Scholtissek, C. (1979). Correlation of pathogenicity and gene constellation of influenza A viruses. 111,Non-pathogenic recombinants derived from highly pathogenic parent strains. J . Gen. Virol. (in press). Schild, G. C. (1970). Studies with antibody to the purified hemagglutinin of an influenza A 0 virus. J . Gen. Virol. 9, 191-200. Schild, G . C., and Sutton, R. N. S. (1965). Inhibition of influenza viruses in uitro and in vivo by 1-adamantanamine hydrochloride. Br. J . Exp. Pathol. 46, 263-273. Scholtissek, C. (1978). The genome of the influenza virus. Curr. Top. Microbiol. Immunol. 80, 139-169. Scholtissek, C. (1979). The genes coding for the surface glycoproteins of influenza A viruses contain a small conserved and a large variable region. Virology 93, 594597. Scholtissek, C., and Bowles, A. L. (1975). Isolation and characterization of temperaturesensitive mutants of fowl plague virus. Virology 67, 576-587. Scholtissek, C., and Faulkner, G . P. (1979). Amantadine-resistant and sensitive influenza A strains and recombinants. J . Gen. Virol. (in press). Scholtissek, C., and Klenk, H.-D. (1975). Influenza virus replication. In “The Influenza Viruses and Influenza” (E. D. Kilbourne, ed.), pp. 215-242. Academic Press, New York. Scholtissek, C., and Murphy, B. R. (1978). Host range mutants of an influenza A virus. Arch. Virol. 58, 323-333. Scholtissek, C., and Rott, R. (1964). Behavior of virus-specific activities in tissue cultures infected with myxoviruses after chemical changes of the viral ribonucleic acid. Virology 22, 169-176. Scholtissek, C., and Rott, R. (1969). Hybridization studies with influenza virus RNA. Virology 39, 400-407. Scholtissek, C., and Rott, R. (1970). Synthesis in vivo of influenza virus plus and minus strand RNA and its preferential inhibition by antibiotics. Virology 40, 989-996. Scholtissek, C., Kruczinna, R., Rott, R., and Klenk, H.-D. (1974). Characteristics of an influenza mutant temperature-sensitive for viral RNA synthesis. Virology 58,317322. Scholtissek, C., Harms, E., Rohde, W., Orlich, M., and Rott, R. (1976). Correlation between RNA fragments of fowl plague virus and their corresponding gene functions. Virology 74, 332-344. Scholtissek, C., Rohde, W., and Harms, E. (1977a). Genetic relationship between an influenza A and a B virus. J . Gen. Virol. 37, 243-247. Scholtissek, C., Rohde, W., Harms, E., and Rott, R. (1977b).Correlation between the base sequence homology of RN-4 segment 4 and antigenicity of the hemagglutinin of influenza viruses. Virology 79, 330-336. Scholtissek, C., Rott, R,, Orlich, M., Harms, E., and Rohde, W. (1977~).Correlation of pathogenicity and gene constellation of an influenza A virus (fowl plague). I. Exchange of a single gene. Virology 81, 74-80.
INFLUENZA VIRUS GENETICS
35
Scholtissek, C., von Hoyningen, V., and Rott, R. (1978a). Genetic relatedness between the new 1977 epidemic strains (HlN1) of influenza and human influenza strains isolated between 1947 and 1957 ( H l N l ) . Virology 89, 613-617. Scholtissek, C., Koennecke, I., and Rott, R. (1978b). Host range recombinants of fowl plague (influenza A) virus. Virology 91,79-85. Scholtissek, C., Rohde, W., von Hoyningen, V., and Rott, R. (1978~). On the origin of the human influenza virus subtypes H2N2 and H3N2. Virology 87, 13-20. Scholtissek, C., Rohde, W., Harms, E., Rott, R., Orlich, M., and Boschek, C. B. (19788. A possible partial heterozygote of a n influenza A virus. Virology 89, 506-516. Schulman, J. L., and Palese, P. (1976). Selection and identification of influenza virus recombinants of defined genetic composition. J . Virol. 20, 248-254. Schulman, J. L., and Palese, P. (1977). Virulence factors of influenza A viruses: WSN virus neuraminidase required for productive infection in MDBK cells. J . Virol. 24, 170- 176. Simpson, R. W., and Bean, J. W. (1975). The biologically active proteins of influenza virus. Influenza transcriptase activity of cells and virions. In “The Influenza Viruses and Influenza” (E. D. Kilbourne, ed.), pp. 125-143. Academic Press, New York. Simpson, R. W., and Hirst, G. K. (1968). Temperature-sensitive mutants of influenza A virus: Isolation of mutants and preliminary observations on genetic recombination and complementation. Virology 35, 41-49. Skehel, J. J. (1972). Polypeptide synthesis of influenza virus infected cells. Virology 49, 23-26. Skehel, J. J., and Hay, A. J. (1978a).Nucleotide sequences a t the 5’ termini of influenza virus RNAs and their transcripts. Nucleic Acids Res. 5, 1207-1219. Skehel, J. J.,and Hay, A. J. (1978b). Influenza virus transcription. J.Gen. Virol. 39,l-8. Skehel, J. J., Hay, A. J., and Armstrong, J. A. (1977). On the mechanism of inhibition of influenza virus replication by amantadine hydrochloride. J . Gen. Virol. 38,97-110. Smith, J. C., Carey, N. H., Fellner, P., McGeoch, D., and Barry, R. D. (1978). Comparative studies of nucleotide sequences within two influenza virus genes. In “Negative Strand Viruses and the Host Cell” (B. W. J. Mahy and R. D. Barry, eds.), pp. 37-46. Academic Press, New York. Spooner, L. L. R., and Barry, R. D. (1977). Participation of DNA-dependent RNA polymerase I1 in replication of influenza viruses. Nature (London) 268, 650-652. Spring, S. B., Nusinoff, S. R., Murphy, B. R., and Chanock, R. M. (1975a). Temperaturesensitive mutants of influenza virus. VI. Transfer of ts lesions from the Asian subtype of influenza A virus to the Hong Kong subtype (H3N2). Virology 66, 522-532. Spring, S. B., Nusinoff, S. R., Tierney, E. L., Richman, D. D., Murphy, B. R., and Chanock, R. M. (1975b). Temperature-sensitive mutants of influenza. VIII. Genetic and biological characterization of ts mutants of influenza virus A (H3N2) and their assignment to complementation groups. Virology 66, 542-550. Spring, S. B., Maassab, H. F., Kendal, A. P., Murphy, B. R., and Chanock, R. M. (1977a). Cold-adapted variants of influenza virus A. I. Comparison of the genetic properties of ts mutants and five cold-adapted variants of influenza A. Virology 77,337-343. Spring, S. B., Maassab, H. F., Kendal, A. P., Murphy, B. R., and Chanock, R. M. (1977b). Cold-adapted variants of influenza A. 11. Comparison of the genetic and biological properties of ts-mutants and recombinants of the cold-adapted A/AA/6/60 strain. Arch. Virol. 55, 233-246. Sugiura, A. (1975). Influenza virus genetics. In “The Influenza Viruses and Influenza” (E. D. Kilbourne, ed.), pp. 171-213. Academic Press, New York.
36
CHRISTOPH SCHOLTISSEK
Sugiura, A., Tobita, K., and Kilbourne, E. D. (1972). Isolation and preliminary characterization of temperature-sensitive mutants of influenza virus. J . Virol. 10, 633647. Sugiura, A,, Ueda, M., Tobita, K., and Enomoto, L. (1975). Further isolation and characterization of temperature-sensitive mutants of influenza virus. Virology 65, 363373. Taylor, J . M., Illmensee, R., Litwin, S., Herring, L., Broni, B., and Krug, R. M. (1977). Use of specific radioactive probes to study transcription and replication of the influenza virus genome. J . Virol. 21, 530-540. Tuckova, E., Vonka, V., Zavadova, A,, and Kutineva, L. (1973). Sensitivity to 1-adamantanamine as a marker in genetic studies with influenza viruses. J . Biol. Stand. 1, 341-346. Ueda, M. (1972). Temperature-sensitive mutants of influenza virus. Isolation and preliminary characterization. Arch. Gesamte Virusforsch. 39, 360-368. Ueda, M., and Kilbourne, E. D. (1976). Temperature-sensitive mutants of influenza virus: A mutation in the hemagglutinin gene. Virology 70, 425-431. Ueda, M., Tobita, K., Sugiura, A,, and Enomoto, C. (1978). Identification of hemagglutinin and neuraminidase genes of influenza B virus. J . Virol. 25, 685-686. Vallbracht, A. (1978). “Neurovirulenz in einem Influenza A-Rekombinations-system.” Dissertation in Fachbereich Biologie, Universitat Tiibingen, Germany. Vallbracht, A., Flehmig, G., and Gerth, H.-J. (1979).Influenza virus: Appearance of high mouse-neurovirulent recombinants. Intervirology 11, 1 6 2 2 . Webster, R. G., and Bean, W. J . (1978). Genetics of influenza virus.Annu. Rev. Genet. 12, 415-431. Webster, R. G., and Laver, W. G. (1975).Antigenic variation of influenza viruses. In “The Influenza Viruses and Influenza” (E. D. Kilbourne, ed.), pp. 269-314. Academic Press, New York. Young, J., and Content, J. (1971). 5’-Terminus of influenza virus RNA. Nature (London1 New Biol. 230, 140-142. Zazimko, L. A,, and Gorev, N . E. (1976). Comparative study of the electrophoretic mobility of the RNA of influenza parent and recombinant strains. Arch. Virol. 52, 1-6. Zhdanov, V. M., Lvov, N. A., Reznik, V. I., Zakstelskaya, L. Y., Yakhono, M. R., Isachenko, V. I., Bravde, N. B., Pysina, T. V., Andreyev, V. R., and Podchernyaeva, R. Y. (1978). Return of epidemic A1 (HlN1) influenza virus. Lancet 1, 294-295.
GENETICS OF APPLIED MICROBIOLOGY Vedpal Singh Malik Research Laboratories. The Upjohn Company. Kalamazoo. Michigan
I. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . I1. Screening Methods . . . . . . . . . . . . . . . . . . . . . . . . . A. Agar Plate Method . . . . . . . . . . . . . . . . . . . . . . . . B . Colony Morphology . . . . . . . . . . . . . . . . . . . . . . . . C . Pigment Changes and Colony Color . . . . . . . . . . . . . . . . D. Chemostat . . . . . . . . . . . . . . . . . . . . . . . . . . . . E . Glaser’s Dumb-Waiter . . . . . . . . . . . . . . . . . . . . . . 111. Mutagenesis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . IV. Mutants . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. Inhibitor-Resistant Mutants . . . . . . . . . . . . . . . . . . . . B . Auxotrophic and Suppressor Mutants . . . . . . . . . . . . . . . C. Constitutive Mutants . . . . . . . . . . . . . . . . . . . . . . . D . “Up-Promotor” Mutants . . . . . . . . . . . . . . . . . . . . . . E . Enzyme-Specificity Mutants . . . . . . . . . . . . . . . . . . . .
F . Permeability Mutants . . . . . . . . . . . . . . . . . . . . . . . G. Increase in Resistance to Its Own Metabolite . . . . . . . . . . . . H . Mutations to Generate Molecules with Altered Biological Activities . LViruses . . . . . . . . . . . . . . . . . . . . . . . . . . . . . V . GeneDosage . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. Gene Amplification . . . . . . . . . . . . . . . . . . . . . . . . B . Transduction . . . . . . . . . . . . . . . . . . . . . . . . . . . C . Plasmids . . . . . . . . . . . . . . . . . . . . . . . . . . . . . VI . New Gene Combinations . . . . . . . . . . . . . . . . . . . . . . . A . Intraspecific Recombination . . . . . . . . . . . . . . . . . . . . B. Interspecific Recombination (Hybridization) . . . . . . . . . . . . C . Transformation . . . . . . . . . . . . . . . . . . . . . . . . . . D.Plasmids . . . . . . . . . . . . . . . . . . . . . . . . . . . . . E . Transduction . . . . . . . . . . . . . . . . . . . . . . . . . . . F . Cell Fusion . . . . . . . . . . . . . . . . . . . . . . . . . . . G . Heterokaryosis . . . . . . . . . . . . . . . . . . . . . . . . . . VII. Strain Stability . . . . . . . . . . . . . . . . . . . . . . . . . . . A.Storage . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
38 40 40 41 42 43 44 44 46 46 51 52 53 55 57 59 59 63 65 65 66 67 68 68 75 77 79
82 83 84
85 85
37 ADVANCES I N GENETICS. Val 20
Copyright 0 1979 by Academic Press. Inc . All rights of reproduclion in any form reserved . ISBN 0-12-017620-3
38
VEDPAL SINGH MALIK
B.Viruses . . . . . . . . . . . . . C. Tandem Duplications and Unstable VIII. Antibiotic Synthesis . . . . . . . . . A. Genetic Control . . . . . . . . . B. Plasmids and Antibiotic Production C. Multivalent Induction of Secondary IX. Epilogue . . . . . . . . . . . . . . References . . . . . . . . . . . . .
. . . . . . . . . . . . . . . .
Phenotype . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Metabolite Formation
. . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
85 87 89 89 93 98 101 101
I. Introduction
Efficient microbes, such as Escherichia coli, transform food molecules principally into essential cellular building blocks. These tightly regulated organisms are of little practical use, since excessive synthesis of metabolites is prevented. Other organisms have less efficient regulatory mechanisms for the control of intermediary metabolism (Demain, 1976) and can use cheap growth media to produce an excess of metabolites valuable to man (Perlman, 1977). The creation and improvement of such strains is the mission of the industrial microbiologist. Man has long exercised selection of yeasts for brewing and wine making. Hansen in the 1870s, a t the laboratories of the Carlsberg Brewery in Copenhagen, introduced the use of selected pure yeast cultures for making beer. About 60 years later, Winge, working in the same laboratories, studied yeast genetics (Burnet, 1975). The science of microbial synthesis came of age early in this century. At the Pasteur Institute in 1910, Fernback had used starch to grow Clostridium, yielding acetone and butyl alcohol, but the process failed on an industrial scale. In World War I, Weizmann solved a critical acetone shortage by using the fermentation of Clostridium acetobutylicum. In contrast to Fernback, Weizmann succeeded in finding a vigorous organism that could tolerate acid conditions and yield significant quantities of acetone from cornmeal mash. Weizmann's microorganism was improved by heat shock a t 90"- 100°Cgiven to each subculture from spores. This treatment removed oxygen and eliminated weak strains and degeneration in Clostridium (Schofield, 1974). Neuberg during World War I produced glycerol by adding NaHSO, to fermenting yeasts. The German biochemist found that in the presence of NaHSO, acetaldehyde was converted to its bisulfite addition product. As a result, the normal pathway for reoxidation of NADH by reduction of acetaldehyde was blocked and dihydroxyacetone was utilized instead. The a-glycerophosphate produced was subsequently hydrolyzed to produce glycerol.
GENETICS OF APPLIED MICROBIOLOGY
39
Today, the fermentation industry uses microorganisms to convert raw materials into organic solvents, amino acids, vitamins, proteins, food supplements, and therapeutic agents (Perlman, 1977). In 1971, more than 200,000 tons of yeast were produced commercially in the United States alone to supplement foods. More than a million pounds of the vitamin riboflavin are synthesized commercially each year by yeast fermentation. Bacteria are also employed in making annually at least 2000 pounds of vitamin B,, and 5 million pounds of sorbose, which is chemically converted to vitamin C. Each year, over 50 million pounds of glutamate and 1 million pounds of lysine are synthesized by bacteria for the U S . food industry (Porter, 1973). Production by traditional fermentation has been replaced in some cases by chemical synthesis. As might be expected, economic trends influence this development. Fermentation processes based on conversion of carbohydrates to commercial products, such a s ethanol, acetone, lactic acid, and butanol, for example, were profitable as long as sugar was cheap. As sugar prices rose, however, chemical synthesis became comparatively more economical and replaced the microbial process (Perlman, 1973). If current interest in utilization of cellulose waste material as a substrate for fermentation continues, petrochemically produced ethanol could again have to compete with alcohol produced by fermentation (Anderson, 1977; Wilke, 1975; Ratledge, 1977). Many fermentation products serve no known vital purpose for the organisms that produce them and are therefore called secondary metabolites (Bu’Lock, 1961). Production of a secondary metabolite is rarely seen simultaneously with growth of the producing organism (Malik, 1972). Generally, synthesis of secondary metabolites is suppressed while cells are actively multiplying. Synthesis begins as the culture enters stationary phase. The yield of secondary metabolites is strongly influenced by the growth rate of the producing culture: conditions that increase growth rate usually decrease the yield of the secondary metabolite. To produce these secondary metabolites economically, most nutrients must be diverted into their formation, with a minimum left to the organism for conversion into biomass. The cellular regulatory mechanisms must be altered so that elevated levels of precursors are channeled into the biogenetic pathway leading to the desired metabolite (Drew and Demain, 1977; Elander et al., 1977). This review deals with those aspects of mutational and recombinational genetics that are of importance for creating and improving microbial cultures utilized in the production of commercial metabolites, such as antibiotics and amino acids. Genetic work on the microbial production of organic solvents is rare and will not be covered here.
40
VEDPAL SINGH MALIK
11. Screening Methods
One needs genetic variation in a strain-improvement program. In haploid organisms, variation is produced by mutation and the rate can be increased by the use of mutagens. But variation alone does not help as long as one does not have an efficient method of selection. The selection technique is very important and must be specifically adapted to the organism, environmental conditions, and substance selected for. Microbial geneticists usually select for all-or-none characteristics (such as the ability to grow on a certain medium), while the industrial microbiologist has the more difficult task of devising selection procedures for quantitative differences. Random screening of large numbers of minor variants induced by low dosage of mutagens is still the most fruitful approach for increasing the efficiency of fermentation processes (Sermonti, 1969; Demain, 1973; Fantini, 19761, but nonselective random screening does not always yield good results. As a result of many years of blind selection, antibiotic production in certain cases has reached 10-25 g d l i t e r (penicillin, streptomycin, neomycin, tetracycline), whereas the production of other antibiotics is as low as 2-4 g d l i t e r (erythromycin, oleandomycin). In contrast to this, hyperactive amino acid-producing strains (e.g., 98 g d l i t e r for glutamic acid) have been obtained via selection procedures that take advantage of knowledge of biosynthetic pathways and regulatory circuits (Yamada et al., 1972).
A. AGARPLATE METHOD In programs designed to select mutants with increased metabolite yields, isolates are usually tested in shake-flask cultures to reproduce the submerged growth conditions used in industry. Shaker space and available manpower limit the number of isolates that can be tested; any method that avoids the use of shake flasks in the initial screen of individual colonies could offer the possibility of examining larger numbers of isolates. It is not expected that testing of mutants for production of antibiotics would reveal a strict correlation between titer of performance on agar medium and in shake-flask cultures because of differences in growth conditions. However, initial testing on agar medium can aid in the selection of promising strains for subsequent analysis in shake flasks. Ichikawa et al. (1971) isolated mutants of Streptornyces kasugaensis with increased yields of the antibiotic kasugamycin. Mutagenized spores were spread on agar medium. After 2 days, colonies were re-
GENETICS OF APPLIED MICROBIOLOGY
41
moved individually with a cork borer and the agar disks were placed in petri dishes. After 5 days of further growth, agar disks containing colonies were transferred to biological assay plates seeded with a suitable test organism. With this technique, it was possible to test many more isolates (650,000 colonies) than is feasible in shake flasks, and the yield of kasugamycin was increased more than 10-fold within one year. Using a modification of the technique of Ichikawa et al. (1971), mutants ofAspergillus nidulans have been isolated with higher penicillin yields, in shake flasks, than their parents (Ditchburn et al., 1974).
B. COLONY MORPHOLOGY Small colonies regularly arise spontaneously or after mutagenesis. Many explanations for small-colony formation ranging from temporary influences on cell structures to mutations related to energy metabolism, as for petite Saccharomyces cerevisiae, have been suggested (Mortimer and Hawthorne, 1966; Mishra, 1977). When intermediates in an essential pathway are unknown or metabolic relationships of pathways are poorly understood, small-colony morphology might be exploited. Schwartz and Stadtman (1970) used small-colony formation as a character for selecting mutants of Clostridium sticklandii defective in catabolic enzyme systems that degrade glycine, lysine, proline, and formate. These strains exhibited markedly depressed activities of some catabolic enzymes that generate ATP. In several of these strains the levels of glycine reductase, the ability to ferment lysine to fatty acids and ammonia, and formate-dependent 2,3,5-triphenyltetrazolium chloride reduction was only 0-10% that of the wild type. Another subgroup of mutants exhibited activities of some of these enzymes from 1.3-3 times higher than those of the wild type. Small colony mutants of a n obligate anaerobe can therefore be due to defects in one or more of their energy-producing systems. Proteins of food yeasts are low in the sulfur-containing amino acid methionine. Okanishi and Gregory (1970) isolated mutants of Candida tropicalis that produced 41% more methionine in the cell protein than the parent. These mutants were selected as small colonies on the sulfurlimiting media as compared with the normal colonies of the ancestor. Five of the ten Aspergillus midulans mutants impaired in penicillin biosynthesis induced by gamma rays from a 6oC0source were morphologically different from the parent strain (Edwards et al., 1974). All strains ofPenicillium chrysogenum with improved antibiotic titers had altered morphology, particularly mixed giant colonies (Aytoun, 1970).
42
VEDPAL SINGH MALIK
Stauffer and Backus (1954) selected Ql76 P . chrysogenum colonies of differing morphology but were unable to stabilize any one type. Partial chromosome duplication could account for the instability in Q176 (Ball, 1973b). This view is supported by the enhanced dominant instability if a partial chromosomal duplication is present in a diploid of A . nidulans (Nga and Roper, 1969; Parag and Roper, 1975). Kafer (1977) has recently reviewed meiotic and mitotic recombination in Aspergillus and its chromosomal aberrations. Morphologically stable diploid derivatives of P. chrysogenum arise in sectors from unstable diploids, by mutation in the unstable component of the diploid, or by mitotic crossing-over to generate homozygosis for the stability locus (Ball, 1973a). CHANGES AND COLONY COLOR C. PIGMENT Deposition of altered pigments frequently indicates a metabolic block (e.g., purple adenine mutants), and their connection with some other biochemical changes may be expected. Several aspects of streptomycetes are highly variable with respect to their phenotypic traits. Changes in size, shape, sporulation, and pigmentation of the colony are seen. Some strains ofstreptomyces rimosus were observed to segregate spontaneously into non-tetracyclineproducing variants that had altered colony color (Alikhanian et al., 1959). Mutagenesis of S. rimosus that synthesized 3 gm of oxytetracycline per liter yielded inactive mutants that were classified as white or black, depending on the color of the colonies. The black mutant mycelium synthesized oxytetracycline in the presence of metabolites produced by the white mutants (Alikhanian, 1973). Streptomyces spectabilis, Streptomyces fradiae, Streptomyces erythreus, and Streptomyces espinosus also show morphological instability, and segregant colonies are of various colors. This unstable phenotype in streptomycetes could be due to partial chromosomal duplications, and it is good to subject such isolates to mass selection. In this way Hogtalek et al. (19741 claim to have obtained not only a general stabilization of the given isolate, but also frequently a further increase in its biosynthetic activity and in the mutagenesis efficiency in the subsequent selection step. Induced mutants of Streptomyces griseus var. purpureus produced increased amounts of viomycin and differed morphologically from the parent (Tyc and Kadzikiewicz, 1972). Increased viomycin synthesis in mutants correlated with the production of a melanin-like pigment. Similarly, biosynthetic investigations on ac-
GENETICS OF APPLIED MICROBIOLOGY
43
tinomycin B and on lincomycin suggest a correlation between antibiotic biogenesis and pigment production (Sercik, 1957; Witz et al., 1971). A prerequisite for the study of synthesis of antibiotics and their genetic control is the availability of mutants blocked a t different steps in the biosynthetic pathway. Alterations in morphology and pigmentation of colonies can be used for selecting such mutants. Basic information on the character and probable sites of genetic blocks in the biosynthetic pathway can be obtained by examining metabolic complementation in mixed cultures of pairs of blocked mutants either under submerged conditions (McCormick et al., 1963) or by the agar method (Kirby et al., 1975). The series of blocked mutants used by McCormick and co-workers for studying the biosynthesis of tetracyclines were obtained from a wild strain of Streptomyces aureofaciens ATCC 10.762. Mutations were induced by UV, X-rays, and nitrogen mustard (McCormick et al. , 1963). The wild-type parent forms a lightyellow mycelium when grown on agar medium. The reverse side of the colonies is yellow to yellow-orange or yellow-brown. The blocked mutants were either completely colorless or formed pigments different from those of the parent strain (dark brown, dark green, copper red, etc.). Mutant colonies often had different size and surface characteristics as well and often formed diffuse fluorescent zones. Most mutant pigments were tetracycline derivatives. D. CHEMOSTAT An excellent review of continuous culture methods by Dawson (1977) records advances in the development and the industrial applications of the technique. The chemostat, as a method for the selection and overproduction of enzymes and proteins, has been reviewed (Clarke, 1976; Hartley, 1974; Francis and Hansche, 1972; Dean et al. , 1976). Information on selection methods for industrial production of enzymes is not readily available (Aunstrup, 19771, but the chemostat does offer a method of selecting high enzyme-producing strains. The chemostat has also been successfully used to select strains that synthesize enzymes with altered and efficient substrate specificities (Kubitschek, 1973) and therefore has a great potential for selecting cultures that could be valuable for industrial microbial transformation of commercially important organic molecules (C. K. A. Martin, 1977; Chibata and Tosa, 1977). Senior et d. (1976) described a case of enzyme evolution within a microbial community growing on the herbicide Dalapon.
44
VEDPAL SINGH MALIK
E. GLASER’S DUMB-WAITER Glaser extended the possibility of screening large numbers of cultures with his “Dumb-Waiter.” It employs a television camera and a computer to monitor as many as 10,000 agar trays with up to lo* colonies (Roseth, 1976). A bacterial suspension is adjusted so that there is one bacterium per drop. This suspension is sprayed through a fine nozzle that is vibrated by a n electric current. The drop is electrically charged and is planted in a predetermined position on the agar tray (Sevastopoulos et al., 1977). All colonies have legal addresses on the tray, and a colony with a n illegal address is a contaminant. The computer locates the boundary point of the colony and measures optical density and diameter of the colony. It can examine 85 parameters a t the same time. The Dumb-Waiter can be used to isolate temperature sensitive, auxotrophic, and other types of mutants of industrially important organisms. III. Mutagenesis
Changes in the enzymic constitution of a microbial population may be due to the selection of mutants, the induced synthesis of a n enzyme, or the simultaneous functioning of both mechanisms. Microbes will not utilize a compound if it does not enter the cell, if there are no enzymes that can convert it to a suitable metabolic intermediate, if the enzymes are not induced by the compound, if enzymes that attack the compound or its products do so at a rate too low to be effective, or if the compound is a n inhibitor of a n essential cellular function. Mutations affecting one or more of these properties may permit growth of a compound that is not utilized by the parent and permit significant production of a secondary metabolite. General methods for the induction and selection of mutants have been described (Calam, 1970; Hopwood, 1970; Cox, 1976; Bridges, 1977; Delic et al., 1970; Elander et al., 1976). Streptomyces tenebrarius, which produces three major activities comprising the nebramycin group of aminoglycoside antibiotics, was treated with ultraviolet (UV) light. Mutants were isolated that were able to produce single antibiotics (tobramycin alone or apramycin alone) in good yield (Stark et a l . , 1976). Goldat (1958) applied an eight-step selection procedure using UV in combination with photoreactivation or with preceding treatment with sublethal doses of X-rays or ethylenimine to achieve a 5-fold increase in chlortetracycline production as compared to the parent S . aureofaciens. Repeated UV mutagenesis of S. rirnosus increased the production of tetracycline by
GENETICS OF APPLIED MICROBIOLOGY
45
67%. Further UV irradiation of this strain of S. rimosus produced a variant that produced larger amounts of tetracycline in the presence of high levels of inorganic phosphate in the medium (Alikhanian, 1969). Comparison of spontaneous and mutagen-induced variability of tetracycline production has been made. Mutagens used were UV, X-ray, (NTG), and nitroy-radiation, N-methyl-N'-nitro-N-nitrosoguanidine gen mustard. The most effective mutagen for increasing the production of antibiotics in S . rimosus and S . aureofaciens was found to be UV light, applied either alone or in combination with other mutagens. NTG was superior to the relatively ineffective X-rays and nitrogen mustard (HoBtalek et al., 1974). If the morphological instability of these streptomycetes is affected by plasmids or merodiploidy , treatment with UV light could stabilize the strain, since UV cures cells of extrachromosomal elements and causes deletions of genetic material. Even though UV would be a good source to induce variability with respect to antibiotic production, particularly in streptomycetes of unstable phenotype, the wide occurrence of photoreactivation among streptomycetes makes i t difficult to reproduce the exact mutagenic conditions (Jagger et al., 1970; Elander, 1975). UV is also ineffective on pigmented cells. Backus and Stauffer (1955) selected variants of penicillin-producing cultures from populations of conidia treated with mutagens such as nitrogen mustard or UV radiation. These authors tripled the amount of penicillin produced. They noted that a significant increase in penicillin production could be achieved only as a result of stepwise selection. Each step accumulates a small improvement in penicillin production. This suggests that many loci control the quantitative character of penicillin production. To unravel the genetic control of antibiotic production, variants blocked in different steps in the biosynthetic pathway can be enriched by NTG mutagenesis of synchronized cultures. There are probably common genes and pathways operating in regulating sporulation, production of antibiotics, and other excreted metabolites. The localization and subsequent mutation of such common genes by synchronized mutagenesis could also be of practical value. NTG causes mutations in clusters corresponding to replicating loci (Cerda-Olmedo et al., 1968). When one selectable mutation is induced in a locus, other mutations (comutations) in closely-linked genes are obtained (Guerola et al., 1971; Randazzo et al., 1973, 1976). After NTG treatment, selection of revertants of a his A gene yields more than 6% mutants a t another locus within the his operon and about 4% mutants at a locus adjacent to the his operon (Carere and Randazzo, 1976). These authors de-
46
VEDPAL SINGH MALIK
veloped a method of selecting revertants without imposing any restrictions on the possible comutations accompanying reversion. The growth of comutants was supported in heterokaryosis with the original his strain. Approximately half of the revertants were comutants. Comutation can be used for fine-structure mapping in small regions of the chromosome, for detection of unknown loci in the desired region of the map, for map comparisons between organisms, and for improving yields of metabolites if mutations in a given region are favorable for yield improvement. Hong and Ames (1971) have described procedures for localized mutagenesis of any specific small region of the bacterial chromosome. Methods for predirecting mutations into specific areas of the chromosome of a cephalosporin producing Streptomyces lipmanii and S . olivaceus by synchronizing chromosome replication followed by periodic exposure of cells to NTG have also been reported (Godfrey, 1974; Matselyukh et al., 1973). Transposable elements (Bukhari et al., 1977; Kleckner, 1977; Shapiro, 1977) have not yet been discovered among organisms of commercial interest. Discovery of such elements can open new avenues for isolating mutants. IV. Mutants
A. INHIBITOR-RESISTANT MUTANTS
A wide range of phenotypic changes commonly occur among temperature-sensitive, auxotrophic, suppressor, and analog-resistant mutants (Murgola and Adelberg, 1970; LaCoste et al., 1976). Some of these phenotypes include slower growth rates at normal temperature, the ability to grow at high temperature, hypersensitivity to antibiotics, and altered host-controlled modification (Dunn and Holloway, 1971; Raynal, 1977). Many structural analogs of normal metabolites are bacteriostatic since they are able to mimic the feedback inhibition of an end product, but do not fulfill the biosynthetic functions of this metabolite. Cell growth ceases as a consequence of “pseudo-feedback inhibition” (Moyed, 1960). Metabolic analogs and inhibitors (Table 1)can be used to select resistant mutants. Such mutants are extremely useful, since they sometimes have altered regulatory mechanisms and produce increased amounts of metabolites (Norris and Lea, 1976). Adelberg (1958) devised a n enrichment technique for isolating these controldefective mutants of anabolic pathways. Cells are grown on plates containing an antimetabolite; some of these resistant colonies are
GENETICS OF APPLIED MICROBIOLOGY
47
TABLE 1 Metabolic Analogs ~
~
Metabolite Adenine millanine
0-Alanine
D- Alanine Arginine Asparagine Aspartic acid
Biotin Cysteine a,€-Diaminopimelic acid Glutamic acid
Glutamine
Glycine Histidine Isoleucine
Leucine
Lysine
Methionine
Analog Benzimidazole, 2,6-diaminopurine X- Aminoethanesulfonic acid, glycine, X-aminoisobutyric acid, serine P- Aminobutyric acid, propionic acid, asparagine, D-serine D-Cycloserine, 0-carbamyl-D-serine, D-X-aminobutyric acid Canavanine, lysine, ornithine, homoarginine 2-Amino-2-carboxyethane sulfonamide Cysteic acid, P-hydroxyaspartic acid, diaminosuccinic acid, aspartophenone, X-aminolevulinic acid, X-methylaspartic acid, P-aspartic acid hydrazide, S-methylcysteine sulfoxide, p-methylaspartic acid, hadacidin Avidin; dethiobiotin Allylglycine X,X-Diaminosuberic acid, X,X-diaminosebacic acid, P-hydroxy-X,c-diaminopimelic acid, y-methyl-X,e-diaminopimelic acid, cystine Methionine sulfoxide, y-glutamylethylamide, 0-hydroxyglutamic acid, methionine sulfoximine, X-methylglutamic acid, y-phosphonoglutamic acid, P-ethyl-y-phosphonoglutamicacid, y-fluoroglutamic acid S-Carbamylcysteine, 0-carbamylserine, 0-carbazylserine, 3-amino-3-carboxypropanesulfonamide, N-benzylglutamine, azaserine, 6-diazo-5-oxonorleucine, y-glutamylhydrazide X-Aminomethanesulfonic acid D-Histidine, imidazole, 2-thiazolealanine, 1,2,4-triazolealanine Leucine, methallylglycine, o-dehydroisoleucine, 3-cyclopentene-l-glycine,cyclopentene glycine, 2-cyclopentene-1-glycine; 0-methylthreonine, P-hydroxyleucine D-Leucine, X-aminoisoamylsulfonic acid, norvaline, norleucine, methallylglycine, X-amino-P-chlorobutyric acid, valine, 6-chloroleucine, isoleucine, P-hydroxynorleucine, P-hydroxyleucine, cyclopentene 2-amino-4-methylalanine, 3-cyclopentene-l-alanine, hexenoic acid, 5',5',5'-trifluoroleucine,4-azaleucine X-Amino-e-hydroxycaproicacid, arginine, 2,6-diaminoheptanoic acid, oxalysine, 3-aminomethylcyclohexane glycine, 3-aminocyclohexane alanine, trans-4-dehydrolysine, S-(P-aminoethyl)cysteine, 4-azalysine Crotylalanine, crotylglycine, methoxinine, a-methyl-DL-methionine, norleucine, ethionine, methionine sulfoximine, threonine, selenomethionine
48
VEDPAL SINGH MALIK
TABLE 1 (continued) Metabolite Niacin Ornithine Phenylalanine
Proline Purine Pyridoxine Pyrimidine Serine Thiamine Threonine Thyroxine Tryptophan
Tyrosine Valine
Analog Pyridine-3-sulfonic acid, 3-acetylpyridine, picolinic acid
X- Amino-Bhydroxyvaleric acid, canaline, a-methylornithine
X-Amino-P-phenylethanesulfonic acid, tyrosine, p-phenylserine, cyclohexylalanine, 0-aminophenylalanine, p-aminophenylalanine, fluorophenylalanines, chlorophenylalanines, bromophenylalanines, p-2-thienylalanine, p-3-thienylalanine, p-2-furylalanine, p-3-furylalanine, p-2-pyrrolealanine, I-cyclopentene-1-alanine, 1-cyclohexene-1-alanine, 2-arnino-4-rnethyl-4-hexenoicacid, S-(1,2-dichlorovinyl)cysteine,P-4-pyridylalanine, tryptophan, p-2-pyridylalanine, P-4-pyrazolealanine, p-4-thiazolealanine, p-nitrophenylalanine Hydroxyproline, 3-methylproline, 3,4-dehydroproline, azetidine-2-carboxylic acid 8-Azaguanine Isoniazid 2-Amino-4-methylpyrimidine a-Methylserine, homoserine, threonine, isoserine Pyrithiamine, bacinaethrin Serine, P-hydroxynorvaline, P-hydroxynorleucine Ethers of 3,5-diiodotyrosine Methyltryptophans, naphthylalanines, indoleacrylic acid, naphthylacrylic acid, p-(2-benzothienyl)alanine, styrylacetic acid, indole, ~-amino-p-3(indazole)propionic acid (tryptazan), 5-fluorotryptophan, 6-fluorotryptophan, 7-azatryptophan Aminotyrosine, fluorotyrosines, p-aminophenylalanine, rn-nitrotyrosine, p-(5-hydroxy-Z-pyridyl)alanine PAminoisobutanesulfonic acid, X-aminobutyric acid, norvaline, leucine, isoleucine, methyllylglycine, P-hydroxyvaline, w-dehydroalloisoleucine
surrounded by a halo of secondary colonies that grow by utilizing the metabolite excreted by the resistant clone. The excretion of p-aminobenzoic acid by Staphylococcus aureus resistant to sulfonamides was observed early by Oakberg and Luria (1947). Numerous mutants resistant to different amino acid analogs have since been isolated (Schlegel and Jannasch, 1967; Umbarger, 1971; Work, 1971). Under certain growth conditions, naturally occurring compounds can inhibit growth. For example, the growth of wild-type Escherichia coli K12 on minimal medium is sensitive to valine, which blocks isoleucine biosynthesis through feedback inhibition of acetolactate synthetase. By selecting for resistance to valine, mutants ofE. coli K12
GENETICS OF APPLIED MICROBIOLOGY
49
have been isolated that possess either a valine-resistant acetolactate synthetase or an otherwise increased rate of isoleucine biosynthesis (Ramakrishnan and Adelberg, 1964). Mutants derepressed for histidine biosynthesis can be obtained by selecting clones that are resistant to the histidine analog 1,2,4triazole-3-alanine (TRA), a false corepressor of the operon, and 3-amino-1,2,4-triazole (AT), a n inhibitor of one of the histidine biosynthetic enzymes. Although TRA does not inhibit wild-type Salmonella typhimurium growing in minimal medium, it does inhibit strains having a partial genetic block in the histidine pathway. With a partial block, activity is present but reduced so that the histidine operon must be derepressed for growth. This also can be achieved by growing cells in the presence of AT. Since TRA acts as a false corepressor, it inhibits strains that must be derepressed in order to grow. Therefore, mutants constitutive for histidine biosynthesis are found among cells that are resistant to TRA in the presence of AT (Roth et al., 1966). Araki and Nakayama (1971) isolated mutants of Corynebacterium glutamicum, Arthrobacter citreus, Brevibacterium flavum, Bacillus megaterium, Bacillus subtilis, and Nocardia globerula resistant to TRA or 2-thiazolealanine (TA) by mutagenic treatment with NTG. More than 8% of these analog-resistant mutants of C. glutamicum accumulated large amounts of L-histidine in the culture broth. One TRA-resistant C. glutamicum mutant accumulated 6-8 gm of histidine per liter with a medium containing 15% molasses and 4.5% ammonium sulfate. His T strains of Salmonella are resistant to several amino acid analogs and have altered elution profiles for leucyl- and tryosyl-tRNA. This his T mutant has a n altered tRNA modifying enzyme. At least one species of tRNA leu and the tRNA his from the his T mutant lacks two pseudouridines in the anticodon region (Rizzino et al., 1974). Isoleucine-valine and leucine enzymes are partially derepressed when these strains are grown in minimal medium o r under repressing conditions. Excretion of isoleucine-valine and leucine by the his T mutant, but not by the wild type, suggests that this pleiotropic mutant is altered in the regulation of these amino acids. It may be relevant to multivalent repression of the isoleucine-valine enzymes, since tRNA Val and tRNA ile may be part of this process. Many microorganisms (Serratia, Streptomyces, and Pseudomonas) are quite resistant to growth inhibition by various analogs. Analog sensitivity can be achieved by manipulation of the nutrition and growth conditions. For the isolation of analog-resistant mutants,
50
VEDPAL SINGH MALIK
spores or cells can be spread on minimal agar plates containing alternative carbon and nitrogen sources. Crystals of the analog are placed on the surface of the agar, and the plates are scored for several days for inhibition. Resistant clones are picked and purified several times by single-colony isolation on plates containing sufficient analog to inhibit growth of the wild type (Malik, 1972). Methyl ammonium is a structural analog of ammonia. Selection for methyl ammonium resistance yields mutants of Saccharomyces cerevisiae with impaired nitrogen metabolite repression of enzymes involved in degradation of allantoin and arginine. The sensitivity of S. cerevisiae to methyl ammonium is determined by the nature of the nitrogen source in the growth medium (Middelhoven, 1977). Warr and Roper (1965) found it difficult to obtain a wide variety of resistant mutants in A . nidulans and stressed the critical effect of drug concentration on successful isolation of such mutants. Mutants ofA. nidulans with impaired ammonium repression of many enzymes involved in the degradation of nitrogenous substances were selected by resistance to methyl ammonium (Arst and Cove, 1969). Drug-resistant mutants have not been studied extensively in P. chrysogenum, but resistance to 8-azaguanine has been described (Ball, 1971). Lemke (1969) has surveyed one hundred compounds for their toxicity to the antibioticproducing fungi Cephalosporium, Penicillium chrysogenum, Emericellopsis glabra, Aspergillus nidulans, Saccharomyces cerevisiae, Sistotrema, Schizophyllurn commune, and Actinoplanes utakensis. Some of these analogs may be suitable as selective agents for isolating resistan t mu tan ts. Cephalosporium acremonium or C. polyaleurum resistant to the polyene antibiotics nystatin, kabicidin, or trichomycin produced per liter more than 10 gm of cephalosporin C (Takeda Chemical Industries, Ltd., Japan, 1975a). Modern high penicillin-producing strains detoxify the precursor phenylacetic acid by incorporating it via acyltransferase enzymes into the side chain of the antibiotic (Kitano, 1977). Mutants resistant to fluoro- and methyltryptophan produce 3-fold more pyrrolenitrin than the sensitive parent (Elander et al., 1971). A mutant of Streptomyces hofunensis resistant to the threonine analog a-amino-/I-hydroxyvaleric acid was made by UV treatment. This mutant produced comparable yields of seldomycin on cheaper nitrogen sources than the usual bactopeptone (Nara, 1977). The petroleum yeast Candida lipolytica is of considerable industrial interest as a potential source of single-cell protein (Oura, 1977; Mateles and Tanenbaum, 1968), of enzymes, such as lipase (Pasero et al., 19731, and of various metabolites of the Krebs cycle, such as
GENETICS OF APPLIED MICROBIOLOGY
51
a-ketoglutaric acid or citric acid (Akiyama et al., 1972; Abe et al., 1970). Tabuchi et al. (1968) screened strains with regard to their capacity to excrete citric acid. The excreted product was a mixture of citric and isocitric acid. In a typical fermentation with a nonimproved strain, 60% citric and ~ W O isocitric acid was obtained. Use of an inhibitor of aconitase, monofluoroacetate, which is transformed in vivo into monofluorocitrate, resulted in a great reduction of the percentage of isocitric acid. However, monofluoroacetate is a dangerous compound and cannot be used on a n industrial scale. So mutants unabIe to grow with citrate as the carbon source and showing hypersensitivity to monofluoroacetate were sought. A mutant was isolated whose growth response on citrate is very poor and which shows increased sensitivity to monofluoroacetate. Enzymic measurements indicate that the specific activity of aconitase is 1%of wild type in this mutant and more than a 100 gm of citric acid per liter is accumulated in 80 hours. Contamination by isocitric acid is less than 2%. This case is a n interesting contrast to the usual search for resistant mutants. AND SUPPRESSOR MUTANTS B. AUXOTROPHIC
By the use of various methods of mutagenesis, auxotrophic strains with various growth requirements can be selected. However, in the case of tetracycline synthesis most auxotrophic strains ofstreptomyces aureofaciens had severely decreased or nonexistent ability to synthesize the antibiotic, even in media supplemented with increased amounts of the nutrient required for growth (Hogialek et al., 1974). Auxotrophy may, therefore, not be useful for improving the yield of most antibiotics. However, some superior producers can be found among prototrophic revertants (suppressor) of auxotrophs and nonantibiotic producers (Wood and Bernstein, 1977). Dulaney and Dulaney (1967) obtained tetracycline-producing revertants of a nonproducer s.viridifaciens that produced more than a 6-fold increase compared to its ancestor. Suppressor mutation of a methionine auxotroph resulted in 88% of the revertants producing 1.2-3.2 times more tetracycline than the prototrophic parent. Revertants often become constitutive and excrete the metabolite in high quantities (Demain, 1972; Polsinelli et al., 1965; Hartman and Roth, 1973; Hawthorne and Leupold, 1974). If failure to produce a metabolite is due to a mutation in enzymes that are subjected to end-product regulation, suppressor mutations can relieve this control by producing a protein that is functional but has altered regulatory properties. For the production of L-amino acids and nucleotides, auxotrophic
52
VEDPAL SINGH MALIK
mutants that require one or more nutrients regulating the pathway of the needed metabolite have been used. By supplying suboptimal amounts of the amino acid necessary for growth, the feedback inhibition and repression by these amino acids is released and large amounts of the desired amino acid accumulate in the growth medium (Yamada et al., 1972; Arima, 1977; Nakayama, 1976). All strains of Candida lipolytica tested so far require thiamine (which is needed for the functioning of a-ketoglutarate dehydrogenase). Consequently, using appropriate media with limited amounts of thiamine, several investigators in Japan, in the Soviet Union, and in France have obtained significant excretion of a-ketoglutarate. C. CONSTITUTIVE MUTANTS The specificity of an enzyme is seldom absolute, and a microbe may already have an enzyme that would metabolize a given compound if the necessary enzymes could be synthesized in sufficient quantity. In wild-type inducible strains the basal level $f an inducible catabolic enzyme is very low and can increase about 1000-fold in a fully induced culture. The same high levels are found in constitutive mutants. Even a compound for which an enzyme has low affinity (highK, value) could be a growth substrate if a regulatory mutation occurred that would result in an increased level of the enzyme in the cell. Constitutive mutants of a catabolic pathway are selected by employing growth on alternating substrates, since such mutants will grow upon transfer to the substrate of interest without a lag for induction. Mutants with these characteristics are easily selected by growth in the chemostat when the corresponding substrate is growth-limiting (Novick and Horiuchi, 1961; Horiuchi et al., 1962) or by growth in the presence of structural analogs that exert an inhibitory effect on the induction of catabolic enzymes in the presence of their corresponding substrates (Torriani and Rothman, 1961; Muller-Hill et al., 1964; Zimmerman and Scheel, 1977; Saint-Girons and Margrita, 1975). Constitutive mutants insensitive to catabolite repression have been isolated by enrichment techniques similar to those applied by Neidhardt (1960). In this instance, Aerobacter aerogenes was grown in glucose- histidine minimal medium with histidine as the sole source of nitrogen. Those mutants that could degrade histidine while utilizing glucose produced their nitrogen source via histidine catabolism and grew rapidly. Mutants of Azotobacter that produce nitrogenase and fix atmospheric nitrogen in the presence of ammonia have been isolated by Gordon and Brill (1972). These mutants inoculated into soil should
GENETICS OF APPLIED MICROBIOLOGY
53
enhance its fertility and decrease the necessity of adding chemical fertilizers. Mutants insensitive to catabolite repression for antibiotic production could easily be isolated. Mutagenized populations can be plated on an agar medium thereby activating catabolite repression. After incubation for several days, agar plates can be overlaid with a sensitive organism and mutant colonies should be surrounded with a zone of inhibition signifying antibiotic production. A mutant that produces the butirosin antibiotics when grown with glucose in industrial fermentors has been isolated (Claridge et al., 1974). Nagahari et al. (1977) constructed a n RPCtrp plasmid consisting of RP4DNA and the complete tryptophan operon of E . coli. The RPCtrp plasmid in Escherichia coli was transferred by conjugation to Pseudomonas aeruginosa converting Pseudomonas trp- to a trp+ phenotype. The levels of tryptophan-synthesizing enzymes in P. aeruginosa carrying the RP4-trp plasmid are much higher than those in the wildtype strain, and they are not controlled by the repression system in P. aeruginosa cells. It is probable that the trp repressor protein of P. aeruginosa does not bind to the trp operator of E. coli resulting in constitutive expression of the plasmid trp genes. D. “UP-PROMOTOR” MUTANTS Mutations in the promotor region were first identified in lac- strains which had intact i, z, and o genes but synthesized /3-galactosidase at low rates. The mutations mapped in the DNA region corresponding to the RNA polymerase attachment site and the initiation of transcription of the lac mRNA (Scaife and Beckwith, 1966). This suggested the presence of a promotor region for the group of structural genes transcribed together. Most genes for catabolic enzymes have efficient promotors that permit a high rate of transcription in the presence of inducer. There are, of course, also genes that are transcribed rather slowly, resulting in a low constitutive level of the protein that they determine. The structural gene lac i has a n inefficient promotor such that E . coli synthesizes only 5- 10 molecules of lac repressor per generation. Muller-Hill et aZ. (1968) isolated mutants that have more efficient promotors and allow higher rates of initiation of transcription with a n increase of a t least 5-fold in the amount of lac repressor synthesized. Some enzymes are normally required only at low concentrations and are synthesized constitutively at low rates. Pardee et al. (1971) found that nicotinamide deamidase is a microconstitutive enzyme in E . coli active in the cyclical salvage pathway, but capable of hydrolyzing only 3 nmol of nicotinamide per minute per milligram of
54
VEDPAL SINGH MALIK
protein. Hyperconstitutive mutants with a n efficient promotor for the deamidase were isolated as cells that could utilize nicotinamide as the nitrogen source for growth. Microconstitutive enzymes might be overlooked in a wild-type strain, and new enzyme activities that are difficult to relate to known enzymes in the cell may in some cases be due to promotor mutations of this type. Up-promotor mutations are not restricted to inefficient promotors. In a “superpromotor” mutant ofE. coli, the rate of transcription of the lac operon has been increased 25-fold, so that lac messenger RNA is 20% of the total cellular mRNA (Bruenn and Hollingsworth, 1973). Uppromotor mutations have been described in Salmonella typhimurium for the histidine catabolic pathway (Brill and Magasanik, 1969), for the proline catabolic pathway (Newel1 and Brill, 19721, and for the anidase ofP. aeruginosa (Betz et al., 1974). A mutation in the promotor may confer resistance to catabolite repression. Some of the histidine pathway mutants of 5‘. typhimurium and amidase mutants of P. aeruginosa, are thought to be promotor mutants of this type. A promotor-like mutant ofE. coli produces high levels of glycerol kinase and is resistant to catabolite repression (Berman-Kurtz et al., 1971). Up-promotor mutations of glucose-6-phosphate dehydrogenase have been isolated in E . coli (Fraenkel and Parola, 1972). When bacteria are placed in a culture medium with a nutrient that they cannot utilize, most of the bacteria die. However, a few mutants do survive. These mutants may possess alterations in the promotor that enable them to produce enormous quantities of an enzyme normally made in small amounts. This enzyme incidentally has a slight ability to degrade the nutrient. The enormous quantities of the enzyme make up for its inefficiency in degrading the growth compound. These regulatory mutations could be of great significance in the commercial production of enzymes (McPartland and Somerville, 1976). Production of the commercially important enzyme amylase by B. subtilis has been examined by intrastrain transformation of amy mutants (Coleman and Elliott, 1962; Sekiguchi et al., 1975). Donor DNA isolated from a high amylase-producing strain (amy+),was used to transform amy mutants of a strain that produced very low levels of amylase. About 90% of the transformants produced amylase at the rate of the donor, and the remaining amy+ cells produced the donor amylase a t the level of the recipient. The donor and the recipient enzyme were differentiated by gel electrophoresis. The authors suggested the existence of a “promotor-like” segment, close to the amylase structural gene, that affects the rate of amylase synthesis. Up-promotor mutations that produce elevated levels of amylase have been found in B .
GENETICS OF APPLIED MICROBIOLOGY
55
subtilis (Yamaguchi et al., 1974). High protease-producing mutants of B . subtilis that produced up to 40 times the amount of total protease of the parent have been isolated (Uehara et al., 1974; Higerd et al., 1972; Yoneda and Maruo, 1975). Alkaline and neutral protease activity were increased simultaneously. Interspecific transformation between B. subtilis 168 and B. natto indicated the existence of a regulatory gene (Uehara et al., 1974). The donor B . natto and the majority of transformants produced 20 times more protease than the recipientB. subtilis. A promotor-like DNA segment that controls the neutral protease gene was inherited by B. subtilis from the high-producing donor B. natto.
E. ENZYME-SPECIFICITY MUTANTS Mutations in structural genes that alter the affinities of enzymes for their substrates, or change the rates of reactions, or modify catalytic activities, must by their nature be specific and will, therefore, be less frequent than regulatory mutations. In devising selection methods for detecting and isolating altered enzyme mutants, it may be necessary to use a n indirect approach. Lerneret al. (1964) isolated a mutant with an altered ribitol dehydrogenase by selecting for growth on xylitol. Mutant X1 was able to grow on xylitol and was constitutive for ribitol dehydrogenase. From this mutant X2 was obtained, which grew faster on xylitol and produced the altered enzyme. Continuous culture offers a good system for screening large numbers of bacteria to select for mutants that have acquired some growth advantage over the original population (Mortlok, 1976). Hartley (1974) altered the ribitol dehydrogenase of Klebsiella aerogenes toward a new specificity for xylitol. A mutant of Klebsiella aerogenes constitutive for ribitol dehydrogenase grows on xylitol by producing xylulose. However, the K , for ribitol is about 1 mM, the K , for xylitol is around 1 M . At low xylitol concentrations, the activity of ribitol dehydrogenase is rate limiting for growth of the bacterium. Hartley used continuous culture in a chemostat as a selective tool. In the chemostat, any mutant with a relatively small increase in growth rate that arises has a high probability of taking over the entire culture. By continuously monitoring of the steady-state biomass and the effluent substrate concentration, a series of small evolutionary steps can be recognized. The selective pressure due to external xylitol concentration can be precisely controlled by adjusting the dilution rate of the vessel. The constitutive ancestor produces ribitol dehydrogenase at about 1% of its total soluble protein in late log phase, whereas this enzyme is more than 20% of the total cell protein in some strains
56
VEDPAL SINGH MALIK
selected by the chemostat. The enzyme is identical to the ancestral enzyme in specificity, kinetic behavior, and electrophoretic mobility. A total number of l O I 4 organisms were screened, but no mutant was found with improved enzyme kinetics for xylitol. Although the concentration of ribitol dehydrogenase was increased to surprisingly high levels, possibly owing to gene amplification or other events that lead to increased enzyme concentrations in cells. However, when mutagenesis of the culture was increased with NTG to a level where multiple mutations are expected, mutants with altered enzyme specificity were obtained. These mutants had a loweredK, for xylitol and an increased xylito1:ribitol activity ratio. UV mutagenesis did not yield strains that had altered enzyme specificity. A mutation in a regulatory gene can alter the specificity so that a new compound, for which the enzyme has some affinity, can induce this enzyme. This is, indeed, so for mutants of Escherichia coli that can grow on D-arabinose (LeBlanc and Mortlock, 1971). Some regulatory mutants of Pseudomonas aeruginosa can grow in succinate and formamide medium, with amidase induced by formamide at a much higher rate than in the wild-type strain (Brammar et al., 1967). In a medium in which growth is limited by a substrate inducer such as lactose, the mutants isolated are constitutive, since they will grow faster than the inducible parent and there is no selection pressure against them under these conditions. This is a general method for isolation of constitutive mutants, but it will not work if the enzyme has a very high affinity for substrate-inducer and an efficient permease system. Francis and Hansche (1972) used continuous culture to select an altered acid phosphatase from Saccharomyces cerevisiae. Growth was limited by providing P-glycerophosphate as the sole source of phosphate, and the selection pressure was increased by buffering the growth medium at pH 6.0. This reduced the effective activity of the acid phosphatase by 70%.After 400 doublings they observed a change in the growth of the culture, and this was the result of a mutation in the acid phosphatase structural gene altering the pH optimum of the enzyme from 4.2 to 4.8 and restoring 40% of the activity lost by buffering the medium at pH 6.0. This, indeed, is an elegant example of combining the advantage of continuous culture with direct selection pressure on the enzyme. The role of a n enzyme can be modified under selective pressure. Enzymes used in anabolic functions can be used to fulfill catabolic functions. Stalon et al. (1972) have shown that the catabolic ornithine carbamyltransferase ofPseudomonas can fulfill an anabolic function if, by one or possibly several mutations, the allosteric constraint that
GENETICS OF APPLIED MICROBIOLOGY
57
makes the enzyme normally unresponsive to low concentrations of carbamylphosphate is released. Selection of enzyme overproducers based on a metabolic dependence for a reversed enzymic reaction can be regarded as a means for isolating regulatory mutants. Numerous examples of recruitment of substrate-ambiguous enzymes for novel functions in bacteria have been described by Jensen (1976).
F. PERMEABILITY MUTANTS The specificity of many transport systems is low, and there are often several transport systems for structurally similar compounds (Jensen, 1976). If a compound can enter the cell by an existing constitutive permease, then it might be attacked by an enzyme of low specificity. The appropriate permease might also be induced by the compound. The rapid utilization of xylitol by mutant X3 isolated by Wu et al. (1968) depended on a third mutation, which resulted in a constitutive arabitol permease. Xylitol is transported into the cells by arabitol permease but it does not induce it. Thus mutant X3 owes its growth advantage on xylitol to (a) the constitutive ribitol dehydrogenase mutation of X1 (b) the mutation increasing the affinity of the constitutive ribitol dehydrogenase for xylitol occurring in X2, and (c) the mutation producing a constitutive arabitol permease occurring in X3. Alteration in cellular permeability can confer an apparently new metabolic activity on the cell. Pseudomonas putida cannot utilize p-carboxycis,cis-muconate, one of the intermediates of the protocatechuate branch of the p-ketoadipate pathway. The pathway enzymes are present, but their activity is cryptic in this case, since no suitable permease for the muconate is present. However, mutants can be isolated that have an inducible uptake system for the compound (Meagher et al., 1972). Yonedaet al, (1973) described an interesting mutant ofB. subtilis in which production of protease and production of a-amylase are simultaneously increased. DNA isolated from this mutant transformed the parent to high protease and amylase production. The phenotype was designated Pap and appeared to be the result of a mutation at a single locus. The Pap gene was not linked to the amylase regulatory gene (amy R), and coexistence of amy R and Pap in the same cell were synergistic. The presence of Pap-induced morphological and membrane-associated changes and made B. subtilis incompetent for genetic transformation. The Pap gene may play a role in enzyme excretion by modifying membrane permeability (Glenn, 1976; Priest, 1977). The role of membrane permeability in the production of com-
58
VEDPAL SINGH MALIK
mercial metabolites has been reviewed by Demain and Birnbaum (1968).Corynebacterium glutamicum, which excreted large amounts of glutamic acid, was isolated from soil (Udaka, 1960). This bacterium was later found to be a biotin auxotroph. Biotin regulates the ratio of saturated fatty acids to unsaturated fatty acids and thus affects membrane permeability (Izumi and Ogata, 1977). These cells excrete up to 98 gm of glutamic acid per liter. The addition of penicillin or detergent to molasses medium adequate in biotin or use of fatty acid- or glycerol-requiring mutants also affects membrane permeability (Cronan and Bell, 1974; Cox et al., 1975; McIntyre et al., 1977) and excretion of glutamic acid into the medium. Mutants of C. glutamicum have already been isolated that excrete lysine (44 gm/liter), alanine (40 gm/liter), homoserine (40 gdliter), or ornithine (26 gm/liter) (Arima, 1977; Yamada et al., 1972). Subden et al. (1977) isolated two classes of polyene-resistant mutants from survivors of NTG treatment of a wild-type Candida albicans. One class of these mutants accumulated lichesterol and fecosterol, and the other class accumulated eburicol, obtusifoliol, and lanosterol with minor quantities of C,, sterols. Since sterols are an integral part of the cell membrane, it is likely that these mutants, with altered sterol metabolism, would show pleiotropic membrane permeability effects. As a matter of fact, Cephalosporium acremonium or C. polyaleurum resistant to the polyene antibiotics nystatin, kabicidin, or trichomycin produced per liter more than 10 gm of cephalosporin C (Takeda Chemical Industries, Ltd., Japan, 1975a). Komatsu and Kodaira (1977) isolated a mutant of Cephalosporiurn acremonium with an enhanced potential to utilize sulfate for cephalosporin C production. The mutant had an enhanced L-serine sulfhydrylase activity, which led to increased sulfate utilization and methionine sensitivity by maintaining a high-level cysteine pool. Britten and McClure (1962) have shown the rapid exchange of molecules between the intracellular pool and external environment. A general aromatic permease is involved in both the uptake and loss of tyrosine from the cell (Brown, 1971). If the same transport molecule is involved in both uptake and efflux of an amino acid, then the uptake process must be more efficient than efflux, so that the amino acid accumulates in the intracellular pool. This is possible by a change in the permease affinity from a low affinity for a molecule in the intracellular environment to a high affinity for the same molecule in the external environment. Cells having a permease with a lowered affinity for extracellular molecules will lose these molecules and will excrete and overproduce them (Halsall, 1975).
GENETICS OF APPLIED MICROBIOLOGY
59
G. INCREASE IN RESISTANCE TO ITSOWNMETABOLITE Differences in the biosynthetic activity of various strains might be due to the differences in the level of their resistance to the antibiotic they produce (Malik and Vining, 197213; Cella and Vining, 1974; Makerivich et al., 1976). This resistance could be increased by mutation or by physiological adaptation upon growth in the presence of gradually increased concentrations of the antibiotic. This method is most effective during the initial stages of strain improvement. Katagiri (1954) attained a 4-fold increase in antibiotic productivity of S . aureofaciens by repeated transfers of the standard strain in a medium containing 200-400 pg of chlortetracycline per milliliter. The resulting variant was unstable, and its ability to produce antibiotic gradually dropped to the original level. Veselova (1967) investigated the productivity of different strains of S . aureofaciens and S . rimosus growing in media with a supplement of chlortetracycline or oxychlortetracycline (200- 1000 pglml) and compared it with strains induced by mutagenic factors. The treatment with tetracycline produced a n increased number of high antibioticproducing clones, whereas an increased frequency of low-producing variants was found among mutagen-treated populations. The resistance of each strain t~ increasing concentrations of the antibiotic was in direct proportion to its production capacity. The inhibitory effect of the antibiotic selectively deprives the population of low-producing, antibiotic-sensitive forms. Dulaney (1953) reasoned that the ability of Streptomyces griseus to produce streptomycin was limited by its sensitivity to a high concentration of streptomycin in the medium. Therefore, Dulaney selected a Streptomyces griseus variant that was resistant to 600 units of streptomycin per milliliter and then mutagenized it with UV light and X-rays. After eight different stages of selection, streptomycin production was elevated to 2000 unitdml from the original 250 unitdml. TO GENERATE MOLECULES WITH ALTERED H. MUTATIONS BIOLOGICAL ACTIVITIES
The structural distinction between active and inactive metabolites is sometimes slight. Polyacetylenes diatretyne I and diatretyne I1 are both produced by the same organism and largely by the same mechanism, yet only diatretyne I1 is a n antibiotic (Anchel, 1955). Diatretyne I, H02C*CH=CH.C=C*C=C-CONHz,is inactive; diatretyne 11, HO,C.CH=CH.C=C*C=C=N, is a n antibiotic.
60
VEDPAL SINGH MALIK
It is important to stress right at the outset that a n organism can produce only those structures for whose synthesis it has genetic information. E . coli cannot produce lincomycin but might be able to produce an analog of tyrosine if the specificity of certain of its enzymes was altered by mutation. Some years ago Kelner (1949) showed that mutants of Streptomyces whose parents had been inactive or weakly active in antibiotic production produced activities that had not been present in the antibacterial spectrum of the parent culture. Since these activities were not chemically characterized, evidence for the novelty of these activities is far from satisfactory. The activity of the mutants could be explained as follows. 1. They were higher producers of the same activity as that produced by the parent culture. 2. An alternative explanation is that mutants excreted an intermediate involved in the ultimate synthesis of the antibiotic produced by the parent culture, and this intermediate excreted by the mutant is more potent in spectrum and activity as compared to the parent compound. Such a n explanation is consistent with some published experimental data (Whitfield, 1975). Mutants of tetracycline-producing S . aureofuciens excreted 6-demethylchlortetracycline and 6-demethyltetracycline (McCormick, 1967). Methionine auxotrophs of S . uiridifmiens also produced 6-demethylchlortetracycline (Hendlin et al., 1962). Oxychlortetracycline is not usually produced in fermentation beers, but a mutant blocked in chlortetracycline synthesis accumulates 5a,l la-dehydrochlortetracycline, which is then converted by S. rimosus to oxychlortetracycline (Mitscher et a1., 1966). S . kanamyceticus mutants have yielded five modified kanamycins (Murase et al., 1970). A color mutant of S . peuceticus excreted 14 hydroxydaunomycin (adriamycin) instead of daunomycin (Arcamone et al., 1969).S . indicus, a producer of an antifungal antibiotic, has been mutated to produce an actinomycin-like antibiotic (Chakrakarty and Nandi, 1971). S. mediterranei mutants produce several new rifamycins lacking acetyl or methyl groups (White et al., 1974; Lancini et al., 1970; Lancini and Hengeller, 1969). Two mutants of S. caelestis synthesize N-demethyl-, 7-O-demethyl-, and N-demethyl-7-O-demethylcelesticetin (Argoudelis et al., 1972, 1973, 1974). All these compounds produced by mutants differ in certain functional groups from the parent antibiotic molecule, but the major carbon skeleton of the molecule remains the same. 3. The third interpretation of Kelner’s observation is only theoretical. The parent culture could be excreting an organic molecule that has no antibiotic activity; however, removal of a hydroxyl, methyl, ethyl,
GENETICS OF APPLIED MICROBIOLOGY
61
phosphate, adenyl, carboxyl, or nitro group from this biologically inactive organic molecule may confer antibiotic activity upon it. These types of mutations, which would confer antibiotic activity upon a biologically inert molecule, offer the hope of finding new families of antibiotics. With the exception of McCormick (1967) working on tetracyclines and Majer (1977) working on platenomycin, genetic techniques developed for the study of essential metabolic processes in bacteria have seldom been applied to the study of the biogenesis and regulation of antibiotics. Two approaches for selecting mutants affecting antibiotic synthesis are available. 1. Any mutagen could be used, and mutagenized spores or bacteria are plated on a medium on which the parent culture does not produce an activity against a given organism, e.g., P. aeruginosa.After colonies have been developed, plates can be overlaid with a lawn of the organism against which activity not produced by the parent culture on that particular medium is being sought. Nonproducers of antibiotics are detected by the lack of inhibition of the assay organism. 2. Advantage can be taken of the fact that NTG usually causes multiple mutations. Auxotrophs of a n organism could be isolated and examined for useful activity by tests for the antimicrobial spectrum and by chromatographic methods. The rationale for examining auxotrophs is that NTG has caused additional mutations affecting antibiotic synthesis, besides inducing auxotrophy. In contrast to mutations involving pathways in primary metabolism (which often are easy to detect, for frequently they lead to death or nutritional dependence on media factors), mutations deleting enzymes in secondary metabolism are not usually lethal. Most cells can survive whether they produce antibiotic or not. To make the detection of productive mutants easier, the technique of cosynthesis can be used. Cosynthesis depends upon the use of two nutritionally intact (prototrophic) blocked mutants, neither of which is able to synthesize the antibiotic alone. If certain conditions are met, growth of two nonantibiotic-producing mutants can produce an antibiotic. Consider mutants A and B-one blocked (lacking at least one important enzyme or cofactor for a given step in the sequence) early in the sequence, and the other blocked late in the sequence. (Blocked late)
Mutant A
(Blocked early) Mutant B
Block
1-2-3&+ Block
1L2-34-
antibiotic antibiotic
If a stable intermediate is assembled by mutant A, excreted into the
62
VEDPAL SINGH MALIK
medium, and taken up by mutant B, mutant B has the necessary enzymes to finish the synthesis. This method allows one to detect the presence of a stable intermediate and to demonstrate its biological capabilities. Barring coincidence, positive results in this intact cell system are meaningful whereas negative results could be due to permeability problems, instability of the intermediate, etc. Net synthesis is detected by bioactivity and, given enough mutants, a block in the biosynthetic path can be located without using radiolabeled precursors. One problem of concern in all sequence work involving mutants or blocking agents is the possibility that some of the substances discovered may have good precursor activity but in fact are not true intermediates. Such shunt products could be converted into mainstream intermediates by enzymes not ordinarily involved in the regular biosynthetic route. An instructive example of this pitfall is 4-demethylaminopretetramids that arise by degradation of tetracycline. Certain intermediates could be toxic to the producing organism, so that the inability to carry out the step may cause them to accumulate to a toxic level, and such mutations might then become selflimiting. The size and complexity of deoxystreptamine antibiotics are barriers to the chemical modification of the intact molecules so as to improve their therapeutic value and also renders total synthesis of analogs commercially infeasible at this time. If the biosynthetic scheme for these antibiotics could be established, there exists a n oPportunity to synthesize analogs that are modified in various moieties of the molecule. This could be achieved by blocking the synthesis of the desired moiety, establishing the chemical structure of the precursor required by the blocked mutant for synthesizing the antibiotic, and feeding the mutant with chemically substituted analogs of this precursor. It might be easier to synthesize analogs of various precursors than of the intact antibiotic. Certain blocked mutants may excrete intermediates used in antibiotic synthesis, and these excretors could be directed to make analogs of some intermediates. Several conditions must be met before a n analog of a precursor will be bioconverted into a n analog of an antibiotic: (1) The analog of the precursor must be taken up by the cells of the antibiotic-producing organism from the growth medium. (2) The analog and each biosynthetic intermediate containing it must both bind to the appropriate enzyme and undergo desired bioconversions. (3) The analog should not be hazardously toxic to the producing organism. The striking structural similarity among the members of the
GENETICS O F APPLIED MICROBIOLOGY
63
aminocyclitols suggests a corresponding similarity in their biosynthetic mechanisms (Rinehart and Stroshane, 1976). Shier et al. (1969) isolated a mutant Streptomyces fradiae that was incapable of synthesizing neomycin in the absence of 2-deoxystreptamine, the aminocyclitol subunit common to this group of antibiotics. The related aminocyclitols, streptamine and 2-epistreptamine, both available by chemical synthesis, were incorporated by the mutant ofS. fradiae into four new antibiotics which have been named hybrimycins A, and A, (from streptamine) and hybrimycins B, and B, (from 2-epistreptamine). Selective hydrolysis of the hybrimycin A and B complexes yielded two new antibiotics named hybrimycins A, and B,, respectively. A survey of 29 analogs of 2-deoxystreptamine permitted the establishment of guidelines for future modification {Shier et al., 1973). A requirement for a 1,3-diamino functionality and for the 4-, 5-, and 6-hydroxyl groups in the configuration of 2-deoxystreptamine was established. Substitution on the nitrogen atoms that resulted in alteration of one or more of the steric, charge, or conformational properties produced analogs that were not converted to biologically active products by the mutant. By using the procedure of Shier et al. (19691, substituted analogs of paromomycin (Shier et a l . , 19741, kanamycin, as well as ribostamycin (Kojima and Satoh, 19731, butirosin (Claridge et a l . , 1974), sisomycin (Testa et a l . , 1974; Testa and Tilley, 1975; Daum et a l . , 1977; Rossietal, 19771, streptomycin (Nagaoka and Demain, 19751, and novobiocin (Birch, 1972; Lemaux and Sebek, 1973) have been produced. A fluorotryptophan-resistant mutant synthesized 4'fluoropyrrolenitrin (Gorman et al., 1968).
I. VIRUSES Actinophages can be used to select strains with increased antibiotic production (Nara, 1977). Morozova and Alikhanian (1966) selected two phage-resistant mutants of Streptomyces by growing the culture in the presence of the phage. Two streptomycin-resistant mutants each were obtained by selection on media with increasing concentrations of streptomycin (up to 10,000 units/ml). All four mutants showed a 25% increase in streptomycin production over the parent strain. Subsequently, all four strains were mutagenized with UV rays, and the increase in productivity of all four mutants outstripped that of the initial parent strain. The authors proposed that the superiority of phage-resistant mutants is the consequence of the mutagenic effect of phage and that a derepression of the specific genes controlling strep-
64
VEDPAL SINGH MALIK
tomycin synthesis occurs in streptomycin-resistant mutants. Phage are known to induce mutations in E . coli (Bukhari, 1976; Bukhari et al., 1977; Kleckner, 1977; Nevers and Saedler, 1977). Another possibility is that phage-resistant cultures are lysogens with altered membrane and surface properties. The membrane permeability could be altered so that streptomycin could be excreted in high yields but could not reenter the producing cell to exert regulatory or toxic effects. Lemke (19761 has suggested the possibility of a positive correlation between the presence of polyhedral viruslike particles and penicillin yield in Penicillium chrysogenum. P. notatum, and Aspergillus nidulans do not contain such particles but do indeed produce penicillin. Furthermore, Macdonald and Holt (1976) found viruslike particles in the wild-type strain NRRL 1951 and in representative mutants, impaired in penicillin yield, from each of the complementation groups. Therefore, there is no (firm) evidence of a relationship between the penicillin-producing capacity of a strain and the presence of polyhedral viruslike particles. However, other types of viruses could have a role in penicillin production. Bobkova et al. (1975) suggested a link between penicillin yield and the titer of a new P. chrysogenum virus called PBV5. Rautenshtein and Muradov (1968) reported that a strain of Actinomyces (Streptomyces, English) lost antibiotic production capacity upon elimination of a lysogenic phage from the cell. The antibiotic production reappeared upon lysogenization (Muradov and Rautenshtein, 1973). Alikhanian and Ilyina (1957) noted that actinophage brings about a great increase of morphological variation in Streptomyces olivaceus. Mutagenic effects of the actinophage were also demonstrated in two production strains of S . aureofaciens. Treatment with different phage types led to a 60-200% increase in the production of the antibiotic. The magnitude of the increase depended on the phage type and on the activity of the strain from which the phage had been isolated. Viruslike particles have also been found in Penicillium stoloniferum, P. funiculosum, P. chrysogenum, P. brevicompactum, Saccharomyces cerevisiae, Thielaviopsis basicola, Agaricus bisporus, Aspergillus foetidus, and Ustilago maydis (Lemke and Nesh, 1970; Lemke, 1976, 1977; Wickner and Leibowitz, 1977; Detroy, 1976). If further studies confirm a link between the presence of virus and enhanced antibiotic production, a great diversity of genetic manipulations of antibioticproducing genes would be possible, especially in view of the fact that viruses of the PBV series reproduce in E . coli (Tikchonenko et al., 1974).
GENETICS O F APPLIED MICROBIOLOGY
65
V. Gene Dosage
A. GENEAMPLIFICATION Gene amplification has commercial possibilities and will therefore be discussed. Under conditions in which growth is limited by a sluggish enzyme, the most frequent response by bacterial populations is amplification of the gene involved (Anderson and Roth, 1977). This is preferable to mutational alterations of the substrate specificity of an enzyme, since cells adapt to temporary stress without permanently altering their genetic constitution. While no industrially important instances of amplification have been reported, there are numerous examples of the phenomenon. Escherichia coli strains that synthesize P-galactosidase up to 25% of the total cellular protein were isolated by long-term growth selection in a chemostat containing limiting lactose as the sole carbon source (Horiuchi et al., 1963). Initial selection in the chemostat yielded constitutive mutants. These were later replaced by strains that produced 4-fold normal P-galactosidase levels; these strains were harboring up to four tandem copies of the constitutive lac operon. Less than three chromosomal minutes in length are duplicated in these unstable strains. The hypersynthesizing character is unstable: segregation of stable haploid strains through loss of the extra gene sets is rather frequent. E . coli does not use sodium lactobionate as a carbon source since lactobionate is poorly bound and hydrolyzed by P-galactosidase. Mutations probably analogous to hypersynthesizing strains arise spon(Langtaneously in the presence of lactobionate at a frequency of ridge, 1969). Wild-type Klebsiella aerogenes can use ribitol as a sole carbon source because of inducible ribitol permease and ribitol dehydrogenase. Ordinarily, xylitol is not acceptable as a sole carbon source. However, continuous culture of a strain constitutive for ribitol dehydrogenase, using xylitol as the sole carbon source, has produced strains which grow well on xylitol. These strains have amplified the ribitol dehydrogenase gene and possess elevated levels of this enzyme (Rigby et al., 1974). Salmonella strains harboring tandem duplications of the histidine operon can be selected as those exhibiting increased enzyme expression under conditions that prevent full derepression of the operon. In strains harboring “down-promotor”(his Op) mutations, increased gene expression is selected as resistance to the histidine analog 3-amino1,2,4-triazole, a specific inhibitor of IGP-dehydratase. Duplication of the his B gene confers resistance. Resistant strains have amplified the
66
VEDPAL SINGH MALIK
entire operon, and 2-fold increases in his enzymes are found (Anderson et al., 1976). Legitimate recombination is involved in the formation of these duplications.
B. TRANSDUCTION Special transducing phages can be used to enrich and amplify specific bacterial genes. They arise by aberrant excision of the prophage and carry genetic material from those regions of the host chromosome that are adjacent to the site of the prophage integration. Genes from any region of the E . coli chromosome can be put on lambdoid phages using directed trans position (Gottesman and Beckwith, 19691, episome fusion (Press et al., 19711, or lysogenization of a host carrying a deletion of the phage attachment site (Shimada et al., 1972). Recently, approaches based on restriction endonucleases have made it possible to put any gene from any source on phage A (Murray, 1976; Cohen, 1975; Roberts, 1976; Murray and Murray, 1975; Borck et al., 1976). Expression of bacterial genes within the genome of the transducing phage may occur by transcription from the normal bacterial promotor present in the transposed genome or by continuation into bacterial genes of transcripts initiated at phage promotors. The latter process is facilitated by phage A’S N gene protein, which enables RNA polymerase to ignore termination signals. The yield of the transducing-phage gene product is further enhanced by preventing cell lysis while accelerating DNA replication and transcription. To date there have been no industrially significant applications of this genetic technology, but it is a well established research tool. For instance, the level of the lac repressor protein has been raised more than 1000-fold. The lac repressor is present as 0.002% of the total cell protein (10-30 molecules) in wild-type cells of E . coli (Gilbert and Muller-Hill, 1967). The Iq mutation raises the level by a factor of 20 in a diploid cell. The Is gene was put on a defective phage A, the lac genes replacing genes for late phage functions. Several hundred copies of this phage genome are made when triggered by heat to multiply, but the cell does not lyse since the late-function genes are absent. These cells, containing multiple copies of the Iq gene, have 0.5% of their total protein as lac repressor. An ISuPerq mutation makes 5-fold more repressor than does the Iq parent, so that the yield can be brought up to 2.5% of the total protein; this means several grams of pure repressor protein per kilogram of cells (Gilbert and Muller-Hill, 1970). The amber suppressor gene (Try SU,,,) maps close to the attachment site for bacteriophage $80 (Smith et al., 1970).Landyet al. (1967)
GENETICS OF APPLIED MICROBIOLOGY
67
took advantage of the position of this gene on the E . coli chromosome and isolated a defective transducing 480 in which a portion of the phage genome is exchanged for the Tyr SU,,, gene. The level of the gene product, tRNATur,is increased 10-fold following infection ofE. coli by this defective bacteriophage. A 500-fold overproduction of E . coli DNA ligase after induction of a hybrid A lysogen, constructed in uitro, has been reported by Panasenko et al. (1977). Moir and Brammar (1976) have evaluated several ways of maximizing the yields of products coded by A phages carrying the trp genes. The five trp gene products constituted more than 50% of the infected E. coli cell protein when trp genes were expressed from the trp operator in a trp R(repressor negative) host. In a trp R+ host, the multiple copies of replicating phage DNA (carrying the trp operator) titrated the repressor and overcame the tryptophan-mediated repression. This may not work for genes under positive control, as the availability of needed regulatory protein could be limiting. C. PLASMIDS Studies on R-factor transitioning in bacteria are another excellent example of the adaptive significance of tandem duplications and gene amplification (Clewell et al.,1975; Perlman and Stickgold, 1977). Cloning of genes in Col EI-type plasmids has resulted in significantly increased levels of enzymes of tryptophan and arabinose metabolism (Hershfield et al.,1974; Hopkins et al., 1976; Clarke and Carbon, 1975). Molecular cloning of genes of interest on derivatives of the Col EI plasmid permits the construction ofE. coli carrying multiple copies of specific genes or gene clusters (Sinsheimer, 1977; Curtiss, 1976; Collins, 1977; Beers and Bassett, 1977). Clarke and Carbon (1976) have prepared a collection of 2000 E . coli strains, each carrying a distinct hybrid Col EI plasmid into which a fragment of E . coli chromosomal DNA has been inserted. Hybrid plasmids are maintained a t 10-20 copies per chromosome and can be further amplified by growing E. coli in the presence of chloramphenicol (Clewell, 1972). Raetz et al. (1977) have identified two recombinant plasmids in the collection of Clarke and Carbon (19751 that carry the gene for phosphatidylserine synthase. Strains carrying these plasmids overproduce the synthase by as much as 15-fold as demonstrated by purifying the enzyme to homogeneity. The Clarke and Carbon strains should be useful for purifying other constitutive enzymes. Amplification, in E. coli, of the structural genes for rat pituitary growth hormone (Seeburg et al., 19771, human chorionic somatomam-
68
VEDPAL SINGH MALIK
motropin (Shine et al., 19771, and rat insulin (Ullrich et al., 1977) has already been achieved. These molecules may eventually be produced by microbial fermentation. Production of the human neurohormone somatostatin from a synthetic gene inserted into E . coli is a significant step in the direction of producing animal products in bacteria (Itakura et al., 1977). VI. New Gene Combinations
A. INTRASPECIFIC RECOMBINATION Up to this time, genetic recombination has not been explored widely as a method of producing strains of industrial importance. By the time that microbes producing metabolites of industrial importance are known to possess sexual reproductive mechanisms, the yields of the metabolites have been raised sufficiently by traditional mutagenesis methods. Evidence in support of the need for intraspecific recombination for improving yields of metabolites is hard to obtain. It will be important to decide whether recombination methods are essential for strain improvement or merely a n adventurous alternative to mutation. The mutational approach is most useful with haploid organisms since recessive mutations are readily detected. Dominant mutations in diploids often are associated with chromosome rearrangements leading to sterility or decreased fertility. In higher organisms, recessive mutants are seen after the additional inbreeding necessary to produce homozygosity. The diploid organism, with its dual set of genes, can mask a neutral or deleterious genetic trait. This genetic buffering potential allows for enhanced plasticity and hereditary variability. Preadaptive genes and gene combinations may be retained in a diploid population without being subjected to the selection that operates on strictly haploid species. At the population level, the differences in genotypic capacity between haploid and diploid organisms are quite impressive. For paired alleles at n loci, a haploid organism would generate 2" distinct genotypes whereas the corresponding diploid species could generate 3" genotypes. The genetic potential of a haploid is equal to its range of phenotypes. The number of possible phenotypes in a diploid species would be between haploid and diploid values for genotypes and is dependent on the proportions of dominant, partially dominant, and nondominant allelic pairs (Sinnott et al., 1958). Genetic plasticity is greatly enhanced in sexually reproducing diploids that have available
GENETICS OF APPLIED MICROBIOLOGY
69
the benefits of crossing over as well as those of chromosomal assortment. For diploids, recombination methods are initially more successful than mutagenesis, since heterozygotes from related gene pools may be crossed and so one can rapidly exploit the natural variability of the higher organism. With haploid microorganisms, the variability is usually induced by a mutagen in a single-cell isolate, and the strains crossed are not normally from related gene pools. In addition, chromosome aberrations induced by mutagens can yield inviable recombinants, in much the same way as these agents may lead to the production of inviable gametes in higher organisms. On the other hand, because of haploidy in microorganisms, natural genetic variability is rather small compared to that of eukaryotes, and the presence of interspecific mating barriers makes it unlikely that genetic recombination can be used easily for improving titers of microbial metabolites. There are theoretical reasons for considering recombination methodology for microbes, despite the drawbacks. High-producing industrial strains are saturated for various regulatory mutations and any further increase in yield of metabolites will require tremendous effort. In highly active strains isolated as a result of multistep selection, the frequency of inferior variants cancels that of superior mutations. Further mutagenesis induces a high frequency of morphological mutations and many better-yield strains begin to sporulate poorly. At this stage use of genetic recombination for titer improvement might be rewarding since it would bring along some desirable characteristic of the parent culture (good sporulation, phage resistance, good growth, lysis qualities, etc.). Many antibiotics and other products are produced by Streptomyces. Genetic recombination in a number of antibiotic-producing representatives of these prokaryotes has been reported (see Table 2). The relationship between strains is of decisive importance in breeding. In cases of closely related strains derived from a single prototrophic parent (consequently having similar genotypes controlling antibiotic production), no significant effect of crossing on antibiotic yield can be expected (Alikhanian, 1962, 1969, 1973). Alikhanian and Mindlin (1957) crossed biochemical mutants of two S. rimosus strains with an insignificant difference in their antibioticproducing ability. All prototrophic recombinants exceeded the biochemically deficient parents, but only a few of them were equivalent to the initial ancestor. Mindlin (1969) studied 19 crosses between biochemical mutants of two S. rimosus strains and concluded that there was no correlation between the amount of antibiotic produced by
70
VEDPAL SINGH MALIK
TABLE 2 Genetic Exchange in Actinomycetes Organism
Micromonospora purpurea, M . echinospora, M . chalcea Mycobacteriu m smegmatis Nocardia canicruria, N . erythropolzs," N . restrictus N . mediterranei" Streptomyces achromogenes ( I S . acrimycini" S . antibioticus S . aureofaciens S . bikiniensis" S . coelicolor" S . erythreus S. fradiae S . glaucescens" S . griseus S . griseoflavus S . kasugaensis S . lipmanii S . oliuaceus" S . rimosus"
S . scabies" S . sp. 3022a" S. uenezuelae" Thermoactinomyces uu lgaris
Antibiotic Gentamycins
References Beretta et al. (1971)
Tokunaga et al. (1973) Adams (1964)
Rifamycins Rubradirin
Schupp et al. (1975) Coats (1976)
D. R. Hopwood and H. M. Wright (unpub-
Oleandomycin Chlortetracycline Zorbamycin, zorbonomycin Actinorhodin, methylneomycin Erythromycin Neomycin
-
Streptomycin Novobiocin Kasugamycin Cephamycin
-
Oxytetracycline
-
Chloramphenicol C hloramphenicol
lished) Vladimirov (1966) Alikhanian and Borisova (1961) Coats and Roeser (1971)
Sermonti and Spada-Sermonti (1955) Li-Chuan-Lo (1962) Braendle and Szybalski (1957) Baumann et al. (1974) Braendle and Szybalski (1959) Saito (1958) Ichikawa et al. (1971) Y. Aharonowitz (unpublished) Matzelyukh et al. (1973) Alikhanian and Mindlin (1957); Friend and Hopwood (1971); AlaceviC et al. (1973) Gregory and Huang (1964a) Frances, et al. (1975a) Akagawa et al. (1975) Hopwood and Wright (1972)
" Circular linkage map with considerable resemblance as to location of various loci reported. Thermoactinomyces vulgaris has a transformation system; all others have a genetic system similqr t o conjugation.
GENETICS OF APPLIED MICROBIOLOGY
71
recombinants and by the parents. Borisova and Ivkina (1966) presented data on the activity of more than 1100 recombinants from crosses of various strains ofActinomyces streptomycini. Results show a tendency toward a regular decrease in antibiotic yield of recombinants in intraspecies crosses when poorly producing strains take part. Alikhanian and Borisova (1961) examined the prototrophic recombinants selected from a cross of auxotrophic mutants of S . aureofaciens, Prototrophic recombinants produced more chlortetracycline than the auxotrophic parents but usually did not exceed the level produced by the prototrophic ancestor. Only the cross of arg-3 x ilv yielded recombinants that were superior to the prototrophic parents. In a similar series of experiments (Borisova et al., 1962), most recombinants had a n antibiotic yield lower than or identical to that of the parent strains. However, some recombinants from the arg x ala crosses did produce 6% more antibiotic than the prototrophic parent. On the other hand, Jarai (1961a) obtained three types of recombinants from crosses of auxotrophs isolated from six strains of 5'. aureofaciens. Group one produced 40-60% more of the antibiotic than the prototrophic parents; the second group gave the same titer as the prototrophic parents; group three produced as little antibiotic as the auxotrophic parent. The most active recombinants were obtained from the arg x met crosses. Breeding of strains of different origin might increase the likelihood of obtaining highly active recombinants provided such crosses will be fertile. Experimental data on tetracycline production lend support to this view. Jarai (1961a) examined 278 recombinants obtained from a cross between two unrelated strains ofActinomyces aureofaciens. Up to 20% of the recombinants from nonrelated crosses exceed the productivity of the initial strain 1.5-fold. Mindlin (1969) obtained recombinants from a cross between a Hungarian and a Soviet tetracyclineproducing s.rimosus. A recombinant exceeded parent strains in antibiotic production. Most industrial strains for penicillin production have been derived from Wisconsin strain Q176. Q176 was derived from a wild-type P. chrysogenum strain (NRRL 1951). Macdonald and Holt (1976) have reviewed genetic investigations on the biosynthesis and overproduction of penicillin in P. chrysogenum and Aspergillus nidulans. The discovery of the parasexual cycle in P. chrysogenum led to forecasts of obtaining recombinants with useful characters including high penicillin titers (Pontecorvo, 1956; Pontecorvo and Sermonti, 1953). One approach was to synthesize heterozygous diploids between strains of relatively high penicillin yield and of divergent lineage which had been produced by successive mutagenic treatment. How-
72
VEDPAL SINGH MALIK
ever, segregants were mainly of one or another of the haploid parental type (Macdonald, 1968b). Differences in chromosomal morphology between the haploid parental strains (due to multiple mutagenic treatments) lead to infrequent recombination (Macdonald et al., 1964). In a diploid nucleus, heterozygous for a paracentric inversion, mitotic crossing-over within the inverted region will yield monosomics if division was equational for crossover and noncrossover. Monosomics will break down to haploids so that haploid segregation will occur at the expense of diploid segregation (Kafer, 1961). Translocations will also exclude haploid segregants other than those with parental genomes (Smith and Pateman, 1977; Simchen, 1965). Sermonti (1959) showed that not only are poor producers recessive in relation to the wild type, but so are the higher producers. The recessive character of high producers is also confirmed by Macdonald et al. (19631, who obtained diploids between a poor penicillin-producer and its high-producing descendants D-734 and Wis 54-1255. All three diploids produced penicillin in yields similar to that of the original ancestor, regardless of the activity of the auxotrophic parent. However, Elander (1967) obtained a superior diploid from two biochemical mutants of the high penicillin-producing strain E-15. A diploid from the progeny of a cross between strain Wis 50 and Wis 49 of the Wisconsin series greatly exceeded both parents in penicillin production. Besides loci directly involved in the synthesis of the penicillin molecule, a number of regulatory genes affecting control of primary metabolism may determine the quantity of antibiotic produced by a given strain. Therefore, the yield of penicillin produced by a diploid will be governed by the genealogical relationships of the initial strains. Distant heterozygotic strains highly derepressed in the regulation of primary metabolism may yield superior diploid progeny upon breeding. Alikhanian (1970) documented hybrid diploids that were superior to their auxotrophic ancestor, but not to their prototrophic ancestor. There was no definite regularity in the inheritance of the ability to produce penicillin. The penicillin-producing ability of auxotrophs governed that of the diploid, and the majority of auxotrophs produced less penicillin than the parent prototroph. This decrease in antibiotic production with auxotrophy is due to the pleiotropic effect of the biochemical deficiency in the auxotrophic strain. Since positive and negative mutations of the capacity for penicillin production are recessive to the wild type, and pleiotropic effects of auxotrophy express themselves in the heterozygous state, it is not easy to obtain heterosis with respect to penicillin production. Drug-resistance markers could be used in the genetics of industrial microbes because they do not have a negative
GENETICS OF APPLIED MICROBIOLOGY
73
effect on metabolite production as auxotrophy does, and they are convenient to score. Genetic analysis of high-titer industrial strains is also impeded by frequent somatic instability (Elander, 1967; Elander et al., 1977). Although several segregants with a relatively high yield of penicillin were obtained from diploid P. chrysogenum, none produced penicillin in excess of the higher-yielding original parent when tested again (Macdonald et al. , 19651. Parental genome segregation restricted the types of recombinants which could be isolated. Instability of diploids might be overcome by using a system of balanced lethal mutations. Nonhomologous recessive lethal mutations on separate chromosomes of a homologous pair of a haploidization group can be used to sterilize diploids against segregation by haploidization or mitotic crossing-over (Ball, 1973b; Macdonald, 1964; Azevedo and Roper, 1970; Parag and Roper, 1975). Ball (1971) has reported the creation of balanced lethality by mutagens of a diploid that had initially shown free recombination for three haploidization groups. Mutagens that do not cause gross chromosomal change (inversion, translocation, etc.) appear necessary for marking of strains for parasexual breeding purposes. Besides Penicillium, a number of other organisms produce penicillin. Holt and Macdonald (1968a) and Macdonald et al. (1972) exploited A. nidulans for studying the genetics of penicillin production. They isolated and mapped single titer-increasing mutations using classical Mendelian genetic techniques. However, the penicillin titer is usually inherited in a quantitative manner (Roper, 1965; Holt and Macdonald, 196813; Caglioti and Sermonti, 1956). Merrick (1975a,b) used quantitative methods of biometrical genetics (Caten and Jinks, 1976) to study the extent and genetic control of variation in penicillin yield in wild-type isolates of A. nidulans. Repeated hybridization and selection involving naturally occurring allelic differences among wild-type isolates produced progeny with increased penicillin titer. Four independently selected lines, each derived from a sexual cross between two different heterokaryonincompatible isolates, were established. In each generation, two selected high-titer sister strains were crossed to produce the next generation. Each line yielded an initial increase in penicillin titer, but, after five generations of selection, the rate of response and genetic variation was significantly decreased. From a base population of wildtype strains with a mean titer of 8.6 unitsiml, the mean penicillin yield was enhanced to 16-20 units of penicillin in each progeny line. The increase in antibiotic yield achieved in each selection was due to different genes for increased titer in each line (Merrick, 197513). This
74
VEDPAL SINGH MALIK
additive gene action is dependent on the crossing of initial isolates belonging to genetically diverse heterokaryon compatibility (h-c) groups (Jinks et al., 1966; Merrick and Caten, 1975a,b; Hopwood and Merrick, 1977). The gradual nature of the response suggests that in wild-type isolates ofAspergillus nidulans the yield of penicillin is under the control of many genes and that gene action throughout the selection program was predominantly additive (Merrick and Caten, 1975a). The results of Merrick (1975b) offer the hope that hybridization may yield improved strains of industrially important organisms. Quantitative genetic analysis can, indeed, help the analysis of polygenic systems involved in antibiotic production (Caten and Jinks, 1976). Genetic attempts to alter the linear growth rate in Schizophyllum commune (Simchen, 1966a,b) and Neurospora crassa (Papa et al., 1966) support the work of Merrick (1975b). There was a rapid drop in genetic variation and an associated decrease in the rate of response to selection in the experiments of both Papa and Simchen. Two factors might be responsible for this pattern: (1) ignoring any effect of selection, the program of side mating used in all three studies alone leads to halving of the genetic variance in each generation; or (2) fixation of advantageous alleles through selection occurs more quickly in haploids than in diploids where the dominant allele is easily selected but the masked recessive allele is not selected against. Thus, line selection, with its associated high levels of inbreeding, leads to significant changes in the characters under study. The results of these studies suggest that, to obtain the maximum response, no single line should be continued for more than five or six generations. Frequent introduction of new genetic variation from wild isolates or selection lines is necessary to replenish the gene pool. A heterokaryon test between two mutant strains of Aspergillus nidulans indicated that penicillin production was under nuclear rather than cytoplasmic control (Holt and Macdonald, 1968). Recombinant progeny obtained from sexual crosses between various wild-type isolates produced increased a m o u n g f penicillin (Holt and Macdonald, 1968). Data for one cross between wild-type isolates and crosses of a strain carrying a titer-enhancing mutation with two independent wild-type isolates suggest the presence of large titer-increasing nonallelic interactions in the parents (Cole et al., 1976). Crosses between wild-type isolates can yield recombinants producing more penicillin than their parents (Holt and Macdonald, 1968b; Merrick and Caten, 1975b). It should be possible to breed superior strains from the pool of natural variability by conventional hybridiza-
GENETICS OF APPLIED MICROBIOLOGY
75
tion and selection procedures over a series of generations. Improved hybrids can also be constructed by fusing the protoplasts of significantly different naturally occurring isolates (Solingen and Platt, 1977). To maximize the genetic variation in the base population for such a selection program, the initial parental isolates should be heterokaryon-incompatible. This conclusion is of significance, since parents chosen purely on the basis of titer could easily be compatible, with consequent restriction of the available genetic variation. Background genetic information concerning the parents to be used in any strain improvement program is important. Conventional microbial breeding has relied on induced mutagenesis as the source of genetic diversity and variability by which to break restrictions on such desirable microbial characters as yield, sporulation, and phage resistance. To make real gains, for industrial purposes, it will be necessary to make crosses between genetically distinct parents so as to reach a maximum level of heterosis and maximum yield of metabolite. Techniques of protoplast fusion should be explored to develop industrial strains from widely divergent parental types that might otherwise not be genetically promiscuous (Steplewski and Koprowski, 1970; Zelitch, 1975; Grimsley et al.,1977; Fowke et al.,1977; Sacristan and Melchers, 1977; Day, 1977). B. INTERSPECIFIC RECOMBINATION (HYBRIDIZATION) Hybridization is defined as the crossing of two different species to obtain a new one (Hin, 1976; Li, 1962). It has been used extensively in animal and plant breeding, but has not been significantly applied for selecting commercially useful microbes. Hybridization between different microbes should yield improved strains for industrial purposes (Kosikov, 1975). Breeding between two different species can involve crossing of hundreds of different genetic characteristics. One may choose one parent because of vigorous growth or phage resistance. The other one might be selected because of its fine sporulation quality, its ability to utilize a n unusual substance for growth, or its high metabolite production. However, phenotypic results are not always predictable. Often, because of the new combination of genes, hybrid progeny possess qualities absent in both parents. This is both the promise and the problem of hybridization. Hybrids have been used to examine the behavior of genes in a new host (Bloom et al., 1977) and in understanding host-phage relationships (Gemski et al.,1972). Hybrids obtained by substitution ofE. coli chromosomal genes with Klebsiella-nitrogen-fixinggenes do not absorb
76
E . coli phage
VEDPAL SINGH MALIK
+
X174 (Cannon et al., 1974).E. coli-Salmonella typhosa hybrids absorb phage A but do not support phage growth because they lack the locus necessary for A gene N expression (Friedman and Baron, 1974; Baron et al., 1970). Integration of a foreign donor DNA fragment into a recipient genome depends on the extent of genetic and physical homology between the two genomes (Demerec, 1965; Brenner and Falkow, 1971; Backman et al., 1976; Sanderson, 1971,1976).The similarity of genetic maps of some repre entatives of the genus Streptomyces (Baumann and Kocher, 1976; Ma elyukh, 1976) and the report of infectious transfer of the plasmid ScP, between various Streptomyces species (Hopwood and Wright, 1973a) indicates the possibility of hybridization. Soon after the discovery of genetic recombination in S . aureofaciens (Alikhanian and Borisova, 1961) and in S. rimosus (Alikhanian and Mindlin, 19571, several investigators (Jarai, 1961a; Polsinelli and Beretta, 1966; Mindlin, 1969) examined the possibility of utilizing genetic recombination for interbreeding these production strains. Single or double auxotrophic mutants that were resistant to streptomycin and differed in antibiotic-producing capacity were crossed. Nutritional mutations usually exerted a negative effect on antibiotic production. Most auxotrophs of S. aureofaciens and S. rimosus produced at most 10%as much antibiotic as the prototrophic parent. Alacevik (1969) also described interspecific recombination between S. aureofaciens and S . rimosus. This author has emphasized the morphological markers or other taxonomic characteristics of recombinants, but does not provide any data on the antibiotic production. Blumauerova et al. (1972), however, crossed mutants of S. rimosus producing trace amounts of aureovocin with mutants of S . aureofaciens. Recombinants phenotypically resembled S. rimosus and produced aureovocin equivalent to that produced by S. aureofaciens. These hybrid recombinants should be further exploited genetically. Lomovoskaya et al. (1977) examined recombinants from crosses of S. coelicolor A3 (2) and S. griseus. It is difficult to obtain mutations that block intracellular growth of virulent phages or block adsorption of temperate phage. Moreover, actinophage-resistant S. griseus produce less grisin than do sensitive strains (Zvenigorodsky, 1975). Grisinproducing hybrid recombinants, capable of restricting phages attacking s. coelicolor and griseus, were obtained. Since these two Streptomyces species are mutually antagonistic, conditions were created to allow normal crossing. Spores of streptomycin-sensitive S.griseus, as donor, and streptomycin-resistant S. coelicolor (UF), as recipient, were germinated separately. When
,B
s.
GENETICS OF APPLIED MICROBIOLOGY
77
they were mixed on streptomycin-containing medium, recombinants emerged at low frequency. These recombinants generated heterogeneous progeny with various auxotrophic markers. Most were of the S . coelicolor genotype, but some differed from both parental strains. Unlike the situation when heteroclones from S. coelicolor crosses were examined, only a limited number of recombinant classes were obtained among the progeny of such interspecies heterogenotes. Owing to imperfect structural homology between the chromosomes of S . coelicolor and S. griseus, many recombinants are unbalanced and lethal. Heteroclones and recombinants generated in crosses between A3 (2) derivatives may be structurally different from those produced in breeding between S . coelicolor and S . griseus. The latter may involve extrachromosomal elements that are not integrated into the chromosomes of S. coelicolor and could eventually be lost or preserved in heteroclone progeny. The cells containing such elements, with small chromosomal segments integrated phenotypically, would resemble haploid recombinants. The recombinant RCG1, obtained from a cross betweens. griseus and S. coelicolor UF (SCP1-) strains, phenotypically resembled S. coelicolor UF strains and in crosses with a S. coelicolor NF donor strain, produced recombinant progeny at a frequency of 100%. Another recombinant, RCG,, behaved like SCP,-carrying S. coelicolor. In crosses between S. griseus and RCGI, recombinants were 100 times more frequent than in crosses between S. griseus and S . coelicolor. S. griseus and RCG, transferred chromosomal markers into RCG, and S. coelicolor suggesting that S . griseus had donor properties. This donor ability may be due to the presence of a plasmidlike SCP, in S. griseus and RCG,. C. TRANSFORMATION Even though there are many reports of genetic recombination among Streptomyces, few cases of purified DNA-mediated transformation (to construct hybrids) have been documented. Harada (1959) transformed S . olivaceus with DNA ofS. griseus using streptomycin production and resistance as the genetic markers. Horvath and Buday (1960) examined the effect of DNA of various origins on antibiotic production by Streptomyces. Besides antimicrobial activity, the transformants acquired some morphological characteristics, including formation of aerial mycelia and changes in colony shape. Similar experiments with S. rimosus showed that oxytetracycline-synthesizingcapacity can be conferred on inactive UV mutants by treatment with the DNA of wild-
78
VEDPAL SINGH MALIK
type S. rimosus (Matselyukh, 1964a). Intraspecific transformation of auxotrophic mutants of both S. olivaceus and S . aureofaciens have also been reported (Matselyukh, 1964b). Jarai (1961b) has also claimed transformation of S. aureofaciens auxotrophs to prototrophy by S. griseus DNA but Matselyukh (1963a,b) failed to transform for streptomycin production in interspecies attempts. The results of Biswas and Sen (1971b) suggest that successful heterotransformation among Streptomyces producing the tetracycline group of antibiotics was not possible. This is rather strange since genetic recombination in crosses between S. aureofaciens and S . rimosus (Polsinelli and Beretta, 1966) suggests some genetic homology between the two species. Ramachandran et al. (1965) claimed that antifungal characteristics of thiolutin-producing S. pimprina were stably conferred on a chlortetracycline-producingS. aureofaciens by purified DNA transformation. The recipient showed no morphological changes but produced both antibiotics: chlortetracycline and thiolutin. A candicidinproducing strain of S. griseus acquired antibacterial properties when transformed with the DNA of another S. griseus (Biswas and Sen, 1971a). Biswas and Sen (1971b) also investigated intraspecific and interspecific transformation in Bacillus with respect to antibiotic production. In intraspecific transformation in B. subtilis, 5 of 10 strains used as recipients were transformed. An inactive strain was transformed with DNA from a bacitracin-producing Bacillus to the production of an antibiotic indistinguishable from bacitracin. The bacitracin-producing strain itself was transformed with DNA from other Bacillus strains and acquired the property of elaborating an antifungal antibiotic while retaining its original antibacterial activity. All attempts at transformation of B. cereus, B. circulans, B . firmus, B. laterosporus, and B. megaterium with B. subtilis DNA failed. Mergeay et al. (1970) reported the correction of methionine auxotrophs ofB. subtilis with S. coelicolor DNA, but it is not certain whether this is a DNA induced reversion, suppression by a point mutation, or a true gene correction. The phenomenon is reproducible, though it occurs at a low frequency. The inefficiency of transformation by heterospecific DNA could be due to restriction of donor DNA or to lack of homology between the base sequences of donor and recipient genomes (Stuy, 1976; Biswas and Ravin, 1976). That a substantial part of the inefficiency is, in fact, due to the latter is suggested by the production of genetically hybrid DNA which is intermediate in its transforming properties between the DNAs of the original donor and recipient (Ravin and Chakrabarty, 1975).While heterospecific transformation could not be detected at most genetic loci, transformation with reduced
GENETICS OF APPLIED MICROBIOLOGY
79
frequency did occur a t two well-separated regions of the chromosome, str and leu-ile (Biswas and Ravin, 1976). Application of heterospecific transformation for increasing the output of a particular strain by enhancing t h e level of protease and amylase production in Bacillus has already been demonstrated (Yamaguchi et al., 1974; Yoneda et al., 1974). Yoneda et al. (1974) achieved transformation of B. subtilis for a-amylase productivity with DNA from B. subtilis var. amylosaccharitis.
D. PLASMIDS Use of bacterial plasmids as vehicles in transmission of industrially important genetic information is possible. The initial research in genetic engineering emanated from the earlier discovery that certain hydrocarbon dissimilatory processes are specified genetically by transmissible, extrachromosomal elements. By conjugational processes, Chakrabarty (1976) constructed a n organism able to degrade approximately 75% of the components comprising crude petroleum. Now patented, this “super bug” technology may play a significant role in elimination of environmental problems associated with oil spillage. Present technology is a long way away from successful application to higher organisms. Potential benefits of the research with recombinant DNA are: (1)more knowledge about eukaryotic chromosomes, (2) improved fermentation processes, (3) increased efficiency of nitrogen fixation, (4)new hybrid plants and animals, ( 5 ) good yield of substances previously difficult to produce (interferon, specific antibodies, human growth hormone, insulin, vaccines, antibiotics), (6)genetic therapy andor cure of hereditary diseases. The Pseudomonas aeruginosa plasmid RP, can be transferred to several gram-negative bacteria, such as Escherichia coli, Salmonella typhimurium, Klebsiella aerogenes, Rhizobium leguminosarum and Agrobacterium tumefaciens (Chakrabarty, 1976). Five Staphylococcus aureus plasmids coding for tetracycline or chloramphenicol resistance have been introduced by direct DNA transformation into Bacillus subtilis. Plasmids replicate and express antibiotic resistance in the new host (Ehrlich, 1977). These studies indicate the great potential for genetic exchange between diverse bacterial species. A number of antibiotic resistance loci have the important property of transposing themselves from one replicon to another (Bukhari et al., 1977). In Escherichia coli the TEM-1 and TEM-2 p-lactamase genes of several plasmids can insert into the bacterial chromosome, other plasmids and temperate bacteriophages. Benedik et al. (1977) have shown that the
80
VEDPAL SINGH MALIK
P-lactamase transposon of the RP, plasmid can insert itself into the P. putida SAL and CAM-OCT plasmids. Genes of interest can be isolated and ligated in uitro to plasmids or phages (Brown, 1973; Brown and Stern, 1974; Fournier et al., 1974; Bachman et al., 1976; Ganem et al., 1976; Bahl et al., 1977; Primrose, 1977). These recombinant plasmids can be used to transform recipient strains that are deficient in the DNA restriction system and that will support multiplication of such hybrid DNA molecules (Chater and Wilde, 1976; LeBlanc and Hassell, 1976; Lovett et al., 1976; Roelantset al., 1976). A hybrid molecule constructed from E. coli plasmid PMB9 and a fragment B . subtilis DNA converted leucine auxotrophs ofE. coli to prototrophy, but failed to replicate and survive in B. subtilis. The rare leucine transformants isolated from B. su btilis resulted from chromosomal integration of a B. subtilis DNA fragment. No tet' B. subtilis colonies were found, indicating that the tetracycline drugresistance marker did not get expressed in B. subtilis (Mahler and Halvorson, 1977). This is not surprising, since pMB, does not have a complete TnlO transposon. One of the long-term benefits that may well come from research on in uitro recombinant DNA is better crops, genetically engineered to our requirements. A promising avenue of approach is the use of plasmids rather than transducing phage for transfer of prokaryotic DNA to plants (Hughes et al., 1977). It is clear that crown-gall disease caused by Agrobacterium turnefaciens is the first example of a natural system in which Ti plasmids of the bacterium play a part in regulation of gene expression in eukaryotic cells (Vanlarebeke et al., 1977; Chilton et al., 1977). This raises the obvious possibility of using Ti plasmids for introducing specific bacterial genes into plants. One of the most interesting applications would be integration of the nitrogen-fixing genes fromRhizobium and other bacteria into crop plants. The current interest in nitrogen fixation reflects the desire that an increased amount of the fixed nitrogen in crops should come from biological nitrogen fixation rather than from energy-expensive fertilizer. If nif genes are to be introduced into new hosts, suitable vectors must first be obtained. The nif genes of Klebsiella have already been translocated onto the RP4 factor. If this RP4-nif factor could be integrated into the Ti plasmid, it could be used to convey nitrogen-fixing capacity (Vanlarebeke et al., 1977; Hollaender, 1977; Rao, 1976; Bassham, 1977). Evidence that DNA from the crown-gall bacterium, Agrobacteriurn tumefaciens, does in fact integrate into plant DNA has been shown by Drummond et al. (1977). They showed that DNA isolated from crown-
GENETICS OF APPLIED MICROBIOLOGY
81
gall tissue specifically hybridized with one particular fragment derived from Sma I digestion of the large tumor-inducing (Ti) plasmid ofA. tumefaciens. This integrated plasmid was present in about 20 copies per cell and was transcribed in crown-gall tissue. These results are complemented by the observation that in some cases Ti plasmids contain large hairpin loops characteristic of some translocating sequences. In a strain that had lost the ability both to degrade octopane and to induce tumors, one 400 pm-long loop was missing (Lippincott, 1977; Vanlarebeke et al., 1977). An F' nif factor (Cannon et al., 1977) may provide a useful genetic tool for the study of the nitrogen-fixation genes, their expression and their regulation, since all mutants ofE. coli that have been isolated in the last two decades are now potential hosts for nifgenes. The plasmids can also be used for intergeneric transfer of nif (Boucher et al., 1977). However, the restricted host range of F, the large size of the plasmids and their tendency to dissociate limit their value for intergeneric transfer. In the hands of Cannonet al. (1977) transfer and expression of his and nif on a plasmid was limited to three out of five enteric genera tested: Klebsiella, E . coli, S . typhimurium. These studies provide only circumstantial evidence that the nif genes on the plasmids are, in fact, structural genes determining nitrogenase synthesis. If cryptic nif genes were present in the recipient Escherichia, Klebsiella, and Salmonella species, the plasmids might only have carried a regulatory determinant allowing expression of cryptic nif. Although this is a n unlikely prospect, a precedent for the existence of cryptic nif in microbes exists. Strains ofRhizobium that do not fix nitrogen away from the host plant have been shown to carry nif genes (Child, 1975; Scowcroft and Gibson, 1975; Trinick and Galbraith, 1976). Plasmid-mediated transmission of eukaryotic genes into prokaryotes is of interest. Ullrich et al. (1977) have already taken the first step toward the production of insulin by microbial fermentation. They claim to have inserted a rat gene encoding insulin into E . coli X1776, after ligating it to the plasmid vector pMBS. The pMB,-insulin gene hybrid is replicated reliably. It is now known that the gene is expressed to form insulin molecules, but it is hoped that soon human insulin could be made by microbial fermentations in large quantities at a lower price. Other peptide hormones (ACTH, growth hormone, and prolactin) may also be made by this same technology, as well as natural products, such as heparin, silk, immunoglobulins, and interferon. Other applications of genetic engineering include microbial processes for purification of precious metals.
82
VEDPAL SINGH MALIK
E, TRANSDUCTION P, is a general transducing phage (Mise and Arber, 1976) isolated from Escherichia coli Li that can infect many species of enteric bacteria (Mojica-a, 1975; Rigby et al., 1976). Gene transfer to a taxonomically distant myxobacterium by P1 is also known (Kaiser and Dworkin, 1975). P1 transduction has been used to create intergeneric hybrids of enteric bacteria by moving the gln A and hut genes between Klebsiella aerogenes, Escherichia coli, and Salmonella typhimurium (Tyler and Goldberg, 1976). Streicher et al. (1976) were able to transfer the gln A locus between K. aerogenes and K. pneumoniae. P1 does not transport the kanamycin or chloramphenicol resistance gene into Streptomyces (V. S. Malik, unpublished). Streptomyces may lack surface structures that are necessary for adsorption of P1. A suitable vector for cloning genes in Streptomyces might be an actinophage. Restriction enzyme methodology would allow one to construct an actinophage that has a drug-resistance marker on it. The hybrid between coliphage P1 and an actinophage could have the restriction system and generalized transducing properties of P1 and cell surface-receptor specificity of the actinophage. This hybrid phage should lysogenize and reproduce in a Streptomyces cell. If for some reason it did not replicate, the gene of interest (e.g., ampicillin resistance) might be transposed to the chromosome. Okanishi et al. (1966) have claimed that DNA of actinophage PK-66 can infect protoplasts of S. kanamyceticus. The mature phages thus formed were confirmed as PK-66 phage by neutralization with antiPK-66 serum and by host range, but they did not further infect protoplasts under the conditions used in their experiments. The infectivity of actinophage DNA was markedly affected by pH, with an optimum of pH 6.0. Among the inorganic salts added to the infection mixture, CaC1, completely inhibited the infectivity and MgS04 decreased the infectivity. The infection mixture with added CaCl, exhibited a pH of 5.0 after 16 hours of incubation. This low pH may be the cause of inhibition of phage infection. The infectivity was not inhibited by trypsin and ribonuclease but deoxyribonuclease abolished the capacity of DNA to produce phage. Transducing phages are capable of introducing selected bacterial genes into plant cells. After exposing sycamore cell suspensions to the specialized transducing phage A plac, Johnson et al. (1973) successfully demonstrated expression of A lac genes in these cells, whereas untreated sycamore cells could not assimilate lactose. Doy et al. (1973) carried out similar experiments using tomato callus. Inoculation with
GENETICS O F APPLIED MICROBIOLOGY
83
A pgal+ enabled callus cells to grow slowly on 2% galactose medium for up to 1 5 weeks, whereas untreated cells and controls ( A pgal- with an amber nonsense mutation in the gal operon) died within 3 weeks. Although these results are intriguing, explanations for these observations, other than genetic modification, should be explored. It has been claimed that in tomato callus treated with 480 lac+ E . coli P-galactosidase specifically is synthesized, but no such indication was obtained by Johnson et al. (1973). It is claimed that the biochemicalimmunological test of specific protection a t 60°C is definitive at molecular levels for bacterial P-galactosidase, but it should be critically reappraised, since plant P-galactosidases are present in sycamore cells (Keegstra and Albersheim, 1970) and probably also in tomato callus. Horst et al, (1977) transferred genetic information from E . coli to human cells by A plac (carrying the bacterial P-galactosidase gene). Cultured skin fibroblasts, from a patient with generalized gangliosidosis, which lack P-galactosidase activity were incubated with the bacteriophage A plac or with A plac DNA. The expression of the E . coli lac genes could be demonstrated as a higher level of P-galactosidase activity.
F. CELLFUSION Development of advanced techniques for culturing cells isolated directly from plants or animals has led to comparable advances in the area of somatic cell hybridization (Evans and Barber, 1977; Ringertz and Savage, 1976; Jones et al., 1976). Fungal protoplast fusion (Anne and Peberdy, 1976) and heterokaryon formation have been reported between auxotrophic mutants of Geotrichurn and Candidurn (Ferenczy et al., 1974; Ferenczy and Maraz, 1977). Protoplast fusion and isolation of heterokaryons and diploids from vegetatively incompatible strains of A. nidulans have also been claimed (Dales and Groft, 1977). Hopwood et al. (1977) recombined actinomycete strains a t high frequency with a procedure that depends on polyethylene glycol-induced protoplast fusion and regeneration. Recombination frequencies achieved by this technique are such that selectable markers from significantly different ancestors could be incorporated into industrial strains. Recombination occurring after protoplast fusion of s. coelicolor, s. acrirnycini, lividans, S. parvulus, and S. griseus is independent of sex-factor activity and should therefore occur even in wild-type isolates that lack sex factors. By protoplast fusion, markers of two parents can be combined without any loss due to selection, allowing rapid construction of complex genotypes.
s.
84
VEDPAL SINGH MALIK
G. HETEROKARYOSIS Diplophase yeast strains with increased vigor with respect to ethanol synthesis, ergosterol synthesis, and starch hydrolysis have been used industrially (Kosikov, 1975; Kosikov and Raevskaya, 1976; Kosikov et al., 1977; Elander et al., 1977). The Japanese improved production of soy sauce and other fermented foods through diploid hybridization of selected strains of the heterothallic haploid yeast Saccharomyces r o u i i (Mori and Onishi, 1967). In filamentous fungi, the parasexual cycle provides a means for selecting cells with increased numbers of genes. Uchida et al. (1958) attempted to produce interspecific hybrids between Aspergillus oryzae and Aspergillus sojae. Elander et al. (1973) described the WC-9 diploid strain ofPenicillium that has considerable vigor with respect to formation of P-galactosidase, glucose oxidase, and alkaline protease. The diploid state of the organism may be responsible for the enhanced synthesis of these three enzymes. It seems that the use of the parasexual cycle in fungi to yield efficient diploid strains would be a reasonable approach. Despite the large volume of literature pertaining to the use of fungi in bioconversions of steroids, this author knows of no reports of application of artificially induced diploids for significantly improved bioconversions. The stable diploid (ylo metlwhi ade) ofPenicillium synthesized at the Lilly Laboratories produces large yields of phenoxymethyl penicillin. Its homogeneous colony population pattern and its limited parental genome segregation are probably significant factors resulting in high penicillin accumulation (Elander et al., 1973). Desirable dominant alleles from both parents may be masking many undesirable recessive traits. Ciegler and Roper (1957) obtained heterokaryons between active and inactive strains of A . fonsecaens, a producer of citric and glucuronic acid. These heterokaryons produced intermediate o r lesser amounts of acid than their parents except when two X low-yielding strains were paired. The data of Ciegler and Roper (1957) are hard to interpret since analysis of the culture developed during a fermentation revealed that the majority of heterokaryons segregated out into their component haploid genomes. Efforts to stabilize the heterokaryons failed. However, heterokaryons obtained between two strains of A . oryzae showed heterosis in their ability to synthesize protease (Ikeda et a l . , 1957). Diploids, derived from a cross between poorly active and highly active strains, produced more enzyme than either parent. Certain diploids exceeded their auxotroph parents and prototroph ancestor in their ability to synthesize protease. Some tetraploids obtained from
GENETICS OF APPLIED MICROBIOLOGY
85
these diploids were even superior to the diploids. Paskova and Munk (1962) isolated haploids resulting from the segregation of heterokaryons of two strains of A. niger. The data of these authors are indicative of heterosis with regard to glucooxidase. Heterokaryotic strains of the fungus Claviceps are already used for the production of alkaloids. Although less stable, these strains produce larger amounts of indole alkaloids than homokaryotic strains (Strnadova, 1976). Certain polyploid forms of Cephalosporium are potent producers of the p-lactam antibiotic cephalosporin. The higher ploidy clones are induced after exposure to camphor and acenaphthene and the subsequent giant cells are selected (Takeda Chemical Industries, Ltd., Japan, Patent JS-109680, 1975b). Heterokaryosis has been shown to occur between S . griseus and S . venezuelae (Bradley, 1962; Bradley et al., 1959) and between S . griseus and S . cyaneus (Bradley and Lederberg, 1956). VII. Strain Stability
A. STORAGE Most strains of industrial organisms have been selected for their ability to produce increased yields of interesting metabolites and so derive from lineages that incorporate the results of numerous mutagenic treatments. These strains exhibit decreased vigor as shown by their reduced growth rate and reduced ability to form spores (Sermonti, 1969). Strains of P. chrysogenurn yielding penicillin show a decrease in antibiotic yield after a period of storage or of continued subculture (Haas et aZ.) 1956; Calam, 1964). Low-titer spontaneous mutants are favored either because of their increased longevity or by virtue of increased growth rate relative to high penicillin-producing strains (Macdonald, 1968a). Degeneration caused by a n excessive number of transfers can be precluded by restriction of subculturing. This can be accomplished by limited subculture from strains stored at very low temperatures (Reusser, 1963; Hesseltine and Haynes, 1974). However, lyophilization is the most widely used method for culture preservation (Perlman and Kikuchi, 1977).
B. VIRUSES Fermentations can be chronically plagued by viruses. Phages may account for sporadic marginal decreases in yield, as well as for the dramatic losses accompanied by clearing of the growth in the fermen-
86
VEDPAL SINGH MALIK
tation beer. Streptomycetes are multiply lysogenic; some of the phage outbreaks are due to virulent mutants rather than exogenous introduction of new viruses (Bradley and Jones, 1967; Lancaster and Jones, 1975). Many of the “nonlysogenic” strains do carry several defective phages and/or bacteriocins (Lomovskaya et al., 1971, 1972; Dowding and Hopwood, 1973; Brownell, 1976; Brownell and Adams, 1976; Alikhanian et al., 1976). Virulent mutants of temperate actinophages were often observed in four lysogenic cultures of Actinomyces netropsis producing polyene antibiotics (Muradov and Rautenshtein, 1972, 1973). These virulent mutants were of several plaque-morphology types. Spontaneous formation of variants that have lost their prophages and have become sensitive to the temperate phages of the parent culture occurred frequently. Rautenshtein et al. (1972) have shown that lysis of the industrial strain of oxytetracycline-producing Actinomyces rimosus was caused not by virulent mutants of temperate phage of the lysogenic culture, but by some other lytic factor. This factor did not cause lysis o f A . aureofaciens producing chlortetracycline. These Russian authors propose induction of the lytic factor by the temperate phage of the lytic culture during the period of phage assembly. Lysis of B. subtilis by intracellular accumulation of glucose 1-phosphate has been described by Prasad and Freese (1974). There are many approaches to the control of phage outbreaks, although none will ensure permanent protection. 1. Develop media that do not favor induction of temperate bacteriophages. These media will differ for each culture. 2. Develop media that are unfavorable to free bacteriophage (high pH, low Ca2+,citrate, salts with cations that react with -SH groups). 3. Develop nonlysogenic production cultures. 4. Select for resistance to all known virulent phages. 5. Use rigorous practices to keep out exogenous phage. 6. Develop fermentation conditions and practices that harm phage (high incubation temperature, pasteurization of the final beer). Selection of phage-resistant variants is the easiest approach (Mount, 1976). The selection can be carried out in broth, on agar, or a combination of the two. Crucial factors in isolating phage-resistant variants are: (1) phage:host ratio, (2) Ca2+ concentration, (3) temperature of incubation, and (4)age, size, and physiological state of the host organism. After selecting a phage-resistant variant, it must be freed of exogenous phage. Replating in the presence of EDTA, citrate, or antiphage antiserum is effective. Reference phages should be kept, and
GENETICS OF APPLIED MICROBIOLOGY
87
production cultures should be checked periodically for susceptibility to the phages that had been problems in the past. C. TANDEM DUPLICATIONS AND UNSTABLE PHENOTYPE
The high frequency of tandem duplications of part of the genome explains many observations involving unstable mutants and recombinants. Now methods are available for detection and analysis of such tandem duplications in phage and bacteria (Anderson and Roth, 1977). They usually cause no loss of function, since relatively large, unlimited-size segments of chromosomes are duplicated. However, duplications of material within a single gene can inactivate that gene and duplications of several genes within a single operon can generate, at the joint between duplicated segments, a polar effect on expression. The existence of a duplication creates a n unstable situation in a cell. Normal recombination between the two copies leads either to loss of duplication or further amplification. In Salmonella typhirnuriurn and Escherichia coli, mucoid colonies are unstable merodiploids for the histidine region of the chromosome. Strains that lose the diploid character simultaneously lose the mucoid character (Anderson et al., 1976). Spontaneous formation of tandem duplications is a common event (Straus, 1974). Duplication rates of approximately have been reported for the glycyl transfer RNA synthetase gene (Folk and Berg, 19711, the N-acetyl-7-semialdehyde dehydrogenase gene (Glansdorff and Sand, 19681, and genes required for utilization of Z-malate (Straus and Hoffman, 1975). Studies involving a known informational missense suppressor (gly T S u AGA 1 indicate that 10% of induced suppressors are in a tandem diploid for the gly T locus (Hill and Cambriato, 1973) and presumably arise in strains carrying preexisting duplications of the gly T region. Moreover, after extremely mild UV irradiation (75% survival) 6 5 % of surviving chromosomes harbor tandem duplications of the gly T-pur D region. Transductional studies of Salmonella lethal suppressor mutations Sup R and Sup S, suggest that spontaneous duplications of that chromosomal region may be carried by more than 10% of the cell population (Miller and Roth, 1971). Amplification of the histidine operon was observed by selecting for increased his enzyme levels in strains that are unable to derepress the histidine operon. Under these conditions, tandem his duplications arise a t a frequency of lop4per cell with a mucoid colony phenotype. Some duplications may be up to 21% of the Salmonella genome (Ander-
88
VEDPAL SINGH MALIK
son et al., 1976). Tandem duplications of nearly one-third of the Salmonella chromosome have been reported by Straus and Hoffman (1975). Thus, it appears that Salmonella strains can tolerate quite large increases in their genome size, and may undergo such increases frequently (Straus and Straus, 1976). Partially diploid conjugational progeny called heteroclones are frequently encountered in Streptomyces (Hopwood, 1967; Coats, 1976). In view of the high frequency of duplications in other bacteria, heteroclones may result from recombination events occurring in recipient cells that carry preexisting tandem duplications (Antonov et al., 1977). The size of a preexisting duplication in recipients will determine the size of the merodiploid region, and the heterozygosity would result from replacement of DNA in one of the two copies by the genome inherited from the donor parent. Goldring and Wake (1968) autoradiographed the segregation of the genome within different-sized microcolonies developing from radioactively labeled Bacillus megaterium spores. Segregation patterns suggest the presence of two genomes. It is not known whether both genomes are complete or one genome is partially amplified. Strains of Aspergillus nidulans which have a chromosome segment in duplicate (one segment in the normal position and another copy translocated to another linkage group) are highly unstable a t mitosis. Colonies have a reduced growth rate and characteristic “crinkled” morphology; they produce frequent variant sectors (Nga and Roper, 1969). Even though genetic maps of Salmonella typhimurium and E . coli are virtually identical (Sanderson, 19761, most regions of the chromosome show greatly reduced homology a t the base sequence level. In conjugational crosses between these two organisms, recombinants are recovered with greatly reduced frequency (Middleton and Mojica-a, 1971; Mojica-a and Middleton, 1972). They are frequently unstable, and some may even carry F’ episomes (Johnson et al. , 1975). Unstable recombinants are also obtained in transductional crosses where the recipient strain is marked with a large deletion of a selected gene (Stodolsky, 1974; Jamet-Vierney and Anagnostopoulos, 1975). Deletion reduces the homology usually shared by the couple and recombinants arise with greatly reduced frequency. The selected marker is inherited by unstable addition a t some site near the deletion. Such a recombinational event could depend upon the existence of tandem duplications of the selected allele in rare individuals within the donor populations (Anderson and Roth, 1977).If the mating couple share few regions of homology, duplication in the donor can bring these few regions of homology close to the selected donor markers. Such rear-
GENETICS OF APPLIED MICROBIOLOGY
89
rangements may be necessary to permit hereditary transmission of that marker. This may also be an explanation of the frequent occurrence of unstable recombinant clones following hybridization of distantly related species as in crosses between S. coelicolor and S.griseus (Lomovskaya et al., 1977). Duplications of predetermined extent can indeed be constructed by utilizing strains with gene translocations. Trowsdale and Anagnostopoulos (1976) have in fact described such a novel example of duplication formation in Bacillus subtilis strains with a trp E gene transposition. When strains carrying a particular mutation (trp E 26) are used as recipients in transformation or transduction crosses, unstable trp+ recombinants are obtained carrying duplication of up to one-third of the entire chromosome, including the trp E+ gene (Audit and Anagnostopoulos, 1975). The unusual behavior of this strain is the result of a transposition that moves a segment of the chromosome, including part of the trp E gene, from one point on the chromosome to another. The mutant cell is left with a disrupted incomplete trp E gene sequence at two separate locations on the chromosome. Any wild-type trp E+ chromosomal fragment transduced or transformed into this recipient must recombine with both of these widely separated sequences to permit inheritance of trp E+ (Anderson and Roth, 1977). Duplications with transpositions can be generated for virtually any region of the chromosome of Salmonella and E . coli (Kleckner et al., 1977). This is made possible through the use of transposable drug-resistance genes such as the Tn 10 elements (Kleckner et al., 1975). A translocation situation analogous to that described by Trowsdale and Anagnostopoulos (1976) can be created by use of strains carrying insertions of transposable elements at various points on the chromosome. Homology is provided at these separated sites; recombination between these separated homologous DNA sequences yields duplications that include the segment between the insertion sites of transposable elements (Starlinger and Saedler, 1976). VIII. Antibiotic Synthesis
A. GENETICCONTROL Culture improvement of secondary metabolite production is hampered by a lack of adequate understanding of the mechanisms that affect the yield and synthesis of complex polygenically determined products, such as antibiotics. So far, it has not been possible to map any locus that controls a well characterized enzymic reaction involved in the biosynthetic pathway of a secondary metabolite. As a matter of
90
VEDPAL SINGH MALIK
fact, our knowledge of the biosynthetic pathways of secondary metabolites is only fragmentary. To date, a complete, well-characterized enzymic reaction sequence dictating the biogenesis of any secondary metabolite cannot be written in entirety. This incomplete knowledge makes it impossible to do any systematic mapping of the reactions and loci controlling them. If the genetics of antibiotic production is to progress, the biosynthetic pathway should be well characterized. Meanwhile, culture improvement has to proceed by trial and error. Antibiotic production is controlled by five different classes of genes: 1. Structural genes that code for the enzymes involved in the biogenesis of the antibiotic molecule. 2. Regulatory genes that determine the onset and extent of expression of the structural genes for antibiotic biosynthesis. 3. Resistance genes that determine immunity of the producing organism to the produced antibiotic. 4. Cellular-permeability genes that control entry, exclusion, and excretion of antibiotic. 5 . Regulatory genes that control primary pathways. These genes influence the level of precursors and cofactors needed for antibiotic biogenesis. Genes of classes 1, 2, and 3 may be clustered in operon-like structures and may even be plasmid-borne. However, genes of classes 4 and 5 are probably scattered all over the chromosome. VanZk et al. (1971) built a theoretical model of the regulation of chlortetracycline biogenesis. Some 300 genes participate in the biosynthesis of the chlortetracycline molecule. A number of these might be identified during genetic analysis of loci for biogenesis of the antibiotic. However, many genes involved in the formation of tetracycline belong to various independent primary metabolic pathways that provide precursors for the biogenesis of the antibiotic. Genes for the production of and resistance to methylenomycin, are carried by a plasmid harbored by S . coelicolor. Chromosomal mutations with pleiotropic effects that abolish methylenomycin production and sporulation also exist (Kirby and Hopwood, 1977). S . coelicolor produces a pH indicator pigment actinorhodin. All genes for the biogenesis of this pigment form a closely linked cluster on the chromosome (Wright and Hopwood, 197613). Coats and Roeser (1971) have mapped two biochemically undefined loci on the chromosome affecting the biogenesis of the zorbomycin complex. Genetic mapping of loci controlling tetracycline biogenesis locates several genes on the chromosome of S. rimosus (Hogtalek et al., 1974). The nature of biochemical reactions controlled by these loci is unknown. Alacevii: (1969) tried to
GENETICS OF APPLIED MICROBIOLOGY
91
analyze the segregation of oxytetracycline production while mapping the S. rimosus chromosome. However, oxytetracycline production was not related to other phenotypic characters of segregants. Most strains with the same nutritional markers produced different amounts of antibiotic. This lack of constant effects of nutritional markers on oxytetracycline production made analysis of loci involved in antibiotic biogenesis impossible. Negative effects of auxotrophy on antibiotic production are also seen in chloramphenicol production by S . venezuelae and in pyocyanin production by P. aeruginosa (V. S. Malik, unpublished). Vanek et al. (1971) assumed that the loci controlling the final biosynthetic reactions, i.e., the transformation of the hypothetical tricyclic nonaketide, are grouped into the so-called chlortetracycline operon. Results of genetic analysis performed in S . rimosus (Boronin and Mindlin, 1971) and S. aureofaciens (Blumauerova et al., 1972) support this assumption. Results of genetic analysis of blocked mutants ofS. rimosus (Boronin and Mindlin, 1971) suggest two separate groups of loci that control the biosynthesis of oxytetracycline and are located in the region between two loci for streptomycin resistance. One mutation causes loss of pigmentation (QTC 61, giving white nonproducing strains, and this is accompanied by increased sensitivity to oxytetracycline. Recombination between loci found in different groups gave high yields of recombinants with restored antibiotic production. Recombinants for outside nutritional markers from crosses of mutants blocked in the same group produced no antibiotic. This finding is further supported by reciprocal crosses bet een various types of blocked mutants and the antibioticproducin parent. These results suggest that genes controlling certain steps of tetracycline biogenesis may be clustered in operons. Unlike S. rimosus, the study of the genetic control of antibiotic formation in S. aureofaciens meets with a certain difficulty. The selection of suitable strains for genetic recombination is limited by low yields of mutants that are blocked in different reactions involved in antibiotic biosynthesis. Mutants are frequently leaky and unstable. Many mutants show decreased viability and poor sporulation (Blumauerova et al., 1972).Regardless of the isolation conditions, only arginine auxotrophs have been obtained (Alikhanian and Borisova, 1961; Polsinelli and Beretta, 1966; Hoiitalek et al., 1974). Most combinations of mutant recombinants yielded only heterokaryons. However, heterokaryons and recombinants were sometimes found among the recombinant progeny of the same cross (Blumauerova et al., 1972). The location of selected markers on the chromosome of strains involved in a
tf
92
VEDPAL SINGH MALIK
cross may determine the nature of progeny in the sense of haploid or heterokaryon. The recombinants were usually unstable and exhibited different segregation patterns. Crossing of auxotrophic mutants point-blocked at various steps of tetracycline biosynthesis never yielded recombinants with the expected phenotype of the standard strain. Most recombinants had a biosynthetic activity identical to that of one of the parents or resembled the original prototroph from which the strains involved in the cross were derived. These experiments of Blumauerova et al. (1972) suggest that genes controlling the biosynthesis of tetracycline analyzed in these particular crosses may be closely linked and ight be located far away from any of the auxotrophic markers invo ved in crosses. Recombinants of antibiotic nonproducing mutants can acquire the ability to produce antibiotic. This is particularly true of crosses between mutants with genetic changes in primary metabolism. One of the loci closely linked to the arginine gene eliminates tetracycline biogenesis. However, even with the most active recombinant, complete quantitative recovery equivalent to the antibiotic production ability of the parent was never achieved (Blumauerova et al., 1972). This could be due partly to silent mutations introduced into strains by repeated mutagenesis during several-step preparations of multiply marked mutants. Repeated treatment with nitrosoguanidine, which is known to cause multiple mutations, can introduce undetected mutations in primary metabolism that indirectly affect the yield of the antibiotic. These genetic aberrations would be hard to correct with one recombinational event. This assumption is once more supported by the data of Blumauerova et al. (19721, in which low production strains of S. aureofaciens exhibit negative complementation during recombination; recombinant progeny totally lost the ability to produce antibiotics. AlaceviC et al. (1973) worked with auxotrophic mutants of a low tetracycline-producing strain of Streptomyces rimosus. Most auxotrophic mutants had a decreased or practically nonexistent antibiotic activity. A selective analysis of haploid recombinants obtained by four-point crosses showed a variety of recombinant phenotypes. Since in most cases an excess of prototrophs was obtained, which distorts results for determining linkage relationships between genes, mapping was based on analysis of heteroclones. Initially 10 markers were localized on the chromosome map by analyzing trios of markers from many heteroclones. Four-, five-, or six-point crosses of multiply marked strains were used for further mapping. A clustering of some genes controlling the biosynthesis of histidine was established. Six muta-
%
GENETICS OF APPLIED MICROBIOLOGY
93
tions were closely linked, similarly to the situation in S. coelicolor (Randamo et al., 1976). Mutants used in mapping S. rimosus were derived from two different strains and in many cases displayed different growth requirements. Auxotrophic markers were usually defined on the basis of the required final metabolite. Therefore, it cannot be concluded with certainty that an identical locus controlling the same enzymic step of biosynthesis of the primary metabolite has been mapped in mutants with the same growth requirement. In spite of these facts, the identical sequence of most markers suggests the validity of many tentative genetic maps among Streptomyces. However, careful genetic analysis involving many more completely characterized loci with known enzymic defects should reveal differences. B. PLASMIDS AND ANTIBIOTICPRODUCTION Microbes produce organic molecules of diverse chemical structure that are not essential for their growth. Production of these molecules is not species specific (Lechevalier, 1975). Plasmids may play a role in spreading the genes involved in the biogenesis of these molecules across the microbial world (Dajani and Wannamaker, 1976; Chakrabarty, 1976; Reanney, 1976; Malik and Reusser, 1969). Bacteriocins are small peptide antibiotic molecules produced by a wide variety of organisms (Reeves, 1972; Williams, 1977) and coded by plasmids (Fuchs et al., 1975). Plasmids have been implicated in the control of several phenotypic characters in Streptomyces species. These include fertility (Hopwood et al., 19731, melanin production (Gregory and Huang, 1964a), aerial mycelium (Redshaw et al., 19761, antibiotic production and resistance (Kirby and Hopwood, 1977; Akagawa et al., 1975; Kahler and Noack, 1976; Okanishi et al., 1970; Ogawara and Nozaki, 1977) and protease inhibitors (Umezawa et al., 1978). Loss of one or more of these characters upon treatment of a streptomycete with UV light or acridinium phenanthridinium dyes has been used to indicate plasmid involvement in the expression of these characters. Acridines, for example, cause the loss of chloramphenicol production (Akagawa et al., 19751, melanin production and aerial mycelium in Streptomyces uenezuelae, the loss of kasugamycin and aureothricin production by S. kasugaensis (Okanishi et al., 19701, and loss of melanin and tyrosinase production in S. scabies (Gregory and Huang, 1964b). Plasmid-borne genes are not involved in aerial mycelium formation in S. coelicolor, since mutations have been located on the
94
VEDPAL SINGH MALIK
chromosomal linkage map. All mutations affecting aerial mycelium formation in S. coelicolor behave in crosses as though linked to chromosomal markers (Merrick, 1976b). It is worth remembering that aerial mycelium formation is sensitive to many environmental and genetic factors and the ambiguous morphology of clones can lead to erroneous conclusions. Data involving sporulation and mycelium formation should be interpreted with extreme caution. Okanishi et al. (1970) treated the streptomycete that produced kasugamycin and aureothricin with the DNA intercalating dye acriflavine, blended and plated for single colonies. The colonies obtained lost the ability to produce kasugamycin with a frequency of 4.6 to 50x lop2.Independently, aureothricin production was also lost with a frequency of 2 . 4 ~ These observations suggest involvement of separate plasmids in the production of these two antibiotics. Isolation of plasmid DNAs from a kasugamycin-aureothricin-producing strain was achieved by Umezawa and co-workers (1978). Plasmid DNAs were found that had lengths of 15, 3.4, and 0.59 pm. After acriflavine treatment of a kasugamycin-producing strain and an aureothricinproducing strain, the ability to produce these antibiotics was lost. DNA analysis showed that the 15-pm plasmid was lost in the former strain and the 3.4-pm plasmid had disappeared in the latter. This suggests that the 15-pm plasmid is involved in kasugamycin biosynthesis and the 3.4-pm plasmid in aureothricin biosynthesis. The ability of a kanamycin-producing Streptomyces kanamyceticus to synthesize the 2-deoxystreptamine moiety was eliminated by acriflavine treatment. These results indicate involvement of a plasmid in the biosynthesis of this characteristic moiety of kanamycin (Hotta et al., 1977).Plasmids may be involved in the biogenesis of the characteristic subunit of diverse secondary metabolites. If this is indeed a common occurrence, then recombinant plasmids may have evolved that have pooled genes responsible for the synthesis of structures that have several subunits, each of which was originally unique to various independent molecules and was encoded in an independent plasmid. Plasmids might also affect excretion of intracellular metabolites to the surrounding milieu, since export of tyrosinase from mycelia in Streptomyces glaucescens appears to be under plasmid control (Baumann and Kocher, 1976). Shaw and Piwowarski (1977) have described the effects of ethidium bromide and acriflavine on S. bikiniensis, with emphasis on the possibility of plasmid involvement in streptomycin production and resistance. Treatment with ethidium bromide or acriflavine caused the high frequency loss of antibiotic production by S. bikiniensis. The loss of streptomycin production was always accom-
GENETICS OF APPLIED MICROBIOLOGY
95
panied by decreased resistance to streptomycin. Growth inhibition of most nonproducers occurred a t streptomycin concentrations of 1-4 pglml (the level that is inhibitory to B . subtilis). None of the nonproducing isolates regained either the ability to produce streptomycin or resistance to that antibiotic through repeated transfer of the cultures. There was wide variation in sensitivity to the antibiotic among the different streptomycin-producing isolates. The presence of a few producing isolates that are sensitive to streptomycin a t concentrations between 9 and 18 pg/ml suggests that dye treatment might have caused partial loss of streptomycin resistance in these isolates. This interpretation is questionable, however, because 23 of the 30 producing isolates examined are capable of producing streptomycin in amounts exceeding their sensitivities. These results of Shaw and Piwowarski (1977) may be indicative of a variation in sensitivity of the isolates to streptomycin during early stages of growth, since many microbes develop enhanced resistance to their own antibiotics during or just prior to the phase in which the antibiotic is being synthesized (Malik, 1972; Malik and Vining, 1972a). Treatment with ethidium bromide or acriflavine did not have any effect on production of brown-black pigment but caused a loss of aerial mycelium formation that was not always complete or permanent. The studies of Shaw and Piwowarski (1977) suggest the possible involvement of extrachromosomal elements in resistance and production of streptomycin by S . bikiniensis. A plasmid may be involved in resistance to oxytetracycline in'S. rimosus (Boronin and Sadovnikova, 1972) and in resistance to and production of chloramphenicol in S. venezuelae (Okanishi et al., 1970). Recently, Malik (1977) isolated a plasmid from the chloramphenicol producer S . venezuelae. Involvement of a plasmid in chloramphenicol biogenesis has also been predicted from genetic analysis of recombinants produced by a cross between chloramphenicol-producing and nonproducing mutants (Akagawa et al., 1975). Analysis of recombinants from o cross between a chloramphenicol-producing lys- met- iso-pro-, STMRand a his ade- leu- chloramphenicol nonproducing strain indicated presence of a circular chromosome: his - ade - str - leu - lys - met ile - pro - (his).When the chloramphenicol marker was located on the chromosome, the quadruple crossover frequencies obtained for all possible positions in presence of this marker were far larger than those without this marker in the map. Moreover, in the three crosses, the chloramphenicol marker was not located in the same position. These results indicated that the chloramphenicol marker should lie on genetic material other than the chromosome (Malik and Reusser, 1969). Kirby et al. (1975; Hopwood et al., 1969) suggest plasmid involve-
96
VEDPAL SINGH MALIK
ment in the production of and resistance to methylenomycin A by S . coelicolor. This organism harbors a sex factor termed SCPl (Hopwood et al., 1975), and mutations of SCPl gave progeny that failed to produce the antibiotic methylenomycin, which inhibits sporulation of UF strains of S. coelicolor lacking SCP1. Because antibiotic activity was detected by cross-feeding of these non-antibiotic-producing SCPl++ mutants, the authors concluded that genes that determined steps in the biosynthetic pathway of the antibiotic were located on the plasmid. The ability to synthesize methylenomycin can be efficiently transferred by conjugation to UF strains (Vivian, 1971) or to the strains ofS. liuidans (Hopwood and Wright, 1973a). The SCPl plasmid may be integrated into chromosomes of S. coelicolor strains of the N F fertility type. By mating IF strains with UF strains, it has also been possible to construct S . coelicolor strains harboring derivatives of SCPl in which various chromosomal segments of the donor strain have been inserted (Hopwood and Wright, 1973b). No circular DNA that corresponds to the genetically described SCPl plasmid has yet been detected (Bibb et al., 1977; Schrempf et al., 1975). The 2 0 ~ 1 dalton 0~ circular plasmid pSHl was detected in several strains of S . coelicolor regardless of fertility type. This suggests that this 2 0 ~ 1 dalton 0~ plasmid is not SCP1. At present pSHl has no known genetic marker (Schrempf and Goebel, 1977). DNA hybridization studies and digestion with restriction enzymes HindII, SmaI, and SalI suggest that pSHl has the same nucleotide sequence regardless of its origin. This rules out the possibility that a plasmid of the same size but with different nucleotide sequences could determine different functions and may be present in S. coelicolor strains of various fertility types. Digestion of pSHl with EcoRI and Hind111 show that this plas~ daltons apart. mid has single sites for both enzymes whicn are 7 . 6 lo6 pSHl DNA has been joined to RSF2124 (Corn1 AP) and cloned in E . coli. The E . coli-Streptomyces hybrid plasmid can be amplified in E . coli by chloramphenicol treatment. S. coelicolor Muller and S . achromogenes var. rubradiris were subjected to W mutagenesis (0.01% survival). Colonies were selected that were sensitive to penicillin. These colonies on further restreaking segregated into penicillin-resistant and penicillin-sensitive clones. No stable clone sensitive to penicillin could be isolated. The penicillinresistant and -sensitive phenotypes were interchangeable. Similar results were obtained in experiments designed to obtain chloramphenicol-sensitive strains of chloramphenicol-producing Streptomyces venezuelae, S . coelicolor A3(2), and S. achromogenes var. rubradiris (V. S . Malik, unpublished observation). Elements controlling
GENETICS OF APPLIED MICROBIOLOGY
97
chloramphenicol acetyltransferase-independent chloramphenicol resistance in S. coelicolor A3(2) and S . lividans have been detected (Freeman et al., 1977; Sermonti et al., 1977). S . coelicolor and S. liuidans lacking acetyltransferase produced chloramphenicol-sensitive variants spontaneously at frequencies of up to 2%.The fertility type of S. coelicolor with respect to the SCPl plasmid had no effect on chloramphenicol sensitivity or on the frequency at which chloramphenicol-sensitive variants arose. Chloramphenicol sensitivity and chloramphenicol resistance are reversible phenotypes. Transfer of chloramphenicol resistance into sensitive strains occurred independently of chromosomal recombination. Mapping experiments exclude segregation of a chromosomal locus as the determinant of chloramphenicol resistance versus sensitivity. Resistance to antibiotics like penicillin and chloramphenicol may be controlled by a transposable genetic element (Bukhari, 1976; Starlinger and Saedler, 1976; Kleckner, 1977; Shapiro, 1977) that may also exist extrachromosomally. Beneviste and Davies (1973) proposed that genes coding for antibiotic-inactivating enzymes originated in organisms that produce those antibiotics. This idea was supported by finding antibioticinactivating enzymes in strains that produce aminoglycosidic antibiotics. These authors found aminoglycoside 6’-acetyltransferase and aminoglycoside 3‘-phosphotransferase in a neomycin-producing strain and in a kanamycin-producing strain. Walker and Skorvaga (1973) showed aminoglycoside 3’-phosphotransferase in the streptomycin producer. The possible involvement of aminoglycoside 6’acetyltransferase in kanamycin biosynthesis has also been suggested (Satoh et al., 1975).The presence of aminoglycoside 3-acetyltransferase in strains producing kanamycin, neomycin, or ribostamycin has been shown by isolation of 3-N-acetylkanamycin (Murase et al., 19701, 3-N-acetylneomycin (Rinehart, 19641, and 3-N-acetylribostamycin (Kojima et al., 1975). Aminoglycoside 3’-phosphotransferase I1 has also been found in a butirosin-producing B. circulans (Matsuhashi et al., 1975). The gene for this enzyme was joined with the plasmid ColE1ApR and introduced into E . coli (Courvalin et al., 1977). Incidentally, the hypothesis of Benveniste and Davies does not account for the observation that chloramphenicol-producing streptomycetes do not produce chloramphenicol acetyltransferase but possess other mechanisms of resistance to chloramphenicol (Malik and Vining, 1970,1971; Shaw and Hopwood, 1976; Nakano et al., 1977; Frances et al., 1975a). Teraoka and Tanaka (1974) showed that ribosomes from S. erythreus were resistant to erythromycin and lincomycin. Approximately 2 residues ofN6,N6-dimethyladenine (m6,A)per 23 S ribosomal RNA (rRNA)
98
VEDPAL SINGH MALIK
associated with coresistance to macrolide, lincosaminide, and streptogramin B-type (MLS) antibiotics were found in S . erythreus. MLS resistance was absent in S. albus, S. griseus, and S. rimosus, which do not synthesize any of the MLS antibiotics. The MLS pattern is absent in S. fradiae NRRL 2702, S. cirratus, S . lincolnensis, and S. diastaticus, which produce MLS antibiotics other than erythromycin. However, the macrolide-producers S . fradiae NRRL 2702 (tylosin producer) and S . cirratus (cirramycin producer) contain N6-monomethyladenine (m6,A) in their rRNA, which makes these streptomycetes resistant to the macrolides. S. lincolnensis (lincomycin producer) and S. loidensis (vernamycin A plus B producer) contain neither m6A nor mfjA in 23 S rRNA mPA is present in MLS-resistant Streptococcus fecalis. Plasmids lincosaminide and streptogramin B-type antibiotics (B. Weisblum and M. Y. Graham, unpublished). Approximately 2 residues per 23 S rRNA m$A is present in MLS-resistant Streptococcus fecalis. Plasmids associated with MLS resistance in both S. fecalis and S . pyogenes have been identified (Clewell et al., 1975). The determinant for MLS resistance may indeed be located on plasmids in Streptomyces. There are numerous reports of plasmids in Bacillus, but their role in the physiology of the producing organism is not known (Tanaka et al., 1977). The yeast Saccharomyces cerevisiae contains approximately 100 copies of a 2-pm circular DNA molecule called 2pDNA (Livingston, 1977). Expression of a nuclear oligomycin resistance mutation is correlated with the presence of 2pDNA within the cell. 2pDNA is inherited as a n extrachromosomal element and contains an inverted repeated base sequence comprising 20% of the total molecular length. These properties of this DNA circle are interesting because inverted repetitions that form the boundaries of drug-resistance genes on bacterial plasmids are important to the process of translocating the resistance genes from plasmids to other DNA (Bukhari et al., 1977; Engberg and Klenow, 1977). OF SECONDARY METABOLITE FORMATION C. MULTIVALENT INDUCTION
Unlike bacteria and viruses, industrial strains of microorganisms have not yet been widely used for determining the fundamental basis of heredity or cellular regulatory mechanisms. As a consequence, interest has not focused so much on the exponential phase of growth as on the metabolite they produce and on the study of factors influencing the rate production and yield. At the end of exponential growth, when a n essential nutrient has been exhausted, the growth rate has decreased and intermediates of primary metabolism have accumulated in
GENETICS OF APPLIED MICROBIOLOGY
99
the cell, microbes undergo progressive morphological and biochemical changes that culminate in the formation of endospores and excretion of metabolites. These processes are regulated in time and space by a set of controls operating upon the succession of biochemical events (Lewin, 1977; Pastan and Adhya, 1976). In principle, these controls might be exerted at all levels, i.e., transcription of DNA into RNA, translation of RNA into proteins, and the activity of proteins as enzymes (Doi, 1977; Magasanik et al., 1974; Switzer, 1977; Pirrotta, 1976; Bourgeois and Pfahl, 1976; J. Martin, 1977; Curdova et al., 1976). The control of primary biosynthetic sequences by product negative feedback ensures that organisms will not needlessly waste energy in making a compound that it can obtain more economically from the environment (Goldberger et al., 1976). Even if amino acids are never encountered in the environment, organisms regulate their production in such a way as to maintain reasonably constant concentrations, since there exists both a selectively permeable outer membrane and regulatory mechanisms preventing the overproduction of cellular metabolites. The constant flux of the environment only exacerbates the problem. Furthermore, changes in growth medium determine the physiological state of the cell, and the presence or absence of certain anions or cations in the medium could induce, repress, or inactivate certain enzymes. The immediate cause of onset of secondary metabolism is probably the increase of one or more metabolic concentrations beyond the range within which the regulatory mechanisms of the cell can restore normal levels. This is not to propose, of course, that the absolute mechanisms of the formation of secondary metabolites are as simple as this. To understand the regulation, it would be usoful to know how the overall program of antibiotic synthesis is initiated, a t what level the initiation of antibiotic synthesis is controlled, whether there is any primary locus for initiation, and what the mechanism of its expression is. Genes affecting secondary metabolism might be repressed during rapid balanced vegetative growth and derepressed at the beginning of the stationary growth phase. The precise nature of this repression or derepression is obscure. The switch from general metabolism, operating in the vegetative phase to unbalanced metabolism that follows must provide a mechanism for the simultaneous activation of specific antibiotic synthesizing and excreting genes and repression of certain genes essential for primary metabolism. As a consequence of disruption in the regulation of primary cellular metabolism, the delicate balance among various intertwined pathways is disturbed. Precursors accumulate that induce shunt pathways to produce secondary metabolites, giving
100
VEDPAL SINGH MALIK
the cell metabolic plasticity that a precisely regulated cell cannot afford. The production of penicillin, cycloheximide, and chloramphenicol are self-limiting (Gordee and Day, 1972; Kominek, 1975; Malik and Vining, 1972a). Liu et al. (1977) concluded that synthesis is regulated by feedback inhibition. Addition of 400 pg of exogenous aurodox per milliliter totally inhibited further accumulation of the antibiotic by S . goldiniensis. This is the same concentration of aurodox that the organism produces under the experimental conditions used. Several structural analogs of aurodox with no antibacterial activity also inhibited antibiotic synthesis. The inhibitory effect was immediate and readily reversible, indicating that it could be due to inhibition of an enzyme involved in the biosynthesis of aurodox. Of all the secondary metabolites, the biochemistry of chloramphenicol is best understood. In Streptomyces venezuelae, chloramphenicol is derived by an unusual diversion of intermediates in the shikimic acid pathway of aromatic amino acid biogenesis Wining et a l . , 1968). Chorismic acid is an intermediate in the pathway, and the branch point is after the formation of this compound (Jones and Vining, 1976). In the chloramphenicol-producing Streptomyces, normal intermediates or end products of the shikimate pathway do not inhibit the synthesis or activity of the initial enzyme, 3-deoxy-~arabinoheptulosonate phosphate synthetase (Goerish and Lingens, 1971a,b; Lowe and Westlake, 1972). None of the other enzymes involved in the biosynthesis of aromatic amino acids is subjected to repression by intermediates or end products of the shikimic acid pathway (Lowe and Westlake, 1973). Prephenate dehydratase activity is controlled solely by feedback inhibition by L-phenylalanine, and only L-tryptophan inhibits anthranilate synthetase (Jones and Westlake, 1974). Chorismate mutase of Streptomyces resembles the enzyme from E . coli and B . subtilis and is not inhibited by end products of the pathway (Goerish and Lingens, 1972, 1973, 1974). Lack of repression and insensitivity to feedback inhibition of certain key enzymes of the shikimic acid pathway in chloramphenicolproducing streptomycetes is essential for chloramphenicol formation. Induction of enzymes involved in chloramphenicol formation is due to the accumulation of some branch-point intermediate as a result of feedback inhibition of key enzymes of the shikimate pathway by phenylalanine, tyrosine, and tryptophan (multivalent induction), which accumulate in the cells when multiple pathways utilizing them are partially or wholly closed. Accumulated intermediates are channeled toward chloramphenicol synthesis so that they do not interfere with the coordinated cellular regulatory mechanisms.
GENETICS OF APPLIED MICROBIOLOGY
ioi
IX. Epilogue
For the present, mutation is the best method for improving titers of industrial metabolites. Understanding of regulatory mechanisms controlling the yield of microbial products can aid in selecting the desired mutant. While intraspecific recombination has been disappointing, various methods of constructing stable interspecific hybrid organisms should also be explored. Modern recombinant DNA methodology has opened a new vista and has great potential for improving organisms of industrial interest (Kozlov et al., 1977; Kramer et al., 1976; Kedes et al., 1975; Ilyinet al., 1976; Higuchiet al., 1976; Struhlet al., 1976). The advent of protoplast fusion represents a breakthrough in breeding, as it allows direct selection of characters under controlled conditions and bypasses the mating barriers that exist between species (Harris, 1970; Ephrussi, 1972; Heyn et al., 1974; Carlson and Polacco, 1975; Malik, 1978,1979; Bianchi, 1974; Dudits et al., 1976; Sacristan and Melchers, 1977; Solingen and Platt, 1977). Complete biochemical synthesis of genes (Contreras and Khorana, 1976; Heyneker et al., 1976; Marians et al., 1976; Maniatis et al., 1976; Poonian et al., 1977; Sadler et al., 1977) and total characterization of the nucleotide sequence of genomes (Sanger et al., 1977) offers possibilities for modifying the genetic makeup of organisms.
REFERENCES Abe, M., Tabuchi, T., and Tanaka, M. (1970). Studies on organic acid fermentation in yeasts. Part 111. Accumulation of d-isocitric acid in cultures of yeasts. J . Agric. Chem. SOC.Jpn. 44, 493-498. Adams, J. N. (1964). Recombination between Mocardia erythropolis and Nocardia canicruria. J . Bacteriol. 88, 865-876. Adelberg, E. A. (1958). Selection of bacterial mutants which excrete antagonists of antimetabolites. J . Bacteriol. 76, 326. Akagawa, H., Okanishi, M., and Umezawa, H. (1975). A plasmid involved in chloramphenicol production in Streptomyces uenezuelae: Evidence from genetic mapping. J . Gen. Microbiol. 90, 33G346. Akiyama, S., Suzuki, T., Sumino, Y., Nakao, Y., and Fukuda, H. (1972). Production of citric acid from n-paraffins by fluoroacetate sensitive mutants ofCandida lipolytica. Ferment. Technol. To-Day, Proc. Int. Ferment. Symp., 4th, 1972 pp. 613-617. Alacevii., M. (1969). Recombination in Streptomyces producing tetracyclines. In “Genetics and Breeding of Streptomyces” (G. Sermonti and M. Alacevic, eds.), pp. 137-145. Yugoslav Academy of Sciences and Arts, Zagreb. AlaceviC, M., Strasek-Vesligaj, M., and Sermonti, G. (1973). The circular linkage map of Streptomyces rimosus. J . Gen. Microbiol. 77, 173-185. Alikhanian, S. I. (1962). Induced mutagenesis in the selection of microorganisms. Adu. Appl. Microbiol. 4, 1-50. Alikhanian, S. I. (1969). Induced mutagenesis as related to variation in quantitative features (antibiotic production). In “Genetics and Breeding of Streptomyces” (G.
102
VEDPAL SINGH MALIK
Sermonti and M. Alacevit, eds.), pp. 69-87. Yugoslav Academy of Sciences and Arts, Zagreb. Alikhanian, S. I. (1970). Applied aspects of microbial genetics. Curr. Top. Microbiol. Immunol. 53, 91-148. Alikhanian, S. I. (1973). Principal results and unsolved problems in microbial selection. In. “Genetics of Industrial Microorganisms” (Z. VanBk, Z. Ho%alek, and J. Cudlin, eds.). Elsevier, Amsterdam. Alikhanian, S. I., and Borisova, L. N. (1961). Recombination in Actinomyces aureofaciens. J . Gen. Microbiol. 26, 19-28. Alikhanian, S. I., and Ilyina, T. S. (1957). Actinophage as a mutagenic factor. Nature (London) 179, 784. Alikhanian, S. I., and Kameneva, S. I. (1961). Hybridization of highly active strains of Penicillium chrysogenum. Sci. Rep. 1st Super. Sanita 9, 454-458. Alikhanian, S. I., and Mindlin, S. 2. (1957). Recombination in Streptomyces rimosus. Nature (London) 180, 1208-1209. Alikhanian, S. I., Mindlin, S. Z., Orlova, N. V., and Verkhovtseva, T. P. (1959). Hereditary changes of some physiological properties in Streptomyces rimosus. Appl. Microbiol. 7, 141-144. Alikhanian, S. I., Lomovskaya, N. D., and Danilenko, V. N. (1976). Suppressor-sensitive mutations of Streptomyces coelicolor A3(2) and actinophage 4C31. Proc. Int. Symp. Genet. Ind. Microorg., 2nd, 1974 pp. 595-606. Anchel, M. (1955). Structure of diatretyne 2, a n antibiotic polyacetylenic nitrile from Clitocybe diatretu. Science 121, 607-608. Anderson, E. V. (1977). Plummeting exports hurt U.S. ethanol makers. Chem. & Eng. News 55, 12-14. Anderson, R. P., and Roth, J. R. (1977). Tandem genetic duplications in phage and bacteria. Annul. Rev. Microbiol. 31, 473-505. Anderson, R. P., Miller, C. G., and Roth, J . R. (1976). Tandem duplications of the histidine operon observed following generalized transduction in Salmonella typhimurium. J . Mol. Biol. 105, 201-218. Anne, J., and Peberdy, J. F. (1976). Induced fusion of fungal protoplasts following treatment with polyethylene glycol. J . Gen. Microbiol. 92, 413-417. Antonov, P. P., Ivanov, I. G., and Markov, G. G. (1977). Heterogeneity of Streptomyces DNA. FEBS Lett. 79, 151-154. Araki, K., and Nakayama, K. (1971). Studies on histidine fermentation. Part I. * L-Histidine production of histidine analog resistant mutants from several bacteria. Agric. Biol. Chem. 35, 2081-2088. Arcamone, F., Cassinelli, G., Fantini, G., Grein, A., Orezzi, P., Pol, C., and Spalla, C. (1969). Adriamycin, 14-hydroxydaunomycin, a new antitumor antibiotic from S. peucetius var. caesius. Biotechnol. Bioeng. 11, 1101-1110. Argoudelis, A. D., Coats, J. H., Lemaux, P. G., and Sebek, 0. K. (1972). Antibiotics produced by mutants of Streptomyces caelestis. I. J . Antibiot. 25, 445-455. Argoudelis, A. D., Coats, J . H., Lemaux, P. G., and Sebek, 0. K. (1973). Antibiotics produced by mutants of Streptomyces caelestis. 11. J . Antibiot. 26, 7-14. Argoudelis, A. D., Coats, J . H., and Johnson, L. E. (1974). Directed biosynthesis of new celestosaminide-antibiotics by Streptomyces caelestis. J . Antibiot. 27, 7 3 S 7 4 3 . Arima, K. (1977). Recent developments and future direction of fermentation in Japan. Dev. Ind. Microbiol. 18, 79-117. Arst, H. N., and Cove, D. J . (1969). Methylammonium resistance to Aspergillus nidulans. J . Bacteriol. 98, 1284-1293.
GENETICS OF APPLIED MICROBIOLOGY
103
Audit, C., and Anagnostopoulos, C. (1975). Studies on the size of the diploid region in Bacillus subtilis merozygotes from strains carrying the trp E26 mutation. Mol. Gen. Genet. 137, 337-351. Aunstrup, K. (1977). Enzymes of industrial interest: Traditional products. Annu. Rep. Ferment. Proc. 1, 181-204. Aytoun, R. S. C. (1970). Proc. Int. Symp. Genet. Ind. Microorg., lst., 1970 pp. 123-147. Azevedo, J. L., and Roper, J. A. (1970). Mitotic nonconformity in Aspergillus: Successive and transposable genetic changes. Genet. Res. 16, 79-93. Bachmann, B. J., Low, K. B., and Taylor, A. L. (1976). Recalibrated linkage map of Escherichra coli K-l2.’Bacteriol.Rev. 40, 116-167. Backman, K., Ptashne, M., and Gilbert, W. (1976). Construction ofplasmids carrying C1 gene of bacteriophage-lambda. Proc. Natl. Acad. Sci. U.S.A. 73, 4174-4178. Backus, M. P., and Stauffer, J. F. (1955). The production and selection of a family of strains of P. chrysogenum. Mycologia 47, 429-463. Bahl, C. P., Marians, K. J., Wu, R., Stawinsky, J., and Narang, S. A. (1977). A general method for inserting specific DNA sequences into cloning vehicles. Gene 1, 81. Ball, C. (1971). Haploidization analysis in Penicillium chrysogenum. J . Gen. Microbiol. 66, 63-69. Ball, C. (1973a). Improvement of penicillin productivity in Penicillium chrysogenum by recombination. I n “Genetics of Industrial Microorganisms” (Z. VanPk, Z. HoStalek, and J. Cudlin, eds.), pp. 227-237. Elsevier, Amsterdam. Ball, C. (1973b). The genetics of Penicillium chrysogenum. Prog. Ind. Microbiol. 12, 47-72. Baron, L. S., Penido, E., Ryman, I. R., and Falkow, S. (1970). Behaviour of coliphage lambda in hybrids between E . coli and Salmonella. J . Bacteriol. 102, 221-223. Bassham, J. A. (1977). Increasing crop production through more controlled photosynthesis. Science 197, 630-638. Baumann, R., and Kocher, J. P. (1976). Genetics ofStreptomyces glaucescens and regulation of melanin production. Proc. Znt. Symp. Genet. Ind. Microorg., Znd, 1974 pp. 535-551. Baumann, R., Hutter, R., and Hopwood, D. A. (1974). Genetic analysis of a melaninproducing streptomycete, Streptomyces glaucescens. J . Gen. Microbiol. 81,463-474. Beers, R. F., and Bassett, E. G. (1977). “Recombinant Molecules.” Raven, New York. Benedik, M., Fennewald, M., and Shapiro, J. (1977). Transposition of a beta-lactamase locus from RP1 into Pseudomonas putida degradative plasmids. J . Bacteriol. 129, 809-8 14. Benveniste, R., and Davies, J. (1973). Aminoglycoside antibiotic-inactivating enzymes in actinomycetes similar to those present in clinical isolates of antibiotic-resistant bacteria. Proc. Natl. Acad. Sci. U.S.A. 70, 2276-2280. Beretta, M., Betti, M., and Polsinelli, M. (1971). Genetic recombination in Micromonospora. J . Bacteriol. 107, 415-419. Berman-Kurtz, M., Lin, E. C. C., and Richey, D. P. (1971). Promotor-like mutant with increased expression of the glycerol kinase operon of Escherichia coli. J . Bacteriol. 106, 724-731. Betz, J. L., Brown, P. L., Smyth, M. J., and Clarke, P. H. (1974). Evolution in action. Nature (London) 247, 261-264. Bianchi, F., and Walet-Foederes, H. G. (1974). An investigation into the anatomy of the shoot apex of Petunia hybrida in connection with the results of transformation experiments. Acta Bot. Neerl. 23, 1-6. Bibb, M. J., Freeman, R. F., and Hopwood, D. A. (1977). Physical and genetical charac-
104
VEDPAL SINGH MALIK
terization of a second set factor SCP,, for Streptomyces coelicolor A3(2). Mol. Gen. Genet. 154, 155-166. Birch, A. J. (1972). Partial synthesis o f some novobiocin analogues. Adv. Antimicrobial and Antineoplastic Chemother., Proc. Int. Congr. Chemother., 7th, 1971, Vol. 2, pp. 1023-1024. Biswas, G. D., and Ravin, A. W. (1976). Genetic hybridization o f the leu-ilv region in bacilli. J . Gen. Microbiol. 92, 39&%404. Biswas, G. D., and Sen, S. P. (1971a). Genetic transformation in bacillus with respect to antibiotic production. J . Appl. Bacteriol. 34, 277-285. Biswas, G. D., and Sen, S. P. (1971b). Transformation in streptomyces with respect to antibiotic production. J . Appl. Bacteriol. 34, 287-293. Bloom, F. R., Streicher, S. L., and Tyler, B. (1977). Regulation o f enzyme synthesis by a glutamine synthetase ofSalmonella typhimurium: A factor in addition to glutamine synthetase is sepuirca for activation of enzyme formation. J . Bacteriol. 130(3), 983-990. Blumauerova, M., HoStalek, Z., and VanBk, Z. (1972). Biosynthesis o f tetracyclines: Problems and prospectives in genetic analysis. Ferment. Technol. Today, Proc. Int. Ferment. Symp., 4th, 1972 pp. 223-232. Bobkova, A. F., Velikodvorskaya, G. A,, Tikchonenko, G . I., Lebed, E. S., Egorov, A. A., and Bartoshevich, Y. E. (1975). Viruses infective for bacteria in strains ofpenicillium chrysogenum with various antibiotic activity. Antibiotiki 20, 60C606. Borck, K., Beggs, J . D., Brammar, W. J., Hopkins, A. S., and Murray, N. E. (1976). The construction in vitro of transducing derivatives of phage lambda. Mol. Gen. Genet. 146, 199-207. Borisova, L. N., and Ivkina, N. S. (1966). Recombinations ofActinomyces Streptomycini. Mikrobiologiya 35, 441-448. Borisova, L. N., Konyukhova, M. A,, and Ivkina, N. S. (1962). Recombinations of Actinomyces aureofaciens. Antibiotiki 7 , 685-691. Boronin, A. M., and Mindlin, S. Z. (1971). Genetic analysis of Actinomyces rimosus mutants with impaired synthesis of antibiotic. Genetika 7 , 125- 131. Boronin, A. M., and Sadovnikova, I. G. (1972). Elimination by acridine dyes of oxytetracycline resistance in Actinomyces rimosus. Genetika 8, 174-176. Boucher, C., Bergeron, B., Bertalmio, M. B. D., and Denarie, J. (1977). Introduction of bacteriophage MU into Pseudomonas-Solanacearum and Rhizobium-meliloti using R factor RP4. J . Gen. Microbiol. 98, 253-264. Bourgeois, S., and Pfahl, M. (1976). Repressors. Adu. Protein Chem. 30, 1-99. Bradley, S. G. (1962).Parasexual phenomenon in microorganisms. Annu. Rev. Microbiol. 16, 35-52. Bradley, S. G., and Jones, L. A. (1967). Bacteriophages: Their biology and industrial significance. Prog. Znd. Microbiol. 7, 43-75. Bradley, S. G., and Lederberg, J . (1956). Heterokaryosis in streptomyces. J . Bacteriol. 72, 219-225. Bradley, S. G., Anderson, D. L., and Jones, L. A. (1959). Genetic interaction within heterokaryons of streptomyces. Ann. N . Y . Acad. Sci. 81, 811-823. Braendle, D. H., and Szybalski, W. (1957). Genetic interaction among streptomycetes; heterokaryosis and synkaryosis. Proc. Natl. Acad. Sci. U.S.A. 43, 947-955. Brammer, W. J., Clarke, P. H., and Skinner, A. J . (1967). Biochemical and genetic studies with regulator mutants of the Pseudomonas aeruginosa 8602 amidase system. J . Gen. Microbiol. 47, 87-102.
GENETICS OF APPLIED MICROBIOLOGY
105
Brenner, D. J., and Falkow, S. (1971). Molecular relationships among members of the Enterobacteriaceae. Adv. Genet. 16, 81-118. Bridges, B. A. (1977). Recent advances in basic mutation research. Mutat. Res. 44, 149-164. Brill, W. J., and Magasanik, B. (1969). Genetic and metabolic control of histidase and urocanase inSalmonella typhimurium strain 15-59. J . Biol. Chem. 244,5392-5398. Britten, R. J., and McClure, F. T. (1962). The amino acid pool in Escherichia coli. Bacteriol. Rev. 26, 292-335. Brown, D. D. (1973). The isolation of genes. Sci. A m . 229, 20-29. Brown, D. D., and Stern, R. (1974). Methods of gene isolation. Annu. Rev. Biochem. 13, 667-693. Brown, K. D. (1971). Maintenance and exchange of the aromatic amino acid pool in Escherichia coli. J . Bacteriol. 106, 70-81. Brownell, G. H. (1976). Chromosomal location of P4Hi-C-prophage in Nocardia erythropolis. J . Gen. Microbiol. 94, 217-220. Brownell, G. H., and Adams, J. N. (1976). Inheritance ofnocardiophage 4EC in matings of nocardial lysogens. J . Bacteriol. 126, 1104-1107. Bruenn, J., and Hollingsworth, H. (1973). A mutant of Escherichia coli with a new, highly efficient promoter for the lactose operon. Proc. Natl. Acad. Sci. U.S.A. 70, 3693- 3697. Bukhari, A. I. (1976). Bacteriophage MU as a transposition element. Annu. Rev. Genet. 10, 389-412. Bukhari, A. I., Shapiro, J., and Adhya, S. (1977). “DNA Insertion Elements, Episomes and Plasmids.” Cold Spring Harbor Lab., Cold Spring Harbor, New York. Bu’Lock, J. D. (1961). Intermediary metabolism and antibiotic synthesis. Adu. Appl. Microbiol. 3, 293. Burnet, J . H. (1975). “Mycogenetics: An Introduction to the General Genetics of Fungi.” Wiley, New York. Caglioti, M. T., and Sermonti, G. (1956). A study of the genetics of penicillin-producing capacity in Penicillium chrysogenum. J . Gen. Microbiol. 14, 3%46. Calam, C. T. (1964). Prog. Znd. Microbiol. 5, 3. Calam, C. T. (1970). Methods Microbiol. 3A, 435-459. Cannon, F. C., Dixon, R. A,, Postgate, J . R., and Primrose, S. B. (1974). Chromosomal integration o f Klebsiella nitrogen fixation genes in E . coli. J . Gen. Microbiol. 80, 227-239. Cannon, F. C., Riedel, G. E., and Ausubel, F. E. (1977). Recombinant plasmid that carries part of nitrogen fixation (NIF) gene clusters ofKlebsiella-Pneumoniae.Proc. Natl. Acad. Sci. U.S.A. 74, 2963-2965. Carere, A., and Randazzo, R. (1976). Comutation in streptomyces. Proc. Znt. Symp. Genet. Znd. Microorg., 2nd, 1974 pp. 573-581. Carlson, P. S. (1973). The use of protoplasts for genetic research. Proc. Natl. Acad. Sci. U.S.A. 70, 5 9 ~ ~ 6 0 2 . Carlson, P. S., and Polacco, J . C. (1975). Plant cell cultures: Genetic aspects of crop improvement. Science 188, 622-625. Caten, C. E., and Jinks, J. L. (1976). Quantitative genetics. Proc. Znt. Symp. Genet. Znd. Microorg., 2nd, 1974 pp. 000-000. Cells, R., and Vining, L. C. (1974). Action of streptomycin on the growth ofStreptornyces griseus. Can. J . Microbiol. 20, 1591-1597. Cerda-Olmedo, E., Hanawalt, P. C., and Guerola, N. (1968). Mutagenesis of the replica-
106
VEDPAL SINGH MALIK
tion point by nitrosoguanidine: Map and pattern of replication of theEscherichia coli chromosome. J . Mol. Biol. 33, 705-719. Chakrabarty, A. M. (1976). Plasmids in Pseudomonas. Annu. Rev. Genet. 10, 7-30. Chakrabarty, S. L., and Nandi, P. (1971).A new actinomycin-like antibiotic produced by a mutant strain of Streptomyces indicus. Experientia 27, 595-596. Chater, K. F., and Wilde, L. C. (1976). Restriction of a bacteriophage of Streptomyces albus G involving endonuclease Sal I. J . Bacteriol. 128, 644-650. Chibata, I., and Tosa, T. (1977). Transformation of organic compounds by immobilized microbial cells. Adv. Appl. Microbiol. 22, 1-28. Child, J. J. (1975). Nitrogen fixation by a Rhizobium sp in association with nonleguminous plant-cell cultures. Nature (London1 253, 350-351. Chilton, M. D., Drummond, M. H., Merlo, D. J., Sciaky, D., Montoya, A. L., Gordon, M. P., and Nester, E. W. (1977). Stable incorporation of plasmid DNA into higher plant cells: The molecular basis of crown gall tumorigenesis. Cell 11, 263-271. Ciegler, A,, and Roper, K. (1957). Application of heterokaryons of aspergillus to commercial type fermentations. Appl. Microbiol. 5, 10G112. Clarke, L., and Carbon, J. (1975). Biochemical construction and selection of hybrid plasmids containing specific segments of the Escherichia coli genome. Proc. Natl. Acad. Sci. U.S.A. 72, 4361-4365. Clarke, L., and Carbon, J. (1976). A colony bank containing synthetic Col E,, hybrid plasmids representative of the entire E . coli genome. Cell 9, 91-99. Claridge, C. A,, Busch, J. A., Defuria, M. D., and Price, K. E. (1974). Fermentation and mutation studies with a butiriosin producing strain ofBacillus circulans. Deu. 2nd. Microbiol. 115, 101-113. Clarke, P. H. (1976). Proc. 2nt. Symp. Genet. Znd. Microorg., 2nd, 1974 pp. 15-39. Clewell, D. B. (1972). Nature of Col E, plasmid replication in Escherichia coli in the presence of chloramphenicol. J . Bacteriol. 110, 667-676. Clewell, D. B., Yagi, Y., and Bauer, B. (1975). PJasmid-determined tetracycline resistance in Streptococcus faecalis: Evidence for gene amplification during growth in the presence of tetracycline. Proc. Natl. Acad. Sci. U.S.A. 72, 1720-1724. Coats, J. H. (1976). Genetic recombination in Streptomyces achromogenes var. rubradiris. Proc. Int. Symp. Genet. Ind. Microorg., 2nd, 1974 pp. 521-530. Coats, J. H., and Roeser, J. (1971). Genetic recombination in Streptomyces bikiniensis var. zorbonensis. J . Bacteriol. 105, 880-885. Cocking, E. C. (1977). Uptake of foreign genetic material by plant protoplasts. Int. Rev. Cytol. 48, 323-344. Cohen, S. N. (1975). The manipulation of genes. Sci. A m . 233, 24-33. Cole, D. S., Holt, G., and Macdonald, K. D. (1976). Relationship ofthe genetic determination of impaired penicillin production in naturally occurring strains to that in induced mutants of Aspergillus nidulans. J . Gen. Microbiol. 96, 423-426. Coleman, G., and Elliott., G. (1962). Studies on a-amylase formation by Bacillus subtilis. Biochem. J . 83, 256-263. Collins, J. (1977). Gene cloning with small plasmids. Curr. Top. Microbiol. Imrnunol. (in press). Contreras, R., and Khorana, H. G. (1976). Controlled transcription of synthetic gene for tyrosine transfer RNA. Arch. Znt. Physiol. Biochim. 84, 145-147. Courvalin, P., Weisblum, B., and Davies, J. (1977).Aminoglycoside-modifying enzyme of an antibiotic-producing bacterium acts as a determinant of antibiotic resistance in E . coli. Proc. Natl. Acad. Sci. U.S.A. 74, 999-1004. Cox, E. C. (1976). Bacterial mutator genes and the control of spontaneous mutation. Annu. Reu. Genet. 10, 135-156.
GENETICS OF APPLIED MICROBIOLOGY
107
Cox, G. S., Weissbach, H., and Kaback, H. R. (1975). Transport in a n Escherichia coli fatty acid auxotroph-novel case of catabolite repression. J . Biol. Chem. 250,45424548. Cronan, J. E., and Bell, R. M. (1974). Mutants ofEscherichia coli defective in membrane phospholipid synthesis: Mapping of Sn-glycerol 3-phosphate acyl transferase Km mutants. J . Bacteriol. 120, 227-233. Curdova, E., Kremen, A,, Vangk, Z., and Hosalek, Z. (1976). Regulation of biosynthesis of secondary metabolites. XVIII. Adenylate level and chlorotetracycline production in Streptomyces aureofaciens. Folia Microbiol. (Prague) 21, 481-487. C u r t i s , R., I11 (1976). Genetic manipulation of microorganisms: Potential benefits and biohazards. Annu. Reu. Microbiol. 30, 507-533. Dajani, A. S., and Wannamaker, L. W. (1976). Bacteriocins of gram positive bacteria. Bacteriol. Rev. 40, 722-756. Dales, R. B. G., and Groft, J. H. (1977). Protoplast fusion and the isolation of heterokaryons and diploids from vegetatively incompatible strains of Aspergillus nidulans. FEMS Microbiol. Lett. 1, 204. Daum, S. J., Rosi, D., and Goss, W. A. (1977). Mutational biosynthesis by idiotrophs of Micromonospora purpurea. 11. Conversion of non-amino containing cyclitols to aminoglycoside antibiotics. J . Antibiot. 30, 9% 105. Dawson, P. S. S. (1977).Continuous fermentations. Annu. Rep. Ferment. Proc. 1,73-93. Day, P. R. (1977). Plant genetics: Increasing crop yield. Science 197, 1334-1339. Dean, A. C. R., Ellwood, D. C., Evans, C. T. G., and Melling, J., eds. (1976). “Continuous Culture: Applications and Fields.” Ellis Horwood, L a . , Chichester. Delic, V., Hopwood, D. A,, and Friend, E. J. (1970). Mutagenesis by N-methyl-Nnitrosoguanidine (NTG) in Streptomyces coelicolor. Mutat. Res. 9, 167-182. Demain, A. L. (1972). Genetics and process improvements in Streptomyces. Ferment. Technol. Today, Proc. Int. Ferment. Symp., 1972 pp. 239-245. Demain, A. L. (1973). Mutation and the production of secondary metabolites. Adu. Appl. Microbiol. 16, 177-202. Demain, A. L. (1976). Genetic regulation of fermentation organisms. Stadler Symp. 8, 41-55. Demain, A. L., and Birnbaum, J. (1968). Alteration of permeability for the release of metabolites from the microbial cell. Curr. Top. Microbiol. Zminunol. 46, 1-25. Demerec, M. (1965). Homology and divergence in genetic material of Salmonella typhimurium and Escherichia coli. In “Evolving Genes and Proteins” (V. Bryson and H. J. Vogel, eds.), pp. 505-510. Academic Press, New York. Detroy, R. W. (1976). Mycoviruses: Significance in industrially and agriculturally important fungi. In “Microbiology” (D. Schlessinger, ed.), pp. 563-564. ASM, Washington, D.C. Ditchburn, P., Giddings, B., and Macdonald, K. D. (1974). Rapid screening for the isolation of mutants of Aspergillus nidulans with increased penicillin yields. J . Appl. Bacteriol. 37, 515-523. Doi, R. H. (1977). Role of ribonucleic acid polymerase in gene selection in procaryotes. Bacteriol. Rev. 41, 5 6 S 5 9 4 . Dowding, J . E., and Hopwood, D. A. (1973). Temperate bacteriophages for Streptomyces coelicolor A3(2) isolated from soil. J . Gen. Microbiol. 78, 349-359. D ~ YC., H., Gresshoff, P. M., and Rolfe, B. G. (1973).Biological and molecular evidence for the transgenosis of genes from bacteria to plant cells. Proc. Nutl. Acad. Sci. U . S . A . 70, 723-726. Drew, S. W., and Demain, A. L. (1977). Effect of primary metabolites on secondary metabolism. Annu. Rev. Microbiol. 31, 343-356.
108
VEDPAL SINCH MALIK
Drummond, M. H., Gordon, M. P., Nester, E. W., and Chilton, M. (1977). Foreign DNA of bacterial plasmid origin is transcribed in crown gall tumours. Nature (London) 269, 535-536. Dudits, D., Rasko, I., and Hadlaczky, G. (1976). Fusion of human cells with carrot protoplasts induced by polyethylene glycol. Hereditas 82, 121-123. Dulaney, E. L. (1953). Observations on Streptomyces griseus. VI. Further studies on strain selection for improved streptomycin production. Mycologia 45, 481-487. Dulaney, E. L., and Dulaney, D. D. (1967). Mutant populations ofStreptomyces viridifaciens. Trans. N . Y . Acad. Sci. [2] 29, 782-799. Dunn, N. W., and Holloway, B. W. (1971). Pleiotrophy ofp-fluorophenylalanine-resistant and antibiotic hypersensitive mutants of Pseudomonas aeruginosa. Genet. Res. 18, 185-197. Edwards, G. F. L., Holt, G., and Macdonald, K. D. (1974). Mutants of Aspergillus nidulans impaired in penicillin biosynthesis. J . Gen. Microbiol. 84, 420-422. Ehrlich, S. D. (1977). Replication and expression ofplasmids from Staphylococcus aureus in Bacillus subtilis. Proc. Natl. Acad. Sci. U.S.A. 74, 1680-1682. Elander, R. P. (1967). Enhanced penicillin synthesis in mutant and recombinant strains of Penicillium chrysogenum. In “Induced Mutations and Their Utilization” (H. Stubbe, ed.), pp. 403-423. Akademie-Verlag, Berlin. Elander, R. P. (1973).Zn “Genetics of Industrial Microorganisms” (Z. Vangk, Z. HoStalek, and J. Cudlin, eds.), pp. 239-253. Elsevier, Amsterdam. Elander, R. P. (1975). Genetic aspects of cephalosporin and cephamycin-producing microorganisms. Deu. Znd. Microbiol. 16, 3 5 6 3 7 4 . Elander, R. P., Mabe, J. A,, Hamill, R. L., and Gorman, M. (1971). Biosynthesis of pyrrolnitrin by an analogue-resistant mutant of Pseudomonas fluorescens. Folia Microbiol. (Prague) 16, 157-165. Elander, R. P., Espenshade, M. A,, Pathak, S. G., and Pan, C. H. (1973). The use of parasexual genetics in an industrial strain improvement program with Penicillium chrysogenum. In “Genetics of Industrial Microorganisms” (Z. Vangk, Z. Hosalek, and J. Cudlin, eds.), Vol. 2, pp. 239-253. Elsevier, Amsterdam. Elander, R. P., Corum, C. J., De Valeria, H., and Wilgus, M. (1976). Ultraviolet mutagenesis and cephalosporin synthesis in strains ofCephalosporium acremonium. Proc. Znt. Symp., Genet. Ind. Microorg., 2nd, 1974 pp. 253-271. Elander, R. P., Chang, L. T., and Vaughan, R. W. (1977). Genetics of industrial microorganisms. Annu. Rep. Ferment. Proc. 1, 1-40. Engberg, J., and Klenow, H. (1977). Palindromic arrangement of specific genes in lower eukaryotes. Trends Biochem. Sci. 2, 183-185. Ephrussi, B. (1972). “Hybridization of Somatic Cells.” Princeton Univ. Press, Princeton, New Jersey. Evans, D. K., and Cocking, E. C. (1975).The techniques ofplant cell culture and somatic cell hybridization. New Tech. Biophys. Cell Biol. 2, 127-158. Evans, H. J., and Barber, L. B. (1977). Biological nitrogen fixation for food and fiber production. Science 197, 332-339. Fantini, A. A. (1976). Strain improvement. In “Methods in Enzymology” (J. H. Hash, ed.), Vol. 43, pp. 24-41. Academic Press, New York. Ferenczy, L., and Maraz, A. (1977). Transfer of mitochondria by protoplast fusion in Saccharomyces cerevisiae. Nature (London) 268, 524-525. Ferenczy, L., Kevei, F., and Zsolt, J. (1974). Fusion of fungal protoplasts. Nature (London) 248, 793-794. Fincham, J. R. S., and Day, P. R. (1971). “Fungal Genetics,” Blackwell, Oxford.
GENETICS OF APPLIED MICROBIOLOGY
109
Folk, W. R., and Berg, P. (1971). Duplication of the structural gene for the glycyltransfer RNA synthetase in Escherichia coli. J . Mol. Biol. 58, 595-610. Fournier, M. J., Jr., Brenner, D. J., and Doctor, B. P. (1974). The isolation of genes: A review of advances in the enrichment, isolation and in uitro synthesis of specific cistrons. Prog. Mol. Subcell. Biol. 3, 1 5 8 4 . Fowke, L. C., Constabel, F., and Gamborg, 0. L. (1977). Fine structure of fusion products from soybean cell culture and pea leaf protoplasts. Planta 135, 257-264. Fraenkel, D. G., and Parola, A. (1972). ‘Up-promoter’ mutations of glucose-6-phosphate dehydrogenase in Escherichia coli. J . Mol. Biol. 71, 107-111. Frances, M. M., Cella, R., and Vining, L. C. (1975a). Streptomycin resistance in chloramphenicol-producing strains of Streptomyces species 3022a. Can. J . Microbiol. 21,911-919. Frances, M. M., Cella, R., and Vining, L. C. (1975b). Genetic recombination in a chloramphenicol-producing strain of Streptomyces species 3022a. Can. J . Microbiol. 21, 1151-1159. Francis, J. C., and Hansche, P. E. (1972). Directed evolution of metabolic pathways in microbial populations. I. Modification of the acid phosphatase pH optimum in Saccharomyces ceruisiae. Genetics 70, 59-73. Freeman, R. F., Bibb, M. J., and Hopwood, D. A. (1977). Chloramphenicol acetyl transferase-independent chloramphenicol resistance in Streptomyces coelicolor A3(2). J . Gen. Microbiol. 98, 453-465. Friedman, D. I., and Baron, L. S. (1974). Genetic characterization of a bacterial locus involved in the activity of the N function of phage A. Virology 58, 141-148. Friend, E. J., and Hopwood, D. A. (1971). The linkage map of Streptomyces rimosus. J . Gen. Microbiol. 68, 187-197. Fuchs, P. G., Zajdel, J., and Dobrzanski, W. T. (1975). Possible plasmid nature of the determinant for production of the antibiotic Nisin in some strains of Streptococcus lactis. J . Gen. Microbiol. 88, 189-192. Ganem, D., Nussbaum, A. L., Davoli, D., and Fareed, G. C. (1976). Propagation of a segment of bacteriophage A-DNA in monkey cells after covalent linkage to a defective simian virus 40 genome. Cell 7, 349-359. Gemski, J. R., Alexeichik, J . A,, and Baron, L. S. (1972). Behaviour of coliphage lambda in Shigella flexneri 2a. J . Virol. 10, 668-674. Gilbert, W., and Muller-Hill, B. (1967). Isolation of the lac repressor. Proc. Natl. Acad. Sci. U.S.A. 56, 1891-1898. Gilbert, W., and Muller-Hill, B. (1970). The lactose repressor. I n “The Lactose Operon” (J. R. Beckwith and D. Zipser, eds.), pp. 93-110. Cold Spring Harbor Lab., Cold Spring Harbor, New York. Glansdorff, N., and Sand, G. (1968). Duplication of a gene belonging to an arginine operon of Escherichia coli K-12. Genetics 60, 257-268. Glenn, A. R. (1976). Production of extracellular proteins by bacteria. Annu. Rev. Microbiol. 30, 41-62. Gdfrey, 0. (1974). Directed mutations in Streptomyces lipmanii. Can. J . Microbiol. 20, 1479- 1485, &wish, H., and Lingens, F. (1971a). 3-Deoxy-~-arabino-heptulosonate-7-phosphate synthase of Streptomyces aureofaciens Tue 24. I. Partial purification and properties. Biochim. Biophys. Actu 242, 617-629. Goerish, H., and Lingens, F. (1971b). 3-Deoxy-~-arabino-heptulosonate-7-phosphate synthase of Streptomyces aureofaciens Tue 24. 11. Repression and inhibition by tryptophan and tryptophan analogs. Biochim. Biophys. Acta 242, 630-636.
110
VEDPAL SINGH MALIK
Goerish, H., and Lingens, F. (1972). Properties of chorismate mutase of Streptomyces uenezuelae. Arch. Mikrobiol. 82, 147-154. Goerish, H., and Lingens, F. (1973). Chorismate mutase from Streptomyces aureofuciens heat stable enzyme. J . Bacteriol. 114, 645-651. Goerish, H., and Lingens, F. (1974). Chorismate mutase from Streptomyces. Purification properties and subunit structure of the enzyme from Streptomyces aureofaciens Tue 24. Biochemistry 13, 379C3794. Goldat, S. Yu. (1958). Induced and natural variation in a strain ofStreptomyces uureofaciens. Antibiotiki 4, 1 6 1 8 . Goldat, S. Yu. (1961). Selection ofActinomyces aureofaciens with the use of mutagenic factors. Tr.Znst. Mikrobiol., Akad. Nauk SSSR 10, 159-163. Goldberg, R. B., Bender, R. A,, and Streicher, S. L. (1974). Direct selection for P , sensitive mutants of enteric bacteria. J . Bacteriol. 118, 810-814. Goldberger, R. F., Deeley, R. G., and Mullinix, K. P. (1976). Regulation of gene expression in prokaryotic organisms. Adu. Genet. 18, 1-67. Goldring, E. S., and Wake, R. G. (1968). A comparison of the segregation of chromosomes within microcolonies developing from single Bacillus subtilis and Bacillus megaterium spores. J . Mol. Biol. 35, 647-650. Gordee, E. Z., and Day, L. E. (1972). Effect of exogenous penicillin on penicillin biosynthesis. Antimicrob. Agents & Chemother. 1, 315-322. Gordon, J. K., and Brill, W. J. (1972). Mutants that produce nitrogenase in the presence of ammonia. Proc. Nutl. Acad. Sci. U.S.A. 69, 3501-3503. Gorman, M., Hamill, R. L., Elander, R. P., and Mabe, J. (1968). Preparation of substituted phenyl pyrroles through the metabolism of tryptophan analogs. Biochem. Biophys. Res. Commun. 31, 2 9 6 2 9 8 . Gottesman, S., and Beckwith, J. R. (1969). Directed transposition of the arabinose operon. A technique for the isolation of specialized transducing bacteriophages for any E. coli gene. J . Mol. Biol. 44, 117-127. Gregory, K. F., and Huang, J. C. C. (1964a). Tyrosinase inheritance in Streptomyces scabies. I. Genetic recombination. J . Bacteriol. 87, 1281- 1286. Gregory, K. F., and Huang, J. C. C. (1964b). Tyrosinase inheritance in Streptomyces scabies. 11. Induction of tyrosinase deficiency by acridine dyes. J . Bacteriol. 87, 1287-1294. Grimsley, N. H., Ashton, N. W., and Cove, D. J. (1977). Production of somatic hybrids by protoplast fusion in moss, Physcomitrella-Patens. Mol. Gen. Genet. 153, 97- 100. Guerola, N., Ingraham, J. L., and Cerda-Olmedo, E. (1971). Induction of closely linked multiple mutations by nitrosoguanidine. Nature (London),New Biol. 230,122-125. Haas, F. L., Puglisi, T. A,, Moses, A. J., and Lein, J. (1956). Heterokaryosis as a cause of culture rundown in penicillin. Appl. Microbiol. 4, 187-195. Halsall, D. M. (1975). Overproduction of lysine by mutant strains ofEscherichia coli with defective lysine transport systems. Biochem. Genet. 13, 10% 124. Harada, Y. (1959). Induction of new genetic character by DNA treatment in Streptomyces griseus group. J . Agric. Chem. SOC.Jpn. 33, 744. Harris, H. (1970). “Cell Fusion.” Harvard Univ. Press, Cambridge, Massachusetts. Hartley, B. S. (1974). Enzyme families. Symp. SOC.Gen. Microbiol. 24, 151-182. Hartman. P. E., and Roth, J. R. (1973). Mechanisms of suppression. Adu. Genet. 17, 1-105. Hawthorne, D. C., and Leupold, U. (1974). Suppressor mutations in yeast. Curr. Top. Microbiol. Immunol. 64, 1-47. Hendlin, D., Dulaney, E. L., Dresches, D., Cook, T., and Chaiet, L. (1962). Methionine
GENETICS OF APPLIED MICROBIOLOGY
iii
dependence and the biosynthesis of 6-dimethyl-chloro tetracycline. Biochim. Biophys. Acta 58, 6 3 5 6 3 6 . Hershfield, V., Boyer, H. W., Yanofsky, C., Lovett, M. A,, and Helinski, D. R. (1974). Plasmid Col E, as a molecular vehicle for cloning and amplification of DNA. Proc. Natl. Acad. Sci. U . S . A . 71, 3455-3459. Hess, F. (1977).In “Plant Cell, Tissue and Organ Culture” (K. J. Reinert and Y. P. s. Bajaj, eds.). Springer-Verlag, Berlin and New York. Hesseltine, C. W., and Haynes, W. C. (1974). Sources and management of microorganisms for the development of a fermentation industry. U.S., Dep. Agric., Agric. Handb. 440. Heyn, R. F., Rorsch, A,, and Schilperoort, R. A. (1974). Prospects in genetic engineering of plants. Q. Rev. Biophys. 7, 35-73. Heyneker, H. L., Shine, J., Goodman, H. M., Boyer, H., Rosenberg, J., Dickerson, R. E., Narang, S. A,, Itakura, K., Lin, S. Y., and Riggs, A. D. (1976). Synthetic lac operator DNA is functional in uiuo. Nature (London) 263, 748-752. Higerd, T. B., Hoch, J. A,, and Spizizen, J. (1972). Hyperprotease producing mutants of Bacillus subtilis. J . Bacteriol. 112, 102G1028. Higuchi, R., Paddock, G. V., Wall, R., and Salser, W. (1976). General method for cloning eukaryotic structural gene sequences. Proc. Natl. Acad. Sci. U . S . A . 73,3146-3150. Hill, C., and Cambriato, G. (1973). Kinetic duplications induced a t very high frequency by ultraviolet irradiation in Escherichia coli. Mol. Gen. Genet. 127, 197-214. Hin, H. T. (1976). Cellular hybridization. Recherche 7, 639. Hollaender, A. (1977). “Genetic Engineering for Nitrogen Fixation.” Plenum, New York. Holt, G., and Macdonald, K. D. (1968a). Penicillin production and its mode of inheritance in Aspergillus nidulans. Antonie uan Leeuwenhoek 34, 409-416. Holt, G., and Macdonald, K. D. (196813). Isolation of strains with increased penicillin yield after hybridisation in Aspergillus nidulans. Nature (London) 219, 636-637. Hong, J., and Ames, B. N. (1971). Localised mutagenesis of any small specific region of the bacterial chromosome. Proc. Natl. Acad. Sci. U . S . A . 68, 3 1 5 g 3 1 6 2 . Hopkins, A. S., Murray, N. E., and Brammar, W. J. (1976). Characterization of A trp-transducing bacteriophages made in uitro. J . Mol. Biol. 107, 549-569. Hopwood, D. A. (1967). Genetic analysis and genome structure in Streptomyces coelicolor. Bncteriol. Rev. 31, 373-403. Hopwood, D. A . (1970). The isolation of mutants. Methods Microbiol. 3A, 363-433. Hopwood, D. A,, and Merrick, M. J. (1977). Genetics of antibiotic production. Bacteriol. Rev. 41, 595-535. Hopwood, D. A,, and Wright, H. M. (1972). Transformation in Thermoactinomyces vulgaris. J . Gen. Microbiol. 71, 383-398. Hopwood, D. A,, and Wright, H. M. (1973a). Transfer of a plasmid between Streptomyces species. J . Gen. Microbiol. 77, 187-195. Hopwood, D. A., and Wright, H. M. (1973b).A plasmid ofStreptomyces coelicolor bearing a chromosomal locus and its interspecific transfer. J . Gen. Microbiol. 79, 331-342. Hopwood, D. A,, Harold, R. J., Vivian, A,, and Ferguson, H. M. (1969). A new kind of fertility variant in Streptomyces coelicolor. Genetics 62, 461-477. Hopwood, D. A,, Chater, K. F., Dowding, J. E., and Vivian, A. (1973). Advances in Streptomyces coelicolor genetics. Bacteriol. Rev. 37, 371-405. Hopwood, D. A., Kirby, R., and Wright, L. F. (1975). Plasmid-determined antibiotic synthesis and resistance in Streptomyces coelicolor. Nature (London) 2 5 4 , 2 6 5 2 6 7 . Hopwood, D. A., Wright, H. M., Bibb, M. J., and Cohen, S. N. (1977). Genetic recombination through protoplast fusion in Streptomyces. Nature (London) 268, 171- 174.
112
VEDPAL SINGH MALIK
Horiuchi, T., Tomizawa, J., and Novick, A. (1962). Isolation and properties of bacteria capable of high rates of P-galactosidase synthesis. Biochim. Biophys. Acta 55. 152163. Horiuchi, T., Horiuchi, S., and Novick, A. (1963). The genetic basis of hyper-synthesis of P-galactosidase. Genetics 48, 157- 169. Horst, J., Kluge, F., Beyreuther, K., and Gerok, W. (1977). Gene transfer to human cells: Transducing phage A plac gene expression in GM,-gangliosidosis fibroblasts. Proc. Natl. Acad. Sci. U.S.A. 72, 3531-3535. Horvath, J., and Buday, F. (1960). Effect of DNA of various origins on changes in antibiotic production of Streptomyces. Biol. Kozl. 8, 19-23. HoStalek, Z., Blumauerova, M., and Vangk, Z. (1974). Genetic problems of the biosynthesis of tetracycline antibiotics. Adu. Biochem. Eng. 3, 13-67. Hotta, K., Okami, Y., and Umezawa, H. (1977). Elimination of the ability of a kanamycin-producing strain to biosynthesize deoxystreptamine moiety by acriflavine. J . Antibiot. 30, 11461149. Hughes, B. G., White, F. G., and Smith, M. A. (1977). Fate of bacterial plasmid DNA during uptake by barley protoplasts. FEBS Lett. 79, 80-84. Ichikawa, T., Date, M., Ishikura, T., and Ozaki, A. (1971). Improvement of kasugamycin-producing strain by agar piece method and the prototroph method. Folia Microbiol. (Prague) 16, 218-224. Ikeda, Y., Nakamura, K., Uchida, K., and Ishitani, C. (1957). Two attempts upon improving a n industrial strain of A. oryzae through somatic recombination and polyploidization. J . Gen. Appl. Microbiol. 3, 93-98. Ilyin, Y. V., Tehurikov, N. A., and Georgiev, G. P. (1976). Selection and some properties of recombinant clones of lambda bacteriophage containing genes of Drosophila melanogaster. Nucleic Acids Res. 3, 2115-2127. Itakura, K., Hirose, T., Crea, R., Riggs, A. D., Heyneker, H. L., Boliver, F., and Boyer, H. W. (1977). Expression in Escherichia coli of a chemically synthesized gene for the hormone somatostatin. Science 198, 10561063. Izumi, Y., and Ogata, K. (1977). Some aspects of microbial production of Biotin. Adu. Appl. Microbiol. 22, 1 4 5 1 7 6 . Jacob, F., and Campbell, A. (1959). Sur le systeme de repression assurant l'immunite chez les bacteries lysogenes. C.R. Hebd. Seances Acad. Sci. 248, 3219-3223. Jagger, J., Takebe, H., and Snow, J . M. (1970). Photoreactivation of killing in Streptomyces: Action spectra and kinetic studies. Photochem. Photobiol. 12, 185- 196. Jamet-Vierney, C., and Anagnostopoulos, C. (1975). Induction and transmission of a merodiploid condition near the terminal area of the chromosome ofBacillus subtilis. Genetics 81, 437-458. Jarai, M. (1961a). Genetic recombination in Streptomyces aureofaciens. Acta Microbiol. Acad. Sci. Hung. 8, 73-79. Jarai, M. (1961b). Transformation in Streptomyces. Acta Microbiol. Acad. Sci. Hung. 8, 81-87. Jensen, R. A. (1976). Enzyme recruitment in evolution of new function. Annu. Reu. Microbiol. 30, 409-425. Jinks, J. L., Caten, C. E., Simchen, G., and Croft, J . H. (1966). Heterokaryon incompatibility and variation in wild populations of Aspergillus nidulans. Heredity 21, 227239. Johnson, C. B., Grierson, D., and Smith, H. (1973). Expression of gamma-plac 5 DNA in cultured cells of a higher plant. Nature (London), New Biol. 244, 105-107. Johnson, E. M., Placek, B. P., Snellings, N. J., and Baron, L. S. (1975). Conservation of
GENETICS OF APPLIED MICROBIOLOGY
113
Salmonella typhimurium deoxyribonucleic acid by chromosomal insertion in a partially diploid Escherichia coli hybrid. J . Bacteriol. 123, 1-6. Jones, A,, and Vining, L. C. (1976). Biosynthesis of chloramphenicol in Streptomyces 3022a. Identification of p-amino-L-phenylalanine as a product from the action of arylamine synthetase on chorismic acid. Can. J . Microbiol. 22, 237-244. Jones, A,, and Westlake, D. W. S. (1974). Regulation of chloramphenicol synthesis in Streptomyces species 3022a. Properties of aryllamine synthetase. An enzyme involved in antibiotic biosynthesis. Can. J . Microbiol. 20, 1599- 1611. Jones, C. W., Mastrangelo, I. A,, Smith, J. J., and Liu, H. Z. (1976). Interkingdom fusion between human (HeLa) cells and tobacco (GGLL) protoplasts. Science 193,401-403. Kafer, E. (1961). The process of spontaneous recombination in vegetative nuclei of Aspergillus nidulans. Genetics 46, 1581-1609. Kafer, E. (1977). Meiotic and mitotic recombination in Aspergillus and its chromosomal aberrations. Adu. Genet. 19, 33-131. Kahler, R., and Noack, A. (1974). Action of acridine orange and ethidium bromide on growth and antibiotic activity ofstreptomyces hygroscopicus. 2. Allg. Mikrobiol. 14, 529-533. Kaiser, D., and Dworkin, M. (1975). Gene transfer to a myxobacterium by Escherichia coli phage P,. Science 187, 653-654. Katagiri, I. (1954). Study on the chloretetracycline. Improvement of chloretetracyclineproducing strain by several kinds of methods. J . Antibiot. 7, 45-52. Kedes, L., Chang, A,, Houseman, D., and Cohen, S. (1975). Isolation of histone genes from unfractionated sea urchin DNA by subculture cloning in E . coli. Nature (London) 255, 533-538. Keegstra, K., and Albersheim, P. (1970). Involvement of glycosidases in the cell wall metabolism of suspension-cultured Acer pseudoplatanus cells. Plant Physiol. 45, 675-678. Kelner, A. (1949). Studies on the genetics of antibiotic formation: The induction of antibiotic-forming mutants in actinomycetes. J . Bacteriol. 57, 73-92. Kirby, R., and Hopwood, D. H. (1977). Genetic determination of methylenomycin synthesis by SCP, plasmid of streptomyces-coelicor A3(2). J . Gen. Microbiol. 98,239-252. Kirby, R., Wright, L. F., and Hopwood, D. A. (1975). Plasmid determined antibiotic synthesis and resistance in Streptomyces coelicolor. Nature (London) 254,265-267. Kitano, K. (1977). Studies on the production of p-lactam antibiotics. J . Tukedu Res. Lab. 36, 105-192. Kleckner, N. (1977). Translocatable elements in prokaryotes. Cell 11, 11-23. Kleckner, N., Chan, R. K., Tye, B. K., and Botstein, D. (19751. Mutagenesis by insertion of a drug resistance element carrying a n inverted repetition. J . Mol. Biol. 97, 561-575. Kleckner, N., Roth, J., and Botstein, D. (1977). Genetic engineering in uiuo using translocatable drug resistance elements. J . Mol. Biol. 116, 125-159. Kleinhofs, A,, Eden, F. C., Chilton, M. D., and Benelich, A. J . (1975). On the question of integration of exogenous bacterial DNA into plant DNA. Proc. Natl. Acad. Sci. U.S.A. 72, 274a2752. Kojima, M., and Satoh, A. (1973). Microbial semi-synthesis of aminoglycosidic antibiotics by mutants of S. ribosidificus and S. kanamyceticus. J . Antibiot. 26, 784-786. Kojima, M., Ezaki, N., Amano, S., Inouye, S., and Niida, T. (1975). Bioconversion of ribostamycin. 11. Isolation and structures of 3-N-acetylribostamycin, a microbiologically inactive product of ribostamycin produced by Streptomyces ribosidificus. J . Antibiot. 28, 42-49.
114
VEDPAL SINGH MALIK
Komatsu, K., and Kodaira, R. (1977). Sulfur metabolism of a mutant ofCephalosporium acremonium with enhanced potential to utilize sulfate for cephalosporin C production. J . Antibiot. 30, 226-233. Kominek, L. A. (1975). Cycloheximide production by Streptomyces griseus: Control mechanisms of cycloheximide biosynthesis. Antimicrob. Agents & Chemother. 7 , 856-860. Kosikov, K. V. (1975). Polyploid hybrids of industrial yeast races and prospects for their practical application. Microbiology USSR 44, 615-620. Kosikov, K. V., and Raevskaya, 0. G. (1976). Biological productivity of hybrids and strains of yeasts of different ploidy. Mikrobiologiya 45, 890-894. Kosikov, K. V., Lyapunova, T. S., Raevskaya, 0. G., Semikhatova, N. M., Kochkina, I. B., and Meisel, M. N. (1977).Ergosterol synthesis by yeast hybrids and strains ofthe genus Saccharomyces of different ploidy. Mikrobiologiya 46, 70-74. Kozlov, J . I., Kalinina, N. A., Gening, L. V., Rebentish, B. A,, Strongin, A. Y., Bogush, V. G., and Debabov, V. G. (1977). Suitable method for construction and cloning hybrid plasmids containing Eco RJ fragments of E . coli genome. Mol. Gen. Genet. 150, 211-219. Kramer, R. A,, Cameron, J . R., and Davis, R. W. (1976). Isolation of bacteriophage A containing yeast ribosomal RNA genes. Screening by in situ RNA hybridization in plaques. Cell 8, 227-232. Kubitschek, H. E. (1973). Intensive nuclear selection in tryptophan limited cultures of Escherichia coli. Mol. Gen. Genet. 124, 269-290. LaCoste, L., Lacaille, M., and Brakier-Gingras, L. (1976). New types of streptomycesresistant mutants of Escherichia coli. Biochim. Biophys. Acta 442, 8 S 9 7 . Lancaster, W. D., and Jones, L. A. (1975). Molecular weight of DNA from actinophage MS P,. J . Virol. 16, 736-740. Lancini, G. C., and Hengeller, C. (1969). Isolation of rifamycin SV from a mutant Streptomyces mediterranei strain. J . Antibiot. 22, 637-638. Lancini, G. C., Hengeller, C., and Sensi, P. (1970). New naturally occurring rifamycins. Prog. Antimicrob. Anticancer Chemother., Proc. Int. Congr. Chemother., 6th, 1969 Vol. 2, pp. 1166-1173. Landy, A., Abelson, J., Goodman, H. M., and Smith, J. D. (1967). Specific hybridization of tyrosine transfer ribonucleic acids with DNA from a transducing bacteriophage 480 carrying the amber suppressor gene Su. 111. J . Mol. Biol. 29, 457-471. Langridge, J. (1969). Mutations conferring quantitative and qualitative increases in beta-galactosidase activity in Escherichia coli. Mol. Gen. Genet. 105, 74-83. LeBlanc, D. J., and Hassell, F. P. (1976). Transformation ofStreptococcus sanguis challis by plasmid deoxyribonucleic acid from Streptococcus faecalis. J . Bacteriol. 128, 347-355. LeBlanc, D. J., and Mortlock, R. P. (1971). Metabolism ofmarabinose: A new pathway in Escherichia coli. J. Bacteriol. 106, 90-96. Lechevalier, H. A. (1975). Production of the same antibiotics by members of different genera of microorganisms. Adv. Appl. Microbiol. 19, 2 5 4 5 . Lemaux, P., and Sebek, 0.K . (1973). Use of a mutant for the biosynthesis of a novobiocin analogue. Antimicrob. Agents & Chemother. 13, Abstract 49. Lemke, P. A. (1969). A century of compounds and their effect on fungi. Mycopathol. Mycol. Appl. 38, 49-59. Lemke, P. A. (1976). Virus of eukaryotic microorganisms. Annu. Reu. Microbiol. 30, 105145. Lemke, P. A. (1977). Double stranded RNA viruses among filamentous fungi. In “Mil
GENETICS OF APPLIED MICROBIOLOGY
115
crobiology” (D. Schlessinger, ed.), pp. 568-570. Am. SOC. Microbiol., Washington, D.C. Lemke, P. A,, and Ness, T. M. (1970). Isolation and characterization of double stranded ribonucleic acid from Penicillium chrysogenum. J . Virol. 6, 813-819. Lerner, S. A,, Wu, T. T., and Lin, E. C. C. (1964). Evolution of a catabolic pathway in bacteria. Science 146, 1313-1315. Lewin, B. (1977). “Gene Expression. 111.” Wiley, New York. Li Chuan-Lo (1962). Hybridization of Actinomyces erythreus. Mikrobiologiya 34, 61. Lippincott, T. (1977). Molecular basis of plant tumour induction. Nature (London) 269, 465-466. Liu, C., Hermann, T., and Miller, P. A. (1977). Feedback inhibition ofthe synthesis of a n antibiotic aurodox. J . Antibiot. 30, 244-251. Livingston, A. (1977). Inheritance of the 2 pM DNA plasmid from Saccharomyces. Genetics 86, 73-84. Lomovskaya, N. D., Emeljanova, L. K., and Alikhanian, S. I. (1971).The genetic location of prophage on the chromosome of Streptomyces coelicolor. Genetics 68, 341-347. Lomovskaya, N. D., Mkrtumian, N. M., Gostimskaya, N. L., and Danilenko, V. N. (1972). Characterization of temperate actinophage 4 C31 isolated from Streptomyces coelicolor A3(2). J . Virol. 9, 2 5 g 2 6 2 . Lomovskaya, N. D., Voeykova, T. J., and Mkrtumian, N. M. (1977). Construction and properties of hybrids obtained in interspecific crosses between Streptomyces coelicolor A3(2) and Streptomyces griseus Kr15. J . Gen. Microbiol. 98, 187-198. Lovett, P. S.,Duvall, E . J., and Keggins, K. M. (1976). Bacillwpumilus plasmid pPL10: Properties and insertion in Bacillus subtilis 168 by transformation. J . Bacteriol. 127, 817-828. Lowe, D. A., and Westlake, D. W. S. (1972). Regulation of chloramphenicol synthesis in Streptomyces species 3022A. Branchpoint enzymes of the shikimic acid pathway. Can. J . Biochem. 50, 1064-1073. Lowe, D. A., and Westlake, D. W. S. (1973). Regulation of the shikimic acid path in a chloramphenicol-producing streptomycete. Biochem. Soc. Trans. 1, 219-222. Lurquin, P. F. (1977). Integration versus degradation of exogenous DNA in plants. An open question. Prog. Nucleic Acid Res. Mol. Biol. 20, 161-207. Macaya, G. (1976). Synthetic genes buckle down to work. Recherche 7 , 1080. McCormick, J. R. D. (1967). Tetracyclines. In “Antibiotics 11” (D. Gottlieb and P. D. Shaw, eds.), pp. 113-122. Springer-Verlag, Berlin and New York. McCormick, J . R. D., Sjolander, N. O., Hirsch, U., Jensen, E. R., and Doerschuk, A. P. (1957). A new family of antibiotics: The demethyltetracyclines. J . A m . Chem. Soc. 79, 4561-4563. McCormick, J . R. D., Miller, P. A,, Growich, J . A,, Sjolander, N. O . , and Dorschuk, A. P. (1958a). Two new tetracycline-related compounds: 7-Chloro-5a(lla)-dehydrotetracycline and 5a-epi-tetracycline. A new route to tetracycline. J . A m . Chem. Soc. 80, 5572-5573. McCormick, J. R. D., Sjolander, N. O., Miller, P. A,, Hirsch, U., Arnold, N. H., and Doerschuk, A. P. ( 1958b). The biological reduction of 7-chloro-5a( 1la)-dehydrotetracycline to 7-chlorotetracycline by Streptomyces aureofaciens. J . Am. Chem. Soc. 80, 6460-6461. McCormick, J . R. D., Johnson, S., and Sjolander, N. J . (1963). Biosynthesis of the tetracyclines. V. Naphthacenic precursors. J . A m . Chem. Soc. 85, 1692- 1694. Macdonald, K. D. (1964). Preservation of the heterozygous diploid condition in industrial micro-organisms. Nature (London) 204, 4 0 4 4 0 5 .
116
VEDPAL SINGH MALIK
Macdonald, K. D. (1968a). Degeneration of penicillin titre in cultures of Penicillium chrysogenum. Nature (London) 218, 371-372. Macdonald, K. D. (1968b). The persistence of parental genome segregation in Penicillium chrysogenum after nitrogen mustard treatment. Mutat. Res. 5 , 302-305. Macdonald, K. D., and Holt, G. (1976). Genetics of biosynthesis and overproduction of penicillin. Sci. Prog. (Oxford) 63, 547-573. Macdonald, K. D., Hutchinson, J. M., and Gillett, W. A. (1963). Formation and segregation of heterozygous diploids between a wild-type strain and derivatives of high penicillin yield in Penicillium chrysogenum. J . Gen. Microbiol. 33, 385-394. Macdonald, K. D., Hutchinson, J. M., and Gillett, W. A. (1964). Properties of heterozygous diploids between strains of Penicillium chrysogenum selected for high penicillin yield. Antonie van Leeuwenhoek 30, 209-224. Macdonald, K. D., Hutchinson, J. M., and Gillett, W. A. (1965). Heterozygous diploids of Penicillium chrysogenum and their segregation patterns. Genetica (The Hague) 36, 378-397. Macdonald, K. D., Holt, G., and Ditchburn, P. (1972). The genetics of penicillin production. Ferment. Technol. Today, Proc. Int. Ferment. Symp., 4th, 1972, pp. 251-257. McIntyre, T. M., Chamberlain, B. K., Webster, R. E., and Bell, R. E. (1977). Mutants of Escherichia coli defective in membrane phospholipid synthesis. Effects of cessation and reinitiation of phospholipid synthesis on macromolecular synthesis and phospholipid turnover. J . Biol. Chem. 252, 4487-4493. McPartland, A,, and Somerville, R. N. (1976). Isolation and characterization of mutations creating high efficiency transcription initiation signals within the trp operon of E. coli. J . Bacteriol. 128, 557-572. Magasanik, B., Prival, M. J., Brenchley, J. E., Tyler, B. M., DeLeo, A. B., Streicher, S. L. Bender, R. A,, and Paris, C. G. (1964). Glutamine-synthetase as a regulator of enzyme synthesis. Curr. Top. Cell. Regul. 8, 119-138. Mahler, I., and Halvorson, H. 0. (1977). Transformation ofEscherichia coli and Bacillus subtilis with a hybrid plasmid molecule. J . Bacteriol. 131, 374-377. Majer, J. (1977). Macrolide antibiotics. Annu. Rep. Ferment. Proc. 1, 347-363. Makarevich, V. G., Slugina, M. D., Upiter, G. D., Zaslavskaya, P. L., and Gerasimova, T. M. (1976). Regulation of tetracycline biosynthesis by control of antibiotic-producing organism growth. Antibiotiki 21, 205210. Malik, V. S. (1972). Chloramphenicol. Adu. Appl. Microbiol. 15, 297-336. Malik, V. S. (1977). Preparative method for the isolation of super coiled DNA from a chloramphenicol-producing streptomycete. J . Antibiot. 30, 897-899. Malik, V. S. (1978). Genetics of industrial microorganisms. Nature (London) 274, 844845. Malik, V. S. (1979a). Secondary Metabolism a t Dresden. ASM News 45, 25-28. Malik, V. S. (1979b). Regulation of chorismate derived antibiotic production. Adu. Appl. Microbiol. (in press). Malik, V. S., and Reusser, F. (1979). Restriction enzyme map for streptomycete plasmid pUC3. Plasmid (in press). Malik, V. S., and Vining, L. C. (1970). Metabolism of chloramphenicol by producing organism. Can. J . Microbiol. 16, 173-179. Malik, V. S., and Vining, L. C. (1971). Metabolism of chloramphenicol by the producing organism. Some properties of chloramphenicol hydrolase. Can. J . Microbiol. 17, 1287-1290. Malik, V. S., and Vining, L. C. (1972a). Effect of chloramphenicol on its biosynthesis by Streptomyces species 3022a. Can. J . Microbiol. 18, 137-151.
GENETICS OF APPLIED MICROBIOLOGY
117
Malik, V. S., and Vining, L. C. (1972b). Chloramphenicol resistance in chloramphenicolproducing Streptomyces. Can. J . Microbiol. 18, 583-592. Maniatis, T., Kee, S. G., Efstratiadis, A., and Kafatos, F. C. (1976). Amplification and characterization of a P-globin gene synthesized in uitro. Cell 8, 163-182. Marians, K. J., Wu, R., Stawinski, J., Hozumi, T., and Narang, S. A. (1976). Cloned synthetic lac operator DNA is biologically active. Nature (London) 263, 744-748. Marino, R., Saksena, K. N., Schuler, M., Mayfield, J. E., and Lemke, P. E. (1976). Double-stranded ribonucleic acid in Agaris bisporus. Appl. Enuiron. Microbiol. 31, 433-438. Martin, C. K. A. (1977). Microbial cleavage of sterol side chains. Adu. Appl. Microbiol. 22, 29-58. Martin, J. (1977). Biosynthesis of polyene macrolide antibiotics. A n n u . Rev. Microbiol. 31, 13-38. Martin, J. H., Mitscher, L. A,, Miller, P. A,, Shu, P., and Bohonos, N. (1966). 5-Hydroxy-7-chlortetracycline.I. Preparation, isolation and physiochemical properties. Antimicrob. Agents Chemother. pp. 563-567. Marx, J. L. (1977). Gene transfer in mammalian cells: Mediated by chromosomes. Science 197, 14G148. Mateles, S. R., and Tannenbaum, S. R. (1968). “Single-cell Protein.” MIT Press, Cambridge, Massachusetts. Matselyukh, B. P. (1963a). Transmission of some biochemical properties in actinomycetes by means of DNA. Mikrobiol. Z h . (Kieu) 25, 23. Matselyukh, B. P. (1963b).Transmitted modification of spore formation and the capacity t o synthesize streptomycin in Streptomyces griseus mutant with DNA. Dopou. A k a d . N a u k . Ukr. RSR 12, 1636. Matselyukh, B. P. (1964a). Transformation of oxytetracycline synthesizing capacity and cultural morphological changes in the mutant Streptomyces rimosus No. 11%12 by means of DNA. Dopou. A k a d . N a u k . Ukr. RSR 1, 12. Matselyukh, B. P. (1964b). Transformation in antibiotic production in actinomycetes by means of DNA. Dokl. A k a d . Nauk SSSR 154, 710. Matselyukh, B. P. (1964~).Transformation of antibiotic formation and streptomycin resistance in actinomycetes by means of DNA. Mikrobiol. Z h . !Kiev) 26, 8. Matselyukh, B. P. (1976). Structure and function of the Actinomyces oliuaceus genome. Proc. Int. Symp. Genet. Ind. Microorg., Znd, 1974 pp. 553-563. Matselyukh, B. P., Podgorskaya, M. E., Stenko, A. S., Mukvich, N. S., and Lavrinchuk, V. T. (1973).Actinomyces oliuaceus VK-X-A new object for actinomycete genetics. Mikrobiol. Z h . (Kiev) 35, 2G36. Matsuhashi, Y., Sawa, T., Kondo, S., and Takeuchi, T. (1975). Aminoglycoside 3’phosphotransferase in B . circulans producing butylrosins. J . Antibiot. 30,435-451. Meagher, R. B., McCorkle, G., Ornston, M. K., and Orston, L. N. (1972). Inducible uptake system for B-carboxy4s,cis-mucomate in a permeability mutant of Pseudomonas putida. J . Bacteriol. 111, 465-473. Mehta, R. D., and Gregory, K. F. (1973). Isolation and characterization of wall mutants of yeasts for use as single cell protein. Proc. Can. SOC.Microbiol. 23, 48. Mergeay, M. (1972). Mutagenic effects of Streptomyces coelicolor DNA detected after streptomycin treatment of competent cultures ofBacillus subtilis. Mol. Gen. Genet. 119, 89-92. Mergeay, M., Charles, P., Martin, R., Remy, J., and Ledoux, L. (1970). Transformation “Bacillus subtilis” par du DNA de Streptomyces coelicolor. Arch. Znt. Physiol. Biochim. 78, 603-604.
118
VEDPAL SINGH MALIK
Merrick, M. J. (1975a). Hybridization and selection for increased penicillin titre in wild-type isolates o f Aspergillus nidulans. J . Gen. Microbiol. 91, 27g286. Merrick, M. J. (1975b). The inheritance o f penicillin titre in crosses between lines of Aspergillus nidulans selected for increased productivity. J . Gen. Microbiol. 91, 287-294. Merrick, M. J. (1976a). Hybridization and selection for penicillin production in Aspergillus nidulans-a biometrical approach to strain improvement. Proc. Znt. Symp. Genet. In. Microorg., 2nd, 1974 p. 229. Merrick, M. J. (197613).Morphological and genetic mapping study of bald colony mutants of Streptomyces coelicolor. J . Gen. Microbiol. 96, 299-315. Merrick, M. J., and Caten, C. E. (1975a). Inheritance of penicillin titre in wild-type isolates of Aspergillus nidulans. J . Gen. Microbiol. 86, 283-293. Merrick, M. J.,and Caten, C. E. (1975b). The design offermentation and biological assay procedures for assessment of penicillin production in populations o f Aspergillus nidulans. J . Appl. Bacteriol. 38, 121-131. Middelhoven, W. J. (1977). Isolation and characterization of methylammonium-resistant mutants ofSaccharomyces cereuisiae with relieved nitrogen metabolite repression of allantoinase, arginase, and ornithine transaminase synthesis. J . Gen. Microbiol. 100, 257-269. Middleton, R. B., and Mojicaa, T. (1971). Homology in the Enterobacteriaceae based on inter-crosses between species. Adu. Genet. 16, 53-79. Miller, C., and Roth, J. (1971). Recessive-lethal nonsense suppressors in Salmonella typhimurium. J . Mol. Biol. 59, 63-75. Miller, P. A,, Hash, J. H., Links, M., and Bohonos, N. (1965). Biosynthesis of 5-hydroxytetracycline. Biochem. Biophys. Res. Commun. 18, 325-331. Mindlin, S. Z. (1969). Genetic recombination in the actinomycete breeding. In “Genetics and Breeding of Streptomyces.” (G. Sermonti and M. Alacevit, eds.), pp. 147-159. Yugaslov Academy of Sciences and Arts, Zagreb. Mindlin, S . Z., and Alikhanian, S. I. (1958). A study of VVR-induced variation and selection of actinomyces rimosus. Antibiotiki 3, 1tC22. Mise, K., and Arber, W. (1976). Plaque-forming transducing bacteriophage P, derivative and their behavior in lysogenic conditions. Virology 69, 191-196. Mishra, N. C. (1977). Genetics and biochemistry of morphogenesis in Neurospora. Adu. Genet. 19, 341-405. Mitscher, L. A,, Martin, J. H., Miller, P. A., Shu, P., and Bohonos, N. (1966). 5-Hydroxy-7-chlortetracycline. J . A m . Chem. Soc. 88,3647-3648. Moir, A,, and Brammar, W. J. (1976). The use of specialized transducing phages in the amplification of enzyme production. Mol. Gen. Genet. 149, 87-99. Mojica-a, T. (1975). Transduction by phage P, cm clr-100 in Salmonella typhimurium. Mol. Gen. Genet. 138, 113-126. Mojica-a, T., and Middleton, R. B. (1972). Salmonella typhimurium, Escherichia coli hybrids for the tryptophan region. Genetics 71, 491-505. Mori, H., and Onishi, H. (1967). Diploid hybridization in a heterothalic haploid yeast, Saccharomyces rourie. Appl. Microbiol. 15, 9 2 a 9 3 4 . Morozova, E. S., and Alikhanian, S. I. (1966). Natural and induced variation in some mutants o f actinomyces, streptomycini with respect to antibiotic production. Antibiotiki 11, 5 0 6 5 1 0 . Mortimer, R. K., and Hawthorne, D. C. (1966). Yeast genetics. Annu. Reu. Microbiol. 20, ,151-168. Mortlock, R. P. (1976).Catabolism of unnatural carbohydrates by microorganisms. Adu. Microb. Physiol. 13, 1-53.
GENETICS OF APPLIED MICROBIOLOGY
11'9
Mount, D. W. (1976). Method for isolation ofphage mutants altered in their response to lysogenic induction. .Mol. Gen. Genet. 145, 165. Moyed, H. S. (1960). False feedback inhibition: Inhibition of tryptophan biosynthesis by 5-methyltryptophan. J . Biol. Chem. 235, 109%1102. Muller-Hill, B., Rickenberg, H. V., and Wallenfels, K. (1964). Specificity of the induction o f the enzymes of the lac operon in Escherichia coli. J . Mol. Biol. 10,303-318. Miiller-Hill, B., Crapo, L., and Gilbert, W. (1968). Mutants that make more lac repressor. Proc. Natl. Acad. Sci. U.S.A. 59, 1259-1264. Muradov, M., and Rautenshtein, Y. I. (1972). Spontaneous and induced formation o f virulent mutants of temperate actinophages of lysogenic cultures of Actinomyces netropsis. Mikrobiologiya 41, 122-127. Muradov, M., and Rautenshtein, Y. I. (1973). Lysogenic conversions o f antibiotic production in the cultures of Actinomyces netropsis. Mikrobiologiya 42,327-332. Murase, M., Ito, T., Fukatsu, S., and Umezawa, H. (1970). Studies on kanamycin-related compounds produced during fermentation by mutants of Streptomyces kanamyceticus: Isolation and properties. Prog. Antimicrob. Anticancer Chemother., Proc. Int. Congr. Chemother., 6th, 1969 p. 1098. Murgola, E. J., and Adelberg, E. A. (1970). Streptomycin-suppressible lethal mutations in Escherichia coli. J . Bacteriol. 103,20-26. Murray, K. (1976). Biochemical manipulation of genes. Endeauour 35, 129. Murray, K.,and Murray, N. E. (1975). Phage lambda receptor chromosomes for DNA fragments made with restriction endonuclease I11 of Haemophilus influenzae and restriction endonuclease I of Escherichia coli. J . Mol. Biol. 98, 551-564. Nagahari, K., Sano, Y., and Sakaguchi, K. (1977). Derepression o f E . coli trp operon on interfamilial transfer. Nature (London) 266, 745-746. Nakano, H., Matsuhashi, Y., Takeuchi, T., and Umezawa, H. (1977). Distribution of chloramphenicol acetyltransferase and chloramphenicol-3-acetate esterase among Streptomyces and Corynebacterium. J . Antibiot. 30, 7 6 8 2 . Nagaoka, K., and Demain, A. L. (1975). Mutational biosynthesis o f a new antibiotic, streptomutin A, by an idiotroph of Streptomyces griseus. J . Antibiot. 28,627-635. Nakayama, K. (1976). The production of amino acids. Process Biochem. 12(2),4-9. Nara, T. (1977). Aminoglycoside antibiotics. Annu. Rep. Ferment. Proc. 1, 299-326. Neidhardt, F. C. (1960). Mutant of Aerobacter aerogenes lacking glucose repression. J . Bacteriol. 80, 53G543. Nevers, P., and Saedler, H. (1977). Transposable genetic elements a s agents of gene instability and chromosomal rearrangements. Nature (London) 268, 109-115. Newell, S. L., and Brill, W. J. (1972). Mutants o f Salmonella typhimurium that are insensitive to catabolite repression o f proline degradation. J . Bacteriol. 111, 375382. Nga, B. H., and Roper, J. A. (1969). A system generating spontaneous intrachromosomal changes a t mitosis in Aspergillus nidulans. Genet. Res. 14, 63-70. Norris, R. D., and Lea, P. J. (1976). The use ofamino acid analogues in biological studies. Sci. Prog. (Oxford) 63, 65-86. Novick, A., and Horiuchi, T. (19611. Hyperproduction of p-galactosidase by Escherichia coli bacteria. Cold Spring Harbor Symp. Quanb. Biol. 26,239-245. Oakberg, E. F., and Luria, S. E. (1947). Mutations to sulfonamide resistance in Staphylococcus aureus. Genetics 32, 249-261. Ogawara, H., and Nozaki, S. (1977). Effect of acriflavine on the production of p-lactamase in Streptomyces. J . Antibiot. 30,337-339. Okanishi, M., and Gregory, K. F. (1970). Isolation of mutants ofCandidu tropicalis with increased methionine content. Can. J . Microbiol. 16, 1139-1143.
120
VEDPAL SINGH MALIK
Okanishi, M., and Umezawa, H. (1978). Plasmids involvement in antibiotic production in Streptomyces. In “Symposium on the Genetics of Actinomycetales,” pp. 19-38. Borstel, West Germany. Okanishi, M., Utahara, R., and Okami, Y. (1966). Infection of the protoplasts of Streptomyces kanamyceticus with deoxyribonucleic acid preparation from actinophage PK-66. J . Bacteriol. 92, 1850-1852. Okanishi, M., Ohta, T., and Umezawa, H. (1970). Possible control of formation of aerial mycelium and antibiotic production in Streptomyces by episomic factors. J . Antibiot. 23, 45-47. Okanishi, M., Suzuki, K., and Umezawa, H. (1974). Formation and reversion of S t r e p tomycete protoplasts: Cultural condition and morphological study. J . Gen. Microbiol. 80, 389-400. Oura, E. (1977). Reaction products of yeast fermentations. Process Biochem. 12(3), 19-21. Panasenko, S. M., Cameron, J. R., Davis, R. W., and Lehman, I. R. (1977). Five hundred fold overproduction of DNA ligase after induction of a hybrid lambda lysogen constructed in vitro. Science 196, 1 8 a 1 8 9 . Papa, K. E. (1970). Inheritance of growth rate in Neurospora crassa: Crosses between previously selected lines. Can. J . Genet. Cytol. 12, 1-9. Papa, K. E., Srb, A. M., and Federer, W. G. (1966). Selection for increased growth rate in inter- and intra-strain crosses of Neurospora. Heredity 21, 595-613. Parag, Y., and Roper, J. A. (1975). Genetic control of chromosome instability inAspergi1lus nzdulans as a means for gene amplification in eukaryotic microorganisms. MoJ. Gen. Genet. 140, 275-287. Pardee, A. R., Benz, E. J., St. Peter, D. A,, Krieger, J. N., Meuth, M., and Trieshmann, H. W. (1971). Hyperproduction and purification of nicotinamide deaminase, a microconstitutive enzyme of Escherichia coli K-12 strains. J . Biol. Chem. 246, 6792-6796. Pasero, J., Thibaut, J., and Galanakis, A. (1973). Production of a lipase by Candida lipolytica. Proc. lnt. Spec. Symp. Yeasts, 3rd, 1973 p. 129. Paskova, J., and Munk, V. (1962). Glucose oxidase of A. niger 111 formation of heterokaryotic mycelium in A. niger. Folia Microbiol. (Prague) 8, 3 7 a 3 8 3 . Pastan, I., and Adhya, S. (1976). Cyclic adenosine 5’-monophosphate inE. coli. Bacteriol. Rev. 40, 527-551. Perlman, D. (1973). The fermentation industries. ASM News 39, 6 4 a 6 5 4 . Perlman, D. (1977). Fermentation industries quo vadis? Chemtech. 7, 434-443. Perlman, D., and Kikuchi, M. (1977). Culture maintenance. Annu. Rep. Ferment. Proc, 1, 41-48. Perlman, D., and Stickgold, R. (1977). Selective amplification of genes on the R plasmid NR1 in Proteus mirubilis: An example of the induction of selective gene amplification. Proc. Natl. Acad. Sci. U.S.A. 74, 251S2522. Pirrotta, V. (1976). The A repressor and its action. Curr. Top. Microbiol. Immunol. 74, 21-54. Polsinelli, M., and Beretta, M. (1966). Genetic recombination in crosses between Streptomyces aureofaciens and Streptomyces rimosus. J.Bacteriol. 91, 63-68. Polsinelli, M., Albertini, A., Cassani, G., and Ciferri, 0 . (1965). Relation of biochemical mutations to actinomycin synthesis in Streptomyces antibioticus. J . Gen. Microbiol. 39, 239-246. Pontecorvo, G. (1956).The parasexual cycle in fungi.Annu.Reu. Microbiol. 10,393-400. Pontecorvo, G., and Sermonti, G. (1953). Recombination without sexual reproduction in Penicillium chrysogenum. Nature (London) 172, 126-127. Poonian, M. S., McComas, W. W., and Nussbaum, A. L. (1977).Chemical synthesis oftwo
GENETICS OF APPLIED MICROBIOLOGY
121
deoxyribododeca nucleotides for the attachment of restriction termini to a n artificial mini gene. Gene 1, 357-372. Porter, J. R. (1973). The environment, ours or the microbes. ASM News 39, 173-181. Prasad, C., and Freese, E. (1974). Cell lysis ofBacillus subtilis caused by intracellular accumulation of glucose-1-phosphate. J . Bacteriol. 118, 1111-1122. Press, R., Glansdorff, N., Miner, P., deVries, J., Kadner, R., and Mass, W. K. (1971). Isolation of transducing particles of 980 bacteriophage that carry different regions of Escherichia coli genome. Proc. Natl. Acad. Sci. U.S.A. 68, 795-798. Priest, F. G. (1977). Extracellular enzyme synthesis in the genus Bacillus. Bacteriol. Rev. 41, 711-753. Primrose, S . B. (1977). Genetic engineering. Sci. Prog. (Oxford) 64, 293-322. Raetz, C. R. H., Larson, T. J., and Dowhan, W. (1977). Gene cloning for the isolation of enzymes of membrane lipid synthesis: Phosphatidyl serine synthase overproduction in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 74, 1412-1416. Ramachandran, S. N., Sukapure, R. S., and Thirumalachar, M. J. (1965). Biotransformation of thiolutin production from Streptomyces pimprina to Streptomyces aureofaciens. Hind. Antibiot. Bull. 7 , 197-201. Ramakrishnan, T., and Adelberg, E. A. (1964). Regulatory mechanisms of the biosynthesis of isoleucine and valine. J . Bacteriol. 87, 566-573. Randazzo, R., Sermonti, G., Carere, A., and Bignami, M. (1973). Comutation in streptomyces. J . Bacteriol. 113, 500-501. Randazzo, R., Sciandrello, G., Carere, A., Bignami, M., Velcich, A., and Sermonti, G. (1976). Localized muthgenesis in Streptomyces coelicolor. Mutat. Res. 36,291-302. Rao, R. N. (1976). Mutational alteration of a nitrogen fixing bacterium to sensitivity to infection by bacteriophage Mu. Isolation of nif mutations of Klebsiella pneumoniae M5al induced by Mu. J . Bacteriol. 128, 3 5 6 3 6 2 . Ratledge, C. (1977). Fermentation substrates. Annu. Rep. Ferment. Proc. 1, 49-71. Rautenshtein, J. I., and Muradow, M. (1968). Lysogenic converson of antibiotic formation in Actinomyces levoris 2638. Izv. Akad. Nauk. SSSR, Ser. Biol. 4, 575-579. Rautenshtein, Y., Borisava, T. G., Goldat, S. Yu, Zhunaeva, V. V., Vladimirov, A. V., Moskalenko, L. N., Terebkova, L. S., Isaikina, L. S., and Misyureva, N. G. (1972). Lysis in a culture of Actinomyces rimosus. Mikrobiologiya 41, 934-940. Ravin, A. W., and Chakrabarty, T. (1975). Genetic hybridization at the unlinked thy and str loci of streptococcus. Genetics 81, 223-241. Raynal, E. C. (1977). Ribosomal suppressors and antisuppressors in Podospora anserina; resistance to cycloheximide. J . Bacteriol. 131, 876-883. Reanney, D. (1976). Extrachromosomal elements as possible agents of adaptation and development. Bacteriol. Rev. 40, 552-590. Redei, G. P., Acedo, G., Weingarten, H., and Kier, L. D. (1976). In “Cell Genetics in Higher Plants” (D. Dudits, G. L. Farkas, and M. Maligo, eds.), pp. 117-135. Publ. House Hung. Acad. Sci., Budapest. Redshaw, P. A,, McCann, P. A,, Sankaram, L., and Pogell, B. (1976). Control of differentiation in Streptomycete. Involvement of extrachromosomal deoxyribonucleic acid and glucose repression in aerial mycelia development. J . Bacteriol. 125, 698- 705. Reeves, P. (1972). “The Bacteriocins.” Springer-Verlag, Berlin and New York. Reusser, F. (1963). Stability and degeneration of microbial cultures on repeated transfer. Adv. Appl. Microbiol. 5, 189-215. Rigby, P. W. J., Burleigh, B. D., and Hartley, B. S. (1974). Gene duplication in experimental enzyme evolution. Nature (London) 251, 200-204. Rigby, P. W. J., Gething, M. J., and Hartley, B. S. (1976). Construction of intergeneric hybrids using bacteriophage P,CM: Transfer of the Klebsiella aerogenes ribitol dehydrogenase gene to Escherichia coli. J . Bacteriol. 125, 7 2 a 7 3 8 .
122
VEDPAL SINGH MALIK
Rinehart, K. L., J r . (1964). “The Neomycins and Related Antibiotics.” Wiley, New York. Rinehart, K. L., Jr., and Stroshane, R. M. (1976). Biosynthesis of aminocyclitol antibiotics. J . Antibiot. 29, 319-353. Ringertz, N. R., and Savage, R. E. (1976). “Cell Hybrids.” Academic Press, New York. Roberts, R. J. (1976). Restriction endonucleases. Crit. Rev. Biochem. 4, 123- 164. Roelants, P., Konvalinkova, W., Mergeay, M., Lurquin, P. F., and Ledoux, L. (1976). DNA uptake by Streptomyces species. Biochim. Biophys. Acta 442, 117-122. Roper, J . A. (1965). Fungal genetics and strain improvement. In “Biogenesis of Antibiotic Substances” (Z. VanBk, and Z. HoStalek, eds.), Academic Press, New York. Roseth, R. (1976). Glaser instrument described. ASM News 42, 492-493. Rosi, D., Goss, W. A,, and Daum, S. J . (1977). Mutation biosynthesis by idiotrophs of Micromonospora purpurea. I. Conversion of aminocyclitols to new amino glycoside antibiotics. J . Antibiot. 30, 88-97. Roth, J. R., Anton, D. N., and Hartman, P. E. (1966). Histidine regulatory mutants in Salmonella typhimurium. I. Isolation and general properties. J . Mol. Biol. 22, 305322. Sacristan, M. D., and Melchers, G. (1977). Regeneration of plants from habituated and Agrobacterium transformed single cell clones of tobacco. Mol. Gen. Genet. 152, 111-1 18. Sadler, J. R., Tecklenburg, M., Betz, J. L., Goeddel, D. V., Yansura, D. G., and Caruthers, M. H. (1977). Cloning of chemically synthesized lactose operators. Gene 1,305-322. Saint-Girons, I., and Margarita, D. (1975). Operator-constitutive mutants in the threonine operon of Escherichia coli K-12. J . Bacteriol. 124, 1137-1141. Saito, H. (1958). Heterokaryosis and genetic recombination in Streptomyces griseoflavus. Can. J . Microbiol. 4, 571-580. Sanderson, K. E. (1971). Genetics of the enterobacteriaceae. A. Genetic homology in the enterobacteriaceae. Adv. Genet. 16, 35-51. Sanderson, K. E. (1976). Genetic relatedness in the family enterobacteriaceae. Annu. Rev. Microbiol. 30, 327-349. Sanger, F., Air, G. M., Barrell, B. G., Brown, N. L., Coulson, A. R., Fiddes, J . C., Hutchison, C. A,, 111, Slocombe, P. M., and Smith, M. (1977). Nucleotide sequence of bacteriophage giX 174 DNA. Nature (London) 265, 687-698. Satoh, A,, Ogawa, H., and Satomura, Y. (1975). Role and regulation mechanism of kanamycin acetyltransferase in kanamycin biosynthesis. Agric. Biol. Chem. 39, 2331-2336. Scaife, J., and Beckwith, J. R. (1966). Mutational alteration of the maximal level of lac operon expression. Cold Spring Harbor Symp. Quant. Biol. 31, 403-408. Schlegel, H. G., and Jannasch, H. W. (1967).Enrichment cultures.Annu. Rev. Microbiol. 21, 49-70. Schofield, M. (1974). The impossible takes longer. Chem. Br. 10, 432-433. Schrempf, H., and Goebel, W. (1977). Characterization of a plasmid from Streptornyces coelicolor A3(2). J . Bacteriol. 131, 251-258. Schrempf, H., Bujard, H., Hopwood, D. A,, and Goebel, W. (1975). Isolation ofcovalently closed circular deoxyribonucleic acid from Streptomyces coelicolor A3(2). J . Bacteriol. 121, 416-421. Schupp, T., Hiitter, R., and Hopwood, D. A. (1975). Genetic recombination in Nocardia mediterranei. J . Bucteriol. 121, 128-136. Schwartz, A. C., and Stadtman, T. C. (1970). Small colonies of Clostridiurn sticklandii resulting from nitrosoguanidine treatment and exhibiting defects in catabolic enzymes. J . Bacteriol. 104, 1242-1245. Scowcroft, W. R., and Gibson, A. H. (1975). Nitrogen fixation by Rhizobium associated with tobacco and cowpea cell culture. Nature (London) 253, 351-352.
GENETICS OF APPLIED MICROBIOLOGY
123
Seeburg, P. H., Shine, J., Martial, J . A., Baxter, J . D., and Goodman, H. M. (1977). Nucleotide sequence and amplification in bacteria of structural gene for rat growth hormone. Nature (London) 270, 4 8 6 4 9 4 . Sekiguchi, J., Takada, N., and Okada, H. (1975). Genes affecting the productivity of a-amylase in Bacillus subtilis marburg. J.Bacteriol. 121,6 8 S 6 9 4 . Senior, E., Bull, A. T., and Slater, J . H. (1976). Enzyme evolution in a microbial community growing on the herbicide Dalapon. Nature fLondoni 263, 4 7 6 4 7 9 . Sercik, V. (1957). Occurrence of phenol oxidase in Streptomyces antibioticus producing actinomycin B. Nature (London) 179, 1191-1192. Sermonti, G.(1959). Genetics of penicillin production. Ann. N.Y. Acad. Sci. 81,950973. Sermonti, G. (1969). “Genetics of Antibiotic-Producing Microorganisms.” Wiley, New York. Sermonti, G., and Spada-Sermonti, I. (1955). Genetic recombination in Streptomyces. Nature (London) 176, 121. Sermonti, G., Petris, A,, Micheli, M., and Lanfaloni, L. (1977). A factor involved in chloramphenicol resistance in Streptomyces coelicolor A3(2): Its transfer in absence of fertility factor. J. Gen. Microbiol. 100,347-353. Sevastopoulos, C. G., Wehr, C. T., and Glaser, D. A. (1977). Large scale automated isolation ofE. coli mutants with thermosensitive DNA replication. Proc. Natl. Acad. Sci. U.S.A. 74, 3485-3489. Shapiro, J . A. (1977). DNA insertion elements and the evolution of chromosome primary structure. Trends Biochem. Sci. 2, 176-180. Shaw, P. D., and Piwowarski, J. (1977). Effect of ethidium bromide and acriflavine on streptomycin production by Streptomyces bikiniensis. J.Antibiot. 30, 404-408. Shaw, W. V., and Hopwood, D. A. (1976). Chloramphenicol acetylation in streptomyces. J . Gen. Microbiol. 94,159-166. Shier, W. T., Rinehart, K. L., Jr., and Gottlieb, D. (1969). Preparation of four new antibiotics from a mutant of Streptomyces fradiae. Proc. Natl. Acad. Sci. U.S.A. 63, 198-204. Shier, W. T., Ogawa, S., Hichens, M., and Rinehart, K. L., J r . (1973). Chemistry and biochemistry of the neomycins. XVII. Bioconversion of aminocyclitols to aminocyclitol antibiotics. J . Antibiot. 26, 551-561. Shier, W. T., Schaefer, P. C., Gottlieb, D., and Rinehart, K. L., J r . (1974). Use of mutants in the study of aminocyclitol antibiotics. Biosynthesis and the preparation of the hybrimycin C complex. Biochemistry 13, 5073-5078. Shimada, K.,Weisberg, R. A,, and Gottesman, M. E. (1972). Prophage lambda a t unusual chromosomal locations. I. Location of the secondary attachment sites and the properties of the lysogens. J . Mol. Biol. 63,483-503. Shine, J., Seeburg, P. H., Martial, J. A , , Baxter, J . D., and Goodman, H. (1977). Construction and analysis of recombinant DNA for human chorionic somatomammotropin. Nature (London) 270, 494-497. Simchen, G. (1965). Variation in a dikaryotic population of Collybia uelutipes. Genetics 51, 709-721. Simchen, G. (1966a). Monokaryotic variation and haploid selection in Schizophyllum commune. Heredity 21, 241-263. Simchen, G.(1966b). Fruiting and growth rate among dikaryotic progeny of single wild isolates of Schizophyllum commune. Genetics 53, 1151-1165. Sinnott, E. W., Dunn, L. C., and Dobzhansky, T. (1958). “Principles of Genetics.” McGraw-Hill, New York. Sinsheimer. R. L. (1977). Recombinant DNA. Annu. Reu. Biochem. 46, 415-438. Smith, J . D., Anderson, K., Cashmore, A,, Hooper, M. L., and Russell, R. L. (1970).
124
VEDPAL SINGH MALIK
Studies on the structure and synthesis of Escherichia coli tyrosine transfer RNA. Cold Spring Harbor Symp. Quant. Biol. 35, 21-27. Smith, J. E., and Pateman, J . A. (1977). “Genetics and Physiology of Aspergillus.” Academic Press, New York. Solingen, P. and Platt, J. B. (1977). Fusion of yeast protoplasts. J . Bacteriol. 130, 946-947. Stalon, V., Ramos, F., Pierard, A., and Wiame, J . M. (1972). Regulation of the catabolic omithine carbamoyltransferase of Pseudomonas fluorescens. A comparison with the anabolic transferase and with a mutationally modified catabolic transferase. Eur. J . Biochem. 29, 25-35. Stark, W. M., Knox, N. G., Wilgus, R., and Dubus, R. (1976). The nebramycin fermentation: Culture and fermentation development. Dev. Znd. Microbiol. 17, 61-77. Starlinger, P., and Saedler, H. (1976). Elements in microorganisms. Curr. Top. Microbial Immunol. 75, 111-152. Stauffer, J. F., and Backus, M. P. (1954). Spontaneous and induced variation in selected stocks of the Penicillium chrysogenum series. Ann. N . Y . Acad. Sci. 59, 3 6 4 9 . Steplewski, Z., and Koprowski, H. (1970). Somatic cell fusion and hybridization. Methods Cancer Res. 5, 155-191. Stodolsky, M. (1974). Recipient gene duplication during generalized transduction. Genetics 78, 809-822. Straus, D. S. (1974). Induction by mutagens of tandem gene duplications in the Gly S region of the Escherichia coli chromosome. Genetics 78, 823-830. Straus, D. S., and Hoffman, G. (1975). Selection for a large genetic duplication in Salmonella typhimurium. Genetics 80, 227-237. Straus, D. S., and Straus, L. D A . (1976). Large overlapping tandem genetic duplication in Salmonella typhimurium. J . Mol. Biol. 103, 143-153. Streicher, S. L., Deleo, A. B., and Magasanik, B. (1976). Regulation ofenzyme formation in Klebsiella aerogenes by episomal glutamine synthetase of Escherichia coli. J . Bacteriol. 127, 184-192. Strnadova, K. (1976). A method of preparation and application of nitrous acid as a mutagen in Claviceps purpurea. Folia Microbiol. (Prague) 21, 4 5 S 4 5 8 . Struhl, K., Cameron, J., and Davis, R. (1976). Functional genetic expression of eukaryotic DNA in E . coli. Proc. Natl. Acad. Sci. U.S.A. 73, 1471-1475. Stuy, J. H. (1976). Restriction enzymes do not play a significant role in Haemophilus homospecific or heterospecific transformation. J . Bacteriol. 128, 212-220. Subden, R. E., Safe, L., Morris, D. C., Brown, R. G., and Safe, S. (1977). Eburicol, lichesterol, ergosterol and obtusifoliol from polyene antibiotic-resistant mutants of Candida albicans. Can. J . Microbiol. 23, 751-754. Switzer, R. L. (1977). The inactivation of microbial enzymes in vivo. Annu. Rev. Microbiol. 31, 135-157. Tabuchi, T., Tanaka, M., and Abe, M. (1968). Studies on organic fermentation in yeast. Part I. Examination of yeasts for their ability of producing citric acid. J . Agric. Chem. Soc. Jpn. 42, 440-443. Takeda Chemical Industries, Ltd., Japan (1975a). Patent JA-110723. Takeda Chemical Industries, Ltd., Japan (197513). Patent JS-109680. Tanaka, T., Kuroda, M., and Sakaguchi, K. (1977). Isolation and characterization of four plasmids from Bacillus subtilis. J . Bacteriol. 129, 1487-1494. Teraoka, H., and Tanaka, K. (1974). Properties of ribosomes fromStreptomyces erythreus and Streptomyces griseus. J . Bacteriol. 120, 316-321. Testa, R. T., and Tilley, B. C. (1975). Biotransformation, a new approach to aminoglycoside biosynthesis. I. Sisomycin. J . Antibiot. 28, 573-579.
GENETICS OF APPLIED MICROBIOLOGY
125
Testa, R. T., Wagman, G. H., Daniels, P. J. L., and Weinstein, M. J. (1974). Mutamycins: Biosynthetically created new sisomycin analogues. J . Antibiot. 27, 917-921. Tikchonenko, T. I., Velikodvarskaya, G. A., Bobkova, A. F., Bartoshevich, Y. E., Lebed, E. P., Chaplygina, N. M., and Maksi Mova, T. S. (1974). New fungal viruses capable of reproducing in bacteria. Nature (London) 249, 454-456. Tokunaga, T., Mizugichi, Y., and Suga, K. (1973). Genetic recombination in mycobacteria. J . Bacteriol. 113, 1104-1111. Torriani, A., and Rothman, F. (1961). Mutants of Escherichia coli constitutive for alkaline phosphatase. J . Bacteriol. 81, 835-836. Trinick, M. J., and Galbraith, J. (1976). Structure of root nodules formed by Rhizobium on the non-legume Trema cannabina var. scabra. Arch. Mikrobiol. 108, 159166. Trowsdale, J., and Anagnostopoulous, C. (1976). Differences in the genetic structure of Bacillus subtilis strains carrying the trp EZ6mutation and strain 168. J . Bacteriol. 126, 609-618. Tyc, M., and Kadzikiewicz, T. (1972). Analysis of taxonomic characteristics of highly active viomycin-producing mutants of Streptomyces griseus var. purpureus. Acta Microbiol. Pol. 4, 217-226. Tyler, B. M., and Goldberg, R. B. (1976). Transduction of chromosomal genes between enteric bacteria by bacteriophage P,. J . Bacteriol. 125, 1105-1111. Uchida, K., Ishitani, C., Ikeda, Y., and Sakaguchi, K. (1958). An attempt to produce interspecific hybrids between Aspergillus oryzae and Aspergillus sojae. J . Gen. Appl. Microbiol. Jpn. 4, 31-38. Udaka, S. (1960). Screening method for microorganisms accumulating metabolites and its use in isolation of M . glutamicus. J . Bacteriol. 79, 754-755. Uehara, H. Y., Yonada, Y., Yamane, K., and Maruo, B. (1974). Regulation of neutral protease productivity in Bacillus subtilis. Transformation to high productivity. J . Bacteriol. 119, 82-91. Ullrich, R., Shine, J.,Chirgwin, J., Pictet, R., Tischer, E., Rutter, W. J., and Goodman, H. M. (1977). Rat insulin genes: Construction of plasmids contamine the codine sequences. Science 196, 1313-1319. Umbarger, H. E. (1971). Metabolite analogs a s genetic and biochemical probes. Adu. Genet. 16, 119-140. Umezawa, H., Okami, Y., and Hotta, K. (1978). Transfer of the leupeptin-producing ability of the strain, Streptomyces roseus MA839-A1, by conjugation. J . Antibiot. 31, 99-102. Vangk, Z., Cudlin, J., Blumauerova, M., and HoStalek, Z. (1971).How many genes are required for the synthesis of chloretetracycline. Folia Microbiol. IPrague) 16, 225240. Vanlarebeke, N., Genetello, C., Hernalsteens, J. P., Depicker, A,, Zaenen, I., Messens, E., Vanmontagu, M., and Schell, U. (1977). Transfer of Ti plasmids between Agrobacterium strains by mobilization with conjugative plasmid RP,. Mol. Gen. Genet. 152, 119-124. Veselova, S. I. 11967). A comparative study of the lethal, selective, and mutagenic effects of chlortetracycline, oxytetracycline, and Streptomycin on Actinomyces aureofaciens. Genetika 12, 73-79. Vining, L. C., Malik, V. S., and Westlake, D. W. S. (1968). Biosynthesis of chloramphenicol. Lloydia 31, 355-363. Vivian, A. (1971). Genetic control of fertility in Streptomyces coelicolor A3(2): Plasmid involvement in the interconversion of UF and IF strains. J . Gen. Microbiol. 69, 353-364.
126
VEDPAI, SINGH MALIK
Vladimirov, A. V. (1966). Genetic recombinants in Actinomyces antibioticus producing oleandomycin. Antibiotiki 11, 117-122. Walker, J . B., and Skorvaga, M. (1973). Phosphorylaction of streptomycin and dihydrosteptomycin by Streptomyces. J . Biol. Chem. 248, 2435-2444. Warr, J. R., and Roper, J. A. (1965). Resistance to various inhibitors in Aspergillus nidulans. J . Gen. Microbiol. 40, 273-281. White, R. J., Martinelli, E., and Lancini, G. (1974). Ansamycin biogenesis: Studies on a novel rifamycin isolated from a mutant strain ofNocardia mediterranei. Proc. Natl. Acad. Sci. U.S.A. 71, 3260-3264. Whitfield, G. B. (1975). Biochemical modification of antibiotics. In “Proceedings of the First Intersectional Congress o f IAMS” (T. Hasegawa, ed.), pp. 472-482. Japan. Wickner, R. B., and Leibowitz, T. (1977). Genetics o f a double stranded RNA plasmid: The killer character ofSaccharomyces cerevisiae. I n “Microbiology”(D. Schlessinger, ed.), pp. 571-575. Am. SOC.Microbiol., Washington, D.C. Wilke, C. R., ed. (1975). “Cellulose as a Chemical and Energy Resource,” Biotechnol. Bioeng. Symp. No. 5 . Wiley, New York. Williams, J. A. (1977). Mobilization of morganocin 174 plasmid and kinetics of morganocin production in Proteus and Escherichia coli hosts. Antimicrob. Agents & Ch,emother. 11, 514-520. Witz, D. F., Hessler, E. J., and Miller, T. L. (1971). Bioconversion o f tyrosine into prophylhygric acid moiety of lincomycin. Biochemistry 10, 112kL-1133. Wood, W. J., Jr., and Bernstein, H. (1977). Suppressors o f gene 32 am mutants that specifically overproduce P,, (unwinding protein) in bacteriophage T,. J . Virol. 21, 619-625.
Work, E. (1971). Some applications and use of metabolic analogues in microbiology. Methods Microbiol. 6A, 395-410. Wright, L. F., and Hopwood, D. A. (1976a). Identification of the antibiotic determined by the ScP, plasmid o f Streptomyces coelicolor A3(2). J . Gen. Microbiol. 95, 96-106. Wright, L. F., and Hopwood, D. A. (1976b). Actinorhodin is a chromosomally determined antibiotic in Streptomyces coelicolor A3(2). J . Gen. Microbiol. 96, 289-297. Wu, T. T., Lin, E. C. C., and Tanaka, S. (1968). Mutants ofAerobucteraerogenes capable of growth on xylitol. J . Bacteriol. 96, 447-456. Yamada, K., Kinoshita, S., Tsunoda, T., and Aida, K. (1972). “Microbial Production of Amino Acids.” Wiley, New York. Yamaguchi, K., Nagata, Y., and Maruo, B. (1974). Isolation of mutants defective in a amylase from Bacillus subtilis: Genetic analysis. J . Bacteriol. 119, 416424. Yoneda, Y., and Maruo, B. (1975). Mutation ofBacillus subtilis causing hyperproduction of a-amylase and protease, and its synergistic effect. J . Bacteriol. 124, 4€&54. Yoneda, Y., Yamane, K., and Maruo, B. (1973). Membrane mutation related to the production o f extracellular @-amylaseand protease in Bacillus subtilis. Biochem. Biophys. Res. Commun. 50, 765-770. Yoneda, Y., Yamane, K., Yamaguchi, Y., Nagata, Y., and Maruo, B. (1974). Transformation ofBacillus subtilis in alpha-amylase productivity by deoxyribonucleic acid from B . subtilis var. amylosucchariticus. J . Bucteriol. 120, 11461150. Zelitch, I. (1975). Improving the efficiency o f photosynthesis. Science 188, 625-630. Zimmermann, F. K., and Scheel, I. (1977). Mutants ofSaccharomyces cerevisiue resistant to carbon catabolite repression. Mol. Gen. Genet. 153, 7 5 8 2 . Zvenigorodsky, V. I., Voeikova, T. A,, Yustratova, L. S., Smirnova, E. I., and Lomovskaya, N. D. (1975). Characteristics o f actinophages of Actinomyces griseus and selection of phage-stable mutants o f grisin-producing organisms. Antibiotiki (Moscow) 20, 409-415.
PLANT TISSUE CULTURES IN GENETICS AND PLANT BREEDING* lndrn K. Vasil,t Mulkh R. Ahuia,S a n d Vimla Vasilt I. Introduction , . , , , , , . , . . . . . . . , . , , . . . . 11. Rapid Clonal Propagation . . . . . , . , , . , , . , . . . 111. Tissue Culture and Haploidy . , . . . . . . . . . . . . . . A. Origin of Androgenetic Haploids . . . . . . . . . . . . . B. Nutritional Requirements for Androgenesis . . . . . . . C . Physiology of Androgenesis . . . , . , , , , , , , . . . D. Uses of Androgenetic Plants . . . . . . . . . . . . . . IV. Plant Protoplasts in Genetics and Breeding . . . . . . . . . A. Isolation and Culture of Protoplasts . . . . . . . . . . . B. Fusion of Protoplasts and Somatic Hybridization . . . . . C. Protoplasts as Tools for the Transfer of Cell Organelles or Microorganisms . , . , . . . . . , , , . , , . , . . . V. Direct Transformation by Exogenous DNA . . . . . . . . . VI. Tissue Cultures and Nitrogen Fixation . . . . . . . . . . . VII. Tissue Cultures and Germ Plasm Preservation . . . . . . . VIII. Epilogue . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . .
. . . . .
. . . . . . . . . . . . . . . . . . . .
. . . . .
. . . . .
. . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
127 128 138 139 145 146 148 151 152 155 164 166 168 173 175 177
I. Introduction
Recent advances in cell and tissue culture technology have opened up new avenues for conducting basic genetic research on higher plants at the cellular level and have provided potentially powerful new tools *For the purposes of this review the term “plant tissue culture” is used in its broadest sense, which includes the culture of protoplasts, cells, tissues, and organs of higher (seed) plants. t Department of Botany, University of Florida, Gainesville, Florida. 1Genetics Institute, Justus-Liebig University, Giessen, West Germany, 127 ADVANCES IN GENETICS. Vol. 20
Copyright 0 1979 by Academic Press, Inc. All rights of reproduction in any farm reserved. ISBN 0-12-017620-3
128
INDRA K . VASIL
et al.
in the hands of biologists for generating, selecting, and propagating novel and economically important plant varieties. Although our understanding of basic cellular processes has been considerably enhanced through the in uitro culture of a variety of plant cells, progress in the application of tissue culture technology to remedy specific problems or in “genetic engineering” to produce economically important plant materials has been relatively slow. This may be partly because cells or tissues from a large number of crop plants may be unresponsive to the in uitro conditions as now provided, and partly because the tissue culture manipulations required to modify the genetic contents of plant cells are still in early stages of development. Nevertheless, it is now possible to achieve rapid clonal propagation of plantsespecially herbaceous species-through tissue culture and to attempt new combination of genes or genetic improvement either by fusion of somatic cells from diverse species or by direct incorporation of foreign genetic information into the cells of selected host species (Vasil, 1976; Kleinhofs and Behki, 1977). This review deals with the following specific areas of plant tissue culture which have relevance to genetics and plant breeding: (1)rapid clonal propagation, (2) production of androgenetic (anther- or pollenderived) haploid tissues and plants, and (3) culture and fusion of protoplasts and their use in attempts at genetic modification. II. Rapid Clonal Propagation
Seventy-six years ago, in a now prophetic and classical paper, the German botanist, Gottlieb Haberlandt (19021, discussed the possibility of demonstrating the totipotency of somatic plant cells through tissue cultures. The concept of totipotency itself was inherent in the Cell Theory of Schleiden (1838)and Schwann (18391, and was popularized as early as 1858 by Virchow with his famous aphorism: ‘‘omniscellula e cellula” [every cell from a cell]. Two major developments, which took place in experimental botany and plant physiology during the period 1955-1965, led to the demonstration of totipotency of higher plant cells. These were the discovery of hormonal regulation of growth and organ formation in plants by Skoog and Miller (1957) and the development of experimental procedures for successful culture of tissues (Reinert, 1958a,b, 19591, cell suspensions (Steward et al., 1958), and eventually single cells (V. Vasil and Hildebrandt, 1965a,b, 1967; I. K. Vasil and Vasil, 19721, leading to the in vitro regeneration of whole plants. All this work was done with tissue cultures of the carrot
PLANT TISSUE CULTURES
129
(Daucus carota) and hybrid tobacco (Nicotiana tabacum x Nicotiana gl utinosa). In much of the early work on plant tissue cultures, the basic nutrient media were routinely supplemented with complex mixtures of natural origin (coconut milk, juices of various fruits, casein hydrolysate, yeast extract, etc.) in order to obtain optimal growth and to induce organogenesis (Steward et al., 1958, 1964; Steward, 1968; Hildebrandt, 1962; Vasil and Hildebrandt, 1966a; Butenko, 1968; Street, 1969; Vasil, 1977). The basic nutrient media used for most such cultures were various modifications of the formulations developed in the early 1930s by Philip White in the United States (1932, 1934, 1939, 1963; Hildebrandt et al., 1946) and Roger Gautheret in France (1934, 1939; Heller, 1953). The first major completely chemically defined nutrient medium was developed in 1962 by Toshio Murashige and Folke Skoog at the University of Wisconsin on the basis of their observation that the addition of an aqueous extract of tobacco leaves to the modified White’s medium brought about a 4- to 5-fold increase in the growth of tobacco stem pith explants. They showed that “this promotion of growth was due mainly though not entirely to inorganic rather than organic constituents in the extract” (Murashige and Skoog, 1962). The Murashige- Skoog medium-and some other similar media-are now extensively used for the cultivation of plant tissues in uitro and for experiments leading to the regeneration of shoots, roots, or whole plants (Gamborg et al., 1976; Vasil, 1977). In experiments leading to the regeneration of whole plants, viable tissue explants removed from almost any part of a wide variety of plants are first induced to proliferate by rapid cell division activity into a fairly homogeneous mass of callus tissue. This tissue is then cultured on nutrient media containing the appropriate amounts of auxin (plant growth hormones that favor root initiation) and a cytokinin (plant growth hormones that induce shoot formation). In many cases multiple shoot differentiation can be obtained directly from the initial explant in appropriately designed nutrient media. When only shoots are formed in cultures growing on a particular medium, these can usually be rooted on a simple White’s medium containing low levels of one of the auxins. There are additional growth substances, as well as the physiological and physical conditions of culture, that may control organogenesis in vitro. These must be established for each species experimentally. The plantlets produced in uitro must be transferred very carefully and under strictly controlled conditions-particularly the avoidance of desiccation through maintenance of high humidity around the plantlets-to soil in the greenhouse and later in the field. A
130
INDRA K. VASIL
et al.
detailed discussion of the entire procedure, its advantages and its problems, has been recently provided by Murashige (1974). It is now possible to regenerate whole plants or produce somatic embryos (embryoids) that grow into normal plants in a wide variety of species (Durzan and Campbell, 1974; Murashige, 1974; Pierik, 1975). Table 1 provides a comprehensive-though by no means complete-list of species in which plant regeneration through tissue cultures has been reported. A study of the species listed in Table 1 clearly shows that plant regeneration from cultured tissues is commonly achieved in angiosperms. Most of the species listed in the table are, however, herbaceous, and in many of these vegetative propagation is common. The advantages of using tissue culture techniques in the propagation of these species lie in the rapidity with which propagation can be achieved and in the large number of plants that can be produced with a saving of space and cost for propagation. Legumes, which provide an important source of vegetable protein and are also responsible for the nitrogen enrichment of the soil through symbiosis with Rhizobium, have generally failed to respond to various attempts at plant regeneration in uitro, except for peas (Gamborg et al., 1974a), alfalfa (Saunders and Bingham, 1973, and some other species of minor economic importance. There are several reports of plantlet regeneration in grasses and cereals, but in most of these species large-scale propagation has still to be demonstrated (King et al., 1978). Woody or tree species of angiosperms as well as gymnosperms have been uniformly difficult to culture in vitro. However, the recent reports of plantlet formation in tissue cultures of American elm (Durzan and Lopushanski, 19751, spruce (Campbell and Durzan, 19751, douglas fir (Cheng, 19751, pine (Sommer et al., 1975), poplar (Winton, 1970; Chalupa, 1974), etc., are encouraging and should foster further intensive efforts in this area. The observation that organogenesis is comparatively easier in haploid tissue cultures suggests that anther cultures should be used to regenerate plants in difficult cases (see Section 111, D). Plants produced asexually through organogenesis in tissue cultures are genetically identical and can be produced much more rapidly than is possible through sexual reproduction. These plants are reported to grow faster and mature earlier than seed-propagated plants. Finally, there is virtually no limit to the number of plants that can be produced by this procedure. According to Murashige (19741, “A millionfold increase per year in the rate of clonal multiplication over conventional methods is not unrealistic” (see also Murashige et al., 1972; Hasegawa et al., 1973; Earle and Langhans, 1974a,b; Morel, 1975; Miller and
TABLE 1 Species in Which Adventitious Buds, Shoots, Embryoids, or Whole Plants Have Been Produced through Tissue Culture Techniques" ~~
Species
Acacia Acacia koa Acer s acc haru m Adiantum cuneatum Aechmea fmciata Ailanthus altissima Allium cepa Allium sativum Aloe pretoriensis Alsophila australis Alstroemeria Amaryllis Ammi majus Anagallis arvensis Ananas comosus Ananas sativus Anethum graveolens Anthurium andraeanum Anthurium scherzerianum Antirrhinum majus Apium graveolens
References Kathju and Tewari, 1973 Skolmen and Mapes, 1976 Morselli et al., 1974 Murashige, 1974 Murashige, 1974 Caruso, 1974 Fridborg, 1971 Havranek and Novak, 1973; Kehr and Schaeffer, 1976; Abo El-Nil, 1977 Groenewald et al., 1975, 1976 Murashige, 1974 Ziv et al., 1973 Murashige, 1974; Bapat and Narayanaswamy, 1976 Sehgal, 1972; Grewal et al., 1976 Bajaj and Mader, 1974 Murashige, 1974 Mathews et al., 1976 Johri and Sehgal, 1963 Pierik et al., 1974; Pierik, 1976; Fersing and Lutz, 1977 Pierik and Steegmans, 1976a; Fersing and Lutz, 1977 Poirier-Hamon et al., 1974 Reinert et al., 1966; Williams and Collins, 1976a,b
Species
Arabidopsis thaliana Aranda Armoracia rusticana Asclepias curassavica Ascofinetia Asparagus officinalis Asparagus plumosa Atropa belladona Avena sativa Azadirachta indica Begonia cheimantha Begonia hiemalis Begonia rex Begonia semperflorens Beta vulgaris Betula pendula Betula verrucosa Biota orientalis Brassica alboglabra
References Corcos, 1973; Negrutiu et al., 1975, 1978 Loh et al., 1975 Wurm, 1960 Prabhudesai and Narayanaswamy, 1974 Intuwong and Sagawa, 1973 Takatori et al., 1968; Wilmar and Hellendoorn, 1968; Murashige, 1974 Fonnesbech, 1975 Zenkteler, 1971a; Thomas and Street, 1972 Carter et al., 1967; Cummings et al., 1976 Rangaswamy and Promila, 1972 Fonnesbech, 1974 Welander, 1977 Arora et al., 1970; Chlyah, 1972; Shigematsu and Matsubara, 1972 Thakur, 1973 Margara, 1970; Butenko et al., 1972; Hooker and Nabors, 1977 Huthinen and Yahyaoglu, 1974 Jacquiot, 1955, 1966 Konar and Oberoi, 1965; Thomas et al., 1977 Zee and Hui, 1977
(continued)
TABLE 1 (continued) Species
Brassica napus B. oleracea var. acephala var. botrytis var. capitata
t;
var. gemmifera var. gongylodes var. medullosa Bromus inermis Broussonetia kazinoki Caladium Calanthe Calathea Capsella bursa-pastoris Carica papaya
Carum carvi Cattleya Cheiranthus cheiri Chondrilla juncea Chrysanthemum cinerariaefolium Chrysanthemum morifolium Cichorium endivia Cichorium intybus Citrus aurantifolia
References Kartha et al., 1974a Lustinec and Horak, 1970; Horak e al., 1971 Margara, 1969; Walkey and Woolfit, 1970 Bajaj and Nietsch, 1975; Miszke and Skucinska, 1976 Clare and Collin, 1974 Wurm, 1960 Horak, 1972 Gamborg et al., 1970 Oka and Ohyama, 1974 Hartman, 1974 Bertsch, 1967 Murashige, 1974 Walkey and Cooper, 1976 deBruijne et al., 1974; Yie and Liaw, 1977 Ammirato, 1974 Champagnat and Morel, 1969; Murashige, 1974 Khanna and Staba, 1970 Kefford and Caso, 1972 Hill, 1968; Roest and Bokelmann, 1973 Ben-Jaacov and Langhans, 1972; Earle and Langhans, 1974a,b; Bush et al., 1976 Vasil et al., 1964; Vasil and Hildebrandt, 1966b Margara and Rancillac, 1966 Singh, 1963
Species
Crassula Crepis capillaris Cryptanthus bivittatus Cryptbergia Cryptomeria japonica Cucurbita pep0 Curcuma longa Cuscuta reflexa Cycas Cyclamen persicum Cyclosorus dentatus Cymbidium
Datura innoxia Daucus carota
Dendrobium Dendrophthoe falcata Deutzia candidissima Deutzia sca bra Dianthus caryophyllus
References Murashige, 1974 Yoneda, 1969; Jayakar, 1971; Husemann and Reinert, 1976 Murashige, 1974 Murashige, 1974 Isikawa, 1974; Campbell and Durzan, 1976 Schroeder, 1968; Jelaska, 1972, 1974 Nadgauda et al., 1978 Maheshwari and Baldev, 1962 Norstog, 1965; Norstog and Rhamstine, 1967 Mayer, 1956; Stichel, 1959 Mehra and Palta, 1971 Morel, 1960, 1964, 1965; Wimber, 1963, 1965; Sagawa et al., 1966; Ueda and Torikata, 1968, 1970, 1972; Fonnesbech, 1972a,b Guha and Maheshwari, 1964; Engvild, 1973a Levine, 1947; Steward et al., 1958; Reinert, 1958a,b, 1959; Halperin and Wetherell, 1964; Halperin 1966 Morel, 1965; Sagawa and Shoji, 1967; Kim et al., 1970 Johri and Bajaj, 1962 Beauchesne, 1974 Beauchesne, 1974 Hackett and Anderson, 1967; Earle and Langhans, 1975
Citrus aurantium Citrus grandis Citrus hystriz Citrus ichangensis Citrus jambhiri Citrus kharna Citrus lansium Citrus limon Citrus limonia Citrus madurensis Citrus medica Citrus microcarpa Citrus paradisi Citrus reticulata Citrus sinensis Codiaeum variegatum E; Coffea arabica w
Coffea canephora Coffea liberica Colocasia esculenta Conium maculatum Consolida orientalis Convolvulus arvensis Coptis japonica Cordyline terminalis Coriandrum sativum Corylus avellana Crambe maritima
Esan, 1973; Sadouk Bouzid, 1975 Rangan et al., 1968; Chaturvedi et al., 1974 Esan, 1973 Esan, 1973 Esan, 1973 Singh, 1963; Esan, 1973 Esan, 1973 Rangan et al., 1968; Esan, 1973 Esan, 1973 Grinblat, 1972 Esan, 1973 Rangaswamy, 1961 Kochba et al., 1972; Esan, 1973 Esan, 1973; Sabharwal, 1963 Esan, 1973; Kochba et al., 1972; Mitra and Chaturvedi, 1972 Chikkannaiah and Gayatri, 1974 Staritsky, 1970a; Townsley, 1974; Herman and Haas, 1975; Sondahl and Sharp, 1977 Staritsky, 1970a Staritsky, 1970a Abo El-Nil and Zettler, 1976 Netien and Raynaud, 1972 Nataraja, 1971 Bonnett and Torrey, 1965, 1966; Earle and Torrey, 1965; Hill, 1967a Syono and Furuya, 1972 Kunisaki, 1975; Miller and Murashige, 1976 Steward et al., 1970 Radojevic et al., 1975 Bowes, 1976
Dioscorea deltoidea Dioscorea floribunda Diospyros kaki Dracaena Dracaena deremensis Dracaena godseffiana Dyckia sulphurea Echeveria elegans Elaeis guineensis
Eleusine coracana Epidendrum Eremocitrus glauca Eschscholtzia californica Eucalyptus alba Eucalyptus citriodora Eucalyptus grandis Eucalyptus obliqua Eucalyptus viminalis Euphorbia pulcherrima Fagopyrum esculentum Foeniculum vulgare Fortunella crassifolia Fragaria Freesia Furcraea gigantea
Mascarenhas et al., 1976; Grewal and Atal, 1976 Chaturvedi, 1975 Yokoyama and Takeuchi, 1976 Murashige, 1974 Debergh, 1975 (quoted from Pierik, 1975) Miller and Murashige, 1976 Murashige, 1974 Raju and Mann, 1970 Staritsky, 1970b; Barrett and Jones, 1974; Jones, 1974; Wilson and Webb, 1974; Rabechault and Martin, 1976 Rangan, 1976 Churchill et al., 1971, 1973 Esan, 1973 Kavathekar and Ganapathy, 1973 Kitahara and Caldas, 1975 Aneja and Atal, 1969 Cresswell and Nitsch, 1975 Blake, 1972 Blake, 1972 Nataraja, 1971, 1975; deLanghe et al., 1974 Yamane, 1974 Maheshwari and Gupta, 1965 Esan, 1973 Boxus, 1974; Lee and de Fossard, 1975 Bajaj and Pierik, 1974; Davies, 1972; Hussey, 1975; Pierik and Steegmans, 1975, 1976b Lakshmanan and Janardhanan, 1977
TABLE 1 (continued)
-
Species
Gazania splendens Geranium Gerbera jamesonii Gladiolus Gladiolus hortulans Gleditsia triacanthos Gloxinia hybrida (see Sinningia) Glycine man
*
Haworthia Haworthia Haworthia Haworthia Haworthia Haworthia Haworthia Haworthia
angustifolia atrofusca chloracantha maughanii planifolia retusa turgida variegata
Hedera helix Helianthus annuus Helonwpsis orientalis Hemerocallis Hemerocallis flava Hevea brasiliensis Hippeastrum hybridum
References Landova and Landa, 1974 Pillai and Hildebrandt, 1969 Pierik et al., 1973, 1975; Murashige et al., 1974 Ziv et al., 1970; Hussey, 1975 Hildebrandt, 1971; Simonsen and Hildebrandt, 1971; Wilfret, 1971 Rogozinska, 1969 Bigot, 1974 Kimball and Bingham, 1973; Oswald et al., 1977a Kaul and Sabharwal, 1972 Kaul and Sabharwal, 1972 Kaul and Sabharwal, 1972 Kaul and Sabharwal, 1972 Wessels et al., 1976 Kaul and Sabharwal, 1972 Majumdar, 1970 Kaul and Sabharwal, 1972; Majumdar and Schlosser, 1972 Hackett, 1970; Magrum and Steponkus, 1972 Sadhu, 1974 Kato, 1975 Heuser and Apps, 1976; Meyer, 1976 Chen and Holden, 1972 Paranjothy, 1974; Wilson, 1974 Mii et al., 1974; Hussey, 1975; Seabrook and Cumming, 1977
Species
Lycopersicon peruvianum Lycaste Macleaya cordata Malus sylvestris
Mammillaria woodsii Manihot utilissima Mazus pumilus Medicago sativa Mesem bryanthemum floribundum Microcitrus australasica Microcitrus warburgiuna Microlepia strigosa Miltonia Montbretia crocosmaeflOra Morus alba Musa cavendishii Muscari botryoides Narcissus Narcissus pseudonarcissus Nasturtium officinale Nautilocalyx lynchei Neostyl is Neottia Nephrolepis bostoniensis
References Norton and Boll, 1954 Morel, 1965 Kohlenbach, 1965, 1967 Elliott, 1972; Walkey, 1972; Mehra and Mehra, 1972; Abbott and Whitely, 1974; Quoirin, 1974 Kolar et al., 1976 Kartha et al., 1974c Raste and Ganapathy, 1971 Saunders and Bingham, 1972, 1975; Bingham et al., 1975; McCoy and Bingharn, 1977 Mehra and Mehra, 1972 Esan, 1973 Esan, 1973 Murashige, 1974 Morel, 1965 Matsuzawa and Sato, 1972 Ghugale et al., 1971 Ma and Shii, 1972 Hussey, 1975 Seabrook et al., 1976 Hussey, 1975 Ballade, 1971 Tran Thanh Van and Drira, 1970; Venverloo, 1976 Intuwong and Sagawa, 1973 Champagnat, 1971 Murashige, 1974
Hordeum vulgare Hosta decorata Hyacinthus Hyacinthus orientalis Hydrangea macrophylla Ilex quifolium Ipheion uniflorum Ipomoea batatas Iris hollandica Isatis tinctoria Kalanchoe pinnata Lactuca sativa Laeliocattleya Lilium longiflorum 01
Lilium regale Lilium speciosum Limnophila chinensis Linaria uulgaris Linum usitatissimum Lolium Lolium multiflorum Lotus caucasicus Lotus corniculatus Lunaria annua Lycopersicon esculentum
Norstog, 1970; Cheng and Smith, 1975 Hammer, 1976 Hussey, 1975 Pierik and Ruibing, 1973; Pierik and Post, 1975 Beauchesne, 1974 Hu and Sussex, 1972 Hussey, 1975 Gunckel et al., 1972 Baruch and Quak, 1966; Fujino et al., 1972; Hussey, 1976a Danckwardt-Lilliestrom, 1957 Mohan Ram and Wadhi, 1965 Doerschung and Miller, 1967 Churchill et al., 1971, 1973 Sheridan, 1968; Hackett, 1969 Montezuma-de-Carvalho et al., 1974 Robb, 1957 Sangwan et al., 1976 Charlton, 1965 Gamborg and Shyluk, 1976; Mathews and Narayanaswamy, 1976 Ahloowalia, 1975 Dale, 1975 Niizeki and Grant, 1971 Niizeki and Grant, 1971 Pierik, 1967 Gresshoff and Doy, 1972b; de Langhe and de Bruijne, 1974; Padmanabhan et al., 1974: Kartha et al., 1976
Nephrolepis exaltata Nerine bowdenii Nicotiana longiflora Nicotiana rustica Nicotiana suaveolens Nicotiana sylvestris Nicotiana tabacum Nigella damascena Nigella sativa Odontoglossum Odontonia Olea europica Oncidium Ophrys Ornithogallum thyrsoides Oryza sativa Panax ginseng Paspalum scrobiculatum Passiflora caerulea Pelargonium graveolens Pelargonium hortorum Pennisetum typhoideum Pergularia minor Petroselinum hortense Petunia axillaris Petunia hybrida
Murashige, 1974 Pierik and Ippel, 1977 Ahuja and Hagen, 1966 Walkey and Woolfit, 1968 Paulet and Nitsch, 1963 Murashige, 1974 Skoog and Miller, 1957; Tran Thanh Van, 1973; Tran Thanh Vanet al., 1974a,b; Binding, 1975 Raman and Greyson, 1974; Banerji and Gupta, 1975 Banerji and Gupta, 1975, 1976 Morel, 1965 Bertsch, 1967 Gilad and Lavee, 1974 Bertsch, 1967 Bertsch, 1967; Champagnat and Morel, 1972 Hussey, 1975, 1976b Nishiet al., 1968,1973; Kawata and Ishihara, 1968 Mascarenhas et al., 1975 Butenko et al., 1968; Jhang et al., 1974 Rangan, 1976 Nakayama, 1966; Montaldi, 1972 Skirvin and Janick, 1976 Chen and Galston, 1967 Rangan, 1976 Prabhudesai and Narayanaswamy, 1974 Vasil and Hildebrandt, 1966c Swamy and Chacko, 1973 Handroetal., 1972; Raoetal., 1973; Vasil and Vasil, 1974
(continued)
Species
0
Petunia inflata Phaius Phalaenopsis Phaseolus vulgaris Philodendron Phlox drurnrnondii Phlox paniculata Phoenix dactylifera Phragrnites cornrnunis Physalis minima Physalis peruviana Picea glauca Pinus palustris Pisurn sativurn
01
Plurnbago indica Pogosternon cablin Poncirus trifoliata Populus (hybrid) Populus canescens Populus euroarnericana Populus nigra Populus trernula Populus trernuloides Populus trichocarpa Prunus accolade Prunus arnygdalus Prunus rnariana Prunus pandora Prunus serrulata
References Handro et al., 1972; Rao et al., 1973 Morel, 1965 Hackett et al., 1973 Crocomo et al., 1976 Murashige, 1974 Konar and Konar, 1966 Olesen and Fonnesbech, 1975 Benbadis and Amar, 1976 Sangwan and Gorenflot, 1975 Bapat and Rao, 1977 Zenkteler, 1972a Campbell and Durzan, 1975, 1976 Sommer et al., 1975 Hildebrandt et al., 1963; Gamborget al., 1974a Nitsch and Nitsch, 1967 Hart et al., 1970 Singh, 1963; Esan, 1973 Berbee et al., 1972 Chalupa, 1974 Chalupa, 1974 Ghugale et al., 1971; Brand and Venverloo, 1973; Venverloo, 1973; Chalupa, 1974 Winton, 1971; Chalupa, 1974 Winton, 1968, 1970; Wolter, 1968 Bawa and Stettler, 1972 Quoirin et al., 1974 Mehra and Mehra, 1974 Monsion and Dunez, 1971 Boxus, 1971 Boxus and Quoirin, 1974
Species
Sedurn telephiurn Sequoia sernpervirens Sinapsis alba Sinningia speciosa (see Gloxinia) Siurn suave Solanurn dulcarnara Solanurn melongena Solanurn nigrurn Solanurn sisyrnbriifoliurn Solanurn tuberosurn
Solanurn xanthocarpum S o r g h u m bicolor Sparaxis bicolor Spinacea oleracea Stellaria media Streptocarpus Stylosanthes harnata Syngonium podophyllurn Tamxacurn officinale T h u j a plicata Torenia fournieri Trifolium repens Trigonella foenurn-graecurn Triticum aestivurn
References Brandao and Salema, 1977 Ball, 1950; Restool, 1956 Bajaj and Bopp, 1972 Ammirato and Steward, 1971 Zenkteler, 1972a Yamada et al., 1967 Zenkteler, 1972a Fassuliotis, 1975 Wurm, 1960; Fellenberg, 1963; Kohlenbach and Geier, 1972; Skirvin et al., 1975; Roest and Bokelmann, 1976; Westcott et al., 1977 Rao and Narayanaswamy, 1968 Masteller and Holden, 1970; Gamborg et al., 1977 Hussey, 1975 Negkovit and RadojeviC, 1973 Walkey and Cooper, 1976 Appelgren and Heide, 1972; Raman, 1977 Scowcroft and Adamson, 1976 Miller and Murashige, 1976 Bowes, 1970 Coleman and Thorpe, 1977 Chlyah, 1973, 1974 Pelletier and Pelletier, 1971; Oswald et al., 1977a Subramaniam et al., 1968 Shimada et al., 1969; Dudits et al., 1975; Chin and Scott, 1977
Pseudotsuga menziesii
-
w
4
Pteris argyrea Pteris cretica Pterotheca falconeri Ranunculus sceleratus Rauwolfia serpentina Rhyncostylist Ribes rubrum Ribes uvacrispa Robinia pseudoacacia Rosa Rosa multiflora Rubus idaeus Saccharum Saintpaulia ionantha Salix alba Salk babylonica Salix viminalis Salpiglossis sinuata Santalum album Saxifraga Schizostylis coccinea Schlumbergera bridgesii Schlumbergera gaertneri Scilla sibirica Scindapsus aureus Scopolia parviflora
Cheng, 1975; Winton and Verhagen, 1977; Cheng and Voqui, 1977 Murashige, 1974 Bristow, 1962 Mehra and Mehra, 1971 Konar and Nataraja, 1965a,b Mitra and Chaturvedi, 1970 Teo et al., 1973 Zatyko et al., 1975 Jones and Vine, 1968 Seeliger, 1959 Hill, 1967b; Jacobs et al., 1968 Elliott, 1970; Beauchesne, 1974 Putz, 1974 Barba and Nickell, 1969 Kukulezanka and Suszynska, 1972; Start and Cumming, 1976 Chardenon and Taris, 1960 Beauchesne, 1970, 1974 Letouze, 1974 Beauchesne, 1970 Hughes et al., 1973; Lee et al., 1976 Rao, 1965 Murashige, 1974 Hussey, 1975 Johnson et al., 1976 Johnson et al., 1976 Hussey, 1975 Miller and Murashige, 1976 Tabata et al., 1972
Triticum dicoccum Triticum monococcum Triticum vulgare Tsuga heterophylla Tylophora indica Ulmus americana Ulmus campestris Ulmus glabra Vanda Vascostylis Verbascum thapsus Viburnum opulus Vigna sinensis Vigna unguiculata Vitis riparia Vitis rupestris Vitis uinifera Vuylstekeara Weigelia Woodwardia fimbriata Yucca Zamia integrifolia Zea mays Zygopetal u m
Shimada et al.. 1969 Shimada et al., 1969 Hendre et al., 1971, 1975; Mascarenhas et al., 1975 Cheng, 1976 Rao et al., 1970; Rao and Narayanaswamy, 1972 Durzan and Lopushanski, 1975 Jacquiot, 1951; Gautheret, 1940 Jacquiot, 1966 Kunisaki et al., 1972; Teo et al., 1973 Intuwong and Sagawa, 1973 Caruso, 1971 Beauchesne, 1974 Indira and Ramadasan, 1967; Reddy and Narayana, 1971 Subramaniam et al., 1968 Favre, 1973 Galzy, 1972; Morel, 1975 Mullins and Srinivasan, 1976 Bertsch, 1967 Beauchesne,1974 Murashige, 1974 Murashige, 1974 Norstog, 1965; Norstog and Rhamstine, 1967 Hendre et al., 1971; Mascarenhas et al., 1975; Green and Phillips, 1975; Harms et al., 1976 Bertsch, 1967
I' Some of the reports are admittedly fragmentary, unconfirmed, and of dubious nature. Only a handful of the species listed have been adapted to large-scale clonal propagation through tissue culture techniques. Almost all the species listed here are angiosperms, but several examples from lower vascular plants and gymnosperms are also included. Lists of embryoids or plants derived from microspores (generally haploid or homozygous 2n, 3n, or 4n plants) and from isolated protoplasts are given in Tables 2 and 4, respectively.
138
INDRA K. VASIL
et al.
Murashige, 1976). These highly favorable characteristics of clonal propagation in uitro have naturally attracted the attention of horticulturists, foresters, and plant breeders. There are now many commercial nurseries and other industry-supported laboratories in the United States, France, West Germany, Taiwan, and elsewhere, which produce most of their plants for commercial use by tissue culture techniques. All species in which controlled organogenesis can be induced in vitro may not be suitable for large-scale clonal propagation. This may be because the whole process is too expensive, the rate of multiplication is slow, there is high mortality of plantlets when explanted to the soil, and induced genetic variation occurs in the plantlets through aneuploidy or polyploidy during cell proliferation in uitro (Murashige, 1974; D’Amato, 1975; Matthews and Vasil, 1976; Skirvin, 1978). 111. Tissue Culture and Haploidy
Mutations of scientific or economic importance are difficult to detect in diploid heterozygous plants owing to their generally recessive character. Since a true haploid plant has only one set of chromosomes, all mutations and recessive genes are expressed and can be conveniently and rapidly detected. The first haploid in a flowering plant was reported by Blakeslee et al. (1922) in Datura stramonium, followed by the identification of a doubled haploid plant (Blakeslee and Belling, 1924). The significance of such haploids, particularly their doubled haploid forms, has been obvious to geneticists and plant breeders for the production of inbred lines and for obtaining homozygous lines from heterozygous material through doubled haploids without lengthy inbreeding (Kimber and Riley, 1963; Magoon and Khanna, 1963; Chase, 1952, 1963, 1969, 1974; Vasil and Nitsch, 1975; Nitzsche and Wenzel, 1977). Appearance of haploid forms in natural populations is a t best infrequent, and induction of haploidy through experimental procedures has not been very successful for most species, as only a small number of haploid individuals are produced, and not with any degree of certainty. Many attempts have been made, therefore, since the 1950s to culture in uitro the female gametophyte of gymnosperms, or the microsporangia and anthers of gymnosperms and angiosperms, respectively, in order to induce the production of haploids from the haploid gametophytic cells. Although haploid tissue cultures have been obtained from the pollen of several gymnospermous species, including Ginkgo biloba (Tulecke, 1953, 19571, Taxus (Tulecke, 1959), Torreya nucifera
PLANT TISSUE CULTURES
139
(Tulecke and Sehgal, 19631,Ephedra foliata (Konar, 19631, these have uniformly failed to give rise to shoots or plantlets. Much of the early work on the culture of excised anthers of angiosperms was aimed at understanding the meiotic process (Vasil, 1967, 1973a,b). The first pollen-derived haploid angiosperm tissue culture was obtained from anther cultures of Tradescantia refZexa (Yamada et at., 19631, but this failed to undergo organogenesis. Embryo-like structures or embryoids were later observed by Guha and Maheshwari (1964) to arise from cultured anthers of D a t u m innoxiu and were subsequently shown to have been formed from microspores (Guha and Maheshwari, 1966). Bourgin and Nitsch (1967) later obtained mature, flowering haploid plants from anther cultures of Nicotiana tabmum and N . sylvestris. Extensive and painstaking experimental work led by the late Jean P. Nitsch in France helped to establish the morphological, physiological, and nutritional requirements for the production of androgenetic haploids from cultured anthers of many angiosperms. A list of species in which haploid callus tissue, embryoids, or plantlets have been reported from cultures of excised anthers or isolated microspores is given in Table 2. Although the list of species shown in Table 2 is steadily growing, it is still limited to a few taxa, and there is obviously an urgent need to expand it to include a wider variety of angiosperms, particularly legumes and tree species.
A. ORIGINOF ANDROGENETIC HAPLOIDS In angiosperms, the gametophytic phase of the life cycle begins with the formation of four haploid microspores a t the end of meiosis, enclosed within a callose (P-1,3-glucan) tetrad wall. Callase (/3-1,3glucanase), synthesized and supplied by the somatic anther wall layers (Stieglitz, 19771, later breaks the callose tetrad wall, releasing the four microspores. The haploid microspore nucleus undergoes a mitotic division (microspore mitosis) to give rise to a pollen grain with two unequal cells: the small generative cell with a weakly basophilic cytoplasm containing a nucleus with highly condensed chromatin, and the large vegetative cell with strongly basophilic cytoplasm and a nucleus with diffuse chromatin and a conspicuous nucleolus. Finally, the generative cell undergoes mitosis (pollen mitosis) to form two male gametes. Experience has shown that, for the successful induction of androgenetic development, anthers should be excised and cultured just before, during, or immediately after microspore mitosis. The haploid callus or plantlets may originate in one or more of the following ways: (1) Microspore mitosis is normal, resulting in the formation of typical
TABLE 2 Species of Angiosperms in Which Callus, Embryoids, or Whole Plants of Androgenetic Origin Have Been Obtained through the Culture of Excised Anthers or Isolated Microspores" ~
~
Species
Aegilops (CP) Agropyron repens (E) Anemone spp. (E) Arabidopsis thaliana (CP) Asparagus officinalis (CP) Atropa belladonna (E)
+A
A 0
Brassica campestris (CP) Brassica napus (E) Brassica olemcea (CP) Bmssica oleracea x B . alboglabra (CP) Bromus inermis (E) Camellia sinensis (C) Capsicum annuum (C) Capsicum frutescens (C) Corchorus (C) Datura innonia (E, CP) Datura mete1 (E) Datura meteloides (E, CP)
~~~~
References
Species
Kimata and Sakamoto, 1972 Zenkteler et al., 1975 Johansson and Eriksson, 1977 Gresshoff and Doy, 1972a Pelletier et al., 1972 Zenkteler, 1971a,b; Rashid and Street, 1973 Keller et al., 1975 Thomas and Wenzel, 1975b; Keller and Armstrong, 1977 Kameya and Hinata, 1970; Quazi, 1978 Kameya and Hinata, 1970
Nicotiana otophora (E) Nicotiana raimondii (E) Nicotiana rustica (E) Nicotiana sanderae (N. forgetiana x N . alata) (E) Nicotiana suaveolens x N . langsdorffii (C) Nicotiana sylvestris (El Nicotiana tabacum (E) Oryza sativa (CP, E)
Zenkteler et al., 1975 Iyer and Raina, 1972 Y.Y. Wang et al., 1973; Novak, 1974 Novak, 1974 Iyer and Raina, 1972 Guha and Maheshwari, 1966; Geier and Kohlenbach, 1973 Narayanaswamy and Chandy, 1971 Kohlenbach and Geier, 1972; Nitsch, 1972
Oryza sativa (hybrid) (CP) Paeonia hybrida Paeonia lactifolia Paeonia lutea (E) Paeonia suffruticosa (E) Petunia uxillaris (CP) Petunia hybrida x P. axillaris (CP) Petunia hybrida (CP) Pharbitis nil (E) Populus simonii x P. nigra (CP) Populus ussuriensis (CP)
References Collins et al., 1972 Collins and Sunderland, 1973 Nitsch and Nitsch, 1969 Vyskot and Novak, 1974a Guo, 1972 Bourgin and Nitsch, 1967 Bourgin and Nitsch, 1967 Niizeki and Oono, 1968; Guha et al., 1970 Niizeki and Oono, 1971 Sunderland, 1974 Ono and Tsukida, 1978 Zenkteler et al., 1975 Zenkteler et al., 1975 Doreswamy and Chacko, 1973; Engvild, 1973b Raquin and Pilet, 1972 Binding, 1972a; Iyer and Raina, 1972; Wagner and Hess, 1974 Sangwan and Norreel, 1975a Anonymous, 1975a Anonymous, 1975a
Datura muricata (E) Datura stramonium (E) Datura wrightii (E) Digitalis purpurea (CP) Festuca pratensis (E) Geranium (CP) Helleborus foetidus (E) Hordeum uulgare (CP) Hyoscyamus albus (E) Hyoscyarnus niger (E, CP) Hyoscyamus pusillus (E) Lilium (CP) Lolium multiflorum (CP) Lolium multiflorum x Festuca arundinacea (CP) Lolium perenne (CP) Lycium halimifolium (E) Lycopersicon esculentum (CP) Lycopersicon peruuianum (C) Lycopersicon pimpineliifolium ( C ) Nicotiana d a t a (E) Nicotiana attenuata (E) Nicotiana cleuelandii (El Nicotiana glutinosa (E) Nicotiana knightiana (E) I'
C
=
callus only; E
=
Nitsch, 1972 Guha and Maheshwari, 1967 Kohlenbach and Geier, 1972 Corduan and Spix, 1975 Zenkteler and Misiura, 1974 Abo El-Nil and Hildebrandt, 1973 Zenkteler et al., 1975 Clapham, 1973 Raghavan, 1975 Corduan, 1975; Raghavan, 1975, 1976 Raghavan, 1975 Sharp et al., 197213 Clapham, 1971 Nitzsche, 1970 Clapham, 1971 Zenkteler, 1972b Gresshoff and Doy, 1972b Gresshoff and Doy, 1972b Nitsch and Nitsch. 1969 Nitsch, 1969 Collins and Sunderland, 1973 Vyskot and Novak, 1974a Nitsch, 1969 Collins and Sunderland, 1973
Prunus armeniaca (C) Prunus avium (E, C) Ribes nigrum (C) Saintpaulia ionantha (E, CP) Scopolia carniolica (E) Scopolia lurida (E) Scopolia physaloides (E) Secale cereale (E) Secale montanum (E) Setaria italica (CP) Solanum dulcarnara (E) Solanum melongena (CP) Solanum nigrum (CP) Solanum tuberosum (E) Solanum uerrucosum (E) Tradescantia reflexa (C) Triticale (E) Triticum aegilopoides (C) Triticum uestivurn (CP) Triticum dicoccoides (C) Vitis uinifera (C)
embryoid and/or direct formation of plantlets; CP = callus to plant,
Harn and Kim, 1972 Zenkteler etal., 1975; Jordan, 1975 Jordan, 1975 Hughes et al., 1975 Wernicke and Kohlenbach, 1975 Wernicke and Kohlenbach, 1975 Wernicke and Kohlenbach, 1975 Wenzel and Thomas, 1974; Thomas and Wenzel, 1975a Zenkteler and Misiura, 1974 Ban et al., 1971 Zenkteler, 1973 Iyer and Raina, 1972; Raina and Iyer, 1973 Harn, 1972 Dunwell and Sunderland, 1973; Sopory and Rogan, 1976; Sopory, 1977 Irikura and Sakaguchi, 1972 Yamada et al., 1963 Ono and Larter, 1973; Y. Y. Wanget al., 1973; Sun et al., 1974; Bernard et al., 1976 Fujii, 1970 Ouyanget al., 1973; C. Wang et al., 1973; Craig, 1974; Shimada and Makino, 1975 Fujii, 1970 Gresshoff and Doy, 1974
142
INDRA K . VASIL
et al.
generative and vegetative cells. Thereafter, the generative cell either degenerates or may divide once or twice, but does not normally contribute to the formation of the haploid tissue or the embryoid, which is formed solely by continued divisions of the vegetative cell (Clapham, 1971; Sunderland and Wicks, 1971; Iyer and Raina, 1972; Vasil and Nitsch, 1975; Dunwell and Sunderland, 1976a). (2) Microspore mitosis is somehow deranged, resulting in the formation of two equal cells, with identical staining characteristics. Further divisions of both the cells contribute to the formation of a haploid tissue or the embryoid (Narayanaswamy and George, 1972; Nitsch, 1972; Ouyang et al., 1973; Rashid and Street, 1973; Sunderland et al., 1974). (3) In most cases studied so far, the typical generative cell does not contribute to the formation of the haploid tissue or embryoid. However, Raghavan (1976, 1977) has shown that continued divisions of the generative cell alone following a n apparently normal microspore mitosis give rise to a significant proportion of the embryoids formed in Hyoscyamus niger. It is interesting to note that the induction of androgenetic development in this species takes only 2-3 days, in contrast to the 7-14 days for most other species studied. Such early induction of mitotic activity of the generative cell is possibly related to the fact that the generative nucleus is already programmed for DNA synthesis. In species where the vegetative cell is involved in the proliferative activity, a longer induction period is required, probably because the DNA synthetic machinery has already been shut off and a reorganization of the vegetative cell cytoplasm as well as the nucleus must take place before the induction of mitotic activity. (4) Plantlets may also arise in some rare instances from divisions of the generative as well as vegetative nuclei, with or without accompanying fusion (Sunderland et al., 1974; Dunwell and Sunderland, 1976b,c; Raghavan, 1976).Plantlets formed after the fusion of the nuclei will obviously be diploid. The most common pathway for androgenetic development, however, is through continued divisions of the vegetative cell following a n apparently normal microspore mitosis. There is increasing evidence that the appearance of haploids in nature, and the ability of microspores to proliferate in vitro to form haploid callus or plantlets, is under genetic control (Gresshoff and Doy, 1972a,b; Guha-Mukherjee, 1973; Vyskot and Novak, 197413; Keller et al., 1975; Shimada and Makino, 1975; Simon and Pelonquin, 1977). It is essential, therefore, that a wide selection of genotypes of any given species be used in initial experiments aimed at production of androgenetic plants. Even under the best conditions only 0.5-5% of the
PLANT TISSUE CULTURES
143
pollen grains undergo androgenetic development; frequently the percentages are far below these. Plants regenerated from cultured anthers of several species of Nicotiana and some other genera are almost exclusively haploid, especially in those cases where the microspores give rise directly to embryoids and plantlets. In those species where callus formation precedes shoot differentiation, it is common to find plants with a ploidy level of haploid to pentaploid, and in certain cases this occurs even if plantlet formation is directly from embryoids (Oryza sativa: Nishi and Mitsuoka, 1969; Niizeki and Oono, 1971; Datura innoxza, D. metel: Nitsch and Nitsch, 1970; Engvild et al., 1972; Hordeum uulgare: Clapham, 1973; Atropa belladonna: Zenkteler, 1971a; Narayanaswamy and George, 1972; Solanum nigrum: Harn, 1972; Nicotiana sylvestris: McComb and McComb, 1977). On the other hand, in species like Petunia axillaris, P. hybrida (Engvild, 1973b; Wagner and Hess, 19741, Brassica campestris (Keller et al., 1 9 7 3 , Digitalis purpurea (Corduan and Spix, 1975), most of the androgenetic plants formed are diploid or of higher ploidy levels and few if any, haploid plants are formed. Cytological and genetic analysis of such plants has shown that they originate either by nuclear fusion at very early stages of androgenetic development, or by endomitosis (Narayanaswamy and Chandy, 1971; Engvild et al., 1972; Raquin and Pilet, 1972; Engvild, 1974; Sunderland et al., 1974; Corduan and Spix, 1975; Corduan, 1975; Keller et al., 1975). Wenzel et al. (1976) have shown that a majority of the plants obtained from anther cultures of Secale cereale are diploid. These arise from unreduced microspores and consequently retain heterozygosity. The occurrence of plants of different ploidy levels in anther cultures also seems to be related to the developmental stage of the anther at the time of excision and culture (Engvild et al., 1972; Raquin and Pilet, 1972; Engvild, 1973b, 1974; Sunderland, 1974). Such a relationship may be dependent on the timing of DNA synthesis in the generative and vegetative nuclei following microspore mitosis. Diploid to polyploid plants may also arise in anther cultures from unreduced microspores or as a result of aberrant meioses (Thomas et al., 1975). It is common to find proliferation of the somatic tissues of the anther (anther filament, wall, etc.) leading to callus andlor plantlet formation in many species (Vasil, 1963; Konar and Nataraja, 1965a; Guha and Maheshwari, 1967; Harn et al., 1969; Niizeki and Grant, 1971; Kohlenbach and Geier, 1972; Watanabe et al., 1972; Shimada and Makino, 1975; Malepszy, 1975; Thomas and Wenzel, 1975b). It is essential, therefore, that all anther-derived plants undergo rigorous
144
INDRA K. VASIL
et al.
cytological and genetic analysis before being designated homozygous, andlor pollen-derived. Endomitosis during cell proliferation in vitro is not unique to cultured anthers, but is a common phenomenon in tissue cultures of most higher plants (Partanen, 1963; D’Amato, 1965; Torrey, 1967; Murashige, 1974; Vasil and Nitsch, 1975; Matthews and Vasil, 1976). However, endomitosis or nuclear fusions resulting in the diploidization of the haploid genome can be of considerable advantage in obtaining homozygous tissues or plants in a one-step procedure. In those cases where only haploid plants are produced from anther cultures, as in some Nicotiana species, diploidization can be readily achieved subsequently through the culture of somatic tissues of the haploid plant (stem-pith or leaf explants), with or without the use of colchicine (Burk et al., 1972; Kasperbauer and Collins, 1972; Nitsch, 1972). Since most of our cultivated crops are polyploids, androgenetic plants derived from them are not true haploids. This may reduce the usefulness of such haploids, particularly in biochemical work. A very positive and encouraging development to overcome this problem has been the recent success of a series of experiments by Tran Thanh Van (1977; personal communication), who has succeeded in successively reducing the number of chromosomes in Nicotiana tabacum with a combination of anther culture and the culture of epidermalsubepidermal sectors excised from inflorescence branches. She cultured epidermal explants (containing 3-6 layers of epidermal and subepidermal cells) from inflorescence branches of Nicotiana tabacum (2n = 48). By proper manipulation of the nutrient mediumparticularly sugars, auxins, and cytokinins-the epidermal explants can be induced to form either roots, or vegetative buds, or flower buds, all without any intervening callus stage (Tran Thanh Van et al., 1974a,b). The anthers formed in the flower buds on the epidermal explants give rise to androgenetic haploid plants on culture. Anthers formed on the flowering haploid plants do not form any embryoids in uitro, but anthers from flower buds differentiated on cultured epidermal explants taken from flowering branches of the haploid plants do give rise to embryoids and plants in uitro, which later flower. The chromosome number of these second-generation haploids, or the “hypohaploids” as they are called by Tran Thanh Van, “varies from 3, 6, 9, 10, 11, 12, and so on to 24.”The “hypohaploid” plants also grow to maturity and flower. Epidermal explants isolated from the floral branches of these plants also give rise to flower buds in uitro. Anthers from such flower buds, when cultured, form only aberrant embryoids. Microspore mother cells in these anthers show a chromosome number
PLANT TISSUE CULTURES
145
of 1-24. This is a unique example of the experimental production of plants wi t h greatly reduced number of chromosomes, and it can obviously be of much value in studies of gene mapping and function.
B. NUTRITIONAL REQUIREMENTS FOR ANDROGENENS In addition to the fact that anthers must be excised just before, during, or after microspore mitosis for the successful induction of androgenesis in uitro, the second important requirement for such altered course of development by the microspores is the composition of the nutrient medium. For some species, like Nicotiana tabacum, this may be a simple mineral saltssucrose medium, without any added growth substances (Nitsch and Nitsch, 1969; Nitsch, 1972). For most other plants, particularly nonsolanaceous species, the addition of auxins and/or cytokinins is either necessary for androgenesis or responsible for the proliferation of a larger percentage of microspores (Guha and Maheshwari, 1967; Nakata and Tanaka, 1968; Kameya and Hinata, 1970; Clapham, 1971; Sunderland, 1971; Iyer and k i n a , 1972; Kohlenbach and Geier, 1972; Corduan, 1975; Keller et al., 1975; Thomas et al., 1975; Shimada and Makino, 1975; Zenkteler et al., 1975; A high concentration of sucrose in the Sopory and Maheshwari, 1976~). medium appears to favor androgenetic development, particularly in cultured anthers of cereals, such as wheat (Ouyang et al., 1973) and barley (Clapham, 1973); there is a similar report for Brassica carnpestris by Keller et al. (1975). Kohlenbach and Wernicke (1978) have shown that liquid nutrient media are better than agar media for anther culture, and that this is owing to the presence of an inhibitory substance in the agar. Pelletier and Ilami (1972) have emphasized the importance of the somatic anther wall layers on androgenetic development, as has been known for the normal development of pollen grains from earlier physiological and morphological studies (Vasil, 1967, 1973a). The effect of somatic tissues or their metabolites is nonspecific, as demonstrated by the successful cultivation of tobacco microspores within the anthers of Petunia (Pelletier and Ilami, 1972).Such information has naturally led to the addition of aqueous extracts of embryogenic anthers of Nicotiana and Datura to the nutrient media for the successful induction of androgenesis (Nitsch and Norreel, 1972, 1973; Debergh and Nitsch, 1973). Based on the chemical analysis of the embryogenic and nonembryogenic anthers of Nicotiana, Nitsch (1974) added large amounts of glutamine, serine, and myo-inositol to the synthetic nutrient medium and succeeded in obtaining plantlets from isolated microspores sus-
146
INDRA K . VASIL
et al.
pended in the nutrient medium. Plants have also been obtained from culture of isolated microspores of Petunia hybrida (Sangwan and Norreel, 1975b) and Solanum tuberosum (Sopory, 1977). Sunderland and Roberts (1977) have described another method for the improved production of haploids in culture by taking advantage of the natural dehiscence of pollen from anthers grown in liquid nutrient media. Physical factors prevailing during the incubation of excised anthers also play an important role in the induction of androgenetic development. Two of the most important factors appear to be temperature and both the quality and quantity of light. Sopory and Maheshwari (1976b) indicate that even the manner in which the excised anther is placed on the surface of the agar medium is important in order to get the desired results.
C. PHYSIOLOGY OF ANDROGENESIS “Morphogenetically the angiosperm microspore is a very labile cell, and its course of development into a pollen grain is not determined until about the time of its first mitotic division” (Vasil and Nitsch, 1975). It is owing largely to this fact that the course of microspore development can be changed from a gametophytic to a sporophytic phase through experimental manipulation, resulting in the development of haploid plants demonstrating the totipotency of the microspore, in addition to cells of various other types in angiosperms (Vasil and Vasil, 1972). The fact that the microspore nucleus may undergo supernumerary divisions, and also give rise to structures other than the normal male gametophyte, was first reported by Nemec (1898) in Hyacinthus orientalis. Further detailed observations by de Mol (1923, 1933a,b), Stow (1930, 19341, and Naithani (1937) in H . orientalis, and by Geitler (1941) in Ornithogalum nutans, showed that the microspore nucleus, after forming 416 free nuclei, underwent an organization typical of the angiosperm embryo sac. Thus the male gametophyte had been effectively converted into a female gametophyte, a view strengthened by observations of Stow (1934) that sometimes the polar nuclei fused, and that the “pollen embryo sacs” attracted pollen tubes produced by normal pollen. This very atypical development of the microspore followed treatment of bulbs or young plants, especially exposure to high temperatures during critical stages of pollen development. Other instances of the formation of embryo saclike structures in anthers are described by Vasil and Nitsch (1975), who point to “the possibility of the presence of specific substances within the anther which ensure normal differentiation of pollen grains under standard conditions. The
PLANT TISSUE CULTURES
147
precisely controlled influence of these substances is blocked or deranged under various experimental conditions, which allows the labile microspore to form a callus, an embryoid, or a n embryo-sac-like structure,” As stated earlier, the most critical stage for altering the course of microspore development is the period immediately preceding and following microspore mitosis. This period is characterized by intense metabolic activity within the anther, including the synthesis of RNA, DNA, and nuclear histones (Vasil, 1973a; Mascarenhas, 1975). Immediately following microspore mitosis, DNA is synthesized both in the generative and vegetative nuclei, but most of the RNA synthesislargely rRNA-takes place in the vegetative cell. According to Mascarenhas (1971), most of the rRNA, and possibly tRNA also, is synthesized in the period 24 hours before and after microspore mitosis, after which the rRNA and tRNA genes are turned off for the rest of the life of the pollen grain. It has been suggested that the anthers cultured after these genes have been turned off continue to develop into normal and mature pollen grains because the determination for the gametophytic phase of development has already taken place (Vasil, 1973a). Anthers excised and cultured before the turning off of the genes, and the determination of the gametophytic mode of development, retain the potential to undergo further mitotic divisions and form androgenetic tissue or plants. Nitsch and Norreel (1973) found that a larger percentage of pollen grains developed into embryoids following low-temperature storage of Datura innoxia flower buds prior to anther culture. Improved production of haploids in Nicotiana tabacum (Duncan and Heberle, 19761, Petunia hybrida (Malhotra and Maheshwari, 19771, and Datura innoxia (Sangwan-Norreel, 1977) has also been reported following coldincubation of anthers. According to Vasil and Nitsch (19751, this ‘‘is because of a general reduction in the metabolic activity within the anther, making it possible for the accumulation of a larger percentage of pollen grains a t the required stage of development.” That anther wall factors may be involved in triggering the induction of androgenesis is strongly indicated by the observation in many species that it is largely those anthers which become brown in color that give rise to androgenetic callus or plants. In anthers which outwardly appear healthy and largely retain the original color of their wall, only a few or no microspores undergo androgenetic development. This suggests that the “degenerating” anther wall layers may release new substances, or the factors which ensure the normal development of microspores in nature have been destroyed or eliminated, leaving the microspores free to follow an altered course of development, con-
148
INDRA K. VASIL
et al.
trolled now only by the conditions of their culture. The relationship between anther browning and plantlet formation in anther cultures of Nicotiana tabacum has recently been studied in detail by Mii (1976). The useful effect of aqueous anther extracts-or intact wall layers (Pelletier and Ilami, 1972) or the use of whole anthers as nurse tissues (Sharp et al., 1 9 7 2 a k i n aiding androgenetic development also points in the same direction. There is thus an obvious need for intensive comparative work on the chemical analysis of the aqueous extracts of embryogenic and nonembryogenic anthers to identify the substances involved. Ultrastructural and cytochemical studies of embryogenic microspores of Nicotiana tabacurn have shown that much of the gametophytic cytoplasm present in the vegetative cell following microspore mitosis is eliminated (Sunderland and Wicks, 1971; Bhojwani et al., 1973; Dunwell and Sunderland, 1974a,b). This is especially true of the ribosome population, but changes in the number and structure of most other organelles also take place. The organization and characteristics of the chromatin in the generative and vegetative nuclei are also important pointers to their metabolic state. The generative nucleus shows a highly condensed chromatin structure, suggesting that the histones are present in an active state. Sauter (1969) found DNA-bound lysinerich histones, thought to be active in gene regulation, to be present in a transcription-suppressing form in the highly condensed generative nuclei of Paeonia. On the other hand, the vegetative nucleus is characterized by the presence of highly diffused chromatin and poor histone localization, indicating either that DNA-bound histones are absent or that they are present in a structurally altered or an inactive form that permits continued RNA transcription under appropriate conditions.
D. USESOF ANDROGENETIC PLANTS The principal use of haploids is in the production of fertile, homozygous diploid plants in large numbers through diploidization and clonal propagation in a single generation, rather than taking the years that are required to produce pure lines through inbreeding. Pollen-derived doubled haploids of Nicotiana have been shown to have a high degree of meiotic stability (Collins and Sadasivaiah, 1972). Through the culture of anthers or micmspores, it should be possible to achieve a homozygous state even in self-incompatible plants. In addition, doubled haploids are of considerable advantage in increasing the efficiency of recurrent selection methods (Griffing, 1975). These attributes of haploids, and the fact that they can be produced comparatively easily and quickly by tissue culture techniques-albeit in a limited number
PLANT TISSUE CULTURES
149
of species a t the present time-have stimulated much research in this area during the last decade. Haploid callus tissues, like most other rapidly proliferating plant tissues in culture, are mitotically unstable, and they rapidly become polyploid owing to endomitoses and nuclear fusions, or aneuploid owing to the random loss of chromosomes caused by aberrant mitoses (Collins et al., 1972; Guo, 1972; Matthews and Vasil, 1976). Some stability in the chromosome number of haploid tissues in culture can be achieved by omitting auxins and cytokinins from the nutrient medium and by drastically reducing the time during which the tissues are maintained in culture. Long-term haploid tissue cultures, especially those that require auxins and cytokinins for continued growth, will be of only limited use in the production of haploid plants unless some means can be found to stabilize the haploid nature of a sizable proportion of the cells. Gupta and Carlson (1972) reported that, by the use of suitable concentrations ofp-fluorophenylalanine (PFP)in tissue cultures of tobacco, “it is possible to maintain stable cultures of haploid cells, and to select preferentially haploid cells from mixed populations of cells of varying ploidy.” Other workers have failed to confirm these results in tobacco (Dix and Street, 1974; Zenk, 1974) and Hyoscyamus niger (Corduan, 1975). Chaleff and Carlson (19741, discussing the original report of Gupta and Carlson (1972), stated that “these results are not always reproducible.” Recently, Matthews and Vasil (1976) found that PFP does not preferentially support the growth of haploid tissues, and “sharply-but not totally-inhibits the growth of haploid and diploid tobacco tissues.” Their microspectrophotometric data, however, show that whatever little growth takes place in the presence of PFP in stem pith explants taken from haploid plants is largely due to the division of haploid cells, resulting not only in maintaining but even in increasing the percentage of haploid cells initially present in the culture. In view of the conflicting information available about the effects of PFP on haploid tissue cultures, further research is necessary to find a suitable and reliable means to stabilize the chromosome number of haploid tissue cultures. In the absence of any opposition of dominant and recessive alleles, all the genes present in a single genome are expressed in a haploid tissue o r plant. This effectively eliminates many of the complexities of the diploid-particularly heterozygous-status, Haploid tissue cultures or plants, therefore, can serve as a major means of recovering mutant cell lines as well as individuals. Carlson (1970) thus isolated several auxotrophic mutant cell lines from haploid tobacco cells in culture. In spite of the fact that all these mutants-which were auxotrophs for nucleic acid bases, vitamins, and amino acids-were “leaky,”
150
INDRA K. VASIL
et al.
such pioneering work has effectively demonstrated the potential of haploid tissue cultures in isolating auxotrophs that can be of critical use in experiments attempting somatic hybridization (Vasil and Nitsch, 1975). At about the same time, Binding et al. (1970) isolated streptomycin-resistant cell lines from haploid tissue cultures of Petunia hybrida. Since then, 5-bromodeoxyuridine-resistantcell lines and streptomycin-resistant plants of Nicotiana tabacum have been isolated by Maliga et al, (1973a,b), 2,4-dichlorophenoxyacetic acidresistant and sodium chloride-resistant cell lines of N. sylvestris by Zenk (1974), and mutants with altered pigments in Datura innoxia by Schieder (1976b). Several other mutant cell lines or plants have been isolated from tissue cultures (Widholm, 1974a,b; Chaleff and Carlson, 1974; Vasil, 1976). The fact that most of the important crop plants and species used for mutant selection through tissue culture procedures are natural polyploids, and their haploids or doubled haploids thus contain two or more copies of metabolically essential genes, may account for the leaky nature of the mutants. The best use of these mutants will be made only when they are isolated from true haploids, or their diploidized homozygous progeny. Using haploid tissue cultures ofNicotiana tabacum, Carlson (1973~) isolated mutant cell lines and plants that were resistant to methionine sulfoximine, and several of the mutants recovered showed a specific increase in the level of free methionine, apparently through the loss of, or less effective process of, feedback inhibition. Similar methionine overproducing cell lines of Nicotiana sylvestris have been isolated by Zenk (1974). Loss of such regulatory mechanism can be of practical use in increasing the production of specific natural-primary or secondary metabolites-plant products, particularly steroids, alkaloids, etc., for medical use, and certain amino acids essential and important in human nutrition, e.g., lysine, methionine. As discussed in Section 11, the regeneration of plants from somatic (diploid) tissue cultures is still very difficult or impossible in many species, particularly the legumes and most woody or tree species. Recent observations by several authors-omparing the organogenetic potential of haploid and diploid tissue cultures-indicate that haploid tissue cultures are more amenable to induced organogenesis and plantlet formation in vitro than their diploid counterparts (Binding, 1974; Stringham, 1974; Kerbauy et al., 1976; Sopory and Maheshwari, 1976a). In many of the species listed in Table 2, plantlets were first regenerated from cultured anthers, to be followed by successful regeneration of plants in diploid somatic tissue cultures as the requirements for the expression of the organogenetic potential became better understood. A special effort should be made, therefore, to obtain haploid
PLANT TISSUE CULTURES
151
callus or plantlets from those species where organogenesis in uitro has traditionally proved difficult. Haploid plants, or their diploidized derivatives, obtained from the culture of microspores or anthers have not yet been widely used in plant breeding or plant improvement programs. Some beginning is, however, now being made in this direction. Collins et al. (1974) have produced four breeding lines of Nicotiana tabacurn with different total alkaloid content. Their study supports the view that two major genes control total alkaloid production in burley tobacco. Improved strains of tobacco have also been obtained by Chinese and Japanese scientists using anther culture techniques (Anonymous, 1974; Nakamura et al., 1974). A new cultivar of rice has been developed by Yin et al. (1976) from anther-derived haploids in the Peoples Republic of China, where such haploids are already being used for the improvement of the breeding stock in rice as well as tobacco (G. Melchers, personal communication; see also the report of his visit to the Peoples Republic of China in Haploid Information Sheet, No. 13, 1975; Nitzsche and Wenzel, 1977). Melchers also reported seeing “the first haploid plant of maize raised out of anthers in Peking,” and anther-derived, improved rice plants in the laboratory and in the fields. IV. Plant Protoplasts in Genetics and Breeding
Two of the most important reports published in the field of plant tissue culture during the 10 years from 1967 to 1977 are clearly those of Power et al. (1970) from the University of Nottingham (England), and Carlson et al. (1972) from the Brookhaven National Laboratory (U.S.A.). Together, these publications have provoked more discussion, generated more research, and aroused more hope, than any other publication in the history of plant tissue culture. Power et al. (1970) developed a procedure to induce inter- and intraspecific fusion of isolated protoplasts, and Carlson et al. (1972) reported the production of the first somatic hybrid plants by protoplast fusion. Speculations were made by both groups about the importance of their observations for the future of somatic hybridization and plant improvement. The principal significance of the above work is that it provides a possible approach to both the production of inter- and/or intraspecific hybrids that cannot be obtained by conventional methods of hybridization, and to the introduction of new genetic information into plant cells without sexual reproduction. The term protoplast, as defined by Vasil (19761, “describes that part of the plant cell which lies within the cell wall and can be plasmolysed, and which can be isolated by removing the cell wall by mechanical or
152
INDRA K. VASIL
et al.
enzymatic procedures. The protoplast is, therefore, only a naked cellsurrounded by the plasma m e m b r a n e w h i c h is potentially capable of cell wall regeneration, growth, and division.” The absence of the cell wall in the protoplast permits a variety of experimental procedures, such as the uptake of cell organelles, microorganisms, foreign genetic material, to produce genetically modified cells, in addition to their capacity to fuse with each other to form hybrid cells. Significant progress has taken place in this new field of research in the relatively short period of about 6 years (see Vasil, 1976, for a comprehensive review of plant protoplast research). In the following pages a brief description of the methods used for the isolation and culture of protoplasts precedes a detailed discussion of the implications-and applications-of plant protoplast research in genetics and plant breeding.
A. ISOLATION AND CULTURE OF PROTOPLASTS Protoplasts have been isolated by mechanical methods for a long time (Klercker, 1892; Cocking, 1972; Vasil, 1976). This basically involved strip-cutting of plasmolyzed plant tissues followed by induced osmotic swelling to release the protoplasts. The number of protoplasts obtained by mechanical methods is rather limited, and the procedure can be adapted for only a few types of tissues, which are not necessarily suitable for continued growth in culture. One of the important early contributions in the evolution of modern protoplast research, therefore, was the development of enzymic procedures for the isolation of protoplasts by Cocking (1960).He used a relatively crude cellulase preparation from the fungus Myrothecium uerrucaria to isolate protoplasts from tomato roots. Further modification of this procedure made it possible to obtain protoplasts in large numbers from a variety of plant tissues. The easy commercial availability of a number of potent enzyme preparations since 1969 has further contributed to the rapid development of improved techniques for the isolation of large and homogeneous populations of protoplasts (Cocking, 1972; Gamborg and Wetter, 1975; Vasil, 1976). The most common and important enzyme preparations used for this purpose are the Japanese-manufactured cellulase (from Trichoderma uiride), driselase (from a basidiomycete and rich in cellulase and pectinase), and macerozyme (from Rhizopus and rich in pectinase). In most instances the crude commercial enzyme preparations have been used without any further purification, but some workers partially purify their enzyme by gel filtration. Very highly purified or crystalline enzyme preparations are less suitable for protoplast isolation, as these are unable to break down the chemically and structurally complex plant cell wall. Protoplasts can be isolated from a variety of plant tissues and or-
PLANT TISSUE CULTURES
153
gans, including leaves (the most popular source), shoot apices, fruits, roots, legume root nodules, microspore mother cells, and microspores (Vasil, 1976). Another common and favorite source of protoplasts are plant callus and suspension cultures (Gamborg and Wetter, 1975; Vasil, 1976). Isolating protoplasts from cultured cells is advantageous as these are grown under aseptic and carefully controlled nutritional and physical conditions, and in many cases the requirements for their growth and morphogenesis are already known. Two different procedures are commonly used for the enzymic isolation of protoplasts. In one, young leaves are plasmolyzed and cut into small pieces following the peeling off of the lower epidermis. The leaf pieces are next macerated with macerozyme, which releases the mesophyll cells. The mesophyll cells are then washed and incubated in cellulase to digest the cell walls and release the protoplasts (Takebe et al., 1968). In the second, one-step, procedure, a mixture of pectinase (macerozyme) and cellulase is used, which not only macerates the tissues but also releases protoplasts by digesting the cell walls (Power and Cocking, 1968,1970). Further details of the isolation methods can be found in the handbook of plant tissue culture techniques by Gamborg and Wetter (1975) and in the recent review on protoplasts by Vasil (1976). In normal plant cells, the cell wall protects the protoplast from osmotic damage. Without the cell wall the protoplasts become highly susceptible to changes in their osmotic environment, and, therefore, their osmotic stability must be maintained and protected against sharp and sudden changes by incubating the cells in an appropriate solution during the formation of the protoplasts. Generally, this is achieved by preparing the enzyme solution in 0.4-0.8 M mannitol and/or sorbitol, sucrose or glucose, or better still, with a combination of ionic as well as nonionic osmotica. After the cell walls have been completely digested, the released protoplasts must be removed from the enzyme solution a s soon as possible. The enzyme solution-including much of the cellular debris-is effectively removed and clean preparations of protoplasts are recovered either by filtration through Millipore, nylon, or stainless steel filters, through sedimentation or flotation (for this, high concentrations of sucrose or a n aqueous dextran-polyethylene glycol twophase system must be used) following low speed ( l O O g ) , short-duration (1-2 minutes) centrifugation, and other modifications of the above methods (Larkin, 1976; Hughes et al., 1978a). The protoplasts are then suspended in a suitable medium and can be cultured in various ways. The nutrient solutions that have been commonly used for the culture of protoplasts are similar to the media used for the culture of cells and tissues (Gamborg et al., 1976; Vasil, 1977). The two common formula-
154
INDRA K. VASIL
et al.
tions in use are a modified version of Murashige and Skoog's (1962) medium first employed by Nagata and Takebe (19711, and the B5 medium (Gamborg et al., 1968; Gamborg and Wetter, 1975). A very complex nutrient medium has been used by Kao and Michayluk (1975) to obtain growth and sustained cell divisions of a single protoplast suspended in about 4 ml of the medium. Recently, Kao (1977) has used a modification of the above medium to culture mechanically isolated fused protoplasts of tobacco and soybean into hybrid callus masses. Important ingredients in all the nutrient media are osmotic stabilizers and plant growth substances. Once cell wall regeneration and sustained cell division activity have been initiated, the cells can be transferred to media without osmotic stabilizers. For effective cell wall regeneration and induction of cell division activity, several other factors must also be controlled. Important among these are the density of the protoplasts in the medium (1 x lo3 to 1 x 105/ml),temperature (25"-30"C), and light (some protoplasts will grow well only in the dark, but for others low intensities of light appear to be essential). Culture of protoplasts a t low population densities by the use of nondividing, inactivated, X-irradiated protoplasts as a feeder layer (5- 50 protoplasts per milliliter; Raveh and Galun, 1975) has also been reported, including cross-feeding between tobacco and orange protoplasts (Vardi and Raveh, 1976). Gleba (1978) regenerated tobacco plants from single mesophyll protoplasts cultured in microdroplets (0.25-0.5 pl). Protoplasts are generally cultured in suspension or drop cultures (11, by the plating technique (21, or in microculture chambers (3). 1. About 2 ml of the nutrient medium containing protoplasts at a density of 1 x 105/ml is placed in 25-50-ml Erlenmeyer flasks (Eriksson and Jonasson, 1969; Vasil and Vasil, 1974). The flasks may or may not be shaken a t a low speed. Kao et al. (1971) developed a n important modification of the suspension culture technique, called the liquid droplet method, which has been used very successfully (Gamborg and Wetter, 1975). Several 50-pl drops of the protoplast suspension are placed in plastic petri dishes, which are then sealed and incubated. 2. Protoplasts suspended in a liquid medium are mixed gently but quickly with an equal amount of medium prepared in agar and kept a t about 45°C. Small aliquots of the medium are then poured into petri dishes, sealed, and incubated. Several minor modifications of this procedure are also common. 3 . A droplet of about 30 pl of the nutrient medium, containing one to several protoplasts, is placed on a microscope slide and is enclosed by a cover glass resting on two other cover glasses placed on either side of the drop (Vasil and Vasil, 1973; Durand et al., 1973; Abo El-Nil and Hildebrandt, 1976). Single protoplasts have also been cultured in Cup-
PLANT TISSUE CULTURES
155
rak dishes (Kao, 1977; Gleba, 1978). This procedure is especially useful for closely observing the growth of the protoplasts during their culture. The first visible signs of growth in protoplasts are a rearrangement of most of the cell organelles that become concentrated around the nucleus and the formation of a new cell wall resulting in the loss of the characteristic spherical shape of the protoplasts. Synthesis and deposition of cellulosic microfibrils appears to start within minutes of protoplast isolation and culture (Willison and Cocking, 1975; Williamson et al., 1977). Although protoplasts have provided an excellent system to study cell wall biosynthesis, it is still not known which of the cellular organelles are specifically involved in the synthesis of the microfibrils and their partially oriented deposition on the surface of the plasmalemma. The first mitotic division in the reorganized cell takes place after 2-7 days of culture. It has been noted that protoplasts isolated from differentiated cells, like the mesophyll cells of leaves, which do not divide in nature, take longer to undergo the first division than those isolated from cells dividing rapidly in tissue cultures (Vasil and Vasil, 1974). Multicellular clumps or colonies are formed within 1-3 weeks in culture, and these can either be further subcultured as callus tissues, or transferred to nutrient media with special supplements of auxins and cytokinins to obtain shoot and plantlet formation. The first plants regenerated from isolated protoplasts in culture were those of Nicotiana tabacum (Takebe et al., 1971; Nagata and Takebe, 1971). As shown in Tables 3 and 4, sustained cell divisions in cultured protoplasts leading to callus or plantlet formation have now been achieved in several species, enough to demonstrate the totipotency of cultured even sustained protoplasts. The number of species in which plants-r cell divisions-can be obtained is still very limited, and major efforts are needed to expand this list to include a wider variety of plants, particularly important crop plant species belonging to the cereals and the legumes.
B. FUSIONOF PROTOPLASTS AND SOMATIC HYBRIDIZATION The current widespread interest in plant protoplast research is based on the demonstration that higher plant protoplasts, like their cells (Vasil and Vasil, 1972), are totipotent (Takebe et al., 1971), and that they can be induced to fuse with each other, can take up macromolecules, whole-cell organelles, and microorganisms like bacteria (Vasil, 1976). These attributes make plant protoplasts an ideal system for studies of somatic cell genetics and in developing parasexual methods for the genetic improvement of plants. Although the fusion of mechanically isolated protoplasts has been
156
INDRA K. VASIL
et al.
TABLE 3 Species in Which Sustained Cell Divisions Have Been Reported in Cultured Protoplasts Species
Ammi visnaga Antirrhinum majus Arabidopsis thaliana Brassica oleracea var. acephala Catharanthus roseus Cicer arietinum Citrus sinensis Cucumis sativus Geranium Glycine m a Gossypium hirsutum Haplopappus gracilis Hordeum vulgare Hyoscyarnus niger Linum usitatissimum Lycopersicon esculentum Lycopersicon peruvianum Medicago sativa Melilotus alba Nicotiana acuminata Nicotiana alata Nicotiana glauca Nicotiana langsdorffii Nicotiana longiflora Nicotiana noctiflora Nicotiana paniculata Nicotiana sylvestris Oryza sativa Pennisetum americanum Pharbitis nil Phaseolus vulgaris Pisum sativum Saccharum Solan um tuberosum Vicia faba Vicia hajastana Vicia narbonensis Vigna sinensis Zea mays
References Gamborg et al., 1974b Poirier-Hamon et al., 1974 Gamborg and Miller, 1973 Gatenby and Cocking, 1977 Koblitz, 1975 Gamborg et al., 1974b Vardi et al., 1975 Coutts and Wood, 1975 Abo El-Nil and Hildebrandt, 1976 Kao et al., 1970 Bhojwani et al., 1977 Kao et al., 1971 Koblitz, 1976 Kohlenbach and Bohnke, 1975 Gamborg et al., 197415 Zapata et al., 1977 Zapata et al., 1977 Gamborg et al., 1974b Gamborg et al., 1974b Chupeau et al., 1974 Chupeau et al., 1974 Chupeau et al., 1974 Chupeau et al., 1974 Chupeau et al., 1974 Chupeau et al., 1974 Chupeau et al., 1974 Chupeau et al., 1974 Anonymous, 1975b; Deka and Sen, 1976 Vasil and Vasil, 1979 Messerschmidt, 1974 Pelcher et al., 1974 Constabel et al., 1973; Gamborg et al., 1975 Maretzki and Nickell, 1973 Upadhya, 1975 Binding and Nehls, 1978 Gamborg et al., 1974b Donn, 1978 Davey et al., 1974; Gamborg et al., 197413 Potrykus et al., 1977
157
PLANT TISSUE CULTURE:
TABLE 4 Species in Which Plant Regeneration Has Been Achieved from Cultured Protoplasts Species Asparagus officinalis Atropa belladonna Brassica napus Brassica napus (haploid) Bromus intermis Datura mete1 (haploid and diploid) Datura meteloides (haploid and diploid) Datura innoxia (haploid and diploid) Daucus carota Nicotiana alata (haploid) Nicotiana debneyi Nicotiana langsdorffi Nicotiana otophora Nicotiana sylvestris N . sylvestris x N . otophora (F, hybrid) Nicotiana tabacum N . tabacum x N . otophora (F, hybrid) Nicotiana tabacum (haploid) Petunia axillaris Petunia hybrida Petunia hybrida (haploid) Petunia hybrida (cytoplasmic male sterile) Petunia hybrida x P. parodii (hybrid) Petunia inflata Petunia parodii Petunia parviflora Petunia uiolacea Ranunculus sceleratus Solanum dulcamara Salanum tuberosum
References Bui-Dang-Ha and Mackenzie, 1973 Gosch et al., 1975 Kartha et al., 1974d Thomas et a1 ., 1976 Kao et al., 1973 Schieder, 1977a Schieder, 1977a Schieder, 1975 Grambow et al., 1972; Dudits et al., 1976b Bourgin and Missonier, 1978 H. H. Smith (personal communication) H. H. Smith (personal communication) Banks and Evans, 1976 Bourgin et al., 1976; Nagy and Maliga, 1976; Banks and Evans, 1976 Banks and Evans, 1976 Takebe et al., 1971; Nigata and Tabeke, 1971 Banks and Evans, 1976 Ohyama and Nitsch, 1972 Power et al., 1976a Durand et al., 1973; Frearson et al., 1973; Vasil and Vasil, 1974; Power et al., 1976a Binding, 1974 Vasil and Vasil, 1974 Power et al., 1976b Power et al., 1976a Hayward and Power, 1975 Sink and Power, 1977 Power et al., 1976a Dorion et al., 1975 Binding and Nehls, 1977 Shepard and Totten, 1977
known since 1909 (Kuster, 1909), these fusions were uncontrolled, rare, and generally nonreproducible (Michel, 1937; Hofmeister, 1954). Spontaneous fusion of two or more adjoining protoplasts is common during the enzymic isolation of protoplasts owing to the expansion of their common plasmodesmatal connections (Power et al., 1970; Withers and Cocking, 19721, but these fusion bodies do not develop much further and are of little or no practical use. Similar spontaneous fusion is also very common during preparation of protoplasts from meiocytes (Ito, 1973; Ito and Maeda, 1973).
158
INDRA K. VASIL
et al.
Induced inter- and intraspecific fusion of protoplasts was first achieved by Power et al. (19701, following treatment with sodium nitrate. Later studies have shown that sodium nitrate-induced fusions are generally limited to protoplasts with near-identical osmotic characteristics, and that it has adverse effects on the viability of protoplasts and at best produces fusions in a very limited number of protoplasts (Potrykus, 197313; Burgess and Fleming, 1974; Melchers and Labib, 1974; Vasil, 1976; Melchers, 1977a). It became necessary, therefore, to develop methods that would ensure high fusion frequencies. Keller and Melchers (1973) obtained fusion frequencies of more than 25% by incubating protoplasts in nutrient media containing high concentrations of Ca2+a t high temperatures (37°C) and in a highly alkaline environment (pH 10.5). A very important and effective procedure for the agglutination of protoplasts with the aid of high molecular weight polyethylene glycol (PEG), and fusion following the elution and/or dilution of PEG from the incubation medium, was described by Kao and Michayluk (19741, Constabel and Kao (19741, and Wallin et al. (1974). The fusion treatment must follow immediately after the removal of the protoplasts from the enzyme solution for maximum agglutination and fusion, as cell wall regeneration occurs very rapidly. PEG-induced fusion is nonspecific, and fusion frequencies of up to 100% have been obtained (Kao et al., 1974; Vasil et al., 1975). It is applicable, therefore, for both inter- and intraspecific protoplast fusions. Fusion of plant protoplasts with animal cells has also been ; et al., 1976; Willis et al., achieved with PEG (Dudits et al., 1 9 7 6 ~Jones 19771, as well as yeast protoplasts with hen erythrocytes (Ahkong et al., 1975), and animal cells with each other without the aid of Sendai virus (Pontecorvo, 1975a,b; Davidson and Gerald, 1976, 1977; Maul et al., 1976; Wacker and Kaul, 1977). A combination of the high Ca2+,high temperature, and high pH method of Keller and Melchers (19731, and the PEG procedure of Kao and Michayluk (19741, may give the best results, as it not only ensures high fusion frequencies, but also improves the survival of the fusion products (Burgess and Fleming, 1974; Kao et al., 1974; Wallin et al., 1974). It should now be possible, with the above procedure, to fuse protoplasts of any two higher plant species, irrespective of their taxonomic relationships. Large coenocytic clumps are often formed by the fusion of several protoplasts during induced fusion. This problem can be nearly eliminated by a careful control of the molecular weight and concentration of PEG used, the duration and temperature of fusion treatment, the pH of the fusion mixture, and protoplast density. In fusion experiments involving protoplasts from two different species, five different types of protoplasts are found a t the end of the fusion treatment: unfused protoplasts of both the parental species, fusion products of genetically
PLANT TISSUE CULTURES
159
identical protoplasts (homokaryotic fusions), and fusion products of protoplasts belonging to the two different species (heterokaryotic fusions). By chance alone, fusion of genetically diverse protoplasts should be fairly common, and 3550% heterokaryotic fusions have been reported following PEG treatment (Kao et al., 1974; Vasil et al., 1975; Vasil, 1976). Nuclear fusion and formation of true hybrid cells in most such experiments is at best an infrequent event and does not necessarily follow protoplast fusion. Unfortunately, so far no methods are known that will induce or enhance nuclear fusion in the heterokaryons. However, nuclear fusion with true hybrid cell and plant formation following heterokaryotic protoplast fusions has been conclusively demonstrated in several species (Table 5). Cells with fused hybrid nuclei have been reported by Kao et al. (1974), Kartha et al. (1974b1, Constabel et al. (1975), Constabel (19761, Dudits et al. (1976a1, Gosch and Reinert (19761, Reinert and Gosch (19761, and Kao (1977). In several cases there is strong evidence that selective elimination of chromosomes of one of the parental species takes place from heterokaryons as well as from the true hybrid cells during cell division and tissue formation (Power et al., 1975; Constabel, 1976; Kao, 1977). Kao (1977) has studied chromosomal behavior in somatic hybrid callus tissues obtained by the fusion of soybean and Nicotiana glauca protoplasts. Chromosomes of N. glauca, which had a tendency to stick together and break into pieces, were randomly lost from the hybrid tissues. Some of the N. glauca chromosomes were still present in the hybrid tissue after 6-7 months of culturing (Kao, 1977; Wetter, 1977). No plants were regenerated from these tissues. Stabilization of only a few chromosomes from one of the parents in hybrid tissues following protoplast fusion may be a more realistic approach to somatic hybridization and will certainly be of advantage in chromosome mapping in higher plants. The formation of true hybrid cells does not assure the recovery of hybrid tissues and plants, for it is generally the unfused protoplasts of both the parental species, as well as the homokaryotic fusion products, that grow vigorously, and the few viable hybrid cells and their products are soon lost. Recovery of hybrid cells from cultures growing on normal nutrient media is highly unlikely. Selective nutrient media, which would favor the hybrid products or preferentially allow the growth of only the hybrid cells, would assure their recovery. Unfortunately, selective media or methods to recover hybrid cells from plant tissue cultures are known in only a few instances, in contrast to their extensive use in the recovery of animal somatic cell hybrids. The paucity of proper selective methods for the growth and recovery of plant somatic cell hybrids is perhaps the single most important factor limiting the progress of efforts to produce somatic hybrids in plants.
160
INDRA K. VASIL
et al.
TABLE 5 Plants in Which Somatic Hybrids Have Been Produced through Protoplast Species
References
Datura innoxia + D. innoxia Datura innoxia t D. discolor* D. innoxia + D. stramonium* Daucus carota t D. capillifolius Daucus carota + Aegopodium podagraria* Nicotiana glauca + N . langsdorffii
Schieder, 1977b Schieder, 1978 Schieder, 1978 Dudits et al., 1977 D. Dudits, personal communication Carlson et al., 1972; H. H. Smith et al., 1976 Maliga et al., 1977 Melchers, 1977b Melchers and Labib, 1974; Gleba et al., 1975a; Glimelius et al., 1978 Power et al., 19761, G. Melchers, personal communication
Nicotiana sylvestris + N . knightiana* Nicotiana tabacum + N . sylvestris Nicotiana tabacum t N . tabacum Petunia hybrida t P. parodii Solanum tuberosum + Lycopersicon lycopersicum*
“ Sexual hybrids are known in all the above combinations, except those marked (*), which are presumed to be sexually incompatible. * A somatic hybrid between two genetic strains of the liverwort, Spaerocarpos donnellii, was recovered following protoplast fusion by Schieder (1974). Somatic hybrids of Penicillium roquefortii + P. chrysogenum (Anne et al., 1976) and Physcomitrella patens (Grimsley et al., 1977) have also been obtained through protoplast fusion. The rare instances where such selective methods are available have indeed been used successfully and elegantly to produce somatic hybrids (Table 5). The first successful attempt to produce somatic hybrids in higher plants was made by Carlson et al. (1972). They fused mesophyll protoplasts from the leaves of Nicotiana glauca with those from N . langsdorffii by treatment with a 0.25 M solution of sodium nitrate for 30 minutes, and reported a fusion frequency of about 25%. After the fusion treatment, the protoplasts were washed and plated on the hormone-supplemented regeneration medium used by Nagata and Takebe (1971). “In the Nagata and Takebe medium, protoplasts of N . glauca and N . langsdorffii will regenerate a cell wall and occasionally go through one division cycle. Protoplasts of these two species were never observed to regenerate into a callus. Protoplasts of the amphiploid hybrid react similarly; however, about 0.01% of the protoplasts will continue to divide and give rise to a callus mass of cells” (Carlson et al., 1972). This difference in the growth characteristics of the protoplasts from the two parental species and the hybrid protoplasts served as the first selection screen that allowed the preferential growth of only the hybrid cells. The regenerated calli were later transferred to a
PLANT TISSUE CULTURES
161
modification of the Murashige and Skoog (1962) medium, without hormones. This provided a further selective screen to eliminate parental tissues, which are known not to be able to grow in uitro in the absence of exogenously supplied hormones, while the tissues of the amphiploid hybrid have long been shown to grow vigorously without any added hormones. Finally, hybrid plants regenerated from the hybrid calli were uniformly the same as the amphiploid in morphological characters. Seeds were obtained from one parasexual hybrid, and this was shown to have a 2n chromosome number of 42, which would be expected from the addition of 24 chromosomes of N . glauca with 18 chromosomes of N . langsdorffii. Criticism of the above report has centered around the fact that sodium nitrate has never been known to produce the high degree of fusion events claimed by Carlson et al. (19721, particularly in mesophyll protoplasts, and that an analysis of the fraction I protein (ribulose 1,5-diphosphate carboxylase/oxygenase) isolated from the leaves of the parasexual hybrid plants exhibits a composition that would normally not be expected in a somatic hybrid produced by protoplast fusion (Melchers and Labib, 1974; Vasil, 1976). The fraction I protein of a typical somatic hybrid should contain the small (coded by nuclear genes) as well as the large (coded by chloroplast DNA) subunit polypeptides of both the parents. Kung et al. (1975) found that the fraction I protein obtained from the parasexual hybrid plants contained the small subunit polypeptides of both the parents, but the large subunit polypeptides of only N . glauca. This means that in the hybrid leaves nuclear genes of both the parents are coding for the small subunit of fraction I protein, but that chloroplast DNA of only N . glauca-but not N . langsdorffii-is coding for the large subunit. As suggested by Vasil(1976), one would normally expect such a composition pattern in a sexual hybrid of N . glauca (female parent; nuclear as well as chloroplast genes will be expressed) and N . langsdorffii (male parent; only nuclear genes will be expressed, as there is no transfer of plastids during fertilization). “It is also conceivable that only one chloroplast genome can express itself in a hybrid cytoplasm derived from the fusion of two protoplasts” (Vasil, 1976). If so, it should be further investigated “whether the expression of only one of the parental chloroplast genomes is a general phenomenon, and, if so, whether there is an equal chance that the chloroplasts will be of N . glauca or the N. langsdorffii type” (Kung et al., 1975). Chen et al. (1977) have further examined this question by studying the polypeptide pattern of fraction I protein from sixteen different parasexual hybrids of Nicotiana glauca ( G )and N. langsdorffii (L). “Fourteen of the hybrids displayed the large subunit electrofocusing pattern characteristic of
162
INDRA K. VASIL
et al.
only one parent (8L, 6G). From one hybrid callus two plants were regenerated of which one was exclusively L-type large subunit, the other was exclusively G. A single plant retained a mixture of L and G chloroplast DNA’s” (Chenet al., 1977; H. H. Smith, personal communication). Thus, there appears to be a rapid and indiscriminate sorting out of chloroplasts so that for the most part, the mature parasexual hybrids contain only one (either one) of the parental chloroplast DNAs. The mechanism or basis of this sorting out remains to be understood and explained. H. H. Smith et al. (1976) recently successfully repeated the experiments of Carlson et al. (19721, but, significantly, by using the much more reliable and effective PEG fusion procedure and a complex nutrient medium that contains not only auxins and a cytokinin, but the much more potent and chemically undefined coconut milk. They also employed the two-step selective screening method of Carlson et al. (1972) to recover hybrid cell colonies after the fusion treatment and reported that “both parental and hybrid protoplasts will grow in the fully supplemented M2 medium, but the hybrid colonies develop more rapidly” (H. H. Smith et al., 19761, in contrast to the earlier report where unfused parental protoplasts were reported to “occasionally go through one division cycle” and “were never observed to regenerate into a callus” (Carlson et al., 1972). Perhaps the most important aspect of the report by H. H. Smith et al. (1976) is the high and variable chromosome number exhibited by their somatic hybrids-a 2n number varying from 56 to 64-as opposed to the 2n = 42 reported by Carlson et al. (1972). The higher and variable number of chromosomes found by H. H. Smith et al. (1976) suggests that most of their hybrids are the result of triple fusions, involving two N . langsdorffii and one N . glauca (60 chromosomes), or two N . glauca and one N . langsdorffii (66 chromosomes), protoplasts. They interpreted their results to suggest that the prolonged proliferation of the hybrid cells in culture caused the loss of chromosomes and the resultant aneuploid condition (a fairly common phenomenon in plant tissue cultures), giving rise to plants with fewer than 60 or 66 chromosomes, and that the hybrid tissues of such triple hybrids or their aneuploid derivatives are more successful than others in yielding viable and differentiated cultures that produce mature plants. Dudits et ul. (197613) also reported a higher frequency of the occurrence of tetraploids and hexaploids among carrot plants regenerated from protoplasts following PEG-induced fusion. Melchers and Labib (1974) fused protoplasts of two haploid, chlorophyll-deficient, light-sensitive varieties of Nicotiana tabacum and, taking advantage of genetic complementation in the hybrid protoplasts, selectively recovered somatic hybrids that are resistant to high light intensities and have normal green leaves. Gleba et al.
PLANT TISSUE CULTURES
163
(1975a) also obtained somatic hybrids between two varieties of N . tabacum, using a very similar system. Recently, Power et al. (1976b) have produced a somatic hybrid between Petunia hybrida and P . parodii. They also used a complementation-selection procedure based on the observation that in MurashigsSkoog nutrient medium the leaf protoplasts of P. parodii form only small cell colonies whereas those of P. hybrida produce a callus tissue, and that the protoplasts of the two species show a natural differential sensitivity to actinomycin D. The leaf protoplasts of the two species were induced to fuse with the aid of PEG, and then cultured in a liquid-over-agar medium containing actinomycin D, which completely inhibits the growth of P. hybrida protoplasts, but allows P. parodii protoplasts to form small cell colonies. The hybrid protoplasts, however, are able to grow and form callus tissue as they are protected from actinomycin D by complementation. Later the callus tissue is transferred to a medium favoring organogenesis, resulting in the formation of hybrid plants. It should be pointed out that in all the above cases where somatic hybrids have been obtained by protoplast fusion, sexual hybrids are also known. Therefore, these examples serve as important model systems to demonstrate the feasibility of somatic hybridization and to emphasize the value of proper selection methods to recover preferentially hybrid cells from mixed populations. The absolute requirement for sensitive and powerful selection methods for somatic hybridization has encouraged research aimed a t isolating mutant cell lines that are auxotrophs, temperature- or light-sensitive, analog- or drug-resistant, etc. (Carlson, 1970,1973~; Bindinget al., 1970; Binding, 1972b; Dulieu, 1972, 1974, 1975; Widholm, 1972, 1974a,b, 1976, 1977; Lescure, 1973; Maliga et al., 1973a,b, 1975; Bright and Northcote, 1974, 1975; Chaleff and Carlson, 1974; Cocking et al., 1974; Ohyama, 1974; Marton and Maliga, 1975; Dix and Street, 1975; Palmer and Widholm, 1975; Redei, 1975; Gathercole and Street, 1976; Schieder, 1976a,b; Sung, 1976; Zyrd, 1976; Kandra and Maliga, 1977; Polacco and Polacco, 1977; Muller and Grafe, 1978)? The usefulness of such cell lines in developing workable selection methods for the preferential growth of somatic hybrid cells has been demonstrated recently by Glimelius et al. (1978) and White and Vasil (1978). *Tissue cultures are also being used to select cell lines that are resistant to toxins produced by plant pathogens (Gengenbach and Green, 1975), herbicides (Oswald et al., 1977b), etc. Regeneration of plants from such resistant cell lines can be of much use in practical agriculture. Gengenbach et al. (1977) have regenerated maize plants resistant to the toxin produced by Helminthosporium maydis. This was achieved by selecting resistant cell lines from callus cultures initiated from immature embryos of maize that were susceptible to the toxin.
164
INDRA K. VASIL
et al.
C. PROTOPLASTS AS TOOLS FOR THE TRANSFER OF CELLORGANELLES OR MICROORGANISMS Some of the early physiological and electron microscopic studies of protoplasts have provided elegant and substantive demonstration of the uptake of ferritin, polystyrene latex spheres, tobacco mosaic virus particles, etc., by isolated protoplasts (Mayo and Cocking, 1969; Aoki and Takebe, 1969; Takebe and Otsuki, 1969; Power and Cocking, 1970; Vasil, 1976; Suzuki et al., 1977). In most of these cases uptake seems to take place through pinocytosis. It is not surprising, therefore, that many attempts are being made to introduce isolated cell organelles or whole microorganisms into protoplasts in order to modify the information content of the recipient cells. If successful, the transfer of viable and metabolically functional cell organelles into foreign cytoplasm would provide an excellent system to study the development, behavior, and activity of cell organelles and, most important, for understanding the problems of organelle totipotency and nucleocytoplasmic interactions and inheritance. Intraspecific transfer of chloroplasts into protoplasts was first claimed by Potrykus (1973a,b) in Petunia hybrida. He combined treatments with lysozyme o r sodium nitrate and mild centrifugation to “introduce” the chloroplasts into the protoplasts, but no convincing evidence-apart from hazy light microscope photographs-was provided to demonstrate that the chloroplasts were actually inside the protoplast cytoplasm. At about the same time, Carlson (1973a,b) not only claimed to have transferred chloroplasts isolated from a wild-type (green) tobacco into the protoplasts of an albino mutant of tobacco, but also to have regenerated whole green plants from such protoplasts. The reports by Carlson are sketchy and provide no details of the experimental procedures used. His claim has been seriously disputed by many workers because no suitable methods are yet known to isolate photosynthetically active chloroplasts from tobacco leaves, because uptake of chloroplasts has repeatedly been shown to take place only after exposure of the chloroplast-protoplast mixture to inducing agents like PEG, because no convincing evidence o f chloroplast uptake was provided, and also because normal green plants can be regenerated from apparently albino protoplasts (Potrykus, 1973a,b, 1975; Bonnett and Eriksson, 1974; Davey et a l. , 1976; Giles, 1976; Vasil, 1976). In a recent report, Kung et al. (1975) have again claimed to have transferred isolated chloroplasts of Nicotiana suaveolens into the protoplasts of N . tabacum, and regenerated whole plants that apparently contain the nuclear as well as the chloroplast DNA of N . suaueolens along with those o f N . tabacum. Bonnett and Eriksson (1974) achieved a high frequency of algal (Vaucheria dichotoma) chloroplast uptake by
PLANT TISSUE CULTURES
165
carrot protoplasts following treatment with PEG; similar PEG-induced uptake of Petunia hybrida chloroplasts into the protoplasts of Parthenocissus tricuspidata has been shown by Davey et al. (1976). The methods employed for the isolation of chloroplasts in most of the above reports make it highly unlikely that viable and photosynthetically active chloroplasts were used for the transfer experiments. “The chloroplast preparations were more likely suspensions of fine, inert ‘particles’ ” (Vasil, 1976), and their uptake-like that of polystyrene latex spheres, etc.-would not be surprising. In addition, in most of the above cases the number of chloroplasts transplanted as well as the proportion of protoplasts taking up chloroplasts was rather low, and no definitive ultrastructural evidence was provided to establish actual chloroplast transfer, except in the recent reports of Bonnett (1976) and Davey et al. (1976). Earlier, Vasil and Giles (19751, used protoplasts from the slime strain of Neurospora crassa for the successful, PEG-mediated, transfer of spinach chloroplasts. Their chloroplast preparations were shown to have normal photosynthetic activity at least until the time of uptake. They also showed that almost 50% of the Neurospora protoplasts took up one or more spinach chloroplasts, and in some cases the number of chloroplasts transferred to a single protoplast was well over 40. Ultrastructural evidence for the uptake of chloroplasts by the fungal protoplasts was provided, which showed that the chloroplasts retained their structural integrity within the fungal cytoplasm, and that they were not enclosed in any extra membranous vesicle as would be normally expected after pinocytotic uptake. The presence of a pinocytotic vesicle formed by the plasmalemma of the host protoplast around the transplanted chloroplasts or other structures (Davey and Power, 1975; Bonnett, 1976; Davey et al., 19761, or the absence of such a membranous vesicle as shown in Neurospora (Vasil and Giles, 1975), indicate either that more than one process is involved in the uptake of these structures or that the membranous vesicle is readily digested by the host cytoplasm. The isolation of photosynthetically active chloroplast preparations from leaf tissues has proved to be rather difficult in most species. The demonstration that chloroplasts isolated from protoplasts by forcing the latter through nylon sieves of appropriate pore size remain viable and photosynthetically active points to a simplified approach to isolating chloroplasts from a variety of plant species (Edwards et al., 1976; Nishimura et al., 1976; Rathnam and Edwards, 1976). It is also interesting to note that nuclei isolated from protoplasts are 10- to 100fold more active in transcription activity than nuclear preparations obtained through conventional mechanical procedures (Blaschek et al., 1974).
166
INDRA K. VASIL
et al.
As pointed out by Vasil and Vasil (1974), and Vasil (19761, the transfer of mitochondria and/or chloroplasts isolated from cytoplasmic male sterile plants (corn, petunia, flax, etc.) into protoplasts of normal, male fertile plants, and regeneration of plants from such protoplasts can help to determine the site of “genes” controlling cytoplasmic male sterility. Transfer of isolated nuclei (Potrykus and Hoffmann, 1973) and of whole bacterial, yeast, or algal cells (Davey and Power, 1975) into protoplasts has also been reported. No convincing evidence of nuclear transfer has yet been provided, nor is there any indication that the nuclei or the bacterial, yeast, and algal cells used for transplantation were viable and active. Experiments involving transplantation of cell organelles into protoplasts will be meaningful only if the transplanted organelles not only survive in the foreign cytoplasm, but also multiply in number and continue to perform their normal biological functions. Thus, although it is known that chloroplasts would photosynthesize and survive for a limited period of time in “alien” environments, serious doubts still remain about the extent of the genetic autonomy of chloroplasts, mitochondria, etc. (Givan and Leech, 1971; Tewari, 1971; Giles and Sarafis, 1972; Trench, 1975; Giles, 1976; Kung, 1977). V. Direct Transformation by Exogenous DNA
Many attempts have been made in recent years to transform higher plant cells by direct incorporation of foreign DNA. “In order for transformation to take place, it is not only necessary that the foreign DNA be taken up and survive in the host cells, but also that it be expressed through transcription and translation in its new environment, be integrated into the host genome and finally, be replicated in the transformed host cells” (Vasil, 1976). According to these criteria, the claims of transformation in experiments using intact cells, seeds, seedlings, or whole plants (Ledoux et al., 1971, 1975; Hess, 1972a,b, 1977; Hess et al., 19761, cannot be substantiated. A reinvestigation of many of the above reports shows them to be ill-founded (Kleinhofs et al., 1975; Lurquin and Behki, 1975; Lurquin and Hotta, 1975; Cocking, 1977a,b). In other instances of transformation described by Hess (1972a,b, 1977) and Hess et al. (19761, the effects appear to be nonspecific, or can be explained on the basis of spontaneous somatic mutations (Bianchi and Walet-Foederer, 1974; Cocking, 1977a,b; Kleinhofs and Behki, 1977). In experiments where DNA has to enter intact cells, it is suspected that a major portion of it is degraded owing to high DNase activity in the cellular environment (Holl, 1973; Cocking, 1973). The wall-less
PLANT TISSUE CULTURES
,167
protoplasts may, therefore, be of advantage in DNA uptake studies. There are thus several recent reports of the uptake and partial survival of bacterial and higher plant DNA in protoplasts (Ohyama et al., 1972, 1973; Hoffmann, 1973; Hoffmann and Hess, 1973; Holl et al., 1974; Gleba et al., 1975b; Suzuki and Takebe, 1976; Uchimiya and Murashige, 1977; Hughes et al., 1978b),but the fate of the DNA within the protoplasts is largely unknown, although it has been claimed on the basis of light microscopic examination that some of it is located in the nuclear region (Hoffmann, 1973; Hoffmann and Hess, 1973). There is some evidence to indicate that the surviving DNA is either in the nuclear environment or adsorbed on the outer nuclear membrane. Recently, Suzuki and Takebe (1976) have reported on the uptake and partial preservation of single-stranded fd bacteriophage DNA in tobacco protoplasts; after uptake a portion of the DNA was recovered from the cytoplasmic fraction of protoplast homogenate. Using specialized transducing phages, Doy et al. (1973) reported the transfer and subsequent expression of three systems of genes from the bacterium Escherichia coli in pollen-derived haploid tissue cultures of Arabidopsis thaliana and Lycopersicon esculentum. NO claim for the inheritance of the bacterial genes was made. As the mechanisms of the transfer and maintenance in this system are still obscure, they used the term “transgenosis” to differentiate their observations from the more established and better understood phenomena like transformation in bacteria. We feel that a better approach to direct transformation by incorporation of foreign DNA would be to use highly purified and defined DNA fractions, phages, plasmids (see Section VI), or plant DNA viruses. Encouraging steps in this direction are the recent reports of cleavage of plant chromosomes by restriction endonucleases (Subrahmanyam et al., 1976), and the insertion of Escherichia coli plasmid pBR313 DNA into mesophyll protoplasts of cowpea by Lurquin and Kado (1977). The latter indicate that the double-stranded covalently closed circular DNA becomes associated with nuclei within the protoplasts, and “suggest that plant protoplasts might represent a good recipient system for t,he study of the biological effects of homologous or heterologous DNA sequences recombined in uitro with plasmid DNA as a molecular vector” (Lurquin and Kado, 1977). Plant protoplasts have proved to be a n excellent system to simultaneously infect large populations of cells with plant viruses without the danger of secondary infection and to study virus replication (Zaitlin and Beachy, 1974; Takebe, 1975; Vasil, 1976). The suitability of plant viruses that contain RNA to infect protoplasts under controlled experimental conditions suggests that similar attempts be made to use DNA-containing plant viruses, for example, cauliflower mosaic virus,
168
INDRA K. VASIL
et al.
as a vector for the transfer of foreign DNA into higher plant cells (Shepherd et al., 1968; Sarkar, 1976; Goodman, 1977; Szeto et al., 1977). The appearance of two phage-specific enzymes has been reported in protoplasts of Hordeum uulgare exposed to bacteriophage T3 (Carlson, 1973a). Details of the experimental procedures used were not provided by the author, but, if confirmed, the results would provide convincing evidence that bacteriophage genes can be transcribed and translated in higher plant cells. So far the attempts a t the direct transformation of higher plant cells through the uptake of foreign DNA have been almost totally disappointing (Vasil, 1976; Cocking, 1977a,b). The development of recombinant DNA technology, which is being successfully used in the transformation of bacteria, is encouraging and could be usefully applied to higher plants through protoplasts. However, one should be fully aware of the inherent risks and dangers involved in the use of recombinant DNA techniques and of the governmental and self-imposed regulation of recombinant DNA research. VI. Tissue Cultures and Nitrogen Fixation
It is generally agreed that one of the most important factors in increasing the yield of agronomic crops is the availability of fixed nitrogen, the supply of which is almost totally dependent on two sources. The principal biological source of fixed nitrogen is through the symbiotic association of Rhizobium and leguminous plants. The other major source is synthetic fertilizers, which require a high initial input of energy and have lately been too expensive owing to astronomical increases in the price of basic raw materials used in their production. The above reasons and the fact that total world supply of food myst be increased radically to meet the growing demands of the rapidly increasing human population have stimulated much thought and activity aimed at finding alternative-and relatively inexpensive-sources of fixed nitrogen (Hardy and Havelka, 1975; Newton and Nyman, 1976; Vasil, 1976; Evans and Barber, 1977). A priori the most economical, and experimentally and biologically the most promising, approach to achieving an impressive increase in the quantum of readily available fixed nitrogen would be to confer on nonleguminous plants the ability to associate symbiotically with nitrogen-fixing bacteria like Rhizobium, Azotobacter, Azospirillum (also described as Spirillum), etc. Recent advances in plant tissue culture technology, and a better understanding of the biology of nitrogen fixation by bacteria of the genus Rhizobium, have made plant tissue
PLANT TISSUE CULTURES
169
culture systems an important and indispensable experimental tool in attempts to achieve the above goals. In the development of a natural symbiotic association between Rhizobium and legumes, the bacteria enter the plant through root hairs, finally reside in the cortical tissues of the root, and induce cell divisions resulting in formation of the familiar root nodules. For several decades it has been an accepted dogma that free-living rhizobiadissociated from the leguminous host plant-do not fix nitrogen. Furthermore, that a structural and/or biochemical modification of the bacterium must take place within the host cells prior to the initiation of nitrogen fixation, and finally that a part of the nitrogenase system in legume root nodules might be specified by legume DNA or that a factor contributed by the host plant elicits the expression of nitrogenase genes. The first report of experimentally induced association of Rhizobium japonicum with cultured cells was published in 1971 by Holsten et al., who used tissue cultures derived from soybean (a legume) roots as the host tissue. This initial observation was confirmed by Child and LaRue (19741, and Phillips (1974), who also used soybean tissue cultures. Two important and trend-setting reports were published early in 1975, by Child in Canada, and by Scowcroft and Gibson from Australia, which elegantly demonstrated that effective, nitrogen-fixing associations of Rhizobium can also be established in tissue cultures of nonleguminous plants, like bromegrass, tobacco, rapeseed, and wheat. The bacteria were generally observed to grow on the surface of the callus tissues or in cracks and intercellular spaces, but no bacteria were detected in intact or viable cells. It was also shown that bacteria present in the close vicinity of, but not in direct contact with, the host tissue (legume as well as nonlegume) also fixed nitrogen. These observations helped to dispel one of the dogmas listed above, namely, that rhizobia will form nitrogen-fixing symbiotic associations only with legumes. In addition, they conclusively showed that any host-produced factors involved in the induction of nitrogenase activity are diffusible and common to legumes and nonlegumes; furthermore, that the species barriers in nitrogen fixation are at the stages of infection and nodule formation rather than in the expression of nitrogenase. The fact that a diffusible factor, common to legumes and nonlegumes, will initiate nitrogenase activity in free-living Rhizobium strongly indicates that it may be possible to extend rhizobial symbiosis to nonleguminous plants. Another milestone in understanding the biology of nitrogen fixation by rhizobia was the demonstration of nitrogenase activity in pure cultures ofRhizobium grown on completely defined media (Keister, 1975; Kurz and LaRue, 1975; McComb et al. , 1975; Pagan et al., 1975; Tjepkema and Evans, 1975), directly establishing that all the genes necessary for nitrogenase activ-
170
INDRA K . VASIL
et al.
ity are present in the Rhizobium. This makes it even more probable that nitrogen-fixing genes from Rhizobium can be transferred to, or will function in, nonleguminous plants. A similar extracellular, forced symbiotic association, was reported by Carlson and Chaleff (1974) between Azotobacter uinelandii and carrot tissue cultures. It should be pointed out that the bacterium used in this case does not require a plant host to ~IX nitrogen. Genetic transfer of nitrogen fixation (nif) genes into bacteria that do not naturally fix nitrogen, as from Klebsiella pneumoniae to Escherichia coli (Dixonet al., 1976; Cannon and Postgate, 1976), has been reported. The possibility of transferring the nif operon from microorganisms that ~ I X nitrogen to cereals and other important food plants that do not, has also been discussed (Hardy and Havelka, 1975; Shanmugam and Valentine, 1975). These projections envisage that plasmids containing the nif operon might be introduced into the protoplasts of selected crop plants, followed by culture of the protoplasts and their regeneration into whole plants, which will ultimately carry the newly introduced genetic information in their cells as well as seeds. In this connection it should be mentioned that phage-mediated transfer of bacterial genes (operons) to higher plant cells has been previously reported (Doy et al., 1973). It is well known that oncogenic strains ofAgrobacterium tumefaciens induce the crown gall tumor in many dicotyledonous plants (Lippincott and Lippincott, 1975; Kado, 1976). There is increasing evidence now that a large plasmid-the Ti plasmid-present in tumor-inducing strains of the bacterium determines their oncogenicity, and probably a t least a part of the plasmid is transferred from the bacterium to target plant cells during induction of the crown gall (Gordon et al., 1976; Schell et al., 1976; Hooykaas et al., 1977; van Larebeke et al., 1977). Transfer of the Ti plasmid between Agrobacterium strains, and from Agrobacterium to a strain of Rhizobium trifolii has also been reported (van Larebekeet al., 1977; Hooykaaset al., 1977). In the latter case, where the Ti plasmid was transferred to Rhizobium, the bacterium gained the ability to induce tumors, but also retained its characteristic of forming nitrogen-fixing root nodules on Trifolium pratense (Hooykaas et al., 1977). Large plasmids have also been detected in various strains of Rhizobium (Nuti et al., 19771, and it has been suggested that the nif genes might be plastid-borne in Rhizobium (Dunican and Tierny, 19741, and may control the infection process with legumes. These developments have encouraged the discussion of the possibility of transferring nif genes to the Ti plasmid ofAgrobacterium and then using it to infect nonleguminous dicotyledonous plants in order to transfer the nif genes into crown gall tumor tissue (for a further discussion of this possibility, see Schell and van Montagu, 1977). Re-
PLANT TISSUE CULTURES
171
generation of plants from crown gall tumor tissues of tobacco is known (Sacristan and Melchers, 1977). Associative symbiosis of several tropical grass and cereal plant species with Azospirillum lipoferum, resulting in nitrogen fixation and increased productivity, has been reported by Day et al. (1975), von Bulow and Dobereiner (19751, Dobereiner and Day (19761, and R. L. Smith et al. (1976). Experimental work aimed at establishing and studying the biology of symbiotic association of Azospirillum with tissue cultures of higher plants has, therefore, been recently initiated a t the University of Florida. The preliminary results show that the bacterium grows in close association with the cell wall of the host cells in culture, or in the intercellular spaces, much like the growth of rhizobia in tissue cultures (Vasil et al., 19771, and that such cultures continue to grow and show appreciable rates of acetylene reduction activity on media acutely deficient in nitrogen. The experiments involve tissue cultures of sugarcane and pearl millet. In addition to attempting to establish symbiosis between Azospirillum and tissue cultures of grasses and cereals, attempts are also being made to transfer the bacterium directly into protoplasts prepared from the roots or tissue cultures of the above plant species. As described in Sections IV, B and C, it is now possible to fuse protoplasts of one plant species with another or to introduce cell organelles or whole microorganisms into protoplasts. These important characteristics of isolated plant protoplasts are also being used in a variety of experiments aimed a t conferring on nonlegume species the ability to fix nitrogen in association with various nitrogen-fixing microorganisms. Several authors have successfully fused protoplasts of legumes with nonlegumes (Kao and Michayluk, 1974; Kao et al., 1974; Kartha et al., 1974a; Kao, 1977). It has often been anticipated that hybrid plants resulting from such fusion products might be able to fix nitrogen, as well as retain other important characteristics of economic and nutritional value. There is no evidence a t the present time that viable hybrid plants can be regenerated from the fusion products of such widely diverse protoplasts, or that if such plants were formed they would contain the desirable genetic characters anticipated. Uptake of whole rhizobia by pea leaf protoplasts has been reported by Davey and Cocking (1972). The experimental conditions used in these experiments were such that survival of any viable, nitrogenfixing bacteria is highly unlikely. In contrast, Vasil et al. (1975, 1977; Vasil, 1976) enzymically isolated protoplasts from the nitrogen-fixing root nodules of Lupinus angustifolius and fused these with mesophyll protoplasts isolated from the leaves ofNicotiana tabacum with the help o f a PEG-containing fusion mixture (there is some indication that a
172
INDRA K. VASIL
et al.
part of the original cell wall may still be present around the nodule protoplasts, but this did not appear to prevent agglutination and/or fusion). The fusion products of the nodule and leaf protoplasts appeared to remain viable for several days in culture, and an ultrastructural examination of the fusion products after 2-6 days in culture did not show any evidence of cytoplasmic or organelle disintegration. No cell wall regeneration or visible signs of growth were observed in the fusion products. Vasil et al. (1975) observed acetylene reduction activity in the root nodule slices during the entire period of incubation in cell wall-degrading enzyme solutions, but were unable to demonstrate such activity in isolated nodule protoplasts. This may be owing to the fact that they measured the acetylene reduction activity of the nodule protoplasts immediately after their isolation, whereas it has been recently shown that isolated legume root nodule protoplasts show acetylene reduction activity only after a lag period of 2 days (Broughton et al., 1976). As pointed out.by Vasil (19761, the fusion of legume root nodule protoplasts with nonlegume protoplasts offers several advantages, like overcoming the difficult infection barrier, introducing the bacteria in nonlegume host cells in an active, nitrogenfixing form, and the protection of the bacteriods and their nitrogenase system within membranes of the original legume host plant, which surround them. Another possible approach to confer nitrogen-fixing ability on nonlegumes is to introduce nitrogen-fixing blue-green algae in the cells of such plants. Such a system was used by Burgoon and Bottino (19761, who transferred cells of Gloeocapsa into the protoplasts of tobacco and corn. A fact to be remembered, but often overlooked, in attempts to give nonlegumes the ability to fix nitrogen in associative symbiosis with nitrogen-fixing microorganisms is the energy requirements for nitrogen fixation uis-u-uis the total photosynthetic energy available in the host plant. Fixation of nitrogen requires large amounts of energy, and the energy output of most higher plants is rather limited. Unless the photosynthetic energy output is increased, or photorespiration is markedly reduced, the transfer of nitrogen-fixing capability to nonlegumes may not be of much use because the energy used for nitrogen fixation may actually result in lower final crop yields. All the examples described above involved no more than attempts or possible approaches for transferring nitrogen-fixing ability from a prokaryote cell to a eukaryote cell. This goal has so far not been achieved in any of these instances. It is, therefore, encouraging to conclude this section on tissue cultures and nitrogen fixation by describing a series of successful experiments recently reported by Giles and Whitehead (1975, 1976), where the transfer of nitrogen-fixing ability to a eukary-
PLANT TISSUE CULTURES
173
otic cell has in fact been accomplished. Giles and Whitehead introduced cells of nitrogen-fixing Azotobacter vinelandii, with the aid of PEG, into enzymically isolated spheroplasts (protoplasts) of the fungus Rhizopogon, which forms a mycorrhizal association with the roots of Pinus radiata. Several strains of the fungus were regenerated from treated spheroplasts and were shown not only to grow on nitrogendeficient medium, but also to reduce acetylene in the acetylene reduction assay for nitrogenase activity. No intact bacterial cells or bacterial DNA were detected in the modified forms of the fungus, which shows structurally modified mitochondria and poly-P-hydroxybutyric acid, a typical storage product of Azotobacter cysts. Giles and Whitehead (1977) have now shown that modified, L forms of bacteria are actually present in the modified strains of the fungus and are responsible for its ability to fix nitrogen. It is, therefore, clearly a fine example of forced symbiotic association. The modified fungal strains all show a peculiar pattern of acetylene reduction activity, which reaches a peak around 29 days after isolation and then gradually disappears by about 55 days. However, a renewed cycle of acetylene reduction activity appears if the fungus is transferred to fresh, nitrogen-deficient medium. In this way the acetylene-reduction activity of the modified fungal strains was maintained-albeit at successively reduced levels-for about 7 months during 6-7 transfers to fresh nutrient media. As the genetic or biochemical mechanism for the transfer of bacterial information to the fungal cells was not understood at the time of the original publication, the authors described it as another instance of transgenosis, a term coined by Doy et al. (1973) for their reported transfer of bacterial genetic information to higher plant cells. Another parallel between these two reports is the intermittent nature and the time course for the expression of nitrogenase activity in the modified fungal strains (Giles and Whitehead, 1975, 1976) and the behavior of P-galactosidase activity in transgenosed tomato cells, which also exhibited repeated peaks of activity over a period of time (Doy et al., 1973). The fact that Rhizopogon also forms a mycorrhizal association with pine roots is of significance, for if the modified, nitrogen-king strains of the fungus can also enter into such an association (such an association has now been established; K. L. Giles, personal communication), the host plant may achieve at least a degree of nitrogen sufficiency. VII. Tissue Cultures and Germ Plasm Preservation
Until about the mid 1960s only a few scientists were seriously concerned about the growing threat to the continued existence, in their natural habitats, of the world's crop plant genetic resources. Warnings
174
INDRA K. VASIL
et al.
that primitive crop varieties were gradually disappearing and were being replaced by locally selected or introduced cultivars aroused activity in the exploration, conservation, and utilization of our valuable plant genetic resources (Harlan, 1975; Wilkes, 1977). Gene banks or genetic resource centers have now been established for many crops around the world with the help and initiative of the Food and Agricultural Organization of the United Nations (Frankel and Hawkes, 1975a,b). It has become imperative to preserve and utilize the immense range of genetic variation in the wild relatives of crop plants for the future development of new cultivars. The urgency has been accentuated by the rapid utilization of all available land resources for agricultural production and industrialization, the widespread introduction of highly selected and uniform genetic strains of crop plants, and the nutritional needs of an exploding human population and industrialized society. The problem is all the more acute in view of the fact that it is considered likely that “By 1985 most of the genetic resources in their ancient centers of diversity may well have disappeared . . . consequently, unless collected and stored in gene banks or preserved in other ways, many or most of the most valuable resources will be lost forever” (Frankel and Hawkes, 1975a). Much of the work on germ plasm preservation involves the longterm storage of seeds, pollen grains, etc. (Vasil, 1962; Frankel and Hawkes, 1975b). However, plant tissue cultures also offer a potentially useful method for the long-term storage of plant genetic resources, especially in those species where seeds cannot be easily obtained or stored for long periods of time, and particularly in cultivars where vegetative propagation is essential for the maintenance of genetic stability. Two procedures are currently being developed for the long-term storage of plant tissue cultures. These are the storage and culture of excised shoot meristems (Morel, 1975), and the freeze preservation of callus or suspension cultures (Henshaw, 1975).Another procedure that deserves to be tried is storage in organic solvents, which has proved to be quite satisfactory for the storage of pollen grains of several species (Iwanami, 1975). One foreseeable problem with this technique will be the susceptibility of normal plant cells and tissues with thin walls to damage by the organic solvents. Mature pollen grains appear to be protected against such damage owing to their rather thick sporopollenin-coated and impregnated walls (Vasil, 1973a). Morel (1975) demonstrated that, by culturing excised shoot apices and nodal segments under carefully controlled conditions of nutrition and environment, genetic stocks of grape vines could be maintained with a fraction of time, space, and cost required to maintain them in
PLANT TISSUE CULTURES
175
the field. He calculated that 800 different grape cultivars could be stored in culture in a space of about two square meters, and from a single meristem culture more than 10 million cuttings could be produced within one year. Seibert (1976) later showed that aseptically excised shoot apices of carnation (Dianthus caryophyllus) could be frozen a t -196°C and subsequently thawed and cultured to give rise to plants. Since excised meristems provide genetically stable material for rapid clonal propagation and the production of disease-free plants, much attention needs to be given to this potentially useful method for the freeze preservation of plant genetic stocks. Suspension and callus cultures of many plants have been successfully frozen and/or stored (Quatrano, 1968; Latta, 1971; Sugawara and Sakai, 1974; Henshaw, 1975; Seibert and Wetherbee, 1977; Withers and Street, 1977), and in carrot and tobacco plants have been regenerated from such frozen cultures (Nag and Street, l973,1975a,b; Dougall and Wetherell, 1974; Bajaj, 1976). Here again, much more work needs to be done before the procedure can be relied upon to preserve valuable genetic stocks. As pointed out by D’Amato (1975), the usefulness of callus and suspension cultures for long-term storage is presently severely limited owing to the fact that “For in uitro cultures other than meristem culture, genetic stability (or a t least relative stability at a given ploidy level) is at present no more than a remote possibility.” VIII. Epilogue
Recent experimental methods in plant cell and tissue culture not only have been used to analyze the physiologicalhiochemical basis of cell differentiation and behavior, but also have provided techniques for attempting to construct new combinations of genes through somatic cell fusion across barriers that previously have restricted sexual crosses at the interspecific level or above. Improved techniques have thus opened up possibilities for purposeful modification of the genetic content of plant cells through cell fusion, incorporation of foreign DNA, cell organelles, or whole microorganisms, etc. A prerequisite to successful application of the approaches presented in this review is to be able to regenerate mature plants from cell and tissue cultures of important plant species. Although clonal propagation has been achieved in many species, it is still not possible to apply these techniques to the large-scale clonal multiplication of many agronomically important crop plants, particularly the legumes, cereals/ grasses, and most woody tree species. Even in those species where plants can be regenerated from tissue cultures, the process is complicated by the fact
176
INDRA K. VASIL
et al.
that cellular proliferation and callus formation are frequently accompanied by chromosome aberrations, changes in ploidy levels, and the loss of totipotency. In other instances, the phenotypes selected from essentially undifferentiated cells in culture may not necessarily be expressed in the mature plant or in the appropriate organ. Furthermore, it may be difficult under in uitro conditions to identify traits that are agronomically important, such as increased yield, nutritional qualities, and resistance to lodging. Although protoplast fusion and subsequent regeneration of a hybrid plant offer far-reaching possibilities for increasing genetic variability, there will certainly be eventual limits to the range in remoteness of types that can be combined parasexually and regenerated into viable and stable hybrids, just as there are limits to the range of combinations through sexual crossings. The successful isolation of a parasexually produced hybrid plant will depend primarily upon a knowledge of the cultural conditions that will allow preferential recovery of the fused hybrid cells and at the same time maintain a stable chromosome number. Although the transfer of DNA or genes from microorganisms to the protoplasts or cells of higher plants has been claimed, conclusive experimental evidence supporting the integration of the alien genes into the genomes of the recipient higher plant cells is lacking. Even if not integrated, such gene introgressions offer possibilities for transferring prokaryotic genes of uniquely useful function-such as nitrogen fixation-into eukaryote cells, where they may express their characteristic phenotype epigenetically in a somatic clone. Clearly, there is an urgent need to resolve these and other related problems. Impressive progress has been made in the methods and applications of plant tissue culture techniques in the past decade, and it is anticipated that intensive and extensive efforts in many laboratories throughout the world will make in uitro technology a powerful experimental tool to attempt “genetic engineering” and develop suitable alternatives to sex in plants for generating novel genotypes of economic as well as academic value.
ACKNOWLEDGMENTS This review was completed while I. K. V. was the recipient of the Senior United States Scientist Award for Teaching and Research of the Federal Republic of Germany (West), and was partly supported by funds from a National Science Foundation grant (INT7617525) and the Biomedical Sciences Grant Support from the National Institutes of Health. M. R. A. was supported by the Richard-Merton guest professorship of the Deutsche Forschungsgemeinschaft a t the Genetics Institute of the Justus-Liebig Uni-
PLANT TISSUE CULTURES
177
versity at Giessen, West Germany. It is a pleasure for us to record our thanks to Professor Fritz Anders for his warm hospitality and for providing a quiet but stimulating atmosphere for the completion of this review at Giessen. We also wish to thank Dr. Harold H. Smith (Brookhaven National Laboratory, Upton, New York) and Dr. Larkin C. Hannah (University of Florida) who reviewed the entire manuscript and made very valuable suggestions for improvement.
REFERENCES Abbott, A. J., and Whiteley, E. (1974). In vitro regeneration and multiplication of apple tissues. Tissue Cult. Plant Sci., Proc. Znt. Congr. Plant Tissue Cell Cult., 3rd, 1974 Abstract, p. 263. Abo El-Nil, M. M. (1977). Organogenesis and embryogenesis in callus cultures of garlic (Allium sativum L.). Plant Sci. Lett. 9, 259-264. Abo El-Nil, M. M., and Hildebrandt, A. C. (1973). Origin of androgenetic callus and haploid geranium plants. Can. J . Bot. 51, 2107-2109. Abo El-Nil, M. M., and Hildebrandt, A. C. (1976). Cell wall regeneration and colony formation from isolated single geranium protoplasts in microculture. Can. J . Bot. 54, 1530-1534. Abo El-Nil, M. M., and Zettler, F. W. (1976). Callus initiation and organ differentiation from shoot tip cultures of Colocusiu escutenta. Plant Sci. Lett. 6, 401-408. Ahkong, Q. F., Howell, J. I., Lucy, J. A., Safwat, F., Davey, M. R., and Cocking, E. C. (1975). Fusion of hen -erythrocytes with yeast protoplasts induced by polyethylene glycol. Nature (London) 255, 6G67. Ahloowalia, B. S. (1975). Regeneration of ryegrass plants in tissue culture. Crop Sci. 15, 449-452. Ahuja, M. R., and Hagen, G. L. (1966). Morphogenesis in Nicotiana debneyi-tabacurn, N . longiflora and their tumor-forming hybrid derivatives i n uitro. Dev. Biol. 13, 408-432. Ammirato, P. V. (1974). The effects of abscissic acid on the development of somatic embryos from cells of caraway (Carurn carvi L.). Bot. Gaz. (Chicago) 135,328-337. Ammirato, P. V., and Steward, F. C. (1971). Some aspects of environment on the development of embryos from cultured free cells. Bot. Guz. (Chicago) 132,149-158. Aneja, S., and Atal, C. K. (1969). Plantlet formation in tissue cultures from lignotubers of Eucalyptus citriodora Hook. Curr. Sci. 38, 69. Anne, J., Eyssen, H., and De Somer, P. 1976. Somatic hybridization of Penicillium roquefortii with P. chrysogenum after protoplast fusion. Nature (London) 262,719720. Anonymous (1974). Success of breeding the new tobacco cultivar “Tan-Yuh 1.”Acta Bot. Sin. 16, 300-303. Anonymous (1975a). Induction of haploid popular plants from anther culture in vitro. Sci. Sin. 18, 769-778. Anonymous (1975b). Isolation and culture of rice protoplasts. Sci. Sin. 18, 779-784. Aoki, S., and Takebe, I. (1969). Infection of tobacco mesophyll protoplasts by tobacco mosaic virus ribonucleic acid. Virology 39, 439-448. Appelgren, M., and Heide, 0. (1972). Regeneration in Streptocarpus leaf discs and its regulation by temperature and growth substances. Physiol. Plant. 27, 417-423. Arora, Y. K., Nakao, S., and Nakajima, T. (1970). Perpetuation ofBegonia rex by aseptic culture with micro-leaf cuttings under various conditions of auxin and cytokinin. Jpn. J . Breed. 20, 275-281.
178
INDRA K. VASIL
et al.
Bajaj, Y. P. S . (1976). Regeneration of plants from cell suspensions frozen a t -20, -70 and -196°C. Physiol. Plant. 37, 263-268. Bajaj, Y.P. S., and Bopp, M. (1972). Growth and organ formation in Sinapsis alba tissue cultures. 2. Pflanzenphysiol. 66, 37S381. Bajaj, Y.P. S., and Mader, M. (1974). Growth and morphogenesis in tissue cultures of Anagallis aruensis. Physiol. Plant. 32, 43-48. Bajaj, Y. P. S., and Nietsch, P. (1975). In vitro propagation of red cabbage (Brassica oleracea L. var. capitata). J . Exp. Bot. 26, 883-890. Bajaj, Y.P. S., and Pierik, R. L. M. (1974). Vegetative propagation ofFreesia through callus cultures. Neth. J . Agric. Sci. 22, 153-159. Ball, E. A. (1950). Differentiation in a callus culture ofsequoia semperuirens. Growth 14, 295-325. Ballade, P. (1971). Etude experimentale de l’organogenese axillaire chez Nasturtium offiinale R. Br. Comportemente de noeuds isoles cultives in vitro C.R. Hebd. Seances Acad. Sci., Ser. D 273, 2079-2082. Ban, Y., Kokubu, T., and Miyaji, Y. (1971). Production of haploid plants by anther culture of Setaria italica. Bull. Fac. Agric., Kagoshima Uniu. 21, 77-81. Banerji, S.,and Gupta, S. (1975). Morphogenesis in tissue culture of Nigella satiua. Physiol. Plant. 33, 185-187. Banerji, S.,and Gupta, S. (1976). Embryogenesis and differentiation in Nigella satiua leaf callus in vitro. Physiol. Plant. 38, 115-120. Banks, M. S., and Evans, P. K. (1976). A comparison of the isolation and culture of mesophyll protoplasts from several Nicotiana species and their hybrids. Plant Sci. Lett. 7, 409-416. Bapat, V. A., and Narayanaswamy, S. (1976). Growth and organogenesis in explanted tissues ofAmaryllis in culture. Bull. Torrey Bot. Club 103,53-56. Bapat, V. A., and Rao, P. S. (1977). Experimental controlofgrowth and differentiation in organ cultures of Physalis minima Linn. 2.Pflanzenphysiol. 85, 403-416. Barba, R., and Nickell, L. G. (1969). Nutrition and organ differentiation in tissue cultures of sugarcane, a monocotyledon. Planta 89, 299-302. Barrett, J . N., and Jones, L. H. (1974). Development ofplantlets from cultured tissues of oil palm (Elaeis guineensis). Tissue Cult. Plant. Sci., Proc. Znt. Congr. Plant Tissue Cell Cult., 3rd, 1974 Abstract, p. 218. Baruch, E. R., and Quak, F. (1966). Virus-free plants of iris “Wedgewood’ obtained by meristem culture. Neth. J . Plant Pathol. 72, 270-273. Bawa, K. S., and Stettler, R. F. (1972). Organ culture with black cottonwood Morphogenetic response of female catkin primordia. Can. J . Bot. 50, 1627-1631. Beauchesne, G. (1970). Culture of meristems from lignous plants: Possibilities and limits. Proc. Int. Hortic. Congr., 17th, Vol. 1, p. 209. Beauchesne, G. (1974). The in vitro culture of hydrangeas from meristems. Pepin. Hortic. Mar. 144, 29-31. Benbadis, A,, and Amar, S. (1976). In vitro morphogenesis from various parts ofphoenix dactylifera (L.) roots excised from developing embryo. Proc. Int. Bot. Congr., 12th, 1975 p. 279. Ben-Jaacov, J., and Langhans, R. W. (1972). Rapid multiplication of chrysanthemum plants by stem-tip proliferation. HortScience 7,289-290 Berbee, F.M., Berbee, J. G., and Hildebrandt, A. C. (1972). Induction of callus and trees from stem tip cultures of hybrid poplar. I n Vitro 7, 269. Bernard, S., Picard, E., and de Buyser, J. (1976). Haploid plants obtained by in vitro
PLANT TISSUE CULTURES
179
anther culture of 6x Triticale (xTriticosecale Wittmack). C.R. Hebd. Seances Acad. Sci., Ser. D. 283, 235-238. Bertsch, W. (1967). A new frontier: Orchid propagation by meristem tissue culture. A m . Orchid. Soc. Bull. 36, 32-37. Bhojwani, S. S., Dunwell, J. M., and Sunderland, N. (1973). Nucleic acid and protein contents of embryogenic pollen. J . Exp. Bot. 24, 863-871. Bhojwani, S. S., Power, J. B., and Cocking, E. C. (1977). Isolation, culture and division of cotton callus protoplasts. Plant Sci. Lett. 8, 85-89. Bianchi, F., and Walet-Foederer, H. G. (1974). An investigation into the anatomy of the shoot apex of Petunia hybrida in connection with the results of transformation experiments. Acta Bot. Neerl. 23, 1-6. Bigot, C. (1974). Obtention de plantes entieres a partir de pedoncules floraux de Gloxinia hybrida cultives in vitro. 2. Pflanzenphysiol. 73, 1 7 a 1 8 3 . Binding, H. (1972a). Nuclear and cell divisions in isolated pollen ofpetunia hybrida in agar suspension cultures. Nature (London), New Biol. 237, 283-285. Binding, H. (1972b). Selektion in Kalluskulturen mit haploiden Zellen. 2. Pflanzenzuecht 67,33-38. Binding, H. (1974). Regeneration von haploiden und diploiden Pflanzen aus Protoplasten von Petunia hybrida L. 2. Pflanzenphysiol. 74, 327-356. Binding, H. (1975). Reproducibly high plating efficiencies of isolated mesophyll protoplasts from shoot cultures of tobacco. Physiol. Plant. 35, 225-227. Binding, H., and Nehls, R. (1977). Regeneration of isolated protoplasts to plants in Solanum dulcamara L. 2. Pflanzenphysiol. 85, 279-280. Binding, H., and Nehls, R. (1978). Regeneration of isolated protoplasts of Vicia faba L. 2. Pflanzenphysiol. 88, 327-332. Binding, H., Binding, K., and Struab, J. (1970). Selektion in Gewebekulturen mit haploiden Zellen. Naturwissenschaften 57, 138-139. Bingham, E. T., Hurley, L. V., Kaatz, D. M., and Saunders, J. W. (1975). Breeding alfalfa which regenerates from callus tissue in culture. Crop Sci. 15, 719-721. Blake, T. J. (1972). Studies on the lignotubers of Eucalyptus obliqua l'Herit. 111. The effects of seasonal and nutritional factors on dormant bud development. New Phytol. 71, 327-334. Blakeslee, A. F., and Belling, J. (1924). Chromosomal mutations in the jimson weed, Datura stramonium. J . Hered. 15, 195-206. Blakeslee, A. F., Belling, J., Franham, M. E., and Bergner, A. D. (1922). A haploid mutant in the jimson weed, Datura stramonium. Science 55, 6 4 6 6 4 7 . Blaschek, W., Hess, D., and Hoffmann, F. (1974). Transcription in nuclei prepared from isolated protoplasts of Nicotiana and petunia. 2. Pflanzenphysiol. 72, 262-271. Bonnett, H. T. (1976). On the mechanism of the uptake of Vaucheria chloroplasts by carrot protoplasts treated with polyethylene glycol. Planta 131, 229-234. Bonnett, H. T., and Eriksson, T. (1974). Transfer of algal chloroplasts into protoplasts of higher plants. Planta 120, 71-80. Bonnett, H. T., and Torrey, J. G. (1965). Chemical control of organ formation in root segments of Convolvulus cultured in vitro. Plant Physiol. 40, 1228-1236. Bonnett, H. T., and Torrey, J. G. (1966). Comparative anatomy of endogenous bud and lateral root formation in Conuolvulus aruensis roots cultured in vitro. A m . J . Bot. 53, 496508. Bourgin, J. P., and Missonier, C. (1978).Culture of haploid mesophyll protoplasts from Nicotiana alata Link & Otto. 2. Pflanzenphysiol. 87, 55-64.
180
INDRA K . VASIL et
al.
Bourgin, J . P., and Nitsch, J. P. (1967). Obtention de Nicotiana haploides a partir d’etamines cultivees in vitro. Ann. Physiol. Veg. 9, 377-382. Bourgin, J . P., Missonier, C., and Chupeau, Y. (1976). Culture of mesophyll protoplasts from haploid and diploid Nicotiana syluestris Speg. I%Comes. C.R. Hebd. Seances Acad. Sci., Ser. D 282, 1853-1856. Bowes, B. G. (1970). Preliminary observations on Tarmacum offcinale tissue cultures. Protoplusma 71, 197-202. Bowes, B. G. (1976). In vitro morphogenesis of Crambe maritima L. Protoplasma 89, 185-188. Boxus, P. (1971). La culture de meristemes de Prunus. Note preliminaire relative a l’espece P. pandora. Bull. Rech. Agron. Gembloux 6, 3-5. Boxus, P. (1974). The production of strawberry plants by in vitro micropropagation. J . Hortic. Sci.49, 209-210. Boxus, P., and Quoirin, M. (1974). La culture de meristemes apicaux de quelques especes de Prunus. Bull. SOC.R. Bot. Belg. 107, 91-101. Brand, R., and Venverloo, C. J . (1973). Formation of adventitious organs. 11. The origin of buds on young adventitious roots ofPopulus nigra L.Acta Bot. Neerl. 22,399-406. Brandao, I., and Salema, R. (1977). Callus and plantlet development from cultured lead explants of Sedum telephium L. Z. Pflanzenphysiol. 85, 1-8. Bright, S. W. J., and Northcote, D. H. (1974). Protoplast regeneration from normal and bromodeoxyuridine-resistant sycamore callus. J . Cell Sci. 16, 445-464. Bright, S. W. J., and Northcote, D. H. (1975). A deficiency of hypoxanthine phosphoribosyltransferase in a Sycamore callus resistant to azaguanine. Planta 123, 7a79. Bristow, J . M. (1962).The controlled in vitro differentiation of callus derived from a fern, Pteris cretica L., into gametophytic or sporophytic tissue. Deu. Biol. 4, 361-375. Broughton, W. J., Wooi, K. C., and Hoh, C. H. (1976). Acetylene reduction by legume root nodule protoplasts. Nature (London) 262, 208. Bui-Dang-Ha, D., and Mackenzie, I. A. (1973). The division of protoplasts from Asparagus officinalis L. and their growth and differentiation. Protoplasma 78, 215221. Burgess, J., and Fleming, E. N. (1974). Ultrastructural studies of the aggregation and fusion of plant protoplasts. Planta 118, 183-193. Burgoon, A. C., and Bottino, P. J. (1976). Uptake of the nitrogen fixing blue green algae Gloeocapsa into protoplasts of tobacco and maize. J . Hered. 67, 223-226. Burk, L. G., Gwynn, G. R., and Chaplin, J. F. (1972). Diploidised haploids from aseptically cultured anthers of Nicotiana tabacum. J . Hered. 63, 355-361. Bush, S. R., Earle, E. D., and Langhans, R. W. (1976). Plantlets from petal segments, petal epidermis, and shoot tips of the periclinal chimera, Chrysanthemum morifolium “Indianapolis.” A m . J . Bot. 63, 729-737. Butenko, R. G. (1968). “Plant Tissue Culture and Plant Morphogenesis” (English transl.). Publ.: Jerusalem. Butenko, R. G., Grushvitskii, R. V., and Slepyan, L. I. (1968).Organogenesis and somatic embryogenesis in a tissue callus of ginseng (Pancwc ginseng) and other Panar L. species. Bot. Zh. 53, 906-911. Butenko, R. G., Atanasov, A. I., and Urmantzeva, W. W. (1972). Some features of the sugarbeet tissue culture. Phytomorphology 22, 140-143. Campbell, R. A,, and Durzan, D. J. (1975). Induction of multiple buds and needles in tissue cultures of Picea glauca. Can. J . Bot. 53, 1652-1657. Campbell, R. A,, and Durzan, D. J. (1976). Vegetative propagation of Picea glauca by tissue culture. Can. J . For. Res. 6, 240-243.
PLANT TISSUE CULTURES
181
Cannon, F. C., and Postgate, J. R. (1976). Expression of Klebsiella nitrogen fixation genes (nip in Azotobacter. Nature (London) 260, 271-272. Carlson, P. S. (1970). Induction and isolation of auxotrophic mutants in somatic cell cultures of Nicotiana tabacum. Science 168, 487-489. Carlson, P. S. (1973a). The use of protoplasts for genetic research. Proc. Natl. Acad. Sci. U.S.A. 70,598-602. Carlson, P. S. (1973b).Towards a parasexual cycle in higher plants. Colloq. Int. C.N.R.S. 212, 497-505. Carlson, P. S. (1973~). Methionine sulfoximine resistant mutants of tobacco. Science 180, 1 3 6 6 1368. Carlson, P. S., and Chaleff, R. S. (1974). Forced association between higher plant and bacterial cells in vitro. Nature (London) 252, 393-394. Carlson, P. S., Smith, H. H., and Dearing, R. D. (1972). Parasexual interspecific plant hybridization. Proc. Natl. Acad. Sci. U.S.A. 69, 2292-2294. Carter, O., Yamada, Y., and Takahashi, E. (1967). Tissue culture of oats. Nature (London) 214,1029-1030. Caruso, J. L. (1971). Bud formation in excised stem segments ofverbascum thapsus. A m . J . Bot. 58, 429-431. Caruso, J. L. (1974). In vitro bud formation in stem segments of Ailanthus altissima. New Phytol. 73, 441-443. Chaleff, R. S., and Carlson, P. S. (1974). Somatic cell genetics of higher plants. Annu. Rev. Plant Physiol. 8, 267-278. Chalupa, V. (1974). Control of root and shoot formation and production of trees from poplar callus. Biol. Plant. 16, 316-320. Champagnat, M. (1971). Sur la multiplication vegetative de Neottia nidus-avis Rich. Ann. Sci. Nut., Bot. Biol. Veg. [12] 12, 209-248. Champagnat, M., and Morel, G. (1969). Multiplication vegetative desCattleya a partir de bourgeons cultives in vitro. Mem. Soc. Bot. Fr. pp. 111-132. Champagnat, M., and Morel, G. (1972). La culture in vitro des tissus de tubercules d’Ophrys. C. R . Hebd. Seances Acad. Sci., Ser. D 274, 3379-3380. Chardenon, J.,and Taris, B. (1960). Remarques sur la structure des tissues neoformes et l’apparition specialisee chez quatre cultivars de Populus chez Salix alba, cultives in vitro. C . R. Hebd. Seances Acad. Sci., Ser. D 251, 2070-2071. Charlton, W. A. (1965). Bud initiation in excised roots of Linaria vulgaris. Nature (London) 207, 781-782. Chase, S. S. (1952). Monoploids in maize. In “Heterosis” (J.W. Gowen, ed.), pp. 389-399. Iowa State Coll. Press, Ames. Chase, S. S. (1963). Androgenesis-its use for transfer of maize cytoplasm. J . Hered. 54, 152- 158. Chase, S. S. (1969). Monoploids and monoploid-derivates of maize (Zea mays L.). Bot. Rev. 35, 117-167. Chase, S. S. (1974).Utilization of haploids in plant breeding: Breeding diploid varieties. In “Haploids in Higher Plants” (K. J. Kasha, ed.), pp. 211-230. University of Guelph, Guelph. Chaturvedi, H. C. (1975). Propagation of Dzoscorea floribunda from in vitro culture of single-node stem segments. Curr. Sci. 44, 839-841. Chaturvedi, H. C., Chowdhury, A. R., and Mitra, G. C. (1974). Shoot-bud differentiation in stem-callus tissue ofcitrus grandis and correlated changes in its free amino acid content. Curr. Sci. 43, 53G537. Chen, C. H., and Holden, D. J. (1972). Organogenesis in day lily callus. Proc. S.D. Acad. Sci. 51, 146-149.
182
INDRA K. VASIL
et al.
Chen, H. R., and Galston, A. W. (1967). Growth and development ofPelargoniun pith cells in vitro. 11. Initiation of organized development. Physiol. Plant. 20, 5 3 S 5 3 9 . Chen, K., Wildman, S. G., and Smith, H. H. (1977). Chloroplast DNA distribution in parasexual hybrids as shown by polypeptide composition of Fraction I protein. Proc. Natl. Acad. Sci., U.S.A. 74, 510%5112. Cheng, T. (1975). Adventitious bud formation in culture of Douglas Fir (Pseudotsuga menziesii (Mirb.) Franco). Plant Sci. Lett. 5, 97-102. Cheng, T. (1976). Vegetative propagation of Western Hemlock (Tsuga heterophylla) through tissue culture. Plant Cell Physiol. 17, 1347-1350. Cheng, T., and Smith, H. H. (1975). Organogenesis from callus culture of Hordeum vulgare. Planta 123, 307-310. Cheng, T., and Voqui, T. H. (1977). Regeneration of Douglas Fir plantlets through tissue culture. Science 198, 306-307. Chikkannaiah, P. S., and Gayatri, M. C. (1974). Organogenesis in endosperm tissue cultures of Codiaeum uariegatum Blume. Curr. Sci. 43, 23-24. Child, J. J. (1975). Nitrogen fixation by a Rhizobium sp. in association with nonleguminous plant cell cultures. Nature (London) 253, 350-351. Child, J. J., and LaRue, T. A. (1974). A simple technique for the establishment of nitrogenase in soybean callus culture. Plant Physiol. 53, 8%90. Chin, J. C., and Scott, K. J. (1977). Studies on the formation ofroots and shoots in wheat callus cultures. A n n . Bot. (London) 41, 473-482. Chlyah, A. (1972). Bud and root neoformation on leaf fragments of Begonia rex Putz: Effect of different growth and trophic substances and environmental conditions. Biol. Plant. 14, 204--212. Chlyah, H. (1973). Neoformation dirigee a partir de fragments dorganes de Torenia fournieri (Lind.) cultives in vitro. Biol. Plant. 15, 80-87. Chlyah, H. (1974). Inter-tissue correlations in organ fragments. Organogenetic capacity of tissues excised from stem segments of Torenia fournieri Lind. cultured separately in vitro. Plant Physiol. 54, 341-348. Chupeau, Y., Bourgin, J. P., Missonier, C., Dorion, N., and Morel, G. (1974). Preparation et culture de protoplastes de divers Nicotiana. C.R. Hebd. Seances Acad. Sci.,Ser. D 278, 565-568. Churchill, M. E., Arditti, J., and Ball, E. A. (1971). Clonal propagation of orchids from leaf tips. A m . Orchid SOC.Bull. 40, 109-113. Churchill, M. E., Ball, E. A,, and Arditti, J. (1973). Tissue culture oforchids. 1. Methods for leaf tips. New Phytol. 72, 161-162. Clapham, D. (1971). In vitro development of callus from the pollen of Lolium and Hordeum. 2. Pflanzenzuecht 65, 285-292. Clapham, D. (1973). Haploid Hordeum plants from anthers in vitro 2. Pf2anzenzuecht 69, 142-155. Clare, M. V., and Collin, H. A. (1974). The production ofplantlets from tissue cultures of Brussels Sprout (Brassica oleracea L. var. gemmifera D.C.). Ann. Bot. (London) 38, 1067-1076. Cocking, E. C. (1960). A method for the isolation of plant protoplasts and vacuoles. Nature (London) 187, 927-929. Cocking, E. C. (1972). Plant cell protoplasts-isolation and development. Annu. Rev. Plant Physiol. 23, 29-50. Cocking, E. C. (1973). Plant cell modification: Problems and perspectives. Colloq. Int., C.N.R.S. 212, 327-341. Cocking, E. C. (1977a). Genetic modification of plant cells: A reappraisal. Nature (London) 266, 13-14.
PLANT TISSUE CULTURES
183
Cocking, E. C. (1977b). Uptake of foreign genetic material by plant protoplasts. Int. Rev. Cytol. 48, 323-343. Cocking, E. C., Power, J. B., Evans, P. K., Safwat, F., Frearson, E. M., Hayward, C., Berry, S. F., and George, D. (1974). Naturally occurring differential drug sensitivities of cultured plant protoplasts. Plant Sci. Lett. 3, 341-350. Coleman, W. K., and Thorpe, T. A. (1977).In vitro culture of Western Red Cedar (Thuja plicata Donn.). I. Plantlet formation. Bot. Gaz. (Chicago) 138, 2 9 g 3 0 4 . Collins, G. B., and Sadasivaiah, R. S. (1972). Meiotic analysis of haploid and doubled haploid forms of Nicotiana otophora and N . tabacum. Chromosoma 38, 387-404. Collins, G. B., and Sundzrland, N. (1973). Anther culture of 24-chromosome Nicotianas. Annu. Rep. John Innes Inst. 64, 6 S 6 9 . Collins, G . B., Legg, P. D., and Kasperbauer, M. J. (1972). Chromosome numbers in anther-derived haploids of two Nicotiana species. J . Hered. 63, 113-118. Collins, G. B., Legg, P. D., and Kasperbauer, M. J. (1974). Use ofanther-derived haploids in Nicotiana. I. Isolation of breeding lines differing in total alkaloid content. Crop. Sci. 14, 77-80. Constabel, F. (1976). Somatic hybridization in higher plants. I n Vitro 12, 743-748. Constabel, F., and Kao, K. N. (1974). Agglutination and fusion of plant protoplasts by polyethylene glycol. Can. J . Bot. 52, 1603- 1606. Constabel, F., Kirkpatrick, J. W., and Gamborg, 0. L. (1973). Callus formation from mesophyll protoplasts of Pisurn satiuum. Can. J . Bot. 51, 2105-2106. Constabel, F., Dudits, D., Gamborg, 0. L., and Kao, K. N. (1975). Nuclear fusion in intergeneric heterokaryons. Can. J . Bot. 53, 2092-2095. Corcos, A. (1973). Redifferentiation of Arabidopsis thaliana from callus culture. A m . J . Bot. 60, Suppl., 5. Corduan, G. (1975). Regeneration of anther-derived plants of Hyoscyamus niger L. Planta 127, 27-36. Corduan, G., and Spix, C. (1975). Haploid callus and regeneration ofplants from anthers of Digitalis purpurea. Planta 124, 1-11. Coutts, R. H. A,, and Wood, K. R. (1975). The isolation and culture of cucumber mesophyll protoplasts. Plant Sci. Lett. 4, 189-193. Craig, 1. L. (1974). Haploid plants (2n = 21) from in vitro anther culture of Triticum aestivum. Can. J . Genet. Cytol. 16, 697-700. Cresswell, R., and Nitsch, C. (1975). Organ culture ofEucalyptus grandis L. Planta 125, 87-90. Crocomo, 0. J., Sharp, W. R., and Peters, J. E. (1976). Plantlet morphogenesis and the control o f callus growth and root induction ofPhuseolus uulgaris with the addition of a bean seed extract. Z. Pflanzenphysiol. 78, 456-460. Cummings, D. P., Green, C. E., and Stuthman, D. D. (1976).Callus induction and plant regeneration in oats. Crop Sci. 16, 465-470. Dale, P. J. (1975). Meristem tip culture inLolium rnultiflorum. J . Exp. Bot. 26,731-736. DAmato, F. (1965). Endopolyploidy as a factor in plant tissue development. I n “Plant Tissue Culture” (P. R. White, ed.), pp. 449-462. McCutchan Publ., Berkeley, California. D’Amato, F. (1975). The problem of genetic stability in plant tissue and cell cultures. In “Crop Genetic Resources for Today and Tomorrow” (0.H. Frankel and J. G. Hawkes, eds.), pp. 333-348. Cambridge Univ. Press, London and New York. Danckwardt-Lilliestrom, C. ( 1957). Kinetin induced shoot formation from isolated roots o f Isatis tinctoria. Physiol. Plant. 10, 794-797. Davey, M. R., and Cocking, E. C. (1972). Uptake of bacteria by isolated higher plant protoplasts. Nature (London) 239, 455-456.
184
INDRA K. VASIL
et al.
Davey, M. R., and Power, J. B. (1975). Polyethylene glycol-induced uptake of microorganisms into higher plant protoplasts: An ultrastructural study. Plant Sci. Lett. 5, 269-274. Davey, M. R., Bush, E., and Power, J. B. (1974). Cultural studies of a dividing legume leaf protoplast system. Plant Sci. Lett. 3, 127-133. Davey, M. R., Frearson, E. M., and Power, J. B. (1976). Polyethylene glycol-induced transplantation of chloroplasts into protoplasts: an ultrastructural assessment. Plant Sci. Lett. 7, 7-16. Davidson, R. L.,and Gerald, P. S. (1976). Improved techniques for the induction of mammalian cell hybridization by polyethylene glycol. Somatic Cell Genet. 2, 165176. Davidson, R. L., and Gerald, P. S. (1977). Induction of mammalian somatic cell hybridization by polyethylene glycol. Methods Cell Biol. 15, 329-338. Davies, D. R. (1972). Speeding up the commercial propagation offreesias. Grower 77,711. Day, J. M., Neves, M. C. P., and Dobereiner, J. (1975). Nitrogenase activity on the roots of tropical forage grasses. Soil Biol. & Biochem. 7, 107-112. Debergh, P. (1975). Intensified vegetative propagation of Dracaena deremensis. Acta Hortic. 54, 83-92. Debergh, P., and Nitsch, C. (1973). Premiers resultats sur la culture in vitro de grains de pollen isoles chez la tomate. C.R. Hebd. Seances Acad. Sci., Ser. D 276, 1281-1284. deBruijne, D., delanghe, E., and van Rijk, R. (1974). Action of hormones and embryoid formation in callus cultures of Carica papaya. Meded. Fak. Landbouwwet., Rijksuniu. Gent 39, 637-645. Deka, P. C., and Sen, S. K. (1976). Differentiation in calli originated from isolated protoplasts of rice (Oryza sativa L.) through plating technique. Mol. Gen. Genet. 145, 239-243. delanghe, E., and deBruijne, D. (1974). Massive propagation in vitro of tomato plants with maintenance of genetic stability. Tissue Cult. Plant Sci., Proc. Znt. Congr. Plant Tissue Cell Cult., 3rd, 1974 Abstract, p. 41. delanghe, E., Debergh, P., and van Rijk, R. (1974). In vitro culture a s a method for vegetative propagation ofEuphorbia pulcherrima. 2.Pflanzenphysiol. 71, 271-274. de Mol, W. E. (1923). Duplication of generative nuclei by means of physiological stimuli and its significance. Genetica 5, 226-272. de Mol, W. E. (1933a). Die Entstehungsweise anormaler Pollenkorner bei Hyacinthen, Tulpen und Narzissen. Cytologiu 5, 31-65. de Mol, W. E. (1933b). Naheres uber das Vorfinden nebst dem experimentellen Hervorrufen mehrchromosomiger und embryosackartiger Pollenkorner bei diploiden und heteroploiden hollandischen Hyacinthenvarietaten. Cytologicl 5, 204-229. Dix, P. J., and Street, H. E. (1974). Effects ofp-fluorophenylalanine on the growth of cell lines differing in ploidy and derived from Nicotiana sylvestris. Plant Sci. Lett. 3, 283- 288. Dix, P. J., and Street, H. E. (1975). Sodium chloride-resistant cultured cell lines from Nicotiana sylvestris and Capsicum annuum. Plant Sci. Lett. 5, 231-237. Dixon, R., Cannon, F., and Kondorosi, A. (1976). Construction of a P plasmid carrying nitrogen fixation genes from Klebsiella pneumoniae. Nature (London) 260,26%271. Dobereiner, J., and Day, J. M. (1976). Associative symbioses in tropical grasses: characterization of microorganisms and dinitrogen-fixing sites. I n "Nitrogen Fixation" (W. E. Newton and C. J. Nyman, eds.), Vol. 2, pp. 51&538. Washington State Univ. Press, Pullman. Doerschung, M. R., and Miller, C. 0. (1967). Chemical control of adventitious organ formation in Lactuca sativa explants. A m . J. Bot. 54, 410-413.
PLANT TISSUE CULTURES
185
Donn, G. (1978). Cell division and callus regeneration from leaf protoplasts of Vicia narboriensis. 2. Pflnnzenphysiol. 86, 6 5 7 5 . Doreswamy, R., and Chacko, E. K. (1973). Induction ofplantlets and callus from anthers of Petunia uxillaris (Lam.) B.S.P. cultured in vitro. Hortic. Res. 13, 41-44. Dorion, N., Chupeau, Y., and Bourgin, J. P. (1975). Isolation, culture and regeneration into plants ofRanunculus sceleratus L. leaf protoplasts. Plant Sci.Lett. 5 , 3 2 5 3 3 1 . Dougall, D. K., and Wetherell, D. F. (1974). Storage of wild carrot cultures in the frozen state. Cryobiology 11, 410-415. Doy, C. H., Gresshoff, P. M., and Rolfe, B. G. (1973). Biological and molecular evidence for the transgenosis of genes from bacteria to plant cells. Proc. Natl. Acad. Sci. U.S.A. 70, 723-726. Dudits, D., Nemet, G., and Haydu, Z. (1975). Study of callus growth and organ formation in wheat (Triticum aestiuum) tissue cultures. Can. J . Bot. 53, 957-963. Dudits, D., Kao, K. N., Constabel, F., and Gamborg, 0. L. (1976a). Fusion of carrot and barley protoplasts and division of heterokaryocytes. Can. J . Genet. Cytol. 18, 263269. Dudits, D., Kao, K. N., Constabel, F., and Gamborg, 0. L. (1976b). Embryogenesis and formation oftetraploid and hexaploid plants from carrot protoplasts. Can. J . Bot. 54, 1063-1067. Dudits, D., Rasho, I., Hadlaczky, G., and Lima-de-Faria, A. (1976~).Fusion of human cells with carrot protoplasts induced by polyethylene glycol. Hereditas 82, 121-124. Dudits, D., Hadlaczky, G., Levi, E., Fejer, O., Haydu, Z., and Lazar, G. (1977). Somatic hybridization ofDaucus carota and D. capillifolius by protoplast fusion. Theor. Appl. Genet. 51, 127-132. Dulieu, H. L. (1972).The combination of cell and tissue culture with mutagenesis for the induction and isolation of morphological or developmental mutants. Phytomorphology 22, 283-296. Dulieu. H. L. (1974). Somatic variations on a yellow mutant in Nicotiana tabmum L. (a,+/a,a$a,). I. Non-reciprocal genetic events occurring on leaf cells. Mutat. Res. 25, 289-304. Dulieu, H. L. (1975). Somatic variations on a yellow mutant in Nicotiana tabucum L. (a,+/a,aja,). 11. Reciprocal genetic events occurring in leaf cells. Mutat. Res. 28, 69-77. Duncan, E. J., and Heberle, E. (1976). Effect of temperature shock on nuclear phenomena in microspores of Nicotiana tabmum and consequently on plantlet production. Protoplasma 90, 173-177. Dunican, L. K., and Tierney, A. B. (1974). Genetic transfer of nitrogen fixation from R. trifolii to K . uerogenes. Biochem. Biophys. Res. Commun. 57, 62-72. Dunwell, J. M., and Sunderland, N. (1973). Anther culture of Solanum tuberosum. Euphytica 22, 317-323. Dunwell, J. M., and Sunderland, N. (1974a). Pollen ultrastructure in anther cultures of Nicotiana tabucum. I. Early stages of culture. J . Exp. Bot. 25, 352-361. Dunwell, J. M., and Sunderland, N. (1974b). Pollen ultrastructure in anther cultures of Nicotiana tabmum. 11. Changes associated with embryogenesis. J . Exp. Bot. 25, 363-3 73. Dunwell, J. M., and Sunderland, N. (1976a). Pollen ultrastructure in anther cultures of Datura innoxia. I. Division of the presumptive vegetative cell. J . Cell Sci. 22, 469- 4 80. Dunwell, J. M., and Sunderland, N. (1976b). Pollen ultrastructure in anther cultures of Datura innoxia. 11. The generative cell wall. J . Cell Sci. 22, 481-491.
186
INDRA K. VASIL
et al.
Dunwell, J . M., and Sunderland, N. (1976~). Pollen ultrastructure in anther cultures of Datura innoxia. 111. Incomplete microspore division. J . Cell Sci. 22, 493-501. Durand, J., Potrykus, I., and Donn, G. (1973). Plants from protoplasts of Petunia. 2. Pflanzenphysiol. 69, 2 6 3 4 . Durzan, D. J., and Campbell, R. A. (1974). Prospects for the mass production of improved stock of forest trees by cell and tissue culture. Can. J . For. Res. 4, 151-174. Durzan, D. J., and Lopushanski, S. M. (1975). Propagation of American elm via cell suspension cultures. Can. J . For. Res. 5, 272-277. Earle, E. D., and Langhans, R. W. (1974a). Propagation ofChrysanthemum in vitro. I. Multiple plantlets from shoot tips and the establishment of tissue cultures. J . A m . SOC.Hortic. Sci. 99, 12tL132. Earle, E. D., and Langhans, R. W. (1974b). Propagation ofChrysanthemum in vitro. 11. Production, growth and flowering of plantlets from tissue cultures. J . A m . SOC. Hortic. Sci. 99, 352-358. Earle, E. D., and Langhans, R. W. (1975). Carnation propagation from shoot tips cultured in liquid medium. HortScience 10, 60P-610. Earle, E. D., and Torrey, J. G. (1965). Morphogenesis in cell colonies grown from Convolvulus cell suspensions plated on synthetic media. A m . J . Bot. 52, 891-899. Edwards, G. E., Huber, S. C., and Gutierrez, M. (1976). Photosynthetic properties of plant protoplasts. I n “Microbial and Plant Protoplasts” (J.F. Peberdy et al., eds.),pp. 299-322. Academic Press, New York. Elliott, R. F. (1970). Axenic cultures of meristem tips of Rosa multiflora. Planta 95, 183- 186. Elliott, R. F. (1972). Axenic culture of shoot apices of apple. N . 2. J . Bot. 10, 254-258. Engvild, K. C. (1973a). Shoot differentiation in calluses of Datura innoxia. Physiol. Plant. 28, 155-159. Engvild, K. C. (1973b). Triploid petunias from anther cultures. Hereditas 74, 144-147. Engvild, K. C. (1974). Plantlet ploidy and flower-bud size in tobacco anther cultures. Hereditas 76, 320-322. Engvild, K. C., Linde-Laursen, I., and Lundqvist, A. (1972). Anther cultures ofDatura innoxia: Flower bud stage and embryoid level of ploidy. Hereditas 72, 331-332. Eriksson, T., and Jonasson, K. (1969).Nuclear division in isolated protoplasts from cells of higher plants grown in vitro. Planta 89, 85-89. Esan, E. B. (1973). A detailed study of adventive embryogenesis in the Rutaceae. Ph.D. Thesis, University of California, Riverside. Evans, H. J., and Barber, L. E. (1977). Biological nitrogen fixation for food and fiber production. Science 197, 332-339. Fassuliotis, G. (1975).Regeneration of whole plants from isolated stem parenchyma cells of Solanum sisymbriifolium. J . A m . SOC.Hortic. Sci. 100, 6 3 6 6 3 8 . Favre, M. J. (1973). Effets correlatifs de facteurs internes e t externes sur la rhizogenese d u n clone de vigne (Vitis riparia x Vitis rupestris)cultive in vitro. Rev. Gen. Bot. 80, 279- 3 61. Fellenberg, G. (1963). Uber die Organbildung an in vitro kultivierten Knollagewebe von Solanum tuberosum. 2. Bot. 51, 113-141. Fersing, G., and Lutz, A. (1977).Comparative study of the vegetative multiplication in vitro of two horticultural species of Anthuriumt A . andreanum and A . scherzerianum. C.R. Hebd. Seances Acad. Sci. Ser. D, 284, 2231-2234. Fonnesbech, M. (1972a). Growth hormones and propagation of Cymbidium in vitro. Physiol. Plant. 27, 310-316. Fonnesbech, M. (1972b). Organic nutrients in the media for propagation ofCymbidium in vitro. Physiol. Plant. 27, 360-364.
PLANT TISSUE CULTURES
187
Fonnesbech, M. (1974). The influence of NAA, BA and temperature on shoot and root development from Begonia cheimantha petiole segments grown in vitro. Physiol. Plant. 32, 49-54. Fonnesbech, M. (1975). Cultivation ofAsparagusplumosa shoot tips in vitro with special reference to vegetative propagation. Acta Hortic. 54, 93-94. Frankel, 0.H., and Hawkes, J. G. (1975a). Genetic resources-the past ten years and the next. In “Crop Genetic Resources for Today and Tomorrow” (0.H. Frankel and J. G. Hawkes, eds.), pp. 1-11. Cambridge Univ. Press, London and New York. Frankel, 0. H., and Hawkes, J. G., eds. (197513).“Crop Genetic Resources for Today and Tomorrow.” Cambridge Univ. Press, London and New York. Frearson, E. M., Power, J. B., and Cocking, E. C. (1973). The isolation, culture, and regeneration of Petunia leaf protoplasts. Deu. Biol. 33, 130-137. Fridborg, G. (1971). Growth and organogenesis in tissue culture o f Allium cepa var. proliferum. Physiol. Plant. 25, 4 3 6 4 4 0 . Fujii, T.(1970).Callus formation in wheat anthers. WheatInf. Seru., Kyoto Uniu. 31,l-4. Fujino, M.,Fujimara, T., and Hamada, K. (1972). Multiplication of Dutch Iris (Iris hollandica) by organ culture. J . Jpn. SOC.Hortic. Sci. 41, 61-71. Galzy, R. (1972). La culture in vitro des apex de Vitis rupestris. C.R. Hebd. Seances Acad. Sci.,Ser. D 274, 210-213. Gamborg, 0.L., and Miller, R. A. (1973). Isolation, culture and uses ofplant protoplasts. Can. J . Bot. 51, 1 7 9 5 1 7 9 9 . Gamborg, 0. L., and Shyluk, J. P. (1976). Tissue culture, protoplasts, and morphogenesis in flax. Bot. Gaz. (Chicago) 137, 301-306. Gamborg, 0.L., and Wetter, L. R., eds. (1975). “Plant Tissue Culture Methods.” Nat. Res. Counc. Can., Ottawa. Gamborg, 0. L., Miller, R. A,, and Ojima, K. (1968). Nutrient requirements of suspension cultures of soybean root cells. Exp. Cell Res. 50, 151-158. Gamborg, 0.L., Constabel, F., and Miller, R. A. (1970). Embryogenesis and production of albino plants from cell cultures of Bromus inermis. Planta 95, 355-358. Gamborg, 0.L., Constabel, F., and Shyluk, J. P. (1974a). Organogenesis in callus from shoot apices o f Pisum satiuum. Physiol. Plant. 30, 125-128. Gamborg, 0. L., Constabel, F., Fowke, L. C., Kao, K . N., Ohyama, K., Kartha, K., and Pelcher, L. (197413).Protoplast and cell culture methods in somatic hybridization in higher plants. Can. J . Genet. Cytol. 16, 737-750. Gamborg, 0. L., Shyluk, J. P., and Kartha, K. K. (1975). Factors affecting the isolation and callus formation in protoplasts from the shoot apices o f p i s u m satiuum L. Plant Sci. Lett. 4, 285-292. Gamborg, 0.L., Murashige, T., Thorpe, T. A,, and Vasil, I. K. (1976).Plant tissue culture media. In Vitro 12, 473-478. Gamborg, 0. L., Shyluk, J. P., Brar, D. S., and Constabel, F. (1977).Morphogenesis and plant regeneration from callus of immature embryos of sorghum. Plant Sci. Lett. 10, 67-74. Gatenby, A. A,, and Cocking, E. C. (1977). Callus formation from protoplasts o f marrow stem kale. Plant Sci. Lett. 8, 2 7 5 2 8 0 . Gathercole, R. W. E., and Street, H. E. (1976). Isolation, stability and biochemistry of a p-fluorophenylalanine-resistantcell line o f Acer pseudoplatanus L. New Phytol. 77, 29-41. Gautheret, R. J. (1934). Culture du tissue cambial. C.R.Hebd. Seances Acad. Sci., Ser. D 198, 2195-2196. Gautheret, R.J. (1939). Sur la possibilite de realiser la culture indefinie des tissus de tubercules de carotte. C. R . Hebd. Seances Acad. Sci., Ser. D 208, 1 1 S 1 2 0 .
188
INDRA K . VASIL
et al.
Gautheret, R. J. (1940). Recherches sur le bourgeonnement du tissue cambial dUlmus carnpestris cultive in vitro. C.R. Hebd. Seances Acad. Sci Ser. D 210, 63%634. Geier, T., and Kohlenbach, H. W. (1973). Development of embryos and embryogenic callus from pollen grains of Datura meteloides and D. inmxia. Protoplasma 78, 381-396. Geitler, L. (1941). Embryosacke aus Pollenkornern bei Ornithogalum. Ber. Dtsch. Bot. Ges. 59,419-423. Gengenbach, B. G., and Green, C. E. (1975). Selection of T-cytoplasm maize callus cultures resistant to Helminthosporium maydis race T pathotoxin. Crop Sci. 15, 645-649. Gengenbach, B. G., Green, C. E., and Donovan, C. M. (1977). Inheritance of selected pathotoxin resistance in maize plants regenerated from cell cultures. Proc. Natl. Acad. Sci. U.S.A. 74, 5113-5117. Ghugale, P. D., Kulkarni, D., and Narasimhan, R. (1971). Effect of auxins and gibberellic acid on growth and differentiation of Morus alba and Populus nigra tissues in vitro. Indian J . Exp. Biol. 9, 381-384. Gilad, T., and Lavee, S. (1974). Callus formation and organogenesis from various parts of developing olive embryos. Tissue Cult, Plant Sci., Proc. Znt. Congr. Plant Tissue Cell Cult., 3rd, 1974 Abstract, p. 87. Giles, K. L. (1976). Chloroplast uptake and genetic complementation. In “Applied and Fundamental Aspects of Plant Cell, Tissue and Organ Culture” (J.Reinert and Y. P. S. Bajaj, eds.), pp. 536-550. Springer-Verlag, Berlin and New York. Giles, K. L., and Sarafis, V. (1972). Chloroplast survival and division in vitro. Nature (London), New Bid. 236, 56-58. Giles, K. L., and Whitehead, H. (1975). The transfer of nitrogen-fixing ability to a eukaryote cell. Cytobios 14,49-61. Giles, K. L., and Whitehead, H. (1976). Uptake and continued metabolic activity of Azotobacter within fungal protoplasts. Science 193, 1125-1126. Giles, K. L., and Whitehead, H. (1977). The localization of introduced Azotobacter cells within the mycelium of a modified mycorrhiza (Rhkopogon) capable of nitrogen fixation. Plant Sci. Lett. 10, 367-372. Givan, C. V., and Leech, R. M. (1971). Biochemical autonomy of higher plant chloroplasts and their synthesis of small molecules. Biol. Rev. Cambridge Philos. Soc. 46, 409-428. Gleba, Y. Y., (1978). Microdroplet culture. Tobacco plants from single mesophyll protoplasts. Naturwissenschaften 65,158-159. Gleba, Y. Y . , Butenko, R. G., and Sytnik, K. M. (1975a). Fusion of protoplasts and parasexual hybridization of Nicotiana tabacum L. Dokt. Akad. Nauk SSSR 221, 1196-1 198. Gleba, Y. Y . , Khasanov, M. M., Sliusarenko, A. G., Butenko, R. G., and Vinetskii, I. P. (197513).Penetration of H3-DNAofBacillus subtilis in isolated protoplasts of cells of tobacco (Nicotiana tabacum L.). Dokl. Akad. Nauk SSSR 219, 1478-1481. Glimelius, K.,Eriksson, T., Grafe, R., and Muller, A. J. (1978). Somatic hybridization of nitrate-reductase deficient mutants of Nicotiana tabacum by protoplast fusion. Physiol. Plant. 44,273-277. Goodman, R. M. (1977).Infectious DNA from a whitefly-transmitted virus ofPhaseolus vulgaris. Nature (London) 266, 54-55. Gordon, M. P., Ferrand, S. K., Sciaky, D., Montoya, A., Chilton, M. D., Merlo, D., and Nester, E. W. (1976). The crown-gall problem. In “Molecular Biology of Plants” (I. Rubinstein, ed.). University of Minnesota, St. Paul.
PLANT TISSUE CULTURES
189
Gosch, G., and Reinert, J. (1976). Nuclear fusion in intergeneric heterokaryocytes and subsequent mitosis of hybrid nuclei. Naturwissenschaften 63, 534. Gosch, G., Bajaj, Y. P. S., and Reinert, J. (1975). Isolation, culture, and induction of embryogenesis in protoplasts from cell suspensions of Atropa belladonna. Protoplasma 86, 405-410. Grambow, H. J., Kao, K. N., Miller, R. A,, and Gamborg, 0. L. (1972). Cell division and plant development from protoplasts of carrot cell suspension cultures. Planta 103, 348-355. Green, C. E., and Phillips, R. L. (1975). Plant regeneration from tissue cultures of maize. Crop Sci. 15, 417-421. Gresshoff, P. M., and Doy, C. H. (1972a). Haploid Arabidopsis thaliana callus and plants from anther culture. Aust. J . Biol. Sci. 25, 259-264. Gresshoff, P. M., and Doy, C. H. (1972b). Development and differentiation of haploid Lycopersicon esczdentum (tomato). Planta 107, 161- 170. Gresshoff, P. M., and Doy, C. H. (1974). Derivation of a haploid cell line from Vitis uinifera and the importance of the stage of meiotic development of anthers for haploid culture of this and other genera. 2. Pflanzenphysiol. 73, 132-144. Grewal, S., and Atal, C. K. (1976). Plantlet formation in callus cultures of Dioscorea deltoidea Wall. Indian J . Exp. Biol. 14, 352-353. Grewal, S., Sachdeva, U., and Atal, C. K. (1976). Regeneration of plants by embryogenesis from hypocotyl cultures of A m m i majus L. Indian J . Exp. Biol. 14, 71G717. Griffing, B. (1975). Efficiency changes due to use of doubled haploid in recurrent selection methods. Theor. Appl. Genet. 46, 367-386. Grimsley, N. H., Ashton, N. W., and Cove, D. J. (1977).Production of somatic hybrids by protoplast fusion in moss, Physcomitrella patens. Mol. Gen. Genet. 153, 97-100. Grinblat, U. (1972). Differentiation of Citrus stem in vitro. J . A m . SOC.Hortic. Sci. 97, 599-603. Groenewald, E. G., Koeleman, A,, and Wessels, D. C. J. (1975). Callus formation and plant regeneration from seed tissues of Aloe pretoriensis Pole Evans. 2. Pflanzenphysiol. 75, 2 70- 2 72. Groenewald, E. G., Wessels, D. C. J., and Koeleman, A. (1976). Embryoid formation in callus cultures of Aloe pretoriensis Pole Evans. S . Afr. J . Sci. 72, 89-90. Guha, S., and Maheshwari, S. C. (1964). In vitro production of embryos from anthers of Datura. Nature (London) 204, 497. Guha, S., and Maheshwari, S. C. (1966). Cell division and differentiation of embryos in the pollen grains of Datura in vitro. Nature (London) 212, 97-98. Guha, S., and Maheshwari, S. C. (1967). Development ofembryoids from pollen grains of Datura in vitro. Phytomorphology 17, 454-461. Guha, S., Iyer, R. D., Gupta, N., and Swaminathan, M. S. (1970).Totipotency ofgametic cells and production of haploids in rice. Cum. Sci. 39, 174-176. Guha-Mukherjee, S. (1973). Genotype differences in the in vitro formation of embryoids from rice pollen. J . Exp. Bot. 24, 139-144. Gunckel, J. E., Sharp, W. R., Williams, B. W., West, W. C., and Drinkwater, W. 0. (1972). Root and shoot initiation in sweet potato explants as related to polarity and nutrient media variations. Bot. Gaz. (Chicago) 133, 254-262. GUO,C. (1972). Effects of chemical and physical factors on the chromosome number in Nicotiana anther callus cultures. I n Vitro 7, 381-386. Gupta, N., and Carlson, P. S. (1972).Preferential growth of haploid plant cells in vitro. Nature (London), New Biol. 239, 86.
190
INDRA K. VASIL
et al.
Haberlandt, G . (1902). Kulturversuche mit isolierten Pflanzenzellen. Sitzungser. Math-Naturwiss. Kl. Kaiser Akad. Wiss. Wien 111, 69-92. Hackett, W. P. (1969). Aseptic multiplication of lily bulblets from bulb scales. Proc. Znt. Plant Prop. Soc. 105, 1 0 5 1 0 8 . Hackett, W. P. (1970). The influence of auxin, catechol and methanolic tissue extracts on root initiation in aseptically cultured shoot apices of the juvenile and adult forms of Hedera helix. J . A m . SOC.Hortic. Sci. 95, 39S402. Hackett, W. P., and Anderson, J . M. (1967). Aseptic multiplication and maintenance of differentiated carnation shoot tissue derived from shoot apices. Proc. A m . SOC. Hortic. Sci. 90, 3 6 5 3 6 9 . Hackett, W. P., Tee, A,, and Smith, R. J . (1973). University of California Flower and Nursery Report. Halperin, W. (1966). Alternative morphogenetic events in cell suspensions. A m . J . Bot. 53,443-453. Halperin, W., and Wetherell, D. F. (1964).Adventive embryony in tissue cultures of the wild carrot, Daucus carota. A m . J . Bot. 51, 274-283. Hammer, P. A. (1976). Tissue culture propagation of Hosta decorata. HortScience 11, 309. Handro, W., Rao, P. S., and Harada, H. (1972). Contralle hormonal de la formation de cals, bourgeons, racines et embryos sur des explanatats de feuilles et de tiges de Petunia cultives in vitro. C.R. Hebd. Seances Acad. Sci., Ser. D 275, 2861-2863. Hardy, R. W. F., and Havelka, U. D. (1975).Nitrogen fixation research: A key to World food? Science 188,633-643. Harlan, J. R. (1975). Our vanishing genetic resources. Science 188, 618-621. Harms, C. T., Lorz, H., and Potrykus, I. (1976). Regeneration of plantlets from callus cultures of Zea mays L. Z . Pflanzenphysiol. 77, 347-351. Harn, C. (1972). Production of plants from anthers of Solanum nigrum cultivated in vitro. Caryologia 25, 429-437. Harn, C., and Kim, M. Z. (1972). Induction of callus from anthers ofPrunus armeniaca. Korean J . Breed. 4,49-53. Harn, C., Koh, Y. S., Chung, D., and Kim, B. (1969). Studies on the anther culture of vegetable crops. I. Diploidal liquid callus of cucumber. Korean J . Hortic. Sci. 6, 25-27. Hart, J . W., Woodcock, G. J.,and Wilson, L. (1970). Culture and sesquiterpene analyses of cells and regenerated plantlets ofPogostemoncablin Benth. (Patchouli).Ann. Bot. (London) 34, 789-798. Hartman, R. D. (1974). Dasheen mosaic virus and other phytopathogens eliminated from Caladium, taro and cocoyam by culture of shoot tips. Phytopathology 64,237-240. Hasegawa, P. M., Murashige, T., and Takatori, F. H. (1973). Propagation of asparagus through shoot apex culture. 11. Light and temperature requirements, transplantation of plants and cytohistological characteristics. J . A m . Soc. Hortic. Sci. 98, 143-148. Havranek, P., and Novak, F. J. (1973). The bud formation in the callus cultures of Allium sativum L. Z . Pflanzenphysiol. 68,308-318. Hayward, C., and Power, J. B. (1975). Plant production from leaf protoplasts ofpetunia parudii. Plant Sci. Lett. 4, 407-410. Heller, R. (1953). Recherches sur la nutrition minerale des tissus vegetaux cultives in vitro. Ann. Sci. Nut., Bot. Biol. Veg. [ll]14, 1-223. Hendre, R. R., Mascarenhas, A. F., Pathak, M., Rao, B. S., and Jagannathan, V. (1971). Proc. Znt. Symp. Morphog. Plant Cell, Tissue Organ Cult., 1971, pp. 49-51.
PLANT TISSUE CULTURES
181
Hendre, R. R., Mascarenhas, A. F., and Jagannathan, V. (1975). Regulation of growth and differentiation in plant cells. I n “Regulation of Growth and Differentiated Function in Eukaryote Cells” (G. P. Talwar, ed.), pp. 17-25. Raven, New York. Henshaw, G. G. (1975). Technical aspects of tissue culture storage for genetic conservation. In “Crop Genetic Resources for Today and Tomorrow” (0.H. Frankel and J . G. Hawkes, eds.), pp. 349-357. Cambridge Univ. Press, London and New York. Herman, E. B., and Haas, G. J. (1975). Clonal propagation of Coffea arabica L. from callus culture. HortScience 10, 58S.589. Hess, D. (1972a). Transformationen an hoheren Organismen. Nuturwissenschaften 59, 34S355. Hess, D. (197213).Versuche zur Transformation an hoheren Pflanzen: Nachweis von Heterozygoten in Versuchen zur Transplantation von Genen Fur Anthocyansynthese bei Petunia hybrida. 2. Pflanzenphysiol. 66, 155-166. Hess, D. (1977). Cell modification by DNA uptake. I n “Applied and Fundamental Aspects of Plant Cell, Tissue, and Organ Culture” (J. Reinert and Y. P. s. Bajaj, eds.), pp. 506-535. Springer-Verlag, Berlin and New York. Hess, D., Schneider, G., Lorz, H., and Blaich, G. (1976). Investigations on the tumor induction in Nicotiana glauca by pollen transfer of DNA isolated from Nicotiana langsdorffii. Z . Pflanzenphysiol. 77, 247-254. Heuser, C. W., and Apps, D. A. (1976). In vitro plantlet formation from flower petal explants of Hemerocallis cv. Chipper Cherry. Can. J . Bot. 54, 616-618. Hildebrandt, A. C. (1962). Tissue and single cell cultures of higher plants a s a basic experimental method. I n “Modern Methoden der Planzen analyze” (K. Paech, M. V. Tracey, and H. F. Linskens, eds.), Vol. 5, pp. 383-421. Springer-Verlag, Berlin and New York. Hildebrandt, A. C. (1971). Growth and differentiation of single plant cells and tissues. Colloq. Int. C.N.R.S. 193, 71-93. Hildebrandt, A. C., Riker, A. J., and Dugger, W. M. (1946). The influence ofcomposition of the medium on growth in vitro of excised tobacco and sunflower tissue cultures. A m . J . Bot. 33, 591-597. Hildebrandt, A. C., Wilmar, J . C., Jonhs, H., and Riker, A. J. (1963). Growth of edible chlorophyllous plant tissues in vitro. A m . J . Bot. 50, 248-254. Hill, G. P. (1967a). Morphogenesis in stem callus cultures of Convolvulus aruensis L. Ann. Bot. (London) 31, 437-446. Hill, G. P. (196713).Morphogenesis of shoot primordia in cultured stem tissue of a garden rose. Nature (London) 216, 5 9 6 5 9 7 . Hill, G. P. (1968).Shoot formation in tissue cultures of Chrysanthemum “Bronze Pride.” Physzol. Plant. 21, 38G389. Hoffmann, F. (1973). Die Aufnahme doppelt-markierter DNS in isolierte Protoplasten von Petunia hybridu. 2. Pflanzenphysiol. 69, 249-261. Hoffmann, F., and Hess, D. (1973).Die Aufnahme radioaktiv markierter DNS in isolierten Protoplasten von Petunia hybrida. 2.Pflanzenphysiol. 69, 81-83. Hofmeister, L. (1954). Mikrurgische Untersuchung iiber die geringe Fusionseignung plasmolysierter, nackter Pflanzenprotoplasten. Protoplasma 43, 278-326. Holl, F. B. (1973).Cellular environment and the transfer of genetic information. Colloq. Int. C.N.R.S. 212, 509-516. Holl, F. B., Gamborg, 0. L., Ohyama, K., and Pelcher, L. (1974). Genetic transformation in plants. Tissue Cult. Plant Sci., Proc. Int. Congr. Plant Tissue Cell Cult., 1974 pp. 301-327.
192
INDRA K. VASIL
et al.
Holsten, R. D., Burns, R. C., Hardy, R. W. F., and Hebert, R. R. (1971). Establishment of symbiosis between Rhizobium and plant cells in vitro. Nature (London) 232, 173176. Hooker, M. P., and Nabors, M. W. (1977). Callus initiation, growth, and organogenesis in sugarbeet (Beta vulgaris L.). Z . Pflanzenphyswl. 84, 237-246. Hooykaas, P. J. J., Klapwijk, P. M., Nuti, M. P., Schilperoort, R. A., and Rorsch, A. (1977). Transfer of the Agrobacterium tumefmiens TI plasmid to avirulent agrobacteria and to Rhizobium ex planta. J . Gen. Microbiol. 98, 477-484. Horak, J. (1972). Ploidy chimeras in plants regenerated from the tissue cultures of Brassica oleracea L. Biol. Plant. 14, 423-426. Horak, J., Landa, Z., and LuStinec, J. (1971). Production of polyploid plants from tissue cultures of Brassica oleracea L. Phyton 28, 7-10. Hu, C. Y., and Sussex, I. M. (1972). In vitro development of embryoids on cotyledons of Ilex aquifolium. Phytomorphology 21, 103-107. Hughes, B. G., White, F. G., and Smith, M. A. (1978a). Purification ofplant protoplasts by discontinuous gradient centrifugation. Biochem. Physiol. Pflanz. 172, 223-231. Hughes, B. G., White, F. G., and Smith, M. A. (1978b). Fate of bacterial DNA during uptake by barley and tobacco protoplasts. 2.Pflanzenphysiol. 87, 1-23. Hughes, H., Lam, S., and Janick, J. (1973). In vitro culture of Salpiglossis sinuatu L. HortScience 8, 335-336. Hughes, K. W., Bell, S . L., and Caponetti, J. D. (1975). Anther-derived haploids of the African violet. Can. J. Bot. 53, 1442-1444. Hiisemann, W., and Reinert, J. (1976). Steuerung des Wachstums und der Morphogenese von Zellkulturen aus Crepis capillaris durch Licht und Phytohormone. Protoplasma 90, 353-367. Hussey, G. (1975). Totipotency in tissue explants and callus of some members of the Liliaceae, Iridaceae, and Amaryllidaceae. J. Exp. Bot. 26, 253-262. Hussey, G. (1976a). Propagation of Dutch Iris by tissue culture. Sci. Hortic. 4, 163-165. Hussey, G. (1976b). Plantlet regeneration from callus and parent tissue in Ornithogalum thyrsoides. J . Exp. Bot. 27, 375-382. Huthinen, O., and Yahyaoglu, Z. (1974). Das friihe Bliihen von aus Kalluskulturen herangezogenen Pflanzchen bei der Birke (Betula pendula Roth.). Silvae Genet. 23, 32-34. Indira, P., and Ramadasan, A. (1967). Shoot formation from the callus tissue ofhormone treated cowpea leaves. Curr. Sci. 36, 616-617. Intuwong, O., and Sagawa, Y. (1973). Clonal propagation of sarcanthine orchids by aseptic culture of inflorescences. Am. Orchid SOC.Bull. 42, 209-215. Irikura, Y., and Sakaguchi, S. (1972). Induction of 12-chromosome plants from anther culture in a tuberous Solanum. Potato Res. 15, 170-173. Isikawa, H. (1974). In vitro formation of adventitious buds and roots on the hypocotyl of Cryptomeria japonica. Bot. Mag. 87, 73-77. Ito, M. (1973). Studies on the behaviour of meiotic protoplasts. 11. Induction of a high fusion frequency in protoplasts from Liliaceous plants. Plant Cell Physiol. 14, 866872. Ito, M., and Maeda, M. (1973). Fusion of meiotic protoplasts in Liliaceous plants. Exp. Cell Res. 80, 453-456. Iwanami, Y. (1975). Absolute dormancy ofpollen induced by soaking in organic solvents. Protoplasma 84, 181-184. Iyer, R. D., and Raina, S. K. (1972). The early ontogeny of embryoids and callus from
PLANT TISSUE CULTURES
193
pollen and subsequent organogenesis in anther cultures of Datum mete1 and rice. Planta 104, 146-156. Jacobs, G., Bornman, C. H., and Allen, P. (1968). Tissue culture studies on rose. Use of pith explants. S. Afr. J. Agric. Sci. 11, 673-678. Jacquiot, C. (1951).Action du meso-inositol e t de l'adenine sur la formation de bourgeons par le tissue cambial d'Ulmus campestris cultive in vitro. C.R. Hebd. Seances Acad. Sci., Ser. D 233, 815-817. Jacquiot, C. (1955). Formation dorganes par le tissue cambial dUlmus campestris L. et de Betula uerrucosa Gaerth. cultives in vitro. C.R. Hebd. Seances Acad. Sci., Ser. D 240, 557-558. Jacquiot, C. (1966). Plant tissue and excised organ cultures and their significance in forest research. J. Znst. Wood Sci. 16, 22-34. Jayakar, M. (1971).In vitro flowering ofCrepis capillaris. Phytomorphology 20,410-412. Jelaska, S . (1972). Embryoid formation by fragments of cotyledons and hypocotyls in Cucurbita pepo. P h n t a 103, 278-280. Jelaska, S. (1974). Embryogenesis and organogenesis in pumpkin explants. Physiol. Plant. 31, 257-261. Jhang, J., Staba, E. J., and Kim, J . (1974). American and Korean ginseng tissue cultures: Growth, chemical analysis and plantlet production. In Vitro 9, 253-258. Johansson, L., and Eriksson, T. (1977). Induced embryo formation in anther cultures of several Anemone species. Physiol. Plant. 40, 172- 174. Johnson, R. T., Koenigsberg, S. S., and Langhans, R. W. (1976). Tissue culture of Christmas and Easter cactus. HortScience 11, 303. Johri, B. M., and Bajaj, Y. P. S. (1962). Behaviour of mature embryo ofDendrophthoe falcata (L.f.) Ettings in vitro. Nature (London) 193, 1 9 6 1 9 5 . Johri, B. M., and Sehgal, C. B. (1963). Chemical induction ofpolyembryony in Anethum gmueolens L. Naturwissenschaften 50, 47-48. Jones, C. W., Mastrangelo, I. A , , Smith, H. H., Liu, H. Z., and Meek, R. A. 11976). Interkingdom fusion between human (HeLa) cells and tobacco hybrid (GGLL) protoplasts. Science 193, 401-403. Jones, L. H. (1974). Propagation of clonal oil palms by tissue culture. Oil Palm News 17, 1-8. Jones, 0. P., and Vine, S. J. (1968). The culture of gooseberry shoot tips for eliminating virus. J . Hortic. Sci. 43, 289-292. Jordan, M. (1975). In vitro kultur von Prunus, Pyrus, und Ribes-antheren. Plant Med. Suppl. pp. 59-65. Kado, C. I. (1976). The tumor-inducing substance of Agrobacterium turnefaciens. Annu. Reu. Phytopathol. 14, 265-308. Kameya, T., and Hinata, K. (1970). Induction of haploid plants from pollen grains of Brassica. Jpn. J . Breed. 20, 82-87. Kandra, G., and Maliga, P. (1977). Is bromodeoxyuridine resistance a consequence of cytokinin habituation in Nicotiana tabacum? Planta 133, 131-133. Kao, K. N . (1977). Chromosomal behaviour in somatic hybrids of soybean-Nicotiana glauca. Mol. Gen. Genet. 150, 225-230. Kao, K. N., and Michayluk, M. R. (1974). A method for high frequency intergeneric fusion of plant protoplasts. Planta 115, 355-367. Kao, K. N., and Michayluk, M. R. (1975). Nutritional requirements for growth of Vicia hajastana cells and protoplasts a t a very low population density in liquid media. Planta 126, 105-110.
194
INDRA K . VASIL
et al.
Kao, K. N., Keller, W. A,, and Miller, R. A. (1970). Cell division in newly formed cells from protoplasts of soybean. Exp. Cell Res. 62, 338-340. Kao, K. N., Gamborg, 0. L., Miller, R. A,, and Keller, W. A. (1971).Cell divisions in cells regenerated from protoplasts of soybean andHaplopappus graczlis. Nature (London), New Biol. 232, 124. Kao, K. N., Gamborg, 0. L., Michayluk, M. R., Keller, W. A,, and Miller, R. A. (1973). The effects of sugars and inorganic salts on cell regeneration and sustained division in plant protoplasts. Colloq. Znt. C.N.R.S. 212, 207-213. Kao, K. N., Constabel, F., Michayluk, M. R., and Gamborg, 0. L. (1974).Plant protoplast fusion and growth of intergeneric hybrid cells. Planta 120, 215-227. Kartha, K . K., Gamborg, 0. L., and Constabel, F. (1974a). In vitro plant formation from stem explants of rape (Brassica napus cv. Zephyr). Physiol. Plant. 31, 217-220. Kartha, K. K., Gamborg, 0. L., Constabel, F., and Kao, K. N. (1974b).Fusion of rapeseed and soybean protoplasts and subsequent division of heterokaryocytes. Can. J . Bot. 52, 2435-2436. . of Kartha, K. K., Gamborg, 0. L., Constabel, F., and Shyluk, J . P. ( 1 9 7 4 ~ )Regeneration cassava plants from apical meristems. Plant Sci. Lett. 2, 107-113. Kartha, K. K., Michayluk, M. R., Kao, K. N., and Gamborg, 0. L. (1974d). Callus formation and plant regeneration from mesophyll protoplasts of rape plants (Brassica napus cu. Zephyr). Plant Sci.Lett. 3, 2 6 5 2 7 1 . Kartha, K. K., Gamborg, 0. L., Shyluk, J. P., and Constabel, F. (1976). Morphogenetic investigations on in vitro leaf culture of tomato (Lycopersicon esculentum Mill. cv. Starfire) and high frequency plant regeneration. 2 . Pflanzenphysiol. 77, 292-301. Kasperbauer, M. J., and Collins, G. B. (1972). Reconstitution of diploids from leaf tissue of anther-derived haploids in tobacco. Crop Sci. 12, 98-101. Kathju, S., and Tewari, M. N. (1973).Labdeu.,Part B 1 1 , 8 4 8 5 (quoted in Pierik, 1975). Kato, Y. (1975).Adventitious bud formation in etiolated stem segments and leafcallus of Heloniopsis orientalis (Liliaceae). Z . Pflanzenphysiol. 75, 211-216. Kaul, K., and Sabharwal, P. S. (1972). Morphogenetic studies on Haworthia: Establishment of tissue culture and control of differentiation. A m . J . Bot. 59, 377-385. Kavathekar, A. K., and Ganapathy, P. S. (1973). Embryoid differentiation in Eschscholtzia californica. Curr. Sci. 42, 671-673. Kawata, S., and Ishihara, A. (1968). The regeneration of rice plant, Oryza satiua L., in the callus derived from the seminal root. Proc. Jpn. Acad. 44, 549-553. Kefford, N. P., and Caso, 0. H. (1972).Organ regeneration on excised roots ofChondrilla juncea and its chemical regulation. Aust. J . Biol. Sci. 25, 691-706. Kehr, A. E., and Schaeffer, G. W. (1976). Tissue culture and differentiation of garlic. HortScience 11, 422-423. Keister, D. L. (1975). Acetylene reduction by pure cultures of rhizobia. J . Bacteriol. 123, 12651268. Keller, W. A,, and Armstrong, K. C. (1977). Embryogenesis and plant regeneration in Brassica napus anther cultures. Can. J . Bot. 55, 1383-1388. Keller, W. A,, and Melchers, G. (1973).The effect of high pH and calcium on tobacco leaf protoplast fusion. 2. Naturforsch., Teil B 28, 737-741. Keller, W. A,, Rajhathy, T., and Lacapra, J. (1975). In vitro production of plants from pollen in Brassica campestris. Can. J . Genet. Cytol. 17, 6 5 5 6 6 6 . Kerbauy, G. B., Hell, K. G., and Handro, W. (1976). Comparative growth of pith tissue from haploid and diploid plants ofNicotiana tabacum. Z . Pflanzenphysiol. 79, 455458. Khanna, P., and Staba, E. J. (1970). In vitro physiology and morphogenesis ofcheiranthus chezri var. Clott ofGold and C . cheiri var. Goliath. Bot. Gaz. (Chicago) 131, 1-5.
PLANT TISSUE CULTURES
195
Kim, K. K., Kunisaki, J. T., and Sagawa, Y . (1970). Shoot tip culture of dendrobiums. Am. Orchid SOC.Bull. 39, 1077-1080. Kimata, M., and Sakamoto, S. (1972). Production of haploid albino plants ofAegilops by anther culture. Jpn. J . Genet. 47, 61-63. Kimball, S. L., and Bingham, E. T. (1973). Adventitious bud development of soybean hypocotyl sections in culture. Crop Sci. 13, 75&760. Kimber, G., and Riley, R. (1963). Haploid angiosperms. Bot. Reu. 29, 480-531. King, P. J., Potrykus, I., and Thomas, E . (1978). In vitro genetics of cereals: Problems and perspectives. Physiol. Veg. 16, 381-399. Kitahara, E . H., and Caldas, L. S. (1975). Shoot and root formation in hypocotyl callus cultures of Eucalyptus. For. Sci. 21, 242-243. Kleinhofs, A., and Behki, R. (1977). Prospects for plant genome modificat.ion by nonconventional methods. Annu. Rev. Genet. 11, 7 9 1 0 1 . Kleinhofs, A,, Eden, F. C., Chilton, M. D., and Bendich, A. J. (1975). On the question of the integration of exogenous bacterial DNA into plant DNA. Proc. Natl. Acad. Sci. U.S.A. 72, 2748-2752. Klercker, J. A. (1892). Eine Methode zur Isolierung lebender Protoplasten. Oefvers. Vetenskaps akad., Stockholm 9, 463-471. Koblitz, H. (1975). Isolation and cultivation of protoplasts from callus culture of Catharanthus roseus. Biochem. Physiol. Pflanz. 167, 489-499. Koblitz, H. (1976). Isolation and cultivation of protoplasts from callus cultures of barley. Biochem. Physiol. Pflanz. 170, 287-293. Kochba, J., Spiegel-Roy, P., and Safran, H. (1972). Adventive plants from ovules and nucelli in Citrus. Planta 106, 237-245. Kohlenbach, H. W. (1965). Uber organisierte Bildungen aus Macleaya cordah Kallus. Planta 64, 37-40. Kohlenbach, H. W. (1967). Entwicklungspotenzen explanatierter und isolierter Dauerzellen. IV. Das organogene Differenzierungs-wachstum bei Macleaya cordata Kalli. 2. Pflanzenphysiol. 57, 305-309. Kohlenbach, H. W., and Bohnke, E. (1975). Isolation and culture of mesophyll protoplasts ofHyoscyamus niger L. var. annuus Sims. Experientia 31, 1281-1283. Kohlenbach, H. W., and Geier, T. (1972).Embryonen aus in vitro Kultivierten Antheren von Datura meteloides Dun., Datura wrightii Regel und Solanum tuberosum L. Z . Pflanzenphysiol. 67, 161-165. Kohlenbach, H. W., and Wernicke, W. (1978). Investigations on the inhibitory effect of agar and the function of active carbon in anther culture. 2. Pflanzenphysiol. 86, 463-472. KolaF, Z., Bartek, J., and Vystok, B. (1976). Vegetative propagation of the cactus Mamillaria woodsii Craig through tissue cultures. Experientia 32, 6 6 a 6 6 9 . Konar, R. N. (1963). A haploid tissue from the pollen ofEphedra foliata Boiss. Phytomorphology 13, 170-174. Konar, R. N., and Konar, A. (1966).Plantlet and flower formation in callus cultures from Phlox drummondii. Phytomorphology 16, 379-382. Konar, R. N., and Nataraja, K. (1965a). Experimental studies in Ranunculus sceleratus L. Development of embryos from the stem epidermis. Phytomorphology 15,132-137. Konar, R. N., and Nataraja, K. (1965b). Production of embryoids from the anthers of Ranunculus sceleratus L. Phytomorphology 15, 245-248. Konar, R. N., and Oberoi, Y. P. (19651. In vitro development of embryoids on the cotyledons of Biota orientalis. Phytomorphology 15, 137-140. Kukulezanka, K., and Suszynska, G. (1972). Regenerative properties of Saintpaulia ionantha Wendl. leaves cultured in vitro. Acta SOC.Bot. Pol. 41, 503-510.
196
INDRA K. VASIL
et al.
Kung, S. C. (1977).Expression ofchloroplast genomes in higher plants. Annu. Rev. Plant Physiol. 28, 401-437. Kung, S. D., Gray, J. C., Wildman, S. G., and Carlson, P. S. (1975). Polypeptide composition of Fraction 1protein from parasexual hybrid plants in the genus Nicotiana. Science 187, 353-355. Kunisaki, J. T. (1975). In vitro propagation of Cordyline terminalis (1.) Kunth. HortScience 10, 601-602. Kunisaki, J. T., Kim, K. K., and Sagawa, Y. (1972). Shoot tip culture of Vanda. A m . Orchid SOC.Bull. 41, 4 3 5 4 3 9 . Kurz, W.G. W., and LaRue, T. A. (1975). Nitrogenase activity in rhizobia in absence of plant host. Nature (London) 256, 407-409. Kuster, E.(1909). Uber die Verschmelzung nackter Protoplasten. Ber. Dtsch. Bot. Ges. 27, 589-598. Lakshmanan, K. K., and Janardhanan, K. (1977). Morphogenesis in leaf culture of Furcraea gigantea. Phytomorphology 27, 85-87. Landova, B., and Landa, Z. (1974). Organogenesis in callus culture ofGazania splendens Moore induced on new medium. Experientia 30, 832-834. Larkin, P. J . (1976).Purification and viability determinations ofplant protoplasts. Plunta 128, 213-216. Latta, R. (1971). Preservation of suspension cultures of plant cells by freezing. Can. J. Bot. 49, 1253-1254. Ledoux, L., Huart, R., and Jacobs, M. (1971). Fate of exogenous DNA in Arabidopsis thaliana. 11. Evidence for replication and preliminary results a t the biological level. I n “Informative Molecules in Biological Systems” (L. Ledoux, ed.), pp. 159-175. North-Holland Publ., Amsterdam. Ledoux, L., Huart, R., Mergeay, M., Charles, P., and Jacobs, M. (1975). DNA mediated genetic correction of thiamineless Arabidopsis thaliana. I n “Genetic Manipulations with Plant Materials” (L. Ledoux, ed.), pp. 499-517. Plenum, New York. Lee, C. W., Skirvin, R. M., and Janick, J . (1976). Propagation ofSalpiglossis sinuatu L. from leaf discs in tissue culture. HortScience 11, 321. Lee, E. C. M., and de Fossard, R. A. (1975). Regeneration of strawberry plants from tissue cultures. Proc. Znt. Plant Prop. Soc. 25, 277-285. Lescure, A. M. (1973). Selection of markers of resistance to base-analogues in somatic cell cultures of Nicotiana tubacum. Plant Sci. Lett. 1, 375-383. Letouze, R. (1974). Croissance du bourgeon axillaire d’une boutre de saule ( S a l k babylonica L.). en culture in vitro. Dominance apicale et qualite de la lumiere. Physiol. Veg. 12, 397-412. Levine, M. (1947). Differentiation of carrot root tissue grown in vitro. Bull. Torrey Bot. Club 74, 321-338. Lippincott, J. A,, and Lippincott, B. B. (1975). The genus Agrobacterium and plant tumorigenesis. Annu. Reu. Microbiol. 29, 377-405. Loh, C. S., Rao, A. N., and Goh, C . J. (1975).Clonal propagation from leaves in the orchid Aranda. Singapore Natl. Acad. Sci. 4, 97-99. Lurquin, P. F., and Behki, R. M. (1975). Uptake of bacterial DNA by Chlamydomonas reinhardi. Mutat. Res. 29, 35-51. Lurquin, P. F., and Hotta, Y. (1975). Reutilization of bacterial DNA by Arabidopsis thaliana cells in tissue culture. Plant Sci. Lett. 5, 103-112. Lurquin, P.F., and Kado, C. I. (1977). Escherichia coli plasmid pBR313 insertion into plant protoplasts and into their nuclei. Mol. Gen. Genet. 154, 113-122.
PLANT TISSUE CULTURES
197
Lustinec, J., and Horak, J. (1970). Induced regeneration of plants in tissue cultures of Brassica oleracea. Experientia 26, 919-920. Ma, S., and Shii, C. (1972). J . Hortic. Sci., China 18, 135-142 (quoted from Murashige, 1974). McComb, J. A., and McComb, A. J. (1977). The cytology of plantlets derived from cultured anthers of Nicotiana sylvestris. New Phytol. 79, 679-688. McComb, J. A., Elliott, J., and Dilworth, M. J. (1975). Acetylene reduction byRhizobium in pure culture. Nature (London) 256, 409-410. McCoy, T. J., and Bingham, E. T. (1977). Regeneration ofdiploid alfalfa plants from cells grown in suspension culture. Plant Sci. Lett. 10, 59-66. Magoon, M. L., and Khanna, K. R. (1963). Haploids. Caryologia 16, 191-235. Magrum, L. J., and Steponkus, P. L. (1972). Differentiation of callus cultures ofHedera helix L. var. Thorndale. HortScience 7, 339. Maheshwari, P., and Baldev, B. (1962). In vitro induction of adventive buds from embryos of Cuscuta reflexa Roxb. In “Plant Embryology-A Symposium” (P. Maheshwari, ed.), pp. 129-138. Counc. Sci. & Ind. Res., New Delhi. Maheshwari, S. C., and Gupta, G. R. P. (1965). Production of adventitious embryoids in vitro from stem callus of Foenicutum vulgare. Planta 67, 384-386. Majumdar, S. K. (1970). Production of plantlets from the ovary wall of Haworthia turgida var. pallidifolia. Planta 90, 212-214. Majumdar, S. K., and Schlosser, S. A. (1972). Morphological and histological studies of the effects of sodium cyclamate on Haworthia callus in vitro. Can. J. Bot. 50, 1013-1016. Malepszy, S . (1975). A contribution to the production of haploids in rye, Secale cereale L. Bull. Acad. Sci. Pol. 23, 167-172. Malhotra, K., and Maheshwari, S. C. (1977). Enhancement by cold treatment of pollen embryoid development in Petunia hybrida. 2. Pflanzenphysiol. 85, 177- 180. Maliga, P., Marton, L., and Sz.-Breznovits, A. (1973a). 5-Bromodeoxyuridine-resistant cell lines from haploid tobacco. Plant Sci. Lett. 1, 119-123. Maliga, P., Sz.-Breznovits, A,, and Marton, L. (197313). Streptomycin-resistant plants from callus culture of haploid tobacco. Nature fLondon), New Biol. 244, 29-30. Maliga, P., Sz-Breznovits, A., Larton, L., and Joo, F. (1975). Non-mendelian streptomycin-resistant tobacco mutant with altered chloroplasts and mitochondria. Nature (London) 255, 401-402. Maliga, P., Gabriella, L., Joo, F., Nagy, A. H., and Menczel, L. (1977). Restoration of morphogenic potential in Nicotiana by somatic hybridization. Mol. Gen. Genet. 157, 291-296. Maretzki, A,, and Nickell, L. G. (1973). Formation of protoplasts from sugarcane cell suspensions and the regeneration of cell cultures from protoplasts. Colloq. Int. C.N.R.S. 212, 51-63. Margara, J. (1969). Etude des facteurs de la neoformation de Bourgeons en culture in vitro chez le chou-fleur (Brassica oleracea L. var. botrytis). Ann. Physiol. Veg. 11, 95-112. Margara, J. (1970). Neoformation de bourgeons in vitro chez la Betterave sucriere, Beta vulgaris L. C.R. Hebd. Seances Acad. Sci., Ser. D 270, 698-701. Margara, J.,and Rancillac, M. (1966).Observations preeliminaires sur le rble du milieu nutritif dans l’initiation florale des bourgeons neoformes in vitro chez Cichorturn intybus L. C.R. Hebd. Seances Acad. Sci., Ser. D 263, 1455-1458. Marton, L., and Maliga, P. (1975). Control of resistance in tobacco cells to 5-bromodeoxyuridine by a simple Mendelian factor. Plant Sci. Lett. 5 , 77-81.
198
INDRA K. VASIL
et al.
Mascarenhas, A. F., Pathak, M., Hendre, R. R., Ghugale, D. D., and Jagannathan, V. (1975). Tissue cultures of maize, wheat, rice and sorghum. IV. Studies of organ differentiation in tissue cultures of maize, wheat and rice. Indian J . Exp. Biol. 13, 116- 119. Mascarenhas, A. F.,Hendre, R. R., Nadgir, A. L., Ghugale, D. D., Godbole, D. A., Prabhu, R. A., and Jagannathan, V. (1976). Development ofplantlets from cultured tissues of Dioscorea deltoidea wall. Indian J . Exp. Biol. 14, 604-606. Mascarenhas, J. P. (1971). RNA and protein synthesis during pollen development and tube growth. I n “Pollen-Development and Physiology” (J. Heslop-Harrison, ed.),pp. 201-222. Butterworth, London. Mascarenhas, J. P. (1975). The biochemistry of angiosperm pollen development. Bot. Rev. 41, 259-314. Masteller, V. J., and Holden, D. J. (1970). The growth of and organ formation from callus tissue of sorghum. Plant Physiol. 45, 362-364. Mathews, V. H., and Narayanaswamy, S. (1976). Phytohormone control of regeneration in cultured tissues o f flax. 2. Pflanzenphysiol. 80, 436-442. Mathews, V. H., Rangan, T. S., and Narayanaswamy, S. (1976). Micropropagation of Ananas sativus in vitro. 2. Pflanzenphysiol. 79, 450-454. Matthews, P. S., and Vasil, I. K. (1976). The dynamics ofcell proliferation in haploid and diploid tissues of Nicotiana tabacum. 2. Pflanzenphysiol. 77, 222-236. Matsuzawa, Y., and Sato, K. (1972). Callus formation and organogenesis in tissue culture ofMontbretia crocosmaeflora Lemoine. Bull. Coll. Agric., Utsunomiya Univ. 8, 9-17. Maul, G. G., Steplewski, Z., Weibel, J., and Koprowski, H. (1976). Time sequence and morphological evaluations of cells fused by polyethylene glycol 6000. In Vitro 12, 787-796. Mayer, L. (1956). Wachstum und Organbildung an in vitro kultivierten Segmenten von Pelargonium zonale und Cyclamen persicum. Planta 47, 401-446. Mayo, M. A,, and Cocking, E. C. (1969). Pinocytotic uptake of polystyrene latex particles by isolated tomato fruit protoplasts. Protoplasma 68, 223-230. Mehra, A,, and Mehra, P. N. (1972). Differentiation in callus cultures of Mesembryanthemum floribundum. Phytomorphology 22, 171-176. Mehra, A,, and Mehra, P. N. (1974). Organogenesis and plantlet formation in vitro in almond. Bot. Gaz. (Chicago) 135, 61-73. Mehra, P. N., and Mehra, A. (1971). Morphogenetic studies in Pterotheca falconeri. Phytomorphology 21, 174-192. Mehra, P. N., and Palta, H. K. (1971).In vitro controlled-differentiation o f root callus o f Cyclosorus dentatus. Phytomorphology 21, 367-375. Melchers, G. (1977a). Kombination somatischer und konventioneller Genetik fur die Pflanzenzuchtung. Naturwissenschaften 64, 184- 194. Melchers, G. (1977b).Microbial techniques in somatic hybridization by fusion of protoplasts I n “International Cell Biology 1976-1977” (B. R. Brinkley and K. R. Poerter, eds.), pp. 207-215. Rockefeller Univ. Press, New York. Melchers, G., and Labib, G. (1974). Somatic hybridization of plants by fusion of protoplasts. I. Selection of light resistant hybrids of “haploid light sensitive varieties of tobacco. Mol. Gen. Genet. 135, 277-294. Messerschmidt, M. (1974).Kallusbildung und Differenzierung aus isoliertern Protoplasten von Pharbitis nil. Z. Pflanzenphysiol. 74, 175-178. Meyer, M. M. (1976). Propagation ofdaylilies by tissue culture.HortScience 11,485-487.
PLANT TISSUE CULTURES
,199
Michel, W. (1937). Uber die experimentelle Fusion pflanzlicher Protoplasten. Arch. Exp. Zellforsch. Besonders Gewebezuecht. 20, 230-252. Mii, M. (1976).Relationships between anther browning and plantlet formation in anther culture of Nicotiana tabacum L. 2. Pflanzenphysiol. 80, 206-214. Mii, M., Mori, T., and Iwase, N. (1974). Organ formation from the excised bulb scales of Hippeastrum hybridum in vitro. J . Hortic. Sci. 49, 241-244. Miller, L. R., and Murashige, T. (1976). Tissue culture propagation of tropical foliage plants. In Vitro 12, 797-813. Miszke, W., and Skucinska, B. (1976). In vitro propagation of Brassica oleracea var. capitata L.f alba. 2. Pflanzenphysiol. 76, 81-82. Mitra, G. C., and Chaturvedi, H. C. (1970). Fruiting plants from in vitro grown leaf tissue of Rauwolfia serpentina Benth. Curr. Sci. 39, 1 2 S 1 2 9 . Mitra, G. C., and Chaturvedi, H. C. (1972).Embryoids and complete plants from unpollinated ovaries and from ovules of in vivo grown emasculated flower buds of Citrus spp. Bull. Torrey Bot. Club 99, 184-189. Mohan Ram, H. Y., and Wadhi, M. (1965). Culture of excised leaves and leaf explants of Kalanchoe pinnata Pers. I n “Tissue Culture” ( C . V. Ramakrishnan, ed.), pp. 274282. Junk Publ., The Hague. Monsion, M., and Dunez, J. (1971). Obtention de jeunes plants de Prunus mariana a partir de boutures cultivees in vitro. C.R. Hebd. Seances Acad. Sci., Ser. D 272, 1861-1 864. Montaldi, E. R. (1972). Kinetin induction of bud differentiation on roots of entire plants. 2. Pflanzenphysiol. 67, 43-44. Montezuma-de-Carvalho, J., Ludovina, M., and Guimaraes, L. (1974). Production of buds and plantlets from the stamen filaments of Lilium regale cultivated in vitro. Biol. Plant. 16, 472. Morel, G. (1960). Producing virus-free Cymbidiums. A m . Orchid SOC.Bull. 29,495-497. Morel, G. (1964). Tissue culture-a new means of clonal propagation in orchids. A m . Orchid Soc. Bull. 33, 473-478. Morel, G. (1965). Clonal propagation of orchids by meristem culture. Cymbidium Soc. News 20, 3-11. Morel, G. (1975). Meristem culture techniques for the long-term storage of cultivated plants. I n “Crop Genetic Resources for Today and Tomorrow” (0.H. Frankel and J. G. Hawkes, eds.), pp. 327-332. Cambridge Univ. Press, London and New York. Morselli, M., Katagiri, K. J.,and Ehrlich, A. D. (1974). Gnotoculture of apical meristems of sugar maple (Acer saccharum Marsh.). Int. Congr. Plant Tissue Cult., 3rd, 1974 Abstract, p. 159. Muller, A. J . , and Grafe, R. (1978). Isolation and characterization of cell lines of Nicotiana tabacum lacking nitrate reductase. Mol. Gen. Genet. 161, 67-76. Mullins, M. G., and Srinivasan, C. (1976). Somatic embryos and plantlets from an ancient clone of the grapevine (cv. Cabernet-Sauvignon) by apomixis in vitro. J . Exp. Bot. 27, 1022-1030. Murashige, T. (1974). Plant propagation through tissue cultures. Annu. Reu. Plant Physiol. 25, 1 3 5 1 6 6 . Murashige, T., and Skoog, F. (1962).A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol. Plant. 15, 473-497. Murashige, T., Shabde, M. N., Hasegawa, P. M., Takatori, F. H., and Jones, J. B. (1972). Propagation of asparagus through shoot apex culture. I. Nutrient medium for formation of plantlets. J . A m . Soc. Hortic. Sci. 97, 1 5 S 1 6 1 .
200
INDRA K.
vAsm et al.
Murashige, T., Serpa, M., and Jones, J. B. (1974). Clonal multiplication of gerbera through tissue culture. HortScience 9, 175-180. Nadgauda, R. S., Mascarenhas, A. F., Hendre, R. R., and Jagannathan, V. (1978). Rapid multiplication of turmeric (Curcuma longa Linn.) plants by tissue culture. Indian J . Exp. Biol. 16, 120-122. Nag, K. K., and Street, H. E. (1973). Carrot embryogenesis from frozen cultured cells. Nature (London) 245, 270-272. Nag, K. K., and Street, H. E. (1975a). Freeze preservation of cultured plant cells. I. The pretreatment phase. Physiol. Plant. 34, 254-260. Nag, K. K., and Street, H. E. (197513).Freeze preservation of cultured plant cells. 11. The freezing and thawing phases. Physiol. Ptunt. 34, 261-265. Nagata, T., and Takebe, I. (1971). Plating of isolated tobacco mesophyll protoplasts on agar medium. Planta 99, 12-20. Nagy, J . I., and Maliga, P. (1976). Callus induction and plant regeneration from mesophyll protoplasts of Nicotiana syluestris. Z. Pflanzenphysiol. 78, 453-455. Naithani, S. P. (1937). Chromosome studies in Hyacinthus orientalis L. 111. Reversal of sexual state in the anthers of H . orientalis L. var. Yellow Hammer. Ann. Bot. (London) 1, 369-377. Nakamura, A,, Yamada, T., Kadotani, N., and Itagaki, R. (1974). Improvement of flue-cured tobacco variety MC1610 by means of haploid breeding method and some problems of this method, I n “Haploids in Higher Plants” (K. J . Kasha, ed.) pp. 277-278. University of Guelph, Guelph. Nakata, K., and Tanaka, M. (1968).Differentiation of embryoids from developing germ cells in anther culture of tobacco. Jpn. J . Genet. 43, 67-71. Nakayama, F. (1966). In vitro culture of tissues ofPassiflora cuerulea. Rev. Fac. Agron., Uniu. Nac. La Platu 42, 63-74. Narayanaswamy, S., and Chandy, L. P. (1971).In vitro induction ofhaploid, diploid and triploid androgenic embryoids and plantlets in Datura metel L. Ann. Bot. (London) 35, 535-542. Narayanaswamy, S., and George, L. (1972). Morphogenesis of belladonna (Atropa belladona L.) plantlets from pollen in culture. Indian J . Exp. Biol. 10, 382-384. Nataraja, K. (1971).Int. Symp. Morphog. Plant Cell, Tissue Organ Cult., 1971 pp. 1-66. Nataraja, K. (1975). Morphogenesis in embryonal callus ofEuphorbia pulcherrima L. in vitro. Curr. Sci. 44, 136. Negrutiu, I., Beeftink, F., and Jacobs, M. (1975).Arabidopsis thuliana as a model system in somatic cell genetics. I. Cell and tissue culture. Plant Sci. Lett. 5, 293-304. Negrutiu, I., Jacobs, M., and Cachita, D. (1978). Some factors controlling in vitro morphogenesis of Arabidopsis thaliana. Z. Pflanzenphysiol. 86, 113-124. Nemec, B. (1898). Uber den Pollen der petaloiden Antheren vonHyacinthus orientalis L. Rozpr. Cesk. Akad. 2, 7 (17). Neikovit, M., and RadojeviC, L. (1973). The growth of and morphogenesis in tissue cultures of Spinacea oleracea L. Bull. Inst. Jardin Bot., Uniu. Beograd 8, 35-37. Netien, G., and Raynaud, J. (1972). Formation dembryons dans la culture in vitro de tissues de Conium maculatum L. Bull. Mens. SOC.Linn. Lyon 41, 49-51. Newton, W. E., and Nyman, C. J., eds. (1976). “Nitrogen Fixation,” Vols. 1 and 2. Washington State Univ. Press, Pullman. Niizeki, H., and Oono, K. (1968). Induction of haploid rice plant from anther culture. Proc. Jpn. Acad. 44, 554-557. Niizeki, H., and Oono, K. (1971). Rice plants obtained by anther culture. Colloq. Int. C.N.R.S. 193,251-257.
PLANT TISSUE CULTURES
201
Niizeki, M., and Grant, W. F. (1971). Callus, plantlets formation, and polyploidy from cultured anthers of Lotus and Nicotiana. Can. J . Bot. 49, 2041-2051. Nishi, T., and Mitsuoka, S. (19691. Occurrence of various ploidy plants from anther and ovary culture of rice plant. Jpn. J . Genet. 44, 341-346. Nishi, T., Yamada, Y., and Takahashi, E. (1968). Organ redifferentiation and plant restoration in rice callus. Nature (London) 219, 5 0 g 5 0 9 . Nishi, T., Yamada, Y., and Takahashi, E. (1973). The role of auxins in differentiation of rice tissues cultured in vitro. Bot. Mag. 86, 183-188. Nishimura, M., Graham, D., and Akazawa, T. (1976). Isolation of intact chloroplasts and other cell organelles from spinach leaf protoplasts. Plant Physiol. 58, 309-314. Nitsch, C. (1974). La culture de pollen isole sur milieu synthetique. C.R. Hebd. Seances Acad. Sci.,Ser. D. 278, 1031-1034. Nitsch, C., and Nitsch, J. P. (1967).The induction of flowering in vitro in stem segments of Plumbago indica L. I. The production of vegetative buds. Planta 72, 355-370. Nitsch, C., and Norreel, B. (1972). Factors favoring the formation of androgenetic embryos in anther culture. In “Genes, Enzymes and Populations” (A. Srb, ed.), pp. 129-144. Plenum, New York. Nitsch, C., and Norreel, B. (1973). Effect d‘un choc thermique sur le pouvoir embryogene du pollen de Datura innoxia cultive dans I’anthere ou isole de l’anthere. C.R. Hebd. Seances Acad. Sci., Ser. D 276, 303-306. Nitsch, J. P. (1969). Experimental androgenesis in Nicotiana. Phytomorphology 19, 389-404. Nitsch, J. P. (1972). Haploid plants from pollen. Z. Pflanzenzuecht. 67, 3-18. Nitsch, J. P., and Nitsch, C. (1969). Haploid plants from pollen grains. Science 163, 8587. Nitsch, J. P., and Nitsch, C. (1970). Obtention de plantes haploides a partir de pollen. Bull. SOC.Bot. Fr. 117, 339-360. Nitzsche, W. (1970). Herstellung haploider Pflanzen aus Festuca-Loliurn-Bastarden. Naturwissenschaften 57, 199-200. Nitzsche, W., and Wenzel, G. (1977). Haploids in plant breeding. Fortschr. Pflanzenzuecht. 8, 1-101. Norstog, K. (1965). Induction of apogamy in megagametophytes of Zamia integrifolia. A m . J . Bot. 52, 993-999. Norstog, K. (1970). Induction of embryo-like structures by kinetin in cultured barley embryo. Dev. Biol. 23, 665-670. Norstog, K., and Rhamstine, E. (1967). Isolation and culture of haploid and diploid cycad tissues. Phytomorphology 17, 374-381. Norton, J. P., and Boll, W. G. (1954).Callus and shoot formation from tomato roots in vitro. Science 119, 220-221. Novak, F. J. (1974). Induction of a haploid callus in anther cultures of Capsicum sp. Z. Pfianzemuecht. 72, 46-54. Nuti, M. P., Ledeboer, A. M., Lepidi, A. A,, and Schilperoort, R. A. (1977). Large plasmids in different Rhizobium species. J . Gen. Microbiol. 100, 241-248. Ohyama, K. (1974). Properties of 5-bromodeoxyuridine-resistantlines of higher plant cells in liquid culture. Exp. Cell Res. 89, 31-38. Ohwma, K., and Nitsch, J. P. (1972). Flowering haploid plants obtained from protoplasts of tobacco leaves. Plant Cell Physiol. 13, 229-236. Ohyama, K., Gamborg, 0. L., and Miller, R. A. (1972). Uptake of exogenous DNA by plant protoplasts. Can. J . Bot. 50, 2077-2080. Ohyama, K., Gamborg, 0. L., Shyluk, J. P., and Miller, R. A. (1973). Studies on trans-
202
INDRA K . VASIL
et al.
formation: Uptake ofexogenous DNA by plant protoplasts. Colloq. Znt. C.N.R.S. 212, 423-428. Oka, S., and Ohyama, K. (1974). Shoot formation from callus ofBroussonetia kazinoki Jpn. 43, 289-290. Sieb. Proc. Crop Sci. SOC. Olesen, M.N., and Fonnesbech, M. (1975).Phlor plants from shoot tips. Acta Hortic. 54, 95-99. Ono, H., and Larter, E. N. (1973). In vitro formation of embryoids and plantlets from triticale pollen. J p n . J. Breed. 23, Suppl. 2, 4 5 . Ono, K., and Tsukida, T. (1978). Haploid callus formation from anther cultures in a cultivar of Paeonia. Jpn. J. Genet. 53, 51-54. Oswald, T. H., Smith, A. E., and Phillips, D. V. (1977a).Callus and plantlet regeneration from cell cultures of landino clover and soybean. Physiol. Plant. 39, 129-134. Oswald, T. H., Smith, A. E., and Phillips, D. V. (197713).Herbicide tolerance developed in cell suspension cultures of perennial white clover. Can. J . Bot. 55, 1351-1358. Ouyang, T.,Hu, H., Chuang, C., and Tseng, C. (1973). Induction of pollen plants from anthers of Triticum aestiuum L. cultured in vitro. Sci. Sin. 16, 79-95. Padmanabhan, V., Paddock, E. F., and Sharp, W. R. (1974). Plantlet formation from Lycopersicon esculentum leaf callus. Can. J . Bot. 52, 1429-1432. Pagan, J. D., Child, J. J., Scowcroft, W. R., and Gibson, A. H. (1975). Nitrogen fixation by Rhizobium cultured on a defined medium. Nature (London) 256, 406-407. Palmer, J. E., and Widholm, J. (1975). Characterization of carrot and tobacco cell cultures resistant to p-fluorophenylalanine. Plant Physiol. 56, 233-238. Paranjothy, K. (1974). Induced mot and embryoid differentiation in Hewa tissue cultures. Tissue Cult. Plant Sci., Proc. Znt. Congr. Plant Tissue Cell Cult., 3rd, 1974 Abstract, p. 67. Partanen, C. R. (1963). Plant tissue culture in relation to developmental cytology. Int. Reu. Cytol. 15, 215-243. Paulet, P., and Nitsch, J. P. (1963). fitude preliminaire du bourgeonnement in vitro de Nicotiana glauca, N. suaueolens et leur hybride. Bull. SOC.Bot. F r . 110, 361-366. Pelcher, L. E., Gamborg, 0. L., and Kao, K. N. (1974). Bean mesophyll protoplasts: Production, culture and callus formation. Plant Sci. Lett. 3, 107-111. Pelletier, G., and Ilami, M. (1972). Les facteurs de l’androgenese in vitro chez Nicotiana tabacum. 2. Pflanzenphysiol. 68, 97-114. Pelletier, G., and Pelletier, A. (1971). White clover (Trzfolium repens) tissue culture in vitro: Variability of regenerated plants. Ann. Amelior. Plant. 21, 221-233. Pelletier, G., Raquin, C., and Simon, G. (1972). La culture in vitro dantheres d‘Asperge (Asparagus officinalis). C.R. Hebd. Seances Acad. Sci., Ser. D 274,848-851. Phillips, D.A. (1974). Factors affecting the reduction of acetylene by Rhizobium-soybean cell associations in vitro. Plant Physiol. 53, 67-72. Pierik, R. L. M. (1967). “Regeneration, Vernalization and Flowering in Lunaria.” Veenman & Zonen, Wageningen. Pierik, R. L. M. (1975). Vegetative propagation of horticultural crops in vitro with special attention to shrubs and trees. Acta Hortic. 54, 71-82. Pierik, R. L. M. (1976). Anthurium andrueanum plantlets produced from callus tissues cultivated in vitro. Neth. J . Agric. Sci. 23, 334-337. Pierik, R. L. M., and Ippel, B. J. (1977). Plantlet formation from excised bulb scale segments of Nerine. Acta Hortic. 78, 197-202. Pierik, R. L. M., and Post, S. J. M. (1975). Rapid vegetative propagation ofHyucinthus orientalis L. in vitro. Sci. Hortic. 3, 293-297. Pierik, R. L. M., and Ruibing, M. A. (1973). Regeneration of bulblets on bulb scale segments of hyacinth in vitro. Neth. J . Agric. Sci. 21, 129-138.
PLANT TISSUE CULTURES
203
Pierik, R. L. M., and Steegmans, H. H. M. (1975). Freesia plantlets from flower buds cultivated in vitro. Neth. J . Agric. Sci. 23, 334-337. Pierik, R. L. M., and Steegmans, H. H. M. (1976a). Vegetative propagation ofAnthurium scherzerianum Schott through callus cultures. Sci. Hortic. 4, 291-292. Pierik, R. L. M., and Steegmans, H. H. M. (1976b). Vegetative propagation of Freesia through the isolation of shoots in vitro. Neth. J . Agric. Sci. 24, 274-277. Pierik, R. L. M., Steegmans, H. H. M., and Marelis, J. J . (1973).Gerbera plantlets from in vitro cultivated capitulum explants. Sci. Hortic. 1, 117-119. Pierik, R. L. M., Steegmans, H. H. M., and van der Meys, J. A. J. (1974). Plantlet formation in callus tissues ofAnthurium andreanum Lind. Sci. Hortic. 2, 1 9 S 1 9 8 . Pierik, R. L. M., Jansen, J . L. M., Maasdam, A,, and Binnendijk, C. M. (1975). Optimalization ofGerbera plantlet production from excised capitulum explants. Sci. Hortic. 3, 351-357. Pillai, S. K., and Hildebrandt, A. C. (1969). Induced differentiation of Geranium plants from undifferentiated callus in vitro. Am. J . Bot. 56, 52-58. Poirier-Hamon, S., Rao, P. S., and Harada, H. (1974). Culture of mesophyll protoplasts and stem segments of Antirrhinum wju (Snapdragon): Growth and organization of embryoids. J . Exp. Bot. 25, 752-760. Polacco, J. C., and Polacco, M. L. (1977). Inducing and selecting valuable mutation in plant cell culture: A tobacco mutant resistant to carboxin.Ann. N.Y. Acad. Sci. 287, 385400. Pontecorvo, G. (1975a). Production of mammalian somatic cell hybrids by means of polyethylene glycol treatment. Somatic Cell Genet. 1, 397-400. Pontecorvo, G. (197513). “Alternatives to sex”: Genetics by means of somatic cells. I n “Modification of the Information Content of Plant Cells” (R. Markham et al., eds.), pp. 1- 14. North-Holland Publ., Amsterdam. Potrykus, I. (1973a). Transplantation ofchloroplasts into protoplasts. Z. Pflunzenphysiol. 70, 364-366. Potrykus, I. (197313). Isolation, fusion and culture of protoplasts from petunia. I n “Yeast, Mould and Plant Protoplasts” (J.R. Villanueva et al., eds.), pp. 319-330. Academic Press, New York. Potrykus, I. (1975). Uptake of cell organelles into isolated protoplasts. I n “Modification of the Information Content of Plant Cells” (R. Markham et al., eds.), pp. 1 6 9 1 7 9 . North-Holland Publ., Amsterdam. Potrykus, I., and Hoffmann, F. (1973). Transplantation of nuclei into protoplasts of higher plants. Z. PfZanzenphysiol. 69, 287-289. Potrykus, I., Harms, C. T., Lorz, H., and Thomas, E. (1977). Callus formation from stem protoplasts of corn (Zea mays L.1. Mol. Gen. Genet. 156, 347-350. Power, J. B., and Cocking, E. C. (1968). A simple method for the isolation of very large numbers of leaf protoplasts by using mixtures of cellulase and pectinase. Biochem. J . 111, 33p. Power, J. B., and Cocking, E. C. (1970). Isolation of leaf protoplasts: Macromolecule uptake and growth substance response. J . Exp. Bot. 21, 64-70. Power, J. B., Cummins, S. E., and Cocking, E. C. (1970). Fusion of isolated plant protoplasts. Nature (London) 255, 101f%1018. Power, J. B., Frearson, E. M., Hayward, C., and Cocking, E. C. (19751. Some consequences of the fusion and selective culture of Petunia and Parthenocissus protoplasts. Plant Sci. Lett. 5, 197-201. Power, J. B., Frearson, E. M., George, D., Evans, P. K., Berry, S. F., Hayward, C., and Cocking, E. C. (1976a). The isolation, culture and regeneration of leafprotoplasts in the genus Petunia. Plant Sci. Lett. 7,51-56.
204
INDRA K. VASIL
et al.
Power, J . B., Frearson, E. M., Hayward, C., George, D., Evans, P. K., Berry, S. F., and Cocking, E. C. (1976b). Somatic hybridization of Petunia hybrida and P. parodii. Nature (London) 263, 500-502. Prabhudesai, V. R., and Narayanaswamy, S. (1974). Organogenesis in tissue cultures of certain Asclepiads. 2. Pflanzenphysiol. 71, 181-185. Putz, C. (1974). Obtention de framboisiers (var. Bois Blanci sans virus par la technique des cultures de meristltmes. Ann. Phytopathol. 3, 493-501. Quatrano, R. S. (1968). Freeze-preservation of cultured flax cells utilizing dimethyl sulfoxide. Plant Physiol. 43, 2057-2061. Quazi, H. M. (1978). Regeneration of plants from anthers of broccoli (Brassica oleracea L.1. Ann. Bot. (London) 42,473-475. Quoirin, M. (1974). Premiers resultats obtenus dans la culture in vitro du meristeme apical de sujets porte-greffe de pommier. Bull. Rech. Agron. Gembloux 9,189-192. Quoirin, M., Boxus, P., and Gaspar, T. (1974). Root initiation and isoperoxidases ofstem tip cuttings from mature Prunus plants. Physiol. Veg. 12, 165-174. Rabechault, H., and Martin, J. (1976). Vegetative propagation of oil palm (Elaeis guineensis Jacq.) by leaf tissue cultures. C.R. Hebd. Seances Acad. Sci., Ser. D 283, 1735-1 738. Radojevic, L., VujiCii5, R., and NeSkovic, M. (1975). Embryogenesis in tissue culture of Corylus avellana L. 2. Pflanzenphysiol. 77, 33-41. Raghavan, V. (1975). Induction of haploid plants from anther cultures of henbane. Z. Pflanzenphysiol. 76, 89-92. Raghavan, V. (1976).Role of the generative cell in androgenesis in henbane. Science 191, 3 8 a 3 89. Raghavan, V. (1977). Patterns of DNA synthesis during pollen embryogenesis in henbane. J . Cell Biol. 73,521-526. Raina, S. K., and Iyer, R. D. (1973). Differentiation of diploid plants from pollen callus in anther cultures of Solanum melongena. 2. Pflanzenzuecht. 70,275-280. Raju, M. V. S.,and Mann, H. E. (1970). Regenerative studies on the detached leaves of Echeveria elegans. Anatomy and regeneration of leaves in sterile culture. Can. J . Bot. 48, 1887-1891. Raman, K. (1977). Rapid multiplication of Streptocarpus and Gloxinia from in vitro cultured pedicel segments. 2. Pflanzenphysiol. 83, 411-418. Raman, K., and Greyson, R. I. (1974). In vitro induction ofembryoids in tissue cultures of Nigella damascena. Can. J . Bot. 52, 1 9 8 a 1 9 8 9 . Rangan, T. S.(1976). Growth and plantlet regeneration in tissue cultures ofsome Indian millets: Paspalum scrobiculatum L., Eleusine coracana Gaertn. and Pennisetum typhoideum. 2. Pflanzenphysiol. 78, 208-216. Rangan, T. S., Murashige, T., and Bitters, W. P. (1968). In vitro initiation of nucellar embryos in monoembryonic Citrus. HortScience 3, 2 2 6 2 2 7 . Rangaswamy, N. S. (1961). Experimental studies on female reporductive structures of Citrus microcarpa Bunge. Phytomorphology 11, 109-127. Rangaswamy, N. S., and Promila (1972). Morphogenesis of the adult embryo of Azadirachtu indica A. Juss. 2. Pflanzenphysiol. 67, 337-379. Rao, P. S. (1965). In vitro induction of embryonal proliferation in Santalum album L. Phytomorphology 15, 175- 179. Rao, P. S., and Narayanaswamy, S.(1968).Induced morphogenesis in tissue cultures of Solanum ranthocarpurn. Planta 81, 372-375. Rao, P. S., and Narayanaswamy, S. (1972). Morphogenetic investigations in callus cultures of Tylophora indica. Physiol. Plant. 27, 271-276.
PLANT TISSUE CULTURES
205
Rao, P. S., Narayanaswamy, S., and Benjamin, B. D. (1970). Differentiation ex-ovulo of embryos and plantlets in stem tissue cultures of Tylophora indica. Physiol. Plant. 23, 140-144. Rao, P. S., Handro, W., and Harada, H. (1973). Bud formation and embryo differentiation in in vitro cultures of Petunia. 2.Pflanzenphysiol. 69, 87-90. Raquin, C., and Pilet, V. (1972). Production de plantules a partir dantheres de Petunias cultivees in vitro. C.R. Hebd. Seances Acad. Sci., Ser. D 274, 1019-1022. Rashid, A., and Street, H. E. (1973). The development ofhaploid embryoids from anther cultures of Atropa belladonna L. Planta 113, 263-270. Raste, A. P., and Ganapathy, P. S. (1971). In vitro behaviour of inflorescence segments of Mazus pumilus. Phytomorphology 20, 367-374. Rathnam, C. K. M., and Edwards, G. E. (1976). Protoplasts as a tool for isolating functional chloroplasts from leaves. Plant Cell Physiol. 17, 117-186. Raveh, D., and Galun, E. (1975). Rapid regeneration of plants from tobacco protoplasts plated a t low densities. 2. Pflanzenphysiol. 76, 7G79. Reddy, K. B. S. M., and Narayana, R. (1971). Znt. Symp. Morphog. Plant Cell, Tissue Organ Cult., 1971 pp. 31-32. Redei, G. P. (1975). Arabidopsis as a genetic tool. Annu. Reu. Genet. 9, 111-127. Reinert, J. (1958a). Untersuchungen iiber die Morphogenese an Gewebekulturen. Ber. Dtsch. Bot. Ges. 71, 15. Reinert, J. (195813).Morphogenese und ihre Kontrolle an Gewebekulturen aus Karotten. Naturw issenschaften 45, 244-245. Reinert, J. (1959). Uber die Kontrolle der Morphogenese und die Induktion von Adventivembryonen an Gewebekulturen aus Karotten. Planta 53, 318-338. Reinert, J., and Gosch, G. (1976). Continuous division of heterokaryons from Daucus carota and Petunia hybrida protoplasts. Naturwissenschaften 63, 534. Reinert, J., Backs, D., and Krossing, M. (1966). Faktoren der Embryogenese in Gewebekulturen aus Umbelliferen. Planta 68, 375-378. Restool, D. (1965). Doctoral Dissertation, Michigan State University, East Lansing. Robb, S. M. (1957). The culture of excised tissue from bulb scales of Lilium speciosum Thun. J . Exp. Bot. 8, 348-352. Roest, S., and Bokelmann, G. S. (1973). Vegetative propagation of Chrysanthemum cinerariaefolium in vitro. HortScience 1, 120-122. Roest, S . , and Bokelmann, G. S. (1976).Vegetative propagation ofSolanurn tuberosum L. in vitro. Potato Res. 19, 173-178. Rogozinska, J. H. (1969).Bull. Acad. Pol. Sci. 17, 721-725 (quoted in Pierik, 1975). Sabharwal, P. S. (1963). In vitro culture of ovules, nucelli, and embryos of Citrus reticulata Blanco var. Nagpuri. Plant Tissue Organ Cult., Symp., 1961 pp. 265274. Sacristan, M. D., and Melchers, G. (1977). Regeneration of plants from “habituated” and “Agrobacterium-transformed” single-cell clones of tobacco. Mol. Gen. Genet. 152, 111-117. Sadhu, M. K. (1974). Effects of different auxins on growth and differentiation in callus tissue derived from sunflower stem pith. Indian J . Exp. Biol. 12, 110-111. Sadouk Bouzid, M. (1975). Some aspects of the behavior of in vitro cultures of Citrus cuttings. C.R. Hebd. Seances Acad. Sci., Ser. D 280, 1689-1692. Sagawa, Y., and Shoji, T. (1967). Clonal propagation of Dendrobiums through shoot meristem culture. A m . Orchid SOC.Bull. 36, 856-859. Sagawa, Y., Shoji, T., and Shoji, T. (1966). Clonal propagation of Cymbidiums through shoot meristem culture. A m . Orchid Soc. Bull. 35, 118-122. Sangwan, R. S., and Gorenflot, R. (1975). In vitro culture ofPhragmites tissues. Callus
206
INDRA K . VASIL
et al.
formation, organ differentiation and cell suspension culture. 2. Pflanzenphysiol. 75, 256269. Sangwan, R. S., and Norreel, B. (1975a). Pollen embryogenesis in Pharbitis nil. Naturwissenschaften 62, 440. Sangwan, R. S., and Norreel, B. (1975b). Induction of plants from pollen grains of Petunia cultured in vitro. Nature [Lona’on) 257, 222-224. Sangwan, R. S., Norreel, B., and Harada, H. (1976). Effects of kinetin and gibberellin A, on callus growth and organ formation in Limnophila chinensis tissue culture. Biol. Plant. 18, 126-131. Sangwan-Norreel, B. S. (1977). Androgenic stimulating factors in the anther and isolated pollen grain culture of Datura innoxia Mill. J. Exp. Bot. 28, 843-852. Sarkar, S. (1976). Potato leafroll virus contains a double-stranded DNA. Virology 70, 265-273. Saunders, J. W., and Bingham, E. T. (1972). Production of alfalfa plants from callus tissues. Crop Sci. 12, 804-809. Saunders, J. W., and Bingham, E. T. (1975).Growth regulator effects on bud initiation in callus cultures of Medicago satiua. Am. J. Bot. 62, 850-855. Sauter, J. (1969). Cytochemische Untersuchung der Histone in Zellen mit unterschiedlicher RNA- und Protein-Synthese. 2. Pflanzenphysiol. 60, 434-449. Schell, J., and van Montagu, M. (1977). The Ti-plasmid ofAgrobacterium tumefaciens, a natural vector for the introduction of nif genes in plants? In “Genetic Engineering for Nitrogen Fixation” (A. Hollaender et al., eds.), pp. 159-179. Plenum, New York. Schell, J., van Montagu, M., de Picker, A,, de Waele, D., Engler, G., Genetello, C., Hernalsteens, J. P., Holsters, M., Silva, B., van den Elsacker, S., Larebeke, N., and Zaenen, I. (1976). Crown-gall: Bacterial plasmids as oncogenic elements for eucaryotic cells. I n “Molecular Biology of Plants” (I. Rubinstein, ed.). University of Minnesota, St. Paul. Schieder, 0. (1974). Selection of a somatic hybrid between auxotrophic mutants of Sphaerocarps donnellii Aust. using the method of protoplast fusion. 2. Pflanzenphysiol. 74, 357-365. Schieder, 0. (1975).Regeneration of haploid and diploid Datura innoxiu Mill. mesophyll protoplasts t o plants. 2. Pflanzenphysiol. 76, 462-466. Schieder, 0. (1976a). The spectrum of auxotrophic mutants from the liverwort Sphaerocarps donnellii Aust. Mol. Gen. Genet. 144, 63-66. Schieder, 0. (1976b). Isolation of mutants with altered pigments after irradiating haploid protoplasts from Datura innoxia Mill. with X-rays. Mol. Gen. Genet. 149, 251254. Schieder, 0. (1977a). Attempts in regeneration of mesophyll protoplasts of haploid and diploid wild lines, and those of chlorophyll-deficient strains from different Solanaceae. 2. Pflanzenphysiol. 84, 275-281. Schieder, 0. (1977b). Hybridization experiments with protoplasts from chlorophylldeficient mutants of some Solanaceous species. Planta 137, 253-257. Schieder, 0. (1978). Somatic hybrids of Datura znnoxza Mill. t Datura discolor Bernh. and ofDatura innoxia Mill. + Datura stramonium L. var. tatula L. Mol. Gen. Genet. 162, 113-119. Schleiden, M. J. (1838). Beitrage zur Phytogenesis. Arch. Anat. Physiol. Wiss. Med. pp. 137-176. Schroeder, C. A. (1968). Adventive embryogenesis in fruit pericarp tissue in vitro. Bot. Gaz. (Chicago) 129, 374-379.
PLANT TISSUE CULTURES
207
Schwann, T. (1839). “Mikroskopische Untersuchungen uber die Ubereinstimmung in der Struktur und dem Wachstume der Tiere und Pflanzen,” No. 176 (“Ostwalds Klassiker der exakten Wissenschaften.” Engelmann, Leipzig, 1910). Scowcroft, W. R., and Adamson, J . A. (1976). Organogenesis from callus cultures of the legume, Stylosanthes hamatu. Plant Sci. Lett. 7, 39-42. Scowcroft, W. R., and Gibson, A . H. (1975). Nitrogen fixation by Rhizobium associated with tobacco and cowpea cell cultures. Nature (London) 253, 351-352. Seabrook, J . E. A,, and Cumming, B. G. (1977). The in vitro propagation of Amaryllis (Hippeastrum spp. hybrids). I n Vitro 13, 831-836. Seabrook, J. E. A,, Cumming, B. G., and Dionne, L. A. (19761. The in vitro induction of adventitious shoot and root apices on Narcissus (daffodil and narcissus) cultivar tissue. Can. J . Bot. 54, 814-819. Seeliger, C. B. (1959). Uber die Bildung wurzelburtiger Sprosse und das Wachstum isolierter Wurzeln der Robinie (Robinia pseudoacacia). Flora fJena) 148.218-254. Sehgal, C. B. (1972). In vitro induction of polyembryony in Ammi majus L. Curr. Sci. 41, 263-264. Seibert, M. (1976). Shoot initiation from carnation shoot apices frozen to - 196°C.Science 191, 117S1179. Seibert, M., and Wetherbee, P. J. (1977). Increased survival and differentiation of frozen herbaceous plant organ cultures through cold treatment. Plant Physiol. 59, 10431046. Shanmugam, K. T., and Valentine, R. C. (1975). Molecular biology of nitrogen fixation. Science 187, 919-924. Sharp, W. R., Raskin, R. S., and Sommer, H. E. (1972a). The use of nurse culture in the development of haploid clones in tomato. Planta 104, 357-361. Sharp, W. R., Raskin, R. S., and Sommer, H. E. (197213).Haploidy in Lilium. Phytomorphology 21, 334-337. Shepard, J. F., and Totten, R. E. (1977). Mesophyll cell protoplasts of potato: Isolation, proliferation, and plant regeneration. Plant Physiol. 60, 313-316. Shepherd, R. J., Wakeman, R. J., and Romanko, R. R. (1968). DNA in cauliflower mosaic virus. Virology 36, 150-152. Sheridan, W. F. (1968). Tissue culture of the monocot Lilium. Planta 82, 189-192. Shigematsu, K.,and Matsubara, H. (1972). The isolation and propagation of the mutant plant from sectorial chimera induced by irradiation in Begonia rex. J . Jpn. SOC. Hortic. Sci. 41, 1 9 6 2 0 0 . Shimada, T., and Makino, T. (1975).In vitro culture ofwheat. 111. Anther culture ofthe A genome aneuploids in common wheat. Theor. Appl. Genet. 46, 407-410. Shimada, T., Sasakuma, T., and Tsunewaki, K. (1969). In vitro culture ofwheat tissues. I. Callus formation, organ redifferentiation and single cell culture. Can. J . Genet. Cytol. 11, 294-304. Simon, P. W., and Pelonquin, S. J. (1977).The influence of paternal species on the origin of callus in anther culture of Solanum hybrids. Theor. Appl. Genet. 50, 53-59. Simonsen, J., and Hildebrandt, A . C. (1971). In vitro growth and differentiation of Gladiolus plants from callus cultures. Can. J . Bot. 49, 1817-1819. Singh, U. P. (1963). Raising nucellar seedlings of some Rutaceae in vitro. Plunt Tissue Organ Cult., Symp., 1961 pp. 2 7 5 2 7 7 . Sink, K. C., and Power, J. B. (1977). The isolation, culture and regeneration of leaf protoplasts of Petunia parviflora Juss. Plant Sci. Lett. 10, 3 3 5 3 4 0 . Skirvin, R. M. (1978). Natural and induced variation in tissue culture. Euphytica 27, 241-266.
208
INDRA K. VASIL
et al.
Skirvin, R. M., and Janick, J. (1976). “Velvet rose” Pelargonium, a scented geranium. HortScience 11, 61-62. Skirvin, R. M., Lan, S., and Janick, J . (1975). Plantlet formation from potato callus in vitro. HortScience 10, 413-414. Skolmen, R. G., and Mapes, M. 0. (1976).Acacia koa Gray plantlets from somatic callus tissue. J . Hered. 67, 114-115. Skoog, F., amd Miller, C. 0. (1957). Chemical regulation of growth and organ formation in plant tissues cultured in vitro. Symp. SOC.Exp. B i d 11, 118-131. Smith, H. H., Kao, K. N., and Combatti, N. C. (1976). Interspecific hybridization by protoplast fusion in Nicotiana. Confirmation and extension. J . Hered. 67, 123- 128. Smith, R. L., Bouton, J. H., Schank, S. C., Quesenberry, K. H., Tyler, M. E., Milam, J . R., Gaskins, M. H., and Littell, R. C. (1976). Nitrogen fixation in grasses inoculated with Spirillum lipoferum. Science 193, 1003- 1005. Sommer, H. E., Brown, C. L., and Kormanik, P. P. (1975). Differentiation ofplantlets in longleaf pine (Pinus palustris Mill.) tissue cultured in vitro. Bot. Gaz. (Chicago) 136, 196-200. Sondahl, M. R., and Sharp, W. R. (1977). High frequency induction of somatic embryos in cultured leaf explants of Coffea arabica L. Z. Pflanzenphysiol. 81, 395-408. Sopory, S. K. (1977). Development of embryoids in isolated pollen culture of dihaploid Solanum tuberosum. Z. Pflanzenphysiol. 84, 453-457. Sopory, S. K., and Maheshwari, S. C. (1976a). Morphogenetic potentialities of haploid and diploid vegetative parts of Datura innoxia. Z . Pflanzenphysiol. 77, 274-277. Sopory, S. K., and Maheshwari, S. C. (1976b). Development of pollen embryoids in anther cultures of Datura innoxia. I. General observations and effects of physical factors. J . Exp. Bot. 27, 49-57. Sopory, S. K., and Maheshwari, S. C. (1976~). Development ofpollen embryoids in anther cultures of Datura inmxia. 11. Effects of growth hormones. J . Exp. Bot. 27, 58-68. Sopory, S. K., and Rogan, P. G. (1976). Induction of pollen divisions and embryoid formation in anther cultures of some dihaploid clones of Solanum tuberosum. 2. Pflanzenphysiol. 80, 77-80. Staritsky, G. (1970a).Embryoid formation in callus tissues of coffee. Acta Bot. N e e d 19, 509- 5 14. Staritsky, G. (1970b). Tissue culture of the oil palm (Elmis guineensis Jacq.) as a tool for its vegetative propagation. Euphytica 19. 288-292. Start, N. G., and Cumming, B. G. (1976).In vitro propagation ofSaintpaulia ionantha Wendl. HortScience 11, 204-206. Steward, F. C. (1968). “Growth and Organization in Plants.” Addison-Wesley, Reading, Massachusetts. Steward, F. C., Mapes, M. O., and Mears, K. (1958).Growth and organized development of cultured cells. 11. Organization in cultures from freely suspended cells. A m . J . Bot. 45, 705-708. Steward, F. C., Mapes, M. O., Kent, A. E., and Holsten, R. D. (1964). Growth and development of cultured plant cells. Science 143, 20-27. Steward, F. C., Ammirato, P. V., and Mapes, M. 0. (1970). Growth and development of totipotent cells: Some problems, procedures, and perspectives. Ann. Bot. (London) 34, 761-787. Stichel, E. (1959). Gleichzeitige Induktion von Sprossen und Wurzeln an in vitro Kultivieren Gewebstucken von Cyclamen persicum. Planta 53, 293-317. Stieglitz, H. (1977). Role of P-1-3-glucanase in post-meiotic microspore release. Deu. Biol. 57, 87-97.
PLANT TISSUE CULTURES
209
Stow, I. (1930). Experimental studies on the formation of embryo sac-like giant pollen grain in the anther of Hyacinthus orientalis. Cytologia 1, 417-439. Stow, I. (1934). On the female tendencies of the embryo sac-like giant pollen grain of Hyacinthus orientalis. Cytologia 5, 8 a 1 0 8 . Street, H. E. (1969). Growth in organized and unorganized systems. Knowledge gained by culture of organs and tissue explants. Plant Physiol. 5B, 3-224. Stringham, G . R. (1974). Morphogenesis in stem explant callus of haploid Brassica. I n “Haploids in Higher Plants” (K. J. Kasha, ed.), p. 143. University of Guelph, Guelph. Subrahmanyam, N. C., Gould, A. R., and Doy, C. H. (1976). Cleavage of plant chromosomes by restriction endonucleases. Plant Sci. Lett. 6, 203-208. Subramaniam, M. K., Subramaniam, S.,Gopinath, P. M., Gupta, K. C., and Vasantha, S. (1968). Histogenesis, organogenesis and morphogenesis in callus cultures of Trigonella foenum-graecum Linn. and Vigna unguiculata (L.) Walp. Curr. Sci. 37, 39a399. Sugawara, Y., and Sakai, A. (1974). Survival of suspension-cultured sycamore cells cooled to the temperature of liquid nitrogen. Plant Physiol. 54, 722-724. Sun, C. S., Wang, C. C., and Chu, C. C. (1974).Cell division and differentiation ofpollen grains in Triticale anthers cultured in vitro. Sci. Sin. 17, 47-51. Sunderland, N. (1971). Anther culture: A progress report. Sci. Prog. (Oxford) 59, 527549. Sunderland, N. (1974). Anther culture as a means of haploid production. I n “Haploids in Higher Plants” (K. J . Kasha, ed.), pp. 91-122. University of Guelph, Guelph. Sunderland, N., and Roberts, M. (1977). New approach t o pollen culture. Nature (London) 270, 236-238. Sunderland, N., and Wicks, F. M. (1971). Embryoid formation in pollen grains of Nicotiana tabacum. J . Exp. Bot. 22, 213-226. Sunderland, N., Collins, G. B., and Dunwell, J . M. (1974). The role of nuclear fusion in pollen embryogenesis in Datura innoxia Mill. Planta 117, 227-241. Sung, Z.R. (1976). Mutagenesis of cultured plant cells. Genetics 84, 51-57. Suzuki, M., and Takebe, I. (1976). Uptake of single-stranded bacteriophage DNA by isolated tobacco protoplasts. 2. Pflanzenphysiol. 78, 421-433. Suzuki, M., Takebe, I., Kajita, S., Honda, Y., and Matsui, C. (1977). Endocytosis of polystyrene spheres by tobacco leaf protoplasts. Exp. Cell Res. 105, 127-135. Swamy, R.D., and Chacko, E. K. (1973).Induction ofplantlets and callus from anthers of Petunia axillaris (Lam.) BSP cultured in vitro. Hortic. Res. 13,41-44. Syono, K., and Furuya, T. (1972). The differentiation ofCoptis plants in vitro from callus cultures. Experientia 28, 236. Szeto, W. W., Hammer, D. H., Carlson, P. S., and Thomas, C. A,, J r . (1977). Cloning of cauliflower mosaic virus (CLMV) DNA in Escherichia coli. Science 196, 210-212. Tabata, M., Yamamoto, H., Hiraoka, N., and Konoshima, M. (1972). Organization and alkaloid production in tissue cultures of Scopolia paruiflora. Phytochemistry 11, 949-955. Takatori, F. H., Murashige, T., and Stillman, J. I. (1968). Vegetative propagation of Asparagus through tissue culture. HortScience 3, 20-22. Takebe, I. (1975). The use of protoplasts in plant virology. Annu. Rev. Phytopathol. 13, 105-125. Takebe, I., and Otsuki, Y. (1969). Infection of tobacco mesophyll protoplasts by tobacco mosaic virus. Proc. Natl. Acad. Sci. U.S.A. 64, 843-848.
210
INDRA K. VASIL
et al.
Takebe, I., Otsuki, Y., and Aoki, S. (1968). Isolation of tobacco mesophyll cells in intact and active state. Plant Cell Physiol. 9, 115-124. Takebe, I., Labib, G., and Melchers, G. (1971). Regeneration of whole plants from isolated mesophyll protoplasts of tobacco. Naturwissenschaften 58, 31EL320. Teo, C. K. H., Kunisaki, J. T., and Sagawa, Y. (1973). Clonal propagation of strap-leafed Vanda by shoot tip culture. A m . Orchid SOC.Bull. 42, 402-405. Tewari, K. K. (1971). Genetic autonomy of extranuclear organelles. Annu. Rev. Plant Physiol. 22, 141-168. Thakur, S. (1973). In vitro foliar shoot bud formation in Begonia semperflorens. Curr. Sci. 42, 430-432. Thomas, E., and Street, H. E. (1972). Factors influencing morphogenesis in excised roots and suspension cultures of Atropa belladonna. Ann. Bot. (London) 36, 239-247. Thomas, E., and Wenzel, W. (1975a).Embryogenesis from microspores of rye. Naturwissenschaften 62, 40-41. Thomas, E., and Wenzel, W. (1975b). Embryogenesis from microspores of Brassica napus. 2.Pflanzenzuecht. 74, 77-81. Thomas, E., Hoffmann, F., and Wenzel, G. (1975). Haploid plantlets from microspores of rye. 2. Pflanzenzuecht. 75, 10&113. Thomas, E., Hoffmann, F., Potrykus, I., and Wenzel, G. (19761. Protoplast regeneration and stem embryogenesis of haploid androgenetic rape. Mol. Gen. Genet. 145, 245248.
Thomas, M. J., Duhoux, E., and Vazart, J. (1977). In vitro organ initiation in tissue cultures ofBiota orientalis and other species o f the Cupressaceae. Plant Sci. Lett. 8, 395-400. Tjepkema, J. D., and Evans, H. J. (1975).Nitrogen fixation by free-living Rhzzobium in a defined liquid medium. Biochem. Biophys. Res. Commun. 65, 625-628. Torrey, J. G. (1967). Morphogenesis in relation to chromosomal constitution in long-term plant tissue cultures. Physiol. Plant. 20, 265-275. Townsley, P. L. M. (1974).Production of coffee from plant cell suspension cultures. Can. Inst. Food Sci. Technol. J . 7, 79-81. Tran Thanh Van, M. (1973). In vitro control of de novo flower, bud, root and callus differentiation from excised epidermal tissues. Nature (London) 246, 44-45. Tran Thanh Van, M. (1977).Regulation of morphogenesis. In “Plant Tissue Culture and its Bio-technological Application” (W. Barz, E. Reinhard, and M. H. Zenk, eds.), pp. 367-385. Springer-Verlag, Berlin and New York. Tran Thanh Van, M., and Drira, A. (1970). Definition of a simple experimental system of directed organogenesis de novo: Organ neoformation from epidermal tissue of Nautilocalyx Zynchei. Colloq. Int. C.N.R.S. 193, 169-176. Tran Thanh Van, M., Chlyah, H., and Chlyah, A. (1974a). Regulation of organogenesis in thin layers of epidermal and sub-epidermal cells. Tissue Cult. Plant Sci., Proc. Int. Congr. Plant Tissue Cell Cult., 3rd, 1974 pp. 101-139. Tran Thanh Van, M., Dien, N. T., and Chlyah, A. (197413). Regulation o f organogenesis in small explants of superficial tissue ofNicotiana tabacum L. PZanta 119,149-159. Trench, R. K. (1975). Of “leaves that crawl”: Functional chloroplasts in animal cells. Symp. Soc. Exp. Biol. 29, 229-265. Tulecke, W. (1953). A tissue derived from the pollen of Ginkgo biloba. Science 117, 599-600. Tulecke, W. (1957). The pollen of Ginkgo biloba: In vitro culture and tissue formation. A m . J . Bot. 44, 602-608. Tulecke, W. (1959).The pollen cultures 0fC.D. LaRue: A tissue from the pollen o f T a u s . Bull. Torrey Bot. Club 86, 283-289.
PLANT TISSUE CULTURES
211
Tulecke, W., and Sehgal, N. (1963). Cell proliferation from the pollen ofTorreya nuczferu. Contrib. Boyce Thompson Inst. 22, 153-163. Uchimiya, H., and Murashige, T. (1977). Quantitative analysis o f t h e fate of exogenous DNA in Nicotiana protoplasts. Plant Physiol. 59, 301-308. Ueda, H., and Torikata, H. (1968). Organogenesis in the meristern cultures of Cymbidiums. I. Studies on the effects of growth substances added to culture media under Hortic. Sci. 37, 340-348. continuous illumination. J . Jpn. SOC. Ueda, H., and Torikata, H. (1970). Organogenesis in the meristem cultures of Cymbidiums. IV. Study on cytokinin activity in the extracts from protocorms.J. Jpn. SOC. Hortic. Sci. 39, 1 0 4 1 0 7 . Ueda, H., and Torikata, H. (1972). Effects of light and culture medium on adventitious Bull. 41, 322root formation by Cymbidiums in aseptic culture. A m . Orchid SOC. 327. Upadhya, M. D. (1975). Isolation and culture of mesophyll protoplasts of potato (SoEanum tuberosum L.). Potato Res. 18, 438-445. van Larebeke, N., Genetello, C., Hernalsteens, J . P., de Picker, A , , Zaenen, I., Messens, E., van Montagu, M., and Schell, J . (1977). Transfer of Ti plasmids between Agrobacterium strains by mobilization with the conjugative plasmid RP4. Mol. Gen. Genet. 152, 119-124. Vardi, A,, and Raveh, D. (1976). Cross-feeder experiments between tobacco and orange protoplasts. 2. Pflanzenphysiol. 78, 350-359. Vardi, A,, Spiegel-Roy, P., and Galun, E . (1975). Citrus cell culture. Isolation of protoplasts, plating densities, effect of mutagens and regeneration of embryos. Plant Sci. Lett. 4, 231-236. 41, Vasil, I. K. (1962). Studies on pollen storage of some crop plants. J . Indian Bot. SOC. 178-196. Vasil, I. K. (1963). Some new experiments with excised anthers. Plant Tissue Organ Cult., Symp., 1961 pp. 230-238. Vasil, I. K. (1967). Physiology and cytology of anther development. Biol. Rev., Cambridge Philos. SOC. 42, 327-373. Vasil, I. K. (1973a). The new biology of pollen. Naturwissenschuften 60, 247-253. Vasil, I. K. (1973b). Plants: Haploid tissue cultures. I n “Tissue Culture: Methods and Applications” (P. F. Kruse, J r . and M. K. Patterson, J r . , eds.), pp. 157-161. Academic Press, New York. Vasil, I. K. (1976). The progress, problems, and prospects of plant protoplast research. Adu. Agron. 28, 119-160. Vasil, I. K. (1977). Nutrient requirements of plant tissues in culture for growth and differentiation. I n “Handbook Series in Nutrition and Food’ (M. Rechcigl., Jr., ed.), Vol. 1, Sect. D, pp. 479-486. CRC Press, Cleveland, Ohio. Vasil, I. K., and Giles, K. L. (1975). Induced transfer of higher plant chloroplasts into fungal protoplasts. Science 190, 680. Vasil, I. K., and Hildebrandt, A. C. (1966a). Growth and chlorophyll production in plant callus tissues grown in vitro. Planta 68, 69-82. Vasil, I. K., and Hildebrandt, A. C. (1966b). Variations of morphogenetic behavior in plant tissue cultures. I. Cichorium endiuia. A m . J . Bot. 53, 860-869. . of morphogenetic behavior in Vasil, I. K., and Hildebrandt, A. C. ( 1 9 6 6 ~ )Variations plant tissue cultures. 11. Petroselinum hortense. A m . J . Bot. 53, 869-874. Vasil, I. K., and Nitsch, C. (1975). Experimental production of pollen haploids and their uses. 2. Pflanzenphysiol. 76, 191-212. Vasil, I. K., and Vasil, V. (1972). Totipotency and embryogenesis in plant tissue cultures. In Vitro 8, 117-127.
212
INDRA K. VASIL
et al.
Vasil, I. K., Hildebrandt, A. C., and Riker, A. J. (1964). Endive plantlets from freely suspended cells and cell groups in vitro. Science 146, 7G77. Vasil, I. K., Vasil, V., Sutton, W. D., and Giles, K. L. (1975). Protoplasts as tools for the genetic modification of plants. Proc. Znt. Symp. Yeast Other Protoplasts, 4th, 1974 pp. 1-82. Vasil, I. K., Vasil, V., and Hubbell, D. H. (1977). Engineered plant cell or fungal association with bacteria that fix nitrogen. Zn “Genetic Engineering for Nitrogen Fixation” (A. Hollaender et al., eds.), pp. 197-211. Plenum, New York. Vasil, V . , and Hildebrandt, A. C. (1965a). Growth and tissue formation from single isolated cells in microculture. Science 147, 1454-1455. Vasil, V., and Hildebrandt, A. C. (1965b). Differentiation of tobacco plants from single isolated cells in microculture. Science 150, 889-892. Vasil, V., and Hildebrandt, A. C. (1967). Further studies on the growth and differentiation of single, isolated cells of tobacco in vitro. Planta 75, 139-151. Vasil, V., and Vasil, I. K. (1973). Growth and cell division in isolated protoplasts in microchambers. Colloq. Znt. C.N.R.S. 212, 139-149. Vasil, V., and Vasil, I. K. (1974). Regeneration of tobacco and petunia plants from protoplasts and culture of corn protoplasts. Zn Vitro 10, 83-96. Vasil, V., and Vasil, I. K. (1979). Isolation and culture of cereal protoplasts. I. Callus formation from pearl millet (Penniseturn arnericanurn) protoplasts. 2. Pflanzenphysiol. 92, 37S383. Venverloo, C. J. (1973). The formation of adventitious organs. I. Cytokinin-induced formation of leaves and shoots in callus cultures of Populus nigra L. var. Italica. Acta Bot. Neerl. 22, 390-398. Venverloo, C. J. (1976). The formation of adventitious organs. 111. A comparison of root and shoot formation on Nautilocalyx explants. 2. Pflanzenphysiol. 80,310-322. Virchow, 13.(1858).“Die Cellularpathologie in ihrer Begrundung auf physiologische und pathologische Gewebelehre.” Hirschwald, Berlin. von Bulow, J. F. W., and Dobereiner, J. (1975). Potential of nitrogen fixation in maize genotypes in Brazil. Proc. Natl. Acad. Sci. U.S.A. 72, 2389-2393. Vyskot, B., and Novak, F. J. (1974a). Experimental androgenesis in vitro in Nicotiana clevelandii Gray and N . sanderae Hort. Theor. Appl. Genet. 44, 138-140. Vyskot, B., and Novak, F. J. (1974b). Genotypic foundation of the frequency of androgenesis in vitro and characteristics of stomates in haploid plants. Fac. Sci. Nut. Ujep Brunensis 4, 25-34. Wacker, A,, and Kaul, S. (1977). Polyathylenglykol-induzierteFusion von Saugetierzellen mit Cytoplasten in Suspension. Naturwissenschaften 64, 146. Wagner, G., and Hess, D. (1974).Haploide, diploide und triploide Pflanzen von Petunia hybrida aus Pollenkornern. 2.Pfinzenphysiol. 73, 273-276. Walkey, D. G. A. (1972).Production of apple plantlets from axillary bud meristems. Can. J . Plant Sci. 52, 1085-1087. Walkey, D. G. A., and Cooper, J. (1976). Growth of Stellaria media, Capsella bursapastoris and Senecio vulgaris plantlets from cultured meristem-tips. Plant Sci. Lett. 7, 179-186. Walkey, D. G. A,, and Woolfit, J. M. G. (1968).Clonal multiplication ofNicotiana rustica L. from shoot meristems in culture. Nature (London) 220, 1346-1347. Walkey, D. G. A , , and Woolfit, J. M. G. (1970). Rapid clonal multiplication ofcauliflower by shake cultures. J . Hortic. Sci. 45, 205-206. Wallin, A., Glimelius, K., and Eriksson, T. (1974). The induction of aggregation and
PLANT TISSUE CULTURES
213
fusion of Daucus carota protoplasts by polyethylene glycol. Z. Pflanzenphysiol. 74, 64-80. Wang, C., Chu, C., Sun, C., Wu, S., Yin, K., and Hsu, C. (1973). The androgenesis in wheat (Triticum uestiuum) anthers cultured in vitro. Sci. Sin. 16, 218-222. Wang, Y. Y., Sun, C. S., Wang, C. C., and Chien, W. F. (1973). The induction ofthe pollen plantlets of Triticale and Capsicum annuum from anther culture. Sci. Sin. 16, 147-151. Watanabe, K., Nishii, Y . , and Tanaka, R. 11972). Anatomical observations on the high frequency callus formation from anther culture of Chrysanthemum. Jpn. J . Genet. 47, 249-255. Welander, T. (1977). In vitro organogenesis in explants from different cultivars of Begonia x heimalis. Physiol. Plant. 41, 142-145. Wenzel, G., and Thomas, E. (1974). Observations on the growth in culture of anthers of Secale cereale. Z. Pflunzenzuecht. 12, 89-94. Wenzel, G., Hoffmann, F., and Thomas, E. (1976). Heterozygous microspore derived plants in rye. Theor. Appl. Genet. 48, 2 0 5 2 0 8 . Wernicke, W., and Kohlenbach, H. W. (1975). Antherenkulturen bei Scopolia. 2. Pflanzenphysiol. 77, 89-93. Wessels, D. C. J., Groenewald, E. G., and Koeleman, A. (1976). Callus formation and subsequent shoot and root development from leaf tissue ofHaworthia planifolia var. cf. var. setuliferu v. Poelln. 2.Pftunzenphysiol. 78, 141-145. Westcott, R. J., Henshaw, G. G., and Roca, W. M. (1977). Tissue culture storage ofpotato germplasm. Culture initiation and plant regeneration. Plant Sci. Lett. 9, 309-316. Wetter, L. R. (1977). Isoenzyme patterns in soybean-Nicotiana somatic hybrid cell lines. Mol. Gen. Genet. 150, 231-235. White, D. W. R., and Vasil, I. K. (1978). Use of amino acid analogue-resistant cell lines for selection of Nicotiana syluestris somatic cell hybrids. Proc. Int. Congr. Plant Tissue Cell Cult., 4th, 1978 p. 69. White, P. R. (1932).Plant tissue cultures: A preliminary report ofresults obtained in the culturing of certain plant meristems. Arch. Exp. Zellforsch. 12, 602-620. White, P. R. (1934). Potentially unlimited growth of excised tomato root tips in a liquid medium. Plant Physiol. 9, 585600. White, P. R. (1939). Potentially unlimited growth of excised plant callus in an artificial medium. Am. J . Bot. 26, 59-64. White, P. R. (1963). “The Cultivation of Animal and Plant Cells,” 2nd ed. Ronald, New York. Widholm, J. M. (1972). Anthranilate synthetase from 5-methyltryptophan-susceptible and resistant cultured Daucus carota cells. Biochim. Biophys. Acta 279, 48-57. Widholm, J. M. (1974a). Cultured carrot cell mutants: 5-methyl-tryptophan-resistance carried from cell to plant and back. Plant Sci. Lett. 3, 323-330. Widholm, J. M. (1974b3. Selection and characteristics of biochemical mutants of cultured plant cells. Tissue Cult. Plant Sci., Proc. Int. Congr. Plant Tissue Cell Cult., 3rd, 1974 pp. 287-299. Widholm, J. M. (1976).Selection and characterization ofcultured carrot and tobacco cells resistant to lysine, methionine, and proline analogs. Can. J . Bot. 54, 1523-1529. Widholm, J. M. (1977). Relation between auxin autotrophy and tryptophan accumulation in cultured plant cells. Planta 134, 10S108. Wilfret, G. J. (1971).Shoot-tip culture ofGladiolus: An evaluation of nutrient media for callus tissue development. Proc. Flu. State Hortic. Soc. 84, 389-393.
214
INDRA K. VASIL
et al.
Wilkes, G. (1977). The worlds crop plant germplasm-an endangered resource. Bull. At. Sci.33, %16, Williams, L., and Collins, H. A. (1976a).Embryogenesis and plantlet formation in tissue cultures of celery. Ann. Bot. (London) 40, 325-332. Williams, L., and Collins, H. A. (1976b). Growth and cytology of celery plants derived from tissue cultures. Ann. Bot. (London) 40, 333-338. Williamson, F. A., Fowke, L. C., Weber, G., Constabel, F., and Gamborg, 0. L. (1977). Microfibril deposition on cultured protoplasts of Vicia hajastana. Protoplasma 91, 213-219. Willis, G. E., Hartmann, J. X., and de Lamater, E. D. (1977). Electrom microscopic study of plant-animal cell fusion. Protoplasma 91, 1-14. Willison, J. H. M., and Cocking, E. C. (1975). Microfibril synthesis a t the surfaces of isolated tobacco mesophyll protoplasts, a freeze-etch study. Protoplasma 84, 147159. Wilmar, C., and Hellendoorn, M. (1968). Growth and morphogenesis of asparagus cells cultured in vitro. Nature (London) 217, 369-370. Wilson, H. M. (1974). Growth, morphogenesis and cell dispersion in callus and cell cultures of Hevea brasiliensis. Tissue Cult. Plant Sci., Proc. Int. Congr. Plant Tissue Cell Cult., 3rd, 1974 Abstract, p. 125. Wilson, H. M., and Webb, K. J. (1974). Callus and suspension cultures of forest tree species. Tissue Cult. Plant Sci., Proc. Int. Congr. Plant Tissue Cell Cult., 3rd, 1974 Abstract, p. 221. Wimber, D. E. (1963).Clonal multiplication of Cymbidiums through tissue culture of the shoot meristem. A m . Orchid SOC.Bull. 32, 105-107. Wimber, D. E. (1965). Additional observations on clonal multiplication of Cymbidium through culture of shoot meristems. Cymbidum SOC.News 20, 7-20. Winton, L. L. (1968). Plantlets from aspen tissue cultures. Science 160, 1234-1235. Winton, L. L. (1970). Shoot and tree production from aspen tissue cultures. A m . J . Bot. 57, 904-909. Winton, L. L. (1971). Tissue culture propagation of European aspen. For. Sci. 17, 3 4 ~ 5 0 . Winton, L. L., and Verhagen, S. A. (1977). Shoots from douglas-fir cultures. Can. J . Bot. 55, 124G1250. Withers, L. A,, and Cocking, E. C. (1972). Fine structural studies on spontaneous and induced fusion of higher plant protoplasts. J . Cell Sci. 11, 59-75. Withers, L. A,, and Street, H. E. (1977). Freeze preservation of cultured plant cells. 111. The pregrowth phase. Physiol. Plant. 39, 171-178. Wolter, K. E. (1968).Root and shoot initiation in aspen callus cultures. Nature (London) 219, 509-510. Wurm, G. (1960). Vergleichende Untersuchungen uber Wachstum und Organbildung an Segmenten pflanzlicher Speicherorgane bei Kultur in vitro. Flora (Jenu) 149, 43-76. Yamada, T., Shoji, T., and Sinoto, Y. (1963).Formation of calli and free cells in the tissue culture of Tradescantio reflexa. Bot. Mag. 76, 332-339. Yamada, T., Nakagawa, H., and Sinoto, Y. (1967). Studies on the differentiation in cultured cells. I. Embryogenesis in three strains of Solanum callus. Bot. Mag. 80, 68-74. Yamane, Y. (1974). Induced differentiation of buckwheat plants from subcultured calluses in vitro. Jpn. J . Genet. 49, 139-146.
PLANT TISSUE CULTURES
215
Yie, S., and Liaw, S. I. (19771. Plant regeneration from shoot tips and callus ofpapaya.In Vitro 13, 564-568. Yin, K., Hsu, C., Chu, C., Pi, F., Wang, S.,Liu, T., Chu, C., Wang, C., and Sun, C. (1976). A study o f the new cultivar of rice raised by haploid breeding method. Scz. Sin. 19, 227- 242, Yokoyama, T., and Takeuchi, M. (1976). Organ and plantlet formation from callus in Japanese persimmon. Phytomorphology 26, 273-275. Yoneda, Y. (1969).Organ formation in cultured leafblades ofCrepis capillaris. Bot. Mag. 82, 204-209. Zaitlin, M., and Beachy, R. N. (1974).The use of protoplasts and separated cells in plant virus research. Adu. Virus Res. 19, 1-35. Zapata, F. J., Evans, P. K., Power, J. B., and Cocking, E. C. (1977). The effect of temperature on the division of leaf protoplasts of Lycopersicon esculentum and Lycopersicon peruuianum. Plant Sci. Lett. 8, 119-124. Zatyko, J. M., Simon, I., and Szabo, C. (1975). Induction of polyembryony in cultivated ovules o f red currant. Plant Sci. Lett. 4, 281-283. Zee, S . Y., and Hui, L. H. (1977). In vitro plant regeneration from hypocotyl and cotyledons of Chinese kale (Brassica alboglabra Bailey). Z . Pflanzenphysiol. 82, 440-445. Zenk, M. H. (1974). Haploids in physiological and biochemical research. In “Haploids in Higher Plants” (K. J. Kasha, ed.), pp. 339-353. University of Guelph, Guelph. Zenkteler, M. (1971a). In vitro production of haploid plants from pollen grains ofAtropa belladonna L. Experientia 27, 1087. Zenkteler, M. (1971b). In vitro culture-a useful method for obtaining haploid plants. Genet. Pol. 12, 267-273. Zenkteler, M. (1972a). In vitro formation o f plants from leaves o f several species of the Solanaceae family. Biochem. Physiol. Pflanz. 163, 509-512. Zenkteler, M. (197213). Development of embryos and seedlings from pollen grains in Lycium halimifolium Mill. in the in vitro culture. Biol. Plant. 14, 420-422. Zenkteler, M. (1973). In vitro development of embryos and seedlings from pollen grains of Solanum dulcamara. Z. Pflanzenphysiol. 69, 189-192. Zenkteler, M., and Misiura, E. (1974). Induction of androgenic embryos from cultured anthers of Hordeum, Secale and Festuca. Biochem. Physiol. Pflanz. 165, 337-340. Zenkteler, M., Misiura, E., and Ponitka, A. (1975).Induction of androgenetic haploids in the in vitro cultured anthers of several species. Experientia 31, 289-291. Ziv, M., Harvey, A. H., and Shilo, R. (1970). Organs and plantlet regeneration of Gladiolus through tissue culture. Ann. Bot. (London) 34, 671-676. Ziv, M., Kanterovitz, R., and Halevy, A. (1973).Vegetative propagation ofAlstromeria in vitro. HortScience 1, 271-277. Zyrd, J. P. (1976). 5-Bromodeoxyuridine as an agent in the selection of sycamore cell cultures. Plant Sci. Lett. 6, 157-161.
MECHANISMS OF GENETIC SEX DETERMINATION, GONADAL SEX DIFFERENTIATION, AND GERM-CELL DEVELOPMENT IN ANIMALS John
R. McCarrey and
Ursula K. Abbott
Department of Avian Sciences, University of California, Davis, California
I. Introduction , . , , . . . . , . , . , . 11. Genetic Sex Determination . , . , . , . A. Early Studies on Sex Determination . B. Sex Determination in Drosophila . . C. Sex Determination in Mammals . . . D. Sex Determination in Birds . . . . . E. Models of Sex Determination . . . . 111. Gonadal Sex Differentiation . . . . . . A. Descriptive Embryology . . . . . . . B. The Dominant Sex versus the Neutral C. Models of Sex Differentiation . . . . D. Somatic Cell-Germ Cell Interactions IV. Germ-Cell Development . . . . . . . . A. Primordial Germ-Cell Determination B. Primordial Germ-Cell Development . C. Gametogenesis . . . . . . . . . . . V. Summary and Conclusions . . . . . . . References . . . . . . . . . . . . . .
. . . .
.
,
.
,
,
.
, ,
. , . . . .
. . . .
. . , . . . , . . , . . , . , . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Sex . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . , , , . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ,
,
. . . . . . . . . .
,
.
. . .
. . . . . . . .
. . . . . . . . . .
. . . . .
. . . . . . , . . . . . . . . . . .
. . . . . . . . . .
. . . . . .
.
.
. . . .
. . . . . . . . . . . . . . . . . . . .
217 218 218 219 220 221 223 230 231 234 238 253 255 255 258 263 272 2 74
1. introduction
The importance of reproduction for the genetics and evolution of a species is paramount, therefore a n extremely important phenotypic characteristic of any animal is its sex. Mechanisms of genotypic sex determination and phenotypic sex differentiation have been studied in a variety of animal systems. Of these, certain mammals, birds, and 217 ADVANCES IN GENETICS, Vol 20
Copyright 0 1979 by Academic Press. Inc A l l rights of reproduction 111 any form reserved. ISBN 0-12-017620-3
218
JOHN R. McCARREY A N D URSULA K . ABBOTT
insects (primarily Drosophila) have been extensively studied either because of experimental accessibility or the correlations that can be drawn with human sexual development. In mammals, birds, and Drosophila, sex determination is an event of genetic programming, whereas sex differentiation involves the development of observable phenotypic changes indicative of the specific sex and can be divided into primary and secondary events. The primary event is the development of the gonads, which, in turn, can be subdivided into: (1) differentiation of the somatic elements of the gonad, and (2) differentiation of the germ cells within the gonad. The secondary event involves development of the accessory sex organs, such as ducts and genitalia. These basic events and their temporal relationships are summarized in Fig. 1. Although a wealth of data concerning each event in sexual development is available, the mechanism by which genetic sex determination influences primary sex differentiation is still not clear. The development of secondary sex characteristics is clearly induced by hormones produced by the somatic elements of the gonad (Jost, 1965) and will not be extensively dealt with here. This review will focus on the basic events of genetic sex determination and primary sex differentiation. It is hoped that a review of the details of each individual event will allow a n analysis of, and speculation upon, the causal interactions involved in the mediation of these events. II. Genetic Sex Determination
A. EARLYSTUDIES ON SEXDETERMINATION The first correlation between the sex of an individual and a specific chromosomal constitution was made by Henking (1891), who observed an extra chromosomal element in the sperm of the insect Pyrrhocoris apterus. McClung (1902) was the first to suggest that a specific chromosome might play a role in sex determination. Shortly after the rediscovery of the Mendelian laws (Correns, 1900; deVries, 1900), attempts to apply these principles to sex determination were extensive (see review by Mittwoch, 1973a). The discovery of intersexes in certain insects including Drosophila (Bridges, 1925) and Lymantria (Goldschmidt, 1934) greatly complicated the attempts to explain sex determination in Mendelian terms. As more and more evidence was gathered, hypothetical sex determination mechanisms
219
SEX DETERMINATION I N ANIMALS
Secondary Sex Differentiation
1
I
Primary Sex Differentiation
Time
>
FIG. 1. The basic events and their temporal relationships in sexual development. During embyronic development, the genetic sex chromosome constitution determines the sexual differentiation ofthe somatic elements ofthe gonad, which in turn induces the sexual differentiation of the germ cells and the secondary sex characteristics.
were obliged to become continually more complex, until the situation seemed to defy genetic analysis.
B. SEXDETERMINATION IN Drosophila The failure to interpret sex determination by means of simple Mendelian concepts resulted in a return to the correlation of sex determination with chromosomal rather than genic inheritance. T. H. Morgan and his associates (1910a,b, 1926) carried out extensive investigations on the patterns of chromosomal inheritance in Drosophila. C. B. Bridges, in a classic experiment, demonstrated sex-linked inheritance, at the same time correlating sex determination with chromosomal inheritance (Bridges, 1916). By crossing vermilion-eyed (X-linked recessive) females (X"X") to normal males (X+Y-), Bridges predictably found vermilion males (X"Y-) and normal females (X+XV) in the F, progeny. However, occasionally a normal male or a vermilion female appeared. With the knowledge that in Drosophila males are normally XY and females XX (Stevens, 1908), Bridges hypothesized that the exceptional offspring were the result of nondisjunction of the two X chromosomes during meiosis in the maternal parent. Thus, a n egg with two X chromosomes fertilized by a Y chromosome-bearing sperm would produce a n X"X"Y- aneuploid female homozygous for vermilion. Alternatively an egg with no X chromosome fertilized by a n X+ chromosome-bearing sperm would result in an XfO male with a normal phenotype. Subsequent cytological analysis confirmed this hypothesis. From these results Bridges concluded that, in Drosophila with a
220
JOHN
R.
McCARREY AND URSULA K. ABBOTT
normal autosomal constitution, when two X chromsomes are present the sex is female, whereas a single X chromosome produces a male. It was obvious that the Y chromosome is not essential for sex determination since both XY and XO genotypes gave rise to male phenotypes. Bridges later found that triploid flies with two X chromosomes (3AXX) are intersexes (Bridges, 1921). The conclusion from these observations was that sex determination in Drosophila is based on the ratio of X chromosomes to complete autosome sets (haploid compliments). Thus, in the normal situation a 2A:XX fly would have a 1 : l ratio of X chromosomes to autosome sets and be female, whereas a 2AXY individual would have the 1:2 male ratio. A 3A:XX genotype would produce a 2:3 ratio, intermediate between the normal male and female ratios, and would be phenotypically intersexual.
C . SEXDETERMINATION IN MAMMALS Subsequent similar correlations of sex chromosome constitution with sexual phenotype were observed in higher animals. As in Drbsophila, most mammals* normally demonstrate a 2A:XX genotype for the female phenotype and a 2A:XY genotype for the male. Klinefelter et al. (1942) described in mammals a phenotypic syndrome that is commonly associated with a 2A:XXY aneuploid genotype (Jacobs and Strong, 1959).In this case the phenotype is clearly male and thus is the converse of the 2A:XXY female phenotype observed in Drosophila. A 2A: XO genotype in mammals produces Turner’s syndrome, which is phenotypically female (Turner, 1938;Ford et al., 1959). Once again the situation is the opposite of that in Drosophila, where a 2A:XO aneuploid displays a male phenotype. Thus, unlike the situation inDrosophila, the presence of the Y chrom?s-msins~ n lr.m a-g. is crucial to the d e t e r m i g tion of sexual phenotype. Normally a mammalian genotype with a Y chromosome and one or more X chromosomes will consistently produce a male phenotype whereas the absence of a Y chromosome results in femaleness, irrespective of the number of X chromosomes presept. In mammals then, the ratio of X chromosomes to autosome sets is irrelevant to sex determination. Human patients with 2A:XXXXY karyotypes have been reported (Fraccaro and Lindsten, 1960; Barret al., 1962; Zaleski et al., 1966), and even in this extreme case the single Y chromosome is sufficient to produce a male phenotype. -__I
*Fredga (1970) has summanzed the deviations from the normal XY/male, XW female inheritance pattern in mammals For the purposes ofthis report, any reference to mammals will refer only to this normal pattern characteristic of the majority ofmammahan species that have been studied
,221
SEX DETERMINATION I N ANIMALS
D. SEXDETERMINATION IN BIRDS The earliest description of a sex-linked inheritance pattern in any organism was provided by E. S. Dixon in 1850 from his results in breeding chickens, in which he correlated leg color and sex. Although Dixon was not aware of sex-linked inheritance, it can now be seen that his results described a sex-linked genetic marker in a system where the female is heterogametic (has unlike sex chromosomes) and the male is homogametic (has identical sex chromosomes). Originally it was believed that female chickens are of ZO sex chromosome constitution, and males ZZ (Hutt, 1949). However, improved cytogenetic techniques allowed Ohno (1961), Ohno et al. (19641, and Schmid (1962) to show that the female is normally Zw, while the male is ZZ. Whether avian sex determination is more similar to that of Drosophila or mammals cannot be conclusively determined from the evidence gathered to date. Although a significant amount of data is available from avian polyploids (predominantly triploids), the necessary evidence from aneuploids (2AZZw and 2A:ZO) is lacking. The avian polyploid data have been summarized by Abbott and Yee (1975). Analysis of these data indicates that any genotype resulting in a 1:l ratio of Z chromosomes to autosome sets (as is the case in the normal 2AZZ male or in a 3A:ZZZ triploid) results in a male phenotype. A 1:2 ratio produces a female phenotype (as in the normal 2A:Zw female), and any ratio that is intermediate between these is associated with an intersexual phenotype. Thus, a 3A:ZZw genotype has a 2:3 ratio and is an intersex (Abdel-Hameed and Schoffner, 1971). A comparison of these data with similar polyploid conditions in Drosophila and mammals (Table 1) fails to shed much light on the TABLE I Genotype-Phenotype Relationships in Sexual Development Phenotype Genotype
Mammals
Drosophila
2AXY (ZW) 2A:XX (ZZ) 2A:XO (ZO) 2A:XXY (ZZw) 2A:XXX (ZZZ) 3A:XXX (ZZZ) 3A:XXY (ZZw) 3A:XYY (Zww)
d
6
P P
6 0
P
d -
P
d
P
0
P 4 d
Birds
P
6
-
d? d 6
a”
-
Ratio X(Z):autosome sets 1:2 1:1 1:2 1:1 3:2 1:1 2:3 1:3
222
JOHN R. McCARREY AND URSULA K . ABBOTT
avian sex-determination scheme. Although an intermediate ratio of Z chromosomes to autosome sets results in an intersex as in Drosophila, it is not clear whether the ratio is a causal or merely a coincidental factor. The key indication of a clear-cut difference in the sex determination mechanisms of mammals versus Drosophila is in the comparison of the 2A:XXY and 2A:XO phenotypes in each species (Table 1). Similarly the corresponding aneuploids, 2A:ZZw and 2A:ZO, must be found and their phenotypes analyzed in order for the nature of the avian sex-determination mechanism to be completely clear. There has been one report of an avian sex-chromosome aneuploid by Crew (1933). This was a phenotypically male chicken which demonstrated sex-linked traits indicative of a female. Crew carefully analyzed the progeny of this cock, considering both their phenotypes and the cytology of tissue samples taken from them. The conclusion of these analyses was that this male had a 2A:ZZw genotype. Unfortunately, it is difficult to confidently formulate any conclusion on the basis of a single observation. With the recent advances in the mapping of avian chromosomes (summarized by Abbott and Yee, 1975), the search for more of the necessary aneuploids now seems more promising. Once assayable gene products have been associated with each avian macrochromosome, detection of 2 A Z 0 and 2A:ZZw individuals should be much more feasible. Despite the lack of critical aneuploid data, there is other eivdence that can be brought to bear on the question of sex determination in birds. In both mammals and Drosophila, the phenomenon of dosage compensation occurs, although by strikingly different means in each group, In mammals the second X chromosome in female somatic cells is found as a heterochromatic body that apparently has no normal genetic function during most of the life-span of the organism. This heterochromatinization of the second X chromosome occurs very early in embryogenesis. The result is that there is only one functional X chromosome in female somatic cells, and thus only a single dose of X-linked gene products, as there is in normal XY male cells. In Drosophila there is no heterochromatinization of the second X chromosome in females. Instead, dosage compensation is accomplished by regulation of the genetic activity of two euchromatic X chromosomes in the female, and of one euchromatic X chromosome in the male (Muller, 1947). This mechanism is based on an effect of X-linked and autosomal compensator genes that modulate the expression of various X-linked structural genes (Gans, 1953; Kazazian et al., 1965; Ohno, 1967; Lucchesi, 1973, 1977; Stewart and Merriam, 1975).
SEX DETERMINATION I N ANIMALS
223
In light of the sex-determination mechanism in Drosophila, it is not surprising that there is no heterochromatinization of the second X chromosome in the female. Such X-inactivation would destroy any difference between the sexes in the ratio of autosome sets to functional, euchromatic, X chromosomes, which is the basis of the Drosophila sex determination mechanism. Similarly in birds there is also no heterochromatinization of either Z chromosome in the homogametic sex; in fact, no evidence for dosage compensation of any sort has been produced (Cock, 1964). That avian species are able to cope with different doses of sex-linked gene products in each sex, while mammals and Drosophila are not, is a n interesting, though presently inexplicable, fact. However, the fact that there is no heterochromatinization of the second Z chromosome in the avian male means that there is a difference in the number of functional Z chromosomes in each sex. This points to the possibility of a Drosophila-like sex determination mechanism that could be based in part on the number of functional euchromatic Z chromosomes present. Although the mechanism of avian sex determination is still unresolved, the data from intersexes, a single aneuploid, and implications from dosage compensation seem to suggest that the mechanism is more similar to that of Drosophila than that of mammals.
E. MODELSOF SEXDETERMINATION 1 . Genic Balance
Several models have been put forth to explain the genetics of sex determination. The work of T. H. Morgan and his associates from 1910 to 1920 defined the relationship between genes and chromosomes. As a result the concept of linkage became clear, largely through the work of Bridges (1914). Based on his observations of triploids, intersexes, and metasexes in Drosophila, Bridges realized the importance of the ratio of X chromosomes to autosome sets in determining the sex of each individual. Bridges proposed that the X chromosome is merely a linkage group of sex-determining genes or factors (Bridges, 1921, 1925). Similarly, he assumed that other sex-determining factors were located on the autosomes and concluded that the sex-determining ratio of sex chromosomes to autosomes actually represents a balance between X-linked and autosomal sex-determining factors. This hypothesis is known as the theory ofgenic balance (Bridges, 1921,1922,1925,1939). Bridges conducted a number of breeding experiments with Drosophila that provided some support for his ideas on sex determina-
224
JOHN R. McCARREY AND URSULA K . ABBOTT
tion. However, the strongest evidence was produced by Dobzhansky and Schultz (19341, who studied Drosophila carrying X-ray-induced deficiencies or duplications for portions of the X chromosome. They found that in intersexes small changes in the amount of X chromosome material produced observable changes in the sexual phenotype of the individual. The entire Y chromosome and the proximal one-third of the X chromosome were shown to be inert with regard to sex determination, while the distal two-thirds of the X chromosome carried genes affecting sexual phenotype. Thus, the addition of X chromatin was found to increase the expressivity of the female phenotype in Drosophila intersexes, while deletions in the X chromosome shifted the intersex phenotype toward maleness. From this evidence Dobzhansky and Schultz concluded that, as Bridges had predicted, the X chromosome contains several female-determining factors, which act in conjunction with male-determining factors on the autosomes to produce the sexual phenotype of the individual. Evidence was later contributed by Bedichek-Pipkin (1959) that autosomal male-determining factors are located on the third chromosome of Drosophila melanogaster. Bridges' theory of genic balance is still widely accepted today. In fact it stands as the best explanation of sex determination in Drosophila." However genic balance does not seem to satisfactorily fit the facts associated with mammalian sex determination, since the ratio or balance of X chromosomes to autosomes is irrelevant. 2. Chromosomal Inheritance
Until very recently there was no evidence that one or a few specific genes are involved in mammalian sex determination. This led Mittwoch to propose that it is the presence, or lack thereof, of all or most of the Y chromosome, rather than any specific gene, that determines the sex of a mammalian individual (Mittwoch, 1967a,b, 1969, 1970a,b, 1971a,b,c, 1973a,b). She suggested that the entire Y chromosome induced maleness in mammals (and that the w chromosome induced femaleness in birds) by influencing the mitotic rate in the developing gonadal cells. *Similarly, several authors have proposed that there are positive female-determining genes located on the mammalian X chromosome (Ohno, 1967; Federman, 1967). The evidence from 45:XO patients with Turner's syndrome who develop only streak gonads indicates that two X chromosomes are necessary for normal ovarian development. This seems to be the case in spite of the fact that one X chromosome becomes heterochromatic in the late blastula stage, long before the time of sexual differentiation of the gonad in the embryo.
SEX DETERMINATION I N ANIMALS
225
3. Genic Inheritance
Contrary to the assumption of Mittwoch and others that sex determination is related solely to chromosomal inheritance, convincing evidence for the involvement of single genes has mounted. The first such evidence came with the discovery of single genes capable of inducing sex reversal in mammals. In goats a recessive, autosomal gene, polled ( p ) , when present in a homozygous state, causes a 2AXX genetic female to develop testes and a corresponding male phenotype (Hamerton et al., 1969). In both pigs (Cantwell et al., 1958; Johnston et al., 1958) and cattle (Asdell, as quoted by Koch, 19631,autosomal recessive genes have also been reported to cause genotypic females to develop as males. In mice, Cattanach et al. (1971) have reported a dominant, autosomal gene (Sxr) capable of a similar sex-reversing action. XX males have also been reported in a family of dogs (Selden et al., 19781, and the condition is well known in humans (Wachtel et al., 1976; Rosenberg et al., 1963). Several theories of sex determination based on the expression of specific genes have been advanced. Ford (1970) proposed that genetic loci on the short arm of the Y chromosome either carry the information necessary for male development, or produce a derepressor that allows expression of the crucial loci in another part of the genome. TWO theories based on Y-linked control over other portions of the genome were presented by Hamerton (1968) and Boczkowski (19711, respectively. These authors both assumed that male development is guided by X-linked genes, the expression of which is mediated by a gene (Boczkowski), or a controlling center (Hamerton) on the Y chromosome. The most recent and best developed theory of sex determination based on genic inheritance involves expression of the gene for the H-Y cell-surface antigen in male cells. The existence of this male-specific antigen was first detected in a series of skin grafts among individuals within highly inbred lines of mice (Eichwald and Silmser, 1955). In these experiments all sexual combinations of donor and recipient tissue resulted in successful graft acceptance, except when male grafts were transplanted to female hosts. Thus, some histocompatibility antigen is present in male tissue, but not in female tissue, in otherwise isogenic individuals. Since the only genetic difference between such individuals is the presence of the Y chromosome in males, this must be the source of this histocompatibility response. This antigen, then, has come to be known as the H-Y (histocompatibility-Y chromosome) antigen.
226
JOHN R. McCARREY A N D URSULA K. ABBOTT
Nearly identical H-Y antigens, which cross-react with the murine H-Y antigen, have been found in the males of all mammalian species tested to date, including rats (Billingham and Silvers, 19591, guinea pigs, rabbits, and humans (Wachtel et al., 1974,1977), wood lemmings (Myopus schisticolor) (Wachtel et al., 19761, cattle (Wachtel et al., 1977), and the mole-vole (Ellobius lutescens) (Nagai and Ohno, 1977). In nonmammalian species sex-specificantigens, which also cross-react with murine H-Y antigen, have been reported in the heterogametic sex in the chicken (Bacon, 1970) and two species of frogs (Ranapipiens and Xenopus laevis) (Wachtel et al., 1975). The apparently ubiquitous occurrence of this evolutionarily conserved H-Y antigen in male mammals and in the heterogametic sex of some nonmammals has led several investigators to hypothesize that the H-Y antigen is involved in sex determination (Silvers et al., 1968; Ohno 1976, 1977; Ohno et al., 1978a,b; Silvers and Wachtel, 1977; Wachtel, 1977). The fact that this antigen has been so highly conserved in evolution indicates that it is involved in a very important and basic trait, such as sex determination. In addition, observations in several mammalian species have revealed a consistent correlation between the presence of H-Y antigen and testicular development (Wachtel, 1977). In fact it seems that it is the expression of the H-Y antigen gene(s1 rather than the mere presence of the Y chromosome (although the former is normally dependent on the latter) that is crucial for male sex determination in mammals. This is epitomized by the finding that the H-Y antigen is expressed on cells of individuals possessing testes but no Y chromosome. Thus, H-Y antigen has been observed in 2A:XX mice carrying Sxr (Bennett et al., 1975), in human 2A:XX males (Wachtel et al., 1976), and in male mole-voles (a species in which both sexes are 2A:XO, but only the males produce H-Y antigen) (Nagai and Ohno, 1977). Wachtel et al. (1978) have recently shown that XX male and true hermaphrodite goats homozygous for the recessive gene polled are also H-Y antigen positive at 60-805'2 of the normal male level. Since the mothers of these XX male goats are obligatory heterozygotes for polled, it is not surprising that Wachtel et al. detected H-Y antigen a t 30-405'2 of the normal male level. Thus, a subthreshold level of H-Y antigen expression is quite compatible with normal female development. A similar finding has been reported by Selden et al. (1978) for a family of dogs. In this case both a 2A:XX male pup and its mother were H-Y antigen positive. In addition, the grandfather of the 2A:XX male pup was found to absorb considerably more H-Y antibody than normal 2A:XY males, indicating the presence of both normal male-
SEX DETERMINATION IN ANIMALS
227
determining H-Y genes on his Y chromosome and supernumerary H-Y genes either on an autosome or on his X chromosome. H-Y antigen is also found on cells of 2AXX mice carrying the X-linked gene for testicular feminization (tfm)(expression of this gene results in development of testes but no other male characteristics) (Bennett et al., 1975). The H-Y antigen gene is expressed in 2A:XXY male mice but not in 2 A X 0 female mice (Celada and Welshons, 1963). Alternatively, there are cases of 2A:XY mammals that are H-Y antigen negative and develop as females. These include approximately half of the observed female wood lemmings (Wachtel et al., 1976) and occasional cases in humans (Ghosh et al., 1978). The hypothesis, then, is that there is a gene, or genes, on the Y chromosome that codes for H-Y antigen prior to the time of sexual differentiation of the gonad in the embryo [as early as the eight-cell stage in mice (Krco and Goldberg, 1976)],and that the presence of this H-Y antigen on the gonadal cells results in testicular development. Crucial to this theory is the presence of a second gene product, which forms a specific membrane-bound receptor for H-Y antigen. While the heterogametic sex-specific expression of H-Y is ubiquitous, this membrane-bound H-Y antigen-receptor is expressed only by gonadal cells, but of both sexes (Ohno et al., 1978b).Neither the exact developmental mechanism nor any precise genetic regulatory mechanism governing the expression of H-Y antigen and its subsequent induction of testicular development have been worked out to date. Ohno et al. f 1978b) feel that expression of the H-Y antigen genes is not stringently regulated, but rather is constitutive. There is no question that there is a Y-linked locus (or loci) that is directly involved in the expression of H-Y antigen. Indeed Koo et ul. (1977) have localized this activity to the short arm of the Y chromosome in normal humans, based on comparing various abnormal sexual phenotypes with certain structurally abnormal Y chromosomes. In fact, Nagai and Ohno (1977) have claimed: “Possession of the H-Y antigen is apparently the ruison d’ktre of the mammalian Y-chromosome.” However, the question remains whether this locus represents the H-Y antigen structural gene or a regulatory gene. According to the latter idea, the Sxr mutation in mice, which is an autosomal gene for H-Y antigen, would represent a constitutive mutation of an autosomal structural gene such that it no longer requires the positive regulative influence from the Y-linked controlling locus. Supporters of a structural gene at the Y locus suggest that Sxr represents a translocation of an H-Y structural gene to an autosome (Wachtel,
228
JOHN R. McCARREY A N D URSULA K . ABBOTT
1977); however, only very limited cytological evidence for such a translocation has been reported (Winsor et al., 1978). In the case of the mole-vole in which both sexes are genetically 2 A X 0 , Nagai and Ohno (1977) proposed that the structural gene for H-Y antigen resides on the X chromosome in males. Again production of H-Y antigen could represent loss of dependence of a n X-linked structural gene on a Y-linked regulatory locus, or a Y-X translocation of the H-Y antigen structural gene. In support of the idea of a structural gene at the Y-linked locus, Wachtel(1977) has pointed out that human males with two Y chromosomes (2A:XYY or 2AXXYY) produce more H-Y antigen than normal 2AXY males; thus there is a correlation between the number of Y chromosomes and the amount of H-Y antigen produced. Wachtel feels this is more easily explained by the existence of supernumerary structural genes than by supernumerary regulatory genes. In the case of the 2A:XY female wood lemmings, it has been suggested that a n X-linked mutation results in suppression of the male-determining function of the Y chromosome (Fredga et al., 1976, 1977). The evolutionarily conserved nature of X-linked loci in mammals is well established (Ohno, 1967). With this in mind, Wachtel (1977) has proposed that the X-linked locus in 2A:XY female wood lemmings may represent a deficient mutant allele of a wild-type positive regulatory gene present in 2A:XY males of the wood lemming and all other mammalian species. This X-linked regulatory gene would thus induce expression of the Y-linked H-Y antigen structural gene in wild-type males. ’ Cytological evidence supporting the idea of an altered X-linked locus in 2A:XY female wood lemmings has recently been provided by Herbst et al. (19781, who have demonstrated differences in G-band patterns between the X chromosome of XY females (X*) and the X chromosome of XY males. This difference in banding pattern is present on the short arm of the X chromosome, which is shorter in the mutant X* chromosome than in the normal X chromosome. This finding provides a cytological tool that allows investigators to distinguish betwe& XX and X*X females and between X*Y females and XY males. Alternatively, there is the idea that the mutant X-linked locus in 2A:XY female wood lemmings is the structural gene for H-Y antigen, which has lost its ability to respond to the positive control exerted by a Y-linked regulatory locus. Thompson (1978) has proposed a theory based on the idea that the Y chromosome was originally completely homologous to the X chromosome and has differentiated throughout evolution while the X chromo-
SEX DETERMINATION I N ANIMALS
229
some has remained fairly stable. Thus, he proposed that both chromosomes originally hosted H-Y antigen operons, however, the Y-linked operon has lost its negative control element and produces H-Y antigen constitutively. This would account for the reduced amount of H-Y antigen produced in 2A.XX males, which would have extra H-Y structural genes but also an extra negative regulator, and could also explain the dosage effect of multiple Y chromosomes producing excess H-Y antigen. Thompson’s theory fits the facts gathered to date, but he has proposed no critical experiments to test it. The question of a regulatory versus structural function of the Y-linked H-Y antigen locus is one that is very difficult to resolve. For both the normal and all abnormal cases there are equally plausible schemes involving either a structural or regulatory Y-linked locus as an explanation. In all likelihood this question will remain unanswered until the mRNA for H-Y antigen can be obtained and used as a probe in an RNA-DNA hybridization experiment to localize the structural gene. The existence of H-Y antigen provides a priori evidence that there exists a structural gene, whatever its location. In addition, there is sufficient evidence to postulate a regulatory gene governing expression of this structural gene. Wachtel(1977) has proposed the existence of a third gene that would affect primary sex differentiation. Based on the notion that any morphogenetic function of H-Y antigen would in all likelihood involve a specific plasma membrane receptor, Wachtel proposed that there must be a gene that codes for such a receptor. Then a mutation in this gene, rendering the receptor inactive, could result in a 2A:XY individual who is H-Y antigen positive but fails to develop testes. Wachtel pointed to H-Y positive human females (2A:XY), who show pure gonadal dysgenesis as possible examples of such a mutation. Indeed German et al. (1978) have reported evidence of a gene they believe to be X-linked that prevents testicular differentiation when present in 2A:XY human embryos. The gonads of such embryos develop as streak gonads similar to those of 2A:XO females. Their hypothesis that this gene is an X-linked recessive is based on its familial occurrence among two sisters, their maternal aunt, and their maternal cousin. This gene has no apparent effect when present as a mutant allele heterozygous to its normal allele in 2A:XX women. The development of the secondary male sex characteristics in marnmals is dependent on a separate set of genes (Ohno, 1976).These traits are androgen-dependent, and therefore require expression of genes necessary to produce testosterone, and expression of the X-linked gene that codes for the cytoplasmic receptor of testosterone (the wild-type
230
JOHN R. McCARREY AND URSULA K . ABBOTT
allele of tfm).Ohno et al. (197813) stated that testosterone production by fetal Leydig cells and antimullerian hormone production by fetal Sertoli cells are programmed consequences of H-Y antigen-induced testicular organogenesis. That there is a w-linked sex-specific antigen in female birds has been demonstrated by Bacon and Craig (1966, 19691, Gilmour (19671, and Wachtel et al. (1975). In addition, the idea that this antigen may also be Z-linked has been argued for (Bacon, 1969) and against (Wachtel et al., 1975). Wachtel et al. (1975) have implied that this sex-specific antigen could be involved in avian sex determination. If the analogy to mammalian sex determination is taken to its full extent, then the hypothesis would be that there is a sex-specific antigen coded for by a w-linked gene in female birds that is responsible for ovarian development. Such a scheme would be consistent with the idea that a specific antigen is produced by, and induces differentiation of, the heterogametic sex in all higher vertebrates. However, this hypothesis would be difficult to support in birds if the sex determination mechanism is based not on the presence or the absence of the w chromosome, but rather on the ratio of Z chromosomes to autosome sets, as discussed earlier. Such a sex-determination mechanism would imply either that the sex-specific antigen is not involved in primary sex differentiation in birds or that, if it is involved, it may not be w-linked. Nevertheless, the evidence for the involvement of the H-Y antigen gene(s) in mammalian sex determination and the possibility of similar genes producing similar effects in other vertebrate species has provided significant support for the concept of genic inheritance of sex. Such a concept would seem at the outset to be preferable to the idea of chromosomal inheritance that relies on a unique, hypothetical, nonMendelian mechanism of expression. The previous inability to identify specific genes involved in sex determination, which spawned the theory of chromosomal inheritance, can probably be attributed to the relatively low number of fecund mutants in this system. Such mutants affecting sex determination and subsequently sex differentiation would obviously directly affect reproductive fitness and, therefore, would be strongly selected against and would be difficult to analyze genetically, since most could not reproduce. 111. Gonadal Sex Differentiation
The most common investigative approach to sex determination has involved studies of sex differentiation, with the hope that an increased
SEX DETERMINATION I N ANIMALS
231
knowledge of the effect may lead to a better understanding of the cause. As with sex determination, the mechanisms of sex differentiation have been examined in several systems. Of those reviewed above, the greatest insights into sex differentiation have come from work with certain birds and mammals.
A. DESCRIPTIVE EMBRYOLOGY In all avian and mammalian species studied to date, the early embryonic gonads are sexually indifferent, and it is the subsequent events of sex differentiation that establish sexual dimorphism. In general, the early development of the indifferent gonad is similar in all vertebrates. Briefly, the germinal ridges first develop a s thickened longitudinal strips of epithelium in close association with the mesonephros. This epithelium derives from the coelomic epithelium and the visceral layer of the lateral plate mesoderm and gives rise to the cortex or germinal epithelium of the indifferent gonad. A medulla composed of loose undifferentiated mesenchyme and primitive sex cords forms below the cortex. These primitive sex cords are derived from the germinal epithelium and grow down into the mesenchymal medulla. Primordial germ cells, which have migrated to the indifferent gonad from their extraembryonic site of origin, are found throughout the cortex and within the sex cords of the medulla. Sexual differentiation of the gonad results from the development of only one gonadal component, either the cortex or the medulla. In both birds and mammals, a testis forms from a proliferation of the medulla and regression of the cortex, whereas an ovary derives from the development of the cortex with a general regression of the medulla. This process is shown schematically in Fig. 2. Differentiation of the testis is marked by continued development of the medullary cords, into which the cortical germ cells migrate. These sex cords form the seminiferous tubules, which are composed of an outer layer of Sertoli cells within which the germ cells undergo spermatogenesis. Concurrent with the differentiation of the seminiferous tubules, a second set of tubules, the rete testis, develops in the hilum of the male gonad. The tubules of the rete testis become continuous with the seminiferous tubules and act as a collection system for the spermatozoa in the adult. The rete testis becomes connected to the genital ducts (the epididymis and the vas deferens), thus completing the pathway for the flow of spermatozoa. Whether it is the loose mesenchymal cells surrounding the primitive sex cords, or the cord cells themselves that develop into the androgensecreting interstitial cells of Leydig in the adult testis is an unresolved question. The primitive cortex degenerates into a condensed layer
232
JOHN R. McCARREY AND URSULA K . ABBOTT
f st ge to
B
C
E
FIG. 2. Gonadal sex differentiation in vertebrates. The process of sexual differentia-
tion of the gonads in vertebrates is shown schematically. (A) The indifferent gonad contains primitive sex cords (psc), germinal epithelium (ge), an interstitial medulla (im), and germ cells (gc) in the germinal epithelium and primitive sex cords. (3)The early testis shows future seminiferous tubules (fst), which develop from the primitive sex cords, the tunica albuginea (ta), which forms as the germinal epithelium condenses, interstitial cells (ic), and spermatogonia ( s ) in the future seminiferous tubules. (C) The differentiated testis contains a rete testis (rt), spermatogonia ( s ) within the seminiferous tubules (st), interstitial cells of Leydig (icL),and the tunica albuginea (ta). (D) The early ovary has regressing medullary cords (rmc),interstitial cells (ic),future follicle cells (ffc), and oogonia (0)in the germinal epithelium (ge). (E) A single mature ovarian follicle contains the oocyte (0)within the cumulus oophorus (co), the granulosa layer (g), the membrana propria (mp), the theca interna (ti), and the theca externa (te).
covering the gonad. This fibrous encapsulating layer is known as the tunica albuginea. The same cortical layer of the indifferent gonad, which forms only the tunica albuginea in the male, gives rise to the entire germinative portion of the ovary in the female. The first sign of ovarian development is an increasing density in the cortex relative to the medulla. The germ cells are concentrated in the cortex, which grows and thickens rapidly.
SEX DETERMINATION IN ANIMALS
233
Cells originally residing in the primitive sex cords (which are of cortical origin) form steroid-producing cells present in the medulla. Subsequently these medullary islets of interstitial cells move to the cortex, where they become embedded among the cells of the theca interna and interfollicular tissue (Narbaitz and DeRobertis, 1968). Thus whereas the medulla is the source of estrogen production in the embryonic ovary, it is the cells of the theca interna layer in the cortex that produce estrogens in the adult. The medulla of the developing female gonad degenerates into a sparsely organized structure destined to act only as a source of physical and vascular support for the ovarian cortex. Despite the basic similarities between mammalian and avian gonadal development, there are certain important distinctions. The most striking difference is that normally in the avian female only the left gonad differentiates into a functional ovary (the right gonad remains indifferent and rudimentary), whereas in mammals female gonad development is bilaterally symmetrical.* Examination of the right indifferent gonad in the chick reveals that the primitive cortex is quite rudimentary and sparse (Hamilton, 1965; Mittwoch, 1971a). Thus, it seems that this gonad is without the potential to form an ovary under any normal circumstance. The medulla of the right gonad is of normal size and composition and therefore can and does participate in normal gonadogenesis in males. The developmental basis of this asymmetrical ovarian development in birds is unknown; however, a consideration of the adult anatomy is revealing. The requisite size of a single reproductive tract necessary for production of the relatively large avian egg consumes most of the space available in the coelomic cavity of the adult female. Thus, it is not surprising that the development of a paired reproductive system in the female of all avian species studied has apparently been selected against during evolution. A second difference between avian and mammalian gonadogenesis involves the disparity in which sex first initiates gonadal differentiation. It is the male gonad that first shows signs of differentiation in mammals (Arey, 1974; Jost, 1958), whereas in birds female gonadal development begins first. In both cases, however, it is the gonad of the heterogametic sex that first initiates sexual differentiation (Hamilton, *There have been several exceptions reported to the rule of asymmetrical gonad development in avian females (Kinsky, 1971; Gunn, 1912). Most birds with paired ovaries possess a single sinestral oviduct, indicating selection against a bilateral reproductive system either began first or h a s been more strongly exerted against the right oviduct as opposed to the right ovary.
234
JOHN
R.
McCARREY AND URSULA K. ABBOTT
1965). In this respect both resemble Drosophila, in which it is the gonad of the heterogametic (male) sex that shows more rapid development (Kerkis, 1931).
B. THE DOMINANT SEXVERSUS
THE
NEUTRAL SEX
An initial question was what effect the presence of gonads of one sex have on those of the other sex, thereby determining any developmental dominance between the sexes. The first observations to this end were made by Tandler and Keller (1911) and Lillie (1916, 1917) in cattle. They noticed that the female partner of a heterosexual set of twins develops as a masculinized female or freemartin, while the male twin differentiates normally. The freemartin phenotype is characterized by ovarian reduction and sterility and fairly complete regression of the Mullerian ducts. In addition, positive signs of male development including a few seminiferous tubules and seminal vesicles are occasionally seen. The freemartin effect is mediated by a vascular anastomosis between the oppositely sexed twins during development. This anastomosis allows both humoral and cellular exchange, such that the freemartin develops as a n X S X Y chimera (Hare, 1977; Sattar, 1977; Vigier et al., 1976). The interpretation of this phenomenon is that the male sex is dominant over the female sex, because the masculinizing influence of the male fetus is sufficient to inhibit, and partially reverse, normal female sexual development. Similar cases of the freemartin effect have been observed in swine (Hughes, 1929) and sheep (Moore and Rowson, 1958; Alexander and Williams, 1964; Wilkes el al., 1978). Several investigators have experimentally tested the effect of the gonads of one sex on the development of the gonads in the opposite sex. In both rabbits and rats, normal development of fetal ovaries is inhibited when these organs are associated with fetal testes in combined grafts on adult hosts (MacIntyre, 1956; Holyoke, 1949). These experiments support the contention that in mammals the male sex is dominant over the female sex. In birds the opposite is true: the female gonad is dominant and has the power to inhibit normal male sexual development. A phenomenon similar to the freemartin in cattle develops in double-yolked eggs in which the twin embryos are of opposite sex. As a result of the common circulation that develops, the ovaries of the female embryo exert a feminizing influence on the developing gonads of the male embryo (Lutz and Lutz-Ostertag, 1959; Ruch, 1962). Experimental associations of avian embryonic ovaries and testes in u i w (Wolff, 1946) and in vitro
SEX DETERMINATION I N ANIMALS
235
(Wolff and Haffen, 1959) have provided further support for female dominance in birds. Studies aimed at establishing the neutral sex have provided a second approach to the determination of dominance between the sexes. T h e neutral sex is that sexual phenotype which develops in the absence o any gonadal influence in the embryo. Although these investigations are based on analysis of secondary sex characteristics, the results agree with, and thus provide support for, the more direct dominance experiments described above. Determination of the neutral sex is made by removing the gonads prior to the time of secondary sex differentiation in the embryo. In mammals, experiments on both the rabbit (Jost, 1947a,b) and the mouse (Raynaud and Fridley, 1947) have shown that female secondary characteristics consistently develop in the absence of gonadal influence in the embryo, irrespective of the genetic sex of the individual. Conversely, in birds early castration experiments performed by Wolff and Wolff (1951) revealed that the male is the neutral sex. On the cellular level, developmental dominance between the sexes has been established by the use of experimental chimeras in mammals, specifically allophenic mice. By fusing two early embryos of unknown genetic sex at random, a single embryo develops that will contain both male and female cells in approximately 50% of the cases (McLaren, 1976). The sex ratio among grouped chimeras of all three possible sexual combinations (XWXX, XWXY, XY/XY) shows a definite excess of males (McLaren, 1976; Mullen and Whitten, 1971; Mystkowska and Tarkowski, 1970; Tarkowski, 1961, 19641, and this is reflected in a strong deviation of the sex ratio toward maleness specifically within the heterosexual (XWXY) class in most (McLaren, 1976; Mystkowska and Tarkowski, 19701, but not all (Mintz, 1974; Mullen and Whitten, 19711, cases. Although an XWXY chimera might be expected to develop a n intersexual phenotype, the incidence of true hermaphrodism* in allophenic mice is consistently well below the expected 50%. Tarkowski (1964) reported 3 hermaphrodites in 14 chimeras; Mintz (1968) found only 6 hermaphrodites in a total of 463 allophenic mice; and Whitten (1975) detected 12 in 1200. In each of the latter two reports (in which the sample size is large), the incidence of hermaphrodism is
1
*Mammals with gonadal tissue characteristic of both sexes are considered to be true hermaphrodites. This combination oftissue types may be in the form of a complete ovary and a complete testis, or as an ovotestis. As a result of the presence of some testicular tissue, most hermaphrodites tend toward maleness in the differentiation of their secondary sex characters, although there is almost always a uterus present (Federman, 1967).
236
JOHN R . McCARREY A N D URSULA K . ABBOTT
approximately 1%. Mullen and Whitten (1971) reported a significant excess of male chimeras, which approximately equaled the missing number of expected hermaphrodites. This led to their conclusion that either many of these males were cryptic hermaphrodites, or the presence of some male cells selected against the development of ovarian tissue. Although the work of MacIntyre (1956) and Mystkowska and Tarkowski (1970) supports this contention, Mintz (1968) reported an approximately equal number of chimeric males and females in addition to the small number of hermaphrodites she observed. Mintz suggested that there may be embryonic selection against hermaphroditic gonads at the organ level or constant selection within the gonad at the cellular level. Allophenic mice composed from strains of “different developmental vigor” do not show any excess of chimeric males according to Mullen and Whitten (1971), although there is still a deficit of hermaphrodites. Thus, this case is supportive of Mintz’s suggestion of selective forces militating against the development of hermaphrodites, based on the assumption that the more vigorous strain predominates. The excess of males in most XWXY chimeras indicates that there seems to be a dominance of the male sex at the cellular level corresponding to that at the organ level in mammals. By combining the experimentally verified concepts of the neutral and dominant sex in each organism, it can be seen that sexual dimorphism is actually not two opposite states, but rather the presence or the absence of a single state (the dominant sex). Thus, the data obtained in the dominance experiments described above should be interpreted not as the result of two antagonistic forces being juxtaposed with the dominant sex winning out in the end, but rather as the imposition of a dominant state on a null state. In mammals it can be seen that the presence of a testicular influence in a normal genetic male, in a freemartin, in a chimera, or as the result of a grafting experiment, leads to the expression of the dominant male state, whereas the lack of this influence results in femaleness. That the dominant sex in mammals is the opposite of that in birds conforms with the contrariety of the heterogametic sex in each species. Thus, it seems that in both cases it is the heterogametic sex which is the dominant sex and begins differentiation first.” The bistable nature of the dominant and null states is quite consis*The correlation of the dominant sex with heterogamety seems to be the general rule for most vertebrates (Jost, 1965); however, certain urodele amphibians have been reported to deviate from this pattern (DeBeaumont, 1933).
SEX DETERMINATION I N ANIMALS
237
tent, and is violated only in the case of true hermaphrodites. That true hermaphrodism represents a very unstable state of sex determination in mammals is evidenced by the paucity of intersexual development in XWXY heterosexual chimeras discussed above. This, in turn, is probably a reflection of strong evolutionary selection against any sexdetermination system that would allow the frequent development of hermaphrodites, since these individuals are usually sterile, and therefore of no benefit to the species. Hermaphrodism remains, however, the most difficult phenotype for any genetic or developmental mechanism of sex determination to explain. The mosaic gonadal phenotype of hermaphrodites would be most easily explained by a mosaic genotype. Although such genetic mosaicism has been found in several human hermaphrodites, the majority have been karyotyped as 46:XX (Federman, 1967; Ford, 1970; Jones and Scott, 1971). However, the degree of mosaicism may vary in different tissues tested and/or a second cell line may have been present in earlier pretest stages. Ferguson-Smith (1966) proposed an ingenious explanation for hermaphrodism in 46:XX individuals. This hypothesis is based on the idea that one of the X chromosomes carries a translocated male-determining portion of the Y chromosome. Then as a result of random X-inactivation in this XXy individual, a mosaic containing both male (Xy) and female (XI cells is established. The possibility of an interchange of X and Y chromatin is supported by the observation of pairing of portions of the X and Y chromosomesduring meiosis in human males (Mosesetal., 1975). The additional observation of a synaptonemal complex in this region of X-Y pairing suggests that crossing-over may occur. Rosenberg et al. (1963) reported the occurrence of hermaphrodism in three human brothers, all with 46:XX genotypes. This suggests a heritable, familial factor that can induce an intersexual phenotype. The action of such a factor could be similar to that of the sex-reversing genes known in other mammals (Sxr,polled), the only real difference being lower expressivity. Indeed, Wachtel e2 al. (1978) showed that p l k d intersex goats are H-Y antigen positive. They feel this finding is consistent with the view that there is a family of H-Y antigen structural genes on the Y chromosome and that translocation of a subcritical number of these genes can produce an intersexual phenotype inherited in a recessive mode. Similarly de la Chapelle ef al. (1978) studied three XX human males from one pedigree and found them all to be H-Y antigen positive. They also found the mothers of these XX males to be H-Y positive. This is consistent with a recessive mode of inheritance of maleness, which would require male-determining genes in both par-
238
JOHN R. McCARREY AND URSULA K . ABBOTT
ents. Such an inheritance pattern is supported by the pedigree of these males since two of them have normal XX sisters. C. MODELSOF SEXDIFFERENTIATION
1. Cortical and Medullary Inductors The idea that sex differentiation is the result of antagonism between male and female forces has been the mainstay of thought in this field throughout this century. This concept, which was first developed in amphibians by Witschi (1939) and was later applied to mammals (Jost, 1958,19651, holds that gonadal differentiation results from a predominance of either cortical or medullary “inductors” in the indifferent gonad. Clearly this theory implied more complexity in the process of gonadogenesis than is really necessary, since all that is needed is an inductor of one sex (the dominant sex), which would be either present or absent in the indifferent gonad. Thus, in mammals a male inducer would stimulate the indifferent gonad to form testicular tissue, whereas in the absence of this inducer the indifferent cortex would form an ovary. Once again in birds the situation would be reversed in that sex differentiation would depend on the presence or the absence of a female inductor that stimulates cortical development. Witschi‘s basic idea that the cortex-medulla relationship represents the phenotypic manifestation of genotypic sex determination remains a valuable developmental approach to the study of phenotypic sex differentiation. Several experiments with birds have demonstrated the developmental capacities of isolated gonadal cortex or medulla in each sex. Wolff and Haffen (1951, 1952a-e, 1959) isolated germinal epithelium (cortex) from the left gonads of duck embryos aged 5-9 days and maintained this tissue in culture. These experiments and the resultant differentiated phenotypes observed are summarized in Table 2. It can be seen that germinal epithelium from female gonads of 5-10 days of incubation or from male gonads at 7 days or later is capable of autonomously forming a complete gonad in accordance with the genetic sex of the tissue. However, cortex isolated from male gonads younger than 6.5 days of incubation did not undergo sexual differentiation. This indicates a dependence of this tissue on some exogenous factor(s1 for sex differentiation. Such a dependence was demonstrated in subsequent experiments by Haffen (1960), in which she recombined cortex and medulla from gonads of opposite sex and varying ages. This work is shown in Table 3. Upon recombination of male germinal epithelium aged 5 -7 days of incubation with differentiated medulla of either sex, the recombinant differentiated in accordance with the sex of
239
SEX DETERMINATION I N ANIMALS
TABLE 2 Isolated Avian Cortex Development Genetic sex
Age when isolated (days of incubation)
Male Male Female
Less than 6 days More than 7 days 5-10 days
Differentiated phenotype
No differentiation Testis Ovary
the medulla. The formation of an ovotestis from the 7-9-day embryonic male corted9- 13 day embryonic female medulla recombinant indicates a gradual lessening of the dependence of male germinal epithelium on medullary induction as development proceeds. The fact that male cortex does not normally form testicular tissue in uiuo may lead to some confusion in analyzing these experiments, since they indicate that male cortex does form testicular tissue in uiko. However, since the seminiferous tubules, which are the dominant component of differentiated testicular tissue, derive from the primitive sex cords, which are in turn a derivative of the germinal epithelium (cortex) of the indifferent gonad, there is no contradiction. Thus, it appears that in the gonad of the dominant sex (females in the avian examples above), the germinal epithelium becomes developmentally autonomous a t a very early stage and is therefore not susceptible to exogenous inductive forces. However, during these same early stages in the neutral sex, the germinal epithelium remains susceptible to, and in fact requires, a n exogenous inductive force from the medulla for sexual differentiation. The key question, then, is: What is this inductive force that mediates the phenomenon of dominance between oppositely sexed gonads or between cortex and medulla in a single gonad? TABLE 3 Avian Cortex-Medulla Fkcombination Experiments Medulla sourceo
+
Cortex source"
-
Differentiated phenotype
9- 13-Day female
5-7-Day female 5-7-Day male 7-9-Day male
Ovary Ovary Ovotestis
9- 13-Day male
5-7-Day male 5-7-Day female
Testis Ovary
" Ages are in days of incubation
240
JOHN R. McCARREY A N D URSULA K . ABBOTT
2. Hormonal Theory
Since the discovery of freemartins in cattle, various authors have attempted to ascribe every aspect of sex differentiation to the action of hormones. Lillie’s original interpretation of the freemartin effect was based on the flow of male sex hormone from the male fetus, via the anastomosed circulation, to the female co-twin, where he assumed it caused a masculinization of the reproductive system. By far the greater part of the evidence dealing with the role of hormones in sex differentiation concerns the development of secondary sex characteristics. That the development of these characters is mediated by hormones secreted by the gonads is well established (Jost, 1965; Goldstein and Wilson, 1975). This conclusion is based on a combination of evidence from the predifferentiation castration experiments in mammals (Jost, 1947a,b; Raynaud and Fridley, 1947) and birds (Wolff and Wolff, 1951), along with the results from hormone administration experiments i n vivo and in vitro (in mammals: Bruner and Witschi, 1946 Jost et al., 1963; Price and Ortiz, 1965; Price, 1970; in birds: Wolff, 1962a,b; Wolff and Haffen, 1965; Haffen, 1970). These experiments satisfy the classical removal and replacement scheme used to establish the source and action of an endocrine function. However, the role of hormones in primary sex differentiation is less clear. Attempts to repeat the results of the experiments that established the phenomenon of dominance between the sexes using exogenously administered sex hormones have produced ambiguous results. Moore (1950) and Short et al. (1969) showed that the freemartin phenotype cannot be completely reproduced by the administration of testosterone to a female fetus in utero. In addition, several other experiments in mammals aimed a t reversing primary sex differentiation by the administration of sex hormones have resulted in only a partial reversal (Raynaud, 19421, an inhibition of normal sexual development (Jost, 1947a,b), or no effect a t all (Wells and van Wagenen, 1954). Burns (1950) found extensive persistence of the germinal epithelium along with a few cases of ovotestes formation as a result of estrogen administration to the testes of newborn opossums.* In duck embryos application of crystalline female hormone to undifferentiated male gonads in culture consistently led to formation of a n ovotestis in the left gonad (Wolff and Haffen, 1952d). Similar results were obtained by Weniger (1958, 1961) using chick gonads. Narbaitz and DeRobertis (1970) produced inversion in chick gonads by applying *Marsupials, such as opossums, are born prematurely and undergo further development within the maternal pouch.
SEX DETERMINATION I N ANIMALS
241
estradiol to genetically male embryos in uiuo. The inversion produced was similar to that seen in culture; however, after hatching these chicks reverted to their genotypic sex and a testis was again formed on the left side. Carlon and Erickson (1978) working with chick gonads showed that culturing embryonic 6- and 8-day left testes for 11and 9 days, respectively, in the presence of either exogenous estrogens or androgens resulted in a partial or complete somatic sex reversal in most cases. They suggest that it is merely the presence of any sex steroids at the time of sexual differentiation (7-8 days of incubation) that induces the avian indifferent gonad to form an ovary, and that the absence of steroidogenesis during the indifferent period may be critical for normal testicular development. Thus, in both birds and mammals, exogenously administered sex hormones are capable of partially affecting gonadal sex differentiation, but this effect is rarely complete. This ambiguity has led to other approaches in deducing the potential role of sex hormones in primary sex differentiation. One approach has been to determine the capacity of the indifferent gonad to synthesize and secrete steroid hormones that could subsequently cause the gonad to differentiate sexually. Production and secretion of steroid hormones are marked by specific ultrastructural cellular characteristics. Narbaitz and Adler (1966) conducted an extensive ultrastructural analysis of embryonic chick gonads, using the presence of agranular reticulum and lipid droplets as key indicators of cellular steroid production. They found that both indicators are present in small amounts in undifferentiated gonads, but that major increases are not seen until after day 8 of incubation in ovaries and after day 16 in testes. These increases are subsequent to the time of sexual differentiation of the gonads and are contemporary with the steroid production required to mediate the induction of secondary sex characteristics. Analysis of the biological activity of early duck gonads has shown that undifferentiated left ovaries can exert a feminizing influence on a developing testis when the two gonads are associated and cultured in uitro (Wolff and Haffen, 1952b,c,d,e). Subsequent experiments by Weniger (1961) in which undifferentiated gonads of opposite genetic sex were linked by parabiosis confirmed these results. Weniger (1962) also demonstrated the diffusible nature of this feminizing influence by growing indifferent testes on culture media which had previously supported undifferentiated ovaries. The result was a feminization of the testes identical to that seen in the parabiosis experiments. Haffen (1975) has reviewed the biochemical and histochemical
242
JOHN R. McCARREY AND URSULA K . ABBOTT
studies of the steroid-producing capacities of undifferentiated avian gonads. Upon introduction of various labeled precursors (Na-[l-'C]acetate, ['4Clprogesterone, and [4-'4C]dehydroepiandrosterone)to indifferent avian gonads in culture, varying amounts of labeled estrogens were produced and secreted into the medium (Weniger and Zeis, 1971; Haffen and Cedard, 1968). Histochemical tests based on the detection of enzymic activity as shown by the presence of A5-3Phydroxysteroid dehydrogenase (A5-3p-HSDH) have indicated that there is activity in the germinal ridge as early as 2.5 days of incubation (Woods and Weeks, 19691, and that this activity is confined to the gonadal medulla in both genetic males and females (Chieffiet al., 1964; Narbaitz and Kolodny, 1964; Wolff et al., 1966; Scheib and Haffen, 1968).This technique has localized this activity to the cells of the early medullary cords, and later, at about 7-8 days of development, activity is also found in the interstitial cells. In mammals, work with guinea pig gonads has provided support for the precocious onset of steroidogenesis in the dominant gonad reported for birds above. Price and co-workers have detected androgen synthesis in undifferentiated guinea pig testes as early as 22 days of gestation (sexual differentiation occurs a t 25-27 days) (Price and Ortiz, 1965; Ortiz et al., 1966, 1967; Price et al., 1967, 1971; Zaaijer et al., 1966; Price, 1970). Detection of androgen secretion was based on the ability of a prostate gland to persist (an androgen-dependent phenomenon) when cultured in vitro in association with the gonad being tested. Moreover, Price (1970) reported that Verhoef-Bouwknegt and Zaaijer detected androgen secretion in 23-day fetal testes using the histochemical test involving detection of A5-3P-HSDHactivity. Finally, electron microscopy has demonstrated agranular reticulum in the somatic cells of fetal testes aged 22-24 days (Black and Christensen, 1969). The evidence from the biochemical, histochemical, and biological tests and electron microscopy leave no doubt that hormonal activity is present in the indifferent gonads of the dominant sex in both birds and mammals prior to the time of gonadal sex differentiation. This is strong coincidental evidence that hormones may be involved in primary sex differentiation; however, the questions of whether or not the amount of hormone produced is sufficient to induce sexual differentiation of the gonad, and, if so, whether this is the causal event in sexual gonadogenesis or merely a contemporary event, remain. To discriminate between sex hormone production as a causative versus coincidental event in primary sex differentiation requires an analysis of the gonadal cell types involved in the production of, and the apparent response to, these hormones. In the male embryonic gonad
SEX DETERMINATION IN ANIMALS
243
the primitive cord cells, and later the interstitial cells of Leydig, are the source of the androgens (Narbaitz and Adler, 1966; Narbaitz and DeRobertis, 1968; Woods and Weeks, 1969). In the embryonic female gonad, it is the future theca cells that produce the estrogens. Narbaitz and Adler (1966) have claimed that both the ovarian theca cells and the testicular Leydig cells derive from the same primitive sex cord cell type in the indifferent gonad of the chick. Accordingly, they suggested that the differentiation of the primitive cord cells in the medulla may be the most important event in primary sex differentiation. Every cell type in the indifferent gonad is involved in organogenesis of the gonad to some extent, however, the primitive germinal epithelium seems to give rise to the most significant portions of the adult gonad in both sexes, and would therefore seem to be the tissue most involved in responding to sex hormones. In the female it is the germinal epithelium that differentiates into the ovarian cortex; and in the male, the primitive sex cords, a derivative of the germinal epithelium (Hamilton, 1965), form the seminiferous tubules. It follows that if the hormonal theory of primary sex differentiation is valid, then the most important events in the sexual development of the gonads are: (1) the differentiation of the primitive sex cord cells in the medulla resulting in the production of the dominant or neutral sex hormones, and (2) the corresponding response to these hormones by the germinal epithelium and/or its derivative, the sex cords. In terms of the dominant-null state concept, the hormone of the neutral (null state) sex would be destined to be produced unless the dominant sexual genotype is present, in which case the dominant sex hormone would be precociously produced. The relationship between the cortex and medulla implied by the hormonal theory is supported by the work of Wolff and Haffen described earlier (Tables 2 and 3). The destiny of the neutral avian male medulla to produce androgens after 7 days of incubation with the resultant formation of a testis can be reversed by the imposition of a dominant female medulla that causes the early male germinal epithelium to form a n ovary. In the normal developmental scheme, the production of sex hormone is initiated earlier in the dominant sex than in the neutral sex. This too corresponds with the idea that the development of the neutral sex is destined to occur unless the dominant state is imposed. The complete scheme of the hormonal theory is summarized in Fig. 3. Two potential sites of genetic control accrue from the hormonal theory. The first possibility is that the sexual genotype dictates the production of either the dominant or neutral sex hormone. The m-oduc-
244
JOHN R. McCARREY AND URSULA K. ABBOTT
I
+ Dominant
Gonadal Sex Differentiotion
I Sex Hormone Production
Heterogametic Gonad (Dominant Sex)
I
-I ’- 4
I
Indifferent Gonad
Sex Hormone
Dominant Sex Hormone
’
Homogametic Gonad (Neutral Sex)
Dominant Hormone
---------- - - -_ _ _-- -/
1
I
/---------
Hormone
Embryogenesis (Time )
FIG. 3. Hormonal scheme of sex differentiation. The hormonal scheme of gonadal sex differentiation is summarized schematically. The development of the dominant gonadal phenotype is correlated with the precocious surge in production of the dominant sex hormone in the gonad. Development of the neutral gonadal phenotype occurs in the absence of dominant sex hormone production and is contemporary with an increase in neutral sex hormone production.
tion of androgens and estrogens involves a partially common biosynthetic pathway, which could represent a n important point of genetic and biochemical control. However, the fact that each sex produces not only a large amount of its own hormone, but also a small amount of the hormone characteristic of the opposite sex, indicates that any control a t this point is of a quantitative rather than qualitative nature. The effects of insufficient hormone production are exemplified in genetic male pseudohermaphroditic rats which carry the sex-linked, sex-limited vet gene. Such rats possess interstitial cells of Leydig which display defective cell maturation, resulting in decreased testosterone synthesis (Bardin et al., 1973; Stanley et al., 1973). The resultant phenotype includes small, vestigial, cryptorchid testes and feminine secondary sex characteristics. Unfortunately, this mutant does not comment on the role of testosterone in testicular differentiation, since the defect is manifested subsequent to primary sex differentiation in the embryo and therefore affects only secondary sex characteristics. The second potential site of control implied by the hormonal theory lies in the ability of the cells of the germinal epithelium and the sex cords to respond to hormonal induction. That specific cytoplasmic receptor mechanisms for steroid hormone action exist within target cells is well established (Baxter and Tomkins, 1971; Rousseau et al., 1972; Higgins et al., 1973; O’Malley and Schrader, 1976). The theory that
SEX DETERMINATION I N ANIMALS
245
such a specific receptor mechanism for testosterone is involved in mediating the development of male secondary sex characteristics in mammals was proposed by Ohno (19711. OMalley and Schrader (1976) have summarized the evidence indicating that steroid hormones in conjunction with their specific receptor proteins act directly on the DNA of the target cell to initiate transcription. They concluded that the regulation in this case is of a positive nature. Evidence for the importance of specific hormone receptor molecules in the production of the sexual phenotype has been provided by inherited forms of testicular feminization, which have been observed in man (Morris, 1953), rats (Stanley and Gumbreck, 19641, cattle (Short, 19671, and mice (Lyon and Hawkes, 1970). Individuals afflicted with this syndrome are genetic males, with testes which produce normal amounts of testosterone, but develop female secondary sex characteristics. In addition, spermatogenesis is usually arrested at the primary spermatocyte stage, although the somatic elements of the gonad appear normal. This syndrome has been correlated with a deficiency for one class of testosterone-binding protein (receptor) in the cytoplasm (Gehring et al., 1971; Gehring and Tomkins, 1974; Ohno et al., 1973; Attardi and Ohno, 1974). Ohno et al. (1971) assume that this deficiency results in the loss of the binding affinity of testosterone to the cytoplasmic receptor complex, thereby eliminating the inductive capacity of the hormone. Drews and Alonso-Lozano (1974) performed a n ingenious experiment based on the idea that female mice heterozygous for the X-linked testicular feminization trait (tfm) must also be mosaics for androgen sensitivity as a result of random X-chromosome inactivation. Normally this mosaicism would not be phenotypically expressed because there are no androgen-dependent traits in the female. However, by performing crosses to produce individuals heterozygous for the sexreversal gene (Sxr)and tfm, Drews and Alonso-Lozano were able to create phenotypically male X T X + mice that possessed androgendependent secondary sex organs and were mosaic for androgen sensitivity as a result of random X-chromosome inactivation. Light and electron microscopy studies of the epididymis revealed the existence of two distinct cell types forming the tubules. One cell type was larger, more columnar, and contained larger nuclei and mitochondria as well as more elaborate Golgi complexes and endoplasmic reticulum than the other cell type. In addition, the former cells contained more stereocilia, multivesicular bodies, and individual coated vesicles than the latter cells. Drews and Alonso-Lozano concluded that these cells represent a differentiated state, whereas the second cell type, which
246
JOHN R. McCARREY AND URSULA K . ABBOTT
appeared cuboidal and lacked the cytoplasmic structures seen in the former group, represents an undifferentiated state. Thus, sex hormones are capable of inducing specific patterns of cytodifferentiation in target cells, and this induction is dependent on a functioning cytoplasmic receptor mechanism. The apparently normal differentiation of the somatic elements of the gonads in tfm individuals indicates that the cytoplasmic receptor mechanism involved in mediating hormonal induction of the secondary sex characteristics is not involved in the induction of primary sex differentiation. This in turn represents a strong argument against the hormonal theory as a whole, if it is assumed that the same cytoplasmic receptor mechanism should logically be involved in mediation of all differentiation induced by the same hormone. However, the hormonal theory can still be maintained if one of several alternative explanations for the normal gonadal differentiation observed in tfm individuals is accepted. One such alternative is that a unique metabolite of testosterone induces gonadal differentiation but is not involved in the induction of other sex characteristics. Such a unique metabolite of testosterone could conceivably operate via a unique cytoplasmic receptor mechanism which is not affected by the tfm mutation. Another possibility is that a different class of receptor molecules is involved in mediating hormonal induction in the early embryo when primary sex differentiation occurs, and that it is only later in embryogenesis that the class of receptor molecules affected by the tfm mutation normally becomes functional. If the same receptor mechanism that is defective in tfm individuals is involved in gonadal differentiation, then the only explanation is that the tfm mutation demonstrates variable expressivity in different tissues, or at different stages of embryogenesis. Ohno et al. (1973) have shown that the expression of tfm can be modified by a change in a nearby regulatory gene such that a partial expression of the male phenotype develops in androgen-sensitive organs. However, this does not provide evidence for a difference in degree of response among the various target organs. In chickens the incompletely dominant, autosomal gene “hen feathering” CHf, also produces aberrant response to sex hormones (Morgan, 1920; Hutt, 1949). This sex-limited trait results in the development of female plumage in male birds. If an Hfmale is castrated the plumage reverts to the type typically found in a castrated male. The observations are consistent with a model in which the receptor mechanism for the neutral avian sex hormone (androgen) has become altered so that, in conjunction with androgen, it induces a response characteristic of the dominant avian sex hormone (estrogen).
SEX DETERMINATION I N ANIMALS
247
TheHf mutation affects only feather development and none of the other sex hormone-dependent organs. Thus, this mutant may provide evidence for a tissue-specific expression of a genetically altered hormone receptor mechanism. A fourth alternative explanation of normal gonadogenesis in tfm individuals is that receptor molecules may not be involved a t all. This contention would imply a n unusual mechanism of steroid hormone action; however, such a mechanism could result from the unusual system of gonad development in which the same cell type would both produce and respond to hormonal induction. Such a n endogenous induction system might not only eliminate the need for the normal steroid-receptor mechanism, but might also explain how a n apparently small amount of hormone production in the indifferent gonad is sufficient to induce gonadal differentiation, and why exogenous applications of the opposite sex hormone cannot completely reverse primary sex differentiation.
3. The Differential Growth Theory The theory of differential growth was introduced in Section I1 of this review, and assumes that gonadal differentiation in the dominant sex is the result of an increased growth rate during a specific period of embryogenesis (Mittwoch, 1973a) (see Fig. 4).Mittwoch proposes that
Gonodol Sex Differentiation
Mitotic Rate i n Gonodal Cells
1
Heterogametic Gonad (Dominant Sex) +Higher Mitotic Indifferent Gonod
Homogametic Gonad
;“;““i Mitotic
Threshold
/-----
--- - - - - -,
He terogomettc Gonod
T----------------
-
Homogametic Gonod
Embryogenesis ( T i m e )
FIG. 4. Differential growth theory of sex differentiation. The differential growth theory of gonadal sex differentiation is summarized schematically. The development of the dominant gonadal phenotype is correlated with the precocious surge in mitotic rate above the threshold level in the gonadal cells. Development of the neutral gonadal phenotype occurs upon the failure of mitotic rate in the gonadal cells to surpass the threshold level.
248
JOHN R. McCARREY AND URSULA K . ABBOTT
sex chromosome volume, which is greater in XX or ZZ individuals than it is in XY or Zw individuals, affects mitotic rate. She quotes several examples of correlations between mitotic rates and chromosomal volumes, including work with plant cells of the species Vicia faba by Bennett (1972) and her own work with polyploid human cells in uitro (Mittwoch and Delhanty, 1972). However, the fact that in mammals it is the presence or absence of the Y chromosome that determines sex has led Mittwoch to postulate that in addition to any effect of the X chromosome constitution, the Y chromosome (or w chromosome in birds) may contain sites that are active in RNA synthesis at specific stages of development and stimulate mitosis in the cells of the indifferent gonad (Mittwoch, 1971a,b). In order to test her theory in chick embryos, Mittwoch has measured gonadal volumes a t various stages of development by estimating the size of every sixth section of serially cross-sectioned male and female gonads. She found that the left gonad in females (Zw) undergoes a spurt of growth between days 5-7 of incubation not seen in male (ZZ) gonads, and therefore postulates that this rapid growth is causally related to gonadal sex differentiation in the dominant female sex. Unfortunately, no attempt to determine actual mitotic rate was made in these investigations. In rats Mittwoch et al. (1969) employed the grid technique to estimate gonadal volumes and concluded that fetal testes undergo more rapid growth than ovaries up to 15 days of gestation. In addition, gonads of Sxr (XX-male) rats which differentiate as testes were shown to be significantly larger than ovaries of normal female embryos a t 15 days, although they were smaller than similarly aged XY-male testes (Mittwoch and Buehr, 1973). This observation led to the conclusion that the Sxr gene mimics the normal male genotype by imposing a n increased growth rate on the indifferent gonad resulting in the formation of a testis. Thus, Mittwoch has inferred from her indirect approach that greater gonadal size as measured by the number of squares in a grid covered by each section counted is indicative of greater mitotic rate in the gonadal cells. Recently, however, Gasc (1978) has analyzed growth in chick and duck embryonic gonads by determination of total protein and DNA content, and DNA synthesis using I3H]Tdr incorporation in uitro. The results of this work do not support Mittwoch’s hypothesis since the rate of DNA synthesis in the left ovary was found to be lower than that in the testes a t 6 days of incubation. 4 . The H-Y Antigen Theory
Ohno et al. (1979) have stated that there are presumably four components involved in mammalian gonadal organogenesis: (1) a n
249
SEX DETERMINATION I N ANIMALS
ovary-organizing antigen and (2) its receptor, and (3) a testisorganizing (H-Y) antigen and (4) its receptor. Of these four, the first two and the fourth are expressed in both sexes and the third (H-Y antigen) is expressed only on male cells. Ohno further claims that the ubiquitous expression of H-Y antigen in males is indicative of its master developmental role, which is not under genetic subjugation. The currently proposed developmental scheme of H-Y antigen action holds that this antigen must out-compete all other irrelevant organogenesis-directing antigens on future gonadal cells. This is feasible because gonadal cells have a preponderance of H-Y antigen receptor sites. Ohno et al. (1979) reported that fetal and newborn testicular cells of the mouse possess 5- 10 times more H-Y antigen receptor sites than do spleen cells. Thus H-Y antigen is not an integral component of the plasma membrane, but rather it utilizes the µglobulin major histocompatibility complex antigen dimers (H-2 in the mouse and HLA in man) as its plasma membrane anchorage sites (Ohno et al., 1979). It is for anchorage at these sites that H-Y antigen must outcompete the ovary-organizing antigen. Ohno et al. (1979) and Zenzes et al. (1978) have initiated investigations of a potential developmental mechanism for the proposed testisorganizing H-Y antigen in mammals (the genetics of which are discussed in Section 11).This theory holds that the presence of H-Y antigen on the surface of the somatic cells of the indifferent gonad causes them to organize a testis (Fig. 5). Thus, Ohno and Zenzes and their collaborators Heterogametic Gonad (Dominont Sex) Gonadal Sex Differentiation
/+-?'.Antigen Level
Antigen Indifferent Gonod
Heterogametic Gonad
Homogametic Gonod (Neutral Sex)
/
L H - Y Medioted Testiculor
-
Homogometic Gonod
______-________ 1_____
Embryoqenesis f T i m e )
FIG. 5 . H-Y antigen theory of sex differentiation. The H-Y antigen theory of gonadal sex differentiation is summarized schematically. The organization of the dominant gonadal phenotype is correlated with the presence of H-Y antigen on the surfaces of the indifferent gonad cells. Development of the neutral gonadal phenotype occurs when no H-Y antigen is present.
250
JOHN R. McCARREY A N D URSULA K. ABBOTT
reasoned that the absence of this antigen would result in the organization of an ovary even by othe-mise normal XY male cells. In terms of the dominanhnull state concept, the removal of H-Y antigen would nullify the dominant male state and allow ovarian development. That this is the case can be inferred from the existence of 2A:XY females that are H-Y-negative. However, in order to provide direct experimen tal evidence in mice (Ohno et al., 1978) and rats (Zenzes et al., 19781, “Moscona-type” dissociation-reaggregation experiments (Moscona, 1957) have been performed on gonadal cells that have been lysostripped of their H-Y antigen. Lysostripping is a technique involving exposure of the gonadal cells to H-Y antibody resulting in the removal of H-Y antigen from the cell surfaces. Ohno et al. (1978) and Zenzes et al. (1978) reported that when gonadal cells from newborn mice or rats are dissociated and reaggregated without lysostripping, cylindrical tubular structures morphologically similar to seminiferous tubules are formed. However, when the H-Y antigen has been removed by lysostripping, spherical aggregates that resemble ovarian follicles are formed. As the concentration of H-Y antibody used to lysostrip the cells is diluted, the percentage of “folliculoids” formed by the male cells is reduced, while the percentage of cylindrical tubules increases (Ohno et al., 1978). As a control, Ohno et al. (1978) performed similar experiments with male epidermal cells and found no effect of H-Y antibody on cell reaggregation patterns. Zenzes et al. (1978) also tested the effect of H-1 antibody on the reaggregation pattern of male gonadal cells and observed no effect. As a result of these dissociation-reaggregation experiments, both Ohno et al. and Zenzes et al. concluded that there is a direct causal relationship between the presence of H-Y antigen on the surface of gonadal cells, and the development of a testis. Further support for this conclusion comes from preliminary experiments reported by Zenzes et al. (1978) indicating that the addition of exogenous H-Y antigen can induce disaggregated ovarian cells to form cylindrical tubules upon reaggregation. Ohno et al. (1979) have also reported that a free suspension of bovine fetal ovarian cells exposed to H-Y antigen reaggregated to form “seminiferous tubule-like structures.” Ohno et al. (1978) suggested that the testicular organization initiated by H-Y antigen induces production of other sets of cell-surface proteins, some of which are shared in common by all the testicular somatic cells, and some of which may be limited to specific component cell types (e.g., Sertoli cells, Leydig cells). Work by Muller et al. (1978a,b) suggests an androgen-dependence of H-Y antigen dissemination among Sertoli cells. This work shows that postpubertal
SEX DETERMINATION I N ANIMALS
251
epididymal fluid is richer in H-Y antigen than prepubertal fluid, and that the presence of 5a-dihydrotestosterone in pure cultures of Sertoli cells from XX Sxr male mice results in excretion of H-Y antigen. The conclusions that the tubular structures formed on these reassociation experiments represent seminiferous tubules and the spherical aggregates ovarian follicles will require further experimental support before they can be fully accepted. Specifically, it remains to be established whether different patterns of protein synthesis, representing different differentiated states, have been induced. Also, characteristic differences between seminiferous tubule cells and follicle cells at the ultrastructural level should be analyzed. However, the significance of these experiments by Ohno et al. and Zenzes et al. for understanding the role of H-Y antigen in normal testicular development is accentuated by an early statement of Jost (1958): “The organogenetic processes involved in the formation of the early seminiferous tubules still have to be studied in detail. It seems that cellular segregation and reassociation are the main events. An evident result is that the primordial germ cells have become surrounded by the Sertoli cells and enclosed in the testicular tubules.” The question remains as to exactly how the H-Y antigen and any other differentiation-inducing antigens directly affect specific gene expression. To this end further analysis of the apparent sex reversal induced by lysostripping H-Y antigen from male cells or adding H-Y antigen to female cells must be performed. Specifically, the induction of sex-specific histological characteristics and protein synthesis should be examined. Ohno et al. (1978) have hypothesized that H-Y antigen functions as a short-range hormone; however, no induction of specific gene expression similar to that produced by hormones has been demonstrated. Certain key questions must be addressed by any developmental theory in order to assess which best explains primary sex differentiation. It has been established above that the most important somatic cell type involved in gonadal sex differentiation is that found in the germinal epithelium and its derivative, the primitive sex cords. The important question then becomes: What controls the differentiation of this cell type? This question can be divided into two other questions: (1) What induces differentiation of this cell type? (2) How is this action mediated and/or received in these cells? The hormonal theory predicts that germinal epithelium-derived cells produce hormones that induce sex differentiation possibly mediated by specific cellular receptor mechanisms. Mittwochs theory assumes that it is the differential sex chromosome volumes along with specific Y-linked RNA synthesis that
252
JOHN R. McCARREY A N D URSULA K . ABBOTT
induce sexual gonadogenesis, and that this effect is mediated by a differential mitotic rate. The H-Y antigen theory holds that the presence of H-Y antigen on all somatic cells of the indifferent gonad induces the organization of seminifeivus cords and the expression of other organizing antigens necessary for the differentiation of specific testicular cell types. A second important question is how intersexual gonadal phenotypes can be explained. Mittwochs theory is forced to assume that an increased mitotic rate occurs in only some of the cells of the indifferent gonad. This is difficult to explain in intersex individuals who are not genetic mosaics and therefore have identical sex chromosome constitutions including identical Y or w chromosomes in all their gonadal cells. The hormonal theory, on the other hand, must assume either that the balance in production of dominant versus neutral hormone is unequal throughout the gonad, or that the receptor mechanisms are not functioning equally in all gonadal cells. The H-Y antigen theory would dictate that there is a differential production of, and/or response to, H-Y antigen by cells in various parts of the gonads. Again, neither of these explanations seems to be satisfactory for intersex individuals possessing gonads made up of genetically homogeneous cells. Thus, the problem of explaining such intersexes stands as one of the most perplexing questions concerning primary sex differentiation. Mittwoch’s theory casts differential mitotic rate in a causative role in gonadogenesis. Thus, a key predication of this model would be that in the absence of a specific increase in mitotic rate in the indifferent gonad, the dominant gonadal phenotype would not develop. Salzgeber (1957) has conducted numerous experiments to test the effect of mitotic poisons and metabolic inhibitors on the development of chick embryo gonads cultured in uitro. The results show that the metabolic inhibitors tend to exert their greatest inhibitory effect on the gonadal medulla in either sex, whereas the mitotic poisons caused deficiencies in cortical development, the effects being most pronounced in female gonads. Although it was not Salzgeber’s intention to test this idea, this evidence would seem to support Mittwoch’s theory since in the chick the female sex is dominant and inhibition of mitotic rate tends to differentially inhibit female gonadogenesis. However, caution must be exercised in interpreting these results in this way because Salzgeber’s experiments were performed on gonads taken from 9- 10-day embryos that had already initiated normal gonadal sex differentiation at about 7.5-8 days or earlier. Similar experiments performed on earlier, undifferentiated gonads would provide more direct evidence in this regard. Similarly, in order to test the notion that gonadal hormones have a
SEX DETERMINATION IN ANIMALS
253
causal role in gonadal differentiation, the most direct experiment would be to block either the production o r subsequent action of the dominant gonadal hormone. Neumann et al. (1970) reported work with a strong antiandrogen that produced extensive inhibition of the androgendependent male secondary sex characteristics in rats. However, the treatment was applied after primary sex differentiation, so that any possible effect on gonadal sex differentiation could not be assessed. Thus, a clear-cut test of the hormonal theory will require administration of antihormonal compounds prior to the time of primary sex differentiation in the embryo. The experiments of Ohno et al. (1978) and Zenzes et al. (1978) involving removal, or addition, of H-Y antigen from gonadal cells provides more evidence for a direct cause and effect relationship than that available for any other theory of primary sex differentiation. Thus, on this ground the H-Y antigen theory seems to be the most satisfactory explanation of gonadal sex differentiation at this time. In all likelihood the production of specific sex hormones, differential mitotic rate, and the presence of H-Y antigen are all involved in gonadal sex differentiation to some extent. What remains is to establish the causal pecking order of these factors in order to understand the relative contribution each makes to primary sex differentiation.
CELL-GERMCELLINTERACTIONS D. SOMATIC The various theories of gonadal sex differentiation discussed above have been presented as mechanisms acting only in the somatic elements of the gonad, with the assumption that the germ cells are not involved. However, the question of germ cell involvement in gonadal differentiation has been debated throughout this century and remains a controversial subject. The idea that the germ cells produce a chemical inductor necessary for normal gonadal development in birds was proposed by Dantchakoff (1932, 1933). She reported a failure of gonadal development following destruction of the primordial germ cells prior to theit migration to the genital ridges. However, several other workers, including the authors, have demonstrated normal development of the gonads in the absence of germ cells. Reagan (1916), Goldsmith (1935), Dubois (19621, Simon (1960b1, and Mims and McKinnel (1971) all observed development of a normal indifferent gonad in chick embryos by 5 days of incubation after destruction of the primordial germ cells at 1-2 days of incubation. We have carried these results further by demonstrating normal sexual differentiation of the somatic elements of the gonads in the absence of
254
JOHN R . McCARREY AND URSULA K . ABBOTT
germ cells (McCarrey and Abbott, 1978). In this latter case, normal morphological and histological differentiation of both male and female gonads was observed at the organ, tissue, and cellular levels. In a 15-day sterile testis, a normal tunica albuginea surrounded a medulla containing sterile seminiferous cords and interstitium. Within the seminiferous cords the normal spermatogonia were lacking, however, the somatic Sertoli cells differentiated normally. Similarly in the female, normal differentiation of the somatic elements of the ovary was observed in a 20-day embryo, including a loosely organized medulla with distended cords, cortical cords extending into the cortex, and a covering epithelium. This was the case despite the lack of the clusters of germ cells located between the somatic cortical cords in the normal ovary. In mammals, Herschler and Fechheimer (1967) have attributed the masculinization observed in the freemartin gonad to the presence of male (XY) germ cells that have migrated from the male co-twin. Similarly, several authors have suggested that germ cells of one sexual genotype can induce sex reversal in surrounding somatic cells in experimental chimeras (Ford et al., 1974; McLaren, 1976; Milet et al., 1972; Mintz, 1969, 1974). It has also been suggested by proponents of the H-Y antigen theory that the key step in primary sex differentiation involves an interaction between germ cells and somatic cells mediated by H-Y antigen in the indifferent gonad (Ohno, 1976; Silvers and Wachtel, 1977). There is no evidence to support this latter contention; however, the idea that germ cells affect gonadal sex differentiation in freemartins and/or chimeras may indeed be valid. Nevertheless, what must be remembered is that neither the freemartin nor the experimental chimera represent normal development. Thus, while evidence from these systems may establish that germ cells can affect gonadal sex differentiation in certain abnormal cases, there is no evidence that germ cells are required for normal gonadal development. In fact, in the latter regard, the evidence in mammals, as well as that discussed above in birds, is to the contrary. Merchant (1975) used the drug busulfan, which selectively destroys primordial germ cells during their migratory phase to produce sterile gonads in rat embryos. He analyzed the subsequent differentiation of these gonads with light and electron microscopy and concluded that the somatic elements of the gonads developed normally despite the absence of germ cells. Tence et al. (1975) demonstrated normal endocrine function in sterile, busulfan-treated rat testes which converted labeled testosterone to androstenedione and dihydrotestosterone normally. Other supporting evidence in mammals comes from mice carry-
SEX DETERMINATION I N ANIMALS
255
ing mutations at the W locus (Coulombre and Russell, 1954; Mintz and Russell, 1957). Various combinations of three alleles at this locus produce varying degrees of sterility including complete sterility. In all cases, however, the somatic elements of the embryonic gonad differentiate normally. The cumulative evidence from work with chicken embryos and rat and mouse embryos, and similar results demonstrating normal development of sterile gonads in amphibians (Bounoure, 1950; Padoa, 1964), indicate that, as a general rule in vertebrates, germ cells are not required for, and play no inductive role in, sexual differentiation of the somatic elements of embryonic gonads. IV. Germ-Cell Development
The ultimate products of embryonic sexual development and subsequent adult sexual maturation are the gametes. These haploid cells, sperm in the male and eggs in the female, derive from diploid germ cells that undergo meiosis in the gonads of the adult. The germ-cell line is set aside very early in embryogenesis, prior to the establishment of the primary germ layers, and remains as a distinct cell line throughout the life of the organism. The germ cells are first detected in the extraembryonic membranes, outside the embryo proper. From this location they migrate to the developing genital ridge, where they eventually differentiate into the gametes.
A. PRIMORDIAL GERM-CELL DETERMINATION I . Polar Plasm in Drosophila The mechanism of primordial germ cell (PGC) determination has been the subject of a great deal of research in Drosophila (Hegner, 1914 Mahowald, 1971a,c) and more recently in mammals (Eddy, 1974, 1975; Beams and Kessel, 1974). Working originally with Drosophila melanogaster and subsequently with other Drosophila species, Mahowald (1962, 1968, 1971b1, Mahowald and Teifert (19701, Illmensee and Mahowald (19741, and Ullman (1965) have provided evidence that “developmentally significant localizations of the egg cytoplasm” act as PGC determinants. Mahowalds ultrastructural studies indicate that these ooplasmic PGC determinants may be the densely staining granules located near the posterior pole of the oocyte. These “polar granules” become incorporated into specific “pole cells” when the
256
JOHN R. McCARREY A N D URSULA K . ABBOTT
cleavage nuclei, which initially form a syncytium in the central portion of the embryo, migrate to this peripheral area and individual cell walls form. It is the pole cells, containing the polar granules, which give rise to the PGC in Drosophila. Both Mahowald (1962, 1968, 1971a,c) and Counce (1963) have followed the fate of the polar granules throughout germ-cell development in Drosophila. They have characterized the complete sequence of morphological changes that occur in these organelles within the germ cell cytoplasm throughout the life cycle of the organism. Included in this cycle is a fragmentation of the polar granules followed by their association with ribosomes just prior to pole-cell formation. These observations led Mahowald (1968) to propose that the polar granules contain messenger RNA that is translated into proteins necessary for pole-cell formation and ultimately germ-cell development. In support of this contention Mahowald (1971b) provided cytochemical evidence indicating the presence of RNA in the polar granules prior to pole-cell formation, but not subsequently. Similar observations, indicating the presence of RNA in the polar granules of Miastor, were made by Nicklaus (1959). Illmensee and Mahowald (1974) and Illmensee et al. (1976) performed an elaborate series of experiments which left no question that some component of the polar plasm in Drosophila is the pole-cell determinant. They transplanted polar plasm from wild-type embryos of the early cleavage stage to the anterior tip of genetically marked embryos of the same stage. These cells developed ultrastructural characteristics commonly found in pole cells but not in anterior cells. In order to determine whether these cells could form germ cells, they then transplanted these induced pole cells into the posterior pole of a third series of embryos that carried their own unique genetic markers. When these host embryos were allowed to develop and reproduce, 4% of their progeny derived from the transplanted, induced pole cells. Thus some component of the polar plasm is capable of inducing pole-cell formation, and subsequently germ-cell differentiation, in presumptive somatic cells. This evidence along with the observation that destruction or removal of the polar plasm results in development of a sterile organism (Geigy, 1931; Poulson and Waterhouse, 1960; Hathaway and Selman, 1961; Warn, 1972) clearly establishes that the polar plasm is the in situ germ-cell determinant in Drosophila. However, whether the polar granules are the specific component of the polar plasm responsible for pole-cell determination has recently been questioned. R. Ueda and M. Okada (unpublished data) have succeeded in isolating a subcellular
SEX DETERMINATION I N ANIMALS
257
fraction of polar plasm capable of inducing pole cells in sterilized DrosophiZa embryos; however, these pole cells do not form PGC. Thus, they have concluded that pole-cell formation and germ-cell formation are controlled by different or multiple factors in the polar plasm. The fraction used to induce pole cells was composed almost exclusively of 15-nm particles, which Ueda and Okada feel may or may __ - -not - have derived from polar granules (H. A. Schneidermaypersonal communication). Thus, whether or not the specific factor responsible for PGC induction is a n integral component of, or merely resides in associgtion with, the polar granules remains to be established. Waring et al. (1978) have shown that a specific protein (MW 95,000) is unique to cell populations containing pole cells. They further found that this protein is highly enriched for, and in fact is the only major protein species present in, a subcellular fraction containing primarily polar granules. However, it remains to be shown that either this protein or purified polar granules are capable of inducing both pole-cell and PGC formation. 2. Germinal Plasm in Vertebrates Regardless of the specific composition of polar plasm, the correlation between a specific segment of the ooplasm and germ-cell determination is well established and unquestioned in Drosophila. Several attempts to extend these findings to other systems have met with varying success (for review, see Eddy, 1975).* Eddy (1974) examined early mammalian (rat) germ cells using light and electron microscopy. He observed “nuage” in these cells that is composed of dense fibrous material and concluded that this material is similar in form and distribution to that seen in the polar granules ofBrosophiZa embryos. Moreover, some studies based on staining characteristics indicated that the nuage is composed of protein and RNA (Daoust and Clermont, 1955; Sud, 1961; Weakley, 1971); although other studies have failed to corroborate these findings (Eddy, 1970). In mice Jeon and Kennedy (1973) observed membrane-bound, electron-dense granules in PGC which they felt were similar to the cytoplasmic inclusions observed in rat PGC. Thus, although the evidence is a s yet incomplete, there is a strong possibility that the mechanism of germ-cell determination is similar in *The best evidence for cytoplasmic determination of germ cells in vertebrates has been produced in amphibians. Experiments by Blackler (1958, 1962), Smith (1966), Smith and Williams (1975),and Wakahara (1978) have clearly established the existence of a “germinal plasm” in the posterior pole of frog eggs, which functions as a germ-cell determinant. In addition, Smith and Williams (1975) have found poIar granule-like structures, called “germinal granules,” in this cytoplasm.
258
JOHN R . McCARREY AND URSULA K. ABBOTT
most, if not all, higher organisms. Of course, even if these cytoplasmic inclusions do prove to be germ-cell determinants, the mechanism by which they induce this result remains unclear. However, it would seem that an initial action of germ-cell determinants may be not to initiate differentiation, but rather to inhibit it. By definition the germ cells must remain totipotent throughout their life history if their DNA is to successfully direct the development of the progeny of the organism. Thus, while the cells of the embryo proper are being organized into the primary germ layers and then into even more specifically differentiated tissues and organs, the PGC are retained in the extraembryonic membranes in a relatively primitive developmental state. It is only after most of the embryonic cells have initiated differentiation that the PGC enter the embryo and migrate to the gonad, where they begin the process of gametogenesis.
B. PRIMORDIAL GERM-CELL DEVELOPMENT 1. Origin and Migration of Primordial Germ Cells The site where the PGC are initially detected, as well as the pathway they follow in their migration to the gonad, varies with each species or genera. In Drosophila the pole cells that become the PGC first form at the vegetal pole of the early embryo and then enter the embryo during gastrulation. Sonnenblick (1965) reviewed this process and pointed out that there are two methods by which the PGC enter the embryonic body. One is by passing between the posterior blastodermic nuclei, and the second is via the posterior midgut invagination. In Drosophila it is the latter pathway that leads to the developing gonad, whereas the former migratory path deposits pole cells in the yolk, where they degenerate. In mammals the PGC are first detected in the endodermal epithelium of the yolk sac at the base of the allantois. Witschi (1948) observed PGC in this position in the early human embryo at approximately 4 weeks of development. Mintz (1960) reported initial detection of PGC in this same location in an 8-day mouse embryo. From this site, the PGC migrate to the connective tissue of the hind gut, then into the gut mesentery, then into the region of the developing kidneys, and finally into the adjacent gonadal rudiments. Unlike the migration of PGC in Drosophila, or that in birds, to be described below, mammalian PGC migrate actively using ameboid movements throughout the distance from the extraembryonic area to the developing gonads. This ameboid movement of mammalian PGC was most vividly demon-
SEX DETERMINATION I N ANIMALS
259
strated by Blandau et al. (1963) with time-lapse photography. Baker (1972) postulated that the PGC may also secrete digestive enzymes to aid in clearing a path for their migration. During their migration, the PGC begin mitosis with a dramatic increase in germ-cell number by the time they reach the gonadal ridge. Dubois and collaborators have examined the origin and migration of PGC in birds (Dubois and Croisille, 1970). They have proposed that the commonly accepted site of origin of the PGC in birds, the anterior germinal crescent (Swift, 19141, is actually a second location. Swift’s experiments in 1914 demonstrated that the PGC are located in the extraembryonic endoderm of the anterior germinal crescent in the head process-stage chick embryo (approximately 1 day of incubation). However, Dubois reasoned that because this proposed anterior location is unlike the posterior embryonic site of PGC origin reported for several other groups, and is observed a t a relatively late stage in development, i t is plausible that avian PGC may actually originate in the posterior portion of the egg and subsequently move to the anterior position. Vakaet (1962) proposed that caudocephalic movements of the endophyll during pregastrula and gastrula stages could result in the passive transport of the PGC from the posterior portion of the egg to a n anterior location. To test this hypothesis, Dubois (1967, 1968, 1969) and Dubois and Croisille (1970) transected unincubated chick and duck blastoderms. An analysis of the number of PGC in various transected bands showed their predominance along the mediolateral midline. Since the avian embryo has begun gastrulation by the time the egg is laid, Dubois feels that the extrapolation back from the anterior location of the PGC in the head process-stage embryo through their medial position in the unincubated blastoderm is indicative of a posterior site of origin of PGC in the newly fertilized zygote. Further evidence for this hypothesis was provided by Fargeix (19691, who grew whole embryos from the posterior halves of transected blastoderms. He found that posterior halves taken from unincubated blastoderms produced embryos with more PGC than did posterior halves of blastoderms incubated for a few hours prior to transection. Dubois’ theory is appealing in that it would bring birds into lime with most other vertebrates which have been studied with respect to the posterior site of PGC origin. This would, in turn, correlate well with the proposed general mechanism of germ-cell determination involving posteriorly localized ooplasmic factors. Although no such germinal plasm has been found in the avian oocyte, Dubois and Croisille have speculated that gravitational and frictional forces that develop as the egg progresses down the oviduct may result in a posterior localization
260
JOHN R . McCARREY A N D URSULA K . ABBOTT
of PGC or of PGC determinants. They pointed out that a similar gravitational force localizes the germinal plasm in the vegetal pole of amphibian eggs. Once the PGC reach the anterior germinal crescent in the chick, they take up residence in the endoderm along the border of the area opaca and area pellucida. They remain in this position until approximately the end of the second day of incubation, when they enter the developing extraembryonic circulation system and are passively transported to the genital ridge (Meyer, 1964).Work by Dubois showed that the PGC actively penetrate the vascular network. Lee et al. (1978b) have studied the activity of the PGC in the anterior germinal crescent with scanning electron microscopy. They showed that the PGC use the dorsal surface of the hypoblast as a substratum for ameboid movements. These investigators suggested that the surface topography of the hypoblast may influence the direction of this migration; however, they could not detect any apparent peculiarities on this surface. Because of the proximity of the developing vascular system, most of the PGC become blood borne. However, a few of these cells do go astray and invade a variety of embryonic tissues. In such abnormal sites they usually degenerate.
2. Chemotactic Guidance of Primordial Germ Cells The PGC are carried passively throughout the avian circulatory system, but become concentrated only in the area of the presumptive gonads. Dubois (1968) used in vitro culture techniques to demonstrate that the germinal epithelium exerts a chemotactic attractive force on the blood-borne PGC. He associated sterile germinal epithelium with various germ cell-containing tissues including fertile germinal crescent, fertile undifferentiated gonad, embryonic testis, and embryonic ovary. In all these associations except the last one, the germ cells were drawn from the source tissue into the sterile germinal epithelium. That the attractive force involved is of a soluble and diffusible nature was demonstrated by interposing a permeable barrier (such as vitelline membrane) between the sterile germinal epithelium and the germ cell-containing tissues in the experiments just described. When this is done, the germ cells accumulate in the portion of the tissue closest to the associated sterile germinal epithelium. I n vivo this diffusible chemotactic factor acts specifically on the blood-borne PGC in the proximity of the genital ridge, causing them to actively migrate out of the vascular system and into the germinal epithelium. Radioactive tracer experiments demonstrated a selective response of PGC to the attractive stimulus (Dubois and Croisille,
SEX DETERMINATION I N ANIMALS
261
1970). In addition, the PGC have been observed to actively ingest material from the germinal epithelium by pinocytosis and phagocytosis. Autoradiographic experiments indicate that the' attractive material is a protein that is actively secreted by the germinal epithelium (Cuminge and Dubois, 1971). These observations have received support from work by Didier et al. (1974), who quantified the number of germ cells in control chick embryos a t 4-5 days and in embryos in which one gonadal anlagen had been excised prior to the arrival of PGC. They found that in normal embryos the number of PGC which colonize the left gonad is approximately five times that found in the right gonad. However, Dubois and Cuminge (1978a,b) reported that 56% of the total number of PGC in the gonadal primordia are present in the left germinal epithelium at the end of the colonization period. These results are based on analysis of 529 embryos and were deemed highly significant by Dubois and Cuminge. This correlates well with Dubois' demonstration that the germinal epithelium is involved in attracting PGC, since in the avian embryo the germinal epithelium of the right gonad is much less developed than that of the left. In addition, Didier et al. found that the early excision of one presumptive gonadal area had no effect on the number of PGC that subsequently migrate to the other gonad. This indicates that the control of direction and extent of PGC migration would appear to lie within the germinal epithelium. The only evidence that questions this conclusion is the finding by Fargeix (1977) that two quail twin embryos derived from right and left halves of a single blastoderm contain a combined total number of germ cells equal to that present in a single normal embryo. In these cases the distribution of germ cells between right and left twins is similar to that between right and left gonads in control embryos. This argues for some autonomous control of migration within the germ cells. In hawks Stanley and Witschi (1940) reported that, in addition to a higher percentage of PGC migrating to the left gonad initially, there is a secondary migration of PGC from the right gonad, across the coelomic mesenteries, to the left gonad. NO such secondary migration has been reported in any other avian species. However, in the Japanese quail Didier and Fargeix (1976) observed that initially equal numbers of PGC colonized each gonad; however, at later stages they observed a larger PGC population in the left gonad than in the right. Although the chemotactic influence of the chick germinal epithelium shows a cellular specificity for PGC, it is capable of attracting PGC of various species. Reynaud (1969) succeeded in injecting PGC from turkey embryos into the bloodstream of chick embryos whose own PGC
262
JOHN R. McCARREY AND URSULA K. ABBOTT
had been destroyed by ultraviolet irradiation of the germinal crescent. These turkey PGC successfully colonized the chick gonad in many cases, and some of the host embryos survived to hatching but no further. This showed that the early chick gonad is capable of attracting turkey PGC just as it normally attracts its own PGC. Tachinante (1974a) demonstrated that early chick gonads are also capable of attracting and including quail PGC. In this case a heterospecific germcell population can be established and detected based on specific nuclear markers (LeDouarin, 1973) in a single embryonic gonad. This phenomenon is also observed in gonads of chick embryos which have received intracoelomic grafts of quail splanchnic mesoderm (Didier, 1977). A second series of experiments extended the interspecific bounds of the PGC attraction even further. Rogulska et al. (1971) grafted PCCcontaining hind guts of early mouse embryos into the coeloms of 2.5day chick embryos. In subsequent histological analyses of the chick embryos, it was found that the migration of the mouse PGC was always oriented toward the chick gonads. Tachinante (1974b) showed that the attractive force exerted by chick epithelium on mouse germ cells remains effective for advanced male germ cells, but that there is no effect on female mouse germ cells once they begin meiosis. This inability of the attractive force to affect advanced female cells was also seen in Dubois’ experiments involving chick germinal epithelium and chick germ cells. Thus the attractive force is equally efficient in heterospecific and homospecific situations. The above evidence would tend to suggest that chemotaxis is a general mechanism for guiding the PGC to the developing gonad in most vertebrates. Indeed, Baker (1972) has reviewed evidence for a -chemctaczc substance called Yelopheron_”being involved in guiding the migration of PGC to the germinal epithelium in human embryos. It should be remembered that one difference between mammals and birds is that avian PGC migrate through the bloodstream to the gonad whereas mammalian PGC move directly through the tissues of the yolk sac and gut into the gonad. Thus in birds the chemotactic substance must be secreted by the germinal epithelium into the blood, whereas in mammals this substance would be present throughout the tissues around the gonad. Dubois and Croisille (1970) postulated that the reason avian PGC become blood-borne rather than moving directly through tissues is merely an adaptive one. That is, because the PGC In the avian anterior germinal crescent are so far removed from the developing gonad, Dubois feels that ameboid migration through the tissues is not as efficient as blood-borne transit. Interestingly, a few of the PGC in mammals do enter the bloodstream rather than migrating
SEX DETERMINATION IN ANIMALS
263
directly to the gonad (Baker, 1972). Cell-surface factors have also been implicated in controlling PGC migration in the chick embryo. Lee et al. (1978a) showed that concanavalin A induced alterations of cell-surface properties resulting in a n inhibition of PGC migration from the anterior germinal crescent to other parts of the embryo. C. GAMETOGENESIS 1 . Descriptive Embryology
Once the PGC have arrived in the gonad, gametogenesis begins. Initially germ cell numbers increase by mitosis. Mitotic activity is first seen in the PGC during their migratory phase and continues after they have colonized the gonad. The subsequent differentiation of the germ cells depends on the sex of the individual. Dubois (1968) and Dubois and Croisille (1970) have described the ultrastructure of developing spermatogonia and oogonia in birds. A clear nucleus surrounded by a sinuous membrane and elongated, clear mitochondria with very few cristae are characteristic of spermatogonia. These cells are also marked by pinocytotic activity and a vesicular cytoplasm that persists a t least until day 14 of incubation in the chick. In oogonia the mitochondria are more dense and contain numerous cristae. These organelles are localized at the posterior pole of the cell and eventually become included in Balbiani's vitellin body, a key cytoplasmic characteristic of early female germ cells. Cytoplasmic lipid droplets seen in the PGC of both sexes disappear from the oogonia by day 8 of incubation, Ultrastructural differences have also been observed between the PGC of each sex in mammals (Franchi and Mandl, 1964; Guraya, 1977). Shortly after the time of sexual gonadogenesis in the rat (about 14 days post coitum) it can be seen that the development of the ER in oogonia is more advanced than that in spermatogonia. Also there are more desmosomelike contacts in female germ cells, whereas male germ cells demonstrate a more angular outline. From 15.5 to 18.5 days the mitochondria in spermatogonia tend to aggregate a t one pole, while those in oogonia remain evently distributed throughout the cell. Although no direct relationship has been established, this polarization of mitochondria coincides with a cessation of mitotic activity in the male germ cells. After 18.5 days these mitochondria again become randomly distributed, and groups of specific organelles called A and B bodies appear in the cytoplasm of the spermatogonia. The function of the granular A bodies is unknown. While the function of the membranebound B bodies is also not clear, there does seem to be a preponderance
264
JOHN R. McCARREY AND URSULA K . ABBOTT
of these organelles in those spermatogonia that fail to complete spermatogenesis. At the same time, in the female there is a general increase in the incidence and complexity of cytoplasmic inclusions. As in the male, the characteristic appearance of certain organelles, such as the swelling of ER vesicles and vacuolation of mitochondria, has been correlated with, but not directly related to, germ-cell degeneration. In both birds and mammals female germ cells enter meiotic prophase during the embryonic period, whereas those of the male remain suspended in mitotic interphase until sexual maturity in the adult. In the mammalian female there is a marked degeneration of germ cells beginning in the late embryonic stages and continuing during postnatal development (Beaumont and Mandl, 1962). In the rat the population of oocytes reaches a peak of about 75,000 on day 18 of gestation; however, only about 3Wo of these remain 2 days after birth. 2. Regulation of Germ-Cell Differentiation Erickson (1974a,b) has localized the control of germ-cell differentiation in the chick embryo. Taking the cytological characteristics described above as indicators of female germ-cell differentiation, he analyzed the extent of germ-cell development in three successively smaller histological units cultured in uitro. These were: (1)pieces of intact ovary, (2) pieces of isolated ovarian cortex containing germ cells, and (3) groups of pure female germ cells. Erickson observed normal differentiation of the germ cells in the first two cases. However, the isolated germ cells in the third group did not undergo further differentiation. These results are taken as strong evidence that residence in close association with an ovarian cortex is a prerequisite for female germ-cell differentiation in birds. Further support for this idea came from a second series of experiments in which Erickson cultured pieces of 6-day and 8-day testis which differentiated into true ovotestes with an ovarian-type cortex. In this case the genetically male germ cells in the cortex differentiated as oocytes whereas those in the testicular medulla differentiated as spermatogonia. These grafts were cultured for a period equivalent to 17 days in O V O . In experiments with male rats (Steinberger et al., 1964; Steinberger and Steinberger, 1966) and hamsters (Ellingson and Yao, 1970), it was shown that germ-cell differentiation progresses normally in pjeces of testes cultured in uitro. However, when isolated germ cells from male rats are cultured alone they survive up to 4 weeks but do not differentiate. These results are consistent with those described for birds above and suggest that the factors that regulate the sexual differentia-
SEX DETERMINATION IN ANIMALS
265
tion of the germ cells reside in the somatic cells of the gonad in both birds and mammals (Erickson, 1974a,b). The hypothesis of somatic control of germ-cell differentiation can be most easily tested by establishing a situation in which germ cells of one genetic sex are localized in gonadal somatic tissue of the opposite phenotypic sex. Such a situation can be achieved in a t least three ways: (1) in natural or experimental chimeras, (2) in sex-reversed individuals, and (3) in gonads into which germ cells of the opposite sex have been experimentally introduced. In mammalian chimeras the gametes are consistently derived from germ cells in which the genetic sex corresponds to the phenotypic sex of the surrounding gonad (Mintz, 1968, 1974; Tarkowski, 1970; McLaren, 1972, 1976). This finding implies that it is the somatic elements of the gonad that initiate sexual differentiation of the germ cells, and that germ cells of one genetic sex cannot be completely reversed to form functional gametes of the opposite sex. Mintz (1974) reported that degeneration of the nonfunctional germ line in XWXY chimeras occurs at the end of meiotic prophase. McLaren (1976) hypothesized that degeneration of one germ line is the result of a n adverse hormonal environment produced by the somatic cells of the surrounding gonad of the opposite phenotypic sex. TWO possible exceptions to this general rule have been reported by Ford et al. (1975) and Evans et al. (1977). In one case, they found a 2A:XXY male rat in the progeny of a n XWXY chimeric female. The albino coat color of this offspring was linked to the XY cell line in the chimeric female and thus indicated that the oocyte that produced this XXY male derived from a n XY cell. In the second case, Evans et al. reported the direct observation of a n XY oocyte a t diakinesis in a preparation from a fertile, chimeric XWXY female mouse. Several cases of apparent natural sex reversal to varying extents have been observed in birds (Crew, 1923; Fell, 1923). In every instance the reversal has been from the female (heterogametic and dominant) sex to the male (homogametic and neutral) sex. Unfortunately, these early instances could not be karyotyped. Recently analysis of individuals that have undergone spontaneous sex reversal as well as those displaying intersexual phenotypes has shown that all are either 3A:ZZw triploids or mosaics including triploid cells (Ohno et al., 1963; Abdel-Hameed and Schoffner, 1971; Jaap and Fechheimer, 1974; Abbott and Yee, 1975). There are two techniques by which sex reversal can be experimentally induced in birds. The first involves castration of the left ovary a t 1-3 weeks after hatching (Goodale, 1916; Benoit, 1923, 1924;
266
JOHN R. McCARREY A N D URSULA K. ABBOTT
Zawadowsky, 1926; Miller, 1938; Masui, 1967). Under these circumstances the right gonadal rudiment differentiates as a testis. A second approach, the exogenous application of sex hormone, has produced varying degrees of sex reversal in both the male to female direction and its converse (Dantchakoff, 1935,1941; Wolff and Ginglinger, 1935; Willier et al., 1935; Wolff and Haffen, 1961; Narbaitz and Teitelman, 1965; Choudhury and Morgan, 1971). With either technique (ovariectomy or hormone administration), initial differentiation of the germ cells is in accordance with the phenotype of the surrounding gonad; however, in the majority of cases functional gametogenesis has not been accomplished. By combining sinistral ovariectomy with serial injections of testosterone propionate, Choudhury and Morgan (1971) have experimentally produced a phenotypically male bird with functional spermatozoa. This bird sired 21 fertile eggs, 18 of which hatched to form normal, healthy chicks. Unfortunately, these authors did not report the sex ratio among these progeny. This ratio would be the most convincing diagnostic feature of functional sex reversal of the germ cells, since a Zw male x Zw female cross would produce a 1:4 ZZ 1:2 Zw 1:4 ww progeny ratio, of which the ww individuals would be inviable and a 2:l female (Zw) to male (ZZ) sex ratio should result. In all other cases reported, gametogenesis has not progressed beyond the spermatid stage (Masui, 1967) except in one instance, in which spermatozoa were produced but were not successful in fertilizing eggs (Miller, 1938). In mammals natural sex reversal has been observed in humans (Therkelsen, 1964; de la Chapelle et al., 1964; Court Brown et al., 1964; deGrouchy et al., 19671, goats (Soller and Angel, 1964; Hamerton et al., 1969, 1971; Soller et al., 19691, pigs (Cantwell et al., 1958; Johnston et al., 1958; Makino et al., 1962; Gerneke, 1964, 1967; Hard and Eisen, 1965; Hard, 1967; Somlev et al., 1970), and mice (Cattanach et al., 1971). In all these cases the direction of reversal is from the female (homogametic and neutral) sex to the male (heterogametic and dominant) sex. This is the opposite of the situation in birds, in which natural sex reversal always occurs in the dominant sex to neutral sex direction. The production of an ovary from a genetically male indifferent gonad has been accomplished experimentally by hormone injection * in the opossum (Burns, 1961). As in the cases of sex reversal in birds, sex-reversed mammals have demonstrated gametogenesis to varying extents. The most frequent observation is the initiation of gametogenesis in conjunction with the sexual phenotype of the gonad, followed by the eventual degeneration of the germ cells. In no case have XX germ cells differentiated as
SEX DETERMINATION I N ANIMALS
267
functional spermatozoa. Turner and Asakawa (1964) transplanted heterosexual pairs of closely apposed fetal mice gonads to a n ectopic site below the kidney capsule of a castrated adult host. They found that the testis differentiated normally, but that the ovary differentiated as an ovotestis including seminiferous tubules with secondary spermatocytes. Burns (1961) reported the development of primordial follicles and a few large oocytes from X Y germ cells in the experimentally sex-reversed gonads of opossums. Gordon (1977) produced chimeric mice composed of cells from normal albino mice and pigmented mice carrying the Sxr mutation in order to determine the ability of XX:Sxr cells to differentiate into either sperm or eggs. The production of over 1200 offspring by such chimeric mice failed to include any progeny deriving from an XX:Sxr germ cell. Gordon thus concluded that an X X germ cell is incapable of forming a spermatozoon, and the Sxr gene prevents a n X X germ cell from forming a n oocyte. Similar work with the transformer (tra) gene in Drosophila (Sturtevant, 19451, which causes a sex reversal similar to that induced by Sxr, has indicated that, in this species as well, germ-line sex reversal does not occur (Van Deusen, 1976; Marsh and Wieschaus, 1978). The introduction of germ cells into a gonad of the opposite phenotypic sex has been accomplished in birds by injection of PGC into the bloodstream of a host embryo (Reynaud, 19691, by parabiosis in vitro of oppositely sexed embryonic gonads (Simon, 1960a1, and by recombining anterior and posterior halves of oppositely sexed embryos prior to PGC migration out of the anterior germinal crescent (Haffen, 1968). Using the injection technique, Reynaud was unable to get chimeric chicks to live past hatching, and with the in vitro parabiotic technique the experiment was terminated prior to hatching. In neither case was there any extensive development of sex-reversed germ cells reported. Similarly with the recombination technique, Haffen observed intiation of oogenesis in male germ cells; however, these cells degenerated in early meiosis. Considered collectively, the data concerning germ cell differentiation present a somewhat ambiguous picture. However, the pattern that seems to emerge is that the somatic elements of the gonad are responsible for initiating germ-cell development in either the male or female direction, but the extent of response to this impetus is dependent upon the genotype of the germ cells themselves. If this is the case, then the sex chromosome constitution of the germ cells must be involved, since that is the only difference in the genotypes of male and female germ cells. This notion is supported by evidence from Sxr mice (Cattanach et al., 1971). X X germ cells in these individuals develop as “presumptive
268
JOHN R. McCARREY AND URSULA K . ABBOTT
male germ cells” during the fetal period; however, they degenerate rapidly after birth. Yet when Sxr is expressed in a n XO genetic female, the XO germ cells develop as fully differentiated spermatozoa but never become motile. The much more successful development of XO germ cells as compared to XX germ cells in a testicular environment suggests that the ability of germ cells to respond to gonadal induction is related to a n X-linked dosage mechanism. It should be noted that there is no X-inactivation or any other dosage compensation active in mammalian female germ cells (Mangia et al., 1975). In addition, Erickson (1976) reported that there is no X-linked activity detectable in postmeiotic spermatozoa based on a G6PD assay. Thus there is a difference in the amount of functional X chromatin normally present in male (XY) and female (XX) germ cells in mammals, and this difference could mediate a differential response mechanism. Mittwoch and Buehr (1973) feel that this response may be based on the ability of XY or XO germ cells to maintain a higher growth rate which may be necessary for spermatogenesis. Burgoyne (1978) summarized the evidence indicating that germ cells in a mammlian ovary must have two X chromosomes to differentiate into oocytes, while those in testes must have only one X chromosome to form spermatocytes. He points to the failure of oogenesis in XO and XY females. Similarly spermatogenesis is impaired in XX and XXY males (Burgoyne, 1978; Searle et al., 1978). Further evidence that germ cells containing a single X chromosome cannot differentiate into functional oocytes is provided by observations on XY female wood lemmings. These females are fertile, producing a n XX germ line (Groppet al., 1978; Fredgaet al., 1976). Thus there seems to be strong selection against XY germ cells in a n ovarian environment. As a result, a n XX germ line is selected for, presumably deriving from one or more nondisjunction events. Gropp et al. (1978) postulated a mechanism of double nondisjunction in the early embryonic life of XY females eliminating the Y chromosome in the germ line and replacing it by duplication of the X chromosome. A similar phenomenon has been observed in the mole-vole (Nagai and Ohno, 1977). In this mammalian species, both sexes are genetically XO; however, the female germ line is again XX. Thus a selection mechanism similar to that acting in the wood lemming is apparently militating against development of an XO female g e m line and in favor of an XX genotype. Aneuploidy of the Y chromosome has some effect on male germ-cell differentiation. 2A:XYY human males usually show impairment, or complete absence, of spermatogenesis, and in some cixses an XY germ
SEX DETERMINATION I N ANIMALS
269
line develops (Evans et al., 1978; Searle et al., 1978). Reciprocal translocations involving the Y or X chromosome can also inhibit spermatogenesis (Searle et al., 1978; Luciani and Stahl, 1978). The factors that induce germ-cell differentiation within the gonad have not been elucidated. However, Erickson (1974a) postulated that development of female germ cells in birds is dependent on a diffusible factor produced by the ovarian follicle cells. He based this on the fact that occasional germ cells found in the ovarian medulla and associated mesenteries have been observed to differentiate as oocytes 24-48 hours later than those in the cortex. This would implicate a diffusible substance produced in the cortex that reaches the cortical germ cells first and subsequently influences the more distant germ cells in the medulla or mesenteries. Erickson suggested that the follicle cells are a likely source of this diffusible substance, since these cells are present by 6 days of incubation (prior to the time of germ-cell differentiation) and because they contain lipid droplets and smooth ER suggestive of the production of an exportable product (Rahil and Narbaitz, 1972; de Simone-Santoro, 1969). Erickson has proposed that a progestin may be involved, and has suggested transfilter experiments to demonstrate the diffusible nature of the factor. Further evidence for hormonal control of germ-cell differentiation comes from the tfm and pseudohermaphroditic (vet) phenotypes in mammals. In both cases androgen action is blocked or severely reduced and there is a simultaneous reduction and arrest of spermatogenesis. Morris (1953) reported no spermatogenesis in adult tfrn humans, while Lyon and Hawkes (1970) observed spermatogenesis up to the spermatocyte stage in some cases. In the vet rat, Stanley et al. (1973) found only spermatogonia in the seminiferous tubules. In both tfrn and vet individuals the testes are cryptorchid, which could contribute to the failure of spermatogenesis. However, Chan et al. (1969) transplanted testes from normal and vet rats 4-5 days old to the subcutaneous connective tissue of the ear in adult castrated normal and vet hosts. Normal spermatogenesis was observed in the normal testes in both the normal and vet hosts; however, vet testes did not complete spermatogenesis beyond the primary spermatocyte stage in most cases, irrespective of the genotype of the host. In a few cases spermatids were formed by the vet testes, but functional spermatozoa were never observed. Lyon et al. (1975) have produced evidence indicating that testosterone acts indirectly on male germ cells in mice. By making chimeras between normal male and tfm embryos, Lyon et al. produced adults with spermatozoa derived from both germ lines. Since the tfm germ
270
JOHN R. McCARREY A N D URSULA K . ABBOTT
cells do not undergo spermatogenesis in a tfm host, and are presumably unable to respond directly to androgenic induction, their successful development in this case was attributed to their association with normal Sertoli cells. That the Sertoli cells are intermediaries for germ-cell response to androgens is indicated by their production of androgen-binding protein (ABP) in response to the pituitary gonadotropin FSH (Gunsalus et al., 1978). Presumably the ABP in Sertoli cells acts to trap testosterone produced by the interstitial Leydig cells (0 and Short, 1977). Jost et al. (1977) reported that although germ-cell numbers in the bovine freemartin are initially normal, by 50-90 days of gestation the germ-cell population is abnormally low. These workers assumed that a hormone produced by the male twin acts to inhibit germ-cell development in the female twin. They further hypothesized that this hormone is identical or similar to the Mullerian-inhibiting hormone normally produced in males and may act to inhibit normal meiosis during normal testicular development. Thus Jost et al. proposed that stimulation of male germ cells by androgen is a secondary event preceded by this inhibitory influence. Byskov and Saxen (1976) and Byskov (1978) tested the effect of male gonad secretions on female germ-cell development by culturing fetal mouse testes and ovaries across Millipore filters. When a differentiated testis was cultured with an indifferent ovary, the oocytes were prevented from completing meiotic prophase. They concluded that the differentiated testis secretes a “meiosis-preventing substance” (MPS). In addition, they found that, when a differentiated ovary was cultured with a n indifferent testis, the male germ cells in the testis were triggered to enter meiosis. Thus they also concluded that the differentiated ovary produces a “meiosis-inducing substance” (MIS). Because removal of the rete ovarii from an early ovary results in a failure of the germ cells to initiate meiosis, Byskov and Saxen proposed that this may be the site of production of MIS. Results indicating a similar meiotic-control mechanism affecting germ cell development in hamsters have also been reported (0 and Baker, 1976, 1978). Applications of various steroids to early gonads of both sexes failed to mimic the effects of MIS or MPS, indicating that these substances probably are not steroids. Whether or not there are specific substances that induce o r prevent meiosis, successful completion of meiosis by germ cells s e e m to be a crucial factor in their development. Thus, it is a t some point in meiosis that germ cells of the wrong genetic sex cease development in chimeric, or sex-reversed, individuals as well as in many interspecific hybrids. As an example of the latter, in mules and hinnies the early germ cells
SEX DETERMINATION I N ANIMALS
271
undergo normal migration to the gonad and several mitotic divisions; however, upon entrance into meiosis they degenerate. This is thought to be the result of inability of the paternal and maternal sets of chromosomes to form homologous pairs at meiotic prophase (Taylor and Short, 1973). Millette and Bellve (1977) and Tung and Fritz (1978) recently presented evidence for a surface antigen specific to spermatocytes in rats. They showed that the expression of these antigens is stage specific during gametogenesis, occurring only on haploid germ cells. Antibody raised from pachytene spermatocytes induces aspermatogenesis when used to challenge normal animals (Tung and Fritz, 1978). These results have led Tung and Fritz to propose that the appearance of these specific antigenic determinants reflects selective gene expression during the late prophase of meiosis. They further suggest that these specific surface components may be involved in cell-cell interactions involving germ cells and neighboring Sertoli cells. Thus the following two approaches to the problem of germ-cell differentiation seem to be the most promising ones: (1)further investigations into the nature of the inductive or controlling factor($ in the somatic portion of the gonad, and (2) the determination of the mechanism that mediates the response of germ cells to inductive influences. As in determining the cause of gonadal sex differentiation, precautions must be taken in identifying the inductive factor(s) such that the distinction between a sufficient and a necessary cause is maintained. Thus any proposed inducer of germ-cell differentiation must first be experimentally blocked prior to its time of action, with a resultant lack of germ-cell differentiation; and second, its effect on PGC of the OPPOsite genetic sex must be analyzed to see whether it can influence their differentiation. Both of these approaches are required to substantiate the role of any factor as the in vivo inducer. With the proposal by Erickson that the controlling factor of avian oocyte differentiation is a steroid hormone, a similar hormone-blocking experiment to that discussed earlier in conjunction with gonadal sex differentiation would seem appropriate. Experimental analysis of the mechanism involved in mediating the response of germ cells to the inductive influences of the gonad seems to be more difficult. Since hormones may have a causal role, differential hormone receptors would be a prime candidate for the mediator of germ-cell response. Also the genetic studies to date have indicated the possibility of an X-linked dosage mechanism. The best tests of these proposals would be further work with mutants such as tfm to test the receptor theory, or with aneuploids with varying numbers of X chromosomes to further
2 72
JOHN R . McCARREY A N D U R S U L A K . A B B O T T
test the dosage theory. If an X-linked dosage mechanism is indicated, duplication and deficiency experiments could be employed to determine more exactly the portion(s1 of the X chromosome involved. Also the possibility that both of these mechanisms are employed, with the X chromosome dosage being causally related to the production of specific steroid receptors should be investigated. Finally to test the possible roles of substances affecting the onset of meiosis (MIS and MPS), experiments with mitotic inhibitors might be revealing. When performed in male mammals, such treatment should be followed by application of androgen to mimic Jost’s proposed twostage inhibition-stimulation scheme.
V. Summary and Conclusions
The processes of genetic sex determination, gonadal sex differentiation, and germ-cell differentiation have been extensively studied throughout this century. This review has summarized such work in certain species of mammals, birds, and insects. Genetic sex determination in mammals, based on the presence o r the absence of the Y chromosome, or specific Y-linked genes, has been contrasted with the genic balance mechanism in Drosophila. Evidence from work with birds has led to the conclusion that the sexdetermination mechanism in this group appears to be similar to the genic balance mechanism in Drosophila. Various theories of genetic sex determination mechanisms in mammals and birds involving either chromosomal or genic inheritance have been discussed. We favor the idea of genic inheritance, since it does not require the imposition of any abnormal o r unique genetic mechanisms as does the chromosomal inheritance theory. It seems quite plausible that one or a few specific structural gene products are directly involved in gonadal sex differentiation. These, together with any regulatory loci affecting their expression, would constitute the genetic mechanism governing sex determination in the embryo. Based on a summary of observations on gonadal sex differentiation in mammals and birds, the concept has been developed that a dominant versus neutral sexual phenotype is determined by a dqminant versus null genetic state. Various specific developmental schemes of induction of gonadal sex differentiation, including the hormonal theory, the differential growth theory, and the H-Y antigen theory have been considered within this conceptual framework. Mittwoch’s (1973a) proposal of a differential growth developmental mechanism
SEX DETERMINATION I N ANIMALS
2 73
of sex differentiation seems unsatisfactory since it is based on chromosomal inheritance. Both the hormonal and H-Y antigen theories are compatible with genic inheritance. However, the hormonal theory has some difficult problems including its inability to easily explain the development of normal gonads in the receptordeficient tf;n mutant, and the inability to completely reverse sex differentiation or mimic the freemartin effect with exogenous application of sex steroids. The H-Y antigen theory has not run into any apparent contradictions as yet; however, it is in its infancy and must still resolve many unanswered questions. At this point, then, the H-Y antigen theory seems most promising. With the mounting evidence for the role of the cell surface in embryonic development (Bennett et al., 1972; Moscona, 1975; Karkinen-Jaaskelainen, 1976; Jacob, 1977; Tung and Fritz, 19781, the idea of a gonad-organizing, cell-surface antigen appears plausible. Still, a great deal of work remains in order to elucidate the exact developmental mechanism( s) involved. Evidence concerning early determination of primordial germ cells (PGC) in Drosophila has been presented and correlated with the limited evidence in mammals. Several observations have lead to a theory of posterior origin of PGC in birds, thus indicating that a posterior site of PGC origin is common in most higher forms. Mechanisms controlling PGC migration from their extraembryonic site of origin to the gonads, including a chemotactic guidance system, appear to be similar in all groups discussed, although the migration route varies. A review of studies on the control(s) of sexual differentiation of the germ cells within the gonad leads to the conclusion that the phenotype of the somatic gonad initially induces sexual differentiation of the germ cells, but that the ability of the germ cells to respond is limited by their own genotype in most cases. The possibility that, in mammals, this response is based on the number of X chromosomes in the germ-cell genotype is discussed. In addition mechanisms involving hormonal control of germ-cell differentiation as well as nonsteroidal humoral inductors and inhibitors of meiosis, and the possible role of cell-surface antigens in germ-cell development have been considered. None of these theories have been developed to the point where they can be constructively analyzed. Much more work is necessary in this area in order to establish the mechanisms controlling germ-cell determination and differentiation. ACKNOWLEDGMENTS The authors are very grateful to Drs. Susumu Ohno and Gregory Erickson for reading this manuscript and providing useful suggestions.
274
JOHN R . MCCARREY A N D URSULA K . ABBOTT
REFERENCES Abbott, U. K., and Yee, G. W. (1975). Avian genetics. In “Handbook of Genetics” (R. C. King, ed.), Chapter 8, pp. 151-200. Plenum, New York. Abdel-Hameed, F., and Schoffner, R. N. (1971). Intersexes and sex determination in chickens. Science 172, 162-964. Alexander, G., and Williams, D. (1964). Ovine freemartins. Nature &mdoni 201, 12961298. Arey, L. B. (1974). “Developmental Anatomy,” 7th ed. Saunders, Philadelphia, Pennsylvania. Attardi, B., and Ohno, S. (1974). Cytosol androgen receptor from kidney of normal and testicular feminized (tfm) mice. Cell 2, 205-212. Bacon, L. D. (1969). Ph.D. Dissertation. Kansas State Univ., Manhattan, Kansas. Bacon, L. D. (1970). Immunological tolerance to female wattle isografts in male chickens. Transplantation 10, 124-126. Bacon, L. D., and Craig, J . V. (1966). Evidence for a histocompatibility locus on the w-chromosome in chickens. Poult. Sci. 45, 1066-1067. Bacon, L. D., and Craig, J. V. (1969). Variability of response to the female histocompatibility antigen in chickens. Transplantation 7, 387-393. Baker, T. G. (1972). Primordial germ cells. In “Germ Cells and Fertilization” (C. R. Austin and R. V. Short, eds.), Chapter 1, pp. 1-13. Cambridge Univ. Press, London and New York. Bardin, C. W., Bullock, L. P.., Sherins, R. J., Mowszowicz, I., and Blackburn, W. R. (1973). Androgen metabolism and mechanism of action in male pseudohermaphroditism: A study of testicular feminization. Recent Prog. Horm. Res. 29, 65-109. Barr, M. L., Carr, D. H., Pozony, J., Wilson, R. A,, Dunn, H. G., Jacobson, T. S., and Miller, J . B. (1962). The XXXXY sex chromosome abnormality. Can. Med. Assoc. J . 87, 891-901. Baxter, J . D., and Tomkins, G. M. (1971). Specific cytoplasmic glucocorticoid hormone receptors in hepatoma tissue culture cells. Proc. Natl. Acad. Sci. U.S.A. 68,932-937. Beams, H. W., and Kessel, R. G. (1974). The problem ofgerm cell determinants. Int. Rev. Cytol. 39, 413-479. Beaumont, A. M., and Mandl, A. M. (1962). A quantitative and cytological study of oogonia and oocytes in the foetal and neonatal rat. Proc. R. SOC.London, Ser. B 155, 557-579. Bedichek-Pipkin, S. (1959). Sex balance in Drosophila melanogaster. Aneuploidy of short regions of chromosome 3, using triploid method. Uniu. Tex. Publ. 5915, 69-88. Bennett, D., Boyse, E. A., and Old, L. J . (1972). Cell surface immunogenetics in the study of morphogenesis. I n “Cell Interactions” (L. G. Silvestri, ed.), pp. 247-263. NorthHolland Publ., Amsterdam. Bennett, D., Boyse, E. A., Lyon, M. F., Mathieson, B. J., Scheid, M., and Yanagisawa, K. (1975). Expression of H-Y (male) antigen in phenotypically female t f d Y mice. Nature (London) 257, 236-238. Bennett, M. D. (1972). Nuclear DNA content and minimum generation time in herbivorous plants. Proc. R. SOC.London, Ser. B 181, 109-135. Benoit, M. J . (1923). Transformation experimentale du sexe par ovariotomie precoce chez la poule domestique. C . R. Hebd. Seances Acad. Sci. 177, 1074-1077. Nnoit, M. J . (1924). Sur la signification de la glande genitale rudimentaire droite chez la poule. C . R . Hebd. Seances Acad. Sci. 178, 341-344. Billingham, R. E., and Silvers, W. K. (1959). Inbred animals and tissue transplantation immunity. Transplant Bull. 6, 399-406.
SEX DETERMINATION I N ANIMALS
2 75
Black, V. H., and Christensen, A. K. (1969). Differentiation of interstitial cells and Sertoli cells in fetal guinea pig testes. A m . J . Anat. 124, 211-238. Blackler, A. W. (1958).Contribution to the study of germ cells in the anura. J . Embryol. Exp. Morphol. 6, 491-503. Blackler, A. W. (1962). Transfer of primordial germ cells between two subspecies of Xenopus lueuis. J . Embryol. Exp. Morphol. 10, 641-651. Blandau, R. J., White, B. J., and Rumery, R. E. (1963). Observations on the movements of the living primordial germ cells in the mouse. Fertil. Steril. 14, 482-489. Boczkowski, K. (1971).Sex determination and gonadal differentiation in man. A unifying concept of normal and abnormal sex development. Clin. Genet. 2, 379-386. Bounoure, L. (1950).Sur le developpement sexuel des glandes genitales de la grenouille en l’absence des gonocytes. Arch. Anat. Microsc. Morphol. Exp. 39, 247-296. Bridges, C. B. (1914). Direct proof through nondisjunction that the sex-linked genes are borne on the X-chromosome. Science, 40, 107-109. Bridges, C. B. (1916). Non-disjunction a s proof of the chromosome theory of heredity. Genetics 1, 1-52 and 107-163. Bridges, C. B. (1921).Triploid intersexes in Drosophila melanogaster. Science 54, 252254. Bridges, C. B. (1922).The origin of variations in sexual and sex-limited characters. A m . Nut. 56, 51-63. Bridges, C. B. (1925).Sex in relation to chromosomes and genes. A m . Nat. 59, 127-137. Bridges, C. B. (1939). Cytological and genetic basis of sex. I n “Sex and Internal Secretions” (E. Allen, ed.), 2nd ed., pp. 15-63. Bailliere, London. Bruner, J. A,, and Witschi, E. (1946). Testosterone-induced modifications of sex development in female hamsters. A m . J . Anat. 79, 293-320. Burgoyne, P. S. (1978). The role of the sex chromosomes in mammalian germ cell differentiation. Ann. Biol. Anim., Biochim., Biophys. 18, 391-398. Burns, R. K. (1950). Sex transformation in the opossum: Some new results and a retrospect. Arch. Anat. Microsc. Morphol. Exp. 39, 467-483. Burns, R. K. (1961). Role of hormones in the differentiation of sex. I n “Sex and Internal Secretions” (W. C. Young, ed.), 3rd ed., Vol. 1, pp. 76-158. Williams & Wilkins, Baltimore, Maryland. Byskov, A. G. (1978).The meiosis inducing interaction between germ cells and rete cells in the fetal mouse gonad. Ann. Biol. Anim., Biochim., Biophys. 18, 327-334. Byskov, A. G., and Saxen, L. (1976).Induction of meiosis in fetal testis in uitro. Deu. Biol. 52, 193-200. Cantwell, G. E., Johnston, E. F., and Zeller, I. H. (1958). The sex chromatin of swine intersexes. J . Hered. 49, 199-202. Carlon, N., and Erickson, G. F. (1978). Fine structure of prefollicular and developing germ cells in the male and female left embryonic chick gonads in uitro with and without androgenic steroids. Ann. Biol. Anim., Biochim., Biophys. 18, 335-349. Cattanach, B. M., Pollard, C. E., and Hawkes, S. G. (1971). Sex reversed mice: XX and XO males. Cytogenetics 10, 3 1 S 3 3 7 . Celada, F., and Welshons, W. J . (1963).An immunogenetic analysis of the male antigen in mice utilizing animals with an exceptional chromosome constitution. Genetics 48, 139- 151. Chan, F., Allison, J . E., Stanley, A. J . , and Gumbreck, L. G. (1969).Reciprocal transplantation of testes between normal and pseudohermaphroditic male rats. Fertil. Steril. 20, 482-494. Chieffi, G., Manelli, H., Botte, V., and Mastrolia, L. (1964). I1 differenziamento istochimico dell’interrenale e dei tessuti somatici delle gonade embrionale di pollo:
276
JOHN R. McCARREY A N D URSULA K . ABBOTT
comportamento della steroid 36-01-deidrogenasi. Acta Embryol. Morphol. Exp. 7 , 89-91. Choudhury, H., and Morgan, W. C. (1971). Further studies on avian sex reversal. Poult. Sci. 50, 1565. Cock, A. G. (1964). Dosage compensation and sex-chromatin in non-mammals. Genet. Res. 5, 354-365. Correns, C. (1900). Mendel’s Regel uber das Verhalten der Nachkommenschaft der Rassenbastarde. Ber. Dsch. Bot. Ges. 18, 146-168. Coulombre, J. L., and Russell, E. S. (1954). Analysis of the W-locus in the mouse: The effects of W and Wv substitution upon postnatal development of germ cells. J . Exp. 2001.126,277-296. Counce, S. J. (1963). Developmental morphology of polar granules in Drosophila. J . Morphol. 112, 129-145. Court Brown, W. M., Harnden, D. G . , and Jacobs, P. A. (1964). Abnormalities of the sex chromosome complement in man. Privy council. Med. Res. Counc. (G.B.),Spec. Rep. Ser. 305. Crew, F. A. E. (1923). Studies on intersexuality. 11. Sex reversal in the domestic fowl. Proc. R . SOC.London, Ser. B 95, 25C278. Crew, F. A. E. (1933). A case of non-disjunction in the fowl. Proc. R. SOC.Edinburgh 53, 89-106. Cuminge, D., and Dubois, R. (1971). Etude ultrastructurale autoradiographique de l’organogenese sexuelle precoce chez l’embryon de poulet. Exp. Cell Res. 64,243258. Dantchakoff, V. (1932). Recherches sur la cellule genitale et la gonade. C . R . Seances SOC.Biol. Ses Fil. 113, 874. Dantchakoff, V. (1933). Formation debauches gonadiques steriles determinees par des cellues germinales alterees ou mortes. C . R . Seances SOC.Biol. Ses Fil. 113, 874. Dantchakoff, V. (1935). Sur l’inversion sexuelle experimentelle de l’ebauche ovarique chez l’embryon de poulet. C . R . Seances SOC.Biol. Ses Fil. 151, 1088-1089. Dantachakoff, V. (1941). “Der Aufbau des Geschlechts bei hoheren Wirbeltieren.” Fischer, Jena. Daoust, R., and Clermont, Y . (1955). Distribution of nucleic acid in germ cells during the cycle of the seminiferous epithelium in the rat. A m . J . Anat. 96,255-283. DeBeaumont, J . (1933). La differenciation sexuelle dans l’appareil uro-genital du Triton e t son determinisme. Wilhelm R o d Arch. Entwicklungsmch. Org. 129, 120-178. deGrouchy, J.,Canivet, J., and Canlorbe, P. (1967).Deux observations dhommes 46. XX. Ann. Genet. 10, 193-200. de la Chapelle, A,, Hortling, H., Niemi, M., and Wennstrom, J . (1964). XX sex chromosomes in a human male. First case. Acta Med. Scand., Suppl. 412,25-38. de la Chapelle, A,, Koo, G. C., and Wachtel, S. S. (1978). Recessive sex-determining genes in human XX male syndrome. Cell 15, 837-842. deSimone-Santoro, I. (1969). Morphologie ultrastructurale de l’ovaire de I’embryon de poulet au courts de sa differenciation et de son organogenese. J . Microsc. (Paris) 8, 739-752. deVries, H. (1900). Das Spaltungsgesetz der Bastarde. Ber. Dsch. Bot. Ges. 18,83-90. Didier, E. (1977).Chimerisme somatique et germinal apres la greffe intracoelomique de mesoderme splanchnique de Caille chez l’embryon de Poulet. C . R . Hebd. Seances Acad. Sci. 284, 671-678. Didier, E. and Fargeix, N. (1976). Aspects quantitatifs du peuplement des gonades par les cellules germinales chez l’embryon de Caille (Coturnix coturnix japonzca). J . Embryol. E x p . Morphol. 35, 637-648.
SEX DETERMINATION I N ANIMALS
277
Didier, E., Fargeix, N., and Bergeaud, Y. (1974). Analyse experimentale de la regulation du nombre des cellules germinales apres deficience gonadique chez le poulet. J . Embryol. Exp. Morphol. 32, 619-635. Dixon, E. S. (1850). “Ornamental and Domestic Poultry,” 2nd ed. Gardner’s Chronicle, London. Dobzhansky, T., and Schultz, J. (1934). The distribution of sex factors in the X-chromosome of Drosophila melanogaster. J . Genet. 28, 349-386. Drews, U., and Alonso-Lozano, V. (1974). X-inactivation pattern in the epididymis of sex-reversed mice heterozygous for testicular feminization. J . Embryol. Exp. Morphol. 32, 217-225. Dubois, R. (1962). Sur la sterilisation de l’embryon de poulet par irradiation aux rayons X du croissant germinal extra-embryonnaire. Arc. Anat. Micros. Morphol. Exp. 51, 85-94. Dubois, R.(1967). Localisation et migration des cellules germinales du blastoderme non incube de poulet, d‘apres les resultats de cultures in uitro. Arch. Anat. Microsc. Morphol. Exp. 56,245-264. Dubois, R. (1968). La colonisation des ebauches gonadiques par les cellules germinales de l’embryon de poulet, en culture in uitro. J . Embryol. Exp. Morphol. 20,189-213. Dubois, R. (1969). Le mecanisme d’entree des cellules germinales primordiales dans le reseau vasculaire, chez l’embryon de Poulet. J . Embryol. Exp. Morphol. 21,255-270. Dubois, R., and Croisille, Y. (1970). Germ-cell line and sexual differentiation in birds. Philos. Trans. R . SOC.London, Ser. B 259, 73-89. Dubois, R. and Cuminge, D. (1978a). Sur l’asymetrie de repartition des cellules germinales primordiales au cours de la colonisation des ebauches gonadiques chez l’embryon de Poulet. C. R . Hebd. Seances Acad. Sci. 286, 535-538. Dubois, R. and Cuminge, D. (1978b). Sur les aspects statistiques de l’asymetrie primaire de repartition des cellules germinales primordiales chez l’embryon de Poulet. C. R. Hebd. Seances Acad. Sci. 286, 1613-1616. Eddy, E. M. (1970). Cytochemical observations on the chromatid body of male germ cells. Biol. Reprod. 2, 1 1 6 1 2 8 . Eddy, E. M. (1974). Fine structural observations on the form and distribution of nuage in germ cells of the rat. Anat. Rec. 178, 731-758. Eddy, E. M. (1975). Germ plasm and the differentiation of the germ cell line. Znt. Reu. Cytol. 43, 229-280. Eichwald, E. J., and Silmser, C. R. (1955). Communication. Transplant. Bull. 2, 148149. Ellingson, D. J., and Yao, K. T. S. (1970). Growth and observations of the Chinese hamster seminiferous epithelium in uitro.J . Cell. Sci. 6, 195-205. Erickson, G. F. (1974a). The control of differentiation of female embryonic germ cells in the bird. Dev. Biol. 36, 113-129. Erickson, G.F. (1974b). Spontaneous sex reversal in organ cultures of the embryonic gonad of the bird. J . Embryol. Exp. Morphol. 31, 611-620. Erickson, R. P. (1976). Glucose-6-phosphate dehydrogenase activity changes during spermatogenesis: Possible relevance to X-chromosome activation. Deu. Biol. 53, 134-137. Evans, E. P., Ford, C. E., and Lyon, M. F. (1977). Direct evidence of the capacity of the XY germ cell in the mouse to become an oocyte. Nature (London) 267, 430-431. Evans, E. P., Beechey, C. V., and Burtenshaw, M. D. (1978).Meiosis and fertility in XYY mice. Cytogenet. Cell Genet. 20, 249-263. Fargeix, N. (1969). Les cellules germinales du canard chez des embryons normaux et des embryons de regulation. Etude des jeunes stades du developpement. J . Embryol. Exp. Morphol. 22, 477-503.
278
JOHN R. McCARREY A N D URSULA K. ABBOTT
Fargeix, N. (1977). La colonisation des gonades par les cellules germinales dans les cas de gemellite experimentale chez l’embryon de Caille (Coturnix coturnix japonica).C . R . Hebd. Seances Acad. Sci. 285, 725-728. Federman, D. D. (1967). “Abnormal Sexual Development.” Saunders, Philadelphia, Pennsylvania. Fell, H. B. (1923). Histological studies on the gonads of the fowl. I. The histological basis of sex reversal. Br. J. Exp. Biol. I, 97-130. Ferguson-Smith, M. A. (1966). X-Y chromosomal interchange in the aetiology of the true hermaphroditism and of XX Klinefelter’s syndrome. Lancet 2, 475476. Ford, C. E., Jones, K. W. Polani, P. E., Almeida, J . C., and Briggs, J . H. (1959). A sex-chromosome anomaly in a case of gonadal dysgenesis. (Turner’s Syndrome). Lancet 1, 711-713. Ford, C . E. (1970). Cytogenetics and sex discrimination in man and mammals. J. Biolsocial Sci.,Suppl. 2, 7-30. Ford, C. E., Evans, E. P., Burtenshaw, M. D., Clegg, H., Barnes, R. D., and Tuffrey, M. (1974). Marker chromosome analysis of tetraparental AKR-CBA-T6 mouse chimaeras. Differentiation 2, 321-333. Ford, C. E., Evans, E. P., Burtenshaw, M. D., Clegg, H. M., Tuffrey, M., and Barnes, R. D. (1975). A functional “sex-reversed” oocyte in the mouse. Proc. R . SOC.London, Ser. B 190, 187-197. Fraccaro, M., and Lindsten, J . (1960). A child with 49 chromosomes. Lancet 2, 1303. Franchi, L. L., and Mandl, A. M. (1964).The ultrastructure ofoogonia and oocytes in the foetal and neonatal rat. Proc. R . SOC.London, Ser. B 157, 99-114. Fredga, K. (1970). Unusual sex chromosome inheritance in mammals. Philos. Trans. R . SOC.London, Ser. B 259, 15-36. Fredga, K., Gropp, A., Winking, H., and Frank, F. (1976). Fertile XX- and XY-type females in the wood lemming Myopus schisticolor. Nature (London) 261, 225-227. Fredga, K., Gropp, A,, Winking, H., and Frank, F. (1977). A hypothesis explaining the exceptional sex ratio in the wood lemming (Myopus schisticolor). Hereditas 85, 101-104. Gans, M. (1953). Etude genetique et physiologique du mutant z de Drosophilu melanogaster. Bull. Biol. Fr. Belg., Suppl. 38, 1-90, Gasc, J . M. (1978). Growth and sexual differentiation in the gonads of chick and duck embryos. J. Embryol. Exp. Morphol. 44, 1-13. Gehring, U., and Tomkins, G . M. (1974). A new mechanism for steroid unresponsiveness: Loss of a nuclear binding activity of a steroid hormone receptor. Cell 3, 205-212. Gehring, U., Tomkins, G. M., and Ohno, S. (1971). Effect of the androgen-insensitivity mutation on a cytoplasmic receptor for dihydrotestosterone.Nature Lhzdon), New Biol. 232, 10&107. Geigy, R. (1931). Action de l’ultra-violet sur le pole germinal dans l’oeuf de Drosophilu melanogaster. Rev. Suisse Zool. 38, 187-288. German, J . , Simpson, J. L., Chaganti, R. S. K., Summitt, R. L., Reid, L. B., and Merkatz, I. R. (1978). Genetically determined sex-reversal in 46, XY humans. Science 202, 53-56. Gerneke, W. H. (1964). The karyotype of a gonadal male pig intersex. S. Afr. J . Sci. 60, 347-351. Gerneke, W. H. (1967). Cytogenetical investigations on normal and malformed animals, with special reference to intersexes. Onderstepoort J. Vet. Sci. 34, 219-300. Ghosh, S. N., Shah, P. N., and Charpure, H. M. (1978). Absence of H-Y antigen in XY females with dysgenetic gonads. Nature (London) 276, 180.
SEX DETERMINATION I N ANIMALS
2 79
Gilmour, D. G. (1967). Histocompatibility antigen in the heterogametic sex in the chicken. Transplantation 5 , 699-706. Goldschmidt, R. B. (1934). Lymantria. Bibliogr. Genet. (Leipzig) 11, 1-180. Goldsmith, J. B. (1935). The primordial germ cells ofthe chick. I. The effect on the gonad of complete and partial removal of the germinal crescent and of removal of other parts of the blastodisc. J . Morphol. 88,49-92. Goldstein, J. L., and Wilson, J. D. (1975). Genetic and hormonal control of male sexual differentiation. J . Cell. Physiol. 85, 365-378. Goodale, H. D. (1916). Gonadectomy in relation to the secondary sexual characters of some domestic birds. Carnegie Znst. Washington Publ. 243, 1-52. Gordon, J. (1977). Failure of XX cells containing the sex reversed gene to produce gametes in allophenic mice. J . Exp. Zool. 198, 367-374. Gropp, A., Fredga, K., Winking, H., and Frank, F. (1978). Regulation ofsex chromosome constitution of somatic and germ cells in the wood lemming. Ann. Biol. Anim., Biochim., Biophys. 18, 367-375. Gunn, F. L. S. (1912). On the presence of two ovaries in certain British birds, more especially the Faleonidae. Proc. 2001.SOC. London. pp. 63-79. Gunsalus, G. L., Musto, N. A,, and Bardin, C. W. (1978). Immunoassay of androgen binding protein in blood: A new approach for study of the seminiferous tubule. Science 200, 65-66. Guraya, S. S. (1977). Recent advances in the morphology, histochemistry, and biochemistry of the developing mammalian ovary. Znt. Reu. Cytol. 51, 49-131. Haffen, K. (1960). La culture in uitro de l’epithelium germanitif isole des gonades mdles e t femelles de l’embryon de Canard. 2. J . Embryol. Exp. Morphol. 8, 414-424. Haffen, K. (1968). Sur la greffe prolongee dovaires, dembryons de Poulet, colonises experimentalement par des cellules germinales de sexe mdle. C . R . Hebd. Seances Acad. Sci. 267, 511-513. Haffen, K. (1970). Sexual differentiation and intersexuality in uitro. Zn “Organ Culture” (J. A. Thomas, ed.), pp. 121-175. Academic Press, New York. Haffen, K. (1975). Sex differentiation of avian gonads in uitro. A m . Zool. 15, 257-272. Haffen, K., and Cedard, L. (1968). Etude en culture organotypique in uitro du metabolisme de la dehydroepiandrosterone e t de la testosterone radioactives, par les gonades normales et intersexuees de l’embryon de poulet. Gen. Comp. Endocrinol. 11, 220-234. Hamerton, J. L. (1968). Significance of sex chromosome derived heterochromatin in mammals. Nature (London) 219, 910-911. Hamerton, J. L., Dickson, J. M., Pollard, C. E., Grieves, S. A,, and Short, R. V. (1969). Genetic intersexuality in goats. J . Reprod. Fertil. 7 , Suppl., 25-51. Hamilton, H. L. (1965). “Lillie’s Development of the Chick’ 3rd ed. Holt, New York. Hard, W. L. (1967). The anatomy and cytogenetics of male pseudohermaphroditism in swine. Anat. Rec. 157, 255-256. Hard, W. L., and Eisen, J. D. (1965). Phenotypic male swine with female karyotype. J . Hered. 56, 255-258. Hare, W. C. D. (1977). Heifer sterility and freemartinism. (Letter to Ed.) Vet. Rec. 100, 536. Hathaway, D. S., and Selman, G. G. (1961). Certain aspects of cell lineage and morphogenesis studied in embryos of Drosophila melanogaster with an ultraviolet micro-beam. J . Embryol. Exp. Morphol. 9, 310-325. Hegner, R. W. (1914). “The Germ Cell Cycle in Animals.” Macmillan, New York. Henking, H. (1891). Untersuchungen iiber ersten Entwicklungsvorgange in den Eiern
2 80
JOHN R . McCARREY A N D U R S U L A K . ABBOTT
der Insekten. 11. ijber Spermatogenese und deren Beziehung zur Entwicklung bei Pyrrhocoris apterus. Z . Wiss. Zool., Abt. A 51, 685-736. Herbst, E. W., Fredga, K., Frank, F., Winking, H., and Gropp, A. (1978). Cytological identification of two X-chromosome types in the wood lemming (Myopus schisticolor). Chromosoma 69, 185-191. Herschler, H. S., and Fechheimer, N. S. (1967). The role of sex chromosomes in altering sexual development of mammals. Cytogenetics 6, 204-212. Higgins, S. J., Rousseau, G. G., Baxter, J. D., and Tomkins, G. M. (1973). Activation of the steroid receptor and its subsequent specific nuclear binding studied in a cell-free system. J. Biol. Chem. 248, 5866-5872. Holyoke, E. A. (1949). The differentiation of embryonic gonads transplanted to the adult omentum in the albino rat. Anat. Rec. 103, 675-699. Hughes, W. (1929). The freemartin condition in swine. Anat. Rec. 41, 213-245. Hutt, F. B. (1949). “Genetics of the Fowl.” McGraw-Hill, New York. Illmensee, K., and Mahowald, A. P. (1974). Transplantation ofposterior polar plasm in Drosophila. Induction of germ cells a t the anterior pole of the egg. Proc. Natl. Acad. Sci. U.S.A. 71, 1016-1020. Illmensee, K., Mahowald, A. P., and Loomis, M. R. (1976).The ontogeny of germ plasm during oogenesis in Drosophila. Deu. Biol. 49, 40-65. Jaap, R. G., and Fechheimer, N. S. (1974). Normal and abnormal avian chromosomes. Proc. Abstr. Worlds Poult. Congr., 15th, 1974 pp. 313-315. Jacob, F. (1977). Mouse teratocarcinoma and embryonic antigens. Immunol. Reu. 33, 3-32. Jacobs, P. A., and Strong, J . A. (1959). A case of human intersexuality having a possible XXY sex-determining mechanism. Nature (London) 183, 302-303. Jeon, K. W., and Kennedy, J. R. (1973). The primordial germ cells in early mouse embryos: Light and electron microscopic studies. Deu. Biol. 31, 275-284. Johnston, E. R., Zeller, J . H., and Cantwell, G. (1958). Sex anomalies in swine.J. Hered. 49, 255-261. Jones, H. W., and Scott, W. W. (1971). “Hermaphroditism, Genital Anomalies and Related Endocrine Disorders.” 2nd ed. Williams & Wilkins, Baltimore, Maryland. Jost, A. (1947a). Sur le r d e des gonads foetals dans la differenciation sexuelle somatique de l’embryon de lapin. C. R. Assoc. Anat. 34, 2 5 5 2 6 3 . Jost, A. (194713).Recherches sur la differenciation sexuelle de l’embryon de lapin. 111. RBle des gonades foetales dans la differenciation sexuelle somatique. Arch. Anat. Microsc. Morphol. Exp. 36, 271-315. Jost, A. (1958). Embryonic sexual differentiation (morphology, physiology, abnormalities). In “Genital Abnormalities, Hermaphroditism, and Related Adrenal Diseases” (H. Jones and W. W. Scott, eds.), pp. 15-45. Williams & Wilkins, Baltimore, Maryland. Jost, A. (1965). Gonadal hormones in the sex differentiation of mammalian foetus. In “Organogenesis” (R. L. deHaan and H. Ursprung, eds.), pp. 611-628. Holt, New York. Jost, A., Chodkiewitz, M., and Mauleon, P. (1963). Intersexualite du foetus de veau produite par des androgenes. C. R. Hebd. Seances Acad. Sci. 256, 274-276. Jost, A., Prepin, J.,and Vigier, B. (1977). Hormones in the morphogenesis of the genital system. In “Morphogenesis and Malformation of the Genital System” (R.J . Blandau and D. Bergsma, eds.), pp. 85-97. Alan R. Liss, Inc., New York. Karkinen-Jaaskelainen, M. (1976). Cell interactions in differentiation. Congr. Dig. Med. Biol. 54, 383-399.
SEX DETERMINATION I N ANIMALS
281
Kazazian, H. H., Jr., Young, W. J., and Childs, B. (1965). X-linked G-phosphogluconate dehydrogenase in Drosophila: Subunit associations. Science 150, 1601- 1602. Kerkis, J . (1931). The growth of the gonads in Drosophila melanogaster. Genetics 16, 212-224. Kinsky, F. C. (1971). The consistent presence ofpaired ovaries in the Kiwi (Apteryx)with some discussion of this condition in other birds. J . Ornithol. 112, 334-357. Klinefelter, H. F., J r . , Reifenstein, E. C., and Albright, F. (1942). Syndrome characterised by gynecomastia, aspermatogenesis without aleydigism, and increased excretion of follicle stimulating hormone. J . Clcn. Endocrznol. Metab. 2, 615627. Koch, W. (1963). Intersexuality in mammals. In “Intersexuality” (C. Overzier, ed.), Chapter 3, pp. 35-47. Academic Press, New York. Koo, G. C., Wachtel, S. S., Krupen-Brown, K., Mittl, L. R., Breg, W. R., Genel, M., Rosenthal, I. M., Borgaonkar, D. S., Miller, D. A,, Tantravahi, R., Schreck, R. R., Erlanger, B. F., and Miller, 0. J . (1977). Mapping the locus of the H-Y gene on the human Y chromosome. Science 198, 940-942. Krco, C., and Goldberg, E. H. (1976). H-Y (male) antigen: Detection in 8-cell mouse embryos. Science 193,1134-1136. LeDouarin, N. (1973). A biological cell labeling technique and its use in experimental embryology. Deu. Biol. 30, 217-222. Lee, H., Karasany, N., and Nagele, R. G., J r . (1978a). The role of the cell surface in the migration of primordial germ cells in early chick embryos. Effects of concanavalin A . J . Embryol. Exp. Morphol. 46, 5-20. Lee, H. Y., Nagele, R. G., and Goldstein, M. M. (197813). Scanning electron microscopy of primordial germ cells in early chick embryos. J . Exp. Zool. 206, 457-462. Lillie, F. R. (1916). The theory of the freemartin. Science 43, 611-613. Lillie, F. R. (1917). The freemartin; a study ofthe action ofthe hormones in the foetal life of cattle. J . Exp. 2001.23, 371-452. Lucchesi, J. C. (1973). Dosage compensation in Drosophila. Annu. Rev. Genet. 7, 225237. Lucchesi, J . C. (1977). Dosage compensation: Transcription-level regulation of X-linked genes in Drosophila A m . Zool. 17, 685-693. Luciani, J. M., and Stahl, A. (1978). Meiotic disturbances related to human male sterility. Ann. Biol. Anim., Biochim., Biophys. 18, 377-382. and Lutz-Ostertag, Y. (1959). Freemartinisme spontane chez les oiseaux. Deu. Lutz, H., Biol. 1, 364-376. Lyon, M. F., and Hawkes, S. G. (1970). X-linked gene for testicular feminization in the mouse. Nature (London) 227, 1217-1219. Lyon, M. F., Glenister, P. H., and Lamoreux, M. L. (1975). Normal spermatozoa from androgen resistant germ cells of chimaeric mice and the role of androgen in spermatogenesis. Nature (London) 258, 620-622. McCarrey, J . R., and Abbott, U. K. (1978). Chick gonad differentiation following excision of primordial germ cells. Deu. Biol. 66, 256-265. McClung, C.E. (1902). The accessory chromosome-sex determinant? Biol. Bull. (Woods Hole, Mass.) 3, 43-84. MacIntyre, M. N. (1956). Effect of the testis on ovarian differentiation in heterosexual embryonic rat gonad transplants. Anat. Rec. 124, 27-46. McLaren, A. (1972). Germ cell differentiation in artificial chimaeras of mice. In “The Genetics of the Spermatozoon” (R. A. Beatty and S. Gluecksohn-Waelsch, eds.), pp. 313-324. Edinburgh and New York.
282
JOHN R. MCCARREY A N D URSULA K . ABBOTT
McLaren, A. (1976). “Mammalian Chimeras.” Cambridge Univ. Press, London and New York. Mahowald, A. P. (1962). Fine structure of pole cells and polar granules in Drosophila melanoguster. J . Exp. 2001.151, 201-2151, Mahowald, A. P. (1968). Polar granules ofDrosophila. 11.Ultrastructural changes during early embryogenesis. J. Exp. 2001.167, 237-261. Mahowald, A. P. (1971a). Polar granules of Drosophila. 111. The continuity of polar granules during the life cycle of Drosophila. J. Exp. Zool. 176, 329-344. Mahowald, A. P. (1971b). Polar granules ofDrosophila. IV. Studies showing loss of RNA from polar granules during early stages of embryogenesis. J. Exp. 2001.176, 345352. Mahowald, A. P. (1971~).Origin and continuity of polar granules. Results Prob. Cell Differ. 2 , 159-169. Mahowald, A. P., and Teifert, M. (1970). Fine structural changes in the Drosophila oocyte nucleus during a short period of RNA synthesis. Wilhelm Roux Arch. Entwicklungsmech. Org. 165, 8-25. Makino, S., Sasaki, M. S., Sofuni, T., and Ishikawa, T. (1962).Chromosome condition of an intersex swine. Proc. Jpn. Acad. 38, 686-689. Mangia, F., Abbo-Halbasch, G., and Epstein, C. J. (1975). X-chromosome expression during oogenesis in the mouse. Deu. Biol. 45, 366-368. Marsh, J. L., and Wieschaus, E. (1978). Is sex determination in germ line and soma controlled by separate genetic mechanisms? Nature (London) 272, 249-251. Masui, K. (1967). “Sex Determination and Sexual Differentiation in the Fowl.” Iowa State Univ. Press, Ames. Merchant, H. (1975). Rat gonadal and ovarian organogenesis with and without germ cells: An ultrastructural study. Deu. Biol. 44, 1-21. Meyer, D. B. (1964). The migration of primordial germ cells in the chick embryo. Deu. Biol. 10, 154-190. Milet, R. G., Mukherjee, B. B., and Whitten, W. K. (1972). Cellular distribution and possible mechanism of sex-differentiation in XWXY chimeric mice. Can. J . Genet. Cytol. 14, 933-941. Miller, R. A. (1938). Spermatogenesis in a sex-reversed female and in normal males of the domestic fowl, Gallus domesticus. Anat. Rec. 70, 1 5 5 189. Millette, C. F., and Bellve, A. R. (1977). Temporal expression of membrane antigens during mouse spermatogenesis. J . Cell Biol. 74, 8G97. Mims, M. F., and McKinnell, R. G. (1971). Laser irradiation of the chick embryo germinal crescent. J. Embryol. Exp. Morphol. 26, 31-36. Mintz, B. (1960). Formation and early development of germ cells. In “Symposium on the Germ Cells and Earliest Stages of Development,” pp. 1-24. Inst. Int. Embryol. Fond. A. Basellie. Mintz, B. (1968). Hermaphroditism, sex chromosomal mosaicism and germ cell selection in allophenic mice. J . Anirn. Sci. 27, Suppl. 1, 51-60. Mintz, B. (1969). Developmental mechanisms found in allophenie mice with sex chromosomal and pigmentary mosaicism. Birth defects, Orig. Art. Ser. 5, 11-22. Mintz, B. (1974). Gene control of mammalian differentiation. Annu. Rev. Genet. 8, 411-470. Mintz, B., and Russell, E. S. (1957). Gene-induced embryological modifications of primordial germ cells in the mouse. J . Exp. 2001.134, 207-237. Mittwoch, U. (1967a). “Sex Chromosomes.” Academic Press, New York. Mittwoch, U. (1967b). Sex differentiation in mammals. Nature (London) 214,554-556.
SEX DETERMINATION I N ANIMALS
283
Mittwoch, U. (1969). Do genes determine sex? Nature (London) 221, 4 4 6 4 4 8 . Mittwoch, U. (1970a). How does the Y chromosome affect gonadal differentiation? Philos. Trans. R . Soc. London, Ser. €3 259, 113-117. Mittwoch, U. (1970b). The mammalian Y-chromosome and gonadal differentiation.Bull. Eur. Soc. Hum. Genet. 4, 6 2 1 . Mittwoch, U. (1971a). Sex determination in birds and mammals. Nature (London) 231, 432-434. Mittwoch, U. (1971b). Sex, growth and chromosomes. New Sci. Sci. J . 51, 1 2 6 1 2 7 . Mittwoch, U. (1971~).Mongolism and sex: A common problem of cell proliferation? J . Med. Genet. 9, 92-95. Mittwoch, U. (1973a). “Genetics of Sex Differentiation.” Academic Press, New York. Mittwoch, U. (1973b). Sex and the single chromosome. New Sci. 59, 251-252. Mittwoch, U., and Buehr, M. L. (1973). Gonadal growth in embryos ofsex reversed mice. Differentiation 1, 2 19- 224. Mittwoch, U., and Delhanty, J. D. A. (1972). Inhibition of mitosis in human triploid cells. Nature (London), New Biol. 238, 11-13. Mittwoch, U., Delhanty, J. D. A,, and Beck, F. (1969). Growth of differentiating testes and ovaries. Nature (London) 224, 1323- 1325. Moore, C. R. (1950). Studies on sex hormones and sexual differentiation in mammals. Arch. Anat. Microsc. Morphol. Exp. 39, 4 8 p 4 9 8 . Moore, N. W., and Rowson, L. E. A. (1958).Freemartins in sheep. Nature (London) 182, 1754- 1755. Morgan, T. H. (1910a). Chromosomes and heredity. A m . Nut. 44, 449-496. Morgan, T. H. (1910b). Sex-limited inheritance in Drosophila. Science 32, 120-122. Morgan, T. H. (1920). The endocrine secretion of hen-feathered fowls. Endocrinology 4, 381-385. Morgan, T. H. (1926). “The Theory of the Gene.” Yale Univ. Press, New Haven, Connecticut (Reprinted: Hafner, New York, 1964). Morris, J. M. (1953). The syndrome of testicular feminization in male pseudohermaphrodites. A m . d.Obstet. Gynecol. 65, 1192-1211. Moscona, A. (1957). The development in uitro of chimeric aggregates of dissociated embryonic chick and mouse cells. Proc. Natl. Acad. Sci. U.S.A. 43, 184-189. Moscona, A. A. (1975). Embryonic cell surfaces: Mechanisms of cell recognition and morphogenetic cell adhesion. I n “Developmental Biology. Pattern Formation and Gene Regulation” (D. MacMahon and C.-F. Fox, eds.), pp, 19-39. Benjamin, New York. Moses, M. J., Counce, S . J., and Poulson, D. F. (1975). Synaptonemal complex complement of man in spreads of spermatocytes, with details of the sex chromosome pair. Science 187, 363-365. Mullen, R. J., and Whitten, W. K. (1971). Relationship of genotype and degree of chimerism in coat color to sex ratios and gametogenesis in chimeric mice. J . Exp. 2001.178, 16S176. Muller, H. J. (1947). Evidence of the precision of genetic adaption. Haruey Lect. 43, 165- 229. Muller, U., Aschmoneit, I., Zenzes, M. T., and Wolf, U. (1978a). Binding studies of H-Y antigen in rat tissues: Indications for a gonad-specific receptor. Hum. Genet. 43, 151-157. Muller, U., Zenzes, M. T., Bauknecht, T., Wolf, U., Siebers, J. W., and Engel, W. (1978b). Appearance of LCG-receptor after conversion of newborn ovarian cells into testicular structures by H-Y antigen in uitro. Hum. Genet. (in press).
2 84
JOHN R . McCARREY A N D U R S U L A K . A B B O T T
Mystkowska, E. T., and Tarkowski, A. K. (1970). Behavior of germ cells and sexual differentiation in late embryonic and early postnatal mouse chimeras. J . Embryol. Exp. Morphol. 23, 395-405. Nagai, Y. and Ohno, S. (1977). Testis-determining H-Y antigen- in XO males of the mole-vole (Ellobius lutescens). Cell 10, 729-732. Narbaitz, R., and Adler, R. (1966). Submicroscopical observations of the differentiation of chick gonads. J . Embryol. Exp. Morphol. 16, 41-47. Narbaitz, R., and DeRobertis, E. M. (1968). Postnatal evolution of steroidogenic cells in the chick ovary. Histockmie 15, 187-193. Narbaitz, R., and DeFbbertis, E. M. (1970). Steroid-producing cells in chick intersexual gonads. Gen. Comp. Endocrinol. 14, 164-169. Narbaitz, R., and Kolodny, L. (1964). 5-Sphydroxysteroid dehydrogenase in differentiating chick gonads. Z. Zellforsch. Mikrosk. Anat. 63, 612-617. Narbaitz, R., and Teitelman, G. (1965). A histochemical study of sex inversion produced by estradiol in chick embryos. J . Embryol. Exp. Morphol. 13, 45-50. Neumann, F.,Elger, W., and Steinbeck, H. (1970). Antiandrogens and reproductive development. Philos. Trans. R . SOC.London, Ser. B 259, 179-184. Nicklaus, R. B. (1959). An experimental and descriptive study of chromosome elimination in Miastor spec. (Cecidomzidae: Diptera). Chromosoma 10, 301-336. 0 ,W. S., and Baker, T. G. (1976). Initiation and control of meiosis in hamster gonad in vitro. J . Reprod. Fert. 48, 39-%401. 0,W., and Baker,’T.G. (1978). Germinal and somatic cell interrelationships in gonadal sex differentiation. Ann. Biol. Anim., Biochim., Biophys. 18,351-357. 0, W., and Short, R. V. (1977). Sex determination and differentiation in mammalian germ cells. In “Morphogenesis and Malformation of the Genital System” (R. J. Blandau and D. Bergsma, eds.), pp. 1-12. Alan R. Liss, Inc., New York. Ohno, S. (1961). Sex chromosomes and microchromosomes of Gallus domesticus. Chromosoma 11, 484-498. Ohno, S.(1967). “Sex Chromosomes and Sex-linked Genes.” Springer-Verlag, Berlin and New York. Ohno, S. (1971). Simplicity of mammalian regulatory systems inferred by single gene determination of sex phenotypes. Nature fLondon) 234, 1 3 P 137. Ohno, S. (1976). Major regulatory genes for mammalian sexual development. Cell 7 , 315-321.
Ohno, S. (1977). Testosterone and cellular response. In “Morphogenesis and Malformation of the Genital System” (R. J. Blandau and D. Bergsma, eds.), pp. 99-106. Alan R. Liss, Inc., New York. Ohno, S., Kitrell, W. A., Christian, L. C., Stenius, C., and Witt, G. A. (1963). An adult triploid chicken (Gallus domesticus) with left ovotestis. Cytogenetics 2, 42-49. Ohno, S., Stenius, C., Christian, L. C., Becak, W., and Becak, M. L. (1964). Chromosomal uniformity in the avian subclass Carinatae. Chromosoma 15, 280288. Ohno, S., Tetlenborn, U., and Dofuku, R. (1971). Molecular biology of sex differentiation. Hereditas 69, 107-124. Ohno, S., Christian, L., Attardi, B. J., and Kan, J. (1973). Modification of expression of the testicular feminization (tfm)gene of the mouse by a “controlling element” gene. Nature (London), New Biol. 245, 92-93. Ohno, S.,Nagai, Y., and Ciccarese, S. (1978). Testicular cells lysostripped of H-Y antigen organize ovarian follicle-like aggregates. Cytogenet. Cell Genet. 20, 351364.
SEX DETERMINATION I N ANIMALS
285
Ohno, S., Nagai, Y., Ciccarese, S., and Iwata, H. (1979). Testis-organizing H-Y antigen and the primary sex-determining mechanism of mammals. Recent Prog. Horm. Res. 35 (in press). O’Malley, B. W., and Schrader, W. T. (1976).The receptors of steroid hormones. Sci. A m . 234, 32-43. Ortiz, E.,Price, D., and Zaaijer, J. J. P. (1966). Organ culture studies of hormone secretion in endocrine glands i f fetal guinea pigs. 11. Secretion of androgenic hormone in adrenals and testes during early stages of development. Proc. K. Ned. Akad. Wet., Ser. C 69,400-408. Ortiz, E.,Zaaijer, J. J. P., and Price, D. (1967). Organ culture studies of hormone secretion in endocrine glands of fetal guinea pigs. IV. Androgens from fetal adrenals and ovaries and their influence on sex differentiation. Proc. K. Ned. Akad. Wet.,Ser. C 70,4 7 5 4 8 8 . Padoa, I. J. (1964). I1 differenziamento sessuale delle gonadi di Rana esculenta rese sterili dall’irradiamento con ultravioletto delle uova indivise. Boll. 2001.31, 811824. Poulson, D. F., and Waterhouse, D. F. (1960). Experimental studies on pole cells and midgut differentiation in diptera. Aust. J . Biol. Sci. 13,541-567. Price, D. (1970). In uitro studies on differentiation of the reproductive tract. Philos. Trans. R . SOC.London, Ser. B 259, 133-139. Price, D., and Ortiz, E. (1965). The role of fetal androgen in sex differentiation in mammals. Zn “Organogenesis” (R. L. deHaan and H. Ursprung, eds.), pp. 629-652. Holt, New York. Price, D., Zaaijer, J. J. P., and Ortiz, E. (1967). Organ culture studies of hormone secretion in endocrine glands of fetal guinea pigs. 111. The relation of testicular hormone to sex differentiation of the reproductive ducts. Anat. Rec. 157, 27-42. Price, D., Ortiz, E., and Zaaijer, J. J. P. (1971).Zn uitro studies of the relation offetal sex hormones to sex differentiation in the guinea pig. In “Hormones in Development” (M. Hamburgh and E. J. W. Barrington, eds.), pp. 631-643. Appleton, New York. Rahil, K. S., and Narbaitz, R. (1972). Evolution of the lining bodies of the embryonic chick gonad. J . Embryol. Emp. Morphol. 28, 133-140. Raynaud, A. (1942). Modification experimentale de la differenciation sexuelle des embryons de souris, par action des hormones androgenes e t oestrogenes. Actual. Sci. Ind. 925926. Raynaud, A,, and Fridley, M. (1947).Destruction des glandes genitales de l’embryon de souris par une irradiation au moyen des rayons X, a l’hge de 13 jours. Ann. Endocrinol. 8, 400-419. Reagan, F. P. (1916). Some results and possibilities of early embryonic castration. Anat. Rec. 11, 251-267. Reynaud, G. (1969).Transfert de cellules germinales primordiales de dindon a l’embryon de poulet par injection intravasculaire. J . Embryol. Exp. Morphol. 21, 485-507. Rogulska, T.,Ozdzenski, W. , and Komer, A. (1971). Behavior of mouse primordial germ cells in the chick embryo. J . Embryol. Exp. Morphol. 25, 1 5 5 1 6 4 . Rosenberg, H.S., Clayton, G. W., and Hsu, T. C. (1963). Familial true hermaphroditism. J . Clin. Endocrinol. Metab. 23, 203-206. Rousseau, G. G., Baxter, J. D., and Tomkins, G. M. (1972). Glucocorticoid receptors: Relations between steroid binding and biological effects. J . Mol. Biol. 67,99-115. Ruth, J. V: (1962). Contribution a l’etude des modifications du systeme genital des embryons issus d‘oeufs doubles de poule (Gullus domesticus). Arch. Anat., Stmslwurg 65,61-129.
286
JOHN R. McCARREY A N D URSULA K . ABBOTT
Salzgeber, B. (1957). Influence de facteurs teratogenes sur l’evolution des organes sexues de l’embryon de poulet. I. Action des facteurs physiques. 11. Action des facteurs chimiques. BUG. Biot. (Woods Hale, Mass.) 91, 355-438. Sattar, A. (1977). A study of bovine freemartinism-morphological variations of the genitalia and sex-chromosome chimerism. Indian Vet. J . 54, 244-248. Scheib, D., and Haffen, K. (1968). Sur la localisation histoenzymologique de la 3/3hydroxysteroide dehydrogenase dans les gonades de l’embryon de poulet, apparition e t specificite de l’activite enzymatique. Ann. Embryol. Morphog. 1, 61-72. Schmid, W. (1962). DNA replication patterns ofthe heterochromosomes in Gallus domesticus. Cytogenetics 1, 344-352. Searle, A. G., Beechy, C. V., and Evans, E. P. (1978). Meiotic effects in chromosomally derived male sterility of mice. Ann. Biol. Anim., Biochim., Biophys. 18, 391-398. Selden, J. R., Wachtel, S. S., Koo, G. C., Haskins, M. E., and Patterson, D. F. (1978). Genetic basis of XX male syndrome and XX true hermaphroditism: Evidence in the dog. Science 201, 644-646. Short, R. V. (1967). Reproduction. Annu. Rev. Physiol. 29, 373-400. Short, R. V., Smith, J., Mann, T., Evans, E. P., Hallett, J., Fryer, A,, and Hamerton, &L (1969). Cytogenetic and endocrine studies of a freemartin heifer and its bull co-twin. Cytogenetics 8, 369-388. Silvers, W. K., and Wachtel, S. S. (1977). H-Y antigen: Behavior and function. Science 195, 9 5 6 9 6 0 . Silvers, W. K., Billingham, R. E., and Sanford, B. H. (1968). The H-Y transplantation antigen: A Y-linked or sex-influenced factor? Nature (London) 220, 401-403. Simon, D. (1960a). Contribution a l’etude de la circulation et du transport des genocytes primaires dans les blastoderms doiseau cultives in uitro. Arch. Anat. Mzcrosc. Morphol. Exp. 49, 93-176. Simon, D. (1960b). Organogenese et differenciation sexulle des glandes genitales de l’embryon de poulet, en l’absence totale des cellules germinales. C. R. Hebd. Seances Acad. Sci. 251, 449-451. Smith, L. D. (1966). The role of a “germinal plasm” in the formation of primordial germ cells in Rana pipiens. Dev. Biol. 14, 330-347. Smith, L. D., and Williams, M. A. (1975). Germinal plasm and determination of the primordial germ cells. In “The Developmental Biology of Reproduction” (C. L. Markert and J. Papaconstantinou, eds.), pp. 3-24. Academic Press, New York. Soller, M., and Angel, H. (1964). Polledness and abnormal sex ratio in saanen goats. J . Hered. 55, 139-142. Soller, M., Padeh, B., Wysoki, W., and Ayalon, N. (1969). Cytogenetics of saanen goats showing abnormal development of the reproductive tract associated with the dominant gene for polledness. Cytogenetics 8, 51-67. Somlev, B., Melander, Y., Hanson-Melander, E., Aamdal, J., and Anderson, K. (1970). Another swine intersex with a female chromosome complement. Hereditas 6 4 , 2 9 6 297. Sonnenblick, B. P. (1965).In “Biology ofDrosophila” (M. Demerec, ed.), Chapter 2, pp. 62-167. Hafner, New York. Stanley, A. J., and Gumbreck, L. G. (1964).Programme, Endocrinol. Soc. 40. Stanley, A. J., and Witschi, E. (1940). Germ cell migration in relation to asymmetry in the sex glands of hawks. Anat. Rec. 76, 329-342. Stanley, A. J., Gumbreck, L. G., and Allison, J. E. (1973).Male pseudohermaphroditism in the laboratory Norway rat. Recent Prog. Horm. Res. 29, 43-64.
SEX DETERMINATION IN ANIMALS
287
Steinberger, A., and Steinberger, E. (1966). Stimulatory effect of vitamins and glutamine on the differentiation of germ cells in rat testes organ culture grown in chemically defined media. Exp. Cell Res. 44, 429-435. Steinberger, E., Steinberger, A,, and Perloff, W. H. (1964).Initiation of spermatogenesis in uitro. Endocrinology 74, 788-792. Stevens, N. M. (1908).A study of the germ cells of certain Diptera, with reference to the heterochromosomes and the phenomena of synapsis. J . Exp. Zool. 5, 359-374. Stewart, B. R., and Merriam, J. R. (1975).Regulation ofgene activity by dosage compensation at the chromosomal level in Drosophila. Genetics 79, 635-647. Sturtevant, A. H. (1945). A gene in Drosophila melanogaster that transforms females into males. Genetics 30, 297-299. Sud, B. P. (1961). Morphological and histochemical studies of the chromatid body and related elements in the spermatogenesis ofthe rat. Q. J . Microsc. Sci. 102,495-505. Swift, C . H. (1914). Origin and early history of the primordial germ cells in the chick. A m . J . Anat. 15, 483-516. Tachinante, F. (1974a).Interspecific exchanges of germ cells between chicken and quail in organotropic culture and coelom grafts. C . R. Hebd. Seances Acad. Sci. 278, 1895-1898. Tachinante, F. (1974b).Migratory activity of mouse germ cells submitted to attractive stimulus of germinal epithelium of chick, in-culture in uitro. C . R. Hebd. Seances Acad. Sci. 278, 3135-3138. Tandler, J., and Keller, K. (1911). Uber das Verhalten des chorions bei verschiedengeschlechtlicher Zwillingsgraviditat des Rines und uber die Morphologie des Genitales der weiblichen Tiere, welche einer solcher Graviditat entstammen. Dtsch. Tieraerztl. Wochenschr. 18, 148. Tarkowski, A. K. (1961). Mouse chimaeras developed from fused eggs. Nature (London) 190, 857-860. Tarkowski, A. K. (1964). True hermaphroditism in chimeric mice. J . Embryol. Exp. Morphol. 12, 735-757. Tarkowski, A. K. (1970).Germ cells in natural and experimental chimeras in mammals. Philos. Trans. R. SOC.London, Ser. B 259, 107-111. Taylor, M. J., and Short, R. V. (1973). Development of the germ cells in the ovary of the mule and hinny. J . Reprod. Fertil. 32, 441-445. Tence, M., Tence, J.,and Drosdowsky, M. (1975).Metabolisme de la testosterone dans les cellules de Sertoli du rat. C . R. Hebd. Seances Acad. Sci. 280, 991-994. Therkelsen, A. J. (1964).Sterile male with chromosome constitution 46XX. Cytogenetics 3, 207-218. Thompson, F. H. (1978). H-Y antigen gene loci. Science 201, 842. Tung, P. S., and Fritz, I. B. (1978).Specific surface antigens on rat pachytene spermatocytes and successive classes of germinal cells. Deu. Biol. 64, 297-315. Turner, C. D., and Asakawa, H. (1964).Experimental reversal of germ cells in ovaries of fetal mice. Science 143, 1344-1345. Turner, H. H. (1938). A syndrome of infantilism, congenital webbed neck and cubitus valgus. Endocrinology 23, 56G574. Ullman, S. L. (1965).Epsilon granules inDrosophila pole cells and oocytes. J . Embryol. Exp. Morphol. 13, 73-81. Vakaet, L. (1962). Arscia utigaven, N.V., Brussels. Van Deusen, E. B. (1976). Sex determination in germ line chimeras of Lfrosophila melanogaster. J . Embryol. Exp. Morphol. 37, 173-185.
2 88
J O H N R. M c C A R R E Y A N D U R S U L A K. A B B O T T
Vigier, B., Locatelli, A., Prepin, J . , Buisson, F. M., and Jost, A. (1976). Les premieres manifestations du freemartinisme chez le foetus de Veau ne dependent pas du chimerisme chromosomique XXIXY. C. R. Hebd. Seances Acad. Sci., Ser. D 282, 135S1358. Wachtel, S . S. (1977). H-Y antigen and the genetics of sex determination. Science 193, 1134- 1136. Wachtel, S. S., Koo, G. C., Zuckerman, E. E., Hammerling, U.,Scheid, M. P., and Boyse, E. A. (1974). Serological crossreactivity between H-Y (male) antigens of mouse and man. Proc. Natl. Acad. Sci. U.S.A. 71, 1215-1218. Wachtel, S. S., Koo, G. C., and Boyse, E. A. (1975). Evolutionary conservation of H-Y (male) antigen. Nature (London) 254,q70-272. Wachtel, S.S., Koo, G. C., Ohno, S., Gropp, Ah Dev, V. G., Tantravahi, R., Miller, D. A., and Miller, 0. J. (1976). H-Y antigen and the origin of XY female wood lemmings (Myopus schisticolor). Nature (London) 264, 6 3 S 6 3 9 . Wachtel, S. S., Koo, G. C., and Ohno, S . (1977).1n “New Concepts ofthe Testis in Normal and Infertile Men: Morphology, Physiology and Pathology” (P. Troen and H. Nankin, eds.). Raven, New York. Wachtel, S. S.,Basrur, P., and Koo, G. C. (1978). Recessive male-determining genes. Cell 15, 279-281. Wakahara, M. (1978). Induction of supernumerary primordial germ cells by injecting vegetal pole cytoplasm into Xenopus eggs. J . Exp. 2001.203, 159-164. Waring, G. L., Allis, C. D., and Mahowald, A. P. (1978). Isolation of polar granules and the identification of polar granule-specific protein. Deu. Biol. 66, 197-206. Warn, R. (1972). Manipulation of the pole plasm of Drosophila melanogmter. Acta Embryol. Exp., Suppl. pp. 415-427. Weakley, B. S. (1971). Basic protein and ribonucleic acid in the cytoplasm of the ovarian oocyte in the golden hamster. Z. Zellforsch. Mikrosk. Anat. 112,69-84. Wells, L. J . , and van Wagenen, G. (1954). Androgen induced female pseudohermaphroditism in the monkey (Macaca mulatta): Anatomy of the reproductive organs. Contrib. Embryol. Carnegie Znst. 33, 103-112. Weniger, J. P. (1958). Persistance de la secretion hormonale de l’ovaire gauche de l’embryon de poulet apres culture in uitro. C. R. Seances SOC.Biol. Ses Fil. 52, 51,5- 5 17. Weniger, J. P. (1961). Activite hormonale des gonades morphoJagiquement indifferenciees de l’embryon de poulet. Arch. Anat. Microsc. Morihol. Exp. 50, 269288. Weniger, J . P. (1962). Diffusion des hormones gonadiques de l’embryon de poulet dans le milieu de culture. C. R . Seances SOC.Biol. Ses Fil. 156, 893-894. Weniger, J. P., and Zeis, A. (1971). Biosynthese doestrogenes par les ebauches gonadiques de poulet. Gen. Comp. Endocrinol. 16, 391-397. Whitten, W. K. (1975). Chromosomal basis for hermaphrodism in mice. I n “The Developmental Biology of Reproduction” (C. L. Markert and J . Papaconstantinou, eds.), pp. 189-206. Academic Press, New York. Wilkes, P. R., Munro, I. B., and Wijeratne, W. V. S. (1978). Studies on a sheep freemartin. Vet Rec. 102, 140-142. Willier, B. H., Gallagher, T. F., and Koch, F. C. (1935). Sex modification in the chick embryo resulting from injections of male and female hormones. Proc. Natl. Acad. Sci. U.S.A. 21, 625-631. Winsor, E. J. T., Ferguson-Smith, M. A,, and Shire, J . G. M. (1978). Meiotic studies in mice carrying the sex reversal ( S r r ) factor. Cytogenet. Cell Genet. 21, 11-18.
SEX DETERMINATION I N ANIMALS
289
Witschi, E. (1939). Modifications of the development of sex in lower vertebrates and in mammals. I n “Sex and Internal Secretions” (E. Allen, ed.), 2nd ed., Chapter 4, pp. 14L226. Williams & Wilkins, Baltimore, Maryland. Witschi, E. (1948). Migration of the germ cells of human embryos from the yolk sac to the primitive gonadal folds. Contrib. Embryol. Carnegie Inst. 32, 69-80. Wolff, Et. (1946). Recherches sur l’intersexualite experimentale produite par la methode des greffes de gonades a l’embryon de poulet. Arch. Anat. Microsc. Morphol. Exp. 36, 69- 90. Wolff, Et. (1962a). Experimental modification of ovarian development. In “The Ovary” (S. Zuckerman, ed.), Vol. 2, pp. 81-129. Academic Press, New York. Wolff, Et. (1962b). The effect of ovarian hormones on the development of the urogenital tract and mammary primordia. In “The Ovary” (S. Zuckerman, ed.), Vol. 2, pp. 155-178. Academic Press, New York. Wolff, Et., and Ginglinger, A. (1935). Sur la transformation des poulets males en intersexues par injection d’hormone femelle (folluidine) aux embryons. Arch. Anat., Strasbourg 20, 219-278. Wolff, Et., and Haffen, K. (1951). Sur la culture in uitro des glandes genitales des embryons d’oiseau: Obtention de la differenciation sexuelle normale e t de l’interesexualite experimentale des gonades explantees. C . R . Hebd. Seances Acad. Sci. 233, 439-444. Wolff, Et., and Haffen, K. (1952a). Sur une methode de culture d’organes embryonnaires in uitro. Tex. Rep. Biol. Med. 10, 463-472. Wolff, Et., and Haffen, K. (1952b). Sur le developpement e t la differenciation sexuelle des gonades embryonnaires doiseau en culture in uitro. J . Exp. 2001.119,381-399. Sur la differenciation sexuelle des gonades embryonWolff, Et., and Haffen, K. (1952~). naires de l’embryon de poulet en culture in uitro. Ann. Endocrinol. 13, 724-731. Wolff, Et., and Haffen, K. (19528. Sur l’intersexualite experimentale des gonades embryonnaires de canard cultivees in uitro. Arch. Anat. Microsc. Morphol. Exp. 41, 184-207. Wolff, Et., and Haffen, K. (1952e). Action feminisante de la gonade droite de l’embryon femelle de canard en culture in uitro. C. R. Seances SOC.Biol. Ses Fil. 146, 17721774. Wolff, Et., and Haffen, K. (1959). La culture in vitro de l’epithelium germinatif isole de gonades males et femelles de l’embryon de canard. Arch. Anat. Microsc. Morphol. Exp. 331-346. Wolff, Et., and Haffen, K. (1961). Sur la feminisation induite par les gonades males intersexuees, chez l’embryon de poulet. Arch. Anat., Strasbourg 44, Suppl., 275302. Wolff, Et., and Haffen, K. (1965). Germ cells and gonads. In “Cells and Tissues in Culture: Methods, Biology and Physiology” (E. N. Willmer, ed.), Vol. 2, pp. 697-743. Academic Press, New York. Wolff, Et., and Wolff, Em, (1951). The effects of castration on bird embryos. J . Exp. Zool. 116, 59-98. Wolff, Et., Haffen, K., and Scheib, D. (1966). Sur la detection et le role d’hormones sexuelles dans les jeunes gonades embryonnaires des oiseaux. Ann. Histochim. 11, 353-368. Woods, J. E., and Weeks, R. L. (1969). Ontogenesis of the pituitary-gonadal axis in the chick embryo. Gen. Comp. Endocrinol. 13, 242-254. Zaaijer, J . , J . P., Price, D., and Ortiz, E. (1966). Organ culture studies of hormone secretion in endocrine glands offetal guinea pigs. I. Androgenic secretion as demonstrated by a bioindicator method. Proc. K . Ned. Akad. Wet., Ser. C 69, 389-399.
290
JOHN R . McCARREY A N D U R S U L A K . ABBOTT
Zaleski, W. A., Houston, C. S., Poszonyi, J., and Ying, K. L. (1966). The XXXXY chromosome anomaly: Fkport of three cases and review of 30 cases from the literature. Can. Med. Assoc. J . 94, 1143-1154. Zawadowski, M. M. (1926). Bisexual nature of the hen and experimental hermaphroditism in hens. Tr. Lab. Eksp. Biol.Mosk. Zooparka 2, 164-179. Zenzes, M. T., Wolf, U., Gunther, E., and Engel, W. (1978). Studies on the function ofH-Y antigen: Dissociation and reorganization experiments on rat gonadal tissue. Cytogenet. Cell Genet. 20, 3 6 6 3 7 2 .
RECENT ADVANCES IN HISTOCOMPATIBILITY IMMUNOGENETlCS George D. Snell The Jackson Laboratory. Bar Harbor. Maine
I . Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . I1. Non-H-2 Histocompatibility Loci . . . . . . . . . . . . . . . . . . . I11. Non-H-2 Membrane Alloantigens Demonstrated by Methods Other Than Grafting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. Recombinant Inbred Strains . . . . . . . . . . . . . . . . . . . . B . The LyM-1 Antigen . . . . . . . . . . . . . . . . . . . . . . . . C . The Thy-1 Antigen . . . . . . . . . . . . . . . . . . . . . . . . D . The Ly Antigens of T Cells . . . . . . . . . . . . . . . . . . . . E . The Ly Antigens of B Cells . . . . . . . . . . . . . . . . . . . . F . Some Miscellaneous Antigens of Lymphocytes . . . . . . . . . . . G. Antigens of Skin and Liver . . . . . . . . . . . . . . . . . . . . IV . The Major Histocompatibility Complex (MHC) and Adjacent Loci . . . . A . Some Loci Adjacent to the H-2 Complex . . . . . . . . . . . . . . B . The H Loci . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. TheZu Loci . . . . . . . . . . . . . . . . . . . . . . . . . . . D . The T Complex . . . . . . . . . . . . . . . . . . . . . . . . . . V . Immune-Response Genes . . . . . . . . . . . . . . . . . . . . . . . A . The Zr-1 Loci of the H-2 Complex . . . . . . . . . . . . . . . . . B. Loci Not Linked to H-2 . . . . . . . . . . . . . . . . . . . . . . VI . Hybrid or Hemopoietic Resistance . . . . . . . . . . . . . . . . . . VII . The MHC in Cell-Cell Interactions . . . . . . . . . . . . . . . . . . Addendum . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
291 292 296 297 297 300 300 303 304 305 306 307 309 318 320 323 323 330 331 334 341 344
I. Introduction
Histocompatibility immunogenetics is concerned with those loci. probably several hundred in number. that determine cell membrane 291 A D V A N C E S IN GENETICS. Vol 20
Copyright @ 1979 by Academic Press. Inc All rights of reproduction In any form reserved ISBN 0-12-017620-3
292
GEORGE G . SNELL
components demonstrable either by tissue transplantation or by serological techniques. If there are nonmembrane alloantigens competent to stimulate graft rejection, these also would fall within the scope of histocompatibility genetics, but a t present we have no evidence for such alloantigens. The subject of histocompatibility immunogenetics has been treated in books by J. Klein (1975) and Snell et al. (1976). This review will cover the period of approximately two years since the more recent of these books was published. Most of the work reported has been done with the mouse, but I shall also include studies carried out with rats and humans. I shall not attempt to cover the many recent papers dealing with the clinical aspects of human histocompatifility and shall deal only briefly with a number of other subjects, especially those covered in recent reviews. Because of the recent surge of interest in the major histocompatibility complex (MHC) and its relation to cellular immunity, this area of research, or at least its genetic aspects, will receive especial attention. I shall have frequent occasion to refer to the different categories of lymphocytes, especially to the different categories of T, or thymusderived, lymphocytes. This subject is briefly reviewed in Snell et al. (1976). A more complete and up-to-date review will be found in Snell (1978). II. Non-H-2 Histocompatibility Loci
It is customary to divide murine histocompatibility loci into two groups, those in the major histocompatibility, or H-2, complex, and those not included in this complex. The non-H-2 loci, unlike the H-2 loci, incite relatively weak allograft responses and are difficult to demonstrate serologically. In previous work it has been found possible to study them only through the use of congenic strain pairs differing one from the other at one histocompatibility ( H )locus, or in a few cases a t multiple, closely linked H loci. Typing of inbred strains for non-H-2 histocompatibility genes is usually done by a complementation test. An F, derived by crossing a congenic strain and the unknown is grafted with skin from the congenic partner strain. Survival of the graft indicates successful complementation. Hauptfeld and Klein (1977) have reported a new, more rapid test, not requiring the production of a n F,, based on a n in vitro cytotoxic method developed by Bevan (1976). One member of a congenic pair is im-
ADVANCES I N HISTOCOMPATIBILITY IMMUNOGENETICS
293
munized against the partner strain by skin grafting and/or injection of lymphoid cells, and spleen cells from the immunized mouse are boosted by additional in uitro exposure to donor cells. Hyperimmunized cells thus produced are then tested for in uitro cytolytic capacity against radiolabeled target cells from the strain to be typed. Cytolysis indicates allelic identity at the test locus with the immunizing partner. The difficulty of demonstrating non-H-2 loci serologically appears to have been overcome, at least to some degree, by Zink and Heyner (1977,1978).Mice were immunized with two injections, 3 weeks apart, of lymphoid tissues either from non-H-2 congenic mice or from mice carrying multiple non-H-2, but no H-2, disparities. Several methods of demonstrating antibodies were tested; the best results were obtained when lymphoid cells were treated first with the presumptive al1,oantibody and then with fluorescein-labeled goat anti-mouse globulin. Appropriate absorptions were performed with the more complex antisera. Antibodies against H-1, H-3, H-8, and H-13 were demonstrated. The anti-H-8 was demonstrable by hemagglutination as well as by immunofluorescence. Although anti-H-4 and anti-H-7 might have been present in antiserum from some of the strain combinations employed, they did not appear. The titers were generally low compared to those often observed in anti-H-2 and anti-Ly sera. Despite these limitations, the use of this sort of antibody sandwich technique for demonstrating non-H-2 antigen is sure to find valuable applications. One qualification should be noted. The H-3 and Ly-4 loci are closely linked, and their alleles show similar, though possibly not identical, strain distributions (Snell et al., 1976). The (BALB/c x DBN2) anti-BlO.D2 used by Zink and Heyner (1977a) could have contained an anti-Ly-4. The evidence that it contained instead an anti-H-3 was a reaction with neonatal kidney. McKenzie and Snell (1975) failed to detect Ly-4 on kidney. Whether 23-3 and Ly-4 are really distinct loci is an important and unresolved point and deserves further study. When W/W" anemic mice are used as recipients of bone marrow grafts, the success of the graft is easily determined by checking the red cell content of the blood, Using this method and a variety of non-H-2 congenic strains, Harrison and Doubleday (1976) have compared the success of marrow grafts and skin grafts made across single non-H-2 disparities. As expected, there was great variation in the length of survival of skin grafts made across the different non-H-2 barriers. Marrow grafts, as tested by their ability to cure anemia in groups of W/W" mice, tended to be either successful or unsuccessful. In general, the cure rate tended to correlate with the weakness of the histocompatibility barrier. There were no cures in the case of the three
294
GEORGE G . SNELL
strongest disparities, 100 or nearly 100% cures in the case of the weakest disparities. In the intermediate range there were some interesting discrepancies between the skin and marrow graft results. The authors conclude that two loci, H-17 and H-26, determine antigens more strongly expressed on skin than on marrow, whereas a third locus, H-12, determines an antigen with the reverse distribution. Gasser (1976a) has reported a sixth allele at the H-3 locus. He notes that the non-H-2 loci, though much less studied than the H-2 loci, begin to appear as though they may possess a comparable degree of polymorphism. The rejection of male skin grafts by females of the same inbred strain has led to the postulate of a Y-chromosome locus,H-Y, that determines a male-specific antigen. A male-specific antigen is also demonstrable serologically on a wide variety of male tissues, including the germ cells. Anti-male antigen sera made in mice react with cells from males of a wide variety of other species, including man and amphibia. They even react with birds, but in this case with females, which are the heterogametic sex. This wide cross-reactivity suggests a gene product of great evolutionary conservatism. One possible interpretation of the male antigen is that it is induced by the male hormone. Although the evidence is conflicting, most investigations seem not to support this interpretation. Krco and Goldberg (1976) have now shown that the male antigen can be demonstrated on about 50% of %cell mouse embryos. This clearly rules out any requirement for testosterone. The authors also note that this points to the expression of parental genes at an early stage of development. Additional evidence comes from the study of the testicular fe inizing syndrome in man. Individuals with this syndrome have the nor 1 male karyotype and gonads in the form of testes but, because they lack a receptor for testosterone, develop phenotypically as females. Koo et al. (1977) have now shown that, despite the testosterone-unresponsiveness of these individuals, they possess the H-Y antigen. Similar results have been found in mice carrying the Tfm X-linked locus. Koo et al. suggest that the function of the H-Y antigen is to direct the development of the undifferentiated gonad into the male or testicular pathway. Ohno et al. (1976) support the same view and find evidence for it in a study of freemartins in cattle. Freemartins are now known not to be the result of testosterone passaged from the male twin, but of XY/XX chimerism. This chimerism extends to the testes. Ohno et al. find that in the testislike gonads of females of male-female twin pairs there is as much H-Y antigen as in the gonads of the twin males. They suggest that induction of the XX gonadal cells in the male direction is caused by the H-Y antigen produced by the XY cells.
T
ADVANCES I N HISTOCOMPATIBILITY IMMUNOGENETICS
295
While most studies point to the mammalian Y chromosome as the bearer of male-determining loci, work with the Sxr locus in mice provides what appears to be contrary evidence (Catternach et al. , 1971). Sxr is a n autosomal locus that causes animals with the XX or female karyotype, although lacking germ cells, to acquire in other respects the male phenotype. Sxr, XO animals have a similar phenotype, though with some spermatogenesis. Bennett et al. (1977) have now shown that, as tested both serologically and by skin grafts, the Sxr, XX males have the H-Y antigen. The association between testicular development and H-Y thus remains intact. To account for the presence of H-Y in the absence of a Y chromosome, the authors postulate that Sxr is really a translocation of a small fragment of the Y chromosome to a n autosome. There is no cytological evidence of this, but the assumption does keep intact a theory that unifies a great variety of data. The situation is compl]kcated, however, by a study by Melvold et al. (1977). These authors report evidence for two male antigens. Among the progeny of a n irradiated male they found a phenotypic though sterile male who, as tested by skin grafts, lacked H-Y. He rejected male grafts and his grafts were accepted by females. Examination of his karyotype &owed the absence of a Y chromosome. Cytologically and phenotypically the mouse thus was reminiscent of Sxr, XO males, though with less development of the testes. This could be due to background genes. However, the skin graft results were contrary to those obtained by Bennett et al. (19771, though it should be noted that in the Bennett study Sxr, XX males we% used. But the surprising finding by Melvold et al. was that, although their exceptional male lacked H-Y as tested by skin grafting, he possessed H-Y as demonstrated serologically. The tests were done with brain and spleen cells. These results do indeed seem to point to the existence of two male antigens-one invoking cellular immunity as demonstrable by skin graft rejection, and the other humoral immunity. An explanation in terms of a restricted tissue distribution of a single antigen is unlikely because the presence of such an antigen on spleen cells would have induced tolerance to male grafts. Such grafts were rejected. As a n explanation of the separation of the two H-Y antigens in this exceptional male, the authors suggest a radiation-induced translocation of a fragment of the Y carrying one but not both of two H-Y loci. The authors suggest H-Y1 as the symbol for the antigen demonstrated by skin grafts and H-Y2 for the antigen demonstrated with antisera. Kralova and Demant (1976) have obtained results in homozygous male to F, female grafting experiments which they interpret as meaning that the Y-linked male factor is a regulatory locus and that the
296
GEORGE G. SNELL
structural locus is associated with the K end ofH-2. These authors used two kinds of grafts, the usual skin grafts and thymus cell grafts, the reaction against which was measured by the enlargement of the lymph node draining the site of injection. The grafts were performed with strains carrying a variety ofH-2 haplotypes, all on a common inbred background. The strength of the reaction varied with the H-2 haplotype of the parent used as donor. Tissue from one parent could incite a strong rejection, tissue from the other parent a weak reaction, in the same F,. In some cases, moreover, response to thymus and skin from the two parents varied in inverse fashion. A strong skin rejection could go with a weak thymus cell rejection, and vice versa. Recombinants mapped the controlling locus at the K end of H-2. This type of result, where the donor rather than the recipient H-2 type determines the response, is not easily explained in terms of Ir-1 genes (Section V,A) . An Ir-1 effect could be invoked if we assumed that T cells “see” H-2 in conjunction with H-Y, but the authors point out two objections to this idea. (1)It would not explain the opposite effects seen with thymus and skin. (2) Results with a single donor haplotype were consistent in different F, females, even though these carried different Ir-1 genes from the other parent. It is because of these problems that the authors invoke an H-2-linked structural gene for H-Y. It seems to this reviewer that the work of Melvold et al. (1977), already cited, suggests another explanation, namely that rejections of skin and thymus are determined by different H-Y antigens, and that these may interact differently with different H-2K antigens. We shall have more to say about this matter of H-2-non-H-2 interactions in Section V,A. Palm et al. (1977) have tested the number of histocompatibility loci in rats, using the conventional parent to F, skin grafts. The ratios obtained were in accord with the assumption that 15 loci were segregating in the particular cross employed. This is very similar to the results obtained in mice in comparable experiments. This method undoubtedly gives a substantial underestimate of the total number of H loci. Ill. Non-H-2 Membrane Alloantigens Demonstrated by Methods Other Than Grafting
Cell membrane alloantigens discovered and usually studied by methods other than skin grafting represent a growing and increasingly important group. The majority of these alloantigens have been demonstrated on lymphocytes by cytotoxic tests. Some have been demon-
ADVANCES IN HISTOCOMPATIBILITY IMMUNOGENETICS
297
strated serologically on cells other than lymphocytes; this group is likely to expand rapidly. One, the Mls gene product, is demonstrated by the mixed lymphocyte reaction. Cell membrane alloantigens of course include blood group antigens, but I shall not consider these. I shall also not consider here, but in a later section, serologically demonstrated antigens determined by genes in or close to the H-2 complex. A. RECOMBINANT INBRED STRAINS When an antiserum gives a previously unknown reaction with a lymphocyte surface component, the question immediately arises whether a new locus is thereby identified. The most useful tools for answering questions of this sort are panels of recombinant inbred (RI) strains derived from crossing two inbred strains with subsequent inbreeding of the progeny (Bailey, 1971; Snell et al., 1976). RI strains are also a potent means of detecting linkages. The one requirement for RI strains to work with any particular antigen is that the original cross segregates for alternative forms of the antigen. Because of this restriction, it is useful to have a variety of RI strain panels. Two new panels have now been reported. One is the AKXL panel derived from an AKWJ x C57L/J cross (Taylor and Meier, 1976; Festenstein et al., 1977); the other is the BXD panel derived from a C57BU6J x DBNBJ cross (Taylor and Shen, 1977). Both panels are larger than Bailey’s original CXB panel, which increases their usefulness, especially for linkage studies. Other panels are in the late stages of development (B. A. Taylor, personal communication). Snell et al. (1976) report eleven alloantigens that fall within the restricted class that we are considering here. Our review includes new information in regard to some of these and the description of nine new alloantigens. The strain distribution of these new alloantigens is given in Table 1. B. THE LyM-1 ANTIGEN
It is a general rule that, when lymphoid cells from genetically disparate individuals are mixed, MHC disparities lead to a strong MLR (mixed lymphocyte reaction) and non-MHC disparities lead to a weak MLR. The one known exception is the Mls locus of the mouse. Four alleles have been found, and when some of these are paired, strong MLRs occur. No human homolog has been demonstrated. Ahmed et al. (1977) have.studied the ontogeny of the Mls gene product and its cellular distribution. Cells of neonatal Mls-disparate
298
GEORGE G . SNELL
TABLE 1. Strain Distribution of Alleles Strain' C57BL C57L 129 A BALBic HTG SJL SWR DBN1 DBN2 C57BWcd C58 C3H CBA AKR RF CE
LyM-1
M (6) M L M (J) L H H L(HeJ) H (J) H (J) L (J) L (J)
Ly-8.2
+ (1OSf)
+ (J) -
(SnSf) (J)
+ (SO
+ (J)
+ (J) -
(Fs)
+ (Fs) + (J)
-(He) - (J) + (J) -? (J)
LyX 3(6)
2 1 (J) 1, 2.1
Lyb-2.1 -
+
(6)
- (Ha) - (J) -
-
3 (J)
2.1, 2.2 1 (He)
3 (CU)
-
NK
Lyb-3
+(a)
+(6J)
+ (J) + (J)
-
(J)
(J)
+ (J)
+ +
+ (J)
+ (J)
+ + (Bi)d + (J)' -
- (J) (J)
-
+ (HIf
-
(Bi) (T6)
+
" Alleles (or specificities of alloantigens determined by alleles) are indicated by high (H), medium (MI, or low (L) reaction with test alloantisera ( L yM- I ) ,by + or - reactions (Ly-8.2, Lyb-2.1, Lyb-3, NK, Qa-1, &a-2, &a-31, by specificity number CLyX, Ala-1, F), or by allelic symbol (Pgk-2,H-2). Sources used for the table are: LyM-1, Tonkonogy and Winn (1976); LY-8.2, Frelinger and Murphy (1976); L y X , Zeicher et al. (1977); Lyb-2, Sat0 and Boyse (1976); Lyb-3, Huber et al. (1977); NK, Glimcher et al. (1977); Ala-1, Feeney and Hammerling (1976); F, Lane and Silver (1976); &a-1, Stanton and Boyse (1976); Qa-2, Flaherty (1976); Qa-3, Flaherty et al. (1978); Pgk-2, Eicher et al. (1978).
H-2-identical mice did not stimulate an MLR. Adult ability to stimulate was not attained until about 4-5 weeks of age. Much the best source of stimulating cells was the spleen, a rich source of B lymphocytes. When purified spleen cell populations were used, only B cells stimulated; purified T cells were inactive. The authors conclude that the Mls antigen is a specific marker for a late stage of B lymphocyte differentiation. Tonkonogy and Winn (1976, 1977) have demonstrated serologically an alloantigen of mice that shows properties very similar to the MZs gene product, but that may be determined by a locus closely linked to MZs rather than Mls itself. The tentative symbol LyM-1 is suggested for the postulated locus. The antigen was detected with reciprocal antisera made with H-2-matched strains CBNJ and C3WHeJ. The titer was low even after a number of injections. A variety of tests
ADVANCES IN HISTOCOMPATIBILITY IMMUNOGENETICS
299
of Murine Alloantigen-Determining Loci".h
F
Ala-1
Qa-1 -
1(Ha) 1 1 1 2 (J)
2 2 (J) 2 1 (Bi) 1 (T6) 2
1 (J)
(6)
2 (St) 2 4
1 1 1 1
Qa-2
Qa-3
Pgk-2
H-2
b b b a d g S
4 4
+ + -
d
(An)
k k k k k
k k
Substrain tested, where stated by the authors, is indicated in parentheses after the symbol indicating nature or degree of alloreactivity. 'l C3WHeJ is -. CBNH is -. 'CBNN is -. Several, but not all, BALBic substrains derived from BALBicAn are 129/terSv and 129/ReJ are c . I;
showed that reactivity was confined to B cells, including stimulated B cells capable of plaque formation. In a backcross, the antigen segregated with ability to stimulate a mixed lymphocyte reaction. When the C3H anti-CBA was tested by both absorption and direct cytotoxicity against a panel of inbred strains, three levels of activity were found, suggesting the existence of a t least three alleles. In general, the strain distribution of activity paralleled the distribution of Mls alleles. However, there was one important exception. Strains CE and RF, which, like CBAJJ, have been typed as Mlsd, were nonreactive with the C3H anti-CBAiJ antibody. The authors favor t h e conclusion that the two techniques which they employed, the serological and the mixed lymphocyte test, revealed distinct though similar alloantigens determined by separate but linked loci. Alternatively, the two methods may be revealing separate mutational sites on one molecule determined by a single locus. A study by Nagy et al. (19761, which shows that H-2 alloantigens may combine simultaneously with the T cell receptor and
300
GEORGE
G.
SNELL
with humoral antibody, and hence must have two combining sites, provides a precedent for the latter interpretation. C . THE Thy-1 ANTIGEN
The Thy-1 alloantigen is, in the mouse, the standard marker for T lymphocytes. The antigen has also been found on cells of mouse brain, epidermis, and mammary gland. A similar antigen occurs in rats, but, since alternative forms have not been found, it is demonstrated with a n appropriately absorbed xenoantiserum. Using such an antiserum, Williams (1976) has reported that the rat antigen, though abundant on thymocytes as in the mouse, occurs in the rat on bone marrow cells rather than peripheral T cells. Thy-1 is thus not a universal T-cell marker. Again in the rat, Lesley and Lennon (1977) have found a transitory expression of Thy-1 on fetal skeletal muscle, and it has been detected on embryo fibroblasts of both rat (Williams et al., 1976) and mouse (Bartlett and Edidin, 1978; Stern, 1973). Barclay et al. (1976) have studied the chemistry of the rat Thy-1. In both thymocytes and brain it is a major membrane glycoprotein of about 25,000 molecular weight of which 30% is carbohydrate. The Thy-1 products in brain and thymus contain similar amounts of each amino acid but have very dissimilar carbohydrate compositions. Because the protein portion of the molecule is hydrophilic in its amino acid composition, it is probable that much of the molecule is exposed on the cell surface.
D. THE Ly ANTIGENSOF T CELLS Murine alloantigens demonstrated by cytotoxic destruction of lymphocytes, other than Thy-1, have been designated by symbols Ly-1, Ly-2, etc. Lymphocyte cytotoxicity provides a simple operational definition similar to the definition used for murine histocompatibility antigens given the designation H and erythrocyte antigens given the designation Ea. Boyse et al. (1977) have proposed splitting the Ly group into two subgroups, Lyb defined as B-lymphocyte alloantigens and Lyt defined as T-lymphocyte alloantigens. I shall follow this practice for newly discovered antigens to which one of the symbols has been applied, but I think it is an unfortunate usage. As we shall see, lymphocyte antigens do not conform to these two neat packages. Because of the complexities, designations applied in a first publication are apt to prove inappropriate. Also there would seem to be little gain in convenience in this additional splitting of symbols.
ADVANCES I N HISTOCOMPATIBILITY IMMUNOGENETICS
301
I consider first new information on Ly antigens reviewed in Snell et al. (1976). Ly-2.1 and 2.2 and Ly-3.1 and 3.2 are two pairs of mutually exclusive specificities determined either by a single locus or two very closely linked loci. No recombinants have been detected. Also it has been reported that both sets of specificities are expressed on a glycoprotein having a molecular weight of approximately 35,000, suggesting that they both occur on the same molecule (Durda and Gottleib, 1976). There is now, however, some evidence that precipitation of reactivity with anti-Ly-2 does not remove all reactivity with anti-Ly-3, suggesting that the specificities are on separate molecules (P. D. Gottleib, personal communication). Only future tests can resolve this problem. The locus (or loci) is very closely linked to an immunoglobulin lightchain variable-region locus, raising the possibility that its product(s) is actually a T-cell antibody. Durda and Gottleib noted, however, that the Ly-2.3 molecular weight is not that of a typical immunoglobulin L chain. Ly-6.2 is an alloantigen defined by a (BALB/c x A)F, anti-CXBD antiserum and by the distinctive CXB recombinant inbred strain pattern BBCCBCB (Snell et al., 1976; McKenzie et al., 1977c,d). No antibody reciprocal to anti-Ly-6.2 has been reported. The Ly-6 antigen was found on kidney cells, but not on red cells, liver, or brain. With respect to lymphocytes, it was found on lymph node cells but not thymus cells. This suggested a B-cell alloantigen, but further studies showed that the antigen, though absent from immature T cells in the thymus, is present on peripheral T cells. Cells treated with anti-Thy-1 and complement and the cells of nude (T-cell-deficient) mice did not react; hence B cells are negative. The antigen thus appeared to have a cellular distribution reciprocal to that of the Tla antigen, which is confined to T cells within the thymus. However, in a study of different T-cell subgroups, while it was possible to demonstrate it on essentially all cytotoxic effector T cells, it was present on only 50-60% of all Thy-l+ cells (Woody et al., 1977). In a subsequent study it was found that while effector T cells were Ly-6+, their precursors were Ly-6-.Both effectors and precursors, as expected, were Thy-l+ Ly-1Ly-2+ (Woody, 1977). The presence of the antigen on effectors and its absence from precursors suggests a similarity to the Ala-1 antigen Section 111, F). Ly-7.2 is an alloantigen defined by a (B6.C-H-2d x CXBGIF, antiCXBK and by the distinctive CXB patterns BCBCBCC. It is easily demonstrated on €3 cells but appears also to be weakly represented on T cells (Snell et al., 1976; McKenzie et al., 1 9 7 7 ~ ) .
302
GEORGE G . SNELL
The T-cell alloantigens Thy-1.1 and Thy-1.2 are usually studied with a C3H anti-AKR and an AKR anti-CSH, respectively. It is known that these antisera may not be monospecific (see Snell et al., 1976). Frelinger and Murphy (1976) found that a C3H anti-AKR (anti-Thy-1.1) reacted with 60-70% of B10 lymph node cells, although this strain is typed as Thy-1.2. Further study of this reaction revealed an antibody that defined a new lymphocyte alloantigen, Ly-8. This is present on both B and T lymphocytes, though whether it is present on all cells of both classes is not yet clear. What appear to be several alloantigens of murine T cells determined by X-linked loci have been reported by Zeicher et al. (1977). The authors were led to search for these antigens because of the existence of a major immune response effect located in the X chromosome (review in Snell et al., 1976). By analogy with the murine l a lymphocyte alloantigen loci, which are in the same MHC region as, or perhaps identical with, the Ir-1 loci, it appeared that alloantigen loci might be associated with the X-linked l r loci. To test this hypothesis, the authors made antisera in several strain combinations of the recipientdonor genetic formula XIoW/Yversus Xlow/Xhlgh,where XloWis the X chromosome of a low responder, and Xhighof a high responder. Recipient and donor mice were F, males and F, females, respectively, from the same low-responder x high-responder cross. If high response is associated with a specific antigen, immunization in such combinations should lead to the production of antibodies reactive with the corresponding high-response strains. In fact, at least four different antibodies were obtained, with specificities labeled 1, 2.1, 2.2, and 3 (Table 1). The authors assume that the antibodies identify three antigens determined by three separate loci. This is a reasonable interpretation by analogy with the H-2-linked l a loci, but proof will require separation of the loci by crossing-over. The designation LyX is proposed for these X-linked loci. Tests were carried out to identify the subpopulation of lymphocytes bearing LyX antigens. The antigens were confined to cells not retained by a nylon wool column. These are predominantly T cells. They were found on lymphocytes of spleen, lymph nodes, and thymus, but not peripheral blood. Helper and effector lymphocytes are circulating lymphocytes, so these results would suggest that the LyX antigens do not characterize these cell types. The authors note that since the X-linked immune response genes act on the response to so-called “thymusindependent antigens,” presumably capable of inducing responses without T-cell help, it is surprising to find LyX on T cells. But as the
ADVANCES IN HISTOCOMPATIBILITY
IMMUNOGENETICS
303
authors also note, the response to one of the antigens used, type I11 pneumococcal polysaccharide, has been shown to be influenced by suppressor T cells and a poorly characterized “amplifier” T cell.
E. THE Ly ANTIGENS OF B CELLS I now come to non-H-2 lymphocyte alloantigens that are predominantly on B cells, or certain classes of B cells. I shall consider only murine B-cell antigens. Walford (1977) has reviewed human B-cell antigens. The first such antigen reported was Ly-4 (Snell et al., 1973b, 1976). Originally, only one specificity, Ly-4.2 of strain C57BL/10, was identified. McKenzie et al. ( 1 9 7 7 ~ )now report the reciprocal antibody, Ly-4.1, in a BIO.A anti-A. Although these antisera are cytotoxic almost exclusively against B cells, the presence of some Ly-4 on T cells was suspected. McKenzie et al. now confirm this by absorption. They estimate, however, that the concentration on spleen cells (which are predominantly B cells) is about 10 times that on thymus cells. Sat0 and Boyse (1976) have reported a new alloantigen of B lymphocytes, which they designate Lyb-2.1. A reciprocal antibody that would identify Lyb-2.2 has not been found. In a variety of tests, Lyb-2 showed a distribution on lymphocytes that was the reciprocal of that shown by Thy-1, the classical T-cell alloantigen. The Lyb-2 locus has been mapped on chromosome 4 about 6.6 centimorgans (cM) from Mup-1 and 14.5 from b (Sato et al., 1977; Taylor and Shen, 1977). A third B-cell alloantigen has been reported, which in some way is related to an X-linked immune-response defect (Huber et al., 1977; %her et al., 1975). The immune-response defect was found in strain CBNN, probably arising originally as a mutant in strain CBNH. CBNN mice are unable to produce a significant antibody response to certain thymus-independent antigens or to produce some of the highaffinity antibodies normally found after immunization with sheep erythrocytes. The associated antigen was identified by a n antibody made by crossing 0 CBNN with 8 BALB/c and immunizing the defective 8 F, with BALB/c spleen cells. Using this combination, the determining locus (though perhaps not the structural locus) is of necessity X-linked. The antigen was present on some but not all purified B cells, but not on bone marrow cells, thymus cells, or purified T cells. It was not found in brain, liver, or kidney. Because it is absent in bone marrow and deficient in spleen cells of young mice, the authors suggest that it may characterize a subclass of mature B lymphocytes. The
304
GEORGE G. SNELL
antigen, designated Lyb-3, seems to be present in all strains except CBNN. There are some indications that strain CBNN lacks entirely the category of B cells that normally bear this antigen. A role for the antigen in the immune response is suggested by its absence in the immunologically defective CBNN strain. Confirmatory evidence comes from the observation that the B cells of normal mice injected with anti-Lyb-3 plus sheep red blood cells in low doses give a greatly enhanced plaque-forming response against the sheep cells (Huber et al., 1977). As a possible explanation of this result, the authors suggest that Lyb-3 is in some way concerned with the triggering by antigen of the particular class of B cells on which it is present. The authors also make the interesting suggestion that anti-Lyb-3 may prove to be useful in enhancing antibody production to non-H-2 histocompatibility and other weak antigens.
F. SOMEMISCELLANEOUS ANTIGENS OF LYMPHOCYTES Feeney and Hammerling (1976,1977) have identified a n alloantigen that appears to be present only on activated B and T lymphocytes. Reciprocal antisera were produced using the H-2k strains C3H and C58. The cells used for immunization were activated prior to injection by exposure to the mitogen PHA. The antisera were multiply absorbed with nonactivated lymphocytes. As thus prepared, they reacted with activated T helper cells, activated T effector or killer cells, and IgM plaque-forming B cells. The antisera did not react with the precursors of these cells. The authors designate the antigens Ala-1.1 and Ala-1.2 (Ala for activated lymphocyte antigen), Ala-1.1 being the form found on strain C3WAn. The strain distribution of Ala-1 (Table l),except for strain 129, is the same as that of Ly-6 (Snell et al., 1976). As we have already noted (Section 111, D) Ala-1 and Ly-6 also are similar in that both are present on T effector cells but absent from the precursors of these cells. This raises the possibility that the two actually are identical. The discordance with respect to strain 129 could be due to the use of different substrains. Only future tests can resolve the questions raised by these findings. However, it is of interest that while anti-Ala-1 is produced with activated lymphocytes and is not removed by absorption with nonactivated lymphocytes, anti-Ly-6 is produced with nonactivated cells. Also anti-Ly-6 shows much more activity with nonstimulated lymph node cells than does anti-Ala-1 (J.A. Frelinger, personal communication). The natural killer (NK) cell is a cell found in the spleens of some
ADVANCES IN HISTOCOMPATIBILITY IMMUNOGENETICS
305
mouse strains, which, without prior immunization, kills in vitro cells of tumors, either isogeneic or allogeneic, induced by the murine leukemia virus. It appears to be a lymphocyte, but is neither a T cell nor a B cell. The surface phenotype is Thy-l-, Ig-, Ly-l-, Ly-2-. The cell is not retained on nylon wool columns. A cell of similar properties has been described under the designation “M” cell (Bennett et al., 1968; Kiessling et al., 1976; Glimcher et al., 1977). Glimcher et al. (1977) have now reported an alloantigen specific for NK cells. The identifying antisera were either a C3H anti-CE (both strains H - 2 k )or a (C3H x BALB/c)F, anti-CE. The C3H anti-CE contained an anti-Ly-1.2; this was removed by absorbing with BALB/c cells. Treatment of spleen cells with these antisera plus complement did not affect the activity of either T helper o r effector cells; it eliminated NK activity of some, but not all, strains possessing this activity. Thus inactivation occurred when B6 or NZB spleen cells were treated, but not with cells of CBNT6, also a killer strain. Strains BALB/c and C3H used in antiserum recipients were of necessity negative, though the latter strain, like CBA, shows NK activity. Whether the antigen is entirely lacking from some NK-active strains or whether it exists in different allelic forms on the active strains is not yet clear. To designate the identified alloantigen, the authors use the provisional symbol NK. Goldschneider (1976) has reported a rat bone marrow lymphocyte antigen (RBMLA) identified by a xenogeneic antiserum. He postulates that the bone marrow lymphocytes bearing this antigen include two different stem cells, each giving rise to a distinct T cell subclass, one a cortical cell and the other a medullary cell.
G. ANTIGENS OF SKINAND LIVER The Sk locus of the mouse determines an alloantigen found in skin and brain. The antigen is demonstrated by the use of chimeric mice. These are produced by injecting neonates with lymphoid cells from a foreign strain. They are then grafted as adults with skin from the chimera donor. The chimeras are of necessity tolerant to nearly all antigens of the donor, but in some strain combinations the skin is rejected (review in Snell et al., 1976). Wachtel et al. (1977) have now found evidence for a second SK-like locus. Mice of a (B6 x A) x B6 backcross generation were made chimeric by irradiation and injection of F, bone marrow and spleen. When grafted with strain-A skin, 71% of the backcross mice rejected their grafts. This suggests the segregation of two loci causing resistance (expected with one locus segregating,
306
GEORGE G. SNELL
5Wo; with two, 75%). There is as yet no information as to the strain distribution of alleles other than that strain A has positive alleles lacked by strain B6. The murine F alloantigen is quite distinct from the other alloantigens that we have been considering, since it may not be a membrane component and is not demonstrated by a n alloantiserum. However, it has interesting properties and we consider it briefly, drawing on studies by Lane and Silver (1976) and Silver and Lane (1977). The F antigen is a n antigen, present in mouse liver, that induces a n autoantibody when injected, using appropriate donor-recipient combinations. Strains fall into two groups, and injections must be between, not within, these groups. Thus either C3H or DBN2 will immunize strain A, producing an antibody that will react with liver of both donor and recipient, but C3H will not induce the antibody in DBN2. Antiserum activity is measured by the ability of presumptive anti-F plus rabbit anti-mouse globulin to precipitate radioiodinated liver extract. The reaction with donor extract is expected, but the antibody also reacts with recipient extract, indicating the presence of autoantibody. The antigen has been purified and has a molecular weight of about 40,000. The interpretation of these results, now generally accepted, is that the F antigen has two reactive sites. The first is a n invariant, tissuespecific site that reacts with the autoantibody. The second is a site that exists in (at least) two forms, permitting an allogeneic response. This site acts as a carrier and is recognized by T helper cells. The helper cells, however, are tolerant to the self form and respond only to the allogeneic form. The stimulation of these T helper cells permits B cells, which are not tolerant to the liver-specific site, to form a n anti-F autoantibody. Unlike some autoimmune reactions, no deleterious effects of a n anti-F response have been observed. Perhaps the antigen is buried. One final point of interest is that some strains do not respond to the alternative form of the antigen. This has been shown to be due to the presence of unfavorable immune response alleles a t Zr-1 and another non-H-2-linked immune-response locus. IV. The Major Histocompatibility Complex (MHC) and Adiacent Loci
The major histocompatibility complex plays an altogether disproportionate role in histocompatibility phenomena, both as a determinant of membrane alloantigens and through its still imperfectly understood influence on immune competence. It has generated a corre-
ADVANCES IN HISTOCOMPATIBILITY
IMMUNOGENETICS
307
spondingly voluminous literature. The MHC of various vertebrates has been thoroughly reviewed in a recent volume (Gotze, 1977). H-2, the murine MHC (chromosome 171, is divided into five closely linked regions, K, I , S, G, and D, each defined by one or more loci. We consider first some loci outside the H-2 complex as thus defined. In the cellular distribution of their products, some of these are reminiscent of the L y loci considered in the preceding section. While not now treated as part of the MHC, there is increasing evidence that they should be. LOCIADJACENT TO A. SOME
THE
H-2 COMPLEX
Tla is a locus 1.5 cM outside of and distal to (relative to centromere) the D end of the H-2 complex. Its product is found on thymocytes, but not on mature T cells which have left the thymus (review in Snell et al., 1976). Studies have now established chemical similarities between the H-2K and H-2D and the Tla (also referred to as TL) gene products. All are composed of major components of about 45,000 MW and a minor component (µglobulin) of 12,000 MW, though it is uncertain whether the major components are always accompanied by p2microglobulin (Uhr et al., 1977). Peptide mapping shows chemical similarities between the H-2 and the Tla major components. The Tla antigeds), however, appeared more polydisperse than the corresponding H-2 product (Cunningham et al., 1977). Possibly this means that the antisera were picking up more than one H-2-like gene product. Recent studies have shown that there are, indeed, multiple H-2-like loci in the Tla region. The keys to their detection were four strains carrying haplotypes derived from crossovers in the H-2D-Tla interval. The strains are: A-Tlah (Tlah from B6 on an A-strain background), B6-Tla", and B6.Kl and B6.K2 derived from an AKR x B6-H-2k cross. Antisera derived from these strains and their congenic partners and tested on the recombinants plus a panel of inbred strains have revealed three loci, Qa-1, Qa-2, and Qa-3, in the indicated interval. In each case only one specificity, and hence one allele, has been identified (hence the use of + and - in Table 1 to represent the results). As yet, however, there has been no real search for the reciprocal antibodies. The crossover giving rise to the B6.Kl haplotype separated Qa-1 and Qa-2, so the evidence for these loci is very clear. The B6.K2 crossover was farther to the right and separated the Qa-l-Qa-2 interval from Tla. The evidence for Qa-3 comes from antisera made in the B6.Kl anti-B6 combination. Strain distribution, tissue distribution, and absorption studies with these B6.Kl anti-B6 revealed two antibodies, one ofwhich
308
GEORGE G . SNELL
appears to identify a third locus, &a-3, close to &a-2. These antisera could have contained the reciprocal of the anti-Qa-l+,but the authors seem to have found no indication of this antibody (Stanton and Boyse, 1976; Flaherty, 1976; Flaherty et al., 1978). Tissue distribution studies show that the Qa antigens, like Tla, are markers for specific subpopulations of lymphocytes, and primarily of T lymphocytes. &a-1 is present on thymocytes and a subpopulation of peripheral T cells, probably not on B cells. Qa-2 appears, like Thy-1, to be characteristic of T cells in general, but to be also on a small population of Thy-1-negative cells especially abundant in the spleen. Qa-3 is confined to a subpopulation of peripheral T cells. All three antigens are absent from brain, kidney, and liver. A chemical study showed the &a-2 gene product to have a molecular weight of 43,000, quite similar to that of the H-2 gene products, and like these products, to be associated with µglobulin. The amount on the surface of lymph node lymphocytes was only about one-tenth that of H-2 (Michaelson et al., 1977). An anti-H-2.28 antiserum made in the strain combination (A.CA x B1O.BR) anti-A.SW apparently contained anti-Qa antibodies (Flaherty et al., 1978). A partial strain distribution of the &a specificities is given in Table 1. Another locus of a quite different sort, Pgk-2, which determines the testicular form of phosphoglycerate kinase, has now been located in the Tla region (Eicher et al., 1978). There are three alleles of this enzyme locus, each determining a product of different electrophoretic mobility. Linkage studies showed close linkage with H-2. The B6.Kl and B6.K2 recombinants place it to the right of &a-1 and &a-2, and hence close to Tla. Its position relative to Tla is unknown, but both linkage data and information from H-2 congenic strains, where it almost always manifests the allele of the introduced segment rather than the background allele, show that it cannot be far to the right. The strain distribution pattern (Table 11, like that of &a-2 and &a-3, shows a considerable correlation with H-2 haplotype. Womack and Eicher (1977) have identified still another enzyme locus, liver-specific lysosome acid phosphatase deficiency (Apl) on chromosome 17 about 7 cM to the right of Fgk-2. Two new minor histocompatibility loci have been located to the left (centromere end) of H-2. H-33 (Flaherty, 1975) is very weak, the median survival time of skin grafts being of the order of 50 days. It appears to be closer to T than to H-2. H-39 (Artzt et al., 1977) is very close to T, no recombinants having been found, and survival time of
ADVANCES I N HISTOCOMPATIBILITY IMMUNOGENETICS
309
grafts ranges from 16 to 37 days. Egorov et al. (1977b) have reported a histocompatibility locus within the right end of, or to the right of, H-2. The key strains were BlO.A(5R) and BlO.D2(R107), which are identical throughout most o f H - 2 , including H-2D, but probably differ a t Tla. Grafts made in one direction were rejected with a mediaasurvival time of 27 days; grafts made in the other direction survived > l o 0 days. The relation of this locus to H-31 and H-32 remains to be determined.
B. THEH LOCI The classical histocompatibility or H loci of the H-2 complex are H-2K and H-2D, located at its respective left and right ends. These also are the loci whose products were first demonstrated by alloantisera, and are the source of much of the serological complexity of H-2. The last two years have seen some important advances in our knowledge of these loci. 1 . The Achievement of Monospecific Antisera
It is appropriate to consider first a major technical advance. The ideal antiserum for many purposes is a monospecific antiserum, but because of the complexity of the MHC it is usually difficult even to approximate this ideal. Galfre et al. (1977) have now shown that it is possible to generate alloantibody-producing cell clones whose product is truly monospecific. This was achieved by using the capacity of Sendai virus to cause cell fusion. A neoplastic mouse plasma cell (myeloma) was fused with spleen cells from A 0 rats immunized against DA donors, and clones thus derived selected over a period of time for the production of anti-DA antibody. Several alloantibodyproducing plasma cell clones were established, each producing a slightly different antibody, but all directed against DA MHC antigens. This technique has not yet been applied to mice, but it should be possible to do so. One of these antisera yielded interesting information in regard to the distribution of the target antigen on rat lymphocytes. In the chromium release cytotoxic assay, the 51Crrelease from heterozygous targets was only about 45% that from homozygous targets, with a marked plateau a t the 45% level. This suggests that only half the cells were being lysed, and hence that in the heterozygous lymphocytes there was allelic exclusion in the expression of the target MHC antigen. If confirmed, this would establish an important similarity between MHC genes and immunoglobulin genes.
310
GEORGE G . SNELL
2. Similarity of H L A Antigens to the Immunoglobulins That the MHC products and the immunoglobulins are indeed similar is indicated by a chemical study of the human HLA antigens (Parham et al., 1977). Amino acid sequencing showed similarities between the HLA-A and HLA-B antigens and the variable regions of the human immunoglobulin heavy chains. There was also evidence that the HLA products, like the immunoglobulins, are divisible into domains. A homology between the two categories of determining loci is indicated. 3. The H-2L Locus Another development of importance is a growing body of evidence that two closely linked loci at the D end of H-2 can be defined by classical H-2 antisera. One of the loci determines the mutually exclusive public specificities H-2.1 and H-2.28; the product of the other bears the private specificities and most or all other public specificities. The 1-28 locus has been given the designation H-2L; the other locus retains the H-2D designation. The history and properties of specificities 1and 28 are given in Snell et al. (1976). They appear to show minor differences from allele to allele and can only be defined in terms of a family of antibodies. Snell et al. (1973a) postulated that 1 and 28 are allelic and are determined by a n antigenic site distinct from the site determining the private specificities. One of the methods that has been used to show that specificities 1and 28 define a distinct molecule is the use of cocapping. Capping of a cell surface alloantigen is demonstrated by treating T lymphocytes first with a n alloantiserum and then with a fluorescent-labeled goat antimouse Ig. If two molecules are being studied, different fluorescent labels are used. With this technique it has been shown that while capping of 28 or 1 causes concomitant capping of the D-end private specificity of the particular strain employed, capping of the private specificity leaves substantial 1 or 28 still distributed over the cell surface (Lemonnier et al., 1975; Morello et al., 1977; Neauport-Sautes et al., 1977a). This phenomenon is not seen with other public specificities. Thus, capping of H-2.4 does produce concomitant capping of H-2.3, H-2.5, H-2.35, and H-2.36. A question that can be raised concerning this type of experiment is whether the failure of anti-4 or other anti-D-end private specificity antisera to cap 28 is due to the presence of contaminant antibodies in the 28 antisera. Demant and co-workers were able to show that anti-Ia
ADVANCES IN HISTOCOMPATIBILITY IMMUNOGENETICS
311
antibodies in the anti-28 were not the cause of the phenomenon (Morello et al., 1977). Anti-Qa antibodies (Flaherty et al., 1978; reviewed in Section 111) are another possible suspect, especially since Flaherty et al. found these antibodies in one anti-28 antiserum. However, this problem would not apply to anti-l sera, where the donors used in the production of the antisera are Qa-negative, and the phenomenon was seen with a n anti-28 in which Flaherty et al. did not detect anti-Qa. Further evidence of the separateness of anti-28 has been provided by chemical studies demonstrating that 28 and the D-end private specificity 4 are on separable molecules, both of about 45,000 MW (Neauport-Sautes et al., 197713; Hansen et al., 1977a). One unexpected feature of the Neauport-Sautes study was that, contrary to the capping results, precipitation with anti-28 did not precipitate all the H-2.4bearing molecules. Additional evidence concerning the H-2L locus comes from the study ofH-2 mutants (McKenzie et al., 1977a).H-2dbis a loss mutation that occurred in strain BALB/c (H-2d).Skin grafts from H-2dto H-2db show a rather strong rejection; skin grafts made in the opposite direction are accepted. Complementation studies map the altered locus a t the D end ofH-2. The loss of histocompatibility is accompanied by the loss of the 28 family of specificities characteristic of H-2D. The mutant fails to react with an anti-28 antiserum, and immunization 0 f H - 2 with ~ ~ H-2" tissues leads to the formation of anti-28. H-2.4, the private specificity ofH-2Dd, is unaltered. It is interesting that specificities 27 and 29 have disappeared with 28, confirming the interpretation of Snell et al. (1973a) that these are determined by a single antigenic site. Other public specificities are unchanged. McKenzie et al. (1977~)find on the basis of complementation tests that the H-2D mutant H-2da(Egorov, 1974; also called M504) also involves the H-2L locus. This is a gain-loss mutant; graft rejection occurs in both directions and new public specificities have been both gained and lost. Surprisingly, in review of the evidence of McKenzie et al. that H-2Ld is the site of the change, Egorov's studies indicate that H-2.4, the private specificity determined by H-2D" is also modified (review in J. Klein, 1975). The mutant, like all strains with H-2D", reacts with anti-4, but it lacks a specificity, H-2.40, defined by an H-2Dda anti-H-2Dd antiserum, which has the same strain distribution as H-2.4. Also, while the reaction of the mutant with anti-4 appears to be unimpaired, the reaction of a recombinant derived from the mutant is quantitatively reduced. A possible interpretation is that H-2.40 is a
312
GEORGE G . SNELL
private specificity of the H-2Ld antigen. Whatever the ultimate explanation, these results emphasize again the importance of' mutants as a source of fundamental information about the H-2 complex. Hansen et al. (1977131, using sequential precipitation of soluble BALB/c (H-2d)antigen with H-2 antisera, found three separable molecules of 45,000 molecular weight. The three molecules were presumably H-2K, H-2D, and H-2L. In the H-2dbmutant, the molecule corresponding to H-2L was absent, or a t least undemonstrable. Studies of recombinants mapped the H-2L locus to the right of the S region and to the left of Qa-2. The situation in regard to specificities H-2.1 and H-2.28 is complicated by the presence of these specificities, or a t least of cross-reacting products, in H-2K (Murphy and Shreffler, 1975; Snell et al., 1974). Whether they occur in H-2D is uncertain. The apparent lack of anti-28 reactivity in the H-Zdbmutant (McKenzie et al., 1977a) would seem to say that they do not, or a t least that if they are present it is in a weak or aberrant form. But if H-2D lacks 28, then the cocapping of H-2D by anti-28 sera has to be explained. Clearly, a great deal of work remains to be done on this problem. Snell et al. (1973a) have suggested a possible homology between specificities 1 and 28 in the mouse and the human Bw4 and Bw6 (originally called 4a and 4b). Oliver and Festenstein (1975) have described haplotypes in Caucasoid and Negroid populations, and they suggest that these may indicate the occurrence of a low order of recombination between HLA-B and HLA-C and the determinant for Bw4 and Bw6. This observation suggests that Bw4 and Bw6, like 1 and 28, are determined by a n independent locus. Much more evidence, however, will be required to establish this. An alternative hypothesis is that H-2L is the homolog of the human HLA-C. However, these loci are serologically quite dissimilar in that HLA-C determines a number of distinct private specificities whereas H-2L does not. Or a t least H-2L determines no presently identifiable private specificities. It is possible that there are H-2L private specificities, but, because of the absence of crossovers, they are masked by the H-2D private specificities. An analogous situation has existed in the case of H-2K and H-2D in those haplotypes where crossovers are unknown or unanalyzed. 4 . H-2 Mutants H-2 mutants continue to be an important source of information about the H-2 complex. The subject has been reviewed by J. Klein (1978). Most mutants have been assigned to the H-2K and H-2D loci, but we saw in Section IV,B,3 that two of them, H-2"" and H-2"", have
ADVANCES IN HISTOCOMPATIBILITY IMMUNOGENETICS
313
occurred at the newly identified H-2L locus. Since H-2 mutants are detected by skin grafting, it perhaps is not surprising that they are concentrated in the major histocompatibility loci, but it may also be that these loci, particularly, perhaps, in some of their allelic forms or on some genetic backgrounds, are highly mutable. It has become something of a dogma in the literature that the histocompatibility changes of the mutants are often unaccompanied by a serological change. Of 8 intensively studied mutants listed by Snell et al. (1976, Table 6.8), 6 were reported as involving no serological change or at most (2 cases) minor quantitative changes. Recent analyses, however, have shown that 3 of these, H-2b"(Mnatsakanian et al., 19771, H-2db(David et al., 1977a; Mnatsakanian et al., 19771,and H-2k"(Klein et al., 1976b) do involve serological changes. David et al. found substantial changes in the H-2dbmutant; the other changes were minor. These results suggest that, while there may be an inherent difficulty in detecting serological modifications in these truly coisogenic situations, they can often or always be found if enough combinations are tried. When "serologically identical" mutants are analyzed by their interaction with T effector lymphocytes in cell-mediated lysis, diversity is easily detected. Nineteen specificities could be identified that distinguished strain C57BL/6 (H-29 and three H-2Kbmutants derived from it (Melief et al., 1977).The stimulation of B lymphocytes and T effector lymphocytes following exposure to most antigens requires the assistance of T helper lymphocytes reacting with a different antigenic site (the carrier site) on the same antigen. Ia antigens have been shown to possess separate sites with which T helper cells and anti-Ia alloantibody can react, and H-2 antigens to have separate sites with which T effector cells and anti-H-2 alloantibody can react (Nagy et al., 1976; review in Snell, 1978). In the light of these facts, it is important to know whether mutant antigens, with their somewhat more restricted immunogenicity in the congenic partner, differ from the parent antigen at more than one site. Studies by peptide mapping of the H-2bnand H-2bdmutants indicate that the mutations apparently do generate alterations in more than one site in the H-2Kbmolecule, though in the case 0 f H - 2the ~ ~alterations are confined to one fragment of about 8000 daltons (Nathenson et al., 1977). Even in H-2b",the differences from H-2bare slight compared to those distinguishing most H-2K and H-2D alleles (Nathenson et al., 1976). 5. The Bodmer Hypothesis
Bodmer (1973) has suggested a model for the major histocompatibility antigens of the MHC quite different from the one generally as-
314
GEORGE G. SNELL
sumed. He postulates that the great polymorphism of these antigens is not due, or a t least not primarily due, to a multiplicity of alleles, but is due rather to a multiplicity of structural loci, only one of which, however, is expressed in a given H-2 haplotype. This hypothesis obviously assigns a major role to a regulatory locus. This, presumably, would be the locus that is mapped by conventional genetic tests and would possess multiple alleles concerned with determining which structural gene is turned on. This hypothesis has received some support from studies that seem to show, by serological tests with H-2 antisera, that a variety of mouse tumors carry unexpected H-2 antigens (e.g., Garrido et al., 1975,1976; Martinet al., 1976, 1977). In one case (Garrido et al., 19761, “derepression” of Ia-like as well as of H-2 specificities was reported. This would suggest that if the Bodmer hypothesis is valid for the H-2K and H-2D loci, it must also apply to the l a loci. In another case (Garrido et al., 19751, the unpredicted H-2-like specificities appeared only after vaccinia virus infection. In some cases a number of unexpected H-2 private specificities seem to have appeared. A possible explanation of this apparent “derepression” of H-2 specificities is provided by the presence in widely used H-2 antisera of antibodies against viral antigens (P. Klein, 1975; Nowinski and Klein, 1975). Endogenous viruses are so ubiquitous in mouse strains that it is scarcely surprising to find that antisera made against normal cells taken from healthy, H-2-disparate mice carry antiviral as well as anti-H-2 antibodies. If certain viral antigens appeared on tumor cells of mice that would normally not manifest these particular antigens, a n apparent “derepression” would result. The authors of the derepression studies were of course aware of this phenomenon and believed that they had used controls necessary to rule it out as a n explanation of their observations. However, definite contrary evidence has now been found in two studies. Flaherty and Rinchik (1978) used antisera from the same source as that employed by Garrido et al. (1976) and one of the same tumors, a lymphoma of C57BW6 origin. They found some of the same “derepression” seen by Garrido et al., but were able to remove the reactions by absorption with normal C57BL/6 spleen cells. They suggest three possible explanations. (1)The anomalous specificities may be virus determined and present on both normal and malignant lymphoid cells, but much more strongly expressed on the tumor than in normal spleen. (2) The anomalous reactions may be due to H-2 specificities shared by C57BW6 and the H-2-disparate tissue donor, but so weakly expressed
ADVANCES IN HISTOCOMPATIBILITY IMMUNOGENETICS
315
on C57BL/6 that they have not previously been detected. (3) The reactions may be due to antibodies in the antisera that are directed not against H-2 antigens, but against Tla or other H-2-associated antigens. Zinkernagel et al. (1977b) likewise failed to find evidence of H-2 derepression. These authors used a quite different system: crossreactions in cell-mediated lysis between isogeneic virus-infected cells and allogeneic uninfected cells. Effector cells primed against H-2 disparate cells did not react with isogeneic infected cells, and cells primed against isogeneic infected cells did not react against uninfected H-2 disparate cells. No unexpected H-2 specificities could be demonstrated as a result of viral infection. It was not possible to test the variety of H-2 haplotypes used in the serological tests, but three different viruses were tested. In view of this contrary evidence, we are justified in viewing the Bodmer hypothesis as a rather unlikely possibility. 6. MHC Polymorphism in Wild Mice and Rats Klein and co-workers have continued their analysis of the H-2 complex in wild mice (Zaleska-Rutczynska and Klein, 1977; Klein and Zaleska-Rutczynska, 1978). Their data are based on the serological and histogenetic analysis of 16 congenic strains derived by backcrossing H-2 complexes from wild mice onto the B10 inbred background. Most of the wild mice were trapped in barns or corn cribs in the Ann Arbor area. The 16 ancestral animals came from 9 farms or homes and from 12 separate structures. Thus in a number of cases more than one mouse came from the same very restricted area. Despite this, H-2 diversity rather than uniformity was the rule. Of 18 known private specificities for which the lines were tested, 5 were found to be present in one, two, or three lines and one showed cross-reactions. Ten new haplotypes were distinguished by these serological tests; when analysis by skin grafting and cell-mediated lysis were added, the number was raised to 14. One line carried the haplotype H-2" of the inbred SM strain. Two mice caught in the same barn had the same wild haplotype. Twelve new H-2K alleles and 14 new H-2D alleles out of a possible 16 appear to have been identified. Many new serological specificities, both private and public, were present; 16 were definitely identified. Pizarro et al. (1977) have obtained similar results with wild mice trapped in Santiago, Chile. Private specificity H-2.4 was not found in wild mice in either study; private specificities 2, 19, and 23 were found in wild mice of both groups. In a study of the major histocompatibility antigens of wild rats
316
GEORGE G. SNELL
trapped in two locations in the continental United States, quite different results were obtained (Shonnard et al., 1976). The serological specificities in the wild populations were essentially the same as those already known in inbred rats. Similar results were obtained with wild rats trapped in France and England (Cramer et al., 1978). While some of the refinements used by Klein and co-workers were not used in these studies, it would seem to show beyond reasonable doubt that the MHC of wild rats is far less polymorphic than that of mice. These results have interesting implications for the Bodmer hypothesis. The results with mice imply that, under this hypothesis, there must be many H-2K and H-2D structural loci or many alleles at each locus or, more probably, both. But the rat results, interpreted according to Bodmer, point to few loci and few alleles. Can it be that major histocompatibility loci have been lost in the rat? On the whole, the wild population data would seem to be more compatible with the conventional interpretation of the MHC. The great difference between mouse and rat might be explained, a t least in part, by the presence in the mouse H-2 linkage group of the T complex with its remarkable combination of lethality, crossover inhibition, and segregation distortion. This, as pointed out by Snell (19681, serves as an effective device for maintaining heterozygosity in the T-H-2 interval.
7 . Some Miscellaneous Observations concerning the Major H A n tigens While it is clear that MHC alloantigens are present on the cell surface as components of the plasma membrane, their presence on internal membranes has been the subject of dispute (review in Snell et al., 1976). Pegrum et al. (1977) have now reported that HLA antigens can be demonstrated on the isolated nucleus. These nuclear HLA-A and HLA-B antigens appear to combine with their corresponding antibodies with particular avidity. The human counterparts of the murine Ia antigens also were demonstrable, though in a form without unusual binding properties. There have been a number of reports of cross-reactions between HLA or H-2 antigens and streptococcal membrane antigens (review in Snell et al., 1976). Tauber et al. (1976) now question this. Their evidence suggests that the apparent cross-reactions are due to nonspecific complement activation by streptococcal structures. Immunological enhancement is the promotion of the growth of allografts by alloantibodies directed against the graft. Similar promotion may be produced by antigen-antibody complexes or, in the case of isografts of chemically induced tumors, by short-lived anti-graft serum
ADVANCES IN HISTOCOMPATIBILITY IMMUNOGENETICS
317
factors probably of host origin and probably not ordinary antibodies, but otherwise as yet poorly characterized (Nepom et al., 1977). Enhancement may occur across either MHC or non-MHC barriers, but from the point of view of its exploitation in organ grafting, is obviously especially important in the case of MHC disparities. The subject is briefly reviewed in Snell et al. (1976). Cohen and Wekerle (1977) have discussed possible mechanisms. The first studies aimed at evaluating the importance in enhancement of antibodies against specific regions of the H-2 complex indicated that anti-Ia antibodies play a special and perhaps exclusive role (reviewed in Snell et al., 1976; McKenzie and Henning, 1977). Davis (1977) has now shown that the survival of heart allografts in mice can be substantially enhanced with an anti-H-2D. Also Jeckel et al. (1977), using kidney allografts in rats, have demonstrated enhancement with antibodies reactive with red blood cells. Since blood cells carry the major H antigens but not Ia antigens, this was taken to mean that anti-Ia antibodies were not involved. The reason for the discrepant results is not clear, but it would seem that a greater diversity of antiMHC antibodies can participate in enhancement than was at first supposed. A secondary response can be demonstrated in the mixed lymphocyte reaction (MLR)just as it can be in many other immune phenomena. In the course of studies of the MLR secondary response, Fathman and Nabholz (1977) found that homozygous responder cells, primed by stimulation with F, cells, responded better to restimulation with F, cells than to restimulation with cells from the other parent. This was surprising, since cells from the other parent, being homozygous, would present the foreign parental antigens in more concentrated form than would the F,. From this and other evidence, the authors conclude that lymphocytes from F, mice heterozygous at H-2 carry antigens not represented in either parent. At least two loci within the major histocompatibility complex (not necessarily H loci) appear to be involved. Hybrid antigens have been known in other species (e.g., pigeons and cattle) for a long time. It is interesting that they now appear to have been found in mice. Some curious deficiencies in the major histocompatibility antigens have been reported in an immunodeficient human infant and in presumably normal laboratory populations of hamsters. The human infant was a 6-month-old boy with partial combined immunodeficiency who died shortly after the study was completed (Betuel et al., 1978). The immunodeficient symptoms were lymphopenia, the presence of only 1oo/o T lymphocytes and 12% Ig-bearing
318
GEORGE G. SNELL
B lymphocytes, and a near absence of bone marrow cells susceptible to in vitro transformation into T lymphocytes under the influence of thymic factors. HLA typing failed to reveal HLA-A or HLA-B (the human counterparts of H-2K and H-2D) on lymphocytes, but these as well as µglobulin were present in serum. Since the child's cells stimulated when tested in mixed lymphocyte reactions, HLA-D antigens (the human counterpart of the murine Ia) presumably were present. The study of the presumed MHC of hamsters (Duncan and Streilein, 1978) was based on tests with five inbred strains. A gene (or group of closely linked genes) was shown to determine skin graft rejection, graft-versus-host reactivity, mixed lymphocyte reactivity, and, with a t least one antigen, the capacity for a n immune response. These, in other species, are the properties of the MHC. But, curiously, no antigens comparable to the mouse H-2K, H-2D, or Ia could be demonstrated serologically. The locus (loci) revealed by these studies was called Hm-1. Departures of this sort from the expected norm for MHC constitution will doubtless tell us in due course a good deal about MHC function, but a t the moment they are largely curiosities.
C. THEla LOCI The murine Ia antigens, determined by loci in the I region of the H-2 complex, play a vital but still poorly understood role in immune phenomena. They are currently the subject of intensive research. I can give only a few highlights here. Reviews will be found in David (1976, 1977), Murphy et al. (1977), and Shreffler et al. (1977). Five subregions of the Z region, Z-A, I-B, I-J, I-E, and I-C, are now distinguished (Shreffler et al., 1977). These have been mapped by studies of the expression of both immune response (Ir-1)loci and l a loci in various H-2 recombinants. It is not certain that all five regions determine Ia antigens. However, the important fact has emerged that Ia antigens from different regions are associated with different categories of lymphocytes. Thus Z-A products are expressed both on B cells and on T cells with an enhancing or helper function, and I-J products on suppressor T cells (Murphy et al., 1977; Okumura et al., 1977). Ia antigens, in one or another of their forms, besides being present on most and possibly all lymphocytes, are present on fetal liver, macrophages, epidermal cells, and spermatozoa. Winchester et al. (1977)
ADVANCES I N HISTOCOMPATIBILITY IMMUNOGENETICS
319
now add the observation that, in man, Ia-like antigens are present on granulocytes during the early phases of differentiation. Klein et al. (1977), in analysis of MHCs derived from wild mice, found Ia specificities not known in inbred stocks. They conclude that the l a loci, like the major H loci, are highly polymorphic. Silver et al. (1977) have isolated Ia antigens from mouse spleen cells. The alloantisera used in the isolation were directed against products of the I-A subregion. Two molecules were obtained, an a chain of approximately 37,000 MW and a p chain of 28,000 MW. The a component showed considerable molecular-weight heterogeneity. Preliminary amino acid sequencing data failed to show obvious homologies either between the two chains or between them and the major H antigens or the immunoglobulins. Schwartz et al. (1977) have isolated Ia antigens from mouse thymus cells carefully freed of Ig-positive elements. These were presumably pure T lymphocytes; in the study of Silver et al., the Ia presumably came preponderantly from B lymphocytes. The antigens thus prepared consisted of two chains of 33,000 and 25,000 MW. While Ia antigen is thus clearly present on T cells, the authors calculate that the amount present on such cells may be only W O O that on the B cell category. The methods used do not permit assigning the isolated antigens to any particular I subregion. Klareskog et al. (1977) have isolated human counterparts of the murine Ia antigens and find molecular weights of 34,000 and 28,000. There was an indication from their data that one of the chains was not coded for by the HLA complex, but Silver et al. found no comparable evidence in mice. Freed and Nathenson (19771, in a study of the carbohydrate components of Ia antigens, found them to be very similar to the carbohydrate elements of the H-2K and H-2D products and very similar among themselves, irrespective of their probable I-region origin. This report of uniformity in Ia carbohydrates contrasts with evidence that there are oligosaccharides in mouse serum bearing a variety of Ia specificities (Jackson et al., 1977; McKenzie et al., 1977b). Jackson et al. also found a high molecular weight compound (approximately 500,000 MW) with Ia activity in the serum. Davidet al. (197713) were unable to confirm these results. Only future studies can determine the reality of the serum Ia oligosaccharides, but if, indeed, there are carbohydrates with Ia specificity, the possibility is thereby opened that Ia gene products function as glycosyl transferases (McKenzie et al., 197713). I cannot go into the history of this concept, but it has attracted considerable support.
320
GEORGE G. SNELL
There have been several reports of histocompatibility loci in the I region of H-2. A particularly thorough study has been carried out by Klein et al. (1976a). The study was based on congenic recombinant strains so selected as to permit the exchange of skin grafts between pairs of mice differing only a t restricted portions of the I region. Two H loci were identified. The first, H-2A, in the I - A subregion, is a strong H locus. Grafts across an H-2A disparity were rejected in less than 3 weeks. The second, in I-C, was called H-2C. Grafts across a n I-C barrier were rejected much more slowly, and some were still in place a t 100 days. Graft rejection in both cases was accompanied by the formation of anti-Ia antibody. It is known that Ia antigens, or a t least some l a antigens, are present on epidermal cells. The anti-H-2C obtained by graft rejection reacted with such cells. When the same strain combinations which produced graft rejection were tested in vitro for the occurrence of cell-mediated lysis, there was parallelism in the strength of the in vivo and in vitro responses. Klein et al. conclude that Ia antigens determined by the I - A and I-C subregions function also as histocompatibility antigens and as targets in cell mediated lysis.
D. THE T COMPLEX The T complex is a group of loci concerned primarily with early development and linked to and showing interesting interactions with H-2 (reviews in Snell et al., 1976; Klein and Hammerburg, 1977). Many lethal (t9 alleles, most of them from wild populations, are known. Early studies were entirely genetic and embryological, but more recently it has become possible to study the T antigens serologically. Anti-T alloantisera can be produced by the injection of sperm, which carry the antigen. After appropriate absorption, these react specifically by dye exclusion with the sperm of particular t haplotypes. Antisera also have been produced against a n undifferentiated teratocarcinoma (Stevens, 1967; Jacob, 19771. These antisera identify an antigen, F9, which has been shown to be a T gene product. It can be demonstrated by direct cytotoxicity and by immunofluorescence on cells of early embryos and of spermatogonia and spermatocytes (Dubois et al.,1976). Artzt and Bennett (1977) have shown that the T antigens are serologically complex. Antisera were produced against spermatozoa and then appropriately absorbed, first to remove sperm autoantibodies and then to remove one or more of possible T-antigen alloantibodies. The analysis of only three cross-reacting T haplotypes revealed six specificities, the maximum number demonstrable with this number of
ADVANCES IN HISTOCOMPATIBILITY IMMUNOGENETICS
,321
haplotypes. T complex recombinants, already identified by differential expression of different t alleles, were shown to determine different specificities. Two loci were thereby serologically proved. The 2' complex thus resembles the H-2 complex in both genetic and serological complexity. The F9 antigen resembles the H-2K and H-2D gene products in that it consists of two molecules, a major component of about 44,000 MW and a minor component of 12,000 MW. It was originally thought that the minor component was the same µglobulin molecule that is part of the major H antigen, but it now appears that this is not the case (Vitetta et al., 1975; Dubois et al., 1976). Although µglobulin probably is not a component of the T antigens, it does appear in early embryos carrying the T antigens but as yet lacking H-2 antigens (Dubois et al,, 1976; Hakansson and Peterson, 1976). One indication of some sort of important interrelationship between T and H-2 is the apparent sequential appearance of these two antigens. That this sequential appearance is a consistent and general phenomenon is not yet firmly proved, but it does appear increasingly probable. One problem is that there are different T antigens that function at different stages of development; hence T antigens might be turned off and H-2 antigens appear at different times on different cell lineages. The clearest evidence for sequential appearance comes from the study of teratocarcinomas. The less differentiated teratocarcinomas consistently manifest T but not H-2, whereas the reverse is the case among the more differentiated teratocarcinomas. Also in a teratocarcinoma, ND ,,which is able to differentiate in uitro, the disappearance of the F9 antigen and the appearance of H-2 antigens can be recorded as a function of time (Forman and Vitetta, 1975; Dubois et al., 1976). In these teratocarcinomas, µglobulin occurs only in association with H-2, and its presence is also antithetical to that of the F9 antigen. Kemler et al. (1977) report evidence that the F9 antigen plays a role in early development. In this study, F9 was identified by a xenoantiserum instead of the usual mouse anti-F9. The antiserum was a rabbit anti-F9-bearing teratocarcinoma massively absorbed with lymphocytes to remove species-specific antibodies. It reacted with F9 cells and with %cell embryos as tested by indirect immunofluorescence. The reaction was blocked by prior treatment with mouse anti-F9. Comparable antisera made against mouse lymphocytes, liver, and skin, and also reactive with &cell embryos, were used for purposes of comparison. Fab fragments of the anti-F9 added to cultures of very early cleaving mouse embryos, while not hindering cleavage, prevented the formation of compact morulae and blastocysts. The effect could be
322
GEORGE G. SNELL
reversed by washing. Reorganization and subsequent normal development then occurred. The effect was not produced by divalent anti-F9 antibodies, or by any of the other sera tested, either as Fab fragments or intact immunoglobulins. Also it was not produced by mouse anti-F9. The need for using the xenogeneic antiserum leaves some doubt as to whether the effect on development is due to anti-F9 activity, but the capacity of the mouse anti-F9 to block binding of the xenoantibody does suggest that the same molecule is involved. If this is indeed true, the molecule evidently plays a n important role in early development. Studies by Klein and co-workers (Hammerberg and Klein, 1975; Hammerberg et al., 1976; Hauptfeld et al., 1976; Klein and Hammerberg, 1977) and by Levinson and McDevitt (1976) have established that a major linkage disequilibrium exists between the T and the H-2 complexes. Since T and H-2 are separated by about 1 5 cM, such a disequilibrium is quite unexpected, but the significance of the loose linkage is somewhat reduced by the ability of some t alleles to suppress crossing over in the T-H-2 interval. Mice from a variety of sources bearing many different t alleles were tested for H-2 serotype or for ability, in different combinations, to give a mixed lymphocyte reaction, a manifestation of H-2. There was a striking though not invariable association between particular t complementation groups and particular H-2 haplotypes. The t complementation groups are groups of lethal t alleles that show intragroup similarities in their effect on development and a tendency to produce partly or completely normal development when crossed. Six such groups have been identified. In the great majority of cases, the H-2 haplotype found with a particular complementation group in one stock was found with this same complementation group in other stocks. Despite the wide separation of T and H-2, the linkage disequilibrium was quite comparable to some of the strong disequilibria that have been demonstrated within the HLA complex in man (Snell et al., 1976). The meaning of the disequilibrium is unknown, but it must point to some important interaction between T and H-2. A family with congenital spina bifida showing dominant inheritance and linkage with HLA was reported by Amos et al. (1975). Because some T alleles cause vertebral abnormalities in the caudal region, the spina bifida locus is a likely candidate for the human homolog of T . Fellous et al. (1977) have now reported another family transmitting a similar trait, again in linkage with HLA. The recombination frequency in the two families is of the same general order as that between T and H-2.
ADVANCES I N HISTOCOMPATIBILITY IMMUNOGENETICS
,323
V. Immune-Response Genes
Immune-response genes are now receiving a great deal of attention. Interest still centers on the Ir-1 loci in the I region of the H-2 complex, but the importance of a number of loci outside the H-2 complex is well established. There are indications that some of the loci are determinants of, or produce a product in some way associated with, antigen recognition structures. Thus there are indications that the Zr-1 gene products react with or “recognize” different amino acid sequences with a considerable specificity (Seaver et al., 1976). However, the mechanism of action of the various immune response loci is still largely obscure. The recent literature is much too extensive to be treated thoroughly in this review. A volume edited by Katz and Benacerraf (1976) deals with the role of the MHC in immune responses. I shall confine this review to the role of immune-response genes in alloimmunity. Even here I shall have to be selective. The genetic control of immune responses to the Thy-1 antigen has been dealt with by Zaleski and Klein (19781, and I shall pass by this subject. It is increasingly apparent that there are many complexities in the genetic control of the immune response. As one example, strain differences in response can be greatly influenced by dose of antigen or the use of adjuvants (Newton and Warner, 1977). The presence of several distinct Ir-1 loci in the Z region of the H-2 complex suggests that complexities might be expected here, and we indeed find this to be the case. I shall consider these MHC-associated loci first.
A. THEIr-1 LOCIOF
THE
H-2 COMPLEX
The formation of antibody to the private specificity of H-2Db, H-2.2, is under control of Ir-1 loci. Wernet et al. (1976) have reported an extension of this finding. When BlO.A(5R) mice were immunized with tissue from congenic B10 (H-2*)mice, which differ only at the D end of H-2, the anti-H-2Db antibodies that appeared were of the IgM type only. However, immunization with A.BY mice, also H-2bbut with multiple non-H-2 differences, permitted the switch from IgM to IgG antibody production. This sort of helper or carrier effect of secondary antigenic disparities appears to be rather common, but is still purely an empirical phenomenon. Wettstein and Haughton (1977a,b) have used the ingenious device of double congenic strains to study the effect ofZr-1 loci in the response to non-H-2 disparate skin grafts. Double congenics are strains that differ from an inbred partner at two, nonlinked loci. Thus B10-H-2dH-7bis a
324
GEORGE G . SNELL
double congenic with respect to B10, which i ~ H - 2 ~ H - 7It" is, . however, H-2 compatible with B10.D2, which is H-2d.Thus skin grafts transferred from B10-H-2dH-7*to B10.D2 recipients test the ability of mice with a B10 background and the H-2dhaplotype to respond to the H-7b antigen. By the use of a number of such strains, it was shown that loci in the H-2 complex determine the speed of rejection of skin grafts with H-4 and H-7 disparities. The locus controlling responsiveness to H-4.2-incompatible skin grafts was mapped in the I-B subregion of H-2. Fast rejection was dominant. We now turn to the role of the Ir-1 loci in the response to the male (H-Y) antigen. The role of these loci was originally demonstrated by using male to female skin grafts in appropriate congenic or recombinant inbred strains. The study has now been extended to the i n uitro cell-mediated lysis (CML) system of Bevan (1976; see Section ID. In the Bevan system, cells are used in four capacities: (1)as responders; (2) as primers; (3) as boosters; (4) as targets. The priming is done in uiuo with skin grafts or injected spleen cells. Primed lymphocytes are boosted in uitro by coculture with irradiated spleen cells. The boosted cells are then cultured for a few hours with 51Cr-labeledtarget cells and the released W r is measured. In this system, as many as four different H-2 haplotypes could be used, but in the studies we shall be considering, responder, primer, and booster were all identical, except that responders were females and cells for priming and boosting were from males. Only the targets were varied. This obviated any problem of an anti-H-2 response, since such a response requires several days of priming i n uitro. For understanding of the work we shall be examining, it is necessary to give some background concerning the phenomenon of H-2 restriction. H-2 restriction is seen in CML systems where the target is any cell surface antigen other than the MHC gene products themselves, for example, viral antigens. In the present context, we are concerned with the H-Y antigen. Simply stated, H-2 restriction means that in the response to cell-bound non-H-2 antigens, there must be some degree of H-2 identity between stimulating and target cells. The T cytotoxic lymphocyte in some way responds simultaneously to the non-H-2 antigen and either H-2K or H-2D. After stimulation with a particular non-H-2 plus H-2 combination, activated effector clones appear that react only with this and perhaps a few cross-reacting combinations. For a more thorough treatment, see Paul and Benacerraf (1977) or Snell (1978). Because of the initial in uiuo priming used in the Bevan system, there may be important differences in the H-2 restriction seen in this
ADVANCES I N HISTOCOMPATIBILITY IMMUNOGENETICS
325
system as compared with the restriction seen in strictly in uitro MLR and CML systems. This is because, in living animals, the presentation of antigen to host lymphocytes probably occurs on host macrophages. This is true even when the antigens are alloantigens administered by way of intact cells. Such cells are probably ingested by host macrophages, which then display the foreign antigens on their surfaces in conjunction with macrophage Ia and/or H-2 antigens. We cannot go into the evidence for this here; a review will be found in Snell (1978). Insofar as this phenomenon does occur, the result is that the non-H-2 antigen under study is “seen” by host lymphocytes in association with host H-2 rather than donor H-2. This can be particularly important when the host is an F, and the donor one of the parents. We now turn to studies by von Boehmer et al. (1977) and Gordon and Simpson (1977) of the CML response to the H-Y antigen. The results suggest that some sort of simplification of the response occurs in the in uitro as compared with the in viuo system. When studied by skin grafts, it is found that, as measured by graft survival, the anti-H-Y response shows variations in strength. Strong, intermediate, and weak or negative responses can be distinguished. In the in uitro system, strain combinations show either strong lysis or no significant lysis. Also some combinations that are positive in uiuo are negative in uitro. Thus strain BlO.A(5R), which is an intermediate responder against male skin grafts, shows no response against male cells in CML. Some of the key results from both studies are assembled in Table 2. Most of the tests were done with H-2 congenic strains on a C57BL/10 (B10) background. Under these conditions, any differences in results between strain combinations must be due to some product or products of the H-2 complex. There are two components of the H-2 complex that we may reasonably expect to influence the result. We already know from skin graft studies that Ir-l genes are important. Because of the phenomenon of H-2 restriction, it is also possible that the locus and/or the allele providing the necessary H-2K or H-2D match between stimulator and target cells is important. In view of these considerations, the third set of columns of the table gives the I-region formula of the responder, since this is the key to Ir-l effects, and the fifth shows the major H gene or genes shared by primer, booster, and target, since this is the key to H-2 restriction effects. It is clear from an inspection of the table that complex factors are at work. It is not possible to fully disentangle these at the present time, but several conclusions are possible. Case 1 shows that the combination C57BW10 (B10) 0 vs C57BL/10 c? gives a positive CML. Other H-2b strains give the same result (data
TABLE 2 The Cell-Mediated Lysis (CML) Response to the Male Antigen"
Case No. 1 2 3
4 5 6 7 8 9 10
11
12 13 14 15 16
17 18
Responder ( P ), primer (d),and booster (6) C57BIJ10
D2.GD HTI BIO.A B lO.A(5R) BIO.A x BlO.A(5R)
I-region formula of responder
A
B
J
E
C
Target ( 6)
b
b
b
b
b
d b k b klb
b b k b klb
b b k k k
b b k k k
b b d d d
C57BLi10 BlO.A(BR) BlO.A(4R) BlO.A(BR) D2.GD HTI BIO.A B lO.A(5R) DBN2 CBA BALBlc CBA BALBlc CBA A A CBA CBA
BALBlc CBA BALBlc x CBA
d k kld
d k kld
d k kld
d k kld
d k kld
BlO.A(2R) BlO.A(4R) BlO.A(BR) x BlO.A(5R) BlO.A(4R) x BlO.A(5R)
k k klb klb
k
k
k
b klb b
b k blk
b k blk
d b d bld
Data in this table were taken from von Boehmer et al. (1977) and Gordon and Simpson (1977).
H genes shared by primer, booster, and target H-2Kb H-2Kb H-2Kd H-2Kb H-2Kk H-2Kb H-2K" H-2Kd H-2Kk H-2Kd ff-2Kk H-2Kk H-2Kk H-2K" H-2Kk
H-2Db H-2Db H-2D
Result
+ + + -
H-2Db H-2Dd H-2Dd H-2Dd H-2Dd
-
H-2Dd H-2D H-2Dd H-2D
-
-
+
-
+ -
-
+ +
ADVANCES IN HISTOCOMPATIBILITY IMMUNOGENETICS
,327
not shown). Cases 2 and 3, B10 0 vs BlO.A(BR) and BlO.A(4R) d , are also positive; hence a n H-2Db match only is adequate for a response. But case 4 shows that with a n H-2Kbmatch only, B10 does not respond. Case 5 adds the information that when a n I-A subregion from H-Zd is substituted for one from H-2b, an H-2Db match is not adequate for a response. We next note that in none of six cases (6, 7, 8, 9, 11, 13)with a match at H-2Dd does a reaction occur. In five of these cases there is also a match for an H-2K allele. Also in one case (6) the entire Z region comes from responder haplotype H-2 b . This last observation indicates that an I region that permits a response in the case of a n H-2Dbmatch does not function with a n H-2Dd match. In cases 9 and 10, the cells under test come from an F, between BIO.A and BlO.A(5R). Both these strains individually are nonresponders (cases 7 and 8). The hybrid also fails to respond to DBN2 (H-2d)as target, where the match is for H-2D". But, as seen in case 10, the same hybrid does respond to CBA (H-2k)as target, where the match is atH-2Kk.This case: (a)establishes that an H-2K as well a s an H-2D match can, in the right combination, lead to a positive response, and (b) confirms that a given I-region constitution may be appropriate for a response for one type of match but not for another. The match itself is a factor in the response, and the effective match may involve either H-2K or H-2D. Cases 11through 14 confirm point 2 in a different combination. Case 13 is negative despite a match a t H-2Kd as well as at H-2Dd;in fact a n H-2Kd match fails to lead to a response in any of the three cases ( 5 , 11, 13) where it occurs. Cases 8,15, and 17 and cases 8,16, and 18 provide two more examples of complementation by nonresponder haplotypes. These cases make it possible to speculate as to the I subregions involved in complementation for a successful response with an H-2Kk match. A comparison of various relevant cases suggests that the essential elements are an I-A subregion from b or d and a n Z-B subregion from b or k . We have noted already that I-A is important in the response with an H-2Dbmatch. An I-E match at h instead of a n Z-B match a t b or k will also fit the data. Reappearance of responsiveness as a result of crossing two nonresponders, so beautifully demonstrated in these studies, is not a new finding. The role of different alleles of H-2K and H-2D in determining responsiveness, if substantiated, is new in the context of the in vitro system and may shed important light on the mode of action of H-2 in immune phenomena. I should caution, however, that all interpretations are still speculative. The influence of particular allelic forms of H-2K and/or H-2D borne by target cells on the immunogenicity of accompanying non-H-2 antigens which, as we have seen, occurs in vitro, also has been demon-
328
GEORGE G . SNELL
strated in vivo. As we have already noted (Section 111, Kralova and Demant (1976) have reported an influence of H-2 on H-Y expression in parent male to F, female skin grafts, and a similar influence has been reported by Wachtel et al. (1973). This is a direct in vivo counterpart of the in vitro phenomenon of von Boehmer et al. (1977) and Gordon and Simpson (1977). An influence of H-2 on non-H-2 immunogenicity has also been reported by Wettstein et al. (1977). We have already described (this section) the use by Wettstein and Haughton (1977a,b) of the device of double congenic stocks to study H-2-non-H-2 interactions. An influence of Ir-1 on host response to H-4 and H-7 was demonstrated. Wettstein et al. used these double congenics to make F, mice which were heterozygous at H-2 but homozygous a t H-7. By challenging these with parental skin grafts, which all had the same H-7 allele but were of two H-2 types, it was possible to test the effect of different donor H-2 alleles on the rapidity ofH-7 rejection. Striking effects were found. Thus H-7b in association with H-2" led to rejection in 26 days (median survival time), whereas H-7bin association with H-2"led to rejection in 56 days. By using second and third grafts, the third graft being of a recombinant haplotype, it was possible to show that the H-2 locus interacting with H-7 was H-2D. In the Kralova and DQmant study with H-Y, the significant locus was H-2K. This confirms the in vitro H-Y studies, where it was found that, depending on the I region of the recipient, either H-2K or H-2D could be the critical locus for the donor. The variable here, however, is the donor non-H-2 antigen, not the Z haplotype of the recipient. Wettstein and Frelinger (1977) have extended the H-7 skin graft study to the Bevan in uitro system. The same effect ofH-2D on H-7 immunogenicity was observed. In both the i n vivo and i n vitro studies it was found in parent to F, tests that the effect ofH-2 was not restricted to the H-2D allele of the initial, priming graft o r cells. This is not a refutation of the hypothesis of H-7 restriction. As we have pointed out where priming occurs in vim, the non-H-2 antigen probably is presented on macrophages in association with host, not donor, H-2 antigens. Goulmy et al. (1977) have shown that anti-Y cytotoxicity of male target cells in man is HLA-restricted. Cells from a female patient who had rejected a bone marrow graft from an HLA-identical brother were boosted in vitro with her brother's lymphocytes and then tested for CML against a panel of cells from persons of known €&A type. Killing was almost completely confined to target cells from males that shared HLA-A2 with the patient and her brother. In summary, it thus appears that the MHC complex or, speaking in
ADVANCES IN HISTOCOMPATIBILITY IMMUNOGENETICS
329
terms of mice, the H-2 complex, has two quite distinct effects on the immune response to any given antigen. It can act by way of the now familiar Ir-1 loci or it can act by way of K and D region products, presumably H-2K7 H-2D, and perhaps the H-2L. The Ir-1 loci exert their influence via the recipient’s immune capability; H-2K and H-2D work via an effect on the potency of donor antigen. When non-H-2 histocompatibility antigens are tested in uitro, it is the K and D type of the priming, boosting, and target strains that are important. Insofar as any in uiuo steps are included, however, we should note that the influence on non-H-2 expression may come via a n association of donor non-H-2 with host H-2. It is also important to note that certain immune capabilities of an undetermined nature that are present in uiuo appear to be lost in uitro, with a consequent exaggeration of the role of H-2K and H-2D. This influence of H-2K and H-2D on the expression of donor non-H-2 alloantigens is clearly in some way tied to the phenomenon of H-2 restriction which we have already briefly discribed. Both presumably depend on an association of H-2 and non-H-2 antigens in such a way as to provide a favorable target for T killer lymphocytes. The important fact emerging from the studies here described is that, for favorable presentation, particular combinations of H-2 and non-H-2 are necessary. Some forms of H-2K and/or H-2D may present a particular allelic form of a non-H-2 antigen in a fashion appropriate for interactions with the cells of a particular effector, whereas other forms of these MHC products may fail to present the antigen suitably. There are thus, in T effector cell activity, complex interactions of I and K-D region products. These phenomena have been studied in the content of non-H-2 alloantigens. To what extent they apply to other antigens remains to be determined. It seems quite likely that they will a t least apply to other T effector lymphocyte systems. Muhlbock and Dux (1977) have studied the effect of H-2 type on mammary tumor incidence in mice. Females from various congenic strains, mostly on a B10 background, were fostered on high-tumor C3H females so that they would all carry the mammary tumor virus. They were force bred, which favors tumor development, and scored for mammary tumor incidence. There were great differences in different strains of different H-2 type. Strain B10 (H-2b)had the lowest incidence, and a C3H-H-2b congenic strain also was low. H-2k strains B1O.BR and C3H were relatively high. Curiously, much the highest incidence among strains on a B10 background was found in recombinant strain BlO.A(5R), which carries the left ( K ) end of H-2 from B10
330
GEORGE G. SNELL
and the right (0) end ofH-2 from strain A (H-2"). BlO.A, which carries H-2" on a B10 background, was a low-intermediate responder. Thus an H-2 haplotype of low and low-intermediate origin favored a high tumor incidence. We can only speculate as to the reason for this. Genes outside H-2 could be involved. But we saw in studies of CML against the H-Y antigen in mice that complex interactions between the Z region and H-2K and H-2D appear to determine the occurrence of target-cell lysis. Perhaps some such interaction is a t work in this instance. Meredith and Walford (19771, again using H-2 congenics, studied the effect of age on the response of lymphocytes to T- and B-cell mitogens. Complex interactions were found between age, H-2 haplotype, and mitogen response. The authors conclude that H-2 may influence the maturation and subsequent decline of various immune capabilities. B. LOCINOT LINKEDTO H-2 The Ir-2 locus is in linkage group 2, closely linked to H-3. It has been shown to affect the immune response to erythrocyte antigen Ea-1 and to histocompatibility antigen H-13. The H-13 locus is also in chromosome 2 about 7 cM from H-3. By analysis of lines congenic for H-3, H-13, and Zr-2, it now has been shown that the order of these genes is H-3-Zr-2-H-13 not Zr-2-H-3-H- 13 as originally assumed, based on cross-over values between the first two loci and agouti (Gasser, 1976a). Gasser (1976b) has also produced evidence that, unlike most immune response genes, Zr-2 may act by inducing cross-tolerance of the affected alloantigens. This implies that the Zr-2 gene product is crossreactive with the Ea-1 and H-13 gene products. This hypothesis is compatible with the fact that Zr-2-induced unresponsiveness, unlike the unresponsiveness caused by most Zr genes, is dominant. The test used consisted of injecting neonatal responder mice with nonresponder spleen cells and then testing these mice as adults for ability to respond. Appropriately injected mice had lost their ability to form antibodies to Ea-1 or, in the case of H-13, to reject skin grafts. Responders had become nonresponders. This certainly suggests the induction of tolerance by a cross-reacting antigen. However, an attempt to prove the existence of such a n antigen by cross-absorption of anti-Ea-1 antibody gave negative results. To this reviewer, this result adds weight to an alternative explanation suggested, but not favored, by Gasser, namely, that unresponsiveness is due to the transfer of suppressor T cells. It has been shown that a t least some cases of genetic unresponsiveness are due to the de-
ADVANCES IN HISTOCOMPATIBILITY IMMUNOGENETICS
331
velopment of suppressor cells in nonresponder strains (Kapp et al., 1977). Iflr-2 nonresponder spleens contain cells capable of suppressing the response to a particular antigen, the neonatal injections of these cells could transfer unresponsiveness. This type of nonresponsiveness could show dominance, just as would that due to cross-reacting antigens. Mice of strain CBNN (also called CBNHN) carry a n X-linked immune response defect causing unresponsiveness to type I11 pneumococcal polysaccharide and denatured DNA. A B-lymphocyte defect appears to be involved (Section 111, El. Ahmed and Scher (1976) have now shown that CBNN mice have a defect in the expression of the MLRstimulating Mls gene product (Section 111, B). Spleen cells from CBNN mice, although they could respond in the MLR to Mls, could not induce the reaction. Yet CBNN mice were found to have a stimulatory Mls genotype, since (CBNN x C3WN)F, spleen cells stimulated an MZs response in C3WN mice. No H-2 disparity is present in this combination; the response must have been due to an Mls product of the CBNN parent. The authors explain these results as being due to the absence in CBNN mice of a subpopulation of B lymphocytes necessary for stimulation in an anti-Mls MLR. In the (CBNN x C3WN)F,, the C3WN parent contributed the ability to produce these B cells, and the CBNN parent an MZs product which C3WN lacked. ) reported a non-H-2-linked Ir gene that Hansen et al, ( 1 9 7 7 ~ have controls the ability to form an anti-H-2.28 antibody. The congenic strain combination C3H anti-C3H.SW (H-2kanti-H-2b) gave rise to an anti-28, but the combination B1O.BR anti-B10, although possessing a n identical H-2 disparity, did not. Responsiveness was dominant and segregated in a (C3H x B1O.BR) x B1O.BR backcross (both strains H-29).No linkage has as yet been demonstrated for the responsible locus. VI. Hybrid or Hemopoietic Resistance
Hybrid resistance is the rejection of parental (PI grafts by F, animals heterozygous a t the MHC (H-2 in the case of mice). According to the classical laws of transplantation, this combination should not lead to rejection. Hybrid resistance is seen with bone marrow transplants and some transplanted leukemias, but not with most other tissues. Unlike more familiar forms of resistance, it is radiation resistant and stronger in males than in females. Also the competence for this type of resistance matures later (about 25 days in mice) than the competence for
332
GEORGE G. SNELL
ordinary graft rejection. There is a major influence of modifying factors; it does not occur in all F, vs P combinations. The same mechanism is probably at work in the rejection of some bone marrow allografts by irradiated recipients. The term hemopoietic resistance has therefore been applied. Hybrid resistance has usually been studied in vivo, but in vitro systems have also been reported (review in Snell et al., 1976). Shearer et al. (19771, using the typical cell-mediated lysis (CML) system, have shown that in F, vs P combinations the active cells have several properties, e.g., late maturation, that differentiate them from the cells active in allogeneic combinations. It may be that in this experimental context, the detectably alloreactive cells are typical radiation-sensitive T effector cells. More striking than the results in the CML system is the finding of Harmon et al. (1977) that, in a n F, vs P combination with lymphoid tumors as targets, in vitro lysis will occur in 4-6 hours without the several days of advance coculture used for typical CML. This ability to attack target cells without advance priming is, so far as we know, a property only of a n effector lymphocyte originally demonstrated in anti-lymphoma systems and designated the natural killer, or NK, cell (Petranyaetal., 1975).There have been reports that a n “M” cell, with properties very similar to those of the NK cell, plays a role in hemopoietic resistance (review in Snell et al., 1976). A cell with natural killer capabilities occurs in man as well as in mice (Ohno et al., 1977). Kiessling et al. (1977) have now compared the properties of the cell involved in hemopoietic resistance with those of the NK cell and conclude that a single cell type is probably a t work. The active cell is neither a T cell nor a B cell, though it is of bone marrow origin (Haller et al., 1977). It acts without advance immunization, it retains activity after heavy irradiation though such radiation depletes the marrow stem cells from which it is derived, it is susceptible t o the anti-marrow agent *%r, it is late maturing. The suggestion has been made that its functions in the normal animal are regulation of hemopoiesis and surveillance over leukemogenesis (Kiessling et al., 1977). It is the unique properties of this cell that are the source of the unique immunophysiology of hybrid resistance. It is tempting to assume that the uniqueness of the cell will be found also to be the source of the genetic uniqueness of hybrid resistance. Besides the NK cell, macrophages are also active in hemopoietic resistance. Previous reports t o this effect were confirmed by Cudkowicz and Yung (1977) by the use of the anti-macrophage agent Seakem carrageenan. Given in small doses intravenously 5-24 hours after
ADVANCES IN HISTOCOMPATIBILITY IMMUNOGENETICS
333
transplantation, it was found to abrogate or weaken resistance to parental, allogeneic, or xenogeneic bone marrow grafts. Carlson and Wegmann (1977) find that lymphoma cells are more subject to radiation-resistant rejection when localized in the spleen than when localized in the liver or in the body a t large. Cells of a methylcholanthrene-induced ascites leukemia were labeled with 1311UdR in uiuo, harvested 4 days later, and injected intravenously a t dose levels of 2 x lo5 to 2 x lo6 cells per recipient. Some of the recipients were irradiated about 2 hours prior to injection of cells. Both allogeneic and parent to F, combinations were used. Cell killing was determined by reduction of radioactivity, either whole body or in spleens or liver, as compared to isogeneic controls. Most of the drop in radioactivity occurred in the spleen, indicating that this was the major site of cell destruction. Killing was apparent at 24 hours, but continued to rise thereafter. In some strains, especially C3H and its congenics, the killing was reduced by radiation; in others it was not. Killing occurred in both allogeneic and parent to F, combinations. Bonmasser and Cudkowicz (19761, using the uptake of 1311UdRgiven 5 days after lymphoma transplantation as their assay for killing, also found the spleen more active in killing than in the liver. Specific tolerance to radiation-resistant killing of transplanted lymphoma cells or bone marrow cells can be induced by prior injection of lymph node or spleen cells. Thymus cells are relatively ineffective. Multiple injections are more effective than single injections. The specificity of the tolerance indicates that killing is due to clones of cells specific for particular target cell types (Kiessling et al., 1977; Lotzova, 1977a). The D end of H-2 plays a particularly important role in hybrid resistance. While some data suggest possible exceptions, it is certainly a general rule that hybrids, in order to reject parental grafts, must be heterozygous for the D region (review in Snell et al., 1976). Lotzova (1977131 now reports that a D-end incompatibility is also essential in allogeneic bone marrow rejection by irradiated mice. Nearly all the haplotypes used in her tests were on a C57BU10 background. It is possible that this predisposes to the need for a D-end incompatibility. While a locus or loci involved in radiation-resistant killing of bone marrow and some lymphoma transplants can be mapped a t the D end ofH-2, the nature of the antigen(s) determined by this locus (or loci) remains a mystery. The situation is particularly puzzling in the F, vs parent combination, where, according to conventional theory, the parental target cells can bear no product foreign to the F, recipients that
334
GEORGE G . SNELL
reject them. Cudkowicz has suggested a n interpretation in terms ofHh (for hemopoietic histocompatibility) loci that produce end products, or a t least demonstrable end products, only when homozygous; heterozygotes are assumed to produce no end product (review in Snell et al., 1976). Snell(1976) has pointed out problems in this hypothesis, but a n alternative proposed by Snell in this paper also has weaknesses. Since it is now clear that the cytotoxic agent in radiation-resistant bone marrow rejection is the NK cell, the answer may come from an understanding of the antigens that, in nature, are the targets of this cell. At present we know that the typical target is a Moloney-type lymphoma, but we still know little about the specific antigents). A plausible assumption would be that it is a viral product in association with an H-2 complex product. The H-2 element could range from a n Ia antigen to H-2K, H-2D, or H-2L, or perhaps be one of the newly discovered &a antigens. VII. The MHC in Cell-Cell Interactions
The regulatory role that the MHC plays in a variety of immune responses suggests that it may directly govern cell-cell interactions. We now turn to evidence dealing directly with this question. There are two rather obvious molecular mechanisms that might be involved in cell contacts: (1)the pairing of complementary structures, analogous to antigen and antibody; (2) the pairing of identical molecules either through dimer formation or through complementary areas on the same or an allelic molecule. The first mechanism was suggested by Weiss in 1950 and has many precedents in cell-surface receptors and the products they bind, e.g., estrogen receptors and estrogen. There is little precedent for pairing of like with like as a regulatory mechanism, but, if demonstrated, it would have obvious potential as a means of selfnonself discrimination. We now turn to a n examination of relevant studies. We shall see that the evidence for complementary pairing implicates the I-region gene products whereas evidence for some sort of self-reactivity implicates the major histocompatibility products. We consider first cases involving Z-region products of macrophages as one of two complementary components. Erb et al. (1976a,b) have reported complementary factors produced by the I-A region ofH-2 that play a role in macrophage-?' cell collaboration. One component, called genetically related factor, or GRF, is released by macrophages after incubation with antigen. This soluble
ADVANCES I N HISTOCOMPATIBILITY IMMUNOGENETICS
335
component has a total molecular weight of 50,000-60,000 and appears to be composed of a n la gene product and a fragment of the inducing antigen. It reacts with anti-Ia, but not with anti-Ig, anti-C3, or antiµglobulin. It appears to be antigen-specific, a surprising finding if indeed it is a macrophage product. Its function appears to be to induce T helper cells, but it is active only with helper cells bearing a homologousI-A subregion. The T-cell receptor for the factor is not well characterized; it may not be a typical Ia antigen. Yano et al. (1977) have reported a similar requirement for a n I-A match in macrophage-T cell collaboration, except that in their study there was no evidence for release of a macrophage factor. It appeared rather that a n I-A gene product on the macrophage was instrumental in presenting antigen to T (helper?) cells. This is a well established function of macrophage Ia. The authors note that this I-A-restricted type of antigen presentation may apply only to one type of macrophage. They also note that the restriction may not be complete; some I-A cross-reactions may occur. Bergholtz et al. (1977) have reported what may be the same phenomenon in man, though the genetic mapping in this study could not be carried beyond the need for an HLA-D match. The GRF macrophage factor of Erb et al. (1976a,b) was reported to be antigen-specific, and the macrophage Ia factor of Yano et al. (19771, on the basis of known Ir-1 locus effects, may have an element of specificity. We now come to a nonspecific T cell mitogen released, in the presence of I-A-compatible macrophages, by T cells infected with Listeria monocytogenes. This nonspecific mitogenic factor was demonstrated by Farr et al. (1977). The T cells and macrophages had to be in contact and had to be matched a t the I-A subregion, implying interaction of I-A-determined cell surface products. The mitogen could act on cells of any H-2 haplotype. In an in vivo study of T effector cell generation, also with Listeria monocytogenes, Zinkernagel et al. (1977a) found that a n I-A subregion match between host and infected cell donor was necessary. This may well have been an in vivo manifestation of the same phenomenon observed by Farr and colleagues, although no role for macrophages was specifically identified. We now come to an antigen-specific factor released by T cells and bound by a receptor on B cells (Taussig et al., 1976). The factor is released by T cells primed in uivo and exposed in vitro to the priming agent. It binds to immunoadsorbents carrying this antigen. It reacts with antisera against Ia products mapped in the I-A subregion but does not react with anti-Ig. The molecular weight is approximately 50,000. It is not produced by some strains that are low responders to the antigen under test. The receptor for the T-cell factor is found on bone
336
GEORGE G. SNELL
marrow cells and purified peripheral B cells but not on thymocytes. There are no indications that the receptor is antigen-specific though it may be specific for this particular lymphokine. The receptor, at least in the case of certain antigens, is blocked by antisera directed against products of the I-A subregion. The receptor, in the case of factor against one antigen studied, was not expressed on B cells of some lowresponder strains. The receptor shows evolutionary conservatism; mouse factor was bound by human lymphocytes. Once again, the point of note here is that factor and receptor are coded by paired genes in the same small region (I-A)of the H-2 complex. What may be another manifestation of the same factor has been reported by Janeway et al. (1976) in a study of the role of immune response genes in the antibody response to IgA and IgG myeloma proteins. There were complications here that we need not go into, for example, a mapping of the Ir-1 locus controlling responsiveness to IgG in the I-B subregion. But again, it was found, in some experimental contexts, that T-B collaboration required an I-A subregion match. The need for a n H-2 match (region not determined) for the function of a quite different lymphokine has been demonstrated by McDevitt et al. (1977). The allogeneic effect factor (AEF) is a nonspecific factor, produced in mixed lymphocyte cultures, that can substitute for T helper cells in the response of primed B cells to haptens (Armerding and Katz, 1974). AEF has a molecular weight of 40,000-50,000 and binds to appropriate anti-Ia. McDevitt et al. studied an AEF produced in mixed lymphocyte cultures between responder lymphocytes treated with anti-Ia and complement (predominantly T cells?) and irradiated stimulator lymphocytes treated with anti-Thy-1 and complement, and hence free of T cells. McDevitt et al. interpret this “restricted’ AEF as a B cell and/or macrophage product and find it to be capable of stimulating only B cells of isogeneic haplotype. Armerding and Katz did not detect such a n MHC restriction. We now come to an I-region product that is clearly different from those previously considered. In antibody-forming systems, a specific suppressor factor can be extracted from primed T suppressor cells that will block antibody formation by antigen-stimulated B cells. The suppressor acts via the T helper cell rather than directly on the B cell. It has a molecular weight in the 35,000-55,000 range. It (or a part of it) is an l a gene product, but unlike the other l a gene factors that we have been considering, the determining locus is in the I-J subregion. The T-cell acceptor for the factor is also a n I-J gene product (Tada et al., 1977). Using the mixed lymphocyte reaction, Engleman et al. (1977) have
ADVANCES I N HISTOCOMPATIBILITY IMMUNOGENETICS
337
demonstrated a somewhat similar suppressor factor in man. Suppression occurs only if the test cell donor and the suppressor-donor share identity at HLA-D, the human counterpart of the murine I region. This suggests, again, that complementary structures are involved, coded by closely linked MHC genes. It appears to be generally assumed that complementary structures are involved in these phenomena. Actually, there appears to be no firm proof of this, but such a n assumption would appear to be in keeping with the presence of the interacting products on two different cell categories. This was the case in all studies we have described except possibly that of McDevitt et aZ. (1977). If released, self-interacting products were involved, the likely consequence would appear to be reattachment to the releasing cell. This objection might not apply to interactions not involving a released product. Assuming that we are dealing with complementary products, it becomes of interest to inquire how many such complementary pairs have been identified. The minimum number would appear to be two, one pair determined by the I-A subregion and another, the suppressor pair, by the I-J subregion. The I-A group would appear to be further divisible, for example, into specific and nonspecific factors, but only further tests can give a firm basis for any detailed classification. It would not be surprising if there turn out to be at least as many pairs as there are subregions in the I region of H-2, and quite possibly more than this. However many pairs there ultimately turn out to be, one important point seems established (assuming again the complementary structure hypothesis), namely, that the interacting structures are the products of very closely linked genes. This is in keeping with the recognized principle that, if two structures are both interacting and polymorphic, they must be determined by closely linked loci. If they are not, recombination will give rise to an intolerable number of nonfunctional combinations. We now turn to a case of apparent H-2-interaction structures of a very unusual but still poorly defined nature. Yamazaki et al. (1976) have reported that mating preference in mice is influenced by H-2 type, probably through an olfactory mechanism. The study was inspired by the observation, made during the course of producing an AKR-H-2b congenic line, that blb males mated preferentially with klb rather than blb females. Extensive additional tests were then carried out using different H-2 haplotypes, including haplotypes on a congenic background so that non-H-2 effects could be ruled out. The original observation was confirmed, and the additional point established that whereas
338
GEORGE G. SNELL
in one haplotype combination there might be an excess of matings of like genotypes, in another the excess might involve the unlike genotype. The genotype preference was far from absolute, but was statistically highly significant. Another point of interest was that in some haplotype combinations the genotype chosen in the first mating tended to be chosen in subsequent matings. The authors speculate that the preference signal is olfactory and that two linked genes are involved, one for the signal and a second for the receptor. There is as yet no evidence as to which region of H-2 may be involved. Egorov et al. (1977a) have obtained evidence, from a study of the graft-versus-host (GVH) response displayed in combinations of two H-2K mutants and the allele of origin, that the H-2K gene product is capable of self-interactions. GVH reactions were induced by the injection of newborn mice with adult spleen cells carrying the mutational disparity. The gene that mutated wasH-2Kb; the derived mutants were H-2Kb" and H-2Kbd.Many combinations were tested, including a variety employing different congenic strains. Some of the key data are presented in Table 3 . In interpreting these data, it is important to remember that we usually think of the recognition mechanism in a GVH reaction as involving the interaction of cell-bound antibody or a n antibody-like recognizer with a cell-surface antigen, most prominently some MHC antigen. With thiq type of recognition mechanism, self-tolerance, in crosses, behaves like a dominant. Thus, if, as in case 1, Table 3 , H-2Kb", when homozygous, fails to respond to H-2Kbd,the introduction of a responding allele should still result in a nonresponding haplotype. The hybrid presumably has fewer clones capable of responding, not more. TABLE 3 Evidence from Graft-versus-Host (GVH) Studies with H-2 Mutants That H-2K Gene Products Recognize Themselves" GVH reaction
Case No.
Donor H-2K type
Recipient H-2K type
Index
1 2 3
ba b bulb ba b bulb
bd bd bd bdlb bdlb bdlb
1.12 1.55 1.92 1.16 1.82 1.79
4
5 6
" Data from Egorov et al. (1977a)
Interpretation
ADVANCES IN HISTOCOMPATIBILITY IMMUNOGENETICS
339
Hence, when responder H-2Kb (case 2) is crossed with nonresponder H-2Kbn (case 11, it is a surprise to find that the H-2KbnIH-2Kbhybrid responds (case 3). Cases 4-6 repeat the first three cases except that the target is bdlb. This combination rules out the possibility of a hostversus-graft reaction in case 5 . The results are the same. Egorov et al. (1977a) discuss various possible explanations of these results. They conclude that the most likely explanation is that the H-2K locus has immune-response capabilities and that, in the key combinations, H-2K" is a responder allele. The H-2K antigen is in some way involved in the recognition of other H-2K antigens. No definite assumption is made as to the type of molecular interaction involved. We now turn to two studies that emphasize the possibility of a fundamental role for H-2, and in one case specifically for H-2K and H-2D, in cell interactions. It is tempting to think that these two studies point the way to an understanding of the still largely mysterious function of the K and D antigens. The studies concern the adhesiveness of cells of different H-2 haplotypes. Zelen9 et al. (1978) tested the adhesiveness of tritium-labeled bone marrow or lymph node cells to cell layers of bone marrow or peritoneal exudate cells. The plates with wells containing the cell mixture were incubated for 60 minutes and then inverted to free the unattached cells and incubated for a n additional 45 minutes. The authors conclude that isogeneic cells showed greater adhesiveness than H-2 allogeneic cells. There was, however, in the test system they used, substantial uncontrollable variability from one experiment to another, and while the reported differences appeared to be significant, this casts some doubt upon the conclusions. Bartlett and Edidin (1978) likewise tested the adhesion of tritiumlabeled free cells to cell monolayers, but there were in other respect important differences in their approach. In most tests, both free cells and monolayers were derived from cultured embryonic fibroblasts. In Some cases, recently cultured adult fibroblasts were substituted, and long-cultured mouse and hamster cell lines were used as controls. Because the free cells were used very shortly after isolation with trypsin, it is likely that any active role in the adhesion process should be attributed to the monolayer. A variety of H-2 congenic strains on several different inbred backgrounds was employed. Adhesion was usually measured over a period of 30 minutes after addition of the free cells, the test wells being examined every 5 minutes. Under these conditions, after a lag of about 3 minutes, there was a straight-line increase in cell adhesion over the 30-minute period. Variability in
340
GEORGE G. SNELL
different experiments ranged from 10 to ~ W O but , this was reduced by comparing only results from tests run on the same day and, insofar as the plan of the experiment permitted, with the same cell suspensions. Contrary to the results found by Zelenjr et al., Bartlett and Edidin found no difference in the adhesiveness of isogeneic as compared with allogeneic cells. This could have been due to differences in the free cells used. In the experiments of Zelen? et al., the free cells were of lymphoid origin. These could have carried on their surface antigen-recognition structures, and possibly in some cases self-antigen-recognition structures (Zinkernagel et al., 1978) that would not have been present on fibroblasts. In the studies of Bartlett and Edidin there was, however, an effect of H-2. Cells of the H-2k haplotype used as embryonic monolayers induced less adhesion of free cells of all H-2 genotypes than did other monolayer haplotypes, and cells of H-2s haplotype used as embryonic monolayers produced greater than the typical adhesion. This was demonstrated with H-2k and H-2bon several different inbred backgrounds. High adhesion was dominant in F, and, in the case of H-2k,was shown to segregate in a backcross with the H-2 type of the cell used as monolayer. Curiously, when adult fibroblasts were used as monolayer, the effect of H-2 type was reversed. In both cases the effect was contingent on the use of recently cultured cells of mouse origin. It was not clear whether the adult cells behaved differently because of their age or their tissue origin. To demonstrate the role of H-2 in the case of fibroblasts from strains with a C57BL/10 background, the cells either had to be treated with neuraminidase or used in a medium containing fetal calf serum. The authors, in this connection, note the report of an Earn locus (Rubinstein et al., 1974) that controls electrophoretic mobility and cell-surface sialic content of mouse red cells. Strain C57BL110 is one of the few strains with high sialic acid and low agglutinability . The strains used in these studies did not permit a sharp delineation of the region of H-2 responsible for the observed adhesion differences. However, Bartlett and Edidin (1978) showed that anti-H-2K and anti-H-2D, directed against the H-2 type of the monolayer, substantially reduced the adhesion, the effect increasing with time. Various control antisera, including anti-Thy- 1 and an anti-CSP (chick fibroblast surface protein) had little or no effect on cell binding, although the anti-Thy-1 and anti-CSP were shown by the use of fluorescent labels to attach strongly to the monolayer cells. Although we are only beginning to understand the role of the major histocompatibility complex in immune phenomena, it is now established beyond question that this role is a major one. The products of
ADVANCES IN HISTOCOMPATIBILITY IMMUNOGENETICS
341
closely linked loci, a number of which, a t least, are homologous to each other, to the immunoglobulin molecules, and perhaps to the T complex gene products, and which were first detected as major targets of alloimmunity, are now found to be also active participants in the immune process. In the case of the I-region gene products, the native function may be the regulation of the interaction of different classes of lymphocytes one with another or with macrophages, and perhaps also the reaction of these cells with antigen. The studies of Zelen9 et al. (1978) and Bartlett and Edidin (1978) suggest that H-2K and H-2D may have a broader function-the regulation of cell interactions in general. Whether they do this directly or, as Bartlett and Edidin are inclined to believe, through an association with other cell-surface products, is a question that is likely to be the subject of many future investigations. Addendum
This addendum summarizes a few of the most important papers which have appeared since the preceding chapter was completed. The sections of the chapter to which material in the addendum is relevant are indicated by the appropriate numbers and letters.
SECTION 111, D-F Correspondence between Drs. E. A. Boyse and M. C. Green has led to an understanding on a nomenclature for the L y (lymphocyte) loci and alloantigens which Boyse will use in forthcoming papers and Green in a forthcoming review (M. C. Green, personal communication). The agreed locus symbols are:
Ly-4, Ly-5, Ly-6, Ly-7, Ly-8 (all unchanged) Lyb-2, Lyb-3, Ltb-4, Lyb-5, Lyb-6 (all unchanged) Lyt-1, Lyt-2, Lyt-3 (were Ly-1, Ly-2, Ly-3) This is likely to become the standard usage. Since the determinants of the Lyt-2.1 and Lyt-3.1 antigens have not been separated by crossing over, it has been uncertain whether they are determined by the same or different genes. Durda and Gottlieb (1978) have now answered this question by an immunochemical approach-the sequential precipitation of mouse thymocyte extracts with anti-Lyt-2 and anti-Lyt-3 sera. The corresponding antigens precipitated separately, showing that they are on separate molecules and hence presumably determined by separate genes.
342
GEORGE G . SNELL
Ly-6, Ly-8, and Ala-1 are antigens of murine lymphocytes defined by alloantisera made in quite different recipient-donor combinations. We have noted that the lymphocyte antigens Ly-6 and Ala-1 show very similar strain distribution patterns and similar, though apparently not identical, cellular distribution. Possible identity is thereby suggested, since the differences could be due to the use of different substrains or to typing error. Horton et al. (19781, using a (CBNCa x A-Thy-1"1 antiAKWCre, which had the properties of a n anti-Ly-6.2, and also the standard antisera by which Ly-6, Ly-8, and Ala-1 were originally characterized, have now shown that Ly-8 and Ala-1, like Ly-6, have the CXB recombinant inbred strain pattern BBCCBCB. This strongly suggests that these antigens, if not identical, are a t least determined by closely linked loci. In view of the growing number of cases of linked loci with similar but distinct end products (e.g., Lyt-2 and Lyt-3, as well as several clusters of similar loci in or adjacent to the H-2 complex), the distinct locus hypothesis is attractive. Ahmed et al. (1978) have reported two new alloantigens of B lymphocytes, Lyb-5 and Lyb-6. These were identified through the use of the same strain, CBA,", used in the identification of Lyb-3. This strain is uniquely useful in the identification of B cell alloantigens because it lacks entirely a category of B cells.
SECTION IV,B,3 Nairn and Nathenson (1978) have carried out a chemical study of the H-2D products of strain BALB/c and of the mutant strain BALBlc-H2db,believed to carry a mutant at the distinct H-2L locus. Peptide mapping showed the H-2D products of BALBic and of its mutant derivative to be identical. This confirms that the mutation, although at the D end of H-2, is indeed not a t H-2D. The existence of H-2L as a distinct locus is confirmed.
SECTION IV,B,5 Meschini and Parmiani (1978) have reported a study with a BALBic methylcholanthrene-induced sarcoma, C-1, which strongly supports the hypothesis that tumors sometimes express unexpected H-2 alloantigens. A BALB/c anti-C-1 was tested by direct cytotoxicity and by absorption against a panel of strains of diverse H-2 haplotype. The reaction pattern was that of an anti-H-2Kk. Strain BALB/c carries the antigens H-2Kd, H-2Dd. It is noteworthy that, despite some previous reports, no evidence was found for the presence of more than this one
ADVANCES IN HISTOCOMPATIBILITY IMMUNOGENETICS
343
unexpected antigen. Why the C-1 tumor grows in BALB/c mice despite the presence of the H-2Kk antigen remains unexplained. Only a few old and uniquely virulent transplantable tumors are able to override the H-2 barrier.
SECTION IV,C A finding of great interest is that the Ia antigens in the epidermis may be confined to Langerhans cells. Previous reports have indicated that Ia is present on all epidermal cells. The more restricted localization has now been reported for man (Rowden et al., 1977; Klareskog et al., 19771, guinea pigs (Klareskog et al., 1977; Stingl et al., 19781, and mice (Rowden et al., 19791. Frelinger et al. (19781, however, find Ia on other epidermal cells as well as Langerhans cells. Both Rowden et al. and Frelinger et al. report the presence in the mouse epidermis of Ia determined by both I-A subregion and I-EC subregion loci. Stingl et al. (19771 have reported that epidermal Langerhans cells carry Fc and C3 receptors, which tends to identify them as members of the monocytemacrophage-histocyte series, although they have limited phagocytic capcity. Stingl et al. (1978) have also shown that, like macrophages, these cells can function in the presentation of antigens to lymphocytes and can stimulate a mixed lymphocyte reaction. Since the Ia antigens on lymphocytes and macrophages clearly function in a n immunoregulatory capacity (review in Snell, 19781, the localization of epidermal Ia to a cell of the monocyte-macrophagehistocyte series points to an immunoregulatory function for this cell also. The reported ability of Langerhans cells not only to bind antigen, but to migrate to the lymph nodes (Silbergerg-Sinakin et al., 1976, cited by Stingl et al., 19771, suggests a n important role in the afferent limb of the immune response. Many fascinating questions are raised. J u s t where do Langerhans cells fit in the macrophage family? There is already evidence that macrophages can be divided on the basis of Ia expression (Cowing et al., 1978). What is the relation of Langerhans cells to the Ia-positive reticular cells (Hoffmann-Fezer et al., 1978) or the Ia-positive dendritic cells (Steinman et al., 1978) of lymph nodes? Do they carry antigen and present it to lymphocytes within the lymph nodes? Murine Ia-positive dendritic cells have a unique capacity to stimulate the mixed lymphocyte reaction and cell mediated lysis in uitro, suggesting a major role in antigen presentation (Steinman and Witmar, 1978). What is the relation of Langerhans cells to the initiator lymphocytes of Livnat and Cohen (1976) which reach the lymph nodes via the skin and afferent lymph and play a major role in the initiation of a t least some immune responses? The clarification of these questions
344
GEORGE G . SNELL
will constitute an important addition to our knowledge of immune processes.
REFERENCE s Ahmed, A., and Scher, I. (1976). Studies on non-H-2-linked lymphocyte-activating determinants. 11. Nonexpression of M l s determinants in a mouse strain with a n X-linked B lymphocyte immune defect. J . Immunol. 117, 1922-1926. Ahmed, A., Scher, I., and Sell, K. W. (1977). Studies on non-H-2-linked lymphocyteactivating determinants. IV. Ontogeny of the Mls product on murine B cells. Cell. Immunol. 30, 122-134. Ahmed, A., Smith, A. H., Kessler, S. W., and Scher, I. (1978).Ontogeny of murine B-cell surface antigens and function. In “Comparative and Developmental Aspects of Immunity and Disease” (M. E. Gershwin and E. L. Cooper, eds.), pp. 175-200. Pergamon, New York. Amos, D. B., Ruderman, N., Mendell, N., and Johnson, A. H. (1975).Linkage between HL-A and spinal development. Transplant. Proc. 7, 93-95. Armerding, D., and Katz, D. H. (1974). Activation of T and B lymphocytes in uitro. 11. Biological and biochemical properties of a n allogeneic effect factor (AEF) active in triggering specific B lymphocytes. J . Exp. Med. 14, 19-37. Artzt, K., and Bennett, D. (1977). Serological analysis of sperm of antigenically crossreacting Tit haplotypes and their recombinants. Immunogenetics 5, 97- 107. Artzt, K., Hamburger, L., and Flaherty, L. (1977). H-39, a histocompatibility locus closely linked to the Tit complex. Immunogenetics 5, 477-480. Bailey, D. W. (1971). Recombinant-inbred strains. An aid to finding identity, linkage, and function of histocompatibility and other genes. Transplantation 11, 325-327. Barclay, A. N., Letarte-Muirhead, M., and Williams, A. F. (1976). Chemical characterization of the Thy-1 glycoproteins from the membranes of r a t thymocytes and brain. Nature (London) 263, 563-567. Bartlett, P. F., and Edidin, M. (1978). Effect of the H-2 gene complex on rates of fibroblast intercellular adhesion. J . Cell Biol. 77, 377-388. Bennett, D., Mathieson, B. J., Scheid, M., Yanagisawa, K., Boyse, E. A,, Wachtel, S., and Cattenach, B. M. (1977). Serological evidence for H-Y antigen in Sxr, XX sexreversed phenotypic males. Nature (London) 265, 2 5 5 2 5 7 . Bennett, M., Baker, E. E., Eastcott, J. W., Kumar, V., and Yonkosky, D. (1976). Selective elimination of marrow precursors with bone-seeking isotope RY Sr: Implications for hemopoiesis, lymphopoiesis, viral leukemogenesis and infection. Res, J . Reticuloendothel. SOC.71, 71-87. Bergholtz, B., Albrechtsen, D., and Thorsby, E . (1977). The influence of HLA-D histocompatibility on macrophageiT lymphocyte interaction in proliferative response to PPD in uitro. Tissue Antigens 10, 246 (abstr.). Betuel, H., Touraine, J . L., Souillet, G., and Jeune, M. (1978). Absence ofcell-membrane HLA antigens in an immunodeficient child. Tissue Antzgens 11, 68-70. Bevan, M. J. (1976). Cytotoxic T cell response to histocompatibility antigens-the role of H-2. Cold Spring Harbor Symp. Quant. Biol. 41, 519-527. Bodmer, W. F. (1973).A new model for allelism a t histocompatibility and other complex loci: Polymorphism for control of gene expression. Transplant. Proc. 5, 1471-1475.
ADVANCES I N HISTOCOMPATIBILITY IMMUNOGENETICS
345
Bonmasser, E., and Cudkowicz, G. (1976). Suppression of allogeneic lymphomas in spleens of irradiated mice. Importance of the D end of the H-2 complex. J . Immunol. 117, 697-700. Boyse, E. A,, Cantor, H., Shen, F.-W., and McKenzie, I. F. C. (1977). Nomenclature for antigens demonstrable on lymphocytes. Zmmunogenetics 5, 189. Burakoff, S. J., Ratnofsky, J . E., and Benacerraf, B. (1977). Mouse cytolytic T lymphocytes induced by xenogeneic rat stimulator cells exhibit specificity for H-2 complex alloantigens. Proc. Natl. Acad. Sci. U.S.A. 74,4572-4576. Carlson, G. A., and Wegmann, T. G. (1977). Rapid in uivo destruction of semi-syngeneic and allogeneic cells by non-immunized mice as a result of nonidentity at H-2. J . Zmmunol. 118,2130-2137. Catternach, B. M., Pollard, C. E., and Hawkes, S. G. (1971). Sex reversal in mice: XX and XO males. Cytogenetics 10,31&337. Cohen, I. R., and Wekerle, H. (1977). Autoimmunity, self-recognition, and blocking factors. In “Autoimmunity” (N. Talal, ed.), pp. 231-265. Academic Press, New York. Cowing, C., Schwartz, B. D., and Dickler, H. B. (1978). Macrophage Ia antigens. I. Macrophage populations differ in their expression of Ia antigens. J . Immunol. 120, 3 7 a 3 84. Cramer, D. V., Davis, B. K., Shonnard, J . W., Stark, O., and Gill, T. J., I11 (1978). Phenotypes of the major histocompatibility complex in wild rats of different geographic regions. J . Immunol: 120, 179-187. Cudkowicz, G., and Yung, Y. P. (1977). Abrogation of resistance to foreign bone marrow grafts by carrageenans. I. Studies with the anti-macrophage agent Seakem carrageenan. J . Zmmunol. 119,483-487. Cunningham, B. A,, Henning, R., Milner, R. J., Reske, K., Ziffer, J . A,, and Edelman, G. M. (1977). Structure of murine histocompatibility antigens. Cold Spring Harbor Symp. Quant. Biol. 41,351-362. David, C. S. (1976).Serologic and genetic aspects of murine Ia antigens. Transplant. Reu. 30, 299-322. David, C. S. (1977). The major histocompatibility system of the mouse. In “The Major Histocompatibility System in Man and Animals” (D. Gotze, ed.), pp. 255-290. Springer-Verlag, Berlin and New York. David, C. S., Neely, B. C., and Cullen, S. E. (1977a). Serologic analysis ofH-2 mutants. I. Evidence for lack of a n H-2K” specificity in B6.M505 (H-2*9.Zmmunogenetics 5, 143- 148. David, C. S., Neely, B. C., and Cullen, S. E. (1977b). Inability to detect Ia antigens in mouse sera. In “Third Zr Gene Workshop” (H. 0. McDevitt, ed.). Academic Press, New York (in press). Davis, W. C. (1977). Enhancement of heart allograft survival across H-2 complex. Transplant. Proc. 9, 937-939. Doherty, P. C., Blanden, R. V., and Zinkernagel, R. M. (1976). Specificity of virusimmune effector T cells for H-2K or H-2D compatible interactions: Implications for H-antigen diversity. Transplant. Reu. 29, 89-124. Dubois, P., Fellous, M., Gachelin, G., Jacob, F., and Kemler, R. (1976). Absence of a serologically detectable association of murine &-microglobulin with the embryonic F9 antigen. Transplantation 22, 467-473. Duncan, W. R., and Streilein, J. W. (19781. Analysis of the major histocompatibility
346
GEORGE G. SNELL
complex in Syrian hamsters. I. Skin graft rejection, graft-versus-host reactions, mixed lymphocyte reactions, and immune response genes in inbred strains. Transplantation 25, 12-16. Durda, P. J . , and Gottiieb, P. D. (1976). The Ly-3 antigens on mouse thymocytes: Immune precipitation and molecular weight characterization. J . Erp. Med. 144, 47G493. Durda, P. J., and Gottlieb, P. D. (1978). Sequential precipitation of mouse thymocyte extracts with anti-Lyt-2 and anti-Lyt-3 sera. I. Lyt-2.1 and Lyt-3.1 antigenic determinants reside on separable molecules. J . Immunol. 121, 983-989. Egorov, I. K. (1974). Genetic control of H-2 alloantigens as inferred from analysis of mutations. Immunogenetics 1, 97-107. Egorov, I. K., Mnatsakanyan, Y. A,, and Pospelov, L. E. (1977a). Do histocompatibility genes recognize themselves? Immunogenetics 5, 6.574. Egorov, I. K., Apt., A. S., and Vedernikov, A. A. (1977b). Unidirectional skin graft incompatibility between the H-2'j and H-217 mouse haplotypes. Immunogenetics 5, 28.5290. Eicher, E. M., Cherry, M., and Flaherty, L. (1978). Autosomal phosphoglycerate kinase linked to mouse major histocompatibility complex. Mol. Gen. Genet. (in press.) Engleman, E. G., McMichael, A,, Sasazuki, T., and McDevitt, H. 0. (1977). Suppressor T cells of the mixed lymphocyte reaction in man (abstract). Tissue Antigens 10, 247. Erb, P., Feldmann, M., and Hogg, N. (1976a). Role of macrophages in the generation o f T helper cells. IV. Nature of genetically related factor derived from macrophages incubated with soluble antigens. Eur. J . Immunol. 6, 36.5372. Erb, P., Meier, B., and Feldmann, M. (1976b). Two gene control of T-helper cell induction. Nature (London) 263, 601-604. Farr, A. G., Dorf, M. E., and Unanue, E. R. (1977). Secretion of mediators following T lymphocyte-macrophage interaction is regulated by the major histocompatibility complex. Proc. Natl. Acad. Sci. U.S.A. 74, 3542-3546. Fathman, C . G., and Nabholz, M. (1977). In uiuo secondary mixed leukocyte reaction (MLR). 11. Interaction MLR determinants expressed by F, cells. Eur. J . Immunol. 7, 370- 3 74. Feeney, A. J., and Hammerling, U. (1976). Ala-1: A murine alloantigen of activated lymphocytes. I. Serological analysis of mitogen-stimulated T and B cells. Immunogenetics 3, 369-379. Feeney, A. J., and Hammerling, U. (1977). Ala-1: A murine alloantigen of activated lymphocytes. 11. T and B effector cells express Ala-1. J . Immunol. 118, 1488-1494. Fellous, M., Hors, J . , Boue, J., Dausset, J., and Jacob, F. (1977). Are there human analogies of the mouse T locus in central nervous system malfunctions. Cong. Int. Neurol., 5th 1977. Festenstein, H., Bishop, C., and Taylor, B. A. (1977). Location of Mls locus on mouse chromosome 1. Immunogenetics 5, 357-361. Flaherty, L. (1975). H-33-a histocompatibility locus to the left of the H-2 complex. Immunogenetics 2, 325-329. Flaherty, L. (1976). The Tla region of the mouse: Identification of a new serologically defined locus, Qa-2. Immunogenetics 3, 533-539. Flaherty, L., and Rinchik, E. (1978). No evidence for foreign H-2 specificities on the EL4 mouse lymphoma. Nature (London) 273, 52-53. Flaherty, L., Zimmerman, D., and Hansen, T. H. (1978). Further serological analysis of the &a antigens. Analysis of a n anti-H-2.28 serum. Zmmunogenetics 6, 245-251.
ADVANCES I N HISTOCOMPATIBILITY IMMUNOGENETICS
347
Forman, J., and Vitetta, E. S. (1975). Absence of H-2 antigens capable of reacting with cytotoxic T cells on a teratoma line expressing a Tlt locus antigen. Proc. Natl. Acad. Sci. U.S.A. 72, 3661-3665. Freed, J. H., and Nathenson, S. G. (1972).Similarity of the carbohydrate structure ofH-2 and Ia glycoproteins. J . Zmmunol. 119, 477-482. Frelinger, J. A., and Murphy, D. B. (1976). A new alloantigen, Ly-8, recognized by C3H anti-AKR serum. Zmmunogenetics 3, 481-487. Frelinger, J. G., Wettstein, P. J., Frelinger, J. A,, and Hood, L. (1978). Epidermal Ia molecules from the Z-A and Z-EC subregions of the mouse H-2 complex. Zmmunogenetics 6, 125-135. Galfre, G., Howe, S. C., Milstein, C., Butcher, G. W., and Howard, J. C. (1977). Antibodies to major histocompatibility antigens produced by hybrid cell lines. Nature (London) 266, 550-552. Garrido, F., Schirrmacher, V., and Festenstein, H. (1975). H-2-like specificities offoreign haplotypes appearing on a mouse sarcoma after vaccinia virus infection. Nature (London) 259, 22S230. Garrido, F., Festenstein, H., and Schirrmacher, V. (1976). Further evidence for derepression of H-2 and Ia-like specificities of foreign haplotypes in mouse tumour cell lines. Nature (London) 261, 705-707. Gasser, D. L. (1976a). Genetic studies on the H-3 region of mice and implantations for polymorphism of histocompatibility loci. Immunogenetics 3, 271-276. Gasser, D. L. (1976b).H-3-linked unresponsiveness to Ea-1 and H-13 antigens. In “The Role of Products of the Histocompatibility Gene Complex in Immune Responses” (D. H. Katz and B. Benacerraf, eds.), pp. 289-295. Academic Press, New York. Glimcher, L., Shen, F. W., and Cantor, H. (1977). Identification of a cell-surface antigen selectively expressed on the natural killer cell. J . Exp. Med. 145, 1-9. Goldschneider, I. (1976). Antigenic relationship between bone marrow lymphocytes, cortical thymocytes, and a subpopulation ofperipheral T cells in the rat: Description of a bone marrow lymphocyte antigen. Cell. Immunol. 24, 289-307. Gordon, R. D., and Simpson, E. (1977). Immune response gene control of cytolytic T-cell responses to H-Y. Transplant. Proc. 9, 885-888. Gbtze, D., ed. (1977). “The Major Histocompatibility System in Man and Animals.” Springer-Verlag, Berlin and New York. Goulmy, E., Termijtelen, A., Bradley, B. A,, and van Road, J. J. (1977).Y-antigen killing by T cells of women is restricted by HLA. Nature (London) 266, 544-545. Hakansson, S., and Peterson, P. A. (1976). Presence of &-microglobulin on the implanting mouse blastocyst. Transplantation 21, 3 5 S 3 6 0 . Haller, O., Kiessling, R., Orn, A,, and Wigzell, H. (1977). Generation of natural killer cells: an autonomous function of the bone marrow. J . Exp. Med. 145, 1411-1416. Hammerberg, C., and Klein, 3. (1975). Linkage disequilibrium between H-2 and t complexes in chromosome 17 of the mouse. Nature (London) 258, 29G299. Hammerberg, C., Klein, J., Artzt, K., and Bennett, D. (19761. Histocompatibility-2 system in wild mice. 11. I?-2 haplotypes of t-bearing mice. Transplantation 21, 199-212. Hansen, T. H., Cullen, S. E., and Sachs, D. H. (1977a). Immunochemical evidence for a n additional H-2 region closely linked to H-2D. J . Exp. Med. 145, 438-442. Hansen, T. H., Cullen, S. E., Melvold, R., Kohn, H., Flaherty, L., and Sachs, D. H. (1977b). Mutations in a new H-2 associated histocompatibility gene closely linked to H-2D. J . Exp. Med. 145, 1550-1558.
348
GEORGE G . SNELL
Hansen, T. H., Cullen, S. E., Shinohara, N., Schurko, E., and Sachs, D. H. (1977~). Genetic control of the humoral response t o an H-2 public specificity. J. Immunol. 118, 1403-1408. Harmon, R. C., Clark, E. A,, O’Toole, C., and Wicker, L. S. (1977). Fksistance of H-2 heterozygous mice to parental tumors. I. Hybrid resistance and natural cytotoxicity to E L 4 are controlled by the H-2D-Hh-1 region. Zmmunogenetics 4, 601-607. Harrison, D., and Doubleday, J . W. (1976). Marrow allograft success in WIW” anemic mice: Relation to skin graft survival time. Immunogenetics 3, 289-297. Hauptfeld, V.,and Klein, J . (1977).A new histogenetic method for minor histocompatibility antigen typing. J . Immunol. 118,423-426. Hauptfeld, V., Hammerling, C., and Klein, J. (1976). Histocompatibility-2 system in wild mice. 111. Mixed lymphocyte reaction and cell-mediated lympholysis with t-bearing mice. Immunogenetics 3, 489-498. Hoffmann-Frezer, G., Gijtze, D., Rodt, H., and Thierfelder, S. (1978). Immunohistochemical localization of xenogeneic antibodies against Iak lamphocytes on B cells and reticular cells. Irnmunogenetics 6, 367-377. Horton, M. A., Beverley, P. C. L., and Simpson, E. (1978). Serological properties of antiLy-6.2 serum produced by a new immunization schedule. Immunogenetics 7 , 173178. Huber, B., Gershon, R. K., and Cantor, H. (1977). Identification of a B-cell surface structure involved in antigen-dependent triggering: Absence of this structure on B cells from CBNN mutant mice. J. Exp. Med. 145, 10-20. Jackson, D. C., Parish, C. R., and McKenzie, I. F. C. (1977). Detection and isolation of an Ia glycoprotein antigen from mouse serum. Immunogenetics 4, 267-279. Jacob, F. (1977). Mouse teratocarcinoma and embryonic antigens. Immunol. Reu. 33, 3-32. Janeway, C. A., Jr., Paul, W. E., Werblin, T. P., and Leiberman, R. (1976). IgG-specific helper activity of T lymphocytes from mice lacking the Ir-IgG gene. Immunogenetics 3, 393-400. Jeckel, J., van Dongen, J., Majoor, G., and Harder, F. (1977). Enhancement of rat renal allografts with antibodies directed against erythrocyte-associated antigens (EAA). Transplant. Proc. 9, 969-972. Kapp, J . A,, Pierce, C. W., and Benacerraf, B. (1977). Immunosuppressive factorb) extracted from lymphoid cells of nonresponder mice primed with L-glutemic acid60~ - a l a n i n e ~ ~ - t y r o s i(GAT). n e ’ ~ 11. Cellular sources and effect on responder and nonresponder mice. J . Ezp. Med. 145,828-838. Katz, D. H., and Benacerraf, B., eds. (1976). “The Role of Products of the Histocompatibility Gene Complex in Immune Responses.” Academic Press, New York. Kemler, R., Babinet, C., Eisen, H., and Jacob, F. (1977). Surface antigen in early differentiation. Proc. Natl. Acad. Sci. U.S.A. 74, 4449-4452. Kiessling, R., Petranyi, G., Karre, K., Jondal, M., Tracey, D., and Wigzell, H. (1976). Killer cells: A functional comparison between natural, immune T cell and antibody-dependent in vitro systems. J . Exp. Med. 143, 772-780. Kiessling, R., Hochman, P. S., Haller, O . , Shearer, G. M., Wigzell, H., and Cudkowicz, G. (1977).Evidence for a similar or common mechanism for natural killer cell activity and resistance to hemopoietic grafts. Eur. J . Immunol. 7 , 655-663. Klareskog, L., Sandberg-Tragordh, L., Rask, L., Lindblom, J. B., Curman, B., and Peterson, P. A. (1977). Chemical properties of human Ia antigens. Nature (London) 265,24a251.
ADVANCES I N HISTOCOMPATIBILITY IMMUNOGENETICS
349
Klareskog, L., Tjernlund, U. M., Forsum, U., and Peterson, P. A. (1977). Epidermal Langerhans cells express Ia antigens. Nature (London) 268, 248-250. Klein, J. (1975). “Biology of the Mouse Histocompatibility-2 Complex.” Springer-Verlag, Berlin and New York. Klein, J. (1978). H-2 mutations: Their genetics and effect on immune functions. Adu. Zrnrnunol. 26, 5G146. Klein, J., and Hammerburg, C. (1977). The control of differentiation by the T complex. Immunol. Rev. 33, 70-104. Klein, J., and Zleska-Rutczynska, Z. (1978). Histocompatibility-2 system of wild mice. VI. Histogenetic analysis of sixteen congenic lines. J . Immunol. (in press). Klein, J., Geib, R., Chiang, C., and Hauptfeld, V. (1976a). Histocompatibility antigens controlled by the Z region of the murine H-2 complex. I. Mapping of the H-2A and H-2C loci. J . Exp. Med. 143, 1439-1452. Klein, J., Hauptfeld, M., Geib, R., and Hammerburg, C. (1976b). Immunogenetic analysis of H-2 mutations. V. Serological analysis of mutations H-2do,H-2’“, and H-2‘““. Transplantation 22, 572-582. Klein, J., Merryman, C. F., Maurer, P. H., Hauptfeld, M., and Gardner, M. B. (1977). Histocompatibility-2 system of wild mice. IV. Ia and Ir typing of two wild mouse populations. Cold Spring Harbor Symp. Quant. Biol. 41, 457-463. Klein, P. A. (1975). Anomalous reactions of mouse alloantisera with cultured tumor cells. I. Demonstration of widespread occurrence using reference typing sera. J . Zmmunol. 115, 1254-1260. Koo, G. C., Wachtel, S. S., Saenger, P., New, M. I., Dosik, H., Amarose, A. P., Dorus, E., and Ventruto, V. (1977). H-Y antigen: Expression in human subjects with testicular feminization syndrome. Science 196, 655-656. Kralova, J.,and Demant, P. (1976). Expression of the H-Y antigen on thymus cells and skin: Differential genetic control linked to the K end of H-2. Zmmunogenetics 3, 583-594. Krco, C. J., and Goldberg, E. H. (1976). H-Y (male) antigen: Detection in eight-cell mouse embryos. Science 193, 1134-1135. Lane, D. P., and Silver, D. M. (1976). Isolation of a murine liver-specific alloantigen, F-antigen, and examination of its immunogenic properties by radio-immunoassay. Eur. J . Zmmunol. 6, 480-485. Lemonnier, F., Neauport-Sautes, C., Kourilsky, F. M., and DBrnant, P. (1975).Relationships between private and public H-2 specificities on the cell surface. fmmunogenetics 2, 517-529. Lesley, J. F., and Lennon, V. A. (1977). Transitory expression of Thy-1 antigen in skeletal muscle development. Nature fLondon) 268, 163- 165. Levinson, J. R., and McDevitt, H. 0. (1976). Murine T factors: An association between alleles a t t and H-2. J . Exp. Med. 144, 834-839. Livnat, S., and Cohen, I. R. (1976). Recruitment of effector lymphocytes by initiator lymphocytes. Recruited lymphocytes are immunospecific and include graft-versushost-reactive lymphocytes. J . Zmmunol. 117, 61P619. Lotzova, E. (1977a). Induction of unresponsiveness to bone marrow grafts. J . Zmmunol. 119,543-547. Lotzova, E. (1977b). Involvement of MHC-linked hemopoietic-histocompatibility genes in allogeneic bone marrow transplantation in mice. Tissue Antigens 9, 14S152. McDevitt, H. O., Delovitch, T. L., and Press, J. L. (1977).Functional and genetic analysis of Ia antigens. Cold Spring Harbor Symp. Quant. Biol. 41, 489-496.
350
GEORGE G. SNELL
McKenzie, I. F. C., and Henning, M. M. (1977). Studies of immunogenicity and enhancement of alloantigens of the various regions of the H-2 complex. Transplant. Proc. 9, 609-612. McKenzie, I. F. C., and Snell, G. D. (1975). Ly-4.2: A cell membrane alloantigen of murine B lymphocytes. I. Population studies. J . Immunol. 114, 8 4 S 8 5 5 . McKenzie, I. F. C., Morgan, G. M., Melvold, R. W., and Kohn, H. I. (1977a). BALBIc-H2”: A new H-2 mutant in BALBlcKh that identifies a locus associated with the D region. Immunogenetics 4, 333-347. McKenzie, I. F. C., Clark, A., and Parish, C. R. (197713). Ia antigenic specificities a r e oligosaccharide in nature: Hapten-inhibition studies. J . Exp. Med. 145, 1039- 1053. . McKenzie, I. F. C., Gardiner, J., Cherry, M., and Snell, G. D. ( 1 9 7 7 ~ )Lymphocyte antigens: Ly-4, Ly-6, and Ly-7. Transplant. Proc. 9, 667-669. McKenzie, I. F. C., Cherry, M., and Snell, G. D. (1977a). Ly-6.2: A new lymphocyte specificity of peripheral T cells. Immunogenetics 5, 25-32. Martin, W. J., Gipson, T. G., Martin, S. E., and Rice, J. M. (1976). Derepressed alloantigen on transplacentally induced lung tumor coded for by H-2 linked gene. Science 194, 532-533. Martin, W. J., Gipson, T. G., and Rice, J. M. (1977). H-2”-associated alloantigen expressed by several transplacentally-inducedlung tumours of C3Hf mice. Nature (London) 265, 738-739. Melief, C. J. M., van der Meuler, M. Y., and Postma, P. (1977). CML typing of serologically identical H-2 mutants. Distinction of 19 specificities on the cells of four mouse strains carrying zl locus mutations and the strains of origin. Immunogenetics 5, 43-50. Melvold, R. W., Kohn, H. I., Yerganian, G., and Fawcett, D. W. (1977). Evidence suggesting two H-Y antigens in the mouse. Immunogenetics 5, 33-41. Meredith, P. J., and Walford, R. L. (1977). Effect of age on response to T and B cell mitogens in mice congenic a t the H-2 locus. Immunogenetics 5, 109-128. Meschini, A., and Parmiani, G. (1978). Anti-H-2 alloantibodies elicited by syngeneic immunizations with chemically induced fibrosarcoma. Immunogenetics 6,117- 123. Michaelson, J.,Flaherty, L., Vitetta, E., and Poulik, M. D. (1977). Molecular similarities between the &a-2 alloantigen and other gene products of the 17th chromosome of the mouse. J . Exp. Med. 145, 10661070. Mnatsakanyan, Y. A,, Pospelov, L. E., and Egorov, I. K. (1977). Study ofH-2 mutations mutant in hemagglutination and graft in mice. VII. Defective reactivity of the H-ZhfZ versus host tests. Genetika 13, 64-69. Morello, D., Neauport-Sautes, C., and Demant, P. (1977). Topographical relationship between H-2 specificities controlled by the D region. Immunogenetics 4, 349-364. Muhlbock, O., and Dux, A. (1977). The role of histocompatibility genes in the genesis of mammary tumours in mice. In “Tumours of Early Life in Man and Animals” (L. Severi, ed.). Murphy, D. B., and ShrefAer, D. C. (1975). Cross-reactivity between H-2K and H-2D products. 11. Identification of the cross-reacting specificities. Transplantation 20, 443-456. Murphy, D. B., Okumara, K., Herzenberg, L. A,, Herzenberg, L. A,, and McDevitt, H. 0. (1977). Selective expression of separate I region loci in functionally different lymphocytes subpopulations. Cold Spring Harbor Symp. Quant. Biol. 41, 497-504. Nagy, Z., Elliott, B. E., and Nabholz, M. (1976). Specific binding of K and I region products of the H-2 complex to activated thymus-derived (T) cells belonging to different Ly subclasses. J. Exp. Med. 144, 15451553.
ADVANCES I N HISTOCOMPATIBILITY IMMUNOGENETICS
351
Nairn, R., and Nathenson, S. G . (1978). Structural studies of the H-2D products of the mouse mutant BALBIc-H-2D“”and the parental strain BALBIcKh-H-2D“. J . Zmmunol. 121, 869-871. Nathenson, S. G., Brown, J. K., Ewenstein, B. M., Rajan, T. V., Freed, J. H., Sears, D. W., Mole, L. E., and Scharff, M. D. (1976). Studies on the chemical basis of variability and the complex cellular expression of the H-2K and H-2D products. In “The Role of Products of the Histocompatibility Gene Complex in Immune Responses” (D. H. Katz and B. Benacerraf, eds), pp. 647-666. Academic Press, New York. Nathenson, S.G., Brown, J. L., Ewenstein, B. M., Nisizawa, T., Sears, D. W., and Freed, J. H. (1977).Structural differences between parent and variant H-2K glycoproteins from mouse strains carrying H-2 gene mutations. Cold Spring Harbor Symp. Quant. Biol. 41, 343-349. Neauport-Sautes, C . , Joskowitz, M., and Demant, P. (1977a). Further evidence for two separate loci (H-2D and H-2L) in the D region of the H-2 complex. Zmmunogenetics 6, 5 13- 527. Neauport-Sautes, C., Morello, D., Freed, J. H., Nathenson, S.G., and Demant, P. (1977b3. The private specificity H-2.4 and the public specificity H-2.28 of the D region are expressed on two independent polypeptide chains, Eur. J . Immunol. 8, 511515. Nepom, J. T., Hellstrom, I., and Hellstrom, K. E. (1977).Antigen-specific purification of blocking factors from sera of mice with chemically induced tumors. Proc. Natl. Acad. Sci. U.S.A. 74, 46064609. Newton, R. C., and Warner, C. M. (1977). The immune response of inbred mouse strains to DNP-BGG. I. The effect of dose and adjuvant. Zmmunogenetics 4, 449-462. Nowinski, R. C., and Klein, P. A. (1975).Anomalous reactions ofmouse alloantisera with cultured tumor cells. 11. Cytotoxicity is caused by antibodies to leukemia viruses. J . Immunol. 115, 1261-1267. Ohno, A., Amos, D. B., and Koren, H. S.(1977). Selective cellular natural killing against human leukemia T cells and thymus. Nature (London) 266, 5 4 6 5 4 8 . Ohno, S., Christian, L. C., Wachtel, S.S., and Koo, G. C . (1976). Hormone-like role of H-Y antigen in bovine freemartin gonad. Nature (London) 261, 597-599. Okumara, K., Tokuhisa, T., Takemori, T., and Tada, T. (1977). Two loci selectively expressed on functionally different T cells. In “Third Ir Gene Workshop” (H. 0. McDevitt, ed.), pp. 147-156. Academic Press, New York. Oliver, R. T. D., and Festenstein, H. (1975). Second, third locus and 4d4b antigen associations in negroids and Caucasoids. Tissue Antigens 5, 395-401. Palm, J., Rigiero, C., and Black, G. (1977). Further studies on the number of histocompatibility loci in rats. Zmmunogenetics 4, 79-83. Parham, P., Alpert, B. N., Orr, H. T., and Strominger, J. L. (1977). The carbohydrate moiety of HLA antigens: Antigenic properties and amino acid sequences around the site of glycosylation. J . Biol. Chem. 252, 75557567. Paul, W. E . , and Benacerraf, B. (1977). Functional specificity of thymus-dependent lymphocytes, A relationship between the specificity of T lymphocytes and their functions is proposed. Science 195, 1293-1300. Pegrum, G . D., Lewis, C. M., and Kent, A. C . (1977). HLA antigens associated with the lymphocyte nucleus. Zmmunogenetics 4, 523-530. Petranyi, G. G., Kiessling, R., and Klein, G. (1975). Genetic control of “natural” killer lymphocytes in the mouse. Immunogenetics 2, 53-61. Pizarro, O., Vergara, U., and Figueroa, F. (1977). A study of histocompatibility-2 antigens in wild mice from Santiago, Chile. Zmmunogenetics 4, 57-64.
352
GEORGE G . SNELL
Rowden, G., Lewis, M. G., and Sullivan, A. K. (1977). la Antigen expression on human epidermal Langerhans cells. Nature (London) 268, 247-248. Rowden, G., Phillips, T. M., and Delovitch, T. L. (1979). Expression of Ia antigens by murine keratinizing epithelial Langerhans cells. Immunogenetics (in press). Rubinstein, P., Liu, N., Streun, E. W., and Decray, F. (1974). Electrophoretic mobility and agglutinability of red blood cells: A “new” polymorphism in mice. J.Exp. Med. 139,313-322. Sato, H., and Boyse, E. A. (1976). A new alloantigen expressed selectively on B cells: The Lyb-2 system. Immunogenetics 3, 5 6 5 5 7 2 . Itakura, K., and Boyse, E. A. (1977). Locacion of Lyb-2 on mouse chromosome 4. Sato, H., Immunogenetics 4, 591-595. Scher, I., Ahmed, A,, Strong, D. M., Steinberg, A. D., and Paul, W. E . (1975). X-linked B-lymphocyte immune defect in CBNHN mice. I. Studies of the function and composition of spleen cells. J . Exp. Med. 141, 78EL803. Schwartz, B. D., Kask, A. M., Sharrow, S. O., David, C. S., and Schwartz, R. H. (1977). Partial chemical characterization of Ia antigens derived from murine thymocytes. Proc. Natl. Acad. Sci. U.S.A. 74, 1195-1199. Seaver, S. S., Brown, A. Hammerling, G., and McDevitt, H. 0. (1976). Genetic control of the immune response: Ability of antigens of defined amino acid sequence to be recognized by the Ir-1 gene system. Eur. J . Immunol. 6, 502-507. Shearer, G. M., Cudkowicz, G., Schmitt-Verhulst, A. M., Rehn, T. G., Waksal, H., and Evans, P. D. (1977).F, hybrid antiparental cell-mediated lympholysis: A comparison with bone marrow graft rejection and with cell-mediated lympholysis to alloantigens. Cold Spring Harbor Symp. Quant. Biol. 41, 511-518. Shonnard, J . W., Cramer, D. V., Polosky, P. E., Kunz, H. W., and Gill, T. J., J r . (1976). Polymorphism of the major histocompatibility locus in the wild Norway rat. Immunogenetics 3, 193-200. Shreffler, D. C., David, C. S., Cullen, S. E., Frelinger, J . A,, and Niederhuber, J. E. (1977). Serological and functional evidence for further subdivisions of t h e 1 region of the H-2 gene complex. Cold Spring Harbor Symp. Quant. Biol. 41, 477-487. Silver, D. M., and Lane, D. P. (1977). Identification of the gene locus controlling dominant nonrespressiveness to F-antigen. Immunogenetics 4, 295-299. Silver, J.,Cecka, J. M., McMillan, M., and Hood, L. (1977). Chemical characterization of products of the H-2 complex. Cold Spring Harbor Symp. Quant. Biol. 41, 369-377. Snell, G. D. (1968). The H-2 locus of the mouse: Observations and speculations concerning its comparative genetics and its polymorphisms. Folia Biol. (Prague) 14, 335358. Snell, G. D. (1976). Recognition structures determined by the H-2 complex. Transplant. Proc. 8, 147-156. Snell, G. D. (1978). T cells, T cell antigen receptors, and the major histocompatibility complex. Immunol. Rev. 38,3-69. Snell, G. D., Cherry, M., and Demant, P. (1973a). H-2: Its structure and similarity to HL-A. Transplant. Rev. 15, 3-25. Snell, G. D., Cherry, M., McKenzie, I. F. C., and Bailey, D. W. (1973b).Ly-4, a new locus determining a cell-surface alloantigen in mice. Proc. Natl. Acad. Sci. U.S.A. 70, 110% 1111. Snell, G. D., Demant, P., and Cherry, M. (1974).Hemagglutination and cytotoxic studies ofH-2. V. The anti-27, 28,29 family of antibodies. Folia Biol. (Prague) 20,145-160. Snell, G. D., Dausset, J., and Nathenson, S. (1976). “Histocompatibility.” Academic Press, New York.
ADVANCES I N HISTOCOMPATIBILITY IMMUNOGENETICS
353
Stanton, T. H.,and Boyse, E. A. (1976).A new serologically defined locus, Qa-I, in the Tla-region of the mouse. Zmmunogenetzcs 3, 525-531. Steinman, R. M., and Witmer, M. D. (1978). Lymphoid dendritic cells are potent stimulators of primary mixed leukocyte reaction in mice. Proc. Natl. Acad. Sci. U.S.A. 75, 5132-5136. Stern, P. L. (1973).Theta alloantigen on mouse and .rat fibroblasts. Nature (London), New Biol. 246, 7678. Stevens, L. C.(1967).The biology of teratomas. Adu. Morphog. 6, 1-31. Stingl, G., Katz, S. I., Clement, L., Green, I., and Shevach, E. M. (1978).Immunologic functions of Ia-bearing epidermal Langerhans cells. J . Zmmunol. 121, 200&2013. Stingl, G., Wolff-Schreiner, E. C., Pinchler, W. J., Gschnait, F., Knapp, W., and Wolff, K. (19771.Epidermal Langerhans cells bear Fc and C3 receptors. Nature (London) 268, 245-246. Tada, T., Taniguchi, M., and Takuhisa, T. (1977).Suppressive T cell factor and its acceptor expressed on different subsets ofT cells: A possible amplification loop in the suppressor system. I n “Third Ir Gene Workshop” (H. 0. McDevitt, ed.), pp. 517-527. Academic Press, New York. Tauber, J. W., Falk, J . A,, Falk, R. E., and Zabriskie, J . B. (1976).Monospecific complement activation by streptococcal structures. I. Re-evaluation of HLA cytotoxic inhibition. J . Exp. Med. 143, 1341-1351. Taussig, M. J., Munro, A. J., and Luzzati, A. L. (1976).I-region gene products in cell cooperation. In “The Role of Products of the Histocompatibility Gene Complex in Immune Responses” (D. .K. Katz and B. Benacerraf, eds.), pp. 553-567. Academic Press, New York. Taylor, B. A,, and Meier, H. (1976).Mapping the adrenal lipid depletion gene of the AKFUJ mouse strain. Genet. Res. 26, 307-312. Taylor, B. A., and Shen, F.-W. (1977). Location of Lyb-2 in mouse chromosome 4: Evidence from recombinant inbred strains. Zmmunogenetics 4, 597-600. Tonkonogy, S. L., and Winn, H. J. (1976).A new alloantigeneic system associated with the Mls locus in the mouse. J . Zmmunol. 116, 835-841. Tonkonogy, S.L., and Winn, H. J . (1977).Further genetic and serological analyses of the LyM-1 alloantigeneic system. Zmmunogenetics 5, 57-64. Uhr, J. W., Vitetta, E. S., Klein, J., Poulik, M. D., Klapper, D. G., and Capra, J. D. (1977). Structural studies of H-2 and TL antigens. Cold Spring Harbor Symp. Quant. Biol. 41, 363-368. Vitetta, E., Artzt, K., Bennett, D., Boyse, E. A , , and Jacob, F. (1975).Structural similarities between a product of the Tit-locus isolated from sperm and teratoma cells, and H-2 antigens isolated from splenocytes. Proc. Natl. Acad. Sci. U.S.A. 72, 3215-3219. von Boehmer, H., Fathman, C. G., and Haas, W. (1977).H-2 gene complementation in cytotoxic T cell responses of female against male cells. Eur. J . Zmmunol. 7,44%447. Wachtel, S. S.,Gasser, D. L., and Silvers, W. K. (1973).Male specific antigen: Modification of potency by the H-2 locus in mice. Science 181, 862-863. Wachtel, S. S., Thaler, H.T., and Boyse, E. A. (1977).A second system of alloantigens expressed selectively on epidermal cells of the mouse. Zmmunogenetics 5, 17-24. Walford, R.L. (1977).Human B-cell alloantigenic systems: Their medical and biological significance. I n “HLA System-New Aspects” (G. B. Ferrara, ed.). North-Holland Publ., Amsterdam. Weiss, P. (1950).Perspectives in the field of morphogenesis. Q. Rev. Biol. 25, 177-198. Wernet, D.,Shafran, H., and Lilly, F. (1976).Genetic regulation of the antibody response
354
GEORGE G. SNELL
to H-2Dhalloantigens in mice. 111. Inhibition of the IgG response to noncongenic cells by preimmunization with congenic cells. J . Exp. Med. 144, 654-661. Wettstein, P. J., and Frelinger, J. A. (1977). H-2 effects on cell-cell interactions in the response to single non-H-2 alloantigens. 11. H-2D region control of H-7.1 specific stimulator function in mixed lymphocyte culture and susceptibility to lysis of H-7.1-specific cytotoxic cells. J.Exp. Med. 146, 1356- 1366. Wettstein, P. J . , and Haughton, G. (1977a).The genetic control of the immune response to murine histocompatibility antigens. I. The response to H-4 alloantigens. Immunogenetics 4, 65-78. Wettstein, P. J.,and Haughton, G. (1977b).The production, testing, and utility ofdouble congenic mouse strains. 11. B10-H-2" H-7*lWts and B10-H-2d H-7YWts. Immunogenetics 5, 85-95. Wettstein, P. J., Haughton, G., and Frelinger, J. A. (1977). H-2 effects on cell-cell interactions in the response to single non-H-2 alloantigens. I. Donor H-2D region control of H-7.1-immunogenicity and lack of restriction i n uiuo. J . Exp. Med. 146, 1346-1355. Williams, A . F. (1976). Many cells in rat bone marrow have cell-surface Thy-1 antigen. Eur. J. Immunol. 6, 5 2 6 5 2 8 . Williams, A. F., Barclay, A,, Letarte-Muirhead, M., and Morris, R. J . (1976). Rat Thyantigens from thymus and brain: Their tissue distribution, purification and chemical composition. Cold Spring Harbor Symp. Quant. Biol. 41, 51-62. Winchester, R. J., Ross, G. D., Jarowski, C. I., Wang, C. Y., Hapler, J., and Brocmeyer, H. E. (1977). Expression of Ia-like antigen molecules on human granulocytes during early phases of differentiation. Proc. Natl. Acad. Sci. U.S.A. 74, 4012-4016. Womack, J. E., and Eicher, E. M. (1977). Liver-specific lysosomal acid phosphartase deficiency ( A p l ) on mouse chromosome 17. Mol. Gen. Genet. 155, 315-317. Woody, J . N. (1977). Ly-6 is a T-cell differentiation antigen. Nature (London) 261,61-63. Woody, J. N., Feldmann, M., Beverley, P. C. I., and McKenzie, I. F. C. (1977). Expression of alloantigens Ly-5 and Ly-6 on cytotoxic effector cells. J . Immunol. 118, 17391743. Yamazaki, K., Boyse, E. A,, Mike, V., Thaler, H. T., Mathieson, B. J.,Abbott, J . , Boyse, J., Zayas, Z. A., and Thomas, L. (1976). Control of mating preferences in mice by genes in the major histocompatibility complex. J . Exp. Med. 144, 1324-1335. Yano, A., Schwartz, R. H., and Paul, W. E. (1977). Antigen presentation in the murine T-lymphocyte proliferative response. I. Requirement for genetic identity a t the major histocompatibility complex. J . Exp. Med. 146, 82&843. Zaleska, M., and Klein, J. (1978). Genetic control of the immune response to Thy-1 antigens. Immunol. Reu. 38, 120-162. Zaleska-Rutczynska, Z., and Klein, J. (1977). Histocompatibility-2 system in wild mice. V. Serological analysis of sixteen BIO.W congenic lines. J . Immunol. 119, 19031911. Zeicher, M., Mozes, E., and Lonai, P. (1977). Lymphocyte alloantigens associated with X-chromosome-linked immune response genes. Proc. Natl. Acad. Sci. U.S.A. 74, 721-724. Zeleny, V., MatouSek, V., and Lengerova, A. (1978). Intercellular adhesiveness of H-2 identical and H-2 disparate cells. J . Immunogen. 5, 41-47. Zink, G. L., and Heyner, S. (1977). The production of non-H-2 histocompatibility alloantibodies in the mouse. Immunogenetics 4, 257-266. Zink, G. L., and Heyner, S. (1978). Further studies on non-H-2 histocompatibility alloantibodies in the mouse. Immunogenetics 6, 269-276.
ADVANCES I N HISTOCOMPATIBILITY IMMUNOGENETICS
355
Zinkernagel, R. M., Althage, A.. Adler, B., Blanden, R. V., Davidson, W. F., Kees, U., Dunlop, M. B. C., and Shreffler, D. C. (1977a). H-2 restriction of cell-mediated immunity to an intracellular bacterium. Effector T cells are specific for Listeria antigen in association with H-21 region-coded self-markers. J. Exp. Med. 145, 1353- 1367, Zinkernagel, R. M., Adler, B., and Althage, A. (197%). The question of derepression of H-2 specificities in virus-infected cells: Failure to detect specific alloreactive cells after systemic virus infection or alloantigen detectable by alloreactive T cells on virus-infected target cells. Zmmunogenetics 5, 367-378. Zinkernagel, R. M., Callahan, G. N., Klein, J., and Dennert, G. (1978). Cytotoxic T cells learn specificity for self H-2 during differentiation in the thymus. Nature (London) 271, 251-253.
HEREDITARY ANEMIAS OF THE MOUSE: A REVIEW FOR GENETICISTS* Elizabeth
S. Russell
The Jackson Laboratory. Bar Harbor. Maine
I . Introduction . . . . . . . . . . . . . . . . . . . . . I1. Hemopoiesis in Hematologically Normal Mice . . . . A . Developmental Changes . . . . . . . . . . . . . . B . Erythroid Homeostasis . . . . . . . . . . . . . . C . Polymorphism of Adult Hemoglobins . . . . . .
. . . .
. . . .
. . . .
. . . . . . . . . . .
. . . . . . . . . .
. . . . . . . . .
D . Embryonic Hemoglobins . . . . . . . . . . . . . . . . . . . . . E . Hemopoietic Stem Cells and Their Derivatives . . . . . . . . . . . F . Normal Erythroid Differentiation and Maturation . . . . . . . . . G . Hemopoiesis in Culture . . . . . . . . . . . . . . . . . . . . . . H . Normal versus Genetically Deficient Hemopoiesis . . . . . . . . . 111. Three Macrocytic Anemias . . . . . . . . . . . . . . . . . . . . . . A . Genetic Structure of W, S'l, and an Loci . . . . . . . . . . . . . . B . Abnormal Fetal Erythropoiesis . . . . . . . . . . . . . . . . . . C. Pertinent Genetic Stocks for Physiological Studies . . . . . . . . . D . Erythroid Homeostatic Mechanisms in Mice with Macrocytic Anemias E . Nonerythroid Aspects of Hemopoiesis in WIW", Sl/Sld, and anlan Mice F . Implantation Therapy and Spleen Colony Formation in Relation to Macrocytic Anemias . . . . . . . . . . . . . . . . . . . . . . . G . Therapy of W-Anemias by Allogeneic Hemopoietic Tissue Implants . H . Radiosensitivity of Mice with Macrocytic Anemias . . . . . . . . . I . Studies of Macrocytic Anemias in Vitro . . . . . . . . . . . . . . J . Trying To Put It All Together . . . . . . . . . . . . . . . . . . . IV . Defects in Iron Utilization . . . . . . . . . . . . . . . . . . . . . . A . Transitory Siderocytic Anemia of Flexed Mice . . . . . . . . . . . B . Sex-Linked Anemia, an Abnormality of the Intestinal Mucosa . . . C . Microcytic Anemia, a Generalized Defect in Iron Absorption . . . .
358 362 362 364 366 368 369 373 376 378 379 380 386 387 390 393 395 401 404 406 408 411 412 417 420
*The preparation of this review. and previously unpublished results. was supported in part by U.S. Public Health Service Grant CA-01074 from the National Cancer Institute. by DOE contract EY-3264. and by Grant ACS-VC58J from the American Cancer Society. 357 ADVANCES I N GENETICS. Vol 20
Copyright 0 1979 by Academic Press. Inc . All rights of reproduction in any form reserved . ISBN 0-12-017620-3
358
ELIZABETH S. RUSSELL
V. Spontaneous Hereditary Hemolytic Anemias, with Fragile Fkd Cells . A. Genetic Information . . . . . . . . . . . . . . . . . . . . . . . B. Descriptions of the Single-Locus Hemolytic Syndromes . . . . . . C. Absence of Hemoglobinopathy and Enzyme Defect . . . . . . . . D. Evidence of Red Cell Membrane Defects . . . . . . . . . . . . . E. Identification of Heterozygous Carrier Mice . . . . . . . . . . . F. The Autoimmune Hemolytic Anemia of NZB/Bl Mice . . . . . . . VI. Hemoglobinopathies Induced by Mutagens . . . . . . . . . . . . . A. Human versus Mouse Frequency of Hemoglobinopathy . . . . . . B. P-Chain Abnormalities in Mice . . . . . . . . . . . . . . . . . C. The Oak Ridge a-Thalassemias . . . . . . . . . . . . . . . . . D. The Jackson Laboratory a-Thalassemia . . . . . . . . . . . . . VII. General Comments on Hypochromic Anemias . . . . . . . . . . . . VIII. Anemias Secondary to Genetic Defects in Other Systems . . . . . . A. Embryonic Anemia of Tail-short Heterozygotes . . . . . . . . . . B. Anemia in Some Newborn Strong’s Luxoid Mice . . . . . . . . . C. Macrocytic Anemia in Diminutive Mice . . . . . . . . . . . . . D. Normocytic Anemia Associated with Cribriform Degeneration . . . IX. General Summary . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . .
.
. . . .
.
.
.
. . . .
. .
. .
.
424 424 426 427 428 430 43 1 436 436 438 438 439 440 442 442 443 444 444 445 445
I. Introduction
A considerable variety of single-gene induced anemias have been identified and characterized in laboratory colonies of M u s musculus, and some excellent reviews of their natures and effects have been published already (Bernstein, 1969; Bannerman et al., 1973). My own latest attempt in this line (Russell, 1970) appeared as a chapter in a very useful book on regulation of hematopoiesis (Gordon, 1970).I hope in this present review to achieve two things: review and evaluation of the many advances in this field since 1970; and presentation of a more detailed discussion of the formal genetics of mouse anemias and of their significance for analysis of patterns of mammalian gene action than can be suitably incorporated in a review aimed at hematologists. Because of its intrinsic interest, and because physiological genetics always depends upon analysis of the basis for phenotypic difference observed between animals of two genotypes, I will also describe normal hemopoietic development and homeostasis and hemoglobin polymorphism. For detailed coverage of literature before 1970, and for more extensive hematology, readers are referred to the reviews cited and to three pertinent chapters in the second edition of “The Biology of the Laboratory Mouse” (E. L. Green, ed., 1966): Chapters 8 (M. C. Green, 1966), 19 (Russell and Bernstein, 19661, and 29 (Russell and Meier, 1966).
HEREDITARY ANEMIAS OF THE MOUSE
359
Throughout this review inbred strains will be mentioned repeatedly, frequently as genetic backgrounds with which particular mutant alleles are congenic. When the subline of a particular strain used is known, its designation will be added (i.e., WB/Re or C57BL/6J). Many interstrain F, hybrids will also be mentioned. At its first appearance in the text, parent strain names will be given in full (i.e., WB/Re-W/+ X C57BL/&JJ-Wv/+1. Thereafter, each F, hybrid will be listed by its recognized short symbol (i.e., WBBGF,- WIW", etc.). At the end of 1978, mutant alleles, each leading to some type of anemia at some or all stages in the life history of affected mice, were identified at 17 genetic loci, and 12 of these loci have been located (boldface) on 10 different chromosomes (Fig. 1).For this review, the anemias will be classified into five convenient categories, with at least one overlap between categories: 1. Anemias of maturation arrest, always macrocytic, a t present involving mutant alleles at three different loci, including dominantFIG. 1(pp. 360,361). Genetic linkage map ofthe mouse, with information on location of seventeen mutants affecting hematological characteristics (adapted from Roderick and Davisson, 1978). Linkage is not yet known for ha, h b d j u , nb, sph. [The tail-short locus has been located on chromosome 11, between Re and Es-3 (Sweet and Lane, 1978).] In the text of this review, reference is made to numerous other genetic loci. The following key is provided to assist readers in locating these loci: Lu 8-Aminolevulinate dehydratase, Agouti-locus, Chr 2 Chr 3 Beige hair coat and M i trh Microphthalmia-white, Chr 6 Chediak-Higashi syndrome, Chr 13 Mitochondria1 malic enzyme, Mod-2 Black light, dominant allele at Chr 7 the brown ( b ) locus, Chr 4 Oligosyndactylism, Chr 8 0s Albino hair coat, Chr 7 Ph Patch, Chr 5 Caracul hair coat, Chr 15 Pintail, Chr 4 Pt Dancer, Chr 19 Ragged, Chr 2 Ra Sombre, dominant Rex, Chr 11 Re allele a t recessive Ruby, Chr 19 ru yellow (el locus Rumpwhite, Chr 5 Rw Scant hair, Chr 9 Ears-hairy, Chr 15 sch Short-Danforth, Chr 2 Sd Epilation, Chr 19 Short-ear, Chr 9 se Angora, Chr 7 Grey-lethal, Chr 10 Shaker-2, Chr 11 sh-2 Twirler, Chr 18 Tw Histocompatibility-1, Chr 7 Varitint-waddler, recently Va Major histocompatability moved from Chr 12 to Chr 3* complex locus, Chr 17 wa-2 Waved-2, Chr 11 Hammer-toe, Chr 5 Extra-toes, Chr 13 Loop-tail, Chr 1 Xt *All loci listed on chromosome 12 have been shown t o be on chromosome 3 (Eicher, personal communication).
3 60
ELIZABETH S. RUSSELL
I
5
4
6
7
8
10
'I
6
2 I
3 2
9
I
3 &
6
: 9
'PI
4
t
Ud
i 6 1
! rn,
b
I 'PI
2 me I
,
21
co
Ldr-l
I
PEP- 2
PK-3 P
r -"-I8
ACO! ENO-I AK- 2
AK- 1
PEP-7 REC-1
PEP-4 Ldh-1
I D " - *APRT
RAM-!
HK-1
B I
362
ELIZABETH S. RUSSELL
spotting (multiple W alleles); steel (multiple SZ alleles); and Hertwig's anemia (an). 2. Anemias involving defects in iron utilization, at present consisting of mutants at three loci, including sex-linked anemia (sZa), microcytic anemia (m k) , and the transitory siderocytic anemia of flexedtailed (flfl mice. 3. Anemias involving greatly reduced erythrocyte life-span, including hemolytic anemia ( h a ) ,jaundice ( j a ) ,normoblastic anemia (nb), and spherocytosis (sph),plus the multigenically induced autoimmune hemolytic anemia, which develops in all mice of the NZB inbred strain. 4. Hemoglobinopathies, consisting at present of three instances of genetically transmissible a-thalassemias (nonexpression of a-globin gene), which appeared independently of each other in offspring of mice that had been irradiated or treated with a chemical mutagen, plus one radiation-induced chromosome anomaly that involves the p-globin chain and leads to a mild normochromic anemia. 5. Anemias almost certainly secondary to genetically induced defects, whose major effects are in other tissues, including, but not necessarily limited to, tail-short (7's 1, cribriform degeneration (cri1, diminutive ( d m ) ,and luxoid (Zu). II. Hernopoiesis in Hernotologically Normal Mice
Analysis of gene actions leading to anemia depends upon, and contributes to, understanding of normal hemopoiesis and hematologic homeostasis. Important aspects of these processes are: developmental changes in site and nature of hemopoiesis; homeostatic mechanisms that regulate blood values under normal conditions and in response to hematologic challenge; differences in hemoglobins produced; the nature, functions, and interrelations of hemopoietic stem cells; and the initiation and pattern of normal erythroid differentiation both in vivo and in vitro. A. DEVELOPMENTAL CHANGES During the total life of a mouse, including prenatal development, hemopoiesis takes place in four different sites (reviewed by Russell and Bernstein, 1966) (Fig. 2). At first, between 7 and 11 days of gestation, hemopoiesis takes place in the yolk sac, where large nucleated erythrocytes develop in blood islands and migrate into the body proper of the fetus. Circulation of these cells commences on day 9. All yolk sac
363
HEREDITARY ANEMIAS OF THE MOUSE
Stage
Site
Red Cells Produced
Hemoglobins
Throughout Life Marrow
FIG. 2. Schematic presentation of developmental changes in mouse hemopoiesis: three successive sites; changes in erythrocyte sizes and presence versus absence of nucleus; changes in hemoglobins produced. Arrows indicate potential migratory paths of hemopoietic stem cells (SC).
hemopoiesis seems to occur more or less synchronously, in a single "wave." Hemoglobin synthesis begins in precursor cells in the yolk sac, but continues in the circulation. The cytoplasm of 11-day nucleated erythrocytes is packed with polyribosomes, but few or none are seen in 14- or 15-day nucleated erythrocytes (Kovach et al., 1967). As late as 12 days, mitoses are frequently seen in moderately hemoglobinized circulating erythrocytes, but thereafter the nucleus becomes pycnotic and is eventually extruded. As soon as the fetal liver has differentiated appropriately (11.5 days or 28 somites), it becomes the chief site of hemopoiesis (Johnson and Jones, 1973) and remains so until fetal day 16 to 18. Although the point has not been absolutely settled (Marks and Rifkind, 19721, the bulk of evidence a t present suggests that the initial hemopoietic cells in the fetal liver have been seeded from the yolk sac, rather than differentiating in situ (Moore and Metcalf, 1970; Johnson and Moore, 1975). The level of hemopoietic activity is very high in the fetal liver. From day 12 to day 16 of gestation, while the mean body weight of hematologically normal FIJlRe- +/+ fetuses increases 10-fold (from 52 mg to 519 mg), the mean total red cell mass, or erythron, increases 70-fold (from 11.6 x 10%to 724 x los erythrocytes) (Russell et al.,
364
ELIZABETH S. RUSSELL
1967). Erythroid differentiation in the fetal liver is very similar to that seen later in bone marrow and spleen. Erythrocytes formed in the fetal liver are somewhat larger (mean diameter, 8 pm) than are erythrocytes of adult mice (mean diameter, 6 pm) (Russell and Bernstein, 1966). Although hemopoiesis continues in the liver until birth and for a brief time thereafter, hemopoiesis (largely myelopoiesis) commences in the spleen on fetal day 15 or 16, and in the marrow (more extensively erythropoiesis) around the time of birth. The level of hemopoietic activity continues to be high during the postnatal period of rapid growth (Gruneberg, 1941). The mean red cell count of WBB6F,-+/+ mice rises from 4.6 x lo6 RBC/mm3 a t birth to 8.8 x lo6 RBC/mm3 at 28 days, while the body weight also increases 10-fold, so that the circulating red cell mass has increased 15-20 times (Russell and Bernstein, 1966). B. ERYTHROID HOMEOSTASIS Normal mice achieve adult hematologic status by 10-12 weeks of age, when their rapid growth spurt has been completed. Mice from different inbred strains show slightly different levels for various hematological parameters. However, typical values and rank orders, determined for mice from an array of 10 inbred strains a t the Jackson Laboratory in 1951, remain valid in 1977 in all laboratories where they have been tested. The mean erythrocyte number for C3WHeJ adults (low) was 8.79 x lo6RBC/mm3,that for C57BWcdJ adults (high) was 10.54 x lo6 RBC/mm3; the lowest mean cell volume was 41.4 pm3 for DBA/2J, the highest 51.5 pm3 for C57L/J. Mean corpuscular hemoglobin content (0.29- 0.31 gm/cm3) and proportion of reticulocytes ll.5-3.5%) varied little between strains. Total hemoglobin content (12.1-15.0 gm/dl) and total hematocrit percentage, or ratio of packed red cells to total blood volume (39.5-50.6%), seemed to depend upon each strain’s typical combination of erythrocyte number and mean cell volume (Russell and Bernstein, 1966). The circulating life-span of normal red cells depends upon their random destruction (10-3W are removed this way) and their intrinsic potential life-span (Landaw and Winchell, 1970), which presumably depends upon continued enzyme activity and integrity of the red cell membrane. The potential red cell life-span, determined by measurement of carbon monoxide production attributable to breakdown of the heme moiety of hemoglobin in a labeled cohort of erythrocytes, varied slightly according to genotype
HEREDITARY ANEMIAS OF THE MOUSE
365
[mean for (WC/Re x C57BL/6J)Fl mice, 57 days, for (C57BL/6J
X
A/J)Fl mice, 53 days, for SEC/lRe mice, 47 days] (Landaw et al., 1970).
Maintaining appropriate levels of hemoglobin to supply oxygen to tissues is of course essential and requires a homeostatic mechanism that can stimulate moderate (replacement) erythropoiesis under normal conditions, but can also respond quickly by stimulating much more erythropoiesis under conditions of hematologic stress. Examples of such stress are loss of blood or massive destruction of red cells by agents such as phenylhydrazine. It also is essential that adequate levels of all substances that must be absorbed by blood-forming tissue be, in fact, available to these cells. Increased numbers of red cells are needed to supply needed oxygen to tissues in hypoxic environmental conditions. Thus, the homeostatic mechanisms governing hemopoiesis must be able to stimulate more erythropoiesis during hypoxia. A great deal of evidence has accumulated indicating that the glycoprotein hormone, erythropoietin, is the primary stimulus to erythroid differentiation and maturation in the mouse (Krantz and Jacobson, 1970). Under normal ambient atmospheric conditions, low levels of oxygen are transported to the kidney by circulating red cells. This normal oxygen supply stimulates the kidney to secrete low to moderate levels of erythropoietin into the blood plasma. This level of plasma erythropoietin stimulates erythropoietin-sensitive cells in the blood-forming tissue, which leads to the maturation of a n appropriate number of red cell precursors to add just enough new reticulocytes to the circlation to replace the erythrocytes lost by attrition. Reduction of the red cell mass, whether by excessive bleeding, chemical destruction of red cells, or killing of stem cells and erythroid precursors by X-irradiation, reduces the oxygen supply to the kidney and increases the secretion of erythropoietin. The increased supply of erythropoietin stimulates further erythropoiesis, which may be observed as an increase in iron uptake and in the proportion of hemecontaining cells in the marrow and spleen. This is followed by reticulocytosis and increasing numbers of circulating erythrocytes. “Stress” erythropoiesis occurs in response to sudden hypoxia, bleeding, red-cell destruction, or presence of extra exogenous erythropoietin. In the mouse, one especially early sign of such “stress” erythropoiesis is the appearance in the spleen of 10- to 100-fold elevated levels of nucleoside deaminase activity, 10-24 hours after exposure to various erythropoietic stimuli. This is accompanied by a reduction in the time between initiation of erythropoiesis and the release of reticulocytes
366
ELIZABETH S. RUSSELL
into the circulation (Rothman et al., 1970). Elevation of this enzyme always starts in very early erythroblasts exposed to high levels of plasma erythropoietin, and it persists throughout erythropoiesis and in the circulating red cell. Thus, a cohort of mouse red blood cells resulting from “stress” erythropoiesis can be identified by their high nucleoside deaminase activity. If extra red cells are added to the circulation by hypertransfusion, so that the mouse becomes polycythemic, secretion of erythropoietin drops to zero, and erythroid differentiation stops completely until normal red cell attrition brings the hematocrit percentage back to normal levels. Polycythemia can also be achieved by first exposing a mouse to constant hypoxia (which stimulates formation of extra new red cells and elevation of the hematocrit percentage, typically to 65% or 70%) and then returning the mouse to normal atmospheric pressure. A wave of erythropoiesis can be induced in polycythemic mice by injection of exogenous erythropoietin, providing an accurate method for assay of plasma erythropoietin content (Keighley et al., 1966; Russell and Keighley, 1972). Splenic erythropoiesis is rare in man, but very common in the mouse, particularly during response to hemopoietic challenge (Coleman et al., 1969; Harrison and Russell, 1972). Pregnancy in the mouse constitutes a hemopoietic challenge, because of greatly increased total blood volume, and at this time the spleen enlarges and becomes a major site of erythropoiesis, equivalent in activity to 40 femora (Fowler and Nash, 1968). C. POLYMORPHISM OF ADULT HEMOGLOBINS Hematologically normal adult mice from many different inbred strains regularly produce more than one kind of hemoglobin, and the arrays of normal hemoglobins produced in mice from different inbred strains are not exactly the same. There is widespread genetic polymorphism at both the Hba locus, determining a-globin structure, and the Hbb locus, determining P-globin structure (list compiled by Staats, 1976), and both loci involve considerable genetic complexity (Russell and McFarland, 1974; Harleman, 1977). A very useful term to use in discussing the various Hba and Hbb “breeding units” is “haplotype.” As originally used for complex major histocompatibility loci (HLA in man, H-2 in the mouse), “haplotype” designates complex hereditary entities, composed of very closely linked genes, or cistrons, each responsible for a distinct primary product, “which because of
HEREDITARY ANEMIAS OF THE MOUSE
367
closeness of the linkage tend to be inherited as a unit" (Snell et al., 1976). The existence of five Hba haplotypes involving production of four distinct structures of a-globin chains, termed 1, 2, 3, and 4, has long been recognized (Hilse and Popp, 1968). These a-globin chains are obviously homologous, differing from each other a t one position only (chains, 1 , 2 , and 3 have different amino acids a t position a-68 only), a t two positions (chain 2 differs from 4 a t positions a-25 and a-621, or at three positions (chains 1 and 3 differ from chain 4 a t positions a-25, a-62, and a-68). All adult hemoglobins produced in mice with haplotype Hba" (for example, in C57BL/6 or 129/J inbred mice) contain a-chain 1 only. All adult hemoglobins produced in mice of the now extinct NB strain (Hba') were reported to contain a-chain 4 only. However two kinds of hemoglobin are produced in adult mice of many other inbred strains. Mice with the Hbab haplotype (for example, mice from the BALB/c or SEC/lRe inbred strains) produce approximately equal amounts of hemoglobins with the a-2 globin chain and with the a-3 globin chain. Approximately two-thirds of the hemoglobin of mice with the Hba' haplotype (for example, SJUJ or C3HeB/J) has the a-4 chain, while the other third contains for a-1 chain. Recently two further Hba haplotypes have been distinguished by isoelectric focusing (Whitney et al., 1979). All adult hemoglobin produced in mice of the Hbaf haplotype (for example, CE/J or AKRJJ inbred mice) contains a fifth kind of a-chain, whose structure is not yet known. All mice with the Hbaghaplotype (for example, A/J or DBA/2J) produce hemoglobins with both a-chain 5 and a-chain 1. This array of phenotypes clearly indicates a history of duplication (probably tandem) of the a-chain "gene," or cistron, followed by slight differentiation. It seems very probable that the rare event of intrahaplotype crossingover occurred a t some time, since in different mice, a-chain 1 is found alone, or in association with chains a-2, a-4, or a-5, and in other mice chains a-2 and a-3 are found together. Similarly, five haplotypes have been described for M u s musculus a t the Hbb, or P-chain structural locus (reviewed by Russell and McFarland, 1974). With one exception, all the adult hemoglobin produced by HbbS/Hbbsmice (for example, C57BL/6J or SEC/lRe inbred mice) contains the same P-globin chain, termed PS,whose amino acid sequence is very similar to that of human P, with only 27 amino acids different (Popp, 1973). In NB and SWR, Popp found a reversed order a t positions P72-73 (Asp-Ser instead of Ser-Asp). However, adult homozygous Hbbd/Hbbd mice (for example, C3WJ or DBA/W) produce unequal
368
ELIZABETH S. RUSSELL
amounts of hemoglobins with two different pchains (in adults, 8% differing from pd differing from p a t three positions, and 20% p* ps at 11 positions). pdmaj differs from pd in six positions (Gilman, 1972, 1976b; Popp and Bailiff, 1973). In addition, adult mice of two particular inbred strains, AU/SsRe and HBBP/Cag, homozygous for HbbplHbbp(Harleman, 19771, produce 80% hemoglobin containing the pd maj globin chain (identical to that in Hbb* mice), and 20% hemowhich differs from globin containing a different minor chain, p p pd at two positions (Gilman, 1974). Structure of the major p-chain of Hbb*Mus musculus castaneus differs at one position from that in M . m. musculus (Gilman, 1974). Obviously the Hbb locus, also, is complex, containing duplicated and differentiated cistrons. No explanation has yet been proposed to account for the strikingly unequal proportions in adult mice of pdmaj vs pd or pp It is very interesting that, although the nonnucleated erythrocytes originating in the fetal liver contain the same kinds of hemoglobin as do adult erythrocytes of mice of the same genotype, the proportion of hemoglobin with the ppmin chain has been proven to be significantly higher in fetuses (30%) than in adults (20%)(Whitney, 1977).A higher level of the minor hemoglobin persists for a time after birth, with the adult proportions firmly established only after the postnatal period of rapid growth.
D. EMBRYONIC HEMOGLOBINS Three hemoglobins synthesized in the first (yolk sac) generation of nucleated erythrocytes are very different from those produced in late fetal and adult nonnucleated erythrocytes (Craig and Russell, 1964). One of the embyronic hemoglobins (EI) contains no adult-type globin chains (Fantoni et al., 1967). Instead, EI contains “x” chains, each with structure related to, but distinctly different from, that of the adult a-chain (more than one-third of sequence different) (Melderis et al., 1974; Steinheider et al., 1975).“The structure of the x chain of different species (mouse, rabbit, man) seems to be closely related. . . . x chains may contribute essentially to the high oxygen affinity of embryonic mouse hemoglobin” (Steinheider et al., 1975). EI also has “y” chains, with structure related to, but quite different from, that of the adult P-globin chains (roughly one-third of the amino acid sequence different) (Steinheider et al., 1972). EII embryonic hemoglobin contains adult a-globin and embryonic y-globin chains, and EIII contains adult a-globin and a second @-like embryonic globin chain, called the z-chain (Fantoni et al., 1967). The
HEREDITARY ANEMIAS OF THE MOUSE
369
structure of this embryonic chain is quite different from that of the y-chain (Steinheider et al., 1975). A genetic variant (y’ vs y2>has been described for EI and EII, that contain the embryonic y-chain (Gilman and Smithies, 1968). Gilman (1976a) also presented a detailed amino acid sequence. The study of Gilman and Smithies first demonstrated linkage between the P-chain cistron and the y-chain cistron, and a later survey of adult vs embryonic hemoglobin phenotypes in mice from 115 different inbred strains showed complete association of the embryonic y’ phenotype with adult Hbbs and of embryonic y2 with adult Hbbd and HbbP (Stern et al., 1976). This latter finding indicates that the determinant for the embryonic yl- vs y2-chain should be included within the appropriate Hbb haplotype. This is especially interesting since, although the p- and y-globin structures are sufficiently alike to be obviously homologous, the conditions calling for the expression of the two kinds of globin chains are very different, suggesting major differences in regulation of gene expression (Fig. 2). The embryonic y-chain is closely related in structure to pdmin; they have identical amino acids at four of the six positions, which differ between pdmaj and pdmin (Steinheider et al., 1975b). Comparing y and pd “differences cluster at the amino end, with a few at the carboxy end, and none in the middle” (Steinheider et al., 1975b). Comparing z and Pd “the substitutions cluster at the middle of the sequence, with few at either end. . . . These findings suggest that either the p-chain genes or the embryonic y and z chain genes arose by a crossover event between nonidentical genes. Either a single or a double crossover could explain the data” (Steinheider et al., 1975b). Although EI, EII, and EIII are certainly the predominant hemoglobins synthesized in the embryonic nucleated erythrocytes, there is some evidence implying the presence of limited amounts of adult-type hemoglobin in nucleated erythrocytes of 1%l k d a y fetuses (Brotherton and Chui, 1977; Chui et al., 1979).
STEMCELLSAND THEIRDERIVATIVES E. HEMOFQIETIC Continued maintenance of an adequate supply of circulating hemoglobinized cells is essential for sustaining life, but in mammals the nonnucleated erythrocyte is not capable of self-renewal. In the mouse both marrow and spleen contain a self-renewing population of pluripotent hemopoietic stem cells, not as yet identifiable by any morphological criterion, but clearly assessed by functional tests. “Stem cells” must “possess extensive proliferative potential” with “capacity to replenish their own numbers when these are depleted either by injury or
370
ELIZABETH S. RUSSELL
under physiological conditions,” and their progeny must be able to differentiate into “mature cells with functional characteristics” usually dependent “upon the appearance within the cells of specific molecules not previously present” (McCulloch, 1970). An important kinetic feature of the hemopoietic stem cell population is its ability to respond “to certain stimuli inducing differentiation into the various subpopulations of cells originating from it” (Lajtha and Schofield, 1971). Pluripotent hemopoietic stem cell populations in the mouse may well be potentially immortal; they certainly can survive and function much longer than can the whole mouse (Harrison, 1973, 1975). Pluripotent stem cells appear to be the ancestors of all recognized types of circulating blood cells, including erythrocytes, granulocytes, megakaryocytes, and lymphocytes (including both T cells and B cells) (Fig. 3) (Lajtha and Schofield, 1971). Hemopoietic stem cells, like many other cells with great proliferative capacity, are highly radiosensitive. Death following acute exposure to whole-body irradiation (LD,,, for normal mice, 850 R to 950 R, depending upon genotype and husbandry) results from hemopoietie
Erythrocytes
<
Granulocytes
x30-60
I I
.;:-...:*
-. Pla t e le Is
x 1000
FIG. 3. Interrelationship ofthe hemopoietic cell populations: CF, colony-forming cell; ERC, erythropoietin-responsive cell; EP,, erythropoietin; GP,, TP,, granulopoietin, thrombopoietin; ARC, antigen-reactive cell; PFC, precursor of plaque-forming cell. (Reprinted with permission from Lajtha and Schofield, 1971.)
HEREDITARY ANEMIAS OF THE MOUSE
371
failure (McCulloch, 1970). The lives of lethally irradiated mice can be saved by intraperitoneal or intravenous injections of suspensions of marrow or spleen cells from normal donors (Congdon, 1959). “A suitable number of hemopoietic cells injected . . . will form macroscopically visible nodules (colonies) in the recipient’s spleen” (Lajtha, 1970). The number of colonies seen 10 days after injection is directly proportional to the number of cells injected (McCulloch, 1970; Till and McCulloch, 1961; Till et al., 1964). Suspensions of marrow cells from unstressed normal mice typically contain approximately 10- 20 CFU-S (spleen colony-forming units) per lo5 cells injected intravenously, and the spleen cell suspensions contain a similar number per lo6 injected cells (McCulloch et al., 1964b). Chromosome markers were used to demonstrate that each spleen colony consists of descendants of a single injected cell (Becker et al., 19631, even though, 8-10 days after marrow cell injection, a single colony contains many morphologically distinct cell types, including both erythroid and myeloid precursors and sometimes a few CFU-S capable of proliferation and colony formation in a second recipient following retransplantation (McCulloch, 1970). The fetal liver also contains CFU-S, the mean total number per C57BL/6J embryo rising from 74.4 a t 12 days’ gestation to 1065 a t 16 days, a 14-fold increase (Barker et al., 1969). Although no one has as yet obtained splenic colonies containing erythroid precursor cells following implantation of cells from 9-11-day yolk sacs, the peripheral blood of 12-day C57BL/6J embryos contains colony-forming cells (mean number per embryo, 4.6 CFU-S). This total number of circulating CFU-S is considerably higher than that observed in peripheral blood of 1 6 1 8 - d a y embryos. “The demonstration of erythroid stem cells in embryonic mouse blood suggests that, during development, stem cells . . . use this pathway to migrate from one haemopoietic site to another” (Barker, 1970). My bias, as yet unproved, favors initial development of hemopoietic stem cells in yolk-sac blood islands, and their subsequent migration into the fetal liver. In the unstressed normal adult mouse, “the population turnover of CFU is low,” and it has been postulated that “in this steady state the majority of these stem cells are not in a state of proliferation a t all but are in the resting (Go)state” (Lajtha and Schofield, 1971). They are nevertheless capable of rapid proliferation under conditions of hemopoietic stress. Some mechanism must exist that regulates the size of the hemopoietic stem cell population, but its nature has not been determined (Fig. 3) (Lajtha and Schofield, 1971). Under conditions of severe induced anemia, erythroid hyperplasia is seen in both marrow and spleen and counts of CFU-S indicate that, as
3 72
ELIZABETH S. RUSSELL
I
foctor
foctor
FIG. 4. Interrelation of colony-forming units (CFU), erythropoietin-responsive cells (ERC), and erythron. CFU in steady state primarily in Gostate. The population control triggers cells into cycle a t rate K , . In steady state, cells are differentiating a t rate K , into ERC (and K , would equal K , if there were no other lines ofdifferentiation). The rate K , is controlled by some feedback from (? late) ERC. Erythropoietin (EPO) regulated by PO, in the kidney causes differentiation of ERC into erythron a t rate K,. RBC, red blood cells. (Reprinted with permission from Lajtha et al., 1971.)
an early step in this response, stem cells migrate from the marrow (CFU-S decreased to 50% by day 5) to the spleen (CFU-S increased 20% by day 3). Thereafter CFU-S, in marrow only, entered active cell cycle, suggesting local feedback control (Renricca et aZ., 1970). Some of the CFU-S, or pluripotent hemopoietic stem cell population, develop in “a first differentiating step” under “the influence of some, as yet unknown, stimuli . . . into a variety of ‘committed precursor cell populations, which in turn are affected by [(?) humoral] factors which induce a second step: differentiation into maturing hemopoietic cells” (Fig. 4)(Lajtha et al., 1971). At an early stage of their differentiation, these committed cells are not necessarily identifiable by any presently known techniques, and it may be useful to distinguish between the recognizable erythron (RE) and the nonrecognizable erythron (NRE) (Gerard et al., 1978). The committed precursor cell populations include erythropoietin-responsive cells (ERC); granulocyte precursor cells (CFU-C), assessed by an agar-colony culture test (Bradley and Metcalf, 1966; Lajtha, 1975); megakaryocyte precursor cells (Ebbe and
HEREDITARY ANEMIAS OF THE MOUSE
3 73
Stohlman, 1965); and antecedents of both antibody-producing B cells and antigen-reactive T cells (Lajtha, 1975). These committed precursor populations are considered to be transit populations capable of some degree of amplification (Fig. 31, with a greater amplification experienced in the preerythroid than in the premyeloid population. According to Lajtha (19751, the amplifying ERG population can alter its rate of amplification. Under normal conditions in the mouse there are probably not much more than four to six cell cycles involved in the transit from the stem cell to the pronormoblast, but under conditions of demand (e.g., growth of splenic colony in the irradiated and bone marrow grafted mouse) this number can probably more than double [Lajtha et al., 19713. This of course can make a very large increase in its potential to produce erythroid cells. The very fast proliferative capacity of these cells also explains why erythropoiesis can recover from a single cytotoxic damage much faster than the stem cells.
Among the erythropoietin-responsive cells is a subclass, called TECFU, “of early erythropoietin-sensitiveprogenitor cells . . . closely related to pluripotent stem cells, but . . . restricted in differentiation capacity to the erythropoietic pathway” (Gregory et al., 1975a). Cells of this class “give rise within four to six days after irradiation to transient endogenous erythropoietic spleen colonies” (Gregory et al., 1975a). Amplification of the myeloid precursor (CFU-C) population depends upon colony-stimulating activity (CSA) carried on outside of the granulocytic population, by “a variety of mesenchymal cells (‘macrophages’, monocytes, stimulated lymphoid cells). . . . The interaction between CSA producing cells and the CFU-C, which has a n absolute requirement for it, is a n interesting example of intercell interaction in the hemopoietic system” (Lajtha, 1975). It seems highly probable that a variety of other cellular interactions regulate the sizes of subpopulations within one committed cell series. Also, the mobility and proliferative capacity of hemopoietic cells may facilitate stimulation or suppression of differentiation through contacts between cells from different committed cell populations.
F. NORMAL ERYTHROID DIFFERENTIATION AND MATURATION Once the commitment to the erythroid series has been made, further differentiation and maturation are required before erythrocytes enter the circulation. The processes are very similar in all mammals studied. “The process of erythroid cell differentiation represents one of the most striking examples of biologic specialization known in nature. . . .
3 74
ELIZABETH S. RUSSELL
Erythropoiesis begins with an undifferentiated stem cell that, within 7 t o 10 days, gives rise to mature erythrocytes containing only the subcellular components adapting them to long-term survival and oxygen transport in the circulation.” The first step is commitment to erythroid differentiation, occurring gradually in the committed precursor population during its amplification. This differentiation involves acquiring “potential for co-ordinated expression of the many genes responsible for the erythroid cell phenotype. Erythroid maturation is the final process by which differentiated precursors, already committed to accumulation of hemoglobin, carry out their program of highly selective expression of a few genes” (Nienhuis and Benz, 1977) (Fig. 5). Certainly the most important, and possibly the only, direct stimulus to development of committed erythroid cells is the glycoprotein hormone, erythropoietin. Its presence seems to be essential for amplification of the early committed-but-not-yet-differentiated erythroid precursor population. Considerably lower levels of erythropoietin seem to be required to trigger differentiated cells from late generations of the ERC population into final erythroid maturation (Lajtha and Schofield, 1971; Nienhuis and Benz, 1977) (Fig. 5). Many studies of erythroid maturation have utilized polycythemic
Globin mRNA Accumulation
Proliferative Potential
Hemoglobin Accumulation
Ervthropoietin
FIG. 5. Chronology of cellular differentiation and morphologic .maturation of erythroid cells. [From Nienhuis and Benz (1977). Reprinted by permission from the New England Journal of Medicine 297, 1318-1328 (19771.1
HEREDITARY ANEMIAS OF THE MOUSE
375
mice, completely free of circulating erythropoietin, but with marrow containing erythropoietin-responsive cells, which can be triggered into erythroid maturation by injections of known doses of exogenous erythropoietin (Keighley et al., 1966). In fetal liver, marrow, and spleen erythroid maturation involves four or five rounds of cell division, usually occurring within 72-96 hours, coordinated with profound morphological and biochemical changes including accumulation of hemoglobin (Izak, 1977). Morphologically distinguishable cell types in order of progressive maturation (Filmanowicz and Gurney, 19611, are proerythroblasts; basophilic erythroblasts (with no stainable hemoglobin); polychromatophilic erythroblasts (with some hemoglobin); orthochromatic erythroblasts (with much hemoglobin); and reticulocytes, which are released into the circulation after extrusion of the pycnotic nucleus. These reticulocytes still contain active ribosomes and continue to synthesize hemoglobin for 8-24 hours. Both DNA and RNA synthesis are stimulated by exposure of marrow, spleen, and fetal liver cells to erythropoietin, but “it is not clear whether the induction of DNA production is the intial step in erythroid differentiation” (Izak, 1977). It is probable that molecules of erythropoietin (molecular weight 46,000) (Goldwasser and Kung, 19721, do not actually enter the erythropoietin-responsive cell, implying that a cell membrane receptor and a cytoplasmic mediator (both as yet unidentified) may be involved as the first step of response to erythropoietin (Adamson and Brown, 1978). Possible early reactions occurring within minutes following contact with erythropoietin have been summarized (Adamson and Brown, 1978). “In early erythroid cells, globin genes are among the small fraction (5 to 10%) of DNA sequences that are available for transcription” (Nienhuis and Benz, 1977).There is a 10-fold to 100-fold enrichment of globin RNA during transcription, and nuclear RNA metabolism further concentrates globin mRNA. All globin mRNAs analyzed to date contain a t least 650-750 nucleotides, and the extra “noncodmg” sequences may have important regulatory functions. Initial transcripts in the nucleus are precursor molecules, two to three times longer than mature cytoplasmic globin mRNAs (Nienhuis and Benz, 1977). Recombinant DNA studies have shown that some portions of the mouse P-chain precursor mRNA, which are removed during intranuclear processing, are insertions, or interruptions, within the message coding for the P-globin sequence translated in the cytoplasm (Konkel et al., 1978; Tilghmannet al., 1977).Very similar insertions are also found in mouse a-chain sequences (Leder et al., 1978).
376
ELIZABETH S. RUSSELL
Globin mRNA sequences are first detectable in proerythroblasts and basophilic erythroblasts. Globin synthesis parallels accumulation of globin mRNA, increasing a t the polychromatophilic and orthochromatophilic stages (Nienhuis and Benz, 1977). DNA synthesis stops a t the polychromatophilic stage, but hemoglobin synthesis continues to rise (Izak, 1977). One orthochromatophilic erythroblast cmtains 20,000-25,000 globin mRNA molecules. During later stages of erythroid maturation, total protein synthesis and mRNA content decrease, but relative content of globin mRNA, which appears to be long-lived, increases. In late erythroblasts and reticulocytes, 95% of total protein synthesis is devoted to accumulation of the globin subunits of hemoglobin (Nienhuis and Benz, 1977). Heme synthesis is also essential to erythropoiesis, and one obvious requirement for heme synthesis is a n ample supply of iron to the blood-forming tissue. Ferritin, the intracellular storage form of iron, is present in the earliest erythroid precursors (Theil, 1976). Heme synthesis, which is carried out in mitochondria, is active in early erythroblasts, before there is extensive accumulation of globin mRNA (Glass et al., 1975). Incorporation of jgFe into hemoglobin has often been utilized to measure erythropoietic activity, particularly in polycythemic mice responding to exogenous erythropoietin. A large proportion of injected j9Fe is rapidly removed from plasma and shows up later in the wave of erythrocytes whose production was stimulated by erythropoietin (Keighley et al., 1966). Heme and globin syntheses are coordinated throughout erythropoiesis, and heme is a potent stimulator of globin synthesis, both in reticulocytes and in cell-free extracts (Nienhuis and Benz, 1977). G. HEMOPOIESIS IN CULTURE Recently developed techniques for studying hemopoietic cell maintenance, amplification, and maturation in uitro, have added greatly to understanding of the kinetics of hemopoiesis. Two distinctly different approaches have been followed in these studies. One series of experiments was concerned with support and long-term maintenance and proliferation of the pluripotent stem cell and myeloid precursors. Assay of granulopoiesis, by the formation in agar of granuloid colonies (CFU-C, see Section 11, E) obviously depends upon tissue culture (Bradley and Metcalf, 1966). Techniques have now been developed by which pluripotent stem cells, capable of forming spleen colonies (CFU-S) upon retransfer in uiuo, can be maintained for 7-9 weeks, and will proliferate extensively (Dexter and Lajtha, 1974). The
HEREDITARY ANEMIAS O F THE MOUSE
377
methodology involves establishment of a n adherent cell population coating the glass vessel, which supports both granulopoiesis and proliferation of pluripotent stem cells (Allen and Dexter, 1976). This adherent cell layer contains phagocytic mononuclear cells, “epithelial” cells, and “giant fat cells” which are important for stem cell maintenance. Since all previous methods for hemopoietic tissue have been restricted to short-term culture, this new method may be a “useful system for the study of factors involved in the control of some of the earliest hemopoietic cells.” The cell populations cultured, however, are “not completely representative. So far we have been unable to demonstrate . . . erythropoiesis or thrombopoiesis” (Dexter et al., 1977). The second approach to hemopoiesis in uitro is concerned entirely with erythropoiesis, and involves amplification and maturation of committed erythroid precursors (Stephenson et al., 1971; Gregory et al., 1973; Rifkind et al., 1974; Iscove and Sieber, 1975; Glass et al., 1975). It has become apparent that erythropoietin stimulates more than one stage of erythropoiesis (Fig. 5). The first erythropoietinresponsive cell type identified in culture was termed the erythroid colony-forming unit, or CFU-E, which gives rise within 2 days after administration of erythropoietin to a small colony of 8-64 peroxidasepositive heme-containing nucleated cells. The numbers of these CFU-E in any given sample does not correlate well with numbers of CFU-C (granuloid colonies) or CFU-S (spleen colonies), and it has been generally agreed that the cell-type expressing in culture as CFU-E is far removed from the pluripotent stem cell and close to the stage of final erythroid maturation (Gregory et al., 1973, 1974a). An earlier erythropoietin-responsive cell type, called BFU-E, has also been identified in culture by the appearance, 7-9 days after treatment with high doses of erythropoietin, of much larger “bursts” of 100-5000 hemecontaining cells (Axelrad et al., 1974). BFU-E proliferation occurs independent of the presence of erythropoietin, but very high doses are required to trigger these cells into erythroid differentiation (burst formation). These two classes of erythropoietin-responsive cells (BFU-E vs CFU-E) are clearly different cell populations, since they can be separated by unit gravity sedimentation (Heath et al., 1976). A useful comparative characterization of CFU-E versus BFU-E appears in Table 1 (Adamson and Brown, 1978). Gregory presents evidence for a third erythropoietin-responsive cell, intermediate between BFU-E and CFU-E, which can be triggered into differentiation by slightly smaller erythropoietin doses than are required by the originally described BFU-E, and which produce “bursts” after 3, rather than 7-9, days (Gregory, 1976; Gregory and Eaves,
378
ELIZABETH S. RUSSELL
TABLE 1 Comparison of Mouse Erythroid Colony-Forming Units (CFU-E) and Bursts“ Characteristic
CFU-E
Frequency Cells per colony Erythropoietin requirement Maximum growth Percent in S phase Sedimentation velocity Relationship to stem-cell CFU Hypertransfusion
30&400 per lo5 cells 8- 64 0.2-0.5 U/ml 2 days 75- 80% 7.5 m d h r Relatively distant Reduced number
Bursts 20-40 per lo5 cells Up to 5000 2.5-5.0 U/ml 7-10 days 40-45% 4.6 m d h r Relatively close No effect
~~
” Adapted with permission
from Adamson and Brown (1978).
1978). The numbers of 8-day BFU-E in a given sample correlate significantly with CFU-S number, 3-day BFU-E numbers less well, and CFU-E numbers show little correlation, suggesting that BFU-E, although committed to erythroid differentiation, may be very close to the original pluripotent stem cell. The decreases, from BFU-E to CFU-E, in remaining proliferative capacity and in erythropoietin requirement, “suggest that decreasing proliferative capacity is associated with progressively increasing erythropoietin responsiveness as primitive erythropoietic progenitors move from a position close to the pluripotent stem cells through several differentiation steps to reach a stage just prior to the onset of detectable hemoglobin synthesis” (Gregory, 1976). Results obtained using an experimental system that combines some features of colony formation both in vivo and i n vitro add some new parameters. Bone marrows from normal and from exhypoxic donor rats have been grown in plasma clot diffusion chambers implanted in the peritoneal cavity of normal, hypoxic, or irradiated hosts. Colonies develop within these chambers, influenced by the physiological state of both donor source of the marrow and the environment-providing recipient of the diffusion chamber (Gerard et al., 1978).
H. NORMAL VERSUS GENETICALLY DEFICIENTHEMOPOIESIS The complicated, carefully integrated processes of hemopoiesis clearly involve actions of a long and varied list of genes, all the way from those controlling stem cell differentiation to those specifying hemoglobin structure or potential red cell life-span. Each of the anemia-producing mutant alleles alters only one of many possible processes in hemopoiesis. The first task of the physiological geneticist
HEREDITARY ANEMIAS OF THE MOUSE
3 79
studying effects of a new mutant allele is to discover the site and time of action of that particular mutant. The investigator must even consider the possibility that a genetic defect outside the hemopoietic tissue may reduce the supply to erythroid precursor cells of essential diffusible substances. Ill. Three Macrocytic Anemias
Mutant alleles at each of three genetic loci in the mouse are responsible for lifelong macrocytic anemia, as well as for pleiotropic effects on germ cell number and, for mutants at two of the loci, restricted distribution of pigment in the hair coat. The three loci are the dominantspotting (W) locus on chromosome 5; the steel ( S l )locus on chromosome 10; and the locus for Hertwig's anemia ( a n ) on chromosome 4 (Fig. 1). Multiple alleles, with interesting variations in extent of effects, have been described at the W and Sl loci. The independent mutants at the W, S1, and an loci produce markedly similar phenotypes. For all three loci, the anemia characteristic of homozygous affected individuals is macrocytic, the erythrocytes containing hemoglobin identical in structure, though not necessarily in proportion, to that of their normal littermates, in a n amount proportional to their increased mean cell volume. The anemia is due to reduction in red cell number, not to reduced cellular hemoglobin content. In almost every case, the number of germ cells in gonads of homozygous mutant individuals of both sexes is severely reduced. No morphologic or hematologic characteristic can be used to definitely distinguish a n adult WJW" mouse from an adult SllSld mouse; both are black-eyed white, sterile, and severely anemic. Hertwig's anemic (an/ a n ) mice also are markedly anemic, and their gonads contain few or no germ cells, but their hair coat pigmentation is normal (Russell and Bernstein, 1966; E. S. Russell and E. C. McFarland, unpublished results). Despite the many similarities in hematologic phenotypes and nonhematologic pleiotropic effects shared by mutants a t the W locus, the S1 locus, and the an locus, important differences indicate that genes a t the three loci control different primary processes. It is hoped that these similarities and differences between effects of W, S1, and an gene substitutions may be utilized to provide clues as to the nature of primary action of genes a t each locus. To facilitate this analysis, I will organize existing information into sections according to areas of investigation (i.e., multiple alleles, fetal erythropoiesis, response to
380
ELIZABETH S. RUSSELL
erythropoietin, o r implantation therapy) and will discuss effects of' mutants at all three loci under each heading.
A. GENETICSTRUCTURE OF THE W, S1,
AND
a n LOCI
A number of separate and independent instances of mutations at the S1 locus, and a n even more impressive list of W locus mutations have been reported (see below). As yet, only one mutant allele has been reported a t the a n locus. 1 . Multiple Steel Alleles
Homozygotes for Sl, the original steel mutation (Sarvella and Russell, 1956), are severely anemic, lethal before birth, and lack primitive and definitive germs cells (Bennett, 1956). Their skin cannot support development of pigment cells (Mayer and Green, 1968). Heterozygous Sll + carriers have somewhat diluted hair pigment and mild macrocytic anemia, but are completely fertile. A number of other mutants a t the S1 locus, usually with somewhat less drastic effects than Sl, have been described (M. C. Green, review through 1966). Two separate instances of very similar homozygousviable mutants, Sl" (Steel-Dickie) a t the Jackson Laboratory (Bernstein, 1960) and SldH(Harwell) at the MRC Radiological Unit at Harwell, are characterized by severely anemic but viable homozygotes that are completely sterile and black-eyed white. Schaible (1963b) reported, as a spontaneous mutant in a belted mouse stock, Slgb(Steel-grizzlebelly) which segregates as an allele to Sl and Sl". Homozygotes are born alive, but are severely anemic and die shortly after birth. S1"" (Steel-sooty) arose spontaneously in C57BLi6 and has effects similar to Slf', except that Sls"lSls"mice survive only to 10-40 days after birth (Miller, 1963). More recently, two furthers1 alleles have been reported in offspring of mutagenized mice. SIC"(Steel-cloud gray), which appeared a t Oak Ridge National Laboratory (Kelly, 19741, produces black-eyed off-white mice with black ears in compound with S1 or with "steeloid" translocations. The mutant Sl"""(Steel-contrasted), found at Harwell (Searle and Beechey, 19741, acts as though allelic to S1 and Sl". Compounds of two dominant alleles, S1"""lSldH and Slcl~nlSlcon, are severely anemic, and S l ( V ihas some macrocytic anemia. S1""'YSl""n females never produce more than one litter, and Sl"~nlSldH females are sterile and have very small ovaries. Sl""" is transmitted with chromosome 10 in four different translocations. It is tempting to consider the possibility that the association of these transmissible "steeloid' var-
HEREDITARY ANEMIAS OF THE MOUSE
381
iants with chromosomal anomalies in offspring of mutagenized mice implies that the complexities of e ects of the Sl locus are in some way related to chromosome rearrange ent. One recessive mutant, sldu,putati ely at the Sl locus, has occurred in the C3WHeJ inbred strain at the Jackson Laboratory (M. C. Green, 1972). Homozygous sl"'/sl"" mice appear as if dusted with flour and are completely fertile; sldu/+ heterozygotes appear completely normal.
3
2 . Multiple W Alleles
The first mutation at the W locus was reported in 1927, and since then, 27 independent instances of mutation at this locus have been reported in the literature. Mice homozygous for the original W mutation (de Aberle, 1927) are characterized by perinatal lethality due to severe macrocytic anemia; sterility in both sexes due to failure of multiplication of primordial germ cells; and complete absence of hair coat pigmentation. Heterozygous W/+ carriers have normal hematologic values and are completely fertile, but can be identified by white-spotting (usually a moderate-sized belly spot, though the size and to some extent the position of spotting is strongly influenced by genetic modifiers). Homozygotes for a second, qualitatively different, mutant, W" (which occurred in C57BL/6J), are usually viable (though this character is influenced by genetic background), but are, nevertheless, severely anemic, sterile, and black-eyed white (Little and Cloudman, 1937). Heterozygous W"/+ mice have very mild macrocytic anemia, normal fertility, and diluted coat color (belly lighter than back) with a moderate belly spot. A third mutant, Ws, was reported whose homozygote (Ws/Ws) is a postnatal lethal; the heterozygote (Ws/+) shows many similarities to W u / +(Strong and Hollander, 1953). Effects of a fourth mutant, W", recorded in C3WHeJ mice in 1952, cannot be distinguished from those of W on the same genetic background. However, effect of a fifth mutant, W J(which also occurred in C3WHeJ) on pigment restriction in the WJI+ heterozygote is much more extensive than is that in the W/+ heterozygote on the same genetic background, even though other homozygous and heterozygous effects of W J and W are indistinguishable (Russell et al., 1957). The effects of the W b mutant, which arose in C57BL/St, appear to be similar to those of W", except that pigmentation of the hair coat of Wb/+is more dilute, with large areas of white-spotting (Ballantyne et al., 1961). Effects of W", which appeared in offspring of a n irradiated mouse of the Z strain, are similar to those of W, including perinatal lethality (Schaible, 1963a). The effects of Wp"(Panda white), which occurred spontaneously in a D f
382
ELIZABETH S. RUSSELL
stock at the Oak Ridge National Laboratory, are particularly interesting. Its homozygous effects, including perinatal lethality, are similar to those of W , but the W p 4 + heterozygote is almost entirely white, with hair pigment restricted to the snout, near the eyes, base of ears, base of tail, and a n occasional spot on hip o r shoulder (Steele, 1974). Even more interesting is the putative W-allele, W f , which occurred spontaneously in a C3WHe stock a t the Institut Pasteur. Heterozygous W9+ mice have a frontal blaze and a belly spot. Mice carrying both W f and W oare fertile and black-eyed white except for grayish ear patches. Homozygous W9Wf mice are fully fertile with very extensive white spotting and have moderate macrocytic anemia; slight macrocytosis and reduced erythrocyte number are found in addition in the heterozygous W9+ mouse. Mice carrying both R w (very closely linked to W ) and W f (Rw +/+ W9 show extended areas of white spotting, and outcrosses of mice of such compound genotypes suggest that W f is either closely linked to, or allelic with, W" (Guenet and Mercier-Balaz, 1975; Guenet et al., 1979). Could this Wr mutant be a W-allele that does not lead to a germ cell defect? This array of effects of multiple W alleles suggests that, for a single mutant allele, there is not always parallelism in severity of pleiotropic effects in different tissues. This implication goes counter to a generalization that we have made in the past, based almost entirely on comparisons of the pleiotropic effects of WIW, WIWu,WulWv,W I +, W / + ,and +/+ (Russell, 1970). When the comparisons were restricted to mice of those widely investigated genotypes, parallelism of severity of effects in different tissues was quite apparent. Unfortunately, this generalization does not appear to carry over to the broader array of mutant alleles discovered by many investigators in many different places. One complication is, of course, possible differences due to environmental factors or, probably more importantly, to differences in genetic background. Mutations occur more frequently a t the W locus than at many other genetic loci. A spontaneous mutation study, which involved 3.5 million mice, was carried out at the Jackson Laboratory, with very careful observation for morphological and pigment variations (Schlager and Dickie, 1966). In this study, the overall mutation rate for all alleles with grossly observable manifestations was 0.8 mutations per locus per million tested gametes (Schlager and Dickie, 1967). However, much higher rates were recorded for the agouti (a)locus (fromA+ a,29.7/106 gametes; reverse, 4.7/106gametes) and for the W locus (18spontaneous dominant mutations in 5,107,970 tested gametes, or 3.52 per lo6 gametes). The W mutation rate also varied according to inbred strain,
HEREDITARY ANEMIAS OF THE MOUSE
383
with an especially high rate (6.7 per lo6 gametes) in C57BL/6J and an almost equally impressive rate in C3WHeJ (5.4 per lo6 gametes). We have maintained, still coisogenic with C57BW6J, 10 W-mutants from that study. All were first identified by their heterozygous effect on pigmentation; all produce white or almost completely white homozygotes; and all these alleles are closely linked to the Ph locus on chromosome 5 . A detailed study is now under way, analyzing the homozygous and heterozygous effects on viability, hematologic values, pigment distribution, fertility, and germ cell number of 10 previously unstudied spontaneous W mutant alleles, all segregating against the same C57BL/6J genetic background, their strain of origin (Geissler, 1978). Five of these W mutants (W34,W35,W38,W40, and W43,designated by the order of their appearance in the spontaneous mutation rate study) are perinatal homozygous lethals, with effects on hematology and pigmentation very similar to those of the original W mutant. The hematologic values in heterozygotes are completely normal. A sixth mutant, W3i, has effects very similar to those of W, except for much ore extensive white spotting in W3Y+ heterozygotes; effects of thi allele thus show considerable similarity to those of Ws, WJ, or Wp". The W42 mutant allele also is lethal when homozygous, but differs markedly from the six described above in its heterozygous effects, Heterozygous W? + mice show much white spotting and have the most severe macrocytic anemia observed in mice of any heterozygous W-locus genotype. Two of this array of mutants, W39 and W41, share two effects on hematologic characteristics with W": although homozygotes show moderate macrocytic anemia, it is not sufficiently severe to impair postnatal viability; and W39/+ and W4Y+ heterozygotes show mild but significant macrocytic anemia, similar to that observed in WY + heterozygotes. Nevertheless, differences do exist between W39 or W41 and W". Although the hair coat of W39/+ mice is very similar to that of WY + mice, with pigment dilution and moderate-sized belly spot, W41/+ heterozygotes are almost completely black, with a n average of approximately 1%white-spotting. Both W39/W3yand W4l/W4Imice are often fertile, in this way resembling WflWf mice. Effects of the tenth mutant W44 (which occurred in C3H/HeJ, but is now highly congenic with C57BL/6J) are unique. W441+ heterozygotes are mostly black; W441W44homozygotes, almost completely white. W44/W44homozygotes are also completely sterile. The exceptional feature of this allele is that both W44/+ heterozygotes and W44/W44homozygotes have completely normal blood values, without the slightest evidence of reduced erythrocyte number or macrocytosis.
2
384
ELIZABETH S. RUSSELL
3 . Possible Complexity of the W Locus Clearly the effects of a particular W mutant can be much more severe in one of the affected tissues than in the other two, and homozygotes for a few of the mutants seem to have effects on only two of the three tissues. The genotype W7Wf affects pigment and apparently blood formation, but not germ cell number, and neither W39/W39nor W4LIW41eliminates fertility. The W441W44genotype affects pigmentation and germ cell number, but not hemopoiesis. In comparisons between different W alleles, it is clear that two alleles may differ greatly in effects on pigmentation, but have otherwise extremely similar effects. It is much easier to envision possible explanations for such “uneven” variations if one considers W to be a complex locus, with separate subunits rather than one message for a single gene product. We have, however, no suggestions as to nature of, nor relations between, such hypothetical subunits. A serious argument that complicates the concept that the W locus is complex, with separable subunits, is the striking fact that homozygotes for almost all the mutant alleles a t two completely independent loci, W and S l , have very similar effects on the same three characteristics: severe macrocytic anemia, absence of coat pigmentation, and failure of multiplication of primordial germ cells (Russell, 1955; Bennett, 1956; Mintz and Russell, 1957). Causation of these three similar characteristics, in spite of quite independent developmental histories, indicate that they must bear some significant relationship to each other. An additional similarity between the W and S1 loci is their relatively high spontaneous mutation rate (see Sections 111, A, 1 and 111, A, 2).
4 . T h e Patch-Rumpwhite-Dominant Spotting Gene Triplet
No discussion of genetic complexities relating to the W locus is complete without reference to the cluster, on chromosome 5, of three very closely linked loci with dominant mutant alleles, all with a common effect on white spotting. Mutant alleles a t each of the loci, Patch ( P h ) ,Rumpwhite ( R w ) ,and W, have lethal effects when homozygous, but the developmental difficulties leading to lethality differ between loci. Over half of homozygous PhlPh embryos die around day 9 of gestation, with abnormal “wavy” neural tubes, “accumulation of a clear liquid flanking the notochord,” and marked enlargement of the heart or pericardium; essentially a condition of fetal hydrops. PhlPh embryos that survive beyond 9 days die around 12-13 days with a distinctive cleft-face phenotype (Griineberg and Truslove, 1960). A second allele a t this locus,Ph“, has
HEREDITARY ANEMIAS OF THE MOUSE
385
been recorded: PhlPh' embryos also show the cleft-face phenotype (Truslove, 1977). Homozygous RwlRw fetuses die "in midpregnancy" (Searle and Truslove, 19701, but no detailed study of their phenotype has been reported. Mice of compound genotypes R w +I+ W", R w +I+ Ph, and Ph +I+ W"are viable and fertile, supporting the concept of nonallelism of the three loci. Recombination between these loci is, however, extremely rare. In a repulsion backcross test of Ph +I+ Wu, only one crossover ( + +) was observed among 1302 offspring (Gruneberg and Truslove, 1960). No recombination has been observed in repulsion backcross tests of R w +I+ W" (011043) or of R w +I+ Ph (01257) (Searle and Truslove, 1970). The interest in this gene triplet centers on their heterozygous white-spotting effect. Mice of each heterozygous genotype share a characteristic spotting phenotype. We have already described the spotting patterns of W alleles including WI +, with a moderate-sized belly with a dark gray spot on a completely black background, and W"/+, back and lighter gray belly with a spot slightly larger than that of Wl+ (Section 111, A, 2). Heterozygous Phl+ mice have sharply demarcated areas of full color and white on the belly extending on to the back, often forming a completely thoracolumbar belt (Gruneberg and Truslove, 1960). Heterozygous Rwl+ mice also have sharply demarcated areas of black and white on belly and back, but their white areas are more posterior than are those of Ph/+ mice (Searle and Truslove, 1970). Mice of all the dominant compound genotypes show extensive hyperadditive spotting. Pigmentation of Ph +I+ W" mice is restricted to the head, that o f R w +/+ Ph to head and shoulders, and R w +/+ W" mice have completely white bellies and mostly white and "flecked' backs (Searle and Truslove, 1970). Such hyperadditive effects in combinations of white-spotting genes are, however, very common. For example, W/+ and W'?+ are known to show hyperadditive spotting in combination with nonlinked spotting genes, such as piebald spotting (Wl+; sis and WV+; sls); steel (W"/+; SZ/+), and flexed (Wl+; flf3. Considerable hyperadditive spotting also is seen in Patch in combination with Steel (Ph/+;SZi+) and in Rumpwhite in combination with belted (Rwi+;btlbt),with Steel-Dickie (RwI+;Sl"J+),and with Splotch ( R w l + ;Spl+). Thus, hyperadditive spotting effects in compounds involving R w , Ph, and W" cannot be considered as compelling evidence of a common evolutionary origin of genes a t these three closely linked loci. However, out of a total of 13 loci known to affect white spotting, in well over 500 named genetic loci in the mouse (Searle, 19791, the
386
ELIZABETH S. RUSSELL
finding of three dominant-spotting loci very closely linked in chromosome 5 certainly suggests some special relationship. One "possibility which ought to be considered in view of the homozygous lethal action of both Ph and R w is that they represent small deficiencies, probably not overlapping with each other (since the compound is fully viable) nor with the W locus itself (since they do not behave like W-alleles)" (Searle and Truslove, 1970). This concept has been made more appealing by the finding that the locus for recessive spotting (rs), whose effects appear to be limited to white spotting, is extremely closely linked to the W locus (in a test backcross, no recombinants in 170 offspring) (Southard and Green, 1971). Possibly mutants at the Ph locus, the R w locus, and even the W locus, affect pigmentation because each one includes the rs locus. While this explanation is convenient, and may turn out to be true, it does not account for differences in spotting patterns produced by R w , Ph, and Wr, nor for the great differences among effects of W alleles. Also, based on skin melanocyte distribution, there is reason to doubt whether the fundamental cause of white spotting is the same in R w / + and Ph/+ mice as in W/+ mice (Searle and Truslove, 1970). B. ABNORMAL FETAL ERYTHROPOIESIS Fetuses of severely affected genotypes carrying two mutant alleles a t the W, Sl, or an locus, are significantly anemic by day 12 or 13 of embryonic development. On embryonic day 12, when 96% of circulating red cells are of the large nucleated type derived from the yolk-sac blood islands, WIW embryos highly cogenic with FLIlRe were already markedly anemic (means 1.6 x lo5 RBC/mm3) in comparison with their FL/lRe-+/+ counterparts (mean, 3.4 x lo5 RBC/mm3), indicating that the W/W genic substitution has a deleterious effect on yolk-sac erythropoiesis (Russell et al., 1968). The W-effect on fetal liver erythropoiesis is considerable. Between days 12 and 16 of prenatal development, the total red cell mass of FLIlRe-+/+ fetuses increased 70-fold, that of FUlRe-W/W fetuses only 30-fold. The hemopoietic defect may arise significantly later in Sl-mutant fetuses than in W-mutants. Fortunately, fetal genotypes can be assigned on the basis of color of hair developing in skin explants, since the hair of SIISld mice is completely white, in contrast to strongly pigmented hair i n S l / + , Sld/+,and +/+ littermates (Chui et al., 1976). From 13 to 17 days of gestation, blood of WCBGF,-Sl/Sl" fetuses contains markedly fewer nonnucleated erythrocytes (mean at 13 days 0.6 x lo5 RBC/mm3, a t 17 days, 13.4 x lo5 RBC/mm3) than does that of
HEREDITARY ANEMIAS OF THE MOUSE
387
congenic +/+ fetuses (mean a t 13 days, 2.0 x lo5 RBC/mm3, a t 17 days 37.7 x lo5RBC/mm3). The nonnucleated erythrocytes of SZISL" fetuses are definitely larger than those of +/+ fetuses (Chui and Loyer, 1975b). The number of yolk sac-derived nucleated red cells is, however, similar in 13 day +/+ fetuses (mean 6.3 x lo5 RBC/mm3) and SZISZ" fetuses (mean 4.7 x lo5RBC/mm3).Detailed electronmicroscopic study of hepatic erythroblasts in +/+ and SZISl" fetuses failed to disclose morphological differences but clearly showed that, while the concentration of immature erythroid precursors per unit area is very similar in +/+ and SZISZd livers, the concentration of mature hemoglobin-containing erythroblasts is lower in SZISl" (Chui and Russell, 1974). Since SIISld fetal livers are much smaller than are +/+ fetal livers, the total number of erythroblasts is much lower in SZISl" fetuses (mean, 13 days, 0.9 x lo6, 16 days, 10.8 x lo6) than in +/+ fetuses (mean, 13 days, 4.0 x lo6, 16 days, 34.3 x 10'9. Although spleen-colony assays demonstrated fewer hemopoietic stem cells in SZISZ" than in +/+ fetal livers (30% of normal a t 13 days, 50% a t 16 days), and rapid stem-cell proliferation occurred in fetuses of both genotypes, the ratio of stem cells to erythroblasts was higher in SZISZ" than in +/+ fetuses. Mutant Sl genes may not affect yolk-sac erythropoiesis, but the mutant fetal liver fails to support, or interferes with, the normal rate of differentiation from immature precursor cells into hemoglobinized erythroblasts (Chui and Loyer, 1975b) and probably also interferes with differentiation from hemopoietic stem cell to immature precursor cells. Hertwig's anemia (anlan) fetuses also are anemic, with differentially reduced numbers of nonnucleated erythrocytes, by day 13 of prenatal development (Kunze, 1954). Studies in progress of erythropoiesis and germ cell development in WBB6F,-anlan versus normal fetuses suggest that anlan anemia is not clearly expressed before fetal day 13 (H. Peters and E. S. Russell, unpublished). C. PERTINENT GENETICSTOCKS FOR PHYSIOLOGICAL STUDIES Three general considerations have dominated the development of genetically controlled mouse stocks appropriate for analysis of hereditary macrocytic anemias. First, it is very important to be able to work with viable although severely anemic adult mice. Second, it is more possible to make comparisons between effects of genes at different loci, or between multiple alleles a t the same locus, if genetic differences between the mice studied are restricted to the loci under investigation. Third, transplantation of tissues between mice of differ-
388
ELIZABETH S. RUSSELL
ent genotypes is a very valuable research tool, providing information as to site of primary gene action for alleles a t each locus. 1 . W Selection Experiments
Although the first anemia-producing mutant gene, W, was identified in 1927 (de Aberle, 19271, investigation of its effects was limited by the perinatal lethal anemia of WIW mice. Finding a viable (W") allele in C57BL/6J mice (Little and Cloudman, 1937) increased potential for analysis, but unfortunately for the possibility of comparisons between alleles, transferring the original W allele to the C57BLI6J genetic background, by repeated backcrossing, increased the severity of WIW anemia, and only a very small proportion of the less severely anemic C57BL/6J-WIWCmice survived to adulthood. In 1948, in a genetically heterogeneous stock with recent ancestry from two stocks of noninbred WI+ mice (received from Holman and from Waelsch), as well as C57BL/6J-W/ + ancestry, two "living ghost" WIW mice each survived for more than one year. This conspicuous longevity prompted the initiation of a n inbreeding program with forced heterozygosis at the W locus and selection for longevity of WIW offspring (Russell and Lawson, 1959). High productivity was encouraged by continuing each line from offspring of single-pair matings that produced a t least five litters. Selection for postnatal viability of WIW mice was based on differences between branches of the pedigree, each usually containing 20 or more matings, to avoid confusion from transient environmental influences. At three- to five-generation intervals, the mean proportions of liveborn WIW individuals and their average survival time in days was determined for each branch of the pedigree, and unpromising branches were eliminated. Of eleven branches continued for more than 10 generations, four lines, each with a full 25% live-born WIW offspring, have been perpetuated. The two best, WB/Re (mean WIW life-span, 10 days) and WC/Re (mean WIW life-span, 14.5 days) are very similar genetically, having common histories through F12.Mice from these two strains have been widely used in physiological research on the W-locus gene action. The favorite anemic mouse, however, has been WBBGF,-WIW" (from a cross between WBIRe-WI+ and C57BL/6W11+ parents), which combines severe macrocytic anemia with hybrid vigor. For certain types of experiments, another interstrain F, hybrid has been extremely useful. The W" mutant, with effects indistinguishable from those of the original W mutant, appeared in C3WHeJ. The (C57BL/f%J x C3H/HeJ)F,-WYWVmouse is frequently used in experiments involving analysis of hormone interactions and ovarian and
HEREDITARY ANEMIAS O F THE MOUSE
389
pituitary tumorigenesis (Murphy and Russell, 1963; Murphy, 1972; Murphy and Beamer, 1973; Russell, 1978). 2. Corresponding S1 a n d a n Stocks
Mice of the SlISL genotype are even less viable than are WIW mice. Although attempts to increase SlISL survival by transferring the S1 mutant to a WCIRe genetic background failed to produce a postnatally viable SlISl mouse, the WCIRe-SU+ stock is vigorous and useful in research. A second mutation (Sl")has slightly less drastic effects. Both C57BL/6J-Slf11SL"and WCBGF,-S1/Sldare viable, and WCB6F,-S11Slf1 in particular is widely used, especially for comparison with WBBGFL-WIW". Although the a n mutation was discovered and exploited early (Hertwig, 1942, 1956; Kunze, 1954; Menner, 1957), progress was greatly impeded by scarcity of postnatally viable anlan individuals. An inbred line, BANIRe, with enforced a n heterozygosity and increased anlan survival, was produced and utilized for a period (Russell, 19701, but has been discarded as less valuable for research than the current choice, WBBGF,-B"anIBl'an. In this F, hybrid, both parental lines carry, in coupling with an, the closely linked dominant coat color marker gene, BLf,to assist in identification of B"an1-t + heterozygous carrier mice. On this F, hybrid genetic background, anlan individuals are completely viable, although severely anemic. Of course, WBB6F,-Blfun/B~tunmice also have special usefulness for comparisons with highly congenic WBB6Fl-W/W" and WCB6F,-SlISld mice. 3. Characteristic Hematologic Values Typical peripheral blood values for young adult untreated WBBGF,-+/+, WBBGF,-W/W", and WCB6F,-SlISld mice have been reported in many papers, with only slight differences between experimental observations, all clearly attributable to differences in methodology or in environment (McCulloch et al., 1964b; Russell and Bernstein, 1966; Lewis et al., 1967; Ebbe et ul., 1973a,b). The most objective comparison can be achieved by citing mean values in one study involving mice of all three genotypes (Harrison and Russell, 19721, and by indicating the range of mean values reported by others. Mean hematocrit percentages (in Harrison and Russell, 1972) were 47.1k 1.3% for WBBGF,-+/+ (other studies, 4 4 4 % ) ; 39.5* l.% for WBBGF,-W/W'' (other studies, 32-40%), and 30.7 k 1.8% for WCBGF,SIISld (another study, 28%). Mean erythrocyte volumes (in Harrison and Russell, 1972) were 48.3 2 1.0 pm3for WBBGF,-+/+ (other studies, 45-49 pm3); 64.9 ? 2.5 pm3 for WIW" (other studies, 65-69 pm?; and
390
ELIZABETH S. RUSSELL
73.65 3.1 pm3 for SUSld (other studies, 74-81 pm3).Mean erythrocyte counts for WBB6Fl-+/+ ranged in these reports from 9.8 x lo6to 10.5 x lo6 RBC/mm3; for WIWc, from 5.5 x lo6 to 6.1 x lo6 RBC/mm3; and for WCB6Fl-SlISld, from 4.1 x lo6 to 4.9 x lo6 RBC/mm3. Thus, on comparable genetic backgrounds the anemia of SllSld mice is more severe than that of WlW" mice. The erythroid defect of young adult WBB6Fl-anlan mice is somewhat less severe than that of either W/Wu or SIISld, with mean hematocrit percentage, 41.3 5 0.6; mean cell volume, 56.7 k 0.6 pm3; and mean erythrocyte number, 7.3 (k 0.2) x lo6RBC/mm3(E. S. Russell and E. C. McFarland, unpublished results). Mice of all three anemic genotypes attempt to elevate their hematocrit percentages. Under nonstressful laboratory conditions, the mean reticulocyte percentage of WBB6Fl-+/+ mice was very low (0.7 k 0.2%), that ofWBB6Fl-WIWcmice was 3.9k 1.7% (Ebbeetal., 19734 and that of WCB6Fl-SlISld, 2.8 k 0.4% (Ebbe et al., 1973b). The number of circulating leukocytes is not reduced in young adult WBB6Fl-W/WUmice (mean, 15.2 x lo3 WBC/mm3) as compared to WBB6Fl-+/+ mice (mean, 12.9 x lo3 WBC/mm3) (Lewis et al., 19671, nor am I aware of any reports of leukocyte reduction in WCB6FI-SlISld mice. The situation is very different for anlan mice, however (Kunze, 1954). In recent studies, WBB6Fl-+/+ mice had a mean of 16 X lo3 WBC/mm3 a t 3 months, while their WBB6F1-anlan littermates had only from 9 x lo3 to 12 x lo3 WBC/mm3; the differences between normal +/+ and deficient anlan become more marked with advancing age (E. S. Russell and E. C. McFarland, unpublished results). WBB6Fl-anlan mice gave about half the responses per spleen in two tests of immune response (Harrison, 1976).
D. ERYTHROID HOMEOSTATIC MECHANISMS IN MICE WITH MACROCYTIC ANEMIAS
Even though, under ambient atmospheric conditions, WIW", SllSld, and anlan mice have lower than normal hematocrit levels, mice of all three anemic genotypes respond to hypoxia by producing more erythrocytes. When WBB6Fl-+/+, WBB6Fl-WIW', and WCB6F1-SlISld mice were exposed to constant hypoxia for 9 days, the WlW" and +/+ mice showed parallel increases in hematocrit level (up to 5% in +/+, and 53% in WIW"). Eight of 12 SIISld mice died. Mice of both anemic genotypes survived less drastic treatment in a second experiment, which started with increasing part-time exposure to hypoxia for 25 days, followed by constant hypoxia for another 25 days. The mean hematocrit levels for +/+ mice reached 65%, for WIW" mice, 60%, and
HEREDITARY ANEMIAS OF THE MOUSE
391
for SIISld mice, 49T0 (Bernstein et al., 1968). In a third experiment testing the responses of WIW" and +I+ mice to reduced atmospheric pressure, hematocrit levels in mice of each genotype increased by 20% in 10 days, and their blood volumes increased by one-third, so that the total red-cell mass nearly doubled in 12 days (Harrison and Russell, 1972). This response was achieved through a wave of increased erythropoiesis that could be seen histologically in normal +/+ marrow after 2 days in hypoxia, in +/+ spleen after 4 days, in WIW" marrow after 3-4 days, and in WIW" spleen after 8-9 days. The proportion of heme-containing red-cell precursors rose from WOto 36% in +/+ marrow, from l%to 22% in +/+ spleen, from WOto 24% in WIW" marrow, and from 1%to 17% in WIW" spleen. When SIISld mice were protected from the initial shock of constant hypoxia by a single 0.5-ml intraperitoneal injection of packed red cells, they also responded effectively to constant hypoxia, reaching a mean hematocrit level of 52% after 24 days. Similar responses were seen when mice of the normal versus two anemic genotypes were subjected to severe blood loss or red-cell destruction by phenylhydrazine. Normal +/+ mice showed increased proportions of heme-containing red-cell precursors in both marrow and spleen beginning on day 2 after treatment, but the WIW" hemopoietic response was not apparent in marrow until day 3-4, nor in spleen until day 7 after treatment. Some SIISld mice responded rapidly to phenylhydrazine treatment, others not until 7- 13 days after treatment. However, within a single SIISld mouse, marrow and spleen responded simultaneously (Harrison and Russell, 1972). The response to constant hypoxia of WBB6FI-anlan mice has not been studied as extensively as that of WIW" and SIISld mice, but it is known that the mean hematocrit levels of 40 anlan mice rose from a pretreatment mean of 42% to a maximum of 69% during 32 days of constant hypoxia (G. L. Keighley, unpublished results). These responses of anemic mice to hypoxia were puzzling, in view of their known resistance to effects of erythropoietin. Under normal atmospheric conditions, WIW" and SIISld mice are anemic despite higher than normal plasma erythropoietin levels, and polycythemic mice of all three anemic genotypes are markedly resistant to exogenous erythropoietin. No erythropoiesis was induced in polycythemic WCB6Fl-SlISl'1 mice by erythropoietin doses as high as 100 units (Bernstein et al., 19681, and it took 150 times as much injected erythropoietin to induce positive j9Fe uptake into hemoglobin in polycythemic WBBGF,-WIW'' as in polycythemic WBB6Fl-+/+ recipients (Keighley et al., 1966). The erythropoietin response curves of polycythemic WBB6Fl-anlan mice are very similar to those of
392
ELIZABETH S. RUSSELL
polycythemic WIW" mice. Exhypoxic polycythemic anlan mice, with hematocrit levels a t the time of erythropoietin injection ranging from 56% to 61%, showed only 5.6% 59Fe uptake after 5 units of erythropoietin (seven recipients), and 15.W0 after 25 units (six recipients) (G. L. Keighley, previously unpublished results). The erythroid homeostatic mechanisms of mice with macrocytic anemia must operate differently from those that normal mice generally employ. In one sense, all erythropoiesis in intact WIW" and SllS1" mice appears similar to "stress" erythropoiesis in normal mice. Even though they were not subjected to external hemopoietic stress, "genetically anemic WIW' mice had more than 50-times, and SIISld mice had more than 300-times, normal specific activities of the enzyme nucleoside deaminase in their circulating erythrocytes," a condition seen in normal mice only following erythropoietic stress. "Nucleoside deaminase levels were normal in circulating erythrocytes of W/Wcmice that had been cured by grafts of marrow cells from either normal or SIISld mice. After SIISI" mice had been partially cured by grafts of intact normal spleens, their erythrocyte enzyme activities dropped from a n average of 98 to an average of 12 units" (still much above +/+ level). In unstressed cured anemic mice, "nucleoside deaminase activities decreased exponentially as erythrocyte packed cell volumes increased." , . . Nucleoside deaminase activities in mouse erythrocytes may be directly proportional to the level of erythropoietin that stimulated a precursor cell to differentiate into those erythrocytes (Harrison et al., 1975). Differences in plasma erythropoietin levels in +/+, WIW' and SIISld mice after various periods of constant hypoxia provide one clue as to their contrasting mechanisms for maintaining erythroid homeostasis. Injected exogenous erythropoietin persists longer in plasma of WIW' mice (54% present after 2 hours, 24% after 4 hours) than in +I+ mice (7% present after 2 hours, 4% after 4 hours). Higher than normal erythropoietin levels (inducing 11.6% rather than 1.3% j9Fe uptake) were found in +/+ plasma after 24 hours of constant hypoxia, but thereafter 59Feincorporation dropped to pretreatment levels, with only brief temporary increases during the next 30-40 days, even though the hematocrit percentage continued to rise. The WIW" mice showed "an increase of packed cell volume, and SlISl" did not, but both responded with large increases of plasma erythropoietin levels" (39.9% to 65% 59Feuptake following injection of plasma from hypoxic WIW" mice; 48% to 66% following injection of hypoxic S1ISlo plasma) "which persisted, except for some temporary falls, through 16-40 days" (Russell and Keighley, 1972). Thus excess circulating erythropoietin was available
HEREDITARY ANEMIAS O F THE MOUSE
393
throughout the period of hypoxia to stimulate the extra erythropoiesis observed in hypoxic WIW" and SIISld mice and was not observed in hypoxic +/+ mice, where it was not needed. At present we do not understand how this difference between plasma erythropoietin levels in hypoxic +I+ and WIW" or SllSld mice comes about, but do know that the effect depends upon the genotype of functioning blood-forming cells, since, when chimeric WIW" mice with implanted +/+ marrow are made hypoxic, their plasma erythropoietin levels follow the same pattern as do those in hypoxic +/+ mice.
E. NONERYTHROID ASPECTSOF HEMOPOIESIS IN WIW", SIISld, AND a d a n MICE
The total cellularity of WBB6F,-WIW" marrow (mean 1.61 X lo7 cells/femur) and WBBGF,-anlan marrow (mean, 1.65 x lo7cells/femur) is approximately three-fourths that of WBB6F,-+/+ marrow (mean, 2.00 x 107cells/femur),and that of WCB6F,-SlISld marrow (mean, 1.19 x lo7cells/femur) is closer to one-half that of normal marrow (Duveau, 1978). Deficiencies in cell numbers extend to myeloid precursors and megakaryocytes, as well as to erythroid precursors. Chervenick and Boggs (1969) found a lower total concentration of marrow cells in the humerus of WIW" than in +/+ mice, with a lower number of both granulocytes (means a t different ages from 2.7 to 2.3 x l o 6 in WIW' versus 5.2 to 3.6 x lo6in +/+I and megakaryocytes (means from 5.7 to 9.2 x lo5 in W"IW" versus 13.1 to 17.1 x lo5 in +/+I. 1 . Leukopoiesis, Leukocyte Numbers, a n d Neoplasia
In spite of the reduced numbers of granulocytes in marrow, the numbers of circulating leukocytes are not reduced in adult unperturbed WIW' mice (Lewis et al., 1967). Chervenick and Boggs (1969) reported slightly reduced numbers of circulating leukocytes a t 3 months, but not in older mice. The incidence of lymphocytic leukemia is higher and the condition appears earlier in B6C3F,-W"IWr mice (of lWo dead by 18 months, one-half showed lymphocytic neoplasms) than in B6C3F1-+/+ mice (less than 1%dead by 18 months, only one of nine with lymphocytic neoplasm) (Murphy, 1971). In keeping with the reduced total number of marrow cells in SIISld mice, their absolute number of granulocyte precursors almost certainly is reduced, although we have found no references to such reduction in the literature. Nor have reports appeared of reductions in numbers of circulating leukocytes. A reduction in proportion of neutrophils and in total blood neutrophil count in SIISI" mice has been reported (Ruscetti
394
ELIZABETH S. RUSSELL
et al., 1976). The incidence of lymphocytic neoplasia is much higher in WCB6F,-S1/Sld mice (37% a t a n average of 370 2 26 days) than in heterozygous and homozygous normal counterparts (5% a t a n average of 965 t 41 days). Possible involvement of a murine leukemia virus, in addition to the intrinsic genetic defect, is suggested by the induction of lymphocytic leukemia in approximately 50% of X-irradiated WCB6Fl-Sl/+, -Sl"i+, and -+/+ hybrid mice a t a n average age of 247 days (Murphy, 1977). Hertwig's anemic (anlan)mice differ from WIW' and SIISld mice in showing reduced numbers of circulating leukocytes throughout life (Kunze, 1954). Fifty-nine WBB6F1-an/an females had a mean of 9.8 k 0.4 x lo3 WBC/mm3 a t 3 months, and 40 WBB6Fl-an/an males, 12.1 2 0.6 x l o 3 WBC/mm3. By 24 months, the mean for 24 surviving WBB6F1-an/an females was 8.7 ? 0.6 x 103/mm3,for eight surviving WBB6Fl-anlan males, 10.3 2 1.0 x lo3 WBC/mm3. These values contrast with normal mean counts for 27 3-month-old WBB6F1-+/+ females of 16.0 2 0.8 x lo3 WBC/mm3, and for 30 WBB6Fl-+I+ males of 16.9 ? 1.0 x lo3 WBC/mm3, and for 24 24-month-old WBB6Fl-+/+ females of 11.8 2 0.6 x lo3 WBC/mm3, and 21 WBB6Fl-+/+ males of 16.4 5 0.9 x lo6 WBC/mm3 (E. S. Russell and E. C. McFarland, unpublished results). Unlike W/Wv and S1/Sld anemic mice, aging WBB6Fl-an/an mice show little lymphocytic leukemia, but a high incidence of reticulum cell sarcoma, type A (D. D. Myers, E. D. Murphy, and A. R. Roy, unpublished results). 2. Thrombopoiesis Considerable study has been made of thrombopoiesis in WIWv and SIISld mice. Although the number of platelets in the circulating blood of WBB6F,-WlWc mice equals that in WBB6Fl-+I+ mice, the mean number of megakaryocytes in tibia1 marrow of W/W" mice (6.2 x 103/0.9 mm3) was approximately one-half that in +/+ mice (12.1 X 103/0.9mm3), and the difference in number per histological section of spleen was even greater (Ebbe et al., 1972, 1973a). The mean size of stage I11 megakaryocytes from W/Wv mice was significantly greater than that of +/+ stage I11 megakaryocytes. No significant differences between genotypes were found in either size or number of blood platelets. When thrombocytopenia was induced in WIW" and +/+ mice by injections of antiplatelet serum, their responses were identical: rebound thrombocytosis to twice normal numbers, comparable increases in platelet volumes, and a wave of increased-sized stage I11 megakaryocytes. The absolute numbers of marrow and splenic
HEREDITARY ANEMIAS OF THE MOUSE
3 95
megakaryocytes remained consistently lower in WIW” than in +/+ mice. The increase in splenic megakaryocytes was delayed in WIW” mice. Thrombocytosis by platelet transfusion resulted in reduced size of megakaryocytes in mice of both genotypes. “The megakaryocytic system appeared to be functionally normal and to have intact homeostatic mechanisms regulating thromobocytopoiesis in spite of reduced numbers of megakaryocytes and the well known stem cell defect” (Ebbe and Phalen, 1977). “These findings support the concept that the major adjustments to acute” thrombopoietic “stimulation occur a t the committed, rather than the pluripotential, stem cell level” (Ebbe and Phalen, 1977). Thrombocytopoiesis in SIISld mice is even more unusual than that in WIW” mice. The numbers of circulating platelets did not differ significantly between unperturbed +I+ and S1/Sld mice, and the mean volume of SIISldplatelets was slightly but not significantly lower than that of +/+ mice. The number of megakaryocytes observed in SIISld tibia1 marrow was less than half that in +/+ marrow, but the average size of SIISld stage I11 megakaryocytes was 157% that of +/+ stage I11 megakaryocytes, and a similar difference was seen in immature stage I megakaryocytes. The size abnormality of SIISld megakaryocytes is greater than that of WIW” megakaryocytes (Ebbe et al., 197313). When subjected to thrombocytopenia, SIISld mice showed a normal degree of macromegakaryocytosis and formation of macrocytic platelets, but no rebound thrombocytosis. Induced thrombocytosis in SIISld mice led to prompt and substantial reduction in platelet size (Ebbe et al., 1978). In transplants of blood-forming tissue between +/+ and SIISld,changes in size of megakaryocytes related to the recipient rather than the donor. The megakaryocytosis ofSlIS1“ mice may be a systemic response to stimulation (Ebbe et al., 19771, while the deficit in megakaryocyte number “could be due to inability to increase rates of cellular proliferation and differentiation” (Ebbe et al., 1978).
F. IMPLANTATION THERAPY AND SPLEEN COLONY FORMATION IN RELATION TO MACROCYTIC ANEMIAS Transplantatian of blood-forming tissues between highly congenic mice differing at Ioei affecting hemopoiesis has contributed greatly to understanding of sites of action of such genes. 1. Cure o f W-Anemias
“The anemia-producing W-series gene action is intrinsic to hemopoietic tissues, as shown by the fact that the anemia of WIW,
396
ELIZABETH S. RUSSELL
WIW", and W'IW" mice can be cured completely and permanently by implantation of histocompatible normal hemopoietic cells from marrow, spleen or fetal liver. . . . The injected cells are accepted without irradiation of the recipient" and "soon become the progenitors of all circulating red cells" (Russell, 1970). The normality of WIW" hemopoietic microenvironment is demonstrated by the fact that histocompatible +/+ stem cells implanting in WIW" spleens form the same number of CFU-S as do +/+ stem cells in lethally irradiated +/+ recipients. When +/+ hemopoietic stem cells implant in WIW" mice, the populations of nonerythroid, as well as erythroid, cells shift to the donor type. Information on this point comes from studies with beige (bgJlbgJ)mice, whose granulocytes are easily identified by characteristic giant cytoplasmic granules, similar to those seen with human Chediak-Higashi syndrome (Murphy et al., 1973). When C57BL/6J-bgJ/bgJmarrow cells were implanted into WBB6Fl-WIWvmice, their anemia was cured, and hemoglobin shifted completely to donor type. The repopulation of nonerythroid cells is not generally as complete as that of erythroid cells; however, by 50 days after implantation, 86%, and by 100 days, 94%, of the granulocytes in the cured recipients showed the "beige" giant granule phenotype (Murphy et al., 1973). In a longer-term experiment with graded doses of bgJlbgJ marrow cells into WIW" recipients, the dose-response relationships (number of cells injected to proportion of beige granulocytes) were consistent with "random seeding of stem cells in the host marrow, coupled with a decreasing efficiency of secondary colonization by local migration. . . . Mouse bone marrow is compartmentalized into essentially self-contained regulatory volumes or domains." The authors "estimate that WIW" marrow contains approximately 2,600 stem cell regulatory units" (Maloney et al., 1978). Following cure of anemia by implantation (2-4 months earlier) of histocompatible translocation-marked CBNH-T61T6 marrow cells into B6CBAFl-W"/W" recipients, and of C57BL/6J-T6/T6 marrow cells into WBBGF,WIW'' recipients, 99% of cells in the thymus, 92% in the marrow, 79% in the spleen, and 39% in the lymph nodes, were of donor genotype. The proportion of donor cells was lower in WIW" recipients cured by implants of +/+ spleen cells (Harrison and Cherry, 1975; Harrison and Astle, 1976). Lymphoid tissues in thymectomized WIW" anemic recipients are populated to the same degree as intact WIW' recipients, demonstrating that thymic processing is not required for normal donor cells to POPUlate the immune system of "cured" WIW" mice (Harrison et al., 1979). The population of mast cells also is defective (less than 1%of normal) in WIW" mice in skin, stomach wall, and cecum. After implantation of
HEREDITARY ANEMIAS OF THE MOUSE
397
+/ + bone marrow cells into WI W" recipients, the number of mast cells in all the above-mentioned sites "increased to levels similar to those of . . . +/+ mice" (Kitamura et al., 1978). Implantation of suspensions of 5 x lo6 to 10 x lo6 cells from the placenta of 15-day C57BL/6J fetuses into adult WBBGF,-WIW'' recipients cured their anemias, demonstrating that in midpregnancy the mouse placenta, as well as the fetal liver, contains hemopoietic stem cells (Dancis et al., 1977). The injection of WIW" marrow or spleen cells does not lead to macroscopically visible splenic colony formation in lethally irradiated +/+ recipients (McCulloch et al., 1964a). However, histological examination of spleens of lethally irradiated +/+ mice that had received injections of WIW" marrow cells revealed small numbers (one-fourth of +I+ colony count) of microscopic colonies, composed almost entirely of myeloid cells (Lewis et al., 1967). WIW" marrow cells administered to lethally irradiated +/+ recipients, moreover, had a life-sparing effect if sufficiently large numbers were injected; 5.75 x lo5WIW" marrow cells saved 50% of lethally irradiated recipients, versus 0.77 x lo5 +/+ marrow cells. The surviving WIW"-implanted mice developed and maintained typical WIW" hematologic values. Nine days after irradiation and marrow implantation, increased spleen weight indicated hemopoietic cell proliferation in all recipients. However, while DNA synthesis in nonerythroid WIW" cells was 44% of that in similar +/+ cells, DNA synthesis in WIW" erythroid cells was insignificant, while that in +/+ erythroid cells was even higher (150%) than that in +/+ nonerythroid cells (Harrison, 197213). All these findings support the concept of a n intrinsic defect in WIW' hemopoietic precursors, at or near the level of the pluripotent stem cell, that results in severe aberration of erythropoiesis, and a lesser disruption of myelopoiesis. Cure of WIW" anemia by implantation of +/+ marrow may involve cooperation between two types of cells, the normal hemopoietic stem cell and a theta-sensitive regulatory cell apparently lacking in WIW" mice. Normal marrow cell suspensions, whose theta-sensitive components had been killed by antiserum to Thy 1.2, yielded normal numbers of splenic colonies when implanted in WIW" recipients, but did not cure their anemia. When +/+ thymocytes (which have no colonyforming capacity) were implanted in WIW" mice along with the treated marrow cells, normal numbers of colonies were formed and the anemia of recipients was cured (Wiktor-Jedrzejczak et al., 1977a). WIW" mice may, thus, have separate defects in two cell types or a deficiency in a common precursor of both.
398
ELIZABETH S. RUSSELL
Repetition of this experiment with implants of bgJlbgJmarrow cells revealed that very few donor polymorphonuclear cells (2.5- 7.5%) appeared in marrow of the recipients following treatment of bgJlbgJcells with anti-theta serum, versus a high proportion (40-86%1 after treatment with normal serum. Thus the thymus either provides a committed stem cell or cooperates with the implanted stem cell in differentiation of both granulocytes and red blood cells (Sharkis et al., 1977a). A humoral factor, emanating from +/+ thymocytes, "may influence the maturation of theta-sensitive regulatory cells" (Sharkis et al., 1977b). Although implants of anti-theta-treated marrow in WIW" recipients leads to appearance of spleen colonies, the recipient anemia is never cured. If spleen cells from WIWO recipients showing splenic colonies are retransplanted, no CFU-S are observed in the secondary recipient. "In the absence of theta-sensitive regulatory cells, CFU-S producing cells in +/+ marrow have limited self-renewal capacity and may only differentiate and subsequently disappear from the recipients" (WiktorJedrzeczak et al., 1977b). The function performed by theta-sensitive regulatory cells apparently does not require the presence of a thymus in order to develop, since thymectomized WIW" recipients are cured by marrow injections from congenitally athymic nude mice (Harrison et al., 1979). 2. Microenvironmental Defect in S1/Sld Mice
All attempts a t therapy of the SIISld anemia by implantation of histocompatible +/+ blood-forming cells have been completely unsuccessful (Bernstein, 1970). Injected SIISld marrow cells saved the lives of lethally irradiated +/+ recipients, and produced the same ratio of splenic colonies t o injected marrow cells (22.7 CFU-S/105 cells) as did injected +/+ marrow cells (21.7 CFU-SllOj cells). Moreover, implanted SIISld marrow cells are just as effective in curing WIW' anemia as are +/+ marrow cells (McCulloch et al., 1964a). Some workers have reported slightly lower than normal ratios (CFU-S/total cells) in SlISl" marrow, and it is generally recognized that the total number of marrow cells is much lower in SZISld than in normal mice (see Section 111, El. WIW" mice cured by implantation of SlIS1" marrow cells respond t o exogenous erythropoietin just as effectively as do congenic +/+ mice (Bernstein et al., 1968). SIISld stem cells appear to be suppressed, or not appropriately stimulated, in their usual surrounding, but are fully functional when placed in a normal cellular environment. The nature of the environmental defect has been explored through intergenotype transplantation of intact spleens. Sites of implant for adult spleens
HEREDITARY ANEMIAS OF THE MOUSE
399
include attachment to the peritoneal wall or anastomosis to the surface of the recipients' spleen, and newborn spleens can be placed subcutaneously or into the kidney capsule of adult recipients. Implantation of either +I+ or WIW?spleens greatly improved the hematologic values of recipient SZISZdmice, increasing hematocrit level and reducing mean cell volume (Bernstein, 1970). Using the percentage of hemecontaining nucleated cells to demonstrate the presence of erythroid precursors, most of the erythropoiesis in such hematologically improved SUSP mice with implanted spleens took place in the spleen from the normal donor, rather than in the indigenous SZISZd marrow and spleen (Harrison and Russell, 1972). The nature of this beneficial effect was explored further by studying spleen colony formation following injection of normal marrow cells into lethally irradiated mice with two spleens, one native plus one of a different genotype. "In contrast to the normal numbers of colonies formed consistently in +I+ and WIW" spleens, few or no colonies were formed in SIISZd spleens, even when spleens of SIISld and WIW" types resided side-by-side in the same abdominal cavity. These findings strengthen the hypothesis that the anemia of the steel (SZISld)mouse results from a defect in its hemopoietic tissue matrix rather than in its hemopoietic stem cells or humoral regulatory apparatus" (Altus et al., 1971). These findings were confirmed in further studies using implants of +I+ and SZISP femora (with ends removed) and portions of whole spleen implanted into SIISld and +I+ recipients (Fried et aZ., 1973). The site of microenvironment defect in SZISZd mice must extend to nonhemopoietic as well as hemopoietic tissues. The number of mast cells in the skin of SZISld mice is only 1%of normal, a level very comparable to that in WIW' mice (Kitamura and Go, 1978). However, when WIW" skin is grafted onto an SIISld mouse, it becomes populated with mast cells. Conversely, if SZISZd skin is grafted onto a WIW" mouse, it does not develop a mast cell population (Kitamura and Go, 1978). These findings suggest that the absence of mast cells in SZISZ" mice may be due to a localized defect in the environment. Several studies have attempted to determine the specific cellular or biochemical nature, or both, of the SZISZn stromal defect. Although it shows some similarities to a "deficiency of erythroid hemopoietic inducing microenvironment" (Gallagher et al., 19711,details of the SlIS1" defect show it not to be identical with E-HIM ( S .E. Bernstein, personal communication). The splenic stroma ofSZlS1" mice has been reported to contain a n elevated concentration of sulfated acid mucopolysaccharide, which the authors suggest may inhibit later stages of erythroid differentiation (McCuskey and Meineke, 1973). In an analysis of spleen
400
ELIZABETH S . RUSSELL
colony formation from SlIS1" versus +/+ marrow cells injected into lethally irradiated +/+ recipients, "lodgement was found to be the same for SlISl" as for the normal" donor, "but commitment" to erythroid differentiation "was subnormal" and "stimulus to proliferate . . . as measured by spleen colony size and cell type content, was even more reduced" (Wolf, 1974). Although +I+ marrow cells injected into 900 R irradiated SIISld recipients did not produce macroscopic colonies, small numbers of microscopic colonies were formed, with lower than normal E:G ratios, and no early erythroid cells (Wolf, 1974).
3. Distinctive Responses of Hertwig's Anemic Mice Intergenotype transplantation of marrow from mice with Hertwig's anemia produces results different from those obtained with either WIWc or SIISldmarrow. When marrow from C57BLI6J-anlan mice was implanted in lethally irradiated C57BL/6J-+/+ recipients, smaller than normal but still macroscopically visible splenic colonies were formed (Thompson et al., 196613). Long-term acceptance of implants of C57BLIGJanlan marrow cells (whose differentiation leads to production of erythrocytes with Hbbs/Hbbs hemoglobin) by WBB6Fl-WlWv, HbbdlHbb"recipients was demonstrated by the finding that only donor type hemoglobin was present in 9 out of 11 such W1W"recipients tested 390 days after implant of anlan marrow cells (Bernstein, 1972). Despite the persistence of anlan marrow implants, however, the recipients still had (WIW" or anlan) macrocytic anemia. These results clearly demonstrate different sites for the gene action responsible for each of the three macrocytic anemias. The erythropoietic defect in WIW" mice is clearly intrinsic within the blood-forming tissue, since implantation of +I+ or SIISld blood-forming cells cures WIW" anemia, and since typical WIW" blood values are seen in lethally irradiated +/+ mice saved by implants of very large numbers of WIW" marrow cells. The hemopoietic defect of SIISld mice is complementary to that of WIW' mice, since their erythroid-committed cells have completely normal capacities when explanted, but can nowhere differentiate normally in the defective hemopoietic microenvironment characteristic of SlISl" blood-forming tissue. The hemopoietic defect in anlan mice differs from those in both SlIS1" and WIW" mice. Stem cells from anlan mice differ from those in WIW" mice by being able to form macroscopically visible spleen colonies in lethally irradiated recipients, and they can implant and function in WIW" recipients. Unlike SllSlctstem cells, anlan stem cells have an intrinsic defect that continues to be expressed when these cells function in WIW" recipients.
HEREDITARY ANEMIAS OF THE MOUSE
401
4 . Responses of Anemic Mice to Friend Spleen Focus-Forming Virus
Infection with certain strains of the Friend virus leads to formation of “macroscopic foci of proliferating haemopoietic cells i n the spleens of susceptible mice” (Steeves et al., 1968). Hybrids (WBBlOFJ between WB/Re-Wl+ and C57BL/10J-Wul+ were utilized in this study. Although WBBIOFl-+/+ and -Wl+ mice were susceptible to this virus, and developed large numbers of foci, no foci were found in spleens of inoculated WBBlOF,-W/W” mice, and very few in spleens of WBBIOFl+ mice. “The difference in susceptibility between Wl+ and W“/+ mice was consistently observed in hybrid mice of both reciprocal crosses, as well as in mice of the parental strains” (Steeveset al., 1968). The spleen focus response to the virus could be developed in both WIW“ and Wu/+ mice by implantation of +/+ marrow cells. Mutant alleles at the steel locus also affect susceptibility to the Friend spleen focus-forming virus. With F, hybrids between C3H/ HeJ-SlI+ and C57BL/10J-Sldl+ parents, no foci were detected in the spleens of inoculated (C3B10)Fl-SlISld mice, whereas their inoculated +/+ littermates developed about 50 foci per spleen. Their Sll+ and Sl“1+ littermates were relatively resistant, showing a highly significant difference from the corresponding +/+ recipients (Bennett et al., 196813). The effect of the virus also was tested on mice carrying a translocation “allele” SIT, which does not cause hematologic defect. Both SITISIT and SITI+ mice were susceptible to the SFFV virus and developed many spleen foci (Bennett et al., 1968b). Injection of +/+ marrow cells into 650 R irradiated S11+ and Sl“l+ mice did not cure their refractory response to the spleen focus-forming virus. “The S1 locus affects the environment of SFFV target cells, so that they are either not available for infection or not able to form spleen foci once infected” (Bennett et al., 1968b). The apparent association between genetically induced macrocytic anemia and susceptibility to the spleen focus-forming variety of the Friend virus is very interesting. It is of further interest that heterozygosity for many W and S1 mutants affects virus susceptibility much more than it does hematologic values. No tests of Friend virus response of anlan mice with macrocytic anemia have been reported.
G. THERAPY OF W-ANEMIASBY ALLOGENEIC HEMOPOIETIC TISSUEIMPLANTS Although experiments to determine sites of anemia-producing gene action are most informative if host and donor are highly congenic
402
ELIZABETH S. RUSSELL
except for differing alleles at the anemia-producing loci, such ideal situations would rarely be available for attempts at therapy of human hereditary anemias. Analyses, therefore, have been undertaken of factors affecting success of allogeneic hemopoietic tissue implants for cure of W-series anemias. Earlier studies (summaries: Russell and Bernstein, 1967; Russell, 1970) clearly demonstrated that, in most circumstances, irradiation of histoincompatible anemic host mice is not useful for inducing acceptance of homologous normal marrow implants. Except for one report of a defective response of W"/W" mice to sheep red blood cells (Shearer and Cudkowicz, 19681, all studies show normal immune responses in WIW" and SZ/SZdadult mice (Mekori and Phillips, 1969; Harrison, 1978) despite their hemopoietic stem cell problems. When nonirradiated anemic recipients were used for marrow transplantation across barriers caused by differences at the major histocompatibility ( H - 2 ) locus, no success was obtained. When normal donor and anemic recipient carried the same H-2 alleles, but differed at other histocompatibility loci, no improvement in hematologic values was observed following injections of large numbers (8 x 10' and 32 x 10') of fetal liver cells into W-anemic adults, using four different combinations. The parental inbred strains involved in these experiments were 129/Re and C57BL/6J-WV/+with H-2b; DBN2J and WWRe-W/+ with H-2d; C3WHeJ-Wz/+ and AKWJ with H-2k; and WBIRe-W/+ and WC/Re-W/+ with H-2". Using appropriate F, hybrids between these strains, normal +/+ F, hybrid donors and F, hybrid W-anemic recipients were produced that were congenic at the H-2 locus and differed at the histocompatibility locus. Using the conventional designations for F, hybrids, the combinations were: for H-2UIH-2b congenics, 129WCFl-+/+ donor cells into WCB6Fl-W/W" recipients, and 129WBF,-+/+ donor cells into WBB6Fl-W/W"recipients; for H-2k/H-2b congenics, AKRBGF,-+/+ cells into C3B6F,-Wz/W"; for H-2d/H-2bcongenics, B6D2FI-+/+ cells into WHBGF,W/W" recipients. However, when WB/Re-+/+ fetal liver cells were given to extremely anemic surviving WC/Re-W/Wjuveniles (all H-2 "), cure of recipient anemias persisted more than 180 days. There are genetic differences between WB/Re and WC/Re, since skin transplants between WB/Re-+/+ and WC/Re-+/+ adults survive only 30-60 days. Also, WB/Re and WC/Re are known to differ at the Plp locus on chromosome-17 (J.B. Whitney, 111, unpublished results). WBB6F =+/+ marrow cells injected into adult WCBGF,-W/W"recipients, and the reciprocal WCBGF,-+/+ marrow in" recipients, uniformly resulted in lifelong jected into WBB6F ,-W/W
HEREDITARY ANEMIAS OF THE MOUSE
403
cures. Thus, in Jackson Laboratory experience, success in marrow implant in curing WIW" anemia requires H-2 matching plus high congenicity, but not absolute identity in genetic background (Russell and Bernstein, 1967). In other experiments (Seller, 1971) the immunological tolerance of newborn mice was used to enhance acceptance of hemopoietic implants. When newborn Wr/W7'Hbbs/HbbS mice (of unstated genetic background) received fetal liver cells from strain A, strain CBA, or strain CBA-TG/TG (all carrying Hbbd/Hbbd, but specific subline not stated) their anemia was cured and hemoglobin changed to donor type. The marker T6 translocation, which allowed cytological identification of the source of all dividing cells, demonstrated colonization by intact donor cells. In all cured anemic mice that had received CBA-TG/TG cells, all dividing cells in bone marrow, spleen, and thymus, and almost all mitotic cells in lymph nodes, carried the T6 translocation. Change to production of 8% donor-type immunoglobulin indicated a shift in lymphopoiesis. Donor cells did not invade the cornea of cured recipients. Similar results were obtained when marrow from A or CBA mice was given to W"/W' mice immunosuppressed with antilymphocyte serum. Successful implantation of +/+ marrow into W/W" recipients has been obtained when host and donor differ at the Ea-2 locus, which determines antigens "strongly expressed on erythrocytes, and originally found on spleen, thymus, liver, testis, lung and brain, but weakly, if a t all, on skin" (Harrison and Cherry, 1975). Intravenous treatment with Ea-2 incompatible marrow cells was more effective (20 out of 23 WIW" recipients permanently cured) than was intraperitoneal implantation. The authors suggested that intravenous injection may provide a better opportunity for rapid establishment of early precursor cells of donor genotype, that "can reproduce themselves almost indefinitely and differentiate to populate the erythropoietic and a t least part of the immune system. . . . Whether a marrow graft is accepted apparently depends on a competition between the immune response of the recipient to the incompatible graft and the speed with which early precursor cells in the graft take over and populate the recipient" (Harrison and Cherry, 1975). Tests have been made of the effectiveness in curing WBB6Fl-W/W" anemia ofH-2 compatible marrow allografts from 22 different congenic lines differing from C57BL/6J at a variety of non-H-2 loci. Harrison and Doubleday (1976) note: No WIW" mice were cured by marrow grafts from donors of the three congenic lines whose skin grafts were rejected in fewer than three weeks. Almost every WIW" mouse
404
ELIZABETH S. RUSSELL
was cured by marrow grafts from donors of the 13 congenic lines whose skin grafts survived l o n g e s t f r o m 11 to more than 25 weeks. Intermediate skin graft survival times failed to predict whether marrow grafts would succeed. . . . The simplest explanation of results is that the antigens specified by the H-2, H-3, H - 4 , H-25, and H-28 histocompatibility loci are strongly immunogenic on both marrow precursor cells and skin, H-17 and H-24 antigens are strongly immunogenic on skin but not on marrow, and the H-12 antibody is strongly inimunogenic on marrow precursor cells but less strongly on skin.
In general, parental strain hemopoietic cells give more successful long-term results when implanted into interstrain F,-hybrid WIW" recipients than when implanted into lethally irradiated F,-hybrid +/+ recipients. Graft-versus-host reactions are much less damaging, presumably because "W-anemic recipients have substantial numbers of their own cells along with the donor cells in their lymphoid tissues. These F, lymphocytes may interact with parental lymphocytes in uiuo to restrain reactions against F, allogeneic antigens" (Harrison, 1976a).
H. RADIOSENSITIVITY OF MICE WITH MACROCYTIC ANEMIAS Both WBBGF,- WIW" and WCB6F,-SZISZdanemic mice are extremely radiosensitive. In contrast, response to whole-body irradiation of WBB6F1-an/an mice corresponds closely with that of WBBGF,-+/+ mice. In simultaneous experiments, the LD,,,,, for WBBGF,-WIW" mice was 365 R, in contrast to 690 R for WBBGF,-W/+, 692 R for WBB6F,W"/+, and 765 R for completely normal WBBGF,-+/+ (Bernstein, 1962). All these differences are attributable to the genotype of "functioning blood-forming tissue, as all differences between genotypes are obliterated following implantation of +/+ marrow cells" (Bernstein, 1963a). In W/Wv mice, the basis of differential radiosensitivity is delay in regeneration of erythroid tissue (Russell et aZ., 1963). After similar reduction in cellularity of +/+ and WIW" marrow a t 2 days after 200 R, the cellularity of +/+ marrow rapidly returned to pretreatment level (by 4 days), while that of WIW" marrow remained low for more than 12 days, mean hematocrit levels dropped to 10-209'0, and some mice died. One conspicuous feature of the WIW" response was almost complete absence of reticulocytes for 8 days after 200 R, followed by a burst of reticulocytes (12-45% of circulating cells), usually between 16 and 23 days. Since the plasma erythropoietin level in radiated WIW" mice was extremely high throughout the long period (more than 12 days) of low hematocrit percentages (Russell and
HEREDITARY ANEMIAS OF THE MOUSE
405
Keighley, 1972), "it seems probable that" highly "erythropoietinsensitive cells were absent until approximately 12 days after irradiation" (Russell, 1970). A similar delay in onset of hemopoietic regeneration in WIW" mice after 100 R, 200 R, and 500 R whole-body irradiation was observed in a second series of experiments, with a similar interpretation (Boggs and Boggs, 1977). less than 150 R) The radiosensitivity of WCB6FI-SlISldmice (LD50,30, is even more extreme than that of WBB6F1-W/W"mice, almost certainly because proliferation and/or differentiation of potentially normal SIISldstem cells and erythroid precursor cells is inhibited by SIISld defect in stromal environment. The "effects of W-locus and 5'1-locus on three different types of rapidly proliferating tissues, . . . and the known contribution of intestinal damage to whole-body radiosensitivity" suggest the possibility of effects of W- and Sl-gene substitutions on another type of rapidly proliferating tissue, the crypt cells of the intestinal mucosa (Hopper and Russell, 1975). Three research groups have attempted to test this possibility, with somewhat different results. One study (Torok and Boggs, 1975) involved exposure of WBB6Fl-+/+ and %ured"-W/W", which had been implanted with +/+ marrow 4 weeks previously, to 1250 rads whole-body irradiation. The WIW" mice died sooner (mean, 5.8 days) than did the +/+ mice (mean, 8.4 days). Further, tritiated thymidine uptake 3 and 4 days after irradiation was lower in WIW" than in +/+ mice. Since the "cured' WIW" mice had normal hematocrit values at the time of irradiation, the authors attributed the differences between WIW" and +/+ responses t o defective regeneration of the WIW" intestinal crypt cells. They made no direct observation of these cells, but cited a slight delay in recovery of dry weight of the WIW" intestine as supporting evidence. However, no intergenotype differences in the responses of intestinal crypt cells to 700 R whole-body irradiation were observed in a second study (Hopper and Russell, 1975). The crypt cell activity of nonirradiated WBB6Fl-+/+, WBB6Fl-WlWv, and SIISld mice were extremely similar, as indicated by number of cells per crypt, L3H1thymidine labeling, and mitotic index. Very similar responses were observed in mice of all three genotypes a t 2, 6, 12, 24, 48, 72, 96, and 120 hours after irradiation. The number of cells per crypt dropped equally in mice of all genotypes during the first 24 hours, then rose above pretreatment level at 72 and 96 hours, and returned to normal by 120 hours. The labeling index dropped for the first 12 hours, then rose above pretreatment level at 48 and 72 hours, and returned to normal by 96 hours, in mice of all three genotypes. Mitotic indices
406
ELIZABETH S. RUSSELL
increased sharply to a maximum 48 hours after irradiation, and thymidine uptake increased to a maximum 78 hours after irradiation, in mice of all three genotypes. In this second study, "the intestinal mucosa of the WIW" and SIISld mice responded to radiation insult in the same manner as did that of +/+ mice. Mice of all three genotypes were equally able to increase proliferative activity in the crypts and to restore normal cell numbers" (Hopper and Russell, 1975). In a third set of experiments, Potten (19781, using split radiation doses, found that intestinal cells in WIW" mice exhibited the same crypt survival curve as did similar cells in +/+ mice, thus confirming the findings of Hopper and Russell. The bases for the differences between these experiments may be attributable to differences in radiation dose used, or to differences in experimental design. It is possible, though not proved, that the hemopoietic defect of the WIWu mice studied by Torok and Boggs had not yet been completed obliterated 4 weeks after +/+ marrow implantation; although hematocrit levels had reached normal levels, the number of +/+ stem cells may still have been low. Evidence supporting this view has been obtained by Harrison (1976b). Even though both WIW" and SIISld anemic mice are extremely radiosensitive, this defect is not an inevitable consequence of hereditary macrocytic anemia. The response of WBB6Fl-anlan mice to whole-body irradiation (LD50,30,695 R) is very similar to that of WBB6Fl-+/+ (S. E. Bernstein, unpublished results). As yet we can offer no suggestion as to the basis of this intergenotype difference.
I. STUDIES OF MACROCYTIC ANEMIAS in Vitro The potentialities of pluripotent stem cell populations in WBB6Fl-WIW" and WCB6F,-SlISld mice have been studied in vitro with methods (Allen and Dexter, 1976) particularly useful for the study of very early hemopoietic cells (see Section 11, G for methods and terminology). Parallel cultures were maintained for 4-6 weeks with WCBGF,-+/+ or WBBGF,-+/+ adherent cell layers with corresponding +/+ nonadherent cells added; WCB6F1-S1lSldadherent cell layers with SllSlrl nonadherent cells added, WIW" adherent cells with WIW" nonadherent cells added; SIISld adherent layer with WIW" nonadherent cells added; and WIWc adherent layer with SIISld nonadherent cells added (Dexter and Moore, 1977). In the completely normal +/+ combinations, 28 x 10" and 70 x lo5total nonadherent cells per culture, and 41,700 and 23,000 CFU-C per culture, were observed after 4 weeks in culture, and in the WCBGF,-+/+ combination, 14.0 x lo5 nonadherent
HEREDITARY ANEMIAS OF THE MOUSE
407
cells and 12,200 CFU-C per culture were observed after 6 weeks (WBBGF,-+/+ not tested) (Dexter and Moore, 1977). The total number of nonadherent marrow cells per culture was much smaller in S1ISld -SIISld combinations (1.6 x lo5 after 4 weeks, 9.0 x lo5 after 6 weeks), as was the number of CFU-C per culture (540 after 4 weeks, 90 after 6 weeks). Similar low values were observed for WIW'-WIW" combinations (3.2 x lo5 nonadherent cells and 260 CFU-C per culture after 4 weeks). When SlISl adherent layer cell populations were combined with WIW" nonadherent marrow cells, cultures grew poorly (1.2 x lo5total nonadherent cells and no CFU-C per culture after 4 weeks). However, when WIW" adherent layer cells were combined with SIISld nonadherent cells, the cultures grew and functioned well (58 x lo5 nonadherent cells and 13,800 CFU-C per culture after 4 weeks). Although both numbers of nonadherent cells and numbers of colonyforming units differed widely between experiments involving normal (+/+ or WIW") environments and normal (SIISldand +/+) nonadherent cells, all were similar to the extent of producing large numbers of cells. By contrast, extremely small numbers of cells and colonyforming units were produced when the adherent cell layer was genetically deficient (SZISZd)or when the nonadherent cell source was genetically deficient (WIW")(Dexter and Moore, 1977). The similarity in behavior of the SIISld adherent cell population i n vitro to that of hemopoietic stroma in vivo, and of the WIW" nonadherent cells i n vitro to hemopoietic stem cells i n vivo, is very striking. It is unfortunate that this culture system does not support erythroid differentiation, since the defects of WIW" and SIISld are expressed in vivo much more in erythroid than in myeloid differentiation. Also, the greatly reduced number of CFU-C in long-term SIISld and WIW' cultures is out of line with the normal or near normal number of CFU-C in marrow taken directly from WIW" and SIISld mice. Although the longterm maintenance of parts of hemopoiesis in those cultures is encouraging, one is left with lingering doubts as to the pertinence of the observations for increasing understanding of gene actions in macrocytic anemias. Very interesting observations also have been made of erythropoiesis in cultures of WIW" and SlISl" marrow with added doses of erythropoietin (see Section 11, GI. Although the femoral marrow of untreated WIW" mice contained almost as many CFU-E as did that of +/+ mice, the number in WIW" spleen was markedly reduced. Much greater reduction in CFU-E numbers in response to plethorization was seen in WIW" marrow and spleen than in +/+ marrow and spleen, and in such plethorized mice the increase in CFU-E in response to exoge-
408
ELIZABETH S. RUSSELL
nous erythropoietin was much less in WIW" than in +/+ mice (Gregory
et ul., 1974b).
In later experiments comparing burst and colony formation in cultures of WIW" vs +/+ adult marrow, exposed to 2.5 units erythropoietin, significantly fewer day-8 BFU-E (36.8% of +/+ values), day-3 BFU-E (66.3% of +/+), and CFU-E (59.6% of +/+I were observed in WIW" than in +I+ cultures (Gregory and Eaves, 1978). It is interesting that the WIW" deficiency of %day BFU-E (committed erythroid, but relatively close to the pluripotent stem cell) was greater than that of CFU-E (relatively late-committed erythroid precursor). In colonies from WIW" spleens, greater reduction (11.4-21.0% of +/+ values) was observed for all bursts and colonies. These studies "reinforce the concept that the genetically determined anemia in WIW" mice is due primarily to alterations in behavior of primitive hemopoietic precursors" (Gregory and Eaves, 1978). Similar studies have been made of bursts and colonies formed in uitro from SlISl" vs +/+ fetal liver (days 13 to 15) (Chui et al., 1978). In contrast to the observation on WIW" adult marrow, the number of 8-day BFU-E was higher in SZISZ" than in +/+ cultures, especially those from day-13 and day-14 fetuses. Lower numbers of CFU-E were observed in SZISld than in +I+ cultures. These observations suggest that the hemopoietic defect imposed by the SIISld fetal liver hemopoietic microenvironment affects a stage of differentiation between the BFU-E and the CFU-E. This contrast in time or stage of initiation of the defect in cultured WIW" vs SIISl'l hemopoietic tissue is very interesting. Aside from the genotype difference, the two experiments also differ in tissue involved (adult marrow and spleen vs fetal liver), and in details of erythropoietin dose. These differences may well account for apparent differences between experiments in ratio of BFU-E to CFU-E in cults from normal mice. The potentialities for analysis of genotypic differences in response to erythropoietin through culture seem hopeful.
J. TRYINGTo PUTIT ALL TOGETHER The content of this section of the review, dealing with macrocytic anemias, differs considerably from that in earlier reviews of the same area not only in referring to a larger number of papers, but also in considering a wider variety of problems. The need for this wider coverage has resulted in part from recent expansion in understanding of normal hemopoiesis (Section 111, and also from development of hypotheses on the existence and potentiality for amplification and interac-
HEREDITARY ANEMIAS OF THE MOUSE
409
tions of hitherto unrecognized subpopulations of hemopoietic precursor cells committed to different types of differentiations. Mice of the "complementary" WIW" and SIISld anemic genotypes have been used in some cases to test these new hypotheses. We still cannot identify the primary action of the W, S1, or an genes, nor can we state how these relate either to observed hemopoietic effects or to pleiotropic effects in other tissues. However, since 1970 some former possibilities have been eliminated and new ones added. Particularly important for the changed perspective are the following points. (1) Evidence that erythropoietin acts at more than one stage. It has been acknowledged for a long time as initiator of erythropoietic differentiation in committed precursor cells. It is now recognized as essential (in high doses) for amplification of the very early committed erythroid precursor population and also is needed (in low doses) to trigger final erythroid maturation of late-generation differentiated erythroid precursors (see Section 11, F; see also, Lajtha and Schofield, 1974; Nienhuis and Benz, 1977). (2) Inclusion of information on Hertwig's anemic (anlan) mice, including their hematologic values and their responses to erythropoietin and to whole-body radiation. (3) Demonstration of normal regeneration of intestinal crypt cells in irradiated WIW" and SIISld mice. (4)Systematic study of multiple W and Sl alleles, including discussion of pleiotropic effects. Although the normal counterparts of the cell populations affected by W, S1, and an gene substitutions all must be capable of increasing their numbers very rapidly, and all show reduced or delayed multiplication in mice of severely affected genotypes, it is no longer possible to attribute their defects to ageneral defect in proliferative capacity. The intestinal crypt cells also must reproduce very rapidly, and neither WIW" norSIISld mice differ significantly from normal mice in their rate or pattern of intestinal crypt regeneration. Increased radiosensitivity is not inevitably associated with all geneinduced macrocytic anemias, although both WIW" and SlISl* mice are extremely radiosensitive. The radiosensitivity of anlan mice does not differ significantly from that of their normal littermates. Analysis of this genotypic difference in response to radiation may contribute to our understanding of responses to erythropoietin. Defective response to erythropoietin remains an important aspect of the cause of all three known types of hereditary macrocytic anemia, but the nature of these defects differs. In WIW" mice, a population of hemopoietic cells close to the pluripotent stem cell is intrinsically
410
ELIZABETH S. RUSSELL
incapable of producing a normal vigorous response to erythropoietin. In SlISl“ mice, a defect in the hemopoietic microenvironment inhibits effective response to erythropoietin. It is not unreasonable to consider that in normal hemopoiesis two types of cells, one a n early hemopoietic precursor, the other a component of the hemopoietic microenvironment, may be required to interact in some specific way (come into contact? exchange material? form a particular type of receptor site?) before erythropoietin can stimulate the precursor cells to increase in number and to proceed with erythroid differentiation. According to this hypothesis, the “interacting precursor cell” population of WIW’ mice is either smaller than that of normal mice, or its individual cells are less responsive, or both. In SIISld mice, the “interacting microenvironmental cell” population is either smaller than that in normals, and sparsely distributed, or its individual component cells are less effective, or both. This microenvironmental factor may or may not be important throughout erythroid differentiation, but its interaction with a n early hemopoietic precursor is clearly important. Defects in either partner in this interaction reduces the early-phase “amplification” response to high doses of erythropoietin in a way which leads to macrocytic anemia. Whatever the exact mechanism of this early-phase interaction may be, one would expect increased radiosensitivity to be a consequence of its disruption. Destruction of a significant proportion of the highly radiosensitive pluripotent stem cells has life-threatening effects wherever amplification of their hemopoietic descendant population is critically inhibited by a reduced response to erythropoietin. However, anlan mice with macrocytic anemia also show a defective response to erythropoietin, apparently somewhat less severe than those in WIW” and SIISld mice, although they have normal radiosensitivity. This implies that the erythropoietin-sensitive cell population that is defective in anlan mice is far removed from the pluripotent stem cell. Given the evidence that moderate doses of erythropoietin are needed to trigger erythroid maturation of late-generation erythroid precursors, it seems clear that the hemopoietic defect in Hertwig’s anemic mice involves a defect in this late-stage response to erythropoietin. It is very interesting that intrinsic hemopoietic cellular defects involving response to erythropoietin at both very early and late stages of erythroid differentiation result in rnacrocytic anemias. Analysis of the pleiotropic effects of W , Sl, and an substitutions on germ cells and pigment distribution presents almost more difficulties in conceptualization in 1978 than in 1970. The lack of parallelism in severity of effects of different W mutant alleles in the three affected
HEREDITARY ANEMIAS OF THE MOUSE
411
tissues, and the high rate of spontaneous mutation observed, suggest that the W locus may be a "large target," with complex subunits, each possibly acting on a different aspect of the pleiotropism. The prevalence of association between macrocytic anemia and germ cell defect, and the association of both with pigment restriction in WIW" and SZISZ" mutants, suggest that if there are separable subunits, they must be closely related, probably with a common origin. One complication is that no logical linear way of arranging the subunits in serial order has been hypothesized that will fit with the observed array of mutant effects. A possible alternative which can be considered is that slight differences in the structure of one large unit could have different severities of effect on the metabolism or on the surface of cells in the three affected tissues. It may be worth remembering that both normal germ cells and normal melanoblasts multiply rapidly as they migrate through or over other foreign cell populations before reaching their final destinations. Could specific cell interactions be involved in these migrations? The multiplication defect of germ cells in WIW" and SZISld fetuses is expressed during this migration, that of melanoblasts before or during migration. In the case of pigment restriction, the defect in WIW" is intrinsic to the neural crest-derived melanoblast, whereas that of SZISld involves the receiving skin or hair follicle. Could some specific reciprocal cell-surface interaction be required for these processes, as hypothesized for the early-phase response to erythropoietin? And if so, could the same W and Sl gene products possibly be involved in such different processes? It stretches the imagination to believe otherwise. One challenge to this "interaction" interpretation is the reduced germ cell number in Hertwig's mice. In this case a germ cell defect is associated with macrocytic anemia and defective response to erythropoietin, as in WIW" and SllSld, but the anlan erythropoietinresponse defect comes much later and is not known to involve cell inter action. Obviously, we have not yet put together all the correct interpretations as to causation of macrocytic anemias and associated effects, but we have many new avenues to pursue. IV. Defects in Iron Utilization
Mutant alleles at three different genetic loci in the mouse are responsible for iron-deficiency anemias, in which mice of affected genotypes characteristically have hypochromic erythrocytes with
412
ELIZABETH S. RUSSELL
lower than normal mean erythrocyte volume and lower than normal total hemoglobin content. Beyond these similarities, the syndromes are different for each of the iron-defect anemias, and certainly their etiologies are basically different.
SIDEROCYTIC ANEMIAOF FLEXED MICE A. TRANSITORY 1. Morphological Characterization
The single-gene induced character “flexed-tail” (flf, was recognized through appearance of tail flexures (Hunt et al., 1933) and the embryonic anemia associated with homozygous flexed ($0 individuals was first described in 1935 (Kamenoff, 1935). Early interest in this mutant centered around certain pleiotropic effects associated with the flf genotype. Flexure effects and stiffness of the tail result from “unilateral fusions of adjacent vertebrae,” with the abnormality first observed a t day 14 of prenatal development. By that stage of development an embryonic anemia is already expressed and prenatal growth is retarded in flexed fetuses. Kamenoff (1935) reported significantly shorter crown-rump length in flf as compared with -/+ fetuses as early a s day 11, and described the phenomena listed above. He postulated “that flexures are due to the retardation of growth a t a time when this is critical for intervertebral disks.” Later, he demonstrated reduction in number of blood-forming cells in day 16 and day 17 flexed fetal livers, with a higher than normal proportion of early precursor cells (Kamenoff, 1942). In his first work, he asked, “what is the primary effect of the flexed gene: anemia causing growth retardation, or growth retardation causing anemia?” Attention has since been directed to a third pleiotropic effect of flf gene substitution. On almost all genetic backgrounds, flexed mice show ventral white spotting, in contrast to solid color in congenic +/+ mice (Russell, 1955; Russell and McFarland, 1966). The basis for these pleiotropic relationships is still not completely understood. Studies by Hans Gruneberg have contributed greatly to understanding of flexed anemia. He measured the degree of hypochromic anemia in newborn flexed mice and followed changes in hematologic values from birth to 1 month, showing postnatal increase in red cell number (up to nearly normal by 1 week) and more gradual increase in mean corpuscular hemoglobin content (Gruneberg, 1942a). These results were later confirmed and extended to inbred FLIlRe-flf mice (Russell and McFarland, 1966). Through observations of flexed anemic fetuses and newborns, Gruneberg also identified an important but previously
HEREDITARY ANEMIAS OF THE MOUSE
413
unrecognized type of blood cell, the siderocyte, that contains granules of nonheme iron stainable with Prussian blue. (Large numbers of this type of cell are found in normal human, as well a s mouse, fetuses.) He concluded that “the anemia of flexed-tailed mice is a siderocyte anemia” (Gruneberg, 1942b). He presented data supporting his concept of a distinct generation of nonnucleated erythrocytes, which appeared after the primitive nucleated erythrocytes, but before the definitive generation erythrocytes produced only after birth. The nonnucleated erythrocytes making up his proposed “intermediate generation” are formed largely, but not necessarily exclusively, in the fetal liver and are somewhat larger (diameter approximately 8 Fm) than definitive generation erythrocytes (diameter 6 pm). “The flexed-tail gene . . . clearly delimits a n intermediate generation of blood cells, most of which” (95% in flexed fetuses) “are siderocytes, from the true definitive generation, in which these cells are scarce” (Gruneberg, 194213). Gruneberg noted that the very large primitive generation nucleated erythrocytes of both +/+ andflf fetuses were fully hemoglobinized, and in fetuses of both genotypes, they often’contained siderocytic granules. He made no attempt to determine the total number of circulating red cells in 12- and 13-day fetuses, but deduced (incorrectly) from proportions of nucleated versus nonnucleated cells that flexed (flfl fetuses were not anemic a t 12 days. Siderocytic granules also were seen in a moderate proportion of nonnucleated +/+ erythrocytes, but these “stippled” cells were well hemoglobinized. Almost all (95%) of the nonnucleated frf fetal erythrocytes were siderocytes, and these cells also contained very little hemoglobin (Gruneberg, 1942b). Most of the findings in this quantitative characterization of flexed fetal anemia have been confirmed on inbred FIJlRe-flf and congenic FIJ4Re-+/+ 12- to 16-day fetuses (Russell et al., 1968). As early as 12 days, and continuously thereafter, the body weights of f l f fetuses were significantly smaller than those of their +/+ counterparts, the numbers of both nucleated and nonnucleated RBC/mm3 also smaller in flf fetuses, and the total erythron (red cell mass) per fetus remarkably smaller (Russell et al., 1968). However, between day 12 and day 16 of prenatal development, the rate of increase in red cell mass was as great in flexed as in normal fetuses. An important difference between genotypes, however, was that, while almost all +/+ nonnucleated erythrocytes lost their stippling (correlated with presence of siderocytic granules) and became fully hemoglobinized, the great majority offlf nonnucleated erythrocytes remained poorly hemoglobinized and stippled (Russell et al., 19681. An early cellular defect in hemopoiesis in flf fetuses was manifested “stippled” cells were well hemoglobinized. Almost all (95%) of the
414
ELIZABETH S. RUSSELL
by smaller than normal numbers of erythroblasts and higher than normal erythroid to myeloid ratios in flexed early fetal livers (Bateman et al., 1972). These workers suggested that the ‘)7f genotype interferes with the flow of cells through the erythropoietin-sensitive cell compartment, and . . . this lesion retards colonization of f l f fetal liver” (Bateman et al., 1972). They also suggested that “development of hemoglobin synthetic machinery might be delayed during the early stages of hepatic erythropoiesis” (Bateman et al., 1972). This apparent double action of flexed, affecting both cellular proliferation and heme synthesis, has led to confusion and conflicting interpretations. 2. Genetic Exploration of Flexed Effects
It may be of interest to geneticists to learn of difficulties encountered in the development of inbred strains homozygous for the flexed gene Although all investigators have agreed that newborn flf mice are anemic, the expressions of tail-flexure and white-spotting differ with genetic background. Progress in inbreeding has proved to be difficult, either because of penetrance problems leading to misassignment of genotypes, or because of limited postnatal viability offlf individuals on many genetic backgrounds. Hunt et al. (1933) were unable to carry any lines beyond F3. Attempts to produce flf inbred lines congenic with either C57BL/6J or C3WHeJ were completely unsuccessful (E. S. Russell, unpublished results). Homozygosis was eventually achieved (in FLIlRe) by allowing the flexed gene to “select its own background,” starting from an outbred colony segregating for flexed, and selecting brother-sister lines favoring flf survival and expressivity. A congenic normal inbred strain (FL/4Re), and congenic lines segregating for W/ + , were produced by repeated backcrosses of the normal wild-type allele at the flexed locus, and the W-allele from strain WB/Re, to the FL/lRe genetic background (Russell and McFarland, 1966; Coleman et al., 1969). Interactions between effects on fetal hematology of two nonallelic anemia-producing genes ( W and F ) have been studied by comparing FUlRe (+/+; flf, fetuses with congenic WIW; +/+ and W/W; f l f fetuses (Russell et a l . , 1969):
(fro.
Quantitative evaluation of the developing erythron of 12- to 16-day inbred normal fetuses . . .; of highly congenic fetuses with siderocytic anemia , . .; and of similar fetuses with W series macrocytic anemia . , . has demonstrated that both of these deleterious genotypes (W and f , have inhibited growth and have differentially reduced red cell number by the 12th day of development. Between 12th and 16th day of fetal development, the total erythron expands 70 fold in +/+; +/+ and +/+;flffetuses, 30 fold in WIW;+/+, and 20 fold in doubly anemic WIW;flf. . . . Histological classification of red cell types showed that W gene action inhibits proliferation of both the primitive large
HEREDITARY ANEMIAS OF THE MOUSE
415
nucleated erythrocytes and the subsequent smaller nonnucleated erythrocytes, but does not interfere with the deposition of hemoglobin in the few cells produced. By contrast, flf gene substitution, although it reduces the size of the total erythron as early as day 12, does not decrease the rate of increase of red cell numbers, but rather inhibits hemoglobin deposition in nonnucleated red cells of 13- to 16-day fetuses. Both of these independent gene actions reduce available hemoglobin, and their combination (in WIW;flf fetuses) leads to prenatal lethality.
3. Flexed Gene Effects on Hernopoiesis in Adult Mice Even though the peripheral blood values of adult flexed mice are completely normal, thefrf genotype still exerts a significant effect upon hemopoietic regeneration. The activity of 6-aminolevulinate dehydratase (ALD) rises sharply in spleens and livers of mice undergoing hemopoiesis, to a level determined a t the locus controlling level solely by alleles (Lu“ or Lub)of 6-aminolevulinate dehydratase, which segregates independently from the flexed locus (Coleman et al., 1969): A delay in the normal compensatory increase in ALD activity was observed in spleens from homozygous flexed mice after phenylhydrazine treatment when compared with normal mice. The parallel delays in the rate of spleen hypertrophy, in the increase of nucleated cells staining for hemoglobin, and in the development of a second enzyme in the heme biosynthetic pathway, uroporphyrinogen synthetase, suggest that the flexed locus affects hemopoiesis by controlling the rate of proliferation of hemopoietic cells.
4 . Experimental Analysis of Flexed Gene Effects The transitory nature of flexed siderocytic anemia, and the apparent implication of defects in both cellular proliferation and heme synthesis in its etiology, have stimulated a variety of experiments designed to unravel its mysteries. Among the first were studies of spleen colony formation, with the initial finding of normal numbers of colonyforming units (CFU-S) in 17- to 19-day livers from flexed fetuses, although the spleen colonies tended to be very small and deficient in erythroid cells 10 days after implantation (Thompson et al., 1966a). The authors suggested that “delay in heme synthesis is a consequence of delayed maturation of erythroid cells rather than of a defect in the heme synthetic capacity of individual cells.” This view was developed further in experiments, using radioautographic technique, which showed that the f l f defect in hemopoiesis was limited to erythropoietic cells and was “manifested only under conditions of rapid hemopoietic growth” (Fowler et al., 1967). Later studies of the formation of transient endogenous erythroid colonies (TE-CFU) in the spleens offlf and +/+ mice, 4-6 days after irradiation and stimulation by erythropoietin, showed greatly reduced numbers of TE-CFU in flexed as compared to normal spleens, although numbers of CFU-S after 12
416
ELIZABETH S. RUSSELL
days were similar in both genotypes. These results “indicate that the generation or maturation of TE-CFU represents a primary site of expression of the flf defect” (Gregory et al., 197513).However, a somewhat different evaluation of the cellular makeup of flexed livers was reported by Bateman and Cole (19721,who found that the total number of CFU-S and of nucleated liver cells was reduced in 11-to 16-dayflf as compared with +/+ fetal liver, but their ratio of CFU-S to nucleated cells was normal. Fewer recognizable erythroblasts were seen in flf than in +/+ 13- to 16-day fetal livers. In cultures of cells from ll-l&dayflf and +/+ fetal livers, Cole and Regan found reduced numbers (50% normal) of CFU-E in flf cultures, but normal numbers of CFU-C. These authors examined the “possibility that restricted haem synthesis is the primary effect of the flf genotype, and responsible for disturbances of both haemopoietic cellular proliferation and haemoglobin synthesis” (Cole and Regan, 1976). From day 13 of prenatal development until birth, fetal red cells fromflf and +/+ fetuses, exposed to j9Fe in vitro, took up the same amount of iron per cell, but “the flexed cells incorporated less than half as much isotope into heme as did the normal cells” (Fowler and Russell, 1968). This finding was confirmed by Cole et al. (1972). Similar levels of heme synthetase activity were found in flexed and normal fetal erythrocytes, but the activity was “markedly dependent on protoporphyrin added’ in flf fetal reticulocytes, and relatively independent in +/+ reticulocytes (Cole et al., 1974). These investigators also studied globin synthesis in fetal reticulocytes, and found that in “+/+ fetal reticulocytes a- and P-globin was synthesized in approximately equal amounts during a 4 h labelling period, but in flf reticulocytes there was an approximate 50% deficiency in P-globin synthesis” (Cole et al., 1974). Further information has been obtained on globin synthesis in flf fetal reticulocytes (Chui et al., 1977). These investigators demonstrated that the excess nonheme iron accumulates in the mitochondria in flf siderocytes. They also showed that P-chain synthesis is decreased compared with a-chain synthesis, confirming findings of Cole et al. (1974). However, Chui et al. (1977) found that exogenous hemin affected +I+ more thanfif hemopoiesis, and three different heme synthesis inhibitors altered protein synthesis more in normal than in flexed reticulocytes. All who have studied hemopoiesis in flexed embryonic mice agree that both cell proliferation and hemoglobin synthesis are affected. Confusing and conflicting secondary findings make it difficult a t present to determine the nature of the primary flexed gene effect.
417
HEREDITARY ANEMIAS OF THE MOUSE
A clear, concise summary of work up to 1973 on flexed hemopoiesis may be found in a n excellent review by Bannerman et al. (1973).
B. SEX-LINKED ANEMIA,AN ABNORMALITYOF INTESTINAL MUCOSA
THE
Discovery of a sex-linked anemia in the mouse (Grewal, 1962) and the position of the recessive gene (sla) responsible for this anemia between Bent-tail [Bn, map distance 10 centimorgans (cM)] and tabby (Ta, map distance 3 cM) (Falconer and Isaacson, 1962) were reported simultaneously. Affected individuals (slalY males and slalsla females) were smaller than their normal littermates at birth and at 7, 14, 21, 28, and 240 days postnatal. They had lower than normal red cell counts, with mild hypochromia and microcytosis (Grewal, 1962). Bannerman and Cooper (1966) reported the anemia to be severe (4-8 gm of hemoglobin per 100 ml of blood) shortly after birth, but with a tendency to be corrected with advancing age. A few anemic mice died between birth and weaning. The mutant sla gene has been transferred, by repeated backcrossing, to the C57BU6J genetic background (E. S. Russell, unpublished) and most of the research reported here utilized slalsla and slalY mice congenic with C57BL/6J. Hematologic values of slalY and slalsla mice were improved to normal levels by intravenous injections of iron-dextran, although parenteral iron was completely ineffective (Bannerman and Cooper, 1966; Bannerman and Pinkerton, 1967). At 33 days, blood smears from slalY mice showed hypochromia, poikilocytosis, and anisocytosis with target cells (Bannerman and Pinkerton, 1967). Young slalsla and slalY mice had depleted tissue iron stores (3.72 k 0.27 mg/100 mg body weight vs 5.49 5 0.27 mg/100 ml for -/+ counterparts). Serum iron was lower than normal, total ironbinding capacity was increased, and iron clearance was very rapid in slalY and slalsla mice (Bannerman and Pinkerton, 1967). Interestingly, excessive stainable iron deposits were seen in the epithelium of the duodenum and upper jejunum of slalY and slalsla mice, but not in normal littermates (Pinkerton and Bannerman, 1967; Pinkerton, 1968). No clear-cut evidence of a mosaic pattern of cells with, versus cells without, iron deposits has been observed in s1al-t females, but this may be a methodological defect. “Anemic animals show evidence of increased hemopoiesis and striking depletion of the body stores of iron, most noticeably in the spleen.” They “show accuniulations of hemosiderin in the mucosal cells of the upper small intes-
418
ELIZABETH S. RUSSELL
tine,” suggesting that “iron transport from intestinal mucosa . . . is defective” (Pinkerton, 1968). These findings, plus the effectiveness of intravenous iron-dextran treatment, suggested that the site of sla gene action might be in the gut epithelium, rather than indigenous to the hemopoietic tissue. Strong support for this view came from the finding that marrow cells from anemic slalY males saved the lives of lethally irradiated normal mice, producing normal numbers of normal red cells in the recipients (Bennett et al., 1968a). Another argument proposed against sla gene action within hemopoietic tissue has been the absence in erythrocytes of slal + heterozygous females of any duality in the red cell population, as “might have been expected in terms of the Lyon hypothesis if the gene directly affected erythroblasts” (Pinkerton and Bannerman, 1968). A hint of heterozygous effect ofsla has been found, however, in a greater susceptibility to dietary iron effects of deficiency in slal+ than in +/+ females (Edwards et al., 1972). The finding of “impaired rather than increased intestinal iron absorption, indicating the anemia is a consequence of iron malabsorption, . . . suggests that the genetically determined defect in intestinal mucosa.. . may be due to deficiency o f . . . enzyme or carrier substance necessary for normal transfer of iron from intestinal mucosal cell to plasma” (Pinkerton et al., 1970). Numerous approaches have been utilized to investigate the nature of the sla iron-transport defect. Everted duodenal sacs, with cells that line the intestinal lumen on the outside, showed the “overall uptake of Fe the same in slafY and normal sacs, but transport of iron to the inside of the sac was much decreased in sla” (Edwards and Bannerman, 1970). The problem in transfer from mucosa to plasma is a partial defect involving iron but not calcium, galactose, or proline, and transfer of iron appears not to be increased by several different physiological stimuli (Manis, 1970, 1971). This could imply that slalsla and slalY mice “lack a substance required for iron transport,’’ or exert an influence that “binds iron within the cell abnormally” or produce in the intestinal mucosal cell a specific inhibitor (Manis, 1971). Ultrastructural studies of the duodenal mucosa of slalsla and slalY mice showed ferritin deposits in the lysosomes and cytoplasm (Bedard et al., 1971). However, radioautographic studies showed the rough endoplasmic reticulum to be the main site of localization of iron in the duodenal mucosal cells of slalsla and slalY mice (Bedard et al., 1973). Studies of iron-absorption and iron-binding proteins in the intestinal mucosa showed a special relation between “protein 2,” important in rapid absorption, and insufficient adaptation to low iron diet in slalY mice
HEREDITARY ANEMIAS OF THE MOUSE
419
(Huebers et al., 1973). Iron absorption was less in sla-anemic than in normal mice on both normal and iron-deficient diets, with a “relationship between this insufficient adaptation of iron absorption to the low-iron diet” and level of protein 2. This abnormal behavior of protein 2 may be due to a defect of its biosynthesis, to its iron-binding properties, or to a defect in an enzymically controlled loading and unloading mechanism. No decision can be reached until further information is available (Huebers et al., 1973). Phenobarbitone administration enhances iron absorption in hematologically stressed normal, but not sla-anemic, mice on a n iron-supplemented diet. The same substance enhances iron absorption in both sla-anemic and normal mice maintained on a n iron-deficient diet (Scorbie et al., 1974). The iron transport pathway in sla-anemic mice has a limited capacity when saturated with dietary iron, but normal regulatory mechanisms operate when the pathway is not saturated. Whether the primary defect lies in a mucosal intracellular component or in a n extracellular stimulus to activate iron transport is not clear” (Scorbie et al., 1974). The treatment of slalY mice on an iron-deficient diet with phenobarbitone enhanced iron absorption, and led to “disappearance of iron-staining material from the duodenal mucosa. The results of this study indicate that the defect in sex-linked anemia is probably not a qualitative one but rather a n abnormality in the regulation of iron absorption” (Edwards and Hoke, 1975a). The ferritin concentration in liver and spleen is lower in slalY than in +/Y mice. The synthesis of ferritin in the duodenum, both in vivo, and in vitro in everted sacs, increases with iron-deficient diet in slalY mice, but decreases in +/Y mice. By contrast, the synthesis of ferritin in the liver is decreased by iron-deficient diet in both +/Y and slalY mice. These findings suggest that “the primary genetic defect” in slalY and slalsla mice “is more likely a disorder of intramucosal iron transport than a primary disturbance of ferritin metabolism” (Edwards et al., 1977). This iron-transport difficulty obviously leads secondarily to alterations of hemopoiesis. There is an “element of ineffective erythropoiesis with increased early-labeling of bile pigment” (Kreimer-Birnbaum, et al., 1972b). The erythrocytes contain elevated levels of free erythrocyte protoporphyrin and there is a moderate increase in fecal urobilinogen (Kreimer-Birnbaum et al., 1972a). A new hematinic agent, called EX10-478, provides nonionized iron when administered in the diet. It is as effective as intravenous irondextran in curing the anemia of sla mice. EX10-478 is well absorbed from the intestine of both + / Y and slalY mice, and more is used for
420
ELIZABETH S. RUSSELL
erythropoiesis in slaiY than in +/Y mice. Apparently there is “no defect in the absorption of non-ionized iron in sex-linked anemia” (Edwards et al., 1974). One interesting facet of sex-linked anemia has been relatively little investigated. In young adult slaisla and slalY mice, the defect is clearly in transport of iron from the intestinal mucosa to the blood plasma. Such a defect should have no effect prior to birth, yet newborn slaisla and slalY mice, and 19-day slalY fetuses, are anemic (Dancis and Jansen, 1970). Is there a defect in placental iron transport? “The anemia in newborn sla mice is attributable to iron deficiency, since their total body iron is lower than in normal newborn mice, while their birth weights are almost identical” (Kingston et al., 1978). By following weights and blood values of individual mice in segregating litters, from birth to over 50 days of age, retrospective assignment of genotypes of newborn slaisla, slal+, slaiY, and +lY mice was possible, leading to the conclusion of lower iron content in slaisla and slalY than in s l d + and +I+ newborn mice. “Hemoglobin levels a t birth . . . are also influenced by the mother’s genotype and phenotype. . . . For any given newborn genotype, the haemoglobin will be progressively lower according to the sla gene dose of the mother. . . . When radioiron was administered continuously in food a significant cumulative reduction in iron transfer to anemic foetuses was demonstrated” (Kingston et al., 1978).These careful studies provide real evidence of a defect in placental iron transport to slaisla and slaiY fetuses, resulting in prenatal and newborn anemia.
C. MICROCYTIC ANEMIA,A GENERALIZED DEFECTIN IRON ABSORPTION Microcytic anemia (mklmk), inherited as an autosomal recessive, differs from previously reported anemias in showing “compensatory increase in the production of red blood cells . . . approximately one-half normal size . . . so that by weaning age” mklmk mice have more than the normal number of erythrocytes (Nash et al., 1964). The original mutation was detected in the F, generation from a cross between C57BLl6J and DBAIBJ (Nash et al., 19641,but was soon placed on three different homogeneous genetic backgrounds, either by repeated brother-sister matings with forced heterozygosis a t mk, starting from the original F, stock (MKIRe-mkl+) or by repeated rounds of cross-intercross matings to previously established inbred strains (SECIlRe-mkl+ and WBIRe-mki+). Poor postnatal viability of mklmk
HEREDITARY ANEMIAS OF THE MOUSE
42 1
individuals prevented similar establishment of mk on C57BL/6J (Russell et al., 1970a). Possibility of allelism of mklmk with two mutants causing hemolytic anemia (ha and j a ) was eliminated by test crosses, as was allelism or linkage with either Hba or Hbb, the hemoglobin structural loci (Russell et al., 1970b). Further linkage tests demonstrated that the mk locus is on chromosome 15, closely linked to Caracul (Ca), with 38 crossovers (8.2%) in a test population of 465 (McFarland and Russell, 1975). Eight-week-old microcytic mice congenic with WWRe, SEUlRe, or 10.9 g d d l for WB/Re all showed low blood hemoglobin content (15, mklml versus 6 17.5 g d d l for -/+ in SEC/lRe); small mean erythrocyte volume (29 pm3 for mklmk versus 47 pm3 for -/+ in SEC/lRe); low mean corpuscular hemoglobin concentration (27 g d d l packed red cells for mkimk, vs 35 g d d l for -/+, in SECIlRe); and low mean corpuscular hemoglobin content (E, 8 pg per erythrocyte for mklmk vs 17 pg per erythrocyte for -/+, in SEC/lRe) but higher than normal numbers of red cells (Russell et al., 1970b). Similar values were obtained for microcytics congenic with each of the three inbred strains, and all developed elevated red cell numbers, showed high reticulocyte percentages, and had enlarged spleens (Russell et al., 1970b). The small reticulocytes of mklmk mice typically contain more ribosomes than do the larger reticulocytes of normal mice, so that when they are spread on glass slides and stained with Methylene Blue, the ribosomes of mklmk reticulocytes appear in a “Christmas wreath” arrangement. Microcytic mice give a n effective response to long-term hypoxic exposure. A group of 6 young adult SEC/lRe-mklmk mice, with a mean pretreatment hematocrit level of 39.5%, achieved a mean hematocrit level of 53.0% after 5 weeks in a hypobaric chamber, as compared with 6 SEC/lRe-+/+ counterparts, whose hematocrit levels rose from a pretreatment mean of 49% to a maximum mean of 66%during concomitant 5-week exposure. The drop in hematocrit following return to ambient atmospheric conditions was more rapid in mklmk mice (back to 4Wu in 1week, with stabilization at 36-37% 2-6 weeks after return) than in +/+ controls (gradual return to 49% by 3 weeks, and stabilization a t 46-47% in weeks 4 to 6 after return) (G. L. Keighley, unpublished results). Examination of 15- and 16-day mklmk fetuses, identifiable in segregating litters by pale color, showed normal numbers of small, pale erythrocytes. The “hemoglobin deficit of mklmk fetuses results entirely from reduction in erythrocyte size and hemoglobin content, rather than from reduced red-cell number. It is interesting that at the 15th
422
ELIZABETH S. RUSSELL
and 16th days of gestation the hemoglobin deficit of mklmk fetuses has not had a deleterious effect on growth.” At birth, when mklmk mice still have normal numbers of erythrocytes, their mean hematocrit percentages were 70-75% of those of normal littermates (Russell et al., 1970b). A pleiotropic effect of mklmk, particularly noticeable on certain genetic backgrounds, is the development of severe skin lesions, appearing at 1-3 weeks postnatal. There is a strong genetic influence on the incidence of this lesion that contributes to mortality. Microcytic hypochromic anemia and development of skin lesions are important, but relatively ‘independent, manifestations of mk gene action (Russell et al., 1970a). Postnatal viability was poor in MWRe, and worse in early generations of crosses to C57BL/6J, where incidence of skin lesions is high. The postnatal viability of SEC/lRe-mklmk mice is considerably higher, and that of WBIRe-mklmk mice normal, corresponding with low incidence (SECIlRe) and absence (WB/Re) of skin lesions (Russell et al., 1970a). The mother’s genotype also affects viability of offspring, at least in MWRe. Only 44% of the mklmk offspring of mklmk mothers survived to weaning, in contrast to 70% of the mklmk offspring of mkl+ mothers (Russell et al., 1970a). It seems probable that mklmk mothers and mklmk offspring are competing for some metabolite(s1, of which neither has as high a level as do normal littermates, and which neither can absorb as efficiently as can normal mice. In young adult mklmk mice, there appear to be two erythrocyte populations: most red cells are much more osmotically resistant than are normal erythrocytes, but there is a small population of osmotically very sensitive cells (Russell et al., 1970a). This small sensitive red cell population may be related to the subpopulation of short-lived cells discovered by Landaw et al. (1970). “Red blood cell survival and patterns of erythropoiesis-associated haem destruction were studied in mice with microcytosis (mklmk) of the MWRe and SEC/lRe strains and normal controls, using the endogenous production of I4CO following gly~ine-2-’~C injection” (Landaw et al., 1970). Splenic destruction of some reticulocytes was deduced, as well as increased random red-cell hemolysis. An alteration of “early peak” red cell destruction in mklmk mice suggested a “small component of ineffective erythropoiesis.” No treatment applied reduced the high rate of random hemolysis of mklmk erythrocytes. Both ineffective erythropoiesis and destruction of reticulocytes were abolished in mklmk mice that had previously been splenectomized (Landaw et al., 1970). The involvement of a defect in iron metabolism in the etiology of
HEREDITARY ANEMIAS OF THE MOUSE
423
microcytosis soon became apparent. Microcytic mice show depleted body iron stores, and little iron deposited in tissues, but only slightly increased iron-binding capacity (Bannerman et al., 1972). At some levels the results of their defect are similar to those seen in mice with sex-linked anemia; their red cells have high levels of free erythrocyte protoporphyrin, and they show moderately increased fecal urobilinogen (Kreimer-Birnbaum et al., 1972a). Microcytic anemic mice also show impaired intestinal absorption of iron i n uivo, and defective mucosal uptake ofiron in everted duodenal loops in vitro (Edwards and Hoke, 1972). Unlike mice with sex-linked anemia, microcytic anemic mklmk mice do not clear intravenously injected 59Ferapidly from the plasma, nor do they utilize it efficiently (Bannermanet al., 1972).A suitable “working hypothesis” is “that a generalized impairment in the cellular uptake of iron, involving the transfer of iron from the intestinal lumen to the mucosa, and from the plasma to the erythroblast, may provide a unitary explanation of hereditary microcytic anemia” (Bannerman et a1., 1972; see also Bannerman et al., 1973). Implantation of mklmk marrow cells in histocompatible WIWcrecipients (with macrocytic anemia) resulted in change of the host blood picture to typical microcytic anemia, leading to the conclusion that the hemopoietic tissue is a primary site of mklmk gene action (Bernstein, 1972). The blood of mklmk mice also contains circulating stem cells. These can implant in recipients of transfused blood, as in the case of W1W mice whose formerly macrocytic anemic hematologic values changed to typical mklmk values following large-scale (2.3 ml) transfusion of mklmk whole blood (Bernstein, 1973). Reciprocal transplants of mklmk marrow cells into lethally irradiated normals, and of +/+ marrow cells into lethally irradiated mklmk mice, demonstrated clearly that mklmk primary gene action occurs both within hemopoietic tissue and in other parts of the body (Harrison, 1972a). After implantation of mklmk marrow cells, lethally irradiated +/+ mice acquired a microcytic blood picture, but retained their high spenic iron stores. Irradiated mklmk mice acquired an intermediate type of blood picture following implantation of +I+ marrow cells. When these chimeric mklmk mice with +/+ hemopoietic cells were given iron injections, they “produced normal erythrocyte parameters, normal blood values, spleedbody weight ratios, and reticulocyte percentages, although body iron stores remained low (Harrison, 1972a). Although intravenous iron injections given to microcytic mice, or to chimeric +/+ mice with mklmk hemopoietic tissue, did not alter their
424
ELIZABETH S. RUSSELL
peripheral blood values, beneficial results were seen in acceleration of recovery from large-scale blood loss. “These results indicate that not only the erythrocyte precursor cells, but also iron supplies to these cells, and splenic iron stores, are defective in microcytic mice” (Harrison, 1972a). Comparing iron uptake by SECilRe-mklmk reticulocyte-rich blood and reticulocyte-rich blood from acutely bled SEC/lRe-+I+ , Edwards and Hoke (1975b) concluded that their results “support the hypothesis of a generalized impairment of cellular iron uptake in hereditary microcytic anemia and suggest that t.here might. he a defect in red cell receptor sites for transferrin in this condition” (Edwards and Hoke, 1975b). Several other features of microcytic erythrocytes should be mentioned. In a study of levels of 14 different enzymes of the glycolytic and pentose phosphate pathways, there were no enzyme deficiencies in microcytic erythrocytes, and no major changes in reduced glutathione, NAD, NADP, or methemoglobin content (Hutton and Bernstein, 1973). Microcytic WBBGF,-mklmk erythrocytes show a mild to moderate increase in ALA dehydratase, uroporphyrin-I synthetase, and protoporphyrin IX, probably reflecting, in part, “increased frequency of cells that are still active in heme biosynthesis,” and also resulting from “decreased ferrochelatase activity due to iron deficiency” (Sassa and Bernstein, 1977). Normal mouse erythrocytes have relatively low sodium content and high potassium content. The sodium content in mklmk erythrocytes is much higher than that in +/+ erythrocytes, although the potassium level is normal, and levels and ratios of both electrolytes are normal in plasma. These findings, also characteristic of certain other hypochromic anemias, suggest a derangement of a membrane-bound sodium pump (Waymouth, 1973). There is no disturbance of the ratio between hemoglobin a-chain and @-chainsynthesis in reticulocytes of microcytic mice (Rowley, 1972). V. Spontaneous Hereditary Hemolytic Anemias, with Fragile Red Cells
A. GENETICINFORMATION Between 1959 and 1969, five different hereditary anemias were described in the mouse. The first, called “jaundiced’ cia),appeared as a segregant in a colony of inbred strain 12915 mice a t the Jackson Laboratory (Stevens et al., 1959). Since affected individuals never survived more than 24 hours after birth, ovarian transplants were
HEREDITARY ANEMIAS OF THE MOUSE
425
utilized for propagation of the mutant, soon determined to be transmitted as a n autosomal recessive. The second hemolytic anemia described was first recognized in the F,, generation of a developing inbred strain, NZB/BL, maintained in New Zealand (Bielschowsky et al., 1959). All individuals in later generations of inbreeding (at F42 in 1959) were born with normal blood values, but later developed autoimmune hemolytic anemia. No single gene has been located as the cause of this syndrome, which will be described in more detail below (Section V, F). A third hemolytic anemia, called spherocytosis, was found in partially inbred descendants of a random-bred stock related to C3H. The condition, which proved to be inherited as a n autosomal recessive (sphlsph),was “lethal, and no animal with it has survived more than 24 hours” (Joe et al., 1962). A fourth hemolytic anemia, which appeared in a heterogeneous stock at the Jackson Laboratory, also proved to be inherited as an autosomal recessive, but the mutant gene ( h a ) was not allelic to or linked with j a , even though “homozygotes of hemolytic anemia (halha) resemble in nearly every detail jaundiced homozygotes (ialja)’’ (Bernstein, 1963b). The fifth hemolytic anemia syndrome, normoblastic (nblnb), also appeared as a n autosomal recessive mutant in a mixed stock a t the Jackson Laboratory (Bernstein, 1969). It also was not allelic to any of the previously described single-gene induced hemolytic anemias. Attempts to establish the positions on the genetic linkage map of the four loci whose mutant alleles cause hemolytic anemias have been fraught with difficulty because of limited viability and fertility of homozygous affected mice. Homozygous jaundiced (jafja) and spherocytic (sphlsph) mice almost invariably die within 1 or 2 days after birth. Even though approximately one-half of the hemolytic (ha/ h a ) mice survive to weaning, they will not breed. On the most favorable genetic backgrounds, normoblastic mice (nblnb)will grow to adulthood, but their fertility is limited. Until very recently, no reliable means were available for distinguishing heterozygous carriers (+/ja, +/ha, +lnb, +lsph) from their +/+ littermates. Despite these hampering characteristics, linkage tests have eliminated for each locus (1) allelism to or close linkage with the two loci Hba and Hbb that determine structures of the adult hemoglobin a-chain and P-chain, respectively; (2) allelism with any of the other three hemolytic anemiadetermining loci (Bernstein, 1979). Further, negative linkage data have been obtained showing that the ha locus is not closely linked to marker genes on 10 chromosomes: L p ( l ) ,Sd (2),Hin (5),c (71, se (9),Sl
426
ELIZABETH S. RUSSELL
(101,gr (101, Re (111,Ca (151, or ru (191. Similarly, theja locus is not closely linked with L p (l),M i “ h (61, c (71, Es* (8),g r (101, X t (13,Tw (181,ru (191,Dc (19), or ep (19). The nb locus is not closely linked with Ra (2>,Pt (41, c (71, Eso(S), 0 s (8),sch t9), SZ (101, Re (111, wa-2 (ll), sh-2 (111,V a (31,or X t (13).The linkage relations of the spherocytosis locus (sph) have been less thoroughly investigated, but close linkage with c (7),sch (9), and E h (15)have been eliminated (Bernstein, 1979). The search will continue, perhaps with greater ease, through tests involving identification of heterozygotes (see Section V, E). As stated earlier, most of the hemolytic mutants arose in heterogeneous genetic stocks, and certainly no two appeared in the same genetic stock. The great similarities of all hemolytic phenotypes made it very desirable to have each mutant gene segregating against a common genetic background, to facilitate intergenotype comparisons. It also was desirable to find a genetic background that provided optimal viability for mice of each severely affected homozygous genotype. Backcrosses of mutant alleles onto several different inbred backgrounds resulted, within very few generations, in early homozygote lethality. The plan developed by Bernstein (1979) to counteract this difficulty has worked very well for all four hemolytic mutants. “The mutant genes ( m )were introduced into two different standard inbred mouse strains, C57BLi6J and WB/Re, by repeated backcrossing for more than 20 generations, and backcrossing continues. WB/Re-+/+ and +lm littermates in each generation are mated to known C57BL/ 6J-+/m. Thus mice of the two genotypes, +/+ and +lm, are distinguishable, but only on the basis of the types of offspring they produce when mated with a known carrier (+lm). Following genotype identification, the heterozygotes are either mated with new WBIRe-+/+ to produce the next backcross generation, or mated with a heterozygote similarly identified (C57BL/6J-+/m) to produce an F, generation. . . . The F, generation (WBBGF,) is genetically homogeneous (possessing all of the genes present in both parental inbred stocks) except for substitutions at the m locus. . . . Affected offspring with this F, genetic background have a significantly increased vitality, . . . may be compared and contrasted with other genotypic ‘parallels’ on this common background, and can be transplanted with tissues from either parental strain without difficulty” (Bernstein, 1979). OF THE SINGLE-LOCUS HEMOLYTIC SYNDROMES B. DESCRIPTIONS
Certain features are characteristic of all four single-locus induced hemolytic anemias. All homozygous affected fetuses (mlm) survive to term, and neonates, often eaten by their mothers, are “severely anemic
HEREDITARY ANEMIAS OF THE MOUSE
42 7
but not initially jaundiced. . . . They develop a severe icteric condition within a few hours of birth” (Bernstein, 1979). Bilirubin accumulates to very high levels in their serum, especially before the glucuronyl transferase system develops, and large quantities of biliverdin are excreted. Juveniles show hepatomegaly, splenomegaly, cardiac hypertrophy, and extramedullary hematopoiesis (Bernstein, 1979). The blood of those that survive continues to have lower than normal red cell numbers, low packed-cell volume, and low hemoglobin content. Although the mean erythrocyte volume is usually higher than normal, many of the cells have aberrant shapes, frequently with stippling. The reticulocyte percentages are very high, and many nucleated cells are seen in the peripheral blood. “The peripheral blood values and the morphological features of the formed elements are markedly different from normal but indistinguishable from” those of other “mutants within the hemolytic disease group” (Bernstein, 1979). Landaw, using his method of measuring heme catabolism by 14C0formation (Landaw and Winchell, 1970), showed that the erythrocyte life-span in the various hemolytic anemias ranges from 1/50 to 1/200 that of normal erythrocytes, and splenectomy does not materially increase red cell life-span (Bernstein, 1979). The erythrocytes of all hemolytics are “osmotically extremely fragile.” In hemolytic anemic (halha) and normoblastic (nblnb) mice, there is a single population of cells very easily lysed in hypotonic NaC1. In spherocytic (sphlsph) mice, however, there are several different erythrocyte subpopulations, differing in extent of fragility. In the most severely affected of all mutants, jaundiced (ja/ja),the “erythrocytes are so easily damaged in handling that we have not been able to compare them with the other mlm types” (Bernstein, 1979). The defects associated with each of these mutants is intrinsic to blood-forming tissue. “In every case where mlm bone marrow has been transplanted into macrocytic normochromic” anemic WIWc mice, the “WIW“recipient has been completely converted phenotypically to the donor type. . . . The host becomes hyperbilirubinemic, excretes biliverdin, and develops massive hepatosplenomegaly” (Bernstein, 1979).
C. ABSENCEOF HEMOGLOBINOPATHY AND ENZYME DEFECT In humans, hereditary hemolytic anemias have often been found to be associated either with abnormalities in hemoglobin structure or with deficiencies of enzymes, particularly those in the glycolytic pathway (McKusick, 1975). The situation is very different for spontaneous hereditary hemolytic
428
ELIZABETH S. RUSSELL
anemias in the mouse. None of the four mutant alleles responsible for severe hemolytic anemias can be a p-chain hemoglobinopathy, since none behaves as though allelic with, or even closely linked to, the Hbb locus, determining hemoglobin p-chain structure. The Hba locus, determining hemoglobin a-chain structure, is located on chromosome ll, between wa-2 and sh-2. None of the mutants is allelic to Hba. The locus for normoblastosis ( n b )has been shown not to be linked to either wa-2 or sh-2, hence can not be closely linked to the Hba locus. The ha locus, for “hemolytic anemia,” is known not to be linked to Re, which is also on chromosome 11,but approximately 35-45 units from Hba. No tests of chromosome 11 linkage have been reported for jaundiced (ia) or spherocytosis ( s p h ) . In tests of levels of 14 different enzymes in the glycolytic and pentose phosphate pathways in anemic mice homozygous for three (ha, nb, sph) of the four mutant alleles responsible for hemolytic anemias, no instances of enzyme deficiency were found (Hutton and Bernstein, 1973). There also were no major changes in reduced glutathione, NAD, NADP, or methemoglobin content (Hutton and Bernstein, 1973). Analysis of enzyme levels in these severely anemic mutant mice were complicated by their extremely high reticulocyte and nucleated cell counts. On the basis of red cell hemoglobin content, the rate of entry into the glycolytic pathway was extremely high, but on the basis of reticulocyte and nucleated cell content, it was only moderately elevated (Hutton and Bernstein, 1973). High free erythrocyte protoporphyrin levels are characteristic of mice with hemolytic anemia (Kreimer-Birnbaum et al., 1972a). Using new methodology that can determine accurately the amount of protoporphyrin in a single drop of blood, Sassa and Bernstein (1978) have demonstrated that the free erythrocyte protoporphyrin level in halha, j d j a , nbinb, and sphlsph erythrocytes is approximately 10 times that in erythrocytes from highly congenic +I + mice (Kreimer-Birnbaum et al., 1972a). It appears that the “heme synthetic pathway is intact and normally reactive in all of these mutants” (Sassa and Bernstein, 1977; Bernstein, 1979). OF REDCELLMEMBRANE DEFECTS D. EVIDENCE
Defect in red cell membranes has come, by a process of elimination, to be the most probable cause of mouse hemolytic anemias. The first report of positive evidence to support this hypothesis came from a study of erythrocyte sodium and potassium levels in normal and anemic mice (Waymouth, 1973). The electrolyte balance in eryth-
HEREDITARY ANEMIAS OF THE MOUSE
429
rocytes of normal mice and several other species differs from that in man and a different group of other species. The level of sodium ions in normal mouse erythrocytes tends to be low (mean approximately 13 meqlliter) with slight but significant differences between inbred strains, and the potassium level tends to be high (mean, 118meq/liter), again with slight but significant strain differences. Although the sodium ion level remains normal in mice with hypoplastic anemias (W, S1, a n ) and in two of the iron-defect anemias ( f , sla), very high levels (48-64 meq/liter) are seen in mice homozygous for any one of the four hemolytic mutant alleles ( h a ,j a , nb, and sph). In these conditions, the plasma sodium and potassium levels remain normal (Waymouth, 1973). These findings “suggest derangement of the membrane-bound sodium pump” (Waymouth, 1973). Direct studies of erythrocyte membrane components have been undertaken, motivated a t least in part by curiosity concerning shape determination. “Factors that control the shape of the cell appear to be intrinsic to membranes, since osmotically hemolyzed cells can retain their biconcave shape” (Greenquist et al., 1978). The erythrocytes of mice with spherocytosis show a “broad distribution of cell sizes, from microcytic to macrocytic.” They are “extremely spheroidal and unstable, and membranes from these cells show a remarkable deficiency in one of the principal membrane proteins, spectrin” (Greenquist et al., 1978). In normal mice, spectrin constitutes 20%0 of erythrocyte membrane protein. It “contains two polypeptide chains with molecular weights of 240,000 and 220,000 daltons” (Greenquist et al., 1978). Spherocytic erythrocytes showed “substantial reduction in the very high molecular weight polypeptides called spectrin (bands 1and 2). The band 1component was absent and the band 2 component was markedly reduced’ (Greenquist et al., 1978).These authors demonstrated that spectrin did not degrade during membrane isolation, so the decrease was not due to release during isolation. The “finding of spectrin deficiency in whole sphlsph cell preparations . . . confirms the deficiency of spectrin in the sphlsph erythrocyte” (Greenquist et al., 1978). In all four hemolytic mutants, “spectrin varies from none to one-half the normal amount,” and “degree of deficiency correlates closely with clinical severity” (Lux et al., 1979). Red cell ghosts from jalja mice “have no detectable spectrin; sphlsph ghosts lack band 1 but have small amounts of band 2; halha ghosts have about 30%0of the normal amount of both bands 1 and 2; and nblnb ghosts have approximately 50% of the normal amount” (Lux et al., 1979). “The bands” are “completely extractable a t low ionic strength like normal spectrin and
430
ELIZABETH S. RUSSELL
cross-react with a n antihuman spectrin antibody” (Lux et al., 1979). However, Landaw (1978) has found that several protein bands are missing from all mlm erythrocytes. Chen (1978) found that both cholesterol and phospholipid contents of the membrane are diminished in all mlm mutants. A hint of the possible roles of these four different mutants comes from the interpretation that “spectrin, actin and band 4.1 form a protein meshwork which laminates the inner surface of the red blood cell membrane” (Lux et al., 1979).
E. IDENTIFICATION OF HETEROZYGOUS CARRIER MICE Earlier in this report (Section V, A) it was indicated that identification of heterozygous carriers of hemolytic anemia mutant alleles depended entirely on progeny testing. This limitation has led to the need for large testing colonies and has retarded production of homozygous affected mice for research. It has also increased the difficulty of linkage experiments. There are slight mean differences in values for a number of parameters between WBBGF,mI+ and -+/+ young adults, but for any one of these measurements there is considerable overlap between values for erythrocytes from +/m and from +/+ mice. The differences observed indicate that the +/m mice, even though they have practically normal peripheral blood values, have shorter erythrocyte lifespans and are successfully compensating for potential mild anemiaproducing defects. One possible method for identifying heterozygotes would be “discriminant function analysis,” in which measurements of many “parameters, each based on a different principle, are combined to increase diagnostic efficiency” (Sassa and Bernstein, 1978). Bernstein has made considerable progress in development of this system. Another approach under development is measurement of levels of intermediates in the heme pathway, using a special hematofluorometer that can provide accurate determinations from a single drop of blood. Red cells of mice heterozygous for hemolytic-anemia-producing mutants tend to have higher protoprophyrin levels than do cells from littermate controls. Comparing protoporphyrin levels in potential +/+ and +/m erythrocytes from C57BL/6J mice in populations segregating for anemia-producing mutant alleles, it has been possible to identify 100% of +ha and +/nb individuals, 80% of +/sph individuals, and 508 of +/ha individuals (Sassa and Bernstein, 1978). This type of test may eliminate the present necessity for continual progeny testing and aid materially in linkage analysis.
HEREDITARY ANEMIAS OF THE MOUSE
431
F. THE AUTOIMMUNE HEMOLYTIC ANEMIAOF NZB/Bl MICE I n contrast to the single-locus autosomal recessive genetic determination of the four kinds of hemolytic anemia previously described (Sections V, A-V, E), the transmission of susceptibility to the fifth kind, the autoimmune hemolytic anemia of NZB/B1 mice, appears to be much more complicated. The etiology of this condition involves a considerable variety of factors, genetic, immunologic, viral, environmental, each playing essential roles that are not completely understood (Warner, 1977). NZBlBl mice are born with normal hematologic values, but already at this stage are immunologically hyperactive (Talal, 1977). In addition to eventual 10W0 incidence of autoimmune hemolytic anemia, NZB/B1 mice show a high incidence of glomerulonephritis, lymphoreticular neoplasia, and abnormal response to extrinsic antigens (Warner, 1977; Talal, 1977; Talal and Roubinian, 1978; Gershwin, 1978). The basis for inheritance of these characteristics is not completely understood, though influence of a major dominant gene plus modifiers seems probable (Warner, 1977). Much of the difficulty in genetic interpretation comes from the late appearance of the more obvious manifestations. Another important problem in analysis of etiology of the NZB/Bl autoimmune syndrome is determination of the role of vertically transmitted C-type virus (Morton and Siegel, 1973; Datta and Schwartz, 1978). Further complications arise from incomplete understanding of the nature and consequences of their premature development of immunocompetence (Talal, 1977) and their continuing immunoregulatory disequilibrium (Talal, 1977).
1 . Brief History of the NZ Group of Inbred Strains A very interesting group of inbred strains, currently designated NZBR, NZB, NZC, NZO, NZX, and NZY, were derived independently from a common “random-bred’ mouse colony a t the University of Otago, in New Zealand (Bielschowsky and Goodall, 1970; Warner, 1977). Mice from certain of these strains, and from F, hybrid crosses between these strains, have attracted much attention in research through their unusual variety of autoimmune manifestations. Mice from only one strain, NZB, develop autoimmune hemolytic anemia, although (NZB x NZC)F, hybrid mice also show the Coombs’ positivity indicative of antibodies against erythrocytes. Mice stemming from the original NZBiBl stock are currently maintained in many and diverse laboratories, often with their exact line of descent not recorded. To simplify writing, we will list all of these as NZB, indicating sublines only where definitely known.
432
ELIZABETH S. RUSSELL
2. Description of the Anemia
Since this is a review of hereditary anemias, we will concentrate our attention as much as possible on the hematologic aspects of the autoimmune syndrome of NZB mice. Although newborn NZB mice show premature immunocompetence, their hematologic values are normal (Talal, 1977). An early manifestation of hematologic difficulty is Coombs’ reactions, approximately of NZB mice giving positive tests by 6 months, and almost 1 0 a by 10 months (Warner, 1977). With advancing age, hemolytic anemia of increasing severity, jaundice, and splenomegaly appear in 100% of NZB/B1 mice (Bielschowsky et al., 1959). Evidences of this anemia include increased reticulocyte counts, reduced hematocrit percentages, shortened red cell survival, erythrophagocytosis, splenomegaly, liver hemosiderosis, extramedullary hemopoiesis, and pigmented gallstones (Warner, 1977). Erythrocyte morphology is normal in animals with near-normal hematocrit levels but, as anemia increases, anisocytosis and microspherocytosis are frequently seen. The erythrocytes show a variable degree of aberrant osmotic fragility, with the abnormal curves spreading both on the fragile and on the resistant side of normal (Helyer and Howie, 1963a). The hematocrit levels of aging NZB/B1 mice drop steadily, from a mean of 4Wo a t 31 days to a mean of 35% a t 350 days; values as low as 10% are often seen (Holmes and Burnet, 1963). Thrombocytopenia may be observed in late cases (Holmes and Burnet, 1963). Dietary differences can affect reticulocyte level, severity of anemia, and longevity (Fernandes et al., 1972). Young adult NZB mice have higher than normal numbers of hemopoietic stem cells (Morton and Siegel, 19731, almost certainly because they constantly must maintain very high levels of erythropoiesis. As might be expected, they also are more radioresistant than mice of other inbred strains. Plasma erythropoietin levels become somewhat elevated in anemic NZB mice (Rogers et al., 1975). Throughout the greater part of life, red cell destruction in NZB/B1 mice seems to be mainly intrasplenic, and intrahepatic destruction does not become important until late in life (Simpson, 1975). Splenectomy, if performed before hemolysis becomes severe, results in a general damping down of the hemolytic process (Helyer and Howie, 1963a). Erythrocytes from healthy mice are rapidly destroyed in affected NZB mice, and “cells from affected donors survive normally in unaffected” NZB mice (Dacie, 1962). This finding “implies either that mere coating of the red cell with autoantibody does not lead to shortened red cell survival or that elution of the coating antibody may occur in
HEREDITARY ANEMIAS OF THE MOUSE
433
normal circulation” (Dacie, 1962). In chromium-51 labeling experiments, the T , , , for NZB red cell survival dropped from 13.3 days in affected young mice, to 8.2 days in mice with moderate autoimmune disease, to 2.1 days in severely affected mice (Lindsey et al., 1966). An interesting syndrome in NZB mice, presumably secondary to autoimmune disease and hemolytic anemia, is spontaneous development of “high blood pressure and hypertensive vascular disease in the heart and kidney” (Svendsen, 1977). Congenitally athymic NZB mice did not develop high blood pressure (Svendsen, 1977). 3. Immunological Manifestations
NZB/Bl mice remain clinically healthy for some months after the recognition of serological autoimmune disease (Holmes and Burnet, 1963). Once a positive Coombs test has appeared, it usually continues indefinitely, except in rare cases where normal spleen architecture is replaced by leukemic tissue (Holmes and Burnet, 1963). Red cell survival time correlates closely with degree of positivity of the Coombs test (Pinkerton and Bannerman, 1968). By 8 months, the thymus, in 95% of NZB/B1 mice, has developed a proliferative appearance, with development of germinal centers (Holmes and Burnet, 1963). ACTH treatment of animals “with established haemolytic disease” alleviated, but did not cure, their condition (Helyer and Howie, 1963a). Cortisone treatment lowered reticulocyte count, but did not lead to elevation of hematocrit percentage (Giltinan et al., 1965). In NZB/B1 mice, neither thymectomy nor neonatal exchange grafting of a normal thymus from CBA-T6 will prevent autoimmune disease (Helyer and Howie, 1963b). However, autoimmune disease has been transmitted to normal mice by neonatal exchange grafting of thymus glands (Helyer and Howie, 196313). As late as 1964, although it was quite clear that the thymus gland is vitally involved in autoimmune disease, its precise role or roles, whether as promoter, inhibitor, trigger, or target, was still unknown (Norins and Holmes, 1964). Current hypotheses invoke suppressor and helper cells with either loss or malfunction of suppressor T cells or, alternatively, primary abnormality of B cells (Chused et al., 1978).
4. Renal Lesions Older NZB mice show a high incidence of kidney lesions that are, with reasonable certainty, the primary cause of death (Holmes and Burnet, 1963). In many animals, the lesions showed a close resemblance to the renal lesions of disseminated lupus erythromatosus
434
ELIZABETH S. RUSSELL
(Helyer and Howie, 1963a). The earliest manifestation of renal lesion is hyaline thickening of the capillary walls and adjacent intercapillary regions of the glomerular tufts that contained selective localizations of mouse immunoglobulins, probably y-M-globulins (Mellors, 1965). 5. Viral Agent in NZB Mice
A filterable agent has been reported, which was derived from a transplantable malignant lymphoma of NZB mice and was capable, upon inoculation into preweanling NZB mice, of inducing lymphoid cell hyperplasia and kidney lesions qualitatively similar to those of spontaneous occurrence in older NZB mice. This finding led to the hypothesis that the autoimmune disease of NZB mice might be attributable to “a virus transmitted vertically by sperm as well as ovum of NZB/B1 mice,” which demonstrably affects only animals of a strictly limited range of genotypes” (Mellors and Huang, 1966). Further support for this hypothesis came from extraction of a similar agent from the spleen of NZB mice that, when inoculated into newborn Swiss mice, induced manifestations of autoimmune disease (Mellors and Huang, 1967). While other investigators obtained similar results (Masters and Spurling, 1967; East et al., 19671, one research group is unable to confirm the finding (P. J. Russell et al., 1970). Recently Simpson (1976) advised caution. No C-type particles have been demonstrated in NZB/B1 mice from the animal breeding colony at the University of Otago, where the NZB/B1 strain was developed, nor in NZB/B1 mice from the Walter and Eliza Hall Institute in Australia. The “case for viral aetiology is unproven, although the possibility exists that virus may be present in incomplete form. . . . Comparison of results obtained from studies of NZB mice of diverse origin may invite misleading conclusions” (Simpson, 1976). One further consideration should be put forth in this review directed to analysis of hereditary anemias. “Regardless of whether viral infection plays a role in the causation of the NZB autoimmune disease, there is little doubt that gene action important for development of this anemia is extrinsic to erythropoietic tissue, most probably affecting a function of the immunological system” (Russell, 1970) (see also Section V, F, 7). 6. Autoantigens of NZB Erythrocytes Since the basic cause of NZB hemolytic anemia is excessive breakdown of erythrocytes, the red cells of NZB mice must carry antigens that react with autoantibodies. Two specific murine erythrocyte surface antigens, associated with two independent but coexistent spon-
HEREDITARY ANEMIAS OF THE MOUSE
,435
taneous antierythrocyte autoantibody responses, were identified in erythrocytes of NZB mice (Linder and Edgington, 1972). One is a n “exposed erythrocyte surface determinant . . . referred to as the X-antigen,” that “may be of primary significance in the pathogenesis” of NZB autoimmune hemolytic anemia. It could be “part of the major erythrocyte surface g l y ~ o p r o t e i n(Linder ~~ and Edgington, 1972). The other (HB) antigen is not exposed on the normal murine erythrocyte surface, but is exposed by specific proteolysis (Linder and Edgington, 1972). The authors feel there are no differences in erythrocyte structural proteins between NZB red cells and erythrocytes from other mouse strains (Linder and Edgington, 1972). However, the autoantibody-secreting B lymphocyte anti-X-response was completely restricted to the NZB strain and was predominantly of IgG class (Deheer and Edgington, 1974). The anti-HB autoantibody response was genetically nonrestricted, and predominantly of the IgM class (Deheer and Edgington, 1974). A third type of red cell antigen in NZB mice has been described (Linder, 1977). This autoantigen, called Anti-HOL, is located in the inner aspect of the erythrocyte membrane, and it may be associated with fibril-forming structural components of the red cell membrane (Linder, 1977). A fourth autoantigen, anti-I, also has been described; but the data suggest that only the anti-X and anti-HB antigens are pathogenetically implicated in NZB autoimmune hemolytic anemia (Deheer et aZ., 1978).
7. Transmission of Tendency to Immune Hemolytic Anemia by Mouse Chimeras Two allophenic male mice, made by combining NZB and CFW early embryos, were mated to BALB/cJ females (East et al., 1978). One of the allophenic males transmitted only NZB genes to his F, hybrid offspring as evidenced by their black-agouti coat color. The other transmitted only CFW genes, since his F, hybrid offspring were all albinos. “Only the black-agouti offspring developed a protracted course of autoimmune hemolytic disease” (Coombs-positive tests, anemia, splenomegaly, and tumors) “and carried type-C MULV readily detected by electron microscopy” (East et al., 1978). A third allophenic male produced sperm of both original parental types. When crossed to NZB females, his black-colored offspring gave rise to two generations of “NZB descendants displaying the typical NZB profile of autoimmune hemolytic disease. . . . We concluded that infectious virus was not transferred passively by sperm into ova at fertilization, but both autoimmunity and virus were transmitted by incorporation of genetic
436
ELIZABETH S. RUSSELL
information” (East et al., 1978). It is to be hoped that these findings will be confirmed and extended, since they provide not only a tenable explanation of the causation of NZB hemolytic anemia, but also very favorable material for testing hypotheses concerning incorporation of viral DNA into mammalian genomes. VI. Hemoglobinopathies Induced by Mutagens
The heading “hemoglobinopathy” includes two kinds of hereditary anemias: (1) those caused by differences in structure of globin chains (usually single amino acid substitutions) and (2) those caused by reduction in amount of specific globin chains, usually called thalassemias, or with problems in synthesis of particular globin chains. Thalassemias do not involve changes in globin chain structure (Bannerman, 1972; Weatherall and Clegg, 1972). The one most conspicuous difference between the array of hereditary anemias known in the human, and the mouse array, is the extreme rarity, among spontaneously occurring mouse mutations, of any form of hemoglobinopathy (Russell and McFarland, 1974).
A. HUMANVERSUS MOUSEFREQUENCY OF HEMOGLOBINOPATHY In man many differences in primary structure of globin chains, including of course hemoglobin S and hemoglobin C, have been reported as the cause of moderate to severe hereditary anemias (McKusick, 1975), and it is generally believed that all healthy normal adult individuals carry the same a&:,and a& hemoglobins. By contrast, hemoglobin structural differencesare common polymorphismsofhealthy mice (see Section 11, C) and none of the spontaneously occurring mouse hereditary anemia mutations has involved a change in primary structure of the hemoglobin molecule (Russell and McFarland, 1974). Every mutation that changes the structure of an adult hemoglobin would act as an allele t o either the a-chain complex locus (Hba on chromosome 111, or the P-chain complex locus (Hbb on chromosome 7). Such allelism has been ruled out for all presently known single-gene induced mouse anemias (Russell and McFarland, 1974; Bernstein, 1979) (see also Section V, A). Spontaneously occurring thalassemia mutations are also common in man. They include Cooley’s anemia, hemoglobin E disease, and a considerable variety of other a-thalassemias, p-thalassemias, and pSthalassemias (Bannerman, 1972; Weatherall, 1969, 1974).
HEREDITARY ANEMIAS OF THE MOUSE
437
Numerous kinds of p- and PG-thalassemias are known in humans, several of them being grouped together as “Cooley’s anemia” (Weatherall, 1974). The essential criteria for diagnosing thalassemia are “defective or absent synthesis of a- or P-chains and redisposition of the redundant counterpart chains” (Bannerman, 1972). Frequently, but not universally, the blood of p-thalassemia humans contains elevated proportions of a&, minor adult hemoglobin and fetal hemoglobin (a2y,) may also be increased (Weatherall, 1974). Unpaired excess a-chains may also be precipitated and result in distortion of erythrocyte shape and distortions of the cell membrane (Zaino and Rossi, 1974). At least two distinguishable forms of human a-thalassemia are known. The more severe is a-thalassemia-1, whose homozygotes, carrying largely Barts’ ( y 4 )hemoglobin (Hunt and Lehmann, 19591, die in utero. Less severe is a-thalassemia-2, whose homozygote “has not been fully documented,” and whose compound with thal-1 in the doublemutant (thal-l/thal-2)heterozygote “results in HbH disease,” with an aberrant a:p ratio (Bannerman, 1972; Weatherall, 1974). Although in theory regulation of globin synthesis could be controlled by a gene located far from the human a-chain locus or the @-chain locus, in fact all existing evidence supports the concept that the thalassemia mutant alleles are very closely linked to either the a-chain or the p-globin chain structural locus. Serious hematologic disease is also found in some individuals whose genotype combines an allele for hemoglobin structural abnormality on one of a chromosome pair with a thal-1 or thal-2 mutant on the homologous chromosome. Two recent papers give convincing evidence that human fetal-lethal a-thalassemia, hydrops fetalis, is caused by homozygosity for a gene deletion (Ottolenghi et al., 1974; Taylor et al., 1974). This exciting finding has increased enthusiasm for finding a mouse model of thalassemia. According to Bannerman et al. (1974): The requirements for a potential animal model are: 1) a hereditary form of anemia, in which the red cells show hypochromia and related morphological abnormalities; 2) evidence of increased hemoglobin catabolism, which is an important feature of the severe forms of thalassemia in man; and 3) imbalance of globin chain synthesis.
None of the known mouse spontaneous anemia-producing mutants seems to quite fit the bill. The hypochromic anemias offer the greatest possibility, but there is no imbalance of a:p globin synthesis in microcytosis (Rowley, 1972) (Section IV,C); the cause of sex-linked anemia is extrinsic to the hemopoietic system (Section IV, B); and the four single-gene induced hemolytic anemias have been shown to be caused by erythrocyte membrane defects (Section V, D). Search for
43 8
ELIZABETH S. RUSSELL
thalassemia-like syndromes in offspring of mutagenized mice seems now to be the most profitable course.
B. @CHAINABNORMALITIES IN MICE Five radiation-induced mutations at mouse hemoglobin loci were identified at Oak Ridge National Laboratory (L. B. Russell et al., 1976). Two of these affected the P-chain in rather odd ways. (101 x SECIF, 9 86, offspring of an irradiated SEC female, was found to carry a duplicated section of chromosome 7, including the c (albino) locus, the Mod-2 (mitochondria1 malic enzyme) locus, and the Hbb locus. The solubility and crystal formation of the hemoglobin of P 86 differed from those of other (101 x SEC)F, mice. This “abnormal hemoglobin phenotype may and this hypothesis was be explained by the overproduction of PSEC,” proved by quantitative tests of the amino acid composition of the pT-3 and pT-14 peptides, which contain the segments of the P-chain that differ between strain 101 P-chains and strain SEC P-chains (L. B. Russell et at., 1976). Another (101 x SECIF, mouse, 9 732, proved to have an unusual P-chain composition in that she expressed and transmitted only the Hbbd kind of hemoglobin from her nonirradiated strain 101 mother. The authors “conclude that 0 732 has two Chromosomes 7 derived from her 101 parent, and no Chromosome 7 derived from her SEC parent” (L. B. Russell et al., 1976). Other chromosomes (2,4,9, and 11were tested) were of normal F, composition. The authors suggested double nondisjunction of chromosome 7 as a possible explanation.
C. THE OAKRIDGEWTHALASSEMIAS The hemoglobin of three (101 x SEC)F, mice with one irradiated parent showed diminution of the fast band on electrophoresis and higher than normal solubility. These qualities are due to lack of expression of the Hbab gene from their irradiated SEC parents (L. B. Russell et al., 1976). Of these aberrant mice, two ( 0 27 and d 352) “transmitted their abnormal phenotype by a single dominant mode of inheritance,” and the third, 6 72, was sterile because he also carried an autosomal translocation, quite independent of chromosome 11(L. B. Russell et al., 1976). The autosomal dominant condition transmitted by 0 27 and d 352 was quite clearly an a-chain thalassemia. “The heterozygous deletion or inactivation of the cw-chain gene in mice caused an anemia similar to a-Thalassemia minor in persons. The a-chain deficiency created
HEREDITARY ANEMIAS OF THE MOUSE
439
erythrocytosis, reticulocytosis, and microcytic, hypochromic anemia comparable with the changes in human a-Thalassemia minor” (Popp and Enlow, 1977). All the hemoglobin produced in the three a-thalassemic mice contained only the 101-type Hba” a-chains. Analysis of peptide aT-9 (positions 67-73 of the a-chain) showed that neither of the a-chains characteristic of the SEC (Hbab) hemoglobins was present i n bloods of 9 27, 6 352, and 8 72 (Popp et al., 1979a). Preliminary investigations of the embryonic hemoglobins in Popp’s a-thalassemic mice leave some questions still unanswered (Popp et al., 1979b). D. THE JACKSON LABORATORY ~-THALASSEMIA An independent case of a-thalassemia occurred “among progeny of a C57BW6J 9 x triethyleneamine treated male” of Dr. T. H. Roderick’s stock (PosA) derived from the mating of Mus musculus poschiavinus and “Swiss7’mice (Whitney and Russell, 1978). This thalassemic mutant had a n unusual hemoglobin phenotype, “with lower than normal proportions of the hemoglobin containing the diffuse-major chain, as had also been observed in the Oak Ridge Thalassemics” (Whitney and Russell, 1979). This Hba‘h-Jl+ mouse also expressed only the Hba” chain gene from its C57BL/6J mother and contained none of the Hba‘ type of hemoglobin characteristic of its father (Whitney and Russell, 1979). Embryos sired by the a-thalassemic mice of the Jackson Laboratory stock, unlike the Oak Ridge thalassemic embryos, showed atypical content of hemoglobin EI ( x u 2 ) .If synthesis of the x-chain had been normal in these embryos, their relative concentration of E I should be high in comparison to the expected reduced amounts of hemoglobin EII . phenotype was not observed; rather, the (a2y,) and EIII ( a 2 z 2 )This intensity of the EI (x2y2)band was lower than normal in H ~ u ‘ ~ - ~ / + embryos, and comparable to their similar lowered concentration of EII (a2y2) and EIII (a2z2)hemoglobin (Whitney and Russell, 1979). Moreover, a n entirely new hemoglobin component, y4, was found, analogous to the HbH (& tetramer) of adult humans with a-thalassemic trait. Thus Hba‘h-J from the Jackson Laboratory differs from the Oak Ridge 352 mutation in affecting the X as well as the a-chain. “The triethylene-induced HbathdJmutation might be a larger deletion, or might be a mutation in a sequence of basic importance to the expression ofkhe entire alpha globin complex” (Whitney and Russell, 1979). Three-point linkage tests involving Hba‘h-Jand flanking chromosome 11 markers wa-2 and sh-2 show a map position for Hba‘h-J “at or near
440
ELIZABETH S. RUSSELL
the Hba locus complex on mouse Chromosome 11”(Whitney and Russell, 1979). VII. General Comments on Hypochromic Anemias
Many similarities are apparent between the numerous hereditary hemolytic anemias that have been described in mice (see Sections IV, V, B, V, F, and VI). Of course the hemoglobin content of erythrocytes is, by definition, reduced in all hypochromic anemias. Other similarities are reduced red cell life-span (proved for all recognized hypochromic anemias except the transitory siderocytic anemia of flexed mice); tendency to anisocytosis (increased variability in red cell size); and increased reticulocyte percentage. Some of the anemias [siderocytic flexed (flf,newborns, all four single-gene induced hemolytic anemias, and mice with a-thalassemial characteristically have “stippled” red cells. Elevated levels of enzymes in the heme-synthesis pathway and elevated free erythrocyte protoporphyrin have been reported for sexlinked anemia (sla),microcytic anemia ( m k ) ,and the single-gene induced hemolytic anemias, There is a “significant association between erythrocyte protoporphyrin concentrations and number of reticulocytes, independent of anemia examined. . . . Changes” observed “probably reflect increased frequency of cells that are still active in heme biosynthesis as an adaptive response to low 0, carrying capability” and are “not likely to be the result of a specific gene defect” (Sassa and Bernstein, 1977). Splenomegaly has been reported for all mice with hemolytic anemias (including the NZB autoimmune hemolytic anemia and all four single-gene induced hemolytic anemias) and for a-thalassemic mice. Nucleated erythroid precursor cells are found in the circulating blood of mice with any one of the five hemolytic anemias. Higher than normal erythrocyte sodium content has been reported (Waymouth, 1973) for microcytic mice and for mice with three of the four kinds of single-gene induced hemolytic anemias. The important point to be made here is that many of the characteristics seen in mice with hypochromic anemia must be results of rapid red cell destruction and the extra hemopoiesis undertaken by these mice to compensate for this cell loss. The presence of these characteristics thus does not tell us much, if anything, about the cause of the anemia, or the site of primary gene action. Demonstrated abnormalities of the red cell membrane in hemolytic anemias and the abnormal ratios of a:/?chain synthesis seen in thalassemias provide, by contrast, valuable clues as to the site and nature of primary gene action.
HEREDITARY ANEMIAS OF THE MOUSE
441
We have seen great diversity in causes of mouse hypochromic anemias. These include three distinct kinds of abnormality of iron metabolism: in flexed ( P f , mice, in mice with sex-linked anemia (slal sla and SlalY), and in mice with microcytosis (mklmk). Causes of hypochromic anemia also include four distinct kinds of red-cell membrane defects associated with the four single-gene induced hemolytic anemias, plus the autoimmune destruction of erythrocyte membranes in anemic NZB mice. And finally, they include the diminished synthesis of hemoglobin a-chains in both the Oak Ridge and the Jackson Laboratory a-thalassemias. Thus many possibilities must be tested in analyzing gene action leading to a new hypochromic anemia. Two such conditions have been reported, and neither can as yet be assigned to a specific subgroup of hypochromias. An autosomal recessive mutation, hemoglobin deficit ( h b d ) , appeared in an inbred strain carrying lethal yellow (A”) (Scheufler, 1969). The majority of homozygous hbdlhbd mice appear to be born alive, but at birth have lower than normal numbers of erythrocytes (mean, hbdlhbd, 2.36 x lo6 RBC/mm3 vs +/+, 3.67 x lo6 RBC/mm3) and lower than normal total hemoglobin content (6.13 @d, vs 10.5 gddlfornormalnewborns)(Scheufler, 1969).Nucleatednormoblastswere seen in the circulation. Some hbdlhbd individuals must be lost before weaning; the proportion of hbdlhbd mice in a n F2population was 18% (58/328), and in a backcross of heterozygote to homozygous recessive, the proportion was 32% (32/98) (Scheufler, 1969). Adult “anemic mice show a n approximately normal count of erythrocytes, but the content of hemoglobin in the blood is very low.” Interestingly, their mean red cell volume is higher (59.8k 7.2 pm3) than that of normal mice ( 4 6 . 7 t 2 pm3). However, anisocytosis is apparent from the standard errors, and target cells were seen in smears (Scheufler, 1969). “The erythrocytes of anemic mice are more resistant to hypotonic media than those of healthy mice.” Ferric iron therapy was not effective in annihilating the anemia. There appears to be no excessive red cell hemolysis, since serum bilirubin is decreased. “The anemic animals show normal fertility and vitality” (Scheufler, 1969). Still another hemolytic anemia (aha),presumed by its discoverer to have autoimmune etiology, has been reported (Eaton, 1978), inherited as a fully penetrant autosomal recessive. The anemia is present at birth, and 25% of ahalaha mice die before weaning. Nucleated cells are present in the circulation. After weaning the condition of survivors ameliorates, but symptoms reappear later in some but not all adults (Eaton, unpublished results). Surviving anemics are fertile, and
442
ELIZABETH S. RUSSELL
transmission of the mutant allele to offspring is normal. This mutant allele is not allelic to any of the four previously recognized single-gene induced hemolytic anemias (Eaton, unpublished results). Anemic ahdaha mice may be either pale of jaundiced, and both types “may be found in the same litter. The latter condition results from obstructive jaundice. Electron microscopy studies of mutant RBC are in progress and early results reveal dimpling, usually multiple, of the cell membrane” (Eaton, 1978). Obviously it is not possible as yet to assign this syndrome to a specific hypochromic subgroup. However, the “dimpling” of the cell membrane is reminiscent of thalassemia. VIII. Anemias Secondary to Genetic Defects in Other Systems
We have seen in earlier sections of this report that the actions of genes responsible for hereditary anemias do not always occur within hemopoietic cells. A case in point is sex-linked anemia, where the defect is in transport of iron from the cells of the intestinal wall into the plasma. Tn this mutant, there is no intrinsic abnormality in structure o r function of the blood-forming cells (see Section IV, B). Nevertheless, sla gene-action in cells of the intestinal wall leads secondarily to a clear-cut iron-deficiency anemia. We chose, appropriately, to list this condition under iron-utilization problems, but it could as well have been listed among the secondary anemias. In the conditions that have been assigned to this section, it seems clear that the original gene action is extrinsic to blood-forming tissue, and also is not in other tissues having a physiological role in relation to hemopoiesis. Thus we do not list here the steel (5’1) defect in hemopoietic microenvironments. Effects of mutant alleles at four genetic loci are presented here as secondary anemias.
A. EMBRYONIC ANEMIAOF TAIL-SHORT HETEROZYGOTES The first mutant so classified is tail-short ( T s ) , a semidominant allele linked to Re on chromosome 11 (Sweet and Lane, 19781, which arose in the BALB/c inbred strain (Morgan, 1950). Mice homozygous for this allele appear to die before implantation, and heterozygotes, whose viability and expression vary with genetic background, can be recognized by their short, kinky tails (Morgan, 1950). The heterozygotes are smaller than their normal littermates and have many skeletal abnormalities. In detailed embryologic studies, Deol (1961) noted that putative Ts/+ 8-day embryos had smaller numbers of yolk-
HEREDITARY ANEMIAS OF THE MOUSE
443
sac blood islands than did their +I+ littermates. At 9 days the presumed Ts/+ embryos were pale, but had normal-appearing notochords. Deol suggested that abnormality in yolk-sac erythropoiesis was the primary defect in Tsl + embryos. He found no deficiency in numbers of TsI+ embryos a t 14 and 17 days, but did observe a deficiency of newborns (in crosses ofTsl+ x +/+: 264 +I+, 169 TsI+).He suggested that the “anemia is not just a sign of their general retardation; they seem to be anemic even when compared with younger normal embryos of the same crown-rump length” (Deol, 1961). This was a particularly interesting observation, since T s l + newborn mice had normal blood counts. His judgment that the primary gene action at the T s locus was in the erythropoietic cells in the embryonic yolk sac, and was restricted to embryonic hemopoiesis, remained unchallenged for many years. An alternative explanation has now been presented, based on body weights, hemoglobin content, red cell numbers, and electron microscopic preparations of ll-day to 15-day (C57BLl6 x TS/Le)F,T s l t and -I+ embryos (Brotherton et al., 1979). Genotypic identification was not certain a t 11 days. From 12 days onward, putative Ts/+ embryos and fetuses with short kinky tails were always smaller and paler than their +I+ littermates. Within a litter, ratio of hemoglobin content to total body weight was always lower in putative Ts/+ than in +/+ embryos. However, if ratios for putative Ts/+ embryos from one litter were compared with those for younger +I+ embryos from a different litter, with body weights corresponding to those of the older Tsl + embryos, the ratios were not significantly different. According to Brotherton et al. (1979) The maturation of primitive nucleated erythrocytes derived from yolk-sac blood islands in Ts/+embryos lagged behind that in their normal littermates by about 24 hours. . . . Taken together, these observations suggest that the onset of erythropoiesis in yolk-sac blood islands of mutant embryos is delayed, consistent with the overall retardation in development of these animals. . . . It is conceivable that heterozygous mutant Ts/+ embryos have delayed or abnormal implantation, followed by retarded and defective growth and development.
Following this interpretation, the primary action of the T s gene is almost certainly on embryo implantation and growth, with embryonic anemia as a secondary consequence. . B. ANEMIAI N SOME NEWBORN STRONG’S LUXOID MICE
The clearest case of anemia as a secondary consequence of gene action in other tissues is the normocytic “anemia observed in some
444
ELIZABETH S. RUSSELL
newborn Strong’s luxoid’ (lstllst) “homozygotes (Kuharick and Forsthoefel, 1963). Homozygous lstllst mice show many skeletal and integumentary anomalies, apparently resulting from “retardation of the development of parts of the head, integument, limbs and belly,” possibly caused by “lag in chemodifferentiation in the deficient skeletal elements” (Forsthoefel, 1963). In lstllst newborns, the epidermis a t the base of the umbilical cord is weaker than is that of newborn normal littermates, and the anemia frequently observed “results from excessive blood loss caused by . . . tearing of the umbilical cord a t the abdominal surface or failure of the umbilical artery to close promptly after severance” (Kuharick and Forsthoefel, 1963). C. MACROCYTIC ANEMIAIN DIMINUTIVE MICE The recessive mutant, diminutive (dmldm), “markedly reduces body size, produces permanent macrocytic nonsiderocytic anemia, and causes anomalies at all levels of the vertebral column, resulting in curvatures in the spine and flexures in the tail” (Stevens and Mackensen, 1958). The dmldm mouse is much smaller than are normals at birth (mean body weight of diminutives 57% that of normal littermates), and there is some loss of dmldm individuals both before and after birth. The red cell count of newborn dmldm mice is approximately one-third that of +/dm littermates. The anemia of surviving dmldm adults is less severe (range, 5.5 x lo6 to 8.0 x lo6 RBC/mm3), but macrocytosis continues throughout life (Stevens and Mackensen, 1958). The great extent of skeletal abnormality in diminutive mice makes it seem probable that the cause of their anemia is in some way a secondary consequence of skeletal abnormality; but no data are available to either prove or disprove this hypothesis. It may be worth mentioning that the dm locus is on chromosome 2, hence definitely not allelic to any of the other macrocytic anemias nor to flexed (see Fig. 1).Difficulties in finding a genetic background that supports postnatal survival of dmldm individuals have limited research on this mutant.
D. NORMOCYTIC ANEMIAASSOCIATED WITH CRIBRIFORM DEGENERATION Mice with cribriform degeneration (crilcri homozygotes) “show severe vacuolar degeneration in white and gray matter of the spinal cord and brainstem, . . . abnormalities of the myelin sheath . . ., normocytic anemia a t birth which decreases in severity with age, and abnormal-
HEREDITARY ANEMIAS OF THE MOUSE
445
ities of electrolyte distribution” (Green et al., 1972). Homozygous crilcri individuals can be recognized by “visible pallor a t birth . . . and show reduced viability” (Green et al., 1972). The anemia diminishes spontaneously, but does not disappear completely, and is not improved by treatment with vitamin BIZ.The basic defect in cri/cri mice has not been identified. Mice with cribriform degeneration choose to drink physiological saline solution rather than tap water. Secretions of the parotid gland of crilcri mice show marked elevation of Na+ ions. These manifestations have “some similarity to cystic fibrosis” (Kaiser et al., 1974).The mechanism responsible for the altered electrolyte balance is not known, and no explanations for the hematologic involvement have been presented. The normal size and shape of crilcri erythrocytes suggests that electrolyte imbalance is not affecting hemopoiesis directly. This generalization suggests, but does not prove, that the normocytic anemia of crilcri mice appears as a secondary consequence of gene action in other tissues. IX. General Summary
Inasmuch as summarizing comments on gene action in macrocytic anemia were presented in Section 111, on defects in iron utilization in Section IV, on hemolytic anemias in Section V, and on hemoglobinopathies in Section VI, another long summarization is not warranted. It may, however, be worthwhile to close by pointing out that a great variety of gene-induced metabolic aberrations can disrupt hemopoiesis or homeostasis sufficiently to cause severe reduction in the amount of hemoglobin in the circulation, and hence in the amount of oxygen supplied to the body tissues. Conversely, providing for adequate hemoglobin and oxygen supply in normal mice requires the action and interaction of many different genes affecting many different processes.
REFERENCE s Adamson, J. W., and Brown, J. E. (1978). Aspects of erythroid differentiation and proliferation. Symp. SOC.Develop. Biol. 35, 161-180. Allen, T. D., and Dexter, T. M. (1976). Cellular interrelationships during in vitro granulopoiesis. Differentiation 6, 191-194. Altus, M. S., Bernstein, S. E., Russell, E. S., Carsten, A. L., and Upton, A. C. (1971). Defect extrinsic to stem cells in spleens of steel anemic mice. Proc. SOC.Exp. Biol. Med. 138, 985. Axelrad, A. A,, McLeod, D. L., Shreeve, M. M., and Heath, D. S. (1974). Properties of cells
446
ELIZABETH S. RUSSELL
that produce erythrocytic colonies in uitro. In “Hemopoiesis in Culture” (W. A. Robinson, ed.), DHEW Publ. No. (NIH) 74-205, pp. 226-242. Ballantyne, J., Bock, F. G., Strong, L. C., and Quevedo, W. C., Jr. (1961). Another allele at the W locus of the mouse. J . Hered. 52, 200-202. Bannerman, R. M. (1972). Thalassemias: Recent advances in study and management. Hematol. Reu. 3, 297-385. Bannerman, R. M., and Cooper, R. G. (1966). Sex-linked anemia: A hypochromic anemia of mice. Science 151, 581-582. Bannerman, R. M., and Pinkerton, P. H. (1967). X-Linked hypochromic anemia of mice. Br. J . Haematol. 13, lOO(k1013. Bannerman, R. A., Edwards, J. A,, Kreimer-Birnbaum, M., McFarland, E., and Russell, E. S. (1972). Hereditary microcytic anemia in the mouse: Studies in iron distribution and metabolism. B r . J . Haematol. 23, 2 3 5 2 4 5 . Bannerman, R. M., Edwards, J. A,, and Pinkerton, P. H. (1973). Hereditary disorders of the red cell in animals. In “Progress in Hematology” (E. B. Brown, ed.), Vol. 8, pp. 131-179. Grune & Stratton, New York. Bannerman, R. M., Edwards, J. A,, and Kreimer-Birnbaum, M. (1974). Investigations of potential animal models of thalassemia. Ann. N . Y . Acad. Sci. 232, 306-322. Barker, J . E. (1970). Embryonic mouse peripheral blood colony-forming units. Nature (London) 228, 1305. Barker, J. E., Keenan, M. A., and Raphals, L. (1969). Development of the mouse hematopoietic system: Estimation of spleen and liver “stem” cell number. J . Cell. Physiol. 74, 51-56. Bateman, A. E., and Cole, R. J . (1972). Colony-forming cells in the livers of prenatal flexed (flp anemic mice. Cell Tissue Kinet. 5 , 1 6 5 1 7 3 . Bateman, A. E., Cole, R. J., Regan, T . , e t al. (1972). The role oferythropoietin in prenatal erythropoiesis of congenitally anemic flexed-tailed (flf,mice. B r . J . Haematol. 22, 415-427. Becker, A. J., McCulloch, E. A., and Till, J . E. (1963). Cytological demonstration of the clonal nature of spleen colonies derived from transplanted mouse marrow cells. Nature (London) 197, 452-454. Bedard, Y. C., Pinkerton, P. H., and Simon, G. T. (1971). Ultrastructure ofthe duodenal mucosa of mice with a hereditary defect in iron absorption. J . Pathol. 104, 4 5 5 1 . Bedard, Y. C., Pinkerton, P. H., and Simon, G. T. (1973). Radioautographic observations on iron absorption by the duodenum of mice with iron overload, iron deficiency and X-linked anemia. Blood 42, 131-140. Bennett, D. (1956). Developmental analysis of a mutation with pleiotropic effects in the mouse. J . Morphol. 98, 199-234. Bennett, M., Pinkerton, P. H., and Cudkowicz, G. (1968a). Hemopoietic progenitor cells in marrow and spleen of mice with hereditary iron-deficiency anemia. Blood 32, 9oa92i. Bennett, M., Steeves, R. A,, Cudkowicz, G., Mirand, E. A., and Russell, L. B. (196813). Mutant S1 alleles of mice affect susceptibility to Friend spleen focus-forming virus. Science 162, 564-565. Bernstein, S. E. (1960). Mouse News Lett. 23, 33. Bernstein, S. E. (1962). Acute radiosensitivity in mice of differing W-genotype. Science 137,42a429. Bernstein, S. E. (1963a). Modification of radiosensitivity of genetically anemic mice by implantation of blood forming tissue. R a d . Res. 20, 6 9 5 7 0 2 . Bernstein, S. E. (1963b). Analysis of gene action and characterization of a new
HEREDITARY ANEMIAS OF THE MOUSE
447
hematologic abnormality, hemolytic anemia. Genet. Today, Proc. Int. Cong. Genet. 9th. Vol. 1, p. 186. Bernstein, S. E. (1969). Hereditary disorders of the rodent erythron. In “Genetics in Laboratory Animal Medicine” (J.R. Lindsay, ed.), pp. 9-33. Natl. Acad. Sci., Washington, D.C. Bernstein, S. E. (1970). Tissue transplantation a s an analytic and therapeutic tool in hereditary anemias. A m . J . Surg. 119, 448-451. Bernstein, S. E. (1972). Chimaerism induced by intergenotype transplantation of mouse bone marrow. Exp. Hematol. (Oak Ridge, Tenn.) 22, 69-71. Bernstein, S. E. (1973). Hemopoietic tissue transplantation via blood transfusion. Exp. Hematol. (Copenhagen) 1, 281. Bernstein, S. E. (1979). Inherited hemolytic disease in mice. Lab. Anim. Sci. (in press). Bernstein, S. E., Russell, E. S., and Keighley, G. H. (1968). Two hereditary mouse anemias (S1ISldand WIW‘) deficient in response to erythropoietin. Ann. N . Y . Acad. Sci. 149, 475-485. Bielschowsky, M., and Goodall, C. M. (1970). Origin of inbred NZ mouse strains. Cancer Res. 30, 8 3 6 8 3 6 . Bielschowsky, M., Helyer, B. J., and Howie, J. B. (1959). Spontaneous haemolytic anemia in mice of the NZB/Bl strain. Proc. Uniu. Otago Med. Sch. 37, 9-11. Boggs, S.S., and Boggs, D. R. (1977). Possible pathogenetic mechanisms of hypoplastic anemia in WIW“ and SlISl“ mice. Exp. Hematol. 5, Suppl. 2, 35. Bradley, T. R., and Metcalf, D. (1966).The growth of mouse bone marrow cells in vitro. Aust. J . Exp. Biol. Med. Sci. 44, 287-300. Brotherton, T. W., and Chui, D. H. K. (1977). Adult hemoglobin in primitive nucleated erythrocytes during normal mouse fetal development. Clin. Res. 25, 334A. Chen, H. (1978). Personal communication. Chervenick, P. A,, and Boggs, D. R. (1969). Decreased neutrophils and megakaryocytes in anemic mice of genotype WIW“.J . Cell. Physiol. 73, 25-30. Chui, D. H. K., and Loyer, B. V. (1975a). Erythropoiesis in steel mutant mice: effects of erythropoietin in uitro. Blood 45, 427-433. Chui, D. H. K., and Loyer, B. V. (1975b). Foetal erythropoiesis in steel mutant mice. 11. Haemopoietic stem cells in foetal livers during development. Br. J . Haematol. 29, 553- 565. Chui, D. H. K., and Russell, E. S. (1974). Fetal erythropoiesis in steel mutant mice. I. A morphological study of erythroid cell development in fetal liver. Deu. Biol. 40, 256. Chui, D. H. K., Loyer, B. V., and Russell, E. S. (1976). Steel ( S l ) mutation in mice: Identification of mutant embryos early in development. Deu. Biot. 49, 300-303. Chui, D. H. K., Sweeney, G. D., Patterson, M., and Russell, E. S. (1977). Hemoglobin synthesis in siderocytes of flexed-tailed mutant (frf, fetal mice. Blood 50, 165- 177. Chui, D. H. K., Liao, S. K., and Walker, K. (1978). Erythropoiesis in steel mutant mice. 111. Defect in differentiation from BFU-E to CFU-E during early development. Blood 51, 539-547. Chui, D. H. K., Brotherton, T. W., and Goaldie, J. (1979). Hemoglobin ontogeny in fetal mice. In “Cellular and Molecular Regulation of Hemoglobin Switching” (G. Stamatoyannopoulos and A. W. Nienhuis, eds.), pp. 213-235. Grune and Stratton, New York. Chused, T. M., Moutsopoulos, H. M., Sharrow, S. O., Hansen, C. T., and Morse, H. C., 111. (1978).Mechanism of autoimmune disease in New Zealand Black mice. Zn “Genetic Control ofAutoimmune Disease” ( N . R. Rose, P. E. Bagazzi, and N. L. Warner, eds.), pp. 177- 191. Elsevier/North-Holland F’ubl., Amsterdam.
448
ELIZABETH S. RUSSELL
Cole, R. J . , and Regan, T. (1976).Haemopoietic progenitor cells in prenatal congenitally anemic “Flexed-Tailed’ ( f r f , mice. Br. J . Haematol. 33, 387-394. Cole, R. J., Regan, T., and Tarbutt, R. G. (1972).Haemoglobin synthesis in reticulocytes of prenatal frf anemic mice. Br. J . Haematol. 23, 443-452. Cole, R. J., Garlick, J.,andTarbutt, R. G. (1974).Disturbed haem and globin synthesis in reticulocytes of prenatal flexed-tailed (flf, anemic mice. Genet. Res. 23, 125-135. Coleman, D. L., Russell, E. S., and Levin, E. Y. (1969). Enzymatic studies of the hemopoietic defect in flexed mice. Genetics 61, 631-642. Congdon, C. C. (1959).Recovery from radiation injury with special consideration of the use of bone marrow transplantation. Prog. Hematol. 2, 21-46. Craig, M. L., and Russell, E. S. (1964). A developmental change in hemoglobins correlated with an embryonic red cell population in the mouse. Dev. Biol. 10, 191-201. Dacie, J. V. (19621. “The Haemolytic Anaemias. 11. The Auto-immune Haemolytic Anaemias,” 2nd ed. Churchill, London. Dancis, J . , and Jansen, V. (1970).Placental transport of iron in X-linked anemia of mice. B r . J . Haematol. 19, 573-578. Dancis, J., Jansen, V., Brown, G. F., Gorstein, F., and Balis, M. E. (1977). Treatment of hypoplastic anemia in mice with placental transplants. Blood 50, 663-670. Datta, S. K., and Schwartz, R. S. (1978). Genetic, viral and immunologic aspects of autoimmune disease in NZB mice. I n “Genetic Control of Autoimmune Disease” (N. R. Rose, P. E. Bigazzi, and N. L. Warner, eds.), pp. 193-203. ElsevierINorthHolland Publ., Amsterdam. de Aberle, S. B. (1927). A study of the hereditary anemia of mice. Am. J . Anat. 4G, 219-247. Deheer, D. H., and Edgington, T. S. (1974). Clonal heterogeneity of the antierythrocyte autoantibody responses of NZB mice. J . Immunol. 113, 1184-1189. Deheer, D. H., Linder, E . J., and Edgington, T. S . (1978). Delineation of spontaneous erythrocyte autoantibody responses of NZB and other strains of mice. J . Immunol. 120, 8 2 5 8 3 0 . Deol, M. S. (1961). Genetical studies on the skeleton of the mouse. XXVIII. Tail-short. Proc. R. SOC. London Ser. A 155, 7%95. Dexter, T. M., and Lajtha, L. G. (1974). Proliferation of haemopoietic stem cells in vitro. B r . J . Haematol. 28, 5 2 5 5 3 0 . Dexter, T. M., and Moore, M. A. S. (1977).1n vitro duplication and ‘cure’ofhaemopoietic defects in genetically anemic mice. Nature (London) 269, 412-414. Dexter, T. M., Allen, T. D., and Lajtha, L. G. (1977).Conditions controlling the proliferation of hemopoietic stem cells in vitro. J . Cell. Physiol. 91, 335-344. Duveau, S. (1978). Unpublished results. East, J., Harvey, J . J., Tuffrey, M., and Tilly, R. J. (1978).Transmission of autoimmune haemolytic anaemia and murine leukemia virus to hybrid progeny of allophenic NZB-CFW and NZB-BALBlc d mice. Clin. Exp. Immunol. 31, 260-269. East, J . , Prosser, P. R., Holbrow, E. J., and Jaquet, H. (1967). Autoimmune reactions and virus-like particles in germ-free NZB mice. Lancet 1, 7 5 5 7 5 7 . Eaton, G. J. (1978). Autoimmune hemolytic ( a h a ) mutant. Mouse News Lett. 59, 54. Ebbe, S., and Phalen, E. (1978). Regulation of megakaryocytes in WIW“ mice. J. Cell. Physiol. 96, 73-80. Ebbe, S., and Stohlman, F., J r . (1965).Megakaryocytopoiesis in the rat. Blood 26,20-35. Ebbe, S., Phalen, E. A,, and Stohlman, F., J r . (1972). Some abnormalities of megakaryocytes and platelets in WIW“ and SlISl“ mice. Blood 40, 964. Ebbe, S.,Phalen, E., and Stohlman, F., J r . (1973a). Abnormalities of megakaryocytes in WIW” mice. Blood 42, 857-864.
HEREDITARY ANEMIAS OF THE MOUSE
449
Ebbe, S., Phalen, E., and Stohlman, F., J r . (1973b). Abnormalities of megakaryocytes in SWSl" mice. Blood 42, 865-871. Ebbe, S., Phalen, E., and Ryan, M. K. (1977). The production of megakaryocyte macrocytosis by systemic factors in SUSld mice. Proc. SOC.Exp. Biol. Med. 155,243-246. Ebbe, S., Phalen, E., DAmore, P., and Howard, D. (1978). Megakaryocytic responses to thrombocytopenia and thrombocytosis in SWSl" mice. Exp. Hematol. 6, 201-212. Edwards, J. A,, and Bannerman, R. M. (1970). Hereditary defect of intestinal iron transport in mice with sex-linked anemia. J . Clin. Znuest. 49, 1869-1871. Edwards, J. A,, and Hoke, J. E. (1972). Defect of intestinal mucosal iron uptake in mice Exp. Biol. Med. 141, 81-84. with hereditary microcytic anemia. Proc. SOC. Edwards, J. A,, and Hoke, J . E. (1975a). Effect of dietary iron manipulation and phenobarbitone treatment on in vivo intestinal absorption of iron in mice with sex-linked anemia. A m . J . Clin. Nutr. 28, 140-145. Edwards, J. A,, and Hoke, J. E. (1975b). Red cell iron uptake in hereditary microcytic anemia. Blood 46, 381-388. Edwards, J. A., Bannerman, R. M., and Kreimer-Birnbaum, M. (1972). Sex-linked anemia of the mouse: an effect of the gene in the heterozygous state' Int. Congr. Hematol., Brazil, 1971 (abstr.) p. 12. Edwards, J. A,, Ursillo, R. C., and Hoke, J. E. (1974). Studies of the absorption, distribution and utilization of a potential new haematinic (1-1'-diethyl a-a'-thiabiscyclopentadienyl-iron) in normal mice and mice with sex-linked anaemia. Br. J . Haematol. 28, 445-452. Edwards, J. A., Hoke, J. E., Mattioli, M. M., and Reichlin, M. (1977). Ferritin distribution and synthesis in sex-linked anemia. J . Lab. Clin. Med. 90, 68-76. Falconer, D. S., and Isaacson, J. H. (1962). The genetics of sex-linked anemia in the mouse. Genet. Res. 3, 248-250. Fantoni, A,, Banks, A,, and Marks, P. S. (1967). Globin composition and synthesis of hemoglobins in developing fetal mice erythroid cells. Science 157, 1327-1328. Fernandes, G., Yunis, E. G . , Smith, J., and Good, R. A. 11972). Dietary influence on breeding behavior, hemolytic anemia and longevity in NZB mice. Proc. SOC.Exp. Biol. Med. 139, 1189-1196. Filmanowicz, E., and Gurney, C. W. (1961). Studies on eryttropoiesis: XVI. Response to a single dose of erythropoietin in the polycythemic mouse. J . Lab. Clin. Med. 57, 65-72. Forsthoefel, P. F. (1963).The embryological development of the effects of Strong's luxoid gene in the mouse. J . Morphol. 113, 427-451. Fowler, J. H., and Nash, D. J. (1968). Erythropoiesis in the spleen and bone marrow of the pregnant mouse. Deu. Biol. 18, 331-353. Fowler, J. H., and Russell, E. S. (1968). Fetal erythropoiesis in flexed mice. Genetics 60, 178- 179. Fowler, J. H., Till, J. E., McCulloch, E. A , , and Siminovitch, L. (1967).The cellular basis for the defect in haemopoiesis in flexed-tailed mice. 11. The specificity of the defect for erythropoiesis. B r . J . Haematol. 13, 256-264. Fried, W., Chamberlin, W., Knospe, W. H., Husseini, S., and Trobaugh, F. E., J r . (1973). Studies on the defective hematopoietic microenvironment of SlISl" mice. Br. J . Haematol. 24, 643-650. Gallagher, M . T., McGarry, M. P., and Trentin, J. J. (1971). Defect of splenic stronia (hernatopoietic inductive microenvironment) in the genetic anemia of SIISI" mice. Fed. Proc., Fed. A m . SOC.Exp. Biol. 30, 684 (abst.). Geissler, E. N. (1978). Personal communication. Gerard, E., Carsten, A . L., and Cronkite, E. P. (1978). The proliferative potential of
450
ELIZABETH S. RUSSELL
plasma clot erythroid colony-forming cells in diffusion chambers. Blood Cells 4, 105-128. Gershwin, M. E. (1978). The pathogenesis of autoimmune disease in New Zealand mice. I n “Animal Models of Comparative Developmental Aspects of Immunity and Disease” (M. E. Gershwin and E. L. Cooper, eds.), pp. 250-259. Pergamon, New York. Gilman, J. G. (1972). Hemoglobin beta chain structural variations in mice: evolutionary and functional implications. Science 178, 873-874. Gilman, J. G. (1974). Rodent hemoglobin structure: a comparison of several species of mice. A n n . N . Y . Acad. Sci. 241, 4 1 6 4 3 3 . Gilman, J. G. (1976a). Mouse haemoglobin beta chains sequence data on embryonic y chain and genetic linkage of the y-chain locus to the adult p-chain locus Hbb. Biochem. J . 155, 231-241. Gilman, J. G. (1976b). Mouse hemoglobin beta chains. Comparative sequence data on adult major and minor chains from two species, Mus musculus and M u s M. ceruicolor. Biochem. J . 159,43-53. Gilman, J. G., and Smithies, 0. (1968). Fetal hemoglobin variants in mice. Science 160, 885-886. Giltinan, P. J., Holmes, M. C., and Burnet, F. M. (1965). Cortisone acetate treatment of haemolytic anaemia in NZB mice. Aust. J . Exp. Biol. Med. Sci. 43, 523-532. Glass, J., Lavidor, L. M., and Robinson, S. H. (1975). Studies of murine erythroid cell development: synthesis of heme and hemoglobin. J . Cell Biol. 65,29%308. Goldwasser, E., and Kung, C. K.-H. (1972). The molecular weight of sheep plasma erythropoietin. J . Biol. Chem. 247, 5159-5160. Gordon, A. S. (ed.) (1970) “Regulation of Hematopoiesis,” Vol. I: “Red Cell Production.” Appleton, New York. Green, E. L. (ed.) (1966). “The Biology of the Laboratory Mouse,” 2nd ed. McGraw-Hill, New York. Green, M. C. (1966). Mutant genes and linkages. I n “The Biology of the Laboratory Mouse” (E. L. Green, ed.), 2nd ed., pp. 87-150. McGraw-Hill, New York. Green, M. C. (1972). Personal communication. Green, M. C., Sidman, R. L., and Pivetta, 0 .H. (1972). Cribriform degeneration (cri).A new recessive neurological mutation in the mouse. Science 176, 800-803. Greenquist, A. C., Shohet, S. B., and Bernstein, S. E. (1978). Marked reduction of spectrin in hereditary spherocytosis in the common house mouse. Blood 51, 11491155. Gregory, C. J. (1976). Erythropoietin sensitivity a s a differentiation marker in the hemopoietic system: Studies of three erythropoietic responses in culture. J . Cell. Physiol. 89, 289-302. Gregory, C. J., and Eaves, A. C. (1978). Erythropoietic progenitor cell differentiation distinguished by a number of physical and biologic properties. Blood 51, 527-536. Gregory, C. J., McCulloch, E. A,, and Till, J. E. (1973). Erythropoietic progenitors capable of colony formation in culture: State of differentiation. J . Cell. Physiol. 81, 411-420. Gregory, C. J.,McCulloch, E. A., and Till, J . E. (1974al. Differentiation in the hemopoietic system: the significance of CFU-E. I n “Hemopoiesis in Culture” (W. A. Robinson, ed.), DHEW Publ. No. (NIH) 74-205, pp. 23S242. Gregory, C. J., Tepperman, A. D., McCulloch, E. A,, and Till, J. E. (1974b). Erythropoietic progenitors capable of colony formation in culture: responses of normal and genetically anemic WIW“ mice to manipulations of the erythron. J . Cell. Physiol. 84, 1-12. Gregory, C. J.,McCulloch, E . A., and Till, J. E. (1975a).Transient erythropoietic spleen
HEREDITARY ANEMIAS OF THE MOUSE
45 1
colonies: Effects of erythropoietin in normal and genetically anemic WIW" mice. J . Cell. Physiol. 86, 1-8. Gregory, C. J., McCulloch, E. A,, and Till, J . E. (1975b).The cellular basis for the defect in haemopoiesis in Flexed-tailed mice. 111. Restriction of the defect to erythropoietic progenitors capable of transient colony formation in uiuo. Br. J . Haematol. 30, 401-410. Grewal, M. S. (1962). A sex-linked anemia in the mouse. Genet. Res 3, 23&247. Griineberg, H. (1941). The growth of the blood ofthe suckling m0use.J. Pathol. Bacteriol. 52, 32S329. Griineberg, H. (1942a). The anaemia of flexed-tailed mice. I. Static and dynamic haematology. J . Genet. 43, 45-68. Griineberg, H. (1942b3. The anaemia of flexed-tailed mice. 11. Siderocytes. J . Genet. 44, 246-271. Griineberg, H., and Truslove, G. M. (1960). Two closely linked genes in the mouse. Genet. Res. 1, 69-90. Guenet, J. L., and Mercier-Balaz, M. (1975). A fertile allele of the W series (W3. Mouse News Lett. 53, 57. Guenet, J . L., Marchal, G., Milon, G., Tambourin, P., and Wendling, F. (1979). Fertile dominant spotting (W9: a new allele a t the W locus of the house mouse. J . Hered. (in press). Harleman, J. H. (1977). The haemoglobin types of mice. Lab. Anim. 11, 105-108. Harrison, D. E. (1972a). Marrow transplantation and iron therapy in mouse hereditary microcytic anemia. Blood 40, 893-901. Harrison, D. E. (1972b). Lifesparing ability (in lethally irradiated mice) of WIW" mouse marrow with no macroscopic colonies. Rad. Res. 52, 553-563. Harrison, D. E. (1973). Normal production of erythrocytes by mouse marrow continuous for 73 months. Proc. Natl. Acad. Sci. U.S.A. 70, 3184-3188. Harrison, D. E. (1975). Normal function of transplanted cell lines from aged mice. J . Geruntol. 30, 279-285. Harrison, D. E. (1976a). Avoidance of graft versus host reactions in cured W-anemic mice. Transplantation 22, 47-51. Harrison, D. E. (1976b). Stem cell multiplication rate in W-anemic mice, and immune response of mice with Hertwig's anemia. Jackson Laboratory's 47th Annual Report, 1975-1976, 59. Harrison, D. E. (1978). Genetically defined animals valuable in testing aging of erythroid and lymphoid stem cells and microenvironments. Zn "Genetic Bases of Aging," (D. E. Harrison, ed.), Birth Defects: Orig. Art. Ser. 14, 187-196. Harrison, D. E., and Astle, C. M. (1976). Population of lymphoid tissues in cured W-anemic mice by donor cells. Transplantation 22, 42-46. Harrison, D. E., and Cherry, M. (1975). Survival of allografts in WIW' anemic mice: Effect of disparity a t the Ea-2 locus. Zmmunogenetics 2, 219-229. Harrison, D. E., and Doubleday, J. W. (1976).Marrow allograft success in WIW" anemic mice: Relation to skin graft survival times. Zmmunogenetics 3, 289-297. Harrison, D. E., and Russell, E. S. (1972).The response of WIW" and SlISl" anemic mice to haemopoietic stimuli. B r . J . Haematol. 22, 155-168. Harrison, D. E., Malathi, V. G., and Silber, R. (1975). Elevated erythrocyte nucleoside deaminase levels in genetically anemic WIW" and SlISl" mice. Blood Cells 1, 605614. Harrison, D. E., Astle, C. M., and delaittre, J. (1979). Processing by the thymus is not required for cells that cure and populate WIW? recipients. Blood (in press). Heath, D. S., Axelrad, A. A., McLeod, D. L., and Shreeve, M. M. (1976).Separation ofthe
452
ELIZABETH S. RUSSELL
erythropoietin responsive progenitors BFU-E and CFU-E in mouse bone marrow by unit gravity sedimentation. Blood 47, 777-792. Helyer, B. J., and Howie, J . B. (1963a). Spontaneous auto-immune disease in NZBIBL mice. Br. J . Haematol. 9, 119-131. Helyer, B. J., and Howie, J . B. (1963b). The thymus and autoimmune disease. Lancet 2, 1 0 2 G 1029. Hertwig, P. (1942). Neue Mutationen und Koppelungsgruppen bei der Hausmaus. Z . Indukt. Abstamm. Vererbungsl. 80, 220-246. Hertwig, P. (1956). Erbliche Anamien bei Mausen. Verh. Dtsch. Zool. Ges. (Hamburg) 50, 185-193. Hilse, K., and Popp, R. A. (1968). Gene duplication as the basis for amino acid ambiguity in the alpha-chain polypeptides of mouse hemoglobins. Proc. Natl. Acad. Sci. U.S.A. 61, 930-936. Holmes, M. C . , and Burnet, F. M. (1963). The natural history of autoimmune disease in NZB mice: a comparison with the pattern of human autoimmune manifestations. A n n . Int. Med. 59, 265-266. Hopper, A. F., and Russell, E. S. (1975). Postirradiation regeneration of intestinal epithelium in WIW“ and SlISl“ genetically anemic mice. Rad. Res. 63, 310-319. Huebers, H., Huebers, E., Forth, W., and Rummel, W. (1973). Iron-absorption and iron-binding proteins in intestinal mucosa of mice with sex-linked anemia. HoppeZeyler’s Z. Physiol. Chem. 354, 1156-1158. Hunt, H. R., Mixter, R., and Permar, D. (1933). Flexed tail in the mouse, Mus musculus. Genetics 18, 335-366. Hunt, J . A., and Lehman, H. (1959). Haemoglobin “Barts’ ”: A foetal haemoglobin without a-chains. Nature (London) 184, 872-873. Hutton, J . J., and Bernstein, S. E. (1973).Metabolic properties oferythrocytes of normal and genetically anemic mice. Biochem. Genet. 10, 297-307. Iscove, N. N. (1979). Committed erythroid precursor populations in genetically anemic WIW‘ and SWSl“ mice. Proc. Int. Symp. Aplastic Anemia, Kyoto, Japan, 1976 (in press). Iscove, N. N., and Sieber, F. (1975). Erythroid progenitors in mouse bone narrow detected by macroscopic colony formation in culture. Exp. Hematol. 3, 32-43. Izak, G. (1977).Erythroid cell differentiation and maturation. In “Progress in Hematology” (E. B. Brown, ed.), Vol. 10, pp. 1-41. Grune & Stratton, New York. Joe, M., Teasdale, J . M., and Miller, J . R. (1962).A new mutation (sph)causing neonatal jaundice in the house mouse. Can. J . Genet. Cytol. 4, 219-225. Johnson, G. R., and Jones, R. 0. (1973). Differentiation of the mammalian hepatic primordium in vitro. I, Morphogenesis and the onset of hematopoiesis. J . Ernbryol. Exp. Morphol. 30, 83-96. Johnson, G. R., and More, M. A. S. (1975). Role of stem cell migration in initiation of mouse foetal liver haemopoiesis. Nature (London) 258, 72G728. Kaiser, D., Pivetta, O., and Rennert, 0. M. (1974). Autosomal recessively inherited electrolyte defect in the parotid of the “cribriform degeneration” mouse mutantpossible analogy to cystic fibrosis. Life Sci. 15, 803-810. Kamenoff, R. J. (1935). Effects ofthe flexed-tailed gene on the development of the house mouse. J . Morphol. 58, 117-155. Kamenoff, R. J. (1942). A cytological study of the embryonic livers (16-18 days) of normal and flex-tailed (anemic) mice. Genetics 27, 150 (abstr.). Keighley, G. H., Lowy, P., Russell, E. S., and Thompson, M. W. (1966). Analysis of erythroid homeostatic mechanisms in normal and genetically anemic mice. Br. J . Haematol. 12, 461-477.
HEREDITARY ANEMIAS OF THE MOUSE
453
Kelly, E. (1974). Sl“”.Mouse News Lett. 50, 52. Kingston, P. J., Bannerman, C. E. M., and Bannerman, R. M. (1978). Iron deficiency anaemia in newborn sla mice: a genetic defect of placental iron transport. Br. J . Haematol. 40, 265276. Kitamura, Y., and Go, S. (1978). Decreased production of mast cells in SUSI“ anemic mice. Blood 53, 492-497. Kitamura, Y., Go., S., and Hatanaka, K. (1978). Decrease ofmast cells in WIW‘ mice and their increase by bone marrow transplantation. Blood 52, 447-452. Konkel, D. A,, Tilghmann, S. M., and Leder, P. (1978). The sequence of the chromosomal mouse P-globin major gene: Homologies in capping, splicing and poly (A) sites. Cell 15, 11251132. Kovach, J.,Marks, P. A., Russell, E. S., and Epler, H. (1967).Erythroid cell development in fetal mice: ultrastructural characteristics and hemoglobin synthesis. J . Mol. Biol. 25, 131-142. Krantz, S. B., and Jacobson, L. 0. (1970). “Erythropoietin and the Regulation of Erythropoiesis.” Univ. Chicago Press, Chicago, Illinois. Kreimer-Birnbaum, M., Bannerman, R. M., Russell, E. S., and Bernstein, S. E. (1972a). Pyrrole pigments in normal ( + I + ) and congenitally anemic (WIW”,halha, nblnb, mklmk, flfi and slalY) mice. Comp. Biochem. Physiol. A 43, 21-30, Kreimer-Birnbaum, M., Edwards, J . A,, and Bannerman, R. M. (1972b). Further studies on sex-linked anemia of mice XIV. Int. Congr. Hematol., Brazil 16th, p. 19 (abstr.). Kuharick, A. M., and Forsthoefel, P. F. (1963). A study ofanemia in Strong’s luxoid mice. J . Morphol. 112, 13-21. Kunze, H. (1954). Die Erythropoese bei einer erblichen Anamie rontgen-mutierte Mause. Folia Haematol. (Leipzig) 72, 39Z436. Lajtha, L. G. (1970). Stem cell kinetics. In “Regulation of Hematopoiesis” (A. S. Gordon, ed.), Vol. I, pp. 111-131. Appleton, New York. Lajtha, L. G. (1975). Haemopoietic stem cells. Br. J . Haematol. 29, 529-535. Lajtha, L. G., and Schofield, R. (1971). Regulation of stem cell renewal and differentiation: possible significance in aging. Adu. Gerontol. Res. 3, 131-146. Lajtha, L. G., and Schofield, R. (1974).On the problem ofdifferentiation in haemopoiesis. Differentiation 2, 313-320. Lajtha, L. G., Gilbert, C. W., and Guzman, E. (1971). Kinetics of haemopoietic colony growth. Br. J . Haematol. 20, 343-354. Landaw, S. A. (1978). Personal communication. Landaw, S. A,, and Winchell, H. S. (1970). Endogenous production of I4CO:A method for calculation of RBC lifespan in uiuo. Blood 36, 642-656. Landaw, S. A,, Russell, E. S., and Bernstein, S. E. (1970). Splenic destruction of newlyformed red blood cells and shortened erythrocyte survival in mice with congenital microcytosis. Scand. J . Haematol. 7 , 516-524. Leder, A,, Miller, H. I., Hamer, D. H., Seidman, J. G., Norman, B., Sullivan, M., and Leder, P. (1978). Comparison of cloned mouse a-and P-globin genes: Conservation of intervening sequence locations and extragenic homology. Proc. Natl. Acad. Sci. U.S.A. 75, 6187-6191. Lewis, J. P., O’Grady, L. F., Bernstein, S. E., Russell, E. S., and Trobaugh, F. (1967). Growth and differentiation of transplanted WIW‘ marrow. Blood 30, 601-616. Linder, E. (1977).Autoantibodies against the inner aspect of erythrocyte membranes in NZB mice. Clin. Exp. Immunol. 27, 531-537. Linder, E., and Edgington, T. S. (1972). Antigenic specificity of antierythrocyte autoantibody responses of NZB mice. I. Identification and partial characterization of two erythrocyte surface autoantigens. J . Zmmunol. 108, 1615-1623.
454
ELIZABETH S. RUSSELL
Lindsey, E. S., Donaldson, G. W. K., and Woodruff, M. F. A. (1966). Erythrxyte survival in normal mice and in mice with autoimmune haemolytic anemia. Clin. Exp. Immunol. 1, 85-98. Little, C. C., and Cloudman, A. M. (1937). The occurrence of a dominant spotting mutation in the house mouse. Proc. Natl. Acad. Sci. U.S.A. 23, 535-537. Lux, S. E., Pease, B., Tomaselli, M. B., John, K. M., and Bernstein, S. E. 11979). Hemolytic anemias associated with deficient or dysfunctional spectrin. I n “Normal and Abnormal Red Cell Membranes” (S. E. Lux and V. T. Marchesi, eds.), Alan R. Liss, Inc., New York. (In press.) McCulloch, E. A. (1970). Control of hematopoiesis a t the cellular level. In “Regulation of Hematopoiesis” (A. S. Gordon, ed.), Vol. I, pp. 133-159. Appleton, New York. McCulloch, E. A,, Siminovitch, L., and Till, J. E. (1964a). Spleen-colony formation in anemic mice of genotype WIW“.Science 144, 844-846. McCulloch, E. A., Siminovitch, L., Till, J. E., Russell, E. S., and Bernstein, S. E. (196413). The cellular basis of the genetically determined hemopoietic defect in anemic mice of genotype S1lSld. Blood 26, 399-410. McCulloch, E. A,, Till, J . E., and Siminovitch, L. (1965). The role of independent and dependent stem cells in the control of hematopoietic and immunologic responses. In “Methodological Approaches to the Study of Human Leucemias” (V. Defendi, ed.), p. 61. Wistar Inst. Press, Philadelphia. McCuskey, R. S., and Meineke, H. A. (1973). Studies of the hemopoietic microenvironment. 111. Differences in the splenic microvascular system and stroma between SllSl“ and WIW’ anemic mice. A m . J . Anat. 137, 187-191. McFarland, E. C., and Russell, E. S. (1975). Linkage of microcytic anemia. Mouse News Lett. 53, 35. McKusick, V. A. (1975). “Mendelian Inheritance in Man. Catalogs of Autosomal Dominant, Autosomal Recessive, and X-Linked Phenotypes,” 4th ed. Johns Hopkins Univ. Press, Baltimore, Maryland. Maloney, M. A,, Dorie, M. T., Lamela, R. A,, Rogers, Z. R., and Patt, H. M. (1978). Hematopoietic stem cell regulatory volumes a s revealed in studies of the bgJl bgJ:WIWvchimera. J . Exp. Med. 147, 1189-1197. Manis, J. (1970). Active transport of iron by intestine: Selective genetic defect in the mouse. Nature (London) 227, 385-386. Manis, J. (1971). Intestinal iron transport defect in the mouse with sex-linked anemia. J . Physiol. (London) 220, 135-139. Marks, P. A., and Rifkind, R. A. (1972). Protein synthesis: Its control in erythropoiesis. Science 175, 955-961. Masters, J. M., and Spurling, C. L. (1967). Induction ofautoimmune hemolytic disease by diffusible substances from the thymus of NZB/BL mice. Blood 30, 569-575. Mayer, T. C., and Green, M. C. (1968). An experimental analysis of the pigment defect caused by mutations a t the W and S1 loci in mice. Deu. Biol. 18, 62-75. Mekori, T., and Phillips, R. A. (1969). The immune response in mice of genotypes WIW“ and S l I W . Proc. SOC.Exp. Biol. Med. 132,115-119. Melderis, H., Steinheider, G., and Ostertag, W. (1974). Evidence for a unique kind of a-type globin chain in early mammalian embryos. Nature (London) 250, 776776. Mellors, R. C. (1965). Auto-immune disease in NZBiBL mice. I. Pathology and pathogenesis of a model system of spontaneous glomerulonephritis. J . Exp. Med. 122, 25-41. Mellors, R. C., and Huang, C. Y. (1966).Immunopathology of NZBiBL mice. V. Viruslike (filterable) agent separable from iymphoma cells and identifiable by electron microscopy. J . Exp. Med. 124, 1031-1039.
HEREDITARY ANEMIAS OF THE MOUSE
455
Mellors, R. C., and Huang, C. Y. (1967). Immunopathology of NZB/BL mice. VI. Virus separable from spleen and pathogenic for Swiss mice. J . Exp. Med. 126, 53-62. Menner, K. (1957). Die postnatale Gonadenenentwicklung bei Mausen, die a n einer angeborenen Anaemie leiden. Wiss. 2. Martin Luther-Univ. 6, 3 3 6 3 4 4 . Miller, D. S. (1963). Coat color and behavior mutations in inbred mice under chronic low-level y-irradiation. Radiat. Res. 19, 1&1-185. Mintz, B., and Russell, E. S. (1957). Gene-induced embryological modifications of primordial germ cells in the mouse. J . Exp. 2001. 134, 207-237. Moore, M. A. S., and Metcalf, D. (1970). Ontogeny of the haemopoietic system: Yolk sac origin. B r . J . Haematol. 18, 279-296. Morgan, W. C. (1950). A new tail-short mutation in the mouse. J . Hered. 41, 208-215. Morton, J. E., and Siegel, B. V. (1973). Virus tumorigenesis and immunogenesis in New Zealand Black mice. In “Virus Tumorigenesis and Immunogenesis” (W. S. Ceglowski and H. Friedman, eds.), pp. 91-129. Academic Press, New York. Murphy, E. D. (1971). Steel alleles, thymus and susceptibility to leukemogenesis. Proc. A m . Assoc. Cancer Res. 12, 45. Murphy, E. D. (1972). Hyperplastic and early neoplastic changes in the ovaries of mice after genic deletion of germ cells. J . Natl. Cancer Inst. 48, 1283-1295. Murphy, E. D. (1977). Effects of mutant steel alleles on leukemogenesis and life-span in the mouse. J . Natl. Cancer Inst. 58, 107-110. Murphy, E. D., and Beamer, W. G. (1973). Plasma gonadotrophin levels during early stages of ovarian tumorigenesis in mice of the W x / W “genotype. Cancer Res. 33, 721-723. Murphy, E. D., Harrison, D. E., and Roths, J . R. (1973). Giant granules ofbeige mice: a quantitative marker for granulocytes in bone marrow transplantation. Transplantation 15, 52G530. Murphy, E. D., and Russell, E. S. (1963). Ovarian tumorigenesis following genic deletion of germ cells in hybrid mice. Acta Unio Int. Contra Cancrum 19, 779-782. Nash, D. J., Kent, E., Dickie, M. M., and Russell, E. S. (1964).The inheritance of “mick,” a new anemia of the house mouse. A m . 2001.4, 404 (abstr.). Nienhuis, A. W., and Benz, E . J . , J r . (1977). Regulation of hemoglobin synthesis during the development of the red cell. N . Engl. J . Med. 297, 1318-1328, 1371-1381, 1430-1436. Norins, L. C., and Holmes, M. C. (1964). Antinuclear factor in mice. J . Immunol. 93, 148-154. Ottolenghi, S., Lanyon, W. G., Paul, J . , Williamson, R., Weatherall, D. J., Clegg, J. B., Pritchard, J., Pootrakul, S., and Boon, W. H. (1974). The severe form of a-thalassemia is caused by a haemoglobin gene deletion. Nature (London) 251, 3 89-392. Pinkerton, P. H. (1968). Histological evidence of disordered iron transport in the X-linked hypochromic anemia of mice. J . Pathol. Bacterzol. 95, 1 5 s 165. Pinkerton, P. H., and Bannerman, R. M. (1967). Hereditary defect in iron absorption in mice. Nature (London) 216, 482-483. Pinkerton, P. H., and Bannerman, R. M. (1968). The hereditary anemias of mice. Hematol. Rev. 1, 119-192. Pinkerton, P. H., Bannerman, R. M., Doeblin, T. D., and Edwards, J. A. (1970). Iron metabolism and absorption studies in the X-linked anemia of mice. Br. J . Haematol. 18, 211-228.
Popp, R. A. (1973). Sequence of amino acids in the p chain of single hemoglobins from C57BL, SWR and NB mice. Biochim. Biophys. Acta 303, 52-60. Popp, R. A,, and Bailiff, E. G. (1973). Sequence of amino acids in the major and minor p
456
ELIZABETH S. RUSSELL
chains of the diffuse hemoglobin from BALB/c mice. Biochim. Biophys. Acta 303, 61-67. Popp, R. A,, and Enlow, M. K. (1977).Radiation induced a-thalassemia in mice. Am. J . Vet. Res. 38, 569-572. Popp, R. A,, Stratton, L. P., Hawley, D. K., and Effron, K. (1979a). Hemoglobins of mice with radiation-induced mutations a t the hemoglobin loci. J . Mol. Biol. 127,141- 148. Popp, R. A., Bradshaw, B. S., and Hirsch, G. P. (1979b). Embryonic hemoglobins in a-thalassemic mice. I n “Cellular and Molecular Regulation of Hemoglobin Switching” (G. Stamatoyannopoulos and A. W. Nienhuis, eds.), pp. 213-235. Grune and Stratton, New York. Potten, C. S. (1978). Small intestinal crypt cells in WIW‘ mutant mice. R a d . Res. 74, 139- 143. Renricca, N. J., Rizzoli, V., Howard, D., et al. (1970).Stem cell migration and proliferation during severe anemia. Blood 36, 7 6 4 7 7 1 . Rifkind, R. A., Cantor, L. N., Cooper, M. C., Singer, D., Maniatis, G. M., and Marks, P. A. (1974). “Hemopoiesis in Culture” (W. A. Robinson, ed.), DHEW Publ. No. (NIH) 74-205, pp. 217-226. Roderick, T. H., and Davisson, M. T. (1978). Mouse News Lett. 59, 5. Rogers, G. M., Fink, G. D., Fisher, J. W., and George, W. J. (1975). Renal cyclic AMP (CAMP)and the erythropoietic response to hemolytic anemia in New Zealand Black (NZB) mice. Fed. Proc., Fed. A m . SOC.Exp. Biol. 34, 694 (abstr.). Rothman, I. T., Zanjani, E. D., Gordon, A. S., and Silver, R. (1970). Nucleoside deaminase: An enzymatic marker for stress erythropoiesis in the mouse. J . Clzn. Inuest. 49, 2051-2067. Rowley, P. T. (1972). Personal communication. Ruscetti, F., Boggs, D. R., Torok, B. J . , and Boggs, S. S. (1976). Reduced blood and marrow neutrophils and granulocytic colony forming cells in SlISl“ mice. Proc. SOC. Exp. Biol. Med. 152, 39&402. Russell, E . S. (1955).Review of the pleiotropic effects of W-series genes on growth and differentiation. In “Aspects of Synthesis and Order in Growth” (D. Rudnick, ed.), pp. 113- 126. Princeton Univ. Press, Princeton, New Jersey. Russell, E. S. (1970). Abnormalities of erythropoiesis associated with mutant genes in mice. In “Regulation of Hematopoiesis” (A. S. Gordon, ed.), Vol. I, pp. 649-675. Appleton, New York. Russell, E. S. (1978). Analysis of genetic differences as a tool for understanding aging processes. In “Genetic Effects on Aging” (D. Bergsma and D. E. Harrison, eds.), pp. 5 1 5 5 2 3 . Alan R. Liss, Inc., New York. Russell, E. S.,and Bernstein, S. E. (1966).Blood and blood formation. I n “The Biology of the Laboratory Mouse” (E. L. Green, ed.), pp. 351-372. McGraw-Hill, New York. Russell, E. S.,and Bernstein, S. E. (1967).Influence of non-H-2 genetic factors on success in implantation therapy of W series hereditary anemias of the mouse. Transplantation 5, 142-153. Russell, E. S., and Keighley, G. (1972). The relation between erythropoiesis in normal and genetically anemic mice during prolonged hypoxia or after whole-body irradiation. B r . J . Haematol. 22, 437-442. Russell, E. S., and Lawson, F. A. (1959). Selection and inbreeding for longevity ofa lethal type. J . Hered. 50, 19-25. Russell, E. S., and McFarland, E. C. (1966). Analysis of pleiotropic effects of W and f genic substitutions in the mouse. Genetics 53, 949-959. Russell, E. S., and McFarland, E . C. (1974).Genetics of mouse hemoglobins. In “Hemo-
HEREDITARY ANEMIAS OF THE MOUSE
457
globin, Comparative Molecular Biology Models for the Study of Disease” Ann. N . Y . Acad. Sci. 241, 25-38. Russell, E. S., and Meier, H. (1966). Constitutional diseases. In “The Biology of the Laboratory Mouse” (E. L. Green, ed.), pp. 571-587. McGraw-Hill, New York. Russell, E. S., Lawson, F., and Schabtach, G. (1957). Evidence for a new allele at the W-locus of the mouse. J . Hered. 48, 119-123. Russell, E . S., McFarland, E. C., and Modeen, W. R. (1963). The cellular basis of differential radiosensitivity of normal and genetically anemic mice. R a d . Res. 20, 677-694. Russell, E. S., Thompson, M. W., and McFarland, E. C. (1968). Analysis of effects of W and f genic substitutions on fetal mouse hematology. Genetics 58, 259-270. Russell, E. S., McFarland, E . C., and Kent, E. L. (1970a). Low viability, skin lesions, and reduced fertility associated with microcytic anemia in the mouse. Transplant. Proc. 2, 1 4 4 1 5 1 . Russell, E. S., Nash, D. J . , Bernstein, S. E., Kent, E. L., McFarland, E. C., Matthews, S. M., and Nonvood, M. S. (1970b). Characterization and genetic studies ofmicrocytic anemia in the house mouse. Blood 35, 838-850. Russell, L. B., Russell, W. L., Popp, R. A,, Vaughan, C., and Jacobson, K. B. (1976). Radiation-induced mutations at mouse hemoglobin loci. Proc. Natl. Acad. Sci. U.S.A. 73, 284S2846. Russell, P. J., Hicks, J. D., Boston, L. E., and Abbott, A. (1970). Failure to transfer haemolytic anemia or glomerulonephritis with cell-free material from NZB mice. Clin. Exp. Immunol. 6, 227-239. Sarvella, P. A., and Russell, L. B. (1956).Steel, a new dominant gene in the house mouse. J . Hered. 47, 123-128. Sassa, S., and Bernstein, S. E. (1977). Levels of 8-aminolevulinate dehydratase, uroporphyrin-I synthetase, and protoporphyrin IX in erythrocytes from anemic mutant mice. Proc. Natl. Acad. Sci. U . S . A . 74, 1181-1184. Sassa, S., and Bernstein, S. E. (1978). Studies of erythrocyte protoporphyrin in anemic mutant mice: use of a modified hematofluorometer for the detection of heterozygotes for hemolytic disease. Exp. Hematol. 6 , 479-487. Schaible, R. H. (1963a). Developmental genetics of spotting patterns in the mouse. Ph.D. Dissertation, Iowa State Univ., Ames. Schaible, R. H. (196313). Allelism and linkage of SIB”. Mouse News Lett. 29, 38. Scheufler, H. (1969). Eine weitere Mutante der Hausmaus mit Anaemie ( h b d ) .2. Versuchstierk. 11, 348-353. Schlager, G., and Dickie, M. M. (1966). Spontaneous mutation rates a t five coat color loci in mice. Science 151, 205-206. Schlager, G., and Dickie, M. M. (1967).Spontaneous mutations and mutation rates in the house mouse. Genetics 57, 319-330. Scorbie, J., Hamilton, D. L., and Valberg, L. S. (1974). Effect of various factors in iron absorption in mice with X-linked anemia. Br. J . Haematol. 27, 559-569. Searle, A. G. (1979). Mouse gene list. Mouse News Lett. 60, 2-26. Searle, A. G., and Beechey, C. V. (1974). Con allelic with S1. Mouse News Lett. 50, 39. Searle, A. G., and Truslove, G. M. (1970). A gene triplet in the mouse. Genet. Res. 15, 227-235. Seller, M. J. (1971). Bone marrow transplantation in a genetically determined anemia in the mouse. Ontogeny Acquired Immunity, Ciba Found. S y m p . 1971 pp. 175-191. Sharkis, S. J.,Ahmed, A,, Jedrzeczak, W. S., and Sell, K. W. (1977a). Thymic control of hematopoiesis. Blood 50, Suppl. 1, 161.
458
ELIZABETH S. RUSSELL
Sharkis, S. J., Ahmed, A,, Sensenbrenner, L. L., Wiktor-Jedrzeczak, W., and Sell, K. W. (1977b). The theta-sensitive regulatory cell and hematopoiesis. Enp. Hematol. 5, Suppl. 2, 35. Shearer, G. M., and Cudkowicz, G. (1968). Cluster formation in uitro by mouse spleen cells and sheep erythrocytes. J . Immunol. 101, 1264-1270. Simpson, L. 0. (1975). Spleen and liver weight changes in NZB mice with haemolytic anaemia. Lab. A n i m . 9, 261-273. Simpson, L. 0. (1976). An NZB virus or NZB mice with viral infections? Lab. A n i m . 10, 249- 260. Snell, G. D., Dausset, J., and Nathenson, S. (1976). Serologically and histogenetically demonstrated loci of the H-2 complex. “Histocompatibility,” pp. 91-131. Academic Press, New York. Southard, J . L., and Green, M. C. (1971). Linkage data. Mouse News Lett. 45, 29. Staats, J. (1976). Standardized nomenclature for inbred strains of mice: Sixth listing. Cancer Res. 36, 4333-4377. Steele, M. S. (1974). Panda-white, Pw or W”‘. Mouse News Lett. 50, 52. Steeves, R. A,, Bennett, M., Mirand, E. A,, and Cudkowicz, G. (1968). Genetic control of the W-locus of susceptibility t o (Friend) spleen focus-forming virus. Nature (London) 218, 372-374. Steinheider, G., Melderis, H., and Ostertag, W. (1972). Mammalian embryonic hemoglobins. Zn “International Symposium on Synthesis, Structure and Function of Hemoglobin” (H. Marten and L. Novicki, eds.), pp. 225-235. Lehmann, Munich. Steinheider, G., Melderis, H., and Ostertag, W. (1975a). Embryonic E chains of mice and rabbits. Nature (London) 257, 714-716. Steinheider, G., Melderis, H., and Ostertag, W. (197513). Evidence for Hb Lepore-like hybrid globin P-genes in mice. Nature (London) 257, 712-714. Stephenson, J . R., Axelrad, A. A., McLeod, D. L., and Shreeve, M. M. (1971). Induction of colonies of hemoglobin-synthesizing cells by erythropoietin in uitro. Proc. Natl. Acad. Sci. U . S . A . 68, 1547-1551. Stern, R. H., Russell, E. S., and Taylor, B. A. (1976). Strain distribution and linkage relationship of a mouse embryonic hemoglobin variant. Biochem. Genet. 14, 373381. Stevens, L. C., and Mackensen, J . A. (1958). The inheritance and expression of a mutation in the mouse affecting blood formation, the axial skeleton, and body size. J . Hered. 49, 153-160. Stevens, L. C., Mackensen, J. A,, and Bernstein, S. E. (1959). A mutation causing neonatal jaundice in the house mouse. J . Hered. 50, 35-39. Strong, L. C., and Hollander, W. F. (1953).Two non-allelic mutants resembling “ W in the house mouse. J . Hered. 44, 41-44. Svendsen, U. G. 11977). Spontaneous hypertension and hypertensive vascular disease in the NZB strain of mice. Acta Pathol. Microbiol. Scand. Sect. A . , 85, 548-554. Sweet, H. O., and Lane, P. W. (1978). Tail-short linkage data.Mouse News Lett. 59, 27. Tala4 N. (1977). Autoimmunity and lymphoid malignancy: Manifestations of immunoregulatory disequilibrium. I n “Autoimmunity: Genetic, Immunologic, Virologic, and Clinical Aspects” (N. Talal, ed.), pp. 184-207. Academic Press, New York. Talal, N., and Roubinian, J . R. (1978). Sex, hormones, and autoimmunity. In “Genetic Control of Autoimmune Disease’’ (N. R. Rose, P. E. Bigazzi, and N. L. Warner, eds.), pp. 163-176. ElseviedNorth-Holland Publ., Amsterdam. Taylor, J. M., Dozy, A,, Kan, X. W., Varmus, H. E., Lie-Injo, L. E., Ganesan, J., and Todd,
HEREDITARY ANEMIAS OF THE MOUSE
459
D. (1974). Genetic lesion in homozygous a-thalassemia (hydrops fetalis). Nature (London) 251, 392-393. Theil, E. C. (1976). The abundance of ferritin in yolk-sac derived red blood cells of the embryonic mouse. Br. J . Haematol. 33, 437-442. Thompson, M. W., McCulloch, E. A,, Siminovitch, L., et al. (1966a). The cellular basis for the defect in hemopoiesis in flex-tailed mice. I. The nature and persistence of the defect. Br. J . Haematol. 12, 152-160. Thompson, M. W., McCulloch, E. A,, Siminovitch, L., and Till, J. E. (1966b).The cellular basis for the defect in hemopoiesis in mice with Hertwig’s anemia. Genetics 54,366. Tilghmann, S . M., Tiemeir, D. C., Polsky, F., Edgell, M. H., Seidman, J . G., Leder, A., Enquist, L. W., Norman, B., and Leder, P. (1977). Cloning specific segments of the mammalian genome: Bacteriophage A containing mouse globin and surrounding gene sequences. Proc. Nutl. Acad. Sci. U.S.A. 74, 440G4410. Till, J . E., and McCulloch, E. A. (1961). A direct measurement ofthe radiation sensitivity of normal mouse bone-marrow cells. Rad. Res. 14, 213-222. Till, J. E., McCulloch, E. A,, and Siminovitch, L. (1964). A stochastic model of stem cell proliferation based on the growth of spleen colony-forming cells. Proc. Natl. Acad. Sci. U.S.A. 51, 29-36. Torok, B. J., and Boggs, S. S. (1975). Defective gastrointestinal recovery after irradiation in WIW“ mice. A m . J . Physiol. 228, 1280-1283. Truslove, G. M. (1977). Mouse News Lett. 56, 46. Warner, N. L. (1977). Genetic aspects of autoimmune disease in animals. In “Autoimmunity: Genetic Immunologic, Virologic, and Clinical Aspects,” (N. Talal, ed.), pp. 33-59. Academic Press, New York. Waymouth, C. (1973). Erythrocyte sodium and potassium levels in normal and anemic mice. Comp. Biochem. Physiol. A 4413, 751-766. Weatherall, D. J. (1969). The genetics of the thalassemias. Br. Med. Bull. 25, 24-29. Weatherall, D. J. (1974). The potential molecular mechanisms of thalassemias and related disorders. Ann. N . Y . Acad. Sci. 241, 132-141. Weatherall, D. J., and Clegg, J. B. (1972). “The Thalassaemia Syndromes.” 2nd ed. Blackwell Scientific Publ., Oxford and London. Whitney, J. B., 111. (1977). Differential control of the synthesis of two hemoglobin @chains in normal mice. Cell 12, 863-871. Whitney, J. B. 111, and Russell, E. S. (1978). Alpha thalassemia (Hba‘*-.’).Mouse News Lett. 58, 47-48. Whitney, J. B., 111, and Russell, E. S. (1979). Linkage of the embryonic a-like and adult a-globin genes. Proc. Natl. Acad. Sci. U.S.A. (in press). Whitney, J. B., 111, Copland, G. T., Skow, L. C., and Russell, E. S. (1979). Resolution of the products of the duplicated hemoglobin alpha chain loci by isoelectric focussing. Proc. Nutl. Acad. Sci. U.S.A. 76, 867-871. Wiktor-Jedrzejczak, W., Sharkis, S., Ahmed, A,, Sell, K. W., and Santos, G. (1977a). Theta-sensitive cell and erythropoiesis: identification of a defect in WIW‘ anemic mice. Science 196, 31.3-315. Wiktor-Jednejaak, W., Sharkis, S. J., Ahmed, A,, McKee, A,, Santos, G., and Sell, K. (1977b).Theta-sensitive regulatory cell (TSRC):Its role in regulation of self-renewal . of the hematopoietic stem cell. Exp. Hematol. 5, Suppl. 2, 36. Wolf, N. S. (1974). Dissecting the hematopoietic microenvironment. I. Stem cell lodgement and commitment and the proliferation and differentiation of erythropoietic descendants in the SIISld mouse. Cell Tissue Kinet. 7, 89-98. Zaino, E. C., and Rossi, M. B. (1974). Ultrastructure of the erythrocytes in P-thalassemia. Ann. N . Y . Acad. Sci. 232, 2 3 S 2 6 0 .
SUBJECT INDEX A Agar plate method, screening by, 40-41 Alloantigens demonstrated by methods other than grafting, 29&297,341-342 antigens of skin and liver, 305-306 Ly antigens cfB cells, 303-304 Ly antigens ofT cells, 300-303 Ly-M-1 antigen, 297-300 miscellaneous antigens of lymphocytes, 304-305 recombinant inbred strains, 297 Thy-1 antigen, 300 Amantadine, resistance, of influenza virus, 25 Androgenesis nutritional requirements for, 145-146 physiology of, 146- 148 Androgenetic plants origin of, 139-145 uses of, 148-151 Anemia(s) hypochromic, general comments, 440442 macrocytic, 379-380 abnormal fetal erythropoiesis, 386387 attempt to put it all together, 408-41 1 erythroid homeostatic mechanisms, 39G393 genetic structure of W , Sl and an loci, 380-386 implantation therapy, 395-401 nonerythroid aspects of hemopoiesis
in WIW, SIISI andanlan mice, 393-395 pertinent genetic stocks for physiological studies, 387-390 radiosensitivity of anemic mice, 404-406 studies in uitro, 406-408 therapy of W-anemias, 401-404 microcytic, 420-424 secondary to genetic defects in other systems, 442 cribriform degeneration, 445 diminutive mice, 444-445 newborn Strong’sluxoid mice, 444 tail-short heterozygotes, 443-444 sex-linked, 417-420 spontaneous hereditary hemolytic absence of hemoglobinopathy and enzyme defect, 427-428 autoimmune hemolytic anemia of NZBiB mice, 431-436 descriptions of single-locus hemolytic syndromes, 426-427 evidence of red cell membrane defects, 428-430 genetic information, 424-426 identification of heterozygous carriers, 430 transitory siderocytic of flexed mice, 412-417 Antibiotic(s), synthesis genetic control, 89-93 multivalent induction of secondary metabolite formation, 98- 101 plasmids and, 93-98
461
462
SUBJECT INDEX
Antigenic variability, of influenza virus, genetic basis for, 13-21
B B cells, Ly antigens of, 303-304,341-342 Birds, sex determination in, 221-223 C Chemostat, screening and, 43 Colony color, screening and, 42-43 Colony morphology, screening and, 41-42 Cultures, hemopoiesis in, 376-378
D Deoxyribonucleic acid, exogenous, transformation by, 166-168 Drosophila, sex determination in, 219-220
E Erythropoiesis, abnormal fetal, 386-387
G Gene(s) immune response Ir-1 loci of theH-2 complex, 323-330 loci not linked toH-2,330-331 new combinations cell fusion, 83 heterokaryosis, 84-85 interspecific recombination, 75-77 intraspeeific recombination, 68-75 plasmids, 79-81 transduction, 82-83 transformation, 77-79 Gene dosage, applied microbiology and gene amplification, 65-66 plasmids, 67-68 transduction, 66-67 Genome, segmented, of influenza virus, 3- 4 Germ cell development gametogenesis, 263-272
primordial determination, 255-258 primordial development, 258- 263 interaction with somatic cell, 253-255 Germ plasm, preservation, plant tissue culture and, 173-175 Glaser’s dumb-waiter, screening and, 44
H H loci, MHC and, 309-318 H-2 complex Ir-1 loci of, 323-330 loci not linked to, 330-331 MHC and, 307-309 Hemoglobin adult, polymorphism of, 366-368 embryonic, 368-369 Hemoglobinopathies, mutagen induced P-chain abnormalities in mice, 438 frequency in human vs. mouse, 436-438 Jackson laboratory a-thalassemia, 439-440 Oak Ridge a-thalassemia, 438-439 Hemopoiesis in hematologically normal mice developmental changes, 362-364 embryonic hemoglobins, 368-369 erythroid homeostasis, 3 6 4 3 6 6 hemopoiesis in culture, 3 7 6 3 7 8 hemopoietic stem cells and derivatives, 369-373 normal erythroid differentiation, 373-376 normal vs. deficient hemopoiesis, 378-379 polymorphism of adult hemoglobins, 366-368 Histocompatibility loci, non-H-2, 292-296 Homeostasis, erythroid, 390-393 Hybridization, somatic, protoplasts and, 155-163 I l a loci, MHC and, 318-320 Immune response, genes of, 323-331 Inbred strains, recombinant, 297 Influenza virus assignment of RNA segments to gene function, 12- 13
463
SUBJECT INDEX
base sequence studies on individual R N A segments complementary RNA,5-6 virion RNA,P 5 genetic basis for antigenic variability, 13-16 antigenic drift, 18-21 antigenic shift, 16-18 nomenclature, 2-3 practical applications amantadine resistance as genetic marker, 25 host-range mutants, 24-25 host-range recombinants, 23-24 new pandemic strain (HlN1) from 1977,21-23 possible application of recombinants and mutants for live vaccine production, 26-27 ribonucleic acid, synthesis and regulation, 6-7 segmented genome of, 3-4 temperature-sensitive mutants, defects in biological functions, 8- 12 number of recombination groups, 7-8 virus-specific proteins, structure and number, 3 Iron, defects in utilization, 411-412 microcytic anemia, 420-424 sex-linked anemia, 417-420 transitory siderocytic anemia of flexed mice, 412-417
L Liver, antigens of, 305-306 Lymphocytes, miscellaneous antigens of, 304-305,341-342
M Major histocompatibility complex adjacent loci and, 306-307 H loci, 30%318,342-343 H-2 complex, 307-309 la loci, 318-320,343-344 T complex, 320-322 in cell-cell interactions, 334-341 Mammals, sex determination in, 220
Microorganisms screening methods agar plate method, 40-41 chemostat, 43 colony morphology, 41-42 Glaser’s dumb-waiter, 44 pigment changes and colony color, 42-43 transfer, protoplasts and, 163- 166 Mutagen(s),anemias induced by, 436-440 Mutagenesis, applied microbiology and, 44-46 Mutants with ability to generate molecules with altered biological activities, 5 S 6 3 auxotrophic and suppressor, 51-52 constitutive, 52-53 enzyme-specificity, 55-57 host-range, of influenza virus, 24-25 with increased resistance to own metabolites, 59 inhibitor-resistant, 46- 5 1 permeability, 57-58 temperature-sensitive, of influenza virus, 7-12 up-promotor, 53-55 viruses and, 63-64
N Nitrogen fixation, by plant tissue cultures, 16g173
0 Organelles, transfer, protoplasts and, 163-166
P Pigment changes, screening and, 42-43 Plant tissue culture and haploidy, 13EL139 nutritional requirements for androgenesis, 145-146 origin of androgenetic haploids, 139145 physiology of androgenesis, 146- 148 uses of androgenetic plants, 148- 151 cultures
464
SUBJECT INDEX
germ plasm preservation and, 173175 nitrogen fixation and, 168- 173 direct transformation by exogenous DNA, 166- 168 protoplasts in genetics and breeding, 151- 152 fusion ofprotoplasts and somatic hybridization, 155- 163 isolation and culture of protoplasts, 152-155 protoplasts as tools for the transfer of cell organelles or microorganisms, 163-166 rapid clonal propagation, 128-138 Protein(s1, influenza virus-specific, structure and number, 3 Protoplasts fusion and somatic hybridization, 155163 isolation and culture, 152- 155 as tools for transfer of cell organelles or microorganisms, 163- 166
R Recombinants, host-range, of influenza virus, 23-24 Recombination groups, of influenza virus, 7- 8 Resistance, hybrid or hemopoietic, 331334 Ribonucleic acid influenza virus assignment of segments t o gene function, 12-13 base sequence studies, 4-6 synthesis and regulation, 6-7
5 Sex determination, genetic in birds, 221-223 in Drosophila, 219-220 early studies, 218-219 in mammals, 220 models of, 223-230 Sex differentiation, gonadal, 230-231 descriptive embryology, 231-234 dominant sex versus neutral sex, 234238 models of, 238-253 somatic cell-germ cell interaction, 253-255 Skin, antigens of, 305-306 Spleen colony formation, macrocytic anemia and, 395-401 Stem cells, hemopoietic, 369-373 Strain stability storage and, 85 tandem duplications and unstable phenotype, 87-89 viruses and, 85-87
T T cells, Ly antigens of, 300-303,341-342 T complex, MHC and, 320-322 a-Thalassemia Jackson Laboratory, 439-440 Oak Ridge, 438-439 Thy-1 antigen, 300
V Vaccines, influenza virus, production of, 26-27