ADVANCES IN GENETICS VOLUME 21 Edited by
E. W. CASPARI Department of Biology University of Rochester Rochester, New Yor...
5 downloads
551 Views
22MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
ADVANCES IN GENETICS VOLUME 21 Edited by
E. W. CASPARI Department of Biology University of Rochester Rochester, New York
1982
ACADEMIC PRESS A Subsidiary of Harcourt Brace Jouanovich, Publishers NEW YORK LONDON PARIS SAN DIEGO SAN FRANCISCO SAO PAUL0 SYDNEY TOKYO TORONTO
COPYRIGHT @ 1982, BY ACADEMIC PRESS, INC. ALL RIGHTS RESERVED. NO PART O F THIS PUBLICATION MAY BE REPRODUCED OR TRANSMITTED IN ANY FORM OR BY ANY MEANS, ELECTRONIC OR MECHANICAL, INCLUDING PHOTOCOPY, RECORDING, OR ANY INFORMATION STORAGE AND RETRIEVAL SYSTEM, WITHOUT PERMISSION IN WRITING FROM T HE PUBLISHER.
ACADEMIC PRESS, INC.
111 Fiflh Avenue, New York, New
York 10003
United Kingdom Edition published b y ACADEMIC PRESS, INC. ( L O N D O N ) LTD. 24/28 Oval Road, London N W l 7DX
LIBRARY O F CONGRESS
CATALOG CARD
NUMBER:47-30313
ISBN 0-12-017621-1 PRINTED IN TH E UNITED STATES O F AMERICA
82838485
9 8 7 6 5 4 3 2 1
CONTRIBUTORS TO VOLUME 21 Numbers in parentheses indicate the pages on which the authors’ contributions begin.
JAMESA. BAUM(3471, Department of Genetics, North Carolina State University, Raleigh, North Carolina 27650 HOWARD J . EISEN(l),Developmental Pharmacology Branch, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, Maryland 20205 P. K. GUFTA(2551,Cytogenetics Laboratory, Department ofAgricultura1 Botany, Meerut University, Meerut, India LEONARD M. HJELMELAND (l),Developmental Pharmacology Branch, National Institute of Child Health and Human Development, National Institutes o f Health, Bethesda, Maryland 20205 ERICKUBLI(1231, Zoologisches Institut der Universitat Zurich-Irchel, CH-8057 Zurich, Switzerland MATTIA. LANG( l),Developmental Pharmacology Branch, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, Maryland 20205 CHRISTOPHER W. LAWRENCE (1731,Department of Radiation Biology and Biophysics, University of Rochester, School of Medicine and Dentistry, Rochester, New York 14642 LASSELINDAHL (53),Department of Biology, The University of Rochester, Rochester, New York 14627 DANIELW. NEBERT (l),Developmental Pharmacology Branch, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, Maryland 20205 MASAHIKONEGISHI ( l),Developmental Pharmacology Branch, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, Maryland 20205 P. M. PRIYADARSHAN (255), Cytogenetics Laboratory, Department of Agricultural Botany, Meerut University, Meerut, India JOHNG. SCANDALIOS (3471, Department of Genetics, North Carolina State University, Raleigh, North Carolina 27650 JANICEM. ZENGEL (53),Department of Biology, The University of Rochester, Rochester, New York 14627 vii
THE Ah LOCUS. A MULTIGENE FAMILY NECESSARY FOR SURVIVAL IN A CHEMICALLY ADVERSE ENVIRONMENT: COMPARISON WITH THE IMMUNE SYSTEM
.
Daniel W Nebert. Masahiko Negishi. Matti A . Lang. Leonard M Hjelrneland. and Howard J Eisen
.
.
Developmental Pharmacology Branch. National Institute of Child Health and Human Development. National Institutes of Health. Bethesda. Maryland
I . Introduction ........................................................ A . Phase I and Phase I1 Drug-Metabolizing Enzymes .................. B. What Is “Cytochrome P-450?” .............................. C.What Is “Monooxygenase Activi .............................. D. Multiple Forms of P-450 ....... I1. The Ah System .................................................... A . Early Studies .................................................... B. Linkage .......................................................... C. Pleiotypic Response of the Ah Locus .............................. D. Regulation by the Ah Cytosolic Receptor .......................... E . Evidence for Multiple Structural Gene Products .................... F. Suggestive Evidence for Temporal Genes .......................... I11. The Various Means by Which Organisms Cope with Environmental Adversity ............................................ A . Rapid Responses to an Adverse Environment ...................... B. Diversity in the Organism That May Play a Role in These Responses IV . Comparison of the A h System with the Immunoglobulin System ...... A. Initiation of Programming in the “Control” Animal . . . . . . . . . . . . . . . . B. Phylogenetic Expression . . . . . . . . . . . . . . . . ..................... C. Clinical Disease .................................................. D . Reciprocal Relationship between the P-450 and Immune Systems . . E . Overlapping Specificities . . ...................... V . Multiple Forms of Other Drug mes . . . . . . . . . . . . . . . . VI . Conclusions and Directions of Future Research ...................... A . How Many Forms of P-450 Are There? ............................ B . Research Directions ........................... 1
.
ADVANCES IN GENETICS Val . 21
2
2
3 4 7 8 8 11 11 13 16 26 27 27 29 32 32 33 33 34 34 39 40 40 40
.
Copyright 0 1982 by Academic Press Inc. All rights of reproduction in any form reserved . ISBN 0-12-017621-1
2
DANIEL
w.
NEBERT
et al.
VII. Summary .......................................................... References
..........................................................
42 43
I. Introduction
In the past several years, a large amount of exciting information has developed with regard to the genetic regulation of certain drugmetabolizing enzymes. Most of this information has appeared in pharmacology and biochemistry journals. The purpose of this article is to introduce this subject to the geneticist. First, the drug-metabolizing enzyme systems are introduced. Second, the Ah system is introduced and evidence is presented for a cytosolic receptor, which is believed to be the major A h regulatory gene product. Third, data are given for multiple A h structural gene products; these are the various newly induced enzyme proteins, the cDNA of some of which we have recently cloned. Fourth, evidence is described for possible temporal gene(s) related to this system. Lastly, this genetic system, which aids the organism in coping with environmental adversity, is compared with other systems that also aid the organism in survival. Many of the ideas and new data presented herein are very recent and will need corroboration and extension. We believe this research field has become extremely fascinating, however, even though there still remain many more questions than answers.
A. PHASE I AND PHASE I1 DRUG-METABOLIZING ENZYMES
At least lo5 and possibly many more foreign chemicals exist in our environment. These chemicals are not to be confused with the approximately lo6 antigens (proteins, or usually glycoproteins) on this planet that evoke the immune response-although antibodies have been developed against some of these foreign chemicals. Many of the foreign chemicals are highly toxic t o all organisms, or to certain classes of organisms, and a growing number of these chemicals are being shown to cause mutations, cancer, and birth defects. How are living things able to respond to this chemical adversity? Most of these foreign chemicals-also called xenobiotics-are so fatsoluble that they would remain in the organism indefinitely were it not for Phase I and Phase I1 drug-metabolizing enzymes (Goldstein et al., 1974). During Phase I metabolism, polar groups (such as alcohols) are introduced into the parent molecule, thereby presenting the Phase I1 conjugating enzymes with a substrate. The Phase I1
THE
Ah
LOCUS
3
enzymes use the polar group as a “handle” for attaching other very water-soluble moieties such as glucuronide, sulfate, or glycine. The Phase I products (such as alcohols or quinones) and especially the Phase I1 conjugates are sufficiently polar to be excreted by the organism. B. WHATIs “CYTOCHROME P-450?” “Cytochrome,” a Greek word, literally means “colored substance in the cell.” The color is derived from the properties of d electrons of transition elements such as iron, and, indeed, cytochromes appear reddish in color when sufficient concentrations exist in a subcellular fraction. “P-450”denotes a pigment with the unusual property of having its major optical absorption peak (Soret maximum) at about 450 nm, when the material has been reduced and combined with carbon monoxide (Omura and Sato, 1964).Although the name P-450 was intended to be temporary until more information about this substance became available (Omura and Sato, 19641, the terminology has persisted for 17 years because of the increasing complexity of this enzyme system with each passing year and because of the lack of agreement on any better nomenclature. The interesting history of the discovery and characterization of P-450 independently from different approaches in three laboratories-Johnson Research Foundation, University of Pennsylvania; Department of Biochemistry, University of Oregon Medical School, Portland; and Institute of Protein Research, Osaka University-between 1955 and 1962 has been recently detailed (Sato and Omura, 1978; Mannering, 1980). Cytochrome P-450 represents a family of hemoproteins (heme-containing proteins) possessing catalytic activity toward thousands of substrates. The estimated molecular weights of various forms of P450 range from 43,000 to 60,000 on sodium dodecyl sulfate polyacrylamide gels (Nebert, 1979). The porphyrin ring (including the iron) represents about 650 daltons; this heme group is lost during denaturating electrophoresis but under normal conditions is combined with the various apo-enzymes to form the functional holo-enzymes. The apo-enzyme portions-polypeptides ranging in length from about 390 to 550 amino acids-are believed to confer (at least some) substrate specificity toward these thousands of environmental chemicals. Some forms of P-450 appear to be glycoproteins. P-450 is ubiquitous; its presence has been studied in bacteria, plants, primitive animals, and every mammalian tissue with the possible exception of crystalline
4
DANIEL
w.
NEBERT
et al.
bone. Recently, nomenclature committees have objected to the use of the term “cytochrome” for this enzyme. C. WHATIs “MONOOXYGENASE ACTIVITY?” Monooxygenases are enzymes that insert one atom of atmospheric oxygen into their substrates (Mason et al., 1955; Hayaishi et al., 1955). The various forms of P-450 represent a large subset of all monooxygenases. To perform this monooxygenation, the P-450 hemoprotein receives two electrons from the cofactors NADPH and/or NADH, and these electrons are received one at a time, usually via reductases (flavoproteins). In certain bacteria such as Pseudomonas (Tanaka et al., 1976), the entire electron chain-NADH, reductase, an iron-sulfur protein, and P-450-is in the cytosol. In certain fungi (Yoshida, 1978; Kato, 1979; Cerniglia and Gibson, 1979) the P-450 appears to be rather easily dissociated from microsomal” membranes. In most organisms, however, the electron chain is deeply embedded in the endoplasmic reticulum, inner mitochondrial membrane, and perhaps the nuclear envelope. The microsomal electron chain contains reductase and P-450, but the mitochondrial electron chain includes reductase, iron-sulfur protein (“adrenodoxin”), and P-450. P-450-mediated monooxygenases therefore represent a large number of Phase I enzymes. These enzymes very often appear to be stimulated-or induced-when the organism is exposed to a particular P450 substrate or to other inducing chemicals (Nebert et al., 1981). The thousands of foreign chemicals and normal body substrates for these enzymes include polycyclic hydrocarbons such as benzo[alpyrene (ubiquitous in the combustion of coal and in city smog, cigarette smoke, and charcoal-cooked foods), anthracenes, and biphenyl; halogenated hydrocarbons such as polychlorinated and polybrominated biphenyls, defoliants, insecticides, and ingredients in soaps and deodorants; certain fungal toxins and antibiotics; many of the chemotherapeutic agents used to treat human cancer; ethanol; almost all drugs; almost all commonly used laboratory reagents; strong mutagens such as N-methyl-N’-nitro-N-nitrosoguanidine and nitrosamines; various chemicals found in cosmetics and perfumes; numerous aromatic amines, such as those found in hair dyes, nitro aromatics, *Microsoma1 membranes denote the pellet formed when the postmitochondrial supernatant fraction (following 9,000 or 15,000 g x 15 min) is centrifuged again at 105,000g for 60 min. Whereas the majority of the microsomes represent the endoplasmic reticulum, this crude fraction usually contains plasma membranes, nuclear and mitochondrial membrane fragments, Golgi bodies, and lysosomal membranes.
THE
Ah
LOCUS
5
aminoazo and diazo compounds, and heterocyclics; N-acetylarylamines and nitrofurans; most plant phytoalexins and wood terpenoid derivatives; epoxides; carbamates; alkyl halides; safrole derivatives; antioxidants, other food additives, and many ingredients of foodstuffs and spices; both naturally occurring and synthetic steroids; prostaglandins; and other endogenous substrates such as biogenic amines, indoles, thyroxine, and fatty acids. Monooxygenase activities (Fig. 1)therefore require the integrity of an electron flow between the cofactor NADPH (in some cases, NADH) and the oxygenated form of P-450.More than three-fourths of the liver microsomal reductase molecule is believed (Vermilion and Coon,
FIG. 1. Hypothetical diagram of the relationship between flavoprotein reductases and forms of cytochrome P-450 embedded in cellular membranes (Nebert, 1979). R, substrate (such as a drug); R-0, oxygenated intermediate or product. Reproduced with permission from Dr. W. Junk Publishers.
6
DANIEL
w.
NEBERT
et al.
1978a) to sit free of the lipid bilayer, whereas P-450 molecules are believed to be usually deeply embedded in the membrane, thereby making solubilization of “pure” forms of these hemoproteins extremely difficult. Detergent treatment involving micelle formation often interferes with normal function (rate of catalytic activity in intact microsomes or in perfused liver), so that “reconstituted” activity sometimes may differ from “intact” microsomal catalytic activity (Lu and Levin, 1974). The functions of membrane-bound FAD- and FMN-containing flavoproteins (Vermilion and Coon, 1978b1, mitochondria1 P450 (Mason et al., 19731, cytochrome b, (Enomoto and Sato, 1973; Noshiro et al., 19791, and cyanide-sensitive fatty acid desaturase (Ohba et al., 1978) are beyond the scope of this article. Following passage of electrons from NADPH (or NADH) via the reductases to P-450, one atom of atmospheric oxygen is transferred to the substrate-at the P-450 enzyme-active site involving activated iron of the heme. The other atom of oxygen is ultimately found in cellular water. It is perhaps most reasonable to assume that the oxygenation occurs at or near the outside surface of the microsomal (lipoidal) membrane and that the more polar intermediates or products are then repelled from the hydrophobic membrane surface. It is feasible, however, that oxygenation of certain (more fat-soluble?) substrates occurs within the membrane and that the conjugated polar product is repelled from the inside surface of the membrane. Evidence does exist for some type of an “assembly-line” process. In other words, a chemical may be metabolized sequentially by one or more Phase I enzymes and one or more Phase I1 enzymes-without the intermediate ever leaving the proximity of these membrane-bound moieties. Differences in benzo[a]pyrene metabolite ratios occur, for example, depending upon whether the nonmetabolized parent compound, or a hydroxylated metabolite, is introduced as the substrate to the intact microsomal membrane (Nemoto et aZ., 1978; Owens et al., 1979). Whether such differences also occur for more water-soluble drugs or other chemicals is presently not known. It is not known whether the P-450 molecules are arranged in rosettes (Pfeil et al., 1977) around a reductase molecule (as depicted in Fig. 1) or the reductase moves among randomly located P-450 molecules, like a ship moving through a sea of rocks or a bee moving among a cluster of flowers. The stoichiometry of P-450 molecules to reductase molecules ranges between 1O:l and 1OO:l (Estabrook et al., 1971; Sat0 and Omura, 1978; Mannering, 1980). It is entirely possible that one P-450 molecule is able to donate electrons directly to another
THE
Ah
LOCUS
7
P-450 molecule; the mitochondria1 oxidative phosphorylation chain is an example for such oxidation-reduction occurring among different cytochromes. P-450 may comprise between 3 and 12% of the total microsomal protein.
D. MULTIPLEFORMS OF P-450 In summary of the previous sections, therefore, the metabolism of thousands of foreign (and endogenous) chemicals by P-450 is rivaled in complexity perhaps only by the immune response to about one million unique antigens, and cognitive processes, in response to the thousands of unique sensory stimuli. The stimuli leading to monooxygenase induction likewise may be complex and may result in a large number of induced forms of P-450. It is common knowledge that many chemicals (e.g., ethanol, benzene, most tranquilizers, antiseizure medications, etc.) administered chronically will require increasing doses t o maintain the same “effect.” This phenomenon includes the mechanism of drug addiction and tolerance. It is also common knowledge that many chemicals administered chronically influence the effects of a second chemical. For example, cigarette smokers require several times more coffee to feel the same caffeine effect. The bones of children on chronic antiseizure medication may become osteoporotic (decreased calcium content due to changes in vitamin D metabolism caused by the drug). The egg shells of birds exposed chronically to various insecticides may become brittle, presumably due to the interference by these environmental chemicals in normal sex steroid metabolism. Conney’s extensive review 14 years ago (Conney, 1967) listed more than 200 drugs, carcinogens, other environmental chemicals-and even normal body steroids-that induce their own metabolism and/or that of other substrates via P-450 induction. More than five dozen inducers have now been described in sufficient detail to suggest that each may be inducing its own unique form of P-450 (Nebert et al., 1981). In other words, one or more of the 390 to 550 amino acids may be different so that substrate specificity (and perhaps even molecular weight) may be unique. It has been suggested (Nebert, 1979) that organisms possess the genetic capacity to synthesize as many new forms of P-450 as there are chemicals capable of being inducers. What makes one chemical a better inducer than another? Why are there differences among species? How is this induction process evoked, and what are the steps in the response? What
8
DANIEL
w.
NEBERT
et al.
is the significance of P-450 having overlapping substrate specificity? Some aspects of these questions can be answered by our recent investigation of the murine Ah locus. II. The Ah System
A. EARLYSTUDIES A far better understanding than ever before about the genetic control of P-450 induction resulted from the exciting discovery (Nebert and Bausserman, 1970; Nebert et al., 1971) that certain forms of inducible P-450 differ among inbred strains of mice. This heritable trait has been named the Ah locus. Wild mice and the majority of inbred strains are aromatic hydrocarbon “responsive,” meaning that new forms of P-450 (such as P,-450 and P-448) are easily induced by such polycyclic aromatic compounds as 3-methylcholanthrene, P-naphthoflavone, benzo[alpyrene, and 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Induced aryl hydrocarbon (benzo[alpyrene)hydroxylase (AHH) activity (Fig. 2) is regarded as an accurate assessment of the appearance of induced PI-450. C57BL/6 is the prototype strain (B6, responsive, Ahb). DBA/2 was the first mutant characterized (D2, nonresponsive, Ahd). BEN20 [a] PYRENE NADPH NADH Mg2+
DIHYDRODIOLS QUINONES POLYHYDROXY CONJUGATED COVALENTLY BOUND
1
02 MICROSOMES
PHENOLIC BENZO[a]PYRENE (3-HYDROXYBENZO[a] PYRENE) PRODUCTS
FIG. 2. Diagram of the assay for AHH activity. The substrate benzo[alpyrene is metabolized most specifically by P,-450 to various phenols; the 3- and 9-phenols have the strongest fluorescence. Other oxygenated products of benzo[alpyrene, such as dihydrodiols and quinones, are not measured by this assay (discussed further in Nebert and Jensen, 1979).
THE
Ah
LOCUS
9
If one looks at the origins of the older inbred strains of mice (Staats, 1966) and a list of Ah-nonresponsive strains (Kouri and Nebert, 19773, it appears that nonresponsive mutations have arisen independently at least three or four times between 1909 and 1950 in different parts of the world (DBA,Furth’s A and R stocks, European white mice, and SJL from Webster Swiss). PI-450and A H H activity in “nonresponsive” inbred strains (Fig. 3) can be induced by a dose of TCDD 12 to 18 times larger than that needed in responsive mice (Poland et al., 1974). This difference in sensitivity has been found for numerous induced monooxygenase activities in virtually every tissue of the mouse. The untreated control mouse has no detectable liver P,-450 (Negishi et al., 1981a). The Ahb/Ahdheterozygote is generally responsive, indicating that the trait of P,-450 and A H H induction is autosomal dominant (Fig.
p g TCDD/kg
FIG. 3. Dose-response curve for B6, D2, and B6D2F, mice (Niwa et al., 1975). Dose on the abscissa represents intraperitoneal TCDD; response on the ordinate represents liver microsomal AHH activity 48 hours later. Specific activity of AHH denotes units per mg of wet weight of liver; brackets represent standard error ( N = 6). Induced AHH activity predominantly reflects induced P,-450.Reproduced with permission from Academic Press.
10
DANIEL
w.
NEBERT
et al.
4). AKR/N and AKR/J strains are nonresponsive, and C57BL/6N and C57BW6J strains are responsive. The (C57BL/6N)(AKR/N)F1is Ahnonresponsive, however, whereas the F, derived from either B6 strain crossed with AKR/J and from either AKR strain crossed with C57BL/ 6J is Ah-responsive (Fig. 5 ) . Among F, progeny when certain responsive strains are the progenitors (Fig. 61, some mice are nonresponsive. Among F, progeny when certain nonresponsive strains are the progenitors (Fig. 7), some mice are responsive. Hence, it is clear that regulation of the PI-450 induction process is complicated. It has been estimated that the PI-450induction process must involve at least two
LIVER N=38 N=51 N=65
TREATED
N =46 N=55
N=50
1
0
CONTROL B6
A
600
1,200
I
,
1,800
2,400
1
I
N=20 N-22
D2
MCTREATED
3,000
B6 D2
N=32
F,
N=40
F, x B6
N=3
F,x
F, ~
D2
2
i ,
L,
I
N=61
, , . I , ,N=45
FIG. 4. Genetic variance in liver (top) and lung (bottom) AHH activity in control and 3-methylcholanthrene-treated(MC) offspring from appropriate crosses between B6 and D2 inbred strains (Kouri and Nebert, 1977). MC was given 24 hours before the AHH assay. The number of mice examined individually is given a t the right for each group. Reproduced with permission from the Cold Spring Harbor Laboratory Press.
THE
Ah
11
LOCUS
independent loci with at least three alleles each (Robinson et al., 1974). B. LINKAGE The Ah system is believed to comprise regulatory genes, structural genes, and probably temporal genes. This classification of genes has been introduced by Paigen and co-workers (Lusis and Paigen, 1977). The Ah locus has not been mapped, although chromosomes 8, 9, 17, and 19 are most suspect (C. Legraverend, D. W. Nebert, and P. Lalley, in preparation).” Whether all these genes even reside on a single chromosome is not known. Chromosome 17 is of particular interest, because this chromosome not only has the H-2 complex with its K , D,and L loci and the Ia antigens (which may be identical with the Ir immune-response product) (Klein, 1979) but also has the T locus. The T locus is a region of chromosome identified by sets of dominant and recessive mutations, some of which have profound effects on embryonic development, sperm production and function, and even genetic recombination with parts of the H-2 region; the T locus is responsible for surface antigens specific for early development, affecting also tail length, and has recessive lethal alleles present in wild populations at high frequencies (Bennett, 1975).
C. PLEIOTYPIC RESPONSE OF
THE
Ah Locus
The actions of a particular gene in more than one organ have been called “pleiotropic” (Plate, 1910) (pZei6n meaning “more, various, or several” and trope? meaning “turning, orientation toward, or changing response to external stimuli”). Pleiotropic gene action (Caspari, 1952) denotes morphologic and phenotypic changes occurring in multiple organs. We propose to use the more specific term “pleiotypic” (typikos meaning “distinctive features of any type”), when referring to discrete biochemically detectable changes such as those associated with the Ah system. Accordingly, we suggest that “pleiogenic” would be the best term for describing specific intranuclear interactions between genes in response to a stimulus. After certain chemicals (Fig. 8) bind avidly to a cytosolic receptor, the inducer-receptor complex is believed to translocate to the nucleus in a temperature-dependent step (Okey et al., 1979, 1980), and a pleiotypic response ensues. Induction-specific mRNA (Nebert and Gielen, 1971; Negishi and Nebert, 1981) and protein (Haugen et al., 1976) *The Ahballele appears to be linked with one major allele associated with resistance to audiogenic seizures (Seyfried et al., 1980).
12
DANIEL
w.
NEBERT
et al.
THE
Ah
LOCUS
13
are synthesized, leading to enhanced levels of numerous drug-metabolizing enzymes, most of which are membrane-bound. The function of these newly induced enzymes is to metabolize with increased efficiency (i.e., lower K , value and/or greater V,,,) the foreign chemical inducers; many other chemicals that are not good inducers also appear to be fortuitously metabolized. The result is a complex combination of enhanced detoxication and generation of dangerous reactive intermediates. Discussion of the formation of reactive intermediateswhich bind covalently to protein and nucleic acids and which have been shown to be associated with genetic differences in birth defects, drug toxicity, and cancer (Nebert and Jensen, 1979)-is beyond the scope of this article. D. REGULATIONBY
THE
Ah CYTOSOLIC RECEPTOR
A cytosolic receptor is regarded as the major product of the Ah regulatory genes. Sucrose density gradient analysis following dextrancharcoal treatment is among the most reliable methods (Okey et al., 1979) for characterizing the Ah receptor (Fig. 9). The apparent Kd for TCDD binding is about 0.7 nM, and approximately 5500 binding sites per cell (60 fmol/mg cytosolic protein) are found in C57BLi6N mouse liver (Table 1). A size of 6 S for both the cytosolic and nuclear receptor is estimated on sucrose density gradients in the presence of 0.4 M KCl (Okey et al., 1980). By means of gel permeation chromatography, past discrepancies between the dextran-charcoal adsorption and the sucrose density gradient assays have now been explained (Hannah et al., 1981). Nuclear translocation of the inducer-receptor complex requires a temperature-dependent step (Okey et al., 1980). All nonresponsive mutant inbred strains so far examined have no detectable A h receptor (Poland et al., 1976). It remains possible that these nonresponsive strains have as many as 100 “normal” receptor molecules per cell, because this number is not detectable in our assay. Alternatively, these strains may have larger numbers of receptor molecules per cell but with poorer affinity toward TCDD. FIG. 5. Genetic variance in 3-methylcholanthrene-inducible (MC) AHH activity in the liver microsomes of crosses between C57BL16 and AKR mice from NIH (N) or The Jackson Laboratory (J) (Robinson et al., 1974). In the C57BL/6N x AKRlN cross (top), the lack ofAHH induction is inherited as an autosomal dominant trait; in the other three crosses, in which at least one of the parents is derived from The Jackson Laboratory, AHH induction is inherited in an autosomal dominant fashion. MC was given 24 hours before the AHH assay. Reproduced with permission from American Society of Biological Chemists.
14
DANIEL
w.
NEBERT
et al.
SPECIFIC AHH ACTIVITY
FIG. 6 . Genetic variance in 3-methylcholanthrene-inducibleAHH activity in the liver rnicrosornes of crosses between B6 and C3H/HeN (C3) inbred strains. Although both parents and all F, are Ah-responsive, there is a small number of progeny from the backcrosses and F, x F, intercross that are Ah-nonresponsive.
There is a good structure-activity relationship between biological response (capacity of a chemical to induce P,-450) and the capacity of the chemical to displace f3H1TCDDfrom the Ah receptor (Okey et al., 1979). Phenobarbital, pregnenolone-l6a-~arbonitrile, and many other foreign chemicals that induce some form of P-450 (but not P,450) do not displace the radioligand from its receptor, even at 1000fold excess concentrations. Cholesterol, cholic acid, hematin, bilirubin, estradiol-17p, progesterone, dexamethasone, and countless other endogenous compounds-at 1000-fold excess concentrations-also do not displace VHITCDD from the Ah receptor. Presence of the Ahb allele also appears to correlate well with the temperature-dependent nuclear
THE
Ah
LOCUS
15
translocation of the inducer-receptor complex (Fig. 9). Recent data indicate that numerous diverse chemicals which induce monooxygenase activities to varying degrees also displace [3HlTCDD from the Ah receptor in an excellent structure-activity relationship (Bigelow and Nebert, 1981). It remains to be seen whether any heterogeneity exists in the sucrose density gradient peak which represents the Ah receptor. Does the TCDD-Ah receptor complex interact directly with DNA? The rat liver glucocorticoid receptor can be highly purified by a rapid two-step procedure using DNA-cellulose chromatography (Eisen and Glinsmann, 1976). First, the unheated glucocorticoid-receptor complex is separated from other cytosolic proteins that bind to DNAcellulose with high afEnity. Second, the heat-treated glucocorticoidreceptor complex is separated from other proteins with low affinity for DNA. This purification is not successful with the TCDD-Ah receptor complex (Hannah et d.,1981).If the inducer-Ah receptor interacts with DNA after translocating into the nucleus, therefore, unknown differences exist between the glucocorticoid and Ah receptors. Why should organisms possess a cytosolic receptor having very high avidity for only foreign polycyclic aromatic compounds? One possibility (Poland and Glover, 1980) is that we have an experimental situation similar to that with the opiate receptor, studied for years before the endogenous substance (endorphins) using this receptor was discovered. The other possibility is the organism’s need for such a receptor in order to ensure survival. Benzo[alpyrene, cholanthrenes, anthracenes, and halogenated dibenzo-p-dioxins are naturally occurring combustion products (forest fires, the burning of bituminous coal, etc.). From early in evolution, therefore, prokaryotes and lower eukaryotes might have used polycyclic hydrocarbons as an energy source and/or might have required enzymes to detoxify these chemicals. P-450-mediated metabolism of camphor in Pseudomonas and benzo[a]pyrene in yeast and insects has been well characterized (Sat0 and Omura, 1978; Kato, 1979; Mannering, 1980). Phylogenetically, plant terpenoids and other alkaloids and then the sophisticated steroid hormones of animals all occurred much later than bacterial or yeast P-450. The biosynthesis and degradation of these endogenous compounds require P-450-mediated reactions in many instances, and the presence of these compounds and related synthetic foreign chemicals are known to cause changes in P-450 levels. It is thus conceivable that steroid hormone receptors reflect mutated changes in the Ah receptor. Do plants possess alkaloid receptors? Does Pseudomonas possess a camphor receptor? Much more work will be required before we understand this fascinating subject.
16
DANIEL
w. NEBERT et al.
SPECIFIC AHH ACTIVITY
FIG. 7. Genetic variance in 3-methylcholanthrene-inducibleAHH activity in the liver microsomes of crosses between D2 and either (A) AKWN (AK,) or (B) AKWJ (AKJ inbred strains. Although all parents and all F, are nonresponsive, there is a small number of progeny from the backcrosses and/or F, x F, intercross that are Ahresponsive.
E. EVIDENCE FOR MULTIPLE STRUCTURAL GENEPRODUCTS 1 . Initial Studies As mentioned earlier, AHH is a P-450-mediated monooxygenase activity. Because the AHH fluorescent assay is relatively simple and extremely sensitive (Nebert, 19781, this assay using benzo[alpyrene as the substrate in uitro is most commonly used as the biochemical marker for the Ah locus in laboratory animal and human studies (Nebert, 1980). Constitutive AHH activity represents the fortuitous
THE
Ah
17
LOCUS
I
1
1
I
N =29
AKJ
I
D2
l
I
L
N =I4 1
I
I
N =26
AKJ
--F I I
I
N =I6
AKD2FI
N =26
1
4KDZ)AK
N =84
4KD2)D2
N =81 I
1
I
N =66 0
1000
2000
3000
4 30
SPECIFIC AHH ACTIVITY
FIG. 7B.
metabolism of benzo[a]pyrene by one or more forms of endogenous P450; this activity is preferentially inhibited by such chemicals as metyrapone. Polycyclic aromatic-induced AHH activity reflects newly induced cytochrome P1-450 (by arbitrary definition); this activity is preferentially inhibited by such chemicals as a-naphthoflavone (Nebert and Jensen, 1979) and is absent in control animals not exposed to any inducers (Negishi et al., 1981a). Some portion of induced AHH activity associated with the Ahb allele is mediated by one or more inducible forms other than PI-450.In all tissues of the nonresponsive mouse, Pl-450-associated AHH activity can be induced to levels similar to those found in tissues of the responsive mouse; the dose-response curve for TCDD in nonresponsive mice is simply shifted 12 to 18 times
18
DANIEL
w.
NEBERT
r
et al.
0 U T S ID E
7
Y
s
F~~ 10E
NUCLEUS UNKNOWN SITE IN NUCLEUS
CHEMICAL CARCINOGENS A N 0 OTHER ENVIRONMENTAL POLLUTANTS
RECEPTOR IN CVTOSOL
INOUCERRECEPTOR COMPLEX IN CYTOSOL
INDUCER-RECEPTOR COMPLEX IN NUCLEUS
N O W HAS
”RECEIVED”
INCORPORATlOh
PLElOTYPlC RESPONSE. TRANSCRIPTION OF INDUCTION SPECIFIC MESSENGER RNA’s
FORMATION INNOCUOUS PRODUCTS REACTIVE INTERMEDIATE
CRITICAL TARGET IN
OF INDUCTION SPECIFIC PROTEINS ICYTOCHROME P, 450)
1 OXlClTY
INTERMEDIATE TO CRITICAL TARGET
OF CANCER
FIG. 8. Diagram of a cell and the hypothetical scheme by which a cytosolic receptor, product of the regulatory Ah gene, binds to inducer (Nebert, 1979). Depending upon the half-life of the reactive intermediate, the rate of formation of the intermediate, and the rate of conjugation and other means to detoxify the intermediate-important covalent binding may occur in the same cell in which metabolism took place, or in some distant cell. Although the “unknown critical target” is illustrated here in the nucleus, there is presently no experimental evidence demonstrating unequivocally the subcellular location of a “critical targetb)” required for the initiation of drug toxicity or cancer or, for that matter, whether the “target” is nucleic acid or protein. Reproduced with permission from Dr. W. Junk Publishers.
1
THE
I
ALBUMIN
Ah
19
LOCUS
A
FIG.9. Genetic differences in the nuclear binding of [1,6-3H]2,3,7,8-tetrachlorodibenzo-p-dioxin ([3H]TCDD)in uiuo iOkey et al., 1979).(A) Nuclear extracts (approximately 5 mg protein per ml) from responsive B6 and nonresponsive D2 liver were treated with dextran-charcoal and then centrifuged on sucrose density gradients prepared in buffer containing 0.4 M KCl. B6 cytosol (labeled in uiuo, 15 mg protein per ml) was treated with dextran-charcoal and centrifuged as usual on a gradient prepared in buffer without KCl. (B) Hepatic nuclear extracts from a responsive Ahb/Ahdand a nonresponsive Ahd/Ahdindividual from the B6D2F, x D2 backcross. The extracts (6 mg protein per ml) following dextran-charcoal treatment were centrifuged on gradients prepared in buffer containing 0.4 M KCl. The B6 and D2 mouse had each received 2 pg of [3H]TCDD(approximately 0.3 pmol per kg body weight) and were killed 2 hours later. The backcross animals had each received 5 pg of ?H]TCDD (about 0.75 pmol per kg body weight) and were killed 3 hours later. These backcross mice had been phenotyped for the Ahb allele (Robinson and Nebert, 1974)more than 1 week earlier. Reproduced with permission from the American Society of Biological Chemists, Inc.
20
DANIEL
w. NEBERT et al.
TABLE 1 Concentration of Receptor in Hepatic Cytosol from Various Responsive and Nonresponsive Animals",'
Strain C57BLi6N C57BLi6J CBAIJ A/J C3HIHeJ DBA/2N DBAIPJ AKWJ SWRIJ RFIJ AhblAhd A hdlAhd Sprague-Dawley rat
Ah locus phenotype Responsive Responsive Responsive Responsive Responsive Nonresponsive Nonresponsive Nonresponsive Nonresponsive Nonresponsive Responsived Nonresponsived Responsive
(N)
(8)
(10) (p4) (p4) (p4) (6) (8)
(p4) (p4) (p4) (3) (3) (1)
Specific TCDD binding' fmollmg cytosol protein 60 f 12 34 2 16 20 16 12 Not detectable Not detectable Not detectable Not detectable Not detectable 35 2 5 Not detectable 33
Reproduced with permission from the American Society of Biological Chemists, Inc. by sucrose density gradient analysis following dextran-charcoal treatment with the use of 10 nM THITCDD 2 1000 nM nonlabeled TCDD (Okey et al., 1979). N represents the number of individual animals assayed; p4 indicates that cytosol from four mice was pooled and used in one assay. The means for C57BL/ 6N mice and C57BL/6J are significantly different ( p < 0.01 by t test). All animals were males 2 to 4 months old except RFIJ mice (females, 2 months old) and a Sprague-Dawley rat (female, 4 months old). 'Values are expressed as means 2 SD when three or more determinations were made separately. Weanlings from the B6D2F1 x D2 backcross were phenotyped at age 3 to 5 weeks by the zoxazolamine paralysis test, as previously described (Robinson and Nebert, 1974). More than 1 week later, these individuals were then assessed for hepatic cytosol receptor.
* Specific binding was measured
to the right (Fig. 3). For technical reasons, it is impossible to administer intraperitoneally to nonresponsive mice sufficient amounts of 3methylcholanthrene or benzo[alpyrene to induce AHH activity (Poland et al., 1974) or PI-450. Other inducers (e.g., phenobarbital and chlorpromazine) appear to increase forms of P-450distinct from P1-450, and AHH induction by these drugs occurs in certain species or tissues. Such induced AHH activity is therefore not associated with the Ahb allele; these other induced forms of P-450apparently metabolize benzo[alpyrene to some
THE
Ah
LOCUS
21
degree but are preferentially inhibited by metyrapone rather than anaphthoflavone (Nebert and Jensen, 1979). Certain chemicals that are present as contaminants in laboratory diets induce ,AHH activity in the intestine, liver, and lung (Legraverend et al., 19801, and this fact can lead to misinterpretation of data. In other words, responsive “control” animals on crude diets or “control” cells in culture may have partially induced, rather than true constitutive, AHH activity. The natural tendency of outbred and randombred populations (Fig. 10) is to be Ah-responsive, and this skewed-to-the-left type of distribution has been seen for outbred or randombred mice, rats, rabbits, guinea pigs, hamsters, as well as among various human populations. C3H, and especially B6, inbred mouse strains thus might be viewed as possessing abnormally high levels of induced AHH activity. When males and females of four inbred strains (Fig. 10) were housed together and allowed t o breed randomly for 46 to 48 months, the AHH inducibility by 3-methylcholanthrene of weanlings between 18 and 22 generations approximated the distribution found normally for outbred or randombred mouse strains (Nebert and Atlas, 1978). These data indicate the involvement of multiple Ah regulatory genes and a “natural selection” tendency of the induction process to “drift” toward lower intensity in populations having heterogeneous genetic input. Polycyclic aromatic-induced AHH activity represents one of at least two dozen polycyclic aromatic-induced P-450-mediated monooxygenase “activities.” The induction of two other metabolically coordinated activities also appears to be associated with the Ahb allele: UDP glucuronosyltransferase (a microsomal Phase I1 enzyme with 4-methylumbelliferone as substrate) and reduced NAD(P):menadione oxidoreductase (a cytosolic enzyme which can reduce benzo[alpyrene quinones). Ornithine decarboxylase induction by polycyclic aromatic compounds is also correlated closely with the Ahb allele (Nebert et al., 1980). Numerous P-450-mediated monooxygenase activities and other metabolically coordinated activities, NADPH-cytochrome c reductase, NADPH-P-450 reductase, epoxide hydrolase, and glutathione transferase are not associated with the Ahb allele (Nebert and Jensen, 1979). 2. How Many Inducible Forms of P-450Are Associated with the Ahb Allele? The polycyclic aromatic-inducible monooxygenase activities associated with the Ahballele include C-hydroxylations of benzo[alpyrene, zoxazolamine, biphenyl, acetanilide, naphthalene, aflatoxin B,, and
DANIEL
w. NEBERT et al.
OUTBRED or RANDOMBRED -
-
INBRED
LOw
-
I
INDUCIBLE AHH ACTIVITY
HIGH
FIG. 10. Distribution of liver microsomal AHH activity from outbred or randombred populations (top) and from four inbred mouse strains (bottom). All mice have been pretreated with 3-methylcholanthrene. DBA/2N (D2) and AKWN are Ah-nonresponsive, although control AHH activity in AKR is at least twice as high as that in D2 mice; a t the highest possible doses of 3-methylcholanthrene, no P,-450-associated AHH activity is detectable in D2 and AKR mice. C3H/HeN (C3H) and C57BL16N (B6) are Ah-responsive. Outbred or randombred animals have control AHH levels similar to those in D2 mice, so that 3-methylcholanthrene-treatedanimals have AHH activities induced 2- to 4-fold and are thus regarded as Ah-responsive (Nebert and Atlas, 1978).
theophylline; 0-deethylations of 7-ethoxycoumarin, phenacetin, and ethoxyresorufin; 0-demethylation of p-nitroanisole; N-demethylations of 3-methyl-4-methylaminoazobenzeneand theophylline; and as yet undetermined oxygenations of p-naphthoflavone, a-naphthoflavone, ellipticine, lindane, niridazole, caffeine, and theobromine (Nebert and Jensen, 1979).These substrates are highly variable in size and shape, and the question was therefore raised long ago (Nebert et al., 1973) whether these induced activities represent the relatively nonspecific metabolism by a single form of polycyclic aromatic-induced P-450or more specific metabolism by a whole family of individual enzymes. With the use of two detergents and two column chromatographic
THE
Ah
LOCUS
23
steps, P-450 from 3-methylcholanthrene-treatedB6 liver microsomes was recently separated into 16 fractions, and many reconstituted monooxygenase activities were studied (Lang and Nebert, 1981). By two-factor analysis of variance, it was concluded that the data can be explained statistically by a minimum of 19 different groups of “activities”: 12 induced by 3-methylcholanthrene and seven control (endogenous) forms. Overlapping substrate specificities cannot be detected in a study of this kind; it is thus possible that this conclusion of 19 distinct activity groups may be a slight overestimate, but it is also possible that this conclusion is a large underestimate. 3. Large mRNA Associated with 3-Methylcholanthrene-Induced Pi -450 An antibody to mouse liver PI-450 has been developed in goat; this antibody effectively inhibits 3-methylcholanthrene-inducedAHH activity much better than control AHH activity (Negishi and Nebert, 1979). With the reticulocyte lysate system in uitro, total translation products and translated products immunoprecipitated by antibodies to P,-450 and mouse serum albumin were recently examined (Negishi and Nebert, 1981). As expected, the anti-PI-450-immunoprecipitated translation product in 3-methylcholanthrene-treatedB6 mice is present in more than 10 times the concentration found in 3-methylcholanthrene-treated D2 mice or control B6 and D2 mice. Sucrose density gradient centrifugations under nondenaturing conditions yield an 18 S mRNA associated with the translation of preproalbumin (M,= 71,000) and a 22 S to 23 S mRNA associated with translation of P,-450 (M,= 55,000). Under denaturing conditions on a 1%agarose gel, preproalbumin mRNA is estimated to be 21 S, and two PI-450 mRNA forms are seen-one slightly smaller than 21 S, the other slightly larger than 23 S (Negishi and Nebert, 1981). These two mRNA species correspond to about 2700 and 3500 nucleotides, respectively, yet only 1500 nucleotides are required for translation into a 55,000-dalton subunit. This unexpectedly large size of PI-450 mRNA is another in a growing list of examples (Table 2) of this observation, i.e., that many nucleotides of mRNA species are “silent” and therefore unaccounted for in the final translation product. These silent regions represent areas in addition to the polyadenylated tail at the 3’ end. Why there are such large amounts of nontranslated 5’and especially 3’-regions of mRNA is presently unknown. These large silent regions of mRNA exist not only in systems needing much diversity (such as immunoglobulins and the H-2 glycoproteins) but also
TABLE 2 Comparison of Observed and Expected Numbers of Nucleotides for mRNA Species Coding for Various Proteins"
N
Protein
A
M, of protein
Number of amino acids
Expected number of mRNA nucleotides
Observed number of mRNA nucleotides
Observed S value for mRNA
P-Globin
16,000
145
435
1310
15 S
Crystallin a B Crystallin aA, Immunoglobulin light chain
22,000 19,000 22,500
200 173 204
600 519 612
533 1130 1130
10 s 14 S 14 S
Ovalbumin
43,000
390
1170
1740
17 S
200,000 71,000
1820 645
5460 1940
6130 1740
30 S 17 S
Vitellogenin Rat or mouse preproalbumin
References Chantrenne et al. (1967); Tilghman et al. (1978) Berns et al. (1971) Mathews et al. (1972) Diggelmann et al. (1973) Shapiro and Schimke (1975); Woo et al. (1975) Shapiro et al. (1976) Strair et al. (1977); Brown and Papaconstantinou (1979)
EpidermaVactin Prepro-al collagen
58,000 56,000 52,000 50,000 46,000 42,000 190.000
542 523 486 468 430 393 1800
1630 1570 1460 1400 1290 1180 5400
Prepro-a2 collagen
150,000
1360
4100
Fibronectin
220,000 45,000 44,500 55,000
2000 409 404 500
6000 1230 1210 1500
Keratin
H-2 glycoproteins PI-450 N
u1
2200 2200 1650 1650 1700 1850 7100 5000 5700 5200 8800 1740
19 s 19 s 16.5 S 16.5 S 17 S 17.5 S 32 S 27 S 29 S 28 S 36 S 17 S
3500 2700
23 S 21 s
Fuchs and Green (1979)
Fuchs and Green (1979) Adams et al. (1979); Upholt et al. (1979) Fagen et al. (1979) J a y et al. (1979) Negishi and Nebert (1981)
a All of these values must be considered approximate, because they depend upon crude estimations of M , by gel electrophoresis and mRNA size by various indirect methods of measurement.
26
DANIEL
w.
NEBERT
et al.
in systems where one would anticipate stability, or no need for diversity (such as p-globin, crystallin aA,, and epidermal/actin). The reason for at least two PI-450mRNA forms is also not clear (Negishi and Nebert, 1981). The larger P,-450mRNA (about 3500 nucleotides) is in fact large enough to be bicistronic. More than one mRNA, however, was recently shown to be associated with H4 histone in HeLa S, cells (Lichtler et al., 1980). At least two mRNA species differing at their 3’ ends direct the synthesis of secreted and membrane-bound immunoglobulin heavy chains (Alt et al., 1980; Rogers et al., 19801, and these two mRNA forms are produced by alternative processing pathways (Early et al., 1980b). Seven mRNA species differing a t their 3‘ ends are associated with the gene amplification of dihydrofolate reductase (Setzer et al., 1980). The meaning of these very recent results will require further work. In any event, these data with P,-450mRNA are an important prelude to the recombinant DNA studies currently in progress in this laboratory. 4 . Studies from Other Laboratories
It should be emphasized that most scientists working on the purification of multiple forms of P-450include oxidation-reduction biochemists, pharmacologists, and enzymologists. Most commonly, phenobarbital, 3-methylcholanthrene, p-naphthoflavone, or TCDD have been used as the inducers in rabbits or rats (Guengerich, 1978; Agosin et al., 1979; Koop and Coon, 1979; Ryan et al., 1979; Warner and Neims, 1979; West et al., 1979; Johnson, 1980; Taniguchi et al., 1980). Until the present time, the general consensus among most laboratories has been that two, three, or six forms of P-450exist and that overlapping substrate specificity accounts for all diversity seen when thousands of different chemicals are metabolized by this monooxygenase system. Because of the exceedingly difficult problem of purification of membrane-bound proteins to absolute homogeneity, one possible answer to how many forms of P-450exist will be derived from nucleotide sequencing of the appropriate genes.
F. SUGGESTIVE EVIDENCE FOR TEMPORAL GENES The usual absorption peak of aggregate P-450is about 450 nm, as discussed earlier. From column chromatographic steps one can separate individual cytochromes having spectral maxima of 448 nm or even lower (i.e., peaks shifted toward the blue end of the optical spectrum). This laboratory has arbitrarily defined “cytochrome P-448” as that form of polycyclic aromatic-inducible P-450having a Soret
THE
Ah
LOCUS
27
peak maximally shifted to the blue when reduced and combined with carbon monoxide. Developmental data (Atlas et al., 1975, 1977) first suggested that hepatic P-448and PI-450 were different. In 3-methylcholanthrene-treated rabbit liver, PI-450 and its associated AHH activity are induced in the fetus and newborn but are not induced beyond 15 days postpartum for the remainder of adult life; P-448is not inducible in the neonate, becomes inducible beyond day 10 postpartum, and remains inducible for the remainder of adult life (Atlas et al., 1977). In polycyclic aromatic-treated rat and mouse liver (Guenthner and Nebert, 19781, PI-450and its associated AHH activity are induced earlier during gestation than P-448,and both cytochromes remain inducible for the remainder of adult life. Recently, antibodies to mouse liver P1-450and P-448have confirmed directly the developmental data described above for mouse liver (Negishi and Nebert, 1979). It is therefore not surprising that hepatic “P-448”in adult rat, for example, appears to be different from hepatic “P-448”in adult rabbit (Kawalek et al., 1977) and that metabolism of benzo[alpyrene by LM, or any other form of liver P-450from adult rabbit (Deutsch et al., 1978) is very limited. The neonatal and adult rabbit liver data are most interesting, because the Ah receptor is detectable at both ages (Kahl et al., 1980)but not P-448is inducible in the newborn, and P-448but yet P1-450 not P1-450is inducible in the adult. Some type of temporal control therefore must be operating, in order to explain these developmental findings. Whether one or more temporal genes exist is not known. In view of the apparent presence of adequate Ah receptor, most likely this temporal control affects the expression of structural gene products (i.e., transcription of mRNA for these enzyme proteins) rather than regulatory gene products; further studies, however, are clearly necessary in order to understand this interesting developmental system. 111. The Various Means by Which Organisms Cope with Environmental Adversity
A. RAPIDRESPONSES TO AN ADVERSE ENVIRONMENT If any organism is exposed suddenly to a potentially lethal foreign substance, a rapid response (within minutes, hours, or days) of some “defense system” is needed to ensure survival (Nebert, 1979). Specific examples of such rapid responses to new environmental dangers are listed in Table 3. Several of these systems appear to respond to a
28
DANIEL
w.NEBERT et al.
TABLE 3 Examples of Rapid Responses of Organisms in Order to Cope with Sudden Environmental Adversity ~
Example Antibiotic resistance, mercury resistance, among plasmids Phytoalexins and “stress metabolites” among plants Chemical weapons against predation among insects Interferon production among animal cells Resistance to heavy metals by metallothionein induction in many mammalian tissues Development of tolerance to the mushroom poison phalloidin Adaptability of cultured cells to “selective pressures” Actinomycin D resistance Barbiturate resistance Methotrexate resistance Lead resistance Synthesis of major histocompatibility antibodies Synthesis of immunoglobulins, the “immune response” Induction of multiple forms of drug-metabolizing enzymes [Drug dependence of all types; insecticide resistance] Cytochromes P-450 UDP glucuronosyltransferases; other enzymes
~~
References Chakrabarty (1976); Chakrabarty et al. (1978) KuC and Currier (1976) Eisner et al. (1980) Baron and Dianzani (1977) Panemangalore and Brady (1978); Rudd and Herschman (1979) Floersheim (1976)
Simard and Cassingena (1969) Roth-Schechter and Mandel (1976) Schimke et al. (1978); Kaufman et al. (1979) Lake et al. (1980) Klein (1979) Putnam et al. (1972); Edelman (1973); Potter (1977) Nebert (1979); Mannering (1981)
much larger array of adversities than the others: synthesis of the histocompatibility antibodies is the response to more than lo3 tissuespecific antigens, synthesis of immunoglobulins is the response to about lo6 antigens, and synthesis of multiple forms of drug-metabolizing enzymes is the response to an as-yet-unknown number of distinct inducing chemicals. If some industrial company deposited into the river a new chemical synthesized on this planet for the first time this year, however, it would be comforting to know that humans and other organisms have the genetic capacity to recognize this new chemical and to develop the necessary forms of enzymes for efficient detoxication.
THE
Ah
29
LOCUS
B. DIVERSITY IN THE ORGANISM THATMAY PLAY A ROLE IN THESERESPONSES Some unexpected observations during the past 4 years in the field of molecular biology have shed new light on the degrees of freedom present in DNA and even RNA. In Table 4 are listed the possible mechanisms that might aid an organism in coping with its adverse environment. 1 . Gene Amplification The selective amplification of dihydrofolate reductase genes in methotrexate-resistant variants of mouse tumor cells in culture (Schimke et al., 1978) is a recent example of eukaryote cells under extreme selective pressure. This form of drug resistance involves gene amplification in “double minute” chromosomes (Kaufman et al., 1979). The TABLE 4 Genetic Mechanisms Now Believed to Aid in an Organism’s Response to Environmental Adversity Mechanisms 1. DNA insertion sequences a. Maize “controlling elements” b. Mutations in bacteria c. Plasmid “transposons” or “jumping genes” d. Mating-type mutations in yeast
e. Mating-type mutations in the plant Antirrhinum f. Indirect evidence in Drosophila 2 . Gene amplification a. Enlarged chromosomes b. “Double-minute” chromosomes 3. Variation in the frameshift read-out (bacteriophage +x174) 4. High-frequency intragenic recombination 5. Intervening sequences a. Rearrangement of DNA b. RNA polymerase skipping to selected regions c. Joining together of separately transcribed pieces of RNA d. Posttranscriptional processing of mRNA precursor molecule
References Bukhari et al. (1977) McClintock (1955) Heffron et al. (1975) Beck (1979) Egel (1976); Hicks and Herskowitz (1977) Fincham and Sastry (1974) Cech and Hearst (1975) Schirnke et al. (1978); Kaufman et al. (1979) Sanger et al. (1977); Pollock et al. (1978) Early et al. (1980a); Perry et al. (1980) Crick (1979); Kolata (1980)
30
DANIEL
w.
NEBERT
et al.
mechanism is believed to involve an as-yet-unknown type of replication of double-stranded DNA and may help explain the existence of plasmids, multigene families (such as P-4501, gene shuffling (of particular importance for maintenance of viability in self-fertilizing organisms), drug resistance, and perhaps many other developmental and compensatory amplifications. 2 . Intragenic Recombination Immunoglobulin diversity is greatly enhanced by the combination of unique segments of the variable (V) region, joining (J)region, and diversity (D) region [residing between the J region and constant (C) region (Early et al., 1980a)l. By intragenic recombination, it now appears that embryonic mouse DNA has the genetic capacity to respond to all possible antigens on earth. Evolution apparently has generated by gene duplication, segregation, and allelic exclusion a large number of “mini-genes,” creating many small subgroups of closely homologous, yet extensively heterologous, gene segments. These segments afford large “targets” for intragenic recombination within each subgroup. Such recombination can, in turn, lead to immunoglobulin diversity in both gene number and sequence by unequal crossing-over, direct recombination, and mismatch repair. Such a postulated mechanism (Brack et al., 1978; Seidman et al., 1978) requires no ad hoc assumptions about special enzymes and can operate in both germ line and somatic cells. If this hypothesis is true, the immune repertoire would be protected from catastrophic gene loss by segregation of homology within these small intragenic recombining sets. 3. The H-2 Complex Another genetic polymorphism, the major histocompatibility complex (Klein, 19791, deserves mention because intragenic recombination is most likely also involved. The H-2 complex was mapped relatively long ago (in the middle portion of chromosome 17 in the mouse), compared with the immunoglobulin system that only recently has been mapped on at least 3 different chromosomes (Meo et al., 1980; Eicher et al., 1979). Perhaps because of this fact, distances between loci within the major histocompatibility complex have been studied in great detail. It now appears that diversity of the major histocompatibility complex may rival that of the immunoglobulin system. In total, 56 alleles a t the H-2K locus and 45 alleles at the H-2D locus have been so far discovered in the house mouse. This number of alleles at the two loci can occur in 2500 combinations, and indications are
THE
Ah
LOCUS
31
that most of these combinations do exist among wild mice. Considering the high degree of H-2 heterozygosity and the fact that there are many more loci within the H-2 complex (such as the H-2L locus and genes encoding for the Ia antigens (Uhr et al., 19791, which may be products of the immune-response [Irl genes), the variability at this complex is extraordinary in natural populations. Why has such H-2 polymorphism evolved? If there were none, all individuals in a given species would carry the same repertoire of Tcell receptors. Consequently, the entire species would be defenseless to any antigen carried by some pathogenic organism, and the very existence of the species would be endangered. H-2 polymorphism prevents the occurrence of such a catastrophe. Therefore, H-2 polymorphism provides a means of generating diversity in the immune response at the population level, in addition to generating diversity at the cellular level within an individual (Klein, 1979). 4 . Intervening Sequences
Possible mechanisms by which intervening sequences are made have been recently reviewed (Crick, 1979), and at least two distinct mechanisms are known to occur experimentally: (a) DNA producing the message for the light chain of immunoglobulin is rearranged to displace or eliminate the sequences not needed (the DNA in the germ line remains unaltered); (b) RNA polymerase makes a primary transcript of the whole region, and this transcript is processed so that all introns are removed while the remaining “exons” are all joined together in the correct order. This latter mechanism seems to occur in the majority of known cases and has been termed “splicing.” Why should intervening sequences exist, and why should they not have been deleted by the pressures of evolution? A case has been made (Darnell, 1978) that intervening sequences might be viewed as evidence for eukaryotes evolving independently of prokaryotes. One possible function of the intervening sequences is that these DNA segments provide stability to the gene, minimizing the frequency of crossovers between two homologous regions of DNA. Another possible function, however, is to offer the greatest degree of freedom t o the organism, i.e., to facilitate recombination and to keep the genome in a constant flux of producing successful, and not so successful, gene products. The r e s u l t d u r i n g evolution of genetic information as well as during sudden, extreme selective pressures-would enable the organism to cope at all times most successfully with environmental adversity.
32
DANIEL
w.
NEBERT
et al.
IV. Comparison of the Ah System with the Immunoglobulin System
There obviously are many distinct differences between the P-450 system and the immune system. Yet, there exist a number of interesting similarities that are worthy of noting.
A. INITIATION OF PROGRAMMING IN THE “CONTROL” ANIMAL Both the immune system and the P-450 system are somewhat similar in the “control” unexposed individual, in that each system is differentiated to recognize toxic or foreign substances. Minute amounts (pglkg doses) of numerous antigens and environmental agents inhaled or ingested may induce distinct immunoglobulins and may induce forms of P-450, respectively. Whereas both systems appear to recognize small chemical determinants, the specificity in the recognition process differs. In the immune system, low-molecular-weight components (called haptens) of macromolecules are recognized by B and T lymphocytes carrying specific membrane-bound receptors (“B” reflects bone marrow-derived and “T” reflects thymus-derived lymphocytes). In the P-450 induction system, what is known today only concerns the Ah locus: the low-molecular-weight chemical enters the cell to be recognized by means of avid binding t o the cytosolic receptor. With the immune system, there is believed to be a stem-cell precursor capable of differentiating (in small numbers of cells) into many thousands of B-lymphocyte clones each possessing a distinct immunoglobulin-plasma membrane receptor. Each clone is committed to production of immunoglobulin with the same V,-VH pair, and this “programming” is irreversible. The initial receptor in the T-lymphocyte for the antigenic signal has not yet been elucidated. One possibility is that the receptor on the T-lymphocyte series is the same as the immunoglobulin product ultimately formed by plasma cells. The nature of the T-lymphocyte receptor is still debated (Potter, 1977). With the P-450 system, one might describe all P-450-containing cells as being pluripotent like the precursor lymphatic stem cell. Sex steroid “imprinting” experiments (Gustafsson et al., 1977) suggest that P-450 “programming” might, in some cases, be irreversible. P450 induction by one or another drug, followed by decreases to basal P-450 levels when the compound is removed, can be repeatedly evoked within the same tissue and probably within the same cell. There does not seem to be a more rapid response of P-450 induction, however, following repeated exposures to the same inducer. Perhaps the de-
THE
Ah
LOCUS
33
velopment of immunological tolerance might be viewed as a process similar to P-450-mediated steroid metabolism imprinting (Gustafsson et ul., 1977) or to the temporal expression of certain inducible forms of P-450 (Atlas et al., 1977; Guenthner and Nebert, 1978).
B. PHYLOGENETIC EXPRESSION The earliest appearance of the immune response, in terms of evolution, is in the phylum Chordutu, with the possible exception of sponges and corals (Hildemann et al., 1979) which can self-recognize and set up cytotoxic T-like attacks on nonself cells. The immune response is not seen in more primitive organisms, probably because such a complex phenomenon is advantageous only to organisms having highly organized tissues in need of circulating cells secreting extracellular defense molecules. On the other hand, phylogenetic expression of P-450 induction occurs much earlier, because of the need for intracellular defense molecules even in unicellular organisms. Relevant reports include evidence for inducible P-450 in bacteria, bacteroids, parasites, fungi, many higher plants, insects, reptiles, and fish, as well as in all higher organisms (Sato and Omura, 1978; Cerniglia and Gibson, 1979; Kato, 1979). Hence, it appears that all living things in need of a mechanism for metabolizing a hydrocarbon as an energy source, or for detoxifying a noxious chemical, require the P-450 induction process to serve this function. It is known that some plasmid genes control the induction of bacterial P-450; for example, camphorinduced bacterial P-450 involved with the hydroxylation of octane is plasmid-borne (Chakrabarty, 1976; Chakrabarty et al., 1978). P-450 is therefore phylogenetically a very old hemoprotein. Of interest, the middle “exon” in globin codes for that part of the polypeptide chain which embraces the heme group (the “heme pocket”) and could well have originated from a hemoprotein that had evolved much earlier in evolution (Crick, 1979). C. CLINICAL DISEASE Theories of cancer etiology include aberrancies of the immune system and involvement of the P-450 system. The etiology of environmental carcinogenesis includes the possible importance of P-450-mediated metabolism of chemicals to their ultimate carcinogenic forms that bind covalently to DNA or otherwise damage DNA (Miller and Miller, 1979; Nebert and Jensen, 1979). It is also interesting to speculate that autoimmune disease, as well as forms of P-450-mediated
34
DANIEL w . NEBERT
et al.
drug toxicity, may be examples in which the body cannot distinguish between what is beneficial and what is detrimental in dealing with an antigen or a xenobiotic.
D. RECIPROCAL RELATIONSHIP BETWEEN THE P-450 AND IMMUNESYSTEMS Administration of nonspecific immunostimulators suppress P-450mediated monooxygenase activities, and the administration of certain monooxygenase inducers has been shown to cause immunosuppression. Such nonspecific immunostimulators include stable heat-killed suspensions of Corynebacterium paruum, BCG vaccine, interferonstimulating agents, and other antitumor bacterial preparations (Mannering et al., 1980). Indomethacin, a potent antiinflammatory agent that inhibits prostaglandin synthesis (Flower, 19741, suppresses all monooxygenase activities tested (Vukoson et al., 1978). Monooxygenase inducers as immunosuppressants include phenobarbital (Park and Brody, 19711, p,p’-DDT (Askari and Gabliks, 1973; Gabliks et al., 1973), the very potent TCDD (Vos and Moore, 1974), benzene (Snyder and Kocsis, 19751, 3-methylcholanthrene (Levy et al., 19771, polybrominated biphenyls (Bekesi et al., 1978; Fraker, 19801, and polychlorinated biphenyls (Yoshimura et al., 1979). The reason for this interesting reciprocal response of the P-450 system, compared with the immune system, when challenged with many types of stimuli, is not yet understood.
E. OVERLAPPING SPECIFICITIES Although one antigen binds to a specific antibody with a high affinity (e.g., an apparent K, of 0.1 FM), other antigens will still bind but with one to three orders of magnitude poorer affinity. Similarly, one antigen may stimulate principally the synthesis of one specific immunoglobulin (Fig. 11)but also stimulates several dozen other antibodies with lesser degrees of specificity (reuiewed in Putnam et al., 1972; Edelman, 1973; Porter, 1973; Potter, 1977). Whether this lack of a strong “biological damper” is accidental or purposeful is not known. It would be advantageous to the organism, however, if some existing form(s) of antibody immediately interacted with a challenging antigen to some degree, until a more specific antibody became available. With regard to the P-450 system this same type of phenomenon would also be advantageous to the organism. If existing form(s) of endogenous (or induced) P-450 immediately began to metabolize-to
THE
Ah
35
LOCUS
Activation of Structural Genes in
Most specific
FIG. 11. Diagram of the immune response. Following binding of antigen, to a (presently not characterized or understood) surface receptor on a T cell, a signal is transmitted to B cells, activating structural genes. In addition to the most specific synthesis of a n antibody (Ab,) which binds most specifically to antigen, (Ag,), there is a stimulation of other B lymphocyte clones to synthesize other antigens (Ab,, Ab,, etc.). Although Ab,, for example, interacts most avidly with Ag,, Ab3 may bind five times less avidly to Ag, and 50 times less avidly to Ag,. The reason for this nonspecific enhancement of antibodies other than Ab, in response to the stimulus by Ag, is not known.
some degree-any challenging toxic chemical until a more specific P450 became available, such a mechanism would aid in survival. Numerous substrates for P-450are metabolized most efficiently by one form of P-450but are metabolized by numerous other forms of P-450 at a rate of 2 to 100 times less (Thomas et al., 1976; Guengerich, 1977). There is similarly a range of polycyclic aromatic inducers which interact with the Ah locus receptor. Though there is a n excellent structure-activity relationship between the shape of the molecule and
36
DANIEL
w.
NEBERT
et al.
the capacity to induce AHH activity (Poland and Glover, 1975, 19771, there is also a 100 to 1000-fold difference in inducer concentrations that are able to displace the most avid inducer from the cytosolic binding site (Poland et al., 1976; Okey et al., 1979). Hence, overlapping specificities exist, both in terms of inducers interacting with one or more receptors and substrates interacting with numerous forms of P-450. The picture that has begun to emerge for the Ah system is illustrated in Figs. 12 and 13; we cannot presently distinguish between these two hypothetical models. Perhaps that form of P-450 most induced is the most efficient form for metabolizing the inducer: e.g., benzo[alpyrene induces benzo[alpyrene monooxygenation (Conney, 1967); phenytoin induces its own metabolism (Gerber and Arnold, 1969); benzene induces benzene metabolism (Gonasun et al., 1973); camphor induces P-450,,, in bacteria (Tanaka et al., 1976); ethanol induces its own metabolism (Ohnishi and Lieber, 1977); 2-acetylaminofluorene induces its own metabolism (Lambotte-Vandepaer et al., 1979), etc. Conney’s review (1967) contained a list of 18 drugs known to stimulate their own metabolism. This phenomenon may involve (Fig. 12) a single receptor for benzo[alpyrene, for example, with the “biological noise” occurring among structural genes where other products (besides P,-450) are synthesized. Alternatively, this phenomenon may involve (Fig. 13) a very accommodating “recognition center” in which benzo[alpyrene, for example, binds most specifically to one receptor but also interacts (with varying, but lesser, affinities) with other receptors. Among Hepa-1 cultures having AHH induction by both 3-methylcholanthrene and benzo[alanthracene, there was found a Hepa-1 mutant clone of cultured mouse hepatoma cells that had lost its AHH inducibility by 3-methylcholanthrene while retaining AHH inducibility by benzo[a]anthracene (I. S. Owens and D. W. Nebert, unpublished data, 1974).* Similar findings with mouse C3H/lOT;CL8 fibroblast cultures were recently reported (Gephly et al., 1979). These data support the possibility of heterogeneous receptors-each binding most specifically to a certain inducer associated with the Ah locus but capable of interacting to varying degrees of specificity with other inducers such as TCDD. The resultant induction of at least two dozen monooxygenase activities associated with the Ah system is the same by either model proposed. The main difficulty in accepting the latter hypothesis is the *Unfortunately, this clone was inadvertently lost in 1976.
THE
Ah
BENZOIalPYRENE
37
LOCUS
Most specific
synthesis
BP 7.8-oxide ACETANILIDE
I
4-HYDROXYACETANILIDE
I
2-ACETYLAMINOFLUORENE
N -HYDROXY-2-ACETYLAMINOFLUORENE 7-ETHOXYCOUMARIN
I I I I
A
THEOPHY LLlNE
I I I
1.3-DIMETHYLURIC ACID
I I
7-HYDROXYCOUMARIN
FIG. 12. Hypothetical scheme of the inducer benzo[a]pyrene (BP) stimulating the induction of drug-metabolizing enzymes (multiple structural gene products). BP binds to receptor, (in a mouse hepatocyte, for example) and structural genes (presumably in the same hepatocyte) are activated. Whereas one form of P-450 (P,-450)is induced most specifically and binds with greatest affinity to BP, other forms of P-450 (P,-450, Pg450, P,-450, P,-450, . . . P,-450) are also (accidentally?) turned on. Although some other substrate (e.g., acetanilide) binds most specifically to (and is metabolized most specifically by) P,-450, there is some degree of overlapping specificity between benzol alpyrene and acetanilide, etc. Whether temporal control occurs a t the level of the regulatory gene product (i.e., the cytosolic receptor) or a t the level of the structural gene products remains to be determined. All the inducible monooxygenase “activities” shown here are among the approximately two dozen activities known (Nebert and Jensen, 1979) to be associated with the Ah locus.
38
DANIEL
w.NEBERT et al.
mw
BENZOlalPYRENE
BP 7.8-oxide ACETANILIDE 4-HY DROXYACETANILIDE 2-ACETYLAMINOFLUORENE N -HYDROXY-2-ACETYLAMINOFLUORENE 7-ETHOXYCOUMARIN 7-HYDROXYCOUMARIN THEOPHYLLINE 1.3-DIMETHY LURlC ACID ETC. OXYGENATED PRODUCT
FIG, 13. Hypothetical scheme of the inducer benzo[a]pyrene (BP) stimulating the induction of drug-metabolizing enzymes via multiple regulatory gene products. BP binds most specifically to cytosolic receptor, (in a mouse hepatocyte, for example) and the specific structural gene for P,-450 is turned on, resulting in induction of the most specific form of cytochrome for metabolizing the inducer benzo[alpyrene. Whereas BP binds with greatest affinity to receptor,, BP also binds with less affinity to receptor,, receptor,, receptor,, receptor,, . . . receptor,, and each of these inducer-receptor complexes activates its own form of P-450 having its own most specific substrate. Again, although some other substrate (e.g., acetanilide) binds most specifically to (and is most specifically metabolized by) P,-450, there is some degree of overlapping substrate specificity between benzo[a]pyrene and acetanilide, etc. Whether temporal control occurs a t the level of the regulatory gene products (i.e., these cytosolic receptors) or at the level of the structural gene products is unknown.
improbable idea that an almost infinite number of receptors exists for all possible xenobiotics. But, then, this problem is similar to that of the T-lymphocyte receptor. Why are some chemicals much more effective inducers of P-450 than others? The answer is presently not known. TCDD induces its own metabolism, although the amount of metabolism is minute (Guenthner et al., 1979). Perhaps this extreme resistance to metabolism is an important factor in explaining the striking potency of TCDD as an inducing agent (Poland et al., 1974; Poland and Glover, 1975).
THE
Ah
LOCUS
39
With the immune response, however, the same question can be posed: why are some molecules much more antigenic than others? There are additional data in support of the pleiotypic response models presented in Figs. 12 and 13. Various drugs “cross-stimulate,” and thereby enhance, hepatic steroid metabolism (Conney and Klutch, 1963; Skett et al., 1979). Indeed, as described above (and reviewed in Conney, 19671, hundreds of publications now include observations that treatment with one drug affects (fortuitously?) the metabolism of one or more other drugs. Dimethyl sulfoxide treatment of rats enhances benzene metabolism (Kocsis et al., 1968). Chronic ethanol ingestion increases polycyclic hydrocarbon metabolism (Seitz et al., 1978). Polycyclic hydrocarbon treatment enhances ethanol metabolism (French et al., 1979).The broad pleiotypic response seen for polycyclic aromatic inducers and steroids is reminiscent of the “protein activator’’ hypothesis of Davidson and Britten (19731, in which their “effector” would be the inducer-receptor complex. Their model is more similar to that illustrated in Fig. 12 than in Fig. 13. V. Multiple Forms of Other Drug-Metabolizing Enzymes
In addition to P-450,many other enzymes appear to metabolizewith a considerable degree of specificity-a wide variety of drugs, chemicals, environmental pollutants, and some endogenous substrates. This subject is beyond the scope of this article, but there is rapidly growing evidence (Nebert, 1979) for two or more (inducible or control) forms for most of the following: NADPH-cytochrome c reductase, epoxide hydrolase, UDP glucuronosyltransferase, glutathione transferase, sulfotransferase, aldehyde dehydrogenase, hydrolase, and acyl transferase. Approximately 13 different structural loci for various esterase activities are known in the mouse; some are clustered on the same chromosome, others are not linked (Womack and Sharp, 1976; Peters and Nash, 1977). It is hard to believe that receptors or structural genes for all these enzymes are waiting for a drug that, for example, has not yet been invented by the pharmaceutical industry. Could it be that some of these drug-metabolizing enzymes are also regulated by insertion sequences, intragenic recombination, and/or intervening sequences, thereby giving the same “picture” (i.e., high specificity for one inducing substrate and some degree of cross-specificity for various other substrates) as that seen for immunoglobulins and perhaps the multiple forms of P-450?
40
DANIEL
w.
NEBERT
et al.
VI. Conclusions and Directions of Future Research
A. How MANYFORMS OF P-450ARETHERE? 1. Endogenous P 4 5 0 In the unexposed control organism, endogenous forms of P-450are critical to life in the biosynthesis and catabolism of steroids, biogenic amines, and other normal body substrates. In this setting, it seems reasonable that metabolism of these endogenous compounds might be highly specific. The 21-hydroxylation and not 20-hydroxylation of progesterone, for example, could be critical to sex differentiation. There is genetic evidence in the rat adrenal, however, that the P-450 responsible for both 18-and llp-steroid hydroxylation is the same (Rapp and Dahl, 1976). It might be argued in this context that metabolism of foreign chemicals does not require this degree of specificity. Evidence refutes this argument, however: highly specific differences in the hydroxylation of warfarin (Fasco et al., 1978) and 2-acetylaminofluorene (Lang and Nebert, 19811, for example, exist at various positions on the molecule. More work on this subject is needed.
2. Induced P 4 5 0 Possessing the genetic capability to form about one million antibodies does not mean that all of these antibodies exist at any one time. Similarly, possessing the genetic capacity to form hundreds or thousands of different P-450species does not mean that all of them would exist at any one time. At any given moment, an organism may be exposed to significant concentrations of perhaps only 10, or 50, important antigens and 10 or 50 important inducing chemicals, so that between 10 and 50 forms of immunoglobulins and induced P-450 would exist in quantities sufficient to be detected. At a later time, the same organism-because of changes in its environment-may have a different profile of detectable immunoglobulins and induced forms of P-450.Further work is needed to confirm or disprove this hypothesis .
B. RESEARCHDIRECTIONS 1. Clonal Isolation The best experimental system for isolating a homogeneous form of P-450is one in which the ratio of a single induced form of P-450to
THE
Ah
LOCUS
41
total P-450 content is very high (ideally, infinity). Conversely, “control” untreated animals would probably be the most difficult to work with, because there are most likely small amounts of numerous forms of P-450 without any one predominating form. Our knowledge of the chemical nature of immunoglobulin variable regions has depended upon highly successful experimental methods for expanding clones to the point a t which sufficient yields of homogeneous immunoglobulin are available for analysis (McKean et al., 1978) and especially upon the development of tumors of immunoglobulin-secreting cells (Porter, 1973; Potter, 1977). In this regard, the research field of immunoglobulin chemistry and immunogenetics is a t least 20 years ahead of similar studies with the heterogeneous membrane-bound P-450 system. Perhaps a promising approach to consider in the future for obtaining a homogeneous form of P-450 will be the use of monoclonal hepatomas, other tumors, or transformed cells in culture that are discovered to produce a single form of cytochrome P-450. One study (Miyake et aZ., 19741, for example, indicated spectrally that only one form of P-450 exists in the rat hepatoma 7777; this form, called P-448, was inducible by 3-methylcholanthrene, in the complete absence of any detectable AHH activity. There is no a priori reason, however, to expect that monoclonal tumors will synthesize just one form of P-450 in the same sense that monoclonal plasmacytomas produce just one immunoglobulin; but, if monoclonal tumors do produce just one form of P-450, the problem then will be to find the appropriate substrate for that enzyme. This problem is similar to that of immunologists trying to find the “correct” antigen for any particular monoclonal antibody. In fact, we are presently searching for the most efficient substrate and catalytic activity for P-448. In addition, some way of coupling clonal proliferation to P-450 inducibility is needed, in order to make isolation of promising clones easier.
2 . Treatment with P 4 5 0 Inducer Treatment of a n animal or cultured cell line with phenobarbital or 3-methylcholanthrene may induce to a large degree one specific form of P-450, but presently there is no way of telling how many additional forms of somewhat less specific P-450 are concomitantly induced (i.e., like Fig. 12 or 13). In certain cases, the newly induced form may comprise a large portion of the total P-450 content. We believe that hepatic P,-450 in 3-methylcholanthrene-treated fetal rabbit, for example, comprises greater than 50% of all P-450 present a t that age (Atlas et al., 1977).
42
DANIEL
w.
NEBERT
et al.
3. Amino Acid or Nucleotide Sequencing Immunochemical studies for any isolated antigenic molecule are obviously limited by the purity of the antigen used to produce the antibody. Amino acid sequencing techniques allow one to say with only 90 or 95% certainty that a given amino acid occurs in a given position. Moreover, the protein becomes exceedingly difficult to sequence, the further one moves in from either end. Each position might contain any one of at least 20 amino acids. A more promising approach will be to bypass the amino acid sequencing with its inherent difficulties and to sequence directly the nucleotides of the different structural genes for P-450. Moreover, there is the choice of only one of four nucleotides at each position (rather than one of 20 amino acids). The construction and analysis of bacterial plasmids that contain and phenotypically express a mammalian genetic sequence are being performed with increasing ease and with less than 20%purity of starting mRNA (Cohen and Shapiro, 1980; Gilbert and Villa-Komaroff, 1980). Further, the protein encoded for may represent 1%or less of the total cellular protein. Today these techniques are clearly more powerful, more precise, and much simpler than amino acid sequencing. VII. Summary
All organisms most likely possess several genetically regulated mechanisms for coping rapidly with adverse changes in the environment. The three systems which appear to respond to a very large array of chemical specificities are the major histocompatibility locus, the immune response, and the induction of drug-metabolizing enzymes. Studies of the Ah locus have greatly aided our understanding of the induction of drug-metabolizing enzymes. Similarities and differences between the immunoglobulin system and the P-450-mediated monooxygenase system are described. If the regulation of P-450 induction resembles in any way the other methods by which prokaryotes and eukaryotes cope genetically with numerous forms of environmental selective pressures, it is very likely that mammalian tissues have the genetic capacity to produce not only hundreds, but probably thousands, of inducible forms of P-450. We have begun cloning cDNA associated with the Ah system (Negishi et al., 1981b; Tukey et al., 1981). It is now clear that the various forms of P-450 represent a multigene family. One of the goals of cloning these genes is, of course, to define the degree of diversity and organization of this multigene family. We should be prepared to look
THE
Ah
LOCUS
43
for evidence of intragenomic recombinations during development (which could generate by orders of magnitude more forms of P-450) and for domains in the genomic DNA that might represent analogs of the constant, variable, and hypervariable regions of the immunoglobulin genome. So far we have no direct evidence for such recombinational events.
ACKNOWLEDGMENTS We thank Drs. Michael Potter, Steven A. Atlas, Sankar L. Adhya, Ananda M. Chakrabarty, Stanley N. Cohen, Ron W. Estabrook, Elvin A. Kabat, Gilbert J. Mannering, Olavi Pelkonen, J. Ed Rall, and John G. M. Shire for valuable discussions. The expert secretarial assistance of Ms. Ingrid E. Jordan is also very much appreciated.
REFERENCES Adams, S. L., Alwine, J. C., de Crombrugghe, B., and Pastan, I. (1979). Use of recombinant plasmids to characterize collagen RNAs in normal and transformed chick embryo fibroblasts. J . B i d . Chem. 254, 4935-4938. Agosin, M., Morello, A., White, R., Repetto, Y., and Pedemonte, J . (1979). Multiple forms of noninduced rat liver cytochrome P-450. J . Biot. Chem. 254, 9915-9920. Alt, F. W., Bothwell, A. L. M., Knapp, M., Siden, E., Mather, E., Koshland, M., and Baltimore, D. (1980).Synthesis of secreted and membrane-bound immunoglobulin Mu heavy chains is directed by mRNAs that differ at their 3’ ends. Cell 20, 293-301. Askari, E. M., and Gabliks, J . (1973). DDT and immunological responses. 11. Altered histamine levels and anaphylactic shock in guinea pigs. Arch. Enuiron. Health. 26, 309-312. Atlas, S. A., Thorgeirsson, S. S., Boobis, A. R., Kumaki, K., and Nebert, D. W. (1975). Differential induction of murine Ah locus-associated monooxygenase activities in rabbit liver and kidney. Biochem. Pharmacol. 24, 2111-2116. Atlas, S. A,, Boobis, A. R., Felton, J. S., Thorgeirsson, S. S., and Nebert, D. W. (1977). Ontogenetic expression of polycyclic aromatic compound-inducible monooxygenase activities and forms of cytochrome P-450 in the rabbit. Evidence for temporal control and organ specificity of two genetic regulatory systems. J . Biol. Chem. 252, 4712-4721. Baron, S., and Dianzani, F., Eds. (1977). “Texas Reports on Biology and Medicine” (Volume on The Interferon System: A Current Review to 1977). Univ. of Texas Medical Branch, Galveston, Texas. Beck, C. F. (1979). A genetic approach to analysis of transposons. Proc. Natl. Acad. Sci. U.S.A. 76, 2376-2380. Bekesi, J. G., Holland, J . F., Anderson, H. A,, Fischbein, A. S., Rom, W., Wolff, M. S., and Selikoff, I. J. (1978). Lymphocyte function of Michigan dairy farmers exposed to polybrominated biphenyls. Science 199, 1207-1209. Bennett, D. (1975). The TAlocus of the mouse. Cell 6, 441-454. Berns, A. J. M., de Abreu, R. A,, van Kraaikamp, M., Beneditti, E. L., and Bloemendal, H. (1971). Synthesis of lens protein in uitro. V. Isolation of messenger-like RNA from lens by high resolution zonal centrifugation. FEBS Lett. 18, 159-163. Bigelow, S. W., and Nebert, D. W. (1981). The Ah regulatory gene product. Survey of
44
DANIEL
w.NEBERT et al.
nineteen aromatic compounds’ and fifteen benzo[alpyrene metabolites’ capacity to bind to the cytosolic receptor. Toxicol. Lett., in press. Brack, C., Hirama, M., Lenhard-Schuller, R., and Tonegawa, S. (1978). A complete immunoglobulin gene is created by somatic recombination. Cell 15, 1-14. Brown, P. C., and Papaconstantinou, J. (1979). Mouse albumin mRNA in liver and a hepatoma cell line. Preparation of complementary DNA from purified mRNA and quantitation by nucleic acid hybridization. J . Biol. Chem. 254, 5177-5183. Bukhari, A. I., Shapiro, J. A,, and Adhya, S. L., Eds. (1977). “DNA Insertion Elements, Plasmids and Episomes.” Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Caspari, E. (1952). Pleiotropic gene action. Evolution 6, 1-18. Cech, T. R., and Hearst, J . E. (1975). An electron microscopic study of mouse foldback DNA. Cell 5, 429-446. Cerniglia, C. E., and Gibson, D. T. (1979). Oxidation of benzo[a]pyrene by the filamentous fungus Cunninghamella elegans. J . Biol. Chem. 254, 12174-12180. Chakrabarty, A. M. (1976). Plasmids in Pseudornonas. Annu. Rev. Genet. 10, 7-30. Chakrabarty, A. M., Friello, D. A,, and Bopp, L. H. (1978). Transportation of plasmid DNA segments specifying hydrocarbon degradation and their expression in various microorganisms. Proc. Natl. Acad. Sci. U.S.A. 75, 3109-3112. Chantrenne, H., Burny, A,, and Marbaix, G. (1967). The search for the messenger RNA of hemoglobin. Prog. Nucleic Acid Res. Mol. Biol. 7, 173-194. Cohen, S. N., and Shapiro, J. A. (1980). Transposable genetic elements. Sci. Am. 242, 40-49. Conney, A. H. (19671. Pharmacological implications of microsomal enzyme induction. Pharmacol. Reu. 19, 317-366. Conney, A. H., and Klutch, A. (1963). Increased activity of androgen hydroxylases in liver microsomes of rats pretreated with phenobarbital and other drugs. J . Biol. Chem. 238, 1611-1617. Crick, F. (1979). Split genes and RNA splicing. Science 204, 264-271. Darnell, J. E., Jr. (1978). Implications of RNA. RNA splicing in evolution of eukaryotic cells. Science 202, 1257-1260. Davidson, E. H., and Britten, R. J. (1973). Organization, transcription, and regulation in the animal genome. Q. Reu. Biol. 48, 565-613. Deutsch, J., Leutz, J. C., Yang, S. K., Gelboin, H. V., Chiang, Y. L., Vatsis, K. P., and Coon, M. J. (1978). Regio- and stereoselectivity of various forms of purified cytochrome P-450 in the metabolism of benzolalpyrene and ( - )trans-7, 8-dyhydroxy7,8-dihydrobenzo[alpyreneas shown by product formation and binding to DNA. Proc. Natl. Acad. Sci. U.S.A. 75, 3123-3127. Diggelmann, H., Faust, C . H., Jr., and Mach, B. (1973). Enzymatic synthesis of DNA complementary to purified 14s messenger RNA of immunoglobulin light chain. Proc. Natl. Acad. Sci. U.S.A. 70, 693-696. Early, P., Huang, H., Davis, M., Calame, K., and Hood, L. (1980a). An immunoglobulin heavy chain variable region gene is generated from three segments of DNA: V,, D and J,. Cell 19, 981-992. Early, P., Rogers, J., Davis, M., Calame, K., Bond, M., Wall, R., and Hood, L. (1980b). Two mRNAs can be produced from a single immunoglobulin p gene by alternative RNA processing pathways. Cell 20, 313-319. Edelman, G. M. (1973). Antibody structure and molecular immunology. Science 180, 830-839.
THE
Ah
LOCUS
45
Egel, R. (1976). Rearrangement a t the mating type locus in fission yeast. Mol. Gen. Genet. 148, 149-158. Eicher, E. M., Riblet, R. J., and Taylor, B. A. (1979). Mouse News Lett. 61, 42. Eisen, H. J., and Glinsmann, W. (1976). Partial purification of the glucocorticoid receptor from rat liver: A rapid, two-step procedure using DNA-cellulose. Biochem. Biophys. Res. Commun. 70, 367-372. Eisner, T., Nowicki, S., Goetz, M., and Meinwald, J. (1980). Red cochineal dye (carminic acid): Its role in nature. Science 208, 1039-1042. Enomoto, K., and Sato, R. (1973). Incorporation in vitro of purified cytochrome b, into liver microsomal membranes. Bcochem. Biophys. Res. Commun. 51, 1-7. Estabrook, R. W., Franklin, M. R., Cohen, B., Shigamatzu, A., and Hildebrandt, A. G. (1971). Influence of hepatic microsomal mixed function oxidation reactions on cellular metabolic control. Metabolism 20, 187-199. Fagen, J . B., Yamada, K. M., de Crombrugghe, B., and Pastan, I. (1979). Partial purification and characterization of the messenger RNA for cell fibronectin. Nucleic Acids Res. 6, 3471-3480. Fasco, M. J., Vatsis, K. P., Kaminsky, L. S., and Coon, M. J. (1978). Regioselective and stereoselective hydroxylation of R and S warfarin by different forms of purified cytochrome P-450 from rabbit liver. J . Biol. Chem. 253, 7813-7820. Fincham, J . R. S., and Sastry, G. R. K. (1974). Controlling elements in maize. Annu. Rev. Genet. 8, 15-50. Floersheim, G. L. (1976). Protection by phalloidin against lethal doses of phalloidin. Agents Actions 6, 490-492. Flower, R. J . (1974). Drugs which inhibit prostaglandin biosynthesis. Pharmacol. Rev. 26, 33-67. Fraker, P. J . (1980). The antibody-mediated and delayed type hypersensitivity response of mice exposed to polybrominated biphenyls. Toxicol. Appl. Pharmacol. 53, 1-7. French, T. A., Atkinson, N., Petersen, D. T., and Chung, L. W. K. (1979). Differential induction of hepatic micrsomal ethanol and drug metabolism by 3-methylcholanthrene in “LS” and “SS’mice. J . Pharmacol. Exp. Ther. 209, 404-410. Fuchs, E., and Green, H. (1979). Multiple keratins of cultured human epidermal cells are translated from different mRNA molecules. Cell 17, 573-582. Gabliks, J., Askari, E., and Yolen, N. (1973). DDT and immunological responses. I. Serum antibodies and anaphylactic shock in guinea pigs. Arch. Environ. Health 26, 305-308. Gephly, E. B., Fahl, W. E., Jefcoate, C. R., and Heidelberger, C. (1979). The metabolism of benzo[alpyrene by cytochrome P-450 in transformable and nontransformable C3H mouse fibroblasts. J . Biol. Chem. 254, 5041-5048. Gerber, N., and Arnold, K. (1969). Studies on the metabolism of diphenylhydantoin in mice. J . Pharmacol. Exp. Ther. 167, 77-90. Gilbert, W., and Villa-Komaroff, L. (1980). Useful proteins from recombinant bacteria. Sci. A m . 242, 74-94. Goldstein, A,, Aronow, L., and Kalman, S. M., Eds. (1974).“Principles of Drug Action” (2nd ed). Wiley, New York. Gonasun, L. M., Witmer, C., Kocsis, J. J., and Synder, R. (1973). Benzene metabolism in mouse liver microsomes. Toxicol. Appl. Pharmacol. 26, 398-406. Guengerich, F. P. (1977). Separation and purification of multiple forms of microsomal cytochrome P-450. Activities of different forms of cytochrome P-450 towards several compounds of environmental interest. J . Biol. Chem. 252, 3970-3979.
46
DANIEL
w.
NEBERT
et al.
Guengerich, F. P. (1978). Separation and purification of multiple forms of microsomal cytochrome P-450. Partial characterization of three apparently homogeneous cytochromes P-450 prepared from livers of phenobarbital- and 3-methylcholanthrenetreated rats. J. Biol. Chem. 253, 7931-7939. Guenthner, T. M., and Nebert, D. W. (1978). Evidence in rat and mouse liver for temporal control of two of cytochrome P-450 inducible by 2,3,7,8-tetrachlorodibenzop-dioxin. Eur. J. Biochem. 91,449-456. Guenthner, T. M., Fysh, J. M., and Nebert, D. W. (1979). 2,3,7,8-Tetrachlorodibenzop-dioxin: Covalent binding of reactive metabolic intermediates principally to protein in vitro. Pharmacology 19, 12-22. Gustafsson, J-A., Eneroth, P., Pousette, A., Skett, P., Sonnenschein, C., Stenberg, A., and Ahlen, A. (1977). Programming and differentiation of rat liver enzymes. J. Steroid Biochem. 8, 429-443. Hannah, R. R., Nebert, D. W., and Eisen, H. J. (1981). Regulatory gene product of the Ah complex. Comparison of 2,3,7,8-tetrachlorodibenzo-p-dioxin and 3-methylcholanthrene binding to several moieties in mouse liver cytosol. J. Biol. Chem. 256, 4584-4590. Haugen, D. A., Coon, M. J., and Nebert, D. W. (1976). Induction of multiple forms of mouse liver cytochrome P-450. Evidence for genetically controlled de novo protein synthesis in response to treatment with p-naphthoflavone or phenobarbital. J . Biol. Chem. 251, 1817-1827. Hayaishi, O., Katagiri, M., and Rothberg, S. (1955). Mechanism of the pyrocatechase reaction. J. Am. Chem. Sac. 77, 5450-5451. Heffron, F., Rubens, C., and Falkow, S. (1975).Translocation of a plasmic DNA sequence which mediates ampicillin resistance: Molecular nature and specificity of insertion. Proc. Natl. Acad. Sci. U.S.A. 72, 3623-3627. Hicks, J. B., and Herskowitz, 1. (1977). Interconversion of yeast mating types. 11. Restoration of mating ability to sterile mutants in homothallic and heterothallic strains. Genetics 85, 373-393. Hildemann, W. H., Johnson, I. S., and Jokiel, P. L. (1979). Immunocompetence in the lowest metazoan phylum: Transplantation immunity in sponges. Science 204, 420-422. Jay, G., Ferrini, U., Robinson, E. A,, Khoury, G., and Appella, E. (1979). Cell-free synthesis of mouse H-2 histocompatibility antigens. Proc. Natl. Acad. Sci. U S A . 76, 6562-6566. Johnson, E. F. (1980). Isolation and characterization of a constitutive form of rabbit liver microsomal cytochrome P-450. J . Bid. Chem. 255, 304-309. Kahl, G. F., Friederici, D., Bigelow, S. W., Okey, A. B., and Nebert, D. W. (1980). Ontogenetic expression of regulatory and structural gene products associated with the Ah locus. Comparison of rat, mouse, rabbit, and Sigmoden hispedis. Dev. Pharmacol. Ther. 1, 137-162. Kato, R. (1979). Characteristics and differences in the hepatic mixed function oxidases of different species. Pharmacol. Ther. 6, 41-98. Kaufman, R. J., Brown, P. C., and Schimke, R. T. (1979). Amplified dehydrofolate reductase genes in unstably methotrexate-resistant cells are associated with double minute chromosomes. Proc. Natl. Acad. Sci. U.S.A. 76, 5669-5673. Kawalek, J. C., Levin, W., Ryan, D., and Lu, A. Y. H. (1977). Role of sulfhydryl groups in the hydroxylation of benzo[a]pyrene by purified rat and rabbit cytochrome P448. Arch. Biochem. Biophys. 183, 732-741.
THE
Ah
LOCUS
47
Klein, J . (1979). The major histocompatibility complex of the mouse. Science 203, 516-521. Kocsis, J . J., Harkaway, S., Santoyo, M. C., and Snyder, R. (1968). Dimethyl sulfoxide: Interactions with aromatic hydrocarbons. Science 160, 427-428. Kolata, G. B. (1980). Genes in pieces. Science 207, 392-393. Koop, D. R., and Coon, M. J. (1979). Purification and properties of P-450 LMab, a constitutive form of cytochrome P-450, from rabbit liver microsomes. Biochem. Biophys. Res. Commun. 91, 1075-1081. Kouri, R. E., and Nebert, D. W. (1977).Genetic regulation of susceptibility to polycyclic hydrocarbon-induced tumors in the mouse. In “Origins of Human Cancer” (H. H. Hiatt, J . D. Watson, and J . A. Winsten, eds.), Vol. 4, pp. 811-835. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Kud, J.,and Currier, W. (1976). Phytoalexins, plants and human health. In “Mycotoxins and Other Fungal Related Food Problems” [Advances in Chemistry Series] (J. V. Rodricks, ed.), Vol. 149, pp. 356-368. Amer. Chem. SOC.,Washington, D.C. Lake, L. M., O’Cheskey, S., Masuji, H., and Gerschenson, L. E. (1980). Isolation of leadresistant cells from an established rat glioma cell line. Chem. Biol. Interact. 30, 237-240. Lambotte-Vandepaer, M., van Bogaert, M. D., de Meester, C., Noel, G., Poncelet, F., Roberfroid, M., and Mercier, M. (1979). Styrene induced modifications of some rat liver enzymes involved in the activation and inactivation of xenobiotics. Biochem. Pharmacol. 28, 1653-1659. Lang, M. A,, and Nebert, D. W. (1981). Structural gene products of the A h complex. Evidence for many unique P-450-mediated monooxygenase activities reconstituted from 3-methylcholanthrene-treatedC57BLi6N mouse liver microsomes. J . Biol. Chem., in press. Legraverend, C., Nebert, D. W., Boobis, A. R., and Pelkonen, 0. (1980). DNA binding of benzo[a]pyrene metabolites: Effects on substrate and microsomal protein concentration in vitro and diet and tissue differences in uiuo. Pharmacology 20, 137-148. Levy, R. L., Barrington, M. H., Lerner, R. A,, Griffin, G. J.,and Whitmire, C. E. (1977). Immunosuppressive effects of 3-methylcholanthrene given intratracheally in various inbred strains of mice. Cancer Res. 37, 3892-3894. Lichtler, A. C., Detke, S., Phillips, I. R., Stein, G. S., and Stein, J. L. (1980). Multiple forms of H4 histone mRNA in human cells. Proc. Natl. Acad. Sci. U.S.A. 77, 1942-1946. Lu, A. Y. H., and Levin, W. (1974). The resolution and reconstitution of the liver microsomal hydroxylation system. Biochim. Biophys. kcta 344,205-240. Lusis, A. J., and Paigen, K. (1977). Mechanisms involved in the intracellular localization of mouse glucuronidase. Isozymes: Curr. Top. Biol. Med. Res. 2, 63-106. McClintock, B. (1955). Controlling elements and the gene. Cold Spring Harbor Symp. Quant. B i d . 21, 197-216. McKean, D. J., Bell, M., and Potter, M. (1978). Mechanisms of antibody diversity: Multiple genes encode structurally related mouse K variable regions. Proc. Natl. Acad. Sci. U.S.A.75, 3913-3917. Mannering, G. J. (1980). Hepatic cytochrome P-450-linked drug-metabolizing systems. In “Concepts in Drug Metabolism” (B. Testa and P. Jenner, eds.), Vol. 2 Part B, pp. 53-165. Dekker, New York. Mannering, G. J., Renton, K. W., el Azhary, R., and Deloria, L. B. (1980). Effects of
48
DANIEL
w. NEBERT et al.
interferon inducing agents on hepatic cytochrome P-450 drug metabolizing systems. Ann. N.Y. Acad. Sci. 350, 314-331. Mason, H. S., Fowlks, W. L., and Peterson, E. (1955). Oxygen transfer and electron transport by the phenolase complex. J . A m . Chem. SOC. 77, 2914-2915. Mason, J. L., Estabrook, R. W., and Purvis, J. L. (1973). Testicular cytochrome P-450 and iron-sulfur protein as related to steroid metabolism. Ann. N.Y. Acad. Sci. 212, 406-419. Mathews, M. B., Osborn, M., Berns, A. J. M., and Bloemendal, H. (1972). Translation of two messenger RNAs from lens in a cell free system from Krebs I1 ascites cells. Nature (London) New Biol. 236, 5-7. Meo, T., Johnson, J., Beechey, C. V., Andrews, S. J., Peters, J., and Searle, A. G. (1980). Linkage analyses of murine immunoglobulin heavy chain and serum prealbumin genes establish their location on chromosome 12 proximal to the T(5;12)31Hbreakpoint in band 12F1. Proc. Natl. Acad. Sci. U.S.A. 77, 550-553. Miller, J. A., and Miller, E. C. (1979). Perspectives on the metabolism of chemical carcinogens. In “Environmental Carcinogenesis: Occurrence, Risk Evaluation and Mechanisms,” pp. 25-50. Netherlands Cancer Society, Amsterdam. Miyake, Y., Gaylor, J. L., and Morris, H. P. (1974). Abnormal microsomal cytochromes and electron transport in Morris hepatomas. J . Biol. Chem. 249, 1980-1987. Nebert, D. W. (1978). Genetic differences affecting microsomal electron transport: The Ah locus. Methods Enzymol. LII, 226-240. Nebert, D. W. (1979). Multiple forms of inducible drug-metabolizing enzymes. A reasonable mechanism by which any organism can cope with adversity. Mol. Cell. Biochem. 27, 27-46. Nebert, D. W. (1980). The Ah locus. A gene with possible importance in cancer predictability. Arch. Toxicol. Suppl. 3, 195-207. Nebert, D. W., and Atlas, S. A. (1978). The Ah locus: Aromatic hydrocarbon responsiveness . . . of mice and men. Human Genet. Suppl. 1, 149-160. Nebert, D. W., and Bausserman, L. L. (1970). Genetic differences in the extent of aryl hydrocarbon hydroxylase induction in mouse fetal cell cultures. J.Biol. Chem. 245, 6373-6382. Nebert, D. W., and Gielen, J . E. (1971). Aryl hydrocarbon hydroxylase induction in mammalian liver cell culture. 11. Effects of actinomycin D and cycloheximide on induction processes by phenobarbital or polycyclic hydrocarbons. J . Biol. Chem. 246, 5199-5206. Nebert, D. W., and Jensen, N. M. (1979). The A h locus: Genetic regulation of the metabolism of carcinogens, drugs, and other environmental chemicals by cytochrome P-450-mediated monooxygenases. In “CRC Critical Reviews in Biochemistry” (G. D. Fasman, ed.), Vol. 6, pp. 401-437. CRC Press, Cleveland, Ohio. Nebert, D. W., Goujon, F. M., and Gielen, J. E. (1971). Genetic regulation of monooxygenase activity. In “Groupes de Contact” (Fonds de la Recherche Scientifique Medicale, eds.), pp. 240-270. Fonds de la Recherche Scientifique Medicale, 11, rue d’Egmont, Bruxelles 5, Belgium. Nebert, D. W., Considine, N., and Owens, I. S. (1973). Genetic expression of aryl hydrocarbon hydroxylase induction. VI. Control of other aromatic hydrocarboninducible mono-oxygenase activities at or near the same genetic locus. Arch. Biochem. Bzophys. 157, 148-159. Nebert, D. W., Jensen, N. M., Perry, J. W., and Oka, T. (1980). Association between ornithine decarboxylase induction and the A h locus in mice treated with polycyclic aromatic compounds. J . Biol. Chem. 255, 6836-6842.
THE
Ah
LOCUS
49
Nebert, D. W., Eisen, H. J., Negishi, M., Lang, M. A., Hjelmeland, L. M., and Okey, A. B.(1981). Genetic mechanisms controlling the induction of polysubstrate monooxygenase (P-450) activities. Annu. Rev. Phurmacol. Toxicol. 21, 431-462. Negishi, M., and Nebert, D. W. (1979). Structural gene products of the Ah locus. Genetic and immunochemical evidence for two forms of mouse liver cytochrome P-450 induced by 3-methylcholanthrene. J . Biol. Chem. 254, 11015-11023. Negishi, M., and Nebert, D. W. (1981). Structural gene products of the Ah complex. Increases in large mRNA from mouse liver associated with cytochrome P,-450 induction by 3-methylcholanthrene. J . Biol. Chem. 256, 3085-3091. Negishi, M., Jensen, N. M., Garcia, G. S., and Nebert, D. W. (1981a). Structural gene products of the murine Ah locus. Differences in ontogenesis, membrane location, and glucosamine incorporation between liver microsomal cytochromes P,-450 and P-448 induced by polycyclic aromatic compounds. Eur. J . Biochem. 115, 585-594. Negishi, M., Swan, D. C . , Enquist, L. W., and Nebert, D. W. (1981b). Isolation and characterization of a cloned DNA sequence associated with the murine Ah locus and a 3-methylcholanthrene-inducedform of cytochrome P-450. Proc. Natl. Acad. Sci. U.S.A. 78, 800-804. Nemoto, N., Takayama, S., Nagao, M., and Umezawa, K. (1978). Modification of the mutagenicity of benzo(a)pyrene on bacteria by substrates of enzymes producing water soluble conjugates. Toxicol. Lett. 2, 205-21 1. Niwa, A,, Kumaki, K., Nebert, D. W . , and Poland, A. P. (1975). Genetic expression of aryl hydrocarbon hydroxylase activity i n the mouse. Distinction betwen the “responsive” homozygote and heterozygote at the Ah locus. Arch. Biochem. Biophys. 166, 559-564. Noshiro, M., Harada, N., and Omura, T. (1979). Immunochemical study on the participation of cytochrome b, in drug oxidation reactions of mouse liver microsomes. Biochem. Biophys. Res. Commun. 91, 207-213. Ohba, M., Sato, R., Yoshida, Y., Nishino, T., and Katsuki, H. (1978). Involvement of cytochrome P-450 and a cyanide-sensitive enzyme in different steps of lanosterol demethylation by yeast microsomes. Biochem. Biophys. Res. Commun. 85, 21-27. Ohnishi, K., and Lieber, C. S. (1977). Reconstitution of microsomal ethanol-oxidizing system J . Biol. Chem. 252, 7124-7131. Okey, A. B., Bondy, G. P., Mason, M. E., Kahl, G. F., Eisen, H. J., Guenthner, T. M., and Nebert, D. W. (1979). Regulatory gene product ofthe Ah locus. Characterization of the cytosolic inducer-receptor complex and evidence for its nuclear translocation. J . Biol. Chern. 254, 11636-11648. Okey, A. B., Bondy, G. P., Mason, M. E., Nebert, D. W., Forster-Gibson, C . J.,Muncan, J., and Dufresne, M. J. (1980). Temperature-dependent cytosol-to-nucleus translocation of the Ah receptor for 2,3,7,8-tetrachlorodibenzo-p-dioxin in continuous cell culture lines. J . Biol. Chem. 255, 11415-11422. Omura, T., and Sato, R. (1964). The carbon monoxide-binding pigment of liver microsomes. I. Evidence for its hemoprotein nature. J . Biol. Chern. 239, 2370-2378. Owens, I. D., Legraverend, C., and Pelkonen, 0. (1979). Deoxyribonucleic acid binding of 3-hydroxy- and 9-hydroxybenzo[alpyrene following further metabolism by mouse liver microsomal cytochrome P,-450. Biochem. Pharmacol. 28, 1623-1629. Panemangalore, M., and Brady, F. 0. (1978). Induction and synthesis of metallothionein in isolated perfused rat liver. J . Biol. Chem. 253, 7898-7904. Park, S. K., and Brody, J. I. (1971).Suppression of immunity by phenobarbital. Nature (London) New Biol. 233, 181-182. Perry, R. P., Kelley, D. E., Coleclough, C., Seidman, J. G., Leder, P., Tonegawa, S.,
50
DANIEL
w.NEBERT et al.
Matthyssens, G., and Weigert, M. (1980). Transcription of mouse K chain genes: Implications for allelic exclusion. Proc. Natl. Acad. Sci. U.S.A.77, 1937-1941. Peters, J., and Nash, H. R. (1977). Polymorphism of esterase-11 in Mus musculus, a further esterase locus on chromosome 8. Biochem. Genet. 15, 217-226. Pfeil, D., Janig, G-R., Behlke, J., and Ruckpaul, K. (1977). Wechselwirkungen der Komponenten des Zytochrom P-450-Monooxygenasesystems aus Lebermikrosomen. 111. Die N-demethylaseaktivitat von Zytochrom P-450 in Abhangigkeit vom Integrationsgrad. Acta Biol. Med. Ger. 36, 1243-1251. Plate, L. (1910). Die Schwanzknickblastovariation. Vererbungslehre und Deszendenztheorie. Festschr. Richard Hertwig 2, 537-610. Poland, A. P., and Glover, E. (1975). Genetic expression of aryl hydrocarbon hydroxylase by 2,3,7,8-tetrachlorodibenzo-p-dioxin: Evidence for a receptor mutation in genetically non-responsive mice. Mol. Pharmacol. 11, 389-398. Poland, A. P., and Glover, E. (1977). Chlorinated biphenyl induction of aryl hydrocarbon hydroxylase activity: A study of the structure-activity relationship. Mol. Pharmacol. 13, 924-938. Poland, A., and Glover, E. (1980). 2,3,7,8-Tetrachlorodibenzo-p-dioxin: Segregation of toxicity with the Ah locus. Mol. Pharmacol. 17, 86-94. Poland, A. P., Glover, E., Robinson, J. R., and Nebert, D. W. (1974). Genetic expression of aryl hydrocarbon hydroxylase activity. Induction of monooxygenase activities and cytochrome P,450 formation by 2,3,7,8-tetrachlorodibenzo-p-dioxin in mice genetically “unresponsive” to other aromatic hydrocarbons. J . Biol. Chem. 249, 5599-5606. Poland, A. P., Glover, E., and Kende, A. S. (1976). Stereospecific, high affinity binding of 2,3,7,8-tetrachlorodibenzo-p-dioxin by hepatic cytosol. Evidence that the binding species is the receptor for the induction of aryl hydrocarbon hydroxylase. J . Biol. Chem. 251, 4936-4946. Pollock, T. J., Tessman, I., and Tessman, E. S. (1978).Potential for variablity through multiple gene products of bacteriophage +x174. Nature (London) 274, 34-37. Porter, R. R. (1973). Structural studies of immunoglobulins. Science 180, 713-716. Potter, M. (1977). Antigen-binding myeloma proteins of mice. In “Advances in Immunology” (H. G. Kunkel and S. J. Dixon, eds.), Vol. 25, pp. 141-211. Academic Press, New York. Putnam, R. W., Shimizu, A., Paul, C., and Shinoda, T. (1972). Variation and homology in immunoglobulin heavy chains. Fed. Proc. Fed. A m . SOC.Exp. Biol. 31, 193-205. Rapp, J. P., and Dahl, L. K. (1976). Mutant forms of cytochrome P-450 controlling both 18- and llp-steroid hydroxylation in the rat. Biochemistry 15, 1235-1242. Robinson, J. R., and Nebert, D. W. (1974). Genetic expression of aryl hydrocarbon hydroxylase induction. Presence or absence of association with zoxazolamine, diphenylhydantoin, and hexobarbital metabolism. Mol. Pharmacol. 10, 484-493. Robinson, J. R., Considine, N., and Nebert, D. W. (1974). Genetic expression of aryl hydrocarbon hydroxylase induction. Evidence for the involvement of other genetic loci. J . Biol. Chem. 249, 5851-5859. Rogers, J., Early, P., Carter, C., Calame, K., Bond, M., Hood, L., and Wall, R. (1980). Two mRNAs with different 3’ ends encode membrane-bound and secreted forms of immunoglobulin chain. Cell 20, 303-312. Roth-Schechter, B. F., and Mandel, P. (1976).A study on the development of barbiturate tolerance and dependence in hamster glial cells in culture. Biochem. Pharmacol. 25, 563-571. Rudd, C. J., and Herschman, H. R. (1979). Metallothionein in a human cell line: The
THE
Ah
LOCUS
51
response of HeLa cells to cadmium and zinc. Toxicol. Appl. Pharmacol. 47,273-278. Ryan, D. E., Thomas, P. E., Korzeniowski, D., and Levin, W. (1979). Separation and characterization of highly purified forms of liver microsomal cytochrome P-450 from rats treated with polychlorinated biphenyls, phenobarbital, and 3-methylcholanthrene. J . Biol. Chem. 254, 1365-1374. Sanger, F., Air, G. M., Barrell, B. G., Brown, N. L., Coulson, A. R., Fiddes, J . C., Hitchinson 111, C. A,, Slocombe, P. M., and Smith, M. (1977). Nucleotide sequence of bacteriophage +x174 DNA. Nature (London) 265, 687-695. Sato, R., and Omura, T., Eds. (1978). “Cytochrome P-450.” Academic Press, New York. Schimke, R. T., Kaufman, R. J., Alt, F. W., and Kellems, R. F. (1978). Gene amplification and drug resistance in cultured murine cells. Science 202, 1051-1055. Seidman, J. G., Leder, A., Nau, M., Norman, B., and Leder, P. (1978).Antibody diversity. The structure of cloned immunoglobulin genes suggests a mechanism for generating new sequences. Science 202, 11-17. Seitz, H. K., Garro, A. J., and Lieber, C. S. (1978). Effect of chronic ethanol ingestion of intestinal metabolism and mutagenicity of benzo(a1pyrene. BEochem. Biophys. Res. Commun. 85, 1061-1066. Setzer, D. R., McGrogan, M., Nunberg, J. H., and Schimke, R. T. (1980). Size heterogeneity in the 3‘ end of dihydrofolate reductase messenger RNAs in mouse cells Cell 22, 361-370. Seyfried, T. N., Yu, R. K., and Glaser, G. H. (1980). Genetic analysis of audiogenic seizure susceptibility in C57BL/6J x DBAiW recombinant inbred strains of mice. Genetics 94, 701-718. Shapiro, D. J., and Schimke, R. T. (1975). Immunochemical isolation and characterization of ovalbumin messenger ribonucleic acid. J . Bid. Chem. 250, 1759-1764. Shapiro, D. J., Baker, H. J., and Stitt, D. T. (1976). In vitro translation and estradiol17p induction of “Xenopus laeuis” vitellogenin messenger RNA. J . Biol. Chem. 251, 3105-3111. S h a r d , R., and Cassingena, R. (1969). Actinomycin resistance in cultured hamster cells Cancer Res. 29, 1590-1597. Skett, P., Mode, A,, Eneroth, P., and Gustafsson, J-A. (1979). The effect of various centrally-acting drugs on hepatic steroid metabolism in male and female rats. Biochem. Pharmacol. 28, 719-722. Snyder, R., and Kocsis, J. J. (1975). Current concepts of chronic benzene toxicity. CRC Crit. Rev. Toxicol. 3, 265-288. Staats, J. (1966). The laboratory mouse. I n “Biology of the Laboratory Mouse” (E. L. Green, ed.), pp. 1-9. Dover, New York. Strair, R. K., Yap, S. H., and Shafritz, D. A. (1977). Use of molecular hybridization to purify and analyze albumin messenger RNA from rat liver. Proc. Natl. Acud. Sci. U.S.A. 74, 4346-4350. Tanaka, M., Zeitlin, S., Yasunobu, K. T., and Gunsalus, I. C. (1976). Current status of the sequence studies of the Pseudomoms putida camphor hydroxylase system. In “Iron and Copper Proteins” (K. T. Yasunobu, H. F. Mower, and 0. Hayaishi, eds.), pp. 263-280. Plenum, New York. Taniguchi, H., Imai, Y., and Sato, R. (1980). Protein-protein and lipid-protein interactions in a reconstituted liver microsomal monooxygenase system. In “Microsomes, Drug Oxidations, and Chemical Carcinogenesis” (M. J. Coon, A. H. Conney, R. W. Estabrook, H. V. Gelboin, J. R. Gillette, and P. J. O’Brien, eds.), Vol. I, pp. 537-540. Academic Press, New York. Thomas, P. E., Lu, A. Y. H., Ryan, D., West, S. B., Kawalek, J., and Levin, W. (1976).
52
DANIEL
w.
NEBERT
et al.
Immunochemical evidence for six forms of rat liver cytochrome P450 obtained using antibodies against purified rat liver cytochromes P450 and P448. Mol. Pharmacol. 12, 746-758. Tilghman, S. M., Curtis, P. J., Tiemeier, D. C., Leder, P., and Weissman, C. (1978). The intervening sequence of a mouse p-globin gene is transcribed within the 15s p-globin mRNA precursor. Proc. Natl. Acad. Sci. U.S.A.75, 1309-1313. Tukey, R. H., Nebert, D. W., and Negishi, M. (1981). Structural gene product of the [Ah] complex. Evidence for transcriptional control of cytochrome P,-450 induction by use of a cloned DNA sequence. J . Biol. Chem. 256, 6969-6974. Uhr, J. W., Capra, J. D., Vitetta, E. S., and Cook, R. G. (1979). Organization of the immune response genes. Both subunits of murine I - A and I-E/C molecules are encoded within the I region. Science 206, 292-297. Upholt, W. B., Vertel, B. M., and Dorfman, A. (1979). Translation and characterization of messenger RNAs in differentiating chicken cartilage. Proc. Natl. Acad. Sci. U.S.A. 76, 4847-4851. Vermilion, J. L., and Coon, M. J. (1978a). Purified liver microsomal NADPH-cytochrome P-450 reductase. Spectral characterization of oxidation-reduction states. J . Biol. Chem. 253, 2694-2704. Vermilion, J . L., and Coon, M. J. (197813). Identification of the high and low potential flavins of liver microsomal NADPH-cytochrome P-450 reductase. J . B i d . Chem. 253, 8812-8819. Vos, J. G., and Moore, J. A. (1974). Suppression of cellular immunity in rats and mice Int. Arch. Allergy by maternal treatment with 2,3,7,8-tetrachlorodibenzo-p-dioxin. Appl. Immunol. 47, 777-794. Vukoson, M. B., Greiner, J. W., Kramer, R. E., and Colby, H. D. (1978). Effects of indomethacin administration on hepatic steroid and drug metabolism in male and female rats. Biochem. Pharmacol. 27, 1977-1979. Warner, M., and Neims, A. H. (1979). Multiple forms of ethoxyresorufin 0-deethylase and benzphetamine N-demethylase in solubilized and partially resolved rat liver cytochromes P-450. Drug Metab. Disp. I , 188-193. West, S. B., Huang, M-T, Miwa, G. T., and Lu, A. Y. H. (1979). A simple and rapid procedure for the purification of phenobarbital inducible cytochrome P-450 from rat liver microsomes. Arch. Biochem. Biophys. 193, 42-50. Womack, J. E., and Sharp, M. (1976). Comparative autosomal linkage in mammals: Genetics of esterases in Mus mwculus and Rattus noruegicus. Genetics 82,665-675. Woo, S. L. C., Rosen, J . M., Liarakos, C. D., Choi, Y. C., Busch, H., Means, A. R., O’Malley, B. W., and Robberson, D. L. (1975). Physical and chemical characterization of purified ovalbumin messenger RNA. J . B i d . Chem. 250, 7027-7039. Yoshida, Y. (1978). Yeast microsomal systems. In “Cytochrome P-450” (R. Sat0 and T. Omura, eds.), pp. 194-202. Kodansha, Japan. Yoshimura, H., Yoshihara, S., Ozawa, N., and Miki, M. (1979). Possible correlation between induction modes of hepatic enzymes by PCBs and their toxicity in rats. Ann. N . Y . Acad. Sci. 320. 179-192.
EXPRESSION OF RIBOSOMAL GENES IN BACTERIA Lasse Lindahl and Janice
M.Zengel
Department of Biology, The University of Rochester, Rochester, New York
I. Introduction . . . . . . . . . . . . . . . . . , . , . . . . . . . . . . . . . . . . . . . . . . . . . , . . . . . . . . . . 11. Phenomenological Description of Ribosome Accumulation . . . . . . . . . . . . . . A. Growth Rate-Dependent Regulation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B.Stringent Response . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 111. Genetics of E . coli Ribosomes , . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. Isolation of Mutants . . . . . . . . . , . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B. Fine Structure Analysis of rRNA and r-Protein Operons . . . . . . . . . . . . C. Implications of the Genetic Organization of r-Protein and rRNA Genes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . IV. Measurements of Transcription and Translation of Ribosomal Genes . . A. Expression of rRNA Genes . . . . . . . . , . , . ............... B. Expression of r-Protein Genes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. Gene Dosage Experiments . . . . . . . . . . . . ... V. Autogenous Regulation of r-Protein Synthesis . . . . . . . . . . . . . . . . . . . . . . . . A. Identification of Regulatory Proteins . . . . . . . . . . . . . . . , . . . . . . . . . . B. Mechanisms for Autogenous Regulation . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. Significance of Autogenous Regulation . . . . . . . . . . . . . . . . . . . . . . . . . . . . VI. Regulation of Transcription of Ribosomal Genes . . . . . . . . . . . . . . . . . . . . . , VII. Current Status of Our Understanding of the Regulation of Ribosome Synthesis . . . . . , . . . . . . . . . . . . , . . . ............... References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
53 54 55 59 61 61 62 65
77 78 80 82 85 85
92 98
102 107
111
1. Introduction In bacteria a striking correlation is seen between the rate of ribosome formation and the rate of cell mass synthesis. This relationship suggests that the adjustment of ribosome accumulation is an integral part of the regulation of cell growth rate. To better understand the physiological relevance and ramifications of this correlation, the syn53 ADVANCES IN GENETICS, Vul. 21
Copyright Q 1982 by Academic Press, Inc. All rights of reproduction in any form reserved. ISBN 0-12-017621-1
54
LASSE LINDAHL AND JANICE M. ZENGEL
thesis of bacterial ribosomes, predominantly in Escherichia coli, has been the subject of intense investigation for almost 25 years. The E . coli ribosome is a complex organelle, composed of three different rRNA molecules (16S rRNA found in the 30 S subunit, and 23 S and 5 S rRNA found in the 50 S subunit) and 53 different ribosomal proteins (30 S subunit proteins S1 through S21 and 50 S subunit proteins L1 through L7, L9 through L25, and L27 through L34). In addition, the synthesis of protein by ribosomes is directly dependent on a number of auxiIiary functions performed by tRNAs and nonribosomal proteins such as RNA polymerase, initiation, elongation and termination factors, and aminoacyl tRNA synthetases. In order to completely understand how the capacity for protein synthesis is regulated, we must investigate the synthesis and degradation of each of the more than 50 components of the ribosome “proper” and their assembly into ribosomes, the synthesis and degradation of the auxiliary components, and the regulation of the activity of the functional complexes (i.e., ribosomes, RNA polymerase, etc.). Further complexity is undoubtedly added to the regulation by the interaction of all these different processes. Physiological experiments have resulted in a detailed phenomenological description of ribosome synthesis and activity but have provided only limited insight into the molecular mechanisms responsible for the regulation. However, the recent development of recombinant DNA technology has greatly facilitated investigation of the ribosome synthesis by genetic and biochemical methods. A major effort to understand the molecular genetics of ribosomal proteins (r-proteins) and rRNA in E . coli, initiated some 7 years ago, has recently led to the clarification of at least some of the molecular mechanisms regulating ribosome synthesis. The major focus of this article is to summarize these recent developments and to evaluate them in the context of other physiological and biochemical evidence. Some features of ribosome genetics and synthesis will be covered only superficially or not at all; in those cases we will refer the interested reader to other reviews which have appeared in recent years. II. Phenomenological Description of Ribosome Accumulation
Extensive studies of ribosome accumulation in bacteria have identified two general types of response to the growth conditions of the cell. First, the rate of accumulation of ribosomes relative to the total synthesis of biomass (i.e., the differential rate of ribosome accumu-
55
RIBOSOMAL GENES IN BACTERIA
lation) is correlated with the growth rate of exponentially growing cells; the growth rate, in turn, is determined by the composition of the growth medium. We will refer to this phenomenon as the “growth rate-dependent regulation.” Second, when cells are deprived of a n essential amino acid, the differential accumulation of ribosomes is drastically reduced. This is called the “stringent response.” These two basic observations have provided the groundwork for investigations of the mechanisms regulating ribosome synthesis. Therefore, to provide a perspective for our discussion of recent studies of the organization and expression of ribosomal genes, we will first summarize the results of physiological experiments describing ribosome accumulation. For more details of these experiments, the reader should consult reviews by Maaloe and Kjeldgaard (19661, Maaloe (1969 and 19791, Kjeldgaard and Gausing (19741, Nierlich (19781, Gallant (1979), and Gausing (1980).
A. GROWTH RATE-DEPENDENT REGULATION 1. Growth Rate and Ribosome Synthesis The growth rate of an E . coli culture during exponential growth phase is determined by the composition of the growth medium. After a few doublings in the exponential phase, the culture will reach a state of balanced, or “steady-state,” growth. This state is defined as the condition in which the chemical composition of the cells is independent of time; i.e., all components accumulate in proportion to their present fraction of the cell mass. The fraction of the cell mass occupied by the ribosomes during balanced growth is correlated with the cell growth rate (usually defined as p, the reciprocal of the doubling time expressed in doublings per hour). At growth rates above approximately 1 doubling per hour, the ribosomal fraction of the cell mass increases as a linear function dependent on p. (Fig. la). This implies that the capacity for total protein synthesis in fast growing cells is determined by the number, rather than the activity, of the ribosomes (Maaloe and Kjeldgaard, 11, the ribosome 1966). However, a t lower growth rates (below p, content is higher than expected from the simple function which is characteristic of faster growing cells. In fact, it has been found that only a fraction of the ribosomes in more slowly growing cells are active in protein synthesis, but the active ribosomes translate at the same rate found in fast growing cells (Koch, 1971). Altogether, the fraction of the cell mass occupied by ribosomes ranges from about 15% at 0.2 to about 45% a t p, 2.5.
-
-
-
LASSE LINDAHL AND JANICE M. ZENGEL
0.3
0.2
0.1
0
1
2
3
1
doublings / hr
2
3
FIG. 1. Growth rate-dependent regulation of ribosome function. (a) Variations in the fraction of cell mass devoted to ribosome synthesis at different growth rates. Shown is a “smoothed graph of measurements of the amount of rRNA relative to total cell mass found in cultures in balanced growth in different media. The data were taken from Koch (1970) and Forchhammer and Lindahl (1971). (b) Variations in the differential rate of r-protein synthesis cq, where ar = d(r-protein)ld(total protein). Shown is the “smoothed” graph of the amount of radioactivity found in r-proteins relative to the amount of radioactivity found in total protein after a brief administration of radioactive amino acid to cells growing in different media. Data are from Gausing (1974), Dennis and Bremer (19’741, and Gausing (1977).
The rate of ribosome accumulation (A ribosome/A t) can be obtained by dividing the mass fraction of ribosomes by the cell doubling time. Consequently, at high growth rates the rate of ribosome accumulation is a function of p2. The rate of ribosome accumulation varies more than 30-fold between p - 0.2 and p - 2.5. More recent experiments have extended the correlation between growth rate and ribosome accumulation to growth rate-dependent regulation of the synthesis of the proteins of the ribosome (synthesis of rRNA is discussed in Section IV). The differential synthesis rate of total r-protein, ar,where a, = rate of r-protein synthesishate of total protein synthesis, has been measured during balanced growth in several different media. Results from several laboratories have shown that a, is regulated in parallel with the number of ribosomes per cell mass (Fig. l b ; Gausing, 1974, 1977; Dennis and Bremer, 1974). Fur-
RIBOSOMAL GENES I N BACTERIA
57
thermore, the synthesis of the individual r-proteins is also regulated coordinately with the growth rate, at least in the range of growth rates investigated (0.65 < p < 1.9; Dennis, 1974a). Since the pool sizes of free r-proteins constitute only a few percent of the total amount of each r-protein (Gausing, 1974; Marvaldi et al., 19741, and since all r-proteins (except L7/L12) are found in one copy per ribosome (Hardy, 19751, this suggests that the individual ribosomal proteins (except L7/ L12) are synthesized in equimolar amounts and that their synthesis is regulated coordinately. L7 and L12 are the products of a single structural gene, L7 being a n acetylated derivative of L12. The ratio of L7 t o L12 changes with the growth condition, but the sum of the two forms is three to four copies per ribosome irrespective of the growth rate (Thammena et al., 1973; Dennis, 1974a; Ramagopal and Subramanian, 1975). Thus, L7/ L12 is also synthesized coordinately with, but in 3- to 4-fold molar excess over, the remaining r-proteins.
2. Synthesis of Other Transcriptional and Translational Components As we mentioned in the Introduction, protein synthesis requires a large number of auxiliary components such as aminoacylated tRNAs, RNA polymerase, and peptide initiation, elongation, and termination factors. To fully understand how the cell regulates its investment in the protein synthesis apparatus, we need to know how the accumulation of these nonribosomal constituents is regulated. To date, the conclusions from studies of the regulation of these macromolecules indicate that a variety of regulatory patterns are involved in their regulation. The accumulation of a number of nonribosomal proteins is tightly coordinated with ribosome accumulation. This is particularly clear with the peptide elongation factors EF-Tu, EF-Ts, and EF-G (Furano, 1975; Pedersen et al., 1978a; Miyajima and Kaziro, 1978). Under a variety of growth conditions, the cell maintains a ratio of 10 EF-Tu molecules, 1 EF-Ts molecule, and 1 EF-G molecule per ribosome (Pedersen et al., 1978a). However, this coordination is not observed for the peptide initiation factors; these proteins constitute a n almost constant fraction of the cell mass at different growth rates (Kraus and Leder, 1975). A complex regulatory pattern is also found with tRNAs and the tRNA synthetases and modifying enzymes. In fast growing cells, the accumulation of tRNAs is coordinated with ribosome accumulation. There are a total of 7 to 8 tRNA molecules per ribosome a t growth
58
LASSE LINDAHL AND JANICE M. ZENGEL
rates above 0.6 doublings per hour. However, at lower growth rates the tRNA/ribosome ratio increases about 2-fold (Nierlich, 1978). Several aminoacyl tRNA synthetases are also found in a fixed number per ribosome, irrespective of the cell growth rate, but others are apparently more loosely coordinated with ribosome accumulation (Neidhardt et al., 1977; Pedersen et al., 1978a). Similarly, some tRNA modifying enzymes are regulated differently from the ribosomes (Ny et al., 1980). However, one enzyme involved in tRNA modification, tRNA(m’U)-methyltransferase, is regulated coordinately with ribosomes under a variety of growth conditions (Ny and Bjork, 1980). The accumulation of RNA polymerase has been investigated by a number of laboratories (see, e.g., Matzura et al., 1973; Iwakura et al., 1974; Blumenthal et al., 1976a; Engbaek et al., 1976; Pedersen et al., 1978a). Unfortunately, there are a number of discrepancies between the different measurements. In spite of these differences, though, several important properties of RNA polymerase accumulation have emerged from the large body of data. First, the accumulation of RNA polymerase subunits p, p’, and cx apparently increases less with the growth rate than does the accumulation of ribosomes. Thus, there are somewhat more RNA polymerase molecules per ribosome at low growth rates than at high growth rates. Also, there is a greater number of cx subunits compared to p and p’ subunits than the a$p’ subunit composition of the core RNA polymerase would predict. The number of p and p’ subunits is approximately one per five ribosomes. Finally, at any given growth rate only a fraction (20 to 30%) of the total RNA polymerase molecules are actively transcribing, although it is not clear whether the remaining RNA polymerase molecules are functional (see Nierlich, 1978). For a more detailed discussion of the accumulation of RNA polymerase, see Yura and Ishihama (19791 and Shepherd et al. (1980). 3. Shifts between Growth Media When cells are shifted from one type of growth medium to another, a situation of dynamic regulation can be obtained. Studies utilizing such shifts can provide new information which could not be extracted from studies of the static regulation operating in a balanced state of growth. A shift of cells to a medium which can support faster growth than the preshift medium (called a “shift-up”) induces an immediate increase in the differential accumulation of rRNA ( (Maabe and Kjeldgaard, 1966), r-proteins (Gausing, 19801, and RNA polymerase (Yura and Ishihama, 1979). This rapid response to the growth conditions
RIBOSOMAL GENES IN BACTERIA
59
strengthens the hypothesis that the regulation of the synthesis of the ribosome and its auxiliary components is of direct importance for determining the overall cell growth rate. It was originally assumed that the regulatory pattern characteristic of balanced growth in the postshift medium was obtained immediately. More accurate measurements, however, have shown that the differential synthesis of rproteins (Dennis, 1974b; Gausing, 1980) and rRNA (Gausing, 1980) goes through several corrections before the final rate is obtained. Since the assembly of ribosomes from rRNA and r-protein takes 2 to 5 minutes (Lindahl, 19751, these oscillations may be due to the fact that an increase in the protein synthesis capacity is not obtained until several minutes after the synthesis of the individual ribosomal components has been boosted. Therefore, it is likely that the cell has to go through several alterations before the synthesis of ribosomal components matches its need for total protein synthesis capacity (see Section VII for details). When the growth rate is decreased by reducing the availability of a carbon source (called a “shift-down”),the cells respond by reducing the accumulation of both rRNA and r-protein within a few minutes after the shift. The reduction in accumulation appears to result from both reduced synthesis and increased degradation of both rRNA and r-protein (MaalZe, 1979). It is interesting that the rapid reduction in the synthesis of ribosomal components is seen in both stringent and relaxed strains (see below). More thorough discussions of shift-up and shift-down experiments have recently been given by Nierlich (19781, Maalge (19791, and Gausing (1980).
B. STRINGENT RESPONSE Deprivation of a given species of aminoacyl tRNA leads to a strong reduction in the accumulation of rRNA in wild-type cells; this response is defined as the “stringent” phenotype. Mutants, called “relaxed” strains, have been isolated which fail to reduce rRNA accumulation during aminoacyl tRNA starvation. There are several classes of relaxed mutants which map at different loci (Nierlich, 1978; Gallant, 1979),but most studies, including those described in this section, have been done with the reZA locus. Strains which have a temperature-sensitive aminoacyl tRNA synthetase can be used to create a partial starvation for a given class of aminoacylated tRNA by growing the strains at a temperature intermediate between the completely permissive and the completely nonpermissive temperatures. Such states of partial starvation in a valSts
60
LASSE LINDAHL AND JANICE M. ZENGEL
mutant have been used to study the influence of the stringent control system on the synthesis of proteins. In partially starved wild-type (relA’) cells, not only rRNA synthesis but also the differential synthesis of r-protein is reduced, even at temperatures creating only a moderate reduction of the overall protein synthesis. In contrast, the differential synthesis of the r-proteins is increased in a relA mutant (Dennis and Nomura, 1974). Thus, the synthesis of both rRNA and r-protein is clearly under stringent control. Similar studies have examined the role of stringent control in the synthesis of other proteins participating in protein synthesis. The synthesis of EF-Tu(A) (EF-Tu synthesized from the tufA gene; see Section 111),EF-Ts, and EF-G are all stringently controlled, i.e., their synthesis is reduced in a stringent strain and stimulated in a relaxed strain, in both cases to about the same degree as r-proteins (Furano and Wittel, 1976; Reeh et al., 1976; Blumenthal et al., 197613). The synthesis of EF-Tu from the t u p gene (“EF-Tu(B)”)is also under stringent control, but the response of EF-Tu(B) to different degrees of valyl tRNA deprivation is apparently not coordinate with the response of r-proteins and EF-Tu(A) (Reeh et al., 1976). For example, in a stringent strain grown at temperatures where the synthesis of total protein is only weakly affected but the synthesis of r-protein is almost completely curtailed, the differential synthesis of EF-Tu(B) is not reduced. However, at temperatures where total protein is more severely affected, the differential synthesis of EF-Tu(B) is reduced. This difference in behavior of EF-Tu(A) and EF-Tu(B) was observed in a strain carrying a mutated tufB gene (Reeh et al., 1976). It is not known whether this mutation affects the response of EF-Tu(B) synthesis to stringent control. The response of RNA polymerase subunits to stringent control is also complex. The synthesis of OL follows a pattern similar to EF-Tu(B1. At temperatures with little effect on total protein synthesis, the synthesis of a is relatively unaffected in stringent strains and somewhat stimulated in relaxed strains (Blumenthal et al., 1976b; Reeh et al., 1976).A t higher temperatures a pattern of typical b . , like r-proteins) stringent and relaxed response is observed. The differential synthesis of p and p’ is unaffected in both relaxed and stringent strains at mildly restrictive temperatures (Blumenthal et al., 1976b; Reeh et al., 1976; Maher and Dennis, 19771, but p is reduced in both stringent and relaxed strains during more severe starvation for valyl-tRNA (Reeh et al., 1976). Thus, the synthesis of a seems to be under a “modified” stringent control, but p and p’ are not stringently controlled at all.
RIBOSOMAL GENES I N BACTERIA
61
111. Genetics of E. coli Ribosomes
A prerequisite for analyzing the molecular basis for regulation of ribosome synthesis is detailed information about the organization of the genes for the ribosomal components. However, since the ribosome is an indispensable subcellular organelle, genetic studies of the ribosome are restricted by the fact that many mutations in these essential genes would be detrimental, if not lethal, to the cell. Until recently, our knowledge of the organization of ribosomal protein genes was essentially limited to the mapping of mutations resulting in antibiotic resistance or dependence and to the identification of electrophoretic or chromatographic variants observed after interspecific or intergeneric matings. Information about the organization of ribosomal RNA genes was also limited. In the past 7 years, however, the introduction of novel techniques for the analysis of these essential genes has greatly facilitated investigations not only of their genetic organization, but also of the regulation of their expression. OF MUTANTS A. ISOLATION
One successful procedure for the isolation of mutations in ribosomal proteins has been to heavily mutagenize the cells with nitrosoguanidine, isolate temperature-sensitive mutants, and screen the mutants for alterations in ribosomal proteins as detected by two-dimensional gel electrophoresis (K. Isono et al., 1976, 1977; S . Isono et al., 1978). Although in most cases further genetic analysis indicated that the temperature sensitivity and the ribosomal protein alterations resulted from independent mutations, the method has, nevertheless, been extremely useful for the identification of structural genes for ribosomal proteins as well as of genes involved in modifying and processing the proteins. Additional mutations have been isolated by selecting streptomycinindependent revertants of a strain requiring streptomycin for growth (Dabbs and Wittmann, 1976; Dabbs, 1978a). Similarly, mutants have been isolated as temperature-insensitive revertants of strains harboring temperature-sensitive defects in alanyl or valyl tRNA synthetase (Wittmann et al., 1974, 1975; Bock et al., 1974; Buckel et al., 1976). In both of these procedures, the mutations were again identified by screening by two-dimensional gel electrophoresis. Mutations in several ribosomal protein genes have also been obtained by “localized mutagenesis” (Berger et al., 1975; Cabezdn et al., 1977; Herzog et al., 1979) and by a method designed to isolate amber
62
LASSE LINDAHL AND JANICE M. ZENGEL
mutations in ribosomal protein genes (Delcuve et al., 1977). All of these procedures, as well as a more exhaustive analysis of antibiotic resistant and dependent mutations (Dabbs, 1978b; Hummel et al., 1979; Buckel et al., 1977) have greatly increased our repertoire of ribosomal mutants, providing valuable tools for the study of ribosome function and biosynthesis. (For a more detailed description of the techniques used for the isolation and characterization of mutations in ribosomal protein genes and genes involved in their modification and processing, see Isono, 1980.) B. FINESTRUCTURE ANALYSISOF rRNA AND r-PROTEIN OPERONS Classical techniques of bacterial genetics have been used to roughly map most of the ribosomal protein genes for which mutationally derived variants are available. Likewise, genes involved in modifying and processing the ribosomal proteins have also been mapped by traditional techniques. However, precise mapping of these genes using classical techniques is complicated by the extensive and sometimes lethal interactions among ribosomal components in the ribosome and is limited to genes for which phenotypic variants are available. Furthermore, the essential nature of the r-protein genes has excluded the extensive use of the types of mutations, for example, deletions and polar mutations, which have been so useful in elucidating the genetic organization and regulation of other operons. The precise mapping of rRNA genes has also been difficult using classical genetic techniques. Early studies were dependent on gene dosage effects using F’ plasmids carrying rRNA genes and on sequence differences in rRNAs in interspecific or intergeneric crosses. Recently, difficulties in analyzing rRNA and r-protein genes have been to a large extent overcome by the isolation and characterization of specialized transducing phages and plasmids carrying r-protein and rRNA genes. Very detailed mapping of r-protein genes has resulted from the analysis of proteins synthesized in cell-free systems programmed by phage o r plasmid DNA or by purified DNA restriction fragments (see, e.g., Lindahl et al., 1977a,b). The organization of these genes has also been deduced from experiments monitoring protein synthesis in ultraviolet-irradiated cells infected with the transducing phages (see, e.g., Jaskunas et al., 1975, 1977). Furthermore, by using hybrid phages carrying segments of DNA from the original phages, and deletion and insertion mutants of the transducing phages, not only the r-protein gene order but also the transcriptional organization and positions of promoters have been determined (e.g., Jaskunas and
RIBOSOMAL GENES IN BACTERIA
63
Nomura, 1977; Jaskunas et al., 1977). Similarly, the mapping and organization of rRNA genes has been accomplished by heteroduplex and RNA-DNA hybridization studies using plasmids and phages carrying rRNA genes (e.g., Ohtsubo et al., 1974; Lindahl et al., 1975; Kenerley et al., 1977). These new physical and biochemical techniques, coupled with the classical techniques used for characterization of available mutations, have resulted in the identification of structural genes for 47 r-proteins. The genes for just five proteins-S9, L13, L20, L31, and L34-remain to be mapped. In addition, seven rRNA transcription units and the genes for several rRNA processing and modifying enzymes and for many other components of the translation and transcription machinery including RNA polymerase subunits p, p', a,and u and elongation factors EF-Tu, EF-G, and EF-Ts have also been identified. The chromosomal locations of these genes are shown in Fig. 2, and are summarized in Tables 1 and 2. In the remainder of this section on the genetics of E . coli ribosomes we will briefly describe the conclusions and implications of the fine structure genetic analysis of ribosomes. For further details, the reader should consult previous reviews (Nomura, 1976; Nomura et al., 1977; Nomura and Post, 1980).
1 . Organization of rRNA Genes Seven rRNA transcription units, each containing one gene apiece for the three rRNA species, have been identified and mapped on the E . coli chromosome (Fig. 2, Table 2). The order of the genes is 5'16 S-spacer-23 S-5 S-3'. A 30 S precursor rRNA molecule containing the sequences of all three rRNA species has been isolated from RNase III-deficient mutants, demonstrating that the whole rRNA transcription unit is cotranscribed and then processed (Dunn and Studier, 1973; Nikolaev et al., 19731. In addition to RNase 111, several other enzymes have been implicated in the processing of the 30 S rRNA transcript into mature 16 S, 23 S, and 5 S molecules (for a recent review, see Apirion et al., 1980). Interestingly, the 16 S-23 S spacer regions in rRNA operons have been found to harbor tRNA genes (Lund et al., 1976; Morgan et al., 1977).Two classes of spacers have been identified; one has a gene for tRNA,"", and the other has genes for both tRNA,,*'" and tRNA"" (Table 2). In addition, some but not all rRNA operons have distal tRNA genes (Morgan et al., 1978). 2 . Organization of r-Protein Genes Approximately half of the genes for r-proteins in E . coli have been mapped in the str region of the E . coli chromosome, around minute
64
LASSE LINDAHL AND JANICE M. ZENGEL
cluster
FIG. 2. Genetic map of E . coli K12 chromosome showing locations of genes for rRNA, r-proteins, RNA polymerase subunits, and peptide elongation factors. The chromosome is divided into 100 minutes (Bachmann and Low, 1980).Where it is known, the direction of transcription is indicated by arrows. Gene sets of rRNA are indicated by r m " X (see Table 2); the general structure of each of the transcription units is 16 S gene, spacer tRNA, 23 S gene, 5 S gene. Genes coding for proteins are indicated by the names of their products. Transcription units in the str and rif clusters are identified by the operon "names"; details of the genes mapping in these operons are shown in Figs. 3 and 4.For further details of the mapping of these genes, see Isono (1980), Nomura and Post (19801, and Bachmann and Low (1980).
72 (Fig. 2; Jaskunas et al., 1977; Lindahl et al., 1977a). In addition to the genes for 27 r-proteins, genes for elongation factors EF-G and EF-Tu and for RNA polymerase subunit a have also been mapped in this cluster. The genes are arranged in four transcription units (Jaskunas and Nomura, 1977) which are transcribed counterclockwise on the E . coli chromosome (Jaskunas et al., 1975). The organization of these four operons is shown in Fig. 3. Another smaller cluster of r-protein genes has been identified in the rifregion, at 88 minutes on the E . coli map (Fig. 2). This cluster contains genes for 50 S proteins L1, L7/L12, L10, and L11 and the p and p' subunits of RNA polymerase, as well as a second gene for elongation factor EF-Tu (Lindahl et al., 1975; Watson et al., 1975).
RIBOSOMAL GENES I N BACTERIA
65
The r-protein genes in this region are organized into two transcription units, one containing the genes for L11 and L1, and the other containing the genes for L10, L7/L12, and p and p’ (Yamamoto and Nomura, 1978, 1979; Linn and Scaife, 1978; Newman et al., 1979). The EF-Tu gene in this region appears to contain its own promoter (Yamamoto and Nomura, 1979; Linn et al., 1979). The transcriptional organization of the rifregion is shown in Fig. 4. Much less detail is known about the genetic organization of r-proteins mapping outside the str and rifregions. Although several small clusters of r-protein genes have been found scattered around the E . coli chromosome (Fig. 21, we do not know if the genes in these clusters are organized into polycistronic transcriptional units.
c. IMPLICATIONS OF THE GENETICORGANIZATION OF r-PROTEIN AND rRNA GENES
Considerable progress has now been made in establishing the details of the genetic organization of the many components of the translation machinery of E . coli. In some respects, as summarized below, these genetic studies have yielded surprising results, and suggest that the regulation of ribosome synthesis may be even more complicated than our original and somewhat naive models had assumed. This information has been vital in providing a framework for interpreting data from regulatory experiments and for designing rational experiments to test possible molecular mechanisms involved in the regulation of ribosome synthesis.
1 . Organization and Number of rRNA Genes The rRNA genes in bacteria are redundant. We assume that the multiple copies of the rRNA genes are necessary to provide sufficient rRNA for rapidly growing cells, but it is not clear that the cells require exactly seven transcription units for optimal growth. Recently, Ellwood and Nomura (1980) isolated a strain of E. coli in which one of the rRNA operons had been deleted, and they observed no significant change in the phenotype even under optimal laboratory growth conditions. The scattering of the seven rRNA transcription units around the E . coli chromosome rather than a tandem organization of the genes may reflect a mechanism to select against the deletion or duplication of rRNA operons by unequal crossover (Ellwood and Nomura, 1980). In fact, duplications of regions of the chromosome can be generated via unequal crossover between rRNA operons, resulting in a n increase
TABLE 1 Genes for Ribosomal Proteins, RNA Polymerase Subunits, and Peptide Elongation Factors" ~
Protein 30 S r-proteins
s1
S2 s3 s4
s5 S6 s7 S8 s9 s 10
s11 s12 S13 S14 S15 S16
Gene name
Map position (minutes) 20 4 72 72 72 95 72 72 ? 72 72 72 72 72 68 56
Operon
~~
Protein 50 S r-proteins L1 L2 L3 L4 L5 L6 L9 L10 L11 L12 L13 L14 L15 L16 L17 L18
Gene name
Map position (minutes)
rplA rPB rplC rplD (eryA) rpm TPfl rp 11 rPkJ rplK (relC) rplL rplM rplN TlO rplP rplQ rPm
89 72 72 72 72 72 95 89 89 89 ? 72 72 72 72 72
Operon L11 s10 s10 s10 SPC SPC
-
P
L11
P
SPC
SPC s10 a
SPC
S17 S18 s19 s20 s 21 RNA polymerase subunits a
P P‘
U
Elongation factors EF-G EF-TuA EF-TUB EF-TS
rpsQ (neu-4) rpsR
rpss rpsT rps U rpoA
rpoB rpoc rpoD fusA tufA turn
tsf
72 95 72 0 67 72 90 90 67 73 73 89 4
s10 -
s10 -
a
P P
-
str str
-
L19 L20 L2 1 L22 L23
rplS rplT rplU rplV rplW
56
L24 L25 L27 L28 L29 L30 L3 1 L32 L33 L34
rplX rplY
72 46 69 81 72 72 ? (30) 81
r P A
r p d rpmC rP rnD
rPd r p d
rpmG rpmH
?
69 72 72
?
-
s10 s10 SPC
-
s10 SPC
-
Q)
4
a Alternate gene symbols are given in parentheses. For proteins whose structural genes have been mapped within polycistronic transcription units, the operon “name” is indicated (see Figs. 2, 3, and 4). The map location of the gene for L32 has only been approximately determined (Isono, 1980). An essentially complete source of references for the information compiled in this table can be found in Bachman and Low (1980). For a detailed description of the genetics of r-protein processing and modifying enzymes (which are not included in this table), see Isono (1980).
68
LASSE LINDAHL AND JANICE M. ZENGEL
TABLE 2 Ribosomal RNA Transcription Units of E. coli K12: Chromosomal Locations and Associated tRNA Genes" rRNA operon
Map position (minutes)
Spacer tRNA genes
Distal tRNA genes
rrnA rrnB rrnC rrnD rrnE rrnF rrnG
86 89 84 72 90 74 56
tRNA"', tRNApk tRNAt'" tRNAz'" tRNA"", tRNAf: tRNA:'" [tRNA"', tRNAt: tRNAg'"
tRNAf"P,tRNA% tRNATh' tRNAf"P1 -
Details of the mapping of the rRNA operons on the E . coli chromosome are given in reviews by Nomura et al. (1977) and Nomura and Post (1980). For the assignment of spacer and distal tRNA genes to rrn operons A through E, see Morgan et a2. (1977) and Nomura and Post (1980). Sequencing studies have recently confirmed the association of many of these tRNA genes, including the spacer tRNA genes in rrnB (Brosius et al., 1981; C . Squires and C. L. Squires, personal communication), the spacer tRNA (C. Squires and C. L. Squires, personal communication), and distal tRNA (Young, 1979) genes in rrnC, and the distal tRNA gene (and extra 5 S gene) in rrnD (Duester and Holmes, 1980). The assignment of the spacer tRNA gene in the rrnG operon is based on heteroduplex studies using the rmG-containing A transducing phage isolated by Zurawski and Brown (1979) and the hybrid plasmids carrying various rRNA operons characterized by Kenerley et al. (1977) (M. Ellwood and M. Nomura, personal communication). The identification of this spacer tRNA has been confirmed by sequencing analysis (C. Squires and C. L. Squires, personal communication). Since studies of rRNA operons isolated as hybrid plasmids have identified an additional rRNA gene set carrying tRNA"", tRNAf2 spacer tRNAs (Kenerley et al., 1977; Morgan et al., 1977), and since the E . coli chromosome appears to contain only seven rRNA operons (Kiss et al., 19771, by a process of elimination these spacer tRNA genes have been tentatively assigned to the remaining ( r r F )rRNA operon. Sequencing studies of hybrid plasmids presumed to carry the rrnF operon have confirmed the presence also of a tRNAASp gene a t the distal end of this operon (Sekiya et al., 1980). It should be noted, however, that no direct correspondence has been shown between the rrnF gene mapped at 74 minutes by Vola et al. (1977) and the "rrnJ"' carried on these hybrid plasmids. Therefore, t o indicate this ambiguity, the tRNA genes listed for rrnF are enclosed in brackets.
in the number of rRNA transcription units; such duplications are unstable and must be maintained by selection (Hill et al., 1977). It is not known if the reiterated rRNA sequences result in any significant (detectable) level of rearrangements of rRNA genes or spacer tRNAs on the E . coli chromosome during normal cell growth. In this regard, it is interesting to note that sequencing studies have revealed structural rearrangements within rRNA operons among independent isolates of operons on transducing phages and plasmids (see, e.g., Morgan
1 kb
FIG. 3. Organization of genes in the str region of the E. coli chromosome. The DNA in the str region has been drawn approximately to scale, except about 15 kilobases have been “deleted a t the site indicated by the diagonal lines. This deleted region does not encode any known proteins. The genes are identified by the names of their products and are indicated by boxes whose lengths are roughly proportional to the expected length of each gene based on molecular weights of the corresponding protein product. The four transcription units in this region are indicated by horizontal arrows. Their promoters are designated as “P,.” For more details about the genetic organization of the str region, see the review by Nomura and Post (19801.
1 kb
H
1
P
B
a
pLII
pu
0 pt“fB
(?I
FIG. 4. Organization of genes in the rzfregion of the E. coli chromosome. The top section of the figure shows the DNA i n the rif region drawn approximately to scale. The genes are identified by the names of their products and are indicated by boxes whose lengths are approximately proportional to the expected length of each gene based on molecular weights of the corresponding protein products. The four transcription units in this region are indicated in the lower part of the figure by horizontal arrows. Their promoters are designated as “PX.” The precise location of the promoter for the EF-Tu gene has not yet been determined. “U” is a protein of unknown function. For more details about the genetic characterization of the rif region, see Nomura and Post (1980) and Friesen et al. (1980).
71
RIBOSOMAL GENES IN BACTERIA
et al., 1977; Boros et al., 1979; Young et al., 1979; Bram et al., 1980; Brosius et al., 1981). Further experiments will hopefully determine whether these observations are simply artifacts of the construction of the phages or plasmids, or representative of “normal” recombination events between various rRNA operons on the chromosome. Sequencing of the promoter regions of five rRNA operons (deBoer et al., 1979; Young and Steitz, 1979; Csordas-Toth et al., 1979; Brosius et al., 1981) and in uitro transcription experiments (Young and Steitz, 1979; Glaser and Cashel, 1979; Gilbert et al., 1979) have revealed a surprising characteristic of rRNA operons: the presence of two tandem promoters approximately 100 bases apart. The promoters for rRNA transcription units contain the basic elements observed for other E . coli promoters, including a Pribnow box and a “ - 3 5 region” (see review by Rosenberg and Court, 1979). However, the first promoters are striking in that all five sequenced operons contain an identical 15 base sequence including the Pribnow box (Fig. 5). The sequence, Pribnow [uenci
-35
TCAGAAAATTATTTTAAATTTCCT TGTC GCCGGAATAACTCC ATAAT GCCAEACTGACACG @
TCAGAhAATTATTTTAAATTTCCT TTGTC
GCCGGAATAACTCC
ATAAT
GCCAEACTGACACG
ACACAtAAAAAGATCAAAAAAATA TTGTG
AAAAATTGGGATCC
ATAAT
GCCTEGTTGAGACG
rrnE
CAGTCATTTTTCTGCAATTTTTCT TTGCG CCTGCGGAGAACTCC
ATAAT
GCCTCCATCGACACG
rrnx
TTGAAAATAAAATGCATTTTTCCG TTGTC CCTGAGCCGACTCC
ATAAT
GCCTCCATCGACACG
rrnA rrnB
I
I
- 50
I
Eonl
-30
,
-1b
-L--
GAGAAAGCAA _ _ GAGAAAGCAA - -
_ _ -
- 50 -30 - 10 FIG. 5. Comparison of promoter sequences of rRNA operons. The antisense strands are shown, and are aligned to maximize homologies. The transcription start sites, at the + 1 position, are indicated by arrows. The first promoters are approximately 310 bases from the sequence coding for 16 S rRNA; the second promoters are approximately 190 bases from the 16 S rRNA sequence. The Pribnow boxes and the -35 region sequences are enclosed by boxes. Regions of complete homology for all five sequences are underlined. References for the sequences are rrnA and r r E , deBoer et al. (1979); rrnD and rrrzX, Young and Steitz (1979); r r B , Csordas-Toth et al. (1979). “ r r n X is a hybrid rRNA operon isolated on the transducing phage hilu5 and believed to carry the promoter region from rrnF or rrnG and the distal portion of rrnC (Collins et al., 1976; Morgan et al., 1977; Boros et al., 1979, Bram et al., 1980).
c.
2 2
72
LASSE LINDAHL AND JANICE M. ZENGEL
which is not found in the second promoter region, may signify some regulatory feature important for coordinating the expression of the rRNA operons in response to regulatory signals such as the stringent response or growth rate dependence. The second rRNA promoters, which contain two different Pribnow sequences (Fig. 51, are interesting because their transcripts in all five cases are initiated with CTP rather than the usual ATP or GTP (Young and Steitz, 1979; Gilbert et al., 1979). Preliminary experiments indicate that the frequency of initiation of transcription in uzuo is higher at the first promoter than at the second (deBoer and Nomura, 1979; Lund and Dahlberg, 19791, although Kiss et al. (1980) report that the in uitro binding of RNA polymerase is stronger at the second promoter. Further measurements under different physiological conditions are necessary to determine what role the tandem promoters may play in modulating rRNA synthesis. It has been suggested that the very high transcription frequency of rRNA operons is due to the existence of multiple (4 to 5 ) promoter sites in each operon (Venetianer et al., 1976; Travers, 1976; Mueller et al., 1977). The sequencing results indicate that there are only two transcription initiation sites per operon, but do not rule out the possibility of additional RNA polymerase recognition and “storage” regions (Csordas-Toth et al., 1979) that could facilitate a high rate of initiation. The storage regions, for example, might correspond to the AT-rich regions found upstream from the Pribnow sequences (Fig. 5 ; Csordas-Toth et al., 1979). Four distinct but weak RNA polymerase binding sites have been mapped by in uitro studies in the region preceding the two initiation sites (Kiss et al., 1980). The organization of rRNA operons into transcription units carrying one gene each for 16 S, 23 S, and 5 S rRNA ensures their production in equimolar amounts. But surprisingly, sequencing results reported by Duester and Holmes (1980) indicate that one rRNA operon, r r D , contains two 5 S genes. No duplication of 5 S genes has been observed for the rrnB (Brosius et al., 19Sl), rrnC (Young, 19791, or rrnF(or G ) (Sekiya et al., 1980) operons. The physiological relevance of the extra 5 S gene in rrnD is not yet clear. The significance of the association of tRNA genes with rRNA operons is also not clear. These genes code for major abundant tRNAs which account for a large fraction of tRNAs in the cell. Thus, their cotranscription with rRNA explains in part the observed coordination in the accumulation of tRNAs with ribosome accumulation (Section 11). But it is not yet understood why there are only two classes of spacer tRNA genes, or why only some of the rRNA operons contain
RIBOSOMAL GENES IN BACTERIA
73
distal tRNA genes (Table 2). Their cotranscription with rRNA may have some important physiological significance; for example, these tRNAs may be used in the stringent control of ribosome synthesis (see Nomura et al., 1977, for 'a more detailed discussion).
2. Organization of r-Protein Transcription Units Perhaps the simplest mechanism for ensuring the coordinate synthesis of the various r-proteins would be to arrange their genes into one, or at most, several, transcription units. However, genetic studies have established that this is not the route taken by E . coli. Although many of the r-protein genes are clustered in the str region and in the rif region, the genes are nevertheless organized into multiple transcription units at both sites. Furthermore, other structural genes for r-proteins have been identified at a minimum of 10 distinct sites elsewhere on the bacterial chromosome. Therefore, even assuming that each of the gene clusters outside the str and rif regions represents single transcription units and that the five unmapped r-protein genes fall into one or more of these transcription units, the cell is faced with the formidable task of coordinating the expression of at least 16 rprotein operons. If the coordinate regulation of synthesis of the various r-proteins were simply the result of transcription initiated at promoters of equal strength and responding to identical regulatory signals, one might expect to find clues for the basis of this coordination by sequencing the promoter regions from different r-protein operons. With this goal in mind, Nomura and co-workers have determined the promoter sequences of five r-protein operons (Post et al., 1978, 1979, 1980). Their results, summarized in Fig. 6, show that the promoters for r-protein operons contain components which have been observed for other E . coli promoters: a Pribnow box, a - 35 sequence, and an A-T rich region in the - 35 to -45 region (Rosenberg and Court, 1979). However, although there are variable regions of dyad symmetry around the promoters of the sequenced r-protein operons, no other striking features of the promoters distinguish them from other E . coli promoters (see Nomura and Post, 1980, for a more detailed discussion of promoter sequences). Furthermore, there is considerably less homology between the various r-protein promoter regions than was found for rRNA transcription units (see Fig. 5 ) . Thus, there is no obvious structural feature that might account for coordinate regulation of the transcription of r-protein operons. The functional significance of the clustering arrangement of the various r-protein genes is not clear. The number of r-protein genes
74
LASSE LINDAHL AND JANICE M. ZENGEL
OPERON
*
--. _ -
GATCGTTGTATATTTCTTGACACCTTTTCGGCATCGCC~~~GGCG~CCTCAT~T~GTGT~
_____
~-
3s
AGCCGTTTATTTTTTCTACCCATATCCTTGAAGCGGTG~~~CGCGCCCTCGATATGGGGA
oc
T T T T C G C A T A T T T T T C T T G C A A A G T T G G G T T G A ~ ~ C T G G ~
L11
AGCGGCGATTTAATCGTTG~ACAAGGCGTGAGATTGGA~~~CGCGCCTTTTG~TTTTAIG ~-___
B
-.-
-_____
___--
TCTGTAAACTAATGCCTTTACGTGGGCGGTGATTTTGT~TACCCCC~ ** * * I I * I I * I I I
- 50
-40
-30
-20
-10
+1
+I0
FIG. 6 . DNA sequences from promoter regions of r-protein operons. The antisense strands are shown with the Pribnow box sequences, indicated by boxes, aligned. Transcribed regions, initiating a t the + 1 position, are indicated by dashed underlining. Regions of sequence symmetry are shown by overlining with a dot a t the center of the dyad symmetry. The p operon promoter region has a second pattern of dyad symmetry centered a t position - 121- 13 that is not indicated in the figure. Regions of complete homology are indicated by a n asterisk. References for the sequences are Post et al. (1978) for the str and spc operons, Post et al. (1979) for the L11 and p operons, and Post et al. (1980) for the (Y operon.
in a transcription unit ranges from one to eleven, with 30 S and 50 S proteins intermingled and cotranscribed. Thus, there seems to be little relationship between the genetic organization and the structure of ribosomes or the pathway for ribosome assembly. Perhaps one of the most interesting features of the organization of the r-protein operons is the presence of genes for the translation factors EF-Tu and EF-G and the RNA polymerase subunits p, p', and (Y within the same transcription units as the r-protein genes. This clustering may be important for coordinating the number of ribosomes with the levels of other proteins performing functions related to protein synthesis. Or, since the genes for r-proteins, RNA polymerase subunits, and translation factors are all transcriptionally active, their clustering may reflect a topographical feature of the bacterial chromosome that ensures the accessibility of these genes to the factors required for their continuous active expression (Nomura, 1975). 3. Stoichiometry Considerations
As with the rRNA operons, the organization of r-protein genes into multigene operons ensures the coordinate transcription of all genes within a given operon. Since the r-proteins are synthesized in equimolar amounts (except for L7/L12), one would predict that all r-protein cistrons on a polycistronic message are translated with equal fre-
RIBOSOMAL GENES IN BACTERIA
75
quency. If so, one might expect to find common features in the translation initiation sites of the cotranscribed genes. However, sequence studies of the ribosome binding sites of several r-protein genes have revealed no obvious basis for stoichiometric synthesis from cotranscribed genes (Post et al., 1978, 1979; Nomura and Post, 1980). Although all the sequenced initiation sites include a Shine-Dalgarno sequence (Shine and Dalgarno, 1974), the length of the sequence and its distance from the initiation codon is variable (Nomura and Post, 1980; see Fig. 7). The basis for the 4-fold higher synthesis of L7/L12 relative to L10, in spite of the cotranscription of their structural genes, is also not yet clear from the sequence studies of the ribosome binding sites. The mapping of genes for translation factors and RNA polymerase OPERON
str
GENE PRODUCT s12
57
TRANSLATION I N I T I A T I O N SEQUENCE
ACCASZCTATTT@ cA A C G G G T A T T T C ~
J E E ~ A C A AEF-G A E GC A A A T
XX
cc
L14
TTAGCGGAGCCTAA~
L24
TC-CGAAT~~
L30
CTGGGGAAAWJAC~
S13
c4
TAGT~GETGCAT@%J ' TGTTGGAGAAAGAACAAAGATRZC
L11
C T T ~ W T T T A T ~ ~
L1
GTFRZCT ---
54
L11
/
L10
CCAZ~XCAAAGCT~
L7lL12
TCAGGAACAATTTA$ZJ GAGCTGGZGZACCC~ECJ
fi
FIG. 7. Sequences of translation initiation sites of genes from r-protein operons. The antisense strands are shown with the initiation codons enclosed by boxes. Solid underlining and overlining indicate Shine-Dalgarno sequences, regions of complementarity with the 3' end of the 16 S rRNA that are involved in ribosome binding to the message (Shine and Dalgarno, 1974).Dashed underlining indicates termination codons from upstream genes. References for the sequences are Post et al. (1978), Post et al. (1979), Post and Nomura (1979), Post et al. (1980), Nomura and Post (1980), and Post and Nomura (1980).
76
LASSE LINDAHL AND JANICE M. ZENGEL
subunits within r-protein operons raises an additional point about the regulation of the synthesis of the transcriptional and translational machinery. Their cotranscription with r-protein genes suggests that elongation factors EF-G and EF-Tu and RNA polymerase subunits p, p', and (Y are synthesized coordinately with r-proteins. However, as with L7/L12, the relative rates of synthesis of EF-Tu, p, and p' are clearly different from the synthesis rates of the cotranscribed r-proteins. The rate of synthesis of EF-Tu is several-fold higher (see below), while p and p' are apparently synthesized at about one-third to onefifth the rate of r-protein synthesis (see Section 11). Furthermore, under some conditions the stoichiometric relationship appears to break down. For example, at faster growth rates, the levels of RNA polymerase subunits p and (Y appear to increase to a somewhat lesser extent than the level of ribosomes (see Section 11). Also, the synthesis of p and p' does not seem to be under stringent control (Reeh et al., 1976; Maher and Dennis, 1977). These observations suggest (and recent experiments discussed in Sections IV and V verify) that more complicated regulatory mechanisms are involved in coordinating the synthesis of the many transcriptional and translational proteins under various growth conditions. It should be noted again that E. coli contains two structural genes for EF-Tu, one (tufA) belonging to an operon that also contains two r-protein genes and the gene for EF-G (Fig. 3) and the other (tufB) in an operon by itself (Fig. 4).The presence of two genes may account in part for the high (approximately 10-fold)stoichiometric ratio of EFTu to ribosomes. However, it appears that the tufA gene is 2 to 3 times more active than the tufB (Pedersen et al., 1976), implying that the relative rate of synthesis of EF-Tu from the tufA gene is still greater than the relative synthesis rates of the other proteins in the same operon. Reportedly, cells can tolerate the inactivation of either the tufA gene (Fischer et al., 1977) or the tufB gene (Van de Klundert et al., 1978; Van der Meide et al., 1980); it will be interesting to see what physiological effects these mutations have. 4 . Chromosomal Locations and Direction of Transcription of
Ribosomal Operons In the r-protein gene cluster at the str region, the direction of transcription is the same (counterclockwise) for all four transcription units (Fig. 2). Similarly, all transcription units in the rif region are transcribed in the same (clockwise) direction. Even though the presence of multiple transcription units at both regions is well established, the unidirectional transcription of all genes within a cluster may
RIBOSOMAL GENES I N BACTERIA
77
reflect an additional level of control responsible for coordinating the expression of the clustered genes. If one considers also the direction of transcription of the rRNA operons, an even more striking pattern is observed. The origin of replication of the E . coli chromosome is located at 82 minutes, and the replication is bidirectional (Bird et al., 1972; McKenna and Masters, 1972). Thus, the direction of transcription of all ribosomal operons so far characterized is precisely that of DNA replication. Since the ribosomal operons are transcriptionally very active, this genetic organization may have evolved to prevent the collision of the DNA polymerase molecules with the actively transcribing RNA polymerase molecules (Nomura et al., 1977). Another interesting observation concerning the location of r-protein and rRNA genes is their nonrandom distribution on the E . coli chromosome. Thirty-three of the 47 mapped r-protein genes lie within 10 minutes (map position) of the origin of replication, and only three genes have been mapped greater than 30 minutes away (Fig. 2). The rRNA operons are also clustered near the origin of replication. The significance of this distribution is not clear. Perhaps the concentration of ribosomal genes near the origin of replication is necessary to provide sufficient amounts of ribosomal proteins and rRNA in rapidly growing cells, which would contain multiple replication forks and therefore multiple copies of r-protein genes. IV. Measurements of Transcription and Translation of Ribosomal Genes
Our current phenomenological description of ribosome synthesis and knowledge of the genetic organization allow us to define at least three questions with respect to the regulation of ribosome synthesis. First, how is the accumulation of ribosomal components coordinated with the remaining metabolic activities of the cell? Second, how is the expression of the different r-protein operons coordinated with each other? And third, how does the stringent response come about? For each question we must clarify several problems. For example, is the regulation in question obtained by modulating synthesis or turnover of the proteins? If synthesis is regulated, does this regulation take place a t the level of transcription or of translation? What are the signals and effectors for the regulation? And where are the targets? Since our concept of the molecular mechanisms is still vague, there is no a priori reason to expect that the processes affecting the three aspects of regulation of ribosome synthesis are necessarily distinct.
78
LASSE LINDAHL AND JANICE M. ZENGEL
Likewise, the overall regulation revealed in physiological experiments may result from the superimposition of several regulatory mechanisms. The goal of the remainder of this article is to examine current information about the mechanisms of regulation and to discuss how this information is contributing answers to the questions defined above.
A. EXPRESSION OF rRNA GENES The mode of regulation of the accumulation of rRNA has been investigated by comparing the rate of rRNA accumulation with the rate of de nouo rRNA synthesis (Gausing, 1977). At growth rates above 1 doubling per hour at 37"C, the rate of synthesis is virtually identical with the rate of accumulation, indicating that at high growth rates there is little or no degradation of excessively synthesized rRNA (Gausing, 1977). Therefore, in fast growing cells rRNA accumulation is regulated exclusively, or almost exclusively, by modulating the rate of synthesis. This result confirms previous observations by other investigators that the balance between rRNA synthesis and mRNA synthesis is shifted in favor of rRNA as the growth rate increases (Pato and von Meyenberg, 1970; Norris and Koch, 1972; Nierlich, 1972). At growth rates below 1 doubling per hour, Gausing's results and earlier studies by Norris and Koch (1972) show that the synthesis of rRNA exceeds the accumulation, with the excess rRNA apparently degraded. This superfluous synthesis becomes increasingly significant as the growth rate decreases; at about 0.2 doublings per hour (at 37°C) approximately 70% of the newly synthesized rRNA is degraded (Gausing, 1977). The mode by which the rate of rRNA synthesis is regulated can be inferred from several other studies. Molin (1976) found that the growth rate of nascent rRNA chains is virtually constant between growth rates of 0.8 and 2.3 doublings per hour. This suggests that the synthesis is regulated by modulation of the frequency of initiation of new chains. The same conclusion can be drawn by comparing a study by Muto (1978) with the data of Gausing (1977). Muto measured the number of RNA polymerase molecules per genome which are actively engaged in rRNA synthesis. As seen in Fig. 8, this number varies with the growth rate in parallel with the rate of synthesis of rRNA. In summary then, the conclusion from the studies of rRNA synthesis and accumulation is that at high growth rates the rate of accumulation is determined by the frequency of initiation of new rRNA chains, but at lower growth rates the degradation of newly synthesized rRNA
79
RIBOSOMAL GENES IN BACTERIA
9 I
8-
ii60
6c
U \
a z
aL
4-
U
2 -
0
1
2
doubling8 / hr FIG. 8. Comparison of the rate of rRNA synthesis and the number of nascent rRNA chains per genome as functions of cell growth rate. The solid line shows the rate of rRNA synthesis, drRNA/dt, in cultures grown in different media. The left ordinate indicates the units, calculated a s pg rRNA synthesized per mg protein per minute, from the data published by Gausing (1977). The solid circles show the number of nascent rRNA molecules per genome, indicated on the right ordinate, found in cells grown in different media. These data were reported by Muto (1978).
becomes an important mechanism for determining the accumulation rate. It is not clear why the mode of regulation of rRNA accumulation varies with the growth rate. Since the concentration of free r-proteins (i.e., r-proteins not bound to ribosomes or ribosomal precursor particles) is low in slowly growing cells (Gausing, 1974) one possibility is that in these cells a significant fraction of the nascent rRNA molecules is attacked by nucleases before the rRNA is protected by bound rprotein. This would presumably abort the assembly process and destine the defective rRNA molecule to complete degradation. If such abortive attempts at assembly do in fact occur, it would be necessafy
80
LASSE LINDAHL AND JANICE M. ZENGEL
for the cell to synthesize more rRNA molecules than are actually accumulated into mature ribosomes. B. EXPRESSION OF I-PROTEIN GENES
1 . Synthesis and Degradation of r-Proteins Measurements of the rates of synthesis of r-proteins have shown that the individual r-proteins are synthesized in equimolar amounts (Dennis, 1974a). Furthermore, although there may be a modest turnover of some newly synthesized proteins, the bulk of r-proteins in exponentially growing cells is stable (Dennis, 1974a; Marvaldi et al., 1974). Thus, the accumulation of r-protein appears to be regulated almost exclusively at the level of synthesis. This does not mean, however, that the r-proteins are insensitive to proteolysis. For example, a slow degradation of r-proteins S6 and S21 was observed in exponentially growing cells (Dennis, 1974a). Extensive degradation of newly synthesized r-protein was observed when the coordination of synthesis of rRNA and r-protein was disrupted by addition of rifampicin (Dennis, 1 9 7 4 ~ )and when the assembly of 50 S ribosomal subunits was inhibited in a temperature-sensitive mutant (Marvaldi et al., 1979). Finally, r-proteins synthesized in excess because of high gene dosage of the corresponding structural genes are also degraded (Geyl and Bock, 1977; Fallon et al., 1979a; see below). 2. Accumulation of r-Protein mRNA The metabolism of r-protein mRNA has been analyzed by hybridizing labeled RNA to DNA from transducing phages carrying various r-protein genes. The amount of mRNA coding for proteins from the CY and spc operons was determined by Dennis and Nomura (1975a) for cultures with growth rates between 0.65 and 2.0 doublings per hour. Over this range, they found a 7.5-fold increase in the amount of mRNA. Over the same range the rate of synthesis of r-proteins encoded by the a and spc operons increased 9.7-fold. Thus, the amount of r-protein mRNA correlates well, but not perfectly, with the rate of r-protein synthesis. The small difference in the increase of mRNA versus protein synthesis may reflect a change in the utilization of mRNA (Dennis and Nomura, 1975a; see below). In subsequent experiments using a competition hybridization technique, Gausing (1977) also found a good correlation between the amount of r-protein mRNA and the rate of r-protein synthesis. Dennis (1977a) compared the amount of mRNA from the CY plus spc
RIBOSOMAL GENES IN BACTERIA
81
operons from the str region with the amount of mRNA from the rprotein genes and the p and p’ genes from the rif region (see Fig. 2). He found that the amount of mRNA from the rif region r-proteins increased with the growth rate in parallel with the amount of mRNA from the str region r-proteins. In contrast, the p, p’ mRNA constituted a fixed fraction of total RNA a t different growth rates (Dennis, 1977a). These results indicate that the transcription of distinctly separate rprotein gene clusters can be regulated coordinately. However, they also demonstrate that the accumulation of mRNA from the p and p’ genes is not coordinate with accumulation of r-protein mRNA, including the mRNA coding for r-protein genes from the same operon as p and p’.
3. Rate of Synthesis of r-Protein m R N A The rate of synthesis of r-protein mRNA has been investigated by hybridizing pulse-labeled RNA to DNA from the a and spc operons in the str region, and to DNA from the four r-protein genes in the rif region (Gausing, 1977; Dennis, 1977a). The r-protein mRNA was found to constitute a fixed fraction of total mRNA synthesized, irrespective of the growth rate. Gausing (1977) found that the rate of total RNA synthesis increased only slightly faster than a function dependent on p. Since the synthesis of r-proteins increases approximately in proportion to p’, there is a lack of strict proportionality between the rate of r-protein mRNA synthesis and the rate of r-protein synthesis. Based on the assumption that total mRNA synthesis can be calculated as total RNA synthesis less rRNA and tRNA synthesis, Gausing (1977) reconciled the two sets of data by arguing that the synthesis of r-protein mRNA as a fraction of the synthesis of total mRNA is, however, proportional to a=. Regardless of this argument, one unavoidable conclusion from the data described above is that the number of proteins translated from a given r-protein messenger molecule increases as the growth rate increases. It also appears that the mean life of the r-protein mRNA increases with increasing growth rate. This follows from the observation that the amount of r-protein mRNA is approximately proportional to the rate of r-protein synthesis and therefore to k2 (Dennis and Nomura, 1975a; see below), whereas the rate of synthesis of mRNA increases only in proportion to p. In summary, in exponentially growing cells r-protein synthesis apparently is regulated at two levels: a t the transcriptional level by adjusting the rate of mRNA synthesis, and at the posttranscriptional level by modulating the efficiency with which the mRNA molecules are translated.
82
LASSE LINDAHL AND JANICE M. ZENGEL
Another example of regulation of r-protein and rRNA synthesis at the level of transcription has been observed during the stringent response. The inhibition of r-protein synthesis in reZA cells partially starved for valyl tRNA results from a decreased rate of transcription of r-protein genes (Dennis and Nomura, 1975b; Dennis, 1977b). +
C. GENEDOSAGEEXPERIMENTS The discussion in the previous section leads to the conclusion that the rates of transcription of both r-protein mRNA and rRNA are regulated. In principle, this regulation can be accomplished in two ways. One possibility is that the availability of “open” promoters is limiting and regulated; the other is that the number of RNA polymerase molecules capable of transcribing the ribosomal genes is limited and regulated. To shed light on this problem, several studies have concentrated on the effect of varying the gene dosage of r-protein and rRNA genes on the synthesis of the ribosomal components. Such studies have also revealed the importance of posttranscriptional mechanisms for regulating gene expression. 1 . Increased Dosage of rRNA Genes Ikemura and Nomura (1977) measured the synthesis of rRNA and “spacer tRNA” species in strains with high copy number plasmids carrying various rRNA operons. These strains contain about twice as many copies of.rRNA genes and about three times as many spacer tRNA genes of a given type as a normal cell. The rate of accumulation of spacer tRNA from the rRNA operon carried by the plasmid was increased 2- to 3-fold relative to a control strain without extra copies of the rRNA operon, while the rate of accumulation of 5 S rRNA was about 1.5-fold higher than in the control (Ikemura and Nomura, 1977). After amplification of the rRNA plasmids by amino acid starvation or chloramphenicol treatment, the increase in accumulation of spacer tRNA and 5 S rRNA was intensified. Thus, the synthesis of these two RNA species was found to be roughly proportional to the gene dosage. A similar gene dosage effect on accumulation was not found for the 16 S and 23 S rRNA species, most likely due to degradation of the excess molecules of these rRNA species (Ikemura and Nomura, 1977). The simplest interpretation of the results of Ikemura and Nomura (1977) is that the rate of rRNA transcription is limited by the availability of “open” promoters and not by the amount of competent RNA polymerase molecules. However, it is difficult to exclude the possibility that the plasmid-carrying strains had adapted to the extra copies of
RIBOSOMAL GENES IN BACTERIA
83
rRNA by activating or redistributing RNA polymerases (Nierlich, 1978). (This type of qualification is valid for many experiments employing a steady state, rather than a dynamic, perturbation of rRNA or r-protein gene expression.) The results reported by Ikemura and Nomura (1977) also demonstrate that the r-protein operons are used to the same extent and no subset of the operons appears to be transcribed preferentially. It therefore seems likely that the rate of rRNA synthesis is controlled not by regulating the number of rRNA operons used, but rather by modulating the intensity with which each is used. A similar conclusion can be reached from studies by Morgan and Kaplan (1976). These investigators exploited the “microheterogeneity” in the sequence found in the rRNA genes of various rRNA operons. They analyzed the composition of the rRNA with respect to this heterogeneity in cells growing at different rates and observed no change in the composition as a function of the growth rate (and therefore of the rRNA synthesis rate).
2. Increased Dosage of r-Protein Genes Gene dosage experiments with the r-protein operons have recently revealed that the utilization of r-protein mRNA can indeed be modulated, confirming the subtle indications for this phenomenon in the experiments previously reported by Dennis and Nomura (1975a). The principle of the recent experiments has been to increase the dosage of one or a few r-protein operons, keeping the copy number of the remaining operons constant, By introducing a n F’ factor or a prophage carrying a subset of the r-protein operons, gene dosage increases of approximately 2- to 3-fold were obtained. Such moderate increases in gene dosage were found to have little or no effect on the synthesis of the individual r-proteins. That is, the operons whose copy numbers were increased still produced the same amount of protein as the operons found only on the chromosome (Geyl and Bock, 1977; Fallon et al., 1979b). One exception to this rule seems to be the S20 operon: a strain carrying extra copies of the S20 gene on an F’ factor overproduced the 520 protein (Geyl and Bock, 1977). A surprising and significant characteristic of the r-protein gene expression in diploid strains was revealed by measurements of r-protein mRNA synthesis. Fallon et al. (1979b) observed that the synthesis of mRNA from the spc operon is increased 2-fold compared to messenger from “control” operons (the r-protein operons in the rif region) in a strain lysogenic for a phage carrying the spc operon. They also found that mRNA from the spc operon has a shorter halflife in the
84
LASSE LINDAHL AND JANICE M. ZENGEL
diploid strain than in the haploid control strain. Thus, even though mRNA is overproduced from the duplicated operon, its translation generates “normal” amounts of protein. It is therefore clear that the r-protein synthesis can be regulated at the posttranscriptional level. Experiments by Olsson and Gausing (1980) have confirmed and expanded on this conclusion. Their measurements of mRNA synthesis in strains containing either a lysogenic phage carrying the spc and a operons or an F’ factor covering the entire str region are in agreement with the results from the work by Fallon et al. (1979b). In addition, Olsson and Gausing (1980) found that the amounts of mRNA from the duplicated operons are increased about 30% in the diploid strains relative to the haploid controls. It therefore appears that the reduced translation is not solely due to the increased mRNA turnover rate, but also to decreased initiation of protein synthesis from the existing messenger molecules. Considerable difficulties have been encountered in attempting to construct high copy number plasmids carrying r-protein genes along with their natural promoters. (We now believe that one reason for this difficulty is the phenomenon of autogenous regulation, discussed in more detail in the following section.) Nevertheless, by using a direct genetic selection Fallon et al. (1979a) succeeded in constructing a ColE1 derivative carrying part of the spc operon. This plasmid contains the promoter and first seven genes of the 10 gene spc operon (see Fig. 3). Cells carrying this plasmid overproduced proteins from the first two genes in the operon 5- to 7-fold, whereas the proteins from the next five cloned genes were oversynthesized only 1.3- to 2fold. The proteins encoded by the distal three genes, which are present only on the chromosome and therefore in the normal copy number, were synthesized at the same rate as protein from other noncloned r-protein operons. The messenger from the spc operon was overproduced about 10- to 20-fold. However, while the mRNA from the most proximal genes appeared to turn over at about the normal rate, more distal spc mRNA had a shorter half-life than observed for haploid strains (Fallon et al., 1979a). Clearly, the presence of multiple copies of partial r-protein operons invokes a complicated regulatory response. In general, though, these experiments are in agreement with the conclusions based on work with more modest gene dosage increases; that is, that the regulation of r-protein synthesis in cells carrying increased copies of r-protein genes occurs at the posttranscriptional level. (To some extent, the behavior of cells carrying high dosages of r-protein genes can now be accounted for by the phenomenon of autogenous regulation, discussed in the following section.) Similar results were obtained by Dennis and Fiil (1979) with a high
RIBOSOMAL GENES I N BACTERIA
85
copy number plasmid carrying the (intact) L11 and p operons (see Fig. 4).The construction of this plasmid did not cause any unusual problems, presumably because complete, rather than partial, operons were cloned. The presence of the plasmid caused a 6-fold increase in the synthesis of mRNA from the L11 and p operons (compared to a 7- to 12-fold amplification of the genes), but only a 30% increase in the synthesis of the corresponding r-proteins (Dennis and Fiil, 1979). Therefore, the results from their study independently demonstrate that r-protein synthesis can be regulated posttranscriptionally. Interestingly, the synthesis of the p and p’ subunits of RNA polymerase from the p operon was increased about 2-fold in the strain carrying the plasmid with this operon (Dennis and Fiil, 1979). Thus, even though the genes for (3, p’, L12, and L10 are in the same operon, their synthesis was not coordinately regulated. V. Autogenous Regulation of r-Protein Synthesis
Recent work has focused on determining the regulatory properties of the r-proteins themselves. Two basic approaches have been used, one an in uivo system in which the regulatory response t o the oversynthesis of one or several specific r-proteins can be analyzed, the other an in uitro system in which the effect of addition of specific purified r-proteins on DNA-dependent synthesis of r-protein can be studied. The conclusions of these experiments, which are described in detail below, are summarized in Fig. 9.
A. IDENTIFICATION OF REGULATORY PROTEINS The problem was approached in uivo by constructing strains in which the synthesis of a single for a few) r-proteink) can be increased conditionally and specifically, and the regulatory response can be followed immediately after the perturbation (Lindahl and Zengel, 1979). Such strains were obtained by cloning DNA fragments harboring one or several r-protein genes onto a multicopy plasmid carrying the lactose promoter and operator. Since the cloned fragments do not carry any natural r-protein promoter, the expression of the cloned genes is controlled by the lac promoter. The plasmids are maintained in strains which have a normal chromosomal complement of r-protein genes. Thus, in the absence of an inducer of the lac operon, virtually all rproteins synthesized are derived from the chromosomal genes. Addition of an inducer activates the plasmid-borne r-protein genes and results in a rapid and specific oversynthesis of the proteins whose
EF-TU
S12
EF-G
-
f nd
nd
S17 L29 L16 S3 (S19, L22) L2 L23
-
+
-
4
-
-
+
+
t
+
+
nd
- -
-
nd
nd
L3 S10
- * + + +
+
+
- + +
-
-
-
-
S11
S13
+
+
+ + t + ( + ) + +
L17
d
+
-
+
+
nd (t)
'SlO
+
pspc
nd
nd
L7/12
a
*
+
nd
nd
s10
SPC
OPERON
OPERON
i n vitro -i n vivo --
OPERON
pa
i n vitro -i-n vivo
pL1l
(+I +
fl' ,8 - -
i n vitro -i n vivo --
i n vitro -i n vivo --
+
L11
+
'str
+
+ ( + ) +
S14 L5 L24 L14
L15 L30 S5 L18 L6 nd
+
's
L11 OPERON i n vitro -i n vivo --
,8
OPERON
i n vitro -i n vivo --
FIG. 9. Regulatory properties of r-proteins responsible for autogenous regulation of r-protein operons. Both in uiuo and in uitro experiments are summarized. Genes in the various operons are identified by their protein products, with the regulatory proteins enclosed in boxes. Direction of transcription is indicated by horizontal arrows. +, Synthesis of the indicated protein is inhibited by the regulatory protein in the same operon. f,Synthesis of the indicated protein is slightly inhibited by the regulatory protein. ( + ), Synthesis of the indicated protein was not measured but is presumed to be inhibited by the regulatory protein. -, Regulatory protein has no effect on the synthesis of the indicated protein. nd, Not determined. For more details of the experiments and complete references, see the text.
RIBOSOMAL GENES I N BACTERIA
87
genes are carried by the plasmid. The immediate effect on the synthesis of other ribosomal components can then be followed. The in uitro approach employed a DNA-dependent protein-synthesizing system programmed with DNA from transducing phages carrying one or several r-protein operons. In such a system, one can monitor the effect of added purified proteins on the synthesis of proteins whose genes are carried on the template DNA (Fukuda et al., 1978; Yates et al., 1980; Brot et al., 1980).
1 . SLO Operon The S10 operon is the longest of the r-protein operons, coding for 11 r-proteins: S10, L3, L4, L23, L2, (S19, L22), S3, L16, L29, and S17. Using the in uiuo technique described above, Lindahl and Zengel (1979) demonstrated that the oversynthesis of L4, L23, L2 (oversynthesized as a group) strongly inhibited the synthesis of proteins from the S10 operon, without significantly affecting the synthesis of r-proteins from other operons. These results were a clear indication that the synthesis of r-proteins is subject to autogenous regulation. In subsequent experiments, Zengel et al. (1980) analyzed the effects of oversynthesis of 9 of the 11 proteins encoded by the S10 operon. The results showed that oversynthesis of a single protein, L4, leads to repression of the entire ,910 operon (with the reservation that the synthesis of L4 from the chromosomal L4 gene could not be measured because of the large amount synthesized from the plasmid-borne L4 gene). None of the other eight proteins tested (S10,L23, L2, S19, L22, L16, L29, and S17) had any effect on the expression of the S10 operon. It appears then that the S10 operon is autogenously regulated and that a single r-protein (L4) works as a regulatory protein in addition to its function as a structural component of the ribosome. Yates and Nomura (1980) analyzed the regulation of the ,910 operon in uitro and found that L4 specifically inhibits the in uitro synthesis of proteins from the S10 operon. Addition of other proteins encoded by the S10 operon or by other r-protein operons had no effect. Thus, the in uitro experiments also suggest that the S10 operon is autogenously regulated by L4. However, one important difference between the in uiuo and in uitro results is that L4 regulates the entire S10 operon in uiuo but only the first three or four genes in the operon in uitro. Possible interpretations for this difference are discussed below. 2 . L l 1 Operon Yates et al. (1980) analyzed the effects of purified proteins on the in uitro expression of the L11 operon, coding for r-proteins L11 and
88
LASSE LINDAHL AND JANICE M. ZENGEL
L1. They found that L1 specifically inhibits the synthesis of both L11 and L1 in the cell-free system. Furthermore, by fusing the L1 gene to the lac promoter Dean and Nomura (1980) showed that oversynthesis in uiuo of L1 leads to specific inhibition of L11 synthesis. Therefore, the L11 operon appears t o be autogenously regulated by L1.
3.
Operon The a operon contains genes for 4 r-proteins and the RNA polymerase subunit a transcribed in the following order: S13, S11, S4, a, L17. I n uitro studies have shown that S4, the product of the third gene in the operon, inhibits its own synthesis and the synthesis of S13 and S11, but not of a and L17 (Yates et al., 1980). Overproduction i n uiuo of S4 and S11, but not S11 alone, specifically inhibits the synthesis of S13 and to a lesser extent L17 (Dean and Nomura, 1980). Although the synthesis of a was not measured (and the synthesis of S4 and S11 from the chromosomal genes could not be distinguished from their synthesis from the plasmid borne genes), it appears that i n uiuo the entire a operon is regulated autogenously by S4. If so, then as with the S10 operon, the in uitro effects differ from the i n uiuo results in that only the more proximal genes are regulated. Another loop of autogenous control may specifically regulate a synthesis. Inhibition of RNA polymerase activity by rifampicin results in a 2-fold increase in (Y synthesis without a concomitant increase in the synthesis of the flanking r-proteins (Pedersen et al., 1978b; Hayward and Fyfe, 1978). Therefore, as with the @ operon (see below), expression of the (Y operon may be subject to several levels of regulation. 01
4 . spc Operon A modified type of autogenous regulation has been observed for the spc operon, which codes for 10 r-proteins: L14, L24, L5, S14, S8, L6, L18, S5, L30, and L15. The r-protein S8 has been identified as a specific autogenous regulator of the spc operon both in uiuo and i n uitro. The in uitro results indicate that S8 inhibits the synthesis of two proteins, S14 and L5 (Yates et al., 1980; Dean et al., 1981). I n uiuo, the oversynthesis of S8 leads t o the inhibition of the synthesis of L5, S14, L6, L18, S5, L15, and L30 (Dean et al., 1981). Again, the promoter distal genes are regulated in uiuo but not in uitro. Even more interesting is the observation that with the spc operon both i n uiuo and i n uitro, inhibition starts at the third, rather than at the
RIBOSOMAL GENES I N BACTERIA
89
first, gene of the operon. It is not clear how the expression of the first two genes, coding for L14 and L24, is regulated.
5 . str Operon A similar modified type of autogenous regulation has been observed for the str operon, encoding the genes for r-proteins ,912 and S7 and elongation factors EF-G and EF-Tu. The protein S7 affects its own synthesis and partially the synthesis of EF-G, but the expression of the first gene in the operon, coding for S12, is not regulated (Nomura et al., 1980). No in uiuo results have been reported for this operon so it is not yet known whether the expression of the most distal gene (encoding EF-Tu) is also regulated by S7. 6 . S20 Operon
Wirth and Bock (1980) have reported that addition of 16 S rRNA to a cell-free protein synthesizing system programmed with DNA carrying the ,320 gene results in the specific stimulation of S20 synthesis. Since S20 can bind tightly to 16 S rRNA, they conclude that newly synthesized S20 can feedback regulate its own synthesis unless it is withdrawn by complexing with 16 S rRNA (Wirth and Bock, 1980). However, several other experimental results appear to contradict their conclusion that the S20 operon is autogenously regulated. First, as mentioned previously, a merodiploid strain carrying a n extra S20 gene on an F' plasmid exhibits a gene dosage effect on S20 synthesis (Geyl and Bock, 1977). Also, preferential synthesis of S20 was observed in minicells containing the plasmid with the S20 gene (Geyl and Bock, 1977). In the latter case, one would expect that because of the absence of 16 S rRNA, newly synthesized S20 should feedback inhibit its own synthesis. And finally, addition of purified 520 to the in uitro system resulted in only a weak inhibition of S20 synthesis (Wirth and Bock, 1980). Further studies are clearly needed to characterize the mode of regulation of the S20 operon.
7. p Operon The p operon, which codes for the r-proteins L10 and L7/L12 and the RNA polymerase subunits (3 and p', appears to be subject to a particularly interesting and complicated type of autogenous regulation. As explained in Section IV, Friesen, Fiil, and their co-workers succeeded in constructing a high copy number plasmid carrying the entire p operon. However, when they attempted to delete part of the operon from their multicopy plasmid, they observed that a deletion
90
LASSE LINDAHL AND JANICE M. ZENGEL
plasmid carrying only the promoter and the first gene (encoding L10) in the operon strongly inhibited growth of the host cells unless the cells carried a n additional plasmid carrying not only the promoter and L10 gene, but also the next two genes in the operon, coding for L7iL12 and p (Friesen et al., 1980). These results are consistent with the idea that L10 is an autogenous regulator of the p operon: the oversynthesis of L10 from the multicopy plasmid would result in a shutoff of the chromosomal p operon, and consequently deplete the cell of the products of other genes in the operon, unless these proteins were provided by a second plasmid. To test the hypothesis that L10 regulates the p operon, Holowachuk et al. (1980) constructed strains that were lysogenic for a phage carrying a hybrid operon consisting of the promoter of the p operon fused to the lacz gene. They found that overproduction of the L10 from a plasmid strongly inhibited the expression of the lacz gene. A weak inhibition of lacz expression was also reported for a strain overproducing L7/L12, but since this strain probably also produces a fragment of the L10 protein, the weak inhibition may result from accumulation of a n L10 fragment. At any rate, the results are consistent with the autogenous regulation of the p operon mediated by L10. Independent evidence for the autogenous regulation of the p operon by L10 and/or a n LlO-L7/L12 complex comes from in uitro experiments reported by Brot et al. (1980) and Fukuda (1980). DNA-dependent cell-free protein synthesizing systems were programmed with DNA carrying either the entire p operon or the proximal portion of the operon. Addition of L10 or the LlO-L7/L12 complex to such systems specifically inhibited the in uitro synthesis of L10 and to a lesser extent of L7/L12. The synthesis of other proteins including p and f3’ was unaffected. The in uitro regulation pattern observed for the p operon resembles the patterns observed for the a,L11, and S10 operons: a single protein from the operon inhibits the expression of the promoter proximal, but not distal, genes. However, while the entire operon is regulated in uiuo in the case of the a,L11, and S10 operons, it is not clear whether p and p’ are regulated by L10 in viva For example, the fact that cells can tolerate the presence on a multicopy plasmid of only the @ promoter and L10, L7/L12, and p genes, but not the presence of only the promoter and the L10 gene, suggests that the synthesis of p’ and probably also p is not severely inhibited by oversynthesis of L10. This conclusion is supported by the observation that strains diploid for the p operon oversynthesize f3 and p’ (Hayward et al., 1974). At even higher dosage of the p operon, oversynthesis was also observed, al-
RIBOSOMAL GENES IN BACTERIA
91
though to a smaller extent than the gene dosage would have predicted (Dennis and Fiil, 1979). In the same experiment very little oversynthesis of L7/L12 was observed (Dennis and Fiil, 1979). Regardless of whether L10 plays a role in the regulation of p and p’ synthesis, it is clear that the two RNA polymerase subunits are also regulated by separate loops of control. One control mechanism appears to be activated by inhibition of the RNA polymerase. Numerous experiments have shown that inhibition of RNA polymerase activity by rifampicin (an inhibitor of RNA chain initiation) leads t o stimulation of the differential synthesis of p and p’ (see reviews by Scaife, 1976; and Yura and Ishihama, 1979).The stimulation does not include the synthesis of L7iL12 (Hayward and Fyfe, 19781, indicating a noncoordinate regulation of the expression of the genes in the p operon (Newman et al., 1979). Inhibition of RNA polymerase activity by exposing temperature-sensitive mutants of the p or p’ genes (see review by Yura and Ishihama, 19791, the u gene (Blumenthal and Dennis, 1980a), or the a gene (Kawakami and Ishihama, 1980) to restrictive or semipermissive temperatures also leads to stimulation of p and p’ synthesis. Similarly, when a strain carrying a temperaturesensitive suppressor in addition to a nonsense mutation in the p gene is shifted to the nonpermissive temperature, the differential synthesis of p’ is increased (Oeschger, 1976; Little and Dennis, 1980). These experiments all suggest that decreased RNA polymerase activity specifically stimulates the synthesis of p and p’. However, there are exceptions to this rule. For example, streptolydigin (an inhibitor of RNA chain elongation) does not stimulate p and p‘ synthesis (Tittawella and Hayward, 1974). Also, some temperature-sensitive strains presumably mutated in the p gene show reduced synthesis of p and p’ (Kirschbaum et al., 1975; Oeschger and Berlyn, 1975; see below, however, for further discussion of these mutants). Nevertheless, the strong, although not perfect, correlation between the RNA polymerase activity and the stimulation of p and 6‘ synthesis has led to the suggestion that p, p’ synthesis is subject to specific autogenous regulation (Scaife, 1976). Regardless of whether autogenous regulation is involved in the response of cells to decreased RNA polymerase activity, it is clear that excessive amounts of RNA polymerase lead to autogenous repression of p and p’ synthesis. Addition of RNA polymerase holoenzyme (Fukuda et al., 1978; Zarucki-Schulz et al., 1979) or an intermediate of RNA polymerase assembly (a$) (Fukuda et al., 1978) specifically inhibits the synthesis of p and p’ in a DNA-dependent cell-free protein synthesizing system. Furthermore, the synthesis of p and p’ in ul-
92
LASSE LINDAHL AND JANICE M. ZENGEL
traviolet-irradiated host cells infected with a transducing phage carrying the p and p’ genes was inhibited when mutants accumulating RNA polymerase assembly intermediates were used as hosts (Taketo et al., 1978). FOR AUTOGENOUS REGULATION B. MECHANISMS
1. Transcriptional us Translational Control Mechanisms The mechanism for autogenous regulation of r-protein synthesis appears to involve the regulation of both transcription and translation. The evidence for a n effect on transcription comes from in vivo studies of the S10 operon. Oversynthesis of L4, the regulatory protein for this operon, was shown to reduce the amount of radioactive uridine incorporated in a very short pulse into RNA capable of hybridizing to both the most proximal gene (encoding S10) and the four most distal genes (encoding S3, L16, L29, and S17) of the S10 operon. L4 reduced the amount of RNA synthesized from these genes to approximately the same extent as the reduction observed for the synthesis of the corresponding proteins (Zengel et al., 1980; J. Zengel and L. Lindahl, unpublished results). At the same time, the incorporation of radioactive uridine into RNA hybridizing to the genes in the (Y and spc operons was unaffected. Thus, in vivo overproduction of L4 results in a specific reduction in the transcription of mRNA from the entire S10 operon. In apparent contrast to the in vivo results, the autogenous regulation i n vitro of r-protein synthesis has been attributed to a n inhibition of the translation of mRNA. This has been shown by “decoupling” the transcription and translation processes of the DNA-dependent cell-free protein synthesizing system. In all cases tested, it was found that the translation of the mRNA is inhibited by the addition of the specific regulatory r-protein, while the transcription process is apparently unaffected (Yates et al., 1980; Yates and Nomura, 1980; Brot et al., 1980). To map the target for the inhibition of translation, Yates et al. (1980) compared the i n vitro translation of mRNA from the L1 operon synthesized by initiation a t the natural promoter with the in vitro translation of mRNA missing the 5’ portion of the L1 gene synthesized by artificial initiation (presumably a t the end of a restriction fragment). They found that L1 inhibited the synthesis of L11 from the complete mRNA but not the synthesis from the incomplete mRNA. Therefore the target for regulation of the L11 gene appears to be close
RIBOSOMAL GENES IN BACTERIA
93
to the 5‘ end of the mRNA. In a similar experiment, Fukuda (1980) showed that the in uitro regulation of the p operon by an LlO-L?/ L12 complex was abolished when the promoter and proximal portion of the L10 gene were deleted from the DNA template. Nomura et al. (1980) have pointed out that the binding sites for S4 and S7 on the 16 S rRNA have structural homologies with mRNA sequences surrounding the fMet initiation codons of the S13 and S7 genes, respectively, the presumed targets on the mRNA for the regulation of translation. The homology between the binding site on the 16 S rRNA and the mRNA at the beginning of the first regulated gene suggests that autogenous regulation of translation is mediated by direct binding of the regulatory protein to the mRNA. This model provides an explanation for why most regulatory proteins are also rRNA binding proteins. It should be noted, however, that at least one r-protein transcription unit, the p operon, is regulated by a ribosomal protein which apparently is not a rRNA binding protein. Thus, several different molecular mechanisms may be involved in the general phenomenon of autogenous regulation (discussed in more detail below). One condition of Nomura’s model is that the binding of a regulatory protein to a specific target site on the mRNA can inhibit the translation of not only the message for the protein whose initiation codon is part of the target site, but also of one or several additional cistrons downstream from the target (Yates et al., 1980; Yates and Nomura, 1980; Nomura et al., 1980). The mechanism by which the translation of several cistrons can be regulated as a unit is not yet clear. The in viuo studies indicate that accumulation of a regulatory protein results in a specific inhibition of mRNA synthesis; the in uitro studies, on the other hand, demonstrate that the regulatory protein inhibits mRNA utilization. Furthermore, it may be recalled that the distal genes of the S10, spc, and a operons are not autogenously regulated in uitro, even though the entire operons (except the two proximal genes in the spc operon) are subject to regulation in uiuo. Accounting for these two discrepancies in the effect of the regulatory protein in uivo and in uitro is important for a complete understanding of the autogenous regulation. One possible explanation assumes that the inhibition of translation is the primary event during autogenous regulation and that the transcription is terminated prematurely in uiuo as a result of the translation inhibition. The implication is that the in uitro system fails to exhibit this coupling between transcription and translation. This model therefore proposes that the autogenous regulation of the proximal genes is due directly to the inhibition of
94
LASSE LINDAHL AND JANICE M. ZENGEL
translation, the rest of the operon being regulated because of a coupling of transcription with translation. The question that follows is, what is the mechanism of this coupling in vivo? One possibility is that the mechanism of autogenous regulation is analogous to the mechanism of polarity observed with polar nonsense mutations. In the latter case interference with translation of the message at the nonsense codon apparently leads to premature termination of transcription (Rosenberg and Court, 1979). Furthermore, the polar effect is difficult to reproduce in in uitro systems. Therefore, the in uivo and in vitro characteristics of the autogenous regulation bear a resemblance to the characteristics observed for the effect of polar nonsense mutations on gene expression. If autogenous regulation were entirely analogous to nonsense mutation-induced polarity, one would expect that the autogenous regulation would fail to affect the distal genes of long r-protein operons in rho- strains, since these mutants were isolated as suppressors of polarity induced by nonsense mutations. However, recent experiments in our laboratory have shown that all genes of the S10 operon respond to oversynthesis of the regulatory protein L4 in several rho mutants (J. Zengel and L. Lindahl, unpublished results). These preliminary results suggest that the regulation of mRNA synthesis in the S10 operon does not involve a rho-dependent termination. A second argument against this model is its inability to explain how the binding of a protein to a single mRNA target site can inhibit the translation of a group of proteins within a given operon. Further experiments clearly are needed to test alternative models for the molecular mechanism of the autogenous regulation, for example, to determine if there are attenuator-like sites downstream from the targets of the regulatory proteins that might account for the coupling of transcription and translation.
2 . Noncoordinate Expression of the Genes in the p Operon As described above, the regulation of the synthesis of the RNA polymerase subunits p and p’ deviates from the regulation of the synthesis of L10 and L12, even though the genes for these four proteins are in the same transcription unit. For example, the synthesis of rproteins shows a stronger dependence on growth rate than does the synthesis of p and p’, the r-proteins are synthesized in approximately 5-fold as many copies as p and p’, and the synthesis of the r-proteins is under stringent control, whereas the synthesis of p and p’ is not. These differences led to the notion that there is a regulatory site between the L12 gene and the p gene. Recent experiments have demonstrated that this intragenic space does in fact harbor two unique
RIBOSOMAL GENES IN BACTERIA
95
regulatory sequences: a site for transcription termination (attenuator) and a site for mRNA processing. The existence of an attenuator in the p operon was investigated by fusing the operon to the 6-galactosidase gene (Barry et al., 1979) or to a tetracycline resistance gene (Friesen et al., 1980). In both cases, the fused genes had been detached from their natural promoters, so that transcription of the connected genes depended on RNA polymerase “reading through” from the p operon. It was found that deletion of a small fragment between the L12 gene and the p gene substantially increased the expression of the connected gene (in the case of the P-galactosidase fusion, where the expression could be quantitated, there was a 5-fold increase). These results suggested that the deleted fragment contains a signal which reduces the expression of the pp’ portion of the operon. The role of this signal in transcription termination was confirmed by analysis of heteroduplex formation between mRNA and DNA fragments from the f3 operon (Barry et al., 1980). These experiments demonstrated that the majority of the transcripts from the p operon terminate at a fixed site between the L12 and P genes. Furthermore, the sequence of this region conforms to the established properties of a terminator: there is a hairpin loop followed by a stretch of Us (Post et al., 1979). The conclusion then is that only a fraction of the transcripts starting at the promoter for the p operon continues through the pP’ genes. The existence of an attenuator site brings up an interesting alternative explanation for those temperature-sensitive mutations (mapping in or close to the P gene) which result in reduced rates of @ and p’ synthesis at nonpermissive temperature (Kirschbaum et al., 1975; Oeschger and Berlyn, 1975; discussed above). Such mutations may in fact be attenuator mutations leading to increased termination a t the nonpermissive temperature. The heteroduplex experiments of Barry et al. 11980) revealed a second interesting characteristic of p operon transcription: for those transcription events which do go beyond the attenuator the pp’ mRNA is normally cleaved off from the proximal mRNA. In an RNase IIIdeficient mutant this cleavage does not occur, indicating that RNase 111 is involved in processing the mRNA from the f3 operon. In fact, the nucleotide sequence reveals that a double-stranded stem with a loop similar t o the RNase I11 processing sites of T7 mRNA (Rabussay and Geiduschek, 1977) is present on the mRNA at a site 150 bases downstream from the attenuator site in the p operon. The regulatory significance of the RNase I11 processing site is not clear. Yet another mechanism responsible for the noncoordinate expres-
96
LASSE LINDAHL AND JANICE M. ZENGEL
sion of the genes in the p operon may be the activation of secondary promoters. There is evidence for one weak promoter between the distal part of the L10 gene and the beginning of the L12 gene, and others may be present close to the 5 ‘ ends of the p and p’ genes (Fiil et al., 1979; Goldberg et al., 1979; Barry et al., 1979; Friesen et al., 1980). The strength of these promoters has not been determined rigorously. When the secondary L12 promoter is fused to a promoterless lacz gene, it promotes about 10% as much P-galactosidase synthesis as is synthesized from a similar fusion between the primary promoter for the p operon and the lacz gene (Holowachuk et al., 1980). However, this is just a rough estimate of the promoter activity since polar mutations created by the fusion process could change the expression of the lacz gene. Other experiments suggest that the secondary L12 promoter may be even stronger. Goldberg et al. (1979) found that the in vitro synthesis of L7/L12 was as high when their system was programmed with DNA lacking the primary promoter of the (3 operon as when it was programmed with DNA carrying an intact primary promoter. The rate of transcription of the P,p’ genes relative to the rate of transcription of the two r-protein genes in the p operon can clearly be modulated. This modulation could be due to regulation of the termination of transcription at the attenuator or to activation of the secondary promoters. We do not know which (or if both) of these explanations is correct, but for the sake of simplicity, we will discuss the evidence for the noncoordinate regulation of the transcription of the different segments of the p operon in terms of the attenuator model. The reader should keep in mind, however, that activation of secondary promoterb) is an alternative model. During starvation for leucine, the rate of transcription of the P,p’ genes relative to the transcription of the L10 and L12 genes increases from 20 to 100% (Blumenthal and Dennis, 1980b). The amino acid starvation apparently causes a reduction in initiations at the beginning of the p operon, but since the read-through is increased, the final rate of transcription of the p and p’ genes is unchanged. This explains why the synthesis of L12 and L10 is stringently controlled, but the synthesis of P and P’ is not. Increased transcription, presumably due to relaxed attenuation, is also the mechanism for increasing the synthesis of the RNA polymerase subunits during inhibition of RNA polymerase activity by rifampicin treatment (Blumenthal and Dennis, 1978; Bass et al., 1979) or by shifting temperature-sensitive mutants to nonpermissive temperatures (Dennis, 1977c; Kirschbaum, 1978; Little and Dennis, 1979; Blumenthal and Dennis, 1980a).
RIBOSOMAL GENES I N BACTERIA
97
We do not know the molecular signal responsible for specifically stimulating the relative transcription of the p,p' genes. Little and Dennis (1979) found that in two mutants defective in assembly of RNA polymerase a t 42"C, the transcription of the p and p' genes is not only not inhibited, but shows a weak stimulation after an extended period of time at the nonpermissive temperature. Little and Dennis (1979) therefore propose that a decrease in the amount of RNA polymerase capable of initiating new RNA chains leads to a n increased read-through at the attenuator site. Whether such a regulatory signal could account for all cases of modulated attenuation, such as during the stringent response, is not yet clear. Inhibition of RNA polymerase synthesis appears to invoke another mode of transcriptional regulation in addition to an increase of the apparent read-through at the attenuator. As was mentioned above, Little and Dennis (1980) reported that the inhibition of p synthesis in a strain carrying an amber mutation in the p gene and a temperature-sensitive suppressor mutation leads to an increased synthesis of p' at the nonpermissive temperature. This increase results from an increase in the rate of transcription of the L10 and L12 genes in addition to an increase in read-through a t the attenuator. Therefore, the decreased synthesis of RNA polymerase apparently also leads to a stimulation of the initiation of transcription at the promoter of the p operon. The increased transcription of the L10 and L12 genes was not accompanied by an increase in L10 and L12 protein synthesis. Little and Dennis (1980) attributed this to specific inhibition of translation of these two proteins, presumably by the autogenous regulatory protein L10. Recently, Ishihama and Fukuda (1980) have proposed that posttranscriptional regulation, activated by excessive accumulation of RNA polymerase and/or RNA polymerase assembly intermediate, is also involved in the control of p and p' synthesis. As was mentioned above, addition of RNA polymerase holoenzyme or the a$ assembly intermediates specifically inhibits the synthesis of p and p' in a DNAdependent cell-free protein synthesizing system. However, the synthesis of mRNA from the p and p' genes is unaffected under these conditions (Ishihama and Fukuda, 19801, indicating that RNA polymerase and the assembly intermediate may specifically inhibit the translation of p,p' message. In summary, the regulation of the p operon appears to be extremely complicated. The noncoordinate expression of the genes in this operon involves at least four regulatory mechanisms: (1)L10-induced inhibition of translation of L10 and L12 mRNA, (2) inhibition of trans-
98
LASSE LINDAHL AND JANICE M. ZENGEL
lation of p,p’ mRNA by RNA polymerase and/or assembly intermediates, (3) regulation of the degree of read-through at the attenuator and/or activation of secondary promoters, and (4) regulation of the rate of initiation of transcription at the primary promoter. The inhibition of translation (mechanisms 1 and 2) presumably involves direct interaction between the regulatory protein and the mRNA. However, we have virtually no information about the molecular details of the modulation of transcription (mechanisms 3 and 4). In uitro experiments suggest that L factor may be involved (Zarucki-Schulz et al., 1979). L factor was originally identified as a protein necessary for synthesis of p-galactosidase in a semidefined cell-free protein synthesizing system (Kung et al., 1975). Recently, Zarucki-Schulz et al. (1979) have shown that L factor is also necessary for the synthesis of p and p’ in the cell-free system. The effect seems to be relatively specific since the synthesis of L10 and L12 proceeds efficiently in the absence of L factor. Experiments by Greenblatt et al. (1980) have demonstrated that L factor is identical to the product of the nusA gene, a gene essential for utilization of the antitermination protein N during lytic growth of bacteriophage A. Therefore, Greenblatt et al. (1980) have proposed that L factor is an antitermination factor working at the transcriptional level, and that this protein is involved in modulating the read-through at the attenuator in the p operon.
C. SIGNIFICANCE OF AUTOGENOUS REGULATION Autogenous regulation is probably important for coordinating the synthesis of r-proteins from different operons (Lindahl and Zengel, 1979; Zengel et al., 1980; Yates et al., 1980). Such a coordinating mechanism may be necessary, for example, to compensate for the replication of different r-protein operons at different times during the DNA replication cycle (Table 3). The nonsynchronous replication of r-protein genes leads not only to variations in the relative gene dosage of the different operons as a function of cell age, but also to variations in the relative average gene dosage of the different operons as a function of the growth rate because of the multifork replication in fast growing cells. Sompayrac and Maalee (1973) have presented theoretical evidence that an autogenous control can very efficiently dampen variations in the synthesis rate of a protein which are generated by the DNA replication process. The critical parameter in the autogenous regulation appears to be the concentration of free regulatory r-protein in the cell. Since the pools of free r-proteins are very small, representing only 1 to 3%of the total amount of a given protein (Marvaldi et al., 1974),very modest
99
RIBOSOMAL GENES I N BACTERIA
TABLE 3 Calculated Times of Replication and Theoretical Gene Dosages of r-Protein Genes Time of replication* Genes rif region str region 52, Ts S16, S19
s1
Sllrzf genes spc geneslrif genes
Map position“ (minutes)
at p. > 1 (minutes)
89 72 21 56 20
5 9 17 22 30
at p = 0.5 (minutes) 8
15
28 36 49
Gene dosage‘ at p. = 2.5
w
at =
0.5
1.47 1.34 1.04 0.92 0.69
1.28 1.21 1.04 0.97 0.81
0.47
0.63
0.91
0.95
“Location of gene(s) on the E . coli chromosome given in “mapping minutes”; see Table 1. * Time (minutes) elapsing between the initiation of replication of the chromosome and the replication of the gene(s). The origin of replication is at 83 “mapping minutes” (Bachmann and Low, 1980). In calculating the time of replication for the individual genes, we assumed that replication of the chromosome proceeds at a constant speed and that the time it takes to complete one round of replication is 40 minutes at cell growth rates (p.) greater than 1doubling per hour and 65 minutes a t 0.5 doubling5 per hour (Cooper and Helmstetter, 1968). ‘Calculated number of copies of a given gene per “chromosome equivalent.” The numbers are calculated using the formula given by Collins and Pritchard (1973) and the times of replication given in the table (see footnote b), assuming no lag between rounds of replication of the chromosome a t p = 2.5, but a 55 minute lag between successive rounds of replication a t p = 0.5 (Cooper and Helmstetter, 1968). The values given are calculated, theoretical values. However, the calculated gene dosages are in reasonable agreement with experimentally determined gene dosages for nearby genes (Bird et al., 1968).
changes in the rate of synthesis or consumption of an r-protein would lead to substantial changes in the free pool. Thus, the autogenous regulation can couple the amount of protein synthesized from a given r-protein gene to the amount consumed. Furthermore, because the regulatory proteins are normally incorporated into ribosomes in equimolar amounts with other r-proteins and rRNA, the ribosome assembly process could provide the mechanism for coordinating the expression of the various r-protein operons. Autogenous regulation mediated by the ribosome assembly process can account for the lack of gene dosage observed in merodiploid strains carrying one or two extra copies of the spc and (Y operons from the str region (Geyl and Bock, 1977; Fallon et al., 1979b; Olsson and Gausing, 1980). Presumably, a relative increase in the amount of the
100
LASSE LINDAHL AND JANICE M. ZENGEL
regulatory r-proteins from the “extra” spc and a. operons results in a feedback inhibition, a t the level of translation, of both operons. What is not yet clear is how the oversynthesis of the regulatory proteins could inhibit the translation of the entire spc and a. operons (unlike the in vitro inhibition of translation of only the proximal genes of these two operons reported by Yates et al., 1980) without a concomitant inhibition of transcription (as was observed for the S10 operon in vivo upon oversynthesis of its regulatory protein; Zengel et al., 1980). Perhaps the posttranscriptional regulation observed during steady-state growth of the diploid cells and the transcriptional effects observed during a transitional stage following induction of a specific regulatory r-protein reflect variations in the mode of autogenous regulation dictated by the very different physiological conditions involved. The regulatory effects observed in strains carrying r-protein operons on high copy number plasmids probably also result, at least in part, from induction of the autogenous response. In the case of the increased dosage of operons in the rifregion, the very effective inhibition of synthesis of r-proteins from the L11 and p operons can be accounted for by posttranscriptional autogenous regulation (Dennis and Fiil, 1979; Friesen et al., 1980). Modulation of mRNA utilization is also apparent in a strain carrying the promoter and the proximal genes of the spc operon on a high copy number plasmid (Fallon et al., 1979a). However, the regulatory response provoked by high dosage of partial r-protein operons is decidedly more complex (Fallon et al., 1979a; see Section IV), presumably because the cell is faced with the predicament of how to repress the synthesis of proteins from the cloned proximal genes to “normal” levels without drastically (and lethally) reducing the synthesis of proteins from the noncloned distal genes. The physiological relevance of autogenous regulation has recently been demonstrated by Jinks-Robertson and Nomura (1981). They found that in a mutant of E . coli which does not produce any detectable amount of L1, L11 is overproduced by 50% compared to other r-proteins. Thus, when the regulatory protein L1 from the L11 operon is absent, the operon is no longer expressed coordinately with other rprotein operons. Autogenous regulation may also explain the observation of Olsson and Isaksson (1979) that a strain containing a mutant S4 oversynthesizes several r-proteins, including S4 and S13. S4 is the autogenous regulatory protein for the a. operon, which also harbors the gene for S13 (along with (Y and S11, which were not analyzed). The oversynthesis of S4 and S13 may result from a decreased ability of the altered S4 protein to properly regulate the operon. Most of the r-proteins identified as autogenous regulators of their
RIBOSOMAL GENES I N BACTERIA
101
respective operons are also rRNA binding proteins (i.e., r-proteins which bind directly and specifically to rRNA early during ribosome assembly). As explained previously, this property of the regulatory proteins is consistent with the homology found between the rRNA binding sites for two such proteins and their presumed mRNA targets (Nomura et al., 1980). Their regulation therefore may be based on competition between rRNA and mRNA. Since the secondary structure of the rRNA binding site is more stable than that of the target site on the mRNA, the rRNA probably has a greater affinity for the relevant r-protein (Nomura et al., 1980). The level of autogenous repression by a protein from a given operon would therefore be determined by the concentration of free regulatory proteins for which no rRNA binding sites is available. The dual nature of the regulatory/rRNA binding proteins may provide the cell with a n efficient mechanism for balancing rRNA synthesis with r-protein synthesis (Zengel et al., 1980). A relative decrease in the synthesis of rRNA and the consequent accumulation of free regulatory proteins would trigger a decrease in r-protein synthesis. On the other hand, a relative increase in the synthesis of rRNA and the sequestering of the regulatory protein could lead to a n immediate increase in the synthesis of r-proteins. Such a linkage would depend on the regulatory proteins binding to rRNA early during the ribosome assembly process. If the regulators were incorporated into the ribosome later in assembly, a decrease in the rate of rRNA synthesis and the consequent accumulation of free regulatory proteins could lock the cell into a n irreversible state of repression. Even if the synthesis of rRNA were to increase, no early binding proteins could be synthesized to provide the substrate for consumption of the accumulated, and therefore repressing, regulatory r-proteins (Zengel et al., 1980). As noted above, one identified regulatory protein, L10, regulating the p operon, is not a n early rRNA binding protein. However, the operon regulated by L10 does not contain any early rRNA binding proteins at all, and therefore is not susceptible to the “locking” problem discussed above. In fact, the mechanism by which L10 regulates the translation of the L10, L12 mRNA may be different from the mechanism proposed by Nomura et al. (1980). This is suggested not only by the fact that L10 is not a n rRNA binding protein, but also by the observation that single base pair mutations more than 100 base pairs upstream from the beginning of the L10 gene affect the translation (but not the transcription) of the L10, L12 mRNA (Fiil et al., 1980). In any event, autogenous regulation cannot be the only mechanism for coordinating rRNA and r-protein synthesis, since sev-
102
LASSE LINDAHL AND JANICE M. ZENGEL
era1 situations have been described in which cells growing under steady-state conditions synthesized rRNA in excess of r-proteins, but degraded the excess rRNA rather than stimulating r-protein synthesis (Gausing, 1977; Nomura et al., 1977). Autogenous regulation of the expression of r-protein operons still fails to explain one observation with respect to the coordinated synthesis of the individual r-proteins: the proximal genes in the spc operon (and perhaps also in the str operon) are apparently not controlled by the regulatory proteins responsible for the autogenous regulation of the remaining genes in the operon (see Fig. 9). For example, S8, the regulatory protein of the spc operon, does not inhibit the expression of the promoter proximal L14 and L24 genes in the cellfree system (Yates et al., 1980), nor does the induced oversynthesis of S8 lead to inhibition of L14 and L24 synthesis in uivo (Dean et al., 1981). L14 and L24 are also oversynthesized in cells carrying the promoter proximal half of the spc operon on a high copy number plasmid (Fallon et al., 1979a). Yet, in a merodiploid strain carrying an extra copy of the spc operon on a transducing phage, the synthesis rates of L14 and L24 are regulated coordinately with the rates of synthesis of other proteins in the spc operon (Fallon et al., 1979b). How the synthesis of these proximal proteins is coordinated with the rest of the r-proteins during normal cell growth is not known. In this context it is interesting to note that the synthesis of L14 and L24 responds more slowly to a nutritional shift-up than would be expected from their position in the spc operon (Lindahl et al., 1977a). VI. Regulation of Transcription of Ribosomal Genes
Experiments discussed in Section IV indicate that the transcription of the rRNA and r-protein genes is regulated in response both to variations in growth rate and to amino acid starvation. Even though some modulation of the transcription of the r-protein operons may be induced by interference with translation (see Section V), there is certainly no compelling evidence yet that suggests all regulation of transcription of r-protein genes is a secondary effect of translational regulation. Furthermore, regulation of transcription of rRNA genes can obviously not be attributed to interference with translation. Since the regulation of transcription of ribosomal genes (particularly rRNA genes) can occur at the level of transcription initiation (see Section IV), one obvious mechanism for transcriptional regulation is the modulation of RNA polymerase-promoter interactions. In this section, we
RIBOSOMAL GENES IN BACTERIA
103
will review recent experiments which may contribute to our understanding of the molecular basis and the biological significance of this mechanism for regulating expression of ribosomal genes. The classic example of transcriptional regulation of ribosomal genes is the stringent control system. During amino acid starvation of stringent (re1 strains, the transcription of ribosomal genes is reduced; concomitant with this inhibition, the cells accumulate the nucleotide ppGpp. Conversely, in relaxed (rel-) strains, where the synthesis of rRNA and r-protein mRNA is unaffected, ppGpp is not accumulated. The correlation between accumulation of ppGpp and decreased synthesis of rRNA and r-protein mRNA led t o the idea that ppGpp is a regulator of rRNA and r-protein gene transcription. Attempts to mimic the stringent response by studying the effects of adding ppGpp t o a n in uitro system have yielded contradictory results. Several groups have reported that ppGpp preferentially inhibits the in uitro synthesis of rRNA and r-protein, while others have observed no specific effects (see Gallant, 1979, for a review). A breakdown in the correlation between ppGpp accumulation and rRNA synthesis has also been reported in several in uiuo studies (Hansen et al., 1975; Gallant et al., 1977). Thus, while it is hard to escape the notion that ppGpp is involved in ribosome synthesis, its precise role is still not clear. Recent reviews by Nierlich (19781, Gallant (19791, and Richter (1980) discuss in more detail the regulation of the synthesis of ppGpp and the evidence for its involvement in regulation of transcription. Gallant’s comment about the role of ppGpp (Gallant, 1979) is, in our opinion, still valid: “Effects of ppGpp on the promoter specificity of RNA polymerase are unquestionably a key in stringent control, but details remain unclear in many respects, and the involvement of additional factors remains a lively possibility.” In this article, we would like to concentrate on recent experimental evidence which may help elucidate the role of ppGpp and “additional factors” in RNA polymerase-promoter interactions involved in the regulation of ribosome synthesis. One effect of ppGpp on initiation of transcription appears to involve direct interaction between the nucleotide and the RNA polymerase. For example, several groups have reported that ppGpp specifically decreases the amount of rRNA synthesized in in uitro transcription systems containing only purified RNA polymerase in addition to a DNA template and triphosphates (Van Ooyen et aZ., 1976; Travers, 1976; Gilbert et al., 1979). The proposed switch in promoter preference induced by ppGpp has been demonstrated more directly by studies showing that ppGpp inhibits the binding of purified RNA polymerase +
104
LASSE LINDAHL AND JANICE M. ZENGEL
to promoters in the rrnE (Hamming et al., 1979) and rrnB (Kingston et al., 1981a) operons. These results suggest that ppGpp interacts specifically with RNA polymerase in such a way that the RNA polymerase affinity for ribosomal promoters is specifically decreased. Recently, Travers (1980a) has pointed out that promoters under stringent control contain a conserved sequence immediately 3' to the Pribnow sequence. Although there is some heterogeneity in this consensus sequence among the stringently controlled genes that Travers examined, and some homology in several genes not under stringent control, the presence of such a sequence may be a determinant of the regulation of promoter expression by ppGpp (Travers, 1980a). In fact, the in uitro significance of this consensus sequence has been demonstrated using a tRNATyrgene with a synthetic alteration in the sequence. Travers (1980b) has shown that in uitro such a promoter now responds to ppGpp in a reciprocal manner to that of the wildtype promoter. To determine the in viuo relevance of the conserved sequence, it would be useful to examine whether the tRNATy' gene with the altered promoter is under stringent or relaxed control in uiuo. Travers et al. (1980a) have proposed a n interesting model for transcription regulation that incorporates the effect of ppGpp, as well as the effect of other factors, in the regulation of RNA polymerase specificity. They found that RNA polymerase holoenzyme can be fractionated by zonal sedimentation through a glycerol gradient into different forms which have different preferences for various promoters. For example, one form initiates transcription relatively efficiently on a n rRNA promoter or a tRNATyrpromoter, but relatively poorly on the 2ac promoter. Another form has the opposite preference. These different forms are relatively stable a t low temperature but rapid isomerization occurs at 30°C. A number of components, including ppGpp, ppApp, IF-2, and fmet-tRNA,M"t, apparently change the equilibrium between the different populations. The different forms therefore also have different sensitivities to these effectors. For example, the form which has preference for rRNA promoters is more sensitive to the effect of ppGpp on rRNA transcription than are other forms. Travers et al. (1980a) suggest that RNA polymerase normally exists in the cell as a mixture of these interconvertible forms, and that regulators of RNA polymerase specificity operate by changing the equilibrium between the various forms of the enzyme. This model of functional heterogeneity of RNA polymerase would account for the previously observed effect of fmet-tRNA,M"t on RNA polymerase specificity. Debenham et al. (1980) reported that fmet-
RIBOSOMAL GENES I N BACTERIA
105
tRNA,"'" selectively inhibited in uitro rRNA synthesis, while stimulating transcription of the lac operon. Such an effect would presumably reflect a fmet-tRNA,M"t-induced shift to a form of RNA polymerase with decreased affinity for rRNA promoters. Similarly, the stimulation of in uitro rRNA synthesis by IF-2 reported by Travers et al. (1980b) may result from a n IF-2-induced shift to a form of RNA polymerase with increased affinity for rRNA promoters. During starvation for valyl tRNA a large fraction of the remaining protein synthesis is devoted to the synthesis of a single protein which has been called the "stringent response protein" (Reeh et al., 1976). Ishihama and Saitoh (1979) have shown that this protein is found in a stable complex with RNA polymerase holoenzyme in cell extracts. They also showed that the in uitro transcription of T7 DNA is weakly inhibited by the stringent response protein, whereas inhibition of different synthetic templates varies from one template to another. Although no studies have been reported yet on the effect of the protein on expression of natural E. colz promoters, particularly of ribosomal promoters, the stringent response protein may also be involved in shifting of RNA polymerase affinity for various promoters. Many laboratories have demonstrated that rRNA (and r-protein) genes can be transcribed in in uitro systems containing only RNA polymerase holoenzyme and template. However, it has been found that the fraction of total in vitro transcript from E. coli DNA which is rRNA is only 10% (Block, 19761, whereas up to 65% of in uiuo transcription is devoted t o rRNA synthesis (Gausing, 1977). Several groups have therefore searched for protein factors which would specifically stimulate rRNA synthesis in uitro. Travers (1973) reported that the complex of EF-Tu and EF-Ts can, under certain circumstances, stimulate the differential synthesis of rRNA in uitro by as much as 4-to 5-fold. Block (1976) was able to fractionate a crude in uitro system that was highly efficient for rRNA synthesis from E. coli DNA into two fractions, one containing RNA polymerase and another which specifically stimulated the differential synthesis of rRNA. Muto (1977) and Oostra et al. (1980) have reported the isolation of crude protein factors, distinct from any RNA polymerase subunit, which stimulate the differential synthesis of rRNA severalfold. It is not known whether any of the factors reported by Block (1976), Muto (19771, or Oostra et al. (1980) are identical to the EF-Tu/EF-Ts complex. Nevertheless, these factors may have a positive effect on rRNA transcription by virtue of their ability to shift RNA polymerase molecules to a form with increased affinity for ribosomal promoters. It is extremely difficult to assess the significance of the model of
106
LASSE LINDAHL AND JANICE M. ZENGEL
functional heterogeneity of RNA polymerase in the in uiuo control of ribosome synthesis. One problem in evaluating all these experiments is the sparsity of in uiuo data to complement the in uitro results. For example, it remains to be demonstrated if the in uitro effects on RNA polymerase activity induced by factors such as IF-2, ppApp, and fmettRNA,M't have any in uiuo relevance. (Although its significance is not yet clear, it may be worth noting that tRNA,"'" can be isolated from cell extracts as a hybrid complex with 23 S rRNA; Dahlberg et al., 1978.) Also, the in uitro studies of transcription have sometimes yielded contradictory results. As mentioned previously, this has been the case with studies of ppGpp effects on in uitro rRNA synthesis. Similarly, the stimulatory effect of the EF-Tu/EF-Ts complex reported by Travers (1973) was not observed by Biebricher and Druminski (1980). In fact, they reported that purified EF-Ts inhibited RNA transcription (although the inhibition required great excess of EF-Ts compared to RNA polymerase, and was not shown to be specific to rRNA). One factor contributing to the confusion is the apparent sensitivity of the in uitro system to the salt concentration and the temperature used for the assays (Travers, 1973). One in uiuo result supports the model for RNA polymerase functional heterogeneity as a mechanism for regulating ribosome synthesis. The alt-1 mutant was isolated as a pseudorevertant of a n adenylcyclase-defective strain by its ability to ferment lactose (Silverstone et al., 1972). It was later found that the RNA polymerase from the alt-1 mutant exhibits a higher affinity for the lac promoter and a reduced affinity for the rrnX promoter in uitro. Furthermore, the in uitro response to ppGpp is altered (Travers et al., 1978). The important point is that even though it was not a required characteristic in the selection scheme used to isolate the mutant, the mutant RNA polymerase has altered promoter preferences resulting not only in an increased ability to express lac genes, but also resulting in a decreased ability to transcribe rRNA. Hopefully, more in uiuo experiments, for example, to determine whether the alt-1 mutation confers a relaxed phenotype in cells, will help to clarify the question of how RNA polymerase-promoter interactions may be involved in regulation of ribosome synthesis. This section has focused on the problem of promoter specificity in regulating transcription of rRNA and r-protein genes. However, it has been suggested that a ppGpp mediated switch in promoter preference of the RNA polymerase may not be the only way ppGpp affects the transcription process. Kingston et al. (1981b) have shown that ppGpp can affect the pattern of "pauses" during the elongation of transcripts
RIBOSOMAL GENES I N BACTERIA
107
from T7 DNA. Assuming that ppGpp has a similar effect on RNA polymerase transcribing rRNA genes, Kingston et al. (1981b) proposed that a ppGpp-induced pause at a site close to the promoter could slow down the initiation process by backing up the RNA polymerase molecules all the way up to the promoter site. Thus, it is possible that the inhibition of transcription of ribosomal genes during the stringent response is the result of several superimposed mechanisms. VII. Current Status of Our Understanding of the Regulation of Ribosome Synthesis
Several molecular mechanisms for regulating r-protein and rRNA synthesis have now been identified. These include autogenous regulation of r-protein operons by key regulatory r-proteins encoded by the operon which they regulate, differential regulation of the transcription of the p operon by attenuation at a site between two genes in the operon, and, possibly, regulation of the transcription of ribosomal genes by modulating the promoter specificity of RNA polymerase. However, many more details of the proposed mechanisms still need to be worked out before we can determine if these models can adequately explain the phenomenological observations. For example, while a reasonably strong case can be made for the involvement of ppGpp in the stringent control of ribosome synthesis, the in uiuo effect of ppGpp and other potential regulators on RNA polymerase specificity is still obscure. Similarly, it seems plausible that autogenous regulation is involved in coordinating the expression of the individual rprotein operons and, perhaps, in also coordinating r-protein synthesis with rRNA synthesis, but we still do not understand the relationship between the modulation of mRNA translation and the inhibition of transcription during the autogenous response. Another example of the insufficiency of these models is their failure to explain the relative differences in sensitivity to amino acid starvation observed for r-proteins, RNA polymerase subunit a,EF-Tu(A), and EF-Tu(B). There is little doubt that modulation of mRNA utilization plays a role in regulating r-protein synthesis, particularly during the autogenous response to increased gene dosage. However, it is not clear what the contribution of posttranscriptional regulation is during normal exponential growth. Connected with this problem is our incomplete understanding of how the cell regulates the rate of r-protein messenger turnover, which apparently varies both with the gene dosage (see above) and with the mRNA structure (Ikemura et al., 1979). One of
108
LASSE LINDAHL AND JANICE M. ZENGEL
the difficulties in solving this problem is obtaining accurate measurements of the half-lives of individual mRNA species. Estimates of functional half-lives have been made by inhibiting new message synthesis with rifampicin and following the “decay” of synthesis of individual r-proteins (Pedersen et al., 1978b). However, the recent discovery of translational regulation of r-protein synthesis makes it highly questionable whether reliable information about mRNA synthesis and decay can be inferred from measurements of protein synthesis. Perhaps the most serious “deficiency” with the identified molecular mechanisms for regulating ribosome synthesis is their failure to explain the fundamental relationship between ribosome accumulation and cell growth rate. To some extent, the increased synthesis of ribosomal components at high growth rates could be accounted for by an increase in gene dosage. As is shown in Table 3, the relative (per “genome equivalent”) number of copies of the major r-protein gene clusters (in the str and rifregions) increases with p. Since most rRNA operons are also close to the origin of replication, the dosage of these genes relative to nonribosomal genes also increases with increasing growth rates. However, the contribution of these “extra” genes is not sufficient to explain the growth rate-dependent variation. The dosage for even those genes that are very close to the origin of replication increases by less than 50% between p = 0.5 and p = 2.5, while the rate of rRNA synthesis over the same range of growth rates increases by 4-to 5-fold (Gausing, 1977). The negative control mechanism implicit in the model for autogenous regulation, in combination with gene dosage effects, is also apparently insufficient to explain the growth rate-dependent regulation. Jinks-Robertson and Nomura (1981) observed a 50% increase in the rate of synthesis of L11 in a strain apparently completely lacking the regulatory protein (Ll) of the L11 operon (discussed in Section V). If we assume that the 50% increase represents the “constitutive” (and therefore maximal) level of L11 synthesis for cells growing at a rate of 1 doubling per hour (the growth rate of the mutant strain), and extrapolate to the expected rate of synthesis at p = 2.5 if gene dosage alone were now responsible for regulating the synthesis of L11, the calculated rate of synthesis is still less than the observed rate of rprotein synthesis in cells growing at p = 2.5. On the basis of theoretical evidence, Maaloe (1969, 1979) has suggested that the growth rate-dependent regulation could be due to a “passive” control mechanism. He proposed that there is a limited
RIBOSOMAL GENES IN BACTERIA
109
capacity for transcription, that nonribosomal promoters and ribosomal promoters compete for this capacity and, furthermore, that this competition switches in the favor of ribosomal genes as the growth rate increases because the need for catabolic and biosynthetic enzymes is reduced when the quality of the growth medium is improved. The limiting factor in this model could, for example, be RNA polymerase, although it is debatable whether the total rate of RNA transcription is in fact limited by the number of RNA polymerase molecules (see Nierlich, 1978, for a discussion). At any rate, while the simplicity of this model makes it attractive, there are few experimental predictions from this model which can easily be tested. How much of a contribution the “passive control” could make to the growth rate-dependent regulation is, therefore, difficult to assess a t this time. Irrespective of the molecular mechanism, the growth rate-dependent regulation of ribosome synthesis may result from the ability of the cell to balance the total protein synthesis capacity with the growth medium-determined rate of production of energy and molecular building blocks (such as amino acids and nucleotides). This possibility is suggested by two types of experiments. One is the shift-up experiments described previously. When cells are shifted t o a medium capable of supporting a higher growth rate, the rates of synthesis of rRNA and r-protein increase within a few minutes. Careful measurements of the r-protein, mRNA, and rRNA synthesis rates have shown that these rates go through several oscillations before the final rates characteristic of the postshift medium are obtained (Gausing, 1980). Since the assembly of ribosomes from r-protein and rRNA takes several minutes (Lindahl, 19771, there is a lag between the time the synthesis of r-proteins accelerates and time the rate of accumulation of active ribosomes is increased. If the regulation of r-proteins and rRNA synthesis is based on a “comparison” between the existing protein synthesis capacity and the increased capacity for energy and “building block” production, the cell may initially overregulate, requiring several successive corrections before finally arriving at the correct rate. The other type of experiment suggesting that the capacity of protein synthesis is the critical parameter for regulating ribosome synthesis involves cells in which the protein synthesizing capacity of the individual ribosomes has been reduced. Such a reduction has been obtained by addition of low concentrations of fusidic acid (Bennett and Maalfie, 1974) or chloramphenicol (Dennis, 1976) or by a mutation in the 30 S subunit ,312 gene (Zengel et al., 1977). In all cases, the reduced efficiency of the individual ribosomes is accompanied by a n
110
LASSE LINDAHL AND JANICE M. ZENGEL
increase in the rate of synthesis of ribosomes, suggesting that the regulatory mechanism attempts to compensate for the reduced efficiency of the individual ribosomes by increasing the total number of ribosomes. How could the cell “sense” its need for protein synthesizing capacity? One possibility is that the ribosome itself may be an autogenous regulator. In such a model, the growth rate-dependent regulation would begin by establishing the pattern of transcription of all nonribosomal genes. This pattern would be defined by the identity and concentrations of metabolites made from the carbon source and other components of the growth medium. The rate of transcription of ribosomal genes would then be determined by the number of ribosomes not actively translating ribosomal and nonribosomal messages. As long as all ribosomes were occupied in translation, rRNA and r-protein genes would be transcribed at the maximal rate. If, however, more ribosomes were synthesized than were needed to translate the available transcripts, idle ribosomes would accumulate. These idle ribosomes could then work as autogenous regulators by specifically inhibiting the transcription of rRNA and r-protein genes (or alternatively, by inhibiting the expression only of rRNA genes, if r-protein synthesis were linked to rRNA synthesis by the mechanism described in Section V). This model would provide for a continuous fine-tuning of the balance between the need for ribosomes and the number actually synthesized. This model would also account for the constant ratio of total mRNA to the number of ribosomes in the cell, independent of the growth rate (Forchhammer and Kjeldgaard, 1968; Norris and Koch, 1972). However, it would fail to explain the accumulation of “inactive” ribosomes in slowly growing cells (see Section 11). Perhaps the ribosomal genes are fully repressed in such slowly growing cells; that is, the basal rate of expression of the ribosomal genes may be higher than the need for ribosomes at very low growth rates. Alternatively, these “extra” ribosomes may not actually be idle, but rather, may be engaged in some unknown complex that prevents them from translating as well as regulating.
ACKNOWLEDGMENTS We are grateful to our many colleagues who contributed unpublished information used in this article. In spite of our efforts to be thorough in reviewing recent experiments in the field of ribosome genetics, it is perhaps inevitable that we overlooked some published reports. We apologize to the authors whose work we may have omitted. The research in our laboratory was supported by a grant from The National Institute of Allergy and Infectious Diseases.
RIBOSOMAL GENES IN BACTERIA
111
REFERENCES Apirion, D., Ghora, B. K., Plautz, G., Misra, T. K., and Gegenheimer, P. (1980). Processing of ribosomal and transfer RNA in Escherichia coli: Cooperation between processing enzymes. In “Transfer RNA: Biological Aspects” (J. Abelson, P. Schimmel, and D. Soll, eds.), pp. 139-154. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Bachmann, B., and Low, K. B. (1980). Linkage map of Escherichia coli K-12, Edition 6. Microbiol. Rev. 44, 1-56. Barry, G., Squires, C. L., and Squires, C. (1979). Control features within the rpkJLrpoBC transcription unit of Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 76, 4922-4926. Barry, G., Squires, C., and Squires C. L. (1980). Attenuation and processing of RNA from the rpZJL-rpoBC transcription unit of Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 77, 3331-3335. Bass, I. A., Danilevskaya, 0. N., Mekhedov, S. L., Fedoseeva, V. B., and Gorlenko, Zh. M. (1979). Effect of rifampicin upon the transcription of RNA polymerase p gene in Escherichia coli. Mol. Gen. Genet. 173, 101-107. Bennett, P. M., and Maaloe, 0. (1974). The effects of fusidic acid on growth, ribosome synthesis and RNA metabolism in Escherichia coli. J . Mol. Biol. 90, 541-561. Berger, I., Geyl, D., Bock, A., Stoffler, G., and Wittman, H. G. (1975). Localized mutagenesis of the aroE-strA section of the Escherichia coli chromosome coding for ribosomal proteins. Mol. Gen. Genet. 141, 207-211. Biebricher, C. K., and Druminski, M. (1980). Inhibition of RNA polymerase activity by the Escherichia coli protein biosynthesis elongation factor Ts. Proc. Natl. Acad. Sci. U.S.A. 77, 866-869. Bird, R. E., Louarn, J., Martuscelli, J., and Caro, L. (1972). Origin and sequence of chromosome replication in Escherichia coli. J . MoZ. Biol. 70, 549-566. Block, R. (1976). Synthesis of ribosomal RNA in a partially purified extract from Escherichia coli. In “Alfred Benzon Symposium IX. Control of Ribosome Synthesis” (N. 0. Kjeldgaard and 0. Maalge, eds.), pp. 226-238. Munksgaard, Copenhagen. Blumenthal, R. M., and Dennis, P. P. (1978). Gene expression in Escherichia coZi B/r during partial rifampicin-mediated restrictions of transcription initiation. Mol. Gen. Genet. 165, 79-86. Blumenthal, R. M., and Dennis, P. P. (1980a). Regulation of ribonucleic acid polymerase synthesis during restriction of an Escherichia coli mutant temperature sensitive for transcription factor sigma. J . Bacteriol 142, 1049-1054. Blumenthal, R. M., and Dennis, P. P. (1980b). Gene expression in Escherichia coli after amino acid, purine or pyrimidine exhaustion. J . Bacteriol. 142, 202-21 1. Blumenthal, R. M., Reeh, S., and Pederson, S. (1976a). Regulation of transcription factor rho and the alpha subunit of RNA polymerase in Escherichia coli B/r. Proc. Natl. Acad. Sci. U.S.A. 73, 2285-2288. Blumenthal, R. M., Lemaux, P. G., Neidhardt, F. C., and Dennis, P. P. (197613). The effects of the relA gene on the synthesis of aminoacyl-tRNA synthetases and other transcription and translation proteins i n Escherichia coli B. Mol. Gen. Genet. 149, 291-296. Bock, A,, Ruffler, D., Piepersberg, W., and Wittmann, H. G. (1974). Genetic analysis of ribosomal protein S20 in revertants of an alanyl-tRNA-synthetase mutant of Escherichia coli. Mol. Gen. Genet. 134, 325-332. Boros, I., Kiss, A., and Venetianer, P. (1979). Physical map of the seven ribosomal RNA genes of Escherichia coli. Nucleic Acids Res. 6, 1817-1830.
112
LASSE LINDAHL AND JANICE M. ZENGEL
Bram, R. J., Young, R. A., and Steitz, J . A. (1980). The ribonuclease 111 site flanking 23s sequences in the 30s ribosomal precursor RNA of E . coli. Cell 19, 393-402. Brosius, J., Dull, T. J., Sleeter, D. D., and Noller, H. F. (1981). Gene organization and primary sequence of a ribosomal RNA operon from Escherichia coli. J . Mol. Biol. 148, 107-128. Brot, N., Caldwell, P., and Weissbach, H. (1980). Autogenous control of Escherichia coli ribosomal protein L10 synthesis in uitro. Proc. Natl. Acad. Sci. U.S.A. 77, 2592-2595. Buckel, P., Piepersberg, W., and Bock, A. (1976). Suppression of temperature-sensitive aminoacyl-tRNA synthetase mutations by ribosomal mutations: A possible mechanism. Mol. Gen. Genet. 149, 51-61. Buckel, P., Buchberger, A,, Bock, A,, and Wittmann, H. G. (1977). Alteration of ribosomal protein L6 in mutants of Escherichia coli resistant to gentamicin. Mol. Gen. Genet. 158, 47-54. Cabezh, T., Herzog, A,, Petre, J., Yaguchi, M., and Bollen, A. (1977). Ribosomal assembly deficiency in an Escherichia coli thermosensitive mutant having a n altered L24 ribosomal protein. J . Mol. Biol. 116, 361-374. Collins, J., and Pritchard, R. H. (1973). Relationship between chromosome replication and F’lac episome replication in Escherichia coli. J . Mol. Biol. 78, 143-155. Collins, J., Fiil, N. P., Jergensen, P., and Friesen, J . D. (1976). Gene cloning of Escherichia coli chromosomal genes important in the regulation of ribosomal RNA synthesis. In “Alfred Benzon Symp. IX. Control of Ribosome Synthesis” (N. 0. Kjeldgaard and 0. Maalee, eds.), pp. 356-367. Munksgaard, Copenhagen. Cooper, S., and Helmstetter, C. E. (1968). Chromosome replication and division cycle of Escherichia coli Blr. J . Mol. B i d . 31, 519-540. CsordBs-T6th, E., Boros, I., and Venetianer, P. (1979). Structure of the promotor region for the rrnB gene in Escherichia coli. Nucleic Acids Res. 7, 2189-2197. Dabbs, E. R. (1978a). Mutational alterations in 50 proteins of the Escherichia coli ribosome. Mol. Gen. Genet. 165, 73-78. Dabbs, E. R. (1978b). Kanamycin-dependent mutants of Escherichia coli. J . Bacteriol. 136, 994-1001. Dabbs, E. R., and Wittman, H. G. (1976).A strain of E . coli which gives rise to mutations in a large number of ribosomal proteins. Mol. Gen. Genet. 149, 303-309. Dahlberg, J . E., Kintner, C., and Lund, E. (1978). Specific binding of formylatable methionine transfer RNA to 23s ribosomal RNA of Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 75, 1071-1075. Dean, D., and Nomura, M. (1980). Feedback regulation of r-protein gene expression in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 77, 3590-3594. Dean, D., Yates, J. L., and Nomura, M. (1981). Escherichia coli ribosomal protein S8 feedback regulates a part of the spc operon. Nature (London) 289, 89-91. Debenham, P. G., Pongs, O., and Travers, A. A. (1980). Formylmethionyl-tRNA alters RNA polymerase specificity. Proc. Natl. Acad. Sci. U.S.A. 77, 870-874. deBoer, H., and Nomura, M. (1979). In vivo transcription of rRNA operons in Escherichia coli initiates with purine mucleoside triphosphates a t the first promotor and with CTP a t the second promotor. J . Biol. Chem. 254, 5609-5612. deBoer, H., Gilbert, S. F., and Nomura, M. (1979). DNA sequences of promotor regions for rRNA operons rrnE and rrnA of E . coli. Cell 17, 201-209. Delcuve, G., Cabezh, T., Ghysen, A., Herzog, A., and Bollen, A. (1977). Amber mutations in Escherichia coli essential genes: Isolation of mutants affected in the ribosomes. Mol. Gen. Genet. 157, 149-153.
RIBOSOMAL GENES IN BACTERIA
113
Dennis, P. P. (1974a). In uiuo stability, maturation and relative differential synthesis rates of individual ribosomal proteins in Escherichia coli Bir. J . MoL. Biol. 88, 25-41. Dennis, P. P. (1974b). Synthesis of individual ribosomal proteins in Escherichia coli Blr. J . Mol. Biol. 89, 223-232. Dennis, P. P. ( 1 9 7 4 ~ )Synthesis . and stability of individual ribosomal proteins in the presence of rifampicin. Mol. Gen. Genet. 134, 39-47. Dennis, P. P. (1976). Effects of chloramphenicol on the transcriptional activities of ribosomal RNA and ribosomal protein genes in Escherichza coEi. J . Mol. Biol. 108, 535-546. Dennis, P. P. (1977a). Transcription patterns of adjacent segments on the chromosome of Escherichia coli containing genes coding for four 50s ribosomal proteins and the P and p' subunits of RNA polymerase. J . Mol. Biol. 115, 603-625. Dennis, P. P. (1977b3. Influence of the stringent control system on the transcription of ribosomal ribonucleic acid and ribosomal protein genes in Escherichia coli. J . Bacteriol. 129, 580-588. Dennis, P. P. (1977~). Regulation of synthesis and activity of a mutant RNA polymerase in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A.74, 5416-5420. Dennis, P. P., and Bremer, H. (1974). Differential rate of ribosomal protein synthesis in Escherichia coli J . Mol. Biol. 84, 407-422. Dennis, P. P., and Fiil, N. P. (1979). Transcriptional and post-transcriptional control of RNA polymerase and ribosomal protein genes cloned on composite ColEl plasmids in the bacterium Escherichia coli. J . Biol. Chem. 254, 7540-7547. Dennis, P. P., and Nomura, M. (1974). Stringent control of ribosomal protein gene expression in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 71, 3819-3823. Dennis, P. P., and Nomura, M. (1975a). Regulation of expression of ribosomal protein genes in Escherichia coli. J . Mol. Biol. 97, 61-76. Dennis, P. P., and Nomura, M. (197513).Stringent control of the transcriptional activities of ribosomal protein genes in E . coli. Nature (London) 255, 460-465. Duester, G. L., and Holmes, W. M. (1980). The distal end of the ribosomal RNA operon r r d of Escherichia coli contains a tRNAIThrgene, two 5 s rRNA genes and a transcription terminator. Nucleic Acids Res. 8, 3793-3807. Dunn, J. J., and Studier, F. W. (1973). T7 early RNAs and Escherichia coli ribosomal RNAs are cut from large precursor RNAs in uiuo by ribonuclease 111. Proc. Natl. Acad. Sci. U.S.A. 70, 3296-3300. Ellwood, M., and Nomura, M. (1980). Deletion of a ribosomal ribonucleic acid operon in Escherichia coli. J . Bacteriol. 143, 1077-1080. Engbaek, F., Gross, C., and Burgess, R. R. (1976). Quantitation of RNA polymerase subunits in Escherichia coli during exponential growth and after bacteriophage T4 infection. Mol. Gen. Genet. 143, 291-295. Fallon, A. M., Jinks, C. S., Yamamoto, M., and Nomura, M. (1979a). Expression of ribosomal protein genes cloned in a hybrid plasmid in Escherichia coli. Gene dosage effects on synthesis of ribosomal proteins and ribosomal protein messenger RNA. J . Bacteriol. 138, 383-396. Fallon, A. M., Jinks, C. S., Strycharz, G. D., and Nomura, M. (1979b). Regulation of ribosomal protein synthesis in Escherichia coli by selective messenger RNA inactivation. Proc. NatL. Acad. Sci. U.S.A. 76, 3411-3415. Fiil, N. P., Bendiak, D., Collins, J., and Friesen, J. D. (1979). Expression of Escherichia coli ribosomal protein and RNA polymerase genes cloned on plasmids. Mol. Gen. Genet. 173, 39-50.
114
LASSE LINDAHL AND JANICE M. ZENGEL
Fiil, N. P., Friesen, J. D., Downing, W. L., and Dennis, P. P. (1980). Posttranscriptional regulatory mutants in a ribosomal protein-RNA polymerase operon. Cell 19, 837-844. Fischer, E., Wolf, H., Hantke, K., and Parmeggiani, A. (1977). Elongation factor Tu resistant to kirromycin in an Escherichia coli mutant altered in both tuf genes. Proc. Natl. Acad. Sci. U.S.A. 74, 4341-4345. Forchhammer, J., and Kjeldgaard, N. 0. (1968). Regulation of messenger RNA synthesis in Escherichia coli. J . Mol. Biol. 37, 245-255. Forchhammer, J., and Lindahl, L. (1971). Growth rate of polypeptide chains as a function of the cell growth rate in a mutant of Escherichia coli 15. J . Mol. Biol. 55,563-568. Friesen, J. D., Fiil, N. P., Dennis, P. P., Downing, W. L., An, G., and Holowachuk, E. (1980). Biosynthetic regulation of rpW, rplL, rpoB and rpoC in Escherichia coli. In “Ribosomes: Structure, Function and Genetics” (G. Chambliss, G. R. Craven, J. Davies, K. Davis, L. Kahan, and M. Nomura, eds.), pp. 719-742. Univ. Park Press, Baltimore, Maryland. Fukuda, R. (1980). Autogenous regulation of the synthesis of ribosomal proteins L10 and L7l12 in Escherichia coli. Mol. Gen. Genet. 178, 483-486. Fukuda, R., Taketo, M., and Ishihama, A. (1978). Autogenous regulation of RNA polymerase p subunit synthesis in uitro. J . Biol. Chem. 253, 4501-4504. Furano, A. (1975). Content of elongation factor Tu in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 72, 4780-4784. Furano, A. V., and Wittel, F. P. (1976). Synthesis of elongation factors Tu and G are under stringent control in Escherichia coli. J . Biol. Chern. 251, 898-901. Gallant, J. A. (1979). Stringent control in E . coli. Annu. Reu. Genet. 13, 393-415. Gallant, J., Palmer, L., and Pao, C. C. (1977). Anomalous synthesis of ppGpp in growing cells. CeZl 11, 181-185. Gausing, K. (1974). Ribosomal protein in E . coli: Rate of synthesis and pool size a t different growth rates. Mol. Gen. Genet. 129, 61-75. Gausing, K. (1977). Regulation of ribosome production in Escherichia coli: Synthesis and stability of ribosomal RNA and ribosomal protein messenger RNA at different growth rates. J . Mol. Biol. 115, 335-354. Gausing, K. (1980). Regulation of ribosome biosynthesis in E . coli. In “Ribosomes: Structure, Function and Genetics” (G. Chambliss, G. R. Craven, J. Davies, K. Davis, L. Kahan, and M. Nomura, eds.), pp. 693-718. Univ. Park Press, Baltimore, Maryland. Geyl, D., and Bock, A. (1977). Synthesis of ribosomal proteins in merodiploid strains and in minicells of Escherichia coli. Mol. Gen. Genet. 154, 327-334. Gilbert, S. F., deBoer, H. A., and Nomura, M. (1979). Identification of initiation sites for the in uitro transcription of rRNA operons rrnE and rrnA in E . coli. Cell 17, 21 1-224. Glaser, G., and Cashel, M. (1979). In uitro transcripts from the rrnB ribosomal RNA cistron originate from two tandem promoters. Cell, 16, 111-121. Goldberg, G., Zarucki-Schulz, T., Caldwell, P., Weissbach, H., and Brot, N. (1979). Regulation of the in uitro synthesis of E. coli ribosomal protein L12. Biochem. Biophys. Res. Cornmun. 91, 1453-1461. Greenblatt, J., Li, J., Adhya, S., Friedman, D. I., Baron, L. S., Redfield, B., Kung, H.F., and Weissbach, H. (1980). L factor that is required for p-galactosidase synthesis is the nusA gene product involved in transcription termination. Proc. Natl. Acad. Sci. U.S.A. 77, 1991-1994.
RIBOSOMAL GENES IN BACTERIA
115
Hamming, J., Gruber, M., and AB, G. (1979). Interaction between RNA polymerase and a ribosomal RNA promoter of E . coli. Nucleic Acids Res. 7, 1019-1033. Hansen, M. T., Pato, M. L., Molin, S., Fiil, N. P., and von Meyenberg, K. (1975). Simple downshift and resulting lack of correlation between ppGpp pool size and ribonucleic acid accumulation. J . Bacteriol 122, 585-591. Hardy, S. J. S. (1975). The stoichiometry of the ribosomal proteins of Escherichia coli. Mol. Gen. Genet. 140, 253-274. Hayward, R. S., and Fyfe, S. K. (1978). Non-coordinate expression of the neighboring genes rplL and rpoB,C of Escherichia coli. Mol. Gen. Genet. 160, 77-80. Hayward, R. S., Austin, S. J., and Scaife, J. G. (1974). The effect of gene dosage on the synthesis and stability of RNA polymerase subunits in Escherichia coli. Mol. Gen. Genet. 131, 173-180. Herzog, A,, Yaguchi, M., Cabezh, T., Corchuelo, M.-C., Petre, J., and Bollen, A. (1979). A missense mutation in the gene coding for ribosomal protein S17 (rpsQ) leading to ribosomal assembly defectivity in Escherichia coli. Mol. Gen. Genet. 171, 15-22. Hill, C. W., Grafstrom, R. H., Harnish, B. W., and Hillman, B. S. (1977). Tandem duplications resulting from recombination between ribosomal RNA genes in Escherichia coli. J . Mol. Biol. 116, 407-428. Holowachuk, E. W., Friesen, J. D., and Fiil, N. P. (1980). Bacteriophage A vehicle for the direct cloning of Escherichia coli promoter DNA sequences: Feedback regulation of the rpkJL-rpoBC operon. Proc. Natl. Acad. Sci. U.S.A. 77, 2124-2128. Hummel, H., Piepersberg, W., and Bock, A. (1979). Analysis of lincomycin resistance mutations in Escherichia coli. Mol. Gen. Genet. 169, 345-347. Ikemura, T., and Nomura, M. (1977). Expression of spacer transfer RNA genes in ribosomal RNA transcriptions units carried by hybrid ColEl plasmids in Escherichia coli. Cell 11, 779-794. Ikemura, T., Itoh, S., Post, L. E., and Nomura, M. (1979). Isolation and characterization of stable hybrid mRNA molecules transcribed from ribosomal protein promoter in E . coli. Cell 18, 895-903. Ishihama, A,, and Fukuda, R. (1980). Autogenous and post-transcriptional regulation of RNA polymerase synthesis. Mol. Cell. Biochen. 31, 177-196. Ishihama, A,, and Saitoh, T. (1979). Subunits of RNA polymerase in function and structure. IX. Regulation of RNA polymerase activity by stringent response protein (SSP).J . Mol. Biol. 129, 517-530. Isono, K. (1980). Genetics of ribosomal proteins and their modifying and processing enzymes in Escherichia coli. In “Ribosomes: Structure, Function and Genetics” (G. Chambliss, G. R. Craven, J. Davies, K. Davis, L. Kahan, and M. Nomura, eds.), pp. 641-670. Univ. Park Press, Baltimore, Maryland. Isono, K., Cumberlidge, A. G., Isono, S., and Hirota, Y. (1977). Further temperaturesensitive mutants of Escherichia coli with altered ribosomal proteins. Mol. Gen. Genet. 152, 239-243. Isono, K., Krauss, J., and Hirota, Y. (1976). Isolation and characterization of temperature-sensitive mutants in Escherichia coli with altered ribosomal proteins. Mol. Gen. Genet. 149, 297-302. Isono, S., Isono, K., and Hirota, Y. (1978). Mutations affecting the structural genes and the genes coding for modifying enzymes for ribosomal proteins in Escherichia coli. Mol. Gen. Genet. 165, 15-20. Iwakura, Y., Ito, K., and Ishihama, A. (1974). Biosynthesis of RNA polymerase in Escherichia coli. I. Control o f RNA polymerase content a t various growth rates. Mol. Gen. Genet. 133, 1-23.
116
LASSE LINDAHL AND JANICE M. ZENGEL
Jaskunas, S . R., and Nomura, M. (1977). Organization of ribosomal protein genes of Escherichia coli as analyzed by insertion mutations. J. Biol. Chem. 252, 73377343. Jaskunas, S. R., Lindahl, L., and Nomura, M. (1975).Isolation of polar insertion mutants and the direction of transcription of ribosomal protein genes in E . coli. Nature (London) 256, 183-187. Jaskunas, S. R., Fallon, A. M., and Nomura, M. (1977). Identification and organization of ribosomal protein genes of Escherichia coli carried by Afus2 transducing phage. J . Biol. Chem. 252, 7323-7336. Jinks-Robertson, S., and Nomura, M. (1981). Regulation of ribosomal protein synthesis in an Escherichia coli mutant missing ribosomal protein L1. J . Bacteriol. 145, 1445-1447. Kawakami, K., and Ishihama, A. (1980). Defective assembly of ribonucleic acid polymerase subunits in a temperature-sensitive a subunit mutant of Escherichia coli. Biochemistry 19, 3491-3495. Kenerley, M. E., Morgan, E. A,, Post, L., Lindahl, L., and Nomura, M. (1977). Characterization of hybrid plasmids carrying individual ribosomal ribonucleic acid transcription units of Escherichiu coli. J . Bucteriol 132, 931-949. Kingston, R. E., Gutell, R. R., Taylor, A. R., and Chamberlin, M. J . (1981a). Transcriptional mapping of plasmid pKK3535: Quantitation of the effect of guanosine tetraphosphate on binding to rrnB promoters and a A promoter with sequence homologies to the cII binding region. J. Mol. Biol. 146, 433-449. Kingston, R. E., Nierman, W. C., and Chamberlin, M. J. (1981b). A direct effect of guanosine tetraphosphate on pausing of E. coli RNA polymerase during RNA chain elongation. J. Biol. Chem. 256, 2787-2797. Kirschbaum, J. B. (1978). A mutation in the gene for the f3‘ subunit of Escherichia coli RNA polymerase which specifically affects transcription of rpoBC operon. J. Mol. Biol. 119, 37-47. Kirschbaum, J . B., Claeys, I. V., Nasi, S., Moholt, B., and Miller, J. H. (1975). Temperature-sensitive RNA polymerase mutants with altered subunit synthesis and degradation. Proc. Natl. Acad. Sci. U.S.A. 72, 2375-2379, Kiss, A., Sain, B., and Venetianer, P. (1977). The number of rRNA genes in Escherichia coli. FEBS Lett. 79, 77-79. Kiss, I., Boros, I., Udvardy, A., Venetianer, P., and Delius, H. (1980). RNA polymerase binding a t the promoters of the rRNA genes of Escherichia coli. Biochim. Biophys. Acta 609, 435-447. Kjeldgaard, N. O., and Gausing, K. (1974). Regulation of biosynthesis of ribosomes. In “Ribosomes” (M. Nomura, A. Tissieres, and P. Lengyel, eds.), pp. 369-392. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Koch, A. (1970). Overall controls on the biosynthesis of ribosomes in growing bacteria. J . Theor. Biol. 28, 203-231. Koch, A. L. (1971). The adaptive responses of Escherichia coli to a feast and famine existence. Adv. Microbiol. Physiol. 6, 147-217. Kraus, S. W., and Leder, P. (1975). Regulation of initiation and elongation factor levels in Escherichia coli as assessed by a quantitative immunoassay. J . Biol. Chem. 250, 3752-3758. Kung, H., Spears, C., and Weissbach, H. (1975). Purification and properties of a soluble factor required for the deoxyribonucleic acid-directed in vitro synthesis of f3-palactosidase. J . Bwl. Chem. 250, 1556-1562. Lindahl, L. (1975). Intermediates and time kinetics of the in vivo assembly of Escherichia coli ribosomes. J . Mol. Biol. 92. 15-37.
RIBOSOMAL GENES I N BACTERIA
117
Lindahl, L., and Zengel, J. M. (1979). Operon specific regulation of ribosomal protein synthesis in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 76, 6542-6546. Lindahl, L., Jaskunas, S. R., Dennis, P. P., and Nomura, M. (1975). Cluster of genes in Escherichia coli for ribosomal proteins, ribosomal RNA and RNA polymerase subunits. Proc. Natl. Acad. Sci. U . S . A .72, 2743-2747. Lindahl, L., Post, L., Zengel, J., Gilbert, S . F., Strycharz, W. A., and Nomura, M. (1977a). Mapping of ribosomal protein genes by in vitro protein synthesis using DNA fragments of hfus3 transducing phage DNA as templates. J . Biol. Chem. 252, 7365-7383. Lindahl, L., Yamamoto, M., Nomura, M., Kirschbaum, J . B., Allet, B., and Rochaix, J.-D. (1977b3. Mapping of a cluster of genes for components of the transcriptional and translational machineries of Escherichia coli. J . Mol. Biol. 109, 23-47. Linn, T., and Scaife, J. G. (1978). Identification of a single promoter in E . coli for rplJ, rplL and rpoB,C. Nature (London) 276, 33-37. Linn, T., Goman, M., and Scaife, J. G. (1979). Studies on the control of the genes for transcription and translation in Escherichia coli. I. tufB and rplA,K have separate promoters. J . Mol. Biol. 130, 405-420. Little, R., and Dennis, P. P. (1979). Expression of RNA polymerase and ribosome component genes in Escherichiu coli mutants having conditionally defective RNA polymerases. J . Bacteriol. 137, 115-123. Little, R., and Dennis, P. P. (1980). Regulation of RNA polymerase synthesis: Conditional lethal amber mutation in the p subunit gene. J.Biol. Chem. 255,3536-3541. Lund, E., and Dahlberg, J. E. (1979). Initiation of Escherichia coli ribosomal RNA synthesis in viuo. Proc. Natl. Acad. Sci. U . S . A .76, 5480-5484. Lund, E., Dahlberg, J . E., Lindahl, L., Jaskunas, S. R., Dennis, P. P., and Nomura, M. (1976). Transfer RNA genes between 16s and 2 3 s rRNA genes in rRNA transcription units of E . coli. Cell 7, 165-177. Maalge, 0. (1969). An analysis of bacterial growth. Dev. Biol. Suppl. 3, 33-58. Maalge, 0. (1979). Regulation of the protein-synthesizing machinery - ribosomes, tRNA, factors, and so on. In “Biological Regulation and Development, Vol. 1” (R. F. Goldberger, ed.), pp. 487-542. Plenum, New York. Maalge, O., and Kjeldgaard, N. 0. (1966). “Control of Macromolecular Synthesis.” Benjamin, New York. McKenna, W. G., and Masters, M. (1972). Biochemical evidence for the bidirectional replication of DNA in Escherzchia coli. Nature (London) 240, 536-539. Maher, D. L., and Dennis, P. P. (1977). In vivo transcription of E . coli genes coding for rRNA, ribosomal proteins and subunits of RNA polymerase: Influence of the stringent control system. Mol. Gen. Genet. 155, 203-211. Marvaldi, J., Pichon, J., DeLaage, M., and Marchis-Mouren, G. (1974). Individual ribosomal protein pool size and turnover rate in Escherichia coli. J . Mol. Biol. 84, 83-96. Marvaldi, J., Pichon, J., and Marchis-Mouren, G. (1979). On the control of ribosomal protein biosynthesis in E . coli. IV. Studies on a temperature-sensitive mutant defective in the assembly of 50s subunits. Mol. Gen. Genet. 171, 317-325. Matzura, H., Hansen, B. S., and Zeuthen, J. (1973). Biosynthesis of the p and p’ subunits of RNA polymerase in Escherichia coli. J . Mol. Biol. 74, 9-20. Miyajima, A,, and Kaziro, Y. (1978). Coordination of levels of elongation factors Tu, Ts and G, and ribosomal protein S1 in Escherichia coli. J . Biochem. 83, 453-462. Molin, S. (19761. Ribosomal RNA chain elongation in Escherichiu coli. In “Alfred Benzon Symp. IX. Control of Ribosome Synthesis” (N. 0. Kjeldgaard and 0. Maaloe, eds.), pp. 333-339. Munksgaard, Copenhagen.
118
LASSE LINDAHL AND JANICE M. ZENGEL
Morgan, E. A., and Kaplan, S. (1976). Coordinate regulation of the individual ribosomal RNA operons in Escherichia coli. Biochem. Biophys. Res. Commun. 68, 969-974. Morgan, E. A., Ikemura, T., and Nomura, M. (1977). Identification of spacer tRNA genes in individual ribosomal RNA transcription units of Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 74, 2710-2714. Morgan, E. A., Ikemura, T., Lindahl, L., Fallon, A. M., and Nomura, M. (1978). Some rRNA operons in E . coli have tRNA genes a t their distal ends. Cell 13, 335-344. Mueller, K., Oebbecke, C., and Forster, G. (1977). Capacity of ribosomal RNA promoters of E . coli to bind RNA polymerase. Cell 10, 121-130. Muto, A. (1977). Control of ribosomal RNA synthesis in Escherichia coli. 111. Cytoplasmic factors for ribosomal RNA synthesis. Mol. Gen. Genet. 152, 161-166. Muto, A. (1978). Control of ribosomal RNA synthesis in Escherichia coli. IV. Frequency of transcription of ribosomal RNA genes as a function of growth rate. Mol. Gen. Genet. 164, 39-44. Neidhardt, F. C., Bloch, P. L., Pedersen, S., and Reeh, S. (1977). Chemical measurement of steady-state levels of aminoacyl-transfer ribonucleic acid synthetases in Escherichiu coli. J . Bacteriol. 129, 378-387. Newman, A. J., Linn, T. G., and Hayward, R. S. (1979). Evidence for cotranscription of the RNA polymerase genes rpoBC with a ribosomal protein gene of Escherichia coli. Mol. Gen. Genet. 169, 195-204. Nierlich, D. P. (1972). Regulation of ribonucleic acid synthesis in growing bacterial cells. 11. Control over the composition of the newly made RNA. J . Mol. Biol. 72, 765-777. Nierlich, D. P. (1978). Regulation of bacterial growth, RNA, and protein synthesis. Annu. Rev. Microbiol. 32, 393-432. Nikolaev, N., Silengo, L. and Schlessinger, D. (1973). Synthesis of a large precursor to ribosomal RNA in a mutant of Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 70, 3361-3365. Nomura, M. (1975). Organization of genes for transcriptional and translational machineries in Escherichia coli. In “Proceedings of the Tenth FEBS Meeting,” pp. 233-241. Nomura, M. (1976). Organization of bacterial genes for ribosomal components: Studies using novel approaches. Cell, 9, 633-644. Nomura, M., and Post, L. E. (1980). Organization of ribosome genes and regulation of their expression in Escherichia coli. In “Ribosomes: Structure, Function, and Genetics” (G.Chambliss, G. R. Craven, J. Davies, K. Davis, L. Kahan, and M. Nomura, eds.), pp. 671-692. Univ. Park Press, Baltimore, Maryland. Nomura, M., Morgan, E. A., and Jaskunas, S. R. (1977). Genetics of bacterial ribosomes. Annu. Rev. Genet. 11, 297-347. Nomura, M., Yates, J. L., Dean, D., and Post, L. E. (1980). Feedback regulation of ribosomal protein gene expression in Escherichia coli: Structural homology between ribosomal RNA and ribosomal protein mRNA. Proc. Natl. Acad. Sci. U.S.A. 77, 7084-7088. Norris, T. E., and Koch, A. L. (1972). Effect of growth rate on the relative rates of synthesis of messenger, ribosomal and transfer RNA in Escherichia coli. J . Mol. Biol. 64, 633-649. Ny, T., and Bjork, G. R. (1980). Growth rate-dependent regulation of transfer ribonucleic acid (5-methyluridine) methyltransferase in Escherichia coli. J . Bacteriol. 141, 67-73, Ny, T., Thomale, J., Hjalmarsson, K., Nass, G., and Bjork, G. R. (1980). Non-coordinate
RIBOSOMAL GENES IN BACTERIA
119
regulation of enzymes involved in transfer RNA metabolism in Escherichia coli. Biochim. Biophys. Acta 607, 277-284. Oeschger, M. P. (1976). Autogenous regulation of RNA polymerase synthesis in E . coli. Fed. Proc. Fed. Am. SOC.Exp. Biol. 35, 1638. Oeschger, M. P., and Berlyn, M. K . B. (1975). Regulation of RNA polymerase synthesis in Escherichia coli: A mutant unable to synthesize the enzyme a t 43". Proc. Natl. Acad. Sci. U.S.A. 72, 911-915. Ohtsubo, E., Soll, L., Deonier, R. C., Lee, H. J., and Davidson, N. (1974). Electron microscope heteroduplex studies of sequence relations among plasmids of Escherichia coli. VIII. The structure of bacteriophage 080d3ilv'su+7, including the mapping of the ribosomal RNA genes. J . Mol. Biol. 89, 631-646. Olsson, M. O., and Gausing, K. (1980). Post-transcriptional control of coordinated ribosomal protein synthesis in Escherichia coli. Nature (London) 283, 599-600. Olsson, M. O., and Isaksson, L. A. (1979). Analysis of rpsD mutations in Escherichia coli. 111. Effects of rpsD mutations on expression of some ribosomal protein genes. Mol. Gen. Genet. 169, 271-278. Oostra, B. A,, AB, G., and Gruber, M. (1980). Specific stimulation of ribosomal RNA synthesis in E. coli by a protein factor. Mol. Gen. Genet. 177, 291-295. Pato, M. L., and von Meyenberg, K. (1970). Residual RNA synthesis in E. coli after inhibition of initiation of transcription by rifampicin. Cold Spring Harb. Symp. Quant. Biol. 35, 497-504. Pedersen, S.. Blumenthal, R. M., Reeh, S., Parker, J., Lemaux, P., Laursen, R. A,, Nagarkatti, S., and Friesen, J. D. (1976). A mutant of Escherichia coli with an altered elongation factor Tu. Proc. Natl. Acad. Sci. U.S.A. 73, 1698-1701. Pedersen, S., Bloch, P. L., Reeh, S., and Neidhardt, F. C. (1978a). Patterns of protein synthesis in Escherichia coli. Catalog of amount of 140 individual proteins a t different growth rates. Cell 14, 179-190. Pedersen, S., Reeh, S., and Friesen, J. D. (197813). Functional mRNA half-lives in E . coli. Mol. Gen. Genet. 166, 329-336. Post, L. E., and Nomura, M. (1979). Nucleotide sequence of the intercistronic region preceding the gene for RNA polymerase subunit a in Escherichia co&. J. Biol. Chem. 254, 10604-10606. Post, L. E., and Nomura, M. (1980). DNA sequences from the str operon of Escherichia coli. J . Biol. Chem. 255, 4660-4666. Post, L. E., Arfsten, A. E., Reusser, F., and Nomura, M. (1978). DNA sequences of promoter regions for the str and spc ribosomal protein operons in E . coli. Cell 15, 215-229. Post, L. E., Strycharz, G. D., Nomura, M., Lewis, H., and Dennis, P. P. (1979). Nucleotide sequence of the ribosomal protein gene cluster adjacent to the gene for RNA polymerase subunit p in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 76, 1697-1701. Post, L. E., Arfsten, A. E., Davis, G. R., and Nomura, M. (1980). DNA sequence of the promoter region for the CY ribosomal protein operon in Escherichia coli. J . Biol. Chem. 255, 4653-4659. Rabussay, D., and Geiduschek, E. P. (1977). Regulation of gene action in the development of lytic bacteriophages. In "Comprehensive Virology, Vol 8 (H. FraenkelConrat and R. W. Wagner, eds.), pp. 1-96. Plenum, New York. Ramagopal, S., and Subramanian, A. R. (1975). Growth dependent regulation, production and utilization of acetylated ribosomal protein L7. J . Mol. B i d . 94,633-641. Reeh, S., Pedersen, S., and Friesen, J. D. (1976). Biosynthetic regulation of individual
120
LASSE LINDAHL AND JANICE M. ZENGEL
proteins in relA’ and relA strains of Escherichia coli during amino acid starvation. Mol. Gen. Genet. 149, 279-289. Richter, D. (1980). In uitro synthesis and decay of guanosine 3’,5’-bis (diphosphate) (ppGpp). In “Ribosomes: Structure, Function and Genetics” (G. Chambliss, G. R. Craven, J. Davies, K. Davis, L. Kahan, and M. Nomura, eds.), pp. 743-765. Univ. Park Press, Baltimore, Maryland. Rosenberg, M., and Court, D. (1979). Regulatory sequences involved in the promotion and termination of RNA transcription. Annu. Reu. Genet. 13, 319-353. Scaife, J. (1976). Bacterial RNA polymerases: The genetics and control of their synthesis. In “RNA Polymerase” (R. Losick and M. Chamberlin, eds.), pp. 207-225. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Sekiya, T., Mori, M., Takahashi, N., and Nishimura, S. (1980). Sequence of the distal tRNAIAnp gene and the transcription termination signal in the Escherichia coli ribosomal RNA operon rrnF(or G ) . Nucleic Acids Res. 8, 3809-3827. Shepherd, N. S., Churchward, G., and Bremer, H. (1980). Synthesis and activity of ribonucleic acid polymerase in Escherichia coli. J . Bucteriol. 141, 1098-1 108. Shine, J., and Dalgarno, L. (1974). The 3’ terminal sequence of Escherichia coli 1 6 s ribosomal RNA: complementarity to nonsense triplets and ribosome binding sites. Proc. Natl. Acad. Sci. U.S.A. 71, 1342-1346. Silverstone, M. E., Goman, M., and Scaife, J. (1972). ALT: A new factor involved in the synthesis of RNA by Escherichia coli. Mol. Gen. Genet. 118, 223-234. Sompayrac, L., and Maal#e, 0. (1973). Autorepressor model for control of DNA replication. Nature (London) New Biol. 241, 133-135. Taketo, M., Fukuda, R., and Ishihama, A. (1978). Biosynthesis of RNA polymerase in Escherichia coli. VII. Regulation of pp’ operon on lambda transducing phage in assembly-defective mutants. Mol. Gen. Genet. 165, 7-14. Thammana, P., Kurland, C. G., Deusser, E., Weber, J., Maschler, R., Stoffler, G., and Wittmann, H. G. (1973). Structural and functional evidence for a repeated 50s subunit ribosomal protein. Nature (London) New Biot. 242, 47-49. Tittawella, I. P. B., and Hayward, R. S. (1974). Differential effects of rifampicin and streptolydigin on the control of RNA polymerase subunit synthesis in Escherichia coli. Mol. Gen. Genet. 134, 181-186. Travers, A. (1973). Control of ribosomal RNA synthesis in uitro. Nature (London) 244, 15-18. Travers, A. (1976). Multiple modes of ribosomal RNA transcriptions in uitro. Cell 8, 605-609. Travers, A. A. (1980a). Promoter sequence for stringent control of bacterial ribonucleic acid synthesis. J . Bucteriol. 141, 973-976. Travers, A. A. (1980b). A tRNATY’ promoter with an altered in uitro response to ppGpp. J . Mol. Biol. 141, 91-97. Travers, A. A., Buckland, R., Goman, M., LeGrice, S. S. G., and Scaife, J. G. (1978). A mutation affecting the u subunit of RNA polymerase changes transcriptional specificity. Nature (London) 273, 354-358. Travers, A. A., Buckland, R., and Debenham, P. G. (L980a). Functional heterogeneity of Escherichia coli ribonucleic acid polymerase holoenzyme. Biochemistry 19, 1656-1662. Travers, A. A., Debenham, P. G., and Pongs, 0. (1980b). Translation initiation factor 2 alters transcriptional selectivity of Escherichia coli ribonucleic acid polymerase. Biochemistry 19, 1651-1656. Van de Klundert, J. A., Van der Meide, P. H., Van de Putte, P., and Bosch, L. (1978). Mutants of Escherichia coli altered in both genes coding for elongation factor Tu. Proc. Natl. Acad. Sci. U.S.A. 75, 4470-4473.
RIBOSOMAL GENES IN BACTERIA
121
Van der Meide, P. H., Borman, T. H., Van Kimmenade, A. M. A., Van de Putte, P., and Bosch, L. (1980). Elongation factor Tu isolated from Escherichiu coli mutants altered in tufA and tufB. Proc. Natl. Acad. Sci. U.S.A. 77, 3922-3926. Van Ooyen, A. J . J., Gruber, M., and Jorgensen, P. (1976). The mechanism of action of ppGpp on ribosomal RNA synthesis in uitro. Cell 8, 123-128. Venetianer, P., Siimegi, J., and Udvardy, A. (1976). Properties of ribosomal RNA promoters. In “Alfred Benzon Symp. IX. Control of Ribosome Synthesis.” (N. 0. Kjeldgaard and 0. Maalfie, eds.), pp. 252-265. Munksgaard, Copenhagen. Vola, C., Jarry, B., and Rosset, R. (1977). Linkage of 5 s RNA and 16s + 23s RNA genes on the E . coli chromosome. Mol. Gen. Genet. 153, 337-341. Watson, R. J., Parker, J., Fiil, N. P., Flaks, J. G., and Friesen, J . D. (1975). New chromosomal location for structural genes of ribosomal proteins. Proc. Natl. Acad. Sci. U.S.A. 72, 2765-2769. Wirth, R., and Bock, A. (1980). Regulation of synthesis of ribosomal protein S20 in uitro. Mol. Gen. Genet. 178, 479-481. Wittman, H. G., Stoffler, G., Piepersberg, W., Buckel, P., RufRer, D., and Bock, A. (1974). Altered S5 and S20 ribosomal proteins in revertants of a n alanyl-tRNA synthetase mutant of Escherichia coli. Mol. Gen. Genet. 134, 225-236. Wittman, H. G., Stoffler, G., Geyl, D., and Bock, A. (1975). Alteration of ribosomal proteins in revertants of a valyl-tRNA synthetase mutant of Escherichia coli. Mol. Gen. Genet. 141, 317-329. Yamamoto, M., and Nomura, M. (1978). Cotranscription of genes for RNA polymerase subunits p and p’ with genes for ribosomal proteins in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 75, 3891-3895. Yamamoto, M., and Nomura, M. (1979). Organization of genes for transcription and translation in the rif region of the Escherichia coli chromosome. J . Bacteriol. 137, 584-594. Yates, J. L., and Nomura, M. (1980). E. coli ribosomal protein L4 is a feedback regulatory protein. Cell, 21, 517-522. Yates, J. L., Arfsten, A. E., and Nomura, M. (1980). In uitro expression of Escherichia coli ribosomal protein genes: Autogenous inhibition of translation. Proc. Natl. Acad. Sci. U.S.A.77, 1837-1841. Young, R. A. (1979). Transcription termination in the Escherichia coli ribosomal RNA operon rrnC. J . Biol. Chem. 254, 12725-12731. Young, R. A,, and Steitz, J. A. (1979). Tandem promoters direct Escherichia coli ribosomal RNA synthesis. Cell 17, 225-234. Young, R. A,, Macklis, R., and Steitz, J. A. (1979). Sequence of the 16s-23s spacer region in two ribosomal RNA operons of Escherichia coli. J . Biol. Chem. 254, 3264-3271. Yura, T., and Ishihama, A. (1979). Genetics of bacterial RNA polymerases. Annu. Reu. Genet. 13, 59-97. Zarucki-Schulz, T., Jerez, C . , Goldberg, G., Kung, H.-F., Huang, K.-H., Brot, N., and Weissbach, H. (1979). DNA-directed in uitro synthesis of proteins involved in bacterial transcription and translation. Proc. Natl. Acad. Sci. U.S.A. 76, 61156119. Zengel, J. M., Young, R., Dennis, P. P., and Nomura, M. (1977). Role of ribosomal protein S12 in peptide chain elongation: Analysis of pleiotropic, streptomycin-resistant mutants of Escherichia coli. J . Bacteriol. 129, 1320-1329. Zengel, J. M., Mueckl, D., and Lindahl, L. (1980). Protein L4 of the E . coli ribosome regulates an eleven gene r-protein operon. Cell 21, 523-535. Zurawski, G., and Brown, K. D. (1979). Ribosomal RNA genes in the 56 minute region of the Escherichia coli chromosome. J . Mol. Biol. 130, 83-96.
THE GENETICS OF TRANSFER RNA IN DROSOPHILA Eric Kubli Zoologisches lnstitut der Universitat Zurich, Zurich, Switzerland
I. Introduction ........................................................ 11. Number and Diversity of tRNA Genes . 111. Localization of tRNA IV. The Structure of tRN V. Isoacceptors and Development . . . . . . . . . . . . . .......... VI. “Transfer RNA Mutants”: Minutes and Others ........................ A. Minutes ........................ ................ B. lethal-meander, K.2 VII. Suppression . . . . . . . . .............. A. The Search for Non B. suppressor of sable, VIII. Conclusions .......
123
140 147 148
I. Introduction One of the most challenging problems of modern biology is the attempt to understand the development of an organism in molecular terms. A prerequisite for this goal is a thorough knowledge of gene structure and function. Whereas the basic mechanisms of gene regulation are well established in prokaryotes (e.g., Goldberger et al., 1976) little is known for eukaryotes (e.g., Axel et al., 1979). This is especially true for the biochemical action of genes controlling the development of an organism. Considering the enormous complexity in higher eukaryotes of the processes leading from fertilization to an adult organism it seems wise to concentrate initially on the elucidation of the structure and function of “simple” gene systems, i.e., genes with 123 ADVANCES IN GENETICS, Vol. 21
Copyright 0 1982 by Academic Press, Ine. All rights of reproduction in any form reserved. ISBN 0-12-017621-1
124
ERIC KUBLI
easily identifiable gene products and known functions. The diverse roles of tRNA in protein synthesis have been described in detail in prokaryotes (Pongs, 1978). Transfer RNA can easily be isolated and sequenced. Therefore the study of tRNA genes and functions is a good approach toward the elucidation of the problem of gene regulation in higher organisms. Besides the classical role in protein synthesis many other functions of tRNA have been described (La Rossa and Soll, 1978; So11 et al., 1980). Only a few examples concerning eukaryotes shall be mentioned. Jacobsen (1971) has postulated a regulatory role for a tRNA5' isoacceptor" for the enzyme tryptophan oxygenase in Drosophila melanogaster (see Section VI1,B). Although these results have been doubted later (Mischke et al., 1975; Wosnick and White, 1977) the final answer to this problem is not yet available (Jacobson, 1978). A specially intriguing fact is the high degree of nucleotide modification of eukaryotic tRNA (Agris and Soll, 1977). The changes in the extent of modification after hormone application (Sharma and Borek, 1974), after transformation of cells (Katze, 1975), and in aging Drosophila males (Hosbach and Kubli, 1979) suggest a n active role for modification in the regulation of cellular activities. The observation of changes in the concentration of specific tRNA isoacceptors found in certain organs during development (e.g., in Bombyx rnori silk glands, Chavancy and Daillie, 1971) has stimulated the formation of theories of development assigning a major control function to tRNA (Strehler et al., 1971). All these results point to a possible involvement of tRNA in the regulation of development, yet they have to be corroborated and extended by further experiments. The redundancy of tRNA genes in higher organisms (Tartof, 1975) raises some interesting questions. How are the tRNA genes distributed over the genome? Are tRNA gene clusters activated at specific stages, as the analysis of mutants suggests (Zust et al., 1972; Kubli, 1978)? How is the information contained in the repetitive genes kept constant? It has been shown for two other repetitive gene families in Drosophila, the 28 S and 18 S ribosomal RNA and the 5 S RNA genes, that compensation can occur if the gene numbers are reduced to half *The following terms and abbreviations will be used in this article: Basic tRNA sequence, a sequence shared by a family of tRNAs with kinetically similar behavior in a RNA-DNA hybridization experiment; homogeneic tRNAs, tRNAs transcribed from the same gene(s) but differing in the degree of modification; isoacceptors, different tRNA species accepting the same amino acid; modification, posttranscriptional addition of, e.g., methyl groups at specific positions of the tRNA. A, Adenosine; C, cytidine, C", 2'-O-methyl-cytidine; D, dihydrouridine;G , guanosine; Q, 7-(4,5-cis-dihydroxy-l-cyclopenten-3-ylaminoethy1)-7-deazaguanosine; U, uridine.
GENETICS OF
tRNA
IN
Drosophila
125
of the normal values (Tartof, 1975). Is this a general mechanism acting on all repetitive genes in Drosophila? One of the main reasons for the impressive progress in our understanding of regulatory processes in lower organisms has been the availability of powerful genetic techniques. For similar reasons many laboratories have chosen Drosophila melanogaster as an object for their molecular studies of gene regulation and development. The number of genes in Drosophila melanogaster has been recently estimated to be about 5000-7000 (Garcia-Bellido and Ripoll, 1978; Young and Judd, 1978). Many mutants have been described morphologically (Lindsley and Grell, 1967) but only a few have been characterized at a molecular level. Treat et al. (1980) list more than 100 biochemical mutations and loci that have been mapped in Drosophila. Most of these are genes coding for enzymes and none of them seems to be directly involved in a developmental process. Despite brilliant work on some gene-enzyme systems (e.g., Chovnick et al., 1977) progress in the understanding of the regulation of genes in Drosophila has been slow. However, the availability of the recently developed techniques of gene cloning (Sinsheimer, 19771, DNA sequencing (Sanger and Coulson, 1975; Maxam and Gilbert, 1977; Sanger et al., 1977), i n situ hybridization (Gall and Pardue, 1969; John et al., 19691, and the use of Xenopus oocyte nuclei as a transcriptional test system (Brown and Gurdon, 1977; Mertz and Gurdon, 1977) supports the assumption that important steps forward will be made in the near future. This has already been demonstrated in the studies of the genes involved in the production of heat shock proteins (Ashburner and Bonner, 19791, actins (Fyrberg et al., 1980; Tobin et al., 1980), and the chorion proteins (Spradling and Mahowald, 1980). Drosophila melanogaster appears also to be one of the organisms of choice for the study of the organization and function of tRNA genes. The number of tRNA genes is in a reasonable range (about 750, yeast: 400, Xenopus: 8000). Sophisticated genetic techniques offer the opportunity to construct duplications and deletions in almost all regions of the genome (Lindsley et al., 1972). Mutants with specific genetic constitution can be grown in large amounts for biochemical analysis (Dubendorfer et al., 1974). The existence of polytene salivary gland chromosomes allows the cytological mapping of genes by in situ hybridization if the primary gene product or the cloned gene with flanking sequences is available. A combination of biochemical and genetical techniques should therefore allow substantial insights into the organization and function of tRNA genes in Drosophila melanogaster. This article aims to review the literature in this field with special
126
ERIC KUBLI
emphasis on the aspects of gene structure and function as well as the possible involvement of tRNA in developmental processes.
II. Number and Diversity of tRNA Genes The total number of tRNA genes in Drosophila melanogaster has been estimated to be 750 by Ritossa et al. (1966) and Tartof and Perry (19701, whereas Weber and Berger (1976) obtained 590 copieshaploid genome. These values correspond to 0.015 and 0.013% of the total DNA, respectively. Reversed phase chromatography resolves Drosophila melanogaster tRNA into 63 major and 39 minor isoacceptor peaks (Grigliatti et al., 1973; White et al., 1973a). Many of these are probably homogeneic, i.e., transcribed from the same genes and modified posttranscriptionally. In fact Weber and Berger (1976) have determined the sequence complexity (Birnstiel et al., 1972; Clarkson et al., 1973) of Drosophila tRNA by hybridization experiments and found a value of 59 basic nucleotide sequences. This agrees quite well with the 63 major isoacceptors described by Grigliatti et al. (19731, assuming different genes for each of the major isoacceptors. If transcription is proportional to the number of these genes, this would lead to a n average redundancy of 10-13 copies for each tRNA gene. The number of genes coding for several isoacceptors has been determined by various hybridization methods (Elder et al., 1980a; Tener et al., 1980). The total number of genes per haploid genome coding for a specific tRNA has been calculated from in uitro hybridization experiments on filters and in solution. The minimum number of genes per tRNA species is revealed by hybridizing labeled tRNA to restriction enzyme digests of DNA separated on agarose gels. The data available are summarized in Table 1. Difficulties were encountered by Tener et al. (1980) in the attempt to determine the number of genes by in uitro hybridization both in solution and on filters. The plateau level of hybridization is dependent on the concentration of tRNA used. Indeed many factors can influence the outcome of such hybridization experiments, e.g., extent of modification and the existence of pseudogenes (genes containing only parts of the full gene sequence, Jacq et al., 1977). Considering the grain counts from i n situ hybridization experiments the number of genes localized at a specific site can be calculated (Elder et al., 1980a,b) genes each for t R N A y are localized in the regions 48A and 72F73A, whereas 8 and 5 t R N A p genes are localized at 42A and 84EF, respectively.
GENETICS OF t R N A IN
127
Drosophila
TABLE 1 Number of Genes per Haploid Genome Coding for a Specific tRNA" Approximate number of genes/ haploid genome
tRNA tRNAtrg tRNAp tRNAy tRNA,M'L tRNAy:' tRNAyt' tRNA2
8 5 18 2 2 6 2 10
12
Location 42A 84F 42A; 42E; 50B; 62A; 63B 48AB 72F 73A 46A 61D; 70F 64DE 84D3,4; 92B; 90BC 56E-57A (tentative assignment)
Data compiled from Elder et nl. (1980a,b) and Tener et al. (1980).
Due to the limitations of the methods used for the determination of tRNA gene numbers only approximate values are obtained. However it may be taken for granted that the haploid genome of Drosophila melanogaster contains 600-700 tRNA genes and that each basic sequence is repeated 5-20 times per haploid genome. The sequences of the following Drosophila melanogaster tRNAs have been determined: tRNAy, t R N A y (initiator tRNA), tRNAEhe, tRNAy'", tRNAH" (Silverman et al., 1979a,b; Altwegg and Kubli, 1979; Altwegg and Kubli, 1980a,b). Apart from some minor differences in modification the sequence of Drosophila t R N A y is the same as that of tRNAkr isolated from rabbit liver (Sprinzl et al., 1980). Only a few differences were found between the nucleotide sequences of the other tRNAs from Drosophila and tRNAs from vertebrates (Sprinzl et al., 1980). These findings hold also for the tRNA genes sequenced in Drosophila melanogaster (Hovemann et al., 1980). This is astonishing, considering the evolutionary distance between these organisms. Apparently tRNA genes evolve very slowly in higher eukaryotes (see also Sections IV and V). 111. Localization of tRNA Genes by in Siru Hybridization
The adaptation of the technique of molecular hybridization of labeled nucleic acids to chromosomes in situ followed by autoradiography has opened a new way for gene localization (Gall and Pardue, 1969; John et al., 1969). In viuo or chemically labeled RNA is hy-
128
ERIC KUBLI
bridized on a chromosome squash pretreated with alkali or heat to denature the DNA. The radioactive RNA forms hybrids with the complementary sequences of the chromosomal DNA. These hybrids are visualized by autoradiography (Fig. 2). With this methodology a number of genes have been identified in a variety of organisms (Steffensen and Wimber, 1972; Hennig, 1973; Pardue et al., 1977; Spradling et al., 1977). The existence of polytene chromosomes in the salivary glands of Drosophila larvae makes this organism especially suitable for this kind of approach. Most often larvae of the mutant giant (gt, 1-0.9) are used as the source of salivary gland chromosomes, since they undergo a n additional 1-2 terms of polytenization due to a prolonged development. Details of the method have been reviewed by Steffensen and Wimber (19721, Hennig (1973), Pardue and Gall (19751, and Wobus (1975). One major difficulty of the in situ hybridization approach was the low specific radioactivity of the RNA obtained by feeding radioactive RNA precursors to Drosophila larvae. The introduction of chemical labeling of RNA with ['261]iodinein vitro (Commerford, 1971) provided a solution to this problem. Specific activities up to 10' dpm/pg can now be obtained (Prensky, 1975). The isolation of pure tRNA isoacceptors using conventional column chromatography techniques has also caused some problems (Grigliatti et al., 19741, since it was found that the tRNA preparation contained 5 S RNA as a contaminant. However affinity chromatography has worked well for the isolation of specific isoacceptors (Kubli and Schmidt, 1978; T. Schmidt et al., 1978). Five main questions can be answered by the technique of in situ hybridization of tRNA to salivary gland chromosomes: 1. Where are the tRNA genes localized in the genome? 2. Are the genes for a family of isoacceptors (e.g., all tRNAG'") clustered? 3. Are the genes coding for one specific isoacceptor (e.g., tRNA2'") clustered? 4. Are any regularities found in the arrangement of the tRNA genes? 5. Does the localization of tRNA genes as determined by in situ hybridization coincide with putative tRNA mutants? (see Section V).
Attempts to localize all tRNA genes by using 3H- or lz51-labeled crude tRNA have been reported by Steffensen and Wimber (1971) and Elder et al. (1980a). Steffensen and Wimber (1971) screened the X
GENETICS OF
tRNA
IN
Drosophila
129
and part of the second chromosome for labeled regions. Twenty-five sites could be identified on the X and 43 sites on the second chromosome. From these results it can be calculated that there are probably 130-140 tRNA gene sites in the Drosophila genome (assuming an even distribution over all chromosomes). However Elder et al. (1980a) using crude 'T-labeled tRNA found only 44 loci distributed over the X, the second, and the third chromosome (Table 2, Fig. 1). Many of them coincide with the ones determined by Steffensen and Wimber (1971). Some discrepancies might be due t o errors in assigning the correct cytological regions. The deviation by a factor of three in the calculations of the total site numbers is probably a result of the overestimation of the loci by Steffensen and Wimber (1971). Their analysis was seriously hampered by the low specific activity of the RNA sample used (4 x lo6 dpm/p.g) leading to a very weak labeling of their chromosome preparations. Some label due to background radiation might have been misinterpreted as due to hybridized tRNA. The following conclusions can be drawn from these experiments. The tRNA genes in Drosophila melanogaster are more or less randomly distributed in clusters over the genome except that the X chromosome contains significantly less tRNA genes than chromosomes 2 and 3 (Fig. 1). No tRNA genes have been found on the fourth chromosome. Since the Y chromosome is not polytene, no genes could be assigned to it. Some tRNA genes present in one or a few copies might not be detected by in situ hybridization; it can therefore be concluded that the Drosophila melanogaster genome contains at least 50 different sites coding for tRNA genes. Several tRNA species have been purified and hybridized in sztu to salivary gland chromosomes (Grigliatti et al., 1973, 1974; Delaney et al., 1976; Dunn et al., 1978, 1979a; Kubli and Schmidt, 1978; T. Schmidt et al., 1978; Hayashi et al., 1980; Schmidt and Kubli, 1980). The results, summarized in Table 2 and Fig. 1, show that (1)many isoacceptors can be found at more than one site in the Drosophila melanogaster genome (e.g., tRNAf'", Fig. 21, and (2) more than one isoacceptor can be localized in the same region. The sensitivity of the in situ hybridization technique does not allow us to decide whether the genes for different isoacceptors are intermingled or clustered separately. Analysis of several plasmids containing tRNA genes has shown that more than one tRNA sequence can be found in close proximity (see Section IV.). A particularly interesting finding is the location of the genes for tRNAy, tRNAf2, and tRNAghein the region 56F (Figs. 1 and 2c, Kubli and Schmidt, 1978; Tener et al., 1980) since this is the site where the 5 S RNA genes have been localized
TABLE 2 Localization of tRNA Genes by in Situ Hybridization" Labeled region
Mutants tRNA species
Puffs
1-4.6 1-5
M(1)30 shb tY
1-14 1-39 1-44,5
5C-5D
sd S ) M(2)LSl
2-3
22D-22E1 22D-23BC
MWZ dw(24)F
2-12.9 2-13
-
28DL.2
M(2)e M(2)e M(We M(2)e
28D-29F 28D-29F 28D-29F 28D-29F
35B,-,
SdHI
M(2)S2 M(2)S2
2-43 2-43 2-43 2-43 2-50.5 2-55.1 2-55.1
M(ZIS2
2-55.1
41A-43A
dm
tRNAp; tRNAp tRNAF
23A 23DE 24DE
tRNAn" tRNA,&'; t R N A p
25D 28D 28F 29A 29D 29E 35A-C 41CD 42A
tRNA,"""
42E 44EF 46A,., 48B,_, 48CD
tRNAFP tRNA,""" tRNAF tRNAzA9;tRNA$" tRnA,LY";tRNA"" tRNAT" tRNA,LY";tRNA" tRNA,M" tRNA,M"
Genetic location Cytological location
su(d;cl
3D 3F 5F 6A 11A 12DE 22A-C 22DE
Gene
12E3.,
23E3-,
42~,.,,
44F1-2
Referencesb 1
41A-43A 41A-43A
1 1 1 1,7 78 1
9 1,7 1 4,7 1 1 1,2,4,7 1,2,4,7 1,7 1 1,2,6,7,9-11,13 1,2,9 1 2,7 1,2,7,13 1
48F 49AB 49F 50A 50BC 52F 53A
tRNAH'% tRNA,Ly" tRNA?'"
54A 54D 55EF 56D3_, 56F
;;
57BC 57D 58AB 59F 60C 60E 61D,., 62A
2-72 2 2-72 2-74 2-77.5
56D
2-87.5 2-92.3
48EF-50A 48EF-50A
1,5,11 1
12 1.3
52E-54F
56C-56F -
1 1 1 1 ~ 1-3
7
7
tRNA,A"" tRNA,A""
63A
tRNA,M" tRNA?'"; tRNAG'" tRNA,L'" tRNAA'"; tRNA,M"
63B 64DE 66B
tRNA,LY' tRNAi:,"' tRNAZk"
67B 69F 70A
2-65 2-65
tRNA,""P
1
58BC
M(2)c 62A-12
2-108
M(3)LSl
60D-60F 61F-62A 62E-63A 63A-63D
3-26 3-28.9 67B4_, 70A
3-40.2 3-41.3
1 11 11 1 1,2,7,13 1,3,12 1,11,13
65D-66B -69F
1 1,5
(Continued)
TABLE 2 (Continued) Labeled region
Mutants tRNA species
Puffs
Gene
Genetic location Cytological location
Referencesb 12,7 1,13 2,7 1,2,7,13 1 1,2,7,13 127 1,5,7,11,13
70BC 70DE 70FI_, 72F 73A 79F 83F 84A 8 4 L 84EF
tRNAPl tRNA,M'L tRNA;M"' tRNA,M"
85AB 87BC 87F 88A 89B
tRNAT-" tRNA,LY"
9 1,7
tRNA?
12
90BC
tRNAA"; tRNAyt'
1,2,11
tRNA:t'
1 1 ~
93A 95F 96A 97CD 99EF
tRNA,L'"; t R N A P tRNA$ tRNA?, tRNAA""
79D-80EF
M(3)LS4
SU~HW)~ Sulss)
3-54.8 3-61
1
92D-93F 96A-96C
M(3)LS5 M f 3 )be
7
1 1 I
Mf31f
3-105
99F-100BC
1
"The location of the puffs are from Ashburner (1975) and M. Ashburner (personal communication). For the mutants listed see Lindsley and Grell (19681, Lindsley et al. (1973), and Zimm and Lindsley (1976). 1. Elder et al. (1980a); 2. Tener et al. (1980); 3. Kubli and Schmidt (1978); 4. T. Schmidt et al. (1978); 5 . Dudler et al. (1980); 6. Yen et al. (1977); 7. Hayashi et al. (1980); 8. Schedl and Donelson (1978); 9. T. Schmidt (personal communication); 10. Hovemann et al. (1980); 11. Schmidt and Kubli (1980); 12. Hosbach et al. (1980); 13. Elder et al. (1980b). See addendum, p. 162.
GENETICS OF t R N A IN
Drosophila
133
(Wimber and Steffensen, 1970). However, the exact arrangement of the tRNA and 5 S RNA genes cannot be determined by this procedure. The analysis of plasmids containing 5 S RNA genes has not revealed any tRNA genes so far (Artavanis-Tsakonas et al., 1977; Tschudi and Pirotta, 1980) but tRNAGlygenes have been identified on a plasmid derived from the region 56F (Hershey and Davidson, 1980). So far no regularities in the arrangement of the tRNA genes have been found. It has to be emphasized, however, that out of 59 basic sequences only about 20 have been localized by in situ hybridization. It is therefore premature to deny any ordered pattern of tRNA genes in Drosophila melanogaster. Also there seems to be no correlation with puffs in the salivary gland chromosomes as indicated in Table 2. Estimations of the gene numbers from the in situ hybridization data suffer from the many uncertainties involved in this methodology. From the assumption of a total of 600-750 tRNA genes composed of 59 different basic sequences (Section 11) an average of 10-13 copies per basic sequence can be calculated. This is probably the order of magnitude of the tRNA gene copies found in the labeled regions. Although relative values can be derived from grain counts, absolute gene numbers have to be determined with other methods (see Section 11). The available results from in situ hybridization experiments open interesting questions about the regulation of tRNA genes. Are all tRNA genes of one region activated together, i.e., do they have the same regulatory sequences? Are they expressed at specific stages? Are all sites functional? How are the sequences of identical genes localized in the same and in different regions kept constant over many generations? Answers to all these problems might be given by combining the sophisticated genetic and biochemical techniques available for D rosophila. A few comments may be added. Many loci found by Steffensen and Wimber (1971) by using 3H-labeled tRNA coincide with the regions labeled with lZ5I-iodinatedtRNA. This reduces the probability of artifacts caused by the labeling procedure employed. Cross hybridization of tRNAs with similar sequences might be a cause of erroneous results (Hovemann et al., 1980). Carefully controlled hybridization conditions are therefore an absolute necessity (Szabo et al., 1977). The in situ hybridization data with purified tRNAs available today (Fig. 1) do suggest that this is not a serious problem (Schmidt and Kubli, 1980). It has to be emphasized, however, that what has been demonstrated by the in situ hybridization experiments is only the existence of sequences complementary to tRNAs in the Drosophila melanogaster
134
ERIC KUBLI
*A
AA A A
A
21
A
=A
A
FIG. 1. Localization of tRNA genes on Drosophila melanogaster polytene salivary gland chromosomes. The tRNA genes a t the pointers without amino acid symbols have not been identified. The bars delineate Minute deficiencies (Zimm and Lindsley, 1976).
genome. This does not imply the function of this DNA at any developmental stage of the organism (silent genes, genes never expressed during the development) nor the completeness of the sequences (pseudogenes). Finally the specific activities used for hybridization and/or the structure of the denatured chromosome at specific sites may not allow the detection of tRNA genes present in a few copies. Only a refined genetic analysis revealing expression of these genes combined with the elucidation of the DNA sequences of tRNA genes containing plasmids will give definite answers to the problems mentioned above. IV. The Structure of tRNA Genes: Plasmids
The method of in situ hybridization provides an elegant means for the gross localization of tRNA genes. However, other techniques are
GENETICS OF t R N A IN
135
Drosophila AMINO
ACID
SYMBOLS
CYSTEl NE
E4
'I
7
7
HF2E4
v
v4 G3.
7'Il
--
G3
!'I
v
N5
7
-
N5
'I1
GLUTAMINE GLUTAMIC ACID GLN AND/OR GLU GLYCINE HISTIDINE
1SOLEUC INE LEUCINE
C
Q
E 2 G H
I L
LVSINE
K
METHIONINE
I
PROLINE
P S
PHENYLALANINE SERINE
F
Hybridization data are from Elder et al. (1980a),Kubli and Schmidt (1978), T.Schmidt et al. (1978), Schmidt and Kubli (1980), and Tener et al. (1980a). Salivary gland map adapted from King (19751. Reproduced with permission. (See addendum, p. 162.)
needed for a fine structure analysis. Plasmid technology (Sinsheimer, 19771, rapid DNA sequencing (Sanger and Coulson, 1975; Maxam and Gilbert, 1977; Sanger et al., 19771, and electron microscopic mapping techniques (Yen et al., 1977) offer the opportunity to study in detail a region of the genome containing tRNA genes. Although many plasmids containing tRNA genes of Drosophila melanogaster have already been isolated (Yen et al., 1977; Schedl and Donelson, 1978; Dudler et al., 1980; Hershey and Davidson, 1980; Hosbach et al., 1980; Hovemann et al., 1980; Yen and Davidson, 1980) only a few of them have been characterized thoroughly (Hershey and Davidson, 1980; Hosbach et al., 1980; Hovemann et al., 1980; Yen and Davidson, 1980). Yen et al. (1977) have studied the arrangement of tRNA genes on the plasmid pCIT 12 (derived from the cytological region 42A) by electron microscopy and restriction enzyme mapping. Their results have been extended by determining the nature of the
136
ERIC KUBLI
FIG. 2. (a) Hybridization of '261-iodinatedtRN&"" to salivary gland chromosomes of the mutant giant. Labeling is found a t the regions 52F, 56EF, and 62A. (b) Region 52F enlarged. (c) Region 56EF enlarged. (d) Region 62A enlarged. Reproduced with permission from Kubli and Schmidt (1978).
tRNA species encoded by these genes and by sequencing the tRNA genes containing regions of this plasmid (Hovemann et al., 1980). Eight tRNA genes have been found in a DNA piece of about 9.3 kb length: 3 tRNAA", 1 tRNAArg,1 tRNA""", and 3 tRNALysgenes (Fig. 3). The three tRNALy"genes have identical sequences in the part coding for the mature tRNA, but the immediately adjacent 5' and 3'
-45
-20
-1 5
-10
-5
0
5
10
15
20
25
30
. - 55
FIG. 3. The arrangement of the tRNA genes in the cytological region 42A of the Drosophila melanogaster salivary gland chromosomes. The tRNA genes are oriented in both directions and coded by both DNA strands. No tRNA genes were found in the regions from 30 to 55 and from -20 to -45. The distance is given in kilobases (adapted from Hovemann et al., 1980, and Yen and Davidson, 1980). Reproduced with permission from Kubli (1981).
138
ERIC KUBLI
sequences are different, A consensus sequence of 11 nucleotides is found 15 nucleotides upstream to the 5' end of the mature tRNA coding region. This sequence is not found in the 5' flanking regions of the other tRNA genes (with the exception of a tRNA:ly gene isolated from the region 56F, Hershey and Davidson, 1980). The analysis of the region 42A has been extended by Yen and Davidson (1980) to a range of 94 kb (Fig. 3). Eighteen tRNA genes have been localized on several plasmids covering this region. Hence, this seems to be one of the richest tRNA gene clusters of the Drosophila genome. With the exception of 1isoleucine gene they all code for tRNA genes chargeable with basic amino acids. Different tRNA genes have also been found on two plasmids investigated by Dudler et al. (1980). These results confirm the data obtained by in situ hybridization of 1251-iodinatedtRNA that more than one tRNA species can be localized in one specific region of the genome (Table 2 and Fig. 1). Very interesting data have been reported by Hosbach et al. (1980) on a cluster coding for 5 tRNA"" genes (derived from the region 62A), which might serve as model for tRNA gene evolution. Striking sequence homologies were found in the 5' and 3' region immediately flanking three tRNAG1"genes (Fig. 41, suggesting that two ancestral
a)
A
-- - b
I-+
a
Glu 1
A
b
Glu2
b
a
B
a
Glu 3
B
FIG. 4. Model for the evolution of a tRNA gene cluster in the cytological region 62A of the Drosophila rnelanogaster salivary gland chromosomes. (a) Sequence homologies around the 3 tRNAG'" genes. (b) Generation of a gene triplet from a hypothetical ancestral gene pair by unequal crossing over. The only difference in the tRNA coding region is a C-T transition in gene 2. This mutation must have happened after the unequal crossing over event since it is only found in this gene (adapted from Hosbach et al., 1980). Reproduced with permission from Kubli (1981).
GENETICS OF t R N A IN
Drosophila
139
genes would have given rise to a doublet by duplication. One of these gene pairs then gave rise to a trio by unequal crossing over, thus producing a set of five tRNAG'"genes. This might be one of the mechanisms used during evolution in order to increase the tRNA gene numbers. Repetitive sequences can also be found on plasmids carrying tRNA genes (Yen et al. 1977; H. Hosbach, personal communication). Very intriguing results have been obtained from the analysis of three plasmids derived from the region 61 D (Sharp et al., 1981). Two of them code for one complete t R N A y gene each, whereas the third contains only incomplete, but conserved parts of this gene. The astonishing fact is that these tRNA,"""fragments are almost exact copies of parts of this gene and, furthermore, that they overlap, i.e., they do not fit the usual scheme of split genes. "Nick translation" experiments followed by in situ hybridization has shown that labeling can be found at several sites on the polytene salivary gland chromosomes. Hence, this plasmid contains repetitive elements. As of today it is not clear whether there is a connection between the presence of the repetitive sequences and the fragmented tRNA,"""gene. The results of the molecular analysis of Drosophila tRNA gene clusters can be summarized as follows. No common sequences have been found a t the 5' ends of the genes (with the exception of the 3 tRNAy and the tRNA?lYgenes mentioned above). The 3' flanking regions of all tRNA genes are AT-rich. The tRNA genes are coded on both DNA strands and are oriented in both directions. The 3' CCAend (common to all tRNAs) has not been found t o be coded by these genes, consequently it has to be added posttranscriptionally by the enzyme nucleotidyltransferase. No intervening sequence has been found in any Drosophila tRNA gene so far. The plasmid pCIT 12 has been transcribed in vitro in an extract prepared from Xenopus laevis germinal vesicles (0.Schmidt et al., 1978). Two transcription products could be identified as tRNA,Ly"and its precursor of about 5 S RNA size. The precursor is not modified and the tRNAy only partially. The 3' terminal sequence CCA found in the mature tRNA? is added by the Xenopus nucleotidyltransferase, since the tRNA,Ly" genes do not contain this sequence (see above). Although the observed size of the tRNA precursor suggests that proper initiation has taken place, a comparison with products transcribed in vivo is needed. However, the assumption is supported by the finding that in vivo labeled RNA containing modified nucleosides specific for tRNA can be found in the region of 5 S RNA upon polyacrylamide gel electrophoresis (Matouschek et al., 1981). Furthermore it was pos-
140
ERIC KUBLI
sible to isolate a precursor t R N A p containing a seven nucleotide leader sequence at the 5’ end of the mature tRNA with pppGp as the 5’ terminal nucleotide after transcription of a tRNApg gene containing plasmid in a germinal vesicle extract of Xenopus oocytes (Silverman et al., 1979~).This strongly suggests that the primary transcription product has been obtained. However, since a heterologous system was used (Drosophila DNA and Xenopus polymerase) it is still an open question whether the initiation site determined reflects the site used in Drosophila. The elegant technique of genetic engineering has also been applied in studies concerning the transcriptional control of the tRNA genes of higher eukaryotes. Both, the 5’ and the 3’ parts of a eukaryotic tRNA gene are important for transcription (Kressmann et al., 1979; DeFranco et al., 1980). But the 5’ flanking sequence can also have a modulating effect. DeFranco et al. (1980) have compared the transcriptional rate of two Drosophila tRNAy genes (derived from two different regions of the genome) in nuclear extracts prepared from Xenopus oocytes. The two genes possess identical tRNA coding sequences but differ in the nucleotide sequence immediately adjacent to the 5’ end. The efficiency of transcription is very different in the Xenopus nuclear extract. “Switching” of the two 5’ flanking sequences of these two genes demonstrates that the efficiency of transcription is controlled by this region (Fig. 5). Hence, besides the internal control regions comprising the mature tRNA coding sequences, the 5’ flanking sequence exerts a modulating effect on the efficiency of transcription. Again, the question arises, whether these results obtained with a heterologous system reflect the in viuo situation. The high degree of sequence conservation observed in the tRNA genes of higher eukaryotes (Sprinzl et al., 1980) seems to justify this conclusion. It is not clear from these experiments what the order of magnitude difference in the transcriptional efficiency means in biological terms. This effect might be a result of the special situation of the Xenopus germinal vesicle extract, where some specific protein factors needed for the efficient transcription might be missing (Roeder et al., 1979). Unfortunately it is not yet possible to measure the transcription rate of these two tRNA genes in situ. V. lsoacceptors and Development
Changes in the pattern of tRNA isoacceptors during development have been described for many organisms (Sueoka and Kano-Sueoka,
GENETICS OF 49
tRNA
1
IN
141
Drosophila 501
a
7 Gene 4
b
Gene 2
C
Gene 4-2
d
t
Gene 2-4
e
Gene A4 1
f
”
Gene A2
c _
I7 t R N A
Lys
Gene
Plasmrd
- Drosophila
DNA
FIG.5. Modulating effect of the 5’ flanking sequence on the transcription efficiency of a tRNA gene. The arrows indicate the orientation of the tRNA genes. The pointer indicates a Hue111 restriction site. The numbers indicate the length of the fragments in base pairs. The 2 genes are transcribed with very different efficiencies in Xenopus laevis nuclear extracts. (a and b) The 2 Drosophila t R N w genes with identical tRNA coding sequences and different 5’ flanking regions. Gene 4 is the efficient gene; gene 2 the inefficient. (c) Combination of the 5’ flanking sequence of gene 4 with the structural gene sequence of gene 2. Transcription is efficient. (d) Combination of the 5‘ flanking sequence of gene 2 with the structural gene sequence of gene 4. Transcription is inefficient. (e and f) The 5’ flanking sequences are replaced by plasmid DNA. Transcription is efficient in both cases (adapted from DeFranco et ul., 1980). Reproduced with permission from Kubli (1981).
1970).These findings have led Strehler et al. (1971) to propose a codon restriction theory of aging and development which assigns a major role t o tRNA. A prerequisite for the eliicidation of the role of tRNA in a possible translational control is a careful analysis of the tRNA isoacceptor patterns at different developmental stages. This has been done for Drosophila melanogaster by White et al. (1973a). First and third instar larvae and adult animals have been chosen for the extraction of tRNA for the following reasons. The cytoplasm of the egg carries material of maternal origin enduring for a long time during early embryogenesis. Thus first instar was chosen as an arbitrary point at which zygotic nuclei would be functioning. Furthermore drastic morphological changes most likely caused by major changes in
142
ERIC KUBLI
gene activity occur during metamorphosis. A comparison between the isoacceptor pattern of third instar larvae and the adult is therefore important. Upon chromatography of tRNA 63 major and 36 minor peaks could be found in the developmental stages examined. About one-third of the major peaks undergo some changes and a few minor peaks only appear or disappear completely during development. Minor or no changes could be found in the isoacceptor patterns of the following tRNAs: Ala, Arg, GlN, Gly, Ileu, Leu, Lys, Pro, Trp, and Val, while the isoacceptors of the tRNAs Cys, Glu, Met, Ser, and Thr undergo quantitative changes in some of their major peaks. The Q-base containing tRNAs AsN, Asp, His, and Tyr (White et al., 1973b) deserve special attention, since they show the most prominent alterations (Fig. 6). The isoacceptors of these tRNAs eluting first from a RPC-5 column (designated S in Fig. 6) contain the modified base Q [or a hypermodified derivative of Q = Q*; Q = 7-(4,5-cis-dihydroxy-l-cyclopenten-3-ylaminomethyl)-7-deazaguanosine]in the first position of their anticodon (Harada and Nishimura, 1972; White et al., 197313; T. Schmidt et al., 1978; Wosnick and White, 1978; see also Section VII). It is believed that the only difference between the major isoacceptors of these species is this modification in the anticodon. The corresponding nucleotide is an unidentified G ( = G*) derivative in the isoacceptors designated y in Fig. 6. The concentration of the Q or Q* containing tRNAs decreases during the development of the larvae. During the metamorphosis this situation is changed and in the adults the amount of the Q or Q* containing isoacceptors increases significantly. This tendency is maintained during the aging process. Hosbach and Kubli (1979) have shown that 35-day-old Drosophila melanogaster males contain a much higher amount of Q (or &*) base modified tRNAAsN,tRNAHi", and tRNATy'than 5-day-old males (Fig. 6). However, the overall concentration of all these four tRNA species does not change during development (White et al., 1973b). Supposing the isoacceptors differ only in their modification of the anticodon, this result reflects changes in the activity of a modifying enzyme(s) rather than differences in rates of transcription. In fact, the insertion of guanine (guanylation), specific for Q-base containing tRNAs, was described by Hankins and Farkas (1970). The guanylation enzyme incorporates guanine into the first position of the anticodon without breaking the polynucleotide chain. This enzyme activity was also found in crude extracts of adult Drosophila (McKinnon et al., 1978; Farkas and Jacobson, 1980). The main substrates for the Drosophila enzyme are the Q (or Q*)-lacking forms of tRNAASp, tRNAA", tRNAHi",and tRNATy'(y-form). These and
GENETICS OF t R N A IN
Nt
Drosophila
Y 3 r d instar
b
su(s)'3rd instar C
e
6
143
I 6
6 vt mixed age idult
d
M t 3 5 d males
6
su(~)~adult f mixed age
7
Y
I Y FIG. 6. Isoacceptor profiles of tRNATYrisolated from wild type (wt) and su(s)' u; bw animals of different stages. The Q-base containing isoacceptor decreases in the larval and increases in the adult stage of the wild type. In the mutant a higher concentration of the Q-base containing isoacceptor is observed. Abscissa, fraction number; ordinate, counts per minute. Reproduced with permission from White et al. (197313) and Hosbach and Kubli (1979).
similar results obtained in E . coli (Nishimura, 1978) suggest that the guanylation enzyme is probably involved in the biosynthesis of Q. On the other hand, it has been shown by Farkas and Jacobson (1980) that during the morphogenesis of Drosophila the guanylation enzyme is mainly active at the stage where the conversion of Q to G proceeds in tRNA. These findings suggest that the enzyme is also involved in
144
ERIC KUBLI
other processes and not only in the replacement of Q by G in tRNA without new transcription of tRNA molecules. None of these changes has been linked to any particular developmental process yet, but many interesting questions arise. It would be of importance to know if the tRNAs synthesized during the developmental stages are transcribed from different gene clusters as discussed in Section 111. The tRNAs AsN, Asp, His, and Tyr respond to the codons XA; (X being A, U, C, or G). It has been shown by Harada and Nishimura (1972) that the tRNAs containing Q in the first position of the anticodon bind slightly better to codons containing U in the wobble position instead of C. This is confirmed by the finding of Grosjean et al. (1978) that the presence of a Q base in the anticodon stabilizes the formation of a G.U complex formed with a tRNA with a complementary anticodon by a factor of three over the identical sequence containing a G instead of a Q. These changes in the structure of tRNA might influence the translation of messengers in the sense of Strehlers theory (Strehler et al., 1971). However, Owenby et al. (1979) have not found any marked effect of Q on protein synthesis in a cell-free, tRNA- and mRNA-dependent system. In contrast to this finding it has been demonstrated that the unmodified tRNATy'isoacceptor of Drosophila can read the stop codon of a TMV-RNA encoded protein into a Xenopus laevis oocyte, when microinjected together with TMV-RNA whereas the Q-base modified tRNATy'cannot (Bienz and Kubli, 1981). This result suggests that the presence or absence of the Q-base modification in the first position of the anticodon plays a discriminatory role in the reading of certain codons. Codon assignments have been made for isoacceptors of tRNASe' (White and de Lucca, 1977) and tRNA""' (Dunn et al., 1978) by the ribosome binding technique. A clear preference for UCU over UCA/ C has been demonstrated for tRNAT. Transfer RNAP' binds mainly to GUA and weakly to GUU and GUG, whereas tRNAyt' binds almost exclusively to the triplet GUG. An exception to the prediction of the wobble hypothesis (Crick, 1966) is found for tRNAP'. This isoacceptor binds to all 4 valine triplets. Many of the isoacceptors are probably transcribed from the same genes, i.e., they are homogeneic. Posttranscriptional modification is responsible for the diversity of the tRNA species found in higher organisms (Agris and So11, 1977). This is illustrated by the finding of Altwegg and Kubli (1979) that tRNA:!&,,la isolated by affinity chromatography (anticodon G"AA) can be separated into 4 isoacceptors upon RPC-5 chromatography at low pH. This resolution is due
GENETICS OF t R N A I N
Drosophila
145
to an U or a D a t a specific position near the extra loop, and a C" or a C at another position in the anticodon loop. The high degree of modification of tRNA found in higher eukaryotes might be a consequence of correction mechanisms responsible for the constancy of the DNA sequences of the redundant tRNA genes (e.g., master-slave, Callan, 1967; crossover fixation, Smith, 1973). The evolutionary restriction imposed on the tRNA genes by such a hypothetical correction mechanism could be relieved posttranscriptionally by a high degree of modification, thus restoring the adaptivity of the tRNA molecules (Kubli, 1980). This assumption is supported by the similarity of the tRNA sequences found in many vertebrates (Sprinzl et al., 1980). The overall amino acid acceptance for the tRNAs studied (White et al., 1973b) does not change considerably during development. Major changes in the isoacceptor patterns have been described only for the Q-base containing tRNAs (White et al., 1973b; Hosbach and Kubli, 1979; Owenby et al., 1979). It seems therefore that all basic tRNA sequences are synthesized in the same proportions during the ontogeny of Drosophila. Changes in the amount of a specific isoacceptor can be induced by introducing deletions or duplications of the corresponding genes into the genome (Dunn et al., 1979a; Tener et al., 1980). For instance the genes for tRNAyt" are localized in the regions 84D, 90BC, and 92B. A mutant containing a deletion of region 84D contains less, whereas a mutant containing a duplication of this region contains more tRNAy;' than the wild-type (Fig. 7). However, the overall tRNAValacceptance (aminoacylation of all tRNAVa' isoacceptors) is greater in the flies with the duplication but similar to the wild-type in the flies with the deletion. The animals containing the deficiency seem to be able to compensate for the loss of tRNA genes. Transfer RNA gene duplications therefore result in dosage effects, whereas deletions for tRNA genes show dosage compensation. Some regulation is obviously possible. Although the X chromosome contains several tRNA gene clusters (Fig. 1)only two specific tRNA isoacceptors have been assigned to this chromosome so far (Hayashi et al., 1980). Dosage compensation is found for enzymes coded by the X chromosome in males (XY). It will be of interest to see whether this mechanism works also for the transcription of tRNA genes. Chavancy etal. (1979) discuss two models for the regulation of tRNA biosynthesis in higher eukaryotes based on the fact that a functional adaption of tRNA population with regard to the amino acid composition of the synthesized proteins can be found in many specialized cells. The first hypothesis assumes that the synthesis of a mRNA and the tRNA species needed for decoding it are coupled and genetically controlled. According to the
146 a
ERIC KUBLI
wt
45
1
b
duplication
C
deficiency
3b
3b
3b
J
3a
LA 6
FIG. 7. Chromatography on RPC-5 of Valyl-tRNA'"' from wild-type flies and flies with duplications or deficiencies at the site 84D.Transfer RNA from the three stocks was aminoacylated with [3H]valine. Each preparation of [sHIValyI-tRNAVa'was chromatographed on a RPC-5 column. The concentration of peak 3b increases in the duplication and decreases in the deletion in comparison with the wild-type. Abscissa, fraction number; ordinate, counts per minute. Reproduced with permission from Dunn et al. (1979a).
second hypothesis (favored by these authors) the concentration of the tRNA isoacceptors is adjusted a posteriori depending on the codon composition and amount of accumulated mRNAs. Transcription of tRNAs would therefore be controlled by the specific requirements a t the polysomes by means of a feedback mechanism. The duplication-deletion experiments of Dunn et al. (1979a) do not favor any of these hypotheses. However, the isoacceptor patterns of individual organs have not been studied in Drosophila. It is therefore not known if such a n extreme situation exists in any Drosophila cell as is found in the silk gland of Bombyx where the concentrations of the tRNAGly,tRNAA1",and tRNAS"' are correlated with the amino acid composition of fibroin, the major protein synthesized in this organ (Chavancy and Daillie, 1971). In all these experiments, the aminoacyl-tRNA synthetases used for the charging of the tRNA were isolated from adult flies. It has been claimed by Ilan et al. (1970) and others (Strehler et al., 1971) that
GENETICS OF
tRNA
IN
Drosophila
147
stage-specific aminoacyl-tRNA synthetases exist, responsible for the charging of specific tRNA isoacceptors involved in translational control of protein synthesis. The appearance of a new tRNA and its activating enzyme has been postulated by Ilan et al. (1970) after topical application of juvenile hormone to first day pupae of Tenebrio molitor. It was shown that the translation of cuticular protein in vitro is affected by the relative amount of tRNA provided either from normal or hormone-treated animals. However, a differential charging of tRNAs could only be observed under suboptimal in uitro conditions by Lassam et al. (1976). No new isoacceptors were observed during development under optimal in uitro aminoacylation conditions. Since in uiuo aminoacylation was not studied in any of these experiments the problem is still unsettled. Hosbach and Kubli (1979) have studied the influence of aging on the isoacceptor patterns of different tRNAs in Drosophila males. Transfer RNA isolated from 5-day-old and 35day-old males was charged with aminoacyl-tRNA synthetases extracted from 5-day-old and 35-day-old animals. No differences in the isoacceptor profiles dependent on the aminoacyl-tRNA synthetases could be found. However, aminoacyl-tRNA synthetases isolated from larvae have never been studied, mainly because of the high protease activity found in this stage. Furthermore, the proportion of in uivo aminoacylated tRNA (the fraction actually available for protein synthesis) has been determined only for 4-day-old larvae (Egg, 1978). Differences between tissues are obscured by the extraction of the tRNA from whole animals of both sexes. Only studies of the tRNA isoacceptors actively engaged in protein synthesis on polysomes from specific tissues will give clear answers about the possible involvement of tRNA in the regulation of translation. A further word of caution shall be added concerning the interpretation of tRNA isoacceptor patterns. Wosnick and White (1977) have demonstrated that rearing temperature and food composition can greatly influence the concentration of the Q-base containing isoacceptors. A careful control of the rearing conditions and of the age of the flies is therefore absolutely necessary if meaningful results are to be obtained. VI. "Transfer RNA Mutants": Minutes and Others
Although the method of in situ hybridization provides a means of localizing sequences complementary to tRNA in the genome, the final proof for functional tRNA genes will rest on the genetic and bio-
148
ERIC KUBLI
chemical analysis of mutants (see Section 111). The importance of a molecular characterization of putative tRNA mutants is therefore obvious. A. Minutes
Minutes are a class of dominant mutants that in heterozygous condition delay development, lengthen the mitotic cycle, decrease viability, reduce female fertility, lead to short thin bristles, and cause a number of other morphological abnormalities (Lindsley and Grell, 1967; Morata and Ripoll, 1975). They are lethal in homozygous or hemizygous condition. About 40 Minutes have been described, which are localized all over the Drosophila melanogaster genome (Lindsley and Grell, 1967; Lindsley et al., 1972). Many of them are correlated with a cytologically detectable deficiency (Fig. 1). Minute phenotypes are produced by heterozygous deficiencies for Minute loci. As Schultz (1929) has shown, Minutes have similar patterns of interaction with other mutants but do not interact with one another. Furthermore there is a strong correlation between the expression of the Minute phenotype and the severity of the effects of Minutes on the phenotypes of unrelated mutants. Schultz (1929) concluded from his experiments that the production of different gene products is affected in different Minutes but that these products have similar functions. Atwood (Ritossa et al., 1966) has proposed the interesting hypothesis that Minutes are the sites of redundant tRNA genes. The hypothesis is based on the following arguments. First, there are about the same number of Minute loci known as would be expected for tRNA gene clusters, assuming a scattered distribution of the major tRNA sequences (see Section 11). Second, many Minutes are associated with a cytologically observable deletion. Since tRNA genes are redundant (10- to 13-fold redundancy per basic sequence om the average), most point mutations should be expected to be ineffective. If the tRNA cistrons are clustered, deletions would be required t o produce a detectable mutant. Third, deletions for different tRNA genes should lead to similar effects. The observed Minute phenotype-delayed development, small bristles, homozygous lethality-fits well with a general retardation of protein synthesis. A similar phenotype is also observed in bobbed flies, deletions for the rRNA cistrons (Ritossa et al., 1966). A first attempt to test Atwoods hypothesis was made by Steffensen and Wimber (1971) by hybridizing crude I3H1tRNA t o salivary gland chromosomes. The labeled regions were compared with the known Minute loci. However, a decisive conclusion could not be drawn, be-
GENETICS OF
tRNA
IN
Drosophila
149
cause most of the Minute loci were not localized with sufficient accuracy on the salivary gland chromosome map and some of the mapping of the radioactivity was considered to be in error. A more recent approach by Elder et al. (1980b) using crude lZ5I-labeledtRNA as a hybridization probe yielded no correlation at all (Fig. 1).It has t o be considered, however, that in situ hybridization will provide information about complementary sequences in the genome (see Section 1111,whereas mutants will reveal the sites of functional genes. It might therefore be argued that the i n situ hybridization data must not necessarily coincide with the Minute locations, i.e., there might be more tRNA gene clusters revealed by i n situ hybridization than loci mutable to a Minute. White (1974) has analyzed all 20 aminoacyl-tRNAs on RPC-5 columns from the following mutants: M(2)S7, M(2)ZB, M(3)hy, and M(3) wiZ4. The only difference in comparison with the wild-type pattern was found in M(3)h.', where the tRNAThrisoacceptor was reduced to 57-65% of the wild type. Repeated crossing of this locus into a wildtype background did not have any effect on the reduction of this peak. Unfortunately the tRNAy genes have not been localized by i n situ hybridization. It is therefore not clear if this change in the isoacceptor pattern is due t o a deletion of tRNATh' genes. An elegant genetic approach to study this problem has been chosen by Huang and Baker (1976). These authors have determined the dose-response curves for the induction of Minutes and sex-linked recessive lethals with ethyl methane-sulfonate (EMS),an agent inducing primarily point mutations in Drosophila (Lim and Snyder, 1968, 1974). If Minutes are the sites of redundant tRNA genes their susceptibility to mutagenesis should differ from the majority of the other loci, which are believed to be not redundant (Laird, 1973). However, the rates of induction of the two types of mutations are clearly correlated. Independent of the EMS dose there are about 68 Minute mutants induced for every 5000 recessive lethals induced. These data fit well with the relative number of existing Minutes and lethal loci in the genome (Huang and Baker, 1976). Since the mutations were produced by an agent inducing point mutations it is difficult to understand how this event could lead to a Minute phenotype in a redundant gene cluster, unless a master-slave mechanism is assumed (Callan, 1967). But since the target size of an average Minute locus is the same as that of an average locus capable of mutating to a lethal (Huang and Baker, 19761, these data do not support Atwood's hypothesis that Minutes are the sites of redundant tRNA genes. Huang and Baker (1976) have pointed out the fact that the Minute
150
ERIC KUBLI
phenotypes are equally consistent with the assumption that the Minutes are the genes for the ribosomal proteins. In fact very recently a ribosomal protein gene has been localized near M(3)l (Vaslet et al., 1980). Oxidative phosphorylation was found to be abnormal by Farnsworth (1964, 1965a,b, 1970) in that phosphorylation was uncoupled from oxygen uptake to a greater extent as compared to controls in the following 9 mutants studied: M(2)12, M(2)1, M(2)173, M(2)z, M(3)w, M(3)124, M(3)B2,M(3)y, and M(3)l. The uptake of [35Slcystein and ['4C]1-leucineinto hemolymph and their incorporation into tissue protein was studied in larvae of wild-type and 5 Minutes: M(2)S-10, M(2)12,M(2)z, M(3)y, and M(3)w. Cystein was found to be accumulated in the hemolymph of the mutants. The incorporation of [35Slcysteine into tissue proteins was reduced according to the rate of growth. However, the incorporation of ['4C]1-leucine into hemolymph and tissue proteins was not different in M(2)12and M(3)w heterozygotes as compared with controls, although in M(2)12the fraction of leucine in the hemolymph incorporated into protein was reduced. Minute mutants have also been described in Drosophila hydei (Beck and van Breughel, 1975) but they have not been studied at the biochemical level. In summary, no solid evidence exists in favor of Atwood's hypothesis. Some Minutes may turn out to be deletions for tRNA genes, others may not. Minute phenotypes due to deletions might reflect the sensitivity of the genome toward changes in the gene balance (Lindsley et al., 1972; Huang and Baker, 1976). Many of these findings may be due to pleiotropy. Such effects might also explain the findings of Farnsworth (1964, 1965a,b, 1970). A detailed analysis on the DNA level is needed before the final answers can be given. B. lethal-meander, l(2)me Large deficiencies for tRNA genes might be expressed as dominant mutations, e.g., Minutes, whereas small ones can be expected to be recessive. In fact there are many recessive genes in Drosophila melanogaster which in homozygous condition display a Minute-like phenotype. Some of them map close to tRNA loci identified by in situ hybridization (e.g., dm, dw 24F, l(2)me, ml). None of them, with the exception of l(2)me, has been characterized on a molecular level. Zethal-meander (2-72 & ) is a recessive lethal factor (Schmid, 1949; Hadorn, 1961).Homozygous larvae stop growing 2 days after hatching from the egg. Most of the animals never pupate and die as 7- to 8day-old larvae (Dubendorfer et al., 1974). The hypothesis has been
GENETICS OF t R N A I N
Drosophila
151
proposed by Ziist et al. (1972) that a deletion for stage-specific activated tRNA genes might be responsible for the lethal effect. Kubli and Schmidt (19781 have localized genes for tRNAf'" in the region 52F (cytological map, Fig. 2b), which is close to 2-72 (genetic map). Although no exact correlation exists between the genetic and the cytological map for this region, the tRNA"'" isoacceptor pattern of l(2)me homozygotes was analyzed (Kubli, 1978). A comparison of the mutant profile with the control (Fig. 8) shows that the isoacceptor pattern is changed. The concentration of tRNAf'" is clearly reduced in the mutant. However, the total acceptance for glutamic acid is only slightly lowered in the mutant (Kubli, 1978). This indicates that not only the concentration of isoacceptor tRNA2'" is reduced in the mutant but a t the same time the concentration of tRNAf'" is increased. If the deletion hypothesis is correct, it follows that the cell possesses a mechanism to keep the total tRNA"'" concentration constant even though some of the tRNAf'" genes are missing. This is in accordance with the results of Dunn et al. (1979a) who found that the total amount
a
----
-
14
C cpm w t 3H cpm &?)me
l4C
@)me
4
FIG. 8. RPC-5 chromatography of unfraetionated tRNA aminoacylated with glutamate isolated from wild type and 1(2ime/l(Z/me4-day-old larvae. The proportion of tRNA$'"/tRNAy'" is changed in t h e mutant. The isotopes were exchanged to exclude isotope effects. Reproduced with permission from Kubli ( 1978).
152
ERIC KUBLI
of tRNAValis the same in wild-type flies and in flies carrying a deletion of the tRNAit' genes (see also Section V). Four-day-old 1(2)me/1(2)rne larvae still contain some of the tRNAf'" isoacceptor (Fig. 6). The question therefore arises whether this isoacceptor is of maternal origin or whether it is transcribed from the other t R N A y loci of the homozygous mutant. The following experiment was performed to answer this question. Homozygous l(2)me larvae were fed with [32Plphosphateand the tRNAf'" isoacceptor isolated by means of anticodon-anticodon affinity chromatography (Grosjean et al., 1973). The tRNAfl" was then digested with RNase TI, an enzyme splitting after G, and fingerprinted. If the tRNAf'" is synthesized in the mutant a normal fingerprint pattern should be the result, if not, only one spot should be found after autoradiography: the 3'-end fragment labeled by the constant turnover of the CCA end. The experiment revealed a complete fingerprint pattern (Kubli and Kutzer, unpublished). It can therefore be concluded that the tRNAfl" isoacceptor is still synthesized in the homozygous mutant. It is not clear, however, from which of the three regions containing genes for tRNA2'" (52F,56F, and 62A) the tRNA is transcribed. A tissue-specific transcription cannot be excluded either, since whole animals were used for this experiment. None of the "tRNA mutants'' described above has been shown unambiguously t o affect the tRNA genes. The recently developed method of digesting DNA with restriction enzymes, separating the digestion products on agarose gels with subsequent transfer onto nitrocellulose filters for hybridization with labeled RNA (Southern, 1975) should make it feasible to find out if deletions of tRNA genes are involved. On the other hand, for the elucidation of the function of tRNA gene clusters during the development of Drosophila the induction and subsequent biochemical analysis of small deficiencies for tRNA coding regions is the method of choice. VII. Suppression
Suppression is defined as "the reversal of a mutant phenotype due to mutation of a mutational site distinct from that of the mutation giving rise to the mutant phenotype" (Rieger et al., 1976). The result is a revertant produced by interaction of both allelic (intragenic suppression) and nonallelic (intergenic suppression) mutant genes. Suppression phenomena can be due to a variety of mechanisms (Hart-
GENETICS OF tRNA I N
Drosophila
153
man and Roth, 1973). According to the scope of this article only tRNAmediated suppression will be considered. Suppressor mutations have been used in prokaryotes as a very potent genetic tool for the elaboration of various cellular processes at the molecular level, e.g., structure and function of genes, interactions between tRNA and aminoacyl-tRNA synthetases, tRNA biosynthesis, codon-anticodon recognition, etc. (for reviews see Steege and Soll, 1979; Celis and Smith, 1979). Great efforts are therefore directed toward the elucidation of the molecular basis of suppression in eukaryotes. It can be expected that new mechanisms and functions will be found. Encouraging progress has been made in the last few years in yeast and in mammalian systems concerning nonsense suppression (suppression of the UAG, UAA, and UGA codons) due to the availability of refined in uitro protein synthesizing systems (Capecchi et al., 1975; Gesteland et al., 1976). In Saccharomyces cereuisiae and Schizosaccharomyces pombe it has been demonstrated that tRNA is involved in nonsense suppression and the suppressing tRNA species have been identified in two cases (Piper et al., 1976, 1978; Kohli et al., 1979). In mammalian systems Capecchi et al. (1977) have shown that the activity of hypoxanthine-guanine phosphoribosyltransferase (HGPRT) of a mutant L-cell line can be restored by injecting a n ochre suppressor tRNA from S. cereuisiae, whereas Gesteland and co-workers (Gesteland et al., 1977) could restore a specific polypeptide fragment of a deficient adeno(2)-SV 40 hybrid virus t o wild-type size by the addition of yeast suppressor tRNA in an in uitro translation reaction. Most recently suppressor genes have been described in Caenorhabditis elegans (Waterston and Brenner, 1978) which might act as nonsense suppressors. However, the exact underlying mechanism is not yet known. Besides these findings nothing is known about tRNA-mediated suppression in a higher organism with the exception of D rosop hi la. In bacteria, suppressor mutations affecting the anticodon of a tRNA occur in general only if the genes for a tRNA species are redundant (Soll et at., 1966). The nonsense suppressor tRNA is most often a minor isoacceptor tRNA and is therefore present only in small amounts (Soll, 1968). Drosophila melanogaster has 590-750 tRNA genes (Ritossa et al., 1966; Weber and Berger, 1976) with a redundancy of about 5-20 copies per basic tRNA sequence (see Section 11). Plenty of spare tRNA are therefore available for a creation of nonsense suppressors. Many suppressor mutations have been described in Drosophila melanogaster (Lindsley and Grell, 1967; Lindsley and Zimm,
154
ERIC KUBLI
1978) but only a few of them have been subjected to a biochemical analysis. FOR NONSENSE SUPPRESSORS IN Drosophila A. THE SEARCH
Two approaches have been made to demonstrate directly the presence of nonsense suppressor tRNAs in certain Drosophila strains. The rationale of the experiments was the same. Transfer RNA was isolated from Drosophila suppressor stocks and tested in a n in uitro protein synthesis system for the ability to suppress a nonsense mutation of a phage used as a messenger. Kiger (1974) has shown that wild-type Drosophila Tyrosyl-tRNA supports protein synthesis with high efficiency in an E . coli cell-free system programmed with bacteriophage f2 RNA. However, this same tRNA from the mutant suppressor of Hairy wing (su(Hw12:3-54.8) does not detectably suppress the amber mutation sus 3 in the fZ coat protein cistron. Possibly this could be due to the incompatibility of prokaryotic systems with eukaryotic tRNA. Therefore Kubli (unpublished results) tested tRNAs from the following suppressor stocks in eukaryotic cell-free protein-synthesizing systems: su(s)*, su(f), su(Hw)', su(t), S U ( S S )and ~ , Su(S). The results of the i n uitro assays in the systems used for amber (Schreyer et al., 1973; Gesteland et al., 1976), ochre, and UGA (Kohli et al., 1979) suppression were all negative. The failure of these attempts to demonstrate suppressor tRNAs in Drosophila does not necessarily mean that they are absent. The efficiency of the systems used might have been too low for detection. More refined methods (Schlegel and Rechsteiner, 1975; Bienz et al., 19801, and prefractionation of the tRNA, might give positive results. An alternative way to search for nonsense suppressors is the production of mutants able to suppress genes that contain a nonsense mutation. Many null mutations have been induced in Drosophila (for review see O'Brien and McIntyre, 1978) and some of them have been characterized as nonleaky, noncomplementing, CRM-negative, the properties expected for nonsense, frameshift, deletion, and some missense mutations. However, none of the proteins affected has yet been sequenced, thus a t present these mutants cannot be used as a screen for nonsense suppressors. More general attempts to discover tRNA-mediated suppression in Drosophila melanogaster have been made by White (1974) and Bienz et al. (1979). White (1974) has found differences in the distribution of the isoacceptors of the Q-base containing tRNAs in suppressor of purple (su(pr)) and suppressor of sable ( S U ( S ) ~ ) (see below). But he
GENETICS OF tRNA IN
Drosophila
155
could not find any significant changes in the overall amino acid acceptance. The changes observed in the isoacceptor patterns are therefore probably due to a variable genetic background and reflect the metabolic state of the flies rather than a primary action of the suppressor mutations. Bienz et al. (1979) have screened the following suppressor stocks for deviations from the wild-type pattern on 2-d polyacrylamide gels: suff),sufs)', suft),S U ( H W )su(wa), ~, SufS), s u ( p f ) , Sufdx), Su(er)-su(tu-bw). The only reproducible difference in comparison to the wild-type appeared in Sufdx): one additional spot was found in the region of the larger tRNA species. Fingerprint analysis suggests that only one tRNA isoacceptor is localized in this additional spot. The occurrence of this spot is correlated with the presence of a second chromosome carrying the Sufdx) mutation. Furthermore, the amount of RNA is clearly dosage dependent (M. Bienz and E. Zublin, unpublished). Although these findings suggest that Sufdx) might code for a tRNA, the available evidence is not strong enough to allow a definitive conclusion. €3. suppressor of sable, sufs), 1-0
suppressor of sable was the first suppressor described for any organism (Lindsley and Grell, 1967). Although at the present time understanding of the suppression mechanism is still elusive, a detailed description seems to be justified since this is the only suppressor gene which has been thoroughly investigated on a biochemical level in higher eukaryotes. These studies provide an excellent example for the difficulties (and frustrations!) that may be encountered in an attempt to elucidate at the molecular level the interaction of genes in complex biological systems. sufs) is a recessive gene suppressing sable (s; 1-43.01, vermilion (u; 1-33.01, speck (sp; 2-107.01, and purple (pr; 2-54.5). sable and speck are body color mutants, whereas vermilion and purple affect the synthesis of eye pigments. Most of the work with sufs) has been done on the interaction with u alleles. Since the original suppressor sufs) has been lost, subsequent work was done with another allele SU(S)'. Considering the complexity of the system a short description of the biosynthesis of eye pigments and the u enzyme tryptophan oxygenase (=tryptophan pyrrolase, EC 1.13.1.121 shall be given. Biochemical genetics started with the studies of eye color mutants in Drosophila and Ephestia. The first mutant to be described in Drosophila was white eye ( w ) by T. H. Morgan (1910). Many eye color mutants were then used in a series of brilliant experiments studying
156
ERIC KUBLI
the factors linking genes and phenotypes (Kuhn, 1932; Caspari, 1933; Beadle and Ephrussi, 1935; Ephrussi and Beadle, 1935). These experiments finally led to the idea that genes control specific steps in metabolic pathways (Beadle and Tatum, 1941; Ephrussi, 1942). Drosophila eyes contain two classes of pigments: ommochromes (brown) and pterins (red) (for reviews see: Hadorn, 1958; Ziegler, 1961; Ziegler and Harmsen, 1969; Linzen, 1974; Needham, 1978). Ommochrome biosynthesis starts with tryptophan whereas the details of the pathways involved in pterin biosynthesis are still unclear (Dickinson and Sullivan, 1975; O'Brien and McIntrye, 1978). vermilion and purple are genes acting in the ommochrome and pterin synthesis, respectively; sable and speck affect probably the synthesis of melanin (Dickinson and Sullivan, 1975). The first enzyme involved in the formation of formylkynurenin from tryptophan in the ommochrome pathway is tryptophan oxygenase. Baglioni (1960) demonstrated that activity of this enzyme is virtually absent in u flies and partially restored by su(s)'. By measuring the enzyme activities of flies with different doses of the u+ gene it has been shown that u + is the structural gene for tryptophan oxygenase (Baillie and Chovnick, 1971). A partial purification has been achieved by Marzluf (1965). Crude enzyme extracts of wild-type animals can be stimulated by adding hematin; the purified enzyme becomes heavily dependent upon added methemoglobin (Baillie and Chovnick, 1971). The vermilion mutants can be divided in two classes: some alleles, designated us (e.g., vk, u'), are suppressible by su(s)', others, designated u' (e.g., u4'=, u51a, u51b, u 5 l C ) ,are not (Green, 1952; Tartof, 1969). It is interesting to note that all X-ray-induced mutants are u' alleles (Green, 1954; Lindsley and Grell, 1967). The degree to which tryptophan oxygenase activity is restored in us flies depends completely on the particular uermilion allele, since three independent suppressor alleles had the same effects on each of two different mutant uermilion alleles (Tartof, 1969). The suppressor genes seem to act only qualitatively, providing the appropriate environment for the restoration of the enzyme activity. vermilion mutants do not complement in uiuo (Green, 1954; Barish and Fox, 1956) but the specific activities of enzyme extracts from certain heterozygotes ( u + I u ) do not behave in additive fashion (Tartof, 1969). The specific activities measured are superadditive, i.e., they are greater than half of the wild type activity ( u + / u + ) . Based on these and other data Tartof (1969) proposed a subunit model for Drosophila tryptophan oxygenase. According to this hypothesis u+ is the structural gene for a subunit of a homodimeric enzyme. The us genes produce polypeptides which are unable to form
GENETICS OF t R N A IN
Drosophila
157
the dimer. A favorable environment for the dimerization of us units is provided in su(s) homozygotes. Tartof concluded that su(s) is acting as a n indirect or metabolic suppressor (Gorini and Beckwith, 1966). However, one of the predictions of this model could not be confirmed. It was shown by Baillie and Chovnick (1971) that tryptophan oxygenase isolated from vk flies (a suppressible u allele) has a similar molecular weight as the wild-type enzyme. Based on these and other results these authors proposed an allosteric regulation model (Baillie and Chovnick, 1971). It is assumed that suppressible vermilion alleles produce altered polypeptides which exhibit a greater than normal sensitivity toward in vivo negative effectors. Homozygous su(s) mutants block the production of these negative effectors, therefore removing the inhibition of the vs tryptophan oxygenase. This hypothesis has obtained some support by work done mainly in K. B. Jacobson's laboratory. The discovery that RNase treatment of vermilion fly extracts restores tryptophan oxygenase activity was received with great interest (Jacobson, 1971). These results were interpreted as suggesting that the RNase removes a RNA acting as a negative effector. In fact it could be demonstrated that the inhibitory action was associated with a specific tRNATyr isoacceptor (Jacobson, 1971). Adding wild-type tRNA to a n activated v extract reduced the enzymatic activity again. Studying the isoacceptor profiles of several tRNAs isolated from wildtype and SU(S)' u flies, Twardzik et al. (1971) could show that the second major isoacceptor peak of tRNATy'was missing in the mutant. Based on these results Twardzik et al. (1971) proposed the following model: Tryptophan oxygenase is affected by the vermilion mutation in such a way that t R N A p functions as a n inhibitor. This inhibitory action can be removed either by RNase action or by introducing su(sI2 into the genome of v homozygotes thereby eliminating a tRNATyr isoacceptor. Not only the isoacceptor pattern of tRNATv is affected in SU(S)' homozygotes. White et al. (1973b) showed that tRNAAsN,tRNAAsp,and tRNAHiSprofiles are also changed. All these tRNAs contain the modified nucleoside Q (or a derivative Q*, see Section V) in the anticodon of some of their isoacceptors. This is probably the only difference between the major isoacceptors (White et al., 1973b). The isoacceptor patterns of these tRNAs change considerably in a similar way during development. In fact, it was demonstrated that t R N A p is not completely absent in s ~ 4 . s )u~flies, but strongly reduced (Fig. 60. White et al. (1973b) suggested that the activity of tryptophan oxygenase is regulated by the proportion tRNATJ"/tRNAEyrwhereby a modifying
158
ERIC KUBLI
enzyme would be responsible for the shift in the equilibrium. su(s)' alters the Q-base isoacceptor pattern such that tRNAEF is virtually absent and the vermilion tryptophan oxygenase therefore functions. This simple model had to be revised recently. Jacobson et al. (1975) and Warner and Jacobson (1976) found that two forms of Drosophila Tyrosyl-tRNA synthetase can be obtained depending on the DEAEfractionation procedure. With wild-type tRNA as a substrate both fractions charge both forms of tRNATyr.With tRNA isolated from su(s)' u animals one enzyme fraction charges both forms, but the other fraction aminoacylates only the first isoacceptor. The authors postulate that the su(s)+ locus produces an enzyme that modifies tRNAy. This modification does not occur in the SU(S)' mutant. The ability to discriminate between tRNAEyrof wild-type and the second tRNA5' isoacceptor of SU(S)' ( = t R N A p ) is dependent upon the presence or absence of the unknown modification. According to this model it is unlikely that the su(s) locus is involved in the Q-base modification. Further doubts on the relationship between tRNATy' and the mechanism of suppression of su(s) have been raised by Wosnick and White (1977). They demonstrated that the proportion of the Q-base containing isoacceptors can be altered by changing the temperature of rearing and the food composition. This effect can be observed in wild-type and in su(s)' v flies. Furthermore they could produce su(s)' v; bw flies with 78% of tRNATy'in the type I1 form which had brown eyes indistinguishable from su(s)' v; bw flies containing only 6% of tRNA?' (bw blocks pterin synthesis, u; bw flies have white eyes, su(s)' v; bw flies possess brown eyes due to the synthesis of brown eye pigments). This finding is in contradiction to the prediction of the first model proposed by Twardzik et al. (1971). In a recent paper Jacobson (1978) however pointed out that su(s)' v; bw flies do not represent the proper control animals. According to his modified hypothesis (Jacobson et al., 1975) the tRNAT,y' concentration should not have any effect in sufs)' u; bw flies since tRNA',Y' lacks a modification present in t R N A p of wild-type or u; bw flies. Jacobson (1978) was able to demonstrate that the eye color was correlated with the extent of Q-base modification in v; bw but not in S U ( S ) ~v; bw flies (Fig. 9) as predicted by his model. The inhibition of the vermilion tryptophan oxygenase may therefore be restored in two ways: first, by introducing su(s)', resulting in a complete or partial loss of a modified nucleoside (not Q!) in t R N A p essential for the interaction with tryptophan oxygenase and the discriminating synthetase; second, by rearing the flies ( v ; bw) on an appropriate diet thereby increasing the concentration of Q-base modified tRNAs.
GENETICS OF tRNA IN U
159
Drosophila
W
V
su(si2 v, bw brown
4
v. bw
brown
%
v, bw
1%
v. bw
tan
FIG. 9. Effect of diet on Tyrosyl-tRNA. The tRNA was charged with either [‘4C]tyrosine or [3Hltyrosine, washed on DEAE-cellulose to remove unbound tyrosine and other ingredients of the reaction mixture, and eluted. The sample was applied to a RPC-5 column and eluted with a linear NaCl gradient. The diets on which the flies were raised are designated “N” for the normal diet and “1%”for the diet consisting of 1% dried brewers yeast. The relative amount of the second peak (without Q*-base; the first peak contains the &*-base modification) is designated on each chromatogram. The eye color of the flies is shown on each panel. Abscissa, fraction number; ordinate, counts per minute. Reproduced with permission from Jacobson (1978).
160
ERIC KUBLI
In addition to the rather confusing “state of the art” in this field several experiments can be criticized. Mischke et al. (1975) were not able to reproduce Jacobson’s (1971) reactivating experiments with RNase, nor could they be confirmed in Jacobson’s own laboratory (Jacobson et al., 1975). Mischke and co-workers believe that the tryptophan oxygenase activity observed in u extracts treated with RNase is due to EDTA present in the tryptophan oxygenase assay used by Jacobson (1971). In fact activity measurements of tryptophan oxygenase seem to be problematic. Crude extracts contain inhibitors which may be removed by Norite treatment (Baillie and Chovnick, 1971). One of the inhibitory compounds removed by this treatment is pterins. It is known that there are regulatory interactions between the pterin and the ommochrome pathways (Parisi et al., 1976). Tryptophan oxygenase is inhibited by some naturally occurring pterines (Ghosh and Forrest, 1967). The question therefore arises whether these in uitro assays reflect the actual in uiuo situation. Furthermore the product measured is not N-formylkynurenine (the product of tryptophan oxygenase) but kynurenine. It is thereby assumed that kynnuenine formidase is not the rate-limiting enzyme. An additional aspect that might be considered is the control of tryptophan oxygenase activity and breakdown by heme and other compounds (Schimke et al., 1965). The studies on the isoacceptor profiles have all been performed with tRNA isolated from larvae or from flies. However, the brown pigments are synthesized about 53-55 hours, and the red ones about 71 hours after pupation (Daneel, 1941; Hadorn and Ziegler, 1958). Pupal tRNA isoacceptor profiles should therefore be compared. Furthermore the eye color is not a reliable indicator for the defects of the metabolic pathways leading to eye pigments. Also the genetic background can considerably influence the biosynthesis of these compounds (Ziegler, 1961). As mentioned in the introduction su(s) also suppresses the mutants purple, speck, and sable. However, much less information is available on the interaction with these genes. It has been shown by Yim et al. (1977) that pr is the structural gene for sepiapterin synthase. su(s), restores the pterins in pr to wild type or nearly wild-type level (Wilson and Jacobson, 1977). A marked decrease in the concentration of the A, component of phenol oxidase (a multimeric enzyme; Mitchell and Weber, 1965) occurs in homozygous speck mutants. In the presence of su(s)’ the normal amount of A, is restored. No data are available on the interaction of su(s) with the body color mutant sable. Is there any connection between tRNA5’ and the activity of tryptophan oxygenase in su(s), u; bw flies? The evidence at hand is not
GENETICS OF t R N A IN
Drosophila
161
too convincing. The shifts observed in the isoacceptor patterns of Qbase containing tRNAs correlated with changes in the eye color may be a fortuitous result of pleiotropy, the primary effect for example being a reduced protein synthesis. This would fit with the finding that old Drosophila males have a reduced protein synthesis and possess a greater amount of Q-base modified tRNAs, and that eyes from u flies darken with aging (Baumann, 1969; Hosbach and Kubli, 1979). Clearly what is needed is the purification and sequencing of the tRNAm and tryptophan oxygenase from wild-type and mutants. This would allow a definite judgment of the adequacy of the hypotheses proposed to explain this complex and interesting system of genes. VIII. Conclusions
Most of the regions containing tRNA genes in the Drosophila melanogaster genome have probably been localized by the in situ hybridization technique. However, the function of these genes during development has to be demonstrated. Suppressor mutations mediated by tRNA might be a valuable help for the accomplishment of this goal. Many deletions affecting tRNA genes will probably be described in the near future. An obvious challenge is the induction of point mutations in regions controlling tRNA gene transcription. This might be especially difficult if each of the redundant genes is under separate control. The great progress in the understanding of the structure and function of tRNA genes induced by the application of genetic engineering techniques is fascinating. The in vitro transcription experiments with extracts of Xenopus laeuis oocyte nuclei will certainly lead to more interesting insights into the control regions of tRNA genes. However, they are plagued by the problems of heterologous systems. In fact, it has to be emphasized that the in uiuo function of the tRNA genes analyzed in this manner has not yet been shown. A careful comparison of the data obtained by in uitro experiments with i n vivo observations will be indispensible. Although the efforts of several laboratories to find a nonsense suppressor tRNA in Drosophila melanogaster have not yet been rewarded, it can be assumed that the application of the recently developed refined test systems for nonsense suppressors (Capecchi et al., 1975; Gesteland et al., 1976; Schlegel and Rechsteiner, 1975; Bienz et al., 1980) will allow a definite answer as to the existence of such a mechanism of suppression in Drosophila. A nonsense suppressor could be of great importance for various reasons. First, it is to be expected that some
162
ERIC KUBLI
null mutations could be identified as nonsense mutations. This would provide the opportunity to induce and select new nonsense suppressors with most probably new characteristics not found in prokaryotes. Second, a nonsense suppressor mutant might help to identify the gene products of mutants controlling developmental processes (e.g., homoeotic mutants). If a nonsense suppressor mutation can restore the function of another mutant we must conclude that the gene product of the latter is a protein. It seems almost certain that a combination of modern biochemical techniques with the sophisticated genetics of Drosophila melanogaster will allow substantial insights into the functions of tRNA and tRNA genes in this organism in the near future. ADDENDUM: Two Drosophila melanogaster tRNALeU genes containing intervening sequences in the anticodon loop of length 38 and 45 bases, respectively, have been described recently by Robinson and Davidson (Cell 23, 251-259, 1981). The sensitive screening system using the Xenopus laevis oocyte for the detection of tRNAs with suppressor activity (Bienz et al., Nucleic Acids Res. 8, 5169-5178, 1980) has been applied to prefractionated tRNA isolated from Drosophila melanogaster suppressor stocks (Bienz, M., Ph.D. Thesis, Univ. Zurich, 1981). The results of these experiments can be summarized as follows. (1) No opal suppressor activity was detected in any of the fractions tested. (2) Transfer R N A F (anticodon G+A) acts as a natural suppressor of the TMV-RNA stop codon whereas t R N A y (anticodon Q+A) does not. These two major tRNATy' isoacceptors are probably homogeneic, i.e., they differ only in the first position of their anticodons. The TMV readthrough protein is also synthesized in TMV-infected tobacco plants. These results indicate that the extent of the synthesis of this protein can be controlled on the translational level by the activity of the Q base modification enzyme. (3) In all tested genotypes the Q base modified tRNATyris not able to read the TMV-RNA stop codon with one exception S U ( S ) ~ .This finding can be interpreted in two ways: (a) S U ( S ) ~is a true amber or ochre nonsense suppressor; (b) su(sj2 restores the ability of the t R N A y to read the leaky TMV-RNA stop codon, but is not a true nonsense suppressor. As of today it is not clear whether su(s)' codes for a mutant tRNA or a modification enzyme. Two findings support the latter assumption. First, no tRNATy' genes map a t the S U ( S ) ~ locus (1-0) as determined by in situ hybridization (22F, 28C, 41AB, 42A, 42E, 56D, and 85A; Dudler et al., Chromosoma 84,49-60, 1981). Second, the readthrough activity of the su(sJ2tRNA;SY' containing fraction is about the same as the activity of the wild-type tRNAzv containing fraction. This sug-
GENETICS OF t R N A IN
Drosophila
163
gests that all S U ( S ) ~t R N A 7 molecules are able to readthrough the TMV-RNA stop codon. This might be due to the absence (or presence) of a modified base present (or absent) in the wild-type tRNAF. ACKNOWLEDGMENTS I would like to express my gratitude to the many colleagues a t the Zoological Institute, University of Zurich, and to Dr. D. So11, Yale University, for reading the manuscript and for many suggestions. This work was supported by grant number 3.024.76 from the Swiss National Science Foundation, the Hescheler- and the Julius Klaus-Stiftung.
REFERENCES Agris, P. F., and Soll, D. (1977). The modified nucleosides in transfer RNA. In “Nucleic Acid-Protein Interactions” (H. J . Vogel, ed.), pp. 321-344. Academic Press, New York. Altwegg, M., and Kubli, E. (1979). The nucleotide sequence of phenylalanine tRNA, of Drosophila rnelanogaster: Four isoacceptors with one basic sequence. Nucleic Acids Res. 7 , 93-105. Altwegg, M., and Kubli, E. (1980a). The sequence of glutamate tRNA, of Drosophila rnelanogaster. Nucleic Acids Res. 8, 215-223. Altwegg, M., and Kubli, E. (1980b). The nucleotide sequence of histidine tRNA of Drosophila rnelanogaster. Nucleic Acids Res. 8, 3259-3262. Altwegg, M., Vogeli, G., and Kubli, E. (1978). Isolation und partielle Sequenzierung von tRNSG’”von Drosophila rnelanogaster mittels Affinitatschromatographie. Rev. Suisse Zool. 85, 5-9. Artavanis-Tsakonas, S., Schedl, P., Tschudi, C., Pirotta, V., Steward, R., and Gehring, W. (1977). The 5 s genes of Drosophila melanogaster. Cell 12, 1057-1067. Ashburner, M. (1975). The puffing activities of the salivary gland chromosomes. Zn “Handbook of Genetics” (R. C. King, ed.), Vol. 3, pp. 793-811. Plenum, New York. Ashburner, M., and Bonner, J. J. (1979). The induction of gene activity in Drosophila ’ by heat shock. Cell 17, 241-254. Axel, R., Maniatis, T., and Fox, F., eds. (1979).“Eucaryotic Gene Regulation.” Academic Press, New York. Baglioni, C. (1960). Genetic control of tryptophanpyrrolase in Drosophila melanogaster and D . uirilis. Heredity 15, 87-96. Baillie, D. L., and Chovnick, A. (1971). Studies on the genetic control of tryptophanpyrrolase in Drosophila melanogaster. Mol. Gen. Genet. 112, 341-353. Barish, N., and Fox, A. S. (1956). Immunogenetic studies of pseudoallelism in Drosophila melanogaster. 11. Antigenic effects of the vermilion pseudoalleles. Genetics 41, 45-57. Baumann, P. A. (1969). Untersuchungen zum Proteinstoffwechsel bei alternden Adultrnannchen, Larven des Wildtyps und der Letalrnutanten (ltr und lme) von Drosophila melanogaster. Z . Vergl. Physiol. 64, 212-242. Beadle, G . W., and Ephrussi, B. (1935). Differenciation de la couleur de l’oeil cinnabar chez la Drosophile (Drosophila melanogaster). C.R. Seances Acad. Sci. (Paris)201, 620-622. Beadle, G. W., and Tatum, E. L. (1941). Experimental control of development and differentiation. Genetic control of developmental reactions. A m . Nut. 75, 107-116.
164
ERIC KUBLI
Beck, H., and van Breughel, F. M. A. (1975). Minute-type mutants in Drosophila hydei. Arch. Genet. 48, 128-147. Bienz, M., and Kubli, E. (1981). Wild type t R N w reads TMV-RNA stop codon, but Q-base modified tRNAF does not. Nature (London), in press. Bienz, M., Zublin, E., and Kubli, E. (1979). Transfer RNA mediated suppression in Drosophila melanogaster. Experientia 35, 956. Bienz, M., Kubli, E., Kohli, J., deHenau, S., and Grosjean, H. (1980). Nonsense suppression in eukaryotes: The use of the Xenopus oocyte as an in vivo assay system. Nucleic Acids Res. 8, 5169-5178. Birnstiel, M. L., Sells, B., and Purdom, I. (1972). Kinetic complexity of RNA molecules. J . Mol. Biol. 63, 21-39. Broker, T. R., Angerer, L. M., Yen, P. H., Hershey, N. D., and Davidson, N. (1978). Electron microscopic visualization of tRNA genes with ferritin-avidin: Biotin labels. Nucleic Acids Res. 5, 363-384. Brown, D. D., and Gurdon, J. B. (1977). High fidelity transcription of 5s DNA injected into Xenopus oocytes. Proc. Natl. Acad. Sci. U.S.A. 74, 2064-2068. Callan, H. G. (1967). The organization of genetic units in chromosomes. J . Cell Sci. 2, 1-7. Capecchi, M. R., Hughes, S. H., and Wahl, G. M. (1975). Yeast super-suppressors are altered tRNAs capable of translating a nonsense codon in uitro. Cell 6, 269-277. Capecchi, M. R., von der Haar, R. A., Capecchi, N. E., and Sveda, M. M. (1977). The isolation of a suppressible nonsense mutant in mammalian cells. Cell 12, 371-381. Caspari, E. (1933). Ueber die Wirkung eines pleiotropen Gens bei der Mehlmotte Ephestia Kuhniella Zeller. R o w Arch. Entwicklungs, mech. Org. 130, 353-381. Chavancy, G., and Daillie, J. (1971). Adaption fonctionelle des tRNA a la biosynthese prot4ique dans un syseme cellulaire hautement differenc6. Biochimie 53, 1187-1194. Chavancy, G., Chevallier, A., Fournier, A., and Garel, J. P. (1979). Adaption of isotRNA concentration to mRNA codon frequency in the eucaryotic cell. Biochimie 61, 71-78. Chovnick, A., Gelbart, W., and McCarron, M. (1977). Organization of the rosy locus in Drosophila melanogaster. Cell 11, 1-10. Celis, J. E., and Smith, J. D., eds. (1979). “Nonsense Mutations and tRNA Suppressors.” Academic Press, New York. Clarkson, S. G., Birnstiel, M. L., and Serra, V. (1973). Reiterated tRNA genes of Xenopus laeuis. J . Mol. Biol. 79, 391-410. Commerford, S. L. (1971). Iodination of nucleic acids in uitro. Biochemistry 10, 1993-1999. Crick, F. H. C. (1966). Codon-anticodon pairing: The wobble hypothesis. J . Mol. Biol. 19, 548-555. Daneel, R. (1941). Die Ausfarbung iiberlebender u- und cn-Drosophila-Augen mit Produkten des Tryptophanstoffwechsels.Biol. Zentralbl. 61, 388-398. De Franco, D., Schmidt, O., and 5611, D. (1980). Two control regions for eukaryotic tRNA gene transcription. Proc. Natl. Acad. Sci. U.S.A. 77, 3365-3368. Delaney, A., Dunn, R., Grigliatti, T. A., Tener, G. M., Kaufman, T. C., and Suzuki, D. T. (1976). Quantitation and localization of tRNA genes of Drosophila melanogaster. Fed. Proc. Fed. A m . Soc. Exp. Biol. 35, 1676. Dickinson, W. J., and Sullivan, D. T. (1975). “Gene-enzyme systems in Drosophila. Springer-Verlag, Berlin and New York. Diibendorfer, K., Nothiger, R., and Kubli, E. (1974). A selective system for a biochemical analysis of the lethal mutation l(2)me of Drosophila melanogaster. Biochem. Genet. 12, 203-211.
GENETICS OF t R N A I N
Drosophila
165
Dudler, R., Egg, A. H., Kubli, E., Artavanis-Tsakonas, S., Gehring, W. J., Steward, R., and Schedl, P. (1980). Transfer RNA genes of Drosophila melanogaster. Nucleic Acids Res. 0, 2921-2937. Dunn, R., Addison, W. R., Gillam, E. C., and Tener, G . M. (1978). The purification and properties of valine tRNAs of Drosophila melanogaster. Can. J . Biochem. 56, 6 18-623. Dunn, R., Hayashi, S., Gillam, I. C., Delaney, A. D., and Tener, G. M. (1979a). Genes coding for valine transfer ribonucleic acid-3b in Drosophila melanogaster. J . Mol. Biol. 120, 277-287. Dunn, R., Delaney, A. D., Gillam, I. C., Hayashi, S., Tener, G. M., Grigliatti, T., Misra, V., Spurr, M. G., Taylor, D. M., and Miller, R. C. (1979b). Isolation and characterization of recombinant DNA plasmids carrying Drosophila tRNA genes. Gene 7, 197-215. Egg, A. H. (1978). Eine vergleichende Analyse der tRNA und 5s rRNA bei der Letalmutante l(3)tr und dem Wildtyp von Drosophila melanogaster. Ph. D. Thesis, University of Zurich. Elder, R., Szabo, P., and Uhlebeck, 0. (1980a). 4 s RNA gene organization in Drosophila melanogaster. In “Transfer RNA” (J. Abelson, P. R. Schimmel, and D. 5611, eds.). Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Elder, R. T., Szabo, P., and Uhlenbeck, 0. (1980b). In situ hybridization of three transfer RNAs to the polytene chromosomes of Drosophila melanogaster. J . Mol. Biol. 142, 1-17. Ephrussi, B. (1942). Analysis of eye color differentiation in Drosophila. Cold Spring Harbor Symp. Quant. Biol. 10, 40-48. Ephrussi, B., and Beadle, G. W. (1935). La transplantation des disques imaginaux chez la Drosophile. C.R. Seances Acad. Sci. (Paris) 201, 98-100. Farkas, W. R., and Jacobson, K. B. (1980). tRNA guanine transglycosylase and guanine accepting transfer RNAs of Drosophila melanogaster. Insect Biochem. 10, 183-188. Farnsworth, M. W. (1964). Growth and cytochrome c oxidase activity in larval stages of the Minute(2)Z’ mutant of Drosophila. J . Exp. Zool. 157, 345-352. Farnsworth, M. W. (1965a). Growth and cytochrome c oxidase activity in Minute mutants of Drosophila. J . Exp. 2001.160, 355-362. Farnsworth, M. W. (196513). Oxidative phosphorylation in the Minute mutants of Drosophila. J . Exp. Zool. 160, 363-368. Farnsworth, M. W. (1970). Uptake and incorporation of amino acids in Minute mutants of Drosophila. J . Exp. Zool. 175, 375-382. Finnegan, D. J., Rubin, G. M., Young, M. W., and Hogness, D. S. (1978). Repeated genes families in Drosophila metanogaster. Cold Spring Harbor Symp. Quant. Biol. 42, 1053-1063. Fyrberg, E. A., Kindle, K. L., and Davidson, N. (1980). The actin genes of Drosophila: A dispersed multigene family. Cell 19, 365-378. Gall, J. G., and Pardue, M. L. (1969). Formation and detection of RNA-DNA hybrid molecules in cytological preparations. Proc. Natl. Acad. Sci. U.S.A. 63, 378-383. Garcia-Bellido, A,, and Ripoll, P. (1978). The number of genes in Drosophila melanogaster. Nature (London) 273, 399-400. Gesteland, R. F., Wolfner, M., Grisafi, P., Fink, G., Botstein, D., and Roth, J. R. (1976). Yeast suppressors of UAA and UAG nonsense codons work efficiently in uitro via tRNA. Cell 7, 381-390. Gesteland, R. F., Wills, N., Lewis, J. B., and Grodzicker, T. (1977). Identification of amber and ochre mutants of the human virus Ad 2’ ND 1. Proc. Natl. Acad. Sci. U . S . A .74, 4567-4571.
166
ERIC KUBLI
Ghosh, D., and Forrest, H. S. (1967). Inhibition of tryptophan pyrrolase by some naturally occurring pteridines. Arch. Biochem. Biophys. 120, 578-582. Goldberger, R. F., Deeley, R. G., and Mullinix, K. P. (1976). Regulation of gene expression in prokaryotic organisms. Adu. Genet. 18, 1-67. Gorini, L., and Beckwith, J. R. (1966). Suppression. Annu. Reu. Microbiol. 20,401-422. Green, M. M. (1952). Mutant isoalleles a t the vermilion locus in Drosophila melanogaster. Proc. Natl. Acad. Sci. U.S.A. 38, 300-305. Green, M. M. (1954). Pseudo-allelism a t the vermilion locus in Drosophila melanogaster. Proc. Natl. Acad. Sci. U.S.A. 40,92-99. Grigliatti, T. A., White, B. N., Tener, G. M., Kaufman, T. C., Holden, J. J., and Suzuki, D. T. (1973). Studies on the transfer RNA genes of Drosophila. Cold Spring Harbor Symp. Quant. Biol. 23, 461-474. Grigliatti, T. A., White, B. N., Tener, G . M., Kaufman, T. C., and Suzuki, D. T. (1974). The localization of transfer RNA,LY“genes in Drosophila melanogaster. Proc. Natl. Acad. Sci. U.S.A. 71, 3527-3531. Grosjean, H., Takada, C., and Petre, J. (1973). Complex formation between tRNAs with complementary anticodons: Use of matrix bound tRNA. Biochem. Biophys. Res. Commun. 53, 882-893. Grosjean, H., de Henau, S., and Crothers, D. M. (1978). On the physical basis for ambiguity in genetic coding. Proc. Natl. Acad. Sci. U.S.A. 75, 610-614. Hadorn, E. (1958). Contribution to the physiological and biochemical genetics of pteridines and pigments in insects. Znt. Congr. Genet., loth, Montreal pp. 337-354. Hadorn, E. (1961). “Developmental Genetics and Lethal Factors.” Wiley, New York. Hadorn, E., and Ziegler, I. (1958). Untersuchungen zur Entwicklung, Geschlechtsspezifitat und phanogenetischer Anatomie der Augen-Pterine verschiedener Genotypen. 2.Vererbungsl. 89, 221-234. Hankins, W. D., and Farkas, W. R. (1970). Guanylation of transfer RNA by rabbit reticulocytes. Biochim. Biophys. Acta 213, 77-89. Harada, F., and Nishimura, S. (1972). Possible anticodon sequences of tRNA”’*,tRNAA”” and tRNAAspfrom Escherichia coli B. Universal presence of nucleoside Q in the first position of the anticodons of these transfer ribonucleic acids. Biochemistry 11, 301-308. Hartman, P. E., and Roth, J. R. (1973). Mechanisms of suppression. Adu. Genet. 17, 1-105. Hayashi, S., Gillam, I. C., Delaney, A. D., Dunn, R., Tener, G. M., Grigliatti, T. A,, and Suzuki, D. T. (1980). Hybridization of tRNAs of Drosophila melanogaster to polytene chromosomes. Chromosoma (Berlin) 76, 65-84. Hennig, W. (1973). Molecular hybridization of DNA and RNA in situ. Znt. Reu. Cytol. 36, 1-44. Hershey, N. D., and Davidson, N. (1980). Two Drosophila melanogaster tRNAGIY genes are contained in a direct duplication a t chromosomal locus 56 F. Nucleic Acids Res. 21, 4899-4910. Hosbach, H. A., and Kubli, E. (1979). Transfer RNA in aging Drosophila: 11. Isoacceptor patterns. Mech. Aging Deu. 10, 141-149. Hosbach, H. A., Silberklang, M., and McCarthy, B. J. (1980). Evolution of a Drosophila melanogaster tRNA gene cluster. Cell 21, 169-178. Hovemann, B., Sharp, S., Yamada, H., and SOU, D. (1980). Analysis of a Drosophila tRNA gene cluster. Cell 19, 889-895. Huang, S.L.,and Baker, B. S. (1976). The mutability of the Minute loci of Drosophila melanogaster with ethyl methanesulfonate. Mutat. Res. 34, 407-414.
GENETICS OF tRNA IN
Drosophila
167
Ilan, I., Ilan, I., and Patel, N. (1970). Mechanism of gene expression in Tenebrio molitor. Juvenile hormone determination of translational control through transfer ribonucleic acid and enzyme. J . Biol. Chem. 245, 1275-1281. Jacobson, K. B. (1971). Role of a n isoacceptor transfer ribonucleic acid as an enzyme inhibitor: effect on tryptophan pyrrolase of Drosophila. Nature (London) New Biol. 231, 17-18. Jacobson, K. B. (1978). Mechanism of suppression in Drosophila. VII. Correlation between disappearance of a n isoacceptor of tyrosine tRNA and activation of the vermilion locus. Nucleic Acids. Res. 6, 2391-2404. Jacobson, K. B., Calvino, J. F., Murphy, J . B., and Warner, C. K. (1975). Mechanism of suppression in Drosophila. 11. Enzymatic discrimination of wild-type and suppressor tyrosine transfer RNA. J . Mol. Biol. 93, 89-97. Jacq, C., Miller, J. R., and Brownlee, G. G. (1977). A pseudogene structure in the 55 DNA of Xenopus laeuis. Cell 12,109-120. John, H. A., Birnstiel, M. L., and Jones, K. W. (1969). RNA-DNA hybrids a t the cytological level. Nature (London) 223, 582-587. Kalisch, W. E., and Rasmuson, B. (1974). Changes of zeste phenotype induced by autosomal mutations in Drosophila melanogaster. Hereditas 78, 97-104. Katze, J. R. (1975). Alterations in SVT2 cell transfer RNAs in response to cell density and serum type. Biochim. Biophys. Acta 383, 131-139. Kiger, J . A. (1974). Participation by Drosophila transfer RNA in protein synthesis in an E . coli protein synthesizing system. Nucleic Acids Res. 1, 1269-1277. King, R. C. (1975). Drosophila melanogaster: An introduction. In “Handbook of Genetics” (R. C. King, ed.), Vol. 5, pp. 625-651. Plenum, New York. Korner, A., Feinstein, S., and Altman, S. (1978). tRNA mediated suppression. In “Transfer RNA” (S. Altman, ed.), pp. 105-135. MIT Press, Cambridge, Massachusetts. Kohli, J., Kwong, T. C., Altruda, F., So11, D., and Wahl, G. (1979). Characterization of a UGA suppressing serine tRNA from Schkosaccharomyces pornbe with the help of a new “in vitro” assay system for eukaryotic suppressor tRNAs. J . Biol. Chem. 254, 1546-1551. Kressmann, A,, Clarkson, S. G., Pirotta, V., and Birnstiel, M. L. (1978). Transcription of Xenopus tDNAIMe‘and sea urchin histone DNA injected into the Xenopus oocyte nucleus. Proc. Natl. Acad. Sci. U.S.A. 75, 1176-1180. Kressmann, A., Hofstetter, H., Di Capua, E., Grosschedl, R., and Birnstiel, M. L. (1979). A tRNA gene of Xenopus laeuis contains a t least two sites promoting transcription. Nucleic Acids Res. 7, 1749-1763. Kubli, E. (1978). Der Letalfaktor l(2)me von Drosophila melanogaster: Eine Deletion fur tRNA Gene? Reu. Suisse Zool. 85, 790-795. Kubli, E. (1980). Modification of transfer RNA in eukaryotes: An evolutionary interpretation. Trends Bioch. Sci. 5, 90-91. Kubli, E. (1981). The structure and function of tRNA genes of higher eukaryotes. Experientia 37, 1-9. Kubli, E., and Schmidt, T. (1978). The localization of tRNA,”” genes from Drosophila melanogaster by “in situ” hybridization. Nucleic Acids Res. 5 , 1465-1478. Kuhn, A. (1932). Entwicklungsphysiologische Wirkung einiger Gene bei Ephestia Kiihniella. Naturwissenschaften 20, 974-977. Laird, C. (1973). DNA of Drosophila chromosomes. Annu. Reu. Genet. 7, 177-204. La Rossa, R., and Soll, D. (1978). Other functions of tRNA. In “Transfer R N A 6. Altman, ed.), pp. 136-167. MIT Press, Cambridge, Massachusetts.
168
ERIC KUBLI
Lassam, N. J., Lorer, H., and White, B. N. (1976). A reexamination of the Leucine tRNAs and the Leucyl-tRNA synthetase in developing Tenebrio molitor. Deu. Biol. 49, 268-277. Lim, J. K., and Snyder, L. A. (1968). The mutagenic effects of two monofunctional alkylating chemicals on mature spermatozoa of Drosophila. Mutat. Res. 6, 129137. Lim, J . K., and Snyder, L. A. (1974). Cytogenetic and complementation analysis of recessive lethal mutations induced in the X chromosome of Drosophila by three alkylating agents. Genet. Res. 24, 1-10, Lindsley, D. L., and Grell, E. H. (1967). Genetic variations of Drosophila melanogaster. Carnegie Inst. Washington Publ. No. 637. Lindsley, D. L., and Zimm, G. G. (1978). A computerized list of mutant stocks of Drosophila melanogaster from six laboratories. Dros. InF Service 53, 1-116. Lindsley, D. L., Sandler, L., Baker, B. S., Carpenter, A. T. C., Denell, R. E., Hall, J. C., Jacobs, P. A., Miklos, G. L. G., Davis, B. K., Gethmann, R. C., Hardy, R. W., Hessler, A., Miller, S. M., Nazawa, H., Parry, D. M., and Gould-Somero, M. (1972). Segmental aneuploidy and the genetic gross structure of the Drosophila genome. Genetics 71, 157-184. Linzen, B. (1974). The tryptophan ommochrome pathway in insects. Adu. Insect Physiol. 10, 117-246. Lis, J. T., Prestidge, L., and Hogness, D. S. (1978). A novel arrangement of tandemly repeated genes a t a major heat shock site in Drosophila melanogaster. Cell 14, 901-920. McKinnon, R. D., Wosnick, M. A,, and White, B. N. (1978). The role of the guanine insertion enzyme in Q-biosynthesis in Drosophila melanogaster. Nucleic Acids Res. 5, 4865-4876. Marzluf, G. A. (1965). Enzymatic studies with the suppressor of vermilion of Drosophila melanogaster. Genetics 52, 503-512. Matouscheck, M., Dubendorfer, A., and Kubli, E. (1981). Studies on the incorporation of [32Pl-phosphate into low molecular weight RNA of various Drosophila melanogaster cell lines. J.N.Y. Entomol. SOC. 88, 241-251. Maxam, A. M., and Gilbert, W. (1977). A new method for sequencing DNA. Proc. Natl. Acad. Sci. U.S.A. 74, 560-564. Mertz, J. E., and Gurdon, J. B. (1977). Purified DNAs are transcribed after microinjection into Xenopus oocytes. Proc. Natl. Acad. Sci. U.S.A.74, 1502-1506. Mischke, D., Kloetzel, P., and Schwochau, M. (1975). Tryptophan pyrrolase activity regulation in Drosophila: Role of an isoacceptor tRNA unsettled. Nature (London) 255, 79-80. Mitchell, H. K., and Weber, U. M. (1965). Drosophila phenol oxidases. Science 148, 964-965. Montgomery, D. L., Hall, B. D., Gillam, S., and Smith, M. (1978). Identification and isolation of the yeast cytochrome c gene. Cell 14, 673-680. Morata, G., and Ripoll, P. (1975). Minutes: Mutants of Drosophila autonomously affecting cell division rate. Deu. Biol. 42, 211-221. Morgan, T. H. (1910). Sex limited inheritance in Drosophila. Science 32, 120-122. Needham, A. E. (1978). Insect biochromes: Their chemistry and role. In “Biochemistry of Insects” (M. Rockstein, ed.). Academic Press, New York. Nishimura, S. (1978). Modified nucleosides and isoaccepting tRNA. In “Transfer R N A (S. Altman, ed.), pp. 168-195. MIT Press, Cambridge, Massachusetts. O’Brien, S. J., and MacIntyre, R. J. (1978). Genetics and biochemistry of enzymes and specific proteins of Drosophila. In “The Genetics and Biology of Drosophila” (M.
GENETICS OF tRNA IN
Drosophila
169
Ashburner and T. R. F. Wright, eds.), Vol. 2a, pp. 395-551. Academic Press, New York. OMalley, B. W., Towle, H. C., and Schwartz, R. J. (1977). Regulation of gene expression in eucaryotes. Annu. Rev. Genet. 11, 239-275. Owenby, R. K., Stulberg, M. B., and Jacobson, K. B. (1979). Alteration of the Q family of transfer RNAs in adult Drosophila melanogaster as a function of age, nutrition and genotype. Mech. Ageing Deu. 11, 91-103. Pardue, M. L., and Gall, J. G. (1975). Nucleic acid hybridization to the DNA of cytological preparations. In “Methods in Cell Biology” (D. M. Prescott, ed.), Vol. 10, pp. 1-16. Academic Press, New York. Pardue, M. L., Kedes, L. H., Weinberg, E. S., and Birnstiel, M. L. (1977). Localization of sequences coding for histone messenger RNA in the chromosomes of Drosophila melanogaster. Chromosoma 63, 135-151. Parisi, G., Carfagna, M., and DAmora, D. (1976). A proposed biosynthesis pathway of drosopterins in Drosophila melanogaster. J . Insect Physiol. 22, 415-423. Piper, P. W. (1978). A correlation between a recessive lethal amber suppressor mutation in Saccharomyces cerevisiae and an anticodon change in a minor serine transfer RNA. J . Mol. Biol. 122, 217-235. Piper, P. W., Wasserstein, M., Engbeck, F., Kaltoft, K., Celis, J. E., Zeuthen, J., Liebman, S., and Sherman, F. (1976). Nonsense suppressors of Saccharomyces cereuisiae can be generated by mutation of the tyrosine tRNA anticodon. Nature (London) 262, 757-761. Pongs, 0. (1978). tRNA function in protein synthesis. In “Transfer RNA” (S. Altman, ed.), pp. 78-104. MIT Press, Cambridge, Massachusetts. Prensky, W. (1975). The radioiodination of RNA and DNA to high specific activities. I n “Methods in Cell Biology” (D. M. Prescott, ed.). Academic Press, New York. Rieger, R., Michaelis, A,, and Green, M. M. (1976). “Glossary of Genetics and Cytogenetics.” Springer-Verlag, Berlin and New York. Ritossa, F. M., Atwood, K. C., and Spiegelman, S. (1966). On the redundancy of DNA complementary to amino acid transfer RNA and its absence from the nucleolus organizer region of Drosophila melanogaster. Genetics 54, 663-676. Roeder, R. G., Engelke, D. R., Ng, S., Segall, J., Shastry, B., and Weil, P. A. (1979). Factors involved in the transcription of purified genes by RNA polymerase 111. In “Eucaryotic Gene Regulation” (R. Axel, T. Maniatis, and C. F. Fox, eds.), pp. 521-540. Academic Press, New York. Sanger, F., and Coulson, A. R. (1975). A rapid method for determining sequences in DNA by primed synthesis with DNA polymerase. J . Mol. Biol. 94, 441-448. Sanger, F., Nicklen, S., and Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. U.S.A. 74, 5463-5467. Schedl, P., Artavanis-Tsakonas, S., Steward, R., Gehring, W. J., Mirault, M.-E., GoldSchmidt-Clermont, M., Moran, L., and Tissiere, A. (1978). Two hybrid plasmids with Drosophila melanogaster DNA sequences complementary to mRNA coding for the major heat shock protein. Cell 14, 921-929. Schedl, T. B., and Donelson, J. E. (1978). A cloned Drosophila DNA fragment which codes for a 4 s RNA species. Biochim. Biophys. Acta 520, 539-554. Schimke, R. T., Sweeney, E. W., and Berlin, C. M. (1965). The roles of synthesis and degradation in the control of rat liver tryptophan pyrrolase. J . Biol. Chem. 240, 322-331. Schimmel, P. R., SOH, D., and Abelson, J. N., eds. (1979). “Transfer RNA: Structure, properties, and recognition.” Cold Spring Harbor Laboratory, Cold Spring Harbor, New York.
170
ERIC KUBLI
Schlegel, R., and Rechsteiner, M. C. (1975). Microinjection of thymidine kinase and bovine serum albumin into mammalian cells by fusion with red blood cells. Cell 5, 371-379. Schmid, W. (1949). Analyse der letalen Wirkung des Faktors lme (lethal-Meander) von Drosophila melanogaster. 2 Indukt. Abstamm. Vererbungsl. 83, 220-253. Schmidt, O., Mao, J., Silverman, S., Hovemann, B., and So11, D. (1978). Specific transcription of eukaryotic tRNA genes in Xenopus germinal vesicle extracts. Proc. Natt. Acad. Sci. U.S.A. 75, 4819-4823. Schmidt, T., and Kubli, E. (1980). The localization of t R N A p , tRNAHLS, and tRNAA'' genes from Drosophila melanogaster by in situ hybridization to polytene salivary gland chromosomes. Chromosoma 80, 277-287. Schmidt, T., Egg, A. H., and Kubli, E. (1978). The localization of tRNA,A"pgenes from Drosophila melanogaster by "in situ" hybridization. Mol. Gen. Genet. 164,249-254. Schreyer, M. H., Staehelin, T., Gesteland, R. F., and Spahr, P. F. (1973). Translation of bacteriophage R17 and Q p RNA in a mammalian cell free system. J . Mol. Biol. 75, 575-578. Schultz, J. (1929). The Minute reaction in the development of Drosophila melanogaster. Genetics 14, 366-419. Sharma, 0. K., and Borek, E. (1974). Hormonal control of tRNA methyltransferases and tRNA structure. Adv. Enzyme Regul. 12, 85-102. Sharp, S., DeFranco, D., Schmidt, T., Kubli, E., Silberklang, M., Hosbach, H., Gurgen, P., Wensink, P., and SOH, S. (1981). Gene structure and arrangement of the initiator tRNA genes of Drosophila melanogaster. Nucleic Acids Res., in press. Silverman, S., Gillam, I. C., Tener, G. M., and So11, D. (1979a).The nucleotide sequence of lysine tRNA, from Drosophila. Nucleic Acids Res. 6, 435-442. Silverman, S., Heckman, J., Cowling, G. J., Delaney, A. D., Dunn, R. J . , Gillam, I. C., Tener, G. M., Soll, D., and RayBhandary, U. L. (1979b). The nucleotide sequence of the initiator tRNA from Drosophila melanogaster. Nucleic Acids Res. 6,421-433. Silverman, S., Schmidt, O., Soll, D., and Hovemann, B. (1979~). The nucleotide sequence of a cloned Drosophila arginine tRNA gene and its in uitro transcription in Xenopus germinal vesicle extracts. J . Biol. Chem. 20, 10290-10294. Sinsheimer, R. L. (1977). Recombinant DNA. Annu. Rev. Biochem. 46, 415-438. Smith, G. P. (1973). Unequal crossover and the evolution of multigene families. Cold Spring Harbor Symp. Quant. Biol. 38, 507-513. So11, D. (1968). Studies on polynucleotides. LXXXV. Partial purification of a n amber suppressor tRNA and studies of in vitro suppression. J . Mol. Biol. 34, 175-187. SOH, D., Cherayil, J., Jones, D. S., Faulkner, R. D., Hampel, A., Bock, R. M., and Khorana, H. G. (1966). sRNA specificity for codon recognition as studied by the ribosomal binding technique. Cold Spring Harbor Symp. Quant. Biol. 31, 51-61. So11, D., Abelson, J. N., and Schimmel, P. R., eds. (1980). Transfer RNA: Biological aspects. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Southern, E. M. (1975). Detection of specific sequences among DNA fragments separated by gel electrophoresis. J . Mol. Biol. 98, 503-517. Spradling, A. C., and Mahowald, A. P. (1980).Amplification of genes for chorion proteins during oogenesis in Drosophila melanogaster. Proc. Natl. Acad. Sci. U.S.A. 77, 1096-1 100. Spradling, A., Pardue, M. L., and Penman, S. (1977). Messenger RNA in heat-shocked Drosophila cells. J . Mol. Biol. 109, 559-587. Sprinzl, M., Gruter, F., Spelzhaus, A., and Gauss, D. H. (1980). Compilation of tRNA sequences. Nucleic Acids Res. 8, rl-r22.
GENETICS OF tRNA IN
Drosophila
171
Steege, D. A., and Soll, D. (1979). Suppression. In “Biological Regulation” (R. F. Goldberger, ed.). Plenum, New York. Steffensen, D. M., and Wimber, D. E. (1971).Localization of tRNA genes in the salivary chromosomes of Drosophila by RNA: DNA hybridization. Genetics 69, 163-178. Steffensen, D. M., and Wimber, D. E. (1972). Hybridization of nucleic acids to chromosomes. In “Results and Problems in Cell Differentiation” (H. Ursprung, ed.), Vol. 3, pp. 47-63. Springer-Verlag, Berlin and New York. Strehler, B. L., Hirsch, G., Gusseck, D., Johnson, R., and Bick, M. (1971). The codonrestriction theory of aging and development. J . Theor. Biol. 33, 429-474. Sueoka, N., and Kano-Sueoka, T. (1970). Transfer RNA and cell differentiation. Progr. Nucleic Acid Res. 10, 23-55. Szabo, P., Elder, R., Steffensen, D. M., and Uhlenbeck, 0. E. (1977). Quantitative “in situ” hybridization of ribosomal RNA species to polytene chromosomes of Drosophila melanogaster. J . Mol. Biol. 115, 539-563. Taniguchi, T., and Weissman, C. (1978). Site-directed mutations in the initiator region of the bacteriophage Q p coat cistron and their effect on ribosome binding. J . Mol. B i d . 118, 533-565. Tartof, K. (1969). Interacting gene system: I. The regulation of tryptophan pyrrolase by the vermilion-suppressor of vermilion system in Drosophila. Genetics 62, 781-795. Tartof, K. (1975). Redundant genes. Annu. Rev. Genet. 9, 355-385. Tartof, K., and Perry, R. P. (1970). The 5s genes of Drosophila melanogaster. J . Mol. Biol. 51, 171-183. Tener, G. M., Hayashi, S., Dunn, R., Delaney, A., Gillam, I. C., Grigliatti, T. A,, Kaufman, T. C., and Suzuki, D. T. (1980). In “Transfer RNA” (J. Abelson, P. R. Schimmel, and D. So11, eds.). Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Tobin, S. L., Zulauf, E., Sanchez, F., Craig, E. A., and McCarthy, B. J. (1980). Multiple actin-related sequences in the Drosophila melanogaster genome. Cell 19, 121-131. Treat, L. G., Doane, W., and MacIntyre, R. (1980). Biochemical loci of the “fruit fly” (Drosophila melanogaster). In “Genetic Maps” (St. J . O’Brien, ed.). NIH, Bethesda, Maryland. Tschudi, C., and Pirotta, V. (1980). Sequence and heterogeneity in the 5 s RNA gene cluster of Drosophila melanogaster. Nucleic Acids Res. 8, 441-451. Twardzik, D. R., Grell, E. H., and Jacobson, K. B. (1971). Mechanism of suppression in Drosophila: A change in tyrosine transfer RNA. J . Mol. Biol. 57, 231-245. Vaslet, C. A., OConnell, P., Izquierdo, M., and Rosbash, M. (1980). Isolation and mapping of a cloned ribosomal protein gene of Drosophila melanogaster. Nature (London)285, 674-676. Warner, B. N., and Jacobson, K. B. (1976). Mechanism of suppression in Drosophila. IV. Specificity and properties of tyrosyl -tRNA synthetase. Can. J . Biochem. 54, 650-656. Waterston, R. H., and Brenner, S. (1978). A suppressor mutation in the nematode acting on specific alleles of many genes. Nature (London) 275, 715-719. Weber, L., and Berger, E. (1976). Base sequence complexity of the stable RNA species of Drosophila melanogaster. Biochemistry 15, 5511-5519. White, B. N. (1974). An analysis of tRNAs in five Minutes and two suppressors. Dros. Inf. Service 51, 58-59. White, B. N., and de Lucca, F. L. (1977). Preparation and analysis of RNA. In “Analytical Biochemistry of Insects” (R. B. Turner, ed.), pp. 85-130. Elsevier, Amsterdam.
172
ERIC KUBLI
White, B. N. Tener, G. M., Holden, J., and Suzuki, D. T. (1973a). Analysis of tRNAs during the development of Drosophila. Dev. Biol. 33, 185-195. White, B. N., Tener, G. M., Holder, J., and Suzuki, D. T. (1973b). Activity of a transfer RNA modifying enzyme during the development of Drosophila and its relationship to the su(s) locus. J . Mol. Biol. 74, 635-651. Wilson, T. G., and Jacobson, K. B. (1977). Mechanism of suppression in Drosophila. V. Localization of the purple mutant of Drosophila melanogaster in the pterine biosynthetic pathway. Biochem. Genet. 15, 321-332. Wimber, D. E., and Steffensen, D. M. (1970). Localization of 5 S RNA genes in Drosophila chromosomes by RNA-DNA hybridization. Science 170, 639-641. Wobus, U. (1975). Hybridisierung von Nukleinsauren ”in situ”. Biol. Zentralbl. 95, 1-23. Wosnick, M. A., and White, B. N. (1977). A doubtful relationship between tyrosine tRNA and suppression of the vermilion mutant in Drosophila. Nucleic Acids Res. 4, 3919-3930. Wosnick, M. A., and White, B. N. (1978). Purification and nucleoside composition of a Q*-containing aspartic acid tRNA from Drosophila melanogaster. Biochem. Biophys. Res. Commun. 81. 1131-1138. Yen, P., and Davidson, N. (1980). The gross anatomy of a tRNA gene cluster at region 42 A of the Drosophila melanogaster chromosome. Cell 22, 137-148. Yen, P. H., Sodja, A,, Cohen, M., Conrad, S. E., and Davidson, N. (1977). Sequence arrangement of tRNA genes on a fragment of Drosophila melanogaster DNA cloned in E . coli. Cell 11, 763-777. Yim, J . J., Grell, E. H., and Jacobson, K. B. (1977). Mechanism of suppression in Drosophila: Control of sepiapterin synthase at the purple locus. Science 198, 1168-1170. Young, M. W., and Judd, B. H. (1978). Nonessential sequences, genes, and the polytene chromosome bands of Drosophila melanogaster. Genetics 88, 723-742. Ziegler, I. (1961). Genetic aspects of ommochrome and pterin pigments. Adu. Genet. 10, 349-403. Ziegler, I., and Harmsen, R. (1969). The biology of pteridines in insects. Adv. Insect Physiol. 6, 139-203. Zimm, G . G., and Lindsley, D. L. (1976). Biochemical mutants of Drosophila melanogaster. In “Handbook of Biochemistry and Molecular Biology. Nucleic Acids” (G. D. Fasman, ed.), Vol. 2, pp. 848-855. CRC Press, Cleveland, Ohio. Ziist, H., Egg, A. H., Hosbach, H. A., and Kubli, E. (1972). Regulation von Darmenzymaktivitaten und Isozymmuster der Hexokinase bei der Letalmutante l(2)me von Drosophila melanogaster. Verh. Schweir. Naturforsch. Ges. 162, 172-182.
MUTAGENESIS IN SACCHAROMYES CEREVISIAE Christopher W. Lawrence Department of Radiation Biology and Biophysics, University of Rochester, School of Medicine and Dentistry, Rochester, New York
........................... B. Estimation of Mutation Frequencies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 111. Induced Mutagenesis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. Misrepair and Misreplication Mutagenesis . . . . . . . . . . . . . . . . . . . . . . . , B. Relationship between Induced Mutagenesis and DNA Repair . . . . . . . . C. Nonrandomness of Induced Mutagenesis and Mutagen Specificity . . IV. Spontaneous Mutagenesis ................................... A. Genetic Analysis . . . . . . . . . . . . . . . . . . . B. Mutation Rates during Meiosis . . . . . . . V. Mitochondria1 Mutagenesis . . . . . VI. Mechanisms of Induc .................................. A. Time of Mutation Induction B. Formation of Pure .................... C. Untargeted Mutag D. Inducibility of Mutagenic Processes . . E. Dose-Response Kinetics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . VII. Conclusions and Comparisons with Other Organisms . . . . . . . . . . . . . _.............. References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
173 174 174 178 186 186 190 204 211 211 216 217 220 220 223 224 227 227 228 240
I. Introduction Although the genetic material of most organisms is replicated and maintained with remarkable fidelity, it is a commonplace observation that mutations occur both spontaneously and in response to treatment 173 ADVANCESIN GENETICS, Vol. 21
Copyright 0 1982 by Academic Press, Inc. All rights of reproduction in any form reserved. ISBN 0-12-0176'21-1
174
CHRISTOPHER W. LAWRENCE
with mutagens. Whether this reflects the action of mechanisms that optimize the level of mutagenesis (Kimura, 1960, 1967; Boiteux et al., 1978) or represents the limit beyond which it is physiologically infeasible to reduce error (Leigh, 1970, 19731, a more thorough understanding of the molecular mechanisms responsible for mutagenesis is an essential and important part of the more general enterprise of research into the molecular biology of DNA, particularly of its replication and repair. The purpose of this article is to survey present knowledge concerning mutagenesis in a simple eukaryote, Saccharomyces cereuisiae, and to compare this with what is known about the same process in E . coli. Although much of the conceptual framework for mutation research has emerged from work with the prokaryotes and their viruses, the fact that the genetic organization of eukaryotes is substantially different and the belief that their replication is more accurate (Drake, 1974) provide motivation for work with these organisms. In the past, much of the progress in mutation research has depended on genetic analysis, and for this purpose bakers’ yeast is ideal. Biochemistry seems to have had less of an impact in this than in other areas of molecular biology, perhaps because biochemical techniques were previously not well suited for the study of rare events in a background of competing activities. Recombinant DNA techniques are likely to remedy this situation, and such methods are also highly developed in Saccharomyces. This article will discuss the experimental systems available for mutation research in bakers’ yeast, the result of investigations concerning induced and spontaneous mutagenesis in nuclear and mitochondrial genomes, and conclusions regarding the mechanisms of mutagenesis. Other reviews in this, or related, areas include Moustacchi et al. (1975, 19771, Haynes et a2. (19791, Lemontt (1980), and Prakash and Prakash (1980). Mutation research with other eukaryotes, or with prokaryotes, has been reviewed by Auerbach and Kilbey (19711, Witkin (19761, Lehman and Bridges (19771, and Hanawalt et al. (1979). II. Experimental Methods
A. MUTANTSTRAINS
As in comparable work with E . coli, investigations into mutagenic processes in yeast have relied heavily on genetic analysis and on the examination of the properties of particular mutant strains. In addition
MUTAGENESIS IN
S. cereuisiae
175
to the capacity of such strains for spontaneous or induced mutagenesis, measured by means of a forward or, more usually, reversion test system of the kind described in Section II,B, other properties are also commonly examined, such as sensitivity to various DNA damaging agents and the amount of spontaneous or induced recombination. Mutants that are deficient or abnormal with respect to induced or spontaneous mutation have been isolated directly, by screening clones of mutagen-treated cells specifically for these phenotypes (Lemontt and Mortimer, 1970; Lemontt, 1971a, 1973, 1977a; von Borstel et al., 1971,1973) and also indirectly by screening previously isolated strains that are sensitive t o DNA damaging agents (Zakharov et al., 1968, 1970; von Borstel et ul., 1968, 1971; Suslova and Zakharov, 1971; Lawrence et al., 1970, 1974; Lawrence and Christensen, 1976; Prakash, 1974, 1976) or are temperature sensitive for DNA synthesis (Prakash et al., 1979a). 1. Direct Screening Procedures
As pointed out by Lemontt (1971a))direct screening procedures have the advantage of providing a sample of mutationally deficient strains by a method free of any prior condition for other properties such as radiation sensitivity, so that the properties of the mutants constitute an unbiased test of such ideas as the “misrepair” hypothesis (see Section 111,A). Mutants deficient with respect to UV*-induced mutagenesis were first isolated by Lemontt (Lemontt and Mortimer, 1970; Lemontt, 1971a1, using reversion of the highly UV-revertible ochre allele arg4-17 to screen potentially mutant clones. Examination of 37,000 clones led to the isolation of 20 independent mutations located at one of three different loci, designated R E V l , REV2, and REV3 (for reversion deficient). Since this procedure screens potentially mutant clones for the induction of only a relatively small number of base-pair substitutions, and would not therefore be expected to necessarily detect reu mutants that were deficient in frameshift mutagenesis, for example, an additional mutant hunt was carried out using a screen based on UVinduced forward mutagenesis to canavanine resistance (Lemontt, 1973, 1977a). Mutation to canavanine resistance can result from a variety of alterations that are located at a large number of sites within the CAN1 locus (Whelan et al., 19791, which is thought to be the *Abbreviations used: UV, ultraviolet light; MMS, methyl methane sulfonate; EMS, ethyl methane sulfonate; DMS, dimethyl sulfate; DES, diethyl sulfate; NG, N-methylN’-nitro-N-nitrosoguanidine; NQO, 4-nitroquinoline-l-oxide; HN,, nitrogen mustard; NA, nitrous acid; NIL, l-nitrosoimidazolidone-2.
176
CHRISTOPHER W. LAWRENCE
structural gene for the arginine-specific permease (Grenson et al., 1966). The testing of 3120 potentially mutant clones yielded 31 UV mutation-resistant strains that contained mutations defining seven new genes, designated UMRl to UMR7 (for UV mutation resistant) as well as a single allele of each of the three REV genes. Although these results clearly demonstrate that the procedure based on forward mutagenesis to canavanine resistance is capable of detecting a broader range of mutants than the method based on arg4I 7 reversion, it is nevertheless far from evident that a complete range of such mutants could be isolated in this way. As discussed in Section II,B, it is likely that there are marked functional restraints to the recovery of mutations at the CAN1 locus. Moreover, even though the total range of base-pair changes capable of giving can1 mutations may be large, the majority may still result from a relatively small subset of these changes, precluding the detection of umr mutants deficient in the production of only the rarer events. This restriction may be a serious one because existing mutants often show quite marked specificities with respect to the kinds of mutational events blocked, and are also highly specific with respect to their unresponsiveness to different mutagens (see Section 111,B).It must be concluded that efforts to “saturate” the yeast genome with mutations of this kind will require the use of a variety of screening systems and a variety of mutagens. To this end, it would be useful t o identify a set of well-defined and contrasting alleles (missense, frameshift, etc.) that give the high induced reversion frequencies necessary for efficient screening. Preliminary results with a his4 frameshift allele suggest that this approach is effective (Lawrence et al., 1981). Direct screening methods have also been used to isolate mutants exhibiting either enhanced or diminished levels of spontaneous mutagenesis. Mutants with enhanced spontaneous mutation rates were isolated by von Borstel et al. (1971) by a multistep procedure, using the number of white papillae in an adenine red (ade2-1)strain as the first stage. Such white papillae are the result of a variety of mutations, including back mutation, nonsense suppression, and forward mutation at other ade loci. Subsequent stages depended on the frequencies of p-fluorophenylalanine-resistantmutations, and of lysl -I reversions in cells grown on lysine-limited medium. The spontaneous mutation rate to lysine independence in 44 mutants selected by this procedure was measured by means of fluctutation tests, yielding 36 strains with rates 2 or more fold higher than those in the parental strain, including seven strains where the rates were 10-fold higher. At least 8 genes, designated MUTl to MUT6, MUTS, and MUT10, are believed to be
MUTAGENESIS I N S . cerevisiae
177
responsible for these enhanced levels of spontaneous mutation (Hastings et al., 1976). The mut6 mutation has recently been shown to be an allele of the RAD51 gene (Morrison and Hastings, 1979). Apart from these strains, mutants have also been isolated by screening for diminished levels of spontaneous mutation (Quah et al., 1977, 1980). It was argued (P. Hastings, personal communication) that such a procedure might identify a set of genes different from those found in mutators, and that mutations in these genes would be more useful for a genetic analysis of spontaneous mutagenesis. A variety of mutations which reduce spontaneous mutation rates have been isolated, one of which is an allele of the REV3 gene (Quah et al., 1980).
2 . Isolation of Strains Sensitive to Radiations and Other DNA Damaging Agents In addition to those isolated by direct screening procedures, spontaneous mutators and strains deficient with respect to induced mutagenesis have also been found by screening radiation-sensitive strains, and strains sensitive to MMS, for these properties. Such strains are thought to be deficient in DNA repair, though direct evidence for this is lacking in all but a handful1 of cases. There is a particularly large collection of these mutants in Saccharomyces, and if the REV and some of the UMR mutations isolated by Lemontt (see above) are included, it would appear that at least 80 different loci are concerned with repair. For the most part, such strains were isolated by virtue of their sensitivity to UV or X-rays (Nakai and Matsumoto, 1967; Snow, 1967 and unpublished-see Game and Mortimer, 1974; Cox and Parry, 1968; Laskowski et al., 1968; Laskowski and Averbeck, 1968; Moustacchi, 1969; Resnick, 1969; Suslova and Zakharov, 1971; Zakharov et al., 1968, 1970; Brown and Kilbey, 1970; Mortimer, unpublished-see Game and Mortimer, 1974; Ananthaswamy et al., 1978; G. McKnight, unpublished) but strains have been isolated that are sensitive to MMS (Snow, unpublished-see Game and Mortimer, 1974; Boram and Roman, 1976; Prakash and Prakash, 1977), to HN, (A. Ruhland and M. Brendel, personal communication), and to psoralen plus near UV (Henriques and Moustacchi, 1980) some of which are sensitive to radiation. Conversely, some of the radiation-sensitive mutants are also sensitive to chemical mutagens (Zimmermann, 1968; Kilbey and Smith, 1969; Lawrence et al., 1974; Prakash, 1974, 1976). Sensitivity t o radiations, and in some cases other mutagens, is also found in strains selected for trimethoprim sensitivity (Game et al., 19751,recombination deficiency (Rodarte-Ramon and Mortimer, 19721, and temperature-sensitive cell cycle defects (Johnston and Nasmyth,
178
CHRISTOPHER W. LAWRENCE
1978; Prakash et al., 1979). A standard nomenclature for radiationsensitive mutations was agreed upon in 1970 at the IVth International Yeast Genetics Conference, and interlaboratory allelism tests carried out by Game and Cox (1971) for predominantly UV-sensitive mutations, and by Game and Mortimer (1974) for predominantly X-raysensitive mutations.
B. ESTIMATION OF MUTATIONFREQUENCIES Test procedures designed to estimate the capacity of different strains for induced or spontaneous mutation have usually been based on the reversion of one or more of a variety of auxotrophic mutations, though occasionally forward mutation methods have also been used. Different test methods vary in the range of base-pair changes detected, sensitivity, convenience, susceptibility to artifact, and in ability to provide information about the underlying nucleotide changes monitored. 1 . Forward Mutation Test Procedures Forward mutation procedures are often thought to detect a wider range of DNA alterations than tests based on reversion, but this is not necessarily so, particularly with the more convenient and sensitive selective methods. At least one of these selective methods, that described by Chattoo et al. (1979a1, appears, however, to combine convenience with an absence of any obvious functional limitations. Nonselective methods usually do monitor a wide range of nucleotide changes, but are probably too laborious for routine quantitative use. Selective tests usually depend on forward mutation to drug resistance, and in many cases are due to mutation within genes whose functions are essential. If so, it is likely that only a small range of missense mutations can be recovered, the remainder being lethal. Resistance to cyclohexamide, cryptopleurine, or trichodermin is, at least in some cases, due to mutation within the structural genes for components of the cytoplasmic ribosomes (Cooper et al., 1967; Skogerson et al., 1973; Schindler et al., 1974). Similarly, another common class of resistance mutations are those that reduce uptake of the drug and in many cases, such as resistance to the arginine analog canavanine, for example, this is the result of an alteration in a membrane component whose loss may also be lethal. Most canavanine-resistant mutations map at the CAN1 locus, which is believed to be the structural gene for the arginine-specific permease (Grenson et al., 1966; Whelan et al., 1979). Only 13 out of 233 canR mutations tested were found to be ochre alleles, and it is possible that frameshift mutations
MUTAGENESIS IN
S. cerevisiae
179
and gross deletions were not recovered at all (Whelan et al., 1979). Despite this limitation, it is nevertheless clear that mutations, predominantly of the missense variety, can arise at many sites within this unusually large gene, giving high spontaneous mutation rates and high induced frequencies. Additional advantages are the convenience of the selection procedure and the ability to select revertants as well as forward mutations. The selection of lys2 mutations by virtue of their ability, unlike any other strain, to utilize a-aminoadipate as a principal nitrogen source (Chattoo et al., 1979a) also appears to be a most promising selective procedure for the quantitative study of forward mutations. A wide variety of different mutations can be recovered in this way, the selection method is simple, and reverse mutations can also be selected, so that this procedure combines what appears to be a virtual absence of functional limitation with convenience. Its chief disadvantage is the high cost of a-aminoadipate. Other selective methods that might be used, such as resistance to ethionine (Cherest and RobichonSzulmajster, 1966; Cherest et al., 19731, the 5-fluoropyrimidines (Jund and Lacroute, 1970), purine analogs (Pickering and Woods, 19731, nystatin (Ahmed and Woods, 19671, p-fluorophenylalanine (von Borstel et al., 19731, copper, cadmium, or lithium (Brennes-Pomales et al., 1955; Middlekauf et aZ., 1956; Laskowski, 19561, or methylmercury (which gives met15 mutants almost exclusively, Singh and Sherman, 1975) are unsuitable for quantitative work either because they have not been studied sufficiently from this point of view, or are likely to have functional limitations to the recovery of some types of mutations, or are technically unsuitable and inconvenient. With the possible exception of the various methods that exploit the red color of adel or ade2 mutants, nonselective forward mutation tests are generally too laborious to be suitable for routine quantitative studies. The frequency of adenine red mutants in a wild-type strain even after high doses of mutagen, and the rarely exceeds 5 x spontaneous frequency appears to be much less than 1 x (Hannan et d.,1976; Lemontt, 1972). Somewhat higher mutation frequencies can be obtained by scoring the production of white colonies and sectors in adenine red mutants, as proposed by Roman (1956). These white mutants either entail mutation in one of the genes controlling the six steps prior to those controlled by ADEl and ADE2, or reversions a t the adel or ade2 loci themselves. When adel or ade2 nonsense mutations are used, white variants can also arise by translational suppression, and in these cases intercomparisons of mutation frequencies should be made only between strains that are uniformly
180
CHRISTOPHER W. LAWRENCE
I)+(or I)-),since this nonmendelian factor changes the spectrum of suppressors that can be detected (Cox, 1971; Liebman et al., 1975; Cox et al., 1980). Many nuclear mutations can also modify the extent of translational suppression, and petite mutations, which may occur at high frequencies particularly after treatment with some mutagens, reduce the accumulation of red pigment in adel and ade2 strains. James and Kilbey (1977) have devised an interesting forward mutation procedure that detects an unusually broad range of mutants, based on a pedigree analysis of individual cells from diploids that have been highly inbred and selected for uniform growth rate. Mutants of six classes were detected, including recessive lethals, semilethals, morphological mutants, growth rate mutants, temperature-sensitive mutants, and auxotrophs. The considerable amount of labor entailed in the micromanipulation and testing was offset by the very high induced mutation frequencies observed (53%), even though the UV treatment killed very few cells (90% survival), and the capacity of this method to distinguish sectored from unsectored mutant colonies has been important in determining the time, relative to DNA synthesis, at which mutations arise in excision proficient and deficient cells (James and Kilbey, 1977; James et al., 1978; see also Section V1,A). All forward mutation methods, however favorable in other respects, nevertheless suffer from two disadvantages; they usually provide no information about the kinds of nucleotide changes that they detect, and they are insensitive to any but the most common mutational events. It is unlikely that they will detect variation in the frequency of the less common base-pair alterations against a constant high background of the more common events.
2 . Reversion Tests Tests based on highly revertible auxotrophic alleles offer sensitivity, convenience, and reasonable reliability, though they usually monitor only a small number of unknown base-pair changes. This disadvantage can be partly ameliorated by studying the reversion of several alleles that seem to be of contrasting types. A further problem is that induced reversion frequencies often depend strongly on the kind of mutagen used, so that a single test procedure is rarely suitable for comparing the effects of different mutagens within any given set of strains. The ochre alleles arg4-17, his5-2, and lysl-1 are all highly revertible by UV, giving reversion frequencies greater than 1 in lo4 survivors at relatively high (>lo%) survival levels. Most (>go%) of the UV-induced revertants are due to intragenic events (Resnick, 1969;
MUTAGENESIS IN
S. cereuisiae
181
Lemontt, 1971a, 1977a1, though nonsense suppression is a common spontaneous event. The his5-2, and to a lesser extent lysl-1, mutation is also highly revertible (>1in lo5 survivors) by nitrogen mustard, nitrogen half mustard, chlorambucil, triaziquone, and cyclophosphamide (Ruhland and Brendel, 19791, the revertants also being almost entirely of the locus type that is, due to intragenic events. Among those tested, the arg4-17 allele gave the highest frequency of revertants induced by ionizing radiation (McKee and Lawrence, 1979b), though such frequencies are both much lower and more uniform among different types of alleles (Prakash and Sherman, 1973; McKee and Lawrence, 1979b). Although not strictly auxotrophic mutations, the initiation mutation cycl-131 and the proline missense mutation cycl-115 are both very highly revertible (up to > 1 in lo4 survivors) by doses of chemical mutagens that kill less than 50% of the cells, particularly those mutagens that are thought to act specifically on G C base-pairs (Prakash and Sherman, 1973).Because of the technical problems in using cycl alleles (see Section II,B), it would be useful to identify genuine auxotrophic alleles with these properties. Spontaneous mutation studies have made use of the reversion of the ochre alleles lysl -1 and arg4-17, the putative missense mutation h i d - 7 , and h o d - 1 0 (e.g., von Borstel et al., 1973). The majority (80-90%) of the spontaneous revertants of lysl -1 and arg4-17 contain ochre suppressors, in JI- strains presumably mutations of one of the eight tyrosyl tRNA genes. The his1 -7 allele appears to be a missense mutation and is capable of second site reversion at a large number of intragenic sites (Korch and Snow, 1973; Fogel et al., 1978).Although h o d - 1 0 has been described as a frameshift allele (Magni, 1963a), the evidence used to support this conclusion is inadequate (see Section IV,B). The techniques for measuring spontaneous mutation rates in yeast are discussed by von Borstel (1978). The usefulness of these reversion tests could be increased by making more use of mutations defined by codon-specific suppressors. Although ochre alleles have been widely used, more use could be made of mutations suppressible by amber suppressors (Liebman et al., 19761, opal suppressors (Hawthorne and Leupold, 1974; Chattoo et al., 1979b), and frameshift suppressors (Culbertson et al., 1977) which detect G-C base-pair additions to runs of G.C base-pairs. Only alleles responding positively to such suppression tests are of value, since negative results have little diagnostic power. Similarly, although the properties of osmoremediality, temperature sensitivity, and allelic complementation usually indicate a missense mutation, in any one case they are diagnostically ambiguous.
182
CHRISTOPHER
W.
LAWRENCE
3. Test Methods Diagnostic for Specific DNA Changes A number of problems in mutation research can be resolved only by identifying the nucleotide changes responsible for the mutations studied, and in the absence of direct DNA sequence data, much ingenuity has been used in attempts to solve this problem indirectly, but with varying success. In Saccharomyces, reliable information can be obtained from the iso-1-cytochrome c gene-protein system developed by F. Sherman, J. Stewart, and colleagues (Sherman et al., 1974; Sherman and Stewart, 1978), and this gene has the added advantage that its entire nucleotide sequence is known (Smith et al., 1979). Recently, the sequence of the HZS4’ gene, together with a number of his4 mutations, has also been determined (Donahue et al., 1980; G . R. Fink, personal communication) and direct determination of mutant nucleotide sequence will, no doubt, be widely used in the future. Quantitative estimation of specific base-pair changes by the interconversion of nonsense codons, as used in the rII gene of bacteriophage T, (Koch, 1971; Salts and Ronen, 1971) is technically not as easy with yeast, and diagnostic tests based on the so-called “specific mutagens” are not always reliable (see Section 111,C). The analysis of protein from CYCl revertants is often capable of determining the base-pair change unambiguously, and may also reveal functional restraints to reversion, but the analysis is time consuming, expensive, and therefore restricted to fairly small samples. As a consequence, a tester system based on the reversion of a set of well-defined mutant alleles has been devised (Prakash and Sherman, 1973). Although each of the test alleles can revert in several ways, and therefore does not in itself provide a test for a unique base-pair alteration, such information could be obtained from the relative rates of reversion of different alleles, the various initiation mutations being particularly informative in this respect. Test alleles of this kind have been used to examine chemical mutagenesis (Prakash and Sherman, 19731, the influence of rev mutations on UV and gamma ray mutagenesis (Lawrence and Christensen, 1978a,b, 1979a; McKee and Lawrence, 1979b) and to examine the reasons for ffhotspots”in UV mutagenesis (Lawrence and Christensen, 1979~).The usefulness of the system is limited by the fact that a given base-pair change occurs at very different frequencies at different sites within the gene, so that the significance of a result is difficult to assess even where a large set of mutant alleles is used. Reliable use of the CYCl system also requires more than usual attention to technical detail (see next section). His4 mutants, particularly frameshift mutants, have also been used to examine chemical mutagenesis (Lucchini et al., 1980).
MUTAGENESIS IN
S . cereuisiae
183
4 . Experimental Precautions
As pointed out in particular by Auerbach (1962, 19761, the estimation of mutation frequencies depends on assumptions that are usually untested and on procedures that are very susceptible to error and artifact. Such problems are likely to be more severe when working with mutant strains, particularly highly abnormal and subvital ones like rud6 mutants. A reliable technique must ensure that all mutations are expressed and detected, and provide a n accurate estimate of the number of surviving mutant and nonmutant cells, a particularly important requirement in selective tests where the mutagen treatment kills some of the cells. Although the need for residual growth to allow mutations to be expressed has long been recognized in work with bacteria, Kilbey et al. (1978) have drawn attention to the fact that a similar awareness is not always found in work with yeast, perhaps because many strains are slightly leaky and continue to grow for a short while on selective media. Kilbey and his colleagues were nevertheless able to show that the frequency of arg4-17 and lysl-1 revertants induced by UV in excision deficient strains was higher in cells grown on minimal medium containing traces of the required nutrilite than on unsupplemented medium. A need for residual growth to express mutations induced by chemical mutagens has also been demonstrated by Zimmermann et al. (1966). Similarly, Gocke and Manney 11979) have emphasized the importance of growth conditions on the expression and detection of mutants resistant to canavanine in excision proficient strains. Plating a high density of cells on selective media inhibits the detection of mutants, perhaps partly because it prevents expression, but also because even preformed mutations may fail to produce colonies. Since different strains vary in this respect, and a limit of no more than lo7 cells/plate may sometimes be necessary, different dilutions should be used and examined for the proportionate recovery of mutants. Conversely, plating very low numbers of cells may encourage too much residual growth, giving rise to a significant number of spontaneous “plate” mutations, which can seriously inflate estimates of induced mutation frequencies. High cell densities have also been found to enhance recovery from lethal damage in mutagen-treated cells, resulting in a n underestimate of the number of viable cells tested for reversion and a n overestimate of induced reversion frequency. In addition, revertants and nonrevertants may possess inherently different sensitivities with respect to mutagen-induced lethality. A good illustration of how misleading this can be is given in Table 1, which shows data concerning the UV-
TABLE 1 Frequency of lysl-1 Revertants, and Surviving Fraction, in rad6-1 and RAD6' Haploid Strains Exposed to Germicidal UV
Strain
md6-1
UV (J m-') 0 5 10
RADG'
0 5
10
A Average number revsilo' cells plated"
B Percentage survivalb
152 125 77
100 24
24 42 79
D Percentage survivald
C revs/lo7 survivors'
(1) lysl (2) LYS+
F Type of revertant' E revsilo' survivors' (corrected)
(%o)
suppressed
(1)
(2) 368 850
100
7.7
152 520 1003
100 93 66
152 134 117
0 0 0
100 100 100
100 104 100
24 40 79
16 55
-
-
-
6 20 54
94 80 46
17 3.1
-
-
-
-
Locus
Average of 3 replicate experiments. Obtained by plating dilutions of the same cell populations used to estimate (A). (1) N B ; (2) "corrected for spontaneous mutation. Average survival of 5 parental lysl-1 clones (D1) and five LYSI + revertant clones (D2). MD2. 'Locus = reverted for lysl-1 alone, suppressed = coreverted for the ochre alleles a d d - I , arg4-17, and trp5-48. Fifty randomly chosen revertants were classified at each fluence in each strain.
MUTAGENESIS IN S.
cereuisiue
185
induced reversion of the ochre allele lysl-1 in a rud6-1 mutant and a RAD6' haploid control. When calculated in the conventional way (0,the results appear to show not only that lysl-1 revertants are induced in the rud6-1 mutant but also that the induced frequency is higher than in the RAD6' haploid, a surprising conclusion in view of the numerous experiments which show that UV mutagenesis is much reduced by the rud6-1 mutation (see Section 111,A). Closer inspection of the data shows, however, that the number of revertants per lo7 cells plated, uncorrected for viability, does not increase in the irradiated rud6-1 cultures, though it does in the irradiated RAD6' cell populations. Moreover, a comparison between the survival curves of five LYSl' revertants and five lysl parental clones showed that the revertants were substantially more resistant (D). When appropriate estimates of surviving fraction (D2)are used, there is no evidence for UV-induced reversion in the rud6-l strain (E), and a classification of the revertants (F) supports the conclusion that the "induced" events are in fact of spontaneous origin. As mentioned in Section II,B, the great majority of spontaneous revertants of ochre alleles like Zysl -1 contain nonsense suppressors, while nearly all UVinduced revertants are of the locus variety. As expected, locus revertants account for most of the induced events in the RAD6' strain, but are not found at all in the irradiated rud6-1 cultures. Although the rad6-1 allele is an amber mutation (Lawrence et al., 1974) that is very efficiently suppressed by the tyrosine inserting amber suppressor SUP7-2 (Lawrence, unpublished data), the above results show that it can also be weakly suppressed by ochre suppressors. These results emphasize the importance of establishing whether the mutations monitored modify the expression of the properties of the strain, and also the necessity of estimating induced mutation rates only in experiments, or with experimental procedures, that give low frequencies of spontaneous events. Although all mutation test procedures are liable to artifact, the cycl tester system is more than usually susceptible in this respect; the additional information that this method can provide must be paid for with extra work. Strains carrying cycl mutations are incapable of utilizing lactate as a carbon source, but mutations at many other loci also have this phenotype and such mutations are commonly part of the background genotype of laboratory strains (Sherman et ul., 1974). It is therefore necessary to score the segregation of cycl mutations by spectroscopic examination of intact cells at - 190°C (Sherman and Slonimski, 1964). Similarly, poor growth on lactate medium due to mutations in the background genotype can interfere with the detection of CYCl revertants, a significant problem when screening
186
CHRISTOPHER W. LAWRENCE
rad, rev or analogous mutants for mutability. Selection for CYCl revertants by plating on lactate medium also selects other mutations (metabolic suppressors) that allow cycf mutants to grow on lactate. Colonies containing such mutations can usually be distinguished by their later appearance and slower growth on the lactate plates (Sherman et al., 19741, but discrimination can be difficult in many haploids. It is therefore desirable to carry out reversion experiments with diploid strains, in which the largely recessive metabolic suppressors are not expressed (Prakash and Sherman, 1973). In aberrant or unusual strains, it is nevertheless important to examine a sample of the revertants spectroscopically, to ensure that the classification of intragenic events is accurate. The residual growth necessary for the expression of CYCl revertants can be stimulated by addition of 0.03% yeast extract, or ergosterol (10 mg/liter) and Tween 80 (0.1% v/v) to the lactate medium (F. Sherman, personal communication). 111. Induced Mutagenesis
A. MISREPAIRAND MISREPLICATION MUTAGENESIS Work with E . coli has led to the hypothesis (discussed for example, by Radman et al., 1979) that mutagens are of two types and act in one of two contrasting ways; those which produce subtle changes in DNA, promoting base-pairing errors but not impeding replication, induce relatively specific types of mutations by a Rec A-independent process of misreplication, while those which produce gross DNA lesions incapable of base-pairing and which substantially delay replication induce a relatively nonspecific array of base-pair changes by a Rec A-dependent process of misrepair. The molecular mechanism of misrepair is still obscure, though models for it have been proposed (Witkin, 1976; Boiteaux et. al., 1978; Radman et al., 1979). Much evidence, reviewed in this section, has been amassed which indicates that Saccharomyces also possesses a misrepair type of mutagenic mechanism. Although a misreplication mechanism is also likely to exist in yeast, evidence supporting this proposal is more sparse and less clear, particularly since certain highly specific mutagens, producing specific base-pair changes, appear to act by, or during, misrepair. As discussed in Section VII, this may imply not only that the yeast replication complex excercises greater discrimination against template defects than the E . coli enzyme, but also that the differences between the misreplication and misrepair modes of mutagenesis are not as great as formerly believed.
MUTAGENESIS IN
S. cerevisiae
187
1. Misrepair Mutagenesis Following the rationale introduced and developed for E . coli by Witkin (1967, 1969, 19761, the discovery that UV mutagenesis was much reduced or absent in UV and X-ray-sensitive yeast strains that carry mutations in one of the REV loci (Lemontt and Mortimer, 1970; Lemontt, 1971a) or the RADG gene (Lawrence et al., 1970, 1974) led to the proposal that wild type Saccharomyces also possessed a similar capacity for error-prone, or mutagenic, repair. A wide variety of contrasting mutagens appear to act by means of this misrepair process. Apart from UV and ionizing radiation, the effectiveness of many chemical mutagens also seems to depend on RADG' function (Prakash, 1974; Kern and Zimmermann, 1978), at least when stationary-phase cells are treated. The mutagens tested include methyl methane sulfonate (MMS), ethyl methane sulfonate (EMS), dimethyl sulfate (DMS), diethyl sulfate (DES), nitrosoguanidine (NG), nitroquinoline oxide (NQO), nitrogen mustard (HN2),p-propiolactone, nitrous acid (NA), nitrosoimidazolidone (NIL), and tritiated uridine. Moreover, B. S. Barclay and J. G. Little (personal communication) have made the interesting observation that mutagenesis resulting from the incubation of strains permeable to thymidine monophosphate (TMP) in medium containing high concentrations of TMP is also RADG' dependent. These authors suggest that intracellular levels of this molecule may act as a signal for error-prone repair, but since high levels of TMP can be lethal other mechanisms are possible. Viewed as a whole, these observations would appear to suggest that a broad range of mutagens, and perhaps the majority of them, owe their effectiveness in yeast to a misrepair mechanism. Apart from acting on many kinds of lesions, this misrepair process is capable of giving rise to a great variety of base-repair changes. Although this is not so with other genes whose functions are involved in mutagenesis (see Section III,B), the RADG' gene function appears to be necessary for the production of all kinds of mutations, at least as far as UV and gamma rays are concerned. For UV, the test systems used include the reversion of the ochre alleles cycl-9, Zys2-1, and arg4-17, the reversion of the putative missense allele hisl-7, and forward mutation to canavanine resistance (Lawrence et al., 1974), the reversion of the ochre allele trp5-u6 (E. G. Hunnable, cited in Cox and Game, 1974),the reversion of the metabolically suppressible i l v l 92 allele (Kern and Zimmermann, 19781, and the reversion of the initiation allele cycl-131, the proline missense allele cycl -1 15, and the frameshift allele cycl-183 (Lawrence and Christensen, unpublished data). Data that appear to show normal or enhanced frequencies
188
CHRISTOPHER W. LAWRENCE
of his1 -1 revertants induced by UV in a rad6-1 strain (except at a high fluence) probably reflect one or another of the numerous technical problems that make working with this extremely sensitive and subvital mutant so difficult (Moustacchi, 1971). Although each of these authors used the rad6-1 mutation, the UV-induced reversion of cycl9 and arg4-17 appears also to be much reduced in strains carrying the rad6-3 allele (unpublished data); further confirmation using this and other alleles is, however, desirable. Gamma ray mutagenesis in rad6-1 strains was examined using the reversion of cycl-9, cycl-131, cycl-115, cycl-183, and arg4-17 (Lawrence et al., 1974; McKee and Lawrence 1979a,b). Chemical mutagenesis has been examined quantitatively in a single strain, using the reversion of cycl-131 (Prakash, 1974, 1976); in view of the technical problems associated with rad6 mutants and the cycl tester system, it would be useful to confirm these results using both the rad6-3 and rad6-1 alleles, several strains, and a wider range of test procedures. It is nevertheless likely, subject to such confirmation, that the RAD6' gene function is required for the production of all kinds of mutational events, at least in stationary phase cells, including all base-pair transitions, transversions, additions, and deletions, induced by a wide variety of powerful and moderately powerful mutagens. This misrepair process has the added unusual feature that it is capable, at least with some mutagens, of giving rise to highly specific types of mutations (Section 111,C).
2 . Misreplication Mutagenesis The positive identification of mutagens that act by misreplication in yeast has been hampered by the paucity of studies examining their effectiveness in rad6 mutants, an essential criterion since the selective induction of specific types of mutations is not necessarily an exclusive property of these agents. A t the same time, normal yeast strains are relatively impermeable to base analogs and may selectively exclude them from their DNA, so that data from this category of mutagens are also sparse. Extensive incorporation of bromodeoxyuridylate or iododeoxyuridylate can be achieved only in mutant strains (tup) permeable to thymidylate, and the 5' monophosphate must be used since yeast cells lack a suitable kinase. Under these conditions, such analogs are mutagenic (0. Landman and J. G. Little, personal communication) but their independence or otherwise of RADG function remains to be established. The adenine analog 2-aminopurine has been described as a misreplication mutagen in yeast (Sora et al., 1973) because it induces the conversion of an ochre into an amber codon at the can1 -100 site with high specificity, the reverse conversion occur-
MUTAGENESIS IN
S. cereuisiae
189
ring at a frequency that was barely above the spontaneous level. The maximum induced mutation frequency was less than 2.5-fold higher than the spontaneous frequency, after an optimum treatment consisting of the growth of an adenine auxotroph, previously starved for this nutrilite, for 24 hours in the presence of the analog. The extent to which this analog is incorporated into DNA is not yet known. As the authors themselves point out, the testing of a single site makes the generality of the results an open question. By contrast, the base analog 6-N-hydroxyaminopurine appears to be highly mutagenic (Shanki, 1975; Cassier et al., 19811, though independence of RAD6 function has yet to be examined. Hydrazine has been proposed as a possible misreplication mutagen in yeast because a period of growth, consistent with a need for DNA synthesis, is necessary before induced mutations can be detected (Lemontt, 1977b, 1978). The action of other mutagens, such as EMS, MMS, NG, NA, UV, and hydroxylamine, do not require such a posttreatment growth period. Hydrazine mutability can be blocked by holding treated cells for 1 day in the presence of the DNA synthesis inhibitor hydroxyurea or the protein synthesis inhibitor cycloheximide, implying that the premutational damage induced by hydrazine either decays or is repaired in an error-free manner during this period. This decay occurs equally in excision proficient strains and in excision deficient strains carrying rud2-1. After optimal treatments, which are entirely nonlethal, the induced mutation frequency to canavanine resistance was increased up to about 10-fold above the spontaneous frequency; higher doses both kill and induce fewer mutations. Although each of these mutagens appears to be unusual in one or another respect, further evidence is required before it can be concluded that they induce base mispairing rather than error-prone repair. If only one or a few sites are examined, selective production of particular base-pair changes is found with the RAD6' dependent mutagen EMS (Prakash and Sherman, 1973) and even with UV (Sherman and Stewart, 1974). Further, most UV-induced mutations are produced postreplicatively in excision-defective strains (James et ul., 1978); it is therefore possible that error-prone repair of hydrazine damage can also take place only after DNA synthesis. Perhaps the clearest case of a misreplication mutagen in yeast is that for the acridine half mustard, ICR-170. This mutagen induces frameshift mutations with fairly high specificity (Culbertson et al., 1977) Donahue et al., 19801, and is effective in a rud6-1 strain; the reversion of the frameshift allele his4519 induced by ICR-170 is about half as frequent in a rad6-1 strain as in a wild type (J. Walsh and G. R. Fink, personal communication).
190
CHRISTOPHER
W.
LAWRENCE
The effect of growth phase on chemical mutagenesis in rad6 mutants is also a n important issue that requires examination. For technical reasons, all work on rad6 mutants has made use of stationary phase cultures; cell aggregates are a t a minimum in such cultures and most of the cells are in G,. Experiments with logarithmic phase wild-type cells show, however, that NG treatments are about 10-fold more mutagenic when delivered during a particular short period during Sphase, consistent with the idea of replication-fork mutagenesis (see Section V1,A). It is not yet known whether this S-phase mutagenesis is RAD6-dependent, leaving open the question of whether it represents misreplication or misrepair. Whichever is the case, the lesions responsible for it must be quickly modified or repaired a t other stages in the S- or late GI-phase because treatments delivered only a few minutes before the critical period are no more effective than those given in G, or early G,. Apart from these uncertainties, it seems likely that fewer mutagens induce misreplication of the “classical” kind in yeast, that is during normal DNA synthesis, than in bacteria. “Misreplication” mutagenesis may, however, occur more commonly in cells undergoing repair (see Section III,C), an observation that questions whether misreplication and misrepair processes are as distinctly different as usually assumed (see Section VII). BETWEEN INDUCED MUTAGENESIS AND DNA REPAIR B. RELATIONSHIP
1. Types of Repair in Saccharomyces Induced mutagenesis is associated with only one of the three main types of dark repair discovered so far in yeast, the other two appearing to be substantially error-free. The existence of these three types of repair has been inferred chiefly from the results of double mutant analysis, that is from the relative sensitivities of sets of double and single mutant strains (Khan et al., 1970; Game and Cox, 1972, 1973; Brendel and Haynes, 1973; Cox and Game, 1974; Lawrence et al., 1974; Lawrence and Christensen, 1976; Prakash, 1977a; Prakash et al., 1979a; McKee and Lawrence, 1980). Cox and Game (1974) have coined the useful term “epistasis group” to describe genes which belong to the same functional category according to this test. In most cases, radiations have been used for this work, though chemical mutagens have also been used occasionally; there is no reason to believe that the composition of an epistasis group must be identical with respect to all DNA damaging agents. Less than a quarter of the 80 or so genes isolated so far have been examined by double mutant analysis
MUTAGENESIS IN
S. cereuisiae
191
with any agent, but as pointed out by Haynes and his colleagues (Brendel et al., 1970; Haynes et al., 1979), the phenotype of single mutants with respect to UV, X-ray, and chemical mutagen sensitivity often provides a rough guide to their epistasis group. Useful insights into the molecular mechanisms underlying the three types of repair have been obtained using physiological tests, such as photoreactivation and liquid holding, and assays for DNA repair, but the types of assays carried out and the number of strains tested is still rather small. a. Excision Repair. The phenotypes of excision-deficient mutants (Table 2) indicate that excision repair in Saccharomyces, as in E . coli, is essentially error-free. The products of at least nine, and probably twelve or more, genes are concerned with excision repair in yeast, a number that is much greater than in the bacterium, perhaps because the process is necessarily more complex in chromatin (Mortelmans et al., 1976). Mutations in nine of these genes prevent the excision of all, or at least a fraction, of pyrimidine dimers and block a n early stage in this process, before or a t about the incision stage (see Table 2 for references). Although incapable of excising dimers from untreated DNA, extracts from radl-19, rad2-4, rad.3-1, and rad4-3 strains excise dimers from DNA previously incised with Micrococcus luteus UV-glycosylase (Reynolds and Friedberg, 1980) and the same is also true of extracts from rad7, radl0, radl4, and radl6 mutants (R. J. Reynolds, personal communication). The appearance and disappearance of transient single-strand breaks during post UV incubation that is characteristic of wild-type strains is virtually absent in strains carrying tight mutations a t the R A D l , RAD2, RAD3, RAD4, and probably the RADl4 locus (R. J . Reynolds, personal communication). Polynucleotide ligase, the product of the CDC9 gene (Johnston and Nasmyth, 19781, is needed for the completion of excision repair (L. Prakash, personal communication). Yeast possesses two main DNA polymerase activities (Chang, 19771, but it is not known whether either is concerned with excision repair, and the genes responsible for these activities have yet to be identified. Finally, Landman and Little have demonstrated the existence of repair replication, using a Pettijohn-Hanawalt type of assay, in wild-type yeast and have also shown that the amount of such repair is reduced in a ra& mutant (Landman (nee Goldberg) and Little, 1978; Haynes et al., 1979). Excision repair seems to cope with a wide range of lesions since apart from being sensitive to UV, excision-deficient mutants are also sensitive to NA (Zimmermann, 19681, diepoxybutane (Kilbey and
TABLE 2 Excision-Deficient Mutants and Their Properties"
Mutation
radl rad2 rad3 rad4 rad7g mdlO radl4 rad16# rad23 mmsl9 cak9
Dimer excision
Induced mutagenesis'
Cross-sensitivity tob NQO S
S S S
NA
MMS
EMS
PA
uv
NQO
S
S S S S M S M M
R R R R
S S
++
++ ++ ++ ++
S
-
S R S
S S M S M R
-
-
-
-
-
-
-
-
-
S
-
++ ++ ++
-
++ ++ ++ ++
-
-
-
R R -
++
++
EMS
NA
PA
gamma
-
-
-
-
-
++ -
++ -
"Table compiled kom Nakai and Matsumoto (1967), Cox and Parry (1968), Resnick (1969), Zimmermann (19681, Brendel and Haynes (1973), Lawrence et al. (1974), Lawrence and Christensen (1976),Prakash (1976),Johnson and Nasmyth (1978), Ruhland and Brendel (1979), Johnston (1979a), F'rakash and Prakash (19791, G. McKnight (rad23, personal communication). * S, sensitive; M, slightly sensitive; R, resistant; PA, polyfunctional alkylating agents. All strains are sensitive to UV and resistant to ionizing radiation. + + , Enhanced mutability per unit dose; = , normal mutability. Chromatography, Unrau et al. (1971); Waters and Moustacchi (1974). UV-glycosylase method, F'rakash (1975, 1977a,b), Prakash and Prakash (1979). Reynolds (1975, 1978), Reynolds and Friedberg (1980). 'Transforming DNA competition assay, Resnick and Setlow (1972). 8 Some loss of UV-endonuclease-sensitive sites detected in these strains (R. Reynolds, personal communication).
MUTAGENESIS IN
S. cerevisiae
193
Smith, 19691, a variety of polyfunctional alklylating agents (Brendel and Haynes, 1973; Ruhland and Brendel, 19791, mitomycin C (J. C. Game, cited in Game and Cox, 1972), mono- and bifunctional psoralens plus near UV (Averbeck and Moustacchi, 1975; Averbeck et al., 1978) and are slightly sensitive to MMS (Zimmermann, 1968). MMS sensitivity is great enough, however, t o allow the isolation of radl and a rad4 mutation (Prakash and Prakash, 1977) and several radl, rud2, and rad4 alleles (Lawrence and Christensen, unpublished data) from MMS-sensitive strains. Although excision-deficient strains have normal resistance to ionizing radiations (Brendel and Haynes, 1973; McKee and Lawrence, 1979a, 19801, NG (Kilbey and Smith, 19691, EMS, DES, and methoxylamine (Lawrence et al., 19741, repair of the lesions produced by these agents may require only the postincision stages of excision repair. As might be expected, excision-deficient strains do not lose the capacity to photoreactivate UV-induced lethal damage during liquid holding (Parry and Parry, 19691, and this was the first indication of their repair deficiency. A second feature of high diagnostic value is that UV-induced mutation frequencies are much enhanced in all excision-deficient mutants tested (Resnick, 1969; Zakharov et al., 1970; Averbeck et al., 1970; Moustacchi, 1969, 1971; Lawrence et al., 1974; Lawrence and Christensen, 1976; Kern and Zimmermann, 1978; Ruhland and Brendel, 1979). The RAD23 gene has been included in Table 2 because rud23 mutants (G. McKnight, personal communication) show this feature, but excision deficiency has not been directly demonstrated in this strain. Excision-deficient mutants also show enhanced mutability with NQO (Prakash, 19761, and furocoumarins (Grant et al., 1979) presumably because with these mutagens, as with UV, a greater number of premutational lesions are directed into errorprone repair. Even though sensitive to such agents, excision-deficient strains give normal mutation frequencies induced by NA (Prakash, 1976) and polyfunctional alkylating agents (Ruhland and Brendel, 1979). In these cases, it is therefore likely that the lethal damage potentially excisable is not capable of producing mutations. Mutagenesis induced by EMS (Prakash, 1976) and ionizing radiation (McKee and Lawrence, 1979a)is also normal in excision-deficientstrains. b. RAD52 Repair. Repair carried out by genes in the RAD52 epistasis group, described as the RAD51 pathway by Cox and Game (19741, also appears to be essentially error-free, at least as far as UV and gamma-ray induced mutagenesis is concerned (Table 3). However, the EMS-induced reversion of cycl-131 is reduced in rad52 mutant strains (Prakash, 1976; Prakash and Prakash, 1979) and the reversion
TABLE 3 RAD.52 Epistasis Group Mutants and Their Properties"
Mutation rad50 rad5l rad52 rad53 rad54 rad55 rad56 rad57 rsl
Sporulation abilityb
+
+/+/-
+ +
+/-
+ +
-
Ascospore viabilityh -
+ -
uv
Recomb. abilityh sensitivity' -
+I-
+I-
+/-
+/-
+
-
-
-
+/-
-
S S S S R R R R S
Induced mutagenesid gamma -
uv
EMS
NA -
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
Table compiled from Nakai and Matsumoto (1967), Cox and Parry (1968),Resnick (1969), Averbeck et al. (19701, Saeki et al. (1974, 1980), Game and Mortimer (1974), Lawrence and Christensen (1976), Prakash (1976), Prakash and Prakash (19791, McKee and Lawrence (1979a1, Game et al. (1979), Prakash et al. (19791, Haynes et al. (1979). ' + , Normal; + I - , moderately reduced; - , very reduced. ' All mutants are sensitive to ionizing radiations and MMS. S, slightly sensitive; R, resistant. =, Normal; -, reduced.
MUTAGENESIS IN
S . cereuisiae
195
of cycl-115 is reduced in a rad51 mutant, as well as in the rad52 strains. Possibly these two loci, and any others like them, belong to the RAD6 epistasis group for the repair of EMS-induced damage, although they do not for UV and gamma-ray repair. All of the mutants listed in Table 3 are substantially sensitive to ionizing radiations and MMS, and are either completely resistant to UV or are only slightly sensitive to it. Since Ananthaswamy et al. (1978)have isolated another 15 nonallelic groups of X-ray sensitive mutations and 11 of the mms mutants isolated by Prakash and Prakash (1977) have a similar phenotype, it is likely that there are many more genes in this epistasis group than those shown in Table 3. Several pieces of evidence suggest that these genes are concerned with a type of repair that depends on genetic recombination. Meiotic recombination cannot be detected at any stage during the sporulation of rad52 (Game et al., 1980; Prakash et al., 1979), rad50, or rad57 homozygous diploid mutants (Game et al., 19791, though they all carry out premeiotic DNA synthesis and produce ascospores. Ascospore viability is much reduced in these strains, however, and also in most of the other mutants in this group together with many of the diploids homozygous for mms mutations (Prakash and Prakash, 1977). Radiation-induced mitotic recombination is reduced or absent in strains carrying mutations at the RAD51 through RAD57 loci (Saeki et al., 1974, 1980; Resnick, 1975; Prakash et al., 1979). The rud52-1 allele has been found to abolish homothallic switching (Malone and Esposito, 1980), a process thought to depend on genetic recombination. Finally, the prominent and characteristic X-ray resistant “tail” that is found on the survival curves of wild-type haploids is absent in haploids carrying mutations at one of the loci listed in Table 3 (Game and Mortimer, 1974). This tail is due to the transiently high X-ray resistance of budded cells (Beam et al., 1954; deLangguth and Beam, 1973), at a time in the cell cycle when newly duplicated homologous chromosomes (Bird and Manney, 1974) are close enough to permit genetic recombination (Brunborg and Williamson, 1978). The high Xray resistance of wild-type diploids is thought to result from the increased opportunity for this kind of repair throughout the cell cycle (Brunborg and Williamson, 19781, and it is significant that diploids homozygous for these mutations lack much of the pronounced shoulder found on wild-type X-ray survival curves (Game and Mortimer, 1974). Although a recombination-dependent process may be required to repair a variety of lesions, double-strand breaks in DNA appear to be a major substrate for RAD52 repair. Resnick and Martin (1976) and Ho (1975) have both found that rad52-1 mutants are unable to repair these lesions, though they are repaired efficiently in wild-type
196
CHRISTOPHER W. LAWRENCE
strains. Similar results have been found by Mowat (1979) with rud511 strains. Resnick (1976) has proposed a specific model for the repair of double-strand breaks by a recombination-dependent mechanism. Strains carrying rud52-1 have also been found to be unable to repair dominant lethal damage (Ho and Mortimer, 1973). c. RADG Repair. In all cases where it has been adequately tested, mutations that reduce or abolish induced mutagenesis have been found to fall within the RADG epistasis group, indicating that errorprone processes are related exclusively to this type of repair. Moreover, mutation frequencies cannot be increased significantly above spontaneous levels when RADG repair is efficiently blocked (Lawrence and Christensen, 1976; McKee and Lawrence, 1979a) and those cases where small increases are seen probably result from very weak translational suppression of the rud6-1 allele, which is very susceptible in this respect. RAD6-dependent activities have also been referred to as the RADl&repair pathway (Cox and Game, 1974) or error-prone repair. The latter term is inappropriate because, as discussed below, several RAD6-dependent activities may be error free. Although all induced mutagenesis-deficient mutations appear to belong to the RADG epistasis group, all mutants within this group do not share this phenotype. Rud9-1 mutant strains show normal levels of gamma-ray induced mutation, for example (McKee and Lawrence, 1979a), though rud9-1 strains are as sensitive to gamma-rays as rud6-1 mutants, and the rud6-1 rud9-1 double mutant is no more sensitive than either single mutant strain (McKee and Lawrence, 1980). The same is probably true of other strains and also for other mutagens (e.g., Prakash, 1976). As discussed in Section III,B, these phenotypes appear to be the result of the existence of both error-free and error-prone processes under RADG control. Strains carrying mutations in genes within this group tend to be sensitive to both UV and ionizing radiations, and in some cases to a wide range of chemical mutagens as well (Table 4), but the degree of sensitivity varies widely from the extreme sensitivity of rud6 mutants (Cox and Parry, 1968) on the one hand to the slight or nonexistent sensitivity of umr mutants on the other (Lemontt, 1977a). In most cases this variation in sensitivity reflects the inherent properties of the loci and not variation in the leakiness of the mutations. Diploids homozygous for rud6-1 (Cox and Parry, 1968) and rud63 (unpublished data) are sporulation deficient, but no other mutant in this group isolated so far shares this property. Since rud6-1 diploids are not deficient with respect to either spontaneous (Kern and Zimmermann, 1978) or induced mitotic recombination (Hunnable and Cox, 1971; Kern and Zimmermann, 1978; Saeki et ul., 19801, since the rev
TABLE 4 Mutants in the RAD6 Group and Their Properties" Sensitivity tob Mutation rad6 raaP rad9 radl6 radl8 rev1 rev2 rev3 umrl' umr2' umr3' mmd cdc8 psol
uv vs S S S
vs M
M
M
R R R Mf M M
Induced mutagenesis'
gamma
EMS
MMS
vs
vs
vs
S
vs S S M
M
M nt nt nt Mf nt M
nt R M M R
R R
nt nt nt nt nt nt
M S
R
nt nt nt nt nt nt nt M nt nt
uv -
-d
+ +I-
gamma -
+ +/-
+
-
+/-
-
-
nt nt nt nt nt nt
EMS
NA
NQO
-d
-
nt
nt
nt
+
-d
-
-
-
-
+I-
+ + +
nt nt nt nt nt nt
+ + +
+
nt nt nt nt nt nt
-
nt nt nt nt nt nt
"Table compiled from Cox and Parry (1968), Cassier et al. (1981), Lawrence et al. (1974), Lawrence and Christensen (1976, 1978a,b, 1979a), Lemontt (1971, 1972, 1977a), McKee and Lawrence (1979a,b, 1980), Prakash (1974, 1976), Prakash and Prakash (1977, 19801, Prakash et al. (1979), Zimmermann (1968). * VS, Very sensitive; S, sensitive; M, moderately sensitive; R, resistant; nt, not tested. ' - , Induced mutability very reduced, at least for some test systems; + I - , induced mutability slightly reduced, at least for some test systems; + , normal mutability. Normal mutability a t low doses. The phenotypes of these mutations suggest that they are in the RAD6 group, but double mutants combining them with rad6 have not yet been tested. Only in diploids.
198
CHRISTOPHER W. LAWRENCE
mutants show normal meiotic and mitotic recombination (Lemontt, 1971b), and since ascospore viability is also normal in all strains that sporulate, it is unlikely that recombination plays a large role in RADG-dependent processes. Although a single r u d 9 4 homozygous diploid has been reported to be deficient in spontaneous and induced recombination (Kowalski and Laskowski, 1975), other rud9 strains do not exhibit this phenotype so it is unlikely that it is attributable to the rud9 mutation itself. At the same time, rud6-1, rud9-1 (Prakash, 1977), and rudl8-1 (Reynolds and Friedberg, 1981) mutants have been shown to carry out normal excision of pyrimidine dimers, indicating that RADG processes are distinctly different from both excision and recombination repair. Similarly, rud6-1 and rudl8-2 mutants contain normal levels of a n endonuclease specific for apurinic sites in DNA (Chlebowicz and Jachymczyk, 1977). Whatever they are, RADG-dependent activities are capable of repairing single- and double-strand breaks in DNA induced by MMS (Jachymczyk et ul., 1977; Chlebowicz and Jachymczyk, 1979). Double-strand breaks are repaired efficiently in haploids only in G2, leading these authors to suggest that they are repaired by a recombinational mechanism. In view of the reduced levels of EMS mutagenesis in rud51 and rud.52 strains, it is possible that RAD52-dependent repair of alkylating agent damage is under RADG control, though other explanations are possible and the involvement of recombination in the repair of MMS-induced double-strand breaks has yet to be demonstrated directly. Rudl8-2 mutants appear to be capable of repairing single- and double-strand breaks induced by ionizing radiation, however (Mowat, 1979). Apart from UV, ionizing radiations, and MMS, rud6-1 mutants are extremely sensitive to a wide range of chemical mutagens, including NA, NG, EMS, DEB, DES, and methoxylamine (Zimmermann, 1968; Prakash, 1974; Lawrence et ul., 19741, suggesting that a wide range of lesions can be repaired by RADG-dependent processes. It is apparent from the foregoing discussion that RADG-dependent processes are the least well understood of the three main types of repair. Evidence given in later sections suggests that RADG repair is unlikely to be a simple linear “pathway.” Instead, it probably comprises a set of functionally independent processes, possibly all directed to a common end. Using the scheme proposed by Clark and Volkert (1978) for the classification of repair activities, it is tempting to speculate that RADG processes are concerned with intrareplicational repair, and involve activities directed toward restoring the ability to synthesize DNA in mutagen damaged cells. d. Other Kinds of Repair. Apart from the technical and theoretical problems of double-mutant analysis (discussed by Game and Cox,
MUTAGENESIS IN
S . cereuisiae
199
1972, and by Lawrence and Christensen, 19761, the existence of mutations that appear to fall into several epistasis groups (e.g., cdc8, Prakash et al., 1979, and r s l , F. Eckardt, personal communication) and the paucity of DNA repair studies in mutant strains, a further problem with the conclusion that yeast possesses only three major types of repair stems from the fact that double-mutant analysis has almost always been based on radiation sensitivity and been carried out almost exclusively with mutations selected for radiation sensitivity. It is far from evident, therefore, that these three types of repair represent the full inventory of such resources available in yeast, particularly with respect to damage caused by chemical mutagens. It is not yet known, for example, whether there is an inducible or constitutive counterpart to the error-free adaptive response repair of alkylated DNA found in E . coli (Samson and Cairns, 1977). It remains to be seen whether analysis of mutations selected for sensitivity to chemical mutagens will reveal the occurrence of other types of repair.
2 . Analysis of RADG-Dependent Activities The phenotypes of mutants within the RADG group suggest that while the RADG gene is involved in all of the activities carried out by this group, other genes are concerned with only some of them. As described in Section III,A, unsuppressed, nonleaky rud6-l mutants seem to be entirely deficient with respect t o mutagenesis induced by a majority of powerful mutagens and are simultaneously extremely sensitive to these agents. They also show enhanced levels of spontaneous mutation (Hastings et al., 19761, and of induced and spontaneous mitotic recombination (Hunnable and Cox, 1971; Kern and Zimmermann, 19781, and growth inhibition by the antifolate drug, trimethoprim (Game et al., 1975). Haploid strains carrying rad6-1 are unable to repair single- and double-strand breaks induced in their DNA by MMS (Jachymczyk et al., 1977; Chlebowicz and Jachymczyk, 1979). Finally, diploids homozygous for rad6-l fail to sporulate (Cox and Parry, 1968) and show only a little recombination in meiotic rescue experiments, even though they synthesize DNA before meiosis in the normal manner (Game et al., 1979). Rad6-3 mutants have not been investigated so thoroughly, but share enough of these properties to suggest that they may be quite similar (unpublished data). Other mutants in the RAD6 group never exhibit all of these phenotypes, however, and the manifestation of any one of these characteristics is rarely as extreme. Together with other evidence reviewed below, this suggests that the RADG gene plays a central, perhaps regulatory, role in a variety of functionally distinct and independent processes, each of which is carried out by a different set of genes
200
CHRISTOPHER W. LAWRENCE
(Lawrence and Christensen, 1978~). That the RADG locus is a structural gene, coding for a protein, is implied by the observation that the rad6-1 and rud6-3 alleles can be translationally suppressed (unpublished data). a. Error-Free and Error-Prone Processes. Based on the properties of rad6-1 SRS2 mutants and other mutants in this group, RADG processes seem to fall into two main categories: a set of error-free processes that are responsible for a substantial fraction of wild-type resistance to killing by DNA-damaging agents, and a set of processes that contribute only a little to recovery, but are necessary for induced mutagenesis and sporulation. The dominant SRS2 mutations, isolated from spontaneous trimethoprim-resistant derivatives of rad6-1 radl8-2 double mutants (Lawrence and Christensen, 1979b), suppress a substantial fraction of the UV sensitivity of rad6-1 strains, but not their deficiencies with respect to UV-induced mutagenesis or sporulation. SRS2 alleles also suppress the UV and trimethoprim sensitivities of strains carrying rad6-3, rad18-3, and rad18-4. The SRS2 mutations do not enhance excision repair since they are equally effective in excision-deficient rad6-l strains. They also have no obvious phenotype in RAD6' RAD18' strains. Since they do not suppress any of the alleles in a set of amber or ochre auxotrophic mutations, but do suppress all rad6 and radl8 mutations tested, the SRS2 mutations appear to be metabolic or nontranslational, suppressors; it cannot be entirely ruled out that they are translational suppressors, however, and that the rad6 and radl8 mutations are all uniquely susceptible to this process. Although several explanations are possible, the SRS2 alleles could be operator mutations in a structural gene, normally under positive control by the RAD6 gene product, that codes for an enzyme concerned with error-free repair of UV-induced damage. The suggestion that RAD6-dependent recovery and mutagenesis are functionally separate activities is further supported by the observation (M. Tuite and B. S. Cox, personal communication) that the serine-inserting ochre suppressor, SUQ5, suppresses the sensitivity of rad6-3 mutants, but not their deficiency with respect to UV-induced mutagenesis, and has the opposite effect on the rad6-l allele. The existence of RAD6-dependent error-free repair may also be implied by the observation that cycl-91 and cycl-152 are reverted by UV 10- to 100-fold less frequently in excision-deficient cells irradiated in exponential phase than in stationary phase (Lawrence and Christensen, unpublished data); it is possible that such repair is much more active in exponentially growing cells, and is responsible for their slightly enhanced resistance to UV (Parry et al., 1976).
MUTAGENESIS IN
S. cereuisiae
20 1
If this hypothesis regarding the subdivision of RAD6-dependent activities is correct, the phenotypes of other mutants within the RAD6 group might also be expected to be of two main types; those which are relatively insensitive, but very deficient with respect to induced mutagenesis, and those which are highly sensitive, but capable of normal induced mutagenesis. Attempts to recognize these two types are at present only partially successful (Table 4). The rev mutants are clearly of the first type, and so also are the umr mutants, though these have not yet been assigned definitely to the RADG epistasis group. The properties of the mms3 mutant suggest that it probably best fits in this category, and while the cdc8 mutant may possibly be of this type, the role of this locus in DNA synthesis makes its categorization rather problematical. Identification of the second type of mutant is less easy, however, because strains potentially of this kind often fail to give normal yields of mutations with one or another mutagen, and also because they vary considerably with respect to their sensitivity to different mutagens. These observations may imply that genes other than RADG are concerned simultaneously with error-free and error-prone processes, or that certain gene products are involved in the error free repair of some lesions and the error-prone processing of others. It is also possible, however, that the reduced yield of induced mutations found in some of these strains represents more a failure to recover the mutations than to induce them, particularly when only a single mutant strain and test system has been examined. That reduced yields of induced mutations in radiation-sensitive strains do not always indicate a lack of induction is emphasized by work with recB and recC mutants of E . coli (Witkin, 1969, 1972; Hill and Nestmann, 1973). This interpretation is supported by the result of a reinvestigation of the phenotype of rad18-2 mutants. Although originally believed to be substantially deficient in UV and gamma-ray mutagenesis (Lawrence et al., 1974),subsequent and more extensive data indicate either no deficiency or one that rarely exceeds a few fold (Lawrence and Christensen, 1976; McKee and Lawrence, 1979a; unpublished data). It is therefore probable that the RADl8 gene functions only in errorfree processes, and that the deficit of induced mutations observed in some strains arose from the technical problems of working with very sensitive strains. It remains an open question whether other results in Table 4 can be explained in this way. Variation in such strains as rad9, radl5, or radl8 mutants in their relative sensitivity to different mutagens presents a less serious problem, and probably reflects the existence of several RADG-dependent error-free processes. This conclusion is reinforced by the observation
202
CHRISTOPHER W. LAWRENCE
that while the SRS2 mutations suppress the UV sensitivity of rad6 and radl8 mutants, they do not suppress their gamma-ray sensitivity (Lawrence and Christensen, 1979b). It is perhaps significant that radl8 mutants are nearly as sensitive to UV as rad6 strains, but much less so to gamma rays, as well as being trimethoprim sensitive and SRS2 suppressible. Rad9 mutants, on the other hand, are about as sensitive as rad6 strains to ionizing radiation, but much less sensitive to UV, and are insensitive to trimethoprim. These genes may therefore define two error-free repair pathways that act on different sets of lesions, one produced predominantly by UV and the other predominantly by ionizing radiation, with some overlap in both cases. Since rad6 mutants are sensitive to a wide range of agents, other nonmutagenic pathways may also exist. b. Multiplicity of Error-Prone Processes. It appears to be a characteristic feature of genes more directly involved in mutagenesis, the genes defined by the mutants of the first type discussed above, that they have restricted mutational phenotypes; that is they are concerned with the production of only certain kinds of mutations induced by only certain mutagens. It follows that different groups of mutations induced by different mutagens are produced as the result of the action of partly different sets of genes and that there are, in a formal sense, several error-prone processes rather than only one. The existence of restricted mutational phenotypes was first discovered by Lemontt (1971a, 19721, who found that reu2-1 mutants, selected for their deficiency in UV-induced reversion of arg4-17, were almost normal with respect to the UV-induced reversion of other alleles, and also for UV-induced forward mutation to auxotrophy. Lemontt also found that the frequencies of EMS-induced auxotrophs were normal in all three reu strains, including reul and rev3 mutants that had a much more general influence on UV-induced mutation. Subsequent work has confirmed and extended these findings. Using the reversion of the well-defined cycl alleles as test system, it was found (Lawrence and Christensen, 1978a) that the REV1 gene function was not required for the UV-induced reversion of two out of twelve base-pair substituion alleles tested, and three out of four frameshift alleles (Table 5 ) . Using the same method, the R E V 2 gene function was found to enhance the UV-induced reversion of the highly UV-revertible ochre allele cycl-9, but to play virtually no part in the reversion of two other ochre alleles, or the reversion of a variety of amber, initiation, missense, or frameshift mutations (Lawrence and Christensen, 197813). The R E V 3 gene has a broader range of activity, and its function is required for the production of most base-pair additions, deletions, and substitutions monitored, though probably not
MUTAGENESIS IN
S. cerevisiae
203
TABLE 5 UV-Induced Reversion of cycl Tester Alleles in Radiation-Sensitive Strains" cycl tester allele
Type Initiation
Ochre Amber
Pro1i ne Missense Frameshift
Number 13 51 131 133 17(= 2) 72 91( = 9) 76 84 179 6 115 31 183 239 33 1
Mutant codon AUPyiA CUG GUG AGG UAA UAA UAA UAG UAG UAG
ccu ccu
- UC?
+A -G -A
Normal codon and position reul".' AUG-1 AUG-1 AUG-1 AUG-1 CAA 21 GAA 66 GAA 2 GAG 71 UGG 64 AAG 9 GCU 12 CUU 14 uuc 3 AAA 10 AAG 4 GAA 2
-
+ -
+ + +
+
rev2"
nt nt
+ + + +
+I-
+ + + + + nt + + nt
r e ~ 3 " . r~ ~ d 6 ~ -
+/-
nt nt
nt nt -
nt nt nt
-
-
nt nt
nt nt nt nt
-
+/-
-
-
nt
-
-
-
nt nt
-
Table compiled from Lawrence and Christensen (1978a,b, 1979a, and unpublished data). " + , Wild-type reversion frequency; + / - , reversion frequency is 25-50% of wild-type value; -, reversion frequencies are very low; in revl strains about 5 8 of wild-type value, in rev3 strains about 2%. and in rud6 strains no detectable reversion above spontaneous levels; nt, not tested. revl -1 and revl -3 alleles tested. rev3-1 and rev3-3 alleles tested.
all (Lawrence and Christensen, 1979a). Frameshift reversion frequencies in rev3-1 and r e v 3 3 mutants were higher than might be expected from mutant "leakiness," and in particular, the reversion of the atypical base-pair substitution mutations c y c l - l I 5 and cycl -131 was reduced by only a factor of two, rather than the factor of fifty o r more that was typical of other mutations in this class. Other results also point to the atypical nature of the processes which are responsible for cyc1-115 and cycl-131 reversion. These alleles revert normally, or almost so, with both UV and gamma rays in rev1 1 and revl -3 mutant strains (Lawrence and Christensen, 1978a; McKee and Lawrence, 1979b). UV-induced reversion is also normal in excision-deficient revl strains, and photoreactivation is as effective in reducing the reversion frequencies of these alleles as it is for others. Lastly, these alleles revert far better with EMS than other similar alleles (Prakash and Sherman, 1973). Although the nucleotide se-
204
CHRISTOPHER
W.
LAWRENCE
quence of the entire CYC1 structural gene and leader region is known (Smith et al., 1979), there is no obvious or simple feature which differentiates cycl -115 and cycl -131 from other base-pair substitution alleles, perhaps indicating that other features such as base modification or chromatin structure are responsible for their unique reversion pathway. The REV genes are also involved with mutagenesis induced by only certain mutagens. Apart from the selective involvements of these genes in UV and gamma ray mutagenesis, as outlined above, their functions are also required for the reversion of cycl-131 induced by the UV-like NQO (Prakash, 1976). However, EMS-induced forward mutation to auxotrophy is normal in each of the three rev mutants (Lemontt, 1972) and so also is EMS- and NA-induced reversion of cycl-131 (Prakash, 1976). In view of the absence of any detectable influence of the reu mutations on EMS or NA-induced mutagenesis, it would be interesting to see if it is possible to isolate reu-like mutations in other genes that specifically block these processes. Such mutations potentially offer the opportunity of classifying mutagens not in terms of the lesions they produce in DNA, but in the more biologically meaningful terms of common enzymatic processing.
C. NONRANDOMNESS OF INDUCED MUTAGENESISAND MUTAGEN SPECIFICITY Although most induced mutations in yeast appear to arise as the consequence of RADG-dependent processes, different mutagens nevertheless seem to be capable of producing distinctly different spectra of mutations (e.g., Sherman et al., 1975) and these are also different from the spectrum of spontaneous mutations. Similarly, identical basepairs located at different genetic sites vary considerably in their susceptibility to mutation, both with respect to overall frequency and to the types of alterations, in a manner which cannot be explained in terms of function restraints to the detection or recovery of mutations. These characteristic features of mutagenesis presumably depend partly on the way mutagens interact with DNA and partly on the enzymatic response to the consequent lesions, but in practice it is often difficult to assess the relative importance of these two groups of factors in any one instance. 1. Mutagen Specificity Experience with bacteria suggests that the action of mutagens could be described as “specific” in one of two different ways: a specificity
MUTAGENESIS IN
S . cerevisiae
205
with respect to the base-pair mutated, possibly coupled with the selective production of particular base-pair changes, and a specificity with respect to the class of mutations produced, such as base-pair substitutions rather than additions and deletions. Many mutagens will, of course, be specific in both these senses. Prakash and Sherman (1973) have examined 12 mutagens for specificity of the first kind, by determining their relative effectiveness in reverting 11 cycl test alleles, including 9 initiation mutants, an ochre and an amber mutant. Although each of these alleles can revert in several ways, most of them share all but one of these modes of reversion, and can, therefore, be used as a tester for that particular base-pair substitution. The initiation alleles, for example, share in common the property of reverting by an AT to GC transition in the - 2 codon and by an AT to TA transversion in the lysine 4 codon; they fall into different groups with respect to the reverting substitutions in the -1 codon, however. Using this test system, the 12 mutagens tested were found to fall into one of two groups. MMS, DMS, HN2, UV and gamma-rays each reverted the 11 test alleles with roughly equal efficiency, and were, therefore, judged to be nonspecific mutagens. EMS, DES, NG, NIL, NA, tritiated uridine, and to a lesser extent P-propiolactone, all reverted the initiation allele cycl-131 much more efficiently than any of the others, by factors ranging from 6-fold to more than 1000-fold. Since cycl-131, unlike any of the other alleles, can revert by GC t o AT transition, such results appear to imply that these mutagens selectively attack GC base-pairs and specifically produce this substitution. As the authors themselves point out, however, the generality of these results is open to question; it is difficult to exclude the possibility that the cycl-131 mutant codon is a “hot spot” for certain kinds of chemical mutagenesis and that the results are not characteristic of most GC base-pairs. Other evidence suggests the cycl-131 site may, in fact, be quite atypical. Although cycl-115, another GC substitution test allele in which the leucine 14 codon is replaced by the proline triplet CCT (Sherman and Stewart, 1978), responds to these mutagens like cycl-131, cycl-6 is reverted very poorly by any of them except UV; cycl-6 also contains the proline triplet CCT, in place of the alanine 12 codon, and can revert by at least some of the substitutions that revert cycl-115 (Putterman et al., 1974). It is clear, therefore, that different GC sites vary enormously in their susceptibility to mutagens such as EMS. Moreover, the genetic control of the induced reversion of cycl-131 and cycl-115 is atypical, at least when radiations are used. Unlike 10 other base-substitution alleles, the UV
206
CHRISTOPHER W. LAWRENCE
and gamma-ray induced reversion frequencies of these two mutations were relatively normal in rev1 mutant strains, and almost so in rev3 mutant strains (Lawrence and Christensen, 1978a, 1979a; McKee and Lawrence, 1979b). It seems likely, therefore, that experiments with these cycl alleles give an exaggerated impression of selectivity exhibited by mutagens such as EMS, and that consequently the real extent of their specificity remains an open question. Since only a single base-pair site was studied, the same uncertainty applies to the claim of specificity for the very weak mutagen 2-AP (Sora et al., 1973). Whatever the answer, the high revertibility of cycl-115 and cycl-131 by some, but not all, chemical mutagens is an interesting problem in its own right. Selective mutagenesis of GC base-pairs, leading to the production of GC t o AT transitions and GC to TA transversions, has, however, been clearly demonstrated in a study of the UV-like chemical mutagen NQO, using the cycl test system (Prakash et al., 1974; Prakash and Sherman, 1974). This mutagen also reverts cycl -131 with high efficiency, and even though the extent of its specificity may be overestimated at this site, it selective attack on GC base-pairs is confirmed by an appreciable, if lesser, ability to revert the initiation mutant cycl-133 as well as six amber alleles; nine ochre alleles were not appreciably reverted. This result is not found with EMS or similar mutagens. The cycl-133 allele contains AGG in place of AUG at the -1 initiation site (Stewart et al., 1971), and, therefore, detects GC to TA transversions, while the amber mutants, unlike the ochre alleles, contain a GC base-pair and can revert by GC to TA or CG transversions. Iso-l-cytochromes c extracted from 10 NQO-induced revertants of the amber mutant cycl-1 79 each contained tyrosine residues a t the amber site, confirming that these revertants had in fact arisen by GC transversion, even though AT changes were common with other mutagens. Finally, analysis of protein from 10 cycl-131 revertants induced by NQO, and 10 cycl-133 revertants, showed that all 20 substitutions occurred only at GC sites, despite the possibility of reversion by AT alterations. Although these results clearly demonstrate that NQO selectively mutates many GC base-pairs, the authors point out that cycl-6, previously found to be refractory to EMS treatment, is also reverted very poorly by NQO. They conclude, therefore, that mutations reverting well with NQO contain GC base-pairs, but that those that do not either contain AT pairs or immutable GC pairs. A similar conclusion was reached in a study of NQO-induced reversion of ochre and opal mutants in Schizosaccharomyces pombe (Janner et al., 1979).
MUTAGENESIS I N
S. cereuisiae
207
Although circumstantial evidence suggests that a number of the mutagens discussed above are specific in the second sense, in that they probably produce base-pair substitutions with much greater efficiency than additions or deletions, critical data are lacking in all but a handful of cases. On average, NQO reverts three cycl frameshift alleles at about 2% the frequency of GC substitutions, a frequency that is about the same as that for AT substitutions, and EMS appears to be very similar (Prakash et al., 1974). Bearing in mind that at least two of the three frameshift alleles can revert by additions or deletions located in an extensive region that contains GC base-pairs, the specificity is striking. By this criterion, UV light is also a relatively specific mutagen. The average reversion frequency of four cycl frameshift alleles induced by this mutagen was only about 7% of that of 12 cycl substitution mutations (Lawrence and Christensen, 1978a,b, 1979a). A similar result was also found in excision-defective strains and after maximal photoreactivation, suggesting that cyclobutyl dipyrimidines are equally responsible for both categories of mutation. UV is not a specific mutagen with respect to the type of base pair altered, however, since AT pairs are at best mutated only twice as well as GC pairs. Nevertheless transitions are about six times as abundant as transversions at both types of site (Lawrence and Christensen, 1979~1,indicating that UV mutagenesis is far from a random process. Less extensive data suggest that gamma rays may be among the least specific of the better studied mutagens. Gamma-ray induced reversion frequencies of different base-pair substitution alleles show much less variation than the frequencies induced by UV, EMS, or NQO (Prakash et aZ., 1974) and a single frameshift allele (cycl-183) reverted at a frequency that was over 20% of that for the three substitution alleles cycl-115, cycl-131, and cycl-9 (McKee and Lawrence, 1979b). When the identical strains were exposed to UV, this frequency was less than 5% (Lawrence and Christensen, 1978a,b, 1979a) so that the results, though taken from a small sample of strains, are probably significant. Moreover, Panzeri et al. (1979) have found that the frequency of reversion of two putative missense alleles uru4-10 and arg418, induced by 50 kV X-rays, was less than that for the his4-519 frameshift allele, a result which also supports the view that ionizing radiations are among the least specific of mutagens. As discussed above, each of the mutagens tested adequately shows at least some tendency to produce base-pair substitutions more readily than additions and deletions, though the extent of this bias varies greatly. In keeping with numerous studies with bacteria, the acridine half mustard ICR-170 appears to exhibit the reverse specificity in
208
CHRISTOPHER W. LAWRENCE
yeast, producing additions and deletions more readily than substitutions. A majority of auxotrophic mutations induced by this agent were found to revert at a much higher frequency when treated with the same mutagen than with NG, quite the reverse of the results with mutations induced by NG or NA (Brusick, 1970; Pittman and Brusick, 1971). Further, a detailed study of 39 his4 mutations induced by ICR170 strongly implies that at least half of these are indeed frameshift mutations (Culbertson et al., 19771,since 20 of them have the following properties: they fail to complement other his4 mutations and exhibit polarity; the polarity can be relieved by mutations within the his4 gene itself; they are not suppressed by SUP4 amber or ochre suppressors, and do not corevert with known UAA, UAG, and UGA nonsense mutations; they are suppressed by dominant external suppressors, which can be induced by ICR-170 but not by EMS or DES, and which do not suppress known nonsense alleles; they revert at high frequencies with ICR-170, but only at low frequencies with EMS or DES. Fifteen further mutations gave no evidence of being missense or nonsense, but neither reverted well with any mutagen nor could be suppressed by any suppressor. Recently, direct confirmation that four of the suppressible and one of the nonsuppressible his4 alleles are indeed frameshifts and due to the insertion of an addition GC base-pair, has been obtained by sequencing DNA from the mutants (Donahue et al., 1980). Finally, three of the mutations appeared t o be missense alleles, and one was an ochre mutation. As the authors point out, these results indicate that mutagen specificity should not be used as the sole criterion for mutant diagnosis. A t the same time, a group of mutations induced by this ICR-170 is more likely to contain a high proportion of frameshift alleles than comparable groups induced by other mutagens. Analysis of the dominant frameshift suppressors that they isolated led Culbertson et al. (1977) to suggest that ICR-170 showed some specificity not only in the sense of producing a higher proportion of base-pair additions than other mutagens, but also in the sense of acting preferentially on certain base-pair sequences. One class of suppressors, comprised of mutations at five loci, affect glycyl tRNAs, a result that is consistent with the view that ICR-170 acts on GGG sequences. The DNA sequence data of Donahue et al. (1980) confirm this conclusion, and show that ICR-170 acts with high specificity both on this and the complementary proline triplet. Monotonous runs of GC pairs have been shown to be the most common site of action for ICR compounds in bacteria (Roth, 1974). Apart from their technical value, the existence of what appear to
MUTAGENESIS IN
S . cereuiszae
209
be misrepair mutagens such as EMS and NQO that act preferentially on particular target base-pairs or sequences, or preferentially produced certain kinds of mutations, is a fact that carries implications concerning the mechanism of RADG-dependent mutagenesis. To act specifically, it is likely that a mutagen must fulfill at least two requirements: it must attack certain base-pairs or sequences preferentially and mutations must be produced at that site, that is they must be targeted. Although it cannot be entirely discounted, the alternative hypothesis that certain kinds of DNA damage elicit particular mutagenic enzymes that produce mutations at only one kind of base-pair site seems less plausible. If this is correct, RADG-dependent processes must, on the one hand produce virtually no untargeted mutations, as with NQO, or on the other a significant frequency of such events, as with UV (see Section VI,C), depending on the type of damage. As discussed in Section VII such a situation reinforces the conclusion that misreplication and misrepair processes are much less distinctly different than previously imagined.
2 . Nonrandom Induced Mutagenesis Even when functional restraints to the detection and recovery of induced mutations are fully allowed for, a nonrandom distribution of induced mutations a t different sites throughout a gene might be expected when mutagens such as NQO and ICR-170 are used because of a nonrandom distribution of target base-pairs or nucleotide sequences. This parameter does not, however, appear to account for all such variation. As discussed in the previous section, the cycl-115 and cycl-131 alleles seem to be hotspots for reversion induced by certain kinds of chemical mutagens, and the cycl-6 site a coldspot. Variation of this second kind appears t o reflect the preferential action at certain sites of the enzymes involved in mutagenesis and repair, rather than a nonrandom distribution of premutational lesions. These enzymes seem to influence not only the overall frequency of substitutions induced at a particular base-pair site, but also the type of substitution that occurs. The latter phenomenon is well illustrated by a study of UV- and NA-induced revertants of three cycl ochre mutants, in which the basepair changes produced were inferred from the amino acid replacements occurring in their iso-l-cytochromes c (Sherman and Stewart, 1974). Each of these ochre alleles has a highly distinctive pattern of reversion with these mutagens, even though virtually all of the revertants due to single base-pair changes can be found when a range of mutagens is used, indicating the absence of functional restraints at these sites.
210
CHRISTOPHER W. LAWRENCE
Seven out of eleven cycl-2 revertants induced by UV arose by AT to TA transversion at the second position of the UAA codon, and the remaining four by AT transversion at the third position. At the cycl9 site, however, 21 out of 23 UV-induced revertants were due to AT to GC transition a t the first site of the UAA codon, and only two by AT transversion at the second site. The cycl-72 allele gave a result that was intermediate between these two. Different, but equally contrasting, patterns of reversion were found with NA. The AT transitions and transversions induced by NA at these ochre sites probably reflect the action of only a minor mutagenic pathway (untargeted mutagenesis?) for this agent, since it is thought to act principally on GC base-pairs. Although the nucleotide sequence surrounding these sites was not entirely explicit at the time, the authors point out that it is unlikely that this variation can be explained in terms of simple differences in adjacent base-pairs, a conclusion that the recently determined sequence (Smith et al., 1979) has confirmed. This conclusion is also supported and extended by an analysis of the UV-induced reversion frequencies of 12 cycf alleles, in which the relative rates of reversion at the three base-pair sites within a codon, together with knowledge of functional restraints, obtained by Sherman, Stewart, and colleagues was combined with estimates of the absolute mutation frequencies of these alleles (Lawrence and Christensen, 1979~).These results show that identical base-pair substitutions taking place at different sites within the cycl gene can occur at frequencies which differ by more than 50-fold, in a manner that is largely independent of flanking base-pairs or of the nucleotide sequence of the surrounding region. In particular, it was not found possible to explain the variation in terms of the number or type of adjacent pyrimidines at the site of reversion or in the surrounding region, implying that a nonrandom distribution of premutational lesions is at best only a minor determinant of mutation frequency. This result is consistent with the existence of a significant proportion of untargeted mutations induced by UV. Although it therefore seems likely that UV-induced mutation frequencies depend largely on the idiosyncracies of enzyme action at different genetic sites, a conclusion for which there is some independent evidence (Lawrence et al., 1974; Lawrence and Christensen, 1978a,b, 1979a1, the reasons for variation in enzyme action are not known. Since hotspots do not appear to possess a unique nucleotide sequence, it therefore remains an open question whether such sequences exist, but have not been recognized because of their length, complexity, number, or redundancy, or whether other extrinsic factors such as base modification or the struc-
MUTAGENESIS IN
S. cereuisiue
211
ture of chromatin, only distantly related to base sequence, are the major determinants of nonrandom mutagenesis. IV. Spontaneous Mutagenesis
A. GENETICANALYSIS As in comparable studies with prokaryotes and their viruses (see Drake, 1973; Cox, 19761, genetic control of spontaneous mutability in yeast has been chiefly analyzed with the aid of radiation-sensitive mutants and with strains directly selected for high spontaneous mutability. A third group of prokaryote mutations used for this purpose, those containing abnormal DNA replication enzymes, have yet to be identified in yeast. Three conclusions emerge from the yeast work carried out so far: the maximum enhancement of spontaneous mutagenesis observed in single mutant strains is small compared with those commonly found in prokaryotes, the extent of the enhancement varies considerably according to the test system used, with suppressor loci generally giving the largest responses, and even in strains selected directly for high spontaneous mutability, this character is usually accompanied by radiation sensitivity. As shown in Table 6, a high proportion of radiation-sensitive strains shows some evidence of increased spontaneous mutation rates, though by no means all of them do. Additional results have been obtained from X-ray sensitive double mutants (Suslova and Zakharov, 1971, cited in von Borstel et ul., 1973). Contrary to the conclusions regarding induced mutagenesis, data listed in Table 6 do not suggest that spontaneous mutagenesis is associated with only one of the three main types of radiation repair in yeast; the largest increases in spontaneous mutation rates are found in rud3-12, rud18-2, and rud52-1 mutants, a group that includes a single representative from each of the three epistasis groups. These increases vary according to the test system used, however; the reversion rate of uru4-11 is increased by 30-fold in rud52-1 strains, for example, while Zysl locus reversion is unchanged. It is not yet known whether this reflects the type of mutational event detected or some kind of site specificity. It would also be interesting to determine whether such specificities can be combined in double mutant strains, and whether the enhanced spontaneous mutation rates are combined additively, synergistically, or epistatically. Table 6 also lists results from mutant strains directly selected for high spontaneous mutability. Other, less well-characterized mutants
TABLE 6 Spontaneous Mutation Rates or Frequencies in Various Mutant Strains Locus and allele radl-1 radl -3 rad2 -2 rad2-16 rad2-17 rad2-18 rad3-12 rad4-3 rad5 (rev2) rad6-1 rad18-2 rad51-1 rad52-1 rad53-1 md53-2 UVs2'
mutl-1 mutl -2 mut2-1 mutl-2 mu&-1 SPOT-1 reml-1
Number of strains 7 1 3 1 1
1 2 2 1 28 5b 5
3 1 1 6 3 3 2 6d 25d
Metric" R F R R R F R R F F R F R R R F R
Spontaneous mutation, times control frequency or rate and test system used Normal, lysl -1, hisl -7 x9, hisl; x 10, l e d ; x6, adel; x9, CanR Normal, lysl-1, hisl -7 Normal, lysl-1 Normal, lysl-1 x6, a d d x5, lysl-1; x3, lysl-LSUP x12, hisl-7 Normal, lysl -1, hisl -7 > x 12, forward mutation to auxotrophy x 3, (lysl-1 ilysl-ISUP) x5, lysl-ISUP; x 12, ura4-11 x 4, (lysl-1 ilysl-ISUP) x 8, lysl-ISUP; x 30, ura4-11 Normal, lysl-1 Normal, lysl-1 x 12, a d d - n x 26, lysl-ISUP; x 19, arg4-17; X 5, hisl -7 x25, lysl-ISUP; x3, h i d - 7 x 7, lysl-ISUP; x 2, hisl -7 x 43, lysl-ISUP; x 30, arg4-17 x lo-', lys2-lSUP, normal, a d d - l x5, CanR; x 15, trp5-2
R, Rate, from fluctuation test; F, frequency. Includes two diploids. ' Interlaboratory designation not assigned, probably excision deficient. Diploids.
a
Reference Brychcy and von Borstel (1977) Moustacchi (1969) Brychcy and von Borstel (1977) von Borstel et al. (1971) von Borstel et al. (1971) Zakharov et al. (1970) Brychcy and von Borstel (1977) Brychcy and von Borstel (1977) Lemontt (1972) Hastings et al. (1976) von Borstel et al. (1971) Hastings et al. (1976) von Borstel et al. (1971) von Borstel et al. (1971) von Borstel et al. (1971) Zakharov et al. (1970) Gottlieb and von Borstel (1976) Gottlieb and von Borstel (1976) Gottlieb and von Borstel (1976) Gottlieb and von Borstel (1976) Esposito et al. (1975) Golin and Esposito (1977)
MUTAGENESIS IN
S. cereuisiue
213
have also been described (von Borstel et al., 1973; Hastings et al., 1976). Large increases in spontaneous mutation rate, which vary up to about 25-fold higher than the wild-type rate in single mutants, are restricted almost entirely t o suppressor mutations; other mutations revert at rates that rarely exceed the wild type values by 5-fold, and are usually closer to them than this. The influence of the two single mutations on the spontaneous mutation rate of suppressor loci appears to be about additive in mutl-2 mut2-1 double mutant haploids, though much less than additive in a double mutant diploid (Gottlieb and von Borstel, 1976). Strains carrying single mutations at six of the eight mut loci identified so far have been reported to be sensitive to one or more of the three mutagenic agents, UV, X-rays, and MMS (von Borstel et al., 1973; Hastings et al., 1976), and mut5-1 has been found to be allelic with rud51-1 (Morrison and Hastings, 1979). In addition, Golin and Esposito (1977) have demonstrated that a strain carrying the reml -1 mutation, which enhances spontaneous intra- and intergenic recombination during mitosis but not meiosis, also shows enhanced spontaneous mutation frequencies. The frequency of spontaneous mutation to canavanine resistance was increased 5-fold, and reversion of trp5-2 15-fold. Apart from these mutations which enhance spontaneous mutation frequencies, Quah et al. (1980) have isolated two mutations, ant1 and unt2, that are partially deficient in this respect. Antl, selected t o reverse the phenotype of a mutl-1 strain, decreases the spontaneous frequency of mutations that suppress lysl-1 by about 4-fold, has no effect on intragenic reversion of lysl -1, and decreases the reversion of his1 -7 by about 2-fold. Antl mutants are also mildly UV-sensitive. It is not known whether ant1 acts on other mutl alleles, or on mutations at other loci, and in view of its very small effect on spontaneous mutation in wild-type strains, its nature remains unclear. The ant2 mutation, which is an allele of the REV3 gene, decreases intragenic reversion of lysl-1 5- to 12-fold, intragenic reversion of arg4-17 4fold, reversion of his1 -7 by about 4-fold, and has little effect on the frequency of suppressor mutations. The antimutator action of this rev3 allele appears to be epistatic to the mutator effect rud.3, rudl8, and rad51 mutations, suggesting that the enhanced mutability of the rud mutants is due to a REV3-dependent mechanism. The result of this genetic analysis of spontaneous mutation is hard to interpret because the effects ascribable to individual mutators or antimutators are rarely large, and vary considerably with test system studied, so that their overall effect on spontaneous mutation within the whole genome is likely to be slight. The normal products of these genes may be involved only peripherally in maintenance of fidelity,
214
CHRISTOPHER W. LAWRENCE
analogous to the effect of the mitochondria1 genome on nuclear mutation (Flury et al., 1976). Moreover, many of the yeast mutator genes exert their greatest influence at suppressor loci, or are active only at such sites, and although these loci may be unusually susceptible to spontaneous mutation, it is difficult in most cases to discount the possibility that the “mutator” gene is concerned more with the expression or selection of these mutations, rather than with their production. The spectrum of suppressor mutations that can be detected depends not only on the cytoplasmically inherited factor, $+, but can also be influenced by a variety of anti- and allosuppressor mutations as well as by mutations that prevent the maintainenance of the JI’ factor (Cox, 1971; Liebman et al., 1975; McCready et al., 1977). In addition, the suppressor mutations may alter the phenotype of the radiationsensitive mutation itself (see Table 11, suppressing the growth rate deficiency that several of them exhibit, leading to a selective enhancement of the frequency of suppressor mutations. The association between changed spontaneous mutability and radiation sensitivity, together with the rather large number of genes that appear to be involved in the control of spontaneous mutability, has led Hastings, von Borstel, and colleagues (Hastings et al., 1976; Quah et al,, 1980) to suggest that 90% or more of all spontaneous mutations are the consequence of the mutagenic repair of spontaneously occuring DNA lesions, rather than the failure to edit, or otherwise correct, replication errors. In addition, they specifically propose that there are at least two pathways for the misrepair of spontaneous damage and, making use of a model proposed by Brendel et al. (19701, that such damage can be “channeled” into these pathways, giving enhanced spontaneous mutation rates, if the first step of one of the error-free (or error-prone) pathways is blocked by a gene mutation: blocks at later steps are thought to trap lesions, probably leading to cell death rather than enhanced mutagenesis. This model is based on the assumption that substantially different sets of gene products are concerned in misrepair and the processes normally thought t o be responsible for the maintenance of nucleotide sequence, but this may not be the case. The involvement of “repair” enzymes in the control of spontaneous mutagenesis does not, therefore, necessarily imply that most spontaneous mutations are caused by DNA alterations functionally analagous to mutagen-induced lesions, though some may be. Depurination is thought to be a very common event under physiological conditions (Lindahl and Nyberg, 19721, but whether this is subject to RADG-dependent repair is not known. Similarly, there is at present very little evidence for the existence of a
MUTAGENESIS IN
S. cereuisiae
215
non-RAD6 misrepair pathway, which was postulated because rad61 is a weak mutator, rather than strong antimutator, gene. The suggestion that such a pathway must nevertheless exist because RAD6dependent processes produce mostly transitions is not supported by the evidence cited by Hastings et al. (1976) and von Borstel and Hastings (1977); rad6 mutants appear to be deficient in the induction of all types of mutations (see Section 111,A).Finally, the distinction between additive and synergistic interactions in double mutants, from which the concept of “channeling” is derived, is difficult to establish experimentally (compare, for example, the data of Game and Cox, 1973; Cox and Game, 1974; Brendel and Haynes, 1973; Lawrence et al., 1974; Game and Mortimer, 1974; Lawrence and Christensen, 1976; McKee and Lawrence, 19801, and the idea is open to question theoretically. In view of the rather small effect that the radiation-sensitive mutations have on spontaneous mutation rates, it seems likely that their influence is rather peripheral and indirect, perhaps by altering the efficiency of the normal set of editing enzymes. The growth rate of several mutants, such as those containing rad6, radl8, or rad52 mutations, is often slower than normal, implying that these loci are involved in normal growth processes. Liebman et al. (1979) have investigated a mutator gene with properties of a kind rather different from those described above. This gene, called DELl, occurs as a spontaneous variant in several strains, is closely linked t o the CYCl locus and specifically produces high frequencies of multisite mutations encompassing the CYCl , RAD7, and OSMl gene cluster that have been shown to be physical deletions (S. W. Liebman, personal communication). DELl appears to be both cis and trans dominant, does not seem to produce deletions at other genetic sites, and increases the spontaneous mutation rate of cycl deletions by a factor of more than lo4. The mutator effect of DELl is not influenced by temperature (23 to 37°C) and is not dependent on the function of the RAD52 gene (Liebman et al., 1980). There is some preliminary evidence that the rad6-1 mutation may lower the CYCl mutation rate in DELl strains, though rad9-1 has no effect (K. Downs and S. W. Liebman, personal communication). The authors point out that DELl shares features in common with transposable elements in maize and E . coli. It is possible that deletion occurs by excision at sites containing one of the repetitive (and highly mobile) Tyl or 6 sequences of the kind described by Cameron et al. (1979). A different kind of transposable element, carrying the his4C gene, has also been found to possess a powerful and general mutator action (H. Greer, personal communication). A wide spectrum of auxotrophic
216
CHRISTOPHER W. LAWRENCE
mutations are produced at frequencies of about 1 x lo5, many of which cannot be reverted by UV light. B. MUTATIONRATESDURING MEIOSIS Magni and von Borstel have reported that the spontaneous rate for some, though not all, mutations is higher during meiosis than mitosis by factors that vary between 3- and 30-fold. Increases were described for forward mutation to canavanine resistance, for reversion of met2, arg8, hisl, and thr4-1 alleles, and for the production of ochre suppressors but not for locus revertants of the ochre alleles lysl -1, his52, ade2-1, and trp5-2 (Magni and von Borstel, 1962; Magni, 1963a,b, 1964, 1969; Magni et al., 1966; Magni and Puglisi, 1966). The frameshift allele his4-519has also recently been stated to show the “meiotic effect” (Panzeri et al., 1979). It was proposed that mutations arising during meiosis are predominantly of the base-pair addition and deletion type, because their production appears to be associated with outside marker recombination, but this is unlikely to be exclusively the case. Ochre suppressors, a major class believed to show the “meiotic effect,” generally arise by base-pair substitution at the anticodon site of the tRNA loci (Piper et al., 1976; Goodman et al., 1977). Esposito et al. (1975) have reported that spo7-1, a temperature-sensitive mutation that blocks sporulation and premeiotic DNA synthesis at the nonpermissive temperature, is an antimutator for suppressor mutations (see Table 6) and, therefore, suggest that the SP07 gene product may be involved in the “meiotic effect.’’ Although these experiments show that more mutations are found during meiosis than mitosis, the work of Manney and colleagues (Whelan et al., 1979; Gocke and Manney, 1979) suggests that this may depend, a t least in some cases, on incomplete detection of mutations during mitosis. Using conditions that had been shown to maximize mutant expression, these authors found very similar rates of spontaneous mutation to canavanine resistance in mitotic and meiotic cultures. Significantly, the values for their mitotic rates were very close to Magni’s meiotic rate. High mitotic rates have also been found by Gottlieb and von Borstel (1976) and by Maloney and Fogel (cited in Whelan et al., 1979). Incomplete expression of spontaneous mutations is likely to be as general a problem as it is with induced mutations (Zimmermann et al., 1966; Brusick, 1970; Kilbey et al., 1978). In addition to these studies, Machida and Nakai (1980) have examined spontaneous reversion of the ochre alleles arg4-17 and l y s l 1, of the nonsuppressible mutations leu1 -1 and hisl -1, and of the
MUTAGENESIS IN
S. cereuisiae
217
frameshift allele his4619 in diploid cells maintained for varying times in sporulation medium. The spontaneous reversion frequency of all but one of these alleles was entirely unchanged over a period in which the frequency of spontaneous recombination increased by two orders of magnitude. The remaining mutation, hisl-1, showed a 3-fold increase in reversion frequency, but this occurred prior to the increase in the number of recombinants. Since the two ochre alleles reverted exclusively by suppression and his4-519 is a frameshift mutation, such data provide no support for the conclusions of Magni and colleagues, and the status of the “meiotic effect” hypothesis remains uncertain. Apart from these studies of point mutagenesis there is circumstantial evidence that suggests that large CYCl deletions may occur more frequently during meiosis than mitosis (Sherman et al., 1975). Such mutations are usually rare, none being found in 353 spontaneous and induced cycl mutants (Sherman et al., 1974). Numerous spontaneous multisite mutations, presumably deletions, were nonetheless found in the meiotic progeny of certain diploids. It cannot be ruled out that a mutator, similar but not identical t o DELl (see previous section), was responsible for these mutations. V. Mitochondria1 Mutagenesis
The extent to which induced and spontaneous mutagenesis within the mitochondria1 genome depends on the same processes and the same gene products as used in comparable activities in the nucleus is not yet known, though the marked dissimilarities between the two genomes with respect to structure, multiplicity, and repair suggest that at least some differences should exist. The response of mitochondrial and nuclear genes to mutagens is qualitatively similar, at least as far as point mutations are concerned. Gross deletions and rearrangements of the kind responsible for the p- mutation (reviewed in Borst et al., 1977) appear to be much more common in the mitochondrial genome, however; as discussed in Section IV,B, nuclear mutations are very rarely of this type, with or without mutagen treatment, a difference that is probably too large to ascribe merely to the higher probability of detecting such changes in the nonessential mitochondrial genome. The properties of the mutants described by Moustacchi et al. (1975, 1976) and Johnston (1979a) and Foury and Goffeau (1979) are consistent with the view that at least some of the gene products respon-
218
CHRISTOPHER W. LAWRENCE
sible for induced and spontaneous mitochondrial mutagenesis are unique to those processes, and are not used in the nucleus. The five uvsp mutants isolated by Moustacchi et al. (1975) are no more sensitive to UV than the wild type, but are more sensitive with respect to the induction of petite mutations. Three of these strains were found to contain a single nuclear mutation, but two of them gave nonmendelian patterns of segregation for the uvsp mutations, and these were lost in po derivatives. Apart from these mutations, a variety of rad mutations have also been reported to influence the induction of petites by UV (Moustacchi, 1969, 1971). Pyrimidine dimers in mitochondrial DNA can be photoreactivated, but not removed by excision repair (Waters and Moustacchi, 1974; Moustacchi et al., 1975; Prakash, 1975), and often lead to extensive DNA degradation (Hixon and Moustacchi, 1978). Since the number of petite mutations induced by UV can be diminished by dark holding and various other kinds of treatment, Waters and Moustacchi (1974)have proposed that a nonexcision dark repair process, possibly depending on recombination, can act on damage in mitochondrial DNA, but there is no direct evidence for this activity. Johnston (1979a) isolated 14 mutations, located in one or another of two nuclear genes, which enhance spontaneous frequences of mutations resistant to erythromycin, oligomycin, and spiramycin by factors of up to 300-fold. The relative influence of the mutators varied with the particular drug used. Since resistance mutations of these kinds are commonly mitochondrial in origin, the mutators presumably enhance the frequency of spontaneous point mutations in the mitochondrial genome, but it cannot be ruled out that they were nuclear events. The mutators did not enhance the spontaneous reversion frequency of the nuclear mutations lys2 or hisl-7, however, and did in most cases increase the frequency of petites. As the author notes, these “mutators” may alter the number of mitochondrial genomes, their transmission or their expression, rather than the mutation rate per se, and the same may be true of the uvsp mutations studied by Moustacchi et al. (1975). Foury and Goffeau (1979) screened gamma-ray sensitive mutants for strains showing enhanced levels of spontaneous mutation in mitochondrial genes, and isolated five nonallelic nuclear mutations with this property that do not complement rad50 through rad57. Strains carrying g a m l , g a d , and gum4 mutations are only weakly sensitive to gamma-rays and show enhanced levels of spontaneous mutation to antibiotic resistance (erythromycin, oligomycin, diuron) and to the rho- condition. Strains carrying gum3 and gum5 are highly sensitive
MUTAGENESIS IN S .
cereuisiae
219
to gamma-rays, and exhibit more selective effects on spontaneous mitochondrial mutability, while g a d mutants also show enhanced levels of spontaneous mutation in a nuclear gene (met2). Although it was previously believed that the nuclear and mitochondrial genomes responded in a qualitatively different manner to mutagens, this no longer appears to be the case, at least as far as point mutations are concerned. Growth in the presence of high concentrations of manganese ions, for example, was originally thought to enhance the misreplication of mitochondrial genes selectively (Putrament et al., 19731, because the mitochondrial DNA polymerase is strongly inhibited by this cation (Iwashima and Rabinowitz, 1969). In support of this view, Putrament and colleagues (Putrament et al., 1973, 1975a,b, 1977; Prazmo et al., 1975) found that mutations resistant to erythromycin and chloramphenicol, as well as petite mutations, could be induced by this treatment. Later work by the same investigator (e.g., Ejchart and Putrament, 1979) suggests, however, that a substantial fraction of these antibiotic resistance mutations were induced in nuclear genes, implying that manganese is also an effective nuclear mutagen. Only Mn", among 11 divalent cations tested, was mutagenic and this property could be reversed by high concentrations of magnesium ions or by hydroxyurea. Conversely, mutagens such as UV, MMS, DEB, and NA, that were previously thought to act only on the nuclear genome have now been shown t o produce mitochondrial point mutations (Ejchart and Putrament, 1979; Polakowska and Putrament, 1979; Baranowska and Putrament, 1979). UV produced mitochondrial and nuclear mutations at roughly comparable frequencies, but the other mutagens induced mitochondrial mutations only at high doses, which killed 90% or more of the cells. In spite of the qualitative similarity in the response of the two genomes to these mutagens, the mitochondrial genome is probably less susceptible quantitatively, even to UV. Even though such a comparison is difficult to make, this conclusion seems to be indicated by the fact that there are many more copies of the mitochondrial than the nuclear genome, and that pyrimidine dimers are not removed by excision from mitochondrial DNA. It would be interesting to determine whether the induction of mutations in mitochondrial DNA with these mutagens depends on the functions of such genes as RAD6 and REV3. Although these chemical mutagens seem to act on both genomes, the mutations induced by thymidylate deprivation appear to occur principally or exclusively in the mitochondrial genome (Barclay and Little, 1978). Incubation of a dTMP auxotroph, carrying the tmpl-6
220
CHRISTOPHER W. LAWRENCE
allele, in the absence of thymidine monophosphate produces higher than normal frequencies of mitochondria1 drug resistance mutations (erythromycin resistance) and also petites, while prolonged incubation results in virtually all surviving cells being po. None of the nuclear mutations tested (ilul-92, hisl-7, trp5, Zysl) was reverted by this treatment. VI. Mechanisms of Induced Mutagenesis
A direct attack on the problem of the mechanisms of induced mutagenesis in yeast, and its enzymology, has not yet been attempted, but a variety of indirect approaches have been used to provide information that is pertinent to this issue. These include investigations into the question of when mutations occur during the cell cycle, particularly in relation to the DNA synthetic period; studies of the causes responsible for the production of pure mutant clones; estimation of the frequency of untargeted mutagenesis and examination of its causes; investigations into the question of whether mutagenic processes depend on inducible activities; and analysis of dose-response kinetics.
A. TIMEOF MUTATION INDUCTION 1 . UV Mutagenesis The question of the stage during the cell cycle at which UV-induced mutations are produced has been investigated by James, Kilbey, and colleagues in a series of experiments which make use of mitotic pedigree analysis (James and Kilbey, 1977; James et al., 1978; Kilbey et al., 1978; Kilbey and James, 1979). Such timing is inferred from the segregation pattern of induced mutants among the two pairs of sister clones that are produced when a UV-irradiated G, diploid is allowed to undergo two consecutive rounds of cell division. In a pedigree containing a single induced mutation, three basic patterns can be found; all four clones contain the mutation (2-strand mutation), the members of only one of the two pairs of sister clones contain the mutation (l-strand mutation), or only one of the four clones contains the mutation (“delayed mutation”). It is inferred that 2-strand mutations arose in the G, period immediately following UV treatment by a process that involved heteroduplex repair. One-strand mutations were produced either in G , (without heteroduplex repair) or in G, (with heteroduplex repair). “Delayed” mutations were produced either
MUTAGENESIS IN
S . cereuisiue
22 1
in G, (without heteroduplex repair) or in the following G, (with heteroduplex repair). The occurrence of mutations in later cell generations is also indicated when one of the clones is mixed mutant/wild in composition. Mutations were detected by sporulating samples of cells from each of the four diploid clones, and examining the meiotic products for the presence of recessive lethals (the largest class scored), temperature-sensitive mutations, auxotrophs, growth rate mutations, and morphological mutations. Using this technique, it was found that mutations induced in a wild-type strain were exclusively 2-strand or l-strand, the relative proportion of I-strand mutations increasing at a higher fluence, and that no delayed mutations were induced (James and Kilbey, 1977). In excision-deficient strains carrying the rudl-1 allele, on the other hand, virtually no 2-strand mutations were found and there was a corresponding increase in the proportion of “delayed mutations (James et al., 1978; Kilbey and James, 1979). If it is assumed that heteroduplex repair is a highly efficient process in both excision-deficient and proficient strains (see later section), these results imply that mutations can be produced no earlier than the G, stage in excision-deficient strains, even though a high proportion of those induced in a wild-type strain are produced in GI, particularly at low fluences (>go% survival). This interpretation is supported by the observation that restricting residual growth, and hence the progress of G, cells into Gz,on UV-irradiated plates reduces the yield of induced mutations in an excision-deficient strain, though not in a wild-type, and that the division-dependent mutations are strongly photoreversible (Kilbey et al., 1978). Support for this view has also been obtained from experiments which examine UV-induced mutation from cdc to CDC’ at the nonpermissive temperature in excision-proficient and deficient strains ( J . Henriques and E. Moustacchi, personal communication). The authors conclude that their data support a dimer/gap model of UV mutagenesis, similar though not identical to that proposed for E . coli (see Witkin, 1976), in which mutations occur during error-prone gap-filling on dimer-containing templates. They propose that although the formation of the dimer/gap structure in the G, cells of excisionproficient strains requires two dimers, one in each complementary DNA strand, only one is required to generate this structure in the G, chromatids of excision-deficient cells. The proposal that two dimers are normally required to initiate the formation of each mutation in RAD’ strains, even though only one is needed in the absence of excision, was based on data indicating that the yield of arg4-17 revertants induced by UV was proportional to (fluence)’ in the wild-
222
CHRISTOPHER W. LAWRENCE
type, but directly proportional to fluence in a radl-1 excision-deficient strain (Kilbey et al., 1978). A necessary requirement for two dimers/ mutation in wild-types as proposed for E . coli does not seem likely in yeast, however, since other investigators find linear kinetics for the induction of forward mutations in such strains, that is for events more closely analogous to those detected in the pedigree analysis than the arg4-17 revertants (Eckardt and Haynes, 1977a). Moreover, it is clear that a variety of factors can influence the shape of dose-response curves (see Section V1,E). Contrary to what is believed to be the usual case in E . coli, however, it is evident that a single dimer can initiate the production of a mutation in yeast. Kilbey and James (1979) have not only demonstrated the induction of “delayed” mutations and mixed clones in excision-deficient diploids, but have also shown that their frequency can be greatly reduced by photoreactivation treatment during the second GI period following UV irradiation. The authors suggest (James et al., 1978) that this capability of persistent dimers to initiate mutagenesis in later cell generations implies either that error-prone processes remain induced for a long period or, more probably, that they are not inducible in yeast. Although this may well be true, it is difficult to rule out the possibility of periodic reinduction.
2 . NG Mutagenesis Two groups of investigators have examined the possibility of establishing the sequential order of individual gene replication in yeast by delivering short NG treatments to fractionated or synchronously growing cultures, in an analogous manner to the “replication fork mutagenesis” experiments carried out with prokaryotes (Burke et al., 1975; Burke and Fangman, 1975; Kee and Haber, 1975). A third group has used a similar technique to determine the stages during which nuclear and mitochondrial genes are replicated (Dawes and Carter, 1974). Each of these investigations indicates that most nuclear genes are about 10 times as susceptible to NG mutagenesis during a certain period that is probably located within the S-phase, as at other stages, although the work of the first two groups shows that non-S-phase stages are nevertheless responsive to the mutagen treatments. Dawes and Carter (1974) claim that mitochondrial genes are particularly susceptible late in the cell cycle, but their results barely reach statistical significance and the absence of control values makes them hard to evaluate. The experiments of Burke and Fangman (1975) and Kee and Haber (1975) both show that different loci reach peak sus-
MUTAGENESIS IN
S . cereuisiae
223
ceptibility a t different times during S-phase, consistent with the occurrence of “replication fork” mutagenesis, but find different relative timing for the two loci that they studied in common. Both sets of results imply that different replicons initiate DNA synthesis at different times during the S-phase, even in a single chromosome, and that relication of one chromosome takes an appreciable fraction of the whole S-period. Further evidence in favor of this model has been obtained by Dawes et al. (1977), who find that reversion at a given locus is often accompanied by mutation at one or other of a set of unlinked loci that is unique to that particular reverting locus. As pointed out by Kee and Haber (19751, however, all these data could equally well reflect a variety of other periodic activities, such as Sphase repair. It would be interesting to carry out these experiments in rad6 mutants, in order to examine the possibility that NG-induced S-phase mutations are the consequence of a misreplication process, while those induced at other stages result from misrepair. The experiments of Prakash (1974) do not bear on this problem because stationary phase cells were used.
B. FORMATION OF PUREMUTANTCLONES In spite of the duplex structure of DNA, it has frequently been observed that a high proportion of the mutations induced by a variety of mutagens are detected in pure, or nonsectored, clones (Nasim and Auerbach, 1967; Hannan et al., 1976; Eckardt and Haynes, 1977b; James and Kilbey, 1977). Unless survival is reduced to low levels, no more than a small proportion of these pure clones can be ascribed to lethal sectoring, that is to the death of a nonmutant daughter cell, a conclusion that is unambiguously demonstrated for UV by the pedigree analysis of James and Kilbey (1977). Since mutations are likely to be initiated in only one of the two DNA strands, these observations show that yeast cells possess efficient mechanisms for heteroduplex repair, similar to those that correct mismatched base-pairs in bacteria (Spatz and Trautner, 1970; Wildenberg and Meselson, 1975). The phenomenon of gene conversion in yeast also requires the existence of such a mechanism, but it is not known whether mutagenesis and recombination make use of the same process. Although heteroduplex repair might be accomplished by excision and resynthesis of the kind used to remove pyrimidine dimers, the results of James and Kilbey (James et al., 1978; Kilbey and James, 1979) showing that such repair takes place efficiently in excision deficient radl-1 strains imply that the two processes cannot be en-
224
CHRISTOPHER W. LAWRENCE
tirely identical. An upper limit of about one-third to the proportion of first generation mismatches left uncorrected is provided by the fraction of second generation mutations resistant to photoreactivation treatment, delivered during the second G , period after UV irradiation. However, the occurrence in photoreactivated cultures of substantial frequencies of mutations segregating in the third and subsequent generations indicates that virtually all of the second generation mutations resistant to photoreactivation must in fact have arisen from dimers, presumably in the second generation itself. It therefore appears that virtually all of the mismatches are corrected shortly after they arise. Eckardt et al. (1980) also have evidence that heteroduplex repair occurs efficiently in excision-deficient strains. It is not known whether heteroduplex repair in yeast preferentially corrects in favor of the information residing in conserved strands, based on such features as the undermethylation of nascent DNA chains, as proposed for E . coli (Wagner and Meselson, 1976). Methyl cytosine, though not methyl adenine, has been detected in nuclear DNA from yeast (Hattman et al., 1978). As noted by Kilbey and James (19791, heteroduplex repair in the absence of dimer excision may imply that the induced mutations are untargeted, that is, do not occur at the site of the dimer. Other evidence (see below) indicates that a significant proportion of UV-induced mutations are in fact untargeted, but an alternative model for heteroduplex repair (James et al., 1978), in which single strand mutations are introduced into a sister chromatid by recombination, is also possible. C. UNTARGETED MUTAGENESIS It is commonly assumed that all but a very small proportion of UVinduced mutations, like those induced by specific chemical mutagens, are produced at the site of the causal lesion and, therefore, constitute what Witkin and Wermundsen (1979) have called "targeted" mutations. Circumstantial evidence of a variety of kinds (Lawrence and Christensen, 1978c, 1979~;Kilbey and James, 1978) suggests, however, that UV irradiation may in fact produce a significant frequency of untargeted mutations, a suggestion that is supported by the results from a recent series of experiments designed specifically to estimate the relative proportions of targeted and untargeted mutations in yeast (Lawrence et al., 1981). These results indicate that a major consequence of UV-irradiation is a substantial reduction in the fidelity with which undamaged is DNA synthesized or maintained. In these experiments, which are conceptually similar to the recom-
MUTAGENESIS IN
S . cereuisiae
225
bination experiments of Fabre and Roman (19771, an irradiated excision-deficient haploid carrying a nonrevertible deletion of the C Y C l locus is mated with an unirradiated excision-deficienthaploid carrying a revertible cycl point mutation, and the diploids examined for the presence of CYCl locus revertants. Reciprocally irradiated and control matings are also made. Irradiating the deletion strain provides an estimate of the frequency of untargeted mutations (actually an underestimate, because the end points of the deletion lie at some distance from the site of reversion), while irradiating the point mutant provides an estimate of the total frequency of both targeted and untargeted mutations. Two deletions were used, one (cycl-383) with end points much nearer to the site of reversion than the other (cycl-363), and two point mutations, the ochre allele cycl -91 (identical to cycl-9) and the proline missense allele cycI-152 (identical to cycl-115), in all combinations with the two mating types. Initial experiments with these eight crosses, in which low cell densities were plated to encourage residual growth and thus mutant expression, showed that about as many mutations were induced by irradiating the deletion strain as the point-mutant. It is difficult in these circumstances, however, to exclude the possibility that the induced mutation frequencies were inflated by the occurrence of spontaneous mutations on the plate. Subsequent experiments, in which residual growth was restricted to between three and five cell generations by plating higher cell densities, suggest that the proportion of untargeted mutations is unlikely to be less than 40%. Since unexcised dimers probably have the capacity to cause mutations in later cell generations (James et al., 1978; Kilbey and James, 19791, this is likely to be an underestimate. These untargeted mutations appear to result from the normal mutagenic process; their production requires the function of the RAD6 and REV3 genes, and their induction kinetics are also very similar, except at high fluences. At high fluences, mating experiments give higher survival and lower mutation frequencies, perhaps due to the rescue of the irradiated by the unirradiated cells. Untargeted mutagenesis appears to be reduced in excision-proficient strains, but this is probably an artifact caused by preferential excision of dimers from the deletion genome during mating: although mutations can be produced promptly following UV treatment of the point mutant, dimers in the deletion genome can only produce mutations after cell or, more probably, nuclear fusion. High frequencies of untargeted mutations are also induced by ionizing radiation. Although the issue is not yet entirely settled, it does not appear likely that untargeted mutations are produced in these mating ex-
226
CHRISTOPHER W. LAWRENCE
periments as a consequence of the introduction of dimers into the unirradiated chromosome X, bearing the cycl point mutations, by recombination with the irradiated chromosome X, bearing the cycl deletion, followed by some kind of “long patch” error-prone repair. The proportion of untargeted mutations is not reduced in experiments with strains that contain the rad52-1 mutation, and are therefore recombination deficient (Lawrence et al., 1981). The results from mating experiments in which one of the strains carries the karl-1 allele, a mutation that prevents nuclear fusion in the zygote (Conde and Fink, 1977),provides little support for the alternative model, however, in which the presence of damage in the deletion genome leads to the formation of a diffusible agent (such as inducible error-prone repair enzymes) capable of inducing mutations in any chromosome. In these experiments, irradiating the deletion strain induced very few mutations, although many were induced by irradiating the point mutant, indicating that efficient untargeted mutagenesis depends on nuclear fusion rather than the coexistence of the two nuclei in a common cytoplasm. The proportion of untargeted mutations may, however, be underestimated in this type of experiment, since only the first of the haploid daughter cells in which mutations could be formed will have any cytoplasmic connection with the parental zygote. As shown by Kilbey and James (1979), a high proportion of the mutations induced in excision-deficient strains arise in subsequent cell generations, due to the inheritance of dimers, and such inheritance is precluded in the karl-1 type of experiments. Various pieces of circumstantial evidence also indicate that a significant proportion of UV-induced mutations in yeast are untargeted. As discussed in the previous section, Kilbey and James (1979) have shown that heteroduplex repair is very efficient in an excision-deficient strain, even though dimers are not removed, a result that suggests that at least some of the mutations are untargeted. Similar results have been found by Eckardt et al. (1980). Weak support for this view is also provided by the observation that UV-induced mutation frequencies are unrelated t o nucleotide sequence at, or near, the site of mutation (Lawrence ‘and Christensen, 1979~).The observation that only relatively few UV-induced mutations involve tandem double base-pair changes (Lawrence et al., 1974) is also consistent with this conclusion, since it has been argued (e.g., Witkin, 1976) that over half of the targeted mutations should be of this type. This argument may not be correct, however, and the true proportion may be much lower (see Section VII).
MUTAGENESIS IN
S. cerevisiae
227
D. INDUCIBILITY OF MUTAGENIC PROCESSES Since the available evidence relating to this issue is both circumstantial and conflicting, it is at present an open question whether the gene products responsible for mutagenesis in yeast exist constitutively or whether high levels of them are induced specifically in response to mutagen treatment. Haynes et al. (1979) have argued that the existence of linear dose-response kinetics for mutations induced by low fluences of UV reflects the presence of a substantial constitutive level of these gene products and that departure from linearity at higher fluences may be due to induction. In keeping with this interpretation, they find that cycloheximide treatment given to cells held for 3 days in nongrowth medium reduces the yield of mutations on the quadratic, but not the linear, part of the curve (Eckardt et al., 1978). Similarly, a split-dose experiment shows that the decline in mutation frequency during liquid holding is inhibited by cycloheximide (Eckardt et al., 1978). There was, however, little evidence for induction at the moderately high fluence used in the Karl-1 mating experiments discussed in the previous section, and this question clearly requires more attention.
E. DOSE-RESPONSE KINETICS In addition to their use in empirical descriptions of data, attempts have been made to interpret dose-response relationships in terms of a particular model of mutagenesis or of the number of lesions required to induce each mutation. The difficulties facing interpretations of this kind have been emphasized in particular by Auerbach and her colleagues (Auerbach, 1976; Auerbach and Ramsey, 1968; Auerbach and Kilbey, 1971); the yield of mutations observed is the net outcome not only of the interaction of mutagen with DNA, but also of the interplay of enzymatic recovery processes and of factors which influence the expression and detection of mutations, all of which may exhibit dosedependent effects. In keeping with such a complex etiology, dose-response curves of various kinds have been observed for mutation induction in yeast. Ionizing radiations often give linear dose-response kinetics, at least at low doses; at higher doses departures from linearity may occur (Mortimer et al., 1965; McKee and Lawrence, 1979a). With UV, linear (Eckardt and Haynes, 1977a,b; Lawrence and Christensen, 1978a,b; Kilbey et al., 19781, quadratic (Lawrence and Christensen, 1976,
228
CHRISTOPHER W. LAWRENCE
1978b; Kilbey et al., 19781, or biphasic curves (Eckhardt and Haynes, 1977a,b) have been found, depending on strain, mutation test system, and fluence range used. Quadratic dose-response curves have been found with EMS, NQO, and NG, while NIL and NA, the two mutagens that caused least lethality, gave linear responses (Prakash, 1974). A mathematical analysis of dose-response curves has been developed by Haynes and Eckardt (1979, see also Eckardt and Haynes, 1977a,b). It is unclear how this variation can be interpreted. Kilbey et al. (1978) have suggested that the quadratic kinetics that they observe for the UV-induced reversion of arg4-17 in an excision-proficient strain implies the need for two dimershevertant, while the linear kinetics observed in a radl-1 haploid indicates that only one dimer is required for this purpose in the absence of excision. As pointed out by Eckardt and Haynes (1977a), however, the occurrence of linear kinetics for the induction of other kinds of mutation in excision-proficient strains argues against any necessary and general requirement for two lesions. The difficulty of drawing general conclusions is also illustrated by a study of UV-induced reversion of arg4-17 in reu2-1 mutants (Lawrence and Christensen, 1978b). The yield of revertants was proportional to (fluence)' in REV2' strains, but directly proportional to fluence in the reu2-1 mutants, suggesting that the REV2' gene products in some way promotes the interaction of two otherwise nonmutagenic lesions to produce the revertants. Such an effect is limited to only some ochre mutations, however; the reversion of other ochre alleles, as well as all other types of mutation, is unaffected by the presence of the reu2-1 allele. VII. Conclusions and Comparisons with Other Organisms
Yeast cells are likely to possess a variety of molecular mechanisms for promoting fidelity during DNA synthesis and for conserving nucleotide sequence at other stages in the cell cycle. These are probably based on the properties of such entities as the DNA polymerases (one of which possesses an associated 3'-5' exonuclease; Chang, 1977) and associated holoenzyme factors, nucleases, glycosylases, DNA binding proteins, and heteroduplex repair enzymes, but little is yet known about such activities. Similarly, much remains to be learned about the way these mechanisms are modified, bypassed, or merely fail in mutagen-treated cells. The fact that the effectiveness of many mutagens in yeast depends on the presence of an active RAD6 gene product, a protein that is also essential for recovery or repair, perhaps
MUTAGENESIS IN
S. cereuisiae
229
indicates that modification or bypass of the fidelity-promoting mechanisms is an inherent part of recovery, as first proposed by Witkin (1967). However, it is difficult to exlude the possibility that mutagenesis merely takes place in cells undergoing RADG-dependent repair or recovery, and is not functionally intrinsic to these processes. If this type of repair is used only rarely, natural selection may have had little opportunity to improve its accuracy. These RADG-dependent repair or recovery processes do not appear to involve either excision or recombination, and may perhaps be analogous to the postreplication repair activities believed to occur in cultured mammalian cells. Analysis of DNA synthesized in mutagentreated mammalian cells, using alkaline sucrose gradient sedimentation or DNA fiber autoradiography, suggests that they can acquire the ability t o replicate their DNA past template lesions, initially effective barriers to chain elongation, with a much reduced delay (reviewed by Lehman and Bridges, 1977; Hanawalt et al., 1979). Similarly, the low-molecular-weight DNA initially synthesized in these cells is eventually incorporated into molecules of normal size. It is not yet clear whether one, or more than one, mechanism is responsible for these phenomena, or even if they are necessarily related to repair or recovery (Park and Cleaver, 1979). Whatever the case, mutagenesis in yeast is associated at best with only a small fraction of these repair activities. The extreme sensitivity of rad6 mutants appears to be due to their deficiencies with respect to error-free repair or recovery, of the kinds dependent on the RAD9 and RAD18 genes. Strains defective in processes that are probably much more closely related to mutagenesis itself, such as the reu and umr mutants, are much less sensitive and also sensitive to a smaller range of mutagens. It may also be significant that strains such as rud9 mutants, which appear to be deficient with respect to mutagenesis induced by some agents but not others, tend to be much more sensitive to the effective than the ineffective mutagens. Further, the mutational deficiencies in these strains are not commensurate with their sensitivities; reul, reu2, and rev3 mutants are about equally sensitive to UV or gamma-rays, for example, but have very different deficiencies with respect to UV or gamma-ray mutagenesis (Lemontt, 1971a; Lawrence and Christensen, 1978a,b, 1979a; McKee and Lawrence, 1979a,b). Similarly, UV mutagenesis is substantially reduced in umrl mutants, even though they are virtually wild-type with regard to resistance (Lemontt, 1977a; Tuite and Cox, 1980). Possibly the REV genes participate in both error-free and error-prone activities, but whatever the explanation it appears unlikely that there is
230
CHRISTOPHER W. LAWRENCE
a simple causal relationship between mutagenesis and repair or recovery. Such observations even question whether mutagenesis is an inherent and inevitable consequence of any of the repair or recovery mechanisms. One of the reasons for this lack of correlation may be that, in a formal sense, yeast appears to possess several at least partially independent mutagenic pathways. Various criteria can in fact be used to separate RAD6-dependent mutagenic activities into different, possibly interrelated, categories. First, some mutagens, such as UV and gamma-rays, produce appreciable numbers of untargeted mutations, while others, such as NQO, probably produce very few. The selective production of GC transitions and transversions by NQO presumably reflects selective attack on this base-pair and the formation of mutations at the site of damage, and the same is likely to be true of EMS, NA, and other similar mutagens. Second, the R E V l , REVZ, and REV3 gene products are needed for the induction of normal yields of mutations by UV, gamma-rays, and NQO, but not by EMS or NA (Table 4). These categories do not completely overlap the first ones, though in general the phenotypes of the mutants in the RAD6 epistasis group suggest some kind of distinction between the physical and nonspecific mutagens on the one hand, and the specific mutagens on the other (Prakash and Sherman, 1973; Lawrence and Christensen, 1976; Prakash, 1976; McKee and Lawrence, 1979a).Third, even when attention is restricted to a single mutagen, such as UV or gammarays, mutations of different kinds appear to be produced by partially different processes (Table 5). Last, characteristically different patterns of base-pair substitutions are produced even by mutagens, such as UV and gamma-rays, that appear to be similar by the above criteria. For example, although a considerable variety of base-pair substitutions are functionally acceptable and can be detected at the cycl-9 site, over 85% of those induced by UV are the result of an AT to GC transition at the first position of the triplet, while ionizing radiation produces a wider range of substitutions (Stewart et al., 1972; Sherman and Stewart, 1974; Lawrence et al., 1974). Analogous, though different, results are found at the cycl -179 amber site (Stewart and Sherman, 1975). It is unlikely that these results merely reflect the preferential action of the two radiations on different target bases or base sequences, since the pattern of mutation varies considerably among different sites, particularly with UV; the frequency of identical substitutions varies by more than 50-fold at different genetic sites, even when they occur in identical sequences (Lawrence and Christensen, 197913. Moreover, substantial fractions of the mutations are probably
MUTACENESIS IN S.
231
cereuisiae
untargeted (Section VI,C). It is not yet known whether these categories are interrelated, or how many pathways they may represent. Clarification of this issue will probably require the study of a wider range of rev-like mutations; there is no reason to believe that these have yet been exhaustively isolated. Whatever their number, each of the mutagenic pathways in yeast appears t o produce more single than multiple base-pair alterations within the cycl locus, though the proportion of multiple changes is not insignificant and some variation also probably occurs in their frequency depending on mutagen or type of alteration studied (Table 7). Apart from the selective production by UV of a high frequency of tandem double base-pair substitutions at the unique cycl -115 site (Sherman and Stewart, 19781, multiple substitutions are rarely detected among the revertants induced by any mutagen at other sites, though ionizing radiation may produce more than the others. Multiple alterations are rather more common among frameshift revertants, however, occurring in 20% of the cases, and again ionizing radiations may produce more than the other mutagens, though the samples are too small to establish this rigorously. At least part of this difference TABLE 7 Number of C Y C l Revertants Containing Multiple Base-pair Alterations",b Mutant allele Type
+A
-G
Number
cycl-183 cycl-I34 cycl-239
Ionizing radiation
UV
NA
Other'
Total
5 (40)
2 (135)
1 (54)
1 (63)
5 (21)
1 (12)
2 (14)
6'(21)
14 (68)
2 (7)
3 (10)
0 (7)
g(13)
11 (37)
7 (28)
4 (22)
2 (21)
12 (34)
25 (105)
9 (292)
"Data compiled from Sherman and Stewart (1973), Stewart and Sherman (1973), Sherman and Stewart (19741, and Stewart and Sherman (1974). * Total number of revertants analyzed in parentheses. Mutations induced by EMS, MMS, NIL, NG, or HN,, or occurring spontaneously. Includes one tandem double substitution. ' Includes four spontaneous multiple alterations. 'Includes four multiple alterations induced by HN,.
232
CHRISTOPHER W. LAWRENCE
between substitutions and frameshift events must be due to the detectability of multiple alterations. Although virtually all amino acid substitutions are probably acceptable at or near the cycl-9 site, and most at or near the cycl-179 site (see Sherman and Stewart, 1973), functional limitations are likely to occur in other regions, such as that of the cycl-2 mutation, which is near the heme attachment site. Moreover, ambiguity of the code prevents the detection of a number of multiple substitutions. Fewer restrictions probably occur with frameshift events, and more multiple changes are detectable. As pointed out by Sherman and Stewart (1973), the alterations in the multiple substitutions are clustered, suggesting that they have a common origin in one mutagenic event, and the same appears to be true in frameshift reversion. Most of the concomitant alterations occur within a region of 10 nucleotides or less, so that mutagenic enzymes may act on a region of about this size. One of the cycl-9 revertants induced by UV represented a tandem double substitution, but as this occurs in a purine-pyrimidine sequence it cannot be the consequence of a targeted mutation at the site of a pyrimidine dimer. No tandem double substitutions were found among the 23 revertants resulting from substitutions within the pyrimidine-pyrimidine sequence at the second and third positions of the cycl-9 triplet, suggesting that the frequency at this site cannot be very high. Five out of nine of the possible types of tandem double substitutions can be detected at this site. The absence of tryptophan insertions is particularly significant. Transitions are about seven times more abundant than transversions among UV-induced mutations (Lawrence and Christensen, 1979~1,and tryptophan codons are the consequence of a double transition, the type of event found at the cycl -115site (Sherman and Stewart, 1978). Unless the cycl-9 and cycl-179 alleles are highly atypical in this respect, the average frequency of tandem double substitutions induced by UV is unlikely to greatly exceed 5-10%. Moreover, the occurrence of a similar event among the revertants of cycl-179 induced by ionizing radiation suggests that they are not unique to UV, though such small numbers do not allow any statement to be made about relative frequencies. The diversity of mutagenic pathways, suggested by the phenotypes of the rev mutations and other data discussed above, presumably reflects the diversity of molecular processes during which mutations could arise, of which there are at least three general types. First, if yeast possesses a DNA polymerase holoenzyme complex of the kind described in E . coli (reviewed by Kornberg, 19801, different presumably nonessential factors may combine with the core polymerase to
MUTAGENESIS I N
S. cereuisiae
233
stabilize its binding to DNA, or enhance its fidelity of base selection, translocation or its excision of noncomplementary nucleotides. Second, noncomplementary bases are probably also excised from replicated DNA (heteroduplex or mismatch repair, Section VI,B) and various factors may modify this process. Finally, yeast cells may possess mechanisms for inhibiting the unregulated activity of such enzymes as terminal deoxynucleotidyl transferases (cf. Witkin, 1967) or glycosylases and insertases (Linn et al., 1978). It is not known which, or how many, of these systems for conserving nucleotide sequence is modified, shut off, or breaks down in mutagen-treated cells. Although the nature of the mutagenic processes is not known, the data of James and Kilbey (1977; James et al., 1978; Section VI,A) suggest that those present in UV irradiated cells act during the filling of gaps, created by excision or by the replication of lesion containing DNA. Several features of the yeast data discussed above resemble analogous results from E . coli, but there appear to be two major differences between these organisms: recombination-dependent repair and mutagenesis are regulated separately in yeast, at least as far as radiations are concerned, rather than coordinately as in E. coli, and the action of certain chemical mutagens, such as EMS and NG, is substantially RecA independent in the bacterium, but RADG-dependent in yeast. Apart from the differences in regulation, recombination-dependent repair may also act on somewhat different sets of substrates in the two species. In E. coli, it appears to be concerned principally with the filling of daughter-strand gaps (Rupp and Howard-Flanders, 1968; Rupp et al., 1971) and accounts for a substantial fraction of the UV resistance due to the RecA gene. In yeast, however, recombinationdeficient mutants like rad52 or rad51 are either UV resistant, or only slightly UV sensitive (Resnick, 1969; Nakai and Matsumoto, 1967) even though deficient in UV-induced recombination (Game et al., 1979; Prakash et al., 1979) and these genes seem t o be concerned principally with the repair of double-strand breaks (Resnick and Martin, 1976; Ho, 1975). Such observations are consistent with results from higher eukaryotes; evidence from experiments with mammalian cells (reviewed by Lehman and Bridges, 1977, and by Hanawalt et al., 1979) suggests that few UV-induced daughter strand gaps are filled by a recombination-dependent mechanism of the kind proposed by Rupp and Howard-Flanders (1968). Similarly, dimer-containing parental sequences are only rarely transferred to newly synthesized DNA chains in these cells, a feature of postreplication repair that yeast appears to share (Resnick and Cox, personal communication). These results tend to argue against the possibility that the apparent sepa-
234
CHRISTOPHER W. LAWRENCE
ration of the two pathways is merely the consequence of the failure to identify or isolate yeast mutations analogous to recA, though this cannot yet be ruled out. It should also be noted that the observations of Jachymczyk et al. (1977) and Prakash and Prakash (1980) may imply that the two pathways might not be separate for the repair of damage induced by some alkylating agents. Although the activities carried out by the RecA and RAD6 pathways do not appear to be the same, they nevertheless share in common the feature that in each of them mutagenesis is associated at best with only a very small fraction of recovery or repair. In E . coli, doublemutant strains carrying recB and recF alleles are as sensitive to UV as recA mutants in both excision proficient and deficient backgrounds, but show normal UV mutability (Kato et al., 1977). Similarly, the reu-like umuC strains (Kato and Shinoura, 1977) and those carrying the probably allelic uum mutations (Steinborn, 1978, 19791, are only slightly UV sensitive, and umuC mutants show no detectable deficiency with respect to postreplication repair of UV damage (Kato, 1977), even though deficient in UV-induced mutability. It has not yet been settled whether this minor fraction of RADGdependent activities in yeast is constitutive or not, but a variety of evidence (reviewed by Witkin, 1976) suggests that RecA -dependent bacterial mutagenesis requires de nouo protein synthesis and is associated with the inducible process responsible for Weigle-reactivation of phage. According to the SOS-repair hypothesis (Radman, 1974; Caillet-Fauquet et al., 1977; Villani et al., 19781, this inducible errorprone recovery reflects an acquired ability to replicate past pyrimidine dimers, or similar nonpairing template lesions that initially block chain elongation, by a process that frequently inserts incorrect bases at the site of the lesion. The specific proposal that DNA chain elongation is blocked as a consequence of polymerase associated proofreading activity, and that the subsequent error-prone replication is due to inhibition of this activity, no longer appears likely. In uitro experiments with purified polymerase lacking the 3'-5'exonuclease function suggest that the polymerase itself is unable to replicate past such damage, since the DNA chains replicated by these enzymes on mutagen-treated templates terminate just before potential sites for lesions (Moore and Strauss, 1979; Moore et al., 1980). It is also unlikely that SOS-repair is responsible for more than a small part of UVinduced Weigle reactivation. Much of this recovery appears to be errorfree and depends on excision repair, since it is substantially reduced in excision-deficient strains and can be completely blocked in uurA recF, uurB recF, and recF recL strains, all of which permit normal
MUTAGENESIS IN
S. cereuisiae
235
levels of bacterial mutagenesis (Kato et al., 1977; Rothman et al., 1979). The mechanism responsible for mutagenesis induced by such agents as EMS and NG appears to constitute a second major difference between the two species. In E. coli, the action of these mutagens is substantially RecA and LexA independent, particularly at low dose levels (Witkin, 1967; Kondo et al., 1970; Ishii and Kondo, 1975), and is therefore believed to depend on misreplication, a conclusion that is also supported by the observation that EMS and NG induce GC to AT transitions with high specificity (Coulondre and Miller, 1977b). The mutagenic effectiveness of high doses of these mutagens appears to be partly LexA dependent, however, since at these dose levels lexAmutants may produce less than 20% of the yield of mutations characteristic of LexA' strains (Jeggo et al., 1977; Schendel et al., 1978). Moreover, NG has been shown to be weakly capable of inducing Weigle-reactivation and Weigle-mutagenesis (Schendel et al., 1978; Defais et al., 19801, so that some of the mutations induced by high doses of NG may be the result of error-prone repair. Part of the decrease in the effectiveness of high doses of NG or EMS in ZexAstrains also appears to be due to enhanced error-free repair, carried out by the adaptive response (Defais et al., 1980); LexA- strains lacking this inducible, error-free mechanism for the removal of 06-alkyl adducts ( a & - mutants) produce more normal frequencies of mutations (Jeggo, 1979). Even though high doses of alkylating agents may require RecA function for full effectiveness, taken as a whole these results are in striking contrast to those found with yeast. Qualitatively similar specificity has been inferred for the mutagenic action of NG and EMS in this organism (Prakash and Sherman, 19731, implying that they are also misreplication mutagens in yeast, but such misreplication appears to be completely under RAD6 control (Prakash, 19741, at least in cells treated in stationary phase. Possibly the replication complex in yeast, or some other mechanism for maintaining fidelity, discriminates far more stringently against template defects than comparable activities in E . coZi, and the RAD6 function reduces this stringency in some way. Such relaxation of stringency might be necessary to permit replication of lesion containing DNA. Alternatively, RAD6-dependent functions might interfere with an exceptionally efficient mechanism for the error-free repair of alkylated bases, in an analogous way to the interference between the RecA gene product and the adaptive response repair in E. coli (Defais et al., 1980). As shown by a comparison between the data obtained by Sherman, Stewart, and colleagues from the CYCl locus of yeast and those of
236
CHRISTOPHER W. LAWRENCE
Miller and colleagues from the ZacI gene of E . coZi, the mutagenic processes in these two organisms generally produce qualitatively similar spectra of mutations. NG, EMS, and NQO each mutate GC basepairs in the l a d gene with high selectivity, the first two mutagens almost exclusively producing transitions and NQO producing about 10% transversions as well as transitions (Coulondre and Miller, 1977b). Similar results are found at the CYCl locus (Prakash and Sherman, 1973, 1974; Prakash et al., 1974), though the existence of a hotspot at the cycl-131 site probably exaggerates the extent of selectivity. UV acts preferentially at sites containing adjacent pyrimidines within the l a d gene, transitions being induced on average from 12 to 18 times more abundantly at these sites than in sequences where purines and pyrimidines, alternate (Coulondre et al., 1978); the data given in Coulondre and Miller (1977a) and Farabaugh (1978) show that transversions are only about 3- to 4-fold more abundant, however. This point has not been examined critically at the CYCl locus, since only one of the 24 sites examined (Lawrence and Christensen, 1 9 7 9 ~ ) contained alternating purines and pyrimidines. Although UV was not detectably mutagenic at this site, other sites containing adjacent pyrimidines also shared this property, so that the significance of these results is hard to assess. A large variability in the UV-induced mutation frequencies within pyrimidine tracts is also found at the ZacI locus (Coulondre et al., 1978). About 2% of the lad mutations induced by UV, though not by any other mutagen, are detectably the result of tandem double base-pair substitutions (Coulondre and Miller, 1977b), a value that is quite similar to the overall frequency of such events detected at the CYCl locus (Table 71, though other mutagens also produce these changes in yeast. This class of mutation is of interest because they may represent misinsertion of bases opposite dimerized pyrimidines, that is, targeted mutations. The frequencies of these events may well be underestimated in both species, since only some of the tandem double substitutions can be detected with either system. Coulondre and Miller (197713) suggest that the true frequency probably exceeds 10% of all induced mutations, and cite data from the tryptophan 220 site, a particularly favorable codon for this purpose. Twenty-one of the nonsense mutations induced by UV at this site were amber alleles, the result of a single GC transition at the second position of the UGG codon, and three were ochre alleles, the consequence of a double transition at positions two and three. Thirty-nine opal alleles were also induced by UV at the tryptophan 220 site, but it cannot be determined whether these represent single GC transitions at the third position
MUTAGENESIS IN
S. cereuzszae
237
of the codon or tandem double events, with an additional substitution at the following AT base-pair in codon 221. Selecting a site at which tandem double mutations have been found may lead to an overestimation of their frequency, however. At the tryptophan 201 site, the other codon of this kind in the lad gene, UV-induced mutations included five amber, fourteen opal, and no ochre alleles (Coulondre and Miller, 1977a). These opal mutations may well represent single GC transitions, since the first position of the following histidine 202 codon is occupied by a CG base-pair (Farabaugh, 19781, resulting in a pyrimidine-purine sequence; as shown by Coulondre et al. (1978), most transitions induced by UV occur within pyrimidine-pyrimidine sequences of the kind found opposite the last two bases of the tryptophan codon. Combining these data, and bearing in mind that only one of three types of tandem double mutation can be detected a t these sites, it appears unlikely that the true frequency of these events can exceed 20% of all UV-induced mutations, a value that lies within the range observed in yeast; no double events out of 23 mutations at the second and third positions of the cycl-9 ochre codon, a site at which five of the nine possible double mutations can be detected, and a rather higher frequency a t the cycl-115 site, where all double events can probably be detected. It seems likely that the frequency varies at different sites. These frequencies appear to be substantially lower than those expected from random insertion of bases opposite dimerized pyrimidines; if each of the bases was equally abundant and inserted randomly, nearly 95% of all pyrimidine dimers would give rise to a mutation of some kind, and about 60% of these would be tandem double mutations. Several explanations for this disparity can be envisaged. The undetectable double events may be very much more abundant than the detectable ones. This does not seem very likely since the detectable double events are the result of transitions, the most common event induced by UV in both E . coli and yeast. The double substitution may be untargeted, and unrelated to misinsertion opposite pyrimidine dimers. The observation that UV produces them preferentially argues against this possibility, but since mutagen and site specificities of other kinds have been found, the argument is not entirely compelling. In the excision-proficient strains used for almost all the 2acI and CYCl studies, pyrimidine dimers may be responsible for only a small fraction of the induced mutations (Witkin, 1976). There is no direct evidence to support this view. Finally, base insertion opposite pyrimidine dimers may not be random. Evidence supporting this possibility is provided by an analysis of the data of Coulondre and Miller (1977a) and
238
CHRISTOPHER W. LAWRENCE
Farabaugh (1978) which shows that UV-induced transitions are five to six times more abundant than transversions in pyrimidinepyrimidine sequences, but about equally frequent in sequences where pyrimidines and purines alternate. If mutations in these sequences are targeted, these data strongly imply that some mechanism exists for base selection opposite dimerized pyrimidines, and suggest that the cumulative error-rate may be much less than the 95% expected from random insertion. If the bias in favor of the incorrect purine is taken as an estimate of the bias in favor of the correct purine, probably an underestimate rather than an overestimate if a specific baseselection mechanism exists, the proportion of double substitutions will only be about 35%, and the cumulative error-rate per dimer about 75%. Ambiguity of the code makes it difficult to determine from the ZacZ data whether such base selection is equally effective at each of the two base-pair sites. Base selection could either be achieved by modification of the dimer, or represent an inherent or acquired capability of the replication complex. Although hydrogen bonding between dimerized pyrimidines and their complementary purines seems to be prohibited in fully duplex DNA, it would be interesting to determine whether at least one correct base-pair could be formed in replicating DNA. Greater latitude for bond rotation may be possible in such a structure, due to the absence of the restraint imposed by adjacent hydrogen bonding on one side. Moreover, proteins may exist which encourage the formation of a suitable configuration. A major motive for studying mutagenesis and repair in eukaryotes is the possibility that some of the mechanisms that they employ for these processes may be different from those discovered so far in the prokaryotes, or at least that they may be organized and regulated differently, and as discussed above there is some evidence that this might in fact be the case. An additional motive is the belief that replication and repair may also be more accurate. The organization of the eukaryote genome into multiple replicons, each some 10 to 100 times smaller than the single E . coli replicon and within which DNA is replicated 10 to 100 times more slowly (Cairns, 1963; Huberman and Riggs, 1968; Petes and Williamson, 1979, would seem to offer more opportunity for the action of fidelity-promoting activities, and the existence of a prolonged GI and Gz period may also help in this respect. Moreover, the selection pressure to evolve efficient mechanisms that reduce the error-rate per base-pair may be greater in the larger genomes characteristic of eukaryotes. Definitive evidence supporting this idea has not yet been obtained, however, though some rather circumstantial evidence is at least consistent with this view.
MUTAGENESIS IN
S. cereuzsiae
239
UV-induced mutation frequencies, relative to the number of dimers induced in the genome, seem to be 10 to 100 times greater in excisiondeficient strains of E. coli than in comparable yeast strains, a difference that is large even if allowance is made for the fact that yeast cells contain four times more DNA than the bacterium. The problems of whether the mutational systems in the two species are comparable, of dosimetry, and of considerable strain variability with respect to induced mutation frequencies, make such data hard to evaluate, however. Drake (1974) has suggested that spontaneous mutation frequencies per base-pair replicated are also about 10-fold greater in bacteria than in the lower eukaryotes. Although Drake did not specifically list data for yeast, similar estimates using his method can be obtained from the data of Whelan et al. (1979) for the CAN1 locus and of Eckardt and Haynes (1977a) for six genes in the adenine biosynthetic pathway. These estimates of 4 and 4.5 x 10” detectable mutations per base-pair replication are close to Drake’s revised estimate for Neurospora (5.8 X l o - ” ) and are about 10 times smaller than the estimates for E. coli (4.0 x lo-’’). As pointed out by Drake, such values are undoubtedly underestimates, since many base-pair changes will not be detected, but the ratios of the values from different species are probably more meaningful. In view of this, the apparent absence of powerful mutator genes in yeast is somewhat surprising. The existence of such mutations in E. coli, that fairly generally enhance spontaneous rates of base-pair substitutions at a variety of test loci, encourages the belief that wild-type strains possess a number of nonessential gene products that considerably enhance the fidelity of base-selection during DNA synthesis, or otherwise enhance its accuracy (Cox, 1976). Although it is possible that such mutations potentially exist in yeast, but have yet t o be isolated, the absence of powerful mutators may also reflect the existence of several redundant mechanisms for enhancing fidelity, so that substantial and general increases in spontaneous mutation rate would only be found in strains containing several mutations. Drake (1977) has also drawn attention to the possible existence of a “misrepair trend,” an increasing localization of mutagenesis within repair rather than normal replication in the phylogenetic series represented by viruses, bacteria, and lower eukaryotes. As discussed above, the observation that a majority of mutagens appear to owe their effectiveness to RAD6 function in stationary phase yeast implies that these cells possess very sensitive means of discriminating modified bases potentially capable of mispairing as well as fast and effective means for their error-free repair. If this is at least partly the
240
CHRISTOPHER W. LAWRENCE
consequence of the activities of the replication complex, it appears likely that the distinction between the misreplication and misrepair modes of mutagenesis is more quantitative than qualitative, a conclusion that is also supported by the observations that NG can induce W-mutagenesis (Schendel et al., 1978; Defais et al., 1980) and insertion of bases opposite dimerized pyrimidines is not random. Rather than a clear distinction between “noninstructive” lesions (Witkin, 1976) which are entirely nonpairing and which elicit error-prone repair on the one hand, and potentially mispairing lesions which lead to misreplication on the other, it seems more likely that different types of lesions present a graded challenge to the replication mechanism and that the probability of error is in some way proportional to the disturbance in template structure. Such discrimination and fidelity may vary not only between organisms, but also between cells in different physiological states, including the presence and extent of repair activities.
ACKNOWLEDGMENTS Some of the work reported in this article was supported in part by U S . Public Health Service Grant GM 21858 and in part performed under Contract No. DE-AC02-76EV03490 with the US. Department of Energy at the University of Rochester Department of Radiation Biology and Biophysics and has been assigned Report No. UR-3490-1875.
REFERENCES Ahmed, K. A., and Woods, R. A. (1967). A genetic analysis of resistance to nystatin in Saccharomyces cerevisiae. Genet. Res. 9, 179-193. Ananthaswamy, H. N., McKey, T. J., and Mortimer, R. K. (1978). Isolation and characterization of additional X-ray sensitive mutants of Saccharomyces cereuisiae. Int. Conf. Yeast Genet. Mol. Biol., 9th, Rochester, New York p. 45. (Abstr.) Auerbach, C. (1962). “Mutation: An Introduction to Research on Mutagenesis.” Oliver & Boyd, Edinburgh. Auerbach, C. (1976). “Mutation Research.” Chapman & Hall, London. Auerbach, C., and Kilbey, B. J. (1971). Mutation in Eukaryotes. Annu. Rev. Genet. 5, 163-218. Auerbach, C., and Ramsey, D. (1968). Analysis of a case of mutagen specificity in Neurospora crassa I. Dose response curves. MoZ. Gen. Genet. 103, 72-104. Averbeck, D., and Moustacchi, E. (1975). 8-Methoxypsoralen plus 365 nm light effects and repair in yeast. Biochim. Biophys. Acta 395, 393-404. Averbeck, D., Laskowski, W., Eckardt, F., and Lehmann-Brauns, E. (1970). Four radiation sensitive mutants of Saccharomyces. Survival after UV- and X-ray-irradiation a s well as UV-induced reversion rates from isoleucine-valine dependence to independence. Mol. Gen. Genet. 107, 117-127. Averbeck, D., Moustacchi, E., and Bisagni, E. (1978). Biological effects and repair of damage photo-induced by a derivative of psoralen substituted a t the 3,4 reaction
MUTAGENESIS IN
S. cerevisiae
241
site. Photoreactivity of this compound and lethal effects in yeast. Biochim. Biophys. Acta 518, 464-481. Baranowska, H., and Putrament, A. (1979). Mitochondria1 mutagenesis in Saccharomyces cereuisiae 111. Nitrous acid. Mutat. Res. 63, 291-300. Barclay, B. J., and Little, J. G. (1978). Genetic damage during thymidylate starvation in Saccharomyces cerevisiae. Mol. Gen. Genet. 160, 33-40. Beam, C. A., Mortimer, R. K., Wolfe, R. G., and Tobias, C. A. (1954). The relation of radioresistance to budding in Saccharomyces cerevisiae. Arch. Biochem. Biophys. 49,110-122. Bird, R. P., and Manney, T. R. (1974). Radioresistance is associated with DNA synthesis not budding. Radiat. Res. 59, 287. (Abstr.) Boiteux, S., Villani, G., Spadari, S., Zambrano, F., and Radman, M. (1978). Making and correcting errors in DNA synthesis: In uitro studies of mutagenesis. In “DNA Repair Mechanisms” (P. C. Hanawalt, E. C. Friedberg, and C. F. Fox, eds.), pp. 73-84. Academic Press, New York. Boram, W. R., and Roman, H. (1976). Recombination in Saccharomyces cereuisiae: A DNA repair mutation associated with elevated mitotic gene conversion. Proc. Natl. Acad. Sci. U.S.A. 73, 2828-2832. Borst, P., Bos, J. L., Grivell, L. A., Groot, G . S. P., Heyting, C., Moorman, A. F. M., Sanders, J. P. M., Talen, J. L., van Kreijl, C. F., and van Ommen, G. J. B. (1977). The physical map of yeast mitochondria1 DNA anno 1977 (a review). In “Mitochondria 1977, Genetics and Biogenesis of Mitochondria” (W. Bandlow, R. J. Schweyer, K. Wolf, and F. Kaudewitz, eds.), pp. 213-264. De Gruyter, Berlin. Brendel, M., and Haynes, R. H. (1973). Interactions among genes controlling sensitivity to radiation and alkylation in yeast. Mol. Gen. Genet. 125, 197-216. Brendel, M., Khan, N. A., and Haynes, R. H. (1970). Common steps in the repair of alkylation and radiation damage in yeast. Mol. Gen. Genet. 106, 289-295. Brennes-Pomales, A., Lindegren, G., and Lindegren, C. C. (1955). Gene control of coppersensitivity in Saccharomyces. Nature (London) 176, 841-842. Brown, A. M., and Kilbey, B. J. (1970). Hyper-UV-sensitive yeast I: Isolation and properties of two such mutants. Mol. Gen. Genet. 108, 258-265. Brunborg, G., and Williamson, D. H. (1978). The relevance of the nuclear division cycle to radiosensitivity in yeast. Mol. Gen. Genet. 162, 277-286. Brusick, D. J. (1970). The mutagenic activity of ICR-170 in Saccharomyces cereuisiae. Mutat. Res. 10, 11-19. Brychcy, T., and von Borstel, R. C. (1977). Spontaneous mutability in UV-sensitive excision-defective strains of Saccharomyces. Mutat. ties. 45, 185-194. Burke, W., and Fangman, W. L. (1975).Temporal order in yeast chromosome replication. Cell 5, 263-269. Burke, W., Newlon, C. S., and Fangman, W. L. (1975). Replication initiation in yeast chromosomes. In “The Eucaryote Chromosome” (W. J. Peacock and R. D. Brock, eds.), pp. 327-343. Australian Nat. Univ. Press, Canberra. Caillet-Fauquet, P., Defais, M., and Radman, M. (1977). Molecular mechanisms of induced mutagenesis. Replication in uitro of Bacteriophage 4x174 single-stranded, ultraviolet light-irradiated DNA in intact and irradiated host cells. J . Mol. Biol. 117, 95-112. Cairns, J. (1963). The bacterial chromosome and its manner of replication as seen by autoradiography. J . Mol. Biol. 6, 208-213. Cameron, J. R., Loh, E. Y., and Davis, R. W. (1979). Evidence for transposition of dispersed repetitive DNA families in yeast. Cell 16, 739.
242
CHRISTOPHER W. LAWRENCE
Cassier, C., Chanet, R., Henriques, J. A. P., and Moustacchi, E. (1981). The effects of three pso genes on induced mutagenesis: A novel class of mutationally defective yeast. Genetics 96, 841-857. Chang, L. M. S. (1977). DNA polymerases from Bakers’ yeast. J. Biol. Chem. 252, 1873-1880. Chattoo, B. B., Sherman, F., Azubalis, D. A., Fjellstedt, T. A,, Mehnert, D., and Ogur, M. (1979a). Selection of lys2 mutants of the yeast Saccharomyces cerevisiae by the utilization of u-aminoadipate. Genetics 93, 51-65. Chattoo, B. B., Palmer, E., Ono, B-I., and Sherman, F. (1979b). Patterns of genetic and phenotypic suppression of lys2 mutations in the yeast Saccharomyces cereuisiae. Genetics 93, 67-79. Cherest, H., and de Robichon-Szulmajster, H. (1966). Resistance a L’ethionine chez Saccharomyces cerevisiae. I. Etude genetique. Genetics 54, 981-991. Cherest, H., Surdin-Kerjan, Y., Antoniewski, J., and de Robichon-Szulmajster, H. (1973). Effects of regulatory mutations upon methionine biosynthesis in Saccharomyces cereuisiae: Loci eth2 - eth3 - ethl0. J . Bacteriol. 115, 1084-1093. Chlebowicz, E., and Jachymczyk, W. J . (1977). Endonuclease for apurinic sites in yeast. Comparison of the enzyme activity in the wild type and in rad mutants of Saccharomyces cerevisiae to MMS. Mol. Gen. Genet. 154, 221-223. Chlebowicz, E., and Jachymczyk, W. J. (1979). Repair of MMS-induced DNA doublestrand breaks in haploid cells of Saccharomyces cerevisiae, which requires the presence of a duplicate genome. Mol. Gen. Genet. 167, 279-286. Clark, A. J., and Volkert, M. R. (1978). A new classification of pathways repairing pyrimidine dimer damage in DNA. In, “DNA Repair Mechanisms” (P. C. Hanawalt, E. C. Friedberg, and C. F. Fox, eds.), pp. 47-72. Academic Press, New York. Conde, J., and Fink, G. R. (1976). A mutant of Saccharomyces cerevisiae defective for nuclear fusion. Proc. Natl. Acad. Sci. U.S.A. 73, 3651-3655. Cooper, D., Banthorpe, D. V., and Wilkie, D. (1967). Modified ribosomes conferring resistance to cyclohexamide in mutants of Saccharomyces cerevisiae. J. Mot. Biol. 26, 347-350. Coulondre, C., and Miller, J . H. (1977a). Genetic studies of the lac repressor 111. Additional correlation of mutational sites with specific amino acid residues. J. Mol. Biol. 117, 525-575. Coulondre, C., and Miller, J. H. (1977b). Genetic studies of the lac repressor IV. Mutagenic specificity in the lacl gene of Escherichia coli. J. Mol. Biol. 117, 577-606. Coulondre, C., Miller, J. H., Farabaugh, P. J., and Gilbert, W. (1978). Molecular basis of base substitution hotspots in Escherichia coli. Nature (London) 274, 775-780. Cox, B. S. (1971). A recessive lethal super-suppressor mutation in yeast and other phenomena. Heredity 26, 211-232. Cox, B. S., and Game, J. C. (1974). Repair systems in Saccharomyces. Mutat. Res. 26, 257-264. Cox, B. S., and Parry, J. M. (1968). The isolation, genetics and survival characteristics of ultraviolet light-sensitive mutants in yeast. Mutat. Res. 6, 37-55. Cox, B. S., Tuite, M. F., and Mundy, C. J. (1980). Reversion from suppression to nonsuppression in SUQ5[psi+I strains of yeast: The classification of mutations. Genetics 95, 589-609. Cox, E. C. (1976). Bacterial mutator genes and the control of spontaneous mutation. Annu. Rev. Genet. 10, 135-156. Culbertson, M. R., Charnas, L., Johnson, M. T., and Fink, G. R. (1977). Frameshifts and frameshift suppressors in Saccharomyces cerevisiae. Genetics 86, 745-764.
+
MUTAGENESIS IN
S . cerevisiae
243
Dawes, I. A., and Carter, B. L. (1974). Nitrosoguanidine mutagenesis during nuclear and mitochondria1 gene replication. Nature (London) 250, 709-7 12. Dawes, I. W., Mackinnon, D. A., Ball, D. E., Hardie, I. D., Sweet, D. M., Ross, F. M., and MacDonald, F. (1977). Identifying sites of simultaneous DNA replication in Eukaryotes by N-methyl-N’-nitro-N-nitrosoguanidine multiple mutagenesis. Mol. Gen. Genet. 152, 53-57. Defais, M., Jeggo, P., Samson, L., and Schendel, P. F. (1980). Effect of the adaptive response on the induction of the SOS pathway in E . coli K-12. Mol. Gen. Genet. 177, 653-659. delangguth, E. N., and Beam, C. A. (1973). Repair mechanisms and cell cycle dependent variations in X-ray sensitivity of diploid yeast. Radiat. Res. 53, 226-234. Donahue, T. F., Farabaugh, P. J . , and Fink, G. R. (1980). Suppressible four base glycine and proline codons in yeast. Science 212, 455-457. Drake, J . W. (1973). The genetic control of spontaneous and induced mutation rates in bacteriophage T4. Genetics Suppl. 73, 45-64. Drake, J. W. (1974). The role of mutation in bacterial evolution. Symp. Soc. Gen. Microbiol. 24, 41-58. Drake, J. W. (1977). Fundamental mutagenic mechanisms and their significance for environmental mutagenesis. In “Progress in Genetic Toxicology” (D. Scott, B. A. Bridges, and F. H. Sobels, eds.), pp. 43-55. Elsevier, Amsterdam. Eckardt, F., and Haynes, R. H. (1977a). Kinetics of mutation induction by ultraviolet light in excision deficient yeast. Genetics 85, 225-247. Eckardt, F., and Haynes, R. H. (1977b). Induction of pure and sectored mutant clones in excision-proficient and deficient strains of yeast. Mutat. Res. 43, 327338. Eckardt, F., Moustacchi, E., and Haynes, R. H. (1978). On the inducibility of errorprone repair in yeast. In “DNA Repair Mechanisms” (P. C. Hanawalt, E. C. Friedberg, and C. F. Fox, eds.), pp. 421-423. Academic Press, New York. Eckardt, F., Teh, S.-J., and Haynes, R. H. (1980). Heteroduplex repair as an intermediate step of UV mutagenesis in yeast. Genetics 95, 63-80. Ejchart, A., and Putrament, A. (1979). Mitochondria1 mutagenesis in Saccharomyces cerevisiae. I. Ultraviolet radiation. Mutat. Res. 60, 173-180. Esposito, M. S., Bolotin-Fukuhara, M., and Esposito, R. E. (1975). Antimutator activity during mitosis by a meiotic mutant of yeast. Mol. Gen. Genet. 139, 9-18. Fabre, F., and Roman, H. (1977). Genetic evidence for inducibility of recombination competence in yeast. Proc. Natl. Acad. Sci. U.S.A. 74, 1667-1671. Farabaugh, P. J. (1978). Sequence of the lac1 gene. Nature (London) 274, 765-769. Flury, F., von Borstel, R. C., and Williamson, D. H. (1976). Mutator activity of petite strains of Saccharomyces cereuisiae. Genetics 83, 645-653. Fogel, S., Lax, C., and Hurst, D. D. (1978). Reversion a t the his1 locus of yeast. Genetics 90, 489-500. Foury, F., and Goffeau, A. (1979). Genetic control of enhanced mutability of mitochondrial DNA and y-ray sensitivity in Saccharom.yces cereuisiae. Proc. Natl. Acad. Sci. U.S.A. 76, 6529-6533. Game, J. C., and Cox, B. S. (1971). Allelism tests of mutants affecting sensitivity to radiation in yeast and a proposed nomenclature. Mutat. Res. 12, 328-331. Game, J. C., and Cox, B. S. (1972). Epistatic interaction between four rad loci in yeast. Mutat. Res. 16, 353-362. Game, J. C., and Cox, B. S. (1973). Synergistic interactions between RAD mutations in yeast. Mutat. Res. 20, 35-44.
244
CHRISTOPHER W. LAWRENCE
Game, J. C., and Mortimer, R. K. (1974). A genetic study of X-ray sensitive mutants in yeast. Mutat. Res. 24, 281-292. Game, J. C., Little, J. G., and Haynes, R. H. (1975). Yeast mutants sensitive to Trimethoprim. Mutat. Res. 28, 175-182. Game, J. C., Zamb, T. J., Braun, R. J., Resnick, M. A., and Roth, R. M. (1980). The role of radiation (rad)genes in meiotic recombination in yeast. Genetics 94,51-68. Gocke, E., and Manney, T. R. (1979). Expression of radiation-induced mutations at the arginine permease (CAN1) locus in Succharomyces cereuisiae. Genetics 91, 53-66. Goldberg, O., and Little, J. G. (1978). DNA repair replication in the yeast Saccharomyces cereuisiae. Znt. Conf. Yeast Genet. Mol. Biol., 9th, Rochester, New York p. 40. (Abstr.) Golin, J. E., and Esposito, M. S. (1977). Evidence for joint genic control of spontaneous mutation and genetic recombination during mitosis in Saccharomyces. Mol. Gen. Genet. 150, 127-135. Goodman, H. M., Olson, M. V., and Hall, B. D. (1977). Nucleotide sequence of a mutant eukaryotic gene: the yeast tyrosine-inserting ochre suppressor SUP4-0. Proc. Natl. Acad. Sci. U.S.A. 74, 5453-5457. Gottlieb, D. J. C., and von Borstel, J. C. (1976). Mutators in Saccharomyces cereuisiae, mutl-1, mutl-2, and mut2-1. Genetics 83, 655-666. Grant, E. L., von Borstel, R. C., and Ashwood-Smith, M. J. (1979). Mutagenicity of cross-links and monoadducts of furocoumarins (psoralen and angelicin) induced by 360-nm radiation in excision-repair-defective and radiation-insensitive strains of Saccharomyces cereuisiae. Enuiron. Mutagen. 1, 55-63. Grenson, M. M., Mousset, M., Wiame, J. M., and Bechet, J. (1966). Multiplicity of the amino acid permeases in Succharomyces cereuisiue. I. Evidence for a specific arginine-transporting system. Biochim. Biophys. Acta 127, 325-338. Hanawalt, P. C., Cooper, P. K., Ganesan, A. K., and Smith, C. A. (1979). DNA repair in bacteria and mammalian cells. Annu. Rev. Biochem. 48, 783-836. Hannan, M. A., Duck, P., and Nasim, A. (1976). UV-induced lethal sectoring and pure mutant clones in yeast. Mutat. Res. 36, 171-176. Hastings, P. J., Quah, S.-K., and von Borstel, R. C. (1976). Spontaneous mutation by mutagenic repair of spontaneous lesions in DNA. Nature (London) 264, 719-722. Hattman, S., Kenny, C., Berger, L., and Pratt, K. (1978). Comparative Study of DNA methylation in three unicellular eucaryotes. J . Bacteriol. 135, 1156-1 157. Hawthorne, D. C., and Leupold, U. (1974). Suppressor mutations in yeast. Curr. Top. Microbiol. Immunol. 64, 1-47. Haynes, R. H., and Eckardt, F. (1979). Analysis of dose-response patterns in mutation research. Can. J . Genet. Cytol. 21, 277-302. Haynes, R. H., Barclay, B. J., Eckardt, F., Cardman, O., Kunz, B., and Little, J. G. (1979). Genetic control of DNA repair in yeast. Proc. Int. Congr. Genet. 14th (in press). Henriques, J. A. P., and Moustacchi, E. (1980). Isolation and characterization of pso mutants sensitive t o photo-addition of psoralen derivatives in Saccharomyces cereuisiae. Genetics 96, 273-288. Hill, R. F., and Nestmann, E. R. (1973). Effect of the recC gene in Escherichia coli on frequencies of ultraviolet-induced mutants. Mutat. Res. 17, 27-36. Hixon, S., and Moustacchi, E. (1978). The fate of mitochondria1 DNA after ultraviolet irradiation. I. Degradation during post-UV dark liquid holding in non-nutrient medium. Biochem. Biophys. Res. Commun. 81, 288-296. Ho, K. S. (1975). Induction of DNA double-strand breaks by X-rays in a radiosensitive strain of the yeast Saccharomyces cereuisiae. Mutat. Res. 30, 327-334.
MUTAGENESIS IN
S. cereuisiae
245
Ho, K. S., and Mortimer, R. K. (1973). Induction of dominant lethality by X-rays in a radiosensitive strain of yeast. Mutat. Res. 20, 45-51. Huberman, J . A., and Riggs, A. D. (1968). On the mechanism of DNA replication in Mammalian Chromosomes. J . Mol. Biol. 32, 327-341. Hunnable, E. G., and Cox, B. S. (1971). The genetic control of dark recombination in yeast. Mutat. Res. 13, 297-309. Ishii, Y., and Kondo, S. (1975). Comparative analysis of deletion and base-change mutabilities of Escherichia coli B strains differing in DNA repair capacity (wildtype, uvrA-, P O W , recA-) by various mutagens. Mutat. Res. 27, 27-44. Iwashima, A., and Rabinowitz, M. (1969). Partial purification of mitochondrial and supernatant DNA polymerase from Saccharomyces cerevisiae. Biochim. Biophys Acta 178, 283-293. Jachymczyk, W. J . , Chlebowicz, E., Swietlinska, Z., and Zuk, J . (1977). Alkaline sucrose sedimentation studies of MMS-induced DNA single-strand breakage and rejoining in the wild type and in UV-sensitive mutants of Saccharomyces cerevisae. Mutat. Res. 43, 1-10, James, A. P., and Kilbey, B. J. (1977). The timing of UV mutagenesis in yeast: A pedigree analysis of induced recessive mutation. Genetics 87, 237-248. James, A. P., Kilbey, B. J., and Prefontaine, G. J . (1978). The timing of UV mutagenesis in yeast: Continuing mutation in an excision defective (radl-1)strain. Mol. Gen. Genet. 165, 207-212. Janner, F., Flury, F., and Leupold, U. (1979). Reversion of nonsense mutants induced by 4-nitroquinoline-1-oxidein Schizosaccharomyces pombe. Mutat. Res. 63, 11-19. Jeggo, P. (1979). Isolation and characterization of Escherichia coli K-12 mutants unable to induce the adaptive response to simple alkylating agents. J . Bacteriol. 139, 783-791. Jeggo, P., Defais, M., Samson, L., and Schendel, P. (1977). An adaptive response of E . coli to low levels of alkylating agents: comparison with previously characterized DNA repair pathways. Mol. Gen. Genet. 157, 1-9. Johnston, L. H. (1979a). Nuclear mutations in Saccharomyces cerevisiae which increase the spontaneous mutation frequency in mitochondrial DNA. Mol. Gen. Genet. 170, 327-331. Johnston, L. H. (1979b). The DNA repair capability of cdc9, the Saccharomyces cerevisiae mutant-defective in DNA ligase. Mol. Gen. Genet. 170, 89-92. Johnston, L. H., and Nasmyth, K. A. (1978). Saccharomyces cerevisiae cell cycle mutant cdc9 is defective in DNA ligase. Nature (London) 274, 891-893. Jund, R., and Lacroute, F. (1970). Genetic and physiological aspects of resistance to 5-fluoropyrimidines in Saccharomyces cerevisiae. J . Bacterial. 102, 607-615. Kato, T. (1977). Effects of Chloramphenicol and caffeine on postreplication repair in uvrA umuC and uvrA recF strains of Escherichia coli K-12. Mol. Gen. Genet. 156, 115-120. Kato, T., and Shinoura, Y . (1977). Isolation and characterization of mutants of Escherichia coli deficient in induction of mutations by ultraviolet light. Mol. Gen. Genet. 156, 121-131. Kato, T., Rothman, R. H., and Clark, A. J. (1977).Analysis of the role of recombination and repair i n mutagenesis of Escherichia coli by UV irradiation. Genetics 87, 1-18. Kee, S. G., and Haber, J. E. (1975). Cell cycle-dependent induction of mutations along a yeast chromosome. Proc. Natl. Acad. Sci. U.S.A. 72, 1179-1183. Kern, R., and Zimmermann, F. K. (1978). The influence of defects in excision and error
246
CHRISTOPHER W. LAWRENCE
prone repair on spontaneous and induced mitotic recombination and mutation in Saccharomyces cerevisiae. Mol. Gen. Genet. 161, 81-88. Khan, N. A., Brendal, M., and Haynes, R. H. (1970). Supersensitive double mutants in yeast. Mol. Gen. Genet. 107, 376-378. Kilbey, B. J., and James, A. D. (1979). The mutagenic potential of unexcised pyrimidine dimers in Saccharomyces serevisiae, radl-1. Evidence from photoreactivation and pedigree analysis. Mutat. Res. 60, 163-171. Kilbey, B. J., and Smith, S. M. (1969). Similarities between a UV-sensitive mutant of yeast and bacterial mutants lacking excision-repair ability. Mol. Gen. Genet. 104, 253-257. Kilbey, B. J., Brychcy, T., and Nasim, A. (1978). Initiation of UV mutagenesis in Saccharomyces cereuisiae. Nature (London) 274, 889-891. Kimura, M. (1960). Optimum mutation rate and degree of dominance as determined by the principle of minimum genetic load. J . Genet. 57, 21-34. Kimura, M. (1967). On the evolutionary adjustment of spontaneous mutation rates. Genet. Res. 9, 23-34. Koch, R. E. (1971). The influence of neighboring base pairs upon base-pair substitution mutation rates. Proc. Natl. Acad. Sci. U.S.A.68, 773-776. Kondo, S., Ichikawa, H., Iwo, K., and Kato, T. (1970). Base-change mutagenesis and prophage induction in strains of Escherichia coli with different DNA repair capacities. Genetics 66, 187-217. Korch, C. T., and Snow, R. (1973). Allelic complementation in the first gene for histidine biosynthesis in Saccharomyces cereuisiae. I. Characterization of mutants and genetic mapping of alleles. Genetics 74, 287-305. Kornberg, A. (1980). “DNA Replication.” Freeman, San Francisco, California. Kowalski, S., and Laskowski, W. (1975). The effect of three red genes on survival, inter- and intragenic mitotic recombination in Saccharomyces. Mol. Gen. Genet. 136, 75-86. Laskowski, W. (1956). The genetics of resistance of Saccharomyces cerevisiae to lithium chloride. Genetics 41, 98-106. Laskowski, W., and Averbeck, D. (1968). UV- and X-ray sensitive mutants of Saccharomyces. Stud. Biophys. 12, 167-172. Laskowski, W., Lochmann, E.-R., Jannsen, S., and Fink, E. (1968). Zur Isolierung einer strahlensensiblen Saccharomyces-mutante. Empfindlichkeit des Koloniebildungsvermoegens, der RNS-und Proteinsynthese. Biophysik 4, 233-242. Lawrence, C. W., and Christensen, R. (1976). UV mutagenesis in radiation-sensitive strains of yeast. Genetics 82, 207-232. Lawrence, C. W., and Christensen, R. B. (1978a). Ultraviolet-induced reversion of cycl alleles in radiation-sensitive strains of yeast I. reul mutant strains. J . Mol. Biol. 122,l-21. Lawrence, C. W., and Christensen, R. B. (1978b). Ultraviolet-induced reversion of cycl alleles in radiation sensitive strains of yeast. 11. rev2 mutant strains. Genetics 90, 213-226. Lawrence, C. W., and Christensen, R. B. (1978~). Ultraviolet light induced mutagenesis in Saccharomyces cereuisiae. In “DNA Repair Mechanisms” (P. C. Hanawalt, E. C. Friedberg, and C. F. Fox, eds.), pp. 437-440. Academic Press, New York. Lawrence, C. W., and Christensen, R. B. (1979a). Ultraviolet-induced reversion of cyci alleles in radiation-sensitive strains of yeast. 111. reu3 mutant strains. Genetics 92, 397-408. Lawrence, C . W., and Christensen, R. B. (197913). Metabolic suppressors of trimeth-
MUTAGENESIS I N
S. cerevisiae
247
roprim and ultraviolet light sensitivities of Saccharomyces cereuisiae rad6 mutants. J . Bacteriol. 139, 866-876. Lawrence, C. W., and Christensen, R. B. (1979~).Absence of relationship between UVinduced reversion frequency and nucleotide sequence a t the CYCI locus of yeast. Mol. Gen. Genet. 177, 31-38. Lawrence, C. W., Stewart, J. W., Sherman, F., and Thomas, F. L. X. (1970). Mutagenesis in ultraviolet-sensitive mutants of yeast. Genetics 64, s36-s37. Lawrence, C. W., Stewart, J. W., Sherman, F., and Christensen, R. (1974). Specificity and frequency of ultraviolet-induced reversion of an Iso-1-cytochrome c ochre mutant in radiation-sensitive strains of yeast. J . Mot. Biot. 85, 137-162. Lawrence, C. W., Christensen, R. B., and Schwartz, A. (1981). Mechanisms of UV mutagenesis in yeast. I n “Cellular Mechanisms of Mutagenesis” (J. F. Lemontt, ed.). Plenum, New York, in press. Lehman, A. R., and Bridges, B. A. (1977). DNA repair. Ess. Biochem. 13, 71-119. Leigh, E. G. (1970). Natural selection and mutability. Am. Nut. 104, 301-305. Leigh, E. G. (1973). The evolution of mutation rates. Genetics Suppl. 73, 1-18. Lemontt, J. F. (1971a). Mutants of yeast defective in mutation induced by ultraviolet light. Genetics 68, 21-33. Lemontt, J. F. (1971b).Pathways of ultraviolet mutability in Saccharomyces cereuisiae. 11. The effect of reu genes on recombination. Mutat. Res. 13, 319-326. Lemontt, J. F. (1972). Induction of forward mutations in mutationally defective yeast. Mol. Gen. Genet. 119, 27-42. Lemontt, J. F. (1973). Genes controlling ultraviolet mutability in yeast. Genetics Suppl. 73, 153-159. Lemontt, J. F. (1977a). Pathways of ultraviolet mutability in Saccharomyces cereuisiae. 111. Genetic analysis and properties of mutants resistant to ultraviolet-induced forward mutation. Mutat. Res. 43, 179-204. Lemontt, J. F. (1977b). Mutagenesis of yeast by hydrazine: Dependence upon posttreatment cell division. Mutat. Res. 43, 165-178. Lemontt, J. F. (1978). Loss of hydrazine-induced mutability in wild-type and excisionrepair-defective yeast during post-treatment inhibition of cell division. Mutat. Res. 50, 57-66. Lemontt, J. F. (1980). Genetic and Physiological factors affecting repair and mutagenesis in yeast. I n “DNA Repair and Mutagenesis in Eukaryotes” (F. J. deSerres, W. M. Generoso, and M. D. Shelby, eds.), pp. 85-120. Plenum, New York. Lemontt, J. F., and Mortimer, R. K. 119701. The selection of mutants of yeast that are defective in ultraviolet light-induced mutation. Genetics 64,s37-s38. Liebman, S. W., Stewart, J. W., and Sherman, F. (1975). The effects of the non-Mendelian factor $ + on the efficiency of nonsense suppression in Saccharomyces cereuisiae. Genetics 80, s53. Liebman, S. W., Sherman, F., and Stewart, J. W. (1976). Isolation and characterization of amber suppressors in yeast. Genetics 82, 251-272. Liebman, S. W., Singh, A,, and Sherman, F. (1979). A mutator affecting the region of the iso-1-cytochrome c gene in yeast. Genetics 92, 783-802. Liebman, S. W., Downs, K. M., and Szwast, A. E. (1980). The effect of rad gene and temperature shifts on the DELI mutator in Saccharomyces cereuisiae. Genetics 94, s63. Lindahl, T., and Nyberg, B. (1972). Rate of depurination of native deoxyribonucleic acid. Biochemistry 11, 3610-3618. Linn, S., Kuhnlein, U., and Deutsch, W. A. (1978). Enzymes from human fibroblasts
248
CHRISTOPHER W. LAWRENCE
for the repair of AP DNA. In “DNA Repair Mechanisms” (P. C. Hanawalt, E. C. Friedberg, and C. F. Fox, eds.), pp. 199-203, Academic Press, New York. Lucchini, G., Sora, S., and Panzeri, L. (1980). Hycanthone as a specific frameshift mutagen in Saccharomyces cereuisiae. Mutat. Res. 72, 397-404. McCready, S. J., Cox, B. S., and McLaughlin, C. S. (1977). The extrachromosomal control of nonsense suppression in yeast: An analysis of the elimination of [psi’] in the presence of a nuclear gene P N M - . Mol. Gen. Genet. 150, 265-270. Machida, I., and Nakai, S. (1980). Induction of spontaneous and UV-induced mutations during commitment to meiosis in Saccharomyces cereuisiue. Mutat. Res. 73,59-68. McKee, R. H., and Lawrence, C. W. (1979a).Genetic analysis of gamma-ray mutagenesis in yeast. I. Reversion in radiation-sensitive strains Genetics 93, 361-373. McKee, R. H., and Lawrence, C. W. (1979b).Genetic analysis of gamma-ray mutagenesis in yeast. 11. Allele-specific control of mutagenesis. Genetics 93, 375-381. McKee, R. H., and Lawrence, C. W. (1980). Genetic analysis of y-ray mutagenesis in yeast. 111. Double-mutant strains. Mutat. Res. 70, 37-48. Magni, G. E. (1963a). Mutation rates during the meiotic process in yeasts. In “Repair from Genetic Radiation Damage” (F. Sobels, ed.), pp. 77-85. Pergamon, Oxford. Magni, G. E. (1963b). The origin of spontaneous mutations during meiosis. Proc. Natl. Acad. Sci. U.S.A. 50, 975-980. Magni, G. E. (1964). Origin and nature of spontaneous mutations in meiotic organisms. J . Cell. Comp. Physiol. Suppl. 64, 165-172. Magni, G. E. (1969). Spontaneous mutations. Proc. Int. Congr. Genet. 12th 3,247-259. Magni, G. E., and Puglisi, P. P. (1966). Mutagenesis of super-suppressors in yeast. Cold Spring Harbor Symp. Quant. Biol. 31, 699-704. Magni, G. E., and von Borstel, R. C. (19621. Different rates of spontaneous mutation during mitosis and meiosis in yeast. Genetics 47, 1097-1108. Magni, G. E., von Borstel, J. C., and Steinberg, C. M. (1966). Super-suppressors as addition-deletion mutations. J . Mol. Biol. 16, 568-570. Malone, R. E., and Esposito, R. E. (1980). The RAD52 gene is required for homothallic interconversion of mating types and spontaneous mitotic recombination in yeast. Proc. Natl. Acad. Sci. U.S.A. 77, 503-507. Middlekauf, J. E., Hino, S., Yang, S. P., Lindegren, G., and Lindgren, C. C. (1956). Gene control of resistance us sensitivity to cadmium in Saccharomyces. J . Bacterial. 72, 796-801. Moore, P., and Strauss, B. S. (1979). Sites of inhibition of in uitro DNA synthesis in carcinogen- and UV-treated 4x174 DNA. Nature (London) 278, 664-666. Moore, P. D., Bose, K., Rabkin, S., and Strauss, B. S. (1980). Sites of termination of in uctro DNA synthesis in AAF reacted DNA. J . Supramol. Struct. Suppl. 4, 356. (Abstr.) Morrison, D. P., and Hastings, P. J. (1979). Characterization of the mutator mutation mut5-1. Mol. Gen. Genet. 175, 57-65. Mortelmans, K., Friedberg, E. C., Slor, H., Thomas, G., and Cleaver, J. E. (1976). Defective thymine dimer excision by cell-free extracts of xeroderma pigmentosum cells. Proc. Natl. Acad. Sci. U.S.A. 73, 2757-2761. Mortimer, R., Brustad, T., and Cormack, D. V. (1965).Influence of linear energy transfer and oxygen tension on the effectiveness of ionizing radiation for induction of mutations and lethality in Saccharomyces cereuisiue. Radiut. Res. 26, 465-482. Moustacchi, E. (1969). Cytoplasmic and nuclear genetic events induced by UV light in strains of Saccharomyces cereuisiae with different UV sensitivities. Mutat. Res. 7, 171-185.
MUTAGENESIS IN
S. cereuisiae
249
Moustacchi, E. (1971). Evidence for nucleus independent steps in control of repair of mitochondrial damage. I. UV-induction of the cytoplasmic “Petite” mutation in UV-sensitive nuclear mutants of Saccharomyces cereuisiae. Mol. Gen. Genet. 114, 50-58. Moustacchi, E., Waters. R., Heude, M., and Chanet, R. (1975). The present status of DNA repair mechanisms in UV irradiated yeast taken as a model eukaryotic system. In “Radiation Research, Biomedical Chemical and Physical Perspectives” (0. F. Nygaard, H. I. Adler, and W. K. Sinclair, eds.), pp. 632-650. Academic Press, New York. Moustacchi, E., Perlman, P. S., and Mahler, H. R. (1976).A novel class of Saccharomyces cereuisiae mutants specifically UV-sensitive to “petite” induction. Mot. Gen. Genet. 148, 251-261. Moustacchi, E., Chanet, R., and Heude, M. (1977). Ionizing and ultraviolet radiation: Genetic effects and repair in yeast. In “Research in Photobiology” (A. Castellani, ed.), pp. 197-206. Plenum, New York. Mowat, M. R. A. (1979). Repair of gamma-ray induced DNA strand breaks in radiation sensitive mutants of yeast. Ph.D. Thesis, University of Alberta, Edmonton, Canada. Nakai, S., and Matsumoto, S. (1967). Two types of radiation-sensitive mutant in yeast. Mutat. Res. 4, 129-136. Nasim, A., and Auerbach, C. (1967). The origin of complete and mosaic mutants from mutagenic treatment of single cells. Mutat. Res. 4, 1-14. Panzeri, L., Sora, S., and Magni, G . E. (1979). Effect of X-irradiation on frameshift and missense mutations in Saccharomyces cereuisiae. Mutat. Res. 62,27-33. Park, S. D., and Cleaver, J. E. (1979). Post replication repair: Questions of its definition and possible alteration in xeroderma pigmentosum cell strains. Proc. Natl. Acad. Sci. U.S.A.76, 3927-3931. Parry, J. M., and Parry, E. M. (1969). The effect of UV-light post-treatments on the survival characteristics of 21 UV-sensitive mutants of Saccharomyces cereuisiae Mutat. Res. 8, 545-556. Parry, J. M., Davies, P. J., and Evans, W. E. (1976). The effects of “cell age” upon the lethal effects of physical and chemical mutagens in the yeast Saccharomyces cereuisiae. Mol. Gen. Genet. 146, 27-35. Petes, T. D., and Williamson, D. H. (1975). Fiber autoradiography of replicating yeast DNA. Exp. Cell Res. 95, 103-110. Pickering, W. R., and Woods, R. A. (1973). Genetics of resistance to 4-aminopyrazolo (3,4-d)-pyrimidine in Saccharomyces cereuisiae. Mol. Gen. Genet. 122,231-242. Piper, P. W., Wasserstein, M., Engback, F., Kaltoft, K., Celis, J. E., Zeuthen, J., Liebman, S., and Sherman, F. (1976). Nonsense suppressors of Saccharomyces cereuisiae can be generated by mutation of the tyrosine tRNA anticodon. Nature (London) 262, 757-761. Pittman, D., and Brusick, D. (1971). Detection of presumptive base-pair substitution and frameshift mutations in Saccharomyces cereuisiae. Mol. Gen. Genet. 111. 352-356. Polakowska, R., and Putrament, A. (1979). Mitochondria1 mutagenesis in Saccharomyces cereuisiae. 11. Methyl methanesulphonate and diepoxybutane. Mutat. Res. 61,207-213. Prakash, L. (1974). Lack of chemically induced mutation in repair-deficient mutants of yeast. Genetics 78, 1101-1118. Prakash, L. (1975). Repair of pyrimidine dimers in nuclear and mitochondrial DNA of yeast irradiated with low doses of ultraviolet light. J. Mol. B i d . 98, 781-795.
250
CHRISTOPHER W. LAWRENCE
Prakash, L. (1976). Effects of genes controlling radiation sensitivity on chemically induced mutations in Saccharomyces cereuisiae. Genetics 83, 285-301. Prakash, L. (1977a). Defective thymine dimer excision in radiation-sensitive mutants rad10 and radl6 of Saccharomyces cereuisiae. Mol. Gen. Genet. 152, 125-128. Prakash, L. (197713). Repair of pyrimidine dimers in radiation-sensitive mutants rad3, rad4, and rad9 of Saccharomyces cereuisiae. Mutat. Res. 45, 13-20. Prakash, L., and Prakash, S. (1977). Isolation and characterization of MMS-sensitive mutants of Saccharomyces cereuisiae. Genetics 86, 33-55. Prakash, L., and Prakash, S. (1979). Three additional genes involved in pyrimidine dimer removal in Saccharomyces cerevisiae: RAD7, RADII, and MMS19. Mol. Gen. Genet. 176, 351-359. Prakash, L., and Prakash, S. (1980). Genetic analysis of error-prone repair systems in Saccharomyces cerevisiae. In “DNA Repair and Mutagenesis in Eukaryotes” (F. J . deSerres, W. M. Generoso, and M. D. Shelby, eds.), pp. 141-158. Plenum, New York. Prakash, L., and Sherman, F. (1973). Mutagenic specificity: Reversion of iso-l-cytochrome c mutants of yeast. J . Mol. Biol. 79, 65-82. Prakash, L., and Sherman, F. (1974). Differentiation between amber and ochre mutants of yeast by reversion with 4- Nitroquinoline-1-oxide. Genetics 77, 245-254. Prakash, L., Stewart, J. W., and Sherman, F. (1974). Specific induction of transitions and transversion of G-C base pairs by 4-Nitroquinoline-1-oxidein iso-1-cytochrome c mutants of yeast. J . Mol. Biol. 85, 51-65. Prakash, L., Hinkle, D., and Prakash, S. (1979a). Decreased UV mutagenesis in cdc8, a DNA replication mutant of Saccharomyces cereuisiae. Mol. Gen. Genet. 172, 249-258. Prakash, S., Prakash, L., Burke, W., and Montelone, B. A. (1979b). Effects of the rad52 gene on recombination in Saccharomyces cereuisiae. Genetics 94, 31-50. Prazmo, W., Balbin, E., Baranowska, H., Ejchart, A., and Putrament, A. (1975). Manganese mutagenesis in yeast. 11. Conditions of induction and characteristics of respiratory deficient Saccharomyces cerevisiae mutants induced with manganese and cobalt. Genet. Res. 26, 21-29. Putrament, A., Baranowska, H., and Prazmo, W. (1973). Induction by manganese of mitochondrial antibiotic resistance mutations in yeast. Mol. Gen. Genet. 126, 357-366. Putrament., A.., Baranowska. H.. Eichart.. A,.. and Prazmo. W. (1975a). Manganese mutagenesis in yeast. A practical application of manganese for the induction of mitochondrial antibiotic resistant mutations. J . Gen. Microbiol. 90, 265-270. Putrament, A., Baranowska, H., Ejchart, A., and Prazmo, W. (1975b). Manganese mutagenesis in yeast. IV. The effect of magnesium, protein synthesis inhibitors and hydroxyurea on AntR induction in mitochondrial DNA. Mol. Gen. Genet. 140, 339-347. Putrament, A,, Baranowska, H., Ejchart, A., and Jachymczyk, W. (1977). Manganese mutagenesis in yeast. VI. Mn2’ uptake, mit DNA relication and ER induction. Comparison with other divalent cations. Mol. Gen. Genet. 151, 69-76. Putterman, G. J., Margoliash, E., and Sherman, F. (1974). Identification of missense mutants by amino acid replacements in iso-1-cytochrome c from yeast. J . Biol. Chem. 249, 4006-4015. Quah, S.-K., von Borstel, R. C., and Hastings, P. J. (1977). Antimutators in yeast. In “The Molecular Biology of Yeast,” p. 82. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. I
I
”
MUTAGENESIS IN S .
cerevisiae
251
Quah, S.-K., von Borstel, R. C., and Hastings, P. J. (1980). The origin of spontaneous mutation in Saccharomyces cerevisiae. Genetics 96, 819-839. Radman, M. (1974). Phenomenology of an inducible mutagenic DNA repair pathway in Escherichia coli: SOS repair hypothesis. In “Molecular and Environmental Aspects of Mutagenesis” (L. Prakash, F. Sherman, M. W. Miller, C. W. Lawrence, and H. W. Taber, eds.), pp. 128-142. Thomas, Springfield, Illinois. Radman, M., Villani, G., Boiteux, S., Kinsella, A. R., Glickman, B. W., and Spadari, S. (1979). Replication fidelity: Mechanisms of mutation avoidance and mutation fixation. In “DNA: Replication and Recombination.” Cold Spring Harbor Symp. Quant. Biol. XLIII. Resnick, M. A. (1969). Genetic control of radiation sensitivity in Saccharomyces cerevisiae. Genetics 62, 519-531. Resnick, M. A. (1975). The repair of double-strand breaks in chromosomal DNA of yeast. I n “Molecular Mechanisms for Repair of DNA” (P. C. Hanawalt, and R. M. Setlow, eds.), Part B, pp. 549-556. Plenum, New York. Resnick, M. A. (1976). The repair of double-strand breaks in D N A A model involving recombination. J . Theor. Biol. 59, 97-106. Resnick, M. A,, and Martin, P. (1976). The repair of double-strand breaks in the nuclear DNA of Saccharomyces cerevisiae and its genetic control. Mol. Gen. Genet. 143, 119-129. Resnick, M. A., and Setlow, J. K. (1972). Repair of pyrimidine dimer damage induced in yeast by ultraviolet light. J . Bacteriol. 109, 979-986. Reynolds, R. J. (1975). Single-strand breaks in DNA from UV-irradiated wild type and UV sensitive strains of Saccharomyces cerevisiae. Biophys. J . 15, 195a. Reynolds, R. J. (1978). Removal of pyrimidine dimers from Saccharomyces cerevisiae nuclear DNA under non-growth conditions as detected by a sensitive, enzymatic assay. Mutat. Res. 50, 43-56. Reynolds, R. J., and Friedberg, E. C. (1980). The molecular mechanism of pyrimidine dimer excision in Saccharomyces cerevisiae. I. Studies with intact cells and cellfree systems. I n “DNA Repair and Mutagenesis in Eucaryotes” (W. M. Generoso, M. D. Shelby, and F. J. de Serres, eds.), pp. 121-139. Plenum, New York. Reynolds, R. J., and Friedberg, E. C. (1981). Molecular mechanisms of pyrimidine dimer excision in Saccharomyces cerevisiae. 11. The incision of UV-irradiated DNA in vivo. J . Bacteriol. 146, 692-704. Rodarte-Ramon, U. S., and Mortimer, R. K. (1972). Radiation-induced recombination in Saccharomyces: Isolation and genetic study of recombination-deficient mutants. Radiat. Res. 49, 133-147. Roman, H. (1956). Studies of gene mutation in Saccharomyces. Cold Spring Harbor Symp. Quant. Biol. 21, 175-183. Roth, J. R. (1974). Frameshift mutations. Annu. Rev. Genet. 8, 319-346. Rothman, R. H., Margossian, L. J., and Clark, A. J. (1979). W-reactivation of phage lambda in recF, recL, uvrA, and uvrB mutants. Mol. Gen. Genet. 169, 279-287. Ruhland, A,, and Brendel, M. (1979). Mutagenesis by cytostatic alkylating agents in yeast strains of differing repair capacities. Genetics 92, 83-97. Rupp, W. D., and Howard-Flanders, P. (1968). Discontinuities in the DNA synthesised in an excision-defective strain of Escherichia coli following ultraviolet irradiation. J . Mol. Biol. 31, 291-304. Rupp, W. D., Wilde, C. E., Reno, D. L., and Howard-Flanders, P. (1971). Exchanges between DNA strands in ultraviolet-irradiated Escherichia coli. J. Mol. Biol. 61, 25-44.
252
CHRISTOPHER W. LAWRENCE
Saeki, T., Machida, I., and Nakai, S. (1974). Split dose recovery controlled by XS1 gene in yeast. Radiat. Res. 59, 95. Saeki, T., Machida, I., and Nakai, S. (1980). Genetic control of diploid recovery after y-irradiation in the yeast Saccharomyces cerevisiae. Mutat. Res. 73, 251-265. Salts, Y., and Ronen, A. (1971). Neighbor effects in the mutation of ochre triplets in the T4rZZ gene. Mutat. Res. 13, 109-113. Samson, L., and Cairns, J. (1977). A new pathway for DNA repair in Escherichia coli. Nature (London) 267, 281-283. Schendel, P. F., and Defais, M. (1980). The role of umuC gene product in mutagenesis by simple alkylating agents. Mol. Gen. Genet. 177, 661-665. Schendel, P. F., Defais, M., Jeggo, P., Samson, L., and Cairns, J. (1978). Pathways of mutagenesis and repair in Escherichia coli exposed to low levels of simple alkylating agents. J . Bacteriol. 135, 466-475. Schindler, D., Grant, P., and Davies, J. (1974). Trichodermin resistance - mutation affecting eukaryotic ribosomes. Nature (London) 248, 535-536. Shanki, A. S. K. (1975). Study of yeast mutant of Saccharomyces cerevisiae obtained with treatments of 6-Hydroxylaminopurine. Thesis, Candidate of Biol. Sci. A.A. Zhdanor State University of Leningrad, USSR. Sherman, F., and Sloninski, P. P. (1964). Respiration-deficient mutants of yeast. 11. Biochemistry. Biochim. Biophys. Acta 90, 1-15. Sherman, F., and Stewart, J . W. (1973). Mutations a t the end of the iso-1-cytochrome c gene of yeast. In “The Biochemistry of Gene Expression in Higher Organisms” (J. K. Pollak and J. W. Lee, eds.), pp. 56-86. Australian and New Zealand Book Co. PTY. LTD, Sydney. Sherman, F., and Stewart, J. W. (1974). Variation of mutagenic action on nonsense mutants a t different sites in the iso-1-cytochrome c gene of yeast. Genetics 78, 97-113. Sherman, F., and Stewart, J. W. (1978). The genetic control yeast iso-1 and iso-2 cytochrome c after 15 years. Zn “Biochemistry and Genetics of Yeasts, Pure and Applied Aspects” (M.Bacila, B. L. Hokeeker, and A. 0. M. Stopani, eds.), pp. 273-316. Academic Press, New York. Sherman, F., Stewart, J. W., Jackson, H., Gilmore, R. A,, and Parker, J . H. (1974). Mutants of yeast defective in iso-1 cytochrome c. Genetics 77, 255-284. Sherman, F., Jackson, M., Liebman, S. W., Schweingruber, A. M., and Stewart, J. W. (1975). A deletion map of cycl mutants and its correspondence to mutationally altered iso-1-cytochromes c of yeast. Genetics 81, 51-73. Singh, A., and Sherman, F. (1975). Characteristics and relationships of mercury-resistant mutants and methionine auxotrophs of yeast. J . Bacteriol. 118, 911-918. Skogerson, L., McLaughlin, C., and Wakatama, E. (1973). Modification of ribosomes in cryptopleurine resistant mutants of yeast. J . Bacteriol. 116, 818-822. Smith, M., Leung, D. W., Gillam, S., Astell, C. R., Montgomery, D. L., and Hall, B. C. (1979). Sequence of the gene for iso-1-cytochrome c in Saccharomyces cerevisiae. Cell 16, 753-761. Snow, R. (1967). Mutants of yeast sensitive to ultraviolet light. J . Bacteriol. 94,571-575. Sora, S., Panzeri, L., and Magni, G. E. (1973). Molecular specificity of 2-Aminopurine in Saccharomyces cerevisiae. Mutat. Res. 20, 207-213. Spatz, H. Ch., and Trautner, T. A. (1970). One way to do experiments on gene conversion? Transfection with heteroduplex SPPl DNA. Mol. Gen. Genet. 109,84-106. Steinborn, G. (1978). Uvm mutants of Escherichia coli K12 deficient in UV mutagenesis. I. Isolation of uum mutants and their phenotypical characterization in DNA repair and mulagenesis. Mol. Gen. Genet. 166, 87-93.
MUTAGENESIS IN S .
cerevisiae
253
Steinborn, G. (1979). Uum mutants ofEscherichia coli K12 deficient in UV mutagenesis. 11. Further evidence for a novel function in error-prone repair. Mol. Gen. Genet. 175, 203-208. Stewart, J . W., and Sherman, F. (1972). Demonstration of UAG as a nonsense codon in Bakers’ yeast by amino-acid replacements in iso-1-cytochrome c. J . Mol. Biol. 68, 429-443. Stewart, J . W., and Sherman, F. (1973). Confirmation of UAG as a nonsense codon in Bakers yeast by amino-acid replacements of glutamic acid 71 in iso-I-cytochrome C. J . Mol. Biol. 78, 169-184. Stewart, J. W., and Sherman, F. (1974). Yeast frameshift mutations identified by sequence changes in iso-1-cytochrome c . In “Molecular and Environmental Aspects of Mutagenesis” (L. Prakash, F. Sherman, M. W. Miller, C. W. Lawrence, and H. W. Taber, eds.), pp. 102-127. Thomas, Springfield, Illinois. Stewart, J . W., Sherman, F., Shipman, N., and Jackson, M. (1971). Identification and mutational relocation of the AUG codon initiating translation of iso-1-cytochrome c in yeast. J . Biol. Chem. 246, 7429-7445. Stewart, J . W., Sherman, F., Jackson, M., Thomas, F. L. X., and Shipman, N. (1972). Demonstration of the UAA ochre codon in Bakers’ yeast by amino-acid replacements in iso-1-cytochrome c. J . Mol. B i d . 68, 83-96. Suslova, N. G., and Zakharov, I. A. (1971). Study of the rate of the spontaneous mutational process in x-ray sensitive mutants of Saccharomyces cerevisiae. Genetika 7, 91-98. Tuite, M. F., and Cox, B. S. (1980). Ultraviolet mutagenesis studies of [psi],a cytoplasmic determinant of Saccharomyces cereuisiae. Genetics 95, 611-630. Unrau, P., Wheatcroft, R., and Cox, B. S. (1971). The excision of pyrimidine dimers from DNA of ultraviolet irradiated yeast. Mol. Gen. Genet. 113, 359-362. Villani, G., Boiteaux, S., and Radman, M. (1978). Mechanism of ultraviolet-induced mutagenesis: Extent and fidelity of in uitro DNA synthesis on irradiated templates. Proc. Natl. Acad. Sci. U.S.A.75, 3037-3041. von Borstel, R. C. (1978). Measuring spontaneous mutation rates in yeast. In “Methods in Cell Biology” (D. M. Prescott, ed.), Vol. 20, pp. 1-23. Academic Press, New York. von Borstel, R. C., and Hastings, P. J. (1977). Mutagenic repair pathways in yeast. In “Research in Photobiology” (A. Castellani, ed.), pp. 683-687. Plenum, New York. von Borstel, R. C . , Graham, D. E., LaBrot, K. J., and Resnick, M. A. (1968). Mutator activity of a X-radiation-sensitive yeast. Genetics 60, s233. von Borstel, R. C., Cain, K. T., and Steinberg, C. M. (1971). Inheritance of spontaneous mutability in yeast. Genetics 69, 17-27. von Borstel, R. C., Quah, S.-K., Steinberg, C. M., Flury, F., and Gottlieb, D. J . C. (1973). Mutants of yeast with enhanced spontaneous mutation rates. Genetics Suppl. 73, 141-151. Wagner, R., and Meselson, M. (1976). Repair tracts in mismatched DNA heteroduplexes. Proc. Natl. Acad. Sci. U.S.A.73, 4135-4139. Waters, R., and Moustacchi, E. (1974). The fate of ultraviolet-induced pyrimidine dimers in the mitochondria1 DNA of Saccharomyces cereuisiae following various post-irradiation cell treatments. Biochim. Biophys. Acta 366, 241-250. Whelan, W. L., Gocke, E., and Manney, T. R. (1979). The CAN1 locus of Saccharomyces cereuisiae: Fine-structure analysis and forward mutation rates. Genetics 91,35-51. Wildenberg, J., and Meselson, M. (1975). Mismatch repair in heteroduplex DNA. Proc. Natl. Acad. Sci. U.S.A.72, 2202-2206. Witkin, E. M. (1967). Mutation-proof and mutation-prone modes of survival in deriv-
254
CHRISTOPHER W. LAWRENCE
atives of Escherichia coli B differing in sensitivity to ultraviolet light. In “Recovery and Repair Mechanisms in Radiobiology.” Brookhaven Symp. Biol. 20, 17-55. Witkin, E. M. (1969). Ultraviolet-induced mutation and DNA repair. Annu. Rev. Genet. 3, 525-552. Witkin, E. M. (1972). Ultraviolet mutagenesis in repair-deficient derivatives of Escherichia coli Blr: uvrA recB and uvrArecC strains. Mutat. Res. 16, 235-242. Witkin, E. M. (1976). Ultraviolet mutagenesis and inducible DNA repair in Escherichia coli. Bacteriol. Rev. 40, 869-907. Witkin, E. M., and Wermundsen, 1. E. (1979). Targeted and untargeted mutagenesis by various inducers of SOS function in Escherichia coli. Cold Spring Harbor Symp. Quant. Biol. 43, 881-886. Zakharov, 1. A., Kozina, T. N., and Federova, I. V. (1968). Increase of spontaneous mutability in ultraviolet-sensitive yeast mutants. Dokl. Akad. SSSR 181,470-472. Zakharov, I. A., Kozina, T. N., and Federova, I. V. (1970). Effet de mutations vers la sensibilite au rayonnements ultraviolet chez la levure. Mutat. Res. 9, 31-39. Zimmermann, F. K. (1968). Sensitivity to methylmethanesulfonate and nitrous acid of ultraviolet light-sensitive mutants in Saccharomyces cerevisiae. Mol. Gen. Genet. 102, 247-256. Zimmermann, F. K. Schwaier, R., and von Laer, U. (1966). The effect of residua1 growth on the frequency of reverse mutations induced with nitrous acid and l-nitrosoimidazolidone-2 in yeast. Mutat. Res. 3, 171-173.
TRITICALE: PRESENT STATUS AND FUTURE PROSPECTS P. K. Gupta and P. M. Priyadarshan Cytogenetics Laboratory, Department of Agricultural Botany, Meerut University, Meerut, India
I. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11. Taxonomy and Terminology . ................................... A.Taxonomy ..................................... B.Terminology .................................................... 111. Triticales at Different Ploidy Levels ................... A. Decaploid Triticales . . . . . . ........................ B. Octoploid Triticales . . . . . . ........................ C. Hexaploid Triticales ....................................... D. Tetraploid Triticales . . . . . . IV. Improvement and Assessment of Hexaploid Triticales . A. Derivation of Secondary Hexaploid Triticales ...................... B. The Role of the D Genome in the Evolution of Hexaploid Triticales C. Hybrid Necrosis-A Limiting Factor ..............................
256 258 262 265 265 265
272 274 278
V. Tetraploid Triticales
............
C. Contribution of Wheat D. General Conclusions . 255 ADVANCES IN GENETICS, Val. 21
Copyright 0 1982 by Academic Press, Inc. All rights of reproduction in any form reserved. ISBN 0-12-017621-1
256
P. K . GUPTA AND P. M. PRIYADARSHAN
................ B. Kernel Shriveling . . .
.............................
312 314
................
1. Introduction
Interspecific and intergeneric hybridization followed by chromosome doubling in plants is a well-established procedure for the creation of new species in nature. Its significance, for the first time, was emphasized by Winge (1917) and was later realized by the successful artificial synthesis of Nicotiana digluta (Clausen and Goodspeed, 19251, R a phanobrassica (Karpechenko, 19271, and Galeopsis tetrahit (Muntzing, 1930). Subsequently, with the discovery of the colchicine technique (Blakeslee and Avery, 1937; Nebel and Ruttle, 1938) it became possible for the plant breeders to repeat nature’s process of interspecific and intergeneric hybridization and chromosome doubling. A number of amphiploids were, therefore, artificially synthesized and the two most promising amphiploids recognized by Stebbins (1956) included Triticum-Agropyron, or perennial wheat and Triticum-Secale or triticale. Although breeders in Russia (Tsitsin, 1975) are still hoping to develop perennial wheat, breeders elsewhere in the world have given up hope and are not working toward this goal (Dewey, 1980). On the other hand, progress and excitement about the Triticum-Secale amphiploid, popularly known as triticale, have been enormous during the last 40 to 45 years, and particularly during the last 20 years. This resulted in the release, among others, of two most promising varieties. An important triticale cultivar Welsh released in Canada in October 1977 had a yield equal to the best wheats, which was 16% higher than another triticale cultivar Rosner released earlier in May 1969 (Larter et al., 1978). The other triticale cultivar Coorong, released in Australia in early 1980, is said t o yield more than wheat. The first sterile hybrid between wheat (Triticum) and rye (Secale), the two parents of present day triticales, was reported by Wilson (1876). The fertile hybrid was reported later by Rimpau (18911, and was discovered to be an amphiploid (Miintzing, 1936). Meister (1930) gave the first botanical description of wheat-rye hybrids and designated the new species as Triticum secalotricum saratoviense Meister.
TRITICALE
257
However, the name “Triticale” was used later by Lindschau and Oehler (1935) on the advice of Tschermak, who himself later suggested the name Secalotricum in analogy to the names Aegilotricum, Haynaldtricum, and Agrotricum then being used for other similar amphiploids. Secalotricum could not replace the name triticale and is now used for triticales which have rye as their female parent. According to Muntzing (1979), a major effort on triticale breeding from 1918 to 1934 was made in Russia at Saratov. Later, Muntzing (1939) spent much time in the study of available octoploid triticales. However, after 1937, with the help of the colchicine technique, a large number of triticales were produced both a t octoploid and hexaploid levels. The initial emphasis in triticale breeding was on octoploid strains (Muntzing, 1948, 1956, 1957, 1958; Ingold et al., 1968), although the first hybrid between tetraploid wheat and rye was described as early as 1913 (Jesenko, 1913) and the amphiploid with 2n = 42 was described as early as 1938 (Derzhavin, 1938). This earlier emphasis on octoploids, however, shifted in the late 1950s (SanchezMonge, 1956, 1959; Sanchez-Monge and n i o , 1954) and a major effort during the last 20 years has been devoted to the improvement of hexaploid triticales, leading to spectacular results. Furthermore, although the initial important work on triticale was done in Europe, with emphasis on octoploids in Sweden and on hexaploids in Spain, the most important recent work was done due to collaboration between the Department of Plant Science, University of Manitoba in Canada and CIMMYT (Centro Internacional de Mejoramiento de Maiz y Trigo) in Mexico. The senior author of this article was associated with some of the early work done at Manitoba from 1964 to 1967, and therefore, retained his interest in the progress of the work on triticale in Manitoba and elsewhere. Due to increasing interest in triticale as an important crop of commercial value, during the last decade, several basic and applied aspects of triticale breeding received the major attention of workers in several countries. These include the following: (1) A taxonomically valid name had to be found, since the generic name “Triticale” and the suggested specific name “Triticale hexaploide Lart” for hexaploid triticale were considered invalid according to the International Code of Botanical Nomenclature (ICBN). The more acceptable generic name for technical reasons became x Triticosecale Wittmack, since unfortunately a proposal for conserving the popular name Tritzcale was rejected. (2) Reproductive disorders including meiotic instability, aneuploidy, partial sterility, kernel shriveling, and preharvest sprouting were considered to be major problems, and solutions for these were sought. (3) Since
258
P. K. GUPTA AND P. M. PRIYADARSHAN
hexaploid triticales initially had cytoplasm from tetraploid wheats, nucleocytoplasmic interactions were recognized and cytoplasm from hexaploid wheat was introduced. (4) Cytogenetic studies revealed that rye chromosomes and particularly their telomeric heterochromatic blocks were associated with several problems in triticales. It was also found that in several improved triticale strains, heterochromatin content was reduced, so that further improvement is expected to be achieved through loss of heterochromatin in rye chromosomes. ( 5 ) In several hexaploid triticales, the full complement of rye chromosomes was not found, so that it is believed that the substitution of chromosomes of the D genome for those of rye, in addition to heterochromatin loss, will play a major role in the improvement of hexaploid triticale. (6) Tetraploid triticales have been synthesized opening new avenues for improvement of hexaploid triticales. (7) Octoploid triticales, due to their cultivation in countries like China, are again looked upon as potential material for a new crop. (8) Adequate attention is being paid to agronomic aspects, disease resistance, nutritive aspects including feeding value, and aspects dealing with their use in several industries. The quantum of work done in triticales is evident from several reviews written in recent years, on different aspects of triticales (OMara, 1953; Briggle, 1968; Sapra et al., 1973; Kaltsikes, 1974a; Scoles and Kaltsikes, 1974; Zillinsky, 1974b; Hawthorn, 1976; Gustafson, 1976b; Bernard, 1979a; Muntzing, 1979; Thomas et al., 19801, and from four symposia held during 1974. Nevertheless, the accelerating pace of work on this new important man-made cereal is great enough t o warrant writing a comprehensive account on this crop. It will be seen that with the availability of new information, the information presented in earlier reviews became obsolete and several notions, views, and theories were proved to be erroneous. We have tried to review critically the available results (which are contradictory in many cases), analyze them, and present our own views. II. Taxonomy and Terminology
A. TAXONOMY
The triticales are amphiploids derived from hybridization between species represented by the genera Triticum L. and Secale L., and hence its name triticale or x Triticusecale Wittmack. Sometimes these amphiploids are also called Secalutricum, when the species represented by the genus Secale is used as the female parent. These am-
TRITICALE
259
phiploids known as triticales were derived from hybrids of hexaploid and tetraploid wheats with diploid rye in order to give rise t o the octoploid and hexaploid triticales, respectively. Similarly, tetraploid triticales should ordinarily be derived from crosses between diploid wheat and diploid rye. However, such a cross between diploid wheats and diploid rye could not produce tetraploid amphidiploids and therefore tetraploid triticales were indirectly derived through crosses between hexaploid triticale and diploid rye. In such cases, therefore, the derived tetraploid triticales were not true amphiploids, since they contained a mixed genome carrying chromosomes from two different original genomes A and B. The situation with several of the promising hexaploid triticales is similar, where the whole genome of rye is not available, some of the chromosomes of this genome being replaced by chromosomes of the D genome. It is thus obvious that many of our presently available triticales are not true amphiploids. There has been some controversy regarding the nomenclature of triticales and varying suggestions have been given at different times without giving due importance to rules laid down in the International Code of Botanical Nomenclature (ICBN) and the International Code of Nomenclature of Cultivated Plants (ICNCP). This led t o frequent usage in the literature of the name Triticale hexuploide Lart. (Larter et ul., 1970), which is illegitimate according to article 23 and recommendation 23B of the ICBN (Lanjouw et al., 1966). In this connection, articles 13 and 16 of the International Code of Nomenclature of Cultivated Plants-1969 (ICNCP) (see Gilmour et al., 1969) are reproduced: Article 13: Botanical names in Latin form for interspecific and intergeneric hybrids and their derivatives are governed by the Botanical Code. Such hybrids are designated, by a formula or a name. All derivatives from same parental combination of two or more species have the same formula or the same botanical name except where established custom or special circumstances demand otherwise, as, for example, in hybrids of different chromosome status. Article 16: The botanical name of derivatives of a n intergeneric hybrid consists of a “generic” name, usually formed by a combination of parts of the two parent genera, preceded by the multiplication sign ( x 1 and normally followed by a Latin collective epithet. The “generic” name of a multigeneric hybrid usually consists of a personal name to which the termination ara is added.
x Triticosecale Wittmack is the first published name for the derivatives of intergeneric hybrids between Triticum and Secale (Wittmack, 1899). In accordance with Article H.4 of the International Code
260
P. K. GUPTA AND P. M. PRIYADARSHAN
of Botanical Nomenclature (Lanjouw et al., 1966) and Article 16 of the International Code of Nomenclature of Cultivated Plants-1969 (ICNCP-see Gilmour et al., 1969), Triticosecale has priority over all other names, including Triticale Muntzing (Muntzing, 1936). Obviously therefore, x Triticosecule Wittmack is the correct generic name for the derivatives of integeneric hybrids derived from crosses between Triticum and Secale as suggested by Terrell (1970). Despite this, due to long usage of the name triticale and its popularity, Baum (1971a) suggested that the name Triticale Muntzing should be retained since it is also a valid name published before January 1, 1953 (ICBN, Article 35-see Lanjouw et al., 1966).Baum (1971b),therefore, made a proposal to conserve the generic name Triticale Muntzing under the provisions of ttNomina Generica Conservanda Proposita” (proposal No. 322, Taxon 20, 644, 1971). This proposal was based on long usage of the name Triticale in the literature of plant breeding and other disciplines. Since in the International Code of Nomenclature of Cultivated Plants (Reg. Veg. 64, Art. 8 , 1969) x Triticosecale Wittmack is accepted as a hybrid generic name and “triticale” as a common name, the proposal for conserving this name Triticale Muntzing was unfortunately rejected due to a solitary vote (B. R. Baum, 1980, personal communication) by the Nomenclature Committee for Spermatophyta (see McVaugh, 1973). The committee felt that even if x Triticale is to be recommended for conservation, no type of the name can be designated, so that with change of generic concepts of genera Triticum and Secale, Triticale may not remain the correct name for a cross between two genera other than Triticunt and Secale. Muntzing (1979) also felt that x Triticosecale Wittmack is the only acceptable name. We however, feel that x Triticale Muntzing can still become acceptable through a modification of the International Code of Nomenclature of Cultivated Plants to remove the variance between ICBN and ICNCP. The variety of names suggested in the past for the amphiploids will be evident from the list of names enumerated in Table 1, derived from Baum (1971a), who has considered in detail the problem of nomenclature of amphiploids taking triticale as an example. Further details of Baum’s proposals regarding specific names under the proposed genus x Triticale are available in Table 2. No acceptable specific names for various forms of triticales are now available, since the names suggested by Baum (1971a) and Zillinsky (1974a) present some problems according to Gustafson (1976b). It may also be necessary to consider here whether or not the triticales having substitutions of D chromosomes for those of R chromosomes should be called triticales and therefore be included in the
26 1
TRITICALE
TABLE 1 Different Names Used for Various Triticum-Secale Amphiploids Arranged Chronologically" Name 1. Triticosecale 2. Triticosecale rimpaui 3. Aegilotricale Tschermak 4. Triticum L. 5. Triticum secalotricum Saratoviense 6 . Tritisecale 7. Triticale 8. Triticale rimpau 9. Triticale strain rimpau 10. Triticale taylor 11. Triticale strain taylor 12. Triticale Meister 13. Secalotricum 14. Triticale Muntzing 15. Triticum L.
16. Triticum turgid0 cereale 17. Triticum dicoccum-cereale 18. Triticum durosecale 19. Triticale hexaploide Rosner 20. Secalotricum
Parentage and Ploidy Amphiploids (2n = 8x = 56) Triticum aestiuum L. x Secale cereale L. Probably amphiploids of Aegilops x Iriticum x Secale (2n = 82 = 56) Amphiploid (2n = 8x = 56) Triticum aestiuum L. x Secale cereale L. Amphiploids (2n = 8%= 56) -
Haploid triticale 2 n = 28 Hexaploid wheat x rye Amphiploids (2n = 8x = 56 and 2n = 6x = 42) Amphiploids (2n = 62 = 42) (AABBRR) Triticum turgidum L. x Secale cereale L. Triticum dicoccum (Schrank) Schubler x Secale cereale L. Triticum durum Desf. x Secale cereale L. Triticum turgidum L. x Secale cereale L. (Rye x wheat)
Reference Wittmack (1899) Wittmack (1899) Tschermak and Bleier (1926) Meister (1930) Meister (1930) Lebedeff (1934) Miintzing (1936) Miintzing (1936) Miintzing (1939) Miintzing (1936) Muntzing (1939) v. Berg and Oehler (1938) Tschermak (1938) OMara (1953) Kiss (1966a) Kiss (1966a) Kiss (1966a) Kiss (1966a) Larter et al. (1970) Smutkupt (1968); Robbelen and Smutkupt (1968)
Modified from Baum (1971a).
genus x Triticosecale. Similarly the name triticale has also been used for amphiploids like BBRR. In such a situation, unless we accept that the genome B belongs to the genus Triticurn, it will not be appropriate to call these amphiploids by the name triticale or by the name x Triticosecale (see Article 13, International Code of Nomenclature of Cultivated Plants-1969). This question will be discussed in relatively more detail in the following section dealing with terminology.
P.
262
K. GUPTA AND P. M. PRIYADARSHAN
TABLE 2 Suggested Names for Various Triticum-Secale Amphiploids“ Name 1. Triticale turgidocereale 2 . Triticale dicoccocereale 3. Triticale durocereale 4. Triticale dicoccoidecereale 5 . Triticale rimpaui 6. Triticale duro-montanum. 7 . Triticale carthlico-vavilovi 8. Triticale timopheevi-cereale a
Parentage
Triticum turgidum x Secale cereale T . dicoccum x 5’.cereale T . durum x S. cereale T . dicoccoides x S. cereale T . aestivum x S. cereale T . durum x S. montanum T . carthlicum x S . valvilovi T . timopheevi x S. cereale
Based on information given by Baum (1971a).
B. TERMINOLOGY It has now been realized that triticales constitute a polyploid complex or what has been called a “hybrid swarm” by Gustafson (1976b), and comprise many different units (Muntzing, 1979). Different terms have been used to identify and distinguish between different kinds of these units available among triticales. Even as late as 1976, Qualset thought that the primary triticales were ffspontaneoushybrids between common (bread) wheat and rye.” However, we know that generally the name triticale is used only for the fertile and true breeding allopolyploids obtained after chromosome doubling from sterile hybrids, and distinction is often made between primary and secondary triticales. The primary triticales often include only the raw amphiploids or their direct descendents. The secondary triticales, on the other hand, are derived from hybrids obtained through crosses of triticales with hexaploid wheat or with triticales at other ploidy levels, followed by several back crosses with parent triticale as the recurrent parent. Among hexaploids, most of these so-called secondary triticales carry the cytoplasm of hexaploid wheat and therefore do not represent the true amphiploids but the hexaploid wheats, where the D genome has been replaced by the R genome. Kiss (1966a) also argued that the name triticale be retained only for octoploids and that hexaploid triticale be included in the genus Triticurn, since these were derived due to substitution of RR for DD. Although primary hexaploids may not be substitutions, since they carry cytoplasm of tetraploid wheats, some of the secondary triticales with hexaploid cytoplasm are definitely so. In still other cases, some of the chromosomes of the R genome are replaced by those of the D genome. Similar modifications are also possible at the octoploid level. An attempt therefore has been made
TRITICALE
263
by Muntzing (1979) to make a further distinction both among the primary triticales and the secondary triticales. He has described five types of triticales: (1)primary triticales, (2) recombined triticales, (3) secondary triticales, (4) substitutional triticales, and (5)secondary substitutional triticales. According to Muntzing (1979), the primary triticales are those autogamous strains that are raised from the immediate product of chromosome doubling. From the category of primary triticales, he has excluded those strains which result from intercrossing primary triticales belonging to the same chromosome level (octoploid triticales or hexaploid triticales). These triticales which are the product of genetic recombination between different amphiploids or primary triticales were called recombined triticales by him and were considered to be comparable to intraspecific hybrids. The triticale lines derived from crosses between hexaploid and octoploid triticales were considered to be secondary triticales by Miintzing (1979). These secondary triticales would be hexaploid or octoploid depending upon whether hexaploid triticales or octoploid triticales are used as recurrent parents, respectively. Improved triticales have also been obtained by crossing hexaploid triticale with hexaploid wheat, followed by the reconstitution of hexaploid triticale by backcrossing with hexaploid triticales. In such a process, the chromosome constitution of triticales may be fully restored or this may accompany substitution of specific D chromosomes for specific rye chromosomes. Although these products are often included in the category of secondary triticales, Muntzing (1979) preferred to call them substitutional triticales on the basis of a suggestion made earlier by Qualset et al. (1976). Muntzing (1979) has recognized yet another category due to crosses between his so-called secondary triticales (derived from crosses between octoploid triticales and hexaploid triticales) and hexaploid wheat. He called them secondary substitutional triticales. As recognized by Muntzing (1979), substitutional triticales can be distinguished only on the basis of laborious cytological analysis, which is not always possible in breeding work. Further, the products of crosses between hexaploid wheat and hexaploid triticales, which do not involve any substitutions, have not been accommodated in any of the five categories suggested by Muntzing (1979). According to him, the term secondary triticales should be reserved for triticales derived from crosses between octoploid and hexaploid lines, and therefore will not include the products of crosses between hexaploid wheat and hexaploid triticale. On the other hand, Muntzing’s category of substitutional triticales will not include the products of crosses between hexaploid wheat and hexaploid triticale, if they do not involve substitutions. To this extent, in our opinion, Muntzing’s terminology is useful, but
264
P. K. GUPTA AND P. M. PRIYADARSHAN
not adequate. We also feel that the distinction made by Muntzing between substitutional and secondary substitutional triticales may not be necessary, since on the basis of chromosome constitution they will not differ from each other and distinction between them will be possible only on the basis of knowledge about the method of their production. In view of the above discussion, it may be desirable t o have the primary triticales divided into (1) raw primary triticales and (2) recombined primary triticales. Similarly the secondary triticales, whenever possible, may be further subdivided into two types: (1) true secondary triticales, which carry 7 pairs of rye chromosomes, and (2) substitutional secondary triticales, which have less than 7 pairs of rye chromosomes. Such terminology will serve a useful purpose because in the absence of any knowledge of substitution, the substitutional triticales will also be called secondary triticales. There is yet another problem in using proper nomenclature and terminology for the so-called substitutional triticales where some of the R chromosomes are replaced by D genome chromosomes. While using the term substitutional triticales for such derivatives, the following question needs to be answered. What will be the range of chromosome substitution or what will be the maximum number of R chromosomes which need to be retained so that these derivatives remain qualified toLbe called substitutional triticales or triticales at all? This question is relevant because when more and more R chromosomes are replaced by D chromosomes, the product becomes more and more like wheat rather than like triticales. For instance, if there is only one pair of R chromosomes and the other six pairs are replaced by D, it will no longer remain triticale, but will become a disomic alien substitution line derived from hexaploid wheat. Since the presence of a mixed genome in secondary triticale has become very common and is not an exception, the validity of calling them triticales without having the full complement of Secale cereale needs to be examined. It may also be necessary to qualify the triticale products with respect to the cytoplasm which is present. Since most of the improved triticales are alloplasmic, their cytoplasm being derived from a source other than its two parents, it may be necessary to distinguish among (1) hexaploid triticales having cytoplasm from tetraploid wheat, (2) hexaploid triticale having cytoplasm from hexaploid wheat, and (3) hexaploid triticales with cytoplasm from diploid rye. Although a distinction has been made in the last category by calling them Secalotricum, the distinction of the first two categories has not been tried and needs careful consideration.
TRITICALE
265
111. Triticales at Different Ploidy Levels
Triticales have been synthesized at four different ploidy levels: (1) decaploid, (2) octoploid, (3) hexaploid, and (4) tetraploid. In the conventional methods, triticales have been derived by crossing species belonging to genera Triticum and Secale followed by doubling of chromosome number in the F, hybrid to get an amphiploid called triticale. This method was supplemented by the production of triple hybrids (F, hybrid x triticale). However, in some cases, the conventional method was not successful and, therefore, the synthesis of triticale depended entirely on the use of unconventional methods as in the case of decaploid and tetraploid triticales. The synthesis of triticales at four levels therefore will be discussed separately in this section.
A. DECAPLOID TRITICALES In the early 1950s, Muntzing, being satisfied with the progress he had made with the octoploid triticales, thought of producing decaploid triticale strains with 2n = 70. He felt tempted to do so, since he found that the tetraploid strains of rye were quite vigorous and productive and were even released to the farmers. In view of this, he thought that if a tetraploid complement of rye was combined with a hexaploid complement of wheat, an interesting triticale derivative could be obtained. When crosses were made between hexaploid wheat and tetraploid rye, no success was obtained and the failure was attributed to the slow rate of growth of the pollen tube of tetraploid rye relative to diploid rye. Therefore, an alternative method of crossing octoploid triticale with diploid rye was tried in order to get a pentaploid hybrid ABDRR (Muntzing, 1955). This cross was successful and the hybrid obtained, on chromosome doubling, gave a strain with 70 chromosomes (Fig. 1).This strain was of no value because it had very poor vigor and fertility. These triticale strains also had a tendency to revert back to lower chromosome numbers, the meiosis being irregular. Muntzing (19551, therefore, concluded that four rye genomes cannot successfully cooperate with a hexaploid wheat complement.
B. OCTOPLOID TRITICALES 1 . Crossability between Wheat and Rye Since the synthesis of octoploid triticales involved crosses between wheat and rye, the crossability between these two parents is relevant.
266
P. K . GUPTA AND P. M. PRIYADARSHAN
FIG. 1. Evolution of triticales at different ploidy levels. AA represents diploid wheat; AABB represents tetraploid wheat; A’A’B’B’DDrepresents hexaploid wheat; and RR represents diploid rye. (ABHABIRR is tetraploid triticale including a mixed genome (AB) of severn chromosomes of variable constitution.
It is known that there is a strong barrier of incompatibility controlled by a gene Kr, located on chromosome 5 (Lange and Riley, 1973) and another gene Kr,. The wheat variety “Chinese Spring” is homozygous
recessive for these genes and can readily cross with rye. The dominant alleles of the genes manifest themselves through inhibition of pollen tube growth both at the style and at the ovary wall. In case of plants with genotypes Kr, Kr, kr, kr,, fertilization could be rarely achieved (Lange and Wojciechowska, 1976). This problem of crossability could be overcome experimentally either by embryo-endosperm grafting (Pissarev and Vinogradova, 1944; Hall, 1954, 1956) or by irradiation of rye pollen with gamma rays (Pienaar, 1973).In the first alternative, it was shown that if wheat embryos were grafted on endosperm of rye, they grew into wheat plants which had a crossability about five times as high as in the control material, where wheat embryos were grafted into endosperm of the same wheat variety. In another experiment, when the embryo of a variety having very low crossability was grafted on endosperm of an easily crossable wheat variety, the embryo de-
TRITICALE
267
veloped into a wheat having increased crossability with rye. This suggested that in the embryo-endosperm grafting experiments there were some chemicals which passed from endosperm to embryo after the grafting was done. The second alternative for promoting crossability involved irradiation of rye pollen with gamma rays which effectively facilitated the crosses. No explanation for this enhanced crossability due to irradiated pollen was given by Pienaar (1973). However, the D genome also has some role in crossability, since it affects the germinability, which can be due to a weak K r system (Pienaar and Marais, 1976).
2 . Synthesis of R a w Amphiploids with 56 Chromosomes Octoploid triticales were initially produced due to spontaneous chromosome doubling in the hybrids between hexaploid wheat and diploid rye. Successful crosses between bread wheat and rye were made initially by E. Carman in the United States, W. Rimpau in Germany, and G. K. Meister in USSR. Although in the beginning it was speculated that the amphiploids originated from F, hybrids due to apogamous development followed by chromosome doubling, Muntzing (1936) later recognized that it was due t o spontaneous formation of small sectors of tissues with doubled chromosome number. Such a sector sometimes involved a solitary anther or a part thereof. Later, v. Berg and Oehler (19381, while describing their new wheat-rye amphiploids, also considered the possibility of occasional apomictic development of ovules in the F, hybrids. Major work on octoploid triticales, according to Muntzing (19791, was done between 1918 and 1934 at the Agricultural Experimental Station a t Saratov, USSR. This work started with the mass appearance of natural F, hybrids between wheat and rye, which later gave rise to fertile and true breeding amphiploids. Later in the 1930s in Sweden, Miintzing started his work on octoploid triticales with six strains, which included two strains from Germany, three from the USSR (including two strains of Russian origin), and one from Sweden itself. Two most important early primary octoploids were called strain A (triticale Rimpau) and strain C (Russian triticale or triticale Meister). Triticale Rimpau, which is the earliest octoploid triticale known, maintained complete constancy of chromosome number 2n = 56 during 45 years of multiplication without any selection or breeding effort (Muntzing, 1936). Muntzing (1939) described results of his detailed work with these six octoploid strains, which differed significantly for pollen fertility, seed set, vigor, gluten content, and baking capacity. Strain A and strain C also differed in meiotic stability. While strain
268
P. K . GUFTA AND P. M. PRIYADARSHAN
C was meiotically more stable with an average of 1.88 univalents per pmc, strain A was unstable with an average of 6.10 univalents per pmc, none of the pmc’s being normal. 3. Recombined Octoploid Triticales a. Crosses between Different Strains. The six octoploid triticale strains procured by Muntzing in Sweden were used by him in the 1930s for intercrosses to obtain recombinants. Surprisingly, crosses between strain A and strain C were made with difficulty. Seed set as low as an average of 5.08% was available in F, (A x C), although it was as high as 18.70%in the control crosses within the same strain. This sterility was still more pronounced in F,. This meant that there was an incompatibility barrier present between the primary strains. Muntzing also crossed his material with octoploid strains from other countries, especially those obtained from Dr. Ingold of Switzerland and selection among them is still being undertaken to bring about the desired improvement in octoploid triticales (Fig. 1). Muntzing (1979) looks for improvement in the breeding of octoploid triticales and as support refers to the practice of commercial cultivation of octoploid triticales in countries like China. b. Crosses between F, Hybrids (Wheat x Rye) and Triticale. Since the initial work involving crossing and recombination among octoploid triticale strains did not give very encouraging results, Muntzing (1935) suggested other methods for the production of octoploid triticales. One of these methods involved the production of triple hybrids through pollination of wheat X rye (F,) hybrids (ABDR) by the pollen from the octoploid triticale (Fig. 2; Muntzing, 1939). In such attempts, when the F, hybrids produced unreduced female gametes having 28 chromosomes, the fertilization due to pollen carrying 28 chromosomes gave new triticale plants with 56 chromosomes. That the unreduced ovules with 28 chromosomes were really produced in primary hybrids was earlier shown by Lebedeff (19341, since he was successful in producing plants with 35 chromosomes by pollinating the wheat-rye F, hybrids (ABDR = 28 chromosomes) by the pollen from diploid rye. Such crosses between F, hybrids and octoploid triticales were possible by growing the wheat-rye F, hybrids surrounded by the plants of octoploid triticale (strains A and C), to allow a certain amount of wind pollination. It was also possible to increase the number of F, hybrid plants vegetatively as described by Riebesel (1937). From these open pollinated plants, hybrids having chromosome numbers ranging from 35 to 69 were obtained, which exhibited two modal chromosome numbers, 49 and 56, presumably resulting due to functioning of the ga-
TRITICALE
269
FIG. 2. Ears of (a) bread wheat; (b) octoploid triticale; and (c) diploid rye. The octoploid triticale ears are from two different I, plants derived from a new triticale heterozygote ( 2 n = 56) which arose from pollination of a primary wheat x rye hybrid ( 2 n = 28) with triticale pollen ( n = 28). from Miintzing (1939) with permission.
metes containing 21 and 28 chromosomes, respectively. Miintzing (1979) recognized that genotypic differences existed between different wheat varieties for the success in producing a high frequency of hybrids with rye. Oehler (1936) and v. Berg (1937) of the Erwin Baur Institute, Muncheberg, Germany also intercrossed four new primary octoploid strains in order to get more comprehensive material of triticale with 56 chromosomes. The new strains were also used as pollinators for primary hybrids between wheat and rye. Katterman (1939) also used this method with Triticale Rimpau as octoploid pollinator. v. Berg and Oehler (1938) suggested that amphiploids can be obtained, if the F, hybrids (hexaploid wheat x diploid rye) are backcrossed, first to one parent and then to the other parent in two steps, provided un-
270
P. K. GUPTA AND P. M. PRIYADARSHAN
reduced gametes are available in each step. Although these workers were not successful with this method, Florell (1936) believed that the octoploid triticales produced by Taylor and Quisenberry (1935) in the United States might have arisen in this manner. 4 . Merits and Demerits of Octoploid Triticales The octoploid triticales have good winter hardiness and have early flowering and seed maturity. The protein content is higher and baking qualities are good. Among the disadvantages is partial sterility, which is partly compensated for by large kernels. Octoploid triticales in rainy weather used to sprout at harvest time. Breeding work can, however, overcome the negative characters. The recombinant strains of octoploids were found to have a low frequency of aneuploidy and sterility and the euploids had higher fertility than aneuploids (Weimarck, 1973, 1975a). The octoploid triticales have been found to be superior at higher altitudes in China and are cultivated in the Yunnan Kweichow plateau of southwestern China and also in Ningsiahui country in North China (Muntzing, 1979).
C. HEXAPLOID TRITICALES According to Muntzing (1979), the first hybrid between tetraploid wheat ( T . dicoccoides) and diploid rye ( S . cereale) was produced by Jesenko (1913). Another report of hybridization between tetraploid wheat ( T . durum) and diploid rye ( S . cereale) was given in 1924 by Schegalow (see Plotnikowa, 1932; Muntzing, 1979). The first amphiploid between tetraploid wheat ( T . durum) and wild rye (S. montunum), however, was possible only in 1938 (Derzhavin, 1938), after the availability of colchicine as an alkaloid for doubling the chromosome number (Blakeslee and Avery, 1937; Nebel and Ruttle, 1938). Later, the hexaploid amphiploid utilizing T . durum and cultivated rye was produced by O’Mara (1948) and that utilizing T . turgidum and rye was produced by Nakajima (1942). More variable material for the hexaploids was produced only after 1950, by workers in several countries including Spain, Hungary, Canada, Sweden, and the United States. After the availability of embryo culture and colchicine techniques, the production of F, hybrids between tetraploid wheat and diploid rye became a routine procedure. However, an additional but quite different method for the production of hexaploid triticales was suggested at the University of Manitoba (Tsuchiya and Larter, 1968; Kaltsikes,
TRITIC ALE
271
1974a). In this method, predoubled parental stocks were crossed, so that the colchicine treatment is not given to the F, hybrid but is given to the parents before the crossing is done (Fig. 1). A much higher seed set was obtained in the cross between doubled tetraploid wheat and doubled diploid rye. The advantage of this method would be that the crossing will be much more successful and one may not have to resort to embryo culture technique. In another method it was suggested that the crosses may be made first, among the wheat varieties and among the rye varieties separately after chromosome doubling. This would enable the synthesis of hexaploid triticales with a wide range of variability. Sisodia and McGinnis (1970b) proposed two new methods for synthesizing, and increasing genetic variability, in hexaploid triticale. As they argue, these methods can also be utilized where laboratory facilities are minimal. The methods are (1)hybridizing the sterile F, hybrids (ABDR) obtained from a cross between hexaploid wheat, Triticum sp. (AABBDD) and diploid rye, Secale sp. (RR) with hexaploid triticale (AABBRR); and (2) crossing pentaploid wheat hybrid (AABBD) with rye (RR) and the resulting F, sterile hybrids with hexaploid triticale (AABBRR). They believe that cytological screening of progenies for the desired chromosome types and/or selection of more fertile triticale-like plants should lead to the production of stable hexaploid triticale lines.
D. TETRAPLOID TRITICALES Synthesis of tetraploid triticales received attention only in recent years and several attempts in this direction failed. Several kinds of tetraploid triticales are mentioned in the literature including, AARR, BBRR, DDRR, and (AB) (AB) RR. Whether all of them can be called triticales needs careful consideration, because all of them cannot be derived by intergeneric hybridization between the genera Triticum and Secale, particularly if Aegilaps is regarded as a separate genus and not merged with Triticum. Simple primary tetraploid triticales with a genomic constitution AARR could never be obtained, first due to failure of the cross between diploid wheat and diploid rye, and second due to failure of getting AARR from the cross AAR x RR (Fig. 1). The only successful method used by Krolow (1973a, 1974a,b, 1975) involved a cross of hexaploid triticale with diploid rye followed by the selfing of the F, hybrid to yield the tetraploid triticales having 14 pairs of chromosomes (Fig. 1). These tetraploid triticales had a com-
272
P. K. GUPTA AND P. M. PRIYADARSHAN
plete intact rye genome and another mixed genome from A and B genomes. Three such triticales were obtained, and, on examination, were found to have a variable number of chromosomes from the A and B genomes (Gustafson and Krolow, 1978). The banding patterns of rye chromosomes were the same in all the three tetraploid triticales, in agreement with that of Secale cereale as reported by Darvey and Gustafson (1975) and Bennett et al. (1977). A more detailed description of tetraploid triticales will be given in Section V, when a full treatment of this subject is given. The three tetraploid triticales obtained by Krolow had chromosomal stability and fertility, but were poor in agronomic performance. Therefore, it had been suggested that the tetraploid triticales can be used for the improvement of octoploid and hexaploid triticales, and were successfully used as male parents in crosses with octoploid and hexaploid triticales. It was also suggested that efforts in this direction may ultimately give rise to hexaploid triticales with the genomic constitutions AADDRR and BBDDRR. Whether such hexaploid individuals could be treated as triticales would still need careful examination from a taxonomic point of view.
IV. Improvement and Assessment of Hexaploid Triticales
Hexaploid triticales received more attention than triticales at any other ploidy level during the last 20 years. This was based (1)on the disappointment with octoploid triticales, (2) on the relative success in hexaploid triticales achieved in a short period, and (3) on a fascination for a chromosome number, which was comparable to that of common wheat. Therefore, a volume of work both fundamental and applied is available in hexaploid triticales, and a very speedy improvement has been achieved. In view of this, they deserve special treatment, as presented in this section. OF SECONDARY HEXAPLOID TRITICALES A. DERIVATION
Hexaploid triticales, as previously mentioned (Section 111), were derived at the primary level through a cross of tetraploid wheat and diploid rye followed by chromosoae doubling. Other methods, however, for the synthesis of primary triticales were also suggested. It was realized in the early 1960s that these primary triticales, due to a variety of reasons, would not fulfill the requirements of a successful
TRITICALE
2 73
commercial crop. Therefore, programs for the modification of these primary triticales were undertaken throughout the world. These included the following hybridization programs. 1. Hexaploid triticales x hexaploid triticales giving rise to what Muntzing (1979) likes to call recombined triticales. 2. Octoploid triticales x hexaploid triticales followed by backcrosses to hexaploid triticales to restore the triticale constitution and leading to the production of secondary triticales (Muntzing, 1979). 3. Hexaploid wheat x hexaploid triticale followed by selfing or backcrossing with hexaploid triticales, using hexaploid triticale as the male parent to retain hexaploid wheat cytoplasm. This led to the production of secondary hexaploid triticales or what were also called substitutional triticales (Muntzing, 1979). 4. Secondary triticales (derived as in 2 above) x hexaploid wheat to give rise to what Muntzing (1979) preferred to call secondary substitutional triticales. 5. F, hexaploid triticale x F, bread wheat to allow for increased variation. The significance of bringing together the genes from the A and B genomes of tetraploid (AABB)and hexaploid wheat (A’A‘B’B’DD)was realized by many workers in view of the fact that these genomes in tetraploid and hexaploid wheats differentiated along different lines of natural evolution (Pissarev, 1966). Crosses between hexaploid triticale and octoploid triticale were also made by a number of workers and a detailed study of hybrids up to F, led Pissarev (1966) to conclude that secondary hexaploid triticales were promising and could give a higher yield than T.aestiuum. The major breakthrough in triticale improvement, however, started with the development of Armadillo strains at CIMMYT in Mexico (Zillinsky and Borlaug, 1971a; Zillinsky, 1974b). These Armadillo strains resulted from spontaneous hybridization between hexaploid triticale and bread wheat having “NORIN 10” dwarfing genes. This hybrid material was the starting point for most of the triticale breeding programs at CIMMYT (Zillinsky, 1974a). The Armadillo derived at CIMMYT had genes for several desirable characters like dwarfness, early maturity, good nutritional quality, insensitivity to day length, etc. Later, in order to derive secondary triticales, artificial crossing of hexaploid triticales with hexaploid wheat was used by several workers (Larter et al., 1968; Kiss and Trefas, 1970; Jenkins, 1969, 1974, 1975; Chen, 1975; Popov and Tsvetkov, 1975; Kolev, 1975).
274
P. K. GUPTA AND P. M. PRIYADARSHAN
B. THEROLEOF THE D. GENOMEIN THE EVOLUTION OF
HEXAPLOID TRITICALES
Specific substitutions of chromosomes from the D genome for those of the R genome are known to have played a very significant role in the development and improvement of secondary triticales and this section will be devoted to this specific aspect of triticale breeding. 1 . Theoretical Possibilities If we believe that specific chromosomes of the D genome can substitute only for their homoeologues in triticale constitution, 128 combinations are possible (Muntzing, 1979) as follows: ChromosomesofRgenome
7 6 5 4
3
2
1 0
ChromosomesofDgenome
0
4
5
6 7
Number of possible combinations
1 7 21 35 35 21 7
1 2
3
1 = 128
In these 128 theoretically possible combinations representing secondary triticales, seven pairs each from the A and the B genomes will be present and the rye chromosome pairs would vary from 7 to 0, the remaining chromosomes of the genome coming from the D genome. These 128 combinations do not include any possible substitutions where the chromosomes of the D genome substitute for rye chromosomes regardless of their homoeology. If nonhomoeologous substitutions, whose possibility cannot be completely ruled out, are also considered, the number of possible combinations will be much more than 128. Nonhomoeologous substitution of 5R for 4A in addition to its substitution for chromosomes of homoeologous 5 was actually shown to be possible (Zeller and Baier, 1973). Similarly, Brandes (1975) identified plants with nonhomoeologous substitutions 1DI6R and 4D/6R in alloplasmic and euplasmic substitution lines obtained from a series of crosses and backcrosses involving the alloplasmic wheat-rye addition line 6R and seven “Chinese Spring” monosomics of the D genome. This indicates the possibility of a very high degree of reorganization of the chromosomal and genomic composition which can be obtained from hexaploid triticale x hexaploid wheat crosses. We also know that very few of the 128 possible combinations are available so far in the triticale populations and that all these combinations may never be obtained. In this connection, there are several reasons for the limitations of these possibilities of chromosome substitutions: (1) specific homoeologous relationships may restrict substitutions as
TRITICALE
275
pointed out earlier (Gupta, 1971); (2) due to gene interaction, absence or presence of specific genes on a specific chromosome of the D genome may check the replacement of a rye chromosome or may inhibit substitution of a D chromosome for a specific rye chromosome; (3) the presence of homozygous translocations in rye may prohibit the substitution of D chromosomes for rye chromosomes 4R/7R and 7R/4R; (4)the preferential selection of specific substitutions like 2D/2R in Armadillo and other strains and the preferential retention of specific rye chromosomes like 1R and 6R in other cases will further restrict substitutions.
2 . Analysis of Triticales for D and R Chromosomes As previously mentioned, one of the most promising hexaploid triticale Armadillo at CIMMYT, Mexico, resulted from spontaneous hybridization between hexaploid triticale and hexaploid wheat. Zillinsky and Borlaug (1971a) recognized that Armadillo contained complete A and B genomes along with a mixed genome of chromosomes from D and R genomes of common wheat and rye, respectively, which was further confirmed by Gustafson and Qualset (1974). In an attempt to identify the D chromosomes in Armadillo, Gustafson and Zillinsky (1973) crossed it with hexaploid wheat (AABBDD) and with seven ditelosomic lines belonging to the D genome. They observed the preponderance of 15" in hexaploid wheat x Armadillo hybrids and a heteromorphic bivalent in hybrids with ditelosomic 2D, thus suggesting that wheat chromosome 2D was substituted in this triticale. Due to the presence of 16" in 2% of the cells in hexaploid wheat x Armadillo hybrids, and to the presence of a heteromorphic bivalent in seven out of 47 cells in a n Armadillo x ditelo 5D hybrid, it was suspected that a segment of 5D might have also substituted. Later, Gregory (1974) and Merker (1975) observed six pairs of rye chromosomes in several lines of Armadillo and did not suggest the possibility of a rye chromosome having a translocated segment from a D chromosome. It was thus confirmed that perhaps only 2D/2R substitution was involved in Armadillo. Due to the detection of a D chromosome in Armadillo, it was argued that the presence of chromosomes from the D genome in secondary triticales may have wide occurrence. In view of this Gregory (1974) had put forward the following major questions regarding the presence of D chromosomes: 1. How many triticale lines have D genome chromosomes substituted for rye chromosomes and how many substitutions do they possess?
276
P. K. GUPTA AND P. M. PRIYADARSHAN
2. Which chromosomes are involved? 3. How much of the improvement in triticales can be attributed to these substitutions? 4. Should we abandon work on triticales and concentrate on a synthetic species with a mixed third genome, and, if so, what breeding methods would we use? In an attempt to find answers to at least some of these questions, Gregory (1974) analyzed 32 triticale lines from Cambridge and CIMMYT. These triticale lines were crossed with Triticurn aestiuurn Chinese Spring and meiosis was studied in the F, hybrids. The number of bivalents in excess of the expected 14’ indicated the number of D chromosomes substituted. Only two of these 32 lines, TG4 and B5, were found to possess a complete rye genome, although B5 did carry a segment of a D chromosome in the form of a translocation with a chromosome of either the A or B genome. Of the remaining 30 lines, one line, M5, carried two pairs of D chromosomes and the other 29 lines each carried a single pair. Three of these 29 lines, each carrying a single pair of D chromosomes, also carried a translocation involving another chromosome of the D genome. However, Gregory (1974) did not identify the substituted D chromosomes with the help of wheat ditelos as was earlier done by Gustafson and Zillinsky (1973) in the case of Armadillo, and only speculated that a specific pair of D genome chromosomes could replace a pair of specific rye chromosomes, which could be dispensed with. Later, Merker (1975) examined the number of rye chromosomes and identified them in 50 strains of hexaploid triticales obtained from CIMMYT. He demonstrated that rye and wheat chromosomes can be easily distinguished at mitosis through a differential Giemsa staining technique, since rye chromosomes showed telomeric heterochromatin, distinct from centromeric heterochromatin or no heterochromatin at all in wheat chromosomes (Merker, 1973c, 1975). The results obtained by Merker (1975) indicated that the number of pairs of rye chromosomes could range from seven to one which would mean that the number of pairs of D chromosomes present would range from zero to six. Merker (1975), however, admitted that in some cases the rye chromosomes in advanced lines might have lost the telomeric heterochromatin, thus making it possible to miss the identification of such rye chromosomes. He recognized such a possibility specifically in the case of his C chromosome in triticale DRIRA and in the case of his F chromosome in two Camel-Pato selections (note that Merker’s designations A-G have no relation to the A-G designations given by E. R. Sears to Imperial rye additions to Chinese Spring.)
TRITICALE
277
Merker (1975) also noticed a correlation between chromosome composition and morphology of triticale plants and recognized that plants tending toward wheat, in general, had fewer rye chromosomes. It was also observed, though not always, that specific triticale characters mainly depended on chromosome B (2R) and F (5R), and that the superiority of triticales depended on D chromosome substitutions. Although substitution of D chromosomes normally and generally takes place for R chromosomes, Merker (1975) emphasized that the possibility of the substitution of D chromosomes for those belonging to A and B genomes cannot be ruled out. One would, therefore, believe that large scale substitutions of D chromosomes, mainly for R chromosomes, but rarely also for A and B genome chromosomes, have contributed to the improvement of hexaploid triticales. 3. Influence of Artificial and Natural Selections Artificial and natural selection pressures have also been shown to influence the chromosome constitution in hexaploid triticales. As can be noticed from the preceding section, when artificial selection was exercised only for agronomic traits, and not for chromosome constitution or cytological stability, not all rye chromosomes were replaced with equal frequency. For instance 2R, 3R, and 5R (and also 4R/7R and 7R/4R) were replaced more frequently, while E (6R) was not replaced in any of the 50 strains examined (Merker, 1975). Gustafson and Zillinsky (1979) crossed a hexaploid triticale having all seven pairs of rye chromosomes (no D chromosome) with hexaploid common wheat and grew F1,F2, and F, plants in complete isolation (to avoid any outcrossing with any other rye, wheat, or triticale) and without exercising selection, to study the effect of natural selection on the chromosome complement of developing secondary triticales. Thirty plants in the F, generation were sampled for Giemsa staining to identify the rye chromosomes. It was found that 2R (largest) was lost in all except one plant, where all seven rye chromosomes were present. This was in accordance with the earlier prediction of Gustafson and Bennet (1976) and Gustafson (1976b). The smallest rye chromosome 1R was the least vulnerable t o loss and was present in all 30 plants analyzed. The remaining rye chromosomes were present in frequencies ranging from 50 to 77%, i.e., 3R (70%), 4R/7R (77%), 5R (60%), 6R (73%), and 7R/4R (50%).Lukaszewski et al. (1979) also studied the elimination of rye chromosomes in F, wheat-rye hybrids and noted that rye chromosome 2R was eliminated in the highest frequency while 1R was eliminated in the lowest frequency, thus supporting the results of Gustafson and Zillinsky (1979). It was also shown by Merker (1975) and Gustafson and Zillinsky
278
P. K. GUPTA AND P.
M.
PRIYADARSHAN
(1979) that four rye chromosomes and three D chromosomes made the optimum constitution of a mixed genome in a desirable triticale. It was also suggested that the triticales having only 1R and 6R could be utilized for wheat breeding, since they had nucleolar activity and could replace 1B and 6B of wheat to the advantage of the wheat cultivar. The utility of retention of rye chromosome 4R/7R and 6R conferring higher protein content and those of 3R and 6R influencing the lysine content may .also be desirable as shown by Sowa and Gustafson (1979). In another study in Meerut, we made hexaploid wheat x hexaploid triticale crosses and kept on selecting for increased pairing up to 21" from F, to F, generations. This led to the reversion of the hybrids to hexaploid wheat like plants in most of the cases, so that only 9 lines out of 34 had rye chromosomes and the number of rye chromosomes did not exceed two pairs (Gupta and Sharma, 1979). Lukaszewski and Apolinarska (1981) screened 83 winter triticales and seven unselected F, winter derivatives from triticale x wheat crosses. Of these, 76 triticales and two F, derivatives had complete rye genome. The remaining seven triticales had each lost only one pair of rye chromosome and five F, derivatives lost all rye chromosomes. From these results, it was concluded that there was a disruptive selection favoring retention of either the complete rye genome or pure wheat constitution. This is in agreement with our own results described above and with the results of Seal and Bennett and those of Merker (personal communication, cited by Gustafson, 1982). However, it should be noted that in earlier studies by us (Gupta and Sharma, 1979) and those conducted by Gustafson and Zillinsky (19791, spring triticales instead of winter triticales were utilized. Further, Lukaszewski and Apolinarska (1981) suggested that the genes for daylength insensitivity located on wheat chromosome 2D may be responsible for frequent 2D/2R substitutions in spring triticales, which will be favorably selected by the breeders.
C. HYBRID NECROSIS-ALIMITING FACTOR Hybrid necrosis, which leads to early death of F, hybrids, is a severe barrier in crossing hexaploid triticales with octoploid triticale and hexaploid wheat. It is a physiological disorder caused by the presence of two complementary genes (Ne, and Nez),which have been studied in some detail in several varieties of common hexaploid wheat and hybrids (Hermsen, 1963a,b; Zeven, 1966, 1968, 1969, 1971; Gregory, 1980). Most of the primary triticales contain gene Ne, located on chromosome 5B (Zeven, 1972) and many secondary triticales may also
TRITICALE
279
contain Ne, introduced due to crosses with T . aestivum. Therefore, it is believed that hybrid necrosis may occur when many of the newly synthesized triticales are crossed with triticale selections derived from crosses involving hexaploid wheat carrying Ne, (Gregory, 1974). D. POSSIBLE BASESFOR SUPERIORITY OF SECONDARY HEXAPLOID TRITICALES The superiority of secondary hexaploid triticales is largely due to the combined action of factors at the genomic, chromosomal, and cytoplasmic levels followed by selection. These factors, therefore, will be discussed separately. 1 . Action of Factors at the Genornic Level The recombination between chromosomes of the A and B genomes from tetraploid (AABB) and hexaploid (A’A’B’B’DD)wheats had been shown to have played a significant role in triticale improvement. It is obvious from the realization that most of the improved secondary hexaploid triticales were obtained from octoploid triticale x hexaploid triticale and hexaploid wheat x hexaploid triticale crosses. The A and B genomes of tetraploid and hexaploid wheats are not similar as shown by extraction of A’A’B’B’ from hexaploid wheats. This extracted A’A’B‘B’ component of hexaploid wheat differs from tetraploid (AABB) wheat and could cooperate with the D genome derived from Aegilops squarrosa (Kerber, 1964; Kaltsikes et al., 1969). Thomas and Kaltsikes (1972) also found that the hexaploid triticales synthesized by utilizing the A’A’B’B’ component extracted from hexaploid wheat had a more regular meiosis than the hexaploid triticales synthesized from tetraploid durum wheats. Triticales No. 57 and No. 64, the commercially released varieties in Hungary, were also derived from crosses between octoploid and hexaploid triticales followed by elimination of chromosomes of the D genome through selfing (Kiss, 1971). These secondary hexaploid triticales thrived well on sandy soil and had stiff straw. Similarly Muntzing (1972, 1975, 1976) obtained secondary octoploid triticales by backcrossing reciprocally the F, hybrids (octoploid triticale x hexaploid triticale) with octoploid triticales. 2 . Action of Factors at the Chromosomal Level As discussed earlier, improvement achieved in many secondary triticales is now attributed to chromosomal reorganization in the form of a mixed third genome, found in addition to the A and B genomes (see Beatty, 1977). This aspect has been discussed in considerable
280
P. K. GUPTA AND P . M. PRIYADARSHAN
detail in a preceding section. It was also shown that the theoretical possibility of a variety of additional mixed genomes also exists, which can extend the range of suitable chromosome combinations. It should, however, be realized that while deriving suitable chromosome composition from AA’BB’DR hybrids ( 1 4 + 14’1, only chromosomes of the A(AA‘) and B(BB’) genomes can recombine and the univalent chromosomes of the D and R genomes are transmitted without recombination. Double cross hybrids (F, hexaploid triticale x F, hexaploid wheat) have been suggested (Merker, 1976a) as a remedy for this problem, since increased variability will thus be released. Similarly, double o r three way crosses (octoploid F, triticale x hexaploid F, triticale or octoploid F, triticale x hexaploid triticale) can allow recombination between chromosomes of the D genome (Merker, 1976a). In such cases, the presence of meiotic disturbances and aneuploid nucleus will be at its zenith in early hybrids resulting from (octoploid triticale x hexaploid triticale) x hexaploid wheat cross, but chromosome balance is restored in later generations due to natural selection and increased homozygosity. Muntzing (19791,therefore, suggested that larger populations be used in earlier generations and selection of individual plants be exercised in further generations. 3 . Action of Factors at the Cytoplasmic Level A primary hexaploid triticale derives its cytoplasm from tetraploid wheat and, therefore, may have incompatible nuclear-cytoplasmic interactions, as emphasized by Sisodia and McGinnis (1970a). Such interactions were noticed when reciprocal crosses of octoploid triticales or hexaploid triticales with hexaploid wheats were made (SanchezMonge, 1959; Kiss, 1966b; Pissarev, 1966; Sisodia and McGinnis, 1970a). These differences were observed despite the earlier observations of Kihara (1968) and Suemoto (19681, who did not find any difference in the cytoplasms of tetraploid and hexaploid wheats. They argued that the cytoplasm in both cases was derived from the same original diploid source. The discrepancy and contradiction may be attributed partly t o an entirely new nucleus in hexaploid triticales resulting in a novel cytoplasmic-nuclear interaction. Moreover, although tetraploid and hexaploid wheat cytoplasms can be traced back to the same original source, some differentiation over several thousand years must have taken place due to the presence of the D genome in hexaploid wheat. When primary hexaploid triticales (AABBRR) are crossed as male parent with either the octoploid triticale (A’A‘B’B’DDRR)or with
TRITICALE
281
hexaploid wheat (A’A’B’B’DD), one is not only permitting recombination between chromosomes of the genomes A,B (from tetraploid wheat) and A’,B’ (from hexaploid wheat), but is also altering the ratio of the ploidy levels of the cytoplasm and nucleus. The C:N (cytop1asm:nucleus) ratio is 1:lin hexaploid triticales with hexaploid wheat cytoplasm and is 1:1.5 in hexaploid triticales having tetraploid wheat cytoplasm. It was, therefore, speculated that in hexaploid triticale, the nuclear-cytoplasmic interactions will be more compatible if hexaploid wheat cytoplasm is present. The significance of nucleocytoplasmic compatibility in the success of natural amphiploids has also been recently emphasized by Maan (1979) on the basis of his studies involving a large number of diploid and polyploid species belonging to the genera Triticum, Aegilops, and Secale. In order to study the nucleocytoplasmic interactions in triticales, Larter and Hsam (1973) synthesized isogenic lines of hexaploid triticales that differed only in the source of their cytoplasm and had no genetic differences. For this, they used tetraploid wheats derived from pentaploid wheat hybrids obtained from reciprocal crosses-hexaploid wheat x tetraploid wheat and tetraploid wheat x hexaploid wheat. These tetraploid wheats and hence the hexaploid triticales derived from them carried hexaploid wheat cytoplasm in one case and tetraploid wheat cytoplasm in the other case. Two types of isogenic hexaploid triticales thus derived were used in getting pairs of C, generations and reciprocal F, hybrids, which could be compared among themselves for the study of differences in nucleocytoplasmic interactions. An improvement due to hexaploid wheat cytoplasm over tetraploid wheat cytoplasm could be noticed in terms of several characteristics including seed density, fertility, univalent frequency, plant height, and number of fertile tillers (Hsam and Larter, 1974a). Using the same F, reciprocal isogenic hybrids in hexaploid triticales, Hsam and Larter (1974b,c) also demonstrated that more protein is synthesized in hexaploid than in tetraploid wheat cytoplasm and that there were qualitative as well as quantitative differences in RNA, nuclear histones, albumin, and globulin fractions between hexaploid triticales with hexaploid and tetraploid cytoplasms. The differences in the cytoplasm of wheat and rye may also be relevant, though not equally important. Smutkupt (1968) emphasized that the effect of cytoplasm is limited to longer straws and ears in the amphiploid Secalotricum (triticales with rye cytoplasm) than in the Triticosecale (triticale with wheat cytoplasm), but the transmission of rye chromosomes showed extreme differences (Rimpau, 1973a,b).
282
P. K. GUPTA AND
P.
M. PRIYADARSHAN
E. ROLEOF TRIPLEHYBRIDS Triple hybrids for the production of hexaploid triticales have recently received attention (Muntzing, 1979, 1980). Earlier the F, hybrids between bread wheat and rye were pollinated with octoploid triticales and superior octoploid triticales were isolated from the triple hybrids (see Section 111). Triple hybrids, by pollinating T. turgidum x rye hybrids, by bread wheat pollen were produced quite early (Miintzing, 1935). Such triple hybrids were later also produced by Nakajima (1942, 1951, 1952, 1958, 1961, 1965). In recent years, primary hybrids between bread wheat and rye were pollinated with hexaploid triticale as suggested by Sisodia and McGinnis (1970b). A further modification has been suggested by them, in which the pentaploid hybrids (AABBD) between hexaploid and tetraploid wheats are crossed with rye, and the resulting F, is crossed with hexaploid triticale to get a variety of combinations. These methods, in addition to other possibilities, will mainly give rise to triple hybrids having the genomic constitution AABBDRR (2n.= 49). In later generations, these triple hybrids can give promising hexaploid triticales. In this connection, Muntzing (1980) has described some of the work done by A. F. Shulyndin (Shulyndin, 1972, 1975) in the USSR and by Porter in the United States. Some hybrids of Shulyndin are said to have surpassed bread wheat in grain yield and amount of protein per hectare. Some of these triple hybrid derivatives also have winter hardiness and have been recommended either for cereal or for forage production. Similar triple hybrids were produced by Porter and Tuleen (1976) and subsequently utilized for isolation of hexaploid triticales in F, and following generations. Most of these selections exceeded the yield of some of the commercial triticale varieties from Texas. Muntzing (1980) believes that this material produced through triple hybrids in the USSR and the South Western Great Plains Research Center at Texas has great diversity and promise for future improvement of hexaploid triticales.
F. USEOF MALESTERILE WHEAT For the rapid production of improved triticales, the use of male sterile wheat has been suggested. This suggestion was based on the knowledge that unreduced gametes due to the restitution nucleus on the female side do function in a small frequency. Porter and Tuleen (1972,1976)suggested the use of male sterile wheat for the production of F, hybrids which in turn can be utilized for the synthesis of triple
TRITICALE
283
hybrids (see Tsunewaki, 1974 for review). Approximately 1%seed set on the male sterile F, hybrids (ABDR) was obtained when crosses were made with hexaploid triticales in field crossing blocks. These triple hybrids which were partially fertile and heterozygous for the male sterile gene resulted in superior triticales in F, lines. Darvey (1979) emphasized the utility of this method which does not require conventional crossing, colchicine treatment, and embryo culture. Male sterile wheats can be grown alternately in rows or blocks with rye collection. Subsequently, wheat-rye hybrids thus obtained can be planted in alternate rows with selected hexaploid triticales. The triticales with cytoplasm of Aegilops ouata, Aegilops caudata, and Triticurn timopheevi were male sterile and promising (Sanchez-Monge, 1975), which can be successfully used for hybrid seed production. Male sterility can also be achieved by foliar applications of gametocides (Sapra et al., 1974). V. Tetraploid Triticales
During the last 50 years the major effort in triticale breeding has been directed toward the development of hexaploid and octoploid triticales. No thought was given to the possibility of production and utility of tetraploid triticales until Chaudry (1968) in Canada made a n attempt, but failed to produce tetraploid triticales using diploid wheat x diploid rye crosses. Later, Krolow (1973, 1974a,b, 1975) was successful in producing tetraploid triticales, which had in their constitution a genome with seven rye chromosomes and another mixed genome of seven chromosomes with variable numbers from the A and B genomes. All attempts t o produce primary tetraploid triticales having AARR constitution failed. It is, however, believed that tetraploid triticales produced by Krolow (1973) could be profitably utilized for the improvement of hexaploid and octoploid triticales.
A. PRODUCTION OF TETRAPLOID TRITICALES The techniques which have been tried and proposed to produce tetraploid triticales are summarized in Table 3. Krolow (1973,1974a,b, 1975) suggested three methods for the production of tetraploid triticales. 1. Cross between T . monococcum and diploid rye to give rise to amphidiploid AARR.
284
P. K. GUPTA AND P. M. PRIYADARSHAN
TABLE 3 Methods Used or Proposed in Attempts for the Production of Tetraploid Triticales Genomic construction
I. AARR
Methods
Reference
1.AA x R R - + A R ( x 2 ) + AARR 2. AAAA x RRRR --* AARR 3. AAAA x RR -+ AAR x AABBRR AABRR (selfed) + AARR 4. AAAABB x RRRR + AABRR (selfed) + AARR 5. AAAAGG x RRRR + AAGRR (selfed) + AARR 6. AADD x RR + ADR( x 2) -+ AADDRR x AABBRR AABDRR (selfed) -+ AARR 7. AAAABB x RR + AABR x RR + AABRR (selfed) + AARR 8. AABBRR x RR + ABRR (selfed) AARR,BBRR 9. ABRR (as above) + (AB) (ABIRR
Success1 failure
Chaudry (1968) Chaudry (1968) Chaudry ( 1968)
Failure
Chaudry (1968)
Failure
Chaudry (1968)
Failure
Chaudry (1968)
Failure
Krolow (1973)
Fa i1ure
Krolow (1973)
Failure
Krolow (1973)
Succeeded
Failure Failure
--f
-+
11. (AB)(AB)RR or
(ABDKABD) RR
111. BBRR
IV. DDRR
10. AABBDDRR x RR
-+
ABDRR + (AB) (AB)RR,(AD)(AD)RR, (BD)(BD)RR,(ABD)(AB D)RR 11. BB x RR + BR( x 2) -+ BBRR 12. BBBB x RRRR + BBRR 13. DDxRR
+
DDRR
~
~
~
~
DR(x2) +
Proposed"
Chaudry (1968) Chaudry ( 1968) Chaudry (1968)
Failure Failure Fa i1u re
~~~~
This method is being tried in the senior author's laboratory at Meerut, India.
TRITICALE
285
2. Cross between hexaploid autoalloploid wheat (AAAABB) and diploid rye giving rise to AABR followed by elimination of the B genome to get AARR. 3. Cross between hexaploid triticale and diploid rye to get ABRR which theoretically on selfing will give rise to AARR, BBRR, and (AB)(AB)RR. Methods 1 and 2 were only partly successful insofar as the initial crossing gave some seed but, despite the use of several approaches, could not give rise to tetraploid triticales according to the plan. For instance, T . monococcum x diploid rye cross was successful only when a AAAA x RR cross was tried. However, the hybrid AAR could not give AARR by a backcross to RR. Only the third method involving crosses between hexaploid triticale and diploid rye were successful. On selfing, the hybrids ABRR, obtained from the cross hexaploid triticale x diploid rye, gave rise to stable tetraploid triticales after five or six generations. These tetraploid triticales were more stable than the hexaploid or octoploid triticales, because they had a n aneuploid frequency of 2.2%.Since only three tetraploid triticales (Trc 4 x 3, Trc 4 x 2, Trc 4 x 5) could be produced by Krolow (1973) by this method, it is necessary to produce additional tetraploid triticales in large number to extend the variability in chromosome and genetic constitution of these tetraploid triticales. It may also be pointed out that the three methods outlined above will theoretically give rise to tetraploid triticales having different cytoplasms: method 1 will give tetraploid triticales with diploid wheat cytoplasm, method 2 will result in tetraploid triticales with tetraploid wheat cytoplasm, and method 3 will give tetraploid triticales with triticale cytoplasm (which will be hexaploid wheat cytoplasm in the case of secondary triticales).
B. CHROMOSOME ANALYSIS OF TETRAPLOID TRITICALES Gustafson and Krolow (1977, 1978) made a n analysis of tetraploid triticales produced by Krolow (19731, using the C-banding technique. All the three triticale lines (Trc 4 x 3, Trc 4 x 2, Trc 4 x 5 ) analyzed by them contained seven rye chromosomes with normal banding patterns of Secale cereale. The wheat genome (AB) constituted a mixture of chromosomes from the A and B genomes; triticale Trc 4 x 3 contained l A , 2B, 3A, 4A, 5B, 6A, and 7B; triticale Trc 4 x 2 contained l A , 2B, 3B, 4B, 5B, 6A, and 7B; and triticale Trc 4 x 5 contained l A , 2B, 3B, 4A, 5A, 6A, and 7B chromosomes. These are the only three
286
P. K. GUPTA AND P. M. PRIYADARSHAN
of the 128 combinations shown below which are theoretically possible on the assumption that for the absence of each A chromosome from the genome, one and only one chromosome from the B genome (depending upon its homoeologous relationship) can substitute. If this specificity is ignored, the number of possible combinations will further increase as shown for a mixed third genome in hexaploid triticales. In view of this, one should expect that a large number of other variable tetraploid triticales with genomic constitution (AB)(AB)RR can still be produced and for this reason we feel that efforts in this direction should be made. A small program toward this objective is currently underway in our department at Meerut in India. Chromosomes of A genome
7
6
5
4
3
2
1
0
Chromosomes of B genome
0
1
2
3
4
5
6
7
Number of possible combinations
1 7 21 35 35 21 7
1 = 128
C. DEVELOPMENT OF SECONDARY TETRAPLOID TRITICALES (CROSSES BETWEEN HEXAPLOID AND TETRAPLOID TRITICALES) A program of crossing hexaploid and tetraploid triticales was undertaken by Krolow (1974a) to develop secondary tetraploid triticales to widen their genetic base. The crosses were successful when hexaploid triticales were used as female. In F2, a considerable back regulation was observed, which was very similar to the back regulation found in F, of the cross hexaploid wheat x tetraploid wheat (Kihara, 1924; Kihara and Matsumura, 1940; Matsumura, 1939; Granhall, 1943). In F3 also, further strong back regulating tendencies to the tetraploid level were observed. The selection of foundation plants for developing new secondary tetraploid lines was not difficult since the number of plants with 28 chromosomes was quite high. Krolow (1974a) expected that most of the plants in F3 and F, would be secondary tetraploids; hence the widening of the genetic base was not very difficult. No final results of these efforts to obtain secondary tetraploid triticales are available.
D. UTILITYOF TETRAPLOID TRITICALES From the present level of success, one does not expect that tetraploid triticales will have any value as a commercial crop in the near future, but its utility in the improvement of diploid rye and hexaploid triticales has been emphasized by Krolow (1973).
TRITICALE
287
1. Development of Alloplasmic Rye (Crosses between Tetraploid Triticales and Other Species)
To study the crossability of tetraploid triticales, crosses were made with species such as Triticum monococcum, Aegilops speltoides and Ae. longissima. These crosses were unsuccessful. However, crosses made between tetraploid triticale and diploid rye were successful (Krolow, 1973, 1974a) and gave plants with 3x = 21 chromosomes. Such triploid hybrids should have a genome constitution (ABIRR. These were recommended for the development of alloplasmic diploid rye with cytoplasm from diploid, tetraploid, or hexaploid wheat. It is believed that such a modification may bring about a shortening of the duration of meiosis of rye, which may thus become a better combiner with wheat genomes than the normal rye for the synthesis of triticales a t the hexaploid and octoploid levels (Section IV). 2. Development of New Hexaploid Triticales (Crosses between Octoploid and Tetraploid Triticales)
Krolow (1974a) suggested that crosses between octoploid and tetraploid triticales may eventually yield hexaploid triticales which will include AABBRR, AADDRR, BBDDRR, AA(BD)(BD)RR, or BBtAD)(AD)RR. These secondary hexaploids can be successfully utilized for further triticale breeding. In the F, hybrid from the cross octoploid triticale x tetraploid triticale, Krolow (1974a) obtained plants with chromosome numbers ranging from 39 to 43, 75% of them having 42 chromosomes. The fertility in these plants was very low. In the progeny of plants with 42 chromosomes, the chromosome number varied from 36 to 46. This is due to reorganization between AD or BD chromosomes. It is suggested that from the resulting hexaploid triticales, if we can select a plant with unshriveled kernels and breadmaking quality, a major breakthrough can be achieved in this crop. The tetraploid triticales perhaps offer us this possibility.
VI. Cytology of Triticales
A. MITOSISIN TRITICALES 1. Karyotype A karyotype for hexaploid triticale Rosner was prepared by Shigenaga and Larter (1971). It included five satellited chromosomes, five metacentric chromosomes, nine submetacentric chromosomes, and
288
P. K. GUPTA AND P. M. PRIYADARSHAN
two chromosomes with subterminal centromeres. In order to identify the chromosomes of rye in a hexaploid triticale karyotype, they prepared the karyotypes of F, hybrids (ABRR)between hexaploid triticale and diploid rye. In these hybrids, since the rye chromosomes were present in pairs, through matching they could be easily identified as distinct from the chromosomes of A and B genomes which were not paired in the F, hybrid. From such a study, it was found that the rye complement of Rosner was represented by the seven longest chromosomes of the karyotype which included three satellited, two metacentric, and two submetacentric chromosomes. These karyotypes were utilized for the identification of the chromosomes contributing to aneuploidy in Rosner (Shigenaga et al., 1971) and revealed that both wheat and rye chromosomes rather than rye alone, as was earlier believed, contribute to aneuploidy. Subsequently, karyotypic studies in line 110 of hexaploid triticale were undertaken by Merker (1973b1, where out of 54 aneuploid plants, 20 were rye aneuploids and 34 were wheat aneuploids. These results of aneuploid frequency obtained by him were quite in agreement with those of Shigenaga et al. (1971). Contrary to expectation based on these studies, univalents in several studies using the Giemsa banding technique were shown to be predominantly rye chromosomes (Section VI,B). In several studies it has also been demonstrated that the morphology of rye chromosomes undergoes modification when included in the alien nucleus (Pieritz, 1970; Tarkowski and Stefanowska, 1972; Bhattacharyya et al., 1961; Gupta, 1970). While Pieritz (1970)and Tarkowski and Stefanowska (1972) observed modifications in the rye karyotype in the triticale nucleus, Bhattacharyya et al. (1961) and Gupta (1970) studied such a variability in rye addition and substitution lines in wheat. Gupta (1970) found that a rye chromosome (rye chromosome V = 4R/7R) developed a fresh satellite and lost a secondary constriction in wheat background. A reverse situation was similarly observed by him in chromosome VI (5R). These studies, therefore, indicated that the morphology of rye chromosomes might be altered in triticale strains and therefore while studying the karyotype of rye chromosomes in triticale strains, some degree of caution is needed. While studying variability of chromosome morphology in triticale, it should also be kept in mind that rye cultivars themselves exhibit chromosome polymorphism as revealed by the Giemsa banding technique (Weimarck, 1975b; Darvey and Gustafson, 1975). Therefore, it will be difficult to ascertain whether the morphological variation in rye chromosomes as detected in many cases is the inherent variation or is induced because of the background in which the rye chromosomes are placed.
289
TRITICALE
2. Duration of Mitosis
Triticale and its parental species present a suitable system for the study of the relationships between length of mitotic cycle in a n amphiploid and its parents. Kaltsikes (1971) worked out the durations of mitotic cycles in one primary triticale (6A190) and its rye and wheat parents (Table 4).The durations of mitotic cycles in triticales were found to be intermediate to the mitotic durations known in the parents. The duration of cell cycle of rye, however, was in agreement with earlier reports (Ayonoadu and Rees, 1973; O'Toole, 1970). Kaltsikes (1972) also analyzed the mitotic cycle in two advanced lines of triticales, Armadillo and Rosner (Table 4).Although the DNA contents in these two lines were the same, there was still a difference of 1 hour in duration of the "S" phase and 1 hour and 20 minutes in the duration of the cycle. In this connection, we may recall that Rosner, with a longer mitotic cycle, has been bred for the low temperature condition of Western Canada, whereas Armadillo with a shorter cycle was bred for the warmer conditions of Mexico. We presume that reduction in the duration of mitotic cycle in the Armadillo strain may be due to the substitution of D genome chromosomes. Hence, comparison with other wheats or rye should be done with caution. Moreover, in advanced triticale lines the S phase was found to be of greater duration than that of the primary lines. This increase in duration according to Kaltsikes (1972) might have been introduced from other parents involving complex pedigree in these advanced lines or may be attributed to unconscious selections. Since the duration of the S phase in the primary 6A190 triticale was shorter than that of its two TABLE 4 Durations of Mitosis and Its Different Phases in Tetraploid Wheat, Diploid Rye, and Hexaploid Triticales Species/line
G,
S
G*
Mitosis
Prophase
Total
Reference
2'. turgidurn var. durum S. cereale cv. Prolific Tritieale 6A190 Rosner Armadillo
3.25
5.50
4.25
0.75"
0.37
13.75
Kaltsikes (1971)
1.20
5.17
4.25
0.88"
0.37
11.50
Kaltsikes (1971)
1.18
5.08
4.75
0.99"
0.55
12.00
Kaltsikes (1971)
2.40b 2.71*
6.25 5.25
3.10 2.50
-
0.45 0.48
12.20 11.00
Kaltsikes (1972) Kaltsikes (1972)
~~
~
~~~~
Duration of prophase is included. ' Duration of metaphase, anaphase, and telophase is included.
290
P. K . GUPTA AND P. M. PRIYADARSHAN
parents, it is clear that the duration of S phase is initially reduced in primary triticales and then increased in the advanced lines due to selection and adaptation. 3. DNA Content There is variation in different reports on DNA content in triticales, wheats, and rye (Table 5). It is well established that DNA amount per diploid genome and the rate of cell development are positively correlated in higher plants (Van’t Hof and Sparrow, 1963; Bennett, 1971; Van’t Hof, 1975). The DNA content of rye is about 34% more than the largest of diploid wheat genomes in tetraploid and hexaploid wheats (Bennett, 1974). Bennett et al. (1977) presented results which indicated considerable intraspecific variation in 4C nuclear DNA in Secale species. Comparison of 4C nuclear DNA within the genus Secale (Bennett et al., 1977) suggested that it may be easy to obtain strains of cultivated rye where chromosomes have both reduced DNA content and less heterochromatin. It is believed that such rye with low DNA and heterochromatin may prove to be better for use in the production of superior triticales. TABLE 5 4C Nuclear DNA Contents of Triticales, Wheats, and Rye Linelplant type and ploidy level
4C value (Pd
Reference
84.7 67.2 92.8 87.7 93.0 94.4 103.9 27.6 69.3 62.8 49.1 48.1 24.9 26.8 45.2 49.1 43.8 48.3 33.1 37.8
Bennett and Smith (1976) Kaltsikes (197 1) Kaltsikes (1972) Kaltsikes (1972) Kaltsikes (1972) Kaltsikes (1972) Bennett (1972) Rees and Walters (1965) Bennett and Smith (1976) Ingle and Sinclair (1972) Rees and Walters (1965) Rees and Walters (1965) Bennett and Smith (1976) Rees and Walters (1965) Rees and Walters (1965) Bennett and Smith (1976) Kaltsikes (1971) Rees and Walters (1965) Bennett and Smith (1976) Evans et al. (1972)
~
Triticale 6A190 ( 6 ~ ) Rosner (6.x triticale) 6517 (6x triticale) Armadillo (62 triticale) 6A250 (6x triticale) Triticale (octoploid) Triticum aegilopoides Bal. ex. Koern T . aestiuum cv. Chinese Spring T. aestivum T. dicoccoides Koern T. dicoccum Schrank T. monococcum L. T. monococcum L. T. timopheevi Zhukov T. tugidum L. var. durum cv. Stewart T. turgidum L. var. durum cv. Stewart T. turgidurn L. var. durum Secale cereale L. cv. Petkus Spring Secale cereale L.
TRITICALE
29 1
The DNA content in hexaploid triticale was recorded to be only 85% of the total DNA content of its two parental species (Kaltsikes, 1971). Various explanations have been given for this difference, which could not be attributed t o aneuploidy, since only euploid cells were scored. However, the 4C DNA values presented by Bennett (1972) did not show such reduction in DNA content in the hexaploid triticales (rye = 37.8 pg; tetraploid wheat = 51.1 pg; hexaploid triticale = 88.9 pg). However, we do not see any reason for a reduction in DNA content in hexaploid triticale, particularly in view of earlier evidence in several allopolyploids that such diminution of DNA does not accompany the process of allopolyploidization (Rees and Walters, 1965; Narayan and Rees, 1974). In general, a correlation between the duration of mitosis and DNA content is observed (Bennett, 1972). However, Kaltsikes (1971) observed that S. cereale had the shortest duration of mitosis (11.5 hours), while T . turgidum had the longest duration (13.75 hours) and hexaploid triticale the intermediate (12.00 hours). He also noted that the duration of S phase did not materially differ in the three materials thus suggesting that the duration of S phase was independent of the DNA content, and that the correlation between DNA content and mitotic duration holds good at the same ploidy level. 4. Mitotic Irregularities
Although meiotic irregularities have been studied in great detail, only rarely have mitotic irregularities been reported. Shkutina and Khvostova (1971) and Orlova (1976) studied mitosis in the root tips of triticales and reported the presence of fragments, lagging chromosomes and chromatid bridges, micronuclei, and tripolar spindles. The frequency of abnormal mitotic cells was less than that found at meiosis, which was 74.5% in eight octoploid and 9.20% in ten hexaploid triticale lines. These mitotic irregularities have been attributed to increased mutation rate in triticale which, we think, may not be the only correct explanation for these abnormalities.
B. MEIOSISIN TRITICALES 1 . Premeiotic Mitosis
A study of premeiotic mitosis is a n integral part of a meiotic study, because events at premeiotic mitosis influence meiosis to a large extent. It is believed that certain events a t premeiotic mitosis are responsible for the onset of meiosis in the spore mother cells. Therefore, attempts have been made in the past to study the premeiotic mitosis
292
P. K. GUPTA AND P. M. PRIYADARSHAN
and to correlate the disturbances at the premeiotic mitosis with those observed during the meiotic cycle. It has been suggested that in triticales also premeiotic disturbances can lead to hypoploid and hyperploid pollen mother cells (Orlova, 1970) and, therefore, to some extent can also explain the univalent formation which is commonly associated with triticales (Muntzing, 1957). In hexaploid and octoploid triticales, micronuclei have also been observed in the cytoplasm of pmc’s at early prophase of meiosis (Tsuchiya, 1969; Weimarck, 1973), which can result from lagging chromosomes found in premeiotic mitosis. In many cases, odd numbers of univalents were observed (v. Berg and Oehler, 1938; Muntzing, 1939), and were attributed to either aneuploid condition in pmc’s or to trivalent formation or to miscounting. Notwithstanding all this, it is rightly believed that the disturbances in premeiotic mitosis cannot be a major cause of meiotic disturbances. 2 . Duration of Meiosis During the last decade, studies on the duration of meiosis attracted major attention of cytogeneticists, because, in any organism, the difference in the duration of mitosis and meiosis was considered to be one possible reason for the onset of meiosis in spore mother cells (FabergB, 1942; Riley, 1968; Bennett, 1977b). In view of this, it was anticipated that a study of duration of meiosis in triticales may explain the causes of meiotic disturbances in octoploid and hexaploid triticales. The duration of meiosis in octoploid, hexaploid, and tetraploid triticales was studied, respectively, by Bennett and Smith (1972), Bennett and Kaltsikes (1973), and Roupakias et al. (1979). It was found that hexaploid triticales had a shorter duration (2/3) than that in the rye parent, but had a longer duration than that in the wheat parent. On the other hand, duration of meiosis in octoploid triticales was shorter than that in either of its two parents (Table 6). Bennett et al. (1971) attributed the meiotic irregularities, including asynapsis in octoploid triticales, to differential meiotic duration, although differences in meiotic duration are believed not to be the only reason for univalent formation in hexaploid triticales (Merker, 1973a; Roupakias and Kaltsikes, 1977a,b). Bennett (1976) has emphasized that the duration of meiosis in its turn is also influenced by several factors: (1) nuclear DNA content (Bennett, 1971) and ploidy level (Bennett and Smith, 1972);(2) genetic constitution (Bennett, 1974); (3)environmental factors (Bennett et al., 1972). a. Nuclear DNA, Ploidy Level, and Duration of Meiosis. It has been shown by Bennett and Smith (1972) and Bennett (1972) that there
293
TRITICALE TABLE 6 Duration of Different Phases of Meiosis in Wheat, Rye, and Triticales"
Stage of development Leptotene Zygotene Pachytene Diplotene Diakinesis First prophase Metaphase I Anaphase I Telophase I Dyads Metaphase I1 Anaphase I1 Telophase I1 MI-TI1 inclusive Total meiotic time Quartet stage Pollen maturation
Wheat
Rye
T. Chinese dZcoccumb Springb
Petkus Spring6
Triticale
(62)
(2x)
6A190 (639
7.5 30.0
10.4 3.4 2.2 0.6 0.4 17.0 1.6 0.5 0.5 2.0 1.4 0.5 0.5 7.0 24.0
13.1 11.4 8.0 1.0 0.6 41.0 2.0 1.0 1.0 2.5 1.7 1.0 1.0 10.2 51.2
9.3
10.0 7.5
8.5 16.0
(4x1
22.5
Chinese Spring x Kind 11' Trc 4 x 5d (8x)
f4x)
12.0 6.0 9.0 2.0 0.5 29.5 2.0 0.5 0.5 2.0 1.5 0.5 0.5 7.5 37.0
7.5 3 .O 2.25 1.oo 0.50 14.25 1.75 0.5 0.5 1.5 1.25 0.5 0.5 6.5 20.75
13.1 1.2 9.7
7.6 52.6
8.0 10.0
7.3 -
8.1 13.8
-
3.1 45.3 2.1 1.0 2.1 1.3
Data for only representative strains.
' Bennett and Smith (1972).
' Bennett and Kaltsikes (1973). Roupakias et al. (1979).
is a positive and linear significant regression of meiotic duration on nuclear DNA content. The 4C nuclear DNA content of diploid rye (37.8 pg) is larger than that of any of the three diploid progenitors of T . aestiuum, and so is the duration of meiosis, which is 51 hours in rye and 42 hours in T . monococcum. Similarly, the duration of meiosis in tetraploid rye (38 hours) is longer than that of tetraploid T . dicoccum (30 hours). Bennett and Kaltsikes (1973) observed that the different nuclear DNA contents of different wheat and rye genomes also determine different rates of development. In general, the duration of meiosis decreased with increase in ploidy level. This is paradoxical, because we have previously discussed that the duration of meiosis increases with increased DNA content. It can, therefore, be inferred that the effect of DNA content and ploidy level are independent. Perhaps, this may also explain why octoploid triticales have a shorter duration of meiosis relative to its two parents.
294
P. K. GUPTA AND P. M. PRIYADARSHAN
b. Genetic Constitution and Environmental Factors us Duration of Meiosis. It has been shown that genetic constitution and environmental factors also influence duration of meiosis (Bennett et al., 1972; Bennett, 1976). It was further shown that the 5B chromosome had a major effect on slowing down the meiotic rate and that the genes responsible for this effect were located on the short arm of 5B. Roupakias and Kaltsikes (1977a) studied the effect of D and R genomes on duration of meiosis and its stages and proved that meiotic disharmony is not merely due to simple changes of ploidy level and/or DNA content. Similarly, the effects of temperature on meiotic duration in wheat and rye were also shown. More elaborate studies need to be conducted in triticales to assess the role of genetic constitution and environmental factors in determining the meiotic duration of this crop. 3. Heterochromatin and Chromosome Pairing a. Identification of Rye Chromosomes by G-Bands. The heterochromatin in triticales is largely contributed by its rye chromosomes having large telomeric blocks of heterochromatin as against smaller and intercalary heterochromatin bands in its wheat chromosomes (Merker, 197313). The differential staining of these heterochromatin regions by Giemsa banding enabled the identification of individual chromosomes in rye (Sarma and Natarajan, 1973; Verma and Rees, 1974; Vosa, 1974; Gill and Kimber, 1974a,b; Hadlaczky and Koczka, 1974; Singh and Lelley, 1975; Singh and Robbelen, 1975; Limin and Dvorak, 1976; Nakata et al., 1977). It also enabled identification of rye chromosomes in triticales (8x,6x, and 4x1 or its hybrid derivatives (Weimarck, 1974; Thomas and Kaltsikes, 1974a, 1976; Stepochkin, 1975; Merker, 1973c, 1975; Lelley, 1975a; Kimber et al., 1976; Bennett, 1977a; Roupakias and Kaltsikes, 1977d; Nalepa and Pilch, 1978; Pilch and Nalepa, 1978; Iordansky et al., 1978; Rogalska, 1978a,b, 1979; Gustafson and Zillinsky, 1979; Roupakias et al., 1979; Sapra and Stewart, 1980; Jouve et al., 1980). Some variation in banding patterns, however, was also demonstrated and attributed to heterochromatin polymorphism in rye a t either the level of populations or individual plants or individual chromosomes (Weimarck, 1975b; Bennett et al., 1977). In triticales too, while identifying rye chromosomes, variation in the presence or absence or in the size of telomeric and intercalary bands was observed in different strains (Darvey and Gustafson, 1975; Gustafson et al., 1979a,b; Merker, 1976b; Gustafson and Zillinsky, 1976; Kaltsikes and Roupakias, 1976). Similar variation in banding patterns of rye chromosomes was also observed in wheat-rye addition, substitution, and
TRITICALE
295
rye trisomic lines (Darvey and Gustafson, 1975; Singh and Robbelen, 1976; Friebe, 1976; Zeller et al., 1977). b. Identification of Rye Chromosomes by “Rye Bodies.” In a n embryological study, Bennett (1974) demonstrated that the presence of rye chromosomes in antipodal cells can be detected with the help of at least eight to nine heteropycnotic bodies found in addition to seven densely stained centromeric regions grouped at one pole. These heteropycnotic bodies were called “rye bodies” which were rather spherical or subspherical Feulgen-positive bodies having distinctive outline. The number of “rye bodies” (eight to nine) exceeded the number of rye chromosomes (seven), because each rye chromosome had a single rye body except chromosome V (1R) which had two rye bodies, one located at the end of each chromosome arm. In some rye chromosomes (5R, 6R, 4R), it is the short arm, while in other cases (chromosome 3R) it is the long arm which produced the rye body. Bennett (1974) suggested that these rye bodies represented the telomeric heterochromatin, and that each rye body constituted 4% of the total haploid rye genome. These rye bodies can obviously be utilized in order to discover the number of rye chromosomes present in specific secondary triticales having substitution of D chromosomes. Further, the presence of two rye bodies on chromosome V (1R) may also allow this chromosome to be distinguished from other rye chromosomes. That the rye bodies can be reliably utilized for identifying the presence of rye chromosome was inferred from the following observations: 1. No rye bodies occur in diploid, tetraploid, and hexaploid wheats. 2. Eight to nine rye bodies were found in several varieties of diploid rye (Secale cereale and S . montanum). 3. Up to 16 “rye bodies” were found in autotetraploid (4x1 Secale cereale. 4. Single rye bodies were found in rye addition lines except in a n addition line for chromosome V (1R) where two rye bodies were found.
c. Influence of Heterochromatin on Meiotic Chromosome Pairing and Mitosis. There is recent evidence available to show that telomeric heterochromatin of rye chromosomes influences the meiotic pairing (Bernard, 1979b) and is, therefore, involved in univalent formation. Such a condition is based on correlations derived from the following observations: 1.The heterochromatin on rye chromosomes is largely concentrated a t telomeres.
296
P. K. GUPTA AND P. M. PRIYADARSHAN
2. The telomeric heterochromatin in rye chromosomes is largely constitutive and therefore late replicating. 3. Meiotic pairing starts mainly at telomeric ends and proceeds toward the centromere. 4. There is an overlap between the late DNA replication of the constitutive heterochromatin and the meiotic chromosome pairing (Thomas and Kaltsikes, 1974a). Since there is evidence that meiotic pairing starts at the telomeric ends both in wheat and rye chromosomes (also shown in barley by Kasha and Burnham, 19651, and that DNA replication in the telomeric heterochromatin of rye chromosomes is delayed, it is believed that meiotic pairing fails leading to univalent formation. The failure of meiotic pairing takes place predominantly in rye chromosomes leading to a preponderance of rye univalents in triticales as shown for octoploid triticales earlier by Pieritz (1966, 1970) and later for hexaploid triticales by Thomas and Kaltsikes (1972, 1974a, 1976). Contrary to this evidence, a few studies earlier demonstrated that the univalents in hexaploid triticales consisted of both wheat and rye chromosomes on a random basis (Larter and Shigenaga, 1971; Shigenaga et UI!.,1971; Merker, 1973a). The influence of heterochromatin on meiotic pairing was further confirmed by several workers (Thomas and Kaltsikes, 1974a, 1976; Merker, 1976b; Roupakias and Kaltsikes, 1977d). Thomas and Kaltsikes (1974a, 19761, by differential staining of telomeric heterochromatin of rye chromosomes and by using marker wheat and rye telocentrics, showed that it was the rye chromosomes which failed to pair at metaphase I. They postulated that it was the telomeric heterochromatin of rye chromosomes which prevented pairing. Rye chromosomes with telomeric heterochromatin at both telomeres failed to pair more often than those with heterochromatin at one end only (Thomas and Kaltsikes, 1974a, 1976). Subsequently, Merker (197613) and Roupakias and Kaltsikes (1977d) in independent studies compared chromosome pairing in isogenic lines with and without telomeric heterochromatin in two different rye chromosomes, namely, chromosome C (which could be 3R or 7R) used by Merker (1976b) and 6R used by Roupakias and Kaltsikes (1977d). In both cases, variants having chromosomes with telomeric heterochromatin in both homologs, in one hornolog, or in none of the two homologs were used. Plants with heterochromatin present either in the homozygous or heterozygous condition exhibited fewer paired arms (Roupakias and Kaltsikes, 1977d), and the plants homozygous for the absence of heterochromatin had more closed bivalents than in the other two classes (Merker,
TR ITIC ALE
297
1976b; Roupakias and Kaltsikes, 1977d). This suggested that telomeric heterochromatin in single or double dose reduced chromosome pairing. However, while Merker (1976b) concluded that heterochromatin mainly influenced pairing of only those chromosomes carrying it, Roupakias and Kaltsikes (1977d) inferred that heterochromatin at one chromosome can influence chromosome pairing in other chromosomes. Merker (1976b3 further concluded that not only telomeric, but also the proximal or intercalary heterochromatin, could influence chromosome pairing and that the effect was correlated with size of the heterochromatin block. The influence of heterochromatin on cell division was also studied in the coenocytic endosperm (Bennett, 1977a). A correlation was observed between the presence of late replicating segments of heterochromatin on rye chromosomes and the occurrence of chromosome bridges at anaphase in the aberrant nuclei. It was speculated that the bridges in triticale endosperm were caused by the failure of rye chromosomes to separate at the telomeres where the late replicating DNA, that is the heterochromatin, was located (Section VII1,B). It was, therefore, recommended that the selection should be exercised in triticale strains against the presence of telomeric heterochromatin. Kaltsikes and Roupakias (1976) also observed improved cytological stability in triticales possessing different modified rye chromosomes deficient for heterochromatin. The repeated DNA sequences of rye can be spliced before incorporation in triticale, or the amount of DNA in wheat can be increased by some means to make it more compatible with rye (Kaltsikes, 1974a). Such a solution may, however, lead to a very narrow genetic base and can be compensated through selection of a number of triticale strains, having individual rye chromosomes deficient for telomeric heterochromatin. These triticale strains containing different known deficient rye chromosomes can then be crossed in order to get plants which will have all the rye chromosomes deficient for heterochromatin. It is possible that the loss of heterochromatin can cause unforeseen problems, since Hsu (1975) postulated a “bodyguard” hypothesis for the function of heterochromatin. The influence of heterochromatin on genetic recombination has been observed in some cases including the Australian grasshopper, Atructornorpha (Miklos and Nankivell, 1976), and a number of diploid plant species. Some other functions relevant to cell division have also been assigned t o constitutive heterochromatin (Walker et ul., 1969; Britten and Kohne, 1968; Flamm, 1972; Yunis and Yasmineh, 1972), which include organization of the spindle microtubules, stabilization of chromosome ends, directing the specific folding patterns of chromosomes and providing raw material for creating new genes (Hsu, 1975). It has
298
P. K. GUPTA AND P. M. PRIYADARSHAN
been postulated that certain repetitive DNA regions in the chromosomes are necessary for proper recombinatory joining (Lee, 1975). Therefore, the reduction of rye chromosome heterochromatin may affect the recombination system thus reducing the recombination potential. Only further studies would reveal whether removing the heterochromatin from the rye chromosomes will solve some problems of triticale breeding or will create new problems. In any case, it will generate new knowledge, fundamental for understanding the organization and function of heterochromatin at the interchromosomal and intrachromosomal levels. Recently May and Appels (19801, utilizing the technique of in situ hybridization, examined 2B/2R substitutions and demonstrated that translocations involving 2BS/2RL and 2RS/2BL were present in the lines utilized, which were previously supposed to carry rye chromosome modified due t o loss of heterochromatin. It was, therefore, suggested that the observed loss of telomeric heterochromatin from rye chromosome in wheat may be due to wheat-rye chromosome translocations in several cases. This observation will necessitate reexamination of the rye chromosomes which have been reported to be modified due to loss of heterochromatin in certain improved triticales. 4 . Univalent Formation Meiotic instability is one of the several limitations recognized in triticales for their commercial utilization. The extent of meiotic instability is measured mainly through univalent frequency (Tables 7, TABLE 7 Meiotic Instability in Hexaploid Triticales as Measured by the Presence of Univalents Frequency of univalents Line
Mean
Range
Percentage of cells disturbed
Durum triticale Durum triticale
2.3 2.71
0-10
Turgidum triticale (Nakajima) Turgidum triticale Dicoccoides triticale Dicoccoides triticale Dicoccum triticale Dicoccum triticale -
0.11
0-5
32.6
1.25 2.0 0.43 2.2 0.83
0-6 0-6 0-6 0-10 0-8
46.8 69.0 31.2 69.0 32.7 36.3
-
79.0 -
Reference Sanchez-Monge (1959) Thomas and Kaltsikes, (1972) Tarkowski (1968) Orlova (1970) Sanchez-Monge (1959) Orlova (1970) Sanchez-Monge (1959) Orlova (1970) Shkutina and Khvostova (1971)
299
TRITICALE
TABLE 7 (Continued) ~~
Line
Frequency of univalents Percentage of cells Mean Range disturbed
T . turgidum x S. cereale T . turgidum x S . cereale T . turgidum x S. montanum
2.20
-
-
1.03
-
-
1.03
-
-
6A298
3.3 (bulk) 2.6 (pure line) 1.13 0.13 1.01-2.33 1.31
1.0-5.4
-
0.0-4.2
-
0-12
41.0 32.3 39.4-75.3 -
6A298
Rosner (15°C) Rosner (30°C) 8 lines Rosner -
20 Strains AABB (extracted from hexaploid wheat) x S. cereate -b -
T . turgidum x S . cereale Steward 63 x Prolific 278-9 Stewart x Prolific 6A190 Steward 63 x OD289 65-4 Tetra-Thatcher x Prolific Tetra-Prelude x OD289 998-2 Camel x Armadillo Cinnamon x Cisnesnoopy Cinnamon x Camel
-
Reference Thomas and Kaltsikes (1971) Thomas and Kaltsikes (1971) Thomas and Kaltsikes (1971) Sapra and Heyne (1973) Sapra and Heyne (1973) Boyd et aE. (1970) Boyd et al. (1970) Merker (1971) Thomas and Kaltsikes (1976) Larter et al. (1968) Tsuchiya (1969) Tsuchiya (1969) Tsuchiya (1969) Tsuchiya (1969) Tsuchiya (1972b) Thomas and Kaltsikes (1972)
1.8 1.76 1.64 2.25 1.42 1.78 2.10
0-12 0-8 0-14 0-8 1.00-3 .84 0-14
57.0 56.4 53.2 70.0 52.0 -
-
-
22.3
0.14-0.40 0.24
-
-
0.64
-
-
1.86
-
-
2.20
-
-
0.36
-
-
2.82
-
-
-
0-10 0.10
95.5 99.0
Shkutina and Khvostova (1971) Krolow (1969b) Thomas and Kaltsikes (1976) Thomas and Kaltsikes (1976) Thomas and Kaltsikes (1976) Thomas and Kaltsikes (1976) Thomas and Kaltsikes (1976) Thomas and Kaltsikes (1976) Merker (1975) Merker (1975)
-
0-10
75.7
Merker (1975)
0-3
7.7-22.8
Various advanced lines were used in these studies. Some secondary triticales were used in these studies.
300
P. K. GUPTA AND P. M. PRIYADARSHAN
8). Although it has been shown that fertility and meiotic instability are independent (Hsam and Larter, 1973; Merker, 1971, 1973a), the success of getting fully fertile triticales without restoring meiotic stability is still doubtful. It is from this point of view that the study of univalency in triticales has been assigned some significance. a. Origin of Univalents. Both in hexaploid and octoploid triticales, univalents are frequently observed during diakinesis and metaphase I. It has been of some interest to find out whether the univalents belong to the wheat or the rye genome and which specific chromosomes are actually involved. In other words, one may question whether the univalents are formed randomly by all the chromosomes in the triticale constitution or whether there is some specificity in this connection. In octoploid triticales, since many lines exhibiting univalents tended to revert back to hexaploid wheat, it was speculated that the univalents should predominantly belong to rye chromosomes, which are, therefore, eliminated (Muntzing, 1957; Sanchez-Monge, 1959; Stutz, 1962; Krolow, 1962). This was confirmed by the karyotypic studies in aneuploids among octoploid triticales studied by Pieritz (19701, who concluded that the univalents in octoploid triticales must have been predominantly rye chromosomes. However, in the formation of aneuploids, he also found some elimination of wheat chromosomes. TABLE 8 Meiotic Instability in Octoploid Triticales as Measured by the Presence of Univalents Frequency of univalents Line Wiebe Wiebe Rimpau Rimpau Rimpau
Mean
Reference Muntzing (1939) Bjurman (1958) Muntzing (1939) Bjurman (1958) Shkutina and Khvostova (1971) v. Berg and Oehler
-
0-18 0-10 1-13 0-15
-
54 61 100 64 73.7
Rimpau
5.75
2.12
100
-
1.90 1.40
0-12 0.10
60 47
Sanchez-Monge (1959) Riley and Chapman
Holdfast x S. montanum
2.76
1-5
-
2.34 1.40-3.81 2.24-6.69
0-10 0-20 0-15
71.6 65.42-91.41 1.00-18.56
Riley and Miller (1970) Pieritz (1970) Weimarck (1973) Weimarck (1975a)
Holdfast x King I1
-
Four lines 12 F, combination
1.88 1.61 6.10 1.88
Percentage of Range cells disturbed
(1938) (1957)
TRITICALE
301
On the other hand, the occurrence of wheat chromosomes as univalents and laggards was also stressed (Krolow, 1969a,b; Weimarck, 1974). Similar studies were also conducted in the hexaploid triticales, although no tendency of reversion to tetraploid wheat was observed. Sanchez-Monge (1959) found that the average numbers of univalents per pmc in hexaploid and octoploid triticales were 2.3 and 1.9 (Tables 7 and 8) and were, therefore, not very different. As a corollary, he also observed that the reduction in the chiasmata frequency in the amphiploid over the total of those of its two parents was also of the same order in hexaploid and octoploid triticales. This led him to agree with Muntzing (1957) that the univalents in hexaploid as well as octoploid triticales predominantly belong to rye chromosomes. Later, Larter et al. (19681, due to their failure to detect any satellited chromosomes of wheat (1B and 6B) among the univalents, agreed with Muntzing (1957) and Sanchez-Monge (1959). However, they did not identify the rye chromosomes among univalents due to their suspected altered morphology in the wheat background. Further evidence indicating that the univalents were mainly derived from rye chromosomes was presented by Thomas and Kaltsikes (1972)who had utilized for their study the hexaploid triticales derived from durum wheat and those derived from AABB extracted from hexaploid wheat. They found that although the frequencies of univalents and those of paired chromosome arms had an inverse relationship as expected, the distribution of arm pairs and univalents was nonrandom. They concluded that the excess of univalents suggested that the univalents may mainly belong to rye chromosomes. The rationale of this conclusion is not clear to us. Subsequently, through Giemsa staining, although in octoploid triticales aneuploidy was found to involve wheat and rye chromosomes on a random basis (Weimarck, 1974), the univalents in hexaploid triticales were found to be predominantly rye chromosomes (Lelley, 1975a; Thomas and Kaltsikes, 1974a, 1976). The distribution of rye chromosomes among univalents, however, may not be random. There is some evidence that 1R and 7R with distinct telomeric heterochromatin bands in both arms may be more frequently found among univalents (Roupakias and Kaltsikes, 1977d) and that 2R may be more frequently lost as in Armadillo (Gustafson and Zillinsky, 1973, 1979). On the other hand, Larter and Shigenaga (1971) found that the range of size of univalents in disomic Rosner was the same as in 21 univalents including all wheat and rye chromosomes of polyhaploid Rosner. It was, therefore, concluded that in hexaploid triticales, the
302
P. K. GUPTA AND P. M. PRIYADARSHAN
univalents were formed randomly by wheat and rye chromosomes. This was further ascertained by the study of the range of univalent size among the two extra univalents often observed in a Rosner monosomic for 1B (recognizable as being satellite) showing 19" + 3'. These results were supported by the results of Merker (197313)and Shigenaga et al. (1971), who studied aneuploid frequency (not univalent frequency) in hexaploid triticales and observed no deviation from a random distribution between the chromosomes of the two parental species contributing to aneuploidy. It is thus obvious that contradictory evidence is available in octoploid as well as hexaploid triticales regarding the origin of univalents from wheat and rye chromosomes. Gustafson (1976b), however, questioned the validity of the hypothesis of random distribution of wheat and rye chromosomes among univalents and discussed the available evidence to demonstrate that at least lB, 6B, and 2R contribute to meiotic instability more often than other chromosomes. Further support for preferential loss of 1B was also derived from the frequent occurrence of 1BAR substitution in several high yielding wheat cultivars in Europe (Mettin et al., 1973; Zeller, 1973; Bennett and Smith, 1975) and higher transmission of monosomy for 1B (Darvey and Larter, 1973). b. Causes of Univalent Formation. The causes of univalent formation in triticales have been examined by a number of workers and reviewed by Kaltsikes (1974b) and Scoles and Kaltsikes (1974). In view of these earlier reviews, the causes of univalent formation will be discussed only briefly and the emphasis will be laid only on some of the salient features. i. Events at meiotic prophase leading to univalent formation. The univalent formation observed at metaphase I can result from a variety of events leading to failure of bivalent formation at prophase I: 1. Asynapsis, ruling out the possibility of subsequent association in bivalents. 2. Desynapsis, undoing the initial pairing of chromosomes and thus leading to the loss of effective chromosome pairing and univalent formation. 3. Failure of chiasma formation so that the chromosomes cannot be held together as bivalents at metaphase I and will fall apart as univalents. 4. Premature disjunction of bivalents so that the disjoined chromosomes will not be able to coorient themselves at metaphase plate and therefore will be observed as univalents.
TRITICALE
303
There is some evidence of reduction in chromosome pairing from diakinesis to metaphase I (Khvostova and Shkutina, 1975). This was inferred from three observations: (1)that the frequency of univalents increased from diakinesis to metaphase I (Tsuchiya, 1970); (2) that similar univalents could be found against each other across the metaphase plate, suggesting premature disjunction (Shkutina and Khvostova, 1971); and (3) that there was a reduction in the number of paired chromosome ends in the last cells of an anther at metaphase I (Thomas and Kaltsikes, 1972). Although these observations suggest that the initial pairing of chromosomes involved in univalents does take place, there is still some doubt whether or not the chiasma formation takes place. It is, however, possible that the initial pairing may take place without being followed by chiasma formation, since it has been shown that these two events are under independent genetic control (Lelley, 1974; Gupta et al., 1980). It is also possible that the initial chromosome pairing and chiasmata formation take place as usual but is followed by precocious separation of bivalents. We still do not know clearly which of the above events (one or more) in prophase is really responsible for the univalent formation. However, some experimental approaches have been suggested by Thomas and Kaltsikes (1974b) in order to find out whether the univalents in triticale result from lack of chromosome pairing or from precocious separation of paired chromosomes. However, these suggested approaches have not been used to find out the answer. i i . Facts bearing on the problem of univalency. Despite the difficulty in examining the causes of univalent formation as discussed in the preceding section, several theories in the past have been advanced to explain univalent formation in triticales. Kaltsikes (1974b) reviewed and classified these theories as cytological, genotypic, and cytoplasmic effects. All these theories utilize a number of facts and data which have a bearing on the problem. These can be summarized as follows: 1. The cytoplasm of primary hexaploid triticales belongs to tetraploid wheats and that of octoploid triticales belongs t o hexaploid wheat, so that the ratio of ploidy level between cytoplasm and nucleus (C:N ratio) becomes 1:1.5in hexaploid triticales and k1.33 in octoploid triticales. 2. Wheat is an autogamous crop while rye is allogamous and the autogamous character of wheat predominates in triticales, thus forcing the rye genome to undergo inbreeding. 3. The genomic ratio of wheat and rye in triticales is 2:l in hexaploids and 3:l in octoploids.
304
P. K. GUPTA AND P. M. PRIYADARSHAN
4. The duration of meiosis is 51 hours in rye (Bennett and Smith, 1972), 37 hours in raw hexaploid triticales (Bennett and Kaltsikes, 1973), 34 hours in improved triticale Rosner (Bennett and Kalkites, 1973) and 20 hours in octoploid triticales (Bennett and Smith, 1972). 5. The average DNA content in individual rye chromosomes is 1.5 times (2n = 14; 2C = 18.9 pg, Kaltsikes, 1971) that of individual wheat chromosomes (2n=42; 2C=36.2 pg, Bennett, 1972), and rye has a higher proportion of repetitive sequences (92%) in its genome than wheat (83%;Flavell et al., 1974). 6. The univalents observed in hexaploid as well as octoploid triticales at metaphase I may be derived both from rye and wheat complements or may be derived predominantly from rye. 7. In hexaploid triticales, the rye genome often remains inactive during the formation of the nucleolus, the nucleolus being organized only by wheat chromosomes 1B and 6B (Darvey, 1974), while in octoploids, there is a strong activity of nucleolar organizing chromosome, 6R (Shkutina and Khvostova, 1971; Darvey, 1974).
iii. Theories explaining univalent formation. As indicated by Kaltsikes (1974b), no clear understanding exists about the causes and mechanism of the formation of univalents in triticales, although a number of theories have been advanced. It is, therefore, possible that no single cause may be adequate to explain the univalency and several causes may involve one or more of the following factors: 1. The presence of tetraploid wheat cytoplasm in primary hexaploid triticales explained partly the meiotic disturbances as already discussed in Section IV,D. However, Merker (1973a) could not find any significant effect of the cytoplasm when he studied the reciprocal crosses utilizing six hexaploid lines with different cytoplasms. His results can be explained on the basis of heterozygosity in the F, hybrids rather than on the basis of cytoplasmic effects. 2. The shorter meiosis of hexaploid and octoploid triticales relative to that of rye has also been considered to be responsible for univalent formation, since it is believed that rye chromosomes need more time to pair in comparison to wheat chromosomes. Evidence for this is only circumstantial because the octoploids having a shorter duration of 20 hours are more irregular meiotically than the hexaploid triticales having a longer duration (37 hours). But since an improvement in hexaploid triticales is accompanied by a reduction in the duration of meiosis from 37 t o 34 hours in Rosner, the shorter duration of meiosis per se cannot be responsible for univalent formation (Section V1,B).
TRITICALE
305
Since there is a difference in the DNA contents of rye and the diploid progenitors of tetraploid wheat, and since there is a correlation between duration of meiosis and amount of DNA at the same ploidy level, it has been speculated that there may be an incidence of allocycly in triticales. This means that the different genomes may replicate their DNA at different times. No experimental evidence for this is available, although it has been suggested that the incorporation of tritiated thymidine into the microsporocytes of materials where rye chromosomes can be identified should resolve this problem (Kaltsikes, 197413). It has also been speculated that improvement in triticales can be brought about either by increasing the DNA content of wheat chromosomes or by decreasing the DNA content of rye chromosomes so that they become comparable to disallow any incidence of allocycly. There is some evidence available suggesting loss of the terminal heterochromatin band in 4R in one of the Cinnamon lines and in 2R in Rosner due to natural selection (Gustafson, 1976b). 3. The forced homozygosity of the allogamous rye is considered t o be another reason for the univalent formation, since reduced chiasma frequency was known in inbred lines of rye (Lamm, 1936; Rees, 1955) and increased chiasma frequency was known in hybrids (Rees and Thompson, 1956). The effects of such homozygosity per se in triticales could not be very well substantiated due to contradictory reports (Sanchez-Monge, 1959; Lelley, 1975b; Weimarck, 1973). In view of this, Muntzing (1957) had suggested that inbred lines of rye should be used in the synthesis of triticales to avoid forced inbreeding in the rye complement. However, triticales produced with inbred lines did not have better meiosis and the F, hybrids between inbred triticales having restored heterozygosity had poorer rather than better meiotic stability. This suggests that homozygosity per se cannot be the reason for univalent formation. 4. The interaction between the genes of rye and wheat chromosomes is considered to be one of the most plausible, though not quite exclusive, explanations for the formation of univalents (Riley and Chapman, 1957). It has been demonstrated that in the hybrids having wheat and rye chromosomes together in different doses, the rye and wheat chromosomes influenced the homologous pairing (Lacadena, 1967; and Lelley, 1976a) and homoeologous pairing (Miller and Riley, 1972; Lelley, 1976b). For instance, Naranjo et al. (1979) observed that in the hybrids ABRRR and ABRR, the wheat complement AB reduced the homologous pairing between rye chromosomes relative to that found in the triploid (RRR) and diploid rye (RR), respectively. Similarly, the presence of rye chromosomes in these hybrids increased the
306
P. K. GUPTA AND P. M. PRIYADARSHAN
homoeologous pairing between the chromosomes of wheat complement AB. Homoeologous pairing between wheat chromosomes in ABRR hybrids was also observed earlier by other workers (Lelley, 1976b; Bernard and Bernard, 1978; Jouve and Montalvo, 1978). This homoeologous pairing between wheat chromosomes and between wheat and rye chromosomes increased with the increase in dose of rye. It has also been shown that a reduction in dosage of wheat genomes in wheat-rye combination increased the probability of homoeologous pairing between wheat and rye chromosomes (Miller and Riley, 1972). Specific interaction between wheat and rye genotypes in regulating meiosis in hybrids was also shown by Lelley (1979). Earlier the role of the presence or absence of the D genome in meiotic pairing was emphasized, for octoploid triticales by Krolow (1966) and for hexaploid triticales by Merker (1973a). It has, however, been shown through study of extracted tetraploid wheats that the absence of the D genome in hexaploid triticales is not responsible for the univalent formation (Scoles and Kaltsikes, 1974). The role of 1B chromosome in the interaction of wheat and rye genomes is emphasized since a higher degree of meiotic stability was observed in monosomic 1B Rosner and a lower degree of meiotic stability was observed in Rosner trisomic for 1B. This activity of 1B in suppressing the pairing in triticale is located in the short arm and has resulted from the interaction of wheat and rye genomes because it does not influence meiotic pairing in hexaploid wheat. It is thus obvious that univalent formation in triticales is the result of a complex phenomenon involving several factors, including interaction between cytoplasm and nucleus and the interaction between different genomes involved. The other causes for the univalent formation may actually be the indirect result of these interactions. Since the univalent formation is genetically controlled, it has been possible to improve the meiotic stability in triticales through selection and breeding. Further improvement in meiotic stability will definitely be achieved by the same methods or through mutation breeding (Muntzing, 1972), which is a potential tool but has not been successfully utilized for achieving meiotic stability in triticales. Recently, Lelley and Larter (1980) have also demonstrated that the genotypes of wheat and rye parents of triticale influenced the chiasma number in F, hybrids. They observed increased homoeologous pairing and high chiasma frequency, when an inbred rye parent was utilized. This relationship was further dependent upon the genotype of the wheat parent. From this they
TRITICALE
307
concluded that the genetic constitution of the rye parent and its specific combining ability with the wheat genotype influence the meiotic behavior of triticale. VII. Aneuploidy
A successful polyploid cereal crop with a breeding system based on sexual reproduction should have stability of chromosome number and should exhibit a diploid-like meiotic behavior to overcome any sterility barrier. For instance, in the natural populations of wheat, the frequency of aneuploids is negligible (Riley and Kimber, 19611, while in oats it is relatively higher, but still very low (0.4 to 1.0%;McGinnis, 1962; Hacker and Riley, 1963). Contrary to this, in triticales the frequency of aneuploidy in natural populations is fairly high as will be shown in this section. This frequent occurrence of aneuploidy is a serious problem both in hexaploid and octoploid triticales, and may sometimes even lead to reversion to their wheat parents by loss of rye chromosomes. Aneuploidy is related to fertility and indirectly also to meiotic instability, although in polyploid crops like triticale, fertility (seed set) is not very adversely affected due to some degree of aneuploidy. These aspects of triticale, including progress already made and future possibilities of reducing aneuploid frequency, will be discussed in this section. OF ANEUPLOIDY A. FREQUENCY
Different levels of aneuploidy have been reported in different triticale strains, which also differ in the level of meiotic stability. The frequencies of aneuploidy in hexaploid and octoploid triticales, reported for bulk populations and for progenies of euploids, are summarized in Table 9. It can be seen that aneuploidy could be as high as 32.7% in hexaploid and as high as 83.3% in octoploid triticales. The lowest frequency of aneuploidy in bulk populations of hexaploid triticales was 8.3% which is by no means negligible. 1 . Effect of Inbreeding and Selection The frequencies of aneuploidy have also been studied after several generations of inbreeding and selection. Tsuchiya and Larter (1969a) examined eight strains of hexaploid triticales which had undergone seven to eight generations of selection for improved agronomic char-
TABLE 9. Aneuploidy in Hexaploid, Octoploid, and Tetraploid Triticales ~~
Number of lines/ strains
Aneuploidy (%)
Hypoploidy (%)
Mean
Range
Mean
6 11 1 28
6.95 9.60 10.0 3.90 8.80 -
3.31-11.43 1.5-17.0 1.5-23.3 4.7-15.2 -
1 35 8 10 10 (selfed) 10 (composite) 10 (F,diallel)
32.7 15.3 8.3 11.5 11.5 13.09 13.18
0.0-57.2 2.7-18.0 9.9-14.9 9.9-15.0 2.50-27.28 5.00-25.56
Range
~~
Hyperploidy (%I Range
Reference
Hexaploids: in progeny of euploids 4.72 2.48-7.14 2.23 8.2 1.5-15.8 1.50 8.2 1.5-18.4 1.80 2.9 1.00 7.5 1.5-15.8 1.30 14.1 0.0-42.0 4.5
0.83-4.29 0.0-3.5 0.0-0.5 0.0-3.5 0.0-13.2
Krolow (1966) Tsuchiya (1968a) Tsuchiya (1969) Krolow (1969a) Tsuchiya and Larter (1969a) Tsuchiya and Larter (1971)
Hexaploids: in bulk populations 21.8 9.1 11.1 0.0-42.8 4.2 18.0 0.0-12.8 2.8 7.7 5.8-11.9 3.8 8.0 5.8-11.9 3.6 10.25 2.50-17.75 2.05 11.19 3.75-22.23 0.72
-
0.0-13.2 0.8-8.1 0.9-6.9 0.0-6.9 0.0-12.73 0.0-2.44
Tarkowski (1965) Tsuchiya (1969) Merker (1971) Tsuchiya (1968a) Tsuchiya and Larter (1969a) Gupta and Malik (1982) Gupta and Malik (1982)
-
3.33
-
Gupta and Malik (1982)
4.10
0.0-60.66
Gupta and Malik (1982)
13.34
-
6.66
23.12
10.67-35.0
18.05
1 1 4 10
82.9 54.9 38.2 34.4
35.4-41.8 15.8-60.0
Octoploids: in progeny of 76.0 24.0 27.6 19.0-40.0 45.9 -
35 13
83.3 56.5
33.3-10.0 30.3-93.7
76.0 68.9
-
29.4
2.5-67.2
11.1
8.23-29.34
Mean
euploids 6.0 30.0 10.5 30.6
Octoploids: in bulk populations 6.0 49.8 Tetraploids: F, to F, 0.5-28.1 23.5
-
-
Krolow (1963) Pieritz (1966) Krolow (1969a) Weimarck (1973)
-
Krolow (1962) Weimarck (1973)
-
1.8-16.4
2.0-39.1
Krolow (1974a)
TRITICALE
309
acteristics. This study revealed an average of 11.6% aneuploids with a range of 9.7 to 14.9% in bulk seed. Of the aneuploids, 69% were hypoploids, showing a preponderance of deficient aneuploids. 2. Aneuploidy in Progenies of Euploids
In order to find out if cytological screening of euploids can lead to reduction in aneuploidy, the frequency of aneuploidy in the progeny of euploid plants was also studied. In advanced generations, Nakajima and Zennyosi (1966) observed 5% aneuploids, while Tsuchiya and Larter (1969a) observed 8.8%aneuploids in the progenies of euploids after seven to nine generations of inbreeding and selection. Tsuchiya and Larter (1969a) also observed that the aneuploid frequency was lower in triticales involving T . turgidum var. dicoccum (3.1%) than in those involving T. turgidum var. durum (12.6%)or T. turgidum var. carthlicum (10.7%). 3. Effect of Seed Size on Aneuploidy In order to find out if selection for seed size can help t o overcome the problem of aneuploidy, Tsuchiya (1972a, 1973) examined the aneuploid frequencies in seeds of different sizes, separated with the help of round holed sieves. The aneuploid frequency was lowest in large seed size classes in all but one strain and, therefore, selection for large seed size was recommended. Later in octoploid triticales similar results were obtained by Weimarck (1975~).She, however, questioned the effectiveness of selection for seed size to be of practical value. Muntzing (19791, however, felt that selection for seed size may not be effective in octoploid triticales due to high frequency of aneuploidy, but may show favorable response in hexaploids with low frequency of aneuploidy. Plots seeded with larger seeds were also found to give higher yields (Ogilvie and Kaltsikes, 1977). The selection of large seed size was therefore also recommended in segregating F, populations for the improvement of yield in later generations.
4. Effect of Mating System on Aneuploidy Using 10 strains of hexaploid triticales, Gupta and Malik (1982) recently studied the aneuploid frequencies in parents, composite, selfed, and diallel hybrid F, seed (Table 9). The data suggested that aneuploids, which were predominantly hypoploids, were found in fairly high frequencies in all populations. The frequencies were significantly higher in F, seed derived from F, hybrids and were attributed to a higher degree of meiotic irregularities recorded in F, hybrids.
310
P. K. GUPTA AND P. M. PRIYADARSHAN
B. TRANSMISSION RATES 1. Transmission of Aneuploidy Pieritz (1966) studied the breeding behavior of two octoploid triticales, one relatively stable and the other unstable. Reciprocal crosses were made between euploid octoploid plants with a stable hexaploid triticale to study male and female transmission rates of euploid and aneuploid gametes. It was observed that male transmission of normal gametes was 97% in both strains of octoploid triticales. On the other hand, female transmission of normal gametes was 63% in the stable strain and 37% in the unstable strain, the range of chromosome numbers being 24 to 30 among the transmitted gametes. No relationship could be observed between the transmission rates and the range of aneuploidy in the progeny of octoploid triticales. Tsuchiya (1968b) and Tsuchiya and Larter (1969b) studied the transmission of aneuploidy in hexaploid triticales with the help of reciprocal crosses of plants with 2n=41 and 2n=43 with euploid (2n = 42) plants and in their selfed progenies. Their results suggested that hypoploids (2n=41) gave a low frequency of euploids (18.7%), while hyperploids (2n=43) gave a relatively higher frequency of euploids (59.0%).The transmission of deficient gametes ( n= 20) in plants with 2n = 41 was higher on the female side (47.7%)than on the male side (36.4%).Scoles and Kaltsikes (1974) referring to another paper of Tsuchiya (1969) gave values of 58.5 and 22.8%for female and male transmissions, respectively. Similarly in plants with 2n = 43, transmission of addition gametes (n=22) was higher on the female side (36.9%)than on the male side (30.5%). 2. Effect of Specific Chromosomes on Transmission In wheat, differential rates of transmission of monosomics for different chromosomes are known (Tsunewaki, 1964; Morris and Sears, 1967). It was shown that in general, monosomics in homoeologous group 1 and 6 in wheat had high transmission and those in group 2 had low transmission. But the low transmission rates were also recorded for monosomics 1B and 6B, which were attributed to their nucleolar organizing role. In hexaploid triticale, Darvey and Larter (1973) examined the transmission rates of monosomics for chromosomes Sat4(1B), Sat5(6B), SM5, and M1 (identified with the help of karyotypes prepared by Shigenaga and Larter, 1971), and recorded in their progenies 28, 8, 12, and 7% nullisomics, respectively. It suggested that in triticales as in wheat, differential transmission rates for different chromosomes
TRITICALE
311
were observed. A high transmission of deficiency for 1B was not in accordance with the results known in wheat and no explanation for this difference in the effect of 1B in wheat and triticale monosomics is available. 3. Transmission Rates us Meiosis Efforts were also made to relate frequencies of aneuploidy and their transmission rates to meiotic irregularities in triticales. Boyd et al. (1970) and Merker (1971) showed that the frequencies of aneuploids in the progeny of euploids was lower than was expected on the basis of meiotic irregularities. This could be due to several reasons as outlined by Boyd et al. (1970): (1)there is always a certation effect among microspores having different chromosome numbers; (2) aneuploid megaspore frequencies are extrapolated from the study of meiosis in pollen mother cells, which may not be justified in view of known differences between male and female meiosis; and (3) some of the abnormal megaspores may not function.
C. CONTRIBUTION OF WHEAT AND RYECHROMOSOMES In Section VI, we discussed the relative contribution of wheat and rye chromosomes to univalent formation. With the help of karyotypes of hexaploid triticales, Shigenaga et al. (1971) and Merker (1973a) found that in aneuploids, rye and wheat chromosomes are eliminated in frequencies proportional to the number of genomes contributed by the two parents. Pieritz (19701, on the other hand, found that although wheat as well as rye chromosomes are involved in aneuploidy, rye chromosomes are predominant. Since these results were based on chromosome measurements and morphology and since chromosomes in triticale can have altered morphology, some doubt has been expressed about the validity of the above results (Weimarck, 1974). One of the valuable methods to identify chromosomes involved in aneuploidy would be to study the pairing behavior of the telocentric chromosome in hybrids between the aneuploid and the relevant ditelos of wheat. The unpaired telo will then determine the identity of the missing wheat chromosome. Similarly, the identity of missing rye chromosomes can be ascertained with the help of wheat rye telo addition or substitution lines. These available methods, to our knowledge, have not as yet been tried for identification of chromosomes involved in aneuploidy. However, with the availability of the Giemsa banding technique, identification of rye and wheat chromosomes in triticale became pos-
312
P. K . GUF'TA AND P. M. PRIYADARSHAN
sible (see Section VI). Using this technique in a meiotically irregular octoploid triticale, Weimarck (1974) demonstrated that aneuploidy involved both wheat and rye chromosomes on a random basis.
D. GENERALCONCLUSIONS The above discussion on aneuploidy illustrates that the problem of aneuploidy cannot be resolved by selection for agronomic traits or for euploidy or for seed size. Very similar frequencies in bulk populations and in the progenies of euploids also need an explanation. It is suggested that this may be due to differences in germination conditions in the laboratory and in the fields so that in the field, aneuploids are eliminated due to low germination and poor emergence. If this is not so, the frequency of aneuploids should increase in subsequent generations, due to their production in high number from aneuploids (81.3%in the progeny of 2n = 41 and 41.0%in the progeny of 2n = 43) and in low frequency also from the euploids. Some kind of equilibrium, therefore, is maintained by eliminating plants with low fertility and fitness due to aneuploidy (Krolow, 1965). We believe that the problem of aneuploidy should be resolved by first stabilizing the meiosis, for which genetic control must be in operation. A mutation program for stabilizing meiosis is laborious, but may provide a solution for this problem. The polygenic control of meiotic stability for which there is some evidence might make the task still more difficult. VIII. Problems, Progress, and Possibilities
The wheat-rye hybrids were initially produced with a view t o transfer some of the desirable attributes of rye to wheat. As a consequence the present day triticales, both octoploid and hexaploid, possess a number of desirable attributes: (1) they possess winter hardiness derived from rye and therefore were found to survive in severe winters, when wheat cultivars used as standards were destroyed or damaged; (2) they possess the ability to grow on light soils (medium light to pure sand); (3) like rye, particularly octoploid winter triticales possess early flowering, seed maturity, and harvest; (4) octoploid triticales have larger kernels (average 1000 kernel weight is 50 g in octoploid triticale and 40 g in wheat) and higher protein and lysine content relative to hexaploid wheat (protein content 18.41%in octoploid triticales and 13.51% in wheat according to Muntzing, 1979). At altitudes of 2000 m and above, both octoploid and hexaploid
TRITICALE
313
triticales have shown competitive performance with wheat in China, India, and Mexico. Recently hexaploid triticales have also shown their ability to compare well with hexaploid wheat or outyield it (cultivar Welsh in Canada and Coorong in Australia) and acquire resistance more easily than wheat (Wabwoto, 1974; Srivastava, 1974). Thus remarkable progress in the improvement of hexaploid triticales is known to have been made through the work conducted in several countries. However, the work carried on in Sweden by Muntzing and his coworkers with patience and perseverance led to considerable improvement in octoploid triticales. Notwithstanding the desirable attributes described above, both in octoploid and hexaploid triticales, there are some serious problems, which have received the attention of triticale workers in recent years: (1) there is meiotic instability, aneuploidy, and partial sterility both in octoploid and hexaploid triticales, due to which ears are not well filled with kernels (like wheat and rye), although in octoploid triticales, this drawback is partly compensated by large kernel size; (2)kernels are often shriveled both in octoploid and hexaploid triticales, which leads to lower values of test weight than in wheat (for test weight see Section VII1,B); (3) octoploid triticale and to some extent even hexaploid triticale kernels have a tendency to sprout before harvest, if the weather is rainy. This is correlated with a high amount of a-amylase (Muntzing, 1979); (4) there are problems concerning diseases and nutritive aspects; ( 5 ) there is also the problem of lodging in octoploid triticales, which reduces the yield. These problems and the progress achieved as well as the possibility of overcoming these problems in the future will be discussed in this section. AND STERILITY A. MEIOTICISTABILITY, ANEUPLOIDY,
Meiotic instability, aneuploidy, and sterility are serious problems in hexaploids as well as octoploid triticales. Detailed discussions of meiotic instability occur in Section VI and of aneuploidy in Section VII. It has, however, been recognized that secondary and advanced hexaploid and octoploid strains have relatively reduced levels of meiotic instability and aneuploidy and have higher levels of fertility (Merker, 1971; Tsuchiya, 1969; Muntzing, 1979). It is also recognized that this problem is relatively less acute in hexaploid than in octoploid triticales, because more rapid and significant progress has been made in hexaploid triticales. There is no direct relationship between meiotic instability and fertility, although meiotic irregularity tends to decrease fertility due to
314
P. K. GUPTA AND P. M. PRIYADARSHAN
increase in aneuploidy. The absence of correlation between meiotic instability and fertility suggests that there are factors other than cytological ones which lead t o reduced fertility. Muntzing (1979) believes that meiotic disturbances and sterility are two symptoms of the same physiological disturbance. According to him the sterility may partly result from meiotic irregularities caused by physiological disturbances. In such a case, it will be haplontic, since the effect will be through unbalanced gametes produced because of univalents, laggards, micronuclei, etc. However, the effect may in part be directly due to physiological disturbances independent of meiosis and then it will be diplontic resulting from mitotic irregularities observed (Section VI). That the sterility could be caused at least partly by somatic effects is obvious from the fact that strains having different degrees of meiotic irregularities were sometimes found to have the same level of fertility and that different regions of a spike had different levels of fertility. On the basis of a reduced level of meiotic stability in F, and variable levels in F2,Merker (1971) suggested that meiotic stability is governed by a specific combination of polygenes, which breaks down in hybrids. It has also been realized that meiotic irregularity is reflected in aneuploidy and therefore partly also in the level of fertility, but selection needs to be exercised independently for a higher degree of meiotic stability and higher level of fertility. Much work needs to be done in this direction to achieve the levels of meiotic stability and fertility available in wheat. The possibilities of relative roles of recombination, selection, and induced mutations in achieving this goal cannot be assessed, but solution of this problem requires the help of all available avenues.
B. KERNAL SHRIVELING Significant improvement in triticale yields have been made during the last two decades. Triticale strains have also been obtained which are relatively unshriveled (Fig. 3). However, despite these intensive efforts, an ideal smooth and well-filled grain has not been obtained so far either in octoploid or in hexaploid triticales. It is believed that as a feed crop, the main objective in triticale breeding will be to achieve higher yields regardless of kernel shriveling. As a food crop, not only does the kernel shape have low acceptance by consumers in developing countries, but its associated high a-amylase activity reduces its use in several industries and is responsible for preharvest sprouting. It is, therefore, obvious that triticale cannot become a major and well-established crop unless kernel shriveling is eliminated. The
TRITICALE
315
FIG. 3. Kernels of four different triticale strains showing variable degrees of shriveling: (a) TS 1-2, (b) DR-IRA, (c) Bronco-90, and (d) Coorong.
reduction in kernel shriveling, it is believed, will improve the storage capacity or sink of the grain, and will reduce the a-amylase activity associated with shriveled grains. These and related aspects of kernel shriveling have recently been reviewed by Thomas et al. (1980). This review and the recent book by Muntzing (1979) are the bases of the short account of kernel shriveling presented in this section.
316
P. K. GUPTA AND P. M. PRIYADARSHAN
1 . Measurement of Kernel Shriveling Kernel shriveling can be quantified by visual rating (Darvey, 1973; Kaltsikas et al., 1975; Bennett, 1977a) or through at least three available objective parameters: test weight, kernel density, and volume ratio. Test weight is measured as weight per hundred liters of bulk volume, kernel density is measured on the basis of displaced volume, and volume ratio is measured as the ratio of displaced volume to the maximum volume, which a kernel displaces during its development. The test weight in triticale ranges from 58 to 72 kghl, while that of best wheats is up to 80 kg/hl. Similarly kernel density in triticales is known to range from 0.66 to 1.30 g/cm3,while that in hard wheat is about 1.36 g/cm3 (Muntzing, 1979; Thomas et al., 1980). Thomas et al. (1980), however, felt that none of these parameters is an ideal index and therefore suggested a joint index like dry weight at maturity over maximum volume displaced during development.
2 . Seed Development Development of seed in triticale has been studied by several workers (Kaltsikes, 1973; Kaltsikes and Roupakias, 1975; Bennett et al., 1975). It has been shown that kernel shriveling is mainly due to abnormal endosperm development, which in its turn depends on two factors. First, the rate of growth of the endosperm is not fast enough to fill the pericarp and second, cavities of different kinds are formed in the subaleurone layer and deep in the endosperm leading to shriveling. Contradictory results are also available in several cases. For instance, although in triticale and rye, where shriveled kernels are found, fewer antipodals are formed relative to wheat, among the triticales themselves, strains with shriveled kernels are associated with a relatively higher number of antipodals (Thomas et al., 1980). Another associated feature of shriveling is delayed pollination, which in wheat x rye and wheat x wheat hybrids caused shriveling. It is, therefore, necessary to find out if kernel shriveling in triticales is due to variation in the time of ovule development and anthesis. If it is so, one may look for genetic variability in the timing of anthesis. The development of embryo and endosperm in relation to seed growth has been studied in some detail. It has been shown that kernel shriveling is determined during early kernel development and is associated with early rapid endosperm divisions, increase in dry weight per kernel in the first 10 days, increase in volume of the kernel, and decrease in kernel density. It is speculated that in early stages, the rapid growth is utilized mainly in the development of seed coat and
TRITICALE
317
the volume of the seed and later leads to a higher frequency of aberrant nuclei. Large kernel size, although associated with kernel shriveling, is not the cause of it. This is also because changes in dry weight later in seed development bear no direct relationship with kernel shriveling (Salminen and Hill, 1978). It was also shown that in several improved secondary triticales, improvement in seed type was accompanied by reduction in the rate of early embryo and endosperm divisions (Bennett et d . ,1975). However, in another study by Kaltsikes and his coworkers at Manitoba (Thomas et al., 19801, slow rate of early endosperm division was not associated with improvement in seed type. This suggests that rapid rate by itself is not responsible for kernel shriveling, but may itself result from other factors, mainly metabolic, which may be responsible for kernel shriveling. This is suggested from the fact that the aberrant nuclei, whose frequency is more closely associated with shriveling, appear, in development, much later than the early stages when a rapid rate of development is observed. In triticales with shriveled kernels, cellularization needs relatively fewer divisions, and abnormalities occur both during the coenocytic period and during cellularization leading to cavities both in the margin and in the center. The aberrant nuclei fail to contribute to endosperm tissue and give rise to a tissue which is watery and does not deposit starch thus forming cavities. The tissue surrounding the cavities is also influenced in its development and expansion due to lack of support on one side. 3. Role of Rye Chromosomes in Shriveling It has been suggested that rye chromosomes are mainly responsible for shriveling, since aberrant nuclei have been observed in rye (Kaltsikes et al., 1975) and in individual rye chromosome addition lines except that for 2R (Darvey, 1973; Kaltsikes and Roupakias, 1975). Moreover, the chromosomes involved in bridge formation in endosperm have been identified as rye chromosomes (Bennett, 1977a) and no shriveling is observed in amphiploids involving alien species other than rye with wheat. The heterochromatin present as telomeric blocks has been suggested to be responsible for shriveling although evidence is contradictory. In addition lines with chromosomes 2R, 3R, and 7R, where telomeric heterochromatin was lost, fewer aberrant nuclei were observed relative to other rye chromosomes carrying heterochromatin (Bennett, 1977a; Singh and Robbelen, 1976; Kaltsikes and Roupakias, 1975). On the other hand, using telocentrics, it could be shown for chromosomes 4R, 5R, and 6R that shriveling is associated with the long arm, although the major terminal C-bands are located on the
318
P. K. GUPTA AND P. M. PRIYADARSHAN
short arm. In triticales also, loss of heterochromatin from the long arm of 7R and from the short arm of 6R had no effect on shriveling (Thomas et al., 1980). Similarly Beagle having relatively more heterochromatin had better seed than DR-IRA with less heterochromatin, while 6A250 with relatively less heterochromatin had better seed than 6A190 having more heterochromatin. In view of these contradictions, the characteristics of rye chromosomes responsible for producing aberrant nuclei and shriveling are not clearly understood. In recent studies (Gustafson and Bennett, 1981; Bennett and Gustafson, 1981) involving three lines containing no modified rye chromosome, one modified rye chromosome (6R), and two modified rye chromosomes (4R/7R and 6R), it was shown that a positive relationship existed between the presence of telomeric heterochromatin on the short arm of two rye chromosomes involved, and the production of aberrant endosperm nuclei. The loss of heterochromatin was also associated with improved thousand kernel weight and test weight, leading to significantly higher yield. Gustafson (1982) also emphasized that there are several studies which indicate that the telomeric heterochromatin in rye contains the same repeated DNA sequences in all the chromosomes (Appels et al., 1978, 1981; Bedbrook et al., 1980), although their arrangement may differ considerably (Appels et al., 1981). In view of this, at this stage, one cannot be sure whether there will be chromosomal specificity regarding the effects of loss of heterochromatin. Further studies in this direction will definitely be rewarding. 4 . Metabolic Aspects A variety of experiments involving study of metabolism of seed development in triticales demonstrated that the limiting factor in triticales is not the ability of plant to synthesize or to translocate or to mobilize the carbohydrates, but it is the storage capacity or the “sink” which is a limiting factor. It has also been observed that precocious release of a-amylase leads to premature digestion of starch granules (Dedio et al., 1975; Klassen et al., 19711, as evident from the observation of eroded starch grains (Dronzek et al., 1974; Dedio et al., 1975; Simmonds, 1974). In the seed, at maturity a negative correlation between a-amylase activity and kernel density was also observed. Variation between a-amylase activity could be observed even between shriveled and unshriveled grains of the same triticale strain (Klassen, 1970). There is, however, other evidence which suggests that a premature increase in a-amylase activity is frequently but not universally associated with shriveling, although a-amylase activity at ma-
319
TRITICALE
turity is more universally associated with shriveling, lack of dormancy, and premature sprouting. Due to the complex genetics involved, breeding for unshriveled kernels seems to be difficult. When visual selections for plump kernels were made, elimination of dwarfing genes was observed. Mutagenic treatments, therefore, may be more useful. Improvement in seed type was obtained through selections in M, and M, generations in Mexico at CIMMYT (Zillinsky, 197413). Jenkins (1975) reported some success with mutagenic treatments in getting variation for improved grain type. Mutation studies were conducted by several other workers (Rao and Joshi, 1976; Sanchez-Monge, 1959; Vettel, 1958, 1959, 1960a,b), but more efforts need to be directed toward this method of achieving our goal in triticale breeding. C. DISEASES Disease resistance in triticale derived from rye was one of the important reasons it was considered to be a potential commercial crop. The most fascinating feature was the differential occurrence of diseases. A list of different known diseases is given in Table 10. Rusts (Chester, 1946; Larter et al., 1968; Quinones, 1971; Lopez, 1971; Fuentes, 1974) and ergot (Larter et al., 1968; Platford and Bernier, 1970) are the main threat to triticales. As a remedy, genes for rust resistance from wheat can be transferred t o triticale or, as an TABLE 10 Diseases of Triticale Disease
Causal organism
Reference
Stem rust (black rust)" Leaf rust (brown rusty
Puccinia graminis tritici Puccinia recondita
Stripe (yellow rusty Leaf blight" Ergot
Puccinia striiformis Alternaria triticina Claviceps purpurea
Downy mildew
Sclerophthora macrospora
Leaf blight
Fusarium nivale
Septoria leaf blotch Bacterial stripe
Septoria tritici Xanthomonas translucens
Head blight
Fusarium spp.
Lopez (1971) Chester (1946); Larter et al. ( 1968) Quinones (1971) Chaudhari et al. (1976) Platford and Bernier (1970); Larter (1976) Troutman and Matejka (19721 Richardson and Zillinsky (1972) Zillinsky (1973) Zillinsky and Borlaug (1971a) CIMMYT report (1972)
a
Reported both in triticale and wheat.
320
P. K. GUPTA AND P. M. PRIYADARSHAN
alternative, the resistance from rye can first be transferred to octoploid triticale and then to hexaploid triticale (Zillinsky, 1974b). It has also been suggested that resistant plants can be intercrossed and backcrossed to wheat to achieve resistance (Quinones, 1974; Rodriguez, 1974). Quinones et al. (1972) studied the inheritance of leaf rust resistance in triticale and concluded that it is monogenically controlled. They also found that genes for resistance from rye had low expressivity in triticale. Three Indian strains, DTS115, JNK 6T017, and JNK 6T210, were found to be resistant to all three rusts (Joshi et al., 1977). Triticale was also found to be resistant to both wheat powdery mildew (Erysiphe graminis f . sp. tritici) and rye powdery mildew (Erysiphe graminis f . sp. secalis) (Linde-Laursen, 1977). Besides the above mentioned diseases, seed-borne and soil-borne fungi also infect the grain, which leads to poorer seed germination.
D. NUTRITIVE ASPECTS The protein, both in content and quality, is higher in rye as well as in triticales (both octoploid and hexaploid) than in bread wheat. Triticales also have a higher content of essential amino acids than bread wheat, and therefore are superior in nutritional value. In view of this and because in Third World Countries cereals provide up to 60% of protein and calories, triticales can provide an additional source of good quality protein and calories. Since significant improvement both in yield and kernel characteristics has been obtained both in octoploid and hexaploid triticales, it has been recently emphasized that adequate attention be given to the nutritional aspects of triticale proteins. This aspect has been dealt with in considerable detail by Hulse and Laing (1974). A summarized account of this and related aspects has also been given by Muntzing (1979). The brief account of these aspects presented in this section is mainly based on these two sources. 1. Total Protein and Its Quality In triticale kernel, as in wheat, barley, and rye, attention is normally given to storage protein in the endosperm. The potential of a plant to deposit a high proportion of protein nitrogen in the endosperm is known to be genetically controlled. However, the expression of this genetic potential is governed by the environment used and the agronomic practices followed for growing the crop (Hulse and Laing, 1974). It was shown that the protein content, gluten content, and bread volume in octoploid triticales was remarkably high. In hexaploid
TRITICALE
32 1
triticales, although the protein content is lower than in octoploids, it is still higher than in wheat, rye, barley, and maize (Kiss, 1975). Hulse and Laing (1974), however, feel that protein content in triticale is higher than in wheat, but is lower than in rye. Biochemical differences between proteins of triticales, wheats, and rye have also been studied and are known to be complex (Hall, 1959). In wheat and rye there are some substances which may be common, but found in the same or different concentrations, and there are others which may be specific to wheat or to rye. Octoploid triticales are known to possess the fractions which are common between wheat and rye and also possess others which are specific to wheat or rye. Also, in triticales, the number of antigenic proteins is known t o be highest, while their number is lowest in rye. The biochemical complexity, therefore, has increased in octoploid triticales in proportion to the degree of polyploidy. On the other hand, in hexaploid triticales, it was also shown that the protein, besides having features of wheat and rye proteins, has its own unique characteristics not found in either of its parents (see Muntzing, 1979).
2 . Amino Acid Composition Of the 18 amino acids commonly found in natural edible proteins, 10 are considered essential for human infants and only 9 for human adults (Kasarda et al., 1971). As in wheat and rye, in triticales lysine is the limiting amino acid (Knipfel, 1969; Kies and Fox, 1970). Therefore, for the improvement of the nutritional quality of proteins, attention is primarily being paid to the proportion of lysine in the storage proteins. Using wheat-rye addition lines, it has been shown by Riley and Ewart (1970) that the interchromosomal interactions involving individual rye chromosomes can influence some amino acids and not others. For instance, the chromosomes of homoeologous group 5 promote higher lysine content. It has been shown that average lysine content in wheat based on a large number of genotypes is 179 mg per gram of nitrogen, the corresponding values for rye and triticales being 212 and 196 mg, respectively. It shows that the lysine content in triticale is intermediate between those in wheat and rye. It was also shown to be about 8-10% higher in hexaploid triticales than in other cereals including wheat. Lysine content expressed as percentage total protein is inversely correlated with protein expressed as percentage dry matter, but is positively correlated with it when lysine is instead expressed as percentage dry matter. It means that with an increase of total protein, total lysine also increases, but its proportion in protein decreases. The
322
P. K. GUPTA AND P. M. PRIYADARSHAN
lysine content estimated in 16 samples of hexaploid triticales ranged from 3.72 to 4.35% of total protein which was estimated to be 13%. When compared with lysine-rich opaque-2 maize, several advanced hexaploid triticales though found to be equal in lysine content, were superior in protein content. 3 . Other Major and Minor Elements In cereal grains like triticale, there are several components other than protein and lysine which are important. According to Muntzing (1979), triticales contain higher amounts of major mineral elements such as potassium and phosphorus. Other nutritionally important, but minor elements such as sodium, manganese, iron, and zinc are also found in higher amounts in triticales than in wheats. Triticales also have a copper tolerance conditioned by the rye genome, which enables it to grow as a new crop in marginal lands with low concentrations of copper as in Australia. Furthermore, triticales can be a good source of mineral elements and B vitamins. 4 . a-Amylase and Resorcinol Data on a-amylase activity also received increased attention and emphasis in view of its association with premature germination and sprouting of kernels at harvest time (Muntzing, 1976). Some triticales have better resistance to sprouting than others which is related to a-amylase activity, thus making the selection possible (Chojnakki et al., 1976). Triticales also differ from wheats in their response to a-amylase activity. For instance it has been shown that triticales with a particular level of amylase activity may give good breads, while the same activity may destroy the baking capacity in wheats. It has also been recommended that triticales should be subjected to abrasion milling to remove seed coat and reduce toxic resorcinol content and undesirable microorganisms from the surface of the grain. However, genetic variability for low resorcinol content will also have to be looked for. 5. Baking Quality Muntzing (19791, based on his experience, observed that octoploid triticales (though not all) had high gluten content and baking capacity giving bread which was porous and had good flavor. It has also been shown that as in wheat, the bread volume in triticale can also be increased by doubling the rate of bromate added to the dough. Hexaploid triticales on the other hand are generally found to be inferior to bread wheat in its baking capacity. However, Muntzing (1979) feels that by adopting a new bread-making technology includ-
TRITICALE
323
ing mechanical development of dough, satisfactory bread from triticale flour can be obtained. Triticale flour can be supplemented with protein from other sources like legumes, milk, microbes, and fish. The benefit derived from these sources will be limited until the lysine ceases to be the first limiting amino acid. 6 . Feeding Experiments
Results are also available from experiments where triticales were used as a feed for humans, rats, laboratory mice, chicks, hogs, swine, calves, and steers. In humans, rats, and mice, superiority of triticales over wheats in terms of nitrogen retention was demonstrated. In chicks also, triticales were at least equal if not better than wheat, and were, therefore, recommended to be included in the diets of hens and turkey poults. In hog-feeding trials, triticales were equal to barley for heavier animals, but inferior in the diet of lighter animals. In these experiments, reduced palatability and loss of appetite were observed on large scale feeding. In calves and steers also, small reductions in feed intake and weight gain were observed, although protein digestibility and feed efficiency were better. In all these cases, it was observed that lysine and sometimes methionine were the first limiting amino acids. However, the reliability of these results has been questioned for several reasons. (1) Since soyabean was used to bring all test diets to the same nitrogen level, the real differences may be obscured or differences may be observed which are more apparent than real. (2) Adequate attention was not paid to record or standardize the characteristics of triticales, particularly with respect to the size and conditions of the kernel. (3) Ergot infection was not given due attention, although we know that it can lead to reduced feed intake and weight gain. From the above account, we may conclude that triticales are good not only as feed and forage, but also as human food. Its use for bread making was demonstrated in Hungary (Kiss, 1975) and it was shown to be intermediate between wheat and rye in the case of milling and energy requirement. In milling, although triticale has more bran than rye, the bran is said to be a valuable base fodder. Triticale flour is also less glutinous than rye flour and has been recommended for making pancakes, tortillas (in Mexico), and chapatis (in India) (see Lorentz, 1974; Hulse and Spurgeon, 1974).
E. COMMERCIALLY RELEASED VARIETIESIN TRITICALES As pointed out earlier, considerable improvement in hexaploid triticales was made during the last 20 to 30 years, due to the utilization
324
P. K . GUPTA AND P. M. PRIYADARSHAN
of octoploid triticales and hexaploid wheats in the development of secondary hexaploid triticales (Pissarev, 1966; Kiss, 1966a; Jenkins, 1969). These improved triticales were assessed for their potentiality as a commercial crop. This led to the release of several varieties of triticales for cultivation in different countries. In this section, we describe some of these varieties, which were released as cultivars, and information about which is available. We realize that many more cultivars must have been released without being published. For instance, we learned from Dr. A. F. Stelmakh (personal communication), Odessa, USSR, that several triticale cultivars have been released in the USSR (AD-206 and Odesskiy kormovoy). 1 . Triticales No. 57 and No. 64. In the plant breeding Research Institute of Mosonmagyarovar in Hungary between 1954 and 1956, an F, population was grown from multiple octoploid triticale crosses (T.AD 20/1, T . Taylor, T . Meister, T . Rimpau) and from the crosses of selected F, elites (8x1 and triticale No. 1 ( 6 ~ )In . 1961 the selected elites were crossed with Triticale No. 30.In 1965 (BC,F,) strains were developed from F, generation. The segregating fertile triticales suitable for propagation have always been hexaploids. Two varieties, No. 57 and No. 64, were the result of selection from this (Kiss, 1971, 1974a,b) and were released in 1968. Both No. 57 and No. 64 were tall and capable of yielding 30-40 q/ha. The lysine content of T . No. 64 was 0.50%, and the protein efficiency coefficient was also higher (&lo%). 2 . Rosner Rosner was developed from a program initiated in 1954 in the Department of Plant Science, University of Manitoba, and was licensed in May 1969 and became recognized as a new crop of commerce in Canada (Larter et aZ., 1970). The cultivar was selected from a double cross involving four amphiploids each of which was initially produced from crosses between a tetraploid wheat species (T.turgidurn L.) and spring rye (Secale cereale L.). The pedigree is as follows: [ T . turgidurn var. durum (cv. Ghiza) x S. cerealel x [T.turgidurn var. durum (cv. Carleton) x S. cerealel x (7'.turgidurn var. persicum x S. cereale) x (T.turgidurn x S. cereale hybrid of unknown identity). Rosner, which was named after the Rosner Research Chair, outyielded Manitoba wheats by approximately 4%, in replicated large plot trials in Manitoba in 1968. Yields of Rosner were equal to those of Conquest barley. But it does not compare favorably with the bread wheats in milling and baking qualities. Rosner was resistant to stem
TRITICALE
325
rust and leaf rust but susceptible to ergot and took a greater number of heat units than wheat to reach maturity. 3 . Cachirulo The triticale variety Cachirulo was released in Spain iln 1970 (Sanchez-Monge, 1974). It was mentioned that high fertility is its good attribute. The protein content is high (average 20%). The lysine content per 100 g of protein was 3.75 g for a sample with 18.4% protein and 3.0 g for another sample with 20.1% of protein. Cachirulo has no disease problems, but has negative attributes such as tallness and lodging in rainy seasons. 4 . Welsh Welsh triticale was selected at the University of Manitoba from a line introduced from CIMMYT, Mexico in 1972 (Larter et al., 1978). The name Welsh was chosen in memory of the late Dr. John Welsh who in 1958 performed the first crosses in the University of Manitoba triticale program. Welsh was granted licence in October 1977. The overall average yield of Welsh is equal to that of Glenlea wheat and is approximately 16.0% higher than Rosner. Welsh is resistant to lodging but susceptible to after harvest sprouting. The protein content of Welsh (N x 5.7; 14% moisture) is equal to that of Glenlea wheat and Rosner triticale. Welsh originated from the cross INIA/rye/2/Armadillo, made in Mexico by F.J. Zillinsky. In this cross ININrye was an octoploid triticale and Armadillo was a hexaploid triticale obtained from a double-cross (Triticum durum L. cv. GhizalSecale cereale L.151T. durum cv. Carletod2lS. cerealel7lT. dicoccoides/3/S. cerealel6lT. persicuml4lS. cereale). Welsh, a hexaploid triticale (2n = 42), was found to have 16 chromosome pairs from wheat and 5 from rye. Two rye chromosomes, 2R and 4R, were absent (Darvey and Gustafson, 1975). Welsh produced about 5% aneuploid progeny, and its fertility was better than Rosner. Welsh is resistant to races of stem rust but moderately susceptible to leaf rust, root rot, loose smut, and bunt. 5. Coorong Coorong has been released in Australia in 1980 by Dr. C.J. Driscoll of University of Adelaide, its pedigree being INIA-ARM “S” x 16485N-2M-OY-2B-OY. The originally accessioned seed was ENTRY 154 from the 6th ITSN (International Triticale Summer Nursery) from CIMMYT.
326
P. K. GUPTA AND P. M. PRIYADARSHAN
6. Carman A new triticale “Carman” has been released from Canada in 1981 (Gustafson et al., 1981), the pedigree and details of which are not available to us at present. IX. Summary and Conclusions
1. Triticale is the first man made cereal of commercial value. It is now accepted that the earlier generic name Triticale and the specific name Triticale hexaploide Lart. are invalid and that the only acceptable generic name for this crop is x Triticosecale Wittmack. Triticale, therefore, is only a popular name and will not be capitalized, underlined, or italicized. 2. Triticales at different ploidy levels can be primary or secondary. The primary triticales can be raw amphiploids or recombined triticales, while the secondary triticales can be true secondary triticales or substitutional secondary triticales. This terminology differs from the one suggested by Muntzing (1979) and has been considered by the authors to be more appropriate. 3. Triticales are known to be produced at four ploidy levels, decaploid (lox= 701, octoploid (8x = 56), hexaploid (6x = 421, and tetraploid (4x= 28). Although conventional methods were successful for the production of octoploid and hexaploid triticales, new methods were required for the production of decaploid and tetraploid triticales. Decaploid triticales (2n= 70 = AABBDDRRRR) were produced by Muntzing (1955)through hybridization between octoploid triticale and tetraploid rye, followed by chromosome doubling of the pentaploid hybrid (ABDRR).Similarly, tetraploid triticales were produced by crossing hexaploid triticales with diploid rye followed by selfing of the F, hybrid (ABRR). This gave rise to tetraploid triticales having a genome of seven pairs of rye chromosomes and another mixed genome with a variable number of chromosomes from A and B genomes. Many more tetraploid triticales need to be produced to have sufficient variability, so that these tetraploid triticales may be used, if not as a commercial crop, at least for the improvement of hexaploid triticales. 4.The improvement of hexaploid triticales is known to have followed several courses. First, the recombination between different primary triticales gave rise to improved recombined triticales. Second, the crosses of hexaploid triticales as male parent with octoploid triticales or with hexaploid wheats as female parent led to the production of secondary triticales, where A‘ and B’ genomes of hexaploid wheat
TRITICALE
327
have been utilized for recombination; tetraploid cytoplasm was replaced by hexaploid cytoplasm and some rye chromosomes were replaced by wheat chromosomes from the D genome. Third, the hybrids between octoploid and hexaploid triticales were crossed to hexaploid wheat to produce triple hybrids, which provided better opportunities for recombination. Fourth, F, hexaploid triticales were crossed with F, bread wheat, and finally, the predoubled tetraploid wheat and predoubled diploid rye were crossed to produce hexaploid triticales, so that the sterility problem of F, hybrids did not exist. 5. The major breakthrough in triticale improvement started with the development of Armadillo due to spontaneous hybridization between hexaploid triticale and bread wheat at CIMMYT. Armadillo had desirable characteristics like dwarfness, early maturity, good nutritional quality, insensitivity t o day length, etc., and carried a 2R/ 2D disomic substitution. 6. With the knowledge of 2R/2D substitution in Armadillo, efforts were made t o find out the extent of substitutions in different triticale strains. These substitutions were also influenced by artificial and natural selection. For instance, 2R, 3R, and 5R were replaced more frequently while 1R and 6R were only rarely replaced, if at all. The nonreplacement of 1R and 6R was attributed to their nucleolar-organizing ability and their substitution in wheat is recommended for wheat breeding. 7. The karyotype of triticales included five satellited, five metacentric, nine submetacentric, and two acrocentric (with subterminal centromeres) chromosomes. The karyotype and the Giemsa C-banding technique were used for the identification of the univalents at meiosis in euploids, and of the missing chromosomes in hypoploids. Although some studies initially suggested the proportionate contribution of wheat and rye chromosomes to univalents and aneuploidy, recent evidence suggests that the rye chromosomes are the main source of meiotic instability. 8. The duration of mitosis in primary triticales was intermediate between that of its parents, but among advanced lines, the mitotic duration was reduced in Armadillo when compared with that of Rosner. This reduction has been attributed to the D/R substitution. On the other hand in the advanced lines, the duration of the S phase was greater and was attributed to the complex pedigree or unconscious selection. The DNA content in hexaploid triticale has been shown to be equal to the sum of the DNA contents of its parents. 9. The duration of meiosis in hexaploid triticales was about twothirds that of the rye parent, but was longer than that of the wheat
328
P. K. GUPTA AND P. M. PRIYADARSHAN
parent, Octoploid triticales, on the other hand, had a shorter duration of meiosis than either of its parents. The difference in the meiotic duration between triticales and its parents has sometimes been considered to be responsible for univalent formation. 10. The univalent formation is now believed to be mainly due to the reduction in chromosome pairing, which is attributed to several reasons including the tetraploid cytoplasm, allogamous rye, the differences between duration of meiosis and DNA contents between wheat and rye, and lastly to the interaction between the genes of wheat and rye chromosomes. The univalent formation thus is a complex phenomenon. 11.Through the C-banding technique and through the identification of rye bodies in antipodals, the heterochromatin in rye chromosomes has been shown to be concentrated in the telomeres. This heterochromatin is responsible to some extent for the meiotic instability in triticales, since several lines, with rye chromosomes modified due to loss of heterochromatin, were found to have improved cytological stability. 12. Aneuploidy in triticales is almost of universal occurrence, its frequency being much higher in octoploids than in the hexaploid triticales. The univalent frequency in the progeny of euploids, though relatively lower, is not of a sufficiently low order to be ignored. Selection of large seeds of hexaploid triticales has been considered to be useful to eliminate aneuploidy, but has not been tried by plant breeders and has been considered by some not to be practical. 13. Some of the desirable attributes of hexaploid triticales include winter hardiness, ability to grow on light soils, early flowering and early maturity, and higher protein and lysine contents. Despite these desirable attributes, there are several serious problems in the commercial utilization of this crop. These problems include meiotic instability, aneuploidy, partial sterility, shriveled kernels leading to low test weight, and preharvest sprouting. It has been suggested that selection for meiotic stability and fertility should be exercised independently. For kernel shriveling although some improvement has been achieved, further breeding and selection is needed to improve this character. A number of diseases are also known in triticales, the most important being rusts. Attention is also being paid to the nutritional aspects in triticales and improvement has been shown to be present in triticales for the protein content and its quality. Since lysine is the limiting amino acid the improvement of lysine content needs greater attention. a-Amylase activity is known to be associated with preharvest sprouting of kernels and therefore needs to be given due attention.
TRITIC ALE
329
Feeding experiments have been conducted with the help of a variety of animals and, in several cases, triticale has been shown to be equal if not superior to other cereals. 14.Several varieties of triticales have been released for commercial cultivation. Some of these varieties include triticales No. 57 and No. 64 released in Hungary, Rosner and Welsh from Manitoba, Canada, Cachirulo in Spain, and Coorong in Australia. It is claimed that some of these varieties outyield wheat while others are equal to wheat.
ACKNOWLEDGMENTS Financial assistance from the Indian Council of Agricultural Research in the form of a 3 year research project “Cytogenetic Studies in Triticales” made it possible for us to undertake this article and is gratefully acknowledged. The authors are also grateful to several triticale workers for the supply of literature and particularly to Arne Muntzing for quickly responding to our querries and for the supply of a photograph. The supply of seed of variety Coorong included in Fig. 3 by C. J. Driscoll is also thankfully acknowledged. Thanks are due to the Council of Scientific and Industrial Research for the award of a research fellowship to one of us (P.M.P.). Thanks are also due to Mrs. Sudha Gupta for secretarial assistance.
REFERENCES Appels, R., Driscoll, C., and Peacock, W. J. (1978). Heterochromatin and highly repeated DNA sequences in rye (Secale cereale). Chromosoma 70, 67-89. Appels, R., Dennis, E. S., Smyth, D. R., and Peacock, W. J . (1981). The heterochromatin blocks of rye (Secale cereale L.) chromosomes: a n analysis a t the molecular level using specific repeated DNA sequences. In preparation. Ayonoadu, U., and Rees, H. (1973). DNA synthesis in rye chromosomes. Heredity 30, 233-240. Baum, B. R. (1971a). The taxonomic and cytogenetic implications of the naming of amphiploids of Triticum and Secale. Euphytica 20, 302-306. Baum, B. R. (1971b). Proposal to conserve the “generic name” Triticale Muntzing. In “Nomina Generica Conservanda Proposita.” Texon 20, 644-645. Beatty, K. D. (1977). Triticale I. Interrelationships of fertility, cytologic and agronomic characteristics. 11. Synthesis and description of new hexaploid and octoploid germplasm, Ph.D. Thesis, University of California, Davis. Bedbrook, J. R., Jones, J., ODell, M., Thompson, R. D., and Flavell, R. B. (1980). A molecular description of telomeric heterochromatin in Secale species. Cell 19, 545-560. Bennett, M. D. (1971). The duration of meiosis. Proc. R . SOC.London Ser. B 178, 277-279. Bennett, M. D. (1972). Nuclear DNA content and minimum generation time in herbaceous plants. Proc. R y . SOC.London Ser. B . 181, 109-135. Bennett, M. D. (1974). Meiotic, gametophytic, and early endosperm development in triticale. Proc. Int. Symp., 1973 El Batan, Mexico IDRC-O24e, pp. 137-148. Bennett, M. D. ( 1976). The cell in sporogenesis and spore development. In “Cell Division in Higher Plants” (M.M. Yeoman, ed.), pp. 161-198. Academic Press, New York.
330
P. K. GUPTA AND P. M. PRIYADARSHAN
Bennett, M. D. (1977a). Heterochromatin, aberrant endosperm nuclei and grain shrivelling in wheat-rye genotypes. Heredity 39, 411-419. Bennett, M. D. (197713).The time and duration of meiosis. Phil. Trans. R . SOC.London Ser. B 277, 201-226. Bennett, M. D., and Gustafson, J. P. (1981). The effect of telomeric heterochromatin from Secale cereale L. on triticale ( x Triticosecale Wittmack) 11. The presence or absence of blocks of heterochromatin in isogenic backgrounds. Can. J.Genet. Cytol. (in press). Bennett, M. D., and Kaltsikes, P. J. (1973). The duration of meiosis in a diploid rye, a tetraploid wheat and the hexaploid triticale derived from them. Can. J . Genet. Cytol. 15, 671-679. Bennett, M. D., and Smith, J . B. (1972). The effects of polyploidy on meiotic duration and pollen development in cereal anthers. Proc. R . SOC.London Ser. B . 181, 81107. Bennett, M. D., and Smith, J . B. (1975). Confirmation of the identification of the rye chromosome in l B / l R wheat-rye chromosome substitution and translocation lines. Can. J . Genet. Cytol. 17, 117-120. Bennett, M. D., and Smith, J . B. (1976). Nuclear DNA in angiosperms. Phil. Trans. R. SOC.London Ser. B 274, 227-274. Bennett, M. D., Chapman, V., and Riley, R. (1971). The duration of meiosis in pollen mother cells of wheat, rye, and triticale. Proc. R . SOC.London Ser. B 178, 259-275. Bennett, M. D., Smith, J. B., and Kemble, R. (1972). The effect of temperature on meiosis and pollen development in wheat and rye. Can. J . Genet. Cytol. 14,615-624. Bennett, M. D., Smith, J. B., and Barclay, I. (1975). Early seed development in the Triticale. Phil. Trans. R . SOC.London Ser. B 212, 199-227. Bennett, M. D., Gustafson, J . P., and Smith, J . B. (1977). Variation in nuclear DNA in the genus Secale. Chromosoma 61, 149-176. v. Berg, K. H. (1937). Die Zytologie in der Pflanzenzuchtung. Forschungsdienst 4, 561-571. v. Berg, K. H., and Oehler, E. (1938). Untersuchungen uber die Cytogenetik amphidiploider Weizen-Roggen-Bastarde. Zuechter 10, 226-238. Bernard, M. (1979a). Creation of a new species-triticale. Bull. SOC.Bot. France Actual. Bot. 126, 55-65. Bernard, M. (1979b). Inbreeding and chromosome pairing in wheat, rye and triticaleconsequences for breeding and introgression. Ann. Amelior. Plantes 29, 43-62. Bernard, M., and Bernard, S. (1978). Methods of gene transfer from bread wheat and rye to 6x triticale. Proc. Congr. Eucarpia., 8th, III. Allopolyploidy pp. 181-189. Bhattacharyya, N. K., Evans, L. E., and Jenkins, B. C . (1961). Karyotype analysis of the individual ‘Dakold’ fall rye chromosome additions to ‘Kharkov’ winter wheat. Nucleus 4, 25-38. Bjurman, B. (1958). Note on the frequency of univalents in some strains of Triticale and their hybrids. Hereditas 44, 189-192. Blakeslee, A. F., and Avery, A. G. (1937). Methods of inducing doubling of chromosomes in plants. J . Hered. 28, 392-411. Boyd, V. J. R., Sisodia, N. S., and Larter, E. N. (1970). A comparative study of the cytological and reproductive behaviour of wheat and Triticale subjected to two temperature regimes. Euphytica 19, 490-497. Brandes, D. (1975). Non-homoeologous substitutions in the D genome of Chinese Spring using the SAT chromosome of Petkuser Sommerroggen. Ph.D. Thesis, University of Gottingen, German Federal Republic.
TRITICALE
331
Briggle, L. W. (1968). Triticale - A review. Crop Sci. 9, 197-202. Britten, R. J., and Kohne, D. E. (1968). Repeated sequences in DNA. Science 161, 529-540. Chaudhari, A., Maiti, S. S., and Saha, P. (1976). Leaf blight of triticale by Alternaria triticina. Plant Dis. Rep. 60, 133-134. Chaudry, M. N. (1968). Synthesis of tetraploid Triticale. Ph.D. Thesis, University of Manitoba, Winnipeg, Canada. Chen, C. (1975). Meiotic stability and multivariate analysis of vegetative and reproductive characteristics in 42-chromosome triticale ( x Triticosecale Wittmack). Dissertation A bstr. Int. B 35, 493-4939, Chester, K. S. (1946). “The Nature and Prevention of the Cereal Rusts as Exemplified in the Leaf Rust of Wheat.” Chronica Bot., Waltham, Massachusetts. Chojnacki, G., Brykczynski, J., and Tymienieka, E. (1976). Preliminary information on sprouting in Triticale. Cereal Res. Commun. 4, 111-114. CIMMYT. (1972). “Results of the First International Triticale Yield Nursery 1969-1970.” CIMMYT, Mexico. Clausen, R. E., and Goodspeed, T. H. (1925). Interspecific hybridization in Nicotiana. 11. A tetraploid glutinosa-tabaccum hybrid-An experimental verification of Winge’s hypothesis. Genetics 10, 278-284. Darvey, N. L. (1973). Genetics of seed shrivelling in wheat and triticale. Proc. Znt. Wheat Genet. Symp., 4th pp. 155-159. Darvey, N. L. (1974). Nucleolar behavior i n hexaploid triticale. E . W. A. C. Newsl. No. 4, 69-70. Darvey, N. L. (1979). Rapid methods for the production of triticale and for alien incorporation into wheat. Proc. Znt. Wheat Genet. Symp., 5th, 1978 pp. 1144-1153. Darvey, N. L., and Gustafson, J. P. (1975). Identification of rye chromosomes in wheatrye lines and triticale by heterochromatin bands. Crop Sci. 15, 239-243. Darvey, N. L., and Larter, E. N. (1973). Monosomic segregation in hexaploid Triticale cv. ‘Rosner’. E . W . A. C . Newsl. No. 4, 70. Dedio, W., Simmonds, D. H., Hill, R. D., and Shealy, H. (1975). Distribution of aamylase in the triticale kernel during development. Can. J . Plant. Sci. 55, 29-36. Derzhavin, A. 11938). Results of work on breeding perennial varieties of wheat and rye. Zzu. Acad. Nauk. USSR, Ser. Biol. 3, 663-665. Dewey, D. R. (1980). Some applications and misapplications of induced polyploidy to plant breeding In “Polyploidy-Biological Relevance” (W. H. Lewis, ed.), pp. 445-470. Plenum, New York. Dronzek, B. L., Orth, R. A., and Bushuk, W. (1974). Scanning electron microscopic studies of triticale and its parental species. I n “Triticale: First Man-made Cereal,” (1973), pp. 91-104. Am. Assoc. Cereal Chem., St. Paul, Minnesota. Evans, G. M., Rees, H., Snell, C. L., and Sun, S. (1972). The relation between nuclear DNA amount and the duration of the mitotic cycle. Chromosomes Today 3, 24-31. Faberge, A. C. (1942). Homologous chromosome pairing: The physical problem. J . Genet. 43, 121-144. Flamm, W. G. (1972). Higher repetitive sequences of DNA in chromosomes. Znt. Rev. Cytol. 32, 1-51. Flavell, R. B., Bennett, M. D., Smith, J. B., and Smith, D. B. (1974). Genome size and the proportion of repeated nucleotide sequence DNA in plants. Biochem. Genet. 12, 257-269. Florell, V. H. (1936). Chromosome differences in wheat-rye amphidiploid. J . Agric. Res. 52, 199-204.
332
P. K. GUPTA AND P. M. PRIYADARSHAN
Friebe, B. (1976). Observations on differential Giemsa staining of mitotic metaphase chromosomes in some lB/lR wheat-rye substitution and translocation lines. Z. Pflanzenzuecht. 77, 304-308. Fuentes, S. F. (1974). Triticale diseases review. Proc. Int. Symp., 1973 El Batan, Mexico pp. 187-192. Gill, B. S., and Kimber, G. (1974a). A Giemsa C-banding technique for cereal chromosomes. Cereal Res. Commun. 2, 87-94. Gill, B. S., and Kimber, G. (1974b). The Giemsa C-banded karyotype of rye. Proc. Natl. Acad. Sci. U.S.A. 71, 1247-1249. Gilmour, J. S. L., Horne, F. R., Little, E. L., Jr., Stafleu, F. A., and Richens, R. H. (1969). “International Code of Nomenclature of Cultivated Plants,” pp. 11-14. IAPT, Utrecht, Netherlands. Granhall, I. (1943). Genetical and physiological studies in interspecific wheat crosses. Hereditas 29, 269-380. Gregory, R. S. (1974). Triticale research programme in the United Kingdom. Proc. Int. Symp., 1973 El Batan, Mexico, IDRC-O24e, pp. 61-67. Gregory, R. S. (1980). Hybrid mecrosis as a problem in handling hexaploid x tetraploid wheat crosses. J. Agric. Sci. (Cambridge) 94, 377-382. Gupta, P. K. (1970). Variability in the morphology of rye (Secale cereale) chromosomes when placed in wheat (Triticum aestivurn) background. Phyton (Austria) 14, 9-13. Gupta, P. K. (1971). Homoeologous relationship between wheat and rye chromosomesPresent Status. Genetica 42, 199-213. Gupta, P. K., and Malik, K. P. (1982). Evaluation of five populations derived from ten strains of hexaploid triticale. Proc. Natl. Semin. Genet. Wheat. Improv. 1980,2nd, (in press). Gupta, P. K., and Sharma, N. C. (1979). Synthesis and evaluation of triticale reconstructions a t hexaploid level. Proc. Int. Wheat. Genet. Symp., 5th, 1978 New Delhi pp. 1179-1185. Gupta, P. K., Tyagi, I. C., and Bahl, J. R. (1980). Chromosome pairing and chiasma formation in hybrids (ABRR) derived from 6n triticale x 2x rye cross. Wheat Inf. Sew. 51, 4-6. Gustafson, J. P. (1976a). Triticale germplasm. Proc. Znt. Triticale Symp., 1973 76-1, pp. 35-41. ICASALS Publ. Gustafson, J. P. (1976b). The evolutionary development of triticale: The wheat-rye hybrid. In “Evolutionary Biology” (M. K. Hecht, W. C. Steere, and Wallace, eds.), Vol. 9, pp. 107-135. Plenum, New York. Gustafson, J. P. (1982). Cytogenetics of triticale. In “Cytogenetics of Crop Plants” (M. S. Swaminathan, P. K. Gupta, and U. Sinha, eds.). Macmillan India Limited (in press). Gustafson, J. P., and Bennett, M. D. (1976). Preferential selection for wheat-rye substitutions in 42-chromosome triticale. Crop Sci. 16, 688-693. Gustafson, J. P., and Bennett, M. D. (1981). The effect of telomeric heterochromatin from Secale cereale L. on triticale ( x Tritzcosecale Wittmack) I. The influence of several blocks of telomeric heterochromatin on early endosperm development and kernel characteristics at maturity. Can. J. Genet. Cytol. (in press). Gustafson, J. P., and Krolow, K. D. (1977). Tentative chromosome analysis of tetraploid triticale. Can. J. Genet. Cytol. 19, 574. (Abstr.) Gustafson, J. P., and Krolow, K. D. (1978). A tentative identification of chromosomes present in tetraploid triticale based on heterochromatin banding patterns. Can. J. Genet. Cytol. 20, 199-204. Gustafson, J. P., and Qualset, C. 0. (1974). Genetics and breeding of 42-chromosome
TRITICALE
333
triticale. I. Evidence for substitutional polyploidy in secondary triticale population. Crop Sci. 14, 248-251. Gustafson, J. P., and Zillinsky, F. J. (1973). Identification of D-genome chromosomes from hexaploid wheat in a 42-chromosome triticale. Proc. Znt. Wheat. Genet. Symp., 4th pp. 225-231. Gustafson, J. P., and Zillinsky, F. J. (1976). Terminal Heterochromatin variations observed in 42-chromosome triticale. Crop Sci. SOC. A m . Annu. Meet. Houston p. 52. (Abstr.) Gustafson, J. P., and Zillinsky, F. J. (1979). Influences of natural selection on the chromosome complement of hexaploid triticale. Proc. Znt. Wheat. Genet. Symp., 5th, 1978 pp. 1201-1207. Gustafson, J. P., Bennett, M. D., and Larter, E. N. (1979a). Rye chromosome substitutions and modifications in 42 chromosome triticale. Eucarpia Triticale Symp. 1979, Radzikow, Poland (in press). Gustafson, J. P., Bennett, M. D., and Larter, E. N. (197913). Cytological studies in triticale ( x Triticosecale Wittmack). Crop. Sci. Soc. Amer. Triticale Symp. 1979, Ft. Collins, Colorado (in press). Gustafson, J. P., Larter, E. N., and Zillinsky, F. J., and Fruehm, M. (1981). Carman triticale. Can. J . Plant Sci. (in press). Hacker, J. B., and Riley, R. (1963). Aneuploids in oat varietal populations. Nature (London) 197, 924-925. Hadlaczky, G., and Koczka, K. (1974). C-banding karyotype of rye from hexaploid triticale. Cereal Res. Commun. 2, 193-200. Hall, 0. L. (1954). Hybridization of wheat and rye after embryo transplantation. Hereditas 40, 453-458. Hall, 0. L. (1956). Further experiments in embryo transplantation. Hereditas 42, 261-262. Hall, 0 . L. (1959). Immuno-electrophoretic analyses of allopolyploid rye-wheat and its parental species. Hereditas 45, 495-504. Hawthorn, J. (1976). Triticale-an intergeneric hybrid. Bot. SOC.Edinburgh Trans. 42, 502-512. Hermsen, J. G. (1963a). Hybrid necrosis as a problem for the wheat breeder. Euphytica 12, 1-16. Hermsen, J. G. (1963b). Sources and distribution of the complementary genes for hybrid necrosis in wheat. Euphytica 12, 147-160. Hsam, S. L. K., and Larter, E. N. (1973). Identification of cytological and agronomic characters affecting the reproductive behaviour of hexaploid triticale. Can. J . Genet. Cytol. 15, 197-204. Hsam, S. L. K., and Larter, E. N. (1974a). Influence of source of wheat cytoplasm on the synthesis and plant characteristics of hexaploid triticale. Can. J . Genet. Cytol. 16, 333-340. Hsam, S. L. K., and Larter, E. N. (197413). Influence of source of wheat cytoplasm on the nature of proteins in hexaploid triticale. Can. J . Genet. CytoE. 16, 529-537. Quantitative relationships of cellular protein, Hsam, S. L. K., and Larter, E. N. (1974~). RNA and nuclearhistone in hexaploid triticale as influenced by source of wheat cytoplasm. Can. J . Genet. Cytol. 16, 619-625. Hsu, T. C. (1975). A possible function of constitutuve heterochromatin-The bodyguard hypothesis. Proc. Int. Congr. Genet. 13th Genetics (Suppl.)79, 137-150. Hulse, J. H., and Laing, E. M. (1974). “Nutritive Value of Triticale Protein.” Monograph, IDRC-02le. Ottawa, Canada.
334
P. K. GUPTA AND P. M. PRIYADARSHAN
Hulse, J. H., and Spurgeon, D. (1974). Triticale. Sci. Am. 231, 72-80. Ingle, J., and Sinclair, J. (1972). Ribosomal RNA genes and plant development. Nature (London) 235, 30-32. Ingold, M., Oehler, E., and Nogler, G. A. (1968). Untersuchungen uber Entstehung, Fertilitat, Morphologie und agronomische Werteigenschaften neuer oktoploider Triticale-Stamme. 2.Pflanzenzuecht. 60, 41-88. Iordansky, A. B., Zurabishvilli, T. G., and Badaev, N. S. (1978). Linear differentiation of cereal chromosomes. 111. Rye, triticale and ‘Aurora’ variety. Theor. Appl. Genet. 51, 281-288. Jenkins, B. C. (1969). History of the development of some presently promising hexaploid Triticales. Wheat Inf Seru. 28, 18-20. Jenkins, B. C. (1974). Hexaploid triticale: Past, present, and future. Proc. Int. Symp., 1973 pp. 56-61. Jenkins, B. C. (1975). Hexaploid triticale: Past, present, and future. Proc. Int. Symp., 1973 Leningrad pp. 26-30. Jesenko, F. (1913). Uber Getreidespeziesbastarde. 2. Zndukt. Abstanrn. Verehungsl. 10, 311-326. Joshi, L. M., Goel, L. B., Singh, D. V., Srivastava, K. D., and Pathak, K. D. (1977). Note on sources of resistance to wheat rusts in triticale. Indian J. Agric. Sci. 47, 163-164. Jouve, N., and Montalvo, D. (1978). Meiotic behaviour in hybrids between 6r Triticale and Secale cereale L. I n “Interspecific Hybridization in Plant Breeding.” Proc. Eucarpia Congr. 8th Madrid pp. 191-197. Jouve, N., Diez, N., and Rodrigues, M. (1980). C-banding in 6x Triticale x Secale cereale L.-Hybrid. Cytogenetics. Theor. Appl. Genet. 57, 75-79. Kaltsikes, P. J . (1971). The mitotic cycle in an amphiploid (triticale) and its parental species. Can. J. Genet. Cytol. 13, 656-662. Kaltsikes, P. J. (1972). Duration of the mitotic cycle in Triticale. Caryologca 25, 537-542. Kaltsikes, P. J. (1973). Early seed development in Triticale. Can. J.Bot. 51,2291-2300. Kaltsikes, P. J. (1974a). Methods for triticale production. 2. Pflanzenzuecht. 71, 264-286. Kaltsikes, P. J. (1974b). Univalency in Triticale. Proc. Int. Symp., 1973 El Batan, Mexico IDRC-O24e, pp. 159-167. Kaltsikes, P. J., and Roupakias, D. G. (1975). Endosperm abnormalities in TriticurnSecale combinations. 11. Addition and substitution lines. Can. J.Bot. 53,2068-2076. Kaltsikes, P. J., and Roupakias, D. G. (1976). Heterochromatin and chromosome pairing in triticale. Crop Sci. SOC.Am. Annu. Meet. Houston p. 54. (Abstr.) Kaltsikes, P. J., Evans, L. E., and Larter, E. N. (1969). Morphological and meiotic characteristics of the extracted AABB tetraploid component of three varieties of common wheat. Can. J . Genet. Cytol. 11, 65-71. Kaltsikes, P. J., Roupakias, D. G., and Thomas, J. B. (1975). Endosperm abnormalities in Triticum-Secale combinations I. x Triticosecale and its parental species. Can. J. Bot. 53, 2050-2067. Karpechenko, G. D. (1927). Polyploid hybrid of Raphanus satiuus L. x Brassica oleracea. Trud. Prikl. Bot. Genet. Sel. 17, 398-410. Kasarda, D. D., Nimmo, C. C., and Kohler, G. 0. (1971). Proteins and the amino acid composition of wheat fractions In “Wheat Chemistry and Technology” (Y.Pomeranz, ed.), pp. 227-299. Amer. Assoc. Cereal Chem., St. Paul, Minnesota. Kasha, K. J., and Burnham, C. R. (1965). The location of interchange breakpoints in
TRITICALE
335
barley. 11. Chromosome pairing and the intercross method. Can. J . Genet. Cytol. 7, 620-632. Kattermann, G. (1939). Uber heterogenomatische amphidiploide Weizen-Roggen-Bastarde. 2. PfZanzenzuecht. 23, 179-209. Kerber, E. R. (1964). Wheat: Reconstitution of the tetraploid component (AABB) of hexaploids. Science 143, 253-255. Khvostova, V. V., and Shkutina, F. M. (1975). The causes of low fertility in triticale. Proc. Int. Symp., 1973 Lenningrud pp. 186-190. Kies, C., and Fox, F. M. (1970). Determination of the first limiting amino acid of wheat and triticale grains for humans. Cereal Chem. 47, 615. Kihara, H. (1924). Cytologische und genetische Studien bei wichtigen Getreidearten mit beconderer Riicksicht auf das Verhalten der Chromosomen und die Sterilitat in den Bastarden. Mem. Coll. Sci. Kyoto. Imp. Univ. 1, 1-200. Kihara, H. (1968). Cytoplasmic relationships in the Triticinae. Proc. Int. Wheat Genet. Symp., 3rd pp. 125-134. Kihara, H., and Matsumura, S. (1940). Weitere Untersuchungen iiber die pentaploiden Triticum-Bastarde. XII. Schlussmitteilung. Jpn. J. Bot. 11, 27-29. Kimber, G., Gill, B. S., Rubenstein, J. M., and Barnhill, G. L. (1976). The technique of giemsa staining of cereal chromosomes. Wheat In6 Serv. 41-42, 55-58. Kiss, A. (1966a). Neue Richtung in der Triticale-Ziichtung. 2. Pflanzenzecht. 55, 309-329. Kiss, A. (196613). Kreuzungsversuche mit Triticale. Zuechter 36, 249-255. Kiss, A. (1971). Origin of the preliminary released Hungarian hexaploid Triticale varieties, Nos. 57 and 64. Wheat Inf. Serv. 32, 20-22. Kiss, A. (1974a). Triticale breeding experiments in Eastern Europe. Proc. Znt. Symp., 1973 El Batun, Mexico, IDRC-O24e, pp. 41-50. Kiss, A. (1974b). Cultivation and problems of triticale in Hungary. Proc. Int. Symp., 1973, pp. 15-20. Kiss, A. (1975). Hexaploid triticale breeding in Hungary. Proc. Iat. Symp., 1973, Leningrad pp. 38-46. Kiss, A,, and Trefas, G. (1970). Studies on hybrids between Triticale and wheat. 11. Development of short secondary hexaploid Triticules by crossing Triticale with wheat. Wheat Inf. Serv. 31, 27-28. Klassen, A. J. (1970). An investigation of kernel shrivelling in triticale. Ph.D. Thesis, University of Manitoba, Winnipeg, Canada. Klassen, A. J., Hill, R. D., and Larter, E. N. (1971). a-amylase activity and carbohydrate content as related to kernel development in Triticale. Crop Sci. 11, 265-267. Knipfel, J. E. (1969). Comparative protein quality of triticale, wheat and rye. Cereal Chem. 46, 313-317. Kolev, D. (1975). Characteristics of Triticale (2n = 56) AD=COC-3 and some of its hybrids. Proc. Int. Symp., 1973 Leningrad pp. 96-107. Krolow, K. D. (1962). Aneuploidie und Fertilitat bei amphidiploiden Weizen-RoggenBastarden (Triticale). I. Aneuploidie und Selection auf Fertilitat bei oktoploiden Triticale-Formen. 2. PfZunzenzuecht. 48, 177-196. Krolow, K. D. (1963). Aneuploidie und Fertilitat bei amphidiploiden Weizen-RoggenBastarden (Triticale).11. Aneuploidie-und Fertilitatsuntersuchungen an einer oktoploiden Triticale-Form mit starker Abregulierungstendenz. 2. Pflanzenzuecht. 49, 210-242. Krolow, K. D. (1965). Aneuploidy and fertility in amphidiploid wheat-rye hybrids. Wheat Inf. Seru. 19-20, 9-11.
336
P. K. GUPTA AND P. M. PRIYADARSHAN
Krolow, K. D. (1966). Aneuploidie und Fertilitat bei amphidiploiden Weizen-RoggenBastarden (Triticale). 111. Aneuploidie, Fertilitats-und Halmlangenuntersuchungen an hexaploiden Triticale-Stammen. 2. Pflanzenzuecht. 55, 105-138. Krolow, K. D. (1969a). Cytologische Untersuchungen an Kreuzungen zwischen 8 x und 6x Triticale. I. Untersuchungen an den Eltern, an der F, und der F,. 2. Pflanzenzuechtg. 62, 241-271. Krolow, K. D. (196913). Cytologiche Untersuchungen an Kreuzungen zwischen 8 x und 6x Triticale. 11. Untersuchungen an F, - (Meiosis), F,-und F,-Pflanzen. 2. Pflanzenzuecht. 62, 311-342. Krolow, K. D. (1973). 4x Triticale, production and use in Triticale breeding. Proc. Znt. Wheat Genet. Symp., 4th, Columbia, Missouri pp. 237-243. Krolow, K. D. (1974a). Research work with 4x-Triticale in Germany (Berlin). Proc. Int. Symp., 1973 El Batan, Mexico IDRC-O24e, pp. 51-60. Krolow, K. D. (1974b). The development and assessment of tetraploid Triticale. E.W.A.C. Newsl. 4, 43-46. Krolow, K. D. (1975). Selection of 4x-triticale from the cross 6x-triticale x 2x-rye. Proc. Int. Symp., 1973 Leningrad pp. 114-122. Lacadena, J. R. (1967). Introduction of alien variation into wheat by gene recombination. I. Crosses betweeen monoV(5B) Trztzcum aestiuum L. and Secale cereale L. and Aegilops columnaris Zhuk. Euphytica 16, 221-230. Lamm, R. (1936). Cytological studies on inbred rye. Hereditas 22, 217-240. Lange, C. N., and Riley, R. (1973). The position on chromosome 5B of wheat, of the locus determining crossability with rye. Genet. Res. 22, 143-153. Lange, W., and Wojciechowska, B. (1976). The crossing of common wheat (Triticum aestiuum L.) with cultivated rye (Secale cereale L.) I. Crossability, pollen grain germination and pollen tube growth. Euphytica 25, 609-620. Lanjouw, J., Mamay, S. H., McVaugh, R., Robyns, W., Rollins, R. C., Ross, R., Rousseau, J., Schulze, G. M., Stafleu, F. A., and de Vilmorin, R., eds. (1966). International Code of Botanical Nomenclature adopted by the tenth International Botanical Congress., Edinburgh, 1964. ICBN, Utrecht. Larter, E. N. (1976). Triticale research a t the University of Manitoba, Canada. Proc. Int. Triticale Symp., 1973, 76-1, pp. 25-34. ICASALS Publ., Texas. Larter, E. N., and Hsam, S. L. K. (1973). Performance of hexaploid triticale as influenced by source of wheat cytoplasm. Proc. Int. Wheat Genet. Symp., 4th, Columbia, Missouri pp. 245-251. Larter, E. N., and Shigenaga, S. (1971). Further evidence on the derivation of univalents in hexaploid triticale. Can. J . Genet. Cytol. 13, 895-898. Larter, E. N., Tsuchiya, T., and Evans, L. (1968). Breeding and cytology of triticale. Proc. Znt. Wheat Genet. Symp., 3rd, Aust. Acad. Sci., Canberra pp. 213-221. Larter, E. N., Shebeski, L. H., McGinnis, R. C., Evans, L. E., and Kaltsikes, P. J. (1970). Rosner, A hexaploid Triticale cultivar. Can. J. Plant Sci. 50, 122-124. Larter, E. N., Gustafson, J. P., and Zillinsky, F. J. (1978). Welsh triticale. Can. J . Plant Sci. 58, 879-880. Lebedeff, V. N. (1934). Neue Falle der Formierung von Amphidiploiden in WeizenRoggen-Bastarden. 2. Pflanzenzuecht. 4, 509-525. Lee, C. S. (1975). A possible role of repetitious DNA in recombinatory joining during chromosome rearrangement in Drosophila melanogaster. Genetics 79, 467-470. Lelley, T. (1974). Desynapsis as a possible source of univalents in metaphase I of Triticale. 2. Pflanzenzuecht. 73, 249-258.
TRITICALE
337
Lelley, T. (1975a). Identification of univalents and rod bivalents i n Triticale with Giemsa. 2. Pflanzenzuecht. 75, 252-256. Lelley, T.(1975b). Genic control of pairing of rye chromosomes in Triticale. 2. Pflanzenzuecht. 75, 24-29. Lelley, T. (1976a). Effect of nulliitetrasomic combinations of wheat chromosomes in Triticale. 2. Pflanzenzuecht. 77, 89-99. Lelley, T. (197613). Induction of homoeologous pairing in wheat by genes of rye suppressing 5B effect. Can. J . Genet. Cytol. 18, 485-489. Lelley, T. (1979). Specific interaction for meiotic regulation of wheat and rye in triticale: Consequences for triticale breeding. Proc. Int. Wheat Genet. Symp., 5th 1978 pp. 1213-1217. Lelley, T., and Larter, E. N. (1980). Meiotic regulation in triticale: Interaction of the rye genotype and specific wheat chromosomes on meiotic pairing in the hybrid. Can. J . Genet. Cytol. 22, 1-6. Lewitsky, G. A., and Benetzkaja, G. K. (1930). Cytological investigation of constantintermediate rye wheat hybrids. Proc. All-Union Congr. Genet. Sel., 1929 pp. 345-352. (In Russian) Lewitsky, G . A,, and Benetzkaja, G. K. (1931). Cytology of the wheat-rye amphidiploids. Bull. Appl. Bot. Genet. Plant Breed, 27, 241-264. (in Russian) Limin, A. E., and Dvorak, J. (1976). C-banding of rye chromosomes with cold SSC buffer. Can. J . Genet. Cytol. 18, 491-496. Linde-Laursen, I. (1977). Reaction of Triticale, wheat and rye to the powdery mildew fungi, Erysiphe graminis f s p . tritiei and E . graminis f. sp. Secalis. 2. Pflanzenzuecht. 79, 110-121. Lindschau, M.,and Oehler, E. (1935). Untersuchungen am konstant intermediaren additiven Rimpau’schen Weizen-Roggen-Bastard. Zuechter, 7, 228-233. Lopez, B.A. (1971). Identification de las formas de Puccinia graminis pers. que atacan a triticale. M. C. Tesis Colegio de Post Graduados. Eescerela, Nacional de Agricultural, Chapingo Mexico. Lorentz, K. (1974). The history, development and utilization of triticale. CRC Crrt. Reu. Food Technol. 5, 175-280. Lukaszewski, A. J., and Apolinarska, B. (1981). The chromosome constitution of hexploid winter triticales. Can. J . Genet. Cytol. 23, 281-285. Lukaszewski, A. J., Apolinarska, B., and Lapinski, B. (1979). Chromosome elimination in the (Triticumpersicum x T . dicoccoides) x Secale cereale F,hybrids: Eucarpia Triticale Symp. 1979. Radzikow, Poland (in press). Maan, S. S. (1979). Specificity of nucleo-cytoplasmic interactions in Triticum and Aegilops species (a review). Wheat Inf. Seru. 50,71-79. McGinnis, R. C. (1962). Aneuploidy in common oats Auena satiua. Can. J . Genet. Cytol. 4, 296-301. McVaugh, R. (1973). Report of the committee for spermatophyta-Conservation of generic names, XVI. Taxon 22, 153-157. Matsumura, S. (1939). 20-jahrige cytogenetische Untersuchung des pentaploiden Weizenbastards zwischen Emmer- und Dinkelreihe. Zuechter 11, 289-301. May, C. E., and Appels, R. (1980). Rye chromosome translocations in hexaploid wheat A re-evaluation of the loss of heterochromatin from rye chromosomes. Theor. Appl. Genet. 56, 17-23. Meister, G. K. (1930). The present purposes of the study of interspecific hybrids. Proc. USSR Congr. Genet. Plant-Anim. Breed. 2, pp. 27-43. (In Russian)
338
P. K. GUPTA AND P. M. PRIYADARSHAN
Merker, A. (1971). Cytogenetic investigations in hexaploid Triticale I. Meiosis, aneuploidy and fertility. Hereditas 68, 281-290. Merker, A. (1973a). Cytogenetic investigations in hexaploid Triticale 11. Meiosis and fertility in F, and F2.Hereditas 73, 285-289. Merker, A. (1973b). Identification of aneuploids in a line of 6x Triticale. Hereditas 74, 1-6. Merker, A. (1973~).A Giemsa technique for rapid identification of chromosomes in Triticale. Hereditas 75, 280-282. Merker, A. (1975). Chromosome composition of hexaploid triticale. Hereditas 80,41-52. Merker, A. (1976a). Chromosome substitution, genetic recombination and the breeding of hexaploid triticale. Wheat In)? Seru. 41-42, 44-48. Merker, A. (1976b). The cytogenetic effect of heterochromatin in hexaploid triticale. Hereditas 83, 215-222. Mettin, D., Bluthner, W. D., and Schlegel, G. (1973).Additional evidence on spontaneous lBllR wheat-rye substitutions and translocations. Proc. Int. Wheat Genet Symp., 4th, Columbia, Missouri pp. 179-184. Miklos, G. L. G., and Nankivell, R. N. (1976). Telomeric satellite DNA functions in regulating recombination. Chromosoma 56, 143-167. Miller, T. E., and Riley, R. (1972). Meiotic chromosome pairing in wheat-rye combinations. Genet. Zber. 24, 241-250. Morris, R., and Sears, E. R. (1967). The cytogenetics of wheat and its relatives. Zn “Wheat and Wheat Improvement” (K. S. Quinsberry and L. P. Reitz, eds.), pp. 19-87. Amer. SOC. Agron., Madison, Wisconsin. Miintzing, A. (1930). Uber Chromosomenvermehrung in Galeopsis. Kreuzungen und ihre phylogenetische Bedeutung. Hereditas 14, 153-172. Muntzing, A. (1935). Triple hybrids between rye and two wheat species. Hereditas 20, 137-160. Muntzing, A. (1936). Uber die Entstehungsweise 56-Chromosomiger Weizen-RoggenBastarde. Zuechter 8, 188-191. Muntzing, A. (1939). Studies on the properties and the ways of production of rye-wheat amphidiploids. Hereditas 25, 387-430. Miintzing, A. (1948). Experiences from work with induced polyploidy in cereals. In “History and Present Problems” (A. akerman et al., eds.), pp. 324-337. Lund, Sweden. Muntzing, A. (1955). Mode of production and properties of a Triticale-Strain with 70 chromosomes. Wheat Znf. Seru. No. 2, 1-12. Muntzing, A. (1956). Chromosomes in relation to species differentiation and plant E. J. Tjeenk Willink, ed.), pp. 1-37. breeding. In “Conference on Chromosomes” (W. Zwolk, Netherlands. Miintzing, A. (1957). Cytogenetic studies in rye-wheat (Triticale). Cytologia (Suppl.) pp. 51-56. Muntzing, A. (1958). Polyploidieziichtung. In “Handbuch der Pflanzenziichtung” (H. Kappert and W. Rudorf, eds.), pp. 700-731. Parey, Berlin. Miintzing, A. (1963). Some recent results from breeding work with rye-wheat. Zn “Recent Plant Breeding Research, Svalof 1946-1961” (E. akerberg and A. Hagberg, eds.), pp. 167-178. Wiley, New York. Muntzing, A. (1966). Cytogenetic and breeding studies in Triticale. Proc. Int. Wheat Genet. Symp., 2nd, 1963 Lund, Sweden pp. 291-300. Hereditas (Suppl.) Muntzing, A. (1972). Experiences from work with octoploid and hexaploid rye-wheat (Triticale). Biol. Zentralbl. 91, 69-80.
TRITICALE
339
Miintzing, A. (1975). Some results from cytogenetic studies and breeding work in triticale. Proc. Int. Symp., 1973 Leningrad pp. 70-75. Muntzing, A. (1976). Studies conducted on triticale in Sweden. Proc. Int. Triticale Symp., 1973 pp. 9-18. ICASALS Publ., Texas. Muntzing, A. (1979). Triticale-Results and Problems. In “Advances in Plant Breeding” 2. Pflanzenzuecht. Suppl. 10, 103. Miintzing, A. (1980). Problems of Allopolyploidy in triticale. I n “Polyploidy: Biological Relevance” (W. H. Lewis, ed.), pp. 409-426. Plenum, New York. Nakajima, G. (1942). Cytogenetical studies of triple hybrids from F, Triticum furgidum x Secale cereale and Triticum uulgare. I. Number of somatic chromosomes and external characters. Proc. Imp. Acad. Tokyo 18, 100-106. Nakajima, G. (1951). Cytogenetical studies of triple hybrids from F, Triticum turgidum x Secale cereale and Triticum uulgare. 11. Maturation division of pollen mother cells in F, plants. Jpn. J . Genet. 26, 105-118. Nakajima, G. (1952). Cytogenetical studies of triple hybrids from F, Triticum turgidum x Secale cereale and Triticum vulgare. 111. Characteristics of F, and F, plants and the number of somatic chromosomes. Jpn. J . Genet. 27,93-99. Nakajima, G. (1958). Cytogenetical studies of triple hybrids from F, Triticum turgidum x Secale cereale and Triticum vulgare IV. Meiosis in PMC’s of F, plants. Jpn. J . Genet. 33, 146-154. Nakajima, G. (1961). Cytogenetical studies of triple hybrids from F, Triticum turgidum x Secale cereale and Triticum uulgare. IV. External characteristics, number of somatic chromosomes and meiosis in PMC’s of triple rye-wheat (Tri F,,-20-3-4-517) plant. Jpn. J . Genet. 36, 467-474. Nakajima, G. (1965). Cytogenetical studies of triple hybrids from F, Triticum turgidum x Secale cereale and Triticum vulgare VII. External characteristics, somatic chromosome numbers and meiosis in PMC’s of a triple hybrid F,, x S. cereale. Kromosomo 60, 1963-1970. Nakajima, G., and Zennyozi, Z. (1966). Cytogenetics of wheat and rye hybrids. Seiken 2ih0 18, 39-48. Nakata, N., Yasumuro, Y., and Sasaki, M. (1977). An acetocarmine Giemsa staining of rye chromosomes. Jpn. J . Genet. 52, 315-318. Nalepa, S., and Pilch, J. (1978). Identification of rye chromosome in hybrid of hexaploid triticale x S. cereale L. (dwarf) by Giemsa C-banding technique. Genet. Polon. 19, 253-257. Naranjo, T., Lacadena, J. R., and Giraldez, R. (1979). Interaction between wheat and rye genomes on homologous and homoeologous pairing. 2. Pftantenzuecht. 82, 289-305. Narayan, R. K. J., and Rees, H. (1974). Nuclear DNA heterochromatin and phylogeny of Nicotiana amphidiploids Chromosoma 47, 75-83. Nebel, B. R., and Ruttle, M. L. (1938). The cytological and genetical significance of colchicine. J . Hered. 29, 3-9. Oehler, E. (1936). Heutiger Stand der Weizen-Roggenkreuzungen in Deutschland. U m S C ~ U U51, 1-4. Ogilvie, I. S., and Kaltsikes, P. J. (1977). Mass selection for seed characters in hexaploid triticale. I Visual selection in the F,. Cereal Res. Commun. 5, 59-66. O’Mara, J. G. (1948). Fertility in allopolyploids. Rec. Genet. Sci. A m . 17, pp. 52. O’Mara, J. G. (1953). The cytogenetics of Triticale. Bot. Reu. 19, 587-605. Orlova, I. N. (1970). Instability of chromosome number in meiosis of 6 x Triticale and analysis of its causes. Genetika 6, 5-6.
340
P. K. GUPTA AND P. M. PRIYADARSHAN
Orlova, I. N. (1976). Causes of mosaicism of the sporogenous tissue with respect to chromosome numbers in microsporocytes of hexaploid Triticale. Genetiku 12, 7- 13. O’Toole, A. J. (1970). Effects of 5 aminouracil on cellular population kinetics of Secale cereale (rye). A m . J . Bot. 57, 765. (Abstr.) Pienaar, R., de V. (1973). Methods to improve the gene flow from rye and wheat to Triticale. Proc. Int. Wheat Genet. Symp., 4th, Columbia, Missouri pp. 253-258. Peinaar, R. de V., and Marais, G. F. (1976). The effect of the D genome on kernel set and viability in wheat x rye cross. Wheat Inf. Serv. 43, 4-9. Pieritz, W. J. (1966). Untersuchunger iiber die Ursachen der Aneuploidie bei amphidiploiden Weizen-Roggen-Bastarden und iiber die Funktionsfahigkeit ihrer mannlichen und weiblichen Gameten. Z . PfZanzenzuecht. 56, 27-69. Pieritz, W. J. (1970). Elimination von Chromosomen in amphidiploiden Weizen-RoggenBastarden (Triticale). 2. PfZanzenzuecht. 64, 90-109. Pilch, J., and Nalepa, S. (1978). Cytological identification of alloplasmic rye (2n = 28). Genet. Polon. 19, 259-263. Pissarev, V. (1966). Different approaches in Triticale breeding. Proc. Znt. Wheat Genet. Symp., 2nd 1963 Lund, Sweden Hereditas (Suppl.) 2, 279-290. Pissarev, V., and Vinogradova, N. M. (1944). Hybrids between wheat and Elymus. C . R . Dokl. Acad. Sci. USSR 45, (3). Platford, R. G., and Bernier, C. C. (1970). Resistance to Clauiceps purpurea in spring and durum wheat. Nature (London) 226, 1770. Plotnikowa, T. W. (1932). Zytologische Untersuchung der Weizen-Roggen-Bastarde. I. Anormale Kernteilung in somatischen Zellen. PlantalArch. Wissensch. Bot. 16 B, 174-177. Pohler, W., Kistner, G., Kiston, H. U., and Szigat, G. (1978). Meiotic studies in Triticale. V. Meiotic behaviour, pollen viability and fertility in triticale F, hybrids and their parents. Biol. Zentralbl. 97, 453-470. Popov, P., and Tsvetkov, S. (1975). Development of winter primary and secondary hexaploid triticale (2n = 42). Proc. Znt. Symp, 1973, Leningrad pp. 151-157. Porter, K. B., and Tuleen, N. A. (1972). Cross breeding male-sterile wheat ( T . aestiuum L.) and rye (Secale spp.) Crop Sci. 12, 706-708. Porter, K. B., and Tuleen, N. A. (1976). The performance, fertility and cytology of progeny of male-sterile wheat-rye F,/triticale hybrids. Proc. Int. Triticale Symp., 1973 76-1, 73-78. Qualset, C. O., Rupert, E., and Prato, J. D. (1976). Triticale in California: Review of current research and appraisal as a new cereal crop. Proc. Znt. Triticale Symp., 1973, Lubbock, Texas 76-1, 47-72. Quinones, M. A. (1971). The inheritance of resistance to Puccinia reconditu Rob. ex. Desm. in hexaploid triticale. Ph. D. Thesis, University of Manitoba, Winnipeg, Canada. Quinones, M. A. (1974). Early steps on triticale breeding at CIMMYT. Proc. Znt. Symp., 1973 El Batan, Mexico IDRC-O24e, pp. 211-212. Quinones, M. A., Larter, E. N., and Samborski, J. (1972). The inheritance of resistance to Puccinia recondita in hexaploid triticale. Can. J . Genet. Cytol. 14, 495-505. Rao, R. V., and Joshi, M. G. (1976). Induced quantitative variation in hexaploid triticale. Mutat. Res. 36, 85-92. Rees, H. (1955). Genotypic control of chromosome behaviour in rye. I. Inbred lines. Heredity 9, 93-116. Rees, H., and Thompson, J. B. (1956). Genotypic control of chromosome behaviour in
TRITICALE
341
rye. 111. Chiasma frequency in homozygotes and heterozygotes. Heredity 10, 409-424. Rees, H., and Walters, M. R. (1965). Nuclear DNA and the evolution of wheat. Heredity 20, 73-82. Richardson, M. J., and Zillinsky, F. J. (1972). A leaf blight caused by Fusarium nivale. Plant Dis. Rep. 56, 803-804. Riebesel, G. (1937).Vegetative Vermehrung von Getreide-Bastarden. Zuechter 9, p. 24. Riley, R. (1968). The basic and applied genetics of chromosome pairing. Proc. Int. Wheat Genet. Symp., 3rd, Canberra pp. 185-195. Riley, R., and Chapman, V. (1957). The comparison of wheat-rye and wheat-Aegilops amphidiploids. J . Agric. Sci. 49, 246-250. Riley, R., and Ewart, J. A. D. (1970). The effect of individual rye chromosomes on the aminoacid content of wheat grains. Genet. Res. (Cambridge) 15, 209-219. Riley, R., and Kimber, G. (1961). Aneuploids and cytogenetic structure of wheat varietal populations. Heredity 16, 275-290. Riley, R., and Miller, T. E. (1970). Meiotic chromosome pairing in Triticale. Nature (London)227, 82-83. Rimpau, J. (1973a). Transmission und Meiose alloplasmatischen Weizen-Roggen-Additionslinien. 2. Pflunzenzuecht. 69, 275-300. Rimpau, J. (1973b). Herstellung von eu-und alloplasmatischen Weizen-Roggen-Substitutionslinien. 2. Pflanzenzuecht. 70, 62-71. Rimpau, W. (1891). Kreuzungsprodukte landwirtschaftlicher Kulturpflanzen. Landwirtschaftl. Jahrb. 20, 335-371. Robbelen, G., and Smutkupt, S. (1968). Reciprocal intergeneric hybridizations between wheat and rye. Wheat Inf. Seru. 27, 10-13. Rodriguez, I. R. (1974). Introduction of new forms and types from wheat and triticale. Proc. Int. Symp., 1973, El Batan, Mexico IDRC-O24e, pp. 213-215. Rogalska, S. (1978a). The identification of rye chromosones in the hexaploid triticale No. 739 by the distribution of heterochromatin bands. Hodowla R o d . Aklim. Nasienn. 22, 21-26. Rogalska, S. (1978b). The chromosome constitution of plants from selected lines of secondary hexaploid triticale. Hodowla R o d . Aktim. Nasienn. 22, 293-301. Rogalska, S. (1979). Identification of univalents in PMC meiosis of different triticale forms by Giemsa technique. Genet. Polon. 20, 333-340. Roupakias, D. G., and Kaltsikes, P. J. (1977a). Genomic effects on the duration of meiosis in triticale and its parental species. Can. J . Genet. Cytol. 19, 331-343. Roupakias, D. G., and Kaltsikes, P. J. (1977b). Independence of duration of meiosis and chromosome pairing in hexaploid triticale. Can. J . Genet. Cytol. 19, 345-354. Roupakias, D. G., and Kaltsikes, P. J. (1977~).The effect of wheat cytoplasm on the meiosis of hexaploid triticale. Can. J . Genet. Cytol. 19, 39-49. Roupakias, D. G., and Kaltsikes, P. J. (1977d). The effect of telomeric heterochromatin on chromosome pairing of hexaploid triticale. Can. J . Genet. Cytol. 19, 543-548. Roupakias, D. G., Kaltsikes, P. J., and Krolow, K. D. (1979). The meiotic cycle of tetraploid triticale. Proc. Int. Wheat Genet. Symp., 5th 1978 New Delhi pp. 1218-1227. Salminen, S., and Hill, R. D. (1978). Rate and duration of dry matter accumulation in relation to kernel shrivelling in triticale. Can. J . Plant Sci. 58, 13-19. Sanchez-Monge, E. (1956). Studies on 42-chromosome Triticale. I. The production of the amphidiploids. Ann. Aula Dei 4, 191-207.
342
P. K. GUPTA AND P. M. PRIYADARSHAN
Sanchez-Monge, E. (1959). Hexaploid Triticale. Proc. fnt. Wheat Genet. Symp., 1st 1958 Manitoba, Canada pp. 181-194. Sanchez-Monge, E. (1974). Development of triticales in Western Europe. Proc. Znt. Symp., 1973 El Batan, Mexico IDRC-O24e, pp. 31-39. Sanchez-Monge, E. (1975). Hexaploid triticale with different cytoplasm. Proc. Znt. Symp., 1973 Leningrad pp. 175-180. Sanchez-Monge, E., and Tjio, J. H. (1954). Note on 42 chromosome Triticale.Caryologia (Suppl.1 2, 748. Sapra, V. T., and Heyne, E. G. (1973). Meiosis and pollen viability in hexaploid Triticale. Crop Sci. 13, 301-302. Sapra, V. T., and Stewart, M. D. (1980). Staining of heterochromatin bands and the determination of rye chromosomes in Triticale (wheat x rye hybrid). Euphytica 29, 497-509. Sapra, V. T., Heyne, E. G., and Wilkins, H. D. (19731. Triticale-a man-made species of crop plant. Trans. Kans. Acad. Sci. 74, 52-58. Sapra, V. T., Sharma, G. C., and Hughes, J. L. (1974). Chemical induction of male sterility in hexaploid triticales. Euphytica 23, 685-690. Sarma, N. P., and Natarajan, A. T. (1973). Identification of heterochromatin regions in the chromosomes of rye. Hereditas 74, 233-238. Scoles, C. J., and Kaltsikes, P. J. (1974). The cytology and cytogenetics of Triticale. 2.Pflanzenzuecht. 73, 13-43. Shigenaga, S., and Larter, E. N. (1971). Karyotype analysis of hexaploid Triticale. Can. J . Genet. Cytol. 13, 585-591. Shigenaga, S., Larter, E. N., and McGinnis, R. C. (1971). Identification of chromosome contributing to aneuploidy in hexaploid Triticale, cultiver Rosner. Can. J . Genet. Cytol. 13, 592-596. Shkutina, F. M., and Khvostova, V. V. (19711. Cytological investigations in Triticale. Theor. Appl. Genet. 41, 109-119. Shulyndin, A. F. (1972). Wheat-rye allopolyploids ( TriticaZe) and problem of immunity, quality winter hardiness and grain production. Genetika 8, 61-74. Shulyndin, A. F. (1975). Genetical grounds of synthesis in various triticales and their improvement by breeding. In “Triticale-Studies and Breeding” Proc. Znt. Symp., 1973 Leningrad pp. 53-69. Simmonds, D. H. (1974). The structure of the developing and mature triticale kernel. Zn “Triticale: First Man-Made Cereal,” pp. 105-121. Amer. Assoc. Cereal. Chem., St. Paul, Minnesota. Singh, R. J., and Lelley, T. (1975). Giemsa banding in meiotic chromosomes of rye, Secale cereale L. Z . Pflanzenzuecht. 75, 85-89. Singh, R. J., and Robbelen, G. (1975). Comparison of somatic Giemsa banding pattern in several species of rye. 2. Pflanzenzuecht. 75, 270-285. Singh, R. J., and Robbelen, G. (1976). Giemsa banding techniques reveals deletions within rye chromosomes in addition lines. Z . Pflanzenzuecht. 76, 11-18. Sisodia, N. S., and McGinnis, B. C. (1970a). Importance of hexaploid wheat germplasm in hexaploid triticale breeding. Crop Sci. 10, 161-162. Sisodia, N. S., and McGinnis, R. C. (1970b). New methods of utilizing wheat and rye germplasm in Triticale breeding. Crop Sci. 10, 163-164. Smutkupt, S. (1968). Herstelling and Eigenschaften vov Secale-triticum im Vergleich mit Triticale.Angew. Bot. 42, 95-118. Sowa, W., and Gustafson, J. P. (1979). Relation between chromosomal constituition in
TRITICALE
343
triticale and several agronomic characters. Eucarpia Triticale Symp. 1979, Radzikow, Poland (in press). Srivastava, J. P. (1974). Prospects of titicale as a commercial crop in India. Proc. Int. Symp., 1973, El Batan, Mexico IDRC - 024e, pp. 87-92. Stebbins, G. L. (1956). Artificial polyploidy as a tool in plant breeding. In “Genetics in Plant Breeding.” Brookhaven Symposia in Biology, No. 9. Brookhaven National Laboratory, New York. Stepochkin, P. I. (1975). Analysis of meiosis in different forms of 42-chromosome triticale using differential staining of the chromosomes. Izu. Sib. Otd. Akad. Nauk. SSSR Ser. Biol. 3, 139-141. (In Russian) Stutz, H. C. (1962). Asynchronous meiotic chromosome rhythm as a cause of sterility in Triticale. Genetics 47, 988. Suemoto, H. (1968). The origin of the cytoplasm of tetraploid wheats. Proc. Int. Wheat Genet. Symp., 3rd, Canberra pp. 141-152. Tarkowski, C. (1968). Aneuploidy disturbances in PMC’s meiosis and plant fertility in Triticale Nakajima. Genet. Polon. 9, 87-95. Tarkowski, C. (1969). Cytogenetics of hexaploid triticale hybrids with wheat and rye. Genet. Polon. 10, 85-86. Tarkowski, C., and Stefanowska, G. (1972). Chromosome morphology in the genome rye (Secale cereale L.) and in Triticale 6x and 8 x . Genet. Polon. 13, 83-89. Taylor, J. W., and Quisenberry, K. S. (1935). Inheritance of rye crossability in wheat hybrids. J . Am . Soc. Agron. 27, 149-153. Terrell, E. E. (1970). Check list of scientific names of introduced agricultural grasses. I. Tribe Triticeae (Hordeae). Crops Res. USDA ARS, 34-116. Thomas, J. B., and Kaltsikes, P. J. (1971). Chromosome pairing in hexaploid Triticale. Can J . Genet. Cytol. 13, 621-624. Thomas, J. B., and Kaltsikes, P, J. (1972). Genotypic and cytological influences on the meiosis of hexaploid triticale. Can. J . Genet. Cytol. 14, 889-898. Thomas, J. B., and Kaltsikes, P. J. (1974a). A possible effect of heterochromatin on chromosome pairing Proc. Natl. Acad. Sci. U.S.A. 71, 2787-2790. Thomas, J. B., and Kaltsikes, P. J. (1974b). Experimental approaches to the problem of univalency in Triticale. Cereal Res. Commun. 2, 5-12. Thomas, J. B., and Kaltsikes, P. J. (1976). The genomic origin of the unpaired chromosomes in triticale. Can. J . Genet. Cytol. 18, 687-700. Thomas, J. B., Kaltsikes, P. J., Gustafson, J. P., and Roupakias, D. G. (1980). Development of kernel shrivelling in triticale. 2. Pflanzenzuecht. 85, 1-27. Troutman, J. L., and Matejka, J. C. (1972). Downy mildew of small grains and sorghums in Arizona. Plant Dis. Rep. 56. 773-774. Tschermak-Seysenegg, E. (1938). Beitrage zur zuchterischen und zytologischen Beurteilung der Weizen-Roggen-und Weizen-Quecken Bastarde. Z . Zuechtung Reiche A Pflanzenzuecht. 22, 397-416. Tschermak-Seysenegg, E., and Bleier, H. (1926). Uber fruchtbare Aegilops-WeizenBastarde. Ber. Dtsch. Bot. Ges. 44, 110-132. Tsitsin, N. V. (1975). “Organization of new species and forms of plants.” Address to the Twelfth International Botanical Congress, Leningrad. Tsuchiya, T. (1968a). Chromosome variations in some strains of hexaploid Triticale. Wheat Inc Serv. 27, 7-8. Tsuchiya, T. (1968b). Breeding behaviour of aneuploids in some hexaploid Triticale. Wheat 1.6 Serv. 27, 9-10.
344
P. K. GUPTA AND P. M. PRIYADARSHAN
Tsuchiya, T. (1969). Cytogenetics of hexaploid Triticale. Colo. State Univ. Wheat Newslett. 15, 10-17. Tsuchiya, T. (1970). Chromosome pairing at diakinesis in hexaploid Triticale. Wheat lnf. Serv. 31, 22-23. Tsuchiya, T. (1972a). Variation of chromosome numbers in different seed size classes of hexaploid Triticale. Wheat Inf. Serv. 33-34, 22-24. Tsuchiya, T. (1972b). Chromosome association and seed fertility in five strains of hexaploid Triticale. Wheat. Inf. Seru. 33-34, 24-26. Tsuchiya, T. (1973). Frequency of euploids in different seed size classes of hexaploid Triticale. Euphytica 22, 592-599. Tsuchiya, T., and Larter, E. N. (1968). Direct synthesis of ctriticale from Colchicin+ doubled parents. Can. J . Genet. Cytol. 10, 770. (Abstr.) Tsuchiya, T., and Larter, E. N. (1969a). Chromosome stability in some hexaploid strains of Triticale. Crop Sci. 9, 235-236. Tsuchiya, T., and Larter, E. N. (1969b). Chromosome variations in the progenies of crosses between aneuploids and euploids in hexaploid Triticale. Wheat Znf. Serv. 28, 16-18. Tsuchiya, T., and Larter, E. N. (1971). Further results on chromosome stability in hexaploid Triticale. Euphytica 20, 591-596. Tsunewaki, K. (1964). Genetic studies of a 6x derivative from a n 8 x triticale. Can. J . Genet. Cytol. 6, 1-11. Tsunewaki, K. (1974). Triticale research in Japan. Proc. Int. Symp., 1973 pp. 21-33. Van’t Hof, J. (1975). The duration o f chromosomal DNA synthesis of the mitotic cycle and of meiosis in higher plants. In “Handbook of Genetics” (R. C. King, ed.), Vol. 2 pp. 363-377. Plenum, New York. Van’t Hof, J., and Sparrow, A. H. (1963). A relationship between DNA content, nuclear volume, and minimum mitotic cycle time. Proc. Natl. Acad. Sci. U.S.A.49,897-902. Verma, S. C., and Rees, H. (1974). Giemsa staining and the distribution o f heterochromatin in rye chromosomes. Heredity 32, 118-122. Vettel, F. (1958). Mutationsversuche an Weizen-Roggen-Bastarden (Triticale). Kuhn Arch. 72, 445-447. Vettel, F. (1959). Mutationsversuche an Weizen-Roggen-Bastarden (Triticale). I . Mutationsauslosung bei Triticale Rimpau, Zuechter 29, 293-317. Vettel, F. (1960a). Mutationsversuche an Weizen-Roggen-Bastarden (Triticale). 11. Zytologische Untersuchungen und Fertilitatsbestimmungen a n Triticale Rimpau und einigen Mutanten. Zuehcter 30, 181-189. Vettel, F. (1960b). Mutationsversuche an Weizen-Roggen-Bastarden ( TriticaEe). 111. Mutationsauslosung bei Triticale Meister und Triticale 8324. Zuechter 30,313-329. Vosa, C. G. (1974). The basic karyotype of rye analysed with Giemsa and fluorescence methds. Heredity 33, 403-408. Wabwoto, B. A. N. (1974). Triticale program and potential in Kenya. Proc. Int. Symp., 1973 El Batan, Mexico, IDRC-O24e, pp. 121-124. Walker, P. M. B., Flamm, W. G., and McLaren, A. (1969). Highly repetitive DNA in rodents. In “Handbook of Molecular Cytology” (A. Lima-de-Faria, ed.), pp. 52-66. Wiley, New York. Weimarck, A. (1973). Cytogenetic behaviour in octoploid Triticale. I. Meiosis, fertility and aneuploidy. Hereditas 74. 103-118. Weimark, A. (1974). Elimination of wheat and rye chromosomes in a strain of octoploid triticale as revealed by Giemsa banding technique. Hereditas 77, 281-286. Weimarck, A. (1975a). Cytogenetic behaviour in octoploid Triticale 11. Meiosis with
TRITICALE
345
spedial reference to chiasma frequency and fertility in F, plant. Hereditas 80, 121-130. Weimarck, A. (1975b). Heterochromatin polymorphism in the rye karyotype as detected by the Giemsa C-banding technique. Hereditas 79, 293-300. Weimarck, A. (1976~).Kernel size and frequency of euploids in octoploid Triticale. Hereditas 80, 69-72. Wilson, A. S. (1876). On wheat and rye hybrids. Trans. Proc. Bot. SOC.Edinburgh 12, 826-288. Winge, 0. (1917). The chromosomes, their numbers and general importance. C. R . Trau. Lab. Carlsberg 13, 131-276. Wittmack, L. (1899). Herr L. Wittmack sprach 'auuber den von Dr. Wilhelm Rimpau in Schlandstedt bereits 1888 erzogenen Bastard zwischen Weizen x Roggen. Ges. Nuturf. Fr. Berlin Vol. 59. Yunis, J. J., and Yasmineh, W. G. (1972). Model for mammalian constitutive heterochromatin. Adv. Cell. Mol. Biol. 2, 1-46. Zeller, F. J. (1973). lB/lR wheat-rye chromosome substitutions and translocations. Proc. Int. Wheat Genet. Symp., 4th Columbia, Missouri pp. 209-221. Zeller, F. J., and Baier, A. C. (1973). Substitution des Weizenchromosomenpaares 4A durch das Roggen Chrornosomenpaar 5R in den Weihenstephaner Weizenstamm w70 a 8b (Blaukorn). 2. Pflanzenzuecht 70, 1-10. Zeller, F. J., Kimber, G., and Gill, B. S. (1977). The identification of rye trisomics by translocation and Giemsa staining. Chromosoma 62, 279-289. Zeven, A. C. (1966). Geographical distribution of genes causing hybrid necrosis in wheat. Euphytica 15, 281-284. Zeven, A. C. (1968). Third supplementary list of wheat varieties classified according to their genotype for hybrid necrosis. Euphytica 17, 46-53. Zeven, A. C. (1969). Fourth supplementary list of wheat varieties classified according to their genotype for hybrid necrosis. Euphytica 18, 48-57. Zeven, A. C. (1971). Fifth supplementary list of wheat varieties classified according to their genotype for hybrid necrosis. Euphytica 20, 239-254. Zeven, A. C. (1972). Determination of the chromosome and its arm carrying the Ne,locus of 2'. aestivum L., Chinese spring and the Ne, expressivity. Wheat Znf. Seru. 33-34, 4-6. Zillinsky, F. J. (1973). Triticale breeding and research a t CIMMYT, a progress report. CIMMYT (Mexico) Res. Bull. 24, Zillinsky, F. J. (1974a). The triticde improvement program at CIMMYT. Proc. Znt. Symp., 1973 El Batan, Mexico IDRC-O24e, pp. 81-85. Zillinsky, F. J. (197413). The development of triticale. A d . Agron. 26, 315-348. Zillinsky, F. J., and Borlaug, N. E. (1971a). Progress in developing triticale as a n economic crop. CZMMYT (Mexico)Res. Bull. 17, 1-27. Zillinsky, F. J., and Borlaug, N. E. (1971b). Search for a new food source for man: Triticale research in Mexico. Agric. Sci. Rev. 9, 28-35.
REGULATORY GENE VARIATION IN HIGHER PLANTS* John G. Scandalios and James A. Baum Department of Genetics, North Carolina State University, Raleigh, North Carolina
I. Introduction
111. Spatial Regulation of Gene Expression .............................. A. Tissue Specificity and the R Locus of Maize ..........
361 361
IV. Subcellular Compartmentation V. Comments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
364
1. Introduction
Of increasing importance in studies of development and differentiation in eukaryotic organisms has been the identification and characterization of regulatory genes which control various facets of gene expression. Especially interesting are those genetic factors which regulate (a) the quantitative level of a structural gene product; (b) the temporal expression of a gene; (c) the subcellular compartmentation of a gene product; and (d) the tissue-specific changes in gene expression which occur during development. Certainly, these categories should not be considered mutually exclusive since a given regulatory gene could affect more than one aspect of gene expression. Furthermore, *Researchfrom our laboratoryhas been supported by Research Grant No. GM 22733-05 from the National Institutes of Health, and by National Science Foundation Grant PCM 77-09394. 347 ADVANCESIN GENETICS, Vol. 21
Copyright 0 1982 by Academic Press, Inc. All rights of reproduction in any form reserved. ISBN 0-12-017621-1
348
JOHN G. SCANDALIOS AND JAMES A. BAUM
it is useful to consider the possibility that certain regulatory com-
ponents may map within the structural gene domain instead of outside of it. Enzymes, particularly isozymes, have been widely used as probes for studying the regulation of gene expression during development because they represent the end product of a specific gene function. However, despite the considerable amount of work which has been devoted to studying genetically defined proteins, few regulatory genes which modulate the expression of specific structural gene products have been identified and characterized, particularly in plants. The intent of this article is not to present a comprehensive review of isozymes or other proteins in plants which have been analyzed by genetic and biochemical means. Nor will the focus of attention be placed on discussing mutants which effect phenotypic changes and which have been suggested to be regulatory in nature. Rather, we limit ourselves to reviewing a number of genetic systems in higher plants for which regulatory genes have been identified and have at least been shown to affect the expression of specific structural gene products (i,e,, proteins). In addition, we discuss certain aspects of gene expression which can be studied at the level of genetically defined proteins for which no regulatory genes have been identified. Also, some experimental approaches that are applicable to studying gene-enzyme systems in higher plants are discussed.
II. Quantitative and Temporal Regulation of Gene Expression A number of genetic systems have been found in higher plants in which a regulatory locus appears to control the activity or level of a specific structural gene product. Such quantitative mutants would be expected to affect the synthesis, degradation, and/or activation of that gene product. Temporal gene mutations (1) which alter the developmental program of structural gene expression will necessarily alter the quantitative expression of that gene during some stage of development. For this reason, it is perhaps better to consider the two regulatory phenomena together. Several of the genetic systems to be considered involve the regulation of storage proteins associated with the developing and mature seed of crop plants. In addition to these, a number of gene-enzyme systems in maize (Zeu mays L.) have been studied in which regulatory loci appear to function in controlling the level of enzyme protein or activity. Although not initially perceived as a temporal gene variation at
REGULATORY GENE VARIATION IN HIGHER PLANTS
349
the enzymatic level, one of the earliest such cases was an esterase (“pH 7.5 isozyme”) mutant in maize (2). The pH 7.5 esterase is prematurely repressed in its expression during endosperm development. The genetic analysis indicated that this mutant is very near to or at the locus determining the electrophoretic mobility of the pH 7.5 isozyme. Since the locus controlling electrophoretic mobility is presumably the structural gene, it is not known whether this cis-acting mutant involves a DNA sequence other than that of the gene coding for the enzyme. Unfortunately, further detailed analysis of this system has not been reported. Warner et al. (3) provided evidence which indicated that two genetic factors may be responsible for controlling the expression of nitrate reductase (NR) in maize through varying rates of synthesis and degradation. However, the genetic relationship between these two factors and the structural gene(s) for maize nitrate reductase was not determined, thus making interpretations difficult. Similarly, Gallagher et al. (4) reported the pattern of inheritance of nitrate reductase activity variation observed between the two wheat lines (Triticurn aestiuurn L.), Anza and UC 44-111. Their genetic evidence is consistent with the hypothesis that UC 44-111 has a single dominant gene, designated Nra, which controls this variability in NR activity. Although the investigators report no isozymic differences in NR between the two lines, they have not yet tested the possibility that this locus may actually represent a structural gene for nitrate reductase. In order to understand fully the nature of a presumed regulatory gene, it is first necessary to know its genetic relationship to the structural genes under its control through a formal genetic analysis of both the regulatory variation and the structural gene product (protein) being studied. Some of the following examples of regulatory gene variation in higher plants involve model systems that are generally well defined in the sense that the structural genes under regulatory control have been mapped to specific chromosomes and the gene products have at least been partially characterized. This information is particularly helpful in formulating models to explain regulatory gene action, the mechanics of which may vary depending on whether the regulatory component is cis- or trans-acting.
A. MODELGENE-PROTEIN SYSTEMS 1 . Maize Catalase
Catalase is a tetrameric hemoprotein which catalyzes the decomposition of hydrogen peroxide (H,O,) by either of two reactions depending on H,O, concentrations (5). At high H20z concentrations,
350
JOHN G. SCANDALIOS AND JAMES A. BAUM
catalase catalyzes the dismutation of HzOz to water and molecular oxygen: H,O,
+ H,O,
+
2H,O
+ 0,.
At low H,O, concentrations, catalase acts peroxidatically to metabolize H202: H,O,
+ RH,
+
R
+
2Hz0,
where RH, represents a suitable hydrogen donor (e.g., methanol, ethanol, phenols, primary amines). The major catalases of maize, CAT-1, CAT-2, and CAT-3, are encoded in the three unlinked structural genes, Catl, Cat2, and Cat3, respectively (6-8). These genes have been mapped on the maize genome using B-A translocation lines (7): Cat1 is on the short arm of chromosome 5 , Cat2 is on the short arm of chromosome 1, and Cat3 is on the long arm of chromosome 1. The catalases of maize have proven to be an interesting system for studying gene expression in a higher eukaryote since the isozymes appear to be regulated by a number of mechanisms during early sporophytic development including the differential turnover of the Cat1 and Cat2 gene products (9,lO) and regulation by an endogenous inhibitor (11-13). Catalase activity in the maize scutellum surges to a peak at approximately 4 days after soaking the kernels in distilled water for 24 hours and germinating them on moistened germination paper. This time course of activity reflects the differential expression of the CAT-1 and CAT-2 isozymes, both of which are found in the scutellum at this stage of development. CAT-1 activity gradually disappears while CAT-2 activity rapidly increases during the days following seed imbibition; these changes in activity are largely, if not entirely, due to changes in the levels of catalase protein (13) caused by varying rates of synthesis and degradation (9,101. As the result of a screening program, two inbred lines were found which express an altered developmental program for catalase in the scutellum. One of these, R6-67, has been analyzed in some detail (14). In this line, catalase activity in the scutellum increases rapidly following germination and maintains a level at least twice that observed in the standard inbred W64A. Using rocket immunoelectrophoresis to quantitate the amount of catalase protein, it was determined that this elevated catalase activity is primarily due to an increase in CAT2 protein (13,141. Crosses were made to establish the inheritance pattern of this altered developmental program using a statistical analysis appropriate for this type of study (15). Frequency distributions expected for the different homozygous genotypes and their heterozygotes were calculated for normal distributions from the means and
REGULATORY GENE VARIATION IN HIGHER PLANTS
351
standard deviations obtained for the parental lines and their F, progeny. Using these calculated values, points of minimum overlap among the distributions representing these three genotypes were determined as boundaries for classification. From these expected frequencies based on the normal distributions of the parental lines and the F, crosses, expected frequencies were computed for the F, and backcross generations. The F, and backcross data were then compared with the expected frequencies by goodness-of-fit x2 tests. The results were consistent with the hypothesis that the elevated CAT-2 activity (and protein) observed in R6-67 is due to a single locus with additive alleles. By using electrophoretic variants of CAT-2 in genetic crosses, it was determined that the regulatory locus is loosely linked to Cat2 on the short arm of chromosome 1 approximately 37 map units away. This transacting locus has been designated Carl (catalase-regulatory). The precise mode of action of the Carl locus on CAT-2 expression is not known although turnover studies with 2-allyl-2-isopropylacetamide (an inhibitor of catalase synthesis, 16) do indicate that Carl may regulate the rate of CAT-2 synthesis (14). One possible model to explain this regulatory variation is that, at approximately 4 days after germination, the Carl gene in W64A responds to a signal to slow down CAT-2 synthesis in the scutellum while, in R6-67, the Carl gene does not respond to this signal and gives rise to an elevated steady-state level of CAT-2 protein. 2. Maize Alcohol Dehydrogenase Maize alcohol dehydrogenase (ADH) is a dimeric enzyme which catalyzes the oxidation of several alcohols in uitro but generally prefers ethanol as a substrate (Lai and Scandalios, unpublished data). The best available evidence suggests that maize ADH serves an important function under anaerobic conditions (17,18), probably through its oxidation of ethanol: CH,CH,OH
+
NAD
$
CH,CHO
+
NADH/H'
whereby NADH is regenerated for the glycolytic pathway. The developmental expression of the maize ADH isozymes has been the subject of intensive research in our laboratory and has been found to be under temporal gene control in the scutellum. ADH activity in the scutellum of maize inbred W64A normally decreases following seed imbibition (19,20). In line R6-67, ADH activity is unusually high in the scutellum of the dry seed and remains at a level nearly 2-3 times that observed in line W64A during the 10 days following seed imbibition. Using rocket immunoelectrophoresis t o quantitate the amount of ADH protein, it was determined
352
JOHN G . SCANDALIOS AND JAMES A. BAUM
that this variation in ADH activity is primarily due to changes in the level of ADH-2 protein, the major isozymic form of ADH in maize which is encoded in a structural gene on the long arm of chromosome 1 (21). The scutella from 10-day-old seedlings were used in the subsequent genetic analysis since the difference in ADH activity observed between the two inbreds is grestest at this point in development. The results indicated that the altered developmental program of ADH-2 in R6-67 is due to a single gene with alleles exhibiting recessive inheritance (22). At 10 days, heterozygotes had an ADH activity level indistinguishable from that observed in W64A, suggesting that the rapid decrease in ADH-2 activity observed in W64A and in the F, progeny is due to a trans-acting dominant allele at this locus. This regulatory gene exhibiting dominant-recessive inheritance has been designated Adrl (alcohol dehydrogenase-regulatory)and has been found to be unlinked to either Cut2 or Adh2 (22). Turnover studies combining density-labeling (deuterium oxide, D,O) with cesium chloride isopycnic centrifugation were undertaken to determine whether or not the Adrl locus controls ADH-2 synthesis and/ or degradation (22). Using this technique, Lai and Scandalios (22) found no evidence of significant ADH-2 synthesis in the scutellum of either W64A or R6-67 during early seedling development, confirming earlier studies with W64A (17) and suggesting that Adrl operates at the level of enzyme degradation. For several years, it has been known that ADH activity in the maize scutellum is negatively correlated with an endogenous inhibitor (17,20,23). Recent evidence has suggested that the inhibitor is a 10,000-dalton proteolytic enzyme which specifically inactivates ADH (Lai and Scandalios, unpublished data). It is tempting to speculate that the gene coding the ADH inhibitor is Adrl and that R6-67 and W64A have alleles which differ in their expression of this inhibitor protein. In any case, the developmental profile of ADH-2 in the scutellum during germination appears t o be at least partly determined by the lack of significant ADH-2 synthesis and by the action of an endogenous inhibitor or protease (16,23). This model is attractive in that it can nicely account for the dominant-recessive nature of the Adrl gene. In recent years, evidence has accumulated which indicates that the fast (F)and slow (S) electrophoretic variants of ADH-2 are differentially expressed in maize tissues. Although no mechanism has yet been demonstrated, it appears that this regulatory phenomenon involves cis-acting regulatory components adjacent to or within the con-
REGULATORY GENE VARIATION I N HIGHER PLANTS
353
fines of the Adh2 structural gene (24,251. Thus, there is evidence that the expression of Adh2 can be controlled by both cis- and trans-acting regulatory components (22,25). The ADH system in maize would appear to be particularly useful in studying regulatory gene variation since a selection scheme is available for isolating ADH dysfunctional and underproducer mutants (26). Combining X-ray and neon ion irradiation with ally1 alcohol selection of pollen grains for reduced ADH expression, a number of transmissible mutations have been recovered (26) which appeared to affect regulatory components of ADH-2 expression: Both overproducers and underproducers of this isozyme were observed. Unfortunately, the presumed mutants were associated with chromosome aberrations and were generally unstable in their expression. Although it was suggested that the mutations did not involve the structural gene, this was not definitively shown to be the case. Despite these problems, the study did suggest that it is possible to mutate and select for regulatory components controlling ADH expression in maize. In fact, one stable mutant, designated Adhl -S1951 [nomenclature: Adhl of Freeling (25) = Adh2 of Scandalios (2311 has been recovered from this mutagenesis program and has been shown to underproduce ADH2-S subunits in the scutellum and overproduce ADH2-S subunits in the anaerobic primary root (25). Although this tissue-specific difference in regulatory behavior would not be expected of a structural gene mutation, the possibility that this mutant involves the structural gene has not been ruled out. Nevertheless, if one considers the possibility that certain regulatory components governing structural gene expression are encoded within the structural gene locus itself, then this mutant can be considered regulatory in nature, regardless of its relationship to the structural gene.
3 . Maize UDP G1ucose:Flavonol 3 -0-Glucosyltransferase The enzyme UDP g1ucose:flavonol 3-O-glucosyltransferase (UFGT) catalyzes the 3-O-glucosylation of flavonols (27) and presumably that of anthocyanidins (281, a reaction thought to be one of the last steps in flavonoid glucoside (anthocyanin) biosynthesis (29,30). The dominant factors A , A2, C, C2, R , Bz, Bz2, and V p are required for anthocyanin formation in the aleurone layer of the maize kernel (31). Significantly, the dominant factors C, R, Vp, and Bz are required for the dramatic increase in UFGT activity which is observed in the developing endosperm (32,331. The bronze locus (Bz)on chromosome 9 (9-31; i.e., chromosome 9-map position 31) appears to be the struc-
354
JOHN G. SCANDALIOS AND JAMES A. BAUM
tural gene encoding this enzyme since the bronze mutants lack UFGT activity (32,34) and since there is a correlation between UFGT activity and dosage of the normal Bz allele (35). The allelic series at the C locus on chromosome 9 (9-26) includes C-I, a dominant inhibitor of anthocyanin pigmentation and UFGT activity, and c-p and c-n, both recessive colorless (anthocyanin-less) mutants which also affect UFGT activity. Endosperms with 3 doses of the C-I and c-p alleles have only 2-3% the UFGT activity of normal endosperm (32). Plants homozygous for the c-p allele are conditional colored mutants which exhibit colorless aleurone but will accumulate anthocyanin pigments in the aleurone during germination in the light. Individuals homozygous for the c-n allele are colorless regardless of light conditions while individuals with the dominant C allele accumulate anthocyanin in the aleurone during seed maturation with and without light (36). If c-p kernels are exposed to light while still on the ear, the aleurone tissue will remain colorless until germination, at which time it will accumulate anthocyanin pigments even if the seedling is grown in the dark. Thus, the light stimulus appears to be stored until the onset of germination when induction occurs. A tentative model for the light-induction phenomenon has been proposed (36); the prominent feature of this model is that light induction and germination induction of anthocyanin pigmentation are two separable events and that the former precedes the latter. Although the regulatory function of C is not clear, the c-p allele is of major interest since this mutant dramatically affects the timing of gene expression. is a compound locus The R locus region on chromosome 10 (10-57) associated with a tandem duplication. The r-g allele at this locus is a null allele giving rise to plants with no anthocyanin pigmentation in any seed or plant parts. Only 2-3% of the normal UFGT activity found in seed endosperm can be detected in lines homozygous for this allele (32,371. Likewise, the up mutation on chromosome 3 (3-128+) also causes a similar reduction in UFGT activity in mature endosperm. The R locus region will be discussed in a later section of this paper because of its apparent role in controlling the tissue specificity of UFGT expression. Two general models have been proposed to explain the interaction between Bz, C, R , and V p (33). According to the first model, C, R , and V p would be regulatory genes coding for macromolecules which directly turn on the Bz gene. According to the second model, C, R , and V p would specify early enzymes in the anthocyanin pathway involved in the synthesis of a flavonoid precursor responsible for UFGT induction. This precursor induction of UFGT could be mediated by
REGULATORY GENE VARIATION IN HIGHER PLANTS
355
way of an activated regulatory protein. Although no clear choice can be made between the two models at this time, it would appear that the precursor-induction model is the more plausible. The evidence which has accumulated to date does suggest that C and R act before C2, A , A2, Bz, and Bz2 in the anthocyanin biosynthesis pathway (38-43).Also, since up is the only colorless aleurone mutant with a pleiotropic effect (vivipary; i.e., premature germination), it has been suggested that V p may precede C and R in the pathway. Dooner and Nelson (33) report that up aleurones are also deficient in phenylalanine ammonia lyase (PAL) activity. Thus, V p could affect the pathway either through direct control of several genes or by its control of PAL, the enzyme responsible for producing the flavonoid precursor, cinnamic acid. A particularly interesting study of the UFGT system was conducted by Dooner and Nelson (44,451using the activator-dissociation (Ac-Ds) controlling element system (46)to induce alterations in UFGT activity. The association of Ds with the Bz locus can lead to absence of any detectable gene product or to alteration of the enzyme encoded by that locus, especially when Ds is made unstable by the introduction of Ac (45).In those instances where UFGT activity in the mature endosperm is dramatically reduced but not absent, the enzyme itself appears to be structurally altered, indicating that Ds has disrupted the structural gene for UFGT. One mutable allele, bz-md, is unusual in that the developmental program for the UFGT protein in the endosperm is significantly altered in addition to the UFGT protein itself (45),suggesting the presence of a regulatory component which maps within the UFGT structural gene (Bz).This situation may be similar to that of the cis-acting regulatory components found to be tightly linked to Adh2 (25). 4 . Storage Proteins Several genes have been identified which appear to regulate the levels of storage proteins in plants such as maize, barley, pea, and sorghum. The first of these to be studied in some detail were the opaque-:! (02) and floury-2 ( f l )mutants which affect zein expression in maize. These two mutants were found to dramatically reduce the level of the lysine-poor protein, zein, while generally causing a secondary perturbation in the levels of glutelin, albumin, and globulin (47-50).Several other mutants were subsequently identified which reduce zein content in maize endosperm: opaque-7 (071,opaque-6 (061, and floury-3 (f13) (51,521. Unlike 02 and fl2, the mutants 06, 07,and f13 cause a slight reduction in glutelin content in addition to reducing
356
JOHN G . SCANDALIOS AND JAMES A. BAUM
zein content. Characterization of the zein components has been difficult because several molecular weight species are present which exhibit extensive charge heterogeneity as shown by isoelectric focusing on polyacrylamide gels (53-56). Six molecular weight components are generally found although the molecular weight values reported in the literature are not entirely consistent (53-59). Zein is primarily composed of two major components with molecular weights of approximately 22,000 and 19,000 (53,60), but it is not precisely known how many structural genes for zein are present in the maize genome. Sodium dodecyl sulfate (SDSI-polyacrylamide gel electrophoresis has been used to demonstrate that the 02, fZ2, and 07 alleles have differential effects on the expression of the zein components (53,571. This analysis has been extended to examining the effect(s) of 02 on the zein polypeptides resolved by isoelectric focusing (IEF) on polyacrylamide gels. The IEF technique has been used to resolve zein into 8-15 polypeptides (depending on the inbred line used); the 02 mutant was found to suppress the expression of all of the polypeptides to some extent, but particularly the more basic proteins (58).A study of several inbred lines demonstrated that the IEF pattern of zein is characteristic of the genotype and that most strains yielded different patterns (58,61). The inheritance of this charge variation could be followed by the IEF technique, thereby permitting genetic analysis of some of the zein polypeptides. The zein components Zpl, Zp2, and Zp3 resolved by isoelectric focusing appear to be inherited as a unit and presumably are the products of either a single structural gene or a gene cluster. This locus is closely linked to the opaque-2 (02)locus on chromosome 7 by approximately 5 map units while the presumed structural genes for Zp6 and Zp12 show no evidence of being linked to either 02 or to each other (62). The structural gene for Zp12 is probably located on the long arm of chromosome 4. The presumed structural gene for Zp13 has been mapped to the short arm of chromosome 4 while a gene encoding a Zp2 polypeptide has been mapped close to the R locus on chromosome 10 (63). The Zp2 polypeptide reported in this study (63) has the same IEF position as the Zp2 polypeptide mentioned previously (62), but differs from it in its molecular weight, suggesting that they are encoded in different structural genes. The assignment of some of the zein genes to chromosomal locations lends further support to the notion that the 02, f12, and 07 genes are regulatory in nature, since they affect the expression of genes which map to other chromosomal positions. Also, as pointed out by Valentini et al. (63), these results are particularly interesting in that three of the zein genes have been mapped t o regions occupied by one of the presumed reg-
REGULATORY GENE VARIATION I N HIGHER PLANTS
357
ulatory genes 02 (7S), f12 (4S),and 07 (1OL).These mapping data have been supported by Viotti et al. (64) using zein mRNA in in situ hybridization experiments to locate the zein structural genes. Hybridization sites were identified on the long arm of chromosome 4, the long arm of chromosome 5, the short arm of chromosome 7 near 02, and the long arm of chromosome 10 near 07. The mode of action of the regulatory genes is not known although both 02 and fl2 have been correlated with a reduced recovery of membrane-bound polysomes capable of directing zein synthesis in uitro (65,661. It should be reemphasized that these mutants do not simply affect zein expression and that they do have a pleiotropic effect on seed metabolism (67). The mutants 02 and fZ2 affect the expression of buffer-soluble proteins (albumins and globulins) including RNase, which tends to be unusually high in the developing 02 endosperm (68,691 and which may have a role in regulating zein content (65,68). Unlike 02, the floury-2 mutation does not appear to affect RNase content in the developing endosperm (68). Studies on the defective kernel mutants of maize may uncover a wealth of regulatory gene variation, particularly with respect to the zein system. Manzocchi et at. (59,701 examined 19 viable defective endosperm mutants and observed that some accumulated low levels of zein and glutelin while others only had reduced levels of zein. A number of these mutants were found to exhibit temporal variation in zein accumulation. One difficulty with this study is that it is not known where these mutants map on the maize genome relative to the zein structural genes. Neuffer and Sheridan (71) recovered and characterized 194 lethal defective kernel mutants from crosses using EMStreated pollen with hopes of identifying auxotrophic mutants (72). Ninety of the 194 mutants were located on 17 of the 18 chromosome arms tested using B-A translocations. It would not be surprising to find some regulatory gene variation among these mutants considering the phenotypes they exhibit (71). An additional factor to be considered is the observation that starchforming mutants in maize have been reported to reduce zein content (65,73-75). The starch-forming mutants can be separated into two groups: the starch-modified and the starch-deficient mutants. The starch-modified mutants amylose-extender (ae), dull (d u ), sugary-:! (su2), and waxy (wx)have little effect on starch accumulation in the endosperm but alter the normal ratio of amylose to amylopectin as well as slightly increase the level of sucrose. The starch-deficient mutants shrunken-1 (sh),shrunken-2 (sh2),shrunken4 (sh41, brittleI (bt), brittle-2 (bt2), and sugary-1 (su) reduce starch content and
358
JOHN G . SCANDALIOS AND JAMES A. BAUM
significantly increase sucrose levels in the endosperm (76). The waxy locus has been shown to be the structural gene for a starch granulebound nucleoside diphosphoglucose-starch glucosyltransferase (77,781 while sh2 and bt2 both control the activity of adenosine diphosphoglucose pyrophosphorylase. Mutation at either locus effects a 90-95% reduction in this enzyme activity in the endosperm but does not affect the enzyme activity in the embryo or pollen (79-83). The evidence accumulated to date is consistent with the hypothesis that the two loci are structural genes for a pyrophosphorylase isozyme characteristic of the endosperm (82,841. The sh gene controls the major form of sucrose synthetase (85) while sh4 appears to regulate the levels of pyridoxal phosphate (86). Tsai et ul. (65) reported that when 02 is combined with each of the starch-modified mutants, zein content is further reduced while nonzein protein content is not. Their results suggest a cumulative effect between 02 and the starch-modified genes in reducing zein expression. However, when 02 is combined with each of the starch-deficient mutants, a synergistic effect is observed with the double mutants accumulating very little zein. In addition, the double-mutant combinations yielded SDS-polyacrylamide gel patterns distinctly different from that characteristic of either parent. In the case of bt2, 02, and bt202 kernels, this reduction in zein content is correlated with a reduced recovery of membrane-bound polysomes capable of directing zein polypeptide synthesis in uitro (65). Significantly, the RNase level of bt202 endosperm is roughly three times that observed in either bt2 or 02 endosperm and seven times that observed in normal endosperm (from the same genetic background), again suggesting that this enzyme plays a role in regulating zein expression. The activity and timing of expression of RNase I in maize endosperm appears to be under genetic control but the high variability in enzyme activity observed during development has rendered a thorough genetic analysis difficult (68,69,87). A number of other crop plants have been shown to have storage protein accumulation under genetic control. An exhaustive review of genetic variability in the control of wheat storage proteins is available and will not be discussed here (88). The recessive allele hl appears to alter the amino acid composition of storage proteins in sorghum (89). Several recessive high-lysine mutants in barley (Hordeurn uulgure) have been studied for their effect(s) on hordein polypeptide expression. The C and B hordein components are controlled by codominant alleles at linked loci, designated Horl and Hor2, respectively, on chromosome 5 (90-92). Horl and Hor2 are approximately
REGULATORY GENE VARIATION I N HIGHER PLANTS
359
10-15 map units apart (91-93). The Riso 1508 mutation is located on chromosome 7 (94-96) and appears to be regulatory since it affects other biochemical processes besides hordein expression (97). This gene eliminates most if not all of the polypeptides encoded in the Horl locus and decreases the amount as well as alters the relative composition of those polypeptides encoded in the Hor2 locus (98). The Riso 56 mutant is located either close to or at the Hor2 locus on chromosome 5 (99) and appears to decrease the expression of the B hordein polypeptides while enhancing the expression of the C polypeptides. The Notch 1, Notch 2 (100,101), Zys95, and lys449 mutations (102) are unmapped genes which decrease the amount of protein encoded in both Horl and Hor2 but have little effect on the polypeptide composition (98). Similarly, the cx subunit of legumin in green pea (Pisurn sativun) is coded by a structural gene which is closely linked t o the r, locus on chromosome 7, a gene which is associated with a wrinkled seed phenotype and a decreased level of legumin. The two loci are approximately 7 map units apart, suggesting that the r, locus serves a regulatory role in controlling legumin expression (103). Taken together, it is clear that regulatory variation in storage protein expression will provide ample opportunities for studying regulatory gene function in higher plants. The complexity of these systems, particularly that of zein, will be an impediment toward a thorough genetic characterization of the regulatory phenomena observed. Still, it is expected that much will be learned from these mutants in the future.
B. OTHERSYSTEMS Several other novel approaches have been used to isolate presumed regulatory mutations, but in these instances, further characterizations of the regulatory phenomena are needed. Ho et aZ. (104) isolated two stable mutants from sodium azide-mutagenized barley seeds which are gibberrellic acid (GA,) insensitive with respect to both a-amylase production and phosphatase release from cell walls of the aleurone. Thus, the two mutants appear to be similar to hormone-insensitive mutants in maize (20,105) and wheat (106). The barley mutants were obtained by screening the F, progeny of NaN, mutagenized seed: barley seeds were cut in half and placed cut edge down on 2% agar plate cultures with and without GA, in the medium. The seeds could then be screened for their ability to synthesize and secrete a-amylase by staining the agar plates for cxamylase activity. In addition to the GA,-insensitive mutants which
360
JOHN G. SCANDALIOS AND JAMES A. BAUM
appear to be regulatory mutants of a-amylase synthesis, preliminary evidence for ABA-insensitive and a-amylase constitutive mutants was also presented. It should be noted, however, that a formal genetic analysis of these mutants has not been reported and that the effect of these mutations on the a-amylase protein itself has not been rigorously studied. Another promising approach has been to select for temperaturesensitive or nitrate reductase-deficient mutants using plant tissue culture techniques. In tobacco, a temperature-sensitive mutant (ts4) has been regenerated from tissue culture (107,108);this mutation has a pleiotropic effect on the activities of phenylalanine ammonia lyase, nitrate reductase (NR), ornithine decarboxylase, and S-adenosyl methionine decarboxylase but does not have an effect on a number of other enzymes involved in nitrate assimilation. A revertent having restored levels of ornithine decarboxylase has been reported (108) and is probably a second site revertent which compensates for ts4. Although the pleiotropic effect of ts4 is suggestive of a regulatory gene mutation, the possibility exists that the mutation is in the structural gene for an enzyme in the nitrate assimilation pathway which directly or indirectly controls other enzymes in the pathway. In similar studies, nitrate reductase-deficient mutants of Arabidopsis thaliana, barley, and tobacco have been obtained by selecting for chlorate resistance (109-112). In tobacco, 14 nitrate reductasedeficient mutant cell lines have been categorized into two groups: mutants which appear to be defective in the production of the molybdenum cofactor required for NR activity and mutants which appear to have an altered NR apoprotein (112). The plant tissue culture approach has also been successfully used to select for methionine sulfoxamine resistance (113), 5-methyl-tryptophan resistance (114,115), streptomycin resistance (1161, and pantothenate auxotrophy (117). Although no regulatory gene variation has been demonstrated in these systems, the potential for finding such mutants is obvious. Using a radically different approach, Sherrard et al. (118) used the Chinese Spring-Hope substitution lines of wheat to identify specific chromosomes which affect the stability and/or activity of nitrate reductase, nitrite reductase, and acid proteinase. Although suggestive of regulatory gene activity, these results are difficult to interpret because the chromosomal locations of the structural genes for these enzymes are not known and because the chromosomal substitutions may have pleiotropic effects on metabolic processes such as protein turnover. Wolf et al. (119) located the structural genes for the phosphodiesterase isozymes of wheat on the three homeologous chromo-
REGULATORY GENE VARIATION I N HIGHER PLANTS
361
somes of group 3 by analyzing the electrophoretic patterns of monosomic, nullisomic, and nullisomicitetrasomic compensation lines. In addition, they provided evidence for the existence of genes on the group 5 chromosomes which positively control the expression of the 3D structural gene encoding phosphodiesterase. Hopefully, it will be possible to obtain variants of these presumed regulatory genes. 111. Spatial Regulation of Gene Expression
Under this category, we may include regulation of tissue-specific gene expression and the subcellular compartmentation of gene products. To our knowledge, no genes which control the subcellular compartmentation of gene products have been characterized to date. Nevertheless, some insight into the mechanisms by which proteins are localized within the subcellular organelles (protein bodies, mitochondria, chloroplasts, etc.) of both plants and animals has been gained in the past few years. For the sake of this discussion, it is instructive to review briefly what is known about the process. Even within the genetic systems discussed so far, there are numerous examples of tissue-specific gene expression which presumably are under genetic control. Unfortunately, there are very few instances where regulatory genes have been shown to control tissue specificity.
A. TISSUESPECIFICITY AND THE R Locus OF MAIZE As mentioned previously, the R locus of maize is one of several genes necessary for anthocyanin pigmentation in the aleurone, possibly through its control of UFGT activity. In addition, the R locus appears to control the anthocyanin pigmentation of anthers and other plant parts including the coleoptile, seedling leaf tip, and root. In this sense, it is distinct from the Bz,Bz2, A, A2, C, and C2 loci which are required for pigmentation in the aleurone. The R:r standard allele is a compound locus composed of a tandem duplication bearing a proximal (to the centromere) plant-pigmenting factor (PI and a distal seed-pigmenting factor (S) on the long arm of chromosome 10.Because of this duplication, unequal crossing-over can occur, giving rise to progeny that can lack either member of the duplication. The r-r allele has lost (S) but retains (P), and gives rise to plants with colorless aleurone but pigmented plant parts. The R-g allele has lost (PI but retains (S), and gives rise to plants with colored aleurone but unpigmented plant parts. The r-g allele codes for no pigmentation in any
362
JOHN G. SCANDALIOS AND JAMES A. BAUM
seed or plant part and thus constitutes a null for this region. A clear explanation of the R locus and the gene symbols used has been presented (37). An additional plant pigmenting factor Lc has been reported (120) which maps 1.5 map units distal to R and appears to be part of a displaced duplicate R segment. However, there is no evidence that Lc is a compound locus and it does not condition aleurone pigmentation. When R-g:l LcIR-g:l Lc individuals were crossed as females to r-g Zclr-g Zc males, progeny were obtained which exhibited a unique tissue specificity in that they lacked both seed and leaf color but had pigmented anthers ( r - r Zc) (37). This generation of a new tissue-specific function was apparently caused by unequal crossingover involving two tightly linked regions of the R locus which control tissue specificity. Based on this and other genetic evidence, it was hypothesized that the cis-acting components of R include a proximal region composed of tightly linked sites controlling tissue specificity and a distal region necessary for R function. Supportive evidence for this has been obtained by Kermicle (121) using the controlling elements (Ds)and Modulator ( M p ) to disrupt R function in R-sc:124 individuals (presumably through integration at the R locus) and then recovering progeny with the original tissue specificity through recombination with an R region encoding a different tissue-specific function. These results indicate that R function consists of one component which controls tissue-specific expression and another which is common to alleles with different tissue-specific activities. This study is an interesting example of how transposable elements can be used to probe gene structure and function. A model for R function has been proposed in which the cis-acting proximal region of the R locus controlling tissue specificity is involved in determining in which tissues the Bz activating signal is produced (37). The signal (e.g., protein, RNA) produced by the distal region of the R locus then activates, either directly or indirectly, the structural gene for UFGT (Bz). B. TISSUE-SPECIFIC EXPRESSION OF THE CATALASE GENES Tissue specificity in the expression of genetically defined isozymes of higher plants is a common occurrence (122,123). In maize, for example, a high degree of tissue specificity in the expression of the Catl, CatZ, and Cat3 structural genes can be observed using standard electrophoretic techniques (124). CAT-1 is found in the scutellum, liquid endosperm, pericarp, and aleurone of developing kernels and is transiently present in the scutellum and etiolated primary leaf of young
REGULATORY GENE VARIATION IN HIGHER PLANTS
363
seedlings. CAT-2 is found in the scutellum and green primary leaf of young seedlings and in the aleurone of developing kernels. CAT3 is primarily found in the coleoptile sheath, mesocotyl, and primary leaf (etiolated or green) of young seedlings but, in some lines, minimal activity can be detected in the pericarp and liquid endosperm of developing kernels and in the scutellum of young seedlings. This variability in tissue localization may serve as a useful tool in analyzing tissue-specific gene expression. A major obstacle to this approach is the present inability to screen conveniently a large number of individuals for variations in tissue specificity. Scandalios et al. (125) have identified a maize line in which the tissue-specific expression of catalase appears to be altered: both Cut1 and Cat3 are expressed in the coleoptile sheath of etiolated seedlings from inbred W59 while, in inbred W64A, only Cat3 is expressed. The genetic basis for this variation in gene expression is currently under investigation. IV. Subcellular Compartmentation
Although it is a common occurrence t o find isozymes (and other proteins) differentially localized within subcellular compartments (1261, the mechanisms by which this is brought about is just beginning to be understood. Several compartmentalized proteins in plants have been found to be synthesized as higher molecular weight precursor proteins which are then cleaved to their proper size during the process of maturation, probably during the compartmentation process. Among the proteins which have been studied are the small subunit of pea chloroplast ribulose-1,5-bisphosphate(RuBP) carboxylase (127-129), hordein (1301, pea vicilin (1311, zein (60,1321, and pea legumin (133). The small subunits of RuBP carboxylase from pea (129) and Chlumydomonas reznhardii (134) and the major zein polypeptides (135) each appear to have an N-terminal leader sequence which is cleaved off during the compartmentation process. To our knowledge, the proteases responsible for this reaction have not been studied in any detail. If this processing mechanism is a general phenomenon, it would indicate that some of the information needed to determine an enzyme’s subcellular localization can be found within the limits of its structural gene. The compartmentation of catalase in maize may prove t o be different from the above examples. Both CAT-1 and CAT-2 are, in part (-50%), localized within glyoxysomes in the scutellum during germination (136).Both isozymes appear to be synthesized on free polysomes, which
364
JOHN G. SCANDALIOS AND JAMES A. BAUM
suggests that they are not directly translocated into this organelle during translation (T. Kelley and J. C. Sorenson, personal communication). A dimeric protein with a molecular weight of approximately 12,000has been isolated from maize scutella and has been found to reversibly bind and inhibit catalase (136-138).The galactose associated with this protein is necessary for the inhibitor activity (12,13,138,139).The fact that the glycoprotein is associated with glyoxysomal membranes has led to the hypothesis that the inhibitor may also serve as a binding protein which facilitates catalase compartmentation within glyoxysomes (13).Thus, the catalase inhibitor may serve a function analogous to that of egasyn, the membrane protein which apparently anchors mouse p-glucuronidase to microsoma1 membranes (1,140). V. Comments
Understanding the genetic and environmental factors which regulate differential gene expression in eukaryotic organisms has become one of the major challenges facing experimental biologists today. The identification and characterization of regulatory genes which control different aspects of gene expression will be a valuable contribution toward this end. It should be noted that the possible role of transposable genetic elements (46,141)in controlling gene expression has not been discussed in this article, partly because these elements are a topic unto themselves and also because no definitive evidence is yet available to suggest that they function in coordinating gene expression during development. Nevertheless, the possibility exists that these genetic elements can serve in such a capacity and thus they should not be overlooked. In studies of regulatory gene variation, transposable elements, at present, are perhaps more useful as potential probes for studying gene structure and function and for inducing mutations (44,45,119). A few points should be discussed regarding experimental approaches used in studies as herein discussed: (a) Because of the nature of the work, it is important that the regulatory systems being studied are well-characterized genetic systems. That is, it is important that one be able to determine whether a regulatory gene maps at or away from the structural gene locus. This information is necessary for constructing models of regulatory gene action which can then be further tested. (b) In addition to the appropriate genetic studies, a biochemical char-
REGULATORY GENE VARIATION I N HIGHER PLANTS
365
acterization of the structural gene product(s) is valuable. The apparent confusion with regard to the number and size of the zein polypeptides in maize illustrates this point. The complexity of the SDS and IEF gel patterns of storage proteins from plants may present problems for investigators studying storage protein mutants. In those instances where cis-acting regulatory components tightly linked to the structural gene have been identified, it is essential that the structural gene products be analyzed for possible alterations. (c) The need for a sensitive, reliable assay for quantitating gene product levels is obvious. The use of immunological techniques for quantitating proteins is highly recommended because interfering substances in crude extracts are prevented from confounding assay results and because regulatory gene function can be more easily interpreted. For instance, it is not clear whether the R and C loci of maize control the level of UFGT protein or the activity of UFGT protein. Instead of acting on the UFGT structural gene (Bz), the two genes could regulate UFGT activity allosterically. In the case of the zein polypeptides and other storage proteins, it may be possible to use monospecific antibodies or monoclonal antibodies (142-144)to assay for specific proteins. Although radioimmunoassays (RIA) are highly sensitive (145,146),the use of simpler and more convenient immunoassay techniques such as rocket immunoelectrophoresis (147)would probably suffice. Recent reviews on the use of antibodies to study isozyme regulation in higher plants are available (148,149).(d) A major obstacle in studying regulatory gene function in higher organisms is the general inability to select for regulatory mutants. The value of having a selection scheme such as the one used for maize ADH is obvious. In some instances, plant tissue culture techniques can provide a means for isolating mutants which affect gene expression (150);these in uztro techniques may prove to be invaluable in future plant genetic research. (e) Studies on the subcellular compartmentation of proteins have suggested that at least some of the information determining a protein’s subcellular localization can be found within the limits of the structural gene for that protein. An attempt should be made to identify the proteases responsible for processing the precursor proteins. Additional information on subcellular compartmentation may be obtained using surrogate secretory systems such as the Xenopus oocyte (151-154).In this system, messenger RNA from an organism is injected into the oocytes where it is translated. Transport and/or compartmentation of the newly translated proteins can then be followed using radioisotopes and monospecific antibodies. (0 In some instances, it may ultimately be necessary to obtain a cDNA probe complementary to the mRNA
366
JOHN G. SCANDALIOS AND JAMES
A.
BAUM
for the structural gene product being studied. The probe can then be used to quantitate messenger RNA levels (155) and thus determine whether or not a regulatory gene exerts its effect at this level of gene regulation. A complementary approach involves the use of an in vitro translation system to quantitate levels of translatable mRNA. It should be noted that cDNA clones for zein mRNA have been obtained (156) and that production of cDNA clones for maize CAT-1 and CAT2 mRNA is being attempted. (g) It is tempting to speculate that regulatory gene variation may have some evolutionary significance in natural populations. Certainly, the possibility of tissue-specific gene expression and temporal gene variation should be taken into account in studies of population genetics. Judging from the studies discussed in this paper and elsewhere (l), it is clear that a wide variety of regulatory mechanisms exists in eukaryotic organisms. Cis- and trans-acting regulatory factors have been identified which control the developmental or tissue-specific expression of structural genes, in some cases by altering the rate of synthesis or degradation of the structural gene product. Although little else is known about the mechanisms by which regulatory genes in higher plants control gene expression, one can anticipate that our knowledge of this subject will be enhanced as research progresses and as new techniques become available. REFERENCES 1. K.Paigen, in “Physiological Genetics” (J.G. Scandalios, ed.), p. 1. Academic Press, New York, 1979. 2. D. Schwartz, Genetics, 47, 1609 (1962). 3. R. L. Warner, R. H. Hageman, J. W. Dudley, and R. J. Lambert, Proc. Natl. Acad. Sci. U.S.A. 62, 785 (1969). 4. L. W. Gallagher, K. M.Soliman, C. 0. Qualset, R. C. Huffaker, and D. W. Rains, Crop Scz. 20, 717 (1980). 5. H. Aebi and H. Sutter, Adu. Hum. Genet. 2, 143 (1971). 6. J. G. Scandalios, Ann. N . Y . Acad. Sci. 151, 274 (1968). 7. D.G. Roupakias, D. E. McMillin, and J. G. Sandalios, Theor. Appl. Genet. 58, 211 (1980). 8. J. G. Scandalios, Plant Res. 70, 140 (1970). 9. P. H.Quail and J. G. Scandalios, Proc. Natl. Acad.. Sci. U.S.A. 68, 1402 (1971). 10. J. C. Sorenson, P. S. Ganapathy, and J. G. Scandalios, Biochem. J. 164, 113 (1977). 11. J. C. Sorenson, and J. G. Scandalios, Plant Physzol. 57, 351 (1976). 12. A. S.Tsaftaris, J. C. Sorenson, and J. G. Scandalios, Biochem. Biophys. Res. Commun. 92, 889 (1980). 13. A. S. Tsaftaris and J. C. Sorenson, Deu. Genet. 1, 257 (1980). 14. J. G. Scandalios, D. -Y. Chang, D. E. McMillin, A. Tsaftaris, and R. H. Moll, Proc. Natl. Acad. Sci. U.S.A. 77, 5360 (1980).
REGULATORY GENE VARIATION IN HIGHER PLANTS
367
15. L. Powers, L. F. Locke, and J. C. Garrett, U S . Dept. Agric. Tech. Bull. 998, 1 (1950). 16. V. E. Price, W. R. Starling, V. A. Tarantola, R. W. Hartloy, and M. Rechcigl, J . Biol. Chern. 237, 3468 (1962). 17. Y. -K. Lai and J . G. Scandalios, Differentiation 9, 111 (1977). 18. M. M. Sachs, M. Freeling, and R. Okimoto, Cell 20, 761 (1980). 19. J. G. Scandalios and M. R. Felder, Deu. Biol. 25, 641 (1971). 20. D. T. -H. Ho and J. G. Scandalios, Plant Physiol. 56, 56 (1975). 21. M. G. Neuffer and E. H. Coe, Jr., in “Handbook of Genetics” (R. C. King, ed.), Vol. 2, p. 3. Plenum, New York, 1975. 22. Y. -K. Lai and J. G. Scandalios, Deu. Genet. 1, 311 (1980). 23. J. G. Scandalios, in “Regulation of Enzyme Synthesis and Activity” (H. Smith, ed.), p. 129. Academic Press, New York, 1977. 24. M. Freeling, Genetics 81, 641 11975). 25. M. Freeling and J. C. Woodman, in “The Plant Seed” (I. Rubenstein, R. L. Phillips, C. E. Green, and B. G. Gengenbach, eds.), p. 85. Academic Press, New York, 1979. 26. M. Freeling and D. S. K. Cheng, Genet. Res. 31, 107 (1978). 27. R. L. Larson, Phytochemistry 10, 3073 (1971). 28. R. L. Larson and C. M. Lonergan, Cereal Res. Cornrnun. 1, 13 (1973). 29. H. Grisebach, in “Chemistry and Biochemistry of Plant Pigments” (T. W. Goodwin, ed.), p. 279. Academic Press, New York, 1965. 30. A. Sutter and H. Grisebach, Biochirn. Biophys. Acta 309, 289 (1973). 31. M. G. Neuffer, L. Jones, and M. S.Zuber, “The Mutants of Maize.” Crop Science Society of America, Madison, Wisconsin, 1968. 32. H. K. Dooner and 0. E. Nelson, Biochem. Genet. 15, 509 (1977). 33. H. K. Dooner and 0. E. Nelson, Genetics 91, 309 (1979). 34. R. L. Larson and E. H. Coe, Proc. XII Inst. Congr. Genet. 1, 131 (1968). 35. R. L. Larson and E. H. Coe, Biochem. Genet. 15, 153 (1977). 36. S. -M. Chen and E. H. Coe, Biochem. Genet. 15, 333 (1977). 37. H. K. Dooner, Genetics 93, 703 (1979). 38. G. M. Reddy and E. H. Coe, Science 138, 149 (1962). 39. L. T. Kirby and E. D. Styles, Can. J . Genet. Cytol. 12, 934 (1970). 40. A. R. Reddy and G. M. Reddy, Curr. Sci. 40, 335 (1971). 41. E. D. Styles and 0. Ceska, Phytochemistry 11, 3019 (1972). 42. E. D. Styles and 0. Ceska, Can. J . Genet. Cytol. 19, 289 (1977). 43. S. McCormick, Biochem. Genet. 16, 777 (1978). 44. H. K. Dooner and 0. E. Nelson, Proc. Natl. Acad. Sci. U.S.A. 74, 5623 (1977). 45. H. K. Dooner and 0. E. Nelson, Proc. Natl. Acad. Sci. U.S.A. 76, 2369 (1979). 46. J . R. S. Fincham and G. R. K. Sastry, Annu. Rev. Genet. 8, 15 (1974). 47. E. T. Mertz, L. S. Bates, and 0. E. Nelson, Science 145, 279 (1964). 48. J . R. Jimenez, in “Proceedings of the High-Lysine Corn Conference” (E. T. Mertz and 0. E. Nelson, eds.). Corn Ind. Res. Found., Washington, D.C., 1966. 49. 0. E. Nelson, E. T. Mertz, and L. S. Bates, Science 150, 1469 (1965). 50. L. W. Hansel, C. Y. Tsai, and 0. E. Nelson, Cereal Chern. 50, 383 (1973). 51. K . S. McWhirter, Maize Genet. Coop. News Lett. 45, 184 (1971). 52. Y . Ma and 0. E. Nelson, Cereal Chem. 52, 412 (1975). 53. K. H. Lee, R. A. Jones, A. Dalby, and C. Y. Tsai, Biochern. Genet. 14, 641 (1976). 54. E. Gianazza, P. G. Righetti, F. Pioli, E. Galante, and C. Soave, Maydica 21, 1 (1976). 55. P. G. Righetti, E. Gianazza, F. Salamini, E. Galante, A. Viotti, and C. Soave, in
368
56. 57. 58. 59. 60. 61. 62. 63. 64. 65. 66. 67. 68. 69. 70. 71. 72. 73. 74. 75. 76. 77. 78. 79. 80. 81. 82. 83. 84. 85. 86. 87. 88. 89. 90. 91. 92. 93. 94.
JOHN G . SCANDALIOS AND JAMES A. BAUM
“Electrofocusing and Isotachophoresis” (B. J. Radola and D. Graesslin, eds.), p. 199. Gruyter, Berlin, 1977. P. G. Righetti, E. Gianazza, A. Viotti, and C. Soave, Planta 136, 115 (1977). N. DiFonzo, E. Fornasari, F. Salamini, and C. Soave, Maydica 22, 77 (1977). C. Soave, P. G. Righetti, C. Lorenzoni, E. Gentinetta, and F. Salamini, Maydica 21, 61 (1976). L. A. Manzocchi, M. G. Daminati, and E. Gentinetta, Maydicu 25, 199 (1980). B. Burr and F. A. Burr, Proc. Natl. Acad. Sci. U.S.A. 73, 515 (1976). E. Gentinetta, T. Maggiore, F. Salamini, G. Lorenzoni, F. Pioli, and C. Soave, Maydica 20, 145 (1975). C. Soave, N. Suman, A. Viotti, and F. Salarnini, Theor. Appl. Genet. 52,263 (1978). G. Valentini, C. Soave, and E. Ottaviano, Heredity 42, 33 (1979). A. Viotti, N. E. Pogna, C. Balducci, and M. Durante, Molec. Gen. Genet. 178, 35 (1980). C. Y. Tsai, B. A. Larkins, and D. V. Glover, Biochem. Genet. 16, 883 (1978). R. A. Jones, Biochem. Genet. 16, 27 (1978). C. Y. Tsai, D. M. Huber, and H. L. Warren, Plant Physiol. 66, 330 (1980). C. M. Wilson, Biochem. Genet. 9, 53 (1973). C. M. Wilson, in “Maize Breeding and Genetics” (D. B. Walden, ed.), p. 405. Wiley, New York, 1978. L. A. Manzocchi, M. G. Daminati, E. Gentinetta, and F. Salamini, Maydica 25, 105 (1980). M. G. Neuffer and W. F. Sheridan, Genetics 95, 929 (1980). W. F. Sheridan and M. G. Neuffer, Genetics 95, 945 (1980). A. Dalby and C. Y. Tsai, Crop Sci. 15, 513 (1975). D. V. Glover, P. L. Crane, P. S. Misra, and E. T. Mertz, in “High-Quality Protein Maize,” Purdue University and the International Maize and Wheat Improvement Center, p. 228. Dowden, Hutchison and Ross, Stroudsburg, Pa., 1975. P. S. Misra, E. T. Mertz, and D. V. Glover, Cereal Chem. 52, 161 (1975). R. G. Creech, Genetics 51, 1175 (1965). T. Akatsuka and 0. E. Nelson, J . Biol. Chem. 241, 2280 (1965). C. Y. Tsai, Biochem. Genet. 11, 83 (1974). C. Y. Tsai and 0. E. Nelson, Science 151, 341 (1966). D. B. Dickinson and J. Preiss, Plant Physiol. 44, 1058 (1969). L. C. Hannah and 0. E. Nelson, Plant Physiol. 55, 297 (1975). W. H. Bryce and 0. E. Nelson, Plant Physiol. 63, 312 (1979). J. Preiss, C. Lammel, and A. Sabraw, Plant Physiol. 47, 104 (1971). L. C. Hannah, D. M. Tuschall, and R. J. Mans, Genetics 95, 961 (1980). P. S. Chourey and 0. E. Nelson, Biochem. Genet. 14, 1041 (1976). B. Burr and 0. E. Nelson, Ann. N.Y. Acad. Sci. 210, 129 (1973). C. M. Wilson, Plant Physiot. 66, 119 (1980). C. F. Konzak, in “Advances in Genetics” (E. W. Caspari, ed.) Vol. 19, p. 407. Academic Press, New York, 1977. R. Singh and J. D. Axtell, Crop Sci. 13, 535 (1973). R. N. Oram, H. Doll, and B. Koie, Hereditus 80, 53 (1975). P. R. Shewry, H. M. Pratt, R. A. Finch, and B. J. Miflin, Heredity 40, 463 (1978). H. Doll and A. D. H. Brown, Can. J . Genet. Cytol. 21, 391 (1979). P. R. Shewry, A. J . Faulks, R. A. Pickering, I. T. Jones, R. A. Finch, and B. J . Miflin, Heredity 44,383 (1980). K. E. Karlsson, Barley Genet. News Lett. 7, 40 (1977).
REGULATORY GENE VARIATION I N HIGHER PLANTS
369
95. J . Jensen, Euphytica 28, 47 (1979). 96. S. E. Ulrich and R. F. Eslick, Crop Sci. 18, 828 (1978). 97. B. J . Miflin and P. R. Shewry, in “Recent Advances in the Biochemistry of Cereals” (D. Laidman and R. G. Wyn Jones, eds.), p. 239. Academic Press, New York, 1979. 98. P. R. Shewry, A. J. Faulks, and B. J. Miflin, Biochem. Genet. 18, 133 (1980). 99. H. Doll, Hereditas 93, 217 (1980). 100. H. Bansal, Curr. Sci. 39, 494 (1970). 101. H. C. Bansal, ISNA Newslett. 2, 10 (1972). 102. N. Di Fonzo and A. M. Stanca, Genet. Agr. 31, 401 (1977). 103. D. R. Davies, Biochern Genet. 18, 1207 (1980). 104. T. -H. D. Ho, S. -C. Shih and A. Kleinhofs, Plant Physiol. 66, 153 (1980). 105. C. S. Robichaud and I. Sussex, Plant Physiol. 63, ,9200 (1979). 106. G. N. Fick and C. 0. Qualset, Proc. Natl. Acad. Sci. U.S.A. 72, 892 (1975). 107. R. L. Malmberg, Genetics 92, 215 (1979). 108. R. L. Malmberg, Cell 22, 603 (1980). 109. F. J. Oosindier-Braaksma and W. J. Feenstra, Mutat. Res. 19, 175 (1973). 110. R. L. Warner, C. J. Lin, and A. Kleinhofs, Nature (London) 269, 406 (1977). 111. A. J. Muller and R. Grafe, Molec. Gen. Genet. 161, 67 (1978). 112. A. Kleinhofs, T. Kuo, and R. L. Warner, Molec. Gen. Genet. 177, 421 (1980). 113. P. S. Carlson, Science 180, 1366 (1973). 114. J. M. Widholm, Crop Sci. 17, 597 (1977). 115. J. Carlson and J. Widholm, Physiol. Plant. 44, 251 (1978). 116. P. Maliga, A. Breznovits, and L. Marton, Nature (London) New Biol. 244, 29 (1973). 117. A. Savage, J. King, and 0. Gamborg, Plant Sci. Lett. 16, 367 (1979). 118. J. H. Sherrard, D. L. Green, L. B. Swinden, and M. J. Dalling, Biochem. Genet. 14, 905 (1976). 119. G. Wolf, J. Rimpau, and T. Lelley, Genetics 86,597 (1977). 120. R. A. Bray, Maize Genet. Coop. News Lett. 38, 134 (1964). 121. J. L. Kermicle, Science 208, 1457 (1980). 122. J. G. Scandalios, Annu. Rev. Plant Physiol. 25, 225-258. 123. C. L. Markert (ed.), “Isozymes,” Vol. 3. Academic Press, New York, 1975. 124. J. G. Scandalios, in “Physiological Genetics” (J. G. Scandalios, ed.), p. 63. Academic Press, New York, 1979. 125. J. G. Scandalios, W. -F. Tong, and D. G. Roupakias, Molec. Gen. Genet. 179, 33 (1980). 126. R. S. Holmes and C. J. Masters, in “Isozymes: Current Topics in Biological and
Medical Research” (M. C. Rattazzi, J. G. Scandalios, and G. S. Whitt, eds.), Vol.
3, p. 53. Liss, New York, 1979). 127. P. E. Highfield and R. J . Ellis, Nature (London)271, 420 (1978). 128. A. R. Cashmore, M. K. Broadhurst, and R. E. Gray, Proc. Natl. Acad. Sci. U.S.A. 75, 655 (1978). 129. J. R. Bedbrook, S. M. Smith, and R. J . Ellis, Nature (London)287, 692 (1980). 130. J. A. Matthews and B. J. Miflin, Plunta 149, 262 (1980). 131. T. J . V. Higgins and D. Spencer, Plant Physiol. 67, 205 (1981). 132. B. A. Larkins and W. J. Hurkman, Plant Physiol. 62, 256 (1978). 133. D. Spencer, T. J. V. Higgins, S. C. Button, and R. A. Davey, Plant Physiol. 66, 510 (1980). 134. G. W. Schmidt, A. Devilliers-Thiery, H. Desruisseaux, G. Blobel, and N. -H. Chua, J . Cell Biol. 83, 615 (1979).
370
JOHN G . SCANDALIOS AND JAMES A. BAUM
135. F. A. Burr and B. Burr, in “The Plant Seed” (I. Rubenstein, R. L. Phillips, C. E. Green, and B. G. Gengenbach, eds.), p. 27. Academic Press, New York, 1979. 136. J. G. Scandalios, J . Hered. 65, 28 (1974). 137. J. C. Sorenson and J. G. Scandalios, Biochem. Biophys. Res. Commun. 63, 239 (1975). 138. J. C. Sorenson and J. G. Scandalios, Plant Physiol. 66, 688 (1980). 139. A. S. Tsaftaris and J. C. Sorenson, Plant Sci. Lett. 20, 147 (1980). 140. K. Paigen, R. T. Swank, S. Tomino, and R. E. Ganschow, J . Cell Physiol. 85, 379 (1975). 141. M. P. Calos and J. H. Miller, Cell 20, 579 (1980). 142. G. Kohler and C. Milstein, Nature (London) 256, 495 (1975). 143. G. Kohler and C. Milstein, Eur. J . Zmmunol. 6, 511 (1976). 144. S. -P. Kwan, D. E. Yelton, and M. D. Scharff, in “Genetic Engineering” ( J . K. Setlow and A. Hollaender, eds.), Vol. 2, p. 31. Plenum, New York, 1980. 145. S. R. Yalow, Science 200, 1236 (1978). 146. G. E. Abraham, “Handbook of Radioimmunoassay.” Dekker, New York, 1977. 147. C. B. Laurell, Anal. Biochem. 15, 45 (1966). 148. J. Daussant, C. Lauriere, N. Carfantan, and A. Skakoun, in “Regulation of Enzyme Synthesis and Activity in Higher Plants” (H. Smith, ed.), p. 197. Academic Press, New York, 1977. 149. J. Daussant and A. Skakoun, in “Isozymes: Current Topics in Biological and Medical Research” (M. C. Rattazzi, J. G. Scandalios, and G. S.Whitt, eds.). Liss, New York, in press. 150. D. Parke and P. S. Carlson, in “Physiological Genetics” (J. G. Scandalios, ed.), p. 195. Academic Press, New York, 1979. 151. T. Zehavi-Willner and C. D. Lane, Cell 11, 683 (1977). 152. C. D. Lane, S. Shannon, and R. Craig, Eur. J . Biochem. 101, 485 (1979). 153. A. Colman and J . Morser, Cell 17, 517 (1979). 154. C. D. Lane, A. Colman, T. Mohun, J. Morser, J. Champion, I. Kourides, R. Craig, S. Higgins, T. C. James, S. W. Applebaum, R. I. Ohlsson, E. Paucha, M. Houghton, J. Matthews, and B. J. Miflin, Eur. J . Biochem. 111, 225 (1980). 155. S. J. Flint, in “Genetics Engineering” (J. K. Setlow and A. Hollaender, eds.), Vol. 2, p. 47. Plenum, New York, 1980. 156. B. Burr, in “Genetic Engineering.” ( J . K. Setlow and A. Hollaender, eds.), Vol. 2, p. 21. Plenum, New York, 1980.
INDEX A
Ah complex comparison with immunoglobulin system clinical disease, 33-34 initiation of programming in control animal, 32-33 overlapping specificities, 34-39 phylogenetic expression, 33 reciprocal relationship between P450 and immune system, 34 early studies, 8-11 evidence for multiple structural gene products, 16-26 linkage, 11 pleiotypic response of Ah locus, 11-13 regulation by Ah cytosolic receptor, 13-16 suggestive evidence for temporal genes, 26-27
C Catalase genes, tissue specific expression of, 362-363 Cytochrome P-450 immune system and, 34 multiple forms of, 7-8 nature of, 3-4 number of forms of, 40
Drosophila, search for nonsense suppressors in, 154-155 Drug-metabolizing enzymes other, multiple forms of, 39 phase I and phase 11, 2-3 research directions. 40-42
E Environmental adversity, means of coping with diversity in organism in responses, 29-31 rapid responses, 27-28
G
Gene(s) tRNA localization by in situ hybridization, 127-134 number and diversity of, 126-127 structure of, 134-140 Gene expression quantitative and temporal regulation, 348-349 model gene-protein systems, 349-359 other systems, 359-361 spatial regulation tissue specific expression of catalase genes, 362-363 tissue specificity and the R locus of maize, 361-362
D DNA, repair, induced mutagenesis and, 190-204
I Immunoglobulin system, comparison with Ah complex 371
372
INDEX
clinical disease, 33-34 initiation of programming in control animal, 32-33 overlapping specificities, 34-39 phylogenetic expression, 33 reciprocal relationship between P-450 and immune system, 34
M Maize, R locus, tissue specificity and, 361-362 Meiosis mutation rate during, 216-217 in triticales, 291-307 Mitochondria, mutagenesis of, 217-220 Mitosis, in triticales, 287-291 Monooxygenase activity, nature of, 4-7 Mutagen, specificity, nonrandomness and, 204-211 Mutagenesis, in Saccharomyces cerevisiae comparison with other organisms, 228-240 experimental methods, 174-186 induced, 186-211 mechanisms of induction, 220-228 mitochondrial, 217-220 spontaneous, 211-217
P Plasmids, tRNA gene structure and, 134-140 Proteinb), subcellular compartmentation Of, 363-364
R Ribosomal genes measurements of transcription and translation of, 77-78 expression of r-protein genes, 80-82 expression of rRNA genes, 78-80 gene dosage experiments, 82-85 regulation of transcription, 102-107 Ribosomal protein genes, expression of, 80-82 Ribosomal protein synthesis, autogenous regulation
identification of proteins, 85-92 mechanisms for, 92-98 significance of, 98-102 Ribosomal RNA genes, expression of, 78-80 Ribosome(s) of E . coli fine structure analysis of rRNA and r-protein operons, 62-65 implications of genetic organization of r-protein, 65-77 isolation of mutants, 61-62 phenomenological description of accumulation, 54-55 growth rate-dependent regulation, 55-59 stringent response, 59-60 Ribosome synthesis, regulation, current status of understanding of, 107-110 S
Saccharomyces cerevisiae experimental methods for mutagenesis estimation of mutation frequencies, 178-186 mutant strains, 174-178 induced mutagenesis misrepair and misreplication, 186-190 nonrandomness and mutagen specificity, 204-211 relationship to DNA repair, 190-204 mechanisms of induced mutagenesis dose-response kinetics, 227-228 formation of pure mutant clones, 223-224 inducibility of mutagenic process, 227 time of mutation induction, 220-223 untargeted mutagenesis, 224-227 mitochondrial mutagenesis in, 217-220 spontaneous mutagenesis genetic analysis, 211-216 mutation rate during meiosis, 2 16-2 17
INDEX
T Transfer RNA genes, structure of, 134-140 isoacceptors and development, 140-147 localization of genes by in situ hybridization, 127-134 mutants, 147-148 lethal-meander, 1(2)me, 150-152 minutes, 148-150 number and diversity of genes for, 126-127 suppression and, 152-154 search for nonsense suppressors in Drosophila, 154-155 suppressor of sable, su(s), 1-0, 155-161 Triticale(s1 aneuploidy in contribution of wheat and rye chromosomes, 311-312 frequency of, 307-309 general conclusions, 312 transmission of, 310-311 cytology of meiosis and, 291-307 mitosis and, 287-291 historical background, 256-258 improvement and assessment of hexaploid strains
373 derivation of secondary hexaploids, 272-273 hybrid necrosis-a limiting factor, 278-279 possible bases for superiority of secondary hexaploids, 279-281 role of D genome in evolution of hexaploids, 274-278 role of triple hybrids, 282 use of male sterile wheat, 282-283 ploidy levels decaploid, 265 hexaploid, 270-271 octoploid, 265-270 tetraploid, 271-272 problems, progress and possibilities, 312-313 commercially released varieties, 323-326 diseases, 319-320 kernel shriveling, 314-319 meiotic instability, aneuploidy and sterility, 313-314 nutritive aspects, 320-323 taxonomy, 258-262 terminology, 262-265 tetraploid chromosome analysis of, 285-286 development of secondary tetraploids, 286 production of tetraploids, 283-285 utility of tetraploids, 286-287