ORAL CANCER RESEARCH ADVANCES No part of this digital document may be reproduced, stored in a retrieval system or transmitted in any form or by any means. The publisher has taken reasonable care in the preparation of this digital document, but makes no expressed or implied warranty of any kind and assumes no responsibility for any errors or omissions. No liability is assumed for incidental or consequential damages in connection with or arising out of information contained herein. This digital document is sold with the clear understanding that the publisher is not engaged in rendering legal, medical or any other professional services.
ORAL CANCER RESEARCH ADVANCES
ALEXIOS P. NIKOLAKAKOS EDITOR
Nova Biomedical Books New York
Copyright © 2007 by Nova Science Publishers, Inc.
All rights reserved. No part of this book may be reproduced, stored in a retrieval system or transmitted in any form or by any means: electronic, electrostatic, magnetic, tape, mechanical photocopying, recording or otherwise without the written permission of the Publisher. For permission to use material from this book please contact us: Telephone 631-231-7269; Fax 631-231-8175 Web Site: http://www.novapublishers.com NOTICE TO THE READER The Publisher has taken reasonable care in the preparation of this book, but makes no expressed or implied warranty of any kind and assumes no responsibility for any errors or omissions. No liability is assumed for incidental or consequential damages in connection with or arising out of information contained in this book. The Publisher shall not be liable for any special, consequential, or exemplary damages resulting, in whole or in part, from the readers’ use of, or reliance upon, this material. Independent verification should be sought for any data, advice or recommendations contained in this book. In addition, no responsibility is assumed by the publisher for any injury and/or damage to persons or property arising from any methods, products, instructions, ideas or otherwise contained in this publication. This publication is designed to provide accurate and authoritative information with regard to the subject matter covered herein. It is sold with the clear understanding that the Publisher is not engaged in rendering legal or any other professional services. If legal or any other expert assistance is required, the services of a competent person should be sought. FROM A DECLARATION OF PARTICIPANTS JOINTLY ADOPTED BY A COMMITTEE OF THE AMERICAN BAR ASSOCIATION AND A COMMITTEE OF PUBLISHERS. LIBRARY OF CONGRESS CATALOGING-IN-PUBLICATION DATA Oral cancer research advances / Alexios P. Nikolakakos, editor. p. ; cm Includes bibliographical references and index. ISBN 13: 978-1-60741-924-2 (E-Book) 1. Mouth--Cancer. 2. Head--Cancer. 3. Neck--Cancer. I Nikoladados, Alexios P. [DNLM: 1. Mouth Neoplasms. 2. Head and Neck Neoplasms. 3. Mouth Neoplasms-genetics. WU 280 0632 2007] RC280. M60725 2007-11-07 616.99’491--dc22 2007026603
Published by Nova Science Publishers, Inc.
New York
CONTENTS Preface
ix
Chapter 1
Effective Administration Methods of 5-Aminolevulinic Acid as a Photosensitizer in Photodynamic Therapy for Tongue Tumor 1 Toshiyuki Ogasawara, Norio Miyoshi, Kazuo Sano, Hidetaka Kinoshita, Tetsushi Yamada, Toru Ogawa, Kazuki Miyauchi and Yoshimasa Kitagawa
Chapter 2
Relationships Between Biological and Clinicopathologic Features in Esophageal Carcinoma Takuma Nomiya, Kenji Nemoto and Shogo Yamada
Chapter 3
Prognostic Indicators in Oral Squamous Cell Carcinoma Márcio Diniz-Freitas, Eva Otero-Rey, Andrés Blanco-Carrión, Tomás García-Caballero, José Manuel-Gándara Rey and Abel GarcíaGarcía
Chapter 4
Tumor-Targeting Non-Viral Gene Therapy for the Treatment of Oral Cancer Yoshiyuki Hattori and Yoshie Maitani
11 51
95
Chapter 5
New Diagnostic Imaging Modalities for Oral Cancers Yasuhiro Morimoto, Tatsurou Tanaka, Izumi Yoshioka, Yoshihiro Yamashita, Souichi Hirashima, Masaaki Kodama, Wataru Ariyoshi, Taiki Tomoyose, Norihiko Furuta, Manabu Habu, Sachiko Okabe, Shinji Kito, Masafumi Oda, Hirohito Kuroiwa, Nao Wakasugi, Tetsu Takahashi and Kazuhiro Tominaga
Chapter 6
The Role of the Percutaneous Endoscopic Gastrostomy in the Management of Head and Neck Malignancy CME Avery
155
The Biomechanical Basis for Internal Fixation of the Radial Osteocutaneous Donor Site CME Avery
183
Chapter 7
125
Chapter 8
Contents
vii
The Current Role of Prophylactic Internal Fixation of the Radial Osteocutaneous Donor Site CME Avery
195
Chapter 9
Cytologic Diagnosis of Oral Malignancies: Scope and Limitations Dilip K. Das
Chapter 10
Benign and Malignant Tumors Occurring in the Pterygopalatine Fossa and Adjacent Structures of the Pterygopalatine Fossa: Recent Advances of Diagnosis and Surgical Management Xin-Chun Jian
Chapter 11
Molecular Aspects of Oral Cancer: the Role of Phase I and II Biotransformation Enzymes in Carcinogenesis Karin Soares Gonçalves Cunha and Dennis de Carvalho Ferreira
211
229
247
Chapter 12
TP53 Mutation, c-myc Amplification and Squamous Cell Carcinoma Recurrence 263 J. Seoane, P. Varela-Centelles, M.A. Romero , A. De la Cruz, F. Barros, L. Loidi and J.L. López Cedrún
Chapter 13
Recent Advances and Future Prospects Upon the Arterial Framework of the Face and Related Applications for Facial Flaps Egidio Riggio
Index
275 285
PREFACE Oral cancer is any cancerous tissue growth located in the mouth. It may arise as a primary lesion originating in any of the oral tissues, by metastasis from a distant site of origin, or by extension from a neighboring anatomic structure, such as the nasal cavity or the maxillary sinus. Oral cancers may originate in any of the tissues of the mouth, and may be of varied histologic types: teratoma, adenocarcinoma derived from a major or minor salivary gland, lymphoma from tonsillar or other lymphoid tissue, or melanoma from the pigment producing cells of the oral mucosa. Far and away the most common oral cancer is squamous cell carcinoma, originating in the tissues that line the mouth and lips. Oral or mouth cancer most commonly involves the tissue of the lips or the tongue. It may also occur on the floor of the mouth, cheek lining, gingiva (gums), or palate (roof of the mouth). Most oral cancers look very similar under the microscope and are called squamous cell carcinoma. These are malignant and tend to spread rapidly. This new book presents important research from around the world. Chapter 1 - Objective: Photodynamic therapy (PDT) is a promising cancer treatment in which a photosensitizing drug accumulates in tumors and is subsequently activated by visible light of an appropriate wavelength matched to the absorption. The advantages of this method, as compared to other conventional cancer treatment modalities, are its low systemic toxicity and its ability to destroy tumors selectively. 5-aminolevulinic acid (ALA)-induced protoporphyrin-IX (PpIX) has been used as a photosensitizer in PDT for oral cancer, which advantage is low side effect compared to other photosensitizer. This study investigates the optimal method of administrating ALA by analyzing PpIX fluorescence in tongue tumor tissue. Methods: PpIX intensities in the mouse (C3H) transplanted tongue cancer (NR-S1) were compared with those in normal tongue after intraperitoneal (i.p.), oral (p.o.), or topical administration of ALA. Tongues were sampled at various times after ALA administration. PpIX intensities were obtained from frozen sections of each sample by using a spectrophotometer. Results: PpIX intensity in the tumor group peaked at 3 h after the i.p. and 5 h after the p.o. administration of ALA, and these levels were about twice as high as those in the normal group. Maximum PpIX accumulation in the tongue tumor tissue was seen at 5 h after the oral
x
Alexios P. Nikolakakos
administration of ALA. In contrast, the topical administration of 20% ALA cream was associated with the lowest PpIX accumulation in the tumor throughout the experiments. Conclusion: Based on these results, most effective administration route of ALA was oral administration and 5 h after administration was regarded to be the optimal time for light irradiation in ALA-PDT. Chapter 2 - The clinical characteristics and radiosensitivity of esophageal cancer differ individually, even in individuals with the same histopathological type. Several investigators have reported that prognosis of patients with esophageal carcinoma differs according to its macroscopic appearance, and it has been shown that macroscopically infiltrative type (like scirrhous type in gastric cancer) is radioresistant and that its prognosis is extremely poor compared to that of macroscopically localized type. The major factors that are thought to have a potent impact on radiosensitivity of a tumor are cell proliferation activity, tumor oxygenation, genetic repair, and intrinsic radiosensitivity. In our study, Ki67, CD34, vascular endothelial growth factor (VEGF), thymidine phosphorylase (TP) and metallothionein (MT) expressions and microvascular density were evaluated using surgically resected esophageal squamous cell carcinomas without preoperative treatment. Microvascular density (MVD) was evaluated in different ways: average-MVD was estimated as an index of tumor oxygenation, and highest-MVD was estimated as an index of the most active neovascularization in the tumor. In the analysis of proliferation activity (Ki67 labeling index), proliferation activity of the radiosensitive group of esophageal carcinomas was higher than that of the radioresistant group of esophageal carcinomas. In the analysis of microvascular density, average-MVD of macroscopically infiltrative type was significantly lower than that of localized type, whereas highest-MVD of macroscopically infiltrative type was significantly higher than that of localized type. The VEGF expression level of infiltrative type was significantly higher than that of localized type. A significant positive correlation was found between highest microvascular density and VEGF expression, and a borderline significant negative correlation was found between average microvascular density and expression of VEGF. TP expression showed a positive correlation with highest-MVD, but the correlation was not as strong as that of VEGF expression. In the analysis of MT, which is recognized as a protein that has a radioprotective effect, expression of MT was not increased in esophageal carcinoma of the radioresistant group. Metallothionein expression was increased in the radiosensitive group. Furthermore, expression of MT was not increased in preoperatively treated esophageal carcinomas. These results suggested that MT does not have a great impact on clinical radiosensitivity in esophageal carcinoma and also suggested that MT expression is not induced by therapeutic irradiation or anticancer agents. The results suggest that radioresistant type is poorly oxygenated by low average-MVD, includes a large amount of hypoxic fraction that is refractory to treatment, shows induction of angiogenic factors and activated neovascularization, and has a high rate of hematogenous metastasis. Tumor oxygenation and presence of a hypoxic fraction seem to have great importance for curability of esophageal carcinoma compared to various other factors the authors have investigated. Chapter 3 - Every year, more than 300,000 new cases of oral cancer are diagnosed worldwide. Oral squamous cell carcinomas (OSCCs) make up about 90 - 95% of these cases.
Preface
xi
Despite intensive research into treatment modalities for oral cancer, the 5-year survival rate has shown little improvement in recent decades. One of the reasons for this is that the TNM classification system (the conventional basis for treatment decisions, in conjunction with histological tumor grade) has proved not to be a consistently good predictor of prognosis. There is thus a pressing need for research into new prognostic indicators, with the aim of enabling the evaluation of the biological aggressiveness of each patient's particular tumor/s. In recent decades, considerable research effort has been dedicated to the identification of new markers of OSCC, with the aim of better predicting tumor behavior and clinical course. Certainly, an improved knowledge of the different biological mechanisms participating in carcinogenesis, as well as of cell proliferation, apoptosis, tumor growth and tumor invasive capacity, may assist individual diagnosis, and help in the development of new treatment strategies. The aim of the present chapter is to briefly review the use of tumor markers for prediction of the biological behavior of OSCCs. The review is divided into three parts, considering first clinical markers, then histological markers, and finally immunohistochemical markers. Chapter 4 - Despite advances in surgery, radiotherapy, and chemotherapy, the survival of patients with oral squamous cell carcinoma has not significantly improved over the past several decades. Gene therapy has the potential for the treatment of oral cancer. Cancer gene therapy is currently being met with the development of non-viral vectors, because non-viral vectors have a much lower potential for an adverse inflammatory or immune reaction, compared with viral vectors. For gene delivery, oral cancer is a particular appropriate target since it can be applied by direct injection. Also since folate and transferrin receptors are frequently overexpressed on oral tumors such as nasopharyngeal tumor and head and neck of squamous cell carcinoma, folic acid and transferrin have been utilized as a ligand for tumortargeting gene delivery. Non-viral vectors conjugated to these ligands have been used as carriers of therapeutic DNA to targeted oral tumor. The strategies are used for inactivation of oncogene expression, introduction of tumor suppressor genes, and introduction of a gene that enable to a prodrug to be activated into an active cytotoxic drug. In this review, the authors outline tumor-targeting liposome and lipid-based nanoparticle vectors, and discuss the effectiveness as these non-viral vectors for DNA transfection and for gene therapy to treat human oral tumors. Chapter 5 - This article reviews the use of imaging modalities; both commonly used and recently introduced, to evaluate oral cancers and their lymph node metastases. Magnetic resonance images (MRI) and X-ray computed tomography (CT) images are used to determine the size, invasive area, and possible pathology of primary cancers. In addition, the two modalities are useful for staging and detecting clinically occult lymph node metastases at different levels of the neck. In particular, a follow-up MR examination method, dynamic MR sialography, for patients with xerostomia after radiation therapy is introduced, and the use of fusion images of the tumors and vessels using three-dimensional fast asymmetric spin-echo (3D-FASE) and MR angiography is discussed. Furthermore, ultrasound imaging (US), in addition to its use for staging and detecting clinically occult lymph node metastases, plays an important role in confirming intra-operative surgical clearance of tongue carcinomas. In addition, the role of US-guided, fine-needle aspiration biology is also reviewed. Finally, the
xii
Alexios P. Nikolakakos
role and limitations of fusion images obtained from positron emission tomography (PET) and CT (PET-CT), which are currently used worldwide, are discussed. Chapter 6 - This chapter reviews the role of the percutaneous endoscopic gastrostomy (PEG) for providing nutritional support in the management of oral cancer. An assessment of the current use of the PEG technique is based on an analysis of the prospective operating series of the author. Insertion of a PEG was attempted on 200 occasions, mainly for malignancy of the oral cavity but also the oropharynx, and some benign pathology and trauma. Seventy-six percent (152/200) of gastrostomies were inserted at the time of definitive surgical treatment and 19.5% (39/200) were inserted at an examination under anaesthesia, often prior to radiotherapy. Five percent (10/200) of procedures had significant endoscopic findings including one synchronous malignancy. The rate of successful insertion was 97% (194/200). The incidence of minor and major complications was 12.5% (25/200) and 3% (6/200) respectively. There was no procedure related mortality. The overall 30-day mortality rate was 7% (10/200) including deaths from terminal disease. Those at increased risk of death were 65 years and over (P=0.005). The median PEG duration was 287 (SE 37) days. Duration was significantly longer for stage T3-4 tumours (P=0.01), N1 or greater neck disease (P=0.02), following surgery with radiotherapy when compared to surgery alone (P<0.001), particularly for hemiglossectomy (P=0.02) and maxillectomy procedures (P=0.003), following a segmental composite bone resection rather than a soft tissue resection, with or without a rim resection, (P=0.03) and finally radiotherapy alone when compared to surgery alone (P=0.004). There was no obvious relationship to age or the type of free flap. Four (2.1%) patients have a gastrostomy that is likely to be permanent. Only two patients did not use the gastrostomy. All patients with T3 and T4 oropharyngeal tumours undergoing radiotherapy or with oral tumours that required reconstruction with a free or pedicled flap were offered a PEG on the basis that nutritional support would be required for more than 2 to 4 weeks. This included T2 tumours without neck disease (stage II disease) if the site of the tumour is likely to have a significant effect on function and hence a flap reconstruction is indicated. The policy of early gastrostomy placement appears to be appropriate. However, the exact pattern of use of the gastrostomy during the various phases of treatment remains to be defined. The insertion of a PEG may be safely performed with a high degree of success and a low incidence of complications by an experienced maxillofacial surgeon. Chapter 7 - Fracture of the radial free flap osteocutaneous donor site is common and causes considerable morbidity. Most fractures are probably caused by relatively low-energy torsional forces. This complication has lead to reduced use of the flap in clinical practice. However, the incidence of fracture may be reduced by placing a bone plate, at the site of the section defect, at the time of harvesting the flap. Both anterior and posterior surgical approaches have been described. The strengthening effect of different types of plate and position were studied using the sheep tibia as a model for the radial osteocutaneous donor site. Fifty matched pairs of adult sheep tibias were tested in torsion and 4-point bending. The weakening effect of an osteotomy was first assessed by comparing an osteotomised bone with an intact bone. Then pairs of bones with an osteotomy were compared with and without
Preface
xiii
reinforcement with different types of 3.5mm plate. The plate was placed in either the anterior (over the defect) or posterior (on the intact cortex) position. An osteotomised bone was significantly weaker than an intact bone. A plate in either the anterior or posterior position significantly strengthened an osteotomised bone. The dynamic compression plate was the strongest reinforcement in both torsion and bending. In torsion the mean strength of the intact bone was 45% greater than after osteotomy (P=0.02). The reinforced bone was on average 61% stronger than the unreinforced bone (P<0.001). Plating restored the strength of the osteotomised bone to that of an intact bone (100%) with a plate in either the anterior (97%) or posterior position (101%). The tibia was able to withstand much greater loads in bending. In bending the mean strength of the intact bone was 188% greater than after osteotomy (P=0.02). The reinforced bone was on average 184% stronger then the unreinforced bone (P<0.001). The posterior plate (80%) had a significantly greater effect than an anterior plate (46%) in restoring the strength of the osteotomised bone to that of an intact bone (100%) (P=0.01). The use of prophylactic internal fixation is recommended for the routine management of the radial osteocutaneous donor site. A plate in the anterior or posterior position will significantly strengthen the donor site and the surgeon may choose either site. The additional strengthening effect of the posterior plate in bending is probably not relevant in clinical practice as the radius is likely to fracture first as a result of lower torsional forces. Chapter 8 - The radial osteocutaneous donor site is dramatically weakened at the site of the osteotomy despite bevelling of the osteotomy cut and limiting the amount of bone removed. Fracture results in considerable morbidity particularly if healing is not ideal. The incidence of fracture remains relatively high, ranging from 0% to 66%, with a mean of 25%. The largest studies have recently reported fracture rates of 15% and 18% and the incidence of secondary surgery, for fractures, was also high, 67% and 46% respectively. Clinical and biomechanical evidence now supports the routine use of prophylactic internal fixation of the radial donor site with a dynamic compression plate to reduce the incidence of fracture and the need for secondary surgery. The plate is effective in either an anterior or posterior position and the choice of site is a matter of surgeon preference. This chapter describes the clinical experience of the author with the anterior approach to internal fixation. In a retrospective review of a series of 28 donor sites the incidence of fracture was 3.6% (1 out of 28). The single fracture was undisplaced and secondary surgery was not indicated. In the literature the incidence of fracture with a plate in the anterior or posterior position is relatively low. To date 268 donor sites have been managed with prophylactic internal fixation and only 7 have fractured, of which only one underwent secondary surgery. The incidence of reported complications related to the technique is also low and very few plates have been replaced or removed. The technique of prophylactic internal fixation allows the surgeon to safely harvest a modest volume of bone, which in conjunction with the excellent soft-tissue paddle means that the radial osteocutaneous flap retains a wide range of potential applications. However, in the current practice of the author, and many others, the radial flap remains a compromise choice or back-up flap. Recent indications have included relatively small defects of the maxilla, older patients that are unlikely to undergo dental implantation, patient preference and if there
xiv
Alexios P. Nikolakakos
is significant peripheral vascular disease or poor general health that will be exacerbated by use of an alternative donor site. Chapter 9 - Cancer of mouth and pharynx is one of the ten most common cancers in the world. Detection of a precancerous or cancerous lesion at an early stage is an important factor to improve 5-year survival rate of oral cancer. A comprehensive physical examination aided by imaging techniques like computed tomography (CT), and magnetic resonance imaging (MRI) are the standard evaluation tools in patients with oral, and pharyngeal neoplasms. Although surgical biopsy and histopathology is considered gold standard for diagnosing the oral lesions, it is impractical to routinely subject large number of patients to biopsy. Whereas oral exfoliative cytology is a useful, economical and practical tool in the diagnosis of oral dysplasia and carcinoma involving cheek, lip and tongue, similar role is played by fine needle aspiration (FNA) cytology for minor salivary gland tumors and other solid neoplasms of the palate, cheek and pharyngeal areas. By brush cytology a spectrum of oral lesions including dysplasia, carcinoma in situ, occult and clinically evident squamous cell carcinoma can be diagnosed. FNA cytology, which collects samples from areas difficult to reach by surgical biopsy, can differentiate benign from malignant tumors and classify them into subtypes. Whereas pleomorphic adenoma is a common benign tumor, adenoid cystic carcinoma, mucous cell carcinoma, acinic cell carcinoma, malignancy in pleomorphic adenoma, and polymorphous low-grade carcinoma are the malignant neoplasms detected in the minor salivary glands. The other oral neoplasms detected by FNA are non-Hodgkin lymphomas, and some rare primary malignancies like sarcomas and chordoma. Metastatic lesions in oral cavity too have been diagnosed by FNA cytology. The efficacy of brush cytology in detection of oral squamous cell carcinoma is very high in majority of reports, which is as follows: sensitivity (84.4 ± 9.97%), specificity (78.6 ± 29.36%), positive predictive value (71.4 ± 31.39%), and negative predictive value (83.0± 16.40%). The sensitivity, specificity, and diagnostic accuracy of FNA cytology for oral malignancies are also high. However, false negative reports are possible with the oral brush cytology technique and some palatal salivary gland tumors are difficult to diagnose by FNA cytology. In difficult situations, ancillary techniques such as cytomorphometry, DNA-cytometry, immunocytochemistry, and molecular tools act as valuable adjunct to cytodiagnostic techniques. Chapter 10 - Surgery in the pterygopalatine fossa region presents anatomic and surgical problems related to the difficulty of access. When a tumor in the pterygopalatine fossa involves the maxilla and extends into the maxillary sinus and a tumor of the deep lobe of the parotid gland extends into the pterygopalatine foss, extensive resection is often necessary. Because of this, there has been a tendency either not to operate on these cases at all or else to carry out simply a partial or piecemeal removal. The current underlying principle of skull base approaches is to minimize brain retraction while maximizing skull base visualization. This concept facilitates three-dimensional tumor resection, tumor margin verification, and functional reconstruction with appropriate esthetic concerns. Current many approaches have been used for the tumor of the middle skull base or the pterygopalatine fossa. With advancements in imaging, diagnostic technology, diagnostic pathology, surgical technology and instrumentation, reconstructive techniques, the surgery of the lateral cranial base or the middle cranial base is now receiving significant attention and interest. It is purpose of this paper to provide readers with an overall review of benign and malignant
Preface
xv
tumors occurring in the pterygopalatine fossa and adjacent structures of the pterygopalatine foss: Recent advances of diagnosis and surgical management. Chapter 11 - Oral cancer is the most common malignant neoplasm of the head and neck and over half of the people who develop this cancer die within five years after the diagnosis. Carcinogenesis is a highly complex process involving both environmental, mainly tobacco and alcohol use, and inherited risk factors. In recent years, inter-individual genetic differences and individual susceptibility to human cancer triggered by environmental exposures has been studied. This environment-gene interaction in carcinogenesis is well reflected by phase I and II enzymes that are involved in the metabolism of carcinogens. Cytochrome P450 family of enzymes (CYP), involved in phase I, converts many carcinogens into DNA-binding metabolites in target cells and can modulate intermediate effect markers such as DNA-adducts. Phase II enzymes, including glutathione S-transferase (GST), Nacetyltransferase (NAT) and others, play important roles in protecting cells from DNA damage by carcinogens and reactive oxygen species. Genetic alterations of these two classes of enzymes have been considered as risk modifiers of some major tobacco-related cancers, including oral cancer. The aim of this chapter is to review the molecular aspects of oral cancer, emphasizing the role of phase I and II enzymes in oral carcinogenesis. Propositions for further researches are highlighted. Chapter 12 - Purpose: to investigate TP53 mutation and c-myc amplification as markers for tumour aggressiveness in terms of tumour recurrence in OSCCs. Methods and materials: Thirty one incident cases of oral squamous cell carcinomas were studied for tumour relapse. The variables considered were demographic, clinical, pathological and genetic. Results: the mean age of 62.09 years (range 36 to 88). Seventeen patients (54.8%) were smokers. The tongue was the main affected area (54.8%). No distant metastases could be identified. Most patients were at early stages of the disease with moderately differentiated tumours and of grade I in Anneroth’s malignancy scale. The oncogene study showed abnormalities in both TP53 (6/31; 19.2%) and c-myc (4/31; 12.9%), that distributed as follows: TP53+/c-myc+ (n=1; 3.2 %); TP53+/c-myc- (n=5; 16.1%); TP53-/c-myc+ (n=3; 9.7 %); TP53-/c-myc- (n=21; 67.7%). TP53 mutations were significantly more frequent in advanced stages. Statistically significant differences in node status were identified in terms of oncogene alterations. Multivariate Cox regression analysis recognized prognostic value for recurrence for alterations of TP53 and c-myc (p<0.05). Conclusions: TP53 mutation is related to advanced stage of oral cancer and suggests the usefulness of analysis of TP53 mutations and c-myc amplifications in order to identify those OSCCs more prone to relapse. Chapter 13 - Coverage of facial defects is frequently challenging. Despite the numerous flaps described, the search for additional flaps with good color match and minimal donor-site morbidity continues and attempts to find valid options to free flaps perhaps overused in the last two decades, in particular for soft tissue replacement of the moderate-to-large perioral resections. The reconstructive research runs through the study of functional topographic or regional anatomy with all the scientific and clinical implications. The article reviews the last reports that are basically focused upon the arterial supply derived from neglected branches of the superficial temporal artery (transverse facial artery, zygomatic-orbital artery, and middle
xvi
Alexios P. Nikolakakos
temporal artery) or the terminal branches of the frontal terminal branch, from the variants of the terminal facial artery and a definite collateral named cutaneous zygomatic branch, or from the submental artery. The up-to-date research embraces the study of the cutaneous perforators of the face. Relevant anterograde or reverse flaps, axial or perforator flaps, and monolayered or multilayered composite flaps are discussed as current, original or still imaginative chances. Moreover, for the realization of totally new flaps in the field of compound facial reconstruction, clinical research efforts should tend to merge with the future perspective of bone and soft-tissue engineering research.
In: Oral Cancer Research Advances Editor: Alexios P. Nikolakakos, pp. 1-10
ISBN 978-1-60021-864-4 © 2007 Nova Science Publishers, Inc.
Chapter 1
EFFECTIVE ADMINISTRATION METHODS OF 5-AMINOLEVULINIC ACID AS A PHOTOSENSITIZER IN PHOTODYNAMIC THERAPY FOR TONGUE TUMOR Toshiyuki Ogasawara1,∗, Norio Miyoshi2, Kazuo Sano1, Hidetaka Kinoshita1, Tetsushi Yamada1, Toru Ogawa1, Kazuki Miyauchi1 and Yoshimasa Kitagawa3 1
Division of Dentistry and Oral Surgery, Department of Sensory and Locomotor Medicine, 2Division of Tumor Pathology, Department of Pathological Sciences, School of Medicine, Faculty of Medical Sciences, University of Fukui, Fukui 910-1193, Japan; 3 Oral Diagnosis and Oral Medicine, Department of Oral Pathobiological Science, Graduate School of Dental Medicine, Hokkaido University, Sapporo 060-8586, Japan.
ABSTRACT Objective: Photodynamic therapy (PDT) is a promising cancer treatment in which a photosensitizing drug accumulates in tumors and is subsequently activated by visible light of an appropriate wavelength matched to the absorption. The advantages of this method, as compared to other conventional cancer treatment modalities, are its low systemic toxicity and its ability to destroy tumors selectively. 5-aminolevulinic acid (ALA)-induced protoporphyrin-IX (PpIX) has been used as a photosensitizer in PDT for oral cancer, which advantage is low side effect compared to other photosensitizer. This study investigates the optimal method of administrating ALA by analyzing PpIX fluorescence in tongue tumor tissue. ∗
Correspondence concerning this article should be addressed to: Toshiyuki Ogasawara, Division of Dentistry and Oral Surgery, Department of Sensory and Locomotor Medicine, School of Medicine, Faculty of Medical Sciences, University of Fukui, 23-3 Matsuokahimoaizuki, Eiheiji, Fukui 910-1193, Japan. Tel: 81-776-613111(ex2409); Fax: 81-776-61-8128; E-mail:
[email protected].
2
Toshiyuki Ogasawara, Norio Miyoshi, Kazuo Sano et al. Methods: PpIX intensities in the mouse (C3H) transplanted tongue cancer (NR-S1) were compared with those in normal tongue after intraperitoneal (i.p.), oral (p.o.), or topical administration of ALA. Tongues were sampled at various times after ALA administration. PpIX intensities were obtained from frozen sections of each sample by using a spectrophotometer. Results: PpIX intensity in the tumor group peaked at 3 h after the i.p. and 5 h after the p.o. administration of ALA, and these levels were about twice as high as those in the normal group. Maximum PpIX accumulation in the tongue tumor tissue was seen at 5 h after the oral administration of ALA. In contrast, the topical administration of 20% ALA cream was associated with the lowest PpIX accumulation in the tumor throughout the experiments. Conclusion: Based on these results, most effective administration route of ALA was oral administration and 5 h after administration was regarded to be the optimal time for light irradiation in ALA-PDT.
Keywords: 5-aminolevulinic acid, protoporphyrin-IX, photodynamic therapy, tongue cancer, spectroscopy, pharmacokinetic
INTRODUCTION Surgery with radiotherapy and / or chemotherapy has been used as the conventional treatment for tongue cancer. However, this treatment causes cosmetic and functional disturbances, especially in the head and neck region. Photodynamic therapy (PDT) is a promising cancer treatment in which a photosensitizing drug accumulates in tumors and is subsequently activated by visible light of an appropriate wavelength matched to the absorption [1]. The advantages of this method, as compared to other conventional cancer treatment modalities, are its low systemic toxicity and its ability to destroy tumors selectively [2]. Photofrin is the most widely used photosensitizer in clinical PDT trials and is the only agent that has been approved for cancer treatment in many countries. However, photofrin remains in the skin and causes photosensitivity lasting several weeks, and the tumor selectivity of this agent is poor [3]. 5-aminolevulinic acid (ALA) is a precursor of protoporphyrin IX (PpIX) in the biosynthetic pathway for heme, and PpIX is an efficient photosensitizer. Today ALA–PDT is successfully used for the treatment of a variety of neoplastic and nonneoplastic diseases [4]. ALA- derived PpIX can be cleared from the body within 24-48 h after systemic ALA administration [5], and because of this rapid clearance, ALA-based PDT would reduce the risk of prolonged skin phototoxicity [6]. The kinetics of ALA-induced PpIX production in different tissues has been studied, typically by means of fluorescence spectroscopic techniques [7]. However, the relationship between the PpIX fluorescent accumulation in oral tumor tissue and the ALA administration methods has not been elucidated. This study investigated the optimal method for administrating ALA in PDT by analyzing PpIX fluorescence in tongue tumor tissue.
Administration Methods of ALA in Tongue Tumors
3
MATERIALS AND METHODS Animals and Tumors Male C3H/HeNCrj mice, 6-8 weeks old, 22-26 g (Charles River, Osaka, Japan) were used in all experiments. An NR-S1 mouse squamous cell carcinoma [8] (National Institute of Radiological Sciences, Chiba, Japan) was transplanted to the mouse tongue, and when the tumor reached a size of at least 3mm x 3mm, the photosensitizer was administered. The photosensitizer was also administered to normal mice as a control.
Chemicals and ALA Administration Route ALA was obtained as a hydrochloride in 98.0% pure powder from Cosmo Oil (Tokyo, Japan). In the intraperitoneal ALA administration group, ALA was freshly dissolved in 0.2 ml of saline and injected at a dose of 250 mg/kg or 500 mg/kg. In the oral ALA administration group, animals were given 250 mg/kg or 500 mg/kg of ALA freshly dissolved in 0.5 ml of saline by means of a gastric tube. In the case of topical ALA administration, an oil-in-water emulsion containing 20% ALA was freshly prepared prior to use. After topical administration of ALA cream to the tongue, animals were maintained under deep anesthesia by pentobarbital sodium to in order to prevent the ALA cream from being washed out or swallowed. Furthermore, two kinds of ALA ester derivative (ALA methyl ester and ALA pentyl ester; Cosmo Oil) were also administrated and compared with topical application. These ALA ester derivatives, are more lipophilic than ALA, and thus may penetrate more easily through the keratinized layer and deeper into tumors than ALA itself [9]. Mice were killed at 1, 3, 4, 5, 6 and 8 h after ALA administration (n=4 animals/time point), and mouse tongue samples were excised. Serial frozen sections (10μm-thick) of each sample were prepared for exact histological localization and quantitative measurement of the concentration of PpIX. PpIX localization was confirmed by fluorescence microscopy (PROVIS-AV80type; Olympus, Tokyo, Japan) by comparing with a hematoxylin-eosin (HE)-stained section. The wavelength width of the excitation filter was in the blue violet region (400-440 nm), and the observation wavelength was more than 475 nm.
Quantitative Measurement of PpIX Fluorescence ProtoporphyrinIX intensities in the mouse transplanted tongue cancer were compared with those in the normal tongue after intraperitoneal, oral, or topical administration of ALA. Levels of PpIX fluorescence were measured with a spectrophotometer [10].
4
Toshiyuki Ogasawara, Norio Miyoshi, Kazuo Sano et al.
Fluorescence emission spectra excited by 410 nm light were obtained from a total of 5 serial frozen sections (10μm-thick) from each sample by using a spectrophotometer (850 type; Hitachi, Tokyo, Japan) equipped with a holder for the particle sample. The subtracted spectrum was obtained by subtracting the background spectrum from the sample raw spectrum. A typical fluorescence spectrum from a tumor showed prominent emission bands at λ=635 nm andλ=705 nm, which corresponded to the standard PpIX spectrum (Figure 1). The PpIX concentration (μM) was calculated from the fluorescence intensity at the 635 nm peak of the sample emission spectrum and a calibration curve of the known concentrations of standard PpIX solution. Standard PpIX aqueous solution was prepared with phosphate-buffered saline solution, cationic surfactant, acetyl-trimethyl-ammonium-bromide and PpIX.
Figure 1. Fluorescence emission spectra excited by 410 nm light are obtained from a total of 5 serial frozen sections (10μm-thick) from each sample by using a spectrophotometer. The no.3 subtracted spectrum was obtained by subtracting the no.2 background spectrum from the no.1 sample raw spectrum. In addition, we confirmed that the no.3 subtracted spectrum pattern corresponded to the no.4 standard PpIX spectrum.
Statistics Groups of normally distributed data were compared using Student`s t-test, while the nonparametric Mann-Whitney test was otherwise employed. Values of <0.05 were considered to indicate statistical significance.
Administration Methods of ALA in Tongue Tumors
5
RESULTS The fluorescence microscopic image showed that the red fluorescence emission of PpIX was distributed strongly and homogeneously in the tongue tumor tissue at 5 h after oral administration of ALA. However, PpIX accumulation was not seen in the necrotic area of the tumor tissue. In addition, there was very weak PpIX accumulation in the normal lingual muscle after administration of ALA.
Figure 2. The PpIX concentration (μM) was calculated from the fluorescence intensity at the 635 nm peak of the subtracted spectrum and a calibration curve of the known concentrations of standard PpIX.
Figure 3. Fluorescence image and corresponding HE-stained image of tongue tumor tissue at 5 h after oral administration of ALA.
The tumor group showed constantly higher PpIX intensities than the normal group throughout the experiments following the i.p. and p.o. administration of ALA. PpIX intensity in the tumor group peaked at 3 h after the i.p. and 5 h after the p.o. administration of ALA, and these peak values were about twice as high as those in the normal group. However, the
6
Toshiyuki Ogasawara, Norio Miyoshi, Kazuo Sano et al.
PpIX intensitiy in the tumor group was not enhanced by an increase in the administrated dose of ALA from 250 mg/kg to 500 mg/kg (Figures 4 and 5). Maximum PpIX accumulation in the tongue tumor tissue was seen at 5 h after the oral administration of ALA (Figure 6). In contrast, the topical administration of 20% ALA cream was associated with the lowest PpIX accumulation in the tumor throughout the experiments (Figure 7). Furthermore, the topical administration of 20% ALA ester derivatives cream (ALA methyl ester and ALA pentyl ester) also resulted in low PpIX accumulation in the tumor, which was not different from the case of topical administration of 20% ALA cream.
Figure 4. PpIX intensity in tongue tissue after intraperitoneal administration of ALA.
Figure 5. PpIX intensity in tongue tissue after oral administration of ALA.
Administration Methods of ALA in Tongue Tumors
7
Figure 6. PpIX intensity in tongue tumor tissue after various types of ALA administration.
Figure 7. PpIX intensity in tongue tissue after topical administration of ALA.
DISCUSSION If the photosensitizer that is administered before light illumination accumulates more highly in tumor tissue, the efficacy of PDT for cancer might be improved. Although photofrin should be used only via intravenous administration, ALA can be used via various
8
Toshiyuki Ogasawara, Norio Miyoshi, Kazuo Sano et al.
administration routes. There have been numerous studies on ALA-induced PpIX fluorescence after a variety of administration routes in various organs. Systemic (intravenous or oral) ALA-based PDT has also been reported for treatment of oral neoplastic lesions [5,11]. However, the optimal administration method of ALA in PDT for oral cancer is still not established. The present study was carried out to determine the most effective route and optimal timing of ALA administration with respect to subsequent therapeutic illumination. In most studies, the techniques used were based on a noninvasive method using a spectrofluorometer or the chemical technique of high pressure liquid chromatography (HPLC) to measure in vivo PpIX fluorescence after administration of ALA. Spectrofluorometry is simple and noninvasive, but can detect only surface emission of the tissue. HPLC can measure the whole tissue, but the resulting values are an average for the whole tissue (more than 1 g) and have no relation to the histopathological findings. Furthermore, the techniques required for this method are complicated [10]. We confirmed the direct detection the PpIX concentrations from the frozen section always in combination with histological staining using cryosamples. Previous studies have shown that the peak of PpIX fluorescence intensity varied between 1 and 6 h after ALA administration in different tissues [5,12,13]. Our present results showed that PpIX intensity in the tongue tumor tissue peaked at 3 h after the intraperitoneal (i.p.) administration of ALA. Another study has also shown that PpIX fluorescence in rat tongue cancer reached a maximum intensity at 3 h after ALA i.p. administration [13]. However, in this study, the maximum PpIX accumulation in the tongue tumor tissue was confirmed at 5 h after oral administration of ALA. Although the reason for this finding is unclear, Mustajoki et al. [14] have shown that a high serum ALA level can be achieved in a human volunteer by continuous enteral infusion of ALA solution. Loh et al. [15] reported that the temporal fluorescence kinetics after oral administration were comparable with that after intravenous injection in the stomach, colon and bladder mucosa of normal rats. Oral administration is considered to be simpler, and it does not require full buffering. ALA can be undertaken by patients themselves, prior to therapy and without supervision [15]. The results of the present study suggested that oral administration was the most effective administration method in ALA-PDT for oral cancer. Furthermore, there was no obvious difference of PpIX intensity between 250 mg/kg and 500 mg/kg after both i.p. or p.o. administration of ALA. Accumulation of PpIX in tongue tumor tissues reaches a plateau after administering at least 250 mg/Kg doses of ALA. Ma et al. [13] reported that early malignant lesions in rat tongue showed complete response to the i.p. administration of ALA-based PDT at both 250 mg/Kg and 1000 mg/Kg. These results suggested that it is not necessary to administer a greater amount of ALA in order to achieve sufficiently high PpIX levels suitable for PDT in oral cancer. Topical ALA-based PDT has been widely used in treating neoplastic lesions of the skin and bladder [4], because local administration of ALA might increase the PpIX concentration in the tumor without unwanted general side effects. It is known that topical application of an oil-in-water emulsion of ALA on the skin lesion can permit penetration of ALA into the lesion and allow synthesis of PpIX [16,17]. Recently, in cases of oral cancer, topical administration of ALA as a rinsing solution has also been tried for ALA-photodynamic diagnosis. However, because there has been no report on the use of topical administration
Administration Methods of ALA in Tongue Tumors
9
ALA-PDT for oral cancer, we here tried topical administration of 20% ALA cream for tongue tumor. Our results showed that PpIX intensity in the tongue tumor after topical administration of ALA cream was not enhanced compared with that in the normal tongue. Several ALA esters have been synthesized, and are more lipophilic than ALA. This higher lipophilicity might result in better penetration into the skin, higher PpIX levels and a more uniform and deeper PpIX distribution [18]. Therefore, we attempted to apply the two kinds of ALA esters for topical administration. However, ALA esters also did not enhance the PpIX intensity in the tongue tumor tissue. Although the reason for this result is unclear, the neutral pH of saliva might cause the immediate degeneration of ALA in the oral mucosa [15,18]. Based on these results, 5 h after oral administration of ALA was regarded to be the optimal time for light irradiation in ALA-PDT.
ACKNOWLEDGEMENT This work was supported by a Grant-in-Aid for Scientific Research (C) (15592104) from Japan Society for the Promotion of Science.
REFERENCES [1] Date M, Sakata I, Fukuchi K et al. (2003). Photodynamic therapy for human oral squamous cell carcinoma and xenografts using a new photosensitizer, PAD-S31. Lasers Surg Med 33: 57-63. [2] Gaullier JM, Berg K, Peng Q et al. (1997). Use of 5-aminolevulinic acid esters to improve photodynamic therapy on cells in culture. Cancer Res 57: 1481-1486. [3] Peng Q, Berg K, Moan J et al. (1997). 5-aminolevulinic acid-based photodynamic therapy: principles and experimental research. Photochem Photobiol 65: 235-251. [4] Peng Q, Warloe T, Berg K et al. (1997). 5-Aminolevulinic acid –based photodynamic therapy. Cancer 79: 2282-2308. [5] Grant WE, Hopper C, MacRobert AJ et al. (1993). Photodynamic therapy of oral cancer:photosensitization with systemic aminolevulinic acid. Lancet 342: 147-148. [6] Webber J, Kessel D, Fromm D (1997). Side effects and photosensitization of human tissue after aminolevulinic acid. J Surg Res 68: 31-37. [7] Stolic S, Tomas SA, Roman-Gallegos E et al. (2002). Kinetic study of δ-Ala induced porphyrins in mice using photoacoustic and fluorescence spectroscopies. J Photochem Photobiol B: Biol 68: 117-122. [8] Usui S, Urano M, Koike S et al (1976). Effect of PSK, a protein polysaccharide, on pulmonary metastasis of C3H mouse squamous cell carcinoma. J Natl Cancer Inst 56: 185-187. [9] Juzenas P, Shafaei S, Moan J et al. (2002). Proitoporphyrin IX fluorescence kinetics in UV-induced tumours and normal skin of hairless mice after topical application of 5aminolevulinic acid methyl ester. J Photochem Photobiol B: Biol 67: 11-17.
10
Toshiyuki Ogasawara, Norio Miyoshi, Kazuo Sano et al.
[10] Miyoshi N, Ogasawara T, Nakano K et al. (2004). In light of recent developments, application of fluorescence spectral analysis in tumor diagnosis. Appl Spectrosc Rev 39: 437-455. [11] Fan KN, Hopper C, Speight PM et al. (1996). Photodynamic therapy using 5aminolevulinic acid for premalignant and malignant lesions of oral cavity. Cancer 78: 1374-1383. [12] Henderson BW, Vaughan L, Bellnier DA et al. (1995). Photosensitization of murine tumor, vasculature and skin by 5-aminolevulinic acid-induced porphyrin. Photochem Photobiol 62: 780-789. [13] Ma G, Ikeda H, Inokuchi T et al. (1999). Effect of photodynamic therapy using 5aminolevulinic acid on 4-nitroquinoline-1-oxide-induced premalignant and malignant lesions of mouse tongue. Oral Oncol 35: 120-124. [14] Mustajoki P, Timonen K, Gorchein A et al. (1992). Sustained high plasma 5aminolevulinic acid concentration in a volunteer: no porphyric symptoms. Euro J Clin Invest 22: 407-411. [15] Loh CS, MacRobert AJ, Bedwell J et al. (1993). Oral versus intravenous administration of 5-aminolaevulinic acid for photodynamic therapy. Br J Cancer 68: 41-51. [16] Kennedy JC, Pottier RH (1992). Endogeneous protoporphyrin IX, a clininically useful photosensitizer for photodynamic therapy. J Photochem Photobiol B 14: 275-292. [17] Szeimies RM, Sassy T, Landthaler M (1994). Penetration potency of topical applied 5aminolevulinic acid for photodynamic therapy of basal cell carcinoma. Photochem Photobiol 59: 73-76. [18] van den Akker JTHM, Lani V, Star WM et al (2000). Topical application of 5aminolevulinic acid hexyl ester and 5-aminolevulinic acid to normal nude mouse skin: differences in protoporphyrin IX fluorescence kinetics and the role of the stratum corneum. Photochem Photobiol 72: 681-689.
In: Oral Cancer Research Advances Editor: Alexios P. Nikolakakos, pp. 11-50
ISBN 978-1-60021-864-4 © 2007 Nova Science Publishers, Inc.
Chapter 2
RELATIONSHIPS BETWEEN BIOLOGICAL AND CLINICOPATHOLOGIC FEATURES IN ESOPHAGEAL CARCINOMA Takuma Nomiya, Kenji Nemoto and Shogo Yamada Department of Radiation Oncology, Yamagata University School of Medicine, Japan.
ABSTRACT The clinical characteristics and radiosensitivity of esophageal cancer differ individually, even in individuals with the same histopathological type. Several investigators have reported that prognosis of patients with esophageal carcinoma differs according to its macroscopic appearance, and it has been shown that macroscopically infiltrative type (like scirrhous type in gastric cancer) is radioresistant and that its prognosis is extremely poor compared to that of macroscopically localized type. The major factors that are thought to have a potent impact on radiosensitivity of a tumor are cell proliferation activity, tumor oxygenation, genetic repair, and intrinsic radiosensitivity. In our study, Ki67, CD34, vascular endothelial growth factor (VEGF), thymidine phosphorylase (TP) and metallothionein (MT) expressions and microvascular density were evaluated using surgically resected esophageal squamous cell carcinomas without preoperative treatment. Microvascular density (MVD) was evaluated in different ways: average-MVD was estimated as an index of tumor oxygenation, and highest-MVD was estimated as an index of the most active neovascularization in the tumor. In the analysis of proliferation activity (Ki67 labeling index), proliferation activity of the radiosensitive group of esophageal carcinomas was higher than that of the radioresistant group of esophageal carcinomas. In the analysis of microvascular density, average-MVD of macroscopically infiltrative type was significantly lower than that of localized type, whereas highest-MVD of macroscopically infiltrative type was significantly higher than that of localized type. The VEGF expression level of infiltrative type was significantly higher than that of localized type. A significant positive correlation was found between highest microvascular density and VEGF expression, and
12
Takuma Nomiya, Kenji Nemoto and Shogo Yamada a borderline significant negative correlation was found between average microvascular density and expression of VEGF. TP expression showed a positive correlation with highest-MVD, but the correlation was not as strong as that of VEGF expression. In the analysis of MT, which is recognized as a protein that has a radioprotective effect, expression of MT was not increased in esophageal carcinoma of the radioresistant group. Metallothionein expression was increased in the radiosensitive group. Furthermore, expression of MT was not increased in preoperatively treated esophageal carcinomas. These results suggested that MT does not have a great impact on clinical radiosensitivity in esophageal carcinoma and also suggested that MT expression is not induced by therapeutic irradiation or anticancer agents. The results suggest that radioresistant type is poorly oxygenated by low averageMVD, includes a large amount of hypoxic fraction that is refractory to treatment, shows induction of angiogenic factors and activated neovascularization, and has a high rate of hematogenous metastasis. Tumor oxygenation and presence of a hypoxic fraction seem to have great importance for curability of esophageal carcinoma compared to various other factors we have investigated.
1. BACKGROUND AND EPIDEMIOLOGY Esophageal cancer is a malignancy that has an extremely poor prognosis. Esophageal carcinoma arises from squamous cells of the esophagus. Squamous cell carcinoma accounts for most esophageal malignancies, and adenocarcinoma is the second-most frequently occurring esophageal malignancy. The proportions of histological type differ according to country and race. A recent survey has shown that the ratios of squamous cell carcinoma and adenocarcinoma in esophageal malignancies in North America are 50-60% and 40-50%, respectively, whereas the ratios of squamous cell carcinoma and adenocarcinoma in Japan are more than 90% and less than 5%, respectively [1,2]. Smoking, alcohol, hot meals, having Barrett esophagus, and genetic inheritance are thought to be the causes of esophageal carcinoma. The difference in the proportions of squamous cell carcinoma and adenocarcinoma of the esophagus might be due to genetic differences between races and to environmental factors, though the reasons have not been clarified. Recent clinical studies on esophageal squamous cell carcinoma have been shown that the 5-year survival rate of patients with esophageal squamous cell carcinoma regardless of stage is about 20-30%. Esophageal carcinoma has thus been a refractory disease despite recent advances in multimodal treatments. The reasons for the extremely poor prognosis are that esophageal carcinoma easily extends to the submucosal layer, results in wide lymphogenous metastases from the neck to abdomen, easily invades adjacent critical organs, easily debilitates the host due to esophageal stenosis and eating disorder, and is difficult to resect completely. It has been shown that prognostic factors of gastro-intestinal malignancies include depth of invasion, extent of lymphogenous metastases, presence of distant metastasis, tumor length, site, age, and extent of lymphatic/ blood vessel invasion [3-5]. In case of gastro-intestinal malignancies, it is known that the clinical characteristics and malignant potential of the tumor differ according to its macroscopic appearance. For example, gastric cancer is roughly classified into localized type and invasive type and is
Relationships Between Biological and Clinicopathologic Features…
13
classified according to presence of ulceration [6]. In gastric cancer, it has been reported that not only the abovementioned depth of invasion, extent of lymphogenous metastases, and lymphatic/ blood vessel invasion but also macroscopic appearance greatly affect patients' prognosis [3,4,7-11]. The prognosis of patients with macroscopically infiltrative type of gastric cancer is generally regarded as poor, and the prognosis of patients with Borrmann's type IV (scirrhous type, diffusely infiltrating type) is extremely poor [7,12,13]. These findings suggest that the morphologic difference shows difference in biological features such as frequency of metastasis, invasiveness, and refractoriness to treatment. There are guidelines for treatment of esophageal carcinoma in Japan in which macroscopic appearance is defined according to Borrmann's classification for gastric cancer [14-16]. Many studies have shown that there is a difference in prognoses of patients with esophageal carcinoma according to macroscopic type in Japan [5,13,17-21]. Similar to gastric cancer, the prognosis of patients with macroscopically infiltrative type of esophageal carcinoma is unfavorable, and the prognosis of patients with diffusely infiltrative type (similar to Borrmann's type IV) is extremely poor [13].
Figure 1. A) Survival curves of patients with esophageal carcinoma treated by radiotherapy alone according to macroscopic types (Stage II-III). The prognosis of patients with macroscopically infiltrative type of esophageal carcinoma is significantly poorer than that of patients with localized type. B) Response to radiotherapy alone. Response rate (CR+PR) of infiltrative type is also significantly worse than that of localized type.
2. TREATMENT OUTCOME AND CLINICAL FEATURES Figure 1A shows survival curves of patients with stage II-III esophageal squamous cell carcinoma treated with radiotherapy alone in our institution from 1981 to 1991 (n=156; 144 males, 12 females; median age, 68.5 years; age range, 46-91 years) [22]. The prognosis of patients with macroscopically infiltrative type of esophageal carcinoma was significantly poorer than that of patients with macroscopically localized type (p<0.0001). Figure 1B shows treatment responses of 134 of the 156 patients for whom data were available. The response to radiotherapy of infiltrative type was significantly worse than that of localized type (p=0.001). As shown in Figure 1A-B, our data also suggest that clinical characteristics and prognosis of
14
Takuma Nomiya, Kenji Nemoto and Shogo Yamada
patients differ according to macroscopic appearance in esophageal carcinoma. It can be said that macroscopically infiltrative type of esophageal carcinoma not only has an extremely poor prognosis but is also more radioresistant than localized type. However, it is not clear whether the unfavorable prognosis of infiltrative type is due to metastasis tendency, poor local controllability, or both of these. Based on these differences in clinical features of esophageal carcinoma, we investigated tumor biological differences from the viewpoint of biological characteristics such as cell proliferation activity, microvascular density, activity of angiogenesis, and intrinsic radiosensitivity.
3. SIGNIFICANCE OF PROLIFERATION ACTIVITY IN MALIGNANCIES In our studies, cell proliferation activity, microvascular density, expressions of angiogenesis factors, and expressions of factors that affect intrinsic radiosensitivity were evaluated using surgically resected esophageal carcinoma specimens, not biopsy specimens. Ki67 labeling index was used for evaluation of cell proliferation activity of the tumor by immunohistochemistry. Ki67 antigen is one of the proteins that are expressed in the nuclei of proliferating cells [23]. The Ki67 antibody combines with a nuclear antigen that is present in proliferating cells but absent in resting cells. According to results of past experiments, Ki67 nuclear antigen is present in S, G2 and M phases of the cell cycle but is absent in G0 phase [24,25]. Ki67 positivity in G1 phase differs depending on the cell line. Ki67 antibody can sensitively detect cells in the proliferating phase. The ratio of Ki67-positive cells in malignant tissue indicates growth rate of the tumor, and Ki67 labeling index is widely used as an index of proliferation activity of the tumor in clinical pathology. Expression of Ki67 antigen in various tissue has been reported, and it has been shown that Ki67 positivity of a malignant tumor is generally higher than that of normal tissue [2632]. Many studies have shown a high Ki67 labeling index in various malignancies: brain tumor [31], head and neck cancer [33,34], breast cancer [28,35-37], gastric cancer [30,38-42], bladder cancer [27,43], rectal cancer [32] and prostatic cancer [44]. Ki67 (MIB-1) labeling index is regarded as one of the indexes that show degree of malignancy of tumor in practical work. In general, it is thought that a tumor that shows a higher level of proliferation activity has a higher degree of malignancy. Past studies have shown relationships between high Ki67 labeling index and poor prognosis in breast cancer [28,35-37,45-47], bladder cancer [27,43], brain tumor [31], and prostatic cancer [44]. However, other studies have shown that there are no relationships between high Ki67 labeling index and poor prognosis in head and neck cancer [34], rectal cancer [32], and gastric cancer [40-42]. A high level of cell proliferation activity of a malignant tumor does not therefore appear to be simply correlated with poor prognosis of patients. It appears that there is no correlation between high Ki67 labeling index and poor prognosis for malignancies that have arisen from oral-digestive system (gastric cancer, rectal cancer, head and neck tumor, etc.), and there might be something like organ dependence in the relationships between high proliferation activity level and prognosis. In the relationships
Relationships Between Biological and Clinicopathologic Features…
15
between other factors, histological grade [27,47], depth of tumor invasion [43], tumor size [38], blood vessel invasion [41], expression of p53 [29], and lymphogenous metastases [33,35,36] have been shown to be factors that correlate with Ki67 labeling index, but a definite theory has not yet been established. On the other hand, from the viewpoint of conventional radiation biology, it is known that the higher the level cell proliferation activity becomes, the more radiosensitivity increases. Based on this theory, a tumor with a high level of proliferation activity seems to be radiosensitive but to have a higher degree of malignancy. It has not been determined whether a high level of proliferation activity of a tumor is an advantage or disadvantage for patients with esophageal carcinoma. In our study, Ki67 labeling index was evaluated using sections of macroscopically localized type and infiltrative type of esophageal carcinoma without preoperative treatment. Ki67 labeling index was estimated independently by two skilled pathologists who had received no clinical information other than the name of the disease, and several microscopic fields were selected at random and the Ki67-positive cell rate (Ki67 labeling index) was calculated by counting 1000 malignant cells. The average value of the two Ki67 labeling indexes was taken as the Ki67 labeling index of the specimen (There was good agreement between the Ki67 labeling indexes calculated by the two pathologists: mean ±S.D. values of the two Ki67 labeling indexes were 53.3 ±20.7% and 55.1 ±21.3%, respectively (p=N.S.) and the mean difference between two Ki67 indexes of the same specimen was 8.4 ±5.9%.). The mean (±S.D.) Ki67 labeling index of all specimens was 54.2% (±20.4), and there was a large variation (range, 8.5-88.5%). In comparison according to macroscopic type, Ki67 labeling index of the infiltrative type was significantly lower than that of the localized type (46.9 ±20.4% vs. 61.5 ±18.1%, p=0.022, Figure 2A). The values of Ki67 labeling index showed a large variation from 8.5% to 88.5% in this study, and the values showed an almost normal distribution.
Figure 2. Comparison between localized type and infiltrative type in Ki67 labeling index (A), averageMVD (B), highest-MVD (C) and VEGF expression (D). Black circles and black bars: localized type, white circles and white bars: infiltrative type, Ki67: Ki67 labeling index, average-MVD: averagemicrovascular density, highest-MVD: highest-microvascular density, VEGF: vascular endothelial growth factor. Average-MVD: sum of vessel counts in four randomly selected fields in the tumor tissue
16
Takuma Nomiya, Kenji Nemoto and Shogo Yamada
at low magnification. Highest-MVD: microvessel count at high magnification in the area of highest neovascularization in the tumor.
According to past studies on Ki67 positivity, the ranges of Ki67 positivity were 11-18% in brain tumor [31], 14-64% in esophageal cancer [48], 4-87% in gastric cancer [41], 7-70% in colorectal cancer [32], 10-50% in cervical cancer [49], 0-17% in bladder cancer [27,43], and 0-17% in prostatic cancer [44]. A certain variation of cell proliferation activity is seen in almost all malignancies, but a very large variation is seen in malignancies of the digestive system. The distribution of Ki67 labeling indexes in this study nearly corresponded with these in past studies, but the reason for these variations is unknown. It seems to be important that there was a significant difference between cell proliferation activities in macroscopically localized type and infiltrative type of esophageal carcinoma. A high Ki67 labeling index was expected in infiltrative type, which has an unfavorable prognosis, but contrary to that expectation, the Ki67 labeling index of the infiltrative type was significantly lower than that of the localized type. Several studies have also suggested that there is no relationship between high Ki67 labeling index and poor prognosis in esophageal carcinoma [50-52]. It has been reported that the prognosis of patients with a high Ki67 labeling index was more favorable than that of patients with a low Ki67 labeling index who received radiotherapy for esophageal carcinoma [51]. However, there was a large overlap of Ki67 labeling index between localized type and infiltrative type of esophageal carcinoma in this study, and it cannot be concluded that patients with a high Ki67 labeling index have good prognosis. The mechanism and cause of the difference in cell proliferation activity is discussed in the following section with the results of other factors.
4. ANGIOGENESIS AND PIVOTAL ROLE OF VEGF Tumor cells keep growing while they are within a microscopic size, but the tumor requires oxygen and nutrition when it grows larger than a certain size. Growth of a tumor in diameter temporarily stops when it has reached a certain size, and then angiogenesis precedes the next tumor growth in diameter [53]. Several conditions are required for the process of angiogenesis, including demand for oxygen by the tumor, release of angiogenic factors from tumor cells, attenuation of angiogenesis-inhibiting factors by the host, and migration of endothelial cells. These mechanisms consist of interaction between tumor cells, host tissue, and endothelial cells, and then formed blood vessels accelerate further growth of the tumor [54-56]. Various angiogenic factors, including bFGF (basic fibroblast growth factor), PD-ECGF (platelet-derived endothelial cell growth factor) and PlGF (placenta growth factor) have been identified, but VEGF (vascular endothelial growth factor) is considered to be one of the strongest angiogenic factors [57]. VEGF is a 34-42-kDa heparin-binding, dimeric, disulfidebonded glycoprotein. VEGF is known as VPF (vascular permeability factor), and it has been shown that VEGF is a potent mediator of angiogenesis and vascular permeability [58-60]. Expression of VPF/VEGF is seen in various animals, various normal organs, and various
Relationships Between Biological and Clinicopathologic Features…
17
neoplasms. VEGF stimulates secretion of fibrinogen to the extra-vascular matrix and contributes to the formation of an interstitial fibrin structure of the tumor. Activities of the fibrinolytic system and plasminogen affect interstitial fibrin formation, and the activity differs depending on the tumors. Development of tumor stroma activates inflammatory reaction and migration of macrophages [61,62]. There is something in common between tumor stroma generation, tumor neovascularization, and the process of wound healing [63]. bFGF is thought to be one of the potent angiogenic factors, but VEGF, unlike bFGF, specifically interacts with endothelial cells. It is known that VEGF, unlike the angiogenic factor PD-ECGF, stimulates not only migration of endothelial cells but also proliferation of endothelial cells [64,65]. Several studies in which the expressions of VEGF and bFGF were compared showed that VEGF is more inducible and highly expressed by hypoxia than is bFGF in experiments using xenografts of melanoma and pancreatic tumor cell lines [66-68]. Other experiments showed that a monoclonal antibody specific for VEGF, the inactivated recombinant soluble human VEGF receptor, and a dominant-negative mutant of the VEGF receptor inhibited angiogenesis of a tumor [69-71]. These findings suggest that VEGF plays an important role in angiogenesis, although there are many angiogenic factors, including bFGF, Ang1/2 and PD-ECGF [72].
5. MICROVASCULAR DENSITY, OXYGEN TENSION, AND HYPOXIC FRACTION Tissue oxygen tension affects many intracellular environments such as glucose metabolism, cell cycle, and angiogenesis. Oxygen tension is one of the important parameters in tumor tissue, and various studies have been carried out to determine oxygen tension in a tumor. Evaluation of microvascular density by immunohistochemistry [73-76], evaluation of hypoxia by a hypoxia marker such as misonidazole and pimonidazole [66,77-80], evaluation of blood perfusion by a perfusion marker Hoechst33342 [81], and measurement by Eppendorf oxygen electrodes [75,82,83] have been performed for evaluation of tumor oxygen tension. Oxygen tension in a tumor seems to be dependent on microvascular density and blood vessel perfusion, and it has been shown that there is a significant correlation between microvascular density and oxygen tension in human tumors [74,84]. It had been thought that cells within a certain distance from vessels were oxygenated and that cells more distant from vessels were in a hypoxic state. However, not all hypoxic cells exist in uniform distance from blood vessels because of heterogeneity in the actual tumor [85,86]. Results of some studies have shown that there is a correlation between microvascular density and tumor oxygen tension [75,76,82], while results of other studies have shown that there is no correlation between microvascular density and tumor oxygen tension [87-89]. A correlation between microvascular density and oxygen tension was seen in cervical cancer, no correlation was seen in head and neck cancer, and both results that there were significant correlation between microvascular density and oxygen tension and that there were no significant correlation between them were observed in experiments using melanoma xenografts. These different findings suggest that there is heterogeneity depending on the organ or cell line. However, biopsy specimens were used for evaluating microvascular
18
Takuma Nomiya, Kenji Nemoto and Shogo Yamada
density in the above studies, and it is problematic whether a biopsy specimen displays characteristics of the whole tumor. The uncertainty of these different results of the studies may caused by methodological problems. On the other hand, an experiment in which the proportion of hypoxic cells and distance from blood vessels were determined using breast cancer xenografts showed that the proportion of the radioresistant hypoxic fraction increased in an area more than 140 µm from blood vessels [90]. To sum up, although there is individual heterogeneity due to oxygen diffusion, blood perfusion, acidosis and glucose metabolism, it can be concluded that the proportion of hypoxic cells increases with increase in intervascular distance in tumor tissue.
6. MICROVASCULAR DENSITY AND VEGF EXPRESSION We discussed the concept of vessel density that affects tumor oxygenation and amount of the hypoxic fraction of a tumor in the previous section. There seems to be another significance in microvascular density. A local "vascular hot spot" induced by overexpression of an angiogenic factor in tumor tissue seems to have another importance from the viewpoint of tumor biology. Weidner et al. suggested this concept of "vascular hot spot" early on [73]. It is thought that a "vascular hot spot" indicates pathological angiogenic activity of the tumor. The way to make vessel count to evaluate angiogenic activity is different from the way to make vessel count to evaluate tumor oxygen tension. After the area of highest neovascularization in a tumor specimen has been identified by observation under a microscope at low magnification, vessel count is then made at high magnification in the vascular hot spot. According to their study, a significant positive correlation between VEGF expression and microvascular density (in the vascular hot spot) has been shown in human breast cancer [91]. It is thought that microvessels in the vascular hot spot are induced by VEGF overexpression. Correlations between VEGF expression and neovascularization have also been found in breast cancer, hepatocellular carcinoma (HCC), ovarian cancer, germ cell tumor, and melanoma xenografts [53,66,68,92-95]. In an experiment, the growth of VEGF-transfected xenografts was significantly faster and the microvascular density of VEGF-transfected xenografts was significantly higher than those of control xenografts [76]. Another study has suggested that genetic overexpression of VEGF is more important than hypoxia-induced upregulation [66]. To sum up, microvascular density of a local "vascular hot spot" in tumor tissue significantly correlates with VEGF expression and indicates activity of tumor angiogenesis. In analysis of tumor tissue obtained from human non-small cell lung cancer (NSCLC), expression level of a hypoxia marker (hypoxia-inducible factor: HIF family) was very high in specimens with high microvascular density or low microvascular density but was low in specimens with medium microvascular density [96]. These findings suggest that there are two patterns of vessel structure: one affects oxygenation and formation of a hypoxic fraction of the tumor, and the other is hypoxiainduced and angiogenic factor-activated microvessels.
Relationships Between Biological and Clinicopathologic Features…
19
7. RESULTS OF OUR INVESTIGATIONS We evaluated microvascular density of the tumor in two ways and expression of VEGF by immunohistochemistry using surgically resected human esophageal squamous cell carcinoma specimens. 1) Average microvascular density (a-MVD): a-MVD was estimated as an index of tumor oxygen tension or amount of oxygenated cells. Using sections stained with anti-CD34 antibody, four areas including tumor tissue were randomly selected, and microvessel counts were made at low magnification, and then the sum of microvessels in the four fields was taken as a-MVD of the section. 2) Highest microvascular density (h-MVD): hMVD was estimated as an index of the most active neovascularization in the tumor. Using sections stained with anti-CD34 antibody, the area of highest neovascularization in the tumor was identified and microvessel count of that field were made at high magnification. Microvessels were counted on the basis of the methods described by Weidner [73]. 3) VEGF expression: Several microscopic fields were selected at random, and VEGF-positive cell rate was calculated by counting 1000 malignant cells. In the analysis of average microvascular density, a-MVD of macroscopically infiltrative type, which is thought to be radioresistant and have a poor prognosis, was significantly higher than that of localized type (mean ±S.D.: 370 ±102 vs. 475 ±91, p=0.0014, Figure 2B), [22]. In contrast, h-MVD of infiltrative type was significantly higher than that of localized type (150 ±75 vs. 82 ±33, p=0.0006, Figure 2C). In the analysis of VEGF expression, VEGF expression of infiltrative type was significantly higher than that of localized type (67.4 ±15 vs. 44.4 ±13, respectively, p<0.0001, Figure 2D). There was significant and strong positive correlation between VEGF expression and h-MVD (r=0.73, p<0.0001, Figure 3A). A negative correlation was found between a-MVD and VEGF expression, but it was borderline significant (r=0.30, p=0.06, Figure 3C).
Figure 3. A) Positive correlation between VEGF expression and highest-MVD (microvascular density). B) Negative correlation between VEGF expression and average-MVD. C) Positive correlation between
20
Takuma Nomiya, Kenji Nemoto and Shogo Yamada
TP expression and highest-MVD. D) Survival curves according to VEGF expression. The patients were divided into two groups of equal size according to VEGF expression. E) Survival curves according to TP/VEGF expressions. TP(-)/VEGF(-): n=11, TP(-)/VEGF(+) or TP(+)/VEGF(-): n=18, TP(+)/VEGF(+): n=11.
Different results have been obtained regarding the relationship between microvascular density and tumor oxygen tension, the correlation between microvascular density and hypoxic fraction, the relationship between microvascular density and radiosensitivity, and the relationship between microvascular density and VEGF expression [66,74-76,80-84,87-89,9295,97]. One possible reason for the difference in results is the difference in methods used to evaluate microvascular density. Another possible reason for heterogeneity of data is the difference in type of study: an experimental study using an animal model, an in vitro study, or a clinical study using human tumor. There seems to be a tendency that uniform data can easily be obtained in an experimental study using cell lines with identical clones or using a model of uniform animal xenografts, whereas it is difficult to obtain uniform data in a clinical study using specimens from human tumors that consist of heterogeneous clones. Accurate definition in evaluating microvascular density should be required for avoiding confusion. The results of our study showed paradoxical data that the inverse vessel counts were obtained between average microvascular density and highest microvascular density in comparison between macroscopically localized type and infiltrative type of esophageal carcinoma. Based on known information, these data can be interpreted as follows. 1) The number of hypoxic cells increases with increase in intervessel distance, and low averageMVD in tumor tissue therefore leads to an increase in the amount of hypoxic fraction. Low average-MVD in infiltrative type of esophageal carcinoma suggests low oxygen supply to the tissue and the presence of a hypoxic fraction. The finding of a lower Ki67 labeling index (low cell proliferation activity) in the infiltrative type supports the presence of larger amount of hypoxic fraction.
Figure 4. Presumptive mechanism of the formation of a hypoxic fraction in tumor tissue and angiogenesis from the results of our study and known information. 1) There is underdeveloped tumor vascularization (as suggested by low average-MVD). 2) The hypoxic fraction increases (as suggested
Relationships Between Biological and Clinicopathologic Features…
21
by low Ki67 labeling index). 3) VEGF is induced by hypoxia. 4) Development of immature microvessels is induced by VEGF overexpression (as suggested by high highest-MVD). 5) These microvessels with high permeability increase the incidence of hematogenous metastasis (which seems to be one of the reasons for unfavorable prognosis).
2) Hypoxia-inducible genes and hypoxia-inducible proteins are expressed in the hypoxic fraction. The potent angiogenic factor VEGF is one of the hypoxia-inducible proteins [67,72,98,99]. The results showing low average-MVD and high VEGF expression level in infiltrative type of esophageal carcinoma suggest the presence of hypoxia and hypoxiainducible VEGF expression (Figure 4A). It was not statistically strong, but negative correlation between a-MVD and VEGF expression is thought to be one of the supporting findings of relationship between increase in hypoxic fraction and increase in expression of angiogenic factor. 3) Angiogenesis is activated by VEGF overexpression, and it was found that irregular microvessels locally and densely developed in tumor tissue (Figure 4B). Low average-MVD, high VEGF expression level, and high highest-MVD were seen in the infiltrative type of esophageal carcinoma. The strong positive correlation between VEGF expression and highest-MVD also seems to support the above mechanism. Figure 5(A-F) shows microscopic findings of typical cases of macroscopically localized type (A-C) and infiltrative type (D-F). The microscopic photos in A-C and those in D-F are of the same specimens: Figures A and D show average-MVD (CD34 stain at low magnification), Figures B and E show VEGF expression and Figures C and F show highest-MVD (CD34 stain at high magnification).
Figure 5. Microscopic findings of typical cases of macroscopically localized type (A-C) and infiltrative type (D-F) of esophageal carcinoma. The microscopic photos in A-C and those in D-F are of the same specimens. A/D: CD34 stain at low magnification (for estimating average-MVD), B/E: VEGF stain, C/F: CD34 stain at high magnification (for estimating highest-MVD). The case of macroscopically infiltrative type of esophageal carcinoma (D-F) shows low average-MVD (D), overexpression of VEGF (E) that seems to be induced by hypoxia, and activated neovascularization (F) that seems to be VEGFinduced vascularization.
22
Takuma Nomiya, Kenji Nemoto and Shogo Yamada
4) Furthermore, these immature vessels with high permeability stimulate the occurrence of hematogenous or lymphogenous metastasis [91,92]. The presence of a hypoxic fraction not only leads to radioresistance but also increases the frequency of hematogenous metastasis. The mechanism such like this (abovementioned 1-4) seems to be one of the causes of radioresistance and unfavorable prognosis in the infiltrative type of esophageal carcinoma. There were large variations in the results of Ki67 labeling indexes and microvessel counts in our studies. This is because the data were obtained from human specimens consisting of heterogeneous clones and conditions. Although it is difficult to obtain uniform data in a study using human tumor specimens consisting heterogeneous subjects, it is noteworthy that significant differences were found despite the large variations.
8. HYPOXIC FRACTION AND CELL CYCLE It has generally been thought that the amount of quiescent cells increases in the hypoxic fraction [100,101]. The results of a study in which hypoxic fractions were compared using melanoma xenografts showed there were relationships between low microvascular density, increase in hypoxic fraction, and increase in the proportion of quiescent cells by flow cytometry [97]. However, it has been reported that not all cells in the hypoxic fraction are in quiescent phase and that some cells proliferate slowly even in the hypoxic area. Rate of proliferating cells in the hypoxic fraction seems to differ depending on cell line, but it is thought that malignant cells stop or delay their cell cycle at G0/G1 phase or at G2/M phase [101,102]. The results of our study showed that the cell proliferation activity level of infiltrative type of esophageal carcinoma, which seems to be radioresistant and have an unfavorable prognosis, was significantly lower than that of localized type. This was unexpected because it is generally thought that a tumor with a high growth rate is highly malignant. However, to sum up following factors such as increase in hypoxic fraction, cell cycle stop/delay, overexpressions of hypoxia-inducible proteins (VEGF) and being radioresistance, it is consistent that infiltrative type of esophageal carcinoma that is thought to be radioresistant and to be refractory to treatment could be poorly oxygenated and show low level of proliferation activity. A study has shown that mutation of p53 causes alteration in the cell cycle under a condition of hypoxia and that this leads to resistance to hypoxia [103]. It has also been reported that normal endothelial cells in S phase increase under a condition of hypoxia and that the cell cycle of normal endothelial cells is delayed but does not stop under a condition of hypoxia [104]. This seems to be rational mechanism, but it is interesting that endothelial cells, which play a pivotal role in angiogenesis, do not stop their cell cycle and continue to proliferate even under a condition of hypoxia.
Relationships Between Biological and Clinicopathologic Features…
23
9. HYPOXIA-INDUCIBLE FACTORS (HIFS) AND METABOLIC CHANGES Metabolism under a condition of hypoxia that differs from metabolism under the condition of normoxia. Under hypoxic conditions, an increase in blood perfusion is seen in normal tissue by its ability of autoregulation [105]. However, it is not known whether tumor tissue has the ability to autoregulate blood perfusion. It is generally thought that angiogenesis and oxygen supply cannot meet oxygen consumption by preceding tumor growth, and then the hypoxic fraction in the tumor usually increases with tumor growth. An in vivo experimental study showed that there is a gradient of oxygen tension in tumor tissue and that increases in lactate content and hypoxic fraction correlate with decrease in metabolic activity [106]. Synthesis of angiogenic factors such VEGF, NADPH oxidase metabolism, cytochrome P450 metabolism and synthesis of heme proteins are changed in cells to adapt to hypoxia [107-109]. HIFs act as promoters or mediators of activation of transcription of these hypoxia-inducible proteins. Hypoxia-inducible factor-1 alpha (HIF1alpha) and hypoxia-inducible factor-2 alpha (HIF-2alpha) are promoters involved in angiogenesis. HIF-1 consists of HIF-1alpha of 120 kDa and hypoxia-inducible factor-1 beta (HIF-1beta) of 94 kDa, and they form heterodimerized basic-helix-loop-helix proteins containing a Per-AHR-ARNT-Sim (PAS) domain. HIF-1 proteins are rapidly expressed in the cytoplasm under a condition of hypoxia, and HIF-1alpha and HIF-1beta are then heterodimerized and are transported into the nucleus, where they initiate transcription of hypoxia-inducible proteins. HIF-1alpha is rapidly inactivated by hydroxylation or degraded by ubiquitin-mediated proteolysis under the condition of normoxia (Figure 6, left). Under a condition of hypoxia, HIF-1alpha is stabilized by avoiding inactivation by prolyl hydroxylase domain-containing enzyme (PHD) or factor inhibiting HIFs (FIH) and starts transcription of specific genes (Figure 6, right). It is also known that HIFs are induced in conditions of anemia, high altitude, and wound healing [110114]. HIF-1 itself is known as a hypoxia marker, and its corresponding expression with other hypoxia markers such as pimonidazole or CAIX has been reported [115]. HIF-1alpha is unique to HIF-1 whereas HIF-1beta (aryl hydrocarbon receptor nuclear translocator: ARNT) can dimerize with the aryl hydrocarbon receptor [116]. Rapid expression of HIF-1alpha subunit in the nucleus is thus thought to be important for its activation [96,117,118]. HIF-1 has independently been identified and reported as endothelial PAS-1 (EPAS-1), HIF-like factor (HLF), a member of the PAS superfamily 2 (MOP2), and HIF-related factor (HRF), but they have high homology [119-121]. HIF-1 plays an important role not only in activation of angiogenesis but also in regulation of erythropoietin, glycolytic enzyme, and nitric oxide synthesis [122-128], and there are two groups of hypoxia-inducible proteins, HIF-1-dependent inducible proteins and HIF-1-independent inducible proteins [129]. The important point is that HIF-1 is a positive mediator of VEGF, which is the most potent angiogenic factor. Overexpression of VEGF and HIF-1 in the hypoxic fraction and correlation of VEGF expression and HIF-1 expression have been shown in both in vitro and in vivo studies [67,72,96-99]. HIF-1 might be a target of anti-angiogenic treatment.
24
Takuma Nomiya, Kenji Nemoto and Shogo Yamada
Figure 6. Mechanism of HIF-1alpha regulation in normoxia and hypoxia. HIF-1alpha: hypoxiainducible factor-1 alpha, HIF-1beta: hypoxia-inducible factor-1 beta, OH: hydroxyl residue, pVHL: von Hippel Lindau protein, Ub: ubiquitin, 26S-P: 26S proteasome, PHD: prolyl hydroxylase, FIH: factorinhibiting HIFs, p300/CBP: coactivators of HIF-1alpha.
10. REPORTS ON REDUNDANCY Several studies have shown significant delay in growth of HIF-1alpha knockout tumors [130-133]. From result showing that there was no delay in tumor growth in the absence of HIF-1 but presence of VEGF, tumor growth delay is thought to be caused by VEGF downregulation due to absence of HIF-1alpha [134]. Interestingly, expression levels of HIF1-dependent proteins such as VEGF, phosphoglycerate kinase 1 (PGK1) and Glut-1 were significantly decreased by HIF-1 knockout, but the expressions of these proteins did not completely disappear [130,132,133]. Recently, the existence of redundancy, which compensates for loss of a major pathway by activating other pathways, has been shown in several human metabolic pathways [135,136]. It also seems to be a redundancy that there are HIF-1alpha-dependent proteins (such as p53, p21 and Bcl-2) and HIF-1alpha-independent proteins (such as p27 and GADD153) among hypoxia-inducible proteins [133]. As compensatory pathways that induce VEGF expression other than hypoxia-HIF-1alpha pathways, these factors are also known as upregulators of VEGF expression such as interferon-gamma (IFN-gamma), Escherichia coli lipopolysaccharide (E. coli LPS), and inducible nitric oxide synthase (iNOS) [137]. HIF-2alpha is one of positive mediators of angiogenic factors that seems to compensate for major angiogenic factor mediators. HIF-2alpha, which has a function similar to that of HIF-1alpha, has recently attracted attention, and a correlation between microvascular density and expression of HIF-2alpha has been reported. However, there are paradoxical reports of a correlation between HIF-2alpha expression and high microvascular density and of a correlation between HIF-2alpha expression and low microvascular density [136,138]. These paradoxical data can be explained from the viewpoint of the relationship between low microvascular density and increase in hypoxic area and from the viewpoint of the relationship between HIF/VEGF expressions and HIF/VEGF-induced neovascularization as well as the results of our studies.
Relationships Between Biological and Clinicopathologic Features…
25
11. HYPOXIC FRACTION AND RESPONSE TO TREATMENT Although there has been controversy for many years regarding the degree of a hypoxic fraction in a tumor, it is now thought that most tumors include a hypoxic fraction to some degree. Although the degree of the hypoxic fraction differs depending on the cell line, the existence of an unexpectedly large hypoxic fraction in human tumor xenografts in mice has been shown [85,139-141]. Direct measurement of oxygen tension by a computerized electrode has indicated the existence of a hypoxic fraction in human cervical cancer and human breast cancer [115,142,143]. It has been suggested that hypoxic status of cells is one of the causes to be refractory to radiotherapy or chemotherapy, and several studies have shown a relationship between hypoxic status of cells and resistance to anticancer agents [140,144-146]. There are some theories that the refractoriness is due to weakness of the genome or due to metabolic alteration under a condition of hypoxia, but the truth is unknown. It is not clear whether the hypoxic fraction is acute or chronic and whether the cell cycle stops or progresses slowly under a condition of hypoxia. It has been reported that the hypoxic fraction increases with tumor growth in the early stage but that the size of the tumor and proportion of the hypoxic fraction are not correlated when the tumor exceeds a certain volume and that growth rate is also not correlated with amount of the hypoxic fraction [139]. On the other hand, it has been suggested that refractoriness to treatment depends on the amount of severe hypoxic fraction rather than that of mild to moderate hypoxic fraction in the tumor [88,83]. In an experimental study using human breast cancer xenografts, although normal tissue was well oxygenated by hyperbaric oxygen, the hypoxic fraction in the tumor was increased under a condition of hyperbaric oxygen [147]. A severe hypoxic fraction is resistant to reoxygenation independent of the presence of glucose [148]. It has also been shown that blood transfusion improved the hypoxic fraction and increased average oxygen tension in a tumor but that the proportion of severe hypoxic fraction did not change [75]. These results suggesst that the hypoxic fraction in a tumor might be more resistant to oxygenation than our expectation. Tumor tissue under a condition of severe hypoxia with low level of angiogenic activity becomes necrotic, and it is therefore questionable whether a severe hypoxic fraction around the necrotic area has the ability to retain clonogenicity [149]. Further investigation is needed to clarify whether a severe hypoxic fraction or a moderate hypoxic fraction is more influential. Negative correlations between microvascular density/angiogenic activity and proapoptotic factors (caspase-3, Fas ligand) have been shown in human head and neck cancer and human NSCLC [150,151]. A relationship between low microvascular density and presence of necrosis has been shown in pancreatic cancer, and hypoxia-induced necrosis was observed in human melanoma xenografts after administration of a VEGF-neutralizing antibody [67,92]. Based on results of those studies, tumor tissue with a high level of angiogenic activity can be more resistant to apoptosis or necrosis under a condition of severe hypoxia. One of the possible mechanisms of radioresistance or chemoresistance is that hypoxia decreases metabolic activity and that hypoxia-induced angiogenesis prevents cells from apoptosis or necrosis.
26
Takuma Nomiya, Kenji Nemoto and Shogo Yamada
12. MICROVASCULAR DENSITY AND RADIOSENSITIVITY According to conventional radiation biology, radiosensitivity is affected by cell repopulation (proliferation), (re)oxygenation, DNA repair and cell redistribution [152]. Oxygen tension in tumor tissue is one of the main factors affecting radiosensitivity [153]. The presence of a hypoxic fraction had been known since 1950's, and it is known that hypoxic cells are 3-times more radioresistant than are aerobic cells [85,103,140]. Tumor oxygenation is affected by vascular density, blood vessel perfusion, cell proliferation, and apoptotic activity [144], and there are wide variations in degree of tumor oxygenation, the degree of tumor oxygenation differing individually even in the same histological type [87,154,155]. Some rare tumors show uniform oxygenation within a certain distance from blood vessels [149], but most solid tumors show a heterogeneous distribution of aerobic/hypoxic fractions, and there is no relationship between oxygenation and clinical characteristics such as tumor volume and clinical stage [82,85,86,142,143]. As stated above, most tumors include a hypoxic fraction to some degree, and the amount of the hypoxic fraction increases in proportion to distance from blood vessels, though there is heterogeneity [79,81,86,147]. The results of an experiment on radiosensitivity using melanoma xenografts suggested that resistance of the hypoxic fraction to irradiation is due to a correlation between amounts of the hypoxic fraction before and after irradiation [87]. Some studies have shown that the amount of hypoxic fraction before treatment is more important than the amounts during treatment and after treatment in human cervical cancer [83]. On the other hand, Wouters et al. suggested that response to conventionally fractionated irradiation is highly dependent upon the cells at oxygen levels intermediate between fully oxygenated and hypoxic [156]. In several clinical studies, correlations between microvascular density, radiosensitivity, and local controllability have been shown in human head and neck tumors [80,157,158]. The results of our studies have also shown relationships between microvascular density, hypoxic fraction and radiosensitivity. Selective sensitization of the hypoxic fraction therefore seems to be an option for tumor control.
13. VEGF EXPRESSION AND RADIOSENSITIVITY Although the relationship between the presence of a hypoxic fraction and radiosensitivity has been mentioned above, the direct effect of VEGF expression on radiosensitivity of esophageal squamous cell carcinoma has not been shown. We investigated the effects of VEGF expression and VEGF receptor expression on radiosensitivity using transfected cell lines. VEGF gene and VEGF-receptor 1 (Flt-1) gene were transfected to a cell line of human esophageal squamous cell carcinoma (KYSE50, Figure 7). Three cell lines were established by transfection: 1) VEGF(-)/Flt-1(-) as a control, 2) VEGF(+)/Flt-1(-) and 3) VEGF(+)/Flt1(+). Figure 8 shows the survival curves of the control, VEGF(+)/Flt-1(-) and VEGF(+)/Flt1(+) cells after irradiation (unpublished). No significant difference was found between the radiosensitivities in vitro of the 3 cell lines. Consistent with the generally accepted view, the results of this study suggested that the mechanism by which VEGF overexpression promotes
Relationships Between Biological and Clinicopathologic Features…
27
in vivo tumor growth is alteration in the microenvironment by neovascularization and not a direct effect of VEGF on the cell cycle or radiosensitivity in esophageal carcinoma. It has been reported that VEGF-transfected xenografts showed significantly more rapid growth than did control xenografts in vivo and that the rapid growth was inhibited by inhibition of the angiogenic factor [159,160]. It has been reported that there was no significant difference between radiosensitivity of a VEGF-transfected cell line and that of a control cell line in fibrosarcoma [159], whereas there was significant difference between radiosensitivity of normal endothelial cells with an angiogenic factor and that of normal endothelial cells without an angiogenic factor [161]. Results of our study and other studies suggest that VEGF does not have a direct effect on tumor cells and that both increase in radioresistance and VEGF upregulation seem to occur as a consequence of the presence of a hypoxic fraction.
Figure 7. A: control cell line (transfected without VEGF insertion). B: VEGF-transfected cell line labeled with Fluorescein streptavidin. C: control cell line (transfected without Flt-1 insertion). D: Flt-1transfected cell line labeled with Texas Red streptavidin.
14. BIOLOGICAL FUNCTIONS OF VEGF RECEPTORS VEGF and its receptors, VEGF-receptor 1 (Flt-1) and VEGF-receptor 2 (FLK/KDR), have recently been shown to have an important role in normal and pathological angiogenesis [162,163]. Flt-1 and FLK/KDR, members of the tyrosine kinase family, contain seven immunoglobulin-like loops and are expressed in various human tissues and cell lines (Figure 9) [164,165]. VEGF-receptors, Flt-1 and FLK/KDR, are specifically expressed in vascular endothelial cells in normal and tumor tissues, and Flt-1 is expressed in monocytes and macrophages [166-168]. Expression of Flt-1 has been found in endothelial cells around tumor tissue but not in endothelial cells in normal tissue. In the area of tumor tissue with high
28
Takuma Nomiya, Kenji Nemoto and Shogo Yamada
vascular density, overexpressions of both Flt-1 and FLK/KDR have been observed [95,169,170].
Figure 8. Survival curves of VEGF(-)/Flt-1(-) (control) cell line, VEGF(+)/Flt-1(-) cell line and VEGF(+)/Flt-1(+) cell line. The cells were irradiated with single doses of 2, 4, 6, 8, 10 and 12 Gy, and cell survival was estimated by clonogenic colony assay. Cell lines were cultured at 37˚C in air with 20% O2.
Figure 9. Mechanism of VEGF-receptor activation. VEGF-receptors are dimerized when ligand-bound, and the intracellular domain is then activated and intracellular signaling pathways are activated. VEGF: vascular endothelial growth factor, PlGF: placenta growth factor, PI3K: phosphoinositide 3-kinase, AKT: one of protein kinases, Src: one of protein kinases.
Relationships Between Biological and Clinicopathologic Features…
29
It has been shown that autophosphorylation of Flt-1 is very weak despite dimerization with high affinity to its ligand VEGF. On the other hand, FLK/KDR shows stronger autophosphorylation by binding to VEGF despite having much less affinity to VEGF. It has been reported that mouse embryos homozygous for a targeted mutation in the Flt-1 locus died of abnormal vascular formation that was excessive formation rather than undevelopment [171-174]. Both Flt-1 and FLK/KDR seem to play essential roles in embryonal vasculogenesis. However, based on the results of these studies, it is thought that FLK/KDR is a positive regulator of angiogenesis in the VEGF/VEGF-receptor system and that Flt-1 is a negative regulator in this receptor system.
15. THYMIDINE PHOSPHORYLASE AND ANGIOGENESIS PD-ECGF, an angiogenic factor, has been shown to have catalytic activity for thymidine phosphorylation [175]. It has been revealed that PD-ECGF is identical to thymidine phosphorylase (TP) by an experiment that the protein obtained from a PD-ECGF-transfected cell line was identified by an anti-TP antibody [176,177]. TP does not enhance tumor growth in vitro but enhances tumor growth in vivo [178]. This different effect of TP between in vitro and in vivo suggests that the enhancement of tumor growth by TP is due to activation of angiogenesis. TP increases thymidine uptake of endothelial cells and has a strong effect on cellular thymidine metabolism. It is known that TP metabolites, dR-1-P (2-deoxyribose-1-phosphate) and 2dR (2-deoxyribose), stimulate migration of endothelial cells [179]. TP has angiogenic activity by stimulating migration of endothelial cells, but TP does not stimulate cell proliferation because it is not a growth factor [178,180,181]. Although expression of TP has hardly been seen in normal tissue, expression of TP has been shown in various malignancies and normal tissue around malignancies such as hepatocellular carcinoma, (HCC) [182,183], NSCLC [184,185], gastro-intestinal cancer [186,187], renal cell carcinoma, (RCC) [188], breast cancer [178], bladder cancer [189], and ovarian cancer [190]. We investigated TP expression, which seems to have a different angiogenic pathway from VEGF signaling pathways, in esophageal carcinoma. As shown in Figure 3C, a positive correlation between TP expression and highest microvascular density was found [191]. This correlation was borderline significant, and the correlation was not as strong as that between VEGF expression and highest-MVD mentioned above. The difference in statistical significance between TP and VEGF in our study suggests the angiogenic potential of TP and VEGF. No significant correlation was found between TP expression and average microvascular density or between TP expression and Ki67 labeling index. No definite evidence of a relationship between hypoxia and TP expression was found in our study either. Several investigators have reported a positive correlation between local microvascular density and TP expression in various malignancies [183,188,192,193], and the results for TP expression in our study are consistent with the results of these studies. It is clear that TP has angiogenic activity in tumor tissue by inducing migration of endothelial cells. There is controversy regarding the correlation between expressions of TP and VEGF, but no
30
Takuma Nomiya, Kenji Nemoto and Shogo Yamada
significant correlation was found between expressions of TP and VEGF in our studies [194,195].
16. MICROVASCULAR DENSITY, VEGF/TP EXPRESSION AND PROGNOSIS We analyzed prognosis of the patients in this study according to VEGF/TP expression using Cox's proportional hazards model and Kaplan-Meier methods [191]. The patients were divided into two groups of equal size according to VEGF expression and also into two groups of equal size according to TP expression. The prognosis of patients in the high VEGF expression group was significantly poorer than that of patients in the low VEGF expression group (3-year survival rate: 30% vs. 70%, p=0.01, Figure 3D), and the prognosis of patients in the high TP expression group tended to be poorer than that of patients in the low TP expression group, though the difference was not statistically significant (3-year survival rate: 40% vs. 62%, p=0.1, figure omitted). The patients were also divided into three groups according to the combination of VEGF expression and TP expression: TP(-)/VEGF(-) group (patients with low level of TP expression and low level of VEGF expression), TP(-)/VEGF(+) or TP(+)/VEGF(-) group (patients with low level of TP expression and high level of VEGF expression or patients with high level of TP expression and low level of VEGF expression), TP(+)/VEGF(+) group (patients with high level of TP expression and high level of VEGF expression). Three-year survival rates of the TP(-)/VEGF(-) group, TP(-)/VEGF(+) or TP(+)/VEGF(-) group, and TP(+)/VEGF(+) group were 73%, 55%, and 18%, respectively (p=0.005, Figure 3E). The prognosis of patients in the TP(+)/VEGF(+) group was much worse than that of patients in the other groups, and the prognosis of patients in the TP(-)/VEGF(-) group was significantly better than that of patients in the other groups. No significant differences were found in results of prognostic analyses according to gender, age, site, tumor length, and Ki67 labeling index. Microvascular density and macroscopic type were excluded from prognostic analysis because of their strong correlation with VEGF expression. These results suggest that overexpression of VEGF is one of negative prognostic factors and that prognosis of patients with co-expression of VEGF and TP is extremely poor. It has been shown that expression of VEGF is one of steps of malignant transformation in various malignancies [58,170,196-200]. Several clinical studies have also shown that expression of VEGF is one of negative prognostic factors in brain tumor [64], gastric cancer [198], RCC [201], breast cancer [94], and esophageal cancer [200]. From the viewpoint of TP expression, some studies have shown no relationship between prognosis and expression of TP [182,183], but several studies have shown that expression of TP is one of negative prognostic factors in RCC [188], cervical cancer [202], colon cancer [192], and breast cancer [195]. From these results and our results, it seems that TP expression is not a strong prognostic factor. Several investigators have suggested that co-expression of VEGF and TP is a clinically unfavorable prognostic factor in some malignancies [195,203]. The results of these studies are consistent with results of our study.
Relationships Between Biological and Clinicopathologic Features…
31
However, there is advantage of TP expression in metabolic activity, that is, TP catalyzes conversion of 5'-DFUR to 5-FU in tumor tissue [176,204]. It has been shown that TPtransfected cells became 160-fold more sensitive to 5'-DFUR (5'-deoxy-5-fluorouridine, prodrug of 5-FU) than did control cells [181,205]. It is therefore thought that an anticancer drug is more effective in tumors that have high expression levels of TP than in tumors with low TP expression levels. Several clinical and experimental studies have shown the outcomes of anticancer treatment using 5-FU or its precursor [176,204-206]. Evaluation of TP and VEGF expressions seems to be useful for predicting patients' prognosis and for selecting effective anticancer agents. On the other hand, microvascular density of a tumor also correlates with prognosis of patients. There have been many studies in which microvascular density was evaluated as the most active neovascularization in the tumor (highest-MVD), and these studies have suggested that high vascularity is associated with significantly unfavorable prognosis for patients with NSCLC [207], breast cancer [73,207], bladder cancer [169], RCC [201], and various malignancies [208,209]. It has been reported that increase in the hypoxic fraction, overexpression of angiogenic factors and prominent vascularization increase the probability of hematogenous metastasis. Stackpole et al. investigated the relationship between amount of hypoxic fraction and probability of metastasis using melanoma xenografts [97], and Weidner et al. showed a relationship between higher microvascular density and increase in frequency of metastasis using human breast cancer [91]. Rofstad et al. also showed relationships between increase in hypoxic fraction, overexpression of angiogenic factors, and increased frequency of lung metastasis using melanoma xenografts [92]. Well-developed microvessels with high permeability, so-called "vascular hot spot", are an open gate to systemic circulation. The mechanisms of metastasis are complex and have not been completely revealed, but overexpression of angiogenic factors, migration of endothelial cells, neovascularization, enhancement of vascular permeability, and migration of cancer cells are thought to be essential for the occurrence of metastasis. To sum up, the presence of a hypoxic fraction and activated angiogenesis seem to affect not only tumor controllability but also the incidence of metastasis and prognosis of patients.
17. INTRINSIC RADIOSENSITIVITY AND METALLOTHIONEIN EXPRESSION Metallothioneins (MTs) are a family of low-molecular-weight (6-7 kDa) intracellular proteins, and they are cysteine-rich proteins with high affinity for both essential and nonessential metals. There are four isoforms of MT (MT-I, -II, -III and -IV) in human organs, and MT-I and -II are the most predominant isoforms. It has been about 50 years since MT was first identified as a Cd-, Zn-binding protein in the horse kidney. It is known that MT-I mRNA and MT-II mRNA are induced not only by heavy metals but also by many nonmetallic compounds including ethanol, alkylating agents, and physical or chemical oxidative stress conditions [210,211]. In addition to its principal roles in detoxification of potentially toxic heavy metals and in regulation of the homeostasis of essential trace metals, MT can also act as an antioxidant and a free radical scavenger [210-212]. Cellular damage caused by
32
Takuma Nomiya, Kenji Nemoto and Shogo Yamada
radiation is mainly oxidative damage due to the formation of several types of oxygen free radicals caused by ionization of water molecules. In an experimental study, radioresistance acquired by MT induction by pretreatment of Cd salts was seen in a human epithelial line and a mouse fibroblast line [213]. Similarly, another experiment demonstrated that MT-induced tumor cells acquired radioresistance [214]. However, several investigators have suggested that MT induction does not have an effect on radioresistance of tumor cells [215-218], and it has remained controversial whether MT expression affects the clinical radiosensitivity of tumor or not. MT induction by therapeutic irradiation is interesting because radiotherapy is widely used for cancer treatment. We evaluated the expression of MT by immunohistochemistry using specimens of resected esophageal squamous cell carcinoma and estimated the significance of expression of MT in clinical radiosensitivity [219]. The resected esophageal carcinomas included 20 macroscopically localized type without preoperative treatment (PT), 20 macroscopically infiltrative type without PT and 5 macroscopically infiltrative type with PT (40 Gy of preoperative irradiation and preoperative chemotherapy with CDDP and 5-FU). Analyses of patients with esophageal carcinoma treated by only radiotherapy showed that macroscopically infiltrative type had a significantly poor prognosis and was significantly resistant to radiotherapy (Figure 1). If MT expression has a great impact on clinical radiosensitivity in esophageal carcinoma, a higher level of MT expression level should be seen in infiltrative type than in localized type, and if MT induction by therapeutic irradiation affects clinical radiosensitivity, a higher level of MT expression level should be seen in patients who have received preoperative treatment. Figure 10 shows the MT expressions in each group. MT expression level of macroscopically localized type without PT was significantly higher than that of infiltrative type without PT (p=0.026) and was significantly higher than that of infiltrative type with PT (p=0.024). No significant difference was found between the group without PT and the group with PT in infiltrative type of esophageal carcinoma. The results of this study showed, contrary to expectation, that MT expression level in the infiltrative type of esophageal carcinoma was lower than that in the localized type of esophageal carcinoma, suggesting that the cause of radioresistance in infiltrative type is unlikely to be the radioprotective effect of MT expression. Similarly, the results of analysis according to presence of preoperative treatment showed that it is unlikely that a tumor acquires resistance to treatment due to MT induction by therapeutic irradiation or anticancer agents. The results of our study are consistent with results of studies showing no correlation between radiosensitivity and MT expression. It seems unlikely that MT will be a target molecule of cancer therapy in the future.
Relationships Between Biological and Clinicopathologic Features…
33
Figure 10. Expressions of MT. Localized type without preoperative treatment (PT): n=20, infiltrative type without PT: n=20, infiltrative type with PT: n=5. Patients in the infiltrative type with PT group received preoperative irradiation of 40 Gy and preoperative chemotherapy (CDDP and 5FU). High MT expression level was not seen in radioresistant infiltrative type. There were no findings that MT expression was induced by preoperative treatments.
18. CONCLUSIONS AND FUTURE VIEWS We have investigated relationships between clinical features and biological features from the viewpoints of cell proliferation activity, tumor oxygenation, angiogenic activity and intrinsic radiosensitivity using resected human esophageal squamous cell carcinoma specimens. The results of our studies suggested that the factors that have the greatest effects on controllability and prognosis are tumor oxygenation and amount of hypoxic fraction. The significance of a hypoxic fraction in tumors has been suggested previously, before the results of our studies have suggested that the presence of a hypoxic fraction is one of the most important factors. Many trials have already been performed, but to overcome hypoxic fraction in tumor is a problem of the moment to be solved. Cell proliferation activity was shown to be correlated with microvascular density, and not all of the specimens with unfavorable prognosis showed a high level of cell proliferation activity in our study. Although stress-inducible proteins that are biosynthesized and act as radioprotectants are not only MTs, expression of stress-inducible protein was not consistent with clinical radiosensitivity. Investigation of DNA repair, which has an important role in radiosensitivity, was not performed in our previous studies. Activity of DNA repair is essential for estimating radiosensitivity, and we will investigate this in a future study. Though
34
Takuma Nomiya, Kenji Nemoto and Shogo Yamada
angiogenic activity does not have a direct effect on radiosensitivity, it plays an important role in tumor growth and occurrence of metastasis. Inhibition of angiogenic factors is attracting much attention, and clinical trials have been started. However, there has been no report of angiogenic factor-inhibiting agents dramatically improving patients' prognosis. As stated above with regard to redundancy, metabolic pathways in humans do not seem be so simple that inhibition of one factor can inhibit one metabolic system. However, elucidation of cytokines and intracellular signaling pathways has been rapidly progressing, and all of the proteins and metabolic systems in humans should be elucidated in the near future. Generally, basic experiments using a single cell line are suitable for determining the influence of a difference in one factor because heterogeneity of the genome is excluded. On the other hand, investigations using obtained human tumors include much heterogeneity in the results because tumors have heterogeneous genomic backgrounds, and large variations in results have seen in our studies. These methods seem to be suitable to extract several potent factors from a population including many parameters and heterogeneity. Many genes have been identified and expressions of thousands of genes can now be analyzed simultaneously new techniques such as the microarray technique. Advances in research technology have made it possible to perform an experiment in several months that would have taken several years before. Further developments in cancer biology are expected.
REFERENCES [1] [2]
[3]
[4]
[5] [6] [7]
[8]
American Cancer Society. Cancer facts and figures 2003. Atlanta: American Cancer Society. Kuwano H, Nakajima M, Miyazaki T, Kato H. Distinctive clinicopathological charadteristics in esophageal squamous cell carcinoma. Ann Thorac Cardiovasc Surg. 2003; 9: 6-13. Okada M, Kojima S, Murakami M, Fuchigami T, Yao T, Omae T, Iwashita A. Human gastric carcinoma: prognosis in relation to macroscopic and microscopic features of the primary tumor. J Natl Cancer Inst. 1983; 71(2):275-279. Compan AF, Medrano J, Calpena R, Diego M, Lacueva J, Serrano P, Molto M, PerezVazquez MT. Gastric carcinoma: study of the most eminent prognostic factors. Eur J Surg Oncol. 1993; 19(6):533-538. Watanabe H, Kato H, Tachimori Y, Yamaguchi H, Itababashi M. [Characteristics of the spread pattern in esophageal carcinoma] Kyobu Geka. 1989; 42(8 Suppl):682-689. Borrmann R. Henke-Lubarsch’ der speziellen pathologischen Anatomie und Histologie, Bd. IV, 1. Springer, Berlin, 1926. Nakamura K, Ueyama T, Yao T, Xuan ZX, Ambe K, Adachi Y, Yakeishi Y, Matsukuma A, Enjoji M. Pathology and prognosis of gastric carcinoma. Findings in 10,000 patients who underwent primary gastrectomy. Cancer. 1992. 70(5):1030-1037. Schmitz-Moormann P, Hermanek P, Himmelmann GW. Morphological predictors of survival in early and advanced gastric carcinoma. J Cancer Res Clin Oncol. 1992; 118(4):296-302.
Relationships Between Biological and Clinicopathologic Features… [9]
[10]
[11]
[12]
[13]
[14] [15]
[16] [17]
[18] [19]
[20]
[21]
[22]
35
Yu CC, Levison DA, Dunn JA, Ward LC, Demonakou M, Allum WH, Hallisey MT. Pathological prognostic factors in the second British Stomach Cancer Group trial of adjuvant therapy in resectable gastric cancer. Br J Cancer. 1995; 71(5):1106-1110. Hiratsuka M, Iwanaga T, Furukawa H, Yasuda T, Nakano H, Nakamori S, Ohigashi H, Kameyama M, Sasaki Y, Kabuto T, et al. [Important prognostic factors in surgically treated gastric cancer patients.] Gan To Kagaku Ryoho. 1995; 22(5): 703-708. Isozaki H, Fujii K, Nomura E, Mabuchi H, Nishiguchi K, Hara H, Tanigawa N. Prognostic factors of advanced gastric carcinoma without serosal invasion (pT2 gastric carcinoma). Hepatogastroenterology. 1999; 46(28): 2669-2672. Taniguchi K, Yonemura Y, Nojima N, Hirono Y, Fushida S, Fujimura T, Miwa K, Endo Y, Yamamoto H, Watanabe H. The relation between the growth patterns of gastric carcinoma and the expression of hepatocyte growth factor receptor (c-met), autocrine motility factor receptor, and urokinase-type plasminogen activator receptor. Cancer. 1998; 82(11): 2112-2122. Natsugoe S, Matsushita Y, Kijima F, Tokuda K, Shimada M, Shirao K, Kusano C, Baba M, Yoshinaka H, Fukumoto T, Mueller J, Aikou T. Diffusely infiltrative squamous cell carcinoma of the esophagus. Surg Today. 1998; 28(2):129-134. Mikuriya S. [Radiographic classification of esophageal neoplasms--type classification to Bormann's classification.] Rinsho Hoshasen. 1982; 27(10 Suppl): 1079-1091. Yamada T, Muramatsu Y, Suzuki M, Takayasu K, Moriyama N, Ushio K, Matsue H, Sasagawa M. [Bormann's classification of esophageal neoplasms.] Rinsho Hoshasen. 1982; 27(10 Suppl): 1071-1077. Japanese Society for Esophageal Diseases. Guidelines for the Clinical and Pathologic Studies on Carcinoma of the Esophagus. 9th ed. Kanehara Co, 1999. Natsugoe S, Nakashima S, Kijima F, Shimada M, Kusano C, Yoshinaka H, Baba M, Takao S, Aikou T. Analysis of macroscopic appearance and p53 expression in superficial esophageal carcinoma. Hepatogastroenterology. 1999; 46(28): 2398-2404. Yamada A. Radiologic assessment of resectability and prognosis in esophageal carcinoma. Gastrointest Radiol. 1979; 4(3): 213-218. Yamada A, Kobayashi S, Ide H, Yoshida M, Endo M. [Significance of radiographic classification on the prognosis of esophageal neoplasms.] Rinsho Hoshasen. 1982; 27(10 Suppl): 1057-1070. Morita K, Takagi I, Watanabe M, Niwa K and Kanazawa H. Relationship between the radiologic features of esophageal cancer and the local control by radiation therapy. Cancer, 1985; 55(11): 2668-2676. Yamada S, Takai Y, Nemoto K, Ogawa Y, Kakuto Y, Hoshi A and Sakamoto K. Prognostic factors in radiation-treated esophageal carcinoma. Acta Oncologica, 1992; 31(5): 563-567. Nomiya T, Nemoto K, Miyachi H, Fujimoto K, Takeda K, Ogawa Y, Takai Y, Yamada S. Relationships between radiosensitivity and microvascular density in esophageal carcinoma: significance of hypoxic fraction. Int J Radiat Oncol Biol Phys. 2004; 58(2): 589-596.
36
Takuma Nomiya, Kenji Nemoto and Shogo Yamada
[23] Gerdes J, Schwab U, Lemke H, Stein H. Production of a mouse monoclonal antibody reactive with a human nuclear antigen associated with cell proliferation. Int J Cancer. 1983; 31(1): 13-20. [24] Gerdes J, Lemke H, Baisch H, Wacker HH, Schwab U, Stein H. Cell cycle analysis of a cell proliferation-associated human nuclear antigen defined by the monoclonal antibody Ki-67. J Immunol. 1984; 133(4): 1710-1715. [25] Key G, Petersen JL, Becker MH, Duchrow M, Schluter C, Askaa J, Gerdes J. New antiserum against Ki-67 antigen suitable for double immunostaining of paraffin wax sections. J Clin Pathol. 1993; 46(12): 1080-1084. [26] Porschen R, Kriegel A, Langen C, Classen S, Hilse M, Lohe B, Hengels KJ, Borchard F. Assessment of proliferative activity in carcinomas of the human alimentary tract by Ki-67 immunostaining. Int J Cancer. 1991; 47(5): 686-691. [27] Stavropoulos NE, Ioackim-Velogianni E, Hastazeris K, Kitsiou E, Stefanaki S, Agnantis N. Growth fractions in bladder cancer defined by Ki67: association with cancer grade, category and recurrence rate of superficial lesions. Br J Urol. 1993; 72(52): 736-739. [28] Molino A, Micciolo R, Turazza M, Bonetti F, Piubello Q, Bonetti A, Nortilli R, Pelosi G, Cetto GL. Ki-67 immunostaining in 322 primary breast cancers: associations with clinical and pathological variables and prognosis. Int J Cancer. 1997; Aug 22;74(4): 433-437. [29] Jaskiewicz K, De Groot KM. p53 gene mutants expression, cellular proliferation and differentiation in oesophageal carcinoma and non-cancerous epithelium. Anticancer Res. 1994; 14(1A): 137-140. [30] Yonemura Y, Kamata T, Ohoyama S, Matumoto H, Kimura H, Kosaka T, Yamaguchi A, Miwa K, Miyazaki I. Relation of proliferative activity to survival in patients with advanced gastric cancer. Anal Cell Pathol. 1991; 3(2): 103-110. [31] Parkins CS, Darling JL, Gill SS, Revesz T, Thomas DG. Cell proliferation in serial biopsies through human malignant brain tumours: measurement using Ki67 antibody labelling. Br J Neurosurg. 1991; 5(3): 289-298. [32] Berenzi A, Benetti A, Bertalot G, Rodolfi A, Portolani N, Giulini SM, Pulcini G, Vinco A, Tiberio G. Ki67 immunohistochemical evaluation in colorectal cancer and normal colonic mucosa. Possible clinical applications. Pathologica. 1992; 84(1090): 155-163. [33] Matsumoto M, Komiyama K, Okaue M, Shimoyama Y, Iwakami K, Namaki S, Tanaka H, Moro I, Sato H. Predicting tumor metastasis in patients with oral cancer by means of the proliferation marker Ki67. J Oral Sci. 1999; 41(2): 53-56. [34] Jones AS, Roland NJ, Caslin AW, Cooke TG, Cooke LD, Forster G. A comparison of cellular proliferation markers in squamous cell carcinoma of the head and neck. J Laryngol Otol. 1994; 108(10): 859-864. [35] Locker AP, Birrell K, Bell JA, Nicholson RI, Elston CW, Blamey RW, Ellis IO. Ki67 immunoreactivity in breast carcinoma: relationships to prognostic variables and short term survival. Eur J Surg Oncol. 1992; 18(3): 224-229. [36] Beck T, Weller EE, Weikel W, Brumm C, Wilkens C, Knapstein PG. Usefulness of immunohistochemical staining for p53 in the prognosis of breast carcinomas:
Relationships Between Biological and Clinicopathologic Features…
[37]
[38]
[39]
[40]
[41]
[42]
[43]
[44]
[45]
[46]
[47]
[48]
37
correlations with established prognosis parameters and with the proliferation marker, MIB-1. Gynecol Oncol. 1995; 57(1): 96-104. Domagala W, Markiewski M, Harezga B, Dukowicz A, Osborn M. Prognostic significance of tumor cell proliferation rate as determined by the MIB-1 antibody in breast carcinoma: its relationship with vimentin and p53 protein. Clin Cancer Res. 1996; 2(1): 147-154. Yonemura Y, Ohoyama S, Kimura H, Kamata T, Yamaguchi A, Miyazaki I. Assessment of tumor cell kinetics by monoclonal antibody Ki-67. Eur Surg Res. 1990; 22(6): 365-370. Ichiyoshi Y, Tomoda M, Tomisaki S, Oda S, Ohno S, Maehara Y, Sugimachi K. Macroscopic appearance and biological character of gastric cancer invading the muscularis propria. Hepatogastroenterology. 1996; 43(9): 553-559. Flejou JF, Paraf F, Muzeau F, Fekete F, Henin D, Jothy S, Potet F. Expression of cerbB-2 oncogene product in Barrett's adenocarcinoma: pathological and prognostic correlations. J Clin Pathol. 1994; 47(1): 23-26. Muller W, Schneiders A, Meier S, Hommel G, Gabbert HE. Immunohistochemical study on the prognostic value of MIB-1 in gastric carcinoma. Br J Cancer. 1996; 74(5): 759-765. Broll R, Mahlke C, Best R, Schimmelpenning H, Strik MW, Schiedeck T, Bruch HP, Duchrow M. Assessment of the proliferation index in gastric carcinomas with the monoclonal antibody MIB 1. J Cancer Res Clin Oncol. 1998; 124(1): 49-54. Limas C, Bigler A, Bair R, Bernhart P, Reddy P. Proliferative activity of urothelial neoplasms: comparison of BrdU incorporation, Ki67 expression, and nucleolar organiser regions. J Clin Pathol. 1993; 46(2): 159-165. Khoo VS, Pollack A, Cowen D, Joon DL, Patel N, Terry NH, Zagars GK, von Eschenbach AC, Meistrich ML, Troncoso P. Relationship of Ki-67 labeling index to DNA-ploidy, S-phase fraction, and outcome in prostate cancer treated with radiotherapy. Prostate. 1999; 41(3): 166-172. Dettmar P, Harbeck N, Thomssen C, Pache L, Ziffer P, Fizi K, Janicke F, Nathrath W, Schmitt M, Graeff H, Hofler H. Prognostic impact of proliferation-associated factors MIB1 (Ki-67) and S-phase in node-negative breast cancer. Br J Cancer. 1997; 75(10): 1525-1533. Veronese SM, Gambacorta M, Gottardi O, Scanzi F, Ferrari M, Lampertico P. Proliferation index as a prognostic marker in breast cancer. Cancer. 1993; 15;71(12): 3926-3931. Pinder SE, Wencyk P, Sibbering DM, Bell JA, Elston CW, Nicholson R, Robertson JF, Blamey RW, Ellis IO. Assessment of the new proliferation marker MIB1 in breast carcinoma using image analysis: associations with other prognostic factors and survival. Br J Cancer. 1995; 71(1): 146-149. Porschen R, Classen S, Piontek M, Borchard F. Vascularization of carcinomas of the esophagus and its correlation with tumor proliferation. Cancer Res. 1994; 54(2): 587591.
38
Takuma Nomiya, Kenji Nemoto and Shogo Yamada
[49] Brown DC, Cole D, Gatter KC, Mason DY. Carcinoma of the cervix uteri: an assessment of tumour proliferation using the monoclonal antibody Ki67. Br J Cancer. 1988; 57(2): 178-181. [50] Sarbia M, Bittinger F, Porschen R, Dutkowski P, Torzewski M, Willers R, Gabbert HE. The prognostic significance of tumour cell proliferation in squamous cell carcinomas of the oesophagus. Br J Cancer 1996; 74(7): 1012-1016. [51] Isaev IG, Goldobenko GV, Tkachev SI. The prognostic significance of the rate of growth in the radiation treatment of esophageal cancer. Med Radiol (Mosk). 1989; 34(7): 45-49. [52] Sarbia M, Gabbert HE. Modern pathology: prognostic parameters in squamous cell carcinoma of the esophagus. Recent Results Cancer Res. 2000; 155: 15-27. [53] Gilead A, Neeman M. Dynamic remodeling of the vascular bed precedes tumor growth: MLS ovarian carcinoma spheroids implanted in nude mice. Neoplasia. 1999; 1(3): 226230. [54] Folkman J. What is the evidence that tumors are angiogenesis dependent? J. Natl. Cancer Inst. 1990; 82: 4-7. [55] Folkman J. The role of angiogenesis in tumor growth. Semin. Cancer Biol. 1992; 3: 6571. [56] Folkman J, Shing Y. Angiogenesis. J Biol Chem. 1992; 267(16): 10931-10934. [57] Klagsbrun M, Soker S. VEGF/VPS: the angiogenesis factor found? Current Biology, 1993; 3: 699-702. [58] Senger DR, Perruzzi CA, Feder J, Dvorak HF. A highly conserved vascular permeability factor secreted by a variety of human and rodent tumor cell lines. Cancer Res. 1986; 46: 5629-5632. [59] Dvorak HF, Sioussat TM, Brown LF, Berse B, Nagy JA, Sotrel A, Manseau EJ, Van De Water L, Senger DR. Distribution of vascular permeability factor (vascular endothelial growth factor) in tumors: concentration in tumor blood vessels. J. Exp. Med. 1991; 174: 1275-1278. [60] Connolly DT, Olander JV, Heuvelman D, Nelson R, Monsell R, Siegel N, Haymore BL, Leimgruber R, Feder J. Human vascular permeability factor. Isolation from U937 cells. J Biol Chem. 1989 264(33): 20017-20024. [61] Senger DR, Van de Water L, Brown LF, Nagy JA, Yeo KT, Yeo TK, Berse B, Jackman RW, Dvorak AM, Dvorak HF. Vascular permeability factor (VPF, VEGF) in tumor biology. Cancer Metastasis Rev. 1993; 12: 303-324. [62] Nagy JA, Brown LF, Senger DR, Lanir N, Van de Water L, Dvorak AM, Dvorak HF. Pathogenesis of tumor stroma generation: a critical role for leaky blood vessels and fibrin deposition. Biochim. Biophys. Acta, 1989; 948: 305-326. [63] Power C, Wang JH, Sookhai S, Street JT, Redmond HP. Bacterial wall products induce downregulation of vascular endothelial growth factor receptors on endothelial cells via a CD14-dependent mechanism: implications for surgical wound healing. J Surg Res. 2001; 101(2): 138-145. [64] Alvarez JA, Baird A, Tatum A, Daucher J, Chorsky R, Gonzalez AM, Stopa EG. Localization of basic fibroblast growth factor and vascular endothelial growth factor in human glial neoplasms. Mod. Pathol. 1992; 5: 303-307.
Relationships Between Biological and Clinicopathologic Features…
39
[65] Ferrara N, Henzel WJ. Pituitary follicular cells secrete a novel heparin-binding growth factor specific for vascular endothelial cells. Biochem Biophys Res Commun. 1989; 161(2): 851-858. [66] Danielsen T, Rofstad EK. The constitutive level of vascular endothelial growth factor (VEGF) is more important than hypoxia-induced VEGF up-regulation in the angiogenesis of human melanoma xenografts. Br J Cancer. 2000; 82(9): 1528-1534. [67] Sipos B, Weber D, Ungefroren H, Kalthoff H, Zuhlsdorff A, Luther C, Torok V, Kloppel G. Vascular endothelial growth factor mediated angiogenic potential of pancreatic ductal carcinomas enhanced by hypoxia: an in vitro and in vivo study. Int J Cancer. 2002; 102(6): 592-600. [68] Li X, Feng GS, Zheng CS, Zhuo CK, Liu X. Influence of transarterial chemoembolization on angiogenesis and expression of vascular endothelial growth factor and basic fibroblast growth factor in rat with Walker-256 transplanted hepatoma: an experimental study. World J Gastroenterol. 2003; 9(11): 2445-2449. [69] Kim KJ, Li B, Winer J, Armanini M, Gillett N, Phillips HS, Ferrara N. Inhibition of vascular endothelial growth factor-induced angiogenesis suppresses tumour growth in vivo. Nature. 1993; 362(6423): 841-844. [70] Kendall RL, Thomas KA. Inhibition of vascular endothelial cell growth factor activity by an endogenously encoded soluble receptor. Proc Natl Acad Sci U S A. 1993; 90(22): 10705-10709. [71] Millauer B, Shawver LK, Plate KH, Risau W, Ullrich A. Glioblastoma growth inhibited in vivo by a dominant-negative Flk-1 mutant. Nature. 1994; 367(6463): 576-579. [72] Cao Y, Linden P, Shima D, Browne F, Folkman J. In vivo angiogenic activity and hypoxia induction of heterodimers of placenta growth factor/vascular endothelial growth factor. J Clin Invest. 1996; 98(11): 2507-2511. [73] Weidner N. Current pathologic methods for measuring intratumoral microvessel density within breast carcinoma and other solid tumors: Breast Cancer Res. and Tre. 1995; 36: 169-180. [74] Vaupel P, Schlenger K, Hoeckel M. Blood flow and tissue oxygenation of human tumors: An update. Adv. Exp. Med. Biol. 1992; 317: 139-151. [75] Sundfor K, Lyng H, Kongsgard UL, Trope C, Rofstad EK. Polarographic measurement of pO2 in cervix carcinoma. Gynecol Oncol. 1997; 64(2): 230-236. [76] Menon C, Polin GM, Prabakaran I, Hsi A, Cheung C, Culver JP, Pingpank JF, Sehgal CS, Yodh AG, Buerk DG, Fraker DL. An integrated approach to measuring tumor oxygen status using human melanoma xenografts as a model. Cancer Res. 2003; 63(21): 7232-7240. [77] Beasley NJ, Wykoff CC, Watson PH, Leek R, Turley H, Gatter K, Pastorek J, Cox GJ, Ratcliffe P, Harris AL. Carbonic anhydrase IX, an endogenous hypoxia marker, expression in head and neck squamous cell carcinoma and its relationship to hypoxia, necrosis, and microvessel density. Cancer Res. 2001; 61(13): 5262-5267. [78] Hlatky L, Ring CS, Sachs RK. Detection of an intrinsic marker in hypoxic cells. Cancer Res. 1989; 49(18): 5162-5166. [79] Durand RE, Raleigh JA. Identification of nonproliferating but viable hypoxic tumor cells in vivo. Cancer Res. 1998; 58(16): 3547-3550.
40
Takuma Nomiya, Kenji Nemoto and Shogo Yamada
[80] Kaanders JH, Wijffels KI, Marres HA, Ljungkvist AS, Pop LA, van den Hoogen FJ, de Wilde PC, Bussink J, Raleigh JA, van der Kogel AJ. Pimonidazole binding and tumor vascularity predict for treatment outcome in head and neck cancer. Cancer Res. 2002; 62(23): 7066-7074. [81] Rijken PF, Bernsen HJ, Peters JP, Hodgkiss RJ, Raleigh JA, van der Kogel AJ. Spatial relationship between hypoxia and the (perfused) vascular network in a human glioma xenograft: a quantitative multi-parameter analysis. Int J Radiat Oncol Biol Phys. 2000; 48(2): 571-582. [82] Lyng H, Sundfor K, Rofstad EK. Oxygen tension in human tumours measured with polarographic needle electrodes and its relationship to vascular density, necrosis and hypoxia. Radiother Oncol. 1997; 44(2): 163-169. [83] Lyng H, Sundfor K, Trope C, Rofstad EK. Disease control of uterine cervical cancer: relationships to tumor oxygen tension, vascular density, cell density, and frequency of mitosis and apoptosis measured before treatment and during radiotherapy. Clin Cancer Res. 2000; 6(3): 1104-1112. [84] Gillies RJ, Schornack PA, Secomb TW, Raghunand N. Causes and effects of heterogeneous perfusion in tumors. Neoplasia. 1999; 1(3): 197-207. [85] Evans SM, Jenkins WT, Shapiro M, Koch CJ. Evaluation of the concept of hypoxic fraction as a descriptor of tumor oxygenation status. Adv Exp Med Biol. 1997; 411: 215-225. [86] Zeman EM, Calkins DP, Cline JM, Thrall DE, Raleigh JA. The relationship between proliferative and oxygenation status in spontaneous canine tumors. Int J Radiat Oncol Biol Phys. 1993; 27(4): 891-898. [87] Rofstad EK. Hypoxia and reoxygenation in human melanoma xenografts. Int J Radiat Oncol Biol Phys. 1989; 17(1): 81-89. [88] Lyng H, Tanum G, Evensen JF, Rofstad EK. Changes in oxygen tension during radiotherapy of head and neck tumours. Acta Oncol. 1999; 38(8): 1037-1042. [89] Wijffels KI, Kaanders JH, Rijken PF, Bussink J, van den Hoogen FJ, Marres HA, de Wilde PC, Raleigh JA, van der Kogel AJ. Vascular architecture and hypoxic profiles in human head and neck squamous cell carcinomas. Br J Cancer. 2000; 83(5): 674-683. [90] Groebe K, Vaupel P. Evaluation of oxygen diffusion distances in human breast cancer xenografts using tumor-specific in vivo data: role of various mechanisms in the development of tumor hypoxia. Int J Radiat Oncol Biol Phys. 1988; 15(3): 691-697. [91] Weidner N, Semple JP, Welch WR, Folkman J. Tumor angiogenesis and metastasis-correlation in invasive breast carcinoma. N Engl J Med. 1991; 324(1): 1-8. [92] Rofstad EK, Halsor EF. Hypoxia-associated spontaneous pulmonary metastasis in human melanoma xenografts: involvement of microvascular hot spots induced in hypoxic foci by interleukin 8. Br J Cancer. 2002; 86(2): 301-308. [93] Nakayama K, Kanzaki A, Hata K, Katabuchi H, Okamura H, Miyazaki K, Fukumoto M, Takebayashi Y. Hypoxia-inducible factor 1 alpha (HIF-1 alpha) gene expression in human ovarian carcinoma. Cancer Lett. 2002; 176(2): 215-223. [94] Toi M, Hoshima S, Takayanagi T, Tominaga T. Association of vascular endothelial growth factor expression with tumor angiogenesis and with early relapse in primary breast cancer. Jpn. J. Cancer Res. 1994; 85: 1045-1049.
Relationships Between Biological and Clinicopathologic Features…
41
[95] Viglietto G, Romano A, Maglione D, Rambaldi M, Paoletti I, Lago CT, Califano D, Monaco C, Mineo A, Santelli G, Manzo G, Botti G, Chiappetta G, Persico MG. Neovascularization in human germ cell tumors correlates with a marked increase in the expression of the vascular endothelial growth factor but not the placenta-derived growth factor. Oncogene. 1996; 13(3): 577-587. [96] Giatromanolaki A, Koukourakis MI, Sivridis E, Turley H, Talks K, Pezzella F, Gatter KC, Harris AL. Relation of hypoxia inducible factor 1 alpha and 2 alpha in operable non-small cell lung cancer to angiogenic/molecular profile of tumours and survival. Br J Cancer. 2001; 85(6): 881-890. [97] Stackpole CW, Alterman AL, Angadi CV, Kim YS, Fornabaio DM. Differences in organization of metastatic and nonmetastatic tumors initiated by the same B16 melanoma clone in mature and young mice. Clin Exp Metastasis. 1990; 8(3): 255-266. [98] Levy AP, Levy NS, Wegner S, Goldberg MA. Transcriptional regulation of the rat vascular endothelial growth factor gene by hypoxia. J Biol Chem. 1995; 270(22): 13333-13340. [99] Dor Y, Porat R, Keshet E. Vascular endothelial growth factor and vascular adjustments to perturbations in oxygen homeostasis. Am J Physiol Cell Physiol. 2001; 280(6): C1367-1374. [100] Mendelsohn ML. The growth fraction: a new concept applied to tumors. Science, 1960; 132: 1496. [101] Schmaltz C, Hardenbergh PH, Wells A, Fisher DE. Regulation of proliferation-survival decisions during tumor cell hypoxia. Mol Cell Biol. 1998; 18(5): 2845-2854. [102] Webster L, Hodgkiss RJ, Wilson GD. Cell cycle distribution of hypoxia and progression of hypoxic tumour cells in vivo. Br J Cancer. 1998; 77(2): 227-234. [103] Zolzer F, Streffer C. Increased radiosensitivity with chronic hypoxia in four human tumor cell lines. Int J Radiat Oncol Biol Phys. 2002; 54(3): 910-920. [104] Tucci M, Hammerman SI, Furfaro S, Saukonnen JJ, Conca TJ, Farber HW. Distinct effect of hypoxia on endothelial cell proliferation and cycling. Am J Physiol. 1997; 272(5 Pt 1): C1700-1708. [105] Schumacker PT, Samsel RW. Oxygen delivery and uptake by peripheral tissues: physiology and pathophysiology. Crit Care Clin. 1989; 5(2): 255-269. [106] Walenta S, Snyder S, Haroon ZA, Braun RD, Amin K, Brizel D, Mueller-Klieser W, Chance B, Dewhirst MW. Tissue gradients of energy metabolites mirror oxygen tension gradients in a rat mammary carcinoma model. Int J Radiat Oncol Biol Phys. 2001; 51(3): 840-848. [107] Acker H. Cellular oxygen sensors. Ann N Y Acad Sci. 1994; 718: 3-10. [108] Fandrey J, Seydel FP, Siegers CP, Jelkmann W. Role of cytochrome P450 in the control of the production of erythropoietin. Life Sci. 1990; 47(2): 127-134. [109] Goldberg MA, Dunning SP, Bunn HF. Regulation of the erythropoietin gene: evidence that the oxygen sensor is a heme protein. Science. 1988; 242(4884): 1412-1415. [110] Wenger RH, Gassmann M. Oxygen(es) and the hypoxia-inducible factor-1. Biol Chem. 1997; 378(7): 609-616. [111] Wiesener MS, Turley H, Allen WE, Willam C, Eckardt KU, Talks KL, Wood SM, Gatter KC, Harris AL, Pugh CW, Ratcliffe PJ, Maxwell PH. Induction of endothelial
42
Takuma Nomiya, Kenji Nemoto and Shogo Yamada
PAS domain protein-1 by hypoxia: characterization and comparison with hypoxiainducible factor-1alpha. Blood. 1998; 92(7): 2260-2268. [112] Salceda S, Caro J. Hypoxia-inducible factor 1a (HIF-1a) protein is rapidly degraded by the ubiquitin-proteasome system under normoxic conditions. J Biol Chem 1997; 272: 22642-22647. [113] Pugh CW, O’Rourke JF, Nagao M, Gleadle JM, Ratcliffe PJ. Activation of hypoxia inducible factor-1; definition of regulatory domains within the a subunit. J Biol Chem 1997; 272: 11205-11214. [114] Huang LE, Gu J, Schau M, Bunn HF. Regulation of hypoxiainducible factor 1a is mediated by an oxygen-dependent domain via the ubiquitin-proteasome pathway. Proc Natl Acad Sci USA 1998; 95: 7987-7992. [115] Jankovic B, Aquino-Parsons C, Raleigh JA, Stanbridge EJ, Durand RE, Banath JP, Macphail SH, Olive PL. Comparison between pimonidazole binding, oxygen electrode measurements, and expression of endogenous hypoxia markers in cancer of the uterine cervix. Cytometry B Clin Cytom. 2006 Feb 2; [Epub ahead of print] [116] Wood SM, Gleadle JM, Pugh CW, Hankinson O, Ratcliffe PJ. The role of the aryl hydrocarbon receptor nuclear translocator (ARNT) in hypoxic induction of gene expression. Studies in ARNT-deficient cells. J Biol Chem. 1996; 271(25): 1511715123. [117] Huang LE, Arany Z, Livingston DM, Bunn HF. Activation of hypoxia-inducible transcription factor depends primarily on redoxsensitive stabilization of its a subunit. J Biol Chem 1996; 271: 32253-32259. [118] Wang GL, Jiang BH, Rue EA, Semenza GL. Hypoxia-inducible factor 1 is a basichelix-loop-helix-PAS heterodimer regulated by cellular O2 tension. Proc Natl Acad Sci USA. 1995; 92(12): 5510-5514. [119] Ema M, Taya S, Yokotani N, Sogawa K, Matsuda Y, Fujii, Kuriyama Y. A novel bHLH-PAS factor with close sequence similarity to hypoxia-inducible factor 1a regulates the VEGF expression and is potentially involved in lung and vascular development. Proc Natl Acad Sci USA 1997; 94: 4273-4278. [120] Hogenesch JB, Chan WK, Jackiw VH, Brown RC, Gu Y-Z, Pray-Grant M, Perdew GH, Bradfield CA. Characterization of a subset of the basic-helix-loop-helix-PAS superfamily that interacts with components of the dioxin signaling pathway. J Biol Chem 1997; 272: 8581-8593. [121] Flamme I, Frohlich T, von Reutern M, Kappel A, Damert A, RisauW. HRF, a putative basic helix-loop-helix-PAS-domain transcription factor is closely related to hypoxiainducible factor-1a and developmentally expressed in blood vessels. Mech Dev 1997; 63: 51-60. [122] Gleadle JM, Ratcliffe PJ: Hypoxia and the regulation of gene expression. Mol Med Today 1998; 4: 122-129. [123] Wang GL, Semenza GL. Characterization of hypoxia-inducible factor 1 and regulation of DNA binding activity by hypoxia. J Biol Chem. 1993; 268(29): 21513-21518. [124] Bos R, van Der Hoeven JJ, van Der Wall E, van Der Groep P, van Diest PJ, Comans EF, Joshi U, Semenza GL, Hoekstra OS, Lammertsma AA, Molthoff CF. Biologic
Relationships Between Biological and Clinicopathologic Features…
43
correlates of (18)fluorodeoxyglucose uptake in human breast cancer measured by positron emission tomography. J Clin Oncol. 2002; 20(2): 379-387. [125] Maxwell PH, Pugh CW, Ratcliffe PJ. Inducible operation of the erythropoietin 38 enhancer in multiple cell lines: Evidence for a widespread oxygen sensing mechanism. Proc Natl Acad Sci USA 1993; 90: 2423-2427. [126] Semenza GL, Wang GL. A nuclear factor induced by hypoxia via de novo protein synthesis binds to the human erythropoietin gene enhancer at a site required for transcriptional activation. Mol Cell Biol 1992; 12: 5447-5454. [127] Schuster SJ, Badiavas EV, Costa-Giomi P, Weinmann R, Erslev AJ, Caro J. Stimulation of erythropoietin gene transcription during hypoxia and cobalt exposure. Blood. 1989; 73(1):13-16. [128] Semenza GL, Roth PH, Fang HM, Wang GL. Transcriptional regulation of genes encoding glycolytic enzymes by hypoxia-inducible factor 1. J Biol Chem. 1994; 269(38): 23757-23763. [129] Wood SM, Wiesener MS, Yeates KM, Okada N, Pugh CW, Maxwell PH, Ratcliffe PJ. Selection and analysis of a mutant cell line defective in the hypoxia-inducible factor-1 alpha-subunit (HIF-1alpha). Characterization of hif-1alpha-dependent and -independent hypoxia-inducible gene expression. J Biol Chem. 1998; 273(14): 8360-8368. [130] Ryan HE, Poloni M, McNulty W, Elson D, Gassmann M, Arbeit JM, Johnson RS. Hypoxia-inducible factor-1alpha is a positive factor in solid tumor growth. Cancer Res. 2000; 60(15): 4010-4015. [131] Ryan HE, Lo J, Johnson RS. HIF-1 alpha is required for solid tumor formation and embryonic vascularization. EMBO J. 1998; 17(11): 3005-3015. [132] Maxwell PH, Dachs GU, Gleadle JM, Nicholls LG, Harris AL, Stratford IJ, Hankinson O, Pugh CW, Ratcliffe PJ. Hypoxia-inducible factor-1 modulates gene expression in solid tumors and influences both angiogenesis and tumor growth. Proc Natl Acad Sci USA. 1997; 94(15): 8104-8109. [133] Carmeliet P, Dor Y, Herbert JM, Fukumura D, Brusselmans K, Dewerchin M, Neeman M, Bono F, Abramovitch R, Maxwell P, Koch CJ, Ratcliffe P, Moons L, Jain RK, Collen D, Keshert E. Role of HIF-1alpha in hypoxia-mediated apoptosis, cell proliferation and tumour angiogenesis. Nature. 1998; 394(6692): 485-490. [134] Blouw B, Song H, Tihan T, Bosze J, Ferrara N, Gerber HP, Johnson RS, Bergers G. The hypoxic response of tumors is dependent on their microenvironment. Cancer Cell. 2003; 4(2): 133-146. [135] Uzgare AR, Isaacs JT. Enhanced redundancy in Akt and mitogen-activated protein kinase-induced survival of malignant versus normal prostate epithelial cells. Cancer Res. 2004; 64(17): 6190-6199. [136] Leek RD, Talks KL, Pezzella F, Turley H, Campo L, Brown NS, Bicknell R, Taylor M, Gatter KC, Harris AL. Relation of hypoxia-inducible factor-2 alpha (HIF-2 alpha) expression in tumor-infiltrative macrophages to tumor angiogenesis and the oxidative thymidine phosphorylase pathway in Human breast cancer. Cancer Res. 2002; 62(5): 1326-1329.
44
Takuma Nomiya, Kenji Nemoto and Shogo Yamada
[137] Ramanathan M, Giladi A, Leibovich SJ. Regulation of vascular endothelial growth factor gene expression in murine macrophages by nitric oxide and hypoxia. Exp Biol Med (Maywood). 2003; 228(6): 697-705. [138] Onita T, Ji PG, Xuan JW, Sakai H, Kanetake H, Maxwell PH, Fong GH, Gabril MY, Moussa M, Chin JL. Hypoxia-induced, perinecrotic expression of endothelial PerARNT-Sim domain protein-1/hypoxia-inducible factor-2alpha correlates with tumor progression, vascularization, and focal macrophage infiltration in bladder cancer. Clin Cancer Res. 2002; 8(2): 471-480. [139] Moulder JE, Rockwell S. Hypoxic fractions of solid tumors: experimental techniques, methods of analysis, and a survey of existing data. Int J Radiat Oncol Biol Phys. 1984; 10(5): 695-712. [140] Moulder JE, Rockwell S. Tumor hypoxia: its impact on cancer therapy. Cancer Metastasis Rev. 1987; 5(4): 313-341. [141] Horsman MR, Khalil AA, Siemann DW, Grau C, Hill SA, Lynch EM, Chaplin DJ, Overgaard J. Relationship between radiobiological hypoxia in tumors and electrode measurements of tumor oxygenation. Int J Radiat Oncol Biol Phys. 1994; 29(3): 439442. [142] Hockel M, Schlenger K, Knoop C, Vaupel P. Oxygenation of carcinomas of the uterine cervix: evaluation by computerized O2 tension measurements. Cancer Res. 1991; 51(22): 6098-6102. [143] Vaupel P, Schlenger K, Knoop C, Hockel M. Oxygenation of human tumors: evaluation of tissue oxygen distribution in breast cancers by computerized O2 tension measurements. Cancer Res. 1991; 51(12): 3316-3322. [144] Bussink J, Kaanders JH, van der Kogel AJ. Tumor hypoxia at the micro-regional level: clinical relevance and predictive value of exogenous and endogenous hypoxic cell markers. Radiother Oncol. 2003; 67(1): 3-15. [145] Volm M, Koomagi R, Mattern J. Interrelationships between microvessel density, expression of VEGF and resistance to doxorubicin of non-small lung cell carcinoma. Anticancer Res. 1996; 16(1): 213-217. [146] Teicher BA. Hypoxia and drug resistance. Cancer Metastasis Rev. 1994; 13(2):139-168 [147] Erickson K, Braun RD, Yu D, Lanzen J, Wilson D, Brizel DM, Secomb TW, Biaglow JE, Dewhirst MW. Effect of longitudinal oxygen gradients on effectiveness of manipulation of tumor oxygenation. Cancer Res. 2003; 63(15): 4705-4712. [148] Snyder, S. A., Lanzen, J. L., Braun, R. D., Rosner, G., Secomb, T. W., Biaglow, J., Brizel, D. M., and Dewhirst, M. W. Simultaneous administration of glucose and hyperoxic gas achieves greater improvement in tumor oxygenation than hyperoxic gas alone. Int. J. Radiat. Oncol. Biol. Phys. 2001; 51: 494-506. [149] Franko AJ, Koch CJ, Boisvert DP. Distribution of misonidazole adducts in 9L gliosarcoma tumors and spheroids: implications for oxygen distribution. Cancer Res. 1992; 52(14): 3831-3837. [150] Riedel F, Gotte K, Bergler W, Hormann K. Inverse correlation of apoptotic and angiogenic markers in squamous cell carcinoma of the head and neck. Oncol Rep. 2001; 8(3): 471-476.
Relationships Between Biological and Clinicopathologic Features…
45
[151] Volm M, Mattern J, Koomagi R. Inverse correlation between apoptotic (Fas ligand, caspase-3) and angiogenic factors (VEGF, microvessel density) in squamous cell lung carcinomas. Anticancer Res. 1999; 19(3A): 1669-1671. [152] Denekamp J. Cell kinetics and radiation biology. Int J Radiat Biol Relat Stud Phys Chem Med. 1986; 49(2): 357-380. [153] Littbrand B, Revesz L. The effect of oxygen on cellular survival and recovery after radiation. Br. J. Radiol. 1969; 42(504): 914-924. [154] Rofstad EK, Eide K, Skoyum R, Hystad ME, Lyng H. Apoptosis, energy metabolism, and fraction of radiobiologically hypoxic cells: a study of human melanoma multicellular spheroids. Int J Radiat Biol. 1996; 70(3): 241-249. [155] Rijken PF, Peters JP, Van der Kogel AJ. Quantitative analysis of varying profiles of hypoxia in relation to functional vessels in different human glioma xenograft lines. Radiat Res. 2002; 157(6): 626-632. [156] Wouters BG, Brown JM. Cells at intermediate oxygen levels can be more important than the hypoxic fraction in determining tumor response to fractionated radiotherapy. Radiat Res. 1997; 147(5): 541-550. [157] Kamijo T, Yokose T, Hasebe T, Yonou H, Hayashi R, Ebihara S, Ochiai A. Image analysis of microvessel surface area predicts radiosensitivity in early-stage laryngeal carcinoma treated with radiotherapy. Clin Cancer Res. 2001; 7(9): 2809-2814. [158] Giatromanolaki A, Sivridis E, Kouskoukis C, Gatter KC, Harris AL, Koukourakis MI. Hypoxia-inducible factors 1alpha and 2alpha are related to vascular endothelial growth factor expression and a poorer prognosis in nodular malignant melanomas of the skin. Melanoma Res. 2003; 13(5): 493-501. [159] Gupta VK, Jaskowiak NT, Beckett MA, Mauceri HJ, Grunstein J, Johnson RS, Calvin DA, Nodzenski E, Pejovic M, Kufe DW, Posner MC, Weichselbaum RR. Vascular endothelial growth factor enhances endothelial cell survival and tumor radioresistance. Cancer J. 2002: 8(1): 47-54. [160] Griffin RJ, Williams BW, Wild R, Cherrington JM, Park H, Song CW. Simultaneous inhibition of the receptor kinase activity of vascular endothelial, fibroblast, and platelet-derived growth factors suppresses tumor growth and enhances tumor radiation response. Cancer Res. 2002; 62(6): 1702-1706. [161] Geng L, Donnelly E, McMahon G, Lin PC, Sierra-Rivera E, Oshinka H, Hallahan DE. Inhibition of vascular endothelial growth factor receptor signaling leads to reversal of tumor resistance to radiotherapy. Cancer Res. 2001; 61(6): 2413-2419. [162] Shibuya M. Role of VEGF-flt receptor system in normal and tumor angiogenesis. Adv Cancer Res. 1995; 67:281-316. [163] Shalaby F, Rossant J, Yamaguchi TP, Gertsenstein M, Wu XF, Breitman ML, Schuh AC. Failure of blood-island formation and vasculogenesis in Flk-1-deficient mice. Nature. 1995; 376(6535): 62-66. [164] Matthews W, Jordan CT, Gavin M, Jenkins NA, Copeland NG, Lemischka IR. A receptor tyrosine kinase cDNA isolated from a population of enriched primitive hematopoietic cells and exhibiting close genetic linkage to c-kit. Proc. Natl Acad Sci. USA 1991; 88: 9026-9030.
46
Takuma Nomiya, Kenji Nemoto and Shogo Yamada
[165] Terman BI, Dougher-Vermazen M, Carrion ME, Dimitrov D, Armellino DC, Gospodarowicz D, Bohlen P. Identification of the KDR tyrosine kinase as a receptor for vascular endothelial cell growth factor. Biochem Biophys Res Commun. 1992; 187(3): 1579-1586. [166] Jakeman LB, Armanini M, Phillips HS, Ferrara N. Developmental expression of binding sites and messenger ribonucleic acid for vascular endothelial growth factor suggests a role for this protein in vasculogenesis and angiogenesis. Endocrinology. 1993; 133(2): 848-859. [167] Eichmann A, Marcelle C, Breant C, Le Douarin NM. Two molecules related to the VEGF receptor are expressed in early endothelial cells during avian embryonic development. Mech Dev. 1993; 42(1-2): 33-48. [168] Clauss M, Weich H, Breier G, Knies U, Rockl W, Waltenberger J, Risau W. The vascular endothelial growth factor receptor Flt-1 mediates biological activities. Implications for a functional role of placenta growth factor in monocyte activation and chemotaxis. J Biol Chem. 1996; 271(30): 17629-17634. [169] Brown LF, Berse B, Jackman RW, Toganazzi K, Manseau EJ, Dvorak HF, Senger DR. Increased expression of vascular permeability factor (vascular endothelial growth factor) and its receptors in kidney and bladder carcinomas. Am. J. Pathol. 1993; 143: 1255-1262. [170] Hatva E, Kaipainen A, Mentula P, Jaaskelainen J, Paetau A, Haltia M, Alitalo K. Expression of endothelial cell-specific receptor tyrosine kinases and growth factors in human brain tumors. Am J Pathol. 1995; 146(2): 368-378. [171] Waltenberger J, Claesson-Welsh L, Siegbahn A, Shibuya M, Heldin CH. Different signal transduction properties of KDR and Flt1, two receptors for vascular endothelial growth factor. J Biol Chem. 1994; 269(43): 26988-26995. [172] Takahashi T, Shibuya M. The 230 kDa mature form of KDR/Flk-1 (VEGF receptor-2) activates the PLC-gamma pathway and partially induces mitotic signals in NIH3T3 fibroblasts. Oncogene. 1997; 14(17): 2079-2089. [173] Fong GH, Rossant J, Gertsenstein M, Breitman ML. Role of the Flt-1 receptor tyrosine kinase in regulating the assembly of vascular endothelium. Nature. 1995; 376(6535): 66-70. [174] Hiratsuka S, Minowa O, Kuno J, Noda T, Shibuya M. Flt-1 lacking the tyrosine kinase domain is sufficient for normal development and angiogenesis in mice. Proc Natl Acad Sci USA. 1998; 95(16): 9349-9354. [175] Finnis C, Dodsworth N, Pollitt CE, Carr G, Sleep D. Thymidine phosphorylase activity of platelet-derived endothelial cell growth factor is responsible for endothelial cell mitogenicity. Eur J Biochem. 1993; 212(1): 201-210. [176] Haraguchi M, Furukawa T, Sumizawa T, Akiyama S. Sensitivity of human KB cells expressing platelet-derived endothelial cell growth factor to pyrimidine antimetabolites. Cancer Res. 1993; 53(23): 5680-5682. [177] Sumizawa T, Furukawa T, Haraguchi M, Yoshimura A, Takeyasu A, Ishizawa M, Yamada Y, Akiyama S.Thymidine phosphorylase activity associated with plateletderived endothelial cell growth factor. Biochem (Tokyo). 1993; 114(1): 9-14.
Relationships Between Biological and Clinicopathologic Features…
47
[178] Moghaddam A, Zhang HT, Fan TP, Hu DE, Lees VC, Turley H, Fox SB, Gatter KC, Harris AL, Bicknell R. Thymidine phosphorylase is angiogenic and promotes tumor growth. Proc Natl Acad Sci USA. 1995; 92(4): 998-1002. [179] Kylie A. Mechanisms by which tumor cells and monocytes expressing the angiogenic factor thymidine phosphorylase mediate human endothelial cell migration. Cancer Research 2003; 63: 527-533. [180] Ishikawa F, Miyazono K, Hellman U, Drexler H, Wernstedt C, Hagiwara K, Usuki K, Takaku F, Risau W, Heldin CH. Identification of angiogenic activity and the cloning and expression of platelet-derived endothelial cell growth factor. Nature. 1989; 338(6216): 557-562. [181] Moghaddam A, Bicknell R. Expression of platelet-derived endothelial cell growth factor in Escherichia coli and confirmation of its thymidine phosphorylase activity. Biochemistry. 1992; 31(48): 12141-12146. [182] Ezaki T, Ikegami T, Ishida T, Aimitsu S, Mori M, Fujihara M. Significance of thymidine phosphorylase in HCC with chronic liver disease for long-term postoperative recurrence. J Surg Oncol. 2003; 83(3): 173-179. [183] Morinaga S, Yamamoto Y, Noguchi Y, Imada T, Rino Y, Akaike M, Sugimasa Y, Takemiya S, Takanashi Y. Platelet-derived endothelial cell growth factor (PD-ECGF) is up-regulated in human hepatocellular carcinoma (HCC) and the corresponding hepatitis liver. Hepatogastroenterology. 2003; 50(53): 1521-1526. [184] Giatromanolaki A, Koukourakis MI, Comley M, Kaklamanis L, Turley H, O'Byrne K, Harris AL, Gatter KC. Platelet-derived endothelial cell growth factor (thymidine phosphorylase) expression in lung cancer. J Pathol. 1997; 181(2): 196-199. [185] Sato J, Sata M, Nakamura H, Inoue S, Wada T, Takabatake N, Otake K, Tomoike H, Kubota I. Role of thymidine phosphorylase on invasiveness and metastasis in lung adenocarcinoma. Int J Cancer. 2003; 106(6): 863-870. [186] Hotta T, Taniguchi K, Kobayashi Y, Johata K, Sahara M, Naka T, Watanabe T, Ochiai M, Tanimura H, Tsubota YT. Increased expression of thymidine phosphorylase in tumor tissue in proportion to TP-expression in primary normal tissue. Oncol Rep. 2004; 12(3): 539-541. [187] Luccioni C, Beaumatin J, Bardot V, Lefrancois D. Pyrimidine nucleotide metabolism in human colon carcinomas: comparison of normal tissues, primary tumors and xenografts. Int J Cancer. 1994; 58(4): 517-522. [188] Imazano Y, Takebayashi Y, Nishiyama K, Akiba S, Miyadera K, Yamada Y, Akiyama S, Ohi Y. Correlation between thymidine phosphorylase expression and prognosis in human renal cell carcinoma. J Clin Oncol. 1997; 15(7): 2570-2578. [189] O'Brien TS, Fox SB, Dickinson AJ, Turley H, Westwood M, Moghaddam A, Gatter KC, Bicknell R, Harris AL. Expression of the angiogenic factor thymidine phosphorylase/platelet-derived endothelial cell growth factor in primary bladder cancers. Cancer Res. 1996; 56(20): 4799-4804. [190] Watanabe Y, Nakai H, Ueda H, Nozaki K, Hoshiai H, Noda K. Platelet-derived endothelial cell growth factor predicts of progression and recurrence in primary epithelial ovarian cancer. Cancer Lett. 2003; 200(2): 173-176.
48
Takuma Nomiya, Kenji Nemoto and Shogo Yamada
[191] Nomiya T, Nemoto K, Nakata E, Takai Y, Yamada S. Expression of thymidine phosphorylase and VEGF in esophageal squamous cell carcinoma. Oncol Rep. 2006; 15(6): 1497-1501. [192] Takebayashi Y, Akiyama S, Akiba S, Yamada K, Miyadera K, Sumizawa T, Yamada Y, Murata F, Aikou T. Clinicopathologic and prognostic significance of an angiogenic factor, thymidine phosphorylase, in human colorectal carcinoma. J Natl Cancer Inst. 1996; 88(16): 1110-1117. [193] Toi M, Hoshina S, Taniguchi T, Yamamoto Y, Ishitsuka H, Tominaga T. Expression of platelet-derived endothelial cell growth factor/thymidine phosphorylase in human breast cancer. Int J Cancer. 1995; 64(2): 79-82. [194] Fukuiwa T, Takebayashi Y, Akiba S, Matsuzaki T, Hanamure Y, Miyadera K, Yamada Y, Akiyama S. Expression of thymidine phosphorylase and vascular endothelial cell growth factor in human head and neck squamous cell carcinoma and their different characteristics. Cancer. 1999; 85(4): 960-969. [195] Toi M, Gion M, Biganzoli E, Dittadi R, Boracchi P, Miceli R, Meli S, Mori K, Tominaga T, Gasparini G. Co-determination of the angiogenic factors thymidine phosphorylase and vascular endothelial growth factor in node-negative breast cancer: prognostic implications. Angiogenesis. 1997; 1(1): 71-83. [196] Berkman RA, Merril MJ, Reinhold WC, Monacci WT, Saxena A, Clark WC, Robertson JT, Ali IU, Oldfield EH. Expression of the vascular permeability factor/ vascular endothelial growth factor gene in central nervous system neoplasms. J. Clin. Invest. 1993; 91: 153-159. [197] Berse B, Brown LF, Van De Water L, Dvorak HF, Senger DR. Vascular permeability factor (vascular endothelial growth factor) gene is expressed differentially in normal tissues, macrophages, and tumors. Mol. Biol. Cell 1992; 3: 211-220. [198] Brown LF, Berse B, Jackman R, Togazzi K, Manseau EJ, Senger DR, Dvorak HF. Expression of vascular permeability factor (vascular endothelial growth factor) and its receptors in adenocarcinomas of the gastrointestinal tract. Cancer Res. 1993; 53: 47274735. [199] Millikan KW, Mall JW, Myers JA, Hollinger EF, Doolas A, Saclarides TJ. Do angiogenesis and growth factor expression predict prognosis of esophageal cancer? Am. Surg. 2000; 66(4): 401-406. [200] Kitadai Y, Haruma K, Tokutomi T, Tanaka S, Sumii K, Carvalho M, Kuwabara M, Yoshida K, Hirai T, Kajiyama G, Tahara E. Significance of vessel count and vascular endothelial growth factor in human esophageal carcinomas. Clin. Cancer Res. 1998; 4(9): 2195-2200. [201] Takahashi A, Sasaki H, Kim SJ, Tobisu K, Kakizoe T, Tsukamoto T, Kumamoto Y, Sugimura T, Terada M. Markedly increased amounts of messenger RNAs for vascular endothelial growth factor and placenta growth factor in renal cell carcinoma associated with angiogenesis. Cancer Res. 1994; 54: 4233-4237. [202] Ryu SY, Oka K, Tsujii H, Suzuki Y, Nakano T. Platelet-derived endothelial cell growth factor as a prognostic factor for radiotherapy outcome in patients with adenocarcinoma of the uterine cervix. Gynecol Oncol. 2003; 89(3): 414-419.
Relationships Between Biological and Clinicopathologic Features…
49
[203] Tsujitani S, Saito H, Maeta Y, Yamaguchi K, Tatebe S, Kondo A, Kaibara N. Neoangiogenesis in patients with gastric carcinoma in relation to the expression of vascular endothelial growth factor and thymidine phosphorylase. Anticancer Res. 2004; 24(3b): 1853-1859. [204] Ogura O, Kanzaki A, Bando H, Ogura T, Toi M, Takebayashi Y. Expression of thymidylate synthase and thymidine phosphorylase in human breast carcinoma: implication for method to detect expression of these molecules in clinic. Cancer Lett. 2003; 190(1): 97-104. [205] Patterson AV, Zhang H, Moghaddam A, Bicknell R, Talbot DC, Stratford IJ, Harris AL. Increased sensitivity to the prodrug 5'-deoxy-5-fluorouridine and modulation of 5fluoro-2'-deoxyuridine sensitivity in MCF-7 cells transfected with thymidine phosphorylase. Br J Cancer. 1995; 72(3): 669-675. [206] Yamaue H, Tanimura H, Kono N, Aoki Y, Tabuse K, Uchiyama K, Takifuji K, Iwahashi M, Tani M. Clinical efficacy of doxifluridine and correlation to in vitro sensitivity of anticancer drugs in patients with colorectal cancer. Anticancer Res. 2003; 23(3B): 2559-2564. [207] Koukourakis MI, Giatromanolaki A, Sivridis E, Fezoulidis I. Cancer vascularization: implications in radiotherapy? Int J Radiat Oncol Biol Phys. 48(2): 545-553, 2000 [208] Weidner N. Intratumor microvessel density as a prognostic factor in cancer. Am J Pathol. 1995; 147(1): 9-19. [209] Weidner N, Folkman J. Tumoral vascularity as a prognostic factor in cancer. Important Adv Oncol. 1996; 167-190. [210] Cherian MG and Chan HM. Biological functions of metallothionein: a review. In: Suzuki KT, Imura N and Kimura M (Eds.), Metallothionein III, Biological Roles and Medical Implications. pp. 87-109, Birkhauser, Basel, 1993 [211] Sato M and Bremner I. Oxygen free radicals and metallothionein. Free Radic. Biol. Med. 1993; 14, 325-337. [212] Cherian MG and Ferguson PJ. Metallothionein in cytotoxicity and genotoxicity of metals. In: Hadjiliadis ND. Heavy Metals Related to Human Environment, NATO ASI Series, 2, Environment, vol. 26, pp. 217-230, Kluwer, Dordrecht,1997 [213] Bakka A, Johnsen AS, Endresen L and Rugstad HE. Radioresistance in cells with high content of metallothionein. Experientia 1982; 38, 381-383. [214] Renan MJ, Dowman PI. Increased radioresistance of tumor cells exposed to metallothionein-inducing agents. Radiat Res 1989; 120(3): 442-455. [215] Kaina B, Lohrer H, Karin M, Herrlich P. Overexpressed human metallothionein IIA gene protects Chinese hamster ovary cells from killing by alkylating agents. Proc Natl Acad Sci USA 1990; 87(7): 2710-2714. [216] Koropatnick J, Pearson J. Altered cisplatin and cadmium resistance and cell survival in Chinese hamster ovary cells expressing mouse metallothionein. Mol Pharmacol 1993; 44(1): 44-50. [217] Lohrer H, Robson T. Overexpression of metallothionein in CHO cells and its effect on cell killing by ionizing radiation and alkylating agents. Carcinogenesis 1989; 10(12): 2279-2284.
50
Takuma Nomiya, Kenji Nemoto and Shogo Yamada
[218] Miura M, Sasaki T. Relationship between radiosensitivity and metallothionein content in clones from a mouse squamous cell carcinoma. Radiat Res 1990; 123(2): 171-175. [219] Nomiya T, Nemoto K, Nakata E, Miyachi H, Takai Y, Yamada S. Intrinsic radiosensitivity by metallothionein expression has no great influence on clinical radiosensitivity in esophageal carcinoma. Oncol Rep. 2004; 12(6): 1195-1199.
In: Oral Cancer Research Advances Editor: Alexios P. Nikolakakos, pp. 51-93
ISBN 978-1-60021-864-4 © 2007 Nova Science Publishers, Inc.
Chapter 3
PROGNOSTIC INDICATORS IN ORAL SQUAMOUS CELL CARCINOMA Márcio Diniz-Freitas1, Eva Otero-Rey1, Andrés Blanco-Carrión2, Tomás García-Caballero3, José Manuel-Gándara Rey2 and Abel García-García4 1
Oral Surgery and Oral Medicine Departments, School of Dentistry, University of Santiago de Compostela, Spain; 2 Department of Oral Medicine, School of Dentistry, University of Santiago de Compostela, Spain; 3 Department of Morphological Sciences, School of Medicine and Dentistry, Clinical University Hospital, University of Santiago de Compostela, Spain; 4 Department of Maxillofacial Surgery, Clinical University Hospital, University of Santiago de Compostela, Spain.
ABSTRACT Every year, more than 300,000 new cases of oral cancer are diagnosed worldwide. Oral squamous cell carcinomas (OSCCs) make up about 90 - 95% of these cases. Despite intensive research into treatment modalities for oral cancer, the 5-year survival rate has shown little improvement in recent decades. One of the reasons for this is that the TNM classification system (the conventional basis for treatment decisions, in conjunction with histological tumor grade) has proved not to be a consistently good predictor of prognosis. There is thus a pressing need for research into new prognostic indicators, with the aim of enabling the evaluation of the biological aggressiveness of each patient's particular tumor/s. In recent decades, considerable research effort has been dedicated to the identification of new markers of OSCC, with the aim of better predicting tumor behavior and clinical course. Certainly, an improved knowledge of the different biological mechanisms participating in carcinogenesis, as well as of cell proliferation, apoptosis,
Márcio Diniz-Freitas, Eva Otero-Rey, Andrés Blanco-Carrión et al.
52
tumor growth and tumor invasive capacity, may assist individual diagnosis, and help in the development of new treatment strategies. The aim of the present chapter is to briefly review the use of tumor markers for prediction of the biological behavior of OSCCs. The review is divided into three parts, considering first clinical markers, then histological markers, and finally immunohistochemical markers.
I. INTRODUCTION In recent decades there have been significant advances in the treatment of oral cancer, in radiotherapy and chemotherapy, and in surgical techniques for resection and reconstruction [1]. Despite this, however, survival rates have not significantly improved over this period [2]. The number of deaths per year attributable to oral cancer and its complications totals about 7800 in the USA (5100 men and 2700 women) and 900 in the UK [3]. In Brazil, deaths attributable to oral cancer in 2002 totaled 2715 in men and 700 in women, giving mortality rates of 3.15 and 0.78 deaths per 100,000 people per annum in men and women respectively [4]. In Spain, Nieto and Ramos [5] reported an increase in mortality due to oral cancer between 1975 and 1994. Note though that in this study we included cancers of the oropharynx, the lips and the salivary glands within their definition of oral cancer. Oral squamous cell carcinomas (OSCCs) make up about 90 - 95% of oral cancers [6]. Over recent decades, considerable research effort has been dedicated to the identification of new markers of OSCC, with the aim of better predicting tumor behavior and clinical course. Certainly, an improved knowledge of the different biological mechanisms participating in carcinogenesis, as well as of cell proliferation, apoptosis, tumor growth and tumor invasive capacity, may assist individual diagnosis, and help in the development of new treatment strategies. The aim of the present chapter is to briefly review the indicators currently available for prediction of the biological behavior of OSCCs. The review is divided into three parts, considering first clinical indicators, then histological indicators, and finally immunohistochemical markers. Note that this chapter does not consider genetic markers of potential utility in diagnosis and prognosis (including DNA microarray techniques): these are considered in Chapter "Current Trends in the Molecular Diagnosis of Oral Squamous Cell Carcinoma".
II. CLINICAL INDICATORS II.1. Age The prognosis for patients with OSCC is directly determined by tumor size, and in particular by dissemination to the cervical lymph nodes. However, in geriatric patients the prognosis may also be influenced by age-related factors, mainly because these patients often have compromised pulmonary, cardiovascular, renal and/or endocrine function. As a result,
Prognostic Indicators in Oral Squamous Cell Carcinoma
53
treatment plans for older patients may be restricted by factors of this type: notably, the more aggressive standard therapies may not be well tolerated, and may indeed reduce survival of these patients [7]. However, the influence of age on prognosis remains rather poorly understood. Some studies have not found any variation in survival with patient age [8,9], whereas a study by Varela-Centelles et al. [10] found that age, together with tumor size, was the principal determinant of survival in a sample of 94 patients with OSCC. OSCC rarely presents in young patients, although its incidence in younger age groups appears to be increasing [11]. In the literature, "young patients" have been diversely and arbitrarily defined, for example as patients younger than 30, 40 or 45 years [12,13,14]. For some authors young patients show more aggressive tumors with higher rates of relapse and cervical metastasis, and higher mortality [15]. However, a study by Rennie et al. [16] did not corroborate these findings. These authors found that the low incidence of OSCC in younger subjects was insufficient to allow reliable inferences about mortality rates, and suggested that the perception of the disease as more aggressive in younger patients may be influenced by emotional factors (i.e. patients and health-care professionals alike are particularly impacted by the appearance of a potentially fatal disease in a relatively young person). Recently, Sasaki et al. [17] have studied the clinico-pathological characteristics of OSCC in patients aged less than 40 years, but did not find any characteristics specific to this age group; neither did they find any differences in survival between patients aged < 40 years and ≥ 40 years.
II.2. Sex Due to the marked predominance of men in most series studied, few studies have attempted to evaluate the possible importance of sex as a prognostic factor. In fact, there appear to be no differences in prognosis between men and women [18,19,20], although some authors have reported lower survival in women, attributing this to longer delays in seeking medical care and to lower acceptance of treatment [21]. In contrast, Boffetta et al. [22] obtained higher survival rates in women than in men.
II.3. Location The limits of the oral cavity - unlike other areas of the body - are not always easy to define. Not surprisingly, then, the definition of the term "oral cancer" as regards location has proved very difficult for both clinicians and researchers. Often a variety of rather homogeneous tumor types has been grouped under this term. In most studies, tumors of the lips and salivary glands have not been included, due to their different histological structure, and to the fact that the lips are exposed to solar radiation. In some studies tumors of the oropharynx have been included. Several authors [23,24,25] have stressed the importance of defining "oral cancer" more precisely, in view of the rather lax use of this term in the research literature and textbooks. In
54
Márcio Diniz-Freitas, Eva Otero-Rey, Andrés Blanco-Carrión et al.
line with the latest edition of the WHO International Classification of Diseases (ICD), Moore et al. [24] have suggested that the term "oral cancer" should include tumors of the mobile part of the tongue, the floor of the mouth, the jugal mucosa, the mucosa of the upper and lower alveolar ridge, and the palate; tumors of the lips, oropharynx and salivary glands should be considered separately. As regards prognosis, it appears to be widely accepted that 5-year survival rates are lower for patients with tumors in more posterior intraoral locations [26,27]. It is well known that carcinomas of the lower lip have a more favorable prognosis than carcinomas in intraoral and oropharyngeal locations [28,29], and that intraoral carcinomas have better prognosis than oropharyngeal carcinomas [30]. These associations are explicable in terms of proximity to the lymph nodes, and to a lesser extent in terms of clinical stage, histological grade and characteristics of the invasive front (including mode of invasion, degree of perineural invasion, and degree of vascular invasion), as well as the ease with which clean surgical margins can be achieved, and the appearance of second primary tumors [31,32,33]. Thus, these between-location differences in tumor course and prognosis are probably partially (though not entirely) explained by differences in vascular and lymphatic networks [34]. As regards intraoral location, however, the results in the literature do not show close agreement. Zelefsky et al. [35] found worse prognosis in patients with lesions in the anterior 2/3 of the tongue (oral tongue) by comparison with patients with lesions on the floor of the mouth. Recently, Bell et al. [36] found no significant differences in prognosis when they compared the anterior 2/3 of the tongue with other intraoral locations.
II.4. Tumor Stage (TNM Classification) The TNM system is accepted worldwide as a classification system for diverse types of neoplasm. This system evaluates the anatomic extension of malignant solid tumors, and is a key indicator of best treatment, as well as an important prognostic factor. Among the most widely used classifications in oral cancer is the staging classification proposed by the American Joint Committee on Cancer (AJCC) [37]. In this classification, stage is determined by the size of the primary lesion and by regional dissemination (to cervical lymph nodes) or distant dissemination. Cure rates for oral cancer depend on stage: the 5-year survival rate is 80% in initial stages, 40% in patients with regional involvement, and less than 20% in patients with distant metastasis [38]. Early detection significantly increases the possibility of a successful cure. At the moment of diagnosis, 36% of patients show localized disease, 43% disease with regional involvement, and 9% distant metastasis; in the remaining 12% of patients disease stage is not readily identifiable [39]. These findings suggest that early diagnosis of this disease is poor, bearing in mind that squamous cell carcinomas are formed in the superficial epithelium of the oral cavity, leading to visible changes at an early stage. Early detection of asymptomatic stages ensures not only improved survival, but also better quality of life for the patient, since aggressive treatments will be less frequently required [40,41].
Prognostic Indicators in Oral Squamous Cell Carcinoma
55
In a series of 47 patients with OSCC [42,43], we found that stages T and N independently correlated with patient survival in univariate analyses; in multivariate analyses, however, stages T and N were not statistically significant predictors of prognosis, and only the final clinical stage correlated with survival. These results indicate that combined consideration of tumor size and cervical lymph node involvement may allow more accurate assessment of prognosis in patients with oral cancer. Cervical metastasis is relatively frequent in oral cancer, and it has been suggested that this is in fact the principal indicator of prognosis [44,45]. It seems that metastatic dissemination to cervical lymph nodes is directly correlated with primary tumor size. It has been demonstrated that T1 tumors of the tongue and floor of mouth undergo cervical metastasis in 14% and 11% of cases respectively, versus 77% and 54% respectively for T4 tumors in these locations [46]. In our series of patients with OSCC, the presence of palpable cervical adenopathies, and the incidence of regional relapse, were also correlated with the size of the primary tumor. However, cervical metastases may also develop from relatively small tumors (T1 or T2, n=12), while conversely large tumors may course without cervical metastasis (T3 or T4, n = 7). Since the initial development of the AJCC TNM classification it has been revised various times. In relation to oral cancer, several modifications of the 5th edition have recently been proposed. Additionally, the German-Austrian-Swiss group for the study of tumors of the maxillofacial region (DÖSAK) has demonstrated in an extensive retrospective study of 1532 cases of primary oral cancer that modification of the TNM classification to include tumor thickness significantly improves prediction of 5-year survival rates [47]. Other studies have likewise demonstrated that tumor thickness is of prognostic value in patients with oral cancer [48,49], but nevertheless this parameter has not yet been included in the TNM system. Although it includes important prognostic factors, the TNM system does not accurately predict the biological properties of tumors. For example, the system does not explain the considerable proportion of small tumors that show poorer course than expected [50].
III. HISTOLOGICAL INDICATORS III.1. Tumor Grade (Degree of Differentiation) Histologically, OSCCs are characterized by the presence of invasive islets and/or cords of malignant epithelial cells similar to those of the spinous layer. Neoplastic cells generally present an abundant eosinophilic cytoplasm with large nuclei and increased nucleus-tocytoplasm ratio. Diverse degrees of cellular and nuclear pleomorphism are often observed [51]. Although developed a long time ago, the classification of Broders [52] is still widely used to evaluate histological grade, in terms of degree of similarity between the tumor and the normal architecture of the epithelium. Carcinomas that produce significant quantities of keratin and show some degree of maturation from the basal to surface layers are classed as well differentiated. Carcinomas that do not produce keratin, but in which some degree of stratification is apparent despite deviation from the normal architecture, are classed as
Márcio Diniz-Freitas, Eva Otero-Rey, Andrés Blanco-Carrión et al.
56
moderately differentiated. When keratin is not produced the tumor bears little resemblance to the normal architecture and shows frequent cellular anomalies; these carcinomas are classed as poorly differentiated [53,54]. Histological grade is closely related to biological behavior. Well-differentiated tumors typically show slower growth and produce metastases at later stages. In contrast, poorly differentiated tumors typically grow more rapidly and metastasize in early stages. However, the process of histological grading of OSCCs remains a subjective process that depends strongly on the individual judgment of the observer. In most cases, clinical [TNM] staging would appear to be more effective than histological grading as a prognostic indicator. Histological grading of OSCCs is almost always done with conventional light microscopy, although immunohistochemical techniques using cytokeratin markers may be useful for distinguishing poorly differentiated or non-differentiated tumors from other malignant lesions. A special form of OSCC is verrucous carcinoma, characterized histologically by its broad base of implantation and its papillary formation. Deep crypts containing keratin plugs are typically observed between elongated surface projections. The epithelium is dysplastic, but only rarely shows pronounced dysplastic traits. The basal membrane remains intact, and there is often a chronic infiltrate of inflammatory cells in the underlying connective tissue. The interface between the tumor and the adjacent normal epithelium is generally well defined, with minimal or zero invasion of epithelial cells along the length of the broadly curving invasive front of the bulb-shaped epithelial crest [55,56]. Histological grading has been used for decades to predict the prognosis of patients with OSCC. The prognostic value of the different systems used has varied considerably [57]. Degree of differentiation as assessed by Broders' system or similar has been considered a useful predictor of dissemination to the cervical lymph nodes [58]. Recently, Kademani et al. reported a higher rate of cervical metastasis and reduced survival in patients with poorly differentiated tumors. These authors also found that it is more difficult to achieve clean surgical margins in resections of poorly differentiated tumors.
a
b
c
Figure 1. Examples of OSCCs showing different degrees of differentiation (a, well differentiated; b, moderately differentiated; c, poorly differentiated).
Prognostic Indicators in Oral Squamous Cell Carcinoma
57
III.2. The Invasive Front Pathologists have been aware for several decades that tumor cells in the most invasive areas of malignant tumors differ substantially from those in other central and surface areas. In view of this, in 1992 Bryne et al. [59] proposed a new approach to histological classification of OSCCs, considering only those cell layers showing deep invasiveness, and their interface with the host tissue (the "deep invasive front"). This approach, a simplification and modification of the multifactorial approach proposed by Anneroth et al. [60], offers highly significant additional information in patients with the same TNM stage. The approach is based on quantitative evaluation of histological parameters including degree of keratinization, nuclear polymorphism, pattern of invasion, and lymphocytic infiltration. Its prognostic value has been confirmed in diverse studies of carcinomas of the head and neck [61,62].
III.3. Pattern of Invasion Pattern of invasion, a factor common to the various classifications of the invasive front, has proved to be one of the most important parameters for predicting the course and prognosis of OSCCs. Although the scales used for classification of pattern of invasion show some differences, they mostly consider that increasing cellular dissociation is an indicator of increased tumor invasiveness, more aggressive clinical behavior, increased number of local and regional relapses, and poorer prognosis. Spiro et al. [63] have suggested a simplification of Bryne et al.'s classification of the deep invasive front (Figure 2). These authors studied pattern of invasion in squamous cell carcinomas of the tongue. They found that the pattern was associated with both patient age and TNM stage, but not with histological grade. The survival of patients with tumors showing a more invasive pattern was significantly lower than in patients with less invasive tumors. Bundgaard et al. [64] studied 8 histological parameters in 78 stage-I OSCCs, finding that pattern of invasion was the only factor with prognostic value in this patient group. We concluded that evaluation of pattern of invasion was a useful alternative to other more complex methods in which several histological parameters must be considered. Tumors with a more invasive histological pattern are typically associated with the appearance of local relapses [65], possibly because of the greater difficulty of achieving clean surgical margins without neoplastic infiltration in tumor resections. Together, these findings suggest that pattern of invasion is a criterion worth taking into account when selecting postoperative adjuvant treatments with radio- and/or chemotherapy.
Márcio Diniz-Freitas, Eva Otero-Rey, Andrés Blanco-Carrión et al.
58
a
b
c
d
Figure 2. a) Tumor with well-defined margins pressing against adjacent tissue; b) tumor with margins infiltrating the adjacent tissue in solid cords; c) tumor with margins containing groups or cords of infiltrating cells (> 15 tumor cells per group or cord); and d) tumors showing marked cellular dissociation giving rise to small groups (<15 tumor cells per group) and even isolated single tumor cells.
III.4. Tumor Thickness (Depth of Tumor Invasion) Many authors have observed that tumor thickness (tumor depth) is better correlated with metastasis to cervical lymph nodes and survival than surface diameter. Some studies have tried to relate tumor thickness to local relapse and cervical metastasis [66,67,68]. Recent studies have demonstrated that tumor thickness is a significant prognostic factor in squamous cell carcinomas of the tongue, probably because access to the lymphatic system is a key determinant of regional dissemination [69]. Although most studies have confirmed that tumor thickness is an important prognostic indicator, there does not appear to be a consensus about cut-off values for discriminating tumors with poor and better prognosis. Spiro et al. found poorer prognosis in patients with tumor thickness greater than 2 mm. Brown et al. found poorer prognosis in patients with tumor thickness greater than 3 mm, and González-Moles et al. [70] likewise found a lower survival rate among patients with tumor thickness greater than 3 mm. In addition, these latter authors did not find differences in survival rate between patients with tumor thickness 4 - 7 mm and patients with tumor thickness > 7 mm. Urist et al. [71] proposed a tumor thickness
Prognostic Indicators in Oral Squamous Cell Carcinoma
59
cut-off value of 6 mm for distinguishing poor from better prognosis. We ourselves have found that patients with tumor thickness ≥ 8 mm show significantly poorer prognosis than patients with tumor thickness < 8 mm. These discrepancies between previous studies may be partly due to the fact that the methodology for measuring tumor thickness has varied considerably between studies. Although most authors have used an optical micrometer, others have not specified how measurements were obtained [72,73]. Some authors have defined tumor thickness as the distance between the deepest point of invasion and the tumor surface, while others have defined it as the distance between the deepest point of invasion and an imaginary line representing the reconstructed continuation of the basal membrane of the adjacent normal mucosa. In addition, in some studies the authors have explicitly excluded keratinized layers or inflammatory infiltrate from the measurements of tumor thickness, while other authors do not specify whether these layers were included or not. Assuming that normal tissue shows a greater resistance to deep invasion than to lateral tumor extension, it may be expected that the greater the capacity for deep invasion, the more aggressive will be the tumor. Thus for González-Moles et al. the tumor mass that reveals the tumor's capacity for deep growth, and thus its aggressiveness, is that observed below the imaginary line reconstructing the basal membrane of the adjacent normal mucosa (Figure 3), since this mass reflects the potential for destruction by neoplastic cells. According to these authors, exophytic growth of the tumor should not be taken into account, because it does not represent the tumor's real capacity for deep invasion against strong resistance. On the same grounds, these authors suggest that the space left below the basal membrane of ulcerated tumors should be taken into account, since it reflects the tumor's destructive capacity.
Figure 3. Measurement of tumor thickness as the distance between the deepest point of invasion and an imaginary line reconstructing the basal membrane of the adjacent normal mucosa.
60
Márcio Diniz-Freitas, Eva Otero-Rey, Andrés Blanco-Carrión et al.
III.5. Surgical Margins For some authors, one of the most important individual prognostic factors is degree of extirpation of the tumor, with failure to completely remove the primary tumor tissue being the principal cause of death in OSCC patients [74]. If neoplastic cells are present at the surgical margin, the local relapse rate will increase substantially and the survival rate will decline [75,76]. There is likewise disagreement in the literature about the effects of post-resection adjuvant treatment with radio- and/or chemotherapy in patients with positive surgical margins. Kovács [77] found that postoperative treatment with radio- and/or chemotherapy did not improve survival rate in patients with surgical margins showing tumor infiltration under microscopy. However, Zelefsky et al. [78] reported good results from postoperative radiotherapy of tumors with positive surgical margins. In another study, radiotherapy was reported to reduce the risk of relapse, but not to the same degree as in patients with tumorfree margins. A potential problem with many studies that have investigated the relationship between surgical margin status and prognosis has been the use of univariate analyses. Tumor relapse occurs in response to multiple interacting factors [79]. Some studies using multivariate analyses have not been able to demonstrate an independent relationship between surgical margin status and local relapse or survival [80]. In addition, the histological identification of positive surgical margins appears to be problematic, and a system of molecular staging based on detection of genetic alterations in neoplastic cells has been proposed. The detection of mutations in the p53 gene by PCR allowed identification of neoplastic cells in 13/25 patients with histologically negative surgical margins, and 5 of these patients suffered local relapse, versus no relapse in any of the 12 patients with negative margins by this technique [81]. In another similar study, mutations of the p53 gene were detected in 72% of tumors with margins assessed as negative by histological methods [82]. The presence of genetic alterations in the histologically normal epithelium adjacent to the tumor may explain the lack of relationship between surgical margin status and survival.
III.6. Perineural and Vascular Invasion Perineural invasion is a recognized route of dissemination in tumors of diverse histological types in the head and neck region. In the literature, reports of the prevalence of perineural invasion in carcinomas of the head and neck have ranged from 6 to 30% [83]. This wide variation may be one of the causes of the contradictory reports in the literature as regards the prognostic value of perineural invasion. Rahima et al. found perineural invasion to be associated with regional relapses, distant metastases and reduced 5-year survival. Perineural invasion correlates with other histological parameters, such as tumor grade and depth of invasion, suggesting that tumors showing perineural invasion are more aggressive.
Prognostic Indicators in Oral Squamous Cell Carcinoma
a
61
b
Figure 4. a) Perineural invasion; b) vascular invasion.
As with perineural invasion, the prognostic value of vascular invasion in OSCC is likewise controversial: some authors have found a relationship with prognosis [84,85,86,87], while others have not [88,89]. These discrepancies between studies may be partially attributable to differences in sensitivity in detection of perineural and vascular invasion (Figure 4). Recently, Kurtz et al. [90] have demonstrated that immunohistochemical techniques can increase the rate of detection of perineural invasion (mAb S100) and vascular invasion (mAb CD31) in OSCC, suggesting that these techniques may have diagnostic and prognostic value. In the same study, the authors found that vascular invasion (though not perineural invasion) was significantly associated with prognosis. The use of immunohistochemical markers in OSCC is discussed in the next section.
IV. IMMUNOHISTOCHEMICAL MARKERS Immunohistochemistry is without doubt the technique that has had greatest impact on disease diagnostics in recent decades [91]. The current importance of immunohistochemistry is demonstrated by its application in more than 20% of tumor diagnoses [92]. However, immunohistochemical demonstration of specific cell proteins is not only used as a diagnostic technique, but also to predict the behavior of certain types of tumor (i.e. for prognostic) and their response to specific new treatment modalities (i.e. for treatment selection) [93,94]. The methodologies used may involve simple detection of stained tumor cells, or may use scales for the quantitation of staining intensity. Immunostaining can also be used to identify and highlight specific structures for prognosis, such as peritumoral blood vessels and microscopic metastases. The pathogenesis of oral cancer, like that of other types of malignant solid tumor, depends on the acquisition of six fundamental capabilities by the neoplastic cells: 1) growth independent of growth-promoting signals, 2) insensitivity to growth-inhibiting signals, 3) avoidance of programmed cell death (apoptosis), 4) unlimited proliferative potential, 5) induction of angiogenesis, and 6) capacity to invade tissues and metastasize (Figure 5) [95]. These behaviors are not independent, and are the result of a complex multi-stage process of genetic alterations. In OSCC, immunohistochemical techniques have been used to identify behaviors of this type and to predict biological behavior. Some of the more important immunohistochemical markers used are discussed in what follows.
62
Márcio Diniz-Freitas, Eva Otero-Rey, Andrés Blanco-Carrión et al.
Figure 5. Capabilities that are acquired by cells during malignant solid tumor development.
IV.1. Oncogenes IV.1.a. Epidermal Growth Factor Receptor (EGFR) EGFR is a glycoprotein forming part of the c-erbB receptor family, comprising transmembrane receptors with intrinsic tyrosine kinase activity. The family has four members: EGFR (c-erbB-1/HER-1), c-erbB-2 (HER-2/Neu), c-erbB-3 (HER-3) and c-erbB-4 (HER-4) [96]. EGFR is coded by the EGFR gene (erbB1) located on chromosome 7 (7p13-q22). It binds various ligands, including epidermal growth factor (EGF), transforming growth factor α (TGF-α), amphiregulin, betacellulin, crypto and epiregulin. Ligand binding to EGFR's extracellular domain induces homo- or heterodimerization, resulting in autophosphorylation of tyrosine residues in the receptor's intracellular domain, and consequent activation of intracellular signaling cascades. This autophosphorylation induces activation of signal transduction cascades [97], leading eventually to cell proliferation, inhibition of apoptosis, stimulation of invasion, and metastasis (Figure 6) [98]. Over-expression of EGFR in human cancer was first described in a vulvar epidermoid carcinoma cell line [99]. Subsequently, over-expression of EGFR has been observed in a wide variety of human tumors, including tumors of the breast, ovary, prostate, bladder, lung, brain and pancreas [100]. Over-expression of EGFR is likewise frequent in oral cancer, and 30% of cases showing over-expression of the protein show EGFR gene amplification [101,102].
Prognostic Indicators in Oral Squamous Cell Carcinoma
63
Figure 6. Carcinogenic involvement of the epidermal growth factor receptor. (Adapted with permission from Harari PM. Epidermal growth factor receptor inhibition strategies in oncology. Endocrine-Related Research 2004;11:689-708. © Society for Endocrinology .
In premalignant lesions, EGFR expression seems to increase proportionally to the degree of epithelial dysplasia. Grandis et al. [103] found increased expression of EGFR in dysplastic mucosa adjacent to squamous cell carcinomas of the head and neck region, by comparison with normal oral mucosa in control patients. In addition, they found that expression of EGFR increased with increasing dysplasia severity, and that EGFR expression was markedly higher in squamous cell carcinoma than in precancerous dysplastic mucosa. Similar findings were reported by Shin et al. [104],who additionally observed that with increasing dysplasia severity, EGFR over-expression extended into more superficial layers of the epithelium. EGFR gene amplification and increased EGFR expression in oral cancer are associated with tumor differentiation and aggressiveness [105]. It has been reported that OSCCs showing EGFR over-expression respond better to chemotherapy than non-EGFRoverexpressing tumors. This is possibly because EGFR-overexpressing tumors show higher proliferative activity, and thus greater sensitivity to cytotoxic drugs [106]. Recent research suggests that anti-EGFR antibodies may be useful in the treatment of premalignant and malignant lesions showing EGFR over-expression [107]. Cells showing EGFR over-expression show a growth advantage over normal cells, especially when the EGFR over-expression is accompanied by increased expression of its ligand TGF-α [108]. The observation of increased EGFR expression in peritumoral tissues adjacent to tumors may explain the early relapse and second primary tumors rather frequently seen after surgery, and anti-EGFR therapies may be especially indicated in these patients. Studies of the prevalence of EGFR immunoreactivity in OSCCs have obtained contradictory results. Sakai et al. [109] found EGFR expression in 14.8% of cases of OSCC, while Kusukawa et al. [110] detected EGFR expression in only 30.8% of cases.
64
Márcio Diniz-Freitas, Eva Otero-Rey, Andrés Blanco-Carrión et al.
The prognostic significance of EGFR expression level in OSCCs is controversial. Some authors have found that higher EGFR expression levels are significantly correlated with less favorable prognosis, while others have reported the opposite relationship [111]. Still other studies have found no correlation between EGFR expression and patient survival [112]. Partridge et al. were among the first researchers to investigate EGFR expression in OSCC. They studied 20 cases and did not find any correlation between EGFR expression and tumor grade, disease-free interval or survival. Subsequently, Bergler et al. found correlation between EGFR expression and tumor stage. Maiorano et al. [113] evaluated EGFR expression in the cytoplasm and membrane of neoplastic cells, finding expression in 36% of cases. In addition, patients with tumors showing expression of EGFR in the cell membrane and/or cytoplasm showed a more favorable prognosis. When EGFR expression was observed only in the membrane, the correlation with improved prognosis was more significant. Ulanovski et al. [114] found expression de EGFR in 34% of 23 SCCs of the tongue. These authors found higher EGFR expression in tumors with lower histological grade. They did not find any correlation between EGFR expression and tumor thickness or N stage, both important predictors of tumor progression. They likewise found no association between EGFR expression and the presence of cervical metastases, recurrence or survival. Bankfalvi et al. [115] observed a correlation between EGFR expression and pattern of invasion in 75 cases of OSCC. In addition, they observed correlation between EGFR expression and T stage. Over-expression of EGFR was associated with unfavorable prognosis. Störkel et al. [116] studied the prognostic value of EGFR expression in 100 patients with OSCC. All cases showed EGFR expression: in addition, EGFR expression levels showed a positive correlation with a malignancy grading of the invasive tumor areas, and a strong negative correlation with 5-year survival. Yamada et al. [117] observed EGFR expression in 51% of OSCCs, but no correlation with tumor grade. Laimer et al. [118], in a study of 109 cases of oral and oropharyngeal SCC using tissue microarrays (TMAs), found that over-expression of EGFR was significantly associated with reduced survival. Xia et al. [119] evaluated the prognostic value of EGFR (HER-1), HER-2, HER-3 and HER-4 in 47 cases of OSCC, and found significant relationships between all four markers and survival. The combined presence of EGFR/HER-2/HER-3 was a better predictor of survival than any of the individual markers. Thus some studies have indicated that over-expression of EGFR has prognostic value in OSCC, being associated with reduced survival. As noted, however, not all studies have obtained this result: for example, Smid et al. [120] did not detect any relationship between EGFR expression and survival in patients treated by surgery and subsequent radiotherapy. Discrepancies between studies may be related to any of diverse factors, including the technique used for determining EGFR expression level (sensitivity and specificity, tissue fixation time, pretreatment procedures, antibodies), the small number of patients in some studies, variation in the localization, stage and treatment of the lesions, short follow-up times, and use of different statistical methods. The apparently critical role of EGFR expression in carcinogenesis has led to extensive research aimed at identifying selective inhibitors of EGFR-mediated signaling. Important strategies currently at the clinical development stage include immunotherapy using monoclonal antibodies and chemotherapy using tyrosine kinase inhibitors. The optimal use of
Prognostic Indicators in Oral Squamous Cell Carcinoma
65
therapies of this type requires quantitative determination of EGFR expression by each tumor, since they can only be usefully applied to tumors showing EGFR over-expression. In view of the contradictory data on the frequency of EGFR over-expression, there is a clear need for standardized immunohistochemical procedures for diagnostic determination of EGFR in OSCC. FDA approval of a commercial kit for this purpose would be a useful first step. In a study of 47 patients by our group, using the EGFR PharmDX kit (Dako), 98% of subjects showed EGFR expression, and over-expression (complete or incomplete moderateintensity staining of the cell membrane in >10% of neoplastic cells) was observed in 74% of subjects. Using the same kit, Schartinger et al. [121] detected EGFR expression in 70.5% of oral and oropharyngeal SCC samples. Due to the high frequency of over-expression of EGFR obtained in these two studies, we agree with the view that therapies based on inhibition of EGFR-mediated signaling may be of value in OSCC patients. IV.1.b. Cyclin D1 The cyclins, together with the cyclin-dependent kinases (CDKs), are upregulators of cell cycle progression. The product of the CCND1/cyclin D1 gene phosphorylates the product of the retinoblastoma gene Rb, inducing transition from the G1 phase to the S phase of the cell cycle. Cyclin D1 activity is inhibited by diverse tumor suppressor genes, including p16, p21 and p27 [122]. Increased expression of cyclin D1 in OSCCs is correlated with more advanced tumor grade [123] Cyclin D1 over-expression has been detected in 32% [124] and 68% [125] of OSCCs. Few studies have investigated the association between cyclin D1 expression and OSCC prognosis. Some such studies have found a correlation between cyclin D1 overexpression and unfavorable prognosis (regional metastasis and poorer survival) [126], but other studies have found no such relationship [127].
IV.2. Tumor Suppressor Genes IV.2.a. The p53 Gene Mutation of the tumor suppressor gene p53 is one of the most frequent and most studied genome changes in human cancer [128]. The p53 gene is located on the short arm of chromosome 17, and codes a 53-kDa phosphoprotein whose function is to regulate gene transcription, DNA synthesis and repair, coordination of the cell cycle and programmed cell death. [129] These functions reflect the capacity of p53 to modulate the expression of diverse genes [130]. Under normal conditions, p53 detects DNA damage and interrupts cell cycle progression at the G1-S transition. After DNA damage, p53 levels increase, stimulating expression of the protein p21, coded by the gene WAF1/CIP1. This protein is an inhibitor of the CDKs that block phosphorylation of pRB, which in turn blocks release of transcription factor E2F, preventing DNA replication [131]. However, expression of WAF1/CIP1 can also be induced via p53-independent routes, for example by growth factors including platelet-derived growth factor (PDGF), fibroblast growth factor (FGF) and transforming growth factor beta (TGF-β).
66
Márcio Diniz-Freitas, Eva Otero-Rey, Andrés Blanco-Carrión et al.
If for any reason there is a failure in this control mechanism, p53 induces apoptosis, thus preventing proliferation of cells with damaged DNA. Mutations in the p53 gene allow neoplastic cells to pass from G1 to S phase, propagating their genetic alterations, which may lead to the inactivation of other tumor suppressor genes or the activation of oncogenes [132]. In OSCC, mutations of the p53 gene appear to occur before the transition from superficial to invasive carcinoma [133]. Mutations of the p53 gene are typically point mutations or deletions. Point mutations may give rise to a structurally altered protein that sequesters and inactivates the wildtype protein; deletions simply give rise to partial or total loss of p53 expression and function. Additionally, some p53 mutations may give rise to p53 over-expression, frequently seen in epithelial dysplasia and OSCCs. Dysplastic lesions showing p53 over-expression have increased risk of malignant transformation [134], and p53 mutations in cancers of the head and neck region are associated with high tumor aggressiveness and poor prognosis [135,136], so that p53 is certainly a useful prognostic marker in OSCC. However, studies of p53 expression in OSCC have obtained contradictory results: some studies have found no relationship with survival [137,138,139], while others have found that p53 overexpression is associated with lower survival [140,141]. These different results are attributable to variation among studies in factors like sample size and heterogeneity, type of tissue analyzed, tissue pretreatments, antibodies used, and the threshold used to define overexpression. IV.2.b. The p27 Gene The p27/KIPL gene, located on chromosome 12 (12p12-12p13.1), likewise has an important role in detaining the cell cycle in G1 phase, regulating proliferation via binding and inhibition of the G1 cyclin/Cdk protein kinase. Mutations of p27 are rare, but have been described in diverse types of malignant human tumor [142]. In addition, several studies have reported loss or reduction of p27 in diverse types of neoplasia. Down-regulation of p27 has been associated with increased tumor aggressiveness and reduced survival [143]. Although p27 mRNA levels do not change during the cell cycle, p27 protein levels do vary, peaking during the G1 and G0 phases. The lower p27 levels at other phases are principally due to increased degradation rates. In normal oral epithelium, the cells of the spinous and granular layers show intense expression of p27 in the nucleus [144]. Several studies have reported that p27 expression is reduced in lesions with severe epithelial dysplasia, and that expression is further reduced in lesions that progress to OSCC [145,146]. Reduced p27 levels have also been reported in early stages of OSCC invasion [147]. These studies have indicated that the reduction in p27 expression occurs at very early stages of oral carcinogenesis. Various studies have suggested that reduced p27 expression may be a useful prognostic marker in patients with OSCC. Kudo et al. [148] reported reduced p27 levels in 87% of cases, and these reduced levels were correlated with more aggressive tumor behavior, including increased metastatic potential and reduced patient survival.
Prognostic Indicators in Oral Squamous Cell Carcinoma
67
IV.3. Cell Proliferation Markers Cell proliferation can be defined as an increase in cell number resulting from cell division, i.e. cell cycle termination [149]. The rate of proliferation of a cancer cell population depends on various factors such as the proportion of cells that are proliferating (the growth fraction), the duration of the cell cycle (cell cycle time), and the rate of cell loss due to cell death and differentiation (cell loss factor). Study of the growth fraction is particularly important: the higher the growth fraction, the faster the growth of the tumor. Hyperproliferation is an early (though not specific) marker of tissue growth disorders. It is generally accepted that an increase in proliferation is associated with more advanced lesions, and that the distribution of proliferative cells in the tissue may give more information on the regulatory mechanism that has failed during the process of multistep carcinogenesis. Various methods have been described for quantifying cell proliferation rate. Among the immunohistochemical markers most commonly used to this end is Ki-67/MIB-1 [150].
IV.3.a. Ki-67 (MIB-1) The antigen Ki-67 is a non-histone nuclear protein expressed in all phases of the cell cycle (G1, S, G2 and M), but absent from resting cells (G0) [151]. The gene for this antigen is located on the long arm of chromosome 10 (10q25) [152]. Ki-67 expression begins in phase G1, increases gradually during phases S and G2 and peaks during mitosis (M) [153]. During interphase, Ki-67 can be detected only during the nucleus, while during mitosis much of the protein is transferred to the chromosomal surface. It is rapidly degraded when the cell enters the non-proliferative state [154], and there does not appear to be Ki-67 expression during the DNA repair process [155]. The precise function of this protein remains unknown [156] Ki-67 can be detected with polyclonal anti-Ki-67 antibody or with the anti-Ki-67 monoclonal MIB-1: the former works only in freeze-cut sections, while the latter works in paraffin sections, and is thus more widely used [157]. Ki-67 immunostaining (often called Ki-67/MIB-1 staining) generally has less background and more contrast than staining for proliferating cell nuclear antigen (PCNA), so that staining with Ki-67 immunostaining is easier to interpret and quantify. Thus immunodetection of Ki-67 is a useful way of assessing the growth fraction in normal and malignant tissues [158] and assessments of the density of Ki-67-positive cells (referred to as "Ki-67 proliferative index" or similar) are widely used. Premalignant lesions in diverse anatomical locations are characterized by increased cell proliferation [159,160], generally related to the degree of epithelial dysplasia. Thus cell proliferation markers may be useful for evaluation of the type and stage of oral premalignant lesions. The changes in proliferative capacity of oral premalignant lesions may reveal early preneoplastic changes and indicate their potential for malignant transformation. It has also been demonstrated that Ki-67 immunostaining intensity is associated with the histological grade of leukoplakic lesions of the oral cavity, increasing with increasing severity of dysplasia [161,162]. These observations suggest that disturbances of proliferation may be an early consequence of exposure to carcinogenic agents. However, Ki-67 immunostaining in premalignant lesions has not yet been shown to have prognostic value [163].
68
Márcio Diniz-Freitas, Eva Otero-Rey, Andrés Blanco-Carrión et al.
Ki-67 immunostaining was recently studied in malignant and premalignant lesions of the oral cavity [164]. In hyperkeratotic lesions and dysplastic lesions Ki-67/MIB-1 is seen both in the basal and suprabasal layers of the epithelium, while in normal oral mucosa it is generally restricted mostly to the basal layer. In OSCC lesions most malignant cells show intense Ki-67 immunostaining (Figure 5). Cell proliferation as measured by Ki-67 expression at the tumor invasion front has been shown to be closely correlated with tumor grade [165]. Intense Ki-67 immunostaining in OSCCs is associated with poor prognosis [166,167]. In fact, not only quantitative but also qualitative evaluations may be indicative of OSCC behavior. Suprabasal expression of Ki-67 in dysplastic oral lesions and malignant oral lesions is correlated with poor prognosis, with recurrences and with cervical metastasis [168]. It has been reported that Ki-67 immunostaining is an indicator of treatment failure. In a large series of SCCs of the oral cavity and oropharynx treated by surgery and radiotherapy, intense Ki-67 immunostaining was indicative of early recurrence [169]. Similar results were described in OSCCs of the tongue. Bortoluzzi et al. [170] found that Ki-67 immunostaining in OSCCs declined with advancing tumor grade. However, Sittel el al. did not detect any relationship between Ki-67 immunostaining level and tumor grade, though staining level was higher in tumors showing subsequent recurrence than in tumors not showing recurrence. Furthermore, tumors with above-average Ki-67 immunostaining showed a significantly shorter time to recurrence. All patients were treated with surgery and radiotherapy, so the authors concluded that proliferation capacity as measured by Ki-67 immunostaining is a useful indicator of early recurrence risk in patients treated in this way. De Vicente et al. found that higher proliferation capacity as indicated by Ki-67 immunostaining was associated with more advanced tumor grade. However, the authors did not find any relationship between proliferation capacity and survival. Xie et al. did not find any relationship between Ki-67 immunostaining and tumor size, N stage, clinical stage or tumor grade. However, Ki-67 immunostaining was more intense in tumors subsequently showing a lower disease-free interval. Silva et al. [171] found that Ki-67 immunostaining was lower in head and neck SCC patients with shorter survival. Tumuluri et al. analyzed proliferation capacity as indicated by Ki-67 immunostaining at the tumor invasion front in OSCCs. Their index of cell proliferation was obtained by counting number of positive cells per mm2 of epithelium using an automatic image analysis system specifically designed for the study. They found higher proliferation at the invasion front of tumors larger than 5 mm and in advanced-stage tumors (stages III and IV). In addition, N2-stage tumors showed higher proliferation than N0- and N1-stage tumors. Interestingly, proliferation was significantly higher in N0 tumors than in N1 tumors. This fact, which initially appears contradictory, was attributed by the authors to the possibility that in some patients with N0 tumors, positive lymph nodes may not be detected by palpation. Finally, the authors found more intense Ki-67 immunostaining in tumors showing distant metastasis. Note though that other studies have not found any relationship between proliferation (as indicated by Ki-67 immunostaining) at the tumor invasion front and cervical lymph node involvement or survival [172]. Bettendorf and Herrmann [173] studied Ki-67 immunostaining in 329 OSCCs. Staining intensity was positively correlated with histological tumor grade, pattern of invasion, tumor size and invasion depth, cervical lymph node status, and 5-year survival rate. Ki-67
Prognostic Indicators in Oral Squamous Cell Carcinoma
69
immunostaining intensity in individual patients did not show any association with prognosis. Stoll et al. [174] studied Ki-67 immunostaining in 107 SCCs of the oral cavity and oropharynx, and did not find any relationship between Ki-67 immunostaining and diseasefree interval or survival.. A study of 47 OSCCs by our group did not detect any relationships between Ki-67 immunostaining and histological parameters, recurrence, disease-free interval or survival. Thus Ki-67 immunostaining, generally using MIB-1, has been widely used to evaluate cell proliferation (growth fraction); however, the precise method used has varied widely. Some authors have recommended quantification of number of positive cells per square millimeter of section, or in the case of dysplastic lesions per millimeter length of the basal layer [175,176]. Another problem is precisely which part of the tumor to study, since Ki-67 expression can show a heterogeneous distribution within a given tumor. Specifically, Ki-67 immunostaining has been found to be higher at the tumor invasion front than in more central and superficial areas of the tumor. Tumor cells at the invasion front also show more aggressive behavior, so that this area can be expected to give better information on tumor progression and patient prognosis. In view of our review of the literature, we can conclude that although cell proliferation indices based on Ki-67/MIB-1 immunostaining are correlated with the degree of cell differentiation, they have not proved to be good indicators of prognosis in most studies. As noted, the growth of a tumor cell population depends on at least three factors: the percentage of cells in the cell cycle, the duration of the cycle, and the cell loss factor. Thus some authors have suggested that it is not possible to evaluate tumor growth using a single marker [177], which would explain the rather contradictory results reported in the literature.
a
b
Figure 7. Oral squamous cells carcinoma showing a) low proliferation index (low Ki-67/MIB-1 immunostaining) and b) high proliferation index (high Ki-67/MIB-1 immunostaining).
IV.4. Apoptosis Markers IV.4.a. Bcl-2 The proto-oncogene Bcl-2, located on chromosome 18, was the first anti-apoptotic gene discovered [178], and is involved in the regulation of apoptosis by p53, with expression levels inversely related to those of this protein [179].
70
Márcio Diniz-Freitas, Eva Otero-Rey, Andrés Blanco-Carrión et al.
Bcl-2 and other proteins of this family are the central elements in the apoptotic program and the principal effectors of programmed cell death. All proteins of this family have two domains, Bh1 and Bh2, that regulate the formation of dimers between the antagonists (Bcl-2 and Bcl-XI) and agonists of apoptosis (Bax) [180]. The activity of this family of proteins is regulated by competition between pro-apoptotic and anti-apoptotic dimers. Thus if the level of Bcl-2 (anti-apoptotic) is greater than that of Bax (apoptosis-inducing), then Bcl-2/Bcl-2 homodimers will prevail and cells will be protected from programmed cell death. Conversely, if Bax is in excess, this will favor the formation of Bcl-2/Bax heterodimers and induce apoptosis. Thus the relationship (relative expression level) between apoptosis-inducing and apoptosis-protective proteins will determine the cell's eventual fate [181]. Loro et al. [182] found that Bcl-2 expression in OSCCs was lower than in normal oral mucosa, and that Bax expression was associated with tumor grade. Another study found that neither Bcl-2 expression nor apoptosis index had significant prognostic value in a series of 57 patients with OSCC. However, increased Bax expression was associated with unfavorable prognosis [183]. In conclusion, reduced Bcl-2 expression in premalignant and malignant human keratinocytes suggests that preferential expression of apoptosis-protective members of the Bcl-2 family is a key early phenomenon in the development of OSCC [184], making cells sensitive to the appearance of mutations and to tumor progression. Under normal conditions, the process of apoptosis efficiently eliminates genetically damaged cells and prevents their proliferation and progression toward malignancy. If this process fails, cells with damaged DNA may survive, leading to hyper-responsiveness to proliferation signals. This continued persistence of apoptosis-resistant cells increases the likelihood that additional mutations will arise, leading eventually to a malignant phenotype. IV.4.b. Survivin In addition to pro- and anti-apoptotic Bcl-2 proteins, another apoptosis-inhibitory protein has been identified, surviving [185,186]. This protein is undetectable in most normal adult tissues, but is expressed in human cancer cells, showing correlation with increased tumor aggressiveness and reduced patient survival. There is evidence that inhibition of apoptosis by survivin may be a useful predictor of poor prognosis in human cancer, and that survivin may be a useful diagnostic and therapeutic target in malignant tumors [187]. Tanaka et al. [188] studied the expression of survivin in OSCCs, finding absence or weak expression of this protein in normal oral mucosa. Of the OSCCs studied, 58% showed survivin immunoreactivity in the cytoplasm. However, the authors did not detect significant differences between survivin expression and the clinicopathological characteristics of the lesions. In this same study, the authors found that 37% of leukoplakias showed survivin expression. Survivin levels in leukoplakias and in malignant tissues were significantly higher than in normal oral mucosa. However, no significant difference in survivin expression was detected between leukoplakias and OSCCs. Lo Muzio et al. [189] investigated the predictive potential of survivin immunostaining for identifying premalignant lesions (with epithelial dysplasia) at higher risk for malignant transformation. Survivin immunostaining was detected sporadically and with low intensity in normal oral mucosa, in the basal and suprabasal layers. However, 94% of premalignant
Prognostic Indicators in Oral Squamous Cell Carcinoma
71
lesions that progressed to carcinoma showed survivin immunostaining, versus only 33% of lesions that did not subsequently undergo malignant transformation. No correlation was detected between survivin immunostaining and degree of epithelial dysplasia. All OSCCs were survivin-positive. Subsequently, this group studied the expression of survivin in a series of 78 OSCC patients, and found overexpression (defined as expression in > 75% of cells) to be a predictor of poor prognosis [190].
IV.5. Angiogenesis Markers Tumor growth is associated with raised cellular activity, so increased blood supply is essential for continued tumor development. Angiogenesis (i.e. formation of new blood vessels) is a process comprising multiple steps regulated by both stimulatory and inhibitory factors. The critical steps for neovascularization include degradation and remodeling of the extracellular matrix and proliferation of endothelial cells. Angiogenesis has been associated with metastasis and reduced survival in various types of tumor, including OSCCs [191,192]. Although direct evaluation of angiogenesis in histological sections is a difficult procedure, it has been suggested that microvessel density, quantified on the basis of immunostaining of microvessels, may be a useful index [193]. Unfortunately, different studies have used different antibodies to identify microvessels, so that among-study comparisons are difficult. IV.5.a. Vascular Endothelial Growth Factor (VEGF) Of the different angiogenic factors, vascular endothelial growth factor (VEGF) is particularly important. VEGF induces proliferation, differentiation and migration of endothelial vascular cells, increases the permeability of capillary vessels [194], and increases endothelial cell survival by preventing apoptosis [195]. Some studies have demonstrated that VEGF is an independent prognostic factor in patients with cancer of the breast [196], colon [197], and esophagus [198]. However, few studies have investigated the correlation between VEGF expression and prognosis in OSCC. Uehara et al. [199] did not find any correlation between VEGF expression and cervical metastasis in OSCC patients, but tumors with poor prognosis showed higher expression of VEGF. Moriyama et al. [200] found a relationship between VEGF expression and incidence of cervical metastasis in a series of 44 patients with OSCC. VEGF appears to be involved in the process of angiogenesis in oral cancer, but its possible utility as a prognostic indicator has not yet been assessed [201]. Increased vascularization in malignant tissues may provide a basis for anti-angiogenesis therapies directed against tumor cells.
72
Márcio Diniz-Freitas, Eva Otero-Rey, Andrés Blanco-Carrión et al.
IV.6. Markers of Invasiveness and Metastasis OSCC is characterized by its high degree of local invasiveness, and its marked tendency to metastasize to cervical lymph nodes [202] leading to high rates of local and regional recurrence. The mechanism of invasion and metastasis is complex, and consists of multiple sequential steps [203]. To achieve invasion and metastasis, the neoplastic cells must detach from the primary tumor and invade the extracellular matrix. During this first step, loss of intercellular adhesion and cell-extracellular matrix adhesion are essential for tumor progression. Recent studies suggest that aberrant expression of intercellular adhesion molecules like E-cadherin, and of cell-extracellular matrix adhesion molecules like laminin 5, is related to the biological behavior of the tumor, leading to acquisition of an invasive phenotype, so that these proteins may be of value for predicting prognosis. Adhesion molecules regulate the growth and differentiation of epithelial cells and play an important role in the maintenance of the structural integrity and organization of the stratified squamous epithelium. Reduced integrity of intercellular adhesion molecules has been implicated in loss of cell differentiation, accompanied by greater mobility and invasiveness, by neoplastic epithelial cells in diverse human carcinomas [204].
IV.6.a. Laminin 5 γ2 The laminins are a large family of basal-membrane glycoproteins with multiple biological functions, including adhesion and roles in cell dispersion, migration, proliferation, and differentiation [205]. A laminin molecule is made up of an α chain, a β chain and a γ chain that combine to form a heterodimer. There are various isoforms of each chain, and their diverse combinations give rise to a great variety of laminin isoforms [206]. The different biological activities of the different laminins in part simply reflect differences in their tissue expression patterns. Laminin 5, made up of an α3, a β3 and a γ2 chain, is initially synthesized as a 460-kDa precursor, which after secretion into the extracellular matrix undergoes specific proteolytic processing to produce a smaller form. Chain γ2 of laminin 5 is of particular interest, since its expression is limited to epithelial tissues, where it has roles in the epithelial attachment system and in cell motility. This chain is essential for adhesion of basal keratinocytes to the underlying basal membrane, and acts as an adhesion ligand for integrins α3β1, α6β1, α6β4, and α2β1 [207] (Figure 8). Results to date suggest that laminin 5 γ2 expression is increased in a various human carcinomas, and that expression of this monomer is characteristic of cancer cells with an invasive phenotype. Several studies have indicated that expression of laminin 5 γ2 may serve as a marker of invasiveness in diverse types of SCC. It has been suggested that laminin 5 γ2 secreted by tumor cells stimulates cell motility and thus invasiveness [208]. Experimental studies have demonstrated that laminin 5 γ2 promotes cell dispersion when added to epithelial cell cultures [209,210].
Prognostic Indicators in Oral Squamous Cell Carcinoma
a
73
b
Figure 8. a) Expression of laminin 5 γ2 is limited to epithelial tissues, where it has roles in epithelial attachment and in cell motility. B) Increased laminin 5 γ2 expression is seen at the tumor invasion front, and has been associated with increased invasive potential.
The higher expression of laminin 5 γ2 within the tumor invasion front, the zone in which tumor cells show most aggressive phenotype [211] supports the possibility that this molecule might be a useful marker of tumor progression and malignancy in diverse types of cancer of epithelial origin [212]. At the invasion front, the tumor tissue frequently shows more advanced undifferentiation and greater cell dissociation [213]. The expression of laminin 5 γ2 in the invasion front has been studied in diverse types of cancer and has been associated with tumor recurrence and poor prognosis in SCCs of the esophagus [214], and colon [215], and in lung adenocarcinomas [216]. Nordemar et al. [217] studied expression of laminin 5 γ2 in premalignant lesions that subsequently underwent transformation to OSCC or not. The authors found laminin 5 γ2 expression in 60% of lesions that underwent transformation by contrast with 23% of lesions that did not. They concluded that premalignant lesions showing laminin 5 γ2 expression have a higher risk of undergoing malignant transformation. To date, there have been few studies of the relationship between laminin 5 γ2 expression and prognosis in patients with OSCC, and most of these studies have considered only lingual SCCs. Ono et al. [218] were the first researchers to investigate the expression of laminin 5 γ2 in oral cancer. In a study of 67 SCCs of the tongue, these authors did not find any relationship between laminin 5 γ2 expression and tumor stage, cervical metastasis or depth of invasion. They did observe a relationship between laminin 5 γ2 expression and both tumor grade and mode of invasion: with increasing laminin 5 γ2 expression the tumor showed more advanced undifferentiation and a more invasive pattern. In addition, increasing laminin 5 γ2 expression was associated with poorer prognosis. In a subsequent study [219] of 108 SCCs of the tongue, the same authors confirmed their initial conclusions. Again, increased laminin 5 γ2 expression was associated with increased tumor invasion depth and poorer prognosis. The authors also investigated possible relationships between EGFR and laminin 5 γ2 expression, finding that tumors with high EGFR expression also showed high laminin 5 γ2 expression.
74
Márcio Diniz-Freitas, Eva Otero-Rey, Andrés Blanco-Carrión et al.
Stoltfuz et al. [220] studied laminin 5 γ2 expression in 36 T1 tumors of the tongue. They did not find any significant relationship with tumor histological grade; however, increased laminin 5 γ2 expression was correlated with increased risk of recurrence. Lim et al. [221] did not find any association between laminin 5 γ2 expression and cervical metastasis or prognosis in stage-I and stage-II SCCs of the tongue. In a study by our group of 47 patients, we did not find any significant relationship between laminin 5 γ2 expression and survival. However, we observed increased laminin 5 γ2 expression in dysplastic epithelium adjacent to OSCCs (Figure 9) [222], suggesting that laminin 5 γ2 may be useful as a marker of invasion or malignant transformation by dysplastic lesions of the oral cavity; however, these conclusions need to be confirmed by further studies.
Figure 9. Expression of laminin 5 γ2 in dysplastic epithelia adjacent to an OSCC.
IV.6.b. E-Cadherin The cadherins are a family of cell-surface glycoproteins that act as intercellular adhesion molecules via calcium-dependent interactions. The classical cadherins, originally named in view of their tissue specificities (E-cadherin, epithelial; N-cadherin, neural; P-cadherin, placental), have been used as markers in the identification of normal and neoplastic tissues. These cadherins comprise a relatively large extracellular segment and short transmembrane and cytoplasmic domains [223]. E-cadherin is a 124-kDa transmembrane glycoprotein, coded by the CDH1/cadherin-E gene located on chromosome 16 at 16q22.1. This is a key molecule for intercellular adhesion. The extracellular domains of E-cadherin molecules of adjacent cells link together to create intercellular adhesion. This adhesive function of cadherins is dependent on their association with cytoplasmic proteins called catenins, which anchor cadherins to the cytoskeleton [224]. The catenin family includes the α, β and γ catenins. The cytoplasmic domain of E-cadherin binds directly to β and γ, and the resulting E-cadherin/β-catenin/γ-catenin is anchored to the actin cytoskeleton via catenin α [225]. E-cadherin also participates in signal transduction
Prognostic Indicators in Oral Squamous Cell Carcinoma
75
pathways controlling diverse cellular phenomena, including polarity, differentiation, growth and cell migration [226]. In the normal or hyperplastic oral epithelium, E-cadherin is expressed in the inferior zone of the spinous and basal layers [227], except at the basal surface of basal cells [228]. Under-regulation of E-cadherin-mediated cell-cell adhesion has been associated with progression of diverse malignant human tumors [229,230], including cancers of the head and neck region [231,232] and oral cancers [233]. Loss of E-cadherin expression has also been associated with increased invasiveness, advanced T and N stage and poor prognosis [234]. (Figure 10) It seems that abnormal expression of E-cadherin can be caused by multiple mechanisms, including loss of heterozygosity at the CDH1 locus, and somatic mutations. Transcriptional silencing by hypermethylation of CpG islands in the promoter region has also been described in diverse tumors and cell lines [235].
a
b
Figure 10. a) The extracellular domains of E-cadherin molecules of adjacent molecules link together, thus creating cell-cell adhesion. This adhesive function of E-cadherin depends mainly on the association with cytoplasmic proteins, called catenins, that bind the E-cadherin to the cytoskeleton. b) Loss of cadherin expression has been associated with OSCC progression to more invasive stages.
Bánkfalvi et al. [236] studied the role of various molecules involved in cell adhesion in the epithelium (CD44, E-cadherin, β-catenin) during oral carcinogenesis oral. They concluded that in early stages there may be a transient increase in E-cadherin expression, finally reversed with loss of expression when the cells acquire invasive phenotype (i.e. in the late stages of carcinogenesis). Hung et al. [237] found that E-cadherin immunoreactivity was lower in premalignant lesions than in normal oral mucosa, and lower in OSCC than in premalignant lesions. The reduction with respect to normal oral mucosa was statistically significant in advanced OSCC stages. Note though that 60% of metastatic lesions showed higher E-cadherin immunoreactivity than the primary OSCC. Bagutti et al. [238] found a correlation between E-cadherin immunostaining and tumor grade: less differentiated tumors showed reduced expression of E-cadherin. Shinohara et al. [239] did not find any correlation between E-cadherin immunostaining and tumor grade, but observed that reduced immunostaining was associated with more invasive histological patterns. In addition, they found reduced immunostaining in tumors with cervical metastases.
76
Márcio Diniz-Freitas, Eva Otero-Rey, Andrés Blanco-Carrión et al.
In view of E-cadherin's important role in maintenance of intercellular connections, it has been suggested that alterations in E-cadherin expression may be an early event in the process of metastasis [240]. Tanaka et al. [241] studied E-cadherin expression in lymph node metastatic processes in 159 patients with OSCC. They found a significant relationship between reduced expression of E-cadherin in primary tumors and associated cervical metastases at the moment of diagnosis. In addition, they found reduced survival in patients showing reduced E-cadherin expression. Chow et al. evaluated E-cadherin expression in 85 cases of SCC of the tongue. They found reduced expression in 85% of cases. The reduction was not correlated with sex, age, histological differentiation or clinical stage. However, reduced E-cadherin expression was correlated with the presence of clinical and subclinical metastases to the cervical lymph nodes. In addition, local and regional recurrences were significantly more frequent in tumors with weak or absent E-cadherin immunostaining. Chang et al. found reduced E-cadherin expression in 83% of cases of carcinoma of the tongue. Prognosis was significantly poorer in cases with strong E-cadherin immunoreactivity. Lim et al. investigated the utility of various histological and immunohistochemical markers (p53, Ki-67, EGFR, cyclin D1, CD31, Cox-2, MUC1, laminin 5 γ2, E-cadherin, βcatenin) for predicting the appearance of late cervical metastases in stage-I and -II tumors. In multivariate analyses, E-cadherin was the only immunohistochemical marker associated with the appearance of cervical metastases. In a study by our group of 47 patients with OSCC, E-cadherin expression declined significantly with increased invasiveness (Figure 11). In addition, we found a close association between reduced expression of cadherin-E and local recurrences, and a significantly shorter disease-free interval. Both univariate and multivariate analyses indicated that absent or weak E-cadherin immunostaining indicative of poor prognosis. The mechanism of intercellular adhesion mediated by E-cadherin remains incompletely understood. Different possible causes have been suggested for the reduced E-cadherin expression in tumor tissues, including suppression of the E-cadherin promoter gene, destabilization of the protein leading to disruption of binding to catenins, or mutations and deletions in the E-cadherin gene. Loss of heterozygosity on chromosome 16, on which the Ecadherin gene is located, is frequent in hepatocellular carcinoma [242] and carcinoma of the stomach [243] and breast [244]. In SCC of the head and neck region loss of heterozygosity on chromosome 16 is infrequent and translocations appear only occasionally. In OSCC the Ecadherin gene does not show mutations [245]. As noted above, one of the most widely known pathways for inactivation of E-cadherin function is transcriptional silencing by hypermethylation of CpG islands in the E-cadherin gene promoter region [246]. Nakayama et al. [247] found that 94.4% of cases of OSCC with reduced E-cadherin expression showed such hypermethylation. These findings were supported by in vitro studies of methylation in cultures of OSCC cell lines without Ecadherin expression: when a demethylating agent was added to cultures, the cells recovered E-cadherin expression and showed a more cohesive growth pattern.
Prognostic Indicators in Oral Squamous Cell Carcinoma
77
Figure 11. Expression of E-cadherin in oral squamous cell carcinomas. a) A low-invasiveness OSCC: most cancer cell nests show intensive E-cadherin immunoreactivity. b) A high-invasiveness OSCC: loss of E-cadherin immunoreactivity is observed in small groups of infiltrating cells.
One of the possible mechanisms through which DNA methylation to promoter regions may regulate gene expression is by preventing binding of transcription factors to the methylated promoter. Current evidence suggests that binding of transcription factors essential for E-cadherin expression is inhibited by methylation of the promoter region. Thus reduced expression of E-cadherin appears to be a useful marker of dissociation of neoplastic cells from the primary tumor. In line with this, reduced E-cadherin expression in OSCC is associated with increased risk of local and regional metastasis, and poorer prognosis.
CONCLUSIONS Although clinical staging systems cannot precisely evaluate the biological properties of tumors, and thus cannot precisely predict their evolution, tumor size and most importantly the existence of metastases at the moment of diagnosis remain the most important prognostic factors. Of histological indicators, both tumor thickness and characteristics of the tumor invasion front give better prognostic information than histological grade alone. Of immunohistochemical markers, E-cadherin has proved to be of great utility for predicting course and prognosis in patients with OSCC. This is one of the markers that has shown most consistent results in the literature. Bearing in mind that carcinogenesis is a multifactorial process that progresses by steps, it seems likely that a multitude of biological markers will be associated with prognosis, and that single markers alone will not be effective for predicting prognosis. Thus techniques that allow simultaneous quantitation of multiple markers, such as tissue microarrays [248,249] and DNA microarrays [250,251] seem particularly promising. This question will be discussed in more detail in the Chapter “Current trends in the molecular diagnosis of oral squamous cell carcinoma”.
78
Márcio Diniz-Freitas, Eva Otero-Rey, Andrés Blanco-Carrión et al.
REFERENCES [1] [2]
[3] [4] [5] [6]
[7] [8] [9]
[10]
[11]
[12] [13]
[14]
[15] [16]
Scully C, Bagan JV. Recent advances in Oral Oncology. Oral Oncol 2007;43(2):10715. Ozols RF, Herbst RS, Colson YL, Gralow J, Bonner J, Curran WJ Jr, et al. Clinical cancer advances 2006: major research advances in cancer treatment, prevention, and screening--a report from the American Society of Clinical Oncology. J Clin Oncol 2007;25: 146-62. Jonson NW, Warnakulasurya KAA. Oral Cancer: Is it more common than cervical? Br Dental Res 1991; 170: 170-171. Kligerman J. Estimativas sobre a incidencia e mortalidade por cáncer no Brasil-2002. Rev Bras Cancerologia 2002; 48: 175-9. Nieto A, Ramos AR. Rising trends in oral cancer mortality in Spain, 1975-94. J Oral Pathol Med 2002; 31: 147-52 Wood NK, Sawyer DR. Cáncer Oral. En: Wood NK, Goaz PW. Diagnósticos diferenciales de las lesiones orales y maxilofaciales. Madrid: Harcourt Brace de España SA; 1998. p. 587-95 Godwin JS, Hunt WC, Janet JM. Determinants of cancer therapy in elderly patients. Cancer 1993; 72: 594-601. Reichard KW, Joseph KT, Cohen M, Greager JA. Squamous cell carcinoma of the tongue: Experience with 86 consecutive cases. J Surg Oncol 1993; 54: 239-42. El-Husseiny G, Kandil A, Jamshed A, Khafaga Y, Saleem M, Allam A, et al. Squamous cell carcinoma of the tongue: an analysis of prognostic factors. Br J Oral Maxillofac Surg 2000; 38: 193- 9. Varela-Centelles PI, Seoane J, Vazquez Fernandez E, De La Cruz A, Garcia Asenjo JA. Survival to oral cancer. A study of clinical risk markers with independent prognostic value. Bull Group Int Rech Sci Stomatol Odontol. 2002; 44: 46-51. Mackenzie J, Ah-See, Takker N, Sloan P, Maran AG, Birch J, et al. Increasing incidence of oral cancer amongst young persons: what is the aetiology? Oral Oncol 2000; 36: 387-9. Oliver RJ, Dearing J, Hindle I. Oral cancer in young adults: report of three cases and review of the literature. Br Dent J 2000; 188: 362-6. Llewellyn CD, Johnson N, Warnakulasuriya S. Factors associated with delay presentation among younger patients with oral cancer. Oral Surg Oral Pathol Oral Med Oral Endod Radiol 2004; 97: 707-13. Llewellyn CD, Linklater K, Bell J, Johnson N, Warnakulasuriya S. An analysis of risk factors for oral cancer in young people: a case-control study. Oral Oncol 2004; 304313. Sarkaria JN, Harari PM. Oral tongue cancer in young adults less than 40 years of age: rationale for aggressive therapy. Head Neck 1994; 16: 107-11. Rennie JS, McGregor AD. Intra-oral squamous cell carcinoma in patients under 40 years of age. A report of 13 cases and review of the literature. Br J Plastic Surg 1987; 40: 270-3.
Prognostic Indicators in Oral Squamous Cell Carcinoma
79
[17] Sasaki T, Moles DR, Imai Y, Speight PM. Clinico-pathological features of squamous cell carcinoma of the oral cavity in patients <40 years of age. J Oral Pathol Med 2005; 34: 129-33. [18] Lo W-L, Kao S-Y, Chi L-Y, Wong Y-K, Chang RC-S. Outcomes of oral squamous cell carcinoma in Taiwan after surgical therapy. J Oral Maxillofac Surg 2003; 61: 751-8. [19] Charoenrat P, Pillai G, Patel S, Ficher C, Archer D, Eccles S, et al. Tumor thickness predicts cervical nodal metastases and survival in early oral tongue cancer. Oral Oncol 2003; 39: 386-90. [20] Kademani D, Bell B, Bagheri S, Holmgren E, Dierks E, Potter B, Homer L. Prognostic factors in intraoral squamous cell carcinoma: The influence of histologic grade. J Oral Maxillofac Surg 2005; 63: 1599-1605. [21] Leite ICG, Koifman S. Survival analysis in a sample of oral cancer patients at a reference hospital in Rio de Janeiro, Brazil. Oral Oncol 1998; 34: 347- 52. [22] Boffetta P, Merletti F, Magnani C, Terracini B. A population-based study of prognostic factors in oral and oropharyngeal cancer. Eur J Cancer B Oral Oncol. 1994;30B:36973. [23] Moreno Lopez LA, Esparza Gomez GC. Oral cancer versus head and neck cancer. Oral Oncol 1998; 34: 576-7. [24] Moore SR, Pierce AM, Wilson DF. “Oral cancer” – The terminology dilemma. Oral Dis 2000; 6: 191-3. [25] McCartan B. “Oral cancer”- The terminology dilemma. Oral Dis 2001; 7: 66. [26] Arthur K, Farr HW. Prognostic significance of histological grade in epidermoid carcinoma of the mouth and pharynx. Am J Surg 1972; 124:489-92. [27] Farr HW, Goldfarb PM, Farr CM. Epidermoid carcinoma of the mouth and pharynx at the Sloan-Kettering Cancer Center. Am J Surg Center 1980; 140: 563-7. [28] Daniele E, Rodolico V, Leonardi V, Tralongo V. Prognosis in lower lip squamous cell carcinoma: Assessment of tumor factors. Pathol Res Pract 1998, 194: 319-24. [29] Nemeth ZS, Velich N, Bogdan S. Upjal M, Szabo G, Suba ZS. The prognostic role of clinical, morphological and molecular markers in oral squamous cell tumors. Neoplasma 2005; 52:95-102. [30] Ilstad ST, Bigelo Gorsky M, Epstein JB, Oakley C, Le ND, Hay J, Stevenson-Moore P. Carcinoma of the tongue: a case series analysis of clinical presentation, risk factors, staging, and outcome. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2004;98: 546-52. [31] Woolgar JA, Scott J , Vaughan ED, Brown JS, West CR, Rogers S. Survival, metastasis and recurrence of oral cancer in relation to pathological features. Ann R Coll Surg Engl 1995, 77: 325-31. [32] Woolgar JA, Triantafyllou A. A histopathological appraisal of surgical resection margins in oral and oropharyngeal cancer resection specimens. [33] Woolgar JA. Histopathological prognosticators in oral and oropharyngeal squamous cell carcinoma.Oral Oncol. [34] Massano J, Regateiro FS, Januario G, Ferreira A. Oral squamous cell carcinoma: review of prognostic and predictive factors. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2006;102:67-76.
80
Márcio Diniz-Freitas, Eva Otero-Rey, Andrés Blanco-Carrión et al.
[35] M.J. Zelefsky, L.B. Harrison and D.E. Fass et al., Postoperative radiotherapy for oral cavity cancers: Impact of anatomic subsite on treatment outcome, Head Neck 1990; 12: 470-5. [36] Bell RB, Kademani D, Homer L, Dierks EJ, Potter BE. Tongue cancer: is there a difference in survival compared with other subsites in the oral cavity? J Oral Maxillofac Surg 2007 ;65:229-36 [37] Sobin LH, Wittekind C, UICCTNM classification of malignant tumours. 6th ed. New York: Wiley-Liss, Inc; 2002. [38] Beeken SW, Krontiras H, Maddox WA, Peters GE, Soong S, Urist MM. T1 and T2 squamous cell carcinoma of the oral tongue: prognostic factors and the role of elective lymph node dissection. Head Neck 1999; 21: 124-30. [39] Silverman S Jr. Oral cancer. 4th ed. Hamilton. Ontario: American Cancer Society, 1998. [40] Sciuba JJ. Oral cancer and its detection. History-taking and the diagnostic phase of management. JADA 2001; 32 (Suppl): 12S- 18S [41] Sciuba JJ. Oral cancer. The importance of early diagnosis and treatment. Am J Clin Dermatol 2001; 2: 239-51 [42] Diniz-Freitas M, García-Caballero T, Antúnez-López J, Gándara-Rey JM, García García A. Pharmacodiagnostic evaluation of EGFR expression in oral squamous cell carcinoma. Oral Diseases 2007; 13:285-90. [43] Diniz-Freitas M, García_Caballero T, Antúnez-López JR, Gándara-Rey JM, GarcíaGarcia A. Reduced E-cadherin expression is an indicator of unfavourable prognosis in oral squamous cell carcinoma. Oral Oncol 2006; 42: 190-200. [44] Tanaka N, Ogi K, Odajima T, Dehari H, Yamada S, Sonoda T, Kohama G. PRb2/p130 protein expression is correlated with clinicopathologic findings in patients with oral squamous cell carcinoma. Cancer 2001; 92: 2117-25. [45] Jones AS, Cook JA, Phillips DE, Roland NJ. Squamous carcinomas presenting as an enlarged lymph node. Cancer 1993; 72: 1756-61. [46] Lindberg R. Distribution of cervical lymph node metastases from squamous cell carcinoma of the upper respiratory and digestive tracts. Cancer 1972; 29: 1446-9. [47] Howaldt HP, Kainz M, Euler B, Vorast H. Proposal for modification of the TNM staging classification for cancer of the oral cavity. DÖSAK. J Craniomaxillofac Surg 1999; 27: 275-88. [48] Baredes S, Leeman DJ, Chen TS, Mohit- Tabatabi MA. Significance of tumour thickness in soft palate carcinoma. Laryngoscope 1993; 103: 389-93. [49] Martinez-Gimeno C, Rodríguez EM, Vila CN, Varela CL. Squamous cell carcinoma of the oral cavity: a clinicopathologic scoring system for evaluating risk for cervical lymph node metastasis. Laryngoscope 1995; 105: 728-33. [50] Bundgaard T, Bentzen SM, Wildt J, Sorensen FB, Sogaard H, Nielsen JE. Histopathologic, stereologic, epidemiologic, and clinical parameters in the prognostic evaluation of squamous cell carcinoma of the oral cavity. Head Neck 1996; 18: 142-52. [51] Neville BW, Damm DD, Allen CM, Bouquot JM. Oral and Maxillofacial Pathology. 2nd ed. Philadelphia: W.B. Saunders, 2002. p. 295-303.
Prognostic Indicators in Oral Squamous Cell Carcinoma
81
[52] Broders AC. Carcinoma: Grading and practical application. Arch Pathol 1926; 2: 376281. [53] García-García A, Ceballos-Salobreña, Gándara-Rey JM. Cáncer Oral. In: CeballosSalobreña A, Bullón-Fernández P, Gándara-Rey JMM, Chimenos-Küstner E, BlancoCarrión A, Martínez-Sahuquillo A, García García A. Medicina Bucal Práctica. Santiago de Compostela: Editorial Danú SL; 2000. p.335- 68. [54] Pindborg JJ, Reichart PA, Smith CJ, van der Waal I. Histological typing of cancer and precancer of the oral mucosa. Berlin: Springer-Verlag; 1997. [55] Saap JP, Eversole LR, Wysocki GP. Patología oral y maxilofacial contemporanea. 2nd ed. Madrid: Mosby; 2005. p. 194. [56] Greer RO. Pathology of malignant and premalignant oral lesions. Otolaryngol Clin N Am 2006; 39: 249-275. [57] Anneroth G, Batsakis J, Luna M. Review of the literature and recommended system of malignancy grading in oral squamous cell carcinomas. Scand J Dent Res 1987; 95: 229-49. [58] Woolgar JA, Scott J. Prediction of cervical lymph node metastasis in squamous cell carcinoma of the tongue/floor of mouth. Head Neck 1995; 17: 463-72. [59] Bryne M, Koppang HS, Lilleng R; Kjaerhein A. Malignancy grading of the deep invasive margins of oral squamous cell carcinomas has high prognostic value. J Pathol 1992; 166: 375-81. [60] Anneroth G, Hanse LS, Silverman Jr S. Malignancy grading in oral squamous cell carcinoma. I. Squamous cell carcinoma of the tongue and the floor of the mouth: histologic grading and clinical evaluation. J Oral Pathol Med 1986; 15: 162-8. [61] Bànkfalvi A, Piffkò J. Prognostic and predictive factors in oral cancer: the role of invasive tumour front. J Oral Pathol Med 2000; 29: 291-8. [62] Bryne M, Boysen M, Alfes CG, Abeler VM, Sudbo J, Nesland JM, et al. The invasive front of carcinomas. The important area of tumour prognosis? Ancer Res 1998; 18: 4747-64. [63] Spiro RH, Guillamondegui O Jr, Paulino AF, Huvos AG. Pattern of invasion and margin assessment in patients with oral tongue cancer. Head Neck 1999; 408-13. [64] Bundgaard T, Rossen K, Henriksen S, Charabi S, Soogaard H, Grau C. Histopathologic parameters in the evaluation of T1 squamous cell carcinomas of the oral cavity. Head Neck 2002; 24: 256-60 [65] Lopes MA, Nikitakis NG, Reynolds MA, Ord RA, Sauk Jr J. Biomarkers of lymph node metastases in oral squamous cell carcinoma. J Oral Maxillofac Surg 2002; 60: 142-7. [66] Spiro RH, Huvos AG, Wong GY, Spiro JD, Gnecco CA, Strong EW. Predictive value of tumor thickness in squamous carcinoma confined to the tongue and floor of the mouth. Am J Surg 1986; 152: 354-50. [67] Brown B, Barnes L, Mazariegos J, Taylor F, Johnson J, Wagner RL. Prognostic factors in mobile tongue and floor of the mouth carcinoma. Cancer 1989; 64: 1195-202. [68] Asakage T, Yokose T, Mukai K, Tsugane S, Tsubono Y, Asai M, Ebihara S. Tumor thickness predicts cervical metastasis in patients with stage I/II carcinoma of the tongue. Cancer 1998; 82: 1443-8.
82
Márcio Diniz-Freitas, Eva Otero-Rey, Andrés Blanco-Carrión et al.
[69] Kurokawa H, Yamashita Y, Takeda S, Zhang M, Fukuyama H, Takahashi T. Risk factors for late cervical lymph node metastasis in patients with stage 1 or 2 carcinoma of the tongue. Head Neck 2002; 24: 731-6. [70] Gonzalez-Moles M, Esteban F, Rodríguez-Archilla A, Ruiz-Avila, Gonzalez-Moles S. Importance of tumour thickness measurement in prognosis of tongue cancer. Oral Oncol 2002; 38: 394-7. [71] Urist MM, O´Brien CJ, Soong SJ, Visscher DW, Maddox WA. Squamous cell carcinoma of the buccal mucosa: analysis of prognostic factors. Am J Surg 1987; 154: 411-4. [72] Mohit-Tabatai MA, Sobel HJ, Rush BF, Mashberg A. Relation of thickness of floor of mouth stage I and II cancers to regional metastasis. Am J Sur 1986; 152: 351-3. [73] Myers JN, Eckins T, Roberts D, Byers RM. Squamous cell carcinoma of the tongue in young adults: increasing incidence and factors that predict treatment outcomes. Otolaryngol Head Neck Surg 2000; 222; 244-51. [74] Loore TR, Strong EW. Significance of positive margins in oral cavity squamous carcinoma. Am J Surg 1990; 106: 410-4. [75] Sutton DN, Brown JS, Rogers SN, Vaughan ED, Woolgar JA. The prognostic implications of the surgical margin in oral squamous cell carcinoma. Int J Oral Maxillofac Surg 2003; 32: 30-4. [76] Binahmed A, Nason RW, Abdoh AA. The clinical significance of the positive surgical margin in oral cancer. Oral Oncol (In press) [77] Kovács AF. Relevance of positive margins in case of adjuvant therapy of oral cancer. Int J Oral Maxillofac Surg 2004; 33: 447-53. [78] Zelefsky MJ, Harrison LB, Fass DE, Armstrong JG, Shah JP, Strong EW. Postoperative radiation therapy for squamous cell carcinomas of the oral cavity and oropharynx: impact of therapy on patients with positive surgical margins. Int J Radiat Oncol Biol Phys 1993; 25: 17-21. [79] McMahon J, O'Brien CJ, Pathak I, Hamill R, McNeil E, Hammersley N. Influence of condition of surgical margins on local recurrence and disease-specific survival in oral and oropharyngeal cancer. Br J Oral Maxillofac Surg. 2003; 41: 224-31. [80] Yuen APW, Lam KY, Chan ACL, Wei WI, Lam LK. Clinicopathological analysis of local spread of carcinoma of the tongue. Am J Surg 1998; 175: 242-4. [81] Brennan JA, Mao L, Hruban RH, Boyle JO, Eby YJ, Koch WM, et al. Molecular assessment of histopathological staging in squamous cell carcinoma of the head and neck. N Engl J Med 1995; 332: 429-35. [82] Partridge M, Li SR, Pateromichelakis S, Francis R, Phillips E, Huang XH, et al. Detection of minimal residual cancer to investigate why oral tumors recur despite seemingly adequate treatment. Clin Cancer Res 2000; 6: 2718-25. [83] Rahima B, Shingaki S, Nagata M, Saito S. Prognostic significance of perineural invasion in oral and oropharyngeal carcinoma. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2004; 97: 423-31. [84] Martinez-Gimeno C, Rodríguez EM, Vila CN, Varela CL. Squamous cell carcinoma of the oral cavity: a clinicopathologic scoring system for evaluating risk of cervical lymph node metastasis. Laryngoscope 1995; 105: 728-33.
Prognostic Indicators in Oral Squamous Cell Carcinoma
83
[85] Conte CC, Ergin MT, Ricci A Jr, Deckers PJ. Clinical and pathologic prognostic variables in oropharyngeal squamous cell carcinoma. Am J Surg 1989; 157: 582-4. [86] Woolgar JA, Scout J. Prediction of cervical lymph node metastasis in squamous cell carcinoma of the tongue/floor of mouth. Head Neck 1995; 17:463-72. [87] Close LG, Burns DK, Reisc J, Schaefer SD. Microvascular invasion in cancer of the oral cavity and orapharynx. Arch Otolaryngol Head Neck Surg 1987; 113: 1191-5. [88] Fagan JJ, Cillins B, Barnes L, D´Amico F, Myers EN, Johnson JT. Perineural invasion in squamous cell carcinoma of the head and neck. Arch Otolaryngol Head Neck Surg 1998; 124: 637-40. [89] Parsons JT, Mendenhall WM, Stringer SP, Cassisi NJ, Million RR. An analysis of factors influencing the outcome of postoperative irradiation for squamous cell carcinoma of the oral cavity. Int J Radiat Oncol Biol Phys 1997; 39: 137.48. [90] Kurtz KA, Hoffman HT, Zimmerman MB, Robinson RA. Perineural and vascular invasion in oral cavity squamous carcinoma: increased incidence on re-view of slides and by using immunohistochemical enhancement. Arch Pathol Lab Med 2005; 129: 354-9. [91] Cartun RW. Immunohistochemistry- 25 years and still going strong. J Histotechnol 2002; 25: 181 [92] Leong AS-Y, Wright J. Contributions of immunohistochemical staing in tumor diagnosis. Histopathology 1987;11: 1295-1305. [93] Leong AS-Y. New vistas in the histopathological assessment of cancer. Med J Aust 1992; 157:699-701. [94] Leong AS-Y. Quantitation in Immunohistology: Fact or fiction? A discussion of variables that influence results. Appl Immunohistochem Mol Morphol; 12: 1-7. [95] Schneider BL, Kulesz-Martin M, Destructive cycles: the role of genomic instability and adaptation in carcinogenesis. Carcinogenesis 2004; 25: 2033-44. [96] Xia W, Lau YK, Zhang HZ, Xia FY, Johnston DA, Liu AR. Combination of EGFR, HER-2/neu, and HER-3 is a stronger predictor for the outcome of oral squamous cell carcinoma than any individual family members. Clin Cancer Res 1999; 5: 4164-74. [97] Todd R, Wong DTW. Epidermal growth factor receptor (EGFR) biology and human oral cancer. Histol Histopathol 1999; 14: 491-500. [98] Williams HK. Molecular pathogenesis of oral squamous carcinoma. J Clin Pathol Mol Pathol 2000; 53: 165-72. [99] Ulrich A, Coussens L, Hayflick JS, Dull TJ, Gray A, Tam AW et al. Human epidermal growth factor receptor cDNA sequence and aberrant expression of the amplified gene in A431 epidermoid carcinoma cells. Nature 1984; 309: 418-25. [100] Gullick WJ. Prevalence of aberrant expression of de epidermal growth factor in human cancers. Br Med Bull 1991; 47: 87- 98. [101] Partridge M, Gullick WJ, Langdom JD, Sherriff M. Expression of epidermal growth factor receptor in oral squamous cell carcinoma. Br J Oral Maxillofac Surg 1988; 26: 381- 9. [102] Scully C. Oncogenes, tumor supressor genes, and viruses in oral squamous cell carcinoma. J Oral Pathol Med 1993; 22: 337-47
84
Márcio Diniz-Freitas, Eva Otero-Rey, Andrés Blanco-Carrión et al.
[103] Grandis JR, Tweardy DJ, Melhem MF. Asynchronous modulation of transforming growth factor-α and epidermal growth factor receptor protein expression in progression of premalignant lesions to head and neck squamous cell carcinoma. Clin Cancer Res 1998; 4: 13-20. [104] Shin DM, Ro JY, Hong WK, Hittelman WN. Dysregulation of epidermal growth factor receptor expression in premalignant lesions during head and neck tumorigenesis. Cancer Res 1994; 54: 3153-9 [105] Christensen ME, Therkildsen MH, Poulsen SS, Bretlau P. Immunoreactivity transforming growth factor alpha and epidermal growth factor in oral squamous cell carcinomas. J Pathol 1993; 169: 323-8. [106] Santini J, Formento JL, Francoual M, Milano G, Schneider M, Dassonville O, et al. Characterisation, quantification and potential clinical value of epidermal growth factor receptor in head and neck carcinomas. Head Neck 1991; 13: 132-9. [107] Kutton NAA, Govard I, Bhak NM. Epidermal growth factor receptor (EGFR) in oral squamous cell carcinomas: over-expression, localization, and therapeutic implications. Indian J Dent Res 1997; 8: 9-18. [108] Rubin Grandis J, Melhem MF, Barnes EL, Tweardy DJ. Quantitative immunohistochemical analysis of transforming growth factor α and epidermal growth factor receptor in patients with squamous cell carcinoma of the head and neck. Cancer 1996; 78: 1284-92. [109] Sakai H, Kawano K, Okamura K, Hashimoto N. Immunohistochemical localisation of c-myc oncogene product and EGF receptor in oral squamous cell carcinoma. J Oral Pathol Med 1990; 19: 1-4. [110] Kusukawa J, Harada H, Shima I, Sasaguri Y, Kaneyama T, Morimatsu M. The significance of epidermal growth factor receptor and matrix metalloproteinase-3 in squamous cell carcinoma of the oral cavity. Eur J Cancer Oral Oncol 1996; 32B: 217-21. [111] Maiorano E, Favia G, Maisonnneuve, Viale G. Prognostic implications of epidermal growth factor receptor immunoreactivity in squamous cell carcinoma of the oral mucosa. J Pathol 1998; 185: 167-74. [112] Bergler W, Bier H, Ganzer U. The expression of epidermal growth factor receptors in the oral mucosa of patients with oral cancer. Arch Otorhinolaryngol 1989; 246: 121-5 [113] Maiorano E, Favia G, Maisonnneuve, Viale G. Prognostic implications of epidermal growth factor receptor immunoreactivity in squamous cell carcinoma of the oral mucosa. J Pathol 1998; 185: 167-74 [114] Ulanovski U, Stern Y, Roizman P, Shpitzer T, Popvtzer A, Feinmesser R. Expression of EGFR and Cerb-B2 as prognostic factors in cancer of the tongue. Oral Oncol 2004; 40: 532-7. [115] Bankfalvi A, Krabort M, Vegh A, Felszeghy E, Piffko J. Deranged expression of the E-cadherin/β-catenin complex and the epidermal growth factor receptor in the clinical evolution and progression of oral squamous cell carcinomas. J Oral Pathol Med 2002; 31: 450-7.
Prognostic Indicators in Oral Squamous Cell Carcinoma
85
[116] Störkel S, Reichert T, Reiffen KA, Wagner W. EGFR and PCNA expression in oral squamous cell carcinomas - a valuable tool in estimating the patient’s prognosis. Oral Oncol Eur J Cancer 1993; 273-7. [117] Yamada Y, Takagi, M, Shioda S. Evaluation of epidermal growth factor receptor in squamous cell carcinoma of the oral cavity. Oral Surg Oral Med Oral Pathol 1992; 73: 67-70. [118] Laimer K, Spizzo G, Gastl G, Obrist P, Brunhuber T, Fong D, et al. High EGFR expression predicts poor prognosis in patients with squamous cell carcinoma of the oral cavity and oropharynx: A TMA-based immunohistochemical analysis. Oral Oncol. 2007;43:193-198. [119] Xia W, Lau YK, Zhang HZ, Xia FY, Johnston DA, Liu AR. Combination of EGFR, HER-2/neu, and HER-3 is a stronger predictor for the outcome of oral squamous cell carcinoma than any individual family members. Clin Cancer Res 1999; 5: 4164-74. [120] Smid EJ, Stoter TR, Bloemena E, Lafleur MV, Leemans CR, van der Waal I, Slotman BJ, Langendijk JA. The importance of immunohistochemical expression of EGFr in squamous cell carcinoma of the oral cavity treated with surgery and postoperative radiotherapy. Int J Radiat Oncol Biol Phys. 2006;65:1323-9. [121] Schartinger VL, Kacani L, Ardle J, Schwentner I, Wurm M, Obrist P, et al. Pharmacodiagnostic value of the HER family in head and neck squamous cell carcinoma. ORL J Otorhinolaryngol Relat Spec 2004; 66: 21-6. [122] Serrano M, Hannon GJ, Beach D. A new regulatory motif in cell-cycle control causing specific inhibition of ciclyn D/CDK4. Nature 1993; 366: 704-7. [123] Angadi PV, Krishnapillai R. Cyclin D1 expression in oral squamous cell carcinoma and verrucous carcinoma: correlation with histological differentiation. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2007;103:e30-5. [124] Xu J, Gimenez-Conti IB, Cunningham JE, Collet AM, Luna MA, Lanfranchi HE, Spitz MR, Conti CJ. Alterations of p53, cyclin D1, Rb, and H-ras in human oral carcinomas related to tobacco use. Cancer 1998;83:204-12. [125] Carlos de Vicente J, Herrero-Zapatero A, Fresno MF, Lopez-Arranz JS. Expression of cyclin D1 and Ki-67 in squamous cell carcinoma of the oral cavity: clinicopathological and prognostic significance. Oral Oncol 2002, 38: 301-8. [126] Kuo MYP, Lin CY, Hahn LJ, Cheng SJ Chiang CP. Expression of cyclin D1 is correlated with poor prognosis in patients with areca quid chewing related oral squamous cell carcinomas in Taiwan, J Oral Pathol Med 1999; 28: 165–9. [127] Lam KY, Ng IOL, Yuen APW, Kwong DLW, Wei W. Cyclin D1 expression in oral squamous cell carcinomas: Clinicopathological relevance and correlation with p53 expression. J Oral Pathol Med 2000; 29:167-72. [128] Hollstein M, Sidransky D, Vogelstein B, Harris CC. p53 mutations in human cancers. Science 1991; 253: 249-53. [129] Hardisson D. Molecular pathogenesis of head and neck squamous cell carcinoma. Eur Arch Otorhinolaryngol 2003: 260: 502-8. [130] Vogelstein B, Kinzier KW. The multistep nature of cancer. Trends Genet 1993; 9: 139-41.
86
Márcio Diniz-Freitas, Eva Otero-Rey, Andrés Blanco-Carrión et al.
[131] Harper JW, Adami GR, Wei N, Keyomarsi K, Elledge SJ. The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases. Cell 1993, 75: 805-16. [132] Todd R, Donoff RB, Wong DTW. The molecular biology of oral cancer: toward a tumor progression model. J Oral Maxillofac Surg 1997; 55: 213-23. [133] Sidransky D, Boyle J, Koch W. Molecular screening: Prospects for a new approach. Arch Head Neck Surg 1993; 119: 1187-90. [134] Cruz I, Napier SS, van der Waal I, Snijders PJ, Walboomers JM, Lamey PJ, et al. Suprabasal p53 immunoexpression is strongly associated with high grade dysplasia and risk for malignant transformation in potentially malignant oral lesions from Northern Ireland. J Clin Pathol 2002; 55: 98-104. [135] Nylander K, Dalbesteen E, may PA. The p53 molecule and its prognostic role in squamous cell carcinomas of the head and neck. J Oral Pathol Med 2000; 29: 413-25. [136] Kamer AR, Krebs L, Hoghooghi SA, Liebow C. Proliferative and apoptotic responses in cancers with special reference to oral cancer. Crit Rev Oral Biol Med 1999; 10: 58-78. [137] Sittel C, Ruiz S, Volling P, Kvasnicka HM, Jungehulsing M, Eckel HE. Prognostic significance of Ki-67 (MIB1), PCNA and p53 in cancer of the oropharynx and oral cavity. Oral Oncol 1999; 35: 583-9. [138] Gonzalez-Moles MA, Galindo P, Gutierrez-Fernandez J, Sanchez-Fernandez E, Rodriguez-Archilla A, Ruiz-Avila I, Bravo M. P53 protein expression in oral squamous cell carcinoma survival analysis. Anticancer Res 2001;21:2889-94 [139] Shiraki M, Odajima T, Ikeda T, Sasaki A, Satoh M, Yamaguchi A, Noguchi M, Nagai I, Hiratsuka H. Combined expression of p53, cyclin D1 and epidermal growth factor receptor improves estimation of prognosis in curatively resected oral cancer. Mod Pathol 2005;18:1482-9. [140] Carlos de Vicente J, Junquera Gutierrez LM, Zapatero AH, Fresno Forcelledo MF,Hernandez-Vallejo G, Lopez Arranz JS.Prognostic significance of p53 expression in oral squamous cell carcinoma without neck node metastases. Head Neck 2004;26:2230. [141] de Oliveira LR, Ribeiro-Silva A, Zucoloto S. Prognostic impact of p53 and p63 immunoexpression in oral squamous cell carcinoma. J Oral Pathol Med 2007 ;36:1917. [142] Kawamata N, Moresetti R, Miller CW, Park D, Spirin KS, Nakamaki T, et al. Molecular analysis of the cyclin-dependent kinase inhibitor gene p27/kip1 in human malignances. Cancer Res 1995; 55: 2266-9. [143] Bloom J, Pagano M. Deregulated degradation of cdk inhibitor p27 and malignant transformation. Semin Cancer Biol 2003; 13: 41-7. [144] Kudo Y, Kitajima S, Ogawa I, Miyauchi M, Takata T. Down-regulation of Cdk inhibitor p27 in oral squamous cell carcinoma. Oral Oncol 2004; 41: 105-16. [145] Shintani S, Mihara M, Nakahara Y, Kiyota A, Ueyama Y, Matsumura, et al. Expression of cell cycle control proteins in normal epithelium, premalignant and malignant lesions of oral cavity. Oral Oncol 2002; 38: 235-43.
Prognostic Indicators in Oral Squamous Cell Carcinoma
87
[146] Schoelch ML, Regezi JA, Dekker NP, Ng IOL, McMillan A, Ziober BL, et al. Cell cycle proteins and the development of oral squamous cell carcinoma. Oral Oncol 1999; 35: 333-42. [147] Kudo Y, Takata T, Ogawa I, Zhao M, Sato S, Takekoshi T, et al. Reduced expression of p27Kip1 correlates with an early stage of cancer invasion in oral squamous cell carcinoma. Cancer Lett 2000; 151: 217-22. [148] Kudo Y, Takata T, Yasui W, Ogawa I, Miyauchi M, Takekoshi T, et al. Reduced expression of cyclin-dependent kinase inhibitor p27Kip1 is an indicator of malignant behavior in oral squamous cell carcinoma. Cancer 1998; 83: 2447-55. [149] Pardee AB. G1 events and regulation of cell proliferation. Science 1989; 246: 603-8. [150] Hall PA, Woods AL. Immunohistochemical markers of cell proliferation. Achievements, problems and prospects. An invited review. Cell Tissue Kinet 1990; 23: 505-22. [151] Sasaki K, Murakami T, Kawasaki M, Takahashi M. The cell cycle associated change of the Ki-67 reactive nuclear antigen expression. J Cell Physiol 1987; 133: 579-84. [152] Verheijen R, Kuijipers HJH, Schlingeman RO, Boehmer ALM, van Driel R, Brakenhoff GJ. Ki-67 detects a nuclear matrix-associated proliferation-related antigen: 1. Intracellular localization during interphase. J Cell Sci 1989; 92: 123-30. [153] Nogami T, Kuyama K, Yakamoto H. Histopathological and immunohistochemical study of malignant transformation of oral leukoplakia, with special reference to apoptosis-related gene products and proliferative activity. Acta Otolaryngol 2003; 123: 767-75. [154] Scholzen T, Gerdes J. The Ki-67 protein: from the known and the unknown. J Cell Physiol 2000; 182: 311-22. [155] Key G, Kubbutat MH, Gerdes J. Assessment of cell proliferation by means of an enzyme-linked immunoabsorbent assay based on the detection of the ki-67 protein. J Immunol Methods 1994; 133: 1710- 5. [156] Dissanayake U, Johnson NW, Warnakulasurya KAAS. Comparison of cell proliferation in the centre and advancing fronts of oral squamous cell carcinomas using Ki-67 index. Cell Prolif 2003; 36: 255-64. [157] Liu SC, Klein-Szanto AJ. Markers of proliferation in normal and leukoplakic oral epithelia. Oral Oncol 2000; 36: 145-51. [158] Gerdes J, Lemke H, Baisch H, Wacker HH, Schwab U, Stein H. Cell cycle analysis of a cell proliferation-associated human nuclear antigen defined by the monoclonal antibody Ki-67. J Immunol 1984; 133: 1710-5. [159] Mittal KP, Demopoulos RI, Goswani S. Proliferating cell nuclear antigen (cyclin) expression in normal and abnormal cervical squamous epithelia. Am J Surg Pathol 1993; 17: 117- 22. [160] Warnakulasurya KAAS, MacDonald DG. Epithelial cell kinetics in oral leukoplakia. J Oral Pathol Med 1995; 24: 163- 9. [161] García-Pola Vallejo MJ, Anitua Roldán MJ, Fernández Álvarez BE, García Martín JM, López Muñiz A. Estudio comparativo de la expresión del Ki-67 en el liquen plano oral y la leucoplasia oral. Análisis cuantitativo. Med Oral 2001; 6: 364-70.
88
Márcio Diniz-Freitas, Eva Otero-Rey, Andrés Blanco-Carrión et al.
[162] Gonzalez-Moles MA, Ruiz-Avila, I, Rodriguez-Archilla A, Martinez-Lara I. Suprabasal expression of Ki-67 antigen as a marker for the presence and severity of oral epithelial dysplasia. Head Neck 2000; 22: 658-61. [163] Sudbo J, Reith A. Which putatively pre-malignant oral lesions become oral cancers? Clinical relevance of early targeting of high-risk individuals. J Oral Pathol Med. 2003; 2: 63-70. [164] Iamaroon A, Khemaleelakul U, Pongsiriwet S, Pintong J. Co-expresion of the p53 and Ki-67 and lack of EBV expression in oral squamous cell carcinoma. J Oral Pathol Med 2004; 33: 30-6. [165] Tumuluri V, Thomas GA, Fraser IS. Analysis of the Ki-67 antigen at the invasive tumor front of human oral squamous cell carcinoma. J Oral Pathol Med 2002; 31: 598-604. [166] Matsumoto M, Komiyama K, Okaue M, Shimoyama Y, Iwakami K, Namaki S, et al. Predicting tumor metastasis in patients with oral cancer by means of the proliferation marker Ki-67. J Oral Sci 1999; 41: 53-6. [167] Xie X, De Angelis P, Clausen OPF, Boyesen M. Prognostic significance of proliferative and apoptotic markers in oral tongue squamous cell carcinomas. Oral Oncol 1999; 35: 502-9. [168] Thompsom PJ, Soames JV, Booth C, O`Shea JA. Epithelial cell proliferative activity and oral cancer progression. Cell Prolif 2002, 35: 583-9. [169] Sittel C, Ruiz S, Volling P, Kvasnicka HM, Jungehulsing M, Eckel HE. Prognostic significance of Ki-67 (MIB1), PCNA and p53 in cancer of the oropharynx and oral cavity. Oral Oncol 1999; 35: 583-9. [170] Bortoluzzi MC, Yurgel LS, Dekker NP, Jordan RCK, Regezi JA. Assessment of p63 in oral squamous cell carcinomas and dysplasias. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2004; 94: 698-704. [171] Silva SD, Agostini M, Nishimoto I, Colleta RD, Alves FA, Lopes MA, et al. Expression of fatty acid synthase, ErbB2 and Ki-67 in head neck squamous cell carcinoma. A clinicopathological study. Oral Oncol 2004; 40: 688-96. [172] Piffko J, Bankfalvi A, Ofner D, Kusch F, Bocker W, Joos U. In situ assessment of cell proliferation at the invasive front of oral squamous cell carcinomas. Virchows Arch 1996; 429: 229-34. [173] Bettendorf O, Herrmann G. Prognostic relevance of Ki-67 antigen expression in 329 cases of oral squamous cell carcinoma. ORL J Otorhinolaryngol Relat Spec 2002; 64: 200-5. [174] Stoll C, Baretton G, Ahrens C, Lörs U. Prognostic significance of apoptosis and associates factors in oral squamous cell carcinoma. Virchows Arch 2000; 436: 102-8. [175] Oliver RJ, MacDonald DG, Felix DH. Aspects of cell proliferation in oral epithelial dysplastic lesions. J Oral Pathol Med 2000; 29: 49-55. [176] Oliver RJ, MacDonald DG. G1 cyclins in oral epithelial dysplasias. J Oral Pathol Med 2001; 30: 80-6. [177] Bankfalvi A, Piffko J. Prognostic and predictive factors in oral cancer: The role of the invasive tumour front. J Oral Pathol Med 2000, 29: 291-8.
Prognostic Indicators in Oral Squamous Cell Carcinoma
89
[178] Scully C, Field JK, Tanzawa H. Genetic aberrations in oral or head and neck squamous cell carcinoma (SCCHN): 1. Carcinogen metabolism, DNA repair and cell cycle control. Oral Oncol 2000; 256-63. [179] Kanekawa A, Tsuji T, Oga A, Sasaki K, Shinozaki F. Chromosome 17 abnormalities in squamous cell carcinoma of the oral cavity, and its relationship with p53 and Bcl-2 expression. Anticancer Res 1999; 19: 81-6. [180] Nuñez G, Clarke MF. The Bcl-2 family of proteins: regulators of cell death and survival. Trends Cell Biol 1994; 4: 399-403. [181] Reed JC. Bcl-2 and the regulation of programmed cell death. J Cell Biol 1994; 124: 1-6. [182] Loro LL, Vintermyr OK, Liavaag PG, Jonsson R, Johannessen AC. Oral squamous cell carcinoma is associated with decreased Bcl-2/Bax expression ratio and increased apoptosis. Hum Pathol 1999; 30: 1097-105. [183] Ito T, Fujieda S, Tsuzuki H, Sunaga H, Fan G, Sugimoto C, et al. Decreased expresion of Bax is correlated with poor prognosis in oral and oropharyngeal carcinoma. Cancer Lett 1999; 140: 81-91. [184] Jordan RCK, Catzavelos GC, Barret AW, Apeight PM. Differential expression of Bcl-2 and bax in squamous cell carcinoma of the oral cavity. Oral Oncol Eur J Cancer 1996; 32B: 394-400. [185] Salvesen GS, Duckett CS. IAP proteins: blocking the road to death’s door. Nat Rev Mol Cell Biol 2002; 3: 226-32. [186] Ambrosini G, Adida C, Altieri DC. A novel anti-apoptosis gene, survivin, expressed in cancer and lymphoma. Nat Med 1997; 3: 917- 21. [187] Altieri DC. The molecular basis and potential role of survivin in cancer diagnosis and therapy. Trend Mol Med 2001; 7: 542-7. [188] Tanaka C, Uzawa K, Shibahara T, Yokoe H, Noma H, Tanzawa H. Expression of an inhibitor of apoptosis, survivin, in oral carcinogenesis. J Dent Res 2003; 82: 607-11. [189] Lo Muzio L, Pannone G, Leonardi R, Staibano MD, Mignogna MD, De Rosa G, et al. Survivin, a potential early marker predictor of tumor progresion in the oral mucosa. J Dent Res 2003; 82: 923-8. [190] Lo Muzio L, Farina A, Rubini C, Pezzetti F, Stabellini G, Laino G, Santarelli A, Pannone G, Bufo P, de Lillo A, Carinci F. Survivin as prognostic factor in squamous cell carcinoma of the oral cavity. Cancer Lett 2005;225:27-33. [191] Lopez-Graniel CM, Tamez de Leon D, Meneses-Garcia A, Gomez-Ruiz C, FriasMendivil M, Granados-Garcia M, Barrera-Franco JL. Tumor angiogenesis as a prognostic factor in oral cavity carcinomas. J Exp Clin Cancer Res 2001;20:463-8. [192] Smith BD, Smith GL, Carter D, Sasaki CT, Haffty BG. Prognostic significance of vascular endothelial growth factor protein levels in oral and oropharyngeal squamous cell carcinoma. J Clin Oncol 2000;18:2046-52 [193] Weidner S, Semple JP, Welch WR, Folkman J. Tumor angiogenesis and metastasis correlation in invasive breast carcinoma. N Engl Med 1991; 324; 1-8. [194] Ferrara N, Davis-Smith T. The biology of vascular endothelial growth factor. Endocrine Rev 1997; 18: 4-25.
90
Márcio Diniz-Freitas, Eva Otero-Rey, Andrés Blanco-Carrión et al.
[195] Gupta K, Kshirsagar S, Li W, Gui L, Ramakrishnan S, Gupta P, et al. VEGF prevents apoptosis of human microvascular endothelial cells via opposing effects on MAPK/ERK and SAPK/JNK signalling. Exp Cell Res 1999; 247: 495-504. [196] Relf M, LeJeune S, Scott PA, Fox S, Smith K, Leek R, et al. Expression of the angiogenic factors vascular endothelial cell growth factor, acidic and basic fibroblast growth factor, tumor growth factor beta-1, platelet-derived endothelial cell growth factor, placenta growth factor, and pleiotrophin in human primary breast cancer and its relation to angiogenesis. Cancer Res 1997; 57: 963-9. [197] Takahashi Y, Kitadai Y, Bucana CD, Cleary KR, Ellis LM. Expression of vascular endothelial growth factor and its receptor, KDR, correlates with vascularity, metastasis, and proliferation of human colon cancer. Cancer Res 1995; 55:3964-8. [198] Uchida S, Shimada Y, Watanabe G, Tanaka H, Shibagaki I, Miyahara T, et al. In oesophageal squamous cell carcinoma vascular endothelial growth factor is associated with p53 mutation, advanced stage and poor prognosis. Br J Cancer 1998; 77: 1704-9. [199] Utehara M, Sano K, Ikeda H, Sekine J, Irie A, Yokota T, et al. Expression of vascular endothelial growth factor and prognosis of oral squamous cell carcinoma. Oral Oncol 2004; 40: 321-5. [200] Moriyama M, Kumagai S, Kawashiri S, Kojima K, Yamamoto E. Immunohistochemical study of tumor angiogenesis in oral squamous cell carcinoma. Oral Oncol 1997; 33: 369-74. [201] Schimming R, Reusch P, Kuschnierz J, Schmelzeisen R. Angiogenic factors in squamous cell carcinoma of the oral cavity: do they have prognostic relevance? Int J Oral Maxillofac Surg 2004; 32: 176-81. [202] Yamamoto E, Miyakawa A, Kohama G. Mode of invasion and lymph node metastasis in squamous cell carcinoma of the oral cavity. Head Neck Surg 1984: 6: 938-47. [203] Fidler IJ. Tumour heterogeneity and the biology of cancer invasion and metastasis. Cancer Res 1978; 38: 2651- 60. [204] Smith MEF. Pignatelli M. The molecular histology of neoplasia: the role of the cadherin/catenin complex. Histopathology 1997; 31: 107-11. [205] Kleinman HK, Cannon FB, Laurie GW, Hassell JR, Aumalley M, Terranova VP, et al. Biological activities of laminin. J Cell Biochem 1985; 27: 317-25. [206] Burgeson RE, Chiquet M, Deutzmann R, Ekblom P, Engel J, Kleinman H, et al. A new nomenclature for the laminins. Matrix Biol 1994; 14: 209-11. [207] Skyldberg B, Salo S, Eriksson E, Aspenblad U, Moberger B, Tryggvason K, Auer G. Laminin-5 as a marker of invasiveness in cervical lesions. J Nat Cancer Inst 1999; 91; 1882-7. [208] Koshikawa N, Moriyama K, Takamura H, Mizushima H, Nagashima Y, Yanoma S, et al. Over-expression of laminin γ 2 chain monomer in invading gastric carcinoma cells. Cancer Res 1999; 59: 5596- 61. [209] Miyazaki K, Kikkawa Y, Nakamura, Yasumitsu H, Umeda M. A large cell-adhesive scatter factor secreted by human gastric carcinoma cells. Proc Natl Acad Sci USA. 1993; 90: 11767-71.
Prognostic Indicators in Oral Squamous Cell Carcinoma
91
[210] Giannelli G, Falk- Marzillier J, Schiraldi O, Stetler-Stevenson WG, Quaranta V. Induction of cell migration by matrix metalloprotease-2 cleavage of laminin-5. Science 1997; 277: 225-8. [211] Bànkfalvi A, Piffko J. Prognostic and predictive factors in oral cancer: The role of the invasive tumour front. J Oral Pathol Med 2000; 29: 291-8. [212] Pyke C, Romer J, Kallunki P, Lund LR, Ralfkaer E, Dano K, Tryggvason K. The γ2 chain of kalinin/laminin 5 is preferentially expressed in invading malignant cells in human cancers. Am J Pathol 1994; 145: 782-91. [213] Bryne M. Is the invasive front of an oral carcinoma the most important area for prognostication? Oral Dis 1998; 4: 70-7. [214] Yakamoto H, Itoh F, Shouhei I, Hosokana M, Imai K. Expression of the γ chain of laminin-5 at the invasive front is associated with recurrence and poor prognosis in esophageal squamous cell carcinomas. Clin Cancer Res 2001; 7: 896-900. [215] Lenander C, Habermann SK, Ost A, Wilsson B, Shimmelpeenning H, Trggvason K, Auer G. Laminin-5 gamma 2 chain expression correlated with unfavourable prognosis in colon carcinomas. Anal Cell Pathol 2001; 22: 201-9. [216] Morya Y, Niki T, Yamada T, Matsuno Y, Kondo H, Hirohashi S. Increased expression of laminin-5 and its prognostic significance in small-size lung adenocarcinoma: an immunohistochemical analysis of 102 cases. Cancer 2001; 91: 1129-41. [217] Nordemar S, Högmo A, Lindholm J, Auer G, Munck-Wikland E. Laminin-5γ2: a marker to identify oral mucosal lesions at risk for tumor development? Anticancer Res 2003; 23: 4985-90. [218] Ono Y, Nakanishi Y, Ino Y, Niki T, Yamada T, Yoshimura K, et al. Clinicopathologic significance of laminin-5 γ2 chain expression in squamous cell carcinoma of the tongue. Immunohistochemical analysis of 67 lesions. Cancer 1999; 85: 2315-21. [219] Katoh K, Nakanishi Y, Akimoto S, Yoshimura K, Takagi M, Sakamoto M, et al. Correlation between laminin-5 γ2 chain expression and epidermal growth factor receptor expression and its clinicopathological significance in squamous cell carcinoma of the tongue. Oncology 2002; 62: 318- 26. [220] Stoltzfus P, Hogmo A, Lindholm J, Aspenblad U, Auer G, Munck-Wikland E. The gamma2 chain of laminin-5 as an indicator of increased risk for recurrence in T1 stage tongue cancer. Anticancer Res. 2004; 24: 3109-14. [221] Lim SC, Zhang S, Ishii G, Endoh Y, Kodama K, Miyamoto S, et al. Predictive markers for late cervical metastasis in stage I and II invasive squamous cell carcinoma of the oral tongue. Clin Cancer Res 2004; 10: 166-72. [222] Diniz-Freitas M. Carcinoma oral de células escamosas: Evaluación pronóstica de variables clínicas, histológicas e inmunohistoquímicas. Doctoral Thesis. University of Santiago de Compostela,2005. [223] Sakaki T, Tamura I, Kadota H, Kakudo K. Changing expression of E-and P-cadherin during rat tongue carcinogenesis induced by 4-nitroquinoline 1-oxide. J Oral Pathol Med 2003; 32: 530-7. [224] Lewis JE, Jensen PJ, Johnson KR, Wheelock MJ. E-cadherin mediates adherens junction organisation through protein kinase C. J Cell Sci 1995; 107: 3615-21.
92
Márcio Diniz-Freitas, Eva Otero-Rey, Andrés Blanco-Carrión et al.
[225] Knusden KA, Soler AP, Johnson KP, Wheelock MJ. Interactions of alpha-actin with the cadherin catenin cell- cell adhesion complex via α-catenin. J Cell Biol 1995; 130: 67-77. [226] Larue L, Antos C, Butz S, Huber O, Delmas V, Dominis M, et al. A role for cadherins in tissue formation. Development 1996; 122: 3185-94. [227] Downer CS, Speight M. E-cadherin expression in normal, hyperplastic and malignant oral epithelium. Eur J Cancer Oral Oncol 1993; 29B: 3003-5. [228] Bankfalvi A, Krabort M, Végh A, Felszeghy E, Piffkó J. Deranged expression of the E-cadherin/ β-catenin complex and the epidermal growth factor receptor in the clinical evolution and progression of oral squamous cell carcinomas. J Oral Pathol 2002; 31: 450-7. [229] Shimoyana Y, Hirohashi S. Cadherin intercellular adhesion molecule in hepatocellular carcinomas; loss of E-cad expression in an undifferentiated carcinoma. Cancer Lett 1999; 57: 2185-91. [230] Mayer B, Johnson JP, Leitl F, Jauch KW, Heiss MM, Schildberg FW, et al. E-cad expression in primary and metastatic gastric cancer; down regulation correlates with cellular dedifferentiation and glandular disintegration. Cancer Res 1993; 53: 1690-5. [231] Andrews NA, Jones AS, Helliwel TR, Kinsella AR. Expression of the cell-cell adhesion molecule E-cadherin in squamous cell carcioma of the head and neck. Clin Otolaryngol 1993; 18: 196-201. [232] Mattijssen V, Peters HM, Schalkwijk L, Manni JJ, van 't Hof-Grootenboer B, de Mulder PH, et al. E- cadherin expression in head and neck squamous cell carcinoma is associated with clinical outcome. Int J Cancer 1993; 55: 580-5. [233] Shinohara M, Hiraki A, Ikebe T, Nakamura S, Kurahara S, Shirasuna K, et al. Immunohistochemical study of desmossomes in oral squamous cell carcinoma: correlation with citokeratin and E-cadherin staining, and with tumour behavior. J Pathol 1998; 184: 369-71. [234] Chow V, Yuen AP, Lam KY, Tsao GS, Ho WK, Wei WI. A comparative study of the clinicopathological significance of E-cadherin and catenins (alpha, beta, gama) expression in the surgical management of oral tongue carcinoma. J Cancer Res Clin Oncol 2001; 127: 59-63. [235] Yoshiura K, Kanai Y, Ochiai A, Shimoyama Y, Sugimura T, Hirohashi S. Silencing of the E-cadherin invasion-supressor gene by CpG methylation in human carcinomas. Proc Natl Acad Sci USA 1995; 92: 7416-9. [236] Bankfalvi A, Krabort M, Buchwalow IG, Végh A, Felszeghy E, Piffkó J. Gains and losses of adhesion molecules (CD44, E-cadherin, and β-catenin) during oral carcinogenesis and tumor progression. J Pathol 2002; 198: 343-51. [237] Hung KF, Chang CS, Liu CJ, Lui MT, Cheng CY, Kao SY. Differential expression of E-cadherin in metastatic lesions comparing to primary oral squamous cell carcinoma. J Oral Pathol Med. 2006; 35:589-94. [238] Bagutti C, Speight PM, Watt FM. Comparison of integrin, cadherin, and catenin expression in squamous cell carcinomas of the oral cavity. J Pathol 1998; 186: 8-16. [239] Shinohara M, Hiraki A, Ikebe T, Nakamura S, Kurahara SI, Shirasuna K. Immunohistochemical study of desmosomes in oral squamous cell carcinoma:
Prognostic Indicators in Oral Squamous Cell Carcinoma
93
correlation with cytokeratin and e-cadherin staining, and with tumour behaviour. J Pathol 1998; 184: 369-81. [240] Birchmeier W, Weidner KM, Hulsken J, Behrens J. Molecular mechanisms leading to cell junction (cadherin) deficiency in invasive carcinomas. Semin Cancer Biol 1993; 4: 231-9. [241] Tanaka N, Odajima T, Ogi K, Ikeda T, Satoh M. Expression of E-cadherin, α-catenin, and β- catenin in the process of lymph node metastasis in oral squamous cell carcinoma. Br J Cancer 2003; 89: 557-63. [242] Tsuda H, Zhang WD, Shimosato Y, Yokota J, Terada M, Sugimura T, et al. Allele loss on chromosome 16 associated with progression of human hepatocellular carcinoma. Proc Natl Acad Sci USA 1990; 87: 6791-4. [243] Wijnhoven BP, de Both NJ, van der Dekken H, Tilanus HW, Dinjens WN. E-cadherin gene mutations are rare in adenocarcinomas of the esophagus. Br J Cancer 1999; 80: 1652- 7 [244] Kanai Y, Oda T, Tsuda H, Ochiai A, Hirohashi S. Point mutation of the E-cadherin gene in invasive lobular carcinoma of the breast. Jpn J Cancer Res 1994; 85: 1035-9. [245] Saito Y, Takazawa H, Uzawa K, Tanzawa H, Sato K. Reduced expression of E-cadherin in oral squamous cell carcinoma: relationship with DNA methylation of 5´CpG island. Int J Oncol 1998; 12: 293-8. [246] Chang HS, Chow V, Lam KY, Wei WI, Yuen APW. Loss of E-cadherin expression resulting from promoter hypermethylation in oral tongue carcinoma and its prognostic significance. Cancer 2002; 94: 386-92. [247] Nakayama S, Sasaki A, Mese H, Alcade RE, Tsuji T, Matsumura T. The e-cadherin gene is silenced by CpG methylation in human oral squamous cell carcinomas. Int J Cancer 2001; 93: 667-73. [248] Kallioniemi OP, Wagner U, Kononen J, Sauter G. Tissue microarrays for high throughput molecular profiling of cancer. Hum Mol Genet 2001; 10: 657- 62. [249] Kononen J, Bubendorf L, Kallioniemi A, Barlund M, Schraml, Leighton S, et al. Tissue microarrays for highthroughput molecular profiling of tumor specimens. Nat Med 1998; 4: 844- 7. [250] Otero-Rey E, Garcia-Garcia A, Barros-Angueira F, Torres-Espanol M, Gandara-Rey JM, Somoza-Martin M. DNA microarrays in oral cancer. Med Oral 2004;9 :288-92. [251] Somoza-Martin JM, Garcia-Garcia A, Barros-Angueira F, Otero-Rey E, Torres-Espanol M, Gandara-Vila P, Reboiras-Lopez MD, Blanco-Carrion A, Gandara-Rey JM. Gene expression profile in oral squamous cell carcinoma: a pilot study. J Oral Maxillofac Surg 63: 786-92.
In: Oral Cancer Research Advances Editor: Alexios P. Nikolakakos, pp. 95-124
ISBN 978-1-60021-864-4 © 2007 Nova Science Publishers, Inc.
Chapter 4
TUMOR-TARGETING NON-VIRAL GENE THERAPY FOR THE TREATMENT OF ORAL CANCER Yoshiyuki Hattori and Yoshie Maitani Institute of Medicinal Chemistry, Hoshi University, Ebara 2-4-41, Shinagawa-ku, Tokyo, 142-8501 Japan.
ABSTRACT Despite advances in surgery, radiotherapy, and chemotherapy, the survival of patients with oral squamous cell carcinoma has not significantly improved over the past several decades. Gene therapy has the potential for the treatment of oral cancer. Cancer gene therapy is currently being met with the development of non-viral vectors, because non-viral vectors have a much lower potential for an adverse inflammatory or immune reaction, compared with viral vectors. For gene delivery, oral cancer is a particular appropriate target since it can be applied by direct injection. Also since folate and transferrin receptors are frequently overexpressed on oral tumors such as nasopharyngeal tumor and head and neck of squamous cell carcinoma, folic acid and transferrin have been utilized as a ligand for tumor-targeting gene delivery. Non-viral vectors conjugated to these ligands have been used as carriers of therapeutic DNA to targeted oral tumor. The strategies are used for inactivation of oncogene expression, introduction of tumor suppressor genes, and introduction of a gene that enable to a prodrug to be activated into an active cytotoxic drug. In this review, we outline tumor-targeting liposome and lipidbased nanoparticle vectors, and discuss the effectiveness as these non-viral vectors for DNA transfection and for gene therapy to treat human oral tumors.
96
Yoshiyuki Hattori and Yoshie Maitani
ABBREVIATIONS AS-ODN, Antisense oligodeoxynucleotide; CHEMS, Cholesteryl hemisuccinate; CMV, Cytomegalovirus; Chol, Cholesterol; DC-Chol, 3([N-(N',N'–dimethylaminoethane)-carbamoyl] cholesterol; DMRIE, Dimyristyloxypropyldimethyl hydroxyethyl ammonium; DOPE, Dioleoyl phosphatidylethanolamine; DPPE, Dipalmitoyl phosphatidylethanolamine; DSPE, Distearoyl phosphatidylethanolamine; DOTAP, Dioleoyltrimethylammonium; DOTMA, Dioleoyltrimethylammonium; FR, Folate receptor; GCV, Ganciclovir; HSV-tk, Herpes simplex virus thymidine kinase; IL, Interleukin; OH-Chol, Cholesteryl-3β-carboxyamidoethylene-N- hydroxyethylamine; PEG, Polyethyleneglycol; PEI, Polyethylenimine; PLL, Poly-L-lysine; PEG-DSPE, Polyethyleneglycol-distearoylphoshatidylethanolamine; RFC, Reduced folate carrier; RNAi, RNA intereferance; SCC, Squamous cell carcinoma; siRNA, Small interfering RNA; Tf , Transferrin; TfR, Transferrin receptor
1. INTRODUCTION Oral cancers constitute about 3-5 percent of all cancer in the United State and are more common in persons over age 50 [1]. Most oral malignant tumors are classified as squamous cell carcinoma (SCC), while the incidence of malignant melanoma and osteosarcoma is comparatively low. Early-stage (I and II) oral SCC can be treated with surgery or radiation. However, in the majority of oral cancers present at an advanced stage (III and IV), a combination of surgery and radiation therapy provides the best survival rate. In chemotherapy for oral cancer, no evidence of increased survival when chemotherapy alone was used. Therefore, chemotherapy is usually combined with radiation therapy. Currently used chemotherapeutic agents include cisplatin, carboplatin, 5-fluorouracil (5-FU) and the taxanes (paclitaxel and docetaxel). However, patients with recurrent oral cancer that is refractory to chemotherapy and/or radiation therapy have a median life expectancy of several months [2],
Tumor-Targeting Non-Viral Gene Therapy for the Treatment of Oral Cancer
97
and the response rate to chemotherapeutic regimens is approximately 15%. Two-thirds of patients dying of this disease have no evidence of distant metastases. Gene therapy is currently being investigated as a new therapeutic approach for oral tumor, which is a particular appropriate target since it can be applied by direct injection. Also since folate and transferrin receptors are frequently overexpressed on oral tumors such as nasopharyngeal tumor and head and neck of squamous cell carcinoma, folic acid and transferrin have been utilized as a ligand for tumor-targeting gene delivery. Cancer gene therapy has been intensively developed using non-viral vectors, among which cationic liposomes and nanoparticles are the most investigated, because non-viral gene therapy has a much lower potential for an adverse inflammatory or immune reaction, compared with viral vectors. However, the clinical application of non-viral gene therapy for treatment of oral cancer will require optimization of gene delivery in tumor specificity and transfection efficiency. We focus on tumor-targeting lipid-based nanoparticle vectors, and discuss the effectiveness as a non-viral vector for DNA transfection and for gene therapy to treat human oral tumors.
2. GENE EXPRESSION MECHANISMS Plasmids for gene expression systems contain a cDNA coding for either a full gene or minigene and several other genetic elements, including introns, polyadenylation sequences and transcript stabilizers to control transcription, translation, protein stability and secretion from the host cells [3]. The minimal transcription unit required for expression of a therapeutic protein consists of a 5’ promoter upstream of the gene encoding the therapeutic protein (for example, HSV-tk or cytosine deaminase) and a polyadenylation signal downstream of the gene. The presence of a polyadenylation signal in a transgene construct helps in the correct processing of the mRNA generated by transcription. Some transgene constructs have introns that increase pre-mRNA processing and nuclear transport [4]. Promoter sequences play a vital role in initiating gene transcription. Promoter sequences offer recognition sites for the RNA polymerase to initiate the transcription process. Enhancers are regions in the plasmid DNA that enhance the production of the gene of interest by as much as several hundred times [5]. Enhancers can be tissue specific and can be present in the plasmid either upstream or downstream from the promoter region. Transcriptional efficiency can be substantially improved by the choice of suitable enhancers. Commonly used enhancer and promoter sequences are derived form viral origins such as cytomegalovirus (CMV), simian virus 40 (SV40), Moloney murine leukemia virus (MoMLV), and Rous sarcoma virus (RSV) [5]. Higher efficiency can be obtained by engineering the plasmid with strong tissue- or tumor-specific promoters. However, there are few reports about oral tumor-specific promoters. Promoter of human papilloma virus (HPV) [6], mouse mammary tumor virus (MMTV) [7,8], multi-drug-resistance gene (mdr-1) [9] and ED-L2 promoter of Epstein Barr (EB) virus [10] are known to be active in oral cancer cells or in other squamous epithelial cells. Promoter from virus such an EB virus might have a useful for nasopharyngeal tumorspecific promoter, because EB virus is present exclusively in the nasopharyngeal tumor cells, but not in the surrounding normal tissues [11]. Recently, S100A7 gene has been shown to be
Yoshiyuki Hattori and Yoshie Maitani
98
markedly over-expressed in SCC, and up-regulatory elements for transcription activity of the S100A7 in oral SCC was identified [12]. This promoter might have potential for oral SCCspecific therapeutic strategies. The actual level of strength that will needed for most gene therapy applications is still not determined. In oral tumor cells, the order of promoter activities of CMV, SV40, MMTV, HPV and mdr-1 was CMV > SV40 > HPV > mdr-1 > MMTV [9]. The RSV promoter was reported to be active in the CHU-2 line of oral cancer cells at low level than the SV40 promoter [13]. In suicide gene therapy with herpes simplex virus thymidine kinase (HSV-tk) gene, HSV promoters were not strong enough to induce the suicide phenotype in the HSV-tk gene-introduced cells after addition of ganciclovir (GCV) [9]. Therefore, CMV and SV40 promoters appear to be the first choice for gene therapy. Table I. Viral vectors and therapeutic genes for treatment of oral tumor Therapeutic gene
Adenoviruses
Retroviruses AAV Lentivirus
Cell lines
Tissue
Ref.
Nasopharyngeal carcinoma (NPC) NPC SCC of head and neck SCC of head and neck Oral SCC NPC NPC NPC Clinical trial for NPC SCC of head and neck NPC Tongue carcinoma Oral SCC, SCC of tongue Oral tumor Oral tumor Tongue carcinoma NPC Oral SCC Oral SCC Oral cancer
[15] [16] [17] [18] [19] [20] [21,22] [24] [23] [25-28] [29] [30] [31] [32] [33] [34] [35] [36] [37] [38]
p21
Oral SCC
[14]
HSV-tk
Oral SCC
[39]
Oral cancer
[40]
p16 p16 p27 p53 or p27 p53 p53 p53 P53 + cisplatin p53 + radiation HSV-tk HSV-tk HSV-tk IL-2 IL-2 HSV-tk + IL-2 Endostatin Endostatin Rb IκBα Anti-bcl2 ribozyme
HIV-1 VPR
C666-1 CNE-1, CNE-2Z SNU-1041, -1066, -1076 SNU-1041, -1066, -1076 HSC-2,-3, -4, SAS CNE-1 CNE-1, CNE-2Z CNE-1, C666-1 KB Tca8113 HSC-2, -3, OSC70 SCC VII SCC VII Tca8113 NE-2 012 SCC15, SCC5 686LN, 1483, Tu183
AT-84
3. VIRAL VECTOR SYSTEMS Viruses used in oral cancer gene therapies include retroviruses [14], adenoviruses [1538], adeno-associated viruses (AAV) [39] and lentivirus [40]. The majority of viral-mediated gene therapy for oral cancer has used adenoviruses (Table I). Adenoviruses are DNA viruses that infect a cell and transfer DNA into the nucleus. This DNA does not integrate into the
Tumor-Targeting Non-Viral Gene Therapy for the Treatment of Oral Cancer
99
host genome. Multiple administrations of the vector are usually required since expression of therapeutic gene is transient. The advantage of adenoviral vectors is that most cells are susceptible to infection, regardless of their position in the cell cycle. In addition, adenoviruses can be produced at a relatively higher titer, thus increasing the efficiency of their administration. However, approximately 90% of humans have already formed antibodies against the virus. Pre-existing antibodies can limit the effectiveness of this strategy, particularly upon a second exposure to the vector. Several genetic alterations have been described in oral cancer, including mutations of p53 [18-24], p16 [15,16], and p27 [17]. The most extensively studied mutations in oral cancer are those of p53, and p53 gene transfer was tested in SCC patients by injecting the primary or regional tumor with an adenoviral vector expressing wild-type p53 (Table I).
4. NON-VIRAL VECTOR SYSTEMS Viral vectors are efficient in transfection, but pose risks to the host due to the immunogenicity of viral proteins, the potential for oncogenesis due to chromosomal integration, and the generation of infectious viruses due to recombination. Non-viral vectors are an attractive alternative method for gene transfection. Particulate systems are needed for the delivery of DNA, which is unstable and highly hydrophilic, and has high molecular weight, because of the high nuclease levels present in serum and its inability to cross intact endothelial barriers. Advantages of using cationic particles include stabilization of the DNA by protecting it, for example, from serum nucleases and enhancing cellular uptake via endocytosis as compared to neutral or anionic particles. This is a result of the favorable electrostatic interaction of cationic particles with the negatively charged moieties on biological membranes. There are two types of methods: physical method such as electrotransfection, and chemical methods, such as vector-mediated transfection. Among them, particulate vectors, e.g., polymeric particles and lipid-based particles, possess specific advantages and disadvantages. Lipid-based nanoparticles can be divided in three groups, liposomes, emulsions and particles. Liposomes contain an inner water phase, emulsions contain an inner oil or water phase, and nanoparticles are here defined as having no inner phase. The advantages of lipid-based nanoparticles are, for instance, the ease of modifying the surface of the particles for tissue-specific targeting, their lack of immunogenicity, their relative safety, and relative ease of large-scale production. The disadvantages include poor efficiency of transfection.
4.1. Physical Methods Naked plasmid DNA provides a promising mechanism for gene delivery, as it is less immunogenic than most non-vial vectors currently used. Although naked plasmid DNA has no target-specificity and is more susceptible to nuclease degradation in serum than encapsulated DNA, high levels of gene expression in oral solid tumor can be obtained by
100
Yoshiyuki Hattori and Yoshie Maitani
intratumoral injection of naked plasmid DNA [41]. Delivery of naked DNA has been prompted through the application of electric pulses to the target areas. Electroporation involves injection of the naked DNA followed by the application of an electric pulse over the target tissues [42]. The electric pulses increase the permeability of the cell membranes and allow for increased uptake of the naked DNA into tumor cells. Transfection by electroporation into oral tumor B88 xenografts resulted in consistently efficient transduction of a higher number of the cells than that by naked DNA alone [43]. Hydrodynamic injection allows DNA delivery to larger target regions, and is not limited to superficial tissue [44]. This method involves high-pressure injection of a large volume of solution containing the DNA of the interest. Gene expression was found to increase, particularly in hepatocytes, as a result of defects in the cells resulting from the high-pressure injection. When plasmid DNA coding for gene of secretable protein as a therapeutic protein was injected by hydrodynamic injection, it can lead to appearance of the mRNA in the liver and the protein in the serum.
4.2. Particle Vectors Non-viral particle systems for DNA can be classified into two major types based on the nature of the synthetic material: 1) liposomal delivery systems (DNA entrapped in and/or complexed to liposomes) [45-47], 2) nanoparticle delivery systems (DNA/nanoparticle complexes). Cationic polymers, liposomes and nanoparticles are commonly used in gene delivery because they can easily complex with the anionic DNA molecules [48]. Polymer/DNA complexes (polyplexes), liposome/DNA complexes (lipoplexes) or nanoparticle/DNA complexes (nanoplexes) are used to deliver DNA into cells. The general mechanism of action of these complexes is based on the generation of a cationic complex owing to electrostatic interaction of cationic polymers or lipid with anionic DNA [49]. The cationic complex can then interact with the negatively charged cell surface to improve DNA uptake. Liposomes Liposomes are spherical, polymolecular aggregates with a bilayer shell configuration. Depending on the method of preparation, lipid vesicles can be uni- or multilamellar, containing one or many bilayer shells, respectively. Liposomes typically vary in size between 20 nm and a few hundred micrometers. Their core is aqueous in nature, its chemical composition corresponding to that of the aqueous solution in which the vesicles are prepared. The advantages of liposome vector are to have ability to entrap DNA in liposome or to complex DNA with cationic liposomes. To increase the overall efficiency of DNA delivery into the cells, cationic liposomes were designed and used as vectors. Cationic liposomes form complexes with DNA, i.e., lipoplexes, through charge interactions. Cationic liposomes are generally composed of a cationic lipid, such as dioleoyltrimethylammonium chloride (DOTMA), dioleoyltrimethylammonium propane (DOTAP), dioleoyldimethylammonio propane (DODAP), dimyristyloxypropyldimethyl hydroxyethyl ammonium (DMRIE) or dimethylaminoethanolamine carbamoyl cholesterol (DC-Chol), and a helper lipid, such as
Tumor-Targeting Non-Viral Gene Therapy for the Treatment of Oral Cancer
101
dioleoyl phosphatidylethanolamine (DOPE) or cholesterol (Chol), which provides fusogenicity and stability to the lipoplex (Figure 1). In gene therapy for treatment of oral tumor, cationic liposomes formulated with DC-Chol/DOPE [50-53], DOTAP/Chol [54], DOTMA/Chol [55-58] and DMRIE/DOPE [59,60] have been used in clinical trials (Table II). In in vitro DNA transfection for oral tumor cells, commercially available cationic liposome, Metafectene (Biontex Loboratories Gmb, Planegg, Germany) [61], Genejammer (Stratagene, CA, USA) [61], Oligofectamine (Invitrogen Corp., Carlsbad, CA, USA) [62] and lipofectamine2000 (Invitrogen) have also been used (Table II). Anionic liposomes have also been used as vesicles to entrap DNA for gene transfer for in vitro and in vivo transfection. However, these liposome formulations present some limitations associated with low efficiency of DNA encapsulation, DNA degradation induced by sonication and the requirement to remove the free DNA from liposome-entrapped DNA. To overcome these limitations, stabilized antisense-lipid particles (SALP) were developed for improved efficiency of encapsulation of DNA [63]. These systems utilize cationic lipids such as DODAP or N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), DC-Chol and an ethanol-containing buffer system for encapsulating large quantities of DNA in lipid vesicles. DOTMA O
+ N O
X O
DOTAP
Chol
O
+
X=
N
N
O
HO-
DC-Chol O
DODAP
O
+
X = (CH3)2NCH2CH2NHCO
O O
OH-Chol +
+ N
X = HOCH2CH2NHCH2CH2NHC
O O
DMRIE
O
+
HO
N O O
DOPE + H3N
O O
-
P O-
O
O O
O O
Figure 1. Structures of commonly used cationic lipids and helper lipids in gene therapy. DOTAP; dioleoyltrimethylammonium propane, DODAP; dioleoyldimethylammonio propane, DOTMA; dioleoyltrimethylammonium chloride, DODAP, ioleoyldimethylammonio propane, DMRIE;
Yoshiyuki Hattori and Yoshie Maitani
102
dimyristyloxypropyldimethyl-hydroxy ethyl ammonium, Chol; cholesterol, DC-Chol; dimethylaminoethanolamine carbamoyl cholesterol, OH-Chol; cholesteryl-3β-carboxyamidoethyleneN-hydroxylamine, and DOPE; dioleoyl phosphatidylethanolamine.
Table II. Gene delivery and therapy by non-viral vectors. All vectors were used in in vitro transfection Transfection method/ Formulation
Naked DNA
Liposome
Nanoparticle
DNA
Promoter
Gene
Combination
Cell lines or tumor
in vivo
-
AS-ODN
-
EGFR
Hydrodynamic injection
Plasmid
CAG
IL-21 and 15
-
1483 (SCCHN) UM-22B (Hypopharyngeal tumor) SCC-VII (SCCHN)
Electroporation
Plasmid
CMV
p27
DC-Chol/DOPE
Plasmid
U6
TGF-α AS-ODN
DC-Chol/DOPE
Plasmid
U6
EGFR AS-ODN Endostatin
DC-Chol/DOPE
Plasmid
CMV
DMRIE/DOPE
Plasmid
RS
Ref.
i.t.
[41]
i.v.
[55]
-
B88 (Oral tongue cancer) i.t.
[43]
-
1483
i.t.
[50]
Docetaxel
1483
i.t.
[51,52]
E1A
-
Clinical trial for SCCHN
i.t.
[53]
HLA-B7
-
Clinical trial for SCCHN
i.t.
[59,60]
i.t.
[57]
DOTMA/Chol
Plasmid
CMV
IL-2
Surgery
SCC VII
DOTMA/Chol
Plasmid
CMV
IL-2
Cisplatin
SCC VII
i.t.
[144]
DOTMA/Chol
Plasmid
CMV
IL-2 and IL-12
-
SCC VII
i.t.
[56]
DOTMA/Chol
Plasmid
CMV
IL-2 and IL-12
Radiation
SCC VII
i.t.
[58]
DOTAP/Chol
Plasmid
SV40
LacZ
-
[54]
Plasmid
CMV
HSV-tk
-
HMG (Oral malignant melanoma) HSC-3 and H357 (oral SCC)
-
Metafectene and Genejammer
-
[61]
Oligofectamine
AS-ODN
-
telomerase
Tca 8113 (Tongue carcinoma)
-
[62]
-
CD-TK
CNE-2 (NPC)
-
[152]
Calcium Phosphate Plasmid
Retinoic acid
CMV; cytomegalovirus, RS; respiratory syncytial virus, CAG; chicken β-actin promoter with CMV enhancer, SV40; simian virus 40, Squamous cell carcinoma; SCC, Squamous cell carcinoma of head and neck; SCCHN.
Nanoparticles The definition of nanoparticle is a formula containing no inner phase, in contrast to liposomes. Cholesterol derivatives are usually unable to form stable bilayers unless used in combination with DOPE or some other neutral lipids. Therefore, these particles composed of cholesterol derivatives and surfactants are nanoparticles without bilayers. Cationic cholesterol derivatives have been used because of their high transfection activity and low toxicity. A series of second-generation cholesterol-based cationic lipids have been developed and studied. Among them, cholesteryl-3β-carboxyamidoethylene-N-hydroxyethylamine (OHChol), having a hydroxyethyl group at the amino terminal (Figure 1) is a cationic lipid showing the most efficient transfection efficiency [64,65]. Nanoparticles consisting of cationic cholesterol derivatives, DC-Chol or OH-Chol as a cationic lipid and Tween 80 can be prepared by a modified ethanol injection method, and are about 100-200 nm in size and show no significant change in size for at least 1 year [66,67]. DNA/nanoparticle complexes
Tumor-Targeting Non-Viral Gene Therapy for the Treatment of Oral Cancer
103
(nanoplex) were formed after mixing the particle and DNA solutions. In other cases, to form multicomponent vectors, DNA was compacted with polymers or detergent to form DNA/polymer or DNA/detergent complexes.
5. NON-VIRAL VECTORS FOR ORAL TUMOR TARGETING The challenge for tumor-specific targeting using particulate gene delivery systems is to decrease this nonspecific gene transfer in the normal tissues while simultaneously maintaining or increasing the level of gene transfer to the tumor tissues. Selective targeting of ligand-linked non-viral vectors to cell surface receptors expressed on tumor cells is a recognized strategy for improving the therapeutic effectiveness of gene therapeutics. For nonviral gene delivery into oral tumor, folic acid and transferrin have been used as a tumortargeting ligand.
5.1. Folic Acid Coenzyme derivatives of folic acid (reduced folate) are necessary for the synthesis of purine and pyrimidine precursors of nucleic acids, for the metabolism of several amino acids, and for the initiation of protein synthesis in mitochondria. Acquisition of folic acid, therefore, is critically important to the viability of proliferating cells. Humans and other mammals cannot synthesize folic acid, and thus must obtain the vitamin from exogenous sources via absorption in the intestine [68]. Reduced folate is a structurally related compound that has the biochemical activity of folic acid. Unless otherwise indicated, the use of the term “reduced folate” throughout this review refers to the principal plasma folate, 5-methyltetrahydrofolate, whereas the use of “folic acid” or “folate” strictly refers to the vitamin in its oxidized form or folic acid derivatives, respectively. Two functionally different systems exist for cellular uptake of folates: (1) membranebound folate receptor, which is linked to the cell surface via a glycosylphosphatidylinositol (GPI) anchor and internalizes folates by receptor-mediated endocytosis [69] and (2) reducedfolate carrier (RFC), which uses a bidirectional anion exchange mechanism to transport folate into the cytoplasm [70]. The RFC is a low-affinity, high capacity system that mediates the uptake of reduced folate into cells, predominantly at pharmacologic (micromolar) extracellular folate concentrations [71]. The RFC transports monoglutamyl reduced folate across tissue membranes. Cellular folate transport can also be mediated by 38- to 44-kDa membrane associated folate-binding proteins (FBPs) or FRs (these terms are used synonymously throughout), which bind physiologic folate with high affinity in the nanomolar range [71]. Three isoforms of FR have been identified and two, FR-α and -β, are attached to the cell by a GPI-anchor, while FR-γ is secreted due to the lack of an efficient signal for GPI modification [72]. FRs were found to be clustered in membrane regions called rafts [73] or caveolae [74,75] which are rich in cholesterol and glycosphingolipid. The role of FRs in the cellular transport of
104
Yoshiyuki Hattori and Yoshie Maitani
folate is not well understood [76,77], although a potocytosis (rafts [73] or caveolin-coated endocytosis [74,75]) model has been proposed. FRs have been found to be overexpressed in a wide range of tumors. While elevated expression of FR has frequently been observed in various types of human tumors, the receptor is generally absent in normal tissues with the exception of the proximal tubules of the kidney, the choroid plexus, intestinal brush-border membranes, type 1 and type 2 pneumocytes of the lung, and placental tissue [71,78-84]. FR-α is frequently overexpressed in tumors, including ovarian, colorectal, breast, lung, renal cell carcinomas and brain metastases derived from epithelial cancers [72,85]. FR-β is frequently overexpressed in tumors of nonepithelial cell lineages such as sarcomas and acute myeloid leukemia [86], and FR-γ is overexpressed in malignant hemopoietic cells [87]. The causes of FR overexpression in tumors are unclear, but high levels of FR are associated with increased biological aggressiveness of carcinomas. The major route of reduced folate entry into nonmalignant cells is RFC, which will not transport folate conjugates of any type. Thus, folate-linked pharmaceuticals only enter cells via the FR, which is overexpressed on cancer cells [88]. This inability of folate conjugates to penetrate the RFC contributes to the low toxicity of folate-linked agents toward normal cells. Therefore, FR presents an attractive target for tumor-selective delivery. FR-targeting materials can continuously accumulate in cells due to receptor recycling. FR-targeting imaging agents arrived on the market in 2004.
Figure 2. Schematic diagrams of FR- or TfR-targeting liposome and nanoparticle. A) FR-targeting liposomes, B) FR-targeting nanoparticles, C) Tf-liposomes, D) TfR-targeting immunoliposomes.
Tumor-Targeting Non-Viral Gene Therapy for the Treatment of Oral Cancer
105
5.2. Folate-Linked Particle Vectors Folic acid offers many potential advantages as a targeting ligand: (1) small size of the targeting ligand, which often leads to favorable phamacokinetic properties of the folate conjugates and reduced probability of immunogenicity; (2) convenient availability and low cost; (3) relatively simple and defined conjugation chemistry; (4) high affinity for FR and lack of FR expression in normal tissue; (5) the receptor and ligand complex can be induced to internalize via endocytosis and (6) high frequency of FR overexpression among human tumors. Therefore, folate-linked targeting systems show great potential for clinical and therapeutic application The liposomes used in recent studies have been coated with folate-polyethyleneglycol (PEG)-lipid to facilitate tumor-targeting by an active mechanism (via FR) (Figure 2A). PEGylated lipids can significantly reduce the nonspecific gene transfer activity in the lung, and conjugation of the targeting ligand, folate, to the PEG chain can restore the gene transfer activity toward FR-positive tumors in vivo [89]. The incorporation of a long PEG spacer between folate and the lipid is important for efficient FR-targeted gene delivery. Modifying the length of the PEG-spacer between folate and the lipid optimized the targeting activity of the liposomes, and PEG spacers ranging from molecular weight 1,000 to 3,400 could function as effective spacers [90]. This is believed to the need for folate to enter the binding pocket of FR on the cell surface. Table III. Tumor-targeted non-viral lipid-based vectors. All vectors were used in in vitro transfection Ligand
Formulae
Folic acid (Folate-PEG-Lipid or Folate-Lipid)
Chol/DODAP/PEG-CerC16
Liposome entrapping DNA
Lipoplex
Lipoplex
Transferrin receptor antibody Liposome
Lipoplex
EFGR
KB
in vivo
Ref.
-
[101]
EggPC/Chol
AS-ODN
-
EFGR
KB
-
DODAP/DSPE/Chol/PEG-DSPE DC-Chol/eggPC/PEG-DSPE
AS-ODN
-
Bcl-2
KB
-
[98]
EggPC/Chol
AS-ODN
-
ICAM-1, H-Ras
KB
i.v.
[90]
EFGR
KB
-
[99]
-
DOTAP/Chol
Plasmid
SV40
Luciferase
KB
-
[93]
DOTAP/DOPE
Plasmid
CMV
p53
JSQ-3
i.v.
[91]
DOTAP/DOPE
Plasmid
CMV
p53
JSQ-3
i.v.
[92]
CHEMS/DOPE DOPS/DOPE LPDII type CHEMS/DOPC
Plasmid
RSV
Luciferase
KB
-
[95]
Plasmid
CMV
Luciferase
KB
-
[100]
Plasmid
CMV
Luciferase
KB
-
[103, 104]
Cationic liposome
C14Corn C14Corn
Plasmid
CMV
HSV-tk
KB
i.t.
[66,67,105]
OH-Chol/Tween80
Plasmid
CMV
Luciferase
KB
-
[106]
DOTAP/Chol
Plasmid
CMV
HSV-tk
HSC-3, SCC-7 i.t.
DOTAP/DOPE
Plasmid
CMV
p53
JSQ-3
-
[115]
DOTAP/DOPE
Plasmid
RSV
p53
JSQ-3
i.t.
[116]
DOTAP/DOPE DDAB/DOPE
Plasmid
CMV
p53
JSQ-3
i.v.
[118]
DC-Chol/Tween80 Lipidnanoparticle
Transferrin Liposome
-
Tumor
AS-ODN
Tetradecylornithinylcystein (C14Corn) Nanoplex
Gene
[96]
Diolein/CHEMS
Nanoparticle
AS-ODN
Promoter
Chol/DODAP/DSPC/PEG-CerC16
Liposome Lipopolyplex
DNA
Cationic liposome
Cationic liposome
i.v.: intravenous injection, i.p.: intraperitoneal injection; i,.t.:intratumoral injection.
[114]
106
Yoshiyuki Hattori and Yoshie Maitani
FR-targeting cationic liposomes were coated with folate-derivatives, such as folateDOPE [91], folate-PEG-DOPE [92], folate-PEG-phosphatidylethanolamine (PE) [93], folatePEG-DOPE [94,95], folate-PEG-distearoyl phosphatidylethanolamine (DSPE) [90,96-99], folate-PEG-Chol [100] (Table III). A folate-cationic liposome system could mediate gene therapy with p53 antisense DNA in head and neck tumor cells (JSQ-3 cells) [92]. For liposome-encapsulated DNA, FR-targeting liposomes coated with a folate-derivative, folatePEG-DSPE, showed efficient gene transfer into KB cells [90,96,98,99,101] (Table III). LPDII-type lipoplexes (lipopolyplexes) consist of a ternary complex of anionic liposomes, DNA-condensing polycation, and plasmid DNA (Table III). To prepare a formulation of LPDII-type vector, DNA was first attached to poly-L-lysine (PLL) and then mixed with pH-sensitive anionic liposomes composed of DOPE/CHEMS/folate-PEG3350DOPE [95,100]. PH-sensitive liposomes are fusogenic at acidic pH and thus can be used to facilitate the endosomal disruption and subsequent release of plasmids in the cytoplasm. An LPDII vector that incorporated polyethylenimine (PEI) as a DNA-condensing agent and a cationic/anionic lipid pair, composed of dimethyldioctadecylammonium bromide (DDAB)/CHEMS/polyoxyethylene sorbitan monoolate (Tween80)/folate-PEG3350-DSPE showed efficient gene delivery into KB cells [102]. An FR-targeting cationic nanoparticle incorporating folate-PEG3400-dipalmitoyl phosphatidylethanolamine (DPPE) and a cationic dithiol-detergent (dimerized tetradecylornithinyl-cysteine, (C14Corn)2) showed efficient FR-dependent cellular uptake and transfection [103]. C14Corn was capable of monomolecular DNA condensation, and modification of the surface of monomolecular DNA with distamycin-PEG3400-folate conjugate with 2 equivalents of bisbenzimidazole fragment increased cellular uptake in KB cells [104]. FR-targeted cholesterol-based nanoparticles consisting of Tween 80 and DC-Chol (NPIF) or OH-Chol (NPII-F) with 1-2 mol% folate-PEG2000-DSPE were produced (Figure 2B) [66,67,105,106]. The use of NPI-F increased transfection efficiency 44-fold in KB cells compared with NPI without folate-PEG-lipid [67]. In contrast, NPII without PEG-lipid exhibited the highest level of transfection activity into the cells. PEG-lipid in NPII reduced the transfection activity 30-fold, but folate-PEG of NPII-F increased the activity 6.6-fold compared to PEG-coated NPII [106].
5.3. Transferrin Iron is required for the activity of ribonucleotide reductase, a key enzyme involved in DNA synthesis. Transferrins comprise a family of large non-hem iron-binding glycoproteins. The three major types of transferrins have been characterized. Serum transferring (Tf) occurs in blood and other mammalian fluids including bile, aminitotic fluid, cerebrospinal fluid, lymph, colostrom, and milk. Ovotransferrin (oTf) is found in avian and reptilian oviduct secretions and in avian egg white [107,108], and lactoferrin (Lf) is found in milk, tear, saliva, and other secretion [109,110]. Tf is mainly synthesized by hepatocytes, with a concentration of 2.5 mg/ml and 30% occupied with iron in blood plasma [111]. The principal biological function of transferrins is thought to be related to iron binding properties. Serum Tf has the
Tumor-Targeting Non-Viral Gene Therapy for the Treatment of Oral Cancer
107
role of carrying iron from the sites of intake into the systemic circulation to the cells and tissues. The transferrin receptor (TfR) is a key cell surface molecule that regulates uptake of ironbound transferrin by receptor-mediated endocytosis. For more than 20 years, there has been a known correlation between the number of cell surface TfR and the rate of cell proliferation. TfR expression is higher in oral cancer cells than in normal cells [112,113]. TfR expression correlates with cellular proliferation and is found higher in rapidly dividing cells. The density of TfR has also been correlated with the rate of DNA synthesis and metastatic potential of tumor cells. Therefore, TfR are considered to be useful as a prognostic tumor maker and as a potential target for gene delivery in therapy of oral cancer.
5.4. Transferrin-Liposome Vectors Tf has demonstrated that its ability to direct cationic liposome to the receptor-bearing cells. Cationic liposomes composed of positively charged lipid bilayers can be complexed to negatively charged DNA and Tf by simple mixing (Figure 2C) [114-116]. Tf-lipoplex was negatively charged ternary complexes of cationic liposome, plasmid DNA and Tf. The in vitro transfection efficiency of cationic liposomes can be dramatically increased when complexed with Tf, employing ligand-receptor mediated endocytosis mechanism. Tfliposome showed 60-70% and 20-30% of in vitro and in vivo transfection efficiency, respectively, for JSQ-3 cells. The optimal Tf-lipoplex particle size on gene transfection efficiency was found to be 50-90 nm [117]. The particle has a highly compacted structure, and resembles a virus particle both in archtitecture and its uniformly small size. This viruslike compact nanostructure is likely to be the key to their high gene transfection efficiency and efficacy both in vitro and in vivo. A model of self-assembly process of this nanoparticles was proposed [117]. Modification of liposome with TfR antibody also enables active targeting to the receptor bearing tumor cells. Immunoliposome for TfR has been developed as a gene delivery vehicle (Figure 2D). Xu et al. reported a cationic immunolipoplex system directed by a single chain antibody variable region fragment (scFv) against the TfR enhanced the transfection efficiency for JSQ-3 cells both in vitro and in vivo [118].
6. DNA GENE THERAPY Cancer gene therapy has become an increasingly important strategy for treating a variety of human diseases [119]. These strategies of gene therapy for oral cancer in clinical trials include inactivation of oncogene expression, gene replacement for tumor suppressor genes, and cytokine transfer.
108
Yoshiyuki Hattori and Yoshie Maitani
6.1. Tumor Suppressor Gene Several genetic alterations have been described in oral cancer, including p53, the retinoblastoma gene (Rb1), p16, and p21. The most extensively studied mutations in oral cancer are those of p53. Dysfunction of p53 is associated with the progression of tumorigenesis [120]. The presence of mutant p53 has also been shown to be associated with an unfavorable prognosis for many human cancers, including lung, colon and breast cancers. Effective restoration of p53 function in tumor cells is expected to re-establish normal cell growth control and restore appropriate responses to DNA damage. When folate-linked cationic liposomes were used as a vector for human SCC of the head and neck, the folate ligand increased the transfection efficiency and transient p53 gene expression both in vitro and in vivo [91,92,121]. The systemic delivery of p53 into tumors resulted in efficient expression of functional p53, sensitizing the tumors to chemotherapy and radiotherapy [92]. Tf-lipoplex has also demonstrated high efficiently in tumor-target gene delivery and long-term therapeutic accuracy in systemic p53 gene therapy for head and neck cancer [115,116]. Tf significantly increased the transfection efficiency for JSQ-3 cells when compared with the liposome alone even in the presence of high levels of serum. Moreover, when combined with radiation, the Tf-lipoplex-p53-treated group exhibited significant tumor regression in head and neck cancer animal model [116]. p27 kip1 is cyclin-dependent kinase inhibitor that regulates progression of cells from G1 into S phase in a cell cycle [122,123], and p27 kip1 protein has attracted as an important prognostic factor in various malihnancies. Loss of p27 kip1 has been associated with disease progression in several malignancies [124]. Transfection with p27 kip1 gene into malignant human oral cancer cells leads to inhibition of proliferation, invasion and metastasis, suggesting that p27 kip1 acts as a tumor suppresser gene [125]. Reduced expression of p27 kip1 in cancer cells occures due to an increase in the rate by ubiqutin-mediated degradation [126]. Therefore, mutant-type p27 kip1 gene, which was not influenced by ubiqutin-mediated degradation, was constructed for gene therapy [127]. When the transfection of mutant-type p27 kip1 gene was directly injected into human oral tongue cancer B88 xenografts by electroporation, mutant-type p27 kip1 exhibited suppression of tumor growth [43]. Deregulation of connexin (Cx) expression is believed to play a part in carcinogenesis [128]. Cx proteins have an essential role in gap junction intercellular communication (GJIC), which is often impaired among tumor cells and between tumor cells and surrounding normal cells. Connexin 43 (Cx43) is a tumor-suppressor [129], and its expression is reduced in various tumors including oral tumors [130]. Forced expression of the Cx43 gene in several Cx43-deficient tumor cell lines attenuated their malignant [131,132]. When Cx43 plasmid DNA was transfected into KB cells by NPI-F, Cx43 exhibited suppression of tumor growth [133]. The transfection into KB cells induced up-regulated mRNA expression of p16, which is known as a tumor growth suppressor [16]. The expression of Cx43 in KB cells also increased apoptosis via down-regulation of anti-apoptotic bcl-2 mRNA expression and upregulation of apoptosis-associated enzyme caspase-3/7 activity. E1A, a gene derived from adenovirus type 5, has been shown to have potent antitumor activity through a variety of mechanisms, including down-regulation of HER-2 expression [134,135], induction of apoptosis [136], inhibition of metastasis [137,138], and reversion of
Tumor-Targeting Non-Viral Gene Therapy for the Treatment of Oral Cancer
109
tumor cells toward a differentiated epithelial phenotype [139]. The EIA gene has been successfully transfected into SCC of head and neck cells using cationic liposome comprised of DC-Chol/DOPE complexed with the E1A plasmid [53]. The E1A gene has demonstrated antitumor activity in vitro and in xenografts models. Intratumoral injection of the lipoplex with E1A plasmid has been shown to be safe and well-tolerated and produce tumor responses comparable to other biologic agents in phase II trials [53]. 6.2. Immunotherapy The immunologic gene therapy approach to oral cancer involves either increasing the immunogenic potential of tumor cells or augmenting the paitient’s immune response to a tumor. Although oral cancer is not classically immunogenic, there is abundant evidence for immune recognition. Tumor-specific T-cell mediated immunity has been recognized as a key mechanism of the antigen specific immune response against tumors [140]. Cytotoxic T lymphocyte (CTL) responses are essential for the recognition of tumor cells and can eliminate established tumors in animal models and humans [141,142]. The induction of strong antigen specific CTL response is, therefore, the major goal of many current cancer gene therapies [143]. Interleukin (IL)-2 stimulates the proliferation and activation of several types of leukocytes with anti-tumor activities, including natural killer (NK) cells, lymphokineactivated killer cells and antigen-specific T-helper cells and cytotoxic lymphocytes, as well as macrophages and B cells [32,33]. The anti-tumor activity of IL-2 has been demonstrated in clinical studies, but the mechanism which IL-2 treatment results in tumor regression in human is not fully understood. For the clinical use, local production of low levels of IL-2 should produce limited or no systemic side effects, because systemic therapy with IL-2 is associated with significant toxicity. Non-viral gene therapies with IL-2 have been studied as an alternative to the potentially toxic adenovirus or other viral vectors. A plasmid/cationic lipid system for IL-2 gene therapy has been described that DOTMA/Chol formulated with IL2 plasmid (pCMV-IL-2) reduced tumor size by intratumoral injection [57,58,144,145]. Treatment of tumors with formulated pCMV-IL2 produced IL-2 protein levels that were 5fold over background, and increased IFN-γ by 32-fold and IL-12 by 5.5-fold compared with control plasmid formulation [144]. The phase II studies have initiated and focus on either comparing the novel non-viral IL-2 gene immunotherapy formulation alone to methotrexate or comparing IL-2 gene therapy in combination with cisplatin in recurrent or unresectable patients with SCC of head and neck [144]. The use of combinated IL-2 and IL-12 gene therapy for SCC also resulted in significant anti-tumor effect, most likely due to increased activation of CTL and NK cells [58]. IL-21 also plays important roles in the regulation of T, B, and NK cells, and provides an immunotherapy strategy for cancer gene therapy by stimulating both Th1 and Th2 immune responses [146]. Significant antitumor effect was observed by repeated transfection with IL21 by hydrodynamic injection into the mice bearing subcutaneous SCC of head and neck, and co-administration of IL-21 and IL-15 genes resulted in increased suppression of tumor growth, significantly prolonging the survival periods [55]. Attempts have also been made to generate tumor specific (HLA-restricted) immune responses. Recognition of foreign tumor antigens by the immune system requires presentation
110
Yoshiyuki Hattori and Yoshie Maitani
of antigen peptide fragments in context of MHC-class I or class II molecules. CD8+ CTLs are activated by MHC-class I bearing cells, while CD4+ CTLs are stimulated primarily by tumor peptides presented by cell surface MHC-class II molecules. MHC-class I levels in oral tumor cells are often decreased or undetectable [147,148]. This may represent one mechanism by which tumor cells escape immune rejection. Avellovectin-7 consisted of a DNA plasmid (VCL-1005) containing the gene for allogeneic MHC-class I protein, human leukocyte antigen B7 (HLA-B7), and β2-microglobulin complexed with cationic lipid mixture (DMRIE/DOPE) that aids in the uptake of VCL-1005 into tumor cells [59,60]. Intratumoral injection of Avellovectin-7 to SCC of head and neck resulted in potential tumor growth suppression in 20 of the 60 patients 6 weeks after the injection and in persistent tumor regression lasting 16 weeks or longer in 11 patients [59].
7. DNA THERAPY IN CHEMOTHERAPY Suicide gene therapy is a strategy whereby a gene is introduced into cancer cells, making them sensitive to a drug that is normally non-toxic. The suicide genes used often encode enzymes that metabolize non-toxic prodrugs into toxic metabolites. Among them, two of the best characterized systems are herpes simplex virus thymidine kinase (HSV-tk)/ganciclovir (GCV) [149] and cytosine deaminase (CD)/5-fluorocytosine (5-FC) [150]. These suicide gene-prodrug systems are currently being evaluated in clinical trials. HSV-tk converts the antiviral drug, such a GCV, to the monophosphorylated forms that are then metabolized to the toxic form (GCV triphosphate) by cellular phosphokinases [149]. GCV triphosphate interacts with cellular DNA polymerase, causing interference with DNA synthesis and leading to the death of dividing cells. CD converts 5-FC into the toxic anabilite 5-FU, which is subsequently processed either to 5-fluorouridine triphosphate (FUTP) or to 5-fluoro-2’deoxyuridine-monophospate (FdUMP) [150]. Whereas FUTP is incorporated into RNA and interferes with RNA processing, FdUMP irreversibly inhibits thymidylate syntheses and thus interferes with DNA synthesis. A powerful characteristic of both suicide gene therapies is that the transduction of a small fraction of tumor cells with the suicide gene can result in widespread tumor-cell death (bystander effect). The cell-to-cell transfer of enzyme-activated prodrug between enzyme expressed tumor cells and neighboring unmodified cells via gap junctions is a major mechanism of the bystander effect [151,152]. This is attractive therapy since the transduction of a small fraction of the tumor cells with the suicide gene can result in widespread tumor-cell death. Calcium phosphate nanoparticle (CPNP) was developed as non-viral vector, and the CPNP/DNA complex could deliver DNA into nasopharyngeal CNE-2 tumor xenografts by intratumoral injection [153]. When CNE-2 cells were treated with 5-FC plus the CPNP/ CDglyTK plasmid coding for CD and HSV-tk fusion protein, the potent antitumoral activities was observed in vitro. In FR-targeting nanoparticle vector, tumor growth of xenografts was significantly inhibited when a NPI-F nanoplex of the HSV-tk gene was injected intratumorally and GCV was administered intraperitomeally [67].
Tumor-Targeting Non-Viral Gene Therapy for the Treatment of Oral Cancer
111
8. ANTISENSE DNA AND SIRNA THERAPY Posttranscriptional gene silencing approaches using various nucleic acid based molecules such as antisense oligodeoxynucleotides (AS-ODNs) have drawn much attention because of their potential therapeutic usefulness for treating various genetic disorders and infectious diseases, including cancer. AS-ODNs are short single-stranded segments of DNA that upon cellular internalization can selectively inhibit the expression of a single protein [154]. The AS-ODN forms a duplex with the mRNA or pre-mRNA and inhibits their translation or processing, consequently inhibiting protein biosynthesis. Since the targets for antisense applications are in the cytoplasm, AS-ODN does not need to enter the cell nucleus [155]. Several applications of AS-ODN have been described in treatment of oral tumor, including EGFR, bcl-2, TNF-α and HER-2 AS-ODNs (Table II and III). The epidermal growth factor receptor (EGFR) is commonly overexpressed in a variety of solid tumors, and clinical trials indicate that this antigen has important roles in cancer progression [156]. When naked EGFR AS-ODN was directly injected into SCC of head and neck 1483 xenografts, tumor volume was significantly reduced in the mice treated with a combination of EGFR ASODN and docetaxel, suggested that blocking EGFR in conjunction with cytotoxic chemotherapy, cancer cells undergo apoptosis [41]. Direct injection of the EGFR AS-RNA expressing plasmid DNA into SCC of head and neck xenografts with liposome resulted in inhibition of tumor growth, suppression of EGFR protein expression, and an increased rate of apoptosis [52]. A combination of anti-angiogenic endostatin and EGFR AS-RNA expressing plasmid DNA also led to significantly enhanced inhibition of SCC of head and neck growth in nude mice [51]. FR-targeted liposomes (SALP) entrapping EGFR AS-ODN efficiently mediated intracellular delivery of the AS-ODN to KB cells, resulting in significant down-regulation of EGFR expression and cell growth inhibition [96,99]. Bcl-2 is one of the most important mammalian regulators of apoptosis and is overexpressed in the majority of human neoplasms, including breast, prostate and lung carcinomas [157]. FR-targeted liposomes containing bcl-2 AS-ODN showed promising transfection activity in KB cells and induced down-regulation of bcl-2 expression and an increase of the sensitivity to daunorubicin [98]. The ability of gene-specific double-stranded RNA to trigger the degradation of homologous cellular RNAs is known as RNA intereferance (RNAi). RNAi is a powerful gene-silencing process that holds great promise in the field of cancer therapy [158]. RNAi can be induced in mammalian cells by the introduction of synthetic small interfering RNA (siRNA) 21–23 base pairs in length or of plasmids that express short hairpin RNAs (shRNAs) that are subsequently processed to siRNAs by the cellular machinery [159,160]. Doublestranded RNA (dsRNA) suppresses the expression of a target gene by triggering specific degradation of the complementary mRNA sequence. For therapeutic use in cancer, candidate target genes for RNAi-mediated knockdown have been identified [161]. To promote their gene inhibition effect, folate-linked cationic nanoparticles have been employed to form complexes with negatively charged synthetic siRNA. HER-2 is a member of the EGFR family that participates in tumor growth and proliferation [162]. We found that the NPIIF/HER-2 siRNA nanoplex efficiently mediated intracellular delivery of synthetic siRNA to KB cells, resulting in a significant down-regulation of HER-2 expression and cell growth
Yoshiyuki Hattori and Yoshie Maitani
112
inhibition (70% cell viability compared with that of control siRNA) (unpublished data). The development of RNAi delivery system has the potential in cancer therapy.
9. CONCLUSION In further, gene diagnosis will be prevailed, corresponding to obtained gene informations, gene therapy may open a new dimension of treatment of cancer, resulting in better tumor-targeting gene therapy. In this review, we showed that non-viral vectors could deliver DNA with high transfection efficiency and selectivity, inhibiting tumor growth following intratumoral injection into oral tumor. Tumor-targeted liposomes and lipid-based nanoparticles have potential as a clinically effective vector in cancer gene therapy. However, there is generally little correlation between in vitro and in vivo gene transfer efficacies of vector formulations, due to very different parameters. Further efforts aimed at optimizing tumor-targeting vector formulations for local administration should lead to the clinical evaluation of these vectors for cancer gene therapy delivery.
REFERENCES [1] [2]
[3]
[4]
[5]
[6]
[7]
[8]
Jemal, A., Siegel, R., Ward, E., Murray, T., Xu, J., Smigal, C., and Thun, M.J. (2006) Cancer statistics, 2006. CA Cancer J.Clin., 56, 106-130. El Sayed, S. and Nelson, N. (1996) Adjuvant and adjunctive chemotherapy in the management of squamous cell carcinoma of the head and neck region. A metaanalysis of prospective and randomized trials. J.Clin.Oncol., 14, 838-847. Papadakis, E.D., Nicklin, S.A., Baker, A.H., and White, S.J. (2004) Promoters and control elements: designing expression cassettes for gene therapy. Curr.Gene Ther., 4, 89-113. Fitzsimons, H.L., Bland, R.J., and During, M.J. (2002) Promoters and regulatory elements that improve adeno-associated virus transgene expression in the brain. Methods, 28, 227-236. Walther, W. and Stein, U. (1996) Cell type specific and inducible promoters for vectors in gene therapy as an approach for cell targeting. J.Mol.Med., 74, 379392. Chen, Z., Storthz, K.A., and Shillitoe, E.J. (1997) Mutations in the long control region of human papillomavirus DNA in oral cancer cells, and their functional consequences. Cancer Res., 57, 1614-1619. Lee, F., Mulligan, R., Berg, P., and Ringold, G. (1981) Glucocorticoids regulate expression of dihydrofolate reductase cDNA in mouse mammary tumour virus chimaeric plasmids. Nature, 294, 228-232. Steele, C., Sacks, P.G., Adler-Storthz, K., and Shillitoe, E.J. (1992) Effect on cancer cells of plasmids that express antisense RNA of human papillomavirus type 18. Cancer Res., 52, 4706-4711.
Tumor-Targeting Non-Viral Gene Therapy for the Treatment of Oral Cancer [9] [10]
[11] [12]
[13]
[14]
[15]
[16]
[17]
[18]
[19]
[20]
[21]
113
Shillitoe, E.J. and Noonan, S. (2000) Strength and specificity of different gene promoters in oral cancer cells. Oral Oncol., 36, 214-220. Nakagawa, H., Inomoto, T., and Rustgi, A.K. (1997) A CACCC box-like cisregulatory element of the Epstein-Barr virus ED-L2 promoter interacts with a novel transcriptional factor in tissue-specific squamous epithelia. J.Biol.Chem., 272, 16688-16699. Liu, F.F. (2002) Novel gene therapy approach for nasopharyngeal carcinoma. Semin.Cancer Biol., 12, 505-515. Fukuzawa, H., Kiyoshima, T., Kobayashi, I., Ozeki, S., and Sakai, H. (2006) Transcription promoter activity of the human S100A7 gene in oral squamous cell carcinoma cell lines. Biochim.Biophys.Acta, 1759, 171-176. Thompson, E.M., Nagata, S., and Tsuji, F.I. (1990) Vargula hilgendorfii luciferase: a secreted reporter enzyme for monitoring gene expression in mammalian cells. Gene, 96, 257-262. Cardinali, M., Jakus, J., Shah, S., Ensley, J.F., Robbins, K.C., and Yeudall, W.A. (1998) p21(WAF1/Cip1) retards the growth of human squamous cell carcinomas in vivo. Oral Oncol., 34, 211-218. Li, A.A., Ng, E., Shi, W., Lee, A., Chia, M., Liu, T.J., Huang, D., O'Sullivan, B., Gullane, P., and Liu, F.F. (2004) Potential efficacy of p16 gene therapy for EBVpositive nasopharyngeal carcinoma. Int.J.Cancer, 110, 452-458. Lee, A.W., Li, J.H., Shi, W., Li, A., Ng, E., Liu, T.J., Klamut, H.J., and Liu, F.F. (2003) p16 gene therapy: a potentially efficacious modality for nasopharyngeal carcinoma. Mol.Cancer Ther., 2, 961-969. Koh, T.Y., Park, S.W., Park, K.H., Lee, S.G., Seol, J.G., Lee, D.W., Lee, C.T., Heo, D.S., Kim, K.H., and Sung, M.W. (2003) Inhibitory effect of p27KIP1 gene transfer on head and neck squamous cell carcinoma cell lines. Head Neck, 25, 44-49. Lee, D.W., Park, S.W., Park, S.Y., Heo, D.S., Kim, K.H., and Sung, M.W. (2004) Effects of p53 or p27 overexpression on cyclooxygenase-2 gene expression in head and neck squamous cell carcinoma cell lines. Head Neck, 26, 706-715. Fukuhara, H., Hayashi, Y., Yamamoto, N., Fukui, T., Nishikawa, M., Mitsudo, K., Tohnai, I., Ueda, M., Mizuno, M., and Yoshida, J. (2003) Improvement of transduction efficiency of recombinant adenovirus vector conjugated with cationic liposome for human oral squamous cell carcinoma cell lines. Oral Oncol., 39, 601-609. Qi, V., Weinrib, L., Ma, N., Li, J.H., Klamut, H., and Liu, F.F. (2001) Adenoviral p53 gene therapy promotes heat-induced apoptosis in a nasopharyngeal carcinoma cell line. Int.J.Hyperthermia, 17, 38-47. Li, J.H., Lax, S.A., Kim, J., Klamut, H., and Liu, F.F. (1999) The effects of combining ionizing radiation and adenoviral p53 therapy in nasopharyngeal carcinoma. Int.J.Radiat.Oncol.Biol.Phys., 43, 607-616.
114
Yoshiyuki Hattori and Yoshie Maitani [22] Li, J.H., Li, P., Klamut, H., and Liu, F.F. (1997) Cytotoxic effects of Ad5CMVp53 expression in two human nasopharyngeal carcinoma cell lines. Clin.Cancer Res., 3, 507-514. [23] Chen, C.B., Pan, J.J., and Xu, L.Y. (2003) [Recombinant adenovirus p53 agent injection combined with radiotherapy in treatment of nasopharyngeal carcinoma: a phase II clinical trial]. Zhonghua Yi.Xue.Za Zhi., 83, 2033-2035. [24] Weinrib, L., Li, J.H., Donovan, J., Huang, D., and Liu, F.F. (2001) Cisplatin chemotherapy plus adenoviral p53 gene therapy in EBV-positive and -negative nasopharyngeal carcinoma. Cancer Gene Ther., 8, 352-360. [25] Nishikawa, M., Hayashi, Y., Yamamoto, N., Fukui, T., Fukuhara, H., Mitsudo, K., Tohnai, I., Ueda, M., Mizuno, M., and Yoshida, J. (2003) Cell death of human oral squamous cell carcinoma cell line induced by herpes simplex virus thymidine kinase gene and ganciclovir. Nagoya J.Med.Sci., 66, 129-137. [26] Sewell, D.A., Li, D., Duan, L., Westra, W.H., and O'Malley, B.W., Jr. (1997) Safety of in vivo adenovirus-mediated thymidine kinase treatment of oral cancer. Arch.Otolaryngol.Head Neck Surg., 123, 1298-1302. [27] Sewell, D.A., Li, D., Duan, L., Schwartz, M.R., and O'Malley, B.W., Jr. (1997) Optimizing suicide gene therapy for head and neck cancer. Laryngoscope, 107, 1490-1495. [28] Goebel, E.A., Davidson, B.L., Zabner, J., Graham, S.M., and Kern, J.A. (1996) Adenovirus-mediated gene therapy for head and neck squamous cell carcinomas. Ann.Otol.Rhinol.Laryngol., 105, 562-567. [29] Boleas Aguirre, M.S., Fernandez, G.S., Gallego Madrid, M.A., and GarciaTapia, U.R. (2002) Antitumoral effect of HSV-tk suicide gene associated with ganciclovir in an experimental model of head and neck epidermoid carcinoma. Acta Otorrinolaringol.Esp., 53, 448-454. [30] Huang, H. and Wang, A. (2001) The adenovirus-mediated HSV-TK/GCV suicide gene system in the treatment of tongue carcinoma cell line. Zhonghua Kou Qiang.Yi.Xue.Za Zhi., 36, 457-460. [31] Dehari, H., Ito, Y., Nakamura, T., Kobune, M., Sasaki, K., Yonekura, N., Kohama, G., and Hamada, H. (2003) Enhanced antitumor effect of RGD fibermodified adenovirus for gene therapy of oral cancer. Cancer Gene Ther., 10, 7585. [32] O'Malley, B.W., Jr., Li, D., Buckner, A., Duan, L., Woo, S.L., and Pardoll, D.M. (1999) Limitations of adenovirus-mediated interleukin-2 gene therapy for oral cancer. Laryngoscope, 109, 389-395. [33] O'Malley, B.W., Cope, K.A., Chen, S.H., Li, D., Schwarta, M.R., and Woo, S.L. (1996) Combination gene therapy for oral cancer in a murine model. Cancer Res., 56, 1737-1741. [34] Ding, X.Q., Chen, Y., Li, L., Liu, R.Y., Huang, J.L., Lai, K., Wu, X.J., Ke, M.L., and Huang, W.L. (2003) Inhibition of tongue cancer development in nude mice transfected with adenovirus carrying human endostatin gene. Ai.Zheng., 22, 1152-1157.
Tumor-Targeting Non-Viral Gene Therapy for the Treatment of Oral Cancer
115
[35] Li, L., Liu, R.Y., Huang, J.L., Liu, Q.C., Li, Y., Wu, P.H., Zeng, Y.X., and Huang, W. (2006) Adenovirus-mediated intra-tumoral delivery of the human endostatin gene inhibits tumor growth in nasopharyngeal carcinoma. Int.J.Cancer, 118, 2064-2071. [36] Zhang, X., Liu, S., Liang, C., and Yang, H. (2001) Adenovirus-mediated Rb gene transfect for head and neck cancer. Hua Xi.Yi.Ke.Da.Xue.Xue.Bao., 32, 194-5, 207. [37] Chen, S., Fribley, A., and Wang, C.Y. (2002) Potentiation of tumor necrosis factor-mediated apoptosis of oral squamous cell carcinoma cells by adenovirusmediated gene transfer of NF-kappaB inhibitor. J.Dent.Res., 81, 98-102. [38] Gibson, S.A., Pellenz, C., Hutchison, R.E., Davey, F.R., and Shillitoe, E.J. (2000) Induction of apoptosis in oral cancer cells by an anti-bcl-2 ribozyme delivered by an adenovirus vector. Clin.Cancer Res., 6, 213-222. [39] Fukui, T., Hayashi, Y., Kagami, H., Yamamoto, N., Fukuhara, H., Tohnai, I., Ueda, M., Mizuno, M., and Yoshida, J. (2001) Suicide gene therapy for human oral squamous cell carcinoma cell lines with adeno-associated virus vector. Oral Oncol., 37, 211-215. [40] Pang, S., Kang, M.K., Kung, S., Yu, D., Lee, A., Poon, B., Chen, I.S., Lindemann, B., and Park, N.H. (2001) Anticancer effect of a lentiviral vector capable of expressing HIV-1 Vpr. Clin.Cancer Res., 7, 3567-3573. [41] Niwa, H., Wentzel, A.L., Li, M., Gooding, W.E., Lui, V.W., and Grandis, J.R. (2003) Antitumor effects of epidermal growth factor receptor antisense oligonucleotides in combination with docetaxel in squamous cell carcinoma of the head and neck. Clin.Cancer Res., 9, 5028-5035. [42] Wells, D.J. (2004) Gene therapy progress and prospects: electroporation and other physical methods. Gene Ther., 11, 1363-1369. [43] Harada, K., Supriatno, Kawaguchi, S., Onoue, T., Kawashima, Y., Yoshida, H., and Sato, M. (2005) High antitumor activity using intratumoral injection of plasmid DNA with mutant-type p27Kip1 gene following in vivo electroporation. Oncol.Rep., 13, 201-206. [44] Hodges, B.L. and Scheule, R.K. (2003) Hydrodynamic delivery of DNA. Expert.Opin.Biol.Ther., 3, 911-918. [45] Merdan, T., Kopecek, J., and Kissel, T. (2002) Prospects for cationic polymers in gene and oligonucleotide therapy against cancer. Adv.Drug Deliv.Rev., 54, 715758. [46] Semple, S.C., Klimuk, S.K., Harasym, T.O., and Hope, M.J. (2000) Lipid-based formulations of antisense oligonucleotides for systemic delivery applications. Methods Enzymol., 313, 322-341. [47] Pedroso de Lima, M.C., Simoes, S., Pires, P., Faneca, H., and Duzgunes, N. (2001) Cationic lipid-DNA complexes in gene delivery: from biophysics to biological applications. Adv.Drug Deliv.Rev., 47, 277-294. [48] Hwang, S.J. and Davis, M.E. (2001) Cationic polymers for gene delivery: designs for overcoming barriers to systemic administration. Curr.Opin.Mol.Ther., 3, 183-191.
116
Yoshiyuki Hattori and Yoshie Maitani [49] Luo, D. and Saltzman, W.M. (2000) Synthetic DNA delivery systems. Nat.Biotechnol., 18, 33-37. [50] Endo, S., Zeng, Q., Burke, N.A., He, Y., Melhem, M.F., Watkins, S.F., Lango, M.N., Drenning, S.D., Huang, L., and Rubin, G.J. (2000) TGF-alpha antisense gene therapy inhibits head and neck squamous cell carcinoma growth in vivo. Gene Ther., 7, 1906-1914. [51] Li, M., Ye, C., Feng, C., Riedel, F., Liu, X., Zeng, Q., and Grandis, J.R. (2002) Enhanced antiangiogenic therapy of squamous cell carcinoma by combined endostatin and epidermal growth factor receptor-antisense therapy. Clin.Cancer Res., 8, 3570-3578. [52] He, Y., Zeng, Q., Drenning, S.D., Melhem, M.F., Tweardy, D.J., Huang, L., and Grandis, J.R. (1998) Inhibition of human squamous cell carcinoma growth in vivo by epidermal growth factor receptor antisense RNA transcribed from the U6 promoter. J.Natl.Cancer Inst., 90, 1080-1087. [53] Villaret, D., Glisson, B., Kenady, D., Hanna, E., Carey, M., Gleich, L., Yoo, G.H., Futran, N., Hung, M.C., Anklesaria, P., and Heald, A.E. (2002) A multicenter phase II study of tgDCC-E1A for the intratumoral treatment of patients with recurrent head and neck squamous cell carcinoma. Head Neck, 24, 661-669. [54] Nakase, M., Okumura, K., Kamei, T., Nakamura, S., Inui, M., and Tagawa, T. (2005) The influence of oral tumor cell proliferation activity and membrane potential on the transfection efficiency of a cationic liposome. Oncol.Rep., 14, 1487-1491. [55] Nakano, H., Kishida, T., Asada, H., Shin-Ya, M., Shinomiya, T., Imanishi, J., Shimada, T., Nakai, S., Takeuchi, M., Hisa, Y., and Mazda, O. (2006) Interleukin-21 triggers both cellular and humoral immune responses leading to therapeutic antitumor effects against head and neck squamous cell carcinoma. J.Gene Med., 8, 90-99. [56] Li, D., Shugert, E., Guo, M., Bishop, J.S., and O'Malley, B.W., Jr. (2001) Combination nonviral interleukin 2 and interleukin 12 gene therapy for head and neck squamous cell carcinoma. Arch.Otolaryngol.Head Neck Surg., 127, 13191324. [57] Li, D., Jiang, W., Bishop, J.S., Ralston, R., and O'Malley, B.W., Jr. (1999) Combination surgery and nonviral interleukin 2 gene therapy for head and neck cancer. Clin.Cancer Res., 5, 1551-1556. [58] Xian, J., Yang, H., Lin, Y., and Liu, S. (2005) Combination nonviral murine interleukin 2 and interleukin 12 gene therapy and radiotherapy for head and neck squamous cell carcinoma. Arch.Otolaryngol.Head Neck Surg., 131, 1079-1085. [59] Gleich, L.L., Gluckman, J.L., Nemunaitis, J., Suen, J.Y., Hanna, E., Wolf, G.T., Coltrera, M.D., Villaret, D.B., Wagman, L., Castro, D., Gapany, M., Carroll, W., Gillespie, D., and Selk, L.M. (2001) Clinical experience with HLA-B7 plasmid DNA/lipid complex in advanced squamous cell carcinoma of the head and neck. Arch.Otolaryngol.Head Neck Surg., 127, 775-779.
Tumor-Targeting Non-Viral Gene Therapy for the Treatment of Oral Cancer
117
[60] Gleich, L.L., Gluckman, J.L., Armstrong, S., Biddinger, P.W., Miller, M.A., Balakrishnan, K., Wilson, K.M., Saavedra, H.I., and Stambrook, P.J. (1998) Alloantigen gene therapy for squamous cell carcinoma of the head and neck: results of a phase-1 trial. Arch.Otolaryngol.Head Neck Surg., 124, 1097-1104. [61] Konopka, K., Fallah, B., Monzon-Duller, J., Overlid, N., and Duzgunes, N. (2005) Serum-resistant gene transfer to oral cancer cells by Metafectene and GeneJammer: application to HSV-tk/ganciclovir-mediated cytotoxicity. Cell Mol.Biol.Lett., 10, 455-470. [62] Zhang, P., Xu, Q., Chen, W.T., Duan, L.Q., Zhang, Z.Y., and Zhou, X.J. (2005) Synergistic down-regulation of telomerase by all-trans retinoic acid and antisense oligonucleotide in oral squamous cell carcinoma cell line (Tca8113). Oral Oncol., 41, 909-915. [63] Semple, S.C., Klimuk, S.K., Harasym, T.O., Dos, S.N., Ansell, S.M., Wong, K.F., Maurer, N., Stark, H., Cullis, P.R., Hope, M.J., and Scherrer, P. (2001) Efficient encapsulation of antisense oligonucleotides in lipid vesicles using ionizable aminolipids: formation of novel small multilamellar vesicle structures. Biochim.Biophys.Acta, 1510, 152-166. [64] Okayama, R., Noji, M., and Nakanishi, M. (1997) Cationic cholesterol with a hydroxyethylamino head group promotes significantly liposome-mediated gene transfection. FEBS Lett., 408, 232-234. [65] Hasegawa, S., Hirashima, N., and Nakanishi, M. (2002) Comparative study of transfection efficiency of cationic cholesterols mediated by liposomes-based gene delivery. Bioorg.Med.Chem.Lett., 12, 1299-1302. [66] Hattori, Y. and Maitani, Y. (2004) Enhanced in vitro DNA transfection efficiency by novel folate-linked nanoparticles in human prostate cancer and oral cancer. J.Control Release, 97, 173-183. [67] Hattori, Y. and Maitani, Y. (2005) Folate-linked nanoparticle-mediated suicide gene therapy in human prostate cancer and nasopharyngeal cancer with herpes simplex virus thymidine kinase. Cancer Gene Ther.. 12, 796-809. [68] Subramanian, V.S., Chatterjee, N., and Said, H.M. (2003) Folate uptake in the human intestine: promoter activity and effect of folate deficiency. J.Cell Physiol, 196, 403-408. [69] Rijnboutt, S., Jansen, G., Posthuma, G., Hynes, J.B., Schornagel, J.H., and Strous, G.J. (1996) Endocytosis of GPI-linked membrane folate receptor-alpha. J.Cell Biol., 132, 35-47. [70] Kaufman, Y., Drori, S., Cole, P.D., Kamen, B.A., Sirota, J., Ifergan, I., Arush, M.W., Elhasid, R., Sahar, D., Kaspers, G.J., Jansen, G., Matherly, L.H., Rechavi, G., Toren, A., and Assaraf, Y.G. (2004) Reduced folate carrier mutations are not the mechanism underlying methotrexate resistance in childhood acute lymphoblastic leukemia. Cancer, 100, 773-782. [71] Kelemen, L.E. (2006) The role of folate receptor alpha in cancer development, progression and treatment: cause, consequence or innocent bystander? Int.J.Cancer, 119, 243-250. [72] Antony, A.C. (1996) Folate receptors. Annu.Rev.Nutr., 16, 501-521.
118
Yoshiyuki Hattori and Yoshie Maitani [73] Wang, J., Gunning, W., Kelley, K.M., and Ratnam, M. (2002) Evidence for segregation of heterologous GPI-anchored proteins into separate lipid rafts within the plasma membrane. J.Membr.Biol., 189, 35-43. [74] Ritter, T.E., Fajardo, O., Matsue, H., Anderson, R.G., and Lacey, S.W. (1995) Folate receptors targeted to clathrin-coated pits cannot regulate vitamin uptake. Proc.Natl.Acad.Sci.U.S.A, 92, 3824-3828. [75] Rothberg, K.G., Ying, Y.S., Kamen, B.A., and Anderson, R.G. (1990) Cholesterol controls the clustering of the glycophospholipid-anchored membrane receptor for 5-methyltetrahydrofolate. J.Cell Biol., 111, 2931-2938. [76] Wu, M., Fan, J., Gunning, W., and Ratnam, M. (1997) Clustering of GPIanchored folate receptor independent of both cross-linking and association with caveolin. J.Membr.Biol., 159, 137-147. [77] Sabharanjak, S. and Mayor, S. (2004) Folate receptor endocytosis and trafficking. Adv.Drug Deliv.Rev., 56, 1099-1109. [78] Holm, J., Hansen, S.I., Hoier-Madsen, M., and Bostad, L. (1991) High-affinity folate binding in human choroid plexus. Characterization of radioligand binding, immunoreactivity, molecular heterogeneity and hydrophobic domain of the binding protein. Biochem.J., 280 ( Pt 1), 267-271. [79] Zimmerman, J. (1990) Folic acid transport in organ-cultured mucosa of human intestine. Evidence for distinct carriers. Gastroenterology, 99, 964-972. [80] Birn, H., Selhub, J., and Christensen, E.I. (1993) Internalization and intracellular transport of folate-binding protein in rat kidney proximal tubule. Am.J.Physiol, 264, C302-C310. [81] Birn, H., Nielsen, S., and Christensen, E.I. (1997) Internalization and apical-tobasolateral transport of folate in rat kidney proximal tubule. Am.J.Physiol, 272, F70-F78. [82] Antony, A.C., Utley, C., Van Horne, K.C., and Kolhouse, J.F. (1981) Isolation and characterization of a folate receptor from human placenta. J.Biol.Chem., 256, 9684-9692. [83] Ross, J.F., Chaudhuri, P.K., and Ratnam, M. (1994) Differential regulation of folate receptor isoforms in normal and malignant tissues in vivo and in established cell lines. Physiologic and clinical implications. Cancer, 73, 24322443. [84] Parker, N., Turk, M.J., Westrick, E., Lewis, J.D., Low, P.S., and Leamon, C.P. (2005) Folate receptor expression in carcinomas and normal tissues determined by a quantitative radioligand binding assay. Anal.Biochem., 338, 284-293. [85] Wu, M., Gunning, W., and Ratnam, M. (1999) Expression of folate receptor type alpha in relation to cell type, malignancy, and differentiation in ovary, uterus, and cervix. Cancer Epidemiol.Biomarkers Prev., 8, 775-782. [86] Shen, F., Ross, J.F., Wang, X., and Ratnam, M. (1994) Identification of a novel folate receptor, a truncated receptor, and receptor type beta in hematopoietic cells: cDNA cloning, expression, immunoreactivity, and tissue specificity. Biochemistry, 33, 1209-1215.
Tumor-Targeting Non-Viral Gene Therapy for the Treatment of Oral Cancer
119
[87] Shen, F., Wu, M., Ross, J.F., Miller, D., and Ratnam, M. (1995) Folate receptor type gamma is primarily a secretory protein due to lack of an efficient signal for glycosylphosphatidylinositol modification: protein characterization and cell type specificity. Biochemistry, 34, 5660-5665. [88] Lacey, S.W., Sanders, J.M., Rothberg, K.G., Anderson, R.G., and Kamen, B.A. (1989) Complementary DNA for the folate binding protein correctly predicts anchoring to the membrane by glycosyl-phosphatidylinositol. J.Clin.Invest, 84, 715-720. [89] Hofland, H.E., Masson, C., Iginla, S., Osetinsky, I., Reddy, J.A., Leamon, C.P., Scherman, D., Bessodes, M., and Wils, P. (2002) Folate-targeted gene transfer in vivo. Mol.Ther., 5, 739-744. [90] Leamon, C.P., Cooper, S.R., and Hardee, G.E. (2003) Folate-liposome-mediated antisense oligodeoxynucleotide targeting to cancer cells: evaluation in vitro and in vivo. Bioconjug.Chem., 14, 738-747. [91] Xu, L., Pirollo, K.F., Rait, A., Murray, A.L. and Chang, E.H. (1999) Systemic p53 gene therapy in combination with radiation results in human tumor regression. 4, 92-104. [92] Xu, L., Pirollo, K.F., and Chang,E.H. (2001) Tumor-targeted p53-gene therapy enhances the efficacy of conventional chemo/radiotherapy. J.Control Release, 74, 115-128. [93] Turk, M.J., Reddy, J.A., Chmielewski, J.A., and Low, P.S. (2002) Characterization of a novel pH-sensitive peptide that enhances drug release from folate-targeted liposomes at endosomal pHs. Biochim.Biophys.Acta, 1559, 56-68. [94] Reddy, J.A., Dean, D., Kennedy, M.D., and Low, P.S. (1999) Optimization of folate-conjugated liposomal vectors for folate receptor-mediated gene therapy. J.Pharm.Sci., 88, 1112-1118. [95] Lee, R.J. and Huang, L. (1996) Folate-targeted, anionic liposome-entrapped polylysine-condensed DNA for tumor cell-specific gene transfer. J.Biol.Chem., 271, 8481-8487. [96] Wang, S., Lee, R.J., Cauchon, G., Gorenstein, D.G., and Low, P.S. (1995) Delivery of antisense oligodeoxyribonucleotides against the human epidermal growth factor receptor into cultured KB cells with liposomes conjugated to folate via polyethylene glycol. Proc.Natl.Acad.Sci.U.S.A, 92, 3318-3322. [97] Reddy, J.A., Abburi, C., Hofland, H., Howard, S.J., Vlahov, I., Wils, P., and Leamon, C.P. (2002) Folate-targeted, cationic liposome-mediated gene transfer into disseminated peritoneal tumors. Gene Ther., 9, 1542-1550. [98] Chiu, S.J., Marcucci, G., and Lee, R.J. (2006) Efficient delivery of an antisense oligodeoxyribonucleotide formulated in folate receptor-targeted liposomes. Anticancer Res., 26, 1049-1056. [99] Yang, L., Li, J., Zhou, W., Yuan, X., and Li, S. (2004) Targeted delivery of antisense oligodeoxynucleotides to folate receptor-overexpressing tumor cells. J.Control Release, 95, 321-331.
120
Yoshiyuki Hattori and Yoshie Maitani [100] Gosselin, M.A., Guo, W., and Lee, R.J. (2002) Incorporation of reversibly crosslinked polyplexes into LPDII vectors for gene delivery. Bioconjug.Chem., 13, 1044-1053. [101] Zhou, W., Yuan, X., Wilson, A., Yang, L., Mokotoff, M., Pitt, B., and Li, S. (2002) Efficient intracellular delivery of oligonucleotides formulated in folate receptor-targeted lipid vesicles. Bioconjug.Chem., 13, 1220-1225. [102] Shi, G., Guo, W., Stephenson, S.M., and Lee, R.J. (2002) Efficient intracellular drug and gene delivery using folate receptor-targeted pH-sensitive liposomes composed of cationic/anionic lipid combinations. J.Control Release, 80, 309319. [103] Dauty, E., Remy, J.S., Zuber, G., and Behr, J.P. (2002) Intracellular delivery of nanometric DNA particles via the folate receptor. Bioconjug.Chem., 13, 831-839. [104] Zuber, G., Zammut-Italiano, L., Dauty, E., and Behr, J.P. (2003) Targeted gene delivery to cancer cells: directed assembly of nanometric DNA particles coated with folic acid. Angew.Chem.Int.Ed Engl., 42, 2666-2669. [105] Hattori, Y. and Maitani, Y. (2005) Folate-linked lipid-based nanoparticle for targeted gene delivery. Current Drug Delivery, 2, 243-252. [106] Hattori, Y., Kubo, H., Higashiyama, K., and Maitani, Y. (2005) Folate-linked nanoparticles formed with DNA complexes in sodium chloride solution enhance transfection efficiency. J.Boimed. Nanotech., 1, 176-184. [107] Jeltsch, J.M. and Chambon, P. (1982) The complete nucleotide sequence of the chicken ovotransferrin mRNA. Eur.J.Biochem., 122, 291-295. [108] Williams, J., Elleman, T.C., Kingston, I.B., Wilkins, A.G., and Kuhn, K.A. (1982) The primary structure of hen ovotransferrin. Eur.J.Biochem., 122, 297303. [109] Baggiolini, M., De Duve, C., Masson, P.L., and Heremans, J.F. (1970) Association of lactoferrin with specific granules in rabbit heterophil leukocytes. J.Exp.Med., 131 , 559-570. [110] Metz-Boutigue, M.H., Jolles, J., Mazurier, J., Schoentgen, F., Legrand, D., Spik, G., Montreuil, J., and Jolles, P. (1984) Human lactotransferrin: amino acid sequence and structural comparisons with other transferrins. Eur.J.Biochem., 145, 659-676. [111] Leibman, A. and Aisen, P. (1979) Distribution of iron between the binding sites of transferrin in serum: methods and results in normal human subjects. Blood, 53, 1058-1065. [112] Miyamoto, T., Tanaka, N., Eishi, Y., and Amagasa, T. (1994) Transferrin receptor in oral tumors. Int.J.Oral Maxillofac.Surg., 23, 430-433. [113] Tanaka, N., Miyamoto, T., Saito, M., Amagasa, T., Shioda, S., Eishi, Y., and Hsieh, K.J. (1991) Transferrin receptor expression in oral tumors. Bull.Tokyo Med.Dent.Univ, 38, 19-26. [114] Neves, S.S., Sarmento-Ribeiro, A.B., Simoes, S.P., and Pedroso de Lima, M.C. (2006) Transfection of oral cancer cells mediated by transferrin-associated lipoplexes: mechanisms of cell death induced by herpes simplex virus thymidine kinase/ganciclovir therapy. Biochim.Biophys.Acta, 1758, 1703-1712.
Tumor-Targeting Non-Viral Gene Therapy for the Treatment of Oral Cancer
121
[115] Xu, L., Pirollo, K.F., and Chang, E.H. (1997) Transferrin-liposome-mediated p53 sensitization of squamous cell carcinoma of the head and neck to radiation in vitro. Hum.Gene Ther., 8, 467-475. [116] Xu, L., Pirollo, K.F., Tang, W.H., Rait, A., and Chang, E.H. (1999) Transferrinliposome-mediated systemic p53 gene therapy in combination with radiation results in regression of human head and neck cancer xenografts. Hum.Gene Ther., 10, 2941-2952. [117] Xu, L., Frederik, P., Pirollo, K.F., Tang, W.H., Rait, A., Xiang, L.M., Huang, W., Cruz, I., Yin, Y., and Chang, E.H. (2002) Self-assembly of a virusmimicking nanostructure system for efficient tumor-targeted gene delivery. Hum.Gene Ther., 13, 469-481. [118] Xu, L., Huang, C.C., Huang, W., Tang, W.H., Rait, A., Yin, Y.Z., Cruz, I., Xiang, L.M., Pirollo, K.F., and Chang, E.H. (2002) Systemic tumor-targeted gene delivery by anti-transferrin receptor scFv-immunoliposomes. Mol.Cancer Ther., 1, 337-346. [119] Dass, C.R. and Burton, M.A. (1999) Lipoplexes and tumours. A review. J.Pharm.Pharmacol., 51, 755-770. [120] Ruley, H.E. (1996) p53 and response to chemotherapy and radiotherapy. Important Adv.Oncol.,37-56. [121] Xu, L., Tang, W.H., Huang, C.C., Alexander, W., Xiang, L.M., Pirollo, K.F., Rait, A., and Chang, E.H. (2001) Systemic p53 gene therapy of cancer with immunolipoplexes targeted by anti-transferrin receptor scFv. Mol.Med., 7, 723734. [122] Koff, A., Ohtsuki, M., Polyak, K., Roberts, J.M., and Massague, J. (1993) Negative regulation of G1 in mammalian cells: inhibition of cyclin E-dependent kinase by TGF-beta. Science, 260, 536-539. [123] Polyak, K., Kato, J.Y., Solomon, M.J., Sherr, C.J., Massague, J., Roberts, J.M., and Koff, A. (1994) p27Kip1, a cyclin-Cdk inhibitor, links transforming growth factor-beta and contact inhibition to cell cycle arrest. Genes Dev., 8, 9-22. [124] Lloyd, R.V., Erickson, L.A., Jin, L., Kulig, E., Qian, X., Cheville, J.C., and Scheithauer, B.W. (1999) p27kip1: a multifunctional cyclin-dependent kinase inhibitor with prognostic significance in human cancers. Am.J.Pathol., 154, 313323. [125] Supriatno, Harada, K., Kawaguchi, S., Yoshida, H., and Sato, M. (2003) Effect of p27Kip1 on the ability of invasion and metastasis of an oral cancer cell line. Oncol.Rep., 10, 527-532. [126] Loda, M., Cukor, B., Tam, S.W., Lavin, P., Fiorentino, M., Draetta, G.F., Jessup, J.M., and Pagano, M. (1997) Increased proteasome-dependent degradation of the cyclin-dependent kinase inhibitor p27 in aggressive colorectal carcinomas. Nat.Med., 3, 231-234. [127] Supriatno, Harada, K., Kawaguchi, S., Onoue, T., Yoshida, H., and Sato, M. (2004) Characteristics of antitumor activity of mutant type p27Kip1 gene in an oral cancer cell line. Oral Oncol., 40, 679-687.
122
Yoshiyuki Hattori and Yoshie Maitani [128] Vine, A.L. and Bertram, J.S. (2002) Cancer chemoprevention by connexins. Cancer Metastasis Rev., 21, 199-216. [129] Yamasaki, H. and Naus, C.C. (1996) Role of connexin genes in growth control. Carcinogenesis, 17, 1199-1213. [130] Oyamada, Y., Oyamada, M., Fusco, A., and Yamasaki, H. (1994) Aberrant expression, function and localization of connexins in human esophageal carcinoma cell lines with different degrees of tumorigenicity. J.Cancer Res.Clin.Oncol., 120, 445-453. [131] Zhang, Z.Q., Zhang, W., Wang, N.Q., Bani-Yaghoub, M., Lin, Z.X., and Naus, C.C. (1998) Suppression of tumorigenicity of human lung carcinoma cells after transfection with connexin43. Carcinogenesis, 19, 1889-1894. [132] Mehta, P.P., Perez-Stable, C., Nadji, M., Mian, M., Asotra, K., and Roos, B.A. (1999) Suppression of human prostate cancer cell growth by forced expression of connexin genes. Dev.Genet., 24, 91-110. [133] Hattori, Y., Fukushima, M., and Maitani, Y. (2007) Non-viral delivery of the connexin 43 gene with histone deacetylase inhibitor to human nasopharyngeal tumor cells enhances gene expression and inhibits in vivo tumor growth. Int J Oncol. 30, 1427-1439. [134] Chang, J.Y., Xia, W., Shao, R., Sorgi, F., Hortobagyi, G.N., Huang, L., and Hung, M.C. (1997) The tumor suppression activity of E1A in HER-2/neuoverexpressing breast cancer. Oncogene, 14, 561-568. [135] Yu, D.H., Scorsone, K., and Hung, M.C. (1991) Adenovirus type 5 E1A gene products act as transformation suppressors of the neu oncogene. Mol.Cell Biol., 11, 1745-1750. [136] Frisch, S.M. and Francis, H. (1994) Disruption of epithelial cell-matrix interactions induces apoptosis. J.Cell Biol., 124, 619-626. [137] Frisch, S.M., Reich, R., Collier, I.E., Genrich, L.T., Martin, G., and Goldberg, G.I. (1990) Adenovirus E1A represses protease gene expression and inhibits metastasis of human tumor cells. Oncogene, 5, 75-83. [138] Somasundaram, K., Jayaraman, G., Williams, T., Moran, E., Frisch, S., and Thimmapaya, B. (1996) Repression of a matrix metalloprotease gene by E1A correlates with its ability to bind to cell type-specific transcription factor AP-2. Proc.Natl.Acad.Sci.U.S.A, 93, 3088-3093. [139] Frisch, S.M. (1994) E1a induces the expression of epithelial characteristics. J.Cell Biol., 127, 1085-1096. [140] Greenberg, P.D. (1991) Adoptive T cell therapy of tumors: mechanisms operative in the recognition and elimination of tumor cells. Adv.Immunol., 49, 281-355. [141] Doherty, P.C., Knowles, B.B., and Wettstein, P.J. (1984) Immunological surveillance of tumors in the context of major histocompatibility complex restriction of T cell function. Adv.Cancer Res. , 42, 1-65. [142] Aebersold, P., Hyatt, C., Johnson, S., Hines, K., Korcak, L., Sanders, M., Lotze, M., Topalian, S., Yang, J., and Rosenberg, S.A. (1991) Lysis of autologous
Tumor-Targeting Non-Viral Gene Therapy for the Treatment of Oral Cancer
123
melanoma cells by tumor-infiltrating lymphocytes: association with clinical response. J.Natl.Cancer Inst., 83, 932-937. [143] Zier, K., Gansbacher, B., and Salvadori, S. (1996) Preventing abnormalities in signal transduction of T cells in cancer: the promise of cytokine gene therapy. Immunol.Today, 17, 39-45. [144] O'Malley, B.W., Jr., Li, D., McQuone, S.J., and Ralston, R. (2005) Combination nonviral interleukin-2 gene immunotherapy for head and neck cancer: from bench top to bedside. Laryngoscope, 115, 391-404. [145] Li, D., Ronson, B., Guo, M., Liu, S., Bishop, J.S., Van Echo, D.A., and O'Malley, B.W., Jr. (2002) Interleukin 2 gene transfer prevents NKG2D suppression and enhances antitumor efficacy in combination with cisplatin for head and neck squamous cell cancer. Cancer Res., 62, 4023-4028. [146] Wurster, A.L., Rodgers, V.L., Satoskar, A.R., Whitters, M.J., Young, D.A., Collins, M., and Grusby, M.J. (2002) Interleukin 21 is a T helper (Th) cell 2 cytokine that specifically inhibits the differentiation of naive Th cells into interferon gamma-producing Th1 cells. J.Exp.Med., 196, 969-977. [147] Esteban, F., Concha, A., Delgado, M., Perez-Ayala, M., Ruiz-Cabello, F., and Garrido, F. (1990) Lack of MHC class I antigens and tumour aggressiveness of the squamous cell carcinoma of the larynx. Br.J.Cancer, 62, 1047-1051. [148] Mattijssen, V., De Mulder, P.H., Schalkwijk, L., Manni, J.J., 't Hof-Grootenboer, B., and Ruiter, D.J. (1991) HLA antigen expression in routinely processed head and neck squamous cell carcinoma primary lesions of different sites. Int.J.Cancer Suppl, 6, 95-100. [149] Fillat, C., Carrio, M., Cascante, A., and Sangro, B. (2003) Suicide gene therapy mediated by the Herpes Simplex virus thymidine kinase gene/Ganciclovir system: fifteen years of application. Curr.Gene Ther., 3, 13-26. [150] Mullen, C.A., Kilstrup, M., and Blaese, R.M. (1992) Transfer of the bacterial gene for cytosine deaminase to mammalian cells confers lethal sensitivity to 5fluorocytosine: a negative selection system. Proc.Natl.Acad.Sci.U.S.A, 89, 33-37. [151] Hamel, W., Magnelli, L., Chiarugi, V.P., and Israel, M.A. (1996) Herpes simplex virus thymidine kinase/ganciclovir-mediated apoptotic death of bystander cells. Cancer Res., 56, 2697-2702. [152] Mesnil, M., Piccoli, C., Tiraby, G., Willecke, K., and Yamasaki, H. (1996) Bystander killing of cancer cells by herpes simplex virus thymidine kinase gene is mediated by connexins. Proc.Natl.Acad.Sci.U.S.A, 93, 1831-1835. [153] Liu, T., Tang, A., Zhang, G., Chen, Y., Zhang, J., Peng, S., and Cai, Z. (2005) Calcium phosphate nanoparticles as a novel nonviral vector for efficient transfection of DNA in cancer gene therapy. Cancer Biother.Radiopharm., 20, 141-149. [154] Crooke, S.T. (1999) Molecular mechanisms of action of antisense drugs. Biochim.Biophys.Acta, 1489, 31-44. [155] Stull, R.A. and Szoka, F.C., Jr. (1995) Antigene, ribozyme and aptamer nucleic acid drugs: progress and prospects. Pharm.Res., 12, 465-483.
124
Yoshiyuki Hattori and Yoshie Maitani [156] Mamot, C. and Rochlitz, C. (2006) Targeting the epidermal growth factor receptor (EGFR)--a new therapeutic option in oncology? Swiss.Med.Wkly., 136, 4-12. [157] Dias, N. and Stein, C.A. (2002) Potential roles of antisense oligonucleotides in cancer therapy. The example of Bcl-2 antisense oligonucleotides. Eur.J.Pharm.Biopharm., 54, 263-269. [158] Pai,S. I., Lin, Y.Y., Macaes, B., Meneshian, A., Hung, C.F., and Wu, T.C. (2006) Prospects of RNA interference therapy for cancer. Gene Ther., 13, 464-477. [159] McManus, M.T. and Sharp, P.A. (2002) Gene silencing in mammals by small interfering RNAs. Nat.Rev.Genet., 3, 737-747. [160] Scherr, M., Morgan, M.A., and Eder, M. (2003) Gene silencing mediated by small interfering RNAs in mammalian cells. Curr.Med.Chem., 10, 245-256. [161] Takeshita, F. and Ochiya, T. (2006) Therapeutic potential of RNA interference against cancer. Cancer Sci., 97, 689-696. [162] Brand, F.X., Ravanel, N., Gauchez, A.S., Pasquier, D., Payan, R., Fagret, D., and Mousseau, M. (2006) Prospect for anti-her2 receptor therapy in breast cancer. Anticancer Res., 26, 715-722.
In: Oral Cancer Research Advances Editor: Alexios P. Nikolakakos, pp. 125-153
ISBN 978-1-60021-864-4 © 2007 Nova Science Publishers, Inc.
Chapter 5
NEW DIAGNOSTIC IMAGING MODALITIES FOR ORAL CANCERS Yasuhiro Morimoto1,∗, Tatsurou Tanaka1, Izumi Yoshioka2, Yoshihiro Yamashita2, Souichi Hirashima2, Masaaki Kodama2, Wataru Ariyoshi2, Taiki Tomoyose2, Norihiko Furuta2, Manabu Habu2, Sachiko Okabe1, Shinji Kito1, Masafumi Oda1, Hirohito Kuroiwa1, Nao Wakasugi1, Tetsu Takahashi2 and Kazuhiro Tominaga2 1
2
Dep. of Oral Diagnostic Science, Kyushu Dental College, Kitakyushu, Japan; Dep. of Oral and Maxillofacial Surgery, Kyushu Dental College, Kitakyushu, Japan.
ABSTRACT This article reviews the use of imaging modalities; both commonly used and recently introduced, to evaluate oral cancers and their lymph node metastases. Magnetic resonance images (MRI) and X-ray computed tomography (CT) images are used to determine the size, invasive area, and possible pathology of primary cancers. In addition, the two modalities are useful for staging and detecting clinically occult lymph node metastases at different levels of the neck. In particular, a follow-up MR examination method, dynamic MR sialography, for patients with xerostomia after radiation therapy is introduced, and the use of fusion images of the tumors and vessels using threedimensional fast asymmetric spin-echo (3D-FASE) and MR angiography is discussed. Furthermore, ultrasound imaging (US), in addition to its use for staging and detecting clinically occult lymph node metastases, plays an important role in confirming intraoperative surgical clearance of tongue carcinomas. In addition, the role of US-guided, ∗
Correspondence concerning this article should be addressed to: Yasuhiro Morimoto DDS PhD, Division of Diagnostic Radiology, Department of Oral Diagnostic Science, Kyushu Dental College, 2-6-1 Manazuru, Kokurakita-ku, Kitakyushu 803-8580, JAPAN. TEL: 81-93-582-1131 (Ext. 2111); FAX: 81-93-581-2152; Email:
[email protected].
126
Yasuhiro Morimoto, Tatsurou Tanaka, Izumi Yoshioka et al. fine-needle aspiration biology is also reviewed. Finally, the role and limitations of fusion images obtained from positron emission tomography (PET) and CT (PET-CT), which are currently used worldwide, are discussed.
Keywords: PET-CT; X-ray CT scanning; MRI; Dynamic MR sialography; MR angiography; ultrasonography; intra-oral ultrasonography
INTRODUCTION Malignant neoplasms of the mouth constitute appropriately 1% of all cancers and about 3% of head and neck cancers [1-3]. Seven percent of oral cavity tumors are malignant, and over 90% of malignant neoplasms are squamous cell carcinomas [1,3]. Since other malignancies can occur in the mouth, such as minor salivary tumors, malignant lymphomas, and a variety of other rare tumors, these are also discussed [1,2]. The second half of the last century generated much knowledge about the human body, including mapping of the human chromosome, but the occurrence, development, and diagnosis of oral cancer still remain obscure. It is thought that both a genetic predisposition and environmental factors, including alcohol abuse and tobacco chewing, lead to the development of oral cancers [1-3]. A particular characteristic of oral cancers is that most lesions are amenable to direct clinical examination and can be easily biopsied [1-3]. Therefore, the most important purpose of imaging these lesions is to identify the extent of invasion into surrounding tissues, including the mucosa, fatty tissues, vessels, nerves, muscles, salivary glands, mandible, and maxilla [2]. In addition, lymph node metastases in primary neoplasm-related regions can be detected using various kinds of imaging modalities [1,2]. Of course, the sizes, shape, and inner characteristics of lesions should also be delineated. Consequently, primary mouth malignancies are staged according to the TNM system of the American Joint Committee on Cancer Staging (AJCCS) [1,2]. In the present article, basic and recent clinical applications of various imaging modalities, such X-ray CT scan, MRI, US, and PET-CT, as they relate to diagnosing mouth cancer, are reviewed.
X-RAY CT SCANS AND MRI USED FOR DETECTING PRIMARY ORAL CANCERS AND LYMPH NODE METASTASES X-ray CT scan and MRI are the most common and the most suitable modalities for evaluating oral cancers [1-5]. CT scans are performed using whole body type machines (Figure 1); for example, in our dental hospital, a Toshiba X Vision RE™ machine (Toshiba Co. Ltd., Tokyo, Japan) is used. For X-ray CT scans, it is commonly advocated that scanning be performed in the axial plane without angulation in 5-mm-thick contiguous sections. X-ray CT scan is the most appropriate for identifying and evaluating the lesion’s location and size, as well as bone and surrounding soft tissue invasion [1-5]. CT scans are performed after the patient has been given an intravenous dose of 50 mL iohexol (300 mgI/mL; Omnipaque
New Diagnostic Imaging Modalities for Oral Cancers
127
300™, Daiichi Pharmaceutical Co. Ltd., Tokyo, Japan) at the start of scanning, followed by an additional 50-mL intravenous infusion during scanning to allow better visualization of the vascular structures [1,4,5]. Images are photographed based on standard algorithms and softtissue windows. In cases where an exact evaluation of erosive changes in the mandible and maxilla is required, coronal plane views should be produced using multi-planar reconstruction (MPR) techniques after acquisition of axial planes with a 1-2-mm section thickness [1,5]. Furthermore, the CT scan can encompass the area from the cavernous sinuses to the thoracic inlet in order to examine the primary cancer and possible lymph node metastases in the neck.
Figure 1. The whole body type X-ray CT scanning machine showing gantry and patient bed (Toshiba X Vision RE™, Toshiba Co. Ltd., Tokyo, Japan).
128
Yasuhiro Morimoto, Tatsurou Tanaka, Izumi Yoshioka et al.
Figure 2. 1.5 Tesla whole body type MR system (VISART®, Toshiba Co. Ltd., Tokyo, Japan) showing the bore and patient bed.
MR images are acquired using a 1.5-T full-body MR system; for example, in our dental hospital, a VISART machine (Figure 2) (Toshiba Co. Ltd., Tokyo, Japan) is used. Head coils are most sensitive for visualizing primary lesions around the oral cavity, but they are less useful for visualizing lymph nodes located in the neck. Thus, a circular polarized neck coil (Figure 3) is essential for visualizing the neck. MR images are commonly obtained using the following 6 sequences: 1) STIR or fat-saturation coronal T2-weighted images; 2) STIR or fatsaturation axial T2-weighted images; 3) coronal T1-weighted images without contrast medium; 4) axial T1-weighted images without contrast medium; 5) coronal T1-weighted images with contrast medium; and 6) axial T1-weighted images with contrast medium [1,2,4,5]. MR image slice thickness should be 5-7 mm [1,4,5]. Similar to X-ray CT scans, MR images can encompass the area from the cavernous sinuses to the thoracic inlet in order to examine the primary cancer and possible lymph node metastases in the neck.
Figure 3. One type of RF coils, circular polarized neck coils are used for examinations of the neck, showing.
DIAGNOSIS USING X-RAY CT SCANS FOR PRIMARY ORAL CANCERS AND THEIR LYMPH NODE METASTASES The X-ray CT scan imaging findings of representative cancers of the mouth, such as squamous cell carcinomas and minor salivary gland malignancy, commonly include soft tissue density masses with mild contrast enhancement (Figure 4) [1,2,4,5]. Of course, tumor margins are often difficult to discern when the tumor abuts or invades adjacent muscle or the lymphoid tissue located in Waldeyer’s ring [5]. Furthermore, masses affected by dental metal streak artifact are often undetectable on X-ray CT scanning (Figure 5). It has been reported
New Diagnostic Imaging Modalities for Oral Cancers
129
that particular radiological findings and parameters using dynamic CT could also be useful [6-8]. Wakasa et al. reported that the peak height, which is the relative CT value measured from the base CT value to the point where the curve reaches its peak, is useful for distinguishing between inflammation and tumors [7]. Transit time, which is the time between two transit points on the time-density curve, has been reported to be significantly longer in benign tumors than in malignant tumors [7]. Michael et al. showed that dynamic CT scanning was valuable for the differential diagnosis, management, and follow-up of hemangiomas [6].
Figure 4. A 52 -year-old female with a right gingival squamous cell carcinoma. The soft tissue density masse (arrowheads) with the mild contrast enhancement by iohexol (300 mgI/mL; Omunipaque 300™, Daiichi Pharmaceutical Co. Ltd., Tokyo, Japan) is shown at gingival gums and alveolar bone of the right premolar regions. The mass invades and destructs the cortical and spongy bone around the right premolar regions.
Figure 5. Steak artifact (arrowheads) caused by dental crowns is shown on an X-ray CT scanning image.
130
Yasuhiro Morimoto, Tatsurou Tanaka, Izumi Yoshioka et al.
Correctly diagnosing metastatic lymph nodes is important for determining the prognosis of patients with oral squamous cell carcinoma (SCC) [2,9-14]. The use of CT scanning continues to be the best diagnostic method for preoperative detection of metastatic neck disease [2,15-23]. Criteria have been developed for the CT diagnosis of lymph node metastases. With respect to size, the major axes of the jugulodigastric nodes and submandibular nodes are 15 mm; for the other nodes, the major axes are 11 mm. The minor axes of the jugulodigastric nodes and submandibular nodes are 10 mm; for the other nodes, the minor axes are 8 mm. Furthermore, lymph node sizes on the affected size are two times larger than those on the contralateral side. The shape of lymph nodes metastases is round; lymph node swelling can result in the formation of a conglomerate. In addition, the presence of central nodal necrosis (CNN) is strongly correlated with malignancy [2,9,13-23]. In our dental hospital, when CNN is present, lymph node metastasis is diagnosed (Figure 6). If CNN is absent, then lymph node metastases are diagnosed if two other criteria are present.
Figure 6. A 39-year-old female with a right gingival squamous cell carcinoma. The lymph nodes with the central nodal necrosis (CNN) on an X-ray CT scanning image (arrowheads) are diagnosed as metastases. A) Two submandibular and a jugulodigastric lymph nodes with CNN is diagnosed as metastasis (arrowheads). B) A submental and two submandibular lymph nodes with CNNs are diagnosed as metastasis (arrowheads).
It is important to recognize that there is a significant relationship between the extent of SCC differentiation in lymph nodes and the incidence of CNN in metastatic lymph nodes [24]. In well-differentiated cancers, metastatic lymph nodes tend to produce CNN, whereas moderately- and poorly-differentiated cancers do not tend to result in CNN. If patients with moderately differentiated or undifferentiated primary oral SCC have metastatic lymph nodes, then CNN would not be able to form in lymph nodes with a maximum diameter of less than 25 mm. Therefore, CT scans should be examined for lymph node density changes in order to determine whether a biopsy is needed to rule out metastatic lymph nodes in patients with moderately differentiated or undifferentiated SCC in the primary sites [24]. Though it is
New Diagnostic Imaging Modalities for Oral Cancers
131
advocated that PET-CT should be used to determine whether there are lymph node metastases, this approach is not that useful, as explained below.
NEW X-RAY CT MACHINE FOR DIAGNOSING ORAL CANCERS An X-ray CT scanning machine is now being developed, and recently multidetector CT (MDCT) and cone-beam CT have been introduced for imaging mouth-related regions. Both machines have advantages for diagnosing oral cancers. It has been reported that cone-beam CT can be used to evaluate and measure three-dimensional bone defects and the presence of periapical lesions more accurately than intraoral X-rays [25-27]. To the best of our knowledge, though there have been no reports dealing with the identification, measurement, and assessment of bone resorption caused by oral cancers, based on previous reports, conebeam CT appears to be a useful tool for accurately evaluating three-dimensional bone resorption. The development of the MDCT machine has allowed faster CT scanning and rapid acquisition of numerous thin axial images. Therefore, more accurate reconstruction images of bones can be obtained than with older X-ray CT scanning machines. It is possible that MDCT, much like cone-beam CT, could also be useful for accurately evaluating threedimensional bone resorption. The MDCT should improve the performance of CT angiograms and dynamic contrast and maneuver imaging [28,29]. MDCT angiography is used to delineate the great vessels and to provide information about the exact location of neoplasms, lymphadenopathy, and their vascular infiltration or spread.
DIAGNOSIS USING MR IMAGES FOR PRIMARY ORAL CANCERS AND THEIR LYMPH NODE METASTASES MR imaging of representative oral cancers, such as squamous cell carcinomas, commonly shows mild to moderate hyperintensity signals on fat suppression T2-weighted images, and isointense signals to muscles on T1-weighted images without contrast enhancement (Figure 7). Therefore, fat suppression T2-weighted images might be the most appropriate sequence for determining the presence of tumors. Based on the likely treatments that will be used, particular fat-suppression techniques, such as the frequency-selective fat saturation method (FS) and the short inversion time inversion recovery (STIR), should be chosen. Compared to STIR, FS sequences have a better resolution and are generally thought to be more useful [30-33]. However, when using FS-sequences, the uniformity of the magnetic field is severely disturbed; this results in more cases of insufficient fat suppression than with STIR. In particular, in our previous study, we demonstrated that insufficient fat suppression is more likely to occur in the oral region when using FS than when using STIR, and that, with FS, the degree of fat suppression homogeneity in the head and neck region depends on the location (Figure 8). In addition, the degree of fat suppression instability with FS may change between pre- and post-reconstruction images when metal plates and myocutaneous flaps are used. Therefore, we should recognize that instability of the amount of
132
Yasuhiro Morimoto, Tatsurou Tanaka, Izumi Yoshioka et al.
fat suppression, which appears to depend on location and reconstruction with metal plate and myocutaneous flap in patients with oral cancer on MR images using, is generally seen in patients with primary squamous cell carcinomas [30].
Figure 7. A 39-year-old female with a right gingival squamous cell carcinoma. The masse (arrowheads) with isointensity signal to muscles in gingival gums and alveolar bone of the right molar regions on T1weighted images without the contrast enhancement (A), and with moderate hyperintensity signal is shown on fat suppression T2-weighted images (B).
Figure 8. Axial T2-weighted images with STIR (short inversion time inversion recovery) in subcutaneous space at the submental level showing a sufficient fat suppression (arrowheads) (A), but insufficient fat suppression (arrowheads) with fat saturation (FS) (B).
Recently, it has been shown that particular imaging findings and parameters of dynamic contrast-enhanced MR images could be used as diagnostic tools for primary oral cancers [3436]. Takashima et al. suggested that dynamic MR imaging contributes to helping predict whether head and neck lesions are malignant, though it can help limit the differential
New Diagnostic Imaging Modalities for Oral Cancers
133
diagnosis and has the potential of predicting vascularity and recurrence [34]. Asaumi et al. showed that dynamic MRI might be useful in differentiating malignant from benign tumors, and in detecting the extent of the tumors in sublingual carcinomas [35]. However, there are reports that question the utility of dynamic MR imaging [37-39]. Arakawa et al. showed that dynamic MR imaging was not significantly better than T2-weighted imaging for identifying areas of invasion [37]. Murakami et al. also reported that, though large tumors extending around tissues are relatively well delineated on dynamic images, the images were no better than T2-weighted images [38]. In the oral cavity, unlike other closed regions, most of the lesions are amenable to direct clinical examination and biopsy. Therefore, it is unnecessary for radiologists to determine the pathological diagnosis of masses in the mouth using imaging modalities. In addition, since there is a relatively large amount of fatty tissue around the oral cavity, it is more difficult for radiologists to diagnose areas of cancer invasion in the mouth using T1-weighted images than using T2-weighted images. Therefore, dynamic MR imaging may not necessarily be a useful technique for identifying the size of oral cancers or for determining their pathological diagnoses. On the other hand, there are reports stating that dynamic contrast-enhanced MR images are useful for diagnosing lymph node metastases [40-43]. Noworolski et al. studied multiple factors, including peak time and peak enhancement, in 21 patients with squamous cell carcinoma of the head and neck and found that, on dynamic imaging, lymph node metastases had heterogeneous contrast enhancement, while normal lymph nodes had homogeneous enhancement [43]. Fischbein et al. also showed that metastatic lymph nodes had a longer time to peak enhancement and a lower peak enhancement than reactive lymph nodes [42]. Thus, overall, metastatic lymph nodes have a longer time to peak, a lower peak enhancement, a lower maximum slope, and a slower washout slope than normal lymph nodes. Furthermore, this technique can be used to distinguish between normal and malignant tissue and to differentiate a malignant lymphoma from other lymph node enlargements. Asaumi et al. demonstrated that metastatic lymph nodes in cases with squamous cell carcinoma had greater and faster peak enhancement than malignant lymphoma [44]. One of the newest techniques involves the use of both MR lymphangiography and carbon dye in patients with mucosal head and neck cancers to detect sentinel lymph nodes; this technique has been found to be useful [45]. Very recently, diffusion-weighted images have been used to diagnose lymph node metastases [46-51]. Diffusion-weighted MRI with ADC mapping is a promising, new technique that can differentiate metastatic from benign lymph nodes [48]. On the ADC map, malignant lymph nodes usually show low signal intensity, and benign lymph nodes usually show high signal intensity. The mean ADC values of metastatic and lymphomatous lymph nodes were significantly lower than the mean ADC value of benign cervical lymph nodes [46-51]. In our dental hospital, ADC values mapping images are represented by the color indication (Figure 9). In particular cases that are difficult to diagnose the expanse of diseases, ADC values mapping are represented as fusion images of T2-weighted imaging (Figure 9). However, since the ADC values are dependent on the particular MR system, a threshold value for differentiating malignant from benign lymph nodes must be determined in each hospital for each machine. Nevertheless, there have been only a few reports of the use of
134
Yasuhiro Morimoto, Tatsurou Tanaka, Izumi Yoshioka et al.
these techniques in primary oral cancers, since it is unnecessary for radiologists to determine the precise pathological diagnosis of mouth lesions.
Figure 9. Axial diffusion-weighted image and ADC map of a 60-year-old male with phlegmon. a) Axial ADC map indicated by color representation shows an abscess formation (arrowhead) as a red and the abscess-free area as the colors of except red. ADC map is prepared from FASE-DWI results obtained with a b factor of 900 sec/mm2. The ADC of the abscess in Figure 9A is 0.95x10-3 mm2/s and that of the abscess-free area was 2.75x10-3 mm2/s. b) Superimposed view of one part of the axial ADC map indicated in Figure 9A and a T2-weighted image.
In the last decade, iron oxide-enhanced MRI has been used, which involves the use of ultra-small superparamagnetic iron oxide (USPIO) particles that are administered through an intravenous injection. The USPIO particles are concentrated in the reticuloendothelial system by functioning histiocytes located in normal lymph nodes. The changes occur over a 6 to 24 hour period after the administration of the contrast agent. Therefore, normal lymph nodes demonstrate a reduced signal intensity on T2*-weighted gradient-echo and T2-weighted MR images. In contrast, metastatic lymph nodes do not take up the USPIO particles and, thus, maintain their pre-contrast signal intensity. It has been reported that this technique improves the accuracy of detecting lymph node metastases [52,53]. The next technique has no direct diagnostic use for oral cancers but was developed and introduced as a new technique for use during follow-up of patients with xerostomia after radiotherapy. This technique is called “dynamic MR sialography”, and it is a new noninvasive diagnostic technique that evaluates the physiological function of the salivary glands [54]. The technique monitors the time-dependent changes in saliva after citric acid stimulation using continuous magnetic resonance (MR) sialographic images [54,55]. Using this technique, we found that dynamic MR sialographic images and parameters have a very high potential of being used as a diagnostic tool for xerostomia and Sjögren’s syndrome [55,56]. We also used this technique in patients with xerostomia after radiotherapy to examine salivary function and obtain salivary flow rate data in physiologic states (unpublished data). The maximum change ratio and detectable duct area using dynamic MR sialographic parameters decreased in parallel with the decreases of salivary flow rates in 3 patients after radiotherapy. These data could be used to determine when treatment for
New Diagnostic Imaging Modalities for Oral Cancers
135
Figure 10. Dynamic MR sialographic images (A and B) and graphs (C and D) from the left parotid glands ducts of a 67-year-old male with decrease of salivary flow rate before (A and C) or after (B and D) radiotherapy for the tongue squamous cell carcinomas. A) The main duct and its side branches in parotid gland became clearer in a time-dependent fashion immediately after citric acid stimulation until 90 seconds (arrowheads). After 90 seconds, the main duct in parotid gland became obscure in a time-dependent manner. The detectable areas in the main duct and the side branches in parotid gland before and after citric acid stimulation were prominently changed. B) After the radiotherapy for tongue, the detectable areas in the main duct and the side branches in parotid gland before and after citric acid stimulation were relatively a little clearer (arrowheads) than before the radiotherapy. C) The graph demonstrating the relationship between the time course after citric acid stimulation and the changing ratio of the detectable area in the parotid gland ducts for the patient of Figure 10A. The changing ratio was higher. D) The graph demonstrating the relationship between the time course after citric acid stimulation and the changing ratio of the detectable area in the parotid gland ducts for the patient of Figure 10B. The maximum changing ratio and detectable ductal area after radiotherapy decreased evidently.
136
Yasuhiro Morimoto, Tatsurou Tanaka, Izumi Yoshioka et al.
xerostomia should begin. The changes in the dynamic MR sialographic images and the data of one case before, during, and after radiotherapy are shown in Figure 10. The dynamic graph produced using MR sialography demonstrated that the maximum change ratio decreased markedly 4 weeks after radiotherapy. These data, together with the clinical data and salivary flow rates, could be used to determine when treatment for xerostomia should begin. However, the possible limitation of that study was the relatively small sample size. Therefore, our next trial will include a larger sample size to more firmly establish our results and the criteria for starting irrigation treatment.
ORAL CANCER-RELATED, SPECIAL NEW MR TECHNIQUES In this final section dealing with MR techniques, we introduce two new special techniques that we developed and recently reported: 1) The identification of vessels in the mouth and neck using MR angiography; 2) The identification of the trigeminal nerve in the root entry zone using MR cisternography.
Figure 11. Superimposed view of a three dimensional (3D)-phase contrast (PC) MR angiography (MRA) image and a 3D-fast asymmetric spin echo (FASE ) sequenced heavy T2-weighted image in 38year-old patient with a haemangioma in the left cheek. This image allows both the haemangioma (arrowhead) and the external carotid arterial system to be seen on different rotatiåons.
MR angiography (MRA) without contrast medium injection is a technique that is used to delineate the relationship between vessels and tumors located in the oral region. This technique is simple and noninvasive. The main external carotid artery and its branches, including the lingual and facial arteries, can be imaged on MRA using 3-dimensional phase contrast (Figure 11). In addition, we devised a new method that involves the superimposition of MRA and T2-weighted images. This approach successfully demonstrates both the presence
New Diagnostic Imaging Modalities for Oral Cancers
137
of the hemangioma and the course of the feeding arteries in 3D without the need to use contrast medium (Figure 11) [57]. However, at present, tumors that do not have much fluid or vessels cannot be depicted as one fusion image. In the future, we plan to resolve this and would like to be able to visualize the relationship between various kinds of cancers and the vessels around tumors without the need for contrast medium. MR cisternography is a technique that outlines the cisterns of the brain, including the cerebellopontine angle cistern, using MR sequences without contrast medium. In our dental hospital, MR cisternography is used in patients with trigeminal neuralgia to detect neurovascular compression in the root entry zone of the trigeminal nerve (Figure 12) [58]. Rarely, patients with neuralgia of unknown etiology have tumors of the cerebellopontine angle region that invade the nerve [2]. In our previous reports, we showed that 4% (6 of 150 patients) of trigeminal neuralgia patients had brain tumors, which is relatively high [58]. Patients with a tumor of the cerebellopontine angle region have been relatively young in previous reports, including our report [2,58]. Therefore, dentists should consider the possibility of a brain tumor in relatively younger patients who have continuous trigeminal neuralgia of unknown etiology; MRI or X-ray CT examinations should be done to rule out space-occupying lesions as soon as possible in such patients. Figure 13 shows a brain tumor that can be seen invading the root entry zone of the trigeminal nerve in a 67-year-old female who had been previously diagnosed as having trigeminal neuralgia of unknown etiology.
Figure 12. Transverse original MR cisternographic image with axial (A) and reformatted coronal (B) 3D- fast asymmetric spin echo (FASE) images of a 52-year-old female with trigeminal neuralgia in a left side caused by neurovascular compression (NVC) in the anterior inferior cerebellar artery. The trigeminal nerve (arrow) surrounded of blood vessels (arrowhead) was visualized on MR cisternography (A, B).
138
Yasuhiro Morimoto, Tatsurou Tanaka, Izumi Yoshioka et al.
Figure 13. Transverse original images of blood vessels and the trigeminal nerve in the root entry zone (REZ) by MR cisternography with axial (A) 3D-fast asymmetric spin echo (FASE) images and T2weighted (B) images of a 67-year-old female with trigeminal neuralgia in a right side. The brain tumor (arrowheads) invaded the REZ region of the trigeminal nerve.
DIAGNOSIS USING ULTRASONOGRAPHIC IMAGES OF PRIMARY ORAL CANCERS AND THEIR LYMPH NODE METASTASES Ultrasonography can be used to assess lymph nodes in patients with oral cancers. The usefulness of ultrasonography for the diagnosis of lymph node metastases has been previously reported [59-63]. In one of the reports, ultrasonography performed by experienced ultrasonographers had a diagnostic accuracy rate of about 90% in cervical lymph node staging [62]. In other reports, sonography was significantly better than CT in depicting cervical metastatic nodes; [64] overall, the diagnostic accuracy rate for lymph node metastases was almost 75-85%, which is similar to our data. Ultrasonography is the method of choice for evaluating tumor infiltration into the great vessels’ walls. In addition, Power Doppler ultrasonographic images with B mode have a higher accuracy rate than B-mode alone [65-68]. Doppler ultrasonography provides information about internal lymph node blood flow, including hilar and peripheral parenchymal nodal flow, and improves the diagnostic accuracy for detecting lymph node metastases from oral cancers. In addition, Chikui et al., based on an analysis of pathology data, suggested that, after irradiation, the enhanced Doppler signals contribute to better visualization of the vessels and better detection of any vascular abnormalities [66,67]. Thus, particular attention should be paid to follow-up imaging examinations of patients with oral cancers before and after radiotherapy to detect lymph node metastases [66]. As already mentioned, ultrasonography is a non-invasive and easy to use imaging modality for patients with various diseases of the soft tissues of the head and neck. Thus, in addition to detection of lymph node metastases on initial examination, it is very useful for
New Diagnostic Imaging Modalities for Oral Cancers
139
following oral cancer patients after surgical treatment and/or radiotherapy. In areas that have been excised and exposed to radiation, normal tissues are replaced with cicatrix produced by granulation tissues. Therefore, the diagnosis of metastases by direct palpation of the remaining lymph nodes in the neck becomes more difficult after cancer treatment, and ultrasonography becomes increasingly more useful to detect subclinical lymph node metastases. On the other hand, US-guided, fine-needle aspiration biopsy including cutting needle biopsy of lymph nodes is easy to perform and has a high sensitivity and specificity, which results in accurate diagnosis of subclinical lymph node recurrences (Figure 14) [69-76]. Studies have reported that the pathological diagnoses of lesions obtained using US-guided needle biopsy agreed with the final pathological diagnoses after surgical dissection in about 90% of cases. However, in about 10-20% of cases, adequate pathological specimens could not be obtained. There have been few reports of major complications, but hematomas have been reported, including a report from our dental hospital [69,73]. Recently, Soudack et al. suggested that in pre-biopsy color Doppler sonography should be routinely used to guide the cutting needle to areas of the lesion showing sufficient vascularity [76]. Power or color Doppler ultrasonography may be associated with fewer vascular-related complications and may equal X-ray CT scan and MR images for identifying vascular-related findings. When doing US-guided needle biopsy as part of the preoperative assessment of head and neck lesions, including diagnosing lymph node metastases, the newly developed Monopty biopsy instrument (MBI) (Monopty, Bard Urologic Division; Covington, GA, USA) has been used; few of the pathological samples had rush artifacts and/or were obscured by blood, both of which are problems that are commonly associated with manual biopsy techniques.
Figure 14. View of ultrasonography (US)-guided fine-needle aspiration biopsy including cutting needle biopsy of lymph node (A). US image showing success centesis (arrowhead) of needle into the mass as metastatic lymph nodes suspected (B).
There have been some reports on the increasing use of US-guided needle biopsy for parotid glands [77-79], thyroid glands [80,81], and others. In the future, X-ray CT- [82-84] and MRI-guided needle biopsy [85-88] will likely be used clinically to diagnose lymphadenopathy.
140
Yasuhiro Morimoto, Tatsurou Tanaka, Izumi Yoshioka et al.
Figure 15. View of examination for tumor thickness of tongue using intraoral ultrasonography (A). US image showing size including thickness of squamous cell carcinoma (arrowheads) in tongue using intraoral ultrasonography (B).
Figure 16. A) A removal squamous cell carcinoma before produce of an embedded specimen. B) An embedded specimen produced using our peculiar technique by gelatin. C) Ultrasonographic image precisely demonstrates the figure, thickness, and size of squamous cell carcinoma embedded by glatin of Figure 17-B using intraoral ultrasonography. D) One of the pathological sections in the same specimen of Figure 17-B, C. The excellent coincidence between the ultrasonograhic image and finding of the pathological section can be demonstrated.
In general, ultrasonography should be used to diagnose lymph node metastases in the head and neck regions, as mentioned above, but the technique is often used to accurately estimate a tumor's size and to define adequate resection margins of tongue cancer cases with tumor extension and deep infiltration [89-95]. In particular, tumor thickness in oral squamous cell carcinomas is highly related to the occurrence of cervical metastasis; thus, accurate
New Diagnostic Imaging Modalities for Oral Cancers
141
preoperative assessment is indispensable to improve therapeutic effects. Many reports suggest that intraoral ultrasonography offers the most exact assessment of oral tumor thickness (Figure 15) [91-94]. The accuracy of tongue tumor thickness can be measured to within 1 mm with intraoral ultrasonography. Very recently, we confirmed this finding while studying the use of intraoral ultrasound to easily allow the operator to assess surgical clearance intraoperatively (Figure 16) [95]. Usually, as in our dental hospital, intraoral ultrasonography of the tongue is performed with an 8- to 12-MHz linear array transducer. The probe is placed directly on the surface of the tumor, as shown in Figure 15. Therefore, intraoral ultrasonography can evaluate tumor thickness of cancers that occur in frontal areas of the tongue, but not in those that occur in posterior areas.
DIAGNOSIS USING PET-CT IMAGES FOR PRIMARY ORAL CANCERS AND THEIR LYMPH NODE METASTASES Recently, a considerable amount of research has focused on the use of positron emission tomography (PET) as an important oncologic imaging tool in the oral and maxillofacial region that can help in primary tumor staging, evaluation of treatment response, recurrence detection, and restaging [96-114]. In particular, PET is useful for evaluating recurrent or residual cancers [97-99], especially when MRI and/or X-ray CT scans cannot distinguish tumor changes caused by chemotherapy and/or radiotherapy. At present, fluorine-18-labeled (18F) fluoro-2-deoxy-D-glucose (FDG) is most commonly used for patients with various diseases. FDG, a glucose analogue, is transported into the cells by glucose transporters and then is phosphorylated intracellularly, but not further metabolized [100- 102]. The distribution of FDG throughout the body mainly reflects glucose metabolism of individual tissues. In most cancer cells, the combination of an increased concentration of glucose transporters, increased glucose phosphorylation, and low phosphatase activity results in relatively high FDG concentrations [100-102]. Therefore, in general, malignant tumors show high FDG uptake; therefore, FDG-PET is useful for differentiating between benign and malignant disease. In order to distinguish between benign and malignant tumors on the basis of the degree of FDG uptake (Figure 17), many reports have stated that the standardized uptake value (SUV) should be 3.0-3.5 [103]. However, since inflammatory cells also have increased glucose metabolism, it is difficult to differentiate between inflammation and malignant tumors on PET imaging [102,104]. Moreover, even normal regions in and around the oral cavity show substantial variations in uptake that can present difficulties for identifying pathological changes. Thus, a permissible range of variation should be established for particular tissues. In particular, intense FDG uptake is found in organs and tissues that contain abundant lymphoid tissue, such as the pharynx, pharyngeal tonsil, palatine tonsils, and lingual tonsillar tissue (Figure 18). On the other hand, FDG uptake is low in normal lymph nodes, even though they contain abundant lymphoid tissue. Furthermore, Bogsrud and Lowe noted that a characteristic “V”-shaped high uptake area in the floor of the mouth along the medial borders of the mandible, which is a consistent finding on FDG-PET, most likely represents the sublingual glands.
142
Yasuhiro Morimoto, Tatsurou Tanaka, Izumi Yoshioka et al.
The most important clinical use of FDG-PET imaging stems from its ability to include the entire body and so detect metastases distant from the neck in patients with oral cancers [105,106]. This advantage is of particular interest when considering nuclear medical investigations. Figure 19 shows that distant metastases from the neck to the ilium could be detected using FDG-PET imaging in a patient from our dental hospital with a 1-cm-size tongue cancer. Another important use of FDG-PET imaging is to provide data on lymph node metabolism. Thus, FDG-PET imaging should be done in cases with suspected lymph node metastases based on X-ray CT scan, MR images, and ultrasonography. Therefore, in our dental hospital, FDG-PET is done in cases with suspected lymph node metastases.
Figure 17. Positron emission tomography (PET) image using fluoro-2-deoxy-D-glucose (FDG) in whole body of a 79-year-old male showing intense FDG uptakes in a left tongue squamous cell carcinoma (arrowhead).
New Diagnostic Imaging Modalities for Oral Cancers
143
Figure 18. PET images using FDG in oral and maxillo-facial regions of a patient with left gingival gum squamous cell carcinoma showing intense FDG uptakes in organ and tissues containing the abundant lymphoid tissue as likely the pharynx, pharyngeal tonsil, palatine tonsils (arrowheads in A), and lingual tonsillar tissue (arrowheads in B) except carcinoma (arrow in A and B).
Figure 19. PET images using FDG in whole body showing that metastasis distant can be detected to the lymph nodes in inferior internal jugular chain (arrowhead in A) and the ilium metastasis (arrowhead in B) in a 59-year-old male with a right tongue cancer having size of the only 1 cm.
144
Yasuhiro Morimoto, Tatsurou Tanaka, Izumi Yoshioka et al.
Figure 20. PET-CT fusion images (C) using FDG in head and neck regions showing identifications of the exact location (arrowhead) of the lymph node, which is suspected as the lymph node metastasis (arrowhead in B) using X-ray CT scanning (A) and PET image (B) in a 79-year-old male with a left tongue squamous cell carcinoma.
The normal anatomy of the oral and maxillofacial regions including the neck is very complex, and it is difficult to identify the exact location of tissues with abnormal findings, due to the low resolution of current PET machines. However, PET can be combined with CT scanning of the head and neck to increase the accuracy (89-97%) compared to X-ray CT scanning alone (69-75%) [107]. Therefore, by combining PET with computed tomography (CT), the diagnostic accuracy in head and neck regions can be increased. In particular, PET/CT allows the locations of metastatic lymph nodes to be more exactly and easily determined. Figure 20 shows that PET/CT can be used to diagnose lymph node metastases and identify their location when they have been identified as suspicious of lymph node metastases on X-ray CT scanning and ultrasonography. However, some studies of the use of FDG-PET or PET/CT for the evaluation of neoplasms and lymph nodes metastases in oral cancers have not been favorable [108-113]. In about 5-10% of patients, PET and PET/CT yielded false-positive results for cervical metastases, due to the presence of inflammatory cells that also have increased glucose metabolism, as discussed above. Figure 21 shows representative false-negative results in patients with oral cancers. In one case, the lymph node was diagnosed as metastasis-negative based on X-ray CT scanning and MR images, but metastasis-positive using ultrasonography. Therefore, FDG-PET/CT imaging was performed. The lymph nodes showed high FDG uptake, and the SUV was 3.0-3.5 [103,114]. However, after neck resection surgery, it was found that the lymph node did not have any metastases. Thus, the advantages and limitations of PET and PET/CT imaging need to be clearly understood. In particular, a high FDG uptake, such as an SUV over 3.5, does not necessarily imply that the lesion is neoplastic.
New Diagnostic Imaging Modalities for Oral Cancers
145
Figure 21. The representative case regarded as the result of false-positive results using a PET image with FDG in an 89-years-old female with squamous cell carcinomas of a right tongue. It is very difficult for the lymph node (arrowhead) in superior internal jugular chain to diagnose metastasis or not using Xray CT scanning (A) and MR images (B). Therefore, the lymph node (arrowhead) on an additional FDG PET imaging (C) is shown as high FDG uptake, and SUV also is 3.8. We diagnosed the lymph node as metastasis. However, the result was metastasis negative after neck resection surgery.
CONCLUSION This article has reviewed the commonly used and newly introduced imaging modalities that are used to evaluate oral cancers and their metastases to lymph nodes. Imaging is advancing very rapidly in both medicine and dentistry. Therefore, the accuracy of detecting oral cancers and of lymph node metastases using modern modalities is also continuing to improve. In this review article, MDCT, new MR imaging techniques, and PET-CT have been discussed as particularly noteworthy. Two particular applications of MR imaging, which are routinely performed in our hospital, were discussed: dynamic MR sialography, which can be used as a follow-up examination method for patients with xerostomia; and the production of fusion images between tumors and vessels using 3D-FASE and MR angiography. Finally, we reviewed the uses and limitations of PET-CT based on the literature and our dental hospital’s cases.
REFERENCES [1]
[2] [3]
Weber AL, Romo L, Hashmi S. Malignant tumors of the oral cavity and oropharynx: clinical, pathologic, and radiologic evaluation. Neuroimag Clin N Am 2003; 13: 443464. Som PM, Curtin HD edited. Head and Neck Imaging, 4th edition. St. Louis; Mosby 2003. Kujan O, Glenny AM, Duxbury AJ, Thakker N, Sloan P. Cochrane Database Syst Rev. 2003; 4: CD004150.
146 [4] [5] [6]
[7]
[8] [9]
[10] [11] [12] [13]
[14] [15] [16]
[17]
[18]
[19] [20]
[21]
Yasuhiro Morimoto, Tatsurou Tanaka, Izumi Yoshioka et al. Simon LL, Rubinstein DR. Imaging of oral cancer. Otolaryngol Clin N Am 2006; 39: 307-317. Harnsberger, editors. Diagnostic imaging head and neck, 1st Edition. Salt Lake City, Utah, Amirsys 2004. Michael AS Michael AS, Mafee MF, Valvassori GE, Tan WS. Dynamic computed tomography of the head and neck: differential diagnostic value. Radiology 1985; 154: 413-419. Wakasa Wakasa T, Higuchi Y, Hisatomi M, Aiga H, Honda Y, Kishi K. Application of dynamic CT for various diseases in the oral and maxillofacial region Eur J Radiol 2002; 44: 10-15. Yerli H, Teksam M, Aydin E, Coskun M, Ozdemir H, Agidere AM. Basal cell adenoma of the parotid gland: dynamic CT and MRI findings. Br J Radiol 2005; 78: 642-645. Cummings BJ. Radiation therapy and treatment of the cervical lymph nodes. In: Cummings CW, Fredrickson JM, Harker LA, editors. Otolarynbology head and neck surgery. 2nd Edition, Vol 2 St. Louis, Mo: Mosby-Year Book, 1993, pp 1626-1648. Johnson JT. A surgeon looks at cervical lymph nodes. Radiology 1990; 175: 607-610. Spiro RH. The management of neck nodes in head and neck cancer: a surgeon’s view. Bull NY Acad Med 1985; 61: 629-937. Batsakis JG. Tumor of the head and neck. clinical and pathological considerations, 2nd Edition. Baltimore, Md: Willimams & Wilkins, 1979. Kuisk H. Development, structure, and function of the lymphatic system. In: Kusik H, editor. Technique of lymphography and principles of interpretation. St Louis, Mo: Green, 1971; pp 5-14. Som PM. Update on imaging metastatic cervical lymph node: criteria and differential diagnosis. Am J Roentgenol 1992; 158: 961-969. Dooms GC, Hricak H, Crooks LE, Higgins CB. Magnetic resonance imaging of the lymph nodes: comparison with CT. Radiology 1984; 153: 719-728. Friedman M, Shelton VK, Mafee M, Bellity P, Grybauskas V, Skolnik E. Metastatic neck disease: evaluation by computed tomography. Arch Otolaryngol 1984; 110: 443447. Stevens MH, Harnsberger HR, Mancuso AA, Davis RK, Johnson LP, Parkin JL. Computed tomography of cervical lymph nodes: staging and management of head and neck cancer. Arch Otolaryngol 1985; 111: 735-739. Close LG, Merkel M, Vuitch MF, Reisch J, Schaefer SD. Computed tomographic evaluation of regional lymph node involvement in cancer of the oral cavity and oropharynx. Head and Neck 1989; 11: 309-317. Mancuso AA, Maceri D, Rice D, Hanafee W. CT of cervical lymph node cancer. Am J Roentgenol 1981; 136: 381-385. Feinmesser R, Freeman JL, Nojek AM. Metastaic neck disease: a clinical/radiographic/pathologic correlative study. Arch Otolaryngol 1987; 113: 13071310. Som PM. Lymph nodes of the neck. Radiology 1987; 165: 593-600.
New Diagnostic Imaging Modalities for Oral Cancers
147
[22] Yousem DM, Som PM, Hackney DB, Schwaibold F, Hendrix RA. Central nodal necrosis and extra capsular neoplastic spread in cervical lymph nodes: MR imaging versus CT. Radiology 1992; 182: 753-759. [23] Snow GB, Annyas AA, van Slooten EA, Bartelink H, Hart AA. Prognostic factors of neck node metastasis. Clin Otolaryngol 1982; 7: 185-192. [24] Morimoto Y, Kurokawa H, Tanaka T, Yamashita Y, Kito S, Okabe S, Takahashi T, Ohba T: Correlation between the incidence of central nodal necrosis in cervical lymph node metastasis and the extent of differentiation in oral squamous cell carcinoma. Dentomaxillofac Radiol 2006; 35: 18-23. [25] Misch KA, Yi ES, Sarment P. Accuracy of cone beam computed tomography for periodontal defect measurements. J Periodontol 2006; 77: 1261-1266. [26] Nair MK and Nair UP. Digital and advanced imaging in endodontics: a review J Endod 2007; 3: 1-6. [27] Lofthag-Hansen S, Huumonen S, Grondahl K, Grondahl HG. Limited cone-beam CT and intraoral radiography for the diagnosis of periapical pathology. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2007; 103: 114-119. [28] Schuknecht B. Latest techniques in head and neck CT angiography. Neuroradiology 2004; 46 Suppl 2: s208-213. [29] Stuhlfaut JW, Barest G, Sakai O, Lucey B, Soto JA. Impact of MDCT angiography on the use of catheter angiography for the assessment of cervical arterial injury after blunt or penetrating trauma. AJR Am J Roentgenol 2005; 185: 1063-1068. [30] Tanaka T, Morimoto Y, Masumi S, Tominaga K, Ohba T. Utility of frequency-selective fat saturation T2-weighted MR images for the detection of joint effusion in the temporomandibular joint. Dentomaxillofac Radiol 2002; 31: 305-312. [31] Mirowitz SA, Apicella P, Reinus WR, Hammerman AM. MR imaging of bone marrow lesions: relative conspicuousness on T1-weighted, fat-suppressed T2-weighted, and STIR images. AJR 1994; 162: 215-221. [32] Graif M, Pennock JM, Pringle J et al. Magnetic resonance imaging: comparison of four pulse sequences in assessing primary bone tumours. Skeletal Radiol 1989; 18: 439-444. [33] Harned EM, Mitchell DG, Burk DL Jr, Vinitski S, Rifkin MD. Bone marrow findings on magnetic resonance images of the knee: accentuation by fat suppression. Magn Reson Imag 1990; 8: 27-31. [34] Takashima S, Noguchi Y, Okumura T, Aruga H, Kobayashi T. Dynamic MR imaging in the head and neck. Radiology 1993; 189: 813-821. [35] Asaumi J, Shigehara H, Konouchi H, Yanagi Y, Hisatomi M, Matsuzaki H, Kishi K. Assessment of carcinoma in the sublingual region based on magnetic resonance imaging Oncol Rep 2002; 9: 1283-1287. [36] Ueda F, Suzuki M, Matsui O, Minato H, Furukawa M, MR findings of nine cases of palatal tumor. Magn Reson Med Sci 2005; 4: 61-67. [37] Arakawa A, Tsuruta J, Nishimura R, Sakamoto Y, Korogi Y, Baba Y, Furusawa M, Ishimuaru Y, Uji Y, Taen A, Ishikawa T, Takahashi M. MR imaging of lingual carcinoma: comparison with surgical staging. Radiat Med 1996; 14: 25-29.
148
Yasuhiro Morimoto, Tatsurou Tanaka, Izumi Yoshioka et al.
[38] Murakami R, Baba Y, Nishimura R, Baba T, Nakaura T, Ishikawa T, Takahashi M. MR imaging of squamous cell carcinoma of the floor of the mouth. Appearance of the sublingual and submandibular glands. Acta Radiol. 1999; 40: 276-281. [39] Tomura N, Watanabe O, kato K, Takahashi S, Watarai J, Sageshima M, Yokomizo M. Irradiated carcinoma of the tongue: correlation of MR imaging findings with pathology. AJR Am J Roentgenol. 2002; 178: 705-710. [40] Shah GV, Fischbein NJ, Gandhi D, Mukherji SK, Dynamic contrast-enhanced MR imaging Top Magn Reson Imaging. 2004; 15: 71-77. [41] Shah GV, Fischbein NJ, Patel R, Mukherji SK. Newer MR imaging techniques for head and neck. Magn Reson Imaging Clin N Am. 2003; 11: 449-469. [42] Fischbein NJ, Noworolski SM, Henry RG, Kaplan MJ, Dillon WP, Nelson SJ. Assessment of metastatic cervical adenopathy using dynamic contrast-enhanced MR imaging. AJNR Am J Neuroradiol 2003; 24: 301-311. [43] Noworolski SM, Fischbein NJ, Kaplan MJ, Lu Y, Nelson SJ, Carvajal L, Henry RG. Challenges in dynamic contrast-enhanced MRI imaging of cervical lymph nodes to detect metastatic disease. J Magn Reson Imaging 2003; 17: 455-462. [44] Asaumi J, Yanagi Y, Hisatomi M, Matsuzaki H, Konouchi H, Kishi K. The value of dynamic contrast-enhanced MRI in diagnosis of malignant lymphoma of the head and neck. Eur J Radiol 2003; 48: 183-187. [45] Nason RW, Torchia MG, Morales CM, Thliveris J. Dynamic MR lymphangiography and carbon dye for sentinel lymph node detection: a solution for sentinel lymph node biopsy in mucosal head and neck cancer. Head Neck 2005; 27: 333-338. [46] Vandecaveye V, De Keyzer F, Nuyts S, Deraedt K, Dirix P, Hamaekers P, Vander Poorten V, Delaere P, Hermans R. Detection of head and neck squamous cell carcinoma with diffusion weighted mri after (chemo)radiotherapy: Correlation between radiologic and histopathologic findings. Int J Radiat Oncol Biol Phys 2006 (in press). [47] Ng SH, Ko SF, Toh CH, Chen YL. Imaging of neck metases. Chang Gung Med J 2006; 29: 119-129. [48] Abdel Razek AA, Soliman NY, Elkhamary S, Alsharaway MK, Tawfik A. Role of diffusion-weighted MR imaging in cervical lymphadenopathy. Eur Radiol 2006; 16: 1468-1477. [49] Sumi M, Van Cauteren M, Nakamura T. MR microimaging of benign and malignant nodes in the neck. AJR Am J Roentgenol. 2006; 186: 749-757. [50] Takahara T, Imai Y, Yamashita T, Yasuda S, Nasu S, Van Cauteren M. Diffusion weighted whole body imaging with background body signal suppression (DWIBS): technical improvement using free breathing, STIR and high resolution 3D display. Radiat Med 2004; 22: 275-282. [51] Sumi M, Sakihama N, Sumi T, Morikawa M, Uetani M, Kabasawa H, Shigeno K, Hayashi K, Takahashi H, Nakamura T. Discrimination of metastatic cervical lymph nodes with diffusion-weighted MR imaging in patients with head and neck cancer. AJNR Am J Neuroradiol 2003; 24: 1627-1634. [52] Mack MG, Balzer JO, Straub R, Eichler K, Vogl TJ. Superparamagnetic iron oxideenhanced MR imaging of head and neck lymph nodes. Radiology 2002, 222; 239-244.
New Diagnostic Imaging Modalities for Oral Cancers
149
[53] Sigal R, Vogl T, Casselman J, Moulin G, Veillon F, Hermans R, Dubrulle F, Viala J, Bosq J, Mack M, Depondt M, Mattelaer C, Petit P, Champsaur P, Riehm S, Dadashitazehozi Y, de Jaegere T, Marchal G, Chevalier D, Lemaitre L, Kubiak C, Helmberger R, Halimi P. Lymph node metastases from head and neck squamous cell carcinoma: MR imaging with ultrasmall superparamagnetic iron oxide particles (Sinerem MR) -- results of a phase-III multicenter clinical trial. Eur Radiolo 2002; 12: 1104-13. [54] Morimoto Y, Ono K, Tanaka T, Kito S, Inoue H, Shinohara Y, Yokota M, Inenaga K, Ohba T: The functional evaluation of salivary glands using dynamic MR sialography following citric acid stimulation: a preliminary study. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 100: 357-364, 2005. [55] Morimoto Y, Habu M, Tomoyose T, Ono K, Tanaka T, Yoshioka I, Tominaga K, Yamashita Y, Ansai T, Kito S, Okabe S, Takahashi T, Takehara T, Fukuda J, Inenaga K, Ohba T: Dynamic MR sialography as a new diagnostic technique for patients with Sjögren syndrome. Oral Dis 12: 408-414, 2006. [56] Tanaka T, Ono K, Habu M, Inoue H, Tominaga K, Okabe S, Kito S, Yokota M, Fukuda J, Inenaga K, Morimoto Y: Functional evaluations of the parotid and submandibular glands using dynamic MR sialography. Dentomaxillofac Radiol (in press) [57] Tanaka T, Morimoto Y, Takano H, Tominaga K, Kito S, Okabe S, Takahashi T, Fukuda J, Ohba T: Three-dimensional identification of hemangiomas and feeding arteries in the head and neck region using combined phase-contrast MR angiography and fast asymmetric spin-echo sequences. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 100: 609-613, 2005. [58] Tanaka T, Morimoto Y, Shiiba S, Sakamoto E, Kito S, Matsufuji Y, Nakanishi O, Ohba T: Utility of magnetic resonance cisternography using three-dimensional fast asymmetric spin-echo sequences with multiplanar reconstruction: The evaluation of sites of neurovascular compression of the trigeminal nerve. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2005; 100: 215-225. [59] Yuasa K, Kawazu T, Kunitake N, Uehara S, Omagari J, Yoshiura K, Nakayama E, Kanda S. Sonography for the detection of cervical lymph node metastases among patients with tongue cancer: criteria for early detection and assessment of follow-up examination intervals. AJNR Am J Neuroradiol 2000; 21: 1127-1132. [60] Gritzmann N, Hollerweger A, Macheiner P, Rettenbacher T. Sonography of soft tissue masses of the neck. J Clin Ultrasound 2002; 30: 356-373. [61] van den Brekel MW, Castelijns JA. What the clinician wants to know: surgical perspective and ultrasound for lymph node imaging of the neck. Cancer Imaging. 2005; 5 Spec No A: S41-49. [62] Koischwitz D, and Gritzmann N. Ultrasound of the neck. Radiol Clin North Am. 2000; 38: 1029-1045. [63] Hayashi T, Ito J, Taira S, Katsura K, Shingaki S, Hoshina H. The clinical significance of follow-up sonography in the detection of cervical lymph node metastases in patients with stage I or II squamous cell carcinoma of the tongue. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2003; 96: 112-117.
150
Yasuhiro Morimoto, Tatsurou Tanaka, Izumi Yoshioka et al.
[64] Sumi M, Ohka M, Nakamura T. Comparison of sonography and CT for differentiating benign from malignant cervical lymph nodes in patients with squamous cell carcinoma of the head and neck. AJR Am J Roentgenol 2001; 176: 1019-1024. [65] Yonetsu K, Sumi M, Izumi M, Ohki M, Eida S, Nakamura T. Contribution of doppler sonography blood flow information to the diagnosis of metastatic cervical nodes in patients with head and neck cancer: assessment in relation to anatomic levels of the neck. AJNR Am J Neuroradiol 2001; 22: 163-169. [66] Chikui T, Yuasa K, Tokumori K, kanda S, Kunitake N, Nakamura K, Nagata T, Hiraki A. Change of sonographic findings on cervical lymph nodes before and after preoperative radiotherapy. Eur Radiol 2004; 14: 1255-1262. [67] Chikui K, Yuasa K, Maemura S, Kanda S. Change of angiostructure and hemodynamics in lymph node metastases in rabbits. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2002; 93: 350-357. [68] Ariji Y, Kimura Y, Hayashi N, Onitsuka T, Yonetsu K, Hayashi K, Ariji E, Kobayashi T, Nakamura T. Power Doppler sonography of cervical lymph nodes in patients with head and neck cancer. AJNR Am J Neuroradiol 1998; 19: 303-307. [69] Yamashita Y, Kurokawa H, Takeda S, Fukuyama H, Takahashi T. Preoperative histologic assessment of head and neck lesions using cutting needle biopsy. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2002; 93: 528-533. [70] Atula TS, Grenman R, Varpula MJ, Kurki TJ, Klemi PJ. Palpation, ultrasound, and ultrasound-guided fine-needle aspiration cytology in the assessment of cervical lymph node status in head and neck cancer patients. Head and Neck 1996; 18: 545-551. [71] Elvin A, Sundstrom C, Larsson SG, Lindgren PG. Ultrasound-guided 1.2-mm cuttingneedle biopsies of head and neck tumours. Acta Radiol 1997; 38: 376-380. [72] Bearcroft PW, Berman LH, Grant J. The use of ultrasound-guided cutting-needle biopsy in the neck. Clin Radiol 1995; 50: 690-695. [73] Screaton NJ, Berman LH, Grant JW. Head and neck lymphadenopathy: evaluation with US-guided cutting-needle biopsy. Radiology 2002; 224: 75-81. [74] Cheung YC, Wan YL, Lui KW, Lee KF. Sonographically guided core-needle biopsy in the diagnosis of superficial lymphadenopathy. J Clin Ultrasound 2000; 28: 283-289. [75] Liu JC, Chiou HJ, Chen WM, Chou YH, Chen TH, Chen W, Yen CC, Chiu SY, Chang CY. Sonographically guided core needle biopsy of soft tissue neoplasms. J Clin Ultrasound 2004; 32: 294-298. [76] Soudack M, Nachtigal A, Vladovski E, Brook O, Gaitini D. Sonographically guided percutaneous needle biopsy of soft tissue masses with histopathologic correlation. J Ultrasound Med 2006; 25: 1271-1277. [77] Howlett DC, Menezes LJ, Lewis K, Moody AB, Violris N, Williams MD. Sonographically guided core biopsy of a parotid mass. AJR Am J Roentgenol 2007; 188: 223-227. [78] Wan YL, Chan SC, Chen YL, Cheung YC, Lui KW, Wong HF, Hsueh C, See LC. Ultrasonography-guided core-needle biopsy of parotid gland masses. AJNR Am J Neuroradiol 2004; 25: 1608-1612.
New Diagnostic Imaging Modalities for Oral Cancers
151
[79] Al-Khafaji BM, Nestok BR, Katz RL. Fine-needle aspiration of 154 parotid masses with histologic correlation: ten-year experience at the University of Texas M. D. Anderson Cancer Center. Cancer, 1998; 84: 153-159. [80] Harvey JN, Parker D, De P, Shrimali RK, Otter M. Sonographically guided core biopsy in the assessment of thyroid nodules. J Clin Ultrasound 2005; 33: 57-62. [81] Screaton NJ, Berman LH, Grant JW. US-guided core-needle biopsy of the thyroid gland. Radiology 2003; 226: 827-832. [82] Tu AS, Geyer CA, Mancall AC, Baker RA. The buccal space: a doorway for percutaneous CT-guided biopsy of the parapharyngeal region. AJNR Am J Neuroradiol 1998; 19: 728-731. [83] Issakov J, Flusser G, Kollender Y, Merimsky O, Lifschitz-Mercer B, Meller I. Computed tomography-guided core needle biopsy for bone and soft tissue tumors. Isr Med Assoc J 2003; 5: 28-30. [84] Altuntas AO, Slavin J, Smith PJ, Schlict SM, Powell GJ, Ngan S, Toner G, Choong PF. Accuracy of computed tomography guided core needle biopsy of musculoskeletal tumours. ANZ J Surg 2005; 75: 187-191. [85] Luciani A, Itti E, Rahmouni A, Meignan M, Clement O. Lymph node imaging: basic principles. Eur J Radiol. 2006; 58: 338-344. [86] Kariniemi J, Blanco Sequeiros R, Ojala R, Tervonen O. MRI-guided abdominal biopsy in a 0.23-T open-configuration MRI system. Eur Radiol, 2005; 15: 1256-1262. [87] Merkle EM, Lewin JS, Aschoff AJ, Stepnick DW, Duerk JL, Lanzieri CF, Strauss M. Percutaneous magnetic resonance image-guided biopsy and aspiration in the head and neck. Laryngoscope 2000; 110: 382-385. [88] Kacl GM, Caris FR, Moll C, Debatin JF. Interactive MR-guided biopsies of maxillary and skull-base lesions in an open-MR system: first clinical results. Eur Radiol, 1999; 9: 487-492. [89] Helbig M. Intraoperative B-mode endosonography of tongue carcinoma. Head Neck. 2001; 23: 233-237. [90] Byers RM, El-Naggar AK, Lee YY, Rao B, Fornage B, Terry NH, Sample D, Hankins P, Smith TL, Wolf PJ. Can we detect or predict the presence of occult nodal metastases in patients with squamous carcinoma of the oral tongue? Head Neck. 1998; 20: 138144. [91] Kurokawa H, Hirashima S, Morimoto Y, Yamashita Y, Tominaga K, Takamori K, Igawa K, Takahashi T, Fukuda J: Preoperative ultrasound assessment of tumour thickness in tongue carcinomas. Asian J Oral Maxillofac Surg 2005; 17: 162-167. [92] Ikezoe J, Nakanishi K, Morimoto S, Takashima S, Inoue T, Masaki N, Kozuka T. Sonographic staging of cancer of the mobile tongue. Acta Radiol 1991; 32: 6-8. [93] Narayana HM, Panda NK, Mann SB, Katariya S, Vasishta RK. Ultrasound versus physical examination in staging carcinoma of the mobile tongue. J Laryngol Otol 1996; 110: 43-47. [94] Shintani S, Yoshihama Y, Ueyama Y, Terakado N, Kamei S, Fijimoto Y, Hasegawa Y, Matsuura H, Matsumura T. The usefulness of intraoral ultrasonography in the evaluation of oral cancer. Int J Oral Maxillofac Surg 2001; 30: 139-143.
152
Yasuhiro Morimoto, Tatsurou Tanaka, Izumi Yoshioka et al.
[95] Tominaga K, Yamamoto K, Khanal A, Morimoto Y, Tanaka T, Kodama M, Fukuda J: Intraoperative surgical clearance conformation of tongue carcinomas using ultrasonography. Dentomaxillofac Radiol (in press) [96] Bogsrud TV and Lowe VJ, Applied Radiology online, Volume: 35 Number: 6 June 2006. [97] Fischbein NJ, AAssar OS, Caouto GR, Kaplan MJ, Singer MI, Prince DC, Dillon WP, Hawkins RA. Clinical utility of positron emission tomography with 18Ffluorodeoxyglucose in detecting residual/recurrent squamous cell carcinoma of the head and neck. AJNR Am J Neuroradiol 1998; 19: 1189-1196. [98] Kubota K, Yokoyama J, Yamaguchi K, Ono S, Qureshy A, Itoh M, Fukuda H. FDGPET delayed imaging for the detection of head and neck cancer recurrence after radiochemotherapy: comparison with MRI/CT. Eur J Nucl Med Mol Imaging 2004; 31: 590595. [99] Farber LA, Benard F, Machtay M, Smith RJ, Weber RS, Weinstein GS, Chalian AA, Alavi A, Rosenthal DI. Detection of recurrent head and neck squamous cell carcinomas after radiation therapy with 2-18F-fluoro-2-deoxy-D-glucose positron emission tomography. Laryngoscope 1999; 109: 970-975. [100] Kowalsky RJ, Falen SW, eds. Radiopharmaceuticals in Nuclear Pharmacy and Nuclear Medicine. 2nd ed. Washington DC: American Pharmacists Association. 2004. [101] Zhuang H, Alavi A. 18-fluorodeoxyglucose positron emission tomographic imaging in the detection and monitoring of infection and inflammation. Semin Nucl Med 2002; 32: 47-59. [102] Shreve PD, Bui CDH. Normal variants in FDG PET imaging. In: Wahl RL, ed. Principles and Practice of Positron Emission Tomography. Philadelphia, PA: Lippincott Williams & Wilkins; 2002:111-136. [103] Roh JL, Ryu CH, Choi SH, Kim JS, Lee JH, Cho KJ, Nam SY, Kim SY. Clinical Utility of 18F-FDG PET for Patients with Salivary Gland Malignancies. J Nucl Med. 2007; 48: 240-246. [104] Hamblen SM, Lowe VJ. Clinical 18F-FDG oncology patient preparation techniques. J Nucl Med Technol.2003; 31: 3-7. [105] Teknos TN, Rosenthal EL, Lee D, Tayor R, Marn CD. Positron emission tomography in the evaluation of stage III and IV head and neck cancer. Head Neck 2001; 23: 10561060. [106] Schwartz DL, Rajendran J, Tueh B, Coltrera M, Anzai Y, Krohn K, Eary J. Staging of head and neck squamous cell cancer with extended-field FDG-PET. Arch Otolaryngol Head Neck Surg 2003; 129: 1173-1178. [107] Fukui MB, Blodgett TM, Meltzer CC. PET/CT imaging in recurrent head and neck cancer. Semin Ultrasound CT MRI 2003; 24: 157-163. [108] Roh JL, Yeo NK, Kim JS, Lee JH, Cho KJ, Choi SH, Nam SY, Kim SY. Utility of 2[(18)F] fluoro-2-deoxy-d-glucose positron emission tomography and positron emission tomography/computed tomography imaging in the preoperative staging of head and neck squamous cell carcinoma. Oral Oncol 2007 (in press).
New Diagnostic Imaging Modalities for Oral Cancers
153
[109] Paul SA, Stoeckli SJ, von Schulthess GK, Goerres GW. FDG PET and PET/CT for the detection of the primary tumour in patients with cervical non-squamous cell carcinoma metastasis of an unknown primary. Eur Arch Otorhinolaryngol 2007; 264: 189-195. [110] Andrade RS, Heron DE, Degirmenci B, Filho PA, Branstetter BF, Seethala RR, Ferris RL, Avril N. Posttreatment assessment of response using FDG-PET/CT for patients treated with definitive radiation therapy for head and neck cancers. Int J Radiat Oncol Biol Phys 2006; 65: 1315-1322. [111] Fanti S, Fanti S, Franchi R, Battista G, Monetti N, Canini R. PET and PET-CT. State of the art and future prospects. Radiol Med (Torino) 2005; 110: 1-15. [112] Menda Y and Graham MM. Update on 18F-fluorodeoxyglucose/positron emission tomography and positron emission tomography/computed tomography imaging of squamous head and neck cancers. Semin Nucl Med 2005; 35: 214-219. [113] Schwartz DL, Ford E, Rajendran J, Yueh B, Coltrera MD, Virgin J, Anzai Y, Haynor D, Lewellyn B, Mattes D, Meyer J, Phillips M, Leblanc M, Kinahan P, Krohn K, Eary J, Laramore GE. FDG-PET/CT imaging for preradiotherapy staging of head-and-neck squamous cell carcinoma. Int J Radiat Oncol Biol Phys 2005; 61: 129-136. [114] Lobrano MB, Hayman E, Dekelbaum M, Campeau R. Biopsy findings in PET/CTpositive lung lesions in a community hospital. J La State Med Soc 2005; 157: 319-324.
In: Oral Cancer Research Advances Editor: Alexios P. Nikolakakos, pp. 155-181
ISBN 978-1-60021-864-4 © 2007 Nova Science Publishers, Inc.
Chapter 6
THE ROLE OF THE PERCUTANEOUS ENDOSCOPIC GASTROSTOMY IN THE MANAGEMENT OF HEAD AND NECK MALIGNANCY CME Avery University Hospitals of Leicester, Leicester, UK.
ABSTRACT This chapter reviews the role of the percutaneous endoscopic gastrostomy (PEG) for providing nutritional support in the management of oral cancer. An assessment of the current use of the PEG technique is based on an analysis of the prospective operating series of the author. Insertion of a PEG was attempted on 200 occasions, mainly for malignancy of the oral cavity but also the oropharynx, and some benign pathology and trauma. Seventy-six percent (152/200) of gastrostomies were inserted at the time of definitive surgical treatment and 19.5% (39/200) were inserted at an examination under anaesthesia, often prior to radiotherapy. Five percent (10/200) of procedures had significant endoscopic findings including one synchronous malignancy. The rate of successful insertion was 97% (194/200). The incidence of minor and major complications was 12.5% (25/200) and 3% (6/200) respectively. There was no procedure related mortality. The overall 30-day mortality rate was 7% (10/200) including deaths from terminal disease. Those at increased risk of death were 65 years and over (P=0.005). The median PEG duration was 287 (SE 37) days. Duration was significantly longer for stage T3-4 tumours (P=0.01), N1 or greater neck disease (P=0.02), following surgery with radiotherapy when compared to surgery alone (P<0.001), particularly for hemiglossectomy (P=0.02) and maxillectomy procedures (P=0.003), following a segmental composite bone resection rather than a soft tissue resection, with or without a rim resection, (P=0.03) and finally radiotherapy alone when compared to surgery alone (P=0.004). There was no obvious relationship to age or the
CME Avery
156
type of free flap. Four (2.1%) patients have a gastrostomy that is likely to be permanent. Only two patients did not use the gastrostomy. All patients with T3 and T4 oropharyngeal tumours undergoing radiotherapy or with oral tumours that required reconstruction with a free or pedicled flap were offered a PEG on the basis that nutritional support would be required for more than 2 to 4 weeks. This included T2 tumours without neck disease (stage II disease) if the site of the tumour is likely to have a significant effect on function and hence a flap reconstruction is indicated. The policy of early gastrostomy placement appears to be appropriate. However, the exact pattern of use of the gastrostomy during the various phases of treatment remains to be defined. The insertion of a PEG may be safely performed with a high degree of success and a low incidence of complications by an experienced maxillofacial surgeon.
INTRODUCTION The technique of percutaneous endoscopic gastrostomy (PEG) was first described by Gauderer [1] and Ponsky [2]. It was used in the management of children and adults to create a gastrocutaneous fistula without the need for a laparotomy. Originally intended as a method of delivering long-term enteral nutrition it has since been employed in an increasingly wide of conditions for the provision of temporary nutritional support [3]. The most common indications are neurological disorders, head and neck malignancy, severe facial or head trauma and gastrointestinal decompression [4]. Cancer Patient
GI Tract Patent
Undergoing antineoplastic tx and moderate/severe malnutrition
Offer PEG placement if long-term tx anticipated >4 weeks and intact GI tract
Figure 1. Based on Rabeneck 1997.
GI Tract Not Patent
Anticipated life span >6 - 8 weeks (and unable to place stent)
If life span anticipated <6 - 8 weeks
Can offer PEG for decompression
Do not offer PEG Placement
Advanced cancer with severe malnutrition and life expectancy <2months (cancer cachexia)
Advanced cancer unresponsive to chemo/radiation therapy /steady deterioration of performance with severe malnutrition anticipated life span >2 months
Do not offer PEG Placement
Do not offer PEG Placement
The Role of the Percutaneous Endoscopic Gastrostomy…
157
A PEG is often the method of choice for the enteral feeding of patients with head and neck malignancy. It was initially used mainly with end-stage disease [5,6] but is now more commonly inserted whenever nutritional support is required for more than 2 to 4 weeks. The indications include painful or ineffective mastication or swallowing, oropharyngeal and oesophageal obstruction, or supplemental nutrition after surgery and during chemotherapy and radiotherapy. The ethical issues surrounding insertion of a gastrostomy, particularly when an illness may be in the terminal phase, has been reviewed [7,8] and an algorithm for assisting in the decision-making process published [7]. A PEG should only be inserted for patients likely to derive physiological benefit from nutritional supplementation and respond to cancer treatment. It should not be offered when life expectancy is less than two months or no improvement in the quality of life may be expected. If in doubt a trial period with a nasogastric tube may be appropriate. The PEG is commonly inserted by a gastroenterologist [9] or a gastrointestinal or general surgeon [5,10-12]. It is occasionally inserted by a specialist nurse [13], otolaryngologist [1416] or maxillofacial surgeon [17]. A radiologically inserted gastrostomy (RIG) or percutaneous radiologic gastrostomy (PRG) is less commonly inserted [18] using a variety of guidance techniques including fluoroscopy [19-22], computerised tomography and fluoroscopy [23] and ultrasound [24]. The gastrostomy may be performed under local anaesthetic, with or without sedation, or under general anaesthesia. The various methods of gastrostomy insertion, their relative merits and complications have been discussed in excellent review articles by Schapiro [25], Safadi [4] and Mellinger [13]. Most of the literature is composed of retrospective cohort studies. There are few prospective studies of the PEG technique and most deal with the issue of nutritional support for dysphagia after a cerebrovascular accident [21,26-34]. The author is aware of only two retrospective series by a single surgeon managing head and neck cancer patients [5,11]. The influence of tumour site and stage within the oral cavity and the type of surgical treatment has an unpredictable effect upon speech and swallowing function. This chapter reviews the prospective experience of the author with the first 200 PEG procedures performed for mainly oral malignancy.
The “Pull” Technique of PEG Insertion The author used the conventional “pull” technique [35] and the Freka® (Fresenius Kabi Ltd, UK) feeding system with a size 9 FR tube. Antibiotic prophylaxis with 1.5 grams of Cefuroxime was given at induction of general anaesthesia [36-38]. The endoscope was inserted under direct vision to minimise the risk of contact with the tumour or perforation. The latter is more likely to happen in the presence of anterior cervical osteophytes, a pharyngeal pouch or abnormalities of the oesophagus such as a stricture, malignancy or eosinophilic oesophagitis [39]. The upper gastrointestinal tract was examined as far as the proximal duodenum with an Olympus (Keymed Ltd, UK) double-lumen or paediatric size gastroscope. The abdomen was palpated to detect organomegaly prior to insufflation. The oropharynx was thoroughly suctioned. Contact between the equipment and the tumour was avoided by shielding the tumour with a hand. The gastrostomy site was selected with a
158
CME Avery
combination of transillumination and palpation. The most favourable angle for insertion of the trocar created a well-defined indentation of the stomach wall. Indentation is more important than transillumination, which is often unsatisfactory and less reliable [4]. If indentation is equivocal then the “safe tract” technique described by Foutch [40] has been advocated [4,35]. The routine use of all three techniques has recently been advised in guidance issued by the British Society of Gastroenterology [39]. The author uses this technique in the obese or when there has been previous abdominal surgery. A syringe of water is advanced while aspirating. If air enters the syringe before reaching the stomach it has punctured another hollow viscous. If in doubt a RIG should be obtained. A second look gastroscopy was performed and the stomach decompressed. All patients were commenced on an antacid drug and given 30 mls of sterile water per hour overnight, via the PEG. Feeding was usually commenced within 12 to 24 hours of surgery.
METHODS Data was prospectively collected and included; patient details, the stage and site of the tumour, the timing of insertion and removal, duration of procedure, incidental findings, the surgical procedure, administration of radiotherapy with or without chemotherapy and complications. Radiotherapy, if indicated, was usually given after surgery.
Statistical Analysis Kaplan-Meier survival methods were used to estimate the percentage of cases with a PEG still in place after one year and the median duration. PEG duration was calculated as the number of days from insertion to either (a) removal (b) patient death with the PEG in place or (c) May 31st 2006. For patients having more than one PEG, but a continuous period of use, the duration was computed from the date of initial insertion. The log-rank test was used to compare PEG duration curves.
RESULTS Insertion of a PEG was attempted on 200 consecutive occasions on a total of 187 patients between May 2000 and May 2006. All patients undergoing major surgery and reconstruction with a free or pedicled flap were offered a PEG on the basis that recovery of oral function was not expected within two to four weeks. Three patients preferred to have a nasogastric tube, of which one subsequently required a PEG during radiotherapy treatment. One additional patient was referred for a RIG because of a previous oesophagectomy. The patient data is tabulated in Table 1. The main indication was malignant disease of the oral cavity. Twelve oncology patients had the PEG replaced either because of a second tumour, recurrent disease or disintegration of the tube, of which 7 had continuous use that ranged from 475 to
The Role of the Percutaneous Endoscopic Gastrostomy…
159
2029 days. Two patients did not use the PEG, of which the first recovered quickly after surgery and the second received only palliative care. Table 1. Patient data and indications for attempted PEG insertion (N=200) Number of patients (n) Male:female Mean age in years (SD)1 Malignant tumour2 Replacement only Facial fractures Benign tumour Severe dysplasia Osteoradionecrosis Secondary reconstruction Neurological deficit 1 2
187 115:72 63 (14) 184 7 3 2 1 1 1 1
Age at time of first PEG for those with more than one PEG; Including second tumour or recurrent disease.
Table 2. PEG insertion procedures (N=200)
Successful PEG insertion Failed PEG insertion At examination under anaesthesia At definitive surgical procedure After definitive surgical procedure During radiotherapy treatment Median duration of procedure in minutes (IQR, range, n) 1 2
% (n) 97 (194) 3 (6) 19.5 (39) 76 (152) 4 (8)1 0.5 (1)2 10 (8-12, 4-21, 197)
Definitive surgery elsewhere (1) and replacement tubes; Initially refused PEG insertion.
Seventy-six percent (152/200) of insertions followed a tracheostomy at the time of definitive surgical treatment and 19.5% (39/200) were at an initial examination under anaesthesia (Table 2). The median procedure time was 10 minutes. The rate of successful insertion was 97% (194/200). One patient had a successful insertion at the second attempt, with a paediatric gastroscope, because of an oesophageal stricture. A RIG was obtained for 2 patients because of a post-cricoid web and morbid obesity. Eleven percent (22/200) of patients had incidental endoscopic findings, of which 10 (5%) were significant. This included one malignant oesophageal tumour and a Barrett’s oesophagus (Table 3). The incidence of minor complications was 12.5% (25/200) (Table 4). A clinically detectable infection occurred at 7.5% (15/200) of gastrostomy sites, of which 5 were infected with Methicillin resistant Staphylococcus aureus (MRSA). The incidence of major complications was 3% (6/200). There was no mortality directly related to the PEG procedure.
CME Avery
160
However one elderly patient with a large pneumoperitoneum and phrenic nerve injury succumbed to a chest infection exacerbated by these complications. The overall 30-day mortality rate was 7% (14/200) including deaths from terminal disease. Those at increased risk of death were 65 years and over (13% v 2%, P=0.005). Table 3. Incidental findings during endoscopy (N=200) Incidental finding Post cricoid web Barratt’s oesophagus Oesophageal adenocarcinoma Oesophageal stricture Benign oesophageal lesion biopsy Gastro-oesophageal reflux Hiatus hernia Gastritis Benign gastric ulcer biopsy Retained suture at gastric resection site
(n) 1* 1* 1* 3* 2* 1 1 9 2* 1
* Significant clinical finding.
Table 4. Major and minor complications Major Complications Aspiration Peritonitis Dislodged tube passed per rectum Tube migration into gastric wall Perforation Gastrocolic fistula Haemorrhage Major infection Tumour implantation Large pneumoperitoneum Minor Complications Peristomal wound infection Peristomal bleed Peristomal leakage Tube obstruction or fragmentation Tube migration in to small bowel
(n) 0 0 2 1 0 0 2 0 0 1 15 1 4 5 0
Based on Schapiro 1996.
The PEG durations were analysed with regard to age, stage of disease, type of resection and reconstruction, and modality of treatment (Table 5 and Figure 2). The median duration
The Role of the Percutaneous Endoscopic Gastrostomy…
161
was 287 (SE 37) days. Duration was not significantly different for those less than 65 years of age (P=0.63). It was significantly longer for stage T3-4 tumours (P=0.01), N1 or greater neck disease (P=0.02) and following surgery with radiotherapy when compared to surgery alone (P<0.001) but not when compared to radiotherapy alone (P=0.50). Duration was also significantly longer for radiotherapy alone when compared to surgery alone (P=0.004). The radiotherapy alone group were primarily T3 or T4 oropharyngeal tumours and/or the patient was not fit for surgery. Table 5. Differences in median PEG duration between treatment and operation subgroups Variable
T 1-2 N0 Surgery and radiotherapy Radiotherapy 2 separate surgical procedures and radiotherapy Primarily soft tissue resection
Median (SE) duration of PEG in days 226 (22) 232 (18) 360 (31) 478 (93) 713 (479) 226 (14)
Variable
T 3-4 N1 and greater Surgery Surgery Surgery Primarily composite bone resection
Median (SE) duration of PEG in days 358 (36) 360 (63) 166 (18) 166 (18) 166 (18)
Statistical significance log-rank test P=0.01 P=0.02 P<0.001 P=0.004 P=0.02
358 (29)
P=0.03
Patients receiving additional chemotherapy are included within the radiotherapy group.
100 90 80 Radiotherapy
70
% of PEG
60 50 40
Surgery+Radiotherapy
30 Surgery
20 10 0 0
100
200
300
400
500
PEG duration in days Figure 2. Duration of PEG by modality of treatment.
600
700
800
CME Avery
162
Table 6. Relationship between duration of PEG placement and other factors for oncology patients 2000-2006 (N=183) Nos of cases 93 90 75 100 80 94
% (SE) with PEG after 12 months 41 (5) 39 (8) 34 (6) 47 (7) 49 (7) 34 (7)
Median (SE) duration of PEG in days 252 (51) 307 (43) 226 (22) 358 (36) 360 (63) 232 (18)
95 18 15 11
47 (6) 40 (14) 36 (14) 41(16)
360 (31) 239 (9) 337 (24) 212 (30)
6 12 12 6
50 (25) 47 (15) 58 (16) 67 (19)
257 (225) 308 (119) 713 (352) 503 (143)
Retromolar +/- rim resection Multiple sites of resection
3 6
60 (22)
91 -
Other resections
6
80 (18)
-
Two separate surgical procedures and radiotherapy Surgery alone Hemiglossectomy Hemimandibulectomy
7
57 (19)
713 (479)
67 27 9
22 (7) 21 (9) -
166 (18) 162 (32) -
Anterior floor of mouth +/- rim resection Anterior mandibulectomy Oropharynx Partial and hemimaxillectomy
11
15(13)
161 (46)
2 3 8
0
176 115 (15)
Buccal resection Retromolar +/- rim resection Radiotherapy (no surgery) By Principle Type of Resection Primarily soft tissue resection Anterior floor of mouth +/- rim Hemiglossectomy Oropharynx Buccal Retromolar +/- rim Primarily composite bone resection Hemimandibulectomy Partial & Hemimaxillectomy Anterior mandibulectomy
4 3 11
69 (19)
211 478 (93)
102 22 45 16 10 6 58 26 21 8
34 (5) 30 (11) 29 (8) 45 (13) 59 (18) 0 44 (9) 42 (14) 43 (14) 42 (22)
226 (14) 173 (30) 219 (14) 308 (93) 503 (147) 211 (131) 358 (29) 337 (31) 357 (106) 257 (183)
Age less than 65 years Age of 65 years and over T1-2 T3-4 N stage 1 or greater disease N0 stage disease By Treatment Modality & Operation Surgery and radiotherapy Hemiglossectomy Hemimandibulectomy Anterior floor of mouth +/- rim resection Anterior mandibulectomy Oropharynx Partial & hemimaxillectomy Buccal resection
Individual PEG durations for when <10 cases
46*, 70*, 74, 257, 262*, 749
281, 360, 475*, 503, 642*, 2029* 25*, 91, 229 232, 246, 358*, 383*, 1016*, 1876* 73*, 164, 210*, 262*, 287*, 507* 134, 176, 246, 475*, 713, 749, 2029*
5*, 7*, 9*, 17*, 28*, 75*, 113*, 286*, 385*
83*, 85 64, 176, 499 6*, 10*, 77, 94*, 98, 112, 155*, 224 55*, 105, 205*, 225* 57, 211, 274
25*, 57, 91, 211, 229, 274
46*, 70*, 74, 83*, 85, 257, 262*, 749
Includes oncology patients with osteoradionecrosis (1), secondary surgery (1) and severe dysplasia (1); Excludes oncology patients with a nasogastric tube (3) and lost to follow-up (1). * PEG in place at death or on 31st May 2006.
The Role of the Percutaneous Endoscopic Gastrostomy…
163
Patients that underwent two separate surgical procedures and radiotherapy had longer durations on average than those having a single surgical procedure (P=0.02) but the duration was similar to those undergoing a single surgical procedure and radiotherapy (P=0.82). The duration following a primarily soft tissue resection, with or without a rim resection, was significantly shorter than after a composite bone resection (P=0.03) (Table 5 and Figure 2). Within the surgery with radiotherapy group and the surgery alone group there was no statistically significant difference (P=0.47) between operation subgroups with at least 6 patients (Table 6). For hemiglossectomy (P=0.02) and maxillectomy procedures (P=0.003) the median duration was significantly longer with surgery and radiotherapy when compared to surgery alone. The limited numbers prevent statistical testing within other subgroups. Four patients that had undergone buccal resection (1), multiple sites of resection (2) and two separate surgical procedures with radiotherapy had a PEG in place for over 1000 days and are unlikely to have it removed. One hundred and sixty patients were reconstructed with a free flap including radial, DCIA, fibula, radial composite, rectus abdominus and latissimus dorsi flaps. There was no obvious relationship between the type of free flap and duration of the PEG.
DISCUSSION Nutritional Considerations Good nutritional status is important to optimise the potential for recovery from illness but is often not achieved and leads to a delay in recovery, an increased incidence of complications and significantly increased costs [41]. Progressive weight loss and malnutrition occurs commonly in the elderly and those with cancer and is a major source of morbidity and mortality [8,42]. Patients who undergo major surgery, particularly those with malignant disease, are at risk of malnutrition due to starvation, the stress of surgery and an increase in metabolic rate. Nutritional support does not prevent weight loss but may significantly reduce the extent of the loss [43]. The nutritional support of the cancer patient has been well reviewed by Rivadeneira [44]. Patients with malignancy of the head and neck region often have underlying nutritional problems because of a history of excessive smoking, poor diet, alcohol abuse [45]. The local effects of the tumour may cause painful mastication and swallowing, and obstruction of the oropharynx or oesophagus [46]. The nutritional status is also compromised by the effects of treatment, particularly radiotherapy, which causes mucositis, xerostomia, altered taste, dysphagia and loss of appetite [47-50]. An increase in survival of adequately nourished, rather than malnourished, patients with head and neck cancer has been claimed [51]. It was speculated that this resulted from an action on the immune system. However, an improved response to tumour treatment has not generally been found, although good nutrition will reduce the incidence of complications, morbidity and mortality [42,49,52-54].
164
CME Avery
The Enteral Route of Nutritional Supplementation Enteral feeding is preferred to parenteral feeding because it preserves the architecture of the gastrointestinal tract and prevents bacterial translocation. The enteral route has fewer complications and is less expensive than intravenous supplementation, which is no longer the method of choice for the treatment of head and neck carcinoma [44,52]. A review of the evidence for enteral tube feeding by the National Collaborating Centre for Acute Care [55] concluded that enteral feeding should be considered for those who are malnourished or at risk of malnutrition and have an inadequate or unsafe oral intake but a functional accessible gastrointestinal tract (Table 7). Table 7. Criteria for malnutrition based on National Collaborating Centre for Acute Care (55)
At risk of malnutrition
Malnutrition
Criteria • have eaten little or nothing for more than 5 days and/or are likely to eat little or nothing for the next 5 days or longer and have a poor absorptive capacity. • and /or have high nutrient losses and/or have increased nutritional needs from causes such as catabolism. • a BMI* less than 18.5 kg/m2 • unintentional weight loss greater than 10% within the last 3 – 6 months or • a BMI* less than 20 kg/m2 and unintentional weight loss of greater than 5% within the last 3 – 6 months.
* Body mass index.
In general enteral tube feeding increased the nutritional intake over and above that with standard care and/or oral supplements. This usually led to an improvement in nutritional status but inconsistent benefit in terms of length of hospital stay or mortality rates. The evidence of benefit related to complications, quality of life, costs and cost-effectiveness was limited. The cost-effectiveness of preoperative enteral nutrition was unclear [55].
The Nasogastric Route Nasogastric (NG) tubes are useful if nutritional support is required for less than two to four weeks. The problems with these tubes are numerous and include; a poor aesthetic appearance and patient dissatisfaction, discomfort, suture line disruption, interference with speech and swallowing function, alar necrosis, sinusitis, replacement with radiological confirmation of position for displacement or tube obstruction, an association with oesophagitis, gastro-oesophageal reflux and aspiration pneumonia [56,57].
The Role of the Percutaneous Endoscopic Gastrostomy…
165
The Gastrostomy Route The percutaneous gastrostomy has largely supplanted the open gastrostomy as the preferred route of access to the functioning gastrointestinal tract [9]. However, the particular surgical approach may vary with referral patterns and local expertise [58,59]. Open surgical gastrostomy has had a comparable morbidity to PEG in small retrospective [60] and prospective studies [61] but often requires a general anaesthetic, may cause more respiratory problems and is more expensive. Wollman et al [9] considered that the procedure took significantly longer to perform and had a significantly higher rate of major complications and 30-day mortality than a PEG or RIG. Complications with a laparoscopic gastrostomy approach may also be comparable [62,63] or higher [59,64].
Comparison of Feeding with the Oral, Nasogastric or Percutanous Gastrostomy Routes The benefit of PEG feeding for long-term nutritional support has been established. The comparison of initial feeding with an NG tube or PEG has been of particular interest in the management of dysphagia after acute stroke. A poor outcome may occur despite early PEG feeding [65]. The largest prospective multi-centre trial concluded that it was very unlikely there was a significant benefit with an early PEG but it was preferred because it was more discrete, comfortable and less easily dislodged than an NG tube. A PEG was recommended if the NG tube was required for more than 2 to 4 weeks or could not be tolerated [31,33,34,55]. However, the initial use of a PEG has been advocated on the basis of prospective studies that have demonstrated significantly increased delivery of feed, greater weight gain and lower mortality [27-29]. However, the improvement in the quality of life, functional, nutritional or subjective health status measures may be limited [29,30] and a PEG places a burden on the patient as well as the carers. There are relatively few studies of this issue in the management of head and neck oncology. Significantly greater weight retention has been demonstrated in prospective studies of early nutritional support with an NG tube [53] or PEG [66,67] rather than the oral route. The PEG may also help to maintain quality of life scores [67] and be the choice of patients [26] but this is not a consistent finding [66]. Magne [68] noted that an NG tube was as effective as a PEG tube in maintaining body weight but the PEG had a lower incidence of aspiration and the advantages of better cosmesis, mobility and quality of life considerations. The PEG also has a role in the rehabilitation of post-surgical or inoperable patients with dysphagia [69]. Gibson [56] retrospectively studied 89 patients with advanced stage III and IV tumours. Hospital stay was up to 61% shorter with a PEG. This finding was statistically significant for tumours of the larynx and pharynx but not the oral cavity. It was speculated that function was better preserved with anterior tongue and floor of mouth tumours but the series only included 15 oral tumours and only 26 defects were reconstructed with either a pedicled or free flap. The extent of the resection and type of reconstruction may be expected to affect function.
166
CME Avery
Mekhail [70] identified hypopharyngeal and stage T4 tumours, female gender and treatment with chemoradiation therapy as factors that predicted the need for a feeding tube. The study of 158 patients only included 4 oral cancers. Patients with a PEG had greater dysphagia at 6 months than those with NG tube. This may have been a selection bias as the duration of NG tube use was significantly shorter, median of 8 and 28 weeks respectively. It was speculated that a PEG stimulated less swallowing effort leading to disuse of the muscles of deglutition with an increased incidence of pharyngeal stenosis and dependency on the PEG.
Contra-Indications to Percutaneous Gastrostomy The absolute contraindications to PEG placement include complete obstruction of the oropharynx or oesophagus, diffuse peritonitis, anorexia nervosa and a significantly limited lifespan. The relative contraindications include significant ascites, peritoneal dialysis, coagulopathy, gastric varices, portal hypertension, large hiatus hernia, hepatomegaly, morbid obesity, subtotal gastrectomy and neoplastic or infiltrative diseases of the gastric or oesophageal walls [4,60,71]. A PEG can often be placed despite marked trismus or partial oropharyngeal obstruction by using a paediatric endoscope or using the manoeuvres of a straight laryngoscope and a nasal or open pharyngeal approach [72]. Previous [73] or recent [74] abdominal surgery does not preclude insertion if the site of puncture is carefully selected. The incidence of failure may be higher after partial gastrectomy and the safe tract technique should be used [40]. With a coagulopathy the platelet count should be greater than 100 X 109/L and the INR less than 1.4 [39]. It is important to try and identify patients that will not benefit from a PEG. The ethical issues surrounding insertion of a gastrostomy particularly when the illness may be in a terminal phase has been reviewed [7,8], and an algorithm developed for assisting in the decision-making process (Figure 1) [7]. A PEG should only be inserted for patients likely to benefit physiologically from nutritional supplementation and respond to cancer treatment. It should not be offered when life expectancy is less than two months or no improvement in the quality of life may be expected. The risk factors for early death in other studies include; age over 75 years, urinary tract infection, diabetes mellitus, cardiac failure, severe functional impairment and dementia [32,75]. There is little information on quality of life considerations [8,75]. In the chronically ill geriatric population with primarily neurological disease there is limited evidence that insertion of a PEG improves nutritional or functional parameters [30] and it should not be inserted for palliative reasons without sufficient justification.
Types of Percutaneous Gastrostomy Technique The various methods of gastrostomy insertion, their relative merits and complications have been reviewed [4,13,25]. In head and neck practice the Push [58] or Pull [76-78] techniques have their advocates based on relatively small comparative reports often with few
The Role of the Percutaneous Endoscopic Gastrostomy…
167
oncology patients. The choice of technique will often depend on the training and personal preference of the surgeon or operator.
Rate of Successful Percutaneous Gastrostomy Placement The earliest large series that included oropharyngeal pathology reported PEG insertion success rates of 95 to 100% [79-82] but rates may be lower with head and neck malignancy [83]. The success rate in the current study of 97% is comparable with a meta-analysis of the gastroenterological literature by Wollman [9] (95.7%) and current head and neck practice (90 to 98.5%) [10,11,14-17,84]. The majority of patients with common gastrointestinal pathology, including partial gastrectomy, were successfully treated. Patients with severe trismus or an oesophageal stricture were managed with a paediatric gastroscope. A RIG was the first choice for a patient with a previous oesophagectomy and was necessary after 2 failed insertions caused by a post-cricoid web and morbid obesity. A PEG may be safely placed with a high degree of success by an appropriately trained otolaryngologist or maxillofacial surgeon [14-17].
The Complication Rates of Percutaneous Gastrostomy The classification and incidence of procedure related complications is variable and largely based on retrospective reports of differing groups of patients, often including a mix of neurological and oropharyngeal malignancy [25]. Schapiro & Edmundowiez [25] reported two reviews with mean incidences of major complications of 2.7% to 2.8% and minor complications of 6% to 7.1%. Wollman et al [9] reported a major complication rate of 9.4% and minor complication rate of 5.9%, with a procedure related mortality of 0.53%. In the recent Guidelines of the British Society of Gastroenterology [39] the incidence of major complications are stated to be 3% with the exact incidence depending on the patient population and generally being higher with malignant disease. The complication rates are similar irrespective of the technique used, whether this is the common Pull (Ponsky) method, the Push (Sachs-Vine) method or the direct introducer (Russell) method [39]. Particular gastrostomy tubes may be associated with a higher incidence of complications [85]. Mortality is closely related to the severity of underlying disease. Cardiopulmonary complications account for about 50% of the potentially serious morbidity and procedure-related deaths associated with endoscopy, often as a result of over sedation of the elderly or at-risk patient. In head and neck surgical practice the incidence of major complications ranges from 0% to 35% and minor complications from 8% to 17.5% [10,11,14-17,84]. The incidence of major complications appears to be higher when the operator is a trainee surgeon or gastroenterologist [12,39,84]. In the experience of the author and Lloyd et al [17] the major complication rate of an experienced maxillofacial surgeon is relatively low, 3.0% and zero respectively. Aspiration and resultant pneumonia remain common major complications [25]. Aspiration may occur during the procedure or later as a result of oropharyngeal aspiration or
168
CME Avery
gastro-oesophageal reflux. The risk of aspiration is not entirely eliminated with a PEG [39, 86]. The supine position during PEG placement and an oropharyngeal tumour may increase the risk of aspiration, especially when the gag reflex is obtunded. The incidence of respiratory distress under intravenous sedation may be as high as 7% [83] to 10% [87]. Airway obstruction occurred in 1% [83] and 2 out of 29 patients with an unsecured airway required an emergency tracheostomy [87]. It has been recommended that sedation or general anaesthesia should be avoided unless the tumour has been removed or the airway secured, sometimes with a tracheostomy, and the PEG performed in theatre [5,10,17,87]. Head and neck surgeons often prefer to take the opportunity to place the PEG either during an initial examination under a general anaesthetic or at the time of definitive surgery when the airway is protected by an endotracheal tube or tracheostomy [15,16]. This may reduce the immediate risk of aspiration or cardio-respiratory complications [10] and avoids an additional separate treatment episode. Enteral feeding may commence as early as three or four hours after insertion in an uncomplicated patient [55,88,89] but is not without risk of aspiration and death [90]. The risk of late aspiration may be reduced by initially keeping the tracheostomy cuff inflated, feeding in an upright or semi-upright position, retaining that position for 30 minutes and later performing aspiration of the residual gastric volume. The author defers feeding after major oncology surgery for twelve hours because gastric emptying is delayed, the airway reflexes are obtunded and evaluation of the abdomen after some free flap procedures is required. Feeding is delayed further if examination of the abdomen is equivocal. Most patients commence feeding within 12 to 24 hours of surgery. Guidance on managing the symptomatic abdomen after PEG placement is available [25,39,55]. Surgeons undertaking the gastrostomy procedure must be familiar with all aspects of patient management from pre-surgical consent through to the detection and management of post-surgical complications. In the current series infection of the stoma site was the commonest minor complication. Specific infections may occur at up to 30% of stoma sites [89]. Infection with MRSA may be increasingly more common [91] but was of no serious consequence in this series. Two patients developed a buried bumper syndrome. This complication occurs after 1.9% of procedures [92] and typically presents as a late event with difficulty flushing and leakage. Excessive tension on the flange has been implicated in this and other major complications [4]. The buried bumper may be removed endoscopically or with a mini-laparotomy approach [92]. The author now has a lower threshold for routine gastroscopy and replacement of a PEG that has been in place for over one year. The 30-day mortality rate after PEG insertion varies with many factors. Janes [75] noted an increasing mortality rate, from 8% to 22%, with greater use of the technique but the procedure-related mortality decreased from 2% to zero. In the meta-analysis by Wollman [9] the mortality rate was 14.7% and in a later report it had fallen to 10% [18]. More recently rates of 4.5% with a PEG and 3.1% with a RIG been reported [22]. In the current study the overall 30-day mortality rate was 7%, which included those managed for terminal care. The risk of death was significantly higher in those aged 65 years and over.
The Role of the Percutaneous Endoscopic Gastrostomy…
169
The Timing of Gastrostomy Insertion in Head and Neck Surgery The value of early placement of a gastrostomy tube prior to radiotherapy and chemotherapy, for mostly advanced oropharyngeal and laryngeal malignancy, has been established in several retrospective studies on the basis of a reduction in weight loss [93-97], reduced duration and frequency of hospitalisation [93,94,96], decreased treatment interruptions [94,97] and a variable effect on quality of life measures [66,67]. There may also be value in insertion before the onset of severe hypoalbuminaemia [98]. The exact timing of gastrostomy insertion prior to surgery remains contentious. Head and neck surgeons, usually otolaryngologists, often have the tube inserted as a separate episode prior to definitive surgical treatment [46] [16,56] or at varying times including examination under anaesthesia or both during and after surgery [14,15]. Fewer complications may occur when the PEG is placed for oropharyngeal and laryngeal tumours during definitive surgery, either before or after tumour resection, and after surgery rather than when placed preoperatively or for inoperable tumours [57]. This highlights the importance of considering the tumour site when analysing a report. Recent publications from maxillofacial surgeons, managing primarily oral carcinoma, have favoured early PEG insertion, sometimes at the time of examination under anaesthesia but principally at the time of definitive surgery and after intubation when a safe airway has been obtained [10,11,17]. These patients are likely to be at increased risk of respiratory compromise because of a high incidence of grade 2 to 4 scores on the American Society of Anaesthesiologists intubation scale [10,11]. Insertion after surgery or during radiotherapy is less frequently performed. In the current study 19.5% of patients had the PEG placed at the time of an examination under anaesthesia or prior to definitive treatment. The histological diagnosis had already been obtained. These were mainly oropharyngeal tumours managed with radiotherapy, with or without chemotherapy, or patients with inoperable disease, poor medical condition or marked weight loss including a few that underwent a trial period of feeding before the treatment modality was decided. Seventy-six percent of patients had a PEG inserted immediately after the tracheostomy and before the tumour resection. The tumour is identified and carefully shielded from the endoscopic equipment to minimise the risk of tumour implantation. A PEG was not inserted after tumour removal because resection does not usually significantly improve access and would require re-draping of the surgical field. Placement immediately after reconstruction is also undesirable because of the risk of damaging the flap. Only 4.5% of gastrostomies were inserted after definitive surgery or during radiotherapy.
The Non-Endoscopic Gastrostomy Approach The endoscopic insertion of a gastrostomy is currently the gold standard technique [21]. However, many gastrostomy tubes are placed using additional image guidance such as fluoroscopy [19] [20,21] [22], computerised tomography and fluoroscopy [23] and ultrasound [24]. The relative merit of each technique is beyond the scope of this article but the outcome is variable and probably operator dependent [21]. In a meta-analysis of the gastroenterology
170
CME Avery
literature the rate of successful gastrostomy placement was significantly higher for a RIG (99.2%) than a PEG (95.7%) and major complications were significantly less frequent, 5.9% and 9.4% respectively [9]. A subsequent series supported these findings but importantly there were no differences in 30-day mortality or complication rates [18]. More recently higher rates of successful PEG insertion of 96% to 100%, together with a lower incidence of complications, have been reported in the head and neck literature [10,11,22], including those inserted by a maxillofacial team [17] and the findings of the current series. Although the rates of success reported for the RIG technique may remain marginally higher with an experienced operator [99] the procedure is less readily available and not infallible, as two of the patients in the current series also failed a RIG procedure. A RIG has been advised on the basis of several additional factors including the limited diagnostic yield of routine gastroscopy [21]. The prevalence of incidental findings during endoscopy ranges between from 10% to 71% [18]. Wollman & D’Agostino [18] noted a 30% rate of incidental endoscopic findings in their series, of which 10% had an intervention, mostly for peptic disease. In their opinion the clinical importance of many incidental findings is unproven. However, in the head and neck oncology group there is a relatively high incidence of metachronous and second primary tumours [100]. In the current series the significant incidental pathology detected included a synchronous oesophageal adenocarcinoma and a Barrett’s oesophagus. Chandu [11,101] also reported a synchronous gastric carcinoma and Barrett’s oesophagus in a series of patients with oral carcinoma. Foutch [85] preferred a PEG because the endoscopic information did alter patient management, although no malignancies were detected [102]. A further consideration is that a RIG may avoid tumour implantation at the stoma site [19,21,103] as the result of direct implantation [104]. However, this rare complication is now recognised and the head and neck surgeon is ideally trained to both identify and shield the tumour during the procedure [14,15]. The availability of the RIG technique and the degree of local expertise may vary. By performing a PEG the surgeon avoids the logistical issues and inconvenience of a separate procedure. There is a short delay between diagnosis and surgical resection hence the issue of pre-surgical feeding is usually not important. A thorough examination of the oropharynx for recurrent disease is also performed when later removing the gastrostomy. The procedure may be undertaken within a theatre environment, with an anaesthetist, as many patients will have a compromised airway after flap reconstruction and radiotherapy. It is for these reasons that the author prefers a PEG. In my practice a RIG is the procedure of choice only when endoscopy is unlikely to succeed. Occasional additional indications may include the need to avoid disturbing a recent surgical flap or suture line [19,20].
The Duration of the Gastrostomy The exact pattern and duration of gastrostomy use during treatment is unknown. Some gastrostomies are only placed at a late stage when oral intake is not being maintained and a number are never removed. The typical time that a gastrostomy is in place is difficult to ascertain because of differing methods of collating and presenting data. The mean or median values in the head and neck literature range from 13.8 to 67.1 weeks [6,11,12,17,70,93,105].
The Role of the Percutaneous Endoscopic Gastrostomy…
171
In the current series the median duration was 287 (SE 37) days or 41 weeks. The delay between the provisional decision to remove a gastrostomy and the procedure was less than 6 weeks in most cases. Only 2.1% of patients had a PEG in place for over 1000 days and are unlikely to have it removed. Unlike Mekhail [70] there was no evidence of prolonged dependency on the PEG as a result of atrophy of the pharyngeal musculature. Dependency was more likely to be related to massive or repeated surgery together with radiotherapy. There is only one other detailed analysis of PEG duration in patients treated for oral cancer. In a series of 49 patients Chandu [11] usually inserted the PEG at the time of definitive surgery. The mean duration of gastrostomies that were removed electively was 114 days and in those that died with the PEG in-situ it was 470 days. A PEG was still in-situ for 14% of patients because of dysfunctional swallowing and a risk of aspiration. In comparison Schweinfurth [106] inserted the gastrostomy at varying times in 142 patients with primarily laryngeal or pharyngeal pathology. The incidence of long-term gastrostomy was 27%, with only 24% of gastrostomies being removed. The analysis of PEG duration and comparison with other publications is complicated by many factors as gastrostomies are inserted at different stages of treatment, are replaced for deterioration or complications, re-inserted or retained for recurrent disease, and recently inserted gastrostomies must be accounted for while data is also skewed by very long-term durations. However, the likely length of gastrostomy duration and the incidence of permanent dependence on the tube is valuable information when counselling a patient.
Indications for Gastrostomy and Predictors of Prolonged Dependence The need for a gastrostomy and likely duration is difficult to predict because of an uncertain relationship to various factors including age, medical and nutritional status, speech and swallowing function, tumour site and stage, the surgical resection and type of reconstruction [107]. The indications for insertion have not been systematically studied and variable criteria have evolved with experience. When considering a report it is important to identify the tumour group and treatment modality being considered as publications from otolaryngology institutes often have a minority of oral carcinoma sites and a preponderance of non-surgical treatment. Gastrostomy has been advised for Stage III and IV disease of the oropharynx treated primarily with radiotherapy [95] or surgery [56] and also for combined modality treatment, previous radiotherapy or significant pre-treatment weight loss [105,108]. A significant reduction in hospitalisation was seen for pharyngeal and laryngeal sites but not oral tumours [56]. The study by Gardine [108] reviewed a mixture of PEG, nasogastric and oesophagostomy routes and was unusual as it contained a majority of oral tumours. These patients had a slightly higher incidence of prolonged dependency on tube feeding but the factors associated with a significantly increased risk of long-term nutritional support included stage IV disease, pharyngeal tumours, combined modality treatment and previous radiotherapy or significant pre-treatment weight loss. For primarily oropharyngeal and laryngeal malignancy Schweinfurth [106] also identified several predictive factors including; heavy alcohol use, base of tongue tumours treated with radiotherapy, reconstruction with a
172
CME Avery
myocutaneous rather free flap, post-operative radiotherapy, mandibulectomy but not mandibulotomy alone, moderately or poorly differentiated tumours, large tumour size but not TMN stage or surgical resection of the floor of mouth and oral tongue. This study had an unusual preponderance of male patients. Ringstrom [109] noted that only 55% of gastrostomies placed after surgery were temporary. An oropharyngeal tumour site and advanced T stage were predictive of the need for gastrostomy. In the surgical treatment of mainly oral carcinoma Chandu [11] listed the indications for gastrostomy insertion as Stage III and IV disease treated with surgery and radiotherapy, and Stage I and II disease in association with major neck dissections with or without distant flap. For benign disease the indications were large composite resections with free flap reconstruction. Although there was a 14% incidence of long-term PEG dependency due to abnormal swallowing and aspiration there was no analysis of other potentially linked factors. In the current study the duration of gastrostomy was significantly longer for stage T3-4 tumours (P=0.01), N1 or greater neck disease (P=0.02), following surgery with radiotherapy when compared to surgery alone (P<0.001) and for radiotherapy alone when compared to surgery alone (P=0.004) (Table 5 and Figure 2). The radiotherapy alone group were primarily stage T3 or 4 oropharyngeal tumours. Unlike previous studies [56,106] there was a significantly increased median duration for hemiglossectomy (P=0.02) and maxillectomy procedures (P=0.003) with radiotherapy when compared to surgery alone. Patients that underwent two separate surgical procedures and radiotherapy had longer durations on average than those having a single surgical procedure (Table 5, P=0.02). The duration following a primarily soft tissue resection, with or without a rim resection, was significantly shorter than after a segmental composite bone resection (P=0.03) (Table 5 and Figure 3). There was no obvious relationship with age or the type of flap reconstruction but the latter will be amenable to further analysis with greater patient numbers. A limitation of this study is the lack of a control group and changes in weight have not been considered. However, with the role of PEG now well established it may be difficult to undertake a prospective randomised comparison of PEG with NG tube feeding except perhaps in targeted groups.
Current Indications for PEG Insertion If the fundamental criteria for PEG insertion have been met then all patients with T3 and T4 oropharyngeal tumours undergoing radiotherapy and patients with oral tumours that require reconstruction with a free or pedicled flap are offered a PEG on the basis that recovery of oral function is not expected within two to four weeks. This includes T2 tumours without neck disease (stage II disease) if the site of the tumour is likely to have a significant effect on function and hence a flap reconstruction is indicated. Those undergoing a smaller oral procedure or extra-oral resection, particularly in conjunction with a neck dissection, that may compromise oral function are also offered a PEG. Other factors may also impact upon this decision making process (Table 8). Walton [84] has advocated a more selective insertion policy on the basis of an unusually high incidence of major complications, probably as the result of not having an experienced endoscopist. A more restrictive insertion policy would probably have led to more gastrostomies being performed at a later stage, when the patient
The Role of the Percutaneous Endoscopic Gastrostomy…
173
may be in a more debilitated state. The current threshold for PEG insertion is lower than in other studies because it is difficult, at present, to identify a subgroup of patients that would not benefit from a PEG. Nevertheless, it is particularly important to try to identify patients that are likely to die soon after the procedure. 100 90 80 70
% of PEG
60 50
Composite bone
40 30
Soft tissue
20 10 0 0
100
200
300
400
500
600
700
800
PEG duration in days
Figure 3. Duration of PEG by principle type of resection.
Table 8. Current indications for insertion of a PEG Current indications • Fundamental criteria for insertion have been met and PEG not contra-indicated • Recovery of oral function within 2 to 4 weeks is not expected • Malnutrition or at risk of malnutrition during treatment • T3 and T4 oropharyngeal tumours undergoing surgery and/or radiotherapy • Intra-oral reconstruction with free or pedicled flap • Smaller oral procedure or extra-oral surgery, particularly in conjunction with a neck dissection, likely to adversely affect oral function • Other factors may be relevant ie reduced oral function, previous radiotherapy
174
CME Avery
CONCLUSION This study has confirmed that a percutaneous endoscopic gastrostomy may be inserted with a high degree of success and minimal complications by an experienced maxillofacial surgeon. All patients with T3 and T4 oropharyngeal tumours undergoing radiotherapy or with oral tumours that require reconstruction with a free or pedicled flap are offered a PEG on the basis that recovery of oral function is not expected within two to four weeks. This includes T2 tumours without neck disease if the site of the tumour is likely to have a significant effect on function and hence a flap reconstruction is indicated. Those undergoing a smaller oral procedure or extra-oral resection, particularly in conjunction with a neck dissection, that may compromise oral function are also offered a PEG. In the opinion of the author most gastrostomies may be inserted at the time of definitive surgery. Those requiring insertion at an initial examination under anaesthesia may usually be identified as having advanced oral or oropharyngeal disease, are likely to receive radiotherapy with or without chemotherapy as the primary modality of treatment, are in poor general health, unsuitable for major surgery or there has been significant weight loss and demonstrable weight gain is desirable prior to the decision about the final treatment modality. The incidence of late gastrostomy insertion should be relatively low. The author is now able to more accurately advise patients about the likely duration of the PEG. Prolonged dependency is associated with T3 and T4 tumours, N1 or greater neck disease, the combination of surgery and radiotherapy and particularly two surgical procedures, and a segmental composite bone resection. However, the incidence of permanent gastrostomy is low. The exact pattern of gastrostomy use during the different phases of treatment should be studied.
REFERENCES [1] [2] [3] [4] [5] [6]
[7]
Gauderer MW, Ponsky JL, Izant RJ, Jr. Gastrostomy without laparotomy: a percutaneous endoscopic technique. J Pediatr Surg 1980;15(6):872-5. Ponsky JL, Gauderer MW. Percutaneous endoscopic gastrostomy: a nonoperative technique for feeding gastrostomy. Gastrointest Endosc 1981;27(1):9-11. Gauderer MW, Ponsky JL, Izant RJ, Jr. Gastrostomy without laparotomy: a percutaneous endoscopic technique. 1980. Nutrition 1998;14(9):736-8. Safadi BY, Marks JM, Ponsky JL. Percutaneous endoscopic gastrostomy: an update. Endoscopy 1998;30(9):781-9. Hunter JG, Lauretano L, Shellito PC. Percutaneous endoscopic gastrostomy in head and neck cancer patients. Ann Surg 1989;210(1):42-6. Shike M, Berner YN, Gerdes H, Gerold FP, Bloch A, Sessions R, et al. Percutaneous endoscopic gastrostomy and jejunostomy for long-term feeding in patients with cancer of the head and neck. Otolaryngol Head Neck Surg 1989;101(5):549-54. Rabeneck L, McCullough LB, Wray NP. Ethically justified, clinically comprehensive guidelines for percutaneous endoscopic gastrostomy tube placement. Lancet 1997;349(9050):496-8.
The Role of the Percutaneous Endoscopic Gastrostomy… [8] [9]
[10]
[11]
[12]
[13] [14] [15]
[16]
[17]
[18]
[19] [20]
[21]
[22]
175
Angus F, Burakoff R. The percutaneous endoscopic gastrostomy tube. medical and ethical issues in placement. Am J Gastroenterol 2003;98(2):272-7. Wollman B, D'Agostino HB, Walus-Wigle JR, Easter DW, Beale A. Radiologic, endoscopic, and surgical gastrostomy: an institutional evaluation and meta-analysis of the literature. Radiology 1995;197(3):699-704. Cunliffe DR, Swanton C, White C, Watt-Smith SR, Cook TA, George BD. Percutaneous endoscopic gastrostomy at the time of tumour resection in advanced oral cancer. Oral Oncol 2000;36(5):471-3. Chandu A, Smith AC, Douglas M. Percutaneous endoscopic gastrostomy in patients undergoing resection for oral tumors: a retrospective review of complications and outcomes. J Oral Maxillofac Surg 2003;61(11):1279-84. Ehrsson YT, Langius-Eklof A, Bark T, Laurell G. Percutaneous endoscopic gastrostomy (PEG) - a long-term follow-up study in head and neck cancer patients. Clin Otolaryngol Allied Sci 2004;29(6):740-6. Mellinger JD, Ponsky JL. Percutaneous endoscopic gastrostomy: state of the art, 1998. Endoscopy 1998;30(2):126-32. Urban KG, Terris DJ. Percutaneous endoscopic gastrostomy by head and neck surgeons. Otolaryngol Head Neck Surg 1997;116(4):489-92. Lin HS, Ibrahim HZ, Kheng JW, Fee WE, Terris DJ. Percutaneous endoscopic gastrostomy: strategies for prevention and management of complications. Laryngoscope 2001;111(10):1847-52. Hujala K, Sipila J, Pulkkinen J, Grenman R. Early percutaneous endoscopic gastrostomy nutrition in head and neck cancer patients. Acta Otolaryngol 2004;124(7):847-50. Lloyd CJ, Penfold CN. Insertion of percutaneous endoscopic gastrostomy tubes by a maxillofacial surgical team in patients with oropharyngeal cancer. Br J Oral Maxillofac Surg 2002;40(2):122-4. Wollman B, D'Agostino HB. Percutaneous radiologic and endoscopic gastrostomy: a 3year institutional analysis of procedure performance. AJR Am J Roentgenol 1997;169(6):1551-3. Myssiorek D, Siegel D, Vambutas A. Fluoroscopically placed percutaneous gastrostomies in the head and neck patient. Laryngoscope 1998;108(10):1557-60. Dinkel HP, Beer KT, Zbaren P, Triller J. Establishing radiological percutaneous gastrostomy with balloon-retained tubes as an alternative to endoscopic and surgical gastrostomy in patients with tumours of the head and neck or oesophagus. Br J Radiol 2002;75(892):371-7. Laasch HU, Wilbraham L, Bullen K, Marriott A, Lawrance JA, Johnson RJ, et al. Gastrostomy insertion: comparing the options--PEG, RIG or PIG? Clin Radiol 2003;58(5):398-405. Silas AM, Pearce LF, Lestina LS, Grove MR, Tosteson A, Manganiello WD, et al. Percutaneous radiologic gastrostomy versus percutaneous endoscopic gastrostomy: a comparison of indications, complications and outcomes in 370 patients. Eur J Radiol 2005;56(1):84-90.
176
CME Avery
[23] Tsukuda T, Fujita T, Ito K, Yamashita T, Matsunaga N. Percutaneous radiologic gastrostomy using push-type gastrostomy tubes with CT and fluoroscopic guidance. AJR Am J Roentgenol 2006;186(2):574-6. [24] Horoldt BS, Lee FK, Gleeson D, McAlindon ME, Sanders DS. Ultrasound guidance in the placement of a percutaneous endoscopic gastrostomy (PEG): an adjuvant technique in patients with abdominal wall varices? Dig Liver Dis 2005;37(9):709-12. [25] Schapiro GD, Edmundowicz SA. Complications of percutaneous endoscopic gastrostomy. Gastrointest Endosc Clin N Am 1996;6(2):409-22. [26] Baeten C, Hoefnagels J. Feeding via nasogastric tube or percutaneous endoscopic gastrostomy. A comparison. Scand J Gastroenterol Suppl 1992;194:95-8. [27] Park RH, Allison MC, Lang J, Spence E, Morris AJ, Danesh BJ, et al. Randomised comparison of percutaneous endoscopic gastrostomy and nasogastric tube feeding in patients with persisting neurological dysphagia. Bmj 1992;304(6839):1406-9. [28] Norton B, Homer-Ward M, Donnelly MT, Long RG, Holmes GK. A randomised prospective comparison of percutaneous endoscopic gastrostomy and nasogastric tube feeding after acute dysphagic stroke. Bmj 1996;312(7022):13-6. [29] Sanders H, Newall S, Norton B, Holmes GT. Gastrostomy feeding in the elderly after acute dysphasgic stroke. J Nutr Health Aging 2000;4(1):58-60. [30] Callahan CM, Haag KM, Weinberger M, Tierney WM, Buchanan NN, Stump TE, et al. Outcomes of percutaneous endoscopic gastrostomy among older adults in a community setting. J Am Geriatr Soc 2000;48(9):1048-54. [31] Dennis MS, Lewis SC, Warlow C. Effect of timing and method of enteral tube feeding for dysphagic stroke patients (FOOD): a multicentre randomised controlled trial. Lancet 2005;365(9461):764-72. [32] Rimon E, Kagansky N, Levy S. Percutaneous endoscopic gastrostomy; evidence of different prognosis in various patient subgroups. Age Ageing 2005;34(4):353-7. [33] Prosser-Loose EJ, Paterson PG. The FOOD Trial Collaboration: nutritional supplementation strategies and acute stroke outcome. Nutr Rev 2006;64(6):289-94. [34] Dennis M, Lewis S, Cranswick G, Forbes J. FOOD: a multicentre randomised trial evaluating feeding policies in patients admitted to hospital with a recent stroke. Health Technol Assess 2006;10(2):iii-iv, ix-x, 1-120. [35] Ponsky JL. Percutaneous endoscopic gastrostomy. J Gastrointest Surg 2004;8(7):903-6. [36] Antibiotic prophylaxis for gastrointestinal endoscopy. American Society for Gastrointestinal Endoscopy. Gastrointest Endosc 1995;42(6):630-5. [37] Rey JR, Axon A, Budzynska A, Kruse A, Nowak A. Guidelines of the European Society of Gastrointestinal Endoscopy (E.S.G.E.) antibiotic prophylaxis for gastrointestinal endoscopy. European Society of Gastrointestinal Endoscopy. Endoscopy 1998;30(3):318-24. [38] Antibiotic prophylaxis in gastrointestinal endoscopy: British Society of Gastroenterology; 2001. http://www.bsg.org.uk/pdf_word_docs/prophylaxis2001.pdf. [39] O’ Toole P. Complications associated with the placement of percutaneous endoscopic gastrostomy. In Guidelines on complications of gastrointestinal endoscopy, Green J (ed). London: British Society of Gastroenterology, 2006: 26-30. http://www.bsg.org.uk/pdf_word_docs/complications.pdf.
The Role of the Percutaneous Endoscopic Gastrostomy…
177
[40] Foutch PG, Talbert GA, Waring JP, Sanowski RA. Percutaneous endoscopic gastrostomy in patients with prior abdominal surgery: virtues of the safe tract. Am J Gastroenterol 1988;83(2):147-50. [41] Holmes S. Nutrition: a necessary adjunct to hospital care? J R Soc Health 1999;119(3):175-9. [42] Daly JM, Hoffman K, Lieberman M, Leon P, Redmond HP, Shou J, et al. Nutritional support in the cancer patient. JPEN J Parenter Enteral Nutr 1990;14(5 Suppl):244S248S. [43] Beattie AH, Prach AT, Baxter JP, Pennington CR. A randomised controlled trial evaluating the use of enteral nutritional supplements postoperatively in malnourished surgical patients. Gut 2000;46(6):813-8. [44] Rivadeneira DE, Evoy D, Fahey TJ, 3rd, Lieberman MD, Daly JM. Nutritional support of the cancer patient. CA Cancer J Clin 1998;48(2):69-80. [45] Feldman JG, Hazan M. A case-control investigation of alcohol, tobacco, and diet in head and neck cancer. Prev Med 1975;4(4):444-63. [46] Roukema JA, van der Werken C, Juttmann JR. Percutaneous endoscopic gastrostomy as a standard procedure in head and neck surgery. Arch Otolaryngol Head Neck Surg 1990;116(6):730-1. [47] Donaldson SS, Lenon RA. Alterations of nutritional status: impact of chemotherapy and radiation therapy. Cancer 1979;43(5 Suppl):2036-52. [48] Donaldson SS. Nutritional support as an adjunct to radiation therapy. JPEN J Parenter Enteral Nutr 1984;8(3):302-10. [49] Pezner R, Archambeau JO. Critical evaluation of the role of nutritional support for radiation therapy patients. Cancer 1985;55(1 Suppl):263-7. [50] Nayel H, el-Ghoneimy E, el-Haddad S. Impact of nutritional supplementation on treatment delay and morbidity in patients with head and neck tumors treated with irradiation. Nutrition 1992;8(1):13-8. [51] Brookes GB. Nutritional status--a prognostic indicator in head and neck cancer. Otolaryngol Head Neck Surg 1985;93(1):69-74. [52] Copeland EM, 3rd, Daly JM, Dudrick SJ. Nutritional concepts in the treatment of head and neck malignancies. Head Neck Surg 1979;1(4):350-65. [53] Daly JM, Hearne B, Dunaj J, LePorte B, Vikram B, Strong E, et al. Nutritional rehabilitation in patients with advanced head and neck cancer receiving radiation therapy. Am J Surg 1984;148(4):514-20. [54] Torosian MH, Daly JM. Nutritional support in the cancer-bearing host. Effects on host and tumor. Cancer 1986;58(8 Suppl):1915-29. [55] Nutrition support in adults Oral nutrition support, enteral tube feeding and parenteral nutrition. In: National collaborating centre for acute care, London.; 2006. http://guidance.nice.org.uk/CG32/guidance/pdf/English. [56] Gibson S, Wenig BL. Percutaneous endoscopic gastrostomy in the management of head and neck carcinoma. Laryngoscope 1992;102(9):977-80. [57] Raynor EM, Williams MF, Martindale RG, Porubsky ES. Timing of percutaneous endoscopic gastrostomy tube placement in head and neck cancer patients. Otolaryngol Head Neck Surg 1999;120(4):479-82.
178
CME Avery
[58] Tucker AT, Gourin CG, Ghegan MD, Porubsky ES, Martindale RG, Terris DJ. 'Push' versus 'pull' percutaneous endoscopic gastrostomy tube placement in patients with advanced head and neck cancer. Laryngoscope 2003;113(11):1898-902. [59] Bankhead RR, Fisher CA, Rolandelli RH. Gastrostomy tube placement outcomes: comparison of surgical, endoscopic, and laparoscopic methods. Nutr Clin Pract 2005;20(6):607-12. [60] Foutch PG, Haynes WC, Bellapravalu S, Sanowski RA. Percutaneous endoscopic gastrostomy (PEG). A new procedure comes of age. J Clin Gastroenterol 1986;8(1):105. [61] Stiegmann GV, Goff JS, Silas D, Pearlman N, Sun J, Norton L. Endoscopic versus operative gastrostomy: final results of a prospective randomized trial. Gastrointest Endosc 1990;36(1):1-5. [62] Peitgen K, Walz MK, Krause U, Eigler FW. First results of laparoscopic gastrostomy. Surg Endosc 1997;11(6):658-62. [63] Peitgen K, von Ostau C, Walz MK. Laparoscopic gastrostomy: results of 121 patients over 7 years. Surg Laparosc Endosc Percutan Tech 2001;11(2):76-82. [64] Rustom IK, Jebreel A, Tayyab M, England RJ, Stafford ND. Percutaneous endoscopic, radiological and surgical gastrostomy tubes: a comparison study in head and neck cancer patients. J Laryngol Otol 2006;120(6):463-6. [65] Wanklyn P, Cox N, Belfield P. Outcome in patients who require a gastrostomy after stroke. Age Ageing 1995;24(6):510-4. [66] Fietkau R, Iro H, Sailer D, Sauer R. Percutaneous endoscopically guided gastrostomy in patients with head and neck cancer. Recent Results Cancer Res 1991;121:269-82. [67] Senft M, Fietkau R, Iro H, Sailer D, Sauer R. The influence of supportive nutritional therapy via percutaneous endoscopically guided gastrostomy on the quality of life of cancer patients. Support Care Cancer 1993;1(5):272-5. [68] Magne N, Marcy PY, Foa C, Falewee MN, Schneider M, Demard F, et al. Comparison between nasogastric tube feeding and percutaneous fluoroscopic gastrostomy in advanced head and neck cancer patients. Eur Arch Otorhinolaryngol 2001;258(2):8992. [69] Koehler J, Buhl K. Percutaneous endoscopic gastrostomy for postoperative rehabilitation after maxillofacial tumor surgery. Int J Oral Maxillofac Surg 1991;20(1):38-9. [70] Mekhail TM, Adelstein DJ, Rybicki LA, Larto MA, Saxton JP, Lavertu P. Enteral nutrition during the treatment of head and neck carcinoma: is a percutaneous endoscopic gastrostomy tube preferable to a nasogastric tube? Cancer 2001;91(9):1785-90. [71] Ponsky JL, Gauderer MW. Percutaneous endoscopic gastrostomy: indications, limitations, techniques, and results. World J Surg 1989;13(2):165-70. [72] Taller A, Horvath E, Ilias L, Kotai Z, Simig M, Elo J, et al. Technical modifications for improving the success rate of PEG tube placement in patients with head and neck cancer. Gastrointest Endosc 2001;54(5):633-6. [73] Stellato TA, Gauderer MW, Ponsky JL. Percutaneous endoscopic gastrostomy following previous abdominal surgery. Ann Surg 1984;200(1):46-50.
The Role of the Percutaneous Endoscopic Gastrostomy…
179
[74] Townsend MC, Flancbaum L, Cloutier CT, Arnold MW. Early postlaparotomy percutaneous endoscopic gastrostomy. Surg Gynecol Obstet 1992;174(1):46-8. [75] Janes SE, Price CS, Khan S. Percutaneous endoscopic gastrostomy: 30-day mortality trends and risk factors. J Postgrad Med 2005;51(1):23-8; discussion 28-9. [76] Kozarek RA, Ball TJ, Ryan JA, Jr. When push comes to shove: a comparison between two methods of percutaneous endoscopic gastrostomy. Am J Gastroenterol 1986;81(8):642-6. [77] Deitel M, Bendago M, Spratt EH, Burul CJ, To TB. Percutaneous endoscopic gastrostomy by the "pull" and "introducer" methods. Can J Surg 1988;31(2):102-4. [78] Akkersdijk WL, van Bergeijk JD, van Egmond T, Mulder CJ, van Berge Henegouwen GP, van der Werken C, et al. Percutaneous endoscopic gastrostomy (PEG): comparison of push and pull methods and evaluation of antibiotic prophylaxis. Endoscopy 1995;27(4):313-6. [79] Ponsky JL, Gauderer MW, Stellato TA. Percutaneous endoscopic gastrostomy. Review of 150 cases. Arch Surg 1983;118(8):913-4. [80] Stern JS. Comparison of percutaneous endoscopic gastrostomy with surgical gastrostomy at a community hospital. Am J Gastroenterol 1986;81(12):1171-3. [81] Larson DE, Burton DD, Schroeder KW, DiMagno EP. Percutaneous endoscopic gastrostomy. Indications, success, complications, and mortality in 314 consecutive patients. Gastroenterology 1987;93(1):48-52. [82] Luetzow AM, Chaffoo RA, Young H. Percutaneous gastrostomy: the Stanford experience. Laryngoscope 1988;98(10):1035-9. [83] Gibson SE, Wenig BL, Watkins JL. Complications of percutaneous endoscopic gastrostomy in head and neck cancer patients. Ann Otol Rhinol Laryngol 1992;101(1):46-50. [84] Walton GM. Complications of percutaneous gastrostomy in patients with head and neck cancer--an analysis of 42 consecutive patients. Ann R Coll Surg Engl 1999;81(4):272-6. [85] Foutch PG, vanSonnenberg E, Casola G, D'Agostino H. Controversies, dilemmas, and dialogues. Nonsurgical gastrostomy: X-ray or endoscopy? Am J Gastroenterol 1990;85(12):1560-3. [86] Akkersdijk WL, Roukema JA, van der Werken C. Percutaneous endoscopic gastrostomy for patients with severe cerebral injury. Injury 1998;29(1):11-4. [87] Riley DA, Strauss M. Airway and other complications of percutaneous endoscopic gastrostomy in head and neck cancer patients. Ann Otol Rhinol Laryngol 1992;101(4):310-3. [88] Choudhry U, Barde CJ, Markert R, Gopalswamy N. Percutaneous endoscopic gastrostomy: a randomized prospective comparison of early and delayed feeding. Gastrointest Endosc 1996;44(2):164-7. [89] McClave SA, Neff RL. Care and long-term maintenance of percutaneous endoscopic gastrostomy tubes. JPEN J Parenter Enteral Nutr 2006;30(1 Suppl):S27-38. [90] McCarter TL, Condon SC, Aguilar RC, Gibson DJ, Chen YK. Randomized prospective trial of early versus delayed feeding after percutaneous endoscopic gastrostomy placement. Am J Gastroenterol 1998;93(3):419-21.
180
CME Avery
[91] Chaudhary KA, Smith OJ, Cuddy PG, Clarkston WK. PEG site infections: the emergence of methicillin resistant Staphylococcus aureus as a major pathogen. Am J Gastroenterol 2002;97(7):1713-6. [92] Gencosmanoglu R, Koc D, Tozun N. The buried bumper syndrome: migration of internal bumper of percutaneous endoscopic gastrostomy tube into the abdominal wall. J Gastroenterol 2003;38(11):1077-80. [93] Tyldesley S, Sheehan F, Munk P, Tsang V, Skarsgard D, Bowman CA, et al. The use of radiologically placed gastrostomy tubes in head and neck cancer patients receiving radiotherapy. Int J Radiat Oncol Biol Phys 1996;36(5):1205-9. [94] Lee JH, Machtay M, Unger LD, Weinstein GS, Weber RS, Chalian AA, et al. Prophylactic gastrostomy tubes in patients undergoing intensive irradiation for cancer of the head and neck. Arch Otolaryngol Head Neck Surg 1998;124(8):871-5. [95] Pezner RD, Archambeau JO, Lipsett JA, Kokal WA, Thayer W, Hill LR. Tube feeding enteral nutritional support in patients receiving radiation therapy for advanced head and neck cancer. Int J Radiat Oncol Biol Phys 1987;13(6):935-9. [96] Beaver ME, Matheny KE, Roberts DB, Myers JN. Predictors of weight loss during radiation therapy. Otolaryngol Head Neck Surg 2001;125(6):645-8. [97] Beer KT, Krause KB, Zuercher T, Stanga Z. Early percutaneous endoscopic gastrostomy insertion maintains nutritional state in patients with aerodigestive tract cancer. Nutr Cancer 2005;52(1):29-34. [98] Nair S, Hertan H, Pitchumoni CS. Hypoalbuminemia is a poor predictor of survival after percutaneous endoscopic gastrostomy in elderly patients with dementia. Am J Gastroenterol 2000;95(1):133-6. [99] de Baere T, Chapot R, Kuoch V, Chevallier P, Delille JP, Domenge C, et al. Percutaneous gastrostomy with fluoroscopic guidance: single-center experience in 500 consecutive cancer patients. Radiology 1999;210(3):651-4. [100] Hujala K, Sipila J, Grenman R. Panendoscopy and synchronous second primary tumors in head and neck cancer patients. Eur Arch Otorhinolaryngol 2005;262(1):17-20. [101] Chandu A, Smith AC, Douglas MC. Synchronous oral and gastric carcinoma. An incidental finding on Percutaneous Endoscopic Gastrostomy insertion. Br J Oral Maxillofac Surg 2004;42(1):46-8. [102] Wolfsen HC, Kozarek RA, Ball TJ, Patterson DJ, Botoman VA, Ryan JA. Value of diagnostic upper endoscopy preceding percutaneous gastrostomy. Am J Gastroenterol 1990;85(3):249-51. [103] Pickhardt PJ, Rohrmann CA, Jr., Cossentino MJ. Stomal metastases complicating percutaneous endoscopic gastrostomy: CT findings and the argument for radiologic tube placement. AJR Am J Roentgenol 2002;179(3):735-9. [104] Adelson RT, Ducic Y. Metastatic head and neck carcinoma to a percutaneous endoscopic gastrostomy site. Head Neck 2005;27(4):339-43. [105] Saunders JR, Jr., Brown MS, Hirata RM, Jaques DA. Percutaneous endoscopic gastrostomy in patients with head and neck malignancies. Am J Surg 1991;162(4):3813. [106] Schweinfurth JM, Boger GN, Feustel PJ. Preoperative risk assessment for gastrostomy tube placement in head and neck cancer patients. Head Neck 2001;23(5):376-82.
The Role of the Percutaneous Endoscopic Gastrostomy…
181
[107] Naik AD, Abraham NS, Roche VM, Concato J. Predicting which patients can resume oral nutrition after percutaneous endoscopic gastrostomy tube placement. Aliment Pharmacol Ther 2005;21(9):1155-61. [108] Gardine RL, Kokal WA, Beatty JD, Riihimaki DU, Wagman LD, Terz JJ. Predicting the need for prolonged enteral supplementation in the patient with head and neck cancer. Am J Surg 1988;156(1):63-5. [109] Ringstrom E, Matthews TW, Lampe HB, Currie C. Role of percutaneous gastrostomy tubes in the postoperative care of patients with cancer of the oral cavity and oropharynx. J Otolaryngol 1999;28(2):68-72.
In: Oral Cancer Research Advances Editor: Alexios P. Nikolakakos, pp. 183-194
ISBN 978-1-60021-864-4 © 2007 Nova Science Publishers, Inc.
Chapter 7
THE BIOMECHANICAL BASIS FOR INTERNAL FIXATION OF THE RADIAL OSTEOCUTANEOUS DONOR SITE CME Avery Department of Maxillofacial Surgery, University Hospitals of Leicester, Leicester, United Kingdom.
ABSTRACT Fracture of the radial free flap osteocutaneous donor site is common and causes considerable morbidity. Most fractures are probably caused by relatively low-energy torsional forces. This complication has lead to reduced use of the flap in clinical practice. However, the incidence of fracture may be reduced by placing a bone plate, at the site of the section defect, at the time of harvesting the flap. Both anterior and posterior surgical approaches have been described. The strengthening effect of different types of plate and position were studied using the sheep tibia as a model for the radial osteocutaneous donor site. Fifty matched pairs of adult sheep tibias were tested in torsion and 4-point bending. The weakening effect of an osteotomy was first assessed by comparing an osteotomised bone with an intact bone. Then pairs of bones with an osteotomy were compared with and without reinforcement with different types of 3.5mm plate. The plate was placed in either the anterior (over the defect) or posterior (on the intact cortex) position. An osteotomised bone was significantly weaker than an intact bone. A plate in either the anterior or posterior position significantly strengthened an osteotomised bone. The dynamic compression plate was the strongest reinforcement in both torsion and bending. In torsion the mean strength of the intact bone was 45% greater than after osteotomy (P=0.02). The reinforced bone was on average 61% stronger than the unreinforced bone (P<0.001). Plating restored the strength of the osteotomised bone to that of an intact bone (100%) with a plate in either the anterior (97%) or posterior position (101%). The tibia was able to withstand much greater loads in bending. In bending the mean strength of the intact bone was 188% greater than after osteotomy (P=0.02). The
184
CME Avery reinforced bone was on average 184% stronger then the unreinforced bone (P<0.001). The posterior plate (80%) had a significantly greater effect than an anterior plate (46%) in restoring the strength of the osteotomised bone to that of an intact bone (100%) (P=0.01). The use of prophylactic internal fixation is recommended for the routine management of the radial osteocutaneous donor site. A plate in the anterior or posterior position will significantly strengthen the donor site and the surgeon may choose either site. The additional strengthening effect of the posterior plate in bending is probably not relevant in clinical practice as the radius is likely to fracture first as a result of lower torsional forces.
INTRODUCTION The incidence of fracture of the radial osteocutaneous donor site ranges from zero to 66%, mean 25% (28 fractures at 114 donor sites) [1]. In two recent large series the incidences of fracture were 15% [2] and 18% [3], with secondary surgery required for 67% and 46% of these fractures, respectively. Fracture of the radius often causes significant morbidity and functional deficit [4]. This frequent complication and the restricted volume of bone available led to a reduction in the popularity of the flap. During axial loading of the forearm the radius bears most of the forces [5]. Osteotomy of the preserved radius has been shown to reduce the strength in bending to 24% of that of an intact radius [6] (Table 1). The sheep tibia model of the radial donor site has been validated by comparison with the preserved human radius [7]. The retained strength in torsion after removal of 30% of the cross-sectional area (1/4 diameter) of the tibia was 26%, and after removal of half of the circumference was 15%. Bevelling the osteotomy had a statistically significant but small strengthening effect of only 5%. This is unlikely to be of significant benefit in clinical practice [7]. The dramatic weakening after osteotomy results from the loss of cortical integrity [8] and creation of an “open-section” defect [7], which reduces the energy-absorbing capacity of the bone [9,10]. The effect is greatest on bones such as the radius, which have relatively thin cortical walls and with long transcortical defects [11]. It is good practice to minimise the risk of fracture by using a careful surgical technique, for example avoiding over-cutting, using a bevelled osteotomy and removing 50% or less of the circumference of the radius. However, the weakening effect of an osteotomy is so dramatic that the ideal solution would be to strengthen the remaining radial bone, particularly against low-energy forces, which are thought to be responsible for most fractures [6]. Prophylactic internal fixation of the radial osteocutaneous donor site was first recommended by the author in 1999 [12] on the basis of a small clinical series. A dynamic compression plate (DCP) was placed in an anterior position (across the section defect) to act as a bridging plate. Since then the strengthening effect of a plate in the anterior position has been reported in larger clinical series with a low incidence of fracture [13,14]. Bowers et al [1] also demonstrated the strengthening effect of a plate in the posterior position (on the intact opposite cortex) in a biomechanical study. The use of the posterior position has also been reported in clinical studies with a low rate of fracture [15,16].
The Biomechanical Basis for Internal Fixation…
185
In this chapter the author investigated the effect of varying the type of plate and position using the sheep tibia as a model for the radial osteocutaneous donor site. Table 1. The weakening effect of an osteotomy
Model Number of pairs of bone Type of osteotomy Amount of bone removed Length of bone removed Mean strength in torsion of bone with osteotomy compared with intact bone (100%) Mean strength in bending of bone with osteotomy compared with intact bone (100%)
Swanson 1990 Preserved human radius 20 Right-angle and bevel 1/3 of diameter 9 cm
Meland 1992 Sheep tibia 45 Right-angle, keel and bevel 30%-50% cross-section 1-4 diameter length
-
14.7 to 25.9
24
-
METHODS Bone Pairs Fifty matched pairs of intact freshly frozen adult sheep tibias of a similar size and age were tested. The bones were divided into 5 groups, each of 10 matched pairs. Within each group 5 pairs were tested in torsion and 5 by bending. Group 1 compared pairs of bones that were intact with those after osteotomy. Groups 2 to 5 compared pairs of osteotomised bones with and without reinforcement (Table 2). The different positions were simulated by putting the plate over the section defect (anterior) or on the intact cortex opposite the section defect (posterior) (Figures 1 and 2). Three different types of 3.5 mm plate were tested. A DCP (STRATEC Medical Ltd, UK) placed anteriorly or posteriorly. A pelvic reconstruction plate (STRATEC Medical Ltd, UK) and a titanium plate (DePuy International Ltd, UK) placed anteriorly. The forces at failure during torsion or bending were recorded, and a photographic record was taken.
Preparation of Bone The bones were stripped of soft tissue except for the periosteum, and stored in moist sealed packages at –28oC. A defect 60 mm long of 40% of the circumference was marked out at three points using a measuring tape (Figure 3). The defect was created in the flat midsection of the shaft, with a right-angled osteotomy at each end, using a fine saw (EXAKT. Germany). A right-angled osteotomy was easier to standardise, and drilling out the corner
CME Avery
186
eliminated over-cutting or points where stress may be concentrated [6]. This technique may also be stronger than bevelling, as stress is defined as force per unit area and the removal of load-bearing bone creates greater stress on the remaining structure [17,18]. This section defect is a broadly similar proportion to that harvested in clinical practice [6]. As the crosssection of the tibia is not circular 40% of the circumference was removed as a reproducible standard. This is within the recommended range of 40% to 50% of the circumference [19,20], or one quarter [7] to one third [6] of the diameter. An 8-hole plate was placed with 2 bicortical screws at each end in a non-compressive position. This is the minimum number of screws required for stability (Figures 1 and 2). The constructs were mounted in an aluminium mould to create the attached cement endings required for the testing apparatus. A bulky diaphysis was cut down to size. Orthopaedic grade polymethylmethacrylate cement (Palacos LV-40. Schering-Plough, Europe) covered the entire diaphysis and contracted to grip the bone [21]. Table 2. Comparison of the matched bone pairs Group 1 2 3 4 5
Pairs 5 5 5 5 5 5 5 5 5 5
Type of bone Intact Intact Osteotomy Osteotomy Osteotomy Osteotomy Osteotomy Osteotomy Osteotomy Osteotomy
Type of bone/ plate/position Osteotomy Osteotomy Osteotomy / DCP/cortex Osteotomy / DCP/cortex Osteotomy / DCP/section Osteotomy / DCP/section Osteotomy / Reconstruction/section Osteotomy / Reconstruction/section Osteotomy / titanium/section Osteotomy / titanium/section
Test Torsion Bending Torsion Bending Torsion Bending Torsion Bending Torsion Bending
In each matched pair one bone was compared with the other. For example in Group 2 one bone will have an osteotomy but not be reinforced and the other will have an osteotomy and be reinforced with a dynamic compression plate (DCP) on the cortex.
Figure 1. Plate over defect (anterior position) with 4 bicortical screws.
The Biomechanical Basis for Internal Fixation…
187
Figure 2. Plate on cortex (posterior position) with 4 bicortical screws.
Figure 3. Standardised section defect.
Torsion Testing A torsion apparatus (Crofts Engineering Ltd, UK) with a force transducer gave a direct reading of 1 millivolt (mv), equivalent to 1 Newton (N), and the force in Newton metres (Nm) was calculated. Rotation of the apparatus at 1 degree/second induced a uniform torque over the length of the bone. The degree of rotation was recorded every 1 to 2 seconds.
Four-Point Bending Test A Hounsfield H50KM apparatus (Hounsfield Test Equipment Ltd, UK) was fitted with a DO30 Universal Type attachment and a 50 KN load cell. The bones with an osteotomy were loaded with the section defect on the opposite side of the superior loading point. Nylon blocks were placed over the steel supports of the apparatus to avoid crushing the bone. The equipment was calibrated with wooden dowels. The rate of displacement was 10 mm/minute. A constant bending movement was applied across the length of the bone. The force in Newton metres (Nm) was automatically recorded at a frequency of 1Hz.
Statistical Analysis Raw data and summary results were tabulated, using means, standard errors (SE), and percentages. The number of pairs of bones in each group was small for the purpose of statistical inference as the variation between bones may not have been captured sufficiently. Approximate 95% confidence intervals (CI) were calculated for mean strength as a ratio
CME Avery
188
(x100) of bone after osteotomy. Parametric methods were used to test for increased strength relative to a bone after osteotomy (Student’s 2 sample t test) and for differences between the strengths of different plates (ANOVA). Approximate 95% confidence intervals (CI) were calculated for mean strength as a ratio (x100) of bone after osteotomy and evidence that bone or bone and plate were stronger was tested using the one-sample t test.
RESULTS The statistical analysis is presented in Tables 3 and 4. The results in Table 3 are expressed as a ratio 100 X (intact bone/bone with osteotomy) to obtain a percentage value for the pair, with the baseline value for bone with an osteotomy being 100. The wide confidence intervals with some results reflect the small number of pairs, and the variability in the increased strength ratios of individual pairs. The one sample t test examines whether the mean ratio is significantly different from 100, where 100 implies that the intact bone or the bone and plate has the same strength as the bone after osteotomy. In Table 4 the two sample t test compares the mean of the bone and plate with the mean for the intact bone. Table 3. Increased strength of the bone with an osteotomy and reinforced with a plate
Torsion groups 1 Intact 2 DCP cortex 3 DCP section 4 Reconstruction section 5 Titanium section Torsion groups 2 to 5 All torsion Bending groups 1 Intact 2 DCP cortex 3 DCP section 4 Reconstruction section 5 Titanium section Bending groups 2 to 5 All bending
No of pairs
How much stronger than a bone with an osteotomy Mean SE 95% CI for ratio x100* mean
Evidence of bone or bone and plate stronger than bone with an osteotomy (One-sample t test p value)
5 5 5 5 5 20 25
145 173 179 166 127 161 158
13 24 28 14 6 10 9
110 to 181 107 to 240 101 to 257 126 to 206 110 to 143 140 to 183 140 to 176
0.02 0.04 0.05 0.01 0.01 <0.001 <0.001
5 5 5 5 5 20 25
288 578 231 182 142 284 283
50 38 36 13 17 42 34
150 to 420 473 to 684 131 to 331 147 to 217 94 to 190 196 to 370 213 to 355
0.02 <0.001 0.02 0.003 0.07 <0.001 <0.001
DCP = Dynamic compression plate. * For example, an intact bone has 145% of the mean strength of a bone with an osteotomy or is approximately 45% stronger.
The Biomechanical Basis for Internal Fixation…
189
Table 4. Percentage of strength restored by reinforcement of a bone with an osteotomy
Torsion groups 1 Intact 2 DCP cortex 3 DCP section 4 Recon section 5 Titanium section Bending groups 1 Intact 2 DCP cortex 3 DCP section 4 Recon section 5 Titanium section
Nos of Pairs
Mean moment (Nm)
SE
Percentage strength restored
2-sample t test (p value)
5 5 5 5 5
23.0 23.2 22.4 16.4 17.4
2.0 2.0 2.4 1.1 0.7
101 97 71 76
0.95 0.85 0.02 0.03
5 5 5 5 5
173 139 80.4 64.3 45.9
25 11 13 7.2 7.3
80 46 37 27
0.25 0.01 0.003 0.001
DCP = Dynamic compression plate.
Torsion Testing The mean strength of the intact bone was 45% greater than the bone after osteotomy (P=0.02). The reinforced bone, with an osteotomy, was on average 61% stronger than the unreinforced bone (P<0.001) for groups 2 to 5. The mean increase in strength with an anterior or posterior DCP was 73% and 79%, respectively. The reconstruction (66%) and titanium (27%) plate constructs were weaker (Table 3). The mean strength of a reinforced bone, with an osteotomy, was compared with an intact bone (100%). The anterior (97%) and posterior (101%) DCP constructs were of similar strength. The reconstruction (71%) and titanium (76%) plate constructs were weaker (Table 4). Spiral or oblique fracture occurred at the angle of the osteotomy, the section defect, between screw holes, or within the shaft of an intact bone.
Four-Point Bending Test The mean strength of the intact bone was 188% greater than that of the bone after osteotomy (P=0.02). The reinforced bone, with an osteotomy, was on average 184% stronger than the unreinforced bone (P<0.001) for groups 2 to 5. The mean increase in strength with a posterior DCP (478%) was greater than with an anterior DCP (131%). The reconstruction (82%) and titanium (42%) plate constructs were weaker (Table 3). The mean strength of a reinforced bone, with an osteotomy, was compared with an intact bone (100%). The posterior DCP (80%) was significantly stronger than an anterior DCP (46%) (2 sample t test P=0.01; Mann-Whitney U test P=0.03). The reconstruction (37%) and
190
CME Avery
titanium (27%) plates were weaker (Table 4). The difference in mean strengths between the 4 constructs was significant (ANOVA P<0.001, Kruskal-Wallis P=0.005). Intact bones failed with a transverse fracture across the shaft. Bones with an osteotomy failed with a transverse fracture at the angle of the osteotomy or within the section defect. Bones that had been reinforced failed at the screw holes or at the angle of the osteotomy site.
DISCUSSION The intact tibia is significantly stronger than the osteotomised tibia in both bending and torsion. The tibia is able to withstand much greater bending forces. This is consistent with the hypothesis that most radial fractures are caused by relatively low-energy forces [6,7], and with torsional forces being responsible for most of these fractures. A bone plate in either the anterior or posterior position significantly increases the strength of an osteotomised bone. The DCP is the strongest form of reinforcement and a DCP in either the anterior or posterior position restores the strength, in torsion, of an osteotomised bone to that of intact bone. Reinforcement with a reconstruction or a titanium plate was weaker than an intact bone. A posterior DCP restored 80% of the bending strength of intact bone and was significantly (P=0.01) stronger than an anterior DCP (46%). This is consistent with the tension band principle [22]. A tension band restores the load-bearing capacity of an eccentrically loaded bone, whilst minimising the forces borne by the fixation device. To be effective the tensile forces must be converted to compressive forces, as bone is strongest when loaded in compression. In this case the plate would exert a force equal in magnitude but opposite in direction to the bending moment created by the tensile force. Hence a plate on the intact cortex should be the strongest form of reinforcement. There are a number of factors that contribute to an assessment of the potential strength of a particular form of reinforcement. The weakest reinforcement in both torsion and bending was the titanium plate, despite a high yield strength and modulus of elasticity closest to that of bone [23]. Bone is more flexible than either stainless steel (E 200 GPa) or titanium (E 110 GPa) [24]. There should be greater sharing of the load between the bone and titanium plate, with the potential for less stress shielding in the longer-term [23,24]. However, it was difficult to adapt the titanium plate passively to the surface of the bone. This probably induced stress within the bone and at the screw holes. Once a load was applied the bone deformed faster than the plate. The screws should transfer part of the load to the plate, which protects the bone until the defect fractures. However, fracture occurred first at the screw holes because of the concentration of stress [25]. This then unloads the plate and transfers the entire load to the bone, which then fractures at the section defect. The reconstruction plate was more readily adapted to the contour of the bony surface as it is more malleable and may be manipulated around the long axis but the design is not as strong as the DCP [26]. Comparisons between the groups of paired bones and other studies are constrained by the relatively small numbers and lack of direct linkage between the groups. In addition care should be taken when comparing reports using different techniques of osteotomy and variable section defects. In the current study the mean bending strength retained by the osteotomised tibia was similar to that reported by Meland et al [7] and Bowers et al [1] but the retained
The Biomechanical Basis for Internal Fixation…
191
strength in torsion was much greater (Tables 1 and 5). Drilling out the corner of the osteotomy and removing 40%, rather than 50%, of the circumference may have contributed to the greater retained strength but the difference was quite large. These factors were not independently tested. Meland et al [7] claimed that an intact tibia was stronger in torsion than the human radius, but this effect was lost when bones with an osteotomy were compared. However, the ratio of the torque strength values for bones that were intact (22%) and after an osteotomy (21%) was actually similar, so this statement was incorrect. Therefore the sheep tibia is probably an adequate but not an ideal model for the radius. This is not surprising as the sheep tibia is relatively short and stout in comparison to the human radius. Table 5. Reinforcement of the radius and tibia after osteotomy Bowers 2000 Avery 2005 Type of bone Fresh human radius Preserved sheep tibia Number of pairs 20 50 Length of osteotomy (cm) 8 6 Amount of bone removed 50% cross-section 40% circumference Type of plate and position DCP cortex DCP cortex & section Percentage retained strength of bone with osteotomy: intact bone (100%) Torsion 18 69 4-point bending 24 35 Percentage retained strength of bone with osteotomy + DCP cortex: intact bone (100%) Torsion 63 101 4-point bending 73 80 Percentage retained strength of bone with osteotomy + DCP section: intact bone (100%) Torsion 97 4-point bending 46 DCP = Dynamic compression plate.
Bowers et al [1] showed that the human radius with an osteotomy and a DCP in the posterior position was 4 times stronger in torsion than an unreinforced bone; it restored a mean of 63% of the strength of an intact bone (Table 5). In the current study reinforcement increased the mean strength by a factor of 1.6. The restoration of strength with a DCP in either position was greater than that reported by Bowers et al [1] (Table 3). This may partly reflect the relative strength of the sheep tibia. Another factor is that, unlike Bowers et al [1], monocortical screws were not placed in the section defect, to avoid concentration of stress and removal of load-bearing bone [25]. Placing monocortical screws weakened the construct. In addition the radial bones used were from elderly patients and may have been correspondingly weak, particularly if from female patients [27,28]. In the same study the mean bending strength with reinforcement was 2.7 times greater than that of an osteotomised radius. This is comparable with a factor of 2.8 in the current study. The bending strengths retained with a posterior DCP were also similar, 80% and 73%, respectively (Table 5).
192
CME Avery
This biomechanical study and that of Bowers et al [1] has demonstrated that prophylactic internal fixation restores sufficient strength to reduce the risk of fracture of the residual radius. However, this effect has not been quantified with an in vivo study. The strengthening effect is supported by the clinical experience of the author [29] and others who have reported relatively low rates of fracture ranging from zero [13,14,16] to 9.6% [15] at a total of 246 plated donor sites. The latter figure of 9.6% was reduced to zero once the practice of inserting monocortical screws within the defect was discontinued [15]. Only one fracture was treated with secondary surgery. The most appropriate position for the plate remains debatable. The anterior and posterior positions are equally effective in resisting torsional forces. A posterior plate resists greater bending forces but requires additional dissection. This strengthening advantage is probably not relevant in clinical practice as it is likely that a fracture will occur first as the result of a lower torsional force. There is no study that compares the morbidity of the two surgical approaches and position used is a matter of personal preference.
CONCLUSION The sheep tibia is an acceptable model for studying the biomechanics of the radial donor site. It is probably a relatively strong bone in comparison to the human radius. The tibia was able to withstand much greater bending loads than torsional forces. An osteotomy significantly weakens a bone and placing a plate on either the anterior or posterior surface significantly strengthens an osteotomised bone. The dynamic compression plate was the strongest reinforcement in both torsion and bending. A plate in either the anterior or posterior position restored the strength of the osteotomised bone to that of an intact bone when subjected to torsional forces. The posterior plate had a significantly greater strengthening effect than an anterior plate under bending loads. On the basis of these findings the use of prophylactic internal fixation is recommended for the management of all radial osteocutaneous donor sites. The additional strengthening effect of the posterior plate in bending is probably not relevant in clinical practice as the radius is likely to fracture first as a result of lower torsional forces.
REFERENCES [1] Bowers KW, Edmonds JL, Girod DA, Jayaraman G, Chua CP, Toby EB. Osteocutaneous radial forearm free flaps. The necessity of internal fixation of the donor-site defect to prevent pathological fracture. J Bone Joint Surg Am 2000;82(5):694-704. [2] Thoma A, Khadaroo R, Grigenas O, Archibald S, Jackson S, Young JE, et al. Oromandibular reconstruction with the radial-forearm osteocutaneous flap: experience with 60 consecutive cases. Plast Reconstr Surg 1999;104(2):368-78; discussion 379-80. [3] Clark S, Greenwood M, Banks RJ, Parker R. Fracture of the radial donor site after composite free flap harvest: a ten-year review. Surgeon 2004;2(5):281-6.
The Biomechanical Basis for Internal Fixation…
193
[4] Richardson D, Fisher SE, Vaughan ED, Brown JS. Radial forearm flap donor-site complications and morbidity: a prospective study. Plast Reconstr Surg 1997;99(1):10915. [5] Markolf KL, Lamey D, Yang S, Meals R, Hotchkiss R. Radioulnar load-sharing in the forearm. A study in cadavera. J Bone Joint Surg Am 1998;80(6):879-88. [6] Swanson E, Boyd JB, Mulholland RS. The radial forearm flap: a biomechanical study of the osteotomized radius. Plast Reconstr Surg 1990;85(2):267-72. [7] Meland NB, Maki S, Chao EY, Rademaker B. The radial forearm flap: a biomechanical study of donor-site morbidity utilizing sheep tibia. Plast Reconstr Surg 1992;90(5):76373. [8] Timmons MJ, Missotten FE, Poole MD, Davies DM. Complications of radial forearm flap donor sites. Br J Plast Surg 1986;39(2):176-8. [9] Frankel VHB, A.H. Load capacity of tubular bone. In: Kenedi RM, editor. Biomechanics and related bio-engineering topics. New York: Permagon Press; 1965. p. 381-396. [10] Clark CR, Morgan C, Sonstegard DA, Matthews LS. The effect of biopsy-hole shape and size on bone strength. J Bone Joint Surg Am 1977;59(2):213-7. [11] Hipp JA, McBroom RJ, Cheal EJ, Hayes WC. Structural consequences of endosteal metastatic lesions in long bones. J Orthop Res 1989;7(6):828-37. [12] Nunez VA, Pike J, Avery C, Rosson JW, Johnson P. Prophylactic plating of the donor site of osteocutaneous radial forearm flaps. Br J Oral Maxillofac Surg 1999;37(3):210-2. [13] Villaret DB, Futran NA. The indications and outcomes in the use of osteocutaneous radial forearm free flap. Head Neck 2003;25(6):475-81. [14] Kim JH, Rosenthal EL, Ellis T, Wax MK. Radial forearm osteocutaneous free flap in maxillofacial and oromandibular reconstructions. Laryngoscope 2005;115(9):1697-701. [15] Werle AH, Tsue TT, Toby EB, Girod DA. Osteocutaneous radial forearm free flap: its use without significant donor site morbidity. Otolaryngol Head Neck Surg 2000;123(6):711-7. [16] Militsakh ON, Werle A, Mohyuddin N, Toby EB, Kriet JD, Wallace DI, et al. Comparison of radial forearm with fibula and scapula osteocutaneous free flaps for oromandibular reconstruction. Arch Otolaryngol Head Neck Surg 2005;131(7):571-5. [17] Wittkampf AR, Starmans FJ. Prevention of mandibular fractures by using constructional design principles. I. Computer simulation of human mandibular strength after segmental resections. Int J Oral Maxillofac Surg 1995;24(4):306-10. [18] Wittkampf AR, Wittkampf FH, van den Braber W. Prevention of mandibular fractures by using constructional design principles. II. A tension strength test on beagle mandibles with two different types of segmental resections. Int J Oral Maxillofac Surg 1995;24(4):311-2. [19] Soutar DS, Scheker LR, Tanner NS, McGregor IA. The radial forearm flap: a versatile method for intra-oral reconstruction. Br J Plast Surg 1983;36(1):1-8. [20] Urken MC, ML. Sullivan, MJ. Biller, HF. Radial forearm. In: Urken M, editor. Atlas of regional and free flaps for head and neck reconstruction. First ed. New York: Raven; 1995. p. 149-168. [21] Rimnac CM, Wright TM, McGill DL. The effect of centrifugation on the fracture properties of acrylic bone cements. J Bone Joint Surg Am 1986;68(2):281-7.
194
CME Avery
[22] Perren SM. Basic aspects of internal fixation. In: Muller MEA, M. Schneider, R. Willenegger, H., editor. Manual of internal fixation. Berlin: Springer; 1991. p. 1-158. [23] Wright TML, SL. Principles and methods. In: Buckwalter JE, T. Simon, S., editor. Orthopaedic basic science: biology and biomechanics of the musculoskeletal system. 2nd ed. Rosemont: American Academy of Orthopaedic Surgeons; 2000. p. 181-215. [24] Uhthoff HK, Bardos DI, Liskova-Kiar M. The advantages of titanium alloy over stainless steel plates for the internal fixation of fractures. An experimental study in dogs. J Bone Joint Surg Br 1981;63-B(3):427-84. [25] Brooks DB, Burstein AH, Frankel VH. The biomechanics of torsional fractures. The stress concentration effect of a drill hole. J Bone Joint Surg Am 1970;52(3):507-14. [26] Schatzker J. Screws and plates and their application. In: Muller MEA, M. Schneider, R. Willenegger, H., editor. Manual of internal fixation. 3rd ed. Berlin: Springer; 1991. p. 179-290. [27] Sowers MR, Clark MK, Hollis B, Wallace RB, Jannausch M. Radial bone mineral density in pre- and perimenopausal women: a prospective study of rates and risk factors for loss. J Bone Miner Res 1992;7(6):647-57. [28] Itoh S, Tomioka H, Tanaka J, Shinomiya K. Relationship between bone mineral density of the distal radius and ulna and fracture characteristics. J Hand Surg [Am] 2004;29(1):123-30. [29] Avery CM, Danford M, Johnson PA. Prophylactic internal fixation of the radial osteocutaneous donor site. Br J Oral Maxillofac Surg 2006, doi:10.1016/j.bjoms.2006.08.025.
In: Oral Cancer Research Advances Editor: Alexios P. Nikolakakos, pp. 195-210
ISBN 978-1-60021-864-4 © 2007 Nova Science Publishers, Inc.
Chapter 8
THE CURRENT ROLE OF PROPHYLACTIC INTERNAL FIXATION OF THE RADIAL OSTEOCUTANEOUS DONOR SITE CME Avery Department of Maxillofacial Surgery, University Hospitals of Leicester, United Kingdom.
ABSTRACT The radial osteocutaneous donor site is dramatically weakened at the site of the osteotomy despite bevelling of the osteotomy cut and limiting the amount of bone removed. Fracture results in considerable morbidity particularly if healing is not ideal. The incidence of fracture remains relatively high, ranging from 0% to 66%, with a mean of 25%. The largest studies have recently reported fracture rates of 15% and 18% and the incidence of secondary surgery, for fractures, was also high, 67% and 46% respectively. Clinical and biomechanical evidence now supports the routine use of prophylactic internal fixation of the radial donor site with a dynamic compression plate to reduce the incidence of fracture and the need for secondary surgery. The plate is effective in either an anterior or posterior position and the choice of site is a matter of surgeon preference. This chapter describes the clinical experience of the author with the anterior approach to internal fixation. In a retrospective review of a series of 28 donor sites the incidence of fracture was 3.6% (1 out of 28). The single fracture was undisplaced and secondary surgery was not indicated. In the literature the incidence of fracture with a plate in the anterior or posterior position is relatively low. To date 268 donor sites have been managed with prophylactic internal fixation and only 7 have fractured, of which only one underwent secondary surgery. The incidence of reported complications related to the technique is also low and very few plates have been replaced or removed. The technique of prophylactic internal fixation allows the surgeon to safely harvest a modest volume of bone, which in conjunction with the excellent soft-tissue paddle means that the radial osteocutaneous flap retains a wide range of potential applications. However, in the current practice of the author, and many others, the radial flap remains a
CME Avery
196
compromise choice or back-up flap. Recent indications have included relatively small defects of the maxilla, older patients that are unlikely to undergo dental implantation, patient preference and if there is significant peripheral vascular disease or poor general health that will be exacerbated by use of an alternative donor site.
INTRODUCTION The potential complications at the osteocutaneous donor site are the same as those encountered after harvest of a soft-tissue flap but also include fracture of the remaining radius. The incidence of fracture in early reports varied from 28.5% to 43% [1-6]. Following fracture of the radius movement of the wrist is often restricted and grip or pinch strength is reduced, particularly if healing is not ideal [4,5]. It has been claimed that a keel or bevelled shaped osteotomy may reduce the frequency of fracture. Swanson [7] reported an incidence of 8% (1 out of 13) and Weinzweig [8] 5.2% (1 out of 19) but the number of donor sites were small. Fractures were attributed to excessive removal of bone, creation of points of stress concentration by over-cutting and inadequate immobilisation. Table 1. The weakening effect of an osteotomy
Model Number of bone pairs Type of osteotomy Amount of bone removed Length of bone removed Mean strength in torsion of osteotomised compared to intact bone (100%) Mean strength in bending of osteotomised compared to intact bone (100%)
Swanson 1990 Preserved human radii 20 Right-angle and bevel
Meland 1992 Sheep tibiae
1/3 of diameter 9 cms
45 Right-angle, keel and bevel 30-50% cross-section 1-4 diameter lengths
-
14.7 to 25.9
24
-
The patterns of physiological loading of the radius and the dissipation of forces by the musculature have not been studied in vivo. In biomechanical studies of the cadaveric forearm the radial bone bears most of the forces in axial loading [9]. The weakening effect of an osteotomy is substantial. The mean strength in bending of an osteotomised preserved human radius is 24% of an intact radius [7] (Table 1). A bevelled osteotomy was not significantly stronger than a right-angled osteotomy. The preserved human radius is a reasonable model as the biomechanics are similar to those of a fresh bone [10]. The sheep tibia model has been validated by comparison with the preserved radius [11]. The retained strength in torsion after removal of 30% (¼ diameter) of the cross-sectional area of the tibia was 25.9% and after removal of 50% was 14.7%. A bevelled osteotomy was statistically stronger but the actual
The Current Role of Prophylactic Internal Fixation…
197
effect was minimal (5%) and of no clinical importance. Alternative donor sites were recommended because “the small changes in the stability of the remaining cortical bone associated with variations in shape, width, depth or length of osteotomy defect are irrelevant in comparison with the 70 to 80 percent decrease in strength and stiffness caused by even the smallest ostectomy defect” [11]. The main weakening effect of an osteotomy comes from the disruption of the integrity of the cortex [2] and creation of an “open-section” defect [11,12]. This causes a significant loss of strength in torsion by reducing the ability of the bone to absorb energy [10,13]. The greatest effect is on bones, such as the radius, with thin cortical walls or long transcortical defects [14]. Most fractures of the radius are spiral and are probably caused by relatively lowenergy torsion forces, as the radius is able to withstand much greater bending forces [7,11,15]. Table 2. Morbidity at the osteocutaneous donor site
Type of study Number of donor sites Mean age in years (range) Male:female Type of osteotomy Mean bone length in cms (range) Percentage of radial circumference External support cast (weeks) Number of donor sites with PIF (type) Incidence of fracture % (n) Incidence of secondary surgery % (n)
Thoma 1999 Retrospective 60 60 (26-86) 38:22 Keel 9.4 (5-14) Below-elbow (-) 0 15 (9) 67 (6)
Clark 2004 Retrospective 71 62* (-) 49:22 Bevel and right-angle 7.7 (5-11) Above-elbow (8) 3 (2 plates, 1 nail) 18 (13) 46 (6)
* Mean age of fracture group is 60 years and no fracture group is 62 years.
In the first prospective study of morbidity at the radial donor site Richardson [16] reported a fracture rate of 17% (6 out of 35). The type of osteotomy used was not specified. Function of the hand was restricted at 36% of donor sites without fracture and 100% with fracture. Fractures that fail to unite or become significantly displaced often require secondary surgery, with external fixation and non-vascularised [17] or vascularised bone grafting [18]. In a recent review of the literature the incidence of fracture at the radial donor site remained relatively high, ranging from 0% to 66%, with a mean of 25% [15]. The two largest retrospective series have also recently reported high rates of fracture and secondary surgery. In 1999 Thoma [19] reviewed 60 donor sites managed with a keel shaped osteotomy and a below-elbow cast, the incidence of fracture was 15%. The recognised causes of fracture were excessive weight bearing or activity. Fracture was not linked to age, gender or size of the bone section. Internal fixation and bone grafting was necessary for 67% of the fractured donor sites yet all were reported as having a “successful outcome”. Despite the additional morbidity of a secondary surgical procedure the flap was considered a “first line” choice for reconstruction of the mandible. In 2004 Clark [12] reported on 71 donor sites, of which 68
CME Avery
198
were managed without internal reinforcement and 3 had internal fixation. The incidence of fracture was 18%, of which 46% required secondary surgery. Fractures occurred despite an above-elbow back-slab cast and were attributed to excessive removal of bone. The type of osteotomy was not a significant factor. Prophylactic internal fixation (PIF) of the radial donor site was advised, particularly for female patients (Table 2). The radial donor site may be strengthened to reduce the risk of fracture. The technique of PIF, using a dynamic compression plate (DCP), was first described in 1999 by the author [20]. A DCP was placed across the section defect using a conventional anterior surgical approach. The significant strengthening effect of internal fixation at both the posterior (opposite intact cortex) and anterior (over section defect) position has since been confirmed in biomechanical studies by Bowers [15] and the author [21]. This chapter describes the clinical experience of the author with the anterior approach to prophylactic internal fixation of the radial osteocutaneous donor site.
Figure 1. The osteocutaneous radial flap.
THE SURGICAL TECHNIQUE OF INTERNAL FIXATION The osteocutaneous flap is harvested using the conventional anterior approach [22] (Figure 1). A subfascial dissection technique was used until superseded by the incomplete suprafascial technique [23] (Figure 2). A cuff of the flexor pollicis longus muscle is removed together with a third to one half of the circumference of the radius. An instrument is used to measure the distance to the posterior border of the radius to avoid excessive bone removal, particularly in the mid-section where the radius is curved (Figure 3). In addition, the crosssection of the radius is triangular and 40% of the circumference approximates to the minimum width of radius on a radiograph in the anteroposterior plane [24]. The osteotomy cuts are bevelled or keel shaped to improve the surgical access and reduce the risk of overcutting (Figure 4). The distal osteotomy cut is made at least 2 cms from the radial styloid to allow sufficient space for two distal screws. The proximal and distal muscle attachments are
The Current Role of Prophylactic Internal Fixation…
199
stripped and then reattached at the end of the procedure. A 3.5 mm plate is placed on the anterior or antero-medial surface and retained with a minimum of 2 bicortical screws at each end (Figure 5). The screw holes are tapped out to the correct length and the screws are placed in a neutral (non-compressive) position with the plate acting as a bridging plate. Care is taken to approximate the flexor pollicus longus and brachioradialis muscles to cover the plate (Figure 6) and the radial defect is then repaired with a skin graft. The author prefers to use a negative pressure wound dressing to encourage healing of the skin graft [25]. For long section defects a reconstruction plate may be placed as it is more malleable and easier to adapt to the radius but it is a weaker form of reinforcement [21]. When there is insufficient distal space a T-shaped plate may be inserted (Figures 7 –9). A complete above or belowelbow plaster cast is applied and the arm initially supported in a sling. A below-elbow lightweight cast is placed when the skin graft at the radial donor site is inspected, usually by the 10th day after surgery A prefabricated cast may be used [26]. External support is provided for a total of 6 weeks while gentle physiotherapy of the wrist and hand is commenced. Strict advice is given on avoiding load bearing.
Figure 2. Suprafascial dissection over the ulna aspect and subfascial dissection on to the radius.
Figure 3. Posterior border of radius identified.
200
CME Avery
Figure 4. A bevelled or keel-shaped osteotomy is preferred.
Figure 5. A 3.5 mm DCP on the antero-medial surface.
METHODS The operations were performed between December 1995 and July 2001 at the Royal Surrey County Hospital, Guildford, United Kingdom and between May 2000 and April 2007 at the University Hospitals of Leicester, Leicester, United Kingdom. The case-records were reviewed retrospectively, although more recent data were collected prospectively. Data included; patient details, age, gender, type of osteotomy and length of bone section, type of fixation plate, site of fracture, size of radial donor site skin defect, type of skin graft and wound complications. The length of the bone section was measured on a lateral radiograph of the forearm. A radiograph was obtained each time the cast was removed to exclude a fracture.
The Current Role of Prophylactic Internal Fixation…
201
Figure 6. Approximation of the flexor muscles to cover the plate.
Figure 7. A reconstruction plate over a long section defect.
RESULTS Thirty-one consecutive patients were reconstructed with osteocutaneous flaps for oral malignancy involving the mandible [21] and maxilla [10] (Table 3). Three patients did not have PIF because of lack of a suitable plate and one of these donor sites fractured. These patients are excluded from further analysis. Five patients died, without fracture, within 30 days of surgery and this reflects the often elderly and infirm nature of this subgroup of patients. The 3.5 mm plates used included 24 steel DCP, 2 titanium DCP, 1 reconstruction and 1 T-shape plate (STRATEC Medical Ltd. UK and DePuy International Ltd. UK).
202
CME Avery
The incidence of fracture was 3.5% (1 out of 28). A single fracture occurred in a 51-year old male 10 weeks after surgery. The fracture was undisplaced and managed conservatively. Insufficient distal space had been left when creating the osteotomy site and because a Tshaped plate was unavailable a DCP was inserted with only 1 distal screw, which weakened the reinforcement. There were no significant wound infections, none of the plates were removed and all of the skin grafted donor sites healed without delay.
Figure 8. A minimum of two proximal and distal bicortical screws.
Figure 9. A T-shaped plate.
The Current Role of Prophylactic Internal Fixation…
203
Table 3. Prophylactic internal fixation of the osteocutaneous donor site Author Type of study Number of donor sites Donor sites with PIF Mean age in years (range) Male: female Mean followup in months (range) Type of osteotomy Mean length of bone in cms (range) Radial circumferenc e% Site of plate fixation Type of fixation plate External cast (weeks) Incidence of fracture % (n) Secondary surgery % (n)
Werle 2000 Retrospective 54
Villaret 2003 Retrospective 34
Militsakh 2005 Retrospective 108
Kim 2005 Retrospective 52
Avery 2007 Retrospective 31
52
34
108
52
28
62 (16-89)
- (54-76)
62 (16-93)
63 (16-87)
67 (25-89)
30:24* 16 (0-45)
28:6 28 (7-54)
68:40 29 (1-116)
34:18 - (4-33)
13:15 32.5 (0-86)
Bevel
Bevel
Bevel
Keel
Bevel or Keel
7.6 (5.5-12)
-
6.6 (3-12)
6.3 (3-11)
7 (4-9.5)
50
40
50
-
33-50
Posterior
Anterior
Posterior
Anterior
Anterior
Steel DCP, LC-DCP, reconstruction Below-elbow (1)
Steel DCP
Steel DCP
Steel DCP
9.6 (5)
Below-elbow (1) 0 (0)
Below-elbow (1) 0 (0)
Below-elbow (1) 1.9 (1)
Steel DCP, titanium DCP, reconstruction Below-elbow (6) 3.6 (1)
0 (0)
0 (0)
0 (0)
100 (1)
0 (0)
- Data not available; LC-DCP = limited contact dynamic compression plate.
DISCUSSION Prophylactic internal fixation has been shown to prevent pathological fracture of the long bone [27-30]. The first description of PIF at the radial donor site was a case-report utilising an intramedullary nail [31] but the nail was too short to resist rotational forces [32]. The current author later reported the use of PIF with a steel DCP at 8 radial donor site defects at the time of flap harvest [20]. The DCP was placed in an anterior or antero-medial position. A moderate amount of bone was harvested without fracture. A subsequent report of 22 plated donor sites supported these findings [33]. The incidence of fracture at that time was 4.5% (1 out of 22).
204
CME Avery
The strengthening effect of a plate in the posterior position, on the intact cortical surface opposite the donor site section defect, was reported in a biomechanical study by Bowers [15]. A comparable strengthening effect of a plate in either the anterior or posterior position has been reported by the author in a study using the sheep tibia model [21]. An osteotomised tibia was significantly weaker than an intact bone. A plate in either the anterior or posterior position significantly strengthened an osteotomised bone. The dynamic compression plate was the strongest reinforcement in both torsion and bending. In torsion a plate in either position restored the strength of the osteotomised bone to that of an intact bone. The tibia was able to withstand much greater loads in bending. The posterior plate had a significantly greater strengthening effect, than an anterior plate, under bending loads but this is probably not relevant in clinical practice as the radius is likely to fracture first at a lower torsional force. Four retrospective clinical series have been published following the original description of the technique, with an incidence of fracture that ranges from zero to 9.6% (Table 3). The posterior cortex was plated in two articles. Werle [34] reported an incidence of fracture of 9.6% (5 out of 52). The fractures all occurred in the initial part of the series when monocortical screws were inserted within the section defect. This practice removed loadbearing bone, created areas of stress concentration and weakened the reinforcement [35,36]. However, none of the fractures were displaced and all were managed conservatively. In the largest operative series Militsakh [37] omitted some technical details but clarified these in a personal communication [38]. There were no “significant” fractures at 108 donor sites. This comment is based on the observation that some forearms were not radiographed after surgery but none of these patients were symptomatic. In the other two articles the plate was placed in an anterior position. Villaret [39] managed 34 donor sites without fracture and Kim [40] reported one fracture out of 52 donor sites (1.9%). The amount of the radius removed in these reports was similar to the current series. The high proportion of males in the series by Villaret [39] is noted but only Clark [12] has linked females to an increased risk of fracture. In the current series the fracture rate was also low (3.6%) and the single fracture was caused by a technical error. The relatively inaccessible posterior cortex has been plated for two reasons. Firstly, it is a strong reinforcement, particularly under bending loads, and secondly it was an attempt to avoid problems with healing of the skin graft. However, the incidence of skin graft loss reported by both Werle [34] and Militsakh [37] was high, 43% and 30% respectively. In the current series healing at the donor sites occurred without complication or delay and no plates were removed. The author prefers to use an incomplete suprafascial dissection technique and a negative pressure wound dressing to improve graft healing [25]. Nevertheless, it is important to carefully approximate the flexor musculature and ensure the plate is adequately covered. There are no studies that directly compare the morbidity of the anterior and posterior surgical approaches. An additional advantage of PIF is that fractures typically remain undisplaced and secondary surgery is often unnecessary. In contrast the rates of secondary surgery reported by Thoma [19] and Clark [12] were relatively high, 67% and 46% of fractures respectively (Table 2). Thoma [19] claimed healing was successful after surgical repair but offered no
The Current Role of Prophylactic Internal Fixation…
205
objective evidence. The incidence and severity of functional loss is likely to be lower with PIF but this is unproven [34]. Both Werle [34] and Villaret [39] used a below-elbow cast as an external support for only one week. The author prefers to provide external support for 6 weeks as the remodelling of bone takes several weeks [41-43]. However, the ideal duration of external support remains unknown. A variety of techniques have been used at the unreinforced donor site including; a full above-elbow plaster cast for 6 weeks with fracture rates of 23% (4 out of 17) [5] and 17% (6 out of 35) [16] or 8 weeks support with a fracture rate of 8% (1 out of 13) [7] and a thermoplastic below-elbow cast with no fractures (0 out of 15) [26]. The type and duration of external support may be an important factor in the prevention of fracture but the effectiveness of these techniques cannot be assessed. A survey of orthopaedic surgeons in the United Kingdom recommended 6 weeks in a complete above-elbow cast [44]. However, a belowelbow cast allows earlier mobilisation of the elbow and would appear to be sufficient if internal fixation has been applied and load-bearing is avoided. The technique of PIF has been criticised by Rockwell [45] who claimed that fractures were becoming less frequent and the method was not cost-effective in the Canadian health care system. However, the fracture rate in their report was still quite high, 15% [19]. Militsakh [37] noted the length of stay in intensive care facilities was shorter, and therefore the expense was lower, with a radial osteocutaneous flap rather than other free flap donor sites. There are many variable factors involved in a cost analysis but the insertion of a permanent plate on the radius is a small element. In the longer term a plate has the potential for causing a stress protection effect leading to localised osteopenia and late fracture. The mechanism may be mechanical unloading [41,46-48] or reduced perfusion [43,49,50] of the cortical bone. In the current study 3.5 mm plates were used as they are of sufficient strength to resist fracture but less likely to cause osteopenia than heavier plates [51-54]. A limited contact DCP may reduce the risk of osteopenia [49] but this is controversial [48]. Werle [34] used limited contact plates and reported radiographic evidence of bone remodelling without osteopenia. In the current study thirteen donor sites were radiographed six months or later after operation and all had a degree of bone-infill and remodelling of the cortex. Attempts to quantify the extent of the remodelling with ultrasound and magnetic resonance imaging were not sufficiently reproducible. Finally, the removal of a plate from the forearm is associated with a small but significant risk of nerve injury and late fracture, therefore asymptomatic plates should not be routinely removed [45,53-56]. To date of the 274 plates inserted for PIF in the literature, including this chapter, only two have required removal and one was replaced for an early fracture. The clinical role of the osteocutaneous radial flap has been compromised by two main factors. To reduce the risk of fracture the volume of bone harvested is restricted to 40 to 50% of the circumference [5,22,57], or one third of the diameter [7], or 30% of the cross-sectional area [11]. This volume of bone is often insufficient for dental implants and other sites now provide greater bone stock [58-60]. However, the incidence of fracture remains high because even a small osteotomy leads to a dramatic weakening of the radial bone. In the opinion of the author the most serious complication at the osteocutaneous donor site is relatively frequent and early fracture. The benefits of PIF in reducing the incidence of fracture and the need for secondary surgery outweigh the potential complications of plate infection, stress
206
CME Avery
protection and late fracture. The use of PIF significantly strengthens the remaining radial bone and allows the surgeon to harvest a modest volume of bone. A subgroup of patients that would not benefit from PIF has not yet been identified. A direct comparison of different management strategies is unlikely because a multicentre trial would probably be needed. The osteocutaneous radial flap has become increasingly popular again following the introduction of PIF. Villaret [39] believes that the clinical indications for the flap have been expanded. Militsakh [37] has used it as the flap of choice for reconstruction of the mandible including the treatment of osteoradionecrosis. However, for many other surgeons it remains less important as alternative donor sites with greater bone stock are usually preferred [61]. In the practice of the author the radial osteocutaneous flap currently constitutes approximately 5% of the flaps used. The introduction of the technique of PIF has consolidated the role of the osteocutaneous radial flap as a compromise or back-up flap. At the beginning of this operative series the flap was often used for reconstruction of the mandible. More recent indications have included relatively small defects of the maxilla, particularly for older patients that are unlikely to undergo dental implantation, patient preference, and if there is significant peripheral vascular disease or poor general health that will be exacerbated by the use of an alternative donor site.
CONCLUSION The radial osteocutaneous donor site is dramatically weakened by an osteotomy. Clinical and biomechanical evidence supports the routine use of prophylactic internal fixation with a dynamic compression plate. The incidence of fracture and secondary surgery is relatively low in comparison to that at the unreinforced donor site. The plate is effective in either an anterior or posterior position and the choice of site is a matter of surgeon preference. The incidence of complications reported in the literature is low and very few plates have been replaced or removed. The technique allows the surgeon to safely harvest a modest volume of bone, which in conjunction with the excellent soft-tissue paddle means that the flap retains a wide range of potential applications. In the current practice of the author, and many others, the radial flap remains a compromise choice or back-up flap. Recent indications have included relatively small defects of the maxilla, particularly in older patients that are unlikely to undergo dental implantation. Additional considerations include patient preference, and if there is significant peripheral vascular disease or poor general health that will be exacerbated by a procedure at an alternative donor site.
REFERENCES [1] McGregor IA. Fasciocutaneous flaps in intraoral reconstruction. Clin Plast Surg 1985;12(3):453-61. [2] Timmons MJ, Missotten FE, Poole MD, Davies DM. Complications of radial forearm flap donor sites. Br J Plast Surg 1986;39(2):176-8.
The Current Role of Prophylactic Internal Fixation…
207
[3] Soutar DS, McGregor IA. The radial forearm flap in intraoral reconstruction: the experience of 60 consecutive cases. Plast Reconstr Surg 1986;78(1):1-8. [4] Boorman JG, Brown JA, Sykes PJ. Morbidity in the forearm flap donor arm. Br J Plast Surg 1987;40(2):207-12. [5] Bardsley AF, Soutar DS, Elliot D, Batchelor AG. Reducing morbidity in the radial forearm flap donor site. Plast Reconstr Surg 1990;86(2):287-92; discussion 293-4. [6] Vaughan ED. The radial forearm free flap in orofacial reconstruction. Personal experience in 120 consecutive cases. J Craniomaxillofac Surg 1990;18(1):2-7. [7] Swanson E, Boyd JB, Mulholland RS. The radial forearm flap: a biomechanical study of the osteotomized radius. Plast Reconstr Surg 1990;85(2):267-72. [8] Weinzweig N, Jones NF, Shestak KC, Moon HK, Davies BW. Oromandibular reconstruction using a keel-shaped modification of the radial forearm osteocutaneous flap. Ann Plast Surg 1994;33(4):359-69; discussion 369-70. [9] Markolf KL, Lamey D, Yang S, Meals R, Hotchkiss R. Radioulnar load-sharing in the forearm. A study in cadavera. J Bone Joint Surg Am 1998;80(6):879-88. [10] Frankel VHB, A.H. Load capacity of tubular bone. In: Kenedi RM, editor. Biomechanics and related bio-engineering topics. New York: Permagon Press; 1965. p. 381-396. [11] Meland NB, Maki S, Chao EY, Rademaker B. The radial forearm flap: a biomechanical study of donor-site morbidity utilizing sheep tibia. Plast Reconstr Surg 1992;90(5):76373. [12] Clark S, Greenwood M, Banks RJ, Parker R. Fracture of the radial donor site after composite free flap harvest: a ten-year review. Surgeon 2004;2(5):281-6. [13] Clark CR, Morgan C, Sonstegard DA, Matthews LS. The effect of biopsy-hole shape and size on bone strength. J Bone Joint Surg Am 1977;59(2):213-7. [14] Hipp JA, Edgerton BC, An KN, Hayes WC. Structural consequences of transcortical holes in long bones loaded in torsion. J Biomech 1990;23(12):1261-8. [15] Bowers KW, Edmonds JL, Girod DA, Jayaraman G, Chua CP, Toby EB. Osteocutaneous radial forearm free flaps. The necessity of internal fixation of the donor-site defect to prevent pathological fracture. J Bone Joint Surg Am 2000;82(5):694-704. [16] Richardson D, Fisher SE, Vaughan ED, Brown JS. Radial forearm flap donor-site complications and morbidity: a prospective study. Plast Reconstr Surg 1997;99(1):10915. [17] Tillman RM, Smith RB. Successful bone grafting of fracture nonunion at the forearm radial flap donor site. Plast Reconstr Surg 1992;90(4):684-6. [18] Inglefield CJ, Kolhe PS. Fracture of the radial forearm osteocutaneous donor site. Ann Plast Surg 1994;33(6):638-42; discussion 643. [19] Thoma A, Khadaroo R, Grigenas O, Archibald S, Jackson S, Young JE, et al. Oromandibular reconstruction with the radial-forearm osteocutaneous flap: experience with 60 consecutive cases. Plast Reconstr Surg 1999;104(2):368-78; discussion 379-80. [20] Nunez VA, Pike J, Avery C, Rosson JW, Johnson P. Prophylactic plating of the donor site of osteocutaneous radial forearm flaps. Br J Oral Maxillofac Surg 1997;37(3):210-2. [21] Avery CM, Best A, Patterson P, Rolton J, Ponter AR. Biomechanical study of prophylactic internal fixation of the radial osteocutaneous donor site using the sheep tibia model. Br J Oral Maxillofac Surg 2006, doi:10.1016/j.bjoms.2006.10.010.
208
CME Avery
[22] Soutar DS, Scheker LR, Tanner NS, McGregor IA. The radial forearm flap: a versatile method for intra-oral reconstruction. Br J Plast Surg 1983;36(1):1-8. [23] Avery CM, Pereira J, Brown AE. Suprafascial dissection of the radial forearm flap and donor site morbidity. Int J Oral Maxillofac Surg 2001;30(1):37-41. [24] Collyer J, Goodger NM. The composite radial forearm free flap: an anatomical guide to harvesting the radius. Br J Oral Maxillofac Surg 2005;43(3):205-209. [25] Avery C, Pereira J, Moody A, Gargiulo M, Whitworth I. Negative pressure wound dressing of the radial forearm donor site. Int J Oral Maxillofac Surg 2000;29(3):198-200. [26] Marinho RO, McLoughlin P. A simple splint for the radial forearm donor site. Br J Oral Maxillofac Surg 1996;34(6):533-4. [27] Parrish FF, Murray JA. Surgical treatment for secondary neoplastic fractures. A retrospective study of ninety-six patients. J Bone Joint Surg Am 1970;52(4):665-86. [28] Ryan JR, Rowe DE, Salciccioli GG. Prophylactic internal fixation of the femur for neoplastic lesions. J Bone Joint Surg Am 1976;58(8):1071-4. [29] Fidler M. Prophylactic internal fixation of secondary neoplastic deposits in long bones. Br Med J 1973;1(5849):341-3. [30] Fidler MW, Stollard G. The management of secondary neoplastic deposits in long bones by prophylactic internal fixation. Archivum Chirurgicum Neerlandicum 1977;29(3):17785. [31] Ilankovan V, Avery BS, Putnam G. A technique to stabilize the radius after harvesting osteocutaneous flaps. Br J Oral Maxillofac Surg 1994;32(1):50-1. [32] Allen PE, Sidebottom AJ, Porter KM. Prophylactic fixation of radial donor site. Br J Oral Maxillofac Surg 1994;32(4):263. [33] Avery CM, Danford M, Johnson PA. Prophylactic internal fixation of the radial osteocutaneous donor site. Br J Oral Maxillofac Surg 2006, doi:10.1016/j.bjoms.2006.08.025. [34] Werle AH, Tsue TT, Toby EB, Girod DA. Osteocutaneous radial forearm free flap: its use without significant donor site morbidity. Otolaryngol Head Neck Surg 2000;123(6):711-7. [35] Wittkampf AR, Wittkampf FH, van_den_Braber W. Prevention of mandibular fractures by using constructional design principles. II. A tension strength test on beagle mandibles with two different types of segmental resections. International Journal of Oral and Maxillofacial Surgery 1995;24(4):311-2. [36] Brooks DB, Burstein AH, Frankel VH. The biomechanics of torsional fractures. The stress concentration effect of a drill hole. J Bone Joint Surg Am 1970;52(3):507-14. [37] Militsakh ON, Werle A, Mohyuddin N, Toby EB, Kriet JD, Wallace DI, et al. Comparison of radial forearm with fibula and scapula osteocutaneous free flaps for oromandibular reconstruction. Arch Otolaryngol Head Neck Surg 2005;131(7):571-5. [38] Militsakh ON. Prophylactic fixation of the radius. In: Avery C, editor. Kansas City; 2005. [39] Villaret DB, Futran NA. The indications and outcomes in the use of osteocutaneous radial forearm free flap. Head Neck 2003;25(6):475-81. [40] Kim JH, Rosenthal EL, Ellis T, Wax MK. Radial forearm osteocutaneous free flap in maxillofacial and oromandibular reconstructions. Laryngoscope 2005;115(9):1697-701.
The Current Role of Prophylactic Internal Fixation…
209
[41] Akeson WH, Woo SL, Rutherford L, Coutts RD, Gonsalves M, Amiel D. The effects of rigidity of internal fixation plates on long bone remodeling. A biomechanical and quantitative histological study. Acta Orthop Scand 1976;47(3):241-9. [42] Uhthoff HK, Bardos DI, Liskova-Kiar M. The advantages of titanium alloy over stainless steel plates for the internal fixation of fractures. An experimental study in dogs. J Bone Joint Surg Br 1981;63-B(3):427-84. [43] Perren SM, Cordey J, Rahn BA, Gautier E, Schneider E. Early temporary porosis of bone induced by internal fixation implants. A reaction to necrosis, not to stress protection? Clin Orthop Relat Res 1988(232):139-51. [44] Sidebottom AJ, Allen PE, Hayton M, Vaughan ED, Brown JS. Management of the radial composite donor site: an orthopaedic opinion. Br J Oral Maxillofac Surg 1999;37(3):213-6. [45] Rockwell GM, Thoma A. Should the donor radius be plated prophylactically after harvest of a radial osteocutaneous flap? A cost-effectiveness analysis. J Reconstr Microsurg 2004;20(4):297-306. [46] Uhthoff HK, Finnegan M. The effects of metal plates on post-traumatic remodelling and bone mass. J Bone Joint Surg Br 1983;65(1):66-71. [47] Terjesen T, Nordby A, Arnulf V. The extent of stress-protection after plate osteosynthesis in the human tibia. Clinical Orthopaedics and Related Research 1986(207):108-12. [48] Uhthoff HK, Boisvert D, Finnegan M. Cortical porosis under plates. Reaction to unloading or to necrosis? J Bone Joint Surg Am 1994;76(10):1507-12. [49] Muller MEA, M. Schneider, R. Willenegger, H. Basic aspects of internal fixation. In: M. A, editor. Manual of Internal Fixation. 3 ed. Berlin, Heidelberg, New York, London, Paris, Tokyo, Hong Kong, Barcelona.: Springer-Verlag; 1991. p. 1 - 158. [50] Cordey J, Perren SM, Steinemann SG. Stress protection due to plates: myth or reality? A parametric analysis made using the composite beam theory. Injury 2000;31 Suppl 3:C113. [51] Hidaka S, Gustilo RB. Refracture of bones of the forearm after plate removal. J Bone Joint Surg Am 1984;66(8):1241-3. [52] Chapman MW, Gordon JE, Zissimos AG. Compression-plate fixation of acute fractures of the diaphyses of the radius and ulna. J Bone Joint Surg Am 1989;71(2):159-69. [53] Langkamer VG, Ackroyd CE. Removal of forearm plates. A review of the complications. J Bone Joint Surg Br 1990;72(4):601-4. [54] Bednar DA, Grandwilewski W. Complications of forearm-plate removal. Can J Surg 1992;35(4):428-31. [55] Dodge HS, Cady GW. Treatment of fractures of the radius and ulna with compression plates. J Bone Joint Surg Am 1972;54(6):1167-76. [56] Langkamer VG, Ackroyd CE. Internal fixation of forearm fractures in the 1980s: lessons to be learnt. Injury 1991;22(2):97-102. [57] Urken MC, ML. Sullivan, MJ. Biller, HF. Radial forearm. In: Urken M, editor. Atlas of regional and free flaps for head and neck reconstruction. First ed. New York: Raven; 1995. p. 149-168.
210
CME Avery
[58] Martin IC, Cawood JI, Vaughan ED, Barnard N. Endosseous implants in the irradiated composite radial forearm free flap. Int J Oral Maxillofac Surg 1992;21(5):266-70. [59] Frodel JL, Jr., Funk GF, Capper DT, Fridrich KL, Blumer JR, Haller JR, et al. Osseointegrated implants: a comparative study of bone thickness in four vascularized bone flaps. Plast Reconstr Surg 1993;92(3):449-55; discussion 456-8. [60] Moscoso JF, Keller J, Genden E, Weinberg H, Biller HF, Buchbinder D, et al. Vascularized bone flaps in oromandibular reconstruction. A comparative anatomic study of bone stock from various donor sites to assess suitability for endosseous dental implants. Arch Otolaryngol Head Neck Surg 1994;120(1):36-43. [61] Zenn MR, Hidalgo DA, Cordeiro PG, Shah JP, Strong EW, Kraus DH. Current role of the radial forearm free flap in mandibular reconstruction. Plast Reconstr Surg 1997;99(4):1012-7.
In: Oral Cancer Research Advances Editor: Alexios P. Nikolakakos, pp. 211-228
ISBN 978-1-60021-864-4 © 2007 Nova Science Publishers, Inc.
Chapter 9
CYTOLOGIC DIAGNOSIS OF ORAL MALIGNANCIES: SCOPE AND LIMITATIONS Dilip K. Das∗ Department of Pathology, Faculty of Medicine, Kuwait University.
ABSTRACT Cancer of mouth and pharynx is one of the ten most common cancers in the world. Detection of a precancerous or cancerous lesion at an early stage is an important factor to improve 5-year survival rate of oral cancer. A comprehensive physical examination aided by imaging techniques like computed tomography (CT), and magnetic resonance imaging (MRI) are the standard evaluation tools in patients with oral, and pharyngeal neoplasms. Although surgical biopsy and histopathology is considered gold standard for diagnosing the oral lesions, it is impractical to routinely subject large number of patients to biopsy. Whereas oral exfoliative cytology is a useful, economical and practical tool in the diagnosis of oral dysplasia and carcinoma involving cheek, lip and tongue, similar role is played by fine needle aspiration (FNA) cytology for minor salivary gland tumors and other solid neoplasms of the palate, cheek and pharyngeal areas. By brush cytology a spectrum of oral lesions including dysplasia, carcinoma in situ, occult and clinically evident squamous cell carcinoma can be diagnosed. FNA cytology, which collects samples from areas difficult to reach by surgical biopsy, can differentiate benign from malignant tumors and classify them into subtypes. Whereas pleomorphic adenoma is a common benign tumor, adenoid cystic carcinoma, mucous cell carcinoma, acinic cell carcinoma, malignancy in pleomorphic adenoma, and polymorphous low-grade carcinoma are the malignant neoplasms detected in the minor salivary glands. The other oral neoplasms detected by FNA are non-Hodgkin lymphomas, and some rare primary malignancies like sarcomas and chordoma. Metastatic lesions in oral cavity too have been diagnosed by FNA cytology. The efficacy of brush cytology in detection of oral ∗
Correspondence concerning this article should be addressed to: Dr. Dilip K. Das, MBBS, MD, PhD, DSc, FRCPath. Department of Pathology, Faculty of Medicine, Kuwait University, P.O.Box: 24923, Safat 13110, Kuwait. Tel: 00965-5319476; Fax: 00965-5338905; E-mail:
[email protected].
212
Dilip K. Das squamous cell carcinoma is very high in majority of reports, which is as follows: sensitivity (84.4 ± 9.97%), specificity (78.6 ± 29.36%), positive predictive value (71.4 ± 31.39%), and negative predictive value (83.0± 16.40%). The sensitivity, specificity, and diagnostic accuracy of FNA cytology for oral malignancies are also high. However, false negative reports are possible with the oral brush cytology technique and some palatal salivary gland tumors are difficult to diagnose by FNA cytology. In difficult situations, ancillary techniques such as cytomorphometry, DNA-cytometry, immunocytochemistry, and molecular tools act as valuable adjunct to cytodiagnostic techniques.
Keywords: Oral cavity, mouth, neoplasm, cancer, carcinoma, minor salivary gland, malignancy, lymphoma, sarcoma, chordoma
INTRODUCTION Cancer of the oral cavity is among the top ten cancers of the world and accounted for 274,000 new cases in 2002 [1]. The World Health Organization (WHO) predicts a continuing worldwide increase in the number of patients with oral cancer, extending the trend well into the next several decades [2]. The well known high-risk factors for oral cancer are tobacco/alcohol use in western Europe, southern Europe, and southern Africa, the chewing of betel quid in south-central Asia and Melanesia, and solar irradiation in Australia (mostly lip cancer) [1]. In addition, a strong evidence for an etiological relationship between human papillomavirus and a subset head and neck cancer has recently been noted [2]. Several oral lesions such as leukoplakia, erythroplakia, actinic keratosis, and lichen planus are considered to be premalignant lesions for oral squamous cell carcinoma, since an increased risk of malignant transformation is associated with them [3,4]. These lesions are often subtle and asymptomatic, requiring a high index of suspicion on the part of clinician, especially if the risk factors such as tobacco use or alcohol abuse are present [5]. The detection of a precancerous or cancerous lesion when small is one of the most important factors to improve 5-year survival rates of oral cancer [6]. Although surgical biopsy is the most definitive method for diagnosing oral lesions, it is impractical to routinely subject large number of patients to biopsy [6,7]. Diagnostic oral exfoliative cytology, on the other hand, is a useful, economical and practical tool in the diagnosis of oral dysplasia and carcinoma, but is not yet used so extensively as in cervico-vaginal cytology [8]. Brush cytology of all visible oral lesions, if they are clinically considered suspicious for oral cancer, are an easily practicable, cheap, non-invasive, painless, safe, and accurate screening method for detection of oral precancerous lesions, carcinoma in situ or invasive squamous cell carcinoma in all stages [9]. However, the great variation in technical quality in cytological smears increases the chance for a diagnostic failure on microscopic examination. With improvement in cytologic techniques that have resulted in the development of liquid-based preparations, the use of this approach as an auxiliary diagnostic tool for oral mucosal lesions has gained a renewed interest [10]. Besides oral squamous cell cancer, a variety of malignant neoplasms involving minor salivary glands, sarcomas, lymphoma, and those invading from adjoining areas or metastatizing from distant sites, affect the oral cavity. Inflammatory lesions presenting as
Cytologic Diagnosis of Oral Malignancies: Scope and Limitations
213
ulcers and swellings may create confusion with oral cancer and other common neoplasms of this area [11]. Tumors arising from minor salivary glands of the palate may exhibit an overlap of clinical and biologic features that may produce diagnostic and therapeutic dilemmas since surgical treatment can be very different, depending on the dimensions and malignant or benign nature of the tumors [12]. A large benign neoplasm of soft palate, e.g. pleomorphic adenoma, can cause sleep apnea syndrome [13]. Under these circumstances, FNA cytology, as a simple, economic, and painless technique, can help to diagnose such cases in an outpatient set up. This tool can play an important role in differentiating inflammatory from neoplastic lesions and also benign from malignant neoplasms of the oral cavity [11], leading to their proper management.
DIAGNOSTIC TECHNIQUES A comprehensive physical examination aided by imaging techniques like computed tomography (CT), positron emission tomography (PET), and magnetic resonance imaging (MRI) are the standard evaluation tools in patients with head and neck carcinomas including occult malignancies [14]. However, management of such lesions requires a prior tissue diagnosis. The various biopsy techniques utilized in the diagnosis and treatment of mouth diseases and tumors include incisional and excisional biopsy, needle (drill) biopsy, aspiration biopsy, curettage, tissue imprints, exfoliative cytology and frozen section [7]. Exfoliative cytology is a simple, noninvasive procedure for studying epithelial cells of mucosal surfaces. For conventional cytologic smears, a wooden spatula has been used as a standard tool for collection of sample by scrapping motions from oral precancerous and cancer. However, the cytobrush is found to be significantly more efficient than the wooden spatula, in terms of both cell yield and cell dispersion [15]. Jones et al [16] have advocated the use of cytobrush for obtaining diagnostic cytology smears from the oral mucosa, taking into consideration the factors such as degree of patient discomfort, the convenience to the clinician, and the quality and distribution of epithelial cells collected. Kujan et al [17] recommended the use of a special custom-designed oral cytobrush for liquid based cytology (LBC). According to these authors [17], LBC which shows good sample perversion, specimen adequacy, and visualization of cell morphology, has potential as a screening tool for oral cancer and precancer. Hayama et al [10] performed both conventional and liquidbased cytology, and concluded that both these tools were diagnostically reliable but the LBC showed overall improvement in sample preservation, specimen adequacy, visualization of cell morphology and reproducibility. When both these tools are used, the conventional smear is first prepared by stroking the brush along the glass slide, which is immediately wet-fixed in 95% ethanol, to be stained by Papanicolaou stain. Then the brush containing the remaining sample is inserted into the transport medium, an alcohol based preservative, to be processed for LBC smears as per the following steps: vortexing, density reagent centrifugation, decanting and resuspension of cell pellets followed by gravity sedimentation on poly-l-lysine coated slides, and subsequent staining with Papanicolaou stain. The LBC sample can also be used for immunocytochemical assays. It is found that the cell morphology as well as immunocytochemical stainings are better visualized in liquid based preparations.
214
Dilip K. Das
Fine needle aspiration (FNA) cytology can play an important role in the diagnosis of oral lesions, especially for those that present as a mass or growth [11]. For this a 10 ml disposable plastic syringe and a 23 gauge disposable needle fitted with a handle (Franzen syringe pistol) is used for aspiration cells from a mass lsion in the oral cavity. By this simple and inexpensive technique, not only lesions of the oral cavity but also those in the pharyngeal area can be punctured with minimal inconvenience to the patients. Maghami et al [18] demonstrated that MRI-guided FNA of the retropharynx is feasible, safe, and sensitive enough to obviate the need for open biopsies in large percentage of cases. According to Cerulli et al [19], FNA appears to be a very useful tool for preoperative diagnosis, which helps in planning the surgical management. Whereas the air-dried smears prepared from the aspirated material are stained by May-Grünwald-Giemsa stain (Diff-Quik), wet-fixed smears are stained by Papanicolaou method, and can be subjected to immunocytohemical staining. The aspirated material can be made into a cell block to study morphology, architectural pattern, and immunohistochemical characteristics. The aspirated material can also be utilized for molecular oncologic studies.
CYTOMORPHOLOGICAL FEATURES Only a few articles describe the cytomorphological features of a wide spectrum of oral neoplasms [11,20]. Das et al [11] diagnosed 45 cases of oral and pharyngeal lesions by FNA cytology, which included 15 benign neoplasms, 16 malignancies, 11 inflammatory, and 3 inadequate cases. The benign tumors were pleomorphic adenoma (11 cases), schwannoma (2), odontogenic tumor (1), and neoplasm, not otherwise specified (1). The malignancies were malignant salivary gland tumors (7 cases), squamous cell carcinoma (6 cases), NHL (2 cases), and malignant odontogenic tumor (1case). Shah et al [20] performed transmucosal FNA for oral and pharyngeal lesions from 79 sites in 76 patients. In their material [20], the sites for 38 malignant lesions were buccal (11 cases), tongue (11), alveolar ridge (3), floor of mouth (3), palate (3), tonsil (2), pharynx (2), lip (1), retroareolar ridge (1), and maxilla (1). The cytodiagnosis of malignant lesions were squamous cell carcinoma (24 cases), melanoma (4), mucoepidermoid carcinoma (3), lymphoma (3), adenoid cytic carcinoma (1), adenocarcinoma (1), metastatic adenocarcinoma (1), and sarcoma (1).
Oral Precancerous Lesions and Squamous Cell Carcinoma: Oral cancer is likely to develop from antecedent dysplastic oral mucosal lesions, if an early diagnosis is not made and treatment given. Leukoplakia is the most common oral premalignant lesion but erythroplakia is particularly relevant considering it’s almost certain relationship with dysplasia and invasive squamous cell carcinoma [2]. The early, asymptomatic oral and oropharyngeal cancers differ markedly from advanced cancers in their clinical presentation, course, and outcome [21]. Maraki et al [22] classified the cytological diagnoses in 98 cases of oral lesions into 75 cases of tumor cell negative (including reactive and inflammatory), four of doubtful tumor cells (mild and moderate dysplasia), four cases of
Cytologic Diagnosis of Oral Malignancies: Scope and Limitations
215
suspicious for tumor cells (sparse abnormal or severe dysplastic cells, and those with vague criteria for malignancy), and 15 tumor cell positive cases (unequivocal malignant cells). In these cases the final diagnoses were 15 cases of squamous cell carcinoma, 21 leukoplakias, three eythroplakia, and 59 other, inflammatory oral lesions. Leukoplakia: The smears from leukoplakia contain hyperkeratotic surface cells and many tightly packed cells with nuclei, which may include those representing an abnormal maturation pattern [23]. Oral Carcinoma in Situ (CIS) and Squamous Cell Carcinoma: In a study of 77 oral CIS [24], the high-risk sites were floor of the mouth (23.2% of all lesions), tongue (22%), and lips (in males only, 19.5%). In another study, among 229 aspirates of squamous cell carcinomas of the head and neck region, 187 (81.7%) were cervical or submandibular sites and 42 (18.3%) were oral cavity sites [25]. Fifty three squamous cell carcinoma of the oral cavity diagnosed by Remmerbah et al [9] had the following gross anatomical distribution: floor of the mouth (6 cases), floor of the mouth and tongue (12), tongue (11), lip (0), tonsil and palate (10), alveolar ridge (7), and cheek (7). In a study by Miyamoto et al [26], the 50 oral squamous cell carcinomas were derived from the tongue (31 cases), lower gingival region (9), upper gingival region (2), buccal mucosa (4), and the floor of mouth (4). Enlarged nuclei, variation in nuclear size and shape (pleomorphism), irregular nuclear border, increased nuclear cytplasmic ratio, hyperchromasia with abnormal chromatin pattern and distribution, multiple prominent and irregular nucleoli, and discrepancy in maturation are the characteristics of malignant cells in oral cancer [23]. In a study of six squamous cell carcinoma cases of the oral cavity diagnosed by FNA cytology [11], the tumor cells were present in compact clusters, discohesive groups and in singly dispersed form, with varying degrees of keratinization (Figure 1). Degenerative changes, necrosis, and giant cell reaction were observed in one or more cases. These cytologic features, when present in a lymph node aspirate from the cervical region, may point towards an occult primary in the catchment areas including oral cavity. Rajab et al [27] described a glycogen-rich clear cell carcinoma in the tongue, which was diagnosed by biopsy and FNA cytology of neck swelling. Patients with metastatic cancer detected by excisional biopsy or fine needle aspiration cytology of cervical lymph nodes in cases with occult primary tumor in the head and neck region can be benefited by positron emission tomography (PET), which has a sensitivity of 66.0% and specificity of 92.9% [28]. Radiation Changes in Oral Cancer: The treated oral cancer cases also require cytological evaluation for detection of radiation response and recurrence of their lesions. The radiation-induced changes in oral cancer cells include micronucleation, multinucleation, binucleation and nuclear budding, which become evident in the initial few days of radiotherapy [29]. The statistically significant dose-response relationship and the high intertumoral variation suggest that serial assay of these changes has a potential use for radiosensitive prediction. Mehrotra et al [30] also found a dose-related increase in multinucleation, micronucleation, nuclear budding, binucleation and cytoplasmic
Dilip K. Das
216
granulation, which was observed after various fractions of radiotherapy in both normal and malignant oral cells. However, these changes were more marked in malignant cells.
A
B
Figure 1. Keratinizing squamous cell carcinoma of tongue: FNA smear from a small growth and ulcer in the middle and left side of tongue of a 42-year-old woman. A: Smear shows loose cohesive clusters of malignant cells with evidence of keratinization (Papanicolaou x 200). B. Higher magnification of malignant cells shows distinct nucleoli and an epithelial (keratin) pearl (Papanicolaou x 400).
Malignant Salivary Gland Tumors: The malignant salivary gland tumors of the oral cavity diagnosed by FNA cytology include malignancy in pleomorphic adenoma, adenoid cystic carcinoma, acinic cell tumor, mucoepidermoid tumor, mucous cell carcinoma, and squamous cell carcinoma. FNA cytology of 151 patients with salivary gland tumors by Cajulis et al [31] showed the following distribution: 125 (83%) from the parotid gland, 23 (15%) from the submandibular gland and only 3 (2%) from the soft palate. Palate is the most common site for salivary gland tumors in oral cavity, both benign and malignant. Six of the 11 pleomorphic adenomas diagnosed by Das et al [11] were also located in palate. Of the seven malignant oral salivary gland tumors diagnosed by them [11], five were located in the palate, one in the cheek, and the remaining one in cheek and palate. The cytodiagnosis of these seven malignant salivary gland tumors were adenoid cystic carcinoma (2 cases), malignancy in pleomorphic adenoma (2), acinic cell carcinoma (1), mucous cell carcinoma (1), and squamous cell carcinoma (1). Of the 51 cases of palatal salivary gland tumors aspirated by Sahai et al [32], the reviewed FNA cytology diagnoses included 27 cases of pleomorphic adenoma, seven polymorphous low grade carcinomas (PLGA), eight adenoid cystic carcinoma, three mucoepidermoid carcinoma, three oncocytoma, and three undetermined type malignancies.
Cytologic Diagnosis of Oral Malignancies: Scope and Limitations
217
Adenoid Cystic Carcinoma: The smear contains globules and cylinders of mucoid material surrounded by closely packed, uniform cells with round nuclei and scanty cytoplasm (Figure 2). Although the cytologic features of adenoid cystic carcinoma is very characteristic, terminal duct carcinoma of the soft palate, at times, may be difficult to distinguish from this neoplasm in FNA smears [33].
A
B
Figure 2. Adenoid cystic carcinoma. A: FNA smear from the palatal swelling in a 50-year-old man. Cylinders of mucoid material are surrounded by small and monomorphic neoplastic cells (MayGrünwald-Giemsa x 200). B: FNA smear from a swelling in the posterior part of the soft palate in a 45year-old woman. Small monomorphic tumor cells surround the mucus globules (May-GrünwaldGiemsa x 436).
Mucous Cell Adenocarcinoma: The smears show pleomorphic malignant cells with round nuclei and abundant cytoplasm containing intracytoplasmic reddish, granular areas suggesting mucin or intracytoplasmic mucin globules. Acinic Cell Carcinoma: Tumor cells are present in cohesive clusters as well as dissociated form in the smears. They have eccentric nuclei and abundant, homogenously, dense cytoplasm with fine granularity, resembling oncocytes to some extent. Many bare nuclei, the size of lymphocytes are scattered in the background. Malignancy in Pleomorphic Adenoma: The smears contain loosely cohesive tumor cells showing mild to moderate pleomorphism and mitotic activity. History of a pre-existing pleomorphic adenoma may be
218
Dilip K. Das
forth coming and/or background may show varying amount of fibrillar mesenchymal tissue reminiscent of a mixed salivary gland tumor. Basal Cell Adenocarcinoma: It is an extremely rare low-grade malignant tumor of the salivary glands, particularly of minor salivary glands, which has cytologic features of basal cell adenoma, together with infiltrative growth [12], difficult to appreciate in cytology. Epithelial-Myoepithelial Carcinomas: FNA cytology of this minor salivary gland tumor of the hard palate show a biphasic population consisting of cells of ductal epithelial and myoepithelial origin arranged in small clusters and sheets [34]. The myoepithelial cells have small, uniform nuclei; ample, clear cytoplasm and distinct cell border, while the ductal epithelial cells have larger, mildly pleomorphic nuclei and scanty cytoplasm. These ductal cells tend to form tubules among background sheets of clear myoepithelial cells. Hyaline material surrounding cell clusters and adenoid cystic carcinoma-like areas with orangeophilic globules are also not uncommon. Polymorphous Low-Grade Adenocarcinoma (PLGA): It is a minor salivary gland arcinoma usually arising intraorally, primarily in the palate. Of the 61 palatal tumors diagnosed by Sahai et al [35] in FNA sears, 10 were PLGA. Evans and Batsakis [36] described 14 cases, which were intraoral in location, involving the palate in 11, the buccal mucosa in two, and the posterior mandibular area in one. According to Sahai et al [35] there are no established FNA cytologic features of PLGA. The smears may show branching papillary pattern with small round to oval cells having scant to moderate cytoplasm, round nucleus, fine chromatin, and inconspicuous nucleoli. FNA cytologic features of a PLGA, arising at the base of the tongue, included cuboidal epithelial cells and short, spindle-shaped myoepithelial-like cells [37]. This tumor also contains large clusters of cells with myxoid material at the center, and occasionally palisading tumor cells surround them.
Lymphoma: FNA cytology is a useful tool for diagnosis of nonHodgkin lymphoma (NHL) in general [38] and oral NHL as well [11]. However, the result may not be always conclusive [39]. The lymphomas of the oral cavity show a more or less mono-typic population of atypical neoplastic lymphoid cells (Figure 3A). The other cytomorphologic features depend upon the subtype of NHL. For example, The FNA cytologic features of Burkitt’s lymphoma (Figure 3B), which commonly involves the jaw bones and adjoining soft tissues, include abnormal lymphoid cells with cytoplasmic vacuolations due to lipid, interspersed with nonneoplastic histiocytes containing cell debris [40]. Arotiba et al [41] reported a case of multiple malignancies involving gingiva, lip, frontal bone, and parotid gland, which was diagnosed as NHL of gingiva and lymphoblastic lymphoma of the parotid by FNA, and he had a concomitant carcinoma of the prostate.
Cytologic Diagnosis of Oral Malignancies: Scope and Limitations
A
219
B
Figure 3. Non-Hodgkin lymphoma. A: Centroblastic lymphoma: FNA smear from the right tonsillar growth in a 68-year-old man. Smear shows distinct nucleoli in centroblasts (May-Grünwald-Giemsa x 500). B: Burkitt-type lymphoma: FNA smear from the upper jaw tumor in 4-yr-old male child. Small non cleaved lymphoma cells contain cytoplasmic vacuolations (May-Grünwald-Giemsa X 1000).
B
C
A Figure 4. Embryonal rhabdomyosarcoma. A. Oral and left maxillary swelling in a boy. B. FNA smear from the swelling shows small round tumor and tadpole-shaped cells (May-Grünwald-Giemsa x 250). C. Tumor cells are positive for desmin (x 400).
Dilip K. Das
220 Sarcomas:
Oral cavity is a known site for embryonal rhabdomyosarcoma, and FNA cytology can be utilized for its diagnosis [42,43]. FNA smear from embryonal rhabdomyosarcoma shows tadpole-shaped cells, besides small round cell population with round to oval nuclei and one to two small nucleoli (Figure 4). The FNA cytologic features of leiomyosarcoma sarcoma of the oral cavity have also been reported in the literature [44]. The smears from this rare neoplasm are cellular, with the cells arranged in fascicles and dispersed form and the nuclei are elongated with blunt ends, imparting a cigar-shaped appearance (Figure 5).
A
B
Figure 5. Leiomyosarcoma. A: FNA smear from a recurrent fungated oral swelling that extended to the lower jaw in an 11-year-old male child. Smear shows bundles of spindle shaped cells with elongated nuclei against a back ground of collagenous material (May-Grünwald-Giemsa x 250). B. The neoplastic cells have cigar shaped nuclei with blunt ends (May-Grünwald-Giemsa x 500).
Chordoma: Chordoma is an uncommon neoplasm of intra-osseous notochord remnants derivative, which is characterized by slow progressive growth, recurrences after incomplete removal, and late metastasis in about one third of cases [45]. It most commonly arises from the sacrococcygeal region and somewhat less frequently from speno-occipital region. Koibasioglu et al [46] described an oropharyngeal chordoma diagnosed by FNA cytology. In FNA smears of sacro-coccygeal chordoma shows classic physaliferous cells with bubbly appearance and a myxoid fibrillary background, which is intensely metachromatic [47]. Similar cytologic features are observed in oropharyngeal chordomas, involving the oral cavity (Figure 6).
Cytologic Diagnosis of Oral Malignancies: Scope and Limitations
A
221
B
Figure 6. Chordoma: FNA smear from the palatal mass in a 35-year-old woman. A. Smear shows typical physaliferous cells with abundant vacuolated cytoplasm imparting a bubbly appearance. Bright fibrillar magenta colored material is observed in the background (May-Grünwald-Giemsa x 400). B. Intense PAS positive reaction is seen in cytoplasm of tumor cells. Background matrix is positively stained by Alcian-blue (PAS- Alcian blue x 400).
Metastatic Malignancies: Oral cavity can be a site of metastatic cancers and FNA is an ideal tool for diagnosis of these lesions without any complications. FNA cytologic diagnosis of metastatic lesions in the oral cavity from sites such as breast [48] and liver [49] has been reported in the literature.
DIAGNOSTIC EFFICACY The efficacy of exfoliative (brush) cytology for oral precancerous and cancerous lesions, as revealed from five recent studies [8,9,50-52], was as follows (table I): The sensitivity ranged from 71.4 to 94.6% with an average of 84.4%. The specificity showed a wide variation, which ranged from 32.0 to 100.0% with an average of 78.6%. The averages of positive and negative predictive values were 71.4 and 83.0%, respectively. In an earlier review of cytological diagnoses in 1306 cases from 14 studies [53] the sensitivity for diagnosing oral cancer ranged from 73.8% to 100%, with an average of 87.4%. According to Navone et al [8], oral cytology can improve the accuracy of histology, and may be a useful screening tool for the diagnosis of oral neoplasia/dysplasia. There are very few studies highlighting the efficacy of FNA cytology in oral lesions. Das et al [11] diagnosed 45 cases of oral lesions by FNA cytology and correlation with histopathology was observed in 77.9% cases. Shah et al [20] demonstrated a high degree of sensitivity (93%) and specificity of 86% for intraoral FNAB, when compared with biopsy by
Dilip K. Das
222
conventional means. In a study by Gross et al [12], FNA cytology had an accuracy of 91.6% and an error rate of 8.4% for tumors arising from minor salivary glands of the palate. Concurrence with histopathology was observed in 22 of 24 of their cases. Table I. Efficacy of oral smear for detection of oral dysplasia, carcinoma in situ, and squamous cell carcinoma Oral Lesions
Sensiti vity % 94.6
Specifi city % 99.5
Accura cy % -
PPV % 98.1
NPV % 98.5
Dysplasia, CIS, ca (Toluidine blue staining) Squamous cell carcinoma
77.0
67.0
-
43.5
88.9
92.5
100.0
-
100.0
84.6
Dysplasia, squamous ca
71.4
32.0
-
44.1
60.0
Dysplasia and/or ca
86.5
94.3
89.6
-
-
Mean ± S.D
84.4 ± 9.97
78.6 ± 29.36
89.6
71.4 ± 31.91
83.0 ± 16.40
Cancer
Authors Remmerbach et al, 2001 Onofre et al, 2001 Remmerbach et al, 2003 Poate et al, 2004 Navone et al, 2004
Ca= carcinoma; PPV= positive predictive value; NPV= negative predictive value; CIS= carcinoma in situ.
DIAGNOSTIC DIFFICULTIES/ DILEMMAS False negative reports are possible with the oral brush cytology technique. Poate et al [52] observed poor results with brush biopsy results and concluded that not all potentially malignant lesions are detected by this noninvasive investigative procedure. In a study conducted in 1970s, the false negative rate of cytodiagnosis of oral cancer was found to be 12.5% as against an average of 14.5% in previous reports [54]. The recent studies as shown in table I also indicate an average sensitivity of 84.5%. Potter et al, [55] who found very good result, i.e., 4 (3.5%) negative cases by brush cytology among 115 histologically proved oral squamous cell carcinomas, suggested that persistent lesions should undergo tissue biopsy for definitive diagnosis. Palatal salivary gland tumors are difficult to diagnose cytologically and this is more so in case of newer entities such as polymorphous low grade adenocarcinoma (PLGA). Sahai et al [32] found that 18 of the 51 palatal tumors (35.3%) could not be typed at initial cytologic examination. It is known that certain diagnostic problems can occur in differentiating pleomorphic adenoma from adenoid cystic carcinoma, monomorphic adenoma, and mucoepidermoid carcinoma [56]. Ustundag et al [57] described an adenoid cystic carcinoma of tongue arising in the minor salivary gland, which was initially diagnosed as a pleomorphic adenoma by FNA cytology. According to Kim et al [58], carcinoma ex pleomorphic adenoma
Cytologic Diagnosis of Oral Malignancies: Scope and Limitations
223
of the palate may be missed by FNA cytology and even by histopathologic examination of the open biopsy. Negahban et al [59] also faced diagnostic challenge in a case of clear cell carcinoma arising in pleomorphic adenoma of minor salivary gland of the palate. A neoplasm like primary ectopic meningioma, located submucosally in the floor of the mouth, may pose a diagnostic challenge to clinicians and cytopathologists as its FNA cytologic feature may be confused with low-grade salivary gland neoplasm and light microscopic findings require the support of ancillary studies like immunohistochemitry and electron microscopy to arrive at the final diagnosis of primary ectopic meningioma [60].
ANCILLARY STUDIES Recently, cytomorphometric assessments improved by advanced computer-assisted image analysis systems have gained importance in the diagnosis of malignant and premalignant oral lesions. Cytomorphometric analysis via oral brush biopsy is a valuable adjunct to biopsy for identification of premalignant and early cancerous oral lesions. It is a rapid and minimally invasive procedure with high specificity and sensitivity rates, requiring no topical or local anesthetic [6]. A study on expression of antigens in cytologic preparations obtained from macroscopically normal oral mucosa of patients with tongue carcinoma and controls showed that oral mucosa of cancer patients had a more than three-fold increased expression of cytokeratin 19 among a panel of antigens, as compared to controls (36.0 versus 11.3%; P<0.01) [61]. Using a panel of keratin antibodies in smears and biopsies of 34 oral cancer patients, Ogden et al [62] observed that the sensitivity of K19 was greatest but its specificity was poor; and the keratin antibodies with best positive predictive values were K8 and LH 8. These authors [62] concluded that for exfoliative cytology to be of value as a diagnostic test, it remains necessary to employ assays using more than one keratin antibodies. Acording to Remmerbach et al [9], application of AgNOR technique to cytologic preparations is found to be a useful adjunct to other methods in routine cytological diagnosis of oral cancer, since it can help to solve cytologically suspicious and doubtful cases. The same group of authors [9], in a study of oral squamous cell carcinoma from brush smears found that the best cut off value of the mean number of AgNOR dots per nucleus distinguishing benign from malignant cells was 4.8. Applying these methods they achieved a positive and negative predictive value of 100% each. Mao [63] reported a mean AgNOR count per nucleus in cancer group to be 4.7 ± 0.72 vs. 2.4 ± 0.37 in normal mucosa (p< 0.005) with no overlap between the two groups. Cytology with DNA-cytometry is also a highly sensitive, specific, and objective adjuvant as well as non-invasive tool for the early diagnosis of oral epithelial neoplasia, showing excellent compliance among patients [22,50]. Remmerbach et al [50] detected DNA aneuploidy (Feulgen stained smears examined under a TV image analysis system) in 96.4% of carcinoma in situ and invasive carcinoma. Sensitivity of DNA-aneuploidy for detection of cancer cells in oral smears was 96.4%, specificity 100%, positive predictive value 100%, and negative predictive value 99%. Combination of cytological diagnosis and DNA-aneuploidy raised the sensitivity to 98.2%, specificity to 100%, positive predictive value to 100%, and negative predictive value to 99.5%. Maraki et al [22] have shown that the sensitivity of
224
Dilip K. Das
cytological diagnosis combined with DNA image cytometry may be as high as 100% and specificity 97.4%. It is also found that cytology along with DNA-cytometry is a highly sensitive, specific, and non-invasive method for periodical follow up oral lichen planus (LP) lesions in order to detect early or exclude malignancy [64]. Oral cytology sample collected with liquid-based technology has been utilized not only for immunocychemical staining but in Hybrid Capture-2 for detection of HPV as well as the PCR-based Roche AMPLICOR HPV test [17]. Oral CDx (OralScan Laboratories Inc.), a computer-assisted method for analysis of the oral brush biopsy, is reported to be a highly accurate method (sensitivity 100%, false negative rate 0%) for detection of oral precancerous and cancerous lesions. The specificity of OralCDx “positive” result was 100%, while the specificity for OralCDx “atypical” results was 92.9% [65]. Fluorescent in situ hybridization (FISH), performed on FNA biopsies of 50 primary oral squamous cell carcinomas (OSCCs), using a BAC clone specific for cyclin D1 gene (CCND1), revealed numerical aberrations in 21 (42.0%) [26]. In this study, the CCND1 aberration was associated significantly with histopathologic grading (p= 0.032), the mode of invasion (p= 0.047), pathologic lymph node status (p= 0.045), disease recurrence (p= 0.004), and survical (p= 0.004). In another study on 41 primary oral squamous cell carcinomas (OSCCs) based on fluorescent in situ hybridization (FISH) on FNA biopsies and immunohistochemistry, the same group of authors [66] found CCND1 amplification as a more reliable prognostic indicator than CCND1 over expression in OSCCs. Aberrations in cyclin D1 gene (CCND1), which was detected by fluorescence in situ hybridization (FISH) in 15 (33.3%) of 45 FNA biopsies of oral squamous cell carcinomas (OSCCs) and was associated with mode of invasion of primary tumor (p=0.01) and the presence of occult lymph node metastasis (p<0.001), appear to be valuable in identifying patients at high risk of late lymph node metastasis in stage I and II OSCCs [67].
REFERENCES [1] Parkin DM, Bray F, Ferlay J, Pisani P. Global cancer statistics. CA Cancer J Clin 2005; 55: 74- 108. [2] Sciubba JJ. Oral cancer. The importance of early diagnosis and treatment. Am J Clin Dermatol 2001; 2: 239- 251. [3] Casiglia J, Woo SB. A comprehensive review of oral cancer. Gen Dent 2001; 49: 72- 82. [4] Hirschberg A, Calderon S, Kaplan I. Update review on prevention and early diagnosis in oral cancer. Refuat Hapeh Vehashinayim 2002; 19: 38- 48. [5] Neville BW, Day TA. Oral cancer and precancerous lesions. Ca Cancer J Clin 2002; 52: 195- 215. [6] Pektas ZO, Keskin A, Gunhan O, Karslioglu Y. Evaluation of nuclear morphometry and DNA ploidy status for detection of malignant and premalignant oral lesions: quantitative cytologic assessment and review of methods for cytomorphometric measurements. J Oral Maxillofac Surg 2006; 64: 628- 635. [7] Ramanathan K. Biopsy techniques in the diagnosis and treatment of mouth diseases and tumours. Med J Malaysia 1979; 34: 28- 31.
Cytologic Diagnosis of Oral Malignancies: Scope and Limitations
225
[8] Navone R, Marsico A, Reale I, Pich A, Broccoleti R, Pentenero M, Gandolfo S. Usefulness of oral exfoliative cytology for the diagnosis of oral squamous dysplasia and carcinoma. Minerva Stomatol 2004; 53: 77- 86. [9] Remmerbach TW, Weidenbach H, Müller C, Hemprich A, Pomjanski N, Buckstegge B, Böcking A. Diagnostic value of nucleolar organizer regions (AgNORs) in brush biopsies of suspicious lesions of the oral cavity. Anal Cell Pathol 2003; 25: 139- 146. [10] Hayama FH, Motta ACF, de Padua G Silva A, Migliari DA. Liquid-based preparations versus conventional cytology: specimen adequacy and diagnostic agreement in oral lesions. Med Oral Patol Oral Cir Bucal 2005; 10: 115- 122. [11] Das DK, Gulati A, Bhatt NC, Mandal AK, Khan VA, Bhambani S. Fine needle aspiration cytology of oral and pharyngeal lesions. A study of 45 cases. Acta Cytol 1993; 37: 333342. [12] Gross M, Maly B, Goldfarb A, Eliashar R. Basal cell adenocarcinoma in a buccal minor salivary gland. Acta Otolaryngol 2004; 124: 213- 216. [13] Murthy SV, Murthy NC, Belagavi CS, Munishwara GB. A large pleomorphic adenoma of soft palate causing sleep apnea syndrome—a case report. Indian J Pathol Microbiol 2003; 46: 466- 467. [14] Miller FR, Hussey D, Beeram M, Eng T, McGuff HS, Otto RA. Positron emission tomography in the management of unknown primary head and neck carcinoma. Arch Otolaryngol Head Neck Surg 2005; 131: 626- 629. [15] Ogden GR, Cowpe JG, Green M. Cytobrush and wooden spatula for oral exfoliative cytology. A comparision. Acta Cytol 1992; 36: 706- 710. [16] Jones AC, Pink FE, Sandow PL, Stewart CM, Migliorati CA, Baughman RA. The cytobrush Plus cell collector in oral cytology. Oral Surg Oral Med Oral Pathol 1994; 77: 95- 99. [17] Kujan O, Desai M, Sargent A, Bailey A, Turner A, Sloan P. Potential applications of oral brush cytology with liquid-based technology: result from a cohort of normal oral mucosa. Oral Oncol 2006; 42: 810- 818. [18] Maghami EG, Bonyadlou S, Larian B, Borges A, Abemayor E, Lufkin RB. Magnetic resonance imaging—guided fine-needle aspiration biopsies of retropharyngeal lesions. Laryngoscope 2001; 111: 2218- 2224. [19] Cerulli G, Renzi G, Perugini M, Becelli R. Differential diagnosis between adenoid cystic carcinoma and pleomorphic adenoma of the minor salivary glands of palate. J Craniofac Surg 2004; 15: 1056- 1060. [20] Shah SB, Singer MI, Liberman E, Ljung B-M. Transmucosal fine-needle aspiration diagnosis of intra-oral and intrapharyngeal lesions. Laryngoscope 1999; 109: 12321237. [21] Mashberg A, Samit A. Early diagnosis of asymptomatic oral and oropharyngeal squamous cell cancers. Ca Cancer J Clin 1995; 45: 328- 351. [22] Maraki D, Becker J, Boecking A. Cytologic and DNA-cytometric very early diagnosis of oral cancer. J Oral Pathol Med 2004; 33: 398- 404. [23] Silverman Jr S. Oral cavity. In “Comprehensive Cytopathology”. Edited by M. Bibbo. WB Saunders Co. Philadelphia, 1997. pp: 403- 412.
226
Dilip K. Das
[24] Waldron CA, Shafer WG. Oral carcinoma in situ. Oral Surg Oral Med Oral Pathol 1975; 39: 227- 238. [25] Feldman PS, Kaplan MJ, Johns ME, Cantrell RW. Fine-needle aspiration in squamous cell carcinoma of the head and neck. Arch Otolaryngol 1983; 109: 735- 742. [26] Miyamoto R, Uzawa N, Nagaoka S, Nakakuki K, Hirata Y, Amagasa T. Potential marker for oral squamous cell carcinoma aggressiveness detected by fluorescence in situ hybridization in fine needle aspiration biopsies. Cancer 2002; 95: 2152- 2159. [27] Rajab E, Akmal SN, Nasir AM. Glycogen-rich clear cell carcinoma of the tongue. J Laryngol Otol 1994; 108: 716- 718. [28] Miller FR, Hussey D, Beeram M, Eng T, McGuff HS, Otto RA. Positron emission tomography in the management of unknown primary head and neck carcinoma. Arch Otolaryngol Head Neck Surg 2005; 131: 626- 629. [29] Bhattathiri NV, Bindu L, Remani P, Chandralekha B, Nair KM. Radiation-induced acute immediate nuclear abnormalities in oral cancer cells: serial cytologic evaluation. Acta Cytol 1998; 42: 1084- 1090. [30] Mehrotra R, Goel N, Singh M, Kumar D. Radiation-related cytological changes in oral malignant cells. Indian J Pathol Microbiol 2004; 47: 343- 347. [31] Cajulis RS, Gokaslan ST, Yu GH, Frias-Hidvegi D. Fine needle aspiration biopsy of the salivary glands. A five-year experience with emphasis on diagnostic pitfalls. Acta Cytol 1997; 41: 1412- 1420. [32] Sahai K, Kapila K, Dahiya S, Verma K. Fine needle aspiration cytology of minor salivary gland tumors of the palate. Cytopathology 2002; 13: 309- 316. [33] Frierson HF Jr, Covell JL, Mills SE. Fine-needle aspiration cytology of terminal duct carcinoma of minor salivary gland. Diagn Cytopathol 1987; 3: 159- 162. [34] Ng WK, Choy C, Ip P, Shek WH, Collins RJ. Fine needle aspiration cytology of epithelial-myoepithelial carcinoma of salivary glands. A report of three cases. Acta Cytol 1999; 43: 765- 680. [35] Sahai K, Kapila K, Dahiya S, Verma K. Cytomorphology of polymorphous low-grade adenocarcinoma: diagnosis and pitfalls. Indian J Pathol Microbiol 2003; 46: 409- 411. [36] Evans HL, Batsakis JG. Polymorphous low-grade adenocarcinoma of minor salivary glands. A study of 14 cases of a distinctive neoplasm. Cancer 1984; 53: 935- 942. [37] Watanabe K, Ono N, Saito K, Saito A, Suzuki T. Fine-needle aspiration cytology of polymorphous low-grade adenocarcinoma of the tongue. Diagn Cytopathol 1999; 20: 167- 169. [38] Das DK, Gupta SK, Datta BN, Sharma SC. FNA cytodiagnosis of non-Hodgkin’s lymphoma and its subtyping under working formulation: A review of 175 cases. Diagn Cytopathol 1991; 7: 487- 498. [39] Radhakrishnan R, Suhas S, Kumar PV, Krishnanand G, Srinivasan R, Rao NN. Plasmablastic lymphoma of the oral cavity in an HIV-positive child. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2005; 100: 725- 731. [40] Das DK, Gupta SK, Pathak IC, Sharma SC, Datta BN. Burkitt-type lymphoma: Diagnosis by fine needle aspiration cytology. Acta Cytol 1987; 31: 1-7.
Cytologic Diagnosis of Oral Malignancies: Scope and Limitations
227
[41] Arotiba JT, Akadiri OA, Okeke LI, Obimakinde OS, Fasola AO, Okoje VN, Kolude B. Multiple malignant lesions involving the orofacial region: a case report. Afr J Med Med Sci 2006; 35: 375- 379. [42] Mazzoleni S, Stellini E, Infantolino D, Favero GA. A case of embryonal rhabdomyosarcoma of the cheek in adolescence. Its cytological diagnosis by fine-needle aspiration via the gingival fornix. Minerva Stomatol 1994; 43: 43- 47. [43] Das DK. Fine-needle aspiration (FNA) cytology diagnosis of small round cell tumors: value and limitations. Indian J Pathol Microbiol 2004; 47: 309- 318. [44] Das DK, Grover RK, Anand VJ, Mandal AK, Jain S, Jain J, Bhat NC, Chowdhury V. Oral leiomyosarcoma in childhood: Report of a case with fine needle aspiration cytology. Acta Cytol 1999; 43: 1150- 1154. [45] Dorfman RD. Bone diseases. In: Sternberg SS, ed. Diagnostic Surgical Pathology. NewYork: Raven Press Ltd, 1989, pp: 243- 245. [46] Koybasioglu F, Simsek GG, Onal BU, Han U, Adabag A. Oropharyngeal chordoma diagnosed by fine needle aspiration: A case report. Acta Cytol 2005; 49: 173- 176. [47] Das DK, Francis IM, Abu Zeidan FM. Fine-needle aspiration diagnosis of a sacrococcygeal chordoma and its recurrence. Diagn Cytopathol 1994; 10: 194- 195. [48] Adelson RT, DeFatta RJ, Miles BA, Hablitt SL, Ducic Y. Metastatic breast cancer of the oral cavity. Am J Otolaryngol 2005; 26: 279- 281. [49] Marker P, Clausen PP. Metastases to the mouth and jaws from hepatocellular carcinoma. A case report. Int J Maxillofac Surg 1991; 20: 371- 374. [50] Remmerbach TW, Weidenbach H, Pomjanski N, Knops K, Mathes S, Hemprich A, Bocking A. Cytologic and DNA-cytometric early diagnosis of oral cancer. Anal Cell Pathol 2001; 22: 211- 221. [51] Onofre MA, Sposto MR, Navarro CM. Reliability of toluidine blue application in the detection of oral epithelial dysplasia and insitu and invasive squamous cell carcinomas. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2001; 91: 535- 540. [52] Poate TW, Buchanan JA, Hodgson TA, Speight PM, Barrett AW, Moles DR, Scully C, Porter SR. An audit of efficacy of the oral brush biopsy technique in a specialist Oral Medicine unit. Oral Oncol 2004; 40: 829- 834. [53] Kaugars GE, Silverman S Jr, Ray AK, Page DG, Abbey LM, Burns JC, Svirsky JA. The use of exfoliative for early diagnosis of oral cancers: is there a role for it in education and private practice? J Cancer Edu 1998; 13: 85- 89. [54] Seto K, Takanashi Y, Tokita M, Watanabe Y. Critical review of biopsy and cytologic examination of oral cancer. Int Dent J. 1977; 27: 35- 43. [55] Potter TJ, Summerlin DJ, Campbell JH. Oral malignancies associated with negative transepithelial brush biopsy. J Oral Maxillofac Surg 2003; 61: 674- 677. [56] Verma K, Kapila K. Role of fine needle aspiraton cytology in diagnosis of pleomorphic adenomas. Cytopathology 2002; 13: 121- 127. [57] Ustundag E, Iseri M, Aydin O, Dal H, Almac A, Paksoy N. Adenoid cystic carcinoma of the tongue. J Laryngol Otol 1994; 114: 477- 480. [58] Kim KM, Lee A, Yoon SH, Kang JH, Shim SI. Carcinoma ex pleomorphic adenoma of the palate—a case report. J Korean Med Sci 1997; 12: 63- 66.
228
Dilip K. Das
[59] Negahban S, Daneshbod Y, Shishegar M. Clear cell carcinoma arising from pleomorphic adenoma of a minor salivary gland: Report of a case with fine needle aspiration, histologic and immunohistochemical findings. Acta Cytol 2006; 50: 687- 690. [60] Hameed A, Gokden M, Hanna EY. Fine-needle aspiration cytology of a primary ectopic meningioma. Diagn Cytopathol 2002; 26: 297- 300. [61] Copper MP, Braakhuis BJ, de Vries N, van Dongen GA, Nauta JJ, Snow GB. A panel of biomarkers of carcinogenesis of the upper aerodigestive tract as potential intermediate endpoints in chemoprevention trials. Cancer 1993; 71: 825- 830. [62] Ogden GR, Chisholm DM, Lane EB. The utility of cytokeratin profiles for detecting oral cancer using exfoliative cytology. Br J Oral Maxillofac Surg 1996; 34: 461- 466. [63] Mao EJ. Prevalence of human papillomavirus 16 and nucleolar organizer region counts in oral exfoliated cells from normal and malignant epithelia. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 1995; 80: 320- 329. [64] Maraki D, Yalcinkaya S, Pomjanski N, Megahed M, Boecking A, Becker J. Cytologic and DNA-cytometric examination of oral lesions in lichen planus. J Oral Pathol Med 2006; 35: 227- 232. [65] Sciubba JJ. Improving detection of precancerous and cancerous oral lesions. Computerassisted analysis of the oral brush biopsy. U.S. collaborative OralCDx Study Group. J Am Dent Assoc 1999; 130: 1445- 1457. [66] Miyamoto R, Uzawa N, Nagaoka S, Hirata Y, Amagasa T. Prognostic significance of cyclin D1 amplification and overexpression in oral squamous cell carcinomas. Oral Oncol 2003; 39: 610- 618. [67] Myo K, Uzawa N, Miyamoto R, Sonoda I, Yuki Y, Amagasa T. Cyclin D1 gene numerical aberration is a predictive marker for occult cervical lymph node metastasis in TNM Stage I and II squamous cell carcinoma of the oral cavity. Cancer 2005; 104: 27092716.
In: Oral Cancer Research Advances Editor: Alexios P. Nikolakakos, pp. 229-246
ISBN 978-1-60021-864-4 © 2007 Nova Science Publishers, Inc.
Chapter 10
BENIGN AND MALIGNANT TUMORS OCCURRING IN THE PTERYGOPALATINE FOSSA AND ADJACENT STRUCTURES OF THE PTERYGOPALATINE FOSSA: RECENT ADVANCES OF DIAGNOSIS AND SURGICAL MANAGEMENT Xin-Chun Jian Department of Oral and Maxillofacial Surgery, Xiangya Hospital, Central South University, Changsha, 410008, Hunan, People’s Republic of China.
ABSTRACT Surgery in the pterygopalatine fossa region presents anatomic and surgical problems related to the difficulty of access. When a tumor in the pterygopalatine fossa involves the maxilla and extends into the maxillary sinus and a tumor of the deep lobe of the parotid gland extends into the pterygopalatine foss, extensive resection is often necessary. Because of this, there has been a tendency either not to operate on these cases at all or else to carry out simply a partial or piecemeal removal. The current underlying principle of skull base approaches is to minimize brain retraction while maximizing skull base visualization. This concept facilitates three-dimensional tumor resection, tumor margin verification, and functional reconstruction with appropriate esthetic concerns. Current many approaches have been used for the tumor of the middle skull base or the pterygopalatine fossa. With advancements in imaging, diagnostic technology, diagnostic pathology, surgical technology and instrumentation, reconstructive techniques, the surgery of the lateral cranial base or the middle cranial base is now receiving significant attention and interest. It is purpose of this paper to provide readers with an overall review of benign and malignant tumors occurring in the pterygopalatine fossa and adjacent structures of the pterygopalatine foss: Recent advances of diagnosis and surgical management.
230
Xin-Chun Jian
In the region of the face, sinuses, or palate, perineural tumor spread usually follows the maxillary division of the trigeminal nerve. Neoplasm can follow the branches of the trigeminal back to the pterygopalatine fossa(PPF), a key landmark in detection of perineural extention. Tumor arising in the face can follow the intraorbital nerve. Tumors of the palate follow the palatine nerves through the greater and lesser palatine foramen and the pterygopalatine canal, passing superiorly from the palate to the PPF. Tumors of the maxillary sinus follow the superior alveolar nerves, perforating the lateral maxillary sinus wall before passing along the posterior wall of the maxillary sinus and entering the PPF. Alternately, a tumor of the maxillary sinus may erode directly into the infraorbital cannal or PPF, gaining access to the neural element. From the PPF, tumor can follow the trigeminal nerve through the foramen rotundum to gain access to the middle cranial fossa at the gasserian ganglion in Meckel cave. Surgery in the pterygopalatine fossa region presents anatomic and surgical problems related to the difficulty of access. With advancement in imaging, diagnostic technology, diagnostic pathology, surgical technology and instrumentation, reconstructive techniques, skull base surgery is now receiving significant attention. It is the purpose of this paper to provide readers with an overall review of diagnosis and surgical management of benign and malignant tumors arising in the PPF and in adjacent structures of the PPF.
ANATOMIC STRUCTURES OF THE PTERYGOPALATINE FOSSA To safely separate the tumors from the PPF, knowledge of the anatomic structures of the PPF region is very important to surgeons. The pterygopalatine fossa is a narrow funnel-shaped space below the cranial base that is bounded anteriorly by the medial part of the maxillary tuberosity, posteriorly by the anterior or sphenomaxillary surface of the pterygoid process of the sphenoid bone, and medially by the lateral surface of the vertical plate of the palatine bone. Its roof is formed by the root of the greater sphenoid wing. A lateral boundary is missing; here the pterygopalatine fossa communicates with the infratemporal fossa through the pterygomaxillary fissure (Figure 1). The pterygopalatine space is widest in its upper part and narrows downward and continues into the pterygopalatine canal between the medial surface of the maxilla and the lateral surface of the vertical plate of the palatine bone. The canal opens into the oral cavity through the greater and lesser palatine foramina. The pterygopalatine fossa contains the ramification of the maxillary nerve, the terminal branches of the maxillary artery, and the pterygopalatine ganglion. The maxillary nerve enters the pterygopalatine fossa through the foramen rotundum. Below the opening of this canal and medial to it opens the pterygoid canal, leading the pterygoid or Vidian nerve to the pterygopalatine, or Meckel’s ganglion. A pterygoid artery, one of the terminal branches of the internal maxillary artery, can be traced posteriorly into the Vidian canal. The palatine nerves and the descending palatine artery reach the oral cavity through the pterygopalatine canal. Through the sphenopalatine foremen between the orbital and sphenoid processes of the palatine bone and the inferior surface of the body of the sphenoid bone the pterygopalatine nerves and artery pass into the oral cavity.
Benign and Malignant Tumors Occurring in the Pterygopalatine Fossa…
231
Figure 1. Pterygopalatine fossa.
Table 1. Benign and malignant tumors occurring in PPF and adjacent structures of PPF Benign tumors Angiofibroma Chondroma Chordoma Craniopharyngioma Hemangioma Lymphangioma Meningioma Neurilemoma Neurofibroma Osteoma Pericytoma Schwannoma Inverted papilloma Reactive granulomatous lesion
Malignant tumors Acinic cell adenocarcinoma Adenocarcinoma Adenoid cystic carcinoma Fibrous histocytoma Olfactory neuroblastoma Rhabdomyosarcoma Sarcoma
BENIGN AND MALIGNANT TUMORS OCCURRING IN THE PPF AND ADJACENT STRUCTURES OF THE PPF A variety of benign tumors may involve the pterygopalatine fossa and pterygoid plates. The epithelial or inverting papilloma usually presents as unilateral soft tissue mass accompanied by simultaneous bone expansion and facial destruction [1,2]. Juvenile nasopharyngeal angiofibromas demonstrate a nasopharyngeal soft tissue mass and expansion of the pterygopalatine fossa [1]. Since these lesions tend to spread locally by extension along natural foramina and fissures, enlargement and/or destruction of these openings into the fossa
232
Xin-Chun Jian
may be demonstrated by careful tomography [3]. Other benign tumors such as large pituitary adenomas or neurinomas of the trigeminal ganglion may erode the sphenoid alae extending into the base of the pterygoid plates and apex of the fossa. Primary malignant tumors of the paranasal sinuses usually produce opacification and bone destruction without evidence for focal expansion of the sinus walls [4]. Squamous cell carcinoma, adenocarcinoma, melanoma, rhabdomyosarcoma and the uncommon esthesioneuroblastoma may all involve the pterygopalatine fossa and adjacent structures by direct extension. A large group of benign and malignant tumors in the PPF and adjacent structures of the PPF all could be encountered (Table 1) [5-19].
Figure 2. Sources and routes of direct spread of malignant tumors in the PPF. A) Tumor spreads to the maxillary sinus by destroying the posterior wall; B) Tumor extends into the orbit through the inferior orbital fissure; C) Tumor extends into the oropharynx through the palatovaginal canal; D) Tumor in the PPF extends into the middle fossa through foramen rotundum; E) Sources of the tumor in the PPF.
ROUTES OF DIRECT SPREAD OF MALIGNANT TUMORS IN THE PPF According to anatomic characteristics of the pterygopalatine fossa and reports in the literature report, we know that the routes of spread of the tumors in the PPF are direct. These tumors are not metastatic to the middle cranial fossa, the maxillary sinus, the orbit, the oral cavity and the paraphylaryngic area, the most common method of spread is by tumor erosion through skull base bone, such as meningiomas and neurofibromas occurring in the
Benign and Malignant Tumors Occurring in the Pterygopalatine Fossa…
233
pterygopalatine fossa, may extend into the middle cranial fossa through the foramen rotundum, oval, or both. A tumor arising in the PPF would grow into the maxillary sinus by destroying the posterior wall (Figure 2A). These tumors arising in the PPF also may extend into the orbit through the medial part of the inferior orbital fissure (Figure 2B). The tumors accurring in the PPF extend into the nasopharynx and the oropharynx through the palatovaginal canal, into the infratemporal fossa through the pterygomaxillary fissure, into the oral cavity by the greater and lesser palatine canals (Figure 2C). The many tumors accurring in adjacent anatomic structures of the PPF also may extend into the PPF, such as tumors in the meddle cranial fossa may extend into the PPF through the foramen rotundum, ovale, or both (Figure 2E). Tumors of the orbit extend into the pterygopalatine fossa by way of the inferior orbital fissure and/or orbital apex. The tumors in the maxillea and in the maxillary sinuses extend into the pterygopalatine fossa through the posterior wall of the maxillary sinuses. The tumors occurring in the upper palatine and/or the oral cavity may extend into the PPF through the greater and lesser palatine foramina. Other common tumors, such as tumors of the deep lobe of the parotid gland, including adenocarcinomas, mucoepidermoid carcinomas, or adenoid cystic carcinomas, may extend into the middle skull base through the pterygopalatine fossa. In our cases, there are extracranial meningioma from the middle skull base or mucoepidermoid carcinomas and adenoid cystic carcinomas occurring in the deep lobe of the parotid gland (Figure 2E).
RADIOLOGY AND RADIOLOGIC DIAGNOSIS OF THE PTERYGOPALATINE FOSSA The pterygopalatine fossa is a major distribution center for the parasympathetic innervation and vascular supply of deep facial structures. Therefore this important structure provides a natural pathway for dissemination or spread of disease processes to contiguous structures. The normal radiographic anatomy of the pterygopalatine fossa and the adjacent pterygoid plates are considered in detail. Variation in these structures as well as their alterations in a variety of pathologic entities is described. The pterygopalatine fossa itself is variable in size and shape. The transverse diameter as well as overall length of the fossa varies considerably from side to side and from patient to patient. The configurations range from an elongated, slitlike fissure to a somewhat more triangular teardrop-shaped opening. In all normal instances, the surrounding cortical margins of the fossa are well delineated. Plain film radiographs and lateral hypocydoidal tomograms through the pterygopalatine fossa and medial pterygoid plate show the broader superior portion of the fossa as it narrows inferiorly to become the pterygopalatine canal. Tomograms through the medial pterygoid plate show a somewhat bulbous inferior prominence, the pterygoid humulus. The lateral pterygoid plate is rarely seen in its entirely on a single lateral tomographic section because of its more oblique orientation. The lateral pterygoid lamina is scimitar-shaped, with a posteriorly directed, slightly concave surface [1]. The base of the pterygoid plates and the pterygoid fossa, the V-shape space contained between the two pterygoid plates, are both best appreciated on either anteroposterior or
234
Xin-Chun Jian
submentovertex tomograms. The foramen rotundum and pterygoid canal can also be identified on these views. The palatinovaginal or pharyngeal canal is anatomically insignificant and is rarely visualized. Computed tomographic studies of the pterygopalatine fossa have indicated, in axial CT, the pterygopalatine fossa had different shapes at different levels. In an axial CT section 5mm more rostral, the upper most part of the PPF is seen adjacent to the infraorbital fissure, which forms an angle of about 45 degrees with head’s transverse diameter. The posterior-medial margin of the PPF at its uppermost extent appears flat. In a CT image at this level the foramen rotundum appears as a sagittally oriented channel about 1mm wide connecting the middle fossa and the PPF. The pterygoid canal is not usually visualized in axial CT. The PPF contains fat in which vessels are identified. Maxillary artery branches appear as multiple small round enhancing structures in axial CT sections through the lower portion of the PPF. The maxillary nerve and the pterygo-palatine ganglion usually are not visualized in routine patient scanning due to partial volume averaging of the skull base. In a coronal CT section 5mm more posterior to the PPF, the triangular openings of the pterygoid canals appear at the base of the sphenoid bone. Superolateral to the pterygoid canals are the round openings of the foramen rotundum. In coronal CT sections 5mm more posterior, the pterygoid canals, with a round opening about 1mm in diameter, are seen. At this level, small troughs at the upper aspect of the sphenoid bone and below the superior orbital fissures mark the posterior ends of the foramen rotundum. In coronal CT sectioning, the maxillary nerve and sometimes the pterygopalatine ganglion are seen as a round softtissue structure within fat at the upper part of the PPF. Maxillary artery branches appear on CT as multiple small round or serpiginous enhancing structures [20]. In patients with tumor infiltrating the PPF, CT shows fat replaced with a denser tissue that usually enhances significantly with intravenous contrast media. The nerves and blood vessels are not distinguished from the tumor. Tumors can enlarge or erode the foramen rotundum and pterygoid canal [20]. To visualize the PPF optimally, 5 and/or 1.5-mm thick axial and coronal sections are recommended [20]. Neoplastic infiltration of PPF is recognized by erosion of osseous margins, replacement of fat by higher-density tissue, and obscuring of vascular and neural tissues in the PPF. The combination of CT and magnetic resonance (MR) imaging has been the standard evaluation for 2 decades. The technologic advances in CT and MR have improved the resolution and efficiency of the data that can be acquired (Figure 3). Computed tomography is critical in analyzing the cranial base bone anatomy whereas MR gives better soft tissue definition in certain areas [21]. CT also can detect enlargement of foramina and erosion of cranial base bone, MR is superior in detecting small lesion and is capable of identifying perineural spread of malignant lesions (Figure 4). Such information can be important in predicting outcomes of therapy [22]. Recent advances in CT technology such as multiclector volumetric scanners and 3-D reconstruction techniques have improved the resolution of smaller bone landmark [23]. Computed tomography angiography is useful technique that allows an assessment of the critical vascular structures. Specifically, it can show the precise relationship between the internal carotid arteries and other cranial base structures and can determine the relationship of such arteries to the lesion [24].
Benign and Malignant Tumors Occurring in the Pterygopalatine Fossa…
Figure 3. CT features of tumor in the PPF.
Figure 4. MR features of tumor in the PPF.
235
236
Xin-Chun Jian
SIGNIFICANCE OF FINE-NEEDLE ASPIRATION CYTOLOGY IN THE DIAGNOSIS OF DEEP LESIONS IN THE PPF Most lesions of the head and neck are readily accessible, and biopsy for diagnostic purposes is a relatively simple procedure. Generally, a portion of every lesion suspected of malignancy should be removed for microscopic examination before definitive therapy is attempted. The simplest method of biopsy is the excision of a small portion of tissue, using a scalpel and fine forceps. This is satisfactory for lesions of the skin, lip and anterior portion of the oral cavity. Open biopsy is, however, extremely difficult, and is almost impossible for tumors occurring in the pterygopalatine fossa [17]. The initial report concerning fine-needle aspiration cytology (FNAC) is from Memorial Hospital for Cancer and Allied Diseases by Martin and Ellis in 1930 [25] . The formal use of FNAC in the head and neck began in 1974 and did not achieve wide-spread acceptance until about a decade ago, when its effectiveness and accuracy were eventually realized [26]. Usually, FNAC can provide clinically useful information that exceeds that obtained by palpation or imaging alone. The 90% to 95% sensitivity obtained with FNAC for the diagnosis of palpable head and neck lesions is comparable to that obtained with traditional open biopsy techniques [27]. But deep-seated lesions may be difficult to access using FNAC and can be confused with complex anatomic structures in the PPF because of the lack of accuracy in needletip localization and possible risk of injury to surrounding vital tissues [2832]. In such instances, the advent of image-guided aspiration has broadened its applicability. Fine-needle aspiration combined with imaging guidance such as radiography, ultrasonography, computed tomography, emission computed tomography, and magnetic resonance imaging may enhance the accuracy of the diagnosis. An 8-mm, 20-gauge MR-compatible needle (Cook Company) that is high in nickel content, thereby reducing the ferromagnetic properties of the alloy and decreasing the magnetic susceptibility differences between the alloy and surrounding tissue, was used under MR guidance to enhance accuracy of the aspiration. He et al [32] achieved an access rate of 100% (12 of 12 patients), with an accuracy of 91.67% (11 of 12 patients), sensitivity of 85.71%, and specificity of 100%. This is the same as the reports of MR-guided aspiration in other head and neck regions [33] and superior to ultrasound-guided and CT-guided cytology in other head and neck regions [34,35]. MR can offer superior soft tissue contrast and multiplanar imaging capability compared with CT and ultrasonography [36,37]. The MRguided needletip can be localized within masses with the diameter of 2 to 3mm [38]. The above-mentioned studies strongly suggest a preferential role of MR over CT in guidance for diagnosis of the deep-seated lesions in the head and neck.
Benign and Malignant Tumors Occurring in the Pterygopalatine Fossa…
237
SURGICAL APPROACHES – BENIGN AND MALIGNANT TUMORS IN THE PPF The rationale for resection of benign PPF tumors has been well established by improved preoperative imaging assessment, new surgical techniques, better postoperative care, and fruitful cooperation between multidisciplinary teams. Despite the technical reproducibility of the classic techniques (ie, the craniofacial and subcranial approaches), modifications are continually being designed to enhance access to this anatomic region [39]. Surgery in the pterygopalatine fossa area presents anatomic and surgical problems related to the difficulty of access. When a lesion involves the maxilla, maxillectomy is often necessary. An anterior approach involving a Weber-Ferguson incision, or one of its modifications, is often used (Figure 5A). The problem with this particular approach, however, is limited posterior exposure, because separation of the maxilla from the pterygoid plates is normally done last and is performed blind, often using a chisel in an already blood-filled field [40-43]. Access to lesions extending into pterygoid plates and associated structure is even more limited with use of this approach. Barbosa [44], in 1963, developed an extended anterior approach (Figure 5B). A WeberFerguson incision was extended from the lateral canthus of the eye posteriorly to the root of the helix of the ear. This allowed a large inferiorly based flap to be raised, which includes the parotid gland within the incision. The masseter and temporalis muscles were divided horizontally, a portion of the ascending ramus of the mandible was resected, and the temporomandibular joint was disarticulated. The then allowed direct lateral access to the pterygomaxillary region, and the pterygoid muscles and plates could be removed. Barbosa originally suggested this technique as a method for performing extending maxillectomy, which could include the orbit and even the anterior cranial fossa in addition to structures of the pterygomaxillary region. Crockett, in 1963, modified this approach by adding a lateral extension from the commisure of mouth (Figure 5C). Following reflection of this flap, access was gained to the pterygomaxillary region by raising two osteoplastic flaps. The inferior flap consisted of the arch and the orbital process of the zygomatic bone attached on the masseter muscle. The superior flap contained the divided coronoid process still attached to the temporalis muscle. Retraction of these two flaps provided a window to the pterygomaxillary region [45]. When lesions involve only the structures of the pterygomaxillary fossa and not the maxilla, access from an anterior approach requires unnecessary maxillectomy. At this time, a number of lateral approaches have been suggested for gaining direct access to pterygomaxillary region. Conley proposed, in 1956, an extended preauricular incision extending down into the neck, with a second submandibular incision extending to the angle of the mouth (Figure 5D). With these incisions, an extensive superior and a smaller inferior flap could be developed. The inferior part of the temporalis muscle and its attachment to the coronoid process could be removed, as could the zygomatic arch with the attached masseter muscle, as well as the ascending ramus of the mandible. The parotid gland and facial nerve were left undisturbed, but the facial incision and bony defect were not cosmetically pleasing, and many of the deeper structures had to be sacrificed [46].
238
Xin-Chun Jian
Figure 5. Outline of incisions. A) Weber-Ferguson; B) Barbosa; C) Crockett; D) Conley; E) Dingman and Conley; F) Attenborough; G) Jian.
In 1970, Dingman and Conley [47] described an inferior approach via a submandibular incision, which was extended anteriorly to include a midline lip-splitting incision and posteriorly to run to the mastemporal incision (Figure 5E). After the extensive skin-flap was raised, the parotid gland and facial nerve were retracted inferiorly. The zygomatic arch was sectioned and reflected inferiorly on the masseter muscle, and the ascending ramus of the mandible was divided horizontally, as in the prior approaches. According to comouflaging the skin incision, care of the facial nerve, and sufficient exposure to accomplish the task at hand are the keys to a successful result. In 1998, we [48] modified the Barbosa approach by adding in a lateral incision in the mandibular gingivobuccal fold from the canine tooth to the retromolar area. This allows a large, inferiorly based flap to be raised, which includes the parotid gland. The masseter and temporalis muscles are divided horizontally, and the ascending ramus of the mandible is
Benign and Malignant Tumors Occurring in the Pterygopalatine Fossa…
239
osteotomided between the mandibular angle and the sigmoid notch and reflected to expose the tumor in the pterygopalatine fossa and maxillary sinus. We believed that this technique is especially useful for tumors in the pterygopalatine fossa extending into the maxillary sinus (Figure 5G). For small lesions, the endoscopic approach with or without external approaches offers an effective mean for tumor resection [49]. Standard approaches to the PPF require transmaxillary techniques that violate the anterior and posterior walls of the maxillary sinus, with the risks of facial edema and pain, infraorbital nerve injury, oroantral fistula and vascular injury. An endoscopic approach to the PPF can potentially reduce these risks, along with providing better visualization than headlight-or microscope-directed approaches. DelGaudio [50] reported an endoscopic approach to the PPF for definitive resection of a schwannoma. The procedure was begun with a large maxillary antrostomy, ethmoidectomy, and wide sphenoidotomy to expose the medial and anterior aspects of the tumor. The mucosa of the posterior maxillary sinus was elevated from superomedial to inferolateral. The thinned posterior wall of the maxillary sinus was easily removed from the anterior and superior surfaces of the PPF mass to expose the capsule. The sphenopalatine artery was dissected from the surface and medial aspect of the mass, cauterized, and transected medially to completely free the medial aspect of the tumor. The tumor was then bluntly dissected off of the pterygoid plates posteriorly. Because of the tight confines of the PPF and the dense inferior attachments of the tumor to the vasculature of the PPF, the tumor could not but removed en bloc. The capsule was therefore opened to allow complete removal of the tumor. The inferior portion of the tumors was removed last, after identification and clipping of the main trunk and branches of the internal maxillary artery. After confirmation of complete tumor removal and irrigation of the PPF, the surgical area with exposed pterygoid periosteum was covered with a dissolvable hyaluronic acid pack [50]. The endoscopic approach to the PPF is a safe and effective surgical procedure. This approach can be used for both diagnostic biopsy and definitive tumor removal where appropriate. The approach described herein proceeds from medial to lateral, allowing for identification of the sphenopalatine vasculature early in the procedure to reduce the risk of vascular injury, which could obscure the endoscopic view. Lateral extension can provide access to the inferior orbital fissure. The use of an image-guided system is a useful adjunct to this surgical approach.
SURGICAL APPROACHES – BENIGN AND MALIGNANT TUMORS OCCURRING IN ADJACENT STRUCTURES OF THE PPF For larger lesions occurring in the PPF, the transfacial and submandibular approaches offer excellent exposure and tumor control. However, for tumors extending to adjacent structures, above attention approaches alone can not provide adequate exposure, and therefore other techniques should be added to allow safe tumor extirpation. In 1986, Jackson et al use craniofacial osteotomies to facilitate skull base tumor resection. A zygomatic arch osteotomy was performed together with an osteotomy of the ascending ramus of the mandible
240
Xin-Chun Jian
and a total parotidectomy. A orbital osteotomy was performed involving the lateral wall, the inferior orbital margin, and the floor of the orbit. This latter segment was not removed but simply moved anteriorly in order to gain better exposure of the retromaxillary and ethmoid areas. In order to excise the tumor totally, it was necessary to resect the posterior half of the maxilla and also a portion of the ethmoid sinuses using a Weber-Ferguson approach. The orbit and the zygomatic arch were wired back into position, but the ascending ramus of the mandible was not, since the lower portion of the resection communicated directly with the maxillectomy area, and the chances of inflection and sequestration of the ascending ramus were high [51]. Janecka et al, in 1990, developed an approach to nasopharynx, clivus and cavernous sinus by using facial soft tissue translocation and craniofacial osteotomies. Surgical field obtained at the skull base can extend from the contralateral eustachian tube to ipsilateral geniculate ganglion. It includes the nasopharynx, clivus, sphenoid and cavernous sinus, as well as the entire infratemporal fossa and superior orbital fissure (Figure 6A). They believed that the greatest advantage of their approach was in the direct access to a neoplasm in this area, previously accessible to surgery in only limited fashion. The excellent visualization and the potential for surgical control of important anatomic structures (carotid artery, optic nerve or the facial nerve), as well as complete visualization of practically all surgical margins is the hallmark of this approach [43] when the pterygopalatine fossa tumor extends into the middle skull base and the intracranial area, however, all the approaches described have limitations. We, in 2003, described a new approach to the pterygomaxillary fossa and the cranial base, using facial translocation. This approach offers excellent visualization. The first incision of this approach is divided the upper lip in the midline, passes under the nasal pyramid and extends laterally, reaching the level of the temporomandibular joint, at which point it exists to meet the vertical coronal/preauricular incision. An incision is then made along the maxillary buccogingival fold in the involved side, running from the midline to the retromolar area. Another incision is made along the mandibular buccogingival fold on the involved side, running from canine to retromolar area. Our surgical approach to extensive tumors in the pterygomaxillary fossa and the skull base is a combined technique that exposes the cranial base from the temporal bone to the contralateral eustachian tube. Note that with this approach, the corresponding intracranial anatomy can be easily accessed. If it is anticipated that the dura of central skull base will be exposed, then vascularized tissue will be needed to reconstruct this area. The temporalis muscle provides regional tissue for this purpose and can be accessed via a frontotemporal incision made anterior to the tragus and extending into the hairline above the temporal region (Figure 6B).
Benign and Malignant Tumors Occurring in the Pterygopalatine Fossa…
241
Figure 6. Outline of incisions used in facial translocation approach. A) Janecka, 1990; Skin incision; B) Jian, 2003; Skin incision.
This technique was designed to provide direct access to the central skull base and/or infratemporal fossa and corresponding intracranial anatomy. It is indicated for benign and malignant lesions that involve 2 or more of the following anatomic areas: pterygopalatine fossa, sphenoid sinus, nasopharynx, infratemporal fossa, cavernous sinus and/or floor of the middle fossa and clivus. Because exposure of the cranial base is wide and direct, this approach facilitates en bloc resection of many skull base neoplasms [16]. To prevent facial incisions, a unilateral or bilateral medial maxillectomy can be carried out from above via the subcranial approach [52]. Combination of the craniofacial approach with the facial translations approach can help resection of large juvenile angiofibromas infiltrating the nasopharynx or pterygopalatine fossa while adding a LeFort I down-fracture allows excision of large chordomas involving the clivus.
RECONSTRUCTION AFTER EXCISION OF BENIGN AND MALIGNANT TUMORS OCCURRING IN ADJACENT STRUCTURES OF THE PPF AND IN THE PPF The ultimate success of contemporary lateral skull base procedure is as dependent on reliable reconstructive methods as the technical competency of the proceeding resection. As procedures have evolved, one reconstructive principle has continued to maintain validity through the years. Vascularized tissue provides the strongest foundation for a stable reconstruction [53]. In open procedures involving subcranial approaches or craniotomies, vascularized tissue can be supplied by local flaps, the most commonly used being the reliable pericranial flap, harvested with or without galea. Temporal fascia or temporalis muscle is one of them. Depending on the size of the dural defect, either a free fascial graft or a pedicled vascularized rotation flap of temporal fascia can be used for closure. Small defects of less than 6 mm are covered with free fascia or plugged with fat. For larger defects, a rotation flap of vascularized superficial or deep temporal fascia is used [54]. The temporalis muscle is also
242
Xin-Chun Jian
freely mobile from its original position and can be placed over the pericranial flap, covering the anterolateral cranial base, sphenoid sinus, nasopharynx, orbit, space of previous maxillary sinus and the pterygopalatine, as well as infratemporal fossa regions (Figure 7). The temporalis muscle, facing the nasal cavity and nasopharynx may be covered with free grafts of normal mucosa or can be permitted to be “remucosalized” by healing of secondary intention. For smaller defects, this flap may be adequate for reconstruction alone. Large defects require more robust tissue flaps, the microvascular free tissue transfers of fasciocutaneous tissue or muscle being used most commonly [53,54]. The volume of the defect is critical to flap selection to avoid brain compression by excessive flap tissue. Hence, de-epithelialized radial forearm free flaps are useful to seal smaller lateral skull fossa defects when pericranium is not available or inadequate, and rectus abdominis muscle useful or larger defect [54,55]. Both microvascular flaps are useful due to their reliability, long pedicle and low donor site morbidity.
Benign and Malignant Tumors Occurring in the Pterygopalatine Fossa…
243
Figure 7. Reconstruction of the central skull base with the temporalis muscle and fascia. A) A patient with neurofibroma of the right maxillary sinus extending into the PPF, frontal view; B) Frontal view postoperatively; C) Incisive design, lateral view; D) After exposure of the right maxilla and PPF, lateral view; E) Preparation of the temporalis muscle and fascial flap, lateral view; F) After the temporalis muscle and fascial flap transfers to the central skull base for repairing defect of the central skull base, lateral view; G) After sutures, lateral view; H) Lateral view after stures were removed.
244
Xin-Chun Jian
REFERENCES [1] Osborn AG: Radiology of the pterygoid plates and pterygopalatine fossa. AJR, 1979; 132: 389-394. [2] Hasbitani S, Sakurai K, Naguchi K, et al: Carcinoma in an inverted papilloma of the pterygopalatine fossa: Report of a case. J Oral Maxillofac Surg., 2001; 59: 1235-1238. [3] Wilson GH, Hanafee WN: Angiographic findings in 16 patients with juvenile nasopharyngeal angiofibroma. Radiology, 1969; 92: 279-284. [4] Dubois PJ, Schultz JC, Perrin RL: Tomography in expansile lesions of the nasal and paranasal sinuses. Radiology, 1977; 125: 149-158. [5] Krespi YP, Sisson GA: Transmandibular exposure of skull base. Am J Surg., 1984; 148: 534-538. [6] Fisch U: Infratemporal fossa approach to tumor of the temporal bone and base of skull. J Laryngol Otol., 1978; 92: 949-967. [7] Fisch U, Pillsburg HC: Infratemporal approach to lesions in the temporal bone and base of the skull. Arch Otolaryngol Head Neck Surg., 1979; 105: 99-107. [8] Kennedy DW, Papel ID, Holliday MJ: Transpalatal approach to the skull base. Ear Nose Throat J, 1986; 65: 48-60. [9] Sekhar LN, Schramm VL, Jones NF: Subtemporal preauricular infratemporal fossa approach to large lateral and posterior cranial base neoplasms. J Neurosurg, 1987; 67: 488-499. [10] Fisch U: Infratemporal fossa approach for lesions in the temporal bone and base of the skull. Adv Otorhinolaryngol, 1984; 34: 254-266. [11] Shah JP, Sundaresan N, Galicich J, et al: Craniofacial resections for tumors involving the base of skull. Am J Surg., 1987; 154: 352-358. [12] Biller HF, Shugar JMA, Krespi YP: A new technique for wide-field exposure of the base of the skull. Arch Otolaryngol Head Neck Surg., 1981; 107: 698-702. [13] Lee Js, Iranmanesh A, Schmidt BL: Limited oral opening in a 43-year-old man. J Oral Maxillofac Surg., 2005; 63: 103-110. [14] Herrera AF, Mercuri LG, Picken MM: Reactive granulomatous lesion in the pterygomandibular fossa mimicking a temporomandibular disorder. J Oral Maxillofac Surg., 2002; 60: 1203-1206. [15] Harar RPS, Eynon-Lewis NJ, Scarivilli F, et al: Extensive salivary gland choristoma of the pterygopalatine fossa. Otolaryngol Head Neck Surg, 2002; 122: 611-612. [16] Jian XC, Liu JP: A new approach to extensive tumors in the pterygopalatine fossa and the skull base. Oral Surg Oral Med Oral Pathol Oral Radiol Endod, 2003; 95: 156-162. [17] Jian XC, Wang CX, Jiang CH: Surgical management of primary and secondary tumors in the pterygopalatine fossa. Otolaryngol Head Neck Surg, 2005; 132: 90-94. [18] Chong VFH, Fan YF, Khoo JBK, et al: Comparing computed tomographic and magnetic resonance imaging visualization of the pterygopalatine fossa in nasopharyngeal carcinoma. Ann Acad Med Singapore, 1995; 24: 436-441. [19] Sham JTS, Cheung YK, Choy D, et al: Nasopharyngeal carcinoma: CT evaluation of pattern of tumor spread. Am J Roentgerol, 1991; 12: 265-270.
Benign and Malignant Tumors Occurring in the Pterygopalatine Fossa…
245
[20] Daniels DL, Rauschning W, Lovas J, et al: Pterygopalatine fossa: Computed tomographic studies. Radiology, 1983; 149: 511-516. [21] Yu Q, Wang PZ, Shi HM, et al: The lesions of the pterygopalatine and infratemporal spaces: computed tomography evaluation. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 1998; 85: 742-751. [22] Williams LS, Mancuso AA, Mendenhall WM: Perineural spread of cutancous squamous and basal cell carcinoma: CT and MR detection and its impact on patient management and prognosis. Int J Radiat Oncol Biol Phys, 2001; 49: 1061-1069. [23] Glenn LW: Innovations in neuroimaging of skull base pathology. Otolaryngol Clin North Am, 2005; 38: 613-629. [24] Leong JL, Batra PS, Citarol MJ: Three-dimensional computed tomography angiography of the internal carotid artery for the preoperative evaluation of sinonasal lesions and intraoperation surgical navigation. Laryngoscope, 2005; 115: 1618-1623. [25] Martin HE, Ellis EB: Biopsy by needle puncture and aspiration. Ann Surg., 1930; 92: 169. [26] Robbins KT, van Sonnenberg E, Casola G, et al: Imageguided needle biopsy of inaccessible head and lesions. Arch Otolaryngol Head Neck Surg., 1990; 116: 957-961. [27] Frable MA, Frable WJ: Fine-needle aspiration biopsy revisited. Laryngoscope, 1982: 92: 1414-1418. [28] Platt JC, Davidson D, Nelson CL, et al: Fine-needle aspiration biopsy: an analysis of 89 head and neck cases. J Oral Maxillofac Surg 1990; 48: 702-706. [29] Schelkun PM, Grundy WG: Fine-needle aspiration biopsy of head and neck lesions. J Oral Maxillofac Surg 1991; 49: 262-267. [30] Daskalopoulou D, Rapidis AD, Maounis N, et al: Fine-needle aspiration cytolog in tumors and tumor-like conditions of the oral and maxillofacial region: diagnostic reliability and limitations. Cancer 1997; 81: 238-247. [31] Fulciniti F, Califano L, Zupi A, et al: Accuracy of fine needle aspiration biopsy in head and neck tumors. J Oral Maxillofac Surg 1997; 55: 1094-1097. [32] He Y, Zhang ZY, Tian Z, et al: The application of magnetic resonance imaging-guided fine needle aspiration cytology in the diagnosis of deep lesions in the head and neck. J Oral Maxillofac Surg 2004; 62: 953-958. [33] Elmar M, Merkle, Jonathan SL, et al: Perculaneous MRI-guided biopsy and aspiration in head and neck. Laryngoscope 2000; 111: 382. [34] Shin HJ, Lahoti S, Sneige N: Endoscopic ultrasound-guided fine-needle aspiration in 179 cases: The M.D. Anderson Cancer Center experience. Cancer 2002; 96: 174-180. [35] Santambrogio I., Nosoti M, Bellaviti N, et al: CT guided fine-needle aspiration cytology of solitary pulmonary nodules: A prospective, randomized study of immediate cytologic evaluation. Chest 1997; 112: 423-425. [36] Lufkin R, Teresi L, Hanafee W: New needle for MR-guided aspiration cytology of the head and neck. AJR Am J Roentgenol 1987; 149; 380-382. [37] Mueller PR, Stark DD, Simeone JF, et al: MR-guided aspiration biopsy: Needle design and clinical trials. Radiology 1986; 161: 605-609. [38] Langen HJ, Kugel H, Krahe T, et al: Precision of MRI-guided needle placement: Experimental results. Radiology 1996; 201: 358.
246
Xin-Chun Jian
[39] Mehta RP, Cueva RA, Brown JD, et al: What’s new in skull base medicine and surgery? Skull Base Committer Report. Otolaryngol Head Neck Surg 2006; 135: 620-630. [40] Pogred MA, Kaplan MJ: Surgical approach to the pterygomaxillary region. J Oral Maxillofac Surg 1986; 44:183-187. [41] Janecka IP, Sen CN, Sekhar LN, et al: Facial translocation: A new approach to the cranial base. Otolaryngol Head Neck Surg 1990; 103: 413-419. [42] Janecka IP: Classification of facial translocation approach to the skull base. Otolaryngol Head Neck Surg 1995; 112: 579-585. [43] Hitotsumatsu T, Rhoton AL: Unilateral upper and lower subtotal maxillectomy approaches to the cranial base: microsurgical anatomy. Neurosurgery 2000; 46: 14161453. [44] Barbosa JF: Surgery of extensive cancer of paranasal sinuses. Arch Otolaryng 1961; 73: 129-138. [45] Crockett DJ: Surgical approach to the back of the maxilla. Br J Surg. 1963;50:819-821. [46] Conley JJ: The surgical approach to the pterygoid area. Ann Surg 1956; 144: 39. [47] Dingman DL, Conley JJ: Lateral approach to the pterygomaxillary region. Ann Otol. 1970; 79: 967-969. [48] Jian XC, Chen XQ, Wang CX: A Surgical approach to extensive tumors in the pterygopalatine fossa extending into the maxillary sinus. J Oral Maxillofac Surg 1998; 56: 578-584. [49] Pasquini E, Sciarretta V, Frank G, et al: Endoscopic treatment of benign tumors of the nose and paranasal sinuses. Otalaryngol Head Neck Surg 2004; 131: 180-186. [50] DelGaudio JM: Endoscopic transnasal approach to the pterygopalatine fossa. Arch Otolaryngol Head Neck Surg 2003; 129: 441-446. [51] Jackson IT, Marsh WR, Bite U, et al: Craniofacial osteotomies to facilitate skull base tumour resection. Brit J Plast Surg 1986; 39: 153-160. [52] Fliss DM, Gil Z, Spektor S, et al: Skull base reconstruction after anterior subcranial tumor resection. Neurosurg Focus 2002; 12: article 10. [53] Teknos T, Smith J, Day T, et al: Microvascular free tissue transfer in reconstructing skull base defects: Lessons learned. Laryngoscope 2002; 112: 1871-1876. [54] Marchetti C, Gessaroli M, Cipriani R, et al: Use of “Perforator flaps” in skull base reconstruction after tumor resection. Plast Reconstr Surg, 2002; 110: 1303-1309. [55] Reza Nouraei SA, Ismail Y, Gerber CJ, et al: Long-term outcome of skull base surgery with microvascular reconstruction for malignant disease. Plast Reconstr Surg 2006; 118: 1151-1160.
In: Oral Cancer Research Advances Editor: Alexios P. Nikolakakos, pp. 247-262
ISBN 978-1-60021-864-4 © 2007 Nova Science Publishers, Inc.
Chapter 11
MOLECULAR ASPECTS OF ORAL CANCER: THE ROLE OF PHASE I AND II BIOTRANSFORMATION ENZYMES IN CARCINOGENESIS Karin Soares Gonçalves Cunha1,2,3 and Dennis de Carvalho Ferreira4 1
Department of Oral Pathology and Diagnosis, School of Dentistry, Federal University of Rio de Janeiro, Rio de Janeiro, Brazil; 2 School of Dentistry, University Center Serra dos Órgãos (UNIFESO), Teresópolis, Brazil; 3 Fluminense Federal University, Niterói, Brazil; 4 Department of Microbiology, Sector of Sexually Transmitted Diseases, Federal Fluminense University, Niterói, Brazil.
ABSTRACT Oral cancer is the most common malignant neoplasm of the head and neck and over half of the people who develop this cancer die within five years after the diagnosis. Carcinogenesis is a highly complex process involving both environmental, mainly tobacco and alcohol use, and inherited risk factors. In recent years, inter-individual genetic differences and individual susceptibility to human cancer triggered by environmental exposures has been studied. This environment-gene interaction in carcinogenesis is well reflected by phase I and II enzymes that are involved in the metabolism of carcinogens. Cytochrome P450 family of enzymes (CYP), involved in phase I, converts many carcinogens into DNA-binding metabolites in target cells and can modulate intermediate effect markers such as DNA-adducts. Phase II enzymes, including glutathione S-transferase (GST), N-acetyltransferase (NAT) and others, play important roles in protecting cells from DNA damage by carcinogens and reactive oxygen species. Genetic alterations of these two classes of enzymes have been considered as risk modifiers of some major tobacco-related cancers, including oral cancer. The aim of this
248
Karin Soares Gonçalves Cunha and Dennis de Carvalho Ferreira chapter is to review the molecular aspects of oral cancer, emphasizing the role of phase I and II enzymes in oral carcinogenesis. Propositions for further researches are highlighted.
1. INTRODUCTION Oral cancer is a serious health problem. It is the sixth most common malignancy, with over 200,00 new cases reported annually worldwide [41]. Squamous cell carcinoma accounts for approximately 90% of all malignancies diagnosed in oral cavity. It is the most common malignant neoplasm of the head and neck and half of the people who develop oral cancer die within five years after the diagnosis [5,45]. Carcinogenesis is a highly complex process involving both environmental and inherited risk factors. In oral cancer, as well as in other head and neck cancers, predominantly tobacco and alcohol consumption are the most significant external factors involved in tumor formation [20]. The higher incidence of cancer in first-degree relatives of patients with squamous cell carcinomas of the head and neck confirms the presence of genetic susceptibilities in the development of this disease [14]. Moreover, within a population, it is remarkable that only some people develop cancer, even with similar exposures. In recent years, inter-individual genetic differences and individual susceptibility to human cancer triggered by environmental exposures has been studied. This environmentgene interaction in carcinogenesis is well reflected by phase I and II enzymes that are involved in the metabolism of carcinogens [39]. Cytochrome P450 family of enzymes (CYPs), involved in phase I, converts many carcinogens into DNA-binding metabolites in target cells and can modulate intermediate effect markers such as DNA-adducts. Phase II enzymes, including glutathione S-transferase (GST), N-acetyltransferase (NAT) and others, play important roles in protecting cells from DNA damage by carcinogens and reactive oxygen species [16,41,57]. Susceptibility to oral cancer in a particular individual may depend in part on the metabolic balance between phase I and phase II enzymes [20]. Genetic alterations of these two classes of enzymes have been considered as risk modifiers of some major tobacco-related cancers, including oral cancer. The aim of this chapter is to review the molecular aspects of oral cancer, emphasizing the role of phase I and II enzymes in oral carcinogenesis.
2. CHEMICAL CARCINOGENESIS Carcinogenesis is a multistep process that involves three distinguishable but closely connected stages: initiation (normal cell → transformed or initiated cell), promotion (initiated cell → preneoplastic cell), and progression (preneoplastic cell → neoplastic cell) [59]. Accumulation of genetic changes that occurs during carcinogenesis allows for the disruption of normal cellular functions and enables a clonal expansion of abnormal cells to form a malignant neoplasm [34].
Molecular Aspects of Oral Cancer
249
Initiation is the first step of carcinogenesis and it is a result of rather rapid and irreparable damage to the cell. Chemical carcinogenesis initiates when DNA in a cell or population of cells is damaged by exposure to exogenous or endogenous carcinogens [27]. Carcinogens can react with DNA to form adducts (carcinogen metabolites bound covalently to DNA) and result in DNA alteration, which is an important step in chemical carcinogenesis [1]. According to their ability to react to DNA to form DNA-adducts, chemicals carcinogens can be divided into two groups. The first group comprises chemical compounds that are direct-acting agents and can react to DNA without metabolic activation to form DNA-adducts. The second group comprises chemical carcinogens that are indirect agents and need to be activated by phase I enzymes to react to DNA [34]. As these chemicals do not react directly with cellular constituents and require enzymatic conversion into their ultimate carcinogenic forms, they are termed procarcinogens [40]. Among known human carcinogens, only a few chemicals belong to the class of 'direct carcinogens', including ethylene oxide, bis(chloromethyl)ether and some aziridine or nitrogen-mustard derivatives used in anticancer chemotherapy. On the other hand, nucleophilic or chemically inert compounds that need to be activated to form DNA-adduct represent the great majority of human carcinogens and comprise aromatic and heterocyclic amines, aminoazo dyes, polycyclic aromatic hydrocarbons (PAHs), N-nitrosamines, halogenated olefins and others [40].
2.1. Tobacco Products and Oral Cancer Tobacco products contain a diverse array of chemical carcinogens and most of them require metabolic activation to exert their carcinogenic effects. Tobacco can be consumed in both smoking and smokeless form. Tobacco smoke comprises nearly 60 known carcinogens, but smokeless tobacco contains fewer carcinogens than tobacco smoke because most of them are formed during combustion [67]. The major carcinogens present in tobacco are PAHs, nitrosamines and aromatic amines. In smokeless tobacco, levels of PAHs are typically low, but there is a high concentration of nitrosamines [10,67].
2.2. Alcohol and Oral Cancer Alcohol, particularly in association with tobacco, has been recognized as an important risk factor for OSCC [48]. Approximately 75% of all oral cancers arise in association with alcohol and tobacco consumption [48]. An independent role of alcohol in carcinogenesis has also been identified [66]. The mechanisms by which alcohol can cause cancer are still poorly understood [3,66]. Ethanol and water are the main component of most alcoholic drinks, but pure ethanol does not act as a carcinogen in animal studies [3,66]. It has been proposed that ethanol may increase the penetration of carcinogens across oral mucosa [3]. This may be through intercellular passage of carcinogens entering the oral mucosa or perhaps by increasing the permeability of the oral mucosa [3,42,43,66]. This may
250
Karin Soares Gonçalves Cunha and Dennis de Carvalho Ferreira
explain the synergistic action of alcohol drinking and tobacco use in oral carcinogenesis, but it does not explain the increased risk of oral cancer in alcohol drinkers and never-smokers [3]. Acetaldehyde, the primary metabolic of ethanol, is a candidate for the carcinogenic effect of alcohol. The main pathway of oxidation of ethanol to acetaldehyde is via the enzyme alcohol desidrogenase (ADH) [66]. It is known that acetaldehyde can form DNA-adducts in human cells in vitro and also in rats, thus resulting in DNA alterations [3]. Production of reactive oxygen species and nitrogen species is another possible mechanism of alcohol-related carcinogenesis [3]. Ethanol is the most important inducer of a specific phase I enzyme (CYP2E1), which is important in the metabolic activation of PAHs and nitrosamines [38,52]. Beyond being an inducer, ethanol is also a substrate of CYP2E1 [52]. Other components in alcoholic beverages, including impurities and contaminants, might also increase the risk of oral cancer [3]. PAHs have been found in hard liquors (e.g. whiskey) and N-nitrosamines have been identified in beers [28].
3. XENOBIOTIC METABOLISM The biochemistry of mammalian cellular metabolism is a complex array of enzymes and metabolic products whose purpose is to generate energy for life and protect fidelity for DNA replication. In humans, these activities occur in a hostile environment where there is a continued exposure to a wide variety of foreign compounds (xenobiotics) [21]. During evolution process, organisms developed mechanisms to protect them against chemical insults [21]. When chemical carcinogens are internalized by cells, they are often metabolized, by phase I enzymes. These resulting metabolic products form the substrates of phase II enzymes, which participate in reactions that involve the conjugation of these products with endogenous molecules, such as glutathionine, facilitating their elimination [10]. Nevertheless, this natural process that serves to excrete xenobiotics also activates chemical procarcinogens [34]. Phase I enzymes convert relatively inert chemicals into electrophilic intermediates via oxidation reactions. Electrophilic chemical species are naturally attracted to nucleophiles like DNA and protein, and through DNA-adduct formation, DNA genetic damage results [34].
3.1. P450 Enzymes (CYPs) Over 90% of phase I metabolisms is mediated by cytochomes P450 (CYPs) [37]. CYPs are intracellular monomeric hemoproteins that belong to the monooxygenase gene superfamily and “activate” molecular oxygen for the oxidative metabolism of a great variety of lipophilic organic chemicals [17,21].
Molecular Aspects of Oral Cancer
251
The difference between CYPs and other hemoproteins is the presence of thiol-group functioning as a ligand that alters the electron density of the resonant porphyrin ring of the heme and provide an electronic center for the activation of molecular oxygen [21]. There are many reactions catalyzed by CYPs and the number of chemicals that can serve of substrates metabolized by CYPs is enormous and is greater than 1000 and includes endogenous substrates, such as steroids, fatty acids, and prostaglandins, as well as exogenous chemicals, including drugs and lipohilic xenobiotics [21,32]. Based on the nucleotide sequences, all CYP-encoding genes occurring in the mammalian genome were divided into 10 gene families which were further divided into subfamilies. Currently, it is believed that there are 50 different genes encoding CYPs in human genome [17]. CYPs were categorized by Families and Subfamilies based on the principle that “a CYP protein sequence form on gene family is defined as usually having less than 40% of resemblance to that from any other family”. Subfamilies grouped together proteins have less than 60% sequence similarity [21]. CYPs are localized in smooth endoplasmic reticulum and mitochondrial membrane in liver and in extra-hepatic localization [17,21,68]. Although the liver represents the major site for CYP-dependent metabolism, the extrahepatic tissues also express significant activity [19,65,68]. CYPs are distributed in almost every organ of the human body, although the type of CYP in a tissue appears to be specific [19,21,68]. The cellular expression of many CYPs is regulated by transcriptional factors which become activates during exposure to various chemicals. The ability of a chemical to serve as an “inducer” is generally linked to a CYP family [21]. There is a paucity of studies that aimed to evaluate the expression of CYPs in oral cavity. Farin et al. (1995) evaluated the expression of CYPs in oral epithelial cells immortalized by human papilloma virus type 16E6/E7 genes and many mRNAs transcripts for several CYPs was observed [13]. Yokose et al. (1999) performed an immunohistochemical study to identify CYP2C and 3A in human non-neoplastic and neoplastic tissues, including normal tongue and OSCC occurring in tongue. Neither CYP2C nor 3A were expressed in normal and neoplastic tongue [68]. Vondracek et al. (2001) studied the CYPs expression (CYP1A1, CYP1A2, CYP2A6, CYP2B6, CYP2C, CYP2D6, CYP2E1, CYP3A4/7 and CYP3A5) in primary cultures of normal keratinocytes obtained from buccal mucosa. A RT-PCR based analysis demonstrated consistent expression of mRNA for CYPs 1A1, 1A2, 2C, 2E1, 3A4/7 and 3A5 [65].
3.2. Phase II Enzymes Phase II enzymes include glutathione S-transferases (GSTs), N-Acetyl transferases (NATs) and others [39]. As already explained before in this chapter, these enzymes are important in detoxification of active metabolites produced by phase I enzymes.
252
Karin Soares Gonçalves Cunha and Dennis de Carvalho Ferreira
GSTs are a supergene family of ubiquitous multifunctional enzymes that play an important role in drug, carcinogens, and reactive species detoxification and act both as peroxidases and as catalysts of glutathionine transfer to electrophiles [10,17]. GSTs are known to play important role in detoxification of several carcinogens found in tobacco, especially benzo[a]pyrene and other PAHs, epoxybutanes, ethylene oxide and halomethanes [5,22]. These enzymes catalyze the conjugation of reduced glutathionine with reactive electrophilic intermediates formed during phase I, resulting in increased water solubility and allowing renal excretion of carcinogenic metabolites [10,17]. The GST family in humans can be divided into four classes: Alpha (α), Mu (μ), Pi (π), and Theta (Ө) enzymes, and they consist of several isoenzymes with overlapping substrate specificity [24, 39]. NATs are cytosolic enzymes present in liver and other tissues in majority of mammals. Human NATs comprise two isoenzymes, the monomorphic NAT1 and the polymorphic NAT2. Both isoforms catalyze the reaction in which xenobiotics containing amine or hydrazime groups are transformed into aromatic amines and hydrazides. This reaction, named N-acetylation, is the major biotransformation pathway of such compounds [17].
4. ASSOCIATION BETWEEN PHASE I AND II POLYMORPHIC VARIANTS AND THE RISK OF ORAL CANCER Since xenobiotic substances metabolism can affect the potency of most carcinogens by activating or detoxificating them, carcinogen-metabolizing enzymes polymorphisms have an important role in susceptibility to such xenobiotic related cancers [11]. Genetic alterations in CYPs have been related to individual susceptibility to various types of malignancies, such as lung, breast, prostate, ovarian, and head and neck cancer [4,17,30,36,41,53,55,57,64]. Cancer risk is determined by the degree of expression and/or activity of CYP enzymes [12]. An elevated activity of these enzymes increases the risk of cancer whereas a lower or absent activity reduces cancer risk. Similarly, variation in the expression and activity of phase II enzymes due to heritable genetic polymorphisms have also been associated to the susceptibility of various cancers (lung, colorectal, bladder, head and neck cancers and others), resulted from the altered ability to face biological insult caused by exposure to carcinogens [7,9,25,47,50]. It also has been postulated that certain genotype combinations can increase the risk of cancer by acting synergically [10]. For e.g. enhanced activation of procarcinogens by phase I enzymes, accompanied by reduced or loss of phase II enzymes function, both caused by genetic polymorphisms, can lead to greater risk for cancer than attributed by single gene variant alone [10].
4.1. CYPs Polymorphisms and the Risk of Oral Cancer To date, three families of CYPs could be associated to the development of OSCC and they are listed bellow.
Molecular Aspects of Oral Cancer
253
4.1.1. CYP1 Gene Family Studies There are three genes (CYP1A1, CYP1A2 and CYP1B1) belonging to the CYP1 gene family [17]. CYP1A1 and CYP1A2 catalyzed chemical reactions and substrates for which are PAHs and cicyclic/heterocyclic aromatic amines, respectively, and thus resulting in the activation of these procarcinogens and formation of mutagenic and genotoxic metabolites [17]. The human enzyme CYP1A1 is the most active among the CYPs in metabolizing procarcinogens, like PAHs and aromatic amines, into active species forming DNA-adducts [44]. Several important single nucleotide polymorphisms have been identified in the CYP1A1 gene, located on chromosome 15q22. The CYP1A1 m1 allele has a thymine/cytosine point mutation in the 3’-noncoding region at nucleotide T6235C, which has been associated with elevated enzyme activity [33,55]. Another polymorphic variant of CYP1A1 gene (m2), which has also been associated with elevated enzyme activity, is the isoleucine/valine substitution in heme-binding region in exon 7 at nucleotide A4889G [33,55]. The variant CYP1A1 m3 has a mutation in intron 7 and appears to be African-American specific. Another polymorphism (m4), located two bases upstream of the m2 site, also causes amino acid substitutions of Thr for Asn in the hemebinding regions of the enzyme [55]. The majority of the studies that investigated the association between OSCC risk and polymorphisms of loci involved in metabolic pathways of xenobiotics, has included the study of CYP1A1 genetic variants [51,57]. Park et al., in 1997, first reported the association of CYP1A1 polymorphism and an increased susceptibility to OSCC in USA [51]. Many other studies, performed in different countries (Japan, Korea, Brazil, India, Twain), have also obtained the same results [6,15,30,41,53,56,57,58]. Conversely, other studies performed in Germany, Japan, Brazil and Netherlands could not find this association [20,31,35,41,49]. CYP1B1 also contributes to aromatic hydrocarbon hydroxylase activity, and interindividual variation in the expression of CYP1B1 has been observed. Human CYP1B1 catalyzes the oxidation of PAHs to yield electrophilic intermediated capable binding covalently to DNA [44]. Several polymorphisms have been identified in the coding region of CYP1B1 gene. Most polymorphisms resulted in the formation of a truncated or nonfunctional protein [33]. Four sense polymorphisms were found in the CYP1B1 gene: at position 48 (Arg to Gly), at position 119 (Ala to Ser), at position 432 (Val to Leu), and at position 453 (Asn to Ser) [33]. The first study that associated CYP1B1 polymorphisms and head and neck cancers was performed in 2001, in Germany, by Ko et al [33]. These authors observed that CYP1B1 Val432Leu polymorphism is an inheritable predisposing factor for smoking-induced head and neck squamous cell carcinomas. Nevertheless, another study performed in the USA found that CYP1B1 Val432Leu polymorphisms are not associated with an increased risk of squamous cell carcinoma of the head and neck [38]. To our knowledge, there is not any other study which investigated CYP1B1 polymorphisms in patients with head and neck cancer.
254
Karin Soares Gonçalves Cunha and Dennis de Carvalho Ferreira
4.1.2. CYP2 Gene Family Studies CYP2 family is the largest studied so far and comprises six subfamilies: CYP2A, CYP2B, CYPEC, CYP2E and CYP2F [17]. Among xenobiotic metabolizing enzymes, the CYP2A family is characteristic of its catalytic properties to nitrosamines [61]. Several genetic alterations within the CYP2D6 gene were found responsible for attenuation or lack of the enzyme activity [17]. A study performed in Indian Subcontinent (Sri Lanka) suggested that deficient CYP2A6 activity due to genetic polymorphisms reduces oral cancer risk in betel quid chewers [61]. The lesser risk of oral cancer in these patients may be explained by the fact that individuals with this genotype are incapable to bioactivating betel quid specific procarcinogens to carcinogens. Another study, performed in Croatia, could not find statistically significant difference between the occurrence of CYP2D6 genetic alterations in head and neck patients and the control population [62]. CYP2E1 catalyzes metabolic activation of several compounds found in cigarette smoke, such as N-nitroso-dimethylamine, benzene, N-nitrosonornicotine, and ethanol [38]. More than 25 polymorphisms of CYP2E1 have been identified, one of which is G1532C located upstream of the CYP2E1 transcription start site that is believed to affect CYP2E1 expression [23,38]. Due to its ability to bioactivate compounds which are potentially carcinogenic, CYP2E1 polymorphisms have been linked to the development of human cancers. Sugimura et al. (2006) observed that CYP2E1 polymorphisms affect the risk of OSCC in Japanese population. They concluded that these polymorphisms had significant interactions with smoking but there was not any interaction with heavy drinking [57]. Liu et al. (2001) also observed that CYP2E1 polymorphisms may contribute for an increased risk for oral cancer in the USA [39]. Similar results were also observed in a Brazilian study which observed that the CYP2E1 genetic alteration increased the risk for oral cancer [15]. However, another Brazilian study could not find an association between CYP2E1 polymorphism and head and neck cancer risk [41]. Li et al. (2005) also did not observe a relationship between CYP2E1 genetic alterations and squamous cell carcinomas of the head and neck, in the USA [38]. 4.1.3. CYP3 Gene Family Studies The human CYP3 gene family is located on chromosome 7q and comprises four genes: CYP3A3, CYP3A4, CYP3A5 and CYP3A7. Enzymes encoded by these genes are involved in oxidative metabolism of aflatoxins, N-nitrosamines and others carcinogens [17]. In a study performed in the USA, with patients with squamous cell carcinoma of the head and neck, it was observed that the expression of CYP3A4 was significant lower in the tumor tissue than in adjacent normal tissue [2]. To our knowledge, it is the only study that investigated the role of CYP3 gene family in OSCC development.
Molecular Aspects of Oral Cancer
255
4.2. Phase II Genes Polymorphisms and the Risk of Oral Cancer 4.2.1. Glutathinine-S Transferase μ Class Studies GST μ class includes five isoenzymes (GSTM1 though GSTM5) with high genetic similarity [18,19,20,24,49,53]. Most of the studies that evaluated GSTs polymorphisms and their association with oral cancer risk has focused on the GSTM1 gene alterations. A non-functional null-allele (GSTM1*O) and two functional alleles (GSTM1*A and GSTM1*B) of GSTM1 have been characterized. It has been hypothesized that the lack of these enzymes decreases the ability to detoxify carcinogens specifics from the tobacco. Therefore, these genetic alterations have been associated to an increased risk for different types of cancer, including head and neck cancer [54]. Sato et al. (2000), in Japan, investigated the association of risk for OSCC and genetic alteration of GSTM1 and CYP1A1 genes in relation to cigarette-smoking dose. The results showed that individuals with specific polymorphisms in both GSTM1 and CY1A1 genes have a high risk of OSCC and combined genotyping of the susceptible GSTM1 and CYP1A1 genes revealed higher risk than that ascribed to a single susceptible gene, in the lowest cigarettedose level [53]. In a study performed in Japan, it was also observed a significantly higher prevalence of inactive GSTM1 in patients with oral cancer with alcohol-drinking habit when compared with non-cancer group with alcohol-drinking habit. GSTM1 deficiency was 2.5 times more prevalent in oral cancer patients and it was particularly high in patients with cancer of the tongue, lower gingiva and floor of the mouth [47]. Hahn et al. (2002) investigated the association of GSTM1 polymorphisms and susceptibility to oral cancer in German patients. The results demonstrated no statistically difference in the prevalence of that GSTM1 homozygous deletion (null genotype) between oral cancer patients and the controls [20]. Another study also performed in Germany obtained similar results [18]. This study showed that GSTM1 null-genotype was almost equally frequent in patients with oral carcinoma and control group. Nevertheless, the simultaneous null genotype of GSTM1 and GSTT1 was significantly more common in oral cancer patients than in controls [18]. Park et al. (2000) investigated the potential role of GSTM polymorphisms in risk for oral cancer in an African-American population compared to Caucasians [50]. It was suggested that GSTM1 null and GSTM3 intron 6 polymorphisms play an important role in risk for oral cancer among African-Americans, showing that the μ class of GSTs are an important tobacco carcinogen detoxifying enzymes in this population. On the other hand, no significant associations were observed between GSTM genotype and oral cancer risk in Caucasians. In a study performed in the Netherlands, no difference could be found in relation to the occurrence of polymorphic variants in the GSTM1 between head and neck cancer patients and controls [49]. The association of GSTM1 null polymorphism and the risk for oral leukoplakia in individuals with tobacco-smoking habit in Brazilian population was investigated [12]. The results showed a positive association between the presence of GSTM1 null genotype and the
256
Karin Soares Gonçalves Cunha and Dennis de Carvalho Ferreira
development of oral leukoplakia. GSTM1 polymorphisms were also demonstrated to be a risk factor for developing oral leukoplakia in ethnic Indian betel quid/tobacco chewers [46]. 4.2.2. Glutathinine-S Transferase π Class Studies GST π (GSTP) codifies functionally different GSTP1 variant proteins. GSTP1 gene has two different polymorphisms: a single nucleotide polymorphism (SNP) in the coding sequences at codon 105 A → G (Ile105Val), ad another at codon 114 C → T (Ala114Val) [22]. Both polymorphisms result in changes of catalytic activity and have been associated to increasing the risk of cancer development. GSTP1 metabolizes carcinogens among them benzo[a]pyrene diolepoxide, which is one of the most important carcinogenic metabolites in tobacco smoke [22,54]. GSTP1 and also GSTM1 and GSTT1 allelic and genotype distributions were studied among Brazilians from Rio de Janeiro with oral cancer. The results did not support the hypothesis of increased risk of GSTP1 G/G, GSTM1 or GSTT1 null genotypes for developing cancer in oral cavity. Differences in GSTM1 and GSTT1 genotype frequencies among ethnic groups could be observed. The frequency of GSTM1 null genotype was lower in non-withes (34-38%) than in whites (46-48%) in case patients and controls. The frequency of GSTT1 null genotype was higher in non-whites (26%) than in whites (21%) in the control group [22]. 4.2.3. Glutathinine-S Transferase Ө Class Studies In relation to GSTT1, a nonfunctional (GSTT1*2) and a functional (GSTT1*1) allele have been identified [33]. GSTT1 is involved in a conjugation of several low-molecular-weight toxins, such as ethylene oxides or methyl-halogenids [54]. The null genotype of GSTT1 has a decreased capacity in detoxifying carcinogens present in tobacco smoke, leading the formation of DNA-adducts and DNA damage [11]. Drummond et al. (2005) evaluated the association between GSTT1 polymorphism and risk for OSCC in a Brazilian population from Minas Gerais state. The prevalence of GSTT1 deficiency (null) was significantly higher in OSSC patients with oral cancer of the floor of the mouth [11]. The link between polymorphism at the GSTT1, GSTM1, GSTM3 genetic alterations and susceptibility to oral cancer among Indian tobacco users were also investigated. The dataset demonstrated that the GSTT1 and GSTM3 genotypes did not influence susceptibility to cancer of the buccal mucosa, while the GSTM1 null genotype emerged as a significant risk factor among Indian tobacco chewers as well as bidi and cigarette smokers [5]. In a study performed with Taiwan population, it was investigated the association of GSTT1 and GSTM1 genotypes with risk for, age of onset, and neck lymph node metastasis in areca-associated OSCC. The data indicated that the null genotypes for GTM1, GSTT1 or both isoforms were not associated with the risk of OSCC. GSTT1 null patients presented at a significant older age than did those with the GSTT1 non-null genotype. The GSTM1 null genotype was significantly associated with the presence of lymph node metastasis. Patients with a combined GSTM1/GSTT1 null genotype appeared to have a higher risk for lymph node metastasis compared to those with the opposite genotypes [39].
Molecular Aspects of Oral Cancer
257
4.3. N-Acetyl Transferases (NATs) Studies NATs catalyze the acetylation of the aryl- and heterocyclic amine, which are major carcinogens present in tobacco [8]. NAT1 and NAT2 have been shown to be polymorphic enzymes that segregate independently into a large number of of polymorphic genotypes that correspond to rapid and slow acetylator genotype [31]. The distribution of genotypes of this family was characterized in homozygous wild-type, homozygous mutant or heterozygous and the translated of nucleotide changes into functional NAT2 alleles, genotypes and inferred acetylator phenotypes (rapid, intermediate and slow) [8,63]. Few studies have investigated the association between NAT polymorphisms and the risk for head and neck cancers [41,20,8,31,29]. Authors have suggested that people with genotypes known to be associated with the slow acetylator phenotype would be less able to detoxify tobacco smoke metabolites, thus having an increased susceptibility to OSCC [8,31]. Katoh et al (1998) investigated NAT1 and NAT2 genetic polymorphisms in OSCC patients from Japan. The results suggested that NAT1*10 allele may be a genetic determinant among Japanese people, but no risk was associated with NAT2 slow acetylator polymorphism [31]. A case-control study performed by Jourenkova-Mironova et al. (1999), in France, showed moderated increase in risk for oral cancer associated with the slow acetylator genotypes [29]. Conversely, Hung et al. (1993), investigating Japanese population, showed that NAT2 rapid acetylator genotype was not a significant risk factor for oral cancer [26]. Similarly, another case-control study performed in the USA did not observed an association between slow acetylator phenotypes and OSCC risk [8].
5. CONCLUSION The conflicting results from the studies which investigated the association of CYPs, GSTs and NATs polymorphisms and the development of oral cancer may be due to several confounding factors. One important factor is that there are significant ethnic differences in frequency distribution of genetic polymorphisms of these genes [41,62]. Other factors include the sample sizes, the choice of the control group and the lack of data on diet and time or frequency of exposition to the environmental factors [12,41,54,60]. Although many studies have been performed to identify an association between OSCC and phase I and II enzymes polymorphisms, little attention has been paid to the genes that are actually expressed in oral cavity. Greater knowledge of the expression pattern and activity of these enzymes in different oral sites should be useful to better understand the role these polymorphisms in oral carcinogenesis. Although many studies have suggested a correlation between oral cancer and drugmetabolizing enzymes genetic alterations, they cannot elucidate the casual relationships between xenobiotic exposure, phase I and II polymorphisms and cancer. Only prospective studies of cohort followed over time and assayed for the development of cancer can distinguish the susceptible phenotype definitively [21].
258
Karin Soares Gonçalves Cunha and Dennis de Carvalho Ferreira
Longitudinal studies investigating the role of these polymorphisms on malignant transformation of premalignant lesions, such as leukoplakia, would be interesting for targeting patients with malignant lesion at high risk for future malignant lesions [12]. Better understanding the relationship between phase I and phase II polymorphisms and OSCC would be important to identify biomarkers of susceptibility to oral cancer. This may have several implications and include the possibility of developing chemoprevention programs for highly susceptible patients, allowing early intervention and the implementation of efficient prevention and treatment strategies [41].
REFERENCES [1] Airoldi, L; Pastorelli, R; Magagnotti, C et al. Carcinogen-DNA adducts as tools in risk assessment. Adv Exp Med Biol. 1999, 472, 231-240. [2] Ali, S; El-Rayes, BF; Heilbrun, LK et al. Cytochrome P450 and glutathione transferase expression in squamous cell cancer. Clin Cancer Res. 2004, 10(13), 4412-4416. [3] Boffetta, P; Hashibe, M. Alcohol and cancer. Lancet Oncol. 2006, 7(2), 149-156. [4] Boyapati, SM; Shu, XO; Gao, YT et al. Polymorphisms in CYP1A1 and breast carcinoma risk in a population-based case-control study of Chinese women. Cancer. 2005, 103(11), 2228-2235. [5] Buch, SC; Notani, PN; Bhisey, RA. Polymorphism at GSTM1, GSTM3, and GSTT1 gene loci and susceptibility to oral cancer in an Indian population. Carcinogenesis. 2002, 23(5), 803-807. [6] Cha, IH; Park, JY; Chung, WY. Polymorphisms of CYP1A1 and GSTM1 genes and susceptibility to oral cancer. Yonsei Med J. 2007, 48(2), 233-239. [7] Chang, TW; Wang, SM; Guo, YL. Glutathione S-transferase polymorphisms associated with risk of breast cancer in southern Taiwan. Breast. 2006, 15(6), 754-761. [8] Chen, C; Ricks, S; Doody, DR et al. N-Acetyltransferase 2 polymorphisms, cigarette smoking and alcohol consumption, and oral squamous cell cancer risk. Carcinogenesis. 2001, 22(12), 1993-1999. [9] Chen, HC; Cao, YF; Hu, WX et al. Genetic polymorphisms of phase II metabolic enzymes and lung cancer susceptibility in a population of Central South China. Dis Markers. 2006, 22(3), 141-152. [10] Devasena, A; Chaubal, PC; Kankan, S et al. Susceptibility to Oral Cancer by Genetic Polymorphisms at CYP1A1, GSTM1 and GSTT1 Loci among Indians: Tobacco Exposure as a Risk Modulator. Carcinogenesis. 2007, doi: doi:10.1093/carcin/bgm038. (in press) [11] Drummond, SN; Gomez, RS; Noronha, JCM et al. Association between GSTT-1 gene deletion and the susceptibility to oral squamous cell carcinoma in cigarette-smoking subjects. Oral Oncol. 2005, 41(5), 515-519. [12] Duarte, EC; da Silva, MS; Gómez, MV et al. GSTM1 polymorphism and oral leukoplakia. J Oral Pathol Med. 2006, 35(4), 202-205.
Molecular Aspects of Oral Cancer
259
[13] Farin, FM; Bigler, LG; Oda, D et al. Expression of cytochrome P450 and microsomal exposide hydrolase in cervical and oral epithelial cells immortalized by human papillomavirus type 16 E6/E7 genes. Carcinogenesis. 1995, 16(7),1670. [14] Foulkes, WD; Brunet, JS; Sieh, W et al. Familial risks of squamous cell carcinoma of the head and neck: retrospective case-control study. BMJ. 1996, 313, 716-721. [15] Gattas, GJ, de Carvalho, MB, Siraque, MS et al. Genetic polymorphisms of CYP1A1, CYP2E1, GSTM1, and GSTT1 associated with head and neck cancer. Head Neck. 2006, 28(9), 819-826. [16] Geisler, SA, Olshan, AF. GSTM1, GSTT1, and the risk of squamous cell carcinoma of the head and neck: a mini-HuGE review. Am J Epidemiol. 2001, 154(2), 95-105. [17] Gresner, P, Gromadzinska, J, Wasowicz, W. Polymorphism of selected enzymes involved in detoxification and biotransformation in relation to lung cancer. Lung Cancer. 2007, doi:10.1016/j.lungcan.2007.02.002. (in press) [18] Gronau, S, Koenig-Greger, D, Jerg, M et al. GSTM1 enzyme concentration and enzyme activity in correlation to the genotype of detoxification enzymes in squamous cell carcinoma of the oral cavity. Oral Dis. 2003, 9(2), 62-67. [19] Guengerich, FP, Mason, PS. Immunological comparison of hepatic and extrahepatic cytochromes P-450. Mol Pharmacol. 1979, 15(1), 154-164. [20] Hahn, M, Hagedorn, G, Kuhlisch, E et al. Genetic Polymorphisms of drug-metabolizing enzymes and susceptibility to oral cavity cancer. Oral Oncol. 2002, 38(5), 486-490. [21] Hasler, JA; Estabrook, R; Murray, M et al. Human cytochromes P450. Mol Aspects Med. 1999, 20(1-2), 1-137. [22] Hatagima, A; Costa, ECB; Marques, CFS et al. Glutathione S-transferase polymorphisms and oral cancer: A case-control study in Rio de Janeiro, Brazil. Oral Oncol. 2007, doi:10.1016/j.oraloncology.2007.02.001. (in press) [23] Hayashi, S; Watanabe, J; Kawajiri, K. Genetic polymorphisms in the 5'-flanking region change transcriptional regulation of the human cytochrome P450IIE1 gene. J Biochem (Tokyo). 1991, 110(4), 559-565. [24] Hayes, JD; Pulford, DJ. The glutathione S-transferase supergene family: regulation of GST and the contribution of the isoenzymes to cancer chemoprotection and drug resistance. Crit Rev Biochem Mol Biol. 1995, 30(6), 445-600. [25] Holley, SL; Rajagopal, R; Hoban, PR et al. et al. Polymorphisms in the glutathione Stransferase mu cluster are associated with tumour progression and patient outcome in colorectal cancer. Int J Oncol. 2006, 28(1), 231-236. [26] Hung, HC; Chuang, J; Chien, YC et al.Genetic polymorphisms of CYP2E1, GSTM1, and GSTT1; environmental factors and risk of oral cancer. Cancer Epidemiol Biomarkers Prev. 1997, 6(11), 901-905. [27] Hursting, SD; Slaga, TJ; Fischer, SM et al. Mechanism-based cancer prevention approaches: targets, examples, and the use of transgenic mice. J Natl Cancer Inst. 1999, 91(3), 215-225. [28] International agency for reseach on cancer. Alcohol drinking. IARC monographs on the evaluation of carcinogenic risks to humans. Lyon: IARC, vol.44; 1988.
260
Karin Soares Gonçalves Cunha and Dennis de Carvalho Ferreira
[29] Jourenkova-Mironova, N; Wikman, H; Bouchardy, C et al. Role of arylamine Nacetyltransferase 1 and 2 (NAT1 and NAT2) genotypes in susceptibility to oral/pharyngeal and laryngeal cancers. Pharmacogenetics. 1999, 9 (4), 533-537. [30] Kao, SY; Wu, CH; Lin, SC et al. Genetic polymorphism of cytochrome P4501A1 and susceptibility to oral squamous cell carcinoma and oral precancer lesions associated with smoking/betel use. Oral Pathol Med. 2002, 31(9), 505-511. [31] Katoh, T; Kaneko, S; Boissy, R et al. A pilot study testing the association between Nacetyltransferases 1 and 2 and risk of oral squamous cell carcinoma in Japanese people. Carcinogenesis. 1998, 19(10), 1803-1807. [32] Kawajiri, K; Fujii-Kuriyama, Y. P450 and human cancer. Jpn J Cancer Res. 1991, 82(12), 1325-1335. [33] Ko, Y; Abel, J; Harth, V et al. Association of CYP1B1 codon 432 mutant allele in head and neck squamous cell cancer is reflected by somatic mutations of p53 in tumor tissue. Cancer Res. 2001, 61(11), 4398-4404. [34] Lai, C; Shields, PG. The role of interindividual variation in human carcinogenesis. J Nutr. 1999, 129(2S Suppl), 552S-555S. [35] Leichsenring, A; Losi-Guembarovski, R; Maciel, ME et al. CYP1A1 and GSTP1 polymorphisms in an oral cancer case-control study. Braz J Med Biol Res. 2006, 39(12), 1569-1574. [36] Leung, YK; Lau, KM; Mobley, J et al. Overexpression of cytochrome P450 1A1 and its novel spliced variant in ovarian cancer cells: alternative subcellular enzyme compartmentation may contribute to carcinogenesis. Cancer Res. 2005, 65(9), 37263734. [37] Lewis, DF; Ioannides,C; Parke, DV. Cytochromes P450 and species differences in xenobiotic metabolism and activation of carcinogen. Environ Health Perspect. 1998, 106(10), 633-641. [38] Li, G; Liu, Z; Sturgis, EM et al. CYP2E1 G1532C, NQO1 Pro187Ser, and CYP1B1 Val432Leu polymorphisms are not associated with risk of squamous cell carcinoma of the head and neck. Cancer Epidemiol Biomarkers Prev. 2005, 14(4), 1034-1036. [39] Liu, C; Chang, C; Lui, M et al. Association of GST genotypes with age of onset and lymph node metastasis in oral squamous cell carcinoma. J Oral Pathol Med. 2005, 34(8), 473-477. [40] Luch, A. Nature and nurture - lessons from chemical carcinogenesis. Nat Rev Cancer. 2005, 5(2), 113-125. [41] Marques, CF; Koifman, S; Koifman, RJ et al. Influence of CYP1A1, CYP2E1, GSTM3 and NAT2 genetic polymorphisms in oral cancer susceptibility: results from a casecontrol study in Rio de Janeiro. Oral Oncol. 2006, 42(6), 632-637. [42] McCoy, GD; Wynder, EL. Etiological and preventive implications in alcohol carcinogenesis. Cancer Res. 1979, 39(7 Pt 2), 2844-2850. [43] Mufti, SI. Alcohol acts to promote incidence of tumors. Cancer Detect Prev. 1992, 16(3), 157-162. [44] Nagaraj, NS; Beckers, S; Mensah, JK et al. Cigarette smoke condensate induces cytochromes P450 and aldo-keto reductases in oral cancer cells. Toxicol Lett. 2006, 165(2), 182-194.
Molecular Aspects of Oral Cancer
261
[45] Nagpal, JK; Das, BR. Oral cancer: reviewing the present understanding of its molecular mechanism and exploring the future directions for its effective management. Oral Oncol. 2003, 39(3), 213-221. [46] Nair, UJ; Nair, J; Mathew, B et al. Glutathione S-transferase M1 and T1 null genotypes as risk factors for oral leukoplakia in ethnic Indian betel quid/tobacco chewers. Carcinogenesis. 1999, 20(5), 742-748. [47] Nomura, T; Noma, H; Shibahara, T et al. Aldehyde dehydrogenase 2 and glutathione Stransferase M 1 polymorphisms in relation to the risk for oral cancer in Japanese drinkers. Oral Oncol. 2000, 36(1), 42-46. [48] Ogden, G R. Alcohol and oral cancer. Alcohol. 2005, 35(3), 169-173. [49] Oude Ophuis, MB; van Lieshout, EM; Roelofs, HM et al. Glutathione S-transferase M1 and T1 and cytochrome P4501A1 polymorphisms in relation to the risk for benign and malignant head and neck lesions. Cancer. 1998, 82(5), 936-943. [50] Park, LY; Muscat, JE; Kaur, T et al. Comparison of GSTM polymorphisms and risk for oral cancer between African-Americans and Caucasians. Pharmacogenetics. 2000, 10(2), 123-131. [51] Park, JY; Muscat, JE; Ren, Q et al. CYP1A1 and GSTM1 polymorphisms and oral cancer risk. Cancer Epidemiol Biomarkers Prev. 1997, 6(10),791-797. [52] Roberts, BJ; Song, Byoung-Joon; Soh, Y et al. Ethanol induces CYP2E1 by protein stabilization. Role of ubiquitin conjugation in the rapid degradation of CYP2E1. J Biol Chem. 1995, 270(50), 29632-29634. [53] Sato, M; Sato, T; Izumo, T et al. Genetically high susceptibility to oral squamous cell carcinoma in terms of combined genotyping of CYP1A1 and GSTM1 genes. Oral Oncol. 2000, 36(6), 267-271. [54] Schneider, J; Bernges, U; Philipp, M et al. GSTM1, GSTT1, and GSTP1 polymorphism and lung cancer risk in relation to tobacco smoking. Cancer Letters. 2004, 208 (1), 6574. [55] Song, N; Tan, W; Xing, D et al. CYP 1A1 polymorphism and risk of lung cancer in relation to tobacco smoking: a case-control study in China. Carcinogenesis. 2001, 22(1), 11-16. [56] Sreelekha, TT; Ramadas, K; Pandey, M et al. Genetic polymorphism of CYP1A1, GSTM1 and GSTT1 genes in Indian oral cancer. Oral Oncol. 2001, 37(7), 593-598. [57] Sugimura, T; Kumimoto, H; Tohnai, I et al. Gene-environment interaction involved in oral carcinogenesis: molecular epidemiological study for metabolic and DNA repair gene polymorphisms. J Oral Pathol Med. 2006, 35(1), 11-18. [58] Tanimoto, K; Hayashi, S; Yoshiga, K et al. Polymorphisms of the CYP1A1 and GSTM1 gene involved in oral squamous cell carcinoma in association with a cigarette dose. Oral Oncol. 1999, 35(2), 191-196. [59] Thangapazham, RL; Sharma, A; Maheshwari, RK. Multiple molecular targets in cancer chemoprevention by curcumin. AAPS J. 2006, 8(3), E443-449. [60] Their, T; Brüning, T; Roos, PH et al. Cytochrome P450 1b1, a new keystone in geneenvironment interactions related to human head and neck cancer? Arch Toxicol. 2002, 76 (5-6), 249-256.
262
Karin Soares Gonçalves Cunha and Dennis de Carvalho Ferreira
[61] Topcu, Z; Chiba, I; Fujieda, M et al. CYP2A6 gene deletion reduces oral cancer risk in betel quid chewers in Sri Lanka. Carcinogenesis. 2002, 23 (n), 595-598. [62] Topic, E; Stefanovic, M; Ivanisevic, AM et al. The cytochrome P450 2D6 (CYP2D6) gene polymorphism among breast and head and neck cancer patients. Clin Chim Acta. 2000, 296(1-2), 101-109. [63] Vatsis, KP; Weber, WW; Bell, DA et al. Nomenclature for N-acetyltransferase (Review). Pharmacogenetics. 1995, 5 (1), 1-17. [64] Vijayalakshmi, K; Vettriselvi, V; Krishnan, M et al. Cytochrome p4501A1 gene variants as susceptibility marker for prostate cancer. Cancer Biomark. 2005, 1(4-5), 251-258. [65] Vondracek, M; Xi, Z; Larsson, P et al. Cytochrome P450 expression and related metabolism in human buccal mucosa. Carcinogenesis. 2001, 22(3), 481-488. [66] Wight, AJ; Ogden, GR. Possible mechanisms by which alcohol may influence the development of oral cancer--a review. Oral Oncol. 1998, 34(6), 441-447. [67] Wogan, GN; Hecht, SS; Felton JS et al. Environmental and chemical carcinogenesis. Semin Cancer Biol. 2004, 14(6), 473-486. [68] Yokose, T; Doy, M; Taniguchi, T et al. Immunohistochemical study of cytochrome P450 2C and 3A in human non-neoplastic and neoplastic tissues. Virchows Arch. 1999, 434(5), 401-411.
In: Oral Cancer Research Advances Editor: Alexios P. Nikolakakos, pp. 263-274
ISBN 978-1-60021-864-4 © 2007 Nova Science Publishers, Inc.
Chapter 12
TP53 MUTATION, C-MYC AMPLIFICATION AND SQUAMOUS CELL CARCINOMA RECURRENCE J. Seoane1, P. Varela-Centelles1,2, M.A. Romero1 , A. De la Cruz3, F. Barros4, L. Loidi4 and J.L. López Cedrún5 1
Department of Stomatology, School of Medicine and Dentistry, University of Santiago de Compostela, Santiago de Compostela, Spain; 2 CS Praza Ferrol, XAP Lugo, Galician Health Service, Spain; 3 Pathology Service, Galician Cancer Centre, A Coruña Spain; 4 Unit of Molecular Medicine, INGO, Galician Health Service, Santiago de Compostela, Spain; 5 Head of Oral and Maxillofacial Surgery Service, Hospital Juan Canalejo, Galician Health Service, A Coruña, Spain.
ABSTRACT Purpose: to investigate TP53 mutation and c-myc amplification as markers for tumour aggressiveness in terms of tumour recurrence in OSCCs. Methods and materials: Thirty one incident cases of oral squamous cell carcinomas were studied for tumour relapse. The variables considered were demographic, clinical, pathological and genetic. Results: the mean age of 62.09 years (range 36 to 88). Seventeen patients (54.8%) were smokers. The tongue was the main affected area (54.8%). No distant metastases could be identified. Most patients were at early stages of the disease with moderately differentiated tumours and of grade I in Anneroth’s malignancy scale. The oncogene study showed abnormalities in both TP53 (6/31; 19.2%) and c-myc (4/31; 12.9%), that distributed as follows: TP53+/c-myc+ (n=1; 3.2 %); TP53+/c-myc- (n=5; 16.1%); TP53/c-myc+ (n=3; 9.7 %); TP53-/c-myc- (n=21; 67.7%). TP53 mutations were significantly more frequent in advanced stages. Statistically significant differences in node status were identified in terms of oncogene alterations. Multivariate Cox regression analysis recognized prognostic value for recurrence for alterations of TP53 and c-myc (p<0.05).
J. Seoane, P. Varela-Centelles, M.A. Romero et al.
264
Conclusions: TP53 mutation is related to advanced stage of oral cancer and suggests the usefulness of analysis of TP53 mutations and c-myc amplifications in order to identify those OSCCs more prone to relapse.
INTRODUCTION Oral squamous cell carcinoma (OSCCs) behaviour in a patient is extremely variable, and its prediction is of great importance in order to determine the prognosis and select the appropriate therapy [1,2]. In current oncological practice, the treatment of OSCCs is based on the histological grade and TNM stage but these parameters have proved a limited predictive capacity in terms of therapeutic outcome. This is why the scientific community acknowledges the need for exploring additional prognostic markers that help to predict the biological behaviour of these tumours. The myc family of oncogenes has been linked with neoplasia, particularly the c-myc gene that codes for a nuclear protein that is involved in cell growth, differentiation and programmed cell death [3]. However, the most frequently documented genetic change that appears in human cancer is that occurring on the short arm of chromosome 17 (17p) in the region that contains the TP53 gene [4]. In squamous cell carcinoma of the head and neck (SCCHN), 40-50% of the tumours studied have shown a mutation in this gene [5]. The TP53 mutations result either in no expression of the wild-type p53 or in overexpression of the mutant p53 protein [6]. The TP53 mutation causes both a loss of its tumour suppressor function and a gain of its oncogenic function by means of p53 controlled genes [7,8]. Most of investigations have generally analysed “head and neck cancer” not “oral cancer”. Moreover, there are some controversial data on the prognostic value of the TP53 mutation in patient which OSCCs [9], which was associated with a negative prognosis by some authors [10-12], but others found no correlation with poor outcome [13,14]. The involvement of p53 and its association with other genetic factors is poorly understood in oral squamous cell carcinoma [15], especially the association of c-myc with p53 which has been less explored, however important [15,16]. The aim of this study was to investigate TP53 mutation and c-myc amplification as markers for tumour aggressiveness in terms of recurrence in oral squamous cell carcinomas.
METHODS AND MATERIALS Study Design Thirty one incident cases of oral squamous cell carcinomas diagnosed at the Galicia Cancer Centre (A Coruña, Spain) in the 1995-1999 period entered the study. This centre is the reference hospital for radiotherapy for all five general hospitals in the North of Galicia (Spain). The patients included represented stages I-IV, none had distant metastasis and were all given intended curative treatment. Based on the stage of the disease and the primary site,
TP53 Mutation, c-myc Amplification and Oral Cancer Recurrence
265
all 31 patients underwent radiotherapy alone (n=12; 38.7%) or combined with surgery or/and chemotherapy (n=19; 61.3%). Local recurrence was considered when tumoral growth reappeared after complete disappearance of tumours confirmed with histological biopsies after treatment. A survival study was designed aimed at determining the influence of TP53 mutations and c-myc amplifications on tumour relapse. The variables considered were demographic (age and sex), clinical (location of the lesion, clinical presentation, tumour size, lymph node status, distant metastases and tumour stage), treatment (date of treatment), evolution (recurrence, date of recurrence, exitus, date of exitus and cause of exitus), pathological (Anneroth score of malignancy and degree of differentiation) and oncogene status (TP53 mutations and c-myc amplifications).
Analysis for TP53 Mutations Ten-micrometer sections were obtained, and appropriate areas from tumour were selected by light microscopy and microdissected for DNA extraction. Necrotic areas were avoided. Digestion with proteinase K followed by boiling was used as the extracting DNA method. Polymerase chain reaction amplification of p53 exons 4 to 8 was performed: for a reaction of 25 μL, 2μL of extracted DNA was added to a mix of 10 mmol/L HCl (pH 8.3), 50 mmol/L KCl, 1.5 mmol/L MgCl2, 200 μmol/L of each dNTP (deoxynucleotide triphosphate), 1μL of each primer (15mM concentration) and 1.25 U of Taq-polymerase (Promega). Primers are described in table 1 and amplification conditions were: 40 cycles (95ºC 20 sec.; 60ºC (55ºC for exon 5) 30 sec.; 72ºC 60 sec). A screening of mutations was performed through SSCP analysis using an automatic electrophoresis system (Phast System; Amerham, Biotech, Sweden) followed by a silver staining method for the detection of amplified products. The single-stranded PCR products were separated on PhastGel homogeneous polyacrilamide gels (20%) with native buffer strips (0.88 M L-alanine, 0.25 M Tris, pH 8.8) (Amersham Biothech). The electrophoretic runs were performed at 15ºC for 200 to 400 Vh according to the length of the fragments. A sample of normal tissue for each exon studied was used as a negative control. All fragments with anomalous migration as detected by SSCP were sequenced in an ALFexpress sequencer (Amersham Biothech) following standard protocols.
Analysis for Amplification of c-myc Gene The amplification of the oncogene c-myc was analysed using differential PCR, where the target gene and a reference gene (tissue plasminogen activator, t-PA) ware co-amplified by PCR in the same reaction vessel. The reference gene t-PA is linked to c-myc gene, avoiding misinterpretation of chromosomal. Normal DNA was titrated with previously characterized myc-amplified DNA (cell line HL60) to verify the relationship between myc and TPA signals.
J. Seoane, P. Varela-Centelles, M.A. Romero et al.
266
2μL of extracted DNA was added to a mix of 10 mmol/L HCl (pH 8.3), 50 mmol/L KCl, 1.5 mmol/L MgCl2, 200 μmol/L of each dNTP (deoxynucleotide triphosphate), 1μL of each primer (for c-myc and t-PA genes, all 15mM concentration) and 1.25 U of Taq-polymerase (Promega), in 50 μl total volume. Primers (one primer for each pair was fluorescently labelled with Cy5) are described in table 1 and amplification conditions were: 35 cycles (95ºC 30 sec.; 68ºC 30 sec.; 72ºC 30 sec.). Table 1. Sequence of primers used in the analysis Gene
Exon
Sequence
TP53
4
5’ ATCTACAGTCCCCCTTGCC 3’ 5’ GCAACTGACCGTGCAAGTCA 3’ 5’ TTCCTCTTCCTACAGTACTC 3’ 5’ GCAAATTTCCTTCCACTCG 3’ 5’ CCATGAGCGCTGCTCAGAT 3’ 5’ AGTTGCAAACCAGACCTCAG 3’ 5’ GTGTTATCTCCTCGGTTGGC 3’ 5’ CAAGTGGCTCCTGACCTGGA 3’ 5’ CTGCCTCTTGCTTCTCTTTT 3’ 5’ GAGGCAAGGAAAGGTGATAA 3’ 5’ GTTTCATCGTGTTGGCCAGGATGGT 3’ 5’ CCAAAGAGCCACTCTAAGCCTGGT 3’ 5’ AGGCCCGTGTGTAAACATAGGTG 3’
5 6 7 8 c-myc t-PA
1μL of the PCR product was mixed with 4μL formamide solution, denatured, and electrophoresed in a denaturing polyacrylamide gel (5.7% acrylamide, 0.3% bisacrylamide, 7 M urea) using an ALFexpress sequencer. The running conditions were 1500 V and 25 W at a constant temperature of 55ºC for 130 minutes with a running buffer of 0.6 X TBE. The data were processed using the AlleleLinnks software (Amersham Biotech). Three values were obtained for each PCR product: fragment size, peak height and peak area. The results expressed as a ratio of c-myc to t-PA peak areas were compared to the controls to provide a measure fo the number of c-myc haplotypes.
Statistical Analysis A descriptive study was performed by means of Student’s t and chi square tests to analyse associations between the data. The probability of treatment failure was calculated for the endpoint of relapse-free survival and tumour relapse by the Kaplan-Meier analysis with the log rank test for curves comparison. All time estimates were done using the date of primary treatment as initial value. A multivariate Cox proportional hazards analysis was also performed using the forward stepwise conditional method for including parameters in the model.
TP53 Mutation, c-myc Amplification and Oral Cancer Recurrence
267
The significance level chosen for all tests was 5%. Analysis was performed on a SPSS 8.0 statistical package. The mean observation time was 34.54 months. No patients were lost for follow-up. Table 2. Relationships between clinico-pathological variables and oncogene status. Chi square test
Node status
T category
Clinical stage
Degree of differentiation Degree of malignancy
N0 N1 N2 p-value T1-T2 T3-T4 p-value I-II III-IV p-value Good Moderate/Poor p-value I II-III p-value
Cases 21 3 7 22 9 18 13 10 21 17 14
p53+ 2 (9.5%) 2 (66.7%) 2 (28.6%) 0.05 3 (13.6%) 3 (33.3%) 0.21 1 (5.6%) 5 (38.5%) 0.0034 2 (20%) 4 (19%) 0.65 3 (17.6%) 3 (21.4%) 0.57
c-myc+ 2 (9.5%) 1 (33.3%) 1 (14.3%) 0.512 3 (13.6%) 1 (11.1%) 0.67 2 (11.1%) 2 (15.4%) 0.56 2 (20%) 2 (9.5%) 0.38 2 (11.8%) 2 (14.3%) 0.62
p53-/c-myc4 (19%) 2 (66.7%) 3 (42.9%) 0.155 17 (77.3%) 5 (55.6%) 0.21 15 (83.3%) 7 (53.8%) 0.08 7 (70%) 15 (71.4%) 0.62 12 (70.6%) 10 (71.4%) 0.63
RESULTS Descriptive Analysis A total of 31 patients entered the study (25 male, 6 female) with a mean age of 62.09 (range 36 to 88). Seventeen patients (54.8%) were smokers. Most lesions (61.39%) were ulcerated-type, followed by exophytic (25.8%) and mixed-type (12.9%). The tongue was the main affected area (54.8%). No distant metastases could be identified. Most patients were at early stages of the disease, mainly at stage II (38.7%, n=12), followed by stage IV (25.8%, n=8) and stages I and III (16.1%, n=5), and stage 0 (3.2%, n=1). The sample was composed chiefly of small tumours (T0 (3.2%, n=1); T1 (22.6%, n=7); T2 (45.2%, n=14); T3 (22.6%, n=7) and T4 (6.5%, n=2)) with no lymph node affectation (N0 (67.7%, n=21); N1 (9.7%, n=3); N2a (3.2%, n=1); N2b (12.9%, n=4) and N2c (6.5%, n=2)). The tumours studied were predominantly moderately differentiated (51.5%, n=16), with 32.3% (n=10) well differentiated and 16.1% (n=5) poorly differentiated. According to Anneroth’s malignancy score, 54.8% (n=17) were grade I; 38.7% (n=12) were grade II and 6.5% (n=2) were grade III.
268
J. Seoane, P. Varela-Centelles, M.A. Romero et al.
The oncogene study showed abnormalities in both TP53 ( 6/31; 19.2%) and c-myc (4/31; 12.9%), that distributed as follows: TP53+/c-myc+ (n= 1; 3.2 %); TP53+/c-myc- (n= 5; 16.1%); TP53-/c-myc+ (n= 3; 9.7 %); TP53-/c-myc- (n=21; 67.7%). In total two TP53 mutations were found in exon 5; two in exon 6 and two in exon 7. We found no significant relation between the mutational status of TP53 and age, gender, primary tumour site and Anneroth´s malignancy grade. The TP53 mutations were significantly more frequent in advanced stages than in the early ones. Statistically significant differences in node status were identified when cases were distributed according to TNM classification criteria, (table 2).
Survival Analysis Kaplan Meier analysis showed that oncogene alterations were not translated into significantly different recurrence rates (table 3) although the survival plots show quite independent curves (figures 1-3). Multivariate Cox regression analysis recognized prognostic value for recurrence when alterations of TP53 and c-myc were considered (Exp β= 10.74; p=0.0223). Oral cancers without TP53 and c-myc alterations have showed longer relapse-free survival periods than those cancers with these modifications, although this difference did not reach signification. Table 3.Relationship among TP53 mutations, c-myc amplification and tumour relapse (Kaplan Meier) Cases TP53+ c-myc+ TP53- & c-myc-
6 4 21
Median relapse-free time (months) 14.46 8.33 53.48
3 year relapsefree 41.67% 50% 60.19%
Log-rank test 0.35 0.689 0.67
DISCUSSION TNM classification of oral carcinomas is a classical method for estimating a prognosis and establishing treatment strategies. However, it does not take into account the biological properties of a single tumour that would explain the number of stage I and II tumours with a rapid lethal course [17]. As age, race and gender influence the stage of disease at presentation, and the choice of therapy, survival differentials based on these factors may be illusionary and may represent secondary associations with clinical variables. Grading of squamous cell carcinoma is unreliable as a predictor of behaviour as a solitary criterion. Major reasons quoted for its unreliability include the knowledge that the differentiation may vary in different sites of the tumour, the biopsy fragment may not be representative, and observer interpretation of the findings may vary [18].
TP53 Mutation, c-myc Amplification and Oral Cancer Recurrence 1,1
1,0
,9
,8
Cum Recurrence
,7
p53 ,6
abnormal
,5 normal ,4 0
20
40
60
80
months Figure 1. Recurrence plot for TP53 mutation.
1,1 1,0
,9 ,8
,7
Cum Recurrence
,6
c-myc abnormal
,5
,4
normal
,3 0
20
40
months Figure 2. Recurrence plot for c-myc amplification.
60
80
269
J. Seoane, P. Varela-Centelles, M.A. Romero et al.
270 1,2
1,0
,8
p53 & c-myc combined
Cum Recurrence
,6
Non concordant p53 & c-myc ,4 Normal p53 & c-myc ,2 0
20
40
60
80
months Figure 3. Recurrence plot for TP53 and c-myc.
Despite these shortcomings several compound prognostic models have been proposed including different tumour features according to their weight on the sample analysed. Ever since the scientific community acquired the ability to explore carcinogenesis at a molecular level, genetic variables were considered in the survival analyses and supposed a qualitative change in this area. One of the most commonly studied genes in oncongenesis is the TP53 gene that is involved in the first transformations of a cell to the cancer cell stage [19]. The reported frequency of TP53 mutation in OSCCs varies widely, from 21% [20] to 64% [21]. This may be a reflection of the techniques used to detect mutations, the regions of the TP53 subjected to analysis and differences in mutation rates between anatomical sites [22,23]. Moreover, the mutational spectrum has been shown to vary between countries and races [5]. Some studies have reported an association between smoking and alcohol use and the frequency of TP53 mutations [5,24]. In this sense, there are reports describing frequencies of TP53 mutations of around 14-17% in OSCCs of non-smoker patients [8,25]. The low frequency of TP53 mutations identified in this study might well be explained by the high proportion of nonsmoker patients in this series. As it happens in this report, many studies analysing gene sequence have focused on exons 5-8 of TP53, since the majority of mutations occur there [22]. However, it is possible that additional mutations might have been detected by direct sequencing of the entire gene (exons 2-12). There have been conflicting conclusions of the stage in oral carcinogenesis at which TP53 mutation occurs. It has been reported that the incidence of TP53 mutations increased
TP53 Mutation, c-myc Amplification and Oral Cancer Recurrence
271
from early lesions (dysplasias) to invasive OSCC [26]. However, other authors support a late role for p53 in the sequential expression of the invasive phenotype [27,28], because p53positive lymph node metastases may develop from p53-negative primary tumours [29]. The finding that clinical stage III-IV cancers harboured more TP53 mutations than clinical stage I-II cancers supports the theory that it is the accumulation of mutations and not necessarily its order what determines cancer progression [30]. Moreover, TP53 mutations of advanced diseases might be an early event which contributes to a more aggressive behaviour of a given cancer compared with more innocent tumours without genetic lesions [31]. The correlation between TP53 mutation and poor prognosis has been identified [10-12] and the contradictory results reported [13,14] seem to be due to the different anatomical locations, tumour stages and treatments considered in the analyses. However, there is now an emerging consensus on that TP53 mutation is predictive of clinical outcome for at least some treatment regimens [22]. A high prevalence of TP53 mutations (68%) has been identified in recurrent squamous cell carcinomas [32,33]. In addition, several studies have proved that mutations in TP53 are strongly associated with recurrence in those patients receiving radiotherapy as their main treatment option [10,11,32,34]. However, this association could not be confirmed when the patients were treated surgically and received postoperative radiotherapy [35]. The survival analysis for recurrence of our patients, treated mainly with radiotherapy, show an independent behaviour of TP53 mutation positive and TP53 mutation negative tumours (figure 1), which may point at the direction described by other research groups [36,37]. The c-myc gene codes for a nuclear protein p62 which is involved in cell growth, differentiation and programmed cell death [38], although the proportion of cases in OSCC where the gene is amplified is around 15% [39], similar to the one in our series. It has been hypothesized that the over-expression of c-myc could be due to a lack of wild-type p53, and could be an attempt by the cell to restore its overexpression [40]. The overexpression of both genes has been suggested to play a vital role in the progression of cancer and apoptosis inhibition in cancer treatment resistance [41]. Our results show a scarce presence of combined alterations of TP53 / c-myc in OSCC and disclose a higher recurrence rate of OSCCs that harbour TP53 mutations or c-myc amplifications than those OSCCs whose TP53 and c-myc genes are normal. The ideal marker in tumour prognosis is one that when present indicates tumour development and when absent excludes this possibility. However, it is unlikely that such a marker exists. It is therefore more likely that TP53 could be one factor in a panel of factors with importance for outcome, rather than the single prognostic factor [5].
CONCLUSION This study shows that TP53 mutation is related to advanced stage of oral cancer and suggests the usefulness of combined analysis of TP53 mutations and c-myc amplifications in order to identify those OSCCs more prone to relapse.
272
J. Seoane, P. Varela-Centelles, M.A. Romero et al.
REFERENCES [1] Gluckman, JL; Pavelic, ZP; Wlkoborsky, HJ; Mann, W; Stambrook, P; Gleich, L; Wilson, K; Righi, P; Portugal, LG; McDonald, J; Biddinger, P; Steward, D; Gartside, P. Prognostic indicators for squamous cell carcinoma of the oral cavity: a clinicopathological correlation. The Laryngoscope, 1997 107, 1239-1244. [2] Atula, S, Kurvinen, K; Grénman, R; Syrjänen, S. SSCP pattern indicative for p53 mutation is related to advanced stage and high grade of tongue cancer. Oral Oncol Eur J Cancer, 1996 32B, 222-229. [3] Evan, GI; Wyllie, AH; Gilbert, CS; Littlewood, TD; Land, H; Brooks, M; Waters, CM; Penn, LZ; Hancok, DCl. Induction of apoptosis in fibroblasts by c-myc protein. Cell, 1992 69, 119-128. [4] Hollstein, M; Sidransky, D; Vogelstein, B; Harris, C. p53 mutations in human cancers. Science, 1991 253, 49-53. [5] Nylander, K; Dabelsteen, E; Hall, PA. The p53 molecule and its pronostic role in squamous cell carcinomas of the head and neck. J Oral Pathol Med, 2000 29, 413-425. [6] Largey, JS; Meltzer, SJ; Yin, J; Norris, K; Sauk, JJ; Archibald, DW. Loss of heterozygosity of p53 in oral cancers demonstrated by the polymerase chain reaction. Cancer, 1993 71, 1933-1937. [7] Lane, DP; Benchimol, S. p53: oncogene or anti-oncogene? Genes Dev, 1990 4, 1-8. [8] Chen, YK; Huse, SS; Lin, LM. Differential expression of p53, p63 and p73 proteins in human buccal squamous-cell carcinomas. Clin Otolaryngol, 2003 28, 451-455. [9] Yamazaki, Y; Chiba, I; Hirai, A; Sugiura, Ch; Notani, K; Kashiwazaki, H; Tei, K; Totsuka, Y; Fukuda, H. Specific p53 mutations predict poor prognosis in oral squamous cell carcinoma. Oral Oncology, 2003 39, 163-169. [10] Koch, WM; Brennan, JA; Zahurak, M. p53 mutation and locoregional treatment failure in head and neck squamous cell carcinoma. J Natl Cancer Inst, 1996 88, 1580-1586. [11] Hedge, PU; Brenski, AC; Caldarelli, DD; Hutchinson, J; Panje, WR; Wood, NB; Leurgans, S; Preisler, HD; Taylor, SG 4th; Caldarelli, L; Coon, JS. Tumor angiogenesis and p53 mutations: prognosis in head and neck cancer. Arch Otolaryngol Head Neck Surg, 1988 124, 80-85 [12] Erber, R; Conradt, C; Homann, N; Enders, C; Finckh, M; Dietz, A; Weidauer, H; Bosch, FX. TP53 DNA contact mutations are selectively associated with allelic loss and have a strong clinical impact in head and neck cancer. Oncogene, 1988 16, 1671-1679. [13] Saunders, ME; MacKenzie, R; Shipman, R; Fransen, E; Gilbert, R; Jordan, RC. Patterns of p53 gene mutations in head and neck cancer: full length sequencing and results of primary radiotherapy. Clin Cancer Res, 1999 5, 2455-2463. [14] Riethdorf, S; Friedrich, RE; Ostwald, C; Barten, M; Gogacz, P; Gundlach, KK; Schlechte, H; Becker, J; Bregenzer, T; Riethdorf, L; Loning, T. p53 gene mutations and HPV infection in primary head and neck squamous cell carcinomas do not correlate with overall survival: a long term follow-up study. J Oral Pathol Med, 1997 26, 315-321. [15] Baral, RN; Patnaik, S; Das, BR. Co-overexpression of p53 and c-myc proteins linked with advanced stages of betel- and tobacco-related oral squamous cell carcinomas from Eastern India. Eur J Oral Sci, 1998 106, 907-913.
TP53 Mutation, c-myc Amplification and Oral Cancer Recurrence
273
[16] Ryan, JJ; Prochownik, E; Gottliel, CA; Apel, IJ; Merino, R; Nuncz, G; Clake, MF. c-myc and bcl2 modulate p53 function by altering p53 subcellular traffiking during the cell cycle. Proc Nat Acad Sci USA, 1994 91, 5878-5882. [17] Bundgaard, T; Sorensen, F; Gaihede, M; Sogaard, H; Overgaard, J. Stereologic, histopathologic, flow cytometric and clinical parameters in the prognostic evaluation of 74 patients with intraoral squamous cell carcinomas. Cancer, 1992 70, 1-13. [18] Gluckman, JL; Pavelic, ZP; Welkoborsky, HJ; Mann, W; Stambrook, P; Gleich, L; Wilson, K; Righi, P; Portugal, LG; McDonald, J; Biddinger, P; Steward, D; Gartside, P. Prognostic indicators of squamous cell carcinoma of the oral cavity: a clinicopathologic correlation. The Laryngoscope, 1997 107, 1239-44. [19] Slootweg, PJ; Koole, R; Hordijk, GJ. The presence of p53 protein in relation to Ki-67 as cellular proliferation marker in head and neck squamous cell carcinoma and adjacent dysplastic mucosa. Oral Oncol Eur J Cancer 1994 30B, 138-141. [20] Munirajan, AK; Tutsumi-Ishii, Y; Mohanprasad, BK; Hirano, Y; Munakata, N; Shanmugam, G; Tsuchida, N. p53 gene mutations in oral carcinomas from India. Int J Cancer, 1996 66, 297-300. [21] Bradley, G; Irish, J; MacMillan, C; Mancer, K; Witterick, I; Hartwick, W; Gullane, P; Kamel-Reid, S; Benchimol, S. Abnormalities of the ARF-p53 pathway in oral squamous cell carcinoma. Oncogene, 2001 20, 654-658. [22] Gasco, M; Crook, T. The p53 network in head and neck cancer. Oral Oncol, 2003 39, 222-231. [23] Ostwald, C; Gogacz, P; Hillman, T; Schweder, J; Gundlach, K; Kundt, G; Barten, M. p53 mutational spectra are different between squamous cell carcinomas of the lip and the oral cavity. Int J Cancer, 2000 88, 82-86. [24] Brennan, JA; Boyle, JO; Koch, WM; Goodman, SN; Hruban, RH; Eby, YJ; Couch, MJ; Forastiere, AA; Sidransky, D. Association between cigarette smoking and mutation of the p53 gene in squamous cell carcinoma of the head and neck. N Engl J Med, 1995 332, 712-717. [25] Lazarus, P; Garewal, HS; Sciubba, J; Zwiebel, N; Calcagnotto, A; Fair, A. A low incidence of p53 mutations in pre-malignant lesions of the oral cavity from non-tobacco users. Int J Cancer, 1995 60, 458-463. [26] Boyle, JO; Hakim, J; Koch, W; van der Riet, P; Hruban, RH; Roa, RA. The incidence of p53 mutations increased with progression of head and neck cancer. Cancer Res, 1993 53, 4477-4480. [27] Shahnavaz, SA; Regezi, JA; Bradley, G; Dube, ID; Jordan, RCK. p53 gene mutations in sequential oral epithelial dysplasias and squamous cell carcinomas. J Pathol, 2000 190, 417-422. [28] Boyle, JO; Hakim, J; Koch, W; van der Riet, RH; Roa, RA; Correo, R; Eby, YJ; Ruppert, JM; Sidransky, D. The incidence of p53 mutations increased with progression of head and neck cancer. Cancer Res, 1993 53, 4477-4480. [29] Frank, JL; Bur, ME; Garb, JL; Kay, S; Ware, JL; Sismanis, A; Weinfeld, JP. p53 tumor suppressor oncogene expression in squamous cell carcinoma of the hypopharynx. Cancer, 1994 73, 181-186.
274
J. Seoane, P. Varela-Centelles, M.A. Romero et al.
[30] López-Martínez, M; Anzola, M; Cuevas, N; Aguirre, JM; Martínez-Pancorbo, M. Aplicaciones clínicas del diagnóstico de las alteraciones de p53 en el carcinoma escamoso de cabeza y cuello (p53 en el CECC). Med Oral, 2002 2, 108-120. [31] Atula, S; Kurvinen, K; Grenman, R; Syrjänen, S. SSCP pattern indicative for p53 mutation is related to advanced stage and high-grade of tongue cancer. Oral Oncol, 1996 4, 222-229. [32] Ganly, I; Soutar, DS; Brown, R; Kaye, SB. p53 alterations in recurrent squamous cell cancer of the head and neck refractory to radiotherapy. Br J Cancer, 2000 82, 392-398. [33] Girod, SC; Krämer, C, Knüfermann, R; Krueger, GRF. p53 expression in the carcinogenesis in the oral mucosa. J Cell Biochem, 1994 56, 444-448. [34] Alsner, J; Sorensen, SB; Overgaard, J. TP53 mutation related to poor prognosis after radiotherapy, but no surgery, in squamous cell carcinoma of the head and neck. Radiother Oncol, 2001 59, 179-185. [35] Sittel, C; Ruiz, S; Volling, P; Kvasnicka, HM; Jungehulsing, M; Eckel, HE. Prognostic significance of ki-67 (MIB1), PCNA and p53 in cancer of the oropharynx and oral cavity. Oral Oncol, 1999 35, 583-589. [36] Koch, WN; Brennan, JA; Zahnrak, M. p53 mutation and locorregional treatment failure in head and neck squamous cell carcinoma. J Natl Cancer Inst, 1996 88, 1580-1586. [37] Erber, R; Conradt, C; Homann, N; Enders, C; Finckh, M; Dietz, A; Weidauer, H; Bosch, FX. TP53 DNA contact mutations are selectively associated with allelic loss and have a strong clinical impact in head and neck cancer. Oncogene, 1998 16, 1671-1679. [38] Baral, RN; Patnaik, S; Das, BR. Co-overexpression of p-53 and c-myc proteins linked with advanced syages of betel- and tobacco-related oral squamous cell carcinomas. Eur J Oral Sci, 1998 106, 907-913. [39] Grabenbauer, GG; Mühlfriedel, C, Rödel, F. Squamous cell carcinoma of the oropharynx: Ki-67 and p53 can identify patients at risk for local recurrence after surgery and postoperative radiotherapy. Int J Radiation Oncology Biol Phys, 2000 48, 10411050. [40] Satio, Y; Ogawa, K. Wild type p53 and c-myc co-operation in generating apoptosis of a rat hepatocellular carcinoma cell line (FAA-HRC 1). Oncogene, 1995 11, 1013-1018. [41] De Rosa, I; Staibano, S; Lo Muzio, L; Delfino, M; Lucariello, A; Coppola, A; De Rosa, G, Scully C. Potentially malignant and malignant lesions of the lip. Role of silver staining nucleolar organizer regions, proliferating cell nuclear antigen, p53, and c-myc in differentiation and prognosis. J Oral Pathol Med, 1999 28, 252-258.
In: Oral Cancer Research Advances Editor: Alexios P. Nikolakakos, pp. 275-283
ISBN 978-1-60021-864-4 © 2007 Nova Science Publishers, Inc.
Chapter 13
RECENT ADVANCES AND FUTURE PROSPECTS UPON THE ARTERIAL FRAMEWORK OF THE FACE AND RELATED APPLICATIONS FOR FACIAL FLAPS Egidio Riggio∗ Plastic Surgery Division, Fondazione IRCCS Istituto Nazionale dei Tumori, Milano, Italy.
ABSTRACT Coverage of facial defects is frequently challenging. Despite the numerous flaps described, the search for additional flaps with good color match and minimal donor-site morbidity continues and attempts to find valid options to free flaps perhaps overused in the last two decades, in particular for soft tissue replacement of the moderate-to-large perioral resections. The reconstructive research runs through the study of functional topographic or regional anatomy with all the scientific and clinical implications. The article reviews the last reports that are basically focused upon the arterial supply derived from neglected branches of the superficial temporal artery (transverse facial artery, zygomatic-orbital artery, and middle temporal artery) or the terminal branches of the frontal terminal branch, from the variants of the terminal facial artery and a definite collateral named cutaneous zygomatic branch, or from the submental artery. The up-todate research embraces the study of the cutaneous perforators of the face. Relevant anterograde or reverse flaps, axial or perforator flaps, and monolayered or multilayered composite flaps are discussed as current, original or still imaginative chances. Moreover, for the realization of totally new flaps in the field of compound facial reconstruction,
∗
Correspondence concerning this article should be addressed to: Egidio Riggio Plastic Surgery Division, Fondazione IRCCS Istituto Nazionale dei Tumori, Milano via Venezian 1, 20137 Milano, Italy. Email:
[email protected].
276
Egidio Riggio clinical research efforts should tend to merge with the future perspective of bone and soft-tissue engineering research.
INTRODUCTION The face is supplied by branches of the facial, superficial temporal, and infraorbital arteries and terminal branches of the ophthalmic artery in the forehead. The superficial temporal artery, its branches as transverse facial, zygomatico-orbital, middle temporal arteries, and the terminal branches supply the preauricolar, jugal superior, malar, and lateral forehead regions and, part of buccal, orbital, infraorbital and temporal regions. The facial artery and its branches, including superior and inferior labial, submental supply lips, mental and jugal inferior regions and part of the buccal, infraorbital, orbital, and nasal regions. The infraorbital artery provides the homonymous region together with the zygomaticofacial artery (from the maxillary artery) and the angular artery. The forehead supraorbital regions are nourished by the supratroclear and supraorbital (frontal) arteries originating from the ophthalmic. Facial flaps are generally supported by axial vessels originating multiple perforators directed towards the skin. Research for axial island flaps based on unknown/neglected arteries or uncommon anatomical variants as well as for the application of a single-perforator flap is developing. Based on facial and superficial temporal vascular frameworks, new flaps with better color/texture match and minor donor-site damage can replace distant flaps for reconstruction of facial defects from moderate to large. The skin is supported by two vascular networks in the body but, here, the subdermal layer permits the elevation of a viable random flap (SVNF, subdermal vascular network flap) without including the deeper subcutaneous layer. The richly dense arteriolar network has a honeycombe-like architecture of anastomoses that distribute the flow in certain directions on different zones. Xiong et al. [1] propose to plan the flap major axis according to the flow direction of the main local vessels without including them in the flap. That means that SVNF should be drawn as transverse in malar and superior jugal areas (based on the transverse facial artery direction) and oblique in buccal and lower jugal areas (from anterior-superior to posterior-inferior, based on the facial artery axis). A lateral genicervical island flap is described, drawn vertically, slightely obliquely along the mandibular arch, from the lower parotid-masseteric area to the neck. The flap pedicle is preauricolar, 1-1.5 cm wide and 3-4 cm long. The flap surface ranges from 6x6 to 9x8 cm while the thickness is 2-4 mm. Surgical anatomy is poorly described but the scientific implications are worthwhile for the preparation of well-planned SVNF on definite perforators supplying large skin areas, with thin pedicle and large rotation arc.
FACIAL ARTERY The classic anatomy is insufficient. Knowledge of the variations in terminal course and in number/type of collateral branches, also in the same individual, is essential for the correct
Recent Advances and Future Prospects Upon the Arterial Framework…
277
choice of any loco-regional flap used for facial and buccal reconstruction. As a first approach to reconstruction, it should always be important to preserve the main axial artery's continuity, and to use one of its branches or one of its perforators as well. Such a concernment embraces all arteries besides the facial. Five variations in terminal course are described by Niranjan [2]: the classic ending as angular artery at the medial canthus; the labialis superior at the upper lip; the alar at the alar nasi; the nasal at the dorsum nasi; the long course running vertically towards the infraorbital foramen and transversally towards the nose, eventually ending as angular. The distribution pattern has been recently classified in five types and more subtypes by the study performed on 284 hemifaces by Loukas et al. [3]. Knowing the subtypes of the superior labial artery can properly allow the selection of the indication for the Abbé flap. Furthermore, it is noticeable that examination of subtype C-1 and, mostly, C-2, where the facial artery terminates solely as superior labial artery, branching off vertically towards the columella bifurcating in bilateral alar nasal vessels could suggest the creation of an axial flap including subcolumellar zone and bilateral nasojugal zone which represent a wide surface in elderly patients. The incidence of these variations occurs in less than 8% of population. A small branch, “cutaneous zygomatic branch”, is presented by Gardetto et al. [4,5] for a new axial island zygomatic flap. This artery has been constantly found in all 62 hemifaces examined. It runs upwards over the buccinator muscle bifurcating at the major zygomatic muscle's border. One branch ascends laterally and ends in the subcutaneous tissue. The second continues through the major zygomatic muscle and penetrates the overlying subcutaneous tissue. A critical point is the venous blood drainage, since the tributaries of the facial vein do not run precisely alongside the artery in the cheek region. Unfortunately, the collateral vein has to be cut to make the elevation possible. However, in clinical application, major venous congestion has not been observed, likely due to drainage by small veins present alongside the artery. Another critical point is the relationship with the zygomatic and buccal branches of the facial nerve. Near the inferolateral border of the zygomatic muscle, buccal branches could cross the facial artery and are to be preserved. The nasolabial island can be extended to the infraorbital skin due to arteriolar anastomoses. Hofer et al. [6] describe a new nasolabial island flap based on one facial artery perforator meanly large at 1.2 mm. A perioral defect from 1.5x1.5 to 2.5x5 cm can be repaired by rotation (120-180 degrees) of a skin island flap with donor-site direct closure. Two suggestions are essential. The first is that the distribution of facial perforators is equally frequent in all facial artery variations. They range from 3 to 9 units for the segment mandiblenasal alar rim and most of the perforators are 4-8 cm from the mandibular angle and, therefore, located below the zygomatic and risorius muscles and lateral to the depressor anguli oris muscle. The second is that the flap survival is reliable even if the pivot point (perforator’s site) is peripheral but preserve a small cuff of subcutaneous tissue around the perforator in order to facilitate the venous drainage, to prevent trouble, and to avoid some vessel kinking. A technique disadvantage involves the nearness of the facial artery that excludes the Doppler identification of the perforator and makes necessary its exposure through the wound edges of contemporary tumor resection. Kawai et al. [7] find new suggestions for perioral flaps starting from the architecture of the lower lip arteries. The supply is mostly derived by three branches of the facial artery:
278
Egidio Riggio
inferior labial artery, horizontal labiomental artery, and vertical labiomental artery. The first that is classically described as arising near the buccal angle has been found to have three different origins. The most frequent origin is not that most known, called by the authors as type B, but that branching off the facial artery near the mandibular border (type A). It can uncommonly diverge from the superior labial artery near the commissure (type C). On the other hand, Pinar et al. [8] found type B in 60% of 50 cadaver specimens and the inferior labial artery as absent in 10%. The second (horizontal labiomental artery) arises near the lower mandibular border proximally to the origin of the inferior labial artery and runs on the mucosal side between depressor labii inferioris and orbicularis oris muscles. The third, i.e. the vertical labiomental artery, diverges from the submental artery near the mentum running deep to the depressor labii muscle and bifurcating into superficial and deep branches close to the orbicularis oris muscle edge. Two records are relevant: a) the horizontal labiomental artery caliber can be larger than the inferior labial artery, b) flow and caliber of the horizontal and vertical labiomental arteries appear to be complementary to each others. Small vertical branches of these arteries form a plexus in both submucosal and subcutaneous layers surrounding the orbicularis muscle. It becomes possible to harvest mucosal/skin vertical flaps without muscle interruption as well as planning new flaps like a submental flap with vertical mental extension or any reverse-flow vertical labiomental flap. The facial artery gives off the submental artery at 3-15 mm below the mandibular arch excepting in one of 56 dissections reported by Martin et al. [9] where the origin is from the carotid artery. It supports one of the current flaps that better matches the requisites for midface reconstruction in one stage. It may be used for coverage of perioral, intraoral, periorbital, and other defects and leave an acceptable donor-site scar. The ipsilateral anterior belly of the digastric muscle must be included in the flap especially when extended to the upper half of the neck, because the artery run mostly deep to the anterior belly and give skin perforators. It also improves the venous drainage [10,11]. The only problem is given by the inclusion of submental lymph nodes into the flap. Contemporary use in case of cancers potentially metastasizing should be avoided or delayed at a second stage after minimal follow-up. The reverse-flow flap, its free variant, and the perforator-based reverse flap, even if has introduced a new perspective for facial flap, are to be used when the normal flow is unavailable, taking care of possible facial nerve injury and venous congestion. The distal pedicle crosses the overlying marginal nerve and, more cranially, the facial vein passes beneath the midfacial nerve branches. It is challenging the possibility of harvesting a double flap including a mucosal-buccinator muscle flap over the facial artery [12,13].
SUPERFICIAL TEMPORAL ARTERY Studies concerning terminal course and number/type of collateral branches are carrying in new appliances. The artery represents the vascular axis of forehead, temporoparietal, and parieto-occipital flap but, even if the predictability about caliber, course and terminal subdivision is well known, Doppler examination allows to recognize those anatomical variants capable of compromising the flap viability (10-20%) in time for changing surgical plan even during dissection [14].
Recent Advances and Future Prospects Upon the Arterial Framework…
279
When the artery becomes superficial at the tragus, it gives the following branches from proximal to distal: transverse facial artery, anterior auricular artery, zygomatic-orbital artery, superior auricular artery, middle temporal artery, terminal frontal and parietal arteries. All of them can support a flap. The transverse facial artery runs below and parallel to the zygomatic arch deep to SMAS. It is short but large and constant. Perforators go perpendicularly through SMAS toward the skin with almost no branching until they supply the subdermal plexus. The dominant perforator consistently branches off between parotid gland and masseter muscle. Whetzel and Mathes [15] have demonstrated how is statistically possible to predict the location of the perforator within a few centimeters. This statement could promote a skin flap drawn in the aesthetic unit of cheek and based on the subdermal vascular network, even if the dissection of perforators is generally difficult in the face because tissues are richly vascularized and perforators are scarcely detectable by Doppler ultrasound probe. The zygomatic-orbital artery runs slightly upwards toward the lateral supra-orbital region. It consists of three segments: proximal, nearly horizontal; central, vertical or oblique; distal from eyebrow to forehead. It is inconsistent in terms of length, course and pertinent vascular territory. This does not mean that this artery may not be used for reconstructive purposes, it can be long enough in 35% of population. The Author, Riggio et al., [16] illustrates a topographic diagram generated by statistical analysis of 50 Doppler investigations, which provides a certain predictability to the anatomy of the zygomaticoorbital artery, and has successfully harvested an innovative forehead flap based on this artery, with a lower pivot point, for total repair of the lower third of the face. Whetzel and Mathes [15] have formerly applied biostatistics upon their study of facial perforators. The Author infers that the zygomatic-orbital blood flow is inversely proportional to the frontal branch flow, i.e., perfusion of the lateral forehead is kept up by both arteries in complementary way. It is suggestive for the existence of some regulation among their flow, caliber, and height. According to Marano [17], the frontal branch is absent in 8% of cases and the diameter is less than 1-mm in another 8%. This means that 16% of standard foreheads flaps are potentially jeopardized, the zygomatic-orbital artery flap may solve the problem. This point of view is challenging and exciting for surgeons because it introduces a dynamic view of the arterial anatomy of facial flaps in relationship with physiological and pathological variations of the arterial circulation without taking into account the venous system [18]. Finding more options for each flap becomes possible and, moreover, consents to protect the major artery or contiguous arteries useful for the remaining circulation of the donor site and to preserve sources of alternative flaps as well. The superior auricular artery runs above the root of the ear and anastomoses with the posterior auricular artery. The retroauricular island flap is supplied by a reverse blood flow from the frontal branch [19] or from the parietal branch (based on the contralateral anastomoses) [20]. It can repair medium midfacial defects. The terminal frontal artery gives off small branches, usually three: anterofrontal, centrofrontal, posterofrontal. They can be used for distinct islands flaps in facial reconstruction [21,22]. Anterior and posterior deep temporal arteries, branches of the internal maxillary artery, nourish the temporalis muscle. Contribution of either the fascial vascular network or the
280
Egidio Riggio
muscular branch of the middle temporal artery originating from the superficial temporal artery is often misjudged. The reverse temporalis muscle flap and related vascular anatomy have been applied [23,24,25]. Survival is possible by a vascular plexus zone located within 1.8 cm below the superior temporal line, large 1.3 cm, and perfused by the superficial temporal artery through the vascular network between superficial and deep temporal fascia in the anterior two thirds and by the muscular branch of the middle temporal artery in the posterior one third, as shown by Chen et al. [26]. For this reason the retrograde-flow flap should include that muscular branch as well as the fascial branch that supplies the deep temporal fascia and gives off small branches to the lower part of muscle [27]. The reverse temporalis flap should have more applications for midfacial reconstruction, including coverage of orbital bone grafts especially when combined to flaps based on the terminal parietal branch. A multi-arterial axial flap of the superficial temporal artery can even include: a) temporal fascia with/without parietal bone based on the parietal branch, b) posterior part of the temporalis muscle based on the middle temporal artery, c) frontal skin based on the frontal branch or zygomatic-orbital artery, d) retroauricular skin with/without ear cartilage based on the superior auricular artery. The territory extends to superficial temporal artery and posterior auricular angiosomes [28]. Dissection can be laborious. Nevertheless, it is suggestive thinking about some utilization for three-dimensional composite reconstruction of the face. The donor-site defect could be acceptable. The drainage problem is solved by harvesting a main vein collector of the frontotemporal region.
CONCLUSION Through research programs in different scientific fields, combination of surgical techniques, vascular anatomy, materials, cells, growth factors, and new methodologies will be capable of improving clinical solutions for head and neck surgery. Experimental basic science is implementing new chances for wound healing and survival of ischemic skin flaps. Use of growth factors, basic fibroblast growth factor (bFGF) and vascular endothelial growth factor (VEGF), have been well-documented throughout the last decade [29]. Gene therapy in flap survival embraces various methods to transplant plasmids or viruses capable of coding and producing growth factors in ischemic tissue through scaffold application over the recipient bed and in-flap or intravenous administration. The bFGF role and interaction with hyperbaric oxygen therapy have been studied to decrease the radiationinduced damage to microcirculation in animal models [30]. Recently, the treatment with shock waves (SW), which consists of transient pressure fluctuations with three-dimensional spreading and apparently releasing angiogenic factors, has been compared to the gene therapy with VEGF [31]. Tissue engineering is rapidly evolving as a therapy option. The growth of human bone [32,33] and cartilage cells [34], pre-adipocytes [35], conjunctiva and oral mucosa equivalents [36,37,38], and adult-derived stem cells [39] have been investigated. For cell-based bone tissue engineering, biophysical stimulation of the host cell population around the bone defect and autologous cell implantation are accepted for clinical proceedings. Warnke et al. [40] report a successful reconstruction of a mandibular defect by growth of a custom bone
Recent Advances and Future Prospects Upon the Arterial Framework…
281
transplant inside the latissimus dorsi muscle. Complex therapeutical options (extracorporeal tissue engineering, stem cell use, and genetic engineering) have been tested in preclinical investigations but have not reached clinical use until now. Clinical investigation for new facial flaps is focused on neglected branches, anastomosis networks, and perforators’ maps. Plastic surgeon must become a fine vascular anatomist. The zygomatic artery flap by Gardetto [5], the nasolabial island perforator flap by Hofer [6], the forehead zygomatic-orbital artery-based island flap by Riggio [16], and the ideas for flap based on the transverse facial artery perforator, for extended submental flap or for composite frontotemporal flaps are some of the inputs coming from recent scientific literature. In the meanwhile, especially in case of reconstruction of the lower face after limphoadenectomy and radiotherapy, valid options are represented by either pedicled flaps such as deltopectoral, supraclavicular, pectoralis major, and trapezius or free flaps such as latissimus dorsi, anterolateral thigh flap, diep, lateral brachial flap, fibula, and radial forearm.
REFERENCES [1] Xiong, SH; Cheng, XD; Xu, DC; Li, N; Yan, L; Zhao, TL; Yu, L; Liao, H; Suw, F; Takemura, A; Toda, I; Ike, H; Fang, YR. Facial subdermal vascular network flap: anatomic study and clinical application. Surg Radiol Anat, 2002, 24(5): 258-64. [2] Niranjan, NS. An anatomical study of the facial artery. Ann Plast Surg, 1988, 21: 14-22. [3] Loukas, M; Hullet, J; Louis, RG; Kapos, T; Knight, J; Nagy, R; Marycz, D. A detailed observation of variations of the facial artery, with emphasis on the superior labial artery. Surg Radiol Anat, 2006, 28(3): 316-24. [4] Gardetto, A; Moriggl, B; Maurer, H; Erdinger, K; and Papp, C. Anatomical basis for a new island axial pattern flap in the perioral region. Surg Radiol Anat, 2002, 24: 147-154. [5] Gardetto, A; Erdinger, K; Papp, C. The zygomatic flap: a further possibility in reconstructing soft-tissue defects of the nose and upper lip. Plast Reconstr Surg, 2004, 113(2): 485-90. [6] Hofer, SO; Posch, NA; Smit, X. The facial artery perforator flap for reconstruction of perioral defects. Plast Reconstr Surg, 2005, 115(4): 996-1003; Discussion 1004-1005 [7] Kawai, K; Imanishi, N; Nakajima, H; Aiso, S; Kakibuchi, M; Hosokawa, K. Arterial anatomy of the lower lip. Scand J Plast Reconstr Surg Hand Surg, 2004, 38(3): 135-9. [8] Pinar, YA; Bilge, O; Govsa, F. Anatomic study of the blood supply of perioral region. Clin Anat, 2005, 18(5): 330-9. [9] Martin, D; Pascal, J F; Baudet, J; Mondie, JM; Farhat, JB; Athoum, A; Le Gaillard, P; Peri, G. The submental island flap: A new donor site. Anatomy and clinical applications as a free or pedicled flap. Plast Reconstr Surg, 1993, 92(5): 867-73. [10] Pistre, V; Pelissier, P; Martin, D; Lim, A; Baudet, J. Ten years of experience with the submental flap. Plast Reconstr Surg, 2001, 108(6): 1576-81. [11] Faltaous, AF; Yetman, RJ. The submental artery flap: an anatomic study. Plast Reconstr Surg, 1996, 97(1): 56-60.
282
Egidio Riggio
[12] Kim, JT; Kim, SK; Koshima, I; Moriguchi, T. An anatomic study and clinical applications of the reversed submental perforator-based island flap. Plast Reconstr Surg, 2002, 109(7): 2204-10. [13] Uysal, AC; Alagoz, MS; Unlu, RE; Sensoz, O. An anatomic study and clinical applications of the reversed submental perforator-based island flap. (letter) Plast Reconstr Surg, 2003, 112(2): 690-1. [14] Pinar, YA; Govsa, F. Anatomy of the superficial temporal artery and its branches: its importance for surgery. Surg Radiol Anat, 2006, 28(3): 248-53. [15] Whetzel, TP; Mathes, SJ Arterial anatomy of the face: an analysis of vascular territories and perforating cutaneous vessels. Plast Reconstr Surg, 1992, 89(4): 591-603. [16] Riggio, E; Spano, A; Nava, M. The forehead zygomatic-orbital artery-based island flap. Plast Reconstr Surg, 2005, 115(1): 226-33. [17] Marano, SR; Fischer, DW; Gaines, C; Sonntag, VK. Anatomical study of the superficial temporal artery. Neurosurgery, 1985, 16(6): 786-90. [18] Imanishi, N; Nakajima, H; Minabe, T; Chang, H.; Aiso, S. Venous drainage architecture of the temporal and parietal regions: Anatomy of the Superficial Temporal Artery and Vein. Plast Reconstr Surg, 2002, 109(7): 2197-203. [19] Song, R; Song, Y; Qi, K; Jiang, H; Pan, F. The superior auricular artery and retroauricular arterial island flap. Plast Reconstr Surg, 1996, 98(4): 657-67. [20] Kilinc, H; Bilen, BT. A new approach to retroauricular flap transfer: parietal branchbased reverse flow superior auricular artery island flap. Ann Plast Surg, 2006, 56(4): 380-3. [21] Uchinuma, E; Sakurai, H; Shioya, N. Anterofrontal superficial temporal artery island flap for full-thickness eyelid reconstruction. Ann Plast Surg, 1989, 23(5): 433-6. [22] Ozdemir, R; Sungur, N; Sensoz, O; Uysal, AC; Ulusoy, MG; Ortak, T; Baran, CN. Reconstruction of facial defects with superficial temporal artery island flaps: a donor site with various alternatives. Plast Reconstr Surg, 2002, 109(5):1528-35. [23] Nakajima, H; Imanishi, N; Minabe, T. The arterial anatomy of the temporal region and the vascular axis of various temporal flaps. Br J Plast Surg, 1995, 48: 439-450. [24] Menderes, A; Ylmaz, M; Vayvada, H; Demirdover, C; Barutcu, A. Reverse Temporalis Muscle Flap for the Reconstruction of Orbital Exenteration Defects. Ann Plast Surg, 2002, 48(5): 521-7. Cordeiro, PG; discussion 526-7. [25] Kim, YO; Park, BY. Reverse temporalis muscle flap: treatment of large anterior cranial base defect with direct intracranial–nasopharyngeal communication. Plast Reconstr Surg, 1995, 96(3): 576–584. [26] Chen, CT; Robinson, JB Jr; Rohrich, RJ; Ansari, M. The blood supply of the reverse temporalis muscle flap: anatomic study and clinical implications. Plast Reconstr Surg, 1999, 103(4): 1181-8. [27] Beheiry, EE; Abdel-Hamid, FA. An anatomical study of the temporal fascia and related temporal pads of fat. Plast Reconstr Surg, 2007, 119(1): 136-44. [28] Houseman, ND; Taylor, GI; Pan, WR. The angiosomes of the head and neck: anatomic study and clinical applications. Plast Reconstr Surg, 2000, 105(7): 2287-313. [29] Waller, W; Lee, J; Zhang, F; Lineaweaver, WC. Gene therapy in flap survival. Microsurgery, 2004, 24(3): 168-173.
Recent Advances and Future Prospects Upon the Arterial Framework…
283
[30] Hom, DB; Unger, GM; Pernell, KJ; Manivel, JC. Improving surgical wound healing with basic fibroblast growth factor after radiation. Laryngoscope, 2005, 115(3): 412-422. [31] Meirer, R; Huemer, G; Oehlbauer, M; Wanner, S; Piza-Katzer, H; Kamelger, F. Comparison of the effectiveness of gene therapy with vascular endothelial growth factor or shock wave therapy to reduce ischaemic necrosis in an epigastric skin flap model in rats. J Plast Reconstr Aesthet Surg, 2007, 60(3): 266-271. [32] Quarto, R; Mastrogiacomo, M; Cancedda, R; Kutepov, SM; Mukhachev, V; Lavroukov, A; Kon, E; Marcacci, M. Repair of large bone defects with the use of autologous bone marrow stromal cells. N Engl J Med, 2001, 344: 385–6. [33] Schimming, R; Schmelzeisen, R. Tissue-engineered bone for maxillary sinus augmentation. J Oral Maxillofac Surg, 2004, 62: 724–729. [34] Naumann, A; Dennis, JE; Aigner, J; Coticchia, J; Arnold, J; Berghaus, A; Kastenbauer, ER; Caplan, AI. Tissue engineering of autologous cartilage grafts in three-dimensional in vitro macroaggregate culture system. Tissue Eng, 2004, 10(11-12):1695-706. [35] Hemmrich, K; von Heimburg, D; Rendchen, R; Di Bartolo, C; Milella, E; Pallua, N. Implantation of preadipocyte-loaded hyaluronic acid-based scaffolds into nude mice to evaluate potential for soft tissue engineering. Biomaterials, 2005, 26(34):7025-37. [36] Yoshizawa, M; Feinberg, SE; Marcelo, CL; Elner, VM. Ex vivo produced human conjunctiva and oral mucosa equivalents grown in a serum-free culture system. J Oral Maxillofac Surg, 2004, 62(8): 980-8. [37] Ahn, KM; Lee, JH; Hwang, SJ; Choung, PH; Kim, MJ; Park, HJ; Park, JK; Jahng, J; Yang, EK. Fabrication of myomucosal flap using tissue-engineered bioartificial mucosa constructed with oral keratinocytes cultured on amniotic membrane. Artif Organs, 2006, 30(6): 411-23. [38] Moharamzadeh, K; Brook, IM; Van Noort, R; Scutt, AM; Thornhill, MH. Tissueengineered oral mucosa: a review of the scientific literature. J Dent Res, 2007, 86(2): 115-24. [39] Goessler, UR; Hormann, K; Riedel, F. Tissue engineering with adult stem cells in reconstructive surgery (review). Int J Mol Med, 2005, 15(6): 899-905. [40] Warnke, PH; Springer, IN; Wiltfang, J; Acil, Y; Eufinger, H; Wehmöller, M; Russo, P; Bolte, H; Scherry, E; Behrens, E; Terheyden H. Growth and transplantation of a custom vascularised bone graft in a man. Lancet, 2004, 364: 766–70.
INDEX
A AAV, 98 abdomen, 12, 157, 168 AC, 37, 45, 81, 89, 151, 175, 180, 225, 272, 282 access, xiv, 58, 165, 169, 198, 229, 230, 236, 237, 239, 240, 241 accuracy, xiv, 108, 134, 138, 141, 144, 145, 212, 221, 222, 236 acidi, ix, 1, 2, 9, 10, 88, 103, 105, 118, 134, 135, 149, 239, 283 acidosis, 18 ACL, 82 actinic keratosis, 212 activation, 23, 28, 29, 43, 46, 62, 66, 109, 249, 250, 251, 252, 253, 254, 260 activity level, 14, 22 acute lymphoblastic leukemia, 117 acute myeloid leukemia, 104 adaptation, 83 ADC, 133, 134 adenocarcinoma, ix, 12, 37, 47, 48, 91, 160, 170, 214, 217, 218, 222, 225, 226, 232 adenocarcinoma of the esophagus, 12 adenocarcinomas, 48, 73, 93, 233 adenoma, xiv, 146, 211, 213, 214, 216, 217, 218, 222, 225, 227, 228 adenopathy, 148 adenovirus, 108, 109, 113, 114, 115 ADH, 250 adhesion, 72, 74, 76, 92 adipocytes, 280
administrationi, ix, x, 1, 2, 3, 5, 6, 7, 8, 10, 25, 44, 99, 109, 112, 115, 134, 158, 280 adolescence, 227 adult stem cells, 283 adult tissues, 70 adults, 156, 177 aerodigestive tract, 180, 228 aetiology, 78 Africa, 212 age, xii, xv, 12, 13, 30, 52, 53, 57, 76, 78, 79, 96, 155, 159, 160, 166, 171, 172, 178, 185, 197, 200, 203, 256, 260, 263, 265, 267, 268 agent, 2, 76, 106, 114 aggregates, 100 aggressive behavior, 69 aggressive therapy, 78 aggressiveness, xi, xv, 51, 59, 63, 66, 70, 104, 123, 226, 263, 264 alanine, 265 alcohol, xv, 12, 126, 163, 171, 177, 212, 213, 247, 248, 249, 250, 255, 258, 260, 262, 270 alcohol abuse, 126, 163, 212 alcohol consumption, 248, 258 alcohol use, xv, 171, 212, 247, 270 algorithm, 157, 166 allele, 253, 255, 256, 257, 260 alternative, xiv, 57, 99, 109, 175, 196, 206, 260, 279 alternatives, 282 alters, 251 aluminium, 186 American Cancer Society, 34, 80 amines, 249, 252, 253 amino acid, 103, 120, 253 amino acids, 103
286
Index
ammonium, 4, 96, 100, 102 anastomosis, 281 anatomy, xv, 144, 233, 234, 240, 241, 246, 275, 276, 279, 280, 281, 282 anemia, 23 aneuploidy, 223 angiofibroma, 244 angiogenesis, 14, 16, 17, 18, 20, 22, 23, 25, 27, 29, 31, 38, 39, 40, 43, 45, 46, 48, 61, 71, 89, 90, 272 angiography, xi, 125, 126, 131, 136, 145, 147, 149, 234, 245 angulation, 126 anhydrase, 39 animal models, 109, 280 animals, 3, 16 anion, 103 anorexia, 166 anorexia nervosa, 166 ANOVA, 188, 190 antiangiogenic therapy, 116 anti-apoptotic, 69, 70, 108 antibiotic, 176, 179 antibody, 14, 19, 25, 29, 36, 37, 67, 107 anticancer drug, 31, 49 antigen, 14, 36, 67, 87, 88, 109, 110, 111, 123, 274 antimetabolites, 46 antioxidant, 31 antisense, 101, 106, 111, 112, 115, 116, 117, 119, 123, 124 antisense oligonucleotides, 115, 117, 124 antisense RNA, 112, 116 antitumor, 108, 109, 114, 115, 116, 121, 123 antiviral, 110 AP, 36, 41, 92, 122 apoptosis, xi, 25, 40, 43, 51, 52, 61, 62, 66, 69, 70, 71, 87, 88, 89, 90, 108, 111, 113, 115, 122, 271, 272, 274 argument, 180 arrest, 121 arteries, 136, 149, 234, 276, 277, 279 artery, xv, 137, 230, 234, 239, 240, 245, 275, 276, 277, 278, 279, 281, 282 aryl hydrocarbon receptor, 23, 42 ascites, 166 ASI, 49 Asia, 212 aspirate, 215 aspiration, xi, xiv, 126, 139, 150, 151, 164, 165, 167, 168, 171, 172, 211, 213, 214, 215, 225, 226, 227, 228, 236, 245
aspiration pneumonia, 164 assessment, xii, 35, 38, 55, 81, 82, 83, 88, 131, 139, 141, 147, 149, 150, 151, 153, 155, 190, 224, 234, 237 asymptomatic, 54, 205, 212, 214, 225 atrophy, 171 attachment, 72, 73, 187, 237 attention, xiv, 24, 34, 111, 138, 229, 230, 239, 257 Australia, 212 availability, 105, 170 averaging, 234 avoidance, 61
B B cells, 109 BAC, 224 barriers, 99, 115 basal cell carcinoma, 10, 245 basal layer, 68, 69, 75 base pair, 111 basic fibroblast growth factor, 16, 38, 39, 90, 280, 283 Bcl-2 proteins, 70 BD, 89, 175 behavior, xi, 51, 52, 57, 61, 66, 68, 87, 92 bending, xii, xiii, 183, 184, 185, 187, 188, 189, 190, 191, 192, 196, 197, 204 benefits, 205 benign, xii, xiv, 129, 133, 141, 148, 150, 155, 172, 211, 213, 214, 216, 223, 229, 230, 231, 232, 237, 241, 246, 261 benign tumors, 129, 133, 214, 231, 246 benzene, 254 beverages, 250 bias, 166 bile, 106 binding, xv, 16, 29, 31, 39, 40, 42, 46, 62, 66, 76, 77, 103, 105, 106, 118, 119, 120, 247, 248, 253 biochemistry, 250 biologic agents, 109 biological behavior, xi, 52, 56, 61, 72 biological markers, 77 biomarkers, 228, 258 biomechanics, 192, 194, 196, 208 biophysics, 115 biopsy, xiv, 14, 17, 130, 133, 139, 148, 150, 151, 160, 193, 207, 211, 212, 213, 215, 221, 222, 223, 224, 226, 227, 228, 236, 239, 245, 268 biosynthesis, 111
Index bladder, 8, 14, 16, 29, 31, 36, 44, 46, 47, 62, 252 blocks, 65, 187 blood, 12, 13, 15, 16, 17, 18, 23, 25, 26, 38, 42, 45, 61, 71, 106, 137, 138, 139, 150, 234, 237, 277, 279, 281, 282 blood flow, 138, 150, 279 blood plasma, 106 blood supply, 71, 281, 282 blood transfusion, 25 blood vessels, 16, 17, 18, 26, 38, 42, 61, 71, 137, 138, 234 BMI, 164 BN, 226 body weight, 165 bone cement, 193 bone grafts, 280 bone marrow, 147, 283 bone mass, 209 bone remodeling, 209 bone resorption, 131 bowel, 160 brachioradialis, 199 brain, xiv, 14, 16, 30, 36, 62, 104, 112, 137, 138, 229, 242 brain tumor, 14, 16, 30, 137, 138 branching, 218, 277, 278, 279 Brazil, 52, 79, 247, 253, 259 Breast, 39, 258 breast cancer, 14, 18, 25, 29, 30, 31, 36, 37, 40, 43, 44, 48, 90, 108, 122, 124, 227, 258 breast carcinoma, 36, 37, 39, 40, 49, 89, 258 breathing, 148 buccal mucosa, 82, 215, 218, 251, 256, 262 budding, 215 buffer, 101, 265, 266 Burkitt’s lymphoma, 218 bystander cells, 123 bystander effect, 110
C cadaver, 278 cadherin, 74, 75, 76, 77, 90, 91, 92, 93 cadherins, 74, 92 cadmium, 49 calcium, 74 caliber, 278, 279 calibration, 4, 5 canals, 233, 234
287
cancer cells, 31, 70, 72, 97, 98, 104, 107, 108, 110, 111, 112, 113, 115, 117, 119, 120, 123, 141, 215, 223, 226, 260 cancer progression, 88, 111, 271 cancer treatment, ix, 1, 2, 32, 78, 139, 157, 166, 271 capillary, 71 capsule, 239 carbon, 133, 148 carcinogen, 249, 252, 255, 260 carcinogenesis, xi, xv, 51, 52, 64, 66, 67, 75, 77, 83, 89, 91, 92, 108, 228, 247, 248, 249, 250, 257, 260, 261, 262, 270, 274 carcinogens, xv, 247, 248, 249, 250, 252, 254, 255, 256, 257 carcinoma, ix, x, xi, xiv, 11, 12, 13, 14, 15, 16, 20, 21, 22, 27, 29, 32, 34, 35, 36, 37, 38, 39, 40, 41, 44, 45, 48, 49, 50, 56, 62, 63, 66, 69, 71, 76, 78, 79, 80, 81, 82, 83, 85, 89, 90, 91, 92, 93, 95, 96, 114, 122, 133, 140, 143, 147, 148, 151, 164, 169, 170, 171, 172, 177, 178, 180, 211, 212, 214, 215, 216, 217, 218, 222, 223, 225, 226, 227, 228, 231, 232, 244, 248, 253, 255, 274 carotid arteries, 234 carrier, 96, 103, 117 cartilage, 280, 283 cast, 197, 199, 200, 203, 205 catabolism, 164 catalysts, 252 catalytic activity, 29, 256 catalytic properties, 254 category a, 36 catheter, 147 Caucasians, 255, 261 CD14, 38 CD34, x, 11, 19, 21 CD44, 75, 92 CD8+, 110 cDNA, 45, 83, 97, 112, 118 CE, 46, 209 cell adhesion, 75, 92 cell culture, 72 cell cycle, 14, 17, 22, 25, 27, 65, 66, 67, 69, 86, 87, 89, 99, 108, 121, 273 cell death, 61, 65, 67, 70, 89, 110, 120, 264, 271 cell differentiation, 69, 72 cell division, 67 cell growth, 16, 39, 46, 47, 48, 90, 108, 111, 122, 264, 271 cell killing, 49
288
Index
cell line, 14, 17, 20, 22, 25, 26, 27, 28, 29, 34, 38, 41, 43, 62, 75, 76, 104, 108, 113, 114, 115, 117, 118, 121, 122, 265, 274 cell lines, 17, 20, 26, 27, 38, 41, 43, 75, 76, 108, 113, 114, 115, 118, 122 cell membranes, 100 cell surface, 100, 103, 105, 107, 110 central nervous system, 48 cerebrospinal fluid, 106 cervical cancer, 16, 17, 25, 26, 30, 40 cervix, 38, 39, 42, 44, 48, 118 chemical composition, 100 chemical reactions, 253 chemoprevention, 122, 228, 258, 261 chemoresistance, 25 chemotaxis, 46 chemotherapeutic agent, 96 chemotherapy, xi, 2, 25, 32, 33, 52, 57, 60, 63, 64, 95, 96, 108, 110, 111, 112, 114, 121, 141, 152, 157, 158, 161, 169, 174, 177, 249, 265 chicken, 120 childhood, 117, 227 children, 156 China, 229, 258, 261 Chinese, 49, 258 Chinese women, 258 chloride, 100, 101, 120 CHO cells, 49 cholesterol, 96, 100, 102, 103, 106, 117 choroid, 104, 118 chromatin, 215, 218 chromosome, 62, 65, 66, 67, 69, 74, 76, 93, 126, 253, 254, 264 chronic hypoxia, 41 cigarette smoke, 254, 256 cigarette smokers, 256 cigarette smoking, 258, 273 circulation, 279 cisplatin, 49, 96, 109, 123 classes, xv, 247, 248, 252 classification, xi, 13, 35, 51, 54, 55, 57, 80, 167, 268 cleavage, 91 clinical examination, 126, 133 clinical presentation, 79, 214, 265 clinical trials, 34, 101, 107, 110, 111, 245 clinicopathologic correlation, 273 clone, 41, 224 cloning, 47, 118 closure, 241, 277 clustering, 118
clusters, 215, 216, 217, 218 CNN, 130 coagulopathy, 166 cobalt, 43 codes, 65, 264, 271 coding, 97, 100, 110, 253, 256, 280 codon, 256, 260 cohort, 157, 225, 257 collateral, xvi, 275, 276, 277, 278 colon, 8, 30, 47, 71, 73, 90, 91, 108 colon cancer, 30, 90 colorectal cancer, 16, 36, 49, 259 combustion, 249 commissure, 278 communication, 108, 282 community, 153, 176, 179 competency, 241 competition, 70 compliance, 223 complications, xii, xiii, 52, 139, 155, 156, 157, 158, 159, 160, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 174, 175, 176, 179, 193, 195, 196, 200, 205, 206, 207, 209, 221 components, 42, 250 compounds, 31, 249, 250, 252, 254 computed tomography, xi, xiv, 125, 144, 146, 147, 151, 152, 153, 211, 213, 236, 245 Computer simulation, 193 concentration, 3, 4, 5, 8, 10, 38, 106, 141, 190, 191, 194, 196, 204, 208, 249, 259, 265, 266 condensation, 106 confidence, 187, 188 confidence interval, 187, 188 configuration, 100, 151 confusion, 20, 213 conjugation, 105, 250, 252, 256, 261 conjunctiva, 280, 283 connective tissue, 56 consensus, 58, 271 consent, 168 consumption, 249 contaminants, 250 continuity, 277 contrast agent, 134 control, 3, 18, 26, 27, 28, 31, 35, 40, 41, 63, 66, 78, 85, 86, 89, 97, 108, 109, 112, 122, 172, 177, 239, 240, 254, 255, 256, 257, 258, 259, 260, 261, 265 control group, 172, 255, 256, 257 conversion, 31, 249
Index correlation, x, 12, 14, 17, 19, 20, 21, 23, 24, 26, 29, 30, 32, 37, 40, 44, 45, 49, 64, 65, 70, 71, 75, 85, 89, 92, 93, 107, 112, 148, 150, 151, 221, 257, 259, 264, 271, 272 correlations, 25, 26, 37 cortex, xiii, 183, 184, 185, 186, 187, 188, 189, 190, 191, 197, 198, 205 costs, 163, 164 coverage, 278, 280 covering, 242 CpG islands, 75, 76 Croatia, 254 CT scan, 126, 127, 128, 129, 130, 131, 139, 141, 142, 144, 145 culture, 9, 283 cycles, 83, 265, 266 cyclin-dependent kinase inhibitor, 86, 87, 108, 121 cycling, 41 cyclins, 65, 88 cyclooxygenase, 113 cyclooxygenase-2, 113 cysteine-rich protein, 31 cytochrome, 23, 41, 259, 260, 261, 262 cytokines, 34 cytologic examination, 222, 227 cytology, xiv, 150, 211, 212, 213, 214, 215, 216, 218, 220, 221, 222, 223, 224, 225, 226, 227, 228, 236, 245 cytomegalovirus, 97 cytometry, xiv, 22, 212, 223 cytomorphometry, xiv, 212 cytoplasm, 23, 55, 64, 70, 103, 106, 111, 217, 218, 221 cytosine, 97, 110, 123, 253 cytoskeleton, 74, 75 cytotoxic, xi, 63, 95, 109, 111 Cytotoxic effects, 114 cytotoxicity, 49, 117
D DD, 80, 179, 245, 272 death, xii, 60, 70, 110, 114, 123, 155, 158, 160, 162, 166, 168 deaths, xii, 52, 155, 160, 167 decision making, 172 decision-making process, 157, 166 decisions, xi, 41, 51
289
defects, xiii, xv, 100, 131, 165, 184, 190, 196, 197, 199, 203, 206, 241, 246, 275, 276, 278, 279, 281, 282, 283 deficiency, 93, 117, 255, 256 deficit, 159, 184 definition, 20, 42, 52, 53, 102, 234 deglutition, 166 degradation, 66, 71, 86, 99, 101, 108, 111, 121, 261 degradation rate, 66 delivery, xi, 41, 95, 97, 99, 100, 102, 103, 104, 105, 106, 107, 108, 111, 112, 115, 116, 117, 119, 120, 121, 122, 165 demand, 16 dementia, 166, 180 density, x, 11, 14, 15, 17, 18, 19, 20, 22, 24, 25, 26, 28, 29, 30, 31, 33, 35, 39, 40, 44, 45, 49, 67, 71, 107, 128, 129, 130, 194, 213, 234 dentists, 137 deoxyribose, 29 deposition, 38 deposits, 208 derivatives, 3, 6, 102, 103, 106, 249 destruction, 59, 231, 232 detection, xiv, 8, 54, 60, 61, 80, 87, 130, 138, 141, 147, 148, 149, 152, 153, 168, 211, 212, 215, 222, 223, 224, 227, 228, 230, 245, 265 deviation, 55 diabetes, 166 diabetes mellitus, 166 dialysis, 166 diaphyses, 209 diaphysis, 186 diet, 163, 177, 257 differential diagnosis, 129, 133, 146 differentiation, 36, 55, 56, 63, 67, 71, 72, 75, 76, 85, 118, 123, 130, 147, 264, 265, 267, 268, 271, 274 diffusion, 18, 40, 133, 134, 148 digestive tract, 80 dimerization, 29 dioxin, 42 discomfort, 164, 213 disease progression, 108 disorder, 12, 244 dispersion, 72, 213 displacement, 164, 187 dissatisfaction, 164 dissociation, 57, 58, 73, 77 distress, 168 distribution, 9, 16, 26, 41, 44, 67, 69, 141, 213, 215, 216, 233, 257, 277
Index
290
division, 230 DNA, xi, xiv, xv, 26, 33, 37, 42, 52, 65, 67, 70, 77, 89, 93, 95, 97, 98, 99, 100, 101, 102, 106, 107, 108, 110, 111, 112, 115, 116, 117, 119, 120, 123, 212, 223, 224, 225, 227, 228, 247, 248, 249, 250, 253, 256, 258, 261, 265, 266, 272, 274 DNA damage, xv, 65, 108, 247, 248, 256 DNA image cytometry, 224 DNA ploidy, 224 DNA polymerase, 110 DNA repair, 26, 33, 67, 89, 261 docetaxel, 96, 111, 115 dogs, 194, 209 doppler, 150 Doppler, 138, 139, 150, 277, 278, 279 dose-response relationship, 215 down-regulation, 108, 111, 117 drainage, 277, 278, 280, 282 drug release, 119 drug resistance, 44, 259 drugs, 63, 123, 251 dsRNA, 111 duodenum, 157 duration, xii, 67, 69, 155, 158, 159, 160, 161, 162, 163, 166, 169, 170, 171, 172, 174, 205 DWI, 134, 148 dyes, 249 dysphagia, 157, 163, 165, 166, 176 dysplasia, xiv, 63, 66, 67, 70, 86, 88, 159, 162, 211, 212, 214, 221, 222, 225, 227
E E. coli, 24 eating, 12 E-cadherin, 72, 74, 75, 76, 77, 80, 84, 91, 92, 93 edema, 239 education, 227 effusion, 147 egg, 106 EIA, 109 elasticity, 190 elderly, 78, 160, 163, 167, 176, 180, 191, 201, 277 electrodes, 17, 40 electron, 223, 251 electron density, 251 electron microscopy, 223 electrophoresis, 265 electroporation, 100, 108, 115 embryonic development, 46
emission, 4, 5, 8, 142, 152, 153, 225, 226, 236 emulsions, 99 encapsulation, 101, 117 encoding, 43, 97, 251 endocrine, 52 endocytosis, 99, 103, 104, 105, 107, 118 endoscope, 157, 166 endoscopy, 160, 167, 170, 176, 179, 180 endothelial cells, 16, 17, 22, 27, 29, 31, 38, 39, 46, 71, 90 endothelium, 46 energy, xii, 41, 45, 183, 184, 190, 197, 250 England, 178 enlargement, 231, 234 environment, xv, 170, 247, 248, 250, 261 environmental factors, 12, 126, 257, 259 enzyme, 23, 87, 106, 108, 110, 113, 250, 253, 254, 259, 260 enzyme-linked immunoabsorbent assay, 87 enzymes, xv, 43, 110, 247, 248, 249, 250, 251, 252, 254, 255, 257, 258, 259 epidemiology, 12 epidermal growth factor, 62, 63, 83, 84, 85, 86, 91, 92, 111, 115, 116, 119, 124 epithelia, 74, 87, 113, 228 epithelial cells, 43, 55, 56, 72, 97, 213, 218, 251, 259 epithelial ovarian cancer, 47 epithelium, 36, 54, 55, 56, 60, 63, 66, 68, 72, 74, 75, 86, 92 Epstein Barr, (virus) 97, 113 equipment, 157, 169, 187 erosion, 232, 234 erythropoietin, 23, 41, 43 Escherichia coli, 24, 47 esophageal cancer, x, 11, 16, 30, 35, 38, 48 esophageal squamous cell carcinoma, x, 11, 12, 13, 19, 26, 32, 33, 34, 48, 91 esophagus, 12, 35, 37, 38, 71, 73, 93 ester, 3, 6, 9, 10 esters, 9 estimating, 21, 33, 85, 268 ethanol, 31, 101, 102, 213, 249, 250, 254 Ethanol, 249, 250, 261 ethical issues, 157, 166, 175 ethnic groups, 256 ethylene, 249, 252, 256 ethylene oxide, 249, 252, 256 etiology, 137 Euro, 10 Europe, 186, 212
Index eustachian tube, 240 evidence, xiii, 29, 38, 41, 70, 77, 96, 109, 164, 166, 171, 176, 188, 195, 205, 206, 212, 216, 232 evolution, 77, 84, 92, 250, 265 examinations, 128, 137, 138 excision, 236, 241 excitation, 3 excretion, 252 exons, 265, 270 expertise, 165, 170 exposure, 43, 67, 99, 237, 238, 239, 241, 243, 244, 249, 250, 251, 252, 257, 277 Exposure, 258 external carotid artery, 136 external fixation, 197 extracellular matrix, 71, 72 extraction, 265
F FAA, 274 facial nerve, 237, 238, 240, 277, 278 failure, 60, 66, 68, 166, 185, 212, 266, 272, 274 false negative, xiv, 212, 222, 224 family, xv, 18, 27, 31, 62, 70, 72, 74, 83, 85, 89, 106, 111, 247, 248, 251, 252, 253, 254, 257, 259, 264 family members, 83, 85 family studies, 253, 254 fascia, 241, 243, 280, 282 fat, 128, 131, 132, 147, 234, 241, 282 fatty acids, 251 FDA, 65 FDA approval, 65 females, 13, 204 femur, 208 fibrin, 17, 38 fibrinogen, 17 fibroblast growth factor, 65 fibroblasts, 46, 272 fibrosarcoma, 27 fibula, 163, 193, 208, 281 fidelity, 250 film, 233 fixation, xiii, 64, 190, 194, 195, 197, 198, 200, 203, 208, 209 flexor, 198, 201, 204 fluctuations, 280 fluid, 106, 137 fluorescence, ix, 1, 2, 3, 4, 5, 8, 9, 10, 224, 226
291
fluorine, 141 folate, xi, 95, 96, 97, 103, 104, 105, 106, 108, 111, 117, 118, 119, 120 folic acid, xi, 95, 97, 103, 120 foramen, 230, 232, 233, 234, 277 Ford, 153 formamide, 266 fractures, xii, xiii, 159, 183, 184, 190, 193, 194, 195, 197, 204, 205, 208, 209 fragmentation, 160 France, 257 free radical scavenger, 31 free radicals, 32, 49 frequency distribution, 257 fusion, xi, 110, 125, 133, 137, 144, 145
G ganglion, 230, 232, 234, 240 gastrectomy, 34, 166, 167 gastric ulcer, 160 gastroenterologist, 157, 167 gastrointestinal tract, 48, 157, 164, 165 gastrostomy, xii, 155, 156, 157, 159, 165, 166, 167, 168, 169, 170, 171, 172, 174, 175, 176, 177, 178, 179, 180, 181 gel, 266 gender, 30, 166, 197, 200, 268 gene, xi, xv, 26, 36, 40, 41, 42, 43, 44, 48, 49, 60, 62, 63, 65, 66, 67, 69, 74, 76, 77, 83, 86, 87, 89, 92, 93, 95, 97, 98, 99, 100, 101, 103, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 119, 120, 121, 122, 123, 224, 228, 247, 248, 250, 251, 252, 253, 254, 255, 256, 258, 259, 261, 262, 264, 265, 270, 271, 272, 273, 280, 283 gene amplification, 62, 63 gene expression, 40, 42, 43, 44, 77, 97, 99, 108, 113, 122 gene promoter, 76, 113 gene silencing, 111 gene therapy, xi, 95, 97, 98, 101, 106, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 119, 121, 123, 280, 283 gene transfer, 99, 101, 103, 105, 106, 112, 113, 115, 117, 119, 123 general surgeon, 157 generation, 17, 38, 99, 100, 102 genes, xi, 21, 23, 34, 43, 65, 66, 83, 95, 98, 107, 109, 110, 111, 122, 251, 253, 254, 255, 257, 258, 259, 261, 264, 266, 270, 271
Index
292
genetic alteration, 60, 61, 66, 99, 108, 254, 255, 256, 257 genetic disorders, 111 genetic factors, 264 genetic linkage, 45 genetic marker, 52 genome, 25, 34, 65, 99, 251 genomic instability, 83 genotype, 252, 254, 255, 256, 257, 259 germ cell tumors, 41 Germany, 101, 185, 253, 255 gingiva, ix, 218, 255 gingival, 129, 130, 132, 143, 215, 227 gland, ix, xiv, 128, 135, 211, 212, 214, 216, 218, 222, 225, 226, 228, 233, 244 glass, 213 glioma, 40, 45 glucose, 17, 18, 25, 44, 141, 142, 144, 152 glucose metabolism, 17, 18, 141, 144 glutathione, xv, 247, 248, 251, 258, 259, 261 glycogen, 215 glycol, 119 glycoprotein, 16, 62 glycoproteins, 72, 74, 106 gold, xiv, 169, 211 grading, 56, 64, 81, 224 granules, 120 graph, 134, 135 gravity, 213 groups, 20, 23, 30, 53, 58, 77, 99, 167, 172, 185, 188, 189, 190, 215, 223, 249, 252, 271 growth, ix, 14, 15, 16, 18, 22, 23, 24, 25, 27, 28, 29, 35, 38, 39, 40, 41, 44, 45, 46, 48, 49, 52, 56, 59, 61, 62, 63, 65, 67, 69, 71, 72, 75, 76, 83, 84, 89, 90, 108, 111, 113, 116, 122, 214, 216, 218, 219, 220, 265, 280, 283 growth factor, 15, 16, 28, 29, 38, 39, 40, 41, 44, 45, 46, 48, 49, 62, 63, 65, 71, 83, 84, 89, 90, 280, 283 growth factors, 45, 46, 65, 280 growth rate, 14, 22, 25 guidance, 157, 158, 169, 176, 177, 180, 236 guidelines, 13, 174
H haplotypes, 266 harvesting, xii, 183, 208, 278, 280 hazards, 30, 266 HD, 145, 272 HE, 5, 37, 38, 43, 49, 85, 86, 88, 245, 274
head and neck cancer, 14, 17, 25, 40, 79, 108, 114, 115, 116, 121, 123, 126, 133, 146, 148, 150, 152, 153, 157, 163, 174, 175, 177, 178, 179, 180, 181, 212, 248, 252, 253, 254, 255, 257, 259, 261, 262, 264, 272, 273, 274 head trauma, 156 healing, xiii, 195, 196, 199, 204, 242 health, xiv, 53, 165, 174, 196, 205, 206, 248 health care, 205 health care system, 205 health status, 165 heat, 113 heavy drinking, 254 heavy metals, 31 height, 129, 266, 279 hemangioma, 137 hematomas, 139 hematopoietic cells, 45, 118 hematoxylin-eosin, 3 heme, 2, 23, 41, 251, 253 hemiglossectomy, xii, 155, 163, 172 hepatitis, 47 hepatocellular, 18, 29, 47, 76, 92, 93, 227, 274 hepatocellular carcinoma, 18, 29, 47, 76, 92, 93, 227, 274 hepatocyte growth factor, 35 hepatocytes, 100, 106 hepatoma, 39 hepatomegaly, 166 hernia, 160, 166 herpes, 98, 110, 114, 117, 120, 123 herpes simplex, 98, 110, 114, 117, 120, 123 heterogeneity, 17, 18, 20, 26, 34, 66, 90, 118 histologic type, ix histological markers, xi, 52 histology, 90, 221 histone, 67, 122 histopathology, xiv, 211, 221 HIV, 115, 226 HIV-1, 115 HLA, 109, 116, 123 homeostasis, 31, 41 homogeneity, 131 Honda, 146 Hong Kong, 209 hospitals, 264 host, 12, 16, 57, 97, 99, 177, 280 host tissue, 16, 57 hot spots, 40 HPLC, 8
Index HPV, 97, 98, 224, 272 human brain, 46 human genome, 251 human leukocyte antigen, 110 human papilloma virus, 97, 251 human papillomavirus, 112, 212, 228, 259 human subjects, 120 hybridization, 224 hydroxyl, 24 hyperbaric oxygen therapy, 280 hypermethylation, 75, 76, 93 hypothesis, 190, 256 hypoxia, 17, 18, 21, 22, 23, 24, 25, 29, 39, 40, 41, 42, 43, 44, 45 Hypoxia, 21, 23, 40, 42, 43, 44, 45 hypoxia-inducible factor, 18, 23, 24, 41, 42, 43, 44 hypoxic cells, 17, 18, 20, 26, 39, 45
I ICD, 54 identification, xi, 51, 52, 60, 74, 131, 136, 149, 223, 239, 277 IFN, 24, 109 ilium, 142, 143 illumination, 7 image analysis, 37, 68, 223 images, xi, 125, 128, 131, 132, 133, 134, 135, 136, 137, 138, 139, 141, 142, 143, 144, 145, 147 imaging, xi, xiv, 104, 125, 126, 128, 131, 132, 133, 138, 141, 142, 144, 145, 146, 147, 148, 149, 151, 152, 153, 211, 213, 225, 229, 230, 234, 236, 237 imaging modalities, xi, 125, 126, 133, 145 imaging techniques, xiv, 145, 148, 211, 213 immune reaction, xi, 95, 97 immune response, 109, 116 immune system, 109, 163 immunity, 109 immunocytochemistry, xiv, 212 immunogenicity, 99, 105 immunoglobulin, 27 immunohistochemical markers, xi, 52, 61, 67, 76, 77 immunohistochemistry, 14, 17, 19, 32, 61, 224 immunoreactivity, 36, 63, 70, 75, 76, 77, 84, 118 immunotherapy, 64, 109, 123 implants, 205, 209, 210 implementation, 258 impurities, 250 in situ, xiv, 211, 212, 215, 222, 223, 224, 226 in situ hybridization, 224, 226
293
in vitro, 20, 23, 26, 29, 39, 49, 76, 101, 102, 105, 107, 108, 109, 110, 112, 117, 119, 121, 250, 283 in vivo, 8, 23, 27, 29, 39, 40, 41, 101, 105, 107, 108, 112, 113, 114, 115, 116, 118, 119, 122, 192, 196 incidence, xii, xiii, 21, 31, 53, 55, 71, 78, 82, 83, 96, 130, 147, 155, 156, 159, 163, 165, 166, 167, 168, 169, 170, 171, 172, 174, 183, 184, 195, 196, 197, 202, 203, 204, 205, 206, 248, 260, 270, 273, 277 inclusion, 278 India, 253, 272, 273 Indians, 258 indication, 133, 158, 277 indicators, xi, 51, 52, 69, 77, 272, 273 indices, 69 inducer, 250, 251 inducible protein, 21, 22, 23, 24, 33 induction, x, 12, 32, 39, 42, 61, 108, 109, 157 infection, 99, 152, 159, 160, 168, 205, 272 infectious disease, 111 infectious diseases, 111 inferences, 53 inflammation, 129, 141, 152 inflammatory cells, 56 inheritance, 12 inhibition, 27, 34, 45, 62, 63, 65, 66, 70, 85, 108, 111, 121, 271 inhibitor, 65, 86, 89, 115, 121, 122 initiation, 103, 248 injury, 147, 160, 179, 205, 236, 239, 278 insertion, xii, 27, 155, 156, 157, 158, 159, 166, 167, 168, 169, 171, 172, 173, 174, 175, 180, 205 instability, 131 integration, 99 integrin, 92 integrity, 72, 184, 197 intensity, ix, 2, 4, 5, 6, 7, 8, 9, 61, 65, 67, 68, 70, 133, 134 interaction, xv, 16, 99, 100, 247, 248, 254, 261, 280 interactions, 74, 100, 122, 254, 261 intercellular adhesion molecule, 72, 74, 92 interface, 56, 57 interference, 110, 124, 164 interferon, 24, 123 interferon gamma, 123 internal fixation, xiii, 183, 184, 192, 194, 195, 198, 203, 205, 206, 207, 208, 209 internalization, 111 International Classification of Diseases, 54 interphase, 67, 87 interpretation, 146, 268
Index
294
interval, 64, 68, 69, 76 intervention, 170, 258 intestine, 103, 117, 118 introns, 97 inversion, 131, 132 inversion recovery, 131, 132 ionization, 32 ionizing radiation, 49, 113 ipsilateral, 240, 278 IR, 45 iron, 106, 107, 120, 134, 148, 149 irradiation, x, 2, 9, 12, 26, 32, 33, 83, 138, 177, 180, 212 island formation, 45 isoleucine, 253 Israel, 123 Italy, 275
J Japan, 1, 3, 4, 9, 11, 12, 13, 95, 125, 126, 127, 128, 129, 253, 255, 257 Jordan, 45, 88, 89, 272, 273 judgment, 56 justification, 166 juvenile angiofibroma, 241
K keratin, 55, 56, 216, 223 keratinocytes, 70, 72, 251, 283 kidney, 31, 46, 104, 118 killer cells, 109 killing, 49, 123 kinase, 24, 27, 28, 43, 45, 46, 62, 64, 66, 96, 98, 110, 114, 117, 120, 121, 123 kinase activity, 45, 62 kinetics, 2, 8, 9, 10, 37, 45, 87 Korea, 253 Kuwait, 211
L labeling, x, 11, 14, 15, 16, 20, 21, 22, 29, 30, 37 lactoferrin, 106, 120 laminin-5, 91 laparotomy, 156, 168, 174 laryngeal cancer, 260 laryngoscope, 166
larynx, 123, 165 latissimus dorsi, 163, 281 leakage, 160, 168 lesion, ix, xiv, 8, 54, 126, 139, 144, 160, 211, 212, 214, 231, 234, 236, 237, 244, 258, 265 lesions, xiv, 8, 10, 36, 54, 56, 63, 64, 66, 67, 68, 69, 70, 73, 74, 75, 81, 84, 86, 88, 90, 91, 92, 123, 126, 128, 131, 132, 134, 137, 139, 147, 150, 151, 153, 193, 208, 211, 212, 213, 214, 215, 221, 222, 223, 224, 225, 227, 228, 231, 234, 236, 237, 239, 241, 244, 245, 258, 260, 261, 267, 271, 273, 274 leukemia, 97 leukocytes, 109, 120 leukoplakia, 212, 215, 256, 258 Leukoplakia, 214, 215 lichen, 212, 224, 228 lichen planus, 212, 224, 228 life expectancy, 96, 157, 166 lifespan, 166 ligand, xi, 25, 28, 29, 45, 63, 72, 95, 97, 103, 105, 107, 108, 251 ligands, xi, 62, 95 likelihood, 70 limitation, 136, 172 linkage, 190 links, 121 lipid rafts, 118 lipids, 101, 102, 105 liposomes, 97, 99, 100, 101, 102, 104, 105, 106, 107, 108, 111, 112, 117, 119, 120 liquid chromatography, 8 literature, xiii, 53, 54, 60, 69, 77, 78, 81, 145, 157, 167, 170, 175, 195, 197, 205, 206, 220, 221, 232, 281, 283 liver, 47, 100, 221, 251, 252 liver disease, 47 local anesthetic, 223 localization, 3, 64, 84, 87, 122, 236, 251 location, 53, 54, 126, 131, 144, 218, 265, 279 locus, 29, 75 loss of appetite, 163 loss of heterozygosity, 75, 76 LPS, 24 luciferase, 113 lumen, 157 lung, 18, 31, 41, 42, 44, 45, 47, 62, 73, 91, 104, 105, 108, 111, 122, 153, 252, 258, 259, 261 lung cancer, 18, 41, 47, 258, 259, 261 lymph, xi, 52, 54, 55, 56, 58, 68, 72, 76, 80, 81, 82, 83, 90, 93, 106, 125, 126, 127, 128, 130, 131,
Index 133, 134, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 215, 224, 228, 256, 260, 265, 267, 271, 278 lymph node, xi, 52, 54, 55, 56, 58, 68, 72, 76, 80, 81, 82, 83, 90, 93, 125, 126, 127, 128, 130, 131, 133, 134, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 215, 224, 228, 256, 260, 265, 267, 271, 278 lymphadenopathy, 131, 139, 148, 150 lymphatic system, 58, 146 lymphocytes, 109, 123, 217 lymphoid, ix, 128, 141, 143, 218 lymphoid tissue, ix, 128, 141, 143 lymphoma, ix, 89, 133, 148, 212, 214, 218, 219, 226 lymphomas, xiv, 126, 211, 218 lysine, 96, 106, 213
M mAb, 61 machinery, 111 macrophages, 17, 27, 43, 44, 48, 109 magnetic field, 131 magnetic resonance, xiv, 134, 147, 149, 151, 205, 211, 213, 234, 236, 244, 245 magnetic resonance imaging, xiv, 147, 205, 211, 213, 236, 244, 245 major histocompatibility complex, 122 Malaysia, 224 males, 13, 204, 215 malignancy, xii, xiv, xv, 12, 14, 15, 64, 70, 73, 81, 118, 128, 130, 155, 156, 157, 163, 167, 169, 171, 201, 211, 212, 215, 216, 224, 236, 248, 263, 265, 267, 268 malignant cells, 15, 19, 22, 68, 91, 215, 216, 217, 223, 226 malignant melanoma, 45, 96 malignant tumors, xiv, xv, 57, 70, 96, 129, 141, 211, 229, 230, 231, 232 malnutrition, 163, 164, 173 mammalian cells, 111, 113, 121, 123, 124 management, xii, xiii, xv, 80, 92, 112, 129, 146, 155, 156, 165, 168, 175, 177, 184, 192, 206, 208, 213, 214, 225, 226, 229, 230, 244, 261 mandible, 126, 127, 141, 197, 201, 206, 237, 238, 239, 277 manipulation, 44 mapping, 126, 133 market, 104 marrow, 147
295
masseter, 237, 238, 279 mastication, 157, 163 matrix, 17, 72, 84, 87, 91, 122, 221 matrix metalloproteinase, 84 maturation, 55, 215 maxilla, xiii, xiv, 126, 127, 196, 201, 206, 214, 229, 230, 237, 240, 243, 246 maxillary sinus, ix, xiv, 229, 230, 232, 239, 242, 243, 246, 283 MBI, 139 meals, 12 measurement, 3, 17, 25, 36, 39, 82, 131 measures, 165, 169 media, 234 median, xii, 13, 96, 155, 158, 159, 160, 161, 163, 166, 170, 171, 172 medical care, 53 medicine, 145, 246 melanoma, ix, 17, 18, 22, 25, 26, 31, 39, 40, 41, 45, 123, 214, 232 membranes, 99, 103, 104 men, 52, 53 meningioma, 223, 228, 233 messenger ribonucleic acid, 46 messenger RNA, 48 meta-analysis, 112, 167, 168, 169, 175 metabolic changes, 23 metabolic pathways, 24, 34, 253 metabolism, xv, 23, 29, 45, 47, 89, 103, 141, 142, 247, 248, 250, 251, 252, 254, 260, 262 metabolites, xv, 29, 41, 110, 247, 248, 249, 251, 252, 253, 256, 257 metabolizing, 252, 253, 254, 257, 259 metallothionein, x, 11, 31, 49, 50 metals, 31, 49 metastasis, ix, x, 9, 12, 13, 14, 21, 22, 31, 34, 40, 47, 53, 54, 55, 56, 58, 62, 65, 68, 71, 72, 73, 74, 76, 77, 79, 80, 81, 82, 83, 89, 90, 91, 93, 108, 121, 122, 130, 140, 143, 144, 145, 147, 153, 220, 224, 228, 256, 260, 264 metastatic cancer, 215, 221 metastatic disease, 148 methylation, 76, 77, 92, 93 MHC, 110, 123 mice, 3, 9, 25, 38, 41, 45, 46, 109, 111, 114, 259, 283 microarray, 34, 52 microcirculation, 280 microenvironment, 27, 43 micrometer, 59, 265
296
Index
microscope, ix, 18, 239 microscopy, 3, 56, 60, 265 migration, 16, 17, 29, 31, 47, 71, 72, 75, 91, 160, 180, 265 milk, 106 minority, 171 mitochondria, 103 mitochondrial membrane, 251 mitogen, 43 mitosis, 40, 67 mitotic, 46, 217 mixing, 103, 107 mobility, 72, 165 models, 109, 270 modulus, 190 moieties, 99 molecular biology, 86 molecular oxygen, 250, 251 molecular weight, 99, 105 molecules, 32, 46, 49, 72, 74, 75, 92, 100, 110, 111, 250 monoclonal antibodies, 64 monoclonal antibody, 17, 36, 37, 38, 87 monocytes, 27, 47 monomer, 72, 90 Moon, 207 morbidity, xii, xiii, xv, 163, 165, 167, 177, 183, 184, 192, 193, 195, 197, 204, 207, 208, 242, 275 morphology, 213, 214 mortality, xii, 52, 53, 78, 155, 159, 163, 164, 165, 167, 168, 170, 179 mortality rate, xii, 52, 53, 155, 160, 164, 168 movement, 187, 196 MRI, xi, xiv, 125, 126, 133, 134, 137, 139, 141, 146, 148, 151, 152, 211, 213, 214, 245 mRNA, 31, 66, 97, 100, 108, 111, 120, 251 mucin, 217 mucoid, 217 mucosa, ix, 8, 9, 36, 54, 59, 63, 68, 70, 75, 81, 84, 89, 118, 126, 213, 223, 225, 239, 242, 249, 273, 274, 280, 283 mucus, 217 multiple factors, 133 multivariate, 55, 60, 76, 266 muscles, 126, 131, 132, 166, 199, 201, 237, 238, 277, 278 musculoskeletal system, 194 mutant, 17, 39, 43, 108, 115, 121, 257, 260, 264 mutation, xv, 22, 29, 90, 93, 253, 263, 264, 269, 270, 271, 272, 273, 274
mutation rate, 270 mutations, xv, 60, 66, 70, 76, 85, 93, 99, 108, 117, 263, 264, 265, 268, 270, 271, 272, 273, 274
N N-acetyltransferase (NAT), xv, 247, 248 nanoparticles, 97, 99, 100, 102, 104, 106, 107, 111, 112, 117, 120, 123 nasal cavity, ix, 242 nasogastric tube, 157, 158, 162, 176, 178 nasopharyngeal carcinoma, 113, 114, 115, 244 nasopharynx, 233, 240, 241, 242 NATO, 49 neck cancer, 108, 253 necrosis, 25, 39, 40, 130, 147, 164, 209, 215, 283 neoplasia, 66, 90, 221, 223, 264 neoplasm, xv, 54, 126, 212, 213, 214, 217, 220, 223, 226, 240, 247, 248 neoplastic cells, 59, 60, 61, 64, 65, 66, 72, 77, 217, 220 neoplastic tissue, 74, 251, 262 neovascularization, x, 11, 12, 16, 17, 18, 19, 21, 24, 27, 31, 71 nerve, 137, 138, 160, 205, 230, 234, 239, 278 nerves, 126, 230, 234 Netherlands, 253, 255 network, 40, 273, 276, 279, 281 neural tissue, 234 neuralgia, 137 neuroblastoma, 231 neurofibroma, 243 neuroimaging, 245 neurological disease, 166 neurological disorder, 156 neutral lipids, 102 New York, 80, 193, 207, 209 nickel, 236 nitric oxide, 23, 24, 44 nitric oxide synthase, 24 nitrogen, 249, 250 nitrosamines, 249, 250, 254 NK cells, 109 nodes, 130, 133, 134, 138, 139, 144, 146, 148, 150, 215 nodules, 151, 245 non-Hodgkin’s lymphoma, 226 normal development, 46 normal distribution, 15 North America, 12
Index Northern Ireland, 86 notochord, 220 nuclei, 14, 55, 215, 217, 218, 220 nucleic acid, 103, 111, 123 nucleophiles, 250 nucleotide sequence, 120, 251 nucleus, 23, 55, 66, 67, 98, 111, 218, 223 nutrition, 16, 156, 157, 163, 164, 175, 177, 178, 181 nutritional supplements, 177
O obesity, 159, 166, 167 observations, 67 obstruction, 157, 160, 163, 164, 166, 168 ODN, 96, 111 oil, 3, 8, 99 older adults, 176 olefins, 249 oligodeoxynucleotides, 111, 119 oncogene, xi, xv, 37, 84, 95, 107, 122, 263, 265, 267, 268, 272, 273 oncogenes, 66, 264 oncogenesis, 99 opacification, 232 operator, 141, 167, 169 optic nerve, 240 optimization, 97 oral cancers, ix, xi, 52, 75, 88, 96, 125, 126, 128, 131, 132, 134, 138, 141, 142, 144, 145, 166, 227, 249, 272 oral cavity, xii, xiv, 10, 53, 54, 67, 68, 69, 74, 79, 80, 81, 82, 83, 84, 85, 86, 88, 89, 90, 92, 126, 128, 133, 141, 145, 146, 155, 157, 158, 165, 181, 211, 212, 214, 215, 216, 218, 220, 221, 225, 226, 227, 228, 230, 232, 236, 248, 251, 256, 257, 259, 272, 273, 274 oral leukoplakia, 87, 255, 258, 261 orbit, 232, 237, 240, 242 organ, 14, 17, 118, 143, 251 organic chemicals, 250 organization, 41, 72 orientation, 233 oropharynx, xii, 52, 53, 54, 68, 69, 82, 85, 86, 88, 145, 146, 155, 157, 163, 166, 170, 171, 181, 232, 233, 274 osteosarcoma, 96 osteotomy, xii, xiii, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 195, 196, 197, 198, 200, 202, 203, 205, 206, 239
297
otolaryngologist, 157, 167 ovarian cancer, 18, 29, 260 oviduct, 106 oxidation, 250, 253 oxidative damage, 32 oxidative stress, 31 oxygen, 16, 17, 18, 19, 20, 23, 25, 26, 32, 39, 40, 41, 42, 43, 44, 45 Oxygen, 17, 26, 40, 41, 49 oxygen consumption, 23 oxygen sensors, 41
P p53, 15, 22, 24, 35, 36, 37, 60, 65, 66, 69, 76, 85, 86, 88, 89, 90, 99, 106, 108, 113, 114, 119, 121, 260, 264, 265, 267, 271, 272, 273, 274 paclitaxel, 96 pain, 239 palliative, 159, 166 palliative care, 159 palpation, 68, 139, 158, 236 pancreas, 62 pancreatic cancer, 25 parameter, 40, 55 Paris, 209 parotid, xiv, 135, 139, 146, 149, 150, 151, 216, 218, 229, 233, 237, 238, 276, 279 parotid gland, xiv, 135, 139, 146, 150, 216, 218, 229, 233, 237, 238, 279 particles, 99, 101, 102, 120, 134, 149 pathogenesis, 61, 83, 85 Pathologists, 57 pathology, xi, xii, xiv, 14, 38, 125, 138, 147, 148, 155, 167, 170, 171, 229, 230, 245 pathophysiology, 41 pathways, 24, 75, 76 patient management, 168, 170, 245 PCR, 60, 224, 251, 265, 266 pectoralis major, 281 peptides, 110 perception, 53 perforation, 157 performance, 131, 175 perfusion, 17, 18, 23, 26, 40, 205, 279 periodontal, 147 periosteum, 185, 239 peripheral vascular disease, xiv, 196, 206 peritonitis, 166 permeability, 16, 21, 22, 31, 38, 46, 48, 71, 100, 249
298
Index
permit, 8 personal, 167, 192, 204 personal communication, 204 PET, xii, 126, 131, 141, 142, 143, 144, 145, 152, 153, 213, 215 pH, 9, 106, 119, 120, 265, 266 pharmaceuticals, 104 pharynx, xiv, 79, 141, 143, 165, 211, 214 phenotype, 70, 72, 73, 75, 98, 109, 257, 271 phenotypes, 257 phosphatidylethanolamine, 96, 101, 102, 106 phosphorylase, x, 11, 29, 43, 46, 47, 48, 49 phosphorylation, 29, 65, 141 photosensitivity, 2 physiology, 41 pilot study, 93, 260 placenta, 16, 28, 39, 41, 46, 48, 90, 118 planning, 214, 278 plasma, 10, 103, 118 plasma membrane, 118 plasmid, 97, 99, 106, 107, 108, 109, 110, 111, 115, 116 Plasmids, 97 plasminogen, 17, 35 Platelet, 47, 48 platelet count, 166 plexus, 104, 118, 278, 279, 280 ploidy, 37 PM, 10, 63, 78, 79, 89, 92, 145, 146, 147, 227, 245 pneumonia, 167 point mutation, 66, 253 polarity, 75 polyacrylamide, 266 polycyclic aromatic hydrocarbon, 249 polyethylene, 119 polyethylenimine, 106 polymer, 103 polymerase, 97, 265, 266, 272 polymerase chain reaction, 272 polymers, 100, 103, 115 polymethylmethacrylate, 186 polymorphism, 57, 253, 254, 255, 256, 257, 258, 260, 261, 262 polymorphisms, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261 poor, x, xiv, 2, 11, 12, 13, 14, 16, 19, 30, 32, 54, 58, 66, 68, 70, 71, 73, 75, 76, 85, 89, 90, 91, 99, 163, 164, 165, 169, 174, 180, 196, 206, 222, 223, 264, 271, 272, 274
population, 34, 45, 67, 69, 79, 166, 167, 218, 220, 248, 249, 254, 255, 256, 257, 258, 277, 279, 280 porphyrins, 9 portal hypertension, 166 Portugal, 272, 273 positive correlation, x, 11, 18, 19, 21, 29, 64 positron, xii, 43, 126, 141, 152, 153, 213, 215 positron emission tomography, xii, 43, 126, 141, 152, 153, 213, 215 posterior cortex, 204 precancerous lesions, 212, 214, 224 predictability, 278, 279 prediction, xi, 52, 55, 215, 264 predictors, 34, 55, 64, 171 preference, xiii, 167, 192, 195, 196, 206 preservative, 213 pressure, 8, 100, 199, 204, 208, 280 prevention, 78, 175, 205, 224, 258, 259 primary tumor, 34, 47, 54, 55, 60, 63, 72, 76, 77, 141, 180, 215, 224 private practice, 227 probability, 31, 105, 266 probe, 141, 279 prodrugs, 110 production, 2, 41, 97, 99, 109, 145 prognosis, x, xi, 11, 12, 13, 14, 16, 19, 21, 22, 30, 31, 32, 33, 34, 35, 36, 45, 47, 48, 51, 52, 53, 54, 55, 56, 57, 58, 60, 61, 64, 65, 66, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 80, 81, 82, 85, 86, 89, 90, 91, 108, 130, 176, 245, 264, 268, 271, 272, 274 prognostic value, xv, 37, 55, 56, 57, 60, 61, 64, 67, 70, 78, 81, 263, 264, 268 program, 70 proliferation, x, xi, 11, 14, 15, 16, 17, 20, 22, 26, 29, 33, 36, 37, 38, 41, 43, 51, 52, 62, 66, 67, 68, 69, 70, 71, 72, 87, 88, 90, 107, 108, 109, 111, 116, 273 promote, 111, 260, 279 promoter, 75, 76, 77, 93, 97, 98, 113, 116, 117 promoter region, 75, 77, 97 propane, 100, 101 prophylactic, xiii, 184, 192, 195, 198, 206, 207, 208 prophylaxis, 157, 176, 179 prostaglandins, 251 prostate, 37, 43, 62, 111, 117, 122, 218, 252, 262 prostate cancer, 37, 117, 122, 262 protein, x, 9, 12, 24, 28, 29, 31, 33, 37, 41, 42, 43, 44, 46, 62, 65, 66, 67, 69, 70, 76, 80, 84, 86, 87, 89, 91, 97, 100, 103, 108, 109, 110, 111, 118, 119, 250, 251, 253, 261, 264, 271, 272, 273
Index protein kinase C, 91 protein kinases, 28 protein sequence, 251 protein synthesis, 43, 103 proteinase, 265 proteins, 14, 21, 23, 24, 31, 34, 61, 70, 72, 74, 75, 86, 87, 89, 99, 103, 108, 118, 251, 256, 272, 274 proteolysis, 23 protocols, 265 proto-oncogene, 69 pterygopalatine foss, xiv, xv, 229 pulse, 100, 147 pulses, 100 pyrene, 252, 256 pyrimidine, 46, 103
Q quality of life, 54, 157, 164, 165, 166, 169, 178
R race, 12, 268 radiation, xi, 15, 26, 32, 35, 38, 45, 53, 82, 96, 108, 119, 121, 125, 139, 152, 153, 177, 180, 215, 280, 283 Radiation, 11, 146, 215, 226, 274 radiation therapy, xi, 35, 82, 96, 125, 152, 153, 177, 180 radio, 57, 60, 152 radiography, 147, 236 radiotherapy, xi, xii, 2, 13, 16, 25, 32, 37, 40, 45, 48, 49, 52, 60, 64, 68, 80, 85, 95, 108, 114, 116, 119, 121, 134, 135, 138, 139, 141, 148, 150, 155, 156, 157, 158, 159, 161, 162, 163, 169, 170, 171, 172, 173, 174, 180, 215, 264, 271, 272, 274, 281 radius, xiii, 184, 185, 191, 192, 193, 194, 196, 197, 198, 199, 204, 205, 207, 208, 209 range, xiii, xv, 13, 15, 103, 104, 141, 159, 170, 186, 195, 197, 203, 206, 233, 263, 267, 277 reactive oxygen, xv, 247, 248, 250 reading, 187 reality, 209 receptors, xi, 27, 28, 38, 46, 48, 62, 84, 95, 97, 103, 117, 118 recognition, 97, 109, 122 recombination, 99 reconstruction, xii, xiv, xvi, 52, 127, 131, 149, 156, 158, 159, 160, 165, 169, 170, 171, 172, 173, 174,
299
185, 189, 190, 192, 193, 197, 199, 201, 203, 206, 207, 208, 209, 210, 229, 234, 241, 246, 275, 276, 277, 278, 279, 280, 281, 282 recovery, 45, 158, 163, 172, 174 rectum, 160 rectus abdominis, 242 recurrence, xv, 36, 47, 64, 68, 69, 72, 73, 74, 79, 82, 91, 133, 141, 152, 215, 224, 227, 263, 264, 265, 268, 271, 274 recycling, 104 redistribution, 26 reduction, 66, 75, 76, 169, 171, 184 redundancy, 24, 34, 43 reflection, 237, 270 reflexes, 168 refractory, x, 12, 22, 25, 96, 274 regional, xv, 44, 54, 55, 57, 58, 60, 65, 72, 76, 77, 82, 99, 146, 193, 209, 240, 275, 277 regression, xv, 108, 109, 110, 119, 121, 263, 268 regression analysis, xv, 263, 268 regulation, 23, 24, 31, 39, 41, 42, 43, 66, 69, 75, 86, 87, 89, 92, 108, 109, 111, 118, 121, 259, 279 regulators, 89, 111 rehabilitation, 165, 177, 178 reinforcement, xiii, 183, 185, 189, 190, 191, 192, 198, 199, 202, 204 rejection, 110 relapses, 57, 60 relationship, xii, 2, 16, 20, 21, 24, 25, 26, 29, 30, 31, 37, 39, 40, 60, 61, 64, 65, 66, 68, 69, 70, 71, 73, 74, 76, 89, 93, 130, 135, 136, 155, 163, 171, 172, 212, 214, 234, 254, 258, 265, 277, 279 relationships, 14, 22, 26, 31, 33, 36, 40, 64, 69, 73, 257 relatives, 248 relevance, 44, 85, 88, 90 reliability, 242, 245 remodeling, 38, 71 remodelling, 205, 209 renal cell carcinoma, 29, 47, 48, 104 repair, x, 11, 33, 65, 204, 279 replication, 65, 250 resection, xii, xiv, 52, 60, 79, 140, 144, 145, 155, 160, 161, 162, 163, 165, 169, 172, 173, 174, 175, 229, 237, 239, 241, 246, 277 residues, 62 resistance, 22, 25, 26, 32, 44, 49, 59, 97, 117, 271 resolution, 131, 144, 148, 234 respiratory, 80, 165, 168, 169 respiratory problems, 165
Index
300
responsiveness, 70 retention, 165 reticulum, 251 retinoblastoma, 65, 108 retinoic acid, 117 retroviruses, 98 RF, 78, 128 rigidity, 209 risk, xii, xv, 2, 60, 66, 68, 70, 73, 74, 77, 78, 79, 80, 82, 86, 88, 91, 155, 157, 160, 163, 164, 166, 167, 168, 169, 171, 173, 179, 180, 184, 192, 194, 198, 204, 205, 212, 215, 224, 236, 239, 247, 248, 249, 250, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 274 risk assessment, 180, 258 risk factors, xv, 78, 79, 166, 179, 194, 212, 247, 248, 261 RNA, 96, 97, 110, 111, 124 RNA processing, 110 RNAi, 96, 111
S SA, 9, 44, 78, 86, 147, 153, 176, 179, 246, 259, 273 safety, 99 saliva, 9, 106, 134 salivary glands, xiv, 52, 53, 54, 126, 134, 149, 211, 212, 218, 222, 225, 226 salts, 32 sample, ix, 2, 3, 4, 53, 66, 79, 136, 188, 189, 213, 224, 257, 265, 267, 270 saturation, 128, 131, 132, 147 scapula, 193, 208 scatter, 90 science, 194, 280 scientific community, 264, 270 scores, 165, 169 search, xv, 275 secrete, 39 secretion, 17, 72, 97, 106 sedimentation, 213 segregation, 118 selecting, 31, 57 selectivity, 2, 112 self-assembly, 107 sensing, 43 sensitivity, xiv, 49, 61, 63, 64, 111, 123, 139, 212, 215, 221, 222, 223, 224, 236 sensitization, 26, 121 separation, 237
sequencing, 270, 272 series, xii, xiii, 53, 55, 68, 70, 71, 79, 102, 155, 157, 165, 167, 168, 170, 171, 184, 195, 197, 204, 206, 270, 271 serum, 8, 99, 108, 120, 283 severity, 63, 67, 88, 167, 205 sex, 53, 76, 265 shape, 126, 130, 193, 197, 201, 207, 215, 233 sharing, 190, 193, 207 sheep, xii, 183, 184, 185, 191, 192, 193, 196, 204, 207 shock, 280, 283 shock waves, 280 sialography, xi, 125, 126, 134, 145, 149 side effects, 8, 109 signal transduction, 46, 62, 74, 123 signaling, 28, 29, 34, 42, 45, 62, 64, 65 signaling pathway, 28, 29, 34, 42 signaling pathways, 28, 29, 34 signalling, 90 signals, 46, 61, 70, 131, 138, 265 significance level, 267 silver, 265, 274 similarity, 42, 55, 251, 255 Singapore, 244 sinus, 230, 232, 233, 239, 240, 241, 242 sinuses, 127, 128, 230, 232, 233, 240, 244, 246 sinusitis, 164 siRNA, 96, 111 sites, xiii, 46, 97, 107, 120, 123, 130, 149, 159, 162, 163, 168, 171, 184, 192, 193, 195, 196, 197, 201, 202, 203, 204, 205, 206, 210, 212, 214, 215, 221, 257, 268, 270 Sjögren’s syndrome, 134 skin, 2, 8, 9, 10, 45, 199, 200, 202, 204, 236, 238, 276, 277, 278, 279, 280, 283 sleep apnea, 213, 225 smoke, 249, 260 smokers, xv, 250, 263, 267 smoking, 163, 249, 253, 254, 255, 258, 260, 270 SNP, 256 sodium, 3, 120 soft palate, 80, 213, 216, 217, 225 soft tissue tumors, 151 software, 266 solid tumors, 26, 39, 43, 44, 54, 111 solubility, 252 somatic mutations, 75, 260 Spain, 51, 52, 78, 263, 264 species, xv, 247, 248, 250, 252, 253, 260
Index specificity, xiv, 64, 97, 99, 113, 118, 119, 139, 212, 215, 221, 223, 224, 236, 252 spectrophotometer, ix, 2, 3, 4 spectroscopy, 2 spectrum, xiv, 4, 5, 211, 214, 270 speech, 157, 164, 171 spin, xi, 125, 136, 137, 138, 149 spindle, 218, 220 splint, 208 SPSS, 267 Sri Lanka, 254, 262 St. Louis, 145, 146 stability, 97, 101, 186, 197 stabilization, 42, 99, 261 stabilizers, 97 stages, xv, 54, 55, 56, 66, 68, 75, 171, 212, 248, 263, 264, 267, 268, 271, 272 standard error, 187 Staphylococcus, 159, 180 starvation, 163 statistical analysis, 188, 279 statistical inference, 187 statistics, 112, 224 steel, 187, 190, 194, 201, 203, 209 stem cells, 280 stenosis, 12, 166 sterile, 158 steroids, 251 stock, 205, 210 stoma, 168, 170 stomach, 8, 76, 158 S-transferase (GST), xv, 247, 248 strategies, xi, 52, 63, 64, 95, 98, 107, 175, 176, 206, 258, 268 stratification, 55 strength, xiii, 98, 183, 184, 185, 187, 188, 189, 190, 191, 192, 193, 196, 197, 204, 205, 207, 208 stress, 33, 163, 186, 190, 191, 194, 196, 204, 205, 208, 209 stroke, 165, 176, 178 stroma, 17, 38 stromal cells, 283 subcutaneous tissue, 277 subgroups, 161, 163, 176 substitution, 253 substrates, 250, 251, 253 success rate, 167, 178 suicide, 98, 110, 114, 117 Sun, 178 superimposition, 136
301
supervision, 8 supply, xv, 20, 23, 233, 275, 276, 277, 279 suppression, 76, 108, 109, 110, 111, 122, 123, 131, 132, 147, 148 surface area, 45, 57 surface layer, 55 surfactant, 4 surfactants, 102 Surgeons, 168, 194 surgical resection, 79, 170, 171, 172 surveillance, 122 survival, xi, xiv, 12, 13, 26, 28, 30, 34, 36, 37, 41, 43, 45, 49, 51, 52, 53, 54, 55, 56, 57, 58, 60, 64, 65, 66, 68, 70, 71, 74, 76, 79, 80, 82, 86, 89, 95, 96, 109, 158, 163, 180, 211, 212, 265, 266, 268, 270, 271, 272, 277, 280, 282 survival rate, xi, xiv, 12, 30, 51, 52, 53, 54, 55, 58, 60, 68, 96, 211, 212 Survivin, 70, 89 susceptibility, xv, 236, 247, 248, 252, 253, 255, 256, 257, 258, 259, 260, 261, 262 suture, 160, 164, 170 SUV, 141, 144, 145 swallowing, 157, 163, 164, 166, 171, 172 Sweden, 265 swelling, 130, 215, 217, 219, 220 symptoms, 10 syndrome, 149, 168, 180, 213, 225 synthesis, 8, 23, 65, 103, 106, 107, 110 systemic circulation, 31, 107 systems, 34, 56, 77, 97, 99, 100, 101, 103, 105, 110, 116, 223
T T cell, 122, 123 T lymphocyte, 109 Taiwan, 79, 85, 256, 258 targets, 111, 259, 261 taxanes, 96 T-cell, 109 technology, xiv, 34, 224, 225, 229, 230, 234 temperature, 266 tension, 17, 18, 19, 20, 23, 25, 26, 40, 41, 42, 44, 168, 190, 193, 208 teratoma, ix ternary complex, 106, 107 territory, 279, 280 Tesla, 128 Texas, 27, 151
302
Index
textbooks, 53 TGF, 62, 63, 65, 116, 121 Th cells, 123 T-helper cell, 109 theory, 15, 209, 271 therapeutics, 103 therapy, ix, xi, 1, 2, 8, 9, 10, 32, 35, 44, 78, 79, 82, 89, 95, 96, 97, 98, 102, 107, 109, 110, 111, 112, 113, 115, 116, 120, 122, 124, 146, 166, 178, 234, 236, 264, 268, 280, 282, 283 thinking, 280 threshold, 66, 133, 168, 173 thymidine, x, 11, 29, 43, 47, 48, 49, 96, 98, 110, 114, 117, 120, 123 thymine, 253 thyroid, 139, 151 thyroid gland, 139, 151 tibia, xii, xiii, 183, 184, 185, 186, 190, 191, 192, 193, 196, 204, 207, 209 time, x, xii, 2, 3, 9, 55, 64, 67, 68, 129, 131, 132, 133, 134, 135, 155, 159, 168, 169, 170, 171, 174, 175, 183, 200, 203, 237, 257, 266, 267, 268, 278 timing, 8, 158, 169, 176 TIR, 131 tissue, ix, xii, xiii, xv, 1, 2, 5, 6, 7, 8, 9, 14, 15, 17, 18, 19, 20, 21, 23, 25, 26, 27, 29, 31, 39, 44, 47, 58, 59, 60, 64, 66, 67, 72, 73, 74, 77, 92, 97, 99, 100, 103, 104, 105, 113, 118, 126, 128, 129, 133, 141, 143, 149, 150, 155, 161, 162, 163, 172, 185, 195, 196, 206, 213, 218, 222, 231, 234, 236, 240, 241, 246, 251, 254, 260, 265, 275, 277, 280, 281, 283 tissue plasminogen activator, 265 titanium, 185, 186, 189, 190, 194, 201, 203, 209 TNF, 111 TNF-α, 111 tobacco, xv, 85, 126, 177, 212, 247, 248, 249, 250, 252, 255, 256, 257, 261, 272, 273, 274 tobacco smoke, 249, 256, 257 tobacco smoking, 261 Tokyo, 3, 4, 46, 95, 120, 126, 127, 128, 129, 209, 259 tongue, ix, xi, xiv, xv, 1, 2, 3, 5, 6, 7, 8, 9, 10, 54, 55, 57, 58, 64, 68, 73, 74, 76, 78, 79, 80, 81, 82, 83, 84, 88, 91, 92, 93, 108, 114, 125, 135, 140, 141, 142, 143, 144, 145, 148, 149, 151, 152, 165, 171, 211, 214, 215, 216, 218, 222, 223, 226, 227, 251, 255, 263, 267, 272, 274 tonsils, 141, 143 toxicity, ix, 1, 2, 102, 104, 109
TPA, 265 tracheostomy, 159, 168, 169 training, 167 traits, 56 transcription, 23, 42, 43, 65, 77, 97, 98, 122, 254 transcription factors, 77 transcripts, 251 transducer, 141, 187 transduction, 100, 110, 113 transfection, xi, 26, 95, 97, 99, 101, 102, 105, 106, 107, 108, 109, 111, 112, 116, 117, 120, 122, 123 transferrin, xi, 95, 97, 103, 107, 120, 121 transformation, 30, 66, 67, 70, 73, 74, 86, 87, 122, 212, 258 transformations, 270 transforming growth factor, 62, 65, 84, 121 transgene, 97, 112 transgenic, 259 transition, 65, 66 translation, 97, 111 translocation, 164, 240, 241, 246 transmembrane glycoprotein, 74 transplantation, 283 transport, 97, 103, 104, 118, 213 trapezius, 281 trauma, xii, 147, 155 trend, 212 trial, 35, 114, 117, 136, 149, 157, 165, 169, 176, 177, 178, 179, 206 trigeminal nerve, 136, 137, 138, 149, 230 trigeminal neuralgia, 137, 138 triggers, 116 tumor cells, 16, 27, 32, 39, 47, 49, 57, 58, 61, 71, 72, 73, 97, 98, 100, 101, 103, 106, 107, 108, 109, 110, 119, 122, 214, 215, 217, 218, 221 tumor depth, 58 tumor growth, xi, 16, 23, 24, 25, 27, 29, 34, 38, 43, 45, 47, 52, 69, 90, 108, 109, 110, 111, 112, 115, 122 tumor invasion, 15, 58, 68, 69, 73, 77 tumor metastasis, 36, 88 tumor necrosis factor, 115 tumor progression, 44, 64, 69, 70, 72, 73, 86, 92 tumor proliferation, 37 tumor resistance, 45 tumorigenesis, 84, 108 tumors, ix, xi, xiv, xv, 1, 2, 3, 17, 20, 24, 25, 26, 31, 33, 34, 38, 39, 40, 41, 43, 44, 46, 48, 53, 54, 55, 56, 57, 58, 59, 60, 62, 63, 64, 65, 68, 71, 73, 74, 75, 76, 77, 79, 82, 95, 97, 104, 105, 108, 109,
Index 119, 120, 122, 125, 126, 129, 131, 133, 136, 137, 141, 145, 175, 177, 211, 213, 214, 216, 218, 222, 226, 227, 230, 231, 232, 236, 237, 239, 240, 244, 245, 246, 260 tumour growth, 39 tumours, xii, xv, 9, 36, 40, 41, 80, 121, 147, 150, 151, 155, 156, 161, 165, 166, 169, 170, 171, 172, 173, 174, 175, 224, 263, 264, 265, 267, 268, 271 tyrosine, 27, 45, 46, 62, 64
U UK, 52, 155, 157, 185, 187, 201 ulcer, 216 ulceration, 13 ulna, 194, 199, 209 ultrasonography, 126, 138, 139, 140, 141, 142, 144, 151, 152, 236 ultrasound, xi, 125, 141, 149, 150, 151, 157, 169, 205, 236, 245, 279 uncertainty, 18 uniform, 9, 17, 20, 22, 26, 187, 217, 218 United Kingdom, 183, 195, 200, 205 univariate, 55, 60, 76 urea, 266 urinary tract, 166 urinary tract infection, 166 urokinase, 35 users, 256, 273 uterus, 118 UV, 9
303
VEGF, x, 11, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 38, 39, 42, 44, 45, 46, 48, 71, 90, 280 VEGF expression, x, 11, 15, 18, 19, 20, 21, 23, 24, 26, 29, 30, 31, 42, 71 vein, 277, 278, 280 vesicle, 117 vessels, xi, 17, 18, 22, 26, 45, 71, 125, 126, 131, 136, 138, 145, 234, 276, 277, 282 vimentin, 37 viral vectors, xi, 95, 97, 99, 102, 103, 109, 112 virus, 96, 97, 98, 99, 107, 110, 112, 114, 115, 117, 120, 121, 123 viruses, 83, 98, 99, 280 vision, 157 visualization, xiv, 127, 138, 213, 229, 239, 240, 244
W weakness, 25 web, 159, 160, 167 weight gain, 165, 174 weight loss, 163, 164, 169, 171, 174, 180 WHO, 54 windows, 127 women, 52, 53, 194 World Health Organization, 212 World Health Organization (WHO), 212 wound healing, 17, 23, 38, 280, 283 wound infection, 160, 202
X V validity, 241 valine, 253 values, 5, 8, 15, 58, 133, 170, 191, 221, 223, 266 variability, 188 variable, 107, 167, 169, 171, 190, 205, 233, 264 variable factor, 205 variables, xv, 36, 83, 91, 263, 265, 267, 268, 270 variation, 15, 16, 53, 60, 64, 66, 141, 187, 212, 215, 221, 252, 253, 260 vascular endothelial growth factor (VEGF), x, 11, 39, 71, 280 vasculature, 10, 239 vector, 97, 99, 100, 106, 108, 110, 112, 113, 115, 123
xenobiotics, 250, 251, 252, 253 xenografts, 9, 17, 18, 20, 22, 25, 26, 27, 31, 39, 40, 47, 100, 108, 109, 110, 111, 121 xerostomia, xi, 125, 134, 145, 163
Y yield, 170, 190, 213, 253 young adults, 78, 82
Z zygomatic arch, 237, 238, 239, 279