Phenotypic Variation
This page intentionally left blank
Phenotypic Variation Exploration and Functional Genomics
M...
85 downloads
1352 Views
1002KB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
Phenotypic Variation
This page intentionally left blank
Phenotypic Variation Exploration and Functional Genomics
Moyra Smith, MD, PhD, MFA
1
2011
1 Oxford University Press, Inc., publishes works that further Oxford University’s objective of excellence in research, scholarship, and education. Oxford New York Auckland Cape Town Dar es Salaam Hong Kong Karachi Kuala Lumpur Madrid Melbourne Mexico City Nairobi New Delhi Shanghai Taipei Toronto With offices in Argentina Austria Brazil Chile Czech Republic France Greece Guatemala Hungary Italy Japan Poland Portugal Singapore South Korea Switzerland Thailand Turkey Ukraine Vietnam
Copyright © 2011 by Oxford University Press, Inc. Published by Oxford University Press, Inc. 198 Madison Avenue, New York, New York 10016 www.oup.com Oxford is a registered trademark of Oxford University Press All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted, in any form or by any means, electronic, mechanical, photocopying, recording, or otherwise, without the prior permission of Oxford University Press. Library of Congress Cataloging-in-Publication Data Smith, Moyra. Phenotypic variation: exploration and functional genomics / Moyra Smith. p.; cm. Includes bibliographical references. ISBN 978-0-19-537963-1 1. Phenotype. 2. Phenotypic plasticity. 3. Genomics. I. Title. [DNLM: 1. Genetic Variation. 2. Phenotype. 3. Congenital Abnormalities—genetics. 4. Genomics. 5. Nervous System Diseases—genetics. QU 500 S655p 2010] QH438.5.S65 2010 576.5’3–dc22 2010004048
9 8 7 6 5 4 3 2 1 Printed in the United States of America on acid-free paper
Now that we have begun exploring in earnest, doing serious science, we are getting glimpses of how huge the questions are, and how far from being answered. —Lewis Thomas (1974)
This page intentionally left blank
PREFACE
During the past two decades, international collaborative studies have yielded extensive information on genome sequences, genome architecture, and their variations. The challenge we now face is to understand how these variations impact structure and function of organelles, physiological systems, and phenotype. The goal of this book is to present steps in the pathways of exploration to connect genotype to phenotype and to consider how alterations in nuclear and mitochondrial genomes impact disease. The information presented is primarily derived from papers published between 2006 and 2009. Several chapters in this book present information derived from new technologies such as microarray analyses that facilitate population genetic studies and case control studies that include thousands of individuals. These studies are shedding light on the roles of nucleotide polymorphisms and mutations and structural variation in the causation of phenotypic variation and disease. Enhanced capabilities of RNA and protein analysis continue to shed light on regulation of expression through mechanisms that impact transcription, mRNA splicing, and control of translation. Perturbations of these processes that lead to disease are presented in one chapter. vii
viii
Preface
In searching for disease causation, it is important to consider not only the nuclear genome but also the mitochondrial genome. Variations in the mitochondrial genome also impact response to environmental perturbations. I present aspects of mitochondrial genome structure and function. As our capacity to analyze proteins increases, we continue to gain insight into post-translational aspects of gene expression and protein surveillance mechanisms that exist in the cell. I review aspects of these mechanisms and their role in origin of late-onset degenerative diseases. Examples of the contribution of functional genomic studies to understanding disease pathogenesis are included in chapters on developmental defects and malformation syndromes, neurodevelopmental disorders and neurobehavioral disorders. To explore aspects of environmental impact on phenotype, I present examples of how individuals with specific genotype variations show differences in their response to specific infectious agents and to treatments. I believe this book will be of interest to medical professionals and to all who are interested in genetics and biology. Moyra Smith University of California, Irvine
ACKNOWLEDGMENTS
I wish to first acknowledge my gratitude to Lionel Penrose who many years ago encouraged me to pursue graduate studies in human genetics and to Harry Harris who admitted me to the Galton laboratory at University College London for that purpose. I am grateful to mentors Malcolm Ferguson-Smith, Kurt Hirschhorn, and Victor McKusick and to unofficial mentors, colleagues, students, and patients who taught me much over the years. Preparation of this book would not have been possible without the amazing resources of the University of California library service. Finally, I wish to thank Bill Lamsback for encouragement early on in this project and Tracy O’Hara, editor at Oxford University Press for her guidance and patience. MS
ix
This page intentionally left blank
CONTENTS
1.
Phenotype and Functional Genomics: Introduction, 3
2.
Evolution, 16
3.
Genomic Architecture and Copy Number Changes, 35
4.
Linkage, Association, and Linkage Disequilibrium, 54
5.
Regulation of Transcription, Splicing and Translation: Impact of Perturbation on Phenotype, 68
6.
Mitochondria: Genome, Functions, and Phenotype, 94
7.
Quality Surveillance, 121
8.
Neurodevelopment and Functional Genomics, 139
9.
Neurobehavioral Disorders, 162
10.
Molecular Analyses of Malformation Syndromes, 181
xi
xii
Contents
11.
Multiple Pathways including Environmental Factors that Lead to a Specific Phenotype with Later Onset, 189
12.
Epilogue, 197 References, 200 Index, 229
Phenotypic Variation
This page intentionally left blank
1 PHENOTYPE AND FUNCTIONAL GENOMICS Introduction
“Several observers to the current scene have commented that the human genome project is changing the approaches to biomedical research; that biomedical research will be progressively more integrated and integrative; that families of genes, not single genes, and physiologic systems, not single reactions will be the objects of study”. —Victor A. McKusick (1997)
The goal of functional genomics is to gain insight into mechanisms through which specific changes in genome transcripts and regulation induce changes in proteins, pathways, organelles, cellular and tissue functions, morphology, and ultimately in phenotype. The flow is bidirectional. Molecular analysis of phenotypes may reveal how known pathways are disrupted; as unusual phenotypes are analyzed, new information emerges revealing molecular pathways, gene interactions, and regulatory mechanisms that were previously unknown.
BACKGROUND Currently phenotypic analyses are carried out against the backdrop of genome information and they represent a continuum in progress to understand individual 3
4
Phenotypic Variation
differences, including differences between humans and differences between humans and other species. Topics selected for each of the chapters in this book have connections to activities of scientists and clinicians over the past 150 years who sought to understand phenotypic variations, defined initially as inherited and later as genetically determined. Some examples of these connections follow. Thomas Henry Huxley bravely published his book, Evidence as to Man’s Place in Nature in 1863; in this work he presented evidence of evolution of man and apes from a common ancestor. Evolution remains an exciting topic particularly as molecular genetics transform paleontology, and I present examples of discoveries in this area in Chapter 2. Francis Galton was fascinated by human phenotypic variation and promoted studies of twins. In 1875 he wrote of twins, “their history affords means of distinguishing between the effects of tendencies received at birth, and those that were imposed by the circumstances of their after lives, in other words between the effects of nature and nurture.” Detailed clinical information and pedigrees of patients and families with hereditary diseases were presented in the publications written primarily by Julia Bell between 1909 and 1958 in The Treasury of Human Inheritance. Peter Harper (2005) wrote of Julia Bell, “her combination of mathematical training, genetic knowledge and clinical expertise yielded numerous important insights into human inheritance first appearing in The Treasury.” Lionel Penrose and his students and collaborators during the 1950s utilized family data, including that compiled in publications of Julia Bell, to initiate linkage studies with the first known markers that showed differences between individuals, the human blood groups. In 1954 Penrose wrote, “The search for other linked characters is likely to prove a fruitful inquiry, because knowledge of the disposition of genes upon chromosomes will greatly help in classifying pedigrees of hereditary disease.” Penrose and colleagues developed methods for linkage analysis including sibling-pair analysis and nonparametric linkage analysis. Penrose also promoted the study of congenital malformations in humans; he was particularly interested in Down syndrome where congenital malformations occurred along with developmental delay and cognitive impairment. The structure of DNA was elucidated in 1953. It is interesting to note that studies of human chromosomes began in earnest later than this. The discovery of trisomy for chromosome 21 in Down syndrome (by Lejeune in 1959) had important implications. Studies of individual variation of proteins and enzymes came to the forefront in the 1960s. Harry Harris contributed greatly to progress in this area. In 1970 he wrote, “…one may anticipate that inherited differences between
Phenotype and Functional Genomics
5
individual members of the species, whether they be expressed as differences in normal physiological or mental characteristics or as differences in the development of particular abnormalities, are likely to be a consequence of differences in enzyme or protein synthesis”. Harry Harris therefore led us not only to consider structural aspects of proteins and enzymes but also to take into account differences in regulation of expression. Mitochondrial function and the unusual parameters of mitochondrial genetics emerged through the studies of Alan Wilson first published in 1969, and more recently through the contributions of Douglas Wallace and Salvatore di Mauro. I have drawn from their studies and those of other investigators in compiling a chapter on mitochondria (Chapter 6). Studies of late-onset disease have come to the fore particularly as individuals in many populations reach greater age. It has therefore become increasingly important to consider aspects of degeneration of cellular components and quality surveillance. Periodically there are surprises in genetics and among these are the recent discoveries of widespread segmental copy number variation on human chromosomes. Other surprises include the discovery of epigenetics, defined as modification in gene expression through heritable (but potentially reversible) changes in DNA methylation and/or chromatin structure, and imprinting in which one member of a pair of alleles at a specific locus is silenced, so that only the maternal or paternal derived allele is expressed. Victor McKusick foresaw the value of genomics and careful documentation of phenotypes and he established a knowledge base to expedite endeavors. Information on DNA sequence and new technologies that facilitate analysis of genes, genotypes, and gene expression, along with phenotype analyses, have revealed that the same phenotype may arise because of defects in any one of a number of genes; sometimes these genes operate in a specific pathway. There are also examples where a specific phenotype arises as a result of defects in genes that operate in apparently distinct pathways that ultimately impinge upon a specific structure or function. Increasingly, studies in functional genomics merge into systems biology.
PHENOTYPE DEFINITION AND RELATING GENOTYPE TO PHENOTYPE Freimer and Sabatti (2003) emphasized the limitations of current phenotype descriptions and noted that these depend largely on standard disease diagnosis terminologies that are imprecise representations of phenotypes. They noted,
6
Phenotypic Variation
furthermore, that descriptions are often not systematized and that they differ between medical specialties. They proposed that the primary task of a Human Phenome Project would be to delineate components of the phenotype to include morphologic, biochemical, physiological, and behavioral characteristics. They further proposed that phenotypic information should be collected at different levels of resolution, including molecular, cellular, tissue, and whole organism. Data to be collected could include neuroimaging and gene expression profiling. They emphasized too the importance of collecting data on environmental exposures. They noted that, where possible, collection of quantitative measures would be advantageous. Continued training of individuals to assess phenotypes will be important. In addition to assessment of human phenotypes, it will become increasingly important to consider comparative phenomics as more information becomes available on different species and on model organisms.
RELATING GENES AND PROTEINS TO PHYSIOLOGY: THE PHYSIOME PROJECT The Physiome Project of the International Union of Physiological Science seeks to integrate information on biochemistry, biophysics, and anatomy of cells and organs in web-accessible physiological databases and to develop models of biological functions. Computational modeling will be used to analyze integrative biological function. Mathematical modeling of physical and chemical processes will also be carried out. The project also seeks to integrate information on genomes into analysis of structure and function. Hunter and Borg (2003) discussed challenges that lay ahead following completion of the Human Genome Project. These included uncovering regulatory mechanisms and the full inventory of RNA transcripts, as well as uncovering the inventory of proteins produced in translation and through post-translational modifications. Hunter and Borg noted that an important aspect of establishing databases has to do with ontologies (i.e., structured controlled vocabularies). The organizing principles of the Gene Ontology database at the National Center for Biotechnology Information (NCBI) are cellular component, biological process, and molecular function. In the Physiome Project, cell level ontologies are required that deal with cell structure, including cytoskeleton and organelle configuration. The primary cell functions to be taken into account include transport, metabolism, signaling, motility, and intercellular communication.
Phenotype and Functional Genomics
7
At the tissue level, structure and function relationships must be included. At the organ level, physical principles, global behavior, and integrative behavior need to be taken into account (Hunter & Borg, 2003). Hunter and Nielsen (2005) used cardiac function as a model of integrative physiology. They noted that heartbeat could only be understood through knowledge of molecular and cellular processes, tissue structure, and functional relations.
MODIFYING GENES AND IMPORTANCE OF STUDIES IN HUMANS AND MODEL ORGANISMS Nadeau (2005) emphasized that there are few truly Mendelian traits and that phenotypes in Mendelian disorders may vary as a result of allelic heterogeneity, modifier gene effects, or as a result of stochastic or environmental effects. He noted that experimentation in model organisms has facilitated analysis of modifier genes. In mice, specific mutations in a specific gene may lead to variable phenotypes in different mouse strains, indicating that genetic background plays a key role. Nadeau stressed the importance of focus on background effects since these effects provide insights into systems biology and into factors relevant to complex common diseases. Few or many modifier genes may interact with a gene responsible for a specific Mendelian trait. In cases where very few modifier genes interact with the primary gene, that gene accounts for almost all the phenotypic variability and its effect size is large. If many modifier genes interact with the primary gene that determines the Mendelian trait, the effect size of that gene diminishes. Nadeau emphasized that the degree of polymorphism that modifier genes exhibit and the interaction of polymorphisms with environmental factors, may also determine the final phenotype.
EXPLORING GENE INTERACTIONS THROUGH STUDIES OF MODEL ORGANISMS AND HUMAN DISEASE An illustration of the importance of cross talk between human and model organism studies, to facilitate discovery of interactions between genes and specific modifying factors, was provided in studies of hearing loss published by Schultz et al. (2005). They evaluated a consanguineous family in which five siblings had sensorineural hearing loss that began in the first decade of life.
8
Phenotypic Variation
All had severe high-frequency hearing loss. There were clinically significant differences between the siblings with respect to low-frequency hearing loss. Three of the siblings had severe low-tone hearing loss while two siblings had normal low-tone hearing. All five siblings were homozygous for a haplotype of polymorphic tandem repeat markers linked to the cadherin 23 gene (CDH23) on chromosome 10q22.1. Subsequently, all siblings were found to be homozygous for a point mutation in the CDH23 gene; this mutation led to substitution of serine for phenylalanine 1888. Phenylalanine at this position in the CDH23 gene is highly conserved in different species including mouse, rat, and chicken. Schultz et al. reported that in the mouse, CDH23 mutations cause deafness and vestibular dysfunction, leading to the waltzer phenotype. The severity of this phenotype in mice is influenced by allelic variation in the ATP2B2 gene that encodes the plasma membrane calcium pump (PMCA2). They therefore analyzed polymorphic markers in the ATP2B2 gene in subjects in the human family with CDH23 mutations and variable phenotype. Schultz et al. established that a specific haplotype was present in heterozygous form in the siblings with low-frequency hearing loss. This haplotype was absent from the siblings with normal low-tone hearing. They subsequently demonstrated that a specific ATP2B2 mutation occurred that led to low-frequency hearing loss. This mutation occurred at amino acid 586 and involved substitution of methionine for valine. They noted that valine 586 in ATP2B2 is highly conserved in different species.
NATURE AND NURTURE: GENETICS, EPIGENETICS Currently the term epigenetics is applied to modification in gene expression caused by heritable, but potentially reversible, changes in DNA methylation and/or chromatin structure (Henikoff & Matzke, 1997). A key question relates to the extent to which epigenetic changes are influenced by environmental factors that may include nutrition. Metabolism of methyl donors, including choline and folate, has been the particular focus of attention. In one frequently cited study, prenatal deficiency of choline in mice led to reduced methylation at the agouti locus and increased expression of the product of that locus and altered fur color (Waterland & Jirtle, 2003). Methylation usually occurs on cytosine residues that are followed by guanine, CpG dinucleotides. Promoter regions of genes are particularly rich in CpG residues. Methylated residues also occur outside of promoter regions and are particularly abundant in repetitive DNA sequences. In humans,
Phenotype and Functional Genomics
9
NH2
−
+ NH3 OOC
CH3
N
S +
N O
HO
N
N
OH
S-Adenosyl methionine: methyl donor
Figure 1–1.
Structure of S-adenosyl methionine an important methyl donor.
S-adenosylmethionine (SAM), derived from metabolism of folate, methionine, and homocysteine, is an important methyl donor (Fig. 1–1). Methyl residues are attached to CpG dinucleotides through activities of DNA methyl transferase (DNMT). Methylated cytosine residues then bind methyl binding domain proteins (MBD1-4) and MECP2 (methylCpG binding protein). These proteins, along with other transcription repressors, act to silence DNA expression. Gene expression is further impacted by methylation of lysine residues in histone H3 (Fig. 1–2).
EPIGENETICS AND BIOENERGETICS AS THE INTERFACE BETWEEN THE ENVIRONMENT AND THE ORGANISM Direct connections exist between nutrient intake and bioenergetics; Wallace and Fan (2009) emphasized the connection between bioenergetics and epigenetic processes. Efficient processing in the bioenergetics systems and particularly in mitochondria lead to conversion of nutrients to adenosine triphosphate (ATP), acetyl coenzyme A, SAM and reduced nicotinamide adenine dinucleotide (NAD). Under optimal nutrient conditions ATP and acetyl coenzyme A acetylate chromatin. This in turn leads to an open chromatin structure that facilitates DNA transcription and replication. Wallace and Fan noted that SAM production is impacted by the status of mitochondrial function and that SAM plays a key role in DNA methylation and in epigenetic regulation of gene expression.
10
Phenotypic Variation Me A.
TG CG AC GC
ATG TAC
Me B.
Mecp2 Me TG CG AC GC
ATG TAC
Me A and B: Silencing of expression through promoter DNA methylation
TG CG AC GC
ATG TAC
Promoter activated: DNA Unmethylated Activated promoter: histone methylation marks K4me3, k4me2 and k4me1, k36me3
Figure 1–2. Role of CpG nucleotide methylation and methyl domain DNA binding protein MECP2 in control of gene promoter activity. Methylation of lysine residues in histone H3 also impacts promoter activity.
They emphasized the important role of signal transduction processes in control of metabolism and regulation of gene expression through epigenetic mechanisms. Donors of active phosphate and acetyl residues required for signal transduction are derived through bioenergetic mechanisms. Aberrant mitochondrial function may therefore perturb the epigenetic state. Similarly aberrations in the epigenome may perturb mitochondrial function. One example of the latter is found in Rett syndrome that is characterized by progressive neurological impairment that often starts in the latter years of the first decade of life. This syndrome occurs in females and is caused by defective function of the MECP2. It is encoded by a gene on the X chromosome, and this repressor binds to methylated DNA in the promoter region of genes. Defective function of MECP2 leads to overexpression of a number of genes including UBE3A (ubiquitin protein ligase E3A), GABRB3 (gamma aminobutyric acid A receptor B3) (Samaco et al., 2005), DLX5 and DLX6 (distal-less homeobox 5 and 6) (Horike et al., 2005). In studies on mice, Kriauconis et al. (2006) determined that MECP2 binds to the promoter region of a nuclear gene ubiquinol cytochrome C reductase
Phenotype and Functional Genomics
11
core protein 1 (UQCRC1) that encodes a component of mitochondrial respiratory complex III. In MECP2-negative mice they determined that there is overexpression of UQCRC1 UQCRC1 with overall increased activity of respiratory complex III and mitochondrial dysfunction. They proposed that chronic mitochondrial underperformance predisposes to the compromised neurological function characteristic of Rett syndrome. Wallace and Fan (2009) noted that epigenetics processes are also linked to the environment and nutritional intake through activity of adenosine monophosphate kinase (AMPK). AMPK plays a key role in regulation when energy production is compromised or inadequate relative to expenditure. AMPK catalyzes the reaction whereby two molecules of ADP generate one molecule of ATP and one molecule of AMP. AMPK phosphorylates transcriptional coactivators (PGC1alpha, PGC1beta) that impact oxidative phosphorylation. It also stabilizes p53, p21, and p27 proteins, and it represses TOR (Target of Rapamycin) kinase to inhibit cell growth and proliferation when nutrients are insufficient. Aberrant MECP2 Function in Males Specific MECP2 gene mutations that lead to Rett syndrome in females, if present in males lead to encephalopathy. Rare mutations in MECP2 have been described in males with mental retardation. Echenne et al (2009) reported clinical findings on males in whom array comparative genomic hybridization (CGH) studies led to identification of duplication of the Xq28 region and extra copies of the MECP2 gene. Clinical manifestations during the first 5 years of life in these males included developmental delay, hypotonia, ataxia, and autistic behaviors. These males had no dysmorphic features but they were noted to have large ears. After 5 to 7 years of life, hypotonia diminished and was often replaced by spasticity. In the second decade of life many of these patients developed seizures. Cranial MRI studies revealed white matter abnormalities. Lugtenberg et al. (2009) carried out studies on 283 male patients with mental retardation and they identified three patients with MECP2 duplications. In another patient cohort comprised of 134 male patients with progressive neurological impairment and mental retardation, they identified three patients with Xq28 duplication. These duplications ranged in size from 100 to 900 kb and included the MECP2 gene. The larger duplications also included adjacent genes. These investigators proposed that MECP2 copy number testing be carried out in males with moderately severe mental retardation and particularly in cases where neurological impairments are also present.
12
Phenotypic Variation
GENOMIC IMPRINTING Genomic imprinting refers to the situation where one member of a pair of alleles at a specific locus is silenced so that expression of that allele is determined by only one chromosome (i.e., the maternally derived chromosome or the paternally derived chromosome). Imprinting status of an allele may vary in different tissues. There are 80 imprinted loci in the human genome. Imprinted loci are frequently present in clusters in the genome and their activity is determined by the sequence in imprint control loci, by antisense transcripts and by methylation of CpG dinucleotides (cytosine connected via a phosphodiester bond to guanosine). Azzi et al. (2009) reported that all except three imprint control regions in the human genome are methylated on the maternally derived chromosome. Genomic imprinting plays an important role in developmental processes. Evidence for this is the fact that imprinting defects lead to developmental defects that are characterized by physical anomalies and impairments of cognition and behavior.
HYPOMETHYLATION SYNDROME Mackay et al. (2006) first described maternal hypomethylation syndrome. Patients with this syndrome presented with transient neonatal diabetes and they manifested hypomethylation at several loci. Azzi et al. (2009) studied patients with Beckwith Wiedeman overgrowth syndrome and Russell Silver dwarfism syndrome caused by aberrations at imprinted loci on chromosome 11p15. They demonstrated that subsets of these patients manifested methylation defects not only at 11p15 but also at other imprinted loci. Furthermore, these defects involved both maternally and paternally derived alleles.
EPIGENETICS AND BEHAVIOR In studies on mice, Murgatroyd et al. (2009) demonstrated that early life stress (e.g., prolonged maternal separation) leads to hypomethylation of a key regulatory region of the arginine vasopressin gene in the hypothalamic paraventricular nucleus. This in turn resulted in sustained hyperactivity of the hypothalamic pituitary axis and elevated glucocorticoid levels. Impairments in stress-coping ability and avoidance-learning ability were subsequently observed in these animals.
Phenotype and Functional Genomics
13
These investigators also established that specific nucleotides within the regulatory region of the arginine vasopressin gene showed aberrant methylation and MECP2 binding in these animals. Their results indicate that adverse life events leave persistent epigenetic marks on specific genes.
DEFINING THE ROLES OF NATURE AND NURTURE THROUGH TWIN STUDIES For more than one and a half centuries, since the studies of Francis Galton (1865), twin studies have provided insights into the relative roles of genetics and post-conception factors in the generation of phenotype. Monozygotic twins are considered genetically identical; conditions determined by genetic factors should lead to identical phenotypes in both members of a monozygotic twin pair. Dizygotic twins are essentially just siblings, from a genetic standpoint. Occurrence of psychiatric disorders in twins has been studied for many years in an effort to determine the roles of genetics and environment (Gottesman, 1976). Many studies have included cohorts of twins raised together and cohorts of twins separated at birth. Concordance rates for schizophrenia in monozygotic twins vary between 41% and 65% (Cardno & Gottesman, 2000). It is important to consider the modes of assessment used to establish diagnosis. One example is bipolar disorders, where assessment categories may vary in different studies. In some studies, investigators include bipolar spectrum with a range of categories from mood disorder (cyclothymia), to bipolar I and to bipolar II that differ in the extent and frequency of hypomania and manic episodes (Edvardsen et al., 2008). Concordance rates for autism in monozygotic twins were reported to be approximately 88% for monozygotic twins and 31% for dizygotic twins (Rosenberg et al., 2009). The fact that in monozygotic twins concordance rates for autism are higher than the concordance rates for schizophrenia, perhaps reflect the fact that in schizophrenia, the causative factors exert effects incrementally over a longer period of time, whereas factors leading to autism impact early neurodevelopment. Epigenetics as a Possible Explanation for Phenotypic Differences in Monozygotic Twins A number of investigators have carried out studies of levels of DNA methylation in monozygotic twins. Fraga et al. (2005) reported that with increasing
14
Phenotypic Variation
age, individual members of monozygotic twin pairs differed with respect to the degree of global DNA methylation and the extent of repeat sequence methylation and histone modification. An important question that remains is whether or not observed quantitative methylation differences impact phenotype. Heijmans et al. (2007) carried out analysis of methylation and expression of imprinted loci IGF2 (insulin-like growth factor locus) and H19 (non-coding RNA element) in adolescent and middle-aged twins. Their studies revealed that age-related degeneration of methylation played a minor role in diversity of expression of these loci. Through studies in dizygotic twins pairs and across different monozygotic twin pairs, they determined that there are differences in the degree of methylation of the IGF2 and H19 loci. These differences were found to be caused by genetic differences and specifically to variation in single nucleotide polymorphisms in cis with the IGF/H19 locus. Genomic Instability as Cause for Differences between Monozygotic Twins One possible explanation for discordance between members of a monozygotic twin pair is that genomic instability leading to dosage changes in specific gene regions continues to operate in postnatal life. Bruder et al. (2008) carried out microarray studies on blood cell derived DNA from monozygotic twins and demonstrated that differences existed between the twins. It will be important to analyze the extent of copy number differences that occur in different tissues of the same individual. It is also important to consider the studies of Gage and colleagues (Coufal et al., 2009) who demonstrated that L1 retrotransposon activity contributes to somatic mosaicism of neurons and to altered expression of specific genes. L1 retrotransposon activity in neurons may potentially lead to differences in individual members of a monozygotic twin pair. Mitochondria in Monozygotic Twins A single egg contains hundreds of mitochondria that are not identical to each other. Following fertilization and replication, mitochondria segregate independently to new cells. Monozygotic twins are therefore not identical with respect to their mitochondria. Important differences also occur in the mitochondrial content of different tissue because of heteroplasmy and continued replication and segregation (Wallace et al., 1999).
Phenotype and Functional Genomics
15
EPIGENETICS AND ART It is important to note that in patients conceived using artificial reproductive technologies (ART), particularly those conceived following intracytoplasmic sperm injection, there is a higher frequency of Beckwith Wiedeman syndrome caused by loss of imprinting at specific imprint control loci on 11p15. Azzi et al. (2009) reported that a number of these patients show loss of imprinting at other loci on chromosomes 6q24, 7q32, and 15q13.
2 EVOLUTION
“Among the many problems which came under my consideration, the position of the human species in zoological classification was one of the most serious. Indeed at that time, it was a burning question in the sense that those who touched it were almost certain to burn their fingers severely.” —T.H. Huxley in the preface for Man’s Place in Nature (1894)
ANALYSES OF RELATEDNESS Thomas Huxley in his book Evidence as to Man’s Place in Nature (1863) and Charles Darwin in The Descent of Man (1871) first drew attention to relatedness of humans and African great apes. Of nonhuman hominids, chimpanzees represent the closest relatives of humans. Comparison studies in hominids were initially carried out at the anatomical level. Alan Wilson first proposed comparing and dating fossils through analysis of mutations (Wilson & Sarich, 1969). King and Wilson (1975) first published evidence of the high degree of similarity of protein sequences between humans and chimpanzees. Alan Wilson and colleagues also focused attention on the idea that the phenomenon of gene rearrangement constitutes the basis for organismal evolution (Wilson et al., 1974). They compared organismal, chromosomal, and molecular evolution in frogs and mammals. From their studies they established 16
Evolution
17
that the rate of protein evolution in frogs is similar to that in mammals. However organismal evolution proceeded more slowly in frogs. They postulated that changes in regulatory systems may be key and suggested that these changes were linked to changes in chromosome structure. Through studies on a variety of different frog species and in mammals, Wilson et al. estimated that for frogs it took 70 million years for species-specific differences in chromosome arm number to evolve. For mammals the average time elapsed for chromosome differences to evolve, based on number of chromosome arms, was 3.5 million years. For their calculations of chromosome numbers, acrocentric chromosomes were assigned one arm; metacentric or submetacentric chromosomes were assigned two arms. They concluded that changes in gene arrangement constituted the important evolutionary change and that gene rearrangement occurred more rapidly in mammals than in frogs. Wilson et al. (1974) published evidence of a rapid rate of gene rearrangement in mammals. They postulated further that genome rearrangements paralleled the rapid rate of anatomical evolution in mammals and led to loss of potential for interspecies hybridization. They concluded that changes brought about by rearrangement were more important for evolution than point mutations in sequence. With respect to intraspecific variation in populations of specific organisms, Wilson et al. drew attention to examples of inversions and translocations. They noted that inversion polymorphisms were well documented in Drosophila, and that island populations of Drosophila often showed karyotypic variations not found in mainland populations. Wilson concurred with the conclusion of other geneticists, including E.B. Ford (1964) that adaptive evolution resulted primarily in the expression of genes relative to one another. Wilson et al. (1974) wrote: “Adaptation is probably a complex process requiring new interactions among many genes. The reshuffling of genes may be an important mechanism by which new interactions occur.” Wilson and colleagues (see Sawada et al., 1985) published evidence of genomic instability resulting from tandem arrays of repeated sequence in DNA. They determined that these repeated elements led to increased frequency of recombination and polymorphisms in specific regions (e.g., in the 5' region of zeta globin) (see Sawada et al., 1985).
MITOCHONDRIAL DNA EVOLUTION AND SPECIES BARCODES Alan Wilson and colleagues in their studies on mitochondrial DNA polymorphisms first drew attention to the fact that the mitochondrial DNA segment that
18
Phenotypic Variation
encoded subunit 2 of cytochrome oxidase evolved faster in primates than in rodents or ungulates. They also noted evidence for coevolution between specific nuclear and mitochondrial genes (Cann et al., 1984). In 2009, Lane reviewed evidence that a specific 648 nucleotide region of mitochondrial DNA varies in different species and that sequence in this region constitutes a bar code that can be used to distinguish between species. Humans differ from chimpanzees at 60 sites within this region and from gorillas at 70 sites. Humans differ from each other by no more than two nucleotides within the 648 nucleotides. Analyses in other species revealed that within each particular species, few sequence differences occur in this region. This 648-nucleotide segment of mitochondrial DNA occurs within the gene that encodes a subunit of cytochrome C oxidase. Lane noted that there is evidence that sequence within this bar code region must be compatible with sequence in nuclear genes that encode other subunits of the cytochrome oxidase and that specific nuclear DNA mutations may result in incompatibility and impaired mitochondrial respiratory and energy function. Lane noted that a number of investigators have proposed that mutations within this bar code sequence drive speciation.
PROTEIN DOMAINS AND DOMAIN STRUCTURE Protein domains may be defined as blocks of consecutive amino acids that correspond to functional units and show evolutionary conservation. Branden and Tooze in their book, Introduction to Protein Structure (1998), defined a protein domain as “a polypeptide chain or a part of a polypeptide chain that can fold independently into a stable tertiary structure. Domains are also units of function.” Domains may function independently or the function of a specific domain may be related to that of other domains within the protein. Domain 3D structure may be maintained by amino acid interactions (e.g., through disulfide bridges or by metal ions). Mobile elements introduced into genomes by microorganisms may also play a role in generating diversity (Doolittle, 1995). Genomic regions that encode domains may undergo duplication rearrangement and fusion; DNA strands may undergo slippage and gene conversion. All of these mechanisms lead to the development of new domain architectures and functions. Advances in proteomic analysis continue to provide insights into domain structure and are relevant to functional genomics (Jolles & Jornvall, 2000). There is a growing body of data on unicellular organisms and metazoans that supports theories that contend that single domains present in prokaryotes,
Evolution
19
came together in eukaryotes to form multidomain proteins. Within a specific protein, domains may be repeated in tandem. Within the tandem repeats, amino acids may diverge. Fong and Marchler-Baue (2008) reviewed the Conserved Domain Database that may be used to examine sequence information and make domain assignments. They noted that a major goal of the post-genomic world is to infer protein function from sequence information. One method to achieve this is to search for conserved sequence elements and to analyze these in different proteins, to analyze conserved motifs and their three-dimensional structure and their active sites. Important insights may also be obtained through analysis of evolutionary conservation. Fong and Marchler-Baue (2008) emphasized that most proteins consist of a mosaic of domains and that protein function is dependent on the combination of domains present in a specific protein. Databases are available to analyze domain structure (e.g., pfam, prosite, prodomain).
GENOME CHANGES IN EVOLUTION OF HUMANS AND NONHUMAN PRIMATES Recent studies indicate that approximately 300 different primate species exist. Dumas et al. (2007) postulated that the genomic mechanisms that underlie species diversity include gene duplication, gene rearrangement, and single nucleotide substitution. They noted that gene duplication is likely a primary driving force in evolution; it facilitates changes in gene expression and provides an additional copy of the gene so that one copy may undergo subsequent changes and serve as a substrate for the origin of new functions. Current and future efforts to analyze evolution will need to take into account recent discoveries of copy number variation and the structural dynamism of the human genome. Varki et al. (2008) wrote that there is some evidence that evolutionary changes in levels of gene expression may be correlated with copy number variation (CNV). Perry et al. (2008) undertook array based comparative genomic hybridization (CGH) of DNA from 30 humans and 30 chimpanzees (Pan troglodytes). The platform used comprised 28,708 large inserts of cloned DNA. They compared the location and frequencies of CNVs over the two species and documented differences between the species. The human samples included 10 Yoruba and 10 Baika rain forest gatherers, 10 Mbuti hunter-gatherers and a European-American male reference sample. In both human and chimpanzee samples, Perry et al. found on average 70 to 80 autosomal CNVs. The median CNV size was 250 kb. In humans,
20
Phenotypic Variation
they identified 353 discrete autosomal regions where CNVs occurred; in chimpanzees, 438 such regions occurred. Perry et al. (2008) determined that 144 of the 353 human CNVs (42%) overlapped chimpanzee CNVs. They interpreted these results as indication of recurrent ongoing CNV generation. Sequence analysis revealed that human and chimpanzee CNV regions are enriched for segmental duplications (i.e., low-copy repeats that are less than 1 kb in size with 90% sequence similarity). This enrichment for low-copy repeats in the CNV regions implies that nonhomologous recombination played an important role in the generation of the CNVs. In humans, 182 of the 353 human CNVs overlapped segmental duplications. Similarly, for chimpanzees 171 of the 453 CNVs overlapped segmental duplications. These CNVs were multiallelic and manifested deletion and duplication alleles. Of the 140 CNVs that overlapped in humans and chimpanzees, 96% shared segmental duplication sequence. The authors interpret their data as reflective of recurrent nonhomologous allelic recombination arising in shared segmental duplication sequences. These duplicated segments likely arose in a common ancestor and were subsequently retained in both species. The analysis of genes in the CNV regions revealed that they often included inflammatory response genes; for example, APOL1 (apolipoprotein L1), involved in resistance to Trypanosomiasis, CARD18, (caspase recruitment domain 18), and interleukin 1 family members 7 and 8 (IL1F7, and ILIF8), involved in innate immunity and immune response. The latter two genes were often deleted in chimpanzees, indicating that different inflammatory response avenues may be present in chimpanzees. Their results revealed no copy number differences between human and chimpanzees at the chemokine CC motif (CCL3L1) locus. They identified a relative copy number loss in chimpanzees at the TBC1D3 (TBC domain) oncogene locus that maps close to CCL3L1. Varki et al. (2008) reported that structural variants involving segments >15 kb in size are nonrandomly distributed throughout the genome. They frequently occur in the regions of segmental duplications and are hot spots for evolutionary change. There is also evidence that structural genomic changes impact local and distal gene expression patterns. With respect to other repetitive elements, Varki et al. noted that the activity of ALU repeat sequence DNA-transposable elements is approximately three times higher in humans than in chimpanzees. Interestingly, short interspersed element, variable number of tandem repeat, (SVA) and ALU repeat elements emerged specifically in the hominid ancestor. The SVA elements contain a short interspersed nuclear repeat (SINE), an ALU sequence, and a variable
Evolution
21
number of tandem repeats (VNTR). There is evidence that the SVA elements may have a significant impact on transcription. The endogenous retroviral elements Pan troglodytes endogenous retrovirus 1 (PTERV1) are common in the gorilla and chimpanzee genomes, but are absent from or very uncommon in the human genome. Varki et al. (2008) noted that in general humans do not appear to have endemic retroviruses in their genomes and that the recent introductions of HIV and T cell leukemia virus into humans are unusual. Varki has postulated that loss of N-glycolylneuraminic acid has played a role in the difference in retroviral frequencies between the two species because many of these viruses utilize this sialic acid for cellular interactions and entry.
COPY NUMBER CHANGES AND REARRANGEMENTS THAT IMPACT SPECIFIC GENES Lineage-Specific Genome Copy Changes Dumas et al. (2007) examined genomic DNA from ten different primate species with human cDNA probes on microarrays to search for lineage-specific gene copy number changes. They identified species-specific copy number changes and, in some cases, these changes could be correlated with specific functional characteristics. One example is the species-specific amplifications of aquaporin that may play a role in physiological adaptations in thermoregulations and energy utilization. Dumas et al. analyzed 24,473 unique genes and they identified 4,159 genes that showed lineage-specific copy number changes. Copy increases exceeded decreases. Changes from primate to human predominantly involved duplications. They also identified gene copy number changes that were shared among related species. They postulated that genes that show lineage-specific copy number changes are likely involved in the generation of phenotypic differences. They determined that genes encoding DUF1220 domains are specifically increased in the human lineage. Proteins with these domains are abundantly expressed in the brain. RANBP2 (Ran binding protein 2) shows changes in humans as compared with other primates. This gene encodes a large protein within a nuclear pore complex that interacts with the small GTPase protein, RAN. In humans, the RANBP2 gene is partially duplicated and it resides in a gene cluster on chromosome 2q12.3 that acts as a recombination hot spot. Other protein-coding genes that have undergone rapid evolution that
22
Phenotypic Variation
likely influenced brain function include FOXP2 (forkhead box P2) and ASPM (abnormal spindle homolog microcephaly associated). Dumas et al. noted in humans that the HLA (histocompatibility antigen) gene region shows reduction in size relevant to that in macaque and lemur.
PROTOCADHERIN H11X AND H11Y Protocadherin H11X/Y (PCDH11X and PCDH11Y), are genes located on Xq21.3 and Yp11.3. This homology arose as a result of translocation of a region of Xq21.3 to Yp11.3. Analysis of genomic structure revealed that this translocation was followed by inversion of the segment on Y and loss of part of the segment during inversion (Williams et al., 2006). Through studies in primates, this translocation event was determined to have taken place in the hominid lineage following divergence of chimpanzee and hominids. The X and Y protocadherin H pair are present only in hominids. PCDH11X is expressed only in the brain. PCDH11Y is expressed primarily in the brain. Some transcripts occur in the testis. These genes are considered to be important candidates for generation of brain asymmetry in the region of the planum temporale, emergence of handedness and language-specific development in the human lineage. There is evidence that protocadherin H11 is expressed from both the X and the Y chromosome and that it escapes X inactivation in females. PCDH11X expression in females is higher than in males. Detailed analysis of genomic DNA and transcripts of PCDH11X and PCDH11Y established that PCDH11X has 17 exons and PCDH11Y has 15 exons, and is missing exons 7 and 8 and a large intron that lies between these exons. There is evidence that transcripts of these genes undergo extensive alternate splicing, and Blanco Arias et al. (2004), established that 395 transcripts may be derived from the gene pair. There is also evidence for sequence divergence and accelerated positive selection on PCDH11X/Y. Human-Specific Mutation in the Human Brain Neuropsin is a secreted serine protease that has been shown to play a role in cognition. Neuropsin has two alternate splice forms in humans. The type II splice form is abundantly expressed in the adult human cortex; both forms have six exons. Lu et al. (2007) determined that alternate splicing of exon 3 led that exon in humans to be longer by 45 amino acids. This alternate splicing results from a mutation at a specific splice regulatory site.
Evolution
23
The type II isoform does not occur in apes and Old World monkeys, indicating that type II became active more recently in evolution. This finding suggests that alternate splicing and generation of new protein isoforms may play a role in evolution. Specific Deletion in Humans Varki et al. (2008) have reported a number of human-specific evolutionary changes that involve sialic acid metabolism and sialic acid binding lectins. The SIGLEC6 gene that encodes a sialic acid binding immunoglobulin-like lectin, is specifically expressed in the human placenta and is not found in the placenta in other hominids. In humans, there is a specific loss of a gene that encodes cytidine monophosphate N-acetyl neuraminic acid hydrolase. This loss leads to significant alterations in cell surface sialic acids. There is also evidence that specific caspase genes have been lost during evolution of humans. Another human-specific change of interest involves a specific mutation leading to loss of expression of myosin 16 (MYH16). Loss of expression of this gene was proposed to play a role in the shift of muscle insertion and jaw configuration in human evolution from hominid ancestors. This theory has however been challenged by some investigators. Gene Duplications in Hominids The increased rate of genomic duplication in hominids has led to emergence of hominid-specific gene families in humans and chimpanzees. Furthermore, there is evidence for positive selection of these families and for increased gene expression. Varki et al. (2008) presented the neuroblastoma breakpoint protein family (NBPF) as an example. NBPF genes are expressed in neurons. Popesco et al. (2006) first described neuronal expression of a gene that encoded a protein with high-copy numbers of a specific domain DUF1220. They noted that these domains were primarily expressed in brain regions involved with higher cognitive function, and their expression occurred in neuronal cell bodies and dendrites. NBPF proteins contain DUF1220 domains Copy number variants in the hominid genome often involve genes that encode products involved in immune response, olfaction, and detoxification. Varki et al. referred to recent evidence indicating that copy number variation frequently involves transcription factor encoding genes, and genes involved in synaptic transmission and in central nervous system (CNS) development. Human lineage-specific amplification of the Morpheus family on chromosome 16 is of
24
Phenotypic Variation
interest in this regard. Duplication of this family predisposes to rearrangement that may lead to neurocognitive defects. Varki et al. (2008) emphasize the “cascading effect” of duplicated segments in increasing diversity. Duplicated segments are sites of nonallelic homologous recombination and predispose to inversions, deletions, duplications, and gene conversion. These investigators expressed the opinion that increase in brain size has been overrated as a factor determining advances in cognitive abilities. They noted, however, that there are correlations between specific human attributes and development of specific brain regions. Thus, language development is associated with development of the peri-sylvian cortex and hemisphere asymmetry. Planning activities are associated with increased frontal development (Abrahams et al., 2007). One important difference between humans and nonhominid primates involves the presence in humans of specific spindle cell neurons, Von Economo neurons that are enriched in human cingulate and insular cortex. These neurons play a role in cognition and behavior, and are apparently selectively affected in frontotemporal dementia. Evolution at the Sensory Function Level FOXP2 protein is interesting in the context of evolution at the protein level of genes involved in neurogenesis, hearing, and speech. There is evidence for selection of a specific form of FOXP2 in humans, and there is also evidence of adaptive selection of FOXP2 transcriptional targets. Varki et al. (2008) noted that humans have lost acuity of many sensory functions, including olfaction and bitter taste sensation, through processes that converted genes to pseudogenes. Superior sensory capacity in humans apparently includes tricolor stereoscopic vision and fingertip tactile synesthesia. Many behaviors in humans and primates involve learning from the previous generation. Varki et al. suggested that intergenerational cultural transfer allowed partial escape from genetic hardwiring and permitted invention and extended developmental plasticity. Accelerated Evolution of Conserved Non-protein Coding Sequences in Humans Prabhakar et al. (2006) searched for human-specific substitutions in 110,549 conserved non-protein coding sequences. They identified 992 elements with an excess of human-specific substitution, 79% more than would be expected by chance. These investigators determined that accelerated substitution occurred disproportionately near genes expressed in the central nervous system
Evolution
25
and particularly near genes that encoded cell adhesion molecules. The region where most noncoding sequences were expressed was the basal lamina. Pollard et al. (2006) scanned genome sequences of a number of vertebrates to identify regions that underwent sequence changes in humans, though they showed conservation in other mammalian species. They identified 49 regions with statistically significant increases in substitution rates in humans; 96% of these regions were in nonprotein coding segments. A 118 base pair region that showed the most dramatic accelerated sequence changes in humans, was designated Human-accelerated region 1 (HAR1). Pollard et al. (2006) determined that HAR1 RNA is strongly expressed in the brain. It is expressed in human neocortex in embryonic life, in Cajal Retzius cell. It is also expressed in the post-embryonic period and in adult life. HAR1 RNA was not detected in a range of other tissues. Subsequent studies by Beniaminov et al. (2008) revealed that the humanspecific substitutions in the HAR1 gene cause the RNA (ribonucleic acid) it encodes to adopt a cloverleaf structure significantly different from the unstable hairpin structure of HAR1 RNA in chimpanzees. Prabhakar et al. (2008) examined genomic sequence for blocks of nonprotein coding conserved sequence that show evidence of rapid sequence divergence in a single species. One such region identified in humans was designated Human-accelerated conserved noncoding sequence 1 (HACNS1). Through genetic engineering of mice, they demonstrated that this sequence drives expression in the mesenchyme in the early stages of development of the forelimb. Later it impacts development in the hind limb. In humans, HACNS1 is located in an intron of the centaurin (CENTG2) gene, approximately 300 kb downstream of the GBX2 homeobox gene. The latter is known to play a role in limb development. Prabhakar et al. (2008) proposed that human-specific changes in this sequence may have played a role in the divergence of limb anatomy of humans versus chimpanzees. This divergence likely favored bipedalism and hand use in humans. Role of Enhancers in Evolution There is evidence that secondary enhancers that impact gene expression may be located at great distances (even tens of kilobases) from sequences they regulate (Wray & Babbitt, 2008). The term “shadow enhancers” is sometimes used to refer to these distantly mapped enhancers (Hong et al., 2008). Shadow enhancers may arise by means of gene duplication, and they may evolve separately to achieve novel binding sites and regulatory activities, without compromising the function of control enhancers.
26
Phenotypic Variation
The subtelomeric region on chromosome 7q36 was shown to play a role in development of hands, feet and digits by several investigators (Heutink et al.,1994; Hing et al., 1995). Lettice et al. (2003) established that a cis-acting regulator for the Sonic Hedgehog gene maps in this region. Another enhancer regulatory sequence that impacts the Sonic Hedgehog (SHH) sequence is located further upstream of that gene; it lies within an intron of the limb regions 1 (LMBR1) gene. This regulator was designated Zone of polarizing regulatory sequence (ZRS). Linkage studies revealed that numerous forms of the developmental anomaly known as preaxial polydactyly syndromes II and III map to 7q36. Lettice et al., (2003) analyzed DNA sequences corresponding to the regulatory domain of ZRS in seven families with pre-axial polydactyly and identified single nucleotide mutations in four families. Triphalangeal thumb polysyndactyly syndrome and syndactyly type IV were found to be caused by duplications that involve the SHH-specific enhancer ZRS (Sun et al., 2008). These studies are at the forefront of analysis of regulatory elements in the etiology of developmental defects.
POSITIVE NATURAL SELECTION Positive natural selection is defined as the force that drives the increase in prevalence of advantageous traits (Sabeti et al., 2006). Darwin (in The Origin of Species 1859) and Wallace (1858) defined advantageous traits as traits that make it more likely that carriers would survive and reproduce. Molecular analysis of positive selection previously involved comparison of amino acid sequence of proteins encoded by candidate genes. Genome-wide sequence and polymorphism data can now be used to analyze selection. In a number of well-known examples, variation in a protein encoded by a specific candidate gene alters the function of the protein in a manner that can clearly be related to selection. Heterozygosity for the sickle cell hemoglobin (HbS) mutation that resulted in increased resistance to malaria is an example of such positive selection. Sabeti et al. (2006) reviewed genetic methods to evaluate selection that take into account available genomic sequence information and polymorphisms. Traditionally, evidence for positive selection is sought by comparing the observed frequency of a specific variant in a defined population subgroup in comparison with the expected frequency of that variant in the general population. For example within a defined African population the observed frequency of HbS heterozygotes resistant to malaria is determined versus the frequency
Evolution
27
of HbS in the general population. Sabeti et al. noted that it is often difficult to distinguish positive selection from effects of population demographic history (e.g., bottlenecks in population growth). Positive selection for a function-altering variant may be determined by comparison of coding genomic sequence or protein sequence of different species. A rise in the frequency of nonsynonymous changes is particularly important. Sabeti et al used as an example the observation that in exon 2 of the protamine 1 gene that encodes a sperm-specific protein, there are six nucleotide changes that lead to amino acid differences in humans versus chimpanzees. The ka/ks test is often applied for analysis, where ka represents nonsynonymous changes, and ks represents synonymous changes. Sabeti et al. noted that one disadvantage of this test is that numerous beneficial changes in one protein or segment are required before values become statistically significant. Another signature used to define selection is reduction of genetic diversity for a specific allele and/or haplotype. The terms hitch-hiking and selective sweep are often applied to this form of selection since, as the selected allele increases in frequency or becomes fixed in the population, the frequencies of variants in the immediate vicinity of that allele are also altered. Positive selection therefore leads to decreased overall allele diversity in a specific region. The test used to detect this is Tajima D. Sabeti et al. noted that this form of selection may be difficult to distinguish from effects of demographic history. The occurrence of long and specific haplotypes in a specific region that result when regions are not altered by recombination may be evidence of a selective sweep. Population differences in the frequency of a specific allele may provide evidence for selection of a specific allele in one population, in response to specific environmental or cultural conditions. Selection for lactase persistence is an example of this. It is particularly interesting to note that analysis of genomic sequence data has revealed evolutionarily selected genomic regions that are apparently gene free. These regions may harbor regulatory sequence elements. Sabeti et al. (2006) emphasized that dissecting selection at a specific locus requires analysis of DNA change, in coding and regulatory regions, analysis of the functional consequences of that change and definition of associated phenotypic differences. Varki et al. (2008) observed that studies that analyze the effect of proteincoding mutations on morphology and phenotype often do not take into account the importance of alternate splicing and its adaptive value. They noted that there are few detailed comparisons of humans and nonhuman hominids with respect to alternate splicing. One molecule that shows human-specific alternate splicing is neuropsin.
28
Phenotypic Variation
EVIDENCE OF POSITIVE SELECTION FOR BRAIN-EXPRESSED GENES Rockman et al. (2005) reported evidence for positive selection in the vicinity of the prodynorphin gene that altered expression of this gene. The selected variation increased transcription of this locus. Prodynorphin is a precursor molecule for endogenous opioids and neuropeptides that play roles in behavior and memory. These investigators proposed that during human evolution multiple noncoding mutations arose upstream of the prodynorphin transcription start site, and that some of these mutations altered cis-regulation of this gene. Positive selection led to an elevated frequency of specific alleles in the region 5' to the prodynorphin transcription start site. They demonstrated that the specific DNA change that alters induction of expression of the gene is polymorphism of a 68-base-pair tandem repeat located 1,250 base pairs upstream of the transcription start site. Within this 68-basepair repeat, there are five substitutions that differentiate humans from chimpanzees. Another difference is copy number change. Nonhuman primates carry one copy of the repeat element. In humans, several copies of the repeat occur and human populations differ with respect to the frequencies of the repeat.
EVOLUTION AND THE LAST COMMON ANCESTOR OF HUMANS AND CHIMPANZEES Many of the studies designed to reveal human-specific genotype and phenotype characteristics concentrate on differences between humans and chimpanzees. Uddin et al. (2008) have focused on earlier changes. They postulated that changes that differentiated the last common ancestor of humans and chimpanzees from other species played a key role in evolution. These investigators analyzed genomic sequences from ten different vertebrate species. In an analysis of 1,240 genes, they defined sequence alterations that differentiate rodents from primates. Uddin et al. (2008) found striking evidence for adaptive evolution in a number of genes that function in mitochondria and in aerobic energy metabolism. Their studies further revealed more recent evolution in humans leading to high levels of expression in the fetal brain of genes that mediate neuronal connectivity (e.g., cadherins). Important phenotypic evolutionary changes that occurred in ancestors of primates included evolution of the mobile shoulder joint. Another important change occurred in the placenta and specifically in the pattern of fetal interdigitation into maternal tissue; this process facilitated extended duration of intrauterine fetal life.
Evolution
29
Uddin et al. proposed that networks of genes, rather than individual genes, might be the targets of natural selection. By comparing rodent to nonhuman primate sequences and human sequences, they defined human ancestryspecific genes. They then examined expression of these genes in different tissues. Their analyses revealed a high frequency of functional changes in genes that encode glycoproteins, genes that play a role in glycosylation, and genes that encode proteins with disulfide bonds. Specific pathways with high frequencies of adaptive changes included pathways of aerobic energy production. These pathways showed changes in the primate ape stem of evolution. In this stem, there was also evidence of changes in immune system functions, including genes involved in cytokine production. Genes expressed in the fetal brain that showed evidence of accelerated sequence changes in humans included genes involved in neuronal connectivity, particularly cadherins, protocadherins PCDHGA8 and PCDHGB1, and genes encoding voltage-sensitive calcium channels (e.g., CACNA1G). Uddin et al. also determined that a gene designated KIAA0319, involved in neuronal migration and axon guidance in the neocortex, shows evidence of adaptive evolution and is highly expressed in the human brain. This finding is of particular interest in view of recent studies that show that reduced expression of KIAA0319 occurs in a form of dyslexia that is linked chromosome 6p22 and specifically to the KIAA0319 gene. Positive selection in the ape lineage and high expression in the adult brain include nuclear gene-encoding products expressed in mitochondria, genes involved in oxidative phosphorylation, and ion transporter activity. Uddin et al. emphasized that the electron-transport-related genes show higher expression in chimpanzee and human brains than in other species. They also determined that there is higher expression of oxidoreductase and energy metabolism genes in thyroid tissue in the primate lines. Uddin et al. (2008) concluded that it is important to consider the deep genetic routes of human distinctiveness and evidence of early adaptive changes. Shetwood et al. (2006) emphasized the importance of evolutionary changes in biochemical pathways of energy production, including changes in lactate dehydrogenase and accelerated evolution of subunits of mitochondrial complexes III and IV and cytochrome C. They demonstrated interspecies differences in the ratio of glia to neurons and that the proportion of glial cells to neurons increases as overall brain size increases in apes and humans. They proposed that this was driven by the higher energy requirements of the extended dendritic arbors and longer axons that evolved in hominids. Glial cells provide metabolic support to neurons.
30
Phenotypic Variation
Lactase Persistence Adaptive evolution: refers to alteration in development or function that leads an organism to function better in a specific environment. Lactase persistence is considered to be an example of adaptive evolution. Reduced ability to digest milk lactose after weaning results from decreased levels of a specific enzyme lactase, phlorizin hydrolase. In many individuals, the levels of production of this enzyme by intestinal cells decrease progressively throughout childhood. However lactase persistence commonly occurs in Northern Europeans. The frequency of lactase persistence decreases from north to south in Europe. In Sweden it is 90%, and in Spain the frequency is 50%. Lactase persistence is rare in the Chinese. In Africa, lactase persistence frequency varies in different populations; it is 90% in cattle-herding populations and is much lower in crop-raising populations (Ingram et al., 2007). This raises the interesting question of gene–environment interaction and the evolutionary age of a specific mutation versus the age of specific behavior. Ennatah et al. (2002) first described the occurrence of a single-nucleotide variant C/T at position -13910, located 14 kb upstream of the lactase gene. This variant was correlated with lactase persistence in Finns. The C allele at -13910 was defined as the ancestral allele and the T allele as the derived allele, The T allele acts as a dominant and it has a cis-acting effect on the lactase promoter. The presence of the T allele leads to higher levels of lactase transcription. Analysis of polymorphic markers in the vicinity of T-13910 and derivation of haplotypes revealed that there is a 1 Mb region that is in linkage disequilibrium with the mutation. Enattah et al. concluded that this mutation likely arose in a specific founder in the Finnish population and that natural selection subsequently operated, leading to high frequencies of lactase persistence in Finns. In cattle-herding populations in Africa, lactase persistence is associated with different nucleotide variants upstream of the lactase gene. Tischkoff et al. (2007) identified a mutation G/C at -14010 in individuals with lactase persistence in Kenya and Tanzania. They noted the presence of a long stretch of homozygosity of nucleotides in the vicinity of -14010 C consistent with positive selection of this region. Other polymorphisms of interest are T/G at -13915 and C/G at -13907. Ingram et al. (2007) described -13915 G variants in Sudanese cattle-herding groups. These variants exist on different haplotype backgrounds and they are geographically restricted. Tischkoff et al. speculate that there are likely additional variants that lead to lactase persistence in African populations.
Evolution
31
Ingram et al. (2009) reported that the single nucleotide polymorphisms (SNPs) associated with lactase persistence occur within a sequence segment that has enhancer function and that each polymorphism may therefore have functional implications. Different genotypes lead to the same phenotype (lactase persistence).
CORRELATING FOSSIL RECORDS AND POLYMORPHISM DATA: EVOLUTION OF MAN IN THE LIGHT OF MOLECULAR GENETICS Portin (2008) reviewed progress in molecular genetics relevant to evolution. He emphasized that huge gaps exist in the fossil data relating to early humans. He stressed that evolutionary events leave imprints on the genome and that analysis of these imprints illuminates evolutionary history. In considering the Out of Africa hypothesis, Portin concludes that an African origin of the human species is supported by fossil records and by genetic studies. Most recent fossil evidence supports the conclusion that anatomically modern humans were present in the Omo Valley in southwest Ethiopia 195,000 years ago. Studies of genetic polymorphisms in nuclear and mitochondrial genome have revealed that the greatest diversity can be observed in African populations. Analysis of human mitochondrial DNA polymorphisms supports the hypothesis that migration of modern humans along the horn of Africa to southeast Asia and Australia occurred 60,000 to 75,000 years ago. Migration to northern Africa and western Eurasia occurred 40,000 to 50,000 years ago. The question arises as to whether or not archaic populations contributed to the modern gene pool. Studies of DNA sequence on Neanderthals have opened the way for sequence comparisons. Analysis of Neanderthal mitochondrial sequence reveals that it is quite different from human mitochondrial sequence and that it is unlikely that Neanderthals contributed to the human gene pool (Portin, 2008). In 2010 Green et al. published results of more extensive DNA sequence analysis of coding segments of Neanderthal genomic DNA. Sequences from Neanderthal were compared with homologous sequences from chimpanzee and from humans from Europe, Asia and Africa. These analyses revealed that interbreeding likely occurred between Neanderthals and early humans who had migrated out of Africa. Segments of nuclear DNA from carefully collected Neanderthal specimens have been analyzed for specific genes. Two of the genes sequenced include the FOXP2 gene and the melanocortin receptor 1 gene (MC1R).
32
Phenotypic Variation
The MC1R gene encodes a transmembrane guanosine triphosphate (GTP)binding heterotrimeric receptor. Loss of function alleles of MC1R lead to deficiency of pheomelanin in skin and hair and result in pale skin and red hair (Rees, 2003). Lalueza-Fox et al. (2007) amplified short segments corresponding to the MC1R gene from Neanderthal DNA specimens gathered from frozen remains found at two sites, El Sidron in Spain and Monti Lesini in Italy. DNA samples from these specimens were also amplified in two other laboratories. In nine of 12 experiments, investigators identified an arginine glycine substitution (R307G). This substitution is very rare in modern humans. It occurs in helix 8 of the receptor molecule. Lalueza-Fox et al. transfected cells with constructs carrying the Arg307Gly (R307G) substitution. In separate cells they carried out transfections with the wild-type allele. They demonstrated compromised activity of the R307G protein. On the basis of these experiments, they propose that the Neanderthal individuals were red-haired and light-skinned. Interestingly, these investigators report that they cannot determine if the sample individuals were homozygous or heterozygous for the mutation. In order to assure the authenticity of Neanderthal DNA samples that they were analyzing, Krause et al. (2007) first determined that mitochondrial DNA in those samples corresponded 99% to Neanderthal sequence. They also established that the DNA samples contained Y-chromosome sequence-specific for Neanderthal and different from that of modern humans. The confirmed Neanderthal DNA was then used for polymerase chain reaction (PCR) amplification and analysis of the FOXP2 gene. Krause et al. determined that the Neanderthal DNA sequences at positions 911 and 977 were the same as in humans. Sequences at these positions represent the only differences between humans and chimpanzees, and the sequence differences are postulated to correlate with development of language. As of 2008, frozen remains from 14 Neanderthal individuals have been recovered from sites in Spain, France, Italy, Central Europe, and Russia (Hodgson & Disotell, 2008).
MOLECULAR ANTHROPATHOLOGY PHYLOGENETICS AND PHENOTYPES Bradley (2008) noted that whole genome sequencing and gene mapping have shifted the focus of molecular anthropology, from phylogenetic analyses to phenotype reconstruction and functional genomics. Bradley stressed that changes in gene regulation likely play a key role in determining human– chimpanzee differences. Candidate loci proposed for selection in the human
Evolution
33
lineage include FOXP2, ASPM, MYH16, and genes involved in auditory capacity. Donaldson and Gottgens (2006) reported that an important molecular change in humans was the deletion of transcription factor binding sites. As noted previously, there is evidence for selection of a specific variant of FOXP2 in humans. Bradley (2008) postulated that since FOXP2 is a transcription factor, it is possible that the changes at this locus probably influence regulation of several other genes. There is evidence that at least 200 genes involved in nervous system biology have undergone positive selection in humans (Dorus et al., 2004). A number of genes involved in hearing have also undergone positive selection in humans. These genes include Diaphonous (DIAPH), EYA4, EYA1 (eyes absent homologous genes), and OTOR (otoraplin). Interesting mutations in these genes play a role in some forms of human deafness and in syndromes associated with ear malformations (EYA is mutated in branchio-oto-renal syndrome). Humans have a higher copy number of ALU1 sequences and there is evidence that ALU integration impacts gene expression in some cases. In humans, the gene that encodes the caspase 12 protein has mutated and become a pseudogene. There is evidence that this change has led to differences in pathogen resistance (Eckhart et al., 2008). Key phenotypic differences between humans and chimpanzees include human bipedalism that led to alteration in spine, pelvis, and cranial anatomy (Crompton et al., 2008), along with an increase in brain size that led to change in head and face shape (Cobb, 2008). Nowak et al. (2002) emphasized that in the human lineage, culture expanded to include complex language with syntax and that cognitive capabilities changed along with tool production and manipulation. Population Migrations: Analysis through Studies on Mitochondrial DNA and Y Chromosomes Mitochondrial DNA and Y-chromosome haplotypes have been used to define archaic and more recent population migration. Mitochondrial haplotypes are described in Chapter 6. Y Chromosome Haplotypes The Y chromosome carries relatively few genes and most of the Y chromosome does not recombine with other chromosomes (Jobling & Tyler-Smith, 2003). Y-chromosome-specific microsatellite repeat polymorphisms, also known as short tandem repeats (STRs), have been predominantly used to define
34
Phenotypic Variation
haplotypes or haplogroups for population migration studies. The primary haplogroups A and B occur in Africa. Subhaplogroups result from replication; population fragmentation, migrations, isolation, and expansion then resulted in differences in frequency of haplogroups in different parts of the world. Eighteen different haplogroups have been defined. In Africa, A and B haplogroups predominate. D and E occur in Africa and Asia. C occurs in eastern Asia and Oceania. J and I occur predominantly in the Middle East and Europe. In Europe and northwestern Asia, I, J, N and R predominate. N and O occur in eastern Asia. Q occurs in northeastern Asia and in the Americas. Y-Chromosome Haplotype Studies Using SNPs and STR Polymorphisms Y-chromosome haplotypes representing allelic variation at single nucleotide polymorphic sites (SNPs) and short tandem repeat polymorphisms (STR) have been used more recently to analyze male ancestral migrations and to define subhaplotypes. Capelli et al. (2003) analyzed polymorphisms in 1,772 Y chromosomes from 25 small urban locations in Britain. They also collected samples from Norway, Denmark, and Germany. They determined that different locales within Britain had different paternal histories. They identified specific haplotypes present at a frequency of 5% in Orkney and Shetland isles that were absent from other parts of Britain. Specific haplotypes present in frequencies of 6 to 7% in samples from central England were absent from Irish, Welsh, and Scottish populations. Capelli et al. (2006) used Y-chromosome haplotypes to investigate population structure in the Mediterranean Basin. They determined that northern African populations show little Y variation and that the frequency of the E3 haplotype is higher than 50% in that population. In Mediterranean samples, the frequency of haplotype is not above 29%. In contrast a higher frequency of Arab haplotypes was found, indicating a higher gene flow between Arab countries and southern and eastern Mediterranean coasts.
3 GENOMIC ARCHITECTURE AND COPY NUMBER CHANGES
ROLE OF GENOME ARCHITECTURE CHANGES IN EVOLUTION Cytogenetic studies carried out several decades ago revealed large-scale rearrangements that differentiated human and chimpanzee genomes (Lejeune et al., 1973; Yunis & Prakash, 1982). These rearrangements included fusion events that generated human chromosome 2, pericentric inversions, and heterochromatin expansions. Availability of genome sequence information and microarray analyses have more recently provided information on microheterogeneity, and have revealed that additional smaller inversions and copy number changes, including duplications and deletions, distinguish human and chimpanzee genomes. Kehrer-Sawatzki and Cooper (2007) reported that structural divergence is particularly marked in the subtelomeric regions. Telomeric caps generated by expansion of segmental duplications are particularly common in chimpanzees and gorillas. These investigators reported further that nine intrachromosomal pericentric inversions are most likely important for separation of human and chimpanzee lineages. They postulated that pericentric inversions could impact function through four mechanisms: gene disruption, formation of chimeric genes, altered expression in regions of breakpoints, and suppression 35
36
Phenotypic Variation
of recombination. Sequence analyses have revealed that segmental duplications occur in pericentric inversion regions. Kehrer-Sawatzki and Cooper concluded that further studies on gene expression are necessary to determine the importance of structural and copy number changes on lineage determination. They noted that function has not yet been defined for many of the genomically identified genes that show lineage-specific copy number changes.
GENERATION OF NOVEL GENE FAMILIES THROUGH SEGMENTAL DUPLICATION DURING EVOLUTION Vandepoele et al. (2005) investigated segmental duplications that arose in the human genome. They defined segmental duplications as, “regions of one to several hundred kilobases that exist in at least two copies in the haploid genome and have a sequence similarity greater than 90%.” Segmental duplications in the genome are particularly enriched in telomeric and centromeric regions. A number of these segmental duplications harbor genes. Vandepoele et al. (2005) identified a novel gene family located within duplicated regions on chromosome 1, including 1p36, 1p12, and 1q21. They identified a specific gene that maps within the duplicated region on chromosome 1p36 at the site of a recurrent breakpoint; in cases with neuroblastoma, this gene was designated NBPF1. These investigators analyzed the structure of the neuroblastoma breakpoint protein family (NBPF) gene and homologous sequences in primates. The NBPF gene family is apparently specific to primates. NBPF1, the specific NBPF gene disrupted by the translocation present in neuroblastoma, spans 51 kb and has a repetitive gene structure with sequence identity present in several exons and flanking introns. There are 25 coding exons in NBPF1; exons 2, 7, and 12 show 95% sequence identity. NBPF1 cDNA encodes a 1213 amino acid protein, and within this protein there is a novel repeat domain, DUF1220. There are several copies of this repeat domain in NBPF. The repeat domain also occurs once in the protein myomegalin. The myomegalin locus maps adjacent to NBPF1 on chromosome 1p36. NBPF1 gene homologs also occur on chromosome 1p12, 1q21, and 1q42. They contain exons homologous to NBPF1 and they contain nonhomologous exons. In silico analyses reveal short NBPF1 homologous sequences on chromosome 3p and on 5q. Vanderpoele et al. (2005) reported that quantitative real-time polymerase chain reaction (PCR) analyses revealed the presence of NBPF transcripts in a number of different tissues including breast, liver, lung, kidney, and brain.
Genomic Architecture and Copy Number Changes
37
They noted that the precise functions of NBPF genes remain to be elucidated. NBPF sequences are overrepresented in sarcomas and small cell lung carcinomas.
GENOMES AS COMPLEX MOSAICS OF DIFFERENT SEGMENTS Johnson et al. (2006) reported occurrence of 450 duplication hubs in genomes of humans and great apes. They noted that the duplication processes generated genomes that are complex mosaics of different segments. Duplication processes created novel genes, fusion genes and gene families. These investigators reported further that human chromosome 16 represents an extreme example of segmental duplication activity. They identified the Morpheus gene family within the low-copy repeat element on chromosome 16 (LCR16), and determined that three blocks of LCR16 duplications occur at 16q22. Twenty blocks of LCR16 duplicons occur on chromosome 16p. Duplication blocks range in size from 19,784 nucleotides to 604,376 nucleotides. They determined that LCR16 has duplicated independently in each of the great ape lineages. Other sequence elements that flank the LCR repeats also show duplication. Johnson and Eichler proposed that the LCR16 elements serve as a source for repair of double-stranded breaks in the genome.
DEVELOPMENT OF SEGMENTAL DUPLICATION MAPS USING SEQUENCE DATA Marques-Bonet et al. (2009) developed segmental duplication maps for four primate genomes (macaque, orangutan, chimpanzee, and human), by aligning whole genome shotgun sequence data. They analyzed sequences to identify lineage-specific and shared duplications. They used fluorescence in situ hydridization (FISH) analysis of chromosomes to confirm locations of duplications. They also developed a primate-specific segmental duplication microarray. Their data analysis revealed that 80% (55 megabases) of the segmental duplications present in humans arose after divergence of the Old World monkey and hominid lineages. Hominid lineages include chimpanzee, bonobo, and human. Marques-Bonet et al. reported that humans and chimpanzees share many specific duplications and that they have a significantly greater number of duplications than macaque or orangutan. They classified 10 megabases of duplication sequence as human-specific; 17 complete genes and 39 partial genes were
38
Phenotypic Variation
present in the duplications. Copy number increases in amylase, aquaporin, and NBPF were present in humans and chimpanzees. These investigators concluded that the most significant bursts of segmental duplication occurred in the common ancestor of humans and chimpanzees, after divergence of the gorilla from this lineage. They determined that subsequent recurrent duplication events took place. Segmental Duplications and Core Duplicons Jiang et al. (2007) reported that a small subset of core duplicons constitute the centers around which the duplication architecture arose. These investigators reported that approximately 437 blocks of human genomic sequence of human sequence manifest evidence for multiple evolutionary duplication events. Within these blocks, there is mosaic architecture of duplicated segments. Jiang et al. (2007) carried out sequence analysis to analyze individual blocks. They determined that some blocks are restricted to a specific chromosome, others occur on multiple nonhomologous chromosomes. In some cases, gene families are embedded in the core duplicons. One example is the occurrence of NBPF1 and DUF1220 gene families on chromosome 1. The protein DUF 1220 is encoded by the gene NBPF1. RAN binding proteins (RANBP) are members of a gene family that are embedded in core duplicons; the RANBP2 locus on chromosome 2q12.3 encodes a component of the nuclear pore complex nucleoporin 358. These proteins also interact with ubiquitin-like modifiers of protein encoded by SUMO (small ubiquitin related modifier). COMMON AND RARE COPY NUMBER VARIANTS Itsara et al. (2004) noted that it is important to distinguish between common and rare copy number variants. Common polymorphic variants are small often less than 10 kb in size; polymorphic variants have a frequency greater than 1% in the population. Copy number variants (CNVs) larger than 100 kb are present at frequencies less than 1%. They note that CNVs larger than 1 Mb are rare in the population and that rare CNVs frequently result from non-homologous recombination between segmental duplications or low-copy repeats. Common copy number variation is illustrated in the microarray heat map in Fig. 3–1. In that figure, a rare copy number change involving a deletion in the neurexin 1 gene (NRXN1) is also depicted. Stefansson et al. (2008) postulated that risk alleles that lead to phenotypes such as mental retardation, autism, or schizophrenia are selected against during
Genomic Architecture and Copy Number Changes
39
Figure 3–1. Heat map of portion of chromosome 2 generated using Affymetrix 6.0 SNP microarrays and genomic DNA samples from 27 individuals. Note highly polymorphic region on the right side of the image; some individuals have higher copy number (lighter color) others have lower copy number (darker color). In the mid–section of the image a low copy number region occurs in one individual; this corresponds to a deletion within the NRXN1 (neurexin 1) gene.
evolution and that they are therefore rare in the general population. They proposed, therefore, that rare variants that arise de novo in a population are more significant for disease phenotypes than common variants. These investigators carried out a comprehensive analysis of parent-child trios in a normal population to search for CNVs that arose de novo in children. They identified 66 de novo CNVs in an analysis of 9,878 transmissions. The authors noted that of the 66 de novo CNVs, 23 were flanked by low-copy repeats; nine had a low-copy repeat on one end, and 34 were not flanked by repeats. The variants not flanked by repeats were individually rare: 27 of the 34 were found only once in the population. This study reported by Stefansson et al. (2008) will be discussed further in the context of copy number variants and Schizophrenia. Taking the Genomic Landscape into Account Yang et al. (2009) emphasized the importance of investigating the summation or combination of a series of common and rare copy number variants in different genomic regions to define the contribution of CNVs to disease risk.
40
Phenotypic Variation
They noted that studies in multigenerational families would be particularly important in this regard.
RECURRENT COPY NUMBER VARIANTS AND PHENOTYPE Interspersed segmental duplications in the human genome result in 10% of the genome being prone to recurrent microdeletions and microduplications (Mefford et al., 2009). Low-copy repeat sequence DNA is present in regions of segmental DNA. In these 50 kb to 10 Mb of unique sequence, DNA is flanked on either side by highly homologous low-copy repeat DNA blocks of approximately 10 kb. Mefford et al. (2009) reported that large microdeletions and microduplications underlie 15% of cases of mental retardation. They emphasized that a diversity of phenotypes may be associated with a specific genomic rearrangement. However, some genomic rearrangements may lead to a fairly consistent phenotype. Patients with 17q21.31 microdeletion have similar facial dysmorphology, global developmental delay, and friendly behavior. On the other hand, patients with 10q22-q23 microdeletions have various cognitive and behavioral abnormalities of varying degree. Mefford et al. (2009) noted that, thus far, patients with neurocognitive and neurobehavioral disorders have been selected for microarray analysis. However, as the repertoire of patients examined by microarray analyses increases, other conditions are being found to be associated with copy number variants. Patients with a 500 kb microdeletion on chromosome 1q21.1 have thrombocytopenia, absent radius syndrome, and no cognitive impairment. The effects of the deletion are not highly penetrant and modifying factors are apparently necessary for expression of the abnormal phenotype. They reported that a 1.5 Mb microdeletion on 17q12 that deletes the hepatocyte nuclear factor (HNF1B) gene (a transcription factor) predisposes to multicystic dysplastic kidneys. Many studies have revealed specific regions that give rise to microdeletions and microduplications. Microduplications also result in phenotypic abnormalities. Microdeletions and microduplications that involve chromosome 16p11.2 occur in 0.01% and 0.03%, respectively, of the general population. Deletions and duplications in this region are more common in individuals with language and behavioral problems. Mefford et al. (2009) proposed that microdeletions and microduplications are responsible for disease but that common modifiers, including genetic, epigenetic and environmental factors, impact the phenotype. They suggested further that purifying selection takes place so that large copy number variants are not transmitted to subsequent generations and that they most commonly arise de novo.
Genomic Architecture and Copy Number Changes
41
They noted that many potentially pathogenic copy number changes arise by mechanisms other than homologous recombination and are infrequent. Furthermore, since these changes are individually rare, their role in disease pathogenicity is difficult to prove. They emphasized that large cohorts will be needed to determine the pathogenicity of rarer copy number variants and that it will be important to be able to fully access patients and families where these variants are found.
MECHANISMS THROUGH WHICH CNVs IMPACT PHENOTYPE: EFFECT ON THE TRANSCRIPTOME In studies on wild mice and inbred strains, Henrichsen et al. (2009) carried out analyses of copy number variations and transcriptomes. They determined that specific CNVs impacted expression of genes located within the CNVs and, furthermore, that CNVs influenced expression of genes in their vicinity. They noted that this effect frequently extended for half a megabase beyond the CNV. They postulated that specific CNVs may contain regulatory elements, including enhancers and insulators and may have a more profound effect on expression of genes that map in their vicinity. Yang et al. (2009) carried out expression analysis in addition to copy number analysis in a three-generation family with bipolar affective disorder. Their studies revealed CNVs in four regions that were enriched in affected subjects. The regions were located at 6q27, 9q21.11, 12p13.31, and 15q11. They determined that these CNVs influenced expression of genes at or near the site of the variants. However, they also noted that in analysis of cell lines with duplication of SNRPN (small nuclear ribonucleoprotein polypeptide N and NDN (necdin homolog) on chromosome 15q11, the expression changes were outside these regions. They concluded that for insight into the significance of specific CNVs it will be essential to determine the location and function of regulatory elements within introns or in intergenic regions included in CNVs.
VARIABLE PHENOTYPES ASSOCIATED WITH COPY NUMBER VARIANTS Copy Number Variation in Schizophrenia Stefansson et al. (2008) designed a copy number analysis based on the premise that risk alleles that lead to autism, schizophrenia, and mental retardation are selected against during evolution and that they are therefore rare in the
42
Phenotypic Variation
general population. This premise predicts that rare variants should be more common in affected individuals than in the general population. These investigators carried out an analysis of parent-child trios in a control population to search for CNV that arose de novo in the offspring. They identified 66 de novo CNVs greater than 400 kb in an analysis of 9,878 transmissions. Of the 66 de novo CNV 23 were flanked by low-copy number repeats, nine were flanked by a single repeat at one end and 34 were not flanked by repeats. They then expanded their study to a much larger sample of controls and cases of schizophrenia from a number of different countries. These studies revealed that the overall number of CNVs in schizophrenia, using their search criteria, was low. However, there was a significantly higher incidence of specific copy number variants in the schizophrenia cases than in controls. Particularly significant CNV occurred at chromosomes 1q21.1, 15q11.2, and 15q13.3. The deletion in chromosome 1q21.1 occurred in 11 out of 4,718 cases of schizophrenia and in eight out of 41,999 controls. The 15q11.2 deletion occurred in 26 out of 4,718 cases of schizophrenia and in 79 out of 41,994 controls. The 15q13.3 deletion was present in seven out of 4,213 cases and in eight out of 39,000 controls. The authors emphasize that phenotypes associated with a specific CNV may not fit within the “nosological borders” criteria currently defined for a specific psychiatric disorder (e.g., in the diagnostic and statistical manual [DSMIV]). Need et al. (2009) reported results of a genome-wide analysis of single nucleotide polymorphisms (SNPs) and copy number variants in Schizophrenia. They initially studied a cohort of 1,460 patients and 12,995 controls. They subsequently analyzed 1,073 cases and population-based controls. In the genome-wide association studies, no SNP attained significance. In the initial analysis Need et al. evaluated CNVs greater than 500 kb in size that included 20 SNPs and were rare in controls. Their studies revealed that deletions greater than 1 Mb in size were more frequent in cases than in controls. They subsequently concentrated on deletions 2 Mb in size or larger since no deletions of this size occurred in controls. They identified eight such deletions in schizophrenia patients, and four of the eight deletions occurred in chromosome 22q11.2; two deletions occurred in chromosome 1q21.1. In addition, they identified a 2.69 Mb deletion on 16p13.11-16p12.4. This deletion overlapped the nudE nuclear distribution (NDE1) gene that encodes a protein that binds to Disrupted in Schizophrenia (DISC1). Two cases were found to harbor smaller deletions that overlapped this region. A large deletion 3.25 Mb in size on chromosome 8p22 occurred in one patient with schizophrenia.
Genomic Architecture and Copy Number Changes
43
This region included three genes previously associated with schizophrenia, peri-centriolar material 1 (PCM1), N-acetyltransferase genes (NAT1 and NAT2), and two genes previously associated with mental retardation: tumor suppressor candidate gene 3 (TUSC3) and acyl-sphingosine hydrolase (ASAH1). Large duplications unique to schizophrenia patients included 9.4 Mb duplication on 15q11-q13.3 (chromosome position approximately 21 to 30 Mb). The authors noted that this duplication includes the amyloid beta precursor binding protein (APBA2) gene, previously associated with schizophrenia. They also observed a case with a 15q13 duplication (chromosome position 28.72 to 30.3 Mb). In a search designed to detect CNVs greater than 100 kb in size, Need et al. reported that 91 of 441 samples from Aberdeen harbored such CNVs. The authors note that the Aberdeen sample included a high number of childhood onset schizophrenia patients. In samples from Munich there was a trend toward significance for more CNV changes, specifically duplications, in patients versus controls. The cohort from the United States manifested a trend toward more deletions in cases than in controls (significance p=0.08). In six patients, deletions occurred on chromosome 11q23 (112,772,031-112,778,135 bp). Need et al. also identified three cases with deletions that encompassed the 3' end of the neurexin 1 gene. These studies support the conclusion that rare deleterious structural anomalies play a role in the etiology of schizophrenia. Furthermore, there is evidence that recurrent genomic events in specific chromosome regions predispose to schizophrenia. Dosage Changes within Specific Genes and Their Roles in Autism and Schizophrenia As previously noted, there is evidence that copy number changes within a specific gene may lead to more than one psychiatric disorder. There are reports of disruption of the neurexin 1 gene in individuals with autism (Szatmari et al., 2007; Kim et al., 2009) and in individuals with schizophrenia (Kirov et al., 2009). Rujescu et al. (2009) carried out a detailed analysis that encompassed all the NRXN1 exons and several kilobases of upstream sequence in 2,977 cases of schizophrenia and in 33,746 controls. They established that CNVs in the NRXN1 locus varied in size from 18 to 420 kb. In schizophrenia cases, they found 12 deletions and two duplications (frequency 0.47%) and in controls CNVs occurred with a frequency of 0.15%. Specific studies on copy number variants in exons revealed that these occurred significantly more frequently in cases than in controls (p=0.0027). The authors emphasized that both deletions
44
Phenotypic Variation
and duplications that impact exons are important since they impact protein structure and splicing. The NRXN1 transcript undergoes extensive alternate splicing that leads to as many as 2,000 isoforms. Rujescu et al. (2009) reported that the NRXN1 CNVs have low-copy repeat elements at their breakpoints. They noted that other proposed mechanisms for generation of CNVs include microhomologies greater than 25 base pairs, microsatellites, and non-processed pseudogenes. Other replication-based mechanisms of copy number variation include replication fork stalling and template switching.
OVERLAP BETWEEN DIFFERENT PSYCHIATRIC PHENOTYPES In a review of recent findings in genomic analysis of psychiatric disorders, St. Clair (2009) noted that rare, highly penetrant mutations, based on copy number variation at 1q21, 15q11.2, 15q13.3, 16p11.2, and 22q12 and at the neurexin 1 locus, increase the risk of a number of different psychiatric disorders; these include schizophrenia, mental retardation, and autism. He noted further that these phenotypes may be associated with deletions or duplications in these regions and that the new findings raise questions concerning the classification of major neuropsychiatric disorders and genetic counseling. St. Clair interpreted these results as indications that distinct psychiatric disorders may share a common etiology. St. Clair noted that it would be important to carry out detailed phenotypic analyses in patients with different CNVs. He emphasized that it will be important to identify additional genetic and environmental risk factors that precipitate disease in carriers of these genomic abnormalities. The manifestations of schizophrenia found in patients with these genomic abnormalities were indistinguishable clinically from classical schizophrenia. The high incidence of de novo copy number changes likely explains the higher frequency of schizophrenia in children of specific parents of than in siblings of the parents. A number of investigators have noted that within CNVs found in cases with neuropsychiatric manifestations, there is an overrepresentation of genes involved in brain development and synaptic plasticity. Specific pathways are now recognizable that include risk genes. Multiple cases with deletions of neurexin 1 occur across different studies of schizophrenia patients. Walsh et al. (2008) reported that ERBB4 genes are disrupted in schizophrenia. ERBB4 encodes receptors for neuregulin and neurexin. Most important is the question as to whether underlying stressors predispose to generation of copy number variations.
Genomic Architecture and Copy Number Changes
45
Variable Phenotypes Associated with Deletions in 1q21.1 As previously described, the chromosome 1q21 region contains low-copy repeat elements that are subject to genomic rearrangements that lead, in some cases, to deletions within 1q21.1. Brunetti Pierri et al. (2008) described findings in 17 cases with 1q21.1 deletions. The deletions they described did not include the adjacent region that, when deleted, gives rise to a syndrome associated with thrombocytopenia and absent radius (TAR). Phenotypic findings in the patients described by Brunetti Pierri et al. included frontal bossing, deepset eyes, and bulbous nose. They noted that frontal bossing and hypertelorism occurred in patients with microduplications in 1q21.1. Dosage imbalance in this chromosomal region led to developmental delay and learning disabilities in most cases. Autism, ADHD, anxiety, depression, and antisocial behavior occurred in several patients in their study. A range of other congenital anomalies occurred in some of the patients; these included cataracts, arthrogryposis, and limb abnormalities including clubfeet and hip dysplasia. In the 1q21.1 microdeletion cases the average head size was significantly decreased. Microduplication of 1q21.1 led to increased head circumference in about 50% of patients. The authors postulated that the hydrocephaly inducing homolog (HYDIN) gene that maps within 1q21.1 might play an important role in determining head circumference. Brunetti-Pierri et al. referred to reports that variants in1q21.1 are associated with schizophrenia and that some cases of this disorder have reduced head size and facial dysmorphology. These authors noted further that 1q21.1 copy number variations occurred in a number of apparently unaffected parents of affected children. They emphasized that penetrance of disease manifestations may vary. Furthermore they emphasized that the rearrangements in unaffected parents may not be identical to the rearrangements present in their children.
Variable Phenotype Associated with 16p11.2 Rearrangements Bijlsma et al. (2009) carried out array comparative genomic hybridization (CGH) on 4,284 patients with mental retardation. They identified 14 patients with 16p11.2 deletions, six patients had de novo deletions, six had inherited deletions from an unaffected parent, and in two cases, parents were not assessed. The deletion extended from 29.5 Mb to 30.1 Mb. Only one of the cases in their study was formally diagnosed with autism. They did not identify specific phenotypic features that were common to all patients with the deletion.
46
Phenotypic Variation
Biljsma et al. (2009) subsequently analyzed 22 individuals, including 14 patients and eight family members who each had an approximately 600 kb deletion in 16p11.2. They concluded that this deletion is associated with a variable phenotype. Individuals with this deletion may have an apparently normal phenotype with no apparent dysmorphology or intellectual impairment. However, individuals with the deletion may manifest dysmorphic features, and isolated developmental problems such as speech delay and dyslexia. Some cases with the deletion manifest autism or mental retardation. These authors noted that other microdeletion syndromes manifest variable phenotypes; one example is the 22q11 microdeletion. They postulated that variability in phenotype might relate to the fact that, in some cases, the deletion unmasks a deleterious allele in the homologous gene region. Consideration of the results reported by Biljsma et al. raise the question as to whether in segmental microdeletion or microduplication syndromes the ultimate phenotype is impacted by polymorphic variation in other parts of the genome. This variation could include copy number variation and gene polymorphisms or regulatory region polymorphisms. As noted previously multiple low-copy repeat elements are present on chromosome 16p11-16p13 and predispose to copy number variants. There have been reports that variants in this region occur in 1% of patients with autism. Variations in Phenotype in Patients with Deletions in 15q13.3 Helbig et al. (2009) carried out genomic screening in 647 unrelated cases of idiopathic epilepsy, defined as IGE syndrome, benign epilepsy of childhood with centrotemporal spikes. They also screened 1,202 population controls. In the epilepsy cases they identified seven individuals with chromosome 15 microdeletions. In six cases there were deletions of 15q13.3, between 15q breakpoints BP3 and BP4. In one case there was a deletion that occurred between 15q breakpoints BP4 and BP5. Seven genes map in this interval. However, Helbig et al. considered the CHRNA7 gene to likely be the most important epilepsy predisposing gene. In a follow-up study, these investigators examined 576 epilepsy cases from Europe and North America and 2,497 European ancestry controls. In five of the 576 cases 15q13.3 deletions occurred; no deletions were found in the control samples. In the total sample of epilepsy cases studied duplications involving CHRNA7 occurred in 12. CHRNA7 duplications occurred in 23 of 3,699 controls.
Genomic Architecture and Copy Number Changes
47
In five of the probands with 15q13.3 deletions, parental DNA was available. In one proband the deletion was de novo, in four cases deletions were inherited from a parent. In one case the mother who had the same deletion as the proband had a diagnosis of panic disorder. In the other three cases the parents were clinically normal. In one family, a brother of the patient carried a 15q13.3 microdeletion that was apparently the same as that present in the proband; he was severely impaired intellectually but was seizure-free. Helbig et al. (2009) reported that of the 12 probands with microdeletions, one manifested severe intellectual disability and two had mild intellectual disability. In nine of the 12 probands, idiopathic generalized epilepsy occurred in the absence of intellectual disability and dysmorphism. These investigators noted that previous reports on cases of 15q13.3 deletions were reported to have schizophrenia or autism. They emphasize that their study provides evidence that shared mechanisms are involved in neuropsychiatric disorders. Dibbens et al. (2009) reported the occurrence of 15q13.3 deletions in seven out of 539 cases of idiopathic generalized epilepsy. In three cases deletions were de novo. In four of the seven pedigrees, there were individuals who carried the deletion but did not manifest the phenotype. In three of these pedigrees, there were individuals who manifested epilepsy but did not have the deletion. These findings led Dibbens et al. to propose that structural genomic variations contribute to human disorders with complex inheritance.
PENETRANCE AND CONTRIBUTION TO COMPLEX INHERITANCE 15q13.3 Sharpe et al. (2008) characterized 15q13.3 microdeletions. Probands with this deletion manifested mental retardation, facial dysmorphism, and digital anomalies. The microdeletion varied in size in different individuals from 1.5 Mb to 3.9 Mb. The 1.5 Mb deletion occurred between 15q breakpoints defined as BP4 and BP5; these breakpoints flank a region that undergoes frequent inversion. One patient had inherited the deletion from an unaffected father. Sharpe et al. concluded that this deletion might be pathogenic and manifest incomplete penetrance. They then used quantitative polymerase chain reaction (PCR) to screen for 15q13 deletions in 1,040 individuals with mental retardation, and they identified four individuals with the BP4-BP5 deletion. These investigators noted that Golgin repeat sequences are located in most of the breakpoints on
48
Phenotypic Variation
chromosome 15. In screening 900 individuals in a control population, they identified one individual with a BP3-BP4 deletion and one with a BP4-BP5 deletion. They noted that the CHRNA7 gene that encodes cholinergic receptor neuronal nicotinic alpha polypeptide 7 maps within the 1.5 Mb region between BP4 and BP5. The CHRNA7-encoded protein is present at synapses and is involved in neuronal signaling.
PHENOTYPE IN MICRODELETION SYNDROMES There is evidence that in subjects with specific segmental chromosome anomalies, phenotypic diversity exists. Van Bon et al. (2009) emphasized the variability of the phenotype associated with 15q13.3 dosage changes. This variability occurs not only between families but also within families. Importantly, these authors noted that in some cases deletion of 15q13.3 is not sufficient to cause phenotypic variation. They reported that of 16 cases of chromosome15q13.3 (BP4-BP5 deletion) two had de novo deletions and 11 were inherited deletions, in three cases parents were not studied. Phenotypes documented initially in 15q13.2–15q13.3 deletions included mental retardation, epilepsy, or abnormal EEG findings. Miller et al. (2009) studied 1,445 unrelated patients referred for clinical evaluation and 1,441 patients with autism from the Agre registry (Autism Genetic Resource Exchange). In this sample they identified five patients with BP4-5 deletion, three patients with BP4-5 duplication and two patients with smaller overlapping duplications. Miller et al. stated that BP4 occurs at approximately 27,729 kb and BP5 at approximately 30,298 kb. The 1.5 Mb region contains six protein-encoding genes and a microRNA gene, miRNA211. The protein-encoding genes included myotubularin related genes (MYMR15 and MTMR10), transient receptor potential cation channel, subfamily M (TRPM1), OTU domain containing gene (OTUD7A), and a cholinergic receptor gene (CHRNA7). Miller et al. (2009) reported that the six patients with 15q12-q13 microdeletions included one with a diagnosis of pervasive developmental disorder (PDD NOS), two with language delay, one with autistic spectrum disorder, and one with a diagnosis of mental retardation. All six had expressive language impairment. In two cases deletions were inherited from a mother who had learning difficulties. The patients also manifested mild hypotonia and delayed age of walking (15 to 24 months).
Genomic Architecture and Copy Number Changes
49
Studies on patients with duplications in 15q13.2 to 15q13.3 revealed that these duplications varied in size from 0.5 to 1.98 Mb. Four of the five patients with these duplications had a diagnosis of autism and one patient had language delay. One of the patients with autism was also diagnosed with obsessive-compulsive disorder. In two patients the duplication was determined to be de novo. One patient had a duplication inherited from an apparently unaffected mother and grandfather. Miller et al. reported that in addition to language delay and/or autistic behaviors, many of the patients with 15q12-q13 imbalances manifested neurobehavioral symptoms that included attention problems, anxiety, mood instability, and impulsivity. They noted that the CHRNA7 gene that maps in this region had been implicated in schizophrenia and bipolar disorder. Explanations for the variable phenotype in 15q12-q13 imbalances include genotype variation in homologous genes and variation elsewhere in the genome. There is also a possibility that in some cases inversions may be present in this region of the genome (Flomen et al., 2008). Pagnamenta et al. (2008) reported the occurrence of a 15q13.3 deletion in a multiplex autism family. All three children in this family met criteria for autism based on standardized diagnostic assessments ICD10, ADOS, and ADI testing. They manifested language delay; their IQ scores ranged from 72 to 96. No dysmorphology was found. Head circumferences were at the 97th percentile. Deletion of 15q13.3, between 28,736 and 30,686 kb was present in the affected children who were male and in their unaffected mother. Pagnamenta et al. proposed that the 15q13.3 deletion acts in concert with modifier genes, other contributing copy number variants, or environmental exposures to determine the phenotype. It is important to note that 15q13.3 deletions have been reported in association with schizophrenia in three large-scale studies. Other Possible Explanations for Variable Penetrance of Microdeletions It is possible that deletions may unmask a mutation in a homologous allele on the nondeleted chromosome. The specific phenotype may then be recessive. Another possible source of variability may be related to the fact that there is a common inversion in the 15q13.3 region. Phenotypic variability in different members in specific kindred may be caused by differences in gene order and structure on the homologous chromosome, depending on whether or not an inversion is present.
50
Phenotypic Variation
Defining the Significance of Specific Structural Genomic Abnormalities In analyzing a specific deletion that encompasses a number of genes and is associated with phenotypic abnormalities, a key question that arises is whether or not deletion of one specific gene is more important than others in the production of the specific phenotype. This question may be answered through studies on a number of different individuals with deletions that only partly overlap the region. It may also be answered if in other patients with similar phenotype mutations are found in one specific gene in the deletion region. It is also possible that in some deletion syndromes, different aspects of the phenotype result from deficiencies in different specific gene products.
ALTERED GENE DOSAGE, ALTERED HOMEOSTASIS, AND OVERLAPPING NEUROLOGICAL SYMPTOMS Homeostasis may be defined as “the ability of a system to return to a set-point after perturbation.” Ramocki and Zoghbi (2008) proposed that neuronal homeostasis might be readily disrupted by alterations in protein levels. They emphasize that alterations within hundreds of different genes may lead to autism or to mental retardation. They propose that autism and mental retardation are common endpoints of a number of conditions where homeostasis is altered. They noted that genotype cannot readily predict neurophenotype. Furthermore, gain or loss of proteins or RNA often lead to overlapping sets of neurological symptoms.
GENE-DOSAGE-ATTRIBUTABLE OCULAR PHENOTYPES Chanda et al. (2008) reported that despite the growing body of information on the role of submicroscopic structural variants in determining human variation and disease, few specific variants have been analyzed at the base-pair level. The authors note that there is evidence that the eye is particularly sensitive to effects of altered gene dosage. Furthermore, the eye is accessible to detailed phenotypic analysis. Abnormalities on chromosome 6p25 lead to a spectrum of abnormalities, including Axenfeld Rieger syndrome (ARS), associated with abnormal development of the anterior segment of the eye and glaucoma. Chanda et al. (2008) noted the unique architecture of the chromosome 6p25 region, within which
Genomic Architecture and Copy Number Changes
51
tandem-arranged forkhead transcription loci (FOXC1, FOXF2, and FOXQ1) occur. These authors designed a study to identify chromosome 6p25 rearrangements in the ocular phenotype ARS, and to examine rearrangements at the base-pair level. Their studies led to elucidation of a novel mechanism in the generation of the 6p25 abnormalities. They demonstrated a constant involvement of FOXC1 in the ARS-associated rearrangement and variable involvement of FOXF2 and FOXQ1. Chanda et al. reviewed mechanisms involved in the generation of copy number changes elsewhere in the genome. They noted that most often copy number variations are generated in regions with low-copy repeats (LCRs). During meiosis, low-copy repeats often misalign, leading to nonallelic homologous recombination. In these copy number changes, common breakpoints are found in different individuals. In regions where copy number variants manifest different breakpoints among different individuals, the breakpoints occur in regions that show microhomology. Repair of breaks in these regions is error prone and leads to deletion or insertion of nucleotides at the breakpoint site. In the 6p25 region, repetitive sequence elements occur that are shorter than LCR elements. Variable numbers of repeats of the nucleotide sequence GTG occur at the breakpoints. Repetitive GTG elements are known to impede polymerase progression. Chanda et al. reported that 6p25 segmental anomalies are unusual in that they vary in size from 30 to –1,220 kb. Breakpoint analysis revealed that mixed mechanisms were likely involved in their generation and included nonallelic homologous recombination and nonhomologous end joining. They noted further that the presence of three tandemly repeated paralogs, FOXC1, FOXF2, and FOXQ1, likely play a role in generation of structural variation.
THE PHENOTYPE IN TELOMERIC AND SUBTELOMERIC CHROMOSOME ABNORMALITIES In 1996, clinical FISH cytogenetic studies were expanded to include the use of probes for subtelomeric regions of chromosomes to search for abnormalities in children with unexplained developmental delay, mental retardation, and/or dysmorphic features. With the advent of array-based methods to search for chromosome dosage changes and inclusion of comprehensive coverage of subtelomeric regions, further insight into the consequences of subtelomeric abnormalities has emerged (Ballif et al., 2007). There is, however, evidence for polymorphic variation in repeat sequence elements in subtelomeric regions. It is therefore important to consider whether or not a specific variant constitutes a pathological variation.
52
Phenotypic Variation
In the study reported by Ballif and coworkers, detection of subtelomeric abnormalities on chromosomes through microarray studies was followed by FISH analysis to confirm abnormalities. These investigators identified subtelomeric abnormalities in 3% of cases referred by clinicians because of mental retardation, developmental delay, and/or congenital anomalies. Of 90 cases with subtelomeric abnormalities, 33 were subsequently found to have unbalanced translocations, 37 had terminal deletions, 19 had interstitial deletions and one had a complex rearrangement. Of unclear clinical significance are cases where subtelomeric abnormalities are present in a patient with autism and in a parent. Ballif et al. reported that this finding occurred in 1.8% of cases. Ballif et al. noted that breakpoints do not necessarily cluster at the most distal chromosome end, but are spread over the length of the distal chromosome segment and sometimes appear as interstitial abnormalities close to the chromosome ends.
TELOMERES: STRUCTURE, SYNTHESIS AND DEFECTS Telomeres contain double-stranded DNA and single-stranded DNA, and are rich in repeats of a specific sequence (TTAGG). The precise sequence of these repeats differs in different organisms. The DNA strands at the telomere form a complicated loop structure held in place by telomere binding proteins (Ly, 2009). The telomerase complex is necessary for synthesis of the chromosome ends. There is also evidence that telomerase acts in repair of double-stranded DNA breaks. Greider and Blackburn first described telomerase in 1985. Blackburn, Greider, and Szostek were awarded the 2009 Nobel Prize in Physiology and Medicine for their discovery of telomerase and telomere structure. Telomeres are progressively lost from the ends of chromosomes during DNA replication in each cell division. This loss controls the numbers of replications that cells can undergo and constitutes a molecular clock. Hayflick (1975) defined this replication clock through studies in cultured cells. Prolonged cell survival can be initiated with increased telomerase expression. Cancer cells often have increased levels of telomerase expression. The main components of telomerase are TERT (encoded on 5p15.3) that acts as an RNA-dependent DNA telomerase, and TERC (encoded on 3q26) that contains RNA and serves as a template for synthesis of the repetitive DNA element of telomeres (O’Reilly et al., 1999). There is now evidence that TERC RNA belongs to the Cajal-body-specific RNA family (scaRNA) (Jady et al., 2004).
Genomic Architecture and Copy Number Changes
53
Additional complexity of telomerase has been revealed in part through studies on patients with specific disorders characterized by telomere abnormalities; manifestations of these disorders include aplastic anemia, dyskeratosis congenita;, and idiopathic pulmonary fibrosis. The genes mutated or deleted in these disorders encode proteins and ribonucleoproteins that form the telomerase holoenzyme complex. They include dyskerin and the ribonucleoproteins NOP10, NHP2, and GAR1 that associate with the H/ACA (hairpin-hingehairpin-tail structure) motif in TERC RNA. Specific Diseases Caused by Telomere Dysfunction Dyskeratosis congenita is an inherited disease with mucocutaneous abnormalities, nail dystrophy, early aging, aplastic anemia, and tendency to develop tumors. X-linked, autosomal dominant and autosomal recessive forms of this disease occur. The dyskeratin gene DKC1 on Xq28 gives rise to the disease in males; mutations in TERT-associated ribonucleoprotein give rise to autosomal forms of the disease. TERT and TERC mutations occur in a subgroup of patients with aplastic anemia. Heterozygous mutations in TERC or TERT genes have been found in patients with idiopathic pulmonary fibrosis (Ly, 2009). Acquired Aplastic Anemia and Telomeres Telomere abnormalities are sometimes found in patients with acquired aplastic anemia. In some cases this is caused by exposure to benzene that is converted in the body to toxic compounds including 1-2 benzoquinone. The latter chemical causes chromosome damage, including DNA strand breaks, telomere attrition, and sister chromatid exchange and mitotic spindle damage.
4 LINKAGE, ASSOCIATION, AND LINKAGE DISEQUILIBRIUM
“Four related paradigm shifts are currently underway: 1) a shift from structural genomics to functional genomics 2) a shift from map based gene discovery to sequence based gene discovery 3) a shift from etiology (cause) to pathogenesis (mechanisms) of disease, and 4) a shift from disease diagnosis to detection of susceptibility to disease” —Victor A. McKusick (1997)
IDENTIFYING GENES AND ALLELIC VARIANTS THAT ARE RESPONSIBLE FOR SPECIFIC PHENOTYPES Microarrays for analysis of human genomic variation initially included probes to examine hundreds of thousands of single-nucleotide polymorphisms (SNPs) spaced across the genome. Each SNP is present in two forms (alleles), read in computer analysis as AA, AB, or BB.
54
Linkage, Association, and Linkage Disequilibrium
55
More recently, microarrays also include probes to enable analysis of copy number variants (CNVs). Feuk et al. (2006) defined copy number variants as chromosomal segments of at least 1,000 base pairs in length that differ between different individuals. A number of different computational methodologies have evolved to facilitate analysis of array data (La Framboise, 2009). In genome-wide association studies (GWAS), SNP array data on large numbers of patients and controls are analyzed to search for statistically significant differences between the two groups in the frequency of particular alleles at specific loci. These studies aim to identify an allele at a specific locus that predisposes to a disease or is in linkage disequilibrium with a disease-predisposing allele at a nearby locus. Linkage disequilibrium refers to the situation where specific alleles at two or more loci appear together in the same individual more often than would be expected by chance. In a number of the computer analyses applied to microarrays, homozygosity is not readily distinguished from hemizygosity. Regions where microarray studies indicate that a single allele is present in each of a series of loci may indicate regions of homozygosity or hemizygosity. Specific programs (e.g., Birdsuite) have been designed to combine SNP data analysis with copy number analysis (Korn et al., 2008).
RANGE OF GENETIC VARIATION Genetic variation includes substitutions at specific nucleotides, insertions or deletions of nucleotides, block substitutions, copy number variants, or inversions. An inversion is defined as a region of the genome where the linear order of genes (or a series of nucleotides) is reversed. The presence of short repeated elements in DNA sequence can predispose to misalignment of chromatids and unequal crossing over during meiosis, leading to duplications or deletions of sequence between the repeat elements. Duplication of sequence between two short repeat sequence elements in the TSC1 gene that encodes hamartin is illustrated in Fig. 4–1. Frazer et al. (2009) reported that complete sequencing of an individual genome provided information on the frequency of factors that generate individual variation in the genome. Sequencing of the genome of J. Craig Venter was carried out using the Sanger sequence methodology that allows sequencing of long segments of DNA; this yielded information on the frequency of the different types of variation. It is estimated that there are approximately 11 million single-nucleotide variants in the genome and that 22% of genomic variation between individuals
56
Phenotypic Variation Normal sequence gccctgcggcagtgctgatgaagccctgcggga
Patient sequence gccctgcggcagtgctgatgaagccctgcgggagtgctgatgaaagccctgcgg
Figure 4–1. DNA sequence within exon 15 of TSC1, the Tuberous sclerosis 1 gene that encodes hamartin. The reference sequence (normal) has two repeat elements (underlined). In an individual with Tuberous sclerosis there are 3 copies of this repeat sequence and sequence between the repeats is duplicated, leading to the presence of 23 additional nucleotides in the exon.
Table 4–1. TYPE OF VARIATION
NUMBER
LENGTH IN NUCLEOTIDES
Single-nucleotide variants Block substitutions Indels (heterozygous) Inversions Copy number variants
3,213,401 53,823 851,575 90 62
1 2 to 206 1 to 82,711 7 to 670,305 8,855 to 1,925949
is structural. Frazer et al. emphasize that a high percentage of the SNP variants occur within structural variants.
VARIANTS AND PHENOTYPES There are opposing theories regarding the key genetic factors that determine common complex diseases. The common variant, common disease theory postulates that common complex diseases result from common variants with small effect sizes. The rare variant hypothesis postulates that common complex traits result from the summation of low-frequency high-penetrance variants with larger effect sizes. Genome wide association studies address the first hypothesis (i.e., common disease, common variant). These studies have provided new insights into disease pathways. Frazer et al. noted that some genomic regions are associated with more than one disease. Interleukin receptor gene variants are associated with Crohn’s disease, multiple sclerosis, systemic lupus erythrematosis and rheumatoid arthritis; all are diseases considered to have an immunemediated etiology. They noted further that there is evidence that a specific SNP
Linkage, Association, and Linkage Disequilibrium
57
locus on chromosome 9p21 is associated with three vascular phenotypes: myocardial infarction, abdominal aneurysm, and intracranial aneurysm. This is discussed in more detail in the following section of this chapter.
A Specific Locus on Chromosome 9p21.3 is Associated with Three Vascular Phenotypes Myocardial Infarction and Coronary Heart Disease Helgadottir et al. (2007) undertook genome-wide association studies on a patient population comprised of 1,607 cases of myocardial infarction that had occurred before age 70 years in males and before age 75 years in females. The control population comprised 6,728 individuals without a history of coronary artery disease (CAD). The three SNPs that gave the strongest evidence of association were located within a 190 kb linkage disequilibrium block on chromosome 9p21. They then genotyped these three SNPs in an additional sample of 665 Icelandic patients and 3,533 controls, and in three sets of patients from different areas of the United States. The replication set comprised 2,980 patients and 6,039 controls. Since the three originally defined SNPs were highly correlated, one of them was analyzed along with additional SNPs in the region. In the replication analyses, SNP rs238201G allele occurred with a frequency of 0.492 in controls and 0.548 in patients. The rs10757278G allele occurred with a frequency of 0.453 in controls and 0.517 in cases. They then calculated the genotype specific odds ratio of risk for early-onset myocardial infarction in individuals with the rs10757278G allele; it was 1.49 for heterozygotes and 2.02 for homozygotes. Helgadottir et al. (2007) noted that the risk allele associated is this variant is 150 kb distant from protein-coding sequence. However it is within a linkage block that contains the cyclin-dependent kinase inhibitor 2A and 2B (CDKN2A and CDKN2B) genes. These genes play a role in control of cell cycle and in proliferation. Between these genes is sequence that encodes an antisense transcript CDKN2BAS. The variant allele occurs with high frequency in the population. Helgadottir et al. (2007) determined that it explains 21% of the attributable risk for myocardial infarction in the populations they studied. In two subsequent GWAS reports an SNP allele, rs1333049C, which is in complete linkage disequilibrium with rs10757278, was found to be strongly associated with coronary heart disease (Samani et al., 2007). Muendlein et al. (2009) performed genotyping in two cohorts of patients (671 and 940 individuals) undergoing coronary angiography for evaluation of
58
Phenotypic Variation
suspected coronary artery disease. They determined that the rs1333049C allele conferred significantly increased risk of coronary stenosis and lumen narrowing >50% in both groups with an odds ratio of 1.71 (p=0.007) in one group and an odds ratio of 1.55 (p=0.012) in the other. They also carried out analyses of other risk factors including levels of cholesterol, low-density and high-density lipoprotein, smoking, and body mass index. They determined that in their study group, the association of rs133304C remained significant after multiple adjustments for confounders. They concluded that the rs1333049C variant exerts effects independent of other coronary atherosclerosis risk factors. Aneurysm Risk In 2008, Helgadottir et al. reported results of investigations into the risk factors for development of aortic aneurysms and intracranial aneurysms. Patients and controls were drawn from Iceland, Europe, New Zealand, Canada, and the United States. They determined that the SNP risk allele on chromosome 9p21 originally found to be associated with coronary artery disease, rs10757278G, was also associated with increased risk for abdominal aortic aneurysm OR 1.3 (p=1.2x10-12) and intracranial aneurysm OR 1.29 (p=2.5X10-6). They also calculated the frequency of the risk allele in patients with aortic aneurysm and intracranial aneurysms who did not have coronary artery disease. The genotype-specific odds ratio of aneurysm risk for patients in this study was AA: 1, AG 1.38 (range 1.18 to 1.63) and GG 1.72 (range 1.39 to 2.13). In an independent study of patients and controls from the UK and Western Australia, Thompson et al. (2009) reported that the frequency of the rs10757278G allele was increased in patients with aortic aneurysms; the odds ratio for AG + GG genotypes was 1.40. These investigators noted that although the G allele is associated with the presence of an aortic aneurysm, it is not associated with the speed of growth of the aneurysm.
Chromosome 9p21.3 Genotype: Vascular Dementia and Alzheimer’s Disease Emanuele et al. (2009) carried out studies of the chromosome 9p21.3 vascular disease susceptibility locus in subjects with vascular dementia (VaD) and subjects with late-onset Alzheimer’s disease (LOAD). The 407 LOAD patients met NIH NINCDS-ADRDA diagnostic criteria and the 200 vascular dementia patients met NIH NINDS-AIREN diagnostic criteria. Severity of dementia was assessed with the mini mental state examination (MMSE). Mean MMSE scores
Linkage, Association, and Linkage Disequilibrium
59
in the LOAD patients were 17.9 +/– 7.1 and scores in the VaD patients were 17.7 +/- 8. In the 405 age-matched healthy controls recruited to the study, the MMSE scores were above 28. There were approximately equal numbers of males and females in each group. All patients were of Italian ancestry. The frequency of the rs1333049C allele was 60.7% in the LOAD patients; in the vascular dementia patients it was 62.2%. In controls the C allele frequency was 53.6%. Emanuele et al. noted that the 9p21.3 region had been implicated as a LOAD region in prior linkage studies and that CDKN2A was considered as a candidate gene for Alzheimer’s disease in previous studies, since it was found to be hyperexpressed in brains of LOAD patients.
GWAS AND RISK FACTORS FOR TYPE 2 DIABETES MELLITUS (T2D) Frazer et al. (2009) reviewed progress in identifying risk factors for Type 2 diabetes using GWAS. They reported that such studies have identified 18 regions of the genome that harbor risk alleles and that some of the locations identify physiological functions not previously implicated in this disease; among the latter is the MTNR1B melatonin receptor locus that plays a role in circadian rhythm and that is correlated with fasting glucose levels. Other risk loci impact pancreatic function and insulin secretion; these include: cyclindependent kinase regulator (CDKAL1), SLC30A8 (a zinc transporter), TCF7L2 (a transcription factor involved in glucose homeostasis), HHEX-1DE (an insulin-degrading enzyme), and KCNJ11 (a potassium channel). Other functionally significant associated loci include: FTO (associated with body mass index), peroxisome proliferator-activated receptor gamma (PPARG), which is associated with adipocyte differentiation, and insulin-like growth factor binding protein (IGFBP2), which is involved in insulin pathway regulation. Frazer et al. estimated that these variants explain less than 4% of the genetic variability that contributes to Type 2 diabetes. An important consideration is that the genetic contribution to common disease may include rare variants that are not in linkage disequilibrium with SNPs. Frazer et al. postulated that common variants may largely act to modify the penetrance of rare variants. Another important observation in their review concerns the extent of documentation of phenotype and disease course in large cohorts used in case control studies. They noted that frequently the clinical assessment in genome wide association studies provided only a snapshot of the disease.
60
Phenotypic Variation
INDICATIONS FOR SHARED CAUSAL VARIANTS IN DIFFERENT DISEASES Smyth et al. (2008) reported that specific alleles at four different loci showed the same direction of significant association in celiac disease and in Type 1 diabetes. These loci were: regulator of G protein signaling (RGS1), cytotoxic T lymphocyte-associated protein (CTLA4), SH2B3 (a lymphocyte adaptor protein), and protein tyrosine phosphatase nonreceptor type (PTPN2). They concluded that their results constituted evidence for shared causal variants in the two conditions. They proposed that specific environmental factors may play roles in the etiology of both conditions. One possible factor they considered was gluten intake and sensitivity.
LIMITATIONS OF GWAS Genome-wide association studies have provided evidence for association between genomic loci and a number of complex diseases. In an editorial in Nature in 2008, Maher noted that although GWAS studies have identified gene markers that are risk factors for common diseases, overall for each disease the contribution of the identified marker to overall risk is surprisingly low. A further problem noted by Maher (2008) was that Tag SNPs are often used (i.e., specific SNP markers are used to represent a block of genetic material). Two people who share a specific SNP marker may differ at some point within that block. Discovery of important changes may require extensive sequencing of regions where SNPs of interest lie. Maher (2008) entertained the possibility that in statistical analysis of GWAS, heritability estimates may be incorrect. This is of particular relevance with respect to analysis of height, where nutrition particularly at key growth phases is critical. Another issue regarding heritability estimates has to do with problems that arise because different diseases may have been lumped together since they have similar symptoms. There are examples of diseases where GWAS studies identified specific pathways involved in particular diseases. One example discussed by Donnelly et al. (2008) is that of breast cancer. A number of the genes identified in GWAS studies play a role in DNA repair as do the first breast cancer-associated gene, BRCA1 and BRCA2. A further example of elucidation of disease pathways is in Crohn’s disease where GWAS revealed that genes in autophagy pathways are involved.
Linkage, Association, and Linkage Disequilibrium
61
It is important to note that prior to 2008, association studies did not take copy number variation into account. Mc Carroll et al. (2008) carried out studies of copy number variation and sequence analysis in the genomic region surrounding a SNP rs1336119 that is strongly associated with Crohn’s disease. This SNP lies upstream of the gene IRGM (immunity-related GTPase family), that maps to chromosome 5q33.2. Copy number analyses revealed the existence of copy number polymorphisms upstream of IRGM. The structural polymorphisms were found to be in linkage disequilibrium with SNP rs1336119. In individuals with a null copy number in this region, 20 kb of sequence was replaced by 7 kb of sequence. The 20 kb sequence element was conserved in chimpanzees. The deletion allele occurred with higher frequency in patients with the disorder. McCarroll et al. determined relative expression of the two alleles using cDNA and SNP genotyping. They determined that the protective allele was more predominantly expressed. The IRGM gene is involved in bacterial autophagy. Goldstein (2009) emphasized that in many cases genetic variants implicated by large-scale genome-wide association studies have identified common variants that are only responsible for a small percentage of the disease risk. He noted that Monolio et al. (2008) described seven gene variants that influence risk of Type 2 diabetes. The variant with strongest effect was in TCF7L2 (a transcription factor involved in glucose homeostasis). This variant is associated with a sibling relative risk of 1.02. Goldstein remarked that this contrasts markedly with the overall sibling risk for diabetes, which is three times that of the general population. Goldstein considered it much more likely that rare genetic variants, either single-site or structural, have considerably larger effects than common variants. He noted further that identification of rare variants might yield a manageable number of genes and pathways for analysis. He acknowledged that common variants do play important roles in some diseases (e.g., in macular degeneration and Alzheimer’s disease) and that initial studies on several thousand individuals were valid. He was less enthusiastic about continuing analyses in ever-larger numbers of subjects. Frazer et al. (2009) reviewed GWAS and reported their limitations. They noted that there are difficulties moving beyond association to delineating the functional processes that lead to a specific phenotype or disease trait. Furthermore, specific SNPs associated with a disease in one population may not be associated with that disease in another population. Importantly, SNP associations discovered thus far only account for a small fraction of the heritability of a specific disease.
62
Phenotypic Variation
Recommendations to Find “Missing Heritability” in Complex Diseases In October 2009, a report was published of discussions at a workshop to investigate the possible causes of the failure of genome-wide association studies to adequately explain factors that contribute to the observed rates of heritability in complex diseases (Manolio et al., 2009). Possible explanations included inadequate coverage of genes on microarrays currently in use. The authors noted that detailed sequence analysis of 30 genes that carry common variants that impact lipid levels revealed that a subset of genes harbor both common and rare variants. They proposed that heritability estimates for common diseases may be erroneous, in part because shared environment of family members is not taken into account. In future studies they recommended that it will be important to integrate association studies and copy number variant analyses. Manolio et al. noted that, thus far, studies of CNVs in disease have concentrated primarily on rare large CNVs (600 kb to 3 Mb). They proposed that more effort be placed on analysis of smaller variants. They emphasized the importance of carrying out more comprehensive phenotype analyses, including iterative phenotype analyses. More comprehensive studies are needed to investigate quantitative phenotypes and pleiotropic gene effects.
DEFINING THE KEY GENE IN A REGION LINKED TO OR ASSOCIATED WITH A SPECIFIC PHENOTYPE The Apolipoprotein E (APOE) Region and Alzheimer’s Disease The APOE4 allele of apolipoprotein E has proved to be the strongest genetic risk factor for late onset Alzheimer’s disease, although it is neither necessary nor sufficient for development of that disease. A number of studies have demonstrated that specific alleles in markers in the genomic regions surrounding APOE also constitute risk factors. The question arises as to whether these alleles contribute to risk of Alzheimer’s disease because they are in linkage disequilibrium with APOE and cosegregate during meiosis, or if they impact APOE4 expression. Alternately, they may independently impact Alzheimer’s disease risk.
Linkage, Association, and Linkage Disequilibrium
63
Takei et al. (2009) carried out analysis of a 200 kb genomic region around APOE. They examined 257 SNPs, 36 of which were within genes. They determined that this region is sandwiched between two recombination hot spots and that genes within this region are in strong linkage disequilibrium. These genes include PVRL2, TOMM40, APOE, and APOC1 (Fig 4.2). In their study the highest level of significance was achieved for association of late-onset Alzheimer’s disease with the marker rs429358 located within APOE. They also reported independent evidence that specific alleles in TOMM40 are associated with Alzheimer’s disease. The PVRL2 gene that maps within the LOAD-linked region encodes the poliovirus receptor 2 that also serves as the herpes virus entry mediator. Takei et al. concluded that all four genes in this region of linkage disequilibrium (PVRL2, TOMM40, APOE, and APOC1) may contribute to Alzheimer’s disease pathogenesis. The TOMM40 gene encodes a translocase of the outer mitochondrial membrane. APOC1 encodes apolipoprotein C. Bekris et al. (2009) carried out studies on postmortem brain specimens from eight Alzheimer’s disease and eight age-matched control individuals.
Chromosome 19
PVRL2 45,34945,392K
TOMM 40 45,394-45406K Q13
APOE 45,409-45412K
Figure 4–2. Diagram of the 19q13.3 region in which the contiguous genes PVLR2, TOMM40 and APOE occur. (Based on www.ncbi.nlm.nih.gov/ map viewer).
64
Phenotypic Variation
They determined that levels of APOE protein are lower in Alzheimer’s disease patients than in controls. Furthermore, they identified seven haplotypes within the region spanning TOMM40 and APOE, including the APOE promoter. They determined that individuals with LOAD were negative for the H1 haplotype. They interpreted their results as indicative of the presence of a specific allele in the proximal region of the APOE gene that controls expression of that protein. They postulated further that Alzheimer’s disease cosegregates with lower levels of expression of APOE with the H1-negative haplotypes. They noted that an alternate explanation for their findings is that genetic variation in TOMM40 plays a major role in Alzheimer’s disease and the specific TOMM40 risk factor is not common in individuals with the H1 haplotype. Roses (2010) reported that a specific allele of TOMM40, marker rs10524523 with 17 T repeats (long) cosegregated with the APOE4 allele, while a significant proportion of individuals with the APOE3 allele had the short form of this marker with 15T repeats. The long form of the repeat in TOMM40 is present in some individuals with the APOE3 genotype, but it occurs in a much lower percentage of individuals than the short form. He postulated that the long form of this TOMM40 marker constituted a major risk factor for Alzheimer’s disease.
GENE–ENVIRONMENT INTERACTION: HERPES SIMPLEX VIRUS AND ALZHEIMER’S DISEASE Itzhaki et al. (1997) determined that Herpes simplex virus 1 (HSV1) is present in amyloid plaques and that it is present in higher amounts in brain tissue from APOE4-positive individuals with LOAD than in APOE4-negative individuals. Wozniak et al. (2009) reported that HSV1 encodes a glycoprotein that contains a sequence highly homologous to the amyloid beta peptide and that HSV1 associates with amyloid precursor protein during axonal transport. As noted, beta amyloid plaques accumulate HSV1 particularly in APOE4-positive patients. Takei et al. (2009) noted that PVRL2 that encodes a product that mediates viral entry is an interesting candidate gene, relevant to environmental pathogenesis of Alzheimer’s disease.
HSV1 AND MITOCHONDRIAL SEQUENCES The HSV1 gene U12 encodes a DNAase (an enzyme that digests DNA). Corcoran et al. (2009) reported that two U12 genes occur, that encode related
Linkage, Association, and Linkage Disequilibrium
65
but distinct proteins. U12 encodes a full-length protein while UL12.5 encodes a protein that is truncated at the amino-terminal end. The two proteins differ in their subcellular location and in their function. U12 localizes to the nucleus, while U12.5 localizes to mitochondria. Corcoran et al. demonstrated that mitochondrial localization of U12.5 protein is dependent upon sequences that lie between amino acids 59 and 119 in UL12.5. Sequence in this region closely resembles that of mitochondrial matrix localization signals. They reported that mutations in sequences in this region impaired mitochondrial localization. HSV1 infection is known to lead to mitochondrial DNA depletion and Corcoran et al. demonstrated that this is dependent upon exonuclease (DNAase) activity of UL12.5. They postulated that resistance of nuclear DNA to U12 DNAase activity may result from the fact that nuclear DNA is encased in chromatin.
GENETIC VARIATION AND DRUG RESPONSE Goldstein (2009) emphasized the importance of application of genome-wide scans in studies aimed at identifying population differences in drug response or in the course of infectious diseases. One example is a polymorphism in HLA-B where the HLA-B*5701 allele occurs in 50% of individuals who have an allergic response to the anti-retroviral drug Abacavir. Fellay et al. (2007) carried out whole genome association studies to assess degree of HIV AIDS viral load in individuals who were asymptomatic for at least 2 years. They identified polymorphisms that explained 15% of the variation in load and development of symptoms. They identified two sets of polymorphisms associated with the HLA-B and HLA-C loci, including one in HLA complex P5 (HCP5). In a genome-wide analysis of polymorphisms associated with progression of disease, they identified polymorphisms in ZNRD1 (zinc ribbon domaincontaining transcription factor). This gene is located 1 Mb telomeric of HLA-B and HLA-C. It encodes an RNA polymerase 1. Fellay et al. propose that it may impact HIV-1 transcription. They noted that their observation may have therapeutic implications (e.g., vaccine strategies could be designed to target HLAC-mediated responses). Ge et al. (2009) carried out a genome-wide association study to identify host genetic factors that determined efficacy of response to Hepatitis C treatment with a specific treatment. They identified a polymorphism 3 kb upstream of interleukin 28, interferon receptor (IL28B), which is significantly
66
Phenotypic Variation
associated with natural clearance of the virus and response to treatment with Peg-Interferon-2 and Ribavirin. The specific genotype leading to better treatment response occurs with significantly higher frequency in patients of European ancestry than in the African population. They concluded that these polymorphisms explain the clinically observed differences in treatment responses between these populations.
LARGE-SCALE MULTIETHNIC STUDIES ON CANDIDATE GENES: LIPID METABOLISM There is growing evidence that adipocytes serve not only as sites of lipid storage but that they play an important role in regulation of lipid and glucose metabolism. Adipocytes secrete hormones and cytokines. Romeo et al. (2007) analyzed sequence variation and function in an adipocyte cytokine ANGPTL4. Expression of this cytokine is induced in the liver during fasting. Further evidence of the importance of ANGPTL4 was obtained from studies in mice that demonstrated that depletion of the gene led to lower plasma triglyceride levels. There is evidence that ANGPTL4 protein may inhibit lipoprotein lipase. These investigators carried out sequence analysis of the seven exons and of exon–intron boundaries in the human ANGPTL4 gene in 3,551 individuals in a multiethnic population in Dallas, Texas. Extensive data on lipid and glucose metabolism was also analyzed in the study participants. Romeo et al. determined that nonsynonymous variants in ANGPTL4 were more prevalent in individuals with triglyceride levels in the lowest quartile. Additional studies were carried out on individuals in an atherosclerosis cohort. Data was collected on 9,247 individuals. A specific variant of ANGPTL4 protein E40K occurred in 3% of Americans of European ancestry. This variant was associated with significantly lower levels of plasma triglyceride and significantly higher levels of high-density lipoprotein cholesterol. This study also revealed that alleles leading to loss of function in ANGPTL4 are more common in European-Americans than in African-Americans. Romeo et al. (2007) noted that large-scale population studies such as the one they described have some advantages. One advantage is that sequence variants can be tested against multiple phenotypes, provided these phenotypes are available in accessible databases. They further emphasized the advantage of using a multiethnic population since this capitalizes on ethnic differences in the frequency of specific gene variants.
Linkage, Association, and Linkage Disequilibrium
67
DISCOVERY OF DISEASE GENES THROUGH LARGE-SCALE GENOMIC SEQUENCING Tarpey and Stratton (2009) designed a study to identify genes that play a role in nonsyndromic X-linked mental retardation (XLMR) through exon sequencing. They recruited 208 families, each with multiple individuals with mental retardation and with an inheritance pattern consistent with X linkage. Affected individuals were negative for cytogenetic abnormalities at the 500band level. For sequence analysis in each family, they utilized DNA from a male proband and an obligate carrier female. They sequenced exons from 718 genes, including 16 genes from the pseudo-autosomal region and 702 that were X-chromosome-specific. They identified likely disease-causing mutations in 25% of the families screened. In six genes they identified truncating mutations that segregated with XLMR, which did not occur in controls. These six genes included AP1S2 (involved in synaptic vesicle trafficking), CUL4B (ubiquitination), BRWD3 (chromatin structure determination), UPF3B (involved in nonsense mediated mRNA decay), ZDHHC9 (post-translational modification through palmitoylation), and SLC9A6 (Na/H exchange). In the SYP gene (synaptophysin, synaptic function), they identified a deletion of four base pairs, three cases with truncating variants and a missense mutation. In the calcium calmodulin-dependent serine protein kinase (CASK) gene, they identified a missense mutation thought to be significant because it introduced a new splice site and removed 27 base pair from the mRNA. The CASK protein is located on the postsynaptic membrane and is involved in synaptic signaling. Tarpey et al. emphasized the analytical challenges of large-scale sequencing screens to identify rare disease-causing variants. They noted that truncating mutations were sometimes found in controls. Relevant to this finding is the fact that there may be functional redundancy of some genes. They noted further that there are a large number of genes on the X chromosome that have a single exon and that these may represent retrotransposons of genes found elsewhere.
5 REGULATION OF TRANSCRIPTION, SPLICING AND TRANSLATION Impact of Perturbation on Phenotype
“…the cloning of promoters and enhancers of genes involved in genetic disorders is likely to be especially useful. There are important therapeutic possibilities based on better understanding of these regulatory elements.” —Victor McKusick (1997) “The split structure of genes in most nucleated cells added a new layer of regulation at the stage of RNA processing.” —Philip Sharp (2009)
INTRODUCTION Insights into regulation of gene expression have expanded significantly through availability of genome sequence information, enhanced capabilities for transcription profiling, and analysis of chromatin modification. In addition, improved microscopic technologies and molecular labeling techniques allow for more detailed analysis of cellular and organelle morphology and for real time studies of gene expression, cell divisions, and cell migration. Together, these advances improve understanding of temporal and spatial gene expression and their roles in cell and tissue differentiation. These insights lead progressively to improved understanding of genotype–phenotype relationships and of mechanisms underlying genesis of unusual or abnormal phenotypes. 68
Regulation of Transcription, Splicing and Translation
69
TRANSCRIPTION PROFILING Through application of high-throughput methodologies investigators are seeking to analyze transcription in much greater depth than was previously possible. Wang et al. (2009) defined three goals of transcription profiling. First, development of catalogs of all transcripts, including coding and noncoding messenger (mRNA). Second, determination of gene structures including 5' and 3' ends, splice patterns, and post-transcriptional modifications. A third goal involves the quantification of changes in expression during development and under different environmental conditions. Advances in transcription profiling include the development of microarrays to investigate cDNAs derived by reverse transcription from messenger RNA. Wang et al. noted that one limitation of this method is reliance on existing knowledge of transcripts to design microarrays. High-throughput RNA sequencing is an alternative method of transcript analysis. It involves isolation of mRNA, total or poly-A fractionated, conversion of mRNA to libraries of cDNA fragments with adapters attached to each end of the cDNA fragment. Individual cDNA fragments may then be sequenced with or without prior amplification. Wang et al. (2009) reported that despite the complexity of RNA sequencing, this method has led to new insights. These include revision of the 5' and 3' gene boundaries and evidence of heterogeneity of 5' untranslated regions. RNA sequencing in yeast also led to identification of previously unknown 5' and 3' open reading frames. Of particular interest was the finding that a number of genes overlapped at their 3' ends. Furthermore, mRNA sequencing revealed extensive transcript complexity, because of alternate splicing and revealed many novel transcribed regions. Sultan et al. (2008) carried out deep sequencing of transcripts from human kidney and lymphoblastoid cell lines. They reported that 66% of polyadenylated transcripts that they sequenced mapped to known genes, and 34% mapped to nonannotated genomic regions. They determined that approximately 5% of splice junctions sequenced were previously unidentified. They reported that exon skipping was the most prevalent form of alternative splicing. Transcriptional Signatures of Cell Types Nelson et al. (2006) reported data on identification of transcriptional signatures of subtypes of neurons through use of fluorescent tagging of subpopulations of cells followed by microarray analysis. Rossner et al. (2006) characterized expression patterns of pyramidal motor neurons and pyramidal somatosensory neurons. They reported elevated
70
Phenotypic Variation
expression of ribosomal genes and genes involved in arenosine triphosphate (ATP) synthesis in motor neurons.
SENSE AND ANTISENSE TRANSCRIPTS He et al. (2008) applied a technique to analyze mRNA populations to determine the proportions of sense and antisense transcripts. Their technique involved bisulfite treatment of mRNA to convert cytidine residues to uridine followed by reverse transcription and polymerase change reaction (PCR) methods to generate and amplify cDNAs. These products were then sequenced. They examined mRNA forms present in five different cell types. They then determined the number and proportion of genes that generated sense and antisense transcripts; 8 to 16% of coding genes generated antisense transcripts. Approximately 2% of genes generated antisense transcripts only. A higher proportion of antisense transcripts were generated from sequence in promoter and terminator gene regions. He et al. determined that for transcripts generated from coding sequence, approximately 20% of sense strands and only 1% of antisense strands undergo alternative splicing. These investigators emphasized that the antisense transcription they observed was nonrandom, that a higher proportion of antisense strands were generated from transcribed regions than from untranscribed regions. Different cell types showed differences in the specific genes that generated antisense transcripts. They concluded that antisense transcripts likely play a role in regulation of gene expression through transcriptional interference with coding transcripts or through post-transcriptional mechanisms. Mercer et al. (2009) reported that array techniques revealed an abundance of previously undetected nonprotein coding mRNA transcripts longer than 200 nucleotides. These transcripts overlapped coding regions or arose from regions between coding transcripts. A number of investigators have questioned whether noncoding RNAs represent transcriptional noise. There is, however, evidence that expression of specific noncoding mRNAs is developmental phase- and location-specific. Mattick (2001) proposed that functions of noncoding RNAs include regulation of expression of neighboring protein-coding genes, possibly through generation of antisense transcripts and recruitment of chromatin modification complexes to genomic segments where antisense transcripts are present. One example of this is the recruitment of Hox transcript antisense RNA (HOTAIR), which is encoded by the HOXC locus. This antisense transcript binds in trans to the 40 kb genomic region that contains the HOXD loci and it
Regulation of Transcription, Splicing and Translation
71
induces repression primarily through recruitment of the Polycomb chromatin modifying complex (Rinn et al., 2007).
CHIMERIC NONLINEAR TRANSCRIPTS Analysis of genome-wide transcription has revealed the presence of chimeric transcripts that are derived from segments of DNA located at some distance from each other. There is evidence that a specific transcript may be derived from different chromosomes (Gingeras, 2009). One interesting example of a chimeric transcript is found in endometrial cells, and is composed of 5' exons from the JAZF zinc finger 1 gene (JAZF1) on chromosome 7p15 and 3' exons of a gene on chromosome 17q11 designated JJAZ1 (joined to JAZ1). This gene encodes an anti-apoptotic protein. There is evidence that this chimeric transcript is derived by trans-splicing in normal endometrial cells regulated by hormones. In endometrial neoplasms, exchanges between these two chromosomal segments have been demonstrated, Gingeras (2009) noted a similar finding in normal spleens. Chimeric transcripts arise between the immunoglobulin heavy chain gene IGH on chromosome 14 and the BCL2 gene on chromosome 18. In lymphomas, translocations between these two chromosomal segments occur. One possible explanation for these chimeric transcripts is that specific regions of chromosomes may be colocated in the nucleus. Relevant to this are observations of transcription factories or hubs within the nucleus. Other unusual chimeric transcripts include noncolinear transcripts of the gene SEC14L1, in some isoforms upstream exons are inserted between downstream exons so that in a specific isoform SEC14L2, amino acids 56 to 93 occur after amino acid 218. SEC14L1 encodes a cytosolic factor that likely plays a role in intracellular transport.
MAPPING REGULATORY SEQUENCES Insights in Regulation of Gene Expression and Cell Type Differentiation through Studies on Globin Higgs et al. (2007) reviewed regulatory elements involved in globin gene expression. They noted that during evolution, chromosome segment reassortment has taken place and that during this reassortment, a specific gene and the cis elements essential for its expression must have stayed together.
72
Phenotypic Variation
Defining the extent of synteny in evolutionarily reassorted segments therefore provides a way to identify elements required for gene expression. Regulatory sequences may be identified through sequence analysis as noncoding syntenic sequence elements, especially those conserved in multiple species. They postulated and subsequently proved that through comparison of synteny around the alpha globin locus in 22 different species, a region could be delineated that contained sequences required for globin gene expression. CpG islands (stretches of sequence rich in cytosine and guanine dinucleotides with phosphodiester residues between cytosine and guanine) serve to modulate gene regulation and Higgs et al. reported that these are present in 50% of genes. They noted that transcription factor binding sites could be identified through sequence analysis and through identification of DNAase1 hypersensitivity sites. There is direct interaction between transcriptional programs and chromatin modifications, including DNA methylation and histone methylation. Higgs et al. reviewed evidence that the position of a gene within the nucleus may impact expression, and they noted that actively expressed genes occur on chromosome loops that congregate within transcription hubs. Coregulated genes are often clustered in a specific chromosome region. They noted also that there is an apparent relationship between gene expression and DNA replication; actively expressed genes usually replicate early in the S phase of the cell cycle, while inactive genes replicate late. There is also evidence that regions of high gene density replicate early.
PROMOTERS, LOCUS CONTROL REGIONS, NUCLEAR POSITION AND CHROMATIN MODIFICATION Cecchini et al. (2009) reviewed newer technologies that are facilitating identification of the promoter regions of genes, Promoters frequently occur in nucleosome-free DNA regions that manifest DNAase hypersensitivity. Promoters are generally but not always associated with islands of CpG nucleotides. One method of promoter identification is to identify sequence elements that bind RNA polymerase II, however binding of this polymerase may not be followed by the generation of long transcripts. There is evidence that active promoters can be distinguished by specific histone modification patterns, particularly trimethylated lysine 4 (K4) of histone H3. Cecchini et al. noted that active promoters are also associated with acetylation of lysine 9 (K9) and lysine 14 (K14) in histone H3. Enhancer sequences may be recognized through association with histone H3K4 mono- or di-methylation. Enhancers may be located at variable distances
Regulation of Transcription, Splicing and Translation
73
from promoters and have previously been difficult to recognize. The presence of mono- and di-methylated lysine 4 (K4) in histone H3 facilitates their recognition. Specific enhancers often act in a tissue-specific manner. In heterochromatic regions of the genome, genes are silenced and these regions are enriched in trimethylation of lysine 27 in histone H3 (H3K27me3). Cecchini et al. noted that expression of the neural-specific silencer, REST, is associated with increase in H3K27me3 and with binding of SIN3A (transcription regulator) and histone deacetylase binding. Histone deacetylase likely acts as a mediator of repression. Locus control regions impact expression of linked genes that demonstrate cell type expression. Cecchini et al. reported that the impact of the LCR is often independent of chromatin character but may be associated with intricate chromosome looping patterns. One of the best studied locus control regions is involved in developmental stage-specific globin gene expression. There is evidence that the position of a genomic segment within the nucleus impacts gene expression. Silenced genes within heterochromatin are frequently located in the periphery of the nucleus. Heterochromatin, rich in H3K27Me3, is often associated with the nuclear membrane proteins lamin B1 and emerin. Euchromatin and actively expressed genes are in the interior. Messenger RNA Decay Messenger RNA decay plays an important role not only in eliminating aberrant transcripts, but also in maintaining steady-state transcript levels. Matsui et al. (2007) investigated the post-transcriptional role of upstream open reading frames (UORFs) in mRNA. UORFs are small, open reading frames located in 5' gene regions; they usually start with the nucleotide code AUG. They used a bioinformatics approach to identify these elements and then compared the expression. They determined that transcripts that were positive for 5' UORF sequences were expressed at lower levels than transcripts that were negative for 5' UORFs. They postulated that the 5' UORFs might decrease gene expression by regulating mRNA degradation.
3’ UNTRANSLATED REGION OF mRNA AND REGULATION OF EXPRESSION AND DIVERSITY Specific sequence elements surround sites of mRNA cleavage and polyadenylation. These include upstream signals AAUAAA, AUUAAA, and additional hexamer variants (Tian et al., 2007).
74
Phenotypic Variation
Cumulative DNA sequence analyses by many investigators have revealed that at least 50% of mammalian genes generate multiple mRNA splice forms through the use of alternate polyadenylation cleavage sites. In recent studies, investigators have begun to understand the role of differential expression of alternate forms of mRNA in determining protein levels. Sandberg et al. (2008) reported that sequences in the 3' untranslated regions (3' UTR) of mRNA determine its stability, localization, and translation. Generation of alternate forms of mRNA with different lengths of 3' untranslated sequence can be splicing-dependent and based on use of different 3' exons. It may also be splicing-independent and based on the use of different polyadenylation sites. They noted that analysis of T cell activation and associated changes in gene expression have provided key insights into aspects of regulation. They analyzed mRNA forms of genes expressed in murine CD4 lymphocytes that were actively proliferating following stimulation through the T cell receptor and determined that these cells produce mRNA species with shorter 3' untranslated regions. They determined that extended 3' untranslated regions contain higher numbers of seed matches for microRNAs. These are short ribonucleic acid molecules, frequently 22 nucleotides long that bind to complementary sequences in the untranslated region of messenger RNA and act as post-transcriptional regulators. Sandberg et al. (2008) postulated that the presence of a shorter 3' untranslated region in mRNA in cells with higher rates of proliferation likely serves as a mechanism to limit down-regulation by microRNAs.
RIBONUCLEOPROTEIN COMPLEXES Ribosomal RNA genes are often clustered in the genome along with many pseudogenes. Primary mRNA transcripts are associated with heterogeneous nuclear complexes (hnRNAP) during transcription. SnRNAs (small nuclear RNAs) are involved in mRNA splicing and are components of spliceosomes. There are more than 100 snRNAs encoded in the human genome. They are uridine rich and they are designated U1 to U100. Small Cajal body RNPs (scaRNPs) carry out modification of snRNAs. Small nucleolar RNA (snoRNA) are active in the nucleolus and are involved in RNA modification and processing. C/D box snoRNAs guide site-specific 2-O-ribose methylation. H/ACA snoRNAs carry out pseudouridylation of RNA. SnoRNAs are frequently encoded in the introns of other genes.
Regulation of Transcription, Splicing and Translation
75
Some are single-copy others are clustered (e.g., in the SNRPN (small nuclear ribonucleoprotein polypeptide N) gene region on chromosome 15q11.2).
SPLICING OF mRNA TRANSCRIPTS AND THE SPLICEOSOME RNA Splicing and Evolution Splicing out of introns from mRNA transcripts of genes to generate functional mRNA is a characteristic of eukaryotes. Furthermore, variation in RNA splicing plays an important role in generating protein diversity in vertebrates. The spliceosome has therefore played an important role in evolution through generation of protein diversity (Query, 2009). Spliceosome Structure, Complexity, and Function Major components of the spliceosome include the small ribonucleoprotein complexes (snRNPs). These complexes contain one or more snRNAs, U1, U2, U4/U6, and U5. They also contain approximately 100 other proteins, including RNA binding proteins and splicing factors, in addition to helicases, kinases, and phosphatases (Cooper et al., 2009). These authors noted that there is a minor splicing complex that is composed of a unique core of proteins (Sm proteins) in addition to the snRNA complex that comprises a unique set of snRNAs (U11, U12, U5). Sm proteins contain the Sm sequence motif, which consists of two regions separated by a linker of variable length that fold as a loop. Assembly of the core of Sm proteins requires ATP and Survival motor neuron protein (SMN protein). Sm proteins undergo modification on arginine mediated by protein arginine methyl transferases 5 (PRMT5). The catalytically active center of the spliceosome is composed of the U4/ U5/U6 snRNP complex, and assembly of this core requires a number of proteins including PRPF3, PRPF8, and PRPF31, precursor mRNA processing factors. Of particular interest is the fact that a number of these factors have been found to be defective in different forms of retinitis pigmentosa. Key elements for splicing primary transcripts include 3' and 5' consensus sequence elements, branch point sequences, and polypyrimidine tracts. The first step in the assembly of the spliceosome is the binding of U1 snRNP to the 5' boundary of an intron. Binding of the U2 snRNP and the U4/U5/U6 snRNP
76
Phenotypic Variation
complex then follows this. Subsequent release of U1 and U4 snRNP leads to activation of the catalytic spliceosome and to removal of the intron in a lariat structure. Subsequently, adjacent exons join together (Query, 2009). PROTEIN–mRNA INTERACTIONS AND POST-TRANSCRIPTIONAL CONTROL OF GENE EXPRESSION There is growing evidence that post-transcriptional factors markedly expand the regulatory plasticity of the genome. Binding of specific proteins to mRNA plays an important role in this regulation. Moore et al. (2006) reviewed protein–mRNA interactions and control of gene expression. Recognition motifs that constitute protein-binding domains occur in mRNA. Specific proteins bind to the 7-methyl guanosine cap at the 5' end of mRNA; other proteins bind specifically to the 3' end of mRNA. There are also proteins that bind to specific recognition sequences along the length of mRNA (e.g., Y box proteins). A number of proteins interact with mRNA within the nucleus. In this category are the hnRNP, which are heterogeneous nuclear proteins and serine arginine-rich proteins. Exon-joining complex (EJC) proteins play a role is mRNA splicing and in nonsense-mediated mRNA decay. Exit of mRNAs from the nucleus takes place through the nuclear pore complex. Binding of specific proteins to mRNA is essential for transport. Following transport from the nucleus to the cytoplasm, mRNAs may be readily translated or they may be stored in a transcriptionally silent state. POLYADENYLATION AND CONTROL OF mRNA TRANSLATION In many cases, mRNAs are held in a translationally silent state. A prime example of translational control of expression is the presence of so-called masked mRNAs in oocytes. There is also evidence that translational control of expression plays an important role in brain in determining synaptic plasticity. Regulation of translation is also important in control of cellular lifespan. Specific elements in RNA, cytoplasmic polyadenylation elements (CPE), and binding of protein, CPEB, to these elements play roles in translation control in all of these situations (Richter, 2007). In vertebrates the principal CPE binding protein is CPEB1. Three additional CPEB homologous proteins occur; they have different RNA binding motifs and differ in their functions.
Regulation of Transcription, Splicing and Translation
77
In a review of CPEB1 function, Richter (2007) reported that within the nucleus most mRNA molecules have long polyadenylation (polyA) tails. Following export from the nucleus, interaction of CPE RNA elements with CPEB1 results in polyA removal. Factors that play a role in this include symplekin (forms a complex with polyadenylation machinery) and deadenylating enzymes (PARN), and other proteins including germline development factor 2 (GRD2), and polyA polymerase. A specific kinase, Aurora, is activated on oocytes’ maturation, and this phosphorylates a specific reside in CPEB, ser174. This phosphorylation results in release of PARN deadenylating enzyme and its expulsion from the complex. The polyA polymerase then acts to elongate mRNA. Other proteins that are involved in the control of translation interact with mRNA, polyadenylation factor EIF4G interacts when polyA regions are short. Once polyA elongation occurs, EIF4G is displaced from mRNA and EIF4E binds to the 5' cap region in mRNA, Bound translation initiation factor EIF4E facilitates 40S ribosomal recruitment and translation. Richter (2007) reviewed the role of CPE and CPEB in synaptic plasticity and the biochemical and morphological changes that occur in the synapse in response to stimulation. There is evidence that regulation of protein synthesis at the synaptic density, a structure that adjoins the synaptic membrane and contains receptors and signaling molecules. Activation of NMDAneurotransmitter receptors stimulates polyadenylation and translation of mRNA for the alpha subunit of calcium calmodulin dependent protein kinase II. CPEB2 and CPEB4 proteins bind mRNA and may regulate translation through mechanisms that do not require AAUAAA polyadenylation. Within the cytoplasm, the mRNA ribonucleoprotein complexes ready for translation interact with translation initiation factors e.g. EIF4E that recruit small ribosomal RNA subunits and initiate scanning for an AUG start codon at the 5' end of mRNA. The process of threading of mRNA through the ribosomal subunits strips away many of the bound ribonucleoproteins. Decay of mRNA also modulates expression. This may occur particularly in certain subcellular locations.
TRANSLATION AND EXON SPLICING Proteins bound to mRNA play key roles in its export from the nucleus, subcellular localization, determination of stability, and translation. A key step in the initiation of translation of mRNA is interaction of the mRNA 5’cap region with a specific cap complex (CBC) or with translation initiation factor EIF4E.
78
Phenotypic Variation
Le Hir and Seraphin (2008) noted that the cap binding complex interacts primarily with mRNA that are translated in the primary round (i.e., pioneer transcripts). The signaling molecule target of Rapamycin (TOR) and its associated S6 kinase are involved in phosphorylation of components of the cap binding complex and in pioneer translation. A specific S6 kinase binding protein (SKAR) occurs in the cap binding complex. SKAR also occurs in the exon junction complex (EJC). Activity of the mRNA 5' cap and EJC activity may be coordinated and it is of interest that proteins such as SKAR and S6 kinase bind to EJC and to the cap-binding complex that includes EIF4A, EIF4E, and EIF4G. The exon joining complex (EJC) assembles on mRNA at approximately 24 nucleotides upstream of a splice junction. It remains associated with mRNA during its export from the nucleus, during localization to subcellular regions within the cytoplasm, and during translation. The core of the EJC remains constant, however proteins may be added to it or removed from it. Some EJCassociated proteins enhance translation while others repress it (or promote its destruction). In nonsense-mediated mRNA decay (NMD), mRNA that carries premature termination codons is selectively destroyed. NMD prevents the translation of shortened proteins that may be harmful. This destruction occurs in the cytoplasm. For nonsense-mediated mRNA decay to occur efficiently, the premature termination codons must occur 50 nucleotides or more upstream of a splice junction. There is evidence that premature stop codons are recognized during the early rounds of translation. A key step in determining nonsense-mediated decay is recruitment of the RNA helicase UPF1. Down-regulation of UPF1 (e.g., by small, interfering RNAs) increases translation efficiency. Tian et al. (2007) noted that there is evidence that splicing and polyadenylation activities are highly integrated. They reported that over half of human genes have alternate polyadenylation sites. Furthermore, a large number of them are located upstream of the putative 3' exon (i.e., they are located in upstream introns). Use of upstream polyadenylation signals leads to generation of variant transcripts, many of which encode proteins. Tian et al. (2007) also obtained evidence that intronic polyadenylation activity varied under different cellular conditions. They propose that intronic polyadenylation sites arose in recent evolutionary history. Evidence for this is the low frequency of such sites in the mouse and rat genomes in comparison with the human genome. Tian et al. reported that reduced splicing activity is associated with enhanced use of upstream polyadenylation.
Regulation of Transcription, Splicing and Translation
79
RIBOSOME STRUCTURE AND BIOGENESIS In eukaryotes ribosome biogenesis occurs in the nucleolus and it involves assembly of ribosomal RNAs and proteins. In eukaryotes, ribosomes are composed of a 40S subunit and a 60S subunit, distinguished on the basis of their centrifugation properties that are defined in Svedberg units. Decoding of the mRNA sequence occurs on the small ribosomal subunit and peptide bond formation occurs on the large ribosomal subunit (Moore and Steitz, 2007).
TRANSLATION INITIATION Costa-Mattioli et al. (2009) noted that translation requires at least twelve initiation factors (EIFs) and they considered three key events in this process. The first is formation of the 43S ribosomal preinitiation complex; the second involves binding of mRNA to the 43S ribosomal complex; the third involves formation of the 80S ribosomal complex. Early in initiation, subunits of EIF2 bind to guanosine triphosphate (GTP) and to tRNA methionine. There is evidence that phosphorylation of EIF2 plays a key role in regulation of translation. Ribosome interactions with mRNA occur via cap-dependent and cap-independent processes. The cap is the 5' structure in mRNA (M7GpppX). Cap-independent ribosome interactions occur between the ribosome and sequence in the 5' untranslated mRNA. Following initiation of translation, elongation of the polypeptide occurs and tRNAs carrying specific amino acids are translocated to the ribosome. Initiation factors are subsequently released from ribosomes by GTP hydrolases. Costa-Mattioli et al. (2009) reported that EIF2 phosphorylation plays a key role in expression of genes that determine long-lasting synaptic plasticity and memory consolidation. Fig 5–1 depicts the impact of nutrients, growth factors, and signal transduction pathway activity on translation. Different mRNA and Protein Products that Arise from a Single Gene either through Alternate Splicing, Use of Different Transcription Start Sites, or Stop Codons Different isoforms of the vascular endothelial growth factor A (VEGFA) occur and there are functional differences between the different isoforms. Harper and Bates (2008) analyzed molecular structure and function of the different VEGFA isoforms. They noted that understanding these functional differences
80
Phenotypic Variation Growth factors nutrients absent
PIP3
RhebGDP
RhebGTP
Tuberin harmatin active
PTEN T
PIP2
H
Growth factors nutrients present
*P PIP2 PIP3
AKT
AKT P
RhebGTP
PPP T H
mTOR
Tuberin phosphorylated complex inactive S6 kinase active translation activated Translation initiation factor active, 4EBP inhibition lifted
Figure 5–1. Illustrates role of growth factors nutrients and signal transduction pathway components including AKT, tuberin, hamartin and RHEB in impacting activity of translation initiation factors and S6 kinase activity,
is important since VEGFA inhibitors are used to treat cancer. The goal of these therapies is to inhibit growth of the microvasculature in tumors. Tumors are dependent on microvessels for removal of metabolic breakdown products. Twelve different mRNA products are derived from the 16,775 nucleotides, and eight exons of the VEGFA gene on human chromosome 6. Alternate splice selection generates mRNA products that differ with respect to their content of nucleotides derived from exons 6, 7, or 8. Alternate stop codons also exist in the sequence, so that mRNA products may or may not contain exon 8. Of particular importance is the fact that isoforms that differ with respect to their content of exon 8 also differ in their function; isoforms are angiogenic or anti-angiogenic depending on whether or not they contain exon 8. Alternate splice forms of exon 8 occur and give rise to products with different amino acids in their carboxy terminal regions. If this region contains CDKPRR amino acids encoded by exon 8a, the protein product is angiogenic. If exon 8b encoded amino acids SLTRKD are present, the product is anti-angiogenic.
Regulation of Transcription, Splicing and Translation
81
VEGF receptor binding sites are present on all isoforms and are encoded by exon 3. Exons 6 and 7 encode heparin binding sites. These sites may be decreased or absent depending on whether or not isoforms contain sequences derived from exon 6 and/or 7. Harper and Bates (2008) noted that an additional level of complexity derives from the fact that VEGFA functions as a dimer and functional differences may result if the dimer is composed of different isoforms. There is also evidence for the use of an upstream non-AUG translation initiation site (CUG) for transcript generation, and this leads to additional isoforms.
EXAMPLES OF PHENOTYPES ASSOCIATED WITH ABERRANT ALTERNATE RIBONUCLEOPROTEINS Spinal muscular atrophy (SMA) is characterized by marked degeneration of spinal motor neurons and often leads to death in infancy. It results from deficiency of the SMN protein that plays a role in the biogenesis of a unique set snRNP that contain Sm proteins. In this disease there are defects in assembly of snRNPs and in splicing. In patients versus controls there is a shift in the ratio of alternatively spliced isoforms of a number of different mRNAs. Two SMN genes are present in humans; these genes are in tandem and are located on chromosome 5q13. However, only the SMN1 gene gives rise to a functional protein that includes exon 7. In the SMN2 gene, a single nucleotide substitution occurs that alters splicing and promotes exon 7 skipping, leading to an inactive and unstable protein. SMA patients have a deletion of the SMN1 gene and SMN2-derived protein does not compensate for the SMN1 loss (Cooper et al., 2009). A number of specific forms of the disease Retinitis pigmentosa, which leads to blindness, occur as a result of deficiency of PRPF31, PRPF3, or PRPF8 proteins that are part of the U4/U5/U6 snRNP complex that forms the catalytic center of spliceosomes. In a number of late-onset neurodegenerative diseases, abnormally high quantities of a heteronuclear ribonucleoprotein, TAR domain protein 43 (TDP43), occur in inclusions in the cytoplasm. TDP43 is an hnRNP that associates with mRNA during transcription and therefore usually occurs in the nucleus. Mutations in the gene that encodes TDP43 occur in sporadic and familial amyotrophic lateral sclerosis (Daoud et al., 2008). Expanded trinucleotide repeats bind excessive quantities of specific proteins and lead to functional depletion of these proteins (Cooper et al., 2009).
82
Phenotypic Variation
One of the most striking examples is the expansion of a CUG repeat in the DMPK gene encoded mRNA in myotonic dystrophy. This expanded repeat binds excessive quantities of two proteins: CUG binding protein1 and muscleblind-like MBNL1. Depletion of MBNL1 proteins leads to aberrant splicing of a number of mRNA transcripts, including the transcript of the chloride ion channel gene (CLCN1). In Fragile X ataxia syndrome, expansion of the CGG repeat depletes RNP proteins, including hnRNPA2 and PUR alpha.
REGULATION OF RNA EDITING AND SPLICING OF A DISTANT GENE BY snoRNA HBII-52 Small nucleolar RNAs (snoRNAs) guide editing of ribosomal RNAs, snRNA, and tRNA through O methylation and pseudouridylation. On chromosome 15q11-q13 there are 47 copies of almost identical sequences that encode snoRNA. One of these snoRNAs is HBII-52 a C/D box snoRNA that is expressed in the brain. Kishore and Stamm (2006) reported that snoRNA HBII-52 impacts alternate splicing of the serotonin2c receptor (HTR2C) mRNA and promotes inclusion of the alternate exon, exonVb. The HTR2C locus is on the X chromosome. Previous studies by Flomen and Makoff (2004) revealed that five sites with exon Vb encoded mRNA of HTR2C are subject to editing from adenosine to inosine. This editing impacts functional efficiency of the receptor (Fig 5–2). Kishore and Stamm (2006) determined through studies in rats that the 5HTR2C receptor isoforms with exon Vb is expressed in all brain areas with the exception of the choroid plexus. In studies of various constructs of the 5HTR2C receptor in cultured mouse neuronal cells, Kishore and Stamm determined that when the concentrations of mouse homolog MBII-52 increased, the use of the 5HTR2C exon Vb was increased. They concluded that MBII-52 promoted inclusion of exon Vb in 5HTR2C receptor pre-mRNA. They also carried out studies to determine whether HBII-52 binds to the 5HTR2C receptor and demonstrated a direct interaction when the two were present in the same cell. Given the imprinting that occurs in the chromosome 15q11-q13 regions and the fact that HBII-52 is expressed from the paternal chromosome that sustains deletions in Prader-Willi syndrome, HBII-52 is likely deficient in PraderWilli syndrome. Kishore and Stamm (2006) confirmed that there was a significant reduction of HBII-52 in Prader-Willi patients. Only 5HTR2C receptor mRNAs that contain exon Vb encode a functional amino acid sequence that is edited on all five sites and that couples efficiently
Regulation of Transcription, Splicing and Translation
83
NH2 N HO O
N
N
N
OH OH
Adenosine O N HO
O
N
NH N
OH OH
Inosine Figure 5–2. Transformation of adenosine to inosine plays a role in RNA editing.
to G protein. Kishore and Stamm determined that patients with Prader-Willi syndrome manifest defects in the serotonergic system. Doe et al. (2009) carried out analyses of 5HTR2C-receptor-determined behaviors in mouse models of Prader-Willi syndrome. These behaviors included reduced attention, impulsive responding, reduced locomotor activity, anxiety, and increased consumption. Binding of serotonin to the 5HTR2C receptor modulates dopamine release in the ventral tegmental areas. The decreased efficiency of the 5HTR2C receptor would likely lead to increased dopamine release. In 2010 Kishore et al. reported that the HBII-52 homolog in mouse, MBII-52, also plays roles in alternate splicing of a number of other primary mRNAs including the mRNA for Corticotropin releasing hormone receptor (CRHR1). This receptor acts as a major regulator of the pathway that connects hypothalamic, pituitary and adrenal functions.
REGULATION OF RNA TRANSCRIPTION AND PROCESSING AND NEURODEGENERATIVE DISEASES RNA processing defects occur in a number of neurodegenerative diseases, including familial amyotrophic lateral sclerosis (ALS/FALS), in hereditary
84
Phenotypic Variation
motor neuropathies Charcot Marie Tooth neuropathy type 2D (CMT2D), spinal muscular atrophy and familial dysautonomia. Simpson et al. (2009) carried out studies on ALS. This disease is characterized by progressive motor neuron degeneration. Mutations in the superoxide dismutase gene (SOD1) account for 1 to 7% of cases; mutations in the TDP43, gene that encodes TAR binding protein (TARDP) account for 0.5 to 7% of cases. They identified a microsatellite polymorphism, D8S1820, on chromosome 8 associated with ALS in cases in the United Kingdom. D8S1820 is located in an intron of the ELP3 gene. ELP3 protein is a component of RNA polymerase II. It is involved in mRNA elongation and processing. Simpson et al. analyzed expression levels of ELP3 in individuals with different ELP3 alleles and established that individuals with alleles that protect against ALS produced 59% more ELP3 protein than individuals with risk alleles. In studies on Drosophila, Simpson et al. (2009) determined that ELP3 is a critical regulator of axon targeting and synaptic communication. Through studies that involved knockdown of ELP3 gene expression in zebra fish, they determined that decreased ELP3 levels led to a dose-dependent shortening and abnormal branching of motor neurons. They also determined that ELP3 protein is present in human spinal motor neurons. They noted that ELP3 directly impacts the expression of the heat shock protein, HSP70. Heat shock proteins protect cells against effects of stressors. They are generally expressed at low levels in motor neurons. Simpson et al. (2009) proposed that specific ELP3 alleles with high levels of expression protect against ALS in part because they lead to increased levels of HSP70. Studies of familial amyotrophic lateral sclerosis (FALS) in a large British family revealed that the disease was linked to a locus on chromosome 16. Follow-up studies using single nucleotide polymorphism (SNP) analysis revealed a conserved haplotype that covered 400 genes in affected individuals (Vance et al., 2009). In view of prior evidence that TDP43 plays a role in ALS, Vance et al. examined genes within this haplotype and searched for domains similar to those present in the TDP43-encoding gene. They identified six genes with TARDP-related domains. They sequenced these genes in affected individuals and found a mutation in affected members of the largest British ALS kindred. The mutation they identified led to an arginine cysteine substitution in the FUS-encoded protein, R521C. The FUS gene was first identified on the basis of studies of chromosome fusions in liposarcomas that involved chromosome 16p11.2.
Regulation of Transcription, Splicing and Translation
85
Vance et al. (2009) then screened for FUS mutations in 197 cases of FALS in which other ALS-predisposing genes were not mutated. They identified the R521C mutation in four other families. In two other FALS pedigrees they identified an R521H (arginine to histidine) mutation in affected individuals. In another FALS pedigree they identified an R514G (arginine to glycine) mutation. They carried out detailed phenotype studies in these pedigrees and established that the average age of onset of the disease was 44 years and that the average length of survival after onset of symptoms was 33 months. Severe loss of lower motor neurons occurred that involved cervical, lumbar, and bulbar regions. Mild loss of upper motor neurons occurred in the motor cortex. Cognitive deficits did not occur. Immunohistochemical studies with antibody to FUS protein revealed large globular and elongated inclusions in the cytoplasm of affected neurons. Vance et al. (2009) noted that FUS is involved in DNA repair and in regulation of transcription. They noted further that the 3' end of FUS protein has arginine glycine repeat regions and zinc fingers that are involved in RNA processing. They postulated that aggregates might lead to sequestration of proteins and/or RNAs in the cytoplasm, resulting in neuronal toxicity. In a large ALS family from Cape Verde island, Kwiatkowski et al. (2009) identified loss of heterozygosity on chromosome 16. This deleted region was 4 Mb in size and it encompassed 56 genes, including FUS. Genome sequencing on the undeleted corresponding region of chromosome 16 revealed a single mutant allele in FUS in four ALS-affected individuals. Kwiatkowski et al. then sequenced 15 FUS exons in 83 FALS cases and in 209 cases of sporadic ALS. In 17 of the 83 families, they identified 13 different FUS mutations. They determined that mutated FUS accumulated in neuronal cytoplasm. These investigators proposed that protein aggregation and defective RNA metabolism are common pathogenic mechanisms in ALS and possibly in other neurodegenerative diseases. Andersson et al. (2008) reported that FUS is a member of the FET family of proteins that play a role in maintenance of genomic integrity, mRNA and microRNA processing, and in regulation of gene expression. They determined that proteins in the FET family localize to stress granules. They proposed that these activities play a role in translation regulation under stress conditions. Stress granules are aggregates of small ribosomal subunits, mRNA and mRNA binding protein, and translation initiation factors including EIF2A (Dang et al., 2006).
86
Phenotypic Variation
DEFECTS OF RIBOSOMAL BIOGENESIS AND RNA MODIFICATION Impaired bone marrow function occurs as a result of abnormal ribosome biogenesis in several different genetically determined syndromes including Diamond Blackfan anemia, Shwachman Diamond syndrome, congenital dyskeratosis, and cartilage hair hypoplasia. Cytopenia occurs in these syndromes as a result of bone marrow dysfunction; congenital anomalies may occur and there is also an increased risk of cancer. Gunapathi and Shimamura (2008) reviewed these syndromes and ribosomal function; they noted that the exact mechanisms through which ribosomal biogenesis defects give rise to clinical syndromes are difficult to determine. Different polymerases are involved in transcription that gives rise to ribosomal RNA (rRNA). This transcript undergoes cleavage and post-translation modification within the nucleolus. Ribosome assembly begins in the nucleolus but is not completed there. Specific factors play a role in transport of ribosomes to the cytoplasm. The rate of ribosome biogenesis is influenced by cell growth, cell proliferation, and stress. In all four syndromes bone marrow dysfunction leads to anemia, however the characteristics of the anemia varies. Diamond Blackfan anemia is a macrocytic anemia with erythroid hypoplasia. Erythropoietin is increased and fetal hemoglobin is present. Cartilage hair hypoplasia syndrome is characterized by macrocytic anemia and decreased T cell function. Neutropenia is particularly prominent in Shwachman Diamond syndrome; in congenital dyskeratosis, pancytopenia and aplastic anemia occur. Skeletal anomalies occur in the four syndromes, however the specific types of anomalies differ. In Diamond Blackfan, anemia radial ray and cranio-facial abnormalities occur in approximately 20% of patients. In congenital dyskeratosis, osteoporosis is prominent. Schwachman Diamond syndrome is associated with osteopenia and abnormalities in bone metaphyses. Nail and skin abnormalities are present in congenital dyskeratosis and cartilage hair hypoplasia syndrome. Gastro-intestinal abnormalities also occur in congenital dyskeratosis, and malabsorption is a feature of Schwachman Diamond syndrome. Diamond Blackfan anemia occurs with a frequency of four per million. It may arise sporadically and may be inherited as an autosomal dominant trait with marked variability in penetrance. Mutations at several different gene loci give rise to autosomal dominant Diamond Blackfan anemia. The first locus identified for this disorder was found through linkage analysis and was mapped the chromosome 19p13.3. It was subsequently found to encode a ribosomal
Regulation of Transcription, Splicing and Translation
87
protein, RPS19. Mutations in ribosomal proteins RPS17 and RPS9 may also give rise to this disorder. Gunapathi and Shimamura (2008) noted that RPS19 encodes one of 33 proteins that form the 40S ribosomal subunit along with 18S ribosomal RNA. Fatica and Tollervey (2002) reviewed ribosomal protein function and reported that these proteins are not only involved in ribosomal assembly, they play a role in rRNA processing and they impact efficiency of translation. Homozygous mutations at the SBDS locus on chromosome 7q11 give rise to Shwachman Diamond syndrome, also known as Shwachman Bodian Diamond syndrome. The protein product of this locus is distributed in the nucleus, nucleolus, and cytoplasm. This disorder is associated with global delay in rRNA processing. Congenital dyskeratosis arises as a result of mutation in the DKC1 gene on the X chromosome. This locus encodes dyskerin, a nucleolar protein that associates with specific small nucleolar RNA, H/ACA snoRNA, that function in rRNA maturation and rRNA pseudouridylation. Pseudouridylation is a process whereby different isomers of uridine are added to RNA. This process may be catalyzed by dyskerin or by pseudouridine synthase that are homologous proteins. Telomerase RNA is a form of H/ACA snoRNA. Congenital dyskeratosis also occurs as a result of mutations in TERC telomerase RNA or in TERT catalytic subunit of telomerase (Walne & Dokal, 2009).
FMRP AND REGULATION OF TRANSLATION FMRP is the protein that was discovered as a result of studies on the gene locus that determines Fragile X mental retardation. In that condition there is an expansion of the triplet repeat sequence CGG in the 5' untranslated promoter region of the gene to beyond 200 repeats. The expanded repeat is then hypermethylated leading to silencing of gene expression. Fragile X mental retardation is therefore caused by the absence of the FMRP. In the normal population the CGG repeat is polymorphic, and between five and 55 CGG repeats are present. Repeat expansions between 55 and 200 are unstable in female meioses and are referred to as premutations. Oostra and Willemsen (2009) reported that the repeat is stable in somatic tissues. FMRP has a cytoplasmic distribution and it occurs on polyribosomes and on free ribosomes in large ribonucleoprotein particles. These particles also contain cytoplasmic interacting protein 1 and 2 (CYFIP1 and CYFIP2). CYFIP1 is encoded on chromosome 15q12 and CYFIP2 is encoded on 5q34.
88
Phenotypic Variation
Rare cases of Fragile X mental retardation result from mutation within the FMRP gene and studies on these patients have provided information on important domains within the FMRP. Two RNA binding domains occur within the FMRP molecule and in addition there is an arginine-glycine-glycine (RGG) box. FMRP apparently shuttles in and out of the nucleus though nuclear pores. Nuclear export signals and nuclear localization structures occur within the protein. Oostra and Willemsen (2009) reported evidence that FMRP plays a role in regulation of translation of specific target mRNAs. FMRP- containing ribonucleoprotein particles migrate along dendrites and through dendritic branches to dendritic spines and synapses. Male and female FMR1 repeat expansion carriers are at risk for developing a neurodegenerative disorder known as Fragile-X-associated tremor/ataxia syndrome (FRXATS). Hagerman (2007) reported that severe cases of this syndrome many manifest cognitive decline. Postmortem studies on patients with this disorder have revealed the occurrence of intranuclear eosinophilic inclusions. These inclusions are ubiquitin-positive. In the brain and in leukocytes of premutation, carriers elevated levels of mRNA derived from the mutant FMR1 gene with expanded CGG repeat occur and there is a slight reduction in FMRP. The inclusions in FMR1 premutation carriers contain ubiquitin, molecular chaperones, including HSP40, and DNA repair-associated molecules (HR23B). There is evidence that the mRNA-containing expanded repeats sequesters specific proteins and diverts them from their normal function, leading to neurodegeneration. FMRP Translational Activation of SOD1 and Protection against Oxidative Stress FMRP binds to hundreds of mRNA targets; this binding occurs through two ribonucleoprotein binding domains (hnRNP domains), and through K homology domains and the RGG box (arginine-glycine-glycine). In the cytoplasm FMRP is associated with polyribosomes. Bechara et al. (2009) reported that FMRP interacts with the mRNA for super-oxide dismutase, SOD1, through a novel stem-loop motif in SOD1 mRNA. They determined that binding of FMRP to SOD1 mRNA enhances translation of the mRNA. They reported that in the absence of FMRP, SOD1 expression is decreased. They observed a significant decrease in SOD1 levels in extracts of the whole brain, hippocampus, and cerebellum in FMRP negative mice. Furthermore, in FMR1-negative mice brain metabolism is more sensitive to oxidative stress. Bechara et al. proposed that deregulation of SOD1 may constitute the basis of a number of traits in Fragile X syndrome.
Regulation of Transcription, Splicing and Translation
89
DISEASE-CAUSING MUTATIONS IN A NUCLEAR GENE THAT ENCODES RNA ONLY Mitochondrial RNA Processing Endoribonuclease RNA Component (RMRP) Mitochondrial processing ribonuclease is a ribonucleoprotein that has endonuclease activity. This endonuclease impacts a number of different forms of RNA including mRNA and ribosomal RNA. It cleaves 5.8S ribosomal RNA. It is particularly abundant in the nucleolus. It also cleaves mitochondrial RNA complementary to the light chain. Copying of this RNA is the first step in mitochondrial DNA replication (Hirose et al., 2006). The nuclear gene that encodes the RNA component of this ribonucleoprotein was mapped to a region of human chromosome 9 that was intensely scrutinized because it showed linkage to the disorder, cartilage hair hypoplasia syndrome (CHH). The disorder is inherited as a recessive condition. The carrier frequency of CHH in the Amish population is one in 76; in the Finnish population it is one in 19. The most common mutation is a 70A>G nucleotide substitution in the RMRP gene. A striking feature of cartilage hair hypoplasia is the great phenotypic variability between siblings. Mutations in RMRP also occur in a number of other disorders associated with bone abnormalities and impaired growth and dermatological problems, including metaphyseal dysplasia, and anauxetic dysplasia. In the latter condition there is severe short stature and disturbance of growth plate structure (Thiel et al., 2007). Interaction between the Catalytic Subunit of Telomerase (TERT) and RMRP In 2009, Maida et al. reported that the human telomerase reverse transcriptase catalytic subunit, TERT, interacts with RMRP. TERT and RMRP form a complex that has RNA-dependent polymerase activity and produces doublestranded RNAs that give rise to small inhibitory RNAs. Maida et al. reported evidence that TERT has activities in addition to its role in telomere maintenance and that it is present in different intracellular complexes. TERT is the protein component of telomerase and it has reverse transcriptase activity. TERC is the RNA component of telomerase and it contains the template to synthesize telomere DNA. It is interesting to note that mutations in TERT or in its associated noncoding RNA (TERC) and mutation in the telomerase-associated protein, dyskerin,
90
Phenotypic Variation
occur in a condition known as dyskeratosis congenita. This syndrome leads to ectodermal dysplasia and bone marrow failure. Maida et al. noted that TERT mutations also occur in aplastic anemia and in idiopathic pulmonary fibrosis. Additional genes have been identified that are critical for telomere maintenance and that give rise to dyskeratosis congenita when mutated. These genes are located on autosomes, and they include NOP10 and NHP2 (snoRNPs) that along with TERC, TERT and dyskerin form the core of the telomerase complex. Dyskeratosis congenita may also occur as a result of mutations in the T-interacting nuclear factor (TIN2) gene that forms part of the shelterin complex that protects telomeres. RESTRICTED EXRESSION DURING DEVELOPMENT AND REACTIVATION IN TUMORS Anaplastic lymphoma receptor tyrosine kinase (ALK) is a tyrosine kinase transmembrane receptor. Iwahara et al. (1997) characterized this receptor and determined that its expression is usually confined to the developing central nervous system. ALK has protein homology to neurotrophin receptors and it participates in neuronal differentiation. The ALK gene maps to chromosome 2p23. Mosse et al. (2008) used linkage studies in families with an autosomal dominant form of neuroblastoma to identify the genome region that segregated with propensity to develop tumors. They identified a neuroblastoma-linked region on chromosome 2p23-p24. Sequence analysis of genes in that region led to identification of sequence changes in the ALK gene in eight probands with neuroblastoma. The sequence changes were not polymorphisms. The mutations clustered in the active domain of the gene. They determined that the mutations increased ALK activity. In a follow-up analysis, Mosse et al. studied 491 sporadically occurring neuroblastomas. They determined that in 22% of cases there was an unbalanced gain of a large region on chromosome 2p. This region included the ALK gene. In some cases, the MYCN gene (myelomytosis viral related oncogene), located at 2p24.1 was also amplified. Their findings have implications for therapy since ALK is sensitive to small molecule inhibitors (e.g., TAE684). CELL LINEAGES AND BLOCKS IN THE EVOLUTION OF A PARTICULAR CELL TYPE Nuclear-encoded mitochondrially expressed adenylate kinase (adenylate kinase 2 or AK2) is mutated in the immune deficiency disease, reticular dysgenesis.
Regulation of Transcription, Splicing and Translation
91
This disorder is characterized by blockage of differentiation of myelo-lymphoid lineages (Pannicke et al., 2008). Adenylate kinase 2 is a mitochondrial energy metabolism gene; reticular dysgenesis is therefore an immune deficiency caused by defective energy metabolism. AK2 is expressed in the inner mitochondrial membrane. Pannicke et al. studied five families with this disorder, including three families in which there was consanguinity. They utilized genome-wide SNP analysis and they identified a region of homozygosity on chromosome 1p34.3-1p36.11.This region encompasses 185 genes. They then examined expression of 80 genes likely to be expressed in bone marrow cells. Their studies revealed that the AK2 gene in affected individuals was missing exons 6 and 7 and that the AK2 cDNA was shortened. They reported that affected individuals in other families with reticular dysgenesis had single base pair mutations and/or small deletions within specific AK2 exons. Pannicke et al. (2008) analyzed the effects of AK2 mutations on leukocyte development in zebra fish. They determined that in those organisms, AK2 mutations impacted T cell and leukocyte development; erythropoiesis was not impaired. These investigators noted that AK2 is one of the enzymes that support high-energy phosphor transfer between adenosine triphosphate to adenosine diphosphate, (ATP and ADP), it catalyzes reversible transfer of the phosphoryl group from ATP to ADP They proposed that the specificity of effect of AK2 mutations on leukocytes is in part related to the fact that AK1 expression is lower in leukocytes than in other tissue. Lagresle-Peyrow et al. (2008) reported that sensorineural deafness occurs in patients with reticular dysgenesis. They determined that AK2 is specifically expressed in the stria vascularis of the inner ear.
CONGENITAL HEART DISEASE AND THE IMPORTANCE OF TRANSCRIPTION FACTORS The importance of genetic factors in congenital heart disease became clear through studies of microdeletion syndromes in which heart malformation occurred. Furthermore, congenital heart disease often occurs in families, however different members of the same family may have different anatomical heart defects. Tetralogy of Fallot (TOF), ventricular septal defects (VSD), or atrial septal defects (ASD) may occur in one family. Bruneau (2008) reviewed progress in delineation of the molecular basis of congenital heart defects. He reported that key factors in heart development
92
Phenotypic Variation
include a cascade of interacting transcription factors, secreted proteins, fibroblast growth factors, bone morphogenetic protein, and WNT (homolog of Drosophila wingless) signaling pathway proteins. Bruneau reported that myocardial, endocardial, and smooth muscle lineages derive from a common precursor. Following expansion of the precursor cell pool, the cell population branches into different lineages. WNT proteins play a role in both processes, expansion and branching. Chromatin-remodeling complexes play a role in cardiac development. Particularly important is SMARCD3, a component of the SWI/SNFchromatin remodeling complex. Histone modification factors that are important include histone methyl transferase and histone deacetylase. Bruneau reviewed the important role of transcription factors in cardiac development. Studies on families with multiple members affected by the HoltOram syndrome revealed that the disorder was linked to chromosome 12. This syndrome is characterized by variable limb abnormalities and cardiac malformations. Subsequently the gene that encodes the T-Box transcription factor TBX5 was determined to be mutated in Holt-Oram syndrome. Mutations in the transcription factor NKX2-5 occur in subsets of patients some with VSD, Epstein anomaly, or Tetralogy of Fallot. Bruneau noted that reports of involvement of TBX5 and NKX2-5 confirmed that transcription factor haplo-insufficiency led to a dominant pattern of inheritance of cardiac anomalies. These transcription factors interact with other proteins. Defects in an NKX2-5 interacting transcription factor GATA4 lead to septation defects. T box transcription factor (TBX1) deficiency resulting from chromosome 22q11 deletion is a key factor in the etiology of Tetralogy of Fallot. Benoit noted that the discovery of specific downstream targets of transcription factors and elucidation of the mechanisms through which they cause heart disease remain to be discovered.
CARDIAC OUTFLOW TRACT ANOMALIES AND VALVE DISEASE Structural changes in cardiac muscle caused, for example, by myosin-heavy deficiency and MYH6 gene defects, lead to altered hemodynamics that in turn lead to outflow tract anomalies. Bruneau (2008) reported that signaling between myocardium and endocardium plays a key role in cardiac valve formation. Mutations in signaling pathway genes and genes that encode specific secreted proteins lead to valve disease. Bone morphogenetic protein 4 (BMP4) is important secreted protein.
Regulation of Transcription, Splicing and Translation
93
NOTCH1 signaling pathway defects lead to bicuspid valve defects and to aortic stenosis and may lead to left ventricular defects and ventricular septal defects. Specific mutations in NOTCH2 or in the NOTCH ligand JAG1 occur in patients with Alagille syndrome characterized by cardiac, skeletal, liver, and ocular abnormalities, and facial dysmorphology. Noonan syndrome is in some cases caused by defects in genes in the RAS signaling pathway. Mutations in the signaling molecule, protein tyrosine phosphatase 11 (PTPN11), have been identified in association with a number of different defects, including aortic stenosis, atrial septal defects, and pulmonary defects. Bruneau reported evidence that microRNAs including miRNA 1 and 2 impact expression of transcription factor HAND2. Ventricular septal defects and conduction defects occur in mice where the HAND2 gene is knocked out. He concluded his review by emphasizing that gene mutations that cause structural anatomical defects during embryogenesis may later cause cardiomyopathies.
6 MITOCHONDRIA Genome, Functions, and Phenotype
INTRODUCTION Through pioneering studies in the 1960s and 1970s by A. Lehninger (1979), E. Racker (1975), and by 1997 Nobel laureates J. Walker and P. Boyer, we gained insight into the key role of mitochondria in energy generation. In the electron-transport chain, electrons derived from reduced nicotinamide adenine dinucleotide (NADH) and reduced flavin adenine dinucleotide (FADH2) generated in metabolism of glucose and fatty acids, are transferred to molecular oxygen and these electrons serve as energy source. Soluble carriers such as coenzyme Q and cytochrome C transfer electrons through the four mitochondrial electron complexes. Cytochrome C oxidase transfers electrons to oxygen. Coincident with electron-transfer protons are transferred to the space that exists between the inner and the outer mitochondrial membranes leading ultimately to an electrochemical proton gradient across the mitochondrial membrane. The proton translocating adenosine triphosphate (ATP) synthase complex (complex V) harnesses the free energy generated by this gradient. This complex synthesizes ATP from adenosine diphosphate (ADP) when free energy and inorganic phosphate are available. Disruption of the correct electron flow can lead to generation of 94
Mitochondria
95
Mitochondrial electron transfer and Oxidative phosphorylation
Complex I
Complex II
Cytc
H
Cytc
CoQ
NADH
NAD
FADH
Inner membrane
Complex V ATP Synthase
Complex IV
Complex III
Cytc
2H+
Cytb FAD
2H + O=H2O
ADP
ATP
Inter-membrane space
Outer membrane
Figure 6–1. Diagram of electron transfer through mitochondrial complexes and oxidative phosphorylation.
reactive oxygen species (ROS). The mitochondrial electron-transport chain and oxidative phosphorylation are schematically represented in Fig. 6–1. Sequencing of the mitochondrial genome revealed that it is 16.5 kb in length, it encodes 13 proteins, 22 transfer RNAs (tRNAs), and two ribosomal RNAs (Attardi, 1986). A map of the mitochondrial genome is depicted in Fig. 6–2. Each cell has hundreds of mitochondria. Mitochondria with deleterious mutations often coexist with wild-type mitochondria; this is referred to as heteroplasmy. The phenotype is determined by the ratio of wild-type to mutant mitochondria (Wallace et al.,1988). Over the past decade we have gained insight into the more than 1,000 nuclear genome-encoded proteins that function within the mitochondria (Wright et al., 2009).
EVOLUTIONARY CHANGES IN MITOCHONDRIA Grossman et al. (2004) noted that two different mechanisms evolved to accommodate increased energy requirements. One mechanism impacts mitochondrial proliferation and plays a role in specific tissues; the second mechanism—and likely the most important one—in anthropoid primates, led to increased efficiency of electron transfer. They then reviewed molecular evolutionary changes in the electron-transport complexes. Cytochrome C oxidase (complex IV) transfers electrons from cytochrome C to oxygen and is composed of three mitochondrial encoded subunits and
96
Phenotypic Variation
P 12s H rRNA
OH T
F D-Loop
Cyt b
V OJ16569 P 16s rRNA
PL
E ND6
L ND5 ND1 I M
Q
ND2 W
L S H AN OL C Y
ND4
ND4L S
G
COI
R ND3
COIII D
COII
K
ATPase6
ATPase8 5 kb deletion KSS
Complex I genes (NADH dehydrogenase)
Complex III genes (ubiquinol: cytochrome c oxidoreductase)
Transfer RNA genes
Complex IV genes (cytochrome c oxidase)
Complex V genes (ATP synthase)
Ribosomal RNA genes
Figure 6–2. Map of the mitochondrial genome and position of encoded genes, (based on illustration in www.mitomap.org and used with permission).
10 nuclear-encoded subunits. Two of the mitochondrial genes and seven of the nuclear-encoded genes show evidence of nonsynonymous nucleotide substitutions in humans. Complex III ubiquinol cytochrome c oxidoreductase is composed of 11 subunits, one encoded by the mitochondrial genome and 10 encoded by the nuclear genome. This complex transfers electrons from the soluble carrier ubiquinol to cytochrome C and this transfer is linked to proton transfer into the intermembrane space. Grossman et al. (2004) noted that complex III is an important site of reactive oxygen species (ROS) production.
Mitochondria
97
Cytochrome C has apparently undergone increased amino acid replacement during two periods of evolution. There is also evidence for adaptive evolutionary changes in the components of complex IV. Grossman et al. (2004) reviewed evidence for the accelerated evolution of specific components of the electron-transfer chain in anthropoid primates including New World and Old World monkeys, apes, and humans. They reported evidence for accelerated rates of nonsynonymous sequence changes in anthropoid genes that encode subunits of complexes I through V and in cytochrome C. These investigators proposed that natural selection might have favored changes that decrease production of reactive oxygen species in longlived anthropoids. Grossman et al. (2004) concluded that molecular evolutionary changes in the electron-transfer complex are likely linked to important phenotypic changes in anthropoid apes. They proposed that examples of phenotypic changes supported by increased energy production included enlargement of the neocortex, prolonged fetal development, brain growth, and extended life span. In addition to evidence of increased rates of protein evolution, there is evidence for regulatory changes during evolution that led to increased expression of ETC genes in the human brain cortex (Uddin et al., 2008). The important role of mitochondrial DNA analysis in the examination of modern human’s evolution is discussed in Chapter 2 of this book, entitled “Evolution.” Polymorphisms in Mitochondrial DNA, Haplogroups, and Population Differences Mitochondrial haplogroups are defined as apparently neutral nucleotide polymorphisms that occur in specific combination or haplogroups. In different populations different haplogroups predominate (Wallace et al., 1999). Specific mitochondrial haplogroups (i.e., specific combinations of nucleotide polymorphisms in mitochondrial DNA) predominate in particular ethnic groups. Indigenous populations in different parts of the world show region-specific mitochondrial haplogroup differences. Indigenous populations in sub-Saharan Africa belong to macrohaplogroup L that includes subgroups L0, L1, L2, and L3. Subgroups of L3, M, and N left Africa and colonized Eurasia. Subgroup N colonized Europe, and from N individuals haplogroups H, I, J, T, UK, UV, W, and X arose. A map representing mitochondrial haplogroups and world migrations is presented in Fig. 6–3. N haplogroup individuals that had migrated to Asia gave rise to A, B, and F haplogroups. M gave rise to the C, D and G Asian haplogroups. A, C, and D were
98
Phenotypic Variation
Figure 6–3. Map illustrating mitochondrial haplogroups and population migration; (illustration in www.mitomap.org and is used with permission).
enriched in Siberia and members of these haplogroups populated the Americas. X and B haplogroups were also among early migrants to the Americas. Wallace noted that some mitochondrial polymorphisms arose multiple times in different populations. Specific haplogroups may be more advantageous in particular geographic and climate regions. For example, specific haplogroups are more common in indigenous populations in geographic areas with cold climates and these specific haplogroups are postulated to impact oxidative phosphorylation. There is evidence that these ancient mitochondrial polymorphisms may impact disease. This impact may be observed in that cases with the same pathogenic mutation in mitochondrial DNA differ from each other with respect to the severity and manifestations of their disease depending on their haplogroups. One example is the finding that individuals with a specific mitochondrial DNA mutation at nucleotide 11778, which leads to Leber’s Hereditary Optic Neuropathy (LHON), differ in the degree of disease and that individuals with the J haplogroup are more severely affected (Brown et al., 2002). There is also evidence that the presence of specific ancestral haplogroups impacts the risk of development of later-onset common diseases. Haplogroup T2 was reported to be at increased risk for macular degeneration (SanGiovanni et al., 2009).
Mitochondria
99
Specific haplogroups may impact mitochondrial function and physiology. Niemi and Majamaa (2003), in a study of elite athletes, reported that specific haplogroups were more common in long-distance runners than in sprinters. In studies designed to investigate the functional impact of haplogroups, Suissa et al. (2009) analyzed the impact of haplogroup-defining mutations within the mitochondrial regulatory region. They screened mitochondrial DNA sequences with different haplogroups for transcription factor binding and transcription rate. They determined that in the Caucasian haplogroup J, binding of the transcription factor (TFAM) was increased and transcription was increased. Furthermore, haplogroup J individuals had a two-fold increase in mitochondrial copy number relative to haplogroup H. The main mitochondrial functions are energy production through oxidative phosphorylation and ATP production and heat generation. Brand (2004) proposed that mitochondrial heat production would be particularly advantageous in cold climates. Wallace and coworkers (Ruiz-Pesini et al., 2004) carried out studies of mitochondrial DNA variants in different populations. They postulated that advantageous mutations would be retained by adaptive selection, whereas selectively neutral mutations would be uniformly distributed throughout populations. They carried out studies to determine if certain haplogroups were more common in populations in specific climate zones. They determined that haplogroups A, C, D, and G are highly enriched in northeastern Siberia. In African populations, the macrohaplogroup is L and haplogroup B is also common. In European populations haplogroups H, I, J, and T are of higher frequency than in African populations. Wallace and Fan (2010) concluded that certain ancient mitochondrial DNA mutations facilitated human adaptation to colder climates through promotion of altered mitochondrial metabolism and that these adaptive mutations were associated with specific haplogroups. They further postulated that in the changed modern environments, these adaptive variations might be deleterious. In summary, ancient mitochondrial haplogroups permitted ancestral populations to adapt optimally to their environment. Migration out of environment, manipulation of environment, and alteration in food sources cause previously advantageous mutations to now be deleterious.
DEFINING PHENOTYPES CAUSED BY MITOCHONDRIAL FUNCTIONAL DEFECTS Given early discoveries on the key functions of mitochondria, including proton transfer through respiratory complexes, and energy production, abnormalities
100
Phenotypic Variation
of these functions were initially investigated primarily in children who manifested compromised muscle function and abnormal muscle histology. Careful analysis of the phenotype of patients who manifested these abnormalities revealed additional phenotypic abnormalities, often of a neurological dimension. DiMauro and Schon (2008) reviewed mitochondrial physiology and pathology. They emphasized that in recent decades investigations have revealed that mitochondrial disorders may involve the central nervous system and lead to seizures, psychomotor retardation or regression, stroke-like episodes, and/or cortical blindness. Defective mitochondrial function may lead to peripheral neuropathies, hearing loss, growth abnormalities, endocrine dysfunction, cardiac abnormalities, gastrointestinal abnormalities, or sideroblastic anemia. Molecular and biochemical studies have revealed that many nuclearencoded gene products are expressed in mitochondria. Defects in nuclear genes may constitute the basis for defective mitochondrial function and may lead to phenotypic abnormalities similar to those found in disorders determined by defects in genes encoded by the mitochondrial genome. Careful analyses of the phenotypes of patients with defects in mitochondrial function have led to delineation of associated phenotypic patterns. Nevertheless, the tissue-specificity of defects associated with specific mitochondrial functional deficits is poorly understood. Another puzzling feature of mitochondrial diseases is that symptoms often manifest first in adult life and then they may arise fairly precipitously. Further Evidence of Variable Phenotypes Associated with Specific Mitochondrial Mutation The A3243G mutation lies within the mitochondrial gene that encodes tRNAleucine (tRNAleu). It is one of the most common mitochondrial DNA mutations and is associated with variable phenotypes. Pierron et al. (2008) examined individuals in the French population who carried the A3243 tRNAleu mutation. They noted that the phenotype in these individuals varied from mild to severe and was associated in some individuals with MELAS symptoms (myopathy, encephalopathy, lactic acidosis, and stroke-like episodes). In other individuals the mutation was associated with diabetes and deafness. Some individuals with this mutation manifested ophthalmoplegia and stroke-like episodes, cardiomyopathy, or kidney disease. Furthermore, the same mutation occurred in patients who had no symptoms. These investigators carried out molecular analyses on 142 unrelated patients with the A3243 tRNAleu mutation to determine their mitochondrial DNA haplogroup and to determine the extent of heteroplasmy (i.e., the percentage of
Mitochondria
101
mitochondria with wild-type DNA and the percentage with the mutant DNA) in muscle and blood. Results of their analyses revealed that 111 different haplogroups occurred in 142 mutation carriers. Pierron et al. noted that the J mitochondrial haplogroup was underrepresented among the A3243G mutation patients. Pathogenesis of Mitochondrial Disorders In order to understand the pathogenesis of mitochondrial disorders it is necessary to consider aspects of mitochondrial structure, biogenesis and replication, including fission and fusion. It is also necessary to consider mitochondrial DNA replication and translation of mitochondrial encoded RNA transcripts. Mitochondrial membranes play a key role in determining import of proteins that function in mitochondria and in exchange of small molecules between mitochondria and cytoplasm. New insights into these processes reveal how they relate to disease processes. Studies of the mitochondrial redox system, generation of reactive oxygen species in the course of mitochondrial metabolism and the analysis of ion sulfur clusters function in mitochondrial are providing new insights into the origin of specific diseases. Additional information on disease pathogenesis is being generated through studies of the impact of reactive oxygen species on mitochondrial and nuclear genomic stability.
MITOCHONDRIAL DNA REPLICATION AND MAINTENANCE DiMauro and Schon (2008) noted that nuclear genomic signals play key roles in determining mitochondrial DNA replication and control of mitochondrial DNA numbers. Spinazzola and Zeviani (2005) reported that defects in genes that encode proteins and enzymes that determine availability of nucleotide pools are sometimes defective in individuals who have multiple mitochondrial DNA deletions. Clinical manifestations in these patients include ophthalmoplegia, ptosis, proximal muscle weakness, sensorimotor neuropathy, and impaired central nervous system function that may manifest as ataxia, dementia, or psychosis. The nucleotide adenosine is transported across the mitochondrial membrane by the protein adenosine nucleotide translocator (ANT1). A specific thymidine phosphorylase encoded by the TYMP locus on chromosome 22q13.3 (also known as ECGF1) plays an important role in mitochondrial DNA synthesis. Deficiency of this thymidine phosphorylase leads to multisystem disease in which gastrointestinal malfunction is a common feature.
102
Phenotypic Variation
Other enzymes that impact the mitochondrial nucleotide pool and that, when defective, lead to mitochondrial DNA depletion include: deoxyguanosine kinase, encoded by DGUK, thymidine kinase 2 (TK2) and p53-inducible ribonucleotide reductase (RRM2B). Mitochondrial DNA depletion may also be associated with mutation in the gene SUCLA2, that encodes the matrix enzyme succinyl co-A synthase. DiMauro and Schon (2008) noted that genes that encode products apparently not involved in mitochondrial nucleotide homeostasis might lead to mitochondrial DNA deletion. Of particular interest in this regard in the MPV17 gene on 2p23.3; mutations in this gene lead to severe neurological and hepatic disease that is relatively common in Navajo Indians (Karadimas et al., 2006). This disease was also found in families in southern Italy (Spinazzola et al., 2006). The MPV17 gene encodes a product that is present in the inner mitochondrial membrane. Mitochondrial DNA Deletions and Depletion Caused by Mutations in Nuclear-Encoded Polymerase Gamma (POLG) Defects in the POLG1 gene, which encodes the alpha (catalytic) subunit of mitochondrial polymerase gamma, or defects in POLG2, which encodes an accessory subunit (beta) of mitochondrial polymerase gamma, lead to multiple mitochondrial DNA deletions and to mitochondrial DNA depletion. POLG mutations may severely impact liver functions and lead to increased sensitivity to specific drugs (e.g., valproate). Mitochondrial DNA replication and repair are dependent upon the twosubunit nuclear-encoded polymerase, polymerase gamma. The POLG1 gene on human chromosome 15q25 encodes the catalytic subunit alpha; the accessory subunit beta is encoded by the POLG2 gene on human chromosome 17q24.1. Chan and Copeland (2009) reviewed polymerase gamma structure and disease-causing mutations. Mitochondrial polymerase gamma shows a high degree of species conservation. Three specific domains within polymerase gamma have polymerase activity and three additional domains have 3' to 5' exonuclease activity. The POLG2-encoded subunit acts to ensure tight binding of the polymerase to DNA. Defective activity of polymerase gamma leads to a number of different disorders characterized by mitochondrial DNA (mtDNA) deletion or depletion. A number of different mutations in POLG lead to progressive external ophthalmoplegia. A specific mutation, Y955C, in POLG1 encoded subunit alpha leads to an autosomal dominant progressive external ophthalmoplegia. This mutation is associated with a 10- to100-fold increase in
Mitochondria
103
mtDNA missense errors. Specific POLG1 mutations give rise to ataxia neuropathy syndromes or to Alpers syndrome that is characterized by cerebral, liver, and muscle manifestations. A glutamine-encoding trinucleotide repeat occurs at the N-terminal end of POLG1. Further studies are required to confirm whether expansion of this repeat plays a role in disease. A heterozygous POLG2 mutation G451E was described in a patient with multiple mtDNA deletions and cytochrome-C-deficient muscle fibers. Studies on myocytes from mice with genetically engineered DNAJA3 deficiency revealed that this chaperone facilitates transfer of POLG alpha subunits into mitochondria (Hayashi et al., 2006). This deficiency led to mitochondrial deletions and impaired mitochondrial function Other accessory proteins and enzymes also play roles in mitochondrial DNA replication. These include mitochondrial single-stranded DNA binding protein, mtSSB, and the mtDNA helicase enzyme, Twinkle.
MITOCHONDRIAL DELETIONS, TISSUE-SPECIFICITY, AND AGING There is evidence from a number of different studies that deletions occur in somatic mitochondrial DNA and that these deletions occur more frequently with advancing age. Meissner et al. (2006) reported deletions of mitochondrial DNA in muscle, heart, and in specific brain regions. Kraytsberg et al. (2006) reported that mitochondrial deletions frequently occur in the substantia nigra brain region in patients with Parkinson’s disease and that these deletions lead involved neurons to be deficient in cytochrome C oxidase (CoxC). Markaryan et al. (2008) reported the occurrence of mitochondrial deletions in cochlear tissue from individuals with age-related hearing loss. They studied the organ of Corti, the spiral ligament, and ganglion cells. A specific deletion occurred in these cases; it was 4,937 base pairs in length. This specific deletion is often referred to as the common deletion. In addition, larger deletions of 5,354 base pairs occurred. The common deletion may arise as a result of impaired replication caused by 13 base-pair repeats that flank the region (Samuels et al., 2004).
MITOCHONDRIAL DYNAMICS AND BIOGENESIS Mitochondria undergo fission and fusion. Tubular networks of mitochondria form and these networks play an important role in transporting mitochondria to
104
Phenotypic Variation
regions with high-energy requirements (Bossy-Wetzel et al., 2003). Motor proteins are involved in the transport of mitochondria; they include kinesin (GTPases) and dyneins. Defects in the kinesin, KIF5A, results in spastic paraplegia. Fission of mitochondria and fusion of mitochondria involve a number of proteins that cause the outer and inner membranes to merge. One protein important for these functions is mitochondrial genome maintenance protein (MGM1P), encoded in humans by the OPA1 locus, and expressed in the inner mitochondrial membrane. The product of the OPA1 locus plays a role in fusion promotion and in defining the structure of mitochondrial cristae. Mutations in OPA1 lead to autosomal dominant optic atrophy (DiMauro & Schon, 2008). Other important proteins for these functions include mitofusins 1 and 2, encoded by the MFN1 and MFN2 loci, which are located in the outer mitochondrial membrane and they have GTPase activity. Dynamin related protein (DRP1) is a protein that plays a role in division of mitochondria. Nakamura et al. (2006) identified a ubiquitin ligase that ubiquinated DRP1 and MFN2 proteins. This ubiquitin ligase, designated MARCH5, is located in the outer mitochondrial membrane. It is encoded by a nuclear gene that maps to chromosome 10q23. MFN2 mutants and MARCH5 mutants lead to mitochondrial fragmentation. Mutations in the mitofusin gene MFN2 cause one form of Charcot Marie Tooth disease and peripheral neuropathies. DiMauro and Schon (2008) noted that optic neuropathies are sometimes present in Charcot Marie Tooth disease.
NEURONAL MIGRATION AND MITOCHONDRIA A number of proteins that play a role in neuronal migration interact with mitochondria. The neuronal migration defect in Miller Dieker lissencephaly is associated with deletion of the chromosome 17p13.3 gene locus that encodes the 14-3-3 epsilon protein. This protein is also known as mitochondrial import stimulation factor subunit L and it acts as a targeting chaperone for transport of proteins from cytoplasm to mitochondria. This protein also interacts with other proteins involved in neuronal migration, including NUDEL (NDE1), a centrosome-associated protein, and deleted in schizophrenia (DISC1) (DiMauro & Schon, 2008). Abnormal mitochondria are present in individuals with schizophrenia because of deletion or mutations in DISC1 (Millar et al., 2005). There is evidence that fission and fusion and mitochondrial remodeling are regulated in part by post-translational modification of specific proteins (Zunino et al., 2007). These modifications include phosphorylation, acetylation, ubiquitination, and sumoylation. The SUMO1 protein interacts with
Mitochondria
105
dynamin related protein DRP1 that plays a key role in mitochondrial fission. Sumoylation promotes DRP1 stability. Overexpression of SUMO1 leads to prolonged stabilization of DRP1 and to mitochondrial fragmentation. Sumoylated proteins subsequently undergo desumoylation through the action of SUMO cysteine proteases. Zunino et al. (2007) demonstrated that the protein, sentrin-specific peptidase 5 (SENP5), plays an important role in mitochondrial dynamics and in control of levels of production of reactive oxygen species. They established that silencing of SENP5 expression led to increased DRP1 and SUMO conjugation and that cells with decreased levels of SENP5 contained fragmented mitochondria. Cells deficient in SENP5 also showed increased production of reactive oxygen species. Kowald et al. (2005) presented evidence that mitochondrial fission and fusion events play an important role in aging and the associated accumulation of mitochondrial DNA deletions.
MITOCHONDRIAL MEMBRANES AND PROTEIN IMPORT Lipid Milieu Altered mitochondrial structure and function may also result from abnormalities in phospholipids in the mitochondrial membrane. Mutations in the Taffazin (TAZ) gene locus on the X chromosome that encodes phospholipid acyl transferase lead to alterations in the structure of mitochondrial cardiolipins and changes in mitochondrial structure and function. Barth syndrome is caused by defects in the TAZ gene. It is an X-linked recessive condition characterized by mitochondrial myopathy, cardiomyopathy, and growth retardation. Import into Mitochondria Different targeting and sorting processes are involved depending on the final destination of the imported protein within mitochondria, whether the protein is destined for the inner membrane, the outer membrane, or the mitochondrial matrix. Different mechanisms exist for import of solutes and small molecules and for larger protein molecules. Members of the heat shock family of proteins are important chaperones involved in mitochondrial function. DiMauro and Schon (2008) noted that relatively few disorders are definitively known to be caused by mitochondrial import defects. Mutations in the heat shock protein, HSP60, lead to hereditary spastic paraplegia. Defects in a translocase that
106
Phenotypic Variation
functions in the inner mitochondrial membrane, TIMM8A, leads to X-linked recessive deafness, dystonia syndrome, and/or Mohr-Tranebjaerg syndrome. Protein Import Protein import into mitochondria requires that molecules traverse two membranes. TOM proteins are involved in transition through the outer membrane. They are further categorized according to their molecular mass. TIM proteins are inner membrane proteins that participate in transport. For a number of cytosolic proteins, specific targeting sequences facilitate localization in mitochondria (Scheffler, 2008). There is also evidence that proteins destined for mitochondria need to be unfolded. Unfolded proteins may be threaded through pores as long polypeptide chains. The TOM complex is composed of at least seven subunits, including a translocase. Transport of proteins into mitochondria requires that the outer membrane complexes and inner membrane complexes become aligned to form a continuous channel. A number of proteins in the TIM complex act as chaperones to transport molecules into the matrix. A condition characterized by dilated cardiomyopathy, cardiac conduction defect, cerebellar ataxia, testicular dysgenesis, growth failure, and increased excretion of organic acids 3-methylglutaconic acid and 3-methylglutaric acid occurs with high frequency in the Canadian Darius Hutterite population. This condition is inherited as a recessive Mendelian trait. Occasional features in this disorder include optic atrophy, microvesicular hepatic steatosis and microcytic anemia. Onset of symptoms in this disease is usually before three years of age and patients die from progressive cardiac failure or sudden cardiac death. Davey et al. (2006) reported that homozygosity mapping led to linkage of this disorder to a 3.2 Mb segment of chromosome 3q26.33. They noted that the gene DNAJC19 maps within this segment and that the DNAJC19 protein shows organizational similarity with the yeast inner mitochondrial membrane protein, TIM14. Bidirectional sequencing of exons and of intron–exon boundaries of DNAJC19 in patients led to identification of a G to C transversion in a conserved AG splice acceptor site in intron 3 of the DNAJC19 gene. All affected individuals were homozygous for this mutation. The mutation led to impaired splicing of exon 4. Davey et al. also carried out analysis of mRNA from patients and determined that a shorter mRNA form was present in patients and that this form was missing exon 4. They determined further that deletion of exon 4 would lead to absence of the DNAJ domain within the DNAJC19 protein. The DNAJ domain is present in proteins that function in the molecular chaperone system, HSP70 and HSP40, which play roles in protein folding
Mitochondria
107
and assembly. HSP40 is involved in loading substrates for folding onto HSP70. Davey et al. (2006) proposed that the defect in this syndrome in the Darius Hutterite population might result from defective protein assembly and defective protein transport through the TIM23 mitochondrial translocase system. They noted that the Mohr-Tranenberg syndrome results from abnormal assembly of the TIM23 transporter. They concluded that since over 99% of mitochondrial proteins are nuclear-encoded, protein transport into mitochondria is critical for their normal functioning. TOMM40 and Alzheimer’s Disease The TOMM40 gene maps on human chromosome 19 in close proximity to the apoliprotein E 4 (APOE4) locus (see Fig. 4–2). Segregation of polymorphisms in this gene with APOE4 genotypes and with Alzheimer’s disease is being intensely studied. At an Alzheimer’s disease conference in Vienna (2009), Alan Roses and colleagues reported studies on 35 patients that involved analysis of a polymorphism in TOMM4O that generated short and long forms resulting from expansion of a T repeat. They determined that the APOE3 was linked to either the short or the long form of TOMM40. The APOE4 allele was linked to the long form. People with APOE3 and the long form of TOMM40 developed Alzheimer’s disease approximately 7 years earlier than individuals who had APOE3 and the short form of TOMM40. The long form of TOMM40 is likely the more dangerous form, (Roses 2010). Potkin et al. 2009 reported analysis of risk alleles in Alzheimer’s patients. They identified a TOMM40 risk allele that was twice as frequent in Alzheimer’s patients as in controls. Protein Import into Mitochondria and Pathology There are reports that soluble amyloid beta oligomers accumulate in mitochondria and induce calcium overload within these structures (Starkov & Beal, 2008). Du et al. (2008) reported that amyloid beta oligomers target the mitochondrial permeability transition core and that their specific interactions occur with cyclophilin D that impact opening of this pore. Solute Passage The mitochondrial transition pore plays a key role in import of proteins, in mitochondrial permeability control, and in apoptosis. There is an ongoing debate concerning the composition of the mitochondrial transition pore.
108
Phenotypic Variation
Previously, components were thought to include the voltage-dependent anion channel (VDAC), and the ADP/ATP translocator that plays a role in the import of ADP and the export of ATP. More recent research indicates that VDAC is not a pore component. Furthermore, there is evidence that PIC, an inorganic phosphate carrier, may be an important component (Baines, 2009). Cyclophilin D in the mitochondrial matrix associates with the pore during opening (Du et al., 2008). Alterations in the inner mitochondrial membrane and opening of the mitochondrial transition pore constitute key steps in the intrinsic pathway of apoptosis. These alterations lead to changes in the mitochondrial transmembrane potential and release of proteins from mitochondria into the cytosol (Elmore, 2007). The role of mitochondria in apoptosis will be discussed further later in this chapter. At least 75 different transporter proteins occur that are involved in the transport of specific amino acids, and of adenine dinucleotides, NAD and FAD. Transport of calcium is also important and this involves a specific uniporter molecule. Mitochondrial Membranes, Proton Gradient, and ATPsynthase The transfer of protons along the mitochondrial electron-transport chain leads ultimately to an electrochemical proton gradient across the mitochondrial membrane. The proton translocating ATP synthase complex harnesses the free energy generated by this gradient. This complex synthesizes ATP from ADP when free energy and inorganic phosphate are available. The ATP synthase complex is present as particles on the inner mitochondrial membrane. The particles have a lollipop configuration. The FO (oligomycin binding) portion of the ATPase synthase complex is in the membrane and the F1 portion is above the membrane. The transmembrane FO structure is composed of at least nine different nuclearencoded subunits and it forms a channel for proton translocation. The F1 portion of the complex is the site of ATP synthesis. The F1 portion is water-soluble and can be removed from FO by urea. At least 25 different nuclear genes encode components of the ATP synthase; in addition the complex contains two mitochondrial encoded components, mt-ATP6 and mt-ATP8 (Campanella et al, 2009). Phenotypes Resulting from Specific Mutations in the mt-ATP6 Gene Childs et al. (2007) described variable phenotypes that were present in a 15-member family where specific individuals were apparently homoplasmic
Mitochondria
109
for a T to C mutation at nucleotide 9185 in mitochondrial DNA. This nucleotide lies within the mt-ATP6 gene that encodes a subunit within the ATP synthase complex. Five individuals within this family in whom the mutation occurred manifested late-onset Leigh syndrome, characterized by neurological abnormalities, brain stem dysfunction, and abnormalities in the basal ganglia or brainstem on magnetic resonance imaging. Another five individuals in the same family were found to have mild coordination deficits and learning disabilities. Two individuals had clinical features characteristic of NARP syndrome: neuropathy, neurogenic muscle weakness, ataxia telangiestasia, and retinitis pigmentosa. Other manifestations present in some members in this family included gastrointestinal symptoms and mild facial dysmorphism with hypertelorism, depressed nasal bridge, and downslanting palpebral fissures. Muscle biopsies from all affected individuals revealed the same apparently homoplasmic mitochondrial DNA mutation T to C substitution at 9185. A different family with the same mutation and NARP phenotype was reported by Castagna et al. (2007). It is possible that phenotypic differences in individuals with the same mitochondrial DNA mutation in the ATP6 subunit of ATP synthase may be caused by variations in other genes that contribute subunits to the mitochondrial ATP synthase complex. Leigh syndrome may arise from mutations in a number of different genes that are each involved in mitochondrial energy metabolism. Lopez-Gallardo et al. (2009) reported that NARP syndrome occurred in a patient who had an insertion in the ATP6 gene that disrupted coding sequence. The patient was heteroplasmic for the mutation, with 85% of muscle mtDNA manifesting the abnormality. These investigators emphasized the importance of DNA sequence analysis in cases with mitochondrial energy deficiency manifestations. Mitochondrial Membranes and Apoptosis Apoptosis involves energy-dependent biochemical mechanisms. It is important during embryonic development, in hormone response, and in immune function. Inappropriate apoptosis occurs in a number of diseases. Elmore (2007) reviewed apoptosis and noted that interest in apoptosis grew in part from studies in the organism C.elegans that demonstrated accuracy and control of this process. During development of that organism, 131 of 1,090 somatic cells undergo programmed cell death with specific cells dying at particular developmental stages.
110
Phenotypic Variation
Biochemical steps in apoptosis include protein cleavage, protein crosslinking, and DNA degradation. Elmore noted that no inflammatory response occurs with apoptosis because cellular components are not released into the surrounding interstitial tissue. Surrounding cells phagocytose apoptotic cells. Key steps in the intrinsic pathway of apoptosis include alterations in the inner mitochondrial membrane, opening of the mitochondrial transition pore, changes in the mitochondrial transmembrane potential and release of proteins into the cytosol. Released proteins include cytochrome C, second mitochondrial derived activator of caspase (SMAC), and serine protease, HT1A2. SMAC and HT1A2 act by blocking proteins that inhibit apoptosis. A second group of proteins released by mitochondria include apoptosisinducing factor (AIF) endonuclease G, and caspase-induced DNA fragmentation factor (CAD). AIF causes DNA fragmentation and endonuclease G cleaves nuclear chromatin. Cytochrome C released from mitochondria and the BCL2 family of proteins play key roles in apoptosis. Twenty-five different nuclear genes encode the BCL2 family of proteins. BCL2 encodes an integral mitochondrial outer membrane protein. Caspase 3 is the “executioner caspase” that activates the endonuclease CAD to cleave chromosomal DNA. Caspase 3 activity also leads to cytoskeletal disruption; it binds to actin. Gelsolin is a specific caspase 3 target. Excessive apoptosis is a feature of neurodegenerative diseases (e.g., Alzheimer’s disease). Elmore (2007) noted that amyloid beta protein might induce oxidative responses. It may also trigger increased apoptosis through binding to death receptors. Elmore (2007) reviewed forms of nonapoptotic programmed cell death that include caspase independent mechanisms. Autophagy represents one such mechanism. In this ATP-dependent process, cytoplasm and organelles are sequestered in vesicles and transported to lysosomes. Ubiquitin protein conjugation plays an important role in autophagy. Autophagy may rescue cells from death.
APOPTOSIS AND CELL DEATH In an analysis of cell death, Spencer et al. (2009) demonstrated that naturally occurring differences in the levels or states of proteins lead to variability in the timing of cell death in cell lines. They demonstrated that in sister cells, rates of protein synthesis rapidly diverge so that these cells become dissimilar in rates of synthesis.
Mitochondria
111
In the first tier of apoptosis, the tumor necrosis factor apoptosis-inducing ligand (TRAIL ligand) binds to the cell surface death receptors, DR4 and DR5. This leads to their association and to the formation of death-inducing signaling complexes that activate initiator caspases. These caspases trigger mitochondrial outer membrane permeabilization. The next phase involves release of the mitochondrial proteins including cytochrome C, SMAC, and DIABLO (activators of caspase). Activation of effector caspases leads to cell death. Spencer et al. (2009) reported that initiator caspases convert a specific pro-apoptotic protein, TBID (inducer of cytochrome C release), to its active form and this also induces assembly of mitochondrial pore-forming apoptotic proteins, BAX and BAK. Antiapoptotic proteins of the BCL2 family modulate the activity of the latter proteins. Spencer et al. concluded that at any one point in time, variations in expression levels of a number of different proteins control the rate of cell death. Balancing Cell Growth and Cell Death Nutrients such as amino acids and anabolic growth factors including insulin and insulin-like growth factors activate Target of Rapamycin (TOR) complexes. The mTORC1 complex controls protein synthesis via S6 kinase and phosphorylation of EIF4E binding proteins that regulate translation initiation; mTORC1 also controls ribosome biogenesis and autophagy. Actin cytoskeletal organization is influenced by mTORC2. Thedieck et al. (2007) characterized two novel TOR binding proteins, PRAS40 and PRR5L, that control the balance between cell growth and apoptosis. PRAS40 inhibits mTORC1 phosphorylation and mTORC1 kinase activity toward substrates S6 and 4EBP. PRAS40 is therefore an mTORC1 inhibitor. These investigators also demonstrated that mTORC1 is pro-apoptotic. Knockdown of PRR5L and PRA40 led cells to be resistant to tumor necrosis factor (TNF) alpha and to cycloheximide-induced apoptosis. MITOCHONDRIA AS A HUB FOR CELLULAR CALCIUM SIGNALING Feissner et al. (2009) reviewed the important role that mitochondria play in buffering calcium concentrations and in uptake of cytosolic calcium. Uptake of calcium into mitochondria occurs through a mitochondrial uniporter and through the mitochondrial ryanodine receptor. Feissner et al. noted that mitochondrial calcium plays a key role in the stimulation of enzymes involved
112
Phenotypic Variation
in oxidative phosphorylation. When mitochondrial calcium uptake is excessive, opening of the mitochondrial permeability transition pore is triggered, and this may lead to apoptosis. Excessive production of reactive oxygen species within mitochondria may impair calcium homeostasis. In reviewing mitochondrial calcium dynamics, Feissner et al. noted that the VDAC ion channel regulates movement of calcium to the intermembrane space; a number of specific transporters then move calcium across the inner mitochondrial membrane. Key to calcium influx across the inner mitochondrial membrane is the mitochondrial calcium uniporter (MCU), the ryanodine receptor, and the rapid mode uptake (RAM) complex, which facilitates rapid calcium uptake. Export of calcium from mitochondria involves sodium-ion-dependent (Na-dependent) and sodium-ion-independent exchanges. In the sodium-dependent system, Na ions are imported into mitochondria in exchange for calcium and subsequently the Na H antiporter exchanges Na ions for hydrogen (H) ions. In the Na-independent system calcium ions (Ca), are exported as 2H ions are imported. In situations of calcium overload, the permeability transition pore (PTP) plays a role in Ca export. Feissner et al. (2009) discussed the role that calcium plays as a signal for activation of mitochondrial enzymes, including enzymes in the tricarboxylic acid cycle (TCA cycle), including pyruvate dehydrogenase, isocitrate dehydrogenase, and alpha ketoglutarate dehydrogenase. Activation of these enzymes leads to increased synthesis of NADH, FADH, enhanced respiratory chain activity, and proton pump activity. Enhanced complex V activity and increased ATP synthase activity leads to increased ATP production. Feissner et al. noted that calcium ions also stimulate alpha glycerophosphate dehydrogenase activity, thereby increasing glycolysis. There is evidence that the components of the PTP may vary under different conditions. Furthermore mitochondrial membrane damage associated with prolonged PTP opening may result in release of matrix components and cytochrome C. Feissner et al., (2009) concluded that knowledge of how reactive oxygen species modulate Ca ion transport in mitochondria is lacking, and they emphasized the importance of carrying out investigations on the interplay between calcium and reactive oxygen species. Factors Involved in the Translation of RNA Products of Mitochondrial DNA Transcription Protein translation in mitochondria takes place on complexes composed of mitochondrial encoded RNA and many nuclear-encoded proteins. These complexes
Mitochondria
113
are composed of 22 tRNAs and two ribosomal RNAs encoded by mitochondria. The protein component encoded by nuclear genes comprises 50 ribosomal proteins, tRNA maturation complexes, and aminoacyl-tRNA synthases, in addition to translation initiation, elongation and termination factors, and RNA modification factors. Valente et al. (2007) noted that there are more than 100 known disease-causing mutations within mitochondria tRNA or mitochondrial ribosomal RNA genes. There are also examples of mutations in nuclear-encoded factors that lead to defects in mitochondrial protein translation. Pseudouridine synthase converts uridine to pseudouridine in tRNA in cytosolic and mitochondrial compartments. Missense mutations in this enzyme were found to be the cause of myopathy, lactic acidosis, and sideroblastic anemia in one patient. Valente et al. reported that a mutation in a nuclear-encoded ribosomal protein, mRPS16, occurred in a patient with lactic acidosis and facial dysmorphology. A severe mitochondrial translation defect associated with severe lactic acidosis and progressive leukodystrophy was found in one patient as a result of a missense mutation in mitochondrial elongation factor, GFM1. Severe lactic acidosis occurred in another patient to missense mutation in the elongation factor tu (EFT). Translation defects lead to severe combined deficiencies in respiratory chain function. DiMauro and Schon (2008) noted that it is important to consider the possibility of translation defects in infants and children with hepatocerebral syndrome or encephalopathy. Mitochondrial RNA processing endoribonuclease (RMRP) is a ribonucleoprotein encoded by a nuclear gene. This endonuclease impacts a number of different forms of RNA, including mitochondrial RNA and ribosomal RNA. It also cleaves RNA that is complementary to the light chain of mitochondrial DNA; copying of this RNA is the first step in mitochondrial DNA replication. The RMRP gene was found through positional cloning efforts within a region of human chromosome 9 that was intensely scrutinized because it showed linkage to the disorder cartilage hair hypoplasia syndrome. In this syndrome, mutations occur in the RNA-coding region of the gene and in the promoter region. The central portion of the gene determines its localization to mitochondria (Martin & Li, 2007). Cartilage hair hypoplasia syndrome is a recessive condition. The carrier frequency of this condition in the Amish population is one in 76. A striking feature of cartilage hair hypoplasia syndrome is the great variability of phenotypic manifestations between siblings. Mutations in RMRP occur in a number of other disorders associated with bone abnormalities and impaired growth, such as metaphyseal dysplasia and anauxetic dysplasia. Spondylometaphyseal dysplasia leads to short stature.
114
Phenotypic Variation
In anauxetic dysplasia there is disturbance of growth plate structure leading to severe short stature; dermatological problems also occur. Mitochondrial Iron Metabolism, Iron-Sulfur Clusters, and Friedreich Ataxia The Frataxin gene (FXN) on chromosome 9q13 is mutated in cases of Friedreich ataxia. Mutations most commonly involve expansions of the GAA repeat within the first intron of FXN. Most patients are homozygous for this repeat expansion, however 2.5% of patients are compound heterozygotes for the GAA repeat expansion and loss of function mutations (Campuzano et al., 1996). Heterozygotes for the repeat expansion are generally healthy. Pandolfo (2008) reported that approximately 30 GAA repeats in FXN intron 1 occur in normal individuals. Disease occurs when repeat expansions are greater than 70. The most disease-causing expansions involve 600 to 900 repeats. The GAA expansions impair transcription and lead to low levels of protein expression. The repeats are unstable during meiosis; they may expand or contract. In a review of this disorder in 2008, Pandolfo noted that the first symptom is usually gait instability. Scoliosis may already be present at first presentation. In rare cases, cardiomyopathy is present before ataxia. Limb weakness develops later. In advanced cases of the disorder, swallowing difficulties arise. Cognitive function is generally preserved. Pathological features include atrophy of sensory neurons in the dorsal root ganglia and atrophy of the posterior columns of the spinal cord. Diabetes mellitus is more common in patients with Friedreich ataxia than in the general population. Pandolfo (2008) noted that differences in GAA repeat expansion sizes account for only 47% of the phenotypic variability in Friedreich ataxia. There is evidence that specific mitochondrial DNA haplogroups impact phenotype. Giacchetti et al. (2009) carried out analysis of mitochondrial DNA haplogroups in 99 Friedreich ataxia patients with known GAA repeat expansion sizes. Their analyses revealed that patients with the U mitochondrial DNA haplogroup had a lower rate of cardiomyopathy and a later degree of disease onset. Frataxin protein contains a mitochondrial targeting sequence. Following entry of the preprotein into mitochondria, this targeting sequence is removed by peptidase cleavage. Frataxin is located on mitochondrial cristae and it occurs as a soluble form in the mitochondrial matrix. Frataxin is ubiquitously expressed; highest levels of expression occur in tissues with high metabolic rates, including neurons and the heart. Frataxin present in mitochondria acts as a chaperone in assembly of ironsulfur clusters that are present in the mitochondrial enzymes, aconitase and
Mitochondria
115
succinate dehydrogenase. Reduced mitochondrial frataxin levels in cases of repeat expansions lead to iron accumulation and to increased sensitivity to oxidative stress. Marmolino et al. (2009) reported that peroxisome proliferator-activated receptor gamma ligand (PGC1alpha) is down-regulated in cases where Frataxin levels are decreased. They noted that PGC1alpha is also down-regulated in diabetes mellitus, a condition that occurs with increased frequency in Friedreich ataxia patients, and that PGC1alpha plays a role in mitochondrial biogenesis. These investigators reported that peroxisome proliferator-activated receptor (PPAR) gamma agonists increased Frataxin mRNA and protein levels two-fold in normal fibroblasts and in patient fibroblasts. Mitochondria, PGC1alpha and Huntington’s Disease (HD) PGC1alpha is the coactivator of the peroxisome proliferator activated receptor gamma (PPARgamma). There is evidence that lack of PGC1alpha can produce a neurodegenerative disease with features of Huntington’s disease in mice and that overexpression of PGC1alpha can mitigate some of the pathology in mouse models of Huntington’s disease. The ameliorative effects of PGC1alpha overexpression were attributed to its effects on mitochondrial oxidative phosphorylation and on control of endogenous antioxidant production. Genome-wide searches for modulators of the Huntington’s disease phenotype revealed that a genomic segment on chromosome 4p15-p16 had this effect. The genomic segment includes the PGC1alpha gene. Weydt et al. (2009) examined two haplogroup blocks within this region in 447 unrelated Huntington disease patients. They established that homozygosity for the block 2 haplogroup significantly delayed disease onset in Huntington’s disease patients. It is important to note that Huntington’s-like phenotype occurs in individuals with the normal form of the HD genes and that one form of Huntington’s-like disease maps to chromosome 4p15.3. The HD gene that encodes Huntington’s disease maps to 4p16.3. Abnormalities of Mitochondrial Function in late-onset Neurodegenerative Conditions Abnormal mitochondrial function occurs in a number of late-onset neurodegenerative conditions and although the mitochondrial defects may not be the primary defect in a specific disorder, they contribute to the pathology and may offer pathways for therapeutic intervention. Ranganathan et al. (2009) reviewed pathophysiology and mitochondrial abnormalities in spinal bulbar muscular atrophy (SBMA) that results from
116
Phenotypic Variation
polyglutamine expansion in the androgen receptor encoded on the X chromosome. The androgen receptor protein occurs normally in the cytoplasm in an inactive form and is bound to heat shock proteins. When ligand binds to the androgen receptor, it is released from the heat shock protein and it moves to the nucleus to bind to specific DNA sequence elements. It then activates transcription. Ranganathan et al. reported that the polyglutamine repeat expansion imparts a toxic gain of function to the androgen receptor, leading to transcriptional dysregulation. There is also evidence that the abnormal androgen receptor may bind to other proteins. The precise mechanism through which the androgen receptor protein with the expanded polyglutamine repeat leads to neurotoxicity is not known. The pathological features of spinal bulbar muscular atrophy include selective degeneration of motor neurons in the spinal cord. Symptoms include muscle cramps, muscle atrophy, and later, swallowing difficulties. Patients may also manifest evidence of androgen insensitivity. Ranganathan et al. (2009) investigated mitochondria in models of SBMA, including cultured MN1 and PC12 cells that carry mutant androgen receptor with the polyglutamine expansion. They noted that mitochondrial numbers were reduced in the mutant cells. This was demonstrated through use of a specific fluorescent dye, Mitotracker green and flow cytometry. They also examined mitochondrial morphology and determined that mitochondria in mutant cells exhibited vesiculated cristae. Assessment of the mitochondrial membrane potential in abnormal cells was carried out using a cationic dye that binds to the mitochondrial membrane. The fluorescent signal emitted by this dye is a function of the mitochondrial membrane potential; the degree of fluorescence was determined using a cell sorter. The fluorescent changes observed in mutant cells were indicative of membrane depolarization. There was also evidence of increased levels of reactive oxygen species in mutant cells. This was demonstrated through use of a specific dye, dihydrorhodamine 123. Ranganathan et al. (2009) measured levels of specific mitochondrial enzymes in mutant cells and in tissues, muscle and spinal cord from mouse models of SBMA. They noted that levels of mitochondrial transcription factor (Tfam) and levels of mitochondrial super-oxide dismutase (SOD2), ND1 and ND5 (NADH dehydrogenases mitochondrial encoded) were decreased. They also observed decreased levels of PGC1beta. These investigators noted that decreased levels of Tfam and PGC1beta could account for reduced mitochondrial numbers and for reduced membrane potential. The increased reactive oxygen species levels activated caspase 9 and caspase 3 and led to increased cell death.
Mitochondria
117
These investigators proposed that mitochondrial dysfunction and dysregulation are important factors in SBMA pathogenesis and may offer therapeutic avenues in this disease.
Mitochondria and Parkinson’s Disease There is evidence that mitochondrial dysfunction plays an important role in Parkinson’s disease (PD). Bogaerts et al. (2008) reviewed the role of mitochondrial dysfunction in this disease. A metabolite contained in drugs of abuse 1-methyl-4-phenylpyridinium (MPP) produces Parkinson’s-like symptoms. This drug is transported into dopaminergic neurons by dopamine transporter. There it enters mitochondria and inhibits respiratory complex I. Rotenone, a toxin known to inhibit mitochondrial complex I, also induces Parkinson’s-like manifestations in rats. Currently only 5 to 10% of cases of PD can be definitively attributed to nuclear gene mutations. There is growing concern that environmental factors may play an important role in PD. These factors may impact mitochondria and/ or influence the function of nuclear-encoded proteins.
Evidence for Impaired Mitochondrial Function in Sporadic Parkinson’s Disease A key feature of PD is loss of dopaminergic neurons in the substantia nigra pars compacta. Studies on the substantia nigra in PD revealed reduced amounts of glutathione reductase and elevated iron concentrations, indicative of oxidative stress. Dopamine is particularly susceptible to oxidation and gives rise to dopamine quinone and other derivatives that are postulated to be neurotoxins (Bogaerts et al., 2008). Studies on mitochondria in dopaminergic neurons of the substantia nigra revealed evidence of deletions in mitochondrial DNA (Bender et al., 2006). Important progress in our understanding of the role of mitochondria in the pathogenesis of PD derives from studies of the cellular distribution and function of proteins that when mutated give rise to PD. The first nuclear gene linked to PD encodes synuclein. Accumulation of this protein in structures known as Lewy bodies constitutes a neuropathological landmark in PD. The normal function of synuclein has not yet been elucidated (Bogaerts et al., 2008). PD-inducing synuclein changes include increased expression resulting from copy number changes and mutations. There is some evidence that promoter region variations that lead to increased expression of synuclein may play a role
118
Phenotypic Variation
in Parkinsonism. Studies on mouse mutants that overexpress synuclein revealed increased mitochondrial DNA damage and impaired autophagy. Parkin, encoded by the PARK2 locus on chromosome 6p25.2–q27 encodes a form of ubiquitin E3 ligase. This protein localizes to mitochondria in proliferating cells and regulates replication of mitochondrial DNA and its transcription (Kuroda et al., 2006). Homozygous Parkin mutations lead to autosomal recessive juvenile-onset PD. Homozygous or compound heterozygous Parkin mutations may lead to PD. Bogaerts et al. (2008) reported increasing evidence that heterozygous Parkin mutations may increase susceptibility to late-onset Parkinson’s disease. The PARK6 locus on chromosome 1p36 encodes phosphatase and tensin homolog induced kinase (PINK1). Homozygous PINK1 mutations occur in familial PD. There is, however, evidence for increased frequency of heterozygous PINK1 mutations in sporadic PD and that PINK1 mutations play a role in late-onset PD. Inactivation of PINK1 protein induces dopaminergic neuronal cell death through an oxidative stress pathway. PINK1 protein localizes to mitochondrial membranes and has a mitochondrial targeting motif (Bogaerts et al., 2008). DJ2 encoded by the PARK7 locus on chromosome 1p36.33-p36.12 is a redox sensor and mitochondrial antioxidant. Multiple pathways and gene defects that lead to Parkinson’s disease are discussed further in chapter 11.
RELATIONSHIP OF MITOCHONDRIAL ROS PRODUCTION AND DNA DAMAGE There is evidence that mitochondrial ROS production is increased in the Substantia nigra in Parkinson’s disease and that in addition to damage of cellular proteins and lipids there is evidence for high levels of DNA mutations in dopamine neurons. Mitochondrial Function and Nuclear Genome Instability: Importance of Iron-Sulfur Clusters Mitochondrial dysfunction leads to nuclear genome instability and iron-sulfur complexes in the mitochondria play a key role in determining nuclear genome integrity. In studies on mitochondria of Saccharomyces cerevisiae, Veatch et al. (2009) determined that loss of mitochondrial DNA led to nuclear DNA instability. Their studies revealed that nuclear genome instability was correlated
Mitochondria
119
with a reduction in mitochondrial membrane potential and a defect in ironsulfur cluster biogenesis. They noted that iron-sulfur clusters are synthesized in mitochondria and that they have a catalytic function in many proteins. Multiple nuclear-encoded proteins function in mitochondria to generate iron-sulfur clusters that are then exported to the cytoplasm where they function in multiple proteins. NAR1 hydrogenase plays an important role in packaging iron-sulfur clusters into nonmitochondrial proteins. A number of proteins that impact nuclear genome integrity contain iron-sulfur clusters; these include RAD3 helicase that is involved in nucleotide excision repair, PRI2 that is important in repair of double-stranded DNA breaks, and NTG2, a glycosylase that is involved in base excision repair. Veatch et al. (2009) postulated that mitochondrial DNA mutations that lead to defects in nonrespiratory functions in mitochondria, including ironsulfur complex biogenesis, play a role in generation of nuclear genome instability and in human disease.
SIGNALING BETWEEN NUCLEUS AND MITOCHONDRIA Anterograde signaling from nucleus to mitochondria and retrograde signaling from mitochondria to nucleus are important in determining the key roles of mitochondria in maintaining bio-energetic competence and as sensors of redox damage (Wright et al., 2009). These authors noted that over 1,000 proteins exist in mitochondria and that only 13 of these are encoded by the mitochondrial genome. A key function of mitochondria is oxidative phosphorylation. However, only between 11 and 14 of the 91 subunits present in Oxphos complexes are mitochondrially encoded. In the electron-transfer system, the mitochondrial genome encodes seven of 45 proteins in complex I, one of 11 proteins in complex III and two of 18 proteins in complex V. Mitochondrial complexes I and III are strongly implicated in formation of reactive oxygen species. Key factors in ROS production are coenzyme Q binding, proteins in complexes III and IV, and cytochrome C. Wright et al. (2009) emphasized the importance of redox imbalance in inducing DNA damage. They noted that DNA damage is higher in mitochondrial genomes than in nuclear genomes. They cited evidence that hundreds of low-frequency somatic mutations occur in genomes during aging. The proximity of mitochondrial DNA to reactive oxygen species likely increases frequency of mitochondrial DNA damage and mutation. They noted that the apparent absence of DNA repair mechanisms in mitochondria and the propensity to imbalance in nucleotide pools likely contribute to the high frequency of somatic mutations. There is evidence for retrograde
120
Phenotypic Variation
signaling between mitochondria and nucleus. Wright et al. reported results of in vitro studies that demonstrated clear evidence that diffusion of superoxide radicals and hydrogen peroxide out of mitochondria induces increased expression of nuclear-encoded redox-sensitive enzymes. Anterograde response from nucleus to mitochondria may then result in recovery of mitochondrial function or apoptosis of cells with damaged mitochondria.
7 QUALITY SURVEILLANCE
INTRODUCTION Protein and organelle quality surveillance coupled with degradation of misfolded proteins or damaged structures are important for maintenance of cellular function and health of the organism. Cuervo (2008) reviewed cellular surveillance processes that utilize chaperones, autophagy, and proteolytic systems. Chaperones assist in protein folding; they also facilitate transport of damaged proteins to sites of degradation. Degradation systems include the ubiquitin proteasome system and the lysosomal system. Lysosomes play a key role in cellular autophagy. These organelles with their content of hydrolases, including proteases and lipases, are particularly important for degradation of macromolecules and cellular components. Cuervo (2008) reported that during the previous decade significant progress was made in the identification of genes that encode products involved in autophagy. Autophagy plays a role in the cellular remodeling required during differentiation and embryogenesis. It is also important in determining immunity. Changes in autophagy systems that occur in aging are in part caused by downregulation of specific genes. Malfunction of autophagy occurs in several forms 121
122
Phenotypic Variation
of neurodegeneration and in muscle disorders that are characterized by accumulation of abnormal aggregates.
AUTOPHAGY Three main types of autophagy that occur in mammalian cells, these include macroautophagy, microautophagy and chaperone-mediated autophagy (Cuervo, 2008). Macroautophagy involves sequestration of organelles, large cellular fragments and protein aggregates. In macroautophagy, the fragment or aggregate is surrounded by a double membrane to produce a phagophore. Once the membrane seals it becomes an autophagosome. This then fuses with late endosomes and multivesicular bodies to give rise to an amphisome that then fuses with the lysosome. The protein microtubule-associated light chain 3 (LC3) occurs in autophagic membranes. It is a histologic marker for autophagic vesicles. The formation and sealing of double-membrane vesicles and their fusion with lysosomes requires specific complexes: the beclin vacuolar protein sorting (VPS-34) system and the mTOR complex (mammalian Target of Rapamycin).
HOMEOSTASIS: ROLES OF AUTOPHAGY,
M TOR
AND BECLIN
Cell and tissue homeostasis is dependent upon the balance between macromolecular biosynthesis and catabolism. Pattingre et al. (2009) reported that the proteosomal and endosome-lysosomal pathways play important roles in catabolism. They noted that the proteosomal system is primarily responsible for protein catabolism. Diverse macromolecules are catabolized in the lysosomal autophagy system. Knockout of autophagy-related genes revealed the important role that these genes play in preventing aggregate accumulation. Specific autophagy related complexes (ATG) promote shuttling of proteins across membranes during formation of autophagosomes. The ATG1 complex integrates signaling with TOR. TOR is a serine threonine kinase that regulates cell growth and cell cycle progression. Nutrient intake impacts protein synthesis and autophagy. The ATG6 complex is also known as beclin and it interacts with phosphoinositol kinase. Vergarajauregui and Puertollano (2008) reviewed information on the autophagic machinery and noted that this process is highly conserved in eukaryotes. There is evidence that autophagy is particularly important in neurons.
Quality Surveillance
123
Initiation of autophagosome development involves development of a double-membrane structure in the cytoplasm. The LC3 is incorporated into membrane fragments through conjugation to membrane phosphatidylethanolamine. Autophagosomes may undergo conjugation with other endosomes or with lysosomes to form endosomal sorting complexes required for transport (ESCRT). Molecules that are components of this system include charged multivesicular proteins (CHMP2B and CHMP1B). Mutations in these genes occur in some forms of amyotrophic lateral sclerosis and frontotemporal dementia (FTD). A CHMP1B-interacting molecule spastin is mutated in some forms of spastic paraplegia. This finding indicates that intracellular membrane traffic defects play a role in motor neuron pathology (Reid et al., 2005).
MICROAUTOPHAGY AND LYSOSOMES Microautophagy involves uptake of cytosolic components directly; the lysosomal membranes surround and engulf the cytosolic component. Chaperonemediated autophagy requires specific recognition and interaction between a chaperone molecule and a specific amino acid sequence in the unfolded protein. Substrates associated with the chaperone complex translocate to the lysosome via the lysosomal associated membrane protein 2 (LAMP2) receptor. In aging cells, the lysosomal compartment is often enlarged and undigested material, including lipofuscin, (yellow brown pigment derived from lysosomal digestion) is present within the lysosomes. There is evidence that the deterioration of macroautophagy that is associated with aging may be slowed by caloric reduction. Cuervo (2008) noted that one of the earliest changes in Alzheimer’s disease is evidence of impaired autophagy in neurons. In Parkinson’s disease, chaperone-mediated autophagy is impaired. Impaired autophagy also plays a role in myopathies associated with aging. Endosome–Lysosome Trafficking and Lysosome-Related Organelles Lysosomes hydrolases play important roles in the degradation of complex molecules. Defective lysosomal hydrolase function and defective targeting of hydrolase enzymes to lysosomes lead to a number of well-characterized genetic disorders—the lysosomal storage diseases. Lysosomal hydrolases also play roles in degradation of membrane proteins and receptors, in antigen processing
124
Phenotypic Variation
and in apoptosis. A growing number of lysosomal membrane proteins (LMPs), lysosomal membrane-associated proteins (LAMPs) and lysosome-integrated membrane proteins (LIMPs) are being characterized (Saftig & Klumperman, 2009). The endosome lysosome pathway is schematically presented in Fig. 7–1. Lysosomal membrane proteins are involved in import from the cytosol and in transport from lysosome to cytosol. They also play a role in proton transfer and in acidification of the lysosome interior. There is growing evidence that mutations in genes encoding lysosomal membrane proteins lead to genetic disease. Defective lysosomal membrane function negatively impacts transport of cysteine, cobalamin (Vitamin B12), acetyl-Coenzyme A and sialic acid, and these defects each lead to specific diseases. Defective transport of cations across lysosomal membranes occurs in Mucolipidosis Type V and in ceroid lipofuscinosis. Lysosomal efflux impacts cholesterol homeostasis. Vergarajauregui et al. (2008) examined the autophagic process in fibroblasts from patients with Mucolipidosis IV. In this condition components of the late endosome lysosome pathway malfunction, as a result of mutations in the gene Mucolipin 1 (MCOLN1). Manifestations of Mucolipidosis IV include
Early Endosome
Normal cell
Late Endosome
Lysosome
Mannose-6-Phosphate Receptor Golgi Apparatus
Figure 7–1.
Diagram of lysosome endosome pathway.
Quality Surveillance
125
neurological and ophthalmologic abnormalities, psychomotor retardation, neurodegenerative changes, corneal clouding, and retinal pigmentary abnormalities leading to abnormal light sensitivity. In addition, patients manifest hypotonia and achlorhydria. MCOLN1 encodes a cation channel. The activity of this channel is modulated by phosphorylation and by changes in calcium concentration and pH. The studies of Vergarajauregui et al. (2008) demonstrated delayed fusion of late autophagosomes with endosomes and lysosomes and accumulation of autophagosomes in patient cells. They concluded that interventions that promote autophagy might serve as therapeutic measures in treatment of Mucolipidosis IV. An intervention that increases autophagy in fibroblasts from Mucolipidosis IV patients is rapamycin treatment. Degradative functions of lysosomes include macroautophagy and chaperone-mediated autophagy. Lysosome exosome vesicle generation and exocytosis are important in MHC class II antigen presentation and in the adaptive immune response. Lysosomal exocytosis plays a role in plasma membrane repair. Exosome vesicles are complex, membrane-derived structures and there is evidence that these vesicles constitute a means of intercellular communication (Thery et al., 2009). Lysosome-Related Organelles (LROs) There is a growing body of data on lysosome-related organelles that are derived from early endosomes (Huizing et al., 2008). Lysosome-related organelles have an acid pH within their lumen, and have individual specialized functions. Huizing et al. in a reviewed formation and function of lysosome-related organelles. Many of the protein complexes necessary for biogenesis of LROs were identified on the basis of being defective in specific subtypes of HermanskyPudlak syndrome (HPS). This is a rare autosomal recessive disorder in which defects occur in multiple lysosome-related organelles. Melanosomes are LROs that specialize in melanin synthesis and storage. Melanin particles are deposited onto striated fibrils within melanosomes. Melanogenic enzymes, including tyrosinase and tyrosinase-related proteins TYRP1 and TYRP2, are specifically sorted into melanosomes. Platelet granules are lysosome-related organelles; delta granules are dense calcium-rich granules in platelets that contain serotonin. Alpha granules within platelets store proteins involved in adhesiveness. Cytotoxic T cells contain specialized LROs that contain proteindegrading molecules. These lytic granules also release perforin that makes holes in membranes of target cells. Lamellar bodies are LROs in pulmonary
126
Phenotypic Variation
type II cells. They specialize in storage and secretion of surfactant phospholipids and protein. Azurophilic granules occur in neutrophils and contain serine proteases, antibiotic proteins, and myeloperoxidase. These LROs are aberrant in Chediak Higashi syndrome. Basophile granules are LROs rich in histamine, serotonin, heparin, and proteases. Specific LROs that occur in B cells, macrophages and dendritic cells are rich major histocompatibility (MHC) class II components. Ruffled borders are LROs that occur in osteoclasts and play a role in bone resorption. At least eight different genes encode proteins that play roles in LRO biosynthesis, and mutations that lead to deficiency of any one of these proteins may give rise to Hermansky-Pudlak syndrome. All forms of the syndrome are characterized by hypopigmentation and bleeding disorder. Hypopigmentation results from impaired melanosome formation or trafficking or impaired transfer of melanin to keratinocytes. Keratoses on sun-exposed areas occur in some forms of the syndrome. Bleeding tendency results from absence of plateletdense granules and the resulting deficit in platelet aggregation. Chediak-Higashi syndrome is characterized by decreased pigmentation, bleeding tendency, and increased susceptibility to infections resulting from neutropenia and defective neutrophil function. Polymorphonuclear leukocytes typically show the presence of large abnormal granules. The central nervous system may also be impacted. This syndrome is caused by a mutation in the LYST gene (lysosomal trafficking regulator) on chromosome 1q42-q43 (Kaplan et al., 2008). Griscelli syndrome is characterized by mild hypopigmentation, immunological impairments and by impaired central nervous system function in types 1 and 2. Defects that cause this syndrome include mutations in myosin 5A (MYO5A) and RAB27A that are involved in LRO transport. Myosin 5A, and RAB27A interact with melanophilin. Hume et al. (2007) reported that melanophilin (Mlph) is a RAB27A- and MYO5A binding protein that regulates melanosome transport. Melanophilin encoded by a gene on chromosome 2q37.3 is a RAB effector. Defects in this gene occur in Griscelli syndrome type 3 that includes pigmentary and immunologic abnormalities; central nervous system abnormalities are not present (Masri et al., 2009). Recycling endosomes are lysosome-related organelles that play an important role at neuronal synapses. They are located at the base of dendritic spines and they contain pools of AMPA glutamate neurotransmitter receptors (AMPAR). Ehlers (2000) reported that long-term potentiation at synapses involves increases in synaptic AMPA receptors and rapid alteration of dendritic morphology. Correia et al. (2008) demonstrated that myosin 5A, an actin-based motor protein present at synaptic sites, mediates the transport of organelles
Quality Surveillance
127
that carry AMPARs into spines in an activity-dependent manner. Their studies led them to conclude that myosin 5A is a critical factor in the regulation of synaptic activity. These findings may account for the cognitive and neurological deficits that occur in Griscelli syndrome that results from myosin 5A deficiency.
UBIQUITIN, UBIQUITIN-LIKE PROTEINS, AND THE UBIQUITIN PROTEASOME SYSTEM Ubiquitin is a small peptide of 76 amino acids that when activated may conjugate to proteins at specific sites. The consequences of ubiquitination are in part dependent on whether attachment involves a ubiquitin monomer or polymer. Attachment of the ubiquitin polymer to a protein facilitates interaction of that protein with the 26S proteasome. There is growing evidence that ubiquitination plays a role in processes that do not directly involve proteolytic degradation. These processes include protein endocytosis and intracellular trafficking, transcription regulation, DNA repair, and signaling complex assembly (Hochstrasser, 2009). Ubiquitin-like proteins also play an important role in protein modification. Enzymes exist that can remove ubiquitin or ubiquitin-like molecules from proteins. Hochstrasse (2009) noted that the dynamic protein modification enabled by ubiquitination and de-ubiquitination facilitates control of different pathways and that the number of cellular processes identified in which ubiquitination plays a role continues to grow. Consequences of ubiquitination depend in part on which amino acid residues in the protein undergoes modification. Polyubiquitin chains linked to lysine 48 in a protein often target this protein for degradation in the proteasome. Lysine 63-linked ubiquitin is present in proteins involved in signal transduction. Ubiquitin modification involves the action of three different enzymes; E1 enzymes activate E2 enzymes, which in turn activate E3 enzymes, which then ligate ubiquitin to the substrate. Ubiquitin and Membrane Proteins Ubiquitin was initially revealed to be a protein molecule that targeted cytoplasmic proteins for proteosomal degradation. More recently it was shown to play a role in targeting membrane proteins for destruction in the endosome lysosome system. Raiborg and Stenmark (2009) reviewed recent information on the role of ubiquitin in endosomal sorting. They noted that degradation of membrane proteins is important not only for quality control but also for attenuation of receptor pathways. They described the process of ubiquitin-dependent
128
Phenotypic Variation
endosomal sorting. In this process, specific E3 ubiquitin ligases attach ubiquitin to target membrane proteins. Endosomal membranes then capture these proteins, endosomes invaginate, and ubiquitinated membrane proteins reach the interior of early endosomes. Key to these processes is the newly described endosomal sorting complexes for transport (ESCRT). Material in early endosomes may be recycled back to the plasma membrane. Some of the material may be recycled from endosomes to the trans-Golgi network. Ubiquitinated proteins may also be sorted into multivesicular endosomes and later into lysosomes. Autophagy involves sequestration of aggregated proteins, organelles, or organisms within double-membrane structures, autophagosomes. These subsequently fuse with lysosomes. Ubiquitinated cytosolic proteins may also be present in autophagosomes. Raiborg and Stenmark reported that deficiency of the ESCRT component resulted in increased number of autophagosomes in cells. This increase may result from impaired fusion between autophagosomes and lysosomes. Deficiency of the ESCRT component VPS-2B (also known as CHMP2B) results in the neurodegenerative disease, frontotemporal dementia. In this disease, ubiquitin-positive aggregates occur in the cytoplasm of cells. Frontotemporal dementia is also characterized by increased neuronal cell death. Nixon and Cataldo (2006) attributed this to impaired down-regulation of neurotrophin signaling caused by VSP2B). Ubiquitination and Endoplasmic Reticulum Secreted proteins must pass through endoplasmic reticulum (ER) to reach their destinations. Hirsch et al. (2009) reviewed the role of chaperones in the endoplasmic reticulum and mechanisms of protein quality control in the ER. Molecular chaperones play a role in protein folding and aggregation. Hirsch et al. (2009) reported that newly synthesized proteins are protected from degradation by N-linked glycans. Within the ER, polypeptides are modified by oligosaccharide transferases that attach glucose, mannose, or N-acetyl glucosamine to asparagine, serine or threonine amino acids in proteins. Oligosaccharide structure is modified as proteins fold. In the ER, misfolded proteins are tagged by a unique glycan code. This glycan tag is decoded by ER membrane-anchored ubiquitin ligase. Proteins, thus tagged and ubiquitinated, exit the endoplasmic reticulum and are degraded by proteasomes. Ubiquitin Proteasome System (UPS) and the Synapse There is evidence that synaptic plasticity is tightly coupled to changes in the proteasome. Tai and Schuman (2008) reviewed the role of the ubiquitin
Quality Surveillance
129
proteasome system in synapses. They reported evidence that the UPS regulates synaptic transmission at both pre- and postsynaptic terminals. In the postsynaptic terminal, UPS plays a role in determining quantities of proteins that occur in the postsynaptic density (e.g., SHANK proteins, protein phosphatases, calmodulin-dependent protein kinase, NR2B, and ionotropic glutamate receptors). Ubiquitin aggregates are often present in neurodegenerative diseases and are frequently surrounded by proteasomes and lysosomes. The authors proposed that in these disorders aggregates marked for destruction are not efficiently removed through endocytosis and degradation in the endosome lysosome system. Tai and Schuman emphasized the importance to postmitotic neurons of ongoing processes of protein degradation and noted that demands for protein degradation are greatly increased in neurons as compared with other cells because of the vast relative increase of surface area to volume in neurons. The extensive branching of neurons brings about this increase. The ubiquitin E3 ligase (UBE3A) is implicated in long-term potentiation at synapses. In a mouse model of Angelman syndrome characterized by decreased UBE3A, synaptic stimulation failed to induce hippocampal longterm potentiation (Jiang et al., 1998). UBE3A is present in dendrites and in dendritic spines and the absence of UBE3A is characterized by alterations in spine density and spine length. The PARK2 gene that is deficient in a specific form of Parkinson’s disease encodes a specific E3 ubiquitin ligase that possesses both mono- and polyubiquitination properties. Delivery of polypeptides to the 20S proteolytic chamber is an energyrequiring process that also requires activity of chaperones. Valosin-containing protein (VCP) is an important chaperone for protein delivery to proteasomes for degradation. Heat shock protein HSP70, in combination with HSP40 and HSP90, plays an important role in control of protein folding. Tai and Schuman noted that there are large number of ubiquitin specific proteases and ubiquitin C-terminal hydrolases that reverse protein ubiquitination. Nedelsky et al. (2008) reviewed autophagy and the ubiquitin proteasome system along with parallels and connections between the two systems. They noted that the UPS system is particularly important for degradation of shortlived proteins and is involved in maintaining amino acid supplies in times of starvation. In the UPS systems unfolded proteins that are tagged with ubiquitin a fed through the barrel or the 26S proteasome. There they are degraded into oligopeptides. Processing of ubiquitinated proteins in proteasomes is schematically presented in Fig. 7–2.
130
Phenotypic Variation
Figure 7–2. Ubiquitination of unfolded protein and subsequent uptake by proteasomes. Uptake is followed by deubiquitination and may be followed by hydrolysis; (modified from illustration in Glickman and Adir (2004).
In a number of neurodegenerative diseases ubiquitin-rich protein deposits occur, indicating defects in the UPS system. Nedelsky et al. (2008) noted too that autophagic vacuoles accumulate in neurons in Alzheimer’s disease. There is evidence that chaperone-mediated autophagy plays a direct role in degradation of alpha synuclein forms that accumulate in Parkinson’s disease. Autophagic vacuoles with protein aggregates accumulate in prion-associated Creutzfeld Jacob disease and in diseases associated with proteins that manifest polyglutamine expansion (e.g., Huntington’s disease). In Ceroid Lipofuscinosis neuronal type 3, (CLN3), a protein present in late endosomal-lysosomal membranes is defective and this leads to defective autosome–lysosome fusion. The protein mTOR negatively regulates autophagy; inhibition of mTOR activity by Rapamycin up-regulates autophagy. Beclin protein stimulates autophagy; beclin knockout in a mouse model of Alzheimer’s disease exacerbates neurodegeneration. There is evidence that the autophagic process may generate toxic amyloid beta protein derivatives that are released into the cytoplasm. In Parkinson’s disease associated with specific alpha-synuclein mutations, the abnormal synuclein accumulates on the lysosomal surface because of impaired chaperone-mediated uptake.
Quality Surveillance
131
Nedelsky et al. (2008) further reviewed evidence that UPS and autophagy are functionally related processes that share certain substrates and regulatory mechanisms and manifest coordinated function. There are proteins that may be degraded in either one or the other of these systems. Animal models and gene knockouts indicate that ubiquitin-tagged molecules may be degraded in lysosomes. Coregulation of the UPS and autophagic systems are mediated by histone deacetylase (HDAC6), p62/sequestome and protein ALFY (WD repeatcontaining protein). p62/sequestome acts as an adaptor for specific molecules in the ubiquitin and autophagic systems; it has a recognition sequence for the microtubule light chain 3 protein located in the membranes of phagosomes. Transcription and translation of p62/sequestome are activated by oxidative stress and under conditions characterized by increased burden of misfolded proteins. Studies in Drosophila revealed that the ALFY protein plays a role both in autophagic degradation and ubiquitin aggregate clearance. Genome-wide association studies have led to the identification of three additional genes that act as Alzheimer’s disease susceptibility genes. Of particular interest is the fact that these genes are involved in clearance of amyloid from the brain; these genes are CLU (encodes clusterin), PICALM (encodes phosphatidyl inositol binding clathrin assembly protein) and the complement receptor gene (CR1) (Lambert et al., 2009; Harold. et al., 2009). Van Es and van den Berg (2009), in reviewing these reports, noted that clusterin is homologous to apoliprotein E (APOE) and likely acts with APOE to suppress amyloid beta deposition and to promote its clearance. The PICALM protein plays a role in endocytosis and intracellular trafficking. They propose that the CR1 receptors may impact amyloid clearance via the complement system.
MOLECULAR CHAPERONES In a review of molecular chaperones, Muchowski and Wacker (2005) reported that molecular chaperones act to combat the cellular effects of misfolded or aggregated proteins. Since postmitotic cells such as neurons cannot dilute protein aggregates through cell division, they are particularly prone to the pathological effects of aggregates. They proposed that the accumulation of protein aggregates in neurons during aging may be in part caused by decrease in proteasome number and to decreased activity of proteasomes. The function of chaperones in protein folding is depicted in Fig. 7–3. In their review, Muchowski and Wacker noted that conditions of stress in cells trigger a cellular response in which heat shock proteins are synthesized and that almost all heat shock proteins act as molecular chaperones.
132
Phenotypic Variation Normal folded protein
Unfolded protein
proteosome
chaperone
Figure 7–3. Illustrates activity of chaperones in protein folding. Proteins that cannot be refolded are taken up in the proteasomes.
Molecular chaperones play a role in mitigating oxidative stress and in blocking apoptotic signaling. Specific drugs are known to increase synthesis of molecular chaperones, including Geldanamycin. DNAJ domain Chaperones Proteins in this group of molecular chaperones share a 70 amino acid domain, the DNAJ domain, however they are diverse in other respects. Cheetham and Caplan (1998) reported that DNAJ proteins function as part of the heat shock protein 70 (HSP70) chaperone machinery and that the DNAJ domain stimulates HSP70 ATPase activity. They reported that DNAJ proteins play a role in protein folding. There is also evidence that DNAJ proteins interact with HSP90. DNAJ proteins play a role in import of proteins into mitochondria through the mitochondrial membrane translocase system and will be discussed in the chapter on mitochondria (Chapter 6).
Quality Surveillance
133
Valosin-Containing Protein (VCP) The VCP molecular chaperone binds to a number of different proteins. Guinto et al. (2007) reviewed structure and function of the VCP chaperone. They reported that VCP binds to polyubiquitinated proteins and facilitates their transport to the proteasome degradation system. VCP is also involved in the endoplasmic reticulum degradation pathway (ERAD). Two ATPase domains are present internally in the VCP protein. The VCP N-terminal domain plays a key role in determining interaction with other proteins. In the disorder, inclusion body myositis with frontotemporal dementia (IBMPFD), VCP mutations occur in the N-terminal region. Guinto et al. (2007) reported two categories of frontotemporal dementia. One category is associated with Tau inclusions and the other with ubiquitinpositive inclusions in the neuronal cytoplasm and nucleus, and dendritic abnormalities. They noted that the ubiquitin pathology in VCP mutation patients is distinct in that abundant ubiquitin-positive intranuclear inclusions are present. Inclusions are prominent in the upper-cortical layers. In patients with IBMPFD, inclusions stain positive with antibodies to the TAR (transcription regulating) DNA binding protein 43 (TDP43). This protein is present in inclusions in an insoluble phosphorylated form. Guinto et al. postulate that VCP mutations impact metabolism of TDP43. Muscle biopsies from patients with IBMPFD show nonspecific myositis with inclusions that stain positive for VCP. Endoplasmic Reticulum Degradation Pathway In the endoplasmic reticulum, secreted proteins are subjected to quality control measures. In the endoplasmic reticulum degradation pathway defective unfolded proteins are recognized, targeted with molecular chaperones and translocated to the cytoplasm for degradation in the ubiquitin proteasome system. (Vembar & Brodsky, (2008)
PROTEIN FOLDING AND THE FUNCTION OF CHAPERONES In a review of protein folding, Hartl and Hayer-Hartl (2009) noted that the original concepts of protein folding attributed the three-dimensional structure of proteins to the amino acid sequence. However, there is now evidence that a large fraction of newly synthesized proteins in the cell require molecular chaperones to reach their final folded states. Another important concept that has
134
Phenotypic Variation
emerged following application of techniques that permit visualization of protein folding is that proteins, even small proteins, pass through various stages and generate intermediate forms prior to achieving their final folded state. Hartl and Hayer-Hartl noted further that partially folded or misfolded proteins often aggregate. Aggregated proteins may be present as highly ordered fibrillar aggregates that constitute amyloid. Under physiological conditions, few proteins form fibrillar amyloid aggregates. However, under denaturing conditions many different proteins may give rise to amyloid aggregates. Amyloid fibrillar structures are usually toxic to cells. These investigators emphasized that chaperones usually ensure efficient protein folding. They play a role in de novo folding, in refolding of denatured proteins, and are involved in intracellular protein transport and in proteolytic degradation. Heat shock proteins act as chaperones. They bind to hydrophobic side chains and promote folding in an adenosine-triphosphate-regulated (ATP) regulated process. Chaperones may, in some cases, counteract the effects of mutations that impair folding capacity of proteins. The nomenclature of heat shock protein chaperones includes their molecular weight (e.g., HSP40, HSP60, HSP70 and HSP90). Specific chaperones bind to polypeptides as they exit ribosomes; these include components of the HSP70 system that interact in ribosome-associated complexes. Hartl and Hayer-Hartl considered HSP70 proteins to be the most versatile chaperones since they play roles in protein folding, trafficking, and in proteolytic degradation. HSP70 chaperones also interact with the HSP40 DNAJ family of proteins and with nucleotide exchange factors. HSP70 binding is ATP-regulated. The HSP70 N-terminal domain has ATPase function. The C terminal chaperone domain binds to the protein to be folded. HSP40 accelerates hydrolysis of adenosine triphosphate to adenosine diphosphate (ATP to ADP). They reported that the J domain of HSP40 interacts with HSP70. They noted that HSP40 might directly interact with the protein substrate. There is evidence that aberrant protein folding occurs as a part of aging and it occurs in a number of neurodegenerative diseases.
HSP90 CHAPERONES, GENETIC VARIABILITY, AND CANALIZATION Canalization serves as one explanation for inheritance of apparently acquired characteristics. McLaren (1999) wrote, “History may be circular but science is helical, it repeats itself but each time at a deeper level.” As an example of this
Quality Surveillance
135
phenomenon she presented the discovery by Rutherford and Lindquist (1998). These investigators determined that impaired function of Drosophila heat shock protein HSP90, by environmental alteration (e.g., temperature change) or by mutation, exposed genetic variation in other proteins. Their discovery was consistent with the concept of canalization proposed by Waddington in 1942, who wrote, “Under influence of natural selection development tends to become canalized so that more or less normal tissues and organs are produced even in the face of slight abnormalities of genotype or of the external environment.” Waddington proposed the canalization hypothesis to explain the expression of a specific drosophila wing pattern in response to exposure to high temperature. After repeated exposure to the abnormal environmental factor (high temperature), the characteristic became fixed in the absence of heat shock and in later generations. The key concept is that cryptic genetic variation was exposed by environmental change. There is abundant evidence that HSP90 plays a role in the folding of proteins; one example is calcineurin (Cowen & Lindquist, 2005). In 2007, Salathia and Queisch demonstrated that HSP90 buffering of genetic variation also occurred in the plant Aridopsis thaliana. They reported evidence that HSP90 impairment may also impact chromatin since treatment with histone deacetylase may reverse some of the effects of HSP90. These authors noted the effect of HSP90 on plasticity, defined as, “the phenomenon that a given genotype may result in distinct phenotypes depending on environmental settings.” Salathia and Queisch reported that other chaperones (e.g., HSP70), also play a role in buffering genetic variation. In addition, small noncoding RNAs, microRNAs (miRNAs), are implicated in the process since they may repress transcription of mutant genes. MicroRNAs are single stranded RNA molecules 21-23 nucleotides in length that regulate gene expression. It is also important to note that highly specific inhibitors of HSP90 occur in nature (Turbyville et al., 2006). Yeyati and van Heyningen (2008) reviewed the role of HSP90 as an evolutionary capacitor that modulates disease. They emphasized that homeostasis of the organism can be maintained when genetic variation is cryptic. Through effects of capacitors, cryptic genetic variation can be maintained in the population. However, specific environmental factors and/or the mutation in genes that encode interacting proteins may serve to uncover the variation. These authors specifically reviewed how chaperone-based mechanisms may episodically be unmasked to reveal new phenotypes. They also reviewed how chaperone-based masking can provide opportunities for evolutionary selection. They noted that many developmental anomalies (e.g. holoprosencephaly, cleft lip and palate, and micropthalmia) may manifest as Mendelian disease or
136
Phenotypic Variation
with complex inheritance. They proposed that these developmental defects are threshold traits where the aberrant phenotype appears when an associated factor falls below a critical level. The term incomplete penetrance is often applied to these conditions. Yeyati and van Heyningen (2008) defined penetrance and incomplete penetrance as follows: “Penetrance reflects the extent to which a genotype is translated to a phenotype; penetrance is incomplete when all the carriers of a certain deleterious allele do not manifest the expected phenotype.” They emphasized that one of the key roles of the HSP90 chaperone protein is to establish correct protein folding and to facilitate folding of mutated or stressdenatured proteins. Information on a growing network of HSP90-interacting proteins is emerging; this network includes kinases, hormone receptors, cell cycle components, and secreted proteins. There is also evidence that HSP90 and cochaperones are part of a multicomponent process required for rapid, precise regulation of gene expression and that these processes are energy-requiring. Factors that can alter HSP expression exist at the transcriptional, translational, and post-translational levels. Environmental fluctuation may perturb HSP90 function. Polymorphic variation in HSP90 may lead to individuals differences in environmental stress responses, and Yeyati and van Heyningen (2008) conclude that the plasticity and multiple functions of the HSP90 machinery allow it to be involved in multiple disease states.
SEQUESTOSOME UBIQUITIN PATHWAY INTERACTION AND PAGET’S DISEASE OF BONE Paget’s disease of bone is a common chronic bone condition present in 3% of Caucasians (Collet et al., 2007). Key features of the bone pathology include focal abnormal bone reabsorption and disorganized new bone formation. The pelvis lumbar spine, femur tibia, and skull are most commonly involved. This disorder may cause pathological fractures, deformities, and bone pain. In some patients deafness occurs. Osteosarcoma occurs with increased frequency in Paget’s disease patients. Paget’s disease occurs predominantly in older men and women; however, a juvenile form of the disease is known. Juvenile Paget’s disease, also known as familial idiopathic hyperphosphatasia, is a rare disorder. There are marked population differences in the frequency of this disorder. The highest incidence is in the United Kingdom. Changes in the frequency of Paget’s disease of bone have occurred, indicating that environmental factors play a role in the disorder (Ralston et al., 2008). Sporadic forms of the disease occur.
Quality Surveillance
137
In 15% of cases there is a positive family history. There is definite evidence that genetic factors play a role and that in some families the disorder is inherited as an autosomal dominant trait. Linkage studies in these families facilitated mapping of disease-causing genes; these studies identified regions on at least eight different chromosomes that likely harbor Paget’s-disease-related genes. The sequestosome 1 gene SQSTM1 (p62) is a definite susceptibility locus and at least 15 different mutations have been defined in Paget’s disease patients. Heterozygous mutations in sequestosome 1 lead to the disease. Approximately 40% of patients with a family history of Paget’s disease carry sequestosome 1 mutations (Helfrich & Hocking, 2008) The majority of sequestosome 1 mutations occur in the C terminal ubiquitin-associated domain (UBA) and impact the interaction of sequestosome 1 with ubiquitin. One specific UBA domain sequestosome mutation, P392L, occurs on a common haplotype and likely represents a founder mutation (Lucas et al., 2005). Phenotypic variation and variable penetrance occur in families with sequestosome mutations. Factors that impact penetrance may be polymorphisms in other genes or environmental factors. Sequestosome Function The Sequestosome 1 protein (SQSTM1) is expressed in the nucleus and in the cytoplasm. It has multiple domains and integrates signaling from multiple receptors with kinase and ubiquitin-mediated signaling pathways (Helfrich & Hocking, 2008). Different forms of ubiquitination occur. Proteins tagged on lysine 48 with a polyubiquitin chain subsequently undergo degradation in the 26S proteasome. Nondegradative tagging involves interaction of lysine 63 in proteins with ubiquitin. An important function of SQSTM1 protein is NF kappa B cascade activation. This occurs following interaction of SQSTM1 with other proteins including protein Kinase C, TRAF1 (tumor necrosis factor receptor), NGF (nerve growth factor) and RANKL. RANK acts as a receptor for RANKL, an osteoclast growth factor. The binding of RANKL to its receptor activates NF kappa B translocation to the nucleus and gene expression. Sequestosome also interacts with the VCP. This protein is deficient in a rare form of Paget’s disease that is associated with frontotemporal dementia and inclusion body myositis. In patients with this disorder the VCP mutations cluster in the ubiquitin binding domain and ubiquitinated protein degradation is likely impacted in this disorder.
138
Phenotypic Variation
Helfrich and Hocking (2008) reported that the characteristic inclusion bodies that occur in osteoclasts in Paget’s disease are aggregates of misfolded proteins that contain ubiquitin. They may also contain VCP and SQSTM1 protein and are surrounded by intermediate filaments and mitochondria. Up-Regulation of SQSTM1 Expression in Paget’s Disease Collet et al. (2007) carried out analysis of SQSTM1 mutations and gene expression in lymphoblastoid cell lines from 94 patients with Paget’s disease. They identified 12 patients with SQSTM1 mutations, six patients had amino acid 392 mutations. They noted that all Paget’s disease patients, including SQSTM1 mutation-positive patients and SQSTM1 mutation-negative patients, showed increased transcription of SQSTM1. In analysis of genotype–phenotype correlations Collet determined that the Paget’s disease of bone patients with SQSTM1 mutations manifested earlier onset of disease and that more bones manifested disease, and affected bones were more liable to fracture. Serum alkaline phosphatase levels were elevated in all Paget’s disease of bone patients, however greater elevations were observed in the group with SQSTM1 mutations. These investigators also reported finding patients with more than one SQSTM1 mutation. In these patients the degree of bone involvement was more marked.
8 NEURODEVELOPMENT AND FUNCTIONAL GENOMICS
“…understanding synaptic function is crucial for understanding how the brain mediates thoughts, feelings and behavior and what goes awry in neuropsychiatric diseases…” —Thomas C. Sudhof and Robert C. Malenka (2008)
INTRODUCTION Key breakthroughs in analysis of neurophysiological processes include the capacity to analyze gene knockouts and gene mutants (most often in mice), and the ability to silence gene expression with short inhibitory ribonucleic acids (siRNAs) and to then observe the effects on the phenotype. Important insights have also been gained through neurophysiological studies, brain imaging and analyses of genes and their expression in patients with neurological and developmental defects.
SYNAPSES, NEUREXINS, AND NEUROLIGINS Processing of information in the brain involves synapses; abnormalities in synaptic function impact brain function. Synaptic transmission involves the 139
140
Phenotypic Variation
rapid transmission of information from one neuron to another. Sudhof (2008) noted that synaptic connectivity has some of the same properties that are observed in intercellular junctions in nonneural tissues. He noted further that although much progress has been made in analyzing synapses, the factors that determine synaptic assembly remain unknown. The term synaptic plasticity is applied to use dependent changes in synaptic strength. Cell adhesion molecules play a key role in synaptic linkage and connectivity, and neuroligins and neurexin are the best characterized synaptic adhesion proteins. Sudhof reported that neurexin and neuroligin dysfunction does not abolish synaptic transmission but it does disrupt specific properties of synapses and neural networks. Neurexins and neuroligins bind to each other and to intracellular PDZ domain proteins. These are proteins with defined 80 to 90 amino acid regions that fold into specific structures that facilitate molecular interactions. Mutations in neurexins and neuroligins occur in forms of autism and in schizophrenia. Sudhof proposed that cognitive dysfunction may arise from subtle changes confined to a subset of synapses in a neural circuit and that involvement of different circuits leads to different neurological symptoms and to different diagnoses (e.g., autism spectrum disorders, Tourette’s syndrome, learning disabilities, and/or schizophrenia). Discoveries that revealed that in these disorders mutations or gene disruptions occur in genes that encode products in the synapse support the argument that impaired synaptic transmission plays a key role in their pathogenesis. Neurexins Neurexins were discovered during the course of analyses of the vertebratespecific toxin alpha latroxin, which is produced by the black widow spider. This toxin binds to specific molecules on presynaptic neuronal terminals and leads to massive release of neurotransmitters. Neurexins are the specific molecules bound by alpha latroxin. Sudhof reported that two types of neurexin proteins occur, alpha and beta neurexins. They differ in their amino-terminal extracellular domains. Three different neurexin genes occur in mammals: NRXN1, NRXN2, and NRXN3. Each gene encodes an alpha and a beta protein and these arise from transcripts that originate on different promoters. Thousands of different neurexin isoforms arise as a result of alternate splicing. Sudhof (2008) emphasized the important observation that alternate splicing of neurexin transcripts is regionally regulated and altered by neuronal activity. Specific forms of neurexin are differentially distributed between different classes of neurons. Neurexins are predominantly located on presynaptic
Neurodevelopment and Functional Genomics
141
terminals, however they may sometimes occur on postsynaptic terminals. The contactin-associated cell adhesion molecules resemble neurexin and are involved in neuron-glial interactions. In humans, NRXN1, NRXN2, and NRXN3 are encoded on chromosomes 2p16.3, 11q13, and 14q31, respectively. Neuroligins Neuroligins are neurexin receptors. Neuroligins form dimers linked through glycosylation. There are five neuroligin-encoding genes in mammals. NLGN3 and NLGN4 map to the X chromosome and NLGN5 maps to the Y chromosome. NLGN1 and NLGN2 are encoded on chromosomes 3q26.31 and 17p13.1, respectively. Neuroligins are enriched in the postsynaptic density (PSD) and bind to neurexins. Neuroligin and neurexin intracellular C terminal domains are connected to PDZ domain-containing proteins. Glycosylated amino acids are present on neuroligins and neurexins, in the regions just outside the membrane. Neuroligin intracellular domain-interacting proteins include SH3 multiple ankyrin repeat domains (SHANK3) encoded on chromosome 22q13.3. Neurexin and Neuroligin Abnormalities in Patients: Their Role in Autism Neurexin proteins occur on synapses and they play a role in formation, maintenance and modification of synapses. Zahir et al. (2008) described a patient with developmental delay, autistic behaviors, vertebral anomalies, and an extra rib. The history revealed that speech was delayed and he used three- to fourword sentences by 3 years and 6 months of age. By 9 years of age he manifested autistic behaviors, had a verbal IQ of 90 and a performance IQ of 70. His head circumference was at the 98th percentile, height was 75th to 95th percentile and weight was 95th percentile. Microarray analysis of the patient’s DNA revealed a de novo heterozygous deletion of 320 kb on chromosome 2p16.3. This deletion led to hemizygosity for neurexin 1 exons 1 to 5 and for the NRXN1 promoter. The deletion in this patient encompasses genomic sequence encoding alpha neurexin. Neuroligin mutations described in autism include a substitution in NLGN3 leading to an amino acid coding change, ARG451CYS, and loss of function mutations in NLGN4. Sudhof (2008) proposed that small changes in neuroligins can lead to substantial changes in neural networks. He noted that autism spectrum disorder (ASD) manifestations first present at 2 to 3 years of age, during a time of synapse formation and maturation. There are few
142
Phenotypic Variation
consistently documented features of autism beyond increased head size. Heritability of ASD is demonstrated by high concordance in monozygotic twins and high frequency of co-occurrence in siblings versus in the general population. The higher frequency of ASD in males may indicate involvement of the X or Y chromosome or facilitated penetrance of disease mutations in males. Scrutiny of the literature reveals that mutations or gene disruptions associated with ASD occur in NRXN1, NLGN3, NLGN4, and SHANK3. Chromosome 22q23 terminal deletion leads to SHANK3 loss and to autism. In some cases the same mutation in SHANK3 may occur in an unaffected sibling of the probands. NLGN3 and NLGN4 mutations lead to symptoms in males. However, sometimes the diagnosis is different in individuals with the same mutation (e.g., they may be diagnosed with ASD or with Tourette’s syndrome). Evidence of NRXN1 involvement includes two reports of disruption of this gene by translocation and four different reports of deletions. Disruptions of the NRXN1 gene region that encodes the alpha subunit have also been reported in schizophrenia (Kirov et al., 2008; Ikeda et al., 2009). Sudhof (2008) emphasized that understanding neural connections and neural transmission are central to understanding human behavioral and cognitive phenotypes. He noted that although much is known about functional mechanisms of synapses, little is known about processes that mediate assembly of synapses into neural circuits. Sudhof postulated that cognitive impairment may result from subtle changes in a subset of synapses. Gutierrez et al. (2009) analyzed the expression and impact of an autismrelated neuroligin 3 mutation. They quantified network activity and firing events. They determined that neuroligin 3 mutations alter network architecture and synchronicity. These authors noted that autism has onset during the first few years of life, during a period of structural remodeling and activity-dependent neuronal plasticity, both of which are likely compromised by functional effects of neuroligin 3 mutations that they demonstrated.
SYNAPTIC TRANSMISSION AND USE-DEPENDENT PLASTICITY Sudhof and Malenka (2008) reviewed advances in genetics, structural biology and electrophysiology that have contributed to our understanding of synaptic transmission and use-dependent plasticity. They consider one of the first major breakthroughs in this area to be the cloning of the nicotinic acetylcholine receptor by Noda et al. in 1982. This was followed by discoveries on the nature and properties of synaptic vesicles that contain neurotransmitters and on the
Neurodevelopment and Functional Genomics
143
organization of the presynaptic active zone and the postsynaptic density. They noted that much remains unknown, including the nature of the various synaptic cell adhesion molecules. Influx of calcium (Ca) plays a key role in fusion of synaptic vesicles to the presynaptic membrane and release of neurotransmitters. It is interesting to note that understanding of this process was derived from analysis of the effects of tetanus and botulinum toxin that block release of neurotransmitters through inhibition of proteolytic cleavage of synaptobrevin in the vesicle. Synaptojanin, another vesicle component, functions as a Ca sensor and complexin acts as a co-factor for Ca release. Synaptic plasticity is the subject of intense study. Changes in the number of AMPA glutamate receptors in the postsynaptic density mediate long-term potentiation and depression (Sudhof & Malenka, 2008). AMPA glutamate receptors are ionotrophic receptors encoded by GRIA 1 to 4 loci. (Neurotransmitter receptors are named for the pharmacological agonists that activate them. AMPA receptors are activated by alpha amino-3-hydroxy-5methyl-4-isoxazole propionate). During long-term potentiation, AMPA receptors are inserted into the postsynaptic density. In long-term depression these receptors undergo endocytosis and degradation. Key factors in AMPAR protein trafficking are scaffolding proteins including PSD-95 and TARP accessory protein (transmembrane AMPA regulatory protein). Dendrites constitute the postsynaptic compartment and dendritic spines act as entry points for signaling activity. A more recent discovery is that endogenous endocannabinoids impact neurotransmission. Release of these substances on depolarization of a postsynaptic neuron leads to transient suppression of GABA (gamma-amino-butyric acid) release from inhibitory presynaptic terminals (Urbanski et al., 2009). Inhibitory neurons play a key role in neural circuits. GABAergic interneurons also impact plasticity. Sudhof and Malenka noted that experience-related plasticity likely plays a key role in learning and memory. Synapses are continuously formed, remodeled, or eliminated throughout adulthood. These processes may differ in different brain regions. They emphasize that the functional and structural diversity of synapses is poorly understood and that it is not yet clear whether or not synapses play a role in memory storage. Memory may involve strengthening or weakening of specific synaptic connections, development of new synapses, or destruction of synapses. They noted that a key question that arises is the extent to which synaptic dysfunction underlies disease. Synaptic architecture is schematically presented in Fig. 8–1. Synaptic plasticity may be defined as the biochemical and morphological changes that synapses undergo in response to stimuli. These changes lead to
144
Phenotypic Variation
Synaptic vesicles and neurotransmitters
mitochondrion
Axon
Neurotransmitters and receptors
neurexins Calcium ion channels
Neuroligins
Dendritic spine
Figure 8–1.
Diagram of components active at the synapse.
increases or decreases in synaptic strength, to long-term potentiation or to long-term depression, respectively. Richter and Klann (2009) noted that studies carried out throughout the 1990s concentrated on the role of transcription and particularly cyclic adenosine monophosphate (AMP) responsive element binding protein-(CREB) induced transcription on synaptic plasticity. They reported that more recent studies have revealed that mRNA, ribosomes and translation factors are present not only in neuronal cell bodies but also in dendrites. There is evidence that control of translation may play a key role in synaptic plasticity. They reported that components of the signal conduction pathway impact translation. Key signaling components include mammalian Target of Rapamycin (mTOR), S6 protein kinase, EIF4E transcription initiation factor and its binding protein EIF4EBP (this pathway was also discussed in Chapter 5 and depicted in Fig. 5–1).
Neurodevelopment and Functional Genomics
145
Costa-Mattioli et al. (2009) presented evidence that control of translation is a key process that regulates neural circuits and controls behavior and memory.
NEUROGENESIS IN POSTNATAL AND ADULT LIFE Small populations of neurons can be replenished from stem cells in the subventricular zone and the dentate gyrus (Zhao et al., 2008). These investigators discovered that in adults, neurogenesis occurs in the subgranular zone lining the lateral ventricles, in the subgranular zone of the dentate gyrus of the hippocampus and in the olfactory bulb. Gage and coworkers noted that neural stem cells occur in many areas of the brain, however neurogenesis occurs only in these zones. Studies of Gage and co-workers (Toni et al., 2008) revealed that neuronal stem cells can give rise to neurons, astrocytes and oligodendrocytes and can also proliferate as stem cells. They proposed that the microenvironment in these specific regions acts as a neurogenic niche. Neurogenesis-promoting substances in the niche include bone morphogenic protein (BMP), Noggin (protein active in development and signaling, binds to BMP), and vascular endothelial growth factor (VEGF) released from blood vessels. There is evidence that increased neurogenesis in adult mice exposed to an enriched environment or increased voluntary exercise is VEGF-dependent. Local neurons and factors that they produce can impact neural progenitors. These factors include neurotransmitters and neuropeptides and growth factors such as epidermal and fibroblast growth factors (EGF, FGF), neurotrophins, including brain-derived factors BDNF and PAX6 (homeobox regulator of transcription), also play important roles (Zhao et al., 2008). These investigators determined that migration of neurons generated in the course of adult neurogenesis does not proceed on radial glial cells but is dependent on extracellular matrix and on factors produced by this matrix, including neural cell adhesion molecule (NCAM), the secreted extracellular matrix proteins Reelin and Tenascin R, and the protein produced by the disrupted in schizophrenia gene (DISC1). They noted that reduction of DISC1-encoded protein expression causes cells to migrate further. There is evidence that neuronal cells that migrate into the dentate gyrus undergo further development and become functionally integrated into the circuitry. A number of studies indicate that these immature neurons may contribute to distinct forms of learning and memory. Bannerman et al. (2004) reported that the dorsal hippocampus is involved in learning and memory, whereas the ventral hippocampus is involved in affective behavior. The hippocampus is
146
Phenotypic Variation
also involved in spatial memory. Hippocampal proliferation is promoted particularly by tasks that promote spatial learning. Aging and stress negatively impact hippocampal proliferation. Zhao et al. (2008) reported that adult neurogenesis likely plays a role in the repair of damaged brain tissue. Neurogenesis and Line 1 (L1) Retrotransposons In studies in mice Gage and coworkers (Kuwabara et al., 2009) demonstrated that Wnt (mammalian homolog of Drosphila wingless gene) signaling and down-regulation of SOX2 transcription factor triggered expression of neurogenic differentiation factor D2 (NeuroD2), and that this in turn played a key role in regulating adult neurogenesis. The NeuroD2 transcription also stimulated activity of Line 1 retrotransposons. There is also evidence that environmental factors including exercise and exposure to new environments, stimulate retrotransposon activity (Muotri et al., 2009). Studies on the human fetal brain revealed that L1 retrotransposon activity is much higher in the hippocampus than in other tissues and that this activity has the potential to contribute to somatic mosaicism of neurons (Coufal et al., 2009).
DEVELOPMENTAL CHANGES IN GENE EXPRESSION IN THE BRAIN DURING ADOLESCENCE Since a number of psychiatric disorders first manifest during adolescence it is important to consider brain changes that occur during that stage of life. Harris et al. (2009) used microarrays to analyze gene expression in postmortem prefrontal cortex of brains from individuals between 0 and 49 years of age. They determined that the most dramatic changes in gene expression occur between 0 and 2 years of age. They determined that a number of genes, including neuregulin 1 (NRG1), reached a plateau of expression during adolescence with minimal changes thereafter. Genes that showed peak expression in late adolescence are associated with energy metabolism (e.g., glycolysis, tricarboxylic acid cycle, electron transport, adenosine triphosphate (ATP) synthesis, and mitochondrial membrane function). Other genes that reached peak expression in adolescence included genes involved in transcription, translation, and protein trafficking. Some genes decreased in expression. Included among the latter were genes involved in neuropeptide and glutamate signaling pathways. Harris et al. noted evidence that grey matter volume in the prefrontal cortex decreases during adolescence as a result of increased synaptic pruning.
Neurodevelopment and Functional Genomics
147
These authors proposed that in schizophrenia, molecular mechanisms critical for adolescent brain development are impaired.
PROGRAMMED CELL DEATH AND ITS ROLE IN SHAPING THE NERVOUS SYSTEM In a review of the role of programmed cell death in central nervous system development, Buss et al. (2006) defined developmental programmed cell death as: “Spatially and temporally reproducible tissue and species specific loss of cells, which serves developmental functions.” They noted that in the nervous system, cell death occurs even in regions where proliferation is taking place. They proposed that the primary role of cell death is to affect the size and morphology of neuronal structures and that it plays a role in establishment and refinement of functional connectivity. At times cell death may result from genomic instability. Buss et al. (2006) reviewed the concept of systems matching and the hypothesis that programmed cell death serves as a means of quantitatively optimizing connectivity between neurons and their efferent targets and afferent inputs, consistent with the neurotrophic hypothesis of Oppenheim and Cowan (2001). They proposed that neurons compete for limiting amounts of survivalpromoting factors from targets or from their afferent connections. Buss et al. reported that programmed cell death occurs during synaptogenesis. In the adult brain, neurogenesis occurs primarily on two brain regions, the dentate gyrus and the olfactory lobe, and programmed cell death also occurs in neurons that arise in adult neurogenesis. Buss et al. (2006) reported that disruption of programmed cell death occurs in mice in which the caspase 3 gene has been knocked out. In these mice excess neuronal proliferation and brain malformations occur that are often lethal.
DEATH RECEPTORS In a review of the role of death receptor activation in programmed cell death in the nervous system, Haase et al. (2008) noted that the outcome of death receptor activation differs. Death receptors are single-pass transmembrane proteins related to the tumor necrosis super-family. A characteristic feature of these receptors is an 80-amino-acid sequence, the death domain. Upon activation of the death receptor, a death-inducing complex forms that triggers downstream activities.
148
Phenotypic Variation
Culling and Pruning in the Central Nervous System Neuronal cell death and axonal pruning are key processes in development of the central nervous system. Important steps include pruning of inappropriate axonal branches and culling of neurons. Nikolaev et al. (2009) reported that two processes play roles: lowered neurotrophin levels and activation of death receptors. In experimental systems, Nikolaev et al. determined that withdrawal of trophic factors led to activation of death receptor DR6. Downstream mechanisms that involved caspase and BAX (apoptosis regulator) then triggered neuronal cell body and axon degeneration. In studies of mouse embryos at mid-gestation, Nikolaev et al. determined that the DR6 receptor is abundantly expressed in differentiation neurons in the spinal cord, in dorsal root ganglia, and in axons. In a particularly interesting set of experiments these investigators analyzed growth and projection of the retinal ganglion cells to the brain and specifically to the superior collicus. The collicus is located in the midbrain and is the center for integrating eye movements. They noted that in exuberant growth of axons from the retinal ganglion cells these axons often extended beyond the anterior collicus and were subsequently pruned. In knockouts of DR6 this pruning was delayed. Nikolaev et al. demonstrated that after trophic deprivation neuronal cell body and axon degeneration are triggered through death receptor 6 signaling. This occurs via BAX and caspase 3 in cell bodies and via BAX and caspase 6 in axons. They obtained evidence that deprivation of trophic factors leads to release of an extracellular fragment of amyloid precursor protein (APP) and a fragment of amyloid precursor-like protein (APLP2). They demonstrated that knockdown of DR6 with short inhibitory RNA (siRNA) -protected neurons from degeneration and they determined that DR6 is required for neuronal cell body and axonal degeneration and synaptic pruning. These investigators reported that the fragments released by secretase cleavage of amyloid precursor protein (SAPP alpha and SAPP beta) undergo further cleavage to yield a 55 kilodalton C-terminal fragment and a 35K N-terminal fragment. The N-terminal fragment binds to DR6. They determined that a similar N-terminal fragment derived from APLP2 also binds to DR6. APP cleavage products and DR6 are highly expressed in spinal and sensory neurons and in their axons. They noted that the death receptor, p75NTR, also binds an approximately 256-amino-acid terminal fragment of APP but with low affinity. An important observation in the Nikolaev et al. (2009) report is that the DR6 ligand interaction with the APP-derived fragment is activated by trophic factor deprivation. Previous studies had revealed that trophic factor deprivation
Neurodevelopment and Functional Genomics
149
triggers BACE (beta secretase) cleavage of APP. There is evidence that both APP and DR6 are highly expressed in the adult brain and that their expression is up-regulated in injured neurons. Nikolaev et al. proposed that signaling of APP via DR6 contributes to initiation of Alzheimer’s disease, either alone or in combination with other APP mechanisms. They noted that DR6 maps to chromosome 6p12.2-21.1, a region reported previously to harbor an Alzheimer’s disease susceptibility locus. Furthermore, DR6 gene expression is highest in brain regions involved in Alzheimer’s disease (e.g., hippocampus, cortex, forebrain, and cholinergic neurons). DR6 receptor protein is abundant in Alzheimer’s plaques and tangles. Nikolaev et al. therefore propose an intriguing connection between APP, DR6, and caspase activity in programmed cell death and in the pathogenesis of Alzheimer’s disease. They noted that gamma secretase inhibitors antagonize DR6-dependent neuronal degeneration. Albrecht et al. (2007) reported that caspase 6 is activated in mild cognitive impairment.
NEURAL CONNECTIVITY Brain white matter increased throughout primate evolution and this contributes to increased connectivity within the brain. The prefrontal white matter is disproportionately larger in humans than in other primates (Schoenemann, 2005). The corpus callosum, which connects left and right brain hemispheres, is the largest connective structure in the brain and contains primarily excitatory axons. Fibroblast growth factor receptor 1 (FGFR1) plays an important role in the development of this structure. Smith et al. (2006) reported that dysfunctional astroglial migration leads to dysgenesis of the corpus callosum in conditional FGFR1 knockout mice. Complete or partial agenesis of the corpus callosum occurs in a number of different chromosomal and genetic abnormalities. Paul et al. (2007) reported that approximately 10% of cases of corpus callosum agenesis have chromosome abnormalities. In 20 to 35% of cases this disorder occurs in association with a neurodevelopmental syndromic abnormality. Neurodevelopment: Spinal Motor Neurons In previous decades neurophysiologists demonstrated that spinal motor neurons segregate in columns that each innervate a specific musculature peripheral domain. Jessell (2000) analyzed molecular programs involved in linking neuronal subtypes to their innervation targets. These investigators determined that
150
Phenotypic Variation
a regulatory network of HOX (homeobox) transcription factors plays a key role in establishing patterns of connectivity. Subsequent studies revealed that the transcription factor FOXP1 acts as a HOX accessory factor. Dasen and Jessell (2009) demonstrated that inactivation of FOXP1 disrupts the HOX network and changes the pattern of neuronal connectivity. Dalla Torre et al. (2008) reviewed evidence that the emergence of brachial lateral motor column neurons in the chick requires transcription of HOX6 and expression of retinaldehyde dehydrogenase 2 (RALDH2). Neurons in the preganglionic motor column (PGC) that project to the thorax and the autonomic nervous system differentiate in response to HOX9 and express bone morphogenetic protein, specifically BMP5. They demonstrated that at the lumbar level HOX10 proteins are important in motor neuron specification. HOX proteins control downstream intermediate transcription factors. Important among these for motor neuron development are the LIM homeodomain transcription factors, RUNX1, NKX6-1, ETS, and PEA3. (LIM homeodomains are comprised of two zinc finger protein domains linked by hydrophobic aminoacids). Dalla Torre et al. noted that a sophisticated transcriptional network acts in motor neuron subpopulations at postmitotic stages. Correct functioning of these networks is required for terminal differentiation and incorporation onto motor circuits.
SPEECH, LANGUAGE, AND FOXP2 A specific monogenic form of speech and language disorder was mapped to chromosome 7q31 following linkage studies in an extended English family (Fisher & Pembrey, 1998). In 2001, Lai and Monaco discovered that point mutations in the gene that encodes the transcription factor FOXP2 lead to this specific type of speech and language disorder. This disorder is defined as developmental verbal dyspraxia and it manifests with impairment of the production of complex coordinated articulations and by disruption of receptive speech and writing. Functional magnetic resonance imaging of the brain revealed abnormal activation of Broca’s area of the brain. Gross chromosomal rearrangements that interrupt the FOXP2 gene may also lead to verbal dyspraxia (Tomblin et al., 2009). FOXP2 protein is a member of the forkhead box containing proteins that act as transcription factors. The forkhead box is a specific 80- to –100-aminoacid domain that serves as a DNA binding domain. Proteins with this domain play an important role in the regulation of gene expression during development and in later life. FOXP2 protein is expressed in a number of different tissues.
Neurodevelopment and Functional Genomics
151
Different protein isoforms arise from different FOXP2 transcripts. FOXP2 proteins may be active as dimers or as monomers in binding DNA. They have expanded polyglutamine tracts in their N-terminal regions. Wild-type FOXP2 protein localizes primarily to the nucleus, consistent with its function as a transcription factor. Vernes et al. (2006) carried out studies to determine the functional effects of specific FOXP2 mutations identified in patients with verbal dyspraxia. They cloned different FOXP2 transcript isoforms into an expression vector and analyzed proteins derived from these cloned isoforms with respect to expression level, subcellular localization, DNA binding, and transcription activation properties. Vernes et al. (2006) identified a single amino acid substitution within the forkhead box of FOXP2 in a three-generation family with severe verbal dyspraxia. This substitution, R553H, leads to disruption of nuclear localization and DNA binding properties of the protein. In a second family with verbal dyspraxia they identified an R328X mutation and determined that the mutated protein was confined to the cytoplasm of cells and did not reach the nucleus. The mutated protein occurred in ubiquitinated aggresomes. These investigators noted that there is evidence that aggresomes play a regulatory role and that they control the quantity of protein made available to the nucleus. Neural Correlates of FOXP2 Disruption Watkins et al. (2002) published results of brain magnetic resonance imaging (MRI) studies in members of a multigeneration verbal dyspraxia family where affected members carried a FOXP2 mutation that impacted the forkhead domain. In affected individuals they observed decreases in gray matter density in the inferior frontal gyrus including Broca’s area, in the caudate nucleus, and in the cerebellum. In contrast, increases in gray matter density were observed in Wernicke’s area in the angular gyrus and in the putamen. Functional MRI (FMRI) studies carried out during linguistic processing revealed an anomalous activation pattern in individuals with the R553H mutation in FOXP2 (Liegeois et al., 2003). Downstream Targets of FOXP2 Chromatin immunoprecipitation (CHIP) methods were used to identify genes that serve as downstream targets of FOXP2 protein (Vernes et al., 2007). Results of these studies indicate that FOXP2 plays an important role in modulating synaptic plasticity, axon guidance, neurodevelopment, and neurotransmission.
152
Phenotypic Variation
FOXP2 protein recognizes a specific consensus core sequence in DNA. The CHIP studies revealed that 303 different gene fragments were bound to FOXP2. Gene ontology categories of FOXP2 binding genes included signaltransduction genes, genes involved in neurodevelopment, genes encoding proteins involved in ion binding and ion transport, and genes involved in cell adhesion. Vernes et al. (2008) carried out experiments to identify promoter sequences to which FOXP2 binds. They reported that FOXP2 binds to the CNTNAP2 gene and that it down-regulates this gene. These investigators used a neuroblastoma cell line engineered to express FOXP2 to examine DNA binding of this protein. CHIP experiments revealed that FOXP2 binds to intron 1 of the CNTNAP2 gene. This gene encodes the protein CASPR2 (contactin associated protein 2), a form of neurexin found in myelinated nerve fibers and at nodes of Ranvier. There is evidence that CASPR2 plays a role in the maintenance of voltage-gated potassium (K) channels. Studies in the developing brain revealed that CNTNAP2 is abundantly expressed in the inferior, middle, and frontal gyri. Interestingly, FOXP2 expression is highest in the cortical layers that show the lowest CNTNAP2 expression. This finding supports the conclusion that FOXP2 is a negative regulator of CNTNAP2. Vernes et al. (2008) analyzed CNTNAP2 polymorphisms in families with language disorders and identified a specific CNTNAP2 single-nucleotide polymorphism (SNP), associated with a specific disorder which impacts ability to reproduce nonsense words. Polymorphisms in exons 13 to 15 are specifically associated with this language defect; these polymorphisms centered around the tagging SNP, rs2710102. This is the same CNTNAP2 gene region that was found to be associated with autism by Alarcon et al. (2008). Autistic spectrum disorders are characterized by deficits in three major areas: social interaction, repetitive behaviors, and communication. Vernes et al. (2008) concluded that their findings support the concept that different components of autistic disorder are likely under different genetic influences.
CHROMOSOME 7Q11.3 AND LANGUAGE The Williams Beuren syndrome is caused by deletion of genes on chromosome 7q11.3 and is associated with strength in expressive language relative to intellectual ability. On the other hand, duplication of the 7q11.3 region was reported to be associated with marked difficulties in expressive language and with receptive language in the low average range (Somerville et al., 2005).
Neurodevelopment and Functional Genomics
153
The specific patient with 7q11.3 duplication reported by these authors manifested with growth retardation and mild dysmorphism including high-arched palate, retrognathia, and short philtrum. Twenty-seven genes, including genes that encode three transcription factors, map in 7q11.3; no specific genes in this region have been definitively associated with language impairment, and it is possible that more than one of the genes in the region determine language.
CHILDHOOD APRAXIA OF SPEECH This disorder is defined by Shriberg et al. (2008) as a “neurological disorder in which the precision and consistency of movements underlying speech are impaired…the core impairment is considered to lie in planning and/or programming of movement sequences.” These authors described the occurrence of childhood speech apraxia in three children in a family who carried an unbalanced chromosome 4q;16q translocation that led to trisomy for genes on 16q24 and deletion of eleven genes in the 4q telomeric region. They proposed that genotype-phenotype studies be undertaken in cases of childhood apraxia.
GENETIC FACTORS IN DYSLEXIA Dyslexia is defined as unexpected difficulty in reading and spelling that cannot be explained by other causes. Criteria for defining dyslexia include analysis of IQ and establishing that there is a significant difference (two or more standard deviations) between observed reading ability and expected ability based on IQ (Parrachini et al., 2007). This condition is usually diagnosed in the early school years. However, there is evidence that language difficulty occurs in preschool children who later manifest with dyslexia. Dyslexia occurs in 5 to 10% of school-age children. The cognitive basis for this disorder may lie in the processing of speech sounds (phonemes). Other proposed defects include difficulties learning the correspondence of letters to sounds (grapheme-phoneme correspondence). These difficulties may result from auditory processing defects or motor control defects (Parrachini et al., 2007). Evidence for the importance of genetic factors in dyslexia derives from family studies and from twin studies. Concordance for dyslexia is present in 40% of siblings of affected individuals. The concordance rate for dyslexia in monozygotic twin pairs is 68%. These findings indicate that dyslexia represents a multifactorial trait impacted by several gene loci and by environmental effects.
154
Phenotypic Variation
Genetic linkage studies have led to identification of a number of candidate dyslexia genes in the genome. In addition, in several families specific chromosome translocations have been found to segregate with dyslexia. In a number of families, dyslexia was linked to chromosome 15q21 and this region was identified as the site of translocation breakpoints in two independent families with dyslexia. Several different linkage studies identified a dyslexia-associated region on chromosome 6p. The defined, linked region encompassed 16 megabases. Association studies led to the identification of two candidate genes within this region: KIAA0319 and DCDC2 (double cortin domain). In some studies association of dyslexia and KIAA0319 is stronger than with DCDC2, although in other studies the reverse is true. These discrepancies may result from phenotype differences in the cohorts studied. KIAA0319 is a membrane protein that is expressed in the developing neocortex. There is evidence that dyslexia-associated alleles in the KIAA0319 risk haplotype exhibit a lower level of expression than the predominant alleles in the controls. Dennis et al. (2009) identified seven single-nucleotide polymorphisms on the dyslexia-risk haplotype in the KIAA0319 gene. These SNPs map close to the transcription start site of the gene. They determined that a specific nucleotide variant in the risk haplotype acts as a silencer for the binding site for the transcription factor OCT1. These investigators noted that the risk haplotype showed association with dyslexia in two sets of families. The DCDC2 gene encodes doublecortin peptide domains. Proteins with these domains are important in microtubular organization and neuronal migration. Chromosome 15q21-q22 and Dyslexia Genes Nopola-Hemmi et al. (2000) identified two Finnish families with dyslexia and balanced translocations that involved 15q21-q22. In one family, three of the four individuals who carried the translocation had dyslexia. A fourth individual who carried the translocation had difficulty reading and impaired phonological awareness; however, he also had an IQ below normal. Taipale et al. (2003) identified a specific gene on chromosome 15q21 that was disrupted as a result of the translocation in this family. The gene was designated DYX1C1 (dyslexia susceptibility 1 candidate 1). It encodes a 420 amino acid protein with three tetratricopeptide repeat domains. These domains occur frequently in protein involved in interaction with other proteins. Following identification of the DYX1C1 gene, Taipale et al. carried out association studies in the Finnish population in samples from 58 dyslexia
Neurodevelopment and Functional Genomics
155
patients and 61 controls. They identified two sequence variants in DYX1C1 that occurred more commonly in the patients than in the controls. One variant led to a premature stop codon and the other variant impacted an ELK (E26-like protein) transcription factor -binding site. The risk haplotype with these variants showed a higher degree of transmission to affected offspring. Massinen et al. (2009) reported that knockdown of rat DYX1C1 expression in utero using siRNA led to defects in neuronal migration within the neocortex. Behavioral studies in these rats revealed deficits in spatial learning and auditory processing. These investigators also carried out studies on protein–protein interaction of DYX1C1. They determined that DYX1C1 colocalized with estrogen receptors alpha and beta in nuclei, when cells were treated with estrogen. Their studies indicated that DYX1C1 protein interacts with ligand activated estrogen receptors. The DYX1C complexes with estrogen receptors alpha and beta were also detected in neurons in the hippocampus. The N-terminal domain of DYX1C1 was specifically required for this interaction. Massinen et al. concluded that DYX1C1 protein is involved in regulation of estrogen receptor activity and may impact neuronal migration through this mechanism. There is evidence that estrogen synthesized in the brain through the activity of the enzyme aromatase plays a role in neurogenesis and synaptic activity (GarciaSegura, 2008). The dyslexia type 5 locus, DYX5, was mapped to chromosome 3p12-q13 on the basis of linkage studies. Subsequently, Hannula-Jouppi et al. (2005) reported that a translocation (3;8) (p12:q11) occurred in a family with 19 members with dyslexia. One family member had dyslexia but did not carry the translocation. The translocation disrupted the first intron of the ROBO1 (roundabout axon guidance receptor) gene. The ROBO1 gene encodes a transmembrane protein that is widely expressed in the brain. There is evidence that it controls axon guidance across the midline of the brain.
SIGNATURES FOR LITERACY Neuroscientists proposed that learning to read involves specific structural brain changes. Delineation of these changes is difficult in children because of other concurrent maturation changes (Carreiras et al., 2009). These investigators studied specific brain changes in individuals who learned to read as adults and who had had no prior education. Specifically, they studied guerilla fighters in Columbia who had laid down weapons and underwent integration into society and education. The control individuals in their study were adults who were illiterate. Carreiras et al. used FMRI and diffusion-weighted magnetic
156
Phenotypic Variation
resonance imaging. Their analyses revealed that reading increased inter-hemispheric functional connectivity between the left and right angular gyri. The strengthened coupling was mediated through increase in white matter pathways through the splenium of the corpus callosum. In comparisons of late-literate and illiterate adults they demonstrated that the late-literates had more white matter in the splenium of the corpus callosum and more grey matter in the bilateral angular gyri and in the dorsal occipital, middle temporal, left supramarginal, and superior temporal gyri.
GENES THAT PLAY A ROLE IN NEURODEVELOPMENT AND IN MAJOR MENTAL ILLNESS The DISC1 gene (disrupted in schizophrenia) was first discovered through its location at the site of a translocation breakpoint on chromosome 1. The translocation involved chromosomes 1 and 11, t (1; 11) (q42.1; q14.3) and it was present in schizophrenia-affected individuals in specific family (Millar et al., 2000). Subsequent studies have revealed that the protein encoded by the DISC1 gene is located in nucleus, cytoplasm and mitochondria and that it interacts with a number of other proteins including nuclear disruption factor (NDE1), NDEL1, and lissencephaly1 (LIS1) (Porteous et al., 2006). The products of DISC1 and these interacting genes are all present in the centrosome. This structure plays a role in nuclear movement and nucleokinesis during neuronal migration. There is evidence that risk alleles in DISC1 and a specific risk haplotype in NDE1 may interact in the pathogenesis of schizophrenia (Hennah et al., 2007). In the adult brain, DISC1 plays a role in integrating neurons that arise from neurogenesis in the dentate gyrus into the adult brain (Chubb et al., 2008). Another important DISC1 binding protein is PDE4 (phosphodiesterase 4); PDE4 regulates cyclic AMP (cAMP) levels. When cAMP levels are high, PDE4 undergoes a conformational change that increases cAMP hydrolysis. There is evidence that PDE4 plays a direct role in schizophrenia. This evidence derived from cytogenetic studies and from association studies (Millar et al., 2005). Bradshaw et al. (2008) used confocal fluorescence microscopy and cultured hippocampal neurons to analyze DISC1 protein distribution. They determined that DISC1 protein is present in punctate structures in the region surrounding dendritic spines and that it overlaps PSD95, (post-synaptic density protein 95) a component of excitatory synapses. Their studies also revealed
Neurodevelopment and Functional Genomics
157
co-localization of DISC1, NDE1, NDEL1, and PDE4 proteins at dendritic protrusion. These findings led them to conclude that these proteins play a key role in synaptic transmission. Dystrobrevin Binding Protein 1 The DTNBP1 gene encodes dystrobrevin binding protein. This gene maps to chromosome 6p22.3. Straub et al. (2002) identified DTNBP1 as a schizophrenia susceptibility gene based on linkage studies in high-density schizophrenia families. Subsequently, a large number of different studies have revealed a positive association between schizophrenia and DTNBP1 alleles. There is accumulated evidence that schizophrenia risk alleles occur in DTNBP1 (Zuo et al., 2009). The DTNBP1 risk haplotype is associated with decreased expression of the protein it encodes in the prefrontal cortex and midbrain. Dystrobrevin binding protein (sometimes referred to as dysbindin) and alpha and beta dystrobrevin, together form part of the dystrophin complex in muscle and brain. This complex links the extracellular matrix and cellular cytoskeleton. It also plays a role in the biogenesis of lysosomes. Guo et al. (2009) determined that the DTNBP1 gene gives rise to a number of different transcripts. They constructed a DTNBP1 protein interactome and determined that this interactome includes the DISC1-encoded protein and proteins involved in retinoic acid metabolism. Centrosome Neuronal cytoskeletal structure and neuron polarity play key roles in the coordinated timing of proliferation, migration and layering that are essential for development of the brain (Higginbotham & Gleeson, 2007). Abnormalities of brain development, including lissencephaly (absence of cortical gyri and sulci), arise as a result of abnormalities of a number genes that encode components of the microtubule cytoskeleton system. The centrosome or microtubule organizing center forms the hub of the neuronal cytoskeleton structure. Evidence for the role of the centrosome and mitotic spindle pole position in determining neuronal proliferation derived from studies on microcephaly, a condition that is in some instances characterized by aberrant centrosome and spindle position. In one form of autosomal recessive microcephaly the centrosome-associated protein CENPY (centrosomal and DNA pathway repair gene), is mutated and this leads to hypoproliferation of neuronal precursor cells.
158
Phenotypic Variation
Microcephaly and Growth Retardation: Involvement of Centrosomal and DNA Breakage Repair Pathway Genes Seckel syndrome, characterized by microcephaly, proportionate dwarfism, prenatal and postnatal growth retardation, and facial dysmorphology, is genetically heterogeneous. This syndrome is inherited as an autosomal recessive disorder. Studies by O’Driscoll et al. (2003) and Alderton et al. (2004) led to the discovery that in a subset of Seckel syndrome patients the disorder results from defects in a signaling pathway that involves the ataxia telangiectasia and RAD3-related protein (ATR) encoded by a gene on 3q22-q24. O’Driscoll et al. (2007) noted that patients with three other disorders associated with microcephaly and growth delay have defects in ATR-signaling responses. These three disorders are Nijmegen breakage syndrome, Fanconi anemia, and microcephaly type 1 (MCPH1). ATR is a kinase that is activated by single-stranded DNA breaks generated during DNA replication stalling or as a result of DNA damage. Griffith et al. (2008) carried out homozygosity mapping using SNP microarray analysis on two consanguineous Middle Eastern families whose children had Seckel syndrome. In these families Seckel syndrome was linked to chromosome 21q22.2. The pericentrin gene (PCNT) lies within this chromosomal region it encodes a centrosomal protein. The investigators postulated that it might be the disease-causing gene in these families since defects in a number of other centrosomal proteins lead to primary microcephaly. They carried out DNA sequence analysis in Seckel-syndrome-affected individuals homozygous for the linked chromosome region on chromosome 21q22.3 and discovered a single base pair deletion in PCNT exon 12 in one of the two families. This deletion results in a frame shift and premature transcription termination. They subsequently identified a Seckel syndrome patient with a homozygous single base pair insertion in PCNT exon 18. This insertion resulted in a frameshift. Griffith et al. (2008) reported that pericentrin is a 360 kilodalton coiledcoil protein; it occurs in two isoforms and localizes to pericentriolar material. There it binds to other proteins and plays a role in spindle organization and microtubular function. They demonstrated that pericentrin was absent in individuals homozygous for mutations in exon 12 or exon 18. They further demonstrated that ATR signaling was defective in PCNT-deficient patients Rauch et al. (2008) drew attention to the important role of centrosomal function in determining cell division, cell size, and growth. They emphasized the importance of studies on patients with extreme growth retardation and microcephaly and of positional cloning to provide insight into key growth regulatory factors. Rauch et al. carried out studies on patients with microcephalic osteodysplastic primordial dwarfism Majewski type II dwarfism (MOPD II). Patients
Neurodevelopment and Functional Genomics
159
with this disorder have a birth weight at term of 1,500 grams and an adult height of 100 centimeters. They have small head size, normal brain morphology, and normal intelligence. However, cerebral vascular abnormalities may be present and may lead to stroke. In addition, they have bone and dental abnormalities and may have pigmentation anomalies. Homozygosity mapping in consanguineous families with MPOD II led to identification of a shared chromosome region on 21q22.3. Mutation analysis led to identification of pericentrin mutations in 25 patients with MOPD II. Rauch et al. reported that the PCNT localizes specifically to the centrosome. This structure organizes cytoplasmic organelles and mitotic spindle microtubules and plays a role in determining chromosome segregation during meiosis. Rauch et al. (2008) noted that mutations in centrosome and mitoticspindle-related proteins have been identified in three forms of primary microcephaly. In MCPH3 the CDK5 regulatory subunit-associated protein (CDKRAP2) is defective. In MCPH5, the abnormal spindle homolog microcephaly associated (ASPM) protein is defective, and in MCPH6 centromere protein J (CENPJ) is mutated. The protein microcephalin 1 that is defective in MCPH1 (associated with microcephaly and growth retardation) plays roles in regulation of chromosome condensation and in DNA repair. Kumar et al. (2009) reported results of studies carried out on patients with familial microcephaly that did not map to any of the known microcephaly loci. They mapped a unique form of microcephaly, MCPH7, to chromosome 1p32.2p33. The gene STIL maps to this chromosome region; this gene encodes a cytoplasmic protein involved in regulation of the mitotic spindle checkpoint chromosome segregation during cell division. It localizes to mitotic spindle poles during metaphase. Kumar et al. identified homozygous mutations in this gene in three of five MCPH7 families. Mutations in this gene did not occur on a common haplotype. Nicholas and Woods (2009) emphasized the importance of centrosomal proteins and correct centrosomal function during neurogenesis. They reported that mutation in the gene that encodes ASPM at the MCPH5 locus on chromosome 1q31.3 represent the most common cause of microcephaly. They determined that microcephaly-causing mutations occur throughout the ASPM gene and that they most commonly lead to protein truncation. NEUREGULINS Neuregulins NRG1 to NRG4 are epidermal-growth-factor–like (EGF-like) ligands that signal via ErbB (epidermal growth factor receptor family of
160
Phenotypic Variation
tyrosine kinase receptors) and bind to receptors via an EGF-like domain. Neuregulin 1 is encoded by one of the largest mammalian genes. The human NRG1 gene extends for approximately 3.4 Mb on chromosome 8p12. NRG1 gives rise to a series of different transcripts that are derived from different promoters and that undergo differential splicing. Binding of neuregulin protein to its receptor induces dimerization of tyrosine kinase receptor subunits, receptor activation, and phosphorylation of tyrosine in the cytoplasmic receptor domain. This may then be followed by activation of RAS MAP kinase signal transduction pathway and phosphatidylinositol-3-kinase (PI3K) and alpha serine threonine protein kinase (AKT) signaling pathways. Birchmeier (2009) reviewed the role of neuregulin ErbB signaling in nervous system development and reported important roles for these gene products in development and function of the neural crest and its derivatives and in neuronal migration and pathfinding. NRG1 plays an important role in the migration and function of Schwann cells that are particularly important in myelination of the peripheral nervous system. Birchmeier reported that experiments carried out in mice reveal that NRG1 plays an important role in development of the cortex, particularly in migration of inhibitory neurons from the subpallium to the cortex and in development of thalamo-cortical projections. There is also evidence that neuregulin ErbB signaling is important in synaptic function, in expression of acetylcholine neurotransmitter receptors, and in GABA expression. Type I and II isoforms of neuregulin 1 undergo proteolytic cleavage by beta secretase BACE1. This enzyme also cleaves amyloid precursor protein. This finding is relevant to treatment of Alzheimer’s disease since therapy with beta secretase inhibitors will compromise neuregulin1 processing and function. There is evidence ADAM proteases (metallo-proteases with receptor binding activities) also process neuregulin 1 protein.
DEVELOPMENT OF DOPAMINE NEURONS, DOPAMINE PATHWAY Flames and Hobert (2009) analyzed dopamine pathway genes that are essential in the development of dopamine neurons. Five genes in this pathway encode proteins involved in dopamine synthesis and transport. In C. elegans these investigators demonstrated that a specific cis-regulatory DNA sequence motif named DA controls the expression of these genes. The specific sequence element acts as a binding site for a specific ETS (E26) -type transcription factor ATS1. They demonstrated that this specific transcription factor persists in the
Neurodevelopment and Functional Genomics
161
postembryonic stages and is therefore required not only to initiate dopamine neurons but also to maintain identity of dopamine neurons. Vertebrate dopamine pathway genes also contain the DA sequence motifs. Flames and Hobert (2009) reported that in vertebrates the necessary transcription factor is the ETS-like factor, ETV1. This factor is continually expressed in postmitotic neurons. In mice lacking ETV1, dopamine neurons fail to differentiate. Spitzer (2009), in a review of the Flames-Hobert studies, wrote that their results clearly demonstrate that a shared DNA bar code (DNA sequence motif) underlies a crucial aspect of neuronal differentiation. Discovery of New Molecules in Well-Studied Receptors through Functional Proteomic Analyses In studies on AMPA glutamate receptors, Schwenk et al. (2009) used a series of different antibodies for affinity purification of these receptors from the rat brain. They then analyzed affinity- purified material using high-resolution nanoflow liquid chromatography and tandem mass spectroscopy. Results of their experiments revealed that subunits present in 70% of AMPA receptors were associated with members of a family of small transmembrane proteins, the cornichon proteins. Schwenk et al. then carried out functional studies and demonstrated that cornichon proteins impact surface expression and gating products of AMPA receptors. They noted that further studies are required to determine whether neurons differ in their activation and deactivation characteristics based on their content of cornichon proteins.
9 NEUROBEHAVIORAL DISORDERS
TRANSFORMATIVE APPROACHES TO THE PATHOPHYSIOLOGY OF PSYCHIATRIC DISEASES Transformative approaches to the pathophysiology of psychiatric diseases have emerged during the past two decades. Insel (2008, 2009) emphasized that schizophrenia, bipolar disease, and depression are recognized as brain disorders, developmental disorders, and complex genetic disorders rather than psychological conflicts or chemical imbalances. Chemical imbalance theories proposed that altered concentrations of neurotransmitters led to disorders, decreased serotonin led to depression, increased dopamine led to schizophrenia. Insel noted that mechanisms of drug action of antipsychotic and antidepressive medications are known. In contrast, little is known about the pathophysiology of psychosis or mood regulation. He has emphasized the importance of transforming psychiatry into clinical neuroscience and of ending the division between mind and brain and focusing on mental activity as neural activity.
162
Neurobehavioral Disorders
163
Insel emphasized the importance of defining prodromal features of mental disorders, features that may precede development of symptoms by a number of years. In considering mental illness as a consequence of disordered circuits, he postulated that symptoms manifest when circuits fail to develop at a specific time, or if compensatory circuits fail to develop or no longer function effectively. In considering the importance of genetic factors, Insel proposed that a set of risk genes determine psychopathology and that the form of the mental disorder is determined by other factors. Dissecting out the Different Aspects of the Schizophrenia Phenotype Features of schizophrenia include psychotic symptoms such as hallucinations and delusions, loss of affect, and cognitive disorganization. Cohen and Insel (2008) reported that the treatment of this disorder has primarily addressed the psychotic symptoms while cognitive dysfunction and motivation disturbances remain largely unaddressed. They emphasized the importance of further development of psychometric tests and clinically applicable instruments to assess cognitive impairment of schizophrenia. The National Institute of Mental Health (NIMH) has undertaken a special initiative to redefine schizophrenia as a cognitive disorder in which psychosis occurs as a late manifestation. The goal of new research approaches will be to assess cognitive processes, understand how they are disrupted in schizophrenia and design new drugs for treatment. Addressing the phenotypic manifestations of schizophrenia with medication has only been partially successful. Cohen and Insel (2008) observed that available medications address some of the symptoms, including hallucinations and delusions. Other symptoms, including loss of affect and cognitive disorganization in particular are not fully addressed. They noted that cognitive dysfunction leads to inability to work and to live independently. They emphasized the importance of translating modern cognitive neuroscience measures into clinically useful instruments. Identification of specific cognitive impairments that precede psychosis could lead to preemptive treatment measures. Investigators have developed a battery of tests for cognitive dysfunction known as the Matrics Consensus Cognitive Battery (MCCB). These tests can also be used to assess impact of specific medications. Cohen and Insel (2008) emphasized that analysis of cognitive disturbances in depression, bipolar disorder, and attention deficit disorder are also important.
164
Phenotypic Variation
NEUROIMAGING STUDIES The prefrontal cortex serves as the focus of many neuroimaging studies in patients with psychiatric disorders and there is evidence of dysfunction in this region in a number of different disorders. The dorsolateral prefrontal cortex mediates executive function that is defined as judgment, planning, and cognitive flexibility. Meyer-Lindenberg et al. (2005) defined this as the region impacted in schizophrenia. Ressler and Mayberg (2007) identified midline infra-genual prefrontal cortex as a region involved with mood determination. Rauch et al. (2006) reported that post-traumatic stress disorder was associated with defects in prefrontal cortex regions associated with fear extinction. Delay in cortical maturation and in achievement of normal cortical thickness was reported as the major abnormality in attention deficit hyperactivity disorder (ADHD). Shaw et al. (2007) reported that delayed maturation manifested particularly in the middle prefrontal cortex in ADHD. Functional Magnetic Resonance Imaging (FMRI) During the past decade technological developments have provided mechanisms to directly investigate the role of disordered neural circuits in mental illness. Specific imaging studies during performance of a particular brain function are valuable in defining regions of the brain that are impacted during a specific phase of mental illness. Kaladjian et al. (2009) carried out FMRI studies during performance of a specific task (Go/No-Go), to identify brain region activation in patients in manic phases of bipolar disorder and in these same patients during remission. This study was therefore longitudinal and designed to determine whether specific response inhibition differences and brain activation differences existed during mania and resolved during remission. Their studies revealed that the left amygdala was the only brain region to show differential activation in patients with bipolar disease relative to controls. Furthermore, in the patient group there was decrease in activation in the amygdala between mania and remission. The patients in remission were medicated and Kaladjian et al. noted that it is possible that both medication and mood state modulate amygdala activity. The amygdala is the key limbic region involved in the regulation of emotion. The authors had no definitive explanation for the differences between right and left amygdala. Based on their studies, Kaladjian et al. concluded that amygdala responsiveness and mood lability are critical determinants in bipolar disease.
Neurobehavioral Disorders
165
Functional connectivity alterations, as demonstrated by FMRI are correlated with symptoms in schizophrenia. Henseler et al. (2009) demonstrated that altered connectivity between prefrontal cortex and hippocampus and altered parieto-occipital connectivity was correlated with positive symptoms including delusions and disorganization.
DEVELOPMENTAL PATHWAYS AND SCHIZOPHRENIA Lewis and Sweet (2009) proposed that in schizophrenia brain developmental pathways are disrupted through interplay of a large number of genetic liabilities and adverse environmental effects. They also emphasized that disturbances in cognition are now considered to be core features of the disease and they noted that the degree of cognitive dysfunction predicts the ability of an individual to have occupational and educational involvement and to live independently. They emphasized the familial aggregation in schizophrenia and that the risk of disease is directly proportional to the percentage of genes shared with an affected person. They reported that genetic factors contribute 80 to 85% of liability to schizophrenia and shared environmental factors contribute 11%. Examples of gene–environment interaction in schizophrenia include polymorphisms that impact the function of catechol-O-methyl- transferase (COMT) and increase the risk of psychosis associated with the use of cannabis. A further example is the interaction of neonatal hypoxia and genes associated with vascular function (Nicodemus et al., 2008). Lewis and Sweet (2009) emphasized that the clinical syndrome of schizophrenia represents an endpoint of different pathogenic pathways. They noted that investigations of brain circuitry in schizophrenia focus upstream on genetic and other etiological factors and how they impact circuitry. They may also focus on downstream effects and how specific clinical features correlate with pathway alteration. They reported examples of the latter and specifically on studies focused on a common problem in schizophrenia—impaired working memory. They also focused on reduced capacity to recognize spoken emotional tone. Impaired working memory is associated with altered circuitry of the dorsal prefrontal cortex while inability to recognize emotional speech tone is associated with defects in the primary auditory cortex. Working memory is defined as the ability to transiently maintain and manipulate a limited amount of information in order to guide behavior toward a goal. There is evidence that schizophrenics have difficulty in manipulating information and maintaining good representation (Barch, 2006). Activation of
166
Phenotypic Variation
the dorsolateral frontal cortex (DLPFC) is associated with performance related to working memory. In schizophrenia, neurons in the DLPFC have fewer axon terminals and dendrites. Dendritic length and the density of dendritic spines are decreased. This is particularly marked in layer 3 of the cortex. Lewis and Sweet (2009) noted further that excitatory input from the thalamus connects primarily with dendritic spines of cortical pyramidal neurons in layer 3. Pyramidal neurons are also regulated by interneurons that use the inhibitory neurotransmitter, gamma amino butyric acid (GABA). Lewis and Sweet (2009) reported that one of the most consistently replicated postmortem findings in schizophrenia is that levels of glutamic acid decarboxylase (GAD67) are reduced. This enzyme regulates GABA synthesis. Levels of GABA transporter 1 (GAT1) are also reduced, indicating that synthesis and uptake of GABA in DLPFC interneurons is impacted in schizophrenia. Subsets of interneurons in the DLPFC express the calcium binding protein parvalbumin, and have special physiologic properties. Parvalbulin neurons are fast-spiking and have a high number of axons and higher excitatory input. Two types of parvalbumin neurons occur, basket neurons, and chandelier neurons. Lewis and Sweet (2009) noted that in schizophrenia parvalbumin neurons have less GAD67 and less GAT1. They also manifest increased GABA receptors that may reflect a compensatory change. There is evidence that other populations of DLPFC interneurons manifest abnormalities; these include neurons that express the neuropeptide cholecystokinin and neurons that express the cannabinoid receptor, CB1. Lewis and Sweet proposed that reduced output of DLPFC pyramidal neurons in patients with schizophrenia may account for decreased activation of dopamine-producing cells. The COMT polymorphism, Val158/Met, also impacts dopamine levels. Another feature of the phenotype in schizophrenia is impaired prosody. Prosody is defined as the emotional tone in speech, including variation in pitch and tone. The AI (primary auditory field) region in the auditory cortex in Heschl’s gyrus is responsible for prosody recognition. There is evidence that gray matter loss in the AI region is exaggerated in schizophrenia. Lewis and Sweet (2009) proposed that deficits in activation of pyramidal neurons in layer 3 of the AI occur in schizophrenia and that this reflects the reduction in synaptic connectivity of these neurons. These authors proposed that understanding the circuitry alterations in schizophrenia opens the way for application of new treatments. They noted that evidence that GABA input from pyramidal neurons is deficient while GABA receptors are increased in number had led to trials involving the use of allosteric modulators of this receptor.
Neurobehavioral Disorders
167
During adolescence there is a decrease in cortical gray matter, attributed to synaptic pruning. There is evidence that this process is exaggerated in schizophrenia. Lewis et al. noted too that excessive spine pruning during adolescence might be modulated through use of spine-specific kinases that regulate spine size, number, activity, and function.
FUNCTIONAL NEUROIMAGING IN PSYCHIATRIC DISORDERS AND CORRELATION OF GENETIC EVENTS AND NEUROIMAGING Esslinger et al. (2009) reported that there is extensive information that indicates abnormal coupling and interactions in the dorsolateral prefrontal cortex and hippocampal formation in schizophrenia. Their studies aimed at defining correlation between the dorsolateral prefrontal cortex and hippocampal activity and allelic variation in the schizophrenia candidate gene located on 2q32 that encodes the zinc finger protein ZNF804A. A specific allelic variant in ZNF804A was found to be associated with psychosis in the genome-wide association studies (GWAS) reported by O’Donovan et al. (2008). This variant was associated with psychosis in schizophrenia and in bipolar disease. Esslinger et al. studied task-related activity in the dorsolateral prefrontal cortex and also coupling across hemispheres. In view of evidence that a specific allele of rs1344706 in ZNF804A is also associated with bipolar psychosis, they analyzed a task that measures activation and connectivity of the amygdala. Emotional face matching and amygdala activation differences occur in neuroticism and mood disorder. They reported that individuals with CC genotype in ZN8044 differed significantly from individuals with the CA genotype with respect to connectivity within DLPFC (same side) and connectivity to the contra-lateral DLPFC. In risk allele carriers there was dosage-dependent increased connectivity of hippocampal formation and DLPFC and increased connectivity of amygdala, hippocampus, orbito-frontal cortex, and medial prefrontal cortex. A number of studies have reported increased activation in the amygdala, particularly in response to negative stimuli, in patients with depression. Esslinger et al. concluded that rs1344706 or a genetic variant in linkage disequilibrium with this marker have functional implications in the brain. They noted also that their findings validate analysis of intermediate phenotypes in psychiatric disorders. In their studies, the intermediate phenotype was emotional face matching and amygdala activation.
168
Phenotypic Variation
RELATIONSHIP BETWEEN SCHIZOPHRENIA, BIPOLAR DISORDERS, AND MIXED OR SCHIZOAFFECTIVE PSYCHOSES In a review published in 2009, Craddock et al. noted that molecular genetic findings in psychiatric illness are leading to new concepts for diagnosis. They emphasized that the traditional dichotomies and diagnostic categories of schizophrenia and bipolar disorder are not supported by genetic data. They noted further that specific genetic susceptibility may lead to illness with features of schizophrenia and bipolar disorder (e.g., schizoaffective disorder). Craddock et al. reported that an important justification for moving away from the Kraepelin dichotomy derives from extensive family studies including studies on over 2 million nuclear families from Sweden, reported by Lichtenstein et al. (2009). These studies revealed that either of these two disorders, schizophrenia or bipolar disease were diagnosed in first-degree relatives of probands originally diagnosed with one of these disorders. In the 2 million nuclear families in Sweden studied by Lichtenstein et al. 35,985 individuals met criteria for schizophrenia, 40,487 individuals met criteria for bipolar disease. They determined that when a proband had bipolar disorder their first-degree relatives had increased risk for bipolar disorder. They also had increased risk for schizophrenia. Their half-siblings had increased risk, though this was lower than the risk in full siblings. Adopted children who had a parent with one of these disorders had increased risk for one of these disorders. These studies suggest a common genetic contribution for schizophrenia or bipolar disorder. The heritability of schizophrenia and bipolar was estimated to be between 60 and 80%. An important conclusion drawn by Lichtenstein et al. was that some genes are probably associated with the risk for both disorders while other genes impact the risk primarily for one disorder. Lichtenstein et al. determined that shared environmental effects account for 3 to 6% of variation. Nonshared environmental effects including perinatal risk factors, also contribute substantially, by approximately 30%. Craddock et al. (2009) cited evidence that variation at the CACNA1C locus, which encodes the C subunit of L type voltage-gated calcium channel, influences susceptibility across the psychosis spectrum. They also noted that the variant in ZNF804 that shows strongest association with schizophrenia also shows association with bipolar disorder. The presence of an unbalanced translocation between chromosomes 2 and 12 that led to deletion of 12p and the CACNA1C gene in siblings with autism is shown in Fig. 9.1. Deletion of the CACNA1C gene is illustrated in Fig. 9–2.
Neurobehavioral Disorders
169
Figure 9–1. Metaphase chromosomes and interphase nucleus showing unbalanced translocation 2p:12p leading to deletion of 2p region in siblings with autism. The yellow-green probe for 2p is present on 3 chromosomes; the red probe marks the presence of the 12q region on 2 chromosomes.
Figure 9–2. Genotyping console map of 12p containing the CACNA1C gene that is present in only 1 copy in siblings with autism (chromosomes illustrated in Fig. 9:1).
170
Phenotypic Variation
In reviewing genomic structural variation that is associated with mood and psychotic illness, Craddock et al. emphasized the importance of copy number variations (CNVs) that are rare in the general population (frequency less than 1%) and more common in a number of neuropsychiatric phenotypes including autism, mental retardation, and schizophrenia. Recurrent large CNVs in three chromosomal regions are more common in subjects with schizophrenia and they also occur in a low percentage of subjects with autism. These chromosomal regions are 1q21.1, 15q11.2, and 15q13.3. Chromosomal imbalance caused by copy number variation may involve deletions or duplications. Copy number changes detected in subjects with autism are shown in Fig. 9–3. They noted that autistic features have long been noted to be a feature of schizophrenia. In addition to involvement of specific chromosome regions, specific genes have been implicated in both schizophrenia and autism. These include CNTNAP2 (contactin associated protein-like 2) deletions that occur in schizophrenia and autism. Interestingly, CACNA1C abnormalities are also found in some cases of autism, in bipolar disease and in schizophrenia. Craddock et al. (2009) emphasized that there is a complex relationship between genotype and phenotype that likely involves many genes and environmental factors. They postulated that molecular genetic findings would help delineate the relationship between specific biological pathways and systems networks and psychopathology domains; they noted that psychopathology
Figure 9–3. Heat map of chromosome 15 obtained using Affymetrix 6.0 SNP array and genomic DNA from 5 different patients with autism. Note large copy number changes in specific regions, including increased copy number (lighter color) in 3 individuals and decreased copy number (darker color) in 2 individuals.
Neurobehavioral Disorders
171
domains that need to be captured in patient assessments include mania, depression, psychosis, autistic functioning, and global intellectual functions. They stressed the importance of continued development of tools to measures dimensions of psychopathology domains. Evidence for a Schizophrenia Locus or Loci on Chromosome 5q Genome-wide studies in families from the Portuguese islands including the Azores, carried out by Sklar et al. (2004) identified linkage of schizophrenia to a locus on chromosome 5 between D5S2112 and D5S820. Marker D5S820 at position 156.6 Mb was significantly linked when the subtype psychosis was assessed. Linkage studies on schizophrenia in the Finnish populations published by Paunio et al. (2001) yielded a significant lod score with the marker D5S820 on chromosome 5q33 at 151,215 K. Studies published by Gurling et al. (2001) reported evidence for linkage of schizophrenia and markers on 5q33.2. The chromosome band positions of the genomic region between 156 Mb and 177 Mb are 5q33-5q35. It is interesting to note that Kerner et al. (2007) reported evidence of linkage to 5q33-q34 of psychosis in pedigrees with bipolar disorder. Almasy et al. (2008) carried out studies of neurocognitive function and genetic linkage in 676 individuals with schizophrenia and in 236 healthy comparison individuals; test and control subjects were drawn from the USA population of European ancestry. Analysis of overall linkage studies revealed evidence for linkage of schizophrenia to a locus on chromosome 19q. However, in the specific neurocognitive domains of abstraction and mental flexibility they demonstrated significant linkage to a locus on chromosome 5q35 with a lod score of 3.425. The lod score profiles for abstraction, mental and verbal memory showed two peaks on chromosome 5q, one with marker D5S400 (163.540 K) and the other at D5S408 (174,711 K) (5q33). They concluded that analysis of quantitative trait loci in neurocognitive phenotypes might inform functional hypotheses regarding relationships of genotypes to disease.
COPY NUMBER VARIATION IN THE GENOME IN SCHIZOPHRENIA O’Donovan et al. (2008, and the International Schizophrenia Consortium) noted that the penetrance of copy number variants is often incomplete.
172
Phenotypic Variation
Expressivity varies, and the copy number variant may be associated with no phenotypic variation; it may be associated with mild anomalies or with severe anomalies including schizophrenia, autism, and mental retardation. These authors noted that schizophrenia and autism share risk factors. They proposed that schizophrenia and low IQ are pleiotropic effects of copy number variations. O’Donovan et al. emphasized that phenotype-based analyses of copy number variations may not capture the full range of pleiotropy for a specific CNV. They stressed the importance of depth of phenotype analysis in broad-based CNV analyses. O’Donovan et al. (2009) reported that several studies have found an increased burden of rare CNVs in schizophrenia and that the exact dimensions of this increase vary in different studies. They postulated that differences between studies might result from differences in the proportion of cases with early-onset or with lower IQ or the proportion of cases with no family history of schizophrenia. In the International Schizophrenia Consortium study of CNV there was a 1.6-fold increase of deletions greater than 500 kb in schizophrenia cases relative to controls. The study published by Stefansson et al. (2008) established that rare large deletions (greater than 400 kb) occurred with a frequency of 0.1% in controls and 1% in schizophrenia, and that these deletions were of large effect. There is evidence that the overall burden of CNV is increased in de novo cases of schizophrenia. O’Donovan et al. (2009) emphasized that it may be useful to integrate assessment of copy number variation and of single-nucleotide polymorphisms in patient studies. Copy number analyses and genome-wide association studies are shedding light on the genetic basis of psychiatric and behavioral disorders. These disorders have up to the present been classified into diagnostic categories on the basis of constellations of symptoms as defined for example in the Diagnostic and Statistical Manual of Mental Disorders (DSMIV). This mode of diagnosis has not yet been replaced by brain imaging studies including structural MRI, FMRI, PET (positron emission tomography) scan, or diffusion tensor tomography (DTT). Of particular interest are findings of genetic studies that have revealed that finding in a particular gene (e.g., disrupted in schizophrenia, or DISC1 gene) may lead to schizophrenia or manic-depressive illness. There is also a growing body of evidence that defects in specific chromosomal regions may lead to behaviors defined as autistic and to behaviors typical of attention deficit hyperactivity disorders. Furthermore defects in specific chromosome regions may be associated with autism in children and with schizophrenia in adults. Genetic findings are therefore beginning to change diagnostic paradigms.
Neurobehavioral Disorders
173
Green et al. (2009) reported that genome-wide association studies provide evidence for risk alleles that are common to schizophrenia and bipolar disorder. Based on meta-analysis of GWAS in bipolar disease, they determined that the gene CACNA1C on chromosome 12p13.3 has a true association that is statistically significant (p=7X10-8). They found an association with a related ion channel gene, CACNA1B, on chromosome 9q34 in the schizophrenia study. Their analyses support the conclusions that in liability to schizophrenia or bipolar disease there is an important polygenic contribution and that there is little evidence for common risk alleles. They emphasize that because of this polygenic contribution it is important that studies with very large subject numbers be carried out. In addition to these polygenic effects there is evidence that in some cases of schizophrenia in particular, de novo copy number variants occur and that these variants have high penetrance, so that the variant significantly increases the risk of the disorder.
DETERMINING SCHIZOPHRENIA ETIOLOGY THROUGH GENOME-WIDE ASSOCIATION STUDIES AND META-ANALYSES There is evidence that genetic and environmental factors and their interaction play a role in the etiology of schizophrenia (Stefansson et al., 2008). These authors noted that discovery of large copy number variations in schizophrenia and evidence that a specific copy number variant may be associated with schizophrenia in some patients and with other psychiatric diagnoses in other patients raise questions about classical diagnostic criteria. Stefansson et al. (2009) carried out genome-wide analyses of single-nucleotide polymorphic (SNP) markers in patients who carried the diagnosis of schizophrenia in two phases. In the first phase they performed genome-wide analyses on 2,663 schizophrenia cases and 13,498 controls from different European locations (SGENE study). They set the level of significance for disease and marker association at p> 1.6X10-7. No marker reached this significance in the first phase of the analysis. Twenty-five of the top scoring 1,500 markers were then screened in additional samples from Europe. Combined analyses revealed the three markers, all in the extended major histocompatibility complex (MHC) region on chromosome 6p21, achieved genome-wide significance in association with schizophrenia. In a further analysis that included European ancestry patient samples from the International Schizophrenia Consortium and the Molecular Genetics of
174
Phenotypic Variation
Schizophrenia Consortium, four other markers showed significance; two of these were located in the MHC region. One associated marker mapped to 11q24.2 and the other mapped to 18p21.2. Stefansson et al. (2009) reported that the schizophrenia-associated markers in the MHC region span five megabases of sequence but cover only 1.4 centimorgans (indicating that they seldom recombine and they are in linkagedisequilibrium). They analyzed classical HLA (histocompatibility locus) alleles to determine their possible association with the SNP alleles. One SNP, rs3131296, was associated with DRB1*03 and HLAB*08.A protective allele was identified. The authors noted that Li et al. in a study of trios (2001) reported undertransmission of the DRB1*03 allele to schizophrenia offspring. Stefansson et al. noted that the DRB1*03 allele and SNP rs313296 were reported as associated markers in a number of other disease studies, including type 1 diabetes, cardiac disease, and lupus erythrematosis. Interestingly, for those diseases the risk allele in rs313296 is the protective allele in schizophrenia. They concluded that the MHC locus association supports the hypothesis that infectious agents play a role in schizophrenia. The overall schizophrenia risk increases as a result of the presence of the risk allele in rs313296 is 1.20 to 1.25. The risk allele at the chromosome 11q24.2 locus increased schizophrenia risk by 1.15. This locus is 3,547 bases upstream of the neurogranin locus (NRGN). Neurogranin binds calmodulin in the pyramidal neurons of the hippocampus where it apparently serves as a reservoir for calmodulin. Calmodulin is a serine threonine protein kinase regulated by calcium. Stefansson et al. reported that the schizophrenia-associated marker on chromosome 18 occurs in the gene TCF4 that encodes a transcription factor that plays a role in brain development. Disruption of this gene was previously reported in a child with mental retardation. They conclude that discovery of common variants associated with schizophrenia may have potential for translation to therapy. In meta-analyses of data from the SGENE, International Schizophrenia Consortium, and Molecular Genetics of Schizophrenia case control sets carried out by Shi et al. (2009), significance was found for association of schizophrenia and markers in the extended MHC region. These investigators reported that the strongest association occurred at 6p22 within a region that encodes several immune function genes and a cluster of histone genes. They concluded that chromatin modification, transcription regulation, and immune response play roles in schizophrenia. In their meta-analysis from genome-wide association studies in the SGENE, International Schizophrenia Consortium, and Molecular Genetics of
Neurobehavioral Disorders
175
Schizophrenia case control sets, Purcell et al. (2009) concluded that the MHC marker rs3130375 showed highest significance. Their studies also implicated thousands of common alleles of small effect in schizophrenia etiology. They concluded that genome-wide association studies support a polygenic basis for schizophrenia. However there is also evidence that highly penetrant rare variants and copy number variation play roles. This group also carried out GWAS on bipolar disorder and concluded that specific SNP alleles may increase liability for schizophrenia and bipolar disorder.
NEUROBEHAVIORAL SYNDROMES AND CALCIUM ION CHANNELS There is evidence that L type voltage-gated calcium channels play an important modulatory role in brain function. Striessnig et al. (2006) reported that these calcium channels and NMDA receptors (N-methyl-D-aspartic acid activated) facilitate calcium entry and information on synaptic activation to the cell nucleus and transcriptional machinery. Particularly important consequences of channel activity are activation of transcription of genes in cyclic AMP responsive element binding protein (CREB) and RAS MAPK (mitogen activated protein kinase) signaling pathways. CREB is a transcription factor that impacts gene expression. The CREB pathway plays a key role in learning and memory and is implicated in depression. Striessnig et al. noted that CREB activation is under tight control of L type calcium channels (LTCC), as illustrated in studies on LTCC blockers such as dihydropyridine in cultured neuronal cells. They noted further that studies on hippocampal neurons revealed that calcium influx via type voltage-gated calcium channels, particularly Cav1.2, are important role in longterm potentiation that leads to MAPK pathway activation, CREB phosphorylation, and activation of CRE-dependent gene expression. Studies in mice indicate that Cav1.2 and Cav1.3 channels play a role in mood behavior. Tippens et al. (2008) used antibodies to localize Cav1.2 channels within the hippocampus. Their light microscopy studies revealed the presence of these channels in the soma of pyramidal cells and in dendritic fields in areas CA1 and CA3 regions of the hippocampus. Chan et al. (2009) reported that the substantia nigra neurons have a unique property they are autonomously active and generate action potentials in the absence of synaptic input. They postulated that this activity serves to maintain dopamine levels. A specific L type calcium ion channel, CACNA1D, enables
176
Phenotypic Variation
this pace-making activity. Energy for maintenance of channel activity and calcium homeostasis is dependent upon adenosine triphosphate generation. Chan et al. noted that calcium moves from cytoplasm to endoplasmic reticulum and it can then pass to mitochondria. They postulated that elevated intraluminal endoplasmic reticulum calcium might compromise the ability of the endoplasmic reticulum to fold and process proteins. They postulated that reducing the calcium flux with L type calcium antagonists might serve to slow progression of Parkinson’s disease.
CALCIUM SIGNALING IN AUTISM Krey and Dolmetsch (2007) reviewed calcium signaling pathways and their relevance to autism. They noted that in rare patients with autism, mutations occurred in voltage-gated or ligand-gated ion channels. They noted too that synapse activity requires regulated calcium signaling. There is growing evidence that autism is a developmental defect characterized by deficits in connectivity between brain areas. The current challenge is to identify genes that, when mutated, lead to impaired connectivity and give rise to autism. There are three reported studies of ion channel defects in subjects with autism. Heterozygous point mutations in the CACNA1C gene were reported in cases of Timothy syndrome, a disorder characterized by arrhythmias and autism. The CACNA1C gene encodes the alpha subunit of the Cav1.2 channel. The CACNA1C protein has 24 transmembrane segments that constitute the pore of the channel. Cav1.2 channels occur in dendrites and in cell bodies of neurons. They play a role in dendrite arborization and neuron survival and activate gene expression of transcription factors such as CREB and myelin expression factor (MEF2/MYEF2). Cav1.2 calcium ion channels in Timothy syndrome may remain open longer than normal. Krey and Dolmetsch noted that the developmental consequences of ion channel mutations have not yet been analyzed. Loss of function mutations in the CACNA1F subunit, encoded by a gene on Xp11.23, impact the Cav1.4 channels and lead to stationary night blindness while gain of function mutations in this gene lead to autism. Splawski et al. (2006) reported that loss of function mutations in the CACNA1H subunit, encoded by a gene on 16p13.3, impact Cav3.2 channels and occur more commonly in autistic subjects than in controls, and these mutations lead to decreased channel activity. Krey and Dolmetsch reported that activity of voltage-gated sodium and potassium channels, SCN1A, SCN2A, and KCNA1, are impacted by calcium
Neurobehavioral Disorders
177
concentrations and that activity of these channels is abnormal in some forms of autism. They noted that glutamate neurotransmitter receptors, GRIN2A and GRIK2, function as ligand-gated calcium channels and mutations in these receptors occur in some patients with autism. Alterations in gene copy number in the inhibitory GABA ergic (transmitting or secreting gamma amino-butyric acid) neuron system occur in some autistic patients. GABA receptors are involved in chromosome imbalances in the 15q11.2-q12 duplications or deletions.
STEROID SULFATASE DEFICIENCY: ATTENTION DEFICIT HYPERACTIVITY DISORDER (ADHD) AND AUTISM X-linked icthyosis occurs in one in 2,000 males. In this condition scaly skin occurs on the scalp, limbs, and trunk. It is caused by deficiency in the enzyme, steroid sulfatase (STS). Deficiency of function of this enzyme is screened for in prenatal patients. Deficiency of STS in the placenta (also known as placental sulfatase deficiency) leads to longer gestation, impaired cervical dilation, and labor complications. Kent et al. (2008) reported that in the majority of cases of STS deficiency, the entire gene is deleted and in some cases flanking genes are also deleted. In light of reports of ADHD and autism associated with deletions in the terminal regions of the short arm of the X chromosome, Kent et al. undertook an assessment of 25 boys with steroid sulfatase deficiency. Sixteen families were recruited to the study through finding very low levels of unconjugated estriol in maternal prenatal serum screening. Ten of the 25 boys recruited to the study met DSMIV criteria for ADHD, eight fulfilled criteria for the inattentive subtype. Of these eight, two had point mutations in STS, four had the typical STS deletion that extended from the flanking VCX3A gene to the VCX2 gene (variable charge genes) and included the STS gene. One had a larger deletion. Five of the 25 boys met criteria for autism spectrum disorders and language communication difficulty and had large deletions that encompassed STS and neuroligin 4 (NLGN4). Steroids, Neurosteroids, Neurophysiological, and Behavioral Processes Kent et al. (2008) noted that haplo-insufficiency of steroid sulfatase is associated with visual-spatial defects in mice. They noted that in addition to inattention a number of their patients manifested verbal dyspraxia. Sulfated dihydroepiandrosterone (DHEAS) is the substrate of steroid sulfatase and is
178
Phenotypic Variation
converted to DHEA in the reaction. DHEAS and DHEA are neurosteroids that impact neurophysiological and behavioral processes. Kent et al. noted further that there is evidence of an inverse relationship between blood DHEA levels and clinical symptoms in ADHD. They noted also that methylphenidate therapy for ADHD, administered over a period of three months, increases serum levels of DHEA and leads to clinical improvement. The term neurosteroids refers to steroid hormones that are synthesized in the brain cells from cholesterol, independently of endocrine organs. Neurosteroids include progesterone, allopregnanalone, dihydroepiandrosterone (DHEA) and its sulfate esters. Follow-Up Association Studies on ADHD and Steroid Sulfatase Brookes et al. (2008) genotyped seven SNPs in the steroid sulfatase gene in 384 families with ADHD. They then carried out the transmission disequilibrium test and determined that two SNPs at the 5’ end of the STS gene were significantly associated with ADHD. Of the 384 children, 318 were classified as ADHD combined type, 33 were inattentive subtype, and 36 had hyperactive subtype. Children with an IQ below 70 and children with autism were excluded from the study. SNP allele rs2770112C in intron 1 and allele rs12861247G in intron 2 showed overtransmission to affected boys; the significance was p=0.05. Data analysis in female probands revealed a higher frequency of homozygosity for the risk alleles than would be expected on the basis of the population frequency of the alleles. Brookes et al noted that the two risk alleles are in linkage disequilibrium.
CANNABIS AND THE ENDOCANNABINOID SYSTEM In a review of insights into mechanisms underlying cannabis-induced psychosis and its relationship to schizophrenia, Lutz (2009) noted that the effects of cannabis have been discussed in western countries for over a century, however only in the last 20 years have discoveries been made regarding cannabinoid receptors and endogenous ligands for these receptors. There is evidence that these receptors and their ligands play key roles in neurodevelopment. Studies in animals have revealed that brain morphological changes and behavioral changes occur in offspring of pregnant females exposed to cannabis containing drugs. Detailed pharmacological studies have revealed that cannabis
Neurobehavioral Disorders
179
consumption and the psychoactive component of cannabis delta-9-tetrahydrocannabinol lead to disruption of the endogenous endocannabinoid system. Lutz noted that endocannabinoids undergo much more rapid degradation than the drug ingredient delta-9-tetrahydrocannabinol. The latter then occupies receptors for a much longer period of time. There is evidence that use of cannabis during adolescence may impact brain maturation. Further, in a subset of individuals cannabis can induce a schizophrenia-like psychosis. Genetic underpinnings of this response are the subject of numerous studies. With respect to the contribution of cannabis abuse to development of schizophrenia, Lutz noted that evidence favors the hypothesis that cannabis consumption likely interacts with environmental and genetic factors to lead to this disorder. Henquet et al. (2008) reported that results of three large studies revealed the association of cannabis use during adolescence, and lifetime subclinical psychotic symptoms. These authors cited evidence that early patterns of cannabis use are more strongly influenced by environmental factors, whereas later abuse and dependence are more strongly influenced by genetic vulnerability. They considered the latter to be polygenic and related to personality (e.g., sensation-seeking personality). In studies on schizophrenia patients and healthy controls, D’Souza et al. (2005) demonstrated that an increase of both positive and negative psychotic symptoms occurred in both groups on exposure to a defined dose of delta9-tetrahydrocannabinol. An important difference between the two groups was the abnormal sensitivity of the patient group to the cognitive effects of the drug; these included impairments of memory, attention and executive function. The enzyme catechol-O-methyltransferase serves to inactivate dopamine, norepinephrine and epinephrine. In the prefrontal cortex, COMT is particularly important in dopamine degradation. The Val158 COMT allele has higher activity than the Met 158 COMT allele. Henquet et al. (2008) cited evidence that the COMT Val allele leads to reduced dopamine transmission in the prefrontal cortex. They determined that individuals with the COMT Val/Val genotype were most sensitive to the effects of cannabis that led to cognitive impairment and memory and attention deficit. Genetic variation in the cannabinoid receptor, CB1, and in the dopamine transporter, DAT1, may also impact responses to cannabis ingestion. Henquet et al. emphasized the need for further studies in this area. There is evidence that cannabis in drugs can impact cognitive processes through influences on the endocannabinoid system and its control of neuronal activity. Trezza et al. (2008) proposed that interference with processes regulated by the endocannabinoid system by exposure to cannabis drugs early in
180
Phenotypic Variation
development might contribute to disorders of the adult nervous systems. They noted that cannabinoid receptors are particularly abundant in brain regions involved in regulation of cognition and mood. These regions include cortex, amygdala, and hippocampus. Levels of endocannabinoid N-arachidonylethanolamine and 2-arachidononyglycerol are highly regulated during embryonic development. There is ongoing debate as to whether the cannabinoid receptor density and function play a role in schizophrenia. D’Souza et al. (2009) reported that there is increasing evidence that early and heavy cannabis exposure may increase the risk of developing a psychotic disorder. They expressed the opinion that cannabis use is a contributing factor in schizophrenia that interacts with other genetic and environmental risk factors in the etiology of this disorder.
10 MOLECULAR ANALYSES OF MALFORMATION SYNDROMES
CHARGE SYNDROME This Syndrome represents an example of a condition with a wide range of phenotypic abnormalities caused by defects in one gene that encodes a protein that regulates the expression of a number of different genes and plays a key role in development. Most cases of CHARGE syndrome are sporadic. In some cases a parent is mildly affected and the condition is transmitted as an autosomal dominant. CHARGE is an acronym to define the main features of the syndrome: coloboma, heart defects, choanal atresia, retardation of growth and development, genital anomalies, and ear anomalies. Sanlaville and Verloes (2007) reviewed this syndrome and reported that additional clinical findings have been added to the CHARGE spectrum; these include facial dysmorphology, abnormalities of the rhombencephalon (hindbrain that occupies the posterior fossa of the cranial cavity and lies below a fold of dura mater, the tentorium cerebelli), and arrhinencephaly (absence of the olfactory bulbs and tracts). In 15 to 20% of cases cleft lip and/or cleft palate are present.
181
182
Phenotypic Variation
Eye defects in CHARGE syndrome may include coloboma (a gap or hole in one of the structures in the eye, commonly in the iris), microphthalmia, in addition to optic nerve hypoplasia. Ears are often low-set, anteverted with reduced vertical height. Middle ear abnormalities may be present, and include hypoplasia of the incus, stapes, and foramen ovale; inner ear abnormalities may be present and include hypoplasia or absence of the semicircular canals. Deafness occurs in 60 to 90% of patients. In addition to choanal atresia (blockage of one or both posterior nasal passages) patients may manifest abnormalities of the larynx and glottis. Hindbrain abnormalities may occur, including hypoplasia of the cerebellar vermis, stenosis of the aqueduct of Sylvius. In some cases Dandy Walker abnormality may occur; this is a triad of abnormalities: complete or partial agenesis of the cerebellar vermis, cystic dilatation of the fourth ventricle, and enlargement of the posterior fossa of the skull. Gene Defect in CHARGE Syndrome The causative gene in CHARGE syndrome was identified following mapping of this syndrome to a specific chromosome region, 8q12. This map location was defined on the basis of microdeletions in two patients with the syndrome. Subsequently, a patient with CHARGE syndrome was found to have a translocation that disrupted chromosome 8q12 and a specific gene chromodomain helicase (CHD7), between exons 3 and 8. The CHD7 gene encodes a nuclear protein that is a member of the chromodomain family of proteins (CHD1 to CHD9). These proteins play a role in altering chromatin structure and transcription. The CHD7 protein has two chromodomains; these domains interact with histone, DNA, and RNA, and are involved in regulation of chromatin structure. CHD7 has one SNF2 domain that has ATPase activity and promotes hydrolysis of ATP to ADP. The helicase domain present in CHD7 plays a role in DNA recombination, replication, and transcription. The CHD7 gene product is active in a number of developmental pathways. Sanlaville and Verloes (2007) reported that mutations in CHD7 described in CHARGE patients occur throughout the gene. Lalani et al. (2006) carried out CHD7 analysis in 110 patients with CHARGE syndrome. They reported that in 73% of cases, mutations were truncating. In their study they identified a sibling pair with a specific CHD7 mutation born to parents who did not carry this mutation, thus confirming that germinal mosaicism occurs in some instances.
Molecular Analyses of Malformation Syndromes
183
There is some evidence for genetic heterogeneity in CHARGE syndrome. Disruptions and mutations in Semaphorin 3A (SEMA3E) have been reported in CHARGE syndrome patients. maps to chromosome 7q21.1. Proteins in the semaphorin family have a characteristic conserved domain of about 500 amino acids. These proteins are involved in embryonic development, and some behave as neural guidance molecules. It is important to note that a number of the specific phenotypic features of CHARGE syndrome may be encountered in other chromosome disorders.
JOUBERT SYNDROME (JS) AND JOUBERT-RELATED DISORDERS (JSRD) These malformation syndromes are examples of conditions with highly similar phenotypic manifestations resulting from defects in a number of different genes. Joubert syndrome is associated with midbrain and hindbrain malformations that involve the cerebellar vermis and cerebellar peduncles; meningoencephalocele malformations may also be present. In neuroradiological examinations a so-called “molar tooth” sign is present. This sign describes the appearance of the cerebellar malformation that is characteristic of this syndrome. Clinical features include oculo-motor apraxia (difficulty controlling eye movements), hypotonia, ataxia, episodic breathing dysregulation, particularly in the neonatal period, and psychomotor delay. In Joubert-related syndromes, patients have the clinical and radiological manifestations of Joubert syndrome and in addition they may manifest involvement of other organs and systems. Additional clinical features that may be present in patients with Joubert syndrome malformations include ocular colobomas, retinal abnormalities, congenital blindness, cystic kidneys, and polydactyly and behavioral abnormalities. Valente et al. (2008) reviewed Joubert syndrome. They reported that genome-wide mapping studies in two consanguineous Italian families revealed that the locus for this autosomal recessive form of the disorder mapped to chromosome 9qter and was designated as the JBTS1 locus. The phenotype in the JBTS1 families was fairly homogeneous, however the degree of psychomotor retardation present varied in different family members. A second Joubert syndrome locus JBTS2 was mapped to chromosome 11 on the basis of studies in families from Sicily, Turkey, the Middle East, and Pakistan. The JBTS3 locus was mapped to chromosome 6q through studies in families in Turkey and Switzerland. Valente et al. (2008) reported that seven
184
Phenotypic Variation
different genes have been found to have defects in different forms of Joubert syndrome and there is evidence that proteins involved in cilial function are defective in these disorders. In Joubert syndrome-related disorders, including Senior Loken syndrome, mutations occur in a number of different genes, including genes that encode nephrocystins NPHP1, NPHP3, NPHP4, NPHP5. Mutations in genes that encode retinitis pigmentosa GTPase regulator interacting protein (RPGRIP1L), centrosomal protein 290 (CEP290) and transmembrane protein 67 (TMEM67) also occur in specific patients with this syndrome. These genes play a role in assembly and stability of cilia or in transport within cilia. Senior Loken syndrome is characterized by renal cystic disease, renal failure, retinal disease, and blindness. Millen and Gleeson (2008) reported that NPHP1, CEP20, and RPGRIPL1 are localized in the basal body of primary cilia. Primary cilia are different than motile cilia. Primary cilia are present in cerebellar granule cell precursors and Purkinje cells. Dandy Walker malformation of the cerebellum occurs in a number of different genetic disorders and chromosome abnormalities. Millen and Gleeson noted that the molar tooth sign is unique to the cerebellar malformation that occurs in Joubert syndrome. The Dandy Walker malformation is characterized by severe hypoplasia of the cerebellar vermis and enlargement of the fourth ventricle. In rare cases, it is associated with chromosome abnormalities. It occurred in patients with chromosome 3q24 deletions and deletion of ZIC1 and ZIC4 genes. The latter are zinc finger genes that act as transcription factors that interact with Gli proteins (DNA binding factors) to modulate expression of genes in the Sonic Hedgehog (SHH) pathway, which plays an important role in developmental processes in the brain.
MUTATIONS IN A SINGLE GENE LEADING TO DIFFERENT HISTOLOGICAL PHENOTYPES: NEW INSIGHTS INTO THE GENETIC CODE Allamand et al. (2006) reported that four types of muscular dystrophy that were originally considered to be distinct entities turned out to result from mutations in a single gene. The four entities caused by a mutation in the selenoprotein N gene (SEPN1) include Rigid Spine muscular dystrophy, multiminicore disease, desmin-related muscular dystrophy with Mallory bodies, and recessive muscular dystrophy with fiber disproportion. Mallory bodies are inclusions
Molecular Analyses of Malformation Syndromes
185
composed of fibrillar and granular material. Multiminicore disease is associated with multiple areas of degeneration along the length of muscle fibers. SEPN1 maps to chromosome 1p36.13. Schara et al. (2007) reviewed the phenotypes in 11 patients with mutations in SEPN1. These patients present with muscular hypotonia and delayed motor development. Hypotonia may be associated with spinal scoliosis. Spinal rigidity is frequently present by 10 years of age. Respiratory impairment is often present by early adolescence. Schara et al. reported results of muscle biopsy in eight patients with SEPN1 mutations. In three patients, no histological changes were found in muscle biopsies. In two patients, minicores and multiminicores were found in biopsied muscle, and in one patient congenital fiber disproportion was noted. Creatine kinase levels were normal in eight of 11 patients studied. Nine different SEPN1 mutations were found in 11 patients. Seven of the 11 patients were compound heterozygotes with two different mutations, and in four cases the patients were homozygous for a specific SEPN1 mutation. The exact function of the protein encoded by SEPN1 gene was delineated in 2008. Jurynec et al. (2008) demonstrated that SEPN1 protein is physically associated with ryanodine receptors, and that it functions as a modifier of the ryanodine channel. They further demonstrated that SEPN1- and RYR1-encoded proteins modulate calcium release and that both are required for normal muscle development and differentiation. SEPN1 protein is particularly important for development of slow twitch muscle. Selenoproteins and Incorporation of Selenocysteines Selenium is most commonly inserted into proteins as the amino acid selenocysteine. Hatfield and Gladyshev (2002) reported that the genetic code was expanded to include the code for selenocysteine. In the original code, established in the 1960’s, of the 64 possible triplet arrangements of the nucleotides U, G and C and A in mRNA, 61 were identified as codes for 20 amino acids and three codes were identified as termination codes. The code AUG was found to have two functions: it initiated translation into protein and it coded for methionine insertion in internal protein regions. The triplet code, UGA, in mRNA (TGA in DNA) is now also recognized as a dual-function code; it acts as a termination codon and as the code for selenocysteine insertion into protein. In the open reading frame within the gene, the nucleotide sequence, TGA, encodes selenocysteine. An important question that was addressed through studies of Hatfield and Gladyshev (2002) related to the mechanism that leads the UGA signal to be
186
Phenotypic Variation
interpreted as a termination code in some instances and as the selenocysteine code in other cases. One important factor is the presence of specific elements, SECIS in the 3' untranslated gene region. Nucleotides within these elements give rise to a unique structure consisting of two helices and two loops. The spacing between the TGA code and the SECIS elements is of defined size, 51 to 111 nucleotides. SECIS elements recruit additional factors: a binding protein SBP2 (SECISBP2) and elongation factor (Efsec) that then recruit tRNAsec. SBP2 is attached to ribosomes. A specific tRNA, sec tRNA, exists for selenocysteine. It is 90 nucleotides long and is thus the longest eukaryotic tRNA. It also has an unusual structure. The amino acid selenocysteine is synthesized on its tRNA. Glutamine and asparagine are also synthesized on their specific tRNAs. Selenocysteines are located at various positions within selenoproteins. A number of selenoproteins that occur in mammals act as antioxidants. These include glutathione peroxidases (GPX), thioredoxin reductases, and methionine sulfoxide reductase. Selenocysteines are also present in thyroid hormone deiodinase. At least 12 other selenoproteins occur in mammals; the functions of many of them are not known. In selenium deficiency the concentrations of selenoproteins (e.g., GPX1) are reduced. Mutation in the selenocysteine insertion sequence (SECIS) that occurs at the 3' end of the SEPN1 genes led to a mild form of rigid spine muscular dystrophy in a patient described by Allamand et al. (2006). The mutation they described destroyed the SBP2 binding site of SECIS.
PHENOTYPIC OVERLAP: RELATED DYSMORPHOLOGY SYNDROMES CAUSED BY MUTATIONS IN DIFFERENT GENES IN A SPECIFIC PATHWAY Noonan syndrome, Costello syndrome, and cardio-facial cutaneous syndrome are developmental disorders that have phenotypic features in common and share a common etiological pathway. They arise as a result of germline mutations in the RAS MAP kinase (RAS oncogene and mitogen activated protein kinase) signal transduction pathway. Tidyman and Rauen (2008) reviewed these syndromes and noted that the associated mutations increased rates of signal transduction in this pathway. Developmental abnormalities that occur in these disorders include distinctive facial dysmorphology, cardiac defects, musculoskeletal and cutaneous abnormalities, and neurocognitive disorders. Tidyman and Rauen (2008) emphasized that the considerable phenotypic overlap between Noonan, Costello, and cardio-facial cutaneous syndromes make
Molecular Analyses of Malformation Syndromes
187
definitive diagnosis of each specific syndrome difficult, particularly in young infants. Phenotypic overlap occurs despite the fact that molecular genetic studies revealed that different genes are defective in these syndromes. Facial dysmorphology features common to Noonan syndrome, Costello syndrome and cardio-facial cutaneous syndrome include high forehead, relative macrocephaly, down-slanting palpebral fissures, hypertelorism, short nose, anteverted nares, and deep philtrum. Cardiac abnormalities common to the three syndromes include pulmonary valve stenosis, septal defects, and cardiomyopathy. Patients often manifest failure to thrive and have short stature. Neurological features include hypotonia, speech delay, and learning disabilities. In the brain, Chiari malformation may occur with downward displacement of the cerebellar tonsils and medulla toward the foramen magnum. This malformation sometimes leads to hydrocephalus. Dermatological abnormalities include pigmentation anomalies (e.g., café au lait macules) and hyperkeratosis are common. The hair texture is frequently unusual and hair is brittle. Childhood malignancies including leukemia and rhabdomyosarcoma are more common in patients with these syndromes than in the general population. Mutations that cause these syndromes usually arise de novo. Genes involved in Noonan syndrome include PTPN11, SOS, RAF1, and KRAS. Tartaglia et al. (2001) reported that 50% of patients with Noonan syndrome have PTPN11 mutations. The PTPN11 gene on chromosome 12q24.1 encodes a nonreceptor protein tyrosine phosphatase (SHP2). Mutations in RAS, RAF1, or KRAS may also lead to Noonan syndrome. PTPN11 mutations also occur in cases of LEOPARD syndrome. This syndrome shares features with Noonan syndrome such as facial dysmorphology, congenital heart defects, and pigmentation changes. LEOPARD is an acronym for the major abnormalities: lentigenes, (freckling) ECG abnormalities, ocular hypertelorism, pulmonary stenosis, abnormalities of genitalia, growth retardation, and deafness. Cognitive impairment is often mild in this syndrome. The cardiac malformations in this syndrome include pulmonary stenosis or subvalvular aortic stenosis associated with progressive obstructive cardiomyopathy. Specific PTPN11 mutations have been identified in Noonan syndrome E139D, I202V, and Y279C; these mutations lead to up-regulation of activity of the PTPN11-encoded protein SHP2 (Martinelli et al., 2008). SHP2 acts as a transducer in the RAS MAP kinase–MEK signaling pathway. Mutations in the BRAF1 gene occur in a subset of Noonan and LEOPARD syndrome patients an in cardio-facial cutaneous syndrome. BRAF encodes a regulator of the RAS MAP kinase–MEK signaling pathway.
188
Phenotypic Variation
RAS MAP Kinase Pathway Members of the RAS gene family encode small G proteins that play a role in conveying signals from stimulated cell surface receptors to cytosolic components and to the nucleus of the cell. They constitute molecular switches involved in cell differentiation, cell proliferation, and cell survival (Aoki et al., 2008). Key RAS genes that encode proteins involved in the RAS MAP kinase pathway include RAS, HRAS, and KRAS. Following activation of cell surface receptors, tyrosine kinase signaling transducers, including SHP2, SHC, GBR2, and SOS1, activate RASGTP exchange factors RAS GEF. Those factors lead RAS and RAS-like proteins to cycle between inactive RASGDP and active RAS RASGTP. Activated RAS then recruits RAF kinases (CRAF and BRAF) that phosphorylate MAP kinases MAPK1 and MAPK2 (also known as MEK1 and MEK2). These then phosphorylate ERK1 and ERK2 kinases that are the terminal effectors in the pathway and they act by phosphorylation of cytosolic and nuclear targets.
NEUROFIBROMATOSIS AND NEUROFIBROMATOSIS-LIKE PHENOTYPE: DEFECTS IN THE RAS SIGNALING PATHWAY Neurofibromin, encoded by the Neurofibromatosis 1 gene (NF1) acts as a RAS GTPase and down-regulates RAS activity. The gene SPRED1 encodes a product that acts as a negative regulator of the RAS–RAF interaction. Mutations in the SRED1 gene have recently been found to cause a Neurofibromatosis-like syndrome. Brems et al. (2007) described families with an autosomal dominant disorder characterized with Neurofibromatosis-like features, including café au lait spots, axillary freckling, and macrocephaly. In addition, the patients manifested Noonan-like facial dysmorphology. No NF1 mutations were identified in the affected members. Linkage analyses revealed that the disease gene in these patients segregated with markers on chromosome 15q13-q14, between 31 and 44 megabases. The SPRED1 gene maps in this interval. This gene encodes a product that plays a role in RAS–RAF interaction and Brems et al. (2007) considered it a possible candidate gene for the Neurofibromatosis-like disorder. They carried out mutation analysis and identified different mutations in SPRED1 in five different families. The mutations included exon-skipping mutations, nonsense and missense mutations.
11 MULTIPLE PATHWAYS INCLUDING ENVIRONMENTAL FACTORS THAT LEAD TO A SPECIFIC PHENOTYPE WITH LATER ONSET
PARKINSON’S DISEASE (PD) The characteristic feature in this disease is degeneration of dopaminergic neurons in the substantia nigra. Degeneration of other neurons, particularly in the brain stem, may occur. The phenotypic features of Parkinson’s disease include slowed movements, tremor, and rigidity after loss of 50 to 70% of the dopaminergic neurons. In some patients there may be autonomic dysfunction and cognitive impairment. Insight into pathogenesis of sporadic Parkinson’s disease was achieved through findings of specific gene defects that lead to monogenic forms of Parkinson’s disease. In a review, Lesage et al. (2009) noted that defects at more than 30 different gene loci lead to this disorder. At a number of these gene loci heterozygous deletions, rearrangements or mutations increase the risk for this disease. Synuclein The synuclein gene (SNCA) on chromosome 4q21 was identified and characterized following linkage studies in Parkinson’s disease (Polymeropoulos, 1998). Copy number changes or mutations in this gene may lead to Parkinson’s disease. 189
190
Phenotypic Variation
SNCA copy number variants are most often familial, however in some cases they arise de novo and are present in a sporadic case of Parkinson’s disease. Rare missense mutations in SNCA may lead to Parkinson’s disease. Synuclein gene defects account for 2% of cases of Parkinson’s disease. However, synuclein protein is a major component of Lewy bodies, a characteristic neuropathology finding in PD (Lesage & Brice, 2009). Ross et al. (2008) undertook detailed genomic and phenotypic studies in five families with Parkinson’s disease and increased copy numbers of the 4q21 chromosome segment that contained the synuclein gene. Their studies included fluorescence in situ hybridization (FISH) with probes within the SNCA gene. They carried out genotype analyses using single-nucleotide polymorphism (SNP) microarrays and microsatellite repeat markers. Their studies revealed differences in the length of the copy number variant in different families. The longest region of duplication encompassed 4.93 to 4.97 megabases and was found in a French family. This duplication included 31 different gene loci. The shortest region of duplication encompassed 0.4 Mb and occurred in a Japanese family. Phenotype–genotype correlations in these five families revealed that the duplication of SNCA was the most important contributing factor and there was no evidence that copy number changes in the adjacent genes impacted the phenotype. Microsatellite marker studies indicated that the duplication event in each family could have arisen by intraallelic segmental duplication or by interallelic recombination with unequal crossing over. Ross et al. (2008) reported that in families with triplication of the SNCA locus, disease was of earlier onset and it progressed much more rapidly. In families with the SNCA triplication, the average age of onset of Parkinson’s disease symptoms was 31 to 34 years, whereas in SNCA duplication families it was 49 years. Symptoms of slowed movement (bradykinesia), tremor, and postural instability were common in both patient groups. However, autonomic symptoms, including orthostatic hypotension, dysphagia, and incontinence were more common in the earlier-onset SNCA triplication patients. These investigators noted that there are reports of individuals in whom de novo increases in SNCA copy numbers occurred, leading to Parkinson’s disease. Lewy Bodies and Alpha Synuclein Alpha synuclein is a key component of Lewy bodies and Lewy neurites, which are characteristic features of Parkinson’s disease. However, they also occur in familial and sporadic Alzheimer’s disease, in Lewy body dementia, and in
Multiple Pathways Including Environmental Factors
191
progressive autonomic failure. Alpha synuclein polymerizes and gives rise to fibrils that constitute the key Lewy body component. Waxman and Giasson (2009) reviewed the molecular mechanism of synuclein-related neurodegeneration. The native alpha synuclein protein is a soluble unfolded protein that occurs at presynaptic terminals close to synaptic vesicles. These investigators reported that synuclein gene knockout mice survived and that there was no evidence of abnormal neuronal development in these mice. A key factor in generation of Parkinson’s disease is overexpression of alpha synuclein. Neuronal damage is particularly marked in individuals with triplication of the alpha synuclein gene. There is also evidence that specific mutations in alpha synuclein lead to polymerization of alpha synuclein into filaments. Waxman and Giasson noted that alpha synuclein filaments give rise to aggregates that likely impair proteasome function. These aggregates also bind other proteins and may constitute a “protein sink” that leads to depletion of proteins and impaired cellular function. Leucine-Rich Kinase 2 (LRRK2) LRRK2 is a large gene of 144 kb with 31 exons. It encodes a 2,527-amino-acid protein. Parkinson’s disease results from missense mutations in this gene. Estimates are that 10% of familial cases and 3.6% of sporadic cases of Parkinson’s disease result from LRRK2 mutations. A number of frequent mutations occur in this gene; G2019S mutations account for 30 to 40% of cases of Parkinson’s disease in North African and Ashkenazi Jewish patients and in 2.5% of European patients. This mutation occurs on three different haplotypes, indicating that it arose at least three times. Lesage et al. (2009) reported that the penetrance of the LRRK2 mutations is approximately 17% at age 50 years and 85% at age 70 years. Of particular interest is the fact that the dosage of the LRRK2 mutation (i.e., heterozygosity or homozygosity) does not affect penetrance. Key functional domains in the LRRK2 protein include a kinase domain close to the 3’ end of the gene and a GTPase domain. In addition, this protein contains leucine-rich repeat domains that may be involved in protein–protein interactions. Moore (2008) reported that GTP binding to the LRRK2 GTPase domain enhances the kinase activity of LRRK2, while GDP represses its activity. He noted further that the most frequent Parkinson’s-disease-associated mutations enhance LRRK2 activity. These mutations include R1441C, R1441G, and R1441H that occur in the GTPase domain, and G2019S and I2020T that occur in the kinase domain. These mutations also alter the cellular distribution of LRRK2. Wild-type LRRK2 protein usually exhibits diffuse distribution.
192
Phenotypic Variation
Mutant LRRK2 protein occurs in larger cytoplasmic inclusions. Studies on the structure of these inclusions revealed that they contained damaged lysosomes, mitochondrial and cytoskeletal elements, and that they were membrane-bound. Moore (2008) postulated that LRRK2 mutations lead to nigra-striatal degradation through apoptosis. In some but not all cases with LRRK2 mutations, alpha synuclein accumulates in Lewy bodies. There is evidence that hydrogen peroxide, oxidative stress, and nitrosative stress stimulate LRRK2 GTP bindings and kinase activity. Moore noted that the physiological role of LRRK2 is not definitively known, however there is some evidence that it plays a role in synaptic vesicle sorting and transport. Population Distribution of LRRK2 Mutations The G2019S and T1441C mutations are widespread across the world; the R1441G mutation is most prevalent in the Basque country in northern Spain. Mata et al. (2009) performed haplotype analysis in 81 control individuals and in 29 unrelated Basque patients with Parkinson’s disease who were heterozygous for the R1441G mutation. They used SNPs and microsatellite markers. Results of their analyses revealed that R1441G mutation carriers shared a rare 10-marker haplotype that extended over 5.8 Mb. They used a computer program, Estrage, to determine the age of the most recent common ancestor from whom this haplotype could have been derived. For this determination, the program utilizes information on the overall population frequency of the shared alleles, information on recombination between each marker, and mutation rates to calculate the number of generations since the Parkinson’s mutation arose in that population. They determined that it most likely arose in the seventh century of the Common Era and that dispersion occurred through short-range gene flow. The LRRK2 G2019S mutation likely arose in the Middle East and then spread across northern Africa, Europe, and the Americas. Mata et al. noted that the spread might have been related to the Jewish Diaspora. Early-Onset Parkinson’s Disease Kufor Rakeb syndrome is an early-onset Parkinson’s disease that is associated with pyramidal degeneration and dementia. It is inherited as an autosomal recessive disease. Typical Parkinson’s disease symptoms occur, including bradykinesia and development of a mask-like face, between the ages of 11 and 16 years. These symptoms show improvement with L-DOPA therapy. Patients with this syndrome also manifest symptoms not usually present in Parkinson’s disease; these include spasticity resulting from corticospinal tract
Multiple Pathways Including Environmental Factors
193
degeneration, supra-nuclear gaze, paresis, and dementia. Hampshire et al. (2001) carried out homozygosity mapping using polymorphic microsatellite markers and established that in four affected subjects from a consanguineous pedigree, the disease segregated with a 9 centimorgan (cm) region on chromosome 1p36. Ramirez et al. (2006) identified a nonconsanguineous Chilean family with 11 children, four of whom were affected with Kufor Rakeb syndrome. They mapped the disease gene to a region of 6.6 cm on 1p36 that contains 40 genes. Within this region they identified a candidate gene, ATP13A2. They established that the mother in the family was heterozygous for a deletion in exon 26 of ATP13A2. This deletion led to a frameshift that generated a premature stop codon. The father was heterozygous for a donor splice site mutation adjacent to exon 13, leading to exon 13 skipping. Ramirez et al. (2006) also carried out sequencing in a consanguineous Jordanian family, which was the first family described with Kufor Rakeb syndrome. They established that affected individuals in this family were homozygous for a duplication of 22 nucleotides in ATP13A2. Studies on ATP13A2 mRNA expression in the brain from controls revealed highest expression in the ventral midbrain and in the substantia nigra. Analysis of subcellular expression of ATP13A2 protein revealed that it colocalized with lysosomal membrane proteins. Ramirez et al. determined that the mutant forms of this protein were unstable and that they were retained in the endoplasmic reticulum. ATP13A2 is necessary for proper functioning of the lysosomal autophagy pathway. Interaction of Nuclear and Mitochondrial Gene Products in the Etiology of Parkinson’s Disease Synuclein protein has a mitochondrial targeting sequence. Cole et al. (2008) reported that under conditions of oxidative stress or metabolic stress that lead to lowering of cellular pH, alpha synuclein undergoes translocation from cytosol to mitochondria. Binding of synuclein to mitochondrial cardiolipin likely facilitates the translocation. There is evidence that synuclein impairs mitochondrial function.
COMPLEMENT FACTOR: GENE–ENVIRONMENT INTERACTIONS AND PHENOTYPIC EFFECTS Complement in the alternate pathway plays a role in the removal of immune complexes and of damaged cells. Complement factor H (CFH) is a key factor
194
Phenotypic Variation
for regulation of the alternate complement pathway. In fluid phase and on cell surfaces it restricts excessive activation of that pathway. Specific CFH variants also play a role in the etiology of eye conditions including age-related macular degeneration and basal laminar drusen. There is evidence that a specific risk allele leading to a Y204H change in the complement factor H protein significantly impacts the frequency of age-related macular degeneration. The Y204H allele results from the presence of a C allele at SNP rs1061170. This risk allele is also associated with an increased risk for peripheral retinal pigmentation changes. (Hecker et al., 2009). The CFH gene is located in a region of chromosome 1q32 that includes five CFH-related genes (CFHR1 to CFHR5). There is a high degree of homology between different genes and they may each impact immune function. Genetic variants that lead to increased activation of complement are associated with age-related macular degeneration. In a comprehensive analysis of the genetic and environmental effects on age-related macular degeneration, Seddon et al. (2009) reported that smoking is an independent risk factor with a multiplicative joint effect with genotype. CFH Mutations in Membrano-Proliferative Glomerulonephritis and Atypical Hemolytic Uremic Syndrome Membrano-proliferative glomerulonephritis is responsible for 4 to 7% of cases of primary renal nephritic syndrome. This condition may occur in individuals with homozygous or compound heterozygous mutations in CFH (de Cordoba & de Jorge, 2008). Hemolytic Uremic Syndrome (HUS) Hemolytic uremic syndrome comprises a triad of manifestations including microangiopathic hemolytic anemia, thrombocytopenia, and renal failure caused by thrombi in the renal microcirculation. This disease usually has a favorable outcome with appropriate treatment. Shiga toxin produced by E.Coli strain O157:H7 (STEC) most commonly triggers this syndrome. The toxin attacks endothelial cells leading to damage of small blood vessels and to glomerular damage. The toxin inactivates a metallo-proteinase (ADAMTS13) leading to platelet aggregation. Deficiency of ADAMTS13, a disintegrin and metalloproteinase with thrombospondin motif, leads to thrombotic thrombocytopenic purpura, acquired or congenital (Zheng & Sadler, 2008). Deficiency of this enzyme may also predispose to hemolytic uremic syndrome. Defective activity of CFH (often caused by presence of
Multiple Pathways Including Environmental Factors
195
auto-antibodies) may increase the risk of hemolytic uremic syndrome (Strobel et al., 2009). Atypical hemolytic uremic syndrome occurs in cases where E.coli infection and Shiga toxin exposure can be excluded and it has a poorer outcome. It is estimated that 80% of patients with atypical HUS have underlying genetic disorders and, of these, 20 to 30% of patients have complement factor H mutations (Boon et al., 2009). The atypical HUS-causing mutations usually cluster in a repeat element, SCR20, in the C terminal gene region. Genomic Architecture in the CFH Gene Region The complement factor H gene encodes a protein with 20 repetitive units, each with 60 amino acids. This gene is a member of a gene cluster on chromosome 1q32. This gene cluster also encodes five highly homologous complement factor F related genes, CFHR1 to CFHR5. The CFHR3 and CFHR1 genes are closest to CFH followed by CFHR4, CFHR2, and CFHR5 (Boon et al., 2009). The CFHR genes were derived from CFH through duplication, nonallelic recombination, and gene conversion. Rearrangements of genes within this cluster lead to deletion of specific genes and to the generation of abnormal fusion genes. The deletions of CHFR genes may have deleterious effects. However the CHFR1 to CHFR3 gene deletion constitutes a polymorphic variation and has been associated with decreased risk of age-related macular degeneration. This same deletion may however have deleterious effects in that it appears to be associated with an increased risk of hemolytic uremic syndrome and with the presence of antibodies to CFH (Abarrategui-Garrido et al., 2009). These authors undertook genomic DNA analyses, expression studies, and analysis of plasma proteins in their studies on hemolytic uremic syndrome since the complexity of gene structure in the RCA cluster poses difficulties for characterization of defects in specific genes. On the basis of their studies they concluded that the reported association of deletion CFHR1 to CFHR3 with increased risk of atypical hemolytic uremic syndrome (aHUS) holds true only for homozygous carriers of this deletion. They also established that a significant number of individuals who are homozygous for the CFHR1 to CFHR3 deletion are positive for antibodies to complement factor H. They discovered two patients with aHUS who had antibodies to CFH1 and were homozygous for CFHR1 deficiency only. They further established that five of seven aHUS patients with antibodies to CFH had three different genetic alterations, including deletion and CFHR1-nonsense mutations.
196
Phenotypic Variation
Auto-antibodies against CFH1 commonly recognize a specific region on that protein encoded by the short consensus repeats SCR19 and 20. These repeats are also present in CHFR1. Abarrategui-Garrido et al. (2009) determined that there a two different allotypes of CFHR1 designated A and B that differ by three amino acids within the SCR3 domain. This difference leads the CFHR1B allele to have the highest sequence similarity to CFH. The CFHR1B allele is strongly associated with aHUS when it is present in homozygous form.
EPILOGUE
“The optimism of science is two-fold: that its methods might reveal, one tiny pixel at a time, more of the wonder of the natural world, and that this knowledge might be able to solve practical human problems. There is abundant evidence in both cases that this optimism is justified.” —Georgina Ferry (2009)
The main substance of this book deals with functional genomics, defined as the elucidation of the cascade of events that lead from the genome and gene expression to the phenotype. Functional genomics includes genomic architecture, definition of genes and their variation, gene expression and its regulation. We now have the capacity, at least at the DNA level, to look back at other evolutionary forms, and to use information garnered from DNA differences to try to infer how specific DNA changes alter specific aspects of the phenotype. Information on genomic architecture includes data on structural variation generated by recombination, gene duplication, insertions, inversions, and deletions. It is these processes that impact protein structure leading to development of new proteins and proteins with new domains. Phenotype and phenotypic variation are ultimately directly related to protein variation and their functional domains and modification. 197
198
Phenotypic Variation
The availability of genome sequence information and the ability to readily identify mutations is now coupled to enhanced methods to examine effects of altered products or product deficiency, in vitro, in patients or in model systems. These studies provide insight into the functional roles of specific genes in pathways, in specific organelles and structures and in tissues. We now have the coming together of genomics, proteomics, and increased capacity to analyze gene expression and function through ability to introduce genes, knock out genes or silence gene expression. Introduction of green fluorescent protein-encoding elements into genes enables analysis of the spatial and temporal protein expression. Quantitative variation, caused by variation in levels of gene expression, likely plays a key role in specific aspects of phenotypic variation. Our understanding of gene regulation and quantitative aspects of gene expression lags behind our knowledge of genome sequence and genomic architecture. Increasingly, evidence in support of the importance of non-protein-coding DNA on gene regulation and ultimately on phenotype comes in part from genome-wide association studies. Such studies have led to the identification of association between specific phenotypes or diseases and specific polymorphisms in non-protein-coding DNA sequence, often located at some distance from the relevant protein-coding gene. Functional genomics also encompasses aspects of transcription and translation and takes into account alternate transcription start sites and termination sites, and alternate splicing. The alternate processes lead to generation of alternative isoforms that differ in their temporal and spatial location in the organism. Isoforms derived from a specific gene may also vary in their function and in their molecular interactions within biochemical and physiological pathways. Availability of genome DNA sequence and transcriptome information facilitates more comprehensive analysis of gene expression and its control. The control may be exerted at the level of promoters, alternate promoters, and regulation of transcript production through stalling of polymerases at promoters. Sequence analysis also continues to reveal previously undiscovered regulators of gene expression, including enhancers and transcription factors. Regulation of cellular processes is also dependent on the turnover of synthesized proteins, including transcription factors. Phenotypic aberrations result from disruption of breakdown processes. New evidence is emerging on proteolysis and autophagy, disruption of these processes and their consequences. A number of late-onset diseases result from impaired proteolysis or autophagy.
Epilogue
199
Analysis of the mitochondrial genome and of nuclear mitochondrial interactions continue to provide key insights into bioenergetics, metabolism, and gene–environment interactions that impact these processes. The phenotype results in part from gene–environment interactions. In this regard, it is important to consider aspects of nutrients, transfer of molecules across membranes, signaling and interactions with chromatin that modify gene expression (i.e., epigenetics). Genetic variation also affects the outcome of interactions of host and infectious agents and the impact of environmental stresses on the host. The long-term goal is to use information garnered from functional genomic analyses to design therapeutic and preventive strategies to mitigate effects of disease causing mutations and adverse gene environment interactions.
REFERENCES
Abarrategui-Garrido, C., Martinez-Barricarte, R., Lopez-Trascasa, M., de Cordoba, S.R., Sanchez-Corral, P. Characterization of complement factor H-related (CFHR) proteins in plasma reveals novel genetic variations of CFHR1 associated with atypical hemolytic uremic syndrome. Blood. 2009;114:4261–71. Abrahams, B.S., Tentler, D., Perederiy, J.V., Oldham, M.C., Coppola, G., Geschwind, D.H. Genome-wide analyses of human perisylvian cerebral cortical patterning. Proc Natl Acad Sci U S A. 2007;104:17849–54. Alarcon, M., Abrahams, B.S., Stone, J.L., Duvall, J.A., Perederiy, J.V., Bomar, J.M., Sebat, J., Wigler, M., Martin, C.L., Ledbetter, D.H. et al. Linkage, association, and gene-expression analyses identify CNTNAP2 as an autism-susceptibility gene. Am J Hum Genet. 2008;82:150–59. Albrecht, S., Bourdeau, M., Bennett, D., Mufson, E.J., Bhattacharjee, M. and LeBlanc, A.C. Activation of caspase-6 in aging and mild cognitive impairment. Am J Pathol. 2007;170:1200–9. Alderton, G.K., Joenje, H., Varon, R., Borglum, A.D., Jeggo, P.A., O’Driscoll, M. Seckel syndrome exhibits cellular features demonstrating defects in the ATRsignalling pathway. Hum Mol Genet. 2004;13:3127–38. Allamand, V., Richard, P., Lescure, A., Ledeuil, C., Desjardin, D., Petit, N., Gartioux, C., Ferreiro, A., Krol, A., Pellegrini, N. et al. A single homozygous point mutation in a 3’ untranslated region motif of selenoprotein N mRNA causes SEPN1-related myopathy. EMBO Rep. 2006;7:450–54.
200
References
201
Almasy, L., Gur, R.C., Haack, K., Cole, S.A., Calkins, M.E., Peralta, J.M., Hare, E., Prasad, K., Pogue-Geile, M.F., Nimgaonkar, V. et al. A genome screen for quantitative trait loci influencing schizophrenia and neurocognitive phenotypes. Am J Psychiatry. 2008;165:1185–92. Andersson, M.K., Stahlberg, A., Arvidsson, Y., Olofsson, A., Semb, H., Stenman, G., Nilsson, O., Aman, P. The multifunctional FUS, EWS and TAF15 proto-oncoproteins show cell type-specific expression patterns and involvement in cell spreading and stress response. BMC Cell Biol. 2008;9:37. Aoki, Y., Niihori, T., Narumi, Y., Kure, S., Matsubara, Y. The RAS/MAPK syndromes: novel roles of the RAS pathway in human genetic disorders. Hum Mutat. 2008;29:992–1006. Attardi, G. The elucidation of the human mitochondrial genome: a historical perspective. Bioessays. 1986;5:34–39. Azzi, S., Rossignol, S., Steunou, V., Sas, T., Thibaud, N., Danton, F., Le Jule, M., Heinrichs, C., Cabrol, S., Gicquel, C. et al. Multilocus methylation analysis in a large cohort of 11p15-related foetal growth disorders (Russell Silver and Beckwith Wiedemann syndromes) reveals simultaneous loss of methylation at paternal and maternal imprinted loci. Hum Mol Genet. 2009;18:4724–33. Baines, C.P. The mitochondrial permeability transition pore and ischemia-reperfusion injury. Basic Res Cardiol. 2009;104:181–88. Ballif, B.C., Sulpizio, S.G., Lloyd, R.M., Minier, S.L., Theisen, A., Bejjani, B.A., Shaffer, L.G. The clinical utility of enhanced subtelomeric coverage in array CGH. Am J Med Genet A. 2007;143A:1850–57. Bannerman, D.M., Rawlins, J.N., McHugh, S.B., Deacon, R.M., Yee, B.K., Bast, T., Zhang, W.N., Pothuizen, H.H., Feldon, J. Regional dissociations within the hippocampus:memory and anxiety. Neurosci Biobehav Rev. 2004;28:273–83. Barch, D.M. What can research on schizophrenia tell us about the cognitive neuroscience of working memory? Neuroscience. 2006;139:73–84. Bechara, E.G., Didiot, M.C., Melko, M., Davidovic, L., Bensaid, M., Martin, P., Castets, M., Pognonec, P., Khandjian, E.W., Moine, H. et al. A novel function for fragile X mental retardation protein in translational activation. PLoS Biol. 2009;7:e16. Bekris, L.M., Galloway, N.M., Montine, T.J., Schellenberg, G.D., Yu, C.E. APOE mRNA and protein expression in postmortem brain are modulated by an extended haplotype structure. Am J Med Genet B Neuropsychiatr Genet. 2010;153B(2): 409–17. Bell, J. Treasury of Human Inheritance . London, England: Cambridge University Press Vol I, parts 1–7 1909–1912; Vol II parts 1–5 1922–1932; Vol III part 1 1925; Vol IV parts 1–5 1934–1947 Vol V Parts 1–3 1951–1958 Bender, A., Krishnan, K.J., Morris, C.M., Taylor, G.A., Reeve, A.K., Perry, R.H., Jaros, E., Hersheson, J.S., Betts, J., Klopstock, T. et al. High levels of mitochondrial DNA deletions in substantia nigra neurons in aging and Parkinson disease.Nat Genet. 2006;38(5):515–17. Beniaminov, A., Westhof, E., Krol, A. Distinctive structures between chimpanzee and human in a brain noncoding RNA. RNA. 2008;14:1270–75. Ben-Shachar, D. The interplay between mitochondrial complex I, dopamine and Sp1 in schizophrenia. J Neural Transm. 2009;116:1383–96.
202
References
Bijlsma, E.K., Gijsbers, A.C., Schuurs-Hoeijmakers, J.H., van Haeringen, A., Fransen van de Putte, D.E., Anderlid, B.M., Lundin, J., Lapunzina, P., Perez Jurado, L.A., Delle Chiaie, B. et al. Extending the phenotype of recurrent rearrangements of 16p11.2: deletions in mentally retarded patients without autism and in normal individuals. Eur J Med Genet. 2009;52:77–87. Birchmeier, C. ErbB receptors and the development of the nervous system. Exp Cell Res. 2009;315:611–18. Blanco-Arias, P., Sargent, C.A., Affara, N.A. Protocadherin X (PCDHX) and Y (PCDHY) genes; multiple mRNA isoforms encoding variant signal peptides and cytoplasmic domains. Mamm Genome. 2004;15:41–52. Bogaerts, V., Theuns, J., van Broeckhoven, C. Genetic findings in Parkinson’s disease and translation into treatment: a leading role for mitochondria? Genes Brain Behav. 2008;7:129–51. Boon, C.J., van de Kar, N.C., Klevering, B.J., Keunen, J.E., Cremers, F.P., Klaver, C.C., Hoyng, C.B., Daha, M.R., den Hollander, A.I. The spectrum of phenotypes caused by variants in the CFH gene. Mol Immunol. 2009;46:1573–94. Bossy-Wetzel, E., Barsoum, M.J., Godzik, A., Schwarzenbacher, R., Lipton, S.A. Mitochondrial fission in apoptosis, neurodegeneration and aging. Curr Opin Cell Biol. 2003;15:706–16. Branden, C., Tooze, J. Introduction to Protein Structure 1998; Garland Publishing Inc. New York NY. Bradley, B.J. Reconstructing phylogenies and phenotypes: a molecular view of human evolution. J Anat. 2008;212:337–53. Bradshaw, N.J., Ogawa, F., Antolin-Fontes, B., Chubb, J.E., Carlyle, B.C., Christie, S., Claessens, A., Porteous, D.J., Millar, J.K. DISC1, PDE4B, and NDE1 at the centrosome and synapse. Biochem Biophys Res Commun. 2008;377:1091–96. Brand, M.D., Affourtit, C., Esteves, T.C., Green, K., Lambert, A.J., Miwa, S., Pakay, J.L., Parker, N. Mitochondrial superoxide: production, biological effects, and activation of uncoupling proteins. Free Radic Biol Med. 2004;37:755–67. Brems, H., Chmara, M., Sahbatou, M., Denayer, E., Taniguchi, K., Kato, R., Somers, R., Messiaen, L., De Schepper, S., Fryns, J.P. et al. Germline loss-of-function mutations in SPRED1 cause a neurofibromatosis 1-like phenotype. Nat Genet. 2007;39: 1120–26. Brookes, K.J., Hawi, Z., Kirley, A., Barry, E., Gill, M., Kent, L. Association of the steroid sulfatase (STS) gene with attention deficit hyperactivity disorder. Am J Med Genet B Neuropsychiatr Genet. 2008;147B:1531–35. Brown, M.D., Starikovskaya, E., Derbeneva, O., Hosseini, S., Allen, J.C., Mikhailovskaya, I.E., Sukernik, R.I., Wallace, D.C. The role of mtDNA background in disease expression: a new primary LHON mutation associated with Western Eurasian haplogroup J. Hum Genet. 2002;110(2):130–38. Bruder, C.E., Piotrowski, A., Gijsbers, A.A., Andersson, R., Erickson, S., de Stahl, T.D., Menzel, U., Sandgren, J., von Tell, D., Poplawski, A. et al. Phenotypically concordant and discordant monozygotic twins display different DNA copy-number-variation profiles. Am J Hum Genet. 2008;82:763–71. Bruneau, B.G. The developmental genetics of congenital heart disease. Nature. 2008;451:943–48.
References
203
Brunetti-Pierri, N., Berg, J.S., Scaglia, F., Belmont, J., Bacino, C.A., Sahoo, T., Lalani, S.R., Graham, B., Lee, B., Shinawi, M. et al. Recurrent reciprocal 1q21.1 deletions and duplications associated with microcephaly or macrocephaly and developmental and behavioral abnormalities. Nat Genet. 2008;40:1466–71. Buss, R.R., Sun, W., Oppenheim, R.W. Adaptive roles of programmed cell death during nervous system development. Annu Rev Neurosci. 2006;29:1–35. Campanella, M., Parker, N., Tan, C.H., Hall, A. M., Duchen, M.R., IF(1):. setting the pace of the F(1)F(0)-ATP synthase. Trends Biochem Sci. Science. 2009;34(7):343–50. Campuzano, V., Montermini, L., Molto, M.D., Pianese, L., Cossee, M., Cavalcanti, F., Monros, E., Rodius, F., Duclos, F., Monticelli, A. et al. Friedreich’s ataxia: autosomal recessive disease caused by an intronic GAA triplet repeat expansion. Science. 1996;271:1423–27. Cann, R.L., Brown, W.M., Wilson, A.C. Polymorphic sites and the mechanism of evolution in human mitochondrial DNA. Genetics. 1984;106:479–99. Capelli, C., Redhead, N., Abernethy, J.K., Gratrix, F., Wilson, J.F., Moen, T., Hervig, T., Richards, M., Stumpf, M.P., Underhill, P.A. et al. A Y chromosome census of the British Isles. Curr Biol. 2003;13:979–84. Capelli, C., Redhead, N., Romano, V., Cali, F., Lefranc, G., Delague, V., Megarbane, A., Felice, A.E., Pascali, V.L., Neophytou, P.I. et al. Population structure in the Mediterranean basin: a Y chromosome perspective. Ann Hum Genet. 2006;70: 207–25. Cardno, A.G., Gottesman, I.I. Twin studies of schizophrenia: from bow-and-arrow concordances to star wars Mx and functional genomics. Am J Med Genet. 2000;97: 12–17. Carelli, V., Achilli, A., Valentino, M.L., Rengo, C., Semino, O., Pala, M., Olivieri, A., Mattiazzi, M., Pallotti, F., Carrara, F. et al. Haplogroup effects and recombination of mitochondrial DNA: novel clues from the analysis of Leber hereditary optic neuropathy pedigrees. Am J Hum Genet. 2006;78:564–74. Carreiras, M., Seghier, M.L., Baquero, S., Estevez, A., Lozano, A., Devlin, J.T., Price, C.J. An anatomical signature for literacy. Nature. 2009;461:983–86. Castagna, A.E., Addis, J., McInnes, R.R., Clarke, J.T., Ashby, P., Blaser, S., Robinson, B.H. Late onset Leigh syndrome and ataxia due to a T to C mutation at bp 9,185 of mitochondrial DNA. Am J Med Genet A. 2007;143A:808–16. Cecchini, K.R., Raja Banerjee, A., Kim, T.H. Towards a genome-wide reconstruction of cis-regulatory networks in the human genome. Semin Cell Dev Biol. 2009; 20:842–48. Chan, C.S., Gertler, T.S., Surmeier, D.J. Calcium homeostasis, selective vulnerability and Parkinson’s disease. Trends Neurosci. 2009;32:249–56. Chan, S.S., Copeland, W.C. DNA polymerase gamma and mitochondrial disease: understanding the consequence of POLG mutations. Biochim Biophys Acta. 2009;1787:312–19. Chanda, B., Asai-Coakwell, M., Ye, M., Mungall, A.J., Barrow, M., Dobyns, W.B., Behesti, H., Sowden, J.C., Carter, N.P., Walter, M.A. et al. A novel mechanistic spectrum underlies glaucoma-associated chromosome 6p25 copy number variation. Hum Mol Genet. 2008;17:3446–58.
204
References
Cheetham, M.E., Caplan, A.J. Structure, function and evolution of DnaJ: conservation and adaptation of chaperone function. Cell Stress Chaperones. 1998;3:28–36. Childs, A.M., Hutchin, T., Pysden, K., Highet, L., Bamford, J., Livingston, J., Crow, Y.J. Variable phenotype including Leigh syndrome with a 9185T>C mutation in the MTATP6 gene. Neuropediatrics. 2007;38:313–16. Chubb, J.E., Bradshaw, N.J., Soares, D.C., Porteous, D.J., Millar, J.K. The DISC locus in psychiatric illness. Mol Psychiatry. 2008;13:36–64. Cobb, S.N. The facial skeleton of the chimpanzee-human last common ancestor. J Anat. 2008;212:469–85. Cohen, J.D., Insel, T.R. Cognitive neuroscience and schizophrenia: translational research in need of a translator. Biol Psychiatry. 2008;64:2–3. Cole, N.B., Dieuliis, D., Leo, P., Mitchell, D.C., Nussbaum, R.L. Mitochondrial translocation of alpha-synuclein is promoted by intracellular acidification. Exp Cell Res. 2008;314:2076–89. Collet, C., Michou, L., Audran, M., Chasseigneaux, S., Hilliquin, P., Bardin, T., Lemaire, I., Cornelis, F., Launay, J.M., Orcel, P. et al. Paget’s disease of bone in the French population: novel SQSTM1 mutations, functional analysis, and genotypephenotype correlations. J Bone Miner Res. 2007;22:310–17. Cooper, T.A., Wan, L., Dreyfuss, G. RNA and disease. Cell. 2009;136:777–93. Corcoran, J.A., Saffran, H.A., Duguay, B.A., Smiley, J.R. Herpes simplex virus UL12.5 targets mitochondria through a mitochondrial localization sequence proximal to the N terminus. J Virol. 2009;83:2601–10. Correia, S.S., Bassani, S., Brown, T.C., Lise, M.F., Backos, D.S., El-Husseini, A., Passafaro, M., Esteban, J.A. Motor protein-dependent transport of AMPA receptors into spines during long-term potentiation. Nat Neurosci. 2008;11:457–66. Costa-Mattioli, M., Sossin, W.S., Klann, E., Sonenberg, N. Translational control of long-lasting synaptic plasticity and memory. Neuron. 2009;61:10–26. Coufal, N.G., Garcia-Perez, J.L., Peng, G.E., Yeo, G.W., Mu, Y., Lovci, M.T., Morell, M., O’Shea, K.S., Moran, J.V., Gage, F.H. L1 retrotransposition in human neural progenitor cells. Nature. 2009;460:1127–31. Cowen, L.E., Lindquist, S. Hsp90 potentiates the rapid evolution of new traits: drug resistance in diverse fungi. Science. 2005;309:2185–89. Craddock, N., O’Donovan, M.C., Owen, M.J. Psychosis genetics: modeling the relationship between schizophrenia, bipolar disorder, and mixed (or “schizoaffective”) psychoses. Schizophr Bull. 2009;35:482–90. Creed, E.R., Ford, E.B., McWhirter, K.G. Evolutionary studies on Maniola Jurtina: the Isles of Scilly, 1958–59. Heredity. 1964;19:471–88. Crompton, R.H., Vereecke, E.E., Thorpe, S.K. Locomotion and posture from the common hominoid ancestor to fully modern hominins, with special reference to the last common panin/hominin ancestor. J Anat. 2008;212:501–43. Cuervo, A.M. Autophagy and aging: keeping that old broom working. Trends Genet. 2008;24:604–12. Dalla Torre di Sanguinetto, S.A., Dasen, J.S., Arber, S. Transcriptional mechanisms controlling motor neuron diversity and connectivity. Curr Opin Neurobiol. 2008;18:36–43. Dang, Y., Kedersha, N., Low, W.K., Romo, D., Gorospe, M., Kaufman, R., Anderson, P., Liu, J.O. Eukaryotic initiation factor 2alpha-independent pathway of stress granule induction by the natural product pateamine A. J Biol Chem. 2006;281:32870–78.
References
205
Daoud, H., Valdmanis, P.N., Kabashi, E., Dion, P., Dupre, N., Camu, W., Meininger, V., Rouleau, G.A. Contribution of TARDBP mutations to sporadic amyotrophic lateral sclerosis. J Med Genet. 2009;46:112–14. Dasen, J.S., Jessell, T.M. Hox networks and the origins of motor neuron diversity. Curr Top Dev Biol. 2009;88:169–200. Darwin, C. On the Origin of Species by Means of Natural Selection. London, England: John Murray; 1859. Darwin, C. The Descent of Man, and Selection in Relation to Sex. London, England:John Murray; 1871. Davey, K.M., Parboosingh, J.S., McLeod, D.R., Chan, A., Casey, R., Ferreira, P., Snyder, F.F., Bridge, P.J., Bernier, F.P. Mutation of DNAJC19, a human homologue of yeast inner mitochondrial membrane co-chaperones, causes DCMA syndrome, a novel autosomal recessive Barth syndrome-like condition. J Med Genet. 2006;43(5):385–93. de Cordoba, S.R., de Jorge, E.G. Translational mini-review series on complement factor H: genetics and disease associations of human complement factor H. Clin Exp Immunol. 2008;151:1–13. Dennis, M.Y., Paracchini, S., Scerri, T.S., Prokunina-Olsson, L., Knight, J.C., Wade-Martins, R., Coggill, P., Beck, S., Green, E.D., Monaco, A.P. A common variant associated with dyslexia reduces expression of the KIAA0319 gene. PLoS Genet. 2009;5:e1000436. Dibbens, L.M., Mullen, S., Helbig, I., Mefford, H.C., Bayly, M.A., Bellows, S., Leu, C., Trucks, H., Obermeier, T., Wittig, M. et al. Familial and sporadic 15q13.3 microdeletions in idiopathic generalized epilepsy: precedent for disorders with complex inheritance. Hum Mol Genet. 2009;18:3626–31. DiMauro, S., Schon, E.A. Mitochondrial disorders in the nervous system. Annu Rev Neurosci. 2008;31:91–123. Doe, C.M., Relkovic, D., Garfield, A.S., Dalley, J.W., Theobald, D.E., Humby, T., Wilkinson, L.S., Isles, A.R. Loss of the imprinted snoRNA mbii-52 leads to increased 5htr2c pre-RNA editing and altered 5HT2CR-mediated behaviour. Hum Mol Genet. 2009;18:2140–48. Donaldson, I.J., Gottgens, B. Evolution of candidate transcriptional regulatory motifs since the human-chimpanzee divergence. Genome Biol. 2006;7:R52. Donnelly, P. Progress and challenges in genome-wide association studies in humans. Nature. 2008;456:728–31. Doolittle, W.F., Sapienza, C. Selfish genes, the phenotype paradigm and genome evolution. Nature. 1980;284(5757):601–3. Dorus, S., Vallender, E.J., Evans, P.D., Anderson, J.R., Gilbert, S.L., Mahowald, M., Wyckoff, G.J., Malcom, C.M., Lahn, B.T. Accelerated evolution of nervous system genes in the origin of Homo sapiens. Cell. 2004;119:1027–40. D’Souza, D.C., Abi-Saab, W.M., Madonick, S., Forselius-Bielen, K., Doersch, A., Braley, G., Gueorguieva, R., Cooper, T.B., Krystal, J.H. Delta-9-tetrahydrocannabinol effects in schizophrenia: implications for cognition, psychosis, and addiction. Biol Psychiatry. 2005;57:594–608. D’Souza, D.C., Sewell, R.A., Ranganathan, M. Cannabis and psychosis/schizophrenia: human studies. Eur Arch Psychiatry Clin Neurosci. 2009;259:413–31. Du, H., Guo, L., Fang, F., Chen, D., Sosunov, A.A., McKhann, G.M., Yan, Y., Wang, C., Zhang, H., Molkentin, J.D. et al. Cyclophilin D deficiency attenuates mitochondrial
206
References
and neuronal perturbation and ameliorates learning and memory in Alzheimer’s disease. Nat Med. 2008;14:1097–105. Dumas, L., Kim, Y.H., Karimpour-Fard, A., Cox, M., Hopkins, J., Pollack, J.R., Sikela, J.M. Gene copy number variation spanning 60 million years of human and primate evolution. Genome Res. 2007;17:1266–77. Echenne, B., Roubertie, A., Lugtenberg, D., Kleefstra, T., Hamel, B.C., Van Bokhoven, H., Lacombe, D., Philippe, C., Jonveaux, P., de Brouwer, A.P. Neurologic aspects of MECP2 gene duplication in male patients. Pediatr Neurol. 2009;41:187–91. Eckhart, L., Ballaun, C., Hermann, M., VandeBerg, J.L., Sipos, W., Uthman, A., Fischer, H., Tschachler, E. Identification of novel mammalian caspases reveals an important role of gene loss in shaping the human caspase repertoire. Mol Biol Evol. 2008;25:831–41. Edvardsen, J., Torgersen, S., Roysamb, E., Lygren, S., Skre, I., Onstad, S., Oien, P.A. Heritability of bipolar spectrum disorders: unity or heterogeneity? J Affect Disord. 2008;106:229–40. Ehlers, M.D. Reinsertion or degradation of AMPA receptors determined by activitydependent endocytic sorting. Neuron. 2000;28:511–25. Elmore, S. Apoptosis: a review of programmed cell death. Toxicol Pathol. 2007;35:495–516. Emanuele, E., Lista, S., Ghidoni, R., Binetti, G., Cereda, C., Benussi, L., Maletta, R., Bruni, A.C., Politi, P. Chromosome 9p21.3 genotype is associated with vascular dementia and Alzheimer’s disease. Neurobiol Aging. 2009; In press. Enattah, N.S., Kuokkanen, M., Forsblom, C., Natah, S., Oksanen, A., Jarvela, I., Peltonen, L., Savilahti, E. Correlation of intestinal disaccharidase activities with the C/T-13910 variant and age. World J Gastroenterol. 2007;13:3508–12. Enattah, N.S., Sahi, T., Savilahti, E., Terwilliger, J.D., Peltonen, L., Jarvela, I. Identification of a variant associated with adult-type hypolactasia. Nat Genet. 2002; 30:233–37. Esslinger, C., Walter, H., Kirsch, P., Erk, S., Schnell, K., Arnold, C., Haddad, L., Mier, D., Opitz von Boberfeld, C., Raab, K. et al. Neural mechanisms of a genomewide supported psychosis variant. Science. 2009;324:605. Evans, P.D., Anderson, J.R., Vallender, E.J., Gilbert, S.L., Malcom, C.M., Dorus, S., Lahn, B.T. Adaptive evolution of ASPM, a major determinant of cerebral cortical size in humans. Hum Mol Genet. 2004;13:489–94. Fatica, A., Tollervey, D. Making ribosomes. Curr Opin Cell Biol. 2002;14:313–8. Feissner, R.F., Skalska, J., Gaum, W.E., Sheu, S.S. Crosstalk signaling between mitochondrial Ca2+ and ROS. Front Biosci. 2009;14:1197–218. Fellay, J., Shianna, K.V., Ge, D., Colombo, S., Ledergerber, B., Weale, M., Zhang, K., Gumbs, C., Castagna, A., Cossarizza, A. et al. A whole-genome association study of major determinants for host control of HIV-1. Science. 2007;317:944–47. Ferry, G. Science’s new battle lines. Nature. 2009;459:34–35. Feuk, L., Marshall, C.R., Wintle, R.F., Scherer, S.W. Structural variants: changing the landscape of chromosomes and design of disease studies. Hum Mol Genet. 2006;15(Spec No 1):R57–66. Fisher, S.E., Vargha-Khadem, F., Watkins, K.E., Monaco, A.P.,Pembrey, M.E. Localisation of a gene implicated in a severe speech and language disorder. Nat Genet. 1998;18:168–70.
References
207
Flames, N., Hobert, O. Gene regulatory logic of dopamine neuron differentiation. Nature. 2009;458:885–89. Flomen, R., Knight, J., Sham, P., Kerwin, R., Makoff, A. Evidence that RNA editing modulates splice site selection in the 5-HT2C receptor gene. Nucleic Acids Res. 2004;32:2113–22. Flomen, R.H., Davies, A.F., Di Forti, M., La Cascia, C., Mackie-Ogilvie, C., Murray, R., Makoff, A.J. The copy number variant involving part of the alpha7 nicotinic receptor gene contains a polymorphic inversion. Eur J Hum Genet. 2008;16(11):1364–71. Fong, J.H., Marchler-Bauer, A. Protein subfamily assignment using the Conserved Domain Database. BMC Res Notes. 2008;1:114. Ford, E.B., Ecological genetics (4th edition 1975). Chapman and Hall, London; 1964. Fraga, M.F., Ballestar, E., Paz, M.F., Ropero, S., Setien, F., Ballestar, M.L., Heine-Suner, D., Cigudosa, J.C., Urioste, M., Benitez, J. et al. Epigenetic differences arise during the lifetime of monozygotic twins. Proc Natl Acad Sci U S A. 2005;102: 10604–9. Frazer, K.A., Murray, S.S., Schork, N.J., Topol, E.J. Human genetic variation and its contribution to complex traits. Nat Rev Genet. 2009;10:241–51. Freimer, N., Sabatti, C. The human phenome project. Nat Genet. 2003;34:15–21. Galton, F. The history of twins, as a criterion of the relative powers of nature and nurture. Journal of the Anthropological Institute. 1875;5:329–348, quote is from p.391. Ganapathi, K.A., Shimamura, A. Ribosomal dysfunction and inherited marrow failure. Br J Haematol. 2008;141:376–87. Garcia-Segura, L.M. Aromatase in the brain: not just for reproduction anymore. J Neuroendocrinol. 2008;20:705–12. Ge, D., Fellay, J., Thompson, A.J., Simon, J.S., Shianna, K.V., Urban, T.J., Heinzen, E.L., Qiu, P., Bertelsen, A.H., Muir, A.J. et al. Genetic variation in IL28B predicts hepatitis C treatment-induced viral clearance. Nature. 2009;461:399–401. Giacchetti, M., Monticelli, A., De Biase, I., Pianese, L., Turano, M., Filla, A., De Michele, G., Cocozza, S. Mitochondrial DNA haplogroups influence the Friedreich’s ataxia phenotype. J Med Genet. 2004;41:293–95. Gingeras, T.R. Implications of chimaeric non-co-linear transcripts. Nature. 2009;461:206–11. Glickman, M.H., Adir, N. The proteasome and delicate balance between destruction and rescue. PloS Biol. Epub. 2004 Jan 20. Goldstein, D.B. Common genetic variation and human traits. N Engl J Med. 2009; 360:1696–98. Gottesman, I.I., Shields, J. A critical review of recent adoption, twin, and family studies of schizophrenia: behavioral genetics perspectives. Schizophr Bull. 1976;2: 360–401. Green, E.K., Grozeva, D., Jones, I., Jones, L., Kirov, G., Caesar, S., Gordon-Smith, K., Fraser, C., Forty, L., Russell, E. et al. The bipolar disorder risk allele at CACNA1C also confers risk of recurrent major depression and of schizophrenia. Mol Psychiatry. 2009; Epub. In press. Green, R.E., Krause, J., Briggs, A.W., Maricic, T., Stenzel, U., Kircher, M., Patterson, N., Li, H., Zhai, W., Fritz, M.H., Hansen, N.F., et al. A draft sequence of the Neandertal genome Science. 2010;328(5979):710–22.
208
References
Greider, C.W., Blackburn, E.H. Identification of a specific telomere terminal transferase activity in Tetrahymena extracts. Cell. 1985;43:405–13. Griffith, E., Walker, S., Martin, C.A., Vagnarelli, P., Stiff, T., Vernay, B., Al Sanna, N., Saggar, A., Hamel, B., Earnshaw, W.C. et al. Mutations in pericentrin cause Seckel syndrome with defective ATR-dependent DNA damage signaling. Nat Genet. 2008;40:232–36. Grossman, L.I., Wildman, D.E., Schmidt, T.R., Goodman, M. Accelerated evolution of the electron transport chain in anthropoid primates. Trends Genet. 2004;20:578–85. Guinto, J.B., Ritson, G.P., Taylor, J.P., Forman, M.S. Valosin-containing protein and the pathogenesis of frontotemporal dementia associated with inclusion body myopathy. Acta Neuropathol. 2007;114:55–61. Guo, A.Y., Sun, J., Riley, B.P., Thiselton, D.L., Kendler, K.S., Zhao, Z. The dystrobrevin-binding protein 1 gene: features and networks. Mol Psychiatry. 2009;14:18–29. Gurling, H.M., Kalsi, G., Brynjolfson, J., Sigmundsson, T., Sherrington, R., Mankoo, B.S., Read, T., Murphy, P., Blaveri, E., McQuillin, A. et al. Genome-wide genetic linkage analysis confirms the presence of susceptibility loci for schizophrenia, on chromosomes 1q32.2, 5q33.2, and 8p21-22 and provides support for linkage to schizophrenia, on chromosomes 11q23.3-24 and 20q12.1-11.23. Am J Hum Genet. 2001;68:661–73. Gutierrez, R.C., Hung, J., Zhang, Y., Kertesz, A.C., Espina, F.J., Colicos, M.A. Altered synchrony and connectivity in neuronal networks expressing an autism-related mutation of neuroligin 3. Neuroscience. 2009;162:208–21. Haase, G., Pettmann, B., Raoul, C., Henderson, C.E. Signaling by death receptors in the nervous system. Curr Opin Neurobiol. 2008;18:284–91. Hagerman, R.J., Coffey, S.M., Maselli, R., Soontarapornchai, K., Brunberg, J.A., Leehey, M.A., Zhang, L., Gane, L.W., Fenton-Farrell, G., Tassone, F., Hagerman, P.J. Neuropathy as a presenting feature in fragile X-associated tremor/ataxia syndrome. Am J Med Genet A. 2007;143A(19):2256–60. Hampshire, D.J., Roberts, E., Crow, Y., Bond, J., Mubaidin, A., Wriekat, A.L., Al-Din, A., Woods, C.G. Kufor-Rakeb syndrome, pallido-pyramidal degeneration with supranuclear upgaze paresis and dementia, maps to 1p36. J Med Genet. 2001;38:680–82. Hannula-Jouppi, K., Kaminen-Ahola, N., Taipale, M., Eklund, R., Nopola-Hemmi, J., Kaariainen, H., Kere, J. The axon guidance receptor gene ROBO1 is a candidate gene for developmental dyslexia. PLoS Genet. 2005;1:e50. Harold, D., Abraham, R., Hollingworth, P., Sims, R., Gerrish, A., Hamshere, M.L., Pahwa, J.S., Moskvina, V., Dowzell, K., Williams, A., Jones, N., Thomas, C., Stretton, A., et al. Genome-wide association study identifies variants at CLU and PICALM associated with Alzheimer’s disease. Nat Genet. 2009;41(10):1088–93. Harper, P.S. Julia Bell and the Treasury of Human Inheritance. Hum. Genet. 2005;116:422–32. Harper, S.J., Bates, D.O. VEGF-A splicing: the key to anti-angiogenic therapeutics? Nat Rev Cancer. 2008;8:880–87. Harris, H. The Principles of Human Biochemical Genetics. Published in Amsterdam: North Holland Publishing Company; 1973. p. 5. Harris, L.W., Lockstone, H.E., Khaitovich, P., Weickert, C.S., Webster, M.J., Bahn, S. Gene expression in the prefrontal cortex during adolescence: implications for the onset of schizophrenia. BMC Med Genomics. 2009;2:28.
References
209
Hartl, F.U., Hayer-Hartl, M. Converging concepts of protein folding in vitro and in vivo. Nat Struct Mol Biol. 2009;16:574–81. Hatfield, D.L., Gladyshev, V.N. How selenium has altered our understanding of the genetic code. Mol Cell Biol. 2002;22:3565–76. Hayashi, M., Imanaka-Yoshida, K., Yoshida, T., Wood, M., Fearns, C., Tatake, R.J., Lee, J.D. A crucial role of mitochondrial Hsp40 in preventing dilated cardiomyopathy. Nat Med. 2006;12:128–32. Hayflick, L. Current theories of biological aging. Fed Proc. 1975;34:9–13. He, Y., Vogelstein, B., Velculescu, V.E., Papadopoulos, N., Kinzler, K.W. The antisense transcriptomes of human cells. Science. 2008;322:1855–57. Hecker, L.A., Edwards, A.O., Ryu, E., Tosakulwong, N., Baratz, K.H., Brown, W.L., Charbel Issa, P., Scholl, H.P., Pollok-Kopp, B., Schmid-Kubista, K.E., Bailey, K.R., Oppermann, M. Genetic control of the alternative pathway of complement in humans and age-related macular degeneration. Hum Mol Genet. 2010;19(1):209–15. Heijmans, B.T., Kremer, D., Tobi, E.W., Boomsma, D.I., Slagboom, P.E. Heritable rather than age-related environmental and stochastic factors dominate variation in DNA methylation of the human IGF2/H19 locus. Hum Mol Genet. 2007;16: 547–54. Helbig, I., Mefford, H.C., Sharp, A.J., Guipponi, M., Fichera, M., Franke, A., Muhle, H., de Kovel, C., Baker, C., von Spiczak, S. et al. 15q13.3 microdeletions increase risk of idiopathic generalized epilepsy. Nat Genet. 2009;41:160–62. Helfrich, M.H., Hocking, L.J. Genetics and aetiology of Pagetic disorders of bone. Arch Biochem Biophys. 2008;473:172–82. Helgadottir, A., Thorleifsson, G., Magnusson, K.P., Gretarsdottir, S., Steinthorsdottir, V., Manolescu, A., Jones, G.T., Rinkel, G.J., Blankensteijn, J.D., Ronkainen, A. et al. The same sequence variant on 9p21 associates with myocardial infarction, abdominal aortic aneurysm and intracranial aneurysm. Nat Genet. 2008;40:217–24. Helgadottir, A., Thorleifsson, G., Manolescu, A., Gretarsdottir, S., Blondal, T., Jonasdottir, A., Sigurdsson, A., Baker, A., Palsson, A., Masson, G. et al. A common variant on chromosome 9p21 affects the risk of myocardial infarction. Science. 2007;316:1491–93. Henikoff, S., and Matzke, M.A. Exploring and explaining epigenetic effects. Trends Genet. 1997;13:293–95. Hennah, W., Tomppo, L., Hiekkalinna, T., Palo, O.M., Kilpinen, H., Ekelund, J., TuulioHenriksson, A., Silander, K., Partonen, T., Paunio, T. et al. Families with the risk allele of DISC1 reveal a link between schizophrenia and another component of the same molecular pathway, NDE1. Hum Mol Genet. 2007;16:453–62. Henquet, C., Di Forti, M., Morrison, P., Kuepper, R., Murray, R.M. Gene-environment interplay between cannabis and psychosis. Schizophr Bull. 2008;34:1111–21. Henrichsen, C.N., Chaignat, E. and Reymond, A. Copy number variants, diseases and gene expression. Hum Mol Genet. 2009;18:R1–8. Henseler, I., Falkai, P., Gruber, O. A systematic fMRI investigation of the brain systems subserving different working memory components in schizophrenia. Eur J Neurosci. 2009;30:693–702. Heutink, P., Zguricas, J., van Oosterhout, L., Breedveld, G.J., Testers, L., Sandkuijl, L.A., Snijders, P.J., Weissenbach, J., Lindhout, D., Hovius, S.E. et al. The gene for triphalangeal thumb maps to the subtelomeric region of chromosome 7q. Nat Genet. 1994;6:287–92.
210
References
Higginbotham, H.R., Gleeson, J.G. The centrosome in neuronal development. Trends Neurosci. 2007;30:276–83. Higgs, D.R., Vernimmen, D., Hughes, J., and Gibbons, R. Using genomics to study how chromatin influences gene expression. Annu Rev Genomics Hum Genet. 2007;8:299–325. Hing, A.V., Helms, C., Slaugh, R., Burgess, A., Wang, J.C., Herman, T., Dowton, S.B., Donis-Keller, H. Linkage of preaxial polydactyly type 2 to 7q36. Am J Med Genet. 1995;58:128–35. Hirose, Y., Nakashima, E., Ohashi, H., Mochizuki, H., Bando, Y., Ogata, T., Adachi, M., Toba, E., Nishimura, G., Ikegawa, S. Identification of novel RMRP mutations and specific founder haplotypes in Japanese patients with cartilage-hair hypoplasia. J Hum Genet. 2006;51:706–10. Hirsch, C., Gauss, R., Horn, S.C., Neuber, O., Sommer, T. The ubiquitylation machinery of the endoplasmic reticulum. Nature. 2009;458:453–60. Hochstrasser, M. Origin and function of ubiquitin-like proteins. Nature. 2009;458: 422–29. Hodgson, J.A., Disotell, T.R. No evidence of a Neanderthal contribution to modern human diversity. Genome Biol. 2008;9:206. Hong, J.W., Hendrix, D.A., Levine, M.S. Shadow enhancers as a source of evolutionary novelty. Science. 2008;321:1314. Horike, S., Cai, S., Miyano, M., Cheng, J.F., Kohwi-Shigematsu, T. Loss of silentchromatin looping and impaired imprinting of DLX5 in Rett syndrome. Nat Genet. 2005;37:31–40. Huizing, M., Helip-Wooley, A., Westbroek, W., Gunay-Aygun, M., Gahl, W.A. Disorders of lysosome-related organelle biogenesis: clinical and molecular genetics. Annu Rev Genomics Hum Genet. 2008;9:359–86. Hume, A.N., Ushakov, D.S., Tarafder, A.K., Ferenczi, M.A., Seabra, M.C. Rab27a and MyoVa are the primary Mlph interactors regulating melanosome transport in melanocytes. J Cell Sci. 2007;120:3111–22. Hunter, P., Nielsen, P. A strategy for integrative computational physiology. Physiology (Bethesda). 2005;20:316–25. Hunter, P.J., Borg, T.K. Integration from proteins to organs: the Physiome Project. Nat Rev Mol Cell Biol. 2003;4:237–43. Huxley, T.H. Evidence as to man’s place in nature. London, England: Williams and Norgate; 1863. Huxley, T.H. Collected Essays. Volume VII. New York: Appleton; 1894. Quote from Preface, p. 2. Ibanez, P., Lesage, S., Janin, S., Lohmann, E., Durif, F., Destee, A., Bonnet, A.M., Brefel-Courbon, C., Heath, S., Zelenika, D. et al. Alpha-synuclein gene rearrangements in dominantly inherited parkinsonism: frequency, phenotype, and mechanisms. Arch Neurol. 2009;66:102–8. Ikeda, M., Aleksic, B., Kirov, G., Kinoshita, Y., Yamanouchi, Y., Kitajima, T., Kawashima, K., Okochi, T., Kishi, T., Zaharieva, I. et al. Copy Number Variation in Schizophrenia in the Japanese Population. Biol Psychiatry. 2010;67:283–86. Ingram, C.J., Elamin, M.F., Mulcare, C.A., Weale, M.E., Tarekegn, A., Raga, T.O., Bekele, E., Elamin, F.M., Thomas, M.G., Bradman, N. et al. A novel polymorphism
References
211
associated with lactose tolerance in Africa: multiple causes for lactase persistence? Hum Genet. 2007;120:779–88. Ingram, C.J., Mulcare, C.A., Itan, Y., Thomas, M.G., Swallow, D.M. Lactose digestion and the evolutionary genetics of lactase persistence. Hum Genet. 2009;124:579–91. Insel, T.R. Asessing the economic costs of serious mental illness Am J Psychiatry. 2008;165(6):663–65. Insel, T.R. Disruptive insights in psychiatry: transforming a clinical discipline. J Clin Invest. 2009;119:700–5. Itsara, A., Cooper, G.M., Baker, C., Girirajan, S., Li, J., Absher, D., Krauss, R.M., Myers, R.M., Ridker, P.M., Chasman, D.I. et al. Population analysis of large copy number variants and hotspots of human genetic disease. Am J Hum Genet. 2009;84:148–61. Itzhaki, R.F., Lin, W.R., Shang, D., Wilcock, G.K., Faragher, B., Jamieson, G.A. Herpes simplex virus type 1 in brain and risk of Alzheimer’s disease. Lancet. 1997;349: 241–44. Iwahara, T., Fujimoto, J., Wen, D., Cupples, R., Bucay, N., Arakawa, T., Mori, S., Ratzkin, B., Yamamoto, T. Molecular characterization of ALK, a receptor tyrosine kinase expressed specifically in the nervous system. Oncogene. 1997;14:439–49. Jady, B.E., Bertrand, E., Kiss, T. Human telomerase RNA and box H/ACA scaRNAs share a common Cajal body-specific localization signal. J Cell Biol. 2004;164: 647–52. Jessell, T.M. Neuronal specification in the spinal cord: inductive signals and transcriptional codes. Nat Rev Genet. 2000;1:20–29. Jiang, Y.H., Armstrong, D., Albrecht, U., Atkins, C.M., Noebels, J.L., Eichele, G., Sweatt, J.D., Beaudet, A.L. Mutation of the Angelman ubiquitin ligase in mice causes increased cytoplasmic p53 and deficits of contextual learning and long-term potentiation. Neuron. 1998;21:799–811. Jiang, Z., Tang, H., Ventura, M., Cardone, M.F., Marques-Bonet, T., She, X., Pevzner, P.A., Eichler, E.E. Ancestral reconstruction of segmental duplications reveals punctuated cores of human genome evolution. Nat Genet. 2007;39:1361–68. Jobling, M.A., Tyler-Smith, C. The human Y chromosome: an evolutionary marker comes of age. Nat Rev Genet. 2003;4:598–612. Johnson, M.E., Cheng, Z., Morrison, V.A., Scherer, S., Ventura, M., Gibbs, R.A., Green, E.D., Eichler, E.E. Recurrent duplication-driven transposition of DNA during hominoid evolution. Proc Natl Acad Sci U S A. 2006;103:17626–31. Jörnvall, H., Jollès, P. Protein structure analysis of today: proteomics in functional genomics. EXS. 2000;88:XI–XIII. Jurynec, M.J., Xia, R., Mackrill, J.J., Gunther, D., Crawford, T., Flanigan, K.M., Abramson, J.J., Howard, M.T., Grunwald, D.J. Selenoprotein N is required for ryanodine receptor calcium release channel activity in human and zebrafish muscle. Proc Natl Acad Sci U S A. 2008;105:12485–90. Kaladjian, A., Jeanningros, R., Azorin, J.M., Nazarian, B., Roth, M., Anton, J.L., Mazzola-Pomietto, P. Remission from mania is associated with a decrease in amygdala activation during motor response inhibition. Bipolar Disord. 2009;11:530–38. Kaplan, J., De Domenico, I., Ward, D.M. Chediak-Higashi syndrome. Curr Opin Hematol. 2008;15:22–29.
212
References
Karadimas, C.L., Vu, T.H., Holve, S.A., Chronopoulou, P., Quinzii, C., Johnsen, S.D., Kurth, J., Eggers, E., Palenzuela, L., Tanji, K. et al. Navajo neurohepatopathy is caused by a mutation in the MPV17 gene. Am J Hum Genet. 2006;79:544–48. Kato, T. Role of mitochondrial DNA in calcium signaling abnormality in bipolar disorder. Cell Calcium. 2008;44:92–102. Kehrer-Sawatzki, H., Cooper, D.N. Structural divergence between the human and chimpanzee genomes. Hum Genet. 2007;120:759–78. Kent, L., Emerton, J., Bhadravathi, V., Weisblatt, E., Pasco, G., Willatt, L.R., McMahon, R., Yates, J.R. X-linked ichthyosis (steroid sulfatase deficiency) is associated with increased risk of attention deficit hyperactivity disorder, autism and social communication deficits. J Med Genet. 2008;45:519–24. Kerner, B., Brugman, D.L., Freimer, N.B. Evidence of linkage to psychosis on chromosome 5q33-34 in pedigrees ascertained for bipolar disorder. Am J Med Genet B Neuropsychiatr Genet. 2007;144B:74–78. Kim, H.G., Kishikawa, S., Higgins, A.W., Seong, I.S., Donovan, D.J., Shen, Y., Lally, E., Weiss, L.A., Najm, J., Kutsche, K. et al. Disruption of neurexin 1 associated with autism spectrum disorder. Am J Hum Genet. 2008;82:199–207. King, M.C., Wilson, A.C. Evolution at two levels in humans and chimpanzees. Science. 1975;188:107–16. Kirov, G., Gumus, D., Chen, W., Norton, N., Georgieva, L., Sari, M., O’Donovan, M.C., Erdogan, F., Owen, M.J., Ropers, H.H. et al. Comparative genome hybridization suggests a role for NRXN1 and APBA2 in schizophrenia. Hum Mol Genet. 2008;17:458–65. Kirov, G., Rujescu, D., Ingason, A., Collier, D.A., O’Donovan, M.C., Owen, M.J. Neurexin 1 (NRXN1) deletions in schizophrenia. Schizophr Bull. 2009;35:851–54. Kishore, S., Stamm, S. The snoRNA HBII-52 regulates alternative splicing of the serotonin receptor 2C. Science. 2006;311:230–32. Kishore, S., Khanna, A., Zhang, Z., Hui, J., Balwierz, P.J., Stefan, M., Beach, C., Nicholls, R.D., Zavolan, M., Stamm, S. The snoRNA MBII-52 (SNORD 115) is processed into smaller RNAs and regulates alternative splicing. Hum Mol Genet. 2010; 9(7):1153–64. Korn, J.M., Kuruvilla, F.G., McCarroll, S.A., Wysoker, A., Nemesh, J., Cawley, S., Hubbell, E., Veitch, J., Collins, P.J., Darvishi, K. et al. Integrated genotype calling and association analysis of SNPs, common copy number polymorphisms and rare CNVs. Nat Genet. 2008;40:1253–60. Kowald, A., Jendrach, M., Pohl, S., Bereiter-Hahn, J., Hammerstein, P. On the relevance of mitochondrial fusions for the accumulation of mitochondrial deletion mutants: a modelling study. Aging Cell. 2005;4:273–83. Krause, J., Lalueza-Fox, C., Orlando, L., Enard, W., Green, R.E., Burbano, H.A., Hublin, J.J., Hanni, C., Fortea, J., de la Rasilla, M. et al. The derived FOXP2 variant of modern humans was shared with Neandertals. Curr Biol. 2007;17: 1908–12. Kraytsberg, Y., Kudryavtseva, E., McKee, A.C., Geula, C., Kowall, N.W., Khrapko, K. Mitochondrial DNA deletions are abundant and cause functional impairment in aged human substantia nigra neurons. Nat Genet. 2006;38:518–20. Krey, J.F., Dolmetsch, R.E. Molecular mechanisms of autism: a possible role for Ca2+ signaling. Curr Opin Neurobiol. 2007;17:112–19.
References
213
Kriaucionis, S., Paterson, A., Curtis, J., Guy, J., Macleod, N., Bird, A. Gene expression analysis exposes mitochondrial abnormalities in a mouse model of Rett syndrome. Mol Cell Biol. 2006;26:5033–42. Kubota, K., Kumamoto, N., Matsuzaki, S., Hashimoto, R., Hattori, T., Okuda, H., Takamura, H., Takeda, M., Katayama, T., Tohyama, M. Dysbindin engages in c-Jun N-terminal kinase activity and cytoskeletal organization. Biochem Biophys Res Commun. 2009;379:191–95. Kumar, A., Girimaji, S.C., Duvvari, M.R., Blanton, S.H. Mutations in STIL, encoding a pericentriolar and centrosomal protein, cause primary microcephaly. Am J Hum Genet. 2009;84:286–90. Kuroda, Y., Mitsui, T., Kunishige, M., Matsumoto, T. Parkin affects mitochondrial function and apoptosis in neuronal and myogenic cells. Biochem Biophys Res Commun. 2006;348(3):787–93. Kuwabara, T., Hsieh, J., Muotri, A., Yeo, G., Warashina, M., Lie, D.C., Moore, L., Nakashima, K., Asashima, M., Gage, F.H. Wnt-mediated activation of NeuroD1 and retro-elements during adult neurogenesis. Nat Neurosci. 2009;12(9):1097–105. Kwiatkowski, T.J., Jr., Bosco, D.A., Leclerc, A.L., Tamrazian, E., Vanderburg, C.R., Russ, C., Davis, A., Gilchrist, J., Kasarskis, E.J., Munsat, T. et al. Mutations in the FUS/TLS gene on chromosome 16 cause familial amyotrophic lateral sclerosis. Science. 2009;323:1205–8. LaFramboise, T. Single nucleotide polymorphism arrays: a decade of biological, computational and technological advances. Nucleic Acids Res. 2009;37:4181–93. Lagresle-Peyrou, C., Six, E.M., Picard, C., Rieux-Laucat, F., Michel, V., Ditadi, A., Demerens-de Chappedelaine, C., Morillon, E., Valensi, F., Simon-Stoos, K.L. et al. Human adenylate kinase 2 deficiency causes a profound hematopoietic defect associated with sensorineural deafness. Nat Genet. 2009;41:106–11. Lai, C.S., Fisher, S.E., Hurst, J.A., Vargha-Khadem, F., Monaco, A.P. A forkheaddomain gene is mutated in a severe speech and language disorder. Nature. 2001;413:519–23. Lalani, S.R., Safiullah, A.M., Fernbach, S.D., Harutyunyan, K.G., Thaller, C., Peterson, L.E., McPherson, J.D., Gibbs, R.A., White, L.D., Hefner, M. et al. Spectrum of CHD7 mutations in 110 individuals with CHARGE syndrome and genotype-phenotype correlation. Am J Hum Genet. 2006;78:303–14. Lalani, S.R., Safiullah, A.M., Molinari, L.M., Fernbach, S.D., Martin, D.M., Belmont, J.W. SEMA3E mutation in a patient with CHARGE syndrome. J Med Genet. 2004;41:e94. Lalueza-Fox, C., Rompler, H., Caramelli, D., Staubert, C., Catalano, G., Hughes, D., Rohland, N., Pilli, E., Longo, L., Condemi, S. et al. A melanocortin 1 receptor allele suggests varying pigmentation among Neanderthals. Science. 2007;318: 1453–55. Lambert, J.C., Heath, S., Even, G., Campion, D., Sleegers, K., Hiltunen, M., Combarros, O., Zelenika, D., Bullido, M.J., Tavernier, B., et al. Genome-wide association study identifies variants at CLU and CR1 associated with Alzheimer’s disease. Nat Genet. 2009;41(10):1094–99. Lane, N. Biodiversity: On the origin of bar codes. Nature. 2009;462:272–74. Le Hir, H., Seraphin, B. EJCs at the heart of translational control. Cell. 2008;133:213–16.
214
References
Lehninger, A.L. Some aspects of energy coupling by mitochondria. Adv Exp Med Biol. 1979;111:1–16. Lejeune, J., Dutrillaux, B., Rethore, M.O., Prieur, M. Comparison of the structure of chromatids of Homo sapiens and Pan troglodytes (author’s transl). Chromosoma. 1973;43:423–44. Lesage, S., Brice, A. Parkinson’s disease: from monogenic forms to genetic susceptibility factors. Hum Mol Genet. 2009;18:R48–59. Lesage, S., Condroyer, C., Lannuzel, A., Lohmann, E., Troiano, A., Tison, F., Damier, P., Thobois, S., Ouvrard-Hernandez, A.M., Rivaud-Pechoux, S. et al. Molecular analyses of the LRRK2 gene in European and North African autosomal dominant Parkinson’s disease. J Med Genet. 2009;46:458–64. Lettice, L.A., Heaney, S.J., Purdie, L.A., Li, L., de Beer, P., Oostra, B.A., Goode, D., Elgar, G., Hill, R.E., de Graaff, E. A long-range Shh enhancer regulates expression in the developing limb and fin and is associated with preaxial polydactyly. Hum Mol Genet. 2003;12:1725–35. Lettice, L.A., Horikoshi, T., Heaney, S.J., van Baren, M.J., van der Linde, H.C., Breedveld, G.J., Joosse, M., Akarsu, N., Oostra, B.A., Endo, N. et al. Disruption of a long-range cis-acting regulator for Shh causes preaxial polydactyly. Proc Natl Acad Sci U S A. 2002;99:7548–53. Lewis, D.A., Sweet, R.A. Schizophrenia from a neural circuitry perspective: advancing toward rational pharmacological therapies. J Clin Invest. 2009;119:706–16. Li, T., Underhill, J., Liu, X.H., Sham, P.C., Donaldson, P., Murray, R.M., Wright, P., Collier, D.A. Transmission disequilibrium analysis of HLA class II DRB1, DQA1, DQB1 and DPB1 polymorphisms in schizophrenia using family trios from a Han Chinese population. Schizophr Res. 2001;49(1–2):73–78. Lichtenstein, P., Yip, B.H., Bjork, C., Pawitan, Y., Cannon, T.D., Sullivan, P.F., Hultman, C.M. Common genetic determinants of schizophrenia and bipolar disorder in Swedish families: a population-based study. Lancet. 2009;373:234–39. Liégeois, F., Baldeweg, T., Connelly, A., Gadian, D.G., Mishkin, M., Vargha-Khadem, F. Language fMRI abnormalities associated with FOXP2 gene mutation. Nat Neurosci. 2003;6(11):1230–37. Lopez-Gallardo, E., Solano, A., Herrero-Martin, M.D., Martinez-Romero, I., CastanoPerez, M.D., Andreu, A.L., Herrera, A., Lopez-Perez, M.J., Ruiz-Pesini, E., Montoya, J. NARP syndrome in a patient harbouring an insertion in the MT-ATP6 gene that results in a truncated protein. J Med Genet. 2009;46:64–67. Lu, Z.X., Peng, J., Su, B. A human-specific mutation leads to the origin of a novel splice form of neuropsin (KLK8), a gene involved in learning and memory. Hum Mutat. 2007;28:978–84. Lucas, G.J., Hocking, L.J., Daroszewska, A., Cundy, T., Nicholson, G.C., Walsh, J.P., Fraser, W.D., Meier, C., Hooper, M.J., Ralston, S.H. Ubiquitin-associated domain mutations of SQSTM1 in Paget’s disease of bone: evidence for a founder effect in patients of British descent. J Bone Miner Res. 2005;20:227–31. Lugtenberg, D., Kleefstra, T., Oudakker, A.R., Nillesen, W.M., Yntema, H.G., Tzschach, A., Raynaud, M., Rating, D., Journel, H., Chelly, J. et al. Structural variation in Xq28: MECP2 duplications in 1% of patients with unexplained XLMR and in 2% of male patients with severe encephalopathy. Eur J Hum Genet. 2009;17:444–53.
References
215
Lutz, B. From molecular neurodevelopment to psychiatry: new insights in mechanisms underlying Cannabis-induced psychosis and schizophrenia. Eur Arch Psychiatry Clin Neurosci. 2009;259:369–70. Ly, H. Genetic and environmental factors influencing human diseases with telomere dysfunction. Int J Clin Exp Med. 2009;2:114–30. Mackay, D.J., Boonen, S.E., Clayton-Smith, J., Goodship, J., Hahnemann, J.M., Kant, S.G., Njolstad, P.R., Robin, N.H., Robinson, D.O., Siebert, R. et al. A maternal hypomethylation syndrome presenting as transient neonatal diabetes mellitus. Hum Genet. 2006;120:262–69. Maher, B. Personal genomes: The case of the missing heritability. Nature. 2008;456: 18–21. Maida, Y., Yasukawa, M., Furuuchi, M., Lassmann, T., Possemato, R., Okamoto, N., Kasim, V., Hayashizaki, Y., Hahn, W.C., Masutomi, K. An RNA-dependent RNA polymerase formed by TERT and the RMRP RNA. Nature. 2009;461:230–35. Manolio, T.A., Brooks, L.D., Collins, F.S. A HapMap harvest of insights into the genetics of common disease. J Clin Invest. 2008;118:1590–605. Markaryan, A., Nelson, E.G., Hinojosa, R. Detection of mitochondrial DNA deletions in the cochlea and its structural elements from archival human temporal bone tissue. Mutat Res. 2008;640:38–45. Marmolino, D., Acquaviva, F., Pinelli, M., Monticelli, A., Castaldo, I., Filla, A., Cocozza, S. PPAR-gamma agonist Azelaoyl PAF increases frataxin protein and mRNA expression: new implications for the Friedreich’s ataxia therapy. Cerebellum. 2009;8:98–103. Marques-Bonet, T., Girirajan, S., Eichler, E.E. The origins and impact of primate segmental duplications. Trends Genet. 2009;25:443–54. Martin, A.N., Li, Y. RNase MRP RNA and human genetic diseases. Cell Res. 2007; 17:219–26. Martinelli, S., Torreri, P., Tinti, M., Stella, L., Bocchinfuso, G., Flex, E., Grottesi, A., Ceccarini, M., Palleschi, A., Cesareni, G. et al. Diverse driving forces underlie the invariant occurrence of the T42A, E139D, I282V and T468M SHP2 amino acid substitutions causing Noonan and LEOPARD syndromes. Hum Mol Genet. 2008;17:2018–29. Masri, A., Bakri, F.G., Al-Hussaini, M., Al-Hadidy, A., Hirzallah, R., de Saint Basile, G., Hamamy, H. Griscelli syndrome type 2: a rare and lethal disorder. J Child Neurol. 2008;23:964–67. Massinen, S., Tammimies, K., Tapia-Paez, I., Matsson, H., Hokkanen, M.E., Soderberg, O., Landegren, U., Castren, E., Gustafsson, J.A., Treuter, E. et al. Functional interaction of DYX1C1 with estrogen receptors suggests involvement of hormonal pathways in dyslexia. Hum Mol Genet. 2009;18:2802–12. Mata, I.F., Hutter, C.M., Gonzalez-Fernandez, M.C., de Pancorbo, M.M., Lezcano, E., Huerta, C., Blazquez, M., Ribacoba, R., Guisasola, L.M., Salvador, C. et al. Lrrk2 R1441G-related Parkinson’s disease: evidence of a common founding event in the seventh century in Northern Spain. Neurogenetics. 2009;10:347–53. Matsui, M., Yachie, N., Okada, Y., Saito, R., Tomita, M. Bioinformatic analysis of post-transcriptional regulation by uORF in human and mouse. FEBS Lett. 2007; 581:4184–88.
216
References
Mattick, J.S. Non-coding RNAs: the architects of eukaryotic complexity. EMBO Rep. 2001;2:986–91. Maurer, I.C., Schippel, P., Volz, H.P. Lithium-induced enhancement of mitochondrial oxidative phosphorylation in human brain tissue. Bipolar Disord. 2009; 11:515–22. McCarroll, S.A., Huett, A., Kuballa, P., Chilewski, S.D., Landry, A., Goyette, P., Zody, M.C., Hall, J.L., Brant, S.R., Cho, J.H. et al. Deletion polymorphism upstream of IRGM associated with altered IRGM expression and Crohn’s disease. Nat Genet. 2008;40:1107–12. McKusick, V.A. Genomics: structural and functional studies of genomes. Genomics. 1997;45:244–49. McLaren, A. Too late for the midwife toad: stress, variability and Hsp90. Trends Genet. 1999;15:169–71. Mefford, H.C., Cooper, G.M., Zerr, T., Smith, J.D., Baker, C., Shafer, N., Thorland, E.C., Skinner, C., Schwartz, C.E., Nickerson, D.A. et al. A method for rapid, targeted CNV genotyping identifies rare variants associated with neurocognitive disease. Genome Res. 2009;19:1579–85. Meissner, C., Bruse, P., Oehmichen, M. Tissue-specific deletion patterns of the mitochondrial genome with advancing age. Exp Gerontol. 2006;41:518–24. Mercer, T.R., Dinger, M.E., Mattick, J.S. Long non-coding RNAs: insights into functions. Nat Rev Genet. 2009;10:155–59. Meyer-Lindenberg, A.S., Olsen, R.K., Kohn, P.D., Brown, T., Egan, M.F., Weinberger, D.R., Berman, K.F. Regionally specific disturbance of dorsolateral prefrontal-hippocampal functional connectivity in schizophrenia. Arch Gen Psychiatry. 2005;62: 379–86. Millar, J.K., James, R., Christie, S., Porteous, D.J. Disrupted in schizophrenia 1 (DISC1): subcellular targeting and induction of ring mitochondria. Mol Cell Neurosci. 2005;30:477–84. Millar, J.K., Pickard, B.S., Mackie, S., James, R., Christie, S., Buchanan, S.R., Malloy, M.P., Chubb, J.E., Huston, E., Baillie, G.S. et al. DISC1 and PDE4B are interacting genetic factors in schizophrenia that regulate cAMP signaling. Science. 2005;310:1187–91. Millar, J.K., Wilson-Annan, J.C., Anderson, S., Christie, S., Taylor, M.S., Semple, C.A., Devon, R.S., Clair, D.M., Muir, W.J., Blackwood, D.H. et al. Disruption of two novel genes by a translocation co-segregating with schizophrenia. Hum Mol Genet. 2000;9:1415–23. Millen, K.J., Gleeson, J.G. Cerebellar development and disease. Curr Opin Neurobiol. 2008;18:12–19. Miller, D.T., Shen, Y., Weiss, L.A., Korn, J., Anselm, I., Bridgemohan, C., Cox, G.F., Dickinson, H., Gentile, J., Harris, D.J. et al. Microdeletion/duplication at 15q13.2q13.3 among individuals with features of autism and other neuropsychiatric disorders. J Med Genet. 2009;46:242–48. Moore, D.J. The biology and pathobiology of LRRK2: implications for Parkinson’s disease. Parkinsonism Relat Disord. 2008;14(Suppl 2):S92–8. Moore, M.J., Schwartzfarb, E.M., Silver, P.A., Yu, M.C. Differential recruitment of the splicing machinery during transcription predicts genome-wide patterns of mRNA splicing. Mol Cell. 2006;24:903–15.
References
217
Moore, P.B., Steitz, T.A. The ribosome revealed. Trends Biochem Sci. 2005;30:281–83. Mosse, Y.P., Laudenslager, M., Longo, L., Cole, K.A., Wood, A., Attiyeh, E.F., Laquaglia, M.J., Sennett, R., Lynch, J.E., Perri, P. et al. Identification of ALK as a major familial neuroblastoma predisposition gene. Nature. 2008;455:930–35. Muchowski, P.J., Wacker, J.L. Modulation of neurodegeneration by molecular chaperones. Nat Rev Neurosci. 2005;6:11–22. Muendlein, A., Saely, C.H., Rhomberg, S., Sonderegger, G., Loacker, S., Rein, P., Beer, S., Vonbank, A., Winder, T., Drexel, H. Evaluation of the association of genetic variants on the chromosomal loci 9p21.3, 6q25.1, and 2q36.3 with angiographically characterized coronary artery disease. Atherosclerosis. 2009;205:174–80. Muotri, A.R., Zhao, C., Marchetto, M.C., Gage, F.H. Environmental influence on L1 retrotransposons in the adult hippocampus. Hippocampus. 2009;19(10):1002–7. Murgatroyd, C., Patchev, A.V., Wu, Y., Micale, V., Bockmuhl, Y., Fischer, D., Holsboer, F., Wotjak, C.T., Almeida, O.F., Spengler, D. Dynamic DNA methylation programs persistent adverse effects of early-life stress. Nat Neurosci. 2009;12:1559–66. Nadeau, J.H. Listening to genetic background noise. N Engl J Med. 2005;352:1598–99. Nakamura, N., Kimura, Y., Tokuda, M., Honda, S., Hirose, S. MARCH-V is a novel mitofusin 2- and Drp1-binding protein able to change mitochondrial morphology. EMBO Rep. 2006;7:1019–22. Nedelsky, N.B., Todd, P.K., Taylor, J.P. Autophagy and the ubiquitin-proteasome system: collaborators in neuroprotection. Biochim Biophys Acta. 2008;1782:691–99. Need, A.C., Ge, D., Weale, M.E., Maia, J., Feng, S., Heinzen, E.L., Shianna, K.V., Yoon, W., Kasperaviciute, D., Gennarelli, M. et al. A genome-wide investigation of SNPs and CNVs in schizophrenia. PLoS Genet. 2009;5:e1000373. Nelson, S.B., Sugino, K., Hempel, C.M. The problem of neuronal cell types: a physiological genomics approach. Trends Neurosci. 2006;29:339–45. Nicholas, A.K., Swanson, E.A., Cox, J.J., Karbani, G., Malik, S., Springell, K., Hampshire, D., Ahmed, M., Bond, J., Di Benedetto, D. et al. The molecular landscape of ASPM mutations in primary microcephaly. J Med Genet. 2009;46:249–53. Nicodemus, K.K., Marenco, S., Batten, A.J., Vakkalanka, R., Egan, M.F., Straub, R.E., Weinberger, D.R. Serious obstetric complications interact with hypoxia-regulated/ vascular-expression genes to influence schizophrenia risk. Mol Psychiatry. 2008; 13:873–77. Niemi, A.K., Majamaa, K. Mitochondrial DNA and ACTN3 genotypes in Finnish elite endurance and sprint athletes. Eur J Hum Genet. 2005;13:965–69. Nikolaev, A., McLaughlin, T., O’Leary, D.D., Tessier-Lavigne, M. APP binds DR6 to trigger axon pruning and neuron death via distinct caspases. Nature. 2009;457: 981–89. Nixon, R.A., Cataldo, A.M. Lysosomal system pathways: genes to neurodegeneration in Alzheimer’s disease. J Alzheimers Dis. 2006;9:277–89. Noda, M., Takahashi, H., Tanabe, T., Toyosato, M., Furutani, Y., Hirose, T., Asai, M., Inayama, S., Miyata, T., Numa, S. Primary structure of alpha-subunit precursor of Torpedo californica acetylcholine receptor deduced from cDNA sequence. Nature. 1982;299:793–97.
218
References
Nopola-Hemmi, J., Taipale, M., Haltia, T., Lehesjoki, A.E., Voutilainen, A., Kere, J. Two translocations of chromosome 15q associated with dyslexia. J Med Genet. 2000;37:771–75. Nowak, M.A., Komarova, N.L., Niyogi, P. Computational and evolutionary aspects of language. Nature. 2002;417:611–17. O’Donovan, M.C., Craddock, N., Norton, N., Williams, H., Peirce, T., Moskvina, V., Nikolov, I., Hamshere, M., Carroll, L., Georgieva, L. et al. Identification of loci associated with schizophrenia by genome-wide association and follow-up. Nat Genet. 2008;40:1053–55. O’Donovan, M.C., Craddock, N.J., Owen, M.J. Genetics of psychosis; insights from views across the genome. Hum Genet. 2009;126:3–12. O’Driscoll, M., Dobyns, W.B., van Hagen, J.M., Jeggo, P.A. Cellular and clinical impact of haploinsufficiency for genes involved in ATR signaling. Am J Hum Genet. 2007;81(1):77–86. O’Driscoll, M., Ruiz-Perez, V.L., Woods, C.G., Jeggo, P.A., Goodship, J.A. A splicing mutation affecting expression of ataxia-telangiectasia and Rad3-related protein (ATR) results in Seckel syndrome. Nat Genet. 2003;33:497–501. Oostra, B.A., Willemsen, R. FMR1: a gene with three faces. Biochim Biophys Acta. 2009;1790:467–77. O’Reilly, M., Teichmann, S.A., Rhodes, D. Telomerases. Curr Opin Struct Biol. 1999;9:56–65. Pagnamenta, A.T., Wing, K., Akha, E.S., Knight, S.J., Bolte, S., Schmotzer, G., Duketis, E., Poustka, F., Klauck, S.M., Poustka, A. et al. A 15q13.3 microdeletion segregating with autism. Eur J Hum Genet. 2009;17:687–92. Pandolfo, M. Friedreich ataxia. Arch Neurol. 2008;65:1296–303. Pannicke, U., Honig, M., Hess, I., Friesen, C., Holzmann, K., Rump, E.M., Barth, T.F., Rojewski, M.T., Schulz, A., Boehm, T. et al. Reticular dysgenesis (aleukocytosis) is caused by mutations in the gene encoding mitochondrial adenylate kinase 2. Nat Genet. 2009;41:101–5. Paracchini, S., Scerri, T., Monaco, A.P. The genetic lexicon of dyslexia. Annu Rev Genomics Hum Genet. 2007;8:57–79. Pattingre, S., Bauvy, C., Levade, T., Levine, B., Codogno, P. Ceramide-induced autophagy: to junk or to protect cells? Autophagy. 2009;5:558–60. Paul, L.K., Brown, W.S., Adolphs, R., Tyszka, J.M., Richards, L.J., Mukherjee, P., Sherr, E.H. Agenesis of the corpus callosum: genetic, developmental and functional aspects of connectivity. Nat Rev Neurosci. 2007;8:287–99. Paunio, T., Ekelund, J., Varilo, T., Parker, A., Hovatta, I., Turunen, J.A., Rinard, K., Foti, A., Terwilliger, J.D., Juvonen, H. et al. Genome-wide scan in a nationwide study sample of schizophrenia families in Finland reveals susceptibility loci on chromosomes 2q and 5q. Hum Mol Genet. 2001;10:3037–48. Penrose, L. The biology of mental defect. London, England: Sidgwick and Jackson; 1954. Quote from p. 96. Perry, G.H., Yang, F., Marques-Bonet, T., Murphy, C., Fitzgerald, T., Lee, A.S., Hyland, C., Stone, A.C., Hurles, M.E., Tyler-Smith, C. et al. Copy number variation and evolution in humans and chimpanzees. Genome Res. 2008;18:1698–710. Pierron, D., Rocher, C., Amati-Bonneau, P., Reynier, P., Martin-Negrier, M.L., Allouche, S., Batandier, C., Mousson de Camaret, B., Godinot, C., Rotig, A. et al.
References
219
New evidence of a mitochondrial genetic background paradox: impact of the J haplogroup on the A3243G mutation. BMC Med Genet. 2008;9:41. Pollard, K.S., Salama, S.R., Lambert, N., Lambot, M.A., Coppens, S., Pedersen, J.S., Katzman, S., King, B., Onodera, C., Siepel, A. et al. An RNA gene expressed during cortical development evolved rapidly in humans. Nature. 2006;443:167–72. Polymeropoulos, M.H. Autosomal dominant Parkinson’s disease and alpha-synuclein. Ann Neurol. 1998;44:S63–4. Popesco, M.C., Maclaren, E.J., Hopkins, J., Dumas, L., Cox, M., Meltesen, L., McGavran, L., Wyckoff, G.J., Sikela, J.M. Human lineage-specific amplification, selection, and neuronal expression of DUF1220 domains. Science. 2006;313:1304-7. Porteous, D.J., Thomson, P., Brandon, N.J., Millar, J.K. The genetics and biology of DISC1–an emerging role in psychosis and cognition. Biol Psychiatry. 2006;60: 123–31. Portin, P. Evolution of man in the light of molecular genetics: a review. Part II. Regulation of gene function, evolution of speech and of brains. Hereditas. 2008;145:113–25. Potkin, S.G., Guffanti, G., Lakatos, A., Turner, J.A., Kruggel, F., Fallon, J.H., Saykin, A.J., Orro, A., Lupoli, S., Salvi, E., et al. Alzheimer’s Disease Neuroimaging Initiative.Hippocampal atrophy as a quantitative trait in a genome-wide association study identifying novel susceptibility genes for Alzheimer’s disease. Alzheimer’s Disease Neuroimaging Initiative PLoS One. 2009;4(8):e6501. Prabhakar, S., Noonan, J.P., Paabo, S., Rubin, E.M. Accelerated evolution of conserved noncoding sequences in humans. Science. 2006;314:786. Prabhakar, S., Visel, A., Akiyama, J.A., Shoukry, M., Lewis, K.D., Holt, A., PlajzerFrick, I., Morrison, H., Fitzpatrick, D.R., Afzal, V. et al. Human-specific gain of function in a developmental enhancer. Science. 2008;321:1346–50. Purcell, S.M., Wray, N.R., Stone, J.L., Visscher, P.M., O’Donovan, M.C., Sullivan, P.F., Sklar, P. Common polygenic variation contributes to risk of schizophrenia and bipolar disorder. Nature. 2009;460:748–52. Query, C.C. Structural biology: Spliceosome subunit revealed. Nature. 2009;458: 418–19. Racker, E. Energy transducing mechanisms. Baltimore, MD: University Park Press; 1975. Raiborg, C., Stenmark, H. The ESCRT machinery in endosomal sorting of ubiquitylated membrane proteins. Nature. 2009;458:445–52. Rajagopalan, S., Nicolas, E., Vivancos, V., Berger, J. and Dickson, B.J. Crossing the midline: roles and regulation of Robo receptors. Neuron. 2000;28:767–77. Ralston, S.H., Langston, A.L., Reid, I.R. Pathogenesis and management of Paget’s disease of bone. Lancet. 2008;372:155–63. Ramirez, A., Heimbach, A., Grundemann, J., Stiller, B., Hampshire, D., Cid, L.P., Goebel, I., Mubaidin, A.F., Wriekat, A.L., Roeper, J. et al. Hereditary parkinsonism with dementia is caused by mutations in ATP13A2, encoding a lysosomal type 5 P-type ATPase. Nat Genet. 2006;38:1184–91. Ramocki, M.B., Zoghbi, H.Y. Failure of neuronal homeostasis results in common neuropsychiatric phenotypes. Nature. 2008;455:912–18. Ranganathan, S., Harmison, G.G., Meyertholen, K., Pennuto, M., Burnett, B.G., Fischbeck, K.H. Mitochondrial abnormalities in spinal and bulbar muscular atrophy. Hum Mol Genet. 2009;18:27–42.
220
References
Rauch, A., Thiel, C.T., Schindler, D., Wick, U., Crow, Y.J., Ekici, A.B., van Essen, A.J., Goecke, T.O., Al-Gazali, L., Chrzanowska, K.H. et al. Mutations in the pericentrin (PCNT) gene cause primordial dwarfism. Science. 2008;319:816–19. Rees, J.L. Genetics of hair and skin color. Annu Rev Genet. 2003;37:67–90. Regenold, W.T., Phatak, P., Marano, C.M., Sassan, A., Conley, R.R., Kling, M.A. Elevated cerebrospinal fluid lactate concentrations in patients with bipolar disorder and schizophrenia: implications for the mitochondrial dysfunction hypothesis. Biol Psychiatry. 2009;65:489–94. Reid, E., Connell, J., Edwards, T.L., Duley, S., Brown, S.E., Sanderson, C.M. The hereditary spastic paraplegia protein spastin interacts with the ESCRT-III complex-associated endosomal protein CHMP1B. Hum Mol Genet. 2005;14: 19–38. Ressler, K.J., Mayberg, H.S. Targeting abnormal neural circuits in mood and anxiety disorders: from the laboratory to the clinic. Nat Neurosci. 2007;10:1116–24. Richter, J.D. CPEB: a life in translation. Trends Biochem Sci. 2007;32:279–85. Richter, J.D., Klann, E. Making synaptic plasticity and memory last: mechanisms of translational regulation. Genes Dev. 2009;23:1–11. Rinn, J.L., Kertesz, M., Wang, J.K., Squazzo, S.L., Xu, X., Brugmann, S.A., Goodnough, L.H., Helms, J.A., Farnham, P.J., Segal, E. et al. Functional demarcation of active and silent chromatin domains in human HOX loci by noncoding RNAs. Cell. 2007;129:1311–23. Rockman, M.V., Hahn, M.W., Soranzo, N., Zimprich, F., Goldstein, D.B., Wray, G.A. Ancient and recent positive selection transformed opioid cis-regulation in humans. PLoS Biol. 2005;3:e387. Romeo, S., Pennacchio, L.A., Fu, Y., Boerwinkle, E., Tybjaerg-Hansen, A., Hobbs, H.H., Cohen, J.C. Population-based resequencing of ANGPTL4 uncovers variations that reduce triglycerides and increase HDL. Nat Genet. 2007;39:513–16. Rosenberg, R.E., Law, J.K., Yenokyan, G., McGready, J., Kaufmann, W.E., Law, P.A. Characteristics and concordance of autism spectrum disorders among 277 twin pairs. Arch Pediatr Adolesc Med. 2009;163:907–14. Roses, A.D. An inherited variable poly-T repeat genotype in TOMM40 in Alzheimer disease. Arch Neurol. 2010;67(5):536–41. Ross, O.A., Braithwaite, A.T., Skipper, L.M., Kachergus, J., Hulihan, M.M., Middleton, F.A., Nishioka, K., Fuchs, J., Gasser, T., Maraganore, D.M. et al. Genomic investigation of alpha-synuclein multiplication and parkinsonism. Ann Neurol. 2008;63: 743–50. Rossner, M.J., Hirrlinger, J., Wichert, S.P., Boehm, C., Newrzella, D., Hiemisch, H., Eisenhardt, G., Stuenkel, C., von Ahsen, O., Nave, K.A. Global transcriptome analysis of genetically identified neurons in the adult cortex. J Neurosci. 2006;26: 9956–66. Ruiz-Pesini, E., Mishmar, D., Brandon, M., Procaccio, V., Wallace, D.C. Effects of purifying and adaptive selection on regional variation in human mtDNA. Science. 2004;303:223–26. Rujescu, D., Ingason, A., Cichon, S., Pietilainen, O.P., Barnes, M.R., Toulopoulou, T., Picchioni, M., Vassos, E., Ettinger, U., Bramon, E. et al. Disruption of the neurexin 1 gene is associated with schizophrenia. Hum Mol Genet. 2009;18:988–96.
References
221
Rutherford, S.L., Lindquist, S. Hsp90 as a capacitor for morphological evolution. Nature. 1998;396:336–42. Sabeti, P.C., Schaffner, S.F., Fry, B., Lohmueller, J., Varilly, P., Shamovsky, O., Palma, A., Mikkelsen, T.S., Altshuler, D., Lander, E.S. Positive natural selection in the human lineage. Science. 2006;312:1614–20. Saftig, P., Klumperman, J. Lysosome biogenesis and lysosomal membrane proteins: trafficking meets function. Nat Rev Mol Cell Biol. 2009;10:623–35. Salathia, N., Queitsch, C. Molecular mechanisms of canalization: Hsp90 and beyond. J Biosci. 2007;32:457–63. Samaco, R.C., Hogart, A., LaSalle, J.M. Epigenetic overlap in autism-spectrum neurodevelopmental disorders: MECP2 deficiency causes reduced expression of UBE3A and GABRB3. Hum Mol Genet. 2005;14:483–92. Samani, N.J., Erdmann, J., Hall, A.S., Hengstenberg, C., Mangino, M., Mayer, B., Dixon, R.J., Meitinger, T., Braund, P., Wichmann, H.E. et al. Genome-wide association analysis of coronary artery disease. N Engl J Med. 2007;357:443–53. Samuels, D.C., Schon, E.A., Chinnery, P.F. Two direct repeats cause most human mtDNA deletions. Trends Genet. 2004;20:393–98. Sandberg, R., Neilson, J.R., Sarma, A., Sharp, P.A., Burge, C.B. Proliferating cells express mRNAs with shortened 3' untranslated regions and fewer microRNA target sites. Science. 2008;320:1643–47. SanGiovanni, J.P., Arking, D.E., Iyengar, S.K., Elashoff, M., Clemons, T.E., Reed, G.F., Henning, A.K., Sivakumaran, T.A., Xu, X., DeWan, A. et al. Mitochondrial DNA variants of respiratory complex I that uniquely characterize haplogroup T2 are associated with increased risk of age-related macular degeneration. PLoS One. 2009;4: e5508. Sanlaville, D., Verloes, A. CHARGE syndrome: an update. Eur J Hum Genet. 2007;15:389–99. Sawada, I., Willard, C., Shen, C.K., Chapman, B., Wilson, A.C., Schmid, C.W. Evolution of Alu family repeats since the divergence of human and chimpanzee. J Mol Evol. 1985;22:316–22. Schara, U., Kress, W., Bonnemann, C.G., Breitbach-Faller, N., Korenke, C.G., Schreiber, G., Stoetter, M., Ferreiro, A., von der Hagen, M. The phenotype and longterm follow-up in 11 patients with juvenile selenoprotein N1-related myopathy. Eur J Paediatr Neurol. 2008;12:224–30. Scheffler, Immo E. Mitochondria. 2nd ed. Hoboken, New York: Wiley-Liss Inc.; 2008. Schmid-Kubista, K.E., Tosakulwong, N., Wu, Y., Ryu, E., Hecker, L.A., Baratz, K.H., Brown, W.L., Edwards, A.O. Contribution of copy number variation in the regulation of complement activation locus to development of age-related macular degeneration. Invest Ophthalmol Vis Sci. 2009;50:5070–9. Schoenemann, P.T., Sheehan, M.J., Glotzer, L.D. Prefrontal white matter volume is disproportionately larger in humans than in other primates. Nat Neurosci. 2005;8:242–52. Schultz, J.M., Yang, Y., Caride, A.J., Filoteo, A.G., Penheiter, A.R., Lagziel, A., Morell, R.J., Mohiddin, S.A., Fananapazir, L., Madeo, A.C. et al. Modification of human hearing loss by plasma-membrane calcium pump PMCA2. N Engl J Med. 2005;352:1557–64.
222
References
Schwenk, J., Harmel, N., Zolles, G., Bildl, W., Kulik, A., Heimrich, B., Chisaka, O., Jonas, P., Schulte, U., Fakler, B. et al. Functional proteomics identify cornichon proteins as auxiliary subunits of AMPA receptors. Science. 2009;323:1313–19. Seddon, J.M., Reynolds, R., Maller, J., Fagerness, J.A., Daly, M.J., Rosner, B. Prediction model for prevalence and incidence of advanced age-related macular degeneration based on genetic, demographic, and environmental variables. Invest Ophthalmol Vis Sci. 2009;50:2044–53. Sharp, A.J., Mefford, H.C., Li, K., Baker, C., Skinner, C., Stevenson, R.E., Schroer, R.J., Novara, F., De Gregori, M., Ciccone, R. et al. A recurrent 15q13.3 microdeletion syndrome associated with mental retardation and seizures. Nat Genet. 2008;40: 322–28. Sharp, P.A. The centrality of RNA. Cell. 2009;136:577–80. Shaw, P., Eckstrand, K., Sharp, W., Blumenthal, J., Lerch, J.P., Greenstein, D., Clasen, L., Evans, A., Giedd, J., Rapoport, J.L. Attention-deficit/hyperactivity disorder is characterized by a delay in cortical maturation. Proc Natl Acad Sci U S A. 2007;104:19649–54. Sherwood, C.C., Stimpson, C.D., Raghanti, M.A., Wildman, D.E., Uddin, M., Grossman, L.I., Goodman, M., Redmond, J.C., Bonar, C.J., Erwin, J.M. et al. Evolution of increased glia-neuron ratios in the human frontal cortex. Proc Natl Acad Sci U S A. 2006;103:13606–11. Shi, J., Levinson, D.F., Duan, J., Sanders, A.R., Zheng, Y., Pe’er, I., Dudbridge, F., Holmans, P.A., Whittemore, A.S., Mowry, B.J. et al. Common variants on chromosome 6p22.1 are associated with schizophrenia. Nature. 2009;460:753–57. Shriberg, L.D., Jakielski, K.J., El-Shanti, H. Breakpoint localization using array-CGH in three siblings with an unbalanced 4q;16q translocation and childhood apraxia of speech (CAS). Am J Med Genet A. 2008;146A:2227–33. Simpson, C.L., Lemmens, R., Miskiewicz, K., Broom, W.J., Hansen, V.K., van Vught, P.W., Landers, J.E., Sapp, P., Van Den Bosch, L., Knight, J. et al. Variants of the elongator protein 3 (ELP3) gene are associated with motor neuron degeneration. Hum Mol Genet. 2009;18:472–81. Sklar, P., Pato, M.T., Kirby, A., Petryshen, T.L., Medeiros, H., Carvalho, C., Macedo, A., Dourado, A., Coelho, I., Valente, J. et al. Genome-wide scan in Portuguese Island families identifies 5q31-5q35 as a susceptibility locus for schizophrenia and psychosis. Mol Psychiatry. 2004;9:213–18. Smith, K.M., Ohkubo, Y., Maragnoli, M.E., Rasin, M.R., Schwartz, M.L., Sestan, N., Vaccarino, F.M. Midline radial glia translocation and corpus callosum formation require FGF signaling. Nat Neurosci. 2006;9:787–97. Smyth, D.J., Plagnol, V., Walker, N.M., Cooper, J.D., Downes, K., Yang, J.H., Howson, J.M., Stevens, H., McManus, R., Wijmenga, C. et al. Shared and distinct genetic variants in type 1 diabetes and celiac disease. N Engl J Med. 2008;359:2767–77. Somerville, M.J., Mervis, C.B., Young, E.J., Seo, E.J., del Campo, M., Bamforth, S., Peregrine, E., Loo, W., Lilley, M., Perez-Jurado, L.A. et al. Severe expressive-language delay related to duplication of the Williams-Beuren locus. N Engl J Med. 2005;353:1694–701. Spencer, S.L., Gaudet, S., Albeck, J.G., Burke, J.M., Sorger, P.K. Non-genetic origins of cell-to cell variability in TRAIL-induced apoptosis. Nature. 2009; 459(7245):428–32.
References
223
Spinazzola, A., Viscomi, C., Fernandez-Vizarra, E., Carrara, F., D’Adamo, P., Calvo, S., Marsano, R.M., Donnini, C., Weiher, H., Strisciuglio, P. et al. MPV17 encodes an inner mitochondrial membrane protein and is mutated in infantile hepatic mitochondrial DNA depletion. Nat Genet. 2006;38:570–75. Spinazzola, A., Zeviani, M. Disorders of nuclear-mitochondrial intergenomic signaling. Gene. 2005;354:162–68. Spitzer, N.C. Neuroscience: A bar code for differentiation. Nature. 2009;458:843–4. Splawski, I., Yoo, D.S., Stotz, S.C., Cherry, A., Clapham, D.E., Keating, M.T. CACNA1H mutations in autism spectrum disorders. J Biol Chem. 2006;281:22085–91. St Clair, D. Copy number variation and schizophrenia. Schizophr Bull. 2009;35:9–12. Starkov, A.A., Beal, F.M. Portal to Alzheimer’s disease. Nat Med. 2008;14:1020–21. Stefansson, H., Ophoff, R.A., Steinberg, S., Andreassen, O.A., Cichon, S., Rujescu, D., Werge, T., Pietilainen, O.P., Mors, O., Mortensen, P.B. et al. Common variants conferring risk of schizophrenia. Nature. 2009;460:744–47. Stefansson, H., Rujescu, D., Cichon, S., Pietilainen, O.P., Ingason, A., Steinberg, S., Fossdal, R., Sigurdsson, E., Sigmundsson, T., Buizer-Voskamp, J.E. et al. Large recurrent microdeletions associated with schizophrenia. Nature. 2008;455:232–36. Straub, R.E., MacLean, C.J., Ma, Y., Webb, B.T., Myakishev, M.V., Harris-Kerr, C., Wormley, B., Sadek, H., Kadambi, B., O’Neill, F.A. et al. Genome-wide scans of three independent sets of 90 Irish multiplex schizophrenia families and follow-up of selected regions in all families provides evidence for multiple susceptibility genes. Mol Psychiatry. 2002;7:542–59. Striessnig, J., Koschak, A., Sinnegger-Brauns, M.J., Hetzenauer, A., Nguyen, N.K., Busquet, P., Pelster, G., Singewald, N. Role of voltage-gated L-type Ca2+ channel isoforms for brain function. Biochem Soc Trans. 2006;34:903–9. Strobel, S., Hoyer, P.F., Mache, C.J., Sulyok, E., Liu, W.S., Richter, H., Oppermann, M., Zipfel, P.F., Jozsi, M. Functional analyses indicate a pathogenic role of factor H autoantibodies in atypical haemolytic uraemic syndrome. Nephrol Dial Transplant. 2009;25:136–44. Südhof, T.C. Neuroligins and neurexins link synaptic function to cognitive disease.Nature. 2008;455(7215):903–11. Sudhof, T.C., Malenka, R.C. Understanding synapses: past, present, and future. Neuron. 2008;60:469–76. Sultan, M., Schulz, M.H., Richard, H., Magen, A., Klingenhoff, A., Scherf, M., Seifert, M., Borodina, T., Soldatov, A., Parkhomchuk, D. et al. A global view of gene activity and alternative splicing by deep sequencing of the human transcriptome. Science. 2008;321:956–60. Sun, M., Ma, F., Zeng, X., Liu, Q., Zhao, X.L., Wu, F.X., Wu, G.P., Zhang, Z.F., Gu, B., Zhao, Y.F. et al. Triphalangeal thumb-polysyndactyly syndrome and syndactyly type IV are caused by genomic duplications involving the long range, limb-specific SHH enhancer. J Med Genet. 2008;45:589–95. Szatmari, P., Paterson, A.D., Zwaigenbaum, L., Roberts, W., Brian, J., Liu, X.Q., Vincent, J.B., Skaug, J.L., Thompson, A.P., Senman, L. et al. Mapping autism risk loci using genetic linkage and chromosomal rearrangements. Nat Genet. 2007;39: 319–28. Tai, H.C., Schuman, E.M. Ubiquitin, the proteasome and protein degradation in neuronal function and dysfunction. Nat Rev Neurosci. 2008;9:826–38.
224
References
Taipale, M., Kaminen, N., Nopola-Hemmi, J., Haltia, T., Myllyluoma, B., Lyytinen, H., Muller, K., Kaaranen, M., Lindsberg, P.J., Hannula-Jouppi, K. et al. A candidate gene for developmental dyslexia encodes a nuclear tetratricopeptide repeat domain protein dynamically regulated in brain. Proc Natl Acad Sci U S A. 2003;100: 11553–58. Takei, N., Miyashita, A., Tsukie, T., Arai, H., Asada, T., Imagawa, M., Shoji, M., Higuchi, S., Urakami, K., Kimura, H. et al. Genetic association study on in and around the APOE in late-onset Alzheimer disease in Japanese. Genomics. 2009;93: 441–48. Tarpey, P.S., Smith, R., Pleasance, E., Whibley, A., Edkins, S., Hardy, C., O’Meara, S., Latimer, C., Dicks, E., Menzies, A. et al. A systematic, large-scale resequencing screen of X-chromosome coding exons in mental retardation. Nat Genet. 2009;41: 535–43. Tartaglia, M., Mehler, E.L., Goldberg, R., Zampino, G., Brunner, H.G., Kremer, H., van der Burgt, I., Crosby, A.H., Ion, A., Jeffery,s S. et al. Mutations in PTPN11, encoding the protein tyrosine phosphatase SHP-2, cause Noonan syndrome. Nat Genet. 2001;29(4):465–68. Thedieck, K., Polak, P., Kim, M.L., Molle, K.D., Cohen, A., Jeno, P., Arrieumerlou, C., Hall, M.N. PRAS40 and PRR5-like protein are new mTOR interactors that regulate apoptosis. PLoS One. 2007;2:e1217. Thery, C., Ostrowski, M., Segura, E. Membrane vesicles as conveyors of immune responses. Nat Rev Immunol. 2009;9:581–93. Thiel, C.T., Mortier, G., Kaitila, I., Reis, A.,Rauch, A. Type and level of RMRP functional impairment predicts phenotype in the cartilage hair hypoplasia-anauxetic dysplasia spectrum. Am J Hum Genet. 2007;81:519–29. Thomas, L. The Medusa and the Snail: The Hazards of Science. First published 1979 by Viking Press. Paperback edition Penguin Books 1995 quote is from paragraph 1 page 74. Thompson, A.R., Golledge, J., Cooper, J.A., Hafez, H., Norman, P.E., Humphries, S.E. Sequence variant on 9p21 is associated with the presence of abdominal aortic aneurysm disease but does not have an impact on aneurysmal expansion. Eur J Hum Genet. 2009;17:391–94. Tian, B., Pan, Z., Lee, J.Y. Widespread mRNA polyadenylation events in introns indicate dynamic interplay between polyadenylation and splicing. Genome Res. 2007;17:156–65. Tidyman, W.E., Rauen, K.A. Noonan, Costello and cardio-facio-cutaneous syndromes: dysregulation of the Ras-MAPK pathway. Expert Rev Mol Med. 2008;10:e37. Tippens, A.L., Pare, J.F., Langwieser, N., Moosmang, S., Milner, T.A., Smith, Y., Lee, A. Ultrastructural evidence for pre- and postsynaptic localization of Cav1.2 L-type Ca2+ channels in the rat hippocampus. J Comp Neurol. 2008;506:569–83. Tishkoff, S.A., Reed, F.A., Ranciaro, A., Voight, B.F., Babbitt, C.C., Silverman, J.S., Powell, K., Mortensen, H.M., Hirbo, J.B., Osman, M. et al. Convergent adaptation of human lactase persistence in Africa and Europe. Nat Genet. 2007;39:31–40. Tomblin, J.B., O’Brien, M., Shriberg, L.D., Williams, C., Murray, J., Patil, S., Bjork, J., Anderson, S., Ballard, K. Language features in a mother and daughter of a chromosome 7;13 translocation involving FOXP2. J Speech Lang Hear Res. 2009;52: 1157–74.
References
225
Toni, N., Laplagne, D.A., Zhao, C., Lombardi, G., Ribak, C.E., Gage, F.H., Schinder, A.F. Neurons born in the adult dentate gyrus form functional synapses with target cells. Nat Neurosci. 2008;11:901–7. Trezza, V., Campolongo, P., Cassano, T., Macheda, T., Dipasquale, P., Carratu, M.R., Gaetani, S., Cuomo, V. Effects of perinatal exposure to delta-9-tetrahydrocannabinol on the emotional reactivity of the offspring: a longitudinal behavioral study in Wistar rats. Psychopharmacology (Berl). 2008;198:529–37. Turbyville, T.J., Wijeratne, E.M., Liu, M.X., Burns, A.M., Seliga, C.J., Luevano, L.A., David, C.L., Faeth, S.H., Whitesell, L., Gunatilaka, A.A. Search for Hsp90 inhibitors with potential anticancer activity: isolation and SAR studies of radicicol and monocillin I from two plant-associated fungi of the Sonoran desert. J Nat Prod. 2006;69:178–84. Uddin, M., Opazo, J.C., Wildman, D.E., Sherwood, C.C., Hof, P.R., Goodman, M., Grossman, L.I. Molecular evolution of the cytochrome c oxidase subunit 5A gene in primates. BMC Evol Biol. 2008;8:8. Urbanski, M.J., Kovacs, F.E., Szabo, B. Depolarizing GABAergic synaptic input triggers endocannabinoid-mediated retrograde synaptic signaling. Synapse. 2009;63: 643–52. Valente, E.M., Brancati, F., Dallapiccola, B. Genotypes and phenotypes of Joubert syndrome and related disorders. Eur J Med Genet. 2008;51:1–23. Valente, L., Tiranti, V., Marsano, R.M., Malfatti, E., Fernandez-Vizarra, E., Donnini, C., Mereghetti, P., De Gioia, L., Burlina, A., Castellan, C. et al. Infantile encephalopathy and defective mitochondrial DNA translation in patients with mutations of mitochondrial elongation factors EFG1 and EFTu. Am J Hum Genet. 2007;80: 44–58. van Bon, B.W., Mefford, H.C., Menten, B., Koolen, D.A., Sharp, A.J., Nillesen, W.M., Innis, J.W., de Ravel, T.J., Mercer, C.L., Fichera, M., Stewart, H., et al. Further delineation of the 15q13 microdeletion and duplication syndromes: a clinical spectrum varying from nonpathogenic to a severe outcome. J Med Genet. 2009;46(8):511–23. van Es, M.A., van den Berg, L.H. Alzheimer’s disease beyond APOE. Nat Genet.2009;41(10):1047–48. Vance, C., Rogelj, B., Hortobagyi, T., De Vos, K.J., Nishimura, A.L., Sreedharan, J., Hu, X., Smith, B., Ruddy, D., Wright, P. et al. Mutations in FUS, an RNA processing protein, cause familial amyotrophic lateral sclerosis type 6. Science. 2009;323: 1208–11. Vandepoele, K., Van Roy, N., Staes, K., Speleman, F., van Roy, F. A novel gene family NBPF: intricate structure generated by gene duplications during primate evolution. Mol Biol Evol. 2005;22:2265–74. Varki, A., Geschwind, D.H., Eichler, E.E. Explaining human uniqueness: genome interactions with environment, behaviour and culture. Nat Rev Genet. 2008;9:749–63. Veatch, J.R., McMurray, M.A., Nelson, Z.W., Gottschling, D.E. Mitochondrial dysfunction leads to nuclear genome instability via an iron-sulfur cluster defect. Cell. 2009;137:1247–58. Vembar, S.S., Brodsky, J.L. One step at a time: endoplasmic reticulum-associated degradation. Nat Rev Mol Cell Biol. 2008;9:944–57. Vergarajauregui, S., Puertollano, R. Mucolipidosis type IV: the importance of functional lysosomes for efficient autophagy. Autophagy. 2008;4:832–34.
226
References
Vernes, S.C., Newbury, D.F., Abrahams, B.S., Winchester, L., Nicod, J., Groszer, M., Alarcon, M., Oliver, P.L., Davies, K.E., Geschwind, D.H. et al. A functional genetic link between distinct developmental language disorders. N Engl J Med. 2008;359: 2337–45. Vernes, S.C., Nicod, J., Elahi, F.M., Coventry, J.A., Kenny, N., Coupe, A.M., Bird, L.E., Davies, K.E., Fisher, S.E. Functional genetic analysis of mutations implicated in a human speech and language disorder. Hum Mol Genet. 2006;15:3154–67. Vernes, S.C., Spiteri, E., Nicod, J., Groszer, M., Taylor, J.M., Davies, K.E., Geschwind, D.H., Fisher, S.E. High-throughput analysis of promoter occupancy reveals direct neural targets of FOXP2, a gene mutated in speech and language disorders. Am J Hum Genet. 2007;81:1232–50. Vincent, K.A., Wilson, A.C. Evolution and transcription of old world monkey globin genes. J Mol Biol. 1989;207:465–80. Wallace, A.R., Contributions to the Theory of Natural Selection. Macmillan and Company; 1871. Wallace, D.C., Brown, M.D., Lott, M.T. Mitochondrial DNA variation in human evolution and disease. Gene. 1999;238:211–30. Wallace, D.C., Fan, W. Energetics, epigenetics, mitochondrial genetics. Mitochondrion. 2010;10:12–31. Wallace, D.C., Zheng, X.X., Lott, M.T., Shoffner, J.M., Hodge, J.A., Kelley, R.I., Epstein, C.M., Hopkins, L.C. Familial mitochondrial encephalomyopathy (MERRF): genetic, pathophysiological, and biochemical characterization of a mitochondrial DNA disease. Cell. 1988;55:601–10. Walne, A.J., Dokal, I. Advances in the understanding of dyskeratosis congenita. Br J Haematol. 2009;145:164–72. Walsh, T., McClellan, J.M., McCarthy, S.E., Addington, A.M., Pierce, S.B., Cooper, G.M., Nord, A.S., Kusenda, M., Malhotra, D., Bhandari, A. et al. Rare structural variants disrupt multiple genes in neurodevelopmental pathways in schizophrenia. Science. 2008;320:539–43. Wang, Z., Gerstein, M., Snyder, M. RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Genet. 2009;10:57–63. Waterland, R.A., Jirtle, R.L. Transposable elements: targets for early nutritional effects on epigenetic gene regulation. Mol Cell Biol. 2003;23:5293–300. Watkins, K.E., Vargha-Khadem, F., Ashburner, J., Passingham, R.E., Connelly, A., Friston, K.J., Frackowiak, R.S., Mishkin, M., Gadian, D.G. MRI analysis of an inherited speech and language disorder: structural brain abnormalities. Brain. 2002;125:465–78. Waxman, E.A., Giasson, B.I. Molecular mechanisms of alpha-synuclein neurodegeneration. Biochim Biophys Acta. 2009;1792:616–24. Weydt, P., Soyal, S.M., Gellera, C., Didonato, S., Weidinger, C., Oberkofler, H., Landwehrmeyer, G.B., Patsch, W. The gene coding for PGC-1alpha modifies age at onset in Huntington’s Disease. Mol Neurodegener. 2009;4:3. Wigg, K.G., Feng, Y., Crosbie, J., Tannock, R., Kennedy, J.L., Ickowicz, A., Malone, M., Schachar, R., Barr, C.L. Association of ADHD and the Protogenin gene in the chromosome 15q21.3 reading disabilities linkage region. Genes Brain Behav. 2008; 7:877–86.
References
227
Williams, N.A., Close, J.P., Giouzeli, M., Crow, T.J. Accelerated evolution of Protocadherin11X/Y: a candidate gene-pair for cerebral asymmetry and language. Am J Med Genet B Neuropsychiatr Genet. 2006;141B:623–33. Wilson, A.C., Maxson, L.R., Sarich, V.M. Two types of molecular evolution. Evidence from studies of interspecific hybridization. Proc Natl Acad Sci U S A. 1974;71: 2843–47. Wilson, A.C., Sarich, V.M. A molecular time scale for human evolution. Proc Natl Acad Sci U S A. 1969;63:1088–93. Wilson, A.C., Sarich, V.M., Maxson, L.R. The importance of gene rearrangement in evolution: evidence from studies on rates of chromosomal, protein, and anatomical evolution. Proc Natl Acad Sci U S A. 1974;71:3028–30. Wozniak, M.A., Mee, A.P., Itzhaki, R.F. Herpes simplex virus type 1 DNA is located within Alzheimer’s disease amyloid plaques. J Pathol. 2009;217:131–38. Wray, G.A., Babbitt, C.C. Genetics. Enhancing gene regulation. Science. 2008;321:1300–1. Wright, A.F., Murphy, M.P., Turnbull, D.M. Do organellar genomes function as longterm redox damage sensors? Trends Genet. 2009;25:253–61. Yang, S., Wang, K., Gregory, B., Berrettini, W., Wang, L.S., Hakonarson, H., Bucan, M. Genomic landscape of a three-generation pedigree segregating affective disorder. PLoS One. 2009;4:e4474. Yeyati, P.L., van Heyningen, V. Incapacitating the evolutionary capacitor: Hsp90 modulation of disease. Curr Opin Genet Dev. 2008;18:264–72. Yunis, J.J., Prakash, O. The origin of man: a chromosomal pictorial legacy. Science. 1982;215:1525–30. Zahir, F.R., Baross, A., Delaney, A.D., Eydoux, P., Fernandes, N.D., Pugh, T., Marra, M.A., Friedman, J.M. A patient with vertebral, cognitive and behavioural abnormalities and a de novo deletion of NRXN1alpha. J Med Genet. 2008;45:239–43. Zhao, C., Deng, W., Gage, F.H. Mechanisms and functional implications of adult neurogenesis. Cell. 2008;132:645–60. Zheng, X.L., Sadler, J.E. Pathogenesis of thrombotic microangiopathies. Annu Rev Pathol. 2008;3:249–77. Zunino, R., Schauss, A., Rippstein, P., Andrade-Navarro, M., McBride, H.M. The SUMO protease SENP5 is required to maintain mitochondrial morphology and function. J Cell Sci. 2007;120:1178–88. Zuo, L., Luo, X., Kranzler, H.R., Lu, L., Rosenheck, R.A., Cramer, J., van Kammen, D.P., Erdos, J., Charney, D.S., Krystal, J. et al. Association study of DTNBP1 with schizophrenia in a US sample. Psychiatr Genet. 2009;19:292–304.
This page intentionally left blank
INDEX
A3243G mutation, 100 A3243 tRNAleu mutation, 100 Aberrant alternate ribonucleoproteins, phenotypes associated with, 81–82 Abnormal spindle homolog microcephaly associated (ASPM) protein, 159 ADAMTS13, 194 Adaptive evolution, 30 Adenosine monophosphate kinase (AMPK), 11 Adenosine nucleotide translocator (ANT1), 101 Adenylate kinase 2, 92 Adolescent brain changes, gene expression in, 146–47 Alpha synuclein, 190–91 Alzheimer’s disease and apolipoprotein E (APOE) region, 62–64 late-onset, 58 AMPA glutamate receptors, 143 protein trafficking, 143 Amygdala, 164 Amyloid beta precursor binding protein (APBA2) gene, 43 Amyloid precursor-like protein (APLP2), 148 Amyloid precursor protein (APP), 148, 149
Anaplastic lymphoma receptor tyrosine kinase (ALK), 90 Aneurysm risk, 58 ANGPTL4 protein, 66 Apolipoprotein E (APOE) region and Alzheimer’s disease, 62–64 Apoptosis and cell death, 110–11 Aquaporin, species-specific amplifications of, 21 2-Arachidononyglycerol, 180 Arenosine triphosphate (ATP) synthesis, 70 Artificial reproductive technologies (ART), 15 ASPM (abnormal spindle homolog microcephaly associated), 22 Ataxia telangiectasia and RAD3-related protein (ATR), 158 ATP13A2, 193 ATP2B2 gene, allelic variation in, 8 Attention deficit hyperactivity disorder (ADHD) and autism, 177–78 Atypical hemolytic uremic syndrome (aHUS), 194–95 AUG code, 185 Aurora, 77
229
230
Index
Autism attention deficit hyperactivity disorder (ADHD) and, 177–78 calcium signaling in, 176–77 dosage changes within specific genes, 43–44 neurexin in, 141 neuroligins in, 141–42 Autism spectrum disorder (ASD), 141–42 Autophagy, in mammalian cells, 122 Autophagy related complexes (ATG), 122 Axonal pruning, 148 Barth syndrome, 105 BAX, 148 Beckwith Wiedeman overgrowth syndrome, 12 Behavioral processes, 177–78 Bell, Julia, 4 Binding protein SBP2 (SECISBP2), 186 Bioenergetics and epigenetics, 9–11 Bipolar disorders and schizophrenia, relationship between, 168–71 Bone morphogenetic protein 4 (BMP4), 92 Bone morphogenic protein (BMP), 145 BRAF1 gene, 187 Brain, human human-specific mutation in, 22–23 Brain-expressed genes, evidence of positive selection for, 28 CACNA1C gene, 169, 176 CACNA1D, 175–76 Cadherin 23 gene (CDH23), 8 Calcium calmodulin-dependent serine protein kinase (CASK) gene, 67 Calcium ion channels and neurobehavioral syndromes, 175–76 Calcium influx of, 143 signaling, in autism, 176–77 C allele, 30 Calmodulin, 174 Cannabinoid receptor (CB1), 166 Cannabis and endocannabinoid system, 178–80 Cardiac outflow tract anomalies and valve disease, 92–93 Cardio-facial cutaneous syndrome, 186–87 Cartilage hair hypoplasia syndrome (CHH), 86, 89, 116 Caspase, 148 Caspase 3, 110 CASPR2 (contactin associated protein 2), 152
Catechol-O-methyltransferase (COMT), 179 Cav1.2 calcium ion channels, 176 Cav1.4 channels, 176 CDK5 regulatory subunit-associated protein (CDKRAP2), 159 Cell growth and cell death, balancing, 111 Cell lineages, 90–91 Centaurin (CENTG2) gene, 25 Central nervous system culling and pruning death receptors in, 148–49 Centrosomal and DNA breakage repair pathway genes, involvement of, 158–59 Centrosomal protein 290 (CEP290), 184 Centrosome, 157 Ceroid Lipofuscinosis neuronal type 3 (CLN3), 130 CFHR genes, 195 Chaperones DNAJ domain, 132 HSP90, 134–36 protein folding and function of, 133–34 Charcot Marie Tooth neuropathy type 2D (CMT2D), 84 CHARGE syndrome, 181–83 clinical findings, 181–82 gene defect in, 182–83 Chediak-Higashi syndrome, 126 Childhood apraxia, of speech, 153 Chimeric nonlinear transcripts, 71 Chimpanzees and humans, evolution and last common ancestor of, 28 lactase persistence, 30–31 Chloride ion channel gene (CLCN1), 82 CHMP1B-interacting molecule spastin, 123 Choanal atresia, CHARGE syndrome, 182 CHRNA7 gene, 46, 48, 49 Chromatin immunoprecipitation (CHIP) methods, 151–52 Chromatin modification, 72–73 Chromodomain helicase (CHD7), 182 Chromosome 1q21 region, 45 Chromosome 1q32, 194, 195 Chromosome 2q12.3, 21 Chromosome 3q24, 184 Chromosome 4q21, 189–90 Chromosome 5q, evidence for schizophrenia locus on, 171 Chromosome 6p25, 50 Chromosome 6q, 183 Chromosome 7q11.3 and language, 152–53 Chromosome 7q21.1, 183
Index Chromosome 7q36, 26 Chromosome 8q12, 182 Chromosome 9p21.3 genotype, 58–59 specific locus on, 57–58 Chromosome 9qter, 183 Chromosome 11, 183 Chromosome 11p15, 12 Chromosome 12q24.1, 187 Chromosome 15q13-q14, 188 Chromosome 15q21-q22 and dyslexia genes, 154–55 Chromosome 17p13.3 gene, 104 CNTNAP2 (contactin associated protein-like 2), 152, 170 Comparative genomic hybridization (CGH), 11, 19, 45 Complement factor, 193–96 complement factor F, 195 complement factor H, 193 mutations in membrano-proliferative glomerulonephritis and aHUS, 194–95 genomic architecture, 195–96 Complex III ubiquinol cytochrom c oxidoreductase, 96 Complex inheritance, penetrance and contribution to, 47 15q13.3 microdeletions, 47–48 Complex mosaics, genomes as, 37 Congenital dyskeratosis, 87 Congenital heart disease, 91–92 Copy number changes and genomic architecture, 35 and rearrangements impacting specific genes, 21–22 Copy number variants (CNVs), 19–20, 38–40, 55, 170 and phenotype, 41 in schizophrenia, 41–43, 171–73 variable phenotypes associated with, 41 Coronary heart disease and myocardial infarction, 57–58 Corticotropin releasing hormone receptor (CRHR1), 83 Costello syndrome, 186–87 CPEB2 protein, 77 CPEB4 protein, 77 CpG dinucleotides, 8 CpG islands, 72 Cyclic AMP responsive element binding protein (CREB), 175, 176 Cytochrome C oxidase (CoxC), 18, 95, 96, 103
231
Dandy Walker abnormality, 182, 184 Darius Hutterite population, 107 DCDC2 (double cortin domain) gene, 154 Death receptors, 147 culling and pruning in CNS, 148–49 Delta-9-tetrahydrocannabinol, 179 Desmin-related muscular dystrophy with Mallory bodies, 184 Diamond Blackfan anemia, 86 Diaphonous (DIAPH), 33 Disrupted in schizophrenia gene (DISC1), 42, 145, 156 Disruptions and mutations in Semaphorin 3A (SEMA3E), 183 Dizygotic twins, 13 DNAJC19 gene, 106 DNAJ domain, 106 chaperones, 132 DNA methyl transferase (DNMT), 9 DNA transcription, 112–14 Dopamine neurons development, 160–61 new molecules discovery, in well-studied receptors, 161 Dorsolateral frontal cortex (DLPFC), 166 Down syndrome, 4 DR6 receptor, 148 gene expression, 149 Dynamin related protein (DRP1), 104 Dyskeratosis congenita, 53 Dyslexia, genetic factors in, 153 chromosome 15q21-q22, 154–55 Dyslexia type 5 locus (DYX5), 155 Dystrobrevin binding protein 1 (DTNBP1), 157 Dystrophies, 184 DYX1C1 (dyslexia susceptibility 1 candidate 1) gene, 154–55 E139D, 187 Ear defects, CHARGE syndrome, 182 Escherichia coli strain O157:H7, 194 EIF4EBP, 144 EIF4E transcription initiation factor, 144 Elongation factor (Efsec), 186 ELP3 protein, 84 Endocannabinoid N-arachidonylethanolamine, 180 Endocannabinoids, endogenous, 143 Endocannabinoid system, 178–80 Endoplasmic reticulum degradation pathway (ERAD), 133 Endosomal sorting complexes for transport (ESCRT), 128
232
Index
Endosome–lysosome trafficking and lysosome-related organelles, 123–25 Epigenetics, 8–9, 15 and behavior, 12–13 and bioenergetics, 9–11 definition of, 5 ERBB4 genes, 44 Erythropoietin, 86 Estrage, 192 ETV1, 161 Evidence as to Man’s Place in Nature, 4 Evolution, 16 brain-expressed genes, evidence of positive selection for, 28 copy number changes and rearrangements, 21–22 fossil records and polymorphism data, correlating, 31–32 genome changes in, of humans and nonhuman primates, 19–21 and last common ancestor of humans and chimpanzees, 28 lactase persistence, 30–31 mitochondrial DNA evolution and species barcodes, 17–18 molecular anthropathology phylogenetics and phenotypes, 32 population migrations, 33 Y chromosome haplotypes, 33–34 positive natural selection, 26–27 protein domains and domain structure, 18–19 protocadherin H11X/Y, 22 accelerated evolution of conserved non-protein coding sequences in humans, 24–25 enhancers’ role in evolution, 25–26 gene duplications in hominids, 23–24 human-specific mutation in the human brain, 22–23 sensory function level, evolution at, 24 specific deletion in humans, 23 relatedness, analyses of, 16–17 Exon-joining complex (EJC) proteins, 76, 78 Experience-related plasticity, 143 EYA1 (eyes absent homologous genes), 33 EYA4, 33 Eye defects, CHARGE syndrome, 182 Familial amyotrophic lateral sclerosis (FALS), 84 Fanconi anemia, 158
Fibroblast growth factor receptor 1 (FGFR1), 149 15q13.3 deletions, 46–47 15q13.3 microdeletions, 47–48 Flavin adenine dinucleotide (FADH2), 94 Fluorescence in situ hydridization (FISH) analysis, 37, 51–52 FMRP and regulation of translation, 87–88 Fossil records and polymorphism data, correlating, 31–32 FOXP2 (forkhead box P2) protein, 22, 24, 150–51 downstream targets of, 151–52 neural correlates of, 151 FOXP2 gene, 31, 32 Fragile-X-associated tremor/ataxia syndrome (FRXATS), 88 Frataxin gene (FXN), 114 Friedreich ataxia, 114–15 Frogs and mammals, evolution in, 16–17 Functional magnetic resonance imaging (FMRI), 164–65 Functional neuroimaging in psychiatric disorders, 167 Functional proteomic analyses, 161 FUS gene, 84 G2019S, 191, 192 GABA (gamma-amino-butyric acid), 143, 166 GABA transporter 1 (GAT1), 166 Galton, Francis, 4 Gelsolin, 110 Gene-dosage-attributable ocular phenotypes, 50 Gene duplications in hominids, 23–24 Gene–environment interaction, 64 Gene expression, post-transcriptional control of, 76 Gene interactions, exploring, 7–8 Gene rearrangement, phenomenon of, 16 Genetic events and neuroimaging, correlation of, 167 Genetic variation and drug response, 65–66 Genome changes in evolution of humans and nonhuman primates, 19–21 as complex mosaics, 37 in schizophrenia, copy number variation in, 171–73 Genome-wide association studies (GWAS), 55, 167 limitations of, 60–62
Index and risk factors for type 2 diabetes mellitus, 59 Genomic architecture and copy number changes, 35 complex inheritance, penetrance and contribution to, 47 15q13.3 microdeletions, 47–48 complex mosaics, genomes as, 37 copy number variants (CNVs), 38–340 and phenotype, 41 in schizophrenia, 41–43 variable phenotypes associated with, 41 dosage changes within specific genes, 43–44 gene-dosage-attributable ocular phenotypes, 50 homeostasis, 50 microdeletion syndromes, phenotype in, 48–50 novel gene families, generation of, 36–37 psychiatric phenotypes, overlap between, 44 chromosome 1q21 region, 45 15q13.3 deletions, 46–47 16p11.2 deletions, 45–46 rare copy number, 38 recurrent copy number variants and phenotype, 40–41 role of genome architecture changes in evolution, 35–36 segmental duplication maps, 37 and core duplicons, 38 telomeres, 52–53 telomeric and subtelomeric chromosome abnormalities, phenotype in, 51–52 Genomic imprinting, 12 Genotype to phenotype, relating, 5–6 Gli proteins, 184 Glutamic acid decarboxylase (GAD67), 166 Glutathione peroxidases (GPX), 186 Griscelli syndrome, 126 H19 (non-coding RNA element), 14 Harris, Harry, 4–5 Hearing loss, sensorineural, 7–8 Hemolytic uremic syndrome (HUS), 194–95 Hepatocyte nuclear factor (HNF1B) gene, 40 Hermansky-Pudlak syndrome (HPS), 125 Herpes simplex virus 1 (HSV1) and mitochondrial sequences, 64–65 Heterochromatin, 73 Hindbrain abnormalities, CHARGE syndrome, 182 Hippocampus, 145–46
233
HLA (histocompatibility antigen) gene, 22 Holt-Oram syndrome, 92 Homeostasis, 122–23 definition of, 50 Hominids, gene duplications in, 23–24 HOX (homeobox) transcription factors, 150 Hox transcript antisense RNA (HOTAIR), 70 HSP40, 106 HSP60 protein, 105 HSP90 chaperones, genetic variability, and canalization, 134–36 HSP90 protein, 136 definition of, 135 Human-accelerated conserved noncoding sequence 1 (HACNS1), 25 Human-accelerated region 1 (HAR1) RNA, 25 Humans and chimpanzees, evolution and last common ancestor of, 28 lactase persistence, 30–31 Humans and nonhuman primates, genome changes in evolution of, 19–21 Human-specific mutation in human brain, 22–23 Huntington’s disease (HD), 115 Huxley, Thomas Henry, 4 Hydrocephaly inducing homolog (HYDIN) gene, 45 Hypomethylation syndrome, 12–13 Hypotonia, and spinal scoliosis, 185 I2020T, 191 I202V, 187 IGF2 (insulin-like growth factor locus), 14 Imprinted loci, 12 interferon receptor (IL28B), 65 Inversion polymorphisms, 17 IRGM (immunity-related GTPase family) gene, 61 Iron metabolism, 114–15 Iron-sulfur clusters, 114–15 JAZF zinc finger 1 gene (JAZF1), 71 JBTS1, 183 JBTS2, 183 JBTS3, 183 Joubert-related disorders (JSRD), 184 Joubert syndrome (JS), 183–84 molar tooth sign, 183 KIAA0319 gene, 29, 154 KRAS, 187 Kufor Rakeb syndrome, 192
234
Index
L1 retrotransposon activity, 14 Lactase persistence, 30–31 Language and FOXP2, 150 downstream targets, 151–52 neural correlates, 151 Large-scale multiethnic studies on candidate genes, 66 Late-onset Alzheimer’s disease (LOAD), 58. See also Alzheimer’s disease Late-onset disease, studies of, 5 L-DOPA therapy, 192 Leber’s Hereditary Optic Neuropathy (LHON), 98 LEOPARD syndrome, 187 Leucine-Rich Kinase 2 (LRRK2), 191–92 population distribution, 192 Lewy bodies and alpha synuclein, 190–91 Limb regions 1 (LMBR1) gene, 26 LIM homeodomains, 50 Lineage-specific genome copy changes, 21 Linkage, association, and linkage disequilibrium, 54 apolipoprotein E (APOE) region and Alzheimer’s disease, 62–64 gene–environment interaction, 64 genetic variation drug response, 65–66 range of, 55–56 GWAS and risk factors for type 2 diabetes mellitus, 59 limitations of, 60–62 HSV1 and mitochondrial sequences, 64–65 identifying genes and allelic variants, 54–55 large-scale multiethnic studies on candidate genes, 66 shared causal variants, indications for, 60 variants and phenotypes, 56 chromosome 9p21.3, specific locus on, 57–58 chromosome 9p21.3 genotype, 58–59 X-linked mental retardation (XLMR), 67 Lipid milieu, 105 Lissencephaly1 (LIS1), 156 Literacy, signatures for, 155–56 Locus control regions (LCR), 72–73 Low-copy repeats (LCRs), 51 element on chromosome 16 (LCR16), 37 L type calcium channels (LTCC), 175 Lysosomal associated membrane protein 2 (LAMP2) receptor, 123
Lysosomal exocytosis, 125 Lysosomal membrane proteins (LMPs), 124 Lysosome-related organelles (LROS), 125–27 endosome–lysosome trafficking and, 123–25 Majewski type II dwarfism (MOPD II), 158–59 Malformation syndromes, molecular analyses of CHARGE syndrome, 181–83 gene defect in, 182–83 Joubert syndrome (JS), 183–84 Joubert-related disorders (JSRD), 184 neurofibromatosis and neurofibromatosislike phenotype, 188 phenotypic overlap, 186–87 single gene mutations, 184–86 Mallory bodies, 184 Mammalian target of rapamycin (mTOR), 144 MARCH5 mutants, 104 Matrics Consensus Cognitive Battery (MCCB), 163 McKusick, Victor, 5 MCOLN1, 125 MCPH6 centromere protein J (CENPJ), 159 MECP2 (methylCpG binding protein), 9, 10 gene mutations, 11 Melanocortin receptor 1 (MC1R) gene, 31, 32 MELAS symptoms, 100 Membrano-proliferative glomerulonephritis, CFH mutations in, 194–95 Mendelian disorders, phenotypes in, 7 Mental retardation, male patients with, 11 Messenger RNA (mRNA) and protein, interactions, 76 transcripts, splicing of, 75 RNA splicing and evolution, 75 spliceosome structure, complexity, and function, 75–76 translation, control of, 76–77 Methylation, 8 Methyl binding domain proteins (MBD1-4), 9 MFN2 mutants, 104 Microcephaly and growth retardation, 158–59 Microcephaly type 1 (MCPH1), 158 Microdeletion syndromes, phenotype in, 48–50 Mini mental state examination (MMSE), 58 Mitochondria, 94 abnormalities of mitochondrial function, 115–17 apoptosis and cell death, 110–11 cell growth and cell death, balancing, 111
Index defining phenotypes caused by mitochondrial functional defects, 99 deletions, tissue-specificity, and aging, 103 DNA evolution and species barcodes, 17–18 DNA replication and maintenance, 101–3 DNA transcription, 112–14 dynamics and biogenesis, 103–4 dysfunction, and Parkinson’s disease, 117 sporadic, 117–18 evolutionary changes in, 95–99 Friedreich ataxia, 114–15 genetics, 5 haplogroups, 97 HSV1 and, 64–65 as hub for cellular calcium signaling, 111 import into mitochondria, 105–6 iron metabolism, 114–15 iron-sulfur clusters, 114–15 lipid milieu, 105 membranes, proton gradient, and ATPsynthase, 108 membranes and apoptosis, 109–10 in monozygotic twins, 14 mt-ATP6 gene, phenotypes resulting from specific mutations in, 108–9 neuronal migration and, 104–5 and nuclear genome instability, 118–19 nucleus and, signaling between, 119–20 pathogenesis of mitochondrial disorders, 101 PGC1alpha and Huntington’s disease (HD), 115 protein import, 106–7 into mitochondria and pathology, 107 solute passage, 107 TOMM40 and Alzheimer’s disease, 107 variable phenotypes, evidence of associated with specific mitochondrial mutation, 100–1 Mitochondrial genome maintenance protein (MGM1P), 104 Mitochondrial RNA processing endoribonuclease RNA component (RMRP), 89 and TERT, interaction between, 89–90 Mixed/schizoaffective psychoses, 168 Modifier genes, 7 Mohr-Tranenberg syndrome, 107 Molar tooth sign, 183, 184 Molecular anthropathology phylogenetics and phenotypes, 32 population migrations, 33 Y chromosome haplotypes, 33–34
235
Molecular chaperones, 131 DNAJ domain chaperones, 132 Monozygotic twins, 13 epigenetics and phenotypic differences in, 13–14 genomic instability, 14 mitochondria in, 14 MPV17 gene, 102 mRPS16 protein, 113 mt-ATP6 gene, phenotypes resulting from specific mutations in, 108–9 Multiminicore disease, 185 Muscular dystrophy, 184 MYCN gene (myelomytosis viral related oncogene), 90 Myelin expression factor (MEF2/MYEF2), 176 Myocardial infarction and coronary heart disease, 57–58 Myosin 16 (MYH16), 23 NDEL1, 156 NDN (necdin homolog), 41 Neanderthal mitochondrial sequence, 31 Nervous system shaping, programmed cell death in, 147 Neural cell adhesion molecule (NCAM), 145 Neuregulin 1 (NRG1), 146 Neuregulins, 159–60 Neurexin, 140–41 in autism, 141 Neurexin 1 gene (NRXN1), 38 exons, 43–44 Neurobehavioral disorders, 162 attention deficit hyperactivity disorder (ADHD) and autism, 177–78 and calcium ion channels, 175–76 calcium signaling in autism, 176–77 cannabis and endocannabinoid system, 178–80 developmental pathways and schizophrenia, 165–67 functional neuroimaging in psychiatric disorders, 167 genetic events and neuroimaging, correlation of, 167 genome in schizophrenia, copy number variation in, 171–73 neuroimaging studies, 164 functional magnetic resonance imaging (FMRI), 164–65
236
Index
Neurobehavioral disorders (continued) psychiatric diseases, transformative approaches to the pathophysiology of, 162–63 schizophrenia and bipolar disorders, relationship between, 168–71 schizophrenia etiology, determining, 173–75 Neuroblastoma breakpoint protein family (NBPF) gene, 23, 36 Neurodegenerative diseases, 83–85 Neurodevelopment and functional genomics, 139 adolescent brain changes, gene expression in, 146–47 centrosomal and DNA breakage repair pathway genes, involvement of, 158–59 centrosome, 157 chromosome 7q11.3 and language, 152–53 death receptors, 147 culling and pruning in CNS, 148–49 DISC1 gene, 156 dopamine neurons, development of, 160 dyslexia, genetic factors in, 153 chromosome 15q21-q22, 154–55 dystrobrevin binding protein 1 (DTNBP1), 157 lissencephaly1 (LIS1), 156 literacy, signatures for, 155–56 NDEL1, 156 neural connectivity, 149 spinal motor neurons, 149–50 neuregulins, 159–60 neurexin, 140–41 in autism, 141 neurogenesis, in postnatal and adult life, 145 Line 1 (L1) retrotransposons, 146 neuroligins, 140, 141 in autism, 141–42 new molecules discovery, in well-studied receptors, 160 nuclear disruption factor (NDE1), 156 programmed cell death, in nervous system shaping, 147 speech, childhood apraxia of, 153 speech, language, and FOXP2, 150 downstream targets, 151–52 neural correlates, 151 synapses, 139–40 synaptic transmission and use-dependent plasticity, 142–45 Neurofibromatosis, 188 Neurofibromatosis 1 gene (NF1), 188
Neurofibromatosis-like phenotype, 188 Neurofibromin, 188 Neurogenesis, in postnatal and adult life, 145 and Line 1 (L1) retrotransposons, 146 Neurogenic differentiation factor D2 (NeuroD2), 146 Neurogranin, 174 Neuroimaging studies, 164 functional magnetic resonance imaging (FMRI), 164–65 Neuroligins, 140, 141 in autism, 141–42 Neuronal cell death, 148 Neuronal migration and mitochondria, 104–5 Neurophysiological processes, 177–78 Neuropsin, 22, 27 Neurosteroids and behavioral processes, 177–78 Neurotransmitter receptors, 143 Neutropenia, 86 Nicotinamide adenine dinucleotide (NADH), 94 Nicotinic acetylcholine receptor, 142 Nijmegen breakage syndrome, 158 NMDA (N-methyl-D-aspartic acid activated) receptors, 175 Noggin, 145 Nonhuman primates and humans, genome changes in evolution of, 19–21 Noonan syndrome, 186–87 Novel gene families, generation of, 36–37 NPHP1, 184 Nuclear disruption factor (NDE1), 156 nuclear gene, disease-causing mutations in, 89 Nuclear position, 72–73 Nucleus and mitochondria, signaling between, 119–20 nudE nuclear distribution (NDE1) gene, 42 Omo Valley, humans in, 31 OTOR (otoraplin), 33 p75NTR, 48 Paget’s disease of bone, 136 up-regulation of SQSTM1 expression in, 138 Pan troglodytes endogenous retrovirus 1 (PTERV1), 21 PARK2 gene, 129 Parkinson’s disease (PD) early-onset, 192–93 Kufor Rakeb syndrome, 192–93 interaction of nuclear and mitochondrial gene products, 193
Index Leucine-Rich kinase 2 (LRRK2), 191–92 Lewy bodies and alpha synuclein, 190–91 and mitochondria dysfunction, 117 sporadic, 117–18 synuclein, 189–90 Parvalbumin neurons, 166 PDE4 (phosphodiesterase 4), 156 PDZ domain proteins, 140 Penrose, Lionel, 4 Pericentrin gene (PCNT), 158 Permeability transition pore (PTP), 112 Peroxisome proliferator-activated receptor (PPAR) gamma agonists, 115 PGC1alpha and Huntington’s disease (HD), 115 Phenotype and functional genomics, 3 background, 3–5 epigenetics, 8–9, 15 and behavior, 12–13 and bioenergetics, 9–11 gene interactions, exploring, 7–8 genomic imprinting, 12 genotype to phenotype, relating, 5–6 hypomethylation syndrome, 12–13 MECP2 gene mutations, 11 modifier genes, 7 monozygotic twins, 13 epigenetics and phenotypic differences in, 13–14 genomic instability, 14 mitochondria in, 14 Physiome Project, 6–7 Phenotypic overlap cardio-facial cutaneous syndrome, 186–87 Costello syndrome, 186–87 Noonan syndrome, 186–87 RAS MAP kinase pathway, 188 Physiome Project, 6–7 PICALM protein, 131 PINK1 protein, 118 Plasma membrane calcium pump (PMCA2), 8 Plasticity experience-related, 143 synaptic, 143–44 POLG1 mutations, 101–2 POLG2 mutations, 101–2 Polyadenylation, 76–77 Polymerase chain reaction (PCR), 47 amplification, 32 Population migrations, 33 Positive natural selection, 26–27 PRAS40 protein, 111 Preganglionic motor column (PGC), 150
237
Prodynorphin gene, 28 Programmed cell death, in nervous system shaping, 147 Promoters, 72–73 Prosody, 66 Protein arginine methyl transferases 5 (PRMT5), 75 Protein domains definition of, 18 and domain structure, 18–19 Protein folding and function of chaperones, 133–34 Protein–mRNA interactions, 76 Protein tyrosine phosphatase 11 (PTPN11), 93 Protocadherin H11X/Y (PCDH11X and PCDH11Y), 22 accelerated evolution of conserved non-protein coding sequences in humans, 24–25 enhancers’ role in evolution, 25–26 gene duplications in hominids, 23–24 human-specific mutation in human brain, 22–23 sensory function level, evolution at, 24 specific deletion in humans, 23 PRR5L protein, 111 PSD95, (post-synaptic density protein 95), 156 Pseudouridylation, 87 Psychiatric disorders, functional neuroimaging in, 167 Psychiatric phenotypes, overlap between, 44 chromosome 1q21 region, 45 15q13.3 deletions, 46–47 16p11.2 deletions, 45–46 PTPN11, 187 PVRL2 gene, 63 Quality surveillance, 121 autophagy, 122 endoplasmic reticulum degradation pathway, 133 endosome–lysosome trafficking and lysosome-related organelles, 123–25 homeostasis, 122–23 HSP90 chaperones, genetic variability, and canalization, 134–36 lysosome-related organelles (LROS), 125–27 molecular chaperones, 131 DNAJ domain chaperones, 132 Paget’s disease of bone, 136 up-regulation of SQSTM1 expression in, 138
238
Index
Quality surveillance (continued) protein folding and the function of chaperones, 133–34 sequestosome function, 137–38 sequestosome ubiquitin pathway interaction, 136 valosin-containing protein (VCP), 132 ubiquitin, 127 -like proteins, 127 and membrane proteins, 127–28 ubiquitination and endoplasmic reticulum, 128 ubiquitin proteasome system (UPS) and the synapse, 128–31 R1441C, 191 R1441G, 191 R1441H, 191 R328X mutation, in FOXP2, 151 R553H mutation, in FOXP2, 151 RAF1, 187 RAN binding proteins (RANBP), 38 RANBP2 (Ran binding protein 2), 21 Rare copy number, 38 RAS MAP kinase (RAS MAPK), 175 germline mutations in, 186 Reactive oxygen species (ROS) production, 96 Recessive muscular dystrophy with fiber disproportion, 184 Recurrent copy number variants and phenotype, 40–41 Reelin, 145 Regulatory sequences, mapping, 71–72 Relatedness, analyses of, 16–17 Reticular dysgenesis, 91–92 Retinaldehyde dehydrogenase 2 (RALDH2), 50 Retinitis pigmentosa GTPase regulator interacting protein (RPGRIP1L), 184 Rett syndrome, 10, 11 Ribonucleic acid (RNA) editing, regulation of, 82–83 modification, 86–87 splicing and evolution, 75 transcription, regulation of, 83–85 Ribonucleoprotein complexes, 74–75 Ribosome biogenesis, 79 defects of, 86–87 structure, 79 Rigid Spine muscular dystrophy, 184
ROBO1 (round-about axon guidance receptor) gene, 155 Russell Silver dwarfism syndrome, 12 S6 kinase binding protein (SKAR), 78, 144 S-adenosylmethionine (SAM), 9 Schizophrenia copy number variants (CNVs) in, 41–43, 171–73 and bipolar disorders, relationship between, 168–71 and developmental pathways, 165–67 dosage changes within specific genes, 43–44 etiology, determining, 173–75 phenotype, different aspects of, 163 Schwachman Diamond syndrome, 86 SCR20, 195 SEC14L1 gene, 71 SECIS, 186 Seckel syndrome, 158 Sec tRNA, 186 Segmental duplications definition of, 36 maps, 37 and core duplicons, 38 Selenium, 185–86 Selenocysteine insertion sequence (SECIS), 186 Selenoprotein N gene (SEPN1), 184–85 Selenoproteins, incorporation of, 185–86 Semaphorin 3A (SEMA3E) disruptions and mutations, 183 Senior Loken syndrome, 184 Sense and antisense transcripts, 70–71 Sensorineural hearing loss, 7–8 Sensory function level, evolution at, 24 Sequestosome function, 137–38 Sequestosome ubiquitin pathway interaction, 136 17q21.31 microdeletion, 40 SH3 multiple ankyrin repeat domains (SHANK3), 141, 142 “Shadow enhancers,” 25 Shared causal variants, indications for, 60 Shiga toxin, 194–95 Short inhibitory RNA (siRNA) -protected neurons, 148 Short interspersed nuclear repeat (SINE), 20 Short tandem repeats (STRs), 33 polymorphisms, 34 SHP2, 187
Index Sickle cell hemoglobin (HbS) heterozygotes, 26 SIGLEC6 gene, 23 Single gene, mutations in, 184–86 selenoproteins and its incorporation, 185 Single-nucleotide polymorphisms (SNPs), 31, 34, 42, 54, 57, 84 648-nucleotide segment of mitochondrial DNA, 18 16p11.2 deletions, 45–46 Small Cajal body RNPs (scaRNPs), 74 small nuclear RNAs (SnRNAs), 74 Small nucleolar RNAs (snoRNAs), 74, 82 Small ribonucleoprotein complexes (snRNPs), 75 snoRNA HBII-52, 82–83 SNRPN (small nuclear ribonucleoprotein polypeptide N), 41 Sonic Hedgehog (SHH) pathway, 26, 184 SOS, 187 Speech childhood apraxia of, 153 and FOXP2, 150 downstream targets, 151–52 neural correlates, 151 Spinal bulbar muscular atrophy (SBMA), 115 Spinal motor neurons, 149–50 Spinal muscular atrophy (SMA), 81 Spinal scoliosis, and hypotonia, 185 Spliceosome structure, complexity, and function, 75–76 Splicing mRNA transcripts, splicing of, 75 RNA splicing and evolution, 75 spliceosome structure, complexity, and function, 75–76 RNA splicing and evolution, 75 translation and exon splicing, 77–78 Spondylometaphyseal dysplasia, 113 SPRED1, 188 SRED1, 188 Steroids and behavioral processes, 177–78 Steroid sulfatase (STS) deficiency, 177, 178 STIL, 159 Sulfated dihydroepiandrosterone (DHEAS), 177–78 SUMO1 protein, 104 Superoxide dismutase gene (SOD1), 84 Survival motor neuron protein (SMN protein), 75 Synaptic plasticity, 143–44 Synaptic transmission, 139–40 and use-dependent plasticity, 142–45
239
Synaptojanin, 143 Syndactyly type IV, 26 Synuclein, 189–90, 193 Synuclein gene (SNCA), 189–90 SYP gene, 67 T1441C, 192 Taffazin (TAZ) gene, 105 Tajima D test, 27 T allele, 30 TAR binding protein (TARDP), 84 TAR domain protein 43 (TDP43), 81 Target of Rapamycin (TOR), 78 complexes, 111 T box transcription factor (TBX1) deficiency, 92 Telomerase reverse transcriptase (TERT) and RMRP, interaction between, 89–90 Telomerase RNA, 87 Telomeres, 52–53 Telomeric and subtelomeric chromosome abnormalities, phenotype in, 51–52 Tenascin R, 145 TGA code, 185, 186 Thrombocytopenia and absent radius (TAR), 45 Timothy syndrome, 176 TIM proteins, 106 T-interacting nuclear factor (TIN2) gene, 90 TOMM40 gene, 63 and Alzheimer’s disease, 107 Transcription chimeric nonlinear transcripts, 71 gene expression, post-transcriptional control of, 76 mRNA transcripts, splicing of, 75 profiling, 69 RNA transcription, regulation of, 83–85 sense and antisense transcripts, 70–71 Transcription profiling, 69 of cell types, 69–70 Translation and exon splicing, 77–78 FMRP and regulation of, 87–88 initiation, 79–81 mRNA translation, control of, 76–77 3′ untranslated region of mRNA, 73–74 Transmembrane protein 67 (TMEM67), 184 Treasury of Human Inheritance, The, 4 Triphalangeal thumb polysyndactyly syndrome, 26 Twins, 4. See also Dizygotic twins; Monozygotic twins
240
Index
Ubiquinol cytochrome C reductase core protein 1 (UQCRC1), 10–11 Ubiquitin, 127 conjugation, 110 and membrane proteins, 127–28 -like proteins, 127 Ubiquitination and endoplasmic reticulum, 128 Ubiquitin E3 ligase (UBE3A), 129 Ubiquitin proteasome system (UPS) and the synapse, 128–31 UGA code, 185 Ultiminocore disease, 184 3′ Untranslated region (3′ UTR) of mRNA, 73–74 Upstream open reading frames (UORFs), 73
Verbal dyspraxia, 151 Von Economo neurons, 24
Valosin-containing protein (VCP), 132 Variable number of tandem repeats (VNTR), 20–21 Vascular dementia (VaD), 58 Vascular endothelial growth factor (VEGF), 145 Vascular endothelial growth factor A (VEGFA) isoforms, 79
ZIC1, 184 ZIC4, 184 Zinc finger genes, 184 Zinc finger protein (ZNF804A), 167 ZNRD1 (zinc ribbon domain-containing transcription factor), 65 Zone of polarizing regulatory sequence (ZRS), 26
Williams Beuren syndrome, 152 Wilson, Alan, 5 WNT proteins, 92 Working memory, 165 X-linked icthyosis, 177 X-linked mental retardation (XLMR), 67 Y204H, 194 Y279C, 187 Y955C mutation, 102 Y chromosome haplotypes, 33–34