Plant Defence: Biological Control (Progress in Biological Control)

Plant Defence: Biological Control Progress in Biological Control Volume 12 Published: Volume 2 J. Eilenberg and H.M.T...

Author: Jean Michel Mérillon | Kishan Gopal Ramawat

341 downloads 3038 Views 7MB Size Report

This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!

Report copyright / DMCA form

DOWNLOAD PDF

Plant Defence: Biological Control

Progress in Biological Control Volume 12 Published: Volume 2 J. Eilenberg and H.M.T. Hokkanen (eds.): An Ecological and Societal Approach to Biological Control. 2007 ISBN 978-1-4020-4320-8 Volume 3 J. Brodeur and G. Boivin (eds.): Trophic and Guild Interactions in Biological Control. 2006 ISBN 978-1-4020-4766-4 Volume 4 J. Gould, K. Hoelmer and J. Goolsby (eds.): Classical Biological Control of Bemisia tabaci in the United States. 2008 ISBN 978-1-4020-6739-6 Volume 5 J. Romeis, A.M. Shelton and G. Kennedy (eds.): Integration of Insect-Resistant Genetically Modiﬁed Crops within IPM Programs. 2008 HB ISBN 978-1-4020-8372-3; PB ISBN 978-1-4020-8459-1 Volume 6 A.E. Hajek, T.R. Glare and M.O’Callaghan (eds.): Use of Microbes for Control and Eradication of Invasive Arthropods. 2008 ISBN: 978-1-4020-8559-8 Volume 7 H.M.T. Hokkanen (ed.): Relationships of Natural Enemies and Non-Prey Foods. 2008 ISBN: 978-1-4020-9234-3 Volume 8 S.S. Gnanamanickam: Biological Control of Rice Diseases ISBN: 978-90-481-2464-0 Volume 9 F.L. Cônsoli, J.R.P. Parra and R.A. Zucchi (eds.): Egg Parasitoids in Agroecosystems with Emphasis on Trichogramma ISBN: 978-1-4020-9109-4 Volume 10 W.J. Ravensberg: A Roadmap to the Successful Development and Commercialization of Microbial Pest Control Products for Control of Arthropods ISBN: 978-94-007-0436-7 Volume 11 K. Davies and Y. Spiegel (eds.): Biological Control of Plant-Parasitic Nematodes. 2011 ISBN: 978-1-4020-9647-1 For further volumes: http://www.springer.com/series/6417

Jean Michel Mérillon s Kishan Gopal Ramawat Editors

Plant Defence: Biological Control

Editors Jean Michel Mérillon Gr. d’Etude Subst. Vég. à Act. Biolog. Institut des Sciences de la Vigne et du University of Bordeaux Chemin de Leysotte 210 33882 Villenave d’Ornon France [email protected]

Kishan Gopal Ramawat Botany, University College of Science M.L. Sukhadia University Durga Nursery Road 313002 Udaipur, Rajasthan India [email protected]

ISBN 978-94-007-1932-3 e-ISBN 978-94-007-1933-0 DOI 10.1007/978-94-007-1933-0 Springer Dordrecht Heidelberg London New York Library of Congress Control Number: 2011939066 © Springer Science+Business Media B.V. 2012 No part of this work may be reproduced, stored in a retrieval system, or transmitted in any form or by any means, electronic, mechanical, photocopying, microﬁlming, recording or otherwise, without written permission from the Publisher, with the exception of any material supplied speciﬁcally for the purpose of being entered and executed on a computer system, for exclusive use by the purchaser of the work. Printed on acid-free paper Springer is part of Springer Science+Business Media (www.springer.com)

Preface

Approximately 6.6 billion humans now inhabit the Earth. Notably, the human population has grown nearly ten-fold over the past three centuries and has increased by a factor of four in the last century. Therefore, demand for food, feed and fodder is ever increasing. Plant diseases worldwide are responsible for billions of dollars worth of crop losses every year. Productivity of crops is at risk due to the incidence of pests, pathogens and animal pests. Crop losses to pests can be substantial and may be reduced by various control activities. Estimates on the crop loss are available for major food and cash crops on the world level. Among crops the total loss potential of pests world-wide varies from 25 to 40%. Globally, enormous losses of the crops are caused by the plant diseases, which can occur from the time of seed sowing in the ﬁeld to harvesting and storage. Important historical evidences of plant disease epidemics are Irish Famine due to late blight of potato (Ireland, 1845), Bengal famine due to brown spot of rice (India, 1942) and Coffee rust (Sri Lanka, 1967). Such epidemics had left their effect on the economy of the affected countries and deep scar on the memories of human civilization. Plant diseases, caused primarily by fungal and bacterial pathogens, cause losses of agricultural and horticultural crops every year. These losses can result in reduced food supplies, poorer quality of agricultural products, economic hardship for growers and processor and results ultimately in higher prices for the consumers. For many diseases, traditional chemical control methods are not always economical nor are they effective, and fumigation as well as other chemical control methods may have unwanted health, safety and environmental risks. Biological control involves use of beneﬁcial micro-organism, such as specialised fungi and bacteria to attack and control plant pathogens and diseases they cause. Biological control offers an environmental friendly approach to the management of plant diseases and can be incorporated in to cultural and physical controls and limited chemical uses for an effective integrated pest management system. Due to the high cost of synthetic pesticides and concerns over environmental pollution associated with the continuous use of these chemicals, there is a renewed interest in the use of botanicals and biological control agents for crop protection. Beneﬁts and v

vi

Preface

risks are always associated with new technologies and their utilization. These types of considerations have encouraged microbiologists and plant pathologists to gain a better knowledge of biocontrol agents, to understand their mechanism of control and to explore new biotechnological approaches to induce natural resistance. This book provides a comprehensive account of interaction of host and its abiotic stress factors and biotic pathogens, and development of biological control agents for practical applications in crops and tree species, from temperate to subtropical regions. The contents are divided into the following sections: s s s s

General biology of parasitism Applications of biological and natural agents for disease resistance Host parasite interaction Mechanism of defence

The chapters have been written by well known workers in their research ﬁeld. The book is primarily designed for use by upper undergraduates and post graduates studying crop protection, agricultural sciences, applied entomology, plant pathology, and plant sciences. Biological and agricultural research scientists in biotechnology, forestry, plant pathology and post harvest technology, crop management and environmental sciences, agrochemical and crop protection industries, and in academia, will ﬁnd much of great use in this book. Libraries in all universities and research establishments where agricultural and biological sciences are studied and taught should have multiple copies of this very valuable book on their shelves. The editors wish to thank all the contributors and staff of the Springer for their cooperation in completion of this book. Prof. J.M. Mérillon and Prof. K.G. Ramawat

Contents

Part I 1

Co-evolution of Pathogens, Mechanism Involved in Pathogenesis and Biocontrol of Plant Diseases: An Overview ....... Jaya Arora, Shaily Goyal, and Kishan G. Ramawat

Part II 2

3

4

General Biology of Parasitism

3

Applications of Biological and Natural Agents

Stilbenes: Biomarkers of Grapevine Resistance to Disease of High Relevance for Agronomy, Oenology and Human Health.................................................................................. Katia Gindro, Virginia Alonso-Villaverde, Olivier Viret, Jean-Laurent Spring, Guillaume Marti, Jean-Luc Wolfender, and Roger Pezet

25

Alternatives to Synthetic Fungicides Using Small Molecules of Natural Origin ............................................. Christian Chervin

55

Fungi as Biological Control Agents of Plant-Parasitic Nematodes ................................................................. Mohammad Reza Moosavi and Rasoul Zare

67

5

Secondary Metabolites and Plant Defence ........................................... 109 Shaily Goyal, C. Lambert, S. Cluzet, J.M. Mérillon, and Kishan G. Ramawat

6

Trends for Commercialization of Biocontrol Agent (Biopesticide) Products ................................................................ 139 Catherine Regnault-Roger

vii

viii

Contents

7

The Role of Indigenous Knowledge in Biological Control of Plant Pathogens: Logistics of New Research Initiatives.................. 161 Arun Kumar and A.K. Purohit

8

Plant Chemicals in Post Harvest Technology for Management of Fungal, Mycotoxin and Insect Contamination of Food Commodities ................................................... 195 N.K. Dubey, Priyanka Singh, Bhanu Prakash, and Prashant K. Mishra

9

Ganoderma Diseases of Woody Plants of Indian Arid Zone and Their Biological Control ................................................................. 209 Rikhab Raj Bhansali

10

Plant Defence Against Heavy Metal Stress ........................................... 241 N.C. Aery

Part III

Host Parasite Interaction

11

Gall Phenotypes – Product of Plant Cells Defensive Responses to the Inducers Attack ........................................ 273 Rosy Mary dos Santos Isaias and Denis Coelho de Oliveira

12

The Role of Roots in Plant Defence ....................................................... 291 Matthias Erb

Part IV

Mechanism and Signal Transduction

13

Activation of Grapevine Defense Mechanisms: Theoretical and Applied Approaches .................................................... 313 Marielle Adrian, Sophie Trouvelot, Magdalena Gamm, Benoît Poinssot, Marie-Claire Héloir, and Xavier Daire

14

Plant Cyclotides: An Unusual Protein Family with Multiple Functions ......................................................................... 333 Michelle F.S. Pinto, Isabel C.M. Fensterseifer, and Octavio L. Franco

15

Methyl Jasmonate as Chemical Elicitor of Induced Responses and Anti-Herbivory Resistance in Young Conifer Trees ..................... 345 Xoaquín Moreira, Rafael Zas, and Luis Sampedro

16

Pathogen-Responsive cis-Elements ........................................................ 363 Ting Yuan and Shiping Wang

17

Pathogenesis Related Proteins in Plant Defense Response.................. 379 J. Sudisha, R.G. Sharathchandra, K.N. Amruthesh, Arun Kumar, and H. Shekar Shetty

About the Author ............................................................................................ 405 Index ................................................................................................................. 407

Contributors

Marielle Adrian Unité Mixte de Recherche INRA 1088/CNRS 5184, Université de Bourgogne Plante-Microbe-Environnement, 17 rue Sully, BP 86510, 21065 Dijon cedex, France, [email protected] N.C. Aery Department of Botany, Mohanlal Sukhadia University, Udaipur 313002, Rajasthan, India, [email protected] Virginia Alonso-Villaverde Misión Biológica de Galicia (CSIC), P.O. Box 28, 36080 Pontevedra, Spain K.N. Amruthesh Applied Plant Pathology Laboratory, Department of Studies in Botany, University of Mysore, Mysore 570 006, Karnataka, India Jaya Arora Laboratory of Bio-Molecular Technology, Department of Botany, M.L. Sukhadia University, Udaipur 313001, India Arun Kumar Division of Plant Sciences and Biotechnology, Central Arid Zone Research Institute, Jodhpur 342003, Rajasthan, India, [email protected] Rikhab Raj Bhansali Central Arid Zone Research Institute, Jodhpur 342 003, Rajasthan, India, [email protected] Christian Chervin Food and Wine Science, Université de Toulouse, UMR Génomique et Biotechnologie des Fruits, INRA-INP/ENSAT, BP 32607, 31326 Catanet-Tolosan, France, [email protected] S. Cluzet GESVAB – EA 3675, Institut des Sciences de la Vigne et du Vin, University of Bordeaux, CS50008, 210, Chemin de Leysotte, Villenave d’Ornon, F-33882, France Xavier Daire Unité Mixte de Recherche INRA 1088/CNRS 5184, Université de Bourgogne Plante-Microbe-Environnement, 17 rue Sully, BP 86510, 21065 Dijon cedex, France N.K. Dubey Centre of Advanced Study in Botany, Banaras Hindu University, Varanasi 221005, India, [email protected] ix

x

Contributors

Matthias Erb Department of Molecular Ecology, Max Planck Institute for Chemical Ecology, Jena, Germany, [email protected] Isabel C.M. Fensterseifer Centro de Análises Proteômicas e Bioquímicas Programa de Pós-Graduação em Ciências Genômicas e Biotecnologia, Universidade Católica de Brasília, SGAN, Quadra 916, Módulo B, Av. W5 Norte, CEP 70.790-160, Brasília, DF, Brazil Octavio L. Franco Centro de Análises Proteômicas e Bioquímicas Programa de Pós-Graduação em Ciências Genômicas e Biotecnologia, Universidade Católica de Brasília, SGAN, Quadra 916, Módulo B, Av. W5 Norte, CEP 70.790-160, Brasília, DF, Brazil, [email protected]; [email protected] Magdalena Gamm Unité Mixte de Recherche INRA 1088/CNRS 5184, Université de Bourgogne Plante-Microbe-Environnement, 17 rue Sully, BP 86510, 21065 Dijon cedex, France Katia Gindro Swiss Federal Research Station Agroscope Changins-Wädenswil, Route de Duillier, P.O. Box 1012, CH-1260 Nyon, Switzerland, [email protected] Shaily Goyal Laboratory of Bio-Molecular Technology, Department of Botany, M.L. Sukhadia University, Udaipur 313001, India Marie-Claire Héloir Unité Mixte de Recherche INRA 1088/CNRS 5184, Université de Bourgogne Plante-Microbe-Environnement, 17 rue Sully, BP 86510, 21065 Dijon cedex, France C. Lambert GESVAB – EA 3675, Institut des Sciences de la Vigne et du Vin, University of Bordeaux, CS50008, 210, Chemin de Leysotte, Villenave d’Ornon F-33882, France Guillaume Marti School of Pharmaceutical Sciences, University of Geneva, Geneva, Switzerland School of Pharmaceutical Sciences, University of Lausanne, Lausanne, Switzerland J.M. Mérillon GESVAB – EA 3675, Institut des Sciences de la Vigne et du Vin, University of Bordeaux, CS50008, 210, Chemin de Leysotte, Villenave d’Ornon, F-33882, France, [email protected] Prashant K. Mishra Centre of Advanced Study in Botany, Banaras Hindu University, Varanasi 221005, India Mohammad Reza Moosavi Department of Plant Pathology, Islamic Azad University, Marvdasht Branch, P.O. Box 465, Marvdasht, Fars, Iran, [email protected] Xoaquín Moreira Centro de Investigación Forestal de Lourizán – Unidad Asociada MBG-CSIC, Apdo. 127, 36080 Pontevedra, Galicia, Spain, [email protected]

Contributors

xi

Denis Coelho de Oliveira Instituto de Ciências Agrárias - ICIAG, UFU, Universidade Federal de Uberlândia, Av Amazonas, Campus Umuarama, Cep: 38400-902, Uberlândia, MG, Brazil Roger Pezet Swiss Federal Research Station Agroscope Changins-Wädenswil, Route de Duillier, P.O. Box 1012, CH-1260 Nyon, Switzerland Michelle F.S. Pinto Centro de Análises Proteômicas e Bioquímicas Programa de Pós-Graduação em Ciências Genômicas e Biotecnologia, Universidade Católica de Brasília, SGAN, Quadra 916, Módulo B, Av. W5 Norte, CEP 70.790-160, Brasília, DF, Brazil Benoît Poinssot Unité Mixte de Recherche INRA 1088/CNRS 5184, Université de Bourgogne Plante-Microbe-Environnement, 17 rue Sully, BP 86510, 21065 Dijon cedex, France Bhanu Prakash Centre of Advanced Study in Botany, Banaras Hindu University, Varanasi 221005, India A.K. Purohit Transcience Transactions, Jodhpur, Rajasthan 342001, India, [email protected] Kishan G. Ramawat Laboratory of Bio-Molecular Technology, Department of Botany, M.L. Sukhadia University, Udaipur 313001, India, [email protected] Catherine Regnault-Roger Institut Pluridisciplinaire Pour l’Environnement et les Matériaux/Equipe Environnement et Microbiologie (IPREM/EEM), IBEAS, Université de Pau et des Pays de l’Adour, UMR CNRS 5254, BP 1155, F-64013 Pau, France, [email protected] Luis Sampedro Centro de Investigación Forestal de Lourizán – Unidad Asociada MBG-CSIC, Apdo. 127, 36080 Pontevedra, Galicia, Spain Rosy Mary dos Santos Isaias Instituto de Ciências Biológicas and Departamento de Botânica, ICB/UFMG, Universidade Federal de Minas Gerais, Av Antonio Carlos 6627, Pampulha, Cep: 31270-901, Belo Horizonte, MG, Brazil, [email protected] R.G. Sharathchandra Department of Microbiology, Tumkur University, Tumkur 572103, Karnataka, India H. Shekar Shetty Downy Mildew Research Laboratory, Department of Studies in Biotechnology, University of Mysore, Mysore 570 006, Karnataka, India Priyanka Singh Centre of Advanced Study in Botany, Banaras Hindu University, Varanasi 221005, India Jean-Laurent Spring Swiss Federal Research Station Agroscope ChanginsWädenswil, Route de Duillier, P.O. Box 1012, CH-1260 Nyon, Switzerland J. Sudisha Downy Mildew Research Laboratory, Department of Studies in Biotechnology, University of Mysore, Mysore 570 006, Karnataka, India

xii

Contributors

Sophie Trouvelot Unité Mixte de Recherche INRA 1088/CNRS 5184, Université de Bourgogne Plante-Microbe-Environnement, 17 rue Sully, BP 86510, 21065 Dijon cedex, France Olivier Viret Swiss Federal Research Station Agroscope Changins-Wädenswil, Route de Duillier, P.O. Box 1012, CH-1260 Nyon, Switzerland Shiping Wang National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan 430070, China, [email protected] Jean-Luc Wolfender School of Pharmaceutical Sciences, University of Geneva, Geneva, Switzerland School of Pharmaceutical Sciences, University of Lausanne, Lausanne, Switzerland Ting Yuan National Key Laboratory of Crop Genetic Improvement, National Center of Plant Gene Research (Wuhan), Huazhong Agricultural University, Wuhan 430070, China Rasoul Zare Department of Botany, Iranian Research Institute of Plant Protection, P.O. Box 1454, Tehran 19395, Iran, [email protected] Rafael Zas Misión Biológica de Galicia (MBG-CSIC), Apdo. 28, 36080, Pontevedra, Galicia, Spain

Part I

General Biology of Parasitism

sdfsdf

Chapter 1

Co-evolution of Pathogens, Mechanism Involved in Pathogenesis and Biocontrol of Plant Diseases: An Overview Jaya Arora, Shaily Goyal, and Kishan G. Ramawat

Abstract Plant pathogens pose a serious problem for global food security. More sustainable and reliable food production will be needed to support the human population for the upcoming years. To develop efﬁcient, economic and environment friendly biocontrol measures, a deep understanding of diseases is required. The Phytopathology has four main objectives (i) etiology, (ii) pathogenesis, (iii) epidemiology and, (iv) control, which should be considered for an overall knowledge about a plant disease. Understanding of the plant response to the pathogen attack has advanced rapidly in recent years; still many plant diseases are unpredictable either due to emergence of new pathogenic strains or due to mutagenic changes in present strains, which cause a failure in all preventive measures. In this review, lacuna in present control measures and future requirements in disease management are discussed in the light of recent advances made in molecular mechanisms and components involved in pathogen defense in plants as well as how pathogens are continuously co-evolving. The complex picture of pathogen defense in plants is beginning to be unraveled but a lot more still remains unclear.

1.1

Introduction

Plant diseases cause economic threats to conventional and organic farming systems. Most of the infectious plant diseases have their characteristics mode of spread and symptoms. The understanding of these characteristics helps in possible control strategies; assess economic impact and the socio-economic consequences

*!RORAs3'OYALs+'2AMAWAT*) Laboratory of Bio-Molecular Technology, Department of Botany, M. L. Sukhadia University, Udaipur 313001, India e-mail: [email protected]

J.M. Mérillon and K.G. Ramawat (eds.), Plant Defence: Biological Control, Progress in Biological Control 12, DOI 10.1007/978-94-007-1933-0_1, © Springer Science+Business Media B.V. 2012

3

4

J. Arora et al.

Fig. 1.1 World production and area under cultivation of staple crops

of their dissemination. Their effects range from mild symptoms to catastrophes in which large areas of food crops are destroyed. Fourteen crop plants provide the bulk of food for human consumption, which are likely to be infested from any of the major plant pathogens including viruses, bacteria, oomycetes, fungi, nematodes, and parasitic plants [1]. Human population is projected to grow at approximately 80 million per annum, increasing by 35% to 7.7 billion by 2020 [2]. With the ever-increasing population there is an increasing demand for food and fodder. According to the Production Estimates and Crop Assessment Division, Foreign Agriculture Service (FAS), United States Department of Agriculture (USDA, 2002/2003) a comparative data of major staple crops production and total cultivated area over the world is presented in the Fig. 1.1 [3]. At least 10% of global food production is lost by plant diseases; either as yield loss or as quality loss, both are included in the concept of crop loss. Food shortage and the damage to the food production, caused by plant pathogens, results in undernourishment of roughly 826 million people in the world, of which 792 million people are in the developing world and 34 million in the developed world [4]. Although the ability to diagnose diseases and the technologies available for their control are far greater than in the past, it is necessary to accumulate loss data, including the importance of pests, key pests and their control for evaluating the efﬁcacy of present crop protection practices [5]. A major portion of crop is also lost due to non-native crop species. Crop loss due to non-native species invasions in the six nations viz., United States, United Kingdom, Australia, South Africa, India, and Brazil, is more than US$ 314 billion per year [6]. Although there is an extensive bibliography available regarding the biology, symptoms, distribution and crop losses by some pathogens, concise data on the mechanism of pathogenesis and their possible control measures are essential to interpret with present scenario of plant diseases. The present article is intended to overview plant pathogenesis and its control.

1 Co-evolution of Pathogens, Mechanism Involved in Pathogenesis and Biocontrol…

1.2

5

Epidemiology

The socio-economic effects of disease epidemics and the consequent crop losses have been well documented. There are some iconic invasive diseases, often exempliﬁed due to their large demographic impacts on communities that are dependent on a single staple crop, resulting into epidemics. Some emerging infectious diseases cause famine and favour human diseases, and technical crises for the management of whole agricultural communities. Frequently cited examples include the Irish potato famine caused by Phytophthora infestans, the oomycete plant pathogen, with one million deaths and two million emigrations from 1845 to 1847 in Europe [7]. The high dependence of large Irish population on potato for sustenance, the lack of resistance in the plant to the pathogen, and wetness of the environment caused Phytophthora to take an epidemic form. Its most notorious species, costing annually on a global basis in excess of $5 billion in terms of losses of the potato crop and control measures [8]. Great Bengal Famine (Rice brown spot) of 1943 and the southern corn leaf blight epidemic of 1970–1971 in the USA were the two another big disasters caused by fungal pathogens of the genus Cochliobolus. The former one was caused by C. miyabeanus, an estimated two million people died owing to the high dependence of most of the population on a single crop, rice. Pathogen’s spread was favoured by the environmental conditions pertaining at that time [9]. In the USA, the corn (maize) crop was completely destroyed by C. heterostrophus, named race T, which was speciﬁcally virulent for maize containing a cytoplasmically inherited gene for male sterility (Tcms). It had been incorporated into about 85% of the American crop by 1970 due to self-fertilization and favourable climatic conditions. Alternative sources of nutrition were plentiful, so no one died and the endemic brought to an end by the withdrawal of susceptible varieties and the establishment of new hybrids [10]. Corn Leaf Blight is renowned for having set a record in terms of economic losses produced on a single agricultural crop in a single season with estimated historic losses of $1 billion [11]. During the ﬁrst 50 years of the nineteenth century, in Ceylon (now Sri Lanka), there was a massive increase of coffee cultivation by British planters. In 1868, there was total elimination of coffee trees by a rust fungus Hemileia vastatrix, which was likely to have spread from Ethiopia, the center of origin of both the plant and its rust [12]. By 1905, the coffee cultivation area in Ceylon had shrunk from 275,000 acres in 1878 to around 3,500 acres in 1905 [13]. Because of the epidemic, coffee had to be replaced, fortunately with success, by tea. The threat of epidemics occurring with catastrophic consequences has been sharply reduced in developed countries compared to developing countries, due to technological advances such as, diagnostics, agronomic practices and the use of speciﬁc disease management strategies [14]. Re-emergence of a disease is the coincidence of a number of unfortunate events, including many anthropogenic activities such as introduction of plant species into new area. But many such introduced species, like corn, wheat, rice, domestic chicken, cattle, and others are beneﬁcial

6

J. Arora et al.

and now provide more than 98% of the world food supply with a value of more than US$ 5 trillion per year [15]. However, alien plant species (introduced plant species) are also known to cause major economic losses in agriculture, forestry, and several other segments of the world economy [16, 17]. Some pathogen communities are introduced together with a newly introduced plant species and resulted in an emerging disease to that new area. Besides trading of whole living plants, alien pathogens can be introduced through vegetables, germplasm, and grafts or via international seed trading. For example, it has been estimated that at least 2,400 different plant pathogens were contained in the seeds of 380 plant genera [18], and that up to one third of the plant pathogenic viruses are transmissible through seeds to at least one of their hosts [19]. Many factors affect the dissemination and infection by an introduced pathogen like in Pierce’s Disease of grapevine, caused by the bacterium Xylella fastidiosa. It was ﬁrst reported in California as not being serious for more than a century, but in 1997 a new vector, Graphocephala atropunctata, was introduced in California. This allowed the rapid development of the disease in the vineyards, with estimated damage of 6 million dollars in 1999 [20]. Lacking the elements favoring their further dissemination, some pathogens may remain restricted to their area of introduction, making very limited impact. Another example of epidemic occurred due to some introduced variety is vine downy mildew disease caused by Plasmopara viticola in France from 1868 to 1882. This disease was ﬁrst observed in America in 1834, and then the pathogen was carried to Europe on American stock, where it was ﬁrst recorded in France. From France, the mildew-pathogen spread throughout Europe, where it is now a very notorious pathogen. Losses in Europe have been enormous due to this disease. The greatest losses to American viticulturists from this disease are incurred in Northern United States; where in some localities it is estimated that 25–75% of the crop is destroyed [21]. There are some more emerging infectious diseases of crops that are challenging the current preventive measures of farmers, such as Cassava Mosaic Virus (CMV), Banana Xanthomonas Wilt (BXW), stem rust of wheat, Citrus Huanglongbing etc. Among them the effects of CMV disease on the farming communities in Uganda became apparent in the early 1990s. The initial impact was greatest in the north-eastern areas of the country, because the particular cultivars were susceptible to the virus. Here, cassava production between 1990 and 1993 was reduced by 80–90% and many farmers stopped its cultivation [22]. The cultivation of other crops, mainly sweet potatoes were preferred at that time to overcome the situation. Several attempts have been made to quantify the losses due to the virus, the most reliable estimate being around 600 thousand tonnes per year valued at 60 million dollars [23]. CMV is the most important disease of cassava in Africa, Sri Lanka and Southern India [24]. The disease caused by the bacterium Xanthomonas campestris pv. musacearum to banana plantations, known as BXW is one of the most important emerging risks. This disease was initially reported in Ethiopia about 40 years ago on Ensete ventricosum, a genus closely related to Musa [25]. It was reported in Uganda in 2001 on banana and from there it has spread rapidly to all regions of Africa where the crop is grown. No varieties of banana have complete genetic resistance, but they differ in degree of susceptibility [26]. It has been estimated that, if not controlled,

1 Co-evolution of Pathogens, Mechanism Involved in Pathogenesis and Biocontrol…

7

the pathogen can increase the area infected at a rate of 8% per year [27]. The damage caused by the disease each year is estimated at $2 billion. A recent study estimated 53% loss in yield of banana production in Uganda in last 10 years. Production losses caused by the disease threaten the food security of about 100 million people and the income of millions of farmers in the Great Lakes region of Central and Eastern Africa [28]. One of major epidemics occurred in the 1940s and 1950s in Australia and the United States is stem rust or black rust of wheat caused by microscopic fungus, Puccinia graminis f. sp. Tritici [29]. It took more than a decade to ﬁnd out cause of re-emergence of stem rust due to its complex life cycle that requires barberry (Berberis vulgaris) as well as a cereal species. Another recently worldwide occurring most destructive disease of all citrus pathosystems is Huanglongbing, the yellow shoot disease. The disease is associated with three bacteria: Candidatus liberibacter asiaticus (Las), C.L. africancus (Laf), and C.L. americanus (Lam). To date, there has been a decline in all commercial citrus industries that have faced the disease [30]. Nowadays epidemiological models are constructed to increase understanding of the complex interactions between vectors, pathogen, host plants, and the environment. If these are accurate and validation with ﬁeld data is demonstrable for a range of epidemiological scenarios, it can be used for decision support over targeted control of epidemics [31, 32]. Food crisis in developed countries due to failure of a crop can be overcome as the impact of plant disease is mostly an economic issue but in developing countries it can be a primary cause of starvation and today developing countries are more integrated into the global economy than in past decades. Stepping up investment in the agriculture sector can be one of the solutions to combat the situations. Such initiatives can achieve success when new diseases are recognized early in their emergence and before they have spread beyond a reasonable containment zone that can only be managed by quarantines or eradication efforts.

1.3

Co-evolution of Plants and Their Pathogens

Darwinian paradigm of ‘variation and selection results in evolution’ plays an important role in predicting evolution of pathogens in nature. Nowadays, alarming disclosure is that the vaccines and chemical therapies used by medicinal and agricultural industries are perhaps the main forces driving the evolution of viral and microbial pathogens [33]. These evolutionary causes can further be used in the development of effective and sustainable treatments of micro parasitic diseases. “Co-evolution” includes population-level processes of reciprocal adaptation of interacting species. Reciprocal traits involved in co-evolution include pathogen infectivity and host resistance. As host defences may reduce the ﬁtness of parasite, host and parasites may co-evolve, deﬁning co-evolution as the process of reciprocally adaptive genetic change in two or more species. Accordingly three conditions

8

J. Arora et al.

that should meet for host pathogen co-evolution are (1) genetic variation in the relevant host and pathogen traits; (2) reciprocal effects of the relevant traits of the interaction on the ﬁtness of host and pathogen; (3) dependence of the outcome of the host-pathogen interaction on the combination of host and pathogen genotypes involved [34]. For plant-virus co-evolution taking Arabidopsis thaliana as model system, there are only partial evidences regarding the detrimental effects of highly virulent viruses in crop production. In such cases, the infection is not necessarily linked to a ﬁtness decrease and the changes in the genetic structure of virus population or a resistance factors introduced by breeder through genetic manipulation of the host plant [35]. Understanding the forces driving co-evolutionary trajectories requires accounting for both within and among-population processes in space and time [36]. Theoretical studies of co-evolution date back over 40 years. Many host pathogen interaction models have been studied. In which primarily animal-virus system of European rabbit-myxoma virus system is a classical example. When the virus was introduced into a local virus population, phenotypic changes were observed in both pathogen and host components of virulence [37]. Plant defence systems have similarity to mammalian innate cellular immunity at a molecular level, and utilize analogous components to recognize pathogen-derived signals and induce defence responses. In both systems pathogens deliver effecter proteins into their respective host cells to mimic, suppress, or modulate host defence signaling pathways and to enhance pathogen ﬁtness. On the host side, plants and animals have evolved reﬁned surveillance mechanisms to recognize various pathogens [38, 39]. These evolutionary commonalities combined with ethical issues that limit experimental manipulations in animal populations, make plant-based systems powerful models for studying the impacts of genetic variation in host disease resistance [40]. Co-evolution is a dynamic process, which occurs in cycles. In ﬁrst phase of a cycle, plant develops some resistant character against its attacking pathogens; these resistance characters reduce the survival or virulence of attacking pathogens. This initiates second phase of a co-evolutionary cycle: the evolution of counter-resistance by attacking pathogens, to evade plant resistance mechanisms; each partner continually evolving just to keep pace with the other, like an evolutionary game of “ping-pong” [41–43]. This process is vibrantly termed as ‘Red Queen’ dynamics [34]. There are several examples in which natural enemies exhibit such characters that can be interpreted only as having evolved to confer counter resistance. For example, seeds of the tropical legume Dioclea megacarpa, which contain the non-protein amino acid L-canavanine, are toxic to most insects because their arginyl-t-RNA synthetases also incorporate L-canavanine into proteins. However, the bruchid beetle Caryedes brasiliensis, whose larvae feed solely on D. megacarpa, has evolved a modiﬁed t-RNA synthetase that distinguishes between L-canavanine and arginine [41, 44]. So the beetle has co-evolved according to its host resistance. Similarly, chitinase evolution in Arabidopsis and related species in the genus Arabis exhibits remarkable similarities to receptor evolution. Plant chitinases are co-evolving with pathogen chitinase inhibitors [45]. However, in some cases counter resistance of a plant against its natural enemy may have additional physiological or ecological functions. Thus, it is a matter of debate whether the resistant characters

1 Co-evolution of Pathogens, Mechanism Involved in Pathogenesis and Biocontrol…

9

are a part of natural selection imposed by natural enemies or only have routinely defensive role in plant physiology [41]. In a phylogenetic analysis done by Richards et al. [46], phytopathogens are extremely important because of their economic impact in the ﬁeld of agriculture. Most of the evolutionary relationships are studied between oomycetes and the fungi, as most of the economically important plant pathogens are found among these groups. Lateral gene transfer is considered as one of the contributing factor for emergence of new phytopathogen. There are several reports on acquisition of prokaryotic genes by microbial eukaryote while there have been few reports on eukaryote-to-eukaryote gene transfers, as a dense taxon sampling is needed to identify donor and recipient lineages for transfer events [47–49]. The gene exchange in unrelated organisms of prokaryotic origin could be both the cause and consequences of adaptation to similar environments, and result in extensive convergent evolution [50]. New disease can also results by acquisition of a new gene function such as Tan spot of wheat is believed to have emerged as a result of lateral gene transfer of the gene for Tox A from the related wheat pathogen Stagonospora nodorum in Pyrenophora tritici-repentis. The most common evidence for lateral transfer is that genes isolated from the proposed recipient are absent in closely related species but present in more distantly related species [51, 52]. There is a growing appreciation among ecologists that long-term evolutionary history has a major role in explaining the composition and structure of ecological communities and phylogenetic approaches are essential in achieving explanation [53]. Sirtuin genes are found in all eukaryotes examined so far, including plants, fungi, and animals. It is therefore safe to assume that sirtuins are very ancient enzymes that existed in the common ancestor of today’s eukaryotes, possibly more than a billion years ago. Sirtuin enzymes evolved early in life’s history to increase somatic maintenance and survival during times of adversity. The xenohormesis hypothesis of Howitz and Sinclair proposes that primordial species synthesized polyphenolic molecules to stimulate sirtuins during times of stress. Plants have retained this ability. Survival pathways in fungi and animals have retained the ability to respond to plant stress signalling molecules because they provide useful information about the state of the environment and/or food supply. This ability would allow organisms to prepare for and survive adversity when they might otherwise perish [54]. Many plant pathogens are limiting factors in food production throughout the world. Agro-ecosystems will need to be re-engineered to prevent the continuous emergence of new pathogens. A combination of environmental, species, and genetic heterogeneity should be reintroduced into the agro-ecosystem to make it less conducive to pathogen emergence. For example, environmental heterogeneity can be increased by combining agriculture and forestry or with other mixed cropping systems. Crop species diversity can be increased through faster and more complex crop rotations, planting of species mixtures, and by decreasing average ﬁeld size. Genetic diversity within monocultures can be increased by growing several different cultivars of the same host in patches within the same farm. The result of re-engineering the agro-ecosystem will be to develop more sustainable and reliable food production that will be needed to support the human population for the upcoming years.

10

1.4

J. Arora et al.

Mechanisms of Plant Disease Resistance

The emergence of a new disease is an output of a number of conditions and steps, including the enhanced fertility of the new pathogen, enhanced survival from season to season, and spread around the world. It also depends on plant’s resistance abilities to defend pathogen attack. Plant populations are often genetically polymorphic for resistance to pathogens. Pathogens are, in turn, polymorphic for virulence genes that can evade plant resistance. Plants exhibit two types of resistance: horizontal and vertical resistance. Horizontal resistance is polygenic, and acts against all races of a particular pathogen. Vertical resistance, conferred by the R-genes, is oligogenic, and can be overcome by a change of race. Horizontal resistance slows down the rate at which disease increases in the ﬁeld. Vertical resistance reduces the initial amount of inoculum from which the epidemic begins. A slow rate of disease increase in the ﬁeld greatly enhances the beneﬁt from reducing the initial inoculum. Therefore, horizontal resistance greatly enhances vertical resistance: horizontal resistance activates the R-genes [55, 56]. The deﬁnitive character of vertical resistance is gene-for-gene relationship as in vertical resistance there are single genes for resistance in the host plant, and there are also single genes for parasitic ability in the parasite [57]. Advances in understanding host-pathogen co-evolutionary interactions requires knowledge of the molecular basis of host resistance and pathogen virulence; so in 1991, researchers began assaying different inbred accessions of Arabidopsis, and found considerable variation in disease resistance and susceptibility among them, following inoculation with strains of the bacterial pathogen Pseudomonas syringae [58, 59]. Studies revealed that some of this variation resulted from the recognition of speciﬁc bacterial avirulence genes, avrRpt2 and avrRpm1, which were capable of restricting the growth of an otherwise virulent P. syringae isolate. This was the ﬁrst step in identifying avr-R gene pairs in Arabidopsis, and opened the door to using the strengths of Arabidopsis to analyze the key genetic idea in plant pathology: the genefor-gene hypothesis [60, 61] and till date Arabidopsis has been an excellent model for answering fundamental question in molecular plant-microbe interactions [62]. The concept of mutation of avirulence genes leading to the defeat of resistant cultivars is also a step convincing for gene-for-gene hypothesis. Point mutations have been implicated in the mutation of avirulence genes in fungal pathogen races [63]. For example, cloning and sequencing of speciﬁc avirulence (Avr) genes in Melampsora lini found evidence for functional changes in the coding regions of targeted Avr genes that occurred almost exclusively via non-synonymous mutations [64]. These observations provide strong independent evidence for the operation of selection on these genes.

1.4.1

Host-Parasite Interaction

The initial interactions of pathogen and plant are the determining factors for disease development. In a bacterial infection, it ﬁrst colonize the leaf surface then enter leaf mesophyll tissue through natural stomatal openings, hydathodes, or wounds, thus

1 Co-evolution of Pathogens, Mechanism Involved in Pathogenesis and Biocontrol…

11

making their ﬁrst contact with internal host cells and remain in apoplast of plant cells; whereas fungi extend their hyphae, which either directly penetrate the epidermis or differentiate to form specialized nutrient exchange structures such as haustoria. After initial contact the potentially infectious agents produce microbe-associated molecules, such as bacterial ﬂagellin, lipopolysaccharide (LPS) and fungal chitin, termed as MAMPs (microbe-associated molecular patterns) [65–67]. The recognition of different MAMPs presumably by speciﬁc plant pattern-recognition receptors (PRR) activates the common signaling pathways including MAP kinase (MAPK) cascade, defence gene transcription, rapid microbursts of reactive oxygen species (ROS) and callose deposition to strengthen the cell wall at sites of infection as a result of complex cellular remodelling [68, 69]. Plants have evolved a variety of PRRs to perceive diverse microbial patterns [70]. Many MAMP receptors have been isolated and characterized by using biochemical and genetic approaches. Initially a 75-kDa soybean plasma membrane protein was puriﬁed as the binding protein for hepta-E-glucan, the cell wall component of oomycetes [71]. The understanding of MAMP perception was greatly advanced with the isolation of the putative bacterial ﬂagellin receptor FLS2 in Arabidopsis. FLS2 is a transmembrane receptor-like kinase (RLK) with extracellular leucine rich repeats (LRR) domain [72]. There is large number of RLKs in plants, with more than 600 in Arabidopsis [73]. One of the earliest responses at the time of pathogen attack is the generation of ROS including superoxide anion (O2−2), hydrogen peroxide (H2O2), and hydroxyl radical (OH−) [74]. On interaction with MAMPs there is a rapid inﬂux of calcium ions (Ca2+) in cytosolic compartment which is often correlated with the production of ROS. Similar response was observed in Arabidopsis leaf cells [75]. Beside this early Ca2+ inﬂux into the cytosolic compartment, a rapid efﬂux of potassium (K+), chloride (Cl−) ions and extracellular alkalinisation of elicited cell cultures has also been observed [76]. The plant ROS is toxic to pathogens directly and cause strengthening of host cell walls via cross linking of glycoproteins [77]. ROS generation lead to a hypersensitive response (HR) that results in a zone of host cell death, which prevents further spread of biotrophic pathogens [78, 79]. In addition to the described direct effects, ROS can also serve as signals that lead to the activation of other defence mechanisms in conjugation with salicylic acid (SA) and nitric oxide (NO) [80]. It acts as intercellular or intracellular second messenger during signal transduction of defence response [81]. Several mechanisms have been proposed for ROS generation in plants such as NADPH-oxidase and superoxide, peroxidase and hydrogen peroxide, nitric oxide, oxalate oxidase, lipid peroxides and oxylipin production [82]. Of these mechanisms, the plasma membrane NADPH-dependent oxidase system has received the most attention because of its similarity to the mammalian oxidase system that initiates ROS production in phagocytes and B lymphocytes as a response to pathogen attack [83, 84]. A rapid elevation of ROS speciﬁcally in resistant wheat and non host rice plants attacked by Hessian ﬂy larvae was observed. Global analyses of gene transcripts known to be or potentially involved in ROS homeostasis indicated that class III peroxidases and oxalate oxidases, instead of NADPH-dependent oxidases, were likely the source of ROS generation in wheat plants during incompatible

12

J. Arora et al.

interactions [85]. In barley (Hordeum vulgare) ROS production has been associated with the formation of defensive barriers against powdery mildew and there is a polarized delivery of ROS, in vesicles inside the cell, which might contribute to inhibition of pathogen growth [86, 87].

1.4.2

Pathogenesis Related (PR) Proteins

PR proteins, initially deﬁned as b-protein, are encoded by the host plant in response to stress generated by various types of pathogens and also by the application of chemicals that induce similar stresses [88]. PR genes get expressed in response to salicylic acid (SA), jasmonic acid (JA) and ethylene (ET) as a part of systemic acquired resistance (SAR) in plants [89]. PR proteins originally were divided into ﬁve groups (PR1–PR5) on the basis of ﬁndings of serological and sequence analysis, afterwards another six groups of proteins induced by pathogens were recommended for inclusion in PR proteins [90]. The ﬁve classic PR protein groups have been divided into acidic and basic subclasses on the basis of chemical properties, cellular localization and the mechanisms by which they are induced [91]. Acidic PR proteins, including PR1 D,E-1,3-glucanases and acidic chitinases, are induced by tobacco mosaic virus (TMV) infection or SA [92] while basic PR proteins, like PR1b and basic chitinases, are efﬁciently induced by wounding or ET and JA treatment [93]. The other six groups include proteinase inhibitors, lysozymes and peroxidases, and can also be elicited [94].

1.4.3

R (Resistance) Gene

Plant–pathogen interactions are governed by speciﬁc interactions between pathogen Avr (avirulence) gene loci and alleles of the corresponding plant disease resistance (R) locus in a variety of host plants, directing responses toward a broad diversity of pathogens including bacteria, fungi, oomycetes, nematodes, and viruses, and even insects. Pathogen’s Avr genes encode speciﬁc elicitors of host defence responses. When corresponding R and Avr genes are present in both host and pathogen, the result is disease resistance, if either is inactive or absent, this results in disease establishment [95]. A set of structurally similar R proteins determines the recognition of a diversity of Avr proteins (type III effector proteins). These type III effectors effectively suppress MAMP mediated immune responses. However, plants have coevolved R proteins to recognize effector proteins and induce potent gene-for-gene resistance [66, 67]. The vast majority of R genes encode proteins containing a nucleotide-binding site (NBS) and leucine-rich repeats (LRRs) [96]. However, the biochemical functions of the majority of the type III effectors remain elusive. Recent structural studies of type III effectors from both mammalian and plant pathogens have revealed important functional information. By these studies, the strategies

1 Co-evolution of Pathogens, Mechanism Involved in Pathogenesis and Biocontrol…

13

employed by plant pathogens to promote virulence can be revealed and their prevention can be determined [97].

1.4.4

Plant Hormones and Defence

The interaction between plant hormone signaling and plant pathology is complex and intertwined. Genetic screens in Arabidopsis have deﬁned many of the pathways involved in the synthesis, perception and effect of plant hormones [98]. These phytohormones are capable of transducing normal development signals such as seed germination, seedling establishment, cell growth, respiration, stomatal closure, senescence-associated gene expression, responses to abiotic stresses, basal thermo tolerance, nodulation in legumes, and fruit yield or adverse environmental stimuli to plant cells for initiating protective responses. Thus plant hormone signaling plays a major role in determining the outcome of plant–pathogen interactions [99, 100]. The best-characterized defence hormones include SA, JA and ET. Critical components of the SA pathway were revealed via genetic screens in Arabidopsis. Transduction of the SA signal leads to activation of genes encoding PR proteins, some of which have antimicrobial activity. The regulatory protein NONEXPRESSOR OF PR GENES1 (NPR1) is required for transduction of the SA signal because mutations in the NPR1 gene render the plant largely unresponsive to pathogen-induced SA production [101]. In Arabidopsis, JA biosynthesis is initiated by a wound-mediated release of a-linolenic acid from chloroplastic membranes, followed by the activity of several chloroplast-located enzymes, including 13-lipoxygenase (LOX). Silencing of LOX3, in Nicotiana attenuata plants, has been shown to reduce JA levels and impair both direct and indirect defences in LOX3-silenced plants [102]. The JA receptor was recently identiﬁed to be CORONATINE INSENSITIVE1 (COI1), an F-box protein required for response to both coronatine (pathogen-derived phytohormone, responsible for stomatal opening to allow entry into the mesophyll) and JA [103]. ET is known to be involved in mediating plant defence responses against herbivores [104]. In Arabidopsis, ET signal transduction is initiated by ET perception through multiple membrane-bound receptors: ETHYLENE RESPONSE1 (ETR1), ETR2, ETHYLENE RESPONSE SENSOR1 (ERS1), ERS2, and ETHYLENE INSENSITIVE4 (ETI4) [105]. All the signaling pathways involved in defence mechanism interact in a complex manner demonstrated by the antagonism of SA and JA, as well as the synergism between JA and ET [106, 107]. Though plants have developed various mechanisms to evade the pathogens yet occurrence of disease is very frequent. In the future, we are likely to see a rapid expansion in our knowledge of alternative mechanisms of resistance, such as efﬂux systems of the kind associated with multidrug resistance, innate resistance due to insensitivity of the target site of phytopathogens, and other novel mechanisms. The manipulation of plant biosynthetic pathways to alter antibiotic proﬁles will also tell us more about the signiﬁcance of secondary metabolites for plant defence. Exploiting the knowledge of the Biochemistry and Molecular Biology of disease in order to increase resistance will also be helpful in disease prevention.

14

1.5

J. Arora et al.

Control Measures

One of the major aspects of plant pathology is to enhance crop production by introducing genetically improved (high-yielding, less susceptible to pathogens) cultivars, enhanced soil fertility via chemical fertilisation, pest control via synthetic pesticides, and irrigation. Besides physical control methods e.g. mowing, slashing, burning, ﬂooding, hand removal, physical barriers (i.e. netting, fences), use of pesticides is very common method for controlling various phytopathogens. The use of synthetic pesticides in the US began in the 1930s and became widespread after World War II. By 1950, pesticide was found to increase farm yield far beyond pre-World War II levels. Farmers depend heavily on synthetic pesticides to control insects in their crops. There are many classes of synthetic pesticides. The main classes consist of organochlorines (e.g., Dichlorodiphenyltrichloroethane: DDT, toxaphene, dieldrin, aldrin), organophosphates (e.g., diazinon, glyphosate, malathion), carbamates (e.g., carbofuran, aldicarb, carbaryl), and pyrethroids (e.g., fenpropanthrin, deltamethrin, cypermethrin). The use of synthetic pesticides in agriculture comes with a cost for the environment, and the health of animals and humans. Exposure to pesticides can cause acute or chronic effects on animals and humans, especially in the reproductive, endocrine, and central nervous systems. So in 1996, US Environment protection agency (EPA) applied Food Quality Protection Act [108] which regularizes the pesticide registration procedures. Therefore, the need for discovery and development of some natural product-based pesticides gain momentum. Organic pesticides like rotenone obtained from Derris root and pyrethrum obtained from Chrysanthemum ﬂower heads were discovered in nineteenth century at the time of European Agriculture revolution. Such organic pesticides are the chemicals that plants use to protect themselves from parasites and pathogens. Essential oils such as pine oil, clove oil, citronella oil are commercialized in various compositions and have herbicidal activity [109]. Inorganic pesticides like borates, silicates and sulphur, work as poisons by physically interfering with the pests. Current inorganic pesticides are relatively low in toxicity and have low environmental impact. Borate insecticides, for example Bora Care and Timbor, in particular, have many uses in structural pest management. Biorational pesticides are those synthetic, organic, or inorganic pesticides that are both, low toxic and exhibit a very low impact on the environment [110]. These are some direct methods of controlling pathogens by applying chemicals, besides this biological and genetic control methods are some of the methods which are being dynamically used since last decades. Both methods are described here in brief.

1.5.1

Biological Control

Biological control, as most commonly construed, is the use of living organisms to control pests. Plant pathogens, insects, nematodes and weeds are controlled by the use of some biologicals. It is the direct inoculation of microbial agents (also called antagonists) into soils or onto host surfaces for immediate beneﬁt [111–113].

1 Co-evolution of Pathogens, Mechanism Involved in Pathogenesis and Biocontrol…

15

Plant growth-promoting bacteria control the plant damage by phytopathogens. This involves different mechanisms including: out competing the phytopathogen, physical displacement of the phytopathogen, secretion of siderophores to prevent pathogens in the immediate vicinity from proliferating, synthesis of antibiotics and synthesis of a variety of small molecules. All these steps can inhibit phytopathogen growth, production of enzymes that inhibit the phytopathogen and stimulation of the systemic resistance of the plant [114]. Intensive screens have yielded numerous candidate organisms for commercial development. Some of the microbial taxa that have been successfully commercialized and are currently marketed as EPA-registered biopesticides in the United States include bacteria belonging to the genera Agrobacterium, Bacillus, Pseudomonas, and Streptomyces and fungi belonging to the genera Ampelomyces, Candida, Coniothyrium, and Trichoderma [115]. More studies on the practical aspects of mass-production and formulation need to be undertaken to make new biocontrol products stable, effective, safer and more cost-effective. Now-a-days detailed studies have been done on mechanism of these biological agents, how they reduce damage inﬂicted by pathogen, for example the role of the indigenous plasmids of Pseudomonas aeroginosa (D) and Azospirillum species isolates in fungal antagonistic property are clariﬁed and more efﬁcient bacterial transformants in controlling the plant pathogen Fusarium solani by chitinase gene transfer have been produced [114]. Recently a Gram-negative rhizobacterial isolate (LSW25) antagonistic to Pseudomonas corrugata (a vein necrosis pathogen of tomato) and promotes the growth of tomato seedlings by increasing calcium uptake, was isolated from surface sterilized tomato roots [116]. Currently, there has been revival of interest in use of bacteriophages for control of bacterial plant diseases [117]. Phage could play an important role in limiting bacteria in the soil, due to the presence of the lytic cycle. Using the strategy of phage application proposed by L. E. Jackson [118], bacterial spot of tomato was signiﬁcantly controlled than the standard copper-mancozeb treatment. Additionally, the yield of extra-large fruits was signiﬁcantly higher on phage-treated plants than on copper-mancozeb treated ones. The phage mixture reduced disease severity of bacterial spot by 17%, whereas copper-mancozeb application caused 11% reduction [119]. The ﬁrst commercial company to produce phages speciﬁcally for control of bacterial plant diseases was AgriPhi, Inc., established by L. E. Jackson [118].

1.5.2

Genetic Control

Each year there is great crop loss caused by pathogenic bacteria, phytoplasmas, viruses and viroids. These microorganisms are difﬁcult to control, as they multiply at an exponential rate and many of them can remain latent in “subclinical infections”, and/or in low numbers, and/or in some special physiological states in propagative plant material and in other reservoirs [120, 121]. In this context, rapid, cheap, sensitive, speciﬁc and reliable identiﬁcation methods of pathogens are required to apply treatments, undertake agronomic measures or proceed with eradication practices,

16

J. Arora et al.

particularly for quarantine pathogens. Increasingly, modern diagnostic tools are being based on the DNA characteristics of the pathogen as they present adequate diversity to distinguish species, strains, substrains, isolates, and even individuals; and offer convenience of detection using modern bio-techniques such as polymerase chain reaction (PCR) or Reverse Transcription (RT)-PCR [122]. Using RT-PCR technique detection of Cherry green ring mottle virus and Cherry necrotic rusty mottle virus in Prunus spp. has been done [123]. Further advancement in detection methods has been done by developing micro-array technology which provides the next generation of DNA diagnostics to measure different pathogens in a massively parallel manner on a single chip and avoid laborious confirmation procedures. A porous capillary solid phase micro-array system is shown for plant-pathogenic Phytophthora spp. multiplex detection [124]. Besides diagnostic methodology transformation techniques have been used to develop resistant varieties. Till date there are several examples of transgenic plants development for disease resistance, some of them are given here. A cloned non host gene (Rxo1) from maize with resistance to Bacterial leaf streak (BLS) of rice caused by Xanthomonas oryzae pv. oryzicola (Xooc), was transferred into four Chinese rice varieties through an Agrobacterium-mediated transformation system. Molecular analysis of the transgenic plants showed the integration of the Rxo1 gene into the rice genomes [125]. Likewise transgenic tobacco plants with synthetic gene of antimicrobial peptide Cecropin P1 were obtained, which exhibit enhanced resistance to phytopathogenic bacteria Pseudomonas syringae, P. marginata, and Erwinia carotovora [126]. The transgenic technology is meant to carry genetic uniformity in the crops with disease resistance as the most promising applications of genetically modiﬁed crops. However, the growth of transgenic technologies in agricultural practice has been limited by public opinion in some countries. The process of genetic engineering can introduce dangerous new allergens and toxins into foods that were previously naturally safe. At present, only two traits are the subject of the commercialized transgenic biotechnology: herbicide (glyphosate) tolerance and insect resistance conferred by the Bt gene from Bacillus thuringiensis. This means that new technologies to ﬁght weeds and insects are in place, and are in itself a noteworthy and positive step. In future new ﬁndings will give us many genes for insect and disease resistance, and then we may feel more secure from the genetic vulnerability that may be presented at the current stage of development of the technology.

1.6

Conclusion

Plants are immobile and as such are incapable of escaping attack by insect and microbial pests. Crop losses due to pests can be devastating to the point of creating a famine. Fungal and bacterial pathogens account for the greatest overall losses associated with plant diseases. One of the primary objectives of conventional plant breeding was to develop resistance to plant diseases. Results, however, were limited due to the length of time needed to develop varieties through conventional breeding,

1 Co-evolution of Pathogens, Mechanism Involved in Pathogenesis and Biocontrol…

17

the lack of suitable donor varieties, and the ability of microbes to adapt by neutralizing plant defense mechanisms. Now-a-days plants are genetically modiﬁed not only to increase quality of food but also to sustain the environmental threats including pathogens with increased shell life. Availability of pathogen-free germplasm to different organization in a safe and timely fashion is the need of hour. There is much to be done to expand our knowledge of plant pathogens and our ability to deal with them. The identity of many damaging pathogens that currently exist has not been done and the severity of the symptoms they cause is often subjective and qualitative rather than objective and quantitative. Plant pathogen populations are also genetically variable with time and space. Although there have been many epidemiological studies, it is difﬁcult to predict the origin of the next plant disease catastrophe that will affect one or other of our crops vital to food security in some part of the globe. Pathogens that have evolved new virulence characteristics can also give rise to some famine conditions. There is a need for adoption of novel and potentially valuable opportunities for crop improvement - especially in developing countries, where new developments are most needed to enhance food security.

References 1. Strange RN, Scott PR (2005) Plant diseases: a threat to global food security. Annu Rev Phytopathol 43:83–116 2. Pinstrup-Andersen P (2000) The future world food situation and the role of plant diseases. Can J Plant Pathol 22:321–331 3. United States Department of Agriculture (USDA) (2005) Foreign agricultural service circular series WAP 08–05, http://www.fas.usda.gov/wap/circular/2005/05-08/tables.html 4. FAO (2000) The state of food insecurity in the world (SOFI). FAO, UN, Rome, www.fao.org/ FOCUS/E/SOFI00/soﬁ001-e.htm 5. Oerke EC, Dehne HW (2004) Safeguarding production—losses in major crops and the role of crop protection. Crop Prot 23:275–285 6. Pimentel DS, McNair J, Janecka J et al (2001) Economic and environmental threats of alien plant, animal, and microbe invasions. Agric Ecosyst Environ 84:1–20 7. Carefoot GL, Sprott ER (1967) Famine on the wind. Rand McNally & Co., Chicago 8. Birch PRJ, Whisson SC (2001) Phytophthora infestans enters the genomic era. Mol Plant Pathol 2:257–263 9. Padmanabhan SY (1973) The great Bengal famine. Annu Rev Phytopathol 11:11–26 10. Ullstrup AJ (1972) The impact of the southern corn leaf blight epidemics of 1970–71. Annu Rev Phytopathol 10:37–50 11. Scheffer RP (1997) The nature of disease in plants. Cambridge University Press, Cambridge 12. Wellman FL (1957) Hemileia vastatrix. Federation Cafetalera de America, San Salvador 13. Mills LA (1964) Ceylon under British rule, 1795–1932. Cass & Co Ltd, Abingdon 14. Waage JK, Woodhall JW, Bishop SJ et al (2009) Patterns of plant pest introductions in Europe and Africa. Agric Syst 99:1–5 15. USBC (1998) Statistical abstract of the United States. US Bureau of the Census, US Government Printing Ofﬁce, Washington, DC 16. Mack MC, D’Antonio CM (1998) Impacts of biological invasions on disturbance regimes. Trends Ecol Evol 13:195–198 17. Pimentel D, Lach L, Zuniga R et al (2000) Environmental and economic costs associated with non-indigenous species in the United States. BioScience 50:53–65

18

J. Arora et al.

18. McGee DC (1997) Plant pathogens and the worldwide movement of seeds. APS Press, Saint Paul 19. Stace-Smith R, Hamilton RI (1988) Inoculum thresholds of seedborne pathogens: viruses. Phytopathology 78:875–880 20. Anderson PK, Cunningham AA, Patel NG, Morales FJ, Epstein PR, Daszak P (2004) Emerging infectious diseases of plants: pathogen pollution, climate change and agrotechnological drivers. Trends Ecol Evol 19:535–544 21. Hesler LR (2008) Grape diseases. In: Hesler LR (ed.) Manual of fruit diseases. Read Books, New York 22. Thresh JM, Otim-Nape GW (1994) Strategies for controlling African cassava mosaic geminivirus. Adv Dis Vector Res 10:215–236 23. Otim-Nape GW, Thresh JM, Bua A, Baguma Y, Shaw MW (1998) Temporal spread of cassava mosaic virus disease in a range of cassava cultivars in different agro-ecological regions of Uganda. Ann Appl Biol 133:415–430 24. Otim-Nape GW, Thresh JM (2006) The recent epidemic of cassava mosaic virus disease in Uganda. In: Cooke BM, Gareth Jones D, Kaye B (eds.) The epidemiology of plant diseases, 2nd edn. Springer, Dordrecht 25. Yirgou D, Bradbury JF (1968) Bacterial wilt of enset (Ensete ventricosum) incited by Xanthomonas musacearum sp. nov. Phytopathology 58:111–112 26. Tripathi L, Odipio J, Tripathi JN, Tusiime G (2008) A rapid technique for screening banana cultivars for resistance to Xanthomonas wilt. Eur J Plant Pathol 121:9–19 27. Kayobyo G, Aliguma L, Omiat G, Mugisha J, Benin S (2005) Impact of BXW on household livelihoods in Uganda. In: Proceedings workshop: assessing the impact of the banana bacterial wilt (Xanthomonas campestris pv. musacearum) on household livelihoods in East Africa, Kampala, 20 Dec 2005 28. Tripathi L, Mwangi M, Abele S, Aritua V, Tushemereirwe WK, Bandyopadhyay R (2009) Xanthomonas wilt: a threat to banana production in East and Central Africa. Plant Dis 93(5):440–451 29. Saari EE, Prescott JM (1985) World distribution in relation to economic losses. In: Roelfs AP, Bushnell WR (eds.) The cereal rusts; diseases, distribution, epidemiology, and control, vol II. Academic, Orlando 30. Gottwald TR (2010) Current epidemiological understanding of Citrus Huanglongbing. Annu Rev Phytopathol 48:6.1–6.21 31. Gilligan CA, van den Bosch F (2008) Epidemiological models for invasion and persistence of pathogens. Annu Rev Phytopathol 46:385–418 32. Jones RAC, Salam MU, Maling TJ et al (2010) Principles of predicting plant virus disease epidemics. Annu Rev Phytopathol 48:179–203 33. Williams PD (2009) Darwinian interventions taming pathogens through evolutionary ecology. Trends Parasitol 26:83–92 34. Woolhouse MEJ, Webster JP, Domingo E et al (2002) Biological and biomedical implications of the co-evolution of pathogens and their hosts. Nat Genet 32:569–577 35. Pagán I, Fraile A, Fernandez-Fueyo E et al (2010) Arabidopsis thaliana as a model for the study of plant-virus co-evolution. Philos Trans R Soc B 365:1983–1995 36. Thrall PH, Burdon JJ (2003) Evolution of virulence in a plant host-pathogen metapopulation. Science 299:1735–1737 37. Fenner F, Fantini B (1999) Biological control of vertebrates pest. CABI Publishing, Wallingford 38. Dangl JL, Jones JDG (2001) Plant pathogens and integrated defence responses to infection. Nature 411:826–833 39. Staskawicz BJ, Mudgett MB, Dangl JL et al (2001) Common and contrasting themes of plant and animal diseases. Science 292:2285–2289 40. Burdon JJ, Thrall PH (2009) Co-evolution of plants and their pathogens in natural habitats. Science 324:755–756 41. Rausher MD (2001) Co-evolution and plant resistance to natural enemies. Nature 411:857–864

1 Co-evolution of Pathogens, Mechanism Involved in Pathogenesis and Biocontrol…

19

42. Shan L, He P, Sheen J (2007) Endless hide-and-seek: dynamic co-evolution in plant-bacterium warfare. J Integr Biol 49:105–111 43. Keen N (1990) Gene-for-gene complementarity in plant-pathogen interactions. Annu Rev Genet 24:447–463 44. Rosenthal GA, Dahlman DL, Janzen DH (1976) A novel means for dealing with L-canavanine, a toxic metabolite. Science 192:256–258 45. Bishop JG, Dean AM, Mitchell-Olds T (2000) Rapid evolution in plant chitinases: molecular targets of selection in plant-pathogen co-evolution. Proc Natl Acad Sci USA 10:5322–5327 46. Richards TA, Dacks JB, Jenkinson JM et al (2006) Evolution of ﬁlamentous plant pathogens: gene exchange across eukaryotic kingdoms. Curr Biol 16:1857–1864 47. Anderson JO (2005) Lateral gene transfer in eukaryotes. Cell Mol Life Sci 62:1182–1197 48. Jain R, Rivera MC, Moore JE et al (2003) Horizontal gene transfer accelerates genome innovation and evolution. Mol Biol Evol 20:1598–1602 49. Kurland CG, Canback B, Berg OG (2003) Horizontal gene transfer: a critical view. PNAS 100:9658–9662 50. Boucher Y, Douady CJ, Papke RT et al (2003) Lateral gene transfer and the origins of prokaryotic groups. Annu Rev Genet 37:283–328 51. Friesen TL, Stukenbrock EH, Liu ZH et al (2006) Emergence of a new disease as a result of interspeciﬁc virulence gene transfer. Nat Genet 38:953–956 52. Oliver RP, Solomon PS (2008) Recent fungal diseases of crop plants: is lateral gene transfer a common theme? Mol Plant Microbe Interact 2:287–293 53. Cavender-Bares J, Kozak KH, Fine PVA et al (2009) The merging of community ecology and phylogenetic biology. Ecol Lett 12:693–715 54. Howitz KT, Bitterman KJ, Cohen HY, Lamming DW, Lavu S, Wood JG et al (2003) Small molecule activators of sirtuins extend Saccharomyces cerevisiae lifespan. Nature 425:191–196 55. Van Der Plank JE (1966) Horizontal (polygenic) and vertical (oligogenic) resistance against blight. Am J Potato Res 43(2):43–52 56. Agrios GN (2005) Plant pathology, 5th edn. Academic, San Diego 57. Robinson RA (1976) Plant pathosystems. Springer, Berlin/Heidelberg/New York 58. Debener T, Lehnackers H, Arnold M et al (1991) Identiﬁcation and molecular mapping of a single Arabidopsis thaliana locus determining resistance to a phytopathogenic Pseudomonas syringae isolate. Plant J 1:289–302 59. Whalen MC, Innes RW, Bent AF et al (1991) Identiﬁcation of Pseudomonas syringae pathogens of Arabidopsis and a bacterial locus determining avirulence on both Arabidopsis and soybean. Plant Cell 3:49–59 60. Flor HH (1955) Host-parasite interactions in ﬂax—its genetics and other implications. Phytopathology 45:680–685 61. Bergelson J, Kreitman M, Stahl Eli A et al (2001) Evolutionary dynamics of plant R-genes. Science 292:2281–2285 62. Nishimura MT, Dangl JL (2010) Arabidopsis and the plant immune system. Plant J 61:1053–1066 63. Thomma B, Van Esse HP, Crous PW et al (2005) Cladosporium fulvum (syn. Passalora fulva), a highly specialized plant pathogen as a model for functional studies on plant pathogenic Mycosphaerellaceae. Mol Plant Pathol 6:379–393 64. Dodds PN, Lawrence GJ, Catanzariti AM et al (2006) Direct protein interaction underlies gene-for-gene speciﬁcity and coevolution of the ﬂax resistance genes and ﬂax rust avirulence genes. PNAS 103:8888–8893 65. Ausubel FM (2005) Are innate immune signaling pathways in plants and animals conserved? Nat Immunol 6:973–979 66. He P, Shan L, Lin NC et al (2006) Speciﬁc bacterial suppressors of MAMP signaling upstream of MAPKKK in Arabidopsis innate immunity. Cell 125:563–575 67. Chisholm ST, Coaker G, Day B et al (2006) Host-microbe interactions: shaping the evolution of the plant immune response. Cell 124:803–814

20

J. Arora et al.

68. Kaku H, Nishizawa Y, Ishii-Minami N et al (2006) Plant cells recognize chitin fragments for defense signaling through a plasma membrane receptor. Proc Natl Acad Sci USA 103:11086–11091 69. Zipfel C, Kunze G, Chinchilla D et al (2006) Perception of the bacterial PAMP EF-Tu by the receptor EFR restricts Agrobacterium-mediated transformation. Cell 125:749–760 70. Meyers BC, Kozik A, Griego A et al (2003) Genome-wide analysis of NBS-LRR-encoding genes in Arabidopsis. Plant Cell 15:809–834 71. Umemoto N, Kakitani M, Iwamatsu A et al (1997) The structure and function of a soybean betaglucan- elicitor-binding protein. Proc Natl Acad Sci USA 94:1029–1034 72. Gomez-Gomez L, Boller T (2000) FLS2: an LRR receptor-like kinase involved in the perception of the bacterial elicitor ﬂagellin in Arabidopsis. Mol Cell 5:1003–1011 73. Shiu SH, Bleecker AB (2003) Expansion of the receptor-like kinase/Pelle gene family and receptor-like proteins in Arabidopsis. Plant Physiol 132:530–543 74. Mittler R, Vanderauwera S, Gollery M et al (2004) Reactive oxygen gene network of plants. Trends Plant Sci 9:490–498 75. Grant JJ, Yun BW, Loake GJ (2000) Oxidative burst and cognate redox signalling reported by luciferase imaging: identiﬁcation of a signal network that functions independently of ethylene, SA and Me-JA but is dependent on MAPKK activity. Plant J 24:569–582 76. Fellbrich G, Blume B, Brunner F et al (2000) Phytophthora parasitica elicitor-induced reactions in cells of Petroselinum crispum. Plant Cell Physiol 41:692–701 77. Lamb C, Dixon RA (1997) The oxidative burst in plant disease resistance. Annu Rev Plant Physiol Plant Mol Biol 48:251–275 78. Heath MC (2000) Hypersensitive response-related death. Plant Mol Biol 44:321–334 79. Gechev TS, Breusegem FV, Stone JM et al (2006) Reactive oxygen species as signals that modulate plant stress responses and programmed cell death. Bioessays 28:1091–1101 80. Torres MA, Jones JDG, Dangl JL (2006) Reactive oxygen species signaling in response to pathogens. Plant Physiol 141:373–378 81. Levine A, Tenhaken R, Dixon R et al (1994) H2O2 from the oxidative burst orchestrates the plant hypersensitive disease resistance response. Cell 79:583–593 82. Bolwell GP, Daudi A (2009) Reactive oxygen species in plant signaling. In: del Río LA, Puppo A (eds.) Signaling and communication in plants. Springer, Berlin/Heidelberg 83. Lambeth JD (2004) NOX enzymes and the biology of reactive oxygen. Nat Rev Immunol 4:181–189 84. Apel K, Hirt H (2004) Reactive oxygen species: metabolism, oxidative stress, and signal transduction. Annu Rev Plant Biol 55:373–399 85. Liu X, Williams CE, Nemacheck JA et al (2010) Reactive oxygen species are involved in plant defense against a gall midge. Plant Physiol 52:985–999 86. Huckelhoven R, Kogel KH (2003) Reactive oxygen intermediates in plantmicrobe interactions: who is who in powdery mildew resistance? Planta 216:891–902 87. Collins NC, Thordal-Christensen H, Lipka V et al (2003) SNARE-protein-mediated disease resistance at the plant cell wall. Nature 425:973–977 88. Bol JF, Linthorst HJM, Cornelissen BJC (1990) Plant pathogenesis-related proteins induced by virus infection. Annu Rev Phytopathol 28:113–138 89. Zhang J, Du X, Wang Q et al (2010) Expression of pathogenesis related genes in response to salicylic acid, methyl jasmonate and 1-aminocyclopropane-1-carboxylic acid in Malus hupehensis (Pamp.) Rehd. BMC Res Notes 3:208–214 90. Van Loon LC, Pierpoint WS, Conejero V (1994) Recommendations for naming plant pathogenesis-related proteins. Plant Mol Biol Rep 12:246–264 91. Sato F, Koiwa H, Sakai Y et al (1995) Synthesis and secretion of tobacco neutral PR-5 protein by transgenic tobacco and yeast. Biochem Biophys Res Commum 211:909–913 92. Ohashi Y, Matsuoka M (1987) Induction and secretion of pathogenesis-related proteins by salicylate or plant hormones in tobacco suspension cultures. Plant Cell Physiol 28:573–580 93. Peña-Cortés H, Willmitzer L (1995) The role of hormones in gene activation in response to wounding. In: Davis PJ (ed.) Plant hormones. Kluwer Academic, Dordrecht

1 Co-evolution of Pathogens, Mechanism Involved in Pathogenesis and Biocontrol…

21

94. Okushima Y, Koizumi N, Kusano T et al (2000) Secreted proteins of tobacco cultured BY2 cells: identiﬁcation of a new member of pathogenesis-related proteins. Plant Mol Biol 42:479–488 95. Nimchuk Z, Eulgem T, Holt BF et al (2003) Recognition and response in the plant immune system. Annu Rev Genet 37:579–609 96. Nimchuk Z, Rohmer L, Chang JH et al (2001) Knowing the dancer from the dance: R-gene products and their interactions with other proteins from host and pathogen. Curr Opin Plant Biol 4:288–294 97. Desveaux D, Singer AU, Dangl JL (2006) Type III effector proteins: doppelgangers of bacterial virulence. Curr Opin Plant Biol 9:376–382 98. Santner A, Estelle M (2010) The ubiquitin-proteasome system regulates plant hormone signaling. Plant J 61:1029–1040 99. Grant MR, Jones JDG (2009) Hormone (Dis)harmony moulds plant health and disease. Science 324:750–752 100. Pieterse CMJ, Leon-Reyes A, Van der Ent S et al (2009) Networking by small-molecule hormones in plant immunity. Nat Chem Biol 5:308–316 101. Dong X (2004) NPR1, all things considered. Curr Opin Plant Biol 7:547–552 102. Onkokesung N, Gális I, von Dahl CC et al (2010) Jasmonic acid and ethylene modulate local responses to wounding and simulated herbivory in Nicotiana attenuata leaves. Plant Physiol 153:785–798 103. Yan J, Zhang C, Gu M et al (2009) The Arabidopsis CORONATINE INSENSITIVE1 protein is a jasmonate receptor. Plant Cell 21:2220–2236 104. von Dahl CC, Winz RA, Halitschke R et al (2007) Tuning the herbivore-induced ethylene burst: the role of transcript accumulation and ethylene perception in Nicotiana attenuata. Plant J 51:293–307 105. Chen YF, Etheridge N, Schaller GE (2005) Ethylene signal transduction. Ann Bot Lond 95:901–915 106. Vlot AC, Dempsey D’Maris A, Klessig DF (2009) Salicylic acid, a multifaceted hormone to combat disease. Annu Rev Phytopathol 47:177–206 107. Attaran E, Zeier TE, Griebel T et al (2009) Methyl salicylate production and jasmonate signaling are not essential for systemic acquired resistance in Arabidopsis. Plant Cell 21:954–971 108. House Resolution- 1627 Food Quality Protection Act (FQPA) (1996) http://www.epa.gov/ pesticides/regulating/laws/fqpa/ 109. Dayan FE, Cantrell CL, Duke SO (2009) Natural products in crop protection. Bioorg Med Chem 17:4022–4034 110. De Angelis J (2010) Pesticides – insecticides, herbicides and fungicides. (http://www. livingwithbugs.com/pesticid.html) 111. Spadaro D, Gullino ML (2005) Improving the efﬁcacy of biocontrol agents against soil borne pathogens. Crop Prot 24:601–613 112. Sharma RR, Singh D, Singh R (2009) Biological control of postharvest diseases of fruits and vegetables by microbial antagonists: a review. Biol Control 50:205–221 113. McSpadden Gardener BB, Fravel DR (2002) Biological control of plant pathogens: research, commercialization, and application in the USA. Plant Health Prog. doi:10.1094/ PHP-2002-0510-01-RV 114. El-Hamshary OIM, Gebally O, El-Gebally Abou-El-Khier ZA et al (2010) Enhancement of the chitinolytic properties of Azospirillum strain against plant pathogens via transformation. J Am Sci 6:169–176 115. United States Environmental Protection Agency (US EPA). Termss: biopesticides. Online. Ofﬁce of Pesticide Programs. http://www.epa.gov/pesticides/biopesticides/ 116. Lee SW, Il-P A, Sim SY et al (2010) Pseudomonas sp. LSW25R, antagonistic to plant pathogens, promoted plant growth, and reduced blossom-end rot of tomato fruits in a hydroponic system. Eur J Plant Pathol 126:1–11 117. Gill JJ, Svircev AM, Smith R et al (2003) Bacteriophages of Erwinia amylovora. Appl Environ Microbiol 69:2133–2138

22

J. Arora et al.

118. Jackson LE (1989) Bacteriophages prevention and control of harmful plant bacteria. US Patent 4,828,999, 9 May 1989 119. Jones JB, Jackson LE, Balogh B et al (2007) Bacteriophages for plant disease control. Annu Rev Phytopathol 45:245–262 120. Helias V, Andrivon D, Jouan B (2000) Internal colonization pathways of potato plants by Erwinia carotovora ssp. atroseptica. Plant Pathol 49:33–42 121. Biosca EG, Marco-Noales E, Ordax M et al (2006) Long-term starvation-survival of Erwinia amylovora in sterile irrigation water. Acta Hortic 704:107–112 122. López MM, Llop P, Olmos A et al (2009) Are molecular tools solving the challenges posed by detection of plant pathogenic bacteria and viruses? Curr Issues Mol Biol 11:13–46 123. Li R, Hartung JS (2007) Reverse transcription-polymerase chain reaction-based detection of cherry green ring mottle virus and cherry necrotic rusty mottle virus in Prunus spp. Unit 16C.1. In: Current protocols in microbiology. Wiley, New Jersey, pp 1–9 124. Schoen CD, de Weerdt M, Szemes M et al (2004) Multiplex detection of plant (quarantine) pathogens by micro-arrays: an innovative tool for plant health management. Acta Hortic ISHS 657:553–558 125. Xie XW, Yu J, Xu JL et al (2007) Introduction of a non host gene Rxo1 cloned from maize resistant to rice bacterial leaf streak into rice varieties. Chin J Biotechnol 23:607–611 126. Zakharchenko NS, Rukavtsova EB, GudkovYa AT et al (2005) Enhanced resistance to phytopathogenic bacteria in transgenic tobacco plants with synthetic gene of antimicrobial peptide cecropin P1. Russ J Genet 41:1187–1193

Part II

Applications of Biological and Natural Agents

sdfsdf

Chapter 2

Stilbenes: Biomarkers of Grapevine Resistance to Disease of High Relevance for Agronomy, Oenology and Human Health Katia Gindro, Virginia Alonso-Villaverde, Olivier Viret, Jean-Laurent Spring, Guillaume Marti, Jean-Luc Wolfender, and Roger Pezet

Abstract Stilbenic phytoalexins are key defence molecules implicated in the resistance of grapevine cultivars to three major fungal pathogens, Botrytis cinerea (grey mould of grape), Plamopara viticola (downy mildew) and Erysiphe necator (powdery mildew). HPLC analysis of stilbenes is an efﬁcient method to evaluate the ability of the vine plants to inhibit the development of fungal pathogens. Resistant grapevine varieties react very rapidly to infections by producing high concentrations of the most toxic stilbenes, G-viniferin and pterostilbene, at the sites of infection. Monitoring of such stress biomarkers is also of great interest for evaluating the efficiency of priming molecules at inducing the grapevines’ natural defence responses. In addition, these compounds have various beneﬁcial effects on human health, acting as anti-oxidants and also as potential chemopreventive agents. The diversity of stilbenes is intriguing, and new holistic analytical approaches, such as metabolomics, that are widely used for wine classiﬁcation also have great potential for the comprehensive study of responses of Vitaceae to biotic and abiotic stress.

K. Gindro (* s/6IRETs* ,3PRINGs20EZET Swiss Federal Research Station Agroscope Changins-Wädenswil, Route de Duillier, 0/"OX #( .YON 3WITZERLAND e-mail: [email protected] V. Alonso-Villaverde Misión Biológica de Galicia (CSIC), P.O. Box 28, 36080 Pontevedra, Spain '-ARTIs* ,7OLFENDER 3CHOOLOF0HARMACEUTICAL3CIENCES 5NIVERSITYOF'ENEVA 'ENEVA 3WITZERLAND 3CHOOLOF0HARMACEUTICAL3CIENCES 5NIVERSITYOF,AUSANNE ,AUSANNE 3WITZERLAND

J.M. Mérillon and K.G. Ramawat (eds.), Plant Defence: Biological Control, Progress in Biological Control 12, DOI 10.1007/978-94-007-1933-0_2, © Springer Science+Business Media B.V. 2012

25

26

2.1

K. Gindro et al.

Introduction

Stilbenes are a family of molecules, whose chemical structure in both the monomeric and oligomeric states is constituted by a diphenylethylene group oriented in cis or trans. When exposed to UV light, they emit intense blue ﬂuorescence. This characteristic is the origin of the name stilbene, which derives from the Greek word “VWLOERV” (stilbos), translated as “shining”. Stilbenes are natural phenolic compounds and have been isolated and identiﬁed in 25 different plant families and also in a Bryophyte and an Antarctic sponge (Table 2.1). This list is likely not exhaustive, but it shows the broad distribution of the biochemical pathway for stilbene synthesis in plants and other organisms. Stilbenes are secondary plant products that are produced through the phenylalanine/polymalonate pathway. Resveratrol was the ﬁrst stilbene identiﬁed [27] and is the most studied. 3TILBENESYNTHASEISTHEKEYENZYMEFORTHEFORMATIONOFRESVERATROLANDOTHER stilbenes produced from various phenolic precursors [28–31] (Fig. 2.1). Table 2.1 Plant families containing stilbenes (only one reference is given per family) Plant family Species Stilbenea Asteraceae [1] Leuzea carthamoides 3,3c-dimethoxy-4,4c-dihydroxystilbene Salacia lehmbachii Lehmbachols A-D Celastraceae [2] Cesalpiniaceae [3] Guibourtia tessmannii 3,4c-dimethoxy-5-rutinosyl stilbene Cyperaceae [4] Scirpus holoschoenus 2-prenyl-3,5,4c-trimethoxystilbene Dioscorea dumentorum Dihydroresveratrol Dioscoreaceae [5] Dipterocarpaceae [6] Stemonoporus canaliculatus Caniculatol Loiseleuria procumbens Piceid Ericaceae [7] Euphorbiaceae [8] Macaranga mappa Mappain Fabaceae [9] Arachis hypogaea 3,5,4c-trihydroxystilbene Gnetaceae [10] Gnetum gnemon Gnemonoside K Anigopreissin A Haemodoraceae [11] Anigozanthos ﬂavidus Hyacinthaceae [12] Scilla nervosa Isorhapontigenin Iridaceae [13] Iris clarkei Ampelopsin B Moraceae [14] Artocarpus incises Artocarbene Musa cavendish Anigopreissin A Musaceae [15] Myrtaceae [16] Eucalyptus wandoo 3,5,4c-trihydroxystilbene-3-E-D-glucoside Orchidaceae [17] Dendrobium plicatile Ephemeranthoquinone Paeoniaceae [18] Paeonia suffruticosa Suffruticosols A, B and C Pinaceae [19] Picea abies Isorhapontin Polygonaceae [20] Rheum rhaponticum Rhaponticin Rosaceae [21] Holodiscus discolor Resveratrol-3-O-E-D-xylopyranoside Umbelliferaceae [22] Foeniculum vulgare Foeniculosides I, II, II, IV Vitaceae [23] Vitis vinifera Resveratrol Zingiberaceae [24] Alpinia katsumadai 1(1-terpinen-4-olyl)-3-methoxystilbene (E) Others Marchesina hongardiana 3,4-dihydroxy-3c-methoxystilbene Lejeuneaceae [25] Antarctic sponge [26] Kirkpatrickia variolosa Resveratrol triacetate a One representative stilbene for each species is shown

2

Stilbenes: Biomarkers of Grapevine Resistance to Disease…

27

Fig. 2.1 General structure of stilbenes (according to [31])

Plant-derived stilbenes are isolated as hydroxylated, methylated, esteriﬁed, glycosylated or prenylated monomers or as polymers. In Vitaceae, resveratrol and D-, E- and H-viniferin were identiﬁed to be phytoalexins [23, 32], which are antimicrobial substances synthesised de novo by plants that accumulate rapidly at areas of incompatible pathogen infection. A methylated stilbene, pterostilbene, was later identiﬁed by Langcake et al. [33]. Prior to these studies, resveratrol and pterostilbene were reported in other plants. Resveratrol was ﬁrst identiﬁed in Veratrum grandiﬂorum by Takaoka in 1939 [27]. Its name likely derives from an abbreviation of the class of molecules to which resveratrol belongs, i.e., resorcinol, the plant name Veratrum and ol indicating the presence of a hydroxyl group. Pterostilbene was ﬁrst described by Spath and Schläger [34] in Pterocarpus santalinus. In Vitaceae, stilbenes represent defence biomarkers because they occur as phytoalexins that are produced dynamically in response to biotic or abiotic stress. Though resveratrol and its derivatives are present in ligniﬁed stem tissue [35, 36], it is absent in the healthy green parts of the grapevine (leaves, young canes). Pterostilbene, however, is present in the healthy grape berries of Vitis vinifera (var. Gamay) [37]. The rate of synthesis of resveratrol after stress induction depends on the grape variety and provides a good metric for evaluation of the resistance of grapevine cultivars to grey mould and downy mildew [35, 36, 38–41]. Resveratrol and its derivatives are present in grape berries [42] and were found in wine by Siemann and Creasy [43]. When Renaud and de Lorgeril [44] and Frankel et al. [45] demonstrated the cardiovascular-protective effects of resveratrol, the French Paradox theory was born. Since then, much research has dealt with the beneﬁcial effects of resveratrol and pterostilbene in medicine [46]. In addition,

28

K. Gindro et al.

groups around the world have since studied the composition of stilbenes present in wine [42, 47–50]. The synthesis of pure pterostilbene and resveratrol has allowed the study of the toxic effect of these stilbenes on Botrytis cinerea, one of the major fungal diseases that attack grapevines [37, 51, 52=%NZYMATICSYNTHESISOFG-viniferin, as well as puriﬁcation of H-viniferin from ligniﬁed canes [53], allowed toxicity testing of these resveratrol dimers on Plasmopara viticola (downy mildew) and Erysiphe necator (powdery mildew) [40, 41, 54, 55]. Because of these results, we have developed biological (artiﬁcial inoculation) and chemical methods (HPLC analysis of stilbenes in grape tissues) to evaluate the level of resistance of grapevine seedlings to downy and powdery mildew in breeding programmes. These tools have led to a signiﬁcant reduction in the time and space required for such experiments.

2.2

Grapevine Cultivars as Models for Resistance to Fungal Diseases and as Breeding Tools

Among the approximately ten species of fungus that are considered to be major grapevine pathogens, three are most responsible for damage in the vineyards: the grey mould of grape (Botrytis cinerea), downy mildew (Plasmopara viticola) and powdery mildew (Erysiphe necator). The grape varieties presently cultivated around the world are more or less sensitive to these diseases and must be protected by repeated annual applications of fungicides. For example, depending on meteorological conditions, 8–10 different treatments are applied in Swiss vineyards to control downy mildew alone [56= )N 3WITZERLAND FOR MORE THAN YEARS THE 2ESEARCH Station Agroscope-Changins-Wädenswil (ACW) has undertaken grape breeding programmes to enhance the diversity and the quality of new cultivars. In 1970, André Jaquinet obtained an interspecies cross-bred strain named Gamaret (Gamay x Reichensteiner) [57]. This cultivar was introduced to Swiss vineyards in 1990. Over the two last decades, its cultivation has become increasingly important thanks to its oenological quality and its remarkable resistance to grey mould. From this programme, which is ongoing, eight new varieties, six red (Carminoir, Diolonoir, Gamaret, Galotta, Garanoir, Mara) and two white (Charmont, Doral), have been REGISTERED/FTHESE 'AMARETHASBEENAGREATSUCCESSIN3WITZERLAND;58]. Gamaret became a model for research on the mechanisms of resistance mechanisms to B. cinerea. This necrotrophic fungal parasite has a low sensitivity to resveratrol and other stilbene derivatives, with the exception of pterostilbene [37, 51]. However, Gamaret does not synthesise pterostilbene at concentrations that affect B. cinerea, so the observed resistance must be explained by other mechanisms. Synergy was observed between glycolic acid, a natural component of grape berries, and pterostilbene. The mixture of these components was found to be highly toxic to B. cinerea conidia [37, 51]. The most probable mechanism of resistance is related to constitutive phenolic and polyphenolic compounds (polymeric proanthocyanidines)

2

Stilbenes: Biomarkers of Grapevine Resistance to Disease…

29

known for their abilities to inhibit B. cinerea stilbene oxidase [53, 59] and to other HYDROLYTIC ENZYMES SECRETED BY THIS FUNGUS AS DEMONSTRATED BY "ATEMAN AND Basham [60]. Because the development of grey mould requires the active detoxiﬁcation of phenolic compounds [59= INHIBITIONOFTHESEENZYMESINHIBITSTHEGROWTH of the fungus in grape berries [40]. 4HESPECIlCCLIMATEIN6ALAIS 3WITZERLAND ALLOWSTHECULTIVATIONOFALARGERANGE of local and foreign grape varieties. Since 1992, an important project has been to safeguard the genetic resources of old, local and high-quality grapevine varieties in order to provide a convenient source for nursery garden and to maintain genotypic variability within varieties [61]. Today, more than 1,300 biotypes from 14 varieties have been placed in a conservatory (after testing for viruses). At the same time, evaluation of the agronomical and oenological value of a large panel of new varieties from various countries and research institutes, which derived from interspecies crossings between European and American or Asiatic species, was initiated. The results of this investigation allowed the introduction, in 1996, of a new cross-breeding programme whose aims are the following: high downy mildew resistance, good agronomical characteristics, high oenological potential, adaptability to various climatic conditions and low sensitivity to powdery mildew and grey mould. As for other research institutes, rapid estimation of the level of resistance at the seedling stage would signiﬁcantly reduce the time, space and effort required for selection of resistant progeny. Due to the speciﬁc orientation of this breeding programme, histological and biochemical criteria, rather than molecular markerassisted selection, were used. Other solutions to these problems include the activation of the natural defence mechanisms of the plant using natural or synthetic products, as well as the application of antagonistic microorganisms that are only partially toxic [62, 63]. The study of genetic methods [64, 65] to transform traditional cultivars represents another alternative, but the production of genetically modiﬁed vines is still controversial [66, 67]. Although a long-term endeavour, grapevine breeding is the most effective way to create cultivars resistant to fungal diseases and to reduce the number of fungicide applications. In fact, traditional grape cultivars do not possess resistance against Plasmopara viticola or Erysiphe necator. The introduction of resistance mechanisms against mildews requires the use of wild American and/or Asiatic Vitis genotypes to supply resistance genes [68]. Therefore, crossbreeding programmes were initiated in different countries and research institutes to develop grapevine genotypes resistant to various diseases, especially downy mildew. Localisation studies of quantitative trait loci (QTL) for downy and powdery mildew resistance have been applied to grapes to obtain insight into the roles of various defence mechanisms in pathogen resistance. Different QTL for resistance to Plasmopara viticola (Rpv) [69–72] and Erysiphe necator (Run) [73, 74] have been mapped. One advantage of this genetic approach is the ability to combine resistance genes in a successive backcrossing strategy, thus introducing QTL loci from wild species into V. vinifera. However, while this strategy has substantial advantages, it is a time-consuming and costly process.

30

2.2.1

K. Gindro et al.

Criteria for Early Selection of Resistant Grape Cultivars to Downy and Powdery Mildew

Grapevine breeding is one of the most promising methods to preserve genetic diversity, but it also allows the selection of speciﬁc genetic traits, such as resistance to pathogens. Each cross produces a large number of germplasms (collection of genetic resources), and a rapid way to estimate the downy mildew resistance level is absolutely necessary to avoid long and tedious ﬁeld observations. For this purpose, artificial inoculations of seedlings with P. viticola sporangia or the conidia of E. necator and estimation of the development of the disease after 1 week of incubation is a very useful method [54, 55]. The production and the density of sporangia issued from these artiﬁcial inoculations are widely accepted as good criteria for the estimation of grapevine resistance to pathogens [36, 75–77]. Tests of resistance of grape cuttings in climate chambers or greenhouses are not always representative of the real resistance level in the vineyards, even if a good correlation has been demonstrated between artiﬁcial inoculations in glasshouses or climate chambers and ﬁeld observations [78]. Other resistance criteria must be stringently tested in seedlings to correlate the resistance in greenhouse or in vitro tests and in vineyards. The ﬁrst model of downy mildew resistant grape variety studied at ACW was 3OLARIS ;-ERZLING X 3APERAVI SEVERNEYI X -USCAT /TTONEL = WHICH WAS OBTAINED from the Weinbauinstitut Freiburg, Germany. In the case of P. viticola, two physiological events are representative of resistance to mildew. One is callose synthesis in stomata at 7 h post-infection with P. viticola ZOOSPORES ;79]. The second is the synthesis of stilbenic phytoalexins, especially resveratrol and its subsequent oxidation products, H- and G-viniferins, [33, 53, 54, 80] and the production of pterostilbene [40]. Callose, a sugar polymer that consists of (1-3)-E-D-glucose subunits, is a known constituent of papillae (raised thickenings in the cuticle), which have long been known to serve as plant defences [81]. When attacked, plants physically reinforce their cell wall to stall or to prevent pathogen penetration [82]. It is known that callose deposits play a role in the ability of grapevines to tolerate downy mildew [83]. More recently, rapid synthesis of callose in the stomata of grapevine leaves after P. viticola infection has been described. This phenomenon stops downy mildew penetration into the stomata and is only visible in resistant cultivars. In downy mildew-susceptible varieties, no callose synthesis has been observed, whereas the number of stomata with callose deposition is generally well correlated with the observed resistance of germplasms to mildew after artiﬁcial inoculations [79]. In addition to callose deposition in stomata, oxidised resveratrol derivatives and pterostilbene are produced in the leaves of resistant cultivars at the site of infection after artiﬁcial inoculation and can be analysed and quantiﬁed by HPLC [54]. One of the oxidation products of resveratrol was determined to be H-viniferin [80], and, more recently, an isomer of this product, the G-viniferin, was described as one of the major stilbenes present in stressed grapevine leaves [53]. Until now, pterostilbene, the stilbene with the highest toxicity towards downy and powdery mildew [40, 84] and grey mould [51], has only been produced in high quantities in speciﬁc vine

2

Stilbenes: Biomarkers of Grapevine Resistance to Disease…

31

Fig. 2.2 3IZEOFNECROTICAREASarrows) developed 72 h after artiﬁcial inoculation with Plasmopara viticola. (a) IRAC 2091[ACW new grapevine variety; Gamaret x Bronner]; (b) Muscadinia rotundifolia. Scale bars represent 1 mm

genotypes and backcrosses. Use of these genotypes must be prioritised to promote resistance. In susceptible cultivars, resveratrol is mainly glycosylated to form piceid. This addition of glucose to resveratrol protects it from further oxidation [85]. This is particularly important when we consider the respective toxicity of the different stilbenes towards each fungal pathogen. Glycosylated resveratrol (piceid) is not toxic, while H- and G-viniferins and pterostilbene are highly toxic [40]. Qualitative and quantitative analysis of stilbenes in the leaves of grapevine seedlings at 48 h post-inoculation is also highly predictive of the level of P. viticola resistance genotypes. In Muscadinia rotundifolia, the necrotic areas consist of a number of small necrotic spots (mean of 35 per 20 mm2, with an average surface area of 0.0028 mm2) located under the infection droplet surface. This means that samples must be taken very carefully, just around the developing necrotic areas under the magnifying glass, as shown in Fig. 2.2; otherwise, the intensity of the stilbene signals is diluted and therefore not representative of the real local accumulation. In this cultivar, the infection process is stopped before the development of either vesicles or infective structures and results in a rapid accumulation of considerable amounts of stilbenes [86]. Not all these stilbenes are equally toxic to P. viticola, as described previously. G-viniferin and pterostilbene are considered to be the most toxic to downy mildew. Pterostilbene is generally absent or present at concentrations that are too low to have a signiﬁcant effect. In Muscadinia, at 24 h after infection, G-viniferin and pterostilbene are present at levels 24 and 42 times higher than their respective ED50s [53]. (ED50 signiﬁes the concentration that inhibits 50% of the development of the pathogen.) Therefore, the most important step in the inhibition of disease in Muscadinia may be the rapid induction of metabolic responses, which occur before any haustorium can appear. According to these results, a two-step procedure is used to select seedlings that are resistant to downy mildew; it consists of the following steps: (1) artiﬁcial inoculation, in the greenhouse, of whole plantlets by spraying an aqueous suspenSIONOFDOWNYMILDEWZOOSPORESANDELIMINATIONOFSPORULATINGPLANTSAFTERWEEK

32

K. Gindro et al.

incubation; and (2) application of histological and biochemical criteria (sporulation, callose in stomata, H- and G-viniferins as well as pterostilbene production) to classify the detached leaves of remaining plants. Leaf samples must be excised under the infection droplets areas. The combination of these criteria have permitted us to establish threshold values for sporulation (<15 sporangia mm−2), callose (>15% of infected stomata presenting callose deposits), and stilbene levels (>40 Pmol mg−1 FW G-viniferin and >50 Pmol mg−1 FW H-viniferin) that can be used to identify resistant seedlings, which are then transferred to the hybridiser and can be planted in the vineyard for further agronomical and oenological evaluation. Currently, 58 crosses have been performed, generating more than 22,000 plantlets, of which 900 have been selected using the early tests described before (mean of 4% of the initial plants). 33 varieties (30 red and 3 white) have been propagated to obtain 20 plants, from which 13 have been successfully planted in extended performance trials. Finally, one variety has been announced for DHS (Diversity Homogeneity Stability) registration in 2009. More recently, the resulting resistant seedlings have been screened for powdery mildew resistance, using histological and biochemical criteria [87]. However, no plantlets were eliminated until a ﬁnal validation of the correlation between ﬁeld observations and laboratory results has been performed. A one-step procedure was developed to evaluate the susceptibility of the remaining seedlings. First, leaf fragments are taken and ﬁxed under osmium vapours for scanning electron microscopy (SEM) analysis. In fact, scanning electron microscopy of the grapevine adaxial leaf surface has revealed that the crystallisation pattern of epicuticular waxes varies between susceptible and resistant grape varieties (Fig. 2.3) [55]. The susceptible V. vinifera cv Chasselas displays a relative smooth surface and some scattered protuberances, giving it a crusty appearance. However, the surface of V. candicans, which is very resistant to powdery mildew, is densely covered by platelet-shaped crystals that protrude perpendicularly from the leaf plane. The width and the crystallisation patterns were conﬁrmed by transmission electron microscopy. The platelets exhibit thin margins and relative triangular shapes on which no haustoria could be observed. Though these results are interesting, SEM is quite time-consuming and therefore unsuitable for a rapid evaluation of seedling resistance in our breeding programme. Further artiﬁcial inoculations were performed on leaf disks incubated under optimal conditions for E. necator growth. Observation of its development and quantiﬁcation of the conidia germination rate, level of appressoria formation, mycelial network density and sporulation level at 6 days after inoculation are efﬁcient epidemiological criteria to determine the level of susceptibility of seedlings to E. necator. A phenomenon speciﬁc to Erysiphe necator infection is the production of mycelium strictly on the host surface. Consequently, the induction of defence metabolites [88] increases only during the development of infectious structures (appressoria, infection peg and haustorial differentiation). The haustoria of E. necator infect only the ﬁrst epidermal cell layer, while P. viticola develops an intercellular mycelium that invades the mesophylle and forms many infective structures in the cells. Because of the local synthesis of stilbenic phytoalexins at the sites of infection, the quantiﬁcation of stilbenes induced by powdery mildew infections must be linked to the number of appressoria and infective structures [84].

2

Stilbenes: Biomarkers of Grapevine Resistance to Disease…

33

Fig. 2.3 Crystallisation pattern of epicuticular waxes of two grapevine cultivars that are susceptible (V. vinifera cv. Chasselas) and resistant (Vitis candicans) to Erysiphe necator and development of the pathogen on the two different structures. (a) Epicuticular waxes of Vitis candicans, observed by scanning electron microscopy (SEM), showing platelet-shaped crystals that protrude perpendicularly from the leaf plane (Dr S. Schnee). (b) Epicuticular waxes of V. vinifera cv. Chasselas, observed by SEM, showing a smooth surface with scattered protuberances (Dr S. Schnee). (c) same as (a), but observed by transmission electron microscopy (TEM). (d) same as (b), but observed by TEM. (e) E. necator conidium, 3 days after inoculation on V. candicans; no haustorium development was observed. (f) E. necator conidium, 1 day after inoculation on V. vinifera cv. Chasselas, with a well developed hautorium arising from an appressorium. a appressorium, c conidium, h haustorium

34

K. Gindro et al.

Results have shown a strong induction of viniferins, which are very toxic towards E. necator, in resistant grapevine cultivars. For this reason, the quantiﬁcation of viniferins at 48 h after inoculation is an important measure of resistance towards powdery mildew. The choice and the relevance of each criterion of resistance must still be correlated to the real resistance of the grapes in question towards E. necator in ﬁeld trials.

2.2.2

Use of Analytical Criteria to Evaluate Elicitors

As mentioned, disease control can be achieved with the repeated use of fungicides, with the risk of emergence of resistant strains of P. viticola [89]. Recently, with the rise of sustainable viticulture, the elicitation or priming of endogenous defence mechanisms in grapevines has gained signiﬁcant attention in the scientiﬁc community. Elicitation and enhancement of plant defence mechanisms have been described for grapevines and for other plants [90]. The generic description of plant immune responses has generalised the use of the term PAMP (Pathogen Associated Molecular Patterns), which precisely deﬁnes an elicitor to be a microbe- or plant-derived moleCULEGENERATEDBYTHEENZYMATICDEGRADATIONOFPLANTCOMPONENTSBYTHEPATHOGEN itself (e.g., galacturonic acid and glucans) during the ﬁrst step of infection [91]. Plant elicitors were ﬁrst deﬁned as compounds able to induce phytoalexin production but are also commonly recognised to induce oxidative processes such as the production of ROS (reactive oxygen species), papillae formation, ligniﬁcation processes and expression of pathogenesis-related (PR) proteins [92]. In the grape, some common plant defence mechanisms against fungal infections have been described, including stilbenic phytoalexins production, which can be induced by biotic or abiotic stresses, such as UV irradiation [31]. Various molecules, such as laminarin [93], BABA [94], BcPG1 [95], cyclodextrin [96], PS3 (sulfated laminarin) [97], botrycin and cinerein extracted from B. cinerea [98], chitosan and fosetyl aluminium, have been shown to induce chitinase and glucanase activity and stilbenic phytoalexins synthesis and have provided a better understanding of these defence responses. Organic viticulture requires products to protect grapevines without the use of synthetic fungicides. Scientiﬁc research is thus necessary to evaluate the activities of new natural products as fungitoxic compounds or as elicitors to confer crop protection [99, 100]. A better knowledge of elicitation processes could contribute to a reduction in the application of fungicides. The synergistic application of priming molecules and fungicides under ﬁeld conditions may allow for a reduction in the doses of fungicides required to control diseases [101]. Some plant extracts have been shown to possess direct antifungal properties against phytopathogenic fungi, while others could indirectly inhibit fungal development by eliciting endogenous mechanisms of defence against P. viticola [63]. Direct application of these extracts in the ﬁeld is not suitable for an efﬁcient evaluation of their efﬁcacy. Recently, the efﬁcacies and the modes of action of various fungicides and elicitors were evaluated on the basis of various markers of resistance to downy

2

Stilbenes: Biomarkers of Grapevine Resistance to Disease…

35

mildew developed, as previously described. These markers (rate of infection, quantiﬁcation of sporulation, quantiﬁcation of stilbenic phytoalexins and stomatal callose) were used on both single leaves and whole plants of susceptible Vitis vinifera varieties such as cvs. Chasselas, Pinot noir, Cabernet sauvignon or Gamay, which were pre-treated with aqueous suspensions of these products at different concentrations. The preliminary results showed that at least two natural plant extracts out of the 55 tested (root extract of the rhubarb Rheum palmatum and bark extract of the glossy buckthorn Frangula alnus) were effective. They induce, simultaneously, prolonged activation of defence mechanisms, particularly stimulation of the G-viniferin synthesis, and inhibition of pathogen development to a signiﬁcant degree. Other treatments (e.g., application of extracts of Galla chinensis and pure gallic acid) induced a massive production of stilbenes for a short period time, but this was insufﬁcient to inhibit the development of downy mildew at 48 h after treatment. Nevertheless, plant protection was ensured by the fungitoxic properties of the applied products. In contrast, copper and tannic acid treatments had fungitoxic effects but did not induce plant defence mechanisms. The ability of R. palmatum and F. alnus extracts to induce stilbenic phytoalexins production and peroxidase activity was clearly due to their anthraquinone content. Indeed, application of aqueous solutions of pure anthraquinones such as rhein, frangulin A, emodin, aloe-emodin, chrysophanol and physcion [102] had effects similar to those of the extracts. However, these plant extracts may also contain other compounds (such as glucans, pectins, lignins or tannins) that could elicit host defences. Stilbene production provides a reliable metric for the efficacy of elicitors and plant protection products against downy mildew. Since 2005, it has been applied in Agroscope-ACW collaborative projects in integrated pest management and organic and biodynamic viticulture. These experiments provide decisive information in advance of ﬁeld-testing. Applications of crude plant extracts have potential for grapevine protection. However, a careful characterisation of the chemical composition of these natural extracts as well as the bioactivity of their individual constituents is necessary. Indeed, it is important to identify the molecules responsible for the induction of host defences, assess the safety of their use for wine production and verify their neutral ecological impact when used in large amounts in the ﬁeld.

2.3

Analytical Tools and Metabolomic Methods for Identifying Stilbenes and Other Defence-Induced Compounds

As previously mentioned, stilbenes are phytoalexins produced naturally by several plants upon attack by pathogens such as bacteria or fungi. Because of their dynamic behaviour as responses to stress, their detection requires methods that can be used for monitoring their differential response in various phytopathologic situations. Various HPLC methods have been used for detection and quantiﬁcation of stilbenes. Indeed, HPLC in gradient mode on reversed phase C18 columns provides a means to separate stilbenes directly in crude extracts without the need for derivatisation.

36

K. Gindro et al.

Many extraction methods have been tested in conjunction with the direct use of HPLC for stilbene proﬁling [103]. Most of the qualitative or quantitative analytical studies were performed with HPLC and ultraviolet (UV), ﬂuorescence (FD) or electrochemical (ECD) detection [104]. We have demonstrated that ﬂuorimetric detection is much more sensitive than UV detection and that its speciﬁcity allows simple pre-puriﬁcation of grape berries juice and/or direct injection of wines [42]. The ﬂuorescent properties of stilbenes have also been used for their in vivo detection and local assessment in grapevine leaves [105]. As discussed below, HPLC coupled to mass spectrometry (LC-MS) provides an even more sensitive and selective method for the detection of these polyphenols [106]. In general, all of these analytical approaches have been used in a targeted manner and require the use of well-deﬁned stilbene standards for identiﬁcation and quantiﬁcation. To obtain a deeper understanding of plant stress response phenomena at the level of production of phytoalexins, phytohormones and other stress-induced metabolites, non-targeted, holistic analytical approaches can be used. These studies are performed using ‘metabolomics’, which is deﬁned as a universally applicable non-targeted analytical approach to identify and quantify the largest possible number of metabolites of a biological system. The complete set of primary and secondary metabolites of low molecular weight (MW < 1,000 Da) constitutes the ‘plant metaBOLOME4HESIZEOFTHISMETABOLOMEISSTILLUNKNOWN BUTITISESTIMATEDTOCONTAIN several thousand constituents [107]. Metabolomic proﬁling may actually provide the most ‘functional’ information of all of the ‘omics’ technologies [108]; it gives a broad view of the biochemical status of an organism that can be used to monitor signiﬁcant metabolite variations. Indeed, because metabolites are the end products of the cellular regulatory processes, their levels can be regarded as the ultimate response of biological systems to genetic or environmental changes. Finally, this information can be used in conjunction with other systems biology approaches to assess gene function and provide a holistic view of a living system [109, 110]. Metabolomics, in contrast to ‘hypothesis-driven’ approaches for the study of plant stress responses, is a ‘data-driven’ approach that can generate new hypotheses in an unbiased manner. It has the potential to detect not only new stilbenes but also other related metabolites. To our knowledge, this type of approach has not yet been implemented to systematically search for stilbenes, but it has been successfully used to study other aspects of plant defence studies and in wine research.

2.3.1

Metabolomics of the Plant Stress Response

With the important developments in analytical methods and data mining that have occurred in recent years, metabolomics has rapidly evolved and provides a global picture of plant molecular organisation at the metabolite level. A very signiﬁcant increase in studies related to plant metabolomics has been recorded over the last

2

Stilbenes: Biomarkers of Grapevine Resistance to Disease…

37

decade [111]. While this approach has been used for various biological systems in conjunction with other omics approaches (e.g., genomics, transcriptomics and proteomics), metabolomics has recently become a key approach for studying plant responses to stress phenomena [112] and plant-host interactions [113]. However, this analytical approach is still very challenging because there is no single extraction or analysis technique that is suitable for all low molecular weight metabolites [114]. Among the different techniques enlisted for metabolomic analysis are mass spectrometry (MS) and nuclear magnetic resonance (NMR); different advantages and disadvantages are associated with each analytical system. Chromatographic metabolite separation combined with detection by MS (GC-MS or LC-MS) constitutes a powerful means of generating multivariate metabolic data. In all cases, however, further development is required to achieve a complete quantitative survey of all metabolites over a signiﬁcant dynamic range in a complex plant or fungal extract. Currently, two main complementary approaches are used for metabolomic investigations, metabolic proﬁling and metabolic ﬁngerprinting. For the latter, the intention is not to identify each observed metabolite, but to compare patterns or “ﬁngerprints” of metabolites that change in response to disease, toxin exposure, environmental changes or genetic alterations. On the other hand, metabolic proﬁling focuses on the analysis of a group of metabolites related to either a speciﬁc metabolic pathway or a class of compounds. When a putative biomarker cannot be directly matched in a database, a dedicated procedure (target analysis) can be performed for identiﬁcation. Furthermore, target analysis can be used when accurate quantiﬁcation is required. MS provides sensitive detection and the ability to identify metabolites based on MS or MS/MS spectra when libraries are available. MS can be used to proﬁle extracts directly or in conjunction with HPLC (LC-MS). Because the MS response is compound dependent, absolute quantiﬁcation in metabolic proﬁling studies is currently not feasible. NMR, on the other hand, is a non-destructive high throughput method that allows metabolite identiﬁcation and quantiﬁcation [115]. It is, however, signiﬁcantly less sensitive than MS [114]. NMR is considered more reproducible than MS, especially in long-term studies where samples collected and analysed over different time period have to be compared. For short-term studies or for studies in which all of the samples can be analysed simultaneously, MS-based metabolomics represents a good alternative. It has been used in numerous plant stress response studies where the biomarkers of interest require a high sensitivity of detection. Today, the most powerful studies combine the advantages of MS and NMR spectroscopy [116].

2.3.2

Mass Spectrometry in Stilbene and Wine Research

Mass spectrometry continues to play a very important role in research and quality control in the viticulture and oenology ﬁelds, and its analytical power is useful for structural studies on aroma, polyphenolic compounds, health beneﬁt, customer safety and other aspects of the winemaking process [117, 118]. LC-MS has been

38

K. Gindro et al.

used to analyse many stilbenes. For example, a sensitive high throughput LC-MS/ MS method for quantiﬁcation of trans- and cis-resveratrol in wine samples has been elaborated and was used for the analysis and comparison of the trans- and cis-resveratrol content of 20 different Romanian wine samples [119]. The detection limits for resveratrol by LC-MS were enhanced compared to LC-UV or LC-FD, even though this phytoalexin presents strong UV emission and ﬂuorescence levels [120]. A new type of ionisation method, atmospheric pressure photoionisation (APPI), has been found to be superior to other, more routinely used conventional approaches, namely electrospray (ESI) [106]. MS enables reductions in the process of sample preparation from extracts. For example, online-coupled LC-MS turbulent-ﬂow chromatography (TFC) makes it possible to directly analyse wine samples in order to determine their ﬂavonoid and resveratrol content. A sample (diluted wine) volume of 10 mL can be passed over a TFC column prior to LC-MS analysis [121]. Direct infusion MS, which requires no prior separation or sample preparation, has also been demonstrated to be a valuable method for rapidly obtaining ﬁngerprints of wine polyphenols in the differentiation of Beaujolais and Dornfelder selections and vintages by metabolomics [122]. Molecular weight information derived by MS, as well as fragmentation patterns obtained with by MS (MS/MS or MSn), can also supply important structural information for the identiﬁcation of stilbenes. A detailed study of downy mildew-infected grapevine leaves by LC-MS has revealed more than 20 stilbenes that can be differentiated based on their MS and MS/MS spectra [106].

2.3.3

Nuclear Magnetic Resonance in Stilbene and Wine Research

Many NMR-based metabolomics studies on grapevine have been reported; however, they have mainly been used for the classiﬁcation of wine products based on their polyphenolic composition. For example, NMR coupled with multivariate statistics has proved to be a suitable method for studying the effect of environmental vineyard conditions on the chemical composition of grapes and their wines [123] or for the differentiation of wines based on grape varieties [123]. A similar approach was used recently for studying the in vitro bioconversion of polyphenols from red wine and grape juice by human intestinal microbiota [124]. Recently, a NMR-based metabolomic studies related to stress responses in grapevines affected by the esca wood disease (a fungal community infection that leads to grapevine apoplexy) was published. In this work the metabolic changes in control versus diseased leaves were ﬁngerprinted using 1D and 2D NMR. Principal component analysis (PCA) of the NMR spectra showed a clear separation between the groups, indicating a difference in compound production due to the esca disease. The study revealed a signiﬁcant increase in phenolic compounds accompanied by a decrease in carbohydrates, suggesting that carbon and energy were rerouted from primary to secondary metabolism in the diseased leaves [125].

2

Stilbenes: Biomarkers of Grapevine Resistance to Disease…

39

NMR is also an invaluable tool for the de novo structure determination of stilbenes, and numerous papers have dealt with issues related to stilbene identiﬁcation [126]. Recently, for example, it has been shown that the establishment of stilbene conﬁguration, a challenging task, can be elegantly established based on 1H-NMR and the theoretical calculation of chemical shifts [127].

2.3.4

MS-Based Metabolomic Proﬁling of Stilbenes and Other Defence-Induced Compounds

In order to study variations in the metabolomes of wines and grapevines, AgroscopeACW, in collaboration with researchers at the University of Geneva, have developed a sensitive MS-based metabolomic approach for the detection of stress-induced biomarkers. The approach is based on the use of ultra high performance liquid chromatography coupled to time-of-ﬂight mass spectrometry (UHPLC-TOF-MS) for a two-step analysis of crude plant extracts [128]. Among the different techniques enlisted for metabolome analysis, UHPLCTOF-MS represents a powerful platform indeed [123]. UHPLC compared to HPLC affords increases sample throughput for fast ﬁngerprinting of biological matrices as well as important resolution enhancements (when used with long gradients) for detailed proﬁling and precise localisation of biomarkers [129]. On the other hand, time-of-ﬂight mass spectrometry (TOF-MS) provides sensitive detection of a large number of plant metabolites. Due to its high resolution and high mass accuracy capabilities, TOF-MS provides molecular formula information on all detected compounds for dereplication or preliminary identiﬁcation of the biomarker of interest [130]. Combination of these two methods gives very reproducible LC-MS datasets, a prerequisite for further data analysis of the high number of extract ﬁngerprints typically recorded in metabolomics [123]. The metabolomics strategy used is based on the following steps: (i) high throughput metabolite ﬁngerprinting involving rapid UPLC-TOF-MS gradients on numerous control and stressed samples for group discrimination and determination OFIONSMZ RESPONSIBLEFORTHEMAINDIFFERENCESAFTERADEQUATEDATATREATMENT and (ii) high resolution metabolite proﬁling of selected pool samples on high peak capacity UHPLC columns after efﬁcient gradient transfer for the localisation and deconvolution of the putative biomarkers. Biomarkers can then be identiﬁed by searching natural products in MS databases, comparison with standards (when available) or de novo structure identiﬁcation [128, 130]. In the last case, a generic approach for the rapid isolation of unknown biomarkers has been developed [128]. It consists of (i) targeted LC-MS-triggered microfractionation of the biomarkers of interest at the semi-preparative level, based on computed LC conditions from UHPLC gradients, and (ii) complete structural determination of the unknown biomarkers based on at-line capillary LC-NMR (CapNMR) experiments. This last method has been shown to provide key structural information on natural products (1D and 2D NMR) at the low-microgram scale [130, 131]. In relation to plant defence, this strategy has already been proven efﬁcient for the discovery of important new low-abundance

40

K. Gindro et al.

stress-induced phytohormones belonging to the jasmonate family and for the study of their induction dynamics from a holistic perspective [128]. In our laboratory, the same technology has been used for the study of stress biomarker induction in two wood-decaying fungi involved in esca disease (Eutypa lata and Botryosphaeria obtusa). Differential UHPLC-TOF-MS proﬁling from extracts of these fungi co-cultivated in Petri dishes was performed. Comparison of the high-resolution metabolite proﬁles showed a strong induction of many stressINDUCEDFUNGALMETABOLITESMYCOALEXINS INTHECONFRONTATIONZONESBETWEENTHE pure fungal strains. Microisolation and further CapNMR measurements enabled their de novo characterisation as O-methylmellein derivatives. The same microfractionation procedure also provided enough material to assay the fungitoxic and phytotoxic activities of the compounds that were induced as a result of the confrontation [123]. Our global sequential metabolomic approach [128] was recently applied to the study of stress-induced metabolites in the resistant grapevine cultivar selected in ACW (2091). To obtain preliminary results on the largest possible set of stressinduced compounds that can be produced in this variety, UV-C irradiation (Philips TUV 30 W, 92 PW cm−2, 253 nm, distance: 13 cm from leaves) was applied. This type of abiotic stress has been shown (in our earlier experiments) to elicit a large range of altered constituents that are characteristic of either natural abiotic or biotic stresses [79]. This study is illustrated in detail in Fig. 2.4. For a rapid estimation of the metabolome changes, 5 leaves of the resistant 2091 cultivar [Gamaret x Bronner] selected in ACW were used as controls, and 5 leaves were exposed to UV light for 10 min. Each fresh leaf sample (300 mg) was crushed in liquid nitrogen and extracted independently with methanol (3 mL) in an ultrasonic bath for 20 min. After a rapid SPE C18 enrichment procedure, the crude extracts (1 Pg) were directly analysed by UHPLC-TOF-MS in both positive and negative ion modes using a rapid gradient (5 min per analysis) and a short UHPLC column (1 × 50 mm). The results presented here are those derived from the negative ion LC-MS datasets, which were the most informative. In the ﬁngerprints obtained (Fig. 2.4a), all metabolites eluted in the ﬁrst MINOFELUTION4HEIONMAPSGENERATEDMZIONSRECORDEDASAFUNCTIONOFGRADIENT time) indicated induction of different ions after UV stress (indicated in dashed ring and square on Fig. 2.4a). These ion maps clearly demonstrate the power of mass spectrometry for such a rapid ﬁngerprinting procedure. As shown, if a complete resolution of the constituents of the extract cannot be obtained in 3 min of elution by UHPLC (see the short gradient total ion chromatogram insets in the ion maps in Fig. 2.4a), TOF-MS detection can provide good resolution in the second dimension for most of the metabolites present. This UHPLC-TOF-MS ﬁngerprinting enabled the analysis of numerous replicates in various time series in a high throughput and reproducible manner. For a good estimation of all observed variation in the metabolomes, the LC-MS datasets obtained were submitted to multivariate data analysis (MVDA). Because the combination of UHPLC separation and MS detection produces large sets of three-dimensional information (retention time × m/z × intensity), preprocessing of the data prior to MVDA was required. In a ﬁrst step, noise ﬁltering, peak detection and matching were concomitantly performed. The ﬁnal data table

2

Stilbenes: Biomarkers of Grapevine Resistance to Disease…

41

UHPLC-TOF-MS fingerprinting Control leaves

UV leaves 2D map

900

900

500

500

0

m/z

m/z

2D map

0 0.5

1.5

2.5

0.5

3.0 min

1.5

2.5

3.0 min

RT

RT

Data mining

PCA (score plot)

PCA (Loadings plot)

UV leaves

Control

Rank

m/z

Ret. time

PC1

1

227.07

1.55

0.239

2

507.05

1.60

0.225

3

489.13

1.71

0.217

4

368.09

2.07

0.205

UHPLC-TOF-MS profiling Control leaves

UV leaves

OH

Resveratrol ([M-H]- C14H11O3)

HO

Trace at 227.07

OH

Biomarker identification Accurate mass Identification Mass Calc. Mass PPM Formula 227.0714 227.0708 62. C14 H11 O3 227.0681 227.0668

14.5 20.3

C10 H7 N6 O C9 H11 N2 O5

Fig. 2.4 Summary of the all steps required for performing a comprehensive MS-based metabolomic study of the effect of UV stress induction on the leaves of a resistant 2091 cultivar. (a) Fingerprinting in the form of total ion chromatogram (TIC) and ion maps performed on a short (5 min) UHPLC gradient; (b) Principal component analysis (PCA) and loading plots of the PCA with ranking of the ions responsible for the metabolome differences (c) Proﬁling using high resolution UHPLC with a long (65 min) gradient (d "IOMARKERIDENTIlCATIONBASEDONTHEFORMULAEXTRACTEDFROMTHEMEASUREDMZ

42

K. Gindro et al.

included values for retention time and positive or negative m/z data pairs as labels. MVDA was used to produce interpretable projections of samples in a reduced dimensionality (score plots) (Fig. 2.4b) and highlight putative biomarkers responsible for the group separation (loading plots). In the example shown, principal components analysis (PCA), a common chemometric tool [130], was used. As a ﬁrst approach, PCA provided an unsupervised data reduction without using class information. Samples were compared to assess metabolite level modiﬁcations occurring after UV stress. As presented in Fig. 2.4b, controls were clearly distinguished from UV-irradiated leaves on the PCA scatter plot (PC1 vs. PC2). In this case, the differences are clear, but in cases where subtler metabolome modiﬁcations occur, other data treatments are needed. In such cases, supervised methods in which class information is given to the model or machine learning algorithms may be necessary [130]. To identify the biomarkers responsible for the differences between UV and control leaves, the loading plots from the PCA were displayed in the form of a list of signiﬁcantly induced ions. The ranking is based on the PC1 score, which explains about 50% of the total variance. The ions displayed at the top of this list are thus those responsible for the main metabolomic differences between the two groups differentiated in the PCA. Based on these results and after gradient transfer to a long UHPLC column, detailed proﬁling was performed on pooled samples from each group (Fig. 2.4c). Here, striking differences were noted. The use of the loading plot from the ﬁngerprinting results was used to localise and identify the biomarkers related to UV stress. As shown in the loading plot (Fig. 2.4), ion m/z 227.071 ([M-H]− ion in the NI mode), with an associated molecular formula of C14H11O3 (Fig. 2.4d), was the most signiﬁcant altered ion. Based on this information, it was easily identiﬁed as resveratrol. The extraction of its selective ion trace (m/z 227) in the high-resolution proﬁling chromatogram shows its localisation and conﬁrms its strong induction. The identiﬁcation of resveratrol is of course not new, but this result shows that an unsupervised metabolomic approach can conﬁrm results obtained by targeted approaches. The advantage of metabolomics is that, in addition to resveratrol, all other ions with a signiﬁcant PCA score are likely to be relevant to stress in this biological system. Thus, interesting biomarkers that are difﬁcult to detect using other methods have a good chance of being discovered using this approach. This last example demonstrates the potential of metabolomics for the discovery of new type of stilbenes or other phytoalexins produced in response to biotic or abiotic stresses.

2.4

Stilbenes in Wines Derived from Resistant Grape Varieties

Because of their antioxidant activities, levels of stilbenes, especially resveratrol, have been quantiﬁed in all type of wines produced worldwide. As mentioned previously, these quantiﬁcations can even be achieved by direct use of wine in HPLC [132].

2

Stilbenes: Biomarkers of Grapevine Resistance to Disease…

43

The levels of stilbenes are linked to various parameters, especially to oenological parameters such as the viniﬁcation process. According to the literature, the transresveratrol content in red wines does not exceed 7 mg/L [133]. We have undertaken analysis of a wide panel of 240 wines from more than 50 different grape varieties viniﬁed according to the same viniﬁcation process. Results have shown that cultivars selected according to their resistance towards Botrytis cinerea (such as Vitis vinifera cvs. Gamaret, Galotta or Mara) or Plasmopara viticola (such as IRAC 2091 [Gamaret x Bronner]), as well as traditional grape varieties (e.g., V. vinifera cvs. Rebo, Ancelotta and Cabernet mitos) contain more than 16, 14 and 11 mg/L of trans-resveratrol, respectively. However, these concentrations vary according to the region of production, but to a smaller extent.

2.4.1

Health and Stilbenes

Berry fruits are known to be a rich source of antioxidants [134]. Grapes in particular contain a wide variety of phenolic compounds including phenolic acids, tannins, ﬂavonoids and stilbenes. Among them, the health beneﬁts of resveratrol have been well known for centuries in Japanese and Chinese traditional medicine; the form of resveratrol isolated from roots of Polygonum cuspidatum [135] has been used in the treatment of cardiac and inﬂammatory diseases and lipid disorders. Indeed, there has been increased interest in this compound and its derivates since Siemann and Creasy [43] found them in wines, and this study was followed by the works of Renaud and de Lorgeril [44] as well as Frankel et al. [136], who found the lowest incidence of coronary heart diseases in people on a high-fat diet including moderate red wine consumption. This theory is known as the ‘French Paradox’ and correlates the efﬁciency of resveratrol and its effects as a cardiovascular protector. This strong interest in resveratrol has resulted in an increase in studies quantifying its expression in wine and grapes worldwide [42, 47–50]. Extensive epidemiological studies concerning the potential beneﬁts of natural antioxidants derived from fruits and vegetables to human health have been carried out [137–143] because of the societal burden of diseases emerging in developed countries (such as cardiovascular disease, cancer, rheumatoid arthritis, lung diseases, 0ARKINSONS !LZHEIMERSANDDIABETES DUETOLIFESTYLEANDDIETARYHABITS)NTHIS respect, grape-derived phenolic compounds have been shown to possess several health beneﬁts and play an important role in the inhibition of cardiovascular diseases, diabetes, neurodegenerative disease and ageing [144–146]. Initially, the reduced risk of cardiovascular disease was attributed to the wine’s ethanol content [147, 148], but the beneﬁts of wine appear to be greater than that of other alcoholic beverages [149–151]. Resveratrol levels in wine are especially dependent on the grape variety, climate, level of UV exposure, ripeness, harvest time and oenological practices [133, 146]. The cardioprotective effects of resveratrol are partly related to its antioxidant activity; resveratrol participates in the scavenging of reactive oxygen species (ROS)

44

K. Gindro et al.

and the attenuation of peroxyl radical and hydrogen peroxide formation [152, 153]. This antioxidant activity inhibits lipid peroxidation [136, 154, 155], vasoconstriction [156–159] and platelet aggregation [158, 160–162], thus delaying the onset and progression of the atherogenic process. Recently Wong et al. [163] showed that resveratrol increases ﬂow-mediated dilatation (FMD) of the branchial artery, a biomarker of endothelial function, and therefore improves blood pressure as well. Inﬂammation is also a signiﬁcant factor in all stages of atherosclerosis [164, 165], and resveratrol inhibits the activity of the cyclooxygenase-2 and the lypoxygenase pathways, which are involved in the synthesis of pro-inﬂammatory mediators [166, 167]. Rius [168] also demonstrated resveratrol’s ability to interfere with the synthesis of several inﬂammatory molecules. Moreover, it has been shown that resveratrol modulates glucose uptake, a very important process for diabetes and fat metabolism [169–172]. Resveratrol also seems to act as a putative cancer chemopreventive agent acting at various stages of carcinogenesis, known as initiation, promotion and progression [173]. Jang et al. [174=AND*ANGAND0EZZUTO [175, 176] found that resveratrol inhibits several cellular processes associated with each stage of carcinogenesis. Pterostilbene, which is also found in extracts of Pterocarpus marsupium [177–179], has many of the same characteristics as resveratrol [180, 181]. In fact, like resveratrol, it possesses antioxidant, anti-inﬂammatory, anti-diabetic and chemopreventive properties [180, 182–188], but it has a relatively higher bioavailability because it is not as quickly glucuronidated and sulphated as resveratrol [181, 187]. Resveratrol and stilbenes are not the only wine polyphenols suggested to be responsible for the beneﬁcial effects of moderate wine consumption. Anthocyanidins and tannins have also been reported to play an important role in the inhibition of malondialdehyde formation in the stomach [189] and in vasodilatation [190]. Nonetheless, despite all of the health beneﬁts attributed to the polyphenols present in grapes, a controversy exists concerning their absorption and clearance processes [191, 192]. Moreover, most of the studies mentioned were performed in vitro and in animal models. Thus, further studies are needed to establish the real effect of wine polyphenols in humans before positive health claims can be deﬁnitively shown to be true.

2.5

Conclusions

Since Langcake identiﬁed stilbenic phytoalexins in the Vitaceae family in 1976, other types of molecules, such as pathogenesis-related (PR) proteins, have been DESCRIBEDASENZYMESPRESENTONHOSTCELLWALLSTHATCANEFlCIENTLYDEGRADEFUNGI However, these proteins probably play a secondary role in resistance. Many years of pioneering research on grape stilbenes at Agroscope-ACW and other research institutes have demonstrated that some of these molecules, such as viniferins and pterostilbene, are at the centre of grapevine mechanisms of defence against fungal pathogens. Very good spatial correlations were found between the synthesis of these

2

Stilbenes: Biomarkers of Grapevine Resistance to Disease…

45

compounds and the sites of infection in grapevine leaves and berries. The higher their concentration is, the higher the level of pathogen resistance of cultivars issued from our breeding programmes. The method of screening new grape plantlets for their natural resistance, which uses artiﬁcial inoculation and micro-analysis of stilbenes, is a very efﬁcient tool for identifying and breeding grapevines that are resistant to fungal diseases. Experiments aiming to characterise new stilbenic phytoalexins or stilbenic constitutive compounds that may be implicated in grape host defences using MS-based metabolomics (UHPLC-TOF-MS) are underway. The hope is to better understand the induction and biochemical synthesis of grape stilbenes and also to improve the actual breeding tools, both of which will prove very useful for the selection of new grape varieties with disease resistance and good organoleptic properties. As this has been discussed, stilbenes and resveratrol play a key role in plant defence and are also of interest to human health. The ﬁne-tuning of stilbenic phytoalexins production by Vitaceae is necessary for the proper response to pathogen infection. A good understanding of the molecular mechanisms that regulate this response is important for improving the resistance of grapevine cultivars. With the knowledge acquired over the years, patterns of stilbenes production are on their way to becoming good diagnostic and predictive tools for both grapevine cultivar selection and defence priming optimisation. All of these scientiﬁc advances should provide ways to produce wine with optimal oenologic characteristics in a sustainable manner.

References 1. Hajdu Z, Varga E, Hohmann J, Kalman A, Argay G, Gunther G (1998) A stilbene from the ROOTSOF,EUZEACARTHAMOIDES*.AT0ROD n +AWAZOE+ 3HIMOGAI. 4AKAISHI9 2AO+3 )MAKURA9 &OURSTILBENESFROM3ALACIA lehmbachii. Phytochemistry 44(8):1569–1573 3. Nyemba AM, Mpondo TN, Kimbu SF, Connolly JD (1995) Stilbene glycosides from Guibourtia tessmannii. Phytochemistry 39(4):895–898 4. Abdel-Mogib M, Basaif SA, Sobahi TR (2001) Stilbenes and a new acetophenone derivative from Scirpus holoschoenus. Molecules 6(8):663–667 5. Adesanya SA, Ogundana SK, Roberts MF (1989) Dihydrostilbene phytoalexins from Dioscorea bulbifera and Dioscorea dumentorum. Phytochemistry 28(3):773–774 6. Bokel M, Diyasena MNC, Gunatilaka AAL, Kraus W, Sotheeswaran S (1988) Canaliculatol, an antifungal resveratrol trimer from Stemonoporous analiculatus. Phytochemistry 27(2): 377–380 7. Cuendet M, Potterat O, Salvi A, Testa B, Hostettmann K (2000) A stilbene and dihydrochalcones with radical scavenging activities from Loiseleuria procumbens. Phytochemistry 54(8):871–874 8. van der Kaaden JE, Hemscheidt TK, Mooberry SL (2001) Mappain, a new cytotoxic prenylated stilbene from Macaranga mappa. J Nat Prod 64(1):103–105 9. Ingham JL (1976) 3,5,4c-trihydroxystilbene as a phytoalexin from groundnuts (Arachis hypogaea). Phytochemistry 15(11):1791–1793 10. Iliya I, Ali Z, Tanaka T, Iinuma M, Furusawa M, Nakaya K, Murata J, Darnaedi D, Matsuura N, Ubukata M (2003) Stilbene derivatives from Gnetum gnemon Linn. Phytochemistry 62(4):601–606

46

K. Gindro et al.

11. Holscher D, Schneider B (1999) HPLC-NMR analysis of phenylphenalenones and a stilbene FROM!NIGOZANTHOSmAVIDUS0HYTOCHEMISTRY n 3ILAYO! .GADJUI"4 !BEGAZ"- (OMOISOmAVONOIDSANDSTILBENESFROMTHEBULBS of Scilla nervosa subsp rigidifolia. Phytochemistry 52(5):947–955 13. Keckeis K, Sarker SD, Dinan L (2000) Resveratrol-type oligostilbenes from Iris clarkei ANTAGONIZE HYDROXYECDYSONEACTIONINTHE$ROSOPHILAMELANOGASTER" ))CELLLINE#ELL Mol Life Sci 57(2):333–336 3HIMIZU + +ONDO 2 3AKAI + ! STILBENE DERIVATIVE FROM !RTOCARPUS INCISUS Phytochemistry 45(6):1297–1298 (OLSCHER$ 3CHNEIDER" !RESVERATROLDIMERFROM!NIGOZANTHOSPREISSIIAND-USA cavendish. Phytochemistry 43(2):471–473 16. Hathway DE, Seakins JWT (1959) Hydroxystilbenes of Eucalyptus wandoo. Biochem J 72:369–374 9AMAKI - (ONDA # 4HE STILBENOIDS FROM $ENDROBIUM PLICATILE 0HYTOCHEMISTRY 43(1):207–208 18. Sarker SD, Whiting P, Dinan L, Sik V, Rees HH (1999) Identiﬁcation and ecdysteroid antagonist activity of three resveratrol trimers (suffruticosols A, B and C) from Paeonia suffruticosa. Tetrahedron 55(2):513–524 19. Pan HF, Lundgren LN (1995) Phenolic extractives from root bark of Picea abies. Phytochemistry 39(6):1423–1428 20. Rupprich N, Hildebrand H, Kindl H (1980) Substrate-speciﬁcity in vivo and in vitro in the formation of stilbenes – biosynthesis of rhaponticin. Arch Biochem Biophys 200(1):72–78 'ONZALEZ,AREDO2& #HAIDEZ'ONZALEZ* !HMED!! +ARCHESY** !STILBENEXYLOSIDE from Holodiscus discolor bark. Phytochemistry 46(1):175–176 /NO- )TO9 +INJO* 9AHARA3 .OHARA4 .IIHO9 NEWGLYCOSIDESOFSTILBENE trimer from Foeniculi fructus (fruit of Foeniculum vulgare Miller). Chem Pharm Bull 43(5):868–871 23. Langcake P, Pryce RJ (1976) Production of resveratrol by Vitis vinifera and other members of Vitaceae as a response to infection or injury. Physiol Plant Pathol 9(1):77–86 24. Ngo KS, Brown GD (1998) Stilbenes, monoterpenes, diarylheptanoids, labdanes and chalcones from Alpinia katsumadai. Phytochemistry 47(6):1117–1123 25. Speicher A, Schoeneborn R (1997) 3,4-dihydroxy-3c-methoxystilbene, the ﬁrst monomeric stilbene derivative from bryophytes. Phytochemistry 45(8):1613–1615 26. Jayatilake GS, Baker BJ, McClintock JB (1995) Isolation and identiﬁcation of a stilbene derivative from the Antarctic sponge Kirkpatrickia variolosa. J Nat Prod 58(12):1958–1960 27. Takaoka M (1939) Resveratrol, a new phenolic compounds from Veratrum grandiﬂorum. Nippon Kagaku Kaishi 60:1090–1100 28. Rupprich N, Kindl H (1978) Stilbene synthases and stilbenecarboxylate synthases, ) %NZYMATIC SYNTHESIS OF c TRIHYDROXYSTILBENE FROM P COUMAROYL COENZYME ! AND MALONYLCOENZYME !(OPPE 3EYLERS:EITSCHRIFT&ÓR0HYSIOLOGISCHE#HEMIE n 29. Schoeppner A, Kindl H (1979) Stilbene synthase (pinosylvine synthase) and its induction by ultraviolet-light. FEBS Lett 108(2):349–352 &RITZEMEIER +( +INDL ( #OORDINATE INDUCTION BY 56 LIGHT OF STILBENE SYNTHASE phenylalanine ammonia-lyase and cinnamate 4-hydroxylase in leaves of Vitaceae. Planta 151(1):48–52 31. Jean-Denis JB (2005) Caractérisation de polyphénols stilbéniques et de dérivés induits ou constitutifs de la vigne impliqués dans sa défense contre l’agent pathogène du mildiou de la vigne, Plasmopara viticola (Berk. and Curt.). UNINE, Neuchâtel 32. Langcake P, Pryce R (1977) A new class of phytoalexins from grapevines. Cell Mol Life Sci 33(2):151–152 33. Langcake P, Cornford CA, Pryce RJ (1979) Identiﬁcation of pterostilbene as a phytoalexin from Vitis vinifera leaves. Phytochemistry 18(6):1025–1027

2

Stilbenes: Biomarkers of Grapevine Resistance to Disease…

47

34. Spath E, Schlager J (1940) Concerning the constituents of red sandal wood II Communication – the make up of pterostilbenes. Berichte Der Deutschen Chemischen Gesellschaft 73B:881–884 35. Pool RM, Creasy LL, Frackelton AS (1981) Resveratrol and the viniferins, their application to screening for disease resistance in grape breeding programs. Vitis 20(2):136–145 36. Dercks W, Creasy LL (1989) The signiﬁcance of stilbene phytoalexins in the Plasmopara viticola grapevine interaction. Physiol Mol Plant Pathol 34(3):189–202 0EZET2 0ONT6 )DENTIlCATIONOFPTEROSTILBENEINGRAPEBERRIESOF6ITISVINIFERA0LANT Physiol Biochem 26(5):603–607 38. Stein U, Blaich R (1985) Investigations on the production of stilbenes and susceptibility to Botrytis of Vitis spp. Vitis 24(2):75–87 39. Jeandet P, Sbaghi M, Bessis R (1992) The production of resveratrol (3,5,4c-trihydroxystilbene) by grapevine in vitro culture and its application to screening for grey mould resistance. J Wine Res 3(1):47–57 0EZET2 'INDRO+ 6IRET/ 2ICHTER( %FFECTSOFRESVERATROL VINIFERINSANDPTEROSTILBENE ON0LASMOPARAVITICOLAZOOSPOREMOBILITYANDDISEASEDEVELOPMENT6ITIS n 'INDRO+ 3PRING*, 0EZET2 2ICHTER( 6IRET/ (ISTOLOGICALANDBIOCHEMICALCRITERIA for objective and early selection of grapevine cultivars resistant to Plasmopara viticola. Vitis 45(4):191–196 0EZET 2 0ONT 6 #UENAT 0 -ETHOD TO DETERMINE RESVERATROL AND PTEROSTILBENE IN grape berries and wines using high-performance liquid-chromatography and highly sensitive ﬂuorometric detection. J Chromatogr A 673(2):303–303 43. Siemann EH, Creasy LL (1992) Concentration of the phytoalexin resveratrol in wine. Am J Enol Vitic 43(1):49–52 44. Renaud S, Delorgeril M (1992) Wine, alcohol, platelets, and the french paradox for coronary heart-disease. Lancet 339(8808):1523–1526 45. Frankel EN, Kanner J, German JB, Parks E, Kinsella JE (1993) Inhibition of oxidation of human low-density-lipoprotein by phenolic substances in red wine. Lancet 341(8843): 454–457 46. Aggarwal BB, Shishodia S (2006) Resveratrol in health and disease. CRC Press/Taylor & Francis Group, Boca Raton 47. Jeandet P, Bessis R, Maume BF, Sbaghi M (1993) Analysis of resveratrol in Burgundy wines. J Wine Res 4(2):79–85 48. Fregoni M, Bavaresco L, Petegolli D, Trevisan M, Ghebbioni C (1994) Indagine sul contenuto di resveratrolo in alcuni vini della Valle d’Aosta e dei Colli piacentini. Vignevini 21(6):33–36 'OLDBERG $- 9AN * .G % $IAMANDIS %0 +ARUMANCHIRI ! 3OLEAS ' 7ATERHOUSE !, (1995) A global survey of trans-resveratrol concentrations in commercial wines. Am J Enol Vitic 46(2):159–165 0EZET2 #UENAT0 2ESVERATROLINWINEEXTRACTIONFROMSKINDURINGFERMENTATIONAND post-fermentation standing of must from Gamay grapes. Am J Enol Vitic 47(3):287–290 0EZET 2 0ONT 6 5LTRASTRUCTURAL OBSERVATIONS OF PTEROSTILBENE FUNGITOXICITY IN dormant conidia of Botrytis-cinerea pers. J Phytopathol – Phytopathologische Zeitschrift 129(1):19–30 0ONT6 0EZET2 2ELATIONBETWEENTHECHEMICAL STRUCTUREANDTHEBIOLOGICAL ACTIVITYOF hydroxystilbenes against Botrytis cinerea. J Phytopathol – Phytopathologische Zeitschrift 130(1):1–8 0EZET2 0ERRET# *EAN $ENIS*" 4ABACCHI2 'INDRO+ 6IRET/ $ELTA VINIFERIN A RESVERATROL DEHYDRODIMER ONE OF THE MAJOR STILBENES SYNTHESIZED BY STRESSED GRAPEVINE leaves. J Agric Food Chem 51(18):5488–5492 0EZET2 'INDRO+ 6IRET/ 3PRING*, 'LYCOSYLATIONANDOXIDATIVEDIMERIZATIONOF resveratrol are respectively associated to sensitivity and resistance of grapevine cultivars to downy mildew. Physiol Mol Plant Pathol 65(6):297–303

48

K. Gindro et al.

3CHNEE3 &ACTEURSDER£SISTANCEÜLOÉDIUM%RYSIPHENECATOR3CHWEIN CHEZLAVIGNE (Vitis vinifera L.). UNINE, Neuchâtel 56. Viret O, Bloesch B, Taillens J, Siegfried W, Dupuis D (2001) Prévision et gestion des infections du mildiou de la vigne (Plasmopara viticola) à l’aide d’une station d’avertissement. Revue Suisse De Viticulture Arboric Hortic 33(2):1–12 57. Spring JL, Maigre D (1995) Comportement du nouveau cépage Gamaret sur trois sites expérimentaux. Revue Suisse De Viticulture Arboric Hortic 27(1):47–52 $UPRAZ 0 3PRING *, #£PAGES PRINCIPALES VARI£T£S DE VIGNE CULTIV£ES EN 3UISSE AMTRA, Nyon 0EZET2 0ONT6 (OANGVAN+ %VIDENCEFOROXIDATIVEDETOXICATIONOFPTEROSTILBENEAND resveratrol by a laccase-like stilbene oxidase produced by Botrytis cinerea. Physiol Mol Plant Pathol 39(6):441–450 60. Bateman DF, Basham HG (1976) Degradation of plant cell walls and membranes by microbial ENZYMES)N(EITEFUSS2 7ILLIAMS0(EDS %NCYCLOPEDIAOFPLANTPHYSIOLOGY PHYSIOLOGICAL PLANTPATHOLOGY VOL3PRINGER .EW9ORK PPn 61. Maigre D, Brugger JJ, Gugerli P, Pont M (2003) Sauvegarde, conservation et valorisation de la diversité génétique de la vigne en Valais (Suisse). Bulletin OIV 76:229–241 62. Steiner U, Schönbeck F (1998) Induced resistance. In: Hartleb H, Heitefuss R, Hoppe HH (eds.) Resistance of crop plants against fungi. Fischer, G, Stuttgart, pp 272–297 63. Gindro K, Godard S, de Groote I, Viret O (2007) Peut-on stimuler les mécanismes de défense de la vigne? Une nouvelle méthode pour évaluer le potentiel des éliciteurs. Revue Suisse De Viticulture Arboric Hortic 126(23):553–558 3PARVOLI& -ARTIN# 3CIENZA! 'AVAZZI' 4ONELLI# #LONINGANDMOLECULARANALYSIS of structural genes involved in ﬂavonoid and stilbene biosynthesis in grape (Vitis vinifera L.). Plant Mol Biol 24(5):743–755 2ICHTER( 0EZET2 6IRET/ 'INDRO+ #HARACTERIZATIONOFNEWPARTIALSTILBENESYNTHASE genes out of over 20 expressed in Vitis vinifera during the interaction with Plasmopara viticola. Physiol Mol Plant Pathol 67(3–5):248–260 66. Rosenﬁeld CL, Samuelian S, Vidal JR, Reisch BI (2010) Transgenic disease resistance in Vitis vinifera: potential use and screening of antimicrobial peptides. Am J Enol Vitic 61(3):348–357 67. Kikkert JR, Vidal JR, Wallace PG, Garcia-Zitter S, Wilcox WF, Gadoury DM, Seem RC, Burr TJ, Rosenﬁeld CL, Samuelian S, Reisch BI (2006) Disease resistance analyses of transgenic grapevines that contain endochitinase or antimicrobial peptide genes. In: Peterlunger E, Di Gaspero G, Cipriani G (eds.) IX international conference on grape genetics and breeding, Udine, Italy, 2006, ISHS Acta Horticulturae, pp 379–384 $OAZAN* 4HESELECTIONOFGRAPEVINEGENOTYPESRESISTANTTOFUNGUSDISEASESANDTHEIR use under ﬁeld conditions. In: 3rd international symposium on grape breed, University of California, Davis, pp 324–331 69. Zyprian E, Eibach R, Töpfer R (2003) Comparative molecular mapping in segregating populations of grapevine. In: Hajdu E, Borbas E (eds.) VIII international conference on grape genetics and breeding, Kecskemet, Hungary, ISHS Acta Horticulturae, pp 73–77 70. Merdinoglu D, Wiedeman-Merdinoglu S, Coste P, Dumas V, Haetty S, Butterlin G, Greif C (2003) Genetic analysis of downy mildew resistance derived from Muscadinia rotundifolia. In: Hajdu E, Borbas E (eds.) VIII international conference on grape genetics and breeding, Kecskemet, Hungary, ISHS Acta Horticulturae, pp 451–456 71. Eibach R, Zyprian E, Welter L, Topfer R (2007) The use of molecular markers for pyramiding resistance genes in grapevine breeding. Vitis 46(3):120–124 "LASI0 !NALYSEG£N£TIQUECOMPAR£EDELAR£SISTANCEÜ0LASMOPARAVITICOLACHEZLES espèces apparentées à la vigne. Université de Strasbourg, Strasbourg 73. Pauquet J, Bouquet A, This P, Adam-Blondon AF (2001) Establishment of a local map of AFLP markers around the powdery mildew resistance gene Run1 in grapevine and assessment of their usefulness for marker assisted selection. Theor Appl Genet 103(8):1201–1210

2

Stilbenes: Biomarkers of Grapevine Resistance to Disease…

49

74. Donald TM, Pellerone F, Adam-Blondon AF, Bouquet A, Thomas MR, Dry IB (2002) Identiﬁcation of resistance gene analogs linked to a powdery mildew resistance locus in grapevine. Theor Appl Genet 104(4):610–618 75. Delp CJ (1954) Effect of temperature and humidity on the grape powdery mildew fungus. Phytopathology 44(11):615–626 76. Dai GH, Andary C, Mondolotcosson L, Boubals D (1995) Histochemical-studies on the interaction between 3 species of grapevine, Vitis-vinifera, V. rupestris and V. rotundifolia and the downy mildew fungus, Plasmopara-viticola. Physiol Mol Plant Pathol 46(3):177–188 77. Liu SM, Sykes SR, Clingeleffer PR (2003) A method using leafed single-node cuttings to evaluate downy mildew resistance in grapevine. Vitis 42(4):173–180 78. Brown MV, Moore JN, Fenn P, McNew RW (1999) Comparison of leaf disk, greenhouse, and ﬁeld screening procedures for evaluation of grape seedlings for downy mildew resistance. Hortscience 34(2):331–333 'INDRO+ 0EZET2 6IRET/ (ISTOLOGICALSTUDYOFTHERESPONSESOFTWO6ITISVINIFERA cultivars (resistant and susceptible) to Plasmopara viticola infections. Plant Physiol Biochem 41(9):846–853 80. Langcake P (1981) Disease resistance of Vitis spp. and the production of the stress metabolites resveratrol, H-viniferin, D-viniferin and pterostilbene. Physiol Plant Pathol 18(2):213–226 81. Aist JR (1976) Papillae and related wound plugs of plant-cells. Annu Rev Phytopathol 14:145–163 82. Maor R, Shirasu K (2005) The arms race continues: battle strategies between plants and fungal pathogens. Curr Opin Microbiol 8(4):399–404 83. Kortekamp A, Wind R, Zyprian E (1997) The role of callose deposits during infection of two downy mildew-tolerant and two-susceptible Vitis cultivars. Vitis 36(2):103–104 84. Schnee S, Viret O, Gindro K (2008) Role of stilbenes in the resistance of grapevine to powdery mildew. Physiol Mol Plant Pathol 72(4–6):128–133 85. Regev-Shoshani G, Shoseyov O, Bilkis I, Kerem Z (2003) Glycosylation of resveratrol PROTECTSITFROMENZYMICOXIDATION"IOCHEM* n 86. Alonso-Villaverde V, Voinesco F, Viret O, Spring JL, Gindro K (2010) The effectiveness of stilbenes in resistant Vitaceae: ultrastructural and biochemical events during Plasmopara viticola infection process. Plant Physiol Biochem 49:265–274 87. Schnee S, Spring JL, Viret O, Dubuis PH, Godard S, Gindro K (2009) Outils pour la sélection précoce de cépages résistants à l’oïdium. Revue Suisse De Viticulture Arboric Hortic 41(2):87–93 "ELHADJ! 3AIGNE# 4ELEF. #LUZET3 "OUSCAUT* #ORIO #OSTET-& -ERILLON*- Methyl jasmonate induces defense responses in grapevine and triggers protection against Erysiphe necator. J Agric Food Chem 54(24):9119–9125 89. Chen WJ, Delmotte F, Richard-Cervera S, Douence L, Greif C, Corio-Costet MF (2007) At least two origins of fungicide resistance in grapevine downy mildew populations. Appl Environ Microbiol 73(16):5162–5172 90. Conrath U, Beckers GJM, Flors V, Garcia-Agustin P, Jakab G, Mauch F, Newman MA, 0IETERSE#-* 0OINSSOT" 0OZO-* 0UGIN! 3CHAFFRATH5 4ON* 7ENDEHENNE$ :IMMERLI, Mauch-Mani B (2006) Priming: getting ready for battle. Mol Plant Microbe Interact 19(10):1062–1071 91. Jones JDG, Dangl JL (2006) The plant immune system. Nature 444(7117):323–329 92. Angelova Z, Georgier S, Roos W (2006) Elicitation of plants. Biotechnol Biotechnol Equip 20(2):72–83 !ZIZ! 0OINSSOT" $AIRE8 !DRIAN- "EZIER! ,AMBERT" *OUBERT*- 0UGIN! Laminarin elicits defense responses in grapevine and induces protection against Botrytis cinerea and Plasmopara viticola. Mol Plant Microbe Interact 16(12):1118–1128 3LAUGHTER !2 (AMIDUZZAMAN -- 'INDRO + .EUHAUS *- -AUCH -ANI " Beta-aminobutyric acid-induced resistance in grapevine against downy mildew: involvement of pterostilbene. Eur J Plant Pathol 122(1):185–195

50

K. Gindro et al.

0OINSSOT " 6ANDELLE % "ENTEJAC - !DRIAN - ,EVIS # "RYGOO 9 'ARIN * 3ICILIA & Coutos-Thevenot P, Pugin A (2003) The endopolygalacturonase 1 from Botrytis cinerea ACTIVATESGRAPEVINEDEFENSEREACTIONSUNRELATEDTOITSENZYMATICACTIVITY-OL0LANT-ICROBE Interact 16(6):553–564 96. Bru R, Selles S, Casado-Vela J, Belchi-Navarro S, Pedreno MA (2006) Modiﬁed cyclodextrins are chemically deﬁned glucan inducers of defense responses in grapevine cell cultures. J Agric Food Chem 54(1):65–71 4ROUVELOT3 6ARNIER!, !LLEGRE- -ERCIER, "AILLIEUL& !RNOULD# 'IANINAZZI 0EARSON 6 +LARZYNSKI / *OUBERT *- 0UGIN ! $AIRE 8 ! BETA GLUCAN SULFATE INDUCES resistance in grapevine against Plasmopara viticola through priming of defense responses, including HR-like cell death. Mol Plant Microbe Interact 21(2):232–243 98. Repka V (2006) Early defence responses induced by two distinct elicitors derived from a Botrytis cinerea in grapevine leaves and cell suspensions. Biol Plant 50(1):94–106 &UNG27- 'ONZALO- &EKETE# +OVACS,' (E9 -ARSH% -C)NTYRE,- 3CHACHTMAN$0 Qiu WP (2008) Powdery mildew induces defense-oriented reprogramming of the transcriptome in a susceptible but not in a resistant grapevine. Plant Physiol 146(1):236–249 100. Copping LG, Duke SO (2007) Natural products that have been used commercially as crop protection agents. Pest Manag Sci 63(6):524–554 "AIDER! #OHEN9 3YNERGISTICINTERACTIONBETWEEN"!"!ANDMANCOZEBINCONTROLLING Phytophthora infestans in potato and tomato and Pseudoperonospora cubensis in cucumber. Phytoparasitica 31(4):399–409 102. Godard S, Slacanin I, Viret O, Gindro K (2009) Induction of defence mechanisms in grapevine leaves by emodin- and anthraquinone-rich plant extracts and their conferred resistance to downy mildew. Plant Physiol Biochem 47:827–837 6INAS0 #AMPILLO. (ERNANDEZ 0EREZ- (ERNANDEZ #ORDOBA- !COMPARISONOF solid-phase microextraction and stir bar sorptive extraction coupled to liquid chromatography for the rapid analysis of resveratrol isomers in wines, musts and fruit juices. Anal Chim Acta 611(1):119–125 104. Gocan S (2009) Analysis of stilbenes in wine by HPLC: recent approaches. J Liq Chromatogr Relat Technol 32(11–12):1598–1643 105. Poutaraud A, Latouche G, Martins S, Meyer S, Merdinoglu D, Cerovic ZG (2007) Fast and local assessment of stilbene content in grapevine leaf by in vivo ﬂuorometry. J Agric Food Chem 55(13):4913–4920 *EAN $ENIS*" 0EZET2 4ABACCHI2 2APIDANALYSISOFSTILBENESANDDERIVATIVESFROM downy mildew-infected grapevine leaves by liquid chromatography-atmospheric pressure photoionisation mass spectrometry. J Chromatogr A 1112(1–2):263–268 107. Lange BM, Ghassemian M (2005) Comprehensive post-genomic data analysis approaches integrating biochemical pathway maps. Phytochemistry 66(4):413–451 108. Fiehn O, Kopka J, Dörmann P, Altmann T, Trethewey RN (2000) Metabolite proﬁling for plant functional genomics. Nat Biotechnol 18(11):1157–1161 4OHGE4 .ISHIYAMA9 (IRAI-9 9ANO- .AKAJIMA* !WAZUHARA- )NOUE% 4AKAHASHI( 'OODENOWE$" +ITAYAMA- .OJI- 9AMAZAKI- 3AITO+ &UNCTIONALGENOMICSBY integrated analysis of metabolome and transcriptome of Arabidopsis plants over-expressing AN-9"TRANSCRIPTIONFACTOR0LANT* n 110. Rochfort S (2005) Metabolomics reviewed: a new “Omics” platform technology for systems biology and implications for natural products research. J Nat Prod 68(12):1813–1820 'UY # +OPKA * -ORITZ 4 0LANT METABOLOMICS COMING OF AGE 0HYSIOL 0LANT 132(2):113–116 112. Shulaev V, Cortes D, Miller G, Mittler R (2008) Metabolomics for plant stress response. Physiol Plant 132(2):199–208 113. Allwood JW, Ellis DI, Goodacre R (2008) Metabolomic technologies and their application to the study of plants and plant-host interactions. Physiol Plant 132(2):117–135 114. Dunn WB (2008) Current trends and future requirements for the mass spectrometric investigation of microbial, mammalian and plant metabolomes. Phys Biol 5(1):doi:011001

2

Stilbenes: Biomarkers of Grapevine Resistance to Disease…

51

115. Colquhoun IJ (2007) Use of NMR for metabolic proﬁling in plant systems. J Pestic Sci 32(3):200–212 116. Crockford DJ, Maher AD, Ahmadi KR, Barrett A, Plumb RS, Wilson ID, Nicholson JK ( .-2 AND 50,# -3% STATISTICAL HETEROSPECTROSCOPY CHARACTERIZATION OF DRUG metabolites (xenometabolome) in epidemiological studies. Anal Chem 80(18):6835–6844 117. Flamini R (2003) Mass spectrometry in grape and wine chemistry. Part I: polyphenols. Mass Spectrom Rev 22(4):218–250. doi:10.1002/mas.10052 118. Prosen H, Strlic M, Kocar D, Rusjan D (2007) In Vino Veritas: LC-MS in wine analysis. LC-GC Eur 20(12):617–621 119. Vlase L, Kiss B, Leucuta SE, Gocan S (2009) A rapid method for determination of resveratrol in wines by HPLC-MS. J Liq Chromatogr Relat Technol 32(14):2105–2121 120. Buiarelli F, Coccioli F, Jasionowska R, Merolle M, Terracciano A (2006) Chromatographic analysis of trans resveratrol in Italian wines: comparisons between FL, UV and MS detection. Chromatographia 64(7–8):475–481 121. Presta MA, Bruyneel B, Zanella R, Kool J, Krabbe JG, Lingeman H (2009) Determination of ﬂavonoids and resveratrol in wine by turbulent-ﬂow chromatography-LC-MS. Chromatographia 69(Suppl 2):167–173 &ULCRAND( -ANE# 0REYS3 -AZEROLLES' "OUCHUT# -AZAURIC* 0 3OUQUET* - -EUDEC % ,I9 #OLE2" #HEYNIER6 $IRECTMASSSPECTROMETRYAPPROACHESTOCHARACTERIZE polyphenol composition of complex samples. Phytochemistry 69(18):3131–3138 'LAUSER' 'INDRO+ &RINGELI* DE*OFFREY* 0 2UDAZ3 7OLFENDER* , $IFFERENTIAL ANALYSISOFMYCOALEXINSINCONFRONTATIONZONESOFGRAPEVINEFUNGALPATHOGENSBYULTRA HIGH pressure liquid chromatography/time-of-ﬂight mass spectrometry and capillary nuclear magnetic resonance. J Agric Food Chem 57(4):1127–1134 124. Gross G, Jacobs DM, Peters S, Possemiers S, van Duynhoven J, Vaughan EE, van de Wiele T (2010) In vitro bioconversion of polyphenols from black tea and red wine/grape juice by human intestinal microbiota displays strong interindividual variability. J Agric Food Chem 58(18):10236–10246 125. Lima MRM, Felgueiras ML, Graca G, Rodrigues JEA, Barros A, Gil AM, Dias ACP (2010) NMR metabolomics of esca disease-affected Vitis vinifera cv. Alvarinho leaves. J Exp Bot 61(14):4033–4042 +OH$ 0ARK+( *UNG* 9ANG( -OK+( ,IM9 #OMPLETEASSIGNMENTOFTHE( and C-13 NMR spectra of resveratrol derivatives. Magn Reson Chem 39(12):768–770 2OTTA2 .ETO!# DE,IMA$0 "EATRIZ! DA3ILVA'6* #ONlGURATIONOFSTILBENE derivatives by H-1 NMR and theoretical calculation of chemical shifts. J Mol Struct 975(1–3):59–62 'LAUSER ' 'RATA % $UBUGNON , 2UDAZ 3 &ARMER % 7OLFENDER *, 3PATIAL AND temporal dynamics of Jasmonate synthesis and accumulation in Arabidopsis in response to wounding. J Biol Chem 283(24):16400–16407 'UILLARME$ 3CHAPPLER* 2UDAZ3 6EUTHEY* , #OUPLINGULTRA HIGH PRESSURELIQUID chromatography with mass spectrometry. TrAC Trends Anal Chem 29(1):15–27 "OCCARD* +ALOUSIS! (ILARIO- ,ANT£RI0 (ANAl- -AZEROLLES' 7OLFENDER* , #ARRUPT 0 ! 2UDAZ3 3TANDARDMACHINELEARNINGALGORITHMSAPPLIEDTO50,# 4/&-3METAbolic ﬁngerprinting for the discovery of wound biomarkers in Arabidopsis thaliana. Chemom Intell Lab Syst 104(1):20–27 7OLFENDER *, 1UEIROZ %& (OSTETTMANN + 0HYTOCHEMISTRY IN THE MICROGRAM domain – a LC-NMR perspective. Magn Reson Chem 43(9):697–709 132. Adrian M, Jeandet P, Breuil AC, Levite D, Debord S, Bessis R (2000) Assay of resveratrol and derivative stilbenes in wines by direct injection high performance liquid chromatography. Am J Enol Vitic 51(1):37–41 133. Joshi VK, Devi MP (2009) Resveratrol: importance, role, contents in wine and factors inﬂuencing its production. Proc Indian Natl Sci Acad Part B Biol Sci 79:212–226 3ZAJDEK! "OROWSKA%* "IOACTIVECOMPOUNDSANDHEALTH PROMOTINGPROPERTIESOF berry fruits: a review. Plant Foods Hum Nutr 63(4):147–156

52

K. Gindro et al.

135. Nonomura S, Kanagawa H, Makimoto A (1963) Chemical constituents of Polygonaceous plants I. Studies on the components of Ko-jo-kon (Polygonum cuspidatum Sieb. et Zucc.). 9AKUGAKU:ASSHIn 136. Frankel EN, Waterhouse AL, Kinsella JE (1993) Inhibition of human LDL oxidation by resveratrol. Lancet 341(8852):1103–1104 137. Visioli F, Borsani L, Galli C (2000) Diet and prevention of coronary heart disease: the potential role of phytochemicals. Cardiovasc Res 47(3):419–425 138. La Vecchia C, Altieri A, Tavani A (2001) Vegetables, fruit, antioxidants and cancer: a review of Italian studies. Eur J Nutr 40(6):261–267 "AZZANO , 3ERDULA - ,IU 3 $IETARY INTAKE OF FRUITS AND VEGETABLES AND RISK OF cardiovascular disease. Curr Atheroscler Rep 5(6):492–499 9AO,( *IANG9- 3HI* 4OMAS "ARBERAN&! $ATTA. 3INGANUSONG2 #HEN33 Flavonoids in food and their health beneﬁts. Plant Foods Hum Nutr 59(3):113–122 141. Potter JD (2005) Vegetables, fruit, and cancer. Lancet 366(9485):527–530 3CALBERT! -ANACH# -ORAND# 2EMESY# *IMENEZ, $IETARYPOLYPHENOLSANDTHE prevention of diseases. Crit Rev Food Sci Nutr 45(4):287–306 "OROWSKA%* 3ZAJDEK! "OROWSKI* !NTIOXIDANTPROPERTIESOFFRUITS VEGETABLESAND their products. Fruit Process 15(1):38–43 ,EIFERT72 !BEYWARDENA-9 #ARDIOPROTECTIVEACTIONSOFGRAPEPOLYPHENOLS.UTR Res 28(11):729–737 0EZZUTO *- 'RAPES AND HUMAN HEALTH A PERSPECTIVE * !GRIC &OOD #HEM 6777–6784 !LI + -ALTESE & #HOI 9( 6ERPOORTE 2 -ETABOLIC CONSTITUENTS OF GRAPEVINE AND grape-derived products. Phytochem Rev 9(3):357–378 'AZIANO *- "URING *% "RESLOW *, 'OLDHABER 3: 2OSNER " 6ANDENBURGH - Willett W, Hennekens CH (1993) Moderate alcohol intake, increased levels of high-densitylipoprotein and its subfractions, and decreased risk of myocardial-infarction. N Engl J Med 329(25):1829–1834 148. Rimm EB, Klatsky A, Grobbee D, Stampfer MJ (1996) Review of moderate alcohol consumption and reduced risk of coronary heart disease: is the effect due to beer, wine, or spirits? Br Med J 312(7033):731–736 149. Tedesco I, Russo M, Russo P, Iacomino G, Russo GL, Carraturo A, Faruolo C, Moio L, Palumbo R (2000) Antioxidant effect of red wine polyphenols on red blood cells. J Nutr Biochem 11(2):114–119 &LESCH- 2OSENKRANZ3 %RDMANN% "OHM- !LCOHOLANDTHERISKOFMYOCARDIAL infarction. Basic Res Cardiol 96(2):128–135 151. Renaud SC, Gueguen R, Siest G, Salamon R (1999) Wine, beer, and mortality in middle-aged men from eastern France. Arch Intern Med 159(16):1865–1870 *ANG *( 3URH 9* 0ROTECTIVE EFFECTS OF RESVERATROL ON HYDROGEN PEROXIDE INDUCED apoptosis in rat pheochromocytoma (PC12) cells. Mutat Res Genet Toxicol Environ Mutagen 496(1–2):181–190 3HIGEMATSU3 )SHIDA3 (ARA- 4AKAHASHI. 9OSHIMATSU( 3AKATA4 +ORTHUIS2* Resveratrol, a red wine constituent polyphenol, prevents superoxide-dependent inﬂammatory responses induced by ischemia/reperfusion, platelet-activating factor, or oxidants. Free Radical Biol Med 34(7):810–817 154. Frei B (1995) Cardiovascular-disease and nutrient antioxidants – role of low-density-lipoprotein oxidation. Crit Rev Food Sci Nutr 35(1–2):83–98 &REMONT, "ELGUENDOUZ, $ELPAL3 !NTIOXIDANTACTIVITYOFRESVERATROLANDALCOHOL FREE wine polyphenols related to LDL oxidation and polyunsaturated fatty acids. Life Sci 64(26):2511–2521 156. Hattori R, Otani H, Maulik N, Das DK (2002) Pharmacological preconditioning with resveratrol: role of nitric oxide. Am J Physiol Heart Circ Physiol 282(6):H1988–H1995 157. Wallerath T, Deckert G, Ternes T, Anderson H, Li H, Witte K, Forstermann U (2002) Resveratrol, a polyphenolic phytoalexin present in red wine, enhances expression and activity of endothelial nitric oxide synthase. Circulation 106(13):1652–1658

2

Stilbenes: Biomarkers of Grapevine Resistance to Disease…

53

&AN%' :HANG,* *IANG3 "AI9( "ENElCIALEFFECTSOFRESVERATROLONATHEROSCLEROSIS J Med Food 11(4):610–614 159. Schmitt CA, Heiss EH, Dirsch VM (2010) Effect of resveratrol on endothelial cell function: molecular mechanisms. Biofactors 36(5):342–349. doi:10.1002/biof.109 160. Bertelli AAE, Giovannini L, DeCaterina R, Bernini W, Migliori M, Fregoni M, Bavaresco L, Bertelli A (1996) Antiplatelet activity of cis-resveratrol. Drugs Exp Clin Res 22(2):61–63 /LAS" 7ACHOWICZ" 3ZEWCZUK* 3ALUK *USZCZAK* +ACA7 4HEEFFECTOFRESveratrol on the platelet secretory process induced by endotoxin and thrombin. Microbios 105(410):7–13 7ANG:2 (UANG9: :OU*' #AO+* 8U9. 7U*- %FFECTSOFREDWINEANDWINE polyphenol resveratrol on platelet aggregation in vivo and in vitro. Int J Mol Med 9(1):77–79 7ONG2( (OWE02 "UCKLEY*$ #OATES!- +UNZ) "ERRY.- !CUTERESVERATROL supplementation improves ﬂow-mediated dilatation in overweight/Obese individuals with mildly elevated blood pressure. Nutr Metab Cardiovas Dis. doi:10.1016/j.numecd.2010.03.003 164. Libby P (2002) Inﬂammation in atherosclerosis. Nature 420(6917):868–874 165. Jawien J (2008) New insights into immunological aspects of atherosclerosis. Polskie Archiwum Medycyny WewnÖTRZNEJ0OL!RCH)NTER-ED n #UENDET - 0EZZUTO *- 4HE ROLE OF CYCLOOXYGENASE AND LIPOXYGENASE IN CANCER chemoprevention. Drug Metabol Drug Interact 17:109–157 167. Donnelly LE, Newton R, Kennedy GE, Fenwick PS, Leung RHF, Ito K, Russell REK, Barnes PJ (2004) Anti-inﬂammatory effects of resveratrol in lung epithelial cells: molecular mechanisms. Am J Physiol Lung Cell Mol Physiol 287(4):L774–L783 2IUS # !BU 4AHA - (ERMENEGILDO # 0IQUERAS , #ERDA .ICOLAS *- )SSEKUTZ !# %STAN , #ORTIJO* -ORCILLO%* /RALLO& 3ANZ-* 4RANS BUTNOTCIS RESVERATROL impairs angiotensin-II-mediated vascular inﬂammation through inhibition of NF-kappa B activation and peroxisome proliferator-activated receptor-gamma upregulation. J Immunol 185(6):3718–3727 169. Baur JA, Pearson KJ, Price NL, Jamieson HA, Lerin C, Kalra A, Prabhu VV, Allard JS, ,OPEZ ,LUCH' ,EWIS+ 0ISTELL0* 0OOSALA3 "ECKER+' "OSS/ 'WINN$ 7ANG-9 Ramaswamy S, Fishbein KW, Spencer RG, Lakatta EG, Le Couteur D, Shaw RJ, Navas P, Puigserver P, Ingram DK, de Cabo R, Sinclair DA (2006) Resveratrol improves health and survival of mice on a high-calorie diet. Nature 444(7117):337–342 ,AGOUGE - !RGMANN # 'ERHART (INES : -EZIANE ( ,ERIN # $AUSSIN & -ESSADEQ . Milne J, Lambert P, Elliott P, Geny B, Laakso M, Puigserver P, Auwerx J (2006) Resveratrol improves mitochondrial function and protects against metabolic disease by activating SIRT1 and PGC-1 alpha. Cell 127(6):1109–1122 171. Penumathsa SV, Maulik N (2009) Resveratrol: a promising agent in promoting cardioprotection against coronary heart disease. Can J Physiol Pharmacol 87(4):275–286 &ISCHER 0OSOVSZKY0 +UKULUS6 4EWS$ 5NTERKIRCHER4 $EBATIN+- &ULDA3 7ABITSCH- (2010) Resveratrol regulates human adipocyte number and function in a Sirt1-dependent manner. Am J Clin Nutr 92(1):5–15 173. Wattenberg LW (1993) Prevention – therapy – basic science and the resolution of the cancer problem – presidential-address. Cancer Res 53(24):5890–5896 174. Jang MS, Cai EN, Udeani GO, Slowing KV, Thomas CF, Beecher CWW, Fong HHS, &ARNSWORTH .2 +INGHORN !$ -EHTA 2' -OON 2# 0EZZUTO *- #ANCER chemopreventive activity of resveratrol, a natural product derived from grapes. Science 275(5297):218–220 *ANG -3 0EZZUTO *- 2ESVERATROL BLOCKS EICOSANOID PRODUCTION AND CHEMICALLY induced cellular transformation: implications for cancer chemoprevention. Pharm Biol 36(Suppl):28–34 *ANG- 0EZZUTO*- #ANCERCHEMOPREVENTIVEACTIVITYOFRESVERATROL$RUGS%XP#LIN Res 25(2–3):65–77 177. Manickam M, Ramanathan M, Jahromi MAF, Chansouria JPN, Ray AB (1997) Antihyperglycemic activity of phenolics from Pterocarpus marsupium. J Nat Prod 60(6):609–610

54

K. Gindro et al.

-AURYA 2 3INGH 2 $EEPAK - (ANDA 33 9ADAV 00 -ISHRA 0+ #ONSTITUENTS OF Pterocarpus marsupium: an ayurvedic crude drug. Phytochemistry 65(7):915–920 'ROVER*+ 6ATS6 9ADAV33 0TEROCARPUSMARSUPIUMEXTRACT6IJAYASAR PREVENTED the alteration in metabolic patterns induced in the normal rat by feeding an adequate diet containing fructose as sole carbohydrate. Diabetes Obesity Metab 7(4):414–420 2IMANDO !- #UENDET - $ESMARCHELIER # -EHTA 2' 0EZZUTO *- $UKE 3/ Cancer chemopreventive and antioxidant activities of pterostilbene, a naturally occurring analogue of resveratrol. J Agric Food Chem 50(12):3453–3457 2EMSBERG #- 9ANEZ *! /HGAMI 9 6EGA 6ILLA +2 2IMANDO !- $AVIES .- Pharmacometrics of pterostilbene: preclinical pharmacokinetics and metabolism, anticancer, antiinﬂammatory, antioxidant and analgesic activity. Phytother Res 22(2):169–179 3ATHEESH -! 0ARI , 4HE ANTIOXIDANT ROLE OF PTEROSTILBENE IN STREPTOZOTOCIN nicotinamide-induced type 2 diabetes mellitus in Wistar rats. J Pharm Pharmacol 58(11): 1483–1490 3ATHEESH-! 0ARI, %FFECTOFPTEROSTILBENEONLIPIDSANDLIPIDPROlLESINSTREPTOZOTOCIN nicotinamide induced type 2 diabetes mellitus. J Appl Biomed 6(1):31–37 184. Joseph JA, Fisher DR, Cheng V, Rimando AM, Shukitt-Hale B (2008) Cellular and behavioral effects of stilbene resveratrol analogues: implications for reducing the deleterious effects of aging. J Agric Food Chem 56(22):10544–10551 185. Perecko T, Jancinova V, Drabikova K, Nosal R, Harmatha J (2008) Structure-efﬁciency relationship in derivatives of stilbene: comparison of resveratrol, pinosylvin and pterostilbene. Neuroendocrinol Lett 29(5):802–805 0AN-( #HIOU93 #HEN7* 7ANG*- "ADMAEV6 (O#4 0TEROSTILBENEINHIBITED tumor invasion via suppressing multiple signal transduction pathways in human hepatocellular carcinoma cells. Carcinogenesis 30(7):1234–1242 ,IN(3 9UE"$ (O0# $ETERMINATIONOFPTEROSTILBENEINRATPLASMABYASIMPLE HPLC-UV method and its application in pre-clinical pharmacokinetic study. Biomed Chromatogr 23(12):1308–1315 188. Alosi JA, McDonald DE, Schneider JS, Privette AR, McFadden DW (2010) Pterostilbene INHIBITSBREASTCANCERINVITROTHROUGHMITOCHONDRIALDEPOLARIZATIONANDINDUCTIONOFCASPASE dependent apoptosis. J Surg Res 161(2):195–201 189. Gorelik S, Ligumsky M, Kohen R, Kanner J (2008) The stomach as a “Bioreactor”: when red meat meets red wine. J Agric Food Chem 56(13):5002–5007 #HALOPIN - 4ESSE ! -ARTINEZ -# 2OGNAN $ !RNAL *& !NDRIANTSITOHAINA 2 Estrogen receptor alpha as a key target of red wine polyphenols action on the endothelium. Plos One 5(1):e8554. doi:e8554 10.1371/journal.pone.0008554 191. Walle T, Hsieh F, DeLegge MH, Oatis JE, Walle UK (2004) High absorption but very low bioavailability of oral resveratrol in humans. Drug Metab Dispos 32(12):1377–1382 192. Boocock DJ, Faust GES, Patel KR, Schinas AM, Brown VA, Ducharme MP, Booth TD, Crowell JA, Perloff M, Gescher AJ, Steward WP, Brenner DE (2007) Phase I dose escalation pharmacokinetic study in healthy volunteers of resveratrol, a potential cancer chemopreventive agent. Cancer Epidemiol Biomarkers Prev 16(6):1246–1252

Chapter 3

Alternatives to Synthetic Fungicides Using Small Molecules of Natural Origin Christian Chervin

Abstract Several small molecules of natural origin have been shown to act as alternatives to synthetic fungicides for biological control of fungal diseases of grapes and other crops. The small molecule chemicals discussed here include: acetaldehyde, acetic acid, aldehydes (other than acetaldehyde), ascorbic acid, ethanol, ethylene, jasmonic acid and methyl jasmonate, salicylic acid and methyl salicylate, salts (e.g. sodium bicarbonate, calcium chloride, copper sulphate), sorbic acid and sulphur. The additive or synergistic effect of these molecules when used in combination is also discussed. Roles played by these molecules in biological control are reviewed in this chapter along with some new ideas about possible developments are given.

3.1

Introduction

There are many grape diseases, among which downy and powdery mildew and gray mold, causes important pre- and post-harvest losses. Most commercial grapevines are susceptible to such fungi. To counteract this disease development a wide panel of synthetic fungicides is in use nowadays. However, solutions to limit pre-harvest treatments with synthetic fungicides are of particular interest as chemical residues are limiting access to many markets, and there are a diminishing number of antifungal compounds that are still registered [1]. Moreover, some pathogen strains may develop resistance to some pesticides, thus alternative strategies are required. One of the most sustainable alternative strategies would be to develop grape cultivars that are naturally resistant to such fungi, and there are available genotypes for

C. Chervin (*) Food and Wine Science, Université de Toulouse, UMR Génomique et Biotechnologie des Fruits, INRA-INP/ENSAT, BP 32607, 31326 Castanet-Tolosan, France e-mail: [email protected]

J.M. Mérillon and K.G. Ramawat (eds.), Plant Defence: Biological Control, Progress in Biological Control 12, DOI 10.1007/978-94-007-1933-0_3, © Springer Science+Business Media B.V. 2012

55

56

C. Chervin

this trait [2]. But it is a long term development and most food industries using grapes are relying on speciﬁc cultivars, around which all marketing efforts have been made for decades. So ﬁnding alternative treatments with existing cultivars is still of interest for the grape industry. The purpose of this review is to list various compounds of natural origin that have been tested for antifungal and antibacterial activities, with or without success in the past. They are arranged in alphabetical order.

3.2

Acetaldehyde

As this compound has such a low boiling point (20°C), it is very volatile at ambient temperature, so most trials were performed for postharvest applications using it in the vapour phase [3]. As most aldehydes, it has a strong bactericidal and fungicidal potential, as aldehydes are very oxidative compounds (Fig. 3.1). One must attract attention to users that they are very toxic compounds to manipulators and quite oxidative to many parts of the equipment. Utama et al. [4] showed that aldehydes were more effective than alcohols in blocking fungus growth in vitro. They stated that acetaldehyde was quite effective against various fungi: Rhizopus stolonifer, Penicillium digitatum, Colletotrichum musae, Erwinia carotovora, and Pseudomonas aeruginosa, showing germicidal effects at concentrations below 1 mmol/dish, as the assays were run in Petri dishes; but they did not report trials in vivo. These germicidal concentrations corresponded approximately to 60 Pmol acetaldehyde/l of air, in the vapour phase, after 1 h of application, and they went down to 20 Pmol/l of air in 5 days at 25°C. When applied on ‘Sultanina’ and ‘Perlette’ grape berries with low sugar content and high acidity, the acetaldehyde was found to increase total soluble solids, decrease acidity, and enhance sensory preference [5], but these authors did not report effects on fungus. These observations were reported later by Avissar and Pesis [6] who showed that acetaldehyde was controlling the decay of table grapes in a postharvest trial. Acetaldehyde is probably present in most plant and fruit, but at very low concentration around a few nmoles.gFW−1[7], so whether it is effective or not at this natural concentration is not known. However, there was an interesting report by Miyake and Shibamoto [8] showing that acetaldehyde can be produced in aerobic and relatively mild conditions by oxidation of L-ascorbic acid. Thus, during the oxidative stress following a fungus infection, there may be some acetaldehyde produced, and it may be part of the natural defence; this has been shown in the case of resistance of potato plants to Phytophthora infestans [9].

Fig. 3.1 Acetaldehyde (MW: 44 g; BP: 20.2°C, 68°F)

3 Alternatives to Synthetic Fungicides Using Small Molecules of Natural Origin

57

Fig. 3.2 Acetic acid (MW: 60 g; BP: 118.1°C, 245°F)

3.3

Acetic Acid

The use of acetic acid fumigation for postharvest control of fungi has been reviewed by Tripathi and Dubey [10]. These authors referenced the fact that acetic acid is a natural metabolite occurring in several fruit, and that fumigation with acetic acid onto grapes has been proven an effective treatment to control gray mold (Fig. 3.2). In a recent work, Camili et al. [11] showed that acetic acid might stimulate natural defences in Italia grapes, as the best control of Botrytis was obtained when the fruit was treated with acetic acid vapours 48 h prior inoculation with Botrytis spores. To my knowledge, there are no or very scarce data about a potential control of grape disease by spraying acetic acid in vineyards, but the trials may be worth it. Interestingly, sprays of indole-acetic acid on tomato seedlings were shown to reduce the symptoms caused by a phytopathogen, Pythium ultimum [12]. The indole-acetic acid, one of the auxins, is obviously quite different to acetic acid, however no application has been tested onto grapevines to check if such an effect would be observed with grape speciﬁc pathogens. In a more comprehensive approach, Martin and Maris [13] tested the antifungal and antibacterial efﬁcacy of 17 organic and mineral acids against several strains of bacteria and fungi, known as food contaminants. They found interesting inhibitory effects by formic, mandelic and lactic acids.

3.4

Aldehydes (Other than Acetaldehyde)

The remarks regarding their toxicity, outlined in the acetaldehyde paragraph, are valid for the following compounds too. The cinnamaldehyde is part of the cinnamon aroma. It can be used as a food additive, and has anti-microbial properties at quite low concentration around 10 mM [14]. There is no report of exogenous treatment of cinnamaldehyde on grapes, but a recent report shows an additional potential of such treatments with this aldehyde or other compounds listed in this chapter. Viazis et al. [15] showed that cinnamaldehyde limit the viability of an enterohemorrhagic Escherichia coli strain on leafy vegetables, when sprayed at 0.5% (v/v). The hexanal and hexenal are two natural compounds, oxidation products of lipids. They have been shown to harbour anti-fungal properties against Botrytis sp., Alternaria sp., and Penicillium sp. among others [10, and references therein]. This has been conﬁrmed recently by Song et al. [16], as hexanal vapours gave a excellent control of Monilinia fructicola on peaches and a very good control of Botrytis cinerea on raspberries at doses around 900 Pl l−1.

58

C. Chervin

Fig. 3.3 Hexanal (MW: 100 g; BP: 120°C, 248°F)

Fig. 3.4 Ascorbic acid (MW: 176 g; solid at ambient temperature)

In planta, experiments have been published recently showing that Arabidopsis, over-producing C6 aldehydes (e.g. hexanal and hexenal) were more resistant to Botrytis infection, mainly through a direct effect of the aldehydes on the fungus growth rather than through an elicitor role that the aldehydes might have had [17]. This study also leads to think that the spraying of such aldehydes on grapevines may reduce the development of various fungi, however the cost and the hazard of manipulating such molecules have to be considered (Fig. 3.3). Utama et al. [4] tested in vitro the bactericidal and fungicidal properties of several aldehydes and benzaldehyde. Benzaldehyde was shown to be slightly more efﬁcient than acetaldehyde.

3.5

Ascorbic Acid

It is a natural compound which accumulates in many fruit, but in grapes it does not reach high levels as in citrus, as it is a precursor of tartaric and oxalic acids [18] (Fig. 3.4). It accumulates at low levels in berries, some Pmoles per gram of fresh weight [19]. Whether it shows some antifungal activity at this level, is unknown. Authors have observed antimicrobial effects of ascorbic acid at higher concentration such as 2.5% [20], but no test has been recorded on grapevines. However the role of ascorbic acid on phytopathogens is probably complex, indeed Barth et al. [21] have shown that Arabidopsis mutants deﬁcient in ascorbic acid are more resistant to bacteria and fungi, may be through an increase in salicylic acid accumulation, thus leading to activation of plant natural defences.

3.6

Ethanol

This compound is also naturally present in plant and fruit tissues, and can be found under normal aerobic conditions when the inside of the cells become too acidic or under hypoxic conditions [22, and refs therein] (Fig. 3.5).

3 Alternatives to Synthetic Fungicides Using Small Molecules of Natural Origin

59

Fig. 3.5 Ethanol (MW: 46 g; BP: 78°C, 172°F)

Our work regarding applications of ethanol has been initiated by reading an article by Beaulieu and Saltveit [23]. They observed that exogenous ethanol was stimulating ethylene production and tomato fruit ripening, so we tested it on grapes in order to modulate ripening and anthocyanin accumulation [24] and wine colour [25] using hand-held sprayers directed towards the bunches. Later we found that ethanol sprays with commercial sprayers increases mostly the berry diameter [26]. Subsequently, we tested ethanol for its efﬁcacy to limit fungus growth. The ﬁrst application was post-harvest, we will present pre-harvest applications later. The idea came from a paper by Lichter et al. [27] showing that dipping grapes at harvest in ethanol solutions was decreasing the Botrytis cinerea growth. The ethanol dip has two drawbacks. Firstly, there is a need to promptly dry the grapes after treatment to prevent berry cracking [28], and secondly, there is possibility of cross-contamination with fungus spores from a previously infected grape crate, when working with low ethanol concentrations. We adapted these ethanol treatments to commercial practices using ethanol in the vapour phase [29]. Indeed the industry is already using fumigation with SO2 in adapted chambers, or in crates with SO2 pads releasing the SO2 in contact with air humidity, so if ethanol was going to be efﬁcient and accepted by the industry, a simple change of the active ingredient was possible. The application of ethanol vapours was optimised over two seasons for ‘Chasselas’ table grapes. At a dose rate of 2 ml kg−1 of grapes, the ethanol vapour was as effective as sulphur dioxide pads to prevent rot development, caused by Botrytis cinerea, and stem browning. Further tests with consumer panels showed no signiﬁcant difference in sensory perception between controls and treated grapes. The application of evenly distributed ethanol vapours is critical, as higher concentrations of ethanol may enhance stem browning. Materials releasing ethanol are already on the market, such as the “ethanol powder” [30]. Post harvest applications of ethanol may also present potentials to reduce berry shatter [31] but these need further development. Then we tested pre-harvest applications of exogenous ethanol in the vineyard, to prevent fungus development ahead; the results that are detailed below have been reported recently [32]. The idea came from the reading of an article by Karabulut et al. [33]. These authors found that spraying 1 l per 5 vines of a solution at 50% ethanol, 24 h prior harvest, was effective in reducing the rots over the postharvest period. We then adapted this to commercial practices, reducing the amount of solution to 150 l/ha (using a mist blower) and no treatment in the last 2 weeks prior to harvest. The treatments were performed every 2 weeks from veraison, we tested a late harvest, scheduled 2 months and a half after veraison, was chosen for these

60

C. Chervin

trials, so the conditions were optimised for high Botrytis development. The fungus development was assessed at harvest and after 4–6 weeks cold storage. We always found a higher impact of the treatments after cold storage when Botrytis development had occurred at higher rates. In preliminary trials, we found that even very low concentration of ethanol i.e., 2% was reducing the Botrytis growth. It is not likely that ethanol would have had a direct effect on fungus growth at this low percentage. This can also be inferred by the studies of Lichter et al. [34]. They showed that at least 30% ethanol is necessary to prevent Botrytis cinerea spore germination. Thus, the 2% ethanol dose is more likely to induce plant defence. The optimal dose of ethanol to reduce Botrytis growth by pre-harvest spraying was found to be around 16%. However, to match the industry demand, we had to combine it with calcium chloride in order to further reduce the gray mold growth. This was done after reading an article by Nigro et al. [1] in which the authors reported the efﬁcacy of various salts to reduce the Botrytis development. This will be detailed in a paragraph below in this chapter. Thus, we reported that preharvest applications of a 16% ethanol solution, containing 1% CaCl2, reduced gray mold development. At harvest the losses due to rotten clusters dropped from 15% in controls to 5% in grapes treated with ethanol and CaCl2. Over 6 weeks of cold storage, the losses due to gray mold were reduced by 50% in bunches treated with ethanol and CaCl2, compared to untreated controls. These treatments did not induce signiﬁcant changes in fruit quality assessed by sensory analysis of healthy berries. The ethanol has a much higher boiling point than acetaldehyde and is not oxidative, therefore it is safe to use. Furthermore, it is already used by industry as a wetting agent or for its solvent properties. As it is ﬂammable, precautions are necessary. Ethanol is rather cheap to produce, and its worldwide production is increasing, mainly due to its use as ethanol fuel, so its cost will decrease.

3.7

Ethylene

It is a gas at ambient temperature and it plays important roles as phytohormone in most plants [35]. Lin et al. [35] review all aspects of ethylene metabolisms in plant biology, including production and perception (Fig. 3.6). Regarding the ethylene role in grape defence, there has been a series of recent papers by the team of Prof. J. M. Mérillon, University of Bordeaux 2, France showing that 2-chloroethylphosphonic acid, an ethylene precursor also called ethephon, led to a decrease of fungus growth when sprayed onto grapevines, through elicitation of natural defences [36]. More details are available in the Chap. 5 in this book. Additionally, a recent series of microarray analyses, using mRNAs extracted from berry tissues after exogenous application of ethylene on grape clusters, has been partly published by Chervin et al. [37]: the expression of some genes involved in plant defence was shown to be modulated by such a phytohormone.

3 Alternatives to Synthetic Fungicides Using Small Molecules of Natural Origin

61

Fig. 3.6 Ethylene (MW: 28 g; gas at ambient temperature)

Fig. 3.7 Methyl jasmonate (MW: 224 g; BP: 89°C, 192°F)

3.8

Jasmonic Acid and Methyl Jasmonate

Jasmonic acid is present naturally in grape berries, particularly in seeds [38] up to 50 pmol/seed, and methyl jasmonate is also present to a lesser extent (about ten times less) (Fig. 3.7). Data are lacking to check the variability over various cultivars. Methyl jasmonate has been shown to promote stilbene accumulation [39] and natural defenses of grape. There will be more details developed in the Chap. 5 in this book.

3.9

Salicylic Acid and Methyl Salicylate

The salicylic acid is well-known to be part of the SAR: Systemic Acquired Resistance [40]. Park et al. [41] showed that both conversions of salicylic acid to methyl salicylate and methyl salicylate to salicylic acid were essential for SAR in tobacco, and they concluded that methyl salicylate is a SAR signal in this plant (Fig. 3.8). However, there is still some controversy about the direct involvement of salicylic acid and methyl salicylate in SAR [40, 42].

62

C. Chervin

Fig. 3.8 Methyl salicylate (MW: 152 g; BP: 222°C, 432°F)

Nevertheless, there are a few papers reporting application of salicylic acid on grapes [43], showing that this compound can induce metabolisms known to be involved in plant defence mechanisms, but there are no reports with grapes, showing induced resistance. On strawberries, Babalar et al. [44] showed that pre-harvest sprays of salicylic acid had potential to limit fungal decay. The concentration that gave a rather good control was 2 mM, and several sprays were necessary like at the vegetative growth stage, then the fruit development stage and then at postharvest. This gives good ideas to set-up an experiment with grapes. Salicylic acid may also interest companies and growers as it seems to be available at low cost (Drs. Liliana Martinez, Mendoza, personal communication). In addition to controlling the fungal diseases, salicylic acid and its derivatives might have other potentials for grape growers. Indeed methyl salicylate was also used to “recruit” beneﬁcial insects in vineyards [45]. These authors showed that use of controlled-release methyl salicylate in a crop could increase recruitment and residency of populations of certain beneﬁcial insects. This strategy may have the potential to improve the efﬁcacy and reliability of biological control application in crop pest management. Lastly, salicylic acid was shown to delay ripening in particular conditions [46]. Thus the fruit quality is obviously a parameter to take into account in any experiment dealing with applications of such a compound, and all treatments described in this chapter.

3.10

Salts (e.g. Sodium Bicarbonate, Calcium Chloride, Copper Sulfate)

Salts are cheap, accepted by consumers, with minor environmental impact at the effective concentrations, which are non-toxic, and they are already used by the food industry. One of the most recent and most comprehensive studies about their use as antifungal agents in vineyards has been published by Nigro et al. [1]. These authors tested 19 different salts, from sodium phosphate dibasic, the most efﬁcient against Botrytis, to potassium carbonate the less efﬁcient in a small trail using artiﬁcially infested berries. Then they ran larger ﬁeld trials in ﬁeld, in which the most efﬁcient salts against bunch rots were calcium chloride, sodium bicarbonate and sodium carbonate at concentrations around 1% (w/v). The spray timing was variable, some treatments preformed 90 and 30 days prior harvest in the last trial, but also 20 and 5 days prior harvest in earlier trials. The salts were as efﬁcient as the classical chemical treatments in some ﬁeld trials.

3 Alternatives to Synthetic Fungicides Using Small Molecules of Natural Origin

63

Fig. 3.9 Sorbic acid (MW: 112 g; solid at ambient temperature)

Another well known salt used in viticulture is the copper sulfate pentahydrate, which has a blue color, and its natural form is called chalcanthite. It is one of most common antifungal when it is mixed with lime, particularly against downy mildew, and it is named Bordeaux mixture. It is one of the rare antifungal treatments, with sulphur, allowed in organic vineyards. However, its intensive use is known to ‘pollute’ soils and to render some cultures difﬁcult after several years of vine growing, as other crops are not so tolerant to high Copper concentrations in soils.

3.11

Sorbic Acid

It is a known food preservative, it can be associated with sodium or potassium, among others (Fig. 3.9). Karabulut et al. [47] showed that potassium sorbate when applied on ‘Thompson Seedless’ grapes after harvest, at concentrations around 1%, reduced the incidence of gray mold over storage. No data was found regarding pre-harvest sprays of sorbate salts to control various fungal or bacterial diseases on grapes, but there is some potential.

3.12

Sulphur

Sulphur remains a very efﬁcient and simple alternative to synthetic fungicides against powdery mildew and a recent report conﬁrmed this fact [48]. They compared the efﬁcacy of several compounds, such as milk, whey, canola oils and potassium bicarbonate to sulphur, and the later was most often the best blocker of powdery mildew. Whey showed some potential, however, in ﬁeld trials the acceptable yield (i.e. bunches with less than 5% powdery mildew infections) was lower than when treated with sulphur. The whey compounds are mainly lactose and lactoglobulin. Why these compounds or the whey pH might have an inhibitory effect on the fungus is not discussed in the article.

3.13

Combinations

These are always interesting as they can generate additive or synergistic effects. One example has been detailed above when combining ethanol with calcium chloride during ﬁeld sprays gave a better control of gray mold at harvest, and after

64

C. Chervin

storage [32]. Elsewhere such effect was seen with ethanol and potassium sorbate [47]. Belhadj et al. [49] have tested with success the combination of methyl jasmonate and sucrose to induce accumulation of polyphenolics in grape cell cultures. Many combinations have been tested on different fruit, giving ideas for grape future treatments. For example, Spadaro et al. [50] have tested with some success combinations of hot water, backing soda and ethanol against Penicillium expansum and Botrytis cinerea over apple storage, but the potential may be extended to grapes and ﬁeld trials. Wang et al. [51] showed that the combined treatment with methyl jasmonate and ethanol resulted in a greater control of green mold due to Penicillium citrinum and also improved antioxidant capacities of bayberries. These authors reported a clear synergistic effect of the combination of methyl jasmonate and ethanol leading to approximately 10% decay in bayberries when each treatment led to 40% decay and the controls showing 80% decay. Interestingly, the combined treatments led to a better sensory appreciation of the fruit by a sensory panel than for all other treatment. There is an inﬁnite number of combinations, (i) as the number of potential individual treatments is great, (ii) as the combination order may vary (e.g. treatment A before treatment B, or B before A), and (iii) as the number of repeated applications over the pre- and post-harvest periods (e.g. one treatment every week over the ripening period or one treatment every fortnight). Combinatorial optimisation has an obvious interest in such approaches.

References 1. Nigro F, Schena L, Ligorio A, Pentimone I, Ippolito A, Salerno MG (2006) Control of table grape storage rots by pre-harvest applications of salts. Postharvest Biol Technol 42:142–149 2. Dry IB, Feechan A, Anderson C, Jermakow AM, Bouquet A, Adam-Blondon A-F, Thomas MR (2010) Molecular strategies to enhance the genetic resistance of grapevines to powdery mildew. Aust J Grape Wine Res 16:94–105 3. Pesis E (2005) The role of the anaerobic metabolites, acetaldehyde and ethanol, in fruit ripening, enhancement of fruit quality and fruit deterioration. Postharvest Biol Technol 37:1–19 4. Utama IMS, Wills RBH, Ben-Ye-Hoshua S, Kuek C (2002) In vitro efﬁcacy of plant volatiles for inhibiting the growth of fruit and vegetable decay microorganisms. J Agric Food Chem 50:6371–6377 5. Pesis E, Frenkel C (1989) Effects of acetaldehyde vapors on postharvest quality of table grapes. Hortic Sci 24:315–317 6. Avissar I, Pesis E (1991) The control of postharvest decay in table grapes using acetaldehyde vapours. Ann Appl Biol 118:229–237 7. Chervin C, Truett JK, Speirs J (1999) Alcohol dehydrogenase expression and alcohol production during pear ripening. J Am Soc Hort Sci 124:71–75 8. Miyake T, Shibamoto T (1995) Formation of acetaldehyde from L-ascorbic acid and related compounds in various oxidation systems. J Agric Food Chem 43:1669–1672 9. Tadege M, Bucher M, Stahli W, Suter M, Dupuis I, Kuhlemeier C (1998) Activation of plant defense responses and sugar efﬂux by expression of pyruvate decarboxylase in potato leaves. Plant J 16:661–671 10. Tripathi P, Dubey NK (2004) Exploitation of natural products as an alternative strategy to control postharvest fungal rotting of fruit and vegetables. Postharvest Biol Technol 32:235–245

3 Alternatives to Synthetic Fungicides Using Small Molecules of Natural Origin

65

11. Camili EC, Benato EA, Pascholati SF, Cia P (2010) Fumigation of ‘Italia’ grape with acetic acid for postharvest control of Botrytis cinerea. Rev Bras Frutic 32:436–443 12. Gravel V, Antoun H, Tweddell RJ (2007) Effect of indole-acetic acid (IAA) on the development of symptoms caused by Pythium ultimum on tomato plants. Eur J Plant Pathol 119:457–462 13. Martin H, Maris P (2004) An assessment of the bactericidal and fungicidal efﬁcacy of seventeen mineral and organic acids on bacterial and fungal food industry contaminants. Sci Alim 25:105–127 14. Smid EJ, Hendriks L, Boerrigter HAM, Gorris LGM (1996) Surface disinfection of tomatoes using the natural plant compound trans-cinnamaldehyde. Postharvest Biol Technol 9:343–350 15. Viazis S, Akhtar M, Feirtag J, Diez-Gonzalez F (2011) Reduction of Escherichia coli O157:H7 viability on leafy green vegetables by treatment with a bacteriophage mixture and transcinnamaldehyde. Food Microbiol 28:149–157 16. Song J, Hildebrand PD, Fan LH, Forney CF, Renderos WE, Campbell-Palmer L, Doucette C (2007) Effect of hexanal vapor on the growth of postharvest pathogens and fruit decay. J Food Sci 72:M108–M112 17. Kishimoto K, Matsui K, Ozawa R, Takabayashi J (2008) Direct fungicidal activities of C6-aldehydes are important constituents for defense responses in Arabidopsis against Botrytis cinerea. Phytochemistry 69:2127–2132 18. DeBolt S, Hardie J, Tyerman S, Ford CM (2004) Composition and synthesis of raphide crystals and druse crystals in berries of Vitis vinifera L. cv. Cabernet Sauvignon: ascorbic acid as precursor for both oxalic and tartaric acids as revealed by radiolabelling studies. Aust J Grape Wine Res 10:134–142 19. Cruz-Rus E, Botella MA, Valpuesta V, Gomez-Jimenez MC (2010) Analysis of genes involved in L-ascorbic acid biosynthesis during growth and ripening of grape berries. J Plant Physiol 167:739–748 20. Van der Wolf JM, Birnbaum Y, Van der Zouwen PS, Groot SPC (2008) Disinfection of vegetable seed by treatment with essential oils, organic acids and plant extracts. Seed Sci Technol 36:76–88 21. Barth C, Moeder W, Klessig DF, Conklin PL (2004) The timing of senescence and response to pathogens is altered in the ascorbate-deﬁcient Arabidopsis mutant vitamin C-1. Plant Physiol 134:1784–1792 22. Sweetman C, Deluc LG, Cramer GR, Ford CM, Soole KL (2009) Regulation of malate metabolism in grape berry and other developing fruits. Phytochemistry 70:1329–1344 23. Beaulieu JC, Saltveit ME (1997) Inhibition or promotion of tomato fruit ripening by acetaldehyde and ethanol is concentration dependent and varies with initial fruit maturity. J Am Soc Hort Sci 122:392–398 24. El Kereamy A, Chervin C, Souquet JM, Moutounet M, Monje MC, Nepveu F, Mondies H, Ford CM, van Heeswijck R, Roustan JP (2002) Ethanol triggers grape gene expression leading to anthocyanin accumulation during berry ripening. Plant Sci 163:449–454 25. Chervin C, Elkereamy A, Roustan JP, Faragher JD, Latche A, Pech JC, Bouzayen M (2001) An ethanol spray at veraison enhances colour in red wines. Aust J Grape Wine Res 7:144–145 26. Chervin C, Savocchia S, Krstic M, Serrano E, van Heeswijck R (2005) Enhancement of grape berry weight induced by an ethanol spray four weeks before harvest and effects of a night spray at an earlier date. Aust J Exp Agric 45:731–734 27. Lichter A, Zutkhy Y, Sonego L, Dvir O, Kaplunov T, Sarig P, Ben-Arie R (2002) Ethanol controls postharvest decay of table grapes. Postharvest Biol Technol 24:301–308 28. Karabulut OA, Gabler FM, Mansour M, Smilanick JL (2004) Postharvest ethanol and hot water treatments of table grapes to control gray mold. Postharvest Biol Technol 34:169–177 29. Chervin C, Westercamp P, Monteils G (2005) Ethanol vapours limit Botrytis development over the postharvest life of table grapes. Postharvest Biol Technol 36:319–322 30. Suzuki Y, Uji T, Terai H (2004) Inhibition of senescence in broccoli ﬂorets with ethanol vapor from alcohol powder. Postharvest Biol Technol 31:177–182

66

C. Chervin

31. Chervin C, Bouzambou N, Latche A, Pech JC (2005) Potential for ethanol vapours to limit table grape berry shatter and to limit ethylene evolution from clusters. Acta Hortic 682:513–518 32. Chervin C, Lavigne D, Westercamp P (2009) Reduction of gray mold development in table grapes by preharvest sprays with ethanol and calcium chloride. Postharvest Biol Technol 54:115–117 33. Karabulut OA, Smilanick JL, Mlikota Gabler F, Mansour M, Droby S (2003) Near harvest applications of Metschnikowia fructicola, ethanol, and sodium bicarbonate to control postharvest diseases of grape in central California. Plant Dis 87:1384–1389 34. Lichter A, Zhou HW, Vaknin M, Dvir O, Zutchi Y, Kaplunov T, Lurie S (2003) Survival and responses of Botrytis cinerea after exposure to ethanol and heat. J Phytopathol 151:553–563 35. Lin ZF, Zhong SL, Grierson D (2009) Recent advances in ethylene research. J Exp Bot 60:3311–3336 36. Belhadj A, Telef N, Cluzet S, Bouscaut J, Corio-Costet MF, Merillon JM (2008) Ethephon elicits protection against Erysiphe necator in grapevine. J Agric Food Chem 56:5781–5787 37. Chervin C, Tira-umphon A, Terrier N, Zouine M, Severac D, Roustan JP (2008) Stimulation of the grape berry expansion by ethylene and effects on related gene transcripts, over the ripening phase. Physiol Plant 134:534–546 38. Kondo S, Fukuda K (2001) Changes of jasmonates in grape berries and their possible roles in fruit development. Sci Hortic 91:275–288 39. Krisa S, Larronde F, BudzinskiH DA, Defﬁeux G, Merillon JM (1999) Stilbene production by Vitis vinifera cell suspension cultures: methyl jasmonate induction and 13C biolabeling. J Nat Prod 62:1688–1690 40. Durrant WE, Dong X (2004) Systemic acquired resistance. Ann Rev Phytopathol 42:185–209 41. Park SW, Kaimoyo E, Kumar D, Mosher S, Klessig DF (2007) Methyl salicylate is a critical mobile signal for plant systemic acquired resistance. Science 318(5847):113–116 42. Attarana E, Zeierb TE, Griebela T, Zeier J (2009) Methyl salicylate production and jasmonate signaling are not essential for systemic acquired resistance in Arabidopsis. Plant Cell 21:954–971 43. Wen PF, Chen JY, Kong WF, Pan QH, Wan SB, Huang WD (2005) Salicylic acid induced the expression of phenylalanine ammonia-lyase gene in grape berry. Plant Sci 169:928–934 44. Babalar M, Asghari M, Talaei A, Khosroshahi A (2007) Effect of pre- and postharvest salicylic acid treatment on ethylene production, fungal decay and overall quality of Selva strawberry fruit. Postharvest Biol Technol 105:449–453 45. James DG, Price TS (2004) Field-testing of methyl salicylate for recruitment and retention of beneﬁcial insects in grapes and hops. J Chem Ecol 30:1613–1628 46. Kraeva E, Andary C, Carbonneau A, Deloire A (1998) Salicylic acid treatment of grape berries retards ripening. Vitis 37:143–144 47. Karabulut OA, Romanazzi G, Smilanick JL, Lichter A (2005) Postharvest ethanol and potassium sorbate treatments of table grapes to control gray mold. Postharvest Biol Technol 37:129–134 48. Crisp P, Wicks TJ, Lorimer M, Scott ES (2006) Novel controls for powdery mildew – greenhouse studies. Aust J Grape Wine Res 12:192–211 49. Belhadj A, Telef N, Saigne C, Cluzet S, Barrieu F, Hamdi S, Merillon JM (2008) Effect of methyl jasmonate in combination with carbohydrates on gene expression of PR proteins, stilbene and anthocyanin accumulation in grapevine cell cultures. Plant Physiol Biochem 46:493–499 50. Spadaro D, Garibaldi A, Gullino ML (2004) Control of Penicillium expansum and Botrytis cinerea on apple combining a biocontrol agent with hot water dipping and acibenzolar-Smethyl, baking soda, or ethanol application. Postharvest Biol Technol 33:141–151 51. Wang KT, Jin P, Shang HT, Zheng YH (2010) Effect of methyl jasmonate in combination with ethanol treatment on postharvest decay and antioxidant capacity in Chinese bayberries. J Agric Food Chem 58:9597–9604

Chapter 4

Fungi as Biological Control Agents of Plant-Parasitic Nematodes Mohammad Reza Moosavi and Rasoul Zare

Abstract Environmental and health concerns over the use of chemical pesticides have increased the need for alternative measures in the control of plant-parasitic nematodes. Biological control is considered ecologically friendly and a possible alternative in pest and disease management. Several organisms are known to be antagonistic against plant parasitic nematodes. Fungal biological control is an exciting and rapidly developing research area and there is growing attention in the exploitation of fungi for the control of nematodes. In this chapter important nematode parasitic and antagonistic fungi are divided into nematophagous and endophytic fungi, and their taxonomy, distribution, ecology, biology and their mode of action are discussed.

4.1

Introduction

In recent decades, concerns about the environmental hazards of using chemical nematicides and limited alternative crops for rotation have led to the development of biological control agents as a component of crop protection. Biological control is now a key strategy used for controlling pests worldwide. Eilenberg et al. [1] deﬁned biological control (or biocontrol) as follows: “The use of living organisms to suppress the population density or impact of a speciﬁc pest organism, making it less abundant or less damaging than it would otherwise be”. M.R. Moosavi (*) Department of Plant Pathology, Marvdasht Branch, Islamic Azad University, P.O. Box 465, Marvdasht, Fars, Iran e-mail: [email protected] R. Zare Department of Botany, Iranian Research Institute of Plant Protection, P.O. Box 1454-19395, Tehran, Iran e-mail: [email protected]

J.M. Mérillon and K.G. Ramawat (eds.), Plant Defence: Biological Control, Progress in Biological Control 12, DOI 10.1007/978-94-007-1933-0_4, © Springer Science+Business Media B.V. 2012

67

68

M.R. Moosavi and R. Zare

Four basic strategies can be used in biological control (i) Introduction: which is considered as a classical technique whereby an exotic helpful organism is introduced into a new region and become fully established. This strategy is usually used against introduced pests that have no indigenous antagonists. (ii) Augmentation: in this method laboratory-bred individuals can be released to compensate the inefﬁciency of present microbial agents. The inadequate level of control can be driven by low number of native natural enemies. (iii) Inoculation: when an indigenous antagonist is not present or an introduced one cannot survive permanently, an inoculative release is made at the beginning of planting season. This process may need to be repeated for each following crop. (iv) Inundation: in this technique the mass culture of a pathogen is carried out for urgent use at critical periods when rapid suppression of pest population is necessary [2]. Biological control agents have an important effect in the regulation of plantparasitic nematode populations, and numerous organisms including fungi, bacteria, viruses, nematodes and other invertebrates have antagonistic activity against plant parasitic nematodes [3]. Various aspects of biological control of nematodes using microbial control agents have been already reviewed [3–11]. The developmental process of progressing biological agents include the isolation and identification of microbial agents associated with plant parasitic nematodes especially in suppressive soils (a soil that completely suppresses nematode reproduction); examination of their potential ability in controlling nematodes; changing the soil environment in favor of antagonistic agents; understanding the mechanisms of parasitism and pathogenicity; and development of commercial product. Investigating nematode-suppressing soil demonstrated that their controlling activity is due to egg-parasitizing fungi, generalized fungal antagonists, mutualistic fungal endophytes, rhizobacteria and obligate parasitic bacteria [12]. Comprehending the mechanisms of suppressiveness can be useful in plant-parasitic nematode control by helping in manipulating these mechanisms. Lots of natural enemies attack nematodes and decrease their populations, but the number of organism which could be employed for biocontrol is restricted. In other words many soil types all around the world show biological control activity but their effect on nematodes can range from insigniﬁcant to complete suppression. In this section the biological control of plant parasitic nematodes by fungal agents will be emphasized according to recent research progresses. Fungal biological control is an exciting and rapidly developing research area and there is growing attention in the exploitation of fungi for the control of nematodes. The relationship between nematodes and fungi that infect them has been the subject of widespread mycological studies. Our information about fungal biological control agents has originally been based on the voluminous and detailed work by Charles Drechsler [284–287]. Different aspects of fungal biological control of nematodes have been reviewed by Jaffee [13], Siddiqui and Mahmood [14], Kerry [15], Kerry and Hominick [2], López-Llorca et al. [16]. Hallmann et al. [17] classiﬁed these fungi into three large groups: nematophagous fungi, saprophagous fungi, and endophytic fungi; however we do not follow this classiﬁcation here. We consider all nematode parasitic and antagonistic fungi as: (i) nematophagous fungi and (ii) endophytic fungi, and their taxonomy and mode of action are brieﬂy shown in Table 4.1.

Basidiomycota

Toxin-producing

a

See text for possible mode of action

Endophytic fungi

Oomycota Ascomycota

Basidiomycota

Oomycota Chytridiomycota Blastocladiomycota Ascomycota

Egg- and female-parasitic

Endoparasitic

Acremonium spp. Nonpathogenic F. oxysporum Neotyphodium spp.

Pochonia Paecilomyces Lecanicillium

Harposporium Drechmeria Haptocillium Hirsutella Nematoctonus

? ? ? Glomus spp.

Pleurotus Coprinus

Nematophthora Metaordyceps Cordyceps Cordyceps

Myzocytiopsis Haptoglossa Catenaria Podocrella ? Cordyceps? ? Hohenbuehelia

Table 4.1 Taxonomy of some nematode parasitic and antagonistic fungi and their infection mechanism Fungal group Phyllum Anamorph Teleomorph Nematophagous fungi Nematode-trapping Zygomycota Stylopage Cystopage Ascomycota Arthrobotrys Orbilia Dactylellina Orbilia Drechslerella Orbilia Gamsylella Orbilia Basidiomycota Nematoctonus Hohenbuehlia

Unknowna Unknowna Unknowna Unknowna

Toxic droplets Toxin, “spiny structures”

Zoospores Appressoria Appressoria Appressoria

Zoospores “Gun cells”, injection Zoospores Ingested conidia Adhesive conidia Adhesive conidia Adhesive conidia Adhesive spores

Adhesive hyphae Adhesive hyphae Adhesive networks Adhesive knobs and/or nonconstricting rings Constricting rings Adhesive branches or unstalked knobs Adhesive “hour-glass” knobs

Infection structures

4 Fungi as Biological Control Agents of Plant-Parasitic Nematodes 69

70

4.2

M.R. Moosavi and R. Zare

Nematophagous Fungi

“Nematophagous fungi” refer to a diverse group of fungi which colonize and parasitize nematodes for exploitation of nutritious substances. Some of them are obligate parasites of nematodes, but the majority is facultative saprophytes [16]. They are usually regarded as soil inhabitant [18], however, they can be found in aquatic environment [19]. The zygomycetous fungi are completely reliant to water ﬁlm that encircles soil particles for ﬁnding the nematode host by their swimming zoospores. Nematophagous fungi were ﬁrst described in the late 1800s and afterward many scientists have contributed to illuminate various aspects of this fascinating group of fungi [16]. Nematophagous fungi are found in most fungal taxa like Ascomycetes (anamorphic Orbiliaceae and Clavicipitaceae), Basidiomycetes (Pleurotaceae), Zygomycetes (Zoopagales), Chytridiomycetes and Oomycetes [20]. It is suggested that the nematophagous habit evolved from lignolytic and cellulolytic fungi in different fungal taxonomic groups, as an adaptation to conquer competition for nutritious substances in soil [21]. The ecology of nematophagous fungi has been extensively reviewed [22–26]. Soil and various organic substrata, especially dung [27, 28], are appropriate sources for these fungi. Nematophagous fungi usually prefer organic soils; however, they can reproduce in nearly all types of soil because of their few nutritional and vitamin requirements [24]. The ability of nematophagous fungi in rhizosphere occupation is very critical for inﬂuencing on their biological control capability. Many nutrients leak from plant roots into rhizosphere as “root exudates” that greatly inﬂuence the rhizosphere ecosystem. Microbial components of rhizosphere could modify these nutrients and cause root and plant a better growth, or could uptake them and increase their population. Here the nematophagous fungi, like other micro-organism, could be affected and could be effective. They can parasitize their nematode host, while also can be parasitized by other myceliophagous species [16]. Combining the existing non-destructive techniques to analyze dynamic of biotic component of the rhizosphere is tempting. Adjustment, manipulation or genetical engineering of the rhizosphere resource exchange could be very important for modifying the behavior of nematophagous fungi, which in turn inﬂuence their capability to control root diseases [16]. The majority of nematophagous fungi are facultative parasites, while some of them are obligate parasites of nematodes [17]. The facultative parasites can infect nematodes through producing structures which trap migratory stages of nematodes, producing specialized adhesive spores, or by means of developing appressoria on specialized hyphae that can penetrate through the nematode cuticle or eggshell. Obligate parasites can initiate infection using their spores. The spores may ingest, germinate in nematode’s digestive system and breach through its wall, or may adhere to the nematode cuticle and penetrate directly [22]. Many biotic and abiotic factors make introduction of nematophagous fungi to soil problematic [16].

4 Fungi as Biological Control Agents of Plant-Parasitic Nematodes

71

A new molecular technique is devised for investigating rhizosphere. In this method a series of genetically engineered bacteria are used whose reporter genes (like GFP and Lux) are jointed with promoters that are induced by some rhizosphere conditions (like starvation, contaminants, quorum sensing). These bacteria are called “bioreporter bacteria” and studying the engineered biocontrol bacteria make a high augmentation in our rhizosphere knowledge [29]. Nematophagous fungi are divided into four groups according to their mode of action against nematodes: (i) nematode-trapping (= predacious or predatory fungi), (ii) endoparasitic, (iii) egg- and female-parasitic and (iv) toxin-producing fungi [30]. It is demonstrated that nematophagous fungi can produce extracelullar enzymes that may be important in their parasitism. Some of these enzymes are characterized (Table 4.2).

4.2.1

Nematode-Trapping Fungi

4.2.1.1

Introduction

As the name of this group implies, they are soil-borne fungi that entrap moving stages of nematodes using trapping structures of various shapes and sizes. These fungi are not host speciﬁc and could trap all soil-dwelling nematodes. Different fungal species produce one or more types of different trapping devices. These structures can vary from simple fungal hyphae covered with sticky secretions (Stylopage spp.) to much more complex structures. They can be adhesive branches, simple loops, two-dimensional, or three-dimensional networks. Adhesive three-dimensional nets, the most common type of fungal traps, are constructed when the loops create a three-dimensional conﬁguration (e.g. Arthrobotrys oligospora, A. superba, Dactylella pseudoclavata). Other groups of trapping fungi produce adhesive spores (Meristacrum spp.) or adhesive knobs (A. haptotyla, Nematoctonus spp.). Lateral branches of vegetative hyphae create non-constricting rings which entrap the entering nematodes by wedging around their body. Constricting rings (Arthrobotrys dactyloides, Monacrosporium doedycoides) are the most specialized trap, which has three cells that swell quickly and hold the entering nematode tightly [3, 11, 16, 49]. Trapping structures may differ even within a genus, for example Nematoctonus robustus produce adhesive knobs exclusively on hyphae, N. leptosporus exclusively on germinated conidia, and N. angustatus on both hyphae and conidia [50]. Some disadvantages like complexity in the establishment in the soil, their limited capturing activity and above all non-speciﬁc trap of plant-parasitic nematodes reduce their potential in biological control. Some Arthrobotrys species have been formulated and applied under speciﬁc conditions, but the results were inconsistent [11]. It was proved that trapping fungi also have the ability of secretion antimicrobial and nematicidal compounds like linoleic acid (A. oligospora, A. conoides) or pleurotin (N. robustus, N. concurrens). The production of linoleic acid was positively correlated with the number of traps formed [51].

Table 4.2 Extracellular enzymes isolated and characterized from different nematophagous fungi (Modiﬁed from [16]) Enzymic group Fungal group Enzyme name Origins Serine proteases Nematode-trapping fungi PII A. oligospora Aoz1 A. oligospora Mlx Arthrobotrys microscaphoides Ds1 Arthrobotrys shizishanna spr1 Monacrosporium megalosporum Endoparasitic fungi Hasp Hirsutella rhossiliensis Egg-parasitic fungi P32 P. rubescens VCP1 P. chlamydosporia PL P. lilacinus Ver112 Lecanicillium psalliotae Serine carboxypeptidase SCP1 P. chlamydosporia Chitinases/chitosanases Egg-parasitic fungi CHI43 P. rubescens CHI43 P. chlamydosporia pcchi44 P. chlamydosporia – P. lilacinus

References [31] [32] [33] [34] [35] [36] [37–39] [40, 41] [42] [43, 44] [45] [46] [46] [47] [48]

72 M.R. Moosavi and R. Zare

4 Fungi as Biological Control Agents of Plant-Parasitic Nematodes

4.2.1.2

73

Taxonomy

The teleomorphs of most nematode-trapping species are located within Orbilia, and their type of trapping apparatus arranged their taxonomic position [52]. These fungi were also classiﬁed according to their genetic data as follows: Arthrobotrys (adhesive three-dimensional networks), Dactylellina (stalked adhesive knobs and/or non-constricting rings), Drechslerella (constricting rings) and Gamsylella (adhesive branches and unstalked knobs) [53].

4.2.1.3

Ecology

Our knowledge about growth and development of trapping fungi in soil, particularly the factors which cause the switch from a saprotrophic to a parasitic phase, is not sufﬁcient [11]. The number of nematode-trapping species present in a speciﬁc soil and their population densities can considerably be different. The highest densities are usually found in fall and in the upper 30 cm of soil [54]. A total of 54 nematophagous fungi were isolated and recognized from Scotland. The nematode-trapping fungi included 16 species while endoparasites included 15 species. Arthrobotrys gephyropaga and Drechslerella brochopaga among nematode-trapping and Harposporium anguillulae among endoparasites had the highest incidence [55], but in Irish sheep pastures 29 nematophagous fungi were isolated of which 12 were nematode-trapping and 17 were endoparasitic. In Ireland Cystopage lateralis, Stylopage hadra, Drechmeria coniospora and Meristacrum asterosperum had the highest incidence [56]. The following species were reported from Kenya: Arthrobotrys dactyloides, A. oligospora, A. superba, Acrostalagamus obovatus, Dactyllela lobata, Harposporium aungulilae, H. liltiputanum, Haptoglosa heterospora, Monacrosporium asterospernum, M. cianopagum, Myzocytium spp., Nematoctonus georgenious and N. leptosporus [57]. Recently two new species of Dactylellina were isolated and described in china. These new nematode-trapping fungi were D. sichuanensis and D. varietas which entraped nematodes by both adhesive knobs and non-constricting rings [58]. Application of chopped organic amendment [24] and glucose [59] to soil could increase the activity of nematode-trapping species which was perhaps the consequent of increase in the number of free-living and microbivorous nematodes. Probably organic amendments stimulated population densities, however, similar population densities of trapping fungi were found in plots with and without organic amendments [60, 61]. The effect of abscisic acid (ABA) and nitric oxide (NO) on the nematodetrapping fungus Drechslerella stenobrocha AS6.1 were tested and demonstrated that the trap development and nematode-trapping capability of D. stenobrocha were increased by ABA but decreased by NO [62]. It is apparent that the trapping fungi need a carbohydrate source for their proliferation but other factors, like those which cause fungistasis are also important in their abundance and trophic state in soil [11]. It is hypothesized that Orbilia species, the teleomorph of Arthrobotrys species, that are weak wood decomposers [63],

74

M.R. Moosavi and R. Zare

support the fungi with carbon and energy sources, while nematode cadavers act as an important supply of nitrogen [21]. It is illustrated that predaceous behavior of A. oligospora can be controlled either by physiologically active compounds (amino-acids or vitamins) present in nematodes or by nitrogen sources [64, 65]. The majority of nematode-trapping fungi colonizes the bulk soil and waits until the passing nematodes contact them. Some fungi increase their trapping chance by producing secondary attractive compounds for nematodes, like A. superba which attract J2 of Meloidogyne species [17]. Others grow in rhizosphere, which give them superior predatory activity to trap plant-parasitic nematodes on their way toward the roots. For example, A. oligospora found more abundance in rhizosphere of tomato and barley plants because of its chemotropical attraction to the root tips [66]. Plant species obviously inﬂuence on rhizosphere and external root colonization. The highest incidence and diversity of nematode-trapping fungi is seen in association with pea rhizosphere [290]. Tomato roots are successfully colonized by Dactylellina ellipsospora and D. dactyloides in a pot experiment [68]. Various fungi have different efﬁcacy in trapping and parasitizing nematodes. It is shown that A. dactyloides is more efﬁcient in trapping Meloidogyne graminicola than Dactylella brochopaga and Monacrosporium eudermatum [17]. Some nematode-trapping fungi are good antagonists but trap few nematodes, while others are efﬁcient in capturing nematodes but do not establish well in soil. This subject limits the potential of this group as microbial control agents [17]. 4.2.1.4

Mode of Action

Attraction of the host is the ﬁrst step in infection of nematode, which includes nematode host chemotaxis towards fungal hyphae or traps [69, 70]. It is not clear that what compounds are involved in chemotaxis [66, 71]. Formation of different trapping structures can be stimulated by environmental, chemical and tactile stimuli [16]. Many studies showed that the presence of nematodes or some speciﬁc organic compounds (like amino acids and peptides) could trigger the formation of trapping structures [17]. It is also demonstrated that the presence of competitor organisms and the level of nutritious substances are important in changing the trophic state from saprotrophic into parasitic [67, 72]. Nematophagous fungi adhesives commonly include proteins and/or carbohydrates [73, 74]. A nematode recognition role is suggested for a Gal-NAc-speciﬁc lectin of A. oligospora [75]. Carbohydrates that cover the surface of nematodes play an important role in both recognition phase of lectin binding and nematode chemotaxis [76, 77]. When a nematode touches A. oligospora traps, the amorphous sticky materials on the surface of the traps change to a ﬁbrillar appearance [78]. Nematode infection triggers a signaling cascade in fungi resulting in penetration and colonization of the nematode [79]. We know a little about the signaling cascades. During trap formation, expression of the genes that are involved in construction of the trapping devices of Dactylellina haptotyla accompanied with those involved in fungal morphogenesis, was recently demonstrated [80]. The same results were reported for an entomopathogenic fungus, M. anisopliae [81].

4 Fungi as Biological Control Agents of Plant-Parasitic Nematodes

75

Fig. 4.1 A nematode is entrapped by two constricting rings of Arthrobotrys dactyloides (arrowheads). I Inﬂated ring, U non-inﬂated ring, H hyphae [82]

The trapping devices are usually constructed on mycelium, while they may also be formed directly on germinating conidia [67] with variation among different taxa. For example, A. dactyloides has a greater ability for conidial trap production than A. superba and A. oligospora. Fungistasis and competition for nutritious substances can cause conidia to form traps directly, and live as parasites [17]. Sudden inﬂation of three cells which form the constricting ring after being touched by a nematode, result in capturing the prey (Fig. 4.1). The mechanism by which the inﬂation of the cells starts and ring closure happens in less than 0.1 s is not clear. Mild heat, pressure and Ca2+ can also stimulate the swelling of the cells in vitro [83]. The signaling pathways that took place in ring closure were examined and a model is suggested. According to that ﬁnding the nematode entrance exerts a pressure on the ring followed by activation of G-proteins. Consequently, cytoplasmic contents of Ca2+ increases in ring cells, calmodulin activates and at last the water channels open. Quick entrance of water via those channels make the cells inﬂate and entrap the prey. Calmodulin could regulate a key step in the signal transduction pathways after being activated by an increase in Ca2+, because the ring closure was inhibited by calmodulin antagonists [82]. The nematode cuticle mostly consists of proteins, hence proteolytic enzymes (Table 4.2) may be important for penetration. A. oligospora produce a serine protease, named PII, which has been characterized, cloned and sequenced. This enzyme belongs to the subtilisin family and its expression is enhanced by the presence of proteins, especially those of nematode cuticle [84]. Aoz1, a PII homologue, is another serine protease secreted by A. oligospora [32]. Other nematode-trapping fungi can also produce serine proteases. Arthrobotrys

76

M.R. Moosavi and R. Zare

microscaphoides produces Mlx [33] and Arthrobortys shizishanna secretes Ds1 [34] both with a high homology to the A. oligospora serine proteases [33, 34]. A putative serine protease gene (spr1) was cloned and characterized from Monacrosporium megalosporum, whose predicted protein sequence was similar to PII and Azo1 from Arthrobotrys oligospora. The fungus has a single copy of this gene [35]. Similar enzymes have also been puriﬁed and characterized from the egg-parasitic fungi Paecilomyces lilacinus [42], Pochonia chlamydosporia [40], and Lecanicillium psalliotae [44].

4.2.2

Endoparasitic Fungi

4.2.2.1

Introduction

Most of these fungi are obligate parasites and poor saprotrophic competitors in soil, but usually have a broad nematode host range. These obligate parasites live their whole vegetative life cycle inside their infected hosts [11, 16]. Endoparasitic fungi infect vermiform plant-parasitic nematodes using their spores (conidia or zoospores). The spores can be ingested by the nematode which germinate in the intestines (mostly the esophagus or mastax), or adhere ﬁrmly on the nematode cuticle when the nematode passes the fungus. The spore contents are inserted into the nematode by means of a narrow penetration tube, apparently with some mechanical pressure [18, 85]. Then an internal mycelium produces, and ﬁnally penetrates the cadaver to sporulate on its surface [20]. Some endosparasitic fungi produce zoospores that swim toward the nematode, attach to the cuticle usually around the natural oriﬁces, and then encyst. The encysted zoospores penetrate the host body via those natural openings and start their vegetative growth. Afterward the hyphae develop some sporangium containing zoospores [11].

4.2.2.2

Taxonomy

We know a little about the actual taxonomy and phylogeny of this group of fungi. They are found in Blastocladiomycota (zoosporic Catenaria anguillulae), Haptocillium (formerly Verticillium), Harposporium (teleomorph: Podocrella) or Drechmeria [16]. In recent higher order classiﬁcations, posteriorly uniﬂagellate fungi (or chytrids) have been placed into three phyla: Blastocladiomycota, Chytridiomycota and Neocallimastigomycota. In this classiﬁcation Catenaria spp. were transferred to Blastocladiomycota instead of previously accommodation under Chytridiomycota [86–90, 289]. The teleomorph of Nematoctonus (basidiomycetous Hohenbuehelia) contains both nematode-capturing and endoparasitic fungi [91]. Drechmeria was segregated from Meria [92] and its similarity with the Clavicipitaceae has been proven [93]. Some species demonstrate a continuum between the genera Harposporium and Hirsutella, developing two kinds of spores

4 Fungi as Biological Control Agents of Plant-Parasitic Nematodes

77

with the related kinds of conidiogenesis [94, 95]. The most distinctive nematophagous verticillium-like genera are Haptocillium species with adhesive conidia that stick to free-living nematodes [20]. Most Hirsutella species are entomogenous, and most of them are synnematous. No comprehensive revision of the genus has so far been published. A common nematode parasite of this genus is H. rhossiliensis [20]. Recently two endoparasitic fungi (Acrostalagmus bactrosporus and A. obovatus) with adhesive spores were transferred to the genus Haptocillium [96].

4.2.2.3

Ecology

Reports of endoparsitic fungi from different countries indicate a nearly cosmopolitan distribution, but a few species are either tropical or temperate. They were mostly described in the United States and Canada [20]. They were also reported from Ireland [97], New Zealand [98], El Salvador [99], and from plants and soils in the maritime Antarctic [26, 100, 288]. Drechmeria coniospora, Haptocillium balanoides, Harposporium anguillulae, and Hirsutella rhossiliensis were also isolated infrequently in Central America [101]. Maximum densities of Harposporium anguillulae are usually found in March and June in Swedish agricultural soil, where going down to 30–40 cm, while Hirsutella rhossiliensis strongly declines after 20 cm [20]. Densities of H. rhossiliensis in a Swedish agricultural soil peaked during September–November [54]. Population densities of these endoparasites speciﬁcally declined after fallow periods [54]. Nematode endoparasites were usually found in deciduous and conifer litter, old dung, moss cushions, and decaying vegetation [97]. Addition of farmyard manure to agricultural soil increased the population of endoparasites [102]. Nematodes are attracted toward Drechmeria coniospora, Haptocillium balanoides, and other endoparasites colonies [23, 69, 103–105]. In contrast with Hirsutella rhossiliensis whose conidia are infectious only while attached to a conidiophore, the conidia of Haptocillium species are equally infectious after liberation, and could bind to a rather wide range of nematode species. Consequently when H. balanoides applied as a suspension of conidia and hyphal fragments had a much greater effect than H. rhossiliensis in controlling Ditylenchus dipsaci and promoting growth of clover, both under gnotobiotic conditions [106] and in pot cultures [107]. According to these authors, H. balanoides has low saprotrophic ability and does not survive in the soil for prolonged periods without added nematodes. Haptocillium is known to parasitize several nematode species, and with records to date, each Haptocillium species appears to have a limited degree of nematode host speciﬁcity [96]. Several species of nematodes such as D. dipsaci, Globodera rostochiensis and Panagrellus redivivus were inoculated with the fungus. Conidia adhered to all species but some of them were removed while the nematode moved through a layer of wet sand. Colonized individuals produced different quantities of conidia that were approximately 16,000, 11,700, and 840 for the above nematode species in the order mentioned [108]. Haptocillium bactrosporum,

78

M.R. Moosavi and R. Zare

Fig. 4.2 Sporulation of Haptocillium obovatum occurring externally on hyphae constructed on head end of a nematode, arrowheads show some proliferating conidiogenous cells [96]

H. obovatum and H. balanoides all abundantly produce conidia on a bacterivorous nematode, Plectusi sp. (Fig. 4.2) [96]. Haptocillium balanoides was also founded on dead needle of Pinus densiﬂora in Tsukuba, Japan [109]. The difference between phytophagous and bacteriophagous nematodes is of great ecological importance in relation to endoparasitic and other nematophagous fungi. The host relation hypothesis proposed for endoparasitic fungi [110] is incompatible with the many reports of relatively little host speciﬁcity. The free-living stages of the same nematodes can be parasitized by different array of taxa, mainly Haptocillium and Hirsutella [20]. Additional examples of extensively studied endoparasitic fungi are Drechmeria coniospora, Nematoctonus spp. and Haptocillium balanoides [11]. Comparing with nematode-trapping fungi, such endoparasitic fungi are more amendable to practical application [54]. Hirsutella rhossiliensis was able to decrease nematode invasion, and therefore nematode populations of Meloidogyne javanica, Heterodera avenae, H. glycines and Criconema xenoplax were decreased. It also successfully infected several other species of Heterodera, Ditylenchus destructor, Meloidogyne hapla, Pratylenchus penetrans, Anaplectus granulosus, and even larvae of Globodera rostochiensis [111]. In an in vitro experiment, H. rhossiliensis killed Ditylenchus dipsaci in 4 days, and juveniles of M. incognita in 2 days [112]. Hirsutella rhossiliensis is considered responsible for rapid ﬂuctuations of C. xenoplax populations in peach orchards [3, 113, 114]. Without nematodes as a food source, the population of H. rhossiliensis in soil dies out [115, 116]. Hirsutella rhossiliensis (18 isolates), H. minnesotensis (8 isolates) and H. vermicola (3 isolates) were compared for their nematode parasitism. Most isolates of H. rhossiliensis and H. minnesotensis parasitized higher percentages of the cyst nematodes (Heterodera glycines and H. avenae) than the four non-cyst nematodes (Meloidogyne hapla, Bursaphelenchus xylophilus,

4 Fungi as Biological Control Agents of Plant-Parasitic Nematodes

79

Heterorhabditis bacteriophora, and Steinernema carpocapsae). Hirsutella vermicola had weak or no ability for parasitizing the six assayed nematode species [117]. The conidia of Hirsutella species are infective only when they are attached to the phialide [118], and furthermore, conidial germination can be greatly affected by soil fungistasis [113, 119]. Consequently the species seems less suited for biological control than species of Haptocillium [107]. No growth was observed below pH 5 on an agar pH gradient [120]. Except for isolates originating from Hoplolaimidae that grew more slowly, other different isolates had uniform characters of nematode pathogenicity. The Hoplolaimidae originated isolates had larger conidia, and were less pathogenic toward nematodes than isolates from other nematode hosts [121]. The fungus produced 78–124 conidia from a colonized individual J2 larva of Meloidogyne hapla, and caused a 50% decrease in J2 penetration of lettuce roots [122]. Patel et al. [123] succeeded to produce inoculum of H. rhossiliensis in liquid culture stirred in 5-L containers. Hirsutella minnesotensis is the second nematophagous species parasitizing the J2 of the soybean cyst nematode, Heterodera glycines [124]. The entomopathogenic species of Hirsutella did not attach to nematodes with their conidia and therefore had no controlling effect [112]. Hirsutella rhossiliensis is frequently seen in association with nematode populations and there are several reports on its suppression effect on populations of H. schachtti [125, 126] and potato cyst nematodes [127]. One worthy species for further investigation is H. rhossiliensis [11] with an obligate parasite lifestyle, make its population density related to population of its host nematode [115]. Contrasting with encouraging results of controlling nematodes by H. rhossiliensis in greenhouse and laboratory assays [128–131], the fungus did not decrease the population of cyst and root-knot nematodes in a number of ﬁeld trials [132]. Because of the fungus inconsistent results, a better understanding of its ecology and population dynamics after being introduced into soil is critical for fungus successful use as an inundative commercial biocontrol agent. A real-time PCR assay was developed to quantify the H. rhossiliensis [133] and H. minnesotensis [134] in soil. The results showed that the quantity of H. rhossiliensis DNA (according to real-time PCR) decreased over time (rapidly in the ﬁrst 17 days and gradually for the succeeding 42 days), regardless of eggs or J2 of H. glycines as inoculum [135]. It is demonstrated that H. rhossiliensis could not decrease the M. javanica population on tomato over the long time [121], however, a related fungus, H. minnesotensis, was considered to have the ability of decreasing M. hapla population between 61% and 98% [136, 137]. Drechmeria coniospora can kill its host within 24 h and produce 5,000–10,000 conidia on each infected nematode [20]. Application of 106 conidia per 250-cm3 pot or 1,000 living infected Panagrellus redivivus as vectors could regulate Meloidogyne incognita in sterile or unsterile soil [138]. About 70% of nematodes which were inoculated with the conidia of D. coniospora retained attached condia after 16 h, with young ones being preferentially infected [139]. Positive correlation between reduction in spore adhesion and the nematode age increment has already been reported for Pasteuria penetrans [140].

80

M.R. Moosavi and R. Zare

Fig. 4.3 Adhesive conidia of Drechmeria coniospora on the head of a nematode. Arrow Adhesive bud of conidia, bar 2 Pm [143]

Adding organic amendment to soil can indirectly increase the population densities of the fungus by stimulating bacteriophagous nematodes [141]. Application of D. coniospora as a biological control agent is not considered feasible, because its population density had not increased adjacent to plant roots; meanwhile the fungus has narrow host range that usually does not include the plant-parasitic nematodes [139, 141–143].

4.2.2.4

Mode of Action

Because of wider mouth openings of bacteriophagous nematodes which facilitate conidial ingestion, this group of nematodes are much more prone to parasitism by endoparasitic and nematode-trapping fungi. Chemical factors are responsible for the attachment of Drechmeria conidia (or to a lesser extent of Haptocillium conidia) to speciﬁc parts of the body [20]. The processes of D. coniospora conidiogenesis and penetration into nematode cuticle were illustrated by light- and electron-microscopy (Fig. 4.3) [143, 145]. Drechmeria coniospora secretes collagenase before and during penetration [146]. The fungus occupies the pseudocoelum of the nematode without colonization of the internal organs. Nematode can ingest the conidia, but no germination is seen in intestine [147]. Thus direct penetration of conidia through cuticle is the only way of infection. Drechmeria coniospora attracts susceptible nematodes [103, 104]. The fungus develops teardrop-shaped conidia coated with a sticky mucous-like layer containing radiating ﬁbrils [148, 149]. Conidia of the fungus stick to the nematode chemosensory

4 Fungi as Biological Control Agents of Plant-Parasitic Nematodes

81

organs, speciﬁcally in the mouth region and in male anal region of certain species. Infected nematodes lost their ability to respond chemotactically to all attraction sources [150] and they were no longer attracted by colonies of the fungus. The site-speciﬁc adhesion of conidia was demonstrated for bacteriophagous, a few plant-parasitic (Meloidogyne and Aphelenchus), and animal-parasitic nematodes while there were no speciﬁc binding for some plant-parasitic nematodes like Pratylenchus, Ditylenchus and Criconemella species [143]. Conidia of D. coniospora can adhere to the chemosensory organs of root-knot nematodes but do not penetrate and colonize the nematode. Application of the fungus resulted in decreasing root galling in tomato roots, emphasized on involvement of chemotactic interference [138]. There are similar reports for insect-parasitic species (Neoaplectana and Heterorhabditis) [151] and Acrobeloides [139] where conidial adhesion occurs without any penetration. It seemed that sialic acid-like carbohydrate (acetyl-neuraminic acid) which localized in head and tail regions, involve in binding to a lectin that located on the parasite’s conidia. Treatment of spores with sialic acid and treatment of nematode with lectin Limulin reduced adhesion [150, 152]. Pronase treatment of the Caenorhabditis elegans also prevents adhesion of the conidia, but the nematodes regenerate the lost protein material after 2 h in Tris buffer [147]. The adhesion is also suggested to be mediated by sensilla exudates [147]. Adhesive on the conidial surface of D. coniospora always keeps its ﬁbrillar appearance [78]. The ﬁbrillar layer is dissolved in Pronase E. Infection was inhibited by Chymostatin (a protease inhibitor), suggesting the involvement of chymotrypsinlike proteases in the infection process [71]. After the binding of conidia of D. coniospora to nematode cuticle, an infection vesicle is developed within the cuticle layers [153, 154]. It is likely that a motile nematode previously colonized by D. coniospora, can be trapped by a second nematophagous fungus as well, however, penetration of Arthrobotrys oligospora to a D. coniospora colonized nematode is inhibited and its hyphae are often killed when placed adjacent to those of D. coniospora [85]. The uniﬂagellate zoospores of C. anguillulae attract toward natural openings (mouth, anus, excretory pores, etc.) of nematodes and after contacting with cuticle, show an amoeboid movement before encystment happen. A cell wall coated with a sticky material cover the encysting zoospores, and the ﬂagellum is withdrawn. A penetration peg is developed from the encysted zoospore which breaches the nematode cuticle and usually invades and digests the nematode cuticle within 24 h. Then the hyphae develop some sporangium containing zoospores that can infect new nematode hosts after releasing. Ability to parasitizing nematode eggs is also reported for C. anguillulae [83]. Hirsutella rhossiliensis is a typical endoparasitic fungus of nematodes. It produces adhesive spores that attach to and penetrate the cuticle of passing nematodes [119]. The conidia are infectious if only they are attached to the phialides [118], and one conidium is generally enough to infect a nematode. When the fungus penetrates its host, the nematode will be totally colonized, and within a few days the new infectious conidia will be produced [155].

82

M.R. Moosavi and R. Zare

One neutral serine protease [156] and more recently a new extracellular alkaline protease (Hasp) [36] has been described from H. rhossiliensis. This enzyme was puriﬁed, cloned and examined against nematodes. Hasp could kill the juveniles of the soybean-cyst nematode (Heterodera glycines) after puriﬁcation [36].

4.2.3

Egg- and Female-Parasitic Fungi

4.2.3.1

Introduction

In contrast with the numerous migrating nematodes, some plant-pathogenic nematodes spend the majority of their life cycle inside plant roots or on their surface in cysts and/or in root knots. These sedentary stages persist in the soil and serve as a selective substratum for fungal colonization by egg parasites. Many opportunistic soil fungi have been isolated from the eggs, cysts and sedentary females that lay their eggs in gelatinous matrices, such as Meloidogyne spp. and Tylenchulus semipenetrans [2, 11, 20, 157–159]. Generally, egg and cyst parasitizing fungi are more numerous than those infecting females [160]. This group of fungi uses appressoria or zoospores to infect their hosts [16]. The parasites of egg and sedentary stages have attracted more attention because of their high potential in biological control of economically important nematodes. These fungi that can saprotrophically survive well in rhizosphere, are relatively easy to mass-culture and are more effective in infecting because their host is sessile (eggs, developing juveniles and females). Among all nematode parasitizing fungi, comparatively few have been considered as promising biocontrol agents [14], and of these the most frequently isolated fungi are Pochonia chlamydosporia and Paecilomyces lilacinus [14, 161–164]. Species of Pochonia, Paecilomyces, Haptocillium, and Hirsutella are among the most favorable biocontrol agents against plant-parasitic nematodes [3, 6, 18, 113, 166–169].

4.2.3.2

Taxonomy

Recently, the egg-parasitic fungi previously accommodated under the genus Verticillium were transferred to the genus Pochonia according to both morphological and molecular characters [170, 171]. Pochonia species mostly produce dictyochlamydospores or at least some irregularly swollen hyphae. The production of dictyochlamydospores was mostly used to characterize Diheterospora, but this is an unreliable character for distinguishing species of this genus, because they are absent or scanty in some species, while similar structures also occur in species of Rotiferophthora and Haptocillium [171]. Their species can be more or less easily distinguished on the basis of conidial shape and the position and abundance of dictyochlamydospores [170, 171]. The teleomorphs of Pochonia species are located within Metacordyceps [172]. Although all Pochonia species could parasitize Meloidogyne javanica eggs [173] and considered as the best egg colonizers,

4 Fungi as Biological Control Agents of Plant-Parasitic Nematodes

83

but other species like Paecilomyces lilacinus and Lecanicillium lecanii are also effective in egg parasitization [16]. In addition to the mentioned facultative parasites in the Hyphomycotina, other fungi belonging to Oomycota (Nematophthora gynophila and an undescribed lagenidiaceous fungus) and Chytridiomycota (Catenaria auxiliaris) are also reported as obligate parasites of cyst nematode females [6].

4.2.3.3

Ecology

Paecilomyces lilacinus is abundant and active in subtropical and tropical areas [11], while Lecanicillium is mainly found in tropical areas [171]. Lecanicillium is reported from W. Indies, Dominican Republic, Peru, Jamaica, USA, Sri Lanka, Indonesia, Iran and Turkey [174–176]. Nematophthora gynophila is prevalent in soils of northern Europe infested with cereal cyst nematode and usually occurs together with P. chlamydosporia, and both are involved in declining of this pest species [2]. Pochonia chlamydosporia, P. bulbillosa, Paecilomyces marquandii, P. lilacinus, and P. carneus were isolated from Ascaris eggs buried in soils in the Czech Republic, Pakistan, Afghanistan, and Cuba. Pochonia spp. and P. lilacinus rapidly infected and killed the eggs [177]. Pochonia chlamydosporia is one of the most cosmopolitan species, but its Metacordyceps teleomorph is so far known only from slug eggs in the tropics [178]. Pochonia chlamydosporia is the major egg pathogen of Heterodera species in all European and American countries examined [3, 113, 179]. The species is also found as an efﬁcient parasite of Meloidogyne root-knot nematodes [164, 180–182]. Pochonia suchlasporia was a rather common fungus in central and northern Europe [20] especially on Heterodera cysts in Denmark, Sweden and the Netherlands [183–185], while P. chlamydosporia is more restricted to young cysts in these countries [171]. Some species, such as Paecilomyces lilacinus and Pochonia spp. are presumably not inﬂuenced by antimicrobial activity of the matrices produced by root-knot [187] and cyst nematodes [2]. These fungi are more abundant on galled roots infected by Meloidogyne spp. than in the rhizospheres of healthy roots [188], and their isolates have been collected from a broad range of cyst and root-knot nematodes with a worldwide distribution [2]. Two distinct barriers impede the infection of nematode eggs by fungi, the eggshell and the cuticle of the second stage larvae within the egg [17], therefore, immature eggs are more prone to parasitism than those containing larvae (Fig. 4.4). Pochonia chlamydosporia colonizes dead eggs of Heterodera more efﬁciently than live ones, with a trophic favorite of young stages, before the embryo development is completed [189]. Many experiments illustrated that egg-parasitic fungi are preferably inhabited at rhizosphere [15, 190]. Plant species inﬂuence the growth of P. chlamydosporia [190], and nematode parasitism may help support the long period maintenance of the fungus in soil [2, 191]; although the fungus is more effective when applied on poor hosts for the nematode, than when applied on fully susceptible crops.

84

M.R. Moosavi and R. Zare

Fig. 4.4 Parasitized eggs of M. javanica infected by Pochonia chlamydosporia var. catenulata (a) condiophore on an egg, (b and c) dictyo-chlamydospore associate with an immature and mature infected egg [173]

4 Fungi as Biological Control Agents of Plant-Parasitic Nematodes

85

Inoculation of the nematode poor host plants prior to a susceptible host could assist the fungus to construct a high level of population density that could manage the nematode efﬁciently [20]. It seems that the fungus could not provide a sufﬁcient nematode control by itself and must be integrated with other managing measures [140, 181, 192]. All egg and female parasites grow willingly on artiﬁcial media and some produce resting spores which serve as a survival stage in soil [2]. Different isolates of Pochonia spp. differ in virulence [15], ability to colonize the root epidermis and cortex [66], and dictyochlamydospore production [171], while all of these characters are considered important for the use of the fungus as a biocontrol agent. Dictyochlamydospores are usually used as an inoculum to introduce and to establish the fungus in the soil and rhizosphere. There are some biological (dilution plating on a selective media) and molecular (PCR, real-time PCR, and RFLP) methods which are developed to screen the presence, abundance and activity of the fungus in the soil, rhizosphere and nematode egg masses [193]. Isolates that obtained from cyst nematodes have greater ability to parasitize the cyst nematode eggs than isolates recovered from root-knot nematodes, and therefore it is suggested that the fungus has host preference [11, 173]. We know a little about the factors that cause switching trophic state from saprotrophs to parasites. In contrast with more abundance of P. chlamydosporia in organic soils, its antagonistic activity may be no greater than in a mineral soil [11]. The fungus can be formulated and introduced as fungal hyphae and conidia, but dictyochlamydospores are the most popular form of inoculum. Single application of 5,000 dictyochlamydospores per gram soil of vegetable crops in tropical soils provided sufﬁcient control of root-knot nematodes but in Europe the results have been less satisfactory [11]. The ecology of P. chlamydosporia has been the subject of many studies [18, 164, 180, 181, 183, 184, 186, 188, 194, 195]. Among all species of Pochonia, P. chlamydosporia var. chlamydosporia has been studied extensively as a potential biocontrol agent against nematodes [15, 181]. Its teleomorph, Metacordyceps chlamydosporia, has been found on slug eggs in tropical countries [20]. There are also some reports on the ability of other members of this genus like P. c. var. catenulata [193, 196], two varieties of P. suchlosporia [183, 186], P. rubescens [197, 198], P. bulbillosa and P. globispora [173] parasitizing nematode eggs. Managing of cyst nematodes and root-knot nematodes by this fungus in greenhouse and microplot trials has been repeatedly reported [161–163, 173, 199, 200]. Pochonia chlamydosporia is also ovicidal to the large roundworm, Ascaris lumbricoides [201] and slug eggs [202, 203]. In peanut fields, Meloidogyne arenaria was more frequently parasitized by P. chlamydosporia than Heterodera glycines [163]. In contrast with many successful trails of the potential application of Pochonia chlamydosporia against plant parasitic nematodes [3, 161, 164, 169, 181, 204], its ﬁrst use of conidial suspensions was failed [205]. Lòpez-Llorca and Duncan [198] illustrated the colonization of Heterodera avenae by species of Pochonia using SEM. Pochonia chlamydosporia can be effectively

86

M.R. Moosavi and R. Zare

integrated with the nematicide Aldicarb. The nematicide mostly prevents initial nematode injury, while the fungus part causes a long-term protection. Aldicarb did not inﬂuence the activity of the fungus and resulted in a better control of M. hapla than treatment with Aldicarb or P. chlamydosporia alone [200]. Using an isolate of P. c. var. catenulata in combination with crop rotation notably reduced nematode populations in soil following a tomato crop [193]. The fungus can also be introduced in combination with an arbuscular mycorrhizal symbiont, Glomus desertorum. Their combination added to tomato nursery seedlings resulted in more efﬁcient control. In that experiment 68% of eggs parasitized, while P. chlamydosporia alone could parasitize 52% of eggs [206]. Application of P. chlamydosporia together with chopped leaves of Azadirachta indica (neem) acted synergistically in reducing both gall index and nematode population in tomato in pot experiments [207]. Applying the combination of P. chlamydosporia, Trichoderma harzianum, and Glomus mosseae signiﬁcantly controlled Heterodera cajani on pigeon pea [208]. The consistency of such approaches needs extensive assessment. The biology of P. chlamydosporia and its potential for biological control of cyst and root-knot nematodes has been reviewed [181, 192]. The fungus proliferates in calcareous loams and organic soil in England and could survive at least 3 month after application, however, different isolates varied signiﬁcantly in their survival ability and also in proliferation in different soils [11, 166, 195]. The fungus prefers peaty sand soil rather than loamy sand or sand in tomato plots infected with M. incognita; however in sandy loam microplots a 90% control of M. hapla could be achieved, only if the temperature did not exceed 25°C [200]. Its optimal pH for growth was 6, but some could grow even at pH 3 [120]. Control of H. schachtii was directly related to the quantity of young infected females but not to the number of colonized cysts. Effective control will achieve only if few egg produced and many of them were colonized [167]. In tomato soils, ﬂuctuations in population densities of M. incognita and P. chlamydosporia followed each other, and supplemented soil with Meloidogyne species cause a population increscent of the fungus [20]. The fungus can naturally decline the nematode populations [209] and partial sterilization of the soil with 38% formaldehyde destroyed the nematode-decline effect according to killing fungus population [49]. It was observed that addition of wheat bran to alginate pellets was essential for the successful and consistent establishment of the fungus [195], while de Leij and Kerry [161] had found that adding dictyochlamydospores and hyphal fragments without any extra food base would result in the best establishment. Supplemented the inoculum with an energy producing base could enhance competition from the residual microﬂora that may cause an adverse effect on survival and multiplication of Pochonia [210]. In the other hand, it seems that the fungus (especially hyphae and conidia inocula) essentially needs an energy source for its establishment in mineral soil [211]. The comprehension of the tritrophic system is important for a successful application [212]. Approximately 103–104 CFU of the fungus per gram soil usually suppresses the cyst nematodes, and dictyochlamydospores are regarded as more efﬁcient than alginate-bran pellets [213]. Up to 43% of egg masses of M. hapla were parasitized

4 Fungi as Biological Control Agents of Plant-Parasitic Nematodes

87

when 5,000 dictyochlamydospores were added to each cm3 of soil, but no effect was observed on lettuce weight, root galling, or egg production [122]. When the population of nematode is high, a successful biocontrol could not be expected [214]. The fungus could produce about 5 × 106 dictyochlamydospores per gram of sand-barely bran medium mixture [49]. On the condition that extra nutrients were added, fungus strongly proliferated in soil [214]. Some isolates of P. chlamydosporia reproduce in the rhizosphere of appropriate host plants without any unfavorable effects on the plant [161, 212, 213, 215]. For a successful exploitation of P. chlamydosporia as an efﬁcient biological control agent, not only a detailed information of the molecular mechanism involved in infection of the nematodes is required, but also of ecological concern is the population dynamics of the fungus in the rhizosphere [15]. Devising a biological control strategy, it is vital to understand the dynamics of P. chlamydosporia in relation to the nematode populations; however, interpreting the basic information of such an approach is difﬁcult due to difﬁculties in quantifying the fungus in the rhizosphere and to the lack of a simple relationship linking fungal abundance to its activity [17]. Quantiﬁcation of ﬁlamentous fungi is not easy since they are not composed of single, simple-to-quantify units of nearly the same size. Like other fungi, P. chlamydosporia has several life stages that comprises of multicellular hyphae and dictyochlamydospores mixed together with unicellular conidia. Consequently, understanding a robust association of fungal biomass with nematode numbers, which practically relates to nematode infection and control, is problematic because any component of fungus quantiﬁed could result from any of the life stages, even the resting stages which not certainly contribute in nematode colonization at the time of estimation [17]. Several methodologies are in hand for such examinations, including selective plating, immunological and PCR-based techniques [216]. The dictyochlamydospores could be extracted and enumerated from soil [217]. Media for the selective isolation and quantiﬁcation of P. chlamydosporia were devised by Gaspard et al. [188, 194] (a chitin-rose bengal agar with 50 mg/L benomyl); de Leij and Kerry [161] and Kerry et al. [195] recommend cornmeal agar (Oxoid) with 37.5 mg carbendazim, 37.5 mg thiabendazole, 75 mg rose bengal, 17.5 mg NaCl, 3 mL Triton X-100, and antibacterial antibiotics; and Moosavi et al. [173] used Shrimp-Agar medium with 3 g shrimp shell powder, 17 g agar, 37.5 mg carbendazim, 37.5 mg thiabendazole, 17.5 mg NaCl, 3 mL Triton X-100, and 200 ppm each streptomycin sulphate and penicillin. Kerry and Crump [218] described a quantiﬁcation method for diseased eggs of Heterodera species. Egg parasites of cyst nematodes could also be quantiﬁed by a standard technique in which the cysts were extracted from soil and then were crushed, afterward their contents were reincorporated into the original soil sample and colonization activity on newly produced eggs is then assessed [219]. Several methods were devised to quantify the ability of the fungus in colonizing the plant rhizosphere in sterile and unsterile soil [190]. Speciﬁc primers for the E-tubulin gene of P. chlamydosporia are developed to detect the fungus on infected plant roots [216, 220]. It is documented that the most precise explanation of fungal dynamics

88

M.R. Moosavi and R. Zare

in the soil could only be achieved by combining culture- and PCR-based techniques together rather than using either method alone [221]. Pochonia suchlasporia was particularly successful in colonizing eggs and exhibited more chitinase and protease activities [183, 184]. The fungus secretes several extracellular enzymes (especially protease, chitinase and collagenase) that serve as virulence factors involving in pathogenicity [222]. Tikhonov et al. [46] demonstrated that P. suchlasporia always secretes higher volume of enzymes compared with P. chlamydosporia. Further production of enzymes may be the key factor for this species that must be considered, while scanty dictyochlamydospore production [171] can be a disadvantage for this species which affects its dispersal and survival in the soil. Comparing with P. chlamydosporia, this fungus has also a lower minimum and optimum temperature for growth [20] that could limit its commercial application in many countries with warm climate (including the Mediterranean). As optimum growth temperature for this variety is measured (18–21°C) [171] this fungus can be a good candidate for temperate and cool regions. The most effective isolate of P. chlamydosporia (V. chlamydosporium) tested by Irving and Kerry [189] was also infectious at 5°C and should probably be identiﬁed as P. suchlasporia. The ex-type strain of P. rubescens was isolated from eggs of H. avenae [178, 197, 198]. The fungus showed optimal growth at pH 6, but generates red pigments on acidic media [120] that when was extracted in chloroform/methanol had nematicidal effect on potato cyst nematode, Globodera rostochiensis [223]. This fungus parasitized eggs of Heterodera and Globodera species in vitro, and as demonstrated in TEM photographs, developing appressoria and penetration hyphae with an interior infection bulb [224]. Describing P. globispora in the genus Pochonia, Zare and Gams [225] have anticipated the potential of this species as a possible biocontrol agent of nematodes. Pochonia bulbilosa is usually recovered from forest soils [171], but apart from its isolation as an ovicidal species from Ascaris eggs in Pakistan and Afghanistan [177], its association with nematodes had not been sufﬁciently known [20]. Moosavi et al. [173] reported effectiveness of the last two species in colonizing M. javanica eggs. Pochonia gonioides was originally observed on a species of Bunonema, but the mode of entry into the nematode could not be established [226]. Recently only two isolates of this species have been available, and these were originally not directly associated with nematodes [20]. Paecilomyces lilacinus is another facultative parasite that has been employed as a biological agent for the control of plant-parasitic nematodes. The fungus potential for human pathogenicity (ocular and cutaneous infections, onychomycosis, sinusitis, and deep infections in immunocompromized patients) [227, 228] seems to preclude its practical application, but some genetic differences were found between humanpathogenic isolates and the nematode parasites [20]. Paecilomyces lilacinus and the similar P. marquandii were isolated from eggs of Ascaris lumbricoides exposed in soils in the Czech Republic, Pakistan, and Cuba [177], and both fungi also penetrated, colonized and killed eggs of Toxocara canis, the canine roundworm [229]. Therefore P. lilacinus might also be applied as a biological control agent against animal helminths in vivo [20].

4 Fungi as Biological Control Agents of Plant-Parasitic Nematodes

89

Fig. 4.5 Paecilomyces lilacinus conidiophores arising from an infected M. javanica egg

Paecilomyces lilacinus has a broad geographical distribution and was ﬁrst observed in association with nematode eggs [230], and like P. chlamydosporia, it is principally regarded as an egg parasite (Fig. 4.5). Eggs of Meloidogyne incognita and Globodera pallida were efﬁciently colonized in Peru [231]. List of the sensitive nematode species to P. lilacinus were named in an extensive review [5]. Early examinations using P. lilacinus as a biocontrol agent were encouraging [5]; however, isolates known to be parasitic on nematode eggs and present at high population levels were unable to control root-knot nematodes [165, 232]. Many factors such as ecological components in connection to the establishment ability of the fungus in soil [232] and genetic factors important in determining levels of pathogenicity [158, 233] can be involved in this inconsistency. Pathogenicity of different isolates of P. lilacinus to nematodes varies greatly [3]. Their pathogenicity was somewhat correlated with their UV resistance, that can also similarly be seen in grouping made by random ampliﬁed polymorphic DNA (RAPD) [234]. There is an inconsistency between greenhouse assays and those that were conducted in the ﬁeld [204]. Paecilomyces lilacinus have also been used joined with organic resources like oil cake, leaf residues and seeds [14, 235]; but as usual, reliable control of nematodes has been difﬁcult to achieve. An attempt was done to select low cost substrate for spore production of a nematicide strain of P. lilacinus. Coffee husks, cassava bagasse, and defatted soybean cake were utilized as substrates, and sugarcane bagasse was used as support. The products obtained by solid-state fermentation were tested for their nematicide activity against M. incognita in pot experiments containing Coleus as host plant. After 2 month the best results were achieved with defatted soybean cake, which showed almost 100% reduction in the number of nematodes, while the reduction with coffee husk was 80% and with cassava bagasse was about 60% [236]. The use of oxamyl 2 weeks before and during transplanting gave similar results to the commercial product containing P. lilacinus but superior to soil solarization [237].

90

M.R. Moosavi and R. Zare

The fungus has the ability to produce antibiotics (leucinostatin and lilacin) and chitinolytic enzymes [182]. Production of a serine protease which serves as a crucial component in disintegration of the eggshell is also documented [42, 238]. Decrease in Rotylenchulus reniformis population in tomato in India was accompanied with P. lilacinus population increment, which causes the level of control comparable to that by carbofuran [239]. In some Meloidogyne-suppressive soils in California, it seemed that P. lilacinus play an unimportant role in managing the nematode population [194]. Unlike positive correlation between population densities of P. lilacinus and P. chlamydosporia, no correlation was seen with Meloidogyne incognita [188]. Adding 10 or 20 g of fungus-colonized wheat kernels per a 76 cm diam microplot at planting time (even better with an additional treatment 10 days before planting) gave good protection against M. incognita and increased tomato yield signiﬁcantly [240, 241]. Application of P. lilacinus in potato ﬁelds of Peru provided a lower galling index due to M. incognita than nematicide treatments [5], and the introduced fungus sufﬁciently established with a single application [242]. Different selective media have been devised for monitoring P. lilacinus by Cabanillas and Barker [241] (PDA with dichloran and oxgall together with antibacterial antibiotics) and Gaspard et al. [194] (chitin-rose bengal agar with 50 mg/L iprodione). Economically production and formulation of ﬁlamentous fungal control agents remains problematic [243]; however, recent progresses in technology have made it possible to produce extremely concentrated formulations that can easily and successfully be used on a ﬁeld scale [244–247]. Paecilomyces lilacinus strain 252 was developed as a commercial product in Germany (BioAct® WG) and South Africa (Pl Plus®) for cyst and root-knot nematode management. They are applied as dispersible granules for application in water [11, 247, 248]. Species of Lecanicillium are mostly entomogenous or fungicolous [171]. Lecanicillium psalliotae (once found in a cyst of Globodera rostochiensis) and “Verticillium” leptobactrum (mainly in Heterodera eggs) were occasionally isolated from nematodes [185]. Verticillium lecanii (= L. muscarium) was also rarely observed as parasites of cysts and eggs of Heterodera and Meloidogyne species [160, 180]. An insect isolate of “Verticillium lecanii” was examined for its in vitro controlling ability of Globodera pallida. After 2 months, eight isolates (most of them probably L. muscarium and one L. longisporum) out of 14 isolates could sufﬁciently colonize the eggs [249]. When L. lecanii was added to monoxenic soybean cyst nematode cultures, it successfully colonized the cyst and female; and reproduced in gelatinous matrix but no egg penetration was observed. Hence its antagonistic activity against soybean cyst nematode was attributed to chemical secretion [250]. Lecanicillium lecanii appears to be speciﬁc to soft scale insects, Coccidae or Lecanidae [171].

4.2.3.4

Mode of Action

The eggshell of nematodes is composed of three distinct layers and mostly consists of protein and chitin, which organized in a microﬁbrillar and amorphous

4 Fungi as Biological Control Agents of Plant-Parasitic Nematodes

91

structure [251]. These layers are an outer vitelline layer, a chitin layer and an inner lipoprotein layer [252]. Penetration to the eggshell of nematode occurs from an appressorium, a specialized penetration peg or lateral branches of mycelium [16]. Chitinases and proteases play an important role during eggshell penetration, and lead to disintegration of eggshell layers [253, 254]. The fungi which can produce more extracellular enzymes (especially protease, chitinase and collagenase) are considered much more effective in infection of nematode eggs [222], and it is demonstrated that fungi differ in their ability to degrade nematode eggshells, and infection process can be affected by the nematode host [238, 254]. Maybe the emanated signals from the egg inﬂuence fungal growth and development, and penetration of the eggshell [255]. The infection of nematodes and their eggs by various nematophagous fungi follows a similar, general pattern [16]. Pochonia chlamydosporia is regarded as a parasite of females and eggs of cyst and root-knot nematodes, and develops branched mycelial networks that form appressoria on the eggshell [11, 37, 164, 198]. Contact of the hyphae with the eggshell is the ﬁrst step in penetrating nematode eggs by P. rubescens, followed by developing an appressorium covered with an extracellular material or adhesive. The extracellular material contains a protease (P32) that can be immunologically detected [16]. Deducing from labeling of the adhesive on the appressoria of P. chlamydosporia and P. rubescens with the lectin Concanavalin A, a glycoprotein nature with mannose/glucose moieties is suggested for that sticky material [256]. The fungus penetrates the nematode eggshell from the appressorium by means of both mechanical and enzymatic components. As the nematode eggshell mainly contains chitin and proteins [252], proteases, chitinases and lipases play an important role during eggshell penetration; however their penetration involvement have not as yet been examined to the same extent and detail [46, 197, 257]. Eleven isolates of Pochonia chlamydosporia that were kept in Rothamsted Research Station culture collection were selected and their ability in producing chitinases, esterases, lipases and serine protease (VCP1) were quantiﬁed and compared. The isolates were chosen so that they had different hosts, substrata and geographical origins. The results demonstrated that signiﬁcant differences in enzyme production could be seen between different isolates, time of growth and the amounts of enzymes produced. No signiﬁcant relationship were observed between trophic phase (parasitic or saprobic) and enzyme activities of the isolates, suggesting that switch in trophic phase is more complex and depended on several factors [258]. Pochonia chlamydosporia can degrade chitosan, an antifungal compound that severely affects plant pathogenic fungi, but not nematophagous and entomopathogenic fungi. It is demonstrated that the most abundant extracellular secreted proteins of P. chlamydosporia grown with chitosan as main carbon and nitrogen sources, involve in carbohydrate or protein degradation and egg penetration [259]. An endochitinase gene (pcchi44) [47] and a new serine carboxypeptidase (SCP1) genes [45] were isolated, identiﬁed and cloned from P. chlamydosporia. Serine proteases were puriﬁed and characterized from P. rubescens [197], and P. suchlasporia [224]. Involvement of the enzyme in pathogenicity was suggested by its immunolocalization in appressoria of the fungus [38].

92

M.R. Moosavi and R. Zare

Pochonia chlamydosporia secretes the VCP1 protease that involves in hydrolyzing eggshell proteins of Meloidogyne species but not those of Globodera [254]. Thickness of the egg shells of Globodera are approximately twice as those of Meloidogyne which cause more resistance to disintegration [224]. A chymoelastaselike protease is also produced by P. chlamydosporia which has the ability of hydrolysing host nematode proteins in situ [40]. Subtilisin-like proteases are the most important classes of extracellular enzymes that different isolates could have up to four isoforms of them. The enzymes decompose the proteins of their nematode hosts and are very important in fungal pathogenicity [238]. The similarity of the enzyme with that secreted by Metarhizium anisopliae is demonstrated [41]. It is also demonstrated that a serine protease and chitinases that are effective in degrading the eggshell, and a nematotoxin, phomalactone, which secreted by P. chlamydosporia enhance the pathogenicity [11, 254]. Further studies using Enterobacterial Repetitive Intergenic Consensus PCR (ERIC-PCR) revealed that different isolates of P. chlamydosporia produce a range of different proteases, and that the difference in the enzymes perhaps relates to the different ecological niches occupied by each fungus [238, 260]. ERIC-PCR generated data using in phylogenetic analysis illustrated that the different isolates of the fungus were related to its host from which the isolate had been obtained [253]. Comparison of the similarity of amino acid sequences between proteases from different nematophagous fungi showed a high level of conservation, with only minor insertions and deletions [261]. Minor variation in amino acid sequence may inﬂuence substrate utilization and host preference [41] that has been documented in VCP1 proteases from different isolates of P. chlamydosporia. Substitution of an alanine by a glycine in the S3 substrate-binding region of VCP1 confers enzymatic activity against eggshells of Meloidogyne [253]. Paecilomyces lilacinus is a well-studied antagonist of some nematodes like Radopholus similis and Tylenchulus semipenetrans, but most research has carried out on the infection of Meloidogyne spp. and Globodera rostochiensis eggs [11]. This fungus has been extensively evaluated for reducing nematode damage to a range of crops and its application usually caused a signiﬁcant nematode control. Paecilomyces lilacinus secrete a serine protease and several chitinases that involve in drastic degradation of the eggshell structure [262, 263]. A very similar mode of egg penetration is seen in fungi that are distantly related. Phylogenetic analysis of a chitinase gene from P. lilacinus with those from mycoparasitic, entomopathogenic and nematophagous fungi illustrated such similarity that it has been hypothesized that probably the gene was acquired by gene transfer from bacteria [264]. All zoospore producing species develop resting spores that survive in soil when their host is absent. These fungi colonize the female nematode and prevent cyst formation. Life cycle of N. gynophila is completed within 5 days at 13°C in the cereal cyst nematode [265]. The zoospores need ﬂooded soil for motility, and therefore nematode infection is limited to periods following rainfall. It is difﬁcult or impossible to culture the obligate parasites in vitro, therefore their commercial prospect is ambiguous [266].

4 Fungi as Biological Control Agents of Plant-Parasitic Nematodes

4.2.4

93

Toxin-Producing Fungi

The toxin-producing fungi secrete a toxin that immobilizes the nematodes before penetration of hyphae through the nematode cuticle [16]. Nematophagous fungi secreted a number of compounds in vitro that may have nematicidal or nematostatic traits. The in vivo role of such compounds is usually not well known but Pleurotus ostreatus produces droplets of a potent toxin that quickly immobilizes nematodes [267] and has the structure of trans-2-decenedioic acid [268]. Finding that basidiomycetous Pleurotus and Coprinus have some species (like P. ostreatus and C. comatus) that produce toxin [267, 269], it is suggested that the nematophagous habit may be more widespread among Basidiomycota than previously thought [16]. Antibiotic (nematicidal and antifungal) activities have been demonstrated for Drechmeria coniospora, Harposporium anguillulae [22], Lecanicillium, Paecilomyces lilacinus [5], and Pochonia [238]. Paecilomyces lilacinus secretes acetic acid that paralyzes juvenile nematodes [270]. Some bioactive compounds have been isolated from in vitro cultures of P. chlamydospora [2] and P. suchlasporia [120], but their role in soil is poorly understood [2]. Because of the rapidity with which the nematode embryos were killed, it is suggested that Catenaria anguillulae secreted toxins [2]. Several oligosporin antibiotics have been described from A. oligospora [271]. Finding new compounds with nematicidal activity and analyzing their synthesizing pathways is a new ﬁeld to be exploited. It is feasible to use the genetically modiﬁed organism in biocontrol after those pathways are fully understood at the molecular level [272].

4.3

Endophytic Fungi

Some fungi grow within plant tissue but do not cause lesions or other disease symptoms and are referred to as endophytes. These organisms can be mutualistic if they defend the plants against herbivores or pathogens and parasites. Acremonium spp. may secrete general toxins that inﬂuence on grazing mammals and herbivorous insects, and induce plant root modiﬁcation which decrease nematode feeding and reproduction [273]. A number of endophytic fungi are nonpathogenic isolates of ordinary plant pathogens like Fusarium oxysporum that during in vitro tests secreted metabolites which were toxic to Radopholus similis, Meloidogyne incognita and Pratylenchus zeae [274, 275]. Even though this fungus can decrease the numbers of nematodes developing in roots, its mode of action is not clear. This can be due to toxin production, competition for space in the roots, alteration of the physiological state of root tissue, or colonization of feeding cells to the detriment of nematodes [2, 276]. Neotyphodium spp. in the leaves of grasses may also rely on a toxic secretion mechanism to lessen nematode infestations in roots [2]. Arbuscular mycorrhizal (AM) fungi are the well known plant root associated endophytes. These fungi are obligate symbiotic parasites of plants that have been

94

M.R. Moosavi and R. Zare

widely reported to enhance the growth of nematode-infected plants and, in some cases, to decrease nematode infestations [277–279]. Plant growth enhancement is happened by improving plant access to nutrients, particularly phosphorus, and especially under conditions of poor nutrient availability. These fungi also assist access to and uptake of water and alleviate heavy metal toxicity [2]. Roots were shared as a resource for food and space between plant parasitic nematodes and AM fungi. According to proximity in tissue, more reciprocal effects were expected between AM fungi and endoparasitic nematodes. Migratory endoparasitic nematodes were the only group whose numbers were greater on AMF-infected plants [280]. Role of AM fungi in suppressing nematode damage to plant and in decreasing nematode densities in the soil has been illustrated in many cases, although most of them include Meloidogyne species. Nematode multiplication rate can be reduced if plant roots are colonized by AM fungi before nematode invasion. The greatest decreases in nematode infestations usually occurring in roots extensively occupied by the fungus before the nematodes invade [2]. Production and secretion of root diffusates may be interfered or some nematotoxic compounds can be produced by AM fungi, however their exact mode(s) of action is not well understood [11]. The efﬁcacy of endophytes depends on the plant colonized and the species of troublesome nematode [2]. Endophytic fungi, especially AM fungi are produced commercially as crop-growth enhancers. They have the advantage that they can be applied as seed treatments, and then they will multiply rapidly and colonize the rhizosphere and plant roots. This can result in protecting the plants from nematode invasion [281]. The level of nematode management can be satisfactory, although the effect of different isolates of the same species can differ distinctly in suppressing nematode damage [11]. Active isolates of F. oxysporum against R. similis are being developed and undergoing ﬁeld trial on banana plantations in Central America and East Africa [11]. However it is speculated that induced resistance has an important role in the interaction, but the modes of action are poorly understood [11]. Some nematophagous fungi have the ability to colonize plant roots as a probable survival strategy [16]. It is demonstrated that P chlamydosporia and P. rubescens endophytically colonize barley roots [45]. The plant defense reactions were probably induced by nematophagous fungi, but these never prevented root colonization. The nematode-trapping and toxin-producing fungi cause necrotic areas on roots at their initial stages of colonization, but were never later observed, even when the fungi proliferated in epidermal and cortical cells. It seemed that monocotyledon plants extensively colonized by nematophagous fungi resulted in producing abundant mycelia, conidia and chlamydospores [16]. The egg parasite fungi, like Pochonia spp., that grow as endophytic fungi may have higher chance to parasitize eggs of economically important endoparasitic nematodes (like cyst and root-knot species) inside the roots and to decrease succeeding spread and roots infection by the second generation of juveniles. Some structures similar to trapping devices were seen in epidermal cells colonized by A. oligospora, which can use to entrap newly hatched juveniles escaping the roots. The ability to colonize plant roots

4 Fungi as Biological Control Agents of Plant-Parasitic Nematodes

95

by nematophagous fungi is a novel area of research that deserves in-depth investigations [16]. The endophytic root colonization potential of different groups of nematophagous species was investigated recently. The egg-parasite P. chlamydosporia and the toxin-producing Pleurotus djamor had the ability to endophytic colonization of barley roots. The nematode-trapping species A. oligospora, D. dactyloides, and N. robustus were all also capable of similar root colonization. Only the endoparasitic fungi H. rhossiliensis and Nematoctonus pachysporus were not capable of endophytic root colonization [66, 282, 283]. The fungi penetrated into plant cell walls of epidermis and cortex cells by means of appressoria, and developed inter- and intracellularly. It was the ﬁrst time that appressoria formation was seen in A. oligospora [66, 283].

References 1. Eilenberg J, Hajek A, Lomer C (2001) Suggestions for unifying the terminology in biological control. Biocontrol 46:387–400 2. Kerry BR, Hominick WM (2002) Biological control. In: Lee DL (ed) The biology of nematodes. Taylor & Francis, London 3. Stirling GR (1991) Biological control of plant-parasitic nematodes: progress, problems and prospects. CAB International, Wallingford 4. Ciancio A, Mukerji KG (2008) Integrated management and biocontrol of vegetable and grain crops nematodes. Springer, Dordrecht 5. Jatala P (1986) Biological control of plant-parasitic nematodes. Annu Rev Phytopathol 24:453–489 6. Kerry BR (1987) Biological control. In: Brown RA, Kerry BR (eds) Principles and practice of nematode control in crops. Academic, New York 7. Mankau R (1981) Microbial control of nematodes. In: Zuckerman BM, Rohde RA (eds) Plant-parasitic nematodes, vol III. Academic, New York 8. Sayre RM (1988) Bacterial diseases of nematodes and their role in controlling nematode populations. Agric Ecosyst Environ 24:263–279 9. Siddiqui ZA, Mahmood I (1999) Role of bacteria in the management of plant parasitic nematodes: a review. Bioresour Technol 69:167–179 10. Sikora RA (1992) Management of the antagonistic potential in agriculture ecosystems for the biocontrol of plant-parasitic nematodes. Annu Rev Phytopathol 30:245–270 11. Viaene N, Coyne DL, Kerry BR (2006) Biological and cultural management. In: Perry RN, Moens M (eds) Plant nematology. CABI, Wallingford 12. Whipps JM, Davies KG (2000) Success in biological control of plant pathogens and nematodes by microorganisms. In: Gurr G, Wratten S (eds) Biological control: measures of success. Kluwer Academic, Dordrecht 13. Jaffee BA (1992) Population biology and biological control of nematodes. Can J Microbiol 38:359–364 14. Siddiqui ZA, Mahmood I (1996) Biological control of plant parasitic nematodes by fungi: a review. Bioresour Technol 58:229–239 15. Kerry BR (2000) Rhizosphere interactions and the exploitation of microbial agents for the biological control of plant-parasitic nematodes. Annu Rev Phytopathol 38:423–441 16. Lòpez-Llorca LV, Macia-Vicente JG, Jansson H-B (2008) Mode of action and interactions of nematophagous fungi. In: Ciancio A, Mukerji KG (eds) Integrated management and biocontrol of vegetable and grain crops nematodes. Springer, Dordrecht

96

M.R. Moosavi and R. Zare

17. Hallmann J, Davies KG, Sikora RA (2009) Biological control using microbial pathogens, endophytes and antagonists. In: Perry RN, Moens M, Starr JL (eds) Root-knot nematodes. CABI, Wallingford 18. Dackman C, Jansson H-B, Nordbring-Hertz B (1992) Nematophagous fungi and their activities in soil. In: Stotsky G, Bollag JM (eds) Soil biochemistry, vol 7. Marcel Dekker, New York 19. Hao Y, Mo M, Su H, Zhang K (2005) Ecology of aquatic nematode-trapping hyphomycetes in southwestern China. Aquat Microb Ecol 40:175–181 20. Gams W, Zare R (2003) A taxonomic review of the clavicipitaceous anamorphs parasitizing nematodes and other microinvertebrates. In: White JF Jr, Bacon CW, Hywel-Jones NL, Spatafora JW (eds) Clavicipitalean fungi: evolutionary biology, chemistry, and cultural impacts. Marcel Dekker, New York 21. Barron GL (1992) Lignolytic and cellulolytic fungi as predators and parasites. In: Carroll GC, Wicklow DT (eds) The fungal community, its organization and role in the ecosystems. Marcel Dekker, New York 22. Barron GL (1977) The nematode-destroying fungi. Canadian Biological Publications Ltd., Guelph 23. Barron GL (1982) Nematode-destroying fungi. In: Burns RG, Slater JH (eds) Experimental microbiology. Blackwell, Oxford 24. Duddington CL (1962) Predaceous fungi and the control of eelworms. In: Duddington CL, Carthy JD (eds) Viewpoints in biology, vol 1. Butterworths, London 25. Gray NF (1983) Ecology of nematophagous fungi: distribution and habitat. Ann Appl Biol 102:501–509 26. Gray NF, Lewis Smith RI (1984) The distribution of nematophagous fungi in the maritime Antarctic. Mycopathologia 85:81–92 27. Glockling SL, Yamada F (1997) A survey of fungi which kill microscopic animals in the dung of the Amami rabbit. Mycologist 11:113–120 28. Juniper AJ (1967) Dung as a source of predaceous fungi. Trans Br Mycol Soc 40:346–348 29. Cardon ZG, Gage DJ (2006) Resource exchange in the rhizosphere: molecular tools and the microbial perspective. Annu Rev Ecol Evol Syst 37:459–488 30. Jansson H-B, Lòpez-Llorca LV (2001) Biology of nematophagous fungi. In: Mishra JD, Horn BW (eds) Trichomycetes and other fungal groups: professor Robert W, Lichtwardt commemoration volume. Science Publisher, Enﬁeld 31. Tunlid A, Rosen S, Ek B, Rask L (1995) Puriﬁcation and characterization of an extracellular serine protease from the nematode-trapping fungus Arthrobotrys oligospora. Microbiology 140:1687–1695 32. Zhao M, Mo M, Zhang Z (2004) Characterization of a serine protease and its full-length cDNA from the nematode-trapping fungus Arthrobotrys oligospora. Mycologia 96:16–22 33. Wang M, Yang JK, Zhang KQ (2006) Characterization of an extracellular protease and its cDNA from the nematode-trapping fungus Monacrosporium microscaphoides. Can J Microbiol 52:130–139 34. Wang RB, Yang JK, Lin C, Zhang Y, Zhang KQ (2006) Puriﬁcation and characterization of an extracellular serine protease from the nematode-trapping fungus Dactylella shizishanna. Lett Appl Microbiol 42:589–594 35. Kanda S, Aimi T, Kano S, Ishihara Sh, Kitamoto Y, Morinaga Y (2008) Ambient pH signaling regulates expression of the serine protease gene (spr1) in pine wilt nematode-trapping fungus, Monacrosporium megalosporum. Microbiol Res 163:63–72 36. Wang B, Liu X, Wu W, Liu X, Li Sh (2009) Puriﬁcation, characterization, and gene cloning of an alkaline serine protease from a highly virulent strain of the nematode-endoparasitic fungus Hirsutella rhossiliensis. Microbiol Res 164:665–673 37. Lòpez-Llorca LV, Claugher D (1990) Appressoria of the nematophagous fungus Verticillium suchlasporium. Micron Microsc Acta 21:125–130 38. Lòpez-Llorca LV, Robertson WM (1992) Immunocytochemical localization of a 32-kDa protease from the nematophagous fungus Verticillium suchlasporium in infected nematode eggs. Exp Mycol 16:261–267

4 Fungi as Biological Control Agents of Plant-Parasitic Nematodes

97

39. Olivares-Bernabeu C (1999) Caracterizacion biologica y molecular de hongos patogenos de huevos de nematodos. PhD thesis, University of Alicante, Alicante 40. Segers R, Butt TM, Kerry BR, Peberdy JF (1994) The nematophagous fungus Verticillium chlamydosporium produces a chymoelastase-like protease which hydrolyses host nematode proteins in situ. Microbiology 140:2715–2723 41. Segers R, Butt TM, Keen JN, Kerry BR, Peberdy JF (1995) The subtilisins of the invertebrate mycopathogens Verticillium chlamydosporium and Metarhizium anisopliae are serologically and functionally related. FEMS Microbiol Lett 126:227–231 42. Bonants PJM, Fitters PFL, Thijs H, den Belder E, Waalwijk C, Henﬂing JWDM (1995) A basic serine protease from Paecilomyces lilacinus with biological activity against Meloidogyne hapla eggs. Microbiology 141:775–784 43. Yang JK, Huang XW, Tian BY, Sun H, Duan J, Wu W, Zhang M (2005) Characterization of an extracellular serine protease gene from the nematophagous fungus Lecanicillium psalliotae. Biotechnol Lett 27:1329–1334 44. Yang JK, Huang XW, Tian BY, Wang M, Niu QH, Zhan KQ (2005) Isolation and characterization of a serine protease from the nematophagous fungus, Lecanicillium psalliotae, displaying nematicidal activity. Biotechnol Lett 27:1123–1128 45. Lòpez-Llorca LV, Gomez-Vidal S, Monfort E, Larriba E, Casado-Vela J, Elortza F, Jansson HB, Salinas J, Martin-Nieto J (2010) Expression of serine proteases in egg-parasitic nematophagous fungi during barley root colonization. Fungal Genet Biol 47:342–351 46. Tikhonov VE, Lòpez-Llorca LV, Salinas J, Jansson HB (2002) Puriﬁcation and characterization of chitinases from the nematophagous fungi Verticillium chlamydosporium and V. suchlasporium. Fungal Genet Biol 35:67–78 47. Mi Q, Yang J, Ye F, Gan Z, Wu C, Niu X, Zou C, Zhang KQ (2010) Cloning and overexpression of Pochonia chlamydosporia chitinase gene pcchi44, a potential virulence factor in infection against nematodes. Process Biochem 45:810–814 48. Chen YY, Cheng CY, Huang TL, Li YK (2005) Chitosanase from Paecilomyces lilacinus with binding afﬁnity for speciﬁc chitooligosaccharides. Biotechnol Appl Biochem 41:145–150 49. Kerry BR, Jaffee BA (1997) Fungi as biological control agents for plant parasitic nematodes. In: Wicklow DT, Soderstrom BE (eds) The mycota: a comprehensive treatise on fungi as experimental systems for basic applied research, vol 4, Environmental and microbial relationships. Springer, Berlin 50. Koziak ATE, Cheng KC, Thorn RG (2007) Phylogenetic analyses of Nematoctonus and Hohenbuehelia (Pleurotaceae). Can J Bot 85:762–773 51. Anke H, Stadler M, Mayer A, Sterner O (1995) Secondary metabolites with nematicidal and antimicrobial activity from nematophagous fungi and Ascomycetes. Can J Bot 73:s932–s939 52. Ahren D, Ursing BM, Tunlid A (1998) Phylogeny of nematode-trapping fungi based on 18S rDNA sequences. FEMS Microbiol Lett 158:179–184 53. Scholler M, Hagedorn G, Rubner A (1999) A reevaluation of predatory orbiliaceous fungi. II. A new generic concept. Sydowia 51:89–113 54. Persmark L, Banck A, Jansson H-B (1996) Population dynamics of nematophagous fungi and nematodes in an arable soil – vertical and seasonal ﬂuctuations. Soil Biol Biochem 28:1005–1014 55. Saxena G (2008) Observations on the occurrence of nematophagous fungi in Scotland. Appl Soil Ecol 39:352–357 56. Kelly P, Good B, Hanrahan JP, Fitzpatrick R, de Waal T (2009) Screening for the presence of nematophagous fungi collected from Irish sheep pastures. Vet Parasitol 165:345–349 57. Wachira P, Mibey R, Okoth S, Kimenju J, Kiarie J (2009) Diversity of nematode destroying fungi in Taita Taveta, Kenya. Fungal Ecol 2:60–65 58. Li Y, Jeewon R, Hyde KD, Mo MH, Zhang KQ (2006) Two new species of nematode-trapping fungi: relationships inferred from morphology, rDNA and protein gene sequence analyses. Mycol Res 110:790–800 59. Cooke RC (1962) The ecology of nematode-trapping fungi in the soil. Ann Appl Biol 50:507–513

98

M.R. Moosavi and R. Zare

60. Jaffee BA, Ferris H, Scrow KM (1998) Nematode-trapping fungi in organic and conventional cropping systems. Phytopathology 88:344–350 61. Timm L, Pearson D, Jaffee B (2001) Nematode-trapping fungi in conventionally and organically managed corn–tomato rotations. Mycologia 93:25–29 62. Xu LL, Lai YL, Wang L, Liu XZ (2011) Effects of abscisic acid and nitric oxide on trap formation and trapping of nematodes by the fungus Drechslerella stenobrocha AS6.1. Fungal Biol 115:91–101 63. Pﬁster DH (1997) Castor, Pollux and life histories of fungi. Mycologia 89:1–23 64. Migunova VD, Byzov BA (2005) Determinants of trophic modes of the nematophagous fungus Arthrobotrys oligospora interacting with bacterivorous nematode Caenorhabditis elegans. Pedobiologia 49:101–108 65. Nguyen VL, Bastow JL, Jaffee BA, Strong DR (2007) Response of nematode-trapping fungi to organic substrates in a coastal grassland soil. Mycol Res 111:856–862 66. Bordallo JJ, Lòpez-Llorca LV, Jansson H-B, Salinas J, Persmark L, Asensio L (2002) Colonization of plant roots by egg-parasitic and nematode-trapping fungi. New Phytol 154:491–499 67. Persmark L, Nordbring-Hertz B (1997) Conidial trap formation of nematode-trapping fungi in soil and soil extracts. FEMS Microbiol Ecol 22:313–323 68. Persson C, Jansson H-B (1999) Rhizosphere colonization and control of Meloidogyne spp. by nematode-trapping fungi. J Nematol 31:164–171 69. Jansson H-B, Nordbring-Hertz B (1979) Attraction of nematodes to living mycelium of nematophagous fungi. J Gen Microbiol 112:89–93 70. Jansson H-B, Thiman L (1992) A preliminary study of chemotaxis of zoospores of the nematodeparasitic fungus Catenaria anguillulae. Mycologia 84:109–112 71. Jansson H-B, Friman E (1999) Infection-related surface proteins on conidia of the nematophagous fungus Drechmeria coniospora. Mycol Res 103:249–256 72. Quinn MA (1987) The inﬂuence of saprophytic competition on nematode predation by nematode-trapping fungi. J Invertebr Pathol 49:170–174 73. Tunlid A, Johansson T, Nordbring-Hertz B (1991) Surface polymers of the nematode-trapping fungus Arthrobotrys oligospora. J Gen Microbiol 137:1231–1240 74. Tunlid A, Nivens DE, Jansson HB, White DC (1991) Infrared monitoring of the adhesion of Catenaria anguillulae zoospores to solid surfaces. Exp Mycol 15:206–214 75. Nordbring-Hertz B, Mattiasson B (1979) Action of a nematode-trapping fungus shows lectinmediated host-microorganism interaction. Nature 281:477–479 76. Jansson H-B (1987) Receptors and recognition in nematodes. In: Veech J, Dickson D (eds) Vistas on nematology. Society of Nematologists, Hyattsville 77. Zuckerman BM, Jansson H-B (1984) Nematode chemotaxis and mechanisms of host/prey recognition. Annu Rev Phytopathol 22:95–113 78. Jansson H-B, Nordbring-Hertz B (1988) Infection events in the fungus-nematode system. In: Poinar GO, Jansson HB (eds) Diseases of nematodes. CRC Press, Boca Raton 79. Tunlid A, Jansson H-B, Nordbring-Hertz B (1992) Fungal attachment to nematodes. Mycol Res 96:401–412 80. Ahren D, Tholander M, Fekete C, Rajashekar B, Friman E, Johansson T et al (2005) Comparison of gene expression in trap cells and vegetative hyphae of the nematophagous fungus Monacrosporium haptotylum. Microbiology 151:789–803 81. Wang C, St. Leger RJ (2005) Developmental and transcriptional responses to host and nonhost cuticles by the speciﬁc locust pathogen Metarhizium anisopliae var. acridum. Eukaryot Cell 4:932–947 82. Chen TH, Hsu CS, Tsai PJ, Ho YF, Lin NA (2001) Heterotrimeric G-protein and signal transduction in the nematode-trapping fungus Arthrobotrys Dactyloides. Planta 212:858–863 83. Wyss U, Voss B, Jansson H-B (1992) In vitro observations on the infection of Meloidogyne incognita eggs by the zoosporic fungus Catenaria anguilulae Sorokin. Fundam Appl Nematol 15:133–139

4 Fungi as Biological Control Agents of Plant-Parasitic Nematodes

99

84. Ahman J, Ek B, Rask L, Tunlid A (1996) Sequence analysis and regulation of a gene encoding a cuticle-degrading serine protease from the nematophagous fungus Arthrobotrys oligospora. Microbiology 142:1605–1616 85. Dijksterhuis J, Sjollema KA, Veenhuis M, Harder W (1994) Competitive interactions between two nematophagous fungi during infection and digestion of the nematode Panagrellus redivivus. Mycol Res 98:1458–1462 86. Gleason FH, Marano AV, Johnson P, Martin WW (2010) Blastocladian parasites of invertebrates. Fungal Biol Rev 24:56–67 87. Hibbett DS, Binder M, Bischoff JF, Blackwell M, Cannon PF, Eriksson OE et al (2007) A higher-level phylogenetic classiﬁcation of the Fungi. Mycol Res 111:509–547 88. James TY, Porter D, Leander CA, Vilgalys R, Longcore JE (2000) Molecular phylogenetics of the Chytridiomycota supports the utility of ultrastructural data in chytrid systematics. Can J Bot 78:336–350 89. James TY, Letcher PM, Longcore JE, Mozley-Standridge PD, Powell MJ, Grifﬁth GW, Vilgalys R (2006) A molecular phylogeny of the ﬂagellated fungi (Chytridiomycota) and description of a new phylum (Blastocladiomycota). Mycologia 98:860–871 90. Letcher PM, Powell MJ, Barr DJS, Churchill PF, Wakeﬁeld WS, Picard KT (2008) Rhizophlyctidales–a new order in Chytridiomycota. Mycol Res 112:1031–1048 91. Thorn RG, Barron GL (1986) Nematoctonus and the tribe resupinateae in Ontario, Canada. Mycotaxon 25:321–453 92. Gams W, Jansson H-B (1985) The nematode parasite Meria coniospora Drechsler in pure culture and its classiﬁcation. Mycotaxon 22:33–38 93. Gernandt DS, Stone JK (1999) Phylogenetic analysis of nuclear ribosomal DNA places the nematode parasite, Drechmeria coniospora, in Clavicipitaceae. Mycologia 91:993–1000 94. Glockling SL (1998) Three new species of Rotiferophthora attacking bdelloid rotifers in Japan. Mycol Res 102:1142–1148 95. Hodge KT, Viaene NM, Gams W (1997) Two Harposporium species with Hirsutella synanamorphs. Mycol Res 101:1377–1382 96. Glockling SL, Holbrook GP (2005) Endoparasites of soil nematodes and rotifers II: the genus Haptocillium. Mycologist 19:2–9 97. Gray NF (1983) Further observations on predaceous fungi from Ireland. Ir Nat J 21:18–22 98. Hay FS (1995) Endoparasites infecting nematodes in New Zealand. N Z J Bot 33:401–407 99. Bucaro RD (1974) Hongos nematofagos de El Salvador. Rev Biol Trop 31:25–28 100. Gray NF, Wyborn CHE, Lewis Smith RI (1982) Nematophagous fungi from the maritime Antarctic. Oikos 38:194–201 101. Persmark L, Marban-Mendoza N, Jansson H-B (1995) Nematophagous fungi from agricultural soils of central America. Nematropica 25:117–124 102. Dackman C, Olsson S, Jansson H-B, Lundgren B, Nordbring-Hertz B (1987) Quantiﬁcation of predatory and endoparasitic nematophagous fungi in soil. Microb Ecol 13:89–93 103. Jansson H-B (1982) Attraction of nematodes to endoparasitic nematophagous fungi. Trans Br Mycol Soc 79:25–29 104. Jansson H-B (1982) Predacity by nematophagous fungi and its relation to the attraction of nematodes. Microbiol Ecol 8:233–240 105. Jansson H-B, Nordbring-Hertz B (1980) Interactions between nematophagous fungi and plant-parasitic nematodes: attraction, induction of trap formation and capture. Nematologica 26:383–389 106. Hay FS, Regnault L (1995) Introduction of endoparasitic nematophagous fungus Verticillium balanoides into white clover (Trifolium repens) by its host, stem nematodes (Ditylenchus dipsaci). Aust Plant Pathol 24:249–251 107. Hay FS, Bateson L (1997) Effect of the nematophagous fungi Hirsutella rhossiliensis and Verticillium balanoides on stem nematode (Ditylenchus dipsaci) in white clover. Aust Plant Pathol 26:142–147 108. Atkinson HJ, Durschner-Pelz U (1995) Spore transmission and epidemiology of Verticillium balanoides, an endozoic fungal parasite of nematodes in soil. J Invert Pathol 65:237–242

100

M.R. Moosavi and R. Zare

109. Watanabe T (2000) Verticillium balanoides, a nematode endoparasite associated with pine needles of collapsing Japanese red pine trees in Tsukuba. Mycoscience 41:283–285 110. Nikoh N, Fukatsu T (2000) Interkingdom host jumping underground: phylogenetic analysis of entomoparasitic fungi of the genus Cordyceps. Mol Biol Evol 17:629–638 111. Sturhan D, Schneider R (1980) Hirsutella heteroderae, ein neuer nematodenparasitarer Pilz. Phytopathol Z 99:105–115 112. Cayrol J-C, Castet R, Samson RA (1986) Comparative activity of different Hirsutella species towards three plant parasitic nematodes. Rev Nematol 9:412–414 113. Stirling GR (1988) Biological control of plant-parasitic nematodes. In: Poinar GO Jr, Jansson H-B (eds) Diseases of nematodes, vol II. CRC Press, Boca Raton 114. Zehr EI (1985) Evaluation of parasites and predators of plant parasitic nematodes. J Agric Entomol 2:130–134 115. Jaffee BA, Phillips R, Muldoon AE, Mangel M (1992) Density-dependent host–pathogen dynamics in soil microcosms. Ecology 73:495–506 116. Timper P, Kaya HK, Jaffee BA (1991) Survival of entomogenous nematodes in soil infested with the nematode-parasitic fungus Hirsutella rhossiliensis (Deuteromycotina: Hyphomycetes). Biol Control 1:42–50 117. Xiang MC, Yang XH, Wang ZX, Liu XZ, Chen SY, Xiao QM (2007) Variability of morphology, parasitism, and nucleotide sequences among isolates and species of nematophagous Hirsutella. Biol Control 41:110–119 118. McInnis TM, Jaffee BA (1998) An assay for Hirsutella rhossiliensis spores and the importance of phialides for nematode inoculation. J Nematol 21:229–234 119. Jaffee BA, Zehr EI (1985) Parasitic and saprophytic abilities of the nematode-attacking fungus Hirsutella rhossiliensis. J Nematol 17:341–345 120. Lòpez-Llorca LV, Moya M, Llinares A (1994) Effect of pH on growth and pigment production of nematophagous and entomogenous fungi. Micol Veg Mediterr 8:107–112 121. Tedford EC, Jaffee BA, Muldoon AE (1994) Variability among isolates of the nematophagous fungus Hirsutella rhossiliensis. Mycol Res 98:1127–1136 122. Viaene NM, Abawi GS (2000) Hirsutella rhossiliensis and Verticillium chlamydosporium as biocontrol agents of the root-knot nematode Meloidogyne hapla on lettuce. J Nematol 32:85–100 123. Patel A, Rose T, Gutberlet V, Muller J, Vorlop KD (2001) Der nematophage Pilz Hirsutella rhossiliensis: Fermentation im 5-Liter Ruhrreaktor und Formulierung in Kapseln und Zuckerrubenpillen (abstr). Phytomedizin 31(4):59 124. Chen SY, Liu XZ, Chen FJ (2000) Hirsutella minnesotensis sp nov, a new pathogen of the soybean cyst nematode. Mycologia 92:819–824 125. Jaffee BA, Muldoon AE (1989) Suppression of cyst nematode by natural infestation of a nematophagous fungus. J Nematol 21:505–510 126. Muller J (1982) The inﬂuence of fungal parasites on the population dynamics of Heterodera schachtii on oil radish. Nematologica 28:161 127. Velvis H, Kamp P (1996) Suppression of potato cyst nematode root penetration by the endoparasitic nematophagous fungus Hirsutella rhossiliensis. Eur J Plant Pathol 102:115–122 128. Amin AW (2000) Efﬁcacy of Arthrobotrys oligospora, Hirsutella rhossiliensis, Paecilomyces lilacinus and Pasteuria penetrans as potential biocontrol agents against Meloidogyne incognita on tomato. Pak J Nematol 18:29–33 129. Chen SY, Liu XZ (2005) Control of the soybean cyst nematode by the fungi Hirsutella rhossiliensis and Hirsutella minnesotensis in greenhouse studies. Biol Control 32:208–219 130. Liu SF, Chen SY (2005) Efﬁcacy of the fungi Hirsutella minnesotensis and Hirsutella rhossiliensis from liquid culture for control of the soybean cyst nematode. Nematology 7:149–157 131. Velvis H, Kamp P (1995) Infection of second stage juveniles of potato cyst nematodes by the nematophagous fungus Hirsutella rhossiliensis in Dutch potato ﬁelds. Nematologica 41:617–627

4 Fungi as Biological Control Agents of Plant-Parasitic Nematodes

101

132. Tedford EC, Jaffee BA, Muldoon AE, Anderson CE, Westerdahl BB (1993) Parasitism of Heterodera schachtii and Meloidogyne javanica by Hirsutella rhossiliensis in microplots over two growing seasons. J Nematol 25:427–433 133. Zhang L, Liu X, Zhu Sh, Chen S (2006) Detection of the nematophagous fungus Hirsutella rhossiliensis in soil by real-time PCR and parasitism bioassay. Biol Control 36:316–323 134. Xiang MC, Xiang PA, Jiang XZ, Duan WJ, Liu XZ (2010) Detection and quantiﬁcation of the nematophagous fungus Hirsutella minnesotensis in soil with real-time PCR. Appl Soil Ecol 44:170–175 135. Zhang L, Yang E, Xiang M, Liu X, Chen S (2008) Population dynamics and biocontrol efﬁcacy of the nematophagous fungus Hirsutella rhossiliensis as affected by stage of the soybean cyst nematode. Biol Control 47:244–249 136. Mennan S, Chen SY, Melakeberhan H (2006) Suppression of Meloidogyne hapla populations by Hirsutella minnesotensis. Biocontrol Sci Technol 16:181–193 137. Mennan S, Chen SY, Melakeberhan H (2007) Effects of Hirsutella minnesotensis and N-Viro Soil (R) on populations of Meloidogyne hapla. Biocontrol Sci Technol 17:233–246 138. Jansson H-B, Jeyaprakash A, Zuckerman BM (1985) Control of root knot nematodes on tomato by the endoparasitic fungus Meria coniospora. J Nematol 17:327–329 139. Dijksterhuis J, Veenhuis M, Harder W (1993) Conidia of the nematophagous fungus Drechmeria coniospora adhere to but barely infect Acrobeloides buetschlii. FEMS Microbiol Lett 113:183–188 140. Davies KG, Laird V, Kerry BR (1991) The motility, development and infection of Meloidogyne incognita encumbered with spores of the obligate hyperparasite Pasteuria penetrans. Rev Nematol 14:611–618 141. van den Boogert PHJF, Velvis H, Ettema CH, Bouwman LA (1994) The role of organic matter in the population dynamics of the endoparasitic nematophagous fungus Drechmeria coniospora in microcosms. Nematologica 40:249–257 142. Durschner U (1983) Pilzliche Endoparasiten an beweglichen Nematodenstadien. Mitt Biol Bundesanst Ld- u Forstw 217:1–83 143. Jansson H-B, Hofsten AV, Mecklenburg CV (1984) Life cycle of the endoparasitic nematophagous fungus Meria coniospora: a light and electron microscopic study. Ant v Leeuwenhoek 50:321–327 144. Jansson H-B, Dackman C, Zuckerman BM (1987) Adhesion and infection of plant parasitic nematodes by the fungus Drechmeria coniospora. Nematologica 33:480–487 145. Dijksterhuis J, Harder W, Wyss U, Veenhuis M (1991) Colonization and digestion of nematodes by the endoparasitic nematophagous fungus Drechmeria coniospora. Mycol Res 95:873–878 146. Jansson H-B, Jeyaprakash A, Zuckerman BM (1985) Differential adhesion and infection of nematodes by the endoparasitic fungus Meria coniospora (Deuteromycetes). Appl Environ Microbiol 49:552–555 147. Jansson H-B (1994) Adhesion of conidia of Drechmeria coniospora to Caenorhabditis elegans wild type and mutants. J Nematol 26:430–435 148. Jansson H-B (1993) Adhesion to nematodes of conidia from the nematophagous fungus Drechmeria coniospora. J Gen Microbiol 139:1899–1906 149. Saikawa M (1982) An electron microscope study of Meria coniospora, an endozoic nematophagous Hyphomycete. Can J Bot 60:2019–2023 150. Jansson H-B, Nordbring-Hertz B (1983) The endoparasitic fungus Meria coniospora infects nematodes speciﬁcally at the chemosensory organs. J Gen Microbiol 129:1121–1126 151. Poinar GO, Jansson H-B (1986) Susceptibility of Neoaplectana spp. and Heterorhabditis heliothidis to the endoparasitic fungus Drechmeria coniospora. J Nematol 18:225–230 152. Jansson H-B, Nordbring-Hertz B (1984) Involvement of sialic acid in nematode chemotaxis and infection by an endoparasitic nematophagous fungus. J Gen Microbiol 130:39–43 153. Dijksterhuis J, Veenhuis M, Harder W (1990) Ultrastructural study of adhesion and initial stages of infection of nematodes by conidia of Drechmeria coniospora. Mycol Res 94:1–8

102

M.R. Moosavi and R. Zare

154. Sjollema K, Dijksterhuis J, VeenhuisM HW (1993) An electron microscopical study of the infection of the nematode Panagrellus redivivus by the endoparasitic fungus Verticillium balanoides. Mycol Res 97:479–484 155. Lackey BA, Jaffee BA, Muldoon AE (1992) Sporulation of the nematophagous fungus Hirsutella rhossiliensis from hyphae produced in vitro and added to soil. Phytopathology 82:415–420 156. Wang B, Wu WP, Liu XZ (2007) Puriﬁcation and characterization of a neutral serine protease with nematicidal activity from Hirsutella rhossiliensis. Mycopathologia 163:169–176 157. Kerry BR (1988) Fungal parasites of cyst nematodes. Agric Ecosyst Environ 24:293–305 158. Stirling GR, West LM (1991) Fungal parasites of root-knot nematode eggs from tropical and sub-tropical regions of Australia. Aust Plant Pathol 20:149–154 159. Walter DE, Kaplan DT (1990) Antagonists of plant-parasitic nematodes in Florida citrus. J Nematol 22:567–573 160. Gintis BO, Morgan-Jones G, Rodriguez-Kabana R (1983) Fungi associated with several developmental stages of Heterodera glycines from an Alabama soybean ﬁeld soil. Nematropica 13:181–200 161. de Leij FAAM, Kerry BR (1991) The nematophagous fungus Verticillium chlamydosporium as a potential biological control agent for Meloidogyne arenaria. Rev Nematol 14:157–164 162. Freire FCO, Bridge J (1985) Parasitism of eggs, females and juveniles of Meloidogyne incognita by Paecilomyces lilacinus and Verticillium chlamydosporium. Fitopatol Braz 10:577–596 163. Morgan-Jones G, Godoy G, Rodriguez-Kabana R (1981) Verticillium chlamydosporium fungal parasite of Meloidogyne arenaria females. Nematropica 11:115–119 164. Morgan-Jones G, White JF Jr, Rodriguez-Kabana R (1983) Phytonematode pathology: ultrastructural studies I: parasitism of Meloidogyne arenaria eggs by Verticillium chlamydosporium. Nematropica 13:245–260 165. Rodriguez-Kabana R, Morgan-Jones G, Godroy G, Gintis BO (1984) Effectiveness of species of Gliocladium, Paecilomyces and Verticillium for control of Meloidogyne arenaria in ﬁeld soil. Nematropica 14:155–170 166. Kerry BR (1989) Fungi as biological control agents for plant parasitic nematodes. In: Whipps JM, Lumsden RD (eds) Biotechnology of fungi for improving plant growth. Cambridge University Press, Cambridge 167. Kerry BR (1990) An assessment of progress toward microbial control of plant-parasitic nematodes. J Nematol 22(4S):621–631 168. Tribe HT (1979) Extent of disease in populations of Heterodera, with especial reference to H. schachtii. Ann Appl Biol 92:61–72 169. Tribe HT (1980) Prospects for the biological control of plant-parasitic nematodes. Parasitology 81:619–639 170. Zare R, Gams W (2001) A revision of Verticillium section Prostrata. IV. The genera Lecanicillium and Simplicillium gen. nov. Nova Hedwigia 73:1–50 171. Zare R, Gams W (2004) A monograph of Verticillium section Prostrata. Rostaniha 3:1–188 172. Sung GH, Hywel-Jones NL, Sung JM, Jennifer Luangsa-ard J, Shrestha B, Spatafora JW (2007) Phylogenetic classiﬁcation of Cordyceps and the clavicipitaceous fungi. Stud Mycol 57:5–59 173. Moosavi MR, Zare R, Zamanizadeh HR, Fatemy S (2010) Pathogenicity of Pochonia species on eggs of Meloidogyne javanica. J Invertebr Pathol 104:125–133 174. Asadolahpour M, Zafari D, Zare R (2008) First report of Lecanicillium psalliotae as an entomogenous fungus from Iran. Rostaniha 9(2):260–262 (English 119) 175. Zare R, Asef MR (2004) First report of Lecanicillium muscarium from Iran. Rostaniha 5:49–50 176. Zare R, Gams W (2003) Lecanicillium lecanii. IMI Descriptions Fungi Bacteria 1565:3 pp 177. Fassatiova O, Lysek H (1982) Ovicidal fungi in soil ecological system. Acta Univ Carol Biol 9:297–334 178. Zare R, Gams W, Evans HC (2001) A revision of Verticillium section Prostata. V. The genus Pochonia, with notes on Rotiferophthora. Nova Hedwigia 73:51–86

4 Fungi as Biological Control Agents of Plant-Parasitic Nematodes

103

179. Bursnall LA, Tribe HT (1974) Fungal parasitism in cysts of Heterodera. II. Egg parasites of H. schachtii. Trans Br Mycol Soc 62:595–601 180. Godoy G, Rodriguez-Kabana R, Morgan-Jones G (1982) Parasitism of eggs of Heterodera glycines and Meloidogyne arenaria by fungi isolated from cysts of H. glycines. Nematropica 12:111–119 181. Kerry BR (2001) Exploitation of the nematophagous fungus Verticillium chlamydosporium Goddard for the biological control of root-knot nematodes (Meloidogyne spp.). In: Butt TM, Jackson CW, Magan N (eds) Fungi as biocontrol agents. Progress, problems and potential. CABI, Wallingford 182. Morgan-Jones G, Rodriguez-Kabana R (1988) Fungi colonizing cysts and eggs. In: Poinar GO Jr, Jansson H-B (eds) Diseases of nematodes, vol II. CRC Press, Boca Raton 183. Dackman C, Nordbring-Hertz B (1985) Fungal parasites of the cereal cyst nematode Heterodera avenae in southern Sweden. J Nematol 17:50–55 184. Dackman C, Chet I, Nordbring-Hertz B (1989) Fungal parasitism of the cyst nematode Heterodera schachtii: infection and enzymatic activity. FEMS Microbiol Ecol 62:201–208 185. Gams W (1988) A contribution to the knowledge of nematophagous species of Verticillium. Neth J Plant Pathol 94:123–148 186. Juhl M (1982) Cereal cyst nematode, soil heating and fungal parasitism. EPPO Bull 12:505–511 187. Orion D, Kritzman G (1991) Antimicrobial activity of Meloidogyne javanica gelatinous matrix. Rev Nematol 14:481–483 188. Gaspard JT, Jaffee BA, Ferris H (1990) Association of Verticillium chlamydosporium and Paecilomyces lilacinus with root-knot nematode infested soil. J Nematol 22:207–213 189. Irving F, Kerry BR (1986) Variation between strains of the nematophagous fungus, Verticillium chlamydosporium. Nematologica 32:474–485 190. Bourne JM, Kerry BR, de Leij FAAM (1996) The importance of the host plant on the interaction between root-knot nematodes (Meloidogyne spp.) and the nematophagous fungus, Verticillium chlamydosporium Goddard. Biocontrol Sci Technol 6:539–548 191. Kerry BR, Crump DH (1998) The dynamics of the decline of the cereal cyst nematode, Heterodera avenae, in four soils under intensive cereal production. Fundam Appl Nematol 21:617–625 192. Kerry BR (1995) Ecological considerations for the use of the nematophagous fungus, Verticillium chlamydosporium, to control plant parasitic nematodes. Can J Bot 73(Supp 1):S65–S70 193. Atkins SD, Hidalgo-Diaz L, Clark IM, Morton CO, Montes de Oca N, Gray PA, Kerry BR (2003) Approaches for monitoring the release of Pochonia chlamydosporia var. catenulata, a biocontrol agent of root-knot nematodes. Mycol Res 107:206–212 194. Gaspard JT, Jaffee BA, Ferris H (1990) Meloidogyne incognita survival in soil infested with Paecilomyces lilacinus and Verticillium chlamydosporium. J Nematol 22:176–181 195. Kerry BR, Kirkwood IA, de Leij FAAM, Barba J, Leijdens MB, Brookes PC (1993) Growth and survival of Verticillium chlamydosporium Goddard, a parasite of nematodes, in soil. Biocontrol Sci Technol 3:355–365 196. Hernandez MA, Hidalgo-Diaz L (2008) KlamiC®: agricultural bionematicida from the fungus Pochonia chlamydosporia var. catenulata. Rev Proteccion Veg 23:131–134 197. Lòpez-Llorca LV (1990) Puriﬁcation and properties of extracellular proteases produced by the nematophagous fungus Verticillium suchlasporium. Can J Microbiol 36:530–537 198. Lòpez-Llorca LV, Duncan GH (1988) A scanning electron microscopy study of fungal endoparasitism of cereal cyst nematode (Heterodera avenae). Can J Microbiol 34:613–619 199. Bhardwaj P, Trivedi PC (1996) Biological control of Heterodera avenae on wheat using different inoculum levels of Verticillium chlamydosporium. Ann Plant Prot Sci 4:111–114 200. de Leij FAAM, Kerry BR, Dennehy JA (1993) Verticillium chlamydosporium as a biological control agent for Meloidogyne incognita and M. hapla in pot and microplot tests. Nematologica 39:115–126 201. Lysek H, Krajci D (1987) Penetration of ovicidal fungus Verticillium chlamydosporium through the Ascaris lumbricoides egg-shells. Folia Parasitol 34:57–60

104

M.R. Moosavi and R. Zare

202. Barron GL, Onions AHS (1966) Verticillium chlamydosporium and its relationships to Diheterospora, Stemphyliopsis, and Paecilomyces. Can J Bot 44:861–869 203. Tribe HT (1977) Pathology of cyst-nematodes. Biol Rev Camb Philos Soc 52:477–507 204. Kerry BR, Evans K (1996) New strategies for the management of plant-parasitic nematodes. In: Hall R (ed) Principles and practice of managing soilborne plant pathogens. APS Press, St Paul 205. Willcox J, Tribe HT (1974) Fungal parasitism in cysts of Heterodera. 1. Preliminary investigations. Trans Br Mycol Soc 62:585–594 206. Rao MS, Kerry BR, Gowen SR, Bourne JM, Parvatha Reddy P (1997) Management of Meloidogyne incognita in tomato nurseries by integration of Glomus deserticola with Verticillium chlamydosporium. Z PﬂKrankh PﬂSchutz 104:419–422 207. Reddy PP, Rao MS, Nagesh M (1999) Eco-friendly management of Meloidogyne incognita on tomato by integration of Verticillium chlamydosporium with neem and Calotropis leaves. Z PﬂKrankh PﬂSchutz 106:530–533 208. Siddiqui ZA, Mahmood I (1996) Biological control of Heterodera cajani and Fusarium udum on pigeonpea by Glomus mosseae, Trichoderma harzianum and Verticillium chlamydosporium. Isr J Plant Sci 44:49–56 209. Kerry BR, Crump DH, Mullen LA (1982) Natural control of the cereal cyst nematode, Heterodera avenae Woll., by soil fungi at three sites. Crop Prot 1:99–109 210. Kok CJ, Papert A, Hok-A-Hin CH (2001) Microﬂora of Meloidogyne egg masses: species composition, population density and effect on the biocontrol agent Verticillium chlamydosporium. Nematology 3:729–734 211. Monfort E, Lòpez-Llorca LV, Jansson H-B, Salinas J (2006) In vitro soil receptivity assays to egg-parasitic nematophagous fungi. Mycol Progress 5:18–23 212. Bourne JM, Kerry BR (1999) Effect of the host plant on the efﬁcacy of Verticillium chlamydosporium as a biological control agent of root-knot nematodes at different nematode densities and fungal application rates. Soil Biol Biochem 31:75–84 213. Davies KG, de Leij FAAM, Kerry BR (1991) Microbial agents for the biological control of plant parasitic nematodes in tropical agriculture. Trop Pest Manag 37:303–320 214. de Leij FAAM, Kerry BR, Dennehy JA (1992) The effect of fungal application rate and nematode density on the effectiveness of Verticillium chlamydosporium as a biological control agent for Meloidogyne incognita. Nematologica 38:112–122 215. Bourne JM, Kerry BR, de Leij FAAM (1994) Methods for the study of Verticillium chlamydosporium in the rhizosphere. J Nematol 26:587–591 216. Hirsch PR, Atkins SD, Mauchline TH, Davies KG, Kerry BR (2001) Techniques for studying nematophagous fungi in the root environment. Plant Soil 232:21–30 217. Crump DH, Kerry BR (1981) A quantitative method for extracting resting spores of two nematode parasitic fungi, Nematophthora gynophila and Verticillium chlamydosporium, from soil. Nematologica 27:330–339 218. Kerry BR, Crump DH (1977) Observations on fungal parasites of females and eggs of the cereal cyst-nematode, Heterodera avenae, and other cyst nematodes. Nematologica 23:193–201 219. Nicolay R, Sikora RA (1989) Techniques to determine the activity of fungal egg parasites of Heterodera schachtii in ﬁeld soil. Rev Nematol 12:97–102 220. Hirsch PR, Mauchline TH, Mendum TA, Kerry BR (2000) Detection of the nematophagous fungus Verticillium chlamydosporium in nematode-infested plant roots using PCR. Mycol Res 104:435–439 221. Mauchline TH, Kerry BR, Hirsch PR (2002) Quantiﬁcation in soil and the rhizosphere of the nematophagous fungus Pochonia chlamydosporia by competitive PCR and comparison with selective plating. Appl Environ Microbiol 68:1846–1853 222. Huang X, Zhao N, Zhang K (2004) Extracellular enzymes serving as virulence factors in nematophagous fungi involved in infection of the host. Res Microbiol 155:811–816 223. Lòpez-Llorca LV, Olivares-Bernabeu C (1998) Metabolites inﬂuencing pathogenicity of nematophagous fungi. In: Bridge P, Couteaudier Y, Clarkson J (eds) Molecular variability of fungal pathogens. CAB International, Wallingford

4 Fungi as Biological Control Agents of Plant-Parasitic Nematodes

105

224. Lòpez-Llorca LV, Robertson WM (1992) Ultrastructure of infection of cyst nematode eggs by the nematophagous fungus Verticillium suchlasporium. Nematologica 39:65–74 225. Zare R, Gams W (2007) Pochonia globispora sp. nov. Nova Hedwigia 84:421–428 226. Drechsler C (1942) Two zoophagous species of Acrostalagmus with multicellular Desmidiospora-like chlamydospores. J Wash Acad Sci 32:343–350 227. de Hoog GS, Guarro J, Gene J, Figueras MJ (2000) Atlas of clinical fungi, 2nd edn. Centraalbureau voor Schimmelcultures, Utrecht 228. Wessolossky M, Harana JP, Bagchi K (2008) Paecilomyces lilacinus olecranon bursitis in an immunocompromised host: case report and review. Diagn Microbiol Infect Dis 61:354–357 229. Basualdo JA, Ciarmela ML, Sariento PL, Minvielle MC (2000) Biological activity of Paecilomyces genus against Toxocara canis eggs. Parasitol Res 86:854–859 230. Lysek H (1976) Autodehelminthization of soil in lowland deciduous forests. Universitatis Palackianae Olomucensis Facultatis Medicae 41:73–106 231. Jatala P, Kaltenbach R, Bocangel M (1979) Biological control of Meloidogyne incognita acrita and Globodera pallida on potatoes (abstr). J Nematol 11:303 232. Hewlett TE, Dickson DW, Mitchell DJ, Kannwischer-Mitchell ME (1988) Evaluation of Paecilomyces lilacinus as a biocontrol agent of Meloidogyne javanica on tobacco. J Nematol 20:578–584 233. Dunn MT, Sayre RM, Carrell A, Wergin WP (1982) Colonization of nematode eggs by Paecilomyces lilacinus (Thom) Samson as observed with scanning electron microscope. Scanning Electron Microsc 3:1351–1357 234. Gunasekera TS, Holland RJ, Gillings MR, Briscoe DA, Neethling DC, Williams KL, Nevalainen KMH (2000) Phenotypic and genetic characterization of Paecilomyces lilacinus strains with biocontrol activity against root-knot nematodes. Can J Microbiol 46:775–783 235. Cannayane I, Sivakumar CV (2001) Nematode egg-parasitic fungus 1: Paecilomyces lilacinus – a review. Agric Rev 22:79–86 236. Brand D, Roussos S, Pandey A, Zilioli PC, Pohl J, Soccol CR (2004) Development of a bionematicide with Paecilomyces lilacinus to control Meloidogyne incognita. Appl Biochem Biotechnol 118:81–88 237. Anastasiadis IA, Giannakou IO, Prophetou-Athanasiadou DA, Gowen SR (2008) The combined effect of the application of a biocontrol agent Paecilomyces lilacinus, with various practices for the control of root-knot nematodes. Crop Prot 27:352–361 238. Segers R, Butt TM, Carder JH, Keen JN, Kerry BR, Peberdy JF (1999) The subtilisins of fungal pathogens of insects, nematodes and plants: distribution and variation. Mycol Res 103:395–402 239. Reddy PP, Khan RM (1988) Evaluation of Paecilomyces lilacinus for the biological control of Rotylenchus reniformis infecting tomato, compared with carbofuran. Nematol Mediterr 16:113–115 240. Cabanillas E, Barker KR (1989) Impact of Paecilomyces lilacinus inoculum level and application time on control of Meloidogyne incognita on tomato. J Nematol 21:115–120 241. Cabanillas E, Barker KR, Nelson LA (1989) Growth of isolates of Paecilomyces lilacinus and their efﬁcacy in biocontrol of Meloidogyne incognita on tomato. J Nematol 21:164–172 242. Jatala P, Salas R, Kaltenback R, Bocangel M (1981) Multiple application and long-term effect of Paecilomyces lilacinus in controlling Meloidogyne incognita under ﬁeld conditions (abstr). J Nematol 13:445 243. Prabhu S, Kumar S, Subramanian S (2007) Mass production and commercial formulation of Paecilomyces lilacinus. Ann Plant Prot Sci 14:444–447 244. Kiewnick S (2006) Multitrophic interactions of Paecilomyces lilacinus strain 251 in the rhizoshere of host and non-host plants. IOBC/WPRS Bull 29:53–61 245. Kiewnick S (2007) Importance of multitrophic interactions for the efﬁcacy of Paecilomyces lilacinus strain 251 to control root-knot nematodes. J Nematol 39:72 246. Kiewnick S, Sikora R (2004) Optimizing the efﬁcacy of Paecilomyces lilacinus (strain 251) for the control of root-knot nematodes. Commun Agric Appl Biol Sci 69:373–380

106

M.R. Moosavi and R. Zare

247. Kiewnick S, Sikora R (2006) Evaluation of Paecilomyces lilacinus strain 251 for the biological control of the northern root-knot nematode Meloidogyne hapla Chitwood. Nematology 8:69–78 248. EPA, US (Environmental Protection Agency) (2005) Paecilomyces lilacinus strain 251; exemption from the requirement of a tolerance. US Fed Regist 70:19278–19283 249. Uziel A, Sikora RA (1992) Use of non-target isolates of the entomopathogen Verticillium lecanii (Zimm.) Viégas to control the potato cyst nematode, Globodera pallida (Stone). Nematologica 38:123–130 250. Meyer SLF, Wergin WP (1998) Colonization of soybean cyst nematode females, cysts, and gelatinous matrices by the fungus Verticillium lecanii. J Nematol 30:436–450 251. Wharton DA (1980) Nematode egg-shells. Parasitology 81:447–463 252. Perry RN (2002) Hatching. In: Lee DL (ed) The biology of nematodes. Taylor & Francis, London 253. Morton CO, Hirsch PR, Peberdy JP, Kerry BR (2003) PCR-based DNA ﬁngerprinting indicates host-related genetic variation in the nematophagous fungus Pochonia chlamydosporia. Mycol Res 107:198–205 254. Segers R, Butt TM, Kerry BR, Beckett A, Peberdy JF (1996) The role of the proteinase VCP1 produced by the nematophagous Verticillium chlamydosporium in the infection process of nematode eggs. Mycol Res 100:421–428 255. Dackman C (1990) Fungal parasites of the potato cyst nematode Globodera rostochiensis: isolation and reinfection. J Nematol 22:594–597 256. Lòpez-Llorca LV, Olivares-Bernabeu C, Salinas J, Jansson H-B, Kolattukudy PE (2002) Prepenetration events in fungal parasitism of nematode eggs. Mycol Res 106:499–506 257. Morton CO, Hirsch PR, Kerry BR (2004) Infection of plant-parasitic nematodes by nematophagous fungi – a review of the application of molecular biology to understand infection processes and to improve biological control. Nematology 6:161–170 258. Esteves I, Peteira B, Atkins SD, Magan N, Kerry B (2009) Production of extracellular enzymes by different isolates of Pochonia chlamydosporia. Mycol Res 113:867–876 259. Palma-Guerrero J, Gomez-Vidala S, Tikhonov VE, Salinas J, Jansson HB, Lòpez-Llorca LV (2010) Comparative analysis of extracellular proteins from Pochonia chlamydosporia grown with chitosan or chitin as main carbon and nitrogen sources. Enzyme Microb Tech 46:568–574 260. Arora DK, Hirsch PR, Kerry BR (1996) PCR-based molecular discrimination of Verticillium chlamydosporium isolates. Mycol Res 100:801–809 261. Siezen RJ, Leunissen JAM (1997) Subtilases: the superfamily of subtilisin-like serine proteases. Protein Sci 6:501–523 262. Khan A, Williams KL, Nevalainen HKM (2004) Effects of Paecilomyces lilacinus protease and chitinase on the eggshell structures and hatching of Meloidogyne javanica juveniles. Biol Control 31:346–352 263. Morgan-Jones G, White JF, Rodriguez-Kabana R (1984) Phytonematode pathology: ultrastructural studies II. Parasitism of Meloidogyne arenaria eggs and larvae by Paecilomyces lilacinus. Nematropica 14:57–71 264. Dong LQ, Yang JK, Zhang KQ (2007) Cloning and phylogenetic analysis of the chitinase genes from the facultative pathogen Paeclilomyces lilacinus. J Appl Microbiol 103:2476–2488 265. Kerry BR, Crump DH (1980) Two fungi parasitic on females of cyst nematodes (Heterodera spp.). Trans Br Mycol Soc 74:119–125 266. Graff NJ, Madelin MF (1989) Axenic culture of the cyst-nematode parasitising fungus, Nematophthora gynophila. J Invert Pathol 53:301–306 267. Thorn RG, Barron GL (1984) Carnivorous mushrooms. Science 224:76–78 268. Kwok OCH, Plattner R, Weisleder D, Wicklow DT (1992) A nematicidal toxin from Pleurotus ostreatus NRRL 3526. J Chem Ecol 18:127–136 269. Luo H, Mo M, Huang X, Li X, Zhang K (2004) Coprinus comatus: a basidiomycete fungus forms novel spiny structures and infects nematodes. Mycologia 96:1218–1225

4 Fungi as Biological Control Agents of Plant-Parasitic Nematodes

107

270. Djian C, Pijarowski L, Ponchet M, Arpin N, Favrebonvin J (1991) Acetic-acid a selective nematocidal metabolite from culture ﬁltrates of Paecilomyces lilacinus (Thom) Samson and Trichoderma longibrachiatum Rifai. Nematologica 37:101–112 271. Anderson MG, Jarman TB, Rickards RW (1995) Structures and absolute conﬁgurations of antibiotics of the oligosporon group from the nematode-trapping fungus Arthrobotrys oligospora. J Antibiot 48:391–398 272. Casas-Flores S, Herrera-Estrella A (2007) Antagonism of plant parasitic nematodes by fungi. In: Kubicek CP, Druzhinina IS (eds) The mycota VI: environmental and microbial relationships, 2nd edn. Springer, Berlin 273. Bernard EC, Gwinn KD (1991) Behaviour and reproduction of Meloidogyne marylandi and Pratylenchus scribneri in roots and rhizosphere of endophyte-infected tall fescue. J Nematol 23:520 274. Hallmann J, Sikora RA (1994) Occurrence of plant parasitic nematodes and non-pathogenic species of Fusarium in tomato plants in Kenya and their role as mutualistic synergists for biological control of root-knot nematodes. Int J Pest Manag 40:321–325 275. Schuster R-P, Sikora RA, Amin N (1995) Potential of endophytic fungi for the biological control of plant parasitic nematodes. Meded Fac Landbouwk Toegep Biol Wetenschappen Univ Gent 60:1047–1052 276. Stiles CM, Glawe DA (1989) Colonisation of soybean roots by fungi isolated from cysts of Heterodera glycines. Mycologia 81:797–799 277. Pinochet J, Calvet C, Camprubi A, Fernandez C (1996) Interactions between migratory endoparasitic nematodes and arbuscular mycorrhizal fungi in perennial crops: a review. Plant Soil 185:183–190 278. Siddiqui ZA, Mahmood I (1995) Role of plant symbionts in nematode management: a Review. Bioresour Technol 54b:217–226 279. Sikora RA, Carter WW (1987) Nematode interactions with fungal and bacterial plant pathogens – fact or fantasy. In: Veech JA, Dickson DW (eds) Vistas on nematology. Society of Nematologists, Hyattsville 280. Hol WHG, Cook R (2005) An overview of arbuscular mycorrhizal fungi–nematode interactions. Basic Appl Ecol 6:489–503 281. Oostendorp M, Sikora RA (1989) Seed treatment with antagonistic rhizobacteria for the suppression of Heterodera schachtii early root infection of sugar beet. Rev Nematol 12:77–83 282. Lòpez-Llorca LV, Jansson H-B (2006) Fungal parasites of invertebrates: multimodal biocontrol agents. In: Robson GD, van West P, Gadd GM (eds) Exploitation of fungi. Cambridge University Press, Cambridge 283. Lòpez-Llorca LV, Bordallo JJ, Salinas J, Monfort E, Lòpez-Serna ML (2002) Use of light and scanning electron microscopy to examine colonisation of barley rhizosphere by the nematophagous fungus Verticillium chlamydosporium. Micron 33:61–67 284. Drechsler C (1933) Morphological diversity among fungi capturing and destroying nematodes. J Wash Acad Sci 23:138–141 285. Drechsler C (1941) Some hyphomycetes parasitic on free-living terricolous nematodes. Phytopathology 31:773–802 286. Drechsler C (1969) A nematode-destroying species of Cephalosporiopsis. Sydowia 22(1968):194–198 287. Drechsler C (1971) A nematode-destroying parasite bearing lageniform conidiiferous branches on endozoic hyphae. Sydowia 24(1970):173–176 288. Gray NF (1982) Psychro-tolerant nematophagous fungi from the maritime Antarctic. Pl Soil 64:431–435 289. Letcher PM, Powell MJ, Churchill PF, Chambers JG (2006) Ultrastructural and molecular phylogenetic delineation of a new order, the Rhizophydiales (Chytridiomycota). Mycol Res 110:898–915 290. Persmark L, Jansson H-B (1997) Nematophagous fungi in the rhizosphere of agricultural crops. FEMS Microbiol Ecol 22:303–312

sdfsdf

Chapter 5

Secondary Metabolites and Plant Defence Shaily Goyal, C. Lambert, S. Cluzet, J.M. Mérillon, and Kishan G. Ramawat

Abstract Infected or elicited plants accumulate an array of plant defensive compounds. Now-a-days, it is well accepted that plant SECONDARY METABOLITES are involved in this plant defence system. The process of inducing resistance using elicitors is environmental friendly and is advantageous over the chemical based pesticides. It is like stimulation of the plant’s own “immune” potential rather than on suppression of pathogens. The resistance developed in this way has prolonged effect. This strategy could be an alternative solution to reduce the use of pesticides. Keywords 0LANTDEFENCEs%LICITORSs)SOmAVONESs3TILBENES

5.1

Introduction

In nature, plants protect themselves against pathogen attack mainly by mechanical and chemical defences. Mechanical defences include structures such as spines, trichomes, thick cuticle, and hard, sticky, or smooth surfaces which prevent pathogens from picking for food or laying eggs. Chemical defences include a variety of substances that are toxic, repellent, or that render plant tissues indigestible to

3'OYALs+'2AMAWAT*) Laboratory of Bio-Molecular Technology, Department of Botany, M.L. Sukhadia University, Udaipur 313001, India e-mail: [email protected] #,AMBERTs3#LUZETs*--£RILLON GESVAB – EA 3675, Institut des Sciences de la Vigne et du Vin, University of Bordeaux, CS50008, 210, Chemin de Leysotte, Villenave d’Ornon, F-33882, France e-mail: [email protected]

J.M. Mérillon and K.G. Ramawat (eds.), Plant Defence: Biological Control, Progress in Biological Control 12, DOI 10.1007/978-94-007-1933-0_5, © Springer Science+Business Media B.V. 2012

109

110

S. Goyal et al.

animals [1]. Chemical defence due to secondary metabolites is prominently developed in plants, providing protection to the plant [2]. Mechanical and chemical defence can be either independent of each other [3] or they can work in combination such as glandular trichomes and secretory canals. They interact to entrap pathogen in sticky and toxic secretions [4]. Many plants produce resins, gum, lattices and mucilage, which are stored under pressure in networks of canals throughout the cortex of the stems and in the leaves, where they follow the vascular bundles. These secretions are rich in several secondary metabolites: for example, oleoresin present in Abies grandis is a complex mixture of monoterpenes, sesquiterpenes and diterpenoid acids, used to deter insect pests and their symbiotic fungal pathogens [5]. Some Bursera species resins, rich in mostly monoterpenes and sesquiterpenes [6] are under considerable pressure, and so when a leaf is damaged, resin may be released in a spectacular syringe- like squirt. This squirt may travel up to 2 m and lasts a few seconds, so it represents a good example of mechanical and chemical defence interaction [7]. Some species of Asclepias (milkweeds) latex contains cardenolides and cardiac glucosides which help the plant in defence response [8]. These toxic steROIDSHAVEANINTERESTINGUSEINMONARCHBUTTERmIES!DULTMONARCHBUTTERmIESSTORE the cardenolides they have built-up during their larval stage, feeding mostly on Asclepias 4HIS STORED CARDENOLIDE CONTENT IN BUTTERmIES DETERS THEM FROM THEIR vertebrate predators. The chemical defence can be further classiﬁed as constitutive and inducible chemical defences. The term constitutive means that the defence is present in the plant whether the predator attacks or not. Many constitutive defence chemicals are produced by epidermal hairs that can trap and kill insect larvae. Inducible systems are those that are absent before a pathogen or predator attack, but are induced when the attack occurs. Defence related responses can occur in the plant organ originally attacked (local response) or in distant unaffected parts (systemic response). Examples of chemical defences can be found in article by Field and co-workers [9]. Plants can have a compatible response towards its pathogen, where their contact lead to a successful infection, or they can have a non-compatible response where a plant and pathogen contact lead to a non-successful infection. In incompatible interactions, infection by pathogens inducts a set of local responses in and around the infected host cell which can lead to cell death [10]. Thus, the pathogen may be “trapped” in dead cells and this prevents the infection from being spread. Local responses in the cells include oxidative burst, changes in cell wall composition that can inhibit penetration by the pathogen, and de novo synthesis of antimicrobial compounds such as phytoalexins and pathogenesis related (PR) proteins. Phytoalexins are mainly characteristics of the local response, PR proteins occur both locally and systemically [11]. The aim of this review is to reveal new avenues of research in the area of elicitor imparted secondary metabolites production in plants which provide them resistance against diseases.

5

Secondary Metabolites and Plant Defence

5.2

111

Secondary Metabolites and Defence

Plants (>300,000 species) and insects (likely >1,000,000 species) have co-evolved, still plants dominate the landscape [12]. This is due to the presence of secondary metabolites that make the plants both repellent and toxic to most pathogens, insects ANDOTHERGRAZINGANIMALS3ECONDARYMETABOLITESARETHEMOLECULESTHATAPPEARTO be dispensable for normal growth, or are required only under particular conditions, whereas primary metabolites are involved in the physiological functions. These secondary products are the key components of active and potent defence mechanisms in plants [13, 14]. They are the active part of the chemical war between plants and their pathogens. About 1–10% of the dry mass of some plants is made up of chemicals designed FORDEFENCEAGAINSTPREDATORS0LANTSSYNTHESIZEAHUGEARRAYAROUNDSEVERALTENSOF thousands) of different secondary metabolites [14=3YNTHESIZINGAPARTICULARCHEMical so that it accumulates in the plant to a signiﬁcant level has an associated cost. Various biosynthetic pathways are involved in secondary metabolites production and there is requirement of substantial amount of ATP. Besides their synthesis during the time of attack by pathogen, their storage in the vacuole requires energy as well. The energy for uphill transport and often for trapping the metabolite in the vacuole is provided by H+ – ATPase. In addition, some metabolites are transported into the vacuole with the help of ATP-binding cassette transporters (ABC-transporter) which depend on ATP [15]. It can be seen that if the cost of producing a defence compound is minimal and allows the plant that produces it to leave more offspring, then that plant has a greater evolutionary ﬁtness than its non-defended colleagues. This can readily be demonstrated by partially defoliating plants or giving them a mild bacterial, fungal, or viral infection. Such plants grow much less vigorously and produce fewer seeds. However, if secondary metabolisms have not been very important in the biology of different organisms, evolution would not have selected and maintained the complex pathways leading to secondary metabolism [14]. Most of the secondary metabolites are derived from the isoprenoid, phenylpropanoid, alkaloid or fatty acid/polyketide pathways [14, 16]. It is observed that related plant families generally make use of related chemical structures for defence, EGSESQUITERPENESINTHE3OLANACEAE STILBENESINTHE6ITACEAE ISOmAVONESINTHE Leguminosae, sulfur-based glucosinolate–myrosinase in the Brassicaceae and limonoids among members of the families Meliaceae and Rutaceae. In plants, the best understood secondary metabolites are implicated in pathogen defence, sensing and signaling. This list is continuously growing by the extensive use of biochemical and genetic approaches to reveal the undiscovered metabolites and their complex signaling pathways that mediate plant disease resistance. Pathogens, insects, and other parasites initially establish physical interactions with hosts via surface contact, and the plant surface initiate chemical signaling in response to it. The secondary metabolites content of the surface exempt of disease is also an important aspect to be studied in order to discover new defence molecules.

112

S. Goyal et al.

For that, accurate methods of detection and quantiﬁcation are required. Now-a-days DESORPTION ELECTROSPRAY IONIZATION MASS SPECTROMETRY $%3) -3 HAVE MADE possible ﬁne scale evaluation of compounds on native surfaces of the plants. Lane and co-workers [17] reported presence of bromophycolides, antimicrobial compounds, on the surface of macroalga Callophycus serratus in sufﬁcient quantity for inhibition of Lindra thalassiae, a marine fungal pathogen. Hamm and co-workers [18] have USEDLASERDESORPTIONIONISATIONTIME OF mIGHTMASSSPECTROMETRY,$) 4O&-3 TO ANALYZEPHYTOALEXINSATTHESURFACEOFVitis vinifera leaves. They have found that the amounts of resveratrol and pterostilbene are directly related to the degree of Plasmopara viticola contamination. Several large groups, such as phenolics, alkaloids, terpenoids, iridoid glycosides, cardenolides, and cyanogenic glycosides have been implicated in plant defence SYSTEMS4HELITERATUREONSECONDARYMETABOLITESISEXTENSIVE(EREWESUMMARIZED phenolics related to plant defence system.

5.3

Phenolics and Disease Resistance

Phenolics are represented by having at least one aromatic ring with one or more hydroxyl groups attached, and are widely present throughout the plant kingdom [19]. They are known to contribute to pigmentation of different organs along with their role against different biotic and abiotic stresses [20]. Phenolics occurring NATURALLYINPLANTTISSUECANBECLASSIlEDINTOTWOGROUPS THEmAVONOIDSANDTHE NON mAVONOIDS $EPENDINGONTHESTRUCTURALCOMPLEXITYOFmAVONOIDSWITHANESTIMATED structurally different members), particularly on the oxidation state of the central ring C, mAVONOIDSARETHEMSELVESSUBCLASSIlEDASmAVONOLS mAVONES mAVAN OLSCATECHINS ANDTHEIROLIGOMERSPROANTHOCYANIDINS ANTHOCYANIDINS mAVANONESANDISOmAVONES AND THOSE THAT ARE PRESENT IN LESS QUANTITY IN DIET ARE DIHYDROmAVONOLS mAVAN 4-diols, chalcones, dihydrochalcones, and aurones [21] (Fig. 5.1). Majority of mAVONOIDS EXIST NATURALLY AS GLYCOSIDES "OTH THE HYDROXYL GROUPS AND SUGARS INCREASEWATERSOLUBILITYOFmAVONOIDS;22]. Flavonoids in general are polyphenolic compounds comprising of 15 carbons, with 2 aromatic rings connected by a 3-carbon bridge (C6–C3–C6). They consist mainly of 2-phenylchromans and also 3-phenylCHROMANS FOR ISOmAVONOIDS 4HE KEY ENZYME FOR THE FORMATION OF THE mAVONOID skeleton is chalcone synthase, which catalyses the stepwise condensation of three acetate units from malonyl-CoA with 4-coumaryl-CoA to the intermediate chalcone. Flavonoids play important role in defence against microorganisms and pests. There are many instances which describe their potent role in disease resistant. A recent investigation by Koskimäki and co-workers [23] observed that accumulation of individual phenolic compounds could be speciﬁc for a particular infection. They demonstrated biosynthesis of different phenolic compounds in bilberry (Vaccinium myrtillus) after infection by a fungal endophyte (Paraphaeosphaeria sp.) and a pathogen (Botrytis cinerea). A study of barley mutants showed that proanthocyanidins

5

Secondary Metabolites and Plant Defence

113

Fig. 5.1 "ASICmAVONOID structure and its derivatives

3' 2' 1 O

8' 9

6

5'

2

7

1'

C

A

4' B

6' 3

10 5

4 O

O

Isoflavone

O

O

Flavone

O

OH

Flavonol

O

O

Flavanones

O

O+

OH

Anthocyanidins

O

OH

Flavan-3-ol

114

S. Goyal et al.

and even small amounts of dihydroquercetin are involved in the defence against Fusarium species [24]. The wild species of groundnut, Arachis kempff-mercadoi is resistant to tobacco armyworm Spodoptera litureDUETOITSmAVONOLSQUERCETINAND its glycoside rutin [25=3IMILARLY NEMATODERESISTANCEINBANANAISDUETOmAVAN 3,4-diols and condensed tannins [26]. Flavonoids also play a major role in postharvest resistance of fruits and vegetables [27=(IGHCONCENTRATIONSOFmAVONOIDSMAINLYIN unripe fruits prevent them from pathogens; thus, ripe fruits are usually more sensible to fungal decay. 4HEREAREALSOSEVERALCLASSESOFNON mAVONOIDS DOMINATEDBYPHENYLPROPANOIDS containing only the C6−C3 phenylpropane skeleton and these compounds are directly linked to lignin (polymer phenyl propanoid) biosynthesis in vascular plants. The most important examples are cinnamic acids and their derivatives such as chlorogenic ACID P COUMARIC FERULICANDSINAPICACIDS!NOTHERCLASSOFNON mAVONOIDPOLYPHENOLS which are less frequently found in diets (except for the grapes and peanuts) is the stilbenes with C6–C2–C6 skeletons [28, 29=(YDROXYCINNAMICACIDSANDmAVONOID CLASSESAREWIDELYPRESENTINHIGHERPLANTSWHEREASCLASSESLIKEISOmAVONESEG Fabaceae) and stilbenes (e.g., 23 families only: Vitaceae, Cyperaceae, Dipterocarpaceae, Iridaceae, Fabaceae, Moraceae, Orchidaceae and Polygonaceae) are limited to particular families.

5.3.1

Isoﬂavones

)SOmAVONESARECHARACTERIZEDBYHAVINGTHE" RINGATTACHEDAT#3 rather than the C2 position [30] (Fig. 5.1 4ILLNOWABOUT ISOmAVONESHAVEBEENIDENTIlEDAND the list is continuously growing [31=4HEISOmAVONESLIKEDAIDZEIN GENISTEIN AND GLYCITEINARESYNTHESIZEDVIATHEPHENYLPROPANOIDPATHWAYANDSTOREDINTHEVACUOLE AS GLUCOSYL AND MALONYL GLUCOSE CONJUGATES 4HE PATHWAY TO DAIDZEIN BRANCHES from the phenylpropanoid pathway, that is common to most plants, following the chalcone synthase reaction (Fig. 5.2 THROUGHALEGUMESPECIlCENZYME CHALCONE reductase. Glycitein synthesis is likely to be derived from isoliquiritigenin. Genistein SYNTHESISSHARESTHENARINGENININTERMEDIATEWITHTHEmAVONOIDANTHOCYANINBRANCH of the phenylpropanoid pathway. In all cases, the unique aryl migration reaction to CREATETHEISOmAVONESISMEDIATEDBYISOmAVONESYNTHASE;32]. Oxidative rearrangeMENTOFNARINGENINmAVANONE WITHA ARYLSHIFTYIELDSTHEISOmAVONE4HEINITIATING STEP IN ISOmAVONE FORMATION MAY BE AN EPOXIDATION CATALYSED BY A CYTOCHROME p-450-dependent mono-oxygenase. After structural rearrangement, aryl shift and addition of a hydroxyl ion to C-2, elimination of water by a dehydratase gives the ISOmAVONESTRUCTURE$ETAILSOFISOmAVONESSTRUCTURECANBEFOUNDINTHEARTICLEOF Veitch, 2007 [31]. 4HESE COMPOUNDS WERE INITIALLY RECOGNIZED FOR THEIR ROLES IN PLANT DISEASE resistance and as signal molecules to promote Rhizobium nodulation [16]. They also serve as precursors for the production of major phytoalexins during plant –microbe interactions [33] and inhibit pathogen attack [34–37=)SOmAVONESHAVEDEMONSTRATED

5

Secondary Metabolites and Plant Defence

115

Phenylalanine Phenylalanineammonia lyase Cinnamate Cinnamic acid 4 - hydroxylase p- Coumarate 4-Coumarate:CoA ligase p - Coumarate -CoA Chalcone synthase

+ 3 malonylCoA Chalcone isomerase

Chalcone reductase Glycitein

Flavone synthase

Isoliquiritigenin

Chalcone isomerase

Isoflavone Genistein synthase Dihydroflavonol Flavonol

Liquiritigenin Isoflavone synthase Daidzein

Isoflavone hydroxylase Isoflavone reductase

Glyceollins

Flavone

Naringenin

Flavan-3,4- diol Anthocyanin synthase Flavan- 3 ,4- diol 4 reductase Condensed tannins Anthocyanins

Fig. 5.2 "IOSYNTHETICROUTEOFISOmAVONESPRODUCTION

EFlCIENTANTIMICROBIALANDANTIFUNGALACTIVITIES4HEISOmAVONESLIKEDAIDZEININHIBITS the growth of Fusarium culmorum, while glycitein and formononetin can reduce mycelial development in Aspergillus ochraceus [38]. Biochanin A and genistein exhibit antifungal activity against Rhizoctonia solani and Sclerotium rolfsii [39]. !NTIMICROBIAL AND ANTIFUNGAL PROPERTIES OF VARIOUS ISOmAVONES HAVE BEEN WELL DEMONSTRATED)SOmAVONESFROMSTEMBARKOFFlemingia paniculata [40] and from F. stropbilifera [41] showed signiﬁcant antibacterial activity. Extract of Tamarix gallica containing quercetin [42], Prunus Americana CONTAINING ISOmAVONES ;43] and Glycirrhiza glabra containing glabridin [44] showed promising antimicrobial activity. On elicitation by Aspergillus sojae, Soybean produced antifungal glyceollins [45] effective against Fusarium oxysporum, Phytophthora capsici, Sclerotina sclerotiorum and Botrytis cinerea WHILELACTOFENINDUCEDISOmAVONESWERECORRELATED with defence responses [46].

116

5.3.2

S. Goyal et al.

Stilbenes

3TILBENES ARE A GROUP OF PHENYLPROPANOID DERIVED COMPOUNDS CHARACTERIZED BY A 1,2-diphenylethylene backbone (C6–C2–C6). Stilbenes exist in the stereo isomeric forms (E and Z forms) depending on the position of where the functional groups are attached in relation to one another on either side of the double bond. Stilbenes constitute an important group of natural products that are of particular interest owing to their wide range of biological activities [47]. Combretastatins, piceatannol, pinosylvin, rhapontigenin, pterostilbene and resveratrol are some of the naturally occurring stilbenes. Of these, combretastatins and resveratrol have been extensively studied. Most plant stilbenes are derivatives of the basic unit trans-resveratrol (3,5,4-0-trihydroxy-stilbene). From this relatively simple structure, over a thousand STILBENOID COMPOUNDS HAVE BEEN CHARACTERIZED RESULTING FROM DIFFERENT CHEMICAL substitutions patterns like methylation, glycosylation or isoprenylation, in addition to oxidative condensations of monomers into dimers (for example viniferins) and subsequent condensations of these [48]. All higher plants seem to be able to syntheSIZEMALONYL #O!AND#O! ESTERSOFCINNAMMICACIDDERIVATIVES BUTONLYFEWPLANT species are able to produce stilbenes, as the stilbene synthase (STS), the fundamenTALENZYMEOFSTILBENESYNTHESIS ISPRESENTINALIMITEDNUMBEROFPLANTSPECIES FOR example Vitis spp., Arachis hypogea, Pinus spp., Rheum spp. and Fallopia spp. STS genes exist as a family of related genes in these plants [49]. Stilbene synthase cataLYZES IN A SINGLE REACTION THE BIOSYNTHESIS OF THE STILBENE BACKBONE FROM THREE malonyl-CoA and one CoA-ester of a cinnamic acid derivative (Fig. 5.3). Grapevine genome contains more than 20 STS genes [50] and nearly all of them are expressed in grape following infection with Plasmopara viticola [51]. Some plant species, such as Fallopia japonica (formely Polygonum cuspidatum), pine (Pinus spp.) and grapevine (Vitis spp.) constitutively accumulate large amounts of stilbenes [49]. However, most studies concerning stilbene biosynthesis have been conducted on peanut, grapevine and pine. Induction of stilbenes synthesis is well known in response to a wide range of abiotic and biotic stresses. As example in grapevine, upon infection with different fungal pathogens, including powdery mildew (Erysiphe necator) [52], downy mildew (P. viticola) [53, 54], or gray mold (B. cinerea) [55, 56= COORDINATEDACTIVATIONOF343ANDUPSTREAMENZYMESINTHIS pathway occurred. Stilbenes can accumulate in plant tissues to concentrations necessary to inhibit fungal growth [57, 58]. Stilbenes like pinosylvin and pinosylvin 3-O-methyl ether, which occur naturally in conifers, have strong antifungal activity in in vitro assays. These compounds are active in vitro against Coriolus versicolor and Gloeophyllum trabeum, two wood-destroying fungi [59]. Other stilbene like resveratrol inhibits conidial germination of Botrytis cinerea (the gray mold agent on grapes) [53] and also reduces the germination of sporangia of Plasmopara viticola (the downy mildew agent) whereas its glucoside piceid reduces fungal spore germination [60] at concentrations compatible with the activity range of other phytoalexins. It is interesting to note that trans-resveratrol, piceids, viniferins and pterostilbene concentrations

5

Secondary Metabolites and Plant Defence

117

Phenylalanine

Phenylalanine ammonia lyase (PAL)

Cinnamic acid

Cinnamate 4-hydroxylase (C4H) p-coumaric acid

4-coumarate CoA ligase (4CL) p-coumaroyl-CoA + 3 malonyl-CoA

Chalcone synthase Stilbene synthase Tetraketide intermediate

Chalcone synthase

Chalcone

Stilbene synthase

Resveratrol

Fig. 5.3 Steps of stilbene biosynthesis

reach up to 50–400 Pg/g DW in infected grapevine leaves [49, 61]. Pterostilbene, the dimethylated form of resveratrol, had a ﬁve-fold higher activity than resveratrol in inhibiting fungal growth in vitro, indicating that methylation of hydroxyphenyl groups could lead to increased biocidal activity of phenolics [62]. To demonstrate the role of these phytoalexins in plant disease resistance, the stilbene synthase VST1 gene fused to an alfalfa pathogen-inducible promoter was introduced in 41B grapevine rootstock. Resulting transgenic plants produced more resveratrol under biotic and abiotic stress conditions and showed reduced symptoms after infection with B. cinerea [63]. Two stilbene synthase genes VST1 and VST2 from grapevine (Vitis vinifera L.) and the pinosylvin synthase gene PSS from pine (Pinus sylvestris L.) were stably transferred into bread wheat. Upon inoculation with the biotrophic pathogen Puccinia recondita f.sp. tritici several VST transgenic wheat lines showed a signiﬁcant reduction of disease symptoms compared to wild-type

118

S. Goyal et al.

plants. The reduction of disease symptoms was even more obvious after inoculation with the facultative biotrophic pathogen Septoria nodorum Berk [64]. Similarly, the transfer of stilbene synthase genes to tobacco, tomato, barley and rice leads to the accumulation of resveratrol and the resistance of the resulting transgenic plants to fungal pathogens [65–67]. In some cases, such as in kiwifruits and poplars , the heterologous expression of stilbene synthase did not result in an improved pathogen resistance, but resveratrol glucosides (less active on fungi than the aglycon form) were accumulated [68, 69]. Resveratrol is one of the most extensively studied natural products. Plethora of studies have demonstrated that resveratrol has preventive effect against a wide variety of diseases including cancer, cardiovascular diseases, as well as AIDS [70, 71].

5.3.3

Mechanism of Secondary Metabolites Action

Flavonoids and phenylpropanoids are widely distributed in plants and exhibit different mode of action against the pathogens. It is interesting to know that hundreds of clinical antifungal drugs in use, target only 6 different processes. Mostly they act as analogues of cellular signal compounds or substrates. They affect various physioLOGICALPROCESSANDTHEPARTSOFTHEPATHOGENSLIKEBIOMEMBRANES ENZYMEINHIBItion, estrogenic properties and DNA alkylation [72]. These molecules usually have several phenolic hydroxyl groups in common, which can dissociate in negatively charged phenolate ions. Phenolic hydroxyl groups form hydrogen and ionic bonds with proteins and peptides. The higher the number of hydroxyl groups, the stronger the astringent and denaturing effect [73]. Proteins can only work properly if they have the correct three-dimensional structure, called conformation. Conformational changes alter their properties and can prevent effective crosstalk between proteins, and between proteins and DNA or RNA. Most secondary metabolites interact with proteins in one or another way by binding, complexing, denaturing, thereby changing protein conformations. Most secondary metabolites form covalent bond with protein, often by binding to free amino-, SH- or OH- groups, e.g., phenylpropanoids binds to amino groups, SH reagents and epoxides couple to free SH groups. The covalent modiﬁcation can lead to a conformational change and thus loss of activity; or protein turnover is altered because proteases can no longer break down the alkylated protein. Polyphenols PHENYLPROPANOIDS mAVONOIDS CATECHINS TANNINS LIGNANS QUININES ANTHRAQUINONES interact with proteins by forming hydrogen bonds and the much stronger ionic bonds with electronegative atoms of the peptide bonds and or the positively charged side chains of basic amino acids (lysine, histidine, arginine). A single of these noncovalent bonds is quite weak. But because several of them are formed concomitantly when a polyphenols encounters a protein, a change in protein conformation ORALOSSINPROTEINmEXIBILITYISLIKELYTOOCCURTHATCOMMONLYLEADSTOPROTEININACtivation. Since most polyphenols are quite polar and therefore, hardly absorbed after oral intake, they are usually not regarded as serious toxins [74].

5

Secondary Metabolites and Plant Defence

119

The effect of two stilbene compounds, pinosylvin and resveratrol, on the growth of several fungi was evaluated in plate tests. Wood decay tests were carried out with birch and aspen samples impregnated with the two stilbenes. In plate experiments, resveratrol had an enhancing effect on growth at concentrations where pinosylvin was already enough to prevent the growth of most fungi studied [75]. Looking at the efﬁcient mode of action of plant SECONDARY METABOLITES against insects and pathogens pesticides, they are gaining increased attention and interest among those concerned with environment friendly, safe, and integrated crop management approaches [76].

5.4

Elicitation

Infected or elicited plants accumulate an array of plant defensive compounds. Nowa-days, it is well accepted that plant SECONDARY METABOLITES are involved in this plant defence system [77]. In 1982, Wolters and Eilert [78] reported for the ﬁrst time that in rue callus cultures the acridone alkaloid content increased when it was co-cultivated with fungi. Through the years, fungal cell wall components, microbial preparations, various heavy metals, UV irradiation or ultrasound treatment are able to enhance SECONDARY METABOLITES accumulation in plants. Plants treated with non-speciﬁc elicitors develop a general defence mechanism. This induced defence is a phenotypic trait. The process of inducing resistance using elicitors is environmental friendly and is advantageous over the chemical based pesticides. It is based on induction of the native “immune” potential of the host plant rather than on suppression of phytopathogens. The resistance developed in this way has prolonged effect. This strategy could be an alternative solution to reduce the use of pesticides. Elicitors are physical or chemical factors which when comes in contact in small concentrations to a living plant cell system triggers morphological and physiological responses such as phytoalexins accumulation. Elicitation is the process in which elicitor induct a sequence of reaction in the living cell, particularly related to biosynthesis of metabolites such as phytoalexins. On the basis of their nature, elicitors can be divided into two types namely biotic and abiotic. Abiotic elicitors are the substances of non –biological origin, like organic salts and physical factors acting as elicitors (Table 5.1). Biotic elicitors are substances with biological origin, like polysaccharides, derived from plant cell walls (pectin or cellulose), plant gums and microorganisms (chitins or glucans) and glycoproteins or intracellular proteins whose functions are coupled to receptors and ACTBYACTIVATINGORINACTIVATINGANUMBEROFENZYMESORIONCHANNELS;79]. Biotic elicitors can be further divided on the basis of their source into exogenous and endogenous groups. Exogenous elicitors are considered as the primary signals in plant pathogen interactions. They originate in the pathogen itself, mostly have a limited mobility within plant tissues, and evoke a response in cells in the immediate vicinity to the pathogen. Endogenous elicitors are of plant origin and arise as a

120

S. Goyal et al.

Table 5.1 List of commonly used biotic and abiotic elicitors Abiotic elicitors 2-amino-2-deoxy-d-galactopyranose &REEZINGANDTHAWINGCYCLES (galactosamine) 2-amino-2-deoxy-d-glucose (glucosamine) Fungicides (Maneb, Butylamine, Benomyl) 6,1c,6c-triamino-6,1c,6c-trideoxysucrose Gentamycin (saccharosamine) E-cyclodextrin (ERBICIDES!CImUOROFEN Activated carbon Methyl jasmonate Arachidonic acid Nitric oxide Colchicine Oxidative stress, amino acid starvation Copper sulphate Salicylic acid Copper/Cadmium/Aluminium chloride Sodium ferric ethylenediamine di-(o-hydroxyphenylacetate) FeEDDHA Cu+2, Cd+2, Ag+ 4RImUOROETHYLSALICYLATE4&%3! Curdlan UV light Denatured proteins (RNase) Vanadium/Vanadyl sulphate Diethyl amino ethyl dichlorophenyl ether XAD-4 Electromagnetic treatment Xanthan Biotic elicitors Arachidonic acid Alginate oligomers Alginate oligomers Alteromonas macleodii Aspergillus niger/sojae Blue green algae crude Botrytis cinerea Cellulase Chitosan Colletotrichum trifolii Cuscuta extract Diaporthe phaseolorum Eicosapentanoic acid Enterobacter sakazaki Exogenous cork pieces Flagellin Fusarium conglutanis Glucans Glucomannose Glycoproteins Harpins Hemicellulase Hepta-E –glucosides

Laminarin Monilicolin Pectic acid Pectin Phytopthora megasperma/cryptogea/sojae Plants gums Polyamines Poly-L-lysine Pythium aphanidermatum Rhizoctonia bataticola Rhizoctonia solani Rhizopus arrhizus Sacharomyces cerevisiae Spodoptera frugiperda Streptomyces melanosporofaciens Syringolide Systemin Trichoderma viride Ulva Verticillum dahliae Volicitin (N-linolenoyl –L-glutamine) Yeast elicitor

result of the interaction with the pathogen. Most appear to be apoplastic and their function may be to modulate the extent of the response in the surrounding tissue. This modulation can be exerted independently of the presence of exogenous elicitors or in a synergistic manner [80].

5

Secondary Metabolites and Plant Defence

121

)N ORDER TO INITIATE DEFENCE ELICITORS MUST BE RECOGNIZED BY PLANT RECEPTORS LOCALIZEDTOTHEPLASMAMEMBRANEORTHECYTOPLASM%LICITORSSUBSEQUENTLYORINDIrectly activate the corresponding effectors such as G-proteins, lipases and kinases, which then transduce the elicitor signal to downstream defence responses. The defence reaction involves synthesis of pathogenesis related proteins or defence secondary metabolites [81]. 4HEINmUXOF#AISACRITICAEVENTINELICITORINDUCEDSIGNALTRANSDUCTIONTHAT leads to accumulation of plant secondary metabolites. For example, treatment of GRAPEVINECELLSWITHVARIOUSELICITORSRAPIDLYTRIGGERS#AINmUX ALKALINIZATIONOF extracellular medium, oxidative burst, activation of MAP kinases and protein phosphorylation/dephosphorylation events. These early events are followed by the induction of defence gene expression (including PAL and STS), resulting in the production of resveratrol, piceid and Ǧ-viniferins [15, 82, 83].

5.5

In Vitro and In Vivo Studies

5.5.1

Abiotic Elicitors

5.5.1.1

Jasmonic Acid

Jasmonic acid (JA), an oxylipin-like hormone with its more active derivative METHYLJASMONATE-E*! ISDERIVEDFROMOXIDIZEDLINOLENICACID)NTENSIVEINVESTIgations by many laboratories about the signal cascade of elicitation process resulted in the identiﬁcation of JA and its derivatives as important elicitors [84]. It plays a key role in the elicitation of defence signaling pathways involved in resistance to pathogens, especially necrotrophs. JA is also used in a large number of cell and organ culture systems to increase the secondary metabolite yields [85]. Fungal diseases are a major problem in grapevine cultivation around the world. In order to limit these infections some alternative eco-friendly strategies like elicitation of plants with elicitors has been adapted. Several studies report the stimulation of stilbene production by exogenous application of MeJA in grapevine cell cultures (Table 5.2). Some in vivo studies demonstrated that MeJA-treated leaves showed INCREASEDTRANSCRIPTLEVELS CODINGPATHOGENESISRELATEDPROTEINSANDCODINGENZYMES involved in phytoalexin biosynthesis (phenylalanine ammonia lyase and stilbene synthase) (Table 5.3). This was correlated with the accumulation of stilbenes (antimicrobial compounds). The eliciting activity of MeJA was conﬁrmed by enhanced tolerance of grapevine foliar cuttings and vineyard against powdery mildew (75% and 73%, respectively) [109]. On the basis of these original results, MeJA could therefore, act as an efﬁcient elicitor in an alternative strategy of grapevine protection. Similarily, MeJA treated in vitro cultures of plants like Pueraria montana, P. candollei, P. tuberosa, Medicago truncatula accumulated signiﬁcantly increased

Vitis vinifera Vitis vinifera Vitis vinifera Vitis vinifera Vitis vinifera

Vitis vinifera Vitis vinifera cv. Barbera

Vitis vinifera cvs Michele Palieri and Red Globe

6 7 8 9 10

11 12

13

Cell cultures

Callus cultures Cell culture

Cell culture Cell culture Cell culture Cell culture Cell culture

Methyl jasmonate

Cyclodextrins Chitosan Methyljasmonate, cyclodextrins Dimethyl E-cyclodextrin Salicylic acid, Na-orthovanadate, jasmonates, chitosan and the monomers d-glucosamine and N-acetyl-d-glucosamine, ampicillin and rifampicin UV irradiation Jasmonic acid, methyljasmonate and Na-orthovanadate

Table 5.2 Effect of elicitors on the stilbenes content of in-vitro grown plants S. No. Plant species Culture types Elicitors used 1 Cayratia trifolia Root cultures Yeast extract, salicylic acid, methyl jasmonate, ethrel 2 Cayratia trifolia Cell culture Salicylic acid, methyl jasmonate, ethrel and yeast extract, salicylic acid and angiosperm parasite Cuscuta 3 Vitis rupestris and Vitis In vitro plants UV irradiation, aluminum chloride, and Botrytis vinifera cvs cinerea 4 Vitis spp Non-embryogenic callus UV-C irradiation 5 Vitis vinifera Cell cultures Methyl jasmonate

trans-Resveratrol trans- and cis-resveratrol; trans-resveratrol and piceids trans-Piceid and H-viniferin

[90] [85, 91]

Resveratrols and piceids trans-Resveratrol and piceids Resveratrol Resveratrol Resveratrol Resveratrol Resveratrol

[102]

[99] [100, 101]

[92] [93, 94] [83, 95] [96, 97] [98]

[89]

[87, 88]

References [86]

Resveratrol

Products Piceid, resveratrol, viniferin, ampelopsin Piceid, resveratrol, viniferin, ampelopsin

122 S. Goyal et al.

5

Secondary Metabolites and Plant Defence

Table 5.3 Effect of elicitors on the stilbenes content of in-vivo grown plants Plant parts S. No. Plant species elicited Elicitors used Products 1 Vitis vinifera Whole plants Laminarin Resveratrol and H-viniferin Postharvest Ultraviolet C Total stilbenes 2 Vitis vinifera grapes sylvestris, Vitis vinifera sativa 3 Vitis vinifera Plants Plasmopara Pterostilbene viticola infection, ultraviolet light, and AlCl3 trans-Resveratrol 4 Vitis vinifera L. Berries Aspergilli cv. Barbera japonicus, A. ochraceus, A. fumigatus and isolates of A. carbonarius 5 Vitis vinifera Plants; berries Methyl jasmonate Stilbenes Ethephon Resveratrol, 6 Vitis vinifera Grapevine piceid, detached viniferins leaves and pterostilbene grapevine foliar cuttings 7 Vitis vinifera cv. Berries Aspergillus trans-Resveratrol Barbera carbonarius and piceatannol 8 Vitis vinifera Flowers, berries UV radiation Resveratrol

123

References [103] [104]

[105, 106]

[107, 108]

[109, 110] [111]

[112]

[113]

AMOUNTOFISOmAVONESINCOMPARISONTOCONTROLCULTURES4HEISOmAVONELIKEDAIDZEIN is the precursor to the major phytoalexins including medicarpin which are produced in Medicago and Glycine, respectively [32]. There are reports for the increased production of these metabolites by using MeJa and other biotic elicitors (Table 5.4). There are studies on Medicago truncatula which demonstrated that on infection with fungal pathogen Macrophomina phaseolina,GENESINVOLVEDINmAVONOIDAND ISOmAVONOIDBIOSYNTHESISWERESTRONGLYUP REGULATEDINTHESHOOT)NADDITION SOME genes in jasmonates (JAs) or ethylene (ET) pathways were not strongly induced in infected root tissue. Treating plants with methyl jasmonate (MJ) induced partial resistance in M. truncatula plants [130].

5.5.1.2

Ethephon

Ethephon is an ethylene-releasing compound. It has been known for a long time as an inducer of phenylpropanoid biosynthesis which may be related to a general wound and/or stress response. An ethephon related increase of PAL activity had

Pueraria montana

Pueraria tuberosa

Trifolium pratense

14

15

12

13

Phaseolus vulgaris

8

Psoralea corylifolia Psoralea corylifolia Pueraria candollei var. candollei and P. candollei var. miriﬁca Pueraria candollei

Glycyrrhiza echinata Lupinus albus Manihot esculenta Medicago truncatula

4 5 6 7

9 10 11

Glycine max

3

Seedlings

Hydroponically grown seedlings Cell cultures

Hairy roots

Hairy roots Cell cultures Cell culture

Seedlings

Cell cultures Seedlings Cell cultures Cell cultures

Hairy roots

Yeast extract, salicylic acid, methyl jasmonate, ethrel Chitohexose Copper Chloride

Methyl jasmonate, chitosan, salicylic acid, Agrobacterium, and yeast extract Cork pieces, XAD-4, and methyl jasmonate

CuCl2, chitosan, gentamycin, saccharosamine, galactosamine and glucosamine Yeast extract, chitosan, salicylic acid Yeast extract, chitosan, salicylic acid Copper sulfate, methyl jasmonate (MeJA), and yeast extract, chitosan, laminarin

Yeast extract Puriﬁed yeast cell wall Yeast extract Yeast extract and methyl jasmonate

Fusarium solani

Table 5.4 %FFECTOFELICITORSONTHEISOmAVONESCONTENTOFin-vitro grown plants S. No. Plant species Culture types Elicitors 1 Albizzia kalkora Root cultures Strains of Rhizobium sp 2 Cicer arietinum Callus/tissues Hypnea musciformis (red algae)

[125] [126]

)SOmAVONES $AIDZEIN GENISTEIN DAIDZIN genistin, and puerarin 0UERAIN GENISTIN DAIDZEINAND genistin Formononetine-7-O-glucosyl-6Ȍmalonate and Maackiain-3O-glucosyl-6Ȍ-malonate.

[129]

[127, 128]

[121]

[117] [118] [119] [120]

[116]

[122] [123] [124]

References [114] [115]

Products $AIDZEINANDGENISTEIN Formononetin, maackiain, naringin and naringin melonate 'ENISTIN DAIDZIN GLYCITINANDTHEIR malonyl conjugates and aglycones, coumestrol and glyceollin &ORMONONETINANDDAIDZEIN 0RENYLATEDISOmAVONEAGLYCONES Phenylpropanoids and scopoletin Formononetin and biochanin-A MEDICARPINANDDAIDZIN Phaseollin, coumestrol, genistein ANDDAIDZEIN $AIDZEINANDGENISTEIN $AIDZEINANDGENISTEIN )SOmAVONES

124 S. Goyal et al.

5

Secondary Metabolites and Plant Defence

125

been described long back [131–133]. There are some in vivo and in vitro studies WHICHDEMONSTRATEINCREASEDSTILBENEANDISOmAVONEACCUMULATIONINTHEPLANTSBY ethephon/ethrel treatment (Tables 5.2–5.4). In a study, Belhadj and co-workers [111] treated grapevine foliar cuttings (Cabernet Sauvignon) with ethylene- releasing ethephon. This resulted in an increase in the number of pathogenesis-related protein gene copies (CHIT4c, PIN, PGIP, and GLU) and in an enhancement of phytoalexin biosynthesis by inducing the PAL and STS genes that correlated with the accumulation of stilbenes (antimicrobial compounds). Moreover, ethephon treatment triggered the protection of grapevine detached leaves and grapevine foliar cuttings against Erysiphe necator, the causal agent of powdery mildew (64% and 70%, respectively). 4HESESTUDIESEMPHASIZETHEMAJORROLEOFETHYLENEINGRAPEVINEDEFENCE 0RODUCTION OF ISOmAVONES LIKE PUERARIN DAIDZEIN GENISTIN AND GENISTEIN WERE also increased in ethephon treated cell cultures of Pueraria tuberosa [128]. Effects OFETHEPHONONISOmAVONESPRODUCTIONINDIFFERENTPLANTSSTILLNEEDATTENTION

5.5.1.3

UV Light

Resveratrol production and expression of the genes related to resveratrol biosynthesis were investigated in the skins of three Vitis vinifera cultivars. Resveratrol concentration in the skins of all the grapes increased signiﬁcantly when exposed to ultraviolet (UV-C, 254 nm) irradiation [134]. In another study, it was demonstrated that in V. rupestris UV irradiation induced a high, constant level of STS mRNA production which was correlated to resveratrol accumulation [89]. Another group of workers EVALUATEDGRAPEmOWERSANDGREENBERRIESOFGRAPEGENOTYPESFORTHEIRABILITYTO produce resveratrol in response to UV radiation. This was used to establish a selection criterion for screening genotypes for resistance to gray mold and powdery mildew. There was a strong negative correlation between UV-induced resveratrol production and susceptibility to Botrytis infection [135]. Callus culture of V. vinifera were exposed to 254 nm UV light. About 15 min of UV irradiation period was found to be effective for induction of (62 Pg/g callus fresh weight) trans-resveratrol production [99]. Thus, UV light can be used as an efﬁcient elicitation source for stilbene production (Tables 5.2 and 5.3).

5.5.1.4

Cyclodextrins

Cyclodextrins (CD) are cyclic oligosaccharides of 6,7 or 8 D –d- glucopyranoside residues linked by D 1Ȣ4 glucosidic bonds, which are called D-, E-, and J- CD. They have an hydrophilic external surface and hydrophobic central cavity that can trap a polar compounds [136]. The production of cyclodextrins is relatively simple AND INVOLVES TREATMENT OF ORDINARY STARCH WITH A SET OF EASILY AVAILABLE ENZYMES [137]. Dimethyl -E-cyclodextrin (DIMEB), an oligosaccharide consisting of 2,6-methylated cyclic D (1Ȣ4)- linked glucopyranose moieties, has shown to be capable of inducing stilbene biosynthesis in liquid Vitis vinifera cell cultures, also

126

S. Goyal et al.

in the absence of pathogenic organisms [96] (Table 5.2). This molecule seems to mimic a defence elicitor which enhances the physical barriers of the cell, stops cell division and induces phytoalexin synthesis [97]. A grapevine liquid cell culture system was used to examine the properties of CDs as inducers of defence responses. This work shows that the chemically pure heptakis (2,6-di-O-methyl)-E CD caused a dramatic extracellular accumulation of the PHYTOALEXINRESVERATROLANDCHANGESINPEROXIDASEACTIVITYANDISOENZYMATICPATTERN Other modiﬁed CDs tested on several grapevine cell lines resulted in different eliciting capacities of CDs and different sensibilities of the cell lines. The spent medium of elicited cultures containing polyphenolic compounds released by plant cells was shown to disturb Botrytis cinerea growth in a plate assay [92].

5.5.1.5

Phosphites

0HOSPHITE IS A NEUTRALIZED SOLUTION OF THE PHOSPHONATE ANION ;138]. Phosphite contains one less oxygen (O) than phosphate, making its chemistry and behavior quite different. Phosphite is less chemically stable and more soluble than phosphate, when applied to plants, it is quickly absorbed by leaves, roots and branches, thus high concentrations can be toxic for plants. It is able to move in both, xylem and phloem. Unlike phosphates, phosphites stimulate the pathogen defence mechanisms in plants and have antifungal activity by inducing production of phytoalexins. It is effective against fungi like Plasmopara viticola, Pythium sp. and Phytophthora nicotianae. The relatively limited fungicidal effect – combined with its ability to stimulate plants to make a broad spectrum of biologically active metabolites – makes phosphite relatively benign to the environment and safe to use [139]. Nowa- days there are many reports on phosphite induced cellular responses to pathogen challenge and suppressed pathogen ingress in both in vitro and in vivo cultures [140, 141]. Different mechanism of phosphite actions were postulated by Grant and co-workers [142=7ITHTHEINDIRECTACTIONS PHOSPHITEISHYPOTHESIZEDTOCAUSETHE pathogen to produce elicitors or inhibit its production of suppressors, allowing plant defence responses to halt invasion by the pathogen [143].

5.5.1.6

Pulsed Electric Field

Pulsed electric ﬁeld (PEF) an external stimulus or stress, is proposed as a promising new abiotic elicitor for stimulating secondary metabolite biosynthesis in plant cell cultures. The effects of PEF on growth and secondary metabolite production by plant cell culture were investigated by using suspension cultures of Taxus chinensis as a model system. A signiﬁcant increase in intracellular accumulation of taxuyunnanine C (Tc), a bioactive secondary metabolite, was observed by exposing the cells in the early exponential growth phase to a 30-min PEF [144]. The effects of PEF and ethephon on growth and secondary metabolites accumulation were also investigated in suspension culture of Vitis vinifera L. cv. Gamay Fréaux as a model system.

5

Secondary Metabolites and Plant Defence

127

After the treatments production levels of extracellular phenolic acids, 3-O-glucosylresveratrol was increased in the cultures [145=)NANOTHERRECENTSTUDY ISOmAVONES production in the Glycine cell culture increased with pulsed electric ﬁeld (PEF) APPLICATIONATK6 ANDAGLYCONEFORMSWEREINmUENCEDTOAGREATEREXTENT;146]. These results show that PEF induced a defence response of plant cells and may have altered the cell/membrane’s dielectric properties.

5.5.2

Biotic Elicitors

5.5.2.1

Chitosan

Chitosan is a polysaccharide called poly [E-(1Ȣ4)-2-amino-2-deoxy -d-glucopyranose]. It is a plant defence booster derived from deactylation of chitin which is extracted from the exoskeleton of crustaceans such as shrimps and crabs, as well as from the cell walls of some fungi [147, 148]. The primary unit in the chitin polymer is poly [E-(1Ȣ4)-2-acetamido-2-deoxy -d-glucopyranose]. The units are combined by 1,4 glycosidic linkages, forming a long chain linear polymer. Removal of most of the acetyl groups of chitin by treatment with strong alkalis yields chitosan [149]. Agricultural applications of chitosan are for stimulation of plant defence. The chitosan molecule triggers a defence response within the plant, leading to the formation of physical and chemical barriers against invading pathogens [150]. Chitosan conferred a high protection of grapevine leaves against grey mould caused by Botrytis cinerea. Treatment of grapevine leaves by chitosan led to marked induction of lipoxygenase (LOX), phenylalanine ammonia-lyase (PAL) and chitinase activities, three markers of plant defence responses. Strong reduction of B. cinerea infection were achieved with 75–150 mg/l chitosan [151]. In some studies it was observed that grapevines with higher assays of chitinase or ß-1,3-glucanase had greater resistance to powdery mildew, and when combined had even greater ﬁeld resistance against powdery mildew (Uncinula necator) [152]. In an investigation, chitosan increased the amounts of genistein and 2hydroxygenistein monoprenyls in roots of white lupin and in the exudates [153]. Further studies indicated that chitosan triggers either the de-novo synthesis of phenolic compounds as the ﬁrst defensive line designed to inhibit growth of the fungus and E-1,3-glucans act as a second mechanical barrier for blocking potential invasion by fungal cells and protecting the tissue against phytotoxic substances [154, 155]. #HITOSANCOATINGOFLITCHIFRUITSINCREASEDTHEIRCONTENTOFmAVONOIDSANDRESISTANCE to browning and postharvest decay [156]. Chitosan has also been used in cell cultures of Vitis vinifera and Psoralea corylifolia, Pueraria candollei to enhance the STILBENEANDISOmAVONEPRODUCTION RESPECTIVELY4ABLES5.2 and 5.4). Besides its use in in vitro studies, chitosan is also used in in vivoSTUDIESTOINCREASETHEISOmAVONES production (Table 5.5). Chitosan is a nontoxic biodegradable material, acting as an elicitor. Thus, has the potential to become a new class of plant protecting agent, assisting towards the goal of sustainable agriculture.

Glycine max

Glycine max Glycine max

Glycine max

Glycine max Lotus japonicus Lupinus angustifolius Medicago sativa Medicago truncatula

Trifolium pratense

2

3 4

5

6 7 8 9 10

11

Products Biochanin A, formononetin and medicarpin and maackiain, homoferreirin and cicerin Seeds Lipo-chitooligosaccharides, chitosan, $AIDZEIN GENISTEIN GLYCITEIN Streptomyces melanosporofaciens strain EF-76 and yeast extract Seeds and seedlings Aspergillus sojae cell wall extract Glyceollins Cotyledons Diaporthe phaseolorum f. sp. $AIDZEIN GENISTEINAND meridionalis glyceollins, apigenin Seeds E-Glucan from Phytophthora sojae $AIDZEIN COUMESTROL GENISTEIN LUTEOLINAND apigenin Cotyledon tissue E-Glucan from Phytophthora sojae Glyceollin Seedlings Reduced glutathione Vestitol Seedlings Pleiochaeta setosa Genistein, 2prime-hydroxygenistein Plantlets Colletotrichum trifolii Medicarpin Plantlets Phoma medicaginis Formononetin 7-O-glucoside and malonylated formononetin 7-O-glucosid Plantlets Yeast extract and chitosan 'ENISTEIN DAIDZEIN FORMONONETINAND biochanin A

Table 5.5 %FFECTOFELICITORSONTHEISOmAVONESCONTENTOFin-vivo grown plants S. No. Plant species Plant part elicited Elicitor 1 Cicer arietinum Seedlings Reduced glutathione

[167]

[162] [163] [164] [165] [166]

[161]

[159] [160]

[158]

References [157]

128 S. Goyal et al.

5

Secondary Metabolites and Plant Defence

5.5.2.2

129

Laminarin

The molecule laminarin (also known as laminaran) is a linear glucan found in brown algae. Laminarin is clearly a high-energy carbohydrate. It is used as a food reserve in the same way that chrysolaminarin is used by phytoplankton. It is made up of E(1Ȣ3)-glucan with E(1Ȣ6)-linkages and a E(1Ȣ3):E(1Ȣ6) ratio of 3:1 [168]. In a study, E-1,3-glucan laminarin derived from the brown algae Laminaria digitata was shown to be an efﬁcient elicitor of defence responses in grapevine cells and plants. It also effectively reduced B. cinerea and P. viticola development on infected grapevine plants. Defence reactions elicited by laminarin in grapevine cells include CALCIUMINmUX ALKALINIZATIONOFTHEEXTRACELLULARMEDIUM ANOXIDATIVEBURST ACTIvation of two mitogen-activated protein kinases, expression of 10 defence-related genes with different kinetics and intensities, increases in chitinase and E-1,3-glucanase activities, and the production of two phytoalexins (resveratrol and H-viniferin). When applied to grapevine plants, laminarin reduced infection of B. cinerea and P. viticola by approximately 55% and 75%, respectively [103]. In another study, LAMINARIN INCREASED THE ISOmAVONES ACCUMULATION IN CELL CULTURES OF Pueraria candollei (Table 5.4).

5.5.2.3

Yeast Extract

Yeast extract is the common name for various forms of processed yeast products made by extracting the yeast cell contents (removing the cell walls). Yeast has been PROVEDTOBEANEFlCIENTELICITORFORTHEINCREASEDACCUMULATIONOFISOmAVONEAND stilbene in different plants (Tables 5.2, 5.4, and 5.5). Yeast extract-treated suspension cultures of a new cell line, AK-1, of Glycyrrhiza echinata were induced to produce AN ISOmAVONOID PHYTOALEXIN MEDICARPIN &ROM THESE CELLS PUTATIVE FULL LENGTH C$.!SENCODINGCYTOCHROME0S 3 mAVANONE HYDROXYLASEANDISOmAVONE 2c-hydroxylase, were cloned [169]. A cDNA encoding UDP-glucose: formononetin 7-O-glucosyltransferase, designated UGT73F1, was cloned from yeast extracttreated Glycyrrhiza echinata L. cell-suspension cultures. Recombinant UGT73F1 was expressed as a histidine-tag fusion protein in Escherichia coli. The puriﬁed RECOMBINANT ENZYME WAS SELECTIVE FOR ISOmAVONE FORMONONETIN AND DAIDZEIN AS substrates [117]. Besides this, there are various reports where yeast extract was the most efﬁcient elicitor in comparison to other elicitors [125].

5.6

Conclusions

The application of biotic and abiotic elicitors in developing plant resistance is still in the early stages of use. Currently, our knowledge is mainly based on the experimental trials. There are many reports which prove there efﬁcacy as potent natural pesticides. It is well established that these elicitors impart disease resistance by

130

S. Goyal et al.

elevating or developing some secondary metabolites in the plants. Effect of several elicitors on the production of stilbenes in different Vitis species and other stilbenes CONTAININGPLANTSHASBEENSUMMARIZEDIN4ABLES5.2 and 5.3. Similarly, the recent STUDIES ON THE EFFECT OF DIFFERENT BIOTIC AND ABIOTIC ELICITORS ON THE ISOmAVONES PRODUCTIONHAVEBEENSUMMARIZEDIN4ABLES5.4 and 5.5. Numbers of studies, especially concerning grapevine inoculated with various pathogens, have established a positive correlation between stilbene levels and pathogen resistance. More evidence supporting the role of stilbene (resveratrol) in resistance to pathogen infection was supplied by the transfer of stilbene synthase genes in plants that do not produce stilbenes, such as tobacco and alfalfa [65, 67]. )SOmAVONESFUNCTIONINBOTH THESYMBIOTICRELATIONSHIPWITHRHIZOBIALBACTERIA AND THE PLANT DEFENCE RESPONSE 4HE IMPORTANCE OF ISOmAVONES CAN BE JUDGED BY different reports where in order to increase the disease resistance in plant, producTIONOFCERTAINTYPEOFISOmAVONESWASENHANCEDBYGENETICMANIPULATIONS;170]. The non-legume plants like Arabidopsis, Nicotiana tabacum and Zea mays (for HUMANCONSUMPTION WEREMETABOLICENGINEEREDFORISOmAVONESPRODUCTION$UETO complexities in regulation of inter-related biochemical pathways, metabolic ENGINEERINGTOAFFECTTHEISOmAVONESBIOSYNTHETICCAPACITYOFATARGETPLANTTISSUE presents a challenge [171]. However, by using elicitors this process can be simpliﬁed and can become more practically feasible in ﬁelds. Use of elicitors has an added advantage over the chemicals used to prevent plants from diseases. There are increasing evidences, that elicitors could be used in the future as alternatives to traditional pesticides for managing pathogens and pests in agriculture and nursery production of forest trees. However, inappropriate use of elicitor treatments can change the chemical composition of the treated plant material. Therefore, with agricultural crops, suitable concentration of elicitors should be use which may not affect human health.

References $EARING-$ &OLEY7* -C,EAN3 4HEINmUENCEOFPLANTSECONDARYMETABOLITESONTHE nutritional ecology of herbivorous terrestrial vertebrates. Annu Rev Ecol Evol Syst 36:169–189 2. Rattan RS (2010) Mechanism of action of insecticidal secondary metabolites of plant origin. Crop Prot 29:913–920 3. Dussourd DE, Denno RF (1991) Deactivation of plant defense: correspondence between insect behavior and secretory canal architecture. Ecology 72:1383–1396 4. Becerra JX (1994) Squirt-gun defense in Bursera and the chrysomelid counterploy. Ecology 75:1991–1996 5. Phillips MA, Rodney B (1999) Croteau Resin-based defenses in conifers. Trends Plant Sci 4:184–190 6. Evans PH, Becerra JX, Venable DL, Bowers WS (2000) Chemical analysis of squirt-gun defense in Bursera and counter defense by chrysomelid beetles. J Chem Ecol 26:745–754 7. Becerra JX, Venable DL, Evans PH, Bowers WS (2001) Interactions between chemical and mechanical defenses in the plant genus Bursera and their implications for herbivores. Am Zool 41:865–876

5

Secondary Metabolites and Plant Defence

131

8. Ramanujan K (Winter 2008) Discoveries: milkweed evolves to shrug off predation. North Woodl (Center for Northern Woodlands Education) 15:56 9. Field B, Jordán F, Osbourn A (2006) First encounters – deployment of defence-related natural products by plants. New Phytol 172:193–207 +OMBRINK% 3CHMELZER% 4HEHYPERSENSITIVERESPONSEANDITSROLEINLOCALAND systemic disease resistance. Eur J Plant Pathol 107:69–78 11. Heil M, Bostock RM (2002) Induced systemic resistance (ISR) against pathogens in the context of induced plant defences. Ann Bot 89:503–512 12. Futuyma DJ, Agrawal AA (2009) Macroevolution and the biological diversity of plants and herbivores. Proc Natl Acad Sci USA 106:18054–18061 13. Wink M (2008) Evolution of secondary plant metabolism. In: Encyclopedia of life sciences (ELS). Wiley, Chichester 14. Ramawat KG, Dass S, Mathur M (2009) The chemical diversity of bioactive molecules and therapeutic potential of medicinal plants. In: Ramawat KG (ed.) Herbal drugs: ethnobotanical to modern perspective. Springer, Heidelberg 15. Wink M, Schimmer O (2010) Molecular modes of action of defensive secondary metabolites. In: Wink M (ed.) Functions and biotechnology of plant secondary metabolites, vol 39, II edn, Annual plant reviews. Wiley Blackwell, Chichester 16. Dixon RA (2001) Natural products and disease resistance. Nature 411:843–847 17. Lanea AL, Nyadonga L, Galhenaa AS, Shearerb TL, Stouta EP, Parryc RM, Kwasnika M, 7ANGC-$ (AYB-% &ERNANDEZA&- +UBANEK* $ESORPTIONELECTROSPRAYIONIZAtion mass spectrometry reveals surface-mediated antifungal chemical defense of a tropical seaweed. Proc Natl Acad Sci USA 106:7314–7319 18. Hamm G, Carré V, Poutaraud A, Maunit B, Frache G, Merdinoglu D, Muller J-F (2010) Determination and imaging of metabolites from Vitis vinifera leaves by laser desorption/ IONISATIONTIME OF mIGHTMASSSPECTROMETRY2APID#OMMUN-ASS3PECTROMn 19. Strack D (1997) Phenolic metabolism. In: Dey PM, Harborne JB (eds) Plant biochemistry. Academic Press, New York 20. Ali K, Maltese F, Choi YH, Verpoorte R (2010) Metabolic constituents of grapevine and grape-derived. Prod Phytochem Rev 9:357–378 *AGANATH)" #ROZIER! $IETARYmAVONOIDSANDPHENOLICCOMPOUNDS)N&RAGA#'ED Plant phenolics and human health: biochemistry, nutrition, and pharmacology. Wiley, Hoboken #ROZIER! *AGANATH)" #LIFFORD-. $IETARYPHENOLICSCHEMISTRY BIOAVAILABILITYAND effects on health. Nat Prod Rep 26:1001–1043 23. Koskimaki JJ, Hokkanen J, Jaakola L, Suorsa M, Tolonen A, Sampo M, Pirttila AM, Hohtola A (2009) Flavonoid biosynthesis and degradation play a role in early defence responses of bilberry (Vaccinium myrtillus) against biotic stress. Eur J Plant Pathol 125:629–640 24. Skadhauge B, Thomsen K, von Wettstein D (1997) The role of barley testa layer and its mAVONOIDCONTENTINRESISTANCETOFusarium infections. Hereditas 126:147–160 -ALLIKARJUNA. +RANTHI+2 *ADHAV$2 +RANTHI3 #HANDRA3 )NmUENCEOFFOLIAR chemical compounds on the development of Spodoptera litura (Fab.) in interspeciﬁc derivatives of groundnut. J Appl Entomol 128:321–328 26. Collingborn FMB, Gowen SR, Mueller-Harvey I (2000) Investigations into the biochemical basis of nematode resistance in roots of three Musa cultivars in response to Radopholus similis infection. J Agric Food Chem 48:5297–5301 ,ATTANZIO6 "IOACTIVEPOLYPHENOLSTHEIRROLEINQUALITYANDSTORABILITYOFFRUITAND vegetables. J Appl Bot 77:128–146 28. Dixon RA, Achnine L, Kota P, Liu C-J, Reddy MSS, Wang L (2002) The phenylpropanoid pathway and plant defence: a genomics perspective. Mol Plant Pathol 3:371–390 3TEVANOVIC4 $IOUF0. 'ARCIA 0EREZ-% "IOACTIVEPOLYPHENOLSFROMHEALTHYDIETS and forest biomass. Curr Nutr Food Sci 5:264–295 $U( (UANG9 4ANG9 'ENETICANDMETABOLICENGINEERINGOFISOmAVONOIDBIOSYNTHESIS Appl Microbiol Biotechnol 86:1293–1312

132

S. Goyal et al.

6EITCH.# )SOmAVONOIDSOFTHE,EGUMINOSAE.AT0ROD2EPn 32. Yu O, Shi J, Hession AO, Maxwell CA, McGonigle B, Odell JT (2003) Metabolic engineering TOINCREASEISOmAVONEBIOSYNTHESISINSOYBEANSEED0HYTOCHEMISTRYn 33. Dixon RA, Ferreira D (2002) Molecules of interest, genistein. Phytochemistry 60:205–211 34. Naoumkina M, Farag MA, Sumner LW, Tang Y, Liu CJ, Dixon RA (2007) Inaugural article, different mechanisms for phytoalexin induction by pathogen and wound signals in Medicago truncatula. Proc Natl Acad Sci USA 104:17909–17915 35. Russell GB, Sutherland ORW, Hutchins RFN, Christmas PE (1978) Vestitol: a phytoalexin with insect feeding-deterrent activity. J Chem Ecol 4:571–579 36. Latunde-Dadaa AO, Lucasa JA (1985) Involvement of the phytoalexin medicarpin in the differential response of callus lines of lucerne (Medicago sativa) to infection by Verticillium albo-atrum. Physiol Plant Pathol 26:31–42 2IVERA 6ARGASA,) 3CHMITTHENNERA!& 'RAHAM4, 3OYBEANmAVONOIDEFFECTSONAND metabolism by Phytophthora sojae. Phytochemistry 32:851–857 38. Kramer RP, Hindorf H, Jha HC, Kallage J, Zilliken F (1984) Antifungal activity of soybean ANDCHICKPEAISOmAVONESANDTHEIRREDUCEDDERIVATIVES0HYTOCHEMISTRYn 39. Weidenborner M, Hindorf H, Jha HC, Tsotsonos P, Egge H (1990) Antifungal activity of ISOmAVONOIDS IN DIFFERENT REDUCED STAGES ON Rhizoctonia solani and Sclerotium rolfsii. Phytochemistry 29:801–803 40. Rahman MM, Gray AI, Khondkar P, Sarker SD (2008) Antibacterial and antifungal activities of the constituents of Flemingia paniculata. Pharm Biol 46:356–359 -ADANI3 3INGH'. +OHLI+ !LI- +UMAR9 3INGH2- 0RAKASH/ )SOmAVONOIDS from ﬂemingia strobilifera (L) R. Br. roots. Acta Pol Pharm Drug Res 66:297–303 42. Ksouri R, Falleh H, Megdiche W, Trabelsi N, Mhamdi B, Chaieb K, Bakrouf A, Magné C, Abdelly C (2009) Antioxidant and antimicrobial activities of the edible medicinal halophyte Tamarix gallica L. and related polyphenolic constituents. Food Chem Toxicol 47:2083–2091 43. YiÜit D, YiÜit N, Mavi A (2009) Antioxidant and antimicrobial activities of bitter and sweet apricot (Prunus armeniaca, KERNELS"RAZ*-ED"IOL2ESn 44. Gupta VK, Fatima A, Faridi U, Negi AS, Shanker K et al (2008) Antimicrobial potential of Glycyrrhiza glabra roots. J Ethnopharmacol 116:377–380 45. Kim HJ, Suh HJ, Lee CH et al (2010) Antifungal activity of glyceollins isolated from soybean elicited with Aspergillus sojae. J Agric Food Chem 58:9483–9487 #HENG * 9UAN # 'RAHAM 4, 0OTENTIAL DEFENSE RELATED PRENYLATED ISOmAVONES IN lactofen-induced soybean. Phytochemistry 72:875–881 47. Aslam SN, Stevenson PC, Kokubun T, Hall DR (2009) Antibacterial and antifungal activity OFCICERFURANANDRELATED ARYLBENZOFURANSANDSTILBENES-ICROBIOL2ESn 48. Shen T, Wang XN, Lou HX (2009) Natural stilbenes: an overview. Nat Prod Rep 26:916–935 49. Chong J, Poutaraud A, Hugueney P (2009) Metabolism and roles of stilbenes in plants. Plant Sci 177:143–155 3PARVOLI& -ARTIN# 3CIENZA! 'AVAZZI' 4ONELLI# #LONINGANDMOLECULARANALYSIS OFSTRUCTURALGENESINVOLVEDINmAVONOIDANDSTILBENEBIOSYNTHESISINGRAPEVitis vinifera L.). Plant Mol Biol 24:743–755 2ICHTER( 0EZET2 6IRET/ 'INDRO+ #HARACTERIZATIONOFNEWPARTIALSTILBENESYNTHASE genes out of over 20 expressed in Vitis vinifera during the interaction with Plasmopara viticola. Physiol Mol Plant Pathol 67:248–260 52. Schnee S, Viret O, Gindro K (2008) Role of stilbenes in the resistance of grapevine to powdery mildew. Physiol Mol Plant Pathol 72:128–133 53. Adrian M, Daire X, Jeandet P, Breuil AC, Weston LA, Bessis R, Boudon E (1997) Comparisons of stilbene synthase activity (resveratrol amounts and stilbenes synthase mRNAs levels) in grapevines treated with biotic and abiotic phytoalexin inducers. Am J Enol Viticult 48:394–395 54. Langcake P, Pryce RJ (1976) The production of resveratrol by Vitis vinifera and other members of the Vitaceae as a response to infection or injury. Physiol Plant Pathol 9:77–86

5

Secondary Metabolites and Plant Defence

133

55. Langcake P, McCarthy WV (1979) The relationship of resveratrol production to infection of grapevine leaves by Botrytis cinerea. Vitis 18:244–253 "EZIER! ,AMBERT" "AILLIEUL& 3TUDYOFDEFENSE RELATEDGENEEXPRESSIONINGRAPEVINE leaves and berries infected with Botrytis cinerea. Eur J Plant Pathol 108:111–120 57. Morales M, Barcelo A, Ros PMA (2000) Plant stilbenes: recent advances in their chemistry and biology. Adv Plant Physiol 3:39–70 58. Jeandet P, Douillet-Breuil AC, Bessis R, Debord S, Sbaghi M, Adrian M (2002) Phytoalexins from the Vitaceae: biosynthesis, phytoalexin gene expression in transgenic plants, antifungal activity, and metabolism. J Agric Food Chem 50:2731–2741 3CHULTZ 40 "OLDIN 7$ &ISHER 4( .ICHOLAS $$ -C-URTREY +$ 0OBANZ + 3TRUCTURE FUNGICIDAL PROPERTIES OF SOME AND HYDROXYLATED STILBENES AND BIBENZYL analogues. Phytochemistry 31:3801–3806 3CHULZE+ 3CHREIBER, 3ZANKOWSKI) )NHIBITINGEFFECTSOFRESVERATROLANDITSGLUCOSIDE piceid against Venturia inaequalis, the causal agent of apple scab. J Agric Food Chem 53:356–362 61. Poutaraud A, Latouche G, Martins S, Meyer S, Merdinoglu D, Cerovic ZG (2007) Fast and LOCALASSESSMENTOFSTILBENECONTENTINGRAPEVINELEAFBYINVIVOmUOROMETRY*!GRIC&OOD Chem 55:4913–4920 0EZET2 'INDRO+ 6IRET/ 3PRING* , 'LYCOSYLATIONANDOXIDATIVEDIMERIZATIONOF resveratrol are respectively associated to sensitivity and resistance of grapevine cultivars to downy mildew. Physiol Mol Plant Pathol 65:297–303 63. Coutos-Thevenot P, Poinssot B, Bonomelli A, Yean H, Breda C, Buffard D, Esnault R, Hain R, Boulay M (2001) In vitro tolerance to Botrytis cinerea of grapevine 41B rootstock in transgenic plants expressing the stilbene synthase Vst1 gene under the control of a pathogeninducible PR 10 promoter. J Exp Bot 52:901–910 3ERAZETDINOVA, /LDACH+( ,RZ( %XPRESSIONOFTRANSGENICSTILBENESYNTHASESIN wheat causes the accumulation of unknown stilbene derivatives with antifungal activity. J Plant Physiol 162:985–1002 (AIN2 2EIF(* +RAUSE% ,ANGEBARTELS2 +INDLE( 6ORMAN" 3CHMELZER% 3CHREIER0 3TOCKER2( 3TENZEL+ $ISEASERESISTANCERESULTSFROMFOREIGNPHYTOALEXINEXPRESSION in a novel plant. Nature 361:153–156 4HOMZIK *% 3TENZEL + 3TCKER 2 3CHREIER 0( (AIN 2 3TAHL $* 3YNTHESIS OF A grapevine phytoalexin in transgenic tomatoes (Lycopersicon esculentum Mill.) conditions resistance against Phytophthora infestans. Physiol Mol Plant Pathol 51:265–278 67. Hipskind JD, Paiva NL (2000) Constitutive accumulation of a resveratrol glucoside in transgenic alfalfa increases resistance to Phoma medicaginis. Mol Plant Microbe Interact 13:551–562 68. Kobayashi S, Ding CK, Nakamura Y, Nakajima I, Matsumoto R (2000) Kiwifruits (Actinidia deliciosa ) transformed with a Vitis stilbene synthase gene produce piceid (resveratrol-glucoside). Plant Cell Rep 19:904–910 'IORCELLI! 3PARVOLI& -ATTIVI& 4AVA! "ALESTRAZZI! 6RHOVSEK5 #ALLIGARI0 "OLLINI2 Confalonieri M (2004) Expression of the stilbene synthase (StSy) gene from grapevine in transgenic white poplar results in high accumulation of the antioxidant resveratrol glucosides. Transgenic Res 13:203–214 70. Baur JA, Sinclair DA (2006) Therapeutic potential of resveratrol: the in vivo evidence. Nat Rev Drug Discov 5:493–506 71. Roupe KA, Remsberg CM, YDUEZ*! $AVIES.- 0HARMACOMETRICSOFSTILBENESSEGUing towards the clinic. Curr Clin Pharmacol 1:81–101 72. Morrissey JP (2009) Biological activity of defence-related plant secondary metabolites. In: /SBOURN!% ,ANZOTTI6EDS 0LANTDERIVEDNATURALPRODUCTSSYNTHESIS FUNCTION ANDAPPLICATION Springer, London 73. Wink M (2008) Ecological roles of alkaloids. In: Fattorusso E, Taglialatela-Scafati O (eds.) Modern alkaloids: structure, isolation synthesis and biology. Wiley-Vch, Weinheim

134

S. Goyal et al.

74. Wink M, Van Wyk B-E (2008) Mind-altering and poisonous plants of the world. Co-production: "RIZA0UBLICATIONS 0RETORIA)3". 75. Seppnen SK, Syrj L, von Weissenberg K, Teeri TH, Paajanen L, Pappinen A (2004) Antifungal activity of stilbenes in in vitro bioassays and in transgenic Populus expressing a gene encoding pinosylvin synthase. Plant Cell Rep 22:584–593 76. Rattan RS (2010) Mechanism of action of insecticidal secondary metabolites of plant origin. Crop Prot 29:913–920 77. Keen NT, Brurgger B (1977) Phytoalexins and chemicals that elicit their production in plants. In: Hedin PA (ed.) Host plant resistance to pests, ACS symposium series. American Chemical Society, Washington, DC 78. Eilert U, Wolters B, Constabel F (1986) Ultrastructure of acridone alkaloid idioblasts in roots and cell cultures of Ruta graveolens. Can J Bot 64:1089–1096 79. Shilpa K, Varun K, Lakshmi BS (2010) An alternate method of drug production: eliciting secondary metabolite production using plant cell culture. J Plant Sci 5:222–247 80. Ebel J, Cosio EG (1994) Elicitors of plant defense responses. In: Jeon KW, Jarvik J (eds.) International review of cytology: a survey of cell biology, vol 148. Academic, London 81. Zhao J, Davis LC, Verpoorte R (2005) Elicitor signal transduction leading to production of plant secondary metabolites. Biotechnol Adv 23:283–333 82. Vandelle E, Poinssot B, Wendehenne D, Bentéjac M, Pugin A (2006) Integrated signaling network involving calcium, nitric oxide, and active oxygen species but not mitogen-activated protein kinases in BcPG1-elicited grapevine defenses. Mol Plant Microbe Interact 19:429–440 &AURIEA " #LUZETA 3 -£RILLON * - )MPLICATION OF SIGNALING PATHWAYS INVOLVING calcium, phosphorylation and active oxygen species in methyl jasmonate-induced defense responses in grapevine cell cultures. J Plant Physiol 166:1863–1877 84. Namdeo AG (2007) Plant cell elicitation for production of secondary metabolites: a review. Pharmacogn Rev 1:69–79 +RISA3 ,ARRONDE& "UDZINSKI( $ECENDIT! $EFlEUX' -£RILLON* - 3TILBENE production by Vitis vinifera cell suspension cultures: methyl jasmonate induction and 13C biolabeling. J Nat Prod 62:1688–1690 86. Arora J, Roat C, Goyal S, Ramawat KG (2009) High stilbenes accumulation in root cultures of Cayratia trifolia, $OMINGROWNINSHAKEmASKS!CTA0HYSIOL0LANTn 87. Roat C, Ramawat KG (2009) Elicitor-induced accumulation of stilbenes in cell suspension cultures of Cayratia trifolia (L.) Domin. Plant Biotechnol Rep 3:135–138 88. Arora J, Goyal S, Ramawat KG (2010) Enhanced stilbene production in cell cultures of Cayratia trifolia through co-treatment with abiotic and biotic elicitors and sucrose. In Vitro Cell Dev Biol Plant 46:430–436 "ORIE" *EANDET0 0ARIZE! "ESSIS2 !DRIAN- 2ESVERATROLANDSTILBENESYNTHASE mRNA production in grapevine leaves treated with biotic and abiotic phytoalexin elicitors. Am J Enol Viticult 55:60–64 90. Liu W, Liu C, Yang C, Wang L, Li S (2010) Effect of grape genotype and tissue type on callus growth and production of resveratrols and their piceids after UV-C irradiation. Food Chem 122:475–481 "ELHADJ! 4ELEF. 3AIGNE# #LUZET3 "ARRIEU& (AMDI3 -ERILLON* - %FFECTOF methyl jasmonate in combination with carbohydrates on gene expression of PR proteins, stilbene and anthocyanin accumulation in grapevine cell cultures. Plant Physiol Biochem 46:493–499 92. Bru R, Sellés S, Casado-Vela J, Belchí-Navarro S, Pedreño MA (2006) Modiﬁed cyclodextrins are chemically deﬁned glucan inducers of defense responses in grapevine cell cultures. J Agric Food Chem 54:65–71 93. Ferri M, Tassoni A, Franceschetti M, Righetti L, Naldrett MJ, Bagni N (2009) Chitosan treatment induces changes of protein expression proﬁle and stilbene distribution in Vitis vinifera cell suspensions. Proteomics 9:610–624

5

Secondary Metabolites and Plant Defence

135

94. Ferri M, Dipalo SCF, Bagni N, Tassoni A (2011) Chitosan elicits mono-glucosylated stilbene production and release in fed-batch bioreactor cultures of grape cells. Food Chem 124:1473–1479 ,IJAVETZKY $ !LMAGRO , "ELCHI .AVARRO 3 -ART¤NEZ :APATER *- "RU 2 0EDRE®O -! (2008) Synergistic effect of methyljasmonate and cyclodextrin on stilbenes biosynthesis pathway gene expression and resveratrol production in Monastrell grapevine cell cultures. BMC Res Notes 1:132–139 96. Zamboni A, Vrhovsek U, Kassemeyer H-H, Mattivi F, Velasco R (2006) Elicitor – induced resveratrol production in cell cultures of different grape genotypes (Vitis spp.). Vitis 45:63–68 97. Zamboni A, Gatto P, Cestaro A, Pilati S, Viola R, Mattivi F, Moser C, Velasco R (2009) Grapevine cell early activation of speciﬁc responses to DIMEB, a resveratrol elicitor. BMC Genomics 10:363–376 98. Laura R, Franceschetti M, Ferri M, Tassoni A, Bagni N (2007) Resveratrol production in Vitis vinifera cell suspensions treated with several elicitors. Caryologia 60:169–171 +ESKIN. +UNTER" 0RODUCTIONOFTRANS RESVERATROLINCALLUSTISSUEOFKÓZGZÓVitis vinifera l.) in response to ultraviolet-c irradiation. J Anim Plant Sci 20:197–200 100. Tassoni A, Fornale S, Franceschetti M, Musiani F, Michael AJ, Perry B, Bagni N (2005) Jasmonates and Na-orthovanadate promote resveratrol production in Vitis vinifera cv. Barbera cell cultures. New Phytol 166:895–905 4ELEF. 3AIGNEA# #LUZETA3 "ARRIEUB& (AMDIB3 -£RILLON* - %FFECTOFMETHYL jasmonate in combination with carbohydrates on gene expression of PR proteins, stilbene and anthocyanin accumulation in grapevine cell cultures. Plant Physiol Biochem 46:493–499 102. Santamaria AR, Antonacci D, Caruso G, Cavaliere C, Gubbiotti R, Laganà A, Valletta A, Pasqua G (2010) Stilbene production in cell cultures of Vitis vinifera L. cvs Red Globe and Michele Palieri elicited by methyl jasmonate. Nat Prod Res 24:1488–1498 !ZIZ! 0OINSSOT" $AIRE8 !DRIAN- "£ZIER! ,AMBERT" *OUBERT* - 0UGIN! Laminarin elicits defense responses in grapevine and induces protection against Botrytis cinerea and Plasmopara viticola. Mol Plant Microbe Interact 16:1118–1128 'UERRERO& 0UERTAS" &ERNÖNDEZ-) 0ALM- #ANTOS 6ILLAR% )NDUCTIONOFSTILBENES in grapes by UV-C: comparison of different subspecies of Vitis. Innov Food Sci Emerg Technol 11:231–238 105. Schmidlin L, Poutaraud A, Claude P, Mestre P, Prado E, Santos-Rosa M, WiedemannMerdinoglu S, Karst F, Merdinoglu D, Hugueney P (2008) A stress-inducible resveratrol O-methyltransferase involved in the biosynthesis of pterostilbene in grapevine. Plant Physiol 148:1630–1639 4AMM, 4HÓRIG" &LIESSBACH! 'OLTLIEB!% +ARAVANI3 #OHEN9 %LICITORSANDSOIL management to induce resistance against fungal plant diseases. Wagening J Life Sci. doi: 10.1016/j.njas.2011.01.001 (in press) "AVARESCO, 6EZZULLI3 "ATTILANI0 'IORNI0 0IETRI! "ERTUZZI4 %FFECTOFOCHRATOXIN A-producing Aspergilli on stilbenic phytoalexin synthesis in grapes. J Agric Food Chem 51:6151–6157 "AVARESCO, 6EZZULLI3 #IVARDI3 'ATTI- "ATTILANI0 0IETRI! &ERRARI& %FFECTOF lime-induced leaf chlorosis on ochratoxin A, trans-resveratrol, and H-viniferin production in grapevine (Vitis vinifera L.) berries infected by Aspergillus carbonarius. J Agric Food Chem 56:2085–2089 "ELHADJ! 3AIGNE# 4ELEF. #LUZET3 "OUSCAUT* #ORIO #OSTET- & -ERILLON* - Methyl jasmonate induces defense responses in grapevine and triggers protection against Erysiphe necator. J Agric Food Chem 54:9119–9125 6EZZULLI3 #IVARDI3 &ERRARI& "AVARESCO, -ETHYLJASMONATETREATMENTASATRIGGER of resveratrol synthesis in cultivated grapevine. Am J Enol Viticult 58:530–533 "ELHADJ! 4ELEF. #LUZET3 "OUSCAUT* #ORIO #OSTET- & -ERILLON* - %THEPHON elicits protection against Erysiphe necator in grapevine. J Agric Food Chem 56:5781–5787

136

S. Goyal et al.

6EZZULLI3 "ATTILANI0 "AVARESCO, 3TILBENE SYNTHASEGENEEXPRESSIONAFTERAspergillus carbonarius infection in grapes. Am J Enol Viticult 58:32–134 113. Shiraishi M, Chijiwa H, Fujishima H, Muramoto K (2010) Resveratrol production potential OFGRAPEmOWERSANDGREENBERRIESTOSCREENGENOTYPESFORGRAYMOLDANDPOWDERYMILDEW resistance. Euphytica 176:371–381 114. Park S-Y, Lee W-Y, Park Y, Ahn J-K (2006) Effects of nitrogen source and bacterial elicitor ONISOmAVONEACCUMULATIONINROOTCULTURESOFAlbizzia kalkora (Roxb.) Prain. J Integr Plant Biol 48:1108–1114 115. Fatima B, Muhammad A, Amanat A, Seema I (2009) Phytoalexins induced in Cicer arietinum CHARACTERIZEDBY,# -3TECHNIQUE)NDIAN*0LANT0HYSIOLn ,OZOVAYA66 ,YGIN!6 :ERNOVA/6 ,I3 (ARTMAN', 7IDHOLM*- )SOmAVONOID accumulation in soybean hairy roots upon treatment with Fusarium solani. Plant Physiol Biochem 42:671–679 117. Nagashima S, Inagaki R, Kubo A, Hirotani M, Yoshikawa T (2004) cDNA cloning and EXPRESSION OF ISOmAVONOID SPECIlC GLUCOSYLTRANSFERASE FROM Glycyrrhiza echinata cellsuspension cultures. Planta 218:456–459 118. Bednarek P, FraāSKI 2 +ERHOAS , %INHORN * 7OJTASZEK 0 3TOBIECKI - 0ROlLING CHANGESINMETABOLISMOFISOmAVONOIDSANDTHEIRCONJUGATESINLupinus albus treated with biotic elicitor. Phytochemistry 56:77–85 'O½MEZ 6A½SQUEZ2 $AY2 "USCHMANN( 2ANDLES3 "EECHING*2 #OOPER2- Phenylpropanoids, phenylalanine ammonia lyase and peroxidases in elicitor-challenged Cassava (Manihot esculenta) suspension cells and leaves. Ann Bot 94:87–97 120. Farag MA, Huhman DV, Dixon RA, Sumner LW (2008) Metabolomics reveals novel pathways and differential mechanistic and elicitor-speciﬁc responses in phenylpropanoid and ISOmAVONOIDBIOSYNTHESISINMedicago truncatula cell cultures. Plant Physiol 146:387–402 121. Durango D, Quiñones W, Torres F, Rosero Y, Gil J, Echeverri F (2002) Phytoalexin accumulation in colombian bean varieties and aminosugars as elicitors. Molecules 7:817–832 3HINDE !. -ALPATHAK . &ULZELE $0 %NHANCED PRODUCTION OF PHYTOESTROGENIC ISOmAVONESFROMHAIRYROOTCULTURESOFPsoralea corylifolia L. using elicitation and precursor feeding. Biotechnol Bioprocess Eng 14:288–294 3HINDE !. -ALPATHAK . &ULZELE $0 /PTIMIZED PRODUCTION OF ISOmAVONES IN CELL cultures of Psoralea corylifolia L. using elicitation and precursor feeding. Biotechnol Bioprocess Eng 14:612–618 124. Korsangruang S, Soonthornchareonnon N, Chintapakorn Y, Saralamp P, Prathanturarug S %FFECTS OF ABIOTIC AND BIOTIC ELICITORS ON GROWTH AND ISOmAVONOID ACCUMULATION IN Pueraria candollei var. candollei and P. candollei var. miriﬁca cell suspension cultures. Plant Cell Tissue Organ Cult 103:333–342 5DOMSUK, *ARUKAMJORN+ 4ANAKA( 0UTALUN7 )MPROVEDISOmAVONOIDPRODUCTION in Pueraria candollei hairy root cultures using elicitation. Biotechnol Lett 33:369–374 126. Kirakosyan A, Kaufman PB, Chang SC, Warber S, Bolling S, Vardapetyan H (2006) 2EGULATIONOFISOmAVONEPRODUCTIONINHYDROPONICALLYGROWNPueraria montanaKUDZU BY cork pieces, XAD-4, and methyl jasmonate. Plant Cell Rep 25:1387–1391 'OYAL 3 2AMAWAT +' )NCREASED ISOmAVONOIDS ACCUMULATION IN CELL SUSPENSION cultures of Pueraria tuberosa by elicitors. Indian J Biotechnol 7:378–382 'OYAL3 2AMAWAT+' )MPROVEMENTOFISOmAVONOIDSACCUMULATIONBYETHRELINCELL suspension cultures of Pueraria tuberosa, a woody legume. Acta Physiol Plant 30:849–853 4EBAYASHI 3 ) )SHIHARA ! )WAMURA ( %LICITOR INDUCED CHANGES IN ISOmAVONOID metabolism in red clover roots. J Exp Bot 52:681–689 130. Gaigea AR, Ayellab A, Shuai B (2010) Methyl jasmonate and ethylene induce partial resistance in Medicago truncatula against the charcoal rot pathogen Macrophomina phaseolina. Physiol Mol Plant Pathol 74:412–418 131. Hyodo H, Yang SF (1971) Ethylene-enhanced synthesis of phenylalanine-ammonia-lyase in pea seedlings. Plant Physiol 47:765–770 132. Abeles FB (1973) Ethylene in plant biology. Springer, New York

5

Secondary Metabolites and Plant Defence

137

133. Rhodes JM, Wooltorton LSC (1978) The biosynthesis of phenolic compounds in wounded plant storage tissues. In: Kahl G (ed.) Biochemistry of wounded plant tissue. Walter de Gruyter & Co., Berlin 134. Takayanagi T, Okuda T, Mine Y, Yokotsuka K (2004) Induction of resveratrol biosynthesis in skins of three grape cultivars by ultraviolet irradiation. J Jpn Soc Hortic Sci 73:193–199 135. Shiraishi M, Chijiwa H, Fujishima H, Muramoto K (2010) Resveratrol production potential OFGRAPEmOWERSANDGREENBERRIESTOSCREENGENOTYPESFORGRAYMOLDANDPOWDERYMILDEW resistance. Euphytica 176:371–381 ,PEZ .ICOLÖS*- "RU2 3ÖNCHEZ &ERRER! 'ARC¤A #ARMONA& 5SEOF@SOLUBLELIPIDS for biochemical processes: linoleic acid-cyclodextrin inclusion complexes in aqueous solutions. Biochem J 308:151–154 "IWER ! !NTRANIKIAN ' (EINZLE % %NZYMATIC PRODUCTION OF CYCLODEXTRINS !PPL Microbiol Biotechnol 59:609–617 138. Dobrowolski MP, Shearer BL, Colquhoun IJ, O’Brien PA, Hardy GEStJ (2008) Selection for decreased sensitivity to phosphite in Phytophthora cinnamomi with prolonged use of fungicide. Plant Pathol 57:928–936 ,OVATT #* -IKKELSEN 2, 0HOSPHITE FERTILIZERS WHAT ARE THEY #AN YOU USE THEM 7HATCANTHEYDO"ETTER#ROPSn 140. Wong M-H, McComb JA, Hardy GEStJ, O’ Brien PA (2009) Phosphite induces expression of a putative proteophosphoglycan gene in Phytophthora cinnamomi. Australas Plant Pathol 38:235–241 141. Daniel R, Wilson BA, Cahill DM (2005) Potassium phosphonate alters the defence response of Xanthorrhoea australis following infection by Phytophthora cinnamomi. Australas Plant Pathol 34:541–548 142. Grant BR, Dunstan RH, Grifﬁth JM, Niere JO, Smillie RH (1990) The mechanism of phosphonic (phosphorous) acid action in Phytophthora. Australas J Plant Pathol 19:115–121 143. Guest D, Grant B (1991) The complex action of phosphonates as antifungal agents. Biol Rev Camb Philos Soc 66:159–187 144. Ye H, Huang L-L, Chen S-D, Zhong J-J (2004) Pulsed electric ﬁeld stimulates plant secondary metabolism in suspension cultures of Taxus chinensis. Biotechnol Bioeng 88:788–795 #AI: 2IEDEL( 4HAW3AW.- +ÓTÓK/ -EWIS) *ÛGER( +NORR$ 3METANSKA) Effects of pulsed electric ﬁeld on secondary metabolism of Vitis vinifera L. cv. Gamay Fréaux suspension culture and exudates. Appl Biochem Biotechnol 164(4):443–453. doi:10.1007/ s12010-010-9146-2 'UEVEN! +NORR$ )SOmAVONOIDPRODUCTIONBYSOYPLANTCALLUSSUSPENSIONCULTURE J Food Eng 103:237–243 147. Domard A, Domard M (2002) Chitosan: structure – properties relationship and biomedical applications. In: Dumitriu S (ed) Polymeric biomaterials. Marcel Dekker, New York 148. Rabea EI, Badawy ME-T, Stevens CV, Smagghe G, Steurbaut W (2003) Chitosan as antimicrobial agent: applications and mode of action. Biomacromolecules 4:1457–1465 149. Peniston QP, Johnson E (1980) Process for the manufacture of chitosan. In: Walker R, 3UZANNE- 0HIL" !LISTAIR'EDS %VALUATIONOFPOTENTIALFORCHITOSANTOENHANCEPLANT defence. Rural Industries Research and Development Corporation, Australia, US patent 4,195,175, 5 pp 150. Yin H, Zhao X, Du Y (2010) Oligochitosan: a plant diseases vaccine—a review. Carbohydr Polym 82:1–8 4ROTEL !ZIZ0 #OUDERCHET- 6ERNET' !ZIZ! #HITOSANSTIMULATESDEFENSEREACTIONS in grapevine leaves and inhibits development of Botrytis cinerea. Eur J Plant Pathol 114:405–413 152. Giannakis C, Bucheli CS, Skene KGM, Robinson SP, Steele Scott N (1998) Chitinase and ß-1,3-glucanase in grapevine leaves: a possible defence against powdery mildew infection. Aust J Grape Wine Res 4:14–22 153. Gagnon H, Ibrahim RK (1997) Effects of various elicitors on the accumulation and secretion OFISOmAVONOIDSINWHITELUPIN0HYTOCHEMISTRYn

138

S. Goyal et al.

154. Benhamou N, Lafontaine PJ, Nicole M (1994) Induction of systemic resistance to Fusarium crown and root rot in tomato plants by seed treatment with chitosan. Phytopathology 84:1432–1444 155. Lafontaine PJ, Benhamou N (1996) Chitosan treatment: an emerging strategy for enhancing resistance of greenhouse tomato plants to infection by Fusarium oxysporum f. sp. radicis-lycopersici. Biocontrol Sci Technol 6:111–124 :HANG$ 1UANTICK0# %FFECTSOFCHITOSANCOATINGONENZYMATICBROWNINGANDDECAY during postharvest storage of litchi (Litchi chinensis Sonn.) fruit. Postharvest Biol Technol 12:195–202 !RMERO* 2EQUEJO2 *ORR¤N* ,PEZ 6ALBUENA2 4ENA- 2ELEASEOFPHYTOALEXINS ANDRELATEDISOmAVONOIDSFROMINTACTCHICKPEASEEDLINGSELICITEDWITHREDUCEDGLUTATHIONEAT root level. Plant Physiol Biochem 9:785–795 158. Al-Tawaha AM, Seguin P, Smith DL, Beaulieu C (2005) Biotic elicitors as a means of increasing ISOmAVONECONCENTRATIONOFSOYBEANSEEDS!NN!PPL"IOLn 159. Boué S, Shih F, Shih B, Daigle K, Carter-Wientjes C, Cleveland T (2008) Effect of biotic ELICITORSONENRICHMENTOFANTIOXIDANTPROPERTIESANDINDUCEDISOmAVONESINSOYBEAN*&OOD Sci 73:H43–H49 160. Modolo LV, Cunha FQ, Braga MR, Salgado I (2002) Nitric oxide synthase-mediated phytoalexin accumulation in soybean cotyledons in response to the Diaporthe phaseolorum f. sp. meridionalis elicitor. Plant Physiol 130:1288–1297 161. FdosS K, Aidar MPM, Salgado I, Braga MR (2009) Elevated CO2 atmosphere enhances PRODUCTION OF DEFENSE RELATED mAVONOIDS IN SOYBEAN ELICITED BY ./ AND A FUNGAL ELICITOR Environ Exp Bot 65:319–329 162. Abbasi PA, Graham MY, Graham TL (2001) Effects of soybean genotype on the glyceollin elicitation competency of cotyledon tissues to Phytophthora sojae glucan elicitors. Physiol Mol Plant Pathol 59:95–105 3HIMADA. !KASHI4 !OKI4 !YABE3 ) )NDUCTIONOFISOmAVONOIDPATHWAYINTHE model legume Lotus japonicus -OLECULAR CHARACTERIZATION OF ENZYMES INVOLVED IN PHYtoalexin biosynthesis. Plant Sci 160:37–47 164. Bednarek P, Kerhoas L, Einhorn J, FraāSKI 2 7OJTASZEK 0 2YBUS :AJÂc M, Stobiecki M 0ROlLINGOFmAVONOIDCONJUGATESINLupinus albus and Lupinus angustifolius responding to biotic and abiotic stimuli. J Chem Ecol 29:1127–1142 165. Salles II, Blount JW, Dixon RA, Schubert K (2002) Phytoalexin induction and E-1,3-glucanase activities in Colletotrichum trifolii infected leaves of alfalfa (Medicago sativa L.). Physiol Mol Plant Pathol 61:89–101 166. JasiāSKIA- +ACHLICKIB0 2ODZIEWICZA0 &IGLEROWICZA- 3TOBIECKI- #HANGESIN THEPROlLEOFmAVONOIDACCUMULATIONINMedicago truncatula leaves during infection with fungal pathogen Phoma medicaginis. Plant Physiol Biochem 47:847–853 3IVESIND% 3EGUIN0 %FFECTSOFFOLIARAPPLICATIONOFELICITORSONREDCLOVERISOmAVONE content. J Agron Crop Sci 192:50–54 .ISIZAWA+ 9AMAGUCHI4 (ANDA. -AEDA- 9AMAZAKI( #HEMICALNATUREOFA uronic acid-containing polysaccharide in the peritrophic membrane of the silkworm. J Biochem 54:419–426 .AKAMURA+ !KASHI4 !OKI4 +AWAGUCHI+ !YABE3 )NDUCTIONOFISOmAVONOIDAND RETROCHALCONE BRANCHES OF THE mAVONOID PATHWAY IN CULTURED Glycyrrhiza echinata cells treated with yeast extract. Biosci Biotechnol Biochem 63:1618–1620 (E 8 : $IXON 2! 'ENETIC MANIPULATION OF ISOmAVONE / METHYLTRANSFERASE enhances biosynthesis of 4c / METHYLATEDISOmAVONOIDPHYTOALEXINSANDDISEASERESISTANCEIN Alfalfa. Plant Cell 12:1689–1702 171. Yu O, Jung W, Shi J, Croes RA, Fader GM, McGonigle B, Odell JT (2000) Production of the ISOmAVONESGENISTEINANDDAIDZEININNON LEGUMEDICOTANDMONOCOTTISSUES0LANT0HYSIOL 124:781–794

Chapter 6

Trends for Commercialization of Biocontrol Agent (Biopesticide) Products Catherine Regnault-Roger

Abstract The need to implement an agricultural system taking into account sustainable development has fostered many initiatives to develop alternative methods in order to reduce the use of chemical synthetic pesticides for plant protection. Among these alternatives, the use of Biocontrol Agents (BCAs) or biopesticides has aroused increasing interest because of their ecological advantages. Their commercialization now increases but the part they occupy in Plant Protection Products (PPP) market is still marginal. After deﬁning what are the BCAs (biopesticide) products, this chapter analyses the factors that encourage or hamper this development and also considers the room of BCAs (biopesticides) and the trends in the global PPP market.

6.1

Introduction

The need to implement an agricultural system taking into account sustainable development has fostered many initiatives to develop alternative methods in order to reduce the use of chemical synthetic pesticides for plant protection. Among these alternatives, the use of Biocontrol Agents (BCAs) or biopesticides has aroused increasing interest because of their ecological advantages. So far exists nowadays a societal claim for friendly environmental plant protection from people in several developed countries and also from National Authorities. Two examples to illustrate

C. Regnault-Roger (*) Institut Pluridisciplinaire Pour l’Environnement et les Matériaux/Equipe Environnement et Microbiologie (IPREM/EEM), IBEAS, Université de Pau et des Pays de l’Adour, UMR CNRS 5254, BP 1155, F-64013 Pau, France e-mail: [email protected]

J.M. Mérillon and K.G. Ramawat (eds.), Plant Defence: Biological Control, Progress in Biological Control 12, DOI 10.1007/978-94-007-1933-0_6, © Springer Science+Business Media B.V. 2012

139

140

C. Regnault-Roger

these considerations are given: (i) the increasing demand for organic products from consumers. Stores and supermarkets enhance now their range of products and organic products are offered in the best location on the shelves (ii) a Round Table name “Grenelle Environnement” took place in 2007 in France bringing together the government, local authorities, trade unions, business and voluntary sectors to draw up a plan of action of concrete measures to deﬁne the key points of public policy on ecological and sustainable development issues. According to agriculture, it was decided to increase the share of organic agriculture to 20% by 2020, and to halve the amount of chemical pesticides. Thus the alternative methods to the uses of synthetic pesticides are focused and among them, the uses of BCAs (biopesticides). This situation follows re-registration procedures for Plant Protection Products (PPP) which occured in several developed countries during the two last decades as a consequence of improvement of scientiﬁc knowledge about biological and toxicological data and environmental concerns. So, it is now the moment to estimate which room there will be for Biocontrol Agents (biopesticides) within Plant Protection Products market in the next future. After having deﬁned what are BCAs and biopesticides, this chapter is questioning about the commercialization of BCAs which actually represents a small part of the PPP global market, the technical and the plant protection challenges, as well as some registration considerations.

6.2

BCAs or Biopesticides: A Concept in Evolution

Plants could not have survived in the course of their evolution without acquiring characteristics which enabled them to reproduce and defend themselves. The study of the numerous compounds they harbour has contributed to a better understanding of the framework of interspeciﬁc relationships between them and bio-aggressors. Following these observations, several strategies are been developed in order to limit or eradicate these bio-aggressors, and some involve biological based-products, also called biopesticides or biocontrol agents (BCAs). There are several deﬁnitions of biopesticides as to which kind of organisms or chemicals emitted by organisms should be considered to be a biopesticide: microorganisms, arthropod predators or parasitoids only or including also transgenic products, semiochemicals, botanicals [1]. Will Hintz, animator of the Biological Working Group of Canadian Weed Science Society (CWSS), initiated a forum on CWSS website to debate about the deﬁnition of biopesticides. It highlighted that the ﬁrst strategies were based on the uses of biopesticides deﬁned to be living organisms for “the planned use of natural enemies to suppress or reduce the populations of a pest until it no longer represents a problem” [2]. Van Driesche and Bellows [3] speciﬁed “the use of parasitoids, predators, pathogens, antagonists or competitive populations to suppress a pest population”. Completing the deﬁnition reported from Smith [4] “the use of biological agents which, directly or indirectly, are able to

6

Trends for Commercialization of Biocontrol Agent (Biopesticide) Products

141

control pests or weeds”, Hintz [5] indicated that “Biopesticides can be interpreted as plant-derived compound substances (or in a broader deﬁnition of all organism substances) having a protective effect on plants. Biopesticides can be found in nature or chemically synthesized”. In the same mind, the US EPA (Environment Protection Agency) states that biopesticides are derived from “natural materials as animals, plants, bacteria, and certain minerals”. They fall into three classes of compounds: (i) microbial pesticides including bacteria (the most widely used microbial pesticides are subspecies and strains of Bacillus thuringiensis, or Bt), fungi, virus or protozoan as the active ingredient, (ii) Plant-Incorporated-Protectants (PIPs) that are “pesticidal substances that plants produce from genetic material that has been added to the plant…The protein and its genetic material, but not the plant itself, are regulated by EPA”, (iii) Biochemical pesticides that are “naturally occurring substances that control pests by non-toxic mechanisms”. This deﬁnition mentions that “conventional pesticides, by contrast, are generally synthetic materials that directly kill or inactivate the pest. Biochemical pesticides include substances, such as insect sex pheromones, that interfere with mating, as well as various scented plant extracts that attract insect pests to traps” [6]. To complete these categories, EPA speciﬁed the properties of biopesticides. They are “usually inherently less toxic than conventional pesticides”; they are speciﬁc i-e. they “affect only the target pest and closely related organisms, in contrast to broad spectrum of conventional pesticides”; “they are effective in very small quantities and often decompose quickly”, and “when they are used as a component of Integrated Pest Management (IPM) programs, biopesticides can greatly decrease the use of conventional pesticides, while crop yields remain high”. Regarding the EPA biopesticide deﬁnition, it has to be emphasised that the category of PIPs is not recognised by the European Union (EU) as biopesticides because PIPs are transgenic compounds. In Europe, Genetically Modiﬁed Organisms (GMOs) fall under EC Directive 2001/18/EC, which requires risk assessment, labelling, and public information on GMOs, although all pesticides of any kind are under Directive 91/414/CE and micro-organisms under Directive 2001/36/CEE. The debate is animated in EU about biopesticides and GMOs. Biopesticides are considered to be better for ecosystems and environment. Should we say that the GMOs do not have any adverse effect on the environment? Many researches are presently conducted to clarify this point. In fact the current term uses in UE is not biopesticides but BCAs. Why BCAs and not biopesticides? Following a discussion within the REBECA Botanical Working Group, two reasons were given: (i) biopesticides which name is built by adding “bio” to “pesticide” evoke the bad marketing position of pesticides because of ecological hazards, and (ii) it is necessary to control pests but not eradicate them for better environmental balance. REBECA belonged to the Sixth Framework Program of the EU and set in 2004. It was deﬁned as “a task force to review current legislation, guidelines and guidance documents at Member State and EU level and compare this with similar legislation in other countries where the introduction of new biopesticides has proven to be more successful.” To carry out this program, a

142

C. Regnault-Roger

coordination action gathered industrials, regulators, academic and researchers to make brain storming and to bring out proposals for a balanced regulatory environment which could lead to better access to biopesticides for growers and farmers. This would lead therefore to further reductions in the use of chemical pesticides (http:// www.rebeca-net.de). REBECA is the acronym for “Regulation of Biological controls Agents”. It is one of the sources for popularising the name of Biological controls Agents (BCAs) as a new concept. Another approach had recently popularised the BCAs concept but under the very closed name of “Biocontrol Agents”. The book of the British Crop Protection Council (BCPC) edited by Leonard G. Copping illustrates this evolution. BCPC decide to produce a book name “The Biopesticide Manual” in 1998 as “a companion of the long established the Pesticide Manual” (which is published over 40 years by BCPC), as said Van Embden [7]. This decision derived from the successes, reviews and sales for biologically-based products. The Biopesticide Manual was covering in detail the biological effects observed with the products and indicated when it was known the modes of action of commercialized products. The classiﬁcation of the products changed with the editions. The main changes for the sections of the products were between the ﬁrst and the second editions (respectively 1998 et 2001): – The “Living system” section including baculoviruses, bacteria and fungi, Protozoa and nematodes changed into “Micro-organisms”. – The “Natural Products” section kept its title and included the substances (chemicals) derived from micro-organisms and higher plants as well. – The “Insect Predators” section became “Macro-organisms” to clarify the classiﬁcation because some of the organisms classiﬁed into this section were not necessarily insects. Parasitoids and predators belong to this section. – The “Pheromones” section changes into “Semiochemicals” to be more accurate and included chemicals used in mating disruption, lure and kill or insect monitoring strategies. – A section “Genes” gathered the genes that have been used to transform world crop to confer tolerance to herbicide application or resistance to attacks by viruses or insects. Another signiﬁcant change was coming with the third edition (2004). The title of the book became “the Manual of Biocontrol Agents” that illustrated the international change in attitude in the pest management. Van Lenteren [8] explained that “the initial trend occasionally to select non-chemical strategies for crop protection seen during the 1980s and 1990s has turn into the ofﬁcial pest management policy in many countries”. This book contained the fourth sections indicated previously, but the ﬁfth one “Genes” became an “Appendix”. Then the last edition (2009) is quite the same in the title and the sections of the book than the third one except that the appendix “Genes” disappeared. These considerations show that, whatever the name of biopesticide or BCA, efforts are devoted to develop this kind of products, even a long way still exists.

6

Trends for Commercialization of Biocontrol Agent (Biopesticide) Products

6.3

143

The Development of BCAs: A Hope Becoming Reality?

Because of more requirements for heath and environmental safety, re-registrations procedures in several developed countries severely cut down the number of chemical active ingredients for PPP. In EU, more than 50% of active substances were not included in Annex I. Therefore the reduction of the choice of chemical pesticides enhances the interest for BCAs. Following the sections deﬁned in the “Manual of Biocontrol Agents” which are now currently accepted, the number of BCAs increased from 175 products (including natural products, semiochemicals, micro-organisms and macro-organisms) in 1998 to 250 in 2001, 353 in 2004 and 452 in 2009. Consequently, the number of products available over 10 year is multiplied by 2.58. All products increased but not in the same way (Fig. 6.1). Many new entries are noted for micro-organisms and macroorganisms more than for semiochemicals and natural products. Macro-organisms products are 3.5 higher in 2009 than 1998, and in the same period micro-organisms multiply by 2.5. These two categories represent now 64% of the entries. This development is constant but accelerates during the ﬁve last years. In the same time, natural products stay at the same levels around 18–20% and semiochemicals (pheromones) regress a little to down to 16%. Several arguments explain this situation: (i) the different kinds of sectors for which the BCAs products are used and the high-value crops they produce, (ii) the registration restrictions for some BCAs natural products which do not present all the guarantees for safety uses. The ratio beneﬁts/risks is not the same for all BCAs as the following illustrations through examples will show it.

6.3.1

Micro-Organisms

This category includes baculoviruses, bacteria and fungi, Protozoa and nematodes. Some micro-organisms are known to be pathogens for human, animal and plant BCAs active substances 1998-2009 160 140

1998 2001

number

120

2004

100

2009

80 60 40 20 0

micro-organisms

macro-organisms

natural products

semiochemicals

genes

Fig. 6.1 Development of the number of BCAs active substances available for commercialization during last decade (according to L.G. Copping, The Biopesticide Manual (1998, 2001) and The Manual of Biocontrol Agents (2004, 2009))

144

C. Regnault-Roger

pathogens, and to produce toxins but they also synthezise antibiotics. However in contrast to chemical pesticides, micro-organisms BCAs (MBCAs) have a history of safe use. Bacteria. The most popular species used as MBCAs is undoubtedly Bacillus thuringiensis or Bt, a widespread Gram-positive, soil-dwelling bacterium. During sporulation many Bt strains produce crystal proteins (proteinaceous inclusions), called G-endotoxins. There are many crystal-producing Bt strains that do not have insecticidal properties but several have insecticidal action. Thousand of strains are divided in 70 sub-species. Some of them were selected because of the toxic properties of Cry protein for Lepidoptera caterpillars (Bacillus thuringiensis kurstaki Btk), for Diptera (Bacillus thuringiensis israelensis Bti), or Coleoptera (Bacillus thuringiensis tenebrionis Btt). Presently 13 strains of Bt are currently used in agriculture. They are commonly used as a biological alternative to a pesticide. The target site of G-endotoxins is the insect midgut. The cells of the midgut become paralyzed and the normal digestion by the insect is disrupted. Cry inserts into the insect gut cell membrane, forming a pore. The pore results cell lysis. Because of the mode of action of G-endotoxins involving very precise receptors, Bt develops a strong speciﬁcity. Spores and crystalline insecticidal proteins produced by B. thuringiensis have been used to control insect pests since the 1920s. Valent Biosciences (ex-Abott) in Illinois, USA, is historically the ﬁrst company which developed the Bt in formulation. The second manufacturer was Certis (California, USA) [9]. Bt is now used as speciﬁc insecticides under trade names such as Dipel® and Thuricide®. Because of their speciﬁcity, these biopesticides are regarded as environmentally friendly, with little or no effect on humans, wildlife, pollinators, and most other beneﬁcial insects. Bt shared with spinosad (an Actinomycete derived insecticide) the pole position of the sales of biopesticide global market [10]. A wide range of harmful species is controlled by the differents strains of Bt. Bt subsp aizawia (Bta) controles Lepidoptera like Heliothis, Spodoptera, Helicoverpa, Pieris species and also Ostrinia nubilalis (Hûbner) (European corn borer, ECB) or Plutella xylostella (L.). Bt subsp. tenebrionis are used against Colorado potato beetle (Leptinotarsa decemlineata (Say)). Bt is largely used to protect tomatoes cultivation, orchards and fruit trees (apple, plum, pear, cherry, peach, apricot, almond), rice, cabbages, red fruits, nuts, aromatic plants, vineyard, Allium spp (garlic, onions, leek). And beside these agricultural uses, Btk is also used to protect forest against pest insects (Thaumetopoea processionea, Lymantia dispar). Formulations of Bt are also widely used by domestic gardeners and commercial growers. However, not all caterpillar pests are equally susceptible to Bt. Bt is effective against ECB if it is applied just as the larvae are hatching. Bt formulations for use against Colorado potato beetle may vary in effectiveness [11]. But these observations are not general. Experiences were conducted to test the efﬁciency of Dipel® (Btk) and Xen Tari® (Bta) against Helicoverpa armingera to protect tomatoes and no signiﬁcant difference was noted between the Bt and chemical reference [12]. However the resistance of the insects is one of the problem induced by the wide use of Bt in formulation. Some moth species, including some populations of diamondback

6

Trends for Commercialization of Biocontrol Agent (Biopesticide) Products

145

moth, have evolved resistance to the Bt variety kurstaki toxins [13, 14]. One of the solutions is to alternate the use of Bt strains. Duchon Dorris and Armengaud [12] observed that the uses of Dipel® (Btk) and Xen Tari® (Bta) alternatively on vine, vegetable cultivations or cotton avoided resistance phenomemon. Baculoviruses are pathogens that attack insects and other arthropods. They are usually extremely small and are composed of double-stranded DNA that codes for genes needed for virus establishment and reproduction. The majority of baculoviruses used as biological control agents are in the genus Nucleopolyhedrovirus. These viruses are excellent candidates for insecticidal applications because of their speciﬁcity [15]. They do not show negative impacts on plants, mammals, birds, ﬁshes, and more generally on non-target insects. However the high speciﬁcity of baculoviruses is also cited as a weakness for agricultural uses, because of the narrow spectrum of its activity. They are used to protect vegetable crops, tomatoes, cabbages, orchards (apple, pear, walnut and plum), cotton, corn and also forest habitat. Their targets are for example Lumber Gypsy moth Lymantria dispar, Beet armyworm Spodoptera exigua, Tobacco budworm Helicoverpa zea, or Spodoptera littoralis. Some companies continue to explore the expansion and development of agriculturaluse viral insecticides and the effectiveness of insecticide “cocktails” consisting of environmentally friendly chemical agents and baculoviruses [16]. Insect-pathogenic fungi. Some insect species are particularly susceptible to infection by naturally occurring insect-pathogenic fungi. These fungi are very speciﬁc to insects, often to particular species, and do not infect animals or plants. Because fungi penetrate the insect body, they can infect sucking insects such as aphids and whiteﬂies that are not susceptible to bacteria and viruses. Infected insects stop feeding and die relatively rapidly. Their bodies could be enveloped but not always, by fungal mycelium from different colors which gave them the aspect of an embalmed body of mummy. Several fungal species have potential as microbial insecticides and, in some countries, are commercially available in formulations that can be applied using conventional spray equipment. Several isolates of Beauveria bassiana are commercialized (isolates GHA, 447, 74040 Bb 147, HF 23) under several trade names Mycotrol® (Mycotech), Organiguard® (Emerald BioAgriculture) etc. They are used in a wide range of targets to control grasshoppers, locusts, for uses on ornamentals, non-food crops in greenhouses, and to manage house ﬂies, aphids, thrips, and spider mites. Another fungus Beauveria brongniarti commercialized under the name of Betel® (NPP now Arysta Life Science) has a non restricted use in agriculture [17].

6.3.2

Macro-Organisms

The macro-organisms section involves insects and mites that are parasitoïds or predators for other insects and also phytophagous insects and mites that can be used for weed control, in glasshouses, interiorscapes and in outdoor agriculture.

146

C. Regnault-Roger

Insect parasitoids develop on or within a single insect host and ultimately killing it. The immature parasitoid feeds on body ﬂuids and organs of the pest. The parasitoïd is a natural enemy of the insect pest. Most beneﬁcial insect parasitoids are Hymenoptera (wasps) or Diptera (ﬂies). They are specialized in their choice of host and only attack a particular life stage of one or several related species. The life cycle and reproductive habits of beneﬁcial parasitoids can be complex. Only the female searches for host and eggs are laid most of the time in or on the host. Different parasitoid species can attack different life stages of insect host. Adult parasitoids are usually more susceptible to pesticides than their hosts but immature parasitoids will usually die if their host is killed. Because of this speciﬁcity, biological control by parasitoids is a success story. The most emblematic example is the use of trichogramma against Ostrinia nubilalis (ECB). As an example, the French cultivation of maize protected by these parasitoids enhanced from 30,000 ha in 1997 to more than 120,000 ha in 2008. Additional information to educate growers for good practices in using the BCAs product including Trichogramma brassicae (TR16+® or Pyratyp Opti®) is provided by the company Biotop™. Other species of trichogramma are also developed. To face the invasive species from South America Tuta absoluta which was recently coming in France through the Mediterranean area, a BCA product is developed based on Trichogramma achaeae, a parasitoïd identiﬁed in Spain for its efﬁcacy on the pest [18]. A new product named Trichotop®-TA with this parasitoid is now commercialized [19]. Insect predators can be found in almost all agricultural and natural habitats. They are arthropods and they prey on insects and mites. They include beetles, true bugs, lacewings, ﬂies, midges, spiders, wasps, and predatory mites. Some predators are specialized in their choice of prey, others are generalists. They kill or consume many preys and they attack immature and adult preys as well. Each group may have a different life cycle and habits and some of them are useful natural enemies of insect pests and they play a role in the suppression of the pests. Predators are used with success to control pests in glasshouses. The Chrysopidae Chysoperla carnea (Stephens), the Coccinellidae Hippodamia convergens (Guérin) and the Cecidomylidae Aphidoletes aphidimyza (Rondani) control aphids Myzus persicae (Sulzer), Macrosiphum euphorbiae (Thomas), Aphis gossypii (Golver) and Aulacorthum solani (Kaltenbach). The acarids Amblyseius cucumeris and A. degenerans, the bugs Orius laevigatus, O. insidiosus et O. majusculus control thrips on pepper Capsicum spp [20]. The management of thrips by acarids was the most popular to protect cut ﬂowers and ﬂowerpots on more than 65 ha of French glasshouses in 2005 (Bertrand and Trottin, personal communication). Unfortunately if some predators are very useful insects, others prey on other beneﬁcial insects as well as pests. Harmonia axyridis (Pallas), the chinese ladybird, is one of the insects used as predator of aphids. It was introduced in North America, then in Europe (Benelux) and rapidly became an invasive species, killing native ladybird larvae in the country it invaded. It is a polyphagous voracious predator and puts biodiversity in danger. In U.K., a national survey website was launched to monitor its spread [17].

6

Trends for Commercialization of Biocontrol Agent (Biopesticide) Products

147

Weed feeders. Insects can control weeds by feeding on seeds, ﬂowers, leaves, stems, roots or by transmitting plant pathogens, which will infect plants. The weedfeeding natural enemies develop several qualities that are used for controlling pests in agriculture but also exotic plant species which have been introduced to new locations around the world. They are speciﬁc to one plant species and have a negative impact on plant individuals and the population dynamics of the target weed. They are proliﬁc and good colonizers. Consequently they become widespread in all habitats and climates that the pest weed occupies. Shelton [11]. noted successes in controlling nodding thistle (Canada; Kansas, U.S.), ragwort (British Columbia, Canada; California and Oregon, U.S), klamath weed (Ontario, Canada; California, Oregon and southeast Washington, U.S.) alligator weed (Florida, Louisiana, and Texas, U.S.), and water lettuce (Florida). He underlined that using biological agents for weed control is beneﬁcial because “once a population of biocontrol agents is established, minimal effort is required to conserve it” and therefore it is less expensive compared to herbicidal sprays.

6.3.3

Semiochemicals

According to the deﬁnition of OECD [21], semiochemicals (SCs) are chemicals emitted by plants, animals, and other organisms – and synthetic analogues of such substances – that evoke a behavioural or physiological response in individuals of the same or other species. They include pheromones and allelochemicals. – Pheromones are semiochemicals by excellence and numerous researches were conducted to evaluate the role they play for social insects. They produced by individuals of a species that modify the behaviour of other individuals of the same species (i.e. an intraspeciﬁc effect). Pheromones are chemical mediators which are emitted by individual of a species to give indication to others about territory and movement, aggregation, mating, oviposition and nest-building, sexual maturation, alarm etc. [22]. – Allelochemicals are semiochemicals produced by individuals of one species that modify the behaviour of individuals of a different species (i.e. an interspeciﬁc effect). They include allomones (emitting species beneﬁts), kairomones (receptor species beneﬁts) and synomones (both species beneﬁt). Plant allelochemicals are involved into plant defence as well as pollinisation. Because of their origin, plant allelochemicals could also be considered into botanicals. Most Scs are volatile because their molecular weight is light. The volatility gives to this chemical signal an advantage for communication because it can travel long distances in the wind. The speciﬁcity of the pheromones and their properties stimulated investigations on their potential for pest control. For over 20 years, several reviews and books focused on this topic [23–29]. The pheromones are used to lure insects and trap

148

C. Regnault-Roger

them following three main approaches: (i) detection and monitoring; (ii) mating disruption; (iii) attract and kill (or lure and kill) mass-trapping capture. The principle of the use of insect pheromones for detection and monitoring is to attract insects to the trap in order to determine their occurrence in the ﬁeld. Most often, the trap bait contains a female sex pheromone to attract males into the traps. Consistent trapping protocols are essential to have relevant information for identiﬁcation of the insects, the evaluation of insect populations and year to year comparisons. This monitoring gives very useful information for decision making on insecticide treatments in the ﬁelds, to survey and sample low density populations. The mating disruption approach involves confusing males by placing several point sources of female sex pheromones in the ﬁeld. The male follows false trails and exspends mating energy in pursuit of artiﬁcial pheromone sources. Consequently, the reproduction of the targeted population is reduced. The attract-and-kill mass trapping is based on formulations containing a combination of pheromone which attracts the insect, and an insecticide that kills it. According to Flint and Doane [30], damage to the target species was very limited, but success was reported against the Chinese tortrix Cydia trasias (Meyrick) to protect Chinese scholar-trees Sophora japonica L.; damage to the trees was reduced by about 70% following control of three generations [31]. The efﬁciency of pheromones as BCAs is not the same for the three strategies. The detection and monitoring approach is certainly the most efﬁcient because trapping insects is a tool for further insecticidal treatments for organic farming and classical agriculture as well. It is currently also used on a large scale for experimental or conventional cropping. Another application is the monitoring of insecticide resistance and distribution in a population, because of the difﬁculties of sampling by traditional methods [32]. According to Royer and Delisle [33], the use of pheromone traps to survey the density of an arrhenotoc species is inappropriate but is relevant to follow the change of geographical distribution. The success of mating disruption strategy for control of insect pests depends on the quality of dispensers to deliver a homogenous emission of pheromone to achieve a sufﬁciently saturated area for male confusion and capture [34]. Mating disruption strategies has been developed with success in the forests of North America as well as in arboriculture and vineyard in Europe [35]. The efﬁcacy of attract and kill mass trapping strategy for control of insect pests largely depends on the targeted species. The knowledge of the biology of the species (monoginy, polyginy, protandry) as well as the density of population, the surface to be protected and the position of the traps are essential to the success of this method [33]. Biocontrol by pheromones is not as well developed as it could be. There are several reasons for this situation: the quality of pheromone formulations, the motivation of the agricultural producers and the cost of treatments: – Most insect sex pheromones are multicomponent with precise ratios of components which may be expensive to manufacture. The current commercial formulations of pheromones do not always sufﬁciently mimic the natural chemical blends pheromones from females. One difﬁculty is that the chemical signal

6

Trends for Commercialization of Biocontrol Agent (Biopesticide) Products

149

changes according to the geographical distribution of insect species [36] and to season generation renewal [37]. Consequently, a comparison between a virgin female in a trap versus a commercial pheromone showed the superiority of the insect [34]. – Another point to temper this approach is the high level of constraints for the farmer. Pheromone pest management needs the installation of many traps in which it is essential that the diffusers allow a regular and sufﬁcient release of the pheromone. This also requires constant monitoring of the plots where the traps are distributed and these plots must be isolated from external contaminations using reinforcement of the treatments at the edges of the treated area. This requires increased vigilance by the farmer to monitor the phases of development of the various parasites to avoid the phenomena of resurgence. – The cost of the products (insect sex pheromone formulations and traps) is another factor that restricts this approach for insects of economic importance. Except the current use for monitoring pests during the crop, the use of pheromone is relevant in particular situations when conventional pesticides are not operating or when the environmental conditions (forests with high trees, arboriculture) do not facilitate the use of conventional pesticides. It is also appropriate for high crops values. In France, the biocontrol of grapevine moths is conducted by mating disruption method in Champagne since 20 years to protect this prestigious vineyard. Today Champagne has 9.000 ha (42% of this area) protected by RAK® (BASF) for the 2010 season. Within entire France, only 2% of vineyards are protected by the mating disruption method. The company BASF explains that the particular professional organisation of the growers into a Joint-Trade Organizational Committee on Champagne Wine (CIVC: Comité Interprofessionnel du Vin de Champagne) makes possible the management of this biocontrol method because wine growers are working together. The company underlines that “In Champagne, all the ingredients are there for the technique to work: a structured wine-producing network, motivated wine growers opting to “ﬁght as a community” rather than to work individually, and a single joint-trade organization ﬁghting for a common cause and participating in technical follow-up” [38].

6.3.4

Botanicals and Natural Products

This category of compounds includes a widespread range of compounds or extracts with very various properties. Beside plant extracts like Ryania or Sabadilla which contain a mixture of several alkaloids as active ingredients, plants essential oils, rosemary and clove oils, jojoba oil etc. are found and also plants allelochemicals (thymol, linalool) or laminarine, an algal extract. Micro-organism derived compounds with insecticide properties (streptomycin, spinosad), yeast extract hydrosylate and Actinomycete derived herbicide (bilanofos) or fungicide and bactericide (kasugamycin) are classiﬁed within [17]. Botanicals and plant derived compounds take up for 60% of these compounds.

150

C. Regnault-Roger

The botanical extracts come from fractionation of the plant by various processes and their composition varies depending on the botanical sample, the experimental conditions and the physicochemical properties of the compounds. Thus, the extracts from the same plant are not only complex but also the molecular composition is very variable from one extraction to another. Moreover, the complexity of the plant metabolism results in a large number of molecules. Mendelsohn and Balick [39] estimated more than 500,000 plant allelochemicals. For decades, the use of botanicals was more focused on the control of insects than other plants organisms. They are repellent, antifeedent, antinutritional, or neurotoxic. More generally, they affect the biotic potential of parasites and pests. Plant extracts and allelochemicals act also on a broad diversity of species like nematodes, phytopathogene micro-organisms (fungi and bacteria), as well as other species plants (allelopathy). In recent years, the improvement of knowledge of plant resistance mechanisms against bio-aggressors underlined that plants allelochemicals play an essential role in plant defence. Phytoalexines are low molecular-weight compounds of a non proteinaceous nature, mainly belonging to polyphenols, terpenoïds and polyacetylens. They are synthesised de novo in response to biotic or abiotic stresses and participate in plant induced resistance. Others, for example diferulates, are involved in the mechanical and biochemical barrier that constitutes the wall of maize grain [40, 41]. Consequently, the potential of plant allelochemicals and botanicals for plant protection could be used in two alternative strategies. The ﬁrst one aims at reinforcing the protection of the plant using traditional soaps with formulation including plant allelochemicals or plant extracts as active ingredients. It is the oldest use which has been made of plant extracts and allelochemicals. The second one aims at reinforcing the plant defence by developing its own mechanisms through allelochemicals. It is more recent and probably less risky than the ﬁrst one.

6.3.4.1

Botanicals in Formulations

The commercialised pesticide soaps and specialities including plant allelochemicals and botanicals can be used in both organic and conventional agriculture depending on the formulation. Plant allelochemicals and botanicals are still not used in plant protection to their full potential. Before the second World War four main groups of compounds were commonly used: nicotine and alkaloïds, rotenone and rotenoïds, pyrethrum and pyrethrins, and vegetable oils. Some of them had several inconvenient properties because of their toxicity on non target species (nicotine) or the instability of the molecules (pyrethrum). As a consequence, the use of these substances decreased with the commercialisation of chemically synthesised insecticides which moreover were easier to produce and handle and were less expensive. But as a result of the many demonstrations of the ecological hazards of synthesised insecticides, there was renewed interest in the 1970s for botanicals. Research on neem (Meliaceae) illustrated this renewed interest. In fact, botanicals as products of metabolism resulting from species co-evolution exhibit many advantages like selectivity, speciﬁcity, biodegradability [42].

6

Trends for Commercialization of Biocontrol Agent (Biopesticide) Products

151

However, during the whole twentieth Century, only a limited number of botanicals or plant allelochemicals were used for crop protection. Isman [43] indicated that only a few botanicals and plant extracts are currently commercialised. Four substances are mainly used, pyrethrum, rotenone, Neem, and essential oils, followed by nicotine, ryania and sabadilla for minor uses. Several factors hamper the industrial development of insecticide formulations containing plant compounds [1, 44, 45]. Beside economical and commercial considerations such as availability of the raw material and its accessibility, or standardisation and reﬁnement of plant commercial products, the toxicity of plant extract compounds on non targeted species is not negligible. Although they are natural, all products are not necessarily safe for people and for the environment. The current claims that plant protecting products or BCAs should not posed unreasonable risks to people or the environment, means that the evaluation of these compounds meet today’s most stringent standards of scientiﬁc knowledge. In this context, the risk assessment for botanicals and plant allelochemicals have to be evaluated by taking into account their toxicological nature and their ecological advantages, as well as the exposure scenario linked to the current use of the formulated end products. As an illustration, let us consider the most commercialised botanicals. Nicotine was one of the ﬁrst molecules used as an insecticide since the use of aqueous extracts of tobacco against the sucking-piercing insects of cereals was mentioned in 1690. But the active molecule of this plant, nicotine, was isolated only in 1828 and it was in 1904 that it was synthesised [46, 47]. This very stable alkaloid in its levogyre form is neurotoxic for insects, mammals and birds. It is an acetylcholine mimic, interfering with the transmission of signals in nerves. The LD50 of nicotine is 50 mg kg−1 for rats but 3 mg kg−1 for mice. A dose of 40–60 mg can be a lethal dosage for adult human beings through paralysis of respiratory muscles and doses as low as 1–4 mg can be associated with toxic effects in some individuals. Nicotine is neither an initiator nor a promoter of tumours in rodents but it is also toxic for birds. Today, some countries like China or Bolivia use nicotine to protect rice cultivation (by immersing the stems of tobacco in the plantations) and potato ﬁelds (spraying) [48]. In the USA, nicotine registration is a restricted pesticide use only in greenhouse for ornamentals against adult whiteﬂies, aphids, and thrips, since May 2008, because of risks for applicators both during and after application, for people who might be exposed to nicotine residues in treated greenhouses, and for consumers of plants from treated greenhouses [49] The Commission of the European Communities decided to not include nicotine in Annex I because it was not demonstrated “a safe use with respect to operators, workers, bystanders and consumers” [50]. Pyrethrum is presently the botanical the most sold on the market. It results from a powder obtained by crushing dried ﬂowers of daisies belonging to the family of Asteraceae: Chrysanthemum spp., Pyrethrum spp., Tanacetum spp. Chrysanthemum cinerariaefolium Benth & Hook was ﬁrst used in Europe in the 1800s against lice and ﬂies [51]. Other species of Chrysanthemum, C. roseum, C. tamrutense and C. carneum also contain signiﬁcant amounts of pyrethrum. Pyrethrum or pyrethrins

152

C. Regnault-Roger

is a mixture of six esters pyrethrins They are very toxic and act very quickly on insects and have low to moderate toxicity towards mammals Toxicity is mentioned for non-targeted species, especially ﬁsh, invertebrate and bees. However, its great instability in light, air and moisture considerably reduces risks related to its use. Despite its high production cost, it is a natural insecticide that is currently widely used (1,000 tonnes of pyrethrum are sold every year with about 90% being used in non-agricultural sites in USA) [52]. It is recommended for the control of ﬂying and crawling insects and arthropods and mites on fruits, ﬁeld crops, ornamentals, greenhouse crops and house plants as well as stored products, domestic and farm animals. It is normally applied in combination with piperonyl butoxide, a synergist that inhibits detoxiﬁcation [17]. Pyrethrins were included for uses as insecticide only in Annex I of Council Directive 91/414/EEC in December 2008. It entered in force in September 2009 until August 2019 [53]. But EPA [52] concludes that pyrethrins are eligible for reregistration provided mitigation measures. Because pyrethrum is registered for use in agricultural, residential, commercial, industrial and public health sites in USA, these mitigations focus on the restriction for (i) using the endproducts in speciﬁc places (e.g. nursing homes, hospitals, schools etc.), and (ii) on the method of application of the end-products and the protection equipment required for applicators, and (iii) the number of application for agricultural use in relation to the season and the pest pressure. This example demonstrates that the most popular botanicals must be used cautiously. Rotenone is widespread in Fabaceae (ex Papilionaceae) growing in Asia (Derris spp.) and in America (Lonchocarpus spp.). Rotenone is one of oldest insecticides used all over the world. The use of crushed roots of Fabaceae to catch freshwater ﬁsh by native populations of South America was mentioned as early as 1665 [54]. The active ingredient belongs to ﬂavonoïds. Rotenone inhibits cellular respiration and energy metabolism at the level of the mitochondrial respiratory chain. Harmless for warm-blooded animals, it is very active against cold-blooded animals such as amphibians, ﬁsh and reptiles. Although some accidents were reported with enzymatic inhibition, rotenone was regarded for a long time as being moderately toxic for mammals. Cases of chronic toxicity leading to kidney and liver damage were noted, and it was also found to be carcinogenic for rodents [55]. More recently a link between rotenone and Parkinson’s disease was hypothesised [56]. Rotenone used alone is not toxic for bees but is lethal in combination with pyrethrum [17]. Rotenone is now classiﬁed in the highest category of toxicity [57]. Until recently, rotenone was used in organic agriculture alone or associated with other ingredients such as pyrethrinoïds, synergist (piperonyl butoxide), sulphur or copper to control a wide range of arthropod pests including aphids, thrips, moths, beetles and spider mites. However, following the regulatory update 46/2007 within the frame of Directive 91/414/EEC and EC Decision (2008/317/EC) published on 10 April 2008, because of a lack of required information, the rotenone substances should not be included in the Annex I to Directive 91/414/EEC and consequently was withdrawn from the European Union plant protection products market at the date of October 10th 2009 [58]. Nevertheless, rotenone has been granted essential use in the UK,

6

Trends for Commercialization of Biocontrol Agent (Biopesticide) Products

153

Italy and France until 2011 on fruit trees, ornamentals and potatoes only. This derogation is limited to professional users with appropriate protective equipment. The uses of rotenone were also restricted in the USA for livestock, residential and home owner use, domestic pet uses, and all other uses except for piscicide uses. Consequently, rotenone is now registered to be applied directly to water to manage ﬁsh populations in lakes, ponds, reservoirs, rivers, streams, and in aquaculture, to eliminate completely or partially undesired ﬁsh species in the treatment area [57]. Neem is extracted from Azadirachta indica A. Juss which is native to arid regions of India. The ability of the oil to repel pests has been known for thousands of years. The oil has also been used on skin and medicinally. Neem is a part of the traditional practices in India. It is a mixture of more than 100 limonoid compounds including azadirachtin, salannin, and nimbin and their analogues. All these compounds act differently and numerous effects of Neem on insects have been reported. Salannin causes repellence and feeding deterrence, while azadirachtins are the only compounds that have a signiﬁcant activity as inhibitors of insect growth [58]. This results from an inhibition of the synthesis of ecdysteroids with, as a consequence, a disruption of moults and of the reproductive cycle of the insect. Neem oil was classiﬁed by EPA [59] in class IV (no signiﬁcant mammal toxicity). It had a mild (minimal) effect on skin sensitisation and eye irritation but was not cytotoxic and mutagenic according the test of Ames. However, Kleter et al. [60] reported that, according to Boeke et al. [61], some unknown hazards with new extraction methods would produce toxic effects of the Neem extract in mice and guinea-pigs with gastro-intestinal spasm, hypothermia and death with 200–400 mg kg−1 of leaf extract. Neem and azadirachtin were recently suspected to be endocrine disruptors but with contradictory results [62–64]. In relation to its environmental impact, Neem is sensitive to light and degrades in water [44]. Consequently, it has limited persistence in the environment. The half life of azadirachtin A after spraying on leaves of tomato or potato was 1 day [65]. A study on six aquatic organisms (crayﬁsh, shrimps, mosquitoes larvae, water ﬂeas) concluded that the risk values of azadirachtin and neem-based insecticides (Neemix™ and Bioneem™) did not exceed the criteria. Consequently no ecological hazard was likely to result from their use [66] or from the forest pest management application on aquatic macroinvertebrates [67]. Azadirachtin acts on a wide range of insects: balsam ﬁr sawﬂy Neodiprion abietis (Harris), thrips, leaf miners, aphids, caterpillars, pine false webworms. It deters certain insects, such as locusts, from feeding, and it interferes with the normal life cycle of insects, including feeding, moulting, mating and egg laying. Tested on over 300 species, it has been effective on 90% of susceptible species with a large variability of DL50 [68]. Recommended by the National Research Council of “Tree for solving global problems” [69], Neem is considered by many experts to be the superior BCA [70, 71]. Despite such qualities, the development of this insecticide is hampered by: (i) cultivating the plant on a commercial scale; (ii) extraction of the active ingredients; (iii) development of persistent formulations and shelf life [72]. According to Kleeberg and Ruch [73], the standardisation of

154

C. Regnault-Roger

Neem seeds extracts, which show a large variation of azadirachtin content, is one of the key factors to enhance the commercialisation of Neem products. Neem and azadirachtin are currently registered in several countries. In USA, azadirachtin was ﬁrst registred in 1985 [56] and the Clariﬁed Hydrophobic Extract of Neem Oil, a naturally occurring compound in 1995 [74]. The Commission of the European Communities decided to not include azadirachtin in Annex I of the Directive 91/414/ EEC because the notiﬁers voluntarily withdrew their support for an inclusion. But as this non-inclusion was not “based on the presence of clear indication of harmful effect,” the decision did not prejudice the submission of a new application [75]. It is apparent from these examples of the main botanicals that have been available on the market over the last decades that the situation is complex and that only a few compounds used in insecticide formulations really appear to have a future as BCAs.

6.3.4.2

Plant Extracts and Allelochemicals Enhancing Inducted Resistance

The stimulation of plant induced resistance involves not only plant allelochemicals, but also other microbial, fungal or mineral molecules. Among the elicitors , plant polyphenols are strongly implicated in these mechanisms [76]. The elicitors currently identiﬁed are mainly of microbial origin but plant extracts from Hedera helix L., Salix alba L., Viscum album L., Alchemilla vulgaris L., Reynoutria sacchalinensis (F. Schmidt) were identiﬁed as inducers of resistance against Fire Blight of apple and of Cotoneaster watererii [77]. Reynoutria sacchalinensis induced phenolic phytoalexines. Marketed under the name of Milsana® (KHH Bioscience), it is used particularly in North America for the protection of ornamental plants like roses and begonias, and also against various Oïdium of vegetables and fruit [78]. Macleaya cordata extract registered under the name of fungicide Qwel® (Camas Technologies Inc), induces increased amounts of polyphenolic phytoalexines and also SAR (Systemic Acquired Resistance) [17]. Another plant extract, Trigonella foenum graecum L., marketed under the name of Stifénia®, was recently approved in France against the vine oïdium [79]. Plant inducers act on a very broad spectrum of plant species and fungal and viral pathogens as well, whilst the expression of their efﬁcacy can be cultivar dependent. In the same context, studies highlight that the physiological stage of the treated plants plays a signiﬁcant role in the expression of the stimulation of plant defence; for example Stifénia® whose use is recommended before ﬂowering. Elicitors to be efﬁcient must be used at a receptive physiological stage of the plant. The limit of this technology is probably the incomplete control of disease (20–85%) or non signiﬁcant results under ﬁeld conditions because the expression of induced resistance is inﬂuenced by environmental conditions, genotype and crop nutrition. An important challenge would be to convince farmers and growers that stimulation of natural plant defence will provide a useful and practical approach to be used in association with fungicides, by decreasing the frequency and amount of chemical treatment to enhance sustainable development [80].

6

Trends for Commercialization of Biocontrol Agent (Biopesticide) Products

155

This overview underlines that BCAs provide interesting approaches to decrease the widely uses of synthetic pesticides in plant protection. Is it any consequence on the PPP market?

6.4

BCAs (Biopesticide) Market Outlook

The biopesticide market has been evaluated to 670 millions USD that represented 2.5% of global pesticides market (26.7 billions USD) in 2005. The total market for global and synthetic pesticides was valued at 37.86 billions USD for 2009 [81]. Pesticides industry is expecting a $45 billion global market for 2014 with a global demand for pesticides rising 2.9% annually. Compared to this situation, the biopesticide market remain very small, even if it increased substancially. However the International Biocontrol Agents Manufacturers Association (IBMA) indicates a raise to one billion USD for 2010 including a 200 millions market for Bt. [10]. According to BCC Research (www.bccresearch.com), the global market for biopesticides was worth an estimated $1.6 billion in 2009 but is expected to increase to $3.3 billion in 2014 for a 5-year compound annual growth rate (CAGR) of 15.6%. These ﬁgures underline that biopesticide industry growth continues, but progress has to be done before biopesticides will share the PPP market with synthetic pesticides. North America is the leader for using biocontrol products (44%), following by Asia (24%) and Europe (20%). Africa and South-Central America represent only 14% (http://www.ibma.ch/). However, the demand for natural biopesticides is rising steadily in all parts of the world. This strong increase coincides with the growth of control of biological pest in the sector of high-value crops like vegetables in greenhouses, vineyard, tree and fruit farming. Biocontrol will develop not only through the enhancement of organic farming but also through Integrated Pest Management (IPM). The surface area for organic agriculture increases in several countries of Western Europe and lay over than 7,287 millions ha compared to total agricultural surface area of 178 millions ha (4%) in 2007. Organic farming is quite developed in Austria with 11.5% (372,000 ha) and must develop in several other countries for the next years. But IPM, using the relevant tools for controlling pests in a friendly environmental approach, will undoubtedly be the future for BCAs. The example of vineyard and apple trees’ biocontrol in Germany is quite representative. The organic farming lays on 4% of surface area for vineyard but IPM using Bt and pheromones totals up to 60% of the surface area for this cultivation. For apple, organic farming cultivates 8% vs 45% for IPM using baculoviruses and pheromones [82]. Many BCAs are developed by SMEs and occupy what it is called a “niche market”. But now major companies are interested by this sector. Since 15 years, a ballet of merging-acquisitions has occurred between leader companies of PPP market and numerous SMEs or start-up societies of the ﬁeld of biotechnologies and biocontrol. They were acquired by these major companies. The SMEs Natural Plant Product (NPP- Callliope) which produces several BCAs (Carpovirusine®, Betel®, Biomite®, Cosmotrak®)

156

C. Regnault-Roger

is now a part of the Japanese company Arysta LifeScience. In another approach, the Majors acquired licence for BCAs: as an example, Syngenta recently acquired the licence for Alfa-Guard® which decreases the production of aﬂatoxins in shellpeanuts [83]. This interest of major companies for BCAs will contribute to stimulate the biopesticide market in the next years. Huge progress in manufacturing, transportation and conservation of BCAS were done during the ten last years. Because BCAs include into formulations living organisms or natural substances which require particular conditions (e.g. temperature as cold chain), they need to be manipulated with care and caution. These special conditions are now integrated into the quality and traceability processes of manufactures. Regulation is another point that could be improved to develop BCAs. Before they can be used as plant protection products, BCAs have to be registered. In the registration process, the risk assessments associated with their properties and their uses have to be evaluated. These risks are linked to the toxicity on the organisms and populations, as well as the exposure. Potential hazards for humans (operators, bystanders, consumers), wildlife and the environment (fate in air, soil and water, non target organisms including the routes to which they are exposed) must be identiﬁed and evaluated depending on the uses of the end-products. The regulation is not the same for macro-organisms, micro-organisms, semiochemicals and natural products. A comparison between regulation rules in UE, USA, Canada, Australia and NewZealand has recently been published [84]. For macrobials, it appears following those conclusions that “Europe lags far behind Australia, New Zealand, Canada and the USA in terms of implementing regulatory procedures for the import and release of invertebrate biological control agents (IBCAs)”. Regarding the other BCAs, the formal data requirements are similar in the EU, Canada, Australia, and the USA for micro-organisms, plants extracts and pheromones, but the legislation is not the same in all countries. For example, in USA, registration procedure is under code 40 CFR (Code of Federal Regulations) of application of FIFRA (Federal Insecticide, Fungicide and Rodenticide Act). The Registration Eligibility Decision (RED) of EPA details clearly the risk assessments linked to uses and exposures. Under considerations based on experiments and reliable data, many natural products are now considered to be minimum risk pesticides (40CFR 152.25f). They are listed (list 25b) and are exempt from the requirement of FIFRA. In EU, currently, microorganisms, botanicals and pheronomes are regulated under the directive 91/414, which was originally developed for chemical pesticides. The directive 91/414 was amended in order to add the speciﬁc requirements of micro-organisms (see directive 2001/36/EC and 2005/25/EC). From these examples, it could be noted that the globalisation of the BCAs (biopesticide) world market needs a harmonization of the regulations at an international level. This outlook on biopesticide market gives us hope that a strong reﬂection is now conducted to develop the BCAs. This would lead to a better use of chemical pesticides and certainly support sustainable agriculture. Aknowledgement The author is thankful to Louis Damoiseau, Chairman of IBMA France, and to Marianne Decoin, Redactor-in-chief of Phytoma, for useful information

6

Trends for Commercialization of Biocontrol Agent (Biopesticide) Products

157

References 1. Regnault-Roger C, Philogène BJR (2008) Past and current prospects for the use of botanicals and plant allelochemicals in integrated pest management. Pharm Biol 46:41–51 2. Watson AK (1991) The classical approach with plant pathogens. In: TeBeest DO (ed.) Microbial control of weeds. Chapman & Hall, New York 3. Van Driesche RG, Bellows JTS (1996) Biological control. Kluwer Academic, Boston, 539 pp 4. Smith RJ (1991) Integration of biological control agents with chemical pesticides. In: TeBeest DO (ed.) Microbial control of weeds. Chapman and Hall, New York 5. Hintz W (2001) Working group report of Biological Canadian Weed Science Society. Website: http://www.cwss-scm.ca/biological_control.htm. Accessed 21 May 2004 6. EPA (2008) Pesticides: regulating pesticides? What are biopesticides? http://www.epa.gov/ opp00001/biopesticides/whatarebiopesticides.htm. (Last updated 21 July 2008). Accessed 11 Aug 2008 7. Van Embden H (2001) Foreword. In: Copping LG (ed.) The biopesticide manual, 2nd edn. BCPC, Alton 8. Van Lenteren JC (2004) Foreword. In: Copping LG (ed.) The manual of biocontrol agents, 3rd edn. BCPC, Alton 9. Ferez JM, Duchon-Doris J, Decoin M (2008) Les trois domaines de Bacillus thuringiensis. Phytoma 613:10–13 10. Decoin M (2010) Bacillus thuringiensis, la longue patience. Phytoma 632:36–39 11. Shelton A (2010) Biological control. A guide to natural enemies in North America, Cornell University, College of Agriculture and Life science, Department of Entomology, http://www. nysaes.cornell.edu/ent/biocontrol/pathogensTOC.html. Accessed 17 Nov 2010 12. Duchon Dorris J, Armengaud P (2009) Bacillus thuringiensis alternatif et d ‘alternance. Phytoma 624–625:26–29 13. Tabashnik BE (1994) Evolution of resistance to Bacillus Thuringiensis. Annu Rev Entomol 39:47–79 14. Fargues J, Bourguet D (2005) La lutte microbiologique contre les isnectes ravageurs des cultures: contraintes, bilan et perspectives. In: Regnault-Roger C (ed.) Enjeux phytosanitaires pour l’agriculture et l’environnement. Tec et Doc Lavoisier, Paris 15. López-Ferber M, Duvauchelle G (2005) Les enjeux écologiques des biopesticides à base de baculovirus. In: Regnault-Roger C (ed.) Enjeux phytosanitaires pour l’agriculture et l’environnement. Tec et Doc Lavoisier, Paris 16. D’Amico V (2010) Baculo-viruses in biological control. A guide to natural ennemies in North America, Shelton Anthony (ed.) Cornell University, College of Agriculture and Life science, Department of Entomology, (on line 17 Nov 2010), http://www.nysaes.cornell.edu/ent/biocontrol/ pathogens/baculoviruses.html. Accessed 17 Nov 2010 17. Copping LG (2009) The manual of biocontrol agents, 4th edn. BCPC, Alton 18. Cabello T, Gallego JR, Vila E, Soler A, del Pino M, Carnero A, Hernández-Suárez E, Polaszek A (2009) Biological control of the South American tomato pinworm, Tuta absoluta (Lep.: Gelechiidae), with releases of Trichogramma achaeae (Hym.: Trichogrammatidae) in tomato greenhouses of Spain. IOBC/WPRS Bull 49:225–230 19. Frandon J, Séguret J, Desneux N, Tabone E (2010) Trichogramma achaeae: un nouvel auxiliaire de lutte contre le ravageur invasif Tuta absoluta sur tomate. Phytoma 634:9–12 20. Maisonneuve JC, Rat-Morris E, Johnson S (2005) Différents aspects de la production biologique intégrée sous serre en France. In: Regnault-Roger C (ed.) Enjeux phytosanitaires pour l’agriculture et l’environnement. Tec et Doc Lavoisier, Paris 21. OECD (2002) OECD series on pesticides number 12 guidance for registration requirements for pheromones and other semiochemicals used for arthropod pest control JT00121481 ENV/ JM/MONO(2001)12 22. Howse PE (1998) Pheromones and behaviour. In: Howse PE, Stevens IDR, Jones OT (eds.) Insect pheromones and their uses in pest management. Chapman & Hall, London

158

C. Regnault-Roger

23. Howse PE, Stevens IDR, Jones OT (1998) Insect pheromones and their use in pest management. Chapman & Hall, New York 24. Jutsum AR, Gordon RFS (1989) Insect pheromones in plant protection. John Wiley, New York 25. Cardé RT, Minks AK (1997) Insect pheromone research: new directions. Chapman & Hall, New York 26. Renou M, Guerrero A (2000) Insect parapheromones in olfaction research and semiochemicalbased pest control strategies. Annu Rev Entomol 45:605–630 27. Wyatt TD (2003) Pheromones and animal behaviour. Cambridge University Press, Cambridge 28. Picimbon JF (2005) Synthesis of odorant reception-suppressing agents, Odorants-Binding Proteins (OBPs) and Chemosensory Proteins (CSPs): molecular targets for pest management. In: Regnault-Roger C, Philogène BJR, Vincent C (eds.) Biopesticides of plant origin. Intercept -Lavoisier, Andover/Paris 29. Picimbon JF, Regnault-Roger C (2008) Composés sémiochimiques volatils, phytoprotection et olfaction: cibles moléculaires pour la lutte intégrée. In: Regnault-Roger C, Philogène BJR, Vincent C (eds.) Biopesticides d’origine végétale, 2nd edn. Lavoisier, Paris 30. Flint HM, Doane DC (1996) Understanding semiochemicals with emphasis on insect sex pheromones in Integrated Pest Management Programs. In: Radcliffe EB, Hutchinson WD (eds.) Radcliffe’s IPM world textbook. University of Minnesota, St. Paul, http://ipmworld. umn.edu. Accessed on 11 Aug 2008 31. Zhang GF, Meng XZ, Yan H, Sheng CF (2002) Chinese tortrix Cydia trasias (Lepidoptera: Olethreutidae): suppression on street-planting trees by mass trapping with sex pheromone traps. Environ Entomol 31:602–607 32. Suckling DM, Karg G (1998) Pheromones and other semiochemicals. In: Rechcigl JE, Rechcigl NA (eds.) Biological and biotechnological control of insect pests. Lewis Publishers, Boca Raton 33. Royer L, Delisle J (2005) Utilisations des pièges à phéromones sexuelle dans la gestion des ravageurs. In: Regnault-Roger C (ed.) Enjeux phytosanitaires pour l’agriculture et l’environnement. Lavoisier, Paris 34. Delisle J, Royer L (2005) Y a-t-il un avenir pour la lutte par confusion sexuelle contre les ravageurs forestiers? In: Regnault-Roger C (ed) Enjeux phytosanitaires pour l’agriculture et l’environnement. Lavoisier, Paris 35. Frérot B (2005) Les phéromones sexuelles des Lépidoptères: nouvelles approches et perspectives en protection intégrée. In: Regnault-Roger C (ed.) Enjeux phytosanitaires pour l’agriculture et l’environnement. Lavoisier, Paris 36. El-Sayed AM, Delisle J, De Lury N, Gut LJ, Judd GJR, Legrand S, Reissig WH, Roelofs WL, Unelus CR, Trimble RM (2003) Geographic variation in pheromone chemistry, antennal electrophysiology, and pheromone-mediated trap catch of North American populations of the oblique-banded leaf-roller. Environ Entomol 32:470–476 37. Delisle J (1992) Monitoring the seasonal male ﬂight activity of Choristoneura rosaceana (Lepidoptera: Tortricidae) in eastern Canada using virgin females and several pheromone blends. Environ Entomol 21:1007–1012 38. BASF (2010) RAK®, the BASF Pheromones, are an alternative method which contributes to the objectives of the “Grenelle de l’environnement”: Stirring things up in the insect world http://www.agro.basf.com/agr/AP-Internet/en/content/news_room/news/rak-the-basfpheromones-are-an-alternative-method-which-contributes-to-the-objectives-of-the-grenellede-lenvironnement. Accessed 17 Nov 2010 39. Mendelsohn R, Balick M (1995) The value of undiscovered pharmaceuticals in tropical forest. Econ Bot 49:223–228 40. Bergvinson DJ, Arnason JT, Hamilton RI, Tachibana S, Towers GHN (1994) Putative role of photodimerized phenolic acids in maize resistance to Ostrinia nubilalis (Lepidoptera: Pyralidae). Environ Entomol 23:1516–1523

6

Trends for Commercialization of Biocontrol Agent (Biopesticide) Products

159

41. Bily A, Reid LM, Taylor JH, Johnston D, Malouin C, Burt AJ, Bakan B, Regnault-Roger C, Pauls KP, Arnason JT, Philogène BJR (2003) Dehydrodimers of ferulic acid in maize grain pericarp: resistance factors to Fusarium graminearum. Phytopathology 93:712–719 42. Regnault-Roger C (2005) Molécules allélochimiques et extraits végétaux dans la protection des plantes: nature, rôle et bilan de leur utilisation au XXe siècle. In: Regnault-Roger C (ed.) Enjeux phytosanitaires pour l’agriculture et l’environnement. Lavoisier, Paris 43. Isman MB (2006) Botanical insecticides, deterrents and repellents in modern agriculture and an increasingly regulated world. Annu Rev Entomol 50:45–66 44. Isman MB (1997) Neem insecticides. Pesticide Outlook 8:32–38 45. Isman MB (2005) Problems and opportunities for the commercialization of botanical insecticides. In: Regnault-Roger C, Philogène BJR, Vincent C (eds.) Biopesticides fo plant origin. Lavoisier/Intercept, Paris/Andover 46. Matsumura F (1985) Toxicology of insecticides, 2nd edn. Plenum Press, New York 47. Ware GW (2000) The pesticide book, 5th edn. Thomson Publication, Fresno 48. Thacker JMR (2002) An introduction to arthropod pest control. Cambridge University Press, Cambridge 49. EPA (2008) Reregistration eligibility decision for nicotine list B case no 2460 OPP-2005-0231 Mar 2008 50. OJEU (2009) Ofﬁcial journal of European Union. Commission Decision of 8 December 2008 concerning the non-inclusion of nicotine in Annex I to Council Directive 91/414/EEC and the withdrawal of authorisations for plant protection products containing that substance. L5/7. 9 Jan 2009 51. EPA (2006) Reregistration eligibility decision for pyrethrins RED list B case no 2580, EPA 738-R-06-004, June 2006 52. OJEU (2008) Ofﬁcial Journal of European Union. Commission Decision of 18 December 2008 amending Council Directive 91/414/EEC to include several active substances. L 344/89. 20 Dec 2008 53. Regnault-Roger C, Philogène BJR, Vincent C (2008) Biopesticides d’origine végétale, 2nd edn. Lavoisier, Paris 54. Weinzeirl R (1998) Botanicals insecticides, soaps and oils. In: Rechcigl JE, Rechcigl NA (eds.) Biological, biotechnological control of insect pest. Lewis Publishers, Boca Raton 55. Betarbet R, Sherer TB, MacKenzie G, Garcia-Osuna M, Panov AV, Greenamyre JT (2000) Chronic systematic pesticide exposure reproduces features of Parkinson’s disease. Nat Neurosci 3:1301–1306 56. EPA (2007) Reregistration eligibility decision for rotenone EPA 738-R-07-005, Mar 2007 57. OJEU (2008) Ofﬁcial Journal of European Union. Commission Decision of 10 April 2008 concerning the non-inclusion of rotenone, extract from equisetum and chinin-hydrochlorid in Annex I to Council Directive 91/414/EEC and the withdrawal of authorisations for plant protection products containing these substances. L 108/30. 18 April 2008 58. Schmutterer H (1990) Properties and potential of natural pesticides from the neem tree. Annu Rev Entomol 35:271–297 59. EPA (1995) Neem oil, tolerance exemptions. FR Doc 95–29991. http://www.epa.gov/EPAPEST/1995/December/Day-13/pr-494.html. Accessed 1 Aug 2008 60. Kleter GA, Poelman M, Groot MJ, Marvin HJP (2006) Inventory of possible emerging hazards to food safety and an analysis of critical factors. Report 2006.010 RIKILT. htpp://www.rikilt. wur.nl. Accessed 1 Aug 2008 61. Boeke SJ, Boersma MG, Alink GM, van Loon JJ, van Huis A, Dicke M, Rietjens IM (2004) Safety evaluation of neem (Azadirachta indica) derived pesticides. J Ethnopharmacol 94:25–41 62. Falconer IR, Chapman HF, Moore MR, Ranmuthugala G (2006) Endocrine-disrupting compounds: a review of their challenge to sustainable and safe water supply and water reuse. Environ Toxicol 21:181–191 63. Pfau W, Bieler C, Neurath G (2009) Safety of Azadirachtin. Toxicol Lett 189(Sup 1):S214

160

C. Regnault-Roger

64. PAN (2010) Pesticide action network pesticide database chemicals. Azadirachtin- identiﬁcation, toxicity, use, water pollution potential, ecological toxicity and regulatory information http:// www.pesticideinfo.org/Detail_Chemical.jsp?Rec_Id=PC35467. Accessed 4 April 2010 65. Kleeberg H (2006): Demands for plants protection products- risk assessment botanicals and semiochemicals REBECA workshop, Brussels, 13–14 June 2006; http://www.rebeca.net.de/ downloads/Risk%20assessment%20botanicals%20semiochemicals%20Minutes.pdf. Accessed 26 July 2007 66. Goktepe I, Portier R, Ahmedna M (2004) Ecological risk assessment of neem-based pesticides. J Environ Sci Health B 39:311–320 67. Kreutzweiser DP (1997) Nontarget effects of neem-based insecticides on aquatic invertebrates. Ecotoxicol Environ Saf 36:109–117 68. Philogène BJR, Regnault-Roger C, Vincent C (2008) Biopesticides d’origine végétale: bilan et perspectives. In: Regnault-Roger C, Philogène BJR, Vincent C (eds.) Biopesticides d’origine végétale, 2nd edn. Lavoisier, Paris 69. National Research Council (NRC) (1992) Neem tree for solving global problems. National Academic Press, Washington, DC 70. Brahmachari G (2004) Neem–an omnipotent plant: a retrospection. Chem BioChem 5:408–421 71. Kleeberg H (2008) Le Neem, un agent de contrôle biologique à base d’extraits végétaux. In: Regnault-Roger C, Philogène BJR, Vincent C (eds.) Biopesticides d’origine végétale, 2nd edn. Lavoisier, Paris 72. Regnault-Roger C, Philogène BJR, Vincent C (2005) Biopesticides of plant origin. InterceptLavoisier, Andover/Paris 73. Kleeberg H, Ruch B (2006) Standardization of neem-extracts. In: Proceedings of International neem conference, Kunming, China, 11–15 Nov 2006 74. EPA (2001) Azadirachtin (121701) clariﬁed hydrophobic extract of neem oil (025007) fact sheet. http://www.epa.gov/pesticides/biopesticides/ingredients/factsheets/factsheet_025007. htm. Accessed 1 Aug 2008 75. OJEU (2008) Ofﬁcial Journal of European Union. Commission Decision of 8 December 2008 concerning the non-inclusion of certain active substances in Annex I to Council Directive 91/414/EEC and the withdrawal of authorisations for plant protection products containing these substances. L 335/91.13 Dec 2008 76. El Modafar C, El Boustani ES, El Aabidine AZ (2008) Rôle des polyphénols dans la défense naturelle des plantes contre les phytopathogènes. Résistance du palmier dattier à la fusariose. In: Regnault-Roger C, Philogène BJR, Vincent C (eds.) Biopesticides d’origine végétale, 2nd edn. Lavoisier, Paris 77. Zeller W (2006) Status of biocontrol methods against ﬁre blight. Phytopathol Pol 39:71–78 78. Konstantinidou-Doltsinis S, Markellou E, Kasselaki AM, Fanouraki MN, Koumaki CM, Schmitt A, Liopa-Tsakalidis A, Malathrakis NE (2006) Efﬁcacy of Milsana (R), a formulated plant extract from Reynoutria sachalinensis, against powdery mildew of tomato (Leveillula taurica). Biocontrol 51:375–392 79. Pajot E, Regnault-Roger C (2008) Stimulation des défenses naturelles des plantes et résistance induite: une nouvelle stratégie phytosanitaire? In: Regnault-Roger C, Philogène BJR, Vincent C (eds.) Biopesticides d’origine végétale, 2nd edn. Lavoisier, Paris 80. Walters DR, Walsh D, Newton A, Lyon G (2005) Induced resistance for plant disease control: maximizing the efﬁcacy of resistance elicitors. Phytopathology 95:1368–1373 81. UIPP (2010) Union des Industries de Protection des Plantes, Rapport d’activité 2009–2010, http://www.uipp.org/var/uipp/storage/original/application/80618e57018a9f5ae4066b9199c88 cd1.pdf. Accessed 24 Nov 2010 82. Damoiseau L (2009) ABIM à Lucerne, le biocontrôle dépasse l’agrobio. Phytoma 629:39–41 83. Hagan A (2005) Alfa-guard cleared for aﬂatoxin suppression in shell-peanuts plant pathology series, extension plant pathology, 30: 556, http://www.aces.edu/timelyinfo/PlantPathology/2005/ March/pp586.pdf. Accessed 17 Nov 2010 84. REBECA (2010) Final activity report, http://www.rebeca-net.de/?p=320. Accessed 24 Nov 2010

Chapter 7

The Role of Indigenous Knowledge in Biological Control of Plant Pathogens: Logistics of New Research Initiatives Arun Kumar and A.K. Purohit

Abstract The Indigenous knowledge (IK) and Bio control exist in a synergy in the strategic repertory of sustainable agriculture. The IK is the systematic body of knowledge acquired by local people through the accumulation of experiences, informal experiments, and intimate understanding of the environment in a given culture. These cultural practices have sustained the farmers from the ancient times, which are often validated as modern conceptual shifts in the agricultural science. The age old farmers’ practice of planting number of different crop combinations is currently recognized as crop diversiﬁcation- successful in averting diseases, and surviving during drought periods besides other advantages. Increasing use of fungi as mycoinsecticides and biocontrol agents for managing insect pests and plant diseases has opened a vast ﬁeld of knowledge for studying this huge unexploited fungal resource. Many naturally occurring microorganisms have been used to control diseases. Besides fungi, induced resistance has emerged as a new strategy for managing plant diseases using Plant Growth Promoting Rhizobacteria (PGPR), leaf proteins, botanicals, animal products, organic manures and other IK materials such as ash, butter and milk. The present paper has extensively reviewed the researches made on documentation and validation of indigenous knowledge worldwide during the last decade with some convincing success stories. Attempts have also been made to reckon the logistics of new research initiatives in the wake of plateaus in agricultural production and spot marching researches on underlying mechanisms of IK and bio-control. The new insights being generated as plant neurobiology, plant intelligence, A. Kumar (*) Division of Plant Sciences and Biotechnology, Central Arid Zone Research Institute, Jodhpur, Rajasthan 342003, India e-mail: [email protected] A.K. Purohit Transcience Transactions, Jodhpur, Rajasthan 342001, India e-mail: [email protected]

J.M. Mérillon and K.G. Ramawat (eds.), Plant Defence: Biological Control, Progress in Biological Control 12, DOI 10.1007/978-94-007-1933-0_7, © Springer Science+Business Media B.V. 2012

161

162

A. Kumar and A.K. Purohit

consciousness and genopsych have been amalgamated to underline the knock of a yet another paradigm shift in ofﬁng- the shift from integration to convergence, where simultaneous to intra- and inter-disciplinary research, trans-disciplinary research at the interface of advents in nano-technology and emergent situations of system biology, is poised to trigger a fresh sigmoid growth in research outcome pushing IDM at the threshold of converging technologies for sustainable agricultural production.

7.1

Introduction

Domestication of plants was probably the most signiﬁcant turning point in the human history as agriculture replaced hunting and food collection from the purview of human activity. It is presumed that sustainable disease control practices must have evolved with the development of agriculture [1]. Indigenous knowledge (IK) is the systematic body of knowledge acquired by local people through the accumulation of experiences, informal experiments, and intimate understanding of the environment in a given culture [2]. Local people, including farmers, landless labourers, women, rural artisans, and cattle rearers, are the custodians of indigenous knowledge systems. Moreover, these people are well informed about their own situations and resources. In other words IK is tuned to the needs of local people and the quality and quantity of available resources, along with a natural system of preserving ecological balance [3]. Diversiﬁed agro-ecosystems have emerged over centuries of biological evolution, and represent the experience of farmers interacting with their environment without access to external inputs, capital, or scientiﬁc knowledge [4]. The efﬁciency of indigenous practices lies in the capacity to adapt to changing circumstances and recycling of natural resources. The IK is a product of experience followed by informal experimentation. It relies strongly on intuition, directly perceivable evidence, and an accumulation of historical experiences [5]. In scientiﬁc colloquium, IK is analogous to technology generation as conceived in on farm trials. The formal experiments are required for the function of technology validation. In view of the fast changing agricultural scenario, a drift has resulted from sustenance to commercial farming. To maximize the yield, farmers are using high yielding varieties and hybrids with higher inputs of chemical fertilizers and pesticides to a large extent. The newly released hybrids, indiscriminate and injudicious use of fertilizers and pesticides have resulted in susceptibility to various diseases and pests. Besides this, a number of other problems such as soil, water and air pollution, residual toxicity in fruit and vegetables, resistance to insects and pathogens, mortality of parasites, predators and pollinators, and resurgence with outbreaks of secondary pests have also cropped up. With increasing environmental awareness, the focus has now shifted towards search for viable alternatives of disease control methods. At the Earth Summit in Rio, Brazil in June 1992 and the International Movement for Ecological Agriculture meeting held in Penang, Malaysia during January 10–13, 1990 also called for natural

7 The Role of Indigenous Knowledge in Biological Control of Plant Pathogens…

163

farming based on traditional experiences [6]. Amidst a web of high throughput technologies, low external input sustainable agricultural (LEISA) technologies are in great demand. Apparently, it sounds logical to once again look for traditional practices, which are ecologically non-disruptive and stable. Sustainability is a new paradigm for modern agriculture. Answering this challenge will take the form of dialectic between our understanding of available practices and our expanding knowledge of ecological relationship in agro-ecosystems. Traditional farming systems are one of the sources of ‘non-chemical’ disease management strategies. The other two sources are biotechnology and biological control [7]. The simple cultural practices such as increasing the seed rate to compensate for pest damage, adjusting the time of sowing to avoid pest damage, intercropping, trap cropping and crop rotation have been found to provide adequate protection from pest damage with no additional cost and without harmful effects on the environment. Traditional farming practices are developed by agrarian societies and traditional farming systems in particular ecological setting. Sustainability in these systems has been derived after a long tenure through trial and error with crops and their cultivation practices [8, 9]. Despite plethora of evidences on ﬁeld efﬁcacy of IK, a great resurgence of interest in biological control and inclusion of practices in Integrated Disease and Pest Management; the relative volume of literature on technology validation, especially through understanding mechanism of action is very meager. The present review, besides documenting the global scenario of interest in IK and biocontrol, attempts to anticipate, logistics of new research needs.

7.2

Disease Management in Traditional Farming Systems

Traditional farming systems have been in existence in India since the time of “Vedas” (2500–1500 B.C.) and “Upanishads” (1500–600 B.C.). The “Vrikshayurveda,” “Agnipurana,” “Brihat Smahitha” and “Arthasastra” (fourth Century B.C.) contain separate sections on Indian agriculture. These texts reveal that the ancient science of agriculture dealt with the collection and selection of seeds, germination, grafting, cutting, sowing, planting, nursing, soil selection, manuring, pest and disease management, nomenclature and taxonomy. The land and its proper utilization occupied an important position in agriculture and traditional farmers were conscious of the nature of soil and its relation to the production of speciﬁc crops [10]. However, an interesting observation has been made by Bentley [11] that farmers generally know more about plants, less about insects and still less about plant pathology. Traditional farming techniques have been widely practiced in Korea, Japan, India and China for centuries and are still in use in aboriginal communities. It is heartening to ﬁnd that the United States, Holland and Australia are pioneers among the developed nations which are gradually turning to ecological agriculture. Sustainable agriculture should combine the wisdom of traditional and natural farming practices with modern technologies. Most of the practices of traditional

164

A. Kumar and A.K. Purohit

farmers for disease management in developing countries consist of cultural controls, yet little information is available and utilized. Some practices of traditional farmers are altering of plant and crop architecture, biological control, burning, depth or time of planning, fallowing, ﬂooding, mulching, multiple cropping, planting without tillage, using organic amendments, crop rotation and sanitation [12, 13]. The disease resistance of traditional cultivars selected over millennia is also most important. Landraces are usually genetically diverse and in balance with their environment and endemic pathogens. Though, not necessarily high yielding, landraces to yield some harvest even under the worst conditions. As far as sustainability of traditional practices is concerned it has been reported by Thurston [14] that most of the traditional practices are sustainable.

7.3

Traditional Farmers’ Practices for Managing Plant Diseases

Farmers’ knowledge is very broad, practical and comprehensive. Most of the cultural practices are sustaining resource-poor farmers from ancient times. There are number of examples given by Thurston [14] to illustrate this. Conklin [15] has reviewed the agricultural knowledge of mountain tribe of Mindoro in the Philippines. Likewise, Mayan Indians in Mexico and traditional farmers of Honduras have impressive knowledge of soil types; plant classiﬁcation system, local agro-ecosystem and general information about plants (see [14]). India, being a very old civilization, has rich knowledge about agricultural practices and different farming systems. Efforts are being made to document that information lying in ancient literatures. Some of the dedicated groups are striving to bring out farmers’ wisdom in the form of books, journal articles and in the form of English translations of literature available in Sanskrit, Arabian, Persian and other regional languages [16–22].

7.3.1

Traditional Fungicides

The key to effective plant health management is prevention. This includes doing your homework before planting by carefully matching plants those are appropriate to the type of soil, sunlight levels, and watering conditions of the site. Once the plants are in the ground, successful plant health management relies on proper sanitation, appropriate fertilization, and necessary pruning practices. Small numbers of farmers use chemical pesticides, but a large chunk of farmers cannot afford them due to high price and toxic effects on humans, livestock and the environment, if used injudiciously. Farmers in India have been traditionally using ‘ashes’ from burning coal and wood for their crop ﬁelds. This has a number of advantages: (i) it makes the soil loose and arable; (ii) it contains potash (2.5–12%), phosphorus (1.6–4.2%) and

7 The Role of Indigenous Knowledge in Biological Control of Plant Pathogens…

165

nitrogen (0.5–1.9%); (iii) its application also reduces the incidence of pests like ‘thrips’ and ‘leaf blight’ bacterial disease[6]. In arid areas of western Rajasthan, India, farmers use to call the ash as ‘lichhmi’means the godess of prosperity. Farmers used to dust the ash (50–60 kg ha−1) on the growing crop of cumin (Cuminum cyminum) to ward off powdery mildew, on lucerne (Medicago sativa) to check the growth of dodder (Cuscuta sp.).

7.3.2

Cultural Practices

1. Adjusting density and spacing: It is known that dense plant populations inﬂuence plant disease resulting into epidemics [23]. Due to change in micro-climate relative humidity increases with relative uniformity in temperature. Intercropping is the common practice among the farmers knowing the importance of the role of spacing between plants and rows. Close cropping situations help in disseminating foliar pathogens along with soil-borne fungi, damping-off organisms and transmission of viruses [24, 25]. However, the reverse is true in case of groundnut (peanut) rosette disease in Africa. It has been observed that early planting and close spacing increased yield and reduced the incidence of the virus [13, 26]. 2. Multiple cropping: Planting number of different crop combinations is a common practice in the traditional farming systems. The 50–80% farmers of developing tropical countries used to do intercropping in the rain fed areas [27]. In arid areas, traditional ‘mixture’ sowing is practiced. Seeds of pearl millet are sown with rainy season legumes (mung bean, moth bean and cluster bean) and sesame in the ratio of 7:1. Besides this, some farmers also grow cucurbits (melon, Citrullus spp. etc.) in addition to legumes. This practice is used to minimize the crop losses due to onset of drought or pests and diseases along with the problem of ‘rode’ or soil crusting [28]. 3. Fallowing: This is an age-old tradition. Ancient Sumerians (now Iraq) used to practice fallowing for cereal ﬁelds [29]. It is a very successful practice for managing soil-borne fungi and nematodes. It becomes more effective when used in combination with crop rotation. It is an old traditional practice in desert areas where crops are not planted in a fallowed ﬁeld for 2–4 years. However, the practice of fallowing is gradually becoming less popular among young farmers because of shrinking land resources. 4. Crop rotation: Growing economic plants in recurring succession and in deﬁned sequence on the same land is a common practice among the farmers. This helps in managing both soil- and air-borne pathogens. Though, it is more a location speciﬁc practice but it has a lot of advantages. It helps prevent soil depletion, maintains soil fertility and reduces soil erosion and controls weeds. Crop rotation as a means to control to insect pests is most effective when the pests are present before the crop is planted have no wide range of host crops; attack only annual/ biennial crops; and do not have the ability to fly from one field to another. In some irrigated pockets of arid district of Barmer, India, which is a double

166

A. Kumar and A.K. Purohit

cropped area having facilities of sprinkler irrigation, farmers are rotating the cash crop of cumin with brown mustard or raya (Brassica juncea) and wheat in the winter season and with pearl millet during rainy season to reduce the incidence of fusarial wilt [30]. 5. Flooding: The practice of ﬂooding has been used mainly for insect and weed management [31, 32]. Farmers control leaf miner (Aproaerema modicell) of groundnut by ﬂooding ﬁeld to submerge the crop overnight and letting out water on the next morning. It has been reported that fungi, bacteria and actinomycetes decline in ﬂooded soils. The anaerobic or near anaerobic conditions produced by ﬂooding help in reducing many soil-borne fungi and nematodes [33]. Thurston [14] has discussed the practice at length with the beneﬁts in suppression of plant diseases, especially in the management of fusarial wilt of bananas and other soil-borne pathogens. Farmers of Pali district in semi-arid western Rajasthan used to ﬂood their ﬁelds even during the rains to suppress the attack of sooty mould (Leptoxyphium fumago) and Vermiculariopsiella sp. growing on leaf secretions of some insect. The farmers claimed to have successfully eliminated the disease using this practice [34, 35]. 6. Suppressive soils: The phenomenon of disease suppressive soils has fascinated plant pathologists for decades. Suppressive soils are those in which a speciﬁc pathogen does not persist despite favorable environmental conditions, the pathogen establishes but doesn’t cause disease, or disease occurs but diminishes with continuous monoculture of the same crop species. The phenomenon is believed to be biological in nature because fumigation or heat-sterilization of the soil eliminates the suppressive effect, and disease is severe if the pathogen is re-introduced. Suppressive soils are living laboratories where the complex interactions among microorganisms that result in disease suppression might someday be unraveled. Characterization of biological communities in soil has proved to be a formidable challenge, and the nature of disease-suppressive soils remains largely an enigma. Suppressive soils have nevertheless proved to be sources of some important antagonists and they continue to provide clues useful in developing biocontrol strategies [36]. Sulfur containing compounds released during the breakdown of crucifer tissues may act as soil fumigants, resulting in less disease. There are many other examples of biological control involving complex microbial communities where the mechanism of biological control is not understood. This includes the use of green manures to control soil-borne pathogens.

7.4

Biological Control Agents in Disease Management of Plants

Effective management of diseases thus becomes an absolute necessity. So far this has been achieved by the use of chemical, cultural, biological and various other techniques. However, among the various disease management strategies adopted, chemical control has emerged as the dominant strategy, and has been the cause of

7 The Role of Indigenous Knowledge in Biological Control of Plant Pathogens…

a

b

167

Pathogen

Pathogen

Host

Environment

Biological Agent(s)

Host Environment

Fig. 7.1 (a) Disease triangle (b) Biological control disease pyramid

mounting concern in recent years. The injudicious application of these chemicals has resulted in development of resistance in pathogens and health hazards in the users. Non-biodegradable pesticides have contaminated soil, food chain and water bodies, and in turn become a major component of environmental pollution. With increasing environmental awareness the focus has now shifted towards search for viable and sustainable alternatives of disease control methods. Amidst a web of high throughput technologies, low external input sustainable agricultural (LEISA) technologies are in demand. A number of cultural practices such as growing genetically similar crop plants in continuous monoculture and plant cultivars susceptible to pathogens, and use of nitrogenous fertilizers at concentrations that promote disease susceptibility have actually enhanced the destructive potential of diseases. In the wake of prevailing situation the concept of biological control has been re-surfaced. The multitude of methods used in biological control can broadly be divided into two groups- (1) antagonists directly introduced into plant tissue and (2) cropping conditions and other factors can be modiﬁed in ways to promote the activities of naturally occurring antagonists. The reports of direct introduction of antagonists are less frequent; however, inducing resistance in the host by inoculating non-pathogenic or avirulent strains of a pathogen has been commonly demonstrated. Antibiosis, competition and hyper-parasitism are the recognized ways of operating biological control outside the host and may be used together with existing fungicides in integrated disease management strategies to reduce the risk of building up resistance in pathogen. Occurrence of any plant disease is the consequence of the interaction among the susceptible host, virulent pathogen and the favourable environment referred as the disease triangle (Fig. 7.1a). Biological control agents interact with the components of the disease triangle to reduce the incidence of disease. The concept of biological control pyramid is formed by separating the biological control agents from the environmental component of the disease triangle (Fig. 7.1b). This biological control pyramid helps in conceptualizing the factors and their intricate interactions, which play a major role in disease control strategy.

168

A. Kumar and A.K. Purohit

The term ‘Biological control’ is commonly used and includes plant disease resistance, biologically derived pesticides, crop rotation etc. Here we are using the term as disease control-mediated by an additional organism(s), which changes the result of interaction between the environment, pathogen and host. Biotechnology for crop protection, is receiving considerable attention today. Many studies are now under way to improve the crop production through genetic engineering and expression of insect and virus resistant genes and microbial pesticides. An area of agricultural biotechnology in which fungi show considerable potential for the future is the biological control of pathogenic fungi, insect pests and weeds [37]. Potential agents for biocontrol activity are rhizosphere-competent fungi and bacteria, which in addition to their antagonistic activity are capable of inducing growth responses either by controlling minor pathogens or by producing growthstimulating factors. Biological control proves to be very successful economically, and even when the method has been less successful, it still produces a beneﬁt-to-cost ratio of 11:1. The organisms, which can be cultured with ease, have maximum potential as commercial product. Unlike the past studies, more ecologically sound approaches involving a combination of organisms is currently being used by a number of workers [38]. Increasing use of fungi as myco-insecticides and biocontrol agents for managing insect pests and plant diseases has opened a vast ﬁeld of knowledge for studying this huge unexploited fungal resource [39]. The biocontrol methods, such as compost, seed bacterization, fungal biocontrol agents (Trichoderma), seed treatments, induced systemic resistance, genetic manipulation and induced resistance using pathogens and non-pathogens that seem to be useful in managing the diseases are discussed in this paper.

7.4.1

Competition

Competition occurs between microorganisms when space or nutrients (i.e. carbon, nitrogen and iron) are limiting, and its role in the biocontrol of plant pathogens has been studied for many years, with special emphasis on bacterial biocontrol agents. An important attribute of a successful rhizosphere biocontrol agent would be the ability to remain at high population density on the root surface, providing protection to the whole root for a longer period of time. Mycorrhizal fungi can also be considered to act as a sophisticated form of competition or cross-protection, decreasing the incidence of root disease.

7.4.2

Antibiosis

Antibiosis is deﬁned as inhibition of the growth of one microorganism by another as a result of diffusion of an antibiotic. Antibiotic production is very common among soil-dwelling bacteria and fungi, and in fact many of our most widely used

7 The Role of Indigenous Knowledge in Biological Control of Plant Pathogens…

169

medical antibiotics (e.g., streptomycin) are made by soil microorganisms. Antibiotic production appears to be important to the survival of microorganisms through elimination of microbial competition for food sources, which are usually very limited in soil. The production of antibiotics by actinomycetes, bacteria and fungi has been adequately demonstrated in vivo. Numerous agar plate tests have been developed to detect volatile and non-volatile antibiotic production by putative biocontrol agents and to quantify their effects on pathogens. Species of Gliocladium and/or Trichoderma are well-known biological control agents that produce a range of antibiotics that are active against pathogens in vitro [40]. Within bacterial biocontrol agents several species of Pseudomonas produce antibiotics to control plant pathogens.

7.4.3

Mycoparasitism

This is parasitism of a pathogenic fungus by another fungus. It involves direct contact between the fungi resulting in death of the plant pathogen, and nutrient absorption by the parasite. Mycoparasitism occurs when one fungus exists in intimate association with another from which it derives some or all its nutrients while conferring no beneﬁt in return. Biotrophic mycoparasites have a persistent contact with living cells, whereas necrotrophic mycoparasites kill the host cells, often in advance of contact and penetration. Mycoparasitism is a commonly observed phenomenon in vitro and in vivo, and its mode of action and involvement in biological disease control has been reviewed. The most common example of mycoparasitism is that of Trichoderma spp., which attack a great variety of phytopathogenic fungi responsible for the most important diseases, suffered by crops of major economic importance worldwide.

7.4.4

Control of Insect Pest

Over 400 species of fungi attack insects and mites, so there is great potential for the use of these organisms as biological insecticides. As insect biocontrol agents, fungi are markedly superior to other microorganisms because they are generally non-speciﬁc in their action and are useful against a wide range of insect pests. Most of these entomopathogenic fungi belong to the classes’ Phycomycetes and Deuteromycetes of division Mycophyta (Table 7.1). Spores of these fungi attack the external or gut cuticle of their insect hosts. Death may result from the production of a toxin secreted by the fungus or following the direct utilization of the body ﬂuids. Insecticidal toxins produced by fungi are non-enzymic in nature having low molecular weight, which can kill insects when present even at low concentrations. The best examples of the use of fungi to control insects are provided by species of Beauveria and Metarhizium. Almost all the acridid pests are highly susceptible to

170

A. Kumar and A.K. Purohit

Table 7.1 Principal Deuteromycetes fungal species for biocontrol of insects

Species Aschersonia aleyrodis Beauveria bassiana Beauveria brongniartii Hirsutella thompsonii Metarhizium anisopliae Nomuraea rileyi Verticillium lecanii

Target pests Whiteﬂies Colorado beetle Cockchafers Rust mites Beetles, bugs, grasshoppers, Caterpillars Aphids, whiteﬂies

the fungus requiring about 1,000 spores or even less to infect and kill 50% of a population in 10 days at 28°C. Metarhizium is promising as a mycoinsecticide for use against locusts and grasshoppers. Constant temperatures between 20°C and 35°C (optimum 28–30°C.) facilitate the fungal infestation of these insects. Fungus is effective under ﬁeld conditions when sprayed at a rate of 1–5 × 1012 conidia ha−1 using an oil-based ULV spray or an oil/water emulsion using a boom sprayer. There is great commercial interest in developing a product for the biocontrol of locust and grasshopper.

7.4.5

Fungal Metabolites

Biologically active secondary fungal metabolites produced are not only being evaluated as potential pesticides but also for controlling plant growth. These compounds have the advantage over conventional pesticides in being effective at very low concentrations while proving essentially non-persistent and harmless to the environment.

7.4.6

Mycorrhizal

Mycorrhiza are symbiotic associations between soil fungi and higher plants. There are around 150 species in Zygomycotina having obligate symbiotic association with agricultural crops. These associations are known to produce growth promoters and induce resistance to plants against different pathogens. It was soon recognized that mycorrhizal association could often greatly increase the rate of uptake of nutrients such as nitrogen and phosphorus from nutrient-deﬁcient soils. This has led to the view that the inoculation of mycorrhizal fungi in soils should lead to an increase in the uptake of these essential plant nutrients. Two types of mycorrhiza have been recognized, the endotropic or vesicular-arbuscular mycorrhiza (VAM), and the ectotrophic type. In VAM the fungal partner is restricted to the cells of the plant cortex where it grows within and without the cells, invading the host cells at intervals to form a dichotomously branched structure called the arbuscle, thought to be the site of nutrient exchange between plant and fungus. The fungal partner

7 The Role of Indigenous Knowledge in Biological Control of Plant Pathogens…

171

appears to have no independent existence is soil. Neither is the interaction speciﬁc, since a single species of fungus can infect a wide range of plant, including most crop species. In ectotrophic mycorrhizas, the fungal partner forms a tight sheath around the plant root and from this sheath hyphae grow into the outer cortex to form a network called the Hartig net. Ectotrophic mycorrhizas, unlike VAM, tend to be non-speciﬁc. Vesicular-arbuscular mycorrhizas can directly enhance the uptake by plants of essential nutrients such as phosphorus, copper and iron on the other hand; zinc and manganese uptake may be reduced. Therefore, mycorrhizal associations protect some plants from the toxic effects of these elements. Ectotrophic mycorrhizas also show enhanced uptake of phosphorus, and by mineralizing organic nitrogen facilitate availability of nitrogen to the plant. They may also protect their plant hosts from heavy metals and attack by pathogens, and they also help increase the uptake of water from soil to plants.

7.5

Biocontrol of Airborne Diseases

Many naturally occurring microorganisms have been used to control diseases on the aerial surfaces of plants. The most common bacterial species that have been used for the control of diseases in the phylloshpere include Pseudomonas syringae; P. ﬂuorescens, P. cepacia, Erwinia herbicola, and Bacillus subtilis. Fungal genera that have been used for the control of air borne diseases include Trichoderma, Ampelomyces, and the yeasts Tilletiopsis and Sporobolomyces. Wan and Tian [41] studied the effect of ammonium molybdate (NH4Mo) as an additive to improve biocontrol efﬁcacy of antagonistic yeasts Rhodotorula glutinis and the use of NH4Mo is a practical approach to improve the efﬁcacy of R. glutinis for post harvest disease control. Phytopathogenic bacteria possess several genes that encode phenotypes that allow them to parasitize plants and overcome defense responses elicited by the plant. In addition, phytopathogenic bacteria possess pathogenicity genes like hrp. Isogenic avirulent mutants can be produced by insertional inactivation of genes involved in pathogenicity. Antibiosis has been proposed as the mechanism of control of several bacterial and fungal diseases in the phyllosphere. Recently, the advances of plant and plant growth promoting bacterial (PGPB) interaction research focusing on the principles and mechanisms of action of PGPB (both free living and endophytic bacteria) and their potential use in biological control of plant diseases is reviewed by Compant et al. [42]. Molecular biological techniques could be used to enhance the efﬁcacy of biocontrol agents that use antibiosis as a mode of action. Biocontrol agents must normally achieve a high population in the phyllosphere to control other strains, but colonization by the agent may be reduced by competition with the indigenous microﬂora. Integration of chemical pesticides and biocontrol agents has been reported with Trichoderma spp. and P. syringae. Biocontrol agents tolerant to specific pesticides could be constructed using molecular techniques.

172

7.6

A. Kumar and A.K. Purohit

Biocontrol of Soil-Borne Diseases

Chemical control of soil-borne plant diseases is frequently ineffective because of the physical and chemical heterogeneity of the soil, which may prevent effective concentrations of the chemical from reaching the pathogen. Enrichment, conservation and management of microorganisms have been extensively used for the biological control of soil borne plant diseases as well as for promoting plant growth. Fluorescent pseudomonades are the most frequently used bacteria for biological control and plant growth promotion, but the species of Bacillus and Streptomyces have also been used commonly. Competition as a mechanism of biological control has been exploited with soil borne plant pathogens as with the pathogens on the phylloplane. Naturally occurring nonpathogenic strains of Fusarium oxysporum have been used to control wilt diseases caused by pathogenic Fusarium spp. Molecular techniques have been used to remove various deleterious traits of soil borne phytopathogenic bacteria to construct a competitive antagonist of the pathogen. Molecular techniques have also facilitated the introduction of beneﬁcial traits into rhizosphere competent organisms to produce potential biocontrol agents. Chitin and E – (1, 3)-glucan are the two major structural components of many plant pathogenic fungi, except by oomycetes, which contain cellulose in their cell wall and no appreciable levels of chitin. Biological control of some soil borne fungal diseases has been correlated with chitinase production, bacteria producing chitinases or glucanases exhibit antagonism in vitro against fungi. A recombinant Escherichia coli expressing the chi A gene from Sclerotium marcescens was effective in reducing disease incidence caused by Sclerotium rolfsii and Rhizoctonia solani. In other studies, chitinase genes from S. marcescens have been expressed in Pseudomonas spp. and the plant symbiont Rhizobium meliloti. Shahnaz et al. [43] have reported biological control of soil borne, root-infecting fungi (Fusarium spp., Macrophomina phaseolina and Rhizoctonia solani) on mung bean and okra using strains of Rhizobium and Bradyrhizobium spp. All rhizobial treatments were effective in controlling the soil borne fungi on these plants. The rhizobial strains also increased nodulation as well as shoot and root growth of treated plants. The effectiveness of certain on-farm weeds as soil amendments was ascertained against Macrophomina phaseolina, a soil-borne pathogen causing dry root rot of crops grown under rainfed conditions in arid regions. Mawar and Lodha [44] have reported signiﬁcant reductions in the population of M. phaseolina with the weed residues. Accordingly, Celosia and Euphorbia residues completely eradicated viable propagules of M. phaseolina. Bio-agents and neem based seed treatment for management of root-rot complex in cluster bean has been studied by Jatav and Mathur [45]. They have observed maximum suppression of Fusarium solani by Bacillus subtilis. However, Rhizoctonia solani was successfully managed by Trichoderma harzianum. It was noted that for R. solani fungal biological control agents were more effective, whereas bacterial antagonists were effective against F. solani.

7 The Role of Indigenous Knowledge in Biological Control of Plant Pathogens…

7.6.1

173

Soil Solarization

This seems to be one of the ﬁeld technologies directly related to the ﬁeld of biological control of soil borne pathogens. A number of studies have been carried out towards managing soil borne pathogens. The effects of soil solarization, residue incorporation, summer irrigation and biocontrol agents on survival of Macrophomina phaseolina have been worked out in the past. Results suggest that in hot arid regions use of Brassica residues can be a practical and feasible substitute for polyethylene mulching in managing soil-borne diseases [46].

7.6.2

Trichoderma – An Environment-Friendly Biocontrol Agent

Species of Trichoderma are one of the small groups of beneﬁcial fungi, which have proven commercially viable as a biological control agent. This micro-organism is now registered as bio-fungicide in India, France, UK, Switzerland, Sweden, Belgium, Chile, New Zealand and the USA, and regulations are pending in several other countries. Trichoderma is completely safe for humans and livestock. Although, it is commonly considered as a contaminant that may cause infections in presence of certain predisposing factors, but in 55 years of research there has been no account of recorded adverse reaction. The predatory qualities of Trichoderma are a big part of the appeal of this fungus along with other associated beneﬁts for commercial applications. The thought of biological control of plant pathogens by mycoparasites (hyperparasites) dates back to Weindling [47]. He discovered that Trichoderma lignorum would parasitize a number of soil borne fungi in culture and suggested controlling certain pathogenic fungi by augmenting soil with an abundance of this mycoparasite. Comprehensive reviews on the subject have been published in the past showing the production of chitinases to break down the mycelial cell walls of fungal plant pathogens as a major cause of biocontrol activity [48–51]. Description and Natural Habitats – Trichoderma is a filamentous fungus that is widely distributed in the soil, plant material, decaying vegetation, and wood. Hypocrea spp. are the teleomorph of some of the Trichoderma species. Trichoderma thrives in the leaf litter or mulch, and it requires a minimum organic carbon level of 1% to ensure proliferation in cropping locations. This species is a myco-parasite or saprophyte, which feeds on pathogenic fungi. There are large number of photographic evidences highlighting this phenomenon where Trichoderma are seen actively parasitizing several group of plant pathogens. Species – The genus Trichoderma has ﬁve major species utilized in biocontrol of plant diseases viz. T. harzianum, T. koningii, T. longibrachiatum, T. pseudokoningii, and T. viride. Morphological features of the conidia and phialides help in differentiation of these species from each other.

174

A. Kumar and A.K. Purohit

Cultural Features – Colonies of Trichoderma grow rapidly and mature within 5 days at 25°C. Its colonies develop as wooly and compact mycelium on potato dextrose agar (PDA) medium. At the time of sporulation scattered blue-green or yellow-green patches are formed. These patches may form concentric rings. They are more readily visible on PDA in comparison to Sabouraud dextrose agar. The fungal growth is pale, tan, or yellowish in colour on the reverse side of cultures. Microscopic Features – Septate, hyaline hyphae, conidiophores, phialides, and conidia are observed. Some of the species like Trichoderma longibrachiatum and T. viride also produce chlamydospores. Conidiophores are hyaline, branched, and occasionally display a pyramidal arrangement. Phialides are hyaline, ﬂaskshaped, and inﬂated at the base. They are attached to the conidiophores at right angles. The phialides may be solitary or arranged in clusters. Conidia (3 Pm in diameter) are one-celled and round or ellipsoidal in shape. They are smooth- or rough-walled and grouped in sticky heads at the tips of the phialides. These clusters frequently get disrupted during routine slide preparation procedure for microscopic examination. The color of the conidia is mostly green. Screening of strains can be conducted in four ways: (1) selection of active strains in relation to plant pathogens (2) screening isolate/s which have high biotechnological indexes (3) analysis of pathogen properties for plant, useful insects, animals and peoples (4) search of low economic value substrates which are convenient for cultivation and saving of spores’ activities. For developing effective biocontrol agent to combat damping-off in nurseries, we investigated fungal strains in the genus Trichoderma that was isolated from soil and fruiting bodies of Ganoderma lucidum [51, 52]. Pathogen Interaction – Mycoparasitism is a complex process, which include several successive steps. The interaction of Trichoderma with its host is speciﬁc. Trichoderma spp. have been extensively studied as biocontrol agents [53]. The ﬁrst detectable interaction shows that the hyphae of the mycoparasite grow directly towards its host. This phenomenon appears a chemotropic growth of Trichoderma in response to some stimuli in the host’s hyphae or toward a gradient of chemicals produces by the host. When the mycoparasite reaches the host, its hyphae often coil around it or are attached to it by forming hook like structures. In this respect, production of appressoria at the tips of short branches has been described for T. hamatum and T. harzianum. The possible role of agglutinins in the recognition process determining the fungal speciﬁcity has been recently examined. Indeed, recognition between T. harzianum and two of its major hosts, R. solani and S. rolfsii, was controlled by two different lectins present on the host hyphae. R. solani carries a lectin that binds to galactose and fructose residues on the Trichoderma cell walls. This lectin agglutinates conidia of a mycoparasitic strain of T. harzianum, but did not agglutinate the non-parasitic strains. This agglutinin may play a role in prey recognition by the predator Moreover, because it does not distinguish among biological variants of the pathogen, it enables the Trichoderma species to attack

7 The Role of Indigenous Knowledge in Biological Control of Plant Pathogens…

175

different R. solani isolates. D-glucose mannose residues inhibited the activity of a second lectin isolated from S. rolfsii, apparently present on the cell walls of T. harzianum. Following these interactions the mycoparasite sometime penetrates into the host mycelium, apparently by partially degrading its cell wall. Microscopic observations led to the suggestion that Trichoderma spp. produce and secrete mycolytic enzymes responsible for the partial degradation of the host’s cell wall. The complexion and diversity of the chitinolitic system of T. harzianum involves the complementary modes of action of six enzymes, all of which might be required for maximum efﬁciency against a broad spectrum of chitin-containing plant pathogenic fungi. The level of hydrolytic enzymes produced differs from host-parasite interaction analyzed. This phenomenon correlates with the ability of each Trichoderma isolate to control a speciﬁc pathogen. It is considered that Mycoparasitism is one of the main mechanisms involved in the antagonism of Trichoderma as a biocontrol agent along with chemotropic growth, secretion of extra cellular enzymes and lyses of host. Thus, the biocontrol ability of Trichoderma is most likely conferred by a number of mechanisms [40]. Efﬁcacy of the culture ﬁltrates of different species of Trichoderma against the powdery mildew (Leveillula taurica) of cluster bean has revealed that T. viride effectively managed powdery mildew, while T. harzianum recorded the highest yield with percent increase in yield over the control [54, 55].

7.7

Induced Resistance for Plant Disease Control

Induced resistance (IR) is a new strategy for managing plant diseases. It is an alternative procedure to protect plants against disease by activating plants’ own defense mechanisms using speciﬁc biotic or abiotic elicitors [56]. The basic tenet of IR lies in enhancing resistance in response to an extrinsic stimulus without altering the genome. The protection is based on the stimulation of defense mechanisms by metabolic changes that enable the plants to defend themselves more efﬁciently. A number of publications with different host-parasite systems have proven the efﬁcacy of IR against fungi, bacteria and viruses through the manipulation of the host plant’s physical and biochemical properties [57–59]. The elicitors secreted through bio-agents are non-speciﬁc and therefore, can be effective against a wide range of pathogens. These elicitors work by bringing about certain metabolic changes in plants to ﬁght against infections. The landmark studies on the development of the classic Systemic Acquired Resistance (SAR) models were conducted during the 1980s in plants, such as common bean (Phaseolus vulgaris L.) and Arabidopsis thaliana (L.) Heynh, demonstrating that SAR was conserved across diverse plant families and was effective against a broad range of viral, bacterial, and fungal pathogens [60]. Additional interests in the biological control of soil borne diseases of plants led to the unexpected discovery of another form of induced

176

A. Kumar and A.K. Purohit

resistance associated with the colonization of plant roots by certain plant growth promoting rhizobacteria (PGPR), referred to as induced systemic resistance (ISR) [58]. ISR is distinct from SAR in several types of physiological and biochemical phenotypes that are best deﬁned in A. thaliana. Results of laboratory and ﬁeld studies show that, like SAR, ISR is effective against a broad range of diseases caused by viruses, bacteria, and fungi [61–65]. It is likely that other forms of induced resistance exist that vary in their reliance on salicylic acid, ethylene, and Jasmonic acid and other as yet discovered plant regulators. However, it is the availability of chemical inducers of SAR, such as BTH, and the characterization of numerous PGPR strains, that makes the applied use of induced resistance in conventional agriculture a reality. Besides these agents, integration of these bio-agents with indigenous knowledge is also developing in modern times as a logical strategy to manage plant diseases [66]. Milk has been demonstrated to effectively control powdery mildew [67], downy mildew [66] and leaf curl virus [59, 66]. Field experiments involving the effects of INA (2, 6-dichloro-isonicotinic acid) and BTH (benzo-1, 2, 3 thiadiazole7-carbothioic acid) on diseases of legumes have been reported [68–71]. Reduced densities of uredinia of the rust fungus, Uromyces appendiculatus, on trifoliolates of common bean were obtained when INA was applied at least 7 days before inoculation, but not at 2 h before inoculation [71]. An additional application of INA during pod-set did not improve resistance of common bean plants to U. appendiculatus, as opposed to a single application to the ﬁrst trifoliolate [71]. Repeated applications of INA to ﬁeld-grown soybean (Glycine max) partially reduced symptoms of white mold caused by Sclerotinia sclerotiorum in ﬁeld trials. The INA was most efﬁcacious in suppressing white mold on the susceptible cultivars.

7.8

The Use of Composts in Plant Disease Control

Research on natural suppression of fungal plant pathogens has signiﬁcantly increased worldwide during the last decade. The use of complex organic substrates has been shown to be effective in protecting plant health. Composted organic material such as plant debris and animal manure has been used from a very long time to improve fertility. It is known that there is a close connection between soil borne plant disease occurrences and the organic matter content in the soil. The importance of composted organic material in suppressing soil borne pathogens has often been documented. Stimulation of antagonistic microorganisms in the rhizosphere or induced defense reactions in the host plant tissue is considered responsible for the beneﬁcial effects. In general, three approaches have been taken to use organic amendments for biological control: (1) compost amendments added to the soil to suppress powdery mildews; (2) seed treatment to suppress damping-off of seedlings; and (3) foliar application of liquid extracts from compost to suppress foliar diseases. Lodha and Burman [72] applied soil amendment of pearl millet and weed composts for higher seed yield of cluster bean and cowpea.

7 The Role of Indigenous Knowledge in Biological Control of Plant Pathogens…

177

Trichoderma is more commonly found living in the soil rather than in plant tissues. More than 200 strains of the organism have been identiﬁed to date, the majority of which are soil-dwellers. The species produce spores at a tremendous rate, rapidly colonizing the growing areas. Maintenance of adequate organic carbon levels is necessary as carbon is the home base for all beneﬁcial microbes. Commercial products can simply be boom-sprayed or irrigated into the soil, but the best carrier is the compost. Good compost contains high humus and billions of microorganisms, some of which provide metabolites necessary for the proliferation of Trichoderma. The Trichoderma-inoculated compost provides huge numbers of thriving fungal protectors, set up in an organic carbon home-base, which help in ensuring their successful colonization.

7.9

Validating People’s Knowledge: Some Case Studies

Practically sound and encouraging results were recorded when validation of the use of milk against major viral and fungal diseases of arid zone crops were made at Central Arid Zone Research Institute (CAZRI), Jodhpur. These results are discussed here as case studies of using IK practice of raw cow milk with species of farmer-friendly fungi Trichoderma spp. and Gliocladium virens.

7.9.1

Effect of Raw Cow Milk and Gliocladium virens Against Downy Mildew of Pearl Millet

Downy mildew (DM) of pearl millet is the most important disease caused by Sclerospora graminicola (Sacc.) Shroet. occurring in all the millet cultivating tracts of India. Symptoms of the disease appear on ear head with all possible degrees of proliferations and malformations. In malformation the ﬂorets are converted into leafy structures of diverse appearance (Fig. 7.2). Systemic symptoms generally appear on the second leaf in the form of chlorosis at the base of infected leaves followed by production of sporulation on the lower side of leaves known as the ‘half-leaf’ symptom (Fig. 7.3). The disease has caused considerable yield losses, and several single-cross F1 hybrid cultivars of pearl millet have been withdrawn during last 35 years because of high susceptibility to DM [73]. There seems to be a continuous struggle between millet breeders and rapidly evolving races or pathotypes of DM pathogen. In a recent ﬁeld survey conducted in Rajasthan, the higher DM incidence (up to 78%) was recorded on pearl millet hybrids [74]. Pre-sowing treatment of seed with systemic fungicides are commonly used technologies to manage the disease [75]. However, the lack of durable resistance, existence of pathogenic variability, and concerns about fungicide resistance has limited the potential of such strategies for managing the disease. With increasing concern regarding environmental protection

178 Fig. 7.2 Green ear affected lower half of the panicle

Fig. 7.3 Leaf showing downy growth on lower surface

A. Kumar and A.K. Purohit

7 The Role of Indigenous Knowledge in Biological Control of Plant Pathogens…

179

and human health, the use of biological control as an alternative, environment-friendly means for the management of fungal diseases has attracted extensive attention and been considered as a potential strategy for plant disease management in recent years. An alternative procedure to protect plants against disease is to activate their own defense mechanisms by speciﬁc biotic or abiotic elicitors [76]. Biocontrol agents have emerged as a new strategy of managing plant diseases by inducing systemic resistance (ISR) in plants against diseases. A number of publications with different host-parasite systems have proven the efﬁcacy of IR against fungi, bacteria and viruses through the manipulation of the host plant’s physical and biochemical properties [58, 77]. The emerging paradigm of sustainability in agriculture strives to amalgamate modern technology with traditional farming wisdom. Reports are available on the effectiveness of milk as abiotic inducer of resistance in susceptible plants [39, 67, 78–80]. Studies undertaken to manage DM in rainfed crop of pearl millet using eco-friendly approach employing biocontrol agents such as raw cow milk (RCM) together with Gliocladium virens as seed and soil treatments provided encouraging results with 72.9% protection over control [66]. In spite of the intriguing capacity of RCM and Trichoderma spp. to confer protection against a gamut of diseases [39, 78], very little information is available. Therefore, our major objective was to explore the ability of RCM and G. virens to protect pearl millet against DM disease. The fact that RCM and Trichoderma successfully protect pearl millet against DM [66] indicated that these agents might facilitate defense response in pearl millet against DM disease. It has been demonstrated that defense related enzymes have been involved in resistance against pearl milletdowny mildew interaction, and that these enzymes act as biochemical markers for induction of pearl millet downy mildew resistance [75, 81]. In the present study the effects of raw cow milk and G. virens were examined on the possible induction of defense-related metabolites and enzymes for their ability to induce downy mildew disease resistance by seed treatment in pearl millet together with application of G. virens mixed with FYM in soil. A number of chemical compounds and microorganisms (Biocontrol agents or BCAs) are reported to induce resistance against plant diseases [82]. However, so far there has been no report on induction of resistance by raw cow milk and Gliocladium against plant diseases. In this study, an attempt was made to analyze changes in a number of key plant biochemical parameters for biocontrol treated and untreated (control) pearl millet plants to correlate those changes with the resistance induced in the treated plants. The chlorophyll a, b, total chlorophyll and carotenoids contents were evaluated. The concentrations of all pigments were reduced in control leaves when compared with the leaves of treated plants. As shown in Table 7.2, the chlorophyll a, b and total chlorophyll in treated plants were observed higher by 22%; 59% and 31%, respectively in healthy leaves of treated plants. Results showed that in the diseased leaves of treated plants the level of chlorophyll a, b and carotenoids was much higher with 76% increase in chlorophyll a; 141% in chlorophyll b, 90% in total chlorophyll and 106% in carotenoids in comparison to the healthy and diseased leaves of control plants (Table 7.2).

180

A. Kumar and A.K. Purohit

Table 7.2 Effect of biocontrol agents on photosynthetic pigments of healthy and downy mildew diseased pearl millet plant leaves Treated leavesa Untreated leaves −1 Pigments (mg dry wt.) Healthy Diseased Healthy Diseased LSD (P d 0.01) 3.65 1.46 0.231 Chlorophyll a 4.45 (+21.9)b 2.57 (+76.0) Chlorophyll b 1.72 (+59.2) 0.94 (+141.0) 1.08 1.46 0.195 Total chlorophyll 6.18 (30.6) 3.52 (+90.2) 4.73 1.85 0.517 Carotenoids 1.36 (+47.8) 0.70 (+105.8) 0.92 0.34 0.305 a Combination of seed treatment of RCM (1:1, i.e. RCM diluted to 50% by adding water) and G. virens (0.6%) with soil application of G. virens (10 g m−2) b Figures in the parenthesis are % changes in treatment over untreated control

Table 7.3 Effect of biocontrol agents on some metabolite in the treated and downy mildew diseased pearl millet plant leaves Treated leavesa Untreated leaves Metabolite Healthy Diseased Healthy Diseased LSD (P d 0.01) 6.36 (+10.0) 4.65 5.78 0.592 Total phenol 4.73 (+1.72)b Ortho-dihydroxy 0.58 (+13.7) 1.16 (+54.6) 0.51 0.75 0.427 phenol (OD) Free proline 1049.8 (−49.6) 1174.9 (−42.8) 1967.7 2057.2 107.51 Free amino acids 2.08 (−10.7) 2.29 (−18.2) 2.33 2.80 0.192 (Pg g−1 dry wt.) Total soluble sugars 47.10 (−32.1) 60.68 (−4.48) 69.41 63.53 3.128 a Combination of seed treatment of RCM (1:1, i.e. RCM diluted to 50% by adding water) and G. virens (0.6%) with soil application of G. virens (10 g m−2) b Figures in the parenthesis are % changes in treatment over untreated control

Phenolics are substances that are involved in plant-pathogen interactions. Therefore, the contents of total soluble phenols and O-dihydroxy phenol (ODP) were determined in the soluble fraction. The total phenolic content showed increase in healthy (2%) and diseased leaves (10%) of treated plants when compared with that of healthy and diseased leaves of control plants. Likewise, ODP contents exhibited 14% and 55% increase over untreated healthy and diseased leaves, respectively (Table 7.3). Results indicated (Table 7.3) that free amino acids reduced by around 11% in healthy and about 18% in the diseased leaves of treated plants. Similarly, free proline contents were also considerably decreased in treated healthy (47%) and diseased (43%) leaves. Free amino acids are important indicators of the plant conditions, arising as a consequence of protein degradation in tissues under programmed cell death or senescence [83]. Amino acid proline has an important role in physiological and pathological stress in plants [84]. Since little information is available in literature about the role of proline in inducing resistance in plants at the biochemical level [85],

7 The Role of Indigenous Knowledge in Biological Control of Plant Pathogens…

181

Table 7.4 Effect of biocontrol agents on defense-related enzymes in the treated and untreated leaves of pearl millet in relation to downy mildew disease Plant part a −1 Leaves (treated)a Leaves (control) Enzyme (OD) min mg protein) LSD (P d 0.01) Healthy Diseased Healthy Diseased Polyphenol Oxidase (PPO) 0.0054 0.0129 0.0019 0.0101 0.0010 Peroxidase (POX) 6.449 8.037 4.591 5.577 0.7159 Catalase (CA) 0.1075 0.3362 0.0583 0.1762 0.0497 Soluble protein (SP) 24.307 19.82 38.089 22.967 2.6910 a Combination of seed treatment of RCM (1:1, i.e. RCM diluted to 50% by adding water) and G. virens (0.6%) with soil application of G. virens (10 g m−2)

evaluation of endogenous proline content in the leaves of treated and control plants revealed that free proline content were reduced by 47% in the healthy and 43% in diseased leaves of treated plants in comparison to the corresponding healthy and diseased leaves of control plants (Table 7.3). This suggests that the leaf tissues in control plants are under senescence. Results revealed that the levels of the enzymes were considerably higher in treated plants than in water-treated control plants. High activity of PPO was recorded in both healthy (184.2%) and diseased (27.72%) leaves of RCM and G. virens (BCAs) treated plants when compared to the corresponding control plants. However, the low PPO activity (58.13%) was recorded in healthy leaves when compared to the diseased ones in treated plants. The same was also found true in case of control plants. Peroxidase (POX) activity was also increased (28.8%) in healthy and diseased (27.7%) leaves of BCAs treated plants. Interestingly, the catalase (CA) activity was higher in healthy and diseased leaves of the BCAs treated plants by 45.7% and 47.5%, respectively. However, soluble proteins were decreased in the treated plants in comparison to the control ones (Table 7.4). Eco-friendly disease resistance strategies are major components of modern, sustainable agriculture. Induced resistance has emerged as a potential alternative and a complementary strategy for crop protection, which signiﬁes the control of pathogens and pests by prior activation of plants’ innate defense pathways. As milk is not a potential environmental or food contaminant; consequently it can be used in organic agriculture. In India, farmers had the tradition of using milk in managing plant diseases. Milk is known to boost immune systems in the plants and the management of several diseases caused by fungi Sphaerotheca fuliginea [32, 78], and effects of RCM seed treatment together with seed and soil treatments with Gliocladium virens on downy mildew disease of pearl millet are also reported [66]. In this study, an attempt was made systematically to analyze changes in a number of key plant biochemical parameters. The key symptom of DM development is the lighter green colour. This colour change of the DM infected leaves could indicate alterations in plastid metabolism. During the disease process, a

182

A. Kumar and A.K. Purohit

decrease in chlorophyll b levels was observed, which was followed by decreases in chlorophyll a and the carotenoids levels. This decrease probably leads to a reduction in photosynthesis, previously reported for T. cacao infected with C. perniciosa [86]. A number of possible biochemical connections for this phenomenon can be visualized. Furthermore, the reduced photosynthesis could be a negative feedback response to the augmented levels of soluble sugars in the infected tissue. In plants, sugars can work directly as gene regulation signals, attenuating the expression of several plastid-localized nuclear genes required for normal chloroplast development [87], and their presence could reduce the need for photosynthesis and, therefore, the need of pigment synthesis [88, 89]. The high levels of sucrose and glucose in the infected tissues have been observed previously in other biotrophic pathosystems [90]. This study corroborates those previous ﬁndings and found that diseased control plants had a signiﬁcant increase in soluble sugar concentrations when compared with the treated ones. Moreover, the decreases in the chlorophyll concentrations during senescence has been demonstrated to be followed by increases in the concentration of soluble sugars and starch [91], which are somewhat similar to characteristics found in this study. Taken together, the observed biochemical alterations associated with the infection suggest that the plant uses unspeciﬁc mechanisms to try to eliminate the fungus, such as an increase in phenolics. However, these mechanisms seem not to be sufﬁcient to avoid the disease suggests that a cascade of events has been triggered to cause the death of the infected organ. Induction of resistance has been measured by using biochemical markers in the form of induction of defense related enzymes that are activated upon pathogen infection. In the present study, we report the involvement of PPO, POX and catalase during the pearl millet and downy mildew disease interaction. A number of previous studies have shown that enhanced enzyme content of POX, PPO and catalase along with decreased soluble protein is associated with induced resistance against a broad range of pathogens [92–94]. An increase in POX, PPO and CA with decrease in soluble proteins induced by RCM and G. virens may be facilitating pearl millet seedlings to prevent the invasion by pathogen. Similar results were observed in studies carried out on Norway spruce (Picea abies) upon infection with Pythium dimorphum [95]. They showed an increased peroxidase activity in infected roots. Effective DM management requires a deﬁnite reduction in primary inoculum from seed and soil. On this count, Gliocladium virens appeared to have grown readily along with the developing root system of the treated plant and protects the roots from initial infection (Fig. 7.4). There is a long tradition of indigenous innovations involving prophylactic use of milk and its derivative for controlling diseases in plants as well as animals in India. In spite of awareness about the hazardous effects of chemical pesticides in the developed countries, recommendations to use milk in controlling diseases are few. The question arises as to whether simple innovations are to be ignored for the fact that they are uncomplicated. Since pearl millet is a crop of low economic value grown by resource-poor farmers, seed treatment with biocontrol agents is a more viable and less expensive option than spraying of fungicides for control of DM. There is a high risk of the pathogen developing resistance that is associated with the

7 The Role of Indigenous Knowledge in Biological Control of Plant Pathogens…

183

Fig. 7.4 Growth of bio-control fungus G. virens emerging out from the isolated root of G. virens treated pearl millet plants on PDA medium

use of chemical fungicides unlike biocontrol agents. As a treatment option RCM and G. virens are very promising for pearl millet downy mildew disease management by seed treatment which is economical and environment-friendly. These treatments, apart from their action against pearl millet downy mildew disease, are good plant growth promoters, which is an added advantage for advantageous cultivation of pearl millet.

7.9.2

Effect of Raw Cow Milk and Trichoderma Induced Protection Against Leaf Curl Disease of Chilli

With increasing concern regarding environmental protection and human health, the use of biological control as an alternative, environmentally friendly means for the management of diseases has attracted extensive attention and been considered as a potential strategy for plant disease management in recent years. Bio-control agents (BCAs) have emerged as a new strategy of managing plant diseases by inducing systemic resistance (ISR) in plants against diseases. The emerging paradigm of sustainability in agriculture strives to amalgamate modern technology with traditional farming wisdom. Reports are available on the effectiveness of milk as abiotic inducer of resistance in susceptible plants [78].

184

A. Kumar and A.K. Purohit

Fig. 7.5 Leaf curl disease affected chilli plant

Fig. 7.6 RCM and Trichoderma treated plant (Left) and control plant

In order to assess efﬁcacy of a bio-management strategy for leaf curl disease (LCD) of chilli (Fig. 7.5) extensive ‘on-farm’ experiments were conducted in farmers’ ﬁelds of Mathania, Narwa and Manai villages of Jodhpur district in western Rajasthan. Chilli seeds were treated with raw cow milk (RCM) for 24 h in 1:1 ratio

7 The Role of Indigenous Knowledge in Biological Control of Plant Pathogens…

185

(i.e. RCM diluted to 50% by adding water) at the room temperature (30 ± 2°C) and Trichoderma viride (6 g Kg−1 seed) and T. viride (10 g m−2) in nursery soil followed by dipping of nursery-raised saplings in RCM (15%) for 20 min before transplantation. After 20-days of transplanting the plants were sprayed with RCM (15%) for four times at 15 days interval. The farmers’ practice (FP) was treated as control. Treatment of bio-control agents was found superior over FP in all the trials providing about 17–65% (mean 48.4%) protection over FP (Fig. 7.6). Yield attributes like plant height, root length, number of branches plant−1, number of fruits plant−1, fruit size, fruit weight and fruit yield plot−1 showed an increase when compared to FP. Besides reduced incidence of LCD and yield attributes, the net monitory return was more (Rs. 8,849 ha−1) in the treatment of bio-agents (RCM and T. viride) in comparison to the FP with beneﬁt: cost (B: C) ratio of 1.68: 1.31 in the treatment and FP, respectively [96]. The protection is based on the stimulation of defense mechanisms by metabolic changes along with increase in defense related enzymes such as polyphenol oxidase and peroxidase that enabled the plants to defend themselves more efﬁciently against LCD virus. Treatment Flow Chart for Managing Leaf Curl Disease in Chilli Seed Treatment ȣ Treated chilli seeds with raw cow milk (RCM) for 24 hrs ȣ After drying in shade ȣ Treated dried seeds with Trichoderma viride (6 g kg−1 seed) ȣ Soil Treatment in Nursery Treated nursery soil with Trichoderma viride (10 g m−2) mixed with FYM ȣ Sowing of treated seed in nursery ȣ Dipping plant roots in RCM (15%) for 10 min before transplanting ȣ RCM (15%) sprayed on the plants after 20 days of transplantation

7.9.3

Rejuvenation of Ganoderma Affected Prosopis Trees Through Biocontrol Agents (BCAs)

Khejri (Prosopis cineraria (L.) Druce) is a drought hardy and multipurpose tree of semi arid areas. This is highly valued tree of desert ecosystem as renewable source of energy and biomass. It is used as food (vegetable, dry fruit), feed and rich source of fuel. It also enriches soil and improves the growth of various arid zone crops.

186

A. Kumar and A.K. Purohit

It is available in abundance in protected agriculture lands because of excellent eco-friendly nature. It is therefore termed as a backbone of rural economy and has become an integral part of traditional agro-forestry system. It can grow on a variety of soils but preferably on deep sandy loam with availability of moisture. The tree is so hardy that it can survive even under dry (less than 100 mm annual rain fall) and harsh climatic conditions (temperature as high as 48°C). Recently, heavy mortality of these trees has been reported from various parts of Rajasthan and has caused serious concern. Khejri is a ‘State Tree of Rajasthan’ and its sudden death has caused worries among the farmers, environmentalists and scientists. The mortality of adult trees was found as high as (5%) in Nagaur, Jhunjhunu, Jodhpur, Churu, Sikar and Jaipur districts of Rajasthan in India. Pathological investigations revealed that white rot fungus, Ganoderma lucidum impaired the nutrient and water transport system of the grown up trees. Moreover, Ganoderma fungus loves to grow and parasitize the basal portion (roots and stem) of tree. Therefore, the disease is named as basal stem rot. The disease is major limiting factor for survival of age-old Khejri plantation. Several workers reported different management practices to contain the mortality of Khejri, but the results are not consistent. Now, fungal biocontrol agents (BCA) have been proved to be a potent method against soil borne plant pathogenic fungi. A number of technical, economical and environmental factors stimulate the use of biocontrol agents for the control of Ganoderma pathogens. Trichoderma species are reported all over world for its beneﬁcial uses not only in disease control but also in improvement of plant health. In these days BCAs have emerged as modern strategy to manage plant diseases. In view of this development, efforts were made to develop a suitable management practice by using BCAs. To achieve the success the native strains of Trichoderma and Gliocladium were used for the recovery of partial to severely affected trees. To achieve the success native strains of Trichoderma and Gliocladium was successfully used for the recovery of partial to moderately diseased trees. Most of affected trees recovered from drying stage to grow again to green stage (production of new ﬂushes of green leaves) after BCA treatments. The success of recovery is mostly dependent on three factors-1. Use of potential BCA 2. Multiplication of BCA on active medium and 3. Maintenance of proper moisture for keeping viability of BCA during ﬁeld application (Fig.7.7). Rejuvenation of Gigantic Sacred Tree- “Ram Khejda”: A sudden drying of 256-yearold religiously important “Khejri” tree was observed in Kherapa village (JodhpurNagaur-NH 65) of Jodhpur district in Rajasthan, India. The tree was highly respectable among the devotees due to its religious and historical importance. This blessed tree was healthy until the month of May, 2003, which dried off suddenly and became leaﬂess. On the basis of encouraging results obtained earlier with biocontrol agents isolated from native soil and diverse habitats (such as sick plant, decaying wood and fruiting bodies of Ganoderma lucidum), the affected tree was treated with potential strains of BCAs. In this case, sick soil and affected tree parts along with Ganoderma fungus was removed. A circular ring around the periphery of trunk (4cdeep and 2.5c wide) was prepared. Four holes (2–4 cm wide and 5–10 cm long) were drilled in woody roots and trunk with electric driller and then inoculated with

7 The Role of Indigenous Knowledge in Biological Control of Plant Pathogens…

187

Fig. 7.7 Rejuvenation of Khejri (Prosopis cineraria) using biocontrol agents. Sudden Drying and Rejuvenation of “256 Years Old Ram Khejda Tree” Near Ramkund at Kherapa Village: (a) suddenly dried tree is seen in background, (b) A new sapling emerged from within the roots of affected tree after BCAs’ treatment (fenced), (c) Fruiting body of Ganoderma was seen on the trunk of the affected tree much above the ground after the application of BCAs, (d) The priest and other devotees are worshipping the new emergence, the same has grown to become a big tree

potential strains of T. pseudokoningii and G. virens (GTP-7 & GGV-3) in the month of July 2003. The potential strains of Trichoderma and Gliocladium were mixed with Jaggery to pour the slurry inside the drilled holes of trunk and roots. Biocontrol fungi were also mixed with FYM to treat the affected soil in ring basin. The tree started rejuvenating in the month of December 2003 by sprouting new growth from the root zone which was treated with biocontrol agents + other additives. Rejuvenated shoots were protected with wire-net so that it can attain a proper growth and to avoid abiotic and biotic damages (Fig.7.8). Tree was further given follow up treatments of biocontrol agents (GTP-7 & GGV-3) with micronutrients in FYM around the root zone of affected tree and rejuvenated sprouts for further development of “New Emergence” turn into a “Young Tree”. The tree has attained a height 11.5 ft. with 1 ft. collar diameter having 16 branches. The scientiﬁc story demonstrates that these native strains have an important role to play in managing plant pathogenic fungi causing root and butt rots. Presently the “New (recovered) tree is young with lush green foliage and true to type”. The rejuvenated tree has reinstated faith among followers and disciples who have again religiously started worshipping this sacred tree.

188

A. Kumar and A.K. Purohit

Fig. 7.8 In the year 2006 experts visited the site and appreciated the efforts made to rejuvenate the affected tree: (a) Main gate of Kherapa Ramdwara, (b) Expert team visiting the tee and newly grown tree, (c) In the year 2010 the same tree has attained good growth, (d) Ramdwara devotees have inscribed the name of the newly developed tree on a stone slab, (e) Ramdwara Guru Gaadee

7.10

Conclusions

While writing this chapter it reminds us the famous quote of Sir Isaac Newton, who said that “I was like a boy playing on the sea-shore, and diverting myself now and then ﬁnding a smoother pebble or a prettier shell than ordinary, whilst the great ocean of truth lay all undiscovered before me”. This chapter is therefore a modest beginning as we are also attempting to a difﬁcult task to summarize ﬁndings of indigenous knowledge in a comprehensive manner. Information on traditional practices for managing plant diseases has never been documented. In his only treatise on the subject Prof. H. D. Thurston [14] has stated that “ the study of traditional management of plant diseases should be a rewarding area for future plant pathologists who are not completely seduced by the terms ‘new’ and ‘innovative’ and the prestigious and intellectually appealing basic research in biotechnology”. Disease management in crops is heavily dependent upon the application of synthetic fungicides for pathogen control. However, restrictions on fungicide use

7 The Role of Indigenous Knowledge in Biological Control of Plant Pathogens…

189

and widespread emergence of pathogen resistance has increased global demand for more sustainable production systems and driven research towards alternative disease control strategies. Biological control, which includes elicitors of host defense, microbial antagonists and natural products, offers an attractive alternative to synthetic pesticides. Biocontrol strategies exist in different forms viz. natural (organisms and environmental factors), classic (involve an active human role), augmentative (to increase population of biocontrol agents) and inundative. The occurrence of any plant disease essentially depends upon the susceptible host, virulent pathogen and favourable environment forming a disease triangle. Bio-control organisms in fact, interact with components of this triangle to reduce disease. A large number of plant diseases have been managed using biocontrol agents. What is important now is to discover and use the natural biological control mechanisms evolved so far against the plant diseases. Present research trends include the increased use of bio-rational screening processes to identify microorganisms with potential for biocontrol, increased testing under semi-commercial and commercial production conditions, increased emphasis on combining biocontrol strains with other control methods and integrating biocontrol into an overall system. Albeit, intensive activity is currently being geared toward the introduction of an increasing number of biocontrol agents into the market, commercialized systems for the biological control of plant diseases are limited in number. However, some biocontrol agents have been reported to be as effective as fungicide control. In view of awareness toward nature-friendly management of plant diseases, use of biological control measures will be a most promising proposition for disease management.

7.10.1

The Need and Logistics of New Research Initiatives

The plateaus are in vogue, being experienced in agricultural productivity, extent of disease and pest control and understanding underlying mechanisms in biological sciences. The fact is to be reckoned with that with all genuine concern for environment and quality food, the extent of use and support to IK and biological control is way behind the chemical technology. The reasons are many, e.g., lack of proper standardization, product formulation, industrial production and value addition in IK technologies. A new approach to research-extension linkage is needed to address these issues and ﬁll the gaps for a sustainable and environment friendly agriculture. In the context of understanding underlying mechanisms, plant physiological and biochemical studies have hitherto contributed, leading to an interface of plant pathology with molecular biology and biotechnology. Yet, it is being realized that in order to understand better some of the initial questions like- why compost is better? Why do we need an organic matrix for fertilizer application? How biodynamic preparations work? Why bio control is more eco-friendly than chemical control? How things like ash, ghee (butter oil) and butter act to control or inducing resistance? How yajnas like Agnihotra can be useful in enhancing agricultural productivity and as homa therapy? Could there be any signiﬁcant difference in the milk, urine and

190

A. Kumar and A.K. Purohit

dung of indigenous cow and exotic cattle or buffalo?-a trans-, disciplinary research including nano technology, quantum physics, genopsych, intramolecular electronics of DNA etc. are needed to break the barrier and surge upward beyond the saturating lines. Moreover, plant adaptations to biotic and abiotic stresses need to be reassessed in the light of new insights being generated as plant neurobiology[97], plant intelligence [98], consciousness [99] and genopsych [100, 101]. Experts used to say that the main reason why grass root innovations were being ignored because peer pressure often forced scientists to focus on high-impact research with wide visibility. The situation is changing with a horizontal emphasis on ecological and quality concerns. Recent patenting of a milk-based product active against a number of fungal diseases in general and mildews in particular from Horticulture and Food Research Institute of New Zealand Limited [102] is, in fact a matter of recognition to the Indigenous Knowledge and farmers’ wisdom. Now it is strongly advocated to strengthen such systems through village based initiatives and actively involving local peasants are considered the keys to successful sustainable agriculture and rural development programs.

References 1. Thurston HD (2004) Ten thousand years of experience with sustainable plant disease control. Plant Dis 88:550–551 2. Rajasekaran B (1993) A framework for incorporating indigenous knowledge system into agricultural research and extension organizations for sustainable agricultural development in India. PhD dissertation, Iowa State University, Ames 3. Butler L, Waud J (1990) Strengthening extension through the concepts of farming systems research and extension (FSR/E) and sustainability. J Farming Syst Res Ext 1:77–98 4. Maloney A (1995) Three sources for non-chemical management of plant diseases: towards an ecological framework. In: Andrews JH, Tommerup IC (eds) Advances in plant pathology, vol II. Academic, London 5. Anonymous (1990) Return to the good earth, damaging effects of modern agriculture and the case for ecological farming, A Third World Network Dossier, Penang, Malaysia 6. Sinha RK (1998) Embarking on the second green revolution for sustainable agriculture in India: a judicious mix of traditional wisdom and modern knowledge in ecological farming. J Agric Environ Ethics 10:183–197 7. Wilson DJ (1999) Indigenous South Americans of the past and present: an ecological perspective. Westview Press, Boulder 8. Farrington J, Martin A (1987) Farmer participatory research: a review of concepts and practices. ODI agricultural administration (research and extension) network discussion paper no. 19, Overseas Development Institute, London 9. Allen OJ (1990) The inﬂuence of intercropping with cereals on disease development in legumes. In: Waddington SR, Palmer AFE, Edge OT (ed) Workshop on research methods for Cereal/Legume intercropping in Eastern and Southern Africa, on-farm research network report no.17, CIAT, CIMMYT and Government of Malawi 10. Vijaylakshmi K (Nov 13, 1993) Traditional agriculture. The Hindu, Madras, India 11. Bentley JW (1989) What farmers don’t know can’t help them: the strengths and weaknesses of indigenous technical knowledge in Honduras. Agric Human Values 6:25–31 12. Altieri MH, Hecht SB (1990) Preface to agroecology and small farm development. CRC Press, Boca Raton

7 The Role of Indigenous Knowledge in Biological Control of Plant Pathogens…

191

13. Allen DJ (1983) The pathology of tropical food legumes. Disease resistance in crop improvement. Wiley, New York 14. Thurston HD (1992) Sustainable practices for plant disease management in traditional farming systems. Westwiew Press, Boulder 15. Conklin HC (1954) An ethnoecological approach to shifting agriculture. Trans NY Acad Sci Ser 2 17:133 16. Sadhale N (1996) Surapala’s Vrikshayurveda (The science of plant life by Surapala). Agric Hist Bull No 1, Asian Agri-History Foundation, Secunderabad 500009, India 17. Sadhale Nalini (1999) Krishi-Parashara (Agriculture by Parashara). Agri-Hist Bull No 2, Asian Agri-History Foundation, Secunderabad 500009, India 18. Witzel M (2003) Vedas and Upanishads. In: Flood G (ed) The Blackwell companion to Hinduism. Blackwell, Malden 19. Goyal P (2003) Ancient crop protection practices: their relevance today. http://www. inﬁnityfoundation.com/mandala/t_es/t_es_goyal_crop_frameset.htm 20. Sundaramari M, Ranganathan TT (2003) Indigenous agricultural practices for sustainable farming. Agrobios, Jodhpur 21. Gupta AK (2006) From Sink to Source: The Honey Bee Network documents indigenous knowledge and innovations in India. Innovations- Summer 2006, p. 49 – 66. www.mitpress. mit.edu/innovations 22. Saxena RC, Choudhary SL, Nene YL (2009) Ancient history of Indian agriculture. Asian Agri-History Foundation, Hyderabad 23. Burdon JJ (1978) Mechanisms of disease control in heterogeneous plant populations- an ecologist’s view. In: Scott PR, Bainbridge A (eds) Plant disease epidemiology. Blackwell, Oxford 24. Palti J (1981) Cultural practices and infectious crop diseases. Springer, Berlin 25. Thresh JM (1982) Cropping practices and virus spread. Annu Rev Phytopathol 20:193–218 26. A’Brook J (1964) The effect of planting date and spacing on the incidence of groundnut rosette disease and the vector, Aphis craccivora, at Mokwa, Northern Nigeria. Ann Appl Biol 54:199–208 27. Jodha NS (1979) Intercropping in traditional farming systems. In: Proceedings of international intercropping workshop for the semi-arid tropics. ICRISAT, Hyderabad, 1979 28. Arun Kumar (2007) Traditional plant protection management practices of Rajasthan. Leisa India 9:29–30 29. La Placa PJ, Powell MA (1990) The agricultural cycle and the calendar at Pre-Sargonic Givsu. Bull Sumer Agric 5:75–104 30. Arun Kumar (2000) Eco-friendly approaches for management of plant diseases in arid zone. In: Chaudhary V, Singh K, Kakralya BL (eds) Environmental protection. Pointer Publishers, Jaipur 31. Newhall AG (1955) Disinfestation of soil by heat, ﬂooding and fumigation. Bot Rev 21:189–250 32. McWhorter CG (1972) Flooding for Johnson-grass control. Weed Sci 20:238–241 33. Baker KF, Cook RJ (1974) Biological control of plant pathogens. Freeman, San Francisco 34. Arun Kumar (1995) Occurrence and incidence of plant diseases in Pali region. Ann Arid Zone 34:73–75 35. Arun Kumar (2010) Role of traditional plant protection practices for legume crops in arid areas of Rajasthan. J Arid Legumes 7:43–46 36. Parke JL (1995) http://www.entomology.wisc.edu/mbcn/fea303.html 37. Cook RJ, Baker KF (1983) The nature and practice of biological control of plant pathogens. APS Press, St. Paul 38. Bull TC (2001) Biological control. In: Maloy OC, Murray TD (eds) Encyclopedia of plant pathology, vol I. Wiley, New York 39. Arun Kumar (2006) On-farm management of leaf curl virus disease in chilli under arid farming system. J Food Agric Environ 4:180–182

192

A. Kumar and A.K. Purohit

40. Howell CR (2003) Mechanisms employed by Trichoderma species in the biological control of plant diseases: the history and evolution of current concepts. Plant Dis 8:4–10 41. Wan YK, Tian SP (2005) Integrated control of post harvest diseases of pear fruits using antagonistic yeasts in combination with ammonium molybdate. J Sci Food Agric 85:2605–2610 42. Compant S, Duffy B, Nowak J, Clement C, Barka EA (2005) Use of plant growth-promoting bacteria for biocontrol of plant diseases: principles, mechanisms of action, and future prospects. Appl Environ Microbiol 71:4951–4959 43. Shahnaz D, Perveen F, Atif D (2005) Effect of different strains of Rhizobium spp. in the control of root infecting fungi and growth of crop plants. Int J Biol Biotechnol 2:415–418 44. Mawar R, Lodha S (2006) Relative efﬁcacy of on-farm weeds as soil-amendment for managing dry root rot of cluster bean. Phytopathol Mediterr 45:215–224 45. Jatav RS, Mathur K (2005) Bio-agents and neem based seed treatment for management of root-rot complex in cluster bean. Indian Phytopathol 58:235–236 46. Israel S, Mawar R, Lodha S (2005) Soil solarization, amendments and bio-control agents for the control of Macrophomina phaseolina and Fusarium oxysporum f.sp. cumini in aridisols. Ann Appl Biol 146:481–491 47. Weindling R (1932) Trichoderma lignorum as a parasite of other soil fungi. Phytopathology 22:837–845 48. Barnett HL, Binder FL (1973) The fungal host-parasite relationship. Annu Rev Phytopathol 11:273–292 49. Lumsden RD (1981) Hyperparasitism for control of plant pathogens. In: Pimentel D (ed) Handbook of pest management in agriculture. CRC Press, Boca Raton 50. Adams B (1990) The potential of mycoparasites for biological control of plant diseases. Annu Rev Phytopathol 28:59–72 51. Raj Bhansali R, Arun Kumar, Aseri GK (2003) Biocontrol of roots and butt rots of arid legume trees. J Mycol Plant Pathol 33:491 52. Raj Bhansali R, Arun Kumar (2004) Rejuvenation of Ganoderma affected Khejri tree through biocontrol agents: a case study. In: Proceedings of 26th annual conference and national symposium– ISMPP, Goa University, Goa, 7–9 Oct 2004 53. Papavizas GC (1985) Trichoderma and Gliocladium: biology, ecology and potential for biocontrol. Annu Rev Phytopathol 23:23–54 54. Deore PB, Sawant DM (2001) Management of guar powdery mildew by Trichoderma spp. culture ﬁltrates. J Maharashtra Agric Univ 25:253–254 55. Liu AY (1992) Biological control of the cowpea diseases of Rhizoctonia solani and Fusarium oxysporum with Trichoderma. Chinese J Biol Control 8:188 56. Walters WD, Newton A, Lyon G (2005) Induced resistance for plant disease control: maximizing the efﬁcacy of resistance elicitors. Phytopathology 95:1368–1373 57. Verma HN, Srivastava S, Varsha KD (1996) Induction of systemic resistance in plants against viruses by a basic protein from Clerodendrum aculeatum leaves. Phytopathology 86:485–492 58. Van Loon LC, Bakker PA, Pieterse MJ (1998) Systemic resistance induced by rhizosphere bacteria. Annu Rev Phytopathol 36:453–483 59. Arun Kumar, Raj Bhansali R, Mali PC (2002) Response of bio-control agents in relation to acquired resistance against leaf curl virus in chilli. In: Proceedings of Asian Congress of mycology plant pathology, Mysore, 1–4 Oct 2002 60. Sticher L, Mauch-Mani B, Métraux JP (1997) Systemic acquired resistance. Annu Rev Phytopathol 35:235–270 61. Murphy JF, Zehnder GW, Schuster DJ, Sikora EJ, Polston JE, Kloepper JW (2000) Plant growth-promoting rhizobacteria mediated protection in tomato against tomato mottle virus. Plant Dis 84:779–784 62. Nandakumar R, Babu S, Viswanathan R, Raguchander T, Samiyappan R (2001) Induction of systemic resistance in rice against sheath blight disease by Pseudomonas ﬂuorescens. Soil Biol Biochem 33:603–612

7 The Role of Indigenous Knowledge in Biological Control of Plant Pathogens…

193

63. Niranjan Raj S, Chaluvaraju G, Amruthesh KN, Shetty HS, Reddy MS, Kloepper JW (2003) Induction of growth promotion and resistance against downy mildew on pearl millet (Pennisetum glaucum) by rhizobacteria. Plant Dis 87:380–384 64. Wei G, Kloepper JW, Tuzun S (1996) Induced systemic resistance to cucumber diseases and increased plant growth by plant growth-promoting rhizobacteria under ﬁeld conditions. Phytopathology 86:221–224 65. Zehnder GW, Murphy JF, Sikora EJ, Kloepper JW (2001) Application of rhizobacteria for induced resistance. Eur J Plant Pathol 107:39–50 66. Arun Kumar, Bhansali RR, Mali PC (2004) Raw cow’s milk and Gliocladium virens induced protection against downy mildew of pearl millet. Int Sorghum Millets Newsl 45:64–65 67. Bettiol W (1999) Effectiveness of cow’s milk against zucchini squash powdery mildew (Sphaerotheca fuliginea) in greenhouse conditions. Crop Prot 18:489–492 68. Arun Kumar, Bhansali RR, Gajja BL (2005) Validating people’s knowledge: the role of formal sciences. Honey Bee 16:4–5 69. Dann EK, Deverall BJ (1996) 2,6-dichloro-isonicotinic acid (INA) induces resistance in green beans to the rust pathogen, Uromyces appendiculatus, under ﬁeld conditions. Aust Plant Pathol 25:199–204 70. Dann E, Diers B, Byrum J, Hammerschmidt R (1998) Effect of treating soybean with 2,6-dichloroisonicotinic acid (INA) and benzothiadiazole (BTH) on seed yields and the level of disease caused by Sclerotinia sclerotiorum in ﬁeld and greenhouse studies. Eur J Plant Pathol 104:271–278 71. Lodha S, Burman U (2000) Efﬁcacy of composts on nitrogen ﬁxation, dry root rot (Macrophomina phaseolina) intensity and yield of legumes. Indian J Agric Sci 70:846–849 72. Thakur RP, Rai KN, Rao VP, Rao AS (2001) Genetic resistance of pearl millet male-sterile lines to diverse Indian pathotypes of Sclerospora graminicola. Plant Dis 85:621–626 73. Rao VP, Thakur R, Rai KN, Sharma YK (2005) Downy mildew incidence on pearl millet cultivars and pathogenic variability among isolates of Sclerospora graminicola in Rajasthan. Int Sorghum Millets Newsl 46:107–110 74. Niranjana SR, Chaluvaraju G, Amruthesh KN, Shetty HS (2003) Induction of growth promotion and resistance against downy mildew on pearl millet (Pennisetum glaucum) by rhizobacteria. Plant Dis 87:380–384 75. Walters D, Walsh D, Newton A, Lyon G (2005) Induced resistance for plant disease control: maximizing the efﬁcacy of resistance elicitors. Phytopathology 95:1368–1373 76. Steiner U, Schönbeck F (1995) Induced disease resistance in monocots. In: Hammerschmidt R, Kuc J (eds) Developments in plant pathology: induced resistance to disease in plants. Springer, New York 77. Arun Kumar, Verma SK (2006) Milk in the management of plant diseases. In: Choudhary SL, Saxena RC, Nene YL (eds) Bridging gap between ancient and modern technologies to increase agricultural productivity. Proceedings national conference, CAZRI, Jodhpur-342003, India, 16–18 Dec 2005 78. Crisp P, Wicks TJ, Troup G, Scott ES (2006) Mode of action of milk and whey in the control of grapevine powdery mildew. Australasian Plant Pathol 35:487–493. 79. Ferrandino FJ, Victoria LS (2007) The effect of milk-based foliar sprays on yield components of ﬁeld pumpkins with powdery mildew. Crop Prot 26:657–663 80. Shivakumar PD, Geetha HM, Shetty HS (2003) Peroxidase activity and isozyme analysis of pearl millet seedlings and their implications in downy mildew disease resistance. Plant Sci 164:85–93 81. Sudisha J, Arun Kumar, Amruthesh KN, Niranjana SR, Shetty HS (2011) Elicitation of resistance and defense related enzymes by raw cow milk and amino acids in pearl millet against downy mildew disease caused by Sclerospora graminicola. Crop Prot 30:794-801 82. Hurst PL, Clark CJ (1993) Post-harvest changes in ammonium, amino-acids, and enzymes of amino-acid-metabolism in Asparagus spear tips. J Sci Food Agric 63:465–471 83. Jörg M, Bhalu B, Mohanty P (2002) Molecular mechanisms of quenching of reactive oxygen species by proline under stress in plants. Curr Sci 82:525–532

194

A. Kumar and A.K. Purohit

84. Niranjana SR, Shetty NP, Shetty HS (2004) Proline- an inducer of resistance against pearl millet downy mildew disease caused by Sclerospora graminicola. Phytoparasitica 32:523–527 85. Orchard JE, Hardwick K (1988) Photosynthesis, carbohydrate translocation and metabolism of host and fungal tissues in cacao seedlings infected with Crinipellis perniciosa. In: Proceedings of the 10th international Cocoa research conference, Santo Domingo, 1988 86. Mullet JE, Klein PG, Klein RR (1990) Chlorophyll regulates accumulation of the plastid-encoded chlorophyll apoproteins CP43 and D1 by increasing apoprotein stability. Proc Natl Acad Sci USA 87:4038–4042 87. Lee JS, Daie J (1997) End-product repression of genes involving carbon metabolism in photosynthetically active leaves of sugarbeet. Plant Cell Physiol 38:887–894 88. Ludewig F, Sonnewald U, Kauder F, Heineke D, Geiger M, Stitt M, Muller-Rober BT, Gillissen B, Kuhn C, Frommer WB (1998) The role of transient starch in acclimation to elevated atmospheric CO2. FEBS Lett 429:147–151 89. Chou HM, Bundock N, Rolfe SA, Scholes JD (2000) Infection of Arabidopsis thaliana leaves with Albugo candida (white blister rust) causes a reprogramming of host metabolism. Mol Plant Pathol 1:99–113 90. Jongebloed U, Szederkenyi J, Hartig K, Schobert C, Komor E (2004) Sequence of morphological and physiological events during natural ageing and senescence of a castor bean leaf: sieve tube occlusion and carbohydrate back-up precede chlorophyll degradation. Physiol Plant 120:338–346 91. Retig N (1974) Changes in peroxidase and polyphenoloxidase associated with natural and induced resistance of tomato to Fusarium wilt. Physiol Plant Pathol 4:145–150 92. Chandra A, Anand A, Mandal PK, Saxena P (2001) Inﬂuence of salicylic acid on protein content and catalase activity in relation to systemic acquired resistance in cowpea against root rot. Indian Phytopathol 54:284–287 93. Ramamoorthy V, Raguchander T, Samiyappan R (2002) Enhancing resistance of tomato and hot pepper to Pythium diseases by seed treatment with ﬂuorescent pseudomonads. Eur J Plant Pathol 108:429–441 94. Fossdal CG, Sharma P, Lonnebong A (2001) Isolation of the ﬁrst putative peroxidase cDNA from a conifer and the local and systemic accumulation of related proteins upon pathogen infection. Plant Mol Biol 47:423–435 95. Arun Kumar (2008) Farmer-inspired participatory approach to manage leaf curl disease in chilli. In: Pratap Narain, Singh MP, Praveen Kumar (eds) Diversiﬁcation of arid farming systems. CAZRAI and Scientiﬁc Publishers, Jodhpur 96. Gajja BL, Arun Kumar (2010) Economic evaluation of raw cow milk and Trichoderma viride induced management of leaf curl virus disease of chilli in arid Rajasthan. In: Proceeding of national conference on recent advances in integrated disease management for enhancing food production in the Department of Plant Pathology, SKRAU, Bikaner, 2010 97. Brenner ED, Stahilberg R, Mancuso S, Vivanco J, Baluska F, Volkenburgh EV (2006) Plant neurobiology: an integrated view of plant signaling. Trends Plant Sci 11:413–419 98. Trewavas A (2005) Green plants as intelligent organisms. Trends Plant Sci 10:413–419 99. Rana UVS, Srinivas K, Aery NC, Purohit AK (2010) The philosophy of evolution. Yash Publishing House, Bikaner 100. Sekhar DMR (2011) Genopsych: a coinage in the foundry of biology. Transcience transactions, vol II. Scientiﬁc Publishers, Jodhpur 101. Purohit AK (2010) Flights of ﬁnches: exploring trajectories of biological evolution. In: Rana UVS, Srinivas K, Aery NC, Purohit AK (eds) The philosophy of evolution. Yash publishing house, Bikaner 102. Horticulture and Food Research Institute of New Zealand Limited (2005). http://www. hortresearch.co.nz/index/page561

Chapter 8

Plant Chemicals in Post Harvest Technology for Management of Fungal, Mycotoxin and Insect Contamination of Food Commodities N.K. Dubey, Priyanka Singh, Bhanu Prakash, and Prashant K. Mishra

Abstract Higher plants produce different bioactive secondary metabolites having potential to protect the food commodities from different pests. Many of these are thought to serve an ecological function for the plants producing them, serving to defend the plants from herbivores and pathogens. Plant products may successfully replace chemical pesticides and provide eco-chemical and biorational strategy to protect cereals, pulses and other agricultural commodities from post harvest losses by microorganisms, mycotoxins and insects. Some plant products have been formulated for large scale application as safe food additives in management of different storage pests. The articles deals with current status and future prospects of plant chemicals in post harvest technology for management of fungal, mycotoxin and insect contamination of food commodities. Keywords -YCOTOXINSs0ESTSs0OST HARVESTTECHNOLOGYs&OODPRESERVATIVES s3EMIOCHEMICALS

8.1

Introduction

Cereal grains are the major source of food for human and most domesticated animals in the world. Grain production in any country varies from year to year. Hence, the grain should be stored strategically for use in years of under- production. Also, grains must be stored for several other reasons such as point of production is not the point of consumption and time of production is not the time of consumption. International agencies that monitor world food resources have acknowledged that one of the most

N.K. Dubey (* s03INGHs"0RAKASHs0+-ISHRA Centre of Advanced Study in Botany, Banaras Hindu University, Varanasi 221005, India e-mail: [email protected]

J.M. Mérillon and K.G. Ramawat (eds.), Plant Defence: Biological Control, Progress in Biological Control 12, DOI 10.1007/978-94-007-1933-0_8, © Springer Science+Business Media B.V. 2012

195

196

N.K. Dubey et al.

feasible options for meeting future food needs is reduction of post-harvest losses [1]. World food shortage accentuates the need for reducing post-harvest losses and developing improved systems for transportation and distribution. The degree and extent of post harvest losses has been the subject of considerable debate. Stored grain can have losses in both quality and quantity. Losses occur when the grain is attacked by microorganisms, insects, rodents, mites and birds [2]. Microorganisms play a vital role in biodeterioration of stored food commodities. The microbiological aspects of food safety have been studied intensively for many decades. Experts believe that 20–60% of stored food commodities is lost due to invasion by different microorganisms [3, 4]. Due to the nature of microbes and our food chain, measures to ensure food safety have to be implemented on a global scale, necessitating a global approach. &UNGI ARE SIGNIlCANT DESTROYERS OF FOODSTUFFS DURING STORAGE RENDERING THEM UNlTFORHUMANCONSUMPTIONBYRETARDINGTHEIRNUTRITIVEVALUEANDSOMETIMESBY PRODUCINGMYCOTOXINS&UNGIHAVEBEENIDENTIlEDASAMAJORCAUSEOFBIODETERIORAtion of all kinds of stored products throughout the world leading to both qualitative and quantitative losses [5]. The fungi are widely distributed all over the world and have been found on all foodstuff and their products [6]. A moisture content that is around 16% in cereals is enough to support the development of the fungi [7]. Improper handling of crops during post harvest processing can cause fungal infestation. Any damage to stored products increases their susceptibility to fungal contamination [8=&UNGALINFESTATIONRESULTSINREDUCTIONOFGRAINQUALITY CHANGEIN COLOUR TASTE SMELL REDUCTIONINNUTRITIONALVALUE INCREASEINFREEFATTYACIDS&&! and reduction of germination ability [9–11]. The deterioration of sensorial properties is often due to the production of exoenzymes during growth. Moulds can produce a vast number of enzymes: lipases, proteases, carbohydrases [12]. Moulds can produce volatiles such as dimethyldisulphide, geosmin and 2-methylisoborneol which can affect the quality of foods [13]. These compounds are produced in large QUANTITIESINSPECIESSPECIlCCOMBINATIONSOFDIFFERENTGENERASUCHASPenicillium, Aspergillus and Fusarium [14]. &UNGALINVASIONSMAYBEHIGHLYHAZARDOUSASCERTAINSPECIESOFFUNGIPRODUCE mycotoxins [15, 16]. Mycotoxins contamination of various foodstuffs and agricultural commodities is a major problem in the tropics and sub-tropics, where climatic conditions and agricultural and storage practices are conducive to fungal growth AND TOXIN PRODUCTION -YCOTOXINS ARE FUNGAL SECONDARY METABOLITES IDENTIlED IN many agricultural products screened for toxigenic moulds [17, 18]. Mycotoxins are highly stable compounds that cannot be destroyed through food processing and cooking. Mycotoxins have been reported to be carcinogenic, teratogenic, tremorogenic, haemorrhagic and dermatitic to a wide range of organisms, and known to cause hepatic carcinoma in man [19]. Approximately 25–40% of cereals worldwide are contaminated with mycotoxins produced by different storage fungi [20]. Consumption of grain contaminated with aﬂatoxins may cause acute and cronic toxicities, liver damage, cancer or death [21]. About 4.5 billion people in developing countries are chronically exposed to uncontrolled amounts of aﬂatoxin [22]. A study

0LANT#HEMICALSIN0OST(ARVEST4ECHNOLOGYFOR-ANAGEMENTOF&UNGALx

197

BY THE 5NITED .ATIONS &OOD AND !GRICULTURE /RGANIZATION &!/ ON WORLDWIDE REGULATIONS FOR MYCOTOXINS REVEALED THAT AT LEAST COUNTRIES NOW HAVE SPECIlC regulations for mycotoxins [23]. The risk of contamination by mycotoxins is an important food safety concern. Mycotoxins affecting peanuts, cereals (maize, rice, sorghum, wheat, barley and oats), pulses (chick pea, mung bean, soya bean, and lentils), spices (black pepper, ginger and nutmeg) and chilli are considered to be of GREATERSIGNIlCANCEWORLDOVERFORHUMANBEINGS;15, 24, 25]. Aﬂatoxins are secondary metabolites produced by toxigenic strains of Aspergillus ﬂavus, Aspergillus parasiticus and Aspergillus nomius [26–28]. It is among the most hepatocarcinogenic substance ever characterized for animal and human populations [29, 30] and interfere with the functioning of the immune system [31]. A wide variETYOFANIMALS INCLUDINGlSH RODENTS WATERFOWL POULTRY SWINEANDCATTLECANBE affected by aﬂatoxins [32–34]. In 1993, the International Agency for Research on Cancer [35=ASSESSEDANDCLASSIlEDNATURALLYOCCURRINGMIXTURESOFAmATOXINSASA CLASSHUMANCARCINOGEN!mATOXICOSISINDUCESDEPRESSEDFEEDEFlCIENCY ABNORmal liver chemistry, depressed immune response, and even death [36, 37]. Aﬂatoxin also has an impact on the agricultural economy through the loss of crop production. In plants, aﬂatoxins inhibit seed germination, seedling growth, root elongation, and chlorophyll and carotenoid synthesis, and retard protein, nucleic acid, and synthesis of some enzymes [38= &!/ AND 7(/ HAVE IMPOSED REGULATORY GUIDELINES OF 20 ppb of total aﬂatoxins as the maximum allowable limit in food or feed substrate [39]. In some European countries aﬂatoxin levels are regulated below 5 ppb [40]. Insects have been another important major enemy of stored food commodities. More importantly insect’s activity can have a profound effect on the spread of fungal diseases through transmitting the spores and increasing the surface area susceptible to fungal infection, Among the several beetle pests, Sitophilus oryzae Linn., commonly known as rice weevil and Tribolium castaneum Herbst., commonly known as red ﬂour beetle have long been known to be the most destructive pests of cereals in storage [41]. The Rice Weevil, Sitophilus oryzae L. is an internal feeder that infests sound grain kernels and develops inside the kernel [42]. The eggs are laid beneath the seed coat, through holes gnawed and covered with saliva by the females, and the entire immature development occurs in the internal part of the kernel; thus, S. oryzae larvae hollow out the grain seed until they reach the adult stage [43]. This species has a relatively short developmental period [44], and high populations can easily be built up. Thus, unless control measures are taken, heavy infestations may take place. Additionally, the kernel damage caused by S. oryzae larvae, enables other species, the external feeders, which are not capable of infesting sound grain, to increase the damage rapidly Besides cereals and grains, chocolate and some animal food products are also infested by insect pests [45, 46]. Stored products of agricultural and animal origin are attacked by more than 600 species of beetle pests, 70 species of moths and about 355 species of mites causing quantitative and qualitative losses [47]. In industrialized countries like Canada and Australia there is zero tolerance for insects in food grains [48, 49].

198

8.2

N.K. Dubey et al.

Synthetic Chemicals as Food Preservatives

With an increasing world population to feed, it is often suggested that a reduction of such losses can lead to substantial increase in food availability particularly in developing world. Control of diseases at the post-harvest stage can be achieved through improvement in the cultural practices at the growing site, timely harvesting, use of chemicals both at pre and post-harvest stages, employment of some physical means like heat therapy, low temperature storage and radiation’s improved STORAGETECHNIQUESBYWAYOFCONTROLLEDORMODIlEDATMOSPHEREASWELLASSTRUCtures and rarely through resistant varieties. However, maximum research efforts have been directed towards chemical control of post-harvest diseases and a large number of chemicals are used in form of fumigants and smoke. However, due to the development of new physiological races of pathogens many of these synthetic chemicals are gradually becoming ineffective [50]. Methyl bromide, a fumigant has been found to be phytotoxic [51]. Some fumigants, such as ethylene dibromane, are highly absorbed by produce [52] and should not be used on any food THATISEATENBYMANORANIMALS-ETHYLBROMIDEHASBEENIDENTIlEDASAMAJOR contributer to ozone layer depletion, which casts a doubt on its future application. There has been repeated indications that certain pests have developed resistance to phosphine, which is widely used today [3]. These drawbacks have increased the interest to develop alternative control methods, which are environmentally SOUNDANDBIODEGRADABLEINNATURE&URTHER MANYOFTHESYNTHETICFUNGICIDESARE the products of petroleum. The Organization of Petroleum Exporting Countries (OPEC) has made us aware of the limitations on the supply of this fossil fuel which has direct impact on petroleum based products. This has further highlighted our awareness of the non renewable resources for the production of energy as well as other raw materials [53]. Therefore, there is now an urgent need to develop new and effective means for controlling post-harvest diseases that pose less risk to human health and the environment [54]. The indiscriminate use of synthetic pesticides has forced researchers to search for newer ecofriendly, more potent and safer insecticides, especially from plant sources [55]. Synthetic chemicals and fumigant have been widely used for preventing quality deterioration of stored products. However these agents will be phased out in the near future due to their potential adverse impact on the environment. Therefore biodegradable alternative SHOULDBEDEVELOPEDWORLDWIDEFORREDUCINGPOSTHARVESTLOSSES&URTHER THEUSE of synthetic chemicals to control postharvest deterioration has been restricted due to their carcinogenicity, teratogenicity, high and acute residual toxicity, long degradation period, environmental pollution and their effects on food and other side EFFECTSONHUMANS)NADDITIONSYNTHETICFUNGICIDESCANLEAVESIGNIlCANTRESIDUES in treated commodities [56]. Thus, heavy reliance on pesticides is not a viable strategy. Pesticides, at least PROVIDEEPHEMERALBENElTS OFTENWITHADVERSESIDEEFFECTS7IDEANDEXTENSIVEUSE of pesticides has eventually resulted in a deep concern for the environment and the living organisms.

0LANT#HEMICALSIN0OST(ARVEST4ECHNOLOGYFOR-ANAGEMENTOF&UNGALx

8.3

199

Plant Chemicals in Post Harvest Technology: The Eco-Chemical Option

Considerable attention has been given towards potential of biological control of post-harvest diseases as a viable alternative of the synthetic chemicals [57]. Microbial antagonists have been reported to protect a variety of harvested perishable commodities against a number of pathogens [58=(OWEVER DECREASINGEFlcacy and lack of consistency under commercial conditions [59] are the major drawbacks of their use. These drawbacks in alternative methods have increased interest in developing further alternative control methods, particularly those which are environmentally sound and biodegradable. Thus, recommendation natural prodUCTSPARTICULARLYOFPLANTORIGIN WHICHARENONTOXICANDSPECIlCINTHEIRACTION IS gaining considerable attention as a better alternatives of synthetic chemicals in pest management programmes. Since time immemorial, chemicals of plant origin, commonly called ‘botanicals’ have been in use for pest control and these materials were devoid of the various disadvantages stated above, as associated with the use of synthetics. The botanicals offer better compatibility with other biological pest control agents than the synthetics and this has brought them to sudden prominence once again. Plant secondary metabolites are frequently regarded as extravagances that serve no obvious biological purpose for the plant that produces them. There is a good reason to suppose that the secondary metabolites of plants have evolved to protect them from attack by microbial pathogens [60]. However, it is becoming increasingly clear that these molecules may play important roles in defense mechanisms. Some higher plant secondary metabolites have also been reported to alter behaviour and life cycle of insect pests without killing them. Such chemicals are termed as semiochemicals by the Organisation for Economic Cooperation and Development [61]. Some of the essential oils and plant components show activity as semiochemicals. Some plants have been reported to contain insect growth regulatory chemicals (IGRs) which disrupt insect maturation and emergence as adults. *UVABIONE FOUNDINTHEWOODOFBALSAMlR WASDISCOVEREDBYACCIDENTWHENPAPER towels made from this source were used to line insect-rearing containers resulting in a suppression of insect development [62]. Analogues of insect juvenile hormones like juvocimenes in Ocimum basilicum have also been reported [63]. Precocenes isolated from essential oils of Matricaria recutita interfere with the normal function of insect glands that produce juvenile hormones resulting in suppression of insect growth while moulting. Many plant chemicals deter insects from feeding showing antifeedant effect. Azadirachtin and limonoids such as limonin and nomilin from different plant species in Meliaceae and Rutaceae (e.g. from Citrus fruits) have long been used successfully for insect control, especially in India. Azadirachtin protects newly grown leaves of crop plants from feeding damage thereby showing systemic antifeedant properties [62]. Semiochemicals are generally considered to be safer and environmentally more acceptable than conventional pesticides because they occur naturally,

200

N.K. Dubey et al.

are able to target the pest species only, possess low acute toxicities to vertebrates and are usually volatile chemicals that do not leave behind harmful residues [64]. However, products containing semiochemicals will still be required to go through some degree of formal registration even if it is less costly than for conventional pesticides. In grain storage environments which are often inhabited by a range of different pest species, multi-species semiochemicals are likely to be more cost EFFECTIVETHANSPECIESSPECIlCONES!LSOTHELARGERQUANTITIESOFSEMIOCHEMICALS required for grain protection compared to their use for pest monitoring, could help to reduce production costs. A Push- Pull or stimulo-deterrent diversionary strategy has been developed in South Africa for minimising damage due to maize stem borer insects [65]. This strategy involves selection of plant species employed as trap crops to attract stem borer insects away from maize or some plant species are used as intercrops to repel insects. The trap and repellent plants contain some semio- chemicals which attract or repel the insect. Pennisetum purpureum and Sorghum vulgare attract the stem borer insect while Milinis minutiﬂra, Desmodium uncinatum and D intorium are the repellent plants. The Push- Pull strategy exploiting chemical ecology of plants would prove an interesting esuriently, indigenous and readily available concept in management of insect population. Plant ﬂowers like marigold and certain kinds of vegetables which help to control pests in or around the main crop. This is sometimes called “companion planting” [66]. Among current alternative strategies aiming at decreasing the use of classical insecticides, ecochemical control based on plant-insect relationships is one of the MOSTPROMISINGMETHODS&ORCENTURIES PLANTSANDINSECTSHAVEFOLLOWEDAPARALLEL and interdependent evolution. Insects cannot live without plants and vice versa. Chemical mediators are used in interspecies communication, especially allelochemicals. These non-nutritional molecules, produced by an organism, modify the behaviour or the biology of an organism from another species. Consequently, plant allelochemicals exert a wide range of inﬂuences on insects: they can be repellent, deterrent or antifeedant; they may inhibit digestion, enhance pollination and capture with their attractive properties; they may increase oviposition or, contrarily, decrease reproduction by ovicidal and larvicidal effects. These molecules generally act at WEAKDOSESANDHAVEASPECIlCACTION6ERYFEWARETOXICFORMAMMALS-OSTOF them are classed as secondary plant products and therefore have chemical structures that classify them as alkaloids, polyphenolics, terpenes and isoprenoids or cyanogenic glucosides [67]. During recent years, some pesticidal plants, e.g. Azadirachta indica, Chrysanthemum cinerariaefolium and Carum carvi have been receiving global attention and their secondary metabolites have been formulated as botanical pesticides in plant protection [62]. Pyrethrum and rotenone, obtained from Chrysanthemum and Derris species respectively have been the most extensively used botanicals in the past. The most important source of former is Chrysanthemum cinerariaefolium and that of the latter, Derris elliptica. Nicotine obtained from Nicotiana tabacum, N. rustica and N. glutinosa has been another well used botanical. Botanicals are in general, more compatible with the environmental components than the synthetic

0LANT#HEMICALSIN0OST(ARVEST4ECHNOLOGYFOR-ANAGEMENTOF&UNGALx

201

pesticides, owing primarily to their susceptibility to degradation by light, heat and microorganisms. Biologicals because of their natural origin are biodegradable and they do not leave toxic residues or byproducts to contaminate the environment [68]. Amongst different plant products, essential oils which have been known and used for centuries (species, medicinal and aromatic plants) are most frequently tested for their antibacterial and antifungal activity. Essential oils, odorous and volatile products of plant secondary metabolism, have a wide application in folk medicine, food ﬂavouring and preservation as well as in fragrance industries. In recent years, a large number of essential oils and their constituents have been investigated for their antimicrobial properties against some bacteria and fungi [69]. Most of the essential oils act in biorational mode of action interrupting the function of octapamine neuroreceptors present in insects but absent in mammals [62]. There has been a growing interest on the research of the possible use of the essential oil and plant extracts, which can be relatively less damaging for pest and disease control. &OR COMPLETE PROTECTION THE STORED FOOD COMMODITIES SHOULD BE PROTECTED FROM fungal and insect infestations as well as mycotoxins secreted by storage fungi. This will provide qualitative as well as quantitative protection of food commodities from the biodeteriorating pests. A perusal of literature shows that several plants have been found to possess pronounced pesticidal activity against different storage pests. Essential oil of Cymbopogon ﬂexuosus and its major component, eugenol were FOUND EFlCIENT IN CHECKING FUNGAL GROWTH AND AmATOXIN PRODUCTION C. ﬂexuosus essential oil absolutely inhibited the growth of A. ﬂavus and aﬂatoxin B1 production at 1.3 and 1.0 Pl ml−1 RESPECTIVELY %UGENOL WAS MORE EFlCACIOUS THAN THE CymbopogonOILASSUCHWHICHEMPHASIZESMASKINGOFTHEIREFlCACYWHENCOMbined together with other constituents [70]. Essential oil extracted from the leaves of Chenopodium ambrosioides Linn. was tested against the aﬂatoxigenic strain of test fungus Aspergillus ﬂavus Link [71]. The oil completely inhibited the mycelial growth at 100 Pg/ml and exhibited broad fungitoxic spectrum against Aspergillus niger, Aspergillus fumigatus, Botryodiplodia theobromae, Fusarium oxysporum, Sclerotium rolfsii, Macrophomina phaseolina, Cladosporium cladosporioides, Helminthosporium oryzae and Pythium debaryanum at similar concentration. The OILALSOSHOWEDSIGNIlCANTEFlCACYININHIBITINGTHEAmATOXIN"PRODUCTIONBYTHE aﬂatoxigenic strain of A. ﬂavus. The effect of cinnamon, clove, oregano, palmarosa ANDLEMONGRASSOILSONZEARALENONE:%! &UMINOSIN&" ANDDEOXYNIVALENOL (DON) accumulation by isolates of Fusarium graminearum and F. proliferatum in non-sterilized naturally contaminated maize grain was evaluated at a 500 mg/kg LEVEL #INNAMON OREGANO AND PALMAROSE OILS HAD SIGNIlCANT INHIBITORY EFFECT ON &"1 PRODUCTION WHILE CLOVE AND LEMONGRASS OILS HAD ONLY SIGNIlCANT INHIBITORY effect [72, 73]. Antifungal activities of the Rosmarinus ofﬁcinalis and Trachyspermum copticum oils were studied with special reference to the inhibition of Aspergillus parasiticus growth and aﬂatoxin production [74]. T. copticum L. oil showed a stronger inhibitory effect than R. ofﬁcinalis on the growth of A. parasiticus. Aﬂatoxin production was inhibited at 450 ppm of both oils with that of R. ofﬁcinalis being stronger inhibitor.

202

N.K. Dubey et al.

Plants synthesize a variety of molecules, including proteinaceous proteinase inhibitors, to defend themselves against attack by insects. Macedo et al. [75] isolated a trypsin inhibitor (DMTI-II) from Dimorphandra mollis seeds and tested for anti-insect activity against C. maculatus larvae. The inhibitor produced 67% mortalITYTOBRUCHIDWHENINCORPORATEDINTOANARTIlCIALDIETATALEVELOF4HEDOSES necessary to cause 50% mortality (LD50) and to reduce weight by 50% (ED50) for DMTI-II were 0.50% and 0.60%, respectively. 4HEEFFECTSOFPARTIALLYPURIlEDmAVONOIDSOBTAINEDFROMCalotropis procera and six standard ﬂavonoids on the adults and eggs of Callosobruchus chinensis, reared on mung beans (Vigna radiata), were studied by Salunke et al. [76]. All ﬂavonoids WERETOXICTOADULTSANDEGGSDEPENDINGONDOSEANDEXPOSUREPERIOD&LAVONOIDS obtained from C. procera showed the highest contact toxicity followed by standard quercetin, rutin and quercitrin at 10 mg mL−1DOSESINlLTERPAPERDIFFUSIONASSAY &LAVONOIDSALSOSHOWEDANOVICIDALEFFECTONBRUCHIDEGGSASWELLASAFFECTINGTHE number and weight of the emerging adults as a function of concentration. Plant lectins have been implicated as antibiosis factors against insects. Talisia esculenta lectin caused 90% mortality against C. maculatus and Zabrotes subfasciatusLARVAEWHENINCORPORATEDINANARTIlCIALDIETATALEVELOFWW 4HE,$50 and ED50 for that lectin was 1% (w/w) for both insects [77]. A set of 14 plant lectins was screened by Sadeghi et al. [78] in a binary choice bioassay for oviposition inhibitory activity on cowpea weevil Callosobruchus maculatus & #OATING OF CHICKPEA SEEDS Cicer arietinum L.) with a 0.05% (w/v) SOLUTION OF PLANT LECTINS CAUSED A SIGNIlCANT REDUCTION IN EGG LAYING 4HE COMpounds, like camphor, eugenol, linalool, carvacrol, thymol, borneol, bornyl acetate and linalyl acetate occur naturally in the essential oils of the aromatic plants of Lamiaceae and Lauraceae viz. Lavandula angustifolia, Rosmarinus ofﬁcinalis, Thymus vulgaris and Laurus nobilis. These compounds were evaluated for fumigant activity against adults of Sitophilus oryzae, Rhyzopertha dominica and Tribolium castaneum [79]. These compounds were found suitable as fumigants because of their high volatility, effectiveness, and their safety. It has been well demonstrated that the chemical composition of different components in the antimicrobial essential oils depends on many factors. It has been found to be inﬂuenced by the climatic, seasonal and geographical conditions, growth regulator and harvest period [80, 81]. Even in case of Neem preparations considerable variation in amount of its active principle has been reported from seeds collected from different geographic area as well as of age of the plant [82]. Hence, before recommendation the pesticidal plant products should be qualitatively standardized by their different physico-chemical properties [80, 83, 84]. A fungitoxicant may exhibit broad fungitoxic spectrum, inhibiting many fungi or may be effective against SOMESPECIlCONESONLY!FUNGITOXICANTPOSSESSINGANARROWRANGEOFTOXICITYCAN not be employed successfully in controlling fungal infestation of food commodities during storage because a variety of fungi usually infest the stored food commodities at the same time. Hence, fungitoxicants with broad spectrum offer greater promise to control fungal infestation of food commodities. Essential oils generally have a broad spectrum of bioactivity because of the presence of several active ingredients that

0LANT#HEMICALSIN0OST(ARVEST4ECHNOLOGYFOR-ANAGEMENTOF&UNGALx

203

work through several modes of action. The individual ingredients in the oils often exert differential effects depending on both the mode of action and the target pest [85]. However, a perusal of literature shows that the plants may possess broad or narrow fungitoxic spectrum. The essential oil of Tagetus erecta [86], Artemisia annua [87], Cymbopogon citrates [88], Turmeric oil [89], Caesulia axillaris [68], Chenopodium ambrosioides, Lippia alba [84], Caesulia axillaris [90], Pinus sylvestris [91], Trachyspermum ammi [92], Mentha arvensis [93] and Cryptomeria japonica [94], have shown broad antifungal spectrum, while those of Prunus persica [95], Hibiscus cannabinus [96], and Polymnia sonchifolia [97] have exhibited narrow antifungal spectrum. Cha et al. [98] evaluated activity of 45 different plant oils against Candida albicans, Aspergillus niger and Rhizopus oligosporus. Of the 45 oils, those of coriander, savory and rosewood were effective against all three microorganisms. The essential oils have also been reported having differential toxicity against different groups of organisms. The structure and metabolic processes of the organisms make them sensitive or resistant to a particular essential oil [99–101]. The concentration of essential oils is also an important factor in deciding sensitivity or resistant to the organisms. The oil of leaves of Ocimum gratissimum was inhibitory to Microsporum gypseum and Trichophyton rubrum at 78 ppm, but a concentration of 312 ppm was required to inhibit growth of Candida albicans and Cryptococcus neoformans [102].

8.4

Conclusion

Currently, different plant products have been formulated for large scale application as botanical pesticides in eco-friendly management of plant pests and are being used as alternatives to synthetic pesticides in crop protection. These products have low mammalian toxicity and are cost effective. Such products of higher plant origin may be exploited as eco-chemical and biorational approach in integrated plant protection programmes. Compared to temperate zones, tropical and sub-tropical regions have a greater potential for food production and can grow multiple crops annually. On the other hand, based on congenial climatic conditions and the particular environment, agriculture in tropical and subtropical countries suffers from severe losses due to pests [103]. There has been a renewed interest in botanical antimicrobials because of several distinct advantages. Botanicals, being natural derivatives are biodegradable, so they do not leave toxic residues or by products to contaminate the environment. Plant origin pesticides are much safer than conventionally used synthetic pesticides. Antimicrobial plants have been in nature as its components for millions of years without any ill or adverse effects on ecosystem. Some plants have more than one chemical as active principle responsible for their biological properties. The biological activity in such plants may be due to synergistic effects of different active principles. They may impart different mode of action during their pesticidal actions.

204

N.K. Dubey et al.

These products may exhibit either for one particular biological effect or may have diverse biological effects. Botanical antimicrobials have a very high level of safety FORHUMANS ANIMALS lSHANDOTHERNONTARGETORGANISMSPRINCIPALLYBECAUSETHEY have been reported to act by very different modes of action than most organic chemical pesticides that attack metabolic systems shared by both pest and non pest organisms. Research and development cost of biologicals from discovery to marketing is reported to be less compared to chemical pesticides.

References 1. Tripathi P, Dubey NK (2004) Exploitation of natural products as an alternative strategy to control postharvest fungal rotting of fruit and vegetables. Postharvest Biol Technol 32:235–245 2. Neethirajan S, Karunakaran S, Jayas DS, White NDG (2007) Detection techniques for storedPRODUCTINSECTSINGRAIN)NT&OOD#ONTROLn 3. Shaaya E, Kostjukovski M, Eilberg J, Sukprakarn C (1997) Plant oils as fumigants and contact insecticides for the control of stored-product insects. J Stored Prod Res 33:7–15 !RTHUR&( 4HRONE*% %FlCACYOFDIATOMACEOUSEARTHTOCONTROLINTERNALINFESTATIONSOF rice weevil (Coleoptera: Curculionidae). J Econ Entomol 96:510–518 -ERONUCK2! 4HESIGNIlCANCEOFFUNGIINCEREALGRAINS0LANT$ISn 6. Wareing PW (1997) Incidence and detection of thermotolerant and thermophilic fungi from maize with particular reference to ThermoascusSPECIES)NT*&OOD-ICROBIOLn 7. Paderes DE, Mew TW, Ilag LL (1997) Inﬂuence of moisture content and length of storage on fungal invasion of paddy rice. Biotropia 10:1–13 4AGLIAFERRI- 2IGO' "ANl' #RAVEDI0 0REVENTIONANDCONTROLOFCONTAMINATIONIN foods derived from wheat. Tecnica Molitoria 44:958–965 9. Dutta GR, Roy AK (1987) Mycoﬂora associated with Strychnos seeds and deterioration of their active principles under storage. Indian Phytopathol 40:520–524 10. Prasad BK, Prasad A, Shanker U, Kumar S (1988) Level of change in carbohydrate in lab bean &$CVSEEDDUETOSEEDBORNEAspergillus niger. Indian J Mycol Plant Pathol 17:145–149 11. White ND, Jayas DS (1993) Microﬂoral infection and quality deterioration of sunﬂower seeds as affected by temperature and moisture content during storage and the suitability of the seeds for insect or mite infestation. Can J Plant Sci 73:303–313 "IGELIS2 &OODENZYMES)N&INKELSTEIN$" "ALL#EDS "IOTECHNOLOGYOFlLAMENtous fungi: technology and products. Butterworth-Heinemann, Boston 13. Illy A, Viani R (1995) Espresso coffee: the chemistry of quality. Academic, London ,ARSEN4/ &RISVAD*# #HARACTERIZATIONOFVOLATILEMETABOLITESFROMPwricillirrm taxa. Mycol Res 99:1153–1166 15. Bryden WL (2007) Mycotoxins in the food chain: human health implications. Asia Pac J Clin Nutr 16:95–101 -ILLER*$ 'LOBALSIGNIlCANCEOFMYCOTOXINS)N-IRAGLIA- VAN%GMOND( "RERA# Gilbert J (eds.) Mycotoxins and phycotoxins – developments in chemistry, toxicology and FOODSAFETY!LAKEN)NC &ORT#OLLINS 17. Clevsrton G, Ljunggren H (1985) Aﬂatoxin formation and the dual phenomenen. Mycopathology 92:129–139 18. Kumar V, Basu MS, Rajendran TP (2008) Mycotoxin research and mycoﬂora in some commercially important agricultural commodities. Crop Prot 27:891–905 19. Refai MK (1998) Aﬂatoxins and aﬂatoxicoses. J Egypt Med Assoc 48:1–19 20. Pittet A (1998) Natural occurrence of mycotoxins in foods and feeds – an updated review. Revue Med Vet 149:479–492

0LANT#HEMICALSIN0OST(ARVEST4ECHNOLOGYFOR-ANAGEMENTOF&UNGALx

205

-ILLER*$ &UNGIANDMYCOTOXINSINGRAINIMPLICATIONSFORSTOREDPRODUCTRESEARCH J Stored Prod Res 31:1–16 22. Williams JH, Phillips TD, Jolly PE, Stiles JK, Jolly CM, Aggarwal D (2004) Human aﬂatoxicosis in developing countries: a review of toxicology, exposure, potential health consequences, and interventions. Am J Clin Nutr 80:1106–1122 &!/ 7ORLDWIDEREGULATIONSFORMYCOTOXINSACOMPENDIUM &OODAND.UTRITION 0APER.O&OODAND!GRICULTURE/RGANIZATION 2OME "HAT26 6ASANTHI3 &OODSAFETYINFOODSECURITYANDFOODTRADE -YCOTOXINFOODSAFETY RISKSINDEVELOPINGCOUNTRIES)&02)&OCUSn 25. CAST (Council for Agricultural Science and Technology) (2003) Mycotoxins: risks in plant, ANIMAL ANDHUMANSYSTEMS 4ASK&ORCE2EPORT#!34 !MES &ENTE#! *AIMEZ/* 6ÖZQUEZ") &RANCO#- #EPEDA! !NEWADDITIVEFORCULTURE media for rapid determination of aﬂatoxin-producing Aspergilli strains. Appl Environ Microbiol 67:4858–4862 27. Leontopoulos D, Siafaka A, Markaki P (2003) Black olives as substrate for Aspergillus parasiticusGROWTHANDAmATOXIN"PRODUCTION&OOD-ICROBIOLn 28. Atanda O, Oguntubo A, Adejumo O, Ikeorah J, Akpan I (2007) Aﬂatoxin M1 contamination of milk and ice cream in Abeokuta and Odeda local governments of Ogun State, Nigeria. Chemosphere 68:1455–1458 29. Squire RA (1981) Ranking animal carcinogens: a proposed regulatory approach. Science 214:877–880 30. Bennett JW, Klich M (2003) Mycotoxins. Clin Microbiol Rev 16:497–516 31. Hsieh D (1988) Potential human health hazards of mycotoxins. Mycotoxins and phytotoxins. In: 2nd joint food and agriculture organization/WHO/United Nations environmental program international conference of mycotoxins, Bangkok, Thailand, 28 Sept–2 Oct. Elsevier, Amsterdam 32. Robinson RM, Ray AC, Reagor JC, Holland LA (1982) Waterfowl mortality caused by aﬂatoxicosis in Texas. J Wildl Dis 18:311–313 3MITH*% -OSS-/ -YCOTOXINSFORMATION ANALYSIS ANDSIGNIlCANCE7ILEY .EW9ORK (IGGINS+& "ARTA2- .EIGER2$ 2OTTINGHAUS'% 3TERRY2) -YCOTOXINOCCURRENCEIN WASTElELDCORNANDINGESTAOFWILDGEESEINTHENORTHERN'REAT0LAINS0RAIRIE.ATn 35. IARC (International Agency for Research on Cancer) (2002) Monographs on the evaluation of carcinogenic risks to humans. Traditional herbal medicine, some mycotoxins, naphthalene and styrene. IARC, Lyon, pp 82–171 36. Bhatnagar D, Garcia S (2001) Aspergillus. In: Labbe RG, Garcia S (eds.) Guide to food born PATHOGENS7ILEY .EW9ORK 37. Thanaboripat D (2002) Importance of aﬂatoxins. KMITL Sci J 2:38–45 *ONES 2+ $UNCAN (% 0AYNE '! ,EONARD +* &ACTORS INmUENCING INFECTION BY Aspergillus ﬂavus in silk inoculated corn. Plant Dis 64:859–863 39. Sidhu OP, Chandra H, Behl HM (2009) Occurrence of aﬂatoxins in mahua (Madhuca indica Gmel.) seeds: synergistic effect of plant extracts on inhibition of Aspergillus ﬂavus growth and aﬂaTOXINPRODUCTION&OOD#HEM4OXICOLn *IUJIANG9 "HATNAGAR$ %HRLICH+# !mATOXINBIOSYNTHESIS2EV)BEROAM-ICOLn 3INGH90 -ALL.0 %FFECTOFVARIOUSGRAINPROTECTANTSONGERMINATIONANDDAMAGEOF wheat grains by Sitophilus oryzae Linn. Bull Grain Technol 29:50–54 42. Rees D (2004) Insects of stored products. CSIRO Publishing, Collingwood 43. Golebiowska Z (1969) The feeding and fecundity of Sitophilus granaries (L.), Sitophilus oryzae (L.) (Coleoptera: Curculionidae) and Rhyzoperta dominica & #OLEOPTERA Bostrychidae) in wheat grain. J Stored Prod Res 5:143–155 44. Aitken AD (1975) Insect travelers, I. Coleoptera, Technical Bulletin 31. HMSO, London 45. Rajendran S, Parveen KMH (2005) Insect infestation in stored animal products. J Stored Prod Res 41:1–30 "EGUM+ 2EDDY06 ,EELAJA"# 2AJASHEKAR9 2AJENDRAN3 3TUDIESONINSECTINFESTATION in chocolates. J Stored Prod Res 43:118–122

206

N.K. Dubey et al.

47. Rajendran S (2002) Postharvest pest losses. In: Pimentel D (ed.) Encyclopedia of pest MANAGEMENT-ARCEL$EKKER .EW9ORK 48. White NDG (1995) Insects, mites and insecticides in stored-grain ecosystems. In: Jayas P, 7HITE.$' -UIR7%EDS 3TORED GRAINECOSYSTEMS-ARCEL$EKKER .EW9ORK 0HELOUNG0 -ACBETH& %XPORTINSPECTIONADDINGVALUETO!USTRALIASGRAIN)N7RIGHT%* Banks HJ, Highley E (eds.) Stored grain in Australia 2000, proceedings of the Australian postharvest technical conference, Adelaide, 1–4 Aug 2000. CSIRO Stored Grain Research Laboratory, Canberra &ENG7 :HENG8 %SSENTIALOILSTOCONTROLAlternariaalternata in vitro and in vivo&OOD Control 18:1126–1130 (ATTON4 #UBBEDGE2( 0HYTOTOXICITYOFMETHYLBROMIDEASAFUMIGANTFOR&LORIDA CITRUSFRUIT0ROC&LA3TATE(ORTC3OCn 52. Webley DJ, Harris AH (1977) A comparison of fumigants for in-bag fumigation. Trop Stored Prod Inf 33:9–18 #OOK2* "AKER+& 4HENATUREANDPRACTICEOFBIOLOGICALCONTROLOFPLANTPATHOGENS American Physiopathology Society, St. Paul 7ILSON#, 7ISNIEWSKI-% &UTUREALTERNATIVESTOSYNTHETICFUNGICIDESFORCONTROLOF postharvest disease. In: Tjanos ET (ed.) Biological control of plant disease. Plenum Press, .EW9ORK 55. Jespers ABK, De Waard MA (1993) Natural products in plant protection. Eur J Plant Pathol 99:109–117 56. Dubey RK, Rajesh K, Jaya DNK (2007) Evaluation of Eupatorium cannabinum Linn. oil in enhancement of shelf life of mango fruits from fungal rotting. World J Microbiol Biotechnol 23:467–473 0ANG8 1UN:HANG:1 (UANG8UE- "IOLOGICALCONTROLOFPOSTHARVESTDISEASESOF fruits and vegetables. J Trop Subtrop Bot 10:186–192 58. Wisniewski M, Wilson C, EL-Ghaouth A, Droby S (2001) Non-chemical approaches to postharvest disease control. Acta Hortc 553:407–412 59. Droby S, Cohen L, Wiess B, Dans A, Wisniewski M (2001) Microbial control of postharvest diseases of fruits and vegetables- current status and future outlook. Acta Hortc 553:371–376 60. Benner JP (1993) Pesticidal compounds from higher plants. Pest Sci 39:95–102 61. Dubey NK, Shukla R, Kumar A, Singh P, Prakash B (2010) Prospects of botanical pesticides in sustainable agriculture. Curr Sci 98:4 62. Varma J, Dubey NK (1999) Prospectives of botanical and microbial products as pesticides of tomorrow. Curr Sci 76:172–179 "ALANDRIN-& +JOCKE!* 7URTELE$& .ATURALPLANTCHEMICALSSOURCESOFINDUSTRIAL and pharmaceutics. Humana press, Clifton 64. Cox PD (2004) Potential for using semiochemicals to protect stored products from insect infestation. J Stored Prod Res 40:1–25 65. Cook SM, Khan ZR, Pickett JA (2007) The use of ‘push–pull’ strategies in integrated pest management. Annu Rev Entomol 52:375–400 66. Kuepper G, Dodson M (2001) Companion planting: basic concepts & Resources. ATTRA, &AYETTEVILLEwww.attra.ncat.org 67. Regnault-Roger C, Philogène BJR (2008) Past and current prospects for the use of botanicals and plant allelochemicals in integrated pest management. Pharm Biol 46:41–52 6ARMA* $UBEY.+ %FlCACYOFESSENTIALOILSOFCaesulia axillaris and Mentha arvensis AGAINSTSOMESTORAGEPESTSCAUSINGBIODETERIORATIONOFFOODCOMMODITIES)NT*&OOD-ICROBIOL 68:207–210 69. Kalemba D, Kunicka A (2003) Antibacterial and antifungal properties of essential oils. Curr Med Chem 10:813–829 70. Kumar A, Shukla R, Singh P, Dubey NK (2009) Biodeterioration of some herbal raw materials by storage fungi and aﬂatoxin and assessment of Cymbopogon ﬂexuosus essential oil and its components as antifungal. Int Biodeterior Biodegrad 63:712–716

0LANT#HEMICALSIN0OST(ARVEST4ECHNOLOGYFOR-ANAGEMENTOF&UNGALx

207

+UMAR 2 -ISHRA !+ $UBEY .+ 4RIPATHI 9" %VALUATION OF Chenopodium ambrosioides as a potential source of antifungal, antiaﬂatoxigenic and antioxidant activity. )NT*&OOD-ICROBIOLn 72. Velluti A, Sanchis V, Ramos AJ, Egido J, Marín S (2003) Inhibitory effect of cinnamon, clove, lemongrass, oregano and palmarose essential oils on growth and fumonisin B1 production by Fusarium proliferatumINMAIZEGRAIN)NT*&OOD-ICROBIOLn 73. Marín S, Velluti A, Ramos AJ, Sanchis V (2004) Effect of essential oils on zearalenone and deoxynivalenol production by Fusarium graminearum IN NON STERILIZED MAIZE GRAIN &OOD Microbiol 21:313–318 2ASOOLI ) &AKOOR -( 9ADEGARINIA $ 'ACHKAR , !LLAMEH ! 2EZAEI -" Antimycotoxigenic characteristics of Rosmarinus ofﬁcinalis and Trachyspermum copticum L. ESSENTIALOILS)NT*&OOD-ICROBIOLn -ACEDO -,2 -ELLO '# &REIRE -'- .OVELLO *# -ARANGONI 3 DE -ATOS $'' Effect of a trypsin inhibitor from Dimorphandra mollis seeds on the development of Callosobruchus maculates. Plant Physiol Biochem 40:891–898 3ALUNKE"+ +OTKAR(- -ENDKI03 5PASANI3- -AHESHWARI6, %FlCACYOFmAvonoids in controlling Callosobruchus chinensis (L.) (Coleoptera: Bruchidae), a post-harvest pest of grain legumes. Crop Prot 24:888–893 -ACEDO -,2 &REIRE -'- .OVELLO *# -ARANGONI 3 Talisia esculenta lectin and larval development of Callosobruchus maculatus and Zabrotes subfasciatus (Coleoptera: Bruchidae). Biochim Biophys Acta 1571:83–88 78. Sadeghi A, Van Damme EJM, Peumans WJ, Smagghe G (2006) Deterrent activity of plant lectins on cowpea weevil Callosobruchus maculatus & OVIPOSITION 0HYTOCHEMISTRY 67:2078–2084 79. RozmanV KI, Korunic Z (2007) Toxicity of naturally occurring compounds of Lamiaceae and Lauraceae to three stored-product insects. J Stored Prod Res 43:349–355 80. Lahlou M (2004) Methods to study the phytochemistry and bioactivity of essential oils. Phytother Res 18:435–448 81. Raina VK, Srivastava SK, Aggarwal KK, Syamasundar KV, Khanuja SPS (2003) Essential oil composition of Cymbopogon martinii FROM DIFFERENT PLACES IN )NDIA &LAVOUR &RAGR * 18:312–315 82. Isman MB, Koul O, Luczynski A, Kaminski A (1990) Insecticidal and antiffedant bioacTIVITIES OF NEEM OILS AND THEIR RELATIONSHIP TO AZADIRACHTIN CONTENT * !GRIC &OOD #HEM 38:1406–1411 83. Thapa RK, Agrawal SG, Dhar KL, Atal CK (1982) Cultivation and utilization of aromatic plants. Publication and Information Directorate, CSIR, New Delhi +ISHORE. $UBEY.+ &UNGITOXICPOTENCYOFSOMEESSENTIALOILSINMANAGEMENTOF damping–off diseases in soil infested with Pythium aphanidermatum and P. debaryanum. )NDIAN*&ORn 85. Isman MB (2000) Plant essential oils for pest and disease management. Crop Prot 19:603–608 +ISHORE. $WIVEDI23 &UNGITOXICITYOFTHEESSENTIALOILOFTagetes erecta L. against Pythium aphanidermatum&ITZ THEDAMPINGnOFFPATHOGEN&LAVOUR&RAGR*n 87. Gundidza M (1993) Antifungal activity of essential oil from Artemisia afra Jacq. The Cent Afr J Med 39:140–142 88. Mishra AK, Dubey NK (1994) Evaluation of some essential oils for their toxicity against fungi causing deterioration of stored food commodities. Appl Environ Microbiol 60:1101–1105 89. Jayaprakasha GK, Jena BS, Negi PS, Sakariah KK (2002) Evaluation of antioxidant activities and antimutagenicity of turmeric oil: a byproduct from curcumin production. Z Naturforsch 57:828–835 90. Varma J, Tripathi M, Ram VJ, Pandey VB, Dubey NK (2002) J-asarone, the fungitoxic principle of the essential oil of Caesulia axillaries. World J Microbiol Biotechnol 18:277–279 -OTIEJUNAITE/ 0ECIULYTE$ &UNGICIDALPROPERTIESOFPinus sylvestris L. for improvement of air quality. Medicina (Kaunas) 40:787–794

208

N.K. Dubey et al.

92. Singh G, Maurya S, Catalan C, De Lampasona MP (2004) Chemical constituents, antifungal ANDANTIOXIDATIVEEFFECTSOFAJWAINESSENTIALOILANDITSACETONEEXTRACT*!GRIC&OOD#HEM 52:3292–3296 +UMAR2 $UBEY.+ 4RIPATHI9" %XPLOITATIONOFESSENTIALOILOFMentha arvensis as botanical fungitoxicant to protect food commodities from fungal infestation. In: 13th international and biodegradation symposium, Madrid Spain #HENG33 ,IN(9 #HANG34 #HEMICALCOMPOSITIONANDANTIFUNGALACTIVITYOFESSENtial oils from different tissues of Japanese Cedar (Cryptomeria japonica *!GRIC&OOD#HEM 53:614–619 -ISHRA !+ $UBEY .+ &UNGITOXIC PROPERTIES OF Prunus persica oil. Hindustan Antibiot Bull 32:91–93 +OBAISY- 4ELLEZ-2 7EBBER#, $AYAN&% 3CHRADER++ 7EDGE$% 0HYTOTOXIC and fungitoxic activities of the essential oil of kenaf (Hibiscus cannabinus L.) leaves and its COMPOSITION*!GRIC&OOD#HEMn 'ONÀALEZ% &ELICIO*$ 0INTO-- 2OSSI-( -EDINA# &ERNANDES-*" 3IMONI)# Inhibition of aﬂatoxin production by Polymnia sonchifolia and its in vitro cytotoxicity. Arq Inst Biol 70:139–143 #HA3# 9OUNG'$ /BERG#* 3CREENINGOFINHIBITORYACTIVITYOFESSENTIALOILSON selected bacteria, fungi, and viruses. J Essent Oil Res 12:639–649 :AIKA,, 3PICESANDHERBSTHEIRANTIMICROBIALACTIVITYANDITSDETERMINATION*&OOD Saf 9:97–118 -ANGENA4 -UYIMA.9/ #OMPARATIVEEVALUATIONOFTHEANTIMICROBIALACTIVITIESOF essential oils of Artemisia afra, Pteronia incana and Rosemarinus ofﬁcinalis on selected bacteria and yeast strains. Lett Appl Microbiol 28:291–296 101. Marino M, Bersani C, Comi G (2001) Impedance measurement to study antimicrobial activITYOFESSENTIALOILSFROM,AMIACEAEAND#OMPOSITAE)NT*&OOD-ICROBIOLn :OLLO! "IYITI0( 4CHOUMBOUGNANG, -ENUT&# ,AMATY' "OUCHET0( !ROMATIC PLANTSOFTROPICAL#ENTRAL!FRICA0ART888))#HEMICALCOMPOSITIONANDANTIFUNGALACTIVITY OFTHIRTEENESSENTIALOILSFROMAROMATICPLANTSOF#AMEROON&LAVOUR&RAGR*n 103. Roy AK (2003) Mycological problems of crude herbal drugs-overview and challenges. Indian Phytopathol 56:1–13

Chapter 9

Ganoderma Diseases of Woody Plants of Indian Arid Zone and their Biological Control Rikhab Raj Bhansali

Abstract Scanty tree vegetation of Indian arid region is affected by a variety of biotic and abiotic factors. Basal rot diseases, caused by a wide variety of wound colonizing fungi, cause decay of the trunk, large branches, and roots of many woody plants of arid and semiarid zones. The root and butt rot fungi include Ganoderma lucidum, Inonotus hispidus, Phellinus pachyphloeus and P. badius are most frequently encountered in natural agroforestry stands in Western India. The rate of decay development within hardwoods varies with the speciﬁc wood decay fungus present and the host species involved. Decay usually develops slowly over a period of many years and may not noticeably shorten the life of an affected tree or shrub. But in recent years it causes huge mortality of Prosopis and Acacia trees. Discoloration and decay of wood are much more common and serious in over mature trees and poorly managed agroforestry stands. In living trees, most of the decay is conﬁned to the older, wood (soft and heartwood) of roots, trunks. Once the tree is wounded, however, the outer wood or sapwood is quickly colonized by the wood-decay Ganoderma fungi. Most affected parts of the trees are root and butt regions. The lower bole has always been of most concern due to the injury during various farm machines operations in cropping period. Management of basal rot disease is difﬁcult due the natural growth of agroforestry trees in farmer’s ﬁeld and soil borne nature of pathogens. Cultural practices for disease control are cumbersome as well as non-practical because of mixed culture of trees and crops. However, biocontrol by using antagonistic fungi such as Trichoderma and Gliocladium can minimize the attack of G. lucidum. Thus management of basal rot in tree replanting areas should be based upon the following strategy: (i) use of G. lucidum uninfected soil having biocontrol fungi in polybags to grow seedlings; (ii) prevention of wounds and infection in young growing tree; (iii) eradication of all sources of Ganoderma

R. Raj Bhansali (*) Central Arid Zone Research Institute, Jodhpur 342 003, Rajasthan, India e-mail: [email protected]

J.M. Mérillon and K.G. Ramawat (eds.), Plant Defence: Biological Control, Progress in Biological Control 12, DOI 10.1007/978-94-007-1933-0_9, © Springer Science+Business Media B.V. 2012

209

210

R. Raj Bhansali

in the ﬁeld; and (iv) application of native strains of biofungicides (Trichoderma spp.) for the management of basal rots.

9.1

Introduction

Natural vegetation of Thar Desert is composed of Acacia jacquemontii, Acacia leucophloea, Acacia senegal, Albizia lebbeck, Azadirachta indica, Anogeissus rotundifolia, Prosopis cineraria, Salvadora oleoides, Tecomella undulata, Tamarix articulata tree, shrub and herb species [1]. Trees in arid zone are sparsely distributed, beneath which are cultivated arable crops. In Indian arid zone, as in many other parts of arid lands of the world, forests are under great threat, due mainly to human interference, pests and pathogens. Fungi play a very important role in growth of forest trees and balance of forest ecosystem. Some fungi help them in nutrient uptake, in decomposition of forest litter and nutrient cycling. There are some fungi, which are harmful to forest plants causing damage to root system, stem, branches, foliage, seed, wood, etc. Wood decay fungi destroy a lot of wood and timber every year in standing trees as well as in wood depots (Table 9.1). Among the pathogens that pose a threat to natural forests and plantations in the arid land farming areas are the wood rotting fungi belong to macrofungi group i.e., Ganoderma lucidum, Inonotus hispidus, Phellinus pachyphloeus and P. badius. This role has become more evident in recent decades as the number of trees affected by G. lucidum has risen and the damage this causes to the desert economy has increased [2, 3].

9.2

Ganoderma

Ganoderma lucidum is one of the most beautiful mushrooms in the world [4]. It grows as a parasite or saprotroph on a wide variety of trees. It has worldwide distribution in both tropical and temperate geographical regions. It belongs to a large group of fungi called polypores. Distinguishing this group are the tubes on the underside of the fruiting body, in which spores are produced. Each tube ends in a tiny Table 9.1 Important wood –decay fungi in arid and semiarid areas Fungus Decay type Common hosts Fomes White AT, PC, AI, AL Fomitopsis Brown CF, SO, SP, AN Ganoderma White AT, PC, AI, DS, EC, ET Inonotus White AN Phellinus White PC, AL, AT AI Azadirachta indica, AT A. tortalis, AN Acacia nilotica, AL Albizia lebbeck, DR Delonix regia, PC Prosopis cineraria, SO Salvadora oleoides, SP Salvadora persica, EC Eucalyptus citriodora, ET Eucalyptus tereticornis

9

Ganoderma Diseases of Woody Plants of Indian Arid Zone…

211

“mouth” called a pore, and a fruiting body includes many hundreds or thousands of pores that discharge countless brown spores. Ganoderma is a very distinctive genus of family Ganodermataceae, white-rot polypore fungi that is primarily characterized by the formation of a double-walled, generally echinulate basidiospore. The shape and size of basidiospores and the texture of pileus surfaces are important characteristics that distinguish members of the Ganodermataceae. Most Ganoderma species are very variable macromorphologically and lack micromorphological distinctiveness [5]. As a consequence, earlier taxonomic studies in the genus have created many synonymous names and have resulted in largely ambiguous species delimitation and identiﬁcation systems, making species identiﬁcation in the genus virtually impossible [6, 7]. Variability of morphological characteristics of Ganoderma led many taxonomists to explore chemical and molecular methods to distinguish between species of Ganoderma having medicinal importance [8]. Isoenzymes and rDNA studies have shown that the Ganoderma species complex is composed of several species that can be difﬁcult to distinguish from one another [9–13]. Recent genetic and biogeographic studies have indicated that most Ganoderma species are geographically restricted. Incorrect taxonomic identiﬁcation of Ganoderma strains hampers comprehensive strategies for drug discovery as well as for monitoring and managing diseases caused by Ganoderma in woody crops and forest ecosystems [14, 15].

9.2.1

Wonder Herb

Though it is wood decaying mushroom occurring on conifers, hardwoods and monocotyledonous species throughout the world [12] but also have tremendous medicinal uses. It has great importance in curing various human ailments [16]. Ganoderma or reishi or lingzhi all refer to the fruiting body of Ganoderma lucidum [Red lingzhi] and G. japonicum [Purple lingzhi]. G. lucidum (known as lingzhi in China and reishi in Japan), has been used extensively to treat a variety of illness from insomnia and arthritis to hepatitis and cancer. It was considered as the “elixir of life” by emperors and sages during most of China’s long history, and has been gloriﬁed in Chinese literary classics, with a reputation as a tonic to prolong life matching that of ginseng. It is one of the most famous traditional Chinese medicinal herb, is used as a healthy food and medicine in the Far East for more than 2,000 years. Active ingredient of Ganoderma fruiting body is Ganoderic acid A & B show biological activity against the various ailments [17–20].

9.2.2

Diseases of Woody Plants

Among the basidiomycetes, species within the genus Ganoderma are widely distributed in natural ecosystems in both tropical and temperate regions of the world [21]. Ganoderma, a polyporoid fungus of the order Polyporales, has a worldwide distribution.

212

R. Raj Bhansali

Fig. 9.1 Butt and root rot of Ganoderma lucidum of woody tree

The genus comprises a large and diverse complex of fungi, many of which are wood rotters and others that are pathogenic on economically important trees and perennial crops. Root and stem rots caused by Ganoderma have long been known to cause extensive losses of many tropical perennial woody or ﬁbrous plants. Several species of the genus Ganoderma are responsible for wood decaying on living trees as well as dead trunks and stumps [22]. Ganoderma basal rot disease has been reported from tropical and temperate countries such as America, Asia, the Middle East and Europe. Generally, Ganoderma spp. cause extensive heart rots of standing trees by growing in the central, non-living woody tissues. There is large number of host species for a single species G. lucidum reported from tropical and temperate countries. G. lucidum is not a single species, but a species complex. Studies employing modern methods differentiate the tropical and temperate species [23]. G. lucidum has been reported as the major causal organism of the heart rot disease of several high valued tree species such as Quercus spp., Cocos nucifera, Camellia sinensis, Prunus persica, Vitis vinifera. In India Ganoderma diseases have been recorded on 144 hosts, and of those G. lucidum has been listed on 91 hosts including Delonix regia and Cassia ﬁstula. According to previous studies, several G. lucidum strains have been identiﬁed in the G. lucidum complex having different host speciﬁcity [23–25]. The dying of Prosopis cineraria, Acacia tortalis and D. regia trees due to basal rot has been observed in the Jodhpur and Nagaur districts of Rajasthan (Fig. 9.1). The ﬁrst observation was made on a 25 year old Prosopis cineraria tree located at CAZRI campus, Jodhpur. The dying of tree has spread in a sequential pattern in different locations of arid and semi arid zone areas [26, 27]. The Ganoderma grows parasitically on the lower portion of tree trunk of native as well as introduced tree species, particularly deciduous woody trees. G. lucidum ﬁrst colonizes wounds and then cause decay of sapwood and heartwood in roots, butts and trunks of trees. This fungus quickly decomposes the logs and stumps.

9

Ganoderma Diseases of Woody Plants of Indian Arid Zone…

213

Various species of Ganoderma are seriously affecting the plantation of A. auriculiformis, A. nilotica and A. mangium in India, Pakistan and Malaysia [28–30]. The range of Indian species of Ganoderma, include Ganoderma adspersum, G. annulare, G. applanatum, G. australe, G. colossum, G. leucopherum,; G. lucidum, G. resinaceum, and G. subtornatum. In Papua New Guinea, approximately 10% annual mortality has been recorded in A. auriculiformis caused by Ganoderma and Phellinus spp. [31]. The fungus rapidly extends along the roots to the collar then upwards to the stem base. In older trees, often only part of the crown is affected. Root rot due to G. lucidum, has also been reported on L. leucocephala in Asia and Australia [32–34] while G. applanatum and G. tornatum affect L. leucocephala in Papua New Guinea [35, 36]. G. lucidum also causes wilting, drying of apical meristems, stem blackening, defoliation, root rot and ultimately death of trees. It is well recognized that G. lucidum is serious pathogen responsible for large scale mortality of trees belongs to family Fabaceae in India [28, 29, 32, 33, 37–39]. It also frequently attacks many arid zone tree species such as Prosopis and Acacia trees [3, 26, 40]. The disease severely affects age old trees of P. cineraria (a state tree of Rajasthan) and cause mortality of hundreds of tree every year. Sudden mortality of agroforestry and fruit trees is causing the serious economic impact of arid and semi-raid woody plants.

9.2.3

Mode of Infection

The entry point of G. lucidum fungus is mostly from the injury on woody tissues near ground region (Fig. 9.2). The fungal activity thus damages the structural root system of the tree [41]. The fungus lives in the soil and on infection colonizes the damaged roots or basal region of the tree depending on moisture level of host as well as soil. The fungus may colonize a plants root system slowly and may take several years to kill a tree in case of arid climate. Trees have two primary root systems. The structural root system is responsible for anchoring a tree to the earth. A trees ﬁne feeder root system is responsible for the daily demands of moisture and nutrients. Once the structural root system has been damaged, trees stability becomes quite a concern and colonizes by Ganoderma sp. Once the root system has been colonized then there is no prevention or control of the disease. There is obviously the avoidance of root damage of other healthy tree is only possibility or recently developed biocontrol method. It may be appropriate recommendations regarding a potential timeline for removal and replacement.

9.2.4

Disease Symptoms

Trees extensively invaded with a wood-rotting fungus G. lucidum show a gradual decline in vigor. Twigs and then branches die back with trees becoming structurally weak and more susceptible wind damage. Most wood-rotting fungi produce fruiting

214

R. Raj Bhansali

Fig. 9.2 Mode of infection of Ganoderma lucidum and decay of wood

structures or sporophores of the bracket (shelf) or hoof type–called conks – or the mushroom (toadstool) type. Bracket or hoof conks may be corky, leathery, woody, punky, or ﬂeshy in texture. Fruiting structures of decay fungi are unreliable predictors of decay because they commonly do not appear until decay is well advanced. Decay fungi may cause the colonized wood to become water soaked, spongy, stringy, crumbly, or ﬂaky. Affected wood may also be discolored, usually brown, white, yellow, or some shade of red, for several feet or more above and below where a conk or cluster of mushrooms appears. The development of wood rots varies somewhat with the fungus involved, the woody host that it invades, and the site on which the tree is growing. Thus, some fungi cause mainly root and butt rot, others a top rot, and still others a trunk and/or branch rot. Top rot decay fungi attack the heartwood in the upper part of the tree (Fig. 9.3). These fungi seldom progress very far into the roots and therefore rarely spread from one tree to another via roots or from the tree stump to the next generation of stump sprouts or root suckers. Root and butt rot fungi colonize the lower stem and roots and can cause serious problems in forest stands generated from sprouts and suckers. Rot in the parent tree and its invasion of cut stumps may serve to infect the new stand with root rot fungi. Fire, logging, lawn mower, tractor, farm machines and construction scars frequently provide entry points for root- and butt-rotting fungi.

9

Ganoderma Diseases of Woody Plants of Indian Arid Zone…

215

Fig. 9.3 Polyporoid fungus infection on the top of tree causing heartwood decay

Some species of decay fungi cause root and butt rot in one species of tree and trunk rot in another species. A few fungi cause both top rot and root or butt rot in the same tree species. Fungi that can decay living sapwood and heartwood and cause cankers are called canker rots.

9.2.4.1

Early Diagnosis of Disease

Basal rot by G. lucidum is most destructive disease of P. cineraria and A. tortalis trees in arid zone of India, which infect and destroy .mostly basal region of the tree. Since the disease progress slowly and infected plant usually dies without producing fungal basidiocarps. In majority of cases, at early stage of infected plants usually appear with symptoms but without external appearance of fungal bodies. Fungus usually emerges on tree at basal stem region in form of development of basidiocarp only when tree is about to die or after death. Molecular and immunological methods can be used or detecting the Ganoderma disease of woody trees at early infection Karthikeyan et al. [42] have used polyclonal antibodies (PAbs) raised against basidiocarp protein of Ganoderma were used for early detection of Ganoderma in coconut trees. Primer generated from the internal transcribed spacer region one (ITS 1) of ribosomal DNA gene of Ganoderma, which produced a PCR product of 167 bp in size, was used. This technique could useful in basal rot affected P. cineraria which do not produce fungal basidiocarps/sporophores.

216

R. Raj Bhansali

In the early stages of infection plants usually appear symptomless and the symptoms appear only when the plant is severely infected, so plants with severe symptoms are unable to be saved. The disease is considered to be spread from plant to plant through root connections in underground, although long-range disease dissemination, with spores spread by wind, has also been reported [3]. Repeated tree replanting on the same area has led to an increase in basal rot disease incidence, which increases from one generation to another.

9.2.4.2

Misdiagnosis

The difﬁculty in disease diagnosis before the development of basidiocarps of Ganoderma is that above ground signs can mimic other abiotic problems of arid environment such long dry spell, droughts and low moisture and poor nutrient to the trees. These conditions usually occur in arid areas. Moreover, trees infected with Ganoderma sp. often sprouts in the spring with signiﬁcant dieback and large dead branches with no changes in the trees environment. Even at this stage of the infection, there may be no visual evidence of fungal conk, usually apparent at the base of the tree. There is also the opposite scenario in that a trees canopy looks perfectly ﬁne, but fruiting structures have developed. Often the only overt evidence of infection is the presence of brackets or conk. Therefore any trees with brackets on it are normally considered to be affected by Ganoderma disease.

9.2.5

Effect on Host Plants

Infected trees initially slow in growth rate their leaves are often small, poor in vigour and yellowed. Affected trees ultimately leaﬂess and dies (Fig. 9.4). These characters are often confused with trees grown under prolonged dry seasons. Infected wood gives light coloured, mottled appearance due to the growth of mycelium. In advanced stages of decay the wood readily fractures across the grain. It remains ﬁrm for a time but eventually becomes soft and spongy. Woody stem and root tissues become mottled and white due to the decomposition of cellulose and lignin. Columns of decaying wood often extend above and below the brackets.

9.2.5.1

Wood Deterioration

More than 1,000 species of fungi can cause wood deterioration and decay. Most of the fungi that cause serious wood rot are belong to the family Basidiomycetes (brown rot and white rot fungi) and some are Ascomycetes [43]. The fungi grow inside the wood cells and produce enzymes that digest the cell wall components for food and energy. The brown rot fungi, which attack mostly softwoods, produce cellulase enzymes that digest the cellulose and hemicellulose in the cell wall but leave

9

Ganoderma Diseases of Woody Plants of Indian Arid Zone…

217

Fig. 9.4 Mortality of Prosopis cineraria due to the attack of Ganoderma lucidum

the lignin largely unaffected. The result is decayed wood that is some shade of brown and that, in an advanced stage, may be stringy, have pockets, or may crack into a cubical pattern. The decayed wood then becomes crumbly. The white rot fungi enzymatically digest both cellulose and lignin and reduce the wood to a lightcolored, spongy, or stringy mass with white pockets or streaks separated by thin areas of ﬁrm sapwood and heartwood (Fig. 9.5). White rot fungi commonly attack hardwoods (deciduous trees) that are normally resistant to brown rot fungi. Some Ascomycetes (such as Daldinia, Hypoxylon and Xylaria) cause a relatively slow white rot with variable black zone lines in and around the rotting wood both in standing hardwood trees and in slash. In standing trees the decay is usually associated with wounds or cankers. Other causes of decay, especially in wood that contains high moisture content, include the soft rot fungi and bacteria. Soft rot fungi, usually species of Ascomycetes and Fungi Imperfecti (e.g., Alternaria, Bisporomyces (Chloridium), Diplodia, and Paecilomyces) digest both lignin and cellulose. Their effects are normally conﬁned

218

R. Raj Bhansali

Fig. 9.5 Cross section (normal and enlarged views) of tree trunk of P. cineraria A. Healthy tree trunk: live sapwood and dead heartwood and B. Dead tree trunk: dead sap wood showing fungal decay of heartwood

to localized pockets in the surface layers of wood commonly exposed to water in moist climates. Bacteria multiply and develop primarily in wood rays, where they feed on the contents and walls of parenchyma cells when the wood is in water or protected with a water spray.

9.2.5.2

White Rot

Mostly, there are three types of rots are formed by wood-decay fungi; mainly white, brown and soft (Table 9.2). White rot is ﬁbrous because some cellulose remains intact till very late stages. It usually turns whitish because of bleaching by oxidation and loss of lignin, which is slightly brown. In some white rots, there is a phenomenon called selective deligniﬁcation. All components are removed, but the relative rate varies. G. lucidum, a white rot has been studied for the production of the ligninmodifying enzymes laccase, manganese-dependent peroxidase (MnP), and lignin peroxidase (LiP). However, chemical analyses of the decayed blocks Prosopis velutina wood lost the most weight indicated that selective deligniﬁcation. Selective deligniﬁcation and simultaneous decay of woods have been investigated through SEM. Deligniﬁcation appeared mainly in areas of tracheids or ﬁbre tracheids, while the rays were simultaneously decayed [44]. They occurred in vascular bundles throughout the woody parts of the tree and provide water and minerals collected by the roots to leaves and other parts of the plant (stem, ﬂowers, fruits etc.). It also gives structural support to softwoods. Because tracheids have a much higher surface to volume ratio compared to vessel elements, they serve to hold water against gravity (by adhesion) when transpiration is not occurring.

9

Ganoderma Diseases of Woody Plants of Indian Arid Zone…

Table 9.2 Types of basal rot caused by microorganisms Type of rots Type Agent Color Texture White Basidiomycota Bleached Fibrous Brown

Basidiomycota

Brown

Fibrous

Soft

Asco/Deutero

Bleached or brown

Usually on surface

219

Chemistry All wood components removed Carbohydrates lost but lignin remains Carbohydrates and some lignin lost

In many of broad leaves trees lignin and hemicelluloses are selectively removed in early stages [45]. This leaves enriched cellulose. This happens in the white regions of a mottled rot and in the pockets of a white pocket. Different types of white rots are called as stringy, spongy, mottled, white pocket rot and formation of zone lines [46–48]. Ganoderma fungus produced brown spots on Prosopis wood because carbohydrates are removed, leaving brownish, oxidized lignin. There is no ﬁbrous texture because the cellulose is broken quickly. The wood shrinks on drying and crosslinings are seen in later stages. The initial stage of infection was non-enzymatic. It seems that fungus produced some small chemical agent that zips around in the cell wall like a little pair of scissor, snipping chains of cellulose and hemicellulose into smaller pieces (Table 9.3). This happens throughout the wall in fairly early stages. The deligniﬁed wood may be used as fodder. It can be readily broken down with the aid of microorganisms.

9.2.6

Development of Basidiocarps

G. lucidum is annual and does not actually grow more each year like some perennial polypores; its fruiting body is quite tough and can last for months. The fungus produces on basal region of tree trunk a medium to large fruiting structure, a fungal conk. It is a shelf like structure that varies in color from a rusty red to a dark red with cream coloration almost always shiny in appearance. Top regions are shiny, zonate with dark brown lines [2]. Initially colour of upper surface of conks is light brown while lower side remains white or cream colored. The concern is that once the fruiting structure is evident, the fungus has often destroyed a large part of the trees ability to stay anchored to the earth, thus creating a high potential for failure and a potentially dangerous situation for recovery of tree. 9.2.6.1

Characteristics of Ganoderma Lucidum

Identiﬁcation of Ganoderma is largely based on morphological and cultural characters [49, 50]. Fruiting body usually stalked. The stalk is usually attached laterally and is 2.5–15 cm long, 1–4 cm thick and also reddish brown and varnished. In short generic diagnoses can be made with following characters: Pilate, annual, tough to

Degrading enzymes Endo-cellulase, Exo-cellulases, and betaglucosidases Hemicellulases actsPentose and hexose sugarssugar acids

Lacases, Manganese peroxidases, Lignin peroxidases

Table 9.3 Decay of wood by Ganoderma white rot and chemical componenets Chemical composition Chemical structure Cellulose-B1-4 Glucose polymer Hemicellulose – short chain polymers Cross-linked to cellulose and pectins

Lignin – phenyl propane skeleton:

220 R. Raj Bhansali

9

Ganoderma Diseases of Woody Plants of Indian Arid Zone…

221

woody hard, white-rotting polypores with a lacquered surface and brown, truncate, double-walled spores with inner wall ornamented. Cap: Bracket 10–25 cm in diameter, 2–3 cm thick, fan- or kidney-shaped, laterally attached, concentrically grooved and zoned rusty brown, later red to reddish brown to blackish, and like the stem conspicuously glossy as if varnished. They are also irregularly knobby or elongated, but by maturity more or less fan-shaped; often roughly arranged into lumpy “zones”; when mature; when young often with zones of bright yellow and white toward the margin. Pore Surface: Whitish, becoming dingy brownish in age; usually bruising brown; with 4–7 tiny (nearly invisible to the naked eye) circular pores per mm; tubes to 2 cm deep. Stem: Stem up to 30–140 × 10–30 mm, dark brown, glossy sometimes absent, but more commonly present; twisted; equal or irregular; varnished and colored like the cap; often distinctively angled away from one side of the cap. Flesh: Brownish; fairly soft when young, but soon tough. Spore Print: Brown. Chemical Reactions: KOH black or blackish on all surfaces. Microscopic Features: Tubes 0.5–2 cm long, pores 4–5 per mm, circular, whitish then cream, ﬁnally tobacco brown, darkening on bruising when fresh. Spores rusty, ellipsoid-ovate with truncate end, 7–13 × 6–8 Pm; appearing smooth at lower magniﬁcations; under oil immersion appearing double-walled, with a row of “pillars” between the walls. Setae and cystidia are absent. Hyphal system is dimitic.

9.2.6.2

Approaches for Distinguishing Ganoderma Species

The limitations of morphological taxonomy in separating closely related species within Ganoderma are well documented [51]. The basidiospores of species within the Ganodermataceae are considered to be the most characteristic taxonomic feature [52, 53] and differences in basidiospore morphology have been reported previously for a number of laccate and non-laccate species [9, 11, 44, 54]. Characteristics of the cuticle cells have also been valuable in distinguishing species within the subgenera Ganoderma and Elfvingia [55]. Several species of Ganoderma have been reported to be pathogenic on woody plants and oil palms in different countries [56, 57]. The major pathogen on oil palm in Malaysia has been identiﬁed as G. boninense [44]. Two species of Ganoderma belonging to different subgenera which cause disease on oil palms are identiﬁed by basidiome morphology and the morphology of their basidiospores. The names G. boninense and G. tornatum have been applied [35]. Signiﬁcant pleiomorphy was observed in basidiome characters amongst the specimens examined. This variation in most instances did not correlate well with host or host status. Spore morphology appeared uniform within a species and spore indices varied only slightly.

222

R. Raj Bhansali

Table 9.4 Host range of Ganoderma lucidum in leguminous trees of Arid Zone Host Incidence (%) Problem Acacia nilotica 1.0–6.5 Minor A. tortalis 2.5–8.0 Major A. cuprssiformis 2.0–4.5 Major A. senegal 0.0 Nil Albizia labbek 1.0–7.5 Major Delonix regia 0.5–1.5 Minor Prosopis cineraria 0.5–3.5 Major Prosopis juliﬂora 0.0–0.5 Minor

Mortality (%) 1.5 2.0 3.0 0.0 2.5 1.0 2.5 0.0

These species appears to have broad host speciﬁcity, occurring on other woody plants. Presently, there is some confusion on the identity of species of Ganoderma causing basal stem rot in different countries. In addition, conﬂicting information is available on the host range of Ganoderma species and their relationships to species associated with crops or vegetation. Morphology of basidiospores and pilocystidia of all specimens should be compared. Structure of basidiospores is similar in all species, but basidiospores of some species differed in length, width, spore index, and shape and distribution of inter-wall pillars [58, 59].

9.2.7

Nature of Basal Rot Disease

G. lucidum fungus may be endemic in agroforestry system of hot arid zone but it does not cause any serious epidemic unless until favourable environment and hosts. However, in a natural agroforestry stand some species are resistant to the pathogen, while others may exhibit varying degrees of susceptibility as give in Table 9.4. Very susceptible hosts may be killed outright. In less susceptible species, the fungus colonizes a small mass of roots in relation to the large mass of healthy roots reacting strongly against infection. Such trees continue to live though as they harbour the fungus in some roots. When the tree is clear-felled, the host resistance is lost and G. lucidum quickly spreads on residual roots and stumps to build up a high inoculum potential. If such a diseased site is not cleared of infected stumps and roots, the susceptible species subsequently planted in the stand become infected. Rotting and brittleness in woody roots were frequently observed indicating deterioration of water translocation system (tissues) of the tree. White fungal growth beneath the root bark was observed in many of the horizontal roots but in many a times fungal fruiting body are not seen despite fungal deterioration of roots. Basal rot disease can also be caused by wide variety of wound colonizing fungi of basidiomycota group, produce decay of the trunk, large branches, and roots of practically all woody plants. Decay usually develops slowly over a period of many years and may not noticeably shorten the life of an affected tree or shrub, although it causes huge annual losses of wood products. Discoloration and decay are much more rapid and serious in over mature Khejri trees than in young trees. In living

9

Ganoderma Diseases of Woody Plants of Indian Arid Zone…

223

trees, most of the decay is conﬁned to the older, sapwood of trunk and roots. Once the tree is injured, the wood-decay fungi (G. lucidum) colonize the outer wood or sapwood. Moisture and temperature conditions are important in formation and development for the growth of the fruiting bodies. When deep wounds or cuts are present, discoloration and decay often spread into the whole wood, especially if hardwood is affected than loses are higher. Wood rots or decay is a deterioration of wood by primarily enzymatic activities of microorganisms. Mostly fungi are the only agents of wood decay.

9.2.8

Host Range

G. lucidum usually attacks age-old trees and residual stumps as well as woody roots of arid zone. The pathogen possesses a wide host range among broad as well as small leaves trees grown in arid areas (Table 9.4). The common tree genera attacked by G. lucidum are P. cineraria, Acacia tortalis, A. nilotica A. catechu, Albizia lebbeck, Azardirachta indica. Cassia siamea, Casuarina equisetifolia, Dalbergia sissoo and D. latifolia, Delonix regia, Eucalyptus spp. Acacia senegal, Salvadora oleoides and S. persica are less affected by Ganoderma infection. Recently, the ﬂame tree (Delonix regia) planted on roadsides, in parks and public gardens for its beautiful ﬂowers and elegant fernlike, bi-pinnate leaves in western Rajasthan were found severely infected by Ganoderma. Infected trees displayed symptoms of leaf yellowing and branch death to complete death of the trees. An increase in the incidence of leaf yellowing, with branch and plant death was observed during the summer period (average temperature 40°C). Basidiocarps emerging from branches and tree trunks caused cracking of the bark followed by secretions of dark brown gummy substances. The brackets were identiﬁed as G. colossus. The basidiospores were brown, ovate, rough-walled, bitunicate, 14–16 × 9–11 mm. G. colossus is a pantropical species, which has been reported on a range of species [60, 61].

9.2.9

Disease Cycle

Infection nearly always occurs through moist, unprotected cracks in the bark where the wood underneath is exposed. These entry wounds include pruning or lopping cuts, branch stubs and damaged roots due to farm equipments. Other infections may occur through dead branches and tree stumps. Basidiospores of Ganoderma are borne by air currents, rain droplets, or the wounding agent, or are carried to the wound surface by insects and infested soil. These pioneer invaders (bacteria and non decay fungi) do not cause wood rot but grow and feed on the cells of the discolored wood around the wound and break down parts of the cell walls, adding to the discoloration and wetness of the wood and increasing certain mineral elements. Such wood is called wetwood, redheart, or blackheart. Finally, if the moisture

224

R. Raj Bhansali

content is above ﬁber saturation, the wood-rotting basidiospores become active, begin to digest the cell walls of the wounded tissue, and grow inside the wood cells that have been discolored by chemical (oxidative) processes and then fed upon by the bacteria, Ascomycetes and Fungi Imperfecti. The sporophores (conks or mushrooms) of wood rotting basidiomycetes appear at or near where the fungus entered, near the soil line, in cankers, at decayed branch stubs or swollen knots, along the trunk or branch of living trees, or along the length of the trunk following its death. The sporophores of most wood rotting fungi (such as Armillaria, Bjerkandera, Cerrena, Collybia, Daedaleopsis, Hericium, Ganoderma, Hypsizygus, Laetiporus, Lentinus, Lenzites, Pholiota, Piptoporus, Pleurotus, Polyporus, Schizophyllum, Trametes, and Trichaptum) are formed annually and do not produce spores for over a year, while those of Fomes, Oxyporus, and Phellinus are usually perennial and add a new layer of spore-producing tissue each year for 50 years or more. The sporophores produce basidiospores at the hymenial surface of gills or pores during part or most of the year, and the spores are carried by air currents, rain, insects, birds and other animals, or other agents to nearby tree wounds. A single large conk may shed up to 100 billion basidiospores in a single day. Typically, the spores are randomly disseminated by the wind. When a spore comes in contact with a wound in a tree and conditions are suitable (proper temperature, the presence of moisture and nutrients, and the lack of inhibitors produced by non-decay organisms), the spore germinates and forms a germ tube that expands into a hypha. The hypha branches and grows into the wood ﬁber and vessel cells to form a mycelium. Food is obtained by enzymatic digestion of the cell walls. Wood rotting fungi may also enter woody plants as mycelium. A tree is commonly injured many times during its lifetime. The disease cycle described above may be repeated after each new wound is formed, thus involving more and more wood in the natural and more or less continuous process of discoloration and decay. The end result is one or more cylindrical compartments of discolored and decayed wood that may extend over much of the height of the tree. Domesticated tree varieties differ greatly in their susceptibility to heartwood decay. These trees can be grouped into resistant or very resistant, moderately resistant, and slightly or nonresistant.

9.2.10

Life History

The basidiospores of the fungus infect trees through dead roots and wounded roots and butts. Fruiting bodies develop after the fungus has been living in the bark and sapwood of the butt and roots. Once the fruiting body appears, spores are released daily from June to September, with most of the spores coming out in the evening when the temperatures are lower and the relative humidity is higher [62]. The spores are dispersed by the wind to new substrates. This is a common sight after rainy season on diseased woody trees. Wood rotting fungi develop on susceptible wood when moisture content of the wood remains above 20%. The fungi

9

Ganoderma Diseases of Woody Plants of Indian Arid Zone…

225

Fig. 9.6 Disease cycle of Ganoderma lucidum on woody plants

develop from airborne or soil-borne spores by germinating on a suitable substrate such as damp wood. The germinating spores produce thin threadlike hyphae, which collectively form mycelium. The hyphae making up the mycelium penetrate the wood, breaking down the wood cell walls and feeding on them. Eventually the mycelium produces a fruit body; this releases spores to the atmosphere, completing disease cycle (Fig. 9.6).

9.2.11

Disease Management

Plant pathogens are among the most important biotic agents causing serious losses and damages to agroforestry tress and crops of arid zone. Plant pests need to be controlled to ensure adequate food, feed, fuel, ﬁber and arid zone environmental safety. Fungal pathogens are among the most important factors that cause serious damages and losses to the plants. A number of different strategies are currently being employed to manage and control plant pathogens [63–68]. Triazole fungicides injected into palm stems and disease lesions due to basal rot have prolonged the lives of diseased standing palms. A carboxin-quintozene mixture also found effective through trunk injection. It is noted that cyproconazole was able to sustain 97% of the Ganoderma-infected palms [69]. Harmful impacts of the chemical

226

R. Raj Bhansali

pesticides on the environment, including undesirable effects on non-target organisms, possible carcinogenicity of some chemicals and development of resistant races of pathogens [65]. In recent years, large no of synthetic fungicides have been banned in the western world because of their undesirable attributes such as high and acute toxicity. In developing countries such as India, they are still being used despite their harmful effects on human and environment. Many pathogenic microorganisms have developed resistance against chemical fungicides. This seriously hinders the management of diseases of agroforestry trees. Considering the deleterious effects of synthetic fungicides on life supporting systems, there is an urgent need for alternative agents for the management of pathogenic microorganisms [70]. In view of the several disadvantages associated with the unscientiﬁc use of pesticides in agriculture, there is an urgent need for minimising the use of chemical pesticides in the management of insect pests. Growing public concern over potential health hazards of synthetic pesticides and also steep increase in cost of cultivation/low proﬁt making by farmers has led to the exploration of eco-friendly pest management tactics. The need for the development of non-chemical alternative methods to control plant diseases is therefore highly desirable. Ganoderma disease is most important disease of the arid zone trees. Cultural methods of disease control are largely inefﬁcient and impractical in minimizing inoculum pressure and in reducing the disease incidence. Chemical methods in combination with soil amendments form short-term solutions for managing the disease. In fact, there is no chemical control for Ganoderma butt rot and once a tree is infected it is only a matter of time until it dies. It may take several years to kill host trees but meanwhile they can pose a hazard because they are very susceptible to wind throw. Wounding of trees should be avoided to reduce the chance of infection and any live trees with broken tops or sizeable wounds should be removed. Careful preparation of the soil and the use of improved resistant germplasm may also play an important role in preventing tree diseases. Earlier much effort went into controlling wounds caused by lopping of trees for upper region [71] but protection of the lower bole is still of prime concern in avoiding wounding [72].

9.2.11.1

Genetic Resistance

Under natural conditions among the Prosopis and Acacia species grown in arid zone, P. juliﬂora and A. senegal were found fairly resistant against G. lucidum attack. Source of resistant genes against Ganoderma pathogen will help in identiﬁcation of resistant genes and then incorporation in economically important susceptible hosts are most warranted. Molecular techniques could be beneﬁcial in acquiring such genetic gains in the improvement of arid zone tree species. In oil palm estates North Sumatra and Indonesia in Southeast Asia differential reactions against Ganoderma boninense of two Elaeis species, guineensis and oleifera have been observed. Differences in susceptibility to the disease have been detected within the Elaeis guineensis, material of Deli origin is highly susceptible compared to material of African origin. It is also possible to detect differences in reaction between parents

9

Ganoderma Diseases of Woody Plants of Indian Arid Zone…

227

and between crosses within a given origin. The variability of resistance to basal stem rot within the same cross is also illustrated by the diverse responses of clones derived from palms of the same origin. The prospects opened up new area for development of early selection of resistant plant [73].

9.2.11.2

Biological Control

Biological control of plant diseases has been considered a viable alternative method to manage plant diseases [65, 74]. The method is environmentally safe and in some cases is the only option available to protect plants against pathogens. Biological control using fungal and bacterial antagonists to manage plant diseases seems to be a promising alternative strategy. Some of the important factors that affect the efﬁcacy of microbial biocontrol agents in controlling plant diseases which should carefully be considered include method of application, formulation of biocontrol microorganisms and timing of application. Various composts and organic amendments as other means of biological control have also been tested on some plants and proven to be promising. A variety of biological controls are now available for use, but further development and effective adoption will require a greater understanding of the complex interactions among plants, people and the environment. Soil borne pathogens of Indian arid and semiarid zones are complex not only in their behavioral pattern but also in their biochemical constituents. Hence, it is not very easy to control these pathogens. To date there is no adequate control for basal rot and no genetic resistance to the disease has been known. Cultural control techniques have little effect on the control of basal rot, because the pathogen can survive in the soil for several years. Basal rot causes a decrease in all tree stands and reduces population rapidly. Thus, recently developed biological control methods using Trichoderma spp. and Gliocladium sp. have great promise for management of the basal rot diseases.

Trichoderma as Biofungicide The genus Trichoderma comprises a great number of fungal strains that act as biological control agents, the antagonistic properties of which are based on the activation of multiple mechanisms. Trichoderma strains exert biocontrol against fungal phytopathogens either indirectly, by competing for nutrients and space, modifying the environmental conditions, or promoting plant growth and plant defensive mechanisms and antibiosis, or directly, by mechanisms such as mycoparasitism. These indirect and direct mechanisms may act coordinately. Importance of the biocontrol process depends on the Trichoderma strain, the antagonized fungus, the plant, and the environmental conditions, including nutrient availability, pH, temperature, and iron concentration. Activation of each mechanism implies the production of speciﬁc compounds and metabolites, such as plant growth factors, hydrolytic enzymes, antibiotics.

228

R. Raj Bhansali

Fig. 9.7 Parasitic growth of Trichoderma on fruiting bodies of Ganoderma lucidum

These metabolites can be either overproduced or combined with appropriate biocontrol strains in order to obtain new formulations for use in more efﬁcient control of plant diseases. The genus Trichoderma has ﬁve species which are commonly used as biological control; they are T. harzianum, T. koningii, T. longibrachiatum, T. pseudokoningii, and T. viride. Morphological features of the conidia and phialides help in differentiation of these species from each other. Ganoderma has many natural antagonists, such as Trichoderma spp., Actinomycetes sp. and Bacillus spp. [75]. Trichoderma species are usually found as saprophytic soil inhabitants, but some of them have been successfully selected as antagonists to Ganoderma [76]. Trichoderma koningii isolate Marihat (MR 14) is one of the most powerful antagonists against Ganoderma and has been formulated as the active ingredient in a biofungicide [75]. In view of these developments, biological control of soil-borne G.lucidum plant pathogen is a potential alternative to the use of chemical pesticides. Several strains of the fungus Trichoderma have been isolated from the basidiospores of Ganoderma (Fig. 9.7) and found to be effective biocontrol agents of various soil-borne plant pathogenic fungi including Ganoderma under greenhouse and ﬁeld conditions. Hence, in view of soil borne nature of Ganoderma pathogen, the biocontrol approach by using native strains of Trichoderma and Gliocladium could be effective method for the basal rot disease management practices [3, 16, 27, 77]. Trichoderma survives as chlamydospores under unfavourable conditions and most of these are resistant to many kinds of chemical pesticides, such as organochlorines, organosulphides, organophosphites and bromides, and herbicides. However, Trichoderma also requires water for growth, so the Trichoderma biofungicide is applied at the beginning or end of the rainy season. The dose of the biofungicide depends on the size and age of the plants.

9

Ganoderma Diseases of Woody Plants of Indian Arid Zone…

229

Characterization and Identiﬁcation Trichoderma population usually presents in all types of soil and infected fruiting bodies [78]. Trichoderma is a ﬁlamentous fungus that is widely distributed in the soil, plant material, decaying vegetation, and wood. Fungus grows well on insects, nematodes and fungal bodies and insects. Hypocrea species are the teleomorph of some Trichoderma species. Trichoderma, an anamorphic Hypocreaceae (class Ascomycetes), is common in the environment, especially in soils. Species of this genus have been used in the production of cellulolytic and hemicellulolytic enzymes, biological control of plant disease, biodegradation of chlorophenolic compounds, and soil bioremediation [79–81]. The taxonomic position is as follows: Taxonomic position Kingdom: Fungi Phylum: Ascomycota Class: Euascomycetes Order: Hypocreales Family: Hypocreaceae Genus: Trichoderma

There are 89 species in the Trichoderma genus. Hypocrea are teleomorphs of Trichoderma which themselves have Hypocrea as anamorphs [81, 82]. It is expected to increase consistently. In this context, the advancements as well as limitations of modern methods like genealogical concordance phylogenetic species recognition and DNA-barcode system for safe identiﬁcation of Trichoderma spp. warrant future investigations. Important Species Trichoderma harzianum Notes: No known teleomorph Trichoderma koningii Hypocrea koningii is a teleomorph of this species. Trichoderma longibrachiatum Notes: No known teleomorph Trichoderma pseudokoningii Hypocrea pseudokoningii is a teleomorph of this species. Trichoderma viride Hypocrea rufa is a teleomorph of this species.

Microscopic Features Septate hyaline hyphae, conidiophores, phialides, and conidia are observed. T. longibrachiatum and T. viride may also produce chlamydospores. Conidiophores are hyaline, branched, and may occasionally display a pyramidal arrangement. Phialides are

230

R. Raj Bhansali

Fig. 9.8 Culture of Trichoderma species having profuse conidial growth on PDA medium

hyaline, ﬂask-shaped, and inﬂated at the base. They are attached to the conidiophores at right angles. The phialides may be solitary or arranged in clusters. Conidia (3 Pm in diameter, average) are one-celled and round or ellipsoidal in shape. They are smooth- or rough-walled and grouped in sticky heads at the tips of the phialides. These clusters frequently get disrupted during routine slide preparation procedure for microscopic examination. The color of the conidia is mostly green (Fig. 9.8). Although it is commonly considered as a contaminant, Trichoderma thrives on the types of plant organic matter and it requires a minimum organic carbon level of 1% to ensure proliferation. Microbial colonies Trichoderma spp. can be isolated and puriﬁed from Ganoderma affected soil and basidiocarps. They have been identiﬁed as T. harzianum, T. pseudokoningii, T. viride, Gliocladium viride, Pseudomonas and Bacillus sp.

Culture Features Colonies of Trichoderma grow rapidly and mature in 5 days. At 25°C and on potato dextrose agar, the colonies are wooly and become compact in time. From the front, the color is white. As the conidia are formed, scattered blue-green or yellow-green patches become visible. These patches may sometimes form concentric rings (Fig. 9.9). They are more readily visible on potato dextrose agar compared to Sabouraud dextrose agar. Reverse side of growth is pale, tan, or yellowish. Trichoderma can be cultivated in submerged state fermentation containing 45 g/l carbon, 0.35 g/l nitrogen, 30°C, 175 rpm and pH 6. This composition can yield the optimum biomass 5 days of culture. The identiﬁed optimal medium is rich in carbon but provided a limiting level of nitrogen (Fig. 9.10).

9

Ganoderma Diseases of Woody Plants of Indian Arid Zone…

231

Fig. 9.9 Formation of concentric rings Trichoderma during in vitro cultures

Fig. 9.10 Mass culture of Trichoderma on liquid yeast and Jaggery medium

Antagonistic Behaviour They are widely used as antagonistic fungal agents against several plant pathogens as well as plant growth enhancers [83]. Faster metabolic rates and anti-microbial metabolites are key factors their antagonistic role. Mycoparasitism, spatial and nutrient competition, antibiosis by enzymes and secondary metabolites, and induction of plant defense system are typical biocontrol actions of Trichoderma spp.

232

R. Raj Bhansali

Fig. 9.11 In vitro antagonistic activity of Trichoderma pseudokoningii on Ganoderma lucidum

Information on the classiﬁcation of the genus, Trichoderma, mechanisms of antagonism and role in plant growth promotion has been well characterized [78, 84–86]. Several strains of Trichoderma have been developed as biocontrol agents against fungal diseases of plants. Most biocontrol agents are from the species T. harzianum, T. viride and T. hamatum. Dual culture technique was used to test the efﬁcacy of T. pseudokoningii and G. virens on G. lucidum on PDA under in vitro conditions (Fig. 9.11). Field experiments conducted on integrated disease management of Ganoderma affected P. cineraria trees in hot and non-hot spots exhibited the recovery of diseased trees.

Bioformulation The formulation of microbial biomass represents a critical step in advancing the commercial development of prospective biological control products. The effect of various amendments on the preservation of the viability and competitiveness, in vitro, of fungal mycelium and spores in a liquid paste has been standardized. Optimization of these factors produces a biomass paste formulation of Trichoderma and Gliocladium virens that remains active, in vitro, for at least 4–6 months at room temperature. In order to overcome the cost limitation and improvement of bio-efﬁcacy of fungal biocontrol agents potential Trichoderma strains isolated from fruiting bodies of pathogens were successfully multiplied on liquid as well as semi-solid media having substrates like potato, corn, pearl millet and oil based by products (neem cake, castor cake and pongamia cacke) by various workers. Despite the use of these alternate sources, the cost of production was still high as these raw materials were required to be supplemented with other nutrients. In our earlier studies we have

9

Ganoderma Diseases of Woody Plants of Indian Arid Zone…

233

Fig. 9.12 Multiplication of Trichoderma spp. on Yeast and Molasses and FYM for ﬁeld application

already used Yeast and Molasses and then multiplied in FYM for the growth of Trichoderma spp. for ﬁeld application, where the spore production is maintained up to 107 CFU/ml (Fig. 9.12). The shelf-life of the product is 4 months at optimum temperature and moisture conditions. At the end of expiry, CFU should not be less than 20 × 106/gm product. 1. Cutting and Seedling Dip: Mix 200 g in 15–20 l of water and dip the cuttings/ rhizomes/tubers/roots of seedlings for 10 min before planting. 2. Field Application: Mix 1–2 kg in 100 kg in moist well–decomposed FYM and keep 10–15 days under polyethene cover in the shade. Turn over the mixture every 3 days to enable uniform multiplication of biofungicides in FYM. Fortify the FYM with 1 kg molasses. Broadcast the fortiﬁed FYM over 1 acre before sowing. Studies conducted in arid zone indicated that the efﬁcacy of Trichoderma spp., as biofungicides formulation in farmyard manure (FYM) and Jaggary are excellent in management of Ganoderma lucidum in Prosopis cineraria and Acacia tortalis affected trees. The formulations comprised FYM + Jaggary (3:1). Furthermore, many researchers have used different class of chemicals were added to increase the value of Trichoderma products. Reduction of losses in agroforestry trees by (a) eliminating, as much as possible, the introduced wood-rotting fungi into healthy stands by early pruning of lower branches; (b) avoid much of the mechanical damage to the root systems of the living trees; (c) harvesting trees before they become overly mature and thus increasingly

234

R. Raj Bhansali

susceptible to wood-rotting fungi; and All trees that are dead, hazardous, diseased, or pest ridden should be removed. Basal rot could be managed satisfactory if the source of infection of Ganoderma could be completely destroyed.

9.3

Conclusions

Arid zones are known to be fragile ecosystems and interference without knowing the ecological linkages within these systems can result in their degradation, which is often irreversible. Agroforestry has traditionally followed in these regions is a complete, ecologically sustainable livelihood system. To meet both present and future demands, policies need to be supportive of the development of these traditional agroforestry systems free from biotic stresses based on synergism with nature. There is also a potential to utilize arid zone agroforestry to solve global problems like desertiﬁcation, global warming (through increased carbon sequestration), and biodiversity conservation, which will require that greater international policy support for arid zone agroforestry. Select and grow species of trees and shrubs that are well adapted and free or resistant to pest and diseases are on top priority. Due to the serious environmental and health problems that wide spread use of chemical pesticides has created in the world, search for alternative safe methods is unavoidable. Biological control developed as an academic discipline during the 1970s and is now a mature science supported in both the public and private sector. Ecological factors play very important roles in the performance and activity of biocontrol-active microorganisms. Introducing new strains having biocontrol mechanisms are primary important for their success. Since fungal plant pathogens are very diverse and their pathogenicity is different on host plants, it is therefore very important to look for new and novel biocontrol microorganisms with different effective mechanisms. There is a growing demand for biologically based pest management practices. An upswing in commercial interests has also developed in the past few years and prospects for increased growth are positive. The Biopesticide Industry Alliance has formed and it is now actively promoting the value and efﬁcacy of biopesticides (including those that control fungal plant pathogens). Recent surveys of both conventional and organic growers indicate an interest in using biocontrol products suggesting that the market potential of biocontrol products will increase in the future [87]. Since the ultimate goal of biological control of plant diseases is to assist the growers to combat and control plant pathogens in the ﬁeld which is the real agricultural environment, it is therefore important to practically integrate biocontrol strategies into agricultural system for arid zone agroforestry system. The development of these new technologies and methodologies for mitigating losses by wood decay fungi by using natural strains of Trichoderma species must be an active ﬁeld of interest. The Trichoderma sp fungus can be used as a biofungicide to kill the Ganoderma sp fungus that causes basal stem rot disease. This will be much more effective than older methods in optimizing tree yields. Early detection of pathogens in standing trees would be useful for predicting future potential damage.

9

Ganoderma Diseases of Woody Plants of Indian Arid Zone…

235

Technology also need to be developed to identify forest pathogens and wood decay fungi in vitro for disease diagnosis or through using molecular methods. Recent research could put an end to the scourge of basal stem rot disease that causes severe losses yearly to arid zone trees. The soil-borne fungus would destroy Ganoderma ﬁlaments without leaving chemical residue on crops — and might provide an environmentally friendly way to ﬁght and sustainable survival of MPT plantation in arid and semiarid areas. Undoubtedly, “We can kill any harmful fungus in a short time by using chemical fungicides. However, this may pollute the environment and harm all biological entities. Therefore, biopesticides may be the most appropriate way to destroy fungi without any environmental risks.” Trichoderma bio-fungicides are unlike chemical fungicides, they do not cause resistance in the pathogens. They are nonphytotoxic and improve yield and growth of plants. Bio-fungicides can be used for coating seeds just before sowing, for nursery bed treatment, dipping cuttings or seedlings and soil application after multiplying on FYM and by soil drenching in case of perennial crops. Trichoderma as biocontrol agent is completely safe for humans and livestock. In nearly 60 years of research there has never been a recorded adverse reaction. The predatory qualities of Trichoderma are a big part of the appeal of this species of fungus for commercial applications, but there are other associated beneﬁts that warrant consideration. The immediate priorities for developing an efﬁcient management system for Ganoderma diseases in India are: (1) a thorough understanding of the etiology and epidemiology of the diseases on different hosts, (2) clarifying current ambiguity in species names, (3) assessing the inter-relationships between populations of Ganoderma on different hosts, (4) developing tools for early detection of diseases in important crops and (5) use of microorganisms in managing basal rot. Biological control research is a low-cost and environmentally friendly treatment for Ganoderma fungal disease to arid zone trees in India. Besides these, medicinal uses of Ganoderma research continue use a preparation of G. lucidum on a daily basis to promote good human health and treatment of many diseases. The medicinal properties of G are gaining popularity all over the world.

References 1. Kaul RN (1970) Arid zones. Dr W Junk NV Publishers, The Hague 2. Raj Bhansali R, Jindal SK (1997) Diseases of desert trees and their management. In: Gputa JP, Sharma BM (eds.) Agroforestry for sustained productivity in arid regions. Scientiﬁc Publishers, Jodhpur 3. Raj Bhansali R (2010) Management of Ganoderma basal stem rot disease of Prosopis cineraria (L.) Druce through biocontrol fungi. In: Trivedi PC (ed.) Plant diseases and its management. Aaviskar Publication and Distributors, Jaipur, pp 135–151 4. Kuo M (2004) Ganoderma lucidum. Retrieved from the Web site: http://www.mushroomexpert.com/ganoderma_lucidum 5. Ryvarden L (1991) Genera of polypores: nomenclature and taxonomy. Synop Fung 5:1–363 6. Moncalvo JM, Ryvarden L (1997) A nomenclatural study of the Ganodermataceae Donk. Fungiﬂora, Oslo

236

R. Raj Bhansali

7. Ryvarden L (1985) Type studies in the Polyporaceae 17: species described by W A Murrill. Mycotaxon 23:169–198 8. Güzelda G, Çolak Ö (2007) Molecular identiﬁcation of Ganoderma lucidum from Turkey. Int J Agric Biol 9:767–770 9. Steyaert RL (1977) Basidiospores of two Ganoderma species and others of two related genera under the scanning electron microscope. Kew Bull 31:437–442 10. Moncalvo JM, Wang HF, Hseu R (1995) Gene phylogeny of the Ganoderma lucidum complex based on ribosomal DNA sequences. Comparison with traditional characters. Mycol Res 99:1489 11. Gottlieb AM, Wright JE (1999) Taxonomy of Ganoderma from southern South America: subgenus Ganoderma. Mycol Res 103:661–673 12. Gottlieb AM, Saidman BO, Wright JE (1998) Isoenzymes of Ganoderma species from South America. Mycol Res 102:415–426 13. Gottlieb AM, Ferrer E, Wright JE (2000) rDNA analyses as an aid to the taxonomy of species of Ganoderma. Mycol Res 104:1033 14. Smith BJ, Sivasithamparam K (2000) Isozymes of Ganoderma species from Australia. Mycol Res 104:952 15. Hong SG, Jung HS (2004) Phylogenetic analysis of Ganoderma based on nearly complete mitochondrial small-subunit ribosomal DNA sequences. Mycologia 96:742–755 16. Raj Bhansali R (2003) Ganoderma fungus and its commercial applications. In: Trivedi PC (ed.) Microbial biotechnology. Aaviskar Publication and Distributors, Jaipur 17. Fang QH, Zhong JJ (2002) Effect of initial pH on production of ganoderic acid and polysaccharide by submerged fermentation of Ganoderma lucidum. Process Biochem 37:769–774 18. Paterson RR (2006) Ganoderma-a therapeutic fungal biofactory. Phytochemistry 67:1985–2001 19. Liu J, Kurashiki K, Shimizu K, Kondo R (2006) Structure-activity relationship for inhibition of 5alpha-reductase by triterpenoids isolated from Ganoderma lucidum. Bioorg Med Chem 14:8654–60 20. Lindequist U, Niedermeyer THJ, Jülich WD (2005) The pharmacological potential of mushrooms. Evid Based Complement Altern Med 2:285–299 21. Steyaert RL (1981) The concept and circumscription of Ganoderma tornatum. Trans Brit Mycol Soc 65:451–467 22. Hennessy C, Daly A (2007) Ganoderma diseases, Agnote, No: I67. Northern Territory Government. www.nt.gov.au/dpifm 23. Tiwari CK, Sharma N, Verma RK (2005) Taxonomy of the genus Ganoderma with reference to Indian species – an overview. Indian J Trop Biodiv 13:57–72 24. Miller RNG, Hoderness M, Bridge PD, Chung GF, Zakaria MH (1999) Genetic diversity of Ganoderma in oil palm plantings. Plant Pathol 45:595–603 25. Sankaran KV, Bridge PD, Gokulapalan C (2005) Ganoderma diseases of perennial crops in India – an overview. Mycopathologia 159:143–152 26. Raj Bhansali R (2002). Occurrence and host range of Ganoderma lucidum in western parts of Rajasthan. In: Asian congress of mycology and plant pathology-plant health for food security, University of Mysore and Indian Society of Mycology and Plant Pathology, Mysore 27. Raj Bhansali R (2005) Biocontrol of Ganoderma affected Khejri (Prosopis cineraria). In: Second global conference plant health-global wealth, Udaipur, 25–29 Nov 2005 28. Bagchee K (1945) Pathological notes: No. 2. Wilt and dieback on shisham (Dalbergia sissoo), babul (Acacia nilotica) and khair (A. catechu) in the artiﬁcial regeneration under agriculturecum-forestry management. Indian For 71:20–24 29. FAO (1981) Seed source establishment and tree improvement -Sabah, Malaysia, Forest Mycology. FAO, Rome, FAO/UNDP/MAL/78-009 30. Lee SS (1985) Tree diseases and wood deterioration problems in Peninsular Malaysia, Occasional Paper No. 5. Faculty of Forestry, Agriculture, University of Malaysia 31. Skelton DJ, Howcroft HS (1987) Seed production and silvicultural trials of Acacias in Papua New Guinea. In: Trurnbull JW (ed.) Proceedings of an international workshop, Australian

9

32. 33. 34. 35.

36. 37. 38.

39.

40.

41.

42.

43.

44.

45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55. 56.

Ganoderma Diseases of Woody Plants of Indian Arid Zone…

237

acacias in developing countries, ACIAR Proceedings Series No. 16. Forestry Training Centre, Gympie, Aug 1986 Raina AK (1983) Performance of leucaena in the Indian arid zones. 3. Fusarium gummosis and Ganoderma root rot. Leucaena Res Rep 4:35–36 Pathak PS (1986) Mortality in leucaena due to Ganoderma lucidum. Leucaena Res Rep 7:65 Lenné JM (1991) Diseases of Leucaena species. Trop Pest Manage 37:281–289 Pilottil CA, Sanderson FR, Aitken EAB, Armstrong W (2004) Morphological variation and host range of two Ganoderma species from Papua New Guinea. Mycopathologia 158:251–265 Shaw D (1984) Microorganisms in Papua New Guinea, Research Bulletin No. 33. Department of Primary Industry, Port Moresby Bakshi BK, Singh S (1967) Rusts on Indian forest trees. Indian forest records (new series). For Pathol 62:139–198 Lenné JM, Boa ER (1998) Diseases of tree legumes. In: Gutteridge RC, Max Shelton H (ed.) Forage tree legumes in tropical agriculture. The tropical grassland society of Australia. Inc. St Lucia Queensland, Australia Fernando KMEP (2008) The host preference of a Ganoderma lucidum species of Fabaceae family; Cassia nodosa, Cassia ﬁstula and Delonix regia. J Natl Sci Found Sri Lanka 36:323–326 Schuch UK, Kelly JJ (2007) Mesquite trees for the urban landscape, Bulletin of the Desert Legume Program of the Boyce Thompson Southwestern Arboretum, vol 19, no 2, Nov 2007. The University of Arizona, Tucson Raj Bhansali R (2008) Butt rots of Prosopis cineraria. In: Narain P, Kar A, Kathju S, Kumar P (eds.) Diversiﬁcation of arid farming systems. Arid Zone Research Association of India and Scientiﬁc Publishers (India), Jodhpur Karthikeyan M, Radhika K, Bhaskaran R, Mathiyazhagan S, Samiyappan R, Velazhahan R (2006) Rapid detection of Ganoderma disease of coconut and assessment of inhibition effect of various control measures by immunoassay and PCR. Plant Protect Sci 42:49–57 Mohammed CL, Barry KM, Irianto RSB (2006). Heart rot and root rot in Acacia mangium: identiﬁcation and assessment. In: Potter K, Rimbawanto A, Beadle C (eds.) Heart rot and root rot in tropical Acacia plantations. Proceedings of the workshop Yogyakarta, Indonesia. Australian centre for international agricultural research, Canberra Australian centre for international agricultural research, Canberra, pp 26–33 Adaskaveg JE, Gilbertson RL (1986) Cultural studies and genetics of sexuality of Ganoderma lucidum and G. tsugae in relation to the taxonomy of the G. lucidum complex. Mycologia 78:694–705 Blanchette RA, Obst JR, Hedges JI, Weliky K (1988) Resistance of hardwood vessels to degradation by White rot Basidiomycetes. Can J Bot 66:1841–1847 Zabel RA, Morrel JJ (1992) Wood microbiology: decay and its prevention. Academic, New York Eaton RA, Hale MDC (1993) Wood: decay, pests and protection. Chapman and Hall, London Blanchette RA (1995) Degradation of the lignocellulose complex in wood. Can J Bot 73:999–1010 Arora D (1986) Mushrooms demystiﬁed: a comprehensive guide to the ﬂeshy fungi. Ten Speed Press, Berkeley/Toronto, p 959 Gilbertson RL, Ryvarden L (1986) North American polypores. Fungiﬂora, Oslo Moncalvo JM (2000) Systematics of Ganoderma. In: Flood J, Bridge PD, Holderness M (eds.) Ganoderma diseases of perennial crops. CABI Publishing, London Donk MA (1964) Conspectus of the families of Aphyllophoralles. Persoonia 3:199–234 Furtado JS (1962) Structure of spores of Ganodermataceae Donk. Rickia I:227–242 Pegler DN, Young TWK (1973) Basidiospore form in British species Ganoderma Karst. Kew Bull 28:351–370 Steyaert RL (1980) Study of some Ganoderma species. Bull Jard Bot Natl Belg 50:135–186 Wakeﬁeld EM (1920) Diseases of oil palm in West Africa. Kew Bull 1920:306–308

238

R. Raj Bhansali

57. Turner PD (1981) Oil palm diseases and disorders. Oxford University Press, Oxford 58. Adaskaveg JE, Gilbertson RL (1988) Basidiospores, Pilocystidia, and other basidiocarp characters in several species of the Ganoderma lucidum Complex. Mycologia 80:493–507 59. Gilbertson RL, Goldstein D, Lindsey JP (1979) Additions to the check list and host index for Arizona wood-rotting fungi. J Arizona Nevada Acad Sci 14:1–87 60. Al Bahry S, Elshaﬁe AE, Deadman M (2004) First report of Ganoderma colossus on Delonix regia in Oman. New Dis Rep 9, Feb–July 2004. (www.bspp.org.uk/ndr) 61. Elshaﬁe A, Al Bahri S, Al Saadi A, Al Raeesi A, Al Maqbali Y, Deadman M (2004) First report of Ganoderma colossus on Ficus altissima in Oman. New Dis Rep 9, Feb–July 2004. (www.bspp.org.uk/ndr) 62. McCracken FI (1978) Spore release by some decay fungi of southern hardwoods. Can J Bot 56:426–431 63. Agrios NA (1988) Plant pathology, 3rd edn. Academic, USA 64. Baker KF (1987) Evolving concepts of biological control of plant pathogens. Annu Rev Phytopathol 25:67–85 65. Cook RJ (1993) Making greater use of microbial inoculants in agriculture. Annu Rev Phytopathol 31:53–80 66. Benhamou N (2004) Potential of the mycoparasite, Verticillium lecanii, to protect citrus fruitagainst Penicillium digitatum, the causal agent of green mold: a comparison with-the effect of chitosan. Phytopathology 94:693–705 67. Islam MT, Yasuyuki H, Abhinandan D, Toshiaki I, Satoshi T (2005) Suppression of dampingoff-disease in host plants by the rhizoplane bacterium Lysobacter sp. strain SB-K88 is-linked to plant colonization and antibiosis against soilborne peronosporomycetes. Appl Environ Microbiol 71:3786–3796 68. Kloepper JW, Ryu CM, Zhang S (2004) Induce systemic resistance and promotion of plant growth by Bacillus spp. Phytopathology 94:1259–1266 69. Idris AS, Arifurrahman, Kushairi A (2010) Hexaconale as preventive treatment for management Ganoderma in oil palm, MPOB Information Series TS No. 75. Malaysian Palm Oil Board (MPOB). Malaysia, Bangi, pp 1–2 70. Dev N, Dawande AY (2010) Biocontrol of soil borne plant pathogen Rhiozoctonia solani using Trichoderma spp. and Pseudomonas ﬂuorescens. Asia J Biotech Res 1:39–44 71. Ahmed SI, Srivastvi KK, Kumar S, Khan UA, Verma N (2001) An approach to study the cause of large scale mortality of Prosopis cineraria (L) Druce (Khejari) in western Rajasthan. In: Mortality of Prosopis cineraria Khejari- A study on responsible causes. CAZRI, Jodhpur 72. Toole ER (1960) Butt rot of southern hardwoods. Forest Pest Leaﬂet 43. US Government Printing Ofﬁce, Washington DC 73. Durand-Gasselin T, Asmady H, Flori A, Jacquemard JC, Hayun Z, Breton F, de Franqueville H (2005) Possible sources of genetic resistance in oil palm (Elaeis guineensis Jacq.) to basal stem rot caused by Ganoderma boninense – prospects for future breeding. Mycopathologia 159:93–100 74. Harman GE (2006) Overview of mechanisms and uses of Trichodermaspp. Phytopathology 96:190–194 75. Soepena H, Purba RY (1998) Biological control strategy for basal rots on oil palm. In: International workshop on Ganoderma diseases perennial crops. MARDI Training Centre, Serdang Selangor 76. Soepena H, Purba RY, Pawirosukarto S (2000) A control strategy for basal stem rot of oil palm. In: Flood J, Bridge PD, Holderness M (eds.) Ganoderma diseases of perennial crops. CABI Publishing, UK 77. Raj Bhansali R (2010) Rejuvenation of Ganoderma affected Khejri trees through biocontrol agents (BCAs). “Success Story” Div III CAZRI, Jodhpur 78. Verma M, Brar SK, Tyagi RD, Surampalli RY, Valéroa JR (2007) Antagonistic fungi, Trichoderma spp Panoply of biological control. Biochem Eng J 37:1–20 79. Rifai MA (1969) A revision of the genus Trichoderma. Mycol Pap 116:1–56

9

Ganoderma Diseases of Woody Plants of Indian Arid Zone…

239

80. Druzhinina IS, Kubcek CP (2005) Species concepts and biodiversity in Trichoderma and Hypocrea: from aggregate species to species clusters? J Zhejiang Univ Sci 6:100–112 81. Druzhinina IS, Kopchinskiy AG, Kubicek CP (2006) The ﬁrst 100 Trichoderma species characterized by molecular data. Mycoscience 47:55–64 82. Samuels GJ (2006) Trichoderma: systematics, the sexual state, and ecology. Phytopathology 96:195–206 83. Mohiddin FA, Khan MR, Khan SM, Bhat BH (2010) Why Trichoderma is considered super hero (super fungus) against the evil parasites? Plant Pathol J 9:92–102 84. Chet I (1987) Trichoderma applications, mode of action and potential as a biocontrol agent of soilborne plant pathogenic fungi. In: Chet I (ed.) Innovative approaches to plant disease control. Wiley, New York 85. Chet I (1990) Mycoparasitism – recognition, physiology and ecology. In: Baker RR, Dunn PE (eds.) New directions in biological control: alternatives for suppressing agricultural pests and diseases. Alan R Liss, New York 86. Chet I, Benhamou N, Haran S (1998) Mycoparasitism and lytic enzymes. In: Harman GE, Kubicek CP (eds.) Trichoderma and Gliocladium, vol 2, Enzymes, biological control, and commercial applications. Taylor & Francis, London 87. Joshi R, Gardener BBM (2006) Identiﬁcation and characterization of novel genetic markers associated with biological control activities in Bacillus subtilis. Phytopathology 96:145–154

sdfsdf

Chapter 10

Plant Defence Against Heavy Metal Stress N.C. Aery

Abstract Heavy metals include both essential as well as nonessential elements. The excess concentration of heavy metals in the soil may be due to natural mineralization or due to anthropogenic factors. Certain plants are capable to develop tolerance and colonize the metalliferous soils. Certain plants partially exclude the metals from their system, others show complete exclusion, and still others show operation of absorption barriers whereas there are others which accumulate them. Some plant species- the hyperaccumulators, have the ability to accumulate large amounts of elements in their tissues without showing any symptoms of toxicity. All hyperaccumulator plant species are endemic to metalliferous soils indicating hyperaccumulation to be an adaptation towards heavy metal stress which probably has evolved as a defense mechanism against herbivores or pathogens. Plants may adopt different defense strategies to detoxify the excessive concentration of heavy metals occurring in their surroundings. The detoxiﬁcation may result at cell wall, cell membrane or protoplasm level. Plants may transport the metals to various compartments, especially to apparent free spaces, intercellular or intracellular vacuoles and bodies like lysosomes to sequester the metals. Plants may achieve metal tolerance by protecting the integrity of plasma membrane, by the use of heat shock proteins or metallothioneins and by chelating heavy metals. It appears that there is no single mechanism that can account for tolerance to a wide range of heavy metals and probably more than one mechanism may be responsible for detoxiﬁcation of a particular metal. How plants defend themselves to toxic heavy metals is discussed in the present review.

N.C. Aery (*) Department of Botany, Mohanlal Sukhadia University, Udaipur 313002, Rajasthan, India e-mail: [email protected]

J.M. Mérillon and K.G. Ramawat (eds.), Plant Defence: Biological Control, Progress in Biological Control 12, DOI 10.1007/978-94-007-1933-0_10, © Springer Science+Business Media B.V. 2012

241

242

N.C. Aery

Keywords (EAVY METALS s (YPERACCUMULATION s $ETOXIlCATION s 4OLERANCE s0HYTOCHELATINSs-ETALLOTHIONEINS

10.1

Introduction

Stress has been deﬁned as any environmental factor which is able to induce an injury or an injurious strain in the organism [1]. Under stress the organism may show a change in its physiology, biochemistry or in case the stress is very severe it may lead to permanent injury or even death. The changes occurring in the organism due to stress may be reversible or irreversible depending upon the severity of stress. A number of stress factors affect the plants. These include drought, ﬂooding, high salinity, hypoxia, extremes of temperature, deﬁciency of nutrients, increased radiations (visible, UV and ionizing) and heavy metals. Heavy metals are present in the environment as a natural component or due to anthropogenic activities. Human activities such as electroplating, metal smelting, intensive agriculture, mining, ore beneﬁciation and production of mine tailings, waste dumping and many other activities contaminate our soils and water bodies. At many places the concentration of heavy metals far exceeds the safer regulatory limits. For the revegetation of contaminated metal-rich areas such as tailing dams resistant plants are required which may help in phytostabilization and/or cleaning up of substratum. But before undertaking any such task one should be aware of the basic principles of heavy metal stress, their absorption, accumulation, toxicity, tolerance and detoxiﬁcation.

10.1.1

Heavy Metals

The term heavy metal has been very vaguely used in the literature and rather ill-deﬁned [2]. Generally heavy metals are deﬁned as metals with density greater than 5 gm cm−3 and/or an atomic weight above 20. Sixty-nine elements are covered under this deﬁnition. However, different workers have deﬁned the term heavy metal differently. Whereas Anon [3] considers metals with speciﬁc gravity above four as heavy metals, Lapedes [4] includes element with speciﬁc gravity ﬁve or higher under heavy metals. Venugopal and Luckey [5] consider any metal beyond calcium as heavy metals. Due to vast difference in the chemical properties, biological activities and effects of different heavy metals, Woolhouse [6] suggested that the term should be abandoned. Niebour and Richardson [7] have given biologically relevant but complex classiﬁcation of metals based on their ligand forming properties and avoid the use of the term heavy metal. These are Class A elements with afﬁnity for O- containing ligands; Class B elements

10

Plant Defence Against Heavy Metal Stress

243

with afﬁnity for N- or S- containing ligands and the Borderline elements i.e. intermediate between the two having afﬁnity for all the three groups with different preferences.

10.1.2

Essential vis-à-vis Non Essential Heavy Metals

Out of the 69 elements considered to be heavy metals many have been found to be essential to the plants and animals. Following criteria have been given to establish the essentiality of an element for an organism.

10.1.2.1

According to Arnon and Stout [8] a Mineral Element can be Considered Essential if it Fulﬁlls Following Three Criteria

(i) The plant must be unable to complete its life cycle in the absence of the mineral element. (ii) The function of the element must not be replaced by another mineral element. (iii) The element must be directly involved in plant metabolism. However, it is still difﬁcult to generalize the essentiality of a particular element to lower as well as higher plant groups.

10.1.2.2

Coefﬁcient of Variation Ratio

It has been suggested that the concentration range of essential elements is less than the non-essential elements. It is probably due to the operation of some sort of regulatory mechanism which helps to keep the amount of essential element constant in plants. The use of Coefﬁcient of Variation (CV) values to interpret essentiality of a particular element has been suggested [9]. According to this the ratio of the plant and soil values for CV should be used for this purpose. A CV ratio more than 0.60 indicates non essential element whereas a CV ratio of less than 0.60 stands for essential element.

10.1.2.3

Normal Versus Log-Normal Distribution

Concentration of most of the elements is considered to be log-normally distributed in different rock types [10]. Liebscher and Smith [11] found that whereas essential elements are normally distributed the non essential elements have log-normal distribution. Contrary to the above, Aery [12] observed that the distribution of Zn and Cu, the essential elements, in soils as well as plants of Zawar Zinc deposits, India is log- normally distributed.

244

10.2

N.C. Aery

Uptake and Accumulation of Heavy Metals

Plants have the capability to absorb each and every mineral element whether it is essential or non essential for their growth. The concentration of a particular element in the plant body depends upon the type of the element, its concentration in the soil and the inherent quality of the plant to absorb that particular element.

10.2.1

Uptake Mechanism

Metals are taken by plants from soil and sediment as well as from air and water. This depends upon their growth environment. Some plants release metals back into water and soil or to the air in gaseous form through their leaves. Metals are present in the soil as components of several different fractions: These are: free metal ions and soluble metal complexes in the soil solution; metal ions occupying ion exchangeable sites and speciﬁcally adsorbed on inorganic soil constituents; organically bound metals; precipitated or insoluble compounds particularly of oxides, carbonates and hydroxides; and metals in the structure of silicate minerals. Only free metal ions and soluble metal complexes in the soil solution and, possibly some components of metal ions occupying ion exchangeable sites and speciﬁcally adsorbed on inorganic soil constituents are readily available to plants. The availability of metal ions can be increased by populating the rhizosphere with selected microorganisms such as strains of Pseudomonas and Bacillus; by adding chelating agents and by the use of soil acidiﬁers and/or ammonium containing fertilizers. The uptake of mineral elements by roots depends on: diffusion of metals into the root along the concentration gradient; mass ﬂow, transport in bulk along the water potential and active transport. In some plants certain metals are taken up mainly by the apical region of the root where as in others they are taken up over the entire root surface. The uptake primarily depends on the uptake capacity and the growth characteristics of the root system. Initially the metals are taken into the apoplast of the root. Some of it is transported further in the apoplast whereas some become bound to the cell wall. How much of the metals will be transported and how much will become bound to the cell wall varies with the plant and the metal [13]. The movement of metals from the soil solution into the cell wall is a passive process. The positively charged metal ions are attracted towards the negatively charged carboxylic groups of the cell wall. The concentration of positively charged ions depends on the CEC of the cell wall which is generally higher in dicots than monocots. However, this assumption is not completely true and depends on the plant species and metal concerned [14]. A part of metal ions is further transported from the apoplast into the cytoplasm through plasma membrane. Most of the metal ions are taken up in the cationic form except molybdenum and boron which are taken up as molybdate and borate ions.

10

Plant Defence Against Heavy Metal Stress

245

The uptake of elements may be passive, metabolic or partially metabolic and partially passive. It has been shown for cadmium [15] that 30% of cadmium is taken up passively whereas rest is taken up actively coupled to H+ATPase. Certain plants secrete metal chelating nonproteinogenic amino acids called phytosiderophores into the rhizosphere to chelate and stabilize soil bound metals. For example, mugineic acid and avenic acid serve as phytosiderophores of graminaceous plant species. These phytosiderophores are released in response to Fe and Zn deﬁciency and can mobilize Cu, Zn and Mn from soil [16]. Their release is rapidly depressed by resupply of iron. For the biosynthesis of phytosiderophores, methionine is the common precursor and nicotianamine an intermediate [17]. This pathway is under strict genetic control and the chromosomes have already been identiﬁed which are responsible for the regulation [18]. Metal- chelating proteins, perhaps related to metallothioneins [19] or phytochelatins [20] may also function as siderophores in plants. The total metal content of the soil is not fully available to the plants. A number of factors affect metal uptake in the ﬁeld conditions. These include, kind of metal, type of plant, root depth, pH, health of plant, drainage, availability of the element, antagonism of other elements, oxygen concentration and redox potentials in soil, calcium status, presence of organic matter, rainfall, clay fractions and soil temperature [14].

10.2.2

Accumulation

The accumulation by plants of a wide range of elements has been known for over 200 years and nearly all elements have been determined in vegetation. Certain elements are preferentially accumulated by the plants and this is known as “Goldschmidt enrichment principle” [21]. Certain elements are absorbed by the plants irrespective of their need in the plant biosystem- the so called “luxury consumption”. The ratio of concentration of the element in the plant and soil is known as Biological Absorption Coefﬁcient (BAC). Very high BAC values have been observed for the plants growing over mineral deposits as well as mine dumps [22–24]. Heavy metal uptake, accumulation and tolerance were investigated in ﬁve British populations of the metallophyte Thlaspi caerulescens from metalliferous sites from north and south Pennines oreﬁelds [25]. In Europe, taxa have been reported which are more or less restricted to calamine (enriched with zinc, lead and often cadmium) and serpentine soils (enriched with nickel, chromium and sometimes cobalt) [26].

10.2.3

Accumulators vis-a-vis Excluders

Baker [27] recognised three types of plant soil relationships (Fig. 10.1) as under: 1. Accumulators: In these species, the metals are concentrated in the above ground plant parts from low as well as high soil metal levels.

246

N.C. Aery

Fig. 10.1 Plant soil relationships (After Baker [27])

2. Indicators: In these, the uptake and transport of metals to the shoot are regulated so that internal concentrations reﬂect external soil levels. A linear accumulation for zinc, lead, cadmium and copper in plants of Zawar zinc and Khetri copper deposits (India) have been observed [22, 23, 28, 29]. In most of the studies plant metal content showed a linear dependence on soil metal contents (Fig. 10.2). 3. Excluders: In these the metal concentrations in the shoot are maintained at a constant low level up to a certain threshold in the soil above which the mechanism breaks down and unrestricted uptake and transport to the shoot take place. Berry [30] suggested three basic strategies of response to heavy metals. These are: (a) avoidance- metal uptake is limited; (b) detoxiﬁcation- metals are detoxiﬁed either by subcellular compartmentation or by binding and (c) biochemical tolerance- specialized metabolic pathways and enzymatic adaptations may occur. Each of the above affects tissue metal concentration in different ways. Closely related species and even sympatric species have evolved quite different and contrasting mechanism of accumulation and exclusion [31]. Aery and Tiagi [22] observed that in spite of the non-essentiality of lead in the plant system and its commonly low average plant soil coefﬁcient (0.6), the concentration of lead in plants growing over mineralized zones in the Zawar Mines, India was anomalously high. Its accumulation may be due to any of the following reasons: (1) Very high concentration in the soil and/or (2) lack of mechanism to restrict its absorption at least in the plants of the study area or (3) if at all any exclusion mechanism exists in these plants, it breaks down at very low soil lead concentrations.

10.2.4

Ecological Signiﬁcance of Metal Accumulation

The excess concentration of heavy metals in the soil may be due to natural mineralization or due to anthropogenic factors. The plant groups in such soils adapt themselves to the harsh environment and vegetation tolerant to such environment may develop there. The vegetation developed on naturally mineralized soils has been

10

Plant Defence Against Heavy Metal Stress

247

Fig. 10.2 Concentration of cadmium in leaf ash expressed as a function of the concentration in the soil (After [23])

called as ‘original heavy metal vegetation’ [32] and that developed on heavy metal polluted soils as called as “anthropogenic metal vegetation” [33]. Metalliferous soils may have less number of plant species compared to their surroundings and can be compared with very small islands surrounded by an ocean of nonmetalliferous soils [34]. The plant species growing on such soils have to face extremes of environmental factors.

10.2.5

Evolution of Metal Resistance in Taxa Occurring on Metal-Rich Soils

Only those species which have the capability to evolve tolerance can colonize metalliferous soils. Euryminerotrophic species i.e. species occurring within a wide

248

N.C. Aery

range of mineral soils and having substantial amount of genetic variability within a species are more successful in establishing in mineralized soils. Only a slightly different requirement of a particular nutrient may be enough for selection and population differentiation e.g. ecotypes of Silene cucubalus [32]. The plant community on a metal rich soil varies on a regional scale due to the differential ability of various species to evolve metal tolerance [35]. The evolution for metal tolerance may be for one, two or multiple metals. Generally metalliferous sites act as refuge for relict species [36].

10.2.6

Plant Communities on Metal-Rich Soils

Several other workers have also studied plant communities growing on metal rich soils and these have practically been used in geobotanical exploration of different metals (Table 10.1). Phytosociological techniques of Braun-Blanquet [45] are used for studying the plant communities over metal rich soils. The method involves studying the composition of the plant community and identifying the most characteristic species of metal rich soils [46, 47].

10.2.7

Classiﬁcation

Two types of indicator plants, namely, ‘Universal’ and ‘Local’ have been identiﬁed [48]. The Universal indicators are those species which require a particular concentration of an element in the soil for healthy growth and fail to grow in soils containing lesser amount than the threshold whereas local indicators are species

Table 10.1 Examples of plant communities actually used in geobotanical exploration in various countries Dominant plant species Element Country of the community References Co Zaire Crotalaria cobalticola, Silene [37] cobalticola Co, Cu Zaire Haumaniastrum robertii, H. [38] katangense [39, 40] Ecbolium lugardae, Albizzia sp., Cu Botswana, Papua-New Helichrysum leptolepis, Celosia Guinea, South West trigyna, Becium homblei Africa, Zimbabwe Cu, Pb, Zn Australia Polycarpaea glabra, Eriachne [41] mucronata Pb, Zn Australia Polycarpaea synandra var. gracilis, [42] Tephrosia sp. Se, U United States Astragalus preussi [43] Ni Australia Hybanthus ﬂoribundus [44]

10

Plant Defence Against Heavy Metal Stress

249

Fig. 10.3 Distribution of Impatiens balsamina on the old mine workings at Zawar Mines

adapted to tolerate mineral rich ground but at places can grow equally well, provided that competition from other species is not too severe [49]. Duvigneaud and Denaeyer-de-Smet [50] and Lambinon and Auquier [51] have given classiﬁcation of indicator plants. Vegetation growing on metalliferous soils of Zawar group of mines, India have revealed that certain plant species in this area are restricted in their distribution to particular community of the metalliferous soils. From the standpoint of constancy and ﬁdelity these species have been considered as ‘Characteristic Species’ of the community and the community has been named as Impatiens balsamina – Triumfetta pentandra association (Fig. 10.3). The most characteristic plant species of the Zawar zinc bearing belt have been classiﬁed among the existing geobotanical classiﬁcations (Table 10.2) [46]. The characteristic species also showed higher concentration of Zn, Pb and Cd in the ash of their various organs. During studies made on certain uranium deposits of Rajasthan Cassia tora, Cassia auriculata, Diospyros cordifolia, Holoptelea integrifolia, Kirganelia reticulata, Lindenbergia muraria and Wrightia tinctoria registered highest constancy and ﬁdelity values on uranium rich soils in comparison to the surrounding background sites [52].

10.2.8

Neo Endemics vis-à-vis Palaeoendemics

Whether the metal tolerant plants are palaeo-endemics or neo-endemics has remained a matter of discussion. Palaeo-endemics are plant species which had widespread distribution earlier but due to competition or climate change now have narrowed their range of distribution to edaphically hostile environment.

250

N.C. Aery

Table 10.2 Geobotanical classiﬁcation of most characteristic plant species of Zawar Mines and Rajpura-Dariba Mines, India (After [46]) Duvigneaud and Denaeyer Braun-Blanquet Malyuga Lambinon and de-Smet [50] [45] S. No. Name of the plant [48] Auquier [51] Zawar Mines 1. Impatiens Local Local Local Exclusive balsamina indicator metallophyte metallophyte 2. Acanthospermum – Elective pseudo- Metallo-resistant Selective hispidum . metallophyte 3. Hemigraphis – -do-do-dolatebrosa . 4. Melhania – -do-do-dofutteyporensis. 5. Triumfetta – -do-do-dopentandra . 6. Celosia argentea. – -do-doPreferential 7. Dyerophytum – -do-do-doindicum 8. Grewia – -do-do-doﬂavescens. 9. Lepidagathis – -do-do-dotrinervis 10. Lindenbergia – -do-do-domuraria

Neo endemics are newly evolved species in the specialized environment and are the relatives of widely distributed plant species distributed in the surrounding areas. The distribution of Thlaspi rotundifolium subsp. cepaeifolium (Wulf.) Rouy et Fouc. and Alyssum wulfenianum Bernh. support the hypothesis that metal tolerant plants are neo-endemic species [26]. Alternatively the metallophytes may simply be considered as transport endemics indicating the efﬁciency of anthropochory [53].

10.2.9

Exclusion of Metals

Certain plants are able to maintain the metal level at a constant level in their body parts up to a certain threshold in the soil. However, beyond the threshold level the exclusion mechanism breaks down and the unrestricted accumulation take place [41].

10.2.10

Absorption Barriers

Rhus mysorensis and Talinum portulacifolium show the operation of absorption barriers. Tiagi and Aery [29] observed that when the copper concentration is low in the substrate both the plant species showed a highly positive correlation between plant

Plant Defence Against Heavy Metal Stress Concentration of copper (Mg/g) in plant ash

10

251

2HUSMYSORENSIS

5000 4000 3000

2000

1000 800 1000

2000 3000 5000 Concentration of copper (Mg/g) in soil

10000

Fig. 10.4 Rhus mysorensis showing indicator behavior at low soil copper and absorption barriers at higher soil copper concentrations (After [29])

and soil copper. With the further increase in the soil copper concentration, a decrease in the plant copper concentration occur and showed a signiﬁcant negative correlation pattern. It seems that plants can accumulate copper up to a threshold limit beyond which a gradual decrease in the copper concentration occur with further increase in the soil copper level (Fig. 10.4). Thus the plant exhibit ‘indicator’ behavior [27] at low soil concentration and exclusion of copper or absorption barriers at high soil copper levels [29].

10.2.11

Partial Exclusion

Brooks [49] have shown the operation of partial exclusion of elements by plants. When plant/soil ratio (Biological Absorption Coefﬁcient, BAC) for copper and zinc is plotted against the concentration of element in the soil i.e. BAC versus elemental levels in the soil an asymptotic curve is produced. Timperley et al. [9] observed in Quintinia acutifolia that the BAC for copper was very high at low soil copper levels. In other words the BAC decreased as elemental concentration in the soil increased showing a partial exclusion of the element in the plant (Fig. 10.5)

10.2.12

Hyperaccumulation of Heavy Metals

Some plant species have the ability to accumulate large amounts of elements in their tissues without showing any symptoms of toxicity. These plants have been called as hyperaccumulators [54]. For some elements such as nickel, cobalt and copper a

252

N.C. Aery

Fig. 10.5 Quintinia acutifolia showing biological absorption coefﬁcient for copper expressed as a function of copper concentration in the soil (After [9])

concentration threshold of 1,000 Pg g−1 in dried material has been considered to represent hyperaccumulation. In case of zinc, a concentration threshold of 10,000 Pg g−1 in dried material has been considered as appropriate [26]. Jaffre [55] has further elaborated the terminology by using hypermanganesophores and hypernickeleophores for plants containing more than 10,000 Pg g−1 Mn and Ni, respectively. As the concentration thresholds for hyperaccumulators have arbitrary physiological basis, Peterson [56] has not preferred to use this terminology. According to Meharg [57] a working deﬁnition of hyperaccumulation should be that the shoot metal level needs to exceed soil metal level. Well over 400 hyperaccumulators have been reported throughout the world, covering many different families of ﬂowering plants [58]. All hyperaccumulator plant species are endemic to metalliferous soils which indicate hyperaccumulation to be an adaptation towards heavy metal stress [59]. The question why and how plants hyperaccumulate is yet to be answered. Little is known about the biological and evolutionary signiﬁcance of hyperaccumulation of heavy metals. Several hypotheses have been proposed to explain the evolution of hyperaccumulation in plants such as luxury consumption, xerophytic adaptation, drought resistance, disposal of metals and plant’s defense mechanism against pathogen or herbivores. Most probably hyperaccumulation has evolved as a defense mechanism against herbivores or pathogens [60, 61]. However, Baker et al. [62] failed to detect any reduced herbivory in nickel hyperaccumulators over ultramaﬁc rocks in Philippines. Similarly Huitson and Macnair [63] observed that zinc did not deter insect herbivores. Hyperaccumulator dominating plant families are Asteraceae, Brassicaceae, Caryophyllaceae, Cyperaceae, Fabaceae, Flacourtiaceae, Lamiaceae, Poaceae, Violaceae and Euphorbiaceae. It is interesting to note that more than 70% of the nickel hyperaccumulators belong to the subclass Dilleniideae of Magnoliophyta and about 26% of these belong to families Flacourtiaceae and Violaceae (order Violales) [64]. The largest number of hyperaccumulators in the temperate zone belongs to the family Brassicaceae and to family Euphorbiaceae in the tropical zone. Alessio et al. [65] have described bacteria associated with serpentine plants. A short list of hyperaccumulators is given in Table 10.3.

10

Plant Defence Against Heavy Metal Stress

253

Table 10.3 Hyperaccumulators of certain elements Element concentration Plant (%) D.W. Basis References Haumaniastrum robertii 1.02 [66] Ipomoea alpina 1.23 [67] Pearsonia metallifera 0.77 [68] Macadamia neurophylla 5.18 [69] Alyssum masmenaeum 2.43 [70] Psychotria douarrei 4.75 [70] Sebertia acuminata 11.0 [70] Pb Thlaspi rotundifolium 0.79 [26] s.sp. cepaeifolium Zn Thlaspi calaminare 4.00 [26] A complete list of hyperaccumulators is available at http://en.wikipedia.org/wiki/Phytoremediation,_Hyperaccumulators; http://en.wikipedia.org/wiki/Hyperaccumulators_table_%E2%80%93_2_:_Nickel and http://en.wikipedia.org/wiki/Hyperaccumulators_table_%E2%80%93_3 Element Co Cu Cr Mn Ni

10.2.13

Hyperaccumulation vis a vis Metal Resistance

Studies have shown that heavy metal resistance and hyperaccumulation may be independent characters [71]. It has been found that populations from non-metal-enriched populations hyperaccumulate more zinc but had lower resistance than populations from metal-enriched soils [72]. Macnair et al. [71] concluded that resistance to zinc was controlled by a single gene whereas hyperaccumulation of zinc was under the regulation of small number of genes. Genetic studies [73] carried out on Arabidopsis halleri x A. lyrita have revealed that cadmium resistance and hyperaccumulation are independent characters. Further, cadmium and zinc may show co-resistance and hyperaccumulation. It may be due to the reason that cadmium and zinc ions are chemically similar in respect to metal transporters or enzymes [57]. Macnair et al. [71] have postulated that metal resistance in plants must have evolved before the evolution of hyperaccumulation. Krämer [74] has reviewed the physiological, molecular, and genetic basis underlying metal hyperaccumulation and its evolution.

10.2.14

Uses of Hyperaccumulators

Hyperaccumulators are exclusively conﬁned to metal rich areas. Therefore, they may be good indicators of mineralization and can be used in metal prospecting. For example, Haumaniastrum and Becium have been used for prospecting of copper as these are always present on soils containing more than 0.01% of copper. Similarly nickel hyperaccumulators have been used to delimit the boundaries of ultramaﬁc

254

N.C. Aery

rocks [62]. They can certainly be used for exploring newer deposits. A new era in biogeochemical prospecting has come up and that is by analyzing herbarium specimens and this has pin pointed a number of hyperaccumulators. Hyperaccumulators can be used for the phytoextraction of soil metals which may provide an economic method for metal extraction– Phytomining, an emerging technology. Chaney et al. [75] has obtained a patent for extracting nickel, cobalt, and other metals, including the platinum and palladium, from soil by cultivation of the soil with hyperaccumulating plants that concentrate these metals in above-ground portions of the plants. The plants are harvested, dried, and burnt to recover the metal. Plants of family Brassicaceae mainly species of genus Alyssum including A. murale, A. pintodasilvae, A. malacitanum, A. lesbiacum, A. tenium, and A. fallacinum have been used. The same plants may also accumulate Pd, Rh, Ru, Pt, Ir, Os, and Re. Prasad et al. [76] have discussed about the phytoavailability and phytomining of uranium. In New Zealand efforts are being made for the phytoextraction of gold and mercury. Thio-ligands can induce the solubility and uptake of gold from waste and low-grade rock. Hyperaccumulators can also be used for the phytoremediation of contaminated soils and waters. Use of roots of rapidly growing high biomass yielding plant species (capable of accumulating metals in their roots) is being made for the removal of heavy metals from water [77] in a process known as rhizoﬁltration. Aquatic plants are chosen to absorb particular nutrient and to remove pathogens, metals and other contaminants from wastewater. Certain plants such as water lily, Echhornia crassipes, Hydrocotyle umbellata, Lemna minor, Azolla pinnata and sunﬂower [59] have been used for the removal of heavy metals and radionuclides from the efﬂuents. The method has a number of advantages such as minimal cost, its applicability for variety of elements, the plant residue is recyclable and has almost no environmental disturbance [78]. But agronomic practices need to be optimized.

10.3

Defense Mechanisms of Heavy Metal Tolerance and Detoxiﬁcation

Higher concentrations of essential (such as Cu and Zn) as well as nonessential heavy metals in the substratum result in toxicity and growth inhibition. Excess of heavy metals may also stimulate the formation of reactive oxygen species vis-a–vis oxidative stress [79]. Plants may adopt different means to detoxify the excessive concentration of heavy metals occurring in their surroundings. Azmat et al. [80] have indicated that variations in leaf anatomy and morphology reﬂect their adaptability to environmental stress. They have observed a self defense mechanism system for the detoxiﬁcation of lead in the leaves of Phaseolus mungo and Lens culinaris. Lead induced changes in the leaf epidermis such as a reduction in the cell size, more abundant wax coating, increase in the number of stomata and trichomes per unit area and reduction in the size of guard cells [81]. The increase in trichome and number of stomata

10

Plant Defence Against Heavy Metal Stress

255

in the upper leaf surface in both the above mentioned plant species seems to form an adaptive morphological mechanism for survival under stress [80]. Becium homblei, a copper plant sheds off its leaves in a season to get rid off the excessive concentration of copper it has absorbed. This seems to be an adaptive mechanism to maintain the copper levels in the plant body [82]. B. homblei accumulates copper in its deciduous aerial parts. At the end of the growing season, the leaves become chlorotic and shed off and the plant is freed from the bulk of its accumulated copper. At the beginning of the new growth season the plant is ready to develop new leaves and produce ﬂowers and seeds, before it is again affected by copper. The plants growing on metal rich soils evolve tolerance to survive there. According to Wainright and Woolhouse [83] following points should be taken into consideration while considering tolerance mechanism: 1. Metal tolerance is speciﬁc. 2. Different degrees of tolerance can be recognized within a population of a given species [84]. 3. Metal tolerance is inherited [85]. There are two basic strategies of metal tolerance. These are metal exclusion or avoidance i.e. metal uptake and transport is restricted and metal tolerance at cellular level in which metals are uninterruptedly accumulated in a detoxiﬁed form. The detoxiﬁcation may result at cell wall, cell membrane or protoplasm level.

10.3.1

Heavy Metal Tolerance by Avoidance

This has already been discussed under the heading metal accumulation where by plants either exclude the metal partially [9, 41] or by the operation of absorption barriers [29] or restrict transport from root to shoot. In this context it will be relevant to discuss the role of mycorrhiza. It has been observed that the mycorrhizal fungus Paxillus involutus retained Zn which led to a reduction in the Zn content of Pinus sylvestris [86]. However, considerable species and metal speciﬁcity and lot of difference in response to different metals have been observed [87]. The mechanism involved includes absorption of metal by the hyphal sheath, chelation by fungal secretions, adsorption by mycorrhiza etc. [88]. These different mechanisms operate between different plant-fungal interactions.

10.3.2

Compartmentalization

This is another adaptive mechanism of plants to combat the metal toxicity. Plants may transport the metals to various compartments, especially to apparent free spaces, intercellular or intracellular vacuoles and other such bodies like lysosomes to sequester the metals [89]. This has been proved in case of zinc tolerance, in

256

N.C. Aery

Silene cucubalus, Rumex acetosa, Thlaspi alpestre and Agrostis tenuis where zinc–malate pathway has been shown to transport zinc towards vacuoles [90]. Root meristematic cells in case of Festuca rubra show increased vacuolation on treatment with zinc [91]. Further, an analysis of transport system at the tonoplast provided evidences in favour of vacuolar mechanism of transport [92]. Tonoplast vesicles from roots of Zn-sensitive and Zn-tolerant ecotypes of Silene vulgaris were isolated and shown that at high Zn concentration zinc transport was 2.5 times higher into vesicles from the tolerant lines than from the Zn-sensitive lines. This indicates that the tonoplast has a role in naturally selected Zn-tolerance. Further, the increased tonoplast uptake has been shown to correlate genetically with Zn-tolerance [93]. Probably zinc transporters are responsible for sequestration of zinc in the vacuole vis a vis zinc tolerance in plants [88]. All these suggest compartmentalization to be another homeostatic means of metal detoxiﬁcation in plants.

10.3.3

Role of Cell Wall

Plants have to keep the metal concentration in their cells at a nontoxic level and try to exclude them from susceptible sites in the protoplasm. Both in case of algae and angiosperms there are reports of heavy metals found associated with cell walls. Bringezu et al. [94] have found a range of heavy metals accumulated in the epidermal cell wall of metal tolerant Silene vulgaris subspecies humilis. The metals were either bound to a protein or as silicates. Most of these heavy metals are bound to polygalacturonic acids which has afﬁnity to different metal ions in the following order: Pb > Cr > Cu > Ca > Zn [95]. Further, Turner and Marshall [96] have shown a positive correlation between zinc tolerance and cell wall Zn binding capacities in Agrostis tenuis. Wyn-Zones et al. [97] think that in case of metal tolerant plants the metal is present as stable complex in the walls of the root cells which prevent it from reaching the active sites and thus avoids damage. Farago et al. [98] have observed that in Armeria maritima most of the copper is found associated with the pectate and other carbohydrates in the roots. Konno et al. [99] have reported 2/5 of the total copper accumulation to be tightly bound to the homogalacturonan of the cell wall pectin in a metal tolerant moss Scopelophila cataractae. In studies carried out on Linum usitatissimum varieties [100] it has been suggested that cell wall may be involved in the reinforcement of tissue cohesion and in the sequestration of cadmium. A decrease in root cell wall pectin concentration and increase in pectin methylation degree may be involved in copper tolerance in Silene paradoxa copper tolerant population [101].

10.3.4

Role of Root Exudates

Root exudates have also been shown to be involved in metal tolerance. In nickel hyperaccumulating plants, Ni chelating exudates rich in histidine and citrate help to

10

Plant Defence Against Heavy Metal Stress

257

reduce Ni uptake and thus play a role in the detoxiﬁcation of Ni in Thlaspi sp. [102]. As the plant roots exclude a variety of compounds they may play a role in tolerance of various heavy metals; for example roots of Fagopyrum esculentum secrete oxalic acid in response to Al stress which is accumulated as non toxic aluminum oxalate in the leaves [103].

10.3.5

Role of Plasma Membrane

Heavy metals alter the plasma membrane function. Copper has shown to increase K+ efﬂux from excised roots of Agrostis capillaris [104]. Damage to the cell membrane has been observed to be the main cause of metal toxicity in different plants. The damage may be due to changes in the composition of membrane [105] inhibition of K+ ATPase [106] or oxidation of protein thiols [107]. Plants may achieve metal tolerance by protecting the integrity of plasma membrane against heavy metal damage [107]. How this is done is not clear. Damage repair by the use of heat shock proteins or metallothioneins is a way to maintain plasma membrane integrity [108]. Further, plasma membrane may play a role in metal homeostasis by preventing or reducing entry into the cell or by selective efﬂux [109]. Reduced uptake for As has been shown in case of Holcus lanatus [110]. Another strategy that plants may adopt and for which there is little direct evidence, is the active efﬂux pumping for Cu, Cd, Zn, Co and Ni. This exists in bacteria [109]. Similar efﬂux transporters may also be involved in metal ion homeostasis in animal cells [111]. Such transporters may also be present in higher plants and may be involved in metal uptake and homeostasis vis-à-vis metal tolerance.

10.3.6

Role of Protoplasm

When plants are exposed to metals different kinds of metabolites such as organic acid, amino acids (proline, histidine), peptides, phytochelatins and metallothioneins accumulate in micro quantities. Nitrogen metabolism seems to be central to the response of plants to heavy metals. The role of these metabolites is being discussed below: (i) Organic Acids and Amino Acids- Organic acids and amino acids play a role in metal tolerance by chelating heavy metal inside the cell and changing the metals to nontoxic forms [20, 90, 112, 113]. Citric acid [103] and oxalic acid [114] have been reported to form Al citrate and Al oxalate complexes in the symplasm in hydrangea and buckwheat, respectively, making it nontoxic. Increased concentrations of malic and citric acid in zinc and malic, citric and malonic acid in nickel tolerant plants have been reported [115]. Ernst et al. [116] have postulated that malic acid binds Zn in the cytosol and thus detoxify it; the Zn-malate complex is transported over the tonoplast into the vacuole where it would dissociate and malate is transported into the cytosol. According

258

N.C. Aery

to Brooks et al. [115] presence of nickel in the mitochondria may block the Kreb’s cycle by deactivating malic dehydrogenase which results in the to build up of malic acid in the vacuoles. This could then absorb excess nickel by a complexing reaction leading to its diffusion back into the vacuole from the mitochondria and thus unblocking the Kreb’s cycle. (ii) Proline-Proline (Pyrrolidine-2-carboxylic acid) is a proteinogenic ﬁve-carbon amino acid and functions as a cell wall component, osmolyte [117], radical scavenger [118] as an antioxidant and stabilizer of macromolecules [119]. Proline interacts with crucial macromolecules of cell as compatible solutes stabilizing protein structure and function [120]. A multifunction role of proline has been discussed by Szabados and Savouré [121]. Proline accumulation is one of the strategies plants have evolved to tackle environmental stress. Proline has been observed to accumulate in a wide range of crop plants such as Oryza sativa, Triticum aestivum, Cajanus cajan, Vigna mungo, Vigna radiata, Brassica juncea and Helianthus annuus even under stresses (salt, water, heavy metal, mineral deﬁciency or excess, UV radiation) which are not hyperosmotic [122, 123]. The amount of free proline that is accumulated varies with the degree of stress [124]. Experiments conducted by Khalique and Roy [125] have shown that Okra (Abelmoschus esculentus) plants grown in heavy metal enriched coal mine spoils show increased proline synthesis during completion of life cycle that might help in adaptation and growth. Proline content in plants is suggested as a biochemical marker for heavy metal stress. Costa and Spitz [126] reported an increase in total free amino acids and hydroxyproline levels with increasing cadmium treatments in Lupinus albus. Proline synthesis is considered as a mechanism of alleviating cytoplasmic acidosis and may maintain NADP+/NADPH ratios [127]. Mehta and Gaur [128] observed a concomitant increase in the accumulation of free proline with the increasing concentrations of copper, chromium, nickel and zinc in Chlorella vulgaris. The amount of intracellular proline in algal cells was observed to increase with an increase in the cell metal contents. Cadmium is also known to enhance proline content signiﬁcantly in wheat seedlings [129]. Saradhi and Saradhi [124] provided evidence to show that Cd was the strongest inducer among four heavy metals tested for proline accumulation. It has been suggested that proline provides protection by chelating heavy metals in the cytoplasm [130], reducing the metal uptake [131] and maintaining the water balance which is often disturbed by heavy metals [15, 132]. It has also been suggested that free proline may act as a storage compound for both carbon and nitrogen during water stress when both starch and protein syntheses are inhibited [133]. Higher proline production has been demonstrated to correlate with increased metal tolerance in transgenic Chlamydomonas reinhardtii [134]. Proline accumulation in plant tissues has been suggested to result from (a) a decrease in proline degradation, (b) an increase in proline biosynthesis, (c) a decrease in protein synthesis or proline utilization, and (d) hydrolysis of proteins [135].

10

Plant Defence Against Heavy Metal Stress

(iii)

(iv)

(v)

(vi)

259

The plant water balance is disturbed when plants are exposed to heavy metals [136] and this may trigger the accumulation of proline [132]. However, it has been observed that metal induced proline accumulation in sunﬂower is a direct consequence of metal uptake and there appears to be no role of water deﬁcit. In their experiment they observed proline accumulation in isolated fully turgid leaf discs ﬂoating on solution [137]. Further researches are required to work out the relative contribution of proline to metal chelation in presence of other ligands such as phytochelatins. Histidine- Kramer et al. [138] have reported a 36 fold increase in the histidine content of the xylem sap in Alyssum lesbiacum- a nickel hyperaccumulator, on exposure to nickel. Further, when histidine was supplied to a non-accumulating plant species it increased its nickel tolerance and the capacity for Ni transport to the shoot. However, this mechanism has not observed to be true for another Ni hyperaccumulator, Thlaspi goesingense [139]. Histidine levels have also been shown to correlate with nickel tolerance in Sachharomyces cerevisae [140]. Moreover, beneﬁcial role of high histidine levels towards Ni tolerance has also been shown in transgenic Arabidopsis thaliana [141]. Heat- Shock Proteins-Heat shock proteins (HSPs) are produced in response to high temperature. However, they are also known to express in response to other stresses such as heavy metals. Aside from their normal function they may also have a role in the protection and repair of proteins under stress condition [142]. Neumann et al. [143] have shown that HSP17 is expressed in roots of Armeria maritima plants when grown on Cu rich substratum. But as generally plants growing on metalliferous soils produce no or very low amounts of HSPs they may not have a role in the heritable metal tolerance. Lewis et al. [144] suggest that HSPs may have a role in the protection of membranes against metal damage. Other Amino Acids- Certain other amino acids such as asparagine has been found to accumulate in zinc tolerant plants forming Zn-asparagine complex which may reduce zinc toxicity. The association between amino acids and metals is very important because nickel complexes with amino acids are considerably more stable than those with carboxylic acids [145, 146]. Certain other amino acids which may be of interest are glutamine, threonine [147] and cystein. Cystein contents have been shown to increase by a factor of 4.5 in tolerant Silene vulgaris in response to metal stress [148]. It is required for methionine and glutathione/phytochelatins synthesis and therefore a key metabolite in antioxidant defense and metal sequestration. Polyamines-Polyamines are synthesized from ornithine, citruline or arginine following decarboxylation and by the addition of one or two amino propyl groups. The levels of polyamines and activity of their biosynthetic enzyme increase under stress. A tenfold increase in putrescine in cadmium treated oat seedlings have been observed [149]. Increase in putrescine level in lower as well as higher plants has also been observed under the inﬂuence of metals [150].

260

N.C. Aery

Though speciﬁc r.ole of polyamines in plant defense against metal stress has not yet been established, it is possible that these may have links with abscisic acid, signaling of reactive oxygen species, nitric oxide generation, Ca2+ homeostasis and modulation of ion channel activities [151]. (vii) Betaines and Nicotianamines- Certain other nitrogen containing amino acids are also synthesized under metal stress. These are glycine betaines- a tri methyl glycine and nicotianamines. Glycine betaines generally accumulate in plants under water stress and have also been shown to accumulate in Armeria maritima ecotypes collected from zinc contaminated sites [152]. Nicotianamine has been indicated to be important in heavy metal detoxiﬁcation in zinc hyperaccumulator Arabidopsis halleri [153] and may be involved in metal homeostasis. (viii) Metallothioneins (MT)- Metallothioneins are low molecular weight proteins which bind heavy metals and are found throughout the plant and animal kingdom. These are cysteine-rich metal binding peptides. Until 1997 only one Metallothionein namely, Wheat Ec (Early cysteine labeled) protein [154] was known. MTs are usually classiﬁed into two groups (on the basis of alignments of cystein residue); these are MT1 and MT2. MT1 possess cystein residues that align with a mammalian renal MT whereas MT2 though possess similar cystein cluster but these can not be easily aligned with class 1 MTs [155]. MT genes have been identiﬁed in a number of higher plants for example Arabidopsis in which additionally MT3 and MT4 types have also been recognized. MT production is induced by copper treatment. But their exact role in detoxiﬁcation of heavy metals is yet to be established fully. A variety of functions have been assigned to MTs. They may have a role in plasma membrane repairing and may also function as antioxidants. Currently structure of metallothianin and their metal thiolate is being studied [156, 157]. The studies would be helpful in knowing their role in metal tolerance. (ix) Phytochelatins- Another mechanism used by plants to combat heavy metal stress is the synthesis of metal-binding polypeptides which sequester and ultimately detoxify the excess metal ions. These are phytochelatins, the small cystein-rich peptides capable of binding metal ions via thiolate coordination. These have widely been studied in plants particularly in relation to Cd tolerance [158]. The heavy metal binding polypeptides of plants are those whose synthesis is induced by heavy metals and which possess the generalized structure (J - Glutamyl Cysteinyl) n -Glycines where n = 2−11 [159, 160]. These have been named as, Cadystins [161], Phytochelatins [159], J -Glutamyl peptide [162], Poly- (Glytamyl Cysteninyl) Glycines [163] and cadmium peptide [164]. Phytochelatins play a central role in the detoxiﬁcation of excess metals and are also involved in trace metal homeostasis. Phytochelatins are synthesized using glutathione as a substrate in presence of an enzyme PC Synthase which is activated in presence of metal ions [158]. The genes

10

Plant Defence Against Heavy Metal Stress

261

encoding for PC Synthase have now been identiﬁed in Arabidopsis and Yeast [165]. The tendency of metals to induce phytochelatins in cell suspension cultures of Rouvolﬁa serpentina decreases in the order Hg > Cd = As = Fe > Cu = Ni > Sb = Au > Sn = Se > Bi > Pb = Zn [166]. However, there are evidences both for and against the role of PCs in cadmium detoxiﬁcation as has been shown in Arabidopsis [167], Brassica juncea [168] and Vigna angularis [169]. A comparative analysis of the contribution of phytochelatins to cadmium and arsenic tolerance in soybean and white lupin has been studied [170]. Recent advances in structure of PCs, their biosynthetic regulation, roles in heavy metal detoxiﬁcation and/or accumulation, and PC synthase gene expression for better understanding of mechanism involved has been discussed [171]. It has been argued that although phytochelatins may play some role in cadmium detoxiﬁcation, large production of phytochelatins may not be the mechanism for increased cadmium tolerance as shown in Silene vulgaris. Vogeli-Lange and Wagner [172] are of the opinion that phytochelatins may act as carriers for metal transport into the vacuole. It is also possible that phytochelatins may play some other important role in the plant cell such as in sulphur metabolism, heavy metal homeostasis or as antioxidants and their role in the heavy metal detoxiﬁcation is probably a result of the above functions [160]. There are other evidences also which indicate that phytochelatins may not be involved in metal tolerance. These are: (i) Tolerant plants or cells do not produce more phytochelatins than nontolerant plants [173, 174]; (ii) Phytochelatin production can be induced by a variety of metals, indicating metal tolerance to be nonspeciﬁc whereas most of the metal tolerances are rather speciﬁc [175]. It appears that there is no single mechanism that can account for tolerance to a wide range of heavy metals. It is also possible that more than one mechanism may be responsible for detoxiﬁcation of a particular metal as has been shown for arsenate tolerance in Holcus lanatus. In this case adaptive suppression of the plasma membrane uptake system and a role for phytochelatin production has been shown [176]. Multiple detoxiﬁcation mechanisms for cadmium have also been suggested to be operative in Typha angustifoila L. [177] and these differ in leaf cell cytoplasm and root cell cytoplasm.

References 1. Levitt J (1980) Responses of plants to environmental stresses, vol I & II. Academic, New York 2. Sittig M (1976) Toxic metals: pollution control and worker protection. Noyes Data Corporation, Park Ridge 3. Anon (1964) Encyclopedia of chemical sciences. Van Nostrand, Princeton 4. Lapedes DN (1974) Encyclopedia of environmental science. McGraw-Hill, New York 5. Venugopal B, Luckey T (1975) Toxicity of non radioactive heavy metals and their salts. In: Coulston F (ed) Heavy metal toxicity, safety and hormology. Academic/George Thieme Stuttagart, New York

262

N.C. Aery

6. Woolhouse HW (1983) Toxicity and tolerance in the responses of plants to metals. In: Pirson A, Zimmerman MH (eds) Encyclopedia of plant physiology. Springer, Berlin 7. Nieboer E, Richardson DHS (1980) The replacement of the nondescript term ‘heavy metal’ by a biologically and chemically signiﬁcant classiﬁcation of metal ions. Environ Pollut Ser B 1:2–26 8. Arnon DI, Stout PR (1939) Mo as an essential element for higher plants. Plant Physiol 14:599–602 9. Timperley MH, Brooks RR, Peterson PJ (1970) The signiﬁcance of essential and nonessential trace elements in plants in relation to biogeochemical prospecting. J Appl Ecol 7:429 10. Ahrens LH (1954) The lognormal distribution of the elements (2). Geochim Cosmochim Acta 6:121–131 11. Liebscher K, Smith H (1968) Essential and nonessential trace elements. A method of determining whether an element is essential or nonessential in human tissue. Arch Environ Health 17:881–890 12. Aery NC (1978) Geobotanical studies of the region of zinc ores deposits in the Udaipur Region. Ph.D. thesis. M.L. Sukhadia University, Udaipur 13. Wierzbicka M (1998) Lead in the apoplast of Allium cepa L. root tips –ultrastructural studies. Plant Sci 133:105–119 14. Sauerbeck DR (1991) Plant, element and soil properties governing plant uptake and availability of heavy metals derived from sewage sludge. Water Air Soil Pollut 227:57–58 15. Costa G, Morel JL (1994) Water relations, gas exchange and amino acid content in cadmiumtreated lettuce. Plant Physiol Biochem 32:561–570 16. Romheld V (1991) The role of phytosiderophores in acquisition of iron and other micronutrients in graminaceous species: an ecological approach. Plant Soil 130:127–134 17. Shojima S, Nishizawa N, Fushiya S, Nozoe S, Irifune T, Mori S (1990) Biosynthesis of phytosiderophores in vitro biosynthesis of 2’-deoxymugineic acid from L-methionine and nicotianamine. Plant Physiol 93:1497–1503 18. Mori S, Nishizawa N (1989) Identiﬁcation of barley chromosome No. 4, possible encoder of genes of mugineic acid synthesis from 2’-deoxymugineic acid using wheat-barley addition lines. Plant Cell Physiol 30:1057–1061 19. Robinson NJ, Tommey AM, Kuske C, Jackson PJ (1993) Plant metallothioneins. Biochem J 295:1–10 20. Rauser WE (1999) Structure and function of metal chelators produced by plants. Cell Biochem Biophys 31:19–48 21. Goldschmidt VM (1937) The principles of the distribution of the chemical elements in minerals and rocks. J Chem Soc 1937:655–673 22. Aery NC, Tiagi YD (1987) Biogeochemistry of lead at Zawar Mines, Udaipur (India). In: Agrawal VP, Rana SVS (eds) Science development and environment. Society of Biosciences, Muzaffarnagar 23. Aery NC, Tiagi YD (1988) Accumulation of cadmium by plants of Zawar mines, Rajasthan, India. Acta Biol Hung 39:87–98 24. Brooks RR, Reeves RD, Baker AJM (1992) The serpentine vegetation of Goiás State, Brazil. In: Proctor J, Baker AJM, Reeves RD (eds) The vegetation of ultramaﬁc (serpentine) soils. Intercept Ltd, Andover 25. Baker AJM, Reeves RD, Hajar ASM (1994) Heavy metal accumulation and tolerance in British populations of the metallophyte Thlaspi caerulescens J. & C. Presl (Brassicaceae). New Phytol 127:61–68 26. Reeves RD, Brooks RR (1983) Hyperaccumulation of lead and zinc by two metallophytes from mining areas of Central Europe. Environ Pollut Ser A Ecol Biol 31:277–285 27. Baker AJM (1981) Accumulators and excluders – Strategies in the response of plants to heavy metals. J Plant Nutr 3:643–654 28. Aery NC, Tiagi YD (1986) Bioindicators and accumulators in geobotanical & biogeochemical prospecting of metals. Acta Biol Hung 37:67–78

10

Plant Defence Against Heavy Metal Stress

263

29. Tiagi YD, Aery NC (1986) Biogeochemical studies at the Khetri Copper deposits of Rajasthan, India. J Geochem Explor 26:267–274 30. Berry WL (1986) Plant factors inﬂuencing the use of plant analysis as a tool for biogeochemical properties. In: Carlisle D, Kaplan IR, Watterson JR (eds) Mineral exploration: biological systems and organic matter, vol 5. Prentice-Hall, New York 31. Baker AJM, Brooks RR, Kersten WJ (1985) Accumulation of nickel by Psychotria species from the Paciﬁc Basin. Taxon 34:89–95 32. Ernst WHO (1974) Schwermetallvegetation der Erde. G. Fischer Verlag, Stuttgart 33. Ernst WHO (1990) Mine vegetation in Europe. In: Shaw AJ (ed) Heavy metal tolerance in plants: evolutionary aspects. CRC Press, Boca Raton 34. MacArthur RH, Wilson EO (1967) The theory of island biogeography. Princeton University Press, Princeton 35. Symeonidis BL, McNeilly T, Bradshaw AD (1985) Differential tolerance of three cultivars of Agrostis capillaries L. to cadmium, copper, lead, nickel and zinc. New Phytol 101:309–315 36. Kakes P (1977) Genecological investigations on zinc plants II. Introgression in a small population of the zinc violet Viola calaminaria ssp. westfalica (Lej.) Ernst. Acta Bot Neerl 26:385–400 37. Duvigneaud P (1958) The vegetation of Katanga and its metalliferous soils (in French). Soc R Bot Belg 90:127–286 38. Malaisse F, Gregoire J, Brooks RR, Morrison RS, Reeves RD (1978) Aeolanthus biformifolius De Wild.: a hyperaccumulator of copper from Zaïre. Science 199(4331):887–888 39. Cole MM, Le Roex HD (1978) The role of geobotany, biogeochemistry and geochemistry in mineral exploration in South West Africa and Botswana - a case history. Trans Geol Soc S Afr 81:277–317 40. Wild H (1968) Geobotanical anomalies in Rhodesia. 3. The vegetation of nickel-bearing soils. Kirkia 7:1–62 41. Nicolls OW, Provan DMJ, Cole MM, Tooms JS (1965) Geobotany and geochemistry in mineral exploration in the Dugald River Area, Cloncurry district, Australia. Trans Inst Min Metall 74:695–699 42. Cole MM, Provan DMJ, Tooms JS (1968) Geobotany, biogeochemistry and geochemistry in the Bulman-Waimuna Springs Area, Northern Territory, Australia. Trans Inst Min Metall Sec B 74:81–104 43. Cannon HL (1957) Description of indicator plants and methods of botanical prospecting for uranium deposits on the Colorado Plateau. US Geol Surv Bull 1030-M:399–516 44. Cole MM (1973) Geobotanical and biogeochemical investigations in the sclerophyllous woodland and shrub associations of the eastern goldﬁeld area of Western Australia, with particular reference to the role of Hybanthus ﬂoribundus (Lindl.) F Muell as a nickel indicator and accumulator plant. J Appl Ecol 10:269–320 45. Braun-Blanquet J (1932) Plant sociology. Mc Graw Hill Book Co, New York/London 46. Tiagi YD, Aery NC (1982) Geobotanical studies on zinc deposit areas of Zawar Mines, Udaipur. Vegetatio 50:65–70 47. Aery NC (2010) Manual of environmental analysis. CRC Press, Boca Raton 48. Malyuga DP (1964) Biogeochemical methods of prospecting. Consultants Bureau, New York 49. Brooks RR (1983) Biological methods of prospecting for minerals. John Wiley and Sons, New York 50. Duvigneaud P, Denaeyer de-Smet S (1963) Cuivre et vegetation an Katanga. Bull Soc Roy Belg 96:93–231 51. Lambinon J, Auquier P (1964) La ﬂorae et La vegetation des terrains calaminaires de la Wallonie Septrentrionale et de la Rhenanie Aixoise. Types Chorologiques et groupes, ecologiques. Natura Mosana 16(4):113–130 52. Aery NC (1995) Geobotanical and biogeochemical studies on certain uranium deposits of Rajasthan. Final Report on the project sponsored by Department of Atomic Energy, Government of India, Udaipur

264

N.C. Aery

53. Antonovics J, Bradshaw AD, Turner RG (1971) Heavy metal tolerance in plants. Adv Ecol Res 7:1–85 54. Brooks RR, Lee J, Reeves RD, Jaffre T (1977) Detection of nickeliferous rocks by analysis of herbarium specimens of indicator plants. J Geochem Explor 7:49–57 55. Jaffré T (1980) Etude écologique du peuplement végétal des sols dérivés de roches ultrabasiques en Nouvelle-Calédonie. Coll Trav Doc ORSTOM 124:1–274 56. Peterson PJ (1983) Adaptation to toxic metals. In: Robb DA, Pierpoint WS (eds) Metals and micronutrients: uptake and utilisation by plants. Academic, London 57. Meharg AA (2005) Mechanisms of plant tolerance to metal and metalloid ions and potential biotechnological applications. Plant Soil 274:161–171 58. Baker AJM, McGrath SP, Reeves RD, Smith JAC (1998) Metal hyperaccumulator plants: a review of the biological resource for possible exploitation in the phytoremediation of metalpolluted soils. In: Banuelos GS, Terry N, Vangronsveld J (eds) Phytoremediation. Ann Arbor Publishers, Michigan 59. Raskin I, Kumar PBAN, Dushenkov S, Salt DE (1994) Bioconcentration of heavy metals by plants. Curr Opin Biotechnol 5:285–290 60. Ernst WHO, Schat H, Verkleij JAC (1990) Evolutionary biology of metal resistance in Silene vulgaris. Evol Trends Plant 4:45–51 61. Rascio N, Navari-Izzo F (2011) Heavy metal hyperaccumulating plants: how and why do they do it? And what makes them so interesting? Plant Sci 180:169–181 62. Baker AJM, Proctor J, van Balgooy MMJ, Reeves RD (1992) Hyperaccumulation of nickel by the ﬂora of the ultramaﬁcs of Palawan, Republic of the Philippines. In: Baker AJM, Proctor J, Reeves RD (eds) The vegetation of ultramaﬁc (serpentine) soils. Intercept Ltd, Andover 63. Huitson SB, Macnair MR (2003) Does zinc protect the zinc hyperaccumulator Arabidopsis halleri from herbivory by snails? New Phytol 159:453–459 64. Baker AJM, Walker PL (1990) Ecophysiology of metal uptake by tolerant plants. In: Shaw AJ (ed) Heavy metal tolerance in plants: evolutionary aspects. CRC Press, Boca Raton 65. Mengoni A, Schat H, Vangronsveld J (2010) Plants as extreme environments? Ni-resistant bacteria and Ni-hyperaccumulators of serpentine ﬂora. Plant Soil 331:5–16 66. Brooks RR (1977) Copper and cobalt uptake by Haumaniastrum species. Plant Soil 48:541–544 67. Malaisse F, Grégoire J, Morrison RS, Brooks RR, Reeves RD (1979) Copper and cobalt in vegetation of Fungurume, Shaba Province, Zaïre. Oikos 33:472–478 68. Wild H (1974) Indigenous plants and chromium in Rhodesia. Kirkia 9:233–241 69. Jaffré T (1979) Accumulation du manganèse par les Protéacées de Nouvelle-Calédonie. C R Acad Sci Paris Sér D 289:425–428 70. Brooks RR, Morrison RS, Reeves RD, Dudley TR, Akman Y (1979) Hyperaccumulation of nickel by Alyssum L (Cruciferae). Proc R Soc Lond B 203:387–403 71. Macnair MR, Bert V, Huitson SB, Saumitou-Laprade P, Petit D (1999) Zinc tolerance and hyperaccumulation are genetically independent characters. Proc R Soc Lond B 266:2175–2179 72. Assunção AGL, Bookun WMT, Nelissen HJM, Vooijs R, Schat H, Ernst WHO (2003) A cosegregation analysis of zinc (Zn) accumulation and Zn tolerance in the Zn hyperaccumulator Thlaspi caerulescens. New Phytol 159:383–390 73. Bert V, Meerts P, Saumitou-Laprade P, Salis P, Gruber W, Verbruggen N (2003) Genetic basis of Cd tolerance and hyperaccumulation in Arabidopsis halleri. Plant Soil 249:9–18 74. Krämer U (2010) Metal hyperaccumulation in plants. Annu Rev Plant Biol 61:517–534 75. Chaney RL, Reeves PG, Ryan JA, Simmons RW, Welch RM, Angle JS (2004) An improved understanding of soil Cd risk to humans and low cost methods to phytoextract Cd from contaminated soil to prevent Cd risks. Biometals 17:549–553 76. Prasad R, Verma M, Kumari K (2010) The phytoavailability and phytomining of uranium. In: Proceedings of the XI International Seminar on Mineral Processing Technology (MPT-2010) Editors: R. Singh, A. Das, P.K. Banerjee, K.K. Bhattacharyya and N.G. Goswami © NML Jamshedpur, 1(Section 8), pp 642–650 77. Dushenkov V, Kumar PBAN, Motto H, Raskin I (1995) Rhizoﬁltration: the use of plants to remove heavy metals from aqueous streams. Environ Sci Technol 29:1239–1245

10

Plant Defence Against Heavy Metal Stress

265

78. Blaylock MJ, Salt DE, Dushenkov S, Zakharova O, Gussman C, Kapulnik Y, Ensley BD, Raskin I (1997) Enhanced accumulation of Pb in Indian mustard by soil-applied chelating agents. Environ Sci Technol 31:860–865 79. Dietz KJ, Baier M, Kramer U (1999) Free radicals and reactive oxygen species as mediators of heavy metal toxicity in plants. In: Prasad MNV, Hagemeyer J (eds) Heavy metal stress in plants – from molecules to ecosystems. Springer, Berlin 80. Azmat R, Haider S, Nasreen H, Aziz F (2009) Viable alternative mechanism in adapting the plants to heavy metal environment. Pak J Bot 41:2729–2738 81. Weryszko-Chmielewska E, Chwil M (2005) Lead – induced histological and ultrastructural changes in the leaves of soybean (Glycine max (L) Merr). Soil Sci Plant Nutr 52:203–212 82. Reilly C, Jane S (1971) Copper Tolerance in Becium homblei. Nature 230:403 83. Wainwright SJ, Woolhouse HW (1975) Physiological mechanisms of heavy metal tolerance in plants. In: Chadwick MJ, Goodman GT (eds) The ecology of resources degradation and renewal, 15th symposium of the British Ecological Society, 10–12 July 1973. Blackwell Scientiﬁc, Oxford 84. Gregory RPG, Bradshaw AD (1965) Heavy metal tolerance in Agrostis tenuis Sibth. and other grasses. New Phytol 64:131–143 85. Urquhart C (1971) Genetics of lead tolerance in Festuca ovina. Heredity 26:19–33 86. Colpaert JV, Van Assche JA (1992) Zinc toxicity in ectomycorrhizal Pinus sylvestris. Plant Soil 143:201–211 87. Huttermann A, Arduini I, Godbold DL (1999) Metal pollution and forest decline. In: Prasad MNV, Hagemeyer J (eds) Heavy metal stress in plants - from molecules to ecosystems. Springer, Berlin/Heidelberg/New York 88. Hall JL (2002) Cellular mechanisms for heavy metal detoxiﬁcation and tolerance. J Exp Bot 53:1–11 89. De DN (2000) Plant cell vacuoles. CSIRO Publishing, Collingwood 90. Mathys W (1977) The role of malate, oxalate and mustard oil glucosides in the evolution of zinc resistance in herbage plants. Physiol Plant 40:130–136 91. Davies KL, Davies MS, Francis D (1991) Zinc- induced vacuolation in root meristematic cells of Festuca rubra L. Plant Cell Environ 14:399–406 92. Verkleij JAC, Koevoets PLM, Blake-Kalff MMA, Chardonnens AN (1998) Evidence for an important role of the tonoplast in the mechanism of naturally selected Zn tolerance in Silene vulgaris. J Plant Physiol 153:188–191 93. Chardonnens AN, Koevoets PLM, van Zanten A, Schat H, Verkleij JAC (1999) Properties of enhanced tonoplast zinc transport in naturally selected zinc-tolerant Silene vulgaris. Plant Physiol 120:779–785 94. Bringezu K, Lichtenberger O, Leopold I, Neumann D (1999) Heavy metal tolerance of Silene vulgaris. J Plant Physiol 154:536–546 95. Farago ME, Pitt MJ (1977) Plants which accumulate metals. Part III. A further investigation of two Australian species which take up zinc. Inorg Chim Acta 24:211–214 96. Turner RG, Marshall C (1972) The accumulation of zinc by subcellular fractions of roots of Agrostis tenuis Sibth., in relation to zinc tolerance. New Phytol 71:671–676 97. Wyn Jones RG, Sutcliffe M, Marshall C (1971) Physiological and biochemical basis for heavy metal tolerance in clones of Agrostis tenuis. In: Samish RM (ed) Recent advances in plant nutrition. Gordon and Breach Science Publishers, New York/London/Paris 98. Farago ME, Mullen WA, Cole MM, Smith RF (1980) A study of Armeria maritima (Mill) Willdenow growing in a copper-impregnated bog Environmental Pollution Series A. Ecol Biol 21:225–244 99. Konno H, Nakashima S, Katoh K (2010) Metal-tolerant moss Scopelophila cataractae accumulates copper in the cell wall pectin of the protonema. J Plant Physiol 167: 358–364 100. Douchiche O, Soret-Morvan O, Chaïbi W, Morvan C, Paynel F (2010) Characteristics of cadmium tolerance in ‘Hermes’ ﬂax seedlings: contribution of cell walls. Chemosphere 81:1430–1436

266

N.C. Aery

101. Colzi I, Doumett S, Del Bubba M, Fornaini J, Arnetoli M, Gabbrielli R, Gonnelli C (2011) On the role of the cell wall in the phenomenon of copper tolerance in Silene paradoxa L. Environ Exp Bot 72(1):77–83 102. Salt DE, Kato N, Krämer U, Smith RD, Raskin I (2000) The role of root exudates in nickel hyperaccumulation and tolerance in accumulator and nonaccumulator species of Thlaspi. In: Terry N, Banuelos G (eds) Phytoremediation of contaminated soil and water. CRC Press LLC, Boca Raton 103. Ma JF, Hiradate S, Nomoto K, Iwashita T, Matsumoto H (1997) Internal detoxiﬁcation mechanism of Al in hydrangea. Identiﬁcation of Al form in the leaves. Plant Physiol 113:1033–1039 104. Wainwright SJ, Woolhouse HW (1977) Some physiological aspects of copper and zinc tolerance in Agrostis tenuis Sibth: cell elongation and membrane damage. J Exp Bot 28:1029–1036 105. Quartacci M, Cosi E, Navari-Izzo F (2001) Lipids and NAPDH-dependent superoxide production in plasma membrane vesicles from roots of wheat grown under copper deﬁciency or excess. J Exp Bot 52:77–84 106. Fodor A, Szabó-Nagy A, Erdei L (1995) The effects of cadmium on the ﬂuidity and H+-ATPase activity of plasma membrane from sunﬂower and wheat roots. J Plant Physiol 147:87–92 107. Meharg AA (1993) The role of the plasmalemma in metal tolerance in angiosperms. Physiol Plant 88:191–198 108. Salt DE, Smith RD, Raskin I (1998) Phytoremediation. Annu Rev Plant Physiol Plant Mol Biol 49:643–668 109. Silver S (1996) Bacterial resistance to toxic metal ions. Gene 179:9–19 110. Meharg AA, Macnair MR (1992) Genetic correlation between arsenate tolerance and the rate of inﬂux of arsenate and phosphate in Holcus lanatus L. Heredity 69:336–341 111. Williams LE, Pittman JK, Hall JL (2000) Emerging mechanisms for heavy metal transport in plants. Biochim Biophys Acta 1465:104–126 112. Gabbrielli R, Mattioni C, Vergnano O (1991) Accumulation mechanisms and heavy metal tolerance of a nickel hyper- accumulator. J Plant Nutr 14:1067–1080 113. Clemens S (2001) Molecular mechanisms of metal tolerance and homeostasis. Planta 212:475–486 114. Ma JF, Hiradate S, Matsumoto H (1998) High aluminum resistance in buckwheat. Ii. Oxalic acid detoxiﬁes aluminum internally. Plant Physiol 117:753–759 115. Brooks RR, Shaw S, Marﬁl AA (1981) The chemical form and physiological function of nickel in some Iberian Alyssum species. Physiol Plant 51:167–170 116. Ernst WHO, Verkleiji JAC, Schat H (1992) Metal tolerance in plants. Acta Bot Neerl 411:229–248 117. Aspinall D, Paleg LG (1981) Proline accumulation: physiological aspects. In: Paleg LG, Aspinall D (eds) The physiology and biochemistry of drought resistance in plants. Academic, Sydney 118. Smirnoff N, Cumbes QJ (1989) Hydroxyl radical scavenging activity of compatiblesolutes. Phytochemistry 28:1057–1060 119. Xu J, Yin HX, Li X (2009) Protective effects of proline against cadmium toxicityin micropropagated hyperaccumulator, Solanum nigrum L. Plant Cell Rep 28:325–333 120. Bohnert HJ, Nelson DE, Jensen RG (1995) Adaptations to environmental stresses. Plant Cell 7:1099–1111 121. Szabados L, Savouré A (2010) Proline: a multifunctional amino acid. Trends Plant Sci 15:89–97 122. Sharmila P, Saradhi P (1997) Stress induced proline accumulation in crop plants is not related to osmoregulation, Abstract No. 1667. Electronic Abstract Centre, American Society of Plant Biologists (ASPB), Rockville 123. Mali M, Aery NC (2009) Effects of silicon on growth, biochemical constituents and mineral nutrition of cowpea. Commun Soil Sci Plant Anal 40:1041–1052

10

Plant Defence Against Heavy Metal Stress

267

124. Saradhi A, Saradhi PP (1981) Proline accumulation under heavy metal stress. J Plant Physiol 138:554–558 125. Khalique S, Roy BK (2000) Genomic responses of higher plants to environmental stress. In: Iqbal M, Srivastava PS, Siddiqi TO (eds) Environmental hazards: plants and people. CBS Publishers and Distributors, New Delhi 126. Costa G, Spitz E (1997) Inﬂuence of cadmium on soluble carbohydrates, freeamino acids, protein content of in vitro cultured Lupinus albus. Plant Sci 128:131–140 127. Hare PD, Cress WA (1997) Metabolic implications of stress - induced proline accumulation in plants. Plant Growth Regul 21:79–102 128. Mehta SK, Gaur JP (1999) Heavy metal-induced proline accumulation and its role in ameliorating metal toxicity in Chlorella vulgaris. New Phytol 143:253–259 129. Öncel I, Kele Y, Üstün AS (2000) Interactive effects of temperature and heavy metal stress on the growth and some biochemical compounds in wheat seedlings. Environ Pollut 107:315–320 130. Farago ME, Mullen WA (1979) Plants which accumulate metals. Part IV. A possible copperproline complex from the roots of Armeria maritima. Inorg Chim Acta 32:93–94 131. Wu JT, Hsieh MT, Kow LC (1998) Role of proline accumulation in response to toxic copper in Chlorella sp. (Chlorophyceae) cells. J Phycol 34:113–117 132. Schat H, Sharma SS, Vooijs R (1997) Heavy metal-induced accumulation of free proline in metal-tolerant and a nontolerant ecotype of Silene vulgaris. Physiol Plant 101:477–482 133. Pugnaire FI, Endolz LS, Pardos J (1994) Constraints by water stress on plant growth. In: Pessarakli M (ed) Handbook of plant and crop stress. Marcel Dekker Inc, New York 134. Siripornadulsil S, Traina S, Verma DPS, Sayre RT (2002) Molecular mechanisms of prolinemediated tolerance to toxic heavy metals in transgenic microalgae. Plant Cell 14:2837–2847 135. Charest C, Phan CT (1990) Cold acclimation of wheat (Triticum aestivum) properties of enzymes involved in proline metabolism. Physiol Plant 80:159–168 136. Barcelo J, Poschenrieder C (1990) Plant water relations as affected by heavy metal stress: a review. J Plant Nutr 13:1–37 137. Kastori R, Petrovic M, Petrovic N (1992) Effect of excess lead, cadmium, copper and zinc on water relations in sunﬂower. J Plant Nutr 15:2427–2439 138. Kramer U, Cotter-Howells JD, Charnock JM, Baker AJM, Smith JAC (1996) Free histidine as a metal chelator in plants that accumulate nickel. Nature 379:635–638 139. Persans MW, Yan X, Patnoe JM, Kramer U, Salt DE (1999) Molecular dissection of the role of histidine in Ni hyperaccumulation in Thlaspi goesingense. Plant Physiol 121:1117–1126 140. Pearce DA, Sherman F (1999) Toxicity of copper, cobalt, and nickel salts is dependent on histidine metabolism in the yeast Saccharomyces cerevisiae. J Bacteriol 181:4774–4779 141. Wycisk K, Kim EJ, Schroeder JI, Kramer U (2004) Enhancing the ﬁrst enzymatic step in the histidine biosynthesis pathway increases the free histidine pool and nickel tolerance in Arabidopsis thaliana. FEBS Lett 578:128–134 142. Tseng CK, Zhou MJ, Zou JZ (1993) Toxic phytoplankton studies in China. In: Smayda TJ, Shimizu Y (eds) Toxic phytoplankton blooms in the sea. Elsevier, Amsterdam 143. Neumann D, zur Nieden U, Lichtenberger O, Leopold I (1995) How does Armeria maritima tolerate high heavy metal concentrations? J Plant Physiol 146:704–717 144. Lewis S, Handy RD, Cordi B, Billinhurst Z, Depledge MH (1999) Stress proteins (HSPÕs): methods of detection and their use as an environmental biomarker. Ecotoxicology 8: 351–368 145. Bhatia NP, Walsh KB, Baker AJM (2005) Detection and quantiﬁcation of ligands involved in nickel detoxiﬁcation in the herbaceous Ni hyperaccumulator Stackhousia tryonii Bailey. J Exp Bot 56:1343–1349 146. Homer FA, Reeves RD, Brooks RR (1997) The possible involvement of amino acids in nickel chelation in some nickel accumulating plants. Curr Top Phytochem 14:31–33 147. White MC, Baker FD, Chaney RL, Decker AM (1981) Metal complexation in xylem ﬂuid. 2. Theoretical equilibrium model and computational computer program. Plant Physiol 67:301–310

268

N.C. Aery

148. Harmens H, Den Hartog PR, Ten Bookum WM, Verkleij JAC (1993) Increased zinc tolerance in Silene vulgaris (Moench.) Garcke is not due to increased production of phytochelatins. Plant Physiol 103:1305–1309 149. Weinstein LH, Kaur-Sawhney R, Rajam MV, Wettlaufer SH, Galston AW (1986) Cadmiuminduced accumulation of putrescine in oat and bean leaves. Plant Physiol 82:641–645 150. Zhou XH, Minocha R, Minocha SC (1995) Physiological responses of suspension cultures of Catharanthus roseus to aluminium: changes in polyamines and inorganic ions. J Plant Physiol 145:277–284 151. Alcázar R, Altabella T, Marco F, Bortolotti C, Reymond M, Koncz C, Carrasco P, Tiburcio AF (2010) Polyamines: molecules with regulatory functions in plant abiotic stress tolerance. Planta 231:1237–1249 152. Köhl K (1996) Population-speciﬁc traits and their implication for the evolution of a droughtadapted ecotype in Armeria maritima. Bot Acta 109:206–215 153. Weber M, Harada E, Vess C, von Roepenack-Lahaye E, Clemens S (2004) Comparative microarray analysis of Arabidopsis thaliana and Arabidopsis halleri roots identiﬁes nicotianamine synthase, a ZIP transporter and other genes as potential metal hyperaccumulation factors. Plant J 37:269–281 154. Lane BG, Kajioka R, Kennedy TD (1987) The wheat germ Ec protein is azinc-containing metallothionein. Biochem Cell Biol 65:1001–1005 155. Prasad MNV (1999) Heavy metal stress in plants: from biomolecules to ecosystems, 2nd edn. Springer, Berlin 156. Freisinger E (2010) The metal-thiolate clusters of plantmetallothioneins. Chimia 64:217–224 157. Grennan AK (2011) Metallothioneins, a diverse protein family. Plant Physiol 155:1750–1751 158. Cobbett CS (2000) Phytochelatins and their roles in heavy metal detoxiﬁcation. Plant Physiol 123:825–832 159. Grill E, Winnacker EL, Zenk MH (1985) Phytochelatins: the principal heavy-metal complexing peptides of higher plants. Science 230:674–676 160. Steffens JC (1990) The heavy metal-binding peptides of plants. Annu Rev Plant Physiol Plant Mol Biol 41:553–575 161. Kondo N, Wada-Nakagawa C, Hayashi Y (1984) Cadystin A and B, major unit peptides comprising cadmium-binding peptides induced in a ﬁssion yeast-separation: revision of structures and synthesis. Tetrahedron Lett 25:3869–3872 162. Reese RN, Mehra RK, Tarbet EB, Winge DR (1988) Studies on the 7-glutamyl Cu-binding peptide from Schizosaccharomyces pombe J. Biol Chem 263:4186–4192 163. Jackson PJ, Unkefer CJ, Doolen JA, Watt K, Robinson NJ (1987) Poly(y-glutamylcysteinyl) glycine: its role in cadmium resistance in plant cells. Proc Natl Acad Sci USA 84:6619–6623 164. Reese RN, Wagner GJ (1987) Properties of tobacco (Nicotiana tabacum) cadmium-binding peptide(s). Unique non-metallothionein cadmium ligands. Biochem J 241:641–647 165. Clemens S, Kim EJ, Neumann D, Schroeder JI (1999) Tolerance to toxic metals by a gene family of phytochelatin synthases from plants and yeast. EMBO J 18:3325–3333 166. Grill E, Winnacker EL, Zenk MH (1987) Phytochelatins, a class of heavy-metal-binding peptides from plants, are functionally analogous to metallothioneins. Proc Natl Acad Sci USA 84:439–443 167. Howden R, Goldsbrough PB, Andersen CR, Cobbett CS (1995) Cadmium-sensitive, cadl, mutants of Arabidopsis thaliana are phytochelatin-deﬁcient. Plant Physiol 107:1059–1066 168. Haag-Kerwer A, Schafer HJ, Heiss S, Walter C, Rausch T (1999) Cadmium exposure in Brassica juncea causes a decline in transpiration rate and leaf expansion without effect on photosynthesis. J Exp Bot 341:1827–1835 169. Inouhe M, Ito R, Ito S, Sasada N, Tohoyama H, Joho M (2000) Azuki bean cells are hypersensitive to cadmium and do not synthesize phytochelatins. Plant Physiol 123:1029–1036 170. Vázquez S, Goldsbrough P, Carpena RO (2009) Comparative analysis of the contribution of phytochelatins to cadmium and arsenic tolerance in soybean and white lupin. Plant Physiol Biochem 47:63–67

10

Plant Defence Against Heavy Metal Stress

269

171. Pal R, Rai JPN (2010) Phytochelatins: peptides involved in heavy metal detoxiﬁcation. Appl Biochem Biotechnol 160:945–963 172. Vogeli-Lange F, Wagner GJ (1990) Subcellular localization of cadmium and cadmiumbinding peptides in tobacco. Implication of a transport function for cadmium-binding peptides. Plant Physiol 92:1086–1093 173. De Vos CHR, Vonk MJ, Vooijs R, Schat H (1992) Glutathione depletion due to copperinduced phytochelatin synthesis causes oxidative stress in Silene cucubalus. Plant Physiol 98:853–858 174. Schat H, Kalff MMA (1992) Are phytochelatins involved in differential heavy metal tolerance or do they merely reﬂect metal-imposed strain? Plant Physiol 99:1475–1480 175. Schat H, Ten Bookum WM (1992) Genetic control of copper tolerance in Silene vulgaris. Heredity 68:219–229 176. Hartley-Whitaker J, Ainsworth G, Meharg AA (2001) Copper and arsenate-induced oxidative stress in Holcus lanatus L. clones with differential senstivity. Plant. Plant Cell Environ 24:713–722 177. Xu W, Shi W, Yan F, Zhang B, Liang J (2011) Mechanisms of cadmium detoxiﬁcation in cattail (Typha angustifolia L.). Aquat Bot 94:37–43

sdfsdf

Part III

Host Parasite Interaction

sdfsdf

Chapter 11

Gall Phenotypes – Product of Plant Cells Defensive Responses to the Inducers Attack Rosy Mary dos Santos Isaias and Denis Coelho de Oliveira

Abstract The great variety of gall morphotypes found in nature indicates the wide range of associated herbivores as well as the potentialities of the host plant cells to respond to their stimuli. Even though the galls are commonly seen as the extended phenotype of the gall inducers, they are constituted of plant cells. Therefore, these cells must have their developmental program altered towards new shapes and functions. Some signalizing molecules are evidenced since the ﬁrst contact of the gall inducer with its host tissues. The closest the stimuli is, the most intense are the responses, in such a way that cytological and histochemical gradients may be generated.

11.1

Introduction

Gall inducers are biotic factors capable of altering their host plant cell’s morphogenetic fate, generating speciﬁc phenotypes for each host plant responsive to cecidogenesis. There is a set of speciﬁc and specialized plant reactions to the gall inducer mode of feeding [62]. In cases where distinct galling herbivores infest the same plant species, each one induces distinct reorganizations in plant tissues and produces a typical and related structure [64]. Even though the role of the gall inducer and of the host plant in determining gall morphology is not clearly understood, several authors reported the action of the galling herbivores in producing speciﬁc

R.M. dos Santos Isaias (*) Instituto de Ciências Biológicas and Departamento de Botânica, ICB/UFMG, Universidade Federal de Minas Gerais, Av Antonio Carlos 6627, Pampulha, Cep: 31270-901, Belo Horizonte, MG, Brazil e-mail: [email protected] D.C. de Oliveira Instituto de Ciências Agrárias - ICIAG, UFU, Universidade Federal de Uberlândia, Av Amazonas, Campus Umuarama, Cep: 38400-902, Uberlândia, MG, Brazil

J.M. Mérillon and K.G. Ramawat (eds.), Plant Defence: Biological Control, Progress in Biological Control 12, DOI 10.1007/978-94-007-1933-0_11, © Springer Science+Business Media B.V. 2012

273

274

R.M. dos Santos Isaias and D.C. de Oliveira

morphologies, even when using the same host-plant morphogenetic potentialities [13, 21, 23, 50, 64, 78, 96, 97]. Even though more rare in nature, the same phytophagous species can induce morphologically similar galls in different host plants [50, 102], which is strong evidence that the galling herbivores control gall morphology [97]. The gall phenotype seems to be a product of a chemical battle between the host plant and the gall inducer [80], and is under the inﬂuence of both the insect and the plant genotypes [101]. Gall structure is currently understood as the extended phenotype of the gall inducer, but it is constructed by plant cells and must be constrained by their morphogenetical potentialities. A good example to reinforce this assumption is the comparison of two or more distinct gall morphotypes induced in the same host plant as was performed by Moura et al. [68] in Lantana camara. Moreover, as previously afﬁrmed by Rohfritsch [85] no new structure is induced and both galls repeat already existing patterns of the host plant morphogenetical program. This study also demonstrates that structural studies in galls are important to establish the ﬁrst steps towards physiological and ecological approaches, and also for the discovery of potential biological control as attested by Williams [104].

11.2

The Host Plant Choice

Plant structural features such as hairiness and sclerophylly may confer resistance or susceptibility to gall inductions [16, 31, 61, 105]. While sharp, long, non-glandular trichomes may function as mechanical defenses, glandular trichomes may synthesize secondary metabolites [17, 40] that may confer either chemical attractiveness or defense. Ligniﬁcation or suberiﬁcation of cell walls may constitute physical barriers but once potentialized in gall site, may also be useful in the defense against natural enemies. More than being capable of surpassing this kind of barriers, the gall inducer must ﬁnd an adequate host plant with suitable morphological and chemical characteristics. The host plant cells must be responsive so that a succession of recognizing systems between insect-plant, insect-organ and insect-tissue should take place [85]. Even though the system of recognition must be similar in nature, when different species of galling herbivores attack the same plant species, each one induces typical galls, because of distinct plant tissue reorganization. Two leaf galls on Lantana camara L. were reported by Moura et al. [68], one induced by Aceria lantanae (Cook) (Acarina: Eriophyidae) and the other by Schismatodiplosis lantanae (Rübsaamen) (Diptera: Cecidomyiidae). Aceria lantanae induces crinckle, uni- or multi-chambered galls with several mites, caused by several leaf folding. They consist basically of hyperplasic epidermis, and homogeneous parenchyma. Schismatodiplosis lantanae induces uni-chambered pouch galls inhabited by one larvae or pupa. These galls have a uniseriate epidermis, and hypertrophied spongy parenchyma. Both galls have small diverse oriented vascular bundles. The mode of feeding and the number of parasites per chamber should have inﬂuenced cell responses and consequently the distinct morphotypes generated. Other investigation on this superhost of galling herbivores focused on a group of individuals of Lantana camara (Verbenaceae) and found either structural or chemical differences

11

Gall Phenotypes – Product of Plant Cells Defensive Responses to the Inducers...

275

Fig. 11.1 The complex Lantana camara L. (Verbenaceae) has plants with pink (PF), white (WF) and red ﬂowers (RF). The plants with RF have denser trichomes, and are the only ones to bear gall inducers

that implied in the choice of the individuals with red ﬂowers (RF) as the host plants, in detriment of individuals with pink (PF) and white ﬂowers (WF) [70]. The RF group of plants had amphistomatic leaves, and the highest stomatal index on the abaxial surface, which the authors related to high rates of gas exchange under favorable conditions of water availability [29], increasing the maximum leaf conductance to CO2, photosynthetic capacity, and nutrient concentration [66]. These features may provide RF individuals with a better environment for the galling herbivores. Also, they have the lower density and major size of the non-glandular trichomes (Fig. 11.1) which may allow the attack of the diminute mites to ordinary epidermal

276

R.M. dos Santos Isaias and D.C. de Oliveira

cells [59, 103], and also form a barrier against their natural enemies and other potential competitive herbivores [12, 49, 57, 61, 105]. The absence of galls in the other groups of plants, i.e. those with the pink (PF) and white ﬂowers (WF) were related by Moura et al. [70] to the plants chemical contents, and higher density of trichomes, which constitute part of the ﬁrst line of resistance to herbivores, as reported for herbivores in general [18, 57, 61, 105]. Moura et al. [70] detected the monoterpenes, eucalyptol and limonene, referred as repellent to phytophagous mites [18, 89], just in the PF and WF groups. Moreover, the phytochemical proﬁles either in TLC or GC–MS analyses revealed differences that may justify the selection of the RF group as the host plants by A. lantanae. The volatile compounds as well as the sesquiterpenes detected should be used by phytophagous insects to locate the right host plant, as pointed out by Visser [99]. Another interesting issue on Lantana camara is that it is a superhost of galling herbivores even though it presents internal secretory idioblasts [67], full of terpenoid derivatives which have remarkable ecological functions due to their action against herbivores and pathogens. In addition, mono- and sesquiterpenes play a fundamental role in the attraction of pollinators as well as fruit and seed dispersers [28, 38, 39, 73]. The site of accumulation has an important inﬂuence on the effectiveness of a given antiherbivory substance [38], thus the presence of internal triterpenes secretory cells in leaves of L. camara could be related to the defense against chewing herbivores, but not against their associated guild of galling herbivores. These insects are so specialists that they can surpass or deal with this kind of chemical barrier.

11.3

Plant Gall Development

The comparative ontogenesis of the host leaves and their galls reveal which of the healthy tissues morphogenetic events are altered by the galling herbivore. Moura et al. [68] followed the leaf ontogenetical events of Lantana camara (Verbenaceae) and considered them similar to the patterns for leaf development described in literature. That is also true for other host plants such as Copaifera langsdorfﬁ [76], and Lonchocarpus muhelbergianus [77], both Fabaceae. All three plant tissue systems, dermall, ground and vascular, respond to the stimuli of gall induction, which generally causes hyperplasia of epidermis and ground system, and alteration in the organization of the vascular bundles. An invagination of the leaf lamina may give rise to a larval chamber which is commonly limited by a nutritive tissue where the inducers feeding activity stimulates cell divisions. It is common that from the growth and development until the maturation phase, the gall increase in size, either by hyperplasia or cell hypertrophy. Gall external covering may be glabrous or constituted by a high density of trichomes whose size and shapes are particular to each gall morphotype. The differentiation of emergencies and neoformation of vascular bundles may promote an increase in the ﬂux of food resources

11

Gall Phenotypes – Product of Plant Cells Defensive Responses to the Inducers...

277

to the gall site. Cell divisions in diverse angles alter the leaf laminar pattern ﬁrstly related to photosynthesis, and result in a variety of gall morphotypes which guarantee an adequate microenvironment and nutrition source to the galling herbivores. Sometimes, the senescent phase is characterized by the nutritive tissue suberization, which indicates the end of the feeding activity of the inducer. From the cytological point of view, the suberization as well as the ligniﬁcation of the nutritive or reserve tissues indicate the end of cell cycles, events that may be related to the emergence of the imago, or to the constraints imposed by the age of the host organ. The activity of the galling herbivores causes structural and biochemical alterations in the host plant tissues. Once gall structure confers protection and a suitable microenvironment, gall chemistry is driven towards nutrition and protection. Within the secondary metabolites, the phenolics are commonly referred to as defensive molecules [20, 47, 109] sometimes produced in response to environmental conditions [35]. However, they also function as signalizing molecules for cecidogenesis [44, 93], and have a great antioxidant potential, intensiﬁed by the production of reactive oxygen species (ROS) [81, 82]. The ROS play an important role in processes of growth, development, and either in response to biotic and abiotic stimuli [8]. According to Liu et al. [60], the ROS are important molecules in plant defense against pathogens, and was proved to be involved in the resistance to the Hessain ﬂy by wheat and rice plants. Further, Oliveira and Isaias [76] and Oliveira et al. [79] detected ROS in gall tissues by the histochemical test with 3-3’diaminobenzidine. These authors reported an increase in ROS production from young galls until senescence, and related it to oxidative stress, and cytological features. Even though the exact molecules responsible for the speciﬁc plant responses that culminate with gall formation are still unknown, the knowledge on gall development evolves in the direction of establishing an interaction between structural and chemical keys. Both kind of stimuli inﬂuence the maintenance of the life cycle of the galling herbivores, which is passed partially of totally inside plant tissues. The anatomical and histochemical analyses of healthy leaﬂets, immature and mature gall tissues of Lonchocarpus muehlbergianus [77] revealed anatomical features of the inducing action of Euphalerus ostreoides on the adaxial surface of the secondary veins. The lost of sinuosity of epidermal cells, the neoformation of trichomes, of conducting cells, and ﬁbres were the most conspicuous responses of L. muehlbergianus to gall induction. Mesophyll hyperplasia with maintenance of tissue stratiﬁcation, and accumulation of lipids, starch, ﬂavones, ﬂavonols and ﬂavanones in gall tissues were observed. A unique chemical response was detected in this system, the absence of oxonium salts in non galled tissues and its formation in galled ones. The authors reported that L. muehlbergianus was submitted to a high oxidative stress induced by the action of E. ostreoides. The structural and chemical alterations detected in this species were considered plant defensive responses against herbivory, and adaptive mechanisms that favor the galling insect establishment within plant tissues. The speciﬁcity of the galling insects to their host plant and organ are so strict that they are able to induce galls in only one or in a group of related host plant species [25, 46, 71, 97]. Through the induction of galls, the insects are capable of promoting morphogenetic changes in the host plant that are at ﬁrst directed against them, but

278

R.M. dos Santos Isaias and D.C. de Oliveira

that they afterwards manipulate and use for food or for shelter [26, 83, 85]. This is another indicative of the presence of a chemical battle inside the gall site, as proposed by Price et al. [80], because the galling insects are sensitive to discrete physiological, chemical, and phenological changes during their host plant development [34]. Consequently, the age of the tissues by the time of oviposition can alter the patterns of anatomical development and the adaptive value of the gall. The inﬂuence of the age of the host plant tissues by the time of oviposition was addressed in Copaifera langsdorfﬁi, a superhost for galling herbivores. This plant species has great morphogenetic potential, and responds differently to the stimuli of more than 20 gall-inducing insects [78]. Among these, an undescribed species of Cecidomyiidae induces a midrib gall in which a radial cecidogenetic ﬁeld is generated and the leaﬂet tissues redifferentiate [58]. In order to assess the amplitude of this cecidogenetic ﬁeld in which the leaﬂet tissues were inﬂuenced by the feeding action of the cecidomyiid, Oliveira and Isaias [75] described how the ﬁnal gall shape was generated; and the adaptive value that the redifferentiation of the cells conferred to the galling herbivore. Cell divisions occurred on the abaxial surface of the epidermis; the spongy parenchyma originated the reserve tissue, the secretory structures, and the vascular bundles; the cells of the palisade parenchyma became homogeneous; and the adaxial epidermis originated the nutritive tissue. These authors deﬁned that cell elongation is a necessary step towards cell redifferentiation, and also that this event may be triggered by an increase in water transport to the gall site and vacuole pressure due to neoformed xylem strands. The generation of the ﬁnal shape of the midrib gall involved repetitive histological steps in response to the amplitude of the cecidogenetic ﬁeld. The largest impact of the cecidomyiid feeding action occurred in gall tissues redifferentiated from protoderm and adaxial ground meristem, which provided advantages to the gall inducer of the midrib galls in C. langsdorfﬁi in terms of nutritional value, microenvironment, and protection against natural enemies.

11.4

Cytological and Histochemical Symptoms

The process which results in gall development involves a series of events since the recognition of the host plant by the gall inducer until gall induction itself. This process depends on mechanical or chemical stimuli whose origin is the gall inducer and the target is one or a few plant cells [62]. During this ﬁrst event in gall formation, the cell or group of cells lose their normal pattern of development in the host organ [55, 62, 69, 76], in a redifferentiation process [57, 76]. The cells which have their ontogenetical course changed are physiologically modiﬁed, and become the initial cells of the gall. The ﬁrst responses of these cells are hyperplasia and hypertrophy [4, 62, 68, 76, 85, 94]. These responses occur easier in young tissues which have a greater capacity for cell division [85], and consequently may respond promptly to the stimuli of the gall inducers [85, 101]. Nevertheless, this is not an exclusive condition, for all plant tissues with live protoplast may redifferentiate and produce galls, a new structurally and physiologically plant organ [42, 62].

11

Gall Phenotypes – Product of Plant Cells Defensive Responses to the Inducers...

279

The midrib gall of Copaifera langsdorfﬁi may be induced either in young or mature tissues [75]. This trait may also be observed in other host plant species such as Piptadenia gonoacantha (Mart.) J.F. Macbr. [4], and Ficus microcarpa L. f. (Moraceae) [94]. So, the age of the host organ may impose crucial constraints that confer distinct adaptive responses during gall formation. More than just cell hypertrophy and tissue hyperplasia, the inhibition of some developmental programs and cytological changes occur during the development of galls [62]. These mechanisms of cell inhibition or development may be related to changes in the hormonal balance under the continuous inﬂuence of the feeding activity of the galling herbivore in plant tissues [36, 43]. The concentration of hormones is generally greater in young tissues than in mature ones [15], what should explain why young tissues are more responsive to the stimuli of the gall inducers than mature ones. According to Oliveira and Isaias [75], when the induction of the midrib galls occur in young leaﬂets of C. langsdorfﬁi, the tissues confer nutritional advantages due to the higher number of cell layers in the reserve tissue. Nevertheless, when the induction occurs in mature tissues, the cell cycles are shorter, the nutritive layers are reduced, and some cell layers lignify. During the ﬁrst phase of gall formation, the induction, the host plant may develop strong defensive mechanisms which end up in the elimination of the gall inducer. These mechanisms, in general, may be related to the formation of ROS. The ROS triggers a cascade of cell responses which activate a hypersensitivity response (HR), a mechanism used by the host plant to counterattack pathogens, in general [24, 32, 33, 76, 87, 108]. The HR is a located resistance mechanism which takes place around the sites of oviposition, feeding or entrance of the larvae in plant tissues. This response causes morphological, histological, and cytological changes in the host plant tissues leading to the cell death, and consequently to the elimination of the gall inducer [32]. The HR is generally observed as a brown spot around the site of gall induction (Fig. 11.2), and may be considered as the main mortality factor of the herbivores that attack rice, wheat and beans [11, 37, 92]. On the other hand, the formation of ROS and consequently the cell death, events preceding the HR, are considered common in plant tissues. So, the localized response is a normal event in plant organogenesis, therefore cell death may act as a mechanism which favors the establishment of the gall inducer [79]. The phase of induction precedes the phase of growth and development, which is characterized by a gain in biomass, and an increase in cell divisions and redifferentiation. In this phase the formation of the typical tissues of the gall occur [55, 62, 76, 85], the morphogenetical cell patterns change, and the three plant tissue systems lose their original functions and turn into the specialized tissues of the galls. According to Stone and Schönrogge [97], external structures of the new organ, the gall, may be related to a defense against herbivory, while the diversiﬁcation of internal structures is probably related to an increase in nutritional supply. In the midrib galls of C. langsdorfﬁi, there is an increase in the number of cell layers in galls induced in young tissues when compared to the galls induced in mature ones. This increase in cell layers may confer protection to the gall inducer. On the other hand, galls induced in mature leaﬂets have ligniﬁed layers in the outer cortex, confering protection against natural enemies. Therefore, the age of the host organ may impose constraints

280

R.M. dos Santos Isaias and D.C. de Oliveira

Fig. 11.2 Hypersensitive response (HR) is a located resistance mechanism which takes place around the site of oviposition. The HR is generally observed as a brown spot, and may be considered as the main mortality factor for galling herbivores. It may block the development of the galls in their ﬁrst phases. In Copaifera langsdorfﬁi, a superhost of galling herbivores the HR seems to be a natural mechanism of biological control of gall inducers population

to the anatomical development of the gall inﬂuencing the adaptive value of the gall to the gall inducer [75]. A superhost for galling herbivores such as C. langsdorfﬁi constitutes an ideal model system to study gall developmental patterns. The alterations of its tissues during the establishment of each gall inducer and the formation of each gall morphotype may shed lights on the intimate relationships between the organisms involved. Also, it must be inferred that the generation of one or more cecidogenetic ﬁelds redirects auxin ﬂux to the gall site, and as a consequence, the fates of the host– plant cells are altered. In this context, the differentiation and redifferentiation of these cells may reveal the origins and pathways of the peculiar cells involved in the deﬁnition of the shapes and the variability of C. langsdorfﬁi gall morphotypes. This is particularly relevant to the discussion of hypotheses regarding nutritional, microenvironmental, and enemy effects [97], as well as a way of demonstrating the adaptation to gall-inducing agents, based on a new functional design. The new design of the galls in comparison to that of their host organs are supposed to be a product of alterations in the pattern of microtubules organization, which govern the orientation of the cellulose microﬁbrils in the cell wall. This orientation regulates the ﬁnal shape and pattern of cell elongation [9], and as is true for plant organs [74, 95], the direction of cell elongation plays a key role in the determination of gall morphology (Fig. 11.3). It was also demonstrated by distinct sites of cell hypertrophy and tissue hyperplasia during the development of

11

Gall Phenotypes – Product of Plant Cells Defensive Responses to the Inducers...

281

Fig. 11.3 Hypothetical development of the leaf gall on Lecytis lanceolata. The patterns of cell elongation have changed to originate the new functional design. The leaf tissues layers are not adapted for photosynthesis but to protect and nurture the galling herbivore. [The circles and arrows indicate the relative cell dimensions and axis of elongation]

galls in the Neotropics [5, 68, 77, 94], as well as in the temperate zone [3, 14, 65, 85]. The midrib galls of C. langsdorfﬁi represent the ﬁrst object of ontogenetic study in this superhost model system, and reveal crucial developmental steps in gall systems. Leaﬂet folding occurs because the cecidogenetic ﬁeld generates more conspicuous hyperplasia and hypertrophy at the opposite site of gall induction, corroborating previous observations [85, 101]. Even though tissue zonation is maintained until maturation, the fates of all leaﬂet tissues are altered during gall development. The phase of maturation of the gall is the main trophic phase of the insect, when it actively feeds in a mass of the nutritive cells located around the larval chamber and/or in the contents translocated from the reserve tissue, located at the outer cortex [14, 55]. In general, it is in this phase that a cytological gradient towards the larval chamber is established in the gall. The most external cells of the gall cortex are more hypertrophied than those located next to the larval chamber. The cells next to the gall inducer may present a high metabolic activity, with dense cytoplasm, a great amount of mitochondria, fragmented vacuole, and large nucleus. This metabolic gradient is crucial for the establishment of a cytological gradient towards the larval chamber [76, 79, 97]. Also, the interaction of the metabolic gradient with the cytological one in gall tissues plays an important role in the deﬁnition of the ﬁnal gall phenotype. Another important trait of gall development is the increase in cell volume, which is also true for plant organogenesis, in general [74]. Therefore, the large vacuoles, with large amounts of water and other substances, are also of extreme relevance for the growth and establishment of the ﬁnal shape of the galls. In this perspective, histometric analyses related to the morphogenesis from healthy leaﬂet until gall senescence are important to quantitatively comprehend the histological patterns involved in the ﬁnal gall morphotype. Current analysis supports the close relationship between storage tissue development and the morphology of the midrib gall of C. langsdorfﬁi [76].

282

11.5

R.M. dos Santos Isaias and D.C. de Oliveira

Substances Related to Nutrition and Defense

Some tissue layers of the gall accumulate substances which may be used for the nutrition of the galling herbivore, in the reserve and the nutritive tissues [14]. The substances accumulated in these tissues depend on the taxa and feeding habit of the galling herbivore [85]. In general, the galls induced by Cecidomyiidae accumulate starch in the reserve tissue, and sugars and / or proteins in the nutritive one. Also, in these galls, there is no formation of a cytological and histochemical gradient, even though they have the greatest morphological and physiological diversity [14]. Moreover, the more systems are studied more exceptions appear. Galls induced by Schismatodiplosis lantana (Cecidomyiidae) in Lantana camara (Verbenaceae) have lipids in the nutritive tissue [68], while galls induced by an unidentiﬁed species of Cecidomyiidae in Aspidosperma spruceanum accumulate starch in the nutritive tissue [76]. This contradicts the common sense for the accumulation of lipids in galls induced by Cynipidae [14]. In the neotropical region, this reserve substance was also detected in the galls induced by Cecidomyiidae and Psyllidae [68, 77]. Other than accumulation of nutrients, the tissues of the galls are said to accumulate defensive or toxic compounds. If these substances are detected in the outer cortex, they may turn into a defense against natural enemies. The class of phenolics is commonly investigated and detected in galls [35, 56, 68, 77, 94]. As the chemical properties of galls may differ from that of their host plants or organs [30, 72], it is assumed that they may be controlled by the herbivores. This may be especially true the closer are the tissue layers to the gall inducer, what can be histochemically demonstrated. Moreover, by the study of the ontogenesis of the galls, it is possible to establish the origin of the tissue layers, which may imply in their functions. The accumulation of nutritive compounds as well as of toxic ones may be restricted to speciﬁc sites. Nyman [71] suggests that the chemical analysis of gall chemical traits should consider different parts of the galls and individual compounds rather than the whole gall and total classes of compounds.

11.6

The Chemical Battle

The deﬁnition of the galls as extended phenotype of their galling inducers implies that the reactions are orchestrated by the gall inducer. The reaction of plant cells are not commonly taken into consideration, even though a complex organism like a plant should not be passively attacked without any reaction. It seems difﬁcult to believe that there was no signal plant molecules involved in the formation of such a diversity of structures. Nowadays it seems clear that several peculiarities of galls have evolved in response to mechanical or chemical stimuli from the galling herbivore but that the plant takes its part in the process. Some early theories on gall induction defended that the gall was a defensive strategy of the host plant. Therefore, Cornell [19] have proposed that gall formation is a result of the gall inducer manipulation of the host plant potentialities, and an

11

Gall Phenotypes – Product of Plant Cells Defensive Responses to the Inducers...

283

interaction of the chemistry of the insect and that of the plant dealing together. According to Hori [45], the phenolics that commonly accumulate in gall tissues and growth stimulators, such as auxins and citokinins interact. Phenolics are commonly detected in responsive tissues at the time of oviposition or the beginning of larvae feeding. Just in sequence, the cells around this site start to divide and grow. So, the ﬁrst molecules involved in gall induction seem to be related to the balance phenolicsauxin. Later on, there is a topographical division between the sites of accumulation of nutrients [1, 48, 91] and defensive compounds [41, 72]. The ﬁrst accumulate in cell layers next to the larval chambers, and the latter in the outer cortex of the gall. This kind of division is important and can be conﬁrmed by histochemical techniques [72]. In fact, some phenolic compounds decline in nutritive tissues during gall formation [63], whereas in others, the insects have the ability to block the unpalatability of these substances, and so they may spread all over the gall. In fact, Rohfritsch and Shorthouse [86], and Cornel (1983) afﬁrmed that this kind of substances could be deleterious to the herbivores, and concentrate externally to the nutritive tissue. The positioning of the chemical defensives in the outer cortex may be crucial for the relationships with the other members of the guild involved in each gall system [97]. Of course this is not the only strategy to discourage the natural enemies. Some species accumulate high levels of biochemical defensive compounds, or present some morphological defensive features; others do not accumulate defensive compounds, and minimize herbivore damage by rapid growth and development, dispersion, or choice of habitat [97]. The chemistry of the gall may lead to mechanical defenses, such as ligniﬁed or resiniferous cells forming a physical barrier, or the accumulation of deterrents for feeding or egg deposition, or even toxins. The range of mechanisms shown by different plant is very wide. It may include cytological reponses, such as membrane disruption, inhibition of transport or signal transduction, of metabolism, and even disruption of hormonal control of developmental processes [10]. Also, plants can be supplied with a system of biochemical hydrogen peroxide generation (glucose oxidase plus glucose) or even up-regulation of genes encoding defensive proteins, whose role in signaling is to be proved yet [106, 107]. Moreover, as pointed out by Stone and Schonrögge [97], there are many challenges in identifying the molecules involved in gall formation. It is not simple to capture and create such diminutive insects. The necessary bioassays, and accompanying of the insect’s behavior is complex either in ﬁeld or green house conditions. Commonly, it is possible to report one step but not the whole of gall development, speciﬁcally in the microscopic level. The signal molecules used as gall inducing stimuli are similar to those acting in normal plant morphogenesis. Also, it is a great challenge to separate the primary stimuli from the secondary ones, as pointed out by Stone and Schönrogge [97]. In the perspective of understanding the microscopic developmental basis of gall morphology, some authors have been addressing the patterns of some gall systems. Their focus is on the peculiarities within and between gall morphotypes. Further, it will be possible to reveal the extent to which each galling taxa exploits host plant or even the superhosts developmental pathways. This will set lights on the patterns involved in gall formation with the aid of histochemical, cytochemical, and immunocytochemical analyzes.

284

11.7

R.M. dos Santos Isaias and D.C. de Oliveira

Revisiting the Aspidosperma australe System

The formation of a histochemical gradient is generated in one or in all of the developmental phases of the gall [14, 68, 76, 79, 90]. It is also dependent of the feeding habit of the galling herbivores. The establishment of a histochemical gradient is followed by the formation of a cytological gradient [76, 79], and, depending on the feeding habit of the insect, specialized nutritive cells may differentiate [14]. These gradients have been reported for galls induced by Cecidomyiidae and Cynipidae, while those induced by phloem sucking feeding insects do not accumulate reserve substances, and, consequently do not develop a nutritive tissue. Due to the diversity of galls induced by sucking insects in the Neotropics [27], histochemical, histological and cytological analyses of their systems have been currently addressed [3, 76, 77, 79]. Even though the feeding site of these insects is frequently restrict to phloem, cytological and histochemical gradients have been reported. In galls induced by Euphalerus ostreoides (Psyllidae) in Lonchocarpus muelhbergianus (Fabaceae), there is an accumulation of starch and lipids in the most internal cell layers of the gall, even if the insect does not directly use these nutrients. In this system, the histochemically detected accumulation of nutrients was related to the maintenance of the gall structure [77]. Starch was also detected in galls of Pistacia terebinthus induced by sucking insects [3]. In another system, Aspidosperma australe – Pseudophacopteron sp., the starch was detected in the cells next to the nymphal chamber, in a centrifugous gradient [76]. So, it was proposed that the formation of a histochemical gradient and the accumulation of starch might be a pattern for galls induced by sucking insects. Galls of A. australe has cytological features similar to those induced by Cecidomyiidae as described by Bronner [14]. The cells next to the nymphal chamber have large nucleus, conspicuous nucleolus, fragmented vacuole, numerous mitochondria, and dense cytoplasm [76], typical features of a nutritive tissue. The most external layers of these galls have a reserve tissue whose cells have amiloplasts, chloroplasts with starch grains, plastoglobules, and large vacuoles. The presence of a chlorophyllian tissue in the most external cell layers indicates the photosynthetic capacity of this tissue, even though the gall tissue is under a high oxidative stress [76]. The photosynthetic apparatus is not damaged, and the electron transport rate is maintained. The recovering and protection of the PSII, and consequent maintenance of the relative electron transport rate was related to the presence of plastoglobules [79]. The plastoglobules are lipidic corpuscules of mixed nature, developed inside the chloroplasts, and which may have the function of recovering the membrane systems of the tylakoid [7]. A diagnostical cytological feature of the production of reactive oxygen species (ROS), and consequent stress in gall tissues is the formation of plastoglobules in the chloroplasts. This production of ROS is attributed to the feeding activity of the galling insect, and leads to a cascade of cell events which may be responsible for the formation of the histochemical and cytological gradients. The production of ROS causes damages to the membrane systems, and consequently leads to cell death in

11

Gall Phenotypes – Product of Plant Cells Defensive Responses to the Inducers...

285

senescent galls. During this phase of gall development, the membrane of thylakoids are the ﬁrst to degrade, followed by the mitochondria, and the membrane that involves the tylakoids [54, 76]. The histochemical and cytological gradient may be related to the metabolism of carbohydrates. These gradients and the accumulation of carbohydrate may have a crucial role in the structural development of the galls, in the maintenance of cell machinery, and in signalizing, especially during the establishment of the histochemical gradient. The activity of two enzymes, the sucrose synthase and the invertases, may help in understanding gall metabolism. The sucrose synthase catalyzes the reversible breakdown of the sucrose to fructose and UDP-glucose, taking part mainly in the processes which involve maturation of plant organs, accumulation of starch, and synthesis of callose [6, 52, 88, 98], and also in several polysacharides of the cell wall [2, 22]. The invertases catalyze the irreversible reactions of sucrose to glucose and frutose, and its activity is associated to the establishment of strong physiological sinks [51, 53, 84]. The formation of sites of cell division, expansion and respiration is associated to the high activity of invertases [52, 84]. The products of the breakdown of sucrose by the invertases take part in the biosynthesis and signalizing of hormones, such as ABA, IAA and cytokinins [52, 100]. Bronner [14] showed the importance of the activity of this enzyme for the accumulation of nutrients in the nutritive tissue of galls induced by Cynipidae and Cecidomyiidae. Generally, the activity of these enzymes is related to growth and development of galls mediated by the stress generated by the feeding activity of the galling herbivores. The effect of the feeding activity of Pseudophacopteron sp. provokes an increase in the production of ROS, and consequently alters the metabolism of A. australe during gall development. This stress may be responsible for the formation of a histochemical and cytological gradient towards the larval chamber. Also, the accumulation of starch and the enzymatic activity related to the metabolism of sugars in this system may be indicative of a pattern of accumulation of reserves in galls of sucking insects.

References 1. Abrahamson WG, Mc Crea KD (1985) Seasonal nutrient dynamics of Solidago altissima (Compositae). Bull Torr Bot Club 112:414–420 2. Albrecht G, Mustroph A (2003) Localization of sucrose synthase in wheat roots: increased in situ of sucrose synthase correlates with cell wall thickening by cellulose deposition under hypoxia. Planta 217:252–260 3. Álvarez R, Encina A, Pérez Hidalgo N (2009) Histological aspects of three Pistacia terebinthus galls induced by three different aphids: Paracletus cimiciformis, Forda marginata and Forda formicaria. Plant Sci 176:133–144 4. Arduin M, Kraus JE (1995) Anatomia e ontogenia de galhas foliares de Piptadenia gonoacantha (Fabales, Mimosaceae). Bol Bot Univ São Paulo 14:109–130 5. Arduin M, Fernandes GW, Kraus JE (2005) Morphogenesis of galls induced by Baccharopelma dracunculifoliae (Hemiptera: Psyllidae) on Baccharis dracunculifolia (Asteraceae) leaves. Braz J Biol 65:559–571

286

R.M. dos Santos Isaias and D.C. de Oliveira

6. Asano T, Kunieda N, Omura Y, Ibe H, Kawasaki T, Takano M, Sato M, Furuhashi H, MujinvT TF, Wu C, Tada Y, Satozawa T, Sakamoto M, Shimada H (2002) Rice SPK, a calmodulin-like domain protein kinase, is required for storage product accumulation during seed developmental: phosphorylation of sucrose synthase is a possible factor. Plant Cell 14:619–628 7. Austin JT, Frost E, Vidi PA, Kessler F, Staehlin A (2006) Plastoglobules are lipoprotein subcompartments of the chloroplast that are permanently coupled to thylakoid membranes and biossynthetic enzymes. Plant Cell 18:1693–1703 8. Bailey-Serres J, Mittler R (2006) The roles of reactive oxygen species in plant cells. Plant Physiol 141:311 9. Baskin TI (2001) On the alignment of cellulose microﬁbrils by cortical microtubules: a review and a model. Protoplasma 215:150–171 10. Bennett RN, Wallgrosve RM (1994) Secondary metabolites in plant defence mechanisms. New Phytol 127:617–633 11. Bentur JS, Kalode MB (1985) Natural enemies of rice leaf and plant-hoppers in Andhra Pradesh. Entomology 10(4):271–274 12. Bernays EA, Chapman RF (1994) Hostplant selection by phytophagous insects. Chapman & Hall, London 13. Boczek J, Grifﬁts DA (1994) Structure and systematics of eriophyid mites (Acari: Eriophyoidea) and their relationship to host plants. In: Williams MAJ (ed.) Plant galls, systematics association special volume, 49. Clarendon, Oxford 14. Bronner R (1992) The role of nutritive cells in the nutrition of cynipids and cecidomyiids. In: Shorthouse JD, Rohfritsch O (eds.) Biology of insect induced galls. Oxford University Press, Oxford 15. Buchanan BB, Gruissem W, Jones RL (2000) Biochemistry and molecular biology of plants. American Society of Plant Physiologists, Rockville 16. Chen M (2008) Inducible direct plant defense against insect herbivores: a review. J Insect Sci 15:101–114. doi:10.1111/j.1744-7917.2008.00190.x 17. Chen H, Gonzales-Vigil E, Wilkerson CG, Howe GA (2007) Stability of plant defense proteins in the gut of insect herbivores. Plant Physiol 143:1954–1967 18. Cook SP (1992) Inﬂuence of monoterpene vapors on spruce spider mite, Oligonychus ununguis, adult females. J Chem Ecol 18:1497–1504 19. Cornell HV (1983) The secondary chemistry and complex morphology of galls formed by the Cynipinae (Hymenoptera): why and how? Am Midl Nat 110:225–234 20. Coruh S, Ercisli S (2010) Interactions between galling insects and plant total phenolic contents in Rosa canina L. genotypes. Sci Res Essay 5(14):1935–1937 21. Crespi BJ, Worobey M (1998) Comparative analysis of gall morphology in Australian gall thrips: the evolution of extended phenotypes. Evolution 52:1686–1696 22. Doblin MS, Kurek I, Jacob-Wilk D, Delmer DP (2002) Cellulose biosynthesis in plants: from genes to rosette. Plant Cell Physiol 43:1407–1420 23. Dodson G (1991) Control of gall morphology: tephritid gallformers (Aciurina spp.) on rabbitbrush (Chrysothamnus). Ecol Entomol 16:177–181 24. Doke N, Miura Y, Sanchez LM, Park H-J, Noritake T, Yoshokawa H, Kawakita K (1996) The oxidative burst protects plants against pathogen attack: mechanism and role as an emergency signal for plant bio-defense. Gene 179:45–51 25. Dreger-Jauffret F, Shorthouse JD (1992) Diversity of gall-inducing insects and their galls. In: Shorthouse JD, Rohfritsch O (eds.) Biology of insect-induced galls. Oxford University Press, New York 26. Edwards PJ, Wratten SD (1981) Ecologia das interações entre insetos e plantas. EDUSP, São Paulo 27. Espírito-Santo MM, Fernandes GW (2007) How many species of gall-inducing insects are there on earth, and where are they? Ann Entomol Soc Am 100:95–99 28. Fahn A (1979) Secretory tissues in plants. Academic, London 29. Fahn A (1990) Plant anatomy, 4th edn. Pergamon, New York 30. Feeny PP (1970) Seasonal changes in oak leaf tannins and nutrients as a cause of spring feeding by winter moth caterpillars. Ecology 51:565–581

11

Gall Phenotypes – Product of Plant Cells Defensive Responses to the Inducers...

287

31. Fernandes GW (1994) Plant mechanical defenses against insect herbivory. Revta Bras Entomol 38(2):421–433 32. Fernandes GW, Cornelissen TG, Isaias RMS, Lara ACF (2000) Plants ﬁght gall formation: hypersensitivity. Cienc Cult 52:49–54 33. Fernandes GW, Duarte H, Lüttge U (2003) Hypersensitivity of Fagus sylvatica L. against leaf galling insects. Trees 17:407–411 34. Floate KD, Fernandes GW, Nilsson JA (1996) Distinguishing intrapopulational categories of plants by their insect faunas: galls on rabbitbrush. Oecologia 105:221–229 35. Formiga AT, Gonçalves SJMR, Soares GLG, Isaias RMS (2009) Relação entre o teor de fenóis totais e o ciclo das galhas de Cecidomyiidae em Aspidosperma spruceanum Müll. Arg. (Apocynaceae). Acta Bot Bras 23:93–99. doi:10.1590/S0102-33062009000100012 36. Fosket DE (1994) Plant growth and development: a molecular approach. Academic, San Diego 37. Garza R, Vera J, Cardona C, Barcenas N, Singh SP (2001) Hypersensitive response of beans to Apion godmani (Coleoptera: Curculionidae). Environ Entomol 94:958–962 38. Gershenzon J, Croteau R (1991) Herbivores: their interaction with secondary plant metabolites. Academic, San Diego 39. Gottlieb OR, Salatino A (1987) Funções e evolução dos óleos essenciais e de suas estruturas secretoras. Ciênc Cult 39:707–716 40. Gottlieb OR, Kaplan MAC, Borin MRMB (1996) Biodiversidade. Um Enfoque QuímicoBiológico. Editora UFRJ, Rio de Janeiro 41. Harborne JB (1988) Phytochemical methods: a guide to modern techniques of plant analysis. Chapman & Hall, London 42. Harper LJ, Schönrogge K, Lim KY, Francis P, Lichtenstein CP (2004) Cynipid galls: insectinduced modiﬁcations or plant development create novel plant organs. Plant Cell Environ 27:327–335 43. Hartley SE (1998) The chemical composition of plant galls: are levels of nutrients and secondary compounds controlled by the gall-former? Oecologia 113:492–501 44. Hartley SE (1999) Are gall insects large rhizobia? Oikos 84:333–342 45. Hori K (1992) Insect secretions and their effect on plant growth, with special reference to hemipterans. In: Shorthouse JD, Rohfritsch O (eds.) Biology of insect-induced galls. Oxford University Press, Oxford 46. Inbar M, Wink M, Wool D (2004) The evolution of host plant manipulation by insects: molecular and ecological evidence from gall-forming aphids on Pistacia. Mol Phylogenet Evol 32:504–511 47. Isaias RMS, Soares GLG, Christiano JCS, Gonçalves SJM (2000) Análise comparativa entre as defesas mecânicas e químicas de Aspidosperma australe Müell. Arg. e Aspidosperma cylindrocarpon Müell. Arg. (Apocynaceae) contra herbivoria. Florest Ambient 7(1):19–30 48. Jankiewicz LS, Plich H, Antoszewski R (1970) Preliminary studies on the translocation of 14C-Iabelled assimilates and 32P03- towards the gall evoked by Cynips (Diplolepis) quercus-folii L. on oak leaves. Marcellia 36:163–172 49. Johnson HB (1975) Plant pubescence: an ecological perspective. Bot Rev 41:233–258 50. Kane NA, Jones CS, Vuorisalo T (1997) Development of galls on leaves of Alnus glutinosa and Alnus incana (Betulaceae) caused by the Eriophyes laevis (Nalepa). Int J Plant Sci 158:13–23 51. Koch K (1996) Carboydrate-modulated gene expression in plants. Annu Rev Plant Physiol Plant Mol Biol 47:509–540 52. Koch K (2004) Sucrose metabolism: regulatory mechanisms and pivotal roles in sugar sensing and plant development. Curr Opin Plant Biol 7:235–246. doi:10.1016/j.pbi.2004.03.014 53. Koch KE, Zeng Y (2002) Molecular approaches to altered C partitioning: gene for sucrose metabolism. J Am Soc Hortic Sci 127:474–483 54. Kolodziejek I, Koziol J, Waleza M, Mostowska A (2003) Ultrastructure of mesophyll cells and pigment content in senescing of maize and barley. J Plant Growth Regul 22:217–227 55. Kraus JE (2009) Galhas: morfogênese, relações ecológicas e importância econômica. In: Tissot-Squalli ML (ed.) Interações ecológicas & biodiversidade. Editora Unijuí, Ijuí

288

R.M. dos Santos Isaias and D.C. de Oliveira

56. Kraus JE, Arduin M, Venturelli M (2002) Anatomy and ontogenesis of hymenopteran leaf galls of Struthanthus vulgaris Mart. (Loranthaceae). Revta Bras Bot 25:449–458 57. Levin DA (1973) The role of trichomes in plant defense. Q Rev Biol 48:3–15 58. Lev-Yadun S (2003) Stem cells in plants are differentiated too. Curr Top Plant Biol 4:93–102 59. Lindquist EE, Oldﬁeld GN (1996) Evolution of eriophyoid mites in relation to their host plants. In: Lindquist EE, Sabelis MW, Bruin J (eds.) Eriophyoid mites their biology, natural enemies and control. Elsevier Science Publisher, Amsterdam 60. Liu Z, Lin H, Ye S, Liu Q, Meng Z, Zhang C, Xia Y, Margoliash E, Rao Z, Liu X (2006) Remarkably high activities of testicular cytochrome c in destroying reactive oxygen species and in triggering apoptosis. Proc Natl Acad Sci USA 103(24):8965–8970 61. Lucas PW, Turner IM, Dominy NJ, Yamashita N (2000) Mechanical defences to herbivory. Ann Bot 86:913–920 62. Mani MS (1964) Ecology of plant galls. W Junk, The Hague 63. Meyer J (1957) Cécidogenêse comparée de quelques gal1es d’arthropodes et évolution cytologique des tissus nouriciers. Thesis, University of Strasbourg, Strasbourg 64. Meyer J (1987) Plant galls and gall inducers. Gebrüder Borntraeger, Berlin 65. Meyer J, Maresquelle HJ (1983) Anatomie des galles. Gerbrüder Borntraeger, Berlin 66. Mott KA, Gibson AC, O’leary JW (1982) The adaptive signiﬁcance of amphistomatic leaves. Plant Cell Environ 5(6):455–460 67. Moura MZD, Isaias RMS, Soares GLG (2005) Ontogenesis of internal secretory cells in leaves of Lantana camara L. (Verbenaceae). Bot J Linn Soc 148:427–431 68. Moura MZD, Isaias RMS, Soares GLG (2008) Species-speciﬁc changes in tissue morphogenesis induced by two arthropod leaf gallers in Lantana camara L. (Verbenaceae). Aust J Bot 56:153–160 69. Moura MZD, Soares GLG, Isaias RMS (2009) Ontogênese da folha e das galhas induzidas por Aceria lantanae Cook (Acarina: Eriophyidae) em Lantana camara L. (Verbenaceae). Revta Bras Bot 32(2):271–282 70. Moura MZD, Alves TMA, Soares GLG, Isaias RMS (2009) Intra-speciﬁc phenotypic variations in Lantana camara leaves affect host selection by the gall maker Aceria lantanae. Biochem Syst Ecol 37:541–548 71. Nyman T (2000) Phylogeny and ecological evolution of gall-inducing sawﬂies (Hymenoptera: Tenthredinidae). PhD dissertations in Biology. University of Joensuu, Joensuu 72. Nyman T, Julkunen-Tiitto R (2000) Manipulation of the phenolic chemistry of willow by gall-inducing sawﬂies. Proc Natl Acad Sci USA 97(24):13184–13187 73. Paré PW, Tumlinson JH (1999) Plant volatiles as a defense against insect herbivores. Plant Physiol 121:325–331 74. Obroucheva NV (2008) Cell elongation as an inseparable component of growth in terrestrial plants. Russ J Dev Biol 39:13–24 75. Oliveira DC, Isaias RMS (2009) Inﬂuence of leaﬂet age in anatomy and possible adaptive values of the gall of Copaifera langsdorfﬁi (Fabaceae: Caesalpinioideae). Revta Biol Trop 57:293–302 76. Oliveira DC, Isaias RMS (2010) Cytological and histochemical gradients induced by a sucking insect in galls of Aspidosperma australe Arg. Muell (Apocynaceae). Plant Sci 178:350–358 77. Oliveira DC, Christiano JCS, Soares GLG, Isaias RMS (2006) Reações de defesas químicas e estruturais de Lonchocarpus muehlbergianus Hassl. (Fabaceae) à ação do galhador Euphalerus ostreoides Crawf. (Hemiptera: Psyllidae). Revta Bras Bot 29:657–667 78. Oliveira DC, Drummond MM, Moreira ASFP, Soares GLG, Isaias RMS (2008) Potencialidades morfogênicas de Copaifera langsdorfﬁi Desf. (Fabaceae): super-hospedeira de herbívoros galhadores. Revta Biol Neotrop 5:31–39 79. Oliveira DC, Magalhães TA, Carneiro RGS, Alvim MN, Isaias RMS (2010) Do Cecidomyiidae galls of Aspidosperma spruceanum (Apocynaceae) ﬁt the pre-established cytological and histochemical patterns? Protoplasma 242:81–93

11

Gall Phenotypes – Product of Plant Cells Defensive Responses to the Inducers...

289

80. Price PW, Fernandes GW, Waring GL (1987) Adaptive nature of insect galls. Environ Entomol 16:15–24 81. Queiroz CGS, Alonso A, Mares-Guia M, Magalhães AC (1998) Chilling-induced changes in membrane ﬂuidity antioxidant enzyme actives in Coffea arabica L. roots. Biol Plant 41:403–413 82. Rao MV, Paliyath G, Ormond DP (1996) Ultraviolet-B and ozone-induced biochemical changes in antioxidant enzymes of Arabidopsis thaliana. Plant Cell 8:1809–1819 83. Redfern M, Askew RR (1992) Plant galls. The Richmond Publishing, Slough 84. Rehill BJ, Schultz JC (2003) Enhanced invertase activities in the galls of Hormaphis hamamelidis. J Chem Ecol 29:2703–2720 85. Rohfritsch O (1992) Patterns in gall development. In: Shorthouse JD, Rohfritsch O (eds.) Biology of insect-induced galls. Oxford University Press, New York 86. Rohfritsch O, Shorthouse J (1982) Insect galls. In: Kahls G, Schell J (eds.) Molecular biology of plant tumors. Academic, New York 87. Rossetti S, Bonatti PM (2001) In situ histochemical monitoring of ozone- and TMV-induced reactive oxygen species in tobacco leaves. Plant Physiol Biochem 39:433–442 88. Salnikov VV, Grimson MJ, Seagull RW, Haigler CH (2003) Localization of sucrose synthase and callose in freeze substituted secondary wall stage cotton ﬁbers. Protoplasma 221:175–184 89. Sánchez-Ramos I, Castañera P (2000) Acaricidal activity of natural monoterpenes on Tyrophagus putrescentiae (Schrank), a mite of stored food. J Stored Prod Res 37:93–101 90. Schönrogge K, Harper LJ, Lichtenstein CP (2000) The protein content of tissue in cynipid galls (Hymenoptera: Cynipidae): similarities between cynipid galls and seeds. Plant Cell Environ 23:215–222 91. Shannon RE, Brewer JW (1980) Starch and sugar levels in 3 coniferous insect galls. J Appl Entomol 89:526–533 92. Shukle RH, Grover PB Jr, Mocelin G (1992) Responses of susceptible and resistant wheat associated with Hessian ﬂy (Diptera: Cecidomyiidae) infestation. Environ Entomol 21:845–853 93. Soares GLG, Isaias RMS, Gonçalves SJMR, Christiano JCS (2000) Alterações químicas induzidas por coccideos galhadores (Coccoidea, Brachyscelidae) em folhas de Rollinia laurifolia Schdtl. (Annonaceae). Revta Bras Zool 2:103–116 94. Souza SCPM, Kraus JE, Isaias RMS, Neves LJ (2000) Anatomical and ultrastructural aspects of leaf galls in Ficus microcarpa L. (Moraceae) induced by Gynaikothrips ﬁcorum Marchal (Thysanoptera). Acta Bot Bras 14:57–69 95. Steeves TA, Sussex IM (1989) Patterns in plant development. Cambridge University Press, Cambridge 96. Stern D (1995) Phylogenetic evidence that aphids, rather than plants, determine gall morphology. Proc R Soc Lond B 260:85–89. doi:10.1098/rspb.1995.0063 97. Stone GN, Schönrogge K (2003) The adaptive signiﬁcance of insect gall morphology. Trends Ecol Evol 18:512–522. doi:10.1016/S0169-5347(03)00247-7 98. Subbaiah CC, Sachs MM (2001) Altered patterns of sucrose synthase phosphorylation and localization precede callose induction and root tip death in anoxic maize seedlings. Plant Physiol 125:585–594 99. Visser JH (1986) Host odor perception in phytophagous insects. Annu Rev Entomol 31:121–144 100. Wachter R, Langhans M, Aloni R, Gotz S, Weilmunters A, Koops A, Temguia L, Mistrik I, Pavlovkin J, Rascher U (2003) Vascularization, high-volume solution ﬂow, and localized roles for enzymes of sucrose metabolism during tumorigenesis by Agrobacterium tumefaciens. Plant Physiol 133:1024–1037 101. Weis AE, Walton R, Crego LR (1988) Reactive plant tissue sites and the population biology of gall makers. Annu Rev Entomol 33:467–486 102. Westphal E (1980) Responses of some Solanaceae to attack by the gall mite Eriophyes cladophthirus. Plant Dis 64:406–409

290

R.M. dos Santos Isaias and D.C. de Oliveira

103. Westphal E (1992) Cecidogenesis and resistance phenomena in mite-induced galls. In: Shorthouse JD, Rohfritsch O (eds.) Biology of insect-induced galls. Oxford University Press, New York 104. Williams MAJ (1994) Plant galls: organisms, interactions, populations. Clarendon, Oxford 105. Woodman RL, Fernandes GW (1991) Differential mechanical defense: herbivory, evapotranspiration, and leaf-hairs. Oikos 60:11–19 106. Wu G, Shortt BJ, Lawrence EB, Léon J, Fitzsimmons KC, Levine EB, Raskin I (1995) Activation of host defense mechanisms by elevated production of H2O2 in transgenic plants. Plant Physiol 115:427–443 107. Wu K, Rooney MF, Ferl RJ (1997) The Arabidopsis 14-3-3 multigene family. Plant Physiol 114:1421–1431 108. Zentgraf U (2007) Oxidative stress and leaf senescence. In: Gan S (ed.) Senescence processes in plants. Blackwell Publishing Ltd./CRC Press, Oxford 109. Zucker WV (1982) How aphids choose leaves: the roles of phenolics in host selection by a galling aphid. Ecology 63(4):972–981

Chapter 12

The Role of Roots in Plant Defence Matthias Erb

Abstract Roots play an important role for plant defence and resistance against pathogens and insect herbivores: They act as environmental sensors for space, nutrients and water, they are important biosynthetic sites of plant toxins, they can store assimilates for future regrowth, and they possess themselves a potent defensive system to fend off belowground attackers. Although roots are often seen as passive tissue that only delivers services to the rest of the plant, it is becoming increasingly evident that roots actively respond to environmental conditions and are a vital part of the plant’s signaling and perception machinery. This chapter summarizes what is known about roots as constituents of plant resistance and defense mechanisms, with a particular emphasis on signaling aspects. It also discusses how the increasing knowledge about roots can be used to help protect plants from harmful pests.

12.1

Introduction

Plants use a variety of strategies to withstand attacks by pathogens and insects. These include structural barriers like cuticules, trichomes, callose and ligniﬁed cell walls, chemical defences including toxic or deterrent secondary metabolites, direct biochemical agents, for instance proteases and proteinase inhibitors, and tolerance mechanisms including compensatory growth and carbon storage in non-attacked tissues. Plant defences can be either constitutive, in which case they are built up or maintained independently of the presence of an attacker, or induced, which means that they are mounted only in response to an environmental threat.

M. Erb (*) Department of Molecular Ecology, Max Planck Institute for Chemical Ecology, Jena, Germany e-mail: [email protected]

J.M. Mérillon and K.G. Ramawat (eds.), Plant Defence: Biological Control, Progress in Biological Control 12, DOI 10.1007/978-94-007-1933-0_12, © Springer Science+Business Media B.V. 2012

291

292

M. Erb

Fig. 12.1 The role of roots in plant defence. The different types of interactions of roots that inﬂuence plant defence are shown. Interactions with beneﬁcial microbes (mycorrhizal fungi, rhizobial bacteria, etc.) are omitted

Traditionally, most plant defensive strategies have been studied aboveground, in the leaves of plants. This is understandable, as leaves are easily accessible, observable by the naked eye, and a healthy shoot is important for crop growth and yield. But of course, leaves are only half of what makes a successful plant, and roots are equally important for plant growth and development. In recent years, the focus of several research groups has shifted to this tissue, and it is becoming increasingly evident how important roots are for plant defence strategies (Fig. 12.1): Roots provide important environmental cues, water, nutrients and a contact surface with beneﬁcial microbes, all of which can support a plant in maintaining its chance of surviving in a hostile environment. Roots have also been found to synthesize a variety of defensive compounds that are then transported aboveground to increase leaf-resistance. Furthermore, they play an important role as storage organs for regrowth after leaf-attack. Finally, it is becoming evident that roots themselves

12

The Role of Roots in Plant Defence

293

possess a potent defensive system to fend off pathogens and herbivores that attack belowground. In this chapter, I would like to discuss what is known about the role of roots in plant defences. Some aspects of root-dependent interactions, like the role of plant growth promoting bacteria, are the subject of other chapters in this book, and I will only mention them brieﬂy. Because of space restrictions and the rather broad scope of this chapter, it is not possible to discuss all the available literature on the subject, and I would like to apologize to the author’s whose work could not be cited here. I hope that by assembling some of our current knowledge about the importance of roots for plant resistance against pathogens and insects, I can provide ideas for the development of novel crop protection strategies and identify interesting new avenues for future research.

12.2

Environmental Sensing: Roots as “Decision Makers” for Plant Defence Strategies?

To optimize resource allocation, plants have to optimize their strategy according to the availability of nutrients, water and space in the soil environment. This also inﬂuences plant defences, as under growth-limiting conditions, it may be more important to defend the already present biomass, while under more favorable conditions; an increase in growth may enable plants to compensate for the loss of tissue. This view is tightly linked with the “growth vs. defence” hypothesis that states that trade-offs exist between cell division and enlargement (growth) and differentiation (including defence) [1]. As the extent of the trade-off depends on the abiotic environment, i.e. the availability of sufﬁcient resources, it can be expected to be inﬂuenced heavily by the root environment, as explained above. Roots may be important environmental sensors that inﬂuence a plant’s decision making regarding its investment in defensive processes. One example of the importance of root sensing for plant defence comes from wild tobacco (Nicotiana sylvestris): Under ﬁeld conditions, N. sylvestris responds to defoliation with an increase in Nicotine biosynthesis. This effect is absent in plants that are grown in small pots in the greenhouse. If the plants are transferred to a bigger pot, alkaloid production becomes inducible, until the root system is constrained again by pot size [2]. These results suggest that N. sylvestris plants can “sense” the expansion potential belowground and adjust their defensive behavior accordingly. In this case according to the theoretical model state above, one would have expected the plants to be more strongly inducible under soil-limiting conditions. It is possible however that trade-offs are different for nitrogen containing secondary metabolites: In this case, the plant may need all the available nitrogen to grow to the ﬂowering stage in a constrained environment and may therefore divert it to growth irrespective of the presence of defoliating attackers. For carbohydrate-based secondary metabolites on the other hand, a plant with a constrained soil environment may be growth-limited, but will still have ample assimilates available for their production.

294

M. Erb

Unfortunately, until today, little additional research has been carried out on the role of root environment sensing for plant defence. Research on the mechanisms of root “mechanosensing”, i.e. the detection of mechanical resistance is highlighting how profoundly this can modulate plant physiology [3]. Mechanical obstacles in the soil trigger an inﬂux of Ca2+into the cytoplasm of root cells, resulting in NADPH oxidation and extracellular superoxide (ROS) production as well as cytosolic acidiﬁcation, which then elicit additional signaling events [4]. Interestingly, herbivore attack elicits a very similar cascade of events in the leaves [5], and possibly also in the roots of plants. Mechanosensing, by sharing response elements with plant defence responses, may therefore inﬂuence the latter directly. Much remains to be done to understand how root sensing inﬂuences plant resistance and defence. Understanding the impact of mechanosensing on plant resistance may be important in the context of tillage in agriculture: In conventional ﬁelds, repeated ploughing at the same depth can lead to a compacted layer called “plough sole”, which is hard to penetrate by plant roots. Novel techniques like no-tillage as well as crop rotation approaches can be employed to avoid this phenomenon and thereby possibly also alter root sensing and plant resistance.

12.3

Nutrient Balance and Plant Defence: Fight with What You Have

Apart from sensing “space” for expansion, roots also deliver information about the availability of essential elements in the soil, which may strongly inﬂuence the plant’s investment in defences. In some cases, such effects are hard to detect experimentally, as reduced nutrient availability will directly impact the available resources for metabolite synthesis as well as resistance against attackers [6]. On the other hand, an increase in plant defensive compounds under nutrient limitation does not necessarily imply augmented biosynthesis, as it may simply be the result of a reduction of primary metabolite production, leading to changes in the ratio between primary and defensive compounds [7]. The question thus arises how we can distinguish between a passive role of roots in plant defences, where they simply do not deliver the needed essential elements, and a more active role, where they provide “information” on the nutritional quality of the environment and thereby inﬂuence plant decision making? Maybe the most direct approach is to study the activity of plant defensive investment under nutrient limitation: If plants actively increase the biosynthesis of defensive metabolites under nutrient limiting conditions, this can be seen as a good indication for such processes to occur. Several studies suggest that a reduction of plant nutrients actively increases the plant’s defence response. In maize (Zea mays mays) for example, it was found that under low nitrogen conditions, plants show a more pronounced jasmonic acid (JA) burst following wounding, and release higher concentrations of volatile organic compounds (VOCs) [8]. Strikingly, this also included the release of indole,

12

The Role of Roots in Plant Defence

295

a nitrogen-containing secondary metabolite that is also needed for tryptophane biosynthesis [9]. Similar results were found in cotton (Gossypium hirsutum) [10]. It should be noted that several other studies did not ﬁnd clear effects of nitrogen supply on induced volatiles [6] and other defences including proteinase inhibitors [11] and alkaloids [12], suggesting that nitrogen-dependent root-to-leaf communication varies strongly between species and mechanisms of defence. Apart from nitrogen, potassium has also been found to have a strong impact on plant defences: In Arabidopsis thaliana, potassium deﬁciency induces oxylipin signaling, which in turn increases glucosinolate biosynthesis and, possibly, insect resistance [13]. It can be speculated that this may be an evolved behavior of the plant to increase its defences in times of potassium limitation. That roots can send out signals to the leaves under potassium deﬁciency has been found in castor bean (Ricinus communis): When grown in a low potassium environment, root-shoot xylem transport of ABA (abscisic acid) was strongly stimulated [14]. ABA is an important signal not only for abiotic stress, but also for insect and pathogen resistance [15, 16], and roots as potassium sensors may therefore play an important role in ABA-mediated defensive processes. A common consequence of nitrogen and potassium deﬁciency is the accumulation of sugars in the leaves, which can act as signals in plant defensive processes. It is therefore important to note that roots are not in all cases directly sending out signals, but may induce secondary signals that then regulate defences [17]. Phosphorus, another important essential element taken up by the roots, seems to have less of an effect on plant defence. In a broad survey of forest plants growing in P-rich and P-depleted environments, it was found that overall phenolic compounds did not differ signiﬁcantly between sites [18]. Diterpenes in garden sage (Saliva ofﬁcinalis) and volatile terpenes in pine trees were equally unaffected by phosphorus-supply [19, 20]. Plant phosphorus supply can be increased if roots are colonized by arbuscular mychorrizal fungi (AMF) [21], which in turn inﬂuences plant defences and resistance [22]. The question if it is the increase in phosphorus availability to the plant that is responsible for this effect is thus pertinent. Until now however, the majority of AMF-studies that included low- and high phosphoruscontrols suggest that AMF induced changes in plant defence are independent of P supply [23]. Overall, roots play an important role, not only as nutrient suppliers, but also as nutrient sensors that can inﬂuence the plants defensive status and resistance. Interestingly, the effect of root nutrient sensing on plant defence differs between genotypes and nutrients. This suggests the existence of either a speciﬁcally adapted interface between nutrient sensing and plant defence, or an indirect, non-adaptive overlap between the plant’s phenotypic adjustment to growth conditions and its ability to fend off pathogens and insects. Future research should aim at ﬁnding common nodes and triggering points between root nutrient sensing and plant defensive processes. This would enable scientists to get insight into the adaptiveness of nutrient-defence relations beyond the classical ecological models and may help to improve crop protection by creating plants that maximize their defensive investment under optimal growth conditions.

296

12.4

M. Erb

Root Water Supply as a Determinant of Plant Defence Mechanisms

Apart from nutrients, roots are supplying water to the aboveground parts of plants. Because of their close contact with the soil environment, they can sense water depletion much earlier than the leaves. Several studies have found a strong inﬂuence of water sensing and supply on plant defences. Water logging, i.e. an excess of water leading to a lack of oxygen in the rhizosphere, stimulates the accumulation of 1-aminocyclopropane-1-carboxylic acid (ACC) in the roots, which can be transported through the plant. ACC is converted to ethylene (ET) [24], which has a strong impact on plant defence and resistance. ET acts in synergy with oxylipin signals like jasmonic acid (JA) and its isoleucine conjugate (JA-Ile) in response to insect attack [25], and thereby serves as a positive regulator of defences against insects [15]. Water-dependent ACC signaling from the roots therefore has the potential to change plant resistance both in the roots and the leaves. A second signal that is deployed from the roots upon changes in water supply is ABA: under water limiting conditions, ABA is synthesized in the roots and transported aboveground, possibly as a conjugate [26], where it induces stomatal closure as well as transcriptional and metabolic changes [27]. Although recent research suggests that an ABA precursor or a hydraulic signal from the roots mediates the drought response of leaves and that ABA may only be a secondary messenger [28, 29], the fact that leaves start reacting to water stress before the actual changes in water potential occur clearly indicates the active role of roots in within plant drought signaling [30]. ABA, as well as other potential drought signals like cytokinins are also involved in defensive processes [31] and resistance [15, 16], and water-dependent leaf-to-root signaling may therefore act as an important modulator of plant defence. One recent example on how important water-stress induced leaf-to root signaling can be for plant-insect interactions comes from my own research: We have found that herbivory by Diabrotica virgifera, a voracious root pest of maize (Zea mays), increases leaf resistance against herbivores and pathogens, both in the ﬁeld and the laboratory. Several leaf-defences were induced in root-infested plants, including the toxic hydroxamic acid 2,4-dihydroxy-7-methoxy-1,4-benzoxazin-3-one (DIMBOA), as well as several pathogen related (PR) and proteinase inhibitor genes [32]. Furthermore, we found that root-herbivory primes the induction of chlorogenic acid, a toxic phenolic compound in the leaves. Surprisingly, all these effects were not the result of a systemic wound response, as would have been expected [33], but of an induction of ABA and water stress in the leaves [34]. We subsequently showed that root-herbivore induced leaf-water stress is required for the increase in resistance, and that ABA is indeed responsible for the majority of increased defences [34, 35]. ABA-signaling and stomatal closure may also be responsible for the observed reduction in herbivore-induced leaf-volatiles and parasitoid attraction in maize [36]. Roots and their interaction with belowground herbivores and water supply thus profoundly inﬂuence the defensive potential and resistance of maize

12

The Role of Roots in Plant Defence

297

plants up to the third trophic level. Several other studies are emphasizing this type of interaction, suggesting that this may be a common effect in plant-environment interactions [37, 38]. Overall, it is evident that root water supply and water-sensing has a profound impact on plant defensive processes. Given the current efforts to breed drought tolerant crops that resist climate change and arid environments, it will be important to understand the interactions between root water stress signaling and pest resistance. This will help to minimize pest control in the newly developed lines and may help to boost yield and sustainability.

12.5

Roots as Biosynthetic Origin of Leaf-Defensive Compounds- the Shoot-Root Loop

Roots do not only supply nutrients and water to the plant, but function themselves as important biosynthetic sites for plant defences. A multitude of root-produced toxins are known [39], and overall, it appears that the diversity of toxic metabolites is at least equal to what can be found in leaves [40]. Interestingly, roots supply defensive compounds to the rest of the plant, particularly the leaves. Upon insect attack aboveground, signals can travel down into the roots and increase the synthesis of these molecules, which are then transported aboveground for defensive purposes. The “shoot-root loop” (Fig. 12.2) seems to be an essential part of the plant’s defensive strategy [55]. Some examples of this mechanism are discussed below. One of the most well studied examples of a root-derived leaf-defensive compound is nicotine [56]. After synthesis in the roots of tobacco (Nicotiana spp.), nicotine is loaded into the xylem, transported to the leaves, unloaded by a speciﬁc MATE transporter and stored in the vacuoles [50, 53], where it serves as an effective defence against insects. After herbivore attack, nicotine synthesis in the roots is increased even further [54, 57]. Apart from tobacco, many other plants derive alkaloids from their own root systems. This includes for example tropane alkaloids in solanaceous plants [58]: It has been shown by reciprocal grafting that their alkaloid patterns are determined by the rootstock rather than the foliage [59]. Pyrrolizidine alkaloids (PAs) in the Asteraceae are also root derived [60]. In Senecio spp., senecionine N-oxide is produced in the roots and serves as a backbone structure for a variety of PAs in the leaves [60]. A second category of defensive compounds that are produced by the roots to serve in leaf-defences are furanocoumarins (FCs). Evidence for their origin comes mainly from studies for pharmaceutical applications: Root cultures of Ammi majus brought together with Ruta graveolens shoots results in an increase of xanthotoxin production by the latter [61], which suggests that (i) the precursor for this FC is root derived and (ii) that the quantity that is supplied by the roots determines the concentration in the leaves. Evidence is increasing for mobile defensive proteins to be synthesized in the roots of plants as well. Resistant maize lines that are attacked by larvae of the pest

298

M. Erb

Fig. 12.2 (a) The role of Zea mays roots in aboveground resistance. (1) The plant recognizes the herbivore via speciﬁc elicitors [41] and activates its local defences. (2) Unknown signals travel down into the roots. (3) A reorganization of the root metabolism takes place, including possibly increased synthesis of the protease MIR-CP1 [42]. (4) Nutrient availability either sensitizes or impairs the plant defence response [8, 43]. (5) Attacking root herbivores increase the expression of aboveground defences [44]. (6) Signals and defensive compounds resulting from processes 3–5 travel from the roots to the shoot [42]. (7) Assimilate ﬂow into the roots increases [45]. (8) The ensuing plant response involving the roots increases herbivore resistance [44]. (b) The role of Nicotiana spp. roots in aboveground resistance and tolerance. (1) The plant recognizes the herbivore via speciﬁc elicitors and activates its local defences, including the induction of Na-GAL83 implicated in sugar transport [46]. (2) Signals travel down into the roots via the phloem [47]. Possible candidates include jasmonic acid (positive signal) [48] and auxin (negative signal) [49]. (3) A reorganization of the root metabolism takes place, including the induction of the N-methyltransferase responsible for nicotine synthesis [50], and sugar invertases [51]. (4) Reduced nutrient availability impairs the plant defence response [52]. (5) Alkaloids are translocated from the roots to the shoot via the xylem. (6) Alkaloids are unloaded and deposited in the vacuoles by Nt-JAT1 [53]. (7) Assimilate ﬂow into the roots increases [51]. (8) The resulting plant response involving the roots increases herbivore resistance [54] and tolerance [46]

Spodoptera frugiperda respond by producing a cysteine protease, Mir1-CP [62]. This protein, which has been reported to be as effective as the widely used bacterial bt-toxins [63], accumulates in the lumen of root metaxylem vessels 24 h after S. frugiperda attack in the leaves. When the roots are excised, the amount of Mir1-CP that accumulates in the leaves diminishes signiﬁcantly [42], suggesting that it is indeed synthesized in the roots and then transported aboveground. Finally, a series of studies shows that a local induction of the roots also increases leaf-defences. While some of these effects may be due to internal systemic signaling, others could be the result of an increase in the transport of toxins from the roots

12

The Role of Roots in Plant Defence

299

to the leaves. Root infestation by larvae of Delia spp. for example increases shoot glucosinolate concentrations in Brassica spp., [64–67], and it remains to be determined if glucosinolates are mobilized from the belowground tissues. In maize, it was observed that root infestation by D. virgifera larvae increases the concentration of terpenoids in the aboveground parts [68]. As the corresponding synthases are not activated in the leaves [69], it is likely that the volatiles themselves were transported or diffused into the aboveground parts. One important question that arises from the fact that roots can increase their defences after leaf attack is which signals are involved in leaf-root communication. Early work on tobacco focused on a possible role of JA as a mobile element. It was found that after 30 min after wounding, JA concentrations increase in N. sylvestris leaves. Ninety minutes later, an increase could also be observed in the roots, leading to the hypothesis that JA itself may travel through the plant and activate nicotine biosynthesis belowground. Using 14C labelled JA, Zhang and Baldwin [48] showed that JA can indeed be transported from the leaves to the root if it is exogenously applied. The dynamics of nicotine induction matched with the translocation speed of the labelled compound, suggesting a possible role of JA as a long-distance signal. In accordance with this hypothesis, it was found that in hybrid poplar, wound-induced transcripts in the leaves were also induced in the roots, suggesting a common wound-inducible signal [70]. Another study however questions the importance of JA as an inducer of the root response in tobacco: Shi et al [49] studied nicotine induction in Nicotiana tabaccum and found that a downregulation of shoot-derived auxin rather than JA may be responsible for the effect. It remains to be determined if (i) different species react to different leaf-to-root signals, if (ii) it is the interplay between the currently known candidates or if (iii) yet unknown signals determine root defence responses following leaf-attack in the case of tobacco. Another open question is why plants would use the roots to synthesize toxins that are needed in the leaves? Given the fact that root-to-leaf transport involves a considerable cost, because the metabolites need to be loaded into and unloaded from the xylem, using roots as “bioreactors” must be associated with a beneﬁt for the plant. Several hypotheses have been brought forward that could explain why producing toxins in the roots is beneﬁcial: s First, if the attacker in the leaves, be it an insect or a pathogen, degrades or consumes a majority of the foliage, the biosynthetic capacity of the aboveground parts may be impaired. In this case, it may be an advantage to produce toxins in the roots, which remain protected. The defensive compounds could then be supplied to the remaining aboveground tissue, and could be loaded into the newly developed leaves. Roots would thus serve as both a protected weapon [71] and a memory, enabling the plant to survive the aboveground attack. s Second, given the fact that aboveground parts of plants are often not directly connected by the vascular system [72, 73], synthesizing toxins in the roots may be a cheap way of supplying all the aboveground parts from one local tissue rather than having to produce a compound in a variety of organs including stem, leaves, ﬂowers and so forth. The toxins could then use the already established xylem structure to be distributed evenly through the plant.

300

M. Erb

s Finally, because some precursors may be more abundant and more easily available in the roots, it may be less costly to assemble the toxic metabolites belowground and transport them aboveground rather than doing the same with the precursors, which may be less stable or more hydrophobic [55]. Thus, while the precise reason for the existence of the shoot-root loop remains to be determined, it is evident how important roots are as suppliers of leaf-defensive elements. Understanding which resistance factors are produced in the roots may enable plant breeders to screen for particularly potent and well developed root systems, which could, apart from their obvious beneﬁts like a more efﬁcient nutrient and water uptake, help to increase the plant’s defensive capacity.

12.6

Assimilate Storage Belowground: Digging in for the Storm

Roots and rhizomes are important storage elements for perennial plants, because nutrients can be stored during the winter or dry-season and can then be used for regrowth at the beginning of the new vegetation period [74, 75]. Humans have learned to use these belowground storage organs for their own purposes. Today, potatoes, carrots, cassava and other tuber crops are an important constituent of the human diet [76]. It is becoming clear that roots also have an important role to play in tolerance against aboveground attackers like insects and pathogens: Because they remain structurally unaffected by leaf-attack, they can serve as save storage organs for assimilates, which can be used for regrowth after the plant has been defoliated and the herbivore has moved on. A number of annual and perennial plant species have been reported to increase assimilate ﬂows into the roots after leaf-attack. In maize for example, attack by the grasshopper Romalea guttata increased carbon ﬂux into the roots, but also from the roots into the rhizosphere [45]. Roots may therefore in this case not only serve as carbon storage for tolerance purposes, but may also change the rhizosphere community in response to leaf-attack [45]. In another poaceae however, Lollium perenne, defoliation increased root soluble C concentrations, but not C availability or microbial growth in the rhizosphere [77], suggesting that the primary function of the change in carbon allocation is associated with a tolerance mechanism. Changes in assimilate partitioning following herbivory have been most intensively studied in Nicotiana spp. Wild tobacco (Nicotiana attenuata) is a pioneer plant of north American deserts, where it is under high leaf-insect pressure, but, as far as observations go, not under any major threat from root attackers (I. Baldwin, personal communication). Tobacco can therefore be expected to possess effective, root-based tolerance strategies. Indeed, it was found that after simulated leaf-herbivory, N. attenuata plants increase carbon allocation to the roots [78] and decrease glucose, fructose and sucrose concentrations in the leaves. The SnRK kinase GAL83, which

12

The Role of Roots in Plant Defence

301

is downregulated in the leaves after herbivory, was found to be an important component of this response, as silenced lines showed an increase in root carbon allocation. GAL83-silenced plants also displayed a prolonged reproductive phase, indicating that the induced response is indeed a tolerance mechanism. But are the roots only passive receivers in this response, or do they, as in many other processes discussed in this chapter, play an active role in plant tolerance? Assimilates are translocated from the leaves to the roots via the phloem. Osmotic differences between source (leaves) and sink (roots) determine the basipetal ﬂow of carbon [79]. An increase in root allocation can therefore be achieved either by increasing the loading into the phloem from the leaves [80], by increasing the unloading into root cells or by conversion of osmotically active metabolites [81]. In tobacco, it was found that invertase activity in the roots increases after Manduca sexta leaf-attack [51] or simulated herbivory [78]. The activation of these sugar cleaving enzymes in the roots is likely to have contributed to the increase in sink strength of the roots. This example illustrates that roots are not passive receivers of assimilates, but active responders to leaf-attack that help the plant to tolerate herbivory. Until today, little is known about the signaling events and regulatory elements that govern root tolerance reactions. In Nicotiana attenuata, it seems that the root response is not mediated by oxylipin signaling, but by a distinct regulatory network [46]. In the future, it will be important to unravel the nature of the shoot-to-root signals that govern plant tolerance responses. Possible candidates include auxins [82] as well as small phloem-born peptides [83] and small RNAs [84]. It was also suggested that root responses may result from hydraulic signaling following an increase in leaf water-loss upon wounding [85]. In this context, it should not be forgotten that sucrose and monosaccarides like glucose and fructose can have important signaling functions [86], and they may therefore by themselves trigger some of the root responses. Understanding carbon allocation patterns in response to herbivory may be used to regulate crop yields of tuber crops, and may help to develop genotypes that are tolerant to defoliation.

12.7

Roots Defend Themselves

Roots do not only play an important role in plant resistance against aboveground attackers, but possess themselves a potent defensive system against threats from the rhizosphere. Although much less is known about constitutive and inducible defences in the roots compared to the leaves, an increasing number of studies are unraveling the underlying mechanisms. Here I will take a non-exhaustive, comparative approach to discuss similarities and differences between leaf- and root defences. I will focus on insect attackers and mention pathogens only brieﬂy. In the leaves, attackers are recognized by so called “molecular patterns”. In the case of herbivores, several compounds are known to serve as speciﬁc elicitors that are used by plants to detect and identify the attacker [87]. In many cases, these

302

M. Erb

compounds elicit a response that is different from a simple wounding [5]. The same holds true for leaf-pathogens, which are recognized by speciﬁc compounds like ﬂagellin and chitin [88]. Do roots possess a comparable receptor-system to recognize local attack? In the case of insects, no root elicitors have been described. However, experiments suggest that the reaction of roots to root herbivore attack is signiﬁcantly different from mere wounding [32](I. Hiltpold, personal communication). Given the fact that roots may be exposed to mechanical wounding in the absence of insects, e.g. by the formation of cracks during dry periods and their closing after rainfall, it is well possible that receptor systems are present to recognize insects. In the case of pathogens, some studies have indicated that roots may lack some effectors that are typically present in the leaves [89]. However, for Arabidopsis, it was recently demonstrated that the roots respond strongly to microbial elicitors [90]. The fact that the responses are restricted to particularly vulnerable tissues like the epidermal layer and the elongation zone suggests that roots have evolved speciﬁc strategies to recognize and cope with root attackers [90]. The ﬁrst detectable changes in the leaf-physiology after elicitor contact are changes in intracellular Ca2+ concentrations, nitric oxide (NO), hydrogen peroxide (H2O2) induction of kinases and phytohormones [5]. Overall, the ﬁrst steps of root defence responses seem to follow a similar pattern [91]: In Medicago truncatula for example, rhizobium infection lead to a rapid inﬂux of cytosolic Ca2+ and the generation of reactive oxygen species (ROS) [92]. Given the fact that the early events of plant stress responses seem to be conserved between tissues and stressors in plants, it is conceivable that roots respond very similarly to leaves in this aspect. In the leaves, speciﬁcity is achieved during the induction of transcription factors like MAP kinases and plant hormones: This so called ﬁne-tuning of the defence response [93, 94] is important to guarantee an appropriate phenotypic response. In the leaves, the main hormones implicated in plant responses to herbivores and pathogens are jasmonates including 12-oxophytodienoic acid (OPDA) and JA-Ile, salycilates with its main metabolite SA, abscisates (mainly ABA) and ethylene (ET) [26]. These compounds orchestrate leaf-responses, and, depending on the attacker, they are induced or repressed and act either synergistically or antagonistically [95]. Interestingly, some of these leaf-stress signals seem to serve an entirely different purpose in the roots: Jasmonates and ET for example are implicated in root hair formation [96], and ABA has been shown to be involved in lateral root formation as well [97]. The question if phytohormones function as speciﬁc stress-signals in the roots is thus pertinent. To get a ﬁrst insight into the root reaction compares to the leaf-response, we measured OPDA, JA, ABA and SA in maize leaves after Spodoptera littoralis attack and the same compounds in the roots after Diabrotica virgifera attack. Our results show that overall, both leaves and roots increase their production of OPDA, JA and ABA, but not SA after local attack [32]. While in the leaves, JA concentrations are ﬁve times higher after attack, the increase in the roots was only two-fold. OPDA on the other hand was induced four-fold in the roots, but only two-fold in the leaves [32]. This suggests that although the direction of the phytohormone response is similar in the roots, its pattern is signiﬁcantly different (Fig. 12.3). Also, there is some evidence that contrary to the leaves, where

12

The Role of Roots in Plant Defence 16

2x

14 12

303 0.35

b

a

8

0.20

a

b

0.15

6

0.10

4 2 0 Control

D.v.

S.l.

D.v.+S.l.

0.0 0.1

a

0.2

a

0.3

4x b

0.5

b

0.6 Control

Root Leaf Root& leaf attack attack attack

JA (ng/mg FW)

OPDA (ng/mg FW)

4x

0.25

10

0.4

b

0.30

b

a

a

0.05 0.00 Control 0.00 0.02 0.04 0.06 0.08 0.10 0.12 0.14 0.16 0.18

D.v.

S.l.

D.v.+S.l.

Leaves Roots

a

a

2x b Control

b

Root Leaf Root& leaf attack attack attack

Fig. 12.3 Average concentrations (+SE) of 12-oxo-phytodienoic acid (OPDA), and jasmonic acid (JA) in maize leaves (upper half) and roots (lower half) of herbivore-infested plants. Leaves were collected after 4 days of belowground infestation by Diabrotica virgifera (Root attack), 2 days of aboveground infestation by Spodoptera littoralis (Leaf attack), or simultaneous infestation by D. virgifera (4 days) and S. littoralis (Root&leaf attack). Values presented are concentrations in ng/mg fresh weight (+SE). Different letters indicate signiﬁcant differences between the treatments (p < 0.05). Fold changes between controls and locally induced concentrations are highlighted (Figure modiﬁed from [32])

lipoxygenases that convert poly unsaturated fatty acids to 13-hydroperoxides (13-LOX) and downstream oxylipins are predominantly active in plant stress responses, the 9-LOX pathway (derived from 9-hydroperoxides) may have a distinct and important role in pathogen resistance [98]. Thus, although little is known about phytohormone-mediated regulation of root defences, it becomes clear that (i) roots respond actively to belowground attack and (ii) the regulatory elements may be different from the leaves. Further research is certainly warranted in this ﬁeld to substantiate these claims. Following hormonal signaling, plants undergo transcriptional reprogramming, which results in phenotypical changes. The synthesis of toxins [99] and volatile organic compounds (VOCs) [100] as well as the formation of structural barriers like ligniﬁed cell walls, trichomes and callose deposits are among the most common defences found in the leaves of plants [101]. Roots have been found to have a comparable arsenal of constitutive and induced defences at their disposal [40], but again, it seems that their reaction is different from the leaves and speciﬁcally targeted at the physiology of the attacker belowground. Maize volatiles induced by herbivory give testimony to this concept: Upon leaf-attack by caterpillars, maize starts producing a diverse and complex blend of volatiles that include green leafvolatiles (GLVs), aromatic compounds as well as homo- mono- and sesquiterpenes.

304

M. Erb

These volatiles serve as host-location cues for parasitic wasps [102]. When roots are attacked by coleopteran larvae, they equally release volatiles, but the blend is qualitatively different: GLVs and aromatics seem to be produced in minor traces only, while one sesquiterpene, E-E-caryophyllene, dominates the bouquet [103]. This compound, which diffuses particularly well through the soil [104] attracts entomopathogenic nematodes, thereby protecting the roots [105]. Thus, while the defensive strategy is similar between the roots and the leaves in maize, roots have evolved a different, speciﬁc capacity to defend themselves. Understanding the speciﬁcity of root responses to pathogens and insects may help to increase the capacity of crops to sustain belowground infestations.

12.8

Conclusions and Outlook

From the current literature, it is becoming evident how important roots are for plant defences, although much remains to be discovered, roots have been shown to function as environmental sensors for space, nutrients and water, all of which inﬂuence the plants investment and capacity for defence. Furthermore, roots serve as biosynthetic reactors for a series of leaf-defences, and they function as carbon storage organs for regrowth after attack. Finally, roots have developed speciﬁc mechanisms to defend themselves. Taken together, this illustrates that roots deserve special attention as defence modulators, and future research should aim at transferring existing knowledge and technology from aboveground studies to the roots to unravel their potential, both in ecological interactions and for agricultural productivity.

References 1. Herms DA, Mattson WJ (1992) The dilemma of plants: to grow or defend. Quart Rev Biol 67(3):283–335 2. Baldwin IT (1988) Damage-induced alkaloids in tobacco – pot-bound plants are not inducible. J Chem Ecol 14(4):1113–1120 3. Monshausen GB, Gilroy S (2009) Feeling green: mechanosensing in plants. Trends Cell Biol 19(5):228–235 4. Monshausen GB, Bibikova TN, Weisenseel MH, Gilroy S (2009) Ca2+ Regulates reactive oxygen species production and ph during mechanosensing in Arabidopsis roots. Plant Cell 21(8):2341–2356 5. Bricchi I, Leitner M, Foti M, Mithöfer A, Boland W, Maffei M (2010) Robotic mechanical wounding (MecWorm) versus herbivore-induced responses: early signaling and volatile emission in Lima bean (Phaseolus lunatus L.). Planta 232(3):719–729 6. Winter TR, Rostas M (2010) Nitrogen deﬁciency affects bottom-up cascade without disrupting indirect plant defense. J Chem Ecol 36(6):642–651 7. Le Bot J, Benard C, Robin C, Bourgaud F, Adamowicz S (2009) The ‘trade-off’ between synthesis of primary and secondary compounds in young tomato leaves is altered by nitrate nutrition: experimental evidence and model consistency. J Exp Bot 60(15):4301–4314

12

The Role of Roots in Plant Defence

305

8. Schmelz EA, Alborn HT, Engelberth J, Tumlinson JH (2003) Nitrogen deﬁciency increases volicitin-induced volatile emission, jasmonic acid accumulation, and ethylene sensitivity in maize. Plant Physiol 133(1):295–306 9. Kriechbaumer V, Weigang L, Fiesselmann A, Letzel T, Frey M, Gierl A, Glawischnig E (2008) Characterisation of the tryptophan synthase alpha subunit in maize. BMC Plant Biol 8:11 10. Chen YG, Schmelz EA, Wackers F, Ruberson J (2008) Cotton plant, Gossypium hirsutum L., defense in response to nitrogen fertilization. J Chem Ecol 34(12):1553–1564 11. Stout MJ, Brovont RA, Duffey SS (1998) Effect of nitrogen availability on expression of constitutive and inducible chemical defenses in tomato, Lycopersicon esculentum. J Chem Ecol 24(6):945–963 12. Baldwin IT, Hamilton W (2000) Jasmonate-induced responses of Nicotiana sylvestris results in ﬁtness costs due to impaired competitive ability for nitrogen. J Chem Ecol 26(4):915–952 13. Troufﬂard S, Mullen W, Larson T, Graham I, Crozier A, Amtmann A, Armengaud P (2010) Potassium deﬁciency induces the biosynthesis of oxylipins and glucosinolates in Arabidopsis thaliana. BMC Plant Biol 10(1):172 14. Jeschke WD, Peuke AD, Pate JS, Hartung W (1997) Transport, synthesis and catabolism of abscisic acid (ABA) in intact plants of castor bean (Ricinus communis L.) under phosphate deﬁciency and moderate salinity. J Exp Bot 48(314):1737–1747 15. Bodenhausen N, Reymond P (2007) Signaling pathways controlling induced resistance to insect herbivores in Arabidopsis. Mol Plant Microbe Interact 20(11):1406–1420 16. Mauch-Mani B, Mauch F (2005) The role of abscisic acid in plant-pathogen interactions. Curr Opin Plant Biol 8(4):409–414 17. Hammond JP, White PJ (2008) Sucrose transport in the phloem: integrating root responses to phosphorus starvation. J Exp Bot 59(1):93–109 18. Wright DM, Jordan GJ, Lee WG, Duncan RP, Forsyth DM, Coomes DA (2010) Do leaves of plants on phosphorus-impoverished soils contain high concentrations of phenolic defence compounds? Funct Ecol 24(1):52–61 19. Nell M, Votsch M, Vierheilig H, Steinkellner S, Zitterl-Eglseer K, Franz C, Novak J (2009) Effect of phosphorus uptake on growth and secondary metabolites of garden sage (Salvia ofﬁcinalis L.). J Sci Food Agric 89(6):1090–1096 20. Sampedro L, Moreira X, Llusia J, Penuelas J, Zas R (2010) Genetics, phosphorus availability, and herbivore-derived induction as sources of phenotypic variation of leaf volatile terpenes in a pine species. J Exp Bot 61(15):4437–4447 21. Hu JL, Lin XG, Wang JH, Cui XC, Dai J, Chu HY, Zhang JB (2010) Arbuscular mycorrhizal fungus enhances P acquisition of wheat (Triticum aestivum L.) in a sandy loam soil with long-term inorganic fertilization regime. Appl Microbiol Biotechnol 88(3):781–787 22. Pozo MJ, Azcon-Aguilar C (2007) Unraveling mycorrhiza-induced resistance. Curr Opin Plant Biol 10(4):393–398 23. Fritz M, Jakobsen I, Lyngkjær M, Thordal-Christensen H, Pons-Kühnemann J (2006) Arbuscular mycorrhiza reduces susceptibility of tomato to Alternaria solani. Mycorrhiza 16(6):413–419 24. Bradford KJ, Yang SF (1980) Xylem transport of 1-aminocyclopropane-1-carboxylic acid, an ethylene precursor, in waterlogged tomato plants. Plant Physiol 65(2):322–326 25. Schmelz EA, Alborn HT, Tumlinson JH (2003) Synergistic interactions between volicitin, jasmonic acid and ethylene mediate insect-induced volatile emission in Zea mays. Physiol Plant 117(3):403–412 26. Erb M, Glauser G (2010) Family business: multiple members of major phytohormone classes orchestrate plant stress responses. Chem A Eur J 16(34):10280–10289 27. Riera M, Valon C, Fenzi F, Giraudat J, Leung J (2005) The genetics of adaptive responses to drought stress: abscisic acid-dependent and abscisic acid-independent signalling components. Physiol Plant 123(2):111–119

306

M. Erb

28. Christmann A, Hoffmann T, Teplova I, Grill E, Muller A (2005) Generation of active pools of abscisic acid revealed by in vivo Imaging of water-stressed Arabidopsis. Plant Physiol 137(1):209–219 29. Christmann A, Weiler EW, Steudle E, Grill E (2007) A hydraulic signal in root-to-shoot signalling of water shortage. Plant J 52(1):167–174 30. Schachtman DP, Goodger JQD (2008) Chemical root to shoot signaling under drought. Trends Plant Sci 13(6):281–287 31. Richardson MD, Bacon CW (1993) Cyclic hydroxamic acid accumulation in corn seedlings exposed to reduced water potentials before, during, and after germination. J Chem Ecol 19(8):1613–1624 32. Erb M, Flors V, Karlen D, de Lange E, Planchamp C, D’Alessandro M, Turlings TCJ, Ton J (2009) Signal signature of aboveground-induced resistance upon belowground herbivory in maize. Plant J 59(2):292–302 33. Koo AJK, Gao XL, Jones AD, Howe GA (2009) A rapid wound signal activates the systemic synthesis of bioactive jasmonates in Arabidopsis. Plant J 59(6):974–986 34. Erb M, Köllner TG, Degenhardt J, Zwahlen C, Hibbard BE, Turlings TCJ (2011) The role of abscisic acid and water stress in root herbivore-induced leaf resistance. New Phytol 189(1):308–320 35. Erb M, Gordon-Weeks R, Camañes G, Turlings TCJ, Ton J (2009) Belowground ABA boosts aboveground production of DIMBOA and primes induction of chlorogenic acid in maize. Plant Signal Behav 4(7):639–642 36. Rasmann S, Turlings TCJ (2007) Simultaneous feeding by aboveground and belowground herbivores attenuates plant-mediated attraction of their respective natural enemies. Ecol Lett 10(10):926–936 37. Masters GJ, Brown VK, Gange AC (1993) Plant mediated interactions between aboveground and belowground insect herbivores. Oikos 66(1):148–151 38. Staley JT, Mortimer SR, Morecroft MD (2008) Drought impacts on above-belowground interactions: do effects differ between annual and perennial host species? Basic Appl Ecol 9(6):673–681 39. Kaplan I, Halitschke R, Kessler A, Sardanelli S, Denno RF (2008) Constitutive and induced defenses to herbivory in above- and belowground plant tissues. Ecology 89(2):392–406 40. Rasmann S, Agrawal AA (2008) In defense of roots: a research agenda for studying plant resistance to belowground herbivory. Plant Physiol 146(3):875–880 41. Schmelz EA, Engelberth J, Alborn HT, Tumlinson JH, Teal PEA (2009) Phytohormonebased activity mapping of insect herbivore-produced elicitors. Proc Natl Acad Sci USA 106(2):653–657 42. Lopez L, Camas A, Shivaji R, Ankala A, Williams P, Luthe D (2007) Mir1-CP, a novel defense cysteine protease accumulates in maize vascular tissues in response to herbivory. Planta 226(2):517–527 43. Gouinguene SP, Turlings TCJ (2002) The effects of abiotic factors on induced volatile emissions in corn plants. Plant Physiol 129(3):1296–1307 44. Erb M, Flors V, Karlen D, De Lange E, Planchamp C, D’Alessandro M, Turlings TCJ, Ton J (2009) Signal signature of aboveground induced resistance upon belowground herbivory in maize. Plant J 59:292–302 45. Holland JN, Cheng WX, Crossley DA (1996) Herbivore-induced changes in plant carbon allocation: Assessment of below-ground C ﬂuxes using carbon-14. Oecologia 107(1):87–94 46. Schwachtje J, Minchin PEH, Jahnke S, van Dongen JT, Schittko U, Baldwin IT (2006) SNF1-related kinases allow plants to tolerate herbivory by allocating carbon to roots. Proc Natl Acad Sci USA 103(34):12935–12940 47. Baldwin IT (1989) Mechanism of damage-induced alkaloid production in wild tobacco. J Chem Ecol 15(5):1661–1680 48. Zhang ZP, Baldwin IT (1997) Transport of [2-C-14]jasmonic acid from leaves to roots mimics wound-induced changes in endogenous jasmonic acid pools in Nicotiana sylvestris. Planta 203(4):436–441

12

The Role of Roots in Plant Defence

307

49. Shi QM, Li CJ, Zhang FS (2006) Nicotine synthesis in Nicotiana tabacum L. induced by mechanical wounding is regulated by auxin. J Exp Bot 57(11):2899–2907 50. Shoji T, Yamada Y, Hashimoto T (2000) Jasmonate induction of putrescine N-methyltransferase genes in the root of Nicotiana sylvestris. Plant Cell Physiol 41(7):831–839 51. Kaplan I, Halitschke R, Kessler A, Rehill BJ, Sardanelli S, Denno RF (2008) Physiological integration of roots and shoots in plant defense strategies links above- and belowground herbivory. Ecol Lett 11(8):841–851 52. Lou YG, Baldwin IT (2004) Nitrogen supply inﬂuences herbivore-induced direct and indirect defenses and transcriptional responses to Nicotiana attenuata. Plant Physiol 135(1):496–506 53. Morita M, Shitan N, Sawada K, Van Montagu MCE, Inze D, Rischer H, Goossens A, Oksman-Caldentey KM, Moriyama Y, Yazaki K (2009) Vacuolar transport of nicotine is mediated by a multidrug and toxic compound extrusion (MATE) transporter in Nicotiana tabacum. Proc Natl Acad Sci USA 106(7):2447–2452 54. Steppuhn A, Gase K, Krock B, Halitschke R, Baldwin IT (2004) Nicotine’s defensive function in nature. PLoS Biol 2(8):1074–1080 55. Erb M, Lenk C, Degenhardt J, Turlings TCJ (2009) The underestimated role of roots in defense against leaf attackers. Trends Plant Sci 14(12):653–659 56. Dawson RF (1941) The localization of the nicotine synthetic mechanism in the tobacco plant. Science 94:396–397 57. Baldwin IT, Schmelz EA, Ohnmeiss TE (1994) Wound-induced changes in root and shoot jasmonic acid pools correlate with induced nicotine synthesis in Nicotiana-Sylvestris Spegazzini and Comes. J Chem Ecol 20(8):2139–2157 58. Ziegler J, Facchini PJ (2008) Alkaloid biosynthesis: metabolism and trafﬁcking. Annu Rev Plant Biol 59:735–769 59. Bais HP, Loyola-Vargas VM, Flores HE, Vivanco JM (2001) Invited review: root-speciﬁc metabolism: the biology and biochemistry of underground organs. Vitro Cell Dev Biol Plant 37(6):730–741 60. Hartmann T, Ober D (2000) Biosynthesis and metabolism of pyrrolizidine alkaloids in plants and specialized insect herbivores. In: Biosynthesis: aromatic polyketides, isoprenoids, alkaloids, vol 209, Topics in current chemistry. Springer, Berlin, pp 207–243 61. Sidwa-Gorycka M, Krolicka A, Kozyra M, Glowniak K, Bourgaud F, Lojkowska E (2003) Establishment of a co-culture of Ammi majus L. and Ruta graveolens L. for the synthesis of furanocoumarins. Plant Sci 165(6):1315–1319 62. Pechan T, Cohen A, Williams WP, Luthe DS (2002) Insect feeding mobilizes a unique plant defense protease that disrupts the peritrophic matrix of caterpillars. Proc Natl Acad Sci USA 99(20):13319–13323 63. Mohan S, Ma PWK, Williams WP, Luthe DS (2008) A naturally occurring plant cysteine protease possesses remarkable toxicity against insect pests and synergizes bacillus thuringiensis toxin. PLoS One 3(3):7 64. Soler R, Bezemer TM, Van der Putten WH, Vet LEM, Harvey JA (2005) Root herbivore effects on above-ground herbivore, parasitoid and hyperparasitoid performance via changes in plant quality. J Anim Ecol 74(6):1121–1130 65. Birch ANE, Grifﬁths DW, Hopkins RJ, Smith WHM, McKinlay RG (1992) Glucosinolate responses of swede, kale, forage and oilseed rape to root damage by turnip root ﬂy (delia-ﬂoralis) larvae. J Sci Food Agric 60(1):1–9 66. van Dam NM, Raaijmakers CE, van der Putten WH (2005) Root herbivory reduces growth and survival of the shoot feeding specialist Pieris rapae on Brassica nigra. Entomol Exp Appl 115(1):161–170 67. van Dam NM, Witjes L, Svatos A (2004) Interactions between aboveground and belowground induction of glucosinolates in two wild Brassica species. New Phytol 161(3):801–810 68. Rasmann S, Kollner TG, Degenhardt J, Hiltpold I, Toepfer S, Kuhlmann U, Gershenzon J, Turlings TCJ (2005) Recruitment of entomopathogenic nematodes by insect-damaged maize roots. Nature 434(7034):732–737

308

M. Erb

69. Kollner TG, Held M, Lenk C, Hiltpold I, Turlings TCJ, Gershenzon J, Degenhardt J (2008) A maize (E)-beta-caryophyllene synthase implicated in indirect defense responses against herbivores is not expressed in most American maize varieties. Plant Cell 20(2):482–494 70. Major IT, Constabel CP (2007) Shoot-root defense signaling and activation of root defense by leaf damage in poplar. Can J Bot Rev Can Bot 85(12):1171–1181 71. Baldwin IT, Schmelz EA (1994) Constraints on an induced defense – the role of leaf-area. Oecologia 97(3):424–430 72. Orians C (2005) Herbivores, vascular pathways, and systemic induction: facts and artifacts. J Chem Ecol 31(10):2231–2242 73. Heil M, Ton J (2008) Long-distance signalling in plant defence. Trends Plant Sci 13:264–272 74. Millard P, Proe MF (1992) Storage and internal cycling of nitrogen in relation to seasonal growth of sitka spruce. Tree Physiol 10(1):33–43 75. Palacio S, Maestro M, Montserrat-Marti G (2007) Seasonal dynamics of non-structural carbohydrates in two species of mediterranean sub-shrubs with different leaf phenology. Environ Exp Bot 59(1):34–42 76. Scott GJ, Rosegrant MW, Ringler C (2000) Global projections for root and tuber crops to the year 2020. Food Policy 25(5):561–597 77. Bazot S, Mikola J, Nguyen C, Robin C (2005) Defoliation-induced changes in carbon allocation and root soluble carbon concentration in ﬁeld-grown Lolium perenne plants: do they affect carbon availability, microbes and animal trophic groups in soil? Funct Ecol 19(5):886–896 78. Hermsmeier D, Schittko U, Baldwin IT (2001) Molecular interactions between the specialist herbivore Manduca sexta (Lepidoptera, Sphingidae) and its natural host Nicotiana attenuata. I. Large-scale changes in the accumulation of growth- and defense-related plant mRNAs. Plant Physiol 125(2):683–700 79. Lalonde S, Tegeder M, Throne-Holst M, Frommer WB, Patrick JW (2003) Phloem loading and unloading of sugars and amino acids. Plant Cell Environ 26(1):37–56 80. Schwachtje J, Baldwin IT (2008) Why does herbivore attack reconﬁgure primary metabolism? Plant Physiol 146(3):845–851 81. Roitsch T, Gonzalez MC (2004) Function and regulation of plant invertases: sweet sensations. Trends Plant Sci 9(12):606–613 82. Robert HS, Friml J (2009) Auxin and other signals on the move in plants. Nat Chem Biol 5(5):325–332 83. Golecki B, Schulz A, Thompson GA (1999) Translocation of structural P proteins in the phloem. Plant Cell 11(1):127–140 84. Ruiz-Medrano R, Xoconostle-Cazares B, Lucas WJ (1999) Phloem long-distance transport of CmNACP mRNA: implications for supracellular regulation in plants. Development 126(20):4405–4419 85. Hummel GM, Naumann M, Schurr U, Walter A (2007) Root growth dynamics of Nicotiana attenuata seedlings are affected by simulated herbivore attack. Plant Cell Environ 30(10):1326–1336 86. Havelange A, Lejeune P, Bernier G (2000) Sucrose/cytokinin interaction in Sinapis alba at ﬂoral induction: a shoot-to-root-to-shoot physiological loop. Physiol Plant 109(3):343–350 87. Mithofer A, Boland W (2008) Recognition of herbivory-associated molecular patterns. Plant Physiol 146(3):825–831 88. Nürnberger T, Brunner F (2002) Innate immunity in plants and animals: emerging parallels between the recognition of general elicitors and pathogen-associated molecular patterns. Curr Opin Plant Biol 5(4):318–324 89. Okubara PA, Paulitz TC (2005) Root defense responses to fungal pathogens: a molecular perspective. Plant Soil 274(1–2):215–226 90. Millet YA, Danna CH, Clay NK, Songnuan W, Simon MD, Werck-Reichhart D, Ausubel FM (2010) Innate immune responses activated in Arabidopsis roots by microbe-associated molecular patterns. Plant Cell 22(3):973–990

12

The Role of Roots in Plant Defence

309

91. Vadassery J, Oelmuller R (2009) Calcium signaling in pathogenic and beneﬁcial plant microbe interactions: what can we learn from the interaction between Piriformospora indica and Arabidopsis thaliana. Plant Signal Behav 4(11):1024–1027 92. Peleg-Grossman S, Volpin H, Levine A (2007) Root hair curling and Rhizobium infection in Medicago truncatula are mediated by phosphatidylinositide-regulated endocytosis and reactive oxygen species. J Exp Bot 58(7):1637–1649 93. Beckers GJM, Spoel SH (2006) Fine-tuning plant defence signalling: salicylate versus jasmonate. Plant Biol 8(1):1–10 94. Wu JQ, Baldwin IT (2009) Herbivory-induced signalling in plants: perception and action. Plant Cell Environ 32(9):1161–1174 95. Pieterse CMJ, Leon-Reyes A, Van der Ent S, Van Wees SCM (2009) Networking by small-molecule hormones in plant immunity. Nat Chem Biol 5(5):308–316 96. Zhu CH, Gan LJ, Shen ZG, Xia K (2006) Interactions between jasmonates and ethylene in the regulation of root hair development in Arabidopsis. J Exp Bot 57(6):1299–1308 97. De Smet I, Zhang HM, Inze D, Beeckman T (2006) A novel role for abscisic acid emerges from underground. Trends Plant Sci 11(9):434–439 98. Vellosillo T, Martinez M, Lopez MA, Vicente J, Cascon T, Dolan L, Hamberg M, Castresana C (2007) Oxylipins produced by the 9-lipoxygenase pathway in Arabidopsis regulate lateral root development and defense responses through a speciﬁc signaling cascade. Plant Cell 19(3):831–846 99. Koul O (2008) Phytochemicals and insect control: an antifeedant approach. Crit Rev Plant Sci 27(1):1–24 100. Kant MR, Bleeker PM, Van Wijk M, Schuurink RC, Haring MA (2009) Plant volatiles in defence. In: Plant innate immunity, vol 51, Advances in botanical research. Academic, London, pp 613–666 101. Karban R, Baldwin IT (1997) Induced responses to herbivory. University of Chicago Press, Chicago 102. Turlings TCJ, Tumlinson JH, Lewis WJ (1990) Exploitation of herbivore-induced plant odors by host-seeking parasitic wasps. Science 250(4985):1251–1253 103. Rasmann S, Köllner TG, Degenhardt J, Hiltpold I, Toepfer S, Kuhlmann U, Gershenzon J, Turlings TCJ (2005) Recruitment of entomopathogenic nematodes by insect-damaged maize roots. Nature 434(7034):732–737 104. Hiltpold I, Turlings TCJ (2008) Belowground chemical signaling in maize: when simplicity rhymes with efﬁciency. J Chem Ecol 34(5):628–635 105. Degenhardt J, Hiltpold I, Kollner TG, Frey M, Gierl A, Gershenzon J, Hibbard BE, Ellersieck MR, Turlings TCJ (2009) Restoring a maize root signal that attracts insect-killing nematodes to control a major pest. Proc Natl Acad Sci USA 106(32):13213–13218

sdfsdf

Part IV

Mechanism and Signal Transduction

sdfsdf

Chapter 13

Activation of Grapevine Defense Mechanisms: Theoretical and Applied Approaches Marielle Adrian, Sophie Trouvelot, Magdalena Gamm, Benoît Poinssot, Marie-Claire Héloir, and Xavier Daire

Abstract Grapevine, as other plants, possesses an innate immune system that usually prevents infection by pathogens. General elicitors are compounds of different biochemical families capable of inducing plant defense reactions. In grapevine, the cascade of defense events induced by elicitors has been studied among others in cell suspensions. The perception of the elicitor triggers signaling events that allow the activation of defense genes encoding PR proteins and other proteins involved in phytoalexin production and cell wall reinforcement. The grapevine phytoalexins resveratrol and derivated compounds have been largely studied. In addition to their antimicrobial activity, they may also contribute to cell wall reinforcement. The mode of action and activity of elicitors depends on their chemical structure. Elicitors are of particular interest for crop protection since they can not only elicit defenses in a broad spectrum of plants, but are also mostly deprived of toxicity and suitable for industrial production from abundant sources. In spite of promising results, on the whole, application of induced resistance in the vineyard still often suffers from inconsistency and provides only limited disease control up to now.

13.1

Introduction

As most grown grapevine Vitis vinifera varieties are susceptible to various diseases such as downy and powdery mildews or grey mold, numerous treatments are required to ensure a satisfactory yield and the quality of the harvest. However, the use of phytochemical fungicides has serious drawbacks: some of them are

M. Adrian (* s34ROUVELOTs-'AMMs"0OINSSOTs- #(£LOIRs8$AIRE Unité Mixte de Recherche INRA 1088/CNRS 5184, Université de Bourgogne Plante-Microbe-Environnement, 17 rue Sully, BP 86510, 21065 Dijon Cedex, France e-mail: [email protected]

J.M. Mérillon and K.G. Ramawat (eds.), Plant Defence: Biological Control, Progress in Biological Control 12, DOI 10.1007/978-94-007-1933-0_13, © Springer Science+Business Media B.V. 2012

313

314

M. Adrian et al.

potentially harmful for the environment and human health and contribute to the selection of resistant pathogen strains. Nowadays, in an objective of sustainable viticulture, there is increasing societal request, political incitation and winegrower’s awareness to reduce the use of pesticides. For example, in France, the governmental plan “Ecophyto 2018” started in 2008 aims to reduce the use of pesticides by 50% until 2018. For these reasons, alternative strategies of protection are under research. Some of them are already experimented in greenhouses of research laboratories or developed in the vineyards. Among these strategies are the biological control, the use of resistant hybrids, and transgenic grapevines. In our laboratory, we are studying another alternative consisting in the activation of the grapevine defense reactions by compounds called elicitors. Such a strategy could be included in an integrated pest management strategy.

13.2

Elicitors of Defense Reactions

Plants are almost constantly in contact with potentially pathogenic microorganisms such as oomycetes, fungi or bacteria. However, due to defense mechanisms, disease is ﬁnally an exceptional outcome in plant-pathogen interactions. Plants possess preformed or constitutive defenses – such as the cuticle, cell walls, and phytoanticipins – that form physical and chemical barriers that are generally sufﬁcient to prevent infection by pathogens. However, if a microorganism successfully bypass or cross this ﬁrst line of defense, a molecular dialog begins between both partners, leading either to infection (the interaction is compatible and the pathogen virulent) or resistance (the interaction is incompatible and the pathogen avirulent) [1]. In plant/pathogen interactions, the plant resistance can be race/cultivar speciﬁc. This is the gene for gene model: the interaction between the product of a plant cultivar R gene and the cognate product of the pathogen race avr gene conditions the plant resistance [2]. More frequently, the resistance is not speciﬁc or non-host [3]. Due to similarities with the animal immune system, these defense responses are now referred to as the plant innate immunity [4–7]. The term elicitor was originally devoted to the products of avr genes capable of interacting with the plant R gene products, leading to the activation of defense reactions [8]. This term has been later extended to compounds able to activate plant defense reactions [9]. Among these compounds are general elicitors belonging to various biochemical families: carbohydrates, lipids, (glyco)peptides and (glyco) proteins. They are active in different plant species and induce a protection against various pathogens. Most of them are secreted by the pathogen or derived from its cell wall during interaction with the plant. These elicitors, now called PAMP (Pathogen Associated Molecular Pattern) or MAMP (Microbe Associated Molecular Pattern) [1, 6, 10, 11], are responsible for a PAMP triggered immunity (PTI). Such molecular patterns have been highly conserved during evolution [12]. These elicitors can also derived from the plant cell wall, after hydrolysis by pathogen cell wall degrading enzymes during the interaction [13, 14], or from algae cell walls [15–17]. Perception

13

Activation of Grapevine Defense Mechanisms: Theoretical and Applied Approaches

315

of some general elicitors by the plant is likely to be achieved by pattern recognition receptors (PRR) [18] present at the plant cell surface. However, few PRR have been identiﬁed. For example, in Arabidopsis, FLS2 and EFR are two LRR-RLK (leucin rich repeat receptor-like kinase) that recognize the bacterial ﬂagellin (ﬂg22) and elongation factor EF-Tu (elf18), respectively [5, 19]. Elicitor perception by the plant i- triggers a cascade of signaling events that ii- enables the activation of defense genes which expression iii- leads to defense reactions including phytoalexin production, pathogenesis related (PR) proteins synthesis, cell-wall strengthening, and sometimes the hypersensitive response (HR). The phytohormones salicylic acid (SA), jasmonic acid (JA), ethylene and abscisic acid are also involved in defense signaling and their role depends on plant/pathogen interactions [20].

13.3

Grapevine Defenses: From Signaling Events to Defense Reactions

As indicated above, the perception of an elicitor by a plant cell triggers a complex cascade of events leading to the defense reactions. We have used Vitis vinifera cv Gamay cell suspensions treated by the elicitor BcPG1 (see below) to precisely describe the early signaling events [21]. The perception of BcPG1 triggers a calcium inﬂux responsible for an increase in the cytoplasmic calcium concentration that activates protein kinases and NO production. NO then induces an efﬂux of calcium from intracellular pools that activates the AOS (active oxygen species) production and the expression of defense genes, leading to the production of phytoalexins (Fig. 13.1). The early events preceding the activation of defense genes were similar to those described in tobacco cells in response to cryptogein [22] but seemed to be differently regulated. Up to now, few defense genes are known in grapevine, mainly PAL (Phenylalanine ammonia lyase), VST or STS (stilbene synthase), LOX (lipoxygenase), CHIT (chitinase), GLU (glucanases), and PGIP (polygalacturonase inhibiting protein) and their expression has been followed in response to various elicitors. The recent grapevine genome sequencing [23] now facilitates the study of changes in the level of global gene expression in response to elicitors or pathogen infection. A microarray approach was recently used to study transcriptional changes associated with P. viticola infection in a susceptible (V. vinifera) and resistant (V. riparia) Vitis species [24]. The authors showed that the resistance of V. riparia was not associated to a different basal gene expression compared to V. vinifera but to a more rapid and higher induction of defense gene expression, especially those encoding PR-proteins and enzymes involved in the phenylpropanoid pathway. It also involves a speciﬁc modulation of the expression of genes encoding components of signaling events, hypersensitive reaction, and JA pathway. Similar studies on changes in gene expression in response to elicitors will rapidly emerge. Different PR-proteins have been identiﬁed in grapevine. Several chitinases (PR3, PR4, PR8, PR11), constitutive or inducible by wounding, salicylic acid treatment or

316

M. Adrian et al.

Fig. 13.1 Scheme representing the cascade of events induced by the BcPG1 elicitor in grapevine cells. The perception of the elicitor (1) triggers a calcium inﬂux (2), leading to an increase of the cytoplasmic calcium concentration that activates protein kinases and NO production (3). NO then induces efﬂux of calcium from intracellular pools (4), anion efﬂux (5), AOS production (6) and the expression of defense genes (7), leading to the production of PR proteins and phytoalexins and other phenolic compounds (8) and to cell wall strengthening (9)

infection by Plasmopara viticola, Erysiphe necator and Botrytis cinerea, have been reported in leaves [25–29]. They are also present in berries where they are supposed to contribute to counteract B. cinerea development [30–32]. ß-1,3-glucanases (PR2) have been identiﬁed in leaves in response to salicylic acid or B. cinerea [33] but no activity could be detected in berries [30, 31]. Other PR-proteins have been described such as osmotins or thaumatin-like protein [28], a ribonuclease-like protein [34] and a lipid transfer protein or LTP (PR14) [32, 35]. The involvement of these PR proteins in grape defense is probable but remains to be ascertained. Grapevine phytoalexin are stilbene compounds including the 3,5,4c-trihydroxystilbene or resveratrol [36] and derivatives. Resveratrol is indeed the precursor of viniferins and pterostilbene. Viniferins are resveratrol dimers (H- and G-viniferins [37, 38]), trimer (D-viniferin [39]) and tetramer (ß-viniferin [40]) whereas pterostilbene

13

Activation of Grapevine Defense Mechanisms: Theoretical and Applied Approaches

317

is a dimethylated resveratrol derivative (3,5-dimethoxy, 4c-hydroxystilbene [41]). There are also glycosylated derivatives of resveratrol such as piceid [42, 43] and astringin [44]. Due to their chemical structure, most of these stilbenes emit a blue purple ﬂuorescence when they are exposed to long wave UV light, allowing their observation in situ. In these conditions, the intensity of the ﬂuorescence is generally correlated to stilbene concentration [45]. Stilbenes are synthesized via the phenylalanine/polymalonate pathway. PAL and STS are two key enzymes of resveratrol synthesis. PAL synthesizes cinnamic acid from phenylalanine, and stilbene synthase converts one molecule of p-coumaroyl-CoA and three molecules of malonyl-CoA into 3,5,4c-trihydroxystilbene or resveratrol [46]. PAL and STS genes belong to large multigene families [47–52]. A coordinated expression of both genes was observed in V. vinifera cv. Optima cells treated with a fungal cell wall preparation [48] and in leaves of Cissus antarctica in response to UV treatment [46]. STS shares signiﬁcant homology with chalcone synthase (CHS) at the DNA and protein levels. Both enzymes catalyze common condensation reactions of p-coumaroyl-CoA and three units from malonyl-CoA but different cyclization reactions to produce resveratrol and naringenin-chalcone (ﬂavonoid biosynthesis pathway), respectively [53]. Stilbenes play a role in grapevine defense. They are constitutively accumulated in high concentrations in the heartwood of grapevine trunks where they certainly prevent wood decay caused by fungi [54–56]. They are also accumulated in leaves or berries in response to infection by pathogens such as P. viticola or B. cinerea and their antifungal properties have been studied [57–60]. Resveratrol does not possess a high antimicrobial activity [57] but it is generally accumulated in high concentrations in response to elicitation or pathogen attack and it is the precursor of more active derivatives. Correlations between the ability of grapevine varieties or species to produce stilbenes and their tolerance to cryptogamic diseases have been established [61–64]. Moreover, the foreign expression of stilbene synthase gene in plants or its overexpression in grapevine usually leads to an increased resistance against pathogens [65, 66]. Resveratrol and derivatives are clearly identiﬁed as phytoalexins [39, 57–60] and their production is also induced by several abiotic stresses such as UV-C, ozone or aluminum chloride [36, 67, 68]. UV-C irradiation has long been used to study stilbene synthesis in grapevine since it induces a high and reproducible response [46, 62, 69, 70]. The accumulation of other phenolic compounds has been described in response to infection, especially in grapevine leaves infected by P. viticola. Flavonoids were detected in stomata and surrounding cells in the resistant species V. rotundifolia 2 days post inoculation whereas they were detected later in the intermediate resistant species V. rupestris and almost not detected in the susceptible V. vinifera species [61]. Therefore, ﬂavonoids certainly contribute to the grapevine resistance to downy mildew. Grapevine cell wall strengthening has been studied at both chemical and physical levels. Using atomic force microscopy (AFM), we showed a loss of elasticity of the cell walls of Gamay cells in response to elicitor treatment and UV-C irradiation [71]. Resveratrol and derivatives may participate to the cell wall strengthening, probably by a peroxidase-mediated cross-linking with cell-wall constituents [72].

318

M. Adrian et al.

Fig. 13.2 Cell wall cross-linking of resveratrol. A solution of resveratrol (500 PM) was added to a Gamay cell suspension. The ﬂuorescence of the stilbene was followed using an epiﬂuorescence microscope under UV (Lex 340 nm–Lem 380 nm, stop filter LP 430 nm). The natural blue purple ﬂuorescence of the stilbene is ﬁrst located in the culture medium and progressively accumulated at the cell wall level. Observations at 0 (A), 3 (B) and 25 min post treatment (C) (×100)

Fig. 13.3 Observation of the lower side of a UV-irradiated leaf of V. rupestris by epiﬂuorescence microscopy. Note the blue purple ﬂuorescence of stilbenes at the cell wall and stomata levels. Observations were made in situ using an epiﬂuorescence microscope under UV (Lex 340 nm–Lem 380 nm, stop filter LP 430 nm). (Leica) (×100)

There is indirect evidence that resveratrol or derivatives can be linked to the cell wall. For example, if resveratrol is added to a cell suspension, the stilbene ﬂuorescence is ﬁrst detected in the culture medium and progressively accumulates at the cell wall level (Fig. 13.2). Similarly, observation of a Vitis rupestris leaf lower side irradiated by UV-C reveals the presence of a blue purple ﬂuorescence mainly located at the cell wall level of epidermal and guard cells (Fig. 13.3). Another indirect evidence of the stilbene cross-linking to cell walls is provided by the in situ observations of petiolar transverse sections after absorption of a resveratrol solution

13

Activation of Grapevine Defense Mechanisms: Theoretical and Applied Approaches

319

Fig. 13.4 Observation of transverse sections of Marselan leaf petioles. Sections were made after petiolar absorption of a methanol/water solution (2% v/v) (A) or a solution of resveratrol (500 PM, 2% ﬁnal methanol concentration) (B). Observations were made in situ using an epiﬂuorescence microscope under UV (Lex 340 nm–Lem 380 nm, stop filter LP 430 nm), (× 50). co collenchyma, pa parenchyma, sc sclerenchyma, xy xylem

Fig. 13.5 Analysis of phenols linked to cell walls of V. rupestris leaves. The cell wall linked phenols were extracted from control (gray bars) and UV-irradiated leaves (black bars) using thioglycolic acid and their level were determined by spectrophotometry (280 nm)

(petiolar absorption). The characteristic blue purple ﬂuorescence of the stilbene is localized at the cell-wall level of the non-ligniﬁed tissues such as parenchyma and collenchyma (Fig. 13.4). In the ligniﬁed tissues (xylem, sclerenchyma), the presence of resveratrol modiﬁes the natural blue light ﬂuorescence of the cell wall in yellow (Fig. 13.4). As phenolic compounds were supposed to play a role in cell wall reinforcement, we have extracted and analyzed the cell wall linked phenolics in V. rupestris leaves treated by UV-C. We have observed that their level increased with time (Fig. 13.5). Using Gamay cell suspensions, we observed that resveratrol and H-viniferin were synthesized in response to elicitor treatment. Resveratrol was

320

M. Adrian et al.

Fig. 13.6 Stilbene production and localization in Gamay cell suspensions treated with different elicitors. Cell suspensions were treated by elicitors (BcPG1, laminarin and an oligogalacturonide) and stilbenes were extracted, separately from cells and the culture medium, from 0 to 72 h post treatment and analyzed by HPLC. Stilbenic compounds were detected in the culture medium (a) and in cells (b). R-lam, R-OG and R-BcPG1: levels of resveratrol induced by laminarin, an oligogalactonide and BcPG1, respectively. V-lam, V-OG and V-BcPG1: levels of H-viniferin induced by laminarin, an oligogalactonide and BcPG1, respectively

in higher concentration in the culture medium whereas H-viniferin was generally in higher concentration in cells (Fig. 13.6). The occurrence of resveratrol in the culture medium indicates that it is excreted from cells. So, our hypothesis is that a part of the excreted resveratrol is cross-linked to cell wall. The modality of resveratrol excretion remains unknown. In V. rotundifolia and V. rupestris leaves inoculated with P. viticola, ﬂavonoids were also found to be bound to the cell wall [61]. All these observations suggest that the secondary metabolites resveratrol, derivative compounds, and ﬂavonoids contribute to the reinforcement of cell wall in response to infection or elicitor treatment.

13.4

Activation of Defense Reactions in Grapevines: Interesting Examples

Different elicitors are able to be recognized by grapevine cells and to induce defense reactions. However, the mode of action of these compounds and/or the biological signiﬁcance of their activity is sometimes different. The aim of this paragraph is to illustrate this point, using experimental results as examples.

13.4.1

Elicitors and Stomata

Stomata, the natural pores present on leaf surfaces, constitute openings providing direct access to leaf inner tissues for numerous pathogens such as bacteria, oomycetes and fungi. Pathogens are able to manipulate these structures to facilitate infection, as

13

Activation of Grapevine Defense Mechanisms: Theoretical and Applied Approaches

321

described for Arabidopsis/Pseudomonas syringae interaction [73]. In grapevine, stomata are also affected during P. viticola infection [74]. In such interactions, stomata constitute the ﬁrst site of the molecular dialog between the plant and the microorganism and can be the site of defense reactions. In grapevine, the downy mildew resistant hybrid Solaris secretes callose at the level of stomata, preventing zoospores entry [75]. The production of callose and lignin in the stomatal pore and guard cells has also been reported in the resistance primed by ß-amino butyric acid (BABA) in the susceptible Chasselas [76]. Similarly, stilbenes and other phenolic compounds are accumulated in stomata in V. rotundifolia and V. rupestris in response to P. viticola infection [61]. The closure of stomata involves signaling events similar to those described in cells after elicitation. Indeed, the ABA-induced stomatal closure triggers H2O2 and NO production, activation of MAP kinases and increase in intracellular calcium concentration in guard cells (for Review, see [77]). Interestingly, elicitors are able to induce stomatal closure via the production of AOS, NO or an intracellular Ca2+ accumulation. Some of these events were described in tomato and Commelina communis in response to oligogalacturonates and chitosan [78] and in Arabidopsis in response to elicitors [79]. All these data let us to hypothesize that elicitors able to effectively protect grapevine leaves against P. viticola (known to enter leaves through stomata) may induce stomatal closure. We have demonstrated that some elicitors were indeed able to induce the closure of grapevine stomata [80]. However, we found no correlation between the ability of an elicitor to close grapevine leaf stomata and its efﬁcacy to confer protection against downy mildew. This example shows that signaling events can be triggered by various stimuli (ABA and elicitors in this case) and lead to various processes: a physical mechanism of closure and a metabolic mechanism of defense reactions.

13.4.2

The Endopolygalacturonase 1 from B. cinerea

B. cinerea is the fungus responsible for grey mold that can seriously affect the quality and quantity of the harvest. We have puriﬁed an elicitor of grapevine defense reactions from culture ﬁltrates of B. cinerea [81]. This was a glycoprotein of 40 kDa identiﬁed as the endopolygalacturonase 1 secreted by B. cinerea (BcPG1). In Gamay cell suspensions, BcPG1 induces calcium inﬂux, production of AOS and NO, activation of MAP kinases, defense gene transcript accumulation, and phytoalexin production. Endopolygalacturonases are normally devoted to hydrolyze plant cell walls and can release oligogalacturonides (OGA) from non-methylated homogalacturonans, the major components of pectins [82]. As OGA were also known to be efﬁcient elicitors [83, 84], the question remained whether defense reactions were induced by the enzyme itself or by the plant cell wall released products resulting from its activity. Chemical treatments of BcPG1, desensitization assays and comparison of defense reactions induced by BcPG1/OGA in cell suspensions ruled out of the second hypothesis. Surprisingly, BcPG1 behaves as an elicitor of defense in grapevine, and then as an avirulence factor, whereas it was described as a virulence

322

M. Adrian et al.

factor associated to B. cinerea pathogenicity on tomato [85]. Other similar examples showing this dual function ie elicitor or virulence factor have been described. For example, extracellular proteins from Cladosporium fulvum have been identiﬁed as virulence or avirulence factors, depending upon genotype of the host tomato [86, 87]. Bacterial proteins such as “type III effector proteins” can also be involved in the virulence and the activation of plant defense responses [88, 89]. The maintenance of avirulence genes in pathogens suggests that these genes play a role in virulence of the pathogen on susceptible plant hosts [90]. For B. cinerea, the production of active oxygen species (AOS) by grapevine in response to BcPG1 probably favors the development of the necrotrophic fungus [91]. The B. cinerea mutant deleted in BcPG1 is affected in its pathogenicity [85], probably due to the loss of its ability to induce AOS production. This example shows how a pathogen has evolved to exploit a defense reaction of the host plant to facilitate infection.

13.4.3

Oligosaccharides as Resistance Inducers to Grape Diseases

Oligosaccharides, deriving from plant or microorganism cell walls, have been shown to be signal molecules, with various biological activities, including activation of defense reactions in several plants [92, 93]. These general elicitors are now considered as MAMP. Moreover, they are of particular interest for crop protection since they can not only elicit defenses in a broad spectrum of plants, but are also mostly deprived of toxicity and suitable for industrial production from abundant sources. Laminarin is a ß-1,3-glucan with a DP of approximatively 33, extracted from the brown algae Laminaria digitata. In tobacco plants, it induces PAL, caffeic acid O-methyl transferase, lipoxygenase activities, PR proteins, salicylic acid accumulation, and resistance against Erwinia carotovora [16]. It also triggers defense reactions in alfalfa [94] and rice [95]. In grapevine cell suspensions, laminarin induces calcium inﬂux, alkalinization of the extracellular medium, oxidative burst, activation of MAP kinases and defense genes, PR-proteins chitinase and ß-glucanase activities, and production of the phytoalexins resveratrol and H-viniferin [96]. It confers a protection of grapevine plantlets against downy mildew and grey mold [96]. Oligogalacturonic acid (dp ~ 25) elicits a pattern of defense events similar to that of laminarin and also signiﬁcantly protects grapevine against P. viticola (Fig. 13.7) in controlled conditions. Chemical modiﬁcation of oligosaccharides probably represents a promising approach to improve their biological properties. For instance, PS3, a compound obtained by chemical sulfation of laminarin, was shown to induce both jasmonateand salicylate-dependent defenses in tobacco and Arabidopsis whereas laminarin activated only the jasmonate-dependant pathway. PS3 also proved more effective in inducing resistance against the tobacco mosaic virus than laminarin [97]. The authors demonstrated that the sulfate residues and a minimum ß-1,3 glucan chain length were essential for PS3 activity. Similarly, PS3 induced grapevine resistance

13

Activation of Grapevine Defense Mechanisms: Theoretical and Applied Approaches

323

100

Leaf sporulating area (%)

90 80 70 60 50 40 30 20 10

m g/

g/ G

A G O

A

(2

(5

.5

m

m

5m .2 (1 A G

L)

L) m

m g/

ct rfa Su O

O

t an

er at W

L)

0

Fig. 13.7 Oligosaccharide-induced resistance against downy mildew. The leaves of Marselan plantlets grown in the greenhouse were spray-treated with an oligolacturonide (OGA, 1.25, 2.5 and 5 mg.mL−1) plus a surfactant, surfactant alone or water and inoculated with P. viticola 48 h post treatment. Disease severity was assessed by estimating sporulating area at 7 days post inoculation Table 13.1 Comparison of the defense events induced by laminarin and PS3 in Gamay cell suspensions and Marselan plants grown in greenhouses, and of the level of induced resistance against P. viticola (Pv) Laminarin PS3 Defense events Calcium inﬂux + − (cell suspensions) MAPK Activation + − H2O2 production + − Defense genes induction + +/− In planta defense events

H2O2 production Defense genes induction Autoﬂuorescence (under UV light) Callose deposition

Induced resistance against P. viticola

− Pv

+Pv

− Pv

+Pv

+ + + −

+ + + −

− +/− − −

+ + + +

+

++

against P. viticola at a higher level than the non-sulfated molecule. Surprisingly PS3 activated none of the defense events triggered in grapevine cell suspensions by laminarin (Table 13.1). However, in PS3-treated grapevine plants challenged with P. viticola, H2O2 production at the infection sites (Fig. 13.8), up-regulation of

324

M. Adrian et al.

Fig. 13.8 Oligosaccharide-induced resistance against downy mildew. The leaves of Marselan plantlets grown in the greenhouse were spray-treated with PS3. The production of H2O2 (visualized by DAB staining (dark arrows)) at the site of infection restricts P. viticola development (white arrow). Bars represent 50 Mm

Fig. 13.9 Stilbene and other phenolic compounds accumulation in response to P. viticola infection in leaves of the susceptible grapevine Marselan treated by PS3 and the non treated resistant V. Rupestris. Observations were performed in situ using an epiﬂuorescence microscope under UV (Lex 340 nm–Lem 380 nm - stop ﬁlter LP 430 nm). Bars represent 100 Mm

13

Activation of Grapevine Defense Mechanisms: Theoretical and Applied Approaches

325

defense-related genes, callose and phenol depositions and hypersensitive response-like cell death were readily detected [98]. Thus, in this case, PS3 primes defense reactions: it triggers more rapid and intense responses once the pathogen attempts to infect the plant [99]. The mechanisms underlying priming remain poorly understood but it is believed to be beneﬁcial since it brings about a lower metabolic cost for the plant than elicitors in the absence of pathogen [100]. Another compound, BABA is known to potentiate defense reactions in grapevine [76] and in other plants such as Arabidopsis [101]. At the cytological level, we found that PS3-induced resistance (PS3-IR) mimicked into some extent the defense responses observed in the tolerant species V. rupestris, as illustrated in Fig. 13.9. Though pharmacological studies indicated that PS3-IR probably depends on jasmonic acid pathway [98], some data suggest that it also relies on other pathways that still remain to be precised.

13.5

Application of Induced Resistance to Grapevine Disease in the Vineyard

The major practical interest of elicitors is their potential use in crop protection. In spite of a wealth of results in controlled conditions, only a limited number of publications have reported effective induced resistance in the ﬁeld, and this also holds true for vineyard trials. Reuveni [102] found that BABA successfully protected grapevine against P. viticola in Israel. However our own results with this compound in France were quite disappointing (unpublished data) maybe because environmental conditions were less favorable to the pathogen in the Golan than in northern France. Later, application of methyl jasmonate proved to induce defense reactions in grape and to reduce powdery mildew severity by 70% in out-door trials [103], suggesting that the grapevine’s defense against Erysiphe necator, relies on JA. Benzothiadiazol (BTH), a synthetic analog of SA, marketed as Bion, has been extensively studied as resistance inducer in laboratory conditions, and most of publications of ﬁeld experiments deal with this compound. It can be very effective against certain diseases in ﬁeld conditions [104], but it is of limited efﬁcacy against downy and powdery mildew in the vineyard [105]. However, BTH may be of interest to control grey mold as a reduction of about 30% of disease severity on bunches has been reported [106]. As far as oligosaccharides are concerned, scientiﬁc publications reporting results from vineyard experiments are scarce. According to our own experience, preliminary results with PS3 against powdery mildew were promising. The potential of oligosaccharides to induce resistance against this disease was conﬁrmed by others (P. van Cutsem 2010, personal communication). In spite of promising results, on the whole, application of induced resistance in the vineyard still often suffers from inconsistency and provides only limited disease control. This may be due to several reasons. One issue is the screening of molecules effective against the main grape pathogens. A screening using plants grown in greenhouses is a seductive approach. However, it is too much time and space

326

M. Adrian et al.

consuming and it requires sufﬁcient quantities of molecules for tests. Being a straight forward procedure, search for defense reactions in cell suspensions is often used to screen elicitors. However, molecules able to induce early defense reactions in cell suspensions (i.e. H2O2 production, MAPK activation, intracellular calcium variations) do not systematically confer protection against pathogens when applied on plants [107]. In addition, as said above, this procedure is not suitable to detect priming agent such as PS3, which effect is mainly detectable upon pathogen challenge. Thus, many compound effective in eliciting so-called defense events in cell suspension failed to induce resistance in plant against a particular pathogen. These observations highlight the difﬁculty to screen and validate elicitors able to effectively protect plants. Another point could be the limited rate of penetration of some elicitors into the leaf. This may be particularly true for oligosaccharides, usually hydrophilic molecules of high molecular weight (>1,000 Da), which likely do not pass easily through the hydrophobic cuticular barrier. These aspects are often neglected by researchers though appropriate surfactants can enhance the penetration of such compounds. Finally one should keep in mind that induced resistance is a plant response, which is therefore inﬂuenced by various factors, essentially unknown as yet. For instance how is affected the plant’s response to elicitation by its developmental stage, what is the inﬂuence of both host and pathogen genotype, of abiotic stress or of nutrition factors are still unanswered questions which need speciﬁc research. This should help introduction of resistance inducers into future integrated disease control management and reducing the use of pesticides. Acknowledgments The authors thank J Negrel A Büchwalter, C Dubreuil, A Gauthier, A Klinguer and E Steimetz for their contribution to experiments presented in this chapter. Parts of the work received the ﬁnancial support of the Conseil Régional de Bourgogne, Bureau Interprofessionnel des Vins de Bourgogne (BIVB) and Goëmar.

References 1. Jones JDG, Dangl JL (2006) The plant immune system. Nature 444:323–329 2. Flor HH (1942) Inheritance of pathogenicity in Melampsora lini. Phytopathology 32:653–669 3. Thordal-Christensen H (2003) Fresh insights into processes of non host resistance. Curr Opin Plant Biol 6:351–357 4. Boller T, Felix G (2009) A renaissance of elicitors: perception of microbe-associated molecular patterns and danger signals by pattern-recognition receptors. Annu Rev Plant Biol 60:379–406 5. Gomez-Gomez L, Boller T (2000) FLS2: an LRR receptor-like kinase involved in the perception of the bacterial elicitor ﬂagellin in Arabidopsis. Mol Cell 5:1003–1011 6. Nürnberger T, Brunner F, Kemmerling B, Piater L (2004) Innate immunity in plants and animals. Striking similarities and obvious differences. Immunol Rev 198:249–266 7. Zipfel C, Felix G (2005) Plants and animals: a different taste for microbes? Curr Opin Plant Biol 8:353–360 8. Keen NT, Partridge TE, Ai Zaki T (1972) Pathogen-produced elicitor of a chemical defense mechanism in soybeans monogenically resistant to Phytophthora megasperma f. sp. glycinea. Phytopathology 62:768 9. Ebel J, Cosio EG (1994) Elicitors of plant defense responses. Int Rev Cytol 148:1–36

13

Activation of Grapevine Defense Mechanisms: Theoretical and Applied Approaches

327

10. Albersheim P, Darvill A (1985) Oligosaccharins. Sci Am 253:44–50 11. Côté F, Hahn M (1994) Oligosaccharins: structures and signal transduction. Plant Mol Biol 26:1379–1411 12. Mackey D, Fall M (2006) MAMPs and MIMPs: proposed classiﬁcations for inducers of innate immunity. Mol Microbiol 61:1365–1371 13. Boudart G, Charpentier M, Laﬁtte C, Martinez Y, Jauneau A, Gaulin E, Esquerré-Tugayé MT, Dumas B (2003) Elicitor activity of a fungal endopolygalacturonase in tobacco requires a functional catalytic site and cell wall localization. Plant Physiol 131:93–101 14. Vidal S, Eriksson ARB, Montesano M, Denecke J, Palva ET (1998) Cell wall-degrading enzymes from Erwinia carotovora cooperate in the salicylic acid-independent induction of a plant defense response. Mol Plant Microbe Interact 11:23–32 15. Bouarab K, Potin P, Correa J, Kloareg B (1999) Sulfated oligosaccharides mediate the interaction between a marine red alga and its green algal pathogenic endophyte. Plant Cell 11:1635–1650 16. Klarzynski O, Plesse B, Joubert J, Yvin J, Kopp M, Kloareg B, Fritig B (2000) Linear beta-1,3 glucans are elicitors of defense responses in tobacco. Plant Physiol 124:1027–1038 17. Potin P, Bouarab K, Küpper F, Kloareg B (1999) Oligosaccharide recognition signals and defence reactions in marine plant-microbe interactions. Curr Opin Microbiol 2:276–283 18. Zipfel C (2008) Pattern-recognition receptors in plant innate immunity. Curr Opin Immunol 20:10–16 19. Zipfel C, Kunze G, Chinchilla D, Caniard A, Jones JD, Boller T, Felix G (2006) Perception of the bacterial PAMP EF-Tu by the receptor EFR restricts Agrobacterium-mediated transformation. Cell 125:749–760 20. Bari R, Jones J (2009) Role of plant hormones in plant defence responses. Plant Mol Biol 69:473–488 21. Vandelle E, Poinssot B, Wendehenne D, Bentejac M, Pugin A (2006) Integrated signaling network involving calcium, nitric oxide, and active oxygen species but not mitogen-activated protein kinases in BcPG1-elicited grapevine defenses. Mol Plant Microbe Interact 19:429–440 22. Garcia-Brugger A, Lamotte O, Vandelle E, Bourque S, Lecourieux D, Poinssot B, Wendehenne D, Pugin A (2006) Early signaling events induced by elicitors of plant defenses. Mol Plant Microbe Interact 19:711–724 23. Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro F, Anthouard V, Vico V, Del Fabbro C, Alaux M, Di Gaspero G, Dumas V, Felice N, Paillard S, Juman I, Moroldo M, Scalabrin S, Canaguier A, Le Clainche I, Malacrida G, Durand E, Pesole G, Laucou V, Chatelet P, Merdinoglu D, Delledonne M, Pezzotti M, Lecharny A, Scarpelli C, Artiguenave F, Pe ME, Valle G, Morgante M, Caboche M, Adam-Blondon AF, Weissenbach J, Quetier F, Wincker P, French-Italian Public Consortium for Grapevine Genome Characterization (2007) The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla. Nature 449:U463–U465 24. Polesani M, Desario F, Ferrarini A, Zamboni A, Pezzotti M, Kortekamp A, Polverari A (2010) General and species-speciﬁc transcriptional responses to downy mildew infection in a susceptible (Vitis vinifera) and a resistant (V. riparia) grapevine species. BMC Genomics 11:117 25. Busam G, Kassemeyer HH, Matern U (1997) Differential expression of chitinases in Vitis vinifera L. responding to systemic acquired resistance activators or fungal challenge. Plant Physiol 115:1029–1038 26. Derckel JP, Legendre L, Audran JC, Haye B, Lambert B (1996) Chitinase of the grapevine (Vitis vinifera L.): ﬁve isoforms induced in leaves by salicylic acid are constitutively expressed in others tissues. Plant Sci 119:31–37 27. Derckel JP, Baillieul F, Manteau S, Audran JC, Haye B, Lambert B, Legendre L (1999) Differential induction of grapevine defenses by two strains of Botrytis cinerea. Phytopathology 89:197–203 28. Jacobs AK, Dry IB, Robinson SP (1999) Induction of different pathogenesis-related cDNAs in grapevine infected with powdery mildew and treated with ethephon. Plant Pathol 48:325–336

328

M. Adrian et al.

29. Robert N, Roche K, Lebeau Y, Breda C, Boulay M, Esnault R, Buffard D (2002) Expression of grapevine chitinase genes in berries and leaves infected by fungal or bacterial pathogens. Plant Sci 162:389–400 30. Derckel JP, Audran JC, Haye B, Lambert B, Legendre L (1998) Characterization, induction by wounding and salicylic acid, and activity against Botrytis cinerea of chitinases and E-1,3glucanases of ripening grape berries. Physiol Plant 104:56–64 31. Robinson SP, Jacobs AK, Dry IB (1997) A class IV chitinase is highly expressed in grape berries during ripening. Plant Physiology 114:771–778 32. Salzman R, Tikhonova I, Bordelon B, Hasegawa P, Bressan R (1998) Coordinate accumulation of antifungal proteins and hexoses constitute a developmentally controlled defense response during fruit ripening in grape. Plant Physiol 117:465–472 33. Renault AS, Deloire A, Bierne J (1996) Pathogenesis-related proteins in grapevine induced by salicylic acid and Botrytis cinerea. Vitis 35:49–52 34. Robert N, Ferran J, Breda C, Coutos-Thévenot P, Boulay M, Buffard D, Esnault R (2001) Molecular characterization of the incompatible interaction of Vitis vinifera leaves with Pseudomonas syringae pv. pisi: expression of genes coding for stilbene synthase and class 10 PR protein. Eur J Plant Pathol 107:249–261 35. Gomes E, Sagot E, Gaillard C, Laquitaine L, Poinssot B, Sanejouand Y, Delrot S, CoutosThevenot P (2003) Nonspeciﬁc lipid-transfer protein genes expression in grape (Vitis sp.) cells in response to fungal elicitor treatments. Mol Plant Microbe Interact 16:456–464 36. Langcake P, Pryce RJ (1976) The production of resveratrol by Vitis vinifera and other members of the Vitaceae as a response to infection or injury. Physiol Mol Plant Pathol 9:77–86 37. Langcake P, Pryce RJ (1977) A new class of phytoalexins from grapevines. Experientia 33:151–152 38. Pezet R, Perret C, Jean-Denis JB, Tabacchi R, Gindro K, Viret O (2003) Delta-viniferin, a resveratrol dehydrodimer: one of the major stilbenes synthesized by stressed grapevine leaves. J Agric Food Chem 51:5488–5492 39. Pryce RJ, Langcake P (1977) Alpha-viniferin: an antifungal resveratrol trimer from grapevines. Phytochemistry 16:1452–1454 40. LangcakeP PRJ (1977) Oxidative dimerization of 4-hydroxystilbene in vitro: production of grapevine phytoalexin mimic. J Chem Soc Chem Commun 1412:208–210 41. Langcake P, Cornford CA, Pryce RJ (1979) Identiﬁcation of pterostilbene as a phytoalexin from Vitis vinifera leaves. Phytochemistry 18:1025–1027 42. Jeandet P, Bessis R, Sbaghi M, Meunier P (1994) Occurence of a resveratrol-E-D-glucoside in wine. Vitis 33:183–184 43. Waterhouse L, Lamuela-Raventos R (1994) The occurence of piceid, a stilbene glucoside in grape berries. Phytochemistry 37:571–573 44. Goldberg DM, Ng E, Karumanchiri A, Diamandis EP, Soleas GJ (1995) The assay of resveratrol glycosides and isomers in wine by direct-injection HPLC. J Chromatogr A 708:89–98 45. Poutaraud A, Latouche G, Martins S, Meyer S, Merdinoglu D, Cerovic ZG (2007) Fast and local assessment of stilbene content in grapevine leaf by in vivo ﬂuorometry. J Agric Food Chem 55:4913–4920 46. Fritzemeier KH, Kindl H (1981) Coordinate induction by UV light of stilbene synthase, phenylalanine ammonia lyase and cinnamate 4-hydroxylase in leaves of Vitaceae. Planta 151:48–52 47. Lanz T, Schröder G, Schröder J (1990) Differential regulation of genes for resveratrol synthase in cell cultures of Arachis hypogea. Planta 181:169–175 48. Melchior F, Kindl H (1991) Coordinate-and elicitor-dependant expression of stilbene synthase and phenylalanine ammonia lyase genes in Vitis cv Optima. Arch Biochem Biophys 288: 552–557 49. Richter H, Pezet R, Viret O, Gindro K (2005) Characterization of 3 new partial stilbene synthase genes out of over 20 expressed in Vitis vinifera during the interaction with Plasmopara viticola. Physiol Mol Plant Pathol 67:248–260 50. Schröder G, Brown J, Schröder J (1988) Molecular analysis of resveratrol synthase. cDNA, genomic clones and relationship with chalcone synthase. Eur J Biochem 172:161–169

13

Activation of Grapevine Defense Mechanisms: Theoretical and Applied Approaches

329

51. Sparvoli F, Martin C, Scienza A, Gavazzio G, Tonelli C (1994) Cloning and molecular analysis of structural genes involved in ﬂavonoid and stilbene biosynthesis in grape (Vitis vinifera L.). Plant Mol Biol 24:743–755 52. Wiese W, Vornam B, Krause E, Kindl H (1994) Structural organization and differential expression of three stilbene synthase genes located on a 13 kb grapevine DNA fragment. Plant Mol Biol 26:667–677 53. Schröder J, Schröder G (1990) Stilbene and chalcone synthases: related enzymes with key functions in plant-speciﬁc pathways. Z Naturforsch 45:1–8 54. Hart JH (1981) Role of phytostilbenes in decay and disease resistance. Annu Rev Phytopathol 19:437–458 55. Hart JH, Shrimpton DM (1979) Role of stilbenes in resistance of wood to decay. Phytopathology 69:1138–1143 56. Schultz TP, Hubbard TF, Jin L, Fisher TH, Nicholas DD (1990) Role of stilbenes in the natural durability of wood: fungicidal structure-activity relationships. Phytochemistry 29:1501–1507 57. Adrian M, Jeandet P, Veneau J, Weston LA, Bessis R (1997) Biological activity of resveratrol, a stilbenic compound from grapevines, against Botrytis cinerea, the causal agent for gray mold. J Chem Ecol 23:1689–1702 58. Hoos G, Blaich R (1990) Inﬂuence of resveratrol on germination of conidia and mycelia growth of Botrytis cinerea and Phomopsis viticola. J Phytopathol 129:102–110 59. Pezet R, Gindro K, Viret O, Spring JL (2004) Glycosylation and oxidative dimerization of resveratrol are respectively associated to sensitivity and resistance of grapevine cultivars to downy mildew. Physiol Mol Plant Pathol 65:297–303 60. Pont V, Pezet R (1990) Relation between the chemical structure and the biological activity of hydroxystilbenes against Botrytis cinerea. J Phytopathol 130:1–8 61. Dai GH, Andary C, Mondolot-Cosson L, Boubals D (1995) Histochemical studies on the interaction between three species of grapevine, Vitis vinifera, V. rupestris and V. rotundifolia. Physiol Mol Plant Pathol 46:177–188 62. Douillet-Breuil AC, Jeandet P, Adrian M, Bessis R (1999) Changes in the phytoalexin content of various Vitis spp. in response to ultraviolet C elicitation. J Agric Food Chem 47: 4456–4461 63. Gindro K, Spring JL, Pezet R, Richter H, Viret O (2006) Histological and biochemical criteria for objective and early selection of grapevine cultivars resistant to Plasmopara viticola. Vitis 45:191–196 64. Pool RM, Creasy LL, Frackelton AS (1981) Resveratrol and the viniferins, their application to screening for disease resistance in grape breeding programs. Vitis 20:136–145 65. Coutos-Thévenot P, Poinssot B, Bonomelli A, Yean H, Breda C, Buffard D, Esnault R, Hain R, Boulay M (2001) In vitro tolerance to Botrytis cinerea of grapevine 41B rootstock in transgenic plants expressing the stilbene synthase Vst1 gene under the control of a pathogeninducible PR10 promoter. J Exp Bot 358:901–910 66. Hain R, Reif H, Krause E, Langebartels R, Kindl H, Vornam B, Wiese W, Schmelzer E, Schreier P, Stöcker R (1993) Disease resistance results from foreign phytoalexin expression in a novel plant. Nature 361:153–156 67. Adrian M, Jeandet P, Bessis R, Joubert JM (1996) Induction of phytoalexin (resveratrol) synthesis in grapevine leaves treated with aluminum chloride (AlCl3). J Agric Food Chem 44:1979–1981 68. Schubert R, Fischer R, Hain R, Schreier PH, Bahnweg G, Ernst D, Sandermann H (1997) An ozone-responsive region of the grapevine resveratrol synthase promoter differs from the basal pathogen-responsive sequence. Plant Mol Biol 34:417–426 69. Borie B, Jeandet P, Bessis R, Adrian M (2003) Comparison of resveratrol and stilbene synthase mRNA production from grapevine leaves treated with biotic and abiotic phytoalexin elicitors. Am J Enol Vitic 55:60–64 70. Langcake P, Pryce RJ (1977) The production of resveratrol and the viniferins by grapevines in response to ultraviolet irradiation. Phytochemistry 16:1193–1196

330

M. Adrian et al.

71. Lesniewska E, Adrian M, Klinger A, Pugin A (2004) Cell wall modiﬁcation in grapevine cells in response to UV stress investigated by atomic force microscopy. Ultramicroscopy 100:171–178 72. Calderon AA, Pedreno MA, Ros Barcelo A, Munoz R (1990) A spectrophotometric assay for quantitative analysis of the oxidation of 4-hydroxystilbene by peroxidase-H2O2 systems. J Biochem Biophys Methods 20:171–180 73. Melotto M, Underwood W, Koczan J, Nomura K, He SY (2006) Plant stomata function in innate immunity against bacterial invasion. Cell 126:969–980 !LLáGRE- $AIRE8 (£LOIR-# 4ROUVELOT3 -ERCIER, !DRIAN- 0UGIN! 3TOMATAL deregulation in Plasmopara viticola-infected grapevine leaves. New Phytol 173:832–840 75. Gindro K, Pezet R, Viret O (2003) Histological study of the responses of two Vitis vinifera cultivars (resistant and susceptible) to Plasmopara viticola infections. Plant Physiol Biochem 41:846–853 76. Hamiduzzaman MM, Jakab G, Barnavon L, Neuhaus JM, Mauch-Mani B (2005) E-Aminobutyric acid-induced resistance against downy mildew in grapevine acts through the potentiation of callose formation and jasmonic acid signaling. Mol Plant Microbe Interact 18:819–829 77. Desikan R, Cheung MK, Bright J, Henson D, Hancock JT, Neill SJ (2004) ABA, hydrogen peroxide and nitric oxide signalling in stomatal guard cells. J Exp Bot 55:205–212 78. Lee S, Choi H, Suh S, Doo IS, Oh KY, Choi EJ, Taylor ATS, Low PS, Lee Y (1999) Oligogalacturonic acid and chitosan reduce stomatal aperture by inducing the evolution of reactive oxygen species from guard cells of tomato and Commelina communis. Plant Physiol 121:147–152 79. Klüsener B, Young JJ, Murata Y, Allen GJ, Mori IC, Hugouvieux V, Schroeder JI (2002) Convergence of calcium signalling pathways of pathogenic elicitors and abscisic acid in Arabidopsis guard cells. Plant Physiol 130:2152–2163 !LLáGRE- (£LOIR-# 4ROUVELOT3 $AIRE8 0UGIN! 7ENDEHENNE$ !DRIAN- !RE grapevine stomata involved in the elicitor-induced protection against downy mildew? Mol Plant Microbe Interact 22:977–986 81. Poinssot B, Vandelle E, Bentéjac M, Adrian M, Levis C, Brygoo Y, Garin J, Sicilia F, CoutosThévenot P, Pugin A (2003) The endopolygalacturonase 1 from Botrytis cinerea activates grapevine defense reactions unrelated to its enzymatic activity. Mol Plant Microbe Interact 16:553–564 82. De Lorenzo G, Ferrari S (2002) Polygalacturonase-inhibiting proteins in defense against phytopathogenic fungi. Curr Opin Plant Biol 5:295–299 -ATHIEU 9 +URKDIJAN ! 8IA ( 'UERN * +OLLER ! 3PIRO - /.EILL - !LBERSHEIM 0 Darvill A (1991) Membrane responses induced by oligogalacturonides in suspension-cultured tobacco cells. Plant J 1:333–343 84. Mathieu Y, Sanchez FJ, Droillard MJ, Lapous D, Laurière C, Guern J (1996) Involvement of protein phosphorylation in the early steps of transduction of the oligogalacturonide signal in tobacco cells. Plant Physiol Biochem 34:399–408 85. Ten Have A, Mulder W, Visser J, Van Kan JAL (1998) The endopolygalacturonase gene Bcpg1 is required to full virulence of Botrytis cinerea. Mol Plant Microbe Interact 11:1009–1016 86. Lauge R, Dmitriev AP, Joosten MHAJ, De Wit PJGM (1998) Additional resistance gene(s) against Cladosporium fulvum present on the Cf-9 introgression segment are associated with strong PR protein accumulation. Mol Plant Microbe Interact 11:301–308 87. Lauge R, Goodwin PH, de Wit PJGM, Joosten MHAJ (2000) Speciﬁc HR-associated recognition of secreted proteins from Cladosporium fulvum occurs in both host and non-host plants. Plant J 23:735–745 88. He SY, Huang HC, Collmer A (1993) Pseudomonas syringae pv. syringae harpinPss: a protein that is secreted via the Hrp pathway and elicits the hypersensitive response in plants. Cell 73:1255–1266 89. Lee J, Klessig DF, Nurnberger T (2001) A harpin binding site in tobacco plasma membranes mediates activation of the pathogenesis-related gene HIN1 independent of extracellular calcium but dependent on mitogen-activated protein kinase activity. Plant Cell 13:1079–1093

13

Activation of Grapevine Defense Mechanisms: Theoretical and Applied Approaches

331

90. Nimchuk Z, Rohmer L, Chang JH, Dangl JL (2001) Knowing the dancer from the dance: R gene products and their interactions with other proteins from host and pathogen. Curr Opin Plant Biol 4:288–294 91. Govrin EM, Levine A (2000) The hypersensitive response facilitates plant infection by the necrotrophic pathogen Botrytis cinerea. Curr Biol 10:751–757 92. Côté F, Ham K, Hahn M, Bergmann C (1998) Oligosaccharide elicitors in host pathogen interactions. Generation, perception, and signal transduction. Subcell Biochem 29:385–432 93. Courtois J (2009) Oligosaccharides from land plants and algae: production and applications in therapeutics and biotechnology. Curr Opin Microbiol 12:261–273 94. Cardinale F, Jonak C, Ligterink W, Niehaus K, Boller T, Hirt H (2000) Differential activation of four speciﬁc MAPK pathways by distinct elicitors. J Biol Chem 275:36734–36740 95. Inui H, Yamaguchi Y, Hirano S (1997) Elicitor actions of N-acetylchitooligosaccharides and laminarioligosaccharides for chitinase and L-phenylalanine ammonia-lyase induction in rice suspension culture. Biosci Biotechnol Biochem 61:975–978 !ZIZ! 0OINSSOT" $AIRE8 !DRIAN- "£ZIER! ,AMBERT" *OUBERT* 0UGIN! Laminarin elicits defense responses in grapevine and induces protection against Botrytis cinerea and Plasmopara viticola. Mol Plant Microbe Interact 16:1118–1128 97. Ménard R, de Ruffray P, Fritig B, Yvin JC, Kauffmann S (2005) Defense and resistance inducing activities in tobacco of the sulfated beta-1,3 glucan PS3 and its synergistic activities with the unsulfated molecule. Plant Cell Physiol 46:1964–1972 98. Trouvelot S, Varnier A, Allegre M, Mercier L, Baillieul F, Arnould C, Gianinazzi-Pearson V, +LARZYNSKI/ *OUBERT* 0UGIN! $AIRE8 !BETA GLUCANSULFATEINDUCESRESISTANCE in grapevine against Plasmopara viticola through priming of defense responses, including HRlike cell death. Mol Plant Microbe Interact 21:232–243 99. Conrath U, Beckers GJ, Flors V, Garcia-Agustin P, Jakab G, Mauch F, Newman MA, Pieterse CM, Poinssot B, Pozo MJ, Pugin A, Schaffrath U, Ton J, Wendehenne D, Zimmerli L, MauchMani B (2006) Priming: getting ready for battle. Mol Plant Microbe Interact 19:1062–1071 100. Van Hulten M, Pelser M, van Loon LC, Pieterse CM, Ton J (2006) Costs and beneﬁts of priming for defense in Arabidopsis. Proc Natl Acad Sci 103:5602–5607 101. Zimmerli L, Jakab G, Metraux JP, Mauch-Mani B (2000) Potentiation of pathogen-speciﬁc defence mechanisms in Arabidopsis by beta-aminobutyric acid. Proc Natl Acad Sci 97: 12920–12925 102. Reuveni M, Zahavi T, Cohen Y (2001) Controlling downy mildew (Plasmopara viticola) in ﬁeld-grown grapevine with beta-aminobutyric acid (BABA). Phytoparasitica 29:125–133 103. Belhadj A, Saigne C, Telef N, Cluzet S, Bouscaut J, Corio-Costet MF, Mérillon JM (2006) Methyl jasmonate induces defense responses in grapevine and triggers protection against Erysiphe necator. J Agric Food Chem 54:9119–9125 104. Vallad GE, Goodman RM (2004) Systemic acquired resistance and induced systemic resistance in conventional agriculture. Crop Sci 44:1920–1934 105. Tally A, Oostendorp M, Lawton K, Staub T, Bassy B (1999) Commercial development of elicitors of induced resistance to pathogens. In: Agrawal AA, Tuzun S, Bent E (eds) Inducible plant defenses against pathogens and herbivores: biochemistry, ecology, and agriculture. American Phytopathological Society Press, St Paul 106. Iriti M, Rossoni M, Borgo Ferrara L, Faoro F (2005) Induction of resistance to gray mold with benzothiadiazole modiﬁes amino acid proﬁle and increases proanthocyanidins in grape: primary versus secondary metabolism. J Agric Food Chem 53:9133–9139 107. van Loon LC, Pahm Bakker WHW, van der Heijdt WD, Pugin A (2008) Early responses of tobacco suspension cells to rhizobacterial elicitors of induced systemic resistance. Mol Plant Microbe Interact 21(12):1609–1621

sdfsdf

Chapter 14

Plant Cyclotides: An Unusual Protein Family with Multiple Functions Michelle F.S. Pinto, Isabel C.M. Fensterseifer, and Octavio L. Franco

Abstract Over the years, a number of peptides containing a cyclic structure have been discovered. Among these molecules, there is the family of cyclotides, which are small cyclic peptides, containing six conserved cysteine residues connected by disulﬁde bridges forming a cyclic cysteine knot, giving great stability in the structure against thermal, chemical and proteolytic degradation. The cyclotides are divided into two major subfamilies, Möbius and bracelet; the main difference between them is the presence in Möbius of a proline residue in cis position in loop 5, which is not seen in Bracelets. In this work, we have carried out a short review of the discovery, biosynthesis, structural characteristics and biological activity of cyclotides. Given the wide range of cyclotide activities, there is much interest in exploring the potential of these peptides, mainly thanks to the countless possibilities for their use by agribusiness and the pharmaceutical industry. Keywords #YCLOTIDES s $EFENSE PEPTIDES s "IOLOGICAL ACTIVITY s 3TRUCTURAL characteristics

14.1

Introduction

Among the range of wild plant-produced molecules with biotechnological potential, a very unusual family known as the cyclotides has been described. The story starts in 1960, when the Norwegian physician Lorents Grande was working as a volunteer

-&30INTOs)#-&ENSTERSEIFERs/,&RANCO*) Centro de Análises Proteômicas e Bioquímicas, Programa de Pós-Graduação em Ciências Genômicas e Biotecnologia, Universidade Católica de Brasília, SGAN, Quadra 916, Módulo B, Av. W5 Norte, CEP 70.790-160, Brasília, DF, Brazil e-mail: [email protected]; [email protected]

J.M. Mérillon and K.G. Ramawat (eds.), Plant Defence: Biological Control, Progress in Biological Control 12, DOI 10.1007/978-94-007-1933-0_14, © Springer Science+Business Media B.V. 2012

333

334

M.F.S. Pinto et al.

in the Republic of the Congo (formerly Zaire) for the Red Cross. He realized that women in the native Lulua tribe drank an infusion made from the leaf of a small bush, to accelerate labor, leading to increased uterine contractions [1–3]. Curious about how this plant extract increased contractions; Lorents took some samples with him when he returned to Norway, to examine them with the help of his colleagues. It was the partial characterization of the compound that was responsible for uterotonic activity [4]. Ten years later, the ﬁrst cyclotide was discovered, as an active compound from an African plant extract, popularly known as Kalata-Kalata (Oldenlandia afﬁnis, belonging to the family Rubiaceae) [1, 4]. This cyclic peptide of about 29 residues of amino acids was named kalata B1. However, the peptide resisted all methods (in existence at that time) to elucidate its complete sequence and its structural features [3]. It was only about 20 years later that scientists established the primary sequence of kalata B1 and its three-dimensional structure [1–7]. That was when the researchers had a surprise, because they found no free terminals; instead, they were linked in the peptide chain, leaving the cyclic structure maintained by 3 (three) linked disulﬁdes [3]. It is believed that the cyclotide family may contain thousands of members. Studies suggest that a single specimen can express 15–60 different cyclotides [1, 8–12]. This family of cyclic peptides, which so far has been reported only in plants, can be found in several organs, including the root, leaf, stem and ﬂowers [6, 13].

14.2

Cyclization Process of Cyclotides

Cyclotides are gene products whose sequences are encoded in the genome of the plant; very little is known about their mechanisms of synthesis and regulation. It is believed that they are derived from a large precursor protein with subsequent cleavage and cyclization of the peptide chain [7, 14, 15]. Many of the genes responsible for expression of circular proteins are already known, and now some genes have been described that are involved in the synthesis of cyclotides in plants. Although no enzyme has been identiﬁed as responsible for cleavage and cyclization of this family of peptides, it is considered that the enzyme asparagil endopeptidase is involved in the process of cleavage by cyclization [3, 16, 17]. The ﬁrst expression genes of cyclotides were found in samples of O. afﬁnis, a total of four genes that are called Oak 1–4 of 11–14 kDa. The Oak 1 gene is responsible for expression of kalata B1, Oak 2 for the expression of kalata B3 and B6, Oak 3 for kalata B7 expression and Oak 4 for the expression of kalata B2 [3, 15, 16]. Characterized genes encode a long linear precursor, containing one to three domains for mature cyclotides [16]. Furthermore, each precursor carries a signaling portion containing 20 amino acid residues, which directs it to the endoplasmic reticulum (ER) [18]. Domains for cyclotides are separated by highly conserved regions with 22 amino acid residues, named N-terminal repeat (NTR), forming an D-helix that has a possible role in processing cyclotides, and may be directly linked to the transport of cyclotides via the secretory pathway [16]. Each precursor also contains a

14

Plant Cyclotides: An Unusual Protein Family with Multiple Functions

335

Fig. 14.1 Outline of the biosynthetic process and cyclization of kalata B1. (a) The precursor protein expression kalata B1 (Oak 1), ER – signal sequence for endoplasmic reticulum, NTPD – N-terminal pro-domain sequences, NTR – N-terminal repeated, KB1 – regions corresponding to kalata B1’s mature and hydrophobic tail. The scissors indicate the positions where the cleavage of the propeptide by AEP cyclotides will occurs. (b) Cyclization process of kalata B1 is completed with the help of AEP. (c) Schematic structure of kalata B1. (d) Three-dimensional representation of kalata B1

unique region of N-terminal pro-domain (NTPD), featuring a number of amino acid residues ranging from 46 to 68, which apparently play no role in the maturation of the cyclotides [3, 16]. During biosynthesis, it is believed that the disulﬁde bonds are formed at the core of the precursor inside the endoplasmic reticulum, and after this step, the precursors are brought to the Golgi apparatus, where cleavage and cyclization of the peptide can occur. With the formation of connections, this would make the ends of the N-and C-terminal domain close enough for the occurrence of cleavage and cyclization [19]. At that moment, the presence of a residue Asn26 or Asp26 at the C-terminal and the N-terminal seems crucial, preceded by a sequence of three conserved amino acid residues, usually Gly-Pro-Leu (Fig. 14.1) [16, 20]. However, the excision process, cyclization and enzymes involved in each biosynthetic step have not been identiﬁed so far [16, 18, 19, 21]. Unlike the other precursors, the clone Oak 4, with three copies for mature cyclotides kalata B2, has the Gly-Leu-Pro sequence of amino acids ﬂanking its Nterminal and the Ser-Leu-Pro sequence ﬂanking its C-terminal, indicating that the cleavage site for kalata B2 occurs in the peptide bonds preceding the Gly and Lys residues in the N-terminal and C-terminal. The cleavage occurs between Asp/Asn

336

M.F.S. Pinto et al.

and Gly/Ser residues [16, 20]. There are no plant enzymes described that are able to accommodate both the Lys residue and Asn/Asp residues, but speciﬁc proteases for Asn/Asp residues are common [16]. One hypothesis raised by researchers is the involvement of an asparaginyl endopeptidase (AEP) enzyme [16, 22]. AEPs are enzymes responsible for cleaving amide linkages. In this process, there is the formation of an intermediate acyl enzyme, before the nucleophilic attack in the amide group of the N-terminal forms a peptide bond, resulting in a cyclic peptide chain [23]. Studies to evaluate the activity of cyclization of AEP cyclotides have been carried out to induce expression of kalata B1 in a plant species that naturally produces no cyclotides (such as Nicotiana benthamiana). When AEP activity was modiﬁed by decreasing its expression or by use of speciﬁc inhibitors, we observed reduced production of cyclotides (in their cyclic form), accompanied by an accumulation of species in a linear structure, compared with a control. These experiments suggest that AEP is responsible for catalyzing the cleavage of the peptide bond and cyclization of cyclotides [17], but does not rule out the possibility that these events are autocatalytic [16, 19, 24]. Another crucial element in the biosynthesis of cyclotides is the knowledge of how this family of peptides cyclizes and how the connections are formed between cysteines [25]. To understand part of this process, the protein disulﬁde isomerase (PDI) in O. afﬁnis was characterized. IDPs are enzymes that are localized in the ER, and they are responsible for oxidation, reduction and isomerization of disulﬁde bonds in proteins; they could be involved in the formation of CCK cyclotides [3, 26]. Further studies are needed to deﬁne their role in the process of cyclization in plants [26].

14.3

Multiple Functions of Cyclotides

Since the discovery of kalata B1, other cyclotides have been characterized, showing various biological activities, such as anti-HIV activity [8, 16, 27], inhibitory activity of neurotensin and trypsin [7, 16], insecticidal and antimicrobial activity [13, 27, 28], anti-tumor activity [16, 28–30] and antioxidant activity [7]. Some cyclotides, such as circulins A and B, besides having anti-HIV activity, also have antimicrobial activity; kalata B1 also presented this latter activity. Ciclopsychotride A and cicloviolacin O2 have been seen to work against Gramnegative, Gram-positive bacteria and fungi [13, 31, 32]. In research conducted with synthetic membranes, we observed that kalata B1, B6 and analogues interacted with liposomal membranes containing dodecilfosfatilcolin [33], indicating that these cyclotides selectively interacted with bacterial membranes. This interaction occurs through afﬁnity with loop 5 through the waste Try23-Pro24-Val25, and loop 6 through Leu2-Pro3-Val25 residues, which are the most hydrophobic loops of these molecules. Together, the presence of negatively charged Arg29 and Glu7 residues, in loops 1 and 6, respectively, is conserved and segregated from the opposite side of the molecule

14

Plant Cyclotides: An Unusual Protein Family with Multiple Functions

337

in contact with the head of polar lipids and by incorporation into the membrane, where there is a slight conformational change in tertiary structure of kalata B1 [19, 33, 34]. Cyclotides with cytotoxic activity have also been discovered, such as cicloviolacins O1 to O11 and cicloviolacin H1, in some species of Viola, including V. Arvensis cyclotides named varv-peptide A-H [7]. In vitro isolation of V. Tricolor demonstrated cytotoxic activity in cultured human cell lymphomas and myelomas, with power similar to chemotherapy drugs used in cancer treatments [10, 20, 29]. Not only do they reach different cancer cell lines, but some also work against small cell solid tumors in lung cancer [20, 29, 32]. Despite their cytotoxic activity against characterized tumor cells, the cyclotides mechanism of action has not been well elucidated [29]. In studies on the structure of kalata B1, we found that the sequence Asn11-Thr12-Pro13-Gly14, present in loop 3, is related to its anti-carcinogenic activity [32]. Besides the activities already mentioned, some cyclotides like Ciclopsychotride A also have antagonistic activity to neurotensin and inhibitory activity against trypsin, the latter being presented by MCOT-I and II [5, 35, 36]. Among the diverse activities of cyclotides, some like kalata B1, B2 and B5 have insecticidal activity when incorporated into the diet of lepidopteran Helicoverpa punctigera and H. Armigena, which are two major pests attacking cotton crops. Here they showed approximately 70% inhibition of larval growth [6]. In initial studies it was believed that the insecticidal activity of cyclotides was through the inhibition of some digestive enzymes in insects, such as trypsin, chymotrypsin and D-amylase [16]. However, recent studies conducted with kalata B1 have demonstrated that the insecticidal activity of this cyclotide did not affect the activity of the insect’s digestive enzymes , but rather provoked changes in the morphology of cells lining of insect intestinal tract, causing edema and cell lysis [37]. Molluscicidal activity was also observed by using cicloviolacin O2 and kalata B1, B2, B7 and B8 from the golden apple snail (Pomacea canaliculata), which attacks crops of rice (Oryza sativa). The cyclotide mechanism of action against the snail is unknown, but snails’ excessive mucus secretion and mode of retraction into their shells, in the presence of cyclotides, suggested a process similar to molucicidel metaldehyde toxicity [38]. Metaldehyde causes damage to the skin and wall of the digestive tract of shellﬁsh, initially leading to excessive mucus secretion, followed by changes in energy metabolism [39]. One possibility for the presence of its molluscicidal activity is based on tendencies of hydrophobic cyclotides, because cicloviolacin O2 was the most active peptide against the snail P. canaliculata, and from all those tested it was the most hydrophobic [38]. In recent studies, we found that kalata B1 and cicloviolacins, beyond their insecticidal and molluscicidal activity, also showed antihelmintic activity against nematodes Haemonchus contortus and Trichostrongylus colubriformis that attack the gastrointestinal system of ruminants. This suggests that the activity of cyclotides is through interaction with the outer epicuticle membrane (rich in lipids) of the nematode [33, 40, 41]. In other studies, cyclotides have exerted some toxic effects

338

M.F.S. Pinto et al.

Table 14.1 Multiple biological activities of plant cyclotides Cyclotides Species and family Activities kalata B1 Odenlandia afﬁnis (Rubiaceae) Anti-HIV Uterotonic Antimicrobial Insecticidal Hemolytic kalata B2 Odenlandia afﬁnis (Rubiaceae) Antimicrobial Insecticidal Molluscicidal ciclopsychotride A Psychotria longipes Inhibition of neurotensin (Rubiaceae) Antimicrobial Hemolytic Cytotoxic/Anti-tumor palicourein Palicourea condensata Anti-HIV (Rubiaceae) circulin A and B Chassalia parvifolia Anti-HIV (Rubiaceae) Antimicrobial Hemolytic MCoTI-I and Momordica conchinchinensis Trypsin inhibitor MCoTI-II (Curcubitaceae) varv-peptide A-H Viola Arvensis (Violaceae) Cytotoxic/Anti-tumor cicloviolacins A-D Leonia cymosa (Violaceae) Anti-HIV Vitri A Viola tricolor (Violaceae) Cytotoxic/Anti-tumor Vibi A-K Viola biﬂora (Violaceae) Cytotoxic/Anti-tumor

References [1, 16, 36, 42]

[6]

[35, 36]

[43] [5, 44]

[5] [40] [7, 45] [29] [20]

on hookworms, which are determinant agents of hookworm infection in humans and dogs [41]. Table 14.1 below summarizes some of the cyclotide activities most reported in the literature.

14.4

Structural Analyses

Cyclotides usually have a small primary structure, ranging from 28 to 37 amino acid residues long with a molecular weight from 2.8 to 3.7 kDa. They are found in species of plants in the Violaceae, Rubiaceae, Poaceae and Curcubitaceae families [6, 30, 46, 47]. This group of proteins is characterized by having a peculiar cyclic structure, due to the absence of the N-and C-terminals that are connected by the polypeptide chain and in having six conserved cysteine residues forming three linked disulﬁde bonds [11, 12, 28, 48]. Cyclotides show this cyclization known as the “head-tail” in their polypeptide chain, which is partially known. First is a ring formed by two connections between disulﬁde bounds CysI-CysIV and CysII-CysV internally positioned in the structure, with a third disulﬁde bridge formed by CysIII-CysVI passing between the other two

14

Plant Cyclotides: An Unusual Protein Family with Multiple Functions

339

Fig. 14.2 Ribbon representation of kalata B1 three-dimensional structure. Disulphide bonds are yellow colored

links, inside the ring, thus linking the bridges and forming a “Cyclic Cysteine Knot” (CCK) [6, 8, 13]. The cyclical nature of the polypeptide chain between the cysteine residues, forming six loops, structurally important for the biological action of these peptides, is conserved, but the number of amino acid residues can vary from one cyclotide to another (Fig. 14.2) [6, 8]. Cyclotides are divided into two major subfamilies, Möbius and bracelets. The main characteristic that distinguishes them is the presence of a conserved proline residue in cis conformation in loop 5 in the Möbius subfamily, causing a 180° twist in the loop, which is not seen in the bracelet subfamily [7, 27, 30, 49]. This conformation is due to the presence of a tryptophan residue (Trp19) that precedes proline (Pro20). Thus, an interaction occurs between the proline pirolidinic ring with the side chain of the tryptophan aromatic ring, causing cis-proline conformation (cis-Pro) [50]. Among the proteins belonging to the Möbius subfamily, there are virtually no variations in the number of amino acid residues between the loops, although they have negatively charged or neutral charged amino acids [8]. On the other hand, the straps show a clear variation in the sizes of the loops, and cyclotides commonly belonging to this subfamily have amino acids with positive charges [28]. Besides these two classiﬁcations, there is a third small subfamily of the trypsin inhibitors, currently composed of two members, MCOT-I and MCOT- II, isolated from the seeds of Momordica cochinchinensis (Curcubitaceae) [49, 51]. The classiﬁcation of

340

M.F.S. Pinto et al.

MCOT-I and II has generated discussion, because they do not show a signiﬁcant homology of their sequences with those of cyclotides. However, they present a CCK in their structure, stabilized by three disulﬁde bridge formed by the presence of six cysteine residues [27, 52]. In studies conducted by Daly and coworkers in 2006, kalata B8 was found in extracts of O. afﬁnis, a cyclotide that has characteristics of two subfamilies, and thus called a hybrid. Kalata B8 shows in the striking resemblance seen between its loops 2 and 3 and the loops 2 and 3 of kalata B1 and B2, belonging to the Möbius strip. Loop 5 is observed to resemble circulin A and B, belonging to the bracelets. In loop 6, it presents an isomerisation equal to MCOT-I. Besides being structurally hybrid, kalata B8 has a higher hydrophobic character than the other cyclotides already featured in O. afﬁnis [49]. The secondary structure of the Mobius and Bracelet subfamilies of cyclotides consists of triple-vertex, E-sheet and several turns. Some cyclotides along loop 3 may exhibit a small 310 helix, involving residues 12–18, like cicloviolacin O2 [2, 53]. The structure of the different kalata B1 cyclotides is stabilized by type I turns (E-turns) between residues 5–8, and between residues 21–24 a “J-turn occurs [2]. These structural elements are stabilized by the cyclotides network of hydrogen bonds and by hydrophobic interactions with its disulﬁde bridges, thus providing its exceptional stability [1, 2]. The cyclotides show varying degrees of similarity in polypeptide sequences both within and between the two subfamilies [9, 19] When compared, the primary sequences for each subfamily show 80% similarity to the Möbius family, while for the Bracelets the identity of the polypeptide chain is approximately 54% [7, 19]. These polypeptides exhibit some highly conserved loops, in terms of numbers and types of amino acid residues. The loop has three amino acids, among them, the Glu3, which seems to be involved in stabilizing the cyclic ring by forming hydrogen bonds with residues in loops 1 and 3 [1, 2]. For cicloviolacin O1, which belongs to the subfamily of the Bracelets, the Glu3 present in the loop carries a hydrogen bond with Thr11, Val12 and Thr13 that are present in loop 3. They are important links to the stabilization of small propeller 310 [2]. Loop 4 is directly related to the connectivity of disulﬁde bonds, with only one amino acid residue, which in most cases is a Ser16 or Thr16, making hydrogen bonds with the side chain [8, 49]. In loop 3, there is a residue at Gly18 which is well conserved for most cyclotides. This residue is from Cys19 upstream. It is believed that this location, with such a conservation pattern, plays a structural role in maintaining the cyclic cysteine bond [2]. Topologically, the residues Gly1, Gly6, Gly12 and Gly18 adopt a positive I angle, which is crucial for the establishment of the disulﬁde bond between Cys I and Cys IV on loop 3, forming, at that point of the molecule, their smallest ring. It is only the presence of a compact glycine residue that allows the disulﬁde bond to penetrate the core of the cyclic molecule [2, 6]. Residues Gly11 and Gly12 present in loop 2, which are often composed of four amino acid residues, appear to be retained only by the Möbius subfamily and in this position, Gly residue is observed in bracelets [6].

14

Plant Cyclotides: An Unusual Protein Family with Multiple Functions

14.5

341

Production of Pharmaceuticals: Novel Perspectives

Since they have a wide range of activities and high structural stability, cyclotides attract great attention from both the scientiﬁc community and the pharmaceutical industry for the development of new drugs [3, 14, 16]. Given this great potential for the development of bioproducts, the prospect of manipulating cyclotides using biotechnology resources is currently increasing, stimulating the construction of gene libraries. This in turn will lead to the exploration of new molecules for speciﬁc biological receptors, research which can be applied in the pharmaceutical, agrochemical or biotechnology areas [18, 19]. Furthermore, small peptides have the advantage of reduced immunogenicity compared to larger proteins [53]. Thus, several approaches have been implemented to improve the stability of pharmaceutically interesting peptides, including protein engineering and chemical synthesis of analogues [3, 16, 53]. Adding to this, the applications of chemical synthesis of peptides, carried out by solid phase synthesis, have advanced greatly in the construction and manipulation of new molecules. The cyclic cysteine knots is the aspect considered most responsible for the structural stability of cyclotides, have become attraction focal point for the introduction of bioactive peptide epitopes. The introduction of multiple peptides fragments have been developed and explored by using loops 2, 3, 5 and 6, preserving, on the other hand, the loops 1 and 4 that are involved in the formation and stabilization of CCK [53, 54]. Cyclotides can also be used as a model for biologically active analogues through changes in their amino acid sequence, with the aim of reducing unwanted effects that the natural molecule may exhibit [32]. One example that was cited consists in the changes that Clark and colleagues induced in the loop in ﬁve analogues of kalata B1, with the replacement of some hydrophobic residues by polar residues. They noted that although no changes occurred in the stability of native structure, although the hemolytic activity of native kalata B1 was reduced, thus increasing its biopharmaceutical properties. This is a vital step for the use of cyclotides as drug models [54]. Changes made in positively charged amino acid residues in the structure of cicloviolacin O2 showed a sevenfold decreased cytotoxicity capability, while a single change in residue Glu3, kept in loop 1 resulted in a 48-fold decrease in its capability [55]. In the pharmaceutical area, the applicability of epitopes in the structure of cyclotides is already showing positive results. The implementation of poly-Arg epitope with antiangiogenic properties, in loop 3 of kalata B1, enhanced activity of inhibition of VEGF-A receptors [32, 53]. Another example we can cite was the development of new anti-infective agents, with the introduction of an epitope in loop 1 of cyclotide MCOT-I, its site of trypsin inhibitory activity, in order to observe the inhibitory activity of other proteases (in this case 3C protease) [52]. MCOT-I with the graft showed a moderate activity against 3C protease, present in the virus responsible for foot and mouth disease that attacks hoofed animals, causing huge losses in the agricultural industry [52]. Despite having produced an unsatisfactory result, this experiment is the ﬁrst of many that may be proposed. The inhibitory activity against

342

M.F.S. Pinto et al.

protease displayed by some cyclotides can be modulated to act against speciﬁc proteases that are differentially expressed in inﬂammatory lung diseases, cardiovascular and frame carcinomas, among others [32, 56]. One drawback to using epitopes would be the formation of an unstable or inactive conformation of the cyclotide structure. However, the existence of several possible locations for the epitope, synthetic ﬂexibility of the structure and ability to introduce unnatural amino acids, minimizes the disadvantage of its application in the development of bioactive molecules [32]. Studies for implementation of cyclotides in the development of therapeutic drugs are only beginning. Their applicability, however, is still a long way off. To reduce this time, it is necessary to minimize the adverse effects of cyclotides. The fact that they are stable and accept changes in their structures can help to speed up the process for using them as biotechnological resources, including protein engineering. Thus these peptides may be widely used in drug design and application in agriculture in the not so distant future [3].

References 1. Saether O, Craik DJ, Campbell ID, Sletten K, Juul J, Norman DG (1995) Elucidation of the primary and three-dimensional structure of the uterotonic polypeptide kalata B1. Biochemistry 34:4147–4158 2. Rosengren KJ, Daly NL, Plan MR, Waine C, Craik DJ (2003) Twists, knots, and rings in proteins. Structural deﬁnition of the cyclotide framework. J Biol Chem 278:8606–8616 3. Craik DJ (2009) Circling the enemy: cyclic proteins in plant defence. Trends Plant Sci 14:328–335 4. Gran L, Sandberg F, Sletten K (2000) Oldenlandia afﬁnis (R&S) DC. A plant containing uteroactive peptides used in African traditional medicine. J Ethnopharmacol 70:197–203 5. Felizmenio-Quimio ME, Daly NL, Craik DJ (2001) Circular proteins in plants: solution structure of a novel macrocyclic trypsin inhibitor from Momordica cochinchinensis. J Biol Chem 276:22875–22882 6. Jennings CV, Rosengren KJ, Daly NL, Plan M, Stevens J, Scanlon MJ, Waine C, Norman DG, Anderson MA, Craik DJ (2005) Isolation, solution structure, and insecticidal activity of kalata B2, a circular protein with a twist: do Mobius strips exist in nature? Biochemistry 44:851–860 7. Pelegrini PB, Quirino BF, Franco OL (2007) Plant cyclotides: an unusual class of defense compounds. Peptides 28:1475–1481 8. Craik DJ, Daly NL, Bond T, Waine C (1999) Plant cyclotides: a unique family of cyclic and knotted proteins that deﬁnes the cyclic cystine knot structural motif. J Mol Biol 294:1327–1336 9. Craik DJ, Daly NL, Waine C (2001) The cystine knot motif in toxins and implications for drug design. Toxicon 39:43–60 10. Trabi M, Craik DJ (2004) Tissue-speciﬁc expression of head-to-tail cyclized miniproteins in Violaceae and structure determination of the root cyclotide Viola hederacea root cyclotide 1. Plant Cell 16:2204–2216 11. Craik DJ (2010) The folding of disulﬁde-rich proteins. Antioxid Redox Signal 14:61–64 12. Craik DJ (2010) Discovery and applications of the plant cyclotides. Toxicon 56:1092–1102 13. Gruber CW, Cemazar M, Anderson MA, Craik DJ (2007) Insecticidal plant cyclotides and related cystine knot toxins. Toxicon 49:561–575 14. Camarero JA, Muir TW (2001) Native chemical ligation of polypeptides. Curr Protoc Protein Sci Chapter 18:Unit18 14

14

Plant Cyclotides: An Unusual Protein Family with Multiple Functions

343

15. Mylne JS, Wang CK, van der Weerden NL, Craik DJ (2010) Cyclotides are a component of the innate defence of Oldenlandia afﬁnis. Biopolymers 94:635–646 16. Jennings C, West J, Waine C, Craik D, Anderson M (2001) Biosynthesis and insecticidal properties of plant cyclotides: the cyclic knotted proteins from Oldenlandia afﬁnis. Proc Natl Acad Sci USA 98:10614–10619 17. Saska I, Gillon AD, Hatsugai N, Dietzgen RG, Hara-Nishimura I, Anderson MA, Craik DJ (2007) An asparaginyl endopeptidase mediates in vivo protein backbone cyclization. J Biol Chem 282:29721–29728 18. Burman R, Gruber CW, Rizzardi K, Herrmann A, Craik DJ, Gupta MP, Goransson U (2009) Cyclotide proteins and precursors from the genus Gloeospermum: ﬁlling a blank spot in the cyclotide map of Violaceae. Phytochemistry 71:13–20 19. Picchi DG, Altei WF, MnS S, VdS B, Cilli EM (2009) Peptídeos cíclicos de biomassa vegetal: caracteristicas, diversidade, biossíntese e atividades biológicas. Química Nova 32:1262–1277 20. Herrmann A, Burman R, Mylne JS, Karlsson G, Gullbo J, Craik DJ, Clark RJ, Goransson U (2008) The alpine violet, Viola biﬂora, is a rich source of cyclotides with potent cytotoxicity. Phytochemistry 69:939–952 21. Trabi M, Mylne JS, Sando L, Craik DJ (2009) Circular proteins from Melicytus (Violaceae) reﬁne the conserved protein and gene architecture of cyclotides. Org Biomol Chem 7:2378–2388 22. Camarero C, Ramos N, Moreno A, Asensio A, Mateos ML, Roldan B (2008) Hepatitis C virus infection acquired in childhood. Eur J Pediatr 167:219–224 23. Conlan BF, Gillon AD, Craik DJ, Anderson MA (2010) Circular proteins and mechanisms of cyclization. Biopolymers 94:573–583 24. Camarero JA, Kimura RH, Woo YH, Shekhtman A, Cantor J (2007) Biosynthesis of a fully functional cyclotide inside living bacterial cells. Chembiochem 8:1363–1366 25. Trabi M, Schirra HJ, Craik DJ (2001) Three-dimensional structure of RTD-1, a cyclic antimicrobial defensin from Rhesus macaque leukocytes. Biochemistry 40:4211–4221 26. Gruber CW, Elliott AG, Ireland DC, Delprete PG, Dessein S, Goransson U, Trabi M, Wang CK, Kinghorn AB, Robbrecht E, Craik DJ (2008) Distribution and evolution of circular miniproteins in ﬂowering plants. Plant Cell 20:2471–2483 27. Craik DJ, Daly NL (2007) NMR as a tool for elucidating the structures of circular and knotted proteins. Mol Biosyst 3:257–265 28. Simonsen SM, Sando L, Ireland DC, Colgrave ML, Bharathi R, Goransson U, Craik DJ (2005) A continent of plant defense peptide diversity: cyclotides in Australian Hybanthus (Violaceae). Plant Cell 17:3176–3189 29. Svangard E, Goransson U, Hocaoglu Z, Gullbo J, Larsson R, Claeson P, Bohlin L (2004) Cytotoxic cyclotides from Viola tricolor. J Nat Prod 67:144–147 30. Chen B, Colgrave ML, Daly NL, Rosengren KJ, Gustafson KR, Craik DJ (2005) Isolation and characterization of novel cyclotides from Viola hederaceae: solution structure and anti-HIV activity of vhl-1, a leaf-speciﬁc expressed cyclotide. J Biol Chem 280:22395–22405 31. Daly NL, Rosengren KJ, Craik DJ (2009) Discovery, structure and biological activities of cyclotides. Adv Drug Deliv Rev 61:918–930 32. Henriques ST, Craik DJ (2009) Cyclotides as templates in drug design. Drug Discov Today 15:57–64 33. Huang YH, Colgrave ML, Daly NL, Keleshian A, Martinac B, Craik DJ (2009) The biological activity of the prototypic cyclotide kalata b1 is modulated by the formation of multimeric pores. J Biol Chem 284:20699–20707 34. Shenkarev ZO, Nadezhdin KD, Sobol VA, Sobol AG, Skjeldal L, Arseniev AS (2006) Conformation and mode of membrane interaction in cyclotides. Spatial structure of kalata B1 bound to a dodecylphosphocholine micelle. FEBS J 273:2658–2672 35. Witherup KM, Bogusky MJ, Anderson PS, Ramjit H, Ransom RW, Wood T, Sardana M (1994) Cyclopsychotride A, a biologically active, 31-residue cyclic peptide isolated from Psychotria longipes. J Nat Prod 57:1619–1625 36. Tam JP, Lu YA, Yang JL, Chiu KW (1999) An unusual structural motif of antimicrobial peptides containing end-to-end macrocycle and cystine-knot disulﬁdes. Proc Natl Acad Sci USA 96:8913–8918

344

M.F.S. Pinto et al.

37. Barbeta BL, Marshall AT, Gillon AD, Craik DJ, Anderson MA (2008) Plant cyclotides disrupt epithelial cells in the midgut of lepidopteran larvae. Proc Natl Acad Sci USA 105:1221–1225 38. Plan MR, Saska I, Cagauan AG, Craik DJ (2008) Backbone cyclised peptides from plants show molluscicidal activity against the rice pest Pomacea canaliculata (golden apple snail). J Agric Food Chem 56:5237–5241 39. Triebskorn R, Casper H, Scheil V, Schwaiger J (2007) Ultrastructural effects of pharmaceuticals (carbamazepine, cloﬁbric acid, metoprolol, diclofenac) in rainbow trout (Oncorhynchus mykiss) and common carp (Cyprinus carpio). Anal Bioanal Chem 387:1405–1416 40. Lindholm P, Goransson U, Johansson S, Claeson P, Gullbo J, Larsson R, Bohlin L, Backlund A (2002) Cyclotides: a novel type of cytotoxic agents. Mol Cancer Ther 1:365–369 41. Colgrave ML, Huang YH, Craik DJ, Kotze AC (2010) Cyclotide interactions with the nematode external surface. Antimicrob Agents Chemother 54:2160–2166 42. Barry DG, Daly NL, Clark RJ, Sando L, Craik DJ (2003) Linearization of a naturally occurring circular protein maintains structure but eliminates hemolytic activity. Biochemistry 42:6688–6695 43. Bokesch HR, Pannell LK, Cochran PK, Sowder RC 2nd, McKee TC, Boyd MR (2001) A novel anti-HIV macrocyclic peptide from Palicourea condensata. J Nat Prod 64:249–250 44. Gustafson KR, Sowder RC, Henderson LE, Parsons IC, Kashman Y, Cardellina JH, McMahon JB, Buckheit RW, Pannell LK, Boyd MR (1994) Circulins A and B. Novel human immunodeﬁciency virus (HIV)-inhibitory macrocyclic peptides from the tropical tree Chassalia parvifolia. J Am Chem Soc 116:9337–9338 45. Hallock YF, Sowder RC 2nd, Pannell LK, Hughes CB, Johnson DG, Gulakowski R, Cardellina JH 2nd, Boyd MR (2000) Cycloviolins A-D, anti-HIV macrocyclic peptides from Leonia cymosa. J Org Chem 65:124–128 46. Ireland DC, Colgrave ML, Nguyencong P, Daly NL, Craik DJ (2006) Discovery and characterization of a linear cyclotide from Viola odorata: implications for the processing of circular proteins. J Mol Biol 357:1522–1535 47. Gruber CW (2010) Global cyclotide adventure: a journey dedicated to the discovery of circular peptides from ﬂowering plants. Biopolymers 94:565–572 48. Craik DJ, Daly NL, Mulvenna J, Plan MR, Trabi M (2004) Discovery, structure and biological activities of the cyclotides. Curr Protein Pept Sci 5:297–315 49. Daly NL, Clark RJ, Plan MR, Craik DJ (2006) Kalata B8, a novel antiviral circular protein, exhibits conformational ﬂexibility in the cystine knot motif. Biochem J 393:619–626 50. Wu WJ, Raleigh DP (1998) Local control of peptide conformation: stabilization of cis proline peptide bonds by aromatic proline interactions. Biopolymers 45:381–394 51. Heitz A, Hernandez JF, Gagnon J, Hong TT, Pham TT, Nguyen TM, Le-Nguyen D, Chiche L (2001) Solution structure of the squash trypsin inhibitor MCoTI-II. A new family for cyclic knottins. Biochemistry 40:7973–7983 52. Thongyoo P, Roque-Rosell N, Leatherbarrow RJ, Tate EW (2008) Chemical and biomimetic total syntheses of natural and engineered MCoTI cyclotides. Org Biomol Chem 6:1462–1470 53. Gunasekera S, Daly NL, Clark RJ, Craik DJ (2009) Dissecting the oxidative folding of circular cystine knot miniproteins. Antioxid Redox Signal 11:971–980 54. Clark RJ, Daly NL, Craik DJ (2006) Structural plasticity of the cyclic-cystine-knot framework: implications for biological activity and drug design. Biochem J 394:85–93 55. Herrmann A, Svangard E, Claeson P, Gullbo J, Bohlin L, Goransson U (2006) Key role of glutamic acid for the cytotoxic activity of the cyclotide cycloviolacin O2. Cell Mol Life Sci 63:235–245 56. Cudic M, Fields GB (2009) Extracellular proteases as targets for drug development. Curr Protein Pept Sci 10:297–307

Chapter 15

Methyl Jasmonate as Chemical Elicitor of Induced Responses and Anti-Herbivory Resistance in Young Conifer Trees Xoaquín Moreira, Rafael Zas, and Luis Sampedro

Abstract Exogenous application of phytohormones such as methyl jasmonate (MJ) can induce chemical and anatomical changes that lead to a reduction in insect herbivory and disease incidence in herbaceous and woody plants. However, exogenous application of MJ also produces notable disadvantages in terms of plant growth and physiology. In this chapter we review current published literature about the effects of exogenous application of MJ in defence responses and herbivory resistance of young conifer trees, as well as their implications for plant growth and physiology. Moreover, we proposed a series of recommendations for the use of MJ as chemical elicitor in young conifer trees.

15.1

Introduction

It is broadly recognized that the evolution of plants has been linked to the pressure exerted by their herbivores, and ever since plants appeared on land insects have been their most harmful herbivores. Forest trees are large, long-lived plants that are particularly exposed to herbivory [1], and insect pests are seen as a great threat for many types of temperate woodland owing to the large amounts of plant tissues they consume. Moreover, contemporary factors including global warming, the movement of genetic material and forest products, the decrease of genetic diversity in breeding

X. Moreira (* s,3AMPEDRO #ENTRODE)NVESTIGACIN&ORESTALDE,OURIZÖNn5NIDAD!SOCIADA-"' #3)# !PDO 0ONTEVEDRA 'ALICIA 3PAIN e-mail: [email protected] R. Zas -ISIN"IOLGICADE'ALICIA-"' #3)# !PDO 0ONTEVEDRA 'ALICIA 3PAIN

J.M. Mérillon and K.G. Ramawat (eds.), Plant Defence: Biological Control, Progress in Biological Control 12, DOI 10.1007/978-94-007-1933-0_15, © Springer Science+Business Media B.V. 2012

345

X. Moreira et al.

programs and in planted forests and the difﬁculties of applying intensive control methods are combining to seriously increase the risk of forest pest damages [2]. !SANILLUSTRATIVEEXAMPLE ABOUTHALFOFTHEAREAFORESTEDWITHPONDEROSAPINEIN British Columbia is now being destroyed by the mountain pine beetle (Dendroctonus ponderosae Hopkins) and it has been predicted that around 80% of the province’s pine volume will be killed by the time the infestation subsides [3]. This huge devastation potential of forest pests could lead to dangerous ecological and social consequences, since coniferous forests are of fundamental importance for both the biodiversity they support and for the environmental, social and ecological services they provide to humanity. Coniferous forests are, for example, currently the most signiﬁcant net C sinks in the Earth, containing more than one-third of all carbon stored in terrestrial ecosystems [4]. Furthermore, coniferous forests are also highly valued from an economic point of view, as most of the conifer species are intensively used for timber, fuelwood, resins and other purposes [5]. During millions of years of co-existence with insect herbivores, conifer trees have evolved potent and effective mechanisms for defending themselves []. These mechanisms include structural, morphological or physical defences, such as resin canals, calcium oxalate structures, sclereid cells and lignin, and chemical defences based on the production of secondary chemical compounds [7]. Both physical and chemical defences are classiﬁed as either constitutive, preformed defences, which are always expressed in the plants, or induced defences that are synthesized or mobilized when the plant is injured. ! CHEMICAL DEFENCE OF PARTICULAR IMPORTANCE TO CONIFERS IS THE OLEORESIN composed by a complex mixture of terpenoids. Monoterpenes (C10) and sesquiterpenes (C15) constitute the volatile fraction of oleoresin, and diterpene resin acids (C20) are the main constituents of the non-volatile fraction [8]. Conifers produce and store copious amounts of resin in specialized anatomical structures such as resin ducts, resin blisters, or resin cells in stems, roots and needles [9]. The network of preformed resin ducts in the phloem is often the ﬁrst defensive element encountered by organisms invading conifers. Resin ﬂuxing from the storage sites out of injured resin ducts is a sticky physical barrier, and terpenes in the resin are highly toxic for insects and fungi [8]. Phenolic compounds are the other major constitutive defence in conifers. Phenolics are abundant in the phloem of all conifer species, especially in the polyphenolic parenchyma cells (PP cells) that are specialized in the synthesis and storage of phenolic compounds [7], but also appear in needle tissues [10]. Phenolic compounds are a complex group of diverse substances with diverse functions in plant physiology, but some types of phenolic are known to be active against a diverse array of herbivores and pathogens. Their effectiveness arises through a variety of mechanisms, such as the inhibition of insect digestive proteins or their toxicity to insects and fungi [11, 12]. !FURTHERGROUPOFCHEMICALSINVOLVEDINCONIFERDEFENCESARETHEALKALOIDSA heterogeneous group of compounds with an organic base containing a nitrogen atom, most of them act as feeding deterrents and/or toxins to most insect herbivores

15

Methyl Jasmonate as Chemical Elicitor of Induced Responses…

347

Fig. 15.1 Xylem cross sections from stems of 1 year-old Pinus pinaster seedlings treated with (a) 0 mM (control) and (b) 22 mM MJ, showing traumatic resin ducts in the xylem

[13= !LKALOIDS ARE RESTRICTED TO SOME TAXA WITHIN CONIFERS WHILE TERPENOIDS AND defensive phenolic compounds are extensively found in gymnosperms [14]. Mechanical and chemical constitutive defences usually require large amounts of resources to be synthesized, and they are produced during the regular growth of conifers. On the other hand, the production of induced defences in response to herbivory is considered to be a cost-saving strategy since defences are only deployed when protection is needed and is thus less energy demanding [15]. Induced defences in conifers include several morphological and physiological changes, such as enhanced resin ﬂow and traumatic resin duct formation [1 17], swelling and proliferation of polyphenolic parenchyma cells in the bark [18, 19], and some qualitative changes and increased production of phenolic compounds [20] and terpenoids [21]. Differentiation and development of traumatic resin canals (TRC) in the secondary xylem of conifers begins soon after herbivory damage [22]. These resin canals are formed in the newly growing rings where they appear in one or two tangential lines within the annual-ring (Fig. 15.1). The formation of traumatic resin canals markedly increases the resin duct density in the xylem and thus the potential resin ﬂow when the wood of conifer trees is injured [1]. Besides oleoresin,

348

X. Moreira et al.

chemical components that are more toxic to insect herbivores may also be present in TRC [1 23]. Induced defences are usually produced in response to the damage or stress caused by biotic and abiotic factors, especially by insect herbivores and plant pathogens (see revision by Eyles et al. [24] on trees). During recent decades, several plant PHYTOHORMONES SUCH AS JASMONIC ACID *! ETHYLENE OR SALICYLIC ACID HAVE BEEN discovered to be implied in the pathways of defence signalling and in the synthesis of chemical defences [25, 2]. These phytohormones also play regulatory roles in other aspects of plant physiology, but they have been found to be especially responsive to biotic aggressions. In particular, the methyl jasmonate pathway has been found to be intimately related to the wounding response to defoliating caterpillars, budworms and bark beetles [27n29]. Thus, exogenous application of some of these compounds can be used as chemical elicitors in order to study the nature of induced responses against herbivory and the environmental factors that determine them, in manipulative experiments in conifer trees. Jasmonic acid is known to be involved in the expression of defence genes induced by wounding insects, and its production is regulated by the octadecanoid pathway (reviewed by Koo and Howe [29]). Jasmonic acid is synthesized from D-linolenic acid, which can be released from the cell membranes of injured tissues. Following several steps mediated by lipoxygenase and ciclase enzymes, D-linolenic acid is transformed into 12-oxo-phytodienoic acid. This last compound undergoes reduction ANDBETAOXIDATIONTOFORM*!4HEMETHYLESTEROF*! METHYLJASMONATE-* IS the most commonly studied elicitor of induced defences against insect and pathogen attacks, in everything from annual to woody plants [30, 31]. In particular, over the last decade, several authors have investigated the role of MJ in wound-induced defence production and in the herbivory resistance of young conifer trees [21, 31n33]. Resistance to herbivory during the initial stages of a conifer’s life is extremely important since insect herbivores are a major cause of early seedling mortality in CONIFEROUSSTANDS!SANILLUSTRATIVEEXAMPLE DAMAGEBYTHEPINEWEEVILHylobius abietis,OFTENCAUSESUPTOnOFSEEDLINGMORTALITYINYOUNGCONIFERSTANDS in Europe during the ﬁrst years after establishment [34]. In recent years, Holopainen and their collaborators have reviewed the potential use of several exogenous elicitors (including MJ) in the pest management of conifer seedlings, and their implications for plant growth and development [35]. The use of chemical elicitors for seedling protection against arthropod herbivores and pathogens appears attractive due to the low ecological risks associated [35]; it does, however, bring considerable disadvantages in terms of negative impacts on plant growth, reproduction and physiology [35]. In this chapter we review the role of the exogenous application of MJ in defence responses and herbivory resistance of young conifer trees, as well as the implications for plant growth and physiology. We also focus on the methodological approaches for the exogenous application of MJ in studies of induced resistance in young conifer trees (<5 years), as an easy, practical and operative means to elicit responses similar to those caused by real herbivory.

15

Methyl Jasmonate as Chemical Elicitor of Induced Responses…

15.2

15.2.1

349

Activation of Young Conifer Defences After Exogenous Application of MJ Chemical Defences

It is broadly accepted that exogenous application of MJ elicits the pathways of biosynthesis of chemical defences in young conifer trees, involving both resin- and phenolic-based defences. Exogenous application of MJ has direct consequences in the synthesis of resin terpenoids. Since early works by Phillips and Croteau [8] and Trapp and Croteau [9], some of the huge advances made in recent years in the knowledge of the pathways of resin biosynthesis in conifers were aided by the use MJ as chemical elicitor of induced responses. Nowadays, it is known that MJ increases the transcript levels, the enzyme concentration and the enzymatic activity of several terpene synthases and monoxygenases involved in the biosynthesis of mono-, sesqui- and diterpenes in conifer trees [3n39=!LTHOUGHNOTIDENTICAL THESE MJ-induced responses were equivalent to those elicited after mechanical wounding and real insect attack, at the transcript level [37]. Quantitative accumulation of terpenoids in young conifer trees induced by MJ treatment has also been reported [32, 40n42]. Interestingly, a 12-fold increase in total monoterpene concentration and a 38-fold increase in total diterpene concentration were observed in spruce saplings treated with 10 mM MJ, when compared with control plants [40]. The effects of MJ application on the accumulation of terpenoids in needles are, however, not as clear as they are in stem tissues. Whereas the concentration of diterpene acids in the needles of young conifers has been reported to increase after MJ application [32, 41], no changes or only minor alterations in mono and sesquiterpenoids were reported in maritime pines [43], Douglas-ﬁr [44], Scots pine [32] and spruce [42], when compared with other tissues of those plants such as stem wood and roots. These results suggest that the response to MJ application in terms of terpenoid chemistry in leaves could differ from that observed in stems or roots, and depends on the chemical fraction under consideration. Exogenous application of MJ also has a relevant effect on the phenylpropanoid pathway leading to the synthesis of phenolic compounds in conifer plants, although at present this area is little understood compared with our knowledge of terpenoids. Wounding and MJ application are known to induce the transcript accumulation of the enzyme chalcone synthase in needles, which is involved in the ﬁrst steps of ﬂavonoid biosynthesis in pine trees [45]. Foliar MJ application also notably increased the concentration of phenolic compounds in the needles of maritime [4] and Monterrey (Moreira et al. unpublished data) pine seedlings. Finally, exogenous application of MJ also stimulates the synthesis of other defensive compounds such us pathogenesis-related (PR) proteins [47n49]. PR proteins include chitinases, peroxidases, proteinase inhibitors and several other proteins. ,OCALWOUNDINGAND-*APPLICATIONSIMILARLYINDUCEDTHEEXPRESSIONOF02PROTEINS in P. monticola [47, 49] and Picea glauca seedlings [48].

350

15.2.2

X. Moreira et al.

Anatomical Defences

That exogenous application of MJ provokes anatomical changes in young trees of several conifer species has been known since the early work carried out with MJ and conifers by Franceschi and collaborators at the beginning of the last decade [50n52]. Reported anatomical changes included the formation of additional traumatic resin ducts in the xylem and additional phenolic deposition in PP cells in the phloem. In a convincing study with seedlings belonging to twelve conifer species, Hudgins et al. [51] reported that the application of 100 mM MJ induced PP cell activation in all the studied species and xylem traumatic resin duct formation and cell wall ligniﬁcation in most of them. Similarly, exogenous application of MJ induced the formation of traumatic resin ducts in the xylem of young Douglas-ﬁr [44, 53], giant redwood [53], Scots pine [32] and Norway spruce [54] trees. Wounding and MJ application were reported to induce early ligniﬁcation of phloem ﬁbres and the accumulation of transcripts of cynnamyl alcohol dehydrogenase, an enzyme involved in the ligniﬁcation of the cell wall in the xylem of P. taeda trees [55].

15.3

Changes in Volatile Organic Compounds Induced by MJ

Exogenous application of MJ was found to have a signiﬁcant effect on the amount of volatile organic compounds (VOCs, mono- and sesquiterpenes) emitted from needles of young conifer trees, increasing their emission between 1 and 3 days after MJ treatment [41, 42]. These results have a great relevance from an ecological point of view since VOCs emitted from injured tissues are airborne molecular messengers involved in plant-animal, animal-animal and plant-plant signalling [8, 5 57]. Thus, VOCs could simultaneously act as herbivore repellent and as olfactory clues for herbivore host selection [58], as well as attracting herbivore predators and parasitoids [10, 59].

15.4

Effects of MJ on Resistance to Insect Herbivores and Plant Pathogens

The defensive responses to MJ application have been commonly associated with enhanced resistance to biotic damage in young conifer trees. In one of the ﬁrst studies relating to this, [0] observed that fumigation with a volatile MJ treatment (25 Pl 100 l−1 air) protected Norway spruce seedlings against the plant pathogen Pythium ultimum Trow. (Pythiales: Pythiaceae). These authors concluded that MJ increased seedling resistance by stimulating the accumulation of salicylic acid in all the parts of the seedlings. Similarly, application of different MJ concentrations signiﬁcantly decreased the disease incidence of the pathogen Diplodia pinea (Desm.) Kickx. (also named Sphaeropsis sapinea, Sphaeropsidales: Sphaeropsidaceae) in P. radiata seedlings

15

Methyl Jasmonate as Chemical Elicitor of Induced Responses…

351

[33, 1]. In contrast with these results, soil application of MJ in ﬁeld-grown P. radiata seedlings did not reduce root rot incidence by Phytophthora cactorum,EBERT#ONH Schröeter (Pythiales: Pythiaceae) compared with the untreated controls [2]. MJ application can also protect conifer seedlings against pest arthropods. For example, the exogenous application of MJ over the foliage signiﬁcantly increased the resistance of pine seedlings against the phloem-feeder Hylobius abietis, (Coleoptera: Curculionidae), both in a cafeteria experiment (in vitro feeding test) [31] and in living plants (in vivo feeding test) [21, 32]. Some of these authors observed signiﬁcant increases in the concentration of stem resin after MJ application, and suggested a direct link between the increase in resin and the observed enhanced resistance [21, 31]. The ingestion of needles by the pine processionary moth Thaumetopoea pityocampa3CHIFF,EPIDOPTERA4HAUMETOPOEIDAE WASALSO signiﬁcantly reduced by exogenous application of MJ (Moreira et al. unpublished data). Speciﬁcally, larvae consumed 10% more needles in the control plants than in MJ-treated plants. The increase in the concentration of total phenolics in the needles after MJ application was suggested as the main factor responsible for the increased resistance against the pine processionary moth.

15.5

Effects of MJ Application on Growth, Primary Metabolism and Physiology

In recent years, exogenous application of MJ to conifer seedlings in forest nurseries has been increasingly proposed as a potential means of protecting seedlings against forest pests [44]. Enhancing plant resistance through the activation of induced responses appears attractive as an environmental friendly tool in the ﬁght against pests and diseases in both agricultural crops and forests. However, this proposal has an important weak point in that the induction of plant defences is beneﬁcial and increases plant ﬁtness when the plant enemies are present, but induced defences are costly for plants to produce and maintain. In the absence of damage, the activation of induced defences could negatively affect plant ﬁtness, as they divert resources that could be used instead for growth, development or reproduction [15]. Indeed, the exogenous application of MJ to conifer seedlings has been found to lead to a decline in growth in many conifer species in numerous studies [21, 32, 33, 1n3]. Remarkable reductions in height and diameter growth [21, 32, 1], as well as shoot [32, 1] and root [32] biomass were observed a few weeks following MJ treatment INPINESEEDLINGS!SSMALLSEEDLINGSMAYSUFFERSERIOUSPROBLEMSOFCOMPETITION with herbaceous forbs and grasses, so MJ application can in fact drastically reduce seedling survival. Exogenous application of MJ can also negatively inﬂuence other plant physiological functions. For example, large decreases in photosynthetic rate of pine seedlings have been observed after foliar application of MJ [32, 33, 1]. Many of these authors also observed decreases in needle water potential and transpiration rate in seedlings treated with MJ [33, 1]. Foliar application of MJ was also reported to depress starch reserves in the stem of pine seedlings [4].

352

X. Moreira et al.

‘Secondary’ metabolism

Increase emission of volatile organic compounds [41,42]

Increase monoterpenes [41,44] Increase diterpenes [32] Alter ratios of monoterpenes [43] Increase total phenolics [31,46] Increase condensed tanins[46]

Apical meristem

Stop primary growth [21,32,46,61]

VOCs

Needles

Increase monoterpenes [32,40,42,44,61] Main stem Increase sesquiterpenes [44] Increase diterpenes [21,31,42,44] Induce PP cell activation [52,53] Induce xylem traumatic resin duct formation [32,40,42,44,52,53] Induce sclereid formation [53]

Induce traumatic resin canals [44] Increase terpenoid content [44]

‘Primary’ metabolism

Root system

Reduce photosynthesis [32,33,61] Reduce water potential [33,61] Reduce transpiration rate [33,61]

Reduce secondary growth [46] Reduce starch storage [46] Reduce biomass [32,61] Reduce growth in basal branches [31]

Reduce biomass [32]

Fig. 15.2 Summary of the reported effects of MJ application on primary and secondary metabolism of young conifer trees. Reference numbers within brackets

Finally, exogenous application of MJ in P. pinaster seedlings can also have relevant effects on C and nutrient reallocation. Increased nutrient concentrations in the shoots along with unchanged or reduced concentrations in the roots have been observed after spraying MJ over the foliage of maritime pine seedlings (Moreira et al. unpublished data). We also observed that MJ application promoted a marked reduction in aboveground biomass but a strong enhancement of ﬁne roots. Both induced responses were likely short-term induced tolerance responses to simulated herbivory, that would likely help to reduce the impact of herbivore damage on plant ﬁtness. Effect of exogenous MJ is summarised in Fig. 15.2.

15.6

15.6.1

Methodological Issues When Using MJ as Experimental Elicitor of Induced Defences Effective Concentration and Method of Application

The effects of MJ application strongly depend on the concentration of MJ in the applied solution, but seedling age and physiological status are also relevant. For example, exogenous application of 100 mM MJ notably increased terpenoid concen-

15

Methyl Jasmonate as Chemical Elicitor of Induced Responses…

353

tration in the stem of pine seedlings, but no signiﬁcant differences were observed between the effects of the application of lower concentrations of MJ and untreated controls in 2 year old seedlings [31, 32]. In 1 year old seedlings, however, the application of 22 mM MJ produced signiﬁcant effects on quantitative defences, growth [4] and carbon and nutrient allocation (Moreira et al. unpublished data). The induction of anatomical defences has also been reported to be MJ dose-dependent. For example, traumatic resin duct size of young giant redwood and Douglas ﬁr trees notably increased with increasing MJ concentration [53]. In contrast with these results, Martin et al. [40] observed lower monoterpene and diterpene content in the wood of young spruces treated with 100 mM MJ as compared with those treated with 10 mM MJ. Enhancement of the effective resistance against pest and pathogens is also MJ dose-dependent, although the relation is not always linear. For example, one application of either 1.0 or 4.5 mM MJ promoted resistance to D. pinea in P. radiata seedlings, whereas a concentration of 18 mM MJ did not reduce the incidence of the plant pathogen [1=!DULTSOFH. abietis consumed 80% less phloem in 100 mM MJ treated seedlings than in control P. pinaster seedlings, and 5 mM and 50 mM MJ treatments produced intermediate values [31]. More surprisingly, young spruce seedlings were reported to be more susceptible to P. ultimum infection at higher concentrations of gaseous MJ [0]. Exogenous application of MJ at high concentrations could result in local phytotoxicity for plants. For example, Moreira et al. [31] observed that although total phenolic concentration in the needles of 5 mM MJ-treated P. pinaster seedlings was slightly greater than in control plants, phenolic concentration signiﬁcantly dropped in seedlings treated with 100 mM MJ concentration, which showed visual signs of stress or toxicity in the form of chlorotic or dead needles. Similarly, phytotoxicity symptoms or plant mortality were observed in pine seedlings treated with high MJ concentrations [32, 1]. Treatments of MJ in young conifer trees are usually applied by spraying over the foliage with a handheld sprayer [32, 33, 40n43, 1]. This method of MJ application showed positive results in the context of induction of chemical and anatomical defences [31, 32, 40, 41] and herbivory resistance [21, 31n33, 1]. However, alternative methods for applying MJ treatments have been also tested [44, 51, 53, 0]. In one study, soil irrigation of MJ increased the production of terpenoids in the needles, stem and roots of Douglas ﬁr seedlings [44], while in other experiments the application of MJ to the stem with a small brush induced xylem traumatic resin duct formation and PP cell activation in several conifer species [51, 53]. Finally, application of MJ to young spruces using cotton wool to allow evaporation increased the resistance against the pathogen P. ultimum [0]. Polyoxyethylene-20-sorbitan monolaurate (commercially also known as Tween-20®) is commonly used as surfactant which favours the suspension of MJ in water, and control treatment in experiments evaluating MJ-induced responses are therefore frequently sprayed with a Tween-20 solution [31, 32, 44, 51, 53, 1]. Recent studies in conifer seedlings have reported, however, significant induced responses in control plants treated with Tween-20 treatment [31, 42]. For example, application of 0.1% Tween-20 to Picea sitchensis Bong

354

X. Moreira et al.

seedlings increased the concentration of diterpenes and sesquiterpenes in the outer stem tissue with respect to the untreated control [42]. Similarly, resin content in P. pinaster branches treated with Tween-20 was higher than that in untreated control branches [31= !LTERNATIVES TO THE USE OF 4WEEN FOR DISsolving MJ without interfering in plant defences do exist [40, 41, 43]. For example, Sampedro et al. [43] used a carrier solution based on deionized water with 2.5% ethanol (v:v), while other authors did not use any surfactant to dissolve MJ [40, 41].

15.6.2

Activation Time, Decay Time and Systemic Effect

,IKEOTHERINDUCEDRESPONSES PLANTDEFENSIVERESPONSESTO-*APPLICATIONREQUIRE a threshold time to be expressed (activation time), and continue for a period of time until defensive levels relax back to their initial state (decay time) [4]. Speciﬁcally, maximum accumulation of monoterpenes and sesquiterpenes in the STEM AND NEEDLES OF YOUNG SPRUCES TREATED WITH -* OCCURS AROUND n DAYS after MJ application and then progressively declines back to control levels in AROUNDnDAYS;40, 41]. Similarly, the concentration of D-pinene and E-pinene in the stems of P. radiata seedlings increased 7 and 14 days after MJ application [1]. Contrastingly, the effect of MJ on the emission of volatile terpenes from the needles is much faster. In spruces, the emission peak occurs just a few hours after -*APPLICATIONAROUNDnHAFTER-*TREATMENTIN3ITKASPRUCEANDBETWEEN ANDHIN.ORWAYSPRUCE ANDREMAINEDHIGHUPTOnDAYSAFTERTREATMENT [41, 42]. The activation time and decay time appears thus to depend on the defensive trait considered. The relatively short decay time of the responses to MJ application may explain why the protection of P. radiata seedlings to D. pinea infection through MJ application is only effective during the ﬁrst 2 weeks after treatment [33= !LL THESE RESULTS HIGHLIGHT THE GREAT RELEVANCE OF THE TIME COURSE OF -* responses, which should be taken into account in any use of MJ as a simulator of real herbivory. Many studies on mature conifer trees have demonstrated that MJ can elicit a response in untreated tissues above or below the treated area [50, 52]. For example, the exogenous application of 100 mM MJ to the bark of 30-year-old Norway spruce induced the formation of traumatic resin ducts some distance away from its application site [50]. These authors also found that the greater the distance from the application area, the smaller the traumatic resin ducts were, indicating the existence of a dose-response phenomenon. However, little is known about the distal effects of proximal MJ application in young conifer trees. Moreira et al. [31] observed that the local application of a solution of 100 mM MJ on a basal branch distally elicited defensive responses on the upper main stem, but not on the opposite branch. Soil application of MJ increased resin terpenoids in the stem of young Douglas ﬁr seedlings [44].

15

Methyl Jasmonate as Chemical Elicitor of Induced Responses…

15.6.3

355

Comparison of Chemical, Biological and Mechanical Induction

It is likely that responses to real herbivory also involve other signalling pathways, and there is even evidence for annual plants that plant defensive responses elicited by closely related insect herbivores or by herbivores belonging to the same guild could differ [28=!SSUMMARIZEDINTHISREVIEW ITISWELLDOCUMENTED4ABLE15.1) that MJ treatments are able to induce defensive responses that provide effective resistance in young conifer trees against pest and diseases, but it remains poorly understood whether defensive responses induced by real and MJ-simulated herbivory are comparable. Indeed, this could be an important drawback to supporting methodological approaches that use MJ to simulate herbivory treatments for the induction of defences. For example, the exogenous application of MJ to young spruces caused signiﬁcant increases of total monoterpenes, sesquiterpenes and diterpenes in the inner stem tissue compared with untreated controls, but these increases were notably lower than those observed after real feeding by the weevil Pissodes strobi Peck. (Coleoptera: Curculionidae) [42]. In contrast, Moreira et al. (unpublished data) observed that chemical induction with 40 mM MJ, mechanical wounding in the stem, and real phloem herbivory by H. abietis produced similar quantitative defensive responses in P. pinaster seedlings, increasing the concentration of resin diterpenes in the stem and total phenolics in the needles by equivalent magnitudes (Fig. 15.3). Further research is needed to conﬁrm at what extent qualitative defensive responses produced by real herbivory are equivalent to those observed after simulated herbivory with MJ in young conifer trees.

15.7

Conclusions and Recommendations

Exogenous application of MJ increases the concentration of secondary chemicals in conifer tissues and promotes the formation of anatomical defence structures in young conifer trees [31, 40, 51]. Defensive responses elicited by MJ also increase the resistance of young conifer trees to insect herbivores and to a lesser extent to some pathogenic fungi [31n33]. MJ could therefore be used as an experimental simulator of real herbivory for scientiﬁc purposes; however the extent to which MJ-induced responses REmECT THOSE ELICITED BY INSECT HERBIVORES NEEDS TO BE FURTHER EXAMINED !LTHOUGH there is evidence that MJ-induced responses could mimic those elicited by wounding caused by coleoptera feeding in phloem, bark and stem, little is known about the responses elicited by caterpillars, nematodes, and defoliators, which could involve responses based in different signalling pathways. The use of exogenous application of MJ as pre-treatment in nursery production instead of traditional and prohibited pesticides should be subjected to further evaluation, as MJ application has also been shown to reduce plant growth, photosynthesis rate and needle transpiration [21, 32, 33].

Table 15.1 Summary of the published works about the effect of exogenous application of MJ in induced defences and resistance of young conifer trees Reference numbera Conifer species MJ treatmentsb Surfactant !PPLICATION Plant agec Plant typed Effect of MJ [1] Pinus radiata 0.0, 1.0, 4.5, 18.0 Tween-20 Foliar spraying 5 m Seedling Increased D-pinene and E-pinene in the stem Increased resistance to Diplodia pinea [33] Pinus radiata 0.0, 1.1, 4.5, 18.0 Tween-20 Foliar spraying 3 m Seedling Increased resistance to Diplodia pinea [32] Pinus sylvestris 0, 10, 100 Not described Foliar spraying 2 y Seedling Induced xylem traumatic resin duct formation Increased terpenoid concentration in needles and xylem Increased resistance to Hylobius abietis [44] Pseudotsuga 0.00, 0.01% (v/v) Tween-20 Soil irrigation nM Seedling Induced traumatic resin duct formation menziesii in the stem and roots Increased the concentration of terpenoids in the stem, needles and roots 12 species 0, 100 Tween-20 Stem brushing 3y Sapling Induced polyphenolic parenchyma cell [52] activation Induced xylem traumatic resin duct formation [53] Pseudotsuga 0, 10, 25, 50, 100 Tween-20 Stem brushing 4y Sapling Induced polyphenolic parenchyma cell menziesii activation and early sclereid formation Sequoiadendron Induced xylem traumatic resin duct giganteum formation [0] Picea abies 0, 25 (PM/100 l−1) None Evaporation by 7 d Seedling Increased salicylic acid concentration in cotton wool roots, hypocotyls and cotyledons Increased resistance to Pythium ultimum

X. Moreira et al.

0, 22

0, 100

Picea sitchensis

Pinus pinaster

Pinus pinaster

Pinus pinaster

Pinus pinaster

Pinus radiata

[42]

[31]

[43]

[21]

[4]

[2]

Ethanol 5NKNOWN

5NKNOWN

Tween-20

Ethanol

Tween-20

0, 22

0, 5, 50, 100

Tween-20

None

None

Foliar spraying

Foliar spraying

Foliar spraying

Foliar spraying

Foliar spraying

Foliar spraying

Foliar spraying

Foliar spraying

Seedling Seedling

M M

Seedling

Seedling

M

2m

Seedling

Seedling

Sapling

Sapling

11 m

1 or 2 y

2y

2y

Induced traumatic resin duct formation in the xylem Increased the concentration of terpenoids in the wood Increased mono- and sesquiterpene concentration in needles Increased terpene emission in needles Induced traumatic resin duct formation in the xylem Increased terpenoid concentration in inner stem tissue Increased volatile terpene concentration in needles Increased stem resin and needle total phenolics Increased resistance to Hylobius abietis Decreased sesquiterpene and D-pinene concentration in needles Increased E-pinene concentration in needles Increased resin in the stem Increased resistance to Hylobius abietis Increased stem diterpenes and needle phenolic compounds No effect on phytophtora root rot disease

b

Reference number in the table coincides with the reference number in the text MJ concentration always in mM, unless other units are speciﬁed c Days (d), months (m) or years (y) d Seedlings: young plant sporophyte developing out of a plant embryo from a seed. Sapling: a young tree with a slender trunk

a

10

Picea abies

[41]

0.00, 0.01% (v/v)

0, 1, 10, 100

Picea abies

[40]

15 Methyl Jasmonate as Chemical Elicitor of Induced Responses… 357

358

Diterpenes in the stem mg g-1

a

40

30 Control

20

10

0

b Total phenolics in the needles mg g-1

Fig. 15.3 Exogenous application of 40 mM MJ, mechanical wounding in the stem (MW) and real herbivory by H. abietis (HYL) increased the concentration of chemical defences by similar magnitudes. (a) Concentration of diterpenes in the stem, and (b) total phenolics in the needles in 1 year-old P. pinaster seedlings after application of MJ (MJ, black bars), mechanical wounding of the phloem (MW, white bars) and phloem feeding by the large pine weevil Hylobius abietis (HYL, grey bars). Data are the mean values ± s.e.m. . !LLTHETREATMENTS were signiﬁcantly different to the untreated control (P < 0.05)

X. Moreira et al.

20

15

10 Control

5

0

MJ

MW

HYL

!SARESULTOFTHISREVIEWWECANPROPOSESEVERALMETHODOLOGICALRECOMMENDAtions for the use of MJ as chemical elicitor in scientiﬁc studies. Firstly, a suspension of MJ in aqueous ethanol should be preferred to the use of the surfactant Tween-20, because the latter detergent increased defensive secondary compounds with respect to the untreated controls [31, 42]. Secondly, the use of the lowest concentrations of MJ as possible should be preferred, since high concentrations may provoke phytotoxicity or even the death of young trees, with unrealistic manipulation of the induction. Thirdly, as far as possible, plant responses to MJ application should be CALIBRATEDWITHRESPECTTOTHOSEELICITEDBYREALHERBIVORY!LTHOUGHITISKNOWNTHAT MJ application can promote defensive responses quantitatively similar to those caused by insect herbivores [42], this is an area which has been relatively little studied and in which there is a relative lack of concrete knowledge.

15

Methyl Jasmonate as Chemical Elicitor of Induced Responses…

359

Acknowledgements 2ESEARCH WAS SUPPORTED BY THE 03% AND !', n &/2 projects.

References &EENY0 0LANTAPPARENCYANDCHEMICALDEFENSE2ECENT!DV0HYTOCHEMn -ERY' +ATILA0 'ALLOWAY' !LFARO2) +ANNINEN- ,OBOVIKOV- 6ARJO* &ORESTS ANDSOCIETYnRESPONDINGTOGLOBALDRIVERSOFCHANGE VOL )5&2/7ORLD3ERIES)5&2/ Vienna 7ALTON! (UGHES* %NG- &ALL! 3HORE4 2IEL" (ALL0 0ROVINCIAL LEVELPROJECTION of the current Mountain pine beetle outbreak: update of the infestation projection based on the 2007 Provincial aerial overview of forest health and revisions to the model (BCMPB.v5). B.C. Ministry of Forests and Range, Victoria 3MITH47 #RAMER70 $IXON2+ .EILSON20 3OLOMON!- 4HEGLOBALTERRESTRIAL CARBONCYCLE7ATER!IR3OIL0OLLUTn &ARJON! !HANDBOOKOFTHEWORLDSCONIFERS"RILL!CADEMIC0UBLISHERS ,EIDEN 3CHULMAN% ,ONGEVITYUNDERADVERSITYINCONIFERS3CIENCEn &RANCESCHI6 +ROKENE0 +REKLING4 !NATOMICALANDCHEMICALDEFENSESOFCONIFERBARK AGAINSTBARKBEETLESANDOTHERPESTS.EW0HYTOLn 0HILLIPS-! #ROTEAU2" 2ESIN BASEDDEFENSESINCONIFERS4RENDS0LANT3CIn 4RAPP3 #ROTEAU2 $EFENSIVERESINBIOSYNTHESISINCONIFERS!NNU2EV0LANT0HYSIOL 0LANT-OL"IOLn -UMM2 (ILKER- $IRECTANDINDIRECTCHEMICALDEFENCEOFPINEAGAINSTFOLIVOROUS INSECTS4RENDS0LANT3CIn 0ASQUIER "ARRE& '£RI# 'OUSSARD& !UGER 2OZENBERG-! 'RENIER3 /VIPOSITION preference and larval survival of Diprion pini on Scots pine clones in relation to foliage CHARACTERISTICS!GRIC&OR%NTOMOLn 12. Barre F, Goussard F, Géri C (2003) Variation in the suitability of Pinus sylvestris to feeding by two defoliators, Diprion pini (Hym., Diprionidae) and Graellsia isabellae galliaegloria ,EP !TTACIDAE *!PPL%NTOMn 3ICILIANO 4 ,EO -$ "ADER ! 4OMMASI .$ 6RIELING + "RACA ! -ORELLI ) Pyrrolizidine alkaloids from Anchusa strigosa and their antifeedant activity. Phytochemistry n 3EIGLER$3 0LANTSECONDARYMETABOLISM+LUWER!CADEMIC0UBLISHERS $ORDRECHT 15. Karban R (2011) The ecology and evolution of induced resistance against herbivores. Funct %COLn !LFARO 2) !N INDUCED DEFENSE REACTION IN WHITE SPRUCE TO ATTACK BY THE WHITE PINE weevil Pissodes strobi#AN*&OR2ESn 4OMLIN%3 !LFARO2) "ORDEN*( (E&, (ISTOLOGICALRESPONSEOFRESISTANTANDSUSCEPTIBLEWHITESPRUCETOSIMULATEDWHITEPINEWEEVILDAMAGE4REE0HYSIOLn 18. Franceschi V, Krokene P, Krekling T, Christiansen E (2000) Phloem parenchyma cells are involved in local and distant defense responses to fungal inoculation or bark-beetle attack in Norway spruce (Pinaceae !M*"OTn 19. Krokene P, Solheim H, Krekling T, Christiansen E (2003) Inducible anatomical defense responses in Norway spruce stems and their possible role in induced resistance. Tree Physiol n +LEPZIG+$ +RUGER%, 3MALLEY%" 2AFFA+& %FFECTSOFBIOTICANDABIOTICSTRESS on induced accumulation of terpenes and phenolics in red pines inoculated with bark beetleVECTOREDFUNGUS*#HEM%COLn 3AMPEDRO , -OREIRA 8 :AS 2 2ESISTANCE AND RESPONSE OF Pinus pinaster seedlings to Hylobius abietisAFTERINDUCTIONWITHMETHYLJASMONATE0LANT%COLn doi:10.1007/s11258-010-9830-x

X. Moreira et al.

:ULAK +' $ULLAT (+ +EELING #) ,IPPERT $ "OHLMANN * )MMUNOmUORESCENCE localization of levopimaradiene/abietadiene synthase in methyl jasmonate treated stems of Sitka spruce (Picea sitchensis) shows activation of diterpenoid biosynthesis in cortical and DEVELOPINGTRAUMATICRESINDUCTS0HYTOCHEMISTRYn ,IEUTIER& (OSTRESISTANCETOBARKBEETLESANDITSVARIATIONS)N,IEUTIER& $AY+2 "ATTISTI ! 'R£GOIRE * # %VANS (& EDS "ARK AND WOOD BORING INSECTS IN LIVING TREES IN %UROPEASYNTHESIS3PRINGER $ORDRECHT P %YLES! "ONELLO0 'ANLEY2 -OHAMMED# )NDUCEDRESISTANCETOPESTSANDPATHOGENS INTREES.EW0HYTOLn "ROEKAERT 7& $ELAUR£ 3, $E "OLLE -&# #AMMUE "0! 4HE ROLE OF ETHYLENE IN HOST PATHOGENINTERACTIONS!NNU2EV0HYTOPATHn #REELMAN2! -ULLET*% *ASMONICACIDDISTRIBUTION AND ACTION IN PLANTS REGULATION DURING DEVELOPMENT AND RESPONSE TO BIOTIC AND ABIOTIC STRESS 0ROC .ATL !CAD 3CI 53! n 2ALPH3' 9UEH( &RIEDMANN- !ESCHLIMAN$ :EZNIK*! .ELSON## "UTTERlELD93. +IRKPATRICK 2 ,IU * *ONES 3*- -ARRA -! $OUGLAS #* 2ITLAND + "OHLMANN * Conifer defence against insects: microarray gene expression proﬁling of Sitka spruce (Picea sitchensis) induced by mechanical wounding or feeding by spruce budworms (Choristoneura occidentalis) or white pine weevils (Pissodes strobi) reveals large-scale changes of the host TRANSCRIPTOME0LANT#ELL%NVIRONn (EIDEL !* "ALDWIN )4 -ICROARRAY ANALYSIS OF SALICYLIC ACID AND JASMONIC ACID signalling in responses of Nicotiana attenuata to attack by insects from multiple feeding GUILDS0LANT#ELL%NVIRONn +OO!*+ (OWE'! 4HEWOUNDHORMONEJASMONATE0HYTOCHEMISTRYn 30. Cipollini D, Mbagwu J, Barto K, Hillstrom C, Enright S (2005) Expression of constitutive and inducible chemical defenses in native and invasive populations of Alliaria petiolata. J Chem %COLn -OREIRA 8 3AMPEDRO , :AS 2 $EFENSIVE RESPONSES OF Pinus pinaster seedlings to exogenous application of methyl-jasmonate: concentration effect and systemic response. %NVIRON%XP"OTn (EIJARI* .ERG! - +AINULAINEN0 6IIRI( 6UORINEN- (OLOPAINEN*+ !PPLICATION of methyl jasmonate reduces growth but increases chemical defence and resistance against Hylobius abietisIN3COTSPINESEEDLINGS%NTOMOL%XP!PPLn 33. Gould N, Reglinski T, Spiers M, Taylor JT (2008) Physiological trade-offs associated with methyl jasmonate - induced resistance in Pinus radiata#AN*&OR2ESn 34. Orlander G, Nordlander G (2003) Effects of ﬁeld vegetation control on pine weevil (Hylobius abietis DAMAGETONEWLYPLANTED.ORWAYSPRUCESEEDLINGS!NNU&OR3CIn (OLOPAINEN*+ (EIJARI* .ERG! - 6UORINEN- +AINULAINEN0 0OTENTIALFORTHEUSE of exogenous chemical elicitors in disease and insect pest management of conifer seedling PRODUCTION/PEN&OR3CI*n 3CHMIDT! 7ÛCHTLER" 4EMP5 +REKLING4 3£GUIN! 'ERSHENZON* !BIFUNCTIONAL geranyl and geranylgeranyl diphosphate synthase is involved in terpene oleoresin formation in Picea abies0LANT0HYSIOLn 37. Zulak KG, Bohlmann J (2010) Terpenoid biosynthesis and specialized vascular cells of conifer DEFENSE*)NT0LANT"IOLn 3CHMIDT! 'ERSHENZON* #LONINGANDCHARACTERIZATIONOFTWODIFFERENTTYPESOFGERANYL diphosphate synthases from Norway spruce (Picea abies 0HYTOCHEMISTRYn 0HILLIPS-! 7ALTER-( 2ALPH3' $ABROWSKA0 ,UCK+ 5RS%- "OLAND7 3TRACK$ Rodríguez-Concepción M, Bohlmann J, Gershenzon J (2007) Functional identiﬁcation and differential expression of 1-deoxy-D-xylulose 5-phosphate synthase in induced terpenoid resin formation of Norway spruce (Picea abies 0LANT-OL"IOLn 40. Martin D, Tholl D, Gershenzon J, Bohlmann J (2002) Methyl jasmonate induces traumatic resin ducts, terpenoid resin biosynthesis, and terpenoid accumulation in developing xylem of .ORWAYSPRUCESTEMS0LANT0HYSIOLn

15

Methyl Jasmonate as Chemical Elicitor of Induced Responses…

41. Martin DM, Gershenzon J, Bohlmann J (2003) Induction of volatile terpene biosynthesis and diurnal emission by methyl jasmonate in foliage of Norway spruce. Plant Physiol n -ILLER" -ADILAO,, 2ALPH3 "OHLMANN* )NSECT INDUCEDCONIFERDEFENSE7HITEPINE weevil and methyl jasmonate induce traumatic resinosis, de novo formed volatile emissions, and accumulation of terpenoid synthase and putative octadecanoid pathway transcripts in Sitka SPRUCE0LANT0HYSIOLn 3AMPEDRO, -OREIRA8 ,LUSIA* 0E®UELAS* :AS2 'ENETICS PHOSPHORUSAVAILABILITY and herbivore-derived induction as sources of phenotypic variation of leaf volatile terpenes in APINESPECIES*%XP"OTn (UBER$07 0HILIPPE2. -ADILAO,, 3TURROCK2. "OHLMANN* #HANGESINANATOMY and terpene chemistry in roots of Douglas-ﬁr seedlings following treatment with methyl JASMONATE4REE0HYSIOLn 2ICHARD 3 ,APOINTE ' 2UTLEDGE 2' 3£GUIN ! )NDUCTION OF CHALCONE SYNTHASE EXPRESSIONINWHITESPRUCEBYWOUNDINGANDJASMONATE0LANT#ELL0HYSIOLn 3AMPEDRO, -OREIRA8 :AS2 #OSTSOFCONSTITUTIVEANDHERBIVORE INDUCEDCHEMICAL DEFENSESINPINETREESEMERGEONLYUNDERLOWRESOURCESAVAILABILITY*%COLn 0IGGOTT. %KRAMODDOULLAH!+- ,IU* * 9U8 'ENECLONINGOFATHAUMATIN LIKE (PR-5) protein of western white pine (Pinus monticola D. Don) and expression studies of MEMBERSOFTHE02 GROUP0HYSIOL-OL0LANT0ATHOLn 0ERVIEUX) "OURASSA- ,AURANS& (AMELIN2 3£GUIN! !SPRUCEDEFENSINSHOWING strong antifungal activity and increased transcript accumulation after wounding and jasmonate TREATMENTS0HYSIOL-OL0LANT0ATHOLn ,IU* %KRAMODDOULLAH!+- :AMANI! !CLASS)6CHITINASEISUP REGULATEDBYFUNGAL infection and abiotic stresses and associated with slow-canker-growth resistance to Cronartium ribicola in western white pine (Pinus monticola 0HYTOPATHOLn &RANCESCHI6 +REKLING4 #HRISTIANSEN% !PPLICATIONOFMETHYLJASMONATEONPicea abies 0INACEAE STEMS INDUCES DEFENSE RELATED RESPONSES IN PHLOEM AND XYLEM !M * "OT n 51. Hudgins JW, Christiansen E, Franceschi VR (2004) Induction of anatomically based defense responses in stems of diverse conifers by methyl jasmonate: a phylogenetic perspective. Tree 0HYSIOLn 52. Hudgins JW, Christiansen E, Franceschi VR (2003) Methyl jasmonate induces changes MIMICKINGANATOMICALDEFENSESINDIVERSEMEMBERSOFTHE0INACEAE4REE0HYSIOLn 53. Hudgins JW, Franceschi VR (2004) Methyl jasmonate-induced ethylene production is responsible for conifer phloem defense responses and reprogramming of stem cambial zone FORTRAUMATICRESINDUCTFORMATION0LANT0HYSIOLn &ÛLDT * -ARTIN $ -ILLER " 2AWAT 3 "OHLMANN * 4RAUMATIC RESIN DEFENSE IN Norway spruce (Picea abies): methyl jasmonate-induced terpene synthase gene expression, ANDC$.!CLONINGANDFUNCTIONALCHARACTERIZATIONOF CARENESYNTHASE0LANT-OL"IOL n "EDON& ,EVASSEUR# 'RIMA 0ETTENATI* 3£GUIN! -AC+AY* 3EQUENCEANALYSIS and functional characterization of the promoter of the Picea glauca Cinnamyl Alcohol DehydrogenaseGENEINTRANSGENICWHITESPRUCEPLANTS0LANT#ELL2EPn 0E®UELAS* ,LUSIA* %STIARTE- 4ERPENOIDSAPLANTLANGUAGE4RENDS%COL%VOL 0E®UELAS* ,LUSIÖ* 0LANT6/#EMISSIONSMAKINGUSEOFTHEUNAVOIDABLE4RENDS%COL %VOLn 58. Pureswaran DS, Gries R, Borden JH (2004) Quantitative variation in monoterpenes in four SPECIESOFCONIFERS"IOCHEM3YST%COLn ,LUSIA* 0E®UELAS* %MISSIONOFVOLATILEORGANICCOMPOUNDSBYAPPLETREESUNDER SPIDERMITEATTACKANDATTRACTIONOFPREDATORYMITES%XP!PPL!CAROLn +OZLOWSKI ' "UCHALA ! -£TRAUX * 0 -ETHYL JASMONATE PROTECTS .ORWAY SPRUCE [Picea abies, +ARST=SEEDLINGSAGAINSTPythium ultimum Trow. Physiol Mol Plant Pathol n

X. Moreira et al.

'OULD. 2EGLINSKI4 .ORTHCOTT', 3PIERS- 4AYLOR*4 0HYSIOLOGICALANDBIOCHEMICAL responses in Pinus radiata seedlings associated with methyl jasmonate-induced resistance to Diplodia pinea0HYSIOL-OL0LANT0ATHOLn 2EGLINSKI4 3PIERS4- $ICK-! 4AYLOR*4 'ARDNER* -ANAGEMENTOFPHYTOPHTHORA ROOTROTINRADIATAPINESEEDLINGS0LANT0ATHOLn 2EGVAR- 'OGALA. ÏNIDARÝIÊ N (1997) Jasmonic acid affects mycorrhization of spruce seedlings with Laccaria laccata4REESn 'MEZ3 VAN$IJK7 3TUEFER*& 4IMINGOFINDUCEDRESISTANCEINACLONALPLANTNETWORK 0LANT"IOLn

Chapter 16

Pathogen-Responsive cis-Elements Ting Yuan and Shiping Wang

Abstract Different types of pathogen-responsive cis-elements have been identiﬁed from the promoters of plant genes involved in host–pathogen interactions. These cis-elements are directly controlled either by pathogen effectors or by plant regulatory proteins and activate or suppress gene expression after pathogen invasion. These elements provide the basis for further studies of defense signal transduction and the molecular mechanisms of defense responses. These elements also represent a valuable resource that can be used to design synthetic promoters for speciﬁcally regulating target genes in plant–pathogen interactions for crop improvement.

16.1

Introduction

Many plant genes, including the receptor genes that encompass disease resistance (R) genes and host pattern recognition receptor (HPRR) genes, defense-responsive genes, and disease susceptibility (S) genes, are involved in plant responses to pathogen attack [1]. The expression level of R, HPRR, and defense-responsive genes must be precisely regulated for effectively warding off pathogen attack but without inﬂuencing other physiologic activities and development of plants. In another way, pathogens can directly or indirectly regulate the expression of host S genes to facilitate

T. Yuan National Key Laboratory of Crop Genetic Improvement, National Center of Plant Gene Research (Wuhan), Huazhong Agricultural University, Wuhan 430070, China S. Wang (*) National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan 430070, China e-mail: [email protected]

J.M. Mérillon and K.G. Ramawat (eds.), Plant Defence: Biological Control, Progress in Biological Control 12, DOI 10.1007/978-94-007-1933-0_16, © Springer Science+Business Media B.V. 2012

363

364

T. Yuan and S. Wang

their infection. The expressions of R, HPRR, defense-responsive, and S genes are specially regulated by some cis-elements (or cis-acting element or cis-regulatory element), named pathogen-responsive cis-elements, in plant–pathogen interactions. A cis-element is a region of DNA or RNA that regulates the expression of genes located on the same chromosome by providing binding sites for one or more transcription factors (or trans-acting factor, trans-acting element, or trans-regulatory element). A cis-element may locate on the upstream end (5c-end) or downstream end (3c-end) of the coding sequence of a gene or in an intron of a gene. A number of pathogen-responsive cis-elements, which activate or suppress gene expression, have been characterized. These elements are directly controlled either by pathogen effectors or by plant regulatory proteins after pathogen invasion. This knowledge will help us understand the interaction of plants and pathogens and will also facilitate turning these resources into breeding programs for improvement of crop disease resistance.

16.2

The cis-Element Controlled Directly by Pathogen Regulators

One way adopted by pathogens to infect plants is using host S genes as their helpers [2–4]. These pathogens develop special effectors to transcriptionally activate host S genes. To face this invasion strategy, plants develop R genes with promoter mutation to trap pathogen effectors; thus, pathogen invasion induces R genes, that, in turn, initiate defense responses [5, 6]. Recent studies have revealed several cis-elements, named UPT (up-regulated by transcription activator-like [TAL] effectors) boxes, for binding of pathogenic bacterial transcription activator-like (TAL) effectors to activate plant gene expression in host–pathogen interactions in pepper and rice [6–10].

16.2.1

The Transcription Activator From Pathogenic Prokaryotes

The proteins, known as effectors and injected into host cells by the type III secretion system of pathogens, have an essential role in pathogenicity in plants. One type of effectors is the TAL effectors. The TAL effectors belong to a large family in a given species and also among different species. These effectors have been investigated intensively in the genus Xanthomonas, including the pathogenic bacteria X. oryzae pv. oryzae (Xoo), Xanthomonas oryzae pv. oryzicola (Xoc), and X. campestris pv. vesicatoria (Xcv) [11, 12]. Since the ﬁrst member of this family, AvrBs3, was identiﬁed in 1989, more than 100 members have been described [11, 13].

16

Pathogen-Responsive cis-Elements

365

N

C Translocation

Nuclear localization signal

Repeat region

Activation domain

Fig. 16.1 Structure model of TAL effector. N, amino-terminus; C, carboxyl-terminus

.UCLEOTIDEFREQUENCY

26$ HD

NG NS

NI

NN N*

HG H*

IG

4 ' # !

Fig. 16.2 The pairing codes between TAL effector and UPT box. The height of a colored bar indicates the frequency of a repeat-variable diresidues (RVD) of a TAL effector targeting to one of the degenerated pairing nucleotides of a UPT box. The frequencies were determined according to experimentally characterized UPT boxes listed in Table 16.1

The most intriguing feature shared by TAL effectors is the central domain of repeat region consisting of 1.5–28.5 repeats with each repeat containing 33–34 amino acid residues (Fig. 16.1). The major polymorphic sites among the repeats of a TAL effector are concentrated at residues 12 and 13 of each repeat and are named repeat-variable diresidues (RVDs) [14]. The RVD codes are usually written using the one-letter symbol of amino acid; thus an RVD is frequently written in two letters, such as HD, NG, NI, IG, and NN (Fig. 16.2). Some repeats in the repeat region of a TAL effector contain only one polymorphic site (missing residue 13) and the missing residue is written using an asterisk, such as the RVDs N* and H* (Fig. 16.2). The repeat region determines the speciﬁcity of transcriptional activation of each TAL effector. Besides the variable repeat region, TAL effectors have a conserved amino-terminus that is essential for type III secretion and a conserved carboxylterminus that harbors two functional nuclear localization signals and an acidic activation domain for activating a target gene (Fig. 16.1) [11]. The structure serves for function. Therefore, TAL effectors must function similarly in the plant nucleus to activate target genes. After being injected into the cytoplasm of plant cells, TAL effectors interact with host importin D, which is a subunit of nuclear import machinery, to direct them into the plant cell nucleus [15]. Thus, the pathogen TAL effectors make use of the host’s system to regulate host gene expression.

366

16.2.2

T. Yuan and S. Wang

Plant Pathogen-Responsive UPT Boxes and the Recognition Mechanism

Thus far, the characterized R genes, which promoters harbor the UPT boxes to trap pathogen TAL effectors, are rice Xa27 encoding an unknown apoplast protein [5, 16], pepper Bs3 encoding a unique protein that shares homology with ﬂavindependent monooxygenase [6], and pepper Bs3-E, which has the major difference from Bs3 in the promoter region [6] (Table 16.1). The characterized S genes, which promoters have UPT boxes for binding of TAL effectors, are rice Xa13 and Os11N3 (Table 16.1). Both Xa13 and Os11N3 belong to the MtN3/saliva multiple gene family, which is prevalent in eukaryotes, including mammals. In addition, some virulence-related transcription factor genes, such as rice TFX1 and pepper UPA20, have also been reported to carry UPT boxes in their promoter regions (Table 16.1). These results indicate that although TAL effectors have structural and functional similarity, they can transcriptionally manipulate different aspects of host genes. Recent studies have revealed that the binding of a TAL effector to the UPT box is determined by the speciﬁc pairing of RVDs of an effector and the nucleotides of a UPT box, with one RVD pairing to one nucleotide in the UPT box [14, 18]. Thus, based on the RVDs of a given TAL effector, one may predict a putative UPT box that interacts with this effector. However, some of the identiﬁed RVDs of TAL effectors have degenerated (2–4) pairing nucleotides based on the identiﬁed and predicted UPT boxes [14, 18]. For example, according to the experimental characterized binding between TAL effectors and UPT boxes (Fig. 16.2), the RVD IG is speciﬁcally pairing with the T nucleotide of UPT boxes; RVD HG pairs T or C with a preference for T; RVD NN recognizes all four types of nucleotides with a preference for G or A; and RVD N* binds either C, A, or G. Furthermore, the binding degeneracy and speciﬁcity appear to be inﬂuenced by the position of an RVD in a TAL effector or by the position of a nucleotide in a UPT box. For example, the RVD NN recognizes all four types of nucleotides in UPT boxes (Fig. 16.2). However, matching the NN-type RVD of Xoo PthXo1 effector to the 5c-end second G nucleotide but not A, C, or T of rice UPTPthXol box is crucial for the interaction between PthXol and UPTPthXo1 [19, 20]. The PthXol RVDs pairing to the third and sixth nucleotides of the UPTPthXo1 box are HD-type, identiﬁed to recognize C, A, and T in the UPT boxes (Fig 16.2). Interestingly, substitution of the third C to A in the UPTPthXo1 box abolished Xoo-induced gene expression and substitution of the sixth C to A in the UPTPthXo1 box did not inﬂuence gene activation (Fig. 16.3) [20]. These results suggest that not all RVDs make an equal contribution to the interaction between a TAL effector and a UPT box. The number of RVDs in a TAL effector determines the size of corresponding UPT box [14, 18]. In addition, the 5c-terminal T nucleotide of UPT boxes, which does not pair with an RVD, appears to be critical for transcriptional activation by a corresponding TAL effector and binding with a TAL effector [10, 18, 19]. However, the length of a functional UPT box is not always as long as that predicted using the TAL effector code. The nucleotides in the 3c-termini of some UPT boxes appear to

Biochemical function in host–pathogen interaction Gene and type Effector Organisma UPT box AvrBs3 Xcv UPTAvrBs3: TATATAAACCTAACCATCC Pepper Bs3, R gene Not characterized AvrHah1 Xg UPTAvrHah1: TATAAACCTAACCAT Pepper Bs3, R gene Not characterized AvrBs3'rep16 Xcv UPTAvrBs3'rep16: TATATAAACCTCTCT Pepper Bs3-E, R gene Not characterized AvrBs3 Xcv UPAAvrBs3: TATATAAACCTGACCCTTT UPA20, virulence-related gene Virulence-related transcription factor Rice Xa27, R gene Not characterized AvrXa27 Xoo UPTAvrXa27: TAGAAGAAGAGACCCATA PthXo1 Xoo UPTPthXo1: TGCATCTCCCCCTACTGTACACCAC Rice Xa13, S gene Copper transport AvrXa7 Xoo UPTAvrXa7: TATATAAACCCCCTCCAACCAGGTGCT Rice Os11N3, S gene Not characterized PthXo3 Xoo UPTPthXo3: ATATAAACCCCCTCCAACCAGGTGCTAAG Rice Os11N3, S gene Not characterized PthXo6 Xoo UPTPthXo6: TATAAAAGGCCCTCACCAACCCAT Rice TFX1, virulence-related Virulence-related gene transcription factor a Xcv, Xanthomonas campestris pv. vesicatoria; Xg, Xanthomonas gardneri; Xoo, Xanthomonas oryzae pv. oryzae

Table 16.1 Characterized bacterial TAL effectors and corresponding plant UPT boxes Bacterium Plant

[5, 9] [17, 19, 20] [19] [4] [19]

References [6] [14] [6] [7, 8]

16 Pathogen-Responsive cis-Elements 367

368

T. Yuan and S. Wang

Fig. 16.3 Expression of reporter gene E-glucuronidase (GUS) driven by native (PXa13) or mutated (PXa13'79T, PXa13'75A, PXa13'78A, and PXa13'77G) Xa13 promoters after infection of Xoo strain PXO99 carrying the PthXo1 effector in rice (This ﬁgure is adapted from Yuan et al. 2011). (a) The sites of promoter mutations. The UPTPthXol box of PXa13 is shown with bold italic letters. (b) Expression of GUS in transgenic plants. GUS activity was determined by measuring the amount of 4-methylumbelliferone (Mu) produced under the catalysis of GUS in 1 mg total protein per minute. ck, without Xoo- or mock-inoculation. The asterisk (*) indicates that a signiﬁcant difference (P < 0.01) was detected between PXO99-inoculated plants and non-inoculated control (ck) plants carrying the same promoter

16

Pathogen-Responsive cis-Elements

369

be not required for gene activation but seem to be indispensable in other UPT boxes. For example, the Xoo AvrXa27 effector contains 17 RVDs, which suggests the corresponding rice UPTAvrXa27 box contains 18 nucleotides [14, 19]. Omission of the last three nucleotides of the predicted UPTAvrXa27 box can still trigger R gene Xa27mediated hypersensitive response by the AvrXa27 effector [9]. It has been suggested that at least 6.5 RVDs are required to recognize the target UPT box and to activate gene expression, and 10.5 or more RVDs can efﬁciently activate gene expression [18]. However, in the interaction of Xoo PthXo1 effector and rice UPTPthXo1 box, all the predicted 24 nucleotides in the UPT box appear to be essential for transcriptional activation of the S gene Xa13 [20]. The nucleotide-binding speciﬁcities of some RVDs, such as HI, SS, NQ, NC, and NV that exist in low frequency in sequenced TALs, have not been determined yet [19]. However, present knowledge provides information to engineer multiple pathogenactivated promoters as transgenic tools. An example is the combining of different UPT boxes (UPTAvrXa27, UPTAvrBs3, and UPTAvrBs3'rep16) into one promoter that can be activated by any one of the bacteria carrying corresponding TAL effectors [9].

16.3

The cis-Element Controlled by Plant Regulators

One of the features of pathogen-induced plant defense signal transduction is transcriptional regulation of a large number of defense-responsive genes [21, 22]. The expression of these defense-responsive genes is either activated or suppressed in plant–pathogen interactions. A relatively large number of defense-responsive genes encode transcription factors. Different pathogen-responsive cis-elements, which are involved in transcriptional regulations of defense-responsive genes, have been identiﬁed to be regulated by host transcription factors (Table 16.2).

16.3.1

W and W-Like Box

The W and W-like boxes (Table 16.2), which are the speciﬁc DNA-binding targets of WRKY-type transcription factors [23], are an important type of pathogen-responsive cis-element. The WRKY-type transcription factors belong to a superfamily. Some of WRKY transcription factors positively regulate gene expression and others negatively regulate gene expression. The deﬁned feature of this type of transcription factors is their DNA-binding domain, called WRKY domain that consists of a WRKYGQK sequence followed by a Cx4-5Cx22-23HxH or Cx7Cx23HxC zinc-binding motif [24]. The promoter regions of many defense-responsive genes harbor one to multiple W or W-like boxes [25]. These include the genes functioning in HPRR-initiated basal immunity, mitogen-activated protein kinase signaling, and salicylic acid (SA)-dependent and jasmonic acid (JA)-dependent pathways [26–30]. The W box was also reported to be important for the function of R gene in

Table 16.2 Characterized pathogen-responsive cis-elements and corresponding plant binding proteins cis-elements Core sequence Binding protein W box and W-like box TTGAC; TTGACC/T; TTGACA; TGACC/T WRKY GCC box and GCC-like box AGCCGCC; AGACCGCC; AGCCACC; TACCGACAT ERF G box CAC(A/G)TG MYC As-1 element TGACG TGA (bZIP) PB GTCAAAAA/T AtWhy1 CGCG box (A/C/G)CGCG(G/T/C) AtSR1 PRE4 TGCGCTT OsWRKY13 Tubby-like WK box TTTTCCAC NtWRKY12 A(C/T)G(A/T)A(C/T)CT EIN3 EIL1 PRE2 ACGCTGCCG Rad51-like Os08g05960 MBSII G(G/T)T(A/T)G(G/T)TA MBY GT GAAAAA GT1-like L box ACCTACC MYB P box AC(A/C)AACC MYB/BPF

References [23, 33] [36, 41] [42] [29] [45] [47] [34] [48] [49, 50] [34] [52] [53] [56, 57] [55]

Response after infection Activation and repression Activation and repression Activation Activation and repression Activation Repression Activation Activation Activation and repression Activation Activation Activation Activation Activation

370 T. Yuan and S. Wang

16

Pathogen-Responsive cis-Elements

371

Arabidopsis–oomycete interaction [31]. W and W-like boxes also exist in the promoters of plant WRKY genes. Plant WRKY proteins can bind to the promoters of their own genes or the promoters of other WRKY genes [26, 32–35]. This feature provides a feedback control of the functions of WRKY transcription factors to balance plant responses to pathogen infection. Thus W and W-like boxes have important roles in both basal and race-speciﬁc disease resistance. Because defense signaling is largely conserved between species boundaries, the deﬁned pathogen-responsive cis-element could be used for synthesizing plant promoters that direct local gene expression in response to pathogen. Multimers of W boxes from parsley pathogenesis-related (PR) PR1 gene were constructed upstream of the cauliﬂower mosaic virus 35S minimal promoter to direct target gene expression. This synthetic promoter can induce the expression of a target gene in the infection site in Arabidopsis after both compatible and incompatible pathogen infection [36].

16.3.2

Phytohormone-Responsive Elements

Ethylene, SA, and JA are well-known defense signaling molecules [37–39]. Abscisic acid has also been reported to be involved in plant–pathogen interactions [40]. Some cis-elements are responsive to hormone signaling in plant–pathogen interactions. The GCC and GCC-like boxes (Table 16.2) can be speciﬁcally recognized by ethylene response factor (ERF)-type transcription factors. These cis-elements have been identiﬁed in the promoter regions of many defense-responsive genes [41]. The GCC box functions as an ethylene-responsive element that is necessary and sufﬁcient for ethylene regulation in the host–pathogen interaction [37]. Tetramers of GCC box (GACCACC) were constructed upstream of the 35S minimal promoter. The gene regulated by this synthetic promoter was speciﬁcally activated in the infection site after pathogen attack in Arabidopsis [36]. The G box (Table 16.2) that provides binding for the MYC-type transcription factor is abundant in the promoters of the genes involved in JA-responsive induced systemic resistance [42]. The activation sequence-1 (as-1) element (Table 16.2) occurs in the promoters of some glutathione S-transferase genes and PR genes that are involved in the SA-mediated defense responses [43]. The TGA class of basic leucine-zipper transcription factors physically interacts with the positive regulator, the nonexpresser of PR gene 1 (NPR1), for regulation of some PR gene expression by binding to the as-1 element [44]. SA could also mediate gene expression by an NPR1-independent pathway. Arabidopsis Why1 transcription factor is an important downstream component of the SA-dependent defense pathway, whose activation is independent of NPR1. Why1 regulates gene expression by binding to the PB element (Table 16.2) in a plant’s response to a pathogen attack [45]. The 6-bp CGCG box is found in promoters of genes involved in different hormone signaling, such as abscisic acid, ethylene, and SA. The Arabidopsis AtSR1 to AtSR6 calmodulin-binding proteins speciﬁcally recognize the CGCG box in vivo [46].

372

T. Yuan and S. Wang

The AtSR1 negatively regulates plant immunity by binding to the promoter fragment harboring a typical CGCG box of EDS1 gene, which is an established regulator of the SA-dependent pathway, and suppressing EDS1 expression [47].

16.3.3

Other cis-Elements

Some pathogen-responsive cis-elements have been discovered rarely in certain promoters based on the present publication or are markedly different from a typical element. Rice WRKY-type transcription factor WRKY13, which can bind to W box, also has the ability to bind to a novel pathogen-responsive cis-element PRE4 (Table 16.2) on its own promoter [33, 34]. The PRE4 does not share sequence similarity with either W or W-like boxes (Table 16.2). In addition, a tubby-like protein also binds to PRE4. PRE4 negatively regulates rice WRKY13 expression when without pathogen infection and positively regulates WRKY13 expression after Xoo infection [34]. Tobacco WRKY-type NtWRKY12 transcription factor speciﬁcally recognizes the WK box (Table 16.2) that is neither a typical W box nor a W-like box and is essential for transcriptional activation of the defense-responsive gene PR-1a [48]. The known ethylene signaling transcription factors ETHYLENE INSENSITIVES3 (EIN3) and ETHYLENE INSENSITIVE3-LIKE (EIL1) can positively regulate the innate immunity by directly activating an HPRR-type receptor gene FLS2 in Arabidopsis [49]. EIN3/EIL1 can also negatively regulate innate immunity by repressing SA biosynthesis, which is mediated by directly suppressing the expression of SALICYLIC ACID INDUCTION DEFICIENT2 (SID2). Interestingly, both the positive regulation of FLS2 and the negative regulation of SID2 are mediated by the direct binding of EIN3 to a consensus sequence of A(C/T)G(A/T) A(C/T)CT [50]. The PRE2 element (Table 16.2) occurs in the promoter region of rice defenseresponsive gene WRKY13 [34]. Two proteins, Rad51-like and an unknown protein (Os08g05960), speciﬁcally bind to PRE2. The genes encoding the two proteins showed differential expression after Xoo infection [34]. PRE2 suppresses WRKY13 when without pathogen infection and activates WRKY13 after Xoo infection. The MBS element (Table 16.2) is present in the promoters of many genes involved in phenylpropanoid biosynthesis and is involved in the response to environmental stresses [51]. Tobacco Myb1 transcription factor preferentially bound to this element in the promoter of defense-responsive gene PR-1a and transcriptionally activated this gene during plant defense responses [52]. Pathogen induces the expression of the soybean SCaM-4 gene by mediating the binding of a GT-type transcription factor to the GT element (Table 16.2) in SCaM-4 promoter [53]. GT elements are usually found in tandem repeats in the promoter regions of many different plant genes including pathogenesis-related tobacco gene PR-1a. GT elements can have a positive or a negative transcriptional function depending on the promoter structure [54].

16

Pathogen-Responsive cis-Elements

373

Pathogen-induced systemic acquired resistance dramatically induces endogenous SA level in dicots. The L box and P box (Table 16.2) are highly conserved in the promoter regions of not only phenylalanine ammonia-lyase (PAL) genes that are involved in SA biosynthesis in plants but also in the promoter regions of other defense-responsive genes [55–57]. The carrot MYB-type transcription factor DcMYB1 was speciﬁcally bound to the L boxes in the promoter of DcPAL1, which activated DcPAL1 in response to fungal elicitor [57]. The parsley DNA-binding protein BPF-1 (Box P-binding factor 1) has been proposed to modulate plant defense by binding to the P box and activating the expression of PAL-1 [55].

16.3.4

Recognition Mechanism Between Plant Transcription Factors and cis-Element

Transcription factors in the same family always recognize similar cis-elements, although they regulate different physiologic activities or function in different positions of the same signal transduction pathway. Even one transcription factor can regulate gene expression both positively and negatively by binding to an identical cis-element in different promoters [49, 50]. How do these recognitions not cause confusion? One explanation is that the recognition of a certain cis-element needs the corresponding transcription factor as well as other proteins or cofactors consisting of protein complexes. For example, the Arabidopsis PR1 gene expression can be quickly activated by pathogen and SA. The positive cofactor NPR1 can recruit TGA transcription factors, such as TGA2 and TGA3, to the as-1 cis-element of PR1 promoter on induction by pathogen in an SA-dependent manner [58]. On the other hand, the negative cofactor SNI1 acts synergistically with TGA2 to repress basal expression of the PR1 gene [44]. SCARECROW-like 14 (SCL14), a member of the GRAS family of transcription regulators, acts as another cofactor of TGA2 and is essential for the transcriptional activation of the corresponding genes harboring as-1 cis-elements in their promoters in plants against certain types of xenobiotic stress [59]. This cofactor effect may work in two ways. One way is that the transcription factor serves as sequence-speciﬁc anchor protein to recruit cofactor to the respective promoter regions. Then the transcription factor and the cofactor consist of a transcription complex to regulate gene expression, such as the TGA2 and SCL14 [59]. The other way is that the cofactor may modify target transcription factor for speciﬁc gene regulation. An SA-induced member of the glutaredoxins family, the Arabidopsis GRX480, is important for the TGA2-mediated repression of PDF1.2. It is deduced that GRX480 might be involved in modifying TAG factors [60]. Thus, the cofactor effect is an important mechanism for a transcription factor to recognize its corresponding cis-element in a speciﬁc promoter under certain stimulation. The DNA-binding selectivity of transcription factors is another ingredient essential for homologous proteins to bind a speciﬁc cis-element. The GCC box (AGCCGCC) is often found in promoter regions of ethylene-responsive genes and is recognized speciﬁcally by ERF motif-containing proteins (Table 16.2).

374

T. Yuan and S. Wang

Some GCC-like boxes, such as JERE (AGACCGCC) and DRE (TACCGACAT), are also recognized by ERFs [61, 62]. However, Arabidopsis AtERFs from a different subfamily can recognize different GCC and GCC-like boxes. Additionally, three conserved residues in the ERF motif, Arg29, Glu39, and Arg41, can directly contact the fourth C, ﬁfth G, and the last C of the GCC box, which provides the primary DNA-binding capability of AtERFs; another three residues in the ERF motif, Arg31, Arg49, and Trp51, may contribute to the selective recognition of the other DNA nucleotides [63]. This suggests that CGNC (N represents A, T, G or C) in the GCC and GCC-like boxes is indispensable for recognition of ERFs, and the other nucleotides in the GCC and GCC-like boxes may be involved in the selective binding of ERFs. The same scenario also occurred in the recognition of WRKY transcription factor and W box. Two well-known functional W box variants are TTGACC and TTGACT (Table 16.2). The groups IIb and IId WRKY proteins can bind both of the variants, and this binding depends on the G residue directly 5c adjacent to the W box [64]. However, WRKY proteins from the other groups can only bind TTGACC in vitro; the 5c ﬂanking sequence has no inﬂuence on their binding afﬁnity, whereas the A residue 3c adjacent to the W box is important for binding [64]. These indicate that WRKY transcription factors from a different subfamily may have distinct binding preferences. However, the exact mechanism by which the selective DNA binding remains to be elucidated. In addition to the DNA-speciﬁc selectivity, the space between the cis-elements is also important for promoter strength. Two promoters were synthesized with tetramers of W boxes (TTGACC) spaced with different lengths of nucleotides as a unit. The spacing effect caused by different distances between W boxes of the two synthetic promoters resulted in a marked difference in promoter activity by pathogen induction [36].

16.4

Conclusion

The UPT boxes are a distinct group of pathogen-responsive cis-elements that are targeted by corresponding pathogen TAL effectors, which results in highly speciﬁc induction of plant genes. For this reason, the UPT box is under a strong selective pressure because the corresponding effector could change quickly through a horizontal gene transfer or gene recombination between different members of this family. The recognition of pathogen-responsive cis-elements by plant transcription factors is more complicated because the recognition will result in either induction or repression of target genes. Commonly, some cis-elements are not only pathogenresponsive but also responsive to abiotic stresses or phytohormones. For this reason, these cis-elements may be responsive to a broad-spectrum of pathogens. These characterized pathogen-responsive cis-elements provide the basis for further studies of defense signal transduction and the molecular mechanisms of defense responses. These elements also represent a valuable resource that can be used to design synthetic promoters for speciﬁcally regulating target genes in plant–pathogen interactions for crop improvement.

16

Pathogen-Responsive cis-Elements

375

References 1. Kou Y, Wang S (2010) Broad-spectrum and durability: understanding of quantitative disease resistance. Curr Opin Plant Biol 13:181–185. doi:10.1016/j.pbi.2009.12.010 DOI:dx.doi.org 2. Chu Z, Yuan M, Yao J, Ge X, Yuan B, Xu C, Li X, Fu B, Li Z, Bennetzen JL, Zhang Q, Wang S (2006) Promoter mutations of an essential gene for pollen development result in disease resistance in rice. Genes Dev 20:1250–1255. doi:10.1101/gad.1416306 3. Yuan M, Chu Z, Li X, Xu C, Wang S (2009) Pathogen-induced expressional loss of function is the key factor in race-speciﬁc bacterial resistance conferred by a recessive R gene xa13 in rice. Plant Cell Physiol 50:947–955. doi:10.1093/pcp/pcp046 4. Antony G, Zhou J, Huang S, Li T, Liu B, White F, Yang B (2010) Rice xa13 recessive resistance to bacterial blight is defeated by induction of the disease susceptibility gene Os-11 N3. Plant Cell 22:3864–3876. doi:10.1105/tpc.110.078964 5. Gu K, Yang B, Tian D, Wu L, Wang D, Sreekala C, Yang F, Chu Z, Wang GL, White FF, Yin Z (2005) R gene expression induced by a type-III effector triggers disease resistance in rice. Nature 435:1122–1125. doi:10.1038/nature03630 6. Römer P, Hahn S, Jordan T, Strauss T, Bonas U, Lahaye T (2007) Plant pathogen recognition mediated by promoter activation of the pepper Bs3 resistance gene. Science 318:645–648. doi:10.1126/science.1144958 7. Kay S, Hahn S, Marois E, Hause G, Bonas U (2007) A bacterial effector acts as a plant transcription factor and induces a cell size regulator. Science 318:648–651. doi:10.1126/science.1144956 8. Kay S, Hahn S, Marois E, Wieduwild R, Bonas U (2009) Detailed analysis of the DNA recognition motifs of the Xanthomonas type III effectors AvrBs3 and AvrBs3Deltarep16. Plant J 59:859–871. doi:10.1111/j.1365-313X.2009.03922.x 9. Römer P, Recht S, Lahaye T (2009) A single plant resistance gene promoter engineered to recognize multiple TAL effectors from disparate pathogens. Proc Natl Acad Sci USA 106:20526–20531. doi:10.1073/pnas.0908812106 10. Römer P, Strauss T, Hahn S, Scholze H, Morbitzer R, Grau J, Bonas U, Lahaye T (2009) Recognition of AvrBs3-like proteins is mediated by speciﬁc binding to promoters of matching pepper Bs3 alleles. Plant Physiol 150:1697–1712. doi:10.1104/pp. 109.139931 11. Boch J, Bonas U (2010) Xanthomonas AvrBs3 family-type III effectors: discovery and function. Annu Rev Phytopathol 48:419–436. doi:10.1146/annurev-phyto-080508-081936 12. Bogdanove AJ, Schornack S, Lahaye T (2010) TAL effectors: ﬁnding plant genes for disease and defense. Curr Opin Plant Biol 13:394–401. doi:10.1016/j.pbi.2010.04.010 DOI:dx. doi.org 13. Bonas U, Stall RE, Staskawicz B (1989) Genetic and structural characterization of the avirulence gene avrBs3 from Xanthomonas campestris pv. vesicatoria. Mol Gen Genet 218:127–136. doi:10.1007/BF00330575 14. Moscou MJ, Bogdanove AJ (2009) A simple cipher governs DNA recognition by TAL effectors. Science 326:1501. doi:10.1126/science.1178817 15. Szurek B, Rossier O, Hause G, Bonas U (2002) Type III-dependent translocation of the Xanthomonas AvrBs3 protein into the plant cell. Mol Microbiol 46:13–23. doi:10.1046/j.1365-2958.2002.03139.x 16. Wu L, Goh ML, Sreekala C, Yin Z (2008) XA27 depends on an amino-terminal signal-anchorlike sequence to localize to the apoplast for resistance to Xanthomonas oryzae pv oryzae. Plant Physiol 148:1497–1509. doi:10.1104/pp. 108.123356 17. Yuan M, Chu Z, Li X, Xu C, Wang S (2010) The bacterial pathogen Xanthomonas oryzae overcomes rice defenses by regulating host copper redistribution. Plant Cell 22:3164–3176. doi:10.1105/tpc.110.078022 18. Boch J, Scholze H, Schornack S, Landgraf A, Hahn S, Kay S, Lahaye T, Nickstadt A, Bonas U (2009) Breaking the code of DNA binding speciﬁcity of TAL-type III effectors. Science 326:1509–1512. doi:10.1126/science.1178811 19. Römer P, Recht S, Strauss T, Elsaesser J, Schornack S, Boch J, Wang S, Lahaye T (2010) Promoter elements of rice susceptibility genes are bound and activated by speciﬁc TAL

376

20.

21.

22. 23.

24. 25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

35.

36.

T. Yuan and S. Wang effectors from the bacterial blight pathogen, Xanthomonas oryzae pv. oryzae. New Phytol 187:1048–1057. doi:10.1111/j.1469-8137.2010.03217.x Yuan T, Li X, Xiao J, Wang S (2011) Characterization of Xanthomonas oryzae-responsive cis-acting element in the promoter of rice race-speciﬁc susceptibility gene Xa13. Mol Plant 4(2):300–309. doi:10.1093/mp/ssq076 Chu Z, Ouyang Y, Zhang J, Yang H, Wang S (2004) Genome-wide analysis of defense-responsive genes in bacterial blight resistance of rice mediated by the recessive R gene xa13. Mol Genet Genomics 271:111–120. doi:10.1007/s00438-003-0964-6 Eulgem T (2005) Regulation of the Arabidopsis defense transcriptiome. Trends Plant Sci 10:71–78. doi:10.1016/j.tplants.2004.12.006 DOI:dx.doi.org Eulgem T, Rushton PJ, Robatzek S, Somssich IE (2000) The WRKY superfamily of plant transcription factors. Trends Plant Sci 5:199–206. doi:10.1016/S1360-1385(00)01600-9 DOI:dx.doi.org Rushton PJ, Somssich IE, Ringler P, Shen QJ (2010) WRKY transcription factors. Trends Plant Sci 15:247–258. doi:10.1016/j.tplants.2010.02.006 DOI:dx.doi.org Qiu D, Xiao J, Xie W, Cheng H, Li X, Wang S (2009) Exploring transcriptional signaling mediated by OsWRKY13, a potential regulator of multiple physiological processes in rice. BMC Plant Biol 9:74. doi:10.1186/1471-2229-9-74 Asai T, Tena G, Plotnikova J, Willmann MR, Chiu WL, Gomez-Gomez L, Boller T, Ausubel FM, Sheen J (2002) MAP kinase signalling cascade in Arabidopsis innate immunity. Nature 415:977–983. doi:10.1038/415977a Journot-Catalino N, Somssich IE, Roby D, Kroj T (2006) The transcription factors WRKY11 and WRKY17 Act as negative regulators of basal resistance in Arabidopsis thaliana. Plant Cell 18:3289–3302. doi:10.1105/tpc.106.044149 Qiu D, Xiao J, Xie W, Liu H, Li X, Xiong L, Wang S (2008) Rice gene network inferred from expression proﬁling of plants overexpressing OsWRKY13, a positive regulator of disease resistance. Mol Plant 1:538–551. doi:10.1093/mp/ssn012 Pape S, Thurow C, Gatz C (2010) The Arabidopsis thaliana PR-1 promoter contains multiple integration sites for the coactivator NPR1 and the repressor SNI1. Plant Physiol 154(4):1805–1818. doi:10.1104/pp.110.165563 Pandey SP, Roccaro M, Schön M, Logemann E, Somssich IE (2010) Transcriptional reprogramming regulated by WRKY18 and WRKY40 facilitates powdery mildew infection of Arabidopsis. Plant J 64:912–923. doi:10.1111/j.1365-313X.2010.04387.x Mohr TJ, Mammarella ND, Hoff T, Woffenden BJ, Jelesko JG, McDowell JM (2010) The Arabidopsis downy mildew resistance gene RPP8 is induced by pathogens and salicylic acid and is regulated by W box cis elements. Mol Plant Microbe Interact 23:1303–1315. doi:10.1094/ MPMI-01-10-0022 Lippok B, Birkenbihl RP, Rivory G, Brümmer J, Schmelzer E, Logemann E, Somssich IE (2007) Expression of AtWRKY33 encoding a pathogen- or PAMP-responsive WRKY transcription factor is regulated by a composite DNA motif containing W box elements. Mol Plant Microbe Interact 20:420–429. doi:10.1094/MPMI-20-4-0420 Qiu D, Xiao J, Ding X, Xiong M, Cai M, Cao Y, Li X, Xu C, Wang S (2007) OsWRKY13 mediates rice disease resistance by regulating defense-related genes in salicylate- and jasmonatedependent signaling. Mol Plant Microbe Interact 20:492–499. doi:10.1094/MPMI-20-5-0492 Cai M, Qiu D, Yuan T, Ding X, Li H, Duan L, Xu C, Li X, Wang S (2008) Identiﬁcation of novel pathogen-responsive cis-elements and their binding proteins in the promoter of OsWRKY13, a gene regulating rice disease resistance. Plant Cell Environ 31:86–96. doi:10.1111/j.1365-3040.2007.01739.x Tao Z, Liu H, Qiu D, Zhou Y, Li X, Xu C, Wang S (2009) A pair of allelic WRKY Genes play opposite role in rice-bacteria interactions. Plant Physiol 151:936–948. doi:10.1104/pp. 109.145623 Rushton PJ, Reinstädler A, Lipka V, Lippok B, Somssich IE (2002) Synthetic plant promoters containing deﬁned regulatory elements provide novel insights into pathogen- and woundinduced signaling. Plant Cell 14:749–762. doi:10.1105/tpc.010412

16

Pathogen-Responsive cis-Elements

377

37. Broekaert WF, Delauré SL, De Bolle MF, Cammue BP (2006) The role of ethylene in host-pathogen interactions. Annu Rev Phytopathol 44:393–416. doi:10.1146/annurev. phyto.44.070505.143440 38. Van der Ent S, Van Wees SC, Pieterse CM (2009) Jasmonate signaling in plant interactions with resistance-inducing beneﬁcial microbes. Phytochemistry 70:1581–1588. doi:10.1016/j. phytochem.2009.06.009 DOI:dx.doi.org 39. Vlot AC, Dempsey DA, Klessig DF (2009) Salicylic Acid, a multifaceted hormone to combat disease. Annu Rev Phytopathol 47:177–206. doi:10.1146/annurev.phyto.050908.135202 40. Ton J, Flors V, Mauch-Mani B (2009) The multifaceted role of ABA in disease resistance. Trends Plant Sci 14:310–317. doi:10.1016/j.tplants.2009.03.006 DOI:dx.doi.org 41. Fujimoto SY, Ohta M, Usui A, Shinshi H, Ohme-Takagi M (2000) Arabidopsis ethyleneresponsive element binding factors act as transcriptional activators or repressors of GCC boxmediated gene expression. Plant Cell 12:393–404. doi:10.1105/tpc.12.3.393 42. Pozo MJ, Van Der Ent S, Van Loon LC, Pieterse CM (2008) Transcription factor MYC2 is involved in priming for enhanced defense during rhizobacteria-induced systemic resistance in Arabidopsis thaliana. New Phytol 180:511–523. doi:10.1111/j.1469-8137.2008.02578.x 43. Garretón V, Carpinelli J, Jordana X, Holuigue L (2002) The as-1 promoter element is an oxidative stress-responsive element and salicylic acid activates it via oxidative species. Plant Physiol 130:1516–1526. doi:10.1104/pp. 009886 44. Kesarwani M, Yoo J, Dong X (2007) Genetic interactions of TGA transcription factors in the regulation of pathogenesis-related genes and disease resistance in Arabidopsis. Plant Physiol 144:336–346. doi:10.1104/pp. 106.095299 45. Desveaux D, Subramaniam R, Després C, Mess JN, Lévesque C, Fobert PR, Dangl JL, Brisson N (2004) A “Whirly” transcription factor is required for salicylic acid-dependent disease resistance in Arabidopsis. Dev Cell 6:229–240. doi:10.1016/S1534-5807(04)00028-0 DOI:dx. doi.org 46. Yang T, Poovaiah BW (2002) A calmodulin-binding/CGCG box DNA-binding protein family involved in multiple signaling pathways in plants. J Biol Chem 277:45049–45058. doi:10.1074/ jbc.M207941200 47. Du L, Ali GS, Simons KA, Hou J, Yang T, Reddy AS, Poovaiah BW (2009) Ca(2+)/calmodulin regulates salicylic-acid-mediated plant immunity. Nature 457:1154–1158. doi:10.1038/ nature07612 48. van Verk MC, Pappaioannou D, Neeleman L, Bol JF, Linthorst HJ (2008) A Novel WRKY transcription factor is required for induction of PR-1a gene expression by salicylic acid and bacterial elicitors. Plant Physiol 146:1983–1995. doi:10.1104/pp. 107.112789 49. Boutrot F, Segonzac C, Chang KN, Qiao H, Ecker JR, Zipfel C, Rathjen JP (2010) Direct transcriptional control of the Arabidopsis immune receptor FLS2 by the ethylene-dependent transcription factors EIN3 and EIL1. Proc Natl Acad Sci USA 107:14502–14507. doi:10.1073/ pnas.1003347107 50. Chen H, Xue L, Chintamanani S, Germain H, Lin H, Cui H, Cai R, Zuo J, Tang X, Li X, Guo H, Zhou JM (2009) ETHYLENE INSENSITIVE3 and ETHYLENE INSENSITIVE3LIKE1 repress SALICYLIC ACID INDUCTION DEFICIENT2 expression to negatively regulate plant innate immunity in Arabidopsis. Plant Cell 21:2527–2540. doi:10.1105/ tpc.108.065193 51. Solano R, Nieto C, Avila J, Cañas L, Diaz I, Paz-Ares J (1995) Dual DNA binding speciﬁcity of a petal epidermis-speciﬁc MYB transcription factor (MYB.Ph3) from Petunia hybrida. EMBO J 14:1773–1784 52. Yang Y, Klessig DF (1996) Isolation and characterization of a tobacco mosaic virus-inducible myb oncogene homolog from tobacco. Proc Natl Acad Sci USA 93:14972–14977 53. Park HC, Kim ML, Kang YH, Jeon JM, Yoo JH, Kim MC, Park CY, Jeong JC, Moon BC, Lee JH, Yoon HW, Lee SH, Chung WS, Lim CO, Lee SY, Hong JC, Cho MJ (2004) Pathogen- and NaCl-induced expression of the SCaM-4 promoter is mediated in part by a GT-1 box that interacts with a GT-1-like transcription factor. Plant Physiol 135:2150–2161. doi:10.1104/pp. 104.041442

378

T. Yuan and S. Wang

54. Zhou DX (1999) Regulatory mechanism of plant gene transcription by GT-elements and GT-factors. Trends Plant Sci 4:210–214. doi:10.1016/S1360-1385(99)01418-1 DOI:dx. doi.org 55. da Costa e Silva O, Klein L, Schmelzer E, Trezzini GF, Hahlbrock K (1993) BPF-1, a pathogeninduced DNA-binding protein involved in the plant defense response. Plant J 4:125–135. doi:10.1046/j.1365-313X.1993.04010125.x 56. Sugimoto K, Takeda S, Hirochika H (2000) MYB-related transcription factor NtMYB2 induced by wounding and elicitors is a regulator of the tobacco retrotransposon Tto1 and defense-related genes. Plant Cell 12:2511–2528. doi:10.1105/tpc.12.12.2511 57. Maeda K, Kimura S, Demura T, Takeda J, Ozeki Y (2005) DcMYB1 acts as a transcriptional activator of the carrot phenylalanine ammonia-lyase gene (DcPAL1) in response to elicitor treatment, UV-B irradiation and the dilution effect. Plant Mol Biol 59:739–752. doi:10.1007/ s11103-005-0910-6 58. Després C, DeLong C, Glaze S, Liu E, Fobert PR (2000) The Arabidopsis NPR1/NIM1 protein enhances the DNA binding activity of a subgroup of the TGA family of bZIP transcription factors. Plant Cell 12:279–290. doi:10.1105/tpc.12.2.249 59. Fode B, Siemsen T, Thurow C, Weigel R, Gatz C (2008) The Arabidopsis GRAS protein SCL14 interacts with class II TGA transcription factors and is essential for the activation of stress-inducible promoters. Plant Cell 20:3122–3135. doi:10.1105/tpc.12.2.279 60. Ndamukong I, Abdallat AA, Thurow C, Fode B, Zander M, Weigel R, Gatz C (2007) SA-inducible Arabidopsis glutaredoxin interacts with TGA factors and suppresses JA-responsive PDF1.2 transcription. Plant J 50:128–139. doi:10.1111/j.1365-313X.2007.03039.x 61. Hao D, Yamasaki K, Sarai A, Ohme-Takagi M (2002) Determinants in the sequence speciﬁc binding of two plant transcription factors, CBF1 and NtERF2, to the DRE and GCC motifs. Biochemistry 41:4202–4208. doi:10.1021/bi015979v 62. Menke FL, Champion A, Kijne JW, Memelink J (1999) A novel jasmonate- and elicitorresponsive element in the periwinkle secondary metabolite biosynthetic gene Str interacts with a jasmonate- and elicitor-inducible AP2-domain transcription factor, ORCA2. EMBO J 18:4455–4463. doi:10.1093/emboj/18.16.4455 63. Wang S, Yang S, Yin Y, Xi J, Li S, Hao D (2009) Molecular dynamics simulations reveal the disparity in speciﬁc recognition of GCC-box by AtERFs transcription factors super family in Arabidopsis. J Mol Recognit 22:474–479. doi:10.1002/jmr.965 64. Ciolkowski I, Wanke D, Birkenbihl RP, Somssich IE (2008) Studies on DNA-binding selectivity of WRKY transcription factors lend structural clues into WRKY-domain function. Plant Mol Biol 68:81–92. doi:10.1007/s11103-008-9353-1

Chapter 17

Pathogenesis Related Proteins in Plant Defense Response J. Sudisha, R.G. Sharathchandra, K.N. Amruthesh, Arun Kumar, and H. Shekar Shetty

Abstract Proteins encoded by the host plant induced under pathological or related conditions are termed pathogenesis-related proteins. These proteins display highdegree of pathogen speciﬁcity and are coordinated at the level of transcription. Induction of PR’s when measured on a time scale is a late event and its effect on the early infection is limited. Application of chemicals or microbially derived metabolites that mimic the effect of pathogen infection induces both PR’s and acquired resistance. Numerous Pathogenesis Related proteins have been detected in rice, wheat, maize, sorghum, barley, tomato, pearl millet, bean, chickpea, soybean, pepper, sunﬂower, carrot, pepper, grape vine, alfalfa, celery, rubber and many other plants. The localization and distribution of the PR is related directly to the method and nature of the pathogen infection. The PR’s have been classiﬁed into various families based on the shared sequence homology. PR’s can also be grouped into different classes based on the migration in the native PAGE, reaction with speciﬁc antisera and mRNA probes. PR’s have also been classiﬁed based on the biological

J. Sudisha (* s(33HETTY Downy Mildew Research Laboratory, Department of Studies in Biotechnology, University of Mysore, Mysore 570 006, Karnataka, India e-mail: [email protected]; [email protected] R.G. Sharathchandra Department of Microbiology, Tumkur University, Tumkur 572103, Karnataka, India e-mail: [email protected] K.N. Amruthesh Applied Plant Pathology Laboratory, Department of Studies in Botany, University of Mysore, Mysore 570 006, Karnataka, India e-mail: [email protected] A. Kumar Division of Plant Sciences and Biotechnology, Central Arid Zone Research Institute, Jodhpur 342003, Rajasthan, India e-mail: [email protected]

J.M. Mérillon and K.G. Ramawat (eds.), Plant Defence: Biological Control, Progress in Biological Control 12, DOI 10.1007/978-94-007-1933-0_17, © Springer Science+Business Media B.V. 2012

379

380

J. Sudisha et al.

activity of the induced defense proteins. Seventeen different groups of PR’s have been identiﬁed. Several studies have revealed that PR proteins are induced in response more rapidly in resistant interactions. Bacteria, fungi, viruses and nematodes induce PR proteins upon entry into the incompatible host. Several PR genes in the form of cDNAs have been identiﬁed and characterized during acquisition of systemic resistance in plants against pathogens. A number of molecules derived from pathogens can serve as elicitors of PR gene expression. In addition to the already existing complexity, some signals are interdependent. Several PR genes encoding PR proteins have been identiﬁed in different plants. They are almost silent in healthy plants. Generally most PR protein genes belong to multi gene families. Pathogen induced PR gene expression often occurs at the level of transcription. The occurrence of multi gene families, localization in the apoplast as well as in the vacuolar compartment and differential induction by endogenous signaling compounds indicate an important role in defense not only against pathogen infection but also in eliciting acquired resistance. Several PR proteins like the PR-1, 2, 3, 4 and 5 have been shown to inhibit growth of fungi. Large groups of PR genes which have been well characterized can be put to use to produce plants with better responses to biotic and abiotic stress. Understanding stress signals and transduction mechanisms and identiﬁcation of additional defense genes will provide opportunities for enhanced resistance engineering in crop plants.

17.1

Introduction

Pathogenesis related proteins (PR’s) are deﬁned as proteins encoded by the host plant induced under pathological or related conditions. Pathological conditions refer to all types of pathogen stresses and not just to resistant hypersensitive responses in which the PR’s are more common. Apart from other pathogens they also include parasitic attack by nematodes, insects and herbivores. In addition, necrosis caused by abiotic stress and toxin related chlorosis also induce PR Proteins [1]. PR’s are a set of novel proteins associated with host defense mainly in incompatible interaction which impede the pathogen progress. These proteins display high-degree of pathogen speciﬁcity and are coordinated at the level of transcription [2]. In the total soluble protein they accumulate to a very high concentrations and in some cases accumulate up to 10% of the total protein content. PR’s are well known for their role in acquired resistance that are induced in association with necrotic lesions in plants. Systemic acquired resistance is related with the induction of PR’s in tissues far-away from the original infection site. Induction of PR’s when measured on a time scale is a LATEEVENTANDITSEFFECTONTHEEARLYINFECTIONISLIMITED(OWEVER 02ACTIVITYISMORE a long-term resistance based on acquired memory [3]. Therefore, PR’s reduce the symptom severity upon further infection in relatively quicker time. Application of chemicals that mimic the effect of pathogen infection induces both PR’s and acquired resistance [4]. Some strains of saprophytic and endophytic bacteria and fungi also induce PR activity and eventually increase disease resistance. Microbially derived

17

Pathogenesis Related Proteins in Plant Defense Response

381

biomolecules which elicit other endogenous defense responses also induce PR related functions in the host. Isolated elicitors like glycoproteins; proteins, peptides, carbohydrates, cellulases, xylanase and fatty acids are known to induce PR’s. Several other abiotic components like, heavy metals and toxic chemicals also induce infection independent pathogen activity. Exogenous application of growth regulators, components of signal transduction and environmental factors are capable of PR induction [5–7]. This chapter summarizes the state-of-the art on the classiﬁcation, structure, functional properties of PR’s, role of PR’s in disease resistance and systemic acquired resistance, regulation and signal transduction involved in PR gene expression and the possible mode of action of PR’s in disease resistance mechanism to phytopathogens.

17.2 17.2.1

Classes of Pathogenesis Related Proteins Occurrence and Distribution of Pathogenesis Related Proteins

Numerous PR’s have been detected in rice, wheat, maize, sorghum, barley, tomato, pearl millet, bean, chickpea, soybean, pepper, sunﬂower, carrot, pepper, grape vine, alfalfa, celery, rubber and many other plants. Pathogenesis related proteins can be detected in almost whole of the plants and large number of Pathogenesis Related proteins belonging to different classes having different functions can be present in a single plant species. Examples of a single plant species with multiple PR’s are listed below. Thirty-three PR proteins have been described in tobacco, 20 are present in sugar beet and more than 30 have been identiﬁed in Norway spruce [8–12]. In addition to their presence in the infected tissues PR’s have also been detected in healthy plant tissues without any infection and stress. Several such proteins are known to be present in mature tomato plants without any stress application. Just like the glucanases and chitinases PR proteins are evident in unstressed leaves of potato plants. PR proteins developmentally regulated and are found in leaves of healthy tobacco plants during ﬂowering and are constitutively present in bean leaves [13]. These PR proteins APPEARONLYAFTERSTRESSINSOMEOFTHEPLANTS(OWEVER THESAMESETOFSTRESSINDUCED PR’s naturally occur in other plant parts such as ﬂowers, pollens, stigma and seeds. Many of the PR proteins appear constitutively in the cultured plant cells [14]. Pathogenesis Related protein pre-dominantly remain localized in leaves than in any other organs. In potato, leaving aside the leaves, PR 10a is reported to ACCUMULATEINTUBERS PETIOLESANDSTEMREGIONAFTERINFECTION(OWEVER INBARLEY PR’s have shown more localization in leaves than in any other parts. More than 30 PR’s are known to accumulate in the roots of Norway spruce in response to fungal infection [15]. In case of pepper PR’s are known to induce in the stem region. Even in the same plant PR’s appear in lower older leaves without any stress while the set of PR’s could not be detected in young leaves near the top of tobacco plants [16].

382

J. Sudisha et al.

It has been observed that the localization and distribution of the PR is directly RELATEDTOTHEMETHODANDNATUREOFTHEPATHOGENINFECTION(OWEVER THEMAJORITY of the acidic PR’s are located in the intracellular spaces of the leaf. This method of localization ensures absolute contact with the advancing pathogen and ensures that their further penetration is prevented. Various basic PR’s have been shown to reduce the infection by the pathogen. Both basic tobacco PR- 1 and PR-5 have antifungal activity against select Oomycetes and the basic PR’s have been shown to localize in the extracellular spaces [1]. Transgenic over expression of basic isoforms of major PR’s in the extracellular spaces have been shown to be directly antimicrobial. Several PR’s with direct antimicrobial activity have been detected from the intracellular and extracellular spaces from wheat, barley, oats, sorghum and maize [17]. It is the allergenic potential of PR proteins, which in addition to all other physiological or evolutionary exchange, formulate PRs in artiﬁcial elicitation of SAR towards crop protection [18].

17.3

Classiﬁcation of Pathogenesis Related Proteins

The PR’s have been classiﬁed into various families based on the shared sequence homology. In addition, the isoelectric points of the PR’s are considered as an important parameter for sub group of classiﬁcation. PR’s can also be grouped into different classes based on the migration in the native PAGE, reaction with speciﬁc antisera and mRNA probes. PR’s have also been classiﬁed based on the biological activity of the induced defense proteins. Seventeen different groups of PR’s have been identiﬁed so far based on the above-mentioned properties [19].

17.3.1

Structural Classes and Biological Properties of Pathogenesis Related Proteins

17.3.1.1

PR-1 Group of Pathogenesis Related Proteins

PR-1 is the most abundant of the PR’s and accumulates to about 1–2% of the total leaf protein content. The expression of PR-1 genes serves as molecular marker to indicate plant defense response. PR-1 proteins have mostly been studied in tobacco [20]. Acidic PR-1 Proteins Acidic PR-1 proteins have been detected in tobacco, tomato, barley, maize, parsley, arabidopsis and many other plants belonging to Graminae, Solanaceae, Chenopodiaceae and Amaranthiceae. They are soluble in acidic buffers and have low molecular weights (14–16 KDa) [20]. Besides arabidopsis, the work carried out

17

Pathogenesis Related Proteins in Plant Defense Response

383

in pathosystems of soybean (Phytophthora sojae), cotton (Fusarium oxysporum), alfalfa (Colletotrichum trifolii) and cassava (Xanthomonas axonopodis) has extended our knowledge on the gene expression changes in response to pathogens [21]. Six acidic isoforms of PR-1 have been described in Nicotiana tabacum cv. samsun which are serologically related and are well characterized at the level of both protein and DNA. PR-1 is higly resistant to proteolysis and is well adapted to extracellular environment. PR’s similar to tobacco PR-1 proteins have been detected in tomato and named as P14. Three different P14 isoforms have been identiﬁed in barley and are responsive to different polyclonal antibodies. Acidic PR-1 genes do not contain any known targeting peptide sequences for vacuolar targeting [22]. PR-1 group of proteins have 138 amino acids in their mature form and is synthesized as a higher molecular weight precursor containing an N-terminal amino acid signal peptide, which is cleaved to produce a 15 KDa mature protein. Acidic PR-1 proteins have been detected in extracellular spaces of the xylem elements of TMV infected tobacco leaves using immunogold labeling. PR-1a and 1b accumulate in the central vacuoles of the specialized cells known as crystal idioblasts [23].

Basic PR-1 Proteins The basic PR-1 proteins have been designated as PRB-1b. The basic PR-1 proteins also contain a hydrophobic N-terminal region of 30 amino acids, which function as a signal peptide for the translocation to the endoplasmic reticulum. There is an extra domain present in the basic PR-1; the C-terminal peptides contain the vacuolar targeting signals [24]. Basic PR-1 proteins are localized in the extracellular space in response to TMV infection in tobacco leaves. Two basic isoforms each of 17 KDa have been identiﬁed in barley. The basic isoforms of PR-1 have an isoelectric point of 10.5 and 11.0. With the exception of one amino acid sequence the basic PR-1 and acidic PR-1 are similar. Basic PR-1 protein isoforms have been identiﬁed in maize, arabidopsis, celery and other cereals [25].

17.3.1.2

PR-2 Group of Pathogenesis Related Proteins

PR-2 group demonstrates E-1,3 glucanase activity. They catalyze the endotype hydrolytic cleavage of 1,3 E-D-glucosidic linkages in E-1,3 glucans. These proteins are abundant in plant tissues and are associated with formation of callose, leaf and stem hairs. Endo E-1,3 glucanases are widely distributed in plant species. Constitutive presence and pathogen induction of several E-1,3 glucanases have been reported [26]. They localize in the epidermis of the lower leaves and roots of healthy plants. E-1,3 glucanase has also been reported in cell suspension cultures of barley and tomato. Majority of the E-1,3 glucanases respond to developmental and pathogen signals. E-1,3 glucanases are present as multiple structural isoforms that differ in size, pI, primary structure, and pattern of regulation. E-1,3 glucanase isoforms have been identiﬁed in tomato, wheat, barley, pearl millet, rice, chickpea, soybean and maize. There are four classes of PR-2 proteins based on the amino acid sequence identity [12].

384

J. Sudisha et al.

E-1,3 glucanase Class I II III IV

Subgroup PR-2e PR-2a,b,c PR-Q Tag 1

Source Nicotiana plumbifola Nicotiana tonentisofrmis Nicotiana tonentisofrmis Nicotiana tonentisofrmis

Molecular weight (KDa) 33 35 35 35

PI Basic Acidic Acidic Acidic

Localization Vacuolar Secreted Secreted Secreted

The N-terminal hydrophobic signal peptide of the class I glucanase is co-translationally removed and a C-terminal extension is N-glycosylated at a single site. The C-terminal extensions contain a signal for targeting vacuoles [27]. The class I, II, III and IV do not have the C-terminal extensions but contain a signal for targeting vacuoles. Tomato produces at least three E-1,3 glucanase isoforms with acidic pI. Basic E-1,3 glucanase isoforms with vacuolar targeting have been found in tobacco with C-terminal region having a dipeptide sequence, which is the cleavage site for removal of C-terminal extensions from precursors of the bigger vacuolar proteins. Acidic and basic isoforms of the E-1,3 glucanases were found to be antigenically related [28]. The substrate speciﬁcities of various E-1,3 glucanase is different between classes. Class I and II are 50–250 times better in degrading E-1,3 glucan substrate than class III and IV [29].

17.3.1.3

Plant Chitinases

PR-3, 4, 8 and 11 Groups of Pathogenesis Related Proteins Chitinases are enzymes of bacteria, fungi, animals and plants, which hydrolyze E,1–4 linkages between N-acetylglucosamine residues of chitin. Chitinases are endo E,1–4 glucosaminidases. Plant chitinases are classiﬁed into four classes of PR proteins based on the sequence homology and the presence or absence of chitin binding domain (CBD). PR-3 group of proteins consist of chitinases belonging to class I to class VII except class III [30].

PR-3 Group of Pathogenesis Related Proteins PR-3 group of plant chitinases posess a common CBD, which is mostly D helical and the catalytic domain contains two glutamates [31].

Class I They are basic chitinases from tobacco. They have a C-terminal pro peptide which help in vacuole targeting. The N-terminal chitin-binding domain is proline and glycine rich. 32 KDa class I chitinases have been identiﬁed in pepper [5].

17

Pathogenesis Related Proteins in Plant Defense Response

385

Class II They are acidic chitinases and lack a CBD . They also have internal deletions which remove one of the four loops required for N-glycosylation. It is more closely related to class I. [32]. Class IV They were originally isolated from bean and are not serologically related to class II and I. They also show very less sequence homology to class II and I. There are three deletions in the CBD, which result in the hydrolysis of glycosidic bond closer to the pathogen surface. They are acidic chitinases and do not posess a binding region [32]. Class V This class has only one representative, which is identiﬁed from Utrica doica. It is a lectin with precursors having chitinase homology with the CBD. Both the catalytic residues in the CBD are deleted and therefore do not have any catalytic activity [33]. Class VI The only representative identiﬁed for this class is from sugarbeet. This chitinase lacks four of the eight cysteines in the CBD. It has the longest spacer region with 135 amino acids and 90 of them being prolines [34]. Class VII The only known representative of this class is present in rice and is highly homologous to class four chitinases. This group of chitinases lacks a CBD but has high homology with cDNA of the class four groups of chitinases [34]. 17.3.1.4

PR-4 Group of Pathogenesis Related Proteins

Only two groups of PR-4 proteins are known. Class I contains the small antifungal (EVEIN AND THE 7IN PROTEINS FROM RUBBER 4HE (EVEIN PROTEINS HAVE STRUCTURAL similarity with the wheat germ agglutinins and the lectins. The Win proteins were identiﬁed in Potato and contain a CBD similar to class I chitinases. They are 14–16 KDa and its typical representative CBD 20 has been identiﬁed from tobacco. Class II PR-4 is known to be defense related proteins which are found in tobacco and tomato. They are homologous to Win proteins but lack a CBD. The 3D structure reveals a compact domain without obvious catalytic cleft [35].

386

17.3.1.5

J. Sudisha et al.

PR-5 Group of Pathogenesis Related Proteins

These proteins share homology with thaumatin and therefore called thaumamatin like proteins, which is a sweet taste protein from the bacterium Thaumatococcus danielli. Two other proteins the osmotins and the WP 24 from tobacco have also been included in the PR-5 group of PR’s. They are detected mainly in the leaves of young healthy plants of tomato, potato, tobacco, brassica, rice, parsley, maize and bean. The thaumatin like protein (TLPs) are well localized in roots, epidermis peel, corolla, ﬂower buds and tissues of over-ripe fruits of cherries. Seeds of several cereals are known to contain TLP’s [36]. They are highly soluble proteins and accumulate to high levels in selective tissues or sub cellular or extra cellular compartments. Their molecular weights range from 22 to 26 KDa with 201–229 amino acids. It is 16 KDa with 148–151 amino acids. TLP’s have acidic, basic and neutral pI values based on the location. Extra cellular TLP’s are acidic and vacuolar TLP’s are basic. There is no glycosylation in TLP’s and are resistant to proteases due to presence of 16-cysteines [37]. A crystal structure of the thaumatins from maize seeds has been deciphered. It is a E pleated sheet with two separate domains stabilized by eight disulﬁde bonds [38, 39]. Three classes of TLP’s have been identiﬁed as acidic osmotins, the basic PR’s and the neutral osmotin like proteins. The amino acid sequence of all the three classes of TLP’s share 76% sequence homology and are serologically related. Osmotin and osmotin like proteins have been mainly expressed during induction of stress responses in cultured cells of tobacco and tomato [40, 41].

17.3.1.6

PR-6 Group of Pathogenesis Related Proteins

Proteinase inhibitors are grouped under the PR-6 group of PR’s. They are highly stable defensive proteins that are developmentally regulated and induced only in response to insect and pathogen attack. They are classiﬁed based on the proteinases of the pathogen that they inhibit [42]. The proteinase inhibitors are classiﬁed into 1. Serine proteinase inhibitors 2. Cysteine proteinase inhibitors 3. Aspartate/metallo proteinase inhibitors Serine proteinase inhibitors are further subdivided into ﬁve categories but the most well studied are the potato type I and II. Type I is 8 KDa containing just one reactive site but retains great variability and thus has the capacity to react with different proteinases [43]. Type II is about 12 KDa in mass and has just one reactive site like the type I but unlike the type I it is not variable and has dual speciﬁcity. The other groups of serine proteinase inhibitors are the Bowman birk/Kunitz inhibitors. This was ﬁrst isolated from soybean but later identiﬁed from most of the plants. These are 8 to 16 KDa in mass and have one or two active sites. Kunitz group of inhibitors are 20–22 KDa in mass and have only one reactive site and are differentially regulated. Cysteine proteinase inhibitors are 12–16 KDa in mass

17

Pathogenesis Related Proteins in Plant Defense Response

387

and inhibit papain and cathepsin proteinases [44]. The members of the metallo proteinases have been found only in tomato and potato and cleave exopeptidases produced by insects and other pathogenic fungi and bacteria [1].

17.3.1.7

PR-7 Group of Pathogenesis Related Proteins

This group shows endoproteinase activity. The amino acid sequence reveals homology to subtlisin like proteinase and has a role in the disease resistance response in tomato plants in response to pathogen attack [45=(OWEVER THEMECHAnism of action and its homologues are clearly understudied.

17.3.1.8

PR-8 Group of Pathogenesis Related Proteins

It is grouped under chitinase class III group of pathogenesis related proteins but also has an additional lysozyme function. They differ in both sequence homology and substrate speciﬁcity. They have been characterized in cucumber, arabidopsis, tobacco and chickpea. This group is present in both acidic and basic isoforms. (EVAMINEISTHEBEST CHARACTERIZED02 GROUPOFCHITINASES WHICHlRSTIDENTIlED in tobacco [1, 30].

17.3.1.9

PR-9 Group of Pathogenesis Related Proteins

This group of PR’s exhibits peroxidase like activity. These enzymes are hemecontaining glycoproteins that catalyze the oxidation of hydrogen peroxide into a wide range of organic and inorganic substrates. They occur in several isoforms in both plants and animals. They have also been implicated in a wide range of physiological processes both related and non-related to pathogen defense. Three broad classes of plant peroxidases have been identiﬁed based on its localization and action [11, 46, 47]. 1. Class I – Cytochrome C peroxidase, ascorbate peroxidase 2. Class II – Extra cellular fungal like peroxidases #LASS)))n%XTRACELLULARPLANTPEROXIDASES(RP# Plant peroxidases have two structural domains that have a central heme group. The catalytic sites are not variable and isoleucine and phenylalanine are commonly involved in substrate binding. Over 60 isoforms of peroxidase have been isolated and puriﬁed from different sources under both abiotic and biotic stress conditions. The two catalytic domains containing the proximal and the distal heme binding regions are created from ten helices and three sheet like secondary structure. Amino acids like arginine, asparagine and aspartate are involved in the peroxidase speciﬁc catalysis [12, 48].

388

17.3.1.10

J. Sudisha et al.

PR-10 Group of Pathogenesis Related Proteins

This group of proteins contain intracellular defense proteins with ribonuclease like activity and structure. Such kinds of proteins are found in potato, asparagus, bean, rice and pearl millet. They are acidic in nature and do not have any signal peptide suggesting that they are intracellularly localized [49]. They are induced in response to various pathogens. They share sequence similarity with the mammalian birch allergen like pollen. They are also induced in response to stress stimuli like auxin depletion as in the case of auxin starved soybean cells. This group is also involved in physiologically signiﬁcant processes like the embryogenesis in pea. Signiﬁcant homology exists between various members of the PR-10 group of pathogenesis related proteins [22, 35].

17.3.1.11

PR-11 Group of Pathogenesis Related Proteins

They show afﬁnity to zinc and do not have any homology with any known chitinase group. They induced in response to ultraviolet radiation and virus infection. They were ﬁrst identiﬁed in tobacco and only known molecular homologue is present in pepper. They are of 18 KDa and do not have a characteristic CBD [50, 51].

17.3.1.12

PR-12 Group of Pathogenesis Related Proteins

Defensins contain small 5 KDa basic antimicrobial peptides and are 41–54 amino acids in length. Based on the amino acid sequence differences four defensin groups have been identiﬁed [52]. Defensins contain eight cysteine residues including one at the C-terminus, which can be easily detected. The structure of the defensin consists of triple stranded E sheets and one D helix that are stabilized by disulﬁde bonds. They have been identiﬁed to be constitutively present in the leaves, tubers, ﬂowers, pods and seeds. They are also located in the peripheral cell layers and in the xylem in over 20 different plant species. They have been shown to be produced during pathogenesis in pear, radish, tobacco and arabidopsis. They are also induced upon treatment with methyl jasmonate, silver nitrate and ethylene. These proteins are barely detected in the healthy uninfected tissues but accumulate systemically at high levels after the localized fungal or bacterial infection [53–55].

17.3.1.13

PR-13 Group of Pathogenesis Related Proteins

Thionins are small 5 KDa basic cysteine rich proteins ﬁrst isolated from barley and additionally isolated from roots and leaves of oats, rye, maize, tomato and papaya. Although the thioinins are constitutively expressed and are induced upon infection

17

Pathogenesis Related Proteins in Plant Defense Response

389

with the pathogen [56]. The thionins are classiﬁed based on the number of cysteine residues and the number of disulﬁde bridges they possess. 1. 2. 3. 4.

Class I – 8 cysteine residues – purothionin/hordothionin/barley leaf thionin Class II – lacks cysteine number three and six-viscotoxin Class III – lacks cysteine number two and eight Class IV – lacks cysteine number two

Thionins are synthesized as much larger precursor with a molecular weight of about 15 KDa. The protein has a C-terminal extension, which contains large number of acidic amino acids. Some amino acids are vastly conserved such as tyrosine at the position number 61 and glycine at the position number 65. The six-cysteine residues are absolutely conserved. The crystal structure shows a compact sized structure stabilized by three to four disulﬁde bridges. Thionins are amphipathic and phospholipid-binding sites have been identiﬁed in the thionins. Thionins are distributed in the cell walls, vacuoles and protein bodies [54].

17.3.1.14

PR-14 Group of Pathogenesis Related Proteins

Lipid transfer proteins (LTP) have been classiﬁed as PR-14 group of pathogenesis related proteins. LTP’s are a family of proteins involved in lipid shuttling between organelles. LTP’s are polypeptides consisting of 90–95 amino acids in length that have been identiﬁed in various tissues both in monocots and dicots. They are secreted and are associated with cell wall. They have been reported in maize, barley, spinach and cotton. Amino acid analysis shows that one third of the residues are conserved including the eight cysteines. The protein has a globular structure that consists of a bundle of four D helices linked by ﬂexible loops with hydrophobic cavity that may accommodate a wide variety of lipids which helps in lipid loading and transfer [54].

17.3.1.15

PR-15 and 16 Group of Pathogenesis Related Proteins

Oxalate-oxidase and oxalate-oxidase like proteins (OLP’s) are described under the PR-15 and 16 groups of pathogenesis related proteins. Oxalate oxidase and the OLP’s share sequence similarity with wheat germins. Oxalate–oxidase and the OLP’s have been isolated from germinating barley, corn, oat, rice, rye and other cereals and dicot plants. They are protease resistant and SDS insensitive. The nature of the secondary structure of the protein was found to be heteropentameric and they are mainly secreted into the extra cellular spaces. They are glycoprotein in nature and are responsible for generation of reactive oxygen species immediately after pathogen infection [57].

390

J. Sudisha et al.

17.3.1.16

PR-17 Group of Pathogenesis Related Proteins

It has only one representative in barley and characterized mainly by its cDNA. The central C-terminal part of the deduced amino acid sequence has ﬁve domains that are highly conserved. They share sequence similarities with aminopeptidase’s form the eukaryotes and thermolysins from bacteria suggesting a proteolytic like activity. The PR-17 family has afﬁnity towards zinc and therefore is similar to Zinc metalloproteinases. The C-terminal A to E domains are highly conserved and are similar to thermolysins. Domain A has protein kinase C phosphorylation site and the domain B has conserved similarities with aminopeptidase’s [58].

17.4

17.4.1

Association of Pathogenesis Related Proteins with Disease Resistance Pathogen Inducible PR’s

Several studies have revealed that PR proteins are more rapidly induced in response to resistant interactions. Bacteria, fungi, viruses and nematodes induce PR proteins upon entry into the incompatible host. Rice leaves inoculated with Pseudomonas syringae enhance the production of PR-1, 2,3,5 and 9. Glucanases and chitinases are synthesized in tobacco leaves stressed with different isolates of Ralstonia solanacerum. Inoculation of Xanthomonas vesicatoria elicits the synthesis of PR proteins of molecular weights 15, 18, 23, 26 and 29 KDa in tomato [22]. PR-6 proteins showed increasing accumulating trends in tomato and pepper when inoculated with Xanthomonas vesicatoria. PR-1 levels are high in Arabidopsis inoculated with Xanthomonas campestris. PR-10 mRNA levels were found to increase in Arabidopsis when inoculated with Pseudomonas syringae pv syringae. PR proteins including peroxidases, glucanases and chitinases are found to increase in rice upon inoculation with Erwinia caratovora. Induction of PR proteins when infected with bacterial plant pathogens was found in brassica, bean, pepper, barley, maize and parsley. Thionin, defensins and LTP’s were found to be induced in a Arabidopsis and wheat in response to Pseudomonas, Xanthomonas, Agrobacterium and Cornyebacterium [1].

17.4.2

PR Proteins in Systemic Acquired Resistance

When a plant is inoculated with an incompatible or sometimes even compatible pathogen or treated with biotic and abiotic inducers, systemic induction of resistance against pathogen is seen and the phenomenon is called systemic acquired resistance (SAR). One of the major physiological traits of SAR is the very rapid and systemic accumulation of PR proteins. The type of PR expression is dependent on

17

Pathogenesis Related Proteins in Plant Defense Response

391

the mode of pathogen infection. SAR is known to be operational against bacteria, fungi and viruses. Identiﬁcation and characterization of PR genes in the form of cDNA that are expressed during the maintenance of SAR has been carried out using various techniques like differential cloning and probing with degenerate oligonucleotide probes. The cDNA thus obtained can be grouped into various PR gene families and are called SAR genes [59]. Exogenous application at even micromolar concentrations of various abiotic inducers like salicylic acid, jasmonic acid, INA, "!"! "4( CHITOSAN METHYLJASMONATE METHYLSALICYLATE OLIGOGALACTURONIDESAND pathogen derived molecules have been known to induce various PR genes and PR gene products like PR-1, 2, 5, 8, 11 in wheat, arabidopsis, barley, rice, oats, tomato, pepper, tobacco, brassica, pearl millet, sugar beet and other plants. The induced resistant state in these plants was found to be effective against a multitude of bacterial, fungal, virus and oomycete infection [60]. Several PR proteins were shown to accumulate in the vacuoles of the cells of the treated plants. Osmotins and the thaumatins localized in the apoplast of tobacco and potato. Similarly, leaves when applied with salicylic acid and methyl salicylate led to PR accumulation in the mesophyll [61]. The induced state corroborated with resistance against an array of fungal pathogens like Fusarium, Botrytis, Colletotrichum and Phytophthora; both acidic and basic forms of PR proteins are able to act against bacterial plant pathogens in SAR [62]. Application of pathogen derived molecules like harpin and abiotic inducers have led to SAR in tobacco, wheat, potato, tomato, barley, rice and arabidopsis where PR groups like the acidic PR-1, chitinase, glucanase and thaumatin have been localized in vacuoles, apoplast, extra cellular pocket vesicles, stomata, mesophyll cells against Pseudomonas, Xanthomonas and Erwinia [63]. Basic 02PROTEINSLIKETHE02 A (602 AANDBAREACTIVEIN3!2INBARLEYANDBEAN The genes that are responsible for the maintenance of an induced resistant state would either be expressed at low levels or not expressed at all in healthy, un-induced tissue and their expression would simultaneously increase with the onset of SAR. Salicylic acid has been shown to induce PR gene expression. Experiments with arabidopsis mutants show constitutively elevated expression of PR genes. Upon exogenous application salicylic acid induced PR-1a and 1b expression in tobacco. Methyl salicylate application also induces higher degree of PR gene expression in plants like tobacco, barley and arabidopsis where PR-1, 4, 8 and 11 were induced. Jasmonate and its methyl esters induce several PR proteins in various plants. Proteinase inhibitors II and I were induced in tobacco leaves along with PR-1a and b. Defensin gene PDF1.2 and transcripts of PR-3, 5 and 9 in rice and barley were induced in response to treatment with jasmonic acid. Precursors of jasmonic acid like the linolenic acid has been reported to induce PR-6 and 7 in both monocot and dicot plants [64]. Oligogalacturonides and growth hormones like auxins and the cytokinins also induce PR gene expression. Oligogalacturonides like chitosan induce PR-6, 2, 11, 13 in plants like barley, pearl millet and rice [65]. Exogenous application of gaseous signaling compounds like systemin and ethylene also induce resistance with increased levels of PR proteins. Ethylene induced the production of two basic isoforms of glucanase and chitinase and PR-5, 7 and Thi 2.1 in arabidopsis, tobacco, potato and barley. Acidic PR-1, 2 and 7 have been induced in arabidopsis upon ethylene treatment [66].

392

17.4.3

J. Sudisha et al.

Signaling in Activation of PR Gene Expression

A number of molecules derived from pathogens can serve as elicitors of PR gene expression. Chitin fragments, glucans, glycoproteins, proteins, glycans, oligosaccharides, harpins and Avr proteins from bacteria and fungi. Upon infection by the pathogen or the pathogen derived molecules the plants increase the production of reactive oxygen species (ROS), salicylic acid (SA,) ethylene and jasmonates. Many of these secondary signals are well known inducers of PR gene expression. In various host pathosystems different signaling systems are induced, for an example 3! INDUCES 02 AND IN TOBACCO (OWEVER TRANSGENIC .AH' DElCIENT IN 3! production also induce acidic PR-1a and PR-1b inferring absence of SA [66]. Methyl jasmonate induces proteinase inhibitors but not PR1-5 in tobacco and also induced PDF1.2, the well known defensin gene. Jasmonate and ethylene pathways act in parallel to induce PR-10, 11, 12,13 in arabidopsis and tobacco. PR-10, 9, 8 and 5, all seem to be induced in a SA dependent manner. Synergism in the signaling molecules has been widely reported. Signal molecules ethylene and jasmonates are known to substantially increase the levels of osmotins. Antagonism between signals has also been reported. Exogenous application of SA inhibited PR-6 in tomato leaves induced by systemic and jasmonic acid. SA is an inhibitor of the octadecanoid pathway mediated induction of PR gene expression. In addition to the already existing complexity, some signals are interdependent. Ethylene may function downstream of jasmonic acid in activating PR-2 and 3 in tobacco upon pathogen infection. Down regulation of PR gene expression is also known. Glucanase is down regulated by ETHYLENE AUXINSANDCYTOKININS3OMEINDUCERSLIKE"4(INDUCE02GENETRANSCRIPT in both ethylene and jasmonate independent manner [67, 68].

17.4.4

Structure and Organization of PR Genes

Several PR genes encoding PR proteins have been identiﬁed in different plants. They are almost silent in healthy plants. Generally most PR protein genes belong to multi gene families and each of the gene family is differentially regulated. Sixteen genes of the PR-1 are present in tobacco, similarly, 13–14 genes for PR-2 and 2–4 genes code for acidic and basic chitinases. Five genes for PR-5, 15 for PR-10 and a small multigene family of three genes have been cloned from barley, oats, wheat, arabidopsis, brassica and tobacco [22]. PR-1a promoter fragment has 902 nucleotides and the ﬁrst 300 base pairs are sufﬁcient for induction of PR gene expression. PR-1a gene has four regulatory elements and contains two functional domains. DNA sequence analysis of the PR-1a promoter reveals a TATA box at the position 34 and a heat shock regulatory element at the position 37. There are three protein-binding domains found in the regulatory element and one highly conserved G box motif is also present in the promoter [69]. The promoters of the PR-2 contain elements, which encode SA and ethylene responsiveness. The ethylene responsive element is

17

Pathogenesis Related Proteins in Plant Defense Response

393

an AGC box and a short promoter region of about 138 base pairs is sufﬁcient to confer full activity in transgenic GUS constructs of tobacco. The PR-2a gene has a major cis-acting element at the region of −364 to −288, which confers a CaMV 35S promoter high level of SA responsiveness [26]. Plant chitinases like PR-8 and 11 have two introns ﬂanking the coding region of the two conserved E strands and the catalytic residues. The PR-3 genes also have two introns and the promoters of chitinases have an ethylene responsive element, which was found to be 22 base pair in length. Two PR-4 genes have been identiﬁed each of 2.2 Kb in length [70]. Two genes of PR-5 have been isolated from tobacco, which do not have any intron. Promoter region −1364 to −718 has been shown to be important for PR-5 gene expression and was found to be ethylene and ABA responsiveness. The thaumatin basic gene promoter has two copies of the sequence element AGCCGC and is responsive to elicitors of microbial and plant origin. PR-6 or proteinase inhibitor genes are regulated at various stages of plant development. The peroxidase gene families are multimeric and are clustered in the genome of most of the plants. 4HEMULTIMERICGENESAREMAPPEDTOCHROMOSOMESEVENINRICE(IGHAMOUNTOF sequence similarity has been found in the peroxidase promoters. They have a putative G box element close to the TATA box. The differences in the distances between the G box and other cis-regulating regions are responsible for differences in gene regulation. Over 60 peroxidase genes have been identiﬁed and characterized in different plant species. The PR-10 group also is a multigene family having cis regulatory elements responsive to various signals like ABA, SA and JA [71]. The PR-10 gene families show non-speciﬁc induction pattern to pathogen and pathogen-derived molecules. The genes coding for thionins have two introns 42 and 91 base pair long that interrupt the sequence coding for the C-terminus acidic precursor of the peptide. In barley the gene encoding thionins are mapped to satellite chromosome six. There is high percentage of the variability in the signal sequence of the acidic thionin domain. The Thi 2.1 gene of the arabidopsis contains cis regulatory elements responsive to jasmonates but not responsive to SA, ethylene and wounding [72, 73]. PR-12 and 14 genes are developmentally regulated. Atleast six LTP genes have been identiﬁed in barley. The defensin genes PDF 1.2 and 2.2 have been cloned in arabidopsis, which have cis regulatory regions responsive to the components of the octadecanoid signaling pathway. The PR-17 gene contains an 829 base pair long ORF. The 3c UTR is very poorly conserved and the poly A signals are very independently located. PR-17 multigene families have been found in wheat and tobacco. The promoter regions are ABA and zinc responsive. Five regions in the promoters are highly conserved in all the PR-17 gene families [58].

17.4.5

Transcriptional Activation of PR Genes

Pathogen induced PR gene expression often occurs at the level of transcription. Analysis by deletion mutants, gain of function, synthetic promoters, DNA ﬁnger printing and in vivo foot printing and mobility shift assay reveals several cis regulatory

394

J. Sudisha et al.

elements controlling pathogen stress have been identiﬁed. The W box, GCC box, G box, SA responsive element, the eleven base pair elicitor responsive element are few of the cis elements that have been identiﬁed. More than 20 PR genes are known to contain the GCC box. It has been found that GCC box is necessary for ethyleneinduced transcription of PR gene expression in tobacco [74]. The same GCC box has also been found in the genes of PR-1b and osmotin genes in tobacco. GCC box regulates cross talk between various signal transduction pathways. Ethylene responsive elicitor binding proteins 1–3 (EREBP 1–3) transcription factors have been found to bind to GCC box in tobacco, parsley and brassicae. These transcription FACTORSWEREINDUCEDBYETHEPHON "!"!AND"4()NARABIDOPSISEVIDENCEHAS been found that ERF 1 a homologue of EREBP acts directly downstream of EIN 3 a nuclear component of the ethylene-signaling pathway and activates PR gene expression. The EREBP and its homologues have been found to be induced in response to bacteria like Pseudomonas, Xanthomonas and Erwinia [75]. A direct connection of the EREBP proteins with disease resistance has been generated in the yeast-two-hybrid system using the tomato Pto gene. The Pto gene products were found to bind to GCC box in arabidopsis upon elicitation with abiotic inducers of disease resistance [76]. Promoter deletion analysis has demonstrated that W box is required for induced expression of parsley PR-1 and PR-2 genes in arabidopsis. A tetramer of the W box was found to be responsive to the inducer treatment in a transient assay system fused to a 35S minimal promoter. This system was also operational when treated with crude elicitor prepared from fragmented mycelium of Fusarium monliformae. South-western screening showed that parsley cDNA encoding W box proteins had the consensus sequence WRKYQQK and is called WRKY proteins. The C-terminal of these proteins contains a zinc ﬁngure structure that may function in DNA binding or protein-protein interaction in resistance to Phytophthora [77]. The PR-1a promoter contains a number of putative GT-1 binding sites distributed over the entire 900 base pair upstream binding regions. GT-1 is a nuclear factor, which binds with DNA sequences in the inducible PR gene promoters. Other groups of the transcription factors like the myb-1 and as-1 are known to be enhanced upon elicitation with SA, methyl jasmonate and auxins. These transcription factors are known to bind PR-1 promoter sequence [78]. GUS reporter-gene experiments with tobacco E glucanase promoters have shown that E glucanases are transcriptionally up regulated upon induction with SA. Gn1 promoter from Nicotiana plumbaginifolia is strongly induced when infected with Pseudomonas syringae, Erwinia caratovora, Pseudomonas ﬂuorescens and the leaf mold pathogen Cladosporium fulvum. The tobacco chia 1 coding for an acidic chitinases has an ethylene responsive element with 22 base pairs, an element to which nuclear factors were shown to bind [79]. Studies with transgenic plants expressing an osmotin and thaumatin promoter GUS gene fusion indicated that the promoter region is responsive to ethylene and SA. The promoter region of the gene contains a sequence element AGCCGCC that is present in several basic PR protein genes [80]. The peroxidase promoter has a putative G box element. Several trans acting factors were found to bind G box elements of POX 8.1, 2.3 and PBT 6.3 genes during incompatible interaction with Erysiphe graminis, Verticillium alboatrum and Xanthomonas

17

Pathogenesis Related Proteins in Plant Defense Response

395

oryzae in barley, potato and rice [81]. Thi 2.1 gene of the thionins from arabidopsis is induced in response to methyl jasmonate, jasmonic acid and regulated via the octadecanoid pathway. Some constitutively expressed defense genes have been reported to be down regulated upon fungal infection. Pth-Sh from tomato, SP 11 from Norway spruce and PDF 2.2 are the defensin genes, which are down regulated in response to Pseudomonas syringae, Pythium dimorphum and Alternaria brassicola [82]. Genetic studies have identiﬁed important genes such as the NPR 1 and the CPR in the signaling leading to PR gene expression. NPR 1 appears to be a positive regulator of PR gene expression. NPR 1 is targeted to the nucleus at the onset of SAR suggesting a role for NPR 1 the nucleus to activate PR gene expression. Genetic studies have revealed that CPR may be responsible for cross talk between SA and JA mediated signaling pathways [83].

17.5 17.5.1

Pathogenesis Related Functions of PR Proteins Possible Functions of PR Proteins

The occurrence of multi gene families, localization in the apoplast as well as in the vacuolar compartment and differential induction by endogenous signaling compounds indicate an important role in defense not only against pathogen infection but also in eliciting acquired resistance. PR-1 shows sequence similarity with mammalian androgen dependent glycoprotein and proteins secreted by fungi during the formation of fruiting bodies. The functions of these proteins are unknown but the similarities with such diverse organisms have to be duly acknowledged and investigated. The PR’s are considered as stress proteins directed to increase the harmful effects of cellular degradation products of the invading pathogen and prevent further ingress. Acidic and basic PR’s seem to be induced in response to abiotic stress components. Such induction in the absence of pathogenic stimuli indicates that they involve in protection of cellular structures either physically by stabilizing the membranes or to keep microbes, which are harmful in check [1]. The promoters of the few of proteins like the PR-1 have a heat shock regulatory element leading to speculation that PR gene products may have a chaperonin like stabilizing activity. Extracellular acidic PR’s like the glucanases and the chitinases might be involved in the recognition process-releasing defense activating signaling molecules from the invading pathogen. Such elicitors could stimulate host defense response and induce acquired resistance to further infection. Occurrence of endogenous substrates of PR’s in plants might allow the proteins to function similarly through release of endogenous signaling compounds. Speciﬁc oligosaccharides have been implicated as signals in response to biotic and abiotic stress [84]. A role of PR’s as a speciﬁc internal signal generating enzymes can be explained by their occurrence in speciﬁc organs and with their induction in relation to pathogen stress. Chitinases have been implicated in developmental regulation in yeast. The catalytic domain of the yeast chitinases was found to have high homology with PR-8 and type III chitinases and

396

J. Sudisha et al.

thus it was suggested that chitinases have a dual role in increasing cell separation and suppress the growth of the pathogens. The occurrence of almost of all types of PR’s in various ﬂoral tissues suggests speciﬁc physiological regulatory function in ﬂower development rather than a role in pathogen defense response. Other PR’s may be involved in protection of cellular structures and might contribute to the reduction of multiplication or the spread of the invading pathogen [85].

17.5.2

Antimicrobial Properties of PR Proteins

Several PR proteins like the PR-1, 2, 3, 4 and 5 have been shown to inhibit growth of fungi. Anti viral activity of some PR’s has also been reported. Tobacco gp 35 with glucanase like properties and gp 22 with PR-5 like activity have been shown to inhibit the viral infection. PR-1 was shown to be directly inhibited oomycetes like Phytophthora parasitica and Peronospora tabacina and bacteria like Cercospora nicotianae and Pseudomonas syringae. In-vitro antifungal activity of PR’s like the glucanase has been measured against Fusarium solani, Trichoderma viridae, Phytophthora infestans, Cladosporium fulvum and Alternaria solani and was found to be very effective. Some chitinases have lysozyme like activity and have been shown to be directly inhibitory to many bacterial plant pathogens [86]. Anti fungal activity of PR-5 group of PR’s has been well studied. TLP’S cause lysis of Phytophthora infestans sporangia. They were also found to be very effective in hyphal extension inhibition assay against Cercospora beticola and Trichoderma russei. The inhibitory effect of TLP’s like the osmotins lead to the enhanced resistance to Verticillium, Fusarium, Alternaria, Bipolaris and Phytophthora in arabidopsis, barley, maize, parsley, brassicae and oats [87]. PR-6 may inhibit the proteinases produced by the bacterial plant pathogens. Proteinase inhibitors were found to restrict Pseudomonas syringae spread in tomato and Xanthomonas campestris [44]. LTP’s have been shown to inhibit bacterial plant pathogens in-vitro. LTP’s act as defense barriers. In-vitro antagonism of LTP’s has been tested against Ersyphie, Rhyncosporium and Fusarium [54].

17.5.3

Toxicity of PR Proteins

Toxicity of the PR proteins has been described for the PR-13 group of thionins. A variety of toxic activities has been demonstrated for most of the thionins. Purothionin is toxic to mammals only when injected intraperitoneally. The common effects of toxicity seem to be destruction membranes. The toxicity may be exerted by a direct detergent-like interaction with lipid bi layers of the biological membranes. Several reports have shown leakage of low molecular weight compounds and ions from different cells upon treatment with puriﬁed thionins. Efﬂux of the phosphate

17

Pathogenesis Related Proteins in Plant Defense Response

397

ions can result in the ATP hydrolysis and depletion of ATP results in cell death and this parameter is usually used to measure thionin activity. Cytotoxic action of the thionin may be mediated by the activation of phospho lipase A 2 and subsequent inﬂux of calcium ions. Pyrularia thionins increases the activity of adenyl cyclase, which has an important role in signal transduction pathways by catalyzing the formation of the second messenger camp from ATP. All toxic thionins have a conserved amphipathic structure, which support a detergent like activity. The toxicity of the thionins has been demonstrated against various phyto pathogenic bacteria and fungi. Purothionins from wheat is found to be bacteritoxic against Ralstonia and Erwinia. Viscotoxins were toxic against fungi like Erysiphe, Fusarium and Plasmadiophora [54, 56].

17.5.4

Mechanism of Action

4HEFUNCTIONOF02 PROTEINISASYETUNIDENTIlED(OWEVER INCREASINGEVIDENCE shows the role of PR-1 protein in the resistance to fungal and oomycete infection. PR-1 proteins may be involved in cell wall thickening and may offer resistance to spread of the pathogen in the apoplast [24]. PR’s like the glucanases act atleast in two different ways. Directly by degrading the cell walls of the pathogen and indirectly by promoting the release of cell wall derived materials that can act as endogenous elicitors of host defense response [26]. Chitinases hydrolyze the E glycosidic bonds at the reducing end of the glucosaminidases. Chitinases can use two different methods of catalysis, retaining or inverting the anomeric conﬁguration at the newly formed reducing end and involves substrate assisted catalysis [30]. The PR-5 group of proteins causes leakage of the cytoplasmic material from the fungal hyphae and thus causes rupture but at low concentrations they may cause membrane permeability changes that cause leakage of cell constituents and increases the uptake of antifungal proteins. TLP’s may also act as bifunctional inhibitors of microbial virulence factors like the proteases and the D amylases [43]. Proteinase inhibitors also lead to cytoplasmic leakage due to proteinase inhibitors blocking the synthesis of the chitin in the cell wall. Peroxidases are the key enzymes in the wall building processes. They oxidise hydroxyl cinnamyl alcohols into free radical intermediates, phenol oxidation, polysaccharide cross linking, ligniﬁcation and suberisation. Extracellular peroxidase activities are consistent with a role for the enzyme in the wall strengthening. ROS formed during the deposition of these compounds into the walls by peroxidase activity are toxic to the pathogen. These active oxygen species may act as secondary messengers to activate plant defense responses that contribute to resistance [49]. PR-10 is reported to function in mRNA degradation and nutrient remobilization in infected host tissues [35]. The PR like activity of plant defensins is mainly by increasing the ionic strength of divalent cations and calcium and potassium ion efﬂux [55]. LTP’s may be involved in the secretion or deposition of extracellular lipophilic materials like the cutin or the wax and acts a structural barrier in stopping

398

J. Sudisha et al.

the pathogen [54]. PR-15 and 16 which show a oxalate oxidase like activity catalyze the oxidation of oxalates by molecular oxygen yielding carbon dioxide and hydrogen peroxide which are involved in the cell wall cross linking and also secondary signaling compounds [57]. It has been speculated that PR-17’s may possess a protease like activity based on the resemblances of the active sites. PR-17’s have activity similar to intracellular caspase like cysteine protease and bestatin an inhibitor of certain zinc metallo peptidases. They serve a role in pathogen defense with relation to either cell wall metabolism or signal transduction where they identify components of particular pathogen, releasing signal molecules in a manner analogous to release of certain carbohydrate elicitors. Another possibility is that they may act as antibiotic components operating directly against an invading pathogen [58].

17.6

Conclusions

Many PR proteins are induced in plants invaded by the phytopathogens. Most of them are induced in resistant interactions rather than susceptible interactions. PR proteins are induced more rapidly upon treatment with several biotic and abiotic agents. Interestingly, genes induced under situations where the plant develops subsequent resistance have been found to be similar to those expressed after infection with a virulent pathogen [88]. Atleast 17 families of PR proteins have been identiﬁed. Multigene families encode most of the PR proteins. PR proteins are present at basal levels in healthy plants and the regulation of PR protein induction primarily takes place at the level of transcription. PR gene expression depends on the binding of certain biotic and abiotic inducible transcription factors. Many cis acting elements have been found in the PR gene promoters, which activate gene expression. Recognition and binding of the cis elements by trans acting factors have been noted. Several transcription factors like the EREBP, Myb 1 and GT1 have been found to activate gene expression of PR’s. Induction of PR gene expression requires speciﬁc or combination of signaling molecules. Synergism and antagonism between signaling molecules has been reported. Elicitors, ethylene, SA, JA, methyl jasmonate, hydrogen peroxide, systemin, oligosaccharides, auxins and cytokinins are the signals involved in induction of PR gene expression. Some PR proteins are localized in the vacuoles, some in the cytoplasm and the others in the apoplast. PR proteins may induce resistance by a variety of mechanisms such as inducing plant cell wall reinforcement, suppressing the pathogen enzymes and by degrading proteins essential for pathogenesis and inducing elicitor inducible host defense mechanism besides being directly antimicrobial and a few of the PR’s like the PR-13 are also toxic to the pathogens. The work carried out in soybean, cotton, alfalfa and cassava pathosystems has extended our knowledge on the gene expression changes in response to pathogens [21]. All these studies exhibit a larger number of induced genes than that of those corresponding classical list of PRs.

17

Pathogenesis Related Proteins in Plant Defense Response

17.7

399

Outlook

Transgenic plants expressing PR proteins has now become routine and several research groups across the world do pioneering work in this regard. A new and deep suited investigation is necessary to identify combinations of PR proteins that are most effective against a speciﬁc pathogen or a broad range of pathogens. A better understanding of all the PR proteins, their mode of action and the cellular targets would lead to better agricultural utilization of the existing knowledge. There is a huge demand for food crops growth with less chemical use. Therefore, genetic engineering is fast emerging as an important tool to support the conventional breeding for improvement of crops. Large groups of PR genes which have been well characterized can be put to use to produce plants with better responses to biotic and abiotic stress. Understanding stress signals and transduction mechanisms and identiﬁcation of additional defense genes will provide opportunities for enhanced resistance engineering in crop plants’ PR gene engineering therefore could be the sustainable solution for better food crop production.

References 1. Van Loon LC (1999) Occurrence and properties of plant pathogenesis related proteins. In: Dutta SK, Muthukrishnan S (eds.) Pathogenesis related proteins in plants. CRC Press, Boca Raton 2. Van Loon LC, Van Strien EA (1999) Families of pathogenesis related proteins, their activities and comparative analysis of PR-1 types. Physiol Mol Plant Pathol 55:85–97 3. Kuc J (2001) Concepts and direction of induced systemic resistance in plants and its application. Eur J Plant Pathol 107:7–12 4. Oostendorp M, Kunz W, Dietrich B, Staub T (2001) Induced disease resistance in plants by chemicals. Eur J Plant Pathol 107:19–28 +IM9* (WANG"+ 0URIlCATION . TERMINALSEQUENCINGANDANTIFUNGALACTIVITYFROM pepper stem treated with mercuric chloride. Physiol Mol Plant Pathol 48:417–432 6. Naranjo MA, Romero C, Belles JM, Motesinos C, Vicente O, Serrano R (2003) Lithium treatment induces hypersensitive like response in tobacco. Planta 217:417–429 7. Plazer A, Zur I (2003) Cold induced plant resistance to necrotrophic pathogens and antioxidant enzyme activity and cell membrane permeability. Plant Sci 164:1019–1028 &LEMING4- -C#ARTNEY4 (OFFMAN3 3TERK2 $EVRIES3 +UHLEMEINER3 )NDUCTION and characterization of some pathogenesis related proteins in sugar beet. Physiol Mol Plant Pathol 39:147–160 9. Sharma P, Borja P, Stougard P, Lonnberg A (1993) PR proteins accumulating in spruce roots infected with pathogenic Pythium sp. Physiol Mol Plant Pathol 43:57–67 3TUNZI ! (EITZ 4 0RASAD 7 +AUFFMAN 3 ,EGRAND - &RITIG " 0LANT PATHOGENESIS related proteins and their role in defense against pathogens. Biochem 75:687–706 11. Van Loon LC (1997) Induced resistance in plants and the role of pathogenesis related proteins in plants. Eur J Plant Pathol 103:753–765 12. Ziadi S, Barbedtte S, Godard JR, Monot D, Corre L, Silue D (2001) Production of Pathogenesis related proteins in the cauliﬂower-downy mildew pathosystem treated with azibenzolar-s-methyl. Plant Pathol 50:579–586

400

J. Sudisha et al.

13. Tuzun S (2001) The relationship between pathogen induced systemic resistance and multigenic resistance in plants. Eur J Plant Pathol 107:85–93 14. Pierpoint WS, Gordon-Weeks R, Jackson PJ (1992) The occurrence of thaumatin like proteins in intracellular ﬂuids of Nicotiana species. Physiol Mol Plant Pathol 41:1–10 #ONSTABLE #0 "RISSON . 4HE 02 RELATED 34( GENE PRODUCT OF POTATO SHOWS RACE speciﬁc accumulation after inoculation with low concentration of Phytophthora infestans zoospores. Planta 188:289–295 16. Constable CP, Brisson N (1995) Stigma and vascular related expression of pathogenesis related genes. Mol Plant Microbe Inter 8:104–113 17. Baga M, Chibbar RN, Kartha KK (1995) Molecular cloning and expression analysis of peroxidase genes from wheat. Plant Mol Biol 29:647–662 -ALANDAIN( ,AVAUD& !LLERGENICITEDEPROTEINSDEDEFENSEVEGETALE2EVUEFRANCAISE d’ allergologie et d’ immunologic Clinique 44:469–475 19. Van Loon LC, Van Strien EA (1994) Recommendations for naming plant pathogenesis related proteins. Plant Mol Biol Rep 12:245–264 20. Gordon-Weeks R, Sugars JM, Antoniuw JF, White RF (1997) Accumulation of novel PR1 proteins in Nicotiana leaves in response to virus infection or treatment with salicylic acid. Physiol Mol Plant Pathol 50:263–273 21. Garcion C, Lamotte O, Metraux JP (2007) Mechanism of defence to pathogens: biochemistry and physiology. In: Walters D, Newton A, Lyon G (eds.) Induced resistance for plant defence: a sustainable approach to crop protection. A Blackwell Publishing Ltd, Oxford 22. Vidhyasekaran P (2002) Inducible plant proteins. In: Bacterial disease resistance – molecular biology and biotechnological applications. Food Products Press, Binghamton/New York 23. Corneillson BJC, LC Van loon, Bol MF (1996) Molecular characterization of messenger RNA’s for pathogenesis related proteins 1a, 1b, 1c induced by TMV infection of Tobacco. EMBO J 15:37–47 24. Eyal Y, Sagge O, Fluhr R (1992) Dark induced accumulation of a basic PR-1 transcript. Plant Mol Biol 101:589–599 "UCHEL!3 "REDERODE&4 "OL*& ,INTHORST(* -UTATIONOF'4 BINDINGSITESINTHE Pr-1A promoter inﬂuences the level of inducible gene expression in vivo. Plant Mol Biol 40:387–396 26. Metzger GL, Meins F (1999) Functions and regulation of plant E 1–3 glucanases. In: Dutta SK, Muthukrishnan S (eds.) Pathogenesis related proteins in plants. CRC Press, Boca Raton 27. Buchner P, Rochat C, Williams S, Boutin JP (2002) Characterisation of tissue speciﬁc and developmentally regulated E 1–3 glucanase gene in pea. Plant Mol Biol 49:171–186 28. Thimmapuram J, Korban SS (2001) Characterization and expression of E 1–3 glucanase genes in peach. Mol Genet Genomics 265:469–479 29. Simmons CR (1994) The physiology and molecular biology of plant 1,3-b-D-glucanases and 1,3; 1,4-b-D-glucanases. Crit Rev Plant Sci 13:325–387 30. Neuhaus JM (1999) Plant chitinases. In: Datta SK, Muthukrishnan S (eds.) Pathogenesis-related proteins in plants. CRC Press, Boca Raton (ONG*+ (WANG"+ )NDUCTIONBYPATHOGEN SALTANDDROUGHTOFABASICCLASS))CHITINASE mRNA and its in situ localization in pepper (Capsicum annuum). Physiol Plant 114:549–558 0ORAT2 6INOKUR6 (OLLAND$ -C#OLLUM4' $ROBY3 )SOLATIONOFACITRUSCHITINASE cDNA and characterization of its expression in response to elicitation of fruit pathogen resistance. J Plant Physiol 158:1585–1590 33. Velazhahan R, Samiyappan R, Vidhyasekaran P (2000) Puriﬁcation of an elicitor-inducible antifungal chitinase from suspension-cultured rice cells. Phytoparasitica 28:131–139 34. Gaudet DA, Laroche A, Frick M, Davoren J, Puchalski B, Ergon A (2000) Expression of plant defence-related PR protein transcripts during hardening and dehardening of winter wheat. Physiol Mol Plant Pathol 57:15–24 (WANG* +IM( ,EE) +IM3' 'ENEENCODINGPATHOGENESIS RELATEDPROTEINOF Lithospermum is responsive to exogenous stimuli related to plant defense system. Plant Sci 165:1297–1302

17

Pathogenesis Related Proteins in Plant Defense Response

401

36. Velazhahan R, Datta SK, Muthukrishnan S (1999) The PR-5 thaumatin like proteins. In: Dutta SK, Muthukrishnan S (eds.) Pathogenesis related proteins in plants. CRC Press, Boca Raton #APELLI . $IAGON 4 'REPPIN ( 3IMON 0 )SOLATION OF A C$.! CLONE ENCODING AN osmotin like protein from Arabidopsis thaliana. Gene 191:51–56 (U8 2EDDY!3. #LONINGANDEXPRESSIONOFA02 LIKEPROTEINFROM!RABIDOPSIS inhibition of fungal growth by bacterially expressed protein. Plant Mol Biol 34:949–959 39. Kim YS, Park JY, Kim KS, Ko M, Chen SJ, Oh BJ (2002) A thaumatin like gene in non-climatic pepper fruits used as a molecular marker in probing disease resistance. Plant Mol Biol 49:125–135 40. Rakwal R, Agarwal GK, Agarwal VP (2001) Jasmonate, Salicylate, protein phosphatase inhibitors and kinetin regulate OSPR-5 expression in rice. J Plant Physiol 158:1357–1362 41. Van Damme EJM, Charles D, Menu-Bouaouiche L, Proost P, Barri A, Rouge P, Peumans EWJ (2002) Biochemical, molecular and structural analyses of multiple thaumatin like proteins from the elderberry tree (Sambucus nigra L.). Planta 214:853–862 (EITZ4 'EOFFREY90 &RITTIG" ,EGRAND- 4HE02 FAMILYOFPROTEINASEINHIBITORSIN plant-microbe and plant-insect interactions. In: Dutta SK, Muthukrishnan S (eds.) Pathogenesis related proteins in plants. CRC Press, Boca Raton $OARES 3( 3YROVETS % 7EILER %7 2YAN #! /LIGOGALACTURONOIDES AND #HITOSAN activate plant defensive genes through the octadecanoid pathway. Proc Natl Acad Sci USA 92:4095–4098 +OIWA ( "RESSAN 2! (ASIGAWA 2- 2EGULATION OF PROTEINASE INHIBITORS IN PLANT defense. Trends Plant Sci 2:379–384 45. Torenero P, Conejero V, Vera P (1997) Identiﬁcation of a new pathogen induced member of subtlisin like processing family from plants. J Biol Chem 272:14412–14419 46. Chittor JM, Leach JE, White F (1999) Induction of peroxidases during defense against pathogens. In: Dutta SK, Muthukrishnan S (eds.) Pathogenesis related proteins in plants. CRC Press, Boca Raton 3HIVKUMAR0$ 'EETHA(- 3HETTY(3 0EROXIDASEACTIVITYANDISOZYMEANALYSISOF pearl millet seedlings and their implication in downy mildew disease resistance. Plant Sci 164:85–93 48. Suklavoic VT, Vuletic M, Vucinic Z (2003) Plasma membrane bound phenolic peroxidase of maize roots: in vitro REGULATION OF ACTIVITY WITH .!$( AND ASCORBATE 0LANT 3CI 165:1429–1435 3HIVKUMAR0$ 6ASANTHI.3 3HETTY(3 0ETERSEN63 2IBONUCLEASESINTHESEEDLINGSOF pearl millet and their involvement in resistance against downy mildew disease. Eur J Plant Pathol 106:825–836 (EITZ4 'EOFFREY0 &RITTIG" ,EGRAND- -OLECULARCHARACTERIZATIONOFANOVELTOBACCO PR protein: a new plant chitinase lysozyme. Mol Gen Genet 245:246–254 51. Bravo JM, Campo S, Murillo I, Coca M, Segundo B (2003) Fungus and wound induced accumulation of mRNA containing class II chitinase of the pathogenesis related 4 family of maize. Plant Mol Biol 52:745–749 52. Conceiaco A, Broaekart W (1999) Plant defensins. In: Dutta SK, Muthukrishnan S (eds.) Pathogenesis related proteins in plants. CRC Press, Boca Raton 0ENNECKS)! %GGERMONT+ 4ERRA&2' 4HOMMA"0( "UCHLAG! -ETRAUX*0 "ROAEKART7& (1996) Pathogen induced activation of plant defense gene is independent of salicylic acid. Plant Cell 8:2309–2323 54. Olendo FG, Molino A, Palenzula PR (1999) Plant defense peptides. Biopolymers 47:479–491 4HOMMA"0(* #AMMEL"0! 4HEVISSEN+ 0LANTDEFENSINS0LANTAn "OHLMANN( 2OLEOFTHIONINSINRESISTANCEOFPLANTS)N$UTTA3+ -UTHUKRISHNAN3 (eds.) Pathogenesis related proteins in plants. CRC Press, Boca Raton 57. Xu X, Bidney DL, Yalpani N, Duvick JP, Crasta O, Folker O, Lu G (2003) Over expression of AGENEENCODING(2O2 generating oxalate-oxidase evokes defense responses in sunﬂower. Plant Physiol 133:170–181

402

J. Sudisha et al.

#HRISTENSEN!" #HO"( .AESBY- 'REGERSEN0, "RANDT4 /RDENNA+- #OLLINGE$" Lu G (2002) The molecular characterization of two barley proteins establishes the novel PR-17 family of pathogenesis related proteins. Mol Plant Pathol 3:135–144 ,EE3( (WANG"+ )DENTIlCATIONOFTHEPEPPER3!2GENEASAMOLECULARMARKER for pathogen infection, abiotic elicitors and environmental stresses in Capsicum annatum. Planta 216:387–396 (EIL - "OSTOCK 2- )NDUCED SYSTEMIC RESISTANCE IN THE CONTEXT OF INDUCED PLANT defenses. Ann Bot 89:503–512 61. Monteiro S, Burakat M, Teixiera AR, Ferriera RB (2003) Osmotins and Thaumatins from Grapes: a putative general defense mechanism against pathogenic fungi. Phytopathol 93:1505–1512 62. Mohmmadi M, Roohiparwar R, Torasi M (2001) Induced chitinase activity in resistant wheat leaves inoculated with an incompatible race of Puccinia striitiformis f.sp. tritici. Mycopathol 154:119–126 63. Soylu S, Boysal O, Soylu EM (2003) Induction of disease resistance by plant defense activator acibenzolar-s-methyl (ASM), against bacterial canker caused by Clavibacter michigenensis in tomato seedlings. Plant Sci 165:1069–1079 64. Cheong JJ, Choi DY (2003) Methyl jasmonate a vital substance in plants. Trends Genet 19:409–413 (ADWIGER,! (OST PARASITEINTERACTIONSELICITATIONOFDEFENSERESPONSESINPLANTSWITH Chitosan. In: Jolles P, Muzzarelli RAA (eds.) Chitin and chitinases. Birkhauser, Basel 66. Metraux JP (2001) Systemic acquired resistance and salicylic acid: current state of knowledge. Eur J Plant Pathol 107:13–18 67. Bostock RM (1999) Signal conﬂicts and synergies in induced resistance to multiple attackers. Physiol Mol Plant Pathol 55:99–109 68. Thaler SJ, Karban R, Ullman DE, Boege K, Bostock RM (2002) Cross talk between jasmonate and salicylate plant defense pathways: effects on several plant parasites. Oecologia 131:227–235 "UCHEL !3 ,INTHORST (*- 02 A GROUP OF PLANT PROTEINS INDUCED UPON PATHOGEN infection. In: Dutta SK, Muthukrishnan S (eds.) Pathogenesis related proteins in plants. CRC Press, Boca Raton 70. Bertini L, Leonardi L, Caporal C, Thui M, Cacone N, Buonocore V, Caruso C (2003) Pathogen responsive wheat PR4 genes are induced by activators of systemic acquired resistance and wounding. Plant Sci 164:1067–1078 71. Ryan CA, Moura DS (2002) Systemic wound signaling in plants. Proc Natl Acad Sci USA 99:6519–6520 72. Bantignics B, Seguin J, Dedelchamp F, Gulick P, Ibrahim R (2002) Direct evidence for ribonucleolytic activity of a PR-10 like protein from white lupin roots. Plant Mol Biol 42:871–881 8U,( ,IU&1 7ANG:, 0ENG7 (UANG2& (UANG$& 8IE$8 !N!RABIDOPSIS mutant cex1 exhibits constant accumulation of jasmonate-regulated ArVSP, Thi 2.1 and PDF 1.2. FEBS Lett 494:161–164 :UO* #HUA.( #HEMICALINDUCIBLESYSTEMSFORREGULATEDEXPRESSIONOFPLANTDEFENSE genes. Curr Opin Biotechnol 11:146–151 75. Sanchez OL, Singh KB (2002) Identiﬁcation of ethylene responsive element binding factors with distinct induction kinetics after pathogen infection. Plant Physiol 128:1312–1322 76. Schweinner C, Zourildou M, Bevan MW (1998) Plant transcription factor studies. Annu Rev Plant Physiol Mol Biol 49:127–150 #ORNMALK 23 %ULGEM 4 2USHTON * +OCHNER 0 (AHLBROCK + 3OMISCH )% Leucine-zipper containing WRKY proteins widen the spectrum of immediate early elicitorinduced WRKY transcription factors in parsley. Biochem Biophys Acta 1576:92–100 'ARRETON 6 #APINELLI * *ORDANA 8 (OLOUGE , 4HE AS PROMOTER ELEMENT IS AN oxidative stress responsive element and salicylic acid and activates it via oxidative stress. Plant Physiol 130:1516–1526

17

Pathogenesis Related Proteins in Plant Defense Response

403

79. Lorenzo O, Riqueres R, Tora J, Solano R (2003) Ethylene responsive factor I integrates signals from ethylene and jasmonates in plant defense. Plant Cell 15:165–176 80. Johnson JC, Bodem E, Arins J (2003) Salicylic acid and NPR 1induce the requirement of trans-activating TGA factors to a defense gene promoters in Arabidopsis. Plant Cell 15:1846–1858 81. Megish T, Chen X, Salmeron J, Diatreich R (2003) The Botrytis susceptible 1gene encodes an R2R3MYB transcription factor protein that is required for biotic and abiotic stress response in arabidopsis. Plant Cell 15:180–190 2EIGNER! &ROMEYER( .AKE# 7ELLMER& +IRCHER3 3CHAFER% (ARTER+ )SOLATION and characterization of four novel proteins that interact with transcriptional regulators CPRF1 and CPRF2. Mol Genet Genomics 265:964–976 3POEL 3( 3USSANE -#3 *! 6AN PELT -ULLER -* "UCHALA !* "ROWN 2 +AZAN + LC Van loon, Dong X (2003) NPR 1 modulates cross talk between salicylate and jasmonate dependent defense pathways through a novel function in cytosol. Plant Cell 15:760–770 84. Klarizinski O, Plesse B, Joubert JM, Yuin JC, Kopp M, Kloraeg B, Frittig B (2000) Linear E, 1–3 glucans are elicitors of defense response in tobacco. Plant Physiol 124:1027–1037 85. Leung DWM (1992) Involvement of chitinases in sexual reproduction in higher plants. Phytochem 31:1899–1992 86. Selitrennikoff CP (2001) Antifungal proteins. Appl Environ Microbiol 67:2883–2894 87. Velazhahan R, Cole KC, Anuratha CS, Muthukrishnan S (1998) Induction of thaumatin-like proteins (TLPs) in Rhizoctonia solani-infected rice and characterization of two new cDNA clones. Physiol Plant 102:21–28 4AO9 8IE: #HEN7 'LAZERBROOK* #HANG(3 (AN" :HU4 :OU4 +ATAGIRI& Quantitative nature of Arabidopsis responses during compatible and incompatible interactions with the bacterial pathogen Pseudomonas syringae. Plant Cell 15:317–330

sdfsdf

About Author

Professor J.M. Mérillon (born 1953) did his M. Pharma (1979) and Ph.D. (1984) from the University of Tours, Tours, France. He joined the University of Tours as faculty member in 1982 and became associate professor in 1987 and a full Professor in 1993 at the faculty of Pharmacy, University of Bordeaux 2, Bordeaux, France. He is currently group leader of ‘study group on biologically active plant substances, Institute of Vine and Wine Sciences’ with 20 scientists and research students. He has published more than 100 research papers in internationally recognized journals. He is involved in developing courses and research on vine and wine in France and traveled widely being a senior professor. Scientists from several countries are working in his laboratory and the research is supported by funds from the vine growers association, ministry of higher education and research and various private entrepreneurs. He has worked as coeditor for a few books on medicinal plants. Professor K.G. Ramawat (born 1952) did his M.Sc (1974) and Ph.D. (1978, Plant Biotechnology) from the University of Jodhpur, Jodhpur India and joined as faculty member in January 1979. He joined M.L. Sukhadia University as Associate Professor in 1991 and became Professor in 2001. He served as Head, Department of Botany (2001–2004), In charge, Department of Biotechnology (2003–2004), member task force on medicinal and aromatic plants, Department of Biotechnology, Government of India, New Delhi (2002–2005) and co-ordinator UGC-DRS and DST-FIST programmes (2002–2009). He did his Post-doctoral at University of Tours, France (1983–85) and subsequently worked as visiting professor at University of Tours (1991) and University of Bordeaux2, France (1995, 1999, 2003, 2006). He visited Poland under INSA-PAN academic exchange programme (2005). He has published more than 120 research papers and review articles in reputed journals and books. He has edited a few books on Biotechnology of medicinal plants published by Science Publishers Inc, Enﬁeld, USA and Springer Verlag, Germany. Prof. Ramawat has completed several major research projects funded by UGC, CSIR, ICAR, DBT and DST, New Delhi and has supervised doctoral thesis of 20 students.

J.M. Mérillon and K.G. Ramawat (eds.), Plant Defence: Biological Control, Progress in Biological Control 12, DOI 10.1007/978-94-007-1933-0, © Springer Science+Business Media B.V. 2012

405

sdfsdf

Index

A ABA. See Abscisic acid Abiotic elicitors, 119–127, 175, 179 Abscisic acid (ABA), 73, 260, 285, 295, 296, 302, 315, 321, 371, 393 Accumulation, 31, 58, 59, 61, 64, 112, 118, 119, 121, 125, 126, 161, 162, 201, 242, 244–256, 258, 259, 261, 276, 277, 282–285, 295, 296, 317, 321, 322, 324, 336, 349, 350, 354, 390, 391 Active oxygen species (AOS), 315, 316, 321, 322, 397 Adrian, M., 313 Aery, N.C., 241, 246, 250 Aﬂatoxins, 156, 196, 197 Airborne diseases, 171 Allelochemicals, 147, 149–151, 154–155, 200 Alonso–Villaverde, V., 25 Ampelomyces, 15, 171 Amruthesh, K.N., 379 Anatomical changes, 345, 350 Animal products, 161 Antifeedant, 199, 200 AOS. See Active oxygen species Arbuscular mycorrhiza, 170 Armengaud, P., 145 Arora, J., 3 Ash, 161, 165, 189, 247, 249, 251 Auquier, P., 249, 250 Avissar, I., 56 Azmat, R., 254

B Babalar, M., 62 Bacillus thuringiensis, 16, 141, 144 Baculoviruses, 142, 143, 145, 155 Baker, A.J.M., 252 Baldwin, I.T., 299 Balick, M., 150 Barker, K.R., 90 Barth, C., 58 Basal rot disease, 209, 212, 215–216, 222–223, 228 BCAs. See Biocontrol agents Beaulieu, J.C., 59 Belhadj, A., 64, 125 Bellows, J.T.S., 140 Bengal famine, 5 Bentley, J.W., 163 Berry, W.L., 246 Biocontrol agents (BCAs), 82, 139–143, 147, 155, 161, 168, 169, 171–174, 179–183, 185–189, 227, 228, 232 Biocontrol fungi, 187, 209 Biofungicides, 210, 233, 235 Biopesticides, 15, 139–142, 144, 155, 234, 235 Biotic elicitors, 119, 120, 123, 127–129 Boeke, S.J., 153 Braun-Blanquet, J., 248, 250 Bringezu, K., 256 Bronner, R., 284, 285 Burman, U., 176

C Cabanillas, E., 90 Camili, E.C., 57 Candida, 15, 203

J.M. Mérillon and K.G. Ramawat (eds.), Plant Defence: Biological Control, Progress in Biological Control 12, DOI 10.1007/978-94-007-1933-0, © Springer Science+Business Media B.V. 2012

407

408 CD. See Cyclodextrins Chaney, R.L., 254 Cha, S.C., 203 Chemical battle, 274, 278, 282–283 Chemical pesticides, 67, 140, 142–144, 156, 164, 171, 182, 195, 204, 226, 228, 234 Chervin, C., 55, 60 Chitosan, 34, 91, 120, 122, 124, 127–128, 321, 391 Classes of PR proteins, 384 Classiﬁcation of PR proteins, 81, 82 Cluzet, S., 109 Co-evolution, 3–17, 150 Compant, S., 171 Coniothyrium, 15 Conklin, H.C., 164 Cornell, H.V., 282 Costa, G., 258 Creasy, L.L., 43 Crop rotation, 86, 163–165, 168, 294 Croteau, R.B., 349 Crump, D.H., 87 Cultural practices, 161, 163–167, 198, 209 Cyclodextrins (CD), 122, 125–126

D Daire, X., 313 Defense signal transduction, 363, 369, 374 de Leij, F.A.A.M., 86, 87 Delisle, J., 148 Delorgeril, M., 27, 43 Denaeyer de-Smet, S., 249, 250 Detoxiﬁcation, 29, 152, 241, 242, 246, 254–261 Doane, D.C., 148 Drechsler, C., 68 Dubey, N.K., 57, 195 Duchon Dorris, J., 145 Duncan, G.H., 85 Duvigneaud, P., 249, 250

E Eilenberg, J., 67 Eilert, U., 119 Elicitation, 34, 60, 115, 119–121, 125, 317, 321, 326, 382, 394 Elicitors, 12, 34–35, 109, 119–129, 154, 175, 179, 189, 298, 301, 302, 313–315, 320–322, 325, 326, 348, 380, 392, 393, 395, 397, 398

Index Elixir of life, 211 Endoparasitic fungi, 72, 76–82, 95 Epidemiology, 3, 5–7, 235 Erb, M., 291 Erwinia carotovora, 16, 56, 322 Ethephon, 60, 123–126, 394 Extracellular enzymes, 72, 88, 91, 92

F Farago, M.E., 256 FCs. See Furanocoumarins Fensterseifer, I.C.M., 333 Flavonoids, 43, 112, 114, 118, 202, 317, 320 Flint, H.M., 148 Flooding, 14, 164, 166, 242 Food commodities, 195–204 Food preservatives, 198 Franco, O.L., 333 Frankel, E.N., 27, 43 Fungal biological control, 67, 68, 172 Fungal metabolites, 40, 170 Furanocoumarins (FCs), 297

G Gamm, M., 313 Gams, W., 88 Ganoderma lucidum, 174, 186, 209–212, 214, 217, 219–222, 225, 228, 232, 233 Gaspard, J.T., 87 Gaur, J.P., 258 Gindro, K., 25 Goyal, S., 3, 109 Grapevine defence mechanisms, 29, 34, 35

H Hallmann, J., 68 Hamm, G., 112 Heavy metals, 119, 171, 241–254, 256–261, 381 Héloir, M.C., 313 Hemileia vastatrix, 5 Herbivory, 252, 277, 279, 296, 300, 301, 303, 345, 347, 348, 352–355, 358 High salinity, 242 Hintz, W., 141 Hominick, W.M., 68 Hori, K., 283 Host- parasite interaction, 10–12, 175 HR. See Hypersensitive response Hudgins, J.W., 350

Index Huitson, S.B., 252 Hyperaccumulation, 241, 251–253 Hypersensitive response (HR), 11, 280, 315, 325, 369, 380

I Index, 86, 90, 174, 222, 275 Indigenous knowledge, 161–190 Insect contamination, 195–204 Insecticides, 14, 144, 145, 150, 152, 153, 161, 169, 198, 200 Insect parasitoids, 146 Insect predators, 142, 146 Isaias, R.M.S., 273, 277–279 Isman, M.B., 151 Isoﬂavones, 111, 112, 114–115, 123–125, 127–130

J JA. See Jasmonic acid Jackson, L.E., 15 Jaffee, B.A., 68 Jaffré, T., 252 Jang, M.S., 44 Jasmonates, 40, 64, 322, 391, 392 Jasmonic acid (JA), 12, 55, 61, 121–123, 176, 294, 296, 298, 303, 315, 325, 348, 369, 391, 392, 395 Jatav, R.S., 172

K Karabulut, O.A., 59, 63 Karthikeyan, M., 215 Kerry, B.R., 68, 86, 87 Khalique, S., 258 Kleeberg, H., 153 Kleter, G.A., 153 Konno, H., 256 Koskimaki, J.J., 112 Kramer, U., 259 Krämer, U., 253 Kumar, A., 161, 379

L Lambert, C., 109 Lambinon, J., 249, 250 Laminarin, 34, 120, 123, 124, 129, 320, 322, 323 Lanea, A.L., 112 Langcake, P., 27

409 Larvicidal, 200 Leaf-defensive compounds, 297–300 Leaf galls, 274 Leaf proteins, 161 Lectins, 174, 202, 385 Lewis, S., 259 Lichter, A., 59 Liebscher, K., 243 Lin, Z.F., 60 Liu, Z., 277 Lodha, S., 172, 176 Lòpez-Llorca, L.V., 68, 85 Luckey, T., 242

M Macedo, M.L.R., 202 Macnair, M.R., 252, 253 Mahmood, I., 68 Maris, P., 57 Marshall, C., 256 Marti, G., 25 Martin, D., 353 Martin, H., 57 Mathur, K., 172 Mawar, R., 172 Mechanisms of defence responses, 8, 13, 34, 126, 294 Meharg, A.A., 252 Mehta, S.K., 258 MeJA. See Methyl jasmonate Mendelsohn, R., 150 Mérillon, J.M., 109 Methyl jasmonate (MeJA), 55, 61, 120–124, 325, 345–358, 388, 391, 392, 394, 395, 398 Milk, 63, 161, 176–185 Mishra, P.K., 195 Moosavi, M.R., 67, 88 Moreira, X., 345, 353–355 Moura, M.Z.D., 274, 276 Multiple cropping, 164, 165 Mycorrhiza, 170, 255 Mycotoxins, 195–197, 201

N Nematode parasitizing fungi, 82 Nematodes trapping, 69, 71–76, 78, 80, 94, 95 Nematophagous fungi, 68–95 Neumann, D., 259 Nicotine, 150, 151, 200, 293, 297–299 Nicotine synthesis, 297, 298 Nieboer, E., 242

410 Nigro, F., 60, 62 Nitric oxide (NO), 11, 73, 120, 260, 302, 315, 316, 321 Nutrient balance, 294–295 Nyman, T., 282

O Obligate parasites, 70, 76, 83, 92 Oligosaccharides, 125, 322–326, 392, 395, 398 Oliveira, D.C., 273, 277–279 Ovicidal, 85, 88, 200 Oviposition, 147, 200, 202, 278–280, 283

P Park, S.W., 61 Patel, A., 79 Pathogenesis related (PR) proteins, 12, 34, 110, 315, 349 Pathogenic prokaryotes, 364–365 Pathogen-responsive cis-elements, 363–374 PEF. See Pulsed electric ﬁeld Pesis, E, 56 Peterson, P.J., 252 Pezet, R., 25 PGPR. See Plant growth promoting rhizobacteria Phenylpropanoids, 118, 124 Pheromones, 141–143, 147, 148, 155, 156 Phillips, M.A., 349 Phosphites, 126 Phytoalexins, 25, 27, 30, 32, 34–36, 42, 110, 114, 116, 117, 119, 123, 126, 129, 313, 315–317, 322 Phytochelatins, 245, 257, 259–261 Phytohormone-responsive elements, 371–372 Phytohormones, 13, 36, 40, 302, 315, 345, 348 Pinto, M.F.S., 333 Plant defence, 8, 13, 34–36, 39, 45, 60, 62, 109–130, 147, 150, 154, 241–261, 291–304 Plant gall, 276–278 Plant growth promoting rhizobacteria (PGPR), 161, 176 Plant nutrients, 170, 294 Plant-parasitic nematodes, 67–95 Plant–pathogen interactions, 12, 13, 363, 364, 369, 371

Index Plant protection products (PPP), 35, 139, 140, 152, 156 Plant regulatory proteins, 363, 364 Plant resistance, 8, 10, 150, 291, 293, 294, 296, 301, 314, 351 Plasmopara viticola, 6, 28, 29, 31, 43, 112, 116, 123, 126, 316 Poinssot, B., 313 PPP. See Plant protection products Prakash, B., 195 Prasad, R., 254 PR genes, 12, 371, 380, 391–395, 399 Price, P.W., 278 Prosopis cineraria, 185, 187, 210, 212, 217, 222, 233 Proteinase inhibitors, 12, 202, 291, 295, 349, 386, 387, 391, 392, 396, 397 PR-proteins, 315, 316, 322 Puccinia graminis f. Sp. Tritici, 7 Pulsed electric ﬁeld (PEF), 126–127 Purohit, A.K., 161 Pyrethrins, 150–152 Pyrethrum, 14, 150–152, 200

R Raj Bhansali, R., 209 Ramawat, K.G., 3, 109 REBECA, 141, 142 Regnault-Roger, C., 139 Renaud, S., 27, 43 Resveratrol, 26–28, 30, 31, 38, 42–45, 112, 116–119, 121–123, 125–127, 129, 313, 316–320, 322 Reuveni, M., 325 Richardson, D.H.S., 242 Rius, C., 44 Rohfritsch, O., 274, 283 Root sensing, 293, 294 Rotenoïds, 150 Roy, B.K., 258 Royer, L., 148 Ruch, B., 153

S Sadeghi, A., 202 Salicylate, 61, 322 Saltveit, M.E., 59 Salunke, B.K., 202 Sampedro, L., 345, 354 Saradhi, A., 258

Index Saradhi, P.P., 258 Savouré, A., 258 Schönrogge, K., 279, 283 SCs. See Semiochemicals Secondary metabolites, 13, 66, 109–130, 195, 197, 199, 200, 231, 274, 277, 291, 293, 320 Semiochemicals (SCs), 140, 142, 143, 147–149, 199, 200 Shahnaz, D., 172 Sharathchandra, R.G., 379 Shelton, A., 147 Shetty, H.S., 379 Shibamoto, T., 56 Shi, Q.M., 299 Shoot-root loop, 297–300 Shorthouse, J.D., 283 Siddiqui, Z.A., 68 Siemann, E.H., 43 Singh, P., 195 Smith, H., 243 Smith, R.J., 140 Soil-borne diseases, 172, 173 Soil-borne fungi, 71, 165, 166 Soil solarization, 89, 173 Song, J., 57 Spadaro, D., 64 Spitz, E., 258 Spring, J-L., 25 Stilbenes, 25–45, 114, 116–119, 121–123, 125, 317, 318, 320, 321 Stilbene synthase (STS), 26, 116–118, 121, 130, 315, 317 Stone, G.N., 279, 283 Storage pests, 195, 201 STS. See Stilbene synthase Sudisha, J., 379 Szabados, L., 258

T Takaoka, M., 27 Terpenes, 200, 295, 346, 354 Thurston, H.D., 164, 188 Tiagi, Y.D., 246, 250 Tian, S.P., 171 Timperley, M.H., 251 Tobacco, 16, 61, 114, 118, 130, 145, 151, 221, 293, 297, 299–301, 315, 322, 372, 381–394, 396 Tolerance, 13, 16, 121, 142, 197, 241, 242, 245–248, 254–261, 291, 298, 300, 301, 317, 352

411 Toxicity, 14, 28, 30, 31, 57, 94, 150–153, 156, 162, 198, 202, 203, 226, 241, 242, 251, 254, 255, 257, 259, 313, 322, 337, 341, 346, 353, 358, 396–397 Toxicity of PR proteins, 396–397 Toxin-producing fungi, 71, 93, 94 Traditional farming, 163–165, 179, 183 Traditional fungicides, 164–165 Trapping structures, 71, 74 Trapp, S., 349 Trichoderma, 15, 86, 120, 168–175, 177, 179, 183–187, 209, 210, 227–235, 396 Tripathi, P., 57 Trouvelot, S., 313 Turner, R.G., 256

U Ultra violet light, 123 Utama, I.M.S., 56, 58

V Van Driesche, R.G., 140 Van Embden, H., 142 Van Lenteren, J.C., 142 Veitch, N.C., 114 Venugopal, B., 242 Viazis, S., 57 Viret, O., 25 Visser, J.H., 276 Vitis vinifera, 26, 27, 35, 43, 112, 117, 122, 123, 125–127, 212, 313, 315 Vogeli-Lange, F., 261 Volatile organic compounds, 294, 303, 350, 352

W Wagner, G.J., 261 Wainwright, S.J., 255 Wang, K.T., 64 Wang, S., 363 Wan, Y.K., 171 Weindling, R., 173 Williams, M.A.J., 274 Wolfender, J-L., 25 Wolters, B., 119 Wong, R.H., 44 Woolhouse, H.W., 242, 255 Wounding response, 348 Wyn Jones, R.G., 256

412 X Xanthomonas campestris pv. Musacearum, 6 Xylella fastidiosa, 6

Y Yeast extract, 122, 124, 128, 129, 149 Yuan, T., 363

Index Z Zare, R., 67, 88 Zas, R., 345 Zhang, Z.P., 299