1 Oligonucleotide
PRINS DNA Synthesis
John R. Gosden and Diane Lawson 1. Introduction The technique for labeling chrom...
57 downloads
1023 Views
12MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
1 Oligonucleotide
PRINS DNA Synthesis
John R. Gosden and Diane Lawson 1. Introduction The technique for labeling chromosomesby annealing an oligonucleotide DNA primer to the denatured DNA of chromosome preparations on glass slides and extending it enzymatically in situ with the incorporation of labeled nucleotides was fust described by Koch et al. in 1989 (I). Since then, the technique has been greatly improved in reliability, sensitivity, and resolution, and now provides a viable, rapid alternative to conventional fluorescence in situ hybridization (FISH) for many investigations, particularly the identification of chromosome aneuploidy in metastatic tissues and antenatal diagnosis and the analysis of the human chromosome complement of somatic hybrid cell lines (Zd). 2. Materials 2.1. Primed In Situ Syf7thesis 1. Twin-Frost glassslides and 22 x 40 mm coverslips: The slides must be cleaned by soaking in ethanol to which a few drops of HCl have beenadded,followed by polishing with a cleanpiece of muslin, before the cells aredepositedon the slide. Coverslips must be cleanedin the sameway before use. 2. PRINS buffer (10): 500 mM KCl, 100 mil4 Tris-HCl, pH 8.3, 15 mA4MgC12, 0.1% BSA. 3. 2’-Deoxyadenosine 5’-triphosphate (dATP): 100-W solution (Pharmacia Biotech, St.Albans, UK), diluted 1:10 with sterile distilled HzO. 4. 2’-Deoxycytidine 5’-triphosphate(dCTP): 100-mM solution (PharmaciaBiotech) diluted 1:10 with sterile distilled H20. 5. 2’-Deoxyguanosine S-triphosphate (dGTP): 100~mM solution (Pharmacia Biotech) diluted 1:10with sterile distilled H20. 6. 2’-Deoxythymidine5’-triphosphate(dTTP): lOO-mJ4solution(PharmaciaBiotech) diluted 1:100with sterile distilled H,O. From. Methods fn Molecular Biology, Vol 71 PRINS and In Situ PCR Protocols Ed&d by. J. R Gosden Humana Press Inc., Totowa, NJ
2
Gosden and Lawson
7. Biotin-16-2’-deoxyuridine-5’-triphosphate (Bio- 16-dUTP) (Boehrmger Mannheim, Lewes, Sussex, UK). 8. Digoxigenin-1 I-deoxyuridine-5’-triphosphate (Dig-l l-dUTP) (Boehrmger Mannherm). 9. FluoroRed (Amersham International, plc, Buckinghamshire, England). 10. FluoroGreen (Amersham International). 11. FluoroBlue (Amersham International). 12. Ohgonucleotide primer(s) at 250 ng/pL (see Note 1) 13 Tuq DNA polymerase (Taq [Boehrmger], AmpliTaq [Cetus], or ThermoprimePrus [Advanced Biotechnologies Ltd., Leatherhead, England]). 14 Rubber cement (vulcanizing solutron) (e.g., Tip-Top, Stahlgruber, DS-8011 Poing, Germany) (see Note 2). 15. Stop buffer (500 mM NaCl, 50 n1J4 EDTA). 16. Flat-bed thermal cycler (see Note 3). 17. Water bath at 65°C
2.2. Detection 1 Dried skimmed milk powder. 2. Avrdin-DCS-fluorescein isothiocyanate (Av-FITC) (Vector Labs, Burlingame, CA). 3. Avidin-DCS-Texas red (Av-TR) (Vector Labs). 4. Antrdigoxigenin-fluorescem (anti-DIG-FITC) (Boehrmger Mannhelm). 5. Antrdigoxigenm-rhodamine (anti-DIG-rhodamine) (Boehrmger Mannheim). 6. Propidium iodide (20 pg/mL) (Sigma). 7. 4’,6-Dtamidino-2-phenylmdole 2 HCl (DAPI) (100 pg/mL) (Sigma). 8. VectaShreld (Vector Labs). 9. 20X SSC: 3.OMNaC1, 0.3OMtn-sodmm citrate, pH 7.3. 10. Wash buffer: 4X SSC (diluted from stock 20X SSC), 0.05% Tnton X-100. 11. Blocking buffer: wash buffer with the addition of 5% skimmed mrlk powder. 12. Incubator or water bath at 37’C and water bath at 45°C. 13. Microscope equipped for eprfluorescence (e g., Zeiss Axioskop or Leitz Ortholux II with Pleomopak filter system)
3. Methods
3.1. Standard PRINS 1. You will need cells or chromosomes, prepared from peripheral blood lymphocytes (71, cultured cells (8), or frozen sections (see Speel et al., Chapter 8) (see Note 5). 2. Oligonucleotide primers are prepared on an Applied Biosystems (Foster City, CA) Model 38 1A DNA synthesizer according to the manufacturer’s instructions. Recommendations for some successful chromosome-specific primers are given in Table 1 (but see Note 4). 3. The reaction mix is made up as follows: For each slide, put 1 pL of each of the diluted nucleotide triphosphates, plus 1 @Lof the selected labeled dUTP (biotin,
PRINS
3
Table 1 Examples of Chromosome-Specific Oligonucleotides and a Primer for All Human Centromeres F673 (20-mer) F60 (30mer)
D16Z1, Satellite II D 172 1, alphoid
G33 (19-mer) 168 (17-mer)
D9Z 1, Satellite III CenP-B Box
4. 5. 6.
7.
TTCTTTTCATACCGCATTCT ATTGCACTTCTTTGAGGAGTACCG TAGTAA AATCAACCCGAGTGCAATC CTTCGTTGGAAACGGGA
digoxigenin, or a fluorochrome), 5 pL 10X PRINS buffer, and 1 pL of the appropriate oligonucleotide pruner (see Note 6) mto a microcentrifuge tube, and add distilled water to 50 PI.,, Mix thoroughly and add 1 U of your chosen DNA polymerase. Mix carefully and place 40 $ on a clean coverslip. Pick the coverslip up with a slide (this spreads the reaction mix evenly, with the least risk of introducing air bubbles) and seal with rubber cement Dry the seal (a cold air fan is quick and safe) and transfer the slides to the flat block of a thermal cycler. A suitable basic program for the Hybaid OmniGeneTM In Situ, or Hybaid OmniSlideTM is 93”C, 3 min; 60°C 5-10 min; 72”C, 15 min. On completion of the program, remove the seal (it peels off easily by rubbing one comer) and transfer the slides for 1 min to a Coplin jar containing stop buffer at 65°C. Leave the coverslips in place, unless they come off readily with the seal; they will in any case fall off in the stop buffer. After 1 min, transfer the slides to a stain dish containing wash buffer. They may be held in this solution overnight if convenient (but see Note 7)
3.2. Detection It is important that the slides do not become dry at any time during this process. The following steps apply only to slides in which the PRINS reaction has been labeled with biotin or digoxigenin. Slides in which the reaction used a fluorochrome-dUTP as the label require no detection step, and are simply mounted (see step 6). 1. Prepare blocking buffer. The milk powder dissolves rapidly if the solution is warmed to 45“C for a few seconds. 2. Put 40 pL blockmg buffer on a clean coverslip, shake surplus wash buffer from the slide, and pick up the coverslip containing blocking buffer. Leave (unsealed) at room temperature for 5 min. 3. Dissolve reporter (avidin-fluorochrome or antidigoxigenin-fluorochrome) in blocking buffer. For Av-FITC or Av-TR, 1:500 is a suitable dilution; anti-DIG FITC and anti-DIG rhodamine are better at 1: 100 dilution. Make sufficient buffer for a 40 &/slide. Spin in a microcentrifuge for 5 min. This precipitates any aggregates that may have formed during storage and can cause high and nonspecific background.
4
Go&en and Lawson
4. Remove the cover&p from the slide, shake surplus fluid off both the sltde and the coverslip, and add 40 pL of reporter solution to the same coverslip. Replace the slide and incubate in a moist chamber (e g., a sandwich box lmed with damp filter paper) at 37°C for 30 mm. 5. Warm a reagent bottle containing wash buffer to 45OC in a water bath. Remove covershps and wash slides 3 x 2 min in 50 mL wash buffer at 45°C. 6. After the final wash, shake off surplus fluid and mount slides in VectaShleld containing the appropriate counterstain: For slides labeled with rhodamine or Texas red, this should be DAPI (5 pg/lOO pL VectaShield, i e., 5 pL of DAPI stock/l00 pL VectaShleld); for slides labeled with FITC, this should be a propidium iodide/DAPI mixture (3.75 & of each stock/l00 pL VectaShield). Use 20-30 pL mountant/slide, blot surplus by covering slide and covershp with a tissue and pressing gently to expel excess mountant, and seal with rubber cement. Slides may be stored m the dark at 4°C for several months. If the stain shows signs of fading, simply peel off the sealant, soak the slide overnight in 4X SSC, 0.05% Triton X-100 (the covershp will fall off at this point), and remount as above Figure 1 shows some typlcal results. 7. Multiple sequential PRINS reactions may be performed on the same sample in order to quantify a number of chromosomes. For details of the method, see Chapter 6 and ref. 6 8. The technique may also be combined with FISH. After the stop buffer, the shdes are passed through an ethanol series (70, 90, 100%) and air-dried before performing a normal FISH procedure, omitting any denaturation of the chromosomal DNA. Detection of the PRINS product and the hybridized FISH probe is then performed simultaneously (9) This provides a rapid method for identifying the chromosomal target located by the FISH. 4. Notes 1. Oligonucleotide pnmers can be synthesized on an ABI DNA synthesizer and used without further purification other than alcohol preclpltatlon and washing. If this facility is not available, they may be obtained from commercial sources, but purification steps, such as HPLC, are not needed and only increase the cost of the product. 2. The requirement for a suitable seal is that it should be reasonably robust, provide a vapor-tight seal, and be easily and completely removed at the end of the procedure. We have found that Tip-Top fulfills all these parameters and is readily available from bicycle repair shops. 3. Thermal cyclers with a flat bed for microscope slides are not yet widely avallable. Some of the products sold for this purpose are not altogether suitable, since they are ad hoc modifications of machines designed for PCR in microtubes, with a plate added to the heated block. Thermal transfer and temperature control m such a system are rarely satisfactory The procedure can be carried out by transferrmg slides through a series of water baths at appropriate temperatures, but this too means that temperature control cannot be precise, and the temperature drop during the
PRINS
Fig. 1. (see color plate number 1 after p. 82) Examples of PRINS reactions with the primers shown in Table 1. All reactions were labeled with biotin-16-dUTP, and the label detected with avidin-FITC. Chromosomes were counterstained with a mixture of DAPI and propidium iodide. (A) Chromosome 16. (B) Chromosome 9. (C) Chromosome 17. (D) CenP-B box primer (labels all centromeres).
transfer from water bath to water bath leads to high backgrounds. The most suitable purpose-built products are the OmniGene In Situ and OmniSlide made by Hybaid (Teddington, Middlesex, UK), which hold 4 and 20 slides, respectively. 4. As an alternative, complete systems for chromosome identification by PRINS are becoming available (e.g., Advanced Biotechnologies, Leatherhead, England). 5. Cell suspensions may be stored in fix (methanol:acetic acid [3: 11) at -20°C for several months. Slides are prepared fresh each week by gently centrifuging the suspension to precipitate the cells, resuspending in fresh fix, repeating this process, and finally resuspending in sufficient fix to give a suitable density and putting one drop on a clean slide, which is allowed to dry at room temperature. The balance of the suspension may then be diluted suitably with fix and returned to -2O’C. Using slides more than l-2 wk old can be successful, but may lead to reduced sensitivity and greater variability. 6. The majority of chromosome-specific alphoid sequences produce adequate signal with a single primer at a concentration of 250 ng/50 l.tL reaction. In some
Go&en and Lawson cases, a clearer signal with less background may be produced with paired pnmers, at the same concentration, whereas in others, the concentration of primer may be reduced, with a concomitant reduction in crossreaction to related chromosomal sequences. 7. Slides that have been labeled directly with fluorochromes may still be held m this solution overnight if convenient, but should be kept in the dark to prevent bleaching and fading of the label.
References 1. Koch, J E., Kolvraa, S., Petersen, K. B., Gregersen, N., and Bolund, I (1989) Oligonucleotide-priming methods for the chromosome-specific labelling of alpha satellite DNA in situ. Chromosoma 98,259-265 2. Gosden, J., Hanratty, D., Starling, J., Fantes, J , Mitchell, A., and Porteous, D. (199 1) Oligonucleotide primed in situ DNA synthesis (PRINS): a method for chromosome mapping, banding and investigation of sequence organization. Cytogenet CeEZGenet. 57, 100-l 04. 3. Gosden, J. and Lawson, D. (1994) Rapid chromosome identification by ohgonucleotide primed in situ DNA synthesis (PRINS). Hum. A401 Genet. 3,93 l-946. 4 Gosden, J and Lawson, D. (1995) Instant PRINS: a rapid method for chromosome identification by detecting repeated sequences in situ. Cytogenet Cell Genet. 68,57-60. 5. Hindkjaer, J., Koch, J., Terkelsen, C., Brandt, C. A., Kolvraa, S., and Bolund, L. (1994) Fast, sensitive multicolour detection of nucleic acids by primed in situ labelling (PRINS). Cytogenet. Cell Genet. 66, 152-l 54. 6. Speel, E. J. M., Lawson, D., Hopman, A. H. N., and Gosden, J. (1995) MultiPRINS: multiple sequential oligonucleotide primed in situ DNA synthesis reactions label specific chromosomes and produce bands. Hum. Genet. 95,29-33. 7. Spowart, G. (1994) Mitotic metaphase chromosome preparation from peripheral blood for high resolution, in Methods in Molecular Biology, vol 29. Chromosome Analyszs Protocols (Gosden, J. R., ed.), Humana, Totowa, NJ, pp. l-10. 8. Fletcher, J. (1994) Immortalized cells lines: chromosome preparation and bmding, in Methods in Molecular Bzology, vol. 29: Chromosome Analyszs Protocols (Gosden, J. R., ed.), Humana, Totowa, NJ, pp. 51-57. 9. Warburton, P. E., Haaf, T., Gosden, J., Lawson, D , and Willard, H. F. (1996) Characterization of a chromosome-specific chimpanzee alpha satellite subset: evolutionary relationship to subsets on human chromosomes. Genomlcs 33,220-228
Chromosome-Specific Jean-Paul
PRINS
Charlieu and Franck Pellestor
1. Introduction The identification of mdlvidual chromosomes IS of great Importance in cytogenetics, in order to detect aneuploidies or chromosomal rearrangements associated with genetic diseases. This can be achieved by several techniques based either on the intrinsic staining properties of the chromosomes in producing bands (the banding pattern being specific for each pair of chromosomes) (1) or the use of a DNA probe to detect specifically a region of the chromosome by fluorescence in sztuhybridization (FISH) (2). The use of centromeric a satellite sequences as FISH probes is very popular because of the specificity of these sequences. cz Satellite (or alphoid) DNA 1s a family of tandemly repeated sequences present at the centromere of all human chromosomes (3). Subfamilies, some of them specific for one or a small group of chromosomes, can be identified within alphoid DNA both by the periodic distribution of restriction sites and the nucleotide sequence of the 171-bp basic motif (4). These chromosome-specific subfamilies can therefore be used as FISH probes. This approach is limited, however, since the DNA sequencesof some subfamilies are very close to each other, and crosshybridization can occur between the centromeric sequences of several pairs of chromosomes. This is the case with chromosomes 13 and 2 1, for example, which share 99.7% homology in their alphoid sequences (5,. The development of the primed in situ (PRINS) technique of labeling DNA (68) introduced a solution to this problem. The PRINS procedure consists of the use of a small oligonucleotide (usually 18-22 nucleotides) from the sequence of interest as a primer. The primer is annealed to the denatured DNA of a chromosome or cell preparation. An in situ DNA synthesis reaction is performed with the incorporation of a labeled precursor (biotindUTP or digoxygenin-dUTP), using a thermostable DNA polymerase. A single From
Methods m Molecular B/otogy, Vol 71 PRlNS and In S~tu PCR Protocols Edlted by. J R Gosden Humana Press Inc., Totowa, NJ
7
8
Charlieu and Pellestor
base mismatch between the target and the probe will produce a less stable hybrid when using a primer than for a long FISH probe. In addition, if the mismatching nucleotide is located at the 3’-end of the PRINS primer, it will prevent any elongation by the DNA polymerase. We have developed several chromosome-specific a-satellite primers for PRINS, each of them carrying at least a chromosome-specific nucleotide at its 3’-end, and we describe in this chapter the use of two of them for the detection of human chromosomes 13 and 21. Other primers are available in the literature (9,ZO) or on request, but we are presenting only the conditions of use for the two most difficult, differing only at one position. 2. Material
2.1. Slides 1. Chromosome spreads are prepared from peripheral blood usmg standard methods (fixation in methanol:acetic acrd 3: 1). 2. 20X SSC: 3M NaCl, 0.3M Nas-citrate (can be stored for several months at room temperature). 3. 70,90, and 100% ethanol. 4. Formamrde (Prolabo, Paris, France): Formamide must be deionized by mixing with Amberlite resm (Sigma, St. Louis, MO), allowing to stand for at least 1 h, and then filtering. Deionized formamide is stored at +4”C.
2.2. PRIM Reaction 1. Primers: Synthetic oligonucleotides are used as primers m the PRINS experiments. Their nucleotide sequences are as follows (11): 13A (chromosome 13): 5’-TGATGTGTGTACCCAGCT-3’ 21A (chromosome 21): 5’-TGATGTGTGTACCCAGCC-3’ Precipitate the primers by adding 10 vol of 1-butanol, vortex, and centrifuge for 1 mm at maximum speed in a bench-top microfuge. Dry the pellets under vacuum, and resuspend in 5 miV Tris-HCl, pH 8.0, to obtain a 50 @4 (50 pmol/pL) solu-
tion. Store small aliquots (50 pL) at -2OT (seeNotes 1 and 2). 2. 2’-Deoxyadenosine
5’-triphosphate
(dATP) (Boehringer
Mannheim,
Meylan,
France): Resuspendin Hz0 to obtain a 100-M stocksolution (store at -2O’C). 3. 2’-Deoxycytosine 5’-triphosphate (dCTP) (Boehringer Mannheim):
Resuspend to
obtain a 100~mMstock solution (-2O’C). 4. 2’-Deoxyguanosine
5’-triphosphate (dGTP) (Boehringer Mannheim):
Resuspend
to obtain a 100~mMstocksolution (-2OT). 5. 2’-Deoxythymidine 5’-triphosphate (dTTP) (Boehringer Mannheim): to obtain a 100-n&f stock solution (-20°C). 6. Biotin-l&dUTP, 1 mM (Boehringer Mannheim) (-2O’C). 7. Glycerol 87% (Prolabo). 8. Tuq DNA polymerase (Boehringer Mannhetm). Store at -2O’C 9. 10X Taq buffer (provided with the enzyme) (-2O’C).
Resuspend
Chromosome-Specific PRIM
9
10. Stop buffer: 500 n&f NaCl, 50 mM EDTA, pH 8.0 (can be stored at room temperature for several months). 11. Sterile, deionized, double-distilled water. 12. Water bath at 60°C. 13. Water bath at 72°C. 14. 1.5~mL microcentrifuge tubes (sterilized by autoclaving). 15. Coverslips (22 x 40). 16. Thermal cycling machine equipped with a flat block (e.g., Techne PHC3).
2.3. Detection 1. 2. 3. 4. 5. 6. 7.
Washing solution: 4X SSC, 0.05% Tween 20. Blocking solution: washing buffer plus 5% nonfat dry milk. Make fresh each time. Fluorescein-avidin DCS (FITC-avidin) (Vector Laboratories, Burlingame, CA). Propidium iodide (PI) (Sigma). Antifade solution Vectashield (Vector Labs). Staining Jars. Microscope equipped for detection of FITC and PI fluorescence
3. Methods 3.1. Slides 1. Store slides prepared according to standard methods at room temperature for 5 d before use. 2. Just before the PRINS reaction, dehydrate the slides by passage through an ethanol series (70,90, 100%) at room temperature, 3 min each step, and air-dry. 3. Denature the chromosomal DNA on the slides by immersing them in 70% formamide, 2X SSC, at 72°C for 2 min, dehydrating through an ice-cold ethanol series (70,90, lOO%), and an-drying (see Note 3).
3.2. PRINS Reaction 1. Prepare a 10X dNTPs mix: Dilute the stock solutions (100 r&f) of dATP, dCTP, dGTP, and dTTP l/l 0 in sterile, distilled water. In a sterile microcentrifuge tube, mix 10 & of each diluted dATP, dCTP, and dGTP, 0.25 pL of diluted dTTP, 25 pL of 1 m&f biotin-16 dUTP, and 55 pL of glycerol. Mix well and store at -2O’C. 2. Prepare the PRINS reaction mix in a sterile 1.5~mL microtube by mixing (for each slide) 4 pL of primer (200 pmol), 5 pL of 10X Tag polymerase buffer, 5 pL of 10X dNTPs mix (from step l), and 0.5 pL of Taq polymerase (2.5 U), and add sterile distilled water to a final volume of 50 pL. 3. Preheat the reaction mix at 60°C in a water bath. 4. Place the slide (prepared as in Section 3.1.) and a coverslip on the plate of the thermal cycler. 5. Set up the program for PRINS: 12 min at the annealing temperature (60°C for primer 13A, 61°C for primer 21A; see Note 4) and 30 min at 72’C. 6. When starting the program, heat the slide(s) and the coverslip at the annealing temperature for 5 min. Then put the reaction mix onto the slide and cover
Char-lieu and Pellestor
10
by the coverslip. Incubate the slide at the annealing temperature for a further 7 min; the temperature is automatically raised to 72°C at the beginning of the elongation step. 7. At the end of the elongation time, transfer the slide to 100 mL of preheated stop buffer (72°C) for 3 min to stop the PRlNS reaction and to remove the coverslip. Then transfer the slide to 100 mL of washing solution. The shdes can stay m thus buffer overnight at 4°C if convenient
3.3. Detection 1. Wash the slides twice for 3 min at room temperature in washing solution, with gentle agitation. 2. Drain the excess washing solution and apply 100 pL of blocking solution to each slide 3. Incubate for 10 min at room temperature under a coverslip. 4. Remove the covershp, dram excess fluid, and apply 100 pL of FITC-avldin diluted to 5 pg/mL in blocking solution to the slide. Cover with a new coverslip and incubate at 37°C for 30 min in a moist chamber. 5. Remove the coverslip and wash the slide three times (5 mm each) m washmg solution, at room temperature, with gentle agitation. 6 Drain excess fluid and mount the slide (22 x 40 coverslip) with Vectashleld antifade solution containing 0.5 l.tglmL propidium iodide. 7 Examine the shde by fluorescence microscopy (Fig. 1).
4. Notes 1. Chromosome-spectfic primers sometimes differ from each other by only one nucleotide at the 3’-end, as for the primers described here. It is therefore advtsable to purify the primers by HPLC to avoid contammation by shorter products am+ mg from premature stops during syntheses.Storage of the primers in small aliquots also prevents degradation of the primers by repeated cycles of freeze-thawing. 2. The concentration of the primers can be determined by using the Beer-Lambert equation: c = A26d%mi
xL
(1)
where C is the concentration (M), A260 is the absorbance at 260 nm, E,,,~~is the molar extinction coefficient (M-l), and L is the path length (cm) of the spectrophotometer cuvet. The molar extinction coefficient for an oligonucleottde can be determined as follows: &max= (number of A x 15,200) + (number of C x 7050) + (number of G x 12,010) + (number of T x 8400) M-l
(2)
3. We describe here formamide denaturation, which gave more consistent results in our hands, but it is also possible to denature the chromosomes by heating the slide at 95“C for 3 min as part of the thermal cycle. In this case, omit step 3 of Section 3.1.) and run the following program on the PCR machine: 95°C for 3 min,
Chromosome-Specific
PRINS
11
Fig. 1. PRINS detection of chromosomes 13 (A) and 21 (B). The detection was performed according to the protocol described in the text. The chromosomes were counterstained with propidium iodide. Arrows indicate the chromosome-specific signals. annealing temperature for 7 min, and 72°C for 30 min. The preheated reaction mix is added after the initial denaturation step. 4. The annealing temperature was determined empirically for each primer, and those described here were found to give specific labeling in our hands with our PCR machine and in our laboratory. However, slight adjustments may be necessary if these primers are to be used in other laboratories, since each PCR machine may have a different thermal response curve. The conditions described here must therefore be taken as indications only, and not as absolute rules. When testing new PRTNS primers, a good start for the annealing temperature is 5°C under the empirically determined melting temperature (T’,) of the primer: 4°C x (G + C) +
12
Charlieu and Pellestor 2°C x (A + T). The annealing temperature is then modified according to the signal and/or the specificity obtained.
References 1, Sumner, A. T. (1994) Chromosome banding and identification: absorption stainmg, m Methods in Molecular Bzology, vol. 29, Chromosome Analysis Protocols (Gosden, J. R., ea.), Humana, Totowa, NJ, pp. 5%81. 2. Lichter, P. and Ried, T. (1994) Molecular analysis of chromosome aberrations: in situ hybridization, in Methods in Molecular Biology, vol. 29, Chromosome Analyszs Protocols (Gosden, 3. R., ed.), Humana, Totowa, NJ, pp. 449-478. 3. Choo, K. H,, Vissel, B., Nagy, A., Earle, E., and Kalitsis, P. (1991) A survey of the genomic distribution of alpha satellite DNA on all the human chromosomes, and derivation of a new consensus sequence. Nuclezc Aczds Res. 19, 1179-I 182. 4. Willard, H. F. and Waye, J. S. (1987) Hierarchical order in chromosome-specific human alpha satellite DNA. Trends Genet. 3, 192-198. 5, Jorgensen, A. L., Bostock, C. J., and Bak, A. L. (1987) Homologous subfamilies of human alphoid repetitive DNA on different nucleolus organizing chromosomes Proc. Natl. Acad. Scz. USA 84, 1075-1079. 6. Koch, J. E., Kolvraa, S., Petersen, K. B., Gregersen, N., and Bolund, L. (1989) Oligonucleotide-priming methods for the chromosome-specific labelling of alpha satellite DNA in situ. Chromosoma 98,259-265. 7. Gosden, J. and Lawson, D. (1994) Rapid chromosome identification by oligonucleotide-primed in situ DNA synthesis (PRINS). Hum. Mol. Genet. 3,93 l-936. 8. Pellestor, F., Girardet, A., Lefort, G., Andrea, B., and Charlieu, J.-P. (1995) Rapid in situ detection of chromosome 2 1 by PRINS technique. Am. J. Med. Genet. 56, 393-397.
9. Pellestor, F., Girardet, A., Andrea, B., Lefort, G., and Charlieu, J.-P. (1994) The use of PRINS technique for a rapid in situ detection of chromosomes 13, 16, 18, 21, X and Y. Hum. Genet. 95,12-17. 10. Pellestor, F., Girardet, A., Lefort, G., And&o, B., and Charlieu, J.-P. (1995) Selection of chromosome specific primers and their use in simple and double PRINS technique for rapid in situ identification of human chromosomes. Cytogenet. Cell. Genet. 70, 138-142 11. Charlieu, J.-P., Murgue, B., Marcais, B., Bellis, M., and Roizes, G. (1992) Discrimination between alpha satellite DNA sequences from chromosomes 21 and 13 by using polymerase chain reaction, Genomics 14,5 15,5 16.
3 Bright-Field Microscopic Detection of Oligonucleotide PRINS-Labeled DNA in Chromosome Preparations Ernst J. M. Speel, Diane Lawson, Frans C. S. Ramaekers, John R. Gosden, and Anton H. N. Hopman 1. Introduction Primed dn situ (PRINS) labeling has become an alternative to in situ hybridization (ISH) for the localization of nucleic acid sequences m cell (I-4) and tissuepreparations (5; seealso Chapter 5). In the PRINS method, an unlabeled primer (restriction fragment, PCR product, or oligonucleotide) is annealed to its complementary target sequencein situ. The primer serves as an initiation site for in situ chain elongation using a thermostable DNA polymerase and labeled nucleotides, which can be detected directly by fluorescence microscopy, such as fluorochrome-labeled dNTPs, or indirectly using, e.g., biotin- or digoxigenin-dUTP and the application of fluorochrome-conjugated avidin or antibody molecules (3,6,7). The detection limit of the PRINS technique appears to be on the order of low-copy sequences (3,8’. Recently, multiple-target PRINS approaches were reported using sequential PRINS reactions with differently modified nucleotides combined with fluorescence detection (6,7,9). For the simultaneous identification of more than two DNA sequences, however, DNA counterstaining or chromosome banding is in principle not possible, since the available fluorescence colors are utilized for specific target detection. Here we describe a bright-field microscopic procedure for the simultaneous detection of up to three different PRINS-labeled DNA target sequences in contrasting colors in both interphase and metaphase cells (Fig. lA,B). DNA sequences were detected by the precipitates of the horseradish peroxidasediaminobenzidine (PO-DAB, brown color), alkaline phosphatase-fast red From Methods m Molecular Biology, Vol 71 PRINS and In Situ PCR Protocols Edited by* J. R Gosden Humana Press Inc , Totowa, NJ
13
Speel et al.
Fig. 1. (see color plate number 2 after p. 82) (A) Bright-field detection of chromosome 9 and 7 centromeres with biotin/PO-DAB (brown) and digoxigenin/APase-fast red (red), respectively, in a human lymphocyte metaphase spread after double-target PRINS, hematoxylin counterstaining and PBS/glycerol (1:9) embedding. (B) Brightfield detection of chromosome 9,7, and Y centromeres with biotin/PO-DAB (brown), digoxigenin/APase-fast red (red), and fluorescein/PO-TMB (green), respectively, in a human lymphocyte metaphase spread after triple-target PRINS, hematoxylin counterstaining and BSA/formaldehyde embedding.
(APase-fast red, red color), and horseradish peroxidase-tetramethylbenzidine (PO-TMB, green color). Chromosomes and nuclei were counterstained with hematoxylin before bright-field microscopical visualization. Such an approach, which had been first described for ISH (IO), has the advantage that no fluorescence microscope with a confocal system or CCD camera for image analysis and processing is required. Furthermore, no fading of the in situ enzyme precipitation products occurs since they are permanently localized. 2. Materials 2.1. PRINS
DNA Labeling
1. Ultrapure dNTP set (Pharmacia, Uppsala, Sweden): 100 mJ4 solutions of dATP, dCTP, dGTP, and dTTP. 2. Ultrapure ddNTP set (Pharmacia): 5-W solutions of ddATP, ddCTP, ddGTP, and ddTTP. 3. Biotin- 16-dUTP, digoxigenin- 1 I-dUTP, and fluorescein- 12-dUTP (Boehringer, Mannheim, Germany). 4. Oligonucleotide primer (see Table 1) at 250 ng/pL. 5. Tuq DNA polymerase (Boehringer) or AmpliTaq (Perkin Elmer, Chalfont St. Giles, UK). 6. Klenow DNA polymerase (Boehringer). 7. Formamide (Fluka, Bornem, Belgium). 8. 20X SSC: 3MNaC1, 300 m&I trisodium citrate, pH 7.0.
Bright- Field Microscopic Detection Table 1 Sequences of Oligonucleotide Name E528 G33 G35 D600
Primers Used in PRINS
Human origin Chromosome Chromosome Chromosome Chromosome
15
Sequence
7 centromere 9 centromere 11 centromere Y centromere
AGCGATTTGAGGACAATTGC AATCAACCCGAGTGCAATC GAGGGTTTCAGAGCTGCTC TCCATTCGATTCCATTTTTTT CGAGAA
9. 10X Taq buffer: 500 mMKC1, 100 mMTns-HCl, pH 8.3, 15 mMMgC12, 0.1% bovine serum albumin (BSA) (Sigma, St. Louis, MO). 10. 10X Klenow buffer: 500 mMTris-HCl, pH 7.2,lOO mMMgS04, 100 mMDTT, 1.5 mg/mL BSA. 11. PRINS stop buffer: 500 mMNaC1,50 rnJ4 EDTA, pH 8 0. 12. Washing buffer: 4X SSC (diluted from 20X SSC), 0.05% Triton X-100. 13. Ethanol/37% HCl (100. 1)-cleaned microscope slides and coverslips 14. Rubber cement. 15. Water bath at 65’C. 16. Thermal cycler (Hybaid Ommgene Flatbed) (Hybaid, Teddington, UK). 17. Humid chamber. 18. Incubator at 37°C.
2.2. ~fnzyme Cytochemicel 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19.
Detection
Dried skimmed milk powder. Normal goat serum (NGS). Horseradish peroxidase-conjugated avidin (AvPO) (Dako, Glostrup, Denmark). Mouse antidigoxm (MADig) (Sigma). Alkaline phosphatase-conjugated goat antimouse IgG (GAMAPase) (Dako). Rabbit anti-FITC (RAFITC) (Dako). Horseradish peroxidase-conjugated swine antirabbit IgG (SWARPO) (Dako). Peroxidase (PO) inactivation solution: O.OlN HCI. 30% H202 (Merck, Darmstadt, Germany). Diaminobenzidine (DAB) (Sigma). 3,3’,5,5’-Tetramethylbenzidine (TMB) (Sigma). Dioctyl sodium sulfosuccinate (DSSS) (Sigma). Sodium tungstate (Sigma). Naphthol-ASMX-phosphate (Sigma). Fast red TR (Sigma). Polyvinylalcohol (PVA), mol wt 40,000 (Sigma) Nitro blue tetrazolium salt (NBT) (Boehrmger). 5-Bromo-4-chloro-3-indolyl phosphate (BCIP) (Boehringer). PO-DAB buffer: O.lM imidazole (Merck) in PBS, pH 7.6.
76
Speel et al.
20. PO-TMB buffer: 100 & citrate-phosphate buffer, pH 5.1. 21 APase buffer: 0 2MTns-HCl, pH 8.5, 10 mMMgCl*, 5% PVA. 22. Hematoxylin: Hematoxylin (Solution Gill no. 3) (Slgma):distrlled water (1:4). 23. Immersion oil (Zeiss). 24. BSA (Sigma). 25. Formaldehyde 37% (Merck). 26. Blockmg buffer: 4X SSC (diluted from stock 20X SSC), 0.05% Triton X-100, 5% skimmed milk powder. 27 Washing buffers: 4X SSC, 0.05% Triton X-100; PBS, 0.05% Triton X-100. 28 Incubator at 37’C. 29 Bright-field microscope (Zeiss Axtophot). 30. Kodak Color Gold 100 ASA film. 3 1 Blue and magenta filters
3. Methods 3.7. PRINS DNA Synthesis 1. Metaphase chromosomes are freshly prepared from peripheral blood lymphocytes by standard methods, fixed in methanol:acetic acid (3:1), and spread on acid/alcohol cleaned slides (see Note 1). 2. Slides are passed through an alcohol series (70,90, and lOO%, 2 min each), which helps m preserving chromosome morphology, and air-dried. 3. Chromosomal DNA 1sdenatured m 70% formamide, 2X SSC, pH 7.0, for 2 mm at 7O”C, followed by dehydration of the slides with 70% ethanol at 4”C, 90 and 100% ethanol, and an-drying. 4 The concentration of the appropriate oligonucleotide resulting in positive signals needs to be determined by experiment. Generally, 250 rig/slide m 40 pL IS used for primers of 16-30 bases complementary to repeated sequences. 5. The PRMS reaction mix is made up on ice as follows: Dilute 100 mM dATP, dGTP, and dCTP 1: 10 with distilled water Dilute 100 mM dTTP 1: 100. Put together in a microcentrifuge tube: 1 u,L of each of the diluted dNTPs, 1 pL of either 1 nnl4 biotm- 16-dUTP, digoxigenin-1 1-dUTP, or fluorescein- 12-dUTP (see Note 2), 5 $ of 10X Tuq buffer, 250 ng of oligonucleotide, 1 U Taq polymerase, and distilled water to 50 $. 6. Place 40 pL of this mixture under a coverslip on the slide, seal with rubber cement, an-dry the rubber cement, and transfer to the heating block of the thermal cycler. 7. Each PRINS reaction cycle consists of 5 min at the appropriate annealing temperature (see Note 3) and 15 min at 72°C for in situ primer extension. 8. Stop the PRINS reaction by transferring the slides (after removal of the rubber solution seal) to 50 mL of PRINS stop buffer in a Coplin jar at 65OC for 1 min. 9. For sequential PRINS reactions, it was found essential to prevent free 3’-ends of the newly synthesized DNA from being used as primers for subsequent reactions. This can be achieved by incubatmg the slides with Klenow DNA polymerase together with ddNTPs. The reaction mix is made up as follows: Dilute 5 mM of all four ddNTPs 1: 10 with distilled water. Put together in a microcentrifuge tube
Bright- Field Microscopic Detection
17
Table 2 Enzyme Cytochemical Detection Systems That Can Be Used for PRINS-Labeled DNAa Detection Label
1st layer
2nd layer
Biotin Biotin
Avidin-Eb Avidin-E
HaptenC Hapten Hapten
Antihapten Ab-E Moused antihapten Ab Mouse antihapten Ab
Hapten
Mouse antihapten Ab
Hapten
Mouse antihapten Ab
Brotin-labeled antiavidin Ab Antimouse Ab-E Rabbit antimouse Ab-E Biotin-labeled antimouse Ab Drgoxigenin-labeled antimouse Ab
3rd layer Avidm-E
Antirabbit Ab-E ABC Anti-digoxigenin Ab-E
aFurther amplification of PRINS signals may be achieved by combining these detection systems with peroxrdase-mediated deposition of hapten- or fluorochrome-labeled tyramldes (1 I, 12) bAbbreviations.Ab, antibody;ABC, avidin biotmylatedenzyme(horseradish peroxidaseor alkalinephosphatase) complex;E, enzyme(horseradish peroxidaseor alkalinephosphatase). CHapten = biotm,digoxtgenm,FITC, or DNP. dAntihaptenantibodyratsedm anotherspecies(e.g., rabbit,goat,swine)canalsobe usedas primary antibody in PIUNS detection schemes.
2.5 @ of each of the ddNTPs, 5 pL of 10X Klenow buffer, 1 U Klenow DNA polymerase, and distilled water to 50 @,. 10. Place 40 & of this mixture under a coverslip on the slide, transfer to a humid chamber, and incubate for 1 h at 37°C in an incubator. 11. Dehydrate the slides as described in step 2 and au-dry before running the next PRINS reaction with another primer and different reporter. 12. Finally, transfer the slides to washing buffer at room temperature and wash for 5 min.
3.2. Enzyme Cytochemical
Detection
1. Place 40 l,tL of blocking buffer under a coverslip on the slide and leave for 5 min at room temperature to reduce background stammg in the detection procedures. 2. Dilute detection molecules as follows: Dilute avidin conjugates m blocking buffer and antibody conjugates in PBS, 0.05% Tnton X-100,2% NGS. 3 For single-target detection, incubate the slides for 30 mm at 37’C with the first detection layer (Table 2), and wash 2 x 5 min m the appropriate washmg buffer (4X SSC, 0.05% Triton X-100 for avidin, and PBS, 0.05% Triton X- 100 for antibody molecules). Repeat this step with the next detection layer until all incubations are complete.
Speel et al.
18 Table 3 Enzyme Cytochemical Reactions That Can Be Used for In Situ Nucleic Enzyme
Enzyme reagents
Acid Detectiona
Embedding
Absorption color
Reference Graham and Karnovsky, 1966 (13) Speel et al., 1994 (IO) Speel et al.,
POb
HZO, + DAB
Aqueous/ organic
Brown
PO
HZ02 + TMB
Organic
Green
APase
N-ASMX-P + fast red TR BCIP + NBT
Aqueous
Red
Aqueous
Blue/purple
APase
1992 (14)
McGadey, 1970 l1.5)
OOther enzyme reactlons that have been used for in SW nucleic acid detectlon are described elsewhere (12,16) bAbbrevlatlonsAPase,alkahnephosphatase, BCIP, 5-bromo-4-chloro-3-mdolyl phosphate; DAB, dlaminobenzldme; N-ASMX-P, naphthol-ASMX-phosphate; NBT, mtrobluetetrazohum, PO,horseradish peroxldase,TMB, tetramethylbenzldme 4 After the last detectionlayer, washsampleswith PBS for 5 min at room temperature
and visualize the DNA target by an appropriate enzyme reaction (see 5, and Table 3) 5. To detect multiple DNA targets labeled with different haptens, a combmatlon of enzyme cytochemlcal detection systems is chosen from Table 2. Smce the enzymes horseradish peroxidase (PO) and alkaline phosphatase (APase) can generate a number of differently colored precipitates (see Table 3), multiple DNA targets can be visualized simultaneously by suitable combmattons of enzyme
reactions. If the entire detection procedure uses more than one PO or APase reaction, the first applied enzyme can be inactivated after the first detection reaction by incubating the sample in O.OlM HCl for 10 min at room temperature. Then, the next detection system can be applied, followed by the appropriate enzyme reaction (Note 4). 6. As an example, a protocol for triple-target PRINS is outlined in Table 4 (Note 5). Protocols for bicolor detection of nucleic acid sequences in situ can be derived from this protocol or can be found elsewhere(Note 6) (10,17-21). 7. Visualize the PRINS-labeled DNA targets with one of the following
enzyme reactions (Note 7): a. PO-DAB reaction: Mix 1 mL 5 mg/mL DAB in PBS, 9 mL PO-DAB buffer, and 10 & 30% H202 just before use, and overlay each sample with 100 pL under a coverslip. Incubate the slides for 5-15 min at 37’C, wash 3 x 5 min with PBS, dehydrate (optionally), and coverslip with an aqueous or organic mounting medium b. PO-TMB reaction: Dissolve 100 mg sodium tungstate m 7.5 mL PO-TMB buffer and adjust the pH of this solution to 5.0-5.5 with 37% HCl. Just before
Bright-Field Microscopic Detection
19
Table 4 Enzyme Cytochemical Detectlon Protocol for Three Nucleic Acid Sequences In Situ, Labeled with PRINS Using Blotin-, Digoxigenin-, and FITC-Modified Nucleotides, Respectivelya Detection step 1. 2. 3. 4. 5.
6. 7.
8. 9. 10
Detect biotin with AvP@ (diluted 1:50) Visualize PO activity in brown (PO-DAB) as described in Section 3.2., step 7a Inactivate residual PO activity with O.OliVHCl Detect digoxigenm and FITC with MADig/RAFITC (both diluted 1:2000) Detect primary antibodies with GAMAPase/SWARPO (diluted 1:25 and 1:lOO) Visualize APase activity in red (APase-fast red) as described in Section 3 2., step 7c Visualize PO activity in green (PO-TMB) as described in Section 3.2., step 7b Counterstam with hematoxylin Air-dry Embed in a protein matrixC
Time 30 min 5 min
Temperature 37°C 37OC
10 min
Room temperature
30 mm
37Y!
30 min
37°C
5-10 min
37OC
1-2 min
37°C
1s 10 min 10 min
Room temperature Room temperature 37OC
OFor details of detection systems, see Table 2. bAbbreviations used: APase, alkaline phosphatase; AvPO, PO-conjugated avidm; DAB, diaminobenzidine; GAMAPase, APase-conlugated goat antrmouse IgG; MADig, mouse antidigoxin; PO, horseradish peroxtdase; RAFITC, rabbit anti-FITC IgG, SWARPO, PO-conjugated swine an&rabbit IgG cFor details of the protein matrrx, see Section 3.2., step 9.
use, dissolve 20 mg DSSS and 6 mg TMB in 2.5 mL 100% ethanol at 80°C. Mix both solutions, add 10 pL HzOz, and overlay each sample with 100 pL under a coverslip. Incubate the slides for l-2 min at 37Y!, wash 3 x 1 min with ice-cold 0. 1Mphosphate buffer, pH 6.0, dehydrate (optionally), and coverslip with an organic mounting medium or immersion oil. c. APase-fast red reaction: Mix 4 mL APase buffer, 1 mg naphthol-ASMX-phosphate in 250 pL buffer without PVA, and 5 mg fast red TR m 750 Ccs,buffer without PVA just before use, and overlay each sample with 100 pL under a coverslip. Incubate the slides for 5-15 min at 37”C, wash 3 x 5 min with PBS, and coverslip with an aqueous mounting medium (Note 8). d. Alkaline phosphatase-NBT/BCIP reaction: Dissolve 1.8 mg BCIP in 100 @., N,N-dimethylformamide and 3.3 mg NBT in 660 & distilled water and add
20
Speel et al.
subsequently to 9.24 mL APase buffer. Overlay each sample with 100 pL under a coverslip. Incubate the slides for 15-60 min at 37”C, wash 3 x S min with PBS, and coverslip with an aqueous mounting medium (Note 8). 8. Aher all enzyme reactions have been performed, counterstain the samples with hematoxylin, wash 1 x S min m tap water and 1 x 2 min in distilled water, and air-dry if you wish. 9 Mount single-target PRINS samples in the embedding medium required for the used enzyme precipitate, as outlined in steps 7a-d and Table 3. Mount multiple-target PRINS samples m the embedding medmm required for the used enzyme precipitates, unless they need different mounting. In that case, apply a protein embedding layer by smearmg 50 pL of a mixture of 40 mg/mL BSA m distilled water and 4% formaldehyde onto the slides. Air-dry for 10 min at 37°C (Note 9) 10. Examine slides under a bright-field microscope. Microphotographs can be made usmg blue and magenta filters and Kodak 100 ASA film.
4. Notes 1. Slides should be used within a week of preparation and stored in a vacuum deslccator until use. Cell suspensions can be stored for up to 3 mo at -20°C. 2. In the case of labeling with biotin- 1QdUTP or fluorescem-12-dUTP, a four times decrease of the concentration of dTTP in the PRINS reaction mix resulted m significantly stronger labeling of DNA sequences. Under the described standard conditions, digoxigenin-1 l-dUTP provides the highest sensitivity. However, all the modified nucleotides are suited for detection of repeated sequences zn sm. 3. The optimum primer annealing temperature is only determined empirically. We usually try a series from 45 to 7O”C, in 5°C steps. 4. Enzyme inactivation by an incubation with O.OlMHCl has no demonstrably negative effect on the stability of the synthesized DNA and its incorporated reporters (blotin, digoxigenin, FITC). 5. If multiple enzyme reactions are utilized, the PO-TMB reaction must always be performed last, since the resulting precipitate proved to be unstable in aqueous solutions with a pH above 6.0 (e.g., distilled water and PBS). 6. In case of enzyme activity detection after application of a PO and APase conjugate, the APase reaction must always be performed first to prevent inactivation of APase during the PO reaction. 7. It is recommended to follow every enzyme reaction under the microscope to ensure discrete localization of the in sztu signals. 8. Do not dehydrate the slides after the APase reaction, since the precipitate dissolves (partially) in organic solvents. Optionally, you may air-dry the slides after rinsing in distilled water. 9. Embedding in a protein layer is essential to prevent dissolving of the enzyme reaction product in an aqueous or organic mounting medium, or in immersion oil. In this way, it ensures stabilization of the enzyme precipitates and, in addition, optimal visualization of color contrast.
Bright- Field Microscopic Detection
21
References 1. Bains, M. A., Agarwal, R., Pringle, J. H., Hutchinson, R. M., and Lauder, I. (1993) Flow cytometric quantitation of sequence-specific mRNA in hemapoietic cell suspensions by pnmer-induced in situ (PRINS) fluorescent nucleotide labeling. Exp. Ceil Res 208,321-326 2. Koch, J., Mogensen, J., Pedersen, S., Fischer, H., Hmdkjmr, S., Kolvraa, S., and Bolund, L. (1992) Fast one-step procedure for the detection of nucleic acids in situ by primer-induced sequence-specific labelmg with fluorescein-12-dUTP. Cytogenet. Cell Genet. 60, l-3. 3. Gosden, J. and Lawson, D. (1994) Rapid chromosome identificatron by oligonucleotide-primed in s~tu DNA synthesis (PRINS). Hum Mol. Genet 3,93 l-936. 4. Pellestor, F., Girardet, A., Lefort, G., And&o, B., and Charlieu, J. P. (1995) PRINS as a method for rapid chromosomal labeling of human spermatozoa. Mel Reprod. Dev. 40,333-337. 5. Speel, E. J. M., Lawson, D., Ramaekers, F. C. S., Gosden, J. R., and Hopman, A. H. N. (1996) Raprd brightfield detection of oligonucleotide primed in situ (PRINS) labeled DNA m chromosome preparations and frozen tissue sections. Biotechniques 20,226234. 6. Hindkjmr, J., Koch, J , Terkelsen, C., Brandt, C. A., Kolvraa, S., and Bolund, L. (1994) Fast, sensitive multicolor detection of nucleic acids in situ by primed in situ labeling (PRINS). Cytogenet. Cell Genet. 66, 152-154. 7. Speel, E. J. M., Lawson, D., Hopman, A. H. N., and Gosden, J. (1995) MultiPRINS: multiple sequential oligonucleotide primed in situ DNA synthesis reactions label specific chromosomes and produce bands. Hum. Genet. 95,2!3-33. 8 Abbo, S., Dunford, R. P., Miller, T. E., Reader, S. M., and King, I. P. (1993) Primer-mediated in s&u detection of the B-hordem gene cluster on barley chromosome 1H Proc. Natl. Acad. Scz. USA 90, 11,821-l 1,824. 9. Volpi, E. V. and Baldini, A. (1993) MultiPRINS. a method for multicolor primed m situ labeling. Chromosome Res. 1,257-260. 10. Speel, E. J. M , Jansen, M. P. H. M., Ramaekers, F. C. S., and Hopman, A. H N. (1994) A novel triple-color detection procedure for brightfield microscopy, combinmg in situ hybridization with immunocytochemistry. J. Histochem Cytochem 42,1299-1307. 11. Bobrow, M. N., Harris, T. D., Shaughnessy, K. J., and Litt, G. J. (1989) Catalyzed reporter deposition, a novel method of signal amplification Amplrfication to immunoassays J Immunol Methods 125,279-285. 12. Speel, E. J. M., Ramaekers, F. C. S., and Hopman, A. H. N. (1995) Cytochemical detection systems form situ hybridization, and the combination wtth immunocytochemistry. Histomchem. J. 27,833-858. 13. Graham, R. C. and Karnovsky, M. J. (1966) The early stages of absorption of injected horseradish peroxidase in the proximal tissues of mouse kidney with structural cytochemistry by a new technique. J. Histochem. Cytochem. 14,291-302. 14. Speel, E J. M., Schutte, B., Wiegant, J., Ramaekers, F. C. S., and Hopman, A. H. N. (1992) A novel fluorescence detection method for m situ hybndtzation, based on the alkaline phosphatase-fast red reaction. J. Histochem. Cytochem. 40,1299-1308.
22
Speel et al.
15. McGadey, J. (1970) A tetrazolium method for non-specific alkaline phosphatase. Histochemistry 23, 180-l 84. 16. Speel, E. J. M., Kamps, M., Bonnet, J., Ramaekers, F. C. S., and Hopman, A. H. N. (1993) Multicolour preparations for in situ hybridization using precipitating enzyme cytochemistry in combination with reflection contrast microscopy. Histochemistry 100,357-366. 17. Hopman, A. H. N., Wiegant, J., Raap, A. K., Landegent, J. E., Van der Ploeg, M., and Van Duijn, P. (1986) B&color detection of two target DNAs by non-radioactive in situ hybridization. Histochemistry 85, l-4. 18. Emmerich, P., Loos, P., Jauch, A., Hopman, A. H. N., Wlegant, J., Higgins, M. J., White, B. N., Van der Ploeg, M., Cremer, C., and Cremer, T. (1989) Double in situ hybridization in combination with digital image analysis: a new approach to study interphase chromosome topography. Exp. Cell Res 181, 126-140 19. Herrington, C. S., Burns, J., Graham, A. K., Bhatt, B., and McGee, J. 0’. D (1989) Interphase cytogenetics using biotin and digoxygenin labeled probes II: simultaneous differential detection of human and papilloma virus nucleic acids in individual nuclei. J. Clin. Pathol. 42,601-606. 20. Mullink, H., Walboomers, J. M. M., Raap, A. K., and Meyer, C. J L. M. (1989) Two color DNA in situ hybridization for the detection of two viral genomes using non-radioactive probes. Histochemrstry 91, 195-198 21. Kerstens, H. M. J., Poddighe, P. J., and Hanselaar, A. G. J M. (1994) Doubletarget m situ hybridization in brightfield microscopy. J. Histochem. Cytochem 42, 1071-1077.
Analysis of Sperm Aneuploidy by PRINS Franck Pellestor and Jean-Paul Charlieu 1.
Introduction
The estimation of aneuploidy rate in human gametes is a subject of interest and research because nondisjunctions make a major contribution to the chromosomal abnormalities found in humans. Numerous questions remain concerning the occurrence and the etiology of such aneuploidy in gametes. Since human sperm is easier to obtain than mature human oocytes,most of the studies have focused on male gametes. In the last decade, direct information on the chromosomal constitution of human sperm has been obtained thanks to the introduction of the in vitro human sperm-hamster egg fertilization system, which allows the karyotyping of human sperm complements (I,2). This new experimental system has provided a direct method to investigate several points (distribution of nondisjunction, sex ratio, paternal age effect, relationship to infertility) and to determinate the meiotic segregation of chromosomal rearrangements (3,4). The method is time-consuming, labor-intensive, and of little profit in terms of sperm karyotypes obtained. Recently, several laboratories have adapted the interphase fluorescence in situ hybridization (FISH) technique to sperm in order to assessdirectly the incidence of disomy in human gametes (5,6). Aneuploidy has thus been estimated for several chromosomes usmg centromeric repeat probes. However, the use of centromeric probes presents some limitations because several human chromosomes share high levels of homology in their a-satellite DNA sequences, resulting in crosshybridization in FISH reactions (7). The most striking example concerns chromosomes 13 and 21 for which this homology reaches 99.3% (8). In addition, the FISH analysis of spermatozoa is hampered by the fact that the DNA in sperm heads is highly condensed and of difficult access. From: Methods fn Molecular Biology, Vol 71: PRINS and In Situ PCR Protocols Edited by J. R Gosden Humana Press Inc , Totowa, NJ
23
Pellestor and Charlieu
24
The primed in situ (PRINS) technique provides an alternative approach for direct chromosomal detection, Because of the high complementarity between the oligonucleotide primer and its genomic target, PRINS appears to be more efficient than FISH for discriminating between a-satellite DNA sequences.The limitation of the PRINS method for the analysis of nondisjunction in human sperm was initially that only one chromosome could be labeled. Thus, the distinction between diploidy and disomy could not be done by PRINS (9). The recent introduction of multicolor PRlNS protocols has allowed us to overcome this problem (10, II). We have adapted our protocol to human sperm. The efficiency of the method has also been improved by the use of a new sperm pretreatment protocol that permits the simultaneous decondensation and denaturation of sperm nuclei. In PRINS, the decondensation of the sperm head is a less limiting factor than in FISH (where the probes are 200-500 bases long) because of the small size of the oligonucleotide primers (18-30 nucleotides). This facilitates their penetration into sperm nuclei and their access to the genomic sequences, resulting in a more homogeneous and more rapid labeling of sperm nuclei (Fig. 1).
2. Materials 2.7. Preparation of Sperm Samples 1. Phosphate-bufferedsaline (PBS) (Gibco BRL,,Eragny, France). 2. Methanol, 99% (Prolabo, Paris, France). 3. Ethanol, 99% (Prolabo). 4. Glacial acetic acid (Prolabo). 5. 3MNaOH. 6. Clean microscope glass slides.
2.2. Dual-Color
PRINS Reaction
1, 2’-Deoxyadenosine
S-triphosphate
(dATP) 100 mkf (Boehringer
Mannheim,
Meylan, France). 2. 2’-Deoxycytosine5’-triphosphate(dCTP) 100mM(Boehringer Mannheim). 3. 2’-Deoxyguanosine 5’-triphosphate (dGTP) 100 n&f (Boehringer Mannheim) 4. 2’-Deoxythymidine 5’-triphosphate (dTTP) 100 & (Boehringer Mannhelm). 5. Labeled dUTP (1 n&I): Biotin-16-dUTP (Boehringer Mannheim), digoxrgenin11-dUTP (Boehringer Mannheim), fluorescein- 12-dUTP (Boehringer Mannheim), and tetramethylrhodamine-6-dUTP (Boehringer Mannheim). 6. 2’.3’-Dideoxy-adenosine-5’kphosphate (ddATP) 10 mM (Boehringer Mannhelm) 7. 2’.3’-Dideoxy-cytrdine-5’kphosphate (ddCTP) 10 mM(Boehringer Mannheim) 8. 2’.3’-Dideoxy-guanosine-5’-triphosphate (ddGTP) 10 mA4 (Boehringer Mannheim). 9. 2’.3’-Dideoxy-thymidine-5’-triphosphate (ddTTP) 10 mM(Boehrmger Mannheim). 10. Taq DNA polymerase (Boehringer Mannheim) (store at -20°C). Il. 10X Tuq buffer (Boehringer Mannheim) (store at -20°C).
Analysis of Sperm Aneuploidy
25
Fig. 1. (see color plate number 3 after p. 82) Examples of dual-color PRINS labeling of human sperm nuclei. (A,B) Normal haploid spermatozoa bearing distinctive green (chromosome 21) and red (chromosome 9) fluorescent spots. (C) PRINS labeling of a disomic sperm nuclei for chromosome 18. The a satellite DNA of the chromosome 18 is labeled with biotin and detected with fluorescein-avidin-DCS. The c1 satellite of the chromosome 12 is labeled with digoxigenin and detected with antidigoxigeninrhodamine. The arrow indicates a sperm nucleus showing two distinctive green fluorescein spots. (D) A diploid sperm (arrow) observed in a direct labeling PRJNS reaction performed with fluorescein-12-dUTP and rhodamine-6-dUTP for the detection of chromosomes 13 and 16, respectively. The marked nucleus shows two green and two red fluorescent signals. This nucleus is larger than normal haploid sperm nuclei. 12. 13. 14. 15. 16. 17. 18. 19. 20. 2 1.
Glycerol, 87% (Prolabo). Stop buffer: 500 mMNaC1,50 mMEDTA, pH 8.0 (store at 4’C). 20X SSC solution: 3MNaCl,0.3Mtrisodium citrate (store at 4°C). Washing buffer: 4X SSC, pH 7.0,0.05% Tween-20 (Boehringer Mannheim). Blocking buffer: Washing buffer plus 5% nonfat dry milk. Make fresh each time. 10X NT buffer: 500 mMTris-HCl, pH 7.2,50 mMMgS04, 0.1 mMdithiothreito1, 1 mg/mL BSA (store at 4’C). Klenow enzyme (Boehringer Mannheim) (store at -2O’C). Oligonucleotide primer at 50 pmol/$ (see Note 1 and Table 1). Deionized, double-distilled water. Water bath at 72°C.
Pellestor and Charlieu
26 Table 1 The Characteristics of the Oligonucleotide Name
Locus
Chromosome location
9c
a sat
9
12c
ci sat
12
13A
CLsat
13
16c
cxsat
16
18c
a sat
18
21A
a sat
21
22. 23. 24. 25.
Primers Used
Sequences 5’ TATCTGCAAGCG GACGTTTTA 3’ 5’ GTTCAATTCACA GAGTAT 3’ 5’ TGATGTGTGTAC CCAGCT 3’ 5’ TTCTTTTCATAC CGCATTCT 3’ 5’ ATGTGTGTCCTC AACTAAAG 3’ 5’ TGATGTGTGTAC CCAGCC 3’
Annealing temperature, T 51
Optimal concentration, PM 150
60
200
60
100
53
75
65
100
61
150
Water bath at the annealing temperature. 1.5~mL sterile microcentrifuge tubes. Coverslips (22 x 40 mm). PCR machine fitted with a flat plate block. Programs are given for the Techne PHC-3 and the Hybaid Omnigene.
2.3. Detection 1. 2. 3. 4. 5. 6. 7
Fluorescein-Avidin-DCS (Vector Labs, Burlingame, CA). Antidigoxigenin-rhodamine, Fab fragments (Boehringer Mannheim). Anttfade solution Vectashteld (Vector Labs). Propidium iodide (Sigma, St. Louis, MO). 4’, 6-Diamidine-2-phenylindole dihydrochlroride (DAPI) (Boehringer Mannheim). Staining jars. Microscope equipped with triple band pass filter (DAPI:FITC:rhodamine).
3. Methods
3.1. Preparation of Sperm Sample 1, Freshly ejaculated sperm sample is allowed to liquefy at room temperature for 30 min (see Note 2). 2. Dilute sperm 1:lO in PBS and centrifuge for 8 mm at 600g. 3. Resuspend the pellet in 1 mL of fixative (3:1, methanol:glacial acettc acid). 4. Fix 1 h at -2O’C. 5. Place in fresh fixative. 6. Drop the cell suspension on a clean microscope slide from a height of about 5 cm.
Analysis of Sperm Aneuploidy
27
7. The slide is air-dried and stored for l-5 d at room temperature before use for the PRINS reaction. 8. Immediately before the PRLNS reaction, the slide is denatured in 3MNaOH at room temperature for 3-l 1 min depending on its age (see Note 3). 9. Pass slide through ethanol series (70,90, lOO%), 3 min each step, and air-dry.
3.2. PRINS Reaction 3.2.1. First PRINS Reaction 1. Preparation of 10X dNTP mixtures: Dilute 100 mM dATP, dCTP, dGTP, and dTTP 1: 10 in drstilled water. In a microcentrifnge tube, put 10 pL of each diluted dATP, dCTP, and dGTP. Add 0.25 & of diluted dTTP, 25 pL of a l-n&f labeled dUTP, and 55 pL of glycerol 87%. Well mix and store at -20°C. 2. Make up the PRINS reaction mixture by mixing 200 pmol of the oligonucleotide primer, 5 pL 10X Tuq polymerase buffer, 5 pL 10X dNTP mixture (incorporating biotin- 16-dUTP or fluorescein- 12-dUTP), and 2.5 U of Taq DNA polymerase in a 1.5~nIL microcentrifuge tube. Add sterile, double-distilled water to a final volume of 50 pL. 3. Preheat the tube in a water bath at the annealing temperature. 4. Place the prepared slide and a coverslip on the plate block of the PCR machine. 5. Set program for the appropriate temperature. The program consists of two steps: a. Twelve minutes at the annealing temperature, specific to the primer used (see Note 4 and Table 1). The slide and the coverslip are heated alone for 5 min to get them to the annealing temperature. The PRTNS reaction mixture is then placed on the slide and covered with the coverslip. The slide is incubated for a further 7 min at the annealing temperature. b. Thirty minutes at 72’C for nucleotide chain elongation. At the beginning of this second step, the temperature is automatically raised to 72°C. 6. Transfer the slide quickly to 100 mL of preheated stop buffer at 72°C for 3 min to terminate the PRINS reaction.
3.2.2. Intermediate ddNTP Reaction 1. Transfer the slide to 50 mL. of 1X NT buffer at room temperature and wash twice for 5 min with gentle agitation. 2. ddNTP mixture: Mix equal amounts of the four 10 mMddNTPs. Add 1 pL of this stock solution to 199 pL of distilled water to make a 50 @4 ddNTP mixture. Store at -20°C. 3. Make up ddNTP reaction mixture by mixing 4 pL of 50 pA4ddNTP mixture, 4 pL. of 1OX NT buffer, 2 U of Klenow enzyme, and distilled water to a total of 40 pL, 4. Apply the ddNTP reaction mixture to the slide and incubate for 10 min at 37°C (or 30 min at room temperature). This intermediate reaction blocks the free 3’-ends of the first elongation fragment and so prevents mixing of labeling. 5. Wash in stop buffer for 3 min at room temperature. 6. Wash twice for 5 min in 1X NT buffer at room temperature.
28
Pellestor and Char-lieu
3.2.3. Second PRl/VS Reaction 1. In 1S-mL microcentrifugation tube, prepare the second PRINS reaction mixture, including a new primer specific for another chromosome and digoxlgemn- I 1-dUTP or rhodamine-6-dUTP (see Section 3.2.1.) step 2). 2. Prewarm this mixture at the annealing temperature specific for the new primer. 3. Drain excess fluid, and place the slide again on the plate block of the PCR machine. 4 Set program for the second PRINS reaction (see Section 3.2.1.) step 5). 5. Stop the reaction by immersing the slide in stop buffer at 72°C for 3 min.
3.2.4. Detection 1. Wash the slide twice for 3 min at room temperature in 4X SSC, 0.05% Tween-20 with gentle agitation. 2. Drain the slide and apply 100 pL of blockmg buffer. 3. Incubate for 10 min at room temperature under a coverslip. 4. Remove coverslip, drain excess fluid, and apply 100 pL of a 1: 1 mixture of avldin DCS-FITC (5 @nL) and antidigoxigenin-rhodamine (20 pg/rnL) in blockmg buffer to the slide. Place on a new coverslip and incubate for 30 min at 37’C in a moist chamber. 5. Remove the coverslip and wash the slide three times for 5 min in 4X SSC, 0.05% Tween-20 at room temperature with gentle agitation. 6. Drain excess fluid and mount in Vectashield antlfade solution contaming DAPI (0.25 &mL). In case of direct labeling (PRINS reactions performed with fluorescem- 12-dUTP and rhodamine-6-dUTP), omit steps 2-5. 7. Cover with a 22X 40-mm glass coverslip. 8. Examine the slide under UV fluorescence equipped with triple band pass filter (Fig. 1).
4. Notes 1. Primers are oligonucleotides, typically 18-30 bases long, specific for a-satellite DNA sequences of human chromosomes. They are identified by comparing the a-satellite DNA sequence of each chromosome to the consensus a-satellite DNA sequence of human chromosomes established by Choo et al. (12). The primer sequences are selected from the region with the most nucleotide divergences. They are generated on an Applied Biosystem DNA synthesizer (model 38 1A) according to the manufacturer’s instructions. Their sequences and the technical conditions are given in Table 1. For convenience, primers are diluted to 50 pmol/& and stored at -2OY. 2. The human semen sample is usually collected in a sterile container and is processed as soon as liquefaction has occurred. A normal sperm sample should liquefy within 30 min of collection at room temperature. The liquefaction may be hastened by incubating sperm samples at 37°C. 3. The use of a 3M NaOH solution allows the simultaneous decondensation and denaturation of sperm nuclei, with the possibility of a rapid control of the degree
Analysis of Sperm Aneuploidy
29
of nuclear decondensation under the microscope. The time of opttmal NaOH treatment depends on the age of the sperm preparation slides. The longer the slides were aged, the longer they need 3MNaOH treatment: 2 d old, 4 min; 4 d old, 6 min; 6 d old, 8 min; 8 d old, 11 min. Combined with PRINS, this method provides excellent results, i.e., homogeneous sperm decondensation and subsequently a high level of sperm labeling. 4. For each primer, the theoretical melting temperature is calculated, but optimal annealing temperatures must be determined empirically. Usually, efficient annealing temperatures are in the -5 to +5’C range around the theoretical melting temperature (Table 1).
1. Yanagimachi, R., Yanagimachi, H., and Rogers, B. J. (1976) The use of zona-free animal ova as a test system for the assessment of the fertilizing capacity of human spermatozoa. Biol Reprod. 15,471-476. 2. Rudak, E., Jacobs, P. A., and Yanagimachi, R. (1978) Direct analysis of the chromosome constitution of human spermatozoa. Nature 274,9 1 l-9 13. 3. Martin, R. H. and Rademaker, A. (1988) The relationship between sperm chromosomal abnormalities and sperm morphology in humans. Mut. Res. 207,159-l 64. 4. Pellestor, F., Sele, B., Jalbert, H., and Jalbert, P. (1989) Direct segregation analysis of reciprocal translocations: a study of 283 sperm karyotypes from four carriers. Am. J. Hum. Genet. 44,464-473. 5. Guttenbach, M., Schakowski, R., and S&mid, M. (1994) Incidence of chromosome 3, 7, 10, 11, 17 and X disomy in mature sperm nuclei as determined by non-radioactive in situ hybridization. Hum. Genet. 93,7-12. 6. Bischoff, F. Z., Nguyen, D. D., Burt, K. J., and Shaffer, L. G. (1994) Estimates of aneuploidy using multicolor fluorescence in situ hybridizatton on human sperm. Cytogenet. Cell. Genet. 66,237-243. 7. Lebo, R. V., Flandermeyer, R. R., Diukman, R., Lynch, E. D., Lepercq, J. A., and Golbus, M. S. (1992) Prenatal diagnosis with repetitive m situ hybridization probes. Am. J. Med. Genet. 43,848-854. 8. Willard, H. F. and Waye, J. S. (1987) Hierarchical order in chromosome specific human alpha satellite DNA. Trends Genet. 3, 192-198. 9. Pellestor, F., Girardet, A., Lefort, G., And&o, B., and Charlieu, J. P. (1995) PRINS as a method for rapid chromosomal labeling on human spermatozoa. Mol. Reprod. Dev. 40,333-337. 10. Gosden, J, and Lawson, D. (1994) Rapid chromosome identification by oligonucleotide-primed in situ DNA synthesis (PRMS). Hum. Mol. Genet. 3,93 l-936. 11. Hindkjaer, J., Koch, J., Terkelsen, C., Brandt, C!. A., Kolvraa, S., and Bolund, L. (1994) Fast, sensitive multicolor detection of nucleic acids in situ by primed in situ labeling (PRJNS). Cytogenet. Cell. Genet. 66, 152-154. 12. Choo, K. H., Vissel, B., Nagy, A., Earle, E., and Kalitsis, P. (1991) A survey of the genomic distribution of alpha satellite DNA on all the human chromosomes, and derivation of a new consensus sequence. Nucleic Acids Res 19,1179-l 182.
PRINS DNA Synthesis on Frozen Tissue Sections Ernst J. M. Speel, Diane Lawson, Frans C. S. Ramaekers, John R. Gosden, and Anton H. N. Hopman 1. Introduction Primed in situ (PRINS) labeling has become an alternative to in situ hybridization (ISH) for the localization of nucleic acid sequences in cell preparations (1-4). In the PRINS method, an unlabeled primer (restriction fragment, PCR product, or oligonucleotide) is annealed to its complementary target sequence in situ. The primer serves as an initiation site for in situ chain elongation using a thermostable DNA polymerase and labeled nucleotides, which can be detected directly by fluorescence microscopy, such as fluorochrome-labeled dNTPs, or indirectly using, e.g., biotin- or digoxigenin-dUTP and the application of fluorochrome-conjugated avidin or antibody molecules (3,5,6). The detection limit of the PRINS technique appears to be in the order of low-copy sequences (3,7). Here we describe an easy protocol for the application of the PRINS labeling reaction to frozen tissue sections (81. In this way, individual cells can be identified in their tissue context and be analyzed for their copy numbers of specific chromosome regions. Both tissue fixation and proteolytic digestion before performing the PRINS reaction proved to be the critical steps in the total procedure permitting access of the PRINS reactants, while preserving the morphology of the nuclei in the tissue. Such pretreatment steps have also been shown to be essential for efficient application of ISH to tissue sections (9, IO). Examples are shown of fluorescence and bright-field detection protocols for labeled DNA sequences m normal diploid tissue nuclei (Fig. lC-E). From. Methods in Molecular Biology, Vol. 71’ PRINS and In Situ PCR Protocols EdlIed by J R Gosden Humana Press Inc., Totowa, NJ
31
Fig. 1. (see color plate number 2 after p. 82) (C) Bright-field detection of chromosome 9 centromeres with biotin/PO-TMB in a frozen tissue section of normal colon epithelium after PRINS, hematoxylin counterstaining, and immersion oil embedding. (D) Brightfield detection of chromosome 9 centromeres with biotin/PO-DAB in a frozen tissue section of normal bladder epithelium after PRINS, hematoxylin counterstaining, and PBS/glycerol (1:9) embedding. (E) Direct fluorescence detection of chromosome 9 centromeres with fluorored (red) in a frozen tissue section of normal bladder epithelium after PRINS and PBS/glycerol/DABCO embedding with DAPI counterstaining.
2. Materials 2.1. PRINS DNA Labeling 1. Pepsin from porcine stomach mucosa (2500-3500 U/mg) (Sigma, St. Louis, MO). 2. Ultrapure dNTP set (Pharmacia, Uppsala, Sweden): 100~mM solutions of dATP, dCTP, dGTP, and dTTP. 3. Biotin- 16-dUTP, digoxigenin- 11 -dUTP, fluorescein- 12-dUTP (Boehringer, Mannheim, Germany), fluorored-dUTP (Amersham, Little Chalfont, UK). 4. Oligonucleotide primers (see Table 1 of Chapter 3) at 250 ng/pL. 5. Tag DNA polymerase (Boehringer) or AmpliTaq (Perkin Elmer, Chalfont St. Giles, UK). 6. Bovine serum albumin (BSA) (Sigma). 7. 20X SSC: 3MNaC1, 300 n-&I trisodium citrate, pH 7.0.
PRINS DNA Synthesis 8. 9. 10. 11. 12. 13. 14.
33
10X Tuqbuffer: 500 mMKC1, 100 mMTris-HCl, pH 8.3,15 mMMgCl,, 0.1% BSA. PRINS stop buffer: 500 mMNaCl,50 mMEDTA, pH 8.0. Washing buffer: 4X SSC (diluted from 20X SSC), 0.05% Triton X- 100. Ethanol/37% HCl(100: I)-cleaned microscope slides and coverslips. Rubber cement. Water bath at 65*C. Thermal cycler (Hybaid Omnigene Flatbed) (Hybaid, Teddington, UK).
2.2. Cyfochefnicel
Defection
1. Dried skimmed milk powder. 2. Normal goat serum (NGS).
3. Horseradish peroxidase-conjugated avidin (AvPO) (Dako, Glostrup, Denmark). 4. Horseradish peroxidase-conjugated sheep antidigoxigenin Fab fragments (SHADigPO) (Boehringer). 5. 30% HzOz (Merck, Darmstadt, Germany). 6. Diaminobenzidine (DAB) (Sigma). 7. 3,3’,5,5’-Tetramethylbenzidine (TMB) (Sigma). 8. Dioctyl sodium sulfosuccinate (DSSS) (Sigma). 9. Sodium tungstate (Sigma). 10. Immersion oil (Zeiss). 11. Vectashield (Vector Brunschwig Chemie, Amsterdam, The Netherlands). 12. 4’,6-Diamidino-2-phenyl indole (DAPI) (Sigma). 13. PO-DAB buffer: 0. 1M imidazole (Merck) in PBS, pH 7.6. 14. PO-TMB buffer: 100 m&f citrate-phosphate buffer, pH 5.1. 15. Hematoxylin: Hematoxylin (Solution Gill no. 3) (Sigma):dutrlled water (1:4). 16. Blocking buffer: 4X SSC (diluted from stock 20X SSC), 0.05% Triton X-100, 5% skimmed milk powder. 17 Washing buffer: 4X SSC, 0.05% Triton X-100. 18. Incubator at 37“C. 19. Zeiss Axiophot microscope (for fluorescence and bright-field microscopy). 20. Kodak 400 ASA and 100 ASA film. 2 1. Blue and magenta filters.
3. Methods 3.1. PRINS DNA Synthesis 1. Fresh tissue samples obtained after surgical resection are snap frozen in liquid nitrogen. From each sample, cut 4-pm sections with a cryostat, mount them on poly+lysine-coated slides, and store at -20°C until use. 2. Air-dry slides, fix in methanol:acetic acid (3:l) for 10 min at room temperature (see Note l), and air-dry again. 3. Wash slides for 5 min in PBS and 2 min in O.OlMHCl. 4. Treat samples with 100 pg/mL pepsin in O.OlMHCl for 10 min at 37’C, wash for 2 min in O.OlMHCl at 37OC, and pass the slides through an ethanol series starting with 70% ethanol in O.OlM HCl (Note 2).
34
Speel et al.
5. Postfix samples in 1% paraformaldehyde m PBS for 20 min at 4”C, wash in PBS for 5 min, dehydrate, and subject slides to the PRINS procedure. 6. Prepare the PRINS reaction mix on ice as follows: Dilute 100 mM dATP, dGTP, and dCTP 1: 10 with distilled water. Dilute 100 m/l4 dTTP 1: 100. Put together in a mlcrocentrifuge tube: 1 pL of each of the diluted dNTPs, 1 & of either 1 mM biotin- 16-dUTP, digoxigenin- 11-dUTP, fluorescein-12-dUTP, or fluororeddUTP (see Note 3), 5 pL of 10X Tag buffer, 250 ng of oligonucleotide (see Note 4), 1 U Taq polymerase, and distilled water to 50 pL. 7. Place 40 $ of this mixture under a coverslip on the slide, seal with rubber cement, air-dry the rubber cement, and transfer to the heating block of the thermal cycler. 8. Each PRINS reaction cycle consists of 2 min at 94°C (for denaturation of cellular DNA, see Note 5), 5 min at the appropriate annealing temperature (see Note 6), and 15 mm at 72°C for zn situ primer extension. 9. Stop the PRINS reaction by tran& -ing the slides (after removal of the rubber solution seal) to 50 mL. of PRINS stL buffer in a Coplin jar at 65’C for 1 min. 10. Transfer the slides to washing buffer at room temperature, and wash for 5 mm.
3.2. Enzyme Cytochemical
Detection
1. Place 40 & of blocking buffer under a coverslip on the slide, and leave for 5 min at room temperature to reduce background staining in the detection procedures 2. Wash slides for 5 min in washing buffer. 3. For reactions using biotin- 16-dUTP: Dilute AvPO 1: 100 in blocking buffer and apply 50 pL under a coverslip. Incubate slides for 30 min at 37’C in a humid chamber (Note 7). 4. For reactions using digoxigenin- 11-dUTP: Dilute SHADlgPO 1: 100 in blocking buffer and treat as in step 3 (Note 7). 5. Fluorescein-12-dUTP and fluorored-dUTP need no additional reporter and are simply mounted as described in step 11 (see Note 7). 6. Wash slides for 2 x 5 min in washing buffer and for 5 min tn PBS. 7. Visuahze the PRINS-labeled DNA target by an appropriate horseradish peroxidase (PO) reactlon (I I; see also Chapter 3): a. Horseradish peroxldase-diaminobenzidine (PO-DAB) reaction: Mix 1 mL 5 mg/mL DAB in PBS, 9 mL PO-DAB buffer, and 10 $ 30% Hz02 just before use, and overlay each sample with 100 pL under a coverslip. Incubate the slides for 5-15 min at 37”C, wash 3 x 5 min with PBS, and dehydrate optionally. b. Horseradish peroxidase-tetramethylbenzidine (PO-TMB) reaction: Dissolve 100 mg sodium tungstate in 7.5 mL PO-TMB buffer, and adJust the pH of this solution to 5.0-5.5 with 37% HCl. Just before use, dissolve 20 mg DSSS and 6 mg TMB in 2.5 mL 100% ethanol at 80°C. Mix both solutions with 10 & H202, and overlay each sample with 100 J.& under a coverslip. Incubate the slides for l-2 mm at 37”C, wash 3 x 1 min with ice-cold O.lM phosphate buffer (pH 6.0), and dehydrate.
PRINS DNA Synthesis
35
8 After performing the enzyme reaction, counterstain the samples with hematoxylin, wash for 5 min in tap water and 2 mm in distilled water, and air-dry if you wish. 9. Mount samples with the PO-DAB or PO-TMB precipitate in an organic mounting medium or immersion oil. The PO-DAB precipitate can also be embedded in an aqueous mounting medium. Mount samples with fluorescent PRINS signals in Vectashield containing 0.5 pg/mL DAPI. 10. Examine slides with absorption PRINS signals under a bright-field microscope. Microphotographs can be made using blue and magenta filters and Kodak 100 ASA film. Slides with fluorescent PRINS signals can be analyzed under a fluorescence microscope equipped with suitable filters. Selected cells can be either directly photographed using Kodak 400 ASA film, visualized with a charge-coupled device (CCD) camera, or scanned with a confocal scanning laser microscope (CSLM).
4. Notes 1. Fixation of frozen tissue sections with other fixatives, such as acetone (10 min at -2O’C), methanol (10 min at -2OY!), methanol/acetone (1 min at -2O”C/3 x 5 s room temperature), 70% ethanol (10 min at -2O’C), and 70% ethanol/l% formaldehyde (10 min at -2O”C), resulted in poor preservation of cell morphology after PRINS. In addition, we frequently observed fluorescent staining of the entire nucleus after PRINS labeling of methanol/acetone-fixed tissue sections, probably caused by nuclease activities that survived methanol-acetone fixation (8). 2. Dehydration of the samples after pepsin treatment starting with 70% ethanol in O.OlMHCl helps in preserving cell morphology (manuscript in preparation). 3. In the case of labeling with biotin- 16-dUTP or fluorescein- 12-dUTP, a four times decrease of the concentration of dTTP in the PRINS reaction mix resulted in significant stronger labeling of DNA sequences. Under the described standard conditions, digoxigenin-1 l-dUTP and fluorored-dUTP provide the highest sensitivity. However, all the modified nucleotides are suitable for detection of repeated sequences in situ. 4. The concentration of the appropriate oligonucleotide resulting in positive signals needs to be determined by experiment. Generally, 250 rig/slide in 40 & is used for primers of 16-30 bases complementary to repeated sequences. 5. Separate denaturation of cellular DNA in 70% formamide/2X SSC, pH 7.0, for 2 min at 70°C before the PRINS reaction, as is usually performed for chromosome preparations, resulted in no or only weak PRINS labeling of DNA sequences in situ. Whether this is caused by inefficient primer annealing or extension is not clear at the moment. The same phenomenon is also observed for PRINS on ethanol-fixed cells (see Chapter 8). 6. The optimum primer annealing temperature is only determined empirically. We usually try a series from 45 to 7O”C, in 5°C steps. 7. Amplification of PRINS signals can be achieved as follows: a. AvPO detection of biotin-16-dUTP may be followed by incubation with biotinylated goat antiavidin (Vector), 1: 100 diluted in blocking buffer, and again AvPO.
Speel et al.
36
b. SHADigPO detection of digoxigenin-1 l-dUTP may be substituted with incubation with monoclonal mouse antidigoxin (Sigma), PO-ConJugated rabbit antimouse IgG (Dako), and PO-conjugated swine antirabbrt IgG (Dako). c. FITC-12-dUTP signals may be amplified by incubation with monoclonal mouse anti-FITC (Dako) and FITC-conjugated rabbit antimouse IgG (Dako). d. Fluorored-dUTP signals cannot be amplified, since antirhodamin antibodies are not commercially available at this time. e. Amplification of PRINS signals may also be achreved by combimng these detection systems with peroxidase-mediated deposition of hapten- or fluorochrome-labeled tyramides (12,13)
References 1 Bains, M. A., Agarwal, R., Pringle, J. H., Hutchmson, R. M., and Lauder, I. (1993) Flow cytometric quantitation of sequence-specific mRNA in hemapoietic cell suspensions by primer-induced in srtu (PRINS) fluorescent nucleotide labeling. Exp Cell Res. 208,321-326. 2. Koch, J., Mogensen, J., Pedersen, S., Fischer, H., HindkJaer, S., Kiilvraa, S , and Bolund, L (1992) Fast one-step procedure for the detection of nucleic acids in situ by primer-induced sequence-specific labeling with fluorescein-12-dUTP. Cytogenet Cell Genet 60, l-3. 3. Gosden, J. and Lawson, D. (1994) Rapid chromosome identification by oligonucleotide-primed in situ DNA synthesis (PRINS). Hum. Mol. Genet. 3,93 l-936. 4. Pellestor, F., Girardet, A., Lefort, G., Andrea, B., and Charheu, J. P. (1995) PRINS as a method for rapid chromosomal labeling of human spermatozoa. Mol. Reprod Dev 40,333-337. 5. Him&jar, J., Koch, J., Terkelsen, C., Brandt, C. A., Karlvraa, S., and Bolund, L (1994) Fast, sensitive multicolor detection of nucleic acids in .sn.uby primed m situ labeling (PRINS). Cytogenet. Cell Genet. 66, 152-l 54. 6. Speel, E. J. M., Lawson, D., Hopman, A. H. N., and Gosden, J. (1995) MultrPRINS: multiple sequential oligonucleotide primed in situ DNA synthesis reactions label specific chromosomes and produce bands. Hum. Genet. 95,29-33. 7. Abbo, S., Dunford, R. P., Miller, T. E., Reader, S. M., and King, I. P. (1993) Primer-mediated in situ detection of the B-hordein gene cluster on barley chromosome 1H. Proc. N&l. Acud. Sci. USA 90, 11,821-l 1,824. 8. Speel, E. J. M., Lawson, D., Ramaekers, F. C. S., Gosden, J. R., and Hopman, A. H. N. (1996) Rapid brightfield detection of oligonucleotide primed in situ (PRINS) labeled DNA in chromosome preparations and frozen tissue sections. Biotechniques 20,226-234. 9. Hopman, A. H. N., Van Hooren, E., Van der Kaa, C. A., Vooijs, G P., and Ramaekers, F. C. S. (1991) Detection of numerical chromosome aberrations using in situ hybridization in paraffin sections of routinely processed bladder cancers. Mod. Path01 4,503-513. 10. Hopman, A. H. N., Poddighe, P. J., Moesker, O., and Ramaekers, F. C. S. (1992) Interphase cytogenetics: an approach to the detection of genetic aberrations m
PRINS DNA Synthesis
37
tumours, in Diagnostic Molecular Pathology, A Practical Approach, vol. 1 (Herrington, C. S. and McGee, J. O’.D., eds.), IRL, Oxford, pp. 141-167 11. Speel, E. J. M., Jansen, M. P. H. M., Ramaekers, F. C. S., and Hopman, A. H. N. (1994) A novel trrple-color detection procedure for brightfield microscopy, combining in situ hybridization with immunocytochemrstry J. Hzstochem. Cytochem. 42,1299-1307.
12. Bobrow, M. N., Harris, T. D., Shaughnessy, K. J., and Litt, G J. (1989) Catalyzed reporter deposition, a novel method of signal amplification. Amplification to immunoassays. J. Immunol. Methods 125,279-285. 13. Speel, E. J. M., Ramaekers, F. C. S., and Hopman, A. H. N. (1995) Cytochemrcal detection systems for in situ hybridrzation, and the combmatron with immunocytochemistry. Histochem. J 27,833-858.
Multiple Sequential Oligonucleotide Primed /n Sctu DNA Syntheses (MULTI-PRINS) John R. Gosden and Diane Lawson 1. Introduction Conventional PRINS (if it is possible to use such a description for a relatively new technique) is capable of identifying and quantifying chromosomes or chromosome pairs in metaphase or interphase cells (1-4). Each PRINS reaction can only identify one pair of homologous chromosomes, because the nature of the reaction means that the product of only one primer or primer pair can be specifically labeled in each reaction. However, by inserting a blocking step after each PRINS reaction to ensure that the 3’-ends of the products of the previous reaction cannot act as primers for the next reaction, it is possible to perform several PRINS reactions on a single slide, and therefore ascertain the number of each of several pairs of chromosomes present in a given sample.
2. Materials 2.1. PRINS Synthesis 1. Twin-Frost glass slides and 22 x 40 mm covershps The slides must be cleaned by soakingm ethanol,to which a few drops of HCI have been added,followed by
polishing with a cleanpiece of muslin before the cells are depositedon the slide. 2. 3. 4. 5.
Coverslips must be cleaned in the same way before use. PRINS buffer (10X): 500 mM KCl, 100 mM Tris-HCl, pH 8.3, 15 m/L4 MgCl,, 0.1% BSA. 2’-Deoxyadenosine 5’-triphosphate (dATP): 100-W solution (Pharmacia Biotech, St. Albans, UK), diluted 1: 10 with sterile distilled H20. 2’-Deoxycytidine 5’-triphosphate (dCTP): lOO-rmI4solution (Pharmacia Biotech), diluted 1: 10 with sterile distilled H,O. 2’-Deoxyguanosine 5’-triphosphate (dGTP): 100-M solution (Pharrnacia Biotech), diluted 1.10 with sterile distilled H,O. From
Methods m Molecular Biology, Vol. 71’ PRM and In Situ PCR Protocols Edlted by J FL Gosden Humana Press lnc , Totowa, NJ
39
Gosden and Lawson
40 Table 1 Primers for X and Y Chromosomes D599 (27-mer)
DYZl
D600 (27-mer)
DYZl (pair for D599) DXZl DXZI (pair for E563)
E563 (23-mer) E564 (23-mer)
TGGGCTGGAATGGAAAGGAATCGAAAC TCCATTCGATTCCATTTTTTTCGAGAA ATAATTTCCCATAACTAAACACA TGTGAAGATAAAGGAAAAGGCTT
6. 2’-Deoxythymidine 5’-triphosphate (dTTP): 100-d solution (Pharmacia Biotech), diluted 1: 100 with sterile distilled H,O. 7. Biotin- 16-2’-deoxyuridine-5’-triphosphate (Bio- 16-dUTP) (Boehrmger Mannheim, Germany). 8. Digoxigenin-I 1- deoxyuridine-5’-triphosphate (Dig- 1 l-dUTP) (Boehringer Mannheim). 9. FluoroRed (Amersham International, plc., Buckinghamshire, England). 10. FluoroGreen (Amersham International, plc.). 11. FluoroBlue (Amersham International, plc.). 12. Oligonucleotide primer(s) at 250 ng/mL. See Note 1 Examples of primers are shown in Table 1, and results wrth these primers in Fig. 1. 13. Tug DNA polymerase (Tuq [Boehringer], AmpliTuq [Perkm Elmer, Foster Crty, CA] or ThermoprimerlUs [Advanced Biotechnologies Ltd., Leatherhead, England]). 14. Rubber cement (vulcanizing solution) (e.g , Tip-Top, Stahlgruber, DS-8011 Pomg, Germany) (see Note 2). 15 Stop buffer: 500 mM NaCl, 50 mA4 EDTA. 16. Flat-bed thermal cycler (see Note 3). 17. Water bath at 65OC.
2.2. Blocking 1 2. 3. 4. 5. 6
0.025 mA4 2’,3’ dideoxyadenosine 5’-triphosphate (ddATP) (Pharmacia). 0.025 mM2’,3’ dideoxycytidine 5’-triphosphate (ddCTP) (Pharmacia). 0.025 mM2’,3’ dideoxyguanosine 5’-triphosphate (ddGTP) (Pharmacta). 0.025 mA4 2’,3’ dideoxythymtdine 5’-triphosphate (ddTTP) (Pharmacia). DNA polymerase 1, large fragment (Klenow enzyme) (Boehringer Mannheim). 10X Nick translation buffer (10X NT): OSM Tris-HCl, pH 7.2, O.lM MgS04, 0.1 n&f dtthiothreitol, 1.5 mg/mL BSA.
2.3. Defection 1. 2. 3. 4. 5.
Dried skimmed milk powder. Avidin-DCS-fluorescein isothiocyanate (Av-FITC) (Vector Labs, Burlingame, CA). Avidm-DCS-Texas red (Av-TR) (Vector Labs). Antidtgoxigenin-fluorescein (anti-DIG-FITC) (Boehringer Mannheim). Antidigoxigenin-rhodamine (anti-DIG-rhodamine) (Boehringer Mannheim).
MUL TI-PRINS
Fig. 1. (see color plate number 4 after p. 82) Double PRINS with primers for X and Y chromosomes. These primers produce cleaner signal with less background when used in pairs as shown in Table 1. (A) X chromosome labeled with biotin and detected with avidinFITC; Y chromosome labeled with FluoroRed. (B) X chromosome labeled with digoxigenin and detected with antidigoxigenin-rhodamine; Y chromosome labeled with biotin and detected with avidin-FITC. Note label clear in interphase nuclei aswell as on chromosomes. 6. 7. 8. 9. 10. 11. 12. 13.
Propidium iodide (20 pg/mL). 4’,6-diamidino-2-phenylindole 2 HCl (DAPI) (100 pg/mL). VectaShield (Vector Labs). 20X SSC: 3.0MNaC1,0.30Mtri-sodium citrate, pH 7.3. Wash buffer: 4X SSC (diluted from stock 20X SSC), 0.05% Triton X-100. Blocking buffer: Wash buffer with the addition of 5% skimmed milk powder. Incubator or water bath at 37’C and water bath at 45°C. Microscope equipped for epifluorescence (e.g., Zeiss Axioskop or Leitz Ortholux II with Pleomopak filter system).
3. Methods 3.1. PRINS Perform the first PRINS reaction as described in Chapter 1, using biotin or digoxigenin as the label (see Note 4).
Gosden and Lawson
42 3.2. Block
1. Make up the block reaction with (for each slide) 4 I,& of each of the four ddNTPs, plus 4 & 10X NT, and distilled water to a total of 40 pL. 2. After the stop buffer (Section 3.1.) step 7 in Chapter l), pass the slides through an ethanol series, air-dry, rinse them briefly in 1X nick translation buffer, and shake off the surplus fluid. 3. Add 1 U Klenow enzyme/slide to the block reaction and altquot 40 pL onto each covershp 4 Pick up the coverslips with the slides and incubate m a humid chamber (e.g , a plastic box contaimng damp filter paper) for 1 h at 37’C. 5. Pass the slides through an ethanol series (70,90, and lOO%), and air-dry before starting the second PRINS reaction.
3.3. Second and Third PRINS 1. Make up a standard PRINS reaction mix, with a different primer and reporter (e g., use biotin for the first PRINS, digoxigenin for the second, and FluoroRed for a third), and perform annealing and extension stages of the reaction, omitting the denaturation step (see Note 5). 2. Stop as before, and, if a third PRINS is required, go through the blockmg process again (Section 3.2., steps 1-5) before carrying out the third PRINS. 3 Otherwise, transfer to 4X SSC; 0.05% Triton X-100
3.4. Detection It is important this process.
that the slides do not become
dry at any time
during
1. Prepare blocking buffer. The milk powder dissolves rapidly if the solution is warmed to 45’C for a few seconds. 2. Put 40 pL blocking buffer on a clean coverslip, shake surplus wash buffer from slide, and pick up coverslip containing blocking buffer. Leave (unsealed) at room temperature for 5 mm. 3. Dilute reporters (see Note 6) in blocking buffer (antidigoxtgenm-fluorochrome at 1: 100 dilution; avidin-fluorochrome at 1:500). Make sufficient for 40 &/slide. Spin in a microcentrifuge for 5 min. This precipitates any aggregates that may have formed during storage that can cause htgh and nonspecific background. 4. Remove the coverslip from the slide, shake surplus fluid off both slide and coverslip, and add 40 $ of reporter solutton to the same coverslip. Replace the slide, and incubate (unsealed) in a moist chamber (e.g., a sandwich box lined with damp filter paper) at 37°C for 30 min. 5. Meanwhile, warm a reagent bottle containing wash buffer to 45OC in a water bath. Remove coverslips, and wash slides 3 x 2 mm in wash buffer at 45°C. 6. After the final wash, shake off surplus fluid and mount slides in VectaShield. For double PRINS, this may contain the appropriate counterstain: For slides labeled with rhodamine or Texas red plus FITC, this should be DAPI (5 pg/lOO pL
MULTI-PRINS
43
VectaShield, i.e., 5 pL DAPI stock/100 pL Vectashield); for triple PRINS, no counterstain can be used (see Note 7). Use 20-30 pL mountant/slide, blot surplus by covermg slide and coverslip with a tissue and pressing gently to expel excess mountant, and seal with rubber cement. Slides may be stored in the dark at 4OC for several months. If the stain shows signs of fading, simply remove the coverslip, soak the slide overnight in 4X SSC, 0.05% Triton X-100, and remount as above.
4. Notes 1. Oligonucleotide primers can be synthesized on an ABI DNA synthesizer and used without further purification other than alcohol precipitation and washing. If this facility is not available, they may be obtained from commercial sources (e.g., Advanced Biotechnologies Ltd., Leatherhead, England), but purification steps, such as HPLC, are not needed and only increase the cost of the product, 2. The requirement for a suitable seal is that it should be reasonably robust, provide a vapor-tight seal, and be easily and completely removed at the end of the procedure. We have found Tip-Top fulfills all these parameters, and 1s readily available from bicycle repair shops. 3. Thermal cyclers with a flat bed for microscope slides are not yet widely available. Some of the products sold for this purpose are not altogether suitable, since they are ad hoc modifications of machines desrgned for PCR m microtubes, with a plate added to the heated block. Thermal transfer and temperature control in such a system are rarely satisfactory. The procedure can be carried out by transferring slides through a series of water baths at appropriate temperatures, but this too means that temperature control cannot be precise, and the temperature drop during the transfer from water bath to water bath leads to high backgrounds. The most suitable purpose-built products are the OmniGene In Situ and OmniSlide made by Hybaid (Teddington, Middlesex, UK), which take 4 and 20 slides, respectively. 4. The order m which primers are used is important. The reaction giving the weakest signal should be performed first, with the strongest label (digoxigenin or biotin), and that with the strongest signal last, with the weakest label (a direct fluorochrome label). This is significant for two reasons: The weakest signal contains the fewest new molecules, and thus has the least number of free 3’-ends to block, and any renaturation of chromosomal DNA during the annealing and extension step will be minimized, giving the most efficient reaction condittons. 5. No denaturation is needed after the first PIUNS, since the chromosomal DNA remains denatured through the PRINS incubations. 6. Choose reporters with care. Texas red avidin (Av-TR) gives a signal clearly distinguished from antidigoxigenin-FITC, and these are the best choices for double PRINS. However, for triple PRINS, the choice will depend on whether all three primers are chromosome-specific (as in Fig. 1A) or whether one of them is intended to produce a banding pattern (as in Fig. 1B). 7. If only two pairs of chromosomes are being targeted, a third primer labeling the Ah sequence can be used, since this produces an R-band pattern. If three
Gosden and Lawson
44
pairs of chromosomes are targeted, no colors are left for staining the chromosome arms, but there is usually sufficient background stain for these to be visible (see Fig. 1A).
References 1. Koch, J. E., Kolvraa, S., Petersen, K. B., Gregersen, N., and Bolund, I. (1989) Ohgonucleotide-priming methods for the chromosome-specific labellmg of alpha satellite DNA in situ. Chromosoma 98,259-265. 2. Gosden, J., Hanratty, D., Starling, J., Fantes, J., Mttchell, A., and Porteous, D. (1991) Oligonucleotide primed in situ DNA synthesis (PRINS): a method for chromosome mapping, banding and investigation of sequence organization. Cytogenet. Cell Genet 57, 100-104. 3. Gosden, J. and Lawson, D (1994) Rapid chromosome identification by oligonucleotide primed m situ DNA synthesis (PRINS). Hum. Mel Genet. 3,93 l-946. 4. Gosden, J. and Lawson, D. (1995) Instant PRINS: a rapid method for chromosome identification by detecting repeated sequences m situ. Cytogenet. Cell Genet. 68, 57-60.
Oligonucleotide PRINS DNA Synthesis on Extended Chromatin Preparations Yoshiro Shibasaki and John R. Gosden 1. Introduction One of the inherent problems with conventronal fluorescent in situ hybridization (FISH) on metaphase chromosomes has been the difficulty in resolving closely associated markers. Any targets separated by less than about 1 Mb (1 x 1O6bp) tend to appear as a single locus on metaphasechromosomes.The first approach to improving this resolution was hybridization to interphase nuclei (Z,Z), in which, because the chromatin is decondensed, the markers are further apart and, therefore, more easily resolved. However, the chromatin in interphase nuclei is not identifiable as discrete strands, so it is both difficult to see whether two markers are definitely linked and impossible to tell whether, if they are physically linked, the chromatin between them follows a straight course or a convoluted one. Thus, it is necessary to measure the distance between a large number of signal pairs to establish modal and average figures for the distance between them. By this means, it has been possible to establish physical distances between markers as little as W-100 kb (5 x 104-10’ kbp) apart. Recently, a number of methods have been described that permit the generation of free, partly decondensed chromatin fibers (3-7). FISH can be performed on this material with much greater resolution than on metaphase chromosomes, and because the path of the chromatin fibers is generally linear, if not entirely straight, and can be readily traced, mapping physical distances and establishing linkage is relatively easy, and markers can be mapped when they are separated by as little as 3-5 kb. An alternative approach can be made with Oligonucleotide Primed In Situ DNA synthesis (PRINS) (see Chapter 1 and refs. &I I). This technique can be usefully applied to extended chromatin both for the structural analysis of chromatin organization and, by combining FISH From
Methods in Molecular Bology, Vol 71: PRlNS and In Situ PCR Protocols Edited by J R Gosden Humana Press Inc , Totowa, NJ
45
Shibasaki and Gosden
46
with PRINS, for relating mapped markers to specific chromatin
organization
patterns (12).
2. Materials 2.1. Extended 1. 2. 3. 4 5.
Chroma tin
Cleaned glass slides as in Chapter 1. Lysis solution: 50 mA4NaOH, 30% ethanol. Phosphate-buffered saline (PBS). Methanol. Ethanol series: 70,95, 100%.
2.2. PRINS 1. PRINS buffer (10X): 500 mMKC1, 100 mMTris-HCl, pH 8.3, 15 mMMgC12, 0.1% BSA. 2. 2’-Deoxyadenosine 5’-triphosphate (dATP): 100-w solution (Pharmacia Biotech, St. Albans, UK), diluted 1: 10 with sterile distilled H,O. 3. 2’-Deoxycytidine 5’-triphosphate (dCTP): lOO-tisolution (Pharmacra Blotech), diluted 1: 10 with sterile dlstilled H20. 4. 2’-Deoxyguanosine 5’-triphosphate (dGTP): 100-d solution (Pharmacia Biotech), diluted 1: 10 with stenle distilled H20. 5. 2’-Deoxythymidine 5’-triphosphate (dTTP): 100-n& solution (Pharmacia Biotech), diluted 1: 100 with sterile distilled H,O. 6. Digoxlgenin- 11 -deoxyundme-5’-triphosphate (Dig-1 1-dUTP) (Boehringer Mannheim, Lewes, Sussex). 7. FluoroRed (Amersham Internatlonal, plc, Buckinghamshire, England). 8. FluoroGreen (Amersham International). 9. Oligonucleotlde primer(s) at 250 ng/mL. See Note 1. 10. Taq DNA polymerase (Tag [Boehringer], AmpliTuq [Perkm Elmer, Foster City, CA], or ThermoprimeP’us [Advanced Biotechnologies Ltd., Leatherhead, England]). 11. Rubber cement (vulcanizing solution) (e.g., Tip-Top, Stahlgruber, DS-80 11 Poing, Germany) (see Note 2). 12. Stop buffer: 500 mMNaC1,50 mM EDTA. 13. Flat-bed thermal cycler (see Note 3). 14 Water bath at 65’C.
2.3. Detection 1. 2. 3. 4. 5. 6.
Dried skimmed milk powder. Antidigoxigenin-fluorescein (anti-DIG-FITC) (Boehringer Mannheim). Antidigoxigenin-rhodamine (anti-DIG-rhodamine) (Boehringer Mannheim). Propidium iodide (20 pg/mL) (Sigma, St. Louis, MO). 4’,6-Diamidino-2-phenylindole 2 HCl (DAPI) (100 @rnL) (Sigma). VectaShield (Vector Labs, Burlingame, CA).
PRlNS on Chromatin
47
Table 1 Examples of Primers Used with Extended ChromatiV E528 (20-mer) D7Z 1, alphoid AGCGATTTGAGGACAATTGC E529 (20-mer) D7Zl (pair CCACCTGAAAATGCCACAGC for E528) 435 (26-mer) p satellite AGTGCAGAGATATGTCACAATGCCCC 450 (19-mer) Ah, 5’-end of AAAGTGCTGGGATTACAGG consensus OResultswith these pnmers are shownm Fig. 1.
7. 8. 9. 10. 11.
20X SSC: 3.OMNaCI,0.30Mtrisodium citrate, pH 7.3. Washbuffer: 4X SSC(diluted from stock20X SSC),0.05% Triton X-100. Blocking buffer: wash buffer with the addition of 5% skimmedmilk powder. Incubator or water bath at 37OCand water bath at 45°C. Microscopeequippedfor epifluorescence(e.g.,Zeiss Axioskop or Leitz Ortholux II with Pleomopakfilter system).
3. Method 3.1. Extended Chrometin In the center of a cleaned glass slide, drop 20 clr, of fixed-cell suspension (stored metaphase chromosome preparations kept in fix at -20°C can be used for up to 1 yr). Before the drop is completely dried, immerse the slides in PBS in a Coplin jar and incubate for 1 min. This procedure neutralizes the acid fix in which the cells are suspended. Blot excessby shaking the slide and touching the edge to filter paper, and pipet 100 pL of lysis solution on the slide held horizontally followed by 100 & of methanol gently on top of the lysis solution. The rapid change of surface tension pulls out the chromatin fibers from the lysed cells. Blot excess fluid as above and air-dry the slides. When they are dry, pass the slides through an ethanol series from 70 to 100% and air-dry. Place the slides in an incubator at 80°C for 1 h, and allow to cool. 3.2. PRINS 1. Slides of extendedcbromatin as above should be storedunder vacuum at room temperatureandusedwithin a weekof preparation.Always usenormal metaphase chromosomepreparations(as in Chapter 1) as controls for eachreaction. 2. Oligonucleotide primers are prepared on an Applied Biosystems(Foster City, CA) Model 381A DNA synthesizeraccording to the manufacturer’s instructions. Examplesof primers are given in Table 1, and resultswith theseprimers shown in Fig. 1. 3. The reaction mix is made up as follows: For each slide, put 1 pL of each of the diluted nucleotide triphosphates, plus 1 & of the selected labeled dUTP
48
Shibasaki and Gosden
Fig. 1. (see color plate number 5 after p. 82) PRINS with extended chromatin. (A) Chromosome 7-specific c1satellite labeled with biotin and detected with avidin-FITC. This satellite DNA is located at the centromere of chromosome 7. Note the extension of what is normally a highly condensed region of chromatin. (B) l3 satellite, labeled directly with FluoroRed and counterstained with DAPI. This is a fairly low-copynumber tandem repeated sequence, with the highest concentrations at the centromere of chromosome 1 and adjacent to the ribosomal DNA on the acrocentric chromosomes. Note the concentrations of label, interspersed with unlabeled DNA, indicating that only some of the DNA is complementary to the primer, and that other sequences are interspersed with the S satellite. (C) Alu, labeled with biotin and detected with avidinFITC. A clear distinction can be seen between the &u-rich and&u-poor regions of the chromatin strand.
PRINS on Chromatin
4.
5. 6. 7. 8.
9.
49
(digoxigenin or a fluorochrome-dUTP), 5 pL 10X PRINS buffer, and 1 pL of the appropriate oligonucleotide primer (see Note 5) into a microcentrifuge tube, and add distilled water to 50 pL. Mix thoroughly and add 1 U of your chosen DNA polymerase. Mix carefully and place 40 JJL on a clean coverslip. It is simpler, when using the same primer reaction on several slides (e.g., extended chromatin and normal controls), to make up a bulk reaction nux (50 & x n, where n is the number of slides) and aliquot to the coverslips. Pick the coverslip up with a slide (this spreads the reaction mix evenly, with least risk of introducing air bubbles), and seal with rubber cement. Dry the seal (a cold air fan is quick and safe), and transfer the slides to the flat block of a thermal cycler. A suitable basic program for the Hybaid OmniGene In Situ, or Hybaid OmniSlide is at 93°C for 3 min; at 6O’C for 5-10 min; at 72’C for 15 min. On completion of the program, remove the seal (it peels off easily by rubbing one corner) and transfer the slides for 1 min to a Coplin jar containing stop buffer at 65°C. Leave the coverslips in place, unless they come off readily with the seal; they will m any case fall off in the stop buffer. If the slides are subsequently to be subjected to FISH, treat as in Note 6; otherwise, continue as in Section 3.3. After 1 min, transfer the slides to a stain dish containmg wash buffer. They may be held in this solution overnight if convenient (but see Note 7).
3.3. Detection It is important that the slides do not become dry at any time during this process. The following steps apply only to slides in which the PRINS reaction has been labeled with digoxigenin. Slides in which the reaction used a fluorochrome-dUTP as the label require no detection step and are simply mounted (see step 6). 1. Prepare blocking buffer. The milk powder dissolves rapidly if the solution is warmed to 45“C for a few seconds. 2. Put 40 pL blocking buffer on a clean coverslip, shake surplus wash buffer from slide, and pick up coverslip containing blocking buffer. Leave (unsealed) at room temperature for 5 min. 3. Dissolve reporter (antldigoxigenin-fluorochrome) in blocking buffer at 1: 100 dilution Make sufficient for 40 ,&/slide. Spin in a microcentrifuge for 5 min. This precipitates any aggregates that may have formed durmg storage, and can cause high and unspecific background. 4. Remove the coverslip from the slide, shake surplus fluid off both slide and coverslip, and add 40 pL of reporter solution to the same coverslip. Replace the slide and incubate in a moist chamber (e.g., a sandwich box lined with damp filter paper) at 37°C for 30 min. 5, Meanwhile, warm a reagent bottle contaming wash buffer to 45°C in a water bath. Remove coverslips and wash slides 3 x 2 min in wash buffer at 45°C.
50
Shibasaki and Gosden
6. After the final wash, shake off surplus fluid and mount slides m VectaShield containing the appropriate counterstain: for slides labeled with rhodamine or Texas red, this should be DAPI (5 pg/lOO pL VectaShleld, i.e., 5 cls, DAPI stock/100 & Vectashield); for shdes labeled with FITC!, this should be a propidlum iodide/DAPI mixture (7.5 pL of each stock solution1100 & VectaShield). Use 20-30 pL mountant/slide, blot surplus by covering slide and coverslip with a tissue and pressing gently to expel excess mountant, and seal with rubber cement. Slides may be stored in the dark at 4°C for several months. If the stain shows signs of fading, simply remove the coverslip, soak the slide overnight m 4X SSC, 0.05% Triton X-100, and remount as above.
4. Notes 1. Oligonucleotide pruners can be synthesized on an ABI DNA synthesizer and used without further purification other than alcohol precipitation and washing. If this facility is not available, they may be obtained from commercial sources, but purification steps, such as HPLC, are not needed, and only increase the cost of the product. 2. The requirement for a suitable seal is that it should be reasonably robust, provide a vapor-tight seal, and be easily and completely removed at the end of the procedure. We have found that Tip-Top fulfills all these parameters and is readily available from bicycle repair shops. 3. Thermal cyclers with a flat bed for microscope slides are not yet widely available. Some of the products sold for this purpose are not altogether suitable, since they are ad hoc modifications of machines deslgned for PCR in microtubes, with a plate added to the heated block. Thermal transfer and temperature control in such a system are rarely satisfactory. The procedure can be carried out by transferring slides through a series of water baths at appropriate temperatures, but this too means that temperature control cannot be precue, and the temperature drop during the transfer from water bath to water bath leads to high backgrounds. The most suitable purpose-built products are the OmniGene In Situ and OmniSlide made by Hybaid (Teddington, Middlesex, UK), which hold 4 and 20 slides, respectively. 4. Cell suspensions may be stored in fix (methanol:acetic acid [3: 11) at -20°C for several months. Slides are prepared fresh each week by gently centrifuging to precipitate, resuspending in fresh fix, repeating this process, and finally resuspending in sufficient fix to give a suitable density and putting one drop on a clean slide, which is allowed to dry at room temperature. The balance of the suspension may then be diluted suitably with fix and returned to -20°C. Using slides more than 1-2 wk old can be successful, but may lead to reduced sensltivity and greater variability. 5. The majority of chromosome-specific repeated sequence primers produce adequate signal with a single primer at a concentration of 250 ng/50 pL reaction. Dispersed repeated sequences (e.g., Alu) and tandem repeated sequences (e.g., p satellite) produce good clear signals at the same concentration.
PRINS on Chromatin
51
6. To combine PRINS with FISH, after the stop buffer (Section 3.2., step 8) transfer slides directly to 70% ethanol at -2O*C for 2 min, then pass through 90 and 100% ethanol, and allow to dry. Thereafter, proceed with normal FISH, without a slide denaturation step, simply warming slides and coverslips to 37°C before adding the labeled, preannealed probe, as described by Lichter and Ried (13). 7. Slides that have been labeled directly with fluorochromes may still be held in this solution overnight if convenient, but should be kept in the dark to prevent bleaching and fading of the label.
References 1. Trask, B. J. (199 1) Fluorescence in situ hybridization: applications in cytogenetits and gene mapping. Trends Genet. 7, 149-154. 2. Van den Engh, G., Sachs, R., and Trask, B. (1992) Estimating distance from DNA sequence location in cell nuclei by a random walk model. Science 257,14 1O-14 12. 3. Heng, H. H. Q., Squire, J., and Tsui, L.-C. (1992) High resolution mapping of mammalian genes by in situ hybridization to free chromatin. Proc. Natl. Acad Sci. USA 89,9509-95 13. 4. Wiegant, J., Kalle, W., Mullenders, L., Brookes, S., Hoovers, J M. N , Dauwerse, J. G., van Ommen, G. J B., and Raap, A. K. (1992) High-resolution m situ hybridization using DNA halo preparations. Hum. Mol. Genet 1,587-591. 5. Parra, I. and Windle, B. (1993) High resolution visual mapping of stretched DNA by fluorescent hybridization. Nature Genet. 5, 17-21. 6. Heiskanen, M., Karhu, R., Hellsten, E., Peltonen, L., Kallionemi, 0. P., and Palotie, A. (1994) High resolution mapping using fluorescence in situ hybridtzation to extended DNA fibers prepared from agarose-embedded cells. BioTechniques 17,928-933. 7. Senger, G., Jones, T. A., Fidlerova, H., Sanseau, P., Trowsdale, J., Dutt, M., and Sheer, D. (1944) Released chromatin: linearized DNA for high resolution fluorescence in situ hybridization. Hum. Mol Genet. 3, 1275-1280. 8. Koch, J. E., Kolvraa, S., Petersen, K. B., Gregersen, N., and Bolund, I. (1989) Oligonucleotide-priming methods for the chromosome-specific labelling of alpha satellite DNA in situ. Chromosoma 98,259-265. 9. Gosden, J., Hanratty, D., Starling, J., Fantes, J., Mitchell, A., and Porteous, D. (1991) Oligonucleotide primed in situ DNA synthesis (PRINS): a method for chromosome mapping, banding and investigation of sequence organization. Cytogenet. Cell Genet. 57, 100-104. 10. Gosden, J. and Lawson, D. (1994) Rapid chromosome identification by oligonucleotide primed in situ DNA synthesis (PRINS). Hum. Mol. Genet. 3,93 l-946. 11. Gosden, J. and Lawson, D. (1995) Instant PRINS: a rapid method for chromosome identification by detecting repeated sequencesin situ. Cytogenet. Cell Genet 68,57-60. 12. Shibasalu, Y. and Gosden, J. R. Manuscript m preparation. 13. Lichter, P. and Ried, T. ( 1994) Molecular analysis of chromosome aberrations, in Methods in Molecular Biology, vol. 29: Chromosome Analysis Protocols (Gosden, J. R., ed.), Humana, Totowa, NJ, pp. 449-478.
8
Combined lmmunocytochemistry and PRINS DNA Synthesis for Simultaneous Detection of Phenotypic and Genomic Parameters in Cells Ernst J. M. Speel, Diane Lawson, Frans C. S. Ramaekers, John R. Gosden, and Anton H. N. Hopman 1. Introduction
Primed in situ (PRINS) labeling has become an alternative to in situ hybridization (ISH) for the localization of nucleic acid sequences in cell (1-4) and tissue preparations (5; see also Chapter 5). In the PRINS method, an unlabeled primer (restriction fragment, PCR product, or oligonucleotide) is annealed to its complementary target sequence in situ. The primer serves as an initiation site for in situ chain elongation using a thermostable DNA polymerase and labeled nucleotides, which can be detected directly by fluorescence microscopy, such as fluorochrome-labeled dNTPs, or indirectly using, e.g., biotin- or digoxigenin-dUTP and the application of fluorochrome-conjugated avidin or antibody molecules (3,6,7). The detection limit of the PRINS technique appears to be on the order of low-copy sequences (3,8). The combination of PRINS and immunocytochemistry (ICC) enables us, for example, to immunophenotype cells containing a specific chromosomal content or viral infection. The successand sensitivity of such a combined procedure depends on such factors, as preservation of cell morphology and protein epitopes, accessibility of nucleic acid targets, lack of crossreaction between the different detection procedures, good color separation, and stability of fluorochromes and enzyme cytochemical precipitates. Since several steps in the PRINS procedure (enzymatic digestion, post fixation, denaturation at high temperatures) may destroy antigenic determinants, a procedure starting with ICC From
Methods in Molecular Biology, Vol 71 PRINS and In Situ PCR Protocols Edited by J. R Gosden Humana Press Inc. Totowa, NJ
53
54
Speel et al.
Fig. 1. (see color plate number 2 after p. 82) (F) Fluorescence detection of chromosome 9 centromeres with digoxigenin/SHADigFITC in H460 cells after PRINS and Vectashield embedding with PI counterstaining. (G) Simultaneous fluorescence detection of EGF receptor with APase-fast red (red) and four chromosome 7 centromeres with biotin/AvFITC (green) in C 12 1-TN6 cells after immunostaining, PRINS, and Vectashield embedding without counterstain. (H) Simultaneous fluorescence detection of NCA?vI antigen with APase-fast red (red) and three chromosome 9 centromeres with digoxigenin/SHADigFITC (green) in H460 cells after immunostaining, PRINS, and Vectashield embedding without counterstaining (compare with F).
and followed by PRINS is usually preferred. A variety of procedures have already been reported for the combination of ICC and ISH (for a review, see ref. 9). Here we describe the application of a sensitive, high-resolution fluorescence alkaline phosphatase (APase)-fast red ICC staining method (10) in combination with subsequent PRINS labeling of DNA target sequences to biological cell preparations. The advantageous slow-fading properties of the APase-fast red precipitate as well as its stability during enzymatic pretreatment steps and the entire PRINS procedure are essential for accurate immunostaining. As a model system, somatic cell hybrid and tumor cell lines have been used for simultaneous detection of surface antigens (EGF receptor, neural cell-adhesion molecule) and repeated chromosome-specific DNA sequences(Fig. 1F-H).
lmmunocytochemistry
and PRiNS
55
2. Materials 2.7. Enzyme Cyfochemicai Antigen Detection 1. Normal goat serum (NGS). 2. Monoclonal antibody (MAb) EGFRl, directed against the epidermal growth factor receptor (a kind gift of V. van Heyningen, Edinburgh, UK). 3. MAb 163A5, directed against a cell-surface marker of JlC14 cells (II). 4. MAb RNLI, directed against the neural cell-adhesion molecule (N-CAM) (22). 5. Alkaline phosphatase-conjugated goat antimouse IgG (GAMAPase) (Dako, Glostrup, Denmark). 6. Naphthol-ASMX-phosphate (Sigma, St. Louis, MO). 7. Fast red TR (Sigma). 8. Polyvinylalcohol (PVA), mol wt 40,000 (Sigma). 9. APase buffer: 0.2MTris-HCl, pH 8.5, 10 mMMgC&, 5% PVA. 10. Blocking buffer: PBS (diluted tirn stock 10X PBS), 0.05% Triton X- 100,2-5% NGS. 11. Washing buffer: PBS, 0.05% Triton X- 100.
2.2. PRINS DNA Labeling 1. Pepsin from porcine stomach mucosa (2500-3500 U/mg) (Sigma). 2. Ultrapure dNTP set (Pharmacia, Uppsala, Sweden): 100 mM solutions of dATP, dCTP, dGTP, and dTTP. 3. Biotin- I6-dUTP, dtgoxigenin- 11-dUTP, and fluorescein-l ZdUTP (Boehringer, Mannheim, Germany). 4. Ohgonucleotide primer (see Table 1 m Chapter 3). 5. Tuq DNA polymerase (Boehringer) or AmphTuq (Perkin Elmer, Chalfont St. Giles, UK). 6. Bovine serum albumm (BSA) (Sigma). 7. Dried skimmed milk powder. 8. FIT&conjugated avidin (AvFITC) (Vector, Brunschwig Chemie, Amsterdam, The Netherlands). 9. FITC-conjugated sheep antidigoxigenin Fab fragments (SHADigFlTC) (Boehringer). 10. Vectashield (Vector). 11. 4’,6-Diamidino-2-phenyl indole (DAPI) (Sigma). 12. 20X SSC: 3MNaCI,300 mM trisodium citrate, pH 7.0. 13. 10X Tag buffer: 500 m&f KCl, 100 mA4 Tris-HCl, pH 8.3, 15 mM MgCl,, 0.1% BSA. 14. PRINS stop buffer: 500 mMNaCI,50 mMEDTA, pH 8.0. 15. Blocking buffer: 4X SSC (diluted from stock 20X SSC), 0.05% Triton X-100, 5% skimmed milk powder. 16. Washing buffer: 4X SSC, 0.05% Triton X-100. 17. Ethanol:37% HCl(lO0: l)-cleaned microscope slides and coverslips. 18. Rubber cement. 19. Water bath at 65OC. 20. Thermal cycler (Hybaid Omnigene Flatbed) (Hybatd, Teddington, UK).
Speel et al.
56 2 1. 22. 23. 24.
Humid chamber. Incubator at 37’C. Zeiss Axiophot microscope. Kodak 400 ASA film.
3. Methods 3.1. Enzyme Cytochemical Antigen Detection 1. Culture hybrid (C121-TN6, JlC14) and tumor (H460) cell lines on glass slides by standard methods (11,13,14), fix in cold methanol (-20°C) for 5 s and cold acetone (4°C) for 3 x 5 s, air-dry, and store at -20°C until use (see Note 1). 2. Incubate slides for 10 min at room temperature with blocking buffer. 3. Incubate slides for 45 min at room temperature with undiluted culture supernatant of the appropriate antigen-specific MAb containing 2% NGS. 4. Wash slides for 2 x 5 mm with washing buffer. 5. Incubate slides for 45 min at room temperature with GAMAPase, diluted 1:50 in blocking buffer (see Note 2). 6. Wash slides for 5 min with washing buffer and for 5 min with PBS. 7. Visualize the antigen with the APase-fast red reaction: Mix 4 mL APase buffer, 1 mg naphthol-ASMX-phosphate tn 250 I.& buffer without PVA, and 5 mg fast red TR in 750 pL buffer without PVA just before use. Overlay each sample with 100 pL under a coverslip. Incubate the shdes for 5-l 5 mm at 37°C and wash 3 x 5 min with PBS (see Notes 3-5).
3.2. PRlNS DNA Labeling 1. Process cells for PRINS as follows: Wash slides for 2 min at 37’C with O.OlM HCl, incubate the samples with 100 pg/rnL pepsin in O.OlM HCl for 20 mm at 37’C, wash again with O.OlM HCl for 2 min, and postfix the slides in 1% paraformaldehyde in PBS for 20 mm at 4OC. Wash cells m PBS for 5 min at room temperature, followed by a wash step in 1X Tag buffer for 5 min at room temperature. 2. Prepare the PRINS reaction mix on ice as follows: Dilute 100 mM dATP, dGTP, and dCTP 1: 10 with distilled water. Dilute 100 mM dTTP 1: 100. Put together in a microcentrifuge tube: 1 pL of each of the diluted dNTPs, 1 pL of either 1 mM biotin- 16-dUTP, digoxigenin- 11-dUTP, or fluorescein- 12-dUTP (see Note 6), 5 pL of 10X Tuq buffer, 250 ng of oligonucleotide (see Note 7), 1 U Taq polymerase, and distilled water to 50 &. 3. Place 40 pL of this mixture under a coverslip on the slide, seal with rubber
cement,air-dry the rubber cement,and transfer to the heating block of the thermal cycler.
4. Each PRINS reaction cycle consistsof 2 min at 94°C (denaturation of cellular DNA, see Note 8), 5 mm at the appropriate annealing temperature (see Note 9), and 15 min at 72°C for in sztu primer extension. 5. Stop the PRINS reaction by transferring the slides (after removal of the rubber
solution seal) to 50 mL of PRINS stop buffer in a Coplin jar at 65°C for 1 min.
lmmunocytochemistry and PRINS
57
6. Transfer the slides to washing buffer at room temperature and wash for 5 min. 7. Place 40 pL of blocking buffer under a coverslip on the slide and leave for 5 min at room temperature to reduce background staining in the detection procedures. 8. Wash slides for 1 x 5 min in washing buffer. 9. For reactions using biotin-16-dLJTP: Dilute AvFITC 1: 100 in blocking buffer and apply 50 pL under a coverslip. Incubate slides for 30 min at 37°C in a humid chamber (Note 10). 10. For reactions using digoxigenin-1 l-dUTP: Dilute SHADigFITC 1: 100 in blocking buffer and treat as in 9 (see Note 10). 11. Fluorescein- 12-dUTP needs no additional reporter and is simply mounted as described in 13 (see Note 10). 12. Wash slides for 2 x 5 min in washing buffer. Alternatively, you may wash the slides for 5 min in PBS and dehydrate them. 13. Mount the slides in Vectashield containing 0.5 pg/mL DAPI. 14. Examine the slides under a microscope equipped with suitable filters. Selected cells can be directly photographed using Kodak 400 ASA film, vrsuahzed with a charge-coupled device (CCD) camera, or scanned with a confocal scanning laser microscope (CSLM).
4. Notes 1. Since methanol-acetone fixation is a very mild fixation procedure, preservation of cell morphology may be a serious problem after PRINS. Furthermore, we frequently observe fluorescent staining of the entire nucleus after PRINS labeling, probably caused by nuclease activities that survive methanol-acetone fixation. Therefore, other fixatives should be tested that are compatible with antigen detection and result in a better cell morphology and specific PRINS labeling. In the case of the H460 cells, a fixation with cold 70% ethanol (-20°C) for 10 min proved to be a valid alternative. 2. If amplification of the immunocytochemical signal is needed, a third detection step may be added after this second incubation step. For details of possible reagents to use, see Table 2 in Chapter 3. 3. It is recommended to monitor the enzyme reaction under the microscope to adjust the reaction time to ensure the precipitate becoming discretely localized and not so dense that it shields nucleic acid sequences in the PRINS reaction. 4. To ensure the specificity of the APase-fast red staining, a control slide with FITCconjugated secondary antibodies is recommended for comparison. Staining specificity can be lost if cells contain endogenous APase activity. This endogenous enzyme activity can be inhibited by the addition of levamisole (Sigma) to the reaction medium to a final concentration of l-5 mM. 5. Do not dehydrate the slides after the APase reaction, because the precipitate dissolves in organic solvents. Optionally, you may air-dry the slides after rinsing in distilled water. 6. In the case of labeling with biotin-16-dUTP or fluorescein-12-dUTP, a fourfold decrease in the concentration of dTTP in the PRINS reaction mix resulted in
58
7.
8.
9. 10. a.
b.
c. d.
Speel et al. significantly stronger labeling of DNA sequences. Under the standard conditions described, digoxigenin-1 1-dUTP provides the highest sensitivity. However, all the modified nucleotides are suited for detection of repeated sequences in situ. The concentration of the appropriate oligonucleotide resulting in positive signals needs to be determined by experiment. Generally, 250 rig/slide m 40 pL are used for prtmers of 16-30 bases complementary to repeated sequences. Separate denaturation of cellular DNA in 70% formamide/2X SSC, pH 7.0 for 2 mm at 70°C before the PRINS reaction, as is usually performed for chromosome preparations, resulted in no or only weak PRINS labeling of DNA sequences in sm. Whether this is caused by inefficient primer annealmg or extension is not clear at the moment. The same phenomenon is also observed for PRINS on frozen tissue sections (5, see Chapter 5) The optimum primer annealing temperature is only determined empirically. We usually try a series from 45 to 7O”C, in 5°C steps. Amphtication of PRNS signals can be achieved as follows: AvFITC detection of biotin-16-dUTP may be followed by mcubation with biotinylated goat antiavtdin (Vector), 1: 100 diluted in blocking buffer, and again AvFITC. SHADigFITC detection of digoxlgenm-1 1-dUTP may be followed by incubation with FITC-conjugated antisheep IgG (Boehrmger) or as described for FITCI2-dUTP amplification (see Note 10~). Fluorescein-12-dUTP signals may be amplified by incubation with monoclonal mouse antiFITC (Dako) and FITC-conjugated rabbit antimouse IgG (Dako). Amplification of PRINS signals may also be achieved by utilizing peroxidasemediated deposition of hapten- or fluorochrome-labeled tyramides (9,I5).
References 1, Bains, M. A., Agarwal, R., Prmgle, J. H., Hutchinson, R. M., and Lauder, I. (1993) Flow cytometric quantitation of sequence-specific mRNA in hemapoietic cell suspensions by primer-induced in situ (PRINS) fluorescent nucleotide labeling. Exp Ceil Res. 208,321-326.
2. Koch, J., Mogensen, J., Pedersen, S., Fischer, H., Hindkjar, S., Kolvraa, S., and Bolund, L. (1992) Fast one-step procedure for the detection of nucleic acids in situ by primer-induced sequence-specific labeling with fluorescein- 12-dUTP. Cytogenet. Cell Genet. 60, l-3. 3. Gosden, J and Lawson, D. (1994) Rapid chromosome identification by oligonucleotide-primed in situ DNA synthesis (PRlNS). Hum. Mol. Genet 3,93 1-936. 4. Pellestor, F., Girardet, A., Lefort, G., And&o, B., and Charlieu, J. P. (1995) PRINS as a method for rapid chromosomal labeling of human spermatozoa. Mol. Reprod. Dev. 40,333-337.
5. Speel, E. J. M., Lawson, D., Ramaekers, F. C. S., Gosden, J. R., and Hopman, A. H. N (1996) Rapid brightfield detection of oligonucleotide primed in situ (PRINS) labeled DNA in chromosome preparations and frozen tissue sections. Biotechniques 20,226-234.
lmmunocytochemistry and PRINS
59
6. HindkjEr, J., Koch, J., Terkelsen, C., Brand& C. A., Kblvraa, S., and Bolund, L. (1994) Fast, sensitive multicolor detection of nucleic acids in srtu by primed in situ labeling (PRINS). Cytogenet. Cell Genet. 66, 152-154. 7. Speel, E. J. M., Lawson, D., Hopman, A. H. N., and Gosden, J. (1995) MultiPRINS: multiple sequential oligonucleotide primed in situ DNA synthesis reactions label specific chromosomes and produce bands. Hum. Genet 95,29-33. 8. Abbo, S., Dunford, R. P., Miller, T. E., Reader, S. M., and King, I. P. (1993) Primer-mediated in situ detection of the B-hordein gene cluster on barley chromosome 1H. Proc. Nutl. Acad. Sci. USA 90, 11,821-l 1,824. 9. Speel, E. J. M., Ramaekers, F. C. S., and Hopman, A. H. N. (1995) Cytochemical detection systems for in situ hybridization, and the combination with mnnunocytochemistry. Histochem. J. 21,833-858. 10. Speel, E. J. M., Herbergs, J., Ramaekers, F. C. S., and Hopman, A. H. N. (1994) Combined immunocytochemistry and fluorescence in situ hybridization for simultaneous tricolor detection of cell cycle, genomic, and phenotypic parameters of tumor cells. J. Histochem. Cytochem. 42,96 1-966. 11. Glaser, T., Housman, D., Lewis, W. H., Gerhard, D., and Jones, C. (1989) A finestructure deletion map of chromosome 1 lp: analysis of Jl series hybrids. Somatic Cell A401 Genet 15,477-501. 12. Boerman, 0. C., Mtjnheere, E. P., Broers, J. L. V., Vooijs, G. P., and Ramaekers, F. C. S. (1991) Biodistribution of a monoclonal antibody (RNL-I) against the neural cell adhesion molecule (NCAM) in athymic mice bearing human smallcell lung-cancer xenografts. Int. J. Cancer 48,457-462. 13. Dorm, J. R., Inglis, J. D., and Porteous, D. J. (1989) Selection for precise targeting of a dominant marker by homologous recombinatron. Science 243,1357-1360. 14. Camey, D. N., Gazdar, A. F., Bepler, G., Guccion, J. G., Marangos, P. J , Moody, T. W., Zweig, M. H., and Minna, J. D. (1985) Establishment and identification of small cell lung cancer cell lines having classic and variant features. Cancer Res. 45,2913-2923.
15. Bobrow, M. N., Harris, T. D., Shaughnessy, K. J., and Litt, G. J. (1989) Catalyzed reporter depositron, a novel method of signal amplification. Amplification to immunoassays. J. Immunol. Methods 125,279-285.
9 Chromosomal PRINS DNA Labeling Combined with Indlrect lmmunocytochemistry Arthur R. Mitchell 1. Introduction The technique of in situ hybridization developed initially by Pardue and Gall (1) and Jones (2) can be placed on a par with Southern (3) hybridtzation in the enormous contribution it has given to the fields of cellular and molecular biology in eukaryotes. Initially developed for repetitive DNAs in mammalian cells, it is now used to assign the chromosomal loci of all kinetic classes of DNA molecules throughout the animal and plant kingdoms. PRINS hybridization developed by Koch et al. (4) was a clever improvisation using oligonucleotide primers to anneal to chromosomal DNA sequencesfollowed by extension using DNA polymerase. A reporter molecule (a digoxigenin or biotinylated deoxynucleotide triphosphate) was incorporated during the reaction. The reporter molecule was then detected using an immunocytochemical approach. Improvements to the basic PRINS technique involve direct incorporation of fluorochrome-tagged deoxynucleotide triphosphates, negating the need for secondary labeling and, the “cycling PRINS” (5) reactions. Here, multidenaturation, annealing, and extension steps are carried out giving greater sensitivity and signal strength, especially when dealing with low-copy chromosomal repeat sequences. Chromosomes, however, do not contain only DNA molecules. More than half of the bulk of a chromosome consists of protein molecules, which themselves can be separated into two classes: the histone and the nonhistone proteins. The interacfions of proteins from these two classeswith chromosomal DNA lead to the formation of a visible chromosome when eukaryotic cells undergo mitotic and meiotic cell divisions. The precise mechanism underlying this process is not well understood. This is parFrom
Methods MI Molecular B!ology, Vol. 71’ PRlNS and In Situ PCR Protocols Edited by J R Gosden Humana Press Inc , Totowa, NJ
61
62
Mitchell
titularly the case for the nonhistone proteins. Some nonhistone proteins (like the histones, which interact with DNA sequences to form the basic nucleosoma1 structure) must also bind directly to specific nucleotide sequences along the backbone of the DNA molecule. One example consists of the scaffold proteins (6). These are nonhistones that are thought to be responsible for attaching specific DNA sequencesto the chromosome scaffold. From the scaffold attachment sites, it is thought that loops of DNA, 100-200 kb m length, protrude into the surrounding matrix of the cell. The functional significance of these loops remains unclear, but it is thought that this is one of the intermediary higher-order structures necessary for the formation of a condensed chromosome. Nor&stone proteins are also thought to be integral parts of the kinetochore of mammalian chromosomes (7). This specialized structure is found at the primary constrictron of mammalian chromosomes and is the site of attachment of spindle microtubules during cell division. An understanding of the proteins associated with this structure has come from the use of autoantibodies from some CREST patients who have a complex scleroderma syndrome (8). Other nonhistone proteins, such as HP1 of Drosophila (9) and Its homologs in human and mouse genomes (IO), interact with other as yet unknown chromosomal proteins leading to the condensation of heterochromatic domains within mammalian chromosomes. Antibodies have been raised against other nonhistone proteins (II) and against histone molecules that have undergone posttranslatlonal modifications, such as acetylation (IZ), using indirect mununofluorescence as the means of detecting the position of these proteins on chromosomes. These results have increased our understanding of how some of the protein constituents of chromosomes interact with one another. An extremely useful approach has been the combination of the two techniques described above, i.e., PRINS, using sequence-specific DNA primers, with indirect rmmunocytochemistry, using antibodies raised against defined proteins. The precise spatial relationship on the metaphase chromosome of a known family of DNA sequences with, for example, a protein thought to be associated with kinetochore structure can be directly correlated by this approach. This chapter describes such a procedure. As the number of antibodies against cytologically important proteins increases, the application of this approach will become increasingly popular with molecular cytologtsts. 2. Materials
2.1, Blood Lymphocyte Cultures 1. Dulbecco’s phosphate-buffered saline (PBS) solution: 0.2 g/L KU, 8.0 g/L NaCl, 0.2 g/L KH2P04, 1.5 g/L Na2HP04. 2. Potassium chromosome medium (KCM) solution: 120 mM KCl, 20 mA4 NaCl, 10 mA4Tris-HCl, pH 8.0,0.5 mkfEDTA, 0.1% (v/v) Triton X-100.
Chromosomal PRINS
63
3. RPMI-1640 medium (Gibco-BRL, Life Technologies Ltd., Paisley, Scotland). 4. Fetal Calf serum (Gibco-BRL). 5. Glutamine (Sigma, Poole, Dorset, England) stock solution 0.3% in water, filter-sterilized. 6. Colcemid (Boehringer Mannheim, Lewes, Sussex) stock solution, ng/mL in water, filter-sterilized. 7. Lymphopaque (Nyegaard Diagnostica, Norway). 8. Lipopolysaccharide (Sigma). 9. Coulter counter or other cell counter. 10. Cytocentrifuge (Ames Cyto-Tek or Shandon Cytospin). 11. Bench-top centrifuge (e.g., WIFUG or Chilspin [Fisons, England]). 12. CO, controlled mcubator.
2.2. Antibodies 1. Normal goat serum (NGS) (Scottish Antibody Production, Law Hospital, Scotland). 2. FITC-labeled second antibody, rabbit antimouse, or rabbit antihuman immunoglobulins (Sigma). 3. Primary antibody-autoimmune anticentromere serum (a gift from George Nuki, Rheumatic Diseases Unit, Western General Trust Hospital, Edinburgh). 4. Blocking solution-4X SSC, 0.05% Triton X- 100,0.6% dried skimmed nonfat milk.
2.3. PRINS 1. dNTP solution-containing the following 2’-deoxyribonucleotide 5’-triphosphates (Pharmacia, Biotech, St. Albans, England): 2.0 mM 2’-deoxyadenostne Striphosphate (dATP); 2.0 n&Q-deoxyguanosine 5’-triphosphate (dGTP); 2.0 mM 2’-deoxycytidine 5’-triphosphate (dCTP); and 0.1 mA42’-deoxythymidine 5’-triphosphate (dTTP). 2. 10X Tuq DNA polymerase buffer (Boehringer Mannheim). 3. Tag DNA polymerase (Boehringer Mannheim). 4. Digoxigenin-l l-2’-deoxyuridine-5’-triphosphate (Dig-l l-dUTP) (Boehringer Mannheim). 5. 5-(N-[N-biotinyl-a-amino caproyll-3-amino-allyl) uridine 5’ triphosphate (Bio 11-dUTP) (Sigma). 6. Specific primer (from 15-32 bases in length) oligonucleotide solution in O.OlM Tris-HCl, pH 7.4. The concentration should be 300-500 ng/pL.
2.4. Chromosome
Staining and Detection
1. DAPI (4’, 6-diamidino-2-phenylindole) (Sigma). 2. Formalin solution (4% v/v formaldehyde in KCM) (1: 10 dilution of formaldehyde, which in concentrated solution is at 40%; the final concentration is 4%). 3. Texas red avidin (Vector Labs, Burlingame, CA). 4. Vectashield (Vector Labs). 5. Antidigoxigenin rhodamine-labeled FAB fragments (Boehringer Mannhetm).
64
Mitchell
3. Methods 3.7. Lymphocyte Cultures from Mouse Spleen Cells 1, Kill mice by cervical dislocation and remove the spleen under sterile conditions (see Note 1). 2. Remove cells from the spleen by forcmg 2 x 5 mL of RPM1 medium through it using a 25-gage needle in a Petri dish. Pellet the cells at 135g for 10 mm, and resuspend m 2 mL RPM1 medium. 3. Add 3 mL of phosphate-buffered saline, and load the cell suspension onto 3 mL of lymphopaque. Centrifuge the sample at 91 lg for 20 min at room temperature using a swing-out rotor (no brake). 4. Remove the lymphocyte layer (a clearly visible band) usmg either a fine plastic pipet or 2 l-gage needle syringe, and wash the cells in RPM1 containing 15% fetal calf serum (FCS) supplemented with glutamine (to a final concentration of 0.03%). 5. Pellet the cells at low speed (as in step 3), and resuspend in 10 mL of the same medium (as in step 4). 6. Count cells with hemocytometer. 7. Set up cultures of 10-r& vol in RPM1 containing the glutamine supplement (step 4) to lo6 cells/ml for 72 h at 37°C. Add the lipopolysaccharide (Sigma) to 0.25 mg/mL to stimulate cell growth. 8. Dividing lymphocytes grow as columns of cells on the surface of the culture dish. The number of these columns of cells is normally a good indicator of the health of the culture.
3.2. Human Blood Lymphocyte Cultures (see Note 2) 1. Defibrinate blood with sterile glass rod. 2. Dilute the defibrinated blood (10-20 mL) with 5-10 mL of either RPMI-1640 medium or PBS, and load onto 3.5 mL of lymphopaque as described in Section 3. l., step 3. Centrifuge, and so forth, as described in Section 3 l., step 3 and onward.
3.3. Metaphase Preparations 1. Add colcemid to each culture to a final concentration of 0 1 pg/mL for l-2 h 2. Release the cells from the flask surface by physically hitting the side of the flask using the palm of your hand. Pellet the cells at low speed (see Section 3.1.) step 2). 3. Pour off supernatant, or suck off using vacuum Ime. 4. Resuspend the cells in approx 10 mL of hypotonic solution (75 mMKCl), and either incubate at 37OC for 10 min or alternatively at room temperature for 12 mm.
3.4. Metaphase Spreads 1. Determine the concentration of the cells in the hypotomc solution using a hemocytometer or other cell-counting device. 2. The optimum cell concentration for the preparation of metaphase spreads using an Ames Cyto-Tek cytocentrifuge (Bayer Diagnostics UK, Basingstoke, UK) is l-2 x 10s cells /mL. 3 The Ames Cyto-Tek cytocentrifhge uses 0.5- or l-n& disposable sample chambers.
Chromosomal PRINS
65
4, Dilute the sample with hypotonic KC1 to the correct concentration. 5. Load the correct volume and centrifuge for 10 min at 2500g onto alcoholcleaned slides. 6. Check the first spreads under phase-contrast microscopy to ensure that the cell concentration requires no adjustment (see Note 3). 7. Wipe the surrounding edges of the square of cells on the slide using a tissue to remove excess fluid. 8. Allow slide to stand in the air for 2 min. 9. Place slide in a Coplin jar containing KCM for 10 min at room temperature.
3.5. UV Fhorescence 1. Add 50 fi Vectashield. 2. Add coverslip (alcohol-cleaned), and seal with rubber solution. 3. Detect signal under UV fluorescence using appropriate filters for FITC (green signal), Texas red, or rhodamine (red signal) and DAPI (blue signal) (see Note 4). 4. Photograph images using Kodak T-max 400 (black and white) or Kodak Ektachrome Pan 400 (color). 5. Alternatively, capture images using a microscope equipped with a CCD camera coupled with a digital imaging system. Examples
of results obtained by this method are shown in Figs. 1 and 2.
3.6. Antibody
Reactions
1. Remove excess KCM by draining, followed by wiping the slide edges with a tissue. 2. Place slide in a moist chamber (a sandwich box with wetted tissues or Whatman’s filter paper) making sure that the slide is above the moist layer by laying it on glass or plastic runners. 3. Add the first (primary antibody) diluted 1:300-1:500 in KCM contaming 10% NGS. Use 40-50 pL of antibody solution/slide and cover this using either a square of Parafilm or an alcohol-cleaned coverslip. 4. Incubate for 1 h at room temperature. 5. Wash slide in KCM to remove unbound primary antibody. Normally 2-3 x 5 min washes in Coplin jars are sufficient. Drain the excess fluid as in step 1 above. 6. Apply the second (FITC-labeled) antibody (1:20) dilution in KCM with 10% NGS. Use the same procedure as described in step 3 above. 7. Incubate for 40-60 min (see Note 5). 8. Wash slide in KCM for 5-10 min to remove excess antibody. 9. Fix the chromosomes on slide in KCM containing 10% (v/v) formalin. 10. Wash slide in water. 11. Air-dry and store in the dark at room temperature.
3.7. PRINS 3.7.1. Pretreatment I. The following procedure is recommended to increase the fluorescent signal (see Note 6).
Fig. 1. PRINS on human lymphocyte chromosomes prepared as described in the text, combined with an immunocytochemical procedure for kinetochore detection. The oligonucleotide AAAGAAGCITKTGAGAAACTGCTTAGTGT was used in this reaction, It is specific for the human alphoid consensus sequence. The antibody used for the kinetochore labeling wasCREST ACA serum (seete@ The PRINS product wasdetected with rhodamine, whereas the CREST was detected using FITC-labeled antihuman IgG. Chromosomes were counterstained with DAPI. Three sequential photographs were taken, each with a filter specific for a single fluomchmme. (A) PRINS labeling (rhodamine). (B) Position of CREST ACA serum (FITC). (C) DAPI-stained chromosomes. Note that in this figure, the signals from both the alphoid DNA and CREST labeling are at the same position on each human chromosome.
Chromosomal
PRINS
67
Fig. 2. PRINS reaction using an oligonucleotide specific for human classical satellite DNA III combined with immunocytochemical detection of kinetochores. The oligonucleotide was (CCATT)7. CREST ACA serum was used to locate the kinetochores. Labeling and photography are as for Fig. 1. (A) PRINS labeling. (B) CREST ACA labeling. (C) DAPI-stained chromosomes. Note that, in this instance, the CREST signal and the simple-sequence satellite DNA do not colocalize to the same position on human chromosome 9 (arrows).
68
Mitchell
2. Immerse slide in 0. 1MNaOH for 10-40 s (see Note 7) followed by neutralization with 2 x 5 min washes in O.OlM Tris-HCl, pH 7.4. Finally, wash slide briefly in distilled water before air-drying. 3. Dip slide into 3: 1 methanol-acetic acid for 2 x 2 min (see Note 8). Follow this by washing in O.OlM Tris-HCl, as in step 2. 4. Pass slide through 70,90, and 100% alcohols (all at 4°C). Allow 2 min for each alcohol step. 5. Air-dry the slide. 6. The slide can be stored in the dark for several weeks at room temperature at this stage.
3.7.2. Denaturation 1. Denature chromosomal DNA by putting the slides into 30 mM NaOH and 1M NaCl (check pH, making sure it is above 12.0) for 45 min at 4°C. 2 Neutralize in O.OlMTris-HCl, pH 7.4 (two changes), usmg Coplm jars. 3. Remove excess fluid by draining. Follow this by blowmg a Jet of air across the slide using a pipet and bulb until dry.
3.7.3. Annealing and Extension 1. To each slide (prewarmed to the annealing temperature) add 50 & of a solution containing: 5 pL of 10X Tuq buffer, 2.5 pL of dNTPs solution, 1.5 pL oligonucleotide primer, 1.0 $ Dig-l l-dUTP or Bio-1 I-dUTP, 37 $ distilled H,O, 1 pL Taq DNA polymerase. 2 Add prewarmed coverslip (alcohol-cleaned), and seal using rubber solution. 3. Anneal for 10 min at 50-55’C. 4. Extend at 64°C for 20-25 min.
3.7.4. Detection 1. Remove the coverslip carefully using a scalpel blade (avoid moving the coverslip across the chromosome spread). 2. Place slide in 50 mMEDTA, 100 mMNaC1 at 4°C for 3 min. 3. Place slide in 4X SK, 0.05% Triton (at 4’C) for 3 min. The slide can be stored at 4°C in this solution at this stage. Alternatively, it can be washed briefly m water and air dried. 4. Place slide in blocking solution (at 4’C) for 3 min. 5. Remove excess fluid by drainmg. 6. Add 50 pL of blocking solution containing 1: 100 dilution of Texas red-conjugated avldin to detect incorporated bio-1 l-dUTP or 1: 100 dilution of antidigoxlgemn-rhodamme FAB fragment to detect incorporated dig- 11-dUTP. 7. Cover with a coverslip or Parafilm square and incubate m a moist chamber as described m Section 3.6., step 4 for 40 min. 8. Wash in 4X SSC, 0.05% Triton for 3 min at room temperature. 9. Stain chromosomal DNA with DAPI for 5 min. Use 50 pL. from a 1 pg/mL solution. Cover with coverslip or Parafilm square.
Chromosomal P/?/A/S
69
10. Remove coverslip and wash in water for 5 min. 11. Air-dry.
4. Notes 1. The spleen is easily located, since it lies Just beneath the skin surface on the left rear dorsal surface. Use spray to sterilize the surroundmg fur with absolute alcohol. Cut the fur and pull it back to reveal the underlying skin. The spleen can be seen as the dark red oblong structure lying directly beneath the skin, Make an incision into the skin and pull out the spleen using sterile forceps. Separate from internal organs with sterile scissors. 2. It is inadvisable to culture blood lymphocytes from oneself. There are risks involving immortalization of your own cells. 3. Low concentrations of cells lead to metaphase spreads containing stretched or pulled chromosomes. Too high a concentration of cells tends to produce dense clumps of cells with poorly spread divisions. It is worthwhile at this stage adjusting concentrations by a factor of 2 or 3 (up or down) to obtain optimum spreads. 4. With the Leitz Ortholux-2 microscope, the corresponding filters are A, I 2/3, and N2, respectively (see Section 3.5 , step 3). 5. For human cells, the second antibody is goat antihuman immunoglobulin. In the case of mouse chromosomes, the second antibody is goat antimouse immunoglobulin. 6. The procedure adopted for the fixation of antibodies to chromosomal proteins often makes accessibility to the chromosomal DNA sequences by DNA polymerases extremely difficult. The end result is either a poor signal or no signal at all after PRINS has been carried out. Thus, additional treatments are required to improve accessibility. 7. The time required will vary according to the repeated DNA family of sequences under study and the cell type from which the chromosome preparation was made. 8. This again may vary according to the cell type and family of repetitive DNAs under study.
References 1. Pardue, M. L. and Gall, J. G. (1969) Molecular hybridization of radioactive DNA to the DNA of cytological preparations Proc Nat1 Acad. SCL USA 64, 600-604. 2. Jones, K. (1970) Chromosomal and nuclear location of mouse satellite DNA in individual cells. Nature 225,912-915. 3. Southern, E. M. (1975) Detection of specific sequences among DNA fragments
separated by gel electrophoresis. J. Mol. Biol. 98,503-5 17 4. Koch, J. E., Kelvraa, S., Petersen, K. B., Gregersen, N., and Bolund, I. (1989) Oligonucleotide-priming methods for the chromosome-specific labeling of alpha satellite DNA in situ. Chromosoma 98,259-265. 5. Gosden, J. and Hanratty, D. (1993) PCR in situ: A rapid alternative to in sztu hybridization for mapping short, low copy number sequences without isotopes. BloTechniques 15,78-80.
70
Mitchell
6. Saitoh, N., Goldberg, I. G., Wood, E. R., and Eamshaw, W. C. (1994) Scl 1: an abundant chromosome scaffold protein is a member of a family of putative ATPases with an unusual predicted tertiary structure. J. Cell Biol 127,303-3 18. 7. Cooke, C. A., Bernat, R. L., and Earnshaw, W. C. (1990) CENP-B; a major human centromere protein located beneath the kinetochore. J. Cell Biol 110,1475-1488. 8. Earnshaw, W. C. and Rothfield, N. (1985) Identification of a fannly of human centromere proteins using auto-immune sera from patients with scleroderma Chromosoma 91,3 13-321. 9. James, T. C. and Elgin, S. C. R. (1986) Identification of a nonhistone chromosomal protein associated with heterochromatin m Drosophila melanogaster and Its gene. Mol. Cell Biol. 6,3862-3872 10. Saunders, W. S., Chue, C , Goebl, M., Craig, C., Clark, R. F., Powers, J. A., Eissenberg, J. C., Elgin, S. C. R., Rothfield, N. F., and Earnshaw, W C. (1993) Molecular cloning of a human homologue of Drosophila heterochromatm protein HP1 using anti-centromere auto-antibodies with anti-chrome specificny J Cell SCI. 104,573-582.
11. Meehan, R. R., Lewis, J. D., and Bird, A. P. (1992) Characterisation of MeCP2, a vertebrate DNA binding protein with affinity for methylated DNA. Nucleic Acids Res 20,5082-5092.
12. Turner, B. M. and Fellows, G. (1989) Specific antibodies reveal ordered and cellcycle-related use of histone-H4 acetylation sites in mammalian cells. Eur J. Biochem 179, 13 1-139.
10 Direct ln Situ Single-Copy (DISC)-PCR Deryl L. Troyer, Hongyan Xie, and Jie Hu 1. Introduction The physical mapping of functional genes and polymorphic markers is obviously important for understanding genome organization in higher organisms, Fluorescence in situ hybridization of labeled DNA to metaphase chromosome spreads has been a very effective means of accomplishing this goal (1,2), but it is difficult to routinely detect sequences <3-5 kb m length using this technique (3). Since the polymerase chain reaction (PCR) (4) provides a means to amplify a single copy of DNA to literally hundreds of thousands of copies in a short time, in principle it could be utilized to detect very short sequences directly on metaphase chromosomes. It has been demonstrated that PCR can be performed on the surface of a slide containing cells (5) and that the PCR process can incorporate biotin-dUTP mto the amplification product (6). On-slide PCR with a smgle primer has been used to detect low-copy sequences on metaphase chromosomes (3). Oligonucleotide premed in situ synthesis (PRIM) (7), in which an oligonucleotide is annealed to denatured chromosomes and extended by a DNA polymerase, has also proven to be an effective method to detect low-copy sequences. Direct in situ single-copy (DISC)-PCR is a method that uses two primers that define unique sequences for on-slide PCR directly on metaphase chromosomes (8). It thus allows exponential accumulation of PCR product at specific sites, while incorporating a hapten-tagged nucleotide, such as biotin- 16-dUTP, into the amplified product. This is followed by detection with streptavidinsignaling enzyme and application of appropriate substrate to yield a chromogenic deposit at the amplification site. The DISC-PCR procedure has been used to localize sequences as short as 100-300 bp to mammalian chromosomes @HZ). It is particularly suited for From
Methods in Molecular Wology, Vol 71. fRtN.5 and In SW PCR Protocols Edited by J R. Gosden Humana Press Inc , Totowa, NJ
71
72
Troyer, Xie, and Hu
physically assigning sequence tagged sites (STSs), such as microsatellites (ms) (12,13), many of which cannot be assigned by in situ hybridization because they have been isolated from small-insert libraries for rapid sequencing. It can also be utilized to map expressed sequence tags (ESTs) physically (8,Z4). DISC-PCR obviates the necessity for an investigator to have a cloned gene in hand, since all that is necessaryis to have enough sequenceinformation to synthesizePCR primers. Its major disadvantages at the present are that a large number of metaphase spreads must be analyzed, and banding is difficult after the procedure.
2. Materials 2.7. DISC-PCR 1. 2. 3. 4. 5. 6. 7. 8.
2’DeoxyadenosineS-triphoaphate(dATP): 10mA4(Perkin-Elmer,Norwalk, CT). 2’-Deoxycytidine 5’-tiphosphate (dCTP). 10mM (Perkin-Elmer). 2’-DeoxyguanosineF&phosphate (dGTP): 10 mM (Perkin-Elmer). 2’-Deoxythymidine S&phosphate (dTTP): 10mM (Perkin-Elmer). Biotin- 16-dUTP: 5 mA4(Boehringer Mannheim, Indtanapolis, lN). Primers (20 m (see Note 1). AmpliTaq DNA polymerase(Perkin-Elmer). Polymerasebuffer (10X) (Perkin-Elmer): 100 mM Tris-HCl, pH 8.3, 500 mM KCl, 15mMMgC&, 0.1% BSA (seeNote 2). 9. Glassmicroscopeslides and 20 x 50 mm coverslips soakedin absoluteethanol and wiped with lint-free gauzejust before dropping the spreads. 10. Nail enamel (seeNote 3).
2.2. Sjgne/ Defection 1. 20X SSC:3.0MNaC1,0.3OMtrisodium citrate, pH 7.5. 2. PBS buffer: Dissolve 8.0 g NaCl, 1.3 g Na,HPO,, and 4.0 g NaH2P04 to 1 L ddHzO;adjust pH to 7.4. 3. Blocking buffer: 100 mM Tris-HCl, pH 7.5; 150 mM NaCl, 0.5% blocking reagent (BMB Genius kit). To do this, first make Tris-NaC1 solution, then add blocking reagent,and stir until dissolved--may take up to 1h. 4. Working buffer: 100mMTris-HCl, pH 7,5,15OmMNaCl,0.2%Tween,0.3%Triton. 5. Streptavidin-horseradish peroxidase,1n@nL (VectorLaboratories,Burlingame,CA). 6. 3,3’,5,5’Tetramethylbenzidine (TrueBlue), Kirkegaard-Perry Laboratories (Gaithersburg, MD). 7. Nuclear fast red (contrastred), (Kirkegaard-Perry Laboratories).
2.3. Bending 1. Propidium iodide (Sigma, St. Louis, MO), 500 pg/mL. 2. PPD-11: Add 100 mg of PPD @-phenylenediamine, free base, Sigma) to a mixture of PBS (10 mL) and glycerol (90 mL). Adjust the pH to 11.0 with l.OM NaOH. Protect the solution against light, heat at 37°C until completely dissolved, aliquot, and store in the dark at -2OT.
DISC-PCR
73
3. Methods 3.1. DISC-PCR 1. Prepare metaphase chromosomes using standard techniques (IS). 2. Wash slide in PBS buffer for 10 min; dehydrate in ethanol series (70, 80, 95, 100%) (see Note 4). 3. For each slide, prepare the following solution in a microfuge tube: 200 @4 each dATP, dCTP, dGTP; 100 @4 dTTP; 100 @4 brotin-16-dUTP (see Note 5); 1.5 weach primer; 2.0 pL 10X Taq buffer; 2.5 U Ampliraq polymerase; and ddHzO to 20 uL. 4. Add the above reaction mixture to metaphase chromosomes on a slide and cover with a 22 x 50 mm coverslip. 5. Seal the perimeter of the coverslip with clear nail polish (see Note 6). One heavy coat is sufficient. 6. Allow polish to dry at room temperature, cover the edges of the slide with silicone grease (Dow Corning Corporation, Midland, MI), and then incubate slides in a suitable thermal cycler (see Note 7) using the following profile: a. 94°C for 3 min b. Annealing temperature of primers for 1 min. c. 72°C for 1 min. d. 92’C for 1 min. e. Cycle to step b 24 more times (25 cycles total). f. Final extension step of 3-5 min.
3.2. Post-DISC-PCR
Washes
1. Remove silicone grease with a tissue, and dip slide in 100% ethanol. Using a sharp razor blade, cut through nail polish around the coverslip, then gently lift the edge of the coverslip, and remove. From this point, it is very important never to allow the slides to dry, although excess buffer can be blotted off the slide edge using a tissue. 2. Immediately immerse slide in 4X SSC, then remove slides one at a time, scrape nail polish from the edges of the slide, and immerse the slide in blocking buffer for 1 h.
3.3. Signal Detection 1. Remove slides from blocking buffer, gently shake off excessbuffer, and add 100 pL of diluted (1: 100) streptavidin-conjugated horseradish peroxidase (diluted in working buffer) (see Note 8). 2. Signal “networking” with one or more rounds of biotinylated antistreptavidin followed by streptavidin-horseradish peroxrdase can be used, but we have found this to be unnecessary with the tetramethylbenzidine (TMB) detection system. 3. Carefully place a 22 x 50 mm coverslip on the slide, place the slide in a humidity chamber, and incubate at 37°C for 1 h. 4. Wash once in working buffer for 10 min at room temperature.
Troyer, Xie, and Hu
Fig. 1. Arrows indicate signals after DISC-PCR on porcine chromosomes using microsatellite primer pairs. (A) Sw137 on chromosome lp, and (B) Sw2440 on chromosome 13. 5. Wash in O.lM Tris-HCl, pH 7.6, for 5 min at room temperature. 6. Apply 100 pL TMB, coverslip, and allow l-2 min at room temperature (a blue tint will appear on slide). 7. Wash with ddH,O for 5 min. 8. Apply contrast red counterstain for 5 min. 9. Dehydrate in ethanol series (20,40,70, 80,95%). 10. Mount in contrast red; seal the coverslip with nail enamel. 11. Slides are read using a phase-contrast microscope. Blue signals are plotted on histograms and statistical analysis is carried out using the Z,, statistic (16). Examples of signals are shown in Fig. lA,B.
3.4. Post-DISC-PCR Banding It is possible to obtain low-resolution R banding of chromosomes after the DISC-PCR
reaction by greatly extending
the propidium
iodide staining step in
the procedure of Lemieux et al. (17) as follows: 1. 2. 3. 4.
Presoak slide in PBS buffer for 10 min at room temperature. Stain with propidium iodide (0.5 pg/mL) for 30 min at room temperature. Wash in ddH,O; blot slide dry. Mount in PPD-11, cover, and seal.
4. Notes 1. Primers should be designed using a commercially available software program, such as the Primer 0.5 program (Whitehead Institute, Cambridge, MA). 2. The PCR procedure should be optimized for each primer pair using solution PCR. Optimal annealing temperature on-slide may differ slightly from that of solution
DISC- PCR
3.
4.
5.
6.
7. 8.
75
PCR. Usually the buffer provided with the Tuq polymerase is adequate, but occasionally adJustments in MgCl, concentration or pH must be made. An optimization kit, such as Opti-Primer PCR Kit (Stratagene, La Jolla, CA), is useful in those cases. We have tested many nail enamel brands; the only one that we have found consistently to prevent leaks is sold as Sally Hansen Hard as Nails. The seal is extremely important, since even a small leak is disastrous. With some primer pairs, we have found that overnight fixation of chromosomes with buffered neutral formalin followed by a 15mm pepsmogen (Sigma) (2 mg/mL) digestion increases signal number and intensity. Digoxigenin-1 1-dUTP can also be incorporated into the amplification product followed by detection with antidigoxigenin tagged with a reporter molecule. However, biotin-dUTP incorporation results in slightly increased signal number and intensity. Air bubbles below the coverslip must be removed before sealing This can be done by applying pressure to the coverslip over the bubble with a plastic disposable pipet tip and working the bubble to the edge. Bubbles (including small ones) will expand during the reaction and ruin the experiment. The PCR machine should be one designed for on-slide PCR. We have had good success using the BioOven III (Biotherm Corporation, Fairfax, VA). If background is a problem, decrease the streptavidin-conjugated horseradish peroxidase concentration and/or increase the duration of wash steps
References 1. Lichter, P., Cremer, T., Borden, J., Manuelidis, L., and Ward, D. C. (1988) Delineation of individual human chromosomes m metaphase and interphase cells by in situ suppression hybridization using recombinant DNA libraries. Hum. Genet. 80, 224-234. 2. Lichter, P., Tang, C. C., Call, K., Hermanson, G., Evans, G. A., Housman, D., and Ward, D. C. (1990) High-resolution mapping of human chromosome 11 by m situ hybndization with cosmid clones. Science 247,64-69. 3. Gosden, J. and Hanratty, D. (1993) PCR in situ: a rapid alternative to in situ hybridization for mapping short, low copy number sequences without isotopes. BioTechniques 15(l), 78-80. 4. Mullis, K. B., Faloona, F., Scharf, S., Saiki, R. K., Horn, G. T., and Erlich, H. A. (1986) Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harbor Symp. Quant. Blol. 51,263. 5. Yap, E. P. H. and McGee, J. 0. D. (1991) Slide PCR: DNA amplification from cell samples on microscopic glass slides. Nucleic Acids Res. 19,4294. 6. Lo, Y. M., Mehal, W. Z., and Flemmg, K. A. (1990) Incorporation of biotmylated dUTP, inPCR Protocols. A Gmde to Methods andApphcations (Innis, M. A., Gelfand, D. H., Sninsky, J. J., and White, T. J., eds.), Academic, San Diego, pp. 113-l 18. 7. Koch, J., Hindkjaer, J., Mogensen, J., Kolvraa, S., and Bolund, L. (1991) An improved method for chromosome-specific labelmg of alpha satellite DNA in situ
76
8.
9.
10. 11.
12.
13.
14. 15. 16. 17.
Troyer, Xie, and Hu using denatured double stranded DNA probes as primers in a PRimed IN Situ (PRINS) procedure. Genet. Anal. Techn. AppZ 8, 171-178. Troyer, D. L., Xie, H., Goad, D. W., and Skinner, D. Z. (1994) Use of a new technique to map the porcine I interferon gene to chromosome 1. Mammalian Genome 5,112-l 14. Troyer, D. L., Goad, D. W., Xie, H., Rohrer, G. A., Alexander, L. J., and Beattie, C. W. (1994) Use of direct in sttu single copy (DISC) PCR to physically map 5 porcine microsatellites. Cytogenet. Cell Genetics 67(3), 199-204. Troyer, D. L., Xie, H., and Goad, D. W. (1995) Use of DISC-PCR to map a porcine microsatellite. Anim. Biotechnol. 6(l), 51-58. Xie, H., Alexander, L. J., Rohrer, G. A., Beattie, C. W., and Troyer, D. L. (1995) Use of DISC-PCR and FISH to assign a linkage group to pig chromosome 10. Mammalian Genome 6, 139-141. Litt, M. and Luty, J. A. (1989) A hypervariable microsatellite revealed by in-vitro amplification of a dinucleotide repeat within the cardiac muscle actin gene. Am J Hum. Genet. 44,397-40 1, Weber, J. L. and May, P. E. (1989) Abundant class of human DNA polymorphisms which can be typed using the polymerase chain reaction. Am J. Hum Genet. 44, 338-396. Schmutz, S. M., Cornwell, D., Moker, J. S., and Troyer, D. L. (1996) Physical mapping of SOD1 to bovine chromosome 1. Cytogenet. Cell Genetics 72,37-39. Halnan, C. R. E. (1989) Banding methods, in Cytogenetics ofAnzmaZs (Halnan, C. R. E., ed.), CAB International, Wallingford, UK, pp. 451-456. Ewens, W. J., Grifftths, R. C., Ethier, S. N., Wilcox, S. A., and Marshall Graves, J. A. (1992) Statistical analysis of in situ hybridization data: derivation and use of the Z,, test. Genomics 12,675-682. Lemieux, N., Dutrillaux, B., and Viegas-Pequignot, E. (1992) A simple method for simultaneous R- or G- banding and fluorescence in situ hybridization of small single-copy genes. Cytogenet. Cell Genetics 59,3 1 l-3 12.
11 /II Sifu PCR to Cells and to Wax Sections An Alternative to In Situ Hybridjzation for the Detection of Low Copies of Human Papillomavirus and Cytomegalovirus DNA Christiane Mougin, Jean Marc Didier, Dominique Bettinger, Laurence Madoz, Sylviane Coumes-Marquet, and Michel Lab 1. Introduction In situ hybridization and solution-phase PCR are suitable methods for DNA or RNA analysis. The first protocol for in situ hybridization was described almost 25 years ago (1). Since then, this technique has proven valuable to localize cellular DNA or mRNA. It has also been applied to detect viral DNA or RNA nucleic acid sequencesin tissue sections or individual cells. The sensitivity of this procedure is, however, limited when small amounts of nucleic acids have to be detected (2-20). Solution-phase PCR, the most sensitive assay for detecting the presence of low-copy number RNA or DNA, has been frequently used over the past 10 years in many fields (for review, see II). It permits the selective in vitro amplification of a specific region of nucleic acid by mimicking the phenomenon of in vivo DNA replication (12). It has been extensively used to amplify specific nucleic acid sequencesfor analysis of viral pathogens. It has successfully improved the detection of human cytomegalovirus (CMV) and human papillomaviruses (HPV) (13-19). This method is currently limited in application, since localizing amplified sequences inside cells or tissue sections is impossible. Recently, some authors have described a new procedure combining in situ hybridization and PCR, and allowing the detection of a low abundance of target sequences in cultured or cytospun cells and in frozen or wax-embedded tissue sections. This technique has been called in situ PCR, PCR in situ, PCR in situ hybridization, in cell PCR, and PCR driven From* Methods in Molecular Biology, Vol 71, PRINS and In Situ PCR Protocols Ed&d by J R Gosden Humana Press Inc., Totowa, NJ
77
Mougin et al.
78
zn situ hybridization. Several protocols have been described so far, and the authors have stressed tlhe importance of various fixatives, fixation time, and proteolytic digestion to preserve cellular morphology and to avoid leakage of the amplified products (20-38). Thus, substantial differences between the sophisticated procedures may affect the reproducibility of the results. The amplification of low-copy target DNA or even cDNA (after a reverse transcription step) can be achieved by different protocols for in situ PCR. Direct in situ PCR is mostly conducted with the use of biotin or digoxigenin-labeled nucleotides or primers, and the visualization of the PCR products is performed using an immunohistochemistry method. Indirect in situ PCR is performed with unlabeled nucleotides or primers, and the amplified products are detected by a classical in situ hybridization using specific probes. In this chapter, feasible techniques optimized for the detection of low levels of CMV and HPV nucleic acid sequences in cultured cells and tissue sections are described (39,40). The crucial steps for successful direct and Indirect in situ PCR are pointed out. Special focus is put on the preparation of the dtfferent starting materials (paraffin-embedded tissues,HeLa cells cultured on slides, MRC5 cells cultured on microwell plates), on the importance of appropriate fixation (especially the duration) and proteolytic digestion (concentration of enzyme and duration), on the selection of appropriate oligonucleotide primers, on the use of optimal concentration of the different reagents in the PCR solution, and finally on the thermal profile of the reaction. 2. Reagents and Materials
2.1. Preparation of Poly-L-Lysine-Coa ted Glass S/ides 1. Detergent (Henkel GV). 2. Deionized water.
3. 4. 5. 6. 7. 8.
100% ethanol. Ether. Poly-L-lysine hydrobromide (Sigma, L’Isle d’Abeau Chesnes, France) IMTris-HCl, pH 8.0. Triton X-100. 26 x 76 mm slides (LL2) (CML, Nemours, France).
9. Slide racks. 10. 11. 12. 13.
Glass stainmg dishes. Coplin jar containing 2000 mL of liquid. Absorbent paper. 60°C oven.
2.2. Preparation of Paraffin-Embedded 1. Na2HP04. 2. KH2POe
Tissues
In Situ PCR to Cells and Wax Sections
79
3. Formaldehyde fixative (aqueous solution 37% [w/v]) (Prolabo, Vaux-enVelin, France). 4. Deionized water. 5. 100,95, and 80% Ethanol. 6. Xylene pure (Carlo Erba, Rueil Malmaison, France). 7. Paraffin Paraplast X-TRA (Oxford Labware, CML, Nemours, France). 8. Uni-cassettes (Bayer Diagnostics, Puteaux, France). 9. Automate for fixation (Tissue-Teck II, Lab Teck, Miles, Paris, France) 10. Heating block (Groupe thermo-blectrique d’Enrobage Tissue-Teck II, Miles). 11. Microtome (ACCU-CUT, Bayer Diagnostics; Ames Technicon, Domont, France).
2.3. Preparatjon
of Tissue Sections
1. 0.1% Aqueous glue: Dilute pure white glue (Rubafix, Barcelona, deionized water (w/v). 2. Xylene. 3. 100,95, and 80% Ethanol. 4. O.lM Tris-HCL, pH 7.4. 5. Absorbent paper. 6. Paraffin-embedded samples. 7. Microtome with knives. 8. Fine brushes. 9. Heating block. 10. 60°C oven 11. Slide racks.
2.4. Preparation 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16.
of Cultured
Spain) in
Cells
HeLa cells (Amencan Type Culture Collection, Rockville, MD) (ATCC). MRC5 cells (ATCC). EMEM media (Seromed, bioMerieux, Marcy l’Etoile, France) RPMI-1640 media (Seromed, bioMerieux). 5 and 10% Fetal calf serum (Gibco BRL, Life Technologies, L’Isle d’Abeau Chesnes, France), Nonessential amino acids (Seromed, biolllerieux). Gentamycin (Panpharma, Les Foug&res, France). Dexamethasone. Dimethylsulfoxide. PBS 1X (Eurobio, Les Ulis, France). Cytomegalovirus stram AD 169 (ATCC). 1 and 2% Buffered formaldehyde (see reagents and materials in Section 2.2.). 100,95, and 80% Ethanol. Ice-cold acetone. 10 x 10 cm Petri dishes. Poly-L-lysine-coated slides.
17. 96-Well tissue-cultureplates (Costar, CLV, Villeurbanne, France).
Mougin et al.
80 Table 1 Sequences of Oligonucleotide Origin
Name MY11 (20-mer) MY09 (20-mer) IE 1 (20-mer) IE2 (20-mer) GAPDH 1 (20-mer) GAPDH2 (20-mer)
Primers Used in In Situ PCR Sequence 5’ GCM CAG GGW CAT AAY AAT GG 3’
Upstream primer, position HPV6/ 6722-674 1 (41) Downstream primer, position HPV6/ 7170-7151 (41) Upstream primer (42) Downstream prrmer (42) Upstream primer
5’ ATC ACC ATC TTC CAG GAG CG 3’
Downstream primer
5’ CCT GCT TCA CCA CCT TCT TG 3’
5’ CGT CCM ARR GGA WAC TGA TC 3’
5’ CCA CCC GTG GRG CCA GCT CC 3’ 5’ CCC GCT CCT CCT GAG CAC CC 3’
Srzes predxted from different primer parrs. MY1 I-MY09* GAPDHl-GAPDH2.573
18. 19. 20. 2 1.
410 bp; IEl-IE2:
159 bp,
bp
Lammar flow tissue-culture hood. Moist chamber. Glass staining dishes. Low-speed centrifuge.
2.5. In Situ PCR Assay 2.5.1. Proteolytic Digestion, Denaturation of Viral DNA, and In Situ PCR 1. 2. 3. 4.
5. 6. 7. 8. 9. 10. 11. 12.
Protemase K (Sigma). O.lM Tris-HCl, pH 8.0. EDTA, 1OmM. Tuq buffer (10X): 100 mMTris-HCl, pH 8.5, 500 mMKC1, 50 mMMgC& for HPV assay and 25 mM MgClz for CMV assay, 0.1% gelatin, 0.5% Tween-20, and 0.5% Nonidet P40. dNTPs: dATP, dTTP, dCTP, and dGTP: 100 mA4 solution each (Boerhinger Mannheim, Meylan, France). Bio-14-dATP: 0.4 mMsolution (Gibco BRL, Life Technologies, Eragny, France). Oligonucleotide primers (see Table 1): synthesized by Genset (Paris, France), purified, and checked using polyacrylamide gel electrophoresis. Ampliruq (Perkin Elmer Cetus, Saint Quentin en Yvelines, France). Slides with tissue sections and HeLa cells. Microtiter plates with MRCS cells. 22 x 22 mm glass coverslips. Nail polish with hardener (Gemey, Paris, France).
In Situ PCR to Cells and Wax Sections
81
13. Sticky paper sheet (Chiron, Suresnes, France). 14. Thermal cycler (Ommslide, Hybaid, Schleicher Ecquevilly, France).
2.6. Detection 1. 2. 3. 4. 5. 6. 7. 8. 9.
10.
11. 12. 13. 14. 15. 16. 17. 18. 19.
of Amplified
and Schuell,
Ceralabo,
Products
0. IM Tris-HCl, pH 7.4. IXPBS. 20X SSC: 3MNaCI,0.3Mtrisodium citrate, pH 7.5. Alkaline-phosphatase conjugated avidin (Dako, Trappes, France). Nitroblue tetrazolium (NBT), 5-bromo-4-chloro-3-indolylphosphate (BCIP) (Glbco BRL, Life Technologies). Buffer A: 0.02M monosodium phosphate, 0.08M disodium phosphate, O.lM NaCI, 5% BSA, 0.5% Triton X-100. Store at -20°C. Buffer B: O.lM Tris-HCl, pH 9.6,O. lMNaC1, 50 mMMgC12. Store at +4”C. Biotinylated probes for HPV, CMV, HIV (Enzo Diagnostics, Valbiotech, Paris, France). Deionized formamide: Mix 500 mL of formamide (Sigma) with 50 g of ionexchange resm (AG 501-X8 CD) (Bioprobe, Montreuil sous Bois, France) and 10 g of activated charcoal (Sigma). Stir overnight at 4OC. Filter through Whatman paper and prepare 5-mL aliquots that are stored at -20°C. Dextran sulfate (Sigma): Mix 100 g of dextran sulfate in 100 mL of deionized water. Heat at 60°C until dissolved (watch carefully to avoid burning). Prepare 2-n& aliquots and store at -8O’C. Salmon sperm DNA (10 mg/mL) (Sigma): Dilute 1: 10 m deionized water and store in 250-$ aliquots at -80°C. 100% Ethanol. Aquamount. Clean muslin. Ovens at 37 and 42°C. Heating block Water bath at 96°C. Scalpel (Alframed, Bradford, England) and razor blades (Miles, Pans, France). Light microscope (Leica, Lyon, France).
3. Methods 3.1. Preparation
of Poly-L-Lysine-Coated
Glass Slides (see Note 1)
1. Prepare poly+lysme hydrobromide solution: To make a 0.05% solution, dissolve 100 mg of poly+lysine in 2L of O.OlM Tris-HCl, pH 8.0, containing 200 pL Triton X-100. This solution must be stored at 4OC. Discard it if it becomes cloudy. 2. Place glass slides in slide racks and clean with detergent; rinse with tap water and then with deionized water (2 x 10 min). 3. Transfer slide racks in two baths of 100% ethanol (10 min each), then in a mixture of 100% ethanol/ether (50/50 [v/v]) for 10 min, and dry at room temperature.
Mougin et al.
82
4. Dip slides for 20 min in a glass staining dish containing poly+lysine solution at room temperature. 5 Remove slide rack from solution, blot off excess solution with absorbent paper, and dry for 1 h in a 60°C oven. 6. Store slides in a slide box at room temperature. Poly-L-lysine-coated
3.2. Preparation
slides are stable for 1 mo.
of Paraffh-Embedded
Tissues
1. Prepare 1% buffered formaldehyde diluted in O.lM Na2HP0,, 0.04M KH2P04, pH 7.2. 2. Place the tissue biopsy in a uni-cassette and immerse in fixation buffer for the required time. Optimal fixation has to preserve cellular morphology, permit PCR reagent access to the target sequences and prevent diffusion of amplified products. Depending on tissues, fixation times ranging from 20 min to 24 h must be tested. Generally, tissues fixed for up to 12 h are suitable material for amplification (see Note 2). 3. Dehydration in five graded ethanol baths (2 x 80,2 x 95, and 1 x 100% ethanol) for 60 min each bath. 4. Incubation in three xylene baths, 60 min each. 5. Paraffin-embedding: After 1 h of incubation in the last paraffin bath at 60°C, tissue biopsies are transferred to the heating block and ready for embeddmg as classically described. Samples must be clearly identified by labeling the u&cassette. 6 Uni-cassettes are stored at room temperature in a dry atmosphere.
3.3. Preparation
of Tissue Sections
1. Cut paraffin-embedded samples m serial 4-10-w thick sections and ensure excellent ribbon continuity. Knives must be cleaned between each block to prevent sample-to-sample contamination. 2. Put one to two drops of aqueous glue on each pretreated slide. 3. Deposit 2 sections/slide on the glue and spread with fine brushes. 4. Transfer the slide to the heating block set at 45’C. 5. When stretching is complete, take off the slide from the block and remove the excess of white glue with absorbent paper. 6. Dry slides in the 60°C oven for 90 min and then cool at 20°C for 24 h. Store slides at room temperature in a slide box. Sections should not be used within 12 h of preparation. 7. Dewax sections by putting slides on the heating block for 5 mm at 60°C followed by three changes in xylene (5 min each). 8. Rehydrate in six graded ethanol baths (2 x 100,2 x 95, and 2 x 80% ethanol) for 5 min each bath. 9. Rinse for 5 min in O.lMTris-HCl, pH 7.4. The slides are not allowed to get dry at any time after this process.
Plate 1 (Fig. 1). Examples of PRINS reactions with the primers shown in Table 1. All reactions were labeled with biotin-16-dUTP, and the label detected with avidinFITC. See full caption on p. 5 and discussion in Chapter 1.
Plate 2 (Fig. 1). See partial captions on pgs. 14,32,54 and discussion in Chaptas 3,5, and 8.
Plate 3 (Fig. 1). Examples of dual-color PRIM labeling of human sperm nuclei. See full caption on p. 25 and discussion in Chapter 4.
Plate 4 (Fig. 1). Double PRIM with primers for X and Y chromosomes. These primers produce cleaner signal with less background when used in pairs as shown in Table 1. See full caption on p. 41 and discussion in Chapter 6.
Plate 5 (Fig. 1). PRINS with extended chromatin. See full caption on p. 48 and discussion in Chapter 7.
In Situ PCR to Cells and Wax Sections 3.4. Preparation of Cultured 3.4.1. HeLa Cells
83
Cells
1. Deposit five pretreated slides/Petri dish. 2. Resuspend cells (1 O6cells/ml) in 30 mL EMEM media containing 10% fetal calf serum, 1% nonessential ammo acids, and 56 mg/L gentamycin under a laminar flow hood. 3. Transfer Petri dishes for 24 h at 37’C to a humidified atmosphere containing 5% cop 4. Then place slides in a glass staining dish filled with 1% buffered formaldehyde for 12 h at 22°C. 5. Remove slides from fixation buffer, drip off excessf=ative, and dry for 1 h at 22°C. Reduced amplification and diffusion of amplified products were seen when fixation was too short (Cl2 h) (Fig. 1). 6. Rehydrate in six graded ethanol baths (2 x 100,2 x 95, and 2 x 80% ethanol) for 5 min each bath. 7. Rinse for 5 min in O.lMTris-HCl, pH 7.4.
The slides must not be allowed to dry at any time after this process. 3.4.2. MRCS Cells 1. Resuspend 1.5 x lo4 cells/well in 200 & RPMI- 1640 media supplemented with 5% FCS and 56 mg/L gentamycin in the flat-bottomed wells of a 96-well tissueculture plate. 2. Incubate plates for 48 h at 37°C in an atmosphere containing 5% CQ. 3, Remove the medium and overlay the monolayers with 200 $ of buffy coat blood leukocytes diluted in RPM1 containing 0.1% dexamethasone and 1% DMSO inside a tissue-culture hood. 4, Centrifuge for 1 h at low speed (200g) at 30°C to increase virus infectivity. 5, Remove the supematant fluid and replace with 200 & RPM1 supplemented with 10% FCS, 0.1% dexamethasone, and 1% DMSO to increase viral replication. 6. Incubate for 16 h at 37°C in a humidified atmosphere containing 5% COz. 7. Wash twice with 1X PBS. 8. Fix cells with 2% buffered formaldehyde for 20 min at room temperature, followed by cold ethanol:acetone mixture (90: 10 [v/v]) for 20 mm at 4°C. 9. Remove fixation buffer. Cells are ready for in situ PCR.
Some positive controls of specificity consist of running in situ PCR on MRCS cells infected with the CMV strain AD 169 diluted l:lO, 1:50,1:100, and 1:lOOO in RPM1 media with 0.1% dexamethasone and 1% DMSO. 3.5. In Situ PCR Assay 3.51. Proteolytic Digestion 1. Incubate slides with fixed samples at 37°C for 20 min in a prewarmed solution of proteinase K diluted in O.lM Tris-HCl, pH 8.0/EDTA 10 mM (10 pg/rnL for
Fig. 1. Effects of fixation duration on the detection of amplified HPV DNA in cultured HeLa cells. Cells were fixed in 1% buffered formalin, digested with 20 pg/mL proteinase K for 20 min at 37”C, and subjected to 20 cycles in situ PCR using biotinylated dATPs. (A) No signal was evident when cells were fixed for 1 h, but the morphology was well preserved (x500). (B) Higher magnification of (A) (x1000). (C) Cells were fixed for 3 h. A pale staining (arrow) in the cytoplasm indicates the diffusion of amplified products (x 1000). (D) In cells fixed for 6 h, the staining is strong, but PCR products are still diffusing (arrow) (x 1000). (E) The fixation for 12 h was the most efficient in this model, showing a dark-blue staining (x 1000). tissue sections and 20 pg/mL for HeLa cells are appropriate protease concentrations for such samples) (Fig. 2).
Aliquots of proteinase K are stored at -2OOC. 2. Inactivate proteinase K by placing the slides on the block of the thermal cycler at 95°C for 2 min. 3. Wash twice with 0.M Tris-HCl, pH 7.4.
Lower concentrations of enzyme produce poor permeabilization, and higher concentrations result in tissue damage. Extensive digestion (more than 20 min) results in the loss of amplified products. A digestion with 0.4% pepsin in 0.04M hydrochloric acid, routinely used in our laboratory for conventional in situ hybridization, has also been tested, but gave a weak signal. For MCR5 cells cultured in microwell plates, pro-
Fig. 2. Effects of permeabilization and cycle number on the detection of amplified HPV DNA in vaginal tissue sections. Tissue was fixed in 1% buffered formalin for 12 h. Sections were digested either with pepsin 0.4% for 15 min at room temperature (A-C), with 5 pg/rnL proteinase K 0, 10 &rnL proteinase K (G&Q, or 20 pg/mL proteinase K (J-M) for 20 min at 37°C. They were subjected to five cycles (upper panel: A,D,G,J), to 10 cycles (middle panel: B,E,H,K,L), or to 20 cycles (lower panel: C,F,I,M) of in situ PCR using biotin-labeled dATPs except in Q, corresponding to the negative control. No signal is evident in tissue sections with our pepsin digestion, even with increasing cycle number. For sections digested with proteinase K, staining was weak with a low concentration of proteinase K, but evident with higher concentrations of proteinase K (10-20 pg!mL). The staining was also present afkr five cycles and maximized atkr 20 cycles.
86
Mougin et al.
teolytic digestion was omitted because cell morphology served (see Note 3).
was not pre-
3.5.2. Denaturation 3.5.2.1.
of Viral DNA
TISSUE SECTIONS AND HELA CELLS
1. Put 100 pL of 1X Tuq buffer (dilute 10X Taq buffer with deionized water). 2 Cover with a coverslip and ensure the buffer spreads without bubbles. 3. Incubate at 9S’C for 5 mm on the block of the thermal cycler, and then transfer slides to ice. 4. Gently remove coverslip, and shake off surplus fluid. 5. Prepare amplification cocktail: 30 clz, total volume/slide 1X Tug buffer (see Note 4), 200 pA4 each dNTP final concentration (for direct zn situ PCR, dATPs consisted of 100 pM bio-14-dATP [see Note 51 and 100 @4 unlabeled dATP), 100 pmol of each primer MY09-MY 11 (Table 1) (see Note 6), 3.5 U Taq polymerase (see Note 7), and deionized water (see Note 8). 3.5.2.2. MRCS CELLS 1. Put 20 Ccs,of 1X Taq buffer in each well of the microplate. 2. Cover each well with a sticky paper sheet (1 x 1 cm). 3 Centrifuge for 10 s at 200g to ensure homogeneous distribution of the buffer. 4. Proceed as for tissue sections and HeLa cells (Section 3.5.2.1.) steps 3-5), except that the amplification cocktail contains 50 pmol of each primer IEl and IE2 (Table 1) and 1 U Tug polymerase. 3.5.3. 3.5.3.1.
In Situ PCR DIRECT IN SITU PCR
1. Place 30 pL of amplification cocktail on each slide or in each well. 2. Cover slides with glass coverslips and seal with nail polish to prevent evaporation. Let nail polish harden for 5 min. For microwells, cover each well with a sticky paper (1 x 1 cm) and then cover the entire plate with a sticky sheet (see Note 9). 3. Perform in situ PCR cycles as follows: For HPV DNA amplification: 60 s at 95’C (denaturation), 90 s at 57°C (annealing), 90 s at 74OC (extension) x 20 cycles, 3 min at 74°C (final extension) x 1 cycle, and 10 s at 30°C (to stop the reaction). For HeLa cells and tissue sections,optimal signal was seen after 15-20 cycles (Fig. 2). For CMV DNA amplification: 60 s at 95’C (denaturatton), 60 s at 55°C (annealing/extension) x 20 cycles.
Thermal cycling conditions are identical to those used classically for solution-phase PCR. Lowering cycle number produces a weak signal, whereas high background, tissue damage, and loss of amplified products can be seen after 2530 cycles (see Note 10).
In Situ PCR to Cells and Wax Sections
87
For both HPV and CMV DNA amplification, duration and temperatures have to be optimized depending on the thermal cycler used (see Note 11). The optimal annealing temperature can be determined empirically for each oligonucleotide primer. 3.5.3.2.
INDIRECT IN
SITUPCR
1. For this assay, the amplification cocktail contains only unlabeled dNTPs. 2. Otherwise, proceed as in Section 3.5.3.1.
3.6. Detection 3.6.7.
of Amplified
Products
Direct In Situ PCR
3.6.1 .l . TISSUE SECTIONS AND HELA CELLS
1. After amplification, take off the coverslip with a scalpeland scratchout remaming nail polish with a razor blade. 2. Wash with O.lMTrrs-HCl, pH 7.4 (2 x 5 min). 3. Dip slides in 100% ice-cold ethanol for 10 min to immobilize amplified products inside cells (see Note 12). 4. Rehydrate in 80% ethanol and wash m 0. IMTns-HCI, pH 7.4 (2 x 5 min). 5. Add 100 pL alkaline phosphatase-conjugated avidin diluted 1:200 in buffer A. 6. Incubate for 30 min at 37°C. 7. Rmse in 1X PBS (2 x 5 min). 8. Prepare substrate buffer by diluting NBT (0.33 mg/mL) and BCIP (0.16 mg/mL) m buffer B. Mix well and place 100 pL of this solution on the slide. 9. Incubate at room temperaturein the dark for l-3 h (depending on the appearance of color development). 10. Stop the reaction by transferring slides to a stain dish containing deionized water for 2 x 5 min, and allow to dry. 11. Add 1 drop of Aquamount, cover with a coverslip, and examine under a light microscope. A brownish purple signal is observed in positive cells.
Direct in situ PCR when optimized does not show any more nonspecific results than those obtained with the use of indirect in situ PCR (Fig. 3) (see Note 13). 3.6.1.2.
MRC5
CELLS
1. After amplification, take off the sticky paper sheet. 2. Aspirate the PCR mixture caretilly.
3. Wash with 0. IMTns-HCl, pH 7.2 (2 x 5 mm). 4. Immerse cells m 100% ethanol for 10 min to maintain localization of PCR products, and then proceed as for tissue sectionsand HeLa cells (Section 3.6.1.l., steps5-9). 5. Check the color development and stop the reaction by rinsing each well with deionized water (2 x 5 min).
Mougin et al.
Fig. 3. Adjacent S-pm paraffin-embedded sections from a cervical biopsy subjected to direct in situ PCR (A,C) and indirect in situ PCR (B,D) for the detection of HPV DNA. (A) Direct in situ PCR using a single primer pair MY 1 l-MY09 and biotinlabeled dATPs. The PCR products are visualized by an immunohistochemistry method (x500). (B) Indirect in situ PCR-using unlabeled dNTPs. Amplified products are detected with a biotinylated probe specific for HPV type 6/l 1 (x500). (C) The omission of primers in the PCR mixture does not show nonspecific signals (x100). (D) After indirect in situ PCR, hybridization with a biotinylated probe specific for HPV 16 does not reveal positive cells (x100).
6. For the last step, prevent drying by adding 100 pL of deionized water to view microplates under an inverse microscope. The results obtained in our laboratory
are shown in Fig. 4.
3.6.2. indirect In Situ PCR (Amplified
products are detected after an in situ hybridization
step.)
1. Proceed as in Section 3.6.1.1. (steps l-4) using only unlabeled dNTPs. 2. Prepare hybridization buffer containing 2X SSC, 50% deionized formamide, 10% dextran sulfate, 250 pg/mL salmon sperm DNA, and 5 ng of probe/slide. 3. Deposit 20 pL of hybridization buffer on each slide and cover with coverslips. 4. Denature target and probe DNA simultaneously in a water bath at 96°C for 5 min.
In Situ PCR to Cells and Wax Sections
89
Fig. 4. Detection of CMV nucleic acid sequences in MRCS fibroblasts by a direct in situ PCR using biotinylated dATPs. (A) In situ PCR performed on MRCS cells 16 h after infection by leukocytes (x75). (B) Higher magnification of (A) showing a clear intense staining (x480). (C-F) Controls of specificity of the in situ PCR assay. (C) Absence of signal in fibroblasts inoculated with leukocytes and treated on addition of the PCR mixture without Taq polymerase (x75). (D) Classical in situ hybridization performed on MRCS cells 72 h after infection by leukocytes, as described by Mougin et al. (9) (x480). (E) In situ PCR test in uninfected MRCS cells; there is no labeling (x300). (F) In ftbroblasts infected with the CMV strain AD 169 at a dilution of 1:50, CMV DNA amplified sequences are concentrated within cell nuclei (x480). 5. Perform in situ hybridization overnight in a humidified atmosphere at 42’C. 6. Displace the coverslips by dipping slides in 4X SSC at room temperature for l-2 min. 7. Wash at high stringency in 2X SSC at room temperature, then in 2X SSC, 0.5X SSC, and 0.1X SSC baths at 42°C. 8. Thereafter, proceed as in Section 3.6.1-l. (steps 5-l 1).
Some applications of this procedure are demonstrated in Figs. 3, 5, and 6.
Mougin et al.
Fig. 5. Detection of HPV DNA in a cervical lesion by a standard in situ hybridization (A,D) and by an indirect in situ PCR (B,C,E). (A) Section hybridized with a biotinylated HPV 16 probe. Few cells are stained and the signal is faint (x 100). (D) Higher magnification of (A). Few dots are visualized in the cell nuclei (x500). (B) In situ hybridization with an identical biotinylated HPV 16 probe after an in situ PCR (x 100). (C) Specificity control. The section was treated with the PCR mixture omitting the Taq DNA polymerase. No signal is visible (x100). (E) Higher magnification of (B) (x500). More positive cells and more intense signals can be observed in this section compared with in situ hybridization.
4. Notes 1. Treatment and age of slides are critical for success with in situ PCR. Perfectly cleaned and poly+lysine-coated glass slides result in an excellent adhesion of cells and wax-embedded tissue sections without any background. This adhesion is strictly necessary because of the multiple steps of the PCR reaction and the great variations in temperature, especially the high denaturation temperature. To obtain the best results, slides should be coated not earlier than 2-3 wk before performing the assay. Some authors prefer Teflon-coated glass slides treated with 3-aminopropyltriethoxysilane (AES) or even albumin or chrome-gelatin. 2. Fixation of cells and tissues has a considerable influence on the efficacy of in situ PCR. In agreement with O’Leary et al. (3 7), we find formaldehyde fixation to be adequate for this procedure. It provides good penetration and access of the PCR
In Situ PCR to Cells and Wax Sections
91
Fig. 6. Detection of HPV DNA in a cervical intraepithelial neoplasia grade 2 by an indirect in situ PCR. (A) Section treated with a single consensus primer pair MY 11 -MY09. The signal appeared as blue-purple deposits located in the superficial cell nuclei and in some parabasal cells (x75). (B) Higher magnification of (A). Note the intensity of the signal (x500). (C) Specificity control. Adjacent section to (A) treated with the PCR mixture minus Taq DNA polymerase. No calorimetric reaction was seen (x75).
92
3.
4.
5.
6.
7.
8.
9.
Mougin et al. reagents to the target sequences, and allows creation of a physical barrier preventing migration of the PCR products. However, it can crosslink histone proteins and impair the action of Tuq DNA polymerase. In our laboratory, tissues are routinely fixed with 1% buffered formaldehyde for 12 h for in situ hybridization and can be amplified with no problem. Concerning HeLa cells cultured on slides, an identical fixation was also very appropriate. As for MRCS cells cultured on flat microwell plates, the combination of 2% buffered formaldehyde and ethanol/acetone flxatron for 20 min each yielded a maximal detection of PCR products. To dissociate histone proteins from native DNA for cells and tissues fixed for 12 h, protemase digestion has to be defined very properly to preserve cell integrity and to avoid the diffusion of amplified products. In our hands, proteinase K has proven successful for amplification of HeLa cells and tissue sections when used between 10 and 20 ug/mL at 37°C for 20 min, whereas digestion step was omitted in MRC5 cells fixed for a short time. Our own results do confirm that different concentrations of enzyme and the duration of digestion must be tested for each type of material. We tried pepsin digestion, a digestion used for our routine in mu hybridization, but unfortunately results were unsatisfactory. The amount and the quality of different reagents in the PCR mixture are critical for in situ PCR. MgCl, can also be sequestrated in the cellular structures. Thus, the best results in our laboratory were obtained with 5 nnl4 MgCl, for in situ PCR performed on glass slides and with lower concentrations (2.5-3 mA4) when the reaction was done on microwell plates. The choice of label for direct in situ PCR is personal In our hands, bio-14-dATP is perfectly adequate, but not the cheapest label. A percentage of 50% of labeled dATPs offers the best results. Some authors have found dig- 11-dUTP to be more sensitive than biotin-labeled dNTPs. A troublesome experience with dig-labeled dNTPs led us to abandon them. In agreement with Gosden et al. (431, high background was observed with their use and resulted in false-positive results. The primers are also used at higher concentrations (100 pmol for HPV and 50 pmol for CMV DNA amplification) than those required for m vitro amphfication. The length of our sets of primers is always 20 bp. Among the Tag DNA polymerases we have tested, the AmpllTaq from Perkin Elmer gave clean results. However, higher concentrations of enzyme than those used in solution-phase PCR are required, especially for in sztu PCR performed on slides, because the enzyme can adhere to the glass of slides and of coverslips. A concentration of 0.1 U&L of PCR mixture permits successful amplification. Yap and McGee (44) have reported that pretreatment of slides with 0.1-l% BSA is able to block sequestration of reagents during the PCR reaction, permitting lower concentrations of Taq DNA polymerase, MgC12, and primers. Proper sealing is also a very critical step to avoid evaporation and to keep unvarying concentrations of the different reagents during the thermal cycles. For slides, we apply a nail polish containing a hardener with very special care. We start to seal each angle of the coverslip and then we seal the edges. We let the nail polish
In Situ PCR to Cells and Wax Sections
10.
11.
12.
13.
dry for 5 min. Some authors have proposed the use of a thin layer of mineral oil on the top of coverslips, but in our experience it does not improve the results and is very difftcult to discard properly at the end of the reaction. For microwells, a neat seal with a sticky paper sheet keeps the reaction volume stable. Heat-transfer kinetics during amplification are not a real problem when using the Omnigene thermal cycler from Hybaid. This cycler is designed so that the thermal profile of the reaction is constant at several sites on the slide, and a temperature adjustment is programmed to allow for variation from top to bottom of the slide and between the slide and the block of the thermocycler. The number of cycles is also of critical importance. In our laboratory, we could demonstrate that the increase in cycle number above 20 does not add any advantage; rather it leads to tissue or cell damage and removal, and sometimes to high background. To prevent the diffusion of PCR products during detection steps, most authors agree that a new fixation is required. In our hands, products of ~200 bp remain mostly localized in the cell nuclei when slides are dipped in 100% ethanol for 10 min. Some authors use buffered formaldehyde to postfix the amplified products. Interestingly enough, specific amplificatton was obtained with the use of a single primer pair, whereas it has been suggested that low-copy number targets could be detected by in situ PCR only if multiple (5-7) primer pairs were used in order to dictate the synthesis of overlapping fragments that could form a complex of over 1500 bp unable to pass through the nuclear membrane (20). Thus, the need for multiprimer pairs has restricted the use of in sztu PCR, owing to the difficulty of generating multiple sequence-specific primers, as well as to their high cost. However, Nuovo et al. (23) have recently reported that a Hot-Start method greatly increased amphfication specificity using a single primer pair and target sequences as short as 115 bp. Such Hot-Start PCR is a method whereby at least one reagent (e.g., enzyme or primers) is withheld until the reaction temperature has reached at least 70°C at the initiation of cycling to reduce mispriming and, consequently, to increase the yield of specific product. Similar results were obtained in our study without the use of Hot-Start. Controls of specificity are essential to validate these sophisticated techniques. The main control consists of checking the amplifiability of the sample using the GAPDH primers (GAPDH gene is the ubiquitous glutaraldehyde phosphate dehydrogenase gene). For each experiment, samples known to be positive or negative have to be used as qualitative controls. The omission of Tuq polymerase and, above all, the omission of primers (especially in direct in situ PCR) from the amplifying solution will attest to the specificity of the reaction. The use of nonsense primers in both direct and indirect zn situ PCR, and the use of an irrelevant probe to hybridize the amplified products also permit the verification of whether proper amplification occurred.
References 1. Gall, J. G. and Pardue, M. L. (1971) Nucleic acid hybridization preparations. Methods Enzymol 38,470-480.
in cytological
94
Mougin et al.
2. Brahic, M. and Haase, A. T. (1978) Detection of viral sequences of low reiteration frequency by in situ hybridization. Proc. Nat1 Acad Sci USA 75, 61256129. 3. Cox, K. H., DeLeon, D. V., Angerer, L. M., and Angerer, R. C. (1984) Detection of mRNAs in sea urchin embryos by in sztu hybridization usmg asymmetric RNA probes. Dev. Biol. 101,485-502. 4. Singer, R. H. and Ward, D. C. (1982) Actin gene expression visualized m chicken muscle tissue culture by using in situ hybridization with biotinated nucleotide analogue. Proc. Natl. Acad. Sci. USA 79,7331-7335. 5. Naoumov, N. V., Alexander, G. J., Eddleston, A. L., and Williams, R. (1988) In situ hybridization in formalm fixed, paraffin wax embedded liver specimens: method for detecting human and viral DNA using biotinylated probes. J. Clin Path01 41,793-798. 6. Crum, C. P., Nuovo, G., Friedman, D., and Silverstein, S. (1988) A comparison of biotin and isotope labeled ribonucleic acid probes for in situ detection of HPV 16 ribonucleic acid in genital precancers. Lab Invest. 58,35&359. 7. NUOVO, G. J. (1989) A comparison of different methodologies (biotm based and 35s based) for the detection of human papillomavirus DNA. Lab. Invest. 61, 47 l-476. 8. Singer, R., Lawrence, J. B., Bashir, R., Byron, K., and Sullivan, J. (1990) Diagnostic applications of nonisotopic in situ hybridization for HIV or HBV nucleic acids, in Modern Pathology, AIDS, and Other Retrovwal Injiectlons (Racz, P., Haase, A., and Gluckmann, H. C., eds.), Karger, Base& pp. 29-34. 9. Mougin, C., Bassignot, A , Coaquette, A., Bourgeois, A., and Lab, M. (1991) Optimization of in situ hybridization for the detection of viral genomes in cultured cells onto 96 microwell plates: a cytomegalovuus model. J. Clan. Microbzol. 29,1735-1739. 10. Bernard, C., Mougin, C., Madoz, L., Drobacheff, C., Van Landuyt, H., Laurent, R., and Lab, M. (1992) Viral coinfections in human papillomavirus associated anogenital lesions according to the serostatus for the human immunodeficiency virus. Znt. J. Cancer 52,731-737. 11. Innis, M. A., Gelfand, D. H., Sninsky, J. J., and White, T. J. (1992) PCR Protocols: A Guide to Methods and Applications, Academic, New York, 482 p. 12. Saiki, R. K., Scharf, S., Falona, F., Mullis, K. B., Horn, G. T., Erlich, H. A., and Arnheim, N. (1985) Enzymatic amplification of globin genomic sequences and restriction site analysis for diagnosis of sickle cell anaemia. Science 230, 1350-1354.
13. Resnick,R. M., Cornelissen,M. T., Wright, D. K., Eichinger, G. H., Fox, H. S., ter Schegget, J., and Manos, M. M. (1990) Detection and typing of HPV in archival cervical cancer specimens using DNA amplification consensus primers. J. Natl. Cancer Inst 82, 1477-1484. 14. Buffone, G. J., Hine, E., and Demmler, G. J. (1990) Detection of mRNA from the immediate early gene of human cytomegalovirus m infected cells by in vitro amplification. Mol. Cell Probes 4, 143-l 5 1.
In Situ PCR to Cells and Wax Sections
95
15. Bitsch, A., Kirchner, H., Dupke, R., and Bein, G. (1993) Cytomegalovirus transcripts in peripheral blood leucocytes of actively infected transplant patients detected by reverse transcription-polymerase chain reaction. J Infect. Dis. 167, 740-743.
16. Arends, M. J., Donaldson, Y. K., Duvall, E., Wyllie, A. H., and Bird, C!. C. (1991) HPV in full thickness cervical biopsies: high prevalence in CIN 2 and CIN 3 detected by a sensitive PCR method. J. Pathol. 165,301-309. 17. Cornelissen, M. T., Bots, T., Briet, M. A., Jeblink, M. F., Struyk, A. P., Van den Tweel, J. G., Greer, C. E., Smits, H. L., and ter Schegget, J. (1992) Detection of human papillomavirus types by the polymerase chain reaction and the differentiation between high-risk and low-risk cervical lesions. Virchows Arch. B Cell Path& 62, 167-l 7 1. 18. Lungu, O., Sun, X. W., Wright, T. C., Ferenczy, A., Richart, R. M., and Silverstein, S. (1995) A polymerase chain reaction-enzyme linked immunosorbent assay method for detecting human papillomavirus in cervical carcinomas and high-grade cervical cancer precursors. O&et. Gynecol. 85,337-342. 19. De Roda Husman, A. M., Walboomers, J. M. M., Van den Brule, A. J. C., Meijer, C. J. L. M., and Snijders, P. J. F. (1995) The use of general primers GP5 and GP6 elongated at their 3’ ends with adjacent highly conserved sequences improves human papillomavirus detection by PCR. J. Gen. Virol. 76, 1057-1062. 20. Haase, A., Retzel, E. F., and Staskus, K. A. (1990) Amplification and detection of lentiviral DNA inside cells. Proc. Natl. Acad. Sci. USA 87,4971-4975. 21. Staskus, K., Couch, L , Bitterman, P., Retzel, E., Zupancic, M., List, J., and Haase, A. (1991) In sztu amplification of visna virus DNA in tissue sections reveals a reservoir of latently infected cells. Microbial. Pathogen. 11,67-76. 22. Nuovo, G., MacConnell, P., Forde, A., and Delvenne, P. (1991) Detection of human papillomavirus DNA in formalin-fixed tissues by in sztu hybridization aRer amplification by polymerase chain reaction. Am. J. Pathof. 139, 847-854. 23, Nuovo, G., Gallery, F., MacConnell, P., Becker, J., and Block, W. (1991) An improved technique for the in situ detection of DNA after polymerase chain reaction amplification. Am. J. Pathol. 139, 1239-1244. 24. NUOVO, G., Margiotta, M., MacConnell, P., and Becker, J. (1992) Rapid in situ detection of PCR-amplified HIV-l DNA, Diagn. Mol. Pathol. 1,98-102. 25. NUOVO, G., Becker, J., Margiotta, M., MacConnell, P., Comite, S., and Hochman, H. (1992) Histological distribution of polymerase chain reactionamplified human papillomavirus 6 and 11 DNA in penile lesions. Am. J. Surg. Pathol. 16,269-275. 26. Bagasra, O., Seshamma, T., and Pomerantz, R. J. (1993) Polymerase chain reaction zn srtu: intracellular amplification and detection of HIV-l proviral DNA and other specific genes. J. Immunol. Methods 158, 13 1-145. 27. Chiu, K. P., Cohen, S., Morris, D., and Jordan, G. (1992) Intracellular amplification of proviral DNA in tissue sections using the polymerase chain reaction. J. Histochem. Cytochem. 40,333-341.
96
Mougin et al.
28. Embleton, M., Gorochov, G., Jones, P., and Winter, G. (1992) In-cell PCR from mRNA: amplifying and linking the rearranged immunoglobulin heavy and light chain V-genes within single cells. Nucleic Acids Res. 20,3831-3837. 29. Long, A., Komminoth, P., and Wolfe, H. (1992) Detection of HIV provuus by in situ polymerase cham reaction (letter). N Engl. J. Med. 327, 1529. 30. Komminoth, P., Long, A., Ray, R., and Wolfe, H. (1992) In situ polymerase chain reaction detection of viral DNA, single copy genes and gene rearrangements m cell suspensions and cytospins. Diagn. Mol. Pathol. 1,85-97. 3 1 Bagasra, O., Seshamma, T , and Pomerantz, R. J. (1993) In sztu PCR: a powerful new methodology, in In Situ Hybridization and Neurology, Oxford University Press, Oxford, UK, pp. 143-156. 32. Embretson, J., Zupancic, M., Beneke, J., Till, M., Wolinsky, S., Burke, A., and Haase, A. (1993) Analysis of human mmmnodeficlency vu-us-infected tissues by amplification and in situ hybridization reveals latent and permissive infections at single-cell resolution. Proc. Nat1 Acad. Sci. USA 90,357-361 33. NUOVO, G., Lidonnict, K., MacConnell, P., and Lane, B. (1993) Intracellular localisation of polymerase chain reaction (PCR)-amplified hepatitis C cDNA Am J. Surg Pathol. 17,683-690.
34. Kommmoth, P. and Long, A. (1993) In situ polymerase chain reactlon. An overview of methods, applications and limitations of a new molecular technique. Vzrchows Arch B. 64,67-73.
35. Long, A., Komminoth, P., and Wolfe, H. (1993) Comparison of indrrect and direct zn situ polymerase chain reaction in cell preparations and tissue sectlons Detection of viral DNA, gene rearrangements and chromosomal translocations Hzstochemzstry 99,15 l-l 62. 36. Patterson, B., Till, M., Otto, P , Goolsby, C., Furtado, M., McBride, L., and Wolinsky, S. (1993) Detection of HIV-l DNA and messenger RNA m mdlvidual cells by PCR-driven in situ hybridization and flow cytometry. Science 260,976-979 37. O’Leary, J. J., Browne, G., Johnson, M. I., Landers, R. J., Crowley, M., Healy, I , Street, J. T., Pollock, A. M., Lewis, F. A., Andrew, A., Cullinane, C., Mohamdee, O., Kealy, W. F., Hogan, J., and Doyle, C. T. (1994) PCR In situ hybridization detection of HPV 16 in fixed CaSlu and fixed SiHa cell lines. J. Clin Pathol. 47,933-938. 38. Lidonnicl, K., Lane, B., and Nuovo, G. (1995) Comparison of serologic analysis and zn situ localizatton of PCR-amplified cDNA for the diagnosis of hepatitis C infection Diagn Mol. Pathol. 4,98-107. 39. Bettinger, D., Mougin, C., and Lab, M. (1994) Rapid detection of active cytomegalovirus infection by in situ polymerase chain reactlon on MCR5 cells inoculated with blood specimens. J. Virol. Methods 49,59-66. 40. Bernard, C., Mougin, C., Bettmger, D., Dldier, J. M., and Lab, M. (1994) Detection of human papillomavirus by in situ polymerase chain reaction in paraffinembedded cervical biopsies. Mol. Cell Probes 8,337-343. 41. Manos, M. M., Ting, Y., Wright, D. K., Lewis, A. J., Brocker, T. R., and Wolinsky, S. M. (1989) The use of polymerase chain reaction amplification for the detection of genital human papillomaviruses. Cancer Cells 7,209-214.
In Situ PCR to Cells and Wax Sections
97
42. Shibata, D., Martin, J., Appleman, M. D., Causey, D. M., Leedom, J. M., and Arnheim, N. (1988) Detection of cytomegalovirus DNA in peripheral blood of patients infected with human immunodeficiency virus. J. Infect. Dis. 158, 1185-l 192. 43. Gosden, J. R. and Lawson, D. ( 1994) Oligonucleotide primed in situ DNA synthesis (PRINS). An alternative to in situ hybridization for gene mapping and the investigation of genome organization, in Methods in Molecular Biology, vol. 29, Chromosome Analyszs Protocols (Gosden, J. R., ed.), Humana, Totowa, NJ, pp. 323-332. 44. Yap, E. P. H. and McGee, J. 0. (1991) Slide PCR DNA amplification samples on microscopic glass slides. Nucleic Acids Res. 19,4294.
from cell
12 Reverse Transcriptase PCR In Situ on Cryopreserved Tissue Sections Fred J. Hendler, Alice Shum-Siu, Brlana W. Heniford, Mohammed El Mekki Ahmed, and V. J. Pate1 1. Introduction The polymerase chain reaction (PCR) is an extraordinarily powerful tool that can amplify fragments of DNA or mRNA from a single cell (I). By combining PCR with other established methods, the reaction has been extended from isolated DNA in solution, to mRNA, to studies using tissue sections (2-5). In situ PCR is much more sensitive than standard in situ hybridization (ISH) because the cellular signal is amplified (6). It has been used to detect unique intracellular nucleic acid sequences (5). Most investigators have amplified the DNA or RNA on the tissue section and used standard ISH to identify the amplified product (PCR-ISH) (2-46). In PCR in situ, the solution amplification has been adapted to tissue sections, and the segment is amplified directly and demonstrated using antibodies or ligands to modified, incorporated nucleic acids or using autoradiography. The assay requires oligonucleotide primers that are specific for the DNA/mRNA segment of interest. Nucleotides modified with digoxigenin, biotin, or radioactivity are incorporated into the amplified product that allows detection of the amplified segment avoiding potential nonspecific binding associated with ISH. We have developed the assay so that it can be used on tissues adherent to slide fragments that are cut to fit into 500~pL thin-walled PCR tubes (7) and to full-size slides (81. The use of slide fragments allows the assayto be done under conditions that are identical to standard PCR with small, 3 x 3 mm, pieces of tissue. The assay on whole slides permits the use of tissue sections 1 cm in diameter. PCR in situ can detect a genomic DNA or mRNA segment in a single cell ($7). The binding observed is always nuclear, even in the RT-PCR in situ, From. Methods In Molecular 6/o/ogy, Vol 71’ PRINS and In Situ PCR Protocols Edlted by: J. R. Gosden Humana Press Inc., Totowa, NJ
99
700
Hendler et al.
except when the cell being assayed significantly overexpresses the mRNA (7). This is either owing to preferential loss or degradation of cytoplasmic mRNA during the processing, the inaccessibility of the cytoplasmic mRNA to either the reverse transcriptase or to the oligonucleotide nucleotide primer, or to lower levels of cellular mRNA. The nuclear incorporation is specific and is sensitive to RNase digestion. However, after 10 cycles of amplification without extensive DNase digestion genomic DNA can be detected even with asymmetric amplification (78). The assay is at best semiquantitative. Assaying mRNA is dependent on reverse transcriptase and the state of the mRNA. The detection of the product is based on amplification. The efficiency of amplification is based on the length of the product, the accessibility of the product to the Tuq polymerase, and the efficiency of incorporation using modified nucleotides. In tissue sections, the assay cannot be quantified. Interassay variability can only be monitored by including cell lines with known levels of DNA or mRNA. Only the amplified segment that remains in the tissue after extensive washing is available either to antibody or biotin for binding and subsequent detection. Viewing the changes in intensity with increased cycles of amplification, it is unclear that true geometric amplification occurs in situ as it does in solution. The difference between symmetric and asymmetric amplification is only significant for two to three cycles. Using antibodies or avidin to detect the modified nucleotides, there is further amplification of the signal, which mutes the difference between levels of mRNA detected. In an effort to maximize the quantitative aspects of the assay, we have limited the cycle number to 7-10. If it were critical to determine if a single copy of viral DNA were present in a cell or tissue, such as in assaying for HIV, it might be appropriate to increase the sensitivity of the assay by increasing the cycles of amplification (9). In this setting, the background should not increase, since there would be no genomic DNA to compete. However, it would be critical to use tissues that were infected as well as uninfected tissues as controls. Since the PCR in situ assayis so sensitive, there are many potential difficulties in applying PCR to tissue sections. These include nonspecific amplification, detection of genomic DNA instead of mRNA, diffusion of the amplified product, endogenous priming, and amplification of DNA repair artifacts. By carrying out careful preliminary studies and using control reactions to verify the products, these potential problems can be avoided. To establish an assay, we always use cultured cells that express known quantities of the mRNA or have known amplification of the DNA of interest (7,s). We prefer to establish an amplification assay using tissue sections from cell pellets adherent to slide fragments rather than whole slides. Using slide fragments (Fig. 1) rather than whole slides (Fig. 2), we are able to assay24 tissue specimens simultaneously.
RT-PCR In Situ on Cryopreserved
ProbeOn Plus slide fragment
Cryosection
Q
-b
SolubllzationlDNase
Tissue Sections
101 Fixation
V -b V9 9 V
Reverse+T~NnTspcriptase
Anti-Dig
PCR + Dig-dUTP
Alkaline
Ab
Phosphatase
Fig. 1. Schematic representation of RT PCR zn sztu using slide fragments. A cryosection was placed on the positively charged side of a ProbeOn Plus slide cut to fit into 0.5-mL PCR tubes. The tissue was fixed, solubilized, and reacted with DNase as described. cDNA was synthesized using RT and an antisense oligonucleotide. The cDNA was amplified and detected with antidigoxigenin antibody. The slide fragments were dehydrated, and adhered to a coverslip and slide using a resin.
With whole slides, we can only assaysix condmons. The oligonucleotide primers must be specific for the amplified segments: This should always be established using PCR in solution. The amplified fragments should be verified by restriction fragment polymorphism (RFLP) and sequence analysis. When a product is significantly overexpressed in a cell line, the reaction can be carried out on tissues adherent to slide fragments (Fig. l), the product detected in solution, and verified using RFLP and sequence analysis (7). The optimal conditions for the amplification with respect to temperature at melting, elongation, and primer binding magnesium concentration (Mg2’), and pH need to be established. Machine calibration is done with internal thermal probes in solution of both the slide fragments and the whole-slide assaysfor each thermocyclers. To reduce nonspecific binding and subsequent priming, we have avoided the use of random heximers in reverse RT. Oligo d(T) as a primer for RT in PCR in situ, will only consistently synthesize cDNA sequences that are relatively near the 3’-end of the mRNA. When possible, we have used sequence-specific primers for the RT reaction, and primers 5’ for the PCR amplification. To avoid amplifying genomic DNA, the oligonucleotide primers span introns by only a few bases. Primers
that span more than four bases 3’ will not discriminate
Hendler et al.
102 Crvosection
Flxatlon Solubllization DNase
Reverse
Transcriptase + dNTP
Circle with Pap Pen
1 1 0
PCR Mixture Dig-d*“TP
0Q
PCR
-+
Anti-Dig
Ab
Alkaline Phosphatase
Cover slide with slide and 2.coverslip spacers
Mlneral Oil
Fig. 2. Schematic representation of RT PCRin situ using whole slides. A cryosection was placed on the positively charged side of an intact ProbeOn Plus slide. The tissue was fixed, solubrhzed, reacted with DNase, and cDNA synthesized. A circle was drawn using a template about the tissue with a PAP pen. On a second slide a mirror image circle was drawn on the positive side of the slide. The PCR reaction mixture was placed within the circle. Two coverslips were placed on top of the frosted end of the slide and the slide was covered with the second slide so that the circle overlapped. Mineral oil was added by capillary action to encircle the tissue. The slide was placed on the surface of a thermocycler for the appropriate number of cycles. Following washes the amplification was detected using antidigoxigenin antibody as described in the text. mRNA
as well as genomic
DNA. The PCR in situ assay tends to detect only
mRNA and transcriptionally active DNA. Limiting the amplification to 7-10 cycles may eliminate the need for using DNase and RNase. More cycles lead to a significant decrease in the specific signal-to-noise ratio. The level of signal detected in control sections begins to equal that detected in the experimental. Furthermore, the incorporated ligand detected with either digoxigenin or avidin appears to be maximal after 7-10 cycles. Once conditions have been established, PCR in situ appears to be applicable to any DNA or mRNA fragment. We have used it to detect EGF receptor, TGF-a, TGF-P, PDGF,flil, H ras, and p53 in human and murine tissues. Where significant sequence homology exists across species, such as in the EGF receptor, the same primers have been used to detect specifically the receptor in human, murine, rabbit, and feline tissues.
103
RT-PCR In Situ on Cryopreserved Tissue Sections 2. Materials
All solutions are made with autoclaved demineralized water (ddH*O). All additions were made using filtered micropipet tips to avoid contamination of the micropipeter. At least once per month, micropipeters are taken apart, cleaned using ultrasound and soap, lubricated, and calibrated. Gloves are always worn, and an effort is made to maintain
as clean an environment
as possible.
2.1. Tissue Preparation
2.1.1. Slides 1. ProbeOn Plus slides (Fisher, Cmcinnati OH) (see Note 1). 2. Glass cutting knife.* 3. Fine permanent black marking pen (Sharpze, Sanford Corp, Bellwood IL).*
2.1.2. Tissue Fixation 1. 10% Buffered formalin (Fisher). 2. 3% Buffered paraformaldehyde
(made fresh): 100 mA4 sodium phosphate, pH 7.4,
5 mA4MgC12. 3. 0.1 mA4 Di-isopropylfluorophosphate (DIFP) (Sigma, St. Louis, MO) in isopropanol (stored at -20°C). 4. PBS-DIFP: Phosphate-buffered saline + 0.1 uA4 DIFP (see Note 2). 5. Thermocycler/humidifcation chamber (see Note 3).
2.7.3. Removal of DNA/RNA Binding Proteins 1. 10% (w/v)
Nonidet P-40 (Sigma); use as 0.1% in PBS
2. 2 mg/mL Trypsinogen (Sigma) in O.OlN HCl. Neutralization solution: O.lM Tris-HCl, pH 7.0; O.lMNaCl; 0.1 niUDIFP. 3. 1 mg/mL proteinase K (Promega, Madison, WI) in 2 mMCaClz, 20 rnA4Tris-HCl, pH 7.5; use as 10 pg/mL. 4. Wash buffer: PBS-DIFP.
2.1.4. DNase Treatment 1. RQl RNase-free DNase (Promega). 2. DNase buffer (10X): 0.4MTris-HCl,
pH 7.9, 100 mA4NaC1,60 mMMgC12.
3. RNasin (Promega).
4. Paratilm (American Can Co., Greenwich CT) coverslip: 15 x 30 mm.** 5. Thermocycler (see Note 4)*/humidification chamber at 37°C. 6. Isopropanol
at -2O’T.
7. ddH*O. *Materials required for slide fragment assay. **Materials used only m the whole-slide assay.
Hendler et al.
104 2.2. Reverse Transcription 1. 2. 3. 4. 5. 6. 7 8.
RT (see Note 5): M-MLTV (Gibco-BRL, Bethesda, MD). RT buffer (5X): 50 rr&fTris-HCl, pH 8.3,250 mi14KCl,7.5 dNTP: 2.5 mM dATP, dCTP, dGTP, dTTP (Pharmac&LKB, RNasin. 10 mMDTT (Gibco). Oligonucleotide primer: 10 PM. Glass coverslip: 20 x 40 mm.** Thermocycler*/humidification chamber at 50 and 75”C.**
mMMgC&. Piscataway, NJ).
2.3. PCR 1. 2 3. 4. 5 6. 7. 8. 9.
Tag I DNA polymerase (Boehringer-Mannheim, Indumapolis IN). Tag polymerase buffer (10X): 100 mMTris-HCl, pH 8.3,500 mMKCl,l5 mMMgCl2. dNTP. 50 mA4MgC1,. 2.5 @4 Digoxigenin-1 l-dUTP (Boerhinger-Mannheim). 5’ and 3’ Oligonucleotide primers: 10 PM. 20X SSC: 3 miWNaC1, 300 mM trisodium citrate. Thermocycler*/Thermocycler covered with heavy duty aluminum foil ** 20 x 40 mm glass coverslip spacers: Two coversllps adherent with a drop of mineral oil.**
2.4. lmmunodetection 1 2. 3. 4. 5. 6. 7. 8. 9. 10.
11.
Maleate buffer: 100 mii4 maleic acid, 150 mMNaC1, pH 7.5. 10% (w/v) Triton X-100 (Sigma). Triton-maleate: 0.3% Tnton X- 100; maleate buffer. Sheep serum: diluted to 4% in Triton-maleate. Fab’-antidigoxigenin-alkaline phosphatase (Boerhinger-Mannhelm): diluted 1:500 in 4% sheep serum-Triton-maleate. Chromogen buffer: 100 mM Tris-HCl, pH 9.5, 100 mMNaCl,50 mM MgCl,. Nitroblue tetrazolium solution (NBT) (Boehringer-Mannheim). 5-Bromo-4-chloro3-indolyl phosphate (X-phosphate) (Boehringer-Mannheim). Levamisole (Sigma). Chromogen solution: 45 pL NBT and 35 & X-phosphate added to 0.24 mg levamisole/mL chromogen buffer. Made immediately pnor to use and stored in foil-covered tube at 4’C. Stop and wash buffer: 10 mM Tris, pH 8.0, 1 mM EDTA.
2.5. Slide Mounting 1. 70,95, and 100% Ethanol. 2 Xylene. *Materials required for slide fragment assay. **Materials used only in the whole-shde assay.
RT-PCR In Situ on Cryopreserved Tissue Sections
705
Table 1 Control Reactions Required to Establish PCR In Situ Primers RNase
DNase -
RT
PCR
Antibody
Chromogen
Reachon
No reaction
No reactton
+ t
+ t
t
-
-
t
+
t -
t
+ t + t
t + t t
t t t +
Anubody control Endogenous DNA/DNA repair RNase/DNase background DNase background RNA DNA DNA + RNA
t
3. Permount. 4. Coverslips: 20 x 40 mm. 5. Microscope slides.
3. Methods Both of the assays described in Sections 3.1. and 3.2. can be adapted to detecting DNA by omitting the DNase treatment and RT steps. Control reactions are carried out simultaneously (Table 1). Once the reaction has been shown to be specific for either RNA or DNA, the control reactions are limited. When assaying DNA, there is no need to treat tissue with RNase since RNA is not a substrate for Taq polymerase. 3.1. RT-PCR In Situ Using S/i& Fragments 3.1.1. Tissue Preparation 1. Thinly mark the negative side edge of a ProbeOn Plus slide with a tine-point, permanentblack marking pen (see Note 6) (Fig. 1). 2. Score shdes with a commercial glass cutting knife. 3. Break slide into fragments that will fit into a 0.5-n& centrifuge tube, making sure
that a negative edgeis always marked. 4. Repeat the process until the slide has been used (15-30 slides fragments/whole slide). Store slide fragments sterilized in dishes (see Note 7). 5. Orient cryopreserved tissue blocks using hematoxylin and eosin staining and size the tissue to fit the glass fragments. 6. Cut a 6-g pm thick cryosection. 7. Place the section immediately on the positive side of slide fragments. 8. Store the slide fragments in labeled 0.5~mL centrifuge tube at -7O’C for at least 16 h (storage at -70°C up to 4 mo).
Hendler et al.
106
9. Fix tissues using 250 IIL of either 10% buffered formalin or 3% paraformaldehyde at room temperature for at least 10 min. 10. Aspirate (see Note 9) and wash slide fragment with PBS three times. 11. Wash twice with ddH,O.
3.1.2. Removal of DNA/RNA-Binding
Proteins
There is no standard approach to pretreatment of tissues to remove nucleic acid-binding proteins. We have found that this may or may not be necessary depending on the RNA/DNA segment to be amplified. Obviously, the best morphology is obtained with the least treatment. The aggressiveness of the digestion required is dependent on the tissue and conditions of fixation. Thus, the investigator must determine which conditions are appropriate to the assay employed. Exposure to 0.1% NP-40 for up to 30 min is the most gentle. Exposure
to trypsinogen
or proteinase
K for more than 10 min yields
poor results. 3.1.3. DNase/RNase
Treatment
To verify that the products are appropriate to reaction, control tissue specimens must be treated with DNase 1 for 30 min at 37OC (Table 1). This is required as a control reaction. If it is shown that primers are specific for RNA, then only the control tissue needs to be treated with DNase. 1. 2. 3. 4.
Cover slide fragment with 100 & containing 8 U DNase/75 U RNasin. Incubate at 37OC for 30 min. Inactivate DNase by heating to 75°C for 15 min. Wash three times with PBS.
3.1.4. RT 1. Add 100 pL reaction mixture containing 400 U RT in 1X RT buffer, 1.5 m&f MgC&, 10 mMDTT, 2.5 l&f dNTP, 0.1 pmol oligonucleotide primer or 12 pmol oligo d(T),,; make up enough reaction mixture for 110 L/tube (see Note 9). 2. Incubate at 50°C for 30 min. 3. Wash with 1X SSC. 4. Inactivate RT by heating to 95°C for 5 min. 5. Wash five times with 1X SSC.
3.1.5. PCR 1. Add 90 ILL solution (1X Tuq polymerase buffer, Mg*+ [see Note lo], 2.5 @4 dNTP, 0.125 piV digoxtgenin-1 l-dUTP, 0.1 pmol primers). Make up enough reaction mixture for 100 L/tube. 2. Cover with 25 l.tL of light-weight mineral oil (Sigma). 3. Heat to 95°C for 3 min.
RT-PCR In Situ on Cryopreserved
Tissue Sections
107
4. Hot-start: Pipet 10 pL containing 0.25 U Tuq polymerase m 1X Taq buffer through the mineral oil while at 95OC. Mix reaction using pipeter five times. 5. PCR conditions vary depending on the primers. For most reactions, 7-10 cycles are appropriate: denaturation, 94’C x 1 min; annealing, 60°C x 1 min; elongation, 72°C x 1 min; and final elongation, 72°C x 10 min. 6. Cool to room temperature. 7. Wash five times with the following SCC solutions: 2X, 1X, and 0.5X.
3.1.6. lmmunodetection 1. Pre-incubate with 250 uL sheep serum-Triton-maleate twice for 15 mm with gentle agitation. 2. Incubate in 250 pL Fab’-antidigoxigenin in sheep serum-Triton-maleate (3 h) at room temperature with gentle agitation (see Note 11). 3 Wash five times with 250 & of Triton-maleate. 4. Wash twice with chromogen buffer. 5. Add chromogen solution in a carefully timed reaction (see Note 12). a. Remove buffer and add 500 pL solution to 1 tube. b. Incubate precisely for 5 min at room temperature. c. Precisely every 30 s later repeat process. d. Stop reaction after incubation by washing immediately with TBE twice. e. After completmg the reaction in all the tubes, wash with TBE three times.
3.1,7. Slide Preparation To avoid removing the chromogen precipitate, which IS somewhat soluble in organic solvents, slide fragments need to be processed individually. 1. Dehydrate tissue by adding and aspirating twice 250 l,L of 70, 95, and 100% EtOH and xylene. 2. Immediately place a drop of permount on a coverslip. Place the slide fragment tissue side down on to the permount. Note the position of the slide on the coverslip (Fig. 1). 3. Repeat the process. 4. Allow the slide fragments to adhere to the coverslip. 5. Slides are ready for viewing by placing on top of a mtcroscope slide. 6. For permanent storage, mount the slide fragmentskoverslips to a glass slide using permount on the bottom of the slide fragments.
3.2. RT-PCR In Situ Using Whole Slides The RT-PCR in situ with whole slides is fairly similar to that developed using the slide fragments: The solutions are identical with the reactions varied to accommodate the use of whole slides. The major differences in the two assaysare that the slides sit on top of the thermocycler, which affects the timing of the PCR and the number of assaysthat can be done simultaneously, and a PCR “hot-start” cannot be done with whole slides.
Hendler et al.
108 3.2.7. Tissue Preparation
1. Orient and size cryopreserved tissue blocks to approximately fit a l-cm2 area in the center of a ProbeOn Plus microscope slide (Fig. 2). 2. Place the tissue section 5-10 mm from the edge of the slide (see Note 13). 3. Fix tissues in either 10% buffered formalin or 3% paraformaldehyde. 4. Wash slides three times with PBS-DIFP. 5. Wash slides with ddH20 (see Note 14).
3.2.2. Removal of DNA/RNA Binding-Proteins 1 Cover the tissue section with 100 pL of either NP-40, trypsinogen, or protemase K. 2. Incubate for a predetermined time. 3. Remove, inactivate, and wash with PBS-DIFP.
3.2.3. DNase/RNase
Treatment
1. Cover the tissue section with 8 U DNase and 75 U RNasin in 100 pL of DNase buffer. 2 Cover with aparafilm coverslip. 3. Place in a humidified chamber at 37’C for 30 min. 4. Float off coverslip with PBS. 5. Inactivate DNase with isopropanol at -20°C for 30 min. 6. Wash three times with PBS.
3.2.4. RT 1. Add 100 L containing 400 U RT in 1X RT buffer, 1.5 mM MgCl*,lO mA4 DTT, 2.5 @4dNTP, 0.1 pmol primer or 0.12 pmol oligo d(T),,, make up enough reaction mixture for 110 pL/slide. 2. Cover with a paratilm coverslip. 3. Incubate in a humidified chamber at 50°C for 30 min. 4. Float off coverslip with 1X SSC. 5. Inactivate RT by heating the slide to 95°C for 5 min. 6. Wash five times with 1X SSC. 7. Wash twice with ddHzO. 8. Dry the slide.
3.2.5. PCR 1. Cover the thermocycler with heavy duty aluminum foil. 2. Mark slides, either two slides with tissue sections or a tissue section and a blank slide, with a PAP pen makmg an identical circle on each slide (Fig. 2) (see Note 15). 3, Place the coverslip spacer onto a drop of mineral oil on the frosted portion of slide. 4. Place a drop of oil on the coverslip spacer. 5. Cover the tissue on one slide with 60 pL containing 0.25 U Taq polymerase in 1X Taq polymerase buffer, Mg 2+, 2.5 l,uV dNTP, 0.125 pA4 digoxigenin- 11-dUTP, 0.1 pmol primers, ddH20; make up enough reaction mixture for 70 pL/shde.
RT-PCR In Situ on Cryopreserved Tissue Sections
709
6. Cover the bottom slide with the second slide so that the PAP markings overlap and no solution leaves the circle. The slides should be offset l-2 mm. 7. Infuse mineral oil by capillary action until it has completely encircled the PAP pen circle. 8. Place on the surface of the thermocycler. 9. Repeat steps 4-8. 10. Heat slides to 92°C for 5 min. 11. PCR conditions vary and are dependent on the primers. For most reactions, 7-10 cycles are appropnate. The temperature and time of reactions are based on the calibration of the PCR machine. With the slides on the surface, there is approximately a 1-min lag before the temperature registered on the machme is reached: denaturation, 92°C x 1 mitt; annealing, 60°C x 1 mm; elongation, 72’C x 1 min; and final elongation-72°C x 10 min. 12. Cool off to room temperature. 13. Float a coverslip with 2X SSC. 14. Wash five times with the followmg SCC solutions: 2X, 1X, and 0.5X.
3.2.6. lmmunodetection 1. Preincubate twice for 15 min with sheep serum-Triton-maleate with continual agitation. 2. Incubate with 100 pL Fab’-antidigoxigenin for at least 3 h at room temperature in a humidified chamber. 3. Wash five times with Triton-maleate. 4. Premcubate twice with buffer. 5. In a carefully timed reaction: a. Remove buffer and add 100 pL solution to each slide. b. Incubate precisely for 5 min at room temperature. c. Precisely every 30 s later, repeat process. d. Stop reaction after incubation by washing twice immediately with TBE. e. After completing the reaction, wash three times with TBE.
3.2.7. Slide Preparation 1. Dehydrate tissue sections by two changes of 70,95, and 100% EtOH and xylene. 2. Immediately cover with permount.
4. Notes 1. Cells and tissue sections adhere best with the least background to these slides when compared to other techniques of slide preparation. The top side of the slide is positively charged and marked as such. The ProbeOn Plus slides were designed for capillary addition of solutions during ISH and have two spacers (Fig. 2). These spacers are required for the assay using whole slides (Section 3.2.). 2. DIFP-containing solutions are prepared immediately prior to their use. 3. A chamber that can maintain humidity for 3 h as those used for ISH should be used.
110
Hendler et al.
4. It is much more convenient and accurate to carry out all temperature-controlled steps using the thermocycler rather than a water bath. 5. AMV and M-MLTV RT enzymes both have optimal reaction temperatures between 37-42’C with recommended reaction times of 1 h. The thermostable RT will use RNA or DNA as a substrate. It cannot be used in this assay. To increase the specificity of the oligonucleotide primer binding to the mRNA, the temperature of the reaction 1sincreased to 50°C. 6. The negative side is marked so that it can readily be identified and be discriminated from the positive side. The tissue will only adhere to the positive side. Avoid injuring the tissue by directly touching the negative side during all operations. A fine black lme in a translucent 0.5~mL tube is the easiest to visualize during the procedure. The Sharpie ink is relatively resistant to all solutions until exposure to solvents durmg dehydration and slide mounting. 7. Tissue-culture cells that grow in monolayer are adherent to these slide fragments. These fragments can be used in standard culture media dishes, and cells will adhere adequately for PCR in situ. 8. All washes are carried out by aspirating the solution with a micropipet tip attached to vacuum. Extreme care is taken to slide the tip down the side of slide away from the tissue, i.e., the side of the slide lined with black marking pen. 9. If there is nonspecific cDNA synthesis during RT, make the reaction mixture without the RT to a final volume of 90 pL/tube. Heat the tube to 5O”C, then add 10 pL/U RT in 10 pL of RT mixture without dNTP. 10. The optimum (Mg2’) must be determined for the PCR reaction. The standard final concentration in supplied buffers IS 1.5 m&K 11. The reaction can be stopped after the RT or the PCR washes. It 1s often convenient to incubate the antibody overnight. However, the entire reaction can be completed in one day with practice and planning. 12. The exposure time is crittcal to the sensitivity of the reaction. The concentration of the chromogen greatly affects the exposure time. For each new batch of chromogen, particularly if you prepare your own, these conditions can vary signiticantly. The sensitivity of the reaction should be set to the level of segment that you are trying to detect. If the mRNA is in low abundance, use a control reaction that is in low abundance to determine the exposure time. When trying to discriminate single copy from modest expression using reagents purchased from Boehringer Mannheim, 5-min exposure works well. 13. To identify where the tissue should be placed, design a template based on the circle that you will draw with a PAP pen (see Section 3.2.). 14. Solutions containing reaction mixtures are aspirated using vacuum and then flooded with wash solutions. Slides are placed tn slide carriers and washed using RNase-free, sterile, staining jars. 15. To avoid loss of the PCR mixture, the drawn circles must be: a. Nearly identical; b. Completely closed; and c. Positioned in identical locations on the slide,
RT-PCR In Situ on Cryopreserved Tissue Sections
111
In doing so, the PAP pen markings will completely overlap when the two slides are placed positive side to positive side (Fig. 2).
Acknowledgments This work was supported m part by the Department of Veteran Affairs, NIEHS ULCEHS #PG94-3, The Alliant Community Trust Foundation, and The James Graham Brown Cancer Center Foundation.
References 1. Li, H. H., Gyllensten, U. B., Cui, X. F., Saiki, R. K., Erlich, H. A., and Arnheim, N. (1988) Amplification and analysis of DNA sequences in single human sperm and diploid cells. Nature 335,414-417. 2. Walboomers, J. M. M., Melchers, W. J. G., Mullink, H., Meijer, C. J. L. M., Struyk, A., Quint, W. G. J., van der Noordaa, J., and ter Scheggt, J. (1988) Sensitivity of in situ detection with biotinylated probes of human papillomavirus type 16 DNA in frozen tissue sections of squamous cell carcinoma of the cervix Am. J Path01 129,587-594. 3. Haase, A. T., Retzel, E. F., and Staskus, K. A. (1990) Proc. Natl. Acad Scz. USA 87,497 l-4975. 4. Nuovo, G. J., MacConnell, P., Forde, A., and Delvenne, P. (1991) Detection of human papillomavn-us DNA in formalin fixed tissues by in situ hybridization after amplification by PCR. Am J. Pathol. 139, 847-854. 5. Spann, W., Pachmann, K., Zabnieuska, H., Pielmeier, A., and Emmerich, B. (1991) In sztu amplification of single copy gene segments in individual cells by the polymerase cham reaction. Infection 19,242-266. 6. NUOVO, G. J. (1992) PCR In Situ Hybridization. Raven, New York. 7. Heniford, B. W., Shum-Siu, A., Leonberger, M., and Hendler, F. J. (1993) Variation in cellular EGF receptor mRNA expression demonstrated by in sztu reverse transcriptase polymerase chain reaction. Nucleic Acids Res. 21,3 159-3 166. 8. Pate& V. J., Shum-Siu, A., Heniford, B. W., Wieman, T. J., and Hendler, F. J. (1994) Detection of epidermal growth factor receptor mRNA in tissue sections from biopsy specimens using in situ polymerase chain reaction. Am. J, Pathol. 144,587-594.
9. Krone, W. J., Sninslay, J. J., and Goudsmit, J. (1990) Detection and characterization of HIV-l by polymerase chain reaction. J. Acq. Immun. De&. Syndrome 3, 242-266.
Flow Cytometry Analysis of an In Situ PCR for the Detection of Human lmmunodeficiency Virus Type-l (HIV-I) Proviral DNA David E. Gibellini, Maria Carla Re, Giuliano Furlini, and Michele La Placa 1. Introduction
The polymerase chain reaction (PCR) (1,2) is extremely sensitive and flexible, and in theory, will detect a single copy of a specific DNA (or retrotranscribed RNA) sequence either in cell cultures or in clinical samples (3). PCR technology has, therefore, been applied to the diagnosis of a wide range of clinical conditions, in particular, infectious diseases (4+. In spite of its adaptability and power, the classical PCR technique has an important drawback: Total DNA or RNA must first be extracted from the sample under examination. Obviously, the extraction procedure is mcompatible with the preservation of cell morphology when the samples consist of cell cultures or pathological tissue specimens. Therefore, the standard PCR procedure prevents the amplified target nucleic acid sequence (amplicon) being associatedwith either a specific cell type or a specific subcellular compartment. Recently, several authors have applied PCR technology directly to intact cells after fixation on glass slides. The amplicon is then revealed by in situ hybridization with a specific labeled probe allowing direct or indirect detection (7-11). This procedure, known as “in situ PCR,” couples the potentialities of both PCR and in situ hybridization methods, allowing the detection of the specific DNA (or RNA) target sequencesand the identification of positive cells in a mixed-cell population. A further modification of in situ PCR is the direct labeling of the amplicon by introducing into the polymerase reaction mixture a From
Methods in Mol8cUlar Biology, Vol 71’ PRlNS and In Situ PCR Protocols E&ted by J R. Gosden Humana Press Inc , Totowa, NJ
113
114
Gibellini et al.
nucleotide, usually a deoxy-uridine-triphosphate (dUTP), coupled with a hapten, usually a molecule of dlgoxygenin, which does not hamper its mcorporation into the polymerase reaction product (12). After the PCR procedure, the cells are reacted with a labeled (usually by an enzyme or fluorochrome) antihapten; positive cells are revealed by irnmunocytochemistry or flow cytometry (613-l 6). Flow cytometry is a relatively easy and accurate way of quantifying positive cells and allows the concomitant analysis of other cellular parameters (13-l 7). We have recently developed an in situ PCR procedure, based on the direct incorporation of digoxigenin-labeled dUTP in the polymerase reaction product and analysis of positive cells by flow cytometry. We have used this to evaluate the frequency of human immunodeficiency virus type- 1 (HIV- 1) proviral DNA carrying cells m the peripheral blood mononuclear cell (PBMC) population of HIV-l-infected subjects, in various stages of the disease. The procedure was developed as a means of monitoring the progress of HIV-l infection and as a useful adjunct in tailoring therapeutic strategies (13). The sensitivity of the procedure has been evaluated in an experimental system represented by lymphoblastoid 8ESLAV cells, which carry a single copy of HIV-l provirus DNA integrated/cell (18), mixed with different amounts of uninfected A3 .O1 (19) lymphoblastoid cells. Under optimal conditions, the procedure was able to give positive results with samples containing as few as 10 HIV-l proviral genome-carrying 8E5LAV cells in a background of 10,000 uninfected A3.01 cells (13). Although the procedure can potentially be applied to detect cells carrying a variety of specific DNA (or retrotranscribed RNA) target sequences and to develop into a multiparametric method for the simultaneous study of membrane or intracellular markers, it has, so far, only been used in the analysis of the HIV- 1 proviral load of PBMC of HIV- 1-infected patients. Therefore, the method will be described taking into consideration only its application to the detection of HIV-l provirus DNA sequences m the cells where the procedure has been successfully applied in practice. 2. Materials
2.1. Cells and Culture Media 1. PBMC obtained (after informed consent)from HIV- I seropositive patients (see Note 1) and from healthy blood donors (the latter are necessaryfor one of the negative controls to be included in eachrun--see Table 1) are collected andprocessedas indicated in Section3.1,) step2. 2. 8E5 LAV lymphoblastoid cell line (seeNote 1) containing oneintegrated HIV- 1 provirus genome copy/cell (for positive and negative controls to be included in each run--see Table 1) (Ogden BioServices Corporation, Rockville, MD).
715
Flow Cytometry Analysis of In Situ PCR Table 1 Positive and Negative Controls Used in Each Run of In Situ PCR and Flow Cytometry
Analysis
Positive controls PBMC or lymphoblastoid 8E5LAV cells assayed using HLA-DQ(a)-specific oligonucleotide primers (see Table 2) Lymphoblastoid 8E5LAV cells assayed using HIV-l gag oligonucleotide primers (see Table 2) Negative controls PBMC obtained from HIV-l seronegative blood donors assayed using HIV- 1 gag specific oligonucleotide primers (see Table 2) Lymphoblastoid 8E5LAV cells assayed using aspecific oligonucleotide primers (e.g., h phage-specific oligonucleotide primers--see Table 2)
3. 4. 5. 6.
RPMI- 1640 medmm (Gibco, Grand Island, NY). Iscove’s modttied Dulbecco’s medium (IMDM) (Grbco). Fetal calf serum (FCS) (Gibco). Ficoll-Hystopaque density gradient (d = 1077 g/mL) solution Uppsala, Sweden).
(Pharmacia,
2.2. Fixation and Permeabilization 1. Phosphate-buffered saline (PBS). 2. Paraformaldehyde (PF) (Sigma, St. Louis, MO): Prepare a solution of 1% PF in PBS, pH 7 4, warming the mixture to about 50-6O”C in a fume hood. Let the solution cool down at room temperature. Store at 4°C. The fixative must be freshly prepared. Avoid the use of fixative solutions over 2 wk old Caution: PF is carcinogenic. Wear disposable plastic gloves and avoid breathing in vapors. Make up PF solutions in a fume hood. Dispose of waste appropriately. 3. Pronase (Boehringer-Mannheim, Mannheim, Germany): Prepare a stock solution (10 mg/mL) in PBS or in 50 mM Tris-HCl, pH 7.6, 5 mA4 ethylene-diaminotetra-acetate (EDTA-sodium salt). Keep the solution for 2 h at 37°C and store in small aliquots at -20°C. 4. Water bath at 37°C. 5. Microcentrifuge (e.g., Eppendorf, Hamburg, Germany).
2.3. In Situ PC!? 1. 2. 3. 4. 5.
2’ Deoxyadenosine 5’-trrphosphate (dATP) (Boehringer-Mannheim) 2’ Deoxycytosine 5’-triphosphate (dCTP) (Boehringer-Mannheim) 2’ Deoxyguanosine 5’-trrphosphate (dGTP) (Boehringer-Mannheim) 2’ Deoxythymidine 5’-triphosphate (dTTP) (Boehringer-Mannheim) Digoxigenin- l l-2’-deoxyuridine 5’-triphosphate (Dig-dUTP) Mannheim) (store at -2OOC). 6. Taq polymerase (5 U/mL) (Perkin-Elmer Cetus, Norwalk, CN)
(store at-20°C). (store at -20°C). (store at -2OOC). (store at-2O’C). (Boehringer(store at -2O’C).
Gibe/hi et al.
116 Table 2 Primer Sequences 5’ GATGAGTTCGTGTCCGTACAACTGG 5’ GGTTATCGAAATCAGCCACAGCGCC SATAATCCACCTATCCCAGTAGGAGAAAT3 5’ TTTGGTCCTTGTCTTATGTCCAGAATGC 5’ GGTGTAAACTTGTACCAG 3’ 5’ GGTAGCAGCGGTGAGTTG 3’
3’ 3’ 3’
7131-7155 7606-7630 1551-1578 1638-1665
h phage h phage HIV- 1 gag (SK38) HIV- 1 gag (SK39) HLA DQ(a) (GH26) HLA DQ(a) (GH27)
7. 10X PCR buffer (1X solution: 10 mM Tris-HCl, pH 8.3, 50 mM KCI, 2.5 rnA4 MgCl& (store at -20°C). 8. Deionized,
double-distilled
water.
9. Oligonucleotide primers: For sequences, see Table 2 (store at -20°C). They were obtained from commercial sources (e.g., Perkin-Elmer Cetus or Genset Paris, France). 10 PCR thermal cycler (e.g., Perkin-Elmer Cetus). 11. Mineral oil (Sigma).
2.4. Amp/icon Defection and Flow Cytometry Analysis of Positive
Cells
1. Blocking reagent (Boehringer-Mannheim) to avoid nonspecific antibody bmding. Prepare a 1% (w/v) solution in 100 mMTris-HCl, pH 7.6, 150 mMNaC1. Store at 4°C for up to 2 mo. 2. Fluorescein-conjugated antidtgoxigenin polyclonal antibody (Boehringer) diluted l/1000 in blocking reagent 1%. Use freshly (within 12 h) diluted preparation. 3. Flow cytometer (e.g., Facscan [Becton-Dickinson, Palo Alto, CA]) equipped with an argon laser (15 mW, 488 nm) and adequate software program (e.g., Lysis II, Becton-Dickinson). 4. Calibration beads (e.g., Becton-Dickinson) (Store at 4°C). 5. Microscope equipped with UV lamp and filters suitable for fluorescemisothiocyanate (FITC) detection (e.g., Zeiss, Jena, Germany). 3. Methods
3.1. Cell Preparations 1. Prepare a culture of exponentially growing (optimal cell density of l-2.5 x lo6 cells/ml) lymphoblastoid 8E5LAV cells, in RPMI-1640 plus 10% FCS, at 37°C m a 5% CO* humidified atmosphere. Centrifuge at 300g for 5 min at room temperature, collect the pellet, and wash twice with PBS. Resuspend at a concentration of 2.0 x lo6 cells/ml in PBS and process immediately (see Note 1). 2. Collect venous blood samples from HIV- 1 seropositive patients (see Note 1) or healthy blood donors in ethylene-diamino-tetra-acetate (EDTA-potassium salt: 7.5%) containing Vacutainer tubes (Becton-Dickinson) and process within 4 h from collection as follows:
How Cytometry Analysis of In Situ PCR
177
a. Dilute venous blood samples 1: 1 with IMDM, and carefully layer 5 mL on 4 niL of Ficoll Histopaque gradient density solution in a centifuge tube (important: Do not mix the Ficoll H&opaque and the diluted blood sample) b. Centrifuge at 400g for 30-40 min at 18-2O’C. c. Draw off the upper layer of plasma using a Pasteur pipet, leaving the lymphocyte layer undisturbed at the interface. d. Using a new Pasteur pipet, transfer the lymphocyte layer to a clean centrifuge tube. e. Add at least 3 vol of PBS, suspend the cells gently, wash them twice with PBS, resuspend them at a final concentration of 1 x lo6 cells/ml in PBS, and process immediately.
3.2. Fixation and Permeabillzation 1. 2. 3. 4. 5. 6. 7. 8. 9.
Place 0.5-l x lo6 cells of each cell sample in a separate microcentrifuge tube. Centrifuge at 600g for 5 min, and discard the supematant. Resuspend the cells in 250 pL of PBS and centrifuge as described in step 2. Repeat step 3. Fix the cells in 300 r.ls,of PF 1% in PBS, pH 7.4, for 2 h at room temperature (see Notes 2 and 3). Wash the samples twice in 250 pL of PBS and centrifuge as described in step 2. Add 200 pL of pronase solution (10 &rnL) to each sample for 5 min at 37’C in a water bath (see Note 4). Inactivate the pronase solution in a thermal cycler for 3 min at 95°C or by boiling for 2 mm. Wash each cell sample twice in 250 & of PBS at room temperature, centrifuge at 6008 for 5 min, and discard the supematant.
3.3. In Situ PC/? Procedure Note: All materials and equipment must be rigorously clean and sterile. A separate set of micropipets and microcentrifuse tubes must be used, exclusively for in situ PCR. The positive and negative controls are summarized in Table 1. 3.3.7. Reaction Mixture Preparation For each cell sample: 1. Tube l-add 49.5 pL of the following solution: 10 mMTris-HCl, pH 8.3; 50 miV KCl; 2.5 mM MgCl,; 220 @4 each dATP, dCTP, dGTP; 215 @4 dTTP; 7 @4 Dig-dUTP (Boehrmger); 200 pMof each primer (see Notes 5 and 6 and Table 2). 2. Tube 2-add 2.5 pL of the solution removed from tube 1, and put on ice. 3. Resuspend the cell sample in the solution left in tube 1. 4. Place tube 1 into a well of the thermal cycler programmed at 82°C for 6 min. 5. Add 0.5 pL of Taq polymerase (Perkin Elmer) to tube 2 and keep on ice. 6. Switch the thermal cycler temperature to 65-75’C, immediately (see Note 7) add the contents of tube 2 (Tag polymerase) to the reaction mixture (tube l), and cover with an overlay of 50 pL of preheated ( 65-75°C) mineral oil.
118
Gibellini et al.
3.3.2. Cycling Protocol 1. Switch to 94*C for 5 min. 2. Program the thermal cycler to 55°C for 90 s, 72’C for 90 s, and 94°C for 60 s, for 35 cycles. 3. At the end of the cycling, cool the sample at 4°C. With a Comforpette 4700 (Eppendorf), with a disposable tip, collect the cells from the bottom of the tube avoiding the mineral oil. Wash the cells twice in 250 pL of PBS and centrifuge at 600g for 5 min at room temperature.
3.4. Detection 1 Suspend each cell sample in 300 pL of a 1% solution of blockmg reagent and keep for 10 min at 37°C. 2. Centrifuge the sample at 600g in a microcentrifuge for 5 min at room temperature. 3 Resuspend the cells in 1% blocking reagent containing a fluorescem-conjugatedantidigoxigenin polyclonal antibody (diluted l/1000) and keep for 30 min at room temperature. 4. Wash the samples twice in 250 pL of PBS and centrifuge at 600g for 5 min at room temperature. Resuspend the cells in 350 pL of PBS. 5 Put a small aliquot of the cell suspension from each sample on a slide. Cover the slide with a coverslip and analyze under a fluorescence microscope. Fluorescence should usually appear localized within the nucleus of most positive cells (Fig. 1). See Note 8. 6. To standardize the flow cytometer instrument (e.g., Becton-Dickinson FACScan) sensitivity, adjust the photomultiplier tube voltage and detector sensmvity with calibration beads (Calibnte beads, Becton-Dickinson). The standard band pass filter for green fluorescence is set at 530/30 (530 f 15) run and the sample acquisition rate at 60 pL/min (some expertise in flow cytometer usage is necessary or can be obtained from specialized manuals, such as Radbruch, A. [ed.] [ 19921 Flow Cytometry and Cell Sorting, Springer-Verlag, Berlin). 7. Select forward scatter (FSC) as the parameter for the threshold trigger (in flow cytometric analysis of all available optical parameters of a particle is recorded if the forward scatter light of the particle exceeds a preset threshold value [trigger]). 8. Run negative controls (see Table l), and adjust gains of forward and side scatter until obtammg a satisfactory dot plot on the screen, with the mean of lymphocyte FSC somewhere between channels 300 and 500 (with 1024 channel full scale). 9. Adjust the trigger level to exclude debris but to include all PBMC. 10. While running the samples of negative control cells, adjust voltage of fluorescence detection so as to display all cells on the left side of the scale. 11. After the setting procedure, run the samples from HIV-l seropositive patients and then the positive controls (see Table 1). Perform the data acquisition with software (Lysis II) in list mode. As parameters, use the FSC light, the side scattered (SSC) light, and green fluorescence (FLl). FSC is a function of cellular cross-section, SSC is a function of cell complexity, and FL1 represents the green fluorescence intensity.
Flow Cytometry Analysis of In Situ PCR
119
Fig. 1. Morphological examination of lymphocytes by fluorescence microscopy after in situ PCR and exposure to fluorescein-conjugated antidigoxigenin antibody. Note that the fluorescence signal in the positive cell is confined to the nucleus (200x magnification). 12. Collect at least 10,000 events for each sample. The events must then be gated for SSC and FSC in order to eliminate cellular debris and cellular aggregates. The percentage of fluorescent-positive cells is determined by integration over a range of 0.1% positive counts on identically treated negative controls. Duplicate or triplicate samples must be run (Fig. 2).
4. Notes 1. Unfixed PBMC from HIV-1-seropositive patients and lymphoblastoid 8E5LAV cells must be handled and processed in a level 3 safety laboratory with adequate precautions. 2. A good fixation may be obtained by alternative protocols, e.g., 4% PF for 30 min or 2% PF for 2 h, at room temperature. 3. It is critical to control the performance of the fixative. Although good results have been reported using alcoholic fixatives (91, most authors agree that the aldehydic fixatives give the best results (6,8,20,21). However, some lots of PF do not permit good reproducibility of the procedure, probably because of osmolarity variations (22). Therefore, it is crucial to check first the performance of the tixative by an in situ amplification assay using HLA-DQ(a)-specific oligonucleotide
Gibellini et al.
B
D
-+ Fig. 2. Flow cytometry analysis of (A) 8E5LAV cells after in sztu PCR with h phage (left peak) or HIV-l gag specific primers (right peak), (B) umnfected PBMC after in situ PCR with HIV- 1 gag specific primers, (C) PBMC from an HIV-l seropositive patient after in situ PCR with HIV-l gag specific primers, and (D) uninfected PBMC after in situ PCR with h phage (left peak) or HLA DQ(o.) (right peak) specific primers. X-axis: fluorescence intensity (logarithmic scale); Y-axis: relative numbers of cells.
primers (see Table 2). The fixative is considered suitable only when 100% of treated cells are posmve for amplified HLA gene sequences. 4. Pronase treatment represents a further critical parameter. The correct concentra-
tion and treatmenttime mustbe checkedfor eachenzymebatch and cell type. A pronase concentration between 10 and 20 pg/mL and an mcubation of 5 mm
were, in our hands,the most effective for good reproducibility of the data.If the permeabllization step is omitted or meffective, this dramatically decreases the percentage of positive cells. 5. The optimal concentration of MgCl, ranged between 1.5 and 3.0 rnA4 for both PBMC and the lymphoblastoid 8E5LAV cell line. Peak of activity was usually
Flow Cytometry Analysis of In Situ PM’
121
observed at 2.5 mM. MgCl, concentration may be influenced by cytoplasmatic structures that nonspecifically bind Mg2+ ions. In other cell systems, a higher MgCl, concentration (up to 4-6 nnl4) may be necessary. 6. To avoid nonspecific background, it is important to use a dTTP:Dig-dUTP ratio between 10: 1 and 30: 1. 7. Amplification is performed with a “hot-start” technique to prevent mispriming and primer dimerization (6). 8. A basic problem in the use of standard PCR methodology is the possibility of false-positive results owing to sample contamination (23). Using ZIZsitu PCR, the amplicon remains mainly localized within the nuclear membrane, although occasional cells may also show a diffuse cytoplasmic positivity. Amplified products diffused from positive cells might, in theory, enter negative cells. It is very unlikely, however, that contamination could reach the nucleus of negative cells. Therefore, a morphological examination of intracellular fluorescence distribution m positive cells should always precede or accompany flow cytometry analysis.
References 1. Mullis, K., Faloona, F., Scharf, S. J., Saiki, R. K., Horn, G. T., and Erhch, H. A. (1986) Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction Cold Spring Harbor Symp. Quant. Bzol. 51,263-273. 2. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G. T., Mullis, K., and Erlich, H. A. (1988) Primer directed enzymatic amphtication of DNA with a thermostable DNA polymerase. Science 239,487-491. 3. Kawasaki, E. R., Saiki, R. K., and Erhch, H. A. (1989) PCR technology, in Przncipies and Applzcations for DNA Amplzjkatzon, 1st ed. (Erhch, H. A., ed.), Stockton, New York, pp. 170-242. 4. Keller, G. H. and Manak, M. M. M. (1993) DNA probes, 2nd ed. (Keller, G. H., ed.), Stockton, New York, pp. 255-297. 5. Inms, M. A., Gelfand, D. H., Sninsky, J J., and White, T. (1989) PCR Protocols, 1st ed., Academic, San Diego, CA, pp. 325-386. 6. Nuovo, G. J. (1993) PCR In Situ Hybridizatzon: Protocols and Applzcatzons, 1st ed. (Nuovo, G. J., ed.), Raven, New York, pp. 157-184. 7. Nuovo, G. J., Forde, A., MacConnell, P., and Fahrenwald, R. (1993) In situ detection of PCR-amplified HIV-l nucleic acids and Tumor Necrosis Factor in cervical tissues. Am. .I, Path01 143,4(1-48. 8. Bagasra, O., Seshamma, T., and Pomerantz, R. (1993) Polymerase chain reaction zn situ: intracellular amplification and detection of HIV- 1 proviral DNA and other specific genes. J. Immunol. Methods 158,131-145. 9. Komminoth, P., Long, A. A., Ray, R., and Wolfe, H. (1992) In situ polymerase chain reaction detection of viral DNA, single-copy genes, and gene rearrangements in cell suspension and cytospins. Dzagn. Mol. Pathol. 1,85-97. 10. Bagasra, O., Seshamma, T., Hansen, J., Bobroski, L., Saikumari, P., Pestaner, J. P., and Pomerantz, R. (1994) Applications of zn situ PCR methods in molecular biology: details of methodology for general use. Cell Vzsion 1,324-335.
122
Gibe//hi et al.
11 Bagasra, 0. and Pomerantz, R. (1993) Human immunodeficiency virus type 1 provirus is demonstrated peripheral blood monocytes zn viva: a study utilizing an in situ polymerase chain reaction. AIDS Res. Hum. Retrovw. 9,69-76. 12. Gibellini, D., Zerbini, M., Musiani, M , Venturoli, S., Gentilomi, G., and La Placa, M. (1993) Microplate capture hybridization of amplified parvovirus B 19 DNA fragment labeled with digoxigenin. A4ol Cell. Probes 7, 101-106. 13. Re, M. C., Furlini, G., Gibellim, D., Vignoli, M., Ramazzotti, E., Lolh, S., Rameri, S., and La Placa, M. (1994) Quantification of human immunodeficiency virus type 1 infected mononuclear cells in peripheral blood of seropositive SubJects by newly developed flow cytometry analysis of the product of an zn sztu PCR assay J Clin. Mlcroblol. 32,2 157-2 163. 14. Patterson, B. K., Till, M., Otto, P., Goolsby, C., Furtado, M., McBride, L J., and Wolmsky, S. M. (1993) Detection of HIV-l DNA and messenger RNA in individual cells by PCR-driven in situ hybridization and flow cytometry. Science 260, 976-979. 15. Embleton, M. J., Gorochov, G., Jones, P T., and Winter, G. (1992) In-cell PCR from mRNA: amplifying and linking the rearranged immunoglobulm heavy and light chain V-genes within single cells. Nucleic Aczds Res. 20,383 l-3837. 16 Gibellini, D., Zauli, G., Re, M. C., Furlini, G., Lolli, S., Bassini, A., Celeghini, C , and La Placa, M. (1995) In sztu polymerase chain reaction technique revealed by flow cytometry as a tool for gene detection. Anal. Bzochem. 228,252-258. 17 Lalli, E , Gibellim, D., Santi, S., and Facchmi, A. (1992) In sztu hybridization in suspension and flow cytometry as a tool for the study of gene expression. Anal Blochem 207,298-303. 18 Folks, T. M., Powell, D., Lrghtfoote, M., Koenig, S., Fauci, A., Benn, S., Rabson, A., Daugherty, D., Gendelman, H E., Hoggan, M. D., Venkatesan, S., and Martin, M. (1986) Biological and biochemical characterization of a cloned Leu-3-cell surviving infection with the acquired unmune deficiency retrovirus. J. Exp. Med 164,280-290. 19. Folks, T. M., Benn, S., Rabson, A., Theodor, T., Hoggan, M. D., Martin, M., Lightfoote, M., and Sell, K. (1985) Characterization of a continuous T-cell line susceptible to the cytopatic effects of the acquired immunodeficiency syndrome (AIDS)-associated retrovirus. Proc. Natl. Acad. SCL USA 82,4539-4543. 20. Bagasra, O., Hauptman, S. P., Lischner, H. W., Sachs, M., and Pomerantz, R. (1992) Detection of HIV-l provirus in mononuclear cells by zn sztu PCR New Engl. J. Med. 326,1385-1391. 21. Haase, A. T., Retzel, E. F., and Staskas, K. A. (1990) Amplification and detection of lentiviral DNA. Proc. Natl. Acad. SCL USA 87,4971-4975. 22. Bauman, J. G. J. and Bentvelzen, P. (1988) Flow cytometric detection of ribosoma1 RNA in suspended cells by fluorescent w situ hybridization. Cytometry 9, 5 17-524. 23. Kwok, S. and Higuchi, R. (1989) Avoiding false positives with PCR. Nature 339, 237,238.
In Situ PCR Amplification Raymond
of Intracellular
mRNA
H. Chen and Susan V. Fuggle
1. Introduction The polymerase chain reaction (PCR) is now commonly used m laboratories involved in research studies and clinical diagnostic work (I,2). A major advantage of PCR combined with reverse transcription (RT-PCR) 1s that it can be used to amplify and detect rare mRNA within a specimen. However, conventional RT-PCR cannot be used either to quantitate the frequency of cells expressing a particular mRNA or determine the cellular origin of the amplified signal. Both of these factors may be relevant in the interpretation of gene expression. In order to overcome the limitations of conventional RT-PCR, methods have been developed for performing in situ RT-PCR (for reviews, see 3-6). By performing the reverse transcription and subsequent amplification within the cells fixed onto microscope slides, it is possible to identify the cellular origin of the signal. The technique has an advantage m that it does not require mRNA to be extracted from the sample, and thus, there is no potential for signal loss during the nucleic acid tsolation step. Furthermore, unlike conventional PCR, the technique can be used to determine the prevalence of gene expression within a cell population. The technique is based on the functional hypothesis that enzymes and reagents can freely enter fixed cells, and synthesize and amplify cDNA in situ. One important corollary is that the PCR products themselves can also freely enter and egress. Consequently, the successof the technique is dependent on an equilibrium between permeability to reagents and the retention of PCR products. In our experience, we found that carefully controlled fixation and digestion were important in maximizing the in situ amplification and retention of signal. The optimization of the equilibrium is critical to the successof the techFrom. Methods m Molecular Biology, Vol. 71 PRlNS and In Situ PCR Protocols EdRed by J R Gosden Humana Press Inc , Totowa, NJ
123
124
Chen and Fuggle
mque, and careful calibration of reaction conditions is mandatory for each primer set used. In this chapter, we will describe the technique we developed for the detection of granzyme A and perforin mRNA in cytospin preparations of activated human peripheral blood lymphocytes (7). Granzyme A and perforin are functional markers of cytotoxic T-cells, NK, and lymphokine-activated killer cells, and they can be readily detected in adult peripheral lymphocytes after in vitro stimulation (8). Our technique involves directly incorporating biotinylated nucleotides into the PCR product and detecting the labeled product with an antibiotin antibody using a standard immunochemical staining method. This method is not suitable for use on tissue sections, since damaged DNA may serve to prime the reaction, and thus, labeled nucleotides may become incorporated into a nonspecific product (9-11). Methods for in situ PCR on tissue sectionshave been described elsewhere (see Chapters 11 and 12 and refs. 12-20). 2. Materials 2.1. Glass Slide Preparation 1. Glassslides (Solmedia, Romford, Essex,UK). 2 Decon 90 (Decon Laboratories, Hove, UK). 3. 3-Aminopropyltriethoxysilane (Tespa; Sigma,Poole, Dorset, UK). 4. Acetone (Merck, Poole, Dorset, UK). 5. Diethyl pyrocarbonate (DEPC; Sigma) treated doubly-distilled water (DEPCddH,O; seeNote 1) 6. Coverslips (ChancePropper, Smethwick,Warley, UK). 7. 1% Dimethyl dichlorosilane in Ccl, (Merck). 2.2. Cell Preparation 1. Anticoagulated humanperipheral blood. 2. RPM1 (Imperial Laboratories, Andover, UK) supplementedwith 10% fetal calf serum (FCS; Imperial Laboratories), 2 mM L-glutamme, 100 U/mL penicillin, and 100 &nL streptomycin. 3. Lymphocyteseparationmedium (Flow Laboratories,Rickmansworth,He&., UK). 4. Phosphate-bufferedsaline (PBS;Unipath, Basingstoke,UK). 5. Phorbol-12-myristate-13-acetate(PMA, 500 ng/mL; Sigma). 6. Phytohemagglutinin (PHA, 1mg/mL; Wellcome, Dartford, UK). 7. Tissue-culture incubator at 37’C. 8. Cytospin centrifuge (ShandonSouthernProducts,Runcom, Cheshire,UK). 2.3. Fixation Starting from this step, it is imperative that all glassware is baked and all reagents are RNase-free (see Note 2). Chemicals should be reserved for RNA work.
In Situ PCR Amplification
125
1. 4% Paraformaldehyde (Sigma) in DEPC-PBS: Make fresh; heat suspension to 60°C with constant agitation for at least 1 h to allow paraformaldehyde to dissolve in DEPC-PBS. Cool to room temperature before use. 2. DEPC-3X PBS, DEPC-1X PBS. 3. DEPC-ddH,O. 4. 50% Ethanol in DEPC-ddHZO, 80% ethanol in DEPC-ddHz0, 100% ethanol.
2.4. Proteinase
K Digestion
Stock solutions: 1. Proteinase K (Type XI protease [Sigma] 10 mg/mL in 0. IM Tris-HCl, pH 8.0). 2. 1M Tris-HCl, pH 8.0. 3. 500 WEDTA, pH 8.0.
2.5. Hybridization
and Reverse
Transcription
1. Hybridization solution: 50% formamide (Merck), 10% dextran sulfate (Pharmacia, Milton Keynes, Bucks., UK), 300 mM NaCl, 20 mM Tris-HCl, pH 7.6, 5 mA4 ethylenediaminetetraacetic acid (EDTA), 1X Denhardt’s (Sigma), 10 mM dithiothreitol (DTT, Sigma). 2. Antisense primer at 1 pg/mL (see Section 2.6.). 3. Moloney murine leukemia virus reverse transcriptase (RT; Life Technologies, Uxbridge, UK). 4. 5X Reverse transcription buffer (Life Technologies). 5. 100 mM stocks of dATP, dCTP, dGTP, dTTP (Boehringer Mannheim, Lewes, East Sussex, UK). 6. 100 mMDTT (Life Technologies). 7. RNase inhibitor (Promega, Southampton, UK). 8. Bovine serum albumin (BSA [Sigma]) 10 mg/mL in DEPC-H20. 9. DEPC-ddH20. 10. DEPC-2X SSC. 11, Humidified slide box. 12. Hybridization oven at 42OC. 13. Hybridization oven at 37°C.
2.6. In Situ PCR 1. Granzyme A primers: 5’-CCA GAA TCT CCA TTG CAC GA 5’-CTG TAA CTT GAA CAA AAG GT 2. Perforin primers: 5’-ACA TGG AAA CTG TAG AAG CG 5’-GGA TTC CAG CTC CAT GGC AG 3. Tuq polymerase (Promega). 4. 1OX Taq polymerase buffer (Promega). 5. 100 mM stocks of dATP, dCTP, dGTP, dTTP.
Chen and Fuggle
126 6. 7. 8 9. 10. 11
22.5 nmol biotin-1 I-dUTP (Sigma). 25 mM MgCl, (Life Technologies). DEPC-ddH,O. Mineral oil (Sigma). Xylene (Merck). Thermocycler (Hybaid, Teddmgton, Middlesex, UK).
2.7. Detection 1. 2. 3. 4 5.
6. 7. 8. 9. 10.
of Amplified
Products
Mouse antibiotin monoclonal antibody (MAb) (Dako, High Wycombe, Bucks., UK). Horseradish peroxldase (HRP)-conjugated, rabbit antimouse Ig antibody (Dako). Human AB serum. BSA (10% stock solution m PBS). Substrate: 3,3-diaminobenzidine tetrahydrochloride (DAB [Sigma], 0.6 mg/mL in PBS made freshly with the addition of 3 pL/mL 3% H202 (Thornton and Ross, Huddersfield, UK) immediately before use. Harris’ hematoxylin (Sigma). 70 ,90, and 100% Ethanol. DPX mountant (Merck). PAP pen (Bayer Diagnostics, Basingstoke, Hams., UK). Humidtfied staining tray.
3. Methods 3.1. Glass Slide Preparation 1 Glass slides should be thoroughly cleaned by soaking overnight m 10% Decon 90 in double distilled water. Then rinse slides successively with coprous amounts of hot tap water, deiomzed water, and ddH20, place in racks, dry, wrap m alummum foil, and bake at 200°C for 4 h to destroy RNase activity. From this point onward, all glassware used should be RNase free (see Note 1). Then coat slides by incubating m a solution of 2% Tespa in acetone for 2 mm. Rinse twice with fresh acetone, twice with DEPC-Hz0 (see Note l), wrap loosely in aluminum foil, and dry at 37OC overnight. Slides may be stored at room temperature before use. 2. Coverslips should be silicon-coated for easy removal during the procedure. Soak the coverslips in 1% dimethyl dichlorosilane in Ccl4 for 1 min, rinse with fresh ddH*O, wrap in alummum foil, bake at 200°C for 4 h, and store at room temperature until required,
3.2. Cell Preparation 1. Dilute human peripheral blood 1:2 with PBS and isolate lymphocytes by centrtfugation through lymphocyte-separation medium at 400g at 20°C for 25 min. 2. Collect lymphocytes from the gradrent interface and dilute at least 1:2 in PBS; pellet at 400g at 20°C for 7 min. 3. Wash twice further in PBS, centrifuging at 300g at 20°C for 5 min.
727
In Situ PCR Amplification
4. Resuspend cells in supplemented RPM1 medium at a concentration of 1 x lo6 cells/ml, and stimulate with 100 ng/mL PMA and 50 &mL PHA in RPMI/FCS. 5. Four days later, harvest cells by centrifugation at 3008 at 20°C for 5 min. 6. Wash cells m DEPC-PBS buffer and pellet onto Tespa-treated microscope slides by Cytospin centrifugatron at 80g at 20°C for 5 min.
3.3. Fixation 1. Place Cytospin preparations on Tespa-treated glass slides in baked slide racks. 2. After allowing the slides to dry for 5 min, fix the cytospin preparations at room temperature according to the following schedule (see Note 2): a. 4% pamformaldehyde, 20 min; b. 3X DEPC-PBS, 5 min; c. 1X DEPC-PBS, 5 min; d. 1X DEPC-PBS, 5 min; e. DEPC-ddH,O, 1 min; 50% EtOH in DEPC-ddH,O, 1 mm; f. 80% EtOH in DEPC-ddI&O, 1 min; and g. 100% EtOH, 1 min. 3. After fixation, cytospm preparations may be covered in aluminum foil and stored at -80°C.
3.4. Proteinase K Digestion 1. Place slides in a baked 2-L beaker at 37°C for a 30-min digestion with 10 pg/mL proteinase K in O.lM TrYSO mM EDTA, pH 8.0 (see Note 2). 2. Subsequently fix slides in 4% paraformaldehyde as in Section 3.3.
3.5. Hybridization
and Reverse Transcription
For all of the manipulations
described below, the slides are placed on a bench
covered with aluminum foil. 1. Hybridize cytospin preparations with 10 pL of hybridization solution containing 2.5 ng/pL of antisense oligonucleotides to the human granzyme A or perform genes in a humidified chamber for 2 h at 42OC (see Note 3). 2. During this incubation, the preparations are covered with a coverslip, and carefully placed onto the cells using baked forceps. 3. At the end of the incubation, wash slides vigorously in 2X SSC for 5 min to remove coverslips and hybridization buffer. 4. Shake slides vigorously, wipe with tissue to remove excess salt, and then air-dry. 5. Apply 7 & of reverse transcription mixture to the cell pellet, cover with a coverslip, and incubate for 1 h in a humidified chamber at 37°C. 6. The mixture contains reverse transcriptase (3 U/pL), in a buffer of 75 miV KCl, 10 mMTris, pH 8.0, 12 mMMgCl*, 2 pg/pL BSA, 10 mJ4DTT containing 1 mM of each dATP, dGTP, dCTP, dTTP, and 1 U/pL RNase inhibitor. 7. Wash slides extensively in 2X SSC buffer for 5 min, briefly rinse in ddH*O, and air-dry.
128
Chen and Fuggle
3.6. In Situ PCR Controls are critically important for in situ PCR. (Please refer to Notes 4 and 5 for suggestions.) In order to reduce the quantity of reagents required for the PCR stage,cut coverslips to a sizeof approx 1 cm* using a diamond glass cutter. 1. Add 5 pL of a solution containing Tug polymerase at 0.5 U/pL; 1 mM dATP, dGTP, dCTP; 0.9 m&I dTTP; 0.1 mM biotin- 11-dUTP; 75 nnI4 KCI; 10 mM Tris, pH 8.0; 10 mM MgCl*; and 7 pmol/pL of each 5’- and 3’-oligonucleotide complementary either to the human granzyme A or perforin genes to the slides (see Note 6). 2. Place slides on the thermocycler (see Note 7), cover the mixture with the small coverslips, and flood the slides with mineral oil to prevent desrccatron (see Note 8). 3. The amplification proceeds for one cycle at 94OC for 5 min; 30 cycles at 94°C for 1 min, 60°C for 1 min, 72OC for 1 min; one cycle of 72OC for 10 min 4. After PCR amplificatron, submerge the slides in xylene for 2 min to remove mineral oil and then leave in the fume hood to allow xylene to evaporate. 5. Spray the slides with 70% alcohol and wipe with tissue to remove any remainmg oil (see Note 9). 6. When dry, place the slides m a rack and agitate in 2X SSC to remove coverslips. Then wash extensively in 2X SSC, in PBS, and finally air-dry.
3.7. Defection of Amplification
Products
1. Draw a circle around the cell pellet with a PAP pen in order to create a barrier to contain reagents for the detection step. 2. The detection step IS performed in a humidified chamber.
3. Rinse slidesin PBSandincubate for 30 min with 50 $ of mouseantibiotin MA\, (1:25 in PBS containing 0.5% BSA). 4. Wash the slides three times in PBS, incubating for 5 min each time. 5 Detect the primary antibody by incubating for 30 min with 50 pL of HRP-coqugated rabbit anttmouse Ig antibody ( 1:50 in PBS with 10% human AB serum and 0.5% BSA).
6. After washing a further three times in PBS, develop the signal with the freshly prepared substratesolution (DAB and HZOZ). 7. Counterstam with Harris’ hematoxylin.
8. Dehydrate through 70,90, and 100%ethanol (1 min each),equilibrate in xylene, and mount in DPX medium. Figure 1 illustrates results obtained by using the RT-PCR technique described in this chapter showing granzyme A mRNA in stimulated peripheral blood lymphocytes.
4. Notes 1. It is important to useRNase-free conditions for this technique. Solutions should be treated with 0.1% DEPC for 12 h at 37°C and autoclaved for 30 min before
In Situ PCR Amplification
129
Fig. 1. In situ cDNA PCR detection of granzyme A. (A) Granzyme A was detected in PHA/PMA stimulated lymphocytes following 30 cycles of PCR amplification. (B) PHA/PMA-stimulated lymphocytes were mixed 1:4 with unstimulated, granzyme A-negative, peripheral blood lymphocytes. Large blast cells are granzyme A-positive, whereas the smaller, unstimulated lymphocytes are negative. This demonstrates that, in this system, despite the presence of labeled PCR product in the supernatant, cells negative for granzyme A within a mixed-cell population remain unstained.
use. Tris buffers cannot be treated directly with DEPC, but should be made with DEPC-treated, autoclaved ddHaO. Glassware should be rendered RNasefree by covering with aluminum foil and baking for 4 h at 200°C. Gloves should be worn at all times. When it is necessary to place slides on the bench, the bench should be covered with aluminum foil and the slides manipulated with baked forceps. 2. Cellular fixation and digestion are critical to the success of this technique. The conditions may vary according to the type of cells used, the size of the PCR product, and the stability of the mRNA. The conditions need to be optimized for each new set of experiments. 3. The duration of hybridization needs to be empirically determined. Although a longer hybridization time should favor oligonucleotide-mRNA binding, labile mRNA may degrade, resulting in a truncated cDNA. 4. Controls are of crucial importance in in situ PCR systems. Positive controls using primers specific for a housekeeping gene need to be performed on the test cells to demonstrate the presence of mRNA. Cells known to be positive for the gene of interest should be included to demonstrate that the reaction conditions have been optimized. Negative controls are particularly important in a system such as we describe, where labeled nucleotides are directly incorporated into the PCR product. In this respect, a PCR in situ hybridization system has advantages and may be preferred. Some suggested negative control reactions are shown in Table 1. A negative result from reaction (a) will demonstrate the absence of endogenous peroxidase in a sample and from (b) the absence of nonspecific binding of the HRP-conjugated secondary antibody. Reactions (c) and (d) will show that there is neither endogenous biotin in the sample nor a signal following RT alone.
Chen and Fuggle
130 Table 1 Suggested Negative Controls for In Situ cDNA PCR a Fixation, digestion Hybridization Reverse transcription PCR Antibiotin antibody HRP-conjugated secondary antibodp Substrate Expected result
bcdefgh
++++++++ ++++-+++ + + + + + ++++++++ _ -
+ + +a ++++++ + +
+ +
+* +
+ +c
+ +d
+
+
+
+
-
-
-
-
-
-
OOmit blotmylated nucleotide. *Omit reverse transcriptase. COmit primers. dOmit Taqpolymerase. eHRP-horseradish peroxidase.
5. 6.
7.
8. 9.
Reactions (e) and (f) are particularly important controls; a negative result demonstrates that the signal results from amplification of the cDNA, and not from priming by nicked DNA or amplification of genomic DNA. Reaction (g) demonstrates the requirement for primers and (h) on Taq polymerase to produce a signal. It 1s possible to perform a Southern blot analysis on the supernatant from the zn situ PCR reaction (3). This enables the specificity of the amplified product to be confirmed. In srtu PCR appears to require higher concentrations of reagents than tube PCR (MgC12, Taq polymerase, and nucleotides). Consequently, it may not be possible to transfer conditions optimized for tube PCR directly to an in sztu PCR system. The heating blocks of traditional PCR thermocyclers, with their discontinuous surface area, do not provide ideal heat conduction for in sztu PCR. It is preferable to use a machine with specifically designed flat blocks. Desiccation during the PCR process can yield false-positive signals. It is important that the mineral oil completely seal the coverslip. The mineral oil should be completely removed before the immunohistochemistry step. If present, the hydrophobic oil droplets will interfere with the antibody binding and subsequent detection of the PCR product.
References 1. Saiki, R. IS., Scharf, S. J., Faloona, F., Mullis, K. B., Horn, G. T., Erlich, H. A., and Arnheim, N. (1985) Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230, 1350-1354.
In Situ PC/? Amplification
137
2. Rolfs, A., Schuller, I., Fin&h, U., and Weber-Rolfs, I. (1992) PCR* Clinical Diagnosis and Research. Springer-Verlag, Heidelberg. 3. Nuovo, G. J. (1992) RNA and mRNA reverse transcriptase PCR znsitu hybridization, in PCR In Situ Hybridization: Protocols and Applzcations (Nuovo, G. J., ed.), Raven, New York, pp. 239-254. 4. Komminoth, P. and Long, A. A, (1993) In situ polymerase chain reaction, An overview of methods, applications and limitations of a new molecular technique. Virchows
Archiv. B Cell Puthol. 64,67-73.
5. Chen, R. H. and Fuggle, S. V. (1995) In situ cDNA polymerase chain reaction: research and clinical applications in Progress in Pathology, vol. 2 (Kirkam, N. and Lemoine, N. R., eds.), Churchill Livingstone, London, UK, pp. 203-218. 6. Teo, I. A. and Shaunak, S. (1995) Polymerase chain reaction in situ: an appraisal of an emerging technique. Histochem. J. 27,647-659. 7. Chen, R. H. and Fuggle, S. V. (1993) In situ cDNA polymerase chain reaction: a novel technique of detecting mRNA expression. Am J. Pathol. 143, 1527-l 534. 8. Griffiths, G. M. and Mueller, C. (1991) Expression of perforin and granzymes in vivo: potential diagnostic markers for activated cytotoxic cells. Immunol. Today 12,415419.
9. Long, A. A., Komminoth, P., Lee, E., and Wolfe, H. J. (1993) Comparison of indirect and direct in-situ polymerase cham reaction in cell preparations and tissue sections, Hzstochemistry 99, 15 1-162. 10. Sallstrom, J. F., Zehbe, I., Alemi, M., and Wilander, E. (1993) Pitfalls of in sztu polymerase chain reaction (PCR) using direct incorporation of labeled nucleotides. Anticancer Res. 13, 1153-l 154. 11. Teo, I. A. and Shaunak, S. (1995) PCR in situ: aspects which reduce amplification and generate false positive signals. Histochem. J. 27,660-669. 12. Nuovo, M. A., Nuovo, G. J., MacConnell, P., Forde, A., and Steiner, G. C. (1992) In situ analysis of Paget’s disease of bone for measles-specific PCR-amplified cDNA. Diagn. Mol. Pathol. 1,256-265. 13. Nuovo, G. J., Forde, A., MacConnell, P., and Fahrenwald, R. (1993) In situ detection of PCR-amplified HIV-l nucleic acids and tumor necrosis factor cDNA in cervical tissues. Am. J. Path01 143,4M8. 14. Nuovo, G. J., Lidonnici, K., MacConnell, P., and Lane, B. (1993) Intracellular localization of polymerase chain reaction (PCR)-amplified hepatitis C cDNA. Am. J. Surg. Pathol. 17,683-690.
15. Heniford, B. W., Shum-Siu, A., Leonberger, M., and Hendler, F. J. (1993) Varration in cellular EGF receptor mRNA expression demonstrated by zn situ reverse transcriptase polymerase chain reaction. Nuclezc Acids Res. 21,3 159-3 166. 16. Nuovo, G. J., Becker, J., Simsir, A., Margiotta, M., Khalife, G., and Shevchuk, M. (1994) HIV- 1 nucleic acids localize to the spermatogonia and their progeny. Am. J. Puthol. 144,1142-l 148. 17. Nuovo, G. J., Gallery, F., MacConnell, P., and Braun, A. (1994) In situ detection of polymerase chain reaction-amplified HIV-l nucleic acids and tumor necrosis factor-a RNA in the central nervous system. Am J. Pathol. 144,659-666.
132
Chen and Fuggle
18. Patel, V. G., Shum-Siu, A., Heniford, B. W., Wieman, T. J., and Hendler, F. J (1994) Detection of epidermal growth factor receptor mRNA in tissue sections from biopsy specimens using in situ polymerase chain reaction. Am J. Pathol. 144,7-14. 19. Staecker, H., Cammer, M., Rubinstein, R., and van de Water, T. R. (1994) A procedure for RT-PCR amplification of mRNAs on histological specimens. Biotechniques 16,76-80. 20. Lau, G. K., Fang, J. W., Wu, P. C., Davis, G. L., and Lau, J. Y. (1994) Detection of hepatrtrs C virus genome in formalin-fixed paraffin-embedded liver tissue by in situ reverse transcription polymerase chain reaction. J. Med. Vzrol. 44,406-409.
15 Localized In Situ Amplification
(LISA)
PCR Amplification of Nucleic Acid Sequences in Tissue Sections Gregory
J. Tsongalis
I. Introduction The polymerase chain reaction (PCR) has revolutionized the manner in which molecular biologists are able to examine nucleic acids by offermg an extremely sensitive mechanism for ampliI+ing specific target sequences.The combination of mcreased sensitivity owing to the amplification process and increased specificity owing to primer sequenceswith subsequentanalysesby DNA sequencing, restriction enzyme digestion, or probe hybridization has provided the most powerful molecular tool thus far for both the research and the clinical laboratory (1,2). The majority of molecular analyses focus on the isolation and purification of nucleic acids from the parent tissues, excluding the possibility of associating the presence of genetic sequences with a specific cell type or region of tissue. In situ hybridization (ISH) protocols have been developed for the detection of nucleic acid sequences within whole cells and/or tissue sections utilizing probe technology. A major disadvantage of ISH is that oftentimes the target of interest may be a single-copy gene or low-copy viral sequence whose detection is below the limit of ISH sensitivity. An extremely powerful technique results from the combination of both in situ PCR (ISP) and ISH. The coupling of these two techniques combines one methodology with extreme sensitivity and specificity (PCR) with the ability to determine cellular localization (ISH) (3-7). Single-copy DNA target sequences that were previously too scarce to detect by ISH can now be amplified so that they are more easily detected. As expected, numerous investigators have described protocols for utilization of these two techniques in the detection of infectious organisms in From. Methods in Molecular Biology, Vol. 71, PRINS and In Situ PCR Protocols Edited by J R Gosden Humana Press Inc , Totowa, NJ
133
Tsongalis
134
tissue samples (3-13), and nucleic acid sequencesin cell cytospin preparations (IO) and formalin-fixed paraffin-embedded tissues (11-I 5). To date, the majority of ISP applications are confined to the detection of foreign nucleic acid sequenceswith respect to foreign organisms of infectious origins. Although publications do exist that describe the use of ISP for detection of genetic alterations, this application has not yet been fully exploited. Meanwhile, in situ RT-PCR has been well described by Nuovo (S-7) and others. This technology at first may seemlimited by the fact that the source of target nucleic acid sequencesis whole tissues.However, the applications at this level of cellular architecture are limited only by one’s imagination. As the number of gene therapy protocols continues to increase, so too will the need for determining not only which cells have received the newly introduced gene, but also which of these cells is expressing this gene. This type of information can be provided accurately only by ISP technologies. As our understanding of some infectious diseaseshas increased owing to information obtained by ISP, gene therapy trials will also benefit from our ability to localize a new gene and/or gene product within specific cell types. Over the past four years, more than 300 manuscripts and at least two books have been devoted to the development and application of ISP for both research and clinical investigations. Four major steps are involved in the ISP process: 1, Tissuepreparation; 2. Cell permeabilization; 3. In situ amplification; and 4. Detection.
Like many, if not all other procedures, each one of these steps must be optimized for the application being pursued. Although tedious and time-consuming, initial optimization can save a great amount of time, effort, and frustration.
2. Materials 2.1. Tissues 1. Formalin-fixed paraffin-embedded tissue: This protocol is designed for routinely fixed (10% buffered formalin) tissues from the Anatomic Pathology Laboratory. 2. Tissue sections: routine, 5-6 pm thickness. 3. Organosilane-coated glass slides (Fisher Scientific, Pittsburgh, PA)
2.2. Cell Permeabilization 1. Xylene (Brand New Labs, New Haven, CT).
2. ProteinaseK (Promega,Madison, WI).
2.3. LISA 1. Deoxynucleoside
triphosphates (Perkin Elmer, Foster City, CA): Each deoxy-
nucleosidetriphosphate(dNTP) is provided separatelyat a concentrationof 10mM. A working solution of all four dNTPs is made up to a concentration of 1.25 &each.
LISA
135
2. AmpliTaq
DNA polymerase (Perkin Elmer).
3. 10X Taq buffer (Perkin Elmer): 100 mMTris-HCl,
9. 10. 11.
pH 8.3,500 mMKC1, 0.01% w/v gelatin. 25 mM MgCl, (Perkin Elmer). Forward and reverse oligonucleotide primer. Deionized water. Digoxigenin-1 I-dUTP (Boehringer Mannheim, Indianapolis, IN; Gemus 1 Kit). Tissue-culture cloning rings (Bellco Glass Inc., Vineland, NJ) (0.8-cm outer diameter, O.&cm inner diameter, 1*O-cm height). Clear nail polish. Mineral oil (Sigma Chemical, St. Louis, MO). Thermal cycler (Conditions are given for the COY TempCycler II, Grass Lake, MI).
2.4.
Defection
4. 5. 6. 7. 8.
1. 2. 3. 4. 5. 6. 7. 8. 9.
Acetone (Sigma). Wash buffer l(lO0 r&T&HCl, 150 mMNaC1, pH 7.5) (Boehringer Mannheim). Blocking buffer (0.5% blocking reagent in wash buffer 1) (Boehringer Mannheim). Humidified chamber Antidigoxigenin antibody (alkaline phosphatase-conjugated antidigoxigenin, (Boehringer Mamrheim). Wash buffer 2: 100 mM Tris-HCl, 100 mM NaCl, 50 mil4 MgC&, pH 9.5 (Boehringer Mannheim). Chromogen: nitroblue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl phosphate (Boehringer Mannheim). Stop buffer: 10 mMTris-HCl, 1 mMEDTA, pH 8.0. Eosin stain (Sigma).
3. Methods
3.1. Tissue Preparation Paraffin-embedded tissue sections fixed in 10% buffered formalin are prepared by the histology laboratory using routine protocol (see Note 1). Sections of 6-pm thickness should be placed onto organosilane-coated
glass slides.
3.2. Cell Permeabllization 1. Deparafflnize tissue sections, and rehydrate by sequentially placing the slides into Coplin jars containing the following solutions for the given time: xylene, 10 min; xylene, 10 min; 100% ethanol, 5 min; 100% ethanol, 5 min; 95% ethanol, 2 min; 70% ethanol, 2 min; 50 % ethanol, 2 min; and phosphate-buffered saline, pH 7.6, 5 min. 2. Treat tissues with proteinase K (1 pg/mL) for 10 min in 10 mMTris-HCl, pH 7.6, 1 mMEDTA at 37°C (see Note 2). 3. Dehydrate tissues in a series of graded alcohols (i.e., 70, 95, and 100% for 2 min each).
Tsongalis
136 3.3. LlSA
1. Place tissue sections, prepared as described in Section 3.2., onto the slide thermocycler (Tempycler II) with heating blocks designed to accommodate glass microscopic slides (Fig. lA,B). 2. Heat slides for 1 min at 94’C to inactivate the proteinase K prior to the addition of glass tissue-culture cloning rings. Place these selectively on top of the tissue section at room temperature (see Note 3). 3. Seal the bottom of the ring to the tissue section with clear nail polish (approx 50 pL), forming an amplification vessel for the LISA reaction. The nail pohsh should be allowed to air-dry before proceeding (see Note 4) (Fig. 2). 4. The amplification reactton consists of a total volume of 25 l.tL/cloning rmg and includes 75 ng of both the forward and reverse primer, 0.5 U Ampli??rq polymerase in a reaction solution containing per liter: 200 nA4of each deoxynucleotide triphosphate, 1.5 miV MgC12, 67 mikf Tris-HCl, pH 8.8, 10 mM 2-mercaptoethanol, 16.6 mM ammonium sulfate, 6.7 mM EDTA, and the addition of 10 mA4 digoxigenin-1 I-dUTP (see Note 5). The reaction mixture is added to the center of the cloning ring and mineral oil is overlaid to prevent evaporation (see Notes 6 and 7). 5 Place the slides onto the slide thermocycler and denature DNA in situ at 94’C for 2 mm prior to amplification (see Note 8). 6. LISA is accomplished by using 20 cycles consisting of a 1-min primer annealing step (55”(Z), 1.5-min extension step (72”(Z), and a 1-min denaturation step (94°C).
3.4. Defection 1. Detect amplified productscontaining incorporated dlgoxigenin- 11-dUTP using a modification of the protocol supplied with the Genius 1 kit. 2. Remove each reaction mixture by pipeting, and rinse the wells with xylene. All solutions and reactions should be at room temperature. 3. Remove the cloning rings from the glass slides by soaking m acetone for l-2 mm (see Note 9). 4. Wash the slides three times with approx 500 pL buffer 1 (100 m&f Tris-HCl, 150 miVNaC1, pH 7.5), and then incubate for 30 min with 500 l.tL buffer 2 (0.5% blocking reagent in buffer 1) in a humidified chamber (see Note 10). 5. Rinse the slides with 500 $ buffer 1, and incubate for 1 h with a 1: 100 dilution of antibody (alkaline phosphatase-conjugated anti-digoxigenin) in a humidt-
fied chamber. 6. Excess antibody is removed by three washes in buffer 3 (100 mMTris-HCl,
100
miWNaC1,50mA4MgC12,pH 9.5) before the addition of the chromogen(mtroblue tetrazolium chloride and 5-bromo-4-chloro3-mdolyl phosphate). 7. Monitor development of the detection reaction for optimal stainmg (approx 1O-25 min), and stop by rinsing three times in buffer 4 (10 mA4 Tris-HCl, 1 mJ4 EDTA, pH 8.0) (see Note 11). 8. Dehydrate the tissues in a series of graded alcohols and counterstain with eosin before coverslipping for microscopy
LISA
137
Fig. 1. The COY TempCycler II (A) was one of the first specialized instruments for ISP applications. The specially designed heating block (B) can accommodate up to four glass slides.
138
Tsongalis CLONING
RINGS L-
TISSUE GLASS SLIDE
Fig. 2. Application of cloning rings to tissue section on glass slide. The ability to place more than one ring on each section allows for the simultaneous performance of multiple reactions.
4. Notes 1. Traditionally 10% buffered formalin has been the fixative of choice. However, others have used frozen tissues as well as alcohol or heat-fixed tissues with limited success. Unbuffered formalin and fixatives containing picric acid or heavy metals are not recommended. 2. Protease digestion is necessary to permeate tissue samples. Fixation crosslinks proteins and nucleotides, thus hindering reagent penetration and target sequence availability. The concentration of enzyme, duration of digestion, and temperature are all critical. Excessive digestion will destroy tissue morphology, whereas under digestion will result in poor permeability, decreased amplification, and increased background. 3. It is imperative that the protease be inactivated at this step before proceeding. 4. Clear nail polish is relatively inexpensive. Colored nail polishes of greater or lesser value are not suitable for LISA because of leaching out of color during high-temperature cycling. 5. PCR reaction mixtures can first be optimized by traditional tube amplification reactions. Some reports suggest using higher concentrations of magnesium and polymerase for ISP. 6. Ampliwax beads may also be used in place of mineral oil for “hot-start” PCR protocols. LISA lends itself quite well to such modifications in PCR procedures. 7. Proper control reactions are essential to all ISP protocols. These should consist of at least the following reactions: omit primers, omit polymerase, alternate primer set for other target sequence, and tissue without target sequence present. 8. Other thermal cyclers are also available specific for ISP from MJ Research, Inc. (Watertown, MA), Hybaid Ltd. (Teddington, England), and Perkin Elmer (Foster City, CA). Conditions will need to be optimized for the respective instrument used. ISP can also be performed on traditional thermal cyclers by covering the heating block with aluminum foil. 9. Cloning rings do not need to be removed at this point. They can be left in place throughout the detection process. However, doing so results in loss of tissue outside the ring acting as an internal negative control for the detection process.
LISA
739
10. Humidified chambers are easily constructed out of plastic containers with lids. Tape damp gauze bandage pads to the inner portion of the lid after slides are placed into the container. Cover with lid to keep slides from drying out. 11. Detection is dependent on the amount of amplification and size of the target. This step must be monitored closely so that overstaining does not occur.
References 1. Landegren, U. (1992) Detection of mutations
in human DNA. Genet. Anal.
Technol. Applic. 9,3-K
2. Mtes, C. (1992) Molecular pathology of paraffin-embedded tissue. current clinical applications. Diagn. Mol. Pathol. 1,206211. 3. Haase, A. T., Retzel, E. F., and Staskus, K. A. (1990) Amplification and detection of lentiviral DNA inside cells. Proc. Natl. Acad. Sci. USA 87,497 l-4975. 4. Nuovo, G. J., MacConnell, P., Forde, A., and Delvenne, P. (1991) Detection of human paprllomavirus DNA in formalin fixed tissues by in situ hybridization after amplification by the polymerase chain reaction. Am J. Pathol. 139, 847-854. 5. Nuovo, G. J., Darfler, M. M., Impraim, C. C., and Bromley, S. E. (1991) Occurrence of multiple types of human papillomavims in genital tract lesions: analysis by rn situ hybridization and the polymerase chain reaction. Am. J. Path01 58,5 18-523 6. Nuovo, G. J., Gallery, F., MacConnell, P., Becker, J., and Bloch, W. (1991) An improved technique for the detection of DNA by in situ hybridization after PCRamplification. Am. J. Pathol. 139, 1239-1244. 7. Nuovo, G. J., Margiotta, M., MacConnell, P., and Becker, J. (1992) Rapid in situ detection of PCR-amplified HIV-l DNA. Diagn. Mol. Pathol. 2,98-102. 8. Ou, C. Y., Kwok, S., Mitchell, S. W., Mack, D. H., Sninsky, J. J., Krebs, J. W., et al. (1988) DNA amplification for direct detection of HIV-l in DNA of peripheral blood mononuclear cells. Sczence 239,295-297. 9. Demmler, G. J., Buffone, G. J., Schimbor, C. M., and May, R. A. (1988) Detection of cyotmegalovirus in urme from newborns by using polymerase chain reaction DNA amplification. J. Infect. Dis. 158, 1177-l 184. 10. Komminoth, P., Long, A. A , Ray, R., and Wolfe, H. J. (1992) In situ polymerase chain reaction detection of viral DNA, single copy genes, and gene rearrangements m cell suspensions and cytospins. Diagn. Mol. Pathol. 1,85-97. 11. Tsongalis, G. J., McPhail, A. H., Lodge-Rigal, R. D., Chapman, J. F., and Silverman, L. M. (1994) Localized in situ amplification (LISA): a novel approach to in situ PCR. Clin. Chem. 40,381-384. 12. Tsongalis, G. J. and Silverman, L. M. (1994) In situ amplification: detection of target sequences in whole tissues. Ann. Clin. Lab. Sci. 24,436-440. 13. Long, A. A. and Kommmoth, P. (1994) Study of viral DNA using zn situ PCR. Cell Vision 1,56,57.
14. Isaacson, S. H., Asher, D. M., Gajdusek, D. C., and Gibbs, C. J., Jr. (1994) Detection of RNA viruses in archival brain tissue by in situ RT-PCR amplification and labeled-probe hybridization. Cell Vision 1,25-28. 15. Bagasra, O., Seshamma, T., and Pomerantz, R. J. (1994)In situ PCR: applications m the pathogenesis of diseases. Cell Vision 1,48-5 1
In Situ PCR An Overview Aldan A. Long and Paul Komminoth 1. Introduction In contrast to the immediate and enormous impact that solution-phase polymerase chain reaction (PCR) had in molecular biology, morphologists have regarded the development of in situ PCR with cautious expectancy (1,Z). The notion of employing a PCR-based amplification step to increase the sensitivity of in situ hybridization (ISH) apparently came to several laboratories independently in the late 1980s (36). The result has been a relatively small number of publications detailing at once some successes,certain problems and limitations of the technique, and a variety of different technical approaches to combining the technologies of ISH and PCR. As we approach the end of the 199Os, it seems likely that the relative importance of the variables identified will be agreed on and that some consensus concerning optimization of the multiple steps involved will emerge, paving the way for standardized protocols that may serve to establish in situ PCR in diagnostic laboratories. The PCR and ISH are now very well-established molecular techniques in studies of gene detection, gene expression, and structure. ISH has the great advantage of permitting localization of specific nucleic acid sequences to individual cells. In addition to morphologic identification of cell types involved, ISH also allows some quantification of observations, for example, with respect to tumor burden or viral load. Unfortunately, the usefulness of ISH is frequently limited by low detection sensitivity, with the reported sensitivity limits of 10-20 copies of mRNA/cell being approached in only the most sensitive protocols. PCR, on the other hand, is a technique of extremely high sensitivity and has been repeatedly used to amplify rare or single-copy gene sequencesto levels easily detectFrom. Methods in Molecular Biology, Vol. 71: PRINS and In Sltu PCR Protocols Edited by J. R. Gosden Humana Press Inc., Totowa, NJ
642
Long and Komminoth
able by gel electrophoresis and Southern blot hybridization. It is this unparalleled sensitivity that created a mini revolution in molecular biology and medicine. Conventional solution-phase PCR requires cell or tissue destruction to isolate nucleic acids, and one cannot, therefore, associate the amplification results to a specific histological cell type, correlate results with histopathological features, or measure the percentage of cells that contain the target sequence. A molecular technique that might combine the high sensitivity of the PCR with the cytological localization of sequences provided by ISH seemed highly desirable. Several groups have described the marriage of these technologies under the sundry names “in situ PCR” (5,,, “PCR in situ” (7,8), “PCR in situ hybridization” (9), “in-cell PCR” (IO), “PCR-driven ISH” (II), or “cycling PRINS” (12). More recently, an intracellular reverse transcription (RT) step to generate cDNA from mRNA templates prior to in situ PCR has been used for the detection of low-copy mRNA sequences. This modification of in sztuPCR has been termed “in situ RT-PCR” (13), or less precisely, “RT in situ PCR” (9) or “in situ cDNA PCR” (14). Important variables of in situ PCR appear to include the type of starting material (suspended cells, cytospins, tissue sections), the type and copy number of target sequence (viral or genomic DNA or RNA), the amplification method (i.e., with single or multiple primer pairs), the detection system (direct or indirect in situ PCR), and the use of adequate control experiments (15-I 7).
2. Principles and Methods of In Situ PCR Experimental protocols for successful in situ PCR share a number of important key steps. These include fixation and permeabilization during sample preparation, a mechanism for thermal cycling cellular material in solution or on glass slides, and a means to detect the amplificants (18). Variables at each of these steps that likely account for some of the reported discrepancies m both results and interpretation have now been identified, and certain principles of optimization are now emerging (1.5,I 7,29,20). 2.1. Sample Preparation In order to preserve morphology and permit accessof the PCR reagents to the intracellular sequences to be amplified, cells or tissue samples need to be fixed and permeabilized before the PCR amplification step. Not all fixatives are equally permissive to in situ PCR. The crosslinking fixatives appearing to provide the most consistently successful outcomes. Successful in situ amplification has been achieved in samples fixed in l-4% paraformaldehyde, 10% buffered formaldehyde solution, and alcohol or mixtures of alcohol and acetic acid (3,5,7,17,21,22). Paraformaldehyde now appears to be the fixative of choice in most laboratories.
In Situ PCR Overview
143
The fixation step has emerged as a critical variable in determining the overall success of in situ PCR. Whereas model systems developed with live cells in culture allow for precise control of both the duration and the nature of the fixation used, clinical samples that include archival paraffin-embedded samples clearly pose complications in this regard. In such situations, prolonged fixation of uncertain duration has frequently been employed. This can have adverse implications not only on PCR reagent accessibility to the nuclear DNA (or cytoplasmic cDNA), but also on the quality of the preserved DNA or RNA. Although reagent accessibility to nuclear DNA can in part be overcome by optimizing protease digestion of the tissues, it is highly recommended that the integrity of nucleic acid preservation be checked in archival samples. Solution-phase PCR with the same primers as intended for use in in situ PCR should be performed on samples of DNA or RNA extracted from the archival tissue as a control for DNA/RNA quality. Protease digestion of tissues after fixation probably contributes to the success of in situ PCR as much through the removal of crosslinked DNA-binding proteins from nuclear DNA as through the creation of holes in cytoplasmic or nuclear membranes. Precisely how much protease digestion to employ is a critical issue in determining the success or failure of in situ PCR, and to date, various permeabilization procedures have been described in the literature using proteases or detergents (7,9,15,23,24). Both overdigestion or underdigestion can hinder the successful outcome of in situ PCR. Leakage of amplified products from the cell in which they were generated is a feature associated with overdigestion, and this can lead to either false-positive or, in theory at least, to false-negative results in mixed-cell populations. Underdigestion results in very inefficient (or even failure of) amplification. In general terms, longer fixation times seem to necessitate longer digestion, and very brief fixations may completely obviate the need for any digestion (I7,22), presumably because of minimal crosslinking of DNA-binding proteins. Thus, in experiments working with freshly harvested cells in suspension, a brief fixation of 4 min with paraformaldehyde gave optimal results for in situ PCR when using no protease digestion. In fact, in this setting, protease digestion resulted in excessive leakage of PCR amplificants from the cells (22). Bagasra et al. have suggested an intriguing strategy for determining the optimal duration of proteolysis for different specimens that involves visual checking of the protease treatment under phase-contrast microscopy (25). The authors have described the development of dots (so-called peppery dots) on the nuclear cytoplasmic membrane of fixed cells and tissues undergoing protease digestion, and have determined empirically that when a cell has 10-20 such dots, it is optimally digested for the purposes of subsequent w situ PCR.
144
Long and Komminoth
The precise nature of these dots or why they should be a useful marker of optimal protease treatment remains speculative. Notwithstanding, such a standardized approach has proven beneficial when tested in blinded comparisons against fixed-time proteolysis in an experimental system (Zehbe et al., manuscript in preparation). This approach may prove useful in determining optimal digestion of disparate cells and tissues, and it should also allow workers to circumvent the variables associated with differing activity or potency of protease enzymes from different sources.
2.2. In Situ Amplit~cation In situ PCR may be performed either with fixed cells suspended in the PCR reaction mixture in a micro-Eppendorf tube, or with cells or tissues affixed to glass slides. In the case of cells in suspension, the cells are recovered after PCR amplification and cytocentrifuged onto glass slides for subsequent study (3,.5,10,II, I7,22,26). For in situ PCR directly performed on glass slides, the cellular material is overlaid with PCR mixture, and steps are taken to prevent evaporation of the PCR reaction mixture. Such evaporation would have the potential to alter the concentration of the reagents and adversely affect efficiency of the procedure. To avoid evaporation, coverslips have been sealed around the edges with nail varnish or rubber cement, or completely overlaid with mineral oil. Before the advent of dedicated equipment (see below), thermal cycling was accomplished by placing the glass slides directly on top of the heating block of a conventional thermal cycler. A benefit of the cell-suspension approach is that an aliquot of cells may be lysed, and the lysate analyzed by gel electrophoresis and Southern blot hybridization to confirm that the PCR has been successful and specific (22). Our results indicate that the approach of using cells in suspension provides optimal physical conditions for thermal cycling and yields maximal cellular target sequence amplification (17,22). Nucleic acids are probably better preserved in single-cell preparations and the fixed cells appear to function as “amplification sacks” with semipermeable membranes that permit the primers, nucleotides, and DNA polymerase to pass into the cell and nucleus, yet seem to retard sufficiently the outward diftision of enough PCR products to allow for their detection in situ. It is likely, however, that relatively few of the potential applications of in situ PCR will have the benefit of working with cells in suspension. Accordingly, a majority of the developmental efforts to date have focused on cells and tissues affixed to microscope slides. A recurring problem with in situ PCR has been inconsistency of results, and it is likely that biological variables as well as mechanical variables were contributory. The mechanical variables have recently been the focus of some progress. The labor-intensive and skill-intensive approaches described above
In Situ PCR Overview
145
have not only proven cumbersome, but the number of slides that can be cycled at a single time is frequently limited to 4/instrument. Furthermore, since thermal cycling of materials on glass slides was not the intended use of these instruments, it is very likely that the additional conduction barriers introduced by these setups, together with considerable upward heat loss from the slides by convection, significantly affect the temperatures actually achieved in the cells and thereby the efficiency of the reactions. It is anticipated that the purposely designed instruments that have recently become available (see below) will help eliminate some of this variability and result in increased reproducibility of in situ PCR protocols. The different in situ PCR instruments share the characteristics of eliminating the need to use nail varnish or other sealants to prevent evaporation, accommodating more than four slides at a time, and achieving more accurate attainment of desired temperatures on the slides. Evaporation is controlled by either placing all slides in a single sealed humid chamber (OmniSlide system, Hybaid, Teddington Middlesex, UK), using water-tight seals individually clamped around the samples, with up to 3 samples/slide (Geneamp in situ PCR System 1000, Perkin-Elmer, Norwalk, CT) or through adding a reagent to prevent evaporation directly into the PCR reaction mixture (PTC-lOO-12MS Programmable Thermal Controller, MJ Research, Inc., Watertown, MA). Attaining accurate temperatures in the cells containing the target DNA to be amplified is crucial. At least one product, a thermal cycling oven (BioOven, Biotherm, Fairfax, VA), assurestemperature fidelity by means of a thermocouple placed under the coverslip of a glass slide from which information is fed back to the control panel of the instrument, and others (OmniSlide system; Geneamp in situ PCR System 1000) have incorporated a simulated slide function into their programming.
2-3. Detect/on of intracellular PC!? Products After PCR amplification, visualization of intracellular PCR products is achieved either indirectly by ISH with a labeled probe (indirect in situ PCR) or through direct immunohistochemical detection of labeled nucleotides (e.g., digoxigenin- 1l-dUTP, fluorescein-dUTP, 3H-CTP) that have been incorporated into PCR products during thermal cycling (direct in situ PCR). Direct in situ PCR, once heralded as a rapid alternative to indirect in situ PCR for DNA and RNA detection by eliminating the need for subsequent ISH (9,27,28), has proved unreliable in the hands of most workers who have been unable to satisfy themselves about the specificity of the results obtained. Even when controlled fixation, controlled protease digestion, and “hot-start” procedures (27,29) are used, the direct detection approach yields very significant false-positive results, especially when working with tissue sections (13,17,
146
Long and Komminoth
25,3&35,. The false-positive signals result mainly from nonspecific incorporation of labeled nucleotides into fragmented endogenous DNA undergoing “repair” by the DNA polymerase (“DNA-repair artifacts”) or by priming of nonspecific PCR products by cDNA or DNA fragments (“endogenous priming”). These artifacts typically exhibit nuclear signals, and are particularly evident in apoptotic or senescentcells where DNA fragmentation is a key feature (36,37). Aldehyde fixation may actually increase the number of single- and double-stranded nicks in DNA and exacerbate this problem with direct in situ PCR. It has not yet proven possible to circumvent this nonspecific pathway in direct zn situ PCR, despite DNase pretreatments to reduce endogenous DNA amplification during in situ RT-PCR experiments (13,38). The artifacts can be somewhat reduced by using an exonuclease-free DNA polymerase (13), or “repairing” DNA nicks by treatment with T4 ligase (39) or initial thermal cycling using unlabeled (40) or dideoxy nucleotides, but these maneuvers do not eliminate the false-positive results, which remain marked enough to interfere significantly with accurate detection of “specific” signals. Future developments may allow for a modification of this posrtion. For example, strategies to induce a state of fixed denaturation of endogenous DNA prior to thermal cyclmg m order to eliminate DNA repair are being re-evaluated (F. Lewis, personal communication). For now, caution and adequate use of appropriate controls (see later) are urged in the interpretation of data generated by the direct detection approach (I 6,32). The indirect method, by using probes that recognize the amplified sequences, provides maximum specificity in detection of intracellular PCR products and is the approach that most investigators have used. At a theoretical level, probes targeted to regions in between the primers represent the ideal for reasons of specificity. Oligonucleotide probes and PCR-generated probes meet this standard. Full-length probes or genomic probes, however, are often used for convenience or because of the increased number of reporter molecules, and therefore higher signal intensity, that they afford. The nature of the reporter systems can also impact the quality or applicability of in situ PCR experiments. Radioactively labeled probes offer high sensttivity, but have stgnificant disadvantages related to cost, instability, and biohazard potential. Calorimetric systemsbased on either alkaline phosphatase or horseradish peroxidase enzymes have been most frequently employed with notable success. Occasionally, these systems result in a poor signal-to-noise ratio, which may contribute to the apparent low “efficiency” of in situ PCR (Z 7,22). Fluorescence-based detection systems have also been employed, but are not the favored tool of morphologists because of limited ability to visualize “negative” cells and tissue types. A recent workshop on in situ PCR (25) compared alkaline phosphatase-based and horseradish peroxtdase systemswith an
In Situ PCR Overview
147
rmmunogold silver detection system. After blinded evaluations, a clear superiority was observed with the latter (Zehbe et al., manuscript in preparation), which consistently gave excellent positive+egative discrimination and intensely strong signals. These data need to be confirmed, but may represent a significant advance in this field. 2.4. Efficiency of In Situ PCR Even though it is unlikely that increasing signal intensity is a linear function of an increasing number of reporter molecules, when crudely determined by the apparent increase in signal intensity over straight ISH, the overall efficiency of in situ DNA amplification appears to be low. It has been estimated to be approx 50 fold after 30 cycles in suspended cells (22), and probably even lower in cytospin preparations and tissue sections. Many factors may be contributing to this low amplification efficiency, including certain deleterious effects of the aldehyde-based crosslinking fixatives, such as histone crosslinking to DNA and single-stranded breaks in DNA as well as sequestration of DNA polymerases and other reagents to the surface of silamzed slides (35). To maximize efficiency the PCR steps, it has been empirically determined by several groups that although the same annealing temperatures determined to be optimal for a given primer pair in solution-phase PCR can generally be used for zn situ PCR, longer extension times (e.g., 2 min) are generally required, probably in part related to imprecisions of temperature transfer in the in situ physical setup. Increased concentrations of both DNA polymerases and Mg2+ ions are also required, possibly because of the absorptive effects of glass slides, especially silanized slides, or enzyme inhibition by contaminants eluted from the tissues or glass surfaces. Often, the addition of bovine serum albumin or lecithin to the reaction mixture serves a purpose similar to increasing enzyme or Mg2+ concentration (35). 3. Applications of In Situ PM In situ PCR has a number of potential research and diagnostic applications. To date, several different groups have reported successful in situ PCR detection of specifically amplified single-copy nucleic acid sequencesin single cells and low-copy DNA or RNA sequencesin tissue sections (see Table 1). Most of the studies have focused on the detection of viral or proviral (foreign) nucleic acid sequences. In addition, in situ PCR has also been applied to study endogenous DNA sequences, including human single-copy genes, rearranged cellular genes, and chromosomal translocations, and to map low-copy-number genomic sequences in metaphase chromosomes. Recently, successful amplification and detection of low-copy mR.NA and viral RNA sequences have also been reported.
Long and Komminoth
148 Table 1 Applications
of In Situ PCR
Foreign DNA/RNA
EndogenousDNA
EndogenousmRNA
Target Lentivirus DNA Cytomegalovirus (CMV) DNA Human papilloma virus (HPV) DNA Human immunodeficiency virus (HIV) DNA Mouse mammarytumor virus (MMTV) DNA Hepatitis C virus (HCV) RNA Hepatitis B virus (HBV) DNA Herpessimplex virus (HSV) DNA JC virus DNA Human T-lymphotroprc virus (HTLV) DNA Simian immunodeflciency virus (SIV) DNA Measlesvirus RNA Pneumocystis carinii DNA MycobacteriumtuberculosisDNA Cystic fibrosis mutations Generearrangements Chromosomaltranslocations Chromosomalmapping 12-LipoxygenasemRNA MetalloproteinasemRNA Nerve growth factor (NGF) mRNA Epidermal growth factor receptor (EGFR) mRNA GranzymemRNA, perforin rnRNA Insulin-like growth factor (IGF) mRNA
References 3,41 5,17,22 6,9,42,43 4,7,11,23, 3544-49 21 13,50-52 17 53-57 58,59 60,61 62 9 63 64 65 IO,22 17 12,66 67 68 69 70,71 14 38
4. Nonspecific Pathways and Pitfalls of In Situ PCR 4.1. False-Positive Results Nonspecific pathways of in situ PCR leading to false-positive results include mispriming and artifacts related to “DNA repair,” “endogenous priming,” and diffusion of PCR products. DNA repair and endogenous priming have been discussed above. Mispriming, causing the amplification of nonspecific DNA and cDNA sequences, is a general problem of PCR, and in situ PCR is not exempt. Factors
In Situ PCR Overview
749
that influence n&priming include the specificity of oligonucleotide primers, the pH and Mg2’ concentration of the PCR reaction mixture, as well as the annealing temperatures used during thermal cycling (72). Several strategies have been employed to attempt to overcome or minimize mispriming during in sztuPCR experiments, but none have proven to be completely reliable to date. It has been shown that “hot-start” modifications of PCR have the potential to reduce mispriming and primer oligomerization (29). The “hot-start” procedure devised for in situ PCR performed on glass slides is achieved by preheating the samples and reagents under the coverslip prior to adding the DNA polymerase, which can be inconvenient or impractical. Alternatively, addition of chemical components (e.g., E. coli single-strand DNA-binding protein SSB, T4 gene 32 protein, or anti-Tag polymerase antibodies) to the PCR reaction mixture can also prevent mispriming at ambient temperatures (8,27,73), the so-called cold-start procedures. However, the effects of such attempts to reduce mispriming are limited by the fact that, with the possible exception of thermal cycling ovens and the newer specifically designed block cycler models, the desired annealing temperatures are probably never actually reached by conventional block thermal cyclers for in situ PCR (personal communication, M. A. Zoccoli, Roche Molecular Systems, Alameda, CA). Furthermore, it has been shown that artifacts related to endogenous priming and DNA repair may be independent of hot-start (13,17,38). “Diffusion artifacts” represent a significant problem of both indirect and direct in situ PCR performed in cells in suspension (17,22,60). PCR products and DNA leak out of template-positive cells and serve as templates for extracellular amplification, which is probably far more efficient than intracellular amplification. These extracellularly amplified DNA sequenceshave the potential to adhere to the surface of adjacent template negative cells or perhaps to even diffuse into them, resulting in false-positive signals (17,22,35). In agreement with Haase et al. (3), we have observed more problems related to difmsion artifacts when short DNA sequences were amplified by in situ PCR, but others have convincingly shown that the problems persist with amplicons of 740 bp (35). Many creative approaches have been employed to minimize the impact of diffusion. It has been suggested that diffusion artifacts can be significantly reduced by optimal flxation and permeabilization, reduction of PCR cycle numbers, generation of longer or more complex (e.g., overlapping or cocatamerized) PCR products, or by incorporation of substituted (e.g., biotinylated or digoxigenin labeled) nucleotides to make the PCR products bulkier and therefore less diffusible (11,22).
4.2. False-Negative Results The problems that contribute to the poor amplification efficiency and reproducibility of in situ PCR can also be the cause of false-negative results. Poor quality or the reduced accessibilityof target sequencesrelated to the protein-
150
Long and Komminoth
DNA crosslinking properties of routinely used fixatives, such as formaldehyde, almost certainly contribute. These crosslinkscan be partially reversed by appropriate treatments of samplesby proteases,hydrochloric acid, and heat. It is cautioned, however, that employment of extensive digestion steps results in substantial destruction of the cell architecture. It is suggested, that optimal conditions for new sample materials be established by performing lysis experiments after attempted in situ PCR and analyzing PCR products by gel electrophoresis. Alternative explanations for false-negative results on glass slides include the loss of PCR products in washing steps of the detection procedure or tissuederived inhibitors of the DNA polymerase. In situ amplification in archival tissue sections remains difficult, but is clearly possible. We and others (17‘21, 23,30,42,45) have only been able to amplify and detect DNA sequences in tissue sections by using multiple primer pairs with short PCR products, and relatively long DNA probes or cocktails of oligonucleotide probes. The improved amplification efficiency of multiple primers with short PCR products probably increases the chances of successful DNA amplification in samples with crosslinked histones and multiple DNA breaks. It is theoretically possible that the positive results seen after in situ PCR with multiple primer pairs are causedby the formation of a “scaffolding” of overlapping PCR products, which help to anchor the PCR products in place and make them less susceptible to being washed away during the detection steps (2 7).
5. Controls for In Situ PCR Results Appropriate controls at each step are essential for the correct mterpretation of in situ PCR experiments. As outlined in Table 2, controls should be both qualitative and quantitative to exclude false-positive and false-negative results (IS). In addition to general qualitative controls, such as the use of appropriate control samples,which either harbor or lack the nucleic acid sequence of interest, additional in situ PCR-specific controls should be added to each experiment, including: 1, Omission of the DNA polymerasefrom the PCR reaction mixture to detectnonspecific sticking of detectionprobes and/or antibodies; 2. Omission of primers to detectartifacts related to “DNA repair” and“endogenous priming” in direct in situ (RT) PCR experiments;and 3. RNasepretreatment of samplesand the omission of the RT step in experiments designedto detect (m)RNA sequences(15).
6. Conclusions and Future Aspects In the emergence of in situ PCR, we have seen the coming together of two very successful technologies, PCR and ISH. Whether one views this marriage as forced (81, inevitable (74), or simply desirable (2), few would argue that the union has provided formidable challenges.
In Situ PCR Overview Table 2 Controls Required Method General
757
for In Situ PCR Experiments Controls Use of known positive and negative control samples Solution-phase PCR on extracted DNA/RNA of actual test samples Amplification of endogenous control DNA sequences
Indirect in situ PCR
Omission of primary antibody in immunohistochemical detection Lysis of cells after in situ PCR and analysis of PCR products by gel electrophoresis, Southern blot hybridization (and sequencing) Omission of DNA polymerase
Direct in situ PCR
Use of irrelevant probes for m situ hybridization Omission of primers
Cells in suspension
Omission of DNA polymerase In situ RT-PCR Quantitative in situ PCR
Omrssion of reverse transcriptase step RNase pretreatment of samples In situ PCR in mixtures of known positive and negative cells of different proportions Identification of different cell types by tmmunohistochemistry
Purpose Control for specificity and sensitivity of method used Detection of false negatives, control for sensitivity Detection of false negatives, control for DNA/RNA quality Detection of endogenous enzyme acttvity Specificity control for PCR products
Detection of nonspecific probe and antibody sticking Control for in situ hybridization spectticity Detection of artifacts related to DNA repair and endogenous priming Detection of nonspecific probe and antibody strcking Detection of mispriming and amplification of endogenous DNA Control of specificity and sensitivity of method used
In situ PCR has not developed in isolation, and several alternative strategies
are becoming available for intracellular analysis of nucleic acids. It is possible that some of those other techniques, such as the isothermal self-sustained
152
Long and Komminoth
Table 3 Comparison of T8ChniqU8S for the h Situ Detection of Intracellular DNA and mRNA In situ hybridization Description: hybridization of a labeled probe to intracellular RNA or DNA Applications: localization of endogenous DNA, mRNA, or foreign DNA/RNA in cells (paraffin or frozen sections, single cell preparations, chromosome preparations) Advantages: well-preserved morphology, high spectticity, applicable to DNA or RNA, low expense instrumentation requirements, isothermal Disadvantages: relatively low sensitivity Comments: the recent availability of very high sensitivity reporter systems, such as catalyzed reporter deposition, may significantly increase sensitivity In situ PCR Description: intracellular PCR amplification and detection of specifically amplified DNA sequences by hybridization of a labeled probe or immunohistochemtcal detection of incorporated labeled nucleotides Applications: localization of altered gene(s) or foreign DNA m cells (paraffin or frozen sections, single-cell preparations, chromosome preparations) Advantages: high sensitivity, ability to detect single-copy species. Disadvantages: thermal cycling required with appropriate instrumentation, variable reproducibility to date, potential for tissue destruction or loss, poor quantification; labor-intensive, usually requires ISH in addition to thermal cycling Comments: dedicated equipment, standardized protocols, and improved reporter systems have the potential to minimize the recognized disadvantages In situ RT-PCR Description: intracellular RT of mRNA to cDNA followed by intracellular PCR amplification and detection Applications: localization of specific mRNA or viral RNA m cells (paraffin or frozen sections, single-cell preparations) Advantages: high sensitivity, ability to detect very low copy messages Disadvantages: thermal cycling required with appropriate instrumentation, variable reproducibility, potential for tissue destruction or loss, poor quantrticatton; labor-intensive, requires RT, ISH in addition to thermal cycling; ability to obtain accurate results by detection of directly incorporated labeled nucleotides still under dispute Comments: dedicated equipment, standardized protocols, and improved reporter systems have the potential to minimize the recognized disadvantages; very unlikely that the direct detection approach will withstand rigorous control experiments as currently formulated PRINS Description: oligonucleotide primed in situ DNA labeling reaction with labeled nucleotides Applications: chromosome identification and mapping of DNA sequences m metaphase spreads and interphase nuclei; chromosomal DNA localization in cells Advantages: rapid, sensitive, nonradioactive, isothermal
In Situ PCR Overview
153
Table 3 (confinueu’) PRINS (continued) Disadvantages: potential for misprhning, specificity depends on a single primer, labeled nucleotide incorporation into damaged DNA may give false-positive signals Comments: success to date is likely predicated on the detection of high-copy number DNA sequences with resultant high signal-to-noise ratios Cycling PRINS Description: not meaningfully different from in situ PCR In sm.4transcription Description: synthesis of labeled complementary DNA within a cell usmg an mRNA complementary primer, reverse transcriptase, and substituted dNTPs Applications: identification and cellular localization of specific mRNA within the cells (paraffin or frozen sections, single-cell preparations) Advantages: an isothermal procedure with higher sensitivity than ISH owing to the production of a long (labeled) cDNA product for each copy of mRNA, potential to identify minor sequence variations in mRNAs by appropriate primer selection Disadvantages: potential for mispriming or nonspecific incorporation of labeled nucleotides, although this should be significantly less than with techniques dependent on DNA polymerase enzymes Comments: can be combined with high activity reporter systemsto increase sensitivity RT PRINS Description: not meaningfully different from in situ transcription In situ 3SR Description: self-sustained sequence replication: isothermal amplification of mRNA by way of cDNA intermediates using three enzymes simultaneously (reverse transcriptase with DNA polymerase activity, RNase, and RNA polymerase) followed by ISH with a labeled probe Potential uses: identification and cellular localization of specific mRNA/cDNA within cells (paraffin or frozen sections, single-cell preparations) Advantages: isothermal, does not require dedicated equipment, higher sensitivity than ISH Disadvantages: a highly complex approach, primers require RNA promoter sequences in their S-end, amplification is followed by ISH Comments: There is little experience of the application of this method in archival to paraffin-embedded material
sequence replication (3SR) (75-77) or refined in situ transcription (78) and ISH techniques, may be more suitable for certain clinical applications. Table 3 represents a perspective on the potential contributions that these different strategies may have. The “honeymoon period” must now be considered over, and the endurance of this potentially powerful technology can only be assured by strict adherence
154
Long and Komminoth
to the principles of scientific methods in the planning and interpretation of experimental data. As detailed above, rigorous and logical controls must be employed to avoid the many dangerous pitfalls that have been identified. Whenever possible, new data obtained by this technology should be confirmed by another method (e.g., Northern blot or solution-phase RT-PCR to confirm RT in situ PCR data) or at least corroborated by parallel mvestlgations (e.g., demonstration of protein gene product in same or similar cells as activated gene or foreign gene is detected by in situ PCR or mRNA by RT in situ PCR). Obstacles with in sztu PCR have been low amplification efficiency, poor reproducibility, and difficulty in quantitation of results (2 7). However, a clear consensus appears to now be emerging concerning optimal strategies to minimize the first two of these as discussed above, which includes controlled approaches to fixation and digestion, as well as the employment of specially designed equipment for in situ PCR. Quantitation remains a limitation and, at the time of this writing, in situ PCR remains at best comparative or semiquantitatlve (17). The reasons for poor quantitation are multiple, and m the mam are lmked to poor amplification efficiency and the plateau effect seen with reporter molecules. Newer reporter systems, such as the nanogold-silver detection (79) or the highly sensitive catalyzed reporter deposition systems (80), will possibly improve the situation through background reduction, as will creative applications, such as flow cytometry in fluorescence-based systems (II). An intnguing modification of the indirect in situ PCR is also currently under study. In this approach, a fluorochrome-labeled oligonucleotlde probe specific for a region of the amplified DNA between the PCR primers 1sincorporated during in sztuPCR. The specific oligonucleotide probe is designed to be only capable of emitting fluorescence signal when hybridized to the appropriate DNA template. Use of such a probe during in satu PCR has the potential to eliminate the need for the subsequent ISH step. It also holds forth the possibility of using different fluorochromes for different amplified sequenceswithin the same cell. With the advances that have recently been made, it seems possible that this fledgling new technology will emerge as a robust technique that might one day find a place in routine diagnostic laboratories. The range of potential applications is large. A majority of pubhcations to date have dealt with detection of viral or foreign DNA within cells, and this will likely remain a major application of in situ PCR. Our ability to detect latent viruses m lowcopy number represents a huge step forward m leading to our understanding of viral disease pathogenesls (23,45,81). We will now have the ability to study the time-course and determinants of viral activation, as well as the morphologic correlates of that activation. Other intracellular infectious agents will also continue to be the targets of study by in situ PCR with obvious diagnostic implications.
In Situ PCR Overview
155
Detection of altered DNA by in situ PCR will also likely have major impact in medicine and biology. Genetic determinants of tumorigenesis, including DNA mutations or chromosomal translocations, will be studied in our quest to understand cause and effect and the latency period between DNA alterations and morphologic characteristics of atypia or malignancy. Radiatron or other treatment-induced mutations will probably be monitored and followed by this technology, as will the presence of minimal residual disease as identified by unique DNA rearrangements or other clonal markers in hematological malignancies. In situ PCR will be a valuable tool in the evaluation of novel gene therapies, since it will allow us to follow not only the engraftment and proliferation of transfected cells, but also their tissue localization, their cellular differentiation, and even the incorporation of the transfected genes at the chromosomal level. Furthermore, the detection of intracellular mRNAs by RT in situ PCR has applications in any situation where the level of gene expression 1sbelow that detectable by ISH (82). It will be a powerful correlative technique for Northern blotting and solution-phase RT-PCR experiments in many circumstances, not the least of which will include viral activation and cytokine expression. Interpreting the meaning of low-level gene expression will very likely provide new insights into the biological roles of many proteins. In conclusion, in situ PCR is a new and exciting technique that is already providing a mechanism to gain insight into disease pathogenesis. Its true strengths and weaknesses are being increasingly understood, and further refinements of the methodology to render it more reliable are steadily emerging. However, clinical application of this technology which now seems inevitable, must still await further resolution of the current limitations (2). References 1. Murray, G. (1993) In situ PCR (editorial). J Puthol. 169, 187,188. 2. Hofler, H. (1993) In s~tupolymerasechain reaction: toy or tool? (editorial). Histochemzstry 99, 103,104.
3. Haase,A. T., Retzel,E. F., and Staskus,K. A. (1990) Amplification and detection of lentiviral DNA inside cells. Proc. Natl. Acad. Sci USA 87,4971-4975. 4. Spann, W., Pachmann,K., Zabnienska, H., Pielmeier, A., and Emmerich, B. (199 1) In situ amplification of single copy gene segmentsin individual cells by the polymerase chain reaction. Infection 19,242-244.
5. Ray, R., Konuninoth, P., Machado,M., and Wolfe, H. J. (1991) Combined polymerasechain reaction and in-situ hybridization for the detection of single copy genesand viral genomlc sequences in intact cells. Modern Pathol. 4, 124A. 6. Nuovo, G., MacConnell,
P., Forde, A., and Delvenne, P. (1991) Detection
of
humanpapillomavirus DNA in fonnalin-fixed tissuesby in situ hybridization after amplification
by polymerase chain reaction. Am J. Pathol. 139,847-854
Long and Komminoth
156
7. Bagasra, O., Seshamma, T., and Pomerantz, R. (1993) Polymerase chain reaction in situ: intracellular amplification and detection of HIV-l proviral DNA and other specific genes. J. Immunol, Methods 158, 13 1-145. 8. Teo, I. A. and Shaunak, S. (1995) Polymerase chain reaction in situ: an appraisal of an emerging technique. Histochem. J. 27,647-659. 9. Nuovo, G. (1992) PCR In Situ Hybridization. Raven, NY. 10. Embleton, M., Gorochov, G., Jones, P., and Winter, G. (1992) In-cell PCR from mR.NA: amplifying and linking the rearranged immunoglobulin heavy and light chain V-genes within single cells. Nucleic Acids Res. 20, 383 l-3837. 11. Patterson, B., Till, M., Otto, P., Goolsby, C., Furtado, M., McBride, L., and Wolinsky, S. (1993) Detection of HIV-l DNA and messenger RNA in individual cells by PCR-driven in situ hybridtzation and flow cytometry. Science 260,976-979. 12. Gosden, J. and Lawson, D. (1995) In-situ cyclic amplification of oligonucleotide primed synthesis (cycling PRINS), m PCR Applzcation Manual (Boehringer Mannheim Corp., ed.), Boehringer Mannheim Corp., Mannheim, Germany, pp. 115-118. 13. Komminoth, P., Adams, V., Long, A. A., Roth, J , Saremaslani, P., Flury, R., S&mid, M., and Heitz, P. U. (1994) Evaluation of methods for hepatitis C virus (HCV) detection in liver biopsies: comparison of histology, mmrunohistochemistry, in-situ hybridization, reverse transcriptase (RT) PCR and in-situ RT PCR. Pathol, Res. Pratt. 190, 1017-1025. 14. Chen, R. H. and Fuggle, S. V. (1993) In situ cDNA polymerase chain reaction. A novel technique for detecting mRNA expression. Am J. Pathol. 143, 1527-1534. 15. Komminoth, P. and Long, A. A. (1993) In-situ polymerase chain reaction. An overview of methods, applications and limitations of a new molecular technique. Virchows Arch. B 64,67-73.
16. Long, A. A., Komminoth, P., and Wolfe, H. J. (1992) Detection of HIV provirus by m sttu polymerase chain reaction (letter), N. Engl. J Med. 327, 1529. 17. Long, A. A., Komminoth, P., Lee, E., and Wolfe, H. J. (1993) Comparison of indirect and direct in-situ polymerase chain reaction in cell preparations and tissue sections. Detection of viral DNA, gene rearrangements and chromosomal translocations. Histochemzstry 99, 15 1-162. 18. Long, A. A. and Komminoth, P. (1995) In situ polymerase chain reaction: general methodology and recent advances, in In situ Polymerase Chain Reaction and Related Technology (Gu, J., ed.), Eaton Publishing, Natick, MA, pp. 23-34. 19. Komminoth, P. and Long, A. A. (1995) In-situ polymerase chain reaction-methodology, applications and non-specific pathways, in PCR Application Manual (Boehringer Mannhetm Corp., ed.), Boehringer Mannhetm Corp., Mannheim, Germany, pp. 97-106. 20. Komminoth, P., Heitz, P. U., and Long, A. A. (1994) In situ polymerase chain reaction: general methodology and recent advances. Verh. Dtsch. Ges. Pathol. 78,146-l 52. 21. Chiu, K.-P., Cohen, S., Morris, D., and Jordan, G. (1992) Intracellular amplification of proviral DNA in tissue sections using the polymerase chain reaction. J. Histochem. Cytochem. 40,333-34 1.
In Situ PCR Overview
757
22. Komminoth, P., Long, A. A., Ray, R., and Wolfe, H. J. (1992) In situ polymerase chain reaction detection of viral DNA, single copy genes and gene rearrangements in cell suspensions and cytospins. Diagn. Mol. Pathol. 1,85-97. 23. Embretson, J., Zupancic, M., Beneke, J., Till, M., Wolinsky, S., Ribas, J., Burke, A., and Haase, A. (1993) Analysis of human immunodeficiency virus-infected tissues by amplification and in situ hybridization reveals latent and permissive infections at single-cell resolution. Proc. Natl. Acad. Sci. USA 90,357-36 1. 24. O’Leary, J. J., Browne, G., Landers, R. J., Crowley, M., Healy, I. B., Street, J. T., Pollock, A. M., Murphy, J., Johnson, M. I., Lewis, F. A., et al. (1994) The tmportance of fixation procedures on DNA template and its suitability for solutionphase polymerase chain reaction and PCR in situ hybridization. Histochem. J. 26, 337-346. 25. Bagasra, O., Sheshamma, T., Hansen, J., Bobiski, L., Saikumari, P., and Pomerantz, R. J. (1994) Application of in situ PCR methods in molecular biology. Special applications in electron microscopy, cytogenetics, and immunohistochemistry. Cell Vision 2,61-70. 26. Long, A. A. (1991) Detection of gene rearrangements by in-situ PCR. Sixth Annual Workshop on Recent Advances in Molecular Pathology. Tufts New England Medical Center, Boston, MA, April 3-6, 1991. 27. Nuovo, G., Gallery, F., MacConnell, P., Becker, J., and Bloch, W. (1991) An improved technique for the in situ detection of DNA after polymerase chain reaction amplification. Am J. Pathol. 139, 1239-1244. 28. Nuovo, G. J., Gorgone, G. A., MacConnell, P., Margiotta, M., and Gorevtc, P. D. (1992) In situ localization of PCR-amplified human and viral cDNAs. PCR Methods Appl. 2,117-123.
29. Erlich, H. A., Gelfand, D., and Sninsky, J. J. (1991) Recent advances m the polymerase chain reaction. Science 252, 1643-165 1. 30. Komminoth, P., Long, A., and Wolfe, H. (1992) Comparison of in-situ polymerase chain reaction (in-situ PCR), in-situ hybridization (ISH) and polymerase chain reactron (PCR) for the detection of viral infection in fixed tissue. PatoZogia 25 (Suppl.),
253.
3 1. Sallstrom, J. F., Zehbe, I., Alemi, M., and Wilander, E. (1993) Pitfalls of in situ polymerase chain reaction (PCR) using direct incorporation of labelled nucleotides. Anticancer Res. 13,1153. 32. Komminoth, P. and Long, A. A. (1994) Questioning in-situ PCR. Detection of epidermal growth factor receptor mRNA in tissue sections from biopsy specimens using in-situ polymerase chain reaction (letter). Am. J. Pathol. 145,742. 33. Sallstrtim, J. F., Alemi, M., Spets, H., and Zehbe, I. (1994) Nonspecific amplification in in-situ PCR by direct incorporation of reporter molecules. Cell Vision 1, 243-25 1. 34. Zehbe, I., Sallstrclm, J. F., Hacker, G. W., Hauser-Kronberger, C., Rylander, E., and Wilander, E. (1994) Indirect and direct in situ PCR for the detection of human papillomavirus. An evaluation of two methods and a double staining technique. Cell Vision 1, 163-167.
158
Long and Komminoth
35. Teo, I. A. and Shaunak, S. (1995) PCR in situ: aspects which reduce amplification and generate false-positive results. Histochem. J. 27,660-669. 36 Gold, R., Schmied, M., Rothe, G., Zischler, H., Breitschopf, H., Wekerle, H., and Lassmann, H. (1993) Detection of DNA fragmentation m apoptosis: application of in situ nick translation to cell culture systems and tissue sections. J. Hlstochem Cytochem. 41,1023-1030. 37. Wijsman, J., Jonker, R., Keljzer, R., van de Velde, C., Cornelisse, C., and van Dierendonck, J. (1993) A new method to detect apoptosrs in paraffin sections. m situ end-labeling of fragmented DNA. J, Histochem. Cytochem. 41,7-12. 38. Martinez, A., Miller, M. J., Quinn, K., Unsworth, E. J., Ebina, M., and Cuttitta, F. (1995) Non-radioactive localization of nucleic acids by direct m situ PCR and in situ RT-PCR in paraffin-embedded sections. J Histochem Cytochem 43, 739-747. 39. Koch, J., HmdkJaer, J., Mogensen, J., Kolvraa, S., and Bolund, L. (1991) An improved method for chromosome-specific labeling of alpha satellite DNA in situ by using denatured double-stranded DNA probes as primers m a primed m situ labeling (PRINS) procedure. Genet. Anal Tech. Appi 8,171-178. 40 Morita, M., Hachisuka, H., and Sasai, Y. (1994) Detection of genomic DNA with a high sensitivity m tissue sections using a two step cycling m situ PCR procedure. Kurume Med. J. 41,215-220. 41. Staskus, K., Couch, L., Bitterman, P., Retzel, E., Zupancrc, M., List, J., and Haase, A. (1991) In situ amplification of visna virus DNA m tissue sections reveals a reservoir of latently infected cells. Microb. Pathogen. 11,67-76. 42. Zehbe, I., Hacker, G., Rylander, E., Sallstrom, J., and Wrlander, E. (1992) Detection of single HPV copies m SiHa cells by in situ polymerase chain reaction (m situ PCR combined with immunoperoxidase and mnnunogold-silver staming [IGSS] techniques). Antrcancer Res. 12,2165-2168. 43. Bernard, C., Mougin, C., Bettinger, D., Didier, J. M., and Lab, M. (1994) Detection of human papillomavirus by m s~tu polymerase chain reaction m paraffinembedded cervical biopsies. Mol. Cell Probes 8,337-343. 44. Bagasra, O., Hauptman, S., Lischner, H., Sachs, M., and Pomerantz, R. (1992) Detection of human immunodeficrency virus type 1 provirus in mononuclear cells by m situ polymerase chain reaction. N. Engl. J. Med. 326, 1385-139 1. 45. Embretson, J., Zupancic, M., Ribas, J., Burke, A., Racz, P., Tenner-Racz, K., and Haase, A. ( 1993) Massive covert infection of helper T lymphocytes and macrophages by HIV during the incubation period of AIDS. Nature 362,359-362. 46. Nuovo, G., Margiotta, M., MacConnell, P., and Becker, J. (1992) Rapid in situ detection of PCR-amplified HIV-l DNA. Dlugn. Mol. Puthol. 1,98-102. 47. NUOVO, G., Forde, A., MacConnell, P., and Fahrenwald, R. (1993) In situ detection of PCR-amplified HIV-l nucleic acids and tumor necrosis factor cDNA in cervical tissues. Am J. Puthol. 143, 1-9. 48. Wesselingh, S. L., Glass, J., McArthur, J. C., Griffin, J. W., and Griffin, D. E. (1994) Cytokine dysregulation in HIV-associated neurological disease. Adv Neurolmmunol. 4, 199-206.
In Situ PCR Overview
759
49. Re, M. C., Furlini, G., Gibellini, D., Vignoli, M., Ramazzotti, E., Lolli, E., Raniert, S., and La, P. M. (1994) Quantification of human immunodeficiency virus type 1-infected mononuclear cells in peripheral blood of seropositive subjects by newly developed flow cytometry analysis of the product of an in situ PCR assay. J. Clin. Microbial. 32,2152-2157. 50. Komminoth, P., Adams, V., Long, A. A., Roth, J., Saremaslani, P., Flury, R., S&mid, M., and Heitz, P. U. (1994) Comparison of histology, immunohistochemtstry, RT-PCR, in situ hybridization, and in situ RT-PCR for demonstration of hepatitis C virus in paraffin-embedded liver biopsies. Verh. Dtsch. Ges. Pathol. 78,22&225. 5 1. Nuovo, G. J., Lidonnici, K., MacConnell, P., and Lane, B. (1993) Intracellular localization ofpolymerase chain reaction (PCR)-amplified hepatitis C cDNA. Am. J Surg. Pathol. 17,683-690. 52. Lau, G. K. K., Fang, J. W. S., Wu, P. C., Davis, G L., and Lau, J. Y. N. (1994) Detection of hepatitis C virus genome in formalin-fixed paraffin-embedded liver tissue by in situ reverse transcription polymerase chain reaction. J Med. Virol. 44,406-409. 53. Gressens, P. and Martin, J. R. (1994) HSV-2 DNA persistence in astrocytes of the trigeminal root entry zone: double labeling by in situ PCR and immunohistochemistry. J. Neuropathol. Exp. Neurol. 53, 127-135. 54. Mehta, A., Maggioncalda, J., Bagasra, O., Thikkavarapu, S., Saikumari, P., Valyi, N. T., Fraser, N. W., and Block, T. M. (1995) In situ DNA PCR and RNA hybridization detection of herpes simplex vuus sequences m trigeminal ganglia of latently infected mice. Virology 206,633-640. 55. Ramakrishnan, R., Levine, M., and Fink, D. J. (1994) PCR-based analysis of herpes simplex virus type 1 latency in the rat trigeminal ganglion established with a ribonucleotide reductase- deficient mutant. J. Virol. 68,7083-7091. 56. Gressens, P., Langston, C., and Martin, J. R. (1994) In situ PCR localization of herpes simplex virus DNA sequences in disseminated neonatal herpes encephalitis. J. Neuropathol. Exp. Neurol. 53,46%482. 57. Mitchell, W. J., Gressens, P., Martin, J. R., and DeSanto, R. (1994) Herpes simplex virus type 1 DNA persistence, progressive disease and transgemc immediate early gene promoter activity in chronic cornea1 infections in mice. J Gen Virol 75,1201-1210 58. Kelleher, M. B., Galutira, D., Duggan, T. D., and Nuovo, G. J. (1994) Progressive multifocal leukoencephalopathy in a patient with Alzheimer’s disease. Diagn. Mol. Pathol. 3, 105-l 13. 59. Ueki, K., Richardson, E. P. J., Henson, J. W., and Louis, D. N. (1994) In situ polymerase chain reaction demonstration of JC virus in progressive multifocal leukoencephalopathy, including an index case. Ann. Neurol. 36,670-673. 60. Zaki, S. R., Heneine, W., Coffield, L. M., Greer, P. W., Sinha, S. D., and Folks, T. M. (1994) In-situ polymerase chain reaction: applications and current limitations. AIDS 8,1186-l 188. 6 1. Walter, M. J., Lehky, T. J., Fox, C. H., and Jacobson, S. (1994) In situ PCR for the detection of HTLV-I in HAM/TSP patients. Ann. NY Acad. Sci. 724,404-4 13.
Long and Komminoth
160
62. Mankowski, J. L., Spelman, J. P., Ressetar, H. G., Strandberg, J. D., Laterra, J., Carter, D. L., Clements, J. E., and Zink, M. C. (1994) Neurovirulent simian immunodeficiency virus replicates productively in endothelial cells of the central nervous system in vivo and in vitro. J Viral. 68,8202-8208. 63. Tsongalis, G. J., McPhail, A. H., Lodge, R. R. D., Chapman, J. F., and Silverman, L. M. (1994) Localized in situ amplification (LISA): a novel approach to m situ PCR. Clan. Chem. 40,381-384. 64. Hu, M., Wang, W. L., and Zhao, Y. L. (1994) In situ PCR-gene hybridization method for detecting mycobacterium tuberculosis in tissue specimens. Chung Hua Chieh Ho Ho Hu Hsi Tsa Chih 17,78,79.
65. Makowski, G. S., Aslanzadeh, J., and Hopfer, S. M. (1995) In situ PCR amplification of Guthrie card DNA to detect cystic fibrosis mutations (letter). Clin. Chem. 41,47’7-479. 66. Gosden, J. and Hanratty, D. (1993) PCR in situ: a rapid alternative to in situ hybridization for mapping short, low copy number sequences wrthout isotopes. Biotechniques
15,78-80.
67. Palluy, O., Bendani, M., Vallat, J. M., and Rigaud, M. (1994) 12-lipoxygenase mRNA expression by cultured neurons. CR Acad. Sci. III 317,s 13-8 18. 68. Nuovo, G. J., MacConnell, P. B., Simsir, A., Valea, F., and French, D. L. (1995) Correlation of the in situ detection of polymerase chain reaction-amplified metalloproteinase complementary DNAs and their mhibitors with prognosis in cervical carcinoma. Cancer Res. 55,267-275. 69. Staecker, H., Cammer, M., Rubinstein, R., and VanDeWater, T. (1994) A procedure for RT-PCR amplification of mRNAs on histological specimens. Biotechniques 16,76-80.
70. Heniford, B. W., Shum, S. A., Leonberger, M., and Hendler, F. J. (1993) Variation in cellular EGF receptor mRNA expression demonstrated by in situ reverse transcriptase polymerase chain reaction. Nucleic Acids Res. 21,3159-3 166. 7 1. Patel, V., Shum-Siu, A., Heniford, B., Wleman, T., and Hendler, F. (1994) Detection of epidermal growth factor receptor mRNA in tissue sections from biopsy specimens using in situ polymerase chain reaction. Am J. Pathol. 144,7-14. 72. Innis, M. A., Gelfand, H. D., Sniisky, J. J., and White, T. J. (1990) PCR Protocols. A Guide to Methods and Applications. Academic, San Diego, CA. 73. Nuovo, G., Gallery, F., Horn, R., MacConnell, P., and Bloch, W. (1993) Importance of different variables for enhancing in situ detection of PCR-amplified DNA. PCR Methods Appl. 2,305-3 12. 74. Anderson, V. M. (1995) In situ PCR: new frontier for histopathologists, in In Situ Polymerase Chain Reaction and Related Technology (Gu, J., ed.), Eaton Publishing, Natick, MA, pp. 13 l-l 37. 75. Fahy, E., Kwoh, D. Y., and Gingeras, T. R. (1991) Self-sustained sequence replication (3SR): an isothermal transcription based amplification system alternative to PCR. PCR Methods Appl. 1,25-33. 76. Zehbe, I., Hacker, G. W., Slllstrom, J. F., Rylander, E., and Wilander, E. (1994) Self-sustained sequence replication-based amplification (3SR) for the in-situ detection of mRNA in cultured cells. Cell Vision 1,2&24.
In Situ PCR Overview
161
77. Hdfler, H., Ptitz, B., Mueller, J., Neubert, W., Sutter, G., and Gais, P. (1995) In situ amplitication of measles virus RNA by the self-sustained sequence replication reaction. Lab. Invest. 73,577-585. 78. Tecott, L. H., Barchas, J. D., and Eberwine, J. H. (1988) In situ transcription: Specific synthesis of complementary DNA in fixed tissue sections. Science 240, 1661-1664. 79. Hacker, G. W. and Danscher, G. (1994) Recent advances in immunogold-silver staining-autometallography. Cell Vision 1, 102-109. 80. Raap, A. K., Van de Corput, M. P. C., Vervenne, R. A. W., van Gijlswijk, R. P. M., Tanke, H. J., and Wiegant, J. (1995) Ultra-sensitive FISH using peroxidasemediated deposition of biotin- or fluorochrome tyramides. Hum. Mol. Genet. 4, 529-534. 81, Kolata, G. (1993) Tests show infection
by AIDS virus affects greater share of cells. The New York Times,January 5, C3. 82. Komminoth, P. and Long, A. A. (1995) In situ polymerase chain reaction and its applications to the study of endocrine diseases. Endocr Pathol. 6, 167-17 1,