CHAPTER 1
Isolation and Purification of Plant Nucleic Acids Genomic and Chloroplast
Mien
T. G. van de Ven, Patrick an...
30 downloads
1589 Views
26MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
CHAPTER 1
Isolation and Purification of Plant Nucleic Acids Genomic and Chloroplast
Mien
T. G. van de Ven, Patrick and Rex M. Brennan
DNA
G. Lanham,
1. Introduction The use of molecular protocols has expanded into virtually all branches of plant science in recent years, and crucial to theseprotocols is the effective isolation of plant nucleic acids in a purified state. Isolation of DNA from plant tissue must be simple, rapid, inexpensive, reproducible, and efficient, particularly when many samples are required, e.g., in population studies. The increasing use of polymerase chain reaction (PCR)based technology in plant molecular biology, especially in transgenic analysis, genetic mapping for genome analysis, and genetic fingerprinting, has placed further emphasis on the need for the efficient isolation of pure DNA, often from small amounts of plant tissue. Isolation of highly purified plant DNA is often complex, particularly from plant tissues high in polyphenolic compounds that can react with cellular enzymes during the extraction procedure to render the DNA unsuitable for further analysis. Contamination with polysaccharides, mainly pectins, is also a frequent problem; the following protocols are designed to limit their effects. Protocols for both genomic and chloroplast DNA (cpDNA) are given. CpDNA is now widely used, particularly in association with restriction From
Methods Nuclerc
In Molecular Acrd Methods
B/ology, Edlted
Vol 50. Species Dlagnostm Protocols PCR and Other by. J P Clapp Humana Press Inc , Totowa, NJ
1
van de Ven, Lanham,
2
and Brennan
analysis, in phylogenetic and other studies. In most higher plants the cpDNA is a circular molecule highly conserved within each species. As with genomic DNA, the isolation procedures must be reliable and rapid to give high quality cpDNA. In both cases, the starting material should be young, soft plant tissue for the best results. 2. Materials Horizontal gel electrophoresis equipment including gel tank, power pack, and combs are required for all methods. 2.1. Genomic DNA 2.1.1. Method 1
1. Mortar and pestle. 2. 15-mL Centrifuge tubes.
3. Micropipets. 4. 5. 6. 7. 8. 9.
Platform shaker. Benchtop centrifuge. Mtcrofuge. Microfuge tubes. Muslin. Extraction buffer: 1 or 2% CTAB (see Notes 1 and 2); 100 mM Tris-HCl, pH 8.0,20 mA4EDTA, pH 8.0, 1.4MNaCl. 10. TE buffer:10 mMTrts-HCI, pH 8.0, 1 mMEDTA, pH 8.0. 2.1.2. Method 2 1. Blender.
2. Centrifuge (medium to low spin). 3. Microfuge. 4. Microfuge tubes. 5. Micropipets.
6. Cheesecloth. 7. Miracloth (Calbiochem, La Jolla, CA). 8. Extraction buffer: 100 miW Tris-HCl, pH 7.5, 0.35M sorbitol, 5 rnIvI EDTA, 20 m&f sodium bisulfate added fresh just before use. 9. Nuclei lysis buffer: 200 mA4 Tris-HCl, 50 mM EDTA, 1M NaCl, 2%
CTAB, pH 7.5. 2.1.3. Method 3 1. Mtcrofuge.
2. Microfuge tubes.
3
Plant Nucleic Acids
3. Disposable grinders. 4. Vortex mixer 5. Extraction buffer: 200 rmI4 Tris-HCl, pH 8.0, 250 mM NaCl, 25 mA4 EDTA, 0.5% SDS.
2.2. Chloroplast
DNA Isolation
1. Scalpel. 2. Waring blender or other blender. 3, Funnels. 4. Nylon gauze of loo-, 64-, and 30-pm pore size. 5. Glass beakers. 6, Centrifuge tubes, 50-, 15-, and 5-mL. 7. Centrifuge, medium to low spin. 8. Ultracentrifuge with SW-28 and SW-50 rotors. 9. Soft pamt brushes. 10. Pasteur pipets. 11. Micropipets. 12. Syringe and needle. 13. Dialyses tubing. 14. Flask, 1.5 L. 15. Extraction buffer: 50 mA4 Tris-HCl, pH 8.0, 7 m&I Na2EDTA, 0.35M sucrose 5 rnA4j3-mercaptoethanol (BME) (see Note 3) (add after buffer has been autoclaved and cooled), 0.1% bovine serum albumin (BSA) (add after buffer has been autoclaved and cooled). 16. Wash buffer: 50 mMTris-HCl, pH 8.0,20 mMNa2EDTA, 0.35M sucrose. 17. Sucrose buffers: 50 mMTris-HCl, pH 8.0,7 mMNa,EDTA, adjusted with sucrose to the required percentage of 20,45, or 60. 18. TE: 10 mMTris-HCl, pH 8.0, 1 mMNa2EDTA. 19. Proteinase K: 10 mg/mL, dissolved in sterile distilled water. 20. Sarcosine: lo%, dissolved in 50 mA4Tris-HCl, pH 8.0,20 mMNa,EDTA. 21. Phenol: phenol saturated with O.lM Tris-HCl, pH 7.6. 22. Phenol/chloroform/isoamyl alcohol: Mix equal amounts of chloroform/ isoamyl alcohol (24: 1) and phenol. 23. 3M Sodium acetate. 24. 100% Ethanol. 25. 70% Ethanol. 26. Cesium chloride. 27. 1% Ethidium bromide. 28. Butanol.
4
van de Ven, Lanham,
and Brennan
3. Methods 3.1. Genomic
DNA
One of the major considerations when isolating DNA from plant tissue is the variety of plant species that exist, so that a method which works well for one species may not work well for another. The methods described here are generally applicable, but for each new species optimization of the DNA extraction procedure is usually required. With this in mind, some variations on the methods are included to give greater scope in their application. All materials and solutions should be sterilized before use in each case. 3.1.1.
Method
1
This method (1,2) uses the cationic detergent hexadecyltrimethylammonium bromide (CTAB), which is widely used for a variety of plant tissues to disrupt cell and nuclear membranes, releasing DNA and other components (‘3). Differences in the solubilities of nucleic acids and polysaccharides in the presence of CTAB assists in eliminating polysaccharide contamination. Additionally CTAB can be used to precipitate DNA when the NaCl concentration is <0.7A4 (I). Protecting the DNA from degradation by native nucleases or secondary compounds is of primary importance. For this reason, ethylenediaminetetraacetic acid (EDTA) is included in most DNA extraction buffers to chelate divalent cations such as Mg2’ or Ca2+,which are cofactors for many DNA-degrading enzymes. However, at least one DNase that is stimulated by EDTA has been observed (4). The reducing agent, P-mercaptoethanol, is included in extraction buffers to protect the DNA against quinones, disulfides, peroxidases, and polyphenoloxidases (5), whereas the inclusion of polyvinylpyrrolidone (PVP) decreasesthe effect of polyphenols, quinones, and tannins. A contaminant, usually thought to be polysaccharide, may copurify with the DNA. This can cause problems in dissolving the DNA or in subsequent manipulations such as digestion with restriction endonucleases. Adoption of alternative precipitation procedures to those given in the main Methods (see Notes) may overcome this. Protein contamination is removed by chloroform extraction stages. 1. Grind material (0.5-2.0 g) in liquid nitrogen(seeNote 4) using a mortar and pestle.The addition of sterile sandmay aid tissue disruption (seeNote 5).
5
Plant Nucleic Acids
2. Add 5 mL of extraction buffer (see Note 6) and transfer to a sterile centrifuge tube containing 300-500 mg of insoluble PVP (see Note 7). Do not allow the ground material to thaw out prior to the addition of extraction buffer. 3. Incubate in a water bath at 65°C for 30-60 min with occasional gentle mixing by inversion of the tube. 4. Add an equal volume, 7.5 mL, of chloroform/isoamyl alcohol (24: 1) and mix for 15 min by laying the tubes in a horizontal position on a platform shaker. It is important that the phases receive thorough mixing without severe agitation, otherwise mechanical shearing of the DNA will occur. 5. Centrifuge at 4000g for 6 min. Usually, this results in the organic and aqueous phases being separated by a solid plug of debris that should be left undisturbed. 6. Filter the aqueous phase through sterile muslin. 7. Add an equal volume (approx 3 mL) of ice-cold propan-2-01 and mix by inversion. Stand at room temperature for 15 min. 8. The precipitated DNA can either be hooked out with a sterile glass hook or pelleted by centrimgation at 4000g for 20 mm. Occasionally, DNA is not visible in the tube after the addition of propan-2-01; if this occurs, DNA may still be recovered by centrifugation. 9. Wash the pellet once with 70% ethanol, to remove residual CTAB and NaCl. Dry the pellet under vacuum and redtssolve in 200-500 pL of sterile TE buffer. Care should be taken not to overdry the pellet, as this can lead to problems m dissolving the DNA. Drying until no ethanol is visible usually is sufficient. 10. The DNA can be treated, if required, with RNAse (final concentration 10 pg/mL, 30 min at 65°C) followed by precipitation with 5 vol of ice-cold 100% ethanol. 3.1.2. Method 2
This method (6,7) first isolates nuclei and then lyses them to extract the DNA. The quantities given are for relatively large amounts of leaf material but can be scaled down (8). 1. Blend 1O-20 g of leaf tissue in a blender using 150 mL of ice-cold extraction buffer. Blending should be sufficient to homogenize the tissue (usually about 15 s), but too much blending will result in mechanical shearing of the DNA and should be avoided. 2. Filter through two layers of sterile cheesecloth and one layer of sterile miracloth into a precooled 250-mL centrifuge bottle on ice. 3. Centrifuge at 4°C at 750g for 5 min.
6
van de Ven, Lanham,
and Brennan
4. Discard the supernatant and resuspend the pellet in 5 mL of extraction buffer (see Note 8). Keep on ice. Add 5 mL of nuclei lysis buffer and then 2 mL of 5% sarkosyl. 5. Transfer to a 50-mL centrifuge tube. 6. Incubate for 15-20 min m a water bath at 60°C with occasronal gentle mixing by inversion of the tube. 7. Add 15 mL of chloroform/lsoamyl alcohol (24: 1) and mtx as m step 4 m Method 1 (see Note 9). 8. Centrifuge for 15 mm at 400g. 9. Carefully pipet the aqueous phase mto another centrifuge tube and add 2/3-l volume of propan-2-01. Mix by inversion and recover the DNA as in steps 8-10 in Method 1 (see Notes 10 and 11). 3.1.3. Method 3 The advent of PCR technology has meant that small quantities of DNA may be sufficient for a given experiment. The following method permits the isolation of PCR-amplifiable DNA from small quantities of leaf material (9). The short time required to complete this procedure makes it possible to process many samples quickly. 1, Pinch out a section of fresh leaf material using the lid of a sterile 1.5-mL Eppendorf tube. 2. Macerate the tissue at room temperature in the Eppendorf tube using a disposable grinder for approx 15 s. 3 Add 400 pL of extraction buffer and vortex for 5 s. At this stage the mixture can be left at room temperature for at least 1 h. 4. Centrifuge for -14,000g for 1 min and transfer 300 pL of the supematant to a fresh tube. 5. Add 300 l.tL of cold propan-2-01, mix, and leave at room temperature for 2 min. 6. Centrifuge for 5 min, discard the supematant. 7. Wash the pellet once with 300 PL of 70% ethanol. Centrifuge at top speed for 5 mm in an Eppendorf centrifuge. 8. Discard the supematant, dry the pellet as m step 9, Method I, and redissolve it m 100 pL of TE buffer.
3.2. Chloroplast
DNA Isolation
Chloroplast genomes have been studied in a wide variety of plant species. In most cases chloroplast DNA (cpDNA) consists of a single circular molecule, which is highly conserved in size and gene arrangement.
Plant Nucleic Acids
7
The size of the plant chloroplast DNA genome ranges from 83-292 kb (IO), whereas in land plants the variation is even smaller, 120-2 17 kb (1 I). This size difference seems mainly owing to the size variation of a single large inverted repeat that can be absent, as in a group of legumes and several conifer species, or can vary in length up to 76 kb (11-13). The genes encoded on the chloroplast genome are mostly involved in photosynthesis or chloroplast protein synthesis (14,15). The organization, structure, evolution, and inheritance of chloroplast genomes have been reviewed by Palmer and others (11,15-19). With the study of chloroplasts from many plant species, a variety of methods have been developed for the isolation of cpDNA (10,20). The procedure given here has been used successfully for the isolation of cpDNA from tobacco and potato and is a compilation of methods described for tobacco and petunia (II), Atriplex (121, and potato (13). This method yielded -1.5 ug cpDNA/g fresh weight of plant material, and the cpDNA readily could be cut with restriction enzymes. If this method is not successful, and if cpDNA isolation is impossible, some suggested modifications and alternatives are given in Section 3.2.5. As mentioned previously, many different protocols for the isolation of cpDNA exist. In the majority of these, intact chloroplasts are first isolated, from which the cpDNA is extracted. It is also possible to extract total cellular DNA and purify the cpDNA by CsCl-gradients (I 1). Fresh, young, and healthy leaves, sometimes grown at low light intensity or dark (to prevent stareh accumulation) seem to be a prerequisite for good chloroplast yields (10,20), although cell suspension cultures (21) and freeze-dried material (22,231 have also been used for the isolation of cpDNA. An advantage of using freeze-dried material is that it can improve the yield of cpDNA from, for example, wheat and rice, and it can be stored for a long time. It also has some disadvantages, such as requiring the use of hazardous solvents, and there seemsto be an inverse correlation between the yield of cpDNA and contamination with nuclear DNA (23). The isolation procedures of chloroplasts from fresh leaves basically are modifications of the methods developed by Kolodner and Tewari (241, using DNAse I digestion of nuclear DNA and cpDNA from broken chloroplasts, and Tewari and Wildman (25) using a sucrose gradient to purify chloroplasts.
van de Ven, Lanham,
8
and Brennan
Leaf tissue is briefly homogenated in extraction buffer in a blender, so the cells are broken but the chloroplasts stay intact. The extraction buffer contains the following components: 1. A buffer to keep the pH stable, usually Tris-HC1 but N-(2-Hydroxyethyl)plperazine-N’-(2-ethanesulfonic acid) (HEPES) (29) and 2-(N-morpholme)-ethanesulfonic acid (MES) (201 have been used. 2. An osmoticum, such as 0.3M sucrose, sorbitol (IO), or mannitol (24). 3. An oxidizmg agent, such as BME or DTT. DTT would probably be preferred to BME as it has a greater redox potenttal, IS capable of suppressing degradative enzyme activity (26), and IS less harmful. 4. EDTA and BSA. The following extraction:
components are sometimes added to aid the chloroplast
1. Spermine and spermidine to stabilize the plastld membrane and reduce nuclease degradation of plastld membrane (26,27). 2. Polyethylene glycol (PEG) and or PVP have beenaddedwhen tissues are expected to contain lots of tannins or other secondary compounds (20,28).
Chloroplasts are isolated from cell debris by filtration through several layers of cheesecloth, miracloth, or nylon gauze up to 20-pm pore size. To concentrate the chloroplasts they are pelleted by centrifugation (1000-l 5OOg) and resuspended in wash buffer, usually containing the same components as the extraction buffer, except for the BME/DTT and BSA. The chloroplasts can be further purified by DNAse I digestion, sucrose gradients, or can be lysed immediately to further simplify the method (29,30). For lysis of the chloroplasts pronase (J&27), proteinase K (26,28,31), SDS (26,29), sarkosyl (10,2.5,27,31), Triton X-100 (23,28), CTAB (30), or a combination of two of these lysmg agents have been used. Some plants react differently to the various lysing agents: e.g., clover chloroplasts are lysed incompletely by pronase, proteinase K, and Triton X- 100, but completely by CTAB (30). The cDNA is either purified by phenol/chloroform extractions or CsCl gradient. The latter tend to give purer cpDNA than phenol/chloroform extractions, but are more laborious and time consuming. The cpDNA is precipitated with salt and ethanol, washed with ethanol, and resuspended in a small volume of TE buffer.
Plant Nucleic Acids
9
3.2.1. Isolation of Intact Chloroplasts Steps l-l 1 are done in a cold room at 4°C. (If no cold room is available the work should be conducted on ice as far as possible.) All solutions and materials are sterilized before use. 1. Leaves (20-30 g) are washed respectively in cold tap water and cold sterile distilled water, drained on sterile paper tissues, and the midrib cut out with a sterile scalpel. 2. Homogenize the leaves in a Waring blender in 100 mL of extraction buffer by giving a few short pulses at top speed. This should disrupt the cells but keep the chloroplasts intact. 3. Filter the homogenate through two layers of nylon gauze of IOO-pm pore size, two layers of gauze of 64 pm, and two layers of 30 pm, respectively. The collected filtrate should be free of most cellular debris. 4. Transfer the filtrate to 50-mL centrifuge tubes and give a slow spin of -50g for 2 min at 4OC in a Universal table centrifuge. This should pellet the nuclei and the chloroplasts will stay in the supernatant. 5. Pour the supernatant in a clean 50-mL centrifuge tube and spin for 10 min at -1500g and 4°C to pellet the chloroplasts. 6. Resuspend the pellet in 10 mL of wash buffer using a soft paint brush. 7. Make a stepwise sucrose gradient by layering the followmg sucrose solutions in a 50-mL centrifuge tube: 10 mL 60% sucrose buffer, 10 mL 45% sucrose buffer, 10 mL 20% sucrose buffer. Disrupt the interfaces with a pipet or by freezing and thawing the gradient a few times, to prevent tight packaging of the chloroplasts. 8. Load the resuspended chloroplasts on top of the sucrose gradient and spin for 50 min at 85,500g (Beckman ultracentrifuge with SW-28 rotor) and 4°C. A green layer of chloroplasts is formed at both interfaces, the top one containing Intact cup-shaped chloroplasts and the second one containing mostly round chloroplasts. The pellet contains most of the nuclear material and starch. 9. The green bands are removed with a pipet and can either be combined or kept separate. 10. Dilute the chloroplast solution with 3-10 vol of wash buffer and pellet the chloroplasts by a 15-min spin at -2000g and 4°C. 11. Resuspend the pellet in 2 mL wash buffer. Option: Solution can be checked for intact chloroplasts by examining a drop with a light microscope.
3.2.2. Isolation of Chloroplast DNA 1. Add 0.1 vol of 10 mg/mL proteinase K, mix by gently inverting the tube, and leave at room temperature for 2 min.
10
van de Ven, Lanham,
and Brennan
2. Add 0.5 mL of 10% sarcosme, mix by gently inverting the tube, and leave at room temperature for 30 min to lyse the chloroplasts. To purify the cpDNA either use phenol extraction (Section 3.2.3.) or put the lysate through a cesium chloride (CsCl) gradient (Section 3.2.4.). 3.2.3. Purification of Chloroplast DNA by Phenol Extraction 1, Extract the lysate with phenol by adding an equal volume of phenol (2.5 mL), mix by inverting the tubes several times, and spin for 10 mm at -2200g. 2. Collect the upper layer, takmg care not to include any of the interface, and repeat the phenol extraction. 3. Extract the cpDNA solution once more with phenol/chloroform/isoamyl alcohol. 4. Precipitate the cpDNA with 0.1 vol of 3M sodium-acetate and 2.5 vol of 100% cold ethanol. 5. If strings of DNA are formed they are hooked out; otherwise pellet the DNA by a 10 minute spm at -3000g. 6. Wash the DNA twice with 70% ethanol and air dry. 7. Resuspend the DNA in 200 pL TE. 3.2.4. Purification of Chloroplasts DNA by C&l-Gradient 1. Add to the lysate 4.76 g of CsCl and adjust the volume to 5 mL with TE. Dissolve the CsCl by gently inverting the tube at room temperature. 2. Add 5 pL of 1% ethidium bromide solution and spin for 12-16 h at 40,000 rpm (Beckmann ultracentrifuge with SW-50-IB rotor). A bright pink band of cpDNA is formed at a buoyant density of = f 1.69, whereas the pellet contains RNA. 3. Remove the cpDNA band with a syrmge and needle under ultravrolet light (UV). If the centrifuge tubes are sealed make sure to make a hole in the top before removing the band, to avoid creating a vacuum. 4. Extract the DNA with an equal volume of butanol saturated with water several times, to remove all ethidium bromide from the DNA-face (bottom layer). 5. Transfer the DNA solution to dialysis tubing soaked in sterile distilled water and dialyse against 1 L of TE at 4°C. Change the TE several times over a period of 16 h to remove the CsCl. 6. Precipitate the cpDNA as mentioned in Section 3.2.3., steps 4-7. 3.2.5. Alternative Procedures for Detecting cpDNA Variation Chloroplast DNA variation is widely used to investigate inter- or intraspecific relationships among plants in studies of evolution, biosystematits, phylogeny, introgression, or cpDNA inheritance. Chloroplast DNA
Plant Nucleic Acids variation can be investigated without extracting cpDNA, but using total cpDNA or cpDNA clones from other plants. CpDNA clones from the whole chloroplast genomes of Petunia, Vigna, and Nicotiana are among several that are available (IO, 32-34). Palmer (IO) provided a list of cpDNA clone banks, from which clones are readily obtainable. Total cellular DNA is isolated, digested with restriction enzymes, electrophoresedto separatethe fragments, and the DNA is transferred to membranes by Southern blotting. cpDNA fragments can be highlighted by using available cpDNA clones as probes in hybridization. Chloroplast DNA variation can be detected and restriction maps or physical maps can then be constructed (35-3 7). A more recent method to investigate cpDNA variation is using PCR. Taberlet et al. (38) designed several primers for amplification of noncoding regions of the cpDNA via PCR. They designed the primers for very conserved regions flanking more variable regions, using the complete nucleotide sequences of liverwort, tobacco, and rice (39-41). The primers worked successfully over a wide variety of plant species, and were used to detect intraspecific polymorphism in European oaks (42). 4. Notes 1. CTAB ISusually usedat 1% for lyophilized tissue and 2% for fresh tissue but can be increasedup to 4%. 2. CTAB may be replaced by sodium dodecyl sulfate (SDS). 3. The concentration of BME may be increased to 25 mM or, alternatively, may be replaced by dithiothreitol (DTT). 4. Instead of using liquid nitrogen, plant material can be ground in extraction buffer preheated to 6O”C, using a preheated mortar and pestle. 5. When freeze-dried samples are to be used with Method 1, the initial step should be to powder this material m a mechanical mill prior to suspension in CTAB extraction buffer (2). 6. The pH of extraction buffers is usually 8.0 but can be increased up to pH 9.5 to give added protection against degradation by DNases. 7. The addition of PVP IS optional. Its inclusion does not seem to have any adverse effects and it can greatly improve the quality of the DNA extracted, therefore it is advisable to begin by including it. 8. The nuclei may be washed twice in extraction buffer to which Triton X- 100 has been added to a final concentration of 0.4% (v/v) before resuspension for lysis as in step 4 (43). 9. More than one chloroform/isoamyl alcohol extraction may be performed if necessary and an additional phenol/chloroform (1: 1) extraction may also be performed to improve the quality of the DNA.
12
van de Ven, Lanham,
and Brennan
10. Polysaccharldes that copurlfy with the DNA may be removed by precipitation with NaCl as described, although this method often results in reduced yield of DNA. a. Add NaCl, from a 5M stock solution, to a final concentration of 1M. b. Store at -20°C for 30 min. c. Centrifuge at top speed in an Eppendorf centrifuge for 5 min to pellet the polysacchandes. d. Remove the supernatant and precipitate DNA by adding 2 vol of 100% ethanol, centrifuge for 5 min, dry, and redissolve the pellet. 11. Precipitation of DNA with propan-2-01 or ethanol can result in copreclpitatlon of a jelly-like material (presumably polysaccharides). An alternative method of precipitation (3) IS as follows: CTAB precipitation buffer: Tris-HCI, 50 mMpH 8.0; EDTA, 10 mMpH 8.0; CTAB 1%. a. Add an equal volume of CTAB precipitation buffer and mix. b. Leave for 30 mm at room temperature. c. Centrifuge at 2000g for 5 min at room temperature. d. Proceed as for steps 9-10, Method 1.
References 1 Murray, M G and Thompson, W. F. (1980) Rapid lsolatlon of high molecular weight plant DNA Nucleic Acrds Rex 8,4321-4325. 2 Saghai-Maroof, M. A , Sohman, K. M., Jorgensen, R. A., and Allard, R W (1984) Ribosomal DNA spacer-length polymorphisms m barley. Mendelian Inheritance, chromosomal location, and population dynamics. Proc Nat1 Acad Scl USA 81, 8014-8018. 3. Rogers, S 0. and Bendlch, A. J. (1988) Extraction of DNA from plant tissues, m Plant Molecular Bzology Manual (Gelvin, S. B. and Schllperoort, R. A., eds.), Kluwer Academic Pubhshers, Dordrecht, pp. A6/1-A6/11 4. Jones, M. C. and Boffey, S. A (1984) Deoxyribonuclease activities of wheat seedlings FEBS Lett. 174,2 15 5. Herrmann, R. G., Palta, H. K , and Kowallik, K. V. (1980) Chloroplast DNA from three archegoniates. Planta 148, 3 19-327 6. Bernatsky, R. and Tanksley, S. D. (1986) Genetics of actm-related sequences in tomato. Theor. Appl. Genet 72, 314-321. 7. Kochert, G., Halward, T., Branch, W. D., and Simpson, C. E. (1991) RFLP variabihty in peanut (Arachis hypogaea L.) cultivars and wild species. Theor Appl. Genet 81,565-570 8. Vosman, B., Arens, P., Rus-Kortekaas, W., and Smulders, M. J M. (1992) Identlficatlon of highly polymorphic DNA regions in tomato. Theor. Appl. Genet 85,239-244. 9. Edwards, K , Johnstone, C., and Thompson, C. (1991) A snnple and rapid method for the preparation of plant genonuc DNA for PCR analysis. Nuclezc AczdsRes. 19, 1349. 10. Palmer, J. D. (1986) Isolation and structural analysis of chloroplast DNA Methods Enzymol. 118, 167-186.
Plant Nucleic Acids 11. Palmer, J D. (1990) Contrastmg modes and tempos of genome evolution in land plant organelles. Trends Genet. 6, 115-120. 12. Strauss, S. H., Palmer, J. D., Howe, G. T., and Doerksen, A. H. (1988) Chloroplast genomes of two conifers lack a large inverted repeat and are extensively rearranged. Proc N&l. Acad Scz USA 85,3898-3902. 13. Palmer, J. D., Osorio, B., Aldrich, J., and Thompson, W. F. (1987) Chloroplast DNA evolution among legumes. loss of a large inverted repeat occurred prior to other sequence rearrangements. Curr Genet. 11,275-286 14. Ko, K. and Strauss, N. A (1986) The chloroplast genome of Vzczafaba, in Thzrd Conspectus of Genetic Variation Within Vicla faba. (Ward, S. and Chapman, G P., eds.), FABIS ICARDA, Aleppo, Syria, pp. 8-18. 15 Neale, D B. and Sederhoff, R R (1988) Inheritance and evolution of conifer organelle genomes, in Genetic Manzpulatzon of Woody Plants (Honver, J W. and Keathley, D. E., eds.), Plenum, New York, pp. 251-264. 16. Whitfield, P. R. and Bottomley, W. (1983) Organization and structure of chloroplast genes. Ann Rev Plant Physiol. 34,279-3 10 17. Crouse, E J , Schrmtt, M., and Bohnert, H. J. (1985) Chloropost and cyanobacterial genomes, genes and RNAs. a compdation. Plant Mol Biol. Rep 3,43-89. 18 Palmer, J D (1985) Comparative orgamzatlon of chloroplast genomes. Ann Rev Genet. 19,325-354 19. Palmer, J. D (1987) Chloroplast DNA evolution and biosystematic uses of chloroplast DNA variation. Am Natur. 130, Xi-S29. 20. Herrmann, R. G. (1982) The preparation of circular DNA from plastlds, m Methods zn Chloroplast Molecular Bzology (Edelman, M., Hallick, R. B., and Chua, N H., eds.), Elsevler, Amsterdam, pp. 259-280. 2 1. DeBonte, L. R and Matthews, F. (1984) Rapid lsolatlon and purification of plastid and mltochondnal DNA from carrot cell suspensions Plant Mol. Bzol Rep. 2,32-36. 22. Bowman, C M. and Dyer, T. A. (1982) Purification and analysis of DNA from wheat chloroplasts isolated m nonaqueous media. Anal Biochem 122, 108-l 18 23. Dally, A. M. and Second, G. (1989) Chloroplast DNA isolation from higher plants. an improved nonaqueous method. Plant Mol. Biol Rep 7, 135-143. 24. Kolodner, R. D. and Tewari, K. K (1975) The molecular size and conformation of the chloroplast DNA from higher plants. Biochim. Biophys Acta 402,372-390. 25 Tewari, K. K and Wildman, S. G. (1966) Chloroplast DNA from tobacco leaves. Sczence 153, 1269-1271. 26. Cahe, P. J. and Woodbury-Hughes, K. (1987) An efficient protocol for the isolation and purification of chloroplast DNA from moss gametophyte tissues. Plant Mol. Biol. Rep. 4,206-212. 27. Palmer, J. D. (1982) Physical and gene mapping of chloroplast DNA from Atriplex trzangularis and Cucumis sativa Nucleic Acids Res. 10, 1593-1605. 28. White, E. E. (1986) A method for extraction of chloroplast DNA from conifers. Plant Mol Bzoi Rep 4,98-l 0 1 29. BookJans, G., Stummann, B. M., and Henningsen, K. W. (1984) Preparation of chloroplast DNA from pea plastids isolated in a medium of high ionic strength. Anal. Bzochem. 141,244-247
14
van de Ven, Lanham,
and Brennan
30. Milhgan, B G. (1989) Purification of chloroplast DNA usmg hexadecyltnmethylammonium bromide. Plant Mol Blol. Rep 7, 144-149. 3 1. Saltz, Y. and Beckman, J. (198 1) Chloroplast DNA preparation from Petunia and Nlcotiana
PMB News1 2, 73,74.
32. Hosaka, K. and Hanneman, R. E. Jr. (1987) A rapid and simple method for determination of potato chloroplast DNA type. Am. Potato J 64,345353. 33. Frankel, R., ScowcroFt, W. R., and Whitfield, P. R. (1979) Chloroplast DNA variation on isonuclear male-sterile lines of Nzcotzana. Mol. Gen. Genet. 169, 129-135 34. Sugiura, M., Shinozaki, K., Zaita, N , Kusuda, M., and Kumano, M. (1986) Clone bank of the tobacco (Nicotiana tabacum) chloroplast genome as a set of overlapping restriction endonuclease fragments. mapping of eleven ribosomal protein genes. Plant Sci. 44,2 11-216. 35. Wagner, D. B., Fumier, G. R., Saghai-Maroof, M. A., Wilhams, S. M., Dancik, B P., and Allard, R. W. (1987) Chloroplast polymorphisms in lodgepole andJack pines and their hybrids. Proc. Natl. Acad. Scz. USA 84,2097-2 100. 36. Doyle, J. J., Doyle, J. L., and Brown, A. H. D. (1990) A chloroplast-DNA phylogeny of wild perennial relatives of soybean (Glycme subgenus glycine): congruence with morphological and crossing groups. Evolutton 44,371-389. 37. Waugh, R., van de Ven, M., Millam, S., Brennan, R , and Powell, W. (1990) The potential use of restriction fragment length polymorphism in Rubus breeding. Acta Hort
280,541-545.
38. Taberlet, P., Gielly, L., Pautou, G., and Bouvet, J (1991) Universal primers for amphfication of three non-coding regions of chloroplast DNA. Plant Mol. Btol 17,1105-l 109 39. Ohyama, K., Fukuzawa, H., Kohchi, T., Shirai, H., Sano, T., Sano, S., Umesono, K., Shiki, Y., Takeuchi, M., Chang, Z., Aota, S., Inokuchi, H , and Ozeki, H. (1986) Complete nucleotide sequence of liverwort Marchantia polymorpha chloroplast DNA Plant Mol. Biol Rep. 4, 148-175. 40. Shinozaki, K., Ohme, M., Tanaka, M., Wakasugi, T., Hayashtda, N., Matsubayashl, T., Zaita, N., Chunwongse, J., Obokata, J., Yamaguch-Shinozaki, K., Ohto, C , Torazawa, K., Meng, B. Y , Sugita, M., Deno, H., Kamogashira, T., Yamada, K., Kusuda, J., Takaiwa, F., Kato, A., Tohdoh, N., Shimada, H , and Sugtura, M (1986) The complete nucleotide sequence of tobacco chloroplast genome. Plant Mol. Biol. Rep 4, 110-147. 41. Hiratsuka, J., Shimada, H., Whittier, R., Ishibashi, T , Sakamoto, M., Mori, M., Kondo, C., Honji, Y., Sun, C. R., Meng, B. Y., Li, Y. Q., Kanno, A., Nishizawa, Y., Hirai, A , Shinozaki, K., and Sugiura, M. (1989) The complete sequence of the rice (Oryza satlva) chloroplast genome mtermolecular recombmation between distinct tRNA genes accounts for a major plastid DNA inversion during the evolution of the cereals. Mol. Gen Genet. 217, 185-194. 42. Ferris, C., Oliver, R. P., Davy, A. J., and Hewitt, G. M. (1993) Native oak chloroplasts reveal an ancient divide across Europe. Mol Ecol 2,337-344. 43. Messegeur, R., Ganal, M. W., Steffens, J. C., and Tanksley, S. D. (1991) Characterization of the level, target sites and inheritance of cytosine methylation in tomato nuclear DNA. Plant Mol Biol. 16,753-770.
CHAPTER2
Isolation and Purification of Insect DNA Andrew E Cockburn and Gary A. Fritz 1. Introduction The isolation of DNA from insects normally does not present any specific problems. Therefore, any one of a multitude of techniques used for isolation of DNA from other organisms will usually work with insect tissue. Our intention in this chapter is to present methods that have worked well in our laboratory, focusing on simplicity, speed, and safety. Our work is primarily population genetics, so we are concerned with the problems associated with processing large numbers of DNA preparations. Generally, we use as crude a sample as possible, in order to eliminate the extra labor involved in complete purification. For polymerase chain reaction (PCR), we actually use a crude homogenate that has not been purified at all, since the small amount of material added to the reaction does not appear to affect the functioning of the Taq polymerase. For restriction digestion, it is necessary to remove most of the protein and RNA, although complete deproteinization is not required. For library construction, we have found that we must use DNA that has been further purified by phenol extraction, and we usually also use cesium chloride gradient purification.
From
Methods Nucleic
m Molecular Awd Methods
Bology, Ed&d
Vol 50 Species Diagnoshcs Protocols PCR and Other by J P Clapp Humana Press Inc , Totowa, NJ
15
Cockburn and Fritz
16
2. Materials 2.1. Rapid
Isolation
and Purification of DNA Digestion tubes with epoxy-resin pestle or mrcroho-
for Restriction
1. 1.5mL mmrocentrifuge mogenizer. 2. Homogenization buffer: 0. IM NaCI, 0.2M sucrose, O.OlM EDTA, 0.03M Trts-HCl, pH 8.0. 3. Lysrs buffer: 0.25M EDTA, 2.5% (w/v) SDS, 0.5M Tris-HCl, pH 9.2. 4. 8M Potassmm acetate. 5. 95% Ethanol. 6. 70% Ethanol. 7. RNase A. 8. TE: 10 mMTrrs-HCl, pH 8.0, 1 mMEDTA. Purification of Total DNA Libraries Homogenization buffer: O.lMNaCl, 0.2M sucrose, O.OlM EDTA, 0.03M Tris-HCI, pH 8.0. Dounce type homogenizer. 500-mL Plastic centrtfuge bottle. Lysis buffer: 0.25MEDTA, 2 5% (w/v) SDS, 0 5M Trrs-HCI, pH 9.2. 60-mL Syringe. Protemase K. 8M Potassmm acetate. 95% Ethanol. 70% Ethanol. TE: 10 mMTrts-HCI, pH 8.0, 1 mM EDTA. 20% Sodium lauryl sarcosmate. CsCl. 10 mg/mL Ethrdium bromide. Water-saturated butanol. Buffer-saturated phenol pH 8.0 (stored under TE). Water-saturated drethyl ether. 2.2. Large-Scale
for Genomic
1. 2. 3. 4 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16.
2.3. Isolation of Mitochondrial DNA 1 Homogenization buffer: O.lM NaCI, 0.2M sucrose, O.OlM EDTA, 0.03M Trrs-HCl, pH 8.0. 2. Dounce homogenizer. 3. 20% Sodium lauryl sarcosinate.
17
Insect DNA
4. CsCl. 5. 6. 7. 8. 9. 10. 11.
10 mg/mL Ethidium bromide. Water-saturated butanol. Buffer-saturated phenol pH 8.0 (stored under TE). Water-saturated diethyl ether. 95% Ethanol. 70% Ethanol. TE: 10 mM Tris-HCl, pH 8.0, and 1 mM EDTA, pH 8.0.
2.4. Isolation 1. 2. 3. 4. 5. 6.
of DNA for PCR
Squash buffer: IO mA4 Trts-HCl, 1 mM EDTA, 50 mMNaC1, pH 8 2. Teflon pestle and sterile 1 5-mL microcentrifuge tubes. Glassmilk SpmBuffer (from an RPM kit, Bio 101, La Jolla, CA). RPM Spinfilters. Solution of 70% ethanol and 100 mMNaC1. Filter sterilized TE buffer: 10 mM Tris-HCl, pH 7.6, 1 mA4 EDTA at pH 8.0.
3. Methods 3.1. Rapid Zsolation of Total DNA from Zndividual Insects for Restriction Digestion This technique is based on one first published for Drosophila although apparently it was used for other organisms previously.
(I),
1. Put 1mosquito mto a microfuge tube or microhomogemzer with 100 pL of homogenization buffer and 25 pL of lysis buffer. Adjust volume up or down for larger or smaller quantities or organisms but keep the total volume under 500 PL for a 1.5-mL tube. 2. Grmd flies (see Note 1). 3. Incubate at 65°C for 30 mm (see Note 2). 4. Add 17 pL of 8Mpotassmm acetate, vortex, spin briefly, and put on ice for at least 30 min (overnight in refrigerator is best) (see Note 3). 5. Spm in a refrigerated mrcrofuge at maximum speed for I5 min and transfer supernatant to a clean tube (see Note 4). 6. Add 400 PL of 95% ethanol;spin down the nucletc acids m microfuge for 5 min at 12,000g (see Note 5). 7. Pour off the supernatant and refill the tube with 70% ethanol. Vortex until the pellet comes off of the side of the tube. Spin for 10 s.Repeat (see Note 6). 8. Air dry the pellet and dtssolve in 85 uL of TE; add RNase A to 1 pg/mL (see Note 7).
18
Cockburn and Fritz
Purification of Total DNA for Genomic Libraries This procedure is a larger scale adaptation of the method outlined in Section 3.1. 3.2. Large-Scale
1. Powder 1 g of frozen insects m a mortar and pestle at -55°C or below (see Note 8). 2. Pour the ground insects mto 100 mL of ice-cold homogenization buffer and homogenize on Ice for a few strokes in a dounce type homogenizer so that the material is thoroughly suspended. It is convenient to transfer the mixture to a 500-mL plastic centrifuge bottle at this stage (see Note 9). 3. Vigorously squirt m 25 mL of lysls buffer using a 60-mL syringe and add about 1 mg protemase K. Incubate at 55°C for 1 h. 4. Add 17 mL of 8M potassium acetate. Mix gently by mvertmg the bottle. Leave on ice for 1 h 5. Spm at 12,000g for 10 min m a refrigerated centrifuge. Carefully remove the supernatant to a clean bottle. 6. Add 250 mL of 95% ethanol. Mix gently by inverting the bottle. Leave on ice for 1 h (see Note 10). 7. Spm 12,OOOgfor 10 min in a refrigerated centrifuge. Pour off the supernatant carefully so as not to disturb the nucleic acid pellet. 8. Add about 200 mL of 70% ethanol and shake vigorously. Spm at 12,OOOg for 5 min in a refrigerated centrifuge. Pour off supematant and allow pellet to air dry. 9. Dissolve pellet m 8 mL of TE. Add 0.5 mL of 20% sodium lauryl sarcosinate if the pellet is difficult to dissolve. Add 1 g CsCl/mL of solution, 0.5 mL of 10 mg/mL ethidium bromide and transfer to an ultracentrifuge tube (see Note 11). Spin at 120,OOOgfor 40 h at 20°C. 10. Remove the DNA band under ultraviolet light into a 30 mL screwcap centrifuge tube. Add 2 vol of water and extract with water-saturated butanol. Repeat extractions until the butanol phase is clear (see Note 12). I 1. Add 1vol of buffer-saturated phenol and mix gently. Spin 12,000g for 10 mm at room temperature. Remove the top aqueous phase and discard the phenol, 12. Fill the tube with water-saturated diethyl ether and mix gently. Pipet off the top ether phase and discard. Repeat, 13. Add 2 vols of 95% ethanol, mix gently. Spm at 12,000g for 10 min at room temperature. 14. Fill the tube with 70% ethanol and shake vigorously. Spin at 12,OOOgfor 5 min at room temperature. Pour off the supematant and repeat twice. Allow pellet to air dry. 15. Dissolve in 1 mL of TE.
Insect DNA
19
3.3. Isolation of Afitochondrial DNA This procedure is designed to purify mitochondria and then isolate the closed circular mitochondrial DNA molecules. Frequently, a mitochondrial DNA band will be visible below the chromosomal DNA band on the CsCl gradient in the previous procedure. It may be considerably easier and more efficient to simply use that procedure rather than go to the trouble of isolating mitochondria. In mosquitoes, and perhaps some other insects, most of the mitochondrial DNA is isolated as linear or open circular molecules. This procedure will not work well for mosquito mitochondrial DNA. It is possible to isolate small quantities of mosquito mitochondrial DNA by electrophoresis of total DNA on a 0.8% agarose gel. The open circular form migrates more slowly than the linear chromosomal DNA and can be visualized as a single sharp band near the origin. 1. Homogenize 2 g of live (not frozen) insects in 100 mL of homogemzatlon buffer on ice. Use at least 20 strokes in a dounce homogenizer. 2. Centrifuge at 16OOgfor 5 min at 4°C to remove cuticle. Decant supernatant to a new bottle. 3. Centrifuge at I6009 for 10 mm at 4OCto pellet nuclei. Decant supernatant to a new bottle. 4. Centrifuge at 17,000g for 30 min at 4°C to pellet mitochondria. Discard supernatant. 5. Resuspend mitochondrlal pellet m 25 mL of homogenization buffer. 6. Centritige at 16OOgfor 10 min at 4°C to pellet remaining nuclei. Decant supernatant to a 30-mL screwcap centrifuge tube. 7. Centrifuge at 40,OOOgfor 10 min at 4’C. Discard supernatant. 8. Resuspend in 8 mL of homogenization buffer. Add 0.5 mL of 20% sodium lauryl sarcosinate, 8.5 g CsCl, and 0.5 mL of 10 mg/mL ethidium bromide. 9. Load sample into ultracentrifuge tube and spin at 120,OOOgfor 40 h at 20°C. Remove upper chromosomal DNA band first and then remove lower mitochondrial DNA band (see Note 13). 10. Add 1 vol of water and extract with water-saturated butanol until the butanol phase IS clear. 11. Add 1 vol buffer-saturated phenol and mix gently. Spin at 12,000g for 10 min at room temperature. Remove the top aqueous phase and discard phenol. 12. Fill the tube with water-saturated diethyl ether and mix gently. Pipet off top ether phase and discard. Repeat. 13. Add 2 vols of 95% ethanol, mix gently. Spin 12,OOOgfor 10 mm at room temperature.
Cockburn
and Fritz
14. Fill tube with 70% ethanol and shake vigorously. Spin at 12,OOOgfor 5 min at room temperature.Pour off supernatantand repeattwice. Allow pellet to air dry. 15. Dissolve in 25 pL of TE. 3.4. Isolation of DNA from Fresh, Dried, and Ancient Insects
for
PCR
The DNA isolated from amber-preserved and desiccated insects is typically fragmented into small molecular sizes (in the range of a few hundred basepairs) owing to degradation by hydrolytic processes prior to desiccation or preservation, and subsequent oxidation. Considerable degradation of DNA can be expected for amber-preserved insects, since these have been entombed for millions of years. Since relatively small fragments of DNA and low cloning efficiency of greatly modified DNA make it difficult to isolate genes from ancient or dried samples, DNA from these sources is normally only suitable for PCR amplification (2). Even PCR amplification, though, is usually limited to small fragment sizes in the range 100-200 bp (3). In addition, successful PCR amplification of DNA from ancient or dried specimens has been limited to fragments of genes with high copy number per cell (e.g., mtDNA and rDNA), suggesting that copy number is responsible in a probabilistic way for the survival and retrieval of these genes. The following procedure for the isolation of DNA from dried or ancient specimens is recommended for subsequent fragment amplification by PCR. In general, fresh insect specimens can be prepared for PCR by simply squashing all or a part of an individual in 100 pL of squash buffer (see Materials). Samples are then boiled for 5 min, and 4-5 pL are used in each 100~p.L amplification reaction. 3.4.1. Preparation of Dried Museum Specimens (2)
1. Macerate(underasepticconditions) approx 5-10 mg of insect tissue(preferably thoracic tissue) m a 1.5-mL microcentrlfuge tube with a Teflon pestle (seeNote 14). 2. Suspendthe maceratedtissue in 300 pL of Glassmilk SpinBuffer and go to Se&on 3.4.2., step3 (seeNote 15).
Insect DNA
21
3.4.2. Preparation of Amber-Entombed Specimens (2) 1. Extract the tissue (surface sterilize amber and crack to remove the tissue from the specimen). 2. Suspend the extracted material in 300 pL of Glassmilk SpmBuffer (see Note 15). 3. Place the tube in a shaker and incubate at 55°C for 60 min. 4. Transfer the samples to RPM Spmfilters and centrifuge at 16,000g for 1mm. 5. Wash the Glassmilk twice with 500 pL of a solution containing 70% ethanol and 100 rnJ4 NaCl. 6. Elute the DNA bound to the Glassmilk by adding 50 pL of filter-sterilized TE buffer and centrifuging at 16,000g for 1 min. 7. The filtrate containing the DNA can be stored at -2OOC until needed. The DNA concentration of the filtrate can be estimated by absorbance at 260 nm. 8. DNA recovery can be expected to be m range of 2.5 ng/mL for amberpreserved specimens to 11.2 ng/mL for dried museum specimens. 3.4.3. Preservation of Insects for DNA Studies Store insects in a solution of 0.25M EDTA, 2.5% (w/v) SDS, 0.5M Tris, pH 9.2 at room temperature. Note that this is one of the solutions used in rapid isolation of total DNA (see Note 16).
4. Notes 1. Thorough grmdmg 1s cntical. Different stages and species have different contaminants which may or may not interfere with subsequent use of the DNA (e.g., DNA/enzyme reactions). Mosquito pupae and fly adults are good stages to use. We make our own homogenizers in mlcrofuge tubes. We pour about 200 pL of epoxy or other resin (electron microscope resin is the best) mto a mlcrofuge tube. Into this we insert the end of a dissecting pm. When the resin hardens, the dissecting pin forms a handle for the homogenizer. Since every brand of tube is slightly different in shape, this is the only way to be sure of obtaining a homogenizer that properly fits your tubes. 2. The exact temperature of step 3 is not important. Heatmg the tubes allows the detergent to thoroughly solubllize the protein. 3. The high K+ concentration in step 4 precipitates the detergent/protein complex. 4. Step 5 is critical. Care should be taken not to disturb the rather loose pellet of protein/SDS/cuticle. It IS always better to leave a little of the supernatant than to get SDS into the DNA preparation.
22
Cockburn
and Fritz
5. In step 6, more DNA can be recovered by ethanol precipitation at 4OCthan other temperatures. 6. Step 7 removes residual SDS, EDTA, and salts from the nucleic acid pellet. 7. The final crude pellet of DNA in step 7 contains many contaminants, but the one that is most likely to interfere with DNA modifying enzymes is RNA. Many of the pigments found in insects copurify with the nucleic acids, so it is not unusual to get yellow, red, purple, or black solutions. Generally, these contaminants do not Interfere with restriction digestion. 8. We store our mortars and pestles in our ultralow freezer. This eliminates the need to use dry ice or liquid mtrogen to cool the mortar. 9. In step 2, it IS important that the insects be completely powdered and suspended and the lysrs buffer be added quickly at once so that all of the tissue is exposed to SDS at the same time. Once the cells and nuclei have lysed and released the chromosomal DNA, the solution becomes so vtscous that little mixing can occur. 10. A large amount of white flocculent prectpitate should be observed at step 6. Because of the large quantity of nucleic acids present, it is not usually helpful to precipitate overnight. 11. The density of the CsCl solution should be about 1.5 g/mL. CsCl forms a gradient when it is centrifuged at high speed, and the DNA bands at the region in the gradient corresponding to its own density. The addition of ethidmm bromide makes this about 1.5 g/mL for linear DNA. 12. Butanol extraction is used to remove the ethrdium bromide. Phenol extraction removes any proteins that have remained bound to the DNA. Ether extraction removes residual phenol, and any remaining ether evaporates while drying the ethanol pellet. 13. The closed circular mitochondrial DNA molecules cannot bind as much ethidmm bromide as linear DNA, so it bands at a lower (denser) position on the CsCl gradient. Because the linear nuclear DNA is extremely viscous, it is important to remove the upper band first. Otherwise, the upper band will probably be sucked up with the mitochondrial band. 14. Since PCR is extremely sensitive to contammatmg DNA, all materials and solutions should be handled under aseptic conditions. Control extracts and multiple independent extracts of the specimen under study should be done in order to detect contamination. In addition, the possibihty of contamination can often be determined by comparing an obtained DNA sequence to the DNA sequences of other closely related species or taxa. 15, It has been shown that amplifiable DNA can be extracted by the Chelex R 100 extraction method (4). The DNA extracted by that method degrades after 2-3 wk of storage at -2OOC and can no longer be amphfied. DNA extracted with Glassmilk SpinBuffer, however, has been stored for at least
Insect DNA
23
60 days at -20°C without significant degradation (2). Repeated freezing and thawing of samples should be avoided to Increase their shelf hfe. 16. Several methods of preservation have been used for insects destined for DNA studies: preservation in ethanol (5), by drying (6), m isopropanol (F. Collins, personal communication, 1990), and in detergent/EDTA/proteinase (Jose Ramuez, personal communicatton, 1993). We have tested specimen preservation at 37OC with different concentrations of alcohol, lysis buffer, CaC12, 10% LaFrance laundry stain remover (contains protemase), and a solutton of 0,25MEDTA, 2.5% (w/v) SDS, 0,5MTris-HCI, pH 9.2. By far the most effective treatment was the EDTA/SDS/Tris solution. Unlike ethanol and isopropanol, the EDTA/SDS/Tris solutton is nonvolatile, nonflammable, and nontoxtc. Even after 1yr at 37°C we were still able to isolate DNA >5 kb m length. In our experience, neither drying nor preservation m alcohol has been effective for storing periods of more than a few days without damaging the DNA substanttally. However, isopropanol preservation of dried specimens has been claimed to be as effective as freezing at-70°C (7). Mosquitoes are relatively small and elongate insects, though, so the penetration of preservative to most tissues should be rapid. Larger and more compact insects such as honeybees may be more difficult to preserve (see Chapter 24). References 1. Livak, K. J. (1984) Organization and mapping of a sequenceon the Drosophzlu melanogaster X and Y chromosomesthat is transcribed during spermatogenesis. Genetzcs 107, 61 l-634.
2 Cano, R. J and Poinar, H N. (1993) Rapid isolation of DNA from fossil and museumspecimenssuitable for PCR. Bzotechnzques 15,432-436. 3. Paabo, S. (1989) Ancient DNA: extraction, characterization,molecular cloning, and enzymaticamplification. Proc. Nat1 Acad. Scz USA 86, 1939-1943. 4. Cano, R. J., Pomar,H , Pieniazek,N., Acra, A., andPomar,G. O., Jr. (1993) Amphfication and sequencingof DNA from a 120-135 million year old weevil. Nature 3,536-539. 5.
Cockburn, A. F. and Seawright, J. A. (1988) Techntques for mttochondnal and ribosomal DNA analysisof anopheline mosquitoes.J Am Mosq. Control Assoc.
6.
Collins, F H., Mehaffey, P C., Rasmussen,M. O., Brandlmg-Bennett, A. D , Odera,J. S.,andFmnerty, V. (1988) Comparison of DNA-probe and lsozyme meth-
3,261-265.
ods for differentiating
Anopheles gambzae and Anopheles arabzenszs (Diptera:
Cuhcidae).J Med. Entomol. 25, 116-120. 7. Copeland, R. S., Koros, J., Ouko, M., Taylor, K. A , and Roberts, C. R. (1992) Sensitivity of a rlbosomal RNA gene probe for ldentlficatlon of life stages of Anopheles arabzensis and An gambiae (Diptera:Culicidae) using three storage methods J Med Entomol. 29,361-363.
CHAPTER3
Isolation and Purification of Vertebrate DNAs David
T. Bilton
and
Maarit
Jaarola
1. Introduction Isolation of DNA from surrounding tissues is a crucial initial step in any molecular biological investigation of organisms. DNA in cells is complexed with numerous proteins and exists in an environment saturated with a whole host of other biomolecules. This chapter presents two alternative methods for the isolation of total cellular DNA from vertebrate tissues. Method 1 is a variation on the standard phenol extraction procedure (I), which is still the most widely used technique for obtaining DNA from animal tissue. Method 2 relies on the use of a saturated salt solution and avoids the need to handle hazardous phenol preparations. Both are suitable for a whole range of vertebrate tissues and provide DNA suitable for most commonly used further manipulations, including cloning and library construction, polymerase chain reaction (PCR) (of both nuclear and mitochondrial regions), multilocus fingerprinting, and analysis of particular genes and gene families (e.g., ribosoma1 DNA) through restriction enzyme digestion and Southern blotting, Also included is a protocol that relies on boiling in the presence of Chelex resin to provide DNA suitable for use directly in PCR analysis (2). This procedure has proved useful when dealing with very small quantities of starting material, in forensics, for example, and is relatively quick and easy to perform. The method given for the isolation of purified mitochondrial DNA relies on differential centrifugation of intact mitochonFrom
Methods Nuclerc
m Molecular Acd Methods
Biology, Edlted
Vol. 50: Speaes by J P Clapp 25
Diagnostics Protocols’ PCR and Other Humana Press Inc , Totowa, NJ
Bilton and Jaarola
26
dria followed by phenol extraction and is a modification of that given by Powell and Zuniga (3) and Jones et al. (4). The technique avoids the use of lengthy ultracentrifugation procedures (5) and expensive cesium chloride gradients, and can provide mitochondrial DNA of sufficient quantity and purity for use in restriction fragment length polymorphism studies using the sensitive silver-staining visualization technique (6,7). Tissue choice and storage are crucial considerattons in any study, and these are considered in the Notes section. 2. Materials Unless otherwise stated, all solutions and stocks should be prepared using ultrapure molecular biology grade chemicals and double-distilled and deionized water. Glassware and other handling equipment should be autoclaved before use, and gloves worn to avoid contamination. Filtration of distilled water and solutions is best carried out using 0.2~pm sterile disposable filters supplied in holders that fit on the tip of a syringe (e.g., Schleicher and Schuell GmbH, Dassel, Germany).
2.1. Phenol:Chloroform:Isoamyl Extraction
Alcohol
of DNA
1. Extraction buffer: 10 mM EDTA, 10 m&I Tns-HCl, pH 8.0, 0.5% sodium dodecyl sulfate (SDS). Prepare from autoclaved stocks of 1M Trts-HCl, pH 8.0 (see Note 1) and 0.5M EDTA using sterile distilled water. Add SDS as powder (w/v). Store at 4°C or as 50-mL aliquots at room temperature for up to 3 mo. Ensure refrigerated stocks reach room temperature before use 2. Protemase K: Dtssolve lyophihzed proteinase K to a final concentration of 10 mg/mL in filtered distilled water. Split into 500~PL aliquots in sterile microcentrifuge tubes and store at -20°C. Aliquots should remain stable for long periods, and can be repeatedlyfreeze-thawedwithout significant loss of activity (see Note 2). 3. Phenol:chloroform:isoamyl alcohol: Mix in 25:24: 1 ratio. Saturate with 10 m&I Trts-HCl, pH 8.0 1 mM EDTA. Available ready prepared from a number of suppliers (e.g., Sigma, Poole, Dorset, UK). Store as 50-mL aliquots at -20°C, which are thawed individually, and retained in foilwrapped tubes(light sensitive) at 4°C when in use (stablefor up to 1 mo). Note: Phenol causes severe burns and may be mutagenic. Handle with extreme care, and carry out all steps using this reagent in a fume hood. 4. Chloroform: Store at room temperature under filtered distilled water to guard against evaporation. Keep in fume hood and avoid rubber seals on storage vials, since these are corroded by this solvent.
Vertebrate DNAs 5. 6. 7. 8.
27
Absolute isopropanol(99.7% minimum). 70% Ethanol: 70% (v/v) absolute ethanol/sterile drstilled water. 5M ammonium acetate: Sterilize by filtration. TE buffer: 10 rmI4 Tris-HCI, pH 8.0, 1 mA4 EDTA. Made up from autoclaved stocks of lMTris-HCI and O.SMEDTA using sterile distilled water. Store at 4°C or room temperature.
2.2. Salt Extraction
of DNA
1. Extractron buffer: 3MNaC1, 0,4MTris-HCl, pH 7.8,20 WEDTA. Made up from autoclaved stocks of 5M NaCl, 2M Tris-HCI, pH 8.0 and 0.5M EDTA and sterile distilled water. Store at 4°C. 2. 25% SDS: Made wrth solid SDS (w/v) and filtered distilled water. Store at room temperature. 3. Proteinase K: Drssolve lyophilized proteinase K to a frnal concentration of 10 mg/mL in filtered distilled water. Split into 500~PL ahquots m sterile microcentrifuge tubes and store at -20°C. Aliquots should remain stable for long periods, and can be repeatedly freeze-thawed without srgmficant loss of activity (see Note 2). 4. Saturated sodium chloride: 6M NaCl solutron made with sterile drstrlled water. Autoclave and store at 4°C. 5. Chloroform: Store at room temperature under filtered distilled water to guard against evaporation. Keep m fume hood and avoid rubber seals on storage vials, since these are corroded by this solvent. 6. Absolute ethanol (99.7% minimum): Store at -20°C since ice-cold liquid will be required. 7. 70% Ethanol: 70% (v/v) absolute ethanol/sterile distilled water 8. Trrs buffer: 10 mM Tris-HCI, pH 8.0. Prepared from autoclaved stock of lMTris-HCl, pH 8.0, and sterrle distilled water. 9. TE buffer: 10 m&I Tris-HCI, pH 8.0, 1 mM EDTA. Made up from autoclaved stocks of IMTris-HC1 and O.SMEDTA using sterile distilled water. Store at 4OC or room temperature.
2.3. Chelex Extraction for use in PCR porn Blood
of DNA and Tissues
1. Sterile distilled water. 2. Chelex resin: 5% (w/v) Chelex 100 resin, biotechnology grade (BioRad Laboratories, Hemel Hempstead, Hertfordshire, UK), suspended in sterile distilled water. Before use on a set of samples, pour slightly more than the required volume of Chelex into a beaker and mix on a magnetic stirrer. The Chelex should be taken directly from the beaker whrle mixmg is occurring.
Bilton and Jaarola
28 2.4. Phenol Extraction of MitocAondriaZ DNA
1. Sterile distilled water. 2. Homogenizing buffer: 50 miI4 Tris-HCl, pH 7.4, 2.5 mM CaC12,70 n-&I sucrose,200 mMmannito1. Made up from stock solutton of 0.5MTris-HCI, pH 7.4, sterile disttlled water, and solid sucrose, manmtol, and calcmm chloride. This can be stored for up to 1 wk at 4°C. For longer pet-rods store at -20°C. 3. EDTA: 200 n~I4 solution, Store at 4°C. 4. Lysts buffer: 10 n&I Trts-HCI, pH 8.0, 10 nnI4 EDTA, OSM NaAc, 0.5% (w/v) sarkosyl (iV-Laurosarcosme, sodium salt [Sigma]), made up from stock solution of 0.5M Tris-HCI, pH 8.0, sterile disttlled water, and solid sodium acetate, EDTA, and 25% sarkosyl. Store at 4°C. 5. RNase A: 20 mg/mL RNase A m 100 mA4NaAc (adjusted to pH 4.5 with glacial acetic acid). 6. Phenol: Equilibrated with 10 mM Tris-HCl, pH 8.0, 1 miU EDTA. Add an equal volume of buffer to the hqutfied phenol and stir on a magnettc stirrer for 15 min. After turning off the stirrer, the two phases should begin to separate. When this has occurred remove as much as possible of the upper aqueous layer using a ptpet. Repeat this process until the pH of the phenolic phase is seen to be >7.8 using pH papers. After removal of the final aqueous phase add 0. I vol buffer. Store as aliquots at -20°C or for up to 1 mo at 4°C in a foil-wrapped tube (light sensitive). Note: Phenol causes severe burns and may be mutagenic. Handle with extreme care, and carry out all steps using this reagent in a fume hood. 7. Phenol:chloroform:isoamyl alcohol: Mix in 10:9.55:0.45 ratio. Saturate with 10 nnI4 Tris-HCI, pH 8.0, 1 mM EDTA. Prepare just before extraction is about to commence. Shake the required volumes together in a tube and allow to stand for approx 30 min until an aqueous layer has appeared on the surface and the organic layer IS clear. Make up fresh each day. Note: Phenol causes severe burns and may be mutagenic. Handle with extreme care, and carry out all steps using this reagent in a fume hood. 8. Chloroform: Store at room temperature under filtered distilled water to guard against evaporation. Keep in fume hood and avoid rubber seals on storage vials, since these are corroded by this solvent. 9. Absolute ethanol: 99.7% minimum. 10. Isopropanol: 99.7% pure reagent.
29
Vertebrate DNAs 3. Methods 3.1. Phenol:Chloroform:Isoamyl Extraction of DNA
Alcohol
1. Take 25-50 mg of tissue (see Note 3) and place in clean weighboat on ice. Chop finely using sterile mounted razor blade or scalpel with fresh disposable blade. 2. Transfer chopped tissue to a 1.5mL mrcrocentrifuge tube containing 750 p.L of extraction buffer. 3. Add 20 pL proteinase K solution, and mix by gentle inversion. 4. Incubate samples at 55°C for at least 3 h or overnight (see Note 4). 5. Following proteinase digestion, transfer tubes to bench and add 750 pL phenol:chloroform:rsoamyl alcohol. 6. Gently mix the contents of the tube until an emulsion forms. Two to five min mixing by hand will normally suffice (see Note 5). 7. Centrifuge the mixture for 30 mm at 13,000g in a benchtop microcentrifuge. 8. Carefully pipet off the upper aqueous layer and transfer to a fresh 1.5-mL microcentrifuge tube (see Note 6). 9. Repeat steps 5-8 (see Note 7). 10. Add 750 pL chloroform to each sample (see Note 8). Il. Mix by gentle inversion until an emulsion forms. 12. Spin at 13,OOOgfor 10 min in a benchtop mrcrofuge. 13. Pipet off the upper aqueous layer and transfer to fresh 1.5-mL microcentritige tube. 14. Add 75 uL 5M ammonium acetate and 750 uL absolute isopropanol to each sample. 15. Stand on ice for 30 min to allow DNA to precipitate. 16. Centrifuge at 13,000g for 30 min in benchtop microfuge (see Note 9). 17. Carefully pour liquid from tube, ensuring that the nucleic acid pellet in the bottom is not dislodged. 18. Add 500 pL 70% ethanol and mix by gentle inversion. 19. Centrifuge for 30 s at 13,000g in benchtop mrcrofuge. 20. Repeat step 17, this time touching the mouth of the inverted tube on a clean tissue in order to aid the removal of liquid via capillary action. 2 1. Dry pellet for 5-10 min in a speedvac or hotblock at 60°C (see Note IO). 22. Redissolve pellet in 100 pL TE buffer. To ensure this occurs completely it is best to allow the samples to stand overnight at 4°C. 23. Quantify nucleic acids by running an aliquot on a gel or by ultraviolet spectrophotometry (see Notes 11 and 12).
Bilton and Jaarola
30 3.2. Salt Extraction
1. 2. 3. 4. 5. 6.
of DNA Take approx 50 mg of tissue (see Note 3) and place m clean weighboat on ice. Chop finely using a sterile mounted razor blade or scalpel with fresh disposable blade. Transfer chopped tissue to a 1.5-mL microcentrifuge tube containing 400 pL of extraction buffer. Add 20 pL proteinase K and 10 pL 25% SDS and mix by gentle hand inversion. Incubate the mixture for at least 3 h or overnight at 55OC (see Note 4). Add 250 pL saturated NaCl and shake the tube by hand. Add 650 pL chloroform and mix by gentle inversion until an emulsion forms (see Note 5).
7. Spin at 13,000g for 30 min in a benchtop microcentrifuge. 8. Carefully remove the upper aqueous layer and transfer to a fresh 1.5-mL microcentrifuge tube (see Note 6). 9. Add 100 nL Tris buffer and 750 nL ice-cold absolute ethanol. 10. Stand samples on ice for 30 min to allow nucleic acid precipitation. 11. Spin at 13,000g for 30 min in a benchtop microcentifuge (see Note 9). 12. Carefully pour off the liquid in each tube, ensurmg that the nucleic acid pellet in the bottom is not dislodged. 13. Add 500 pL 70% ethanol and mix by gentle inversion. 14. Centrifuge for 30 s at 13,000g in a benchtop microfuge. 15. Repeat step 12, this time touchmg the mouth of the inverted tube on a clean tissue in order to aid the removal of liquid via capillary action. 16. Dry pellet for 5-10 min in a speedvac or hotblock at 60°C (see Note 10). 17. Redissolve pellet in 100 pL TE buffer. To ensure that this occurs completely, it is best to allow the samples to stand overnight at 4°C. 18. Quantify nucleic acids by running an aliquot on a gel or by ultraviolet spectrophotometry (see Notes 11 and 12).
3.3. Chelex Extraction of DNA for Use in PCR from Blood and Tissues 1. Pipet 1 mL of sterile distilled water into a graduated 1.5-mL microcentrifuge tube. 2. If using blood, add 3 uL whole blood. Proceed to step 4. 3. If using tissue (see Note 3), add approx 10 mg tissue, and homogenize m the tube using a disposable hand-held pestle (e.g., Disposable Polypropylene Pellet Pestle, Anachem Ltd., Luton, Bedfordshire, UK). Tissue should be broken up until few or no solid lumps remain, and the distilled water is colored.
Vertebrate DNAs
31
4. Incubate on the bench at room temperature for 15-30 mm, mixing occasionally by inversion. 5. Spin for 3 min at 13,OOOgin a benchtop microcentrifuge. 6. Pipet off and discard the supernatant, taking care not to disturb the pellet. 7. Add 5% Chelex resin using a wide-bore pipet tip (e.g., 1 mL, Gilson, Paris) until the total volume m the tube is approx 200 uL. 8. Place in a water bath at 56°C for 15-30 min. 9. Vortex at full speed for 10 s. 10. Incubate in a beaker of boiling water for 7 min. 11. Vortex at full speed for 10 s. 12. Spin for 3 min at 13,000g in a benchtop microcentrrfuge. 13. The sample can now be used for PCR amplification of the target DNA sequence. Ten to twenty microliters of the supernatant should be added to each 100~pL PCR reaction. The remainder of the sample can be stored frozen (-20°C) and reused by going through steps 1l-1 3 on each occasion.
1. 2. 3. 4.
5. 6. 7. 8. 9. 10. 11.
3.4. Phenol Extraction ofMitochondria1 DNA Wash 0.2-l g of tissue (see Note 13) m chilled (4OC) sterile distilled water in a clean beaker to remove blood and fatty deposits. Place in a new beaker and wash with chilled homogenizing buffer. Transfer to a fresh beaker and chop finely with clean scissors. Place tissue m homogenizing tube containing 10 mL of prechilled homogenizing buffer and stand on ice. Homogenize tissue using motor driven glass Teflon homogenizer using the minimum number of strokes necessary to break up the sample at low speed (15&200 rpm) (see Note 14). Add 600 pL EDTA after homogenization of each sample. Transfer samplesto large perspex Beckman tubes and add 5 mL homogenizing buffer and 750 pL EDTA. Check that the various tubes balance, and if necessary add further homogenizing buffer until their weights are identical. Spin in a precooled (4°C) refrigerated centrifuge for 6-7 mm at 1OOOgto pellet nuclei and cell debris. Pipet off the supernatant into a clean Beckman tube on ice. (Steps 8-10 can be excluded; see Note 15.) Resuspend the nuclear pellet in 5 mL homogenizing buffer and 300 pL EDTA. Mix using a glasspipet whose tip hasbeen rounded using a bunsen flame, or alternatively vortex very gently. Repeat step 6 with the resuspended nuclear pellet. Pipet off the supernatant, add this to the supernatant obtained in step 7. Repeat steps 6 and 7, but spin at I 1OOg.
32
Bilton
and Jaarola
12. Once agam ensure that the tubes balance and if necessaryadd more homogemzmg buffer, before spinning at 12,000g and 4°C for 20 mm (or 9OOOg for 60-90 mm) to pellet the mitochondria. 13, Discard the supernatant and wash the mitochondrial pellet by resuspension m 5 mL homogenizing buffer and 300 pL EDTA (see Note 16). 14. Repeat step 12. 15. Discard the supernatant and resuspend the mltochondrral pellet m 1 mL lysis buffer. MIX gently usmg a Pasteur ptpet until the suspenston IS homogeneous and no clumps of mitochondria remain. Incubate at 37°C until clear (see Note 17). 16. When step 15 is underway, boil the RNase A for 10 min to activate the enzyme 17. Add 100 PL RNase A to each sample and incubate for a further 30-60 min. 18. Transfer the samples to gel barrier tubes (e.g., SSt Tubes, Becton Dickmson, Rutherford, NJ; see Note 1S), add 1 mL phenol to each sample and shake gently for 1O-l 5 s. 19. Centrifuge at 5200g and 20°C for 10 min. 20. Pour out the upper aqueous layer to a new gel barrier tube. 2 1. Repeat steps 18-2 1. 22. Add an equal volume of phenol:chloroform:tsoamyl alcohol and mtx by mversion. 23. Spm at 4400g for 10 min, and then repeat step 20. 24. Repeat steps 22 and 23 if necessary (see Note 7). 25. Add an equal volume of chloroform and shake the tubes gently for about 30 s. 26. Spm at 3800g for 10 min. At this point two alternative routes (A or B) can be followed to complete the extraction (see Note 19). 1. 2. 3. 4. 5.
3.4.1. Version A Pour out the upper aqueous layer into an ultracentrifuge tube and add 3 vol of absolute ethanol. Cover with parafilm, mix by inversion, and store at -70°C overnight. Allow the samples to reach room temperature and mix by gentle inversion. Check that the tubes balance, and add further ethanol if necessary. Spin at 30,OOOgand 20°C for 30 mm to precipitate the mttochondrial DNA. Prpet off the liquid and touch the rim of an upturned tube on a clean tissue to aid removal via capillary action. Take care that the pellet does not become loose. Dry samples in a vacuum drier for about 5 min (see Note 10). Redissolve pellet m sterile distilled water (30-50 pL/g tissue) and transfer to a clean 1.5-mL microcentrtfuge tube. Store at -70°C until required (see Note 20).
Vertebrate
DNAs
33
3.4.2. Version B 1. Pour out the upper aqueous layer into a clean I .5-mL microcentrifuge tube, and add 0.7 vol isopropanol to precipitate the mitochondrial DNA. 2. Spin at 4°C and 15,000g (or more!) for 30 min. 3. Remove the supernatant with a pipet and wash the mitochondrial pellet by resuspendmg m 1 niL 70% ethanol. Shake gently to dissolve the pellet. 4. Repeat step 2. 5. Remove ethanol wtth a ptpet and touch the rim of the upturned tube on a clean tissue to aid liquid removal via capillary action. Take care that the pellet does not become loose. Air dry the pellet for about 10 min. 6. Redissolve the pellet in sterile distilled water (30-50 pL/g tissue) and transfer to a clean 1.5-mL microcentrrfuge tube. Store at -70°C until required (see Note 20). 4. Notes 1. Buffers: To make buffered Tris solutions dissolve the required weight of Trts base in half the final volume of sterile distilled water, and bring to pH with 5N HCI. Add extra disttlled water to make up to required volume. Remember that EDTA will not enter solution appreciably at pHs less than 8.0, and must be brought to pH 8 m a similar way, using 5M NaOH on a magnetic stirrer. 2. Proteinase K stability (through freeze/thaw cycles) has been reported to be increased dramatically by storage in a buffer containing Tris-HCl, pH 7.5, calcium tons and glycerol (8) Gibco BRL (Paisley, Scotland) now supply this enzyme directly in such a form. 3. Tissues and their storage prior to use: DNA can be readily extracted from almost any solid vertebrate tissue by phenol:chloroform:isoamyl alcohol or salt extraction. Parttcularly good sources of DNA are heart, kidney, brain, and skeletal muscle. Liver is also a good choice, although some difficulties may be encountered in obtaining high yields of high molecular wetght DNA. Small portions of tissue such as fish scales and fin clippings (J. Kemp, personal communication, 1994) and small mammal toenail clippings will yield appreciable quantities of DNA for manipulation, in some cases sufficient for techniques such as multilocus DNA fingerprinting (‘9). Typical yields of DNA are in the order of 800 pg/lOO mg of tissue. Fresh tissue is obviously the best choice for obtaining maximum yields of high molecular weight DNA. Tissues stored at -70°C are also excellent, and DNA can be extracted successfully from material stored at higher temperatures (e.g., -20°C) for relatrvely short periods (<3 mo). Ttssue samples can also readily be preserved in absolute ethanol, the key here bemg to ensure that the fixative penetrates the tissues rapidly. With small samples,
34
4.
5.
6. 7.
8.
9. 10.
Bilton and Jaarola such as mammalian tail clippings, this presents no problems, but solid tissue blocks such as whole organs or organ fragments should be minced first with clean scissors. DNA obtained from tissues stored m ethanol is typically not as high molecular weight as that from fresh or -70°C frozen tissues, but is stall eminently suitable for PCR analysis. In addition, a number of buffers have been developed to allow tissue storage under field conditions (10). Dry preserved museum skins have also yielded DNA for PCR (1I), as have a number of fossil samples (12). The treatment of such matertal is beyond the scope of this chapter, and the reader 1sinstead referred to the aforementioned references and refs. 13 and 14. The amount of time required for tissue digestion with proteinase K depends on the nature of the sample under study. In general, fresh or frozen soft tissues such as heart muscle, kidney, or liver will usually be fully digested within a few hours. Tissues fixed in ethanol, or those containing a much higher percentage of connective tissues and cartilage such as mammal tail clippings are best given a longer overnight digestion. Samples can be left incubating with protemase K for longer periods (2-3 d) wtth no appreciable change to the yield of DNA observed. Overvigorous mixmg of the tube contents at this stage can lead to extensive shearmg of high molecular weight DNA. This may not be a problem if the sample is solely to be used for PCR amplification, but is obviously to be avoided if other applications such as restrtction digestion or the construction of genomic libraries are planned. During this step take particular care to avoid collecting any white proteinaceous material that may have collected at the interface between the aqueous and organic layers. Phenol:chloroform:isoamyl alcohol extractions should be repeated until little or no white protein maternal is visible at the interface between the two layers following centrifitgation. In practice two to three extractions (one to two for mitochondrial DNA; Protocol 4) will usually suffice, but if in doubt a further extraction can only enhance the purity of the nucleic acid sample. When ptpetmg chloroform it is often noticed that the liquid will drip out of a clean Gilson tip. Thts is probably owing to the solvent bemg repelled by the electrostatic charges present on the tips, and can easily be avoided by first taking up and expelling the required volume of chloroform each time a new tip is used. It is a good Idea to place all tubes at the same alignment within the centrifuge rotor (e.g., with the tube hinge facing outwards). This enables the position of the nucleic acid pellet to be more readily identified. Overdrymg the pellet makesit more difficult to get back into solution.As a general rule the pellet should still appearslightly translucent,not white and flaky.
Vertebrate DNAs
35
Il. If the sample is seen to contain a large amount of RNA (visualized as diffuse, low molecular weight staining on an agarose gel) this is best removed by digesting the sample with 6 pL 10mg/mL preboiled RNase A for 30 min at 37°C. Following this, RNase can be removed by a further round of phenol:chloroform:rsoamyl alcohol extractions. If excessive RNA is a general feature of extractions from the system under study, this digestion is best carried out routinely, immediately after proteinase K digestion. 12. Some contaminants, such as polysaccharides, may copurify with the DNA, and inhibit further manipulative steps such as PCR or restriction endonuclease digestion. A number of commercially available kits relying on ion-exchange columns or silica exist which may be useful m the further clean-up of extracted DNA (e.g., Qiagen Ltd., Dorking, Surrey). In practice, the problem of inhibitory contaminants can often be overcome by diluting the DNA sample further, or carrymg out a further ethanol precipttation step. 13. Organ tissues such as liver, heart, and ktdney and fish eggs are the best sources of mitochondrial DNA. Optimum results have been obtained with fresh material or tissues extracted from animals which have been frozen for <6 mo. Tissues from older specimens will yield pure mitochondrial DNA, providing they have been stored at -70°C. It is important, however, that the animal is frozen very soon after death. Approximately 1 g of tissue should yield m the order of 1 l.tg mitochondrial DNA. In Uppsala the protocol given here has proved sucessful on a wide variety of vertebrates including fish (Coregonus), snakes (Vzpera), birds (Ficedula), and mammals (Sorex, Mcrotus, Clethrionomys, Micromys, Mus, Myopus, Lepus, and Canis) 14. The most crucial factor m homogenizmg the tissues for mitochondrial extraction is the clearance between the pestle and the sides of the tube. This should be great enough to avoid breaking open mitochondrta at this stage, but sufficiently small to disrupt the cells. The optimum clearance appears to be in the order of 0.2 mm. The homogenization step is critical for the performance of this method; too much homogemzation will break the nuclear membranes, resultmg m contamination wtth nuclear DNA, whereas too little will result in a low yield of mitochondrial DNA. For heart, kidney, and liver two to five strokes are sufficient if the tissue has been frozen, For fresh tissue 15-30 strokes usually suffice. 15. If steps 8-10 are excluded the mitochondrial DNA samples will be considerably purer (i.e., contain less contaminating nuclear DNA), but the yield will be 25% less than if these steps are included. Exclusion of steps 8-10 is preferable if very old tissues are used, or in some cases when working with liver.
36
Bilton and Jaarola
16. The isolated mitochondria can now be stored at -70°C for up to 1 wk, but the best performance is obtained if DNA extraction is carried out immediately after isolating the mitochondria. 17. If the supernatant does not clear after about 5 mm, add 5-10 pL of 25% sarkosyl and remcubate. Repeat the step if necessary until all mitochondria are lysed and the sample is clear. Note that some samples, especially those from liver tissue, may appear milky owing to the presence of glycogen, and so on. 18. The use of gel barrier tubes (15) permits clean, rapid phenol extractions, and protects the worker from exposure to these solvents. If such tubes are unavailable, steps 18-26 can be conducted in centrifuge tubes in the normal manner for phenol extractions (see Protocol 1). 19. Of methods A and B, the second is much faster and does not require access to an ultracentrifuge. To date it has only been used on fish tissues, but apparently works as well as the more traditional method A (T. Ost, personal communication, 1994). Given this finding it is very likely to be suitable for other animal and tissue types. 20. If long storage periods (>6 mo) or many freeze/thaw cycles are envisaged it is best to store the mitochondrial DNA in 10 mM Tris-HCl, pH 8.0 Since DNA is an acid it will undergo autocatalysis in the absence of a buffering agent.
Acknowledgments We thank Torbjiirn &t, Peter Thor-en, and HBkan Tegelstriim (University of Uppsala, Sweden) for all their work in the development of Protocol 4. References 1. Sambrook, J., Fritsch, E. F , and Mamatis, T. (1989) Molecular
Clomng. A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 2 Walsh, P. S., Metzger, D. A., and Hrguchr, R (1991) Chelex8100 as a medium for simple
extraction
of DNA
for PCR-based
typing
from
forensic
material
Bzotechnzques 10,50&5 13. 3. Powell, J. R. and Zuniga, M C ( 1983) A simplified procedure for studying mtDNA polymorphisms. Bzochem Genet 21,105 l-1055 4. Jones,C. S., Tegelstrom, H , Latchman, D. S., and Berry, R J (1988) An improved rapid method for mrtochondrral DNA isolation suitable for use m the study of closely related populations Blochem Genet. 26, 83-88
5. Lansman, R. A , Shade, R O., Shapira, J. F., and Avise, J C. (1981) The use of restriction endonucleases to measure mitochondrial DNA sequence relatedness in natural populations III. Techniques and potential applications J. MoZ Evol 17, 214-220.
Vertebrate DNAs 6. Tegelstrom, H. (1986) Mitochondrial DNA m natural populations an improved routme for the screening of genettc vartatton based on sensitive silver staining. Electrophorem 7,226--230. 7. Tegelstrom, H (1992) Detection of mitochondrial DNA fragments, in Molecular Genetic Analysis ofPopulations A Practical Approach (Hoelzel, A. R., ed.), IRL, Oxford, UK, pp. 89-l 13 8. Campbell, J. and Gerard, G (1993) Protemase K stab&y. Focus l&22,23. 9 Stockley, P., Searle, J. B., MacDonald, D. W , and Jones, C S (1993) Female multiple matmg behaviour m the common shrew as a strategy to reduce mbreeding. Proc Roy Sot Lond , Serves B 254, 173-179. 10 Williams, N. A , Dixon, D R., Southward, E C., and Holland, P. W H (1993) Molecular evolution and diversification of the vestimentiferan tube worms. J Marine Blol Assoc UK 73,437-452. 11 Thomas, W. K., Paabo, S., Vtllablanca, F. X., and Wilson, A. C (1990) Spatial and temporal contmurty of kangaroo rat populations shown by sequencmg mitochondrial DNA from museum specimens. J MoZ Evol. 31, 101-I 12 12. Hagelberg, E., Thomas, M G , Cook, C. E , Jr, Sher, A V , Baryshnikov, G F., and Lister, A M. (1994) DNA from ancient mammoth bones. Nature 370,333,334 13. Pliiibo, S (1989) Ancient DNA* extraction, characterization, molecular cloning, and enzymatic amplification Proc Nat1 Acad Sci USA 86, 1939-1943 14. Hagelberg, E., Bell, L. S., Allen, T., Boyde, A., Jones, S J , and Clegg, J B. (1991) Analysts of ancient bone DNA: techniques and applications. Phllosoph Trans Roy Sot Land, Series B 333,399-407 15 Thomas, S. M., Moreno, R. F , and Tllzer, L. L (1989) DNA extraction with organic solvents m gel barrier tubes. Nucleic Acids Res 17, 5411
CHAPTER4
Statistical Analysis of Arbitrarily Primed PCR Patterns in Molecular Taxonomic Studies William
C. Black
IV
1. Introduction 1.1. Overview Two techniques have been described that use the polymerase chain reaction (PCR) to amplify many arbitrary regions of a genome simultaneously. Regions amplified by these techniques are generally polymorphic among closely related species and are beginning to be used in molecular taxonomy. In this chapter I discuss the positive and negative aspects of using arbitrary regions for taxonomy and describe strategies to adopt in overcoming some of their major disadvantages. I discuss how to set up a dataset of arbitrarily primed polymorphisms (APP) and demonstrate how cluster analysis of this dataset can be used to test marker specificity. Once an APP dataset is established, cluster analysis provides a simple means to routinely identify field collected specimens. 1.2. PCR with Arbitrary Primers Williams et al. (I) described a technique called RAPD-PCR (landom _amlification of polymorphic DNA PCR) that employs a single lo-oligonucleotide primer of random sequence but with a minimum GC content of 60%. This primer is annealed to arbitrary regions of target genomic DNA at 37°C during PCR. Welsh and McClelland (2) described a similar technique, AP-PCR (arbitrarily primed PCR), in which a single From
Methods N&WC
m Molecular Acrd Methods
Biology, Edlted
Vol 50, Sperms by J P Clapp
39
D/agnostics Protocols PCR and Other Humana Press Inc , Totowa, NJ
40
Black
long primer (e.g., the Ml 3 universal sequencing primer) is annealed at low temperatures during initial PCR cycles. Both techniques depend on the primer annealing to several complementary regions throughout a genome. With either technique the region between two primer annealing sites will be amplified if the 5’ ends of the annealing sites (or the 3’ end of the annealed primers) face one another on opposite DNA strands. Furthermore, the annealing sites must be sufficiently close that the intervening region can be amplified during routine PCR. By inference, a region amplified by either technique will be flanked by inverted repeats that are mostly complementary to the primers and are separated by no more than 2.5-3.0 kb. There are several mutations that could disrupt amplification. Point mutations in the annealing sites would prevent the primer from pairing with the target DNA at one or both sites. An inversion containing one annealing site would prevent amplification as would an insertion that increased the distance between the annealing sites beyond what can be extended with routine PCR. Presumably when one or more of these conditions occur, the PCR reaction fails and no product appears. Polymorphisms revealed by these techniques are therefore expressed as the presence or absence of a fragment of a particular size among individuals, Both techniques are similar in their reaction conditions and identical in the form of the data produced. For convenience throughout the remainder of the chapter I refer to both techniques as arbitrary PCR (AP). Genetic polymorphisms revealed by AP are being used in a variety of different areas of genetics, including DNA fingerprinting, population genetics, and genome mapping. In this chapter I focus on the use of AP in a fourth area, molecular taxonomy, which I define as the identification of specimens based on molecular rather than morphological characters. Molecular taxonomy is expensive and time consuming and is not a substitute for routine morphological identification. However, Black and Munstermann (3) delineated three areas where a molecular taxonomlc approach is both necessaryand appropriate. These are the identification of: 1. Cryptic membersof speciescomplexes that can usually only be discrimi-
natedby expert morphological analysis; 2. Membersof closely related speciesthat can only be identified at a particular life stage;or 3. Very small specimens (~1 mm m length) that require extensive preparatlon for routme ldentlficatlon
Molecular
Taxonomic
Studies
41
1.3. Advantages and Disadvantages of AP for Molecular Taxonomy Unlike PCR reactions that amplify specific, targeted regions of the genome, AP does not require sequence information for construction of flanking primers. Furthermore, the single primer used in AP amplifies multiple genomic regions that vary in their presence among individuals and species. AP therefore offers an inexpensive means to detect genetic variation at a large number of genomic regions in a single PCR reaction. These polymorphisms provide a powerful tool to discriminate closely related species (4-13) even down to the level of subspecies (14). There are four major disadvantages to AP. First, arbitrary primers are “universal.” Any piece of DNA that fulfills the conditions defined earlier will act as template in the AP reaction and will be amplified. This means that potentially all DNA carried in or on a target organism will yield AP products. DNA from parasites, pathogens, and phoretic organisms will produce fragments that may be visualized in and among AP products of the target species. In this case, AP polymorphisms reflect differences in contamination rather than genetic variability in the target species. Contaminating DNA is of minor concern when the target organisms are large (e.g., most plants, large invertebrates, and most vertebrates) because the target DNA will greatly exceedcontaminating template in a routine DNA isolation. Furthermore, specific tissues can be used that are less likely to contain contaminating templates. Contamination is of greater concern with organisms l pm eliminates problems with template DNA variability, especially when working with small organisms (15). AP products are sensitive to the temperature and ramp times during the amplification process.AP reactions done on different thermal cyclers will almost certainly vary. All these conditions must be standardized prior to initiating extensive genetic experiments. It may be difficult
42
Black
to standardize AP products among different laboratories. A simple way to test for consistency in technique is to compare patterns among reactions with identical templates but run on different days or in different laboratories. Third, the majority of AP polymorphisms segregateas dominant markers. Template DNA from individuals that have either one copy (heterozygotes) or two copies (homozygotes) of an amplifiable region will produce a fi-agment during PCR and copy number cannotbe discerned.Only template DNA fromindividuals in which amplification is disrupted in both chromosomes (homozygote recessives)will fail to produce a fragment. This prevents interpretation of AP patterns as codominant markers in a simple Mendelian fashion. Statistical techniques developed for codominant markers, such as isozymes and RFLPs, cannot be applied to AP polymorphisms. Fourth, AP patterns are complex and require careful interpretation and statistical analysis. Not only are multiple fragments that vary in intensity produced from DNA in a single individual but AP products are becoming widely used in population genetics because they produce fragments that vary within a species. This means that AP does not provide a simple “bar-code” for species identification. The method used for comparison and identification of specimens must account for intraspecific variability. 1.4. Overcoming Problems with AP in Molecular Taxonomy
There are some general strategies to adopt given the problems with AP polymorphisms described in Section 1.3. First, usually a single primer is sufficient to distinguish even closely related species. It is unlikely that any two species will have similar AP patterns for the sameprimer. Use of additional primers is more expensive, time consuming, and makes DNA fragment comparison and interpretation more difficult. Second, a primer should be chosen that shows little intraspecific variability. Examine AP patterns in individuals collected from a large number of different geographic regions in which you are going to carry out your study. Select primers that show little variability among these different collections. If a primer is too variable within a species then it will be difficult to compare AP patterns among individuals and will complicate comparisons of known “standards” with unidentified specimens collected from the field. Third, select primers that produce simple patterns with few, consistently well-amplified DNA fragments. This will also simplify fragment scoring and AP pattern comparisons. If all of these conditions were fulfilled then there would be no need for statistical analysis of AP patterns. A set of standard AP products from
Molecular
Taxonomic
Studies
43
identified specimens could be loaded on a gel alongside AP products from unidentified field collections. Species identity would be established when the AP pattern from the unidentified specimen matched one of the standard patterns. Unfortunately, AP patterns are polymorphic and it is unlikely that a primer can be found that produces fragments that are completely monomorphic within a species.Furthermore, a primer that is mostly monomorphic in one species may be highly polymorphic in another. Intraspecific variation in AP patterns requires that an investigator simultaneously compare the various patterns found in one species, with the many intraspecific patterns found in other species. It is impossible to load a set of all known AP patterns for a species each time a gel is run. The only solution is to create a databaseof all known patterns for species in a complex. The data could be stored as the relative mobility of fragments with respect to a standard set of size markers which are used in all gels. The relative mobilities of AP fragments of unidentified specimens would then be compared to identified patterns in the database. In the following I outline a statistical procedure called cluster analysis in which AP patternsare compared among all individuals in a study and a dendrogram is formed. From the dendrogram it is easy to determine whether individuals of a single speciescluster together. If so, an AP pattern is judged to be “species specific.” If not, then other primers need to be evaluated. Once unique and specific species clusters are established, the AP dataset becomes a taxonomic tool. AP patterns from unidentified specimens are appended onto the AP dataset of identified specimens and the entire cluster analysis is repeated. An unidentified individual will cluster with the identified individual that is most similar in pattern. Cluster analysis is a useful tool when working with AP polymorphisms because it simultaneously compares all inter- and intraspecific patterns. 2. Analysis of AP Data 2.1. The Form of the AP Dataset Once a primer hasbeenidentified for discrimination of speciesin a complex and intraspecific variation has beenestimated by sampling individuals in different geographiclocations, this information must be enteredinto a database. As describedearlier,most AP polymorphisms segregateas dominant markers and occur as either the presenceor absenceof a fragment among individuals. Thesepolymorphisms are most conveniently scoredas a “1” for the presence of a fragment and a “0” for the absenceof a f+agment.A convenient way to store AP data for computer analysis is shown for four individuals in Fig. 1A.
Individual1 Individual2 Individual3 Individual4
NUMBER TITLE: NUMBER
A
101000000000000011000110100000001010000011000000000000 000010000001000110001010010100100110000101000000000000 000010010101000010000010010100100110000101001010100000 010110101010001000010001001101010000101000011000001001
B
OF INDIVIDUALS:
31 KHAMBAMPATI ET AL DATASET OF FRAGMENTS: 54
E0701 E0702 E0711 E0712 E0721 E0722 E0731 E0732 E0741 E0742 E0751 E0752 (A10,3X,54Al) AlbopictueGl AlbooictuaG2 AlbopictueG3 AlbopictuaG4 AlbopictusEll AlbopictueB2 AlbopictueB3 Albopictua.91 AlbopictuaS2 AlbopictueS3 AlbopictueSQ AlbopictuaSS AlbopictuaZl AlbopictuaZ2 AlbopictuaZ3 AlbopictusZ4 Katharine Katharine Katharine Katharme Polyneeie Polyneeie Polyneeie Riverei Riversi Riverei Riverei Seato1 Seatoi Seatoi Seatoi
E0703 B0713 E0723 E0733 E0743 E0753
1 2 3 4 1 2 3
t ; 3 4
E0704 E0714 E0724 E0734 SO744 E0754
E0705 E0715 E0725 E0735 E0745
E0706 E0716 B0726 E0736 E0746
E0707 E0717 E0727 E0737 E0747
E0700 E0718 E0720 E0738 E0748
E0709 E0719 E0729 E0739 E0749
E0710 E0720 E0730 E0740 E0750
000000000000000000100001000010000110001010100100010000 000000000000000000100001000010000010001010100000010000 000000000100000000101001000010000110001010100100010000 000000000100000000100000000010000110001000000100010000 000000000000000100100001000010000110001010100100010000 000000000000000100101001000010000110001010100100000000 000000000100000000100001000010000110001010100100010000 000000000100000000100001010010100110001010000100010000 000000000000000000100001000010000110001010100100010000 000000000000000000100001000010000110001010100100010000 000000000000000000000001000010000110000000000100010000 000000000000000000100001000010000010000010100000010000 000000000000000000000000000010100110001010110100010000 000000000000000000100001000010000110001010000100010000 000000000000000000100001000010100110000010100100010000 000000000000000000100001000010100110000010100100010000 101000000010010011000110000100001010000010100000000000 101000000000000011000110100000001010000010000000000000 101000000000000011000110100000001010000011000000000000 101000000000000011000110100000001010000011000000000000 000010000001000110001010010100100110000101000000000000 000010000001000010000000010100100110000101001010101010 000010010101000010000010010100100110000101001010100000 010110101010001000010001001101010000101000011000001001 010110101010000000010001001101010000101000011000001001 010110101010000000010001001000000000100000011000001000 010110101010000000010001001000000000101000011000001001 000000000000000000001001000001000101010000010001000101 00000000000000000000100100000010010101000~000001000101 000000000000000000001001000001100101010000010001000101 000000000000000000001000000001100101010000010001000101
7777
1 000000000100100000100001000010000110001010100100010000
???? ???? 9117
2 000000000100100000100001000010000110001010100100010000 3 000000000000000000100000000010000010001010000100010000 4 000000000000000010100001001010010010001010100100010000
C
Fig. 1. Arbitrary PCR datasets. (A) Format of an AP dataset. Each line consists of a individual’s name followed by the phenotype of the individual at each AP locus. A “1” mdicates the presence of a fragment at an AP locus, whereas a “0” codes for the absence of a fragment. (B) Input dataset for RAPDPLOT.
Molecular
Taxonomic
Studies
45
An identifying label for each individual is followed by the AP pattern, scored as a series of 1s and OS.Each column contains the phenotype at each presumptive AP locus. 2.2. Cluster Analysis with RAPDPLOT There are three basic steps involved in cluster analysis. The first involves comparing all pairs of individuals in a study. A measure of distance is calculated for each pairwise comparison. If there are y1individuals in a study then there are n(n - 1)/2 distance measures. Second, all distance scores are placed into a matrix. Third, the distance matrix is collapsed using one of several algorithms to produce a dendrogram. The author has written a FORTRAN program, RAPDPLOT, that makes pairwise comparisons among all individuals in a AP dataset like the one shown in Fig. 1B and produces a pair of distance matrices. The first matrix contains distance measures derived from the Nei and Li (16) similarity index: S = 2NABI(NA + NB) (1) where NAB is the number of fragments that individuals A and B share in common, NA is the number of fragments in individual A and NB is the number of fragments in individual B. The distance between A and B is simply 1 - S. This is the measure that is widely used when comparing restriction maps and VNTR (yariable numbers of landem repeats) patterns among individuals. Because alleles at different AP loci segregateindependently, a second distance measure based on the shared presence or absence of a fragment was developed (17). The shared absence of a fragment actually provides more information regarding genetic similarity between individuals (both homozygote recessives) than does the shared presence of that fragment (heterozygote or homozygote dominant). As a second distance measure, RAPDPLOT estimates the fraction of matches (M) using the formula: M=NAB/NT (2) (C) Four individuals of unknown identity. Thesefour lines of dataareappended onto the file in 1B. The number of mdivlduals in the first line of the file are changedto 35 and the RAPDPLOT program is run with the appendedlines to determine the ldentrty of the four Individuals.
Black where NABis the total number of matches in individuals A and B (i.e., both fragments absent or present) and NT is the number of loci scored in the overall study. Unlike the similarity index, the denominator for M is fixed. An A4 value of 1 indicates that two individuals have identical patterns; a value of 0 indicates that two individuals had completely different patterns. As with VNTR markers, AP fragments that comigrate are assumed to arise from identical alleles. However in using M, I also assume that the absence of a fragment in two individuals arose from the identical ancestral mutation (i.e., recessive alleles are identical in state). This may not be true because there are potentially many point mutations at the primer sites that could interrupt annealing. The assumption that recessive alleles are identical in state is valid among full siblings however may overestimate relatedness among nonsiblings. The assumption is completely invalid above the species level. For these reasons, I recommend that only Nei and Li’s similarity index be used for molecular taxonomy. However, for most applications, I have found few differences in the dendrograms produced by the two measures. RAPDPLOT is currently dimensioned to analyze up to 500 RAPD markers in up to 1000 individuals. It is simple to increase these dimensions. RAPDPLOT produces matrices that can be read directly into the NEIGHBOR program on PHYLIP 3.5C. This program can be used to produce dendrograms with either Unweighted Pair-Group Method with Arithmetic Averaging (UPGMA) or Saitou and Nei’s (18) Neighbor Joining analysis. The treefile produced by NEIGHBOR can be plotted using DRAWGRAM in PHYLIP 3.5C to produce publication quality dendrograms on a laser printer or a plotter. Both RAPDPLOT and PHYLIP 3.5C are free and easy to obtain over electronic mail. RAPDPLOT can be obtained in an anonymous FTP file at CSU by using the following instructions. Computer prompts appearin < >. 1. Once you are loggedon your network type: ftp lamar.colostate.edu 2. <user:> anonymous 3. <password:> your e-mail addresson your network 4. cd publwcb4 5. binary 6. dir You ~111seea long list of files. Each tile containsthe sourcecode,executablecode,a testdatasetwith output anddocumentationfor a program, Any file that ends with “nmzip” can be run on a computer without a math
Molecular
Taxonomic
47
Studies
coprocessor.Otherwise, the program assumesthe availability of functions on a math coprocessor. 7. To transfera copy of the program that you want (e.g., rapdplotzlp), type: get rapdplot.zlp. 8. Once the program is on your system the file can be unzipped using PKUNZIP. Joe Felsenstein’s instructlons for obtaining PHYLIP 3.X through e-mail are included in the RAPDPLOT directory. 2.2.1. Example
of RAPDPLOT
Use
An example of the use of RAPDPLOT in the molecular taxonomy of five mosquito species in the Aedes scutelluris complex is illustrated here. Details of this study are in Kambhampati et al. (9). The RAPDPLOT dataset derived by using the single primer E07 in 3 1 individuals is shown in Fig. 1B. The first line of the dataset indicates the number of individuals in the study. The secondline indicates a title for the dataset.The third is the FORTRAN format for the names of the AP loci. The next five lines are the namesof the 54 E07 loci. The FORTRAN format statementfor eachline of AP data follows. The AP datasetfor 3 1 individuals at 54 loci are shown. Figure 2 shows the left half of the 1 - S matrix produced by RAPDPLOT. This matrix indicates the distance among all pairs of mosquitoes in this study. For example, the distance between the first and second A. albopictus individuals is 0.1111 while the distance between the fourth A. albopictus and the last A. seatoi is 0.8889. The distance matrix was analyzed by PHYLIP 3.5C using the NEIGHBOR program and invoking UPGMA to produce the tree shown in Fig. 3. The treefile produced by NEIGHBOR was used to make a plotfile using DRAWGRAM and this was printed on a Hewlett-Packard Laserjet III printer (see Fig. 4 on p. 50). Inspection of Figs. 3 and 4 indicates that members of each of the species fall into distinct clusters. This result clearly indicates that, for the individuals analyzed, E07 provides a species-specific pattern. The dendrograph produced from analysis of the 1 - A4 matrix is shown in Fig. 5 (see p. 51). While the topology of the 1 - A4 and 1 - S dendrograms are different, the power of species discrimination is identical. Next I appended four individuals of unknown species identity (Fig. 1C) onto the end-of the dataset and reanalyzed the datasetusing RAPDPLOT and PHYLIP 3.5C. The dendrogram produced by this analysis is shown in Fig. 6 (see p. 52). The four unknown individuals clearly fall within the A. albopictus cluster.
31 AlbopiCws Alkpictus Albopictus Albopictus Albopictus Albopictus Albopictus Albopictus Albopictus Akopictus Albodctuo A&&fetus Abmictus Alb&tua Albopictus ALbopictus Katharine Katharine Katherine Katherine Polynsic Polynesic POlynesiC Riversi Riversi Riversi Riversi seatoi seatoi Seatoi
.oooo .owo .llll :EZ -0476 -1429 .0476 .1818 .oooo .oooo .2500 .1765 .2000 -0526 .1ooo ;1000 -7391 .8ow :zE .8261 3400 A462 X621 .8571 .9130 .8400 J3000 SOW
:El
.OOOO .2000 350 .1579 -2632 .1579 .3000 -1111 -1111 -4286 -0667 .3333 .I765 .2222 .2222 .7143 -7778 :E .9048 -9130 .9167 .8!il9 a462 .9048 -8261 :Z -8947 1.0000
.oooo .OOOO .owo .zow .1304 .1304 -0435 .1667 :Z .3333 -2632 .2727 .I429 -1818 -1818 .7600 .8182 .8261 .8261 -7600 .8519 -7857 .8710 .a667 .9200 .8519 .7273 -7273 .739l .8182
.oooo .oooo .oooo .OOOO .oow .oow .oooo .oow .2632 :E .2000 .2222 .2222 .2857 -4667 .3333 .I765 .3333 .3333 :Z .8947 .8947 :E .75W .9259 .9231 '2% :Z .8%7 A389
.owo .0909 .0909 ;2174 -0476 .0476 2941 .2222 2381 .lOOO .1429 .I429 -7500 :KZ -8182 .7500 Al462 .8519 -8667 x621 -9167 J462 :E -8182 .5a48
.woo .OOOO .oooo .oooo .oooo .woo .1818 -3043 -1429 -1429 .4118 -3333 -3333 .2ow 2381 2381 -7500 .8095 .8182 -8182 k&7 .8462 .8519 .8667 3621 .9167 1% .7143 -7273 an5
.oooo .woo .owo .OOOO .ww .owo .ww .1304 .0476 .0476 2941 .2222 .2381 .lOW .I429 .1429 .7500 :S .8X32 .8333 :E% .8667 -8621 .9167 A462 2% .8182 .9048
.oooo .oooo .oooo .oow .owo .oooo .owo .OOOO .owo .oooo .owo .owo .oooo .oow .oooo .owo
.I818 .1818 .3333 .36&S .2727 .1429 .1818 .1818 2400 .8182 .8261 .8261 A800 .7037 A429 .8710 .8667 .9200 -8519 .8182 .727?i -7391 .8182
.oow .oooo .2500 .1765 .2000 .0526 .lWO .lOOO .7391 moo A095
3000 JO00 .oow .oow .owo .oow .woo .oow .woo .oooo .25W .1765 .2000 -0526 .lOW .lOOO .A91 3000 -8095
;io9i ia95
.8261 23400 :E
-8261 A400 :E
.8571 .9130 .84W moo A000 :Z?
.8571 .9130 .t%W .8ooo .8oW :zz
.oow .oooo .oow .OOOO .oooo -0000 .woo .owo .owo .woo .oooo :Z .2000 .25W .25W .8%7 .8750 .a824 .8824 .7895 3095 .8182 .92W .9167 .8%7 .9048 -7500 -7500 .8750 .7647
.woo .oooo .oow .owo .oow :Ei .oow .ww .oow .oow .oooo -4118 .25W .1765 :%i .7647 :Zl -9000 .9091 .9130 .9231 .9200 .9ooo .9091 .8824 .8824 1:ZZ
.oooo .owo .OOOO .oooo .owo .woo .oooo .oooo .oooo .oooo .OOOO
:%
-2632 .2wo .2wo .7391 .8000 .8095 :%i .7600 .7692 2% .9130 33400 .8ooo
.oooo .oooo .oooo .oooo .oooo .oow .woo .oooo .woo .oooo .oooo :E .woo .OOW .oooo .woo .1579 .15?9 .8182 :E .8OW -8182 .8333 .84W .857l .8519 -9991 -8333 :Ei
5% .7wo
:iZ
.owo .owo .oooo .oooo .oooo .OOOO .oow .oow .OOOO .OOOO .owo :E .?391 .8000
.oow .oow .owo .OOOO .oooo .oooo .owo .oooo .ww .woo .woo .woo A000 -0000 .OOW :Z SOW
:Z .f391 .7600 .7692 .9310 -9286 .9130 .9ZW
:Z .7391 .7600 -7692 -9310
:%i -7143 .8ow
:E .7143 .8wo
:E .9200
.oooo .oow .owo .oooo .oow .oooo .woo .oooo :Ei .oow .oooo .OOOO .oooo .oow .oooo
.OOOO .oooo .OOOO .oooo .oooo .ww .oooo .oooo -0000 .oooo .oow .ww .ww .oooo .oooo .oow
.woo .owo
.2174 -2500 2500 .6923 -7857 .724l -8750 -8710 .9231 -9286 l.oooo l.WW 1.0000 l.oollo
.ww .I%76 .0476 .7391 A400 -7692 1.0000 l.WW 1.0000 1.0000 1.oooo 1.0000 1.0000 1.oooo
Fig. 2. The first 18of 31 columns of the 1-S matrix produced by RAPDPLOT. The 3 1in the first lme indicates the number of taxa in the analysis. This distance matrix can be analyzed by NEIGHBOR in PHYLIP 3.5C to generate a dendrogram.
Molecular
Taxonomic
49
Studies +--1
+--------26
+Albopfctus
+--2 +Albopictue 1 1 +--7 +Albopictue I 1 +-lo +Albopiotua I 1 +-14 +-Albopiotue I 1 I I +Albopictw +-15 +--6 1 1 +Albopictus 1 I +-18 I +ALbopictus I 1 +---3 I 1 +Albopictue +-20 I I 1 +----Albopictus 11 +-21 +-----Albopictus I I 11 +-Albopfctua +-23 +--11 1 1 +-Albopictue +-25 1 I I +-------Albopictua , I +-------Albopictue 1 +--------Albopictus
1 I I I +-29 +------Katharine , +-------------22 I +Xatharine t I 1 +-V---8 I 1 1 I I 1 1 +Xatharine +--4 1 +-27 +Xatharine 1 1 I 1 t +-------Polynesia +------------24 -3: 1 *----Polyneeie I +-17 +----PolynesLe t +Riverei I +--5 f 1 +Riversi , +------------------15 I +-Riverei f f +-12 +-Riveref I 1 +-28 +Seatoi +--9 t I +-13 +seatoi I I I +-----------------1g ++eatoi 1 +----seatoi
Fig. 3. The dendrogram produced by NEIGHBOR using UPGMA analysis of the matrix in Fig. 2. Numbers on branches indicate the order in which taxa were placed into the dendrogram. Branch lengths are roughly proportional to 1 -S.
Black
50 Alboplctus Albopvdus Alboplctus Albopactus Alboplctus Albopictus Nboplctus A
1
,Albop&
-Albophus
Fig. 4. The dendrogram plotted by DRAWGRAM on a Hewlett-Packard LaserJet III printer using the treefile produced by NEIGHBOR. Branch lengths are proportlonal to 1 -S. OtherwIse the dendrogram 1sidentical to that shown m Fig. 3.
There are several important points to make about this analysis. First, Kambhampati et al. (9) analyzed 108 RAPD loci amplified by two primers and obtained the same degree of resolution as in the present analysis. Use of more than a single primer was unnecessary. Second, there were 9.75, 11.25, 14.67, 16.25, and 10.25 fragments on average in A. albopictus, A. katharinensis, A. polynesiensis, A. rwersi, and A. seatoi, respectively. The sum of these averages was 62.17, whereas the overall
Molecular
Taxonomic
Studies
51
-I
Nbopstur Alboplctus Alboplctus Alboplctua seato1 Seato1 Seato1 Seatot Katharine Kathanns Katharine Kathorm Polynesie Polynssls Polynesm RIVWSI RlVNSl RlVWSl RlVWSl
Fig. 5. The 1 -Mdendrogram plotted by DRAWGRAM as m Fig. 4. number of loci was 54. This implies that there was very little overlap in fragments among these species. The number of AP patterns in a study will increase with the number of species analyzed. Probably it would have been simpler to select a primer that produced fewer fragments. Third, intraspecific variation was detected in each species and in fact there were 27 distinct patterns among 3 1 individuals in the entire study. Despite this high level of intraspecific diversity, very clear species-specific clusters were derived (Fig. 5) and unidentified individuals were easily located alongside identified individuals (Fig. 6). Fourth, the dendrogram should not be interpreted as representing evolutionary relation-
Black
52 Mbopictur Alboplctus Albopictur Nbopictus Albopdur Albopdur Alboplctu8 T??? 7777 Albopwztua Albopictur Albopdus
I
Fig. 6. The I- S dendrogramderived by cluster analysis of the data shown m Fig. 1B with the four unidentified individuals in Fig. 1C appendedto the file. Unidentified individuals are shown as “????.” Otherwise Figs. 2 and 6 are identical. ships among taxa. A. albopictus and A. seatoi are members of the aZbopictus subgroup and should have fallen into a common cluster. Instead they fell on opposite ends of the dendrogram. Black (IS) pointed out that for use of AP polymorphisms in systematic analysis, one would have to assume that fragments of equal mobility are evolutionarily homologous; having been derived from a common ancestral gene. Smith et al. (19) completed a thorough molecular analysis of RAPD patterns
Molecular
Taxonomic
Studies
53
among Xanthomonas campestris strains and showed that fragments of equal mobility were not necessarily homologous. Similarity in AP, patterns among species do not reflect evolutionary relationships. The cluster analysis described earlier is solely intended for discrimination of species clusters. 2.3. Other Statistical Discrimination Methdds In developing this chapter a number of different statistical methods for AP pattern analysis were explored. All of these fall under the category of multivariate analysis because AP phenotypes at multiple loci are compared among individuals. AP polymorphisms require a special form of multivariate analysis because they are scored as a “1” or a “0” and not as continuous variables that follow a normal distribution. Ballinger-Crabtree et al. (14) described the use of nearest neighbor discriminant analysis in examination of AP patterns among individual A. aegypti belonging to two subspecies. This method does not assume that each variable follows a normal distribution. Euclidean or Mahalanobis distances were calculated among all pairs of individuals. Individuals are placed into groups with identical or similar individuals. These are an individual’s “nearest neighbors.” Each time a new individual is evaluated, it is placed in the cluster that contains its nearest neighbor. An individual that is equidistant from individuals in different clusters is placed into an “other” category. The technique was found to accurately place individuals into the correct subspecies cluster most of the time. However, the output of nearest neighbor discriminant analysis is a misclassification table that was not as simple to interpret as the dendrograms examined in the same study. Furthermore, classification of individuals that fell within the “other” cluster was difficult. In practice, given the problems associated with AP comparisons outlined earlier, cluster analysis using RAPDPLOT has proven to be the easiest and most accurate method for routine analysis of AP data. Incorrect classifications are easily detected in dendrograms. Furthermore, it is simple to add unknowns into the analysis and follow their placement into clusters of identified individuals. 3. Concluding Remarks The most difficult part of AP analysis involves the scoring of fragments and in the comparison of patterns resolved on different gels. Although agarose gel electrophoresis is used routinely to score AP poly-
Black morphisms, use of gels that provide greater resolution, especially of lower molecular weight DNA fragments, will simplify pattern comparison. Fractionation of AP products on polyacrylamide gels followed by silver staining (20) is an inexpensive alternative. Gel scannersthat record the relative mobility of fragments with regard to standard DNA markers will also facilitate comparison of patterns on different gels. Once technical issues of pattern comparison are resolved, cluster analysis of AP patterns can become a powerful tool in studies requiring a molecular taxonomic approach. Acknowledgment This research was supported by a grant from the John D. and Catherine T. MacArthur Foundation. References 1. Williams, J. G K., Kubelik, A. R., Livak, K. J., Rafalski, J A., and Tmgey, S. V. (1990) DNA polymorphisms amplified by arbitrary primes are useful genetic markers. Nuclezc Acids Res l&6531-6535. 2 Welsh, J. and McClelland, M (1990) Fmgerprmtmg genomes using PCR with arbitrary primers. Nucletc Aczds Res l&7213-7219. 3. Black, W. C. and Munstermann, L. M. (1995) Molecular taxonomy and systematits of arthropod vectors, in Bzology of Dzsease Vectors (Marquardt, W C and Beaty B., eds.), University of Colorado Press, Boulder, CO, in press 4 Black, W. C., IV, DuTeau, N. M , Puterka, G. J , Nechols, J. R., and Pettorim, J. M (1992) Use of the random amphfied polymorphic DNA polymerase chain reaction (RAPD-PCR) to detect DNA polymorphtsms in aphids. Bull. Entomol Res 82, 151-159. 5. Chapco, W., Ashton, N. W , Martel, R. K. B., Antonishyn, N., and Crosby, W. L. (1992) A feasibility study of the use of random amplified polymorphic DNA in the population genetics and systematics of grasshoppers. Genome 35,569-574. 6. Edwards, 0. R. and Hoy, M. A. (1993) Polymorphrsm in two parasitoids detected using random amplified polymorphic DNA polymerase chain reaction. Biol. Con? 3,243-257. 7. Guertin, D. S., Antolm, M. F., and Petersen, J. J. (1995) The origm of gregarious Musczdzfurax (Hymenoptera: Pteromahdae) in North America. Biol. Cant , in press. 8. Hunt, G. J. and Page, R. E (1992) Patterns of inheritance with RAPD molecular markers reveal novel types of polymorphisms in the honey bee. Theor. Appl Genet. 85, 15-20. 9. Kambhampatt, S., Black, W. C., IV, and Rar, K. S (1992) RAPD-PCR for identtfication and differentiation of mosqurto species and populatrons: techniques and statistical analysis. J A4ed Entomol 29,939-945 10 Perring, T. M., Cooper, A. D., Rodrtguez, R. J., Farrar, C. M., and Bellows, T. S., Jr. (1993) Identtfication of a whitefly species by genomic and behavroral studies Sczence 259,74-77.
Molecular
Taxonomic Studies
55
Il. Puterka, G J., Black, W. C., IV, Sterner, W. M., and Burton, R. L (1993) Genetic variation and phylogenetic relationships among worldwide collections of the Russian Wheat Aphid, Diuraphzs noxza (Mordvilko), Inferred from allozyme and RAPD-PCR markers. Heredity 70,604618. 12. Roehrdanz, R L., Reed, D K., and Burton, R. L. (1993) Use of the polymerase chain reaction (PCR) and arbitrary primers to distmgmsh laboratory reared colonies of parasitic hymenoptera. Blol Cont 3, 199-206. 13. Wilkerson, R. C., Parsons, T. J , Albright, D. G., Klein, T A., and Braun, M. J. (1993) Random amplified polymorphic DNA (RAPD) markers readily distinguish cryptic mosquito species (Diptera:Culicidae:Anopheles) insect Mol Biol 1, 205-211. 14. Ballinger-Crabtree, M. E , Black, W C., IV, and Miller, B R. (1992) Use ofgenetic polymorphisms detected by RAPD-PCR for differenttation and identification of Aedes aegypti populations. Am. J Trop. Med Hyg 47,893-90 1. 15 Black, W C., IV (1993) PCR with arbitrary primers: approach with care. Znsect Mol Biol. 2, l-6. 16. Nei, M. and Li, W. H (1985) Mathematical model for studying genetic variation in terms of restriction endonucleases. Proc. Natl. Acad. SCI USA 76, 5269-5273 17. Apostol, B. L., Black, W. C , IV, Miller, B R., Reiter, P., and Beaty, B. J (1993) Esttmatton of family numbers at an oviposition site using RAPD-PCR markers: applications to the mosquito Aedes aegvptz Theor. Appl Genet 86,991-1000 18. Saitou, N. and Nei, M. (1987) The neighbor-joming method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4,406-425 19. Smith, J. J., Scott-Craig, J. S., Leadbetter, J. R., Bush, G. L , Roberts, D. L., and Fulbright, D W (1994) Characterization of random amplified polymorphic DNA (RAPD) products from Xanthomonas campestru and some comments on the use of RAPD products m phylogenetic analysis. Mol. Phyl. Evol 2, 135-145. 20. Hiss, R. H, Norris, D. E., Dietrich, C. H., Whitcomb, R. F , West, D F., Bosto, C. F., Kambhampati, S., Piesman, J., Antolin, M. F., and Black, W. C., IV (1994) Molecular taxonomy using single strand conformation polymorphtsm (SSCP) analysis of mitochondrial ribosomal DNA genes. Insect Mol. Blol., 3,17 l-l 82
CHAPTER5
Molecular Identification of Phytopathogenic Viruses Donato
Gallitelli
and Pasquale
Saldarelli
1. Introduction The purpose of this chapter is to illustrate some techniques exploiting the properties of viral nucleic acids by which plant viruses can be identified and the diseasesthey induce diagnosed. These methods are basically the same as those used in other fields of biology and, therefore, some details of their description may appear repetitious, if not cumbersome. However, the current literature indicates that a direct transfer without adjustment of these technologies to plant virology is not always possible, as many factors (sap constituents of different plant species, age of the plant, time of sampling, etc.) may seriously affect resolution, sensitivity, and specificity. Since the molecular approach to diagnosis capitalizes on genetic information, it overcomes some of the constraints of the classical biological and serological techniques. Biological techniques demand that the virus to be identified is transmitted to a suitable herbaceous or woody indicator plant (indexing), and the reading and interpretation of the indicator’s reactions. Although bioassays are sensitive and reliable, the procedures are costly, time consuming, and require expensive infrastructures (i.e., glasshouses, screenhouses,field plots, etc.). Moreover, symptoms induced by a viral infection on indicator plants may also vary according with the virus strain, age of the plant, and growing conditions.
From+
Methods Nucle/c
m Molecular Aod Methods
Biology, Edlted
Vol 50 Species Dlagnostrcs Protocols. PCR and Other by J P Clapp Humana Press Inc , Totowa, NJ
57
Gallitelli
and Saldarelli
Serology is a technique that explores the differential immunological properties of the viral coat protein that represents only a small part of the coding capacity of the viral genome. Although in most cases serology is sufficient for the proper identification of plant viruses, it finds serious limitations when applied to: 1. 2. 3. 4.
Unstable or poorly immunogenic viruses; Viruses requiring laborious purification procedures; Detection of nonencapsidateddouble-strandedor single-strandedRNAs; Detection of defective virus partrcles,defectiveinterfering RNAs, or satellite RNAs; 5. Detection of viroids (e.g., infective agentsdeprived of coat protein); and 6. Differentiation of very closely relatedvnus strains.
Owens and Diener (I) were the first to show the potential of nucleic acid hybridization for detecting plant pathogenic viruses and virotds, thus opening the use of a technique that has gained tremendous popularity for a number of applications spanning from pure research to large-scale routine testings. Indeed, molecular applications are highly sensitive, reliable, space- and labor-saving, and possess enough flexrbility to be improved further, for example, by coupling with serological techniques. The theoretical basis of nucleic acid hybridization is that under suitable conditions of temperature and salt concentration, complementary sequences of single-stranded molecules will anneal to form stable double-stranded structures (hybrids). When applied as a diagnostic tool, the method requires that the target nucleic acid be fixed, usually onto a solid support, and the complementary nucleotide sequence (probe) carry a label that provides the necessary signal whereby successful hybridization can be recognized. In dot-blot or spot hybridization (I-31, the target sample (often no more than a crude sap extract) is spotted onto a membrane (also referred to as a filter), whereas in Northern (4) and Southern (5) blots, nucleic acid fragments are first separated by gel electrophoresis then transferred to a membrane by capillarity on which they are immobilized by exposing to UV light (nylon) or by baking (nitrocellulose). The filter is then incubated in a prehybridization mix so as to block the sites that might bind the probe nonspecifically. This mix is replaced by the hybridization solution, which contains the probe labeled with one of the different reporter
Identification
of Viruses
59
systems available, and the filter is incubated for several hours under suitable temperature conditions. After incubation, the unbound probe is washed off and the bound molecules are detected in different ways, depending on the type of label carried by the probe. Various refinements and modifications of hybridization techniques have been proposed aimed at improving their sensitivity and reducing the background that with certain types of plant material can be unacceptably high. Some of these improvements, obtained in our laboratory, are described in this chapter. Nucleic acid hybridization analysis can be employed for studying plant viral genome organization or for diagnostic purposes. For the latter use, dot blot represents the most suitable format for routine testings and can be applied, for example, to sanitary certification schemes. However, two main constraints must be met: 1. A specific probe must be usedfor each individual virus, and even though more than one probe can be containedin the samehybridization solution to detect mixed infections, signals cannot be distinguished from one another; and 2. Becausevirus distribution m the host ~111vary with the season,the success of the techniqueis strongly dependenton a reliable sampling method. 2. Materials 2.1. Dot Blot, Northern Blot, and Southern Blot Three types of membranes are routinely used to immobilize target nucleic acid, nitrocellulose, nylon, and nylon+ (see Note 1). All types of membranes can be stored at room temperature and must be handled with gloves. Some companies sell membranes in rolls that, in our experience, are very convenient because they can be cut to size. 2.2. Electrophoresis Equipment Agarose gel electrophoresis is routinely used for separating components of different sizes in plant virus nucleic acid preparation. Electrophoresis is more easily performed in a horizontal apparatus, which is often referred to as “submarine gel electrophoresis.” There are several types of electrophoretic cells. If a small number of samples has to be analyzed, the mini cells (gel tray 7 x 10 cm) with l-mm thick well comb afford the best results. However, larger tanks are also available to run simultaneously up to 30 samples (gel tray 15 x 10 or 15 x 20 cm), but
60
Gallitelli
and Saldarelli
resolution may be lower, especially with total nucleic acid (TNA) samples. Electrophoresis apparatus should be cleaned frequently with detergents and washed with sterile distilled water. Because DNA samples are usually prepared using enzymes that are not easy to remove (e.g., RNase), two separate apparatuses should be used to run RNA and DNA samples. 2.3. Stock Solutions Molecular biology or analytical grades are suggestedfor all chemicals. All solutions should be sterilized before use. Solutions that do not require sterilization are marked with an asterisk (*). Whenever possible, stock solutions should be used to prepare working solutions. Unless otherwise stated, all solutions are stable for several months at room temperature. 2.3.1. Stock Solutions 1. 1M Tris-HCl, pH 7.5 and pH 8. 2. 500 n&fNa*EDTA adjusted to pH 8 with NaOH (-20 g NaOH pellets/L of solution). 3. 5MNaCl. 4. 10% SDS* (wear a mask when preparingthis solution). 5. TE buffer: 10 mA4Trrs-HCl, 1 mMNa2EDTA, pH 7.5 or pH 8. 6. STE buffer: 100 mA4NaCI, 100 mM Tris-HCI, 2 mJ4 Na*EDTA, pH 8. 7. 10X EB: 1M Glycine, lMNaC1, 100 mM Na2EDTA, adjust pH to 9-9.5 with NaOH. 8. Phenol (water-saturated): Melt phenol crystals at 65’C in its own container. (Caution: Wear gloves when handling and work under a fume hood, phenol is highly toxic and may cause severe burns to skin.) Add 0.1% 8-hydroxyquinoline, fill the container (usually a glass bottle) wrth sterile distilled water, and shake vigorously to mtx phases, let rt stand to separate phases, and ptpet off the (upper) aqueous phase, refill the bottle with sterile distilled water, and separate phases as desrrbed, and remove excesswater, leaving a 2-cm layer on top of the phenol phase. Water-saturated phenol IS stable for several months tf stored at 4°C and protected from light.
2.3.2. Reagents for Sample Preparation 1. Alkaline extraction solution: 50 mMNaOH, 2.5 mMNa2EDTA*. 2. TNA extraction buffer: 1X EB, 2% SDS, 1% N-lauroylsarcosine. 3. RNase-free sterile water (available from several companies): Divide mto ahquots and store at -20°C.
Identification
of Viruses
61
4. Buffer-saturated phenol: Mix 50 mL of water saturated phenol with 50 mL of 500 mMTris-HCl, pH 8, shake vtgorously, and let the phases separate at room temperature, pipet off (upper) buffer phase, add 50 mL of 100 mM Tris-HCl, pH 8, shake again, and store at 4°C protected from light. This preparation is unstable and must be used within 1 mo. 5. Chloroform: Mix 24 vol of chloroform with 1vol isoamyl alcohol, store at 4°C (see Note 2). 2.3.3. Agarose Gel Electrophoresis Reagents 1. Agarose (Type I low EEO, e.g., Sigma, St. Louis, MO). 2. 1OX TBE buffer: 90 mM Tris-HCl, 90 mM boric acid, 2.5 mMNa,EDTA (pH is usually 8.3). 3. 10X MAE buffer: 200 mM MOPS, 50 mM sodium acetate, 10 mA4 Na2EDTA, adjust pH to 7 with 3NNaOH (protect from light, i.e., wrap the bottle with aluminum foil, do not sterilize). 4. Gel loading buffer: 15% Ficoll (Type 400; Pharmacia, Uppsala, Sweden), 0.25% Bromophenol blue m water* (see Note 2). 5. 37% Formaldehyde (wear gloves while handling). 6. Deionized formamide (wear gloves while handling)*: Wash 5 g of BioRad (Richmond, CA) AG 501-X8 (D) resin (or equivalent) with 5 mL formamide for 5-10 min, discard formamide, and add 100 mL of fresh formamide, stir until pH is below 7, filter through “Miracloth” (e.g., Calbiochem, La Jolla, CA), store in aliquots at -7OOC. 7. DNA denaturing solution: 1.5MNaCI,500 mMNaOH. 8, DNA neutralizing solution: 1.5MNaC1, 500 mM Tris-HCl, pH 7.2, 1 mA4 Na*EDTA. 1. 2. 3. 4.
2.3.4. Hybridization Reagents 20X SSC: 3M NaCl, 300 mM Na@trate. 20X SSPE: 3.6M NaCl, 200 mM sodium dihydrogen phosphate, 2 mA4 Na2EDTA, adjust pH to 7.4 with IONNaOH. 50X Denhardt’s solution (6,: 1% Ficoll (e.g., Type 400; Pharmacia), 1% polyvinylpyrrolidone, 1% bovine serum albumin (e.g., Fraction V: Sigma) in sterile distilled water, store at -20°C. 5s DNA (single-stranded sonicated Salmon sperm DNA): Dissolve 1 g salmon sperm DNA (e.g., Sigma type III sodium salt) in 100 mL sterile distilled water (this is a very viscous suspension), sonicate (keep the flask on ice) until the suspension is fluid, pass the suspension through a hypodermic needle several times, boil for 10 min, divide into I-mL ahquots, and store at -2OOC
Gallitelli 5. Digoxigenin-luminescent Mannheim, Germany). 1. 2. 3. 4. 5. 6.
and Saldarelli
detection kit (e.g., Boehrmger Mannheim,
2.3.5. Probe Preparation Reagents Plasmld preparations containing suitable cloned segments of viral genome. Synthetic ollgonucleotldes complementary to specific portions of viral genome. [32P]-Labeled nucleotldes. Restriction endonucleases. SP6/T7 transcrlption kit, nick translation kit, DNA S-end labeling kit, ohgonucleotide primed DNA labeling kit (e.g., Amersham [Arlington Heights, IL], Promega [Madison, WI], Boehringer Mannheim, etc.). Digoxigemn RNA labeling kit (e.g., Boehringer Mannheim).
2.4. Sandwich
Hybridization
1. 2.
2.4.1, Stock Solutions 10 mM Biotm 11-UTP (e.g., Sigma), store at -20°C. 100 rniV DTT (dithiothreltol), store at -20°C. ATP, CTP, GTP, 10 mM each, store at-20°C. Human placental ribonuclease inhibitor (HPRI), store at -2OOC. Streptavidin 2 pg/mL in TN buffer (prepare fresh). TN buffer: 50 mMTns-HCl, pH 7.5, 150 mMNaC1. PBS buffer: 20 mM sodnun phosphate, pH 7.0 150 mMNaC1. 25% Glutaraldehyde in distilled water (prepare solutions under a time hood wearing gloves and mask), store at 4°C. 0.1% Tween-20 in PBS. 2.4.2. Kits DIG-RNA labeling kit (e.g., Boehrmger Mannheim). DIG-RNA detection kit (e.g., Boehringer Mannheim).
1. 2. 3. 4. 5. 6. 7.
2.4.3. Hybridization Mix 50% Deionized formamide. 40 mM Sodium phosphate, pH 7.4,4X SSC. 1X Denhardt’s solution. 240 pg/mL 5S DNA. 2% Dextran sulfate. 1.25 mM blotinylated capture (Blo-Cap). 4 5 mJ4 digoxlgenm-labeled probe (DIG-pro) (prepare fresh).
1. 2. 3. 4. 5. 6. 7. 8. 9. 10.
Identification
of Viruses
2.4.4. Special Equipment 1. A microfiltration apparatus wtth slot format (e.g., Bio-Dot SF, BioRad, Hercules, CA) connected with a vacuum line. 2. Chromatography columns (e.g., Bio-Spin 30, BioRad). 3. A rectangular plastic box with lid.
2.5. In Situ Hybridization I. 2. 3. 4. 5. 6. 1. 2. 3. 4. 5.
1. 2. 3. 1. 2.
2.5.1. Tissue Preparation Reagents Formaldehyde. Absolute ethanol. Glacial acetic acid. Tertiary butyl alcohol. Parawax. Xylene (wear gloves and mask when handling). 2.5.2. Hybridization Reagents Proteinase K. 1OX PBSE buffer: 1.37M NaCI, 30 m&I KCl, 80 n-J4 Na2HP04, 20 rnM NaH2P04, 100 mM EDTA, pH 7.5. Hybridization mix: 600 n-n!4NaCl, 500 pg/mL 5s DNA, 1X Denhardt’s solution, 1 mM EDTA, 10 rnA4 Tris-HCl, pH 7.5, 50% deionized formamide (prepare fresh). [35S] UTP aS with 800 Ci/mmol specific activity, store at -2OOC. 2X SSCE: 2X SSC (17.5 g NaCl, 8.82 g sodium citrate dtssolved in 1 L of distilled water, pH 7), 10 mM EDTA. 2.5.3. Autoradiography Reagents Kodak NTBZ, store at 4OCprotected from light. Kodak D 19, store at 4°C protected from light. Kodak AL-4 fixer. 2.5.4. Staining Reagents Synocryl9 122X. Safranine fast green.
3. Methods 3.1. Sample Preparation 3.1.1. Extraction of Viral RNA from Purified Virus Particles 1. Purify virus particles with one of the currently available methods (see Note 3).
Gallitelli
and Saldarelli
2. After the last step of purification (e.g., last high-speed or density gradient centrifugation) resuspend virus particles m 400 uL of 50 rnA4 NaCl (see Note 4). Transfer the suspension to a fresh sterile 1.5-mL Eppendorf tube. 3. Add 4 pL 1M Tris-HCl, pH 7.5, 1.5 pL 250 mM Na,EDTA, 40 uL 10% SDS. Vortex and incubate at 25°C for 15 min. 4. Add 450 pL phenol:chloroform (1: 1) and vortex for 1 mm. Centrifuge (maximum speed for 2 min with an Eppendorf type centrifuge) to separate phases and carefully collect (upper) aqueous phase. 5. Re-extract aqueous phase with 1 vol of phenol:chloroform (1:I). Repeat step 3. 6. Wash aqueous phase with 1 vol of chloroform. Centrifuge to separate phases and carefully collect (upper) aqueous phase. 7. Add sodium acetate, pH 5.2, to 300 mM and 2.5 vol of cold (-20°C) ethanol. Vortex and place the tube at -70°C for 30 min or at -20°C overnight. 8. Centrifuge, discard the supernatant, and drain excess liquid on a paper towel. Carefully wash the pellet with 70% cold ethanol. Dry pellet under vacuum for 2 min and resuspend RNA in RNase-free water or TE buffer, pH 7.5, to a concentration of 1 mg/mL. Divide into aliquots and store at -70°C (see Note 5). 3.1.2. Extraction of Total Nucleic Acid (TNA) from Infected Plants (7) In our hands, this procedure yields satisfactory results with tissues from vegetables, herbaceous test plants for maintaining virus cultures, and transgenic plants. 1. Crush 100 mg infected tissue very rapidly in a prechilled sterile mortar (kept in ice for at least 15 min). Quickly add 600 uL of 1X EB and transfer 400 pL to a fresh sterile 1.5~mL Eppendorf tube (kept in ice). 2. Add 400 pL phenol:choloroform (1: 1). Vortex and centrifuge to separate the phases. Carefully recover the (upper) aqueous phase, add sodium acetate, pH 5.2, to 300 mA4and 2.5 vol of cold ethanol. Vortex and place the tube at -70°C for 30 min or at -20°C overnight. 3. Centrifuge. Discard supernatant and drain excess liquid on a paper towel. Carefully wash the pellet with 70% cold ethanol. Dry pellet under vacuum for 2 min and resuspend TNA in 100 uL RNase-free water or TE buffer, pH 7.5, to a concentration of 1 mg/mL. Divide mto aliquots and store at -70°C. (see Notes 5 and 6).
Identification
of Viruses
65
3.1.3. Plant Sap Extract in Alkaline Medium (3) This method can be used to prepare extracts from vegetables, weeds, omamentals, and herbaceous hosts for maintaining plant virus cultures. The procedure can be used to detect either RNA or DNA plant viruses but it is not suitable for preparing samples for gel electrophoresis. 1. Collect pieces of young plant tissues (- 1 g or less) into commercially available small plastic bags (10 x 15 cm) (see Note 7). 2. Add 6-9 mL of a freshly prepared solution of 50 mMNaOH, 2.5 mMEDTA. 3. Place the bag on top of a pile of paper hand towels (10 or more) and grind the sample by giving up and down strokes with a mortar pestle. Do not use rotary movements as this could break the plastic bag (see Note 7). 4. Incubate for 5-10 min at room temperature (see Note 8). This preparation must be spotted immediately onto hybridization membrane (nylon or nylon +). 3.1.4. Extraction of Total Nucleic Acid (TNA) from Grapevine Plants Infected by Filamentous RNA Viruses (8) This preparation of TNA is useful to detect viruses by dot blot hybridization, but it is not suitable for gel electrophoresis. 1. Scrape cortical tissue from cuttings stored at 4°C or freshly harvested. 2. In a prechilled sterile mortar, grind 100 mg of tissue to a fine powder with liquid nitrogen. With the aid of a sterile little brush, transfer the powdered tissue to a 1.5-mL Eppendorf tube containing 500 pL of 1X EB, pH 9.5. 3. Add 500 pL phenol:choloroform (1: 1). Vortex and centrifuge to separate phases. Carefully recover the (upper) aqueous phase. 4. Make the aqueous phase (-500 pL) 35% with ethanol, add 150 mg CFl 1 cellulose, and stir the suspension for 1 h at room temperature on a rotary shaker. 5. Centrifuge (half speed for 5 min with an Eppendorf type centrifuge) to collect cellulose-bound nucleic acid. Carefully plpet off the supernatant and wash pellet twice with 500 pL STE buffer containing 35% ethanol. Centrifuge to recover pellet after each wash. 6. Resuspend pellet with 400 pL STE buffer and elute TNA from cellulose by vortexing. 7. Centrifuge and carefully recover supernatant. Ethanol-precipitate TNA (follow steps 2 and 3 m Section 3.1.2.) and resuspend final pellet with 50 pL RNase-free water. Store at -7OOC until used (see Note 5).
66
Gallitelli
and Saldarelli
3.2. Hybridization Formats 3.2.1. Dot-Blot Hybridization This hybridization format simply answers the question of whether a plant is infected or not by a given virus. Dot-blotting does not distinguish between number and size of hybridized molecules, as the hybridization signal is given by the sum of all sequences recognized by the probe. On the other hand, the technique is very fast and versatile, allowing the identification of specific nucleic acid sequences in samples ranging from crude plant sap to highly purified preparations. In our hands, this represents a most suitable detection system for routine and large-scale tests applied, for example, to sanitary certification schemes that require processing of a great number of samples in a short period. The protocol described hereafter is the same as the Boehringer Mannheim DIG-lumlnescent detection kit (9) with some modification and used for chemiluminescent detection of some tomato viruses using digoxigenin (a nonradioactive reporter group). The luminescent system gives very rapid results and, unlike color reaction, is permanently recorded on the impressed X-ray film. Modifications for the use with radiolabeled probes are reported in Section 3.1.2., steps 6-l 1. 1. Mark a piece of nylon+ membrane (see Note 9) mto 1-cm squares using a soft pencil. Make enough squares to allocate all samples and controls. 2. Prepare samples (follow steps 1-4 in Section 3.1.3.) and spot 5 PL onto each square of the membrane. 3. When spotting is completed, wash the membrane for 1 min in 2X SSC. At this point, the membrane can be used immediately or stored for several months at room temperature between two sheets of Whatman (Maidstone, UK) 3MM paper. 4. Place membrane between two plastic sheets (0.2 mm thickness) (see Note lo), cut to size, and seal along three edges with a commercially available plastic sealer. 5. Fill the bag with 150 PL hybridization mix (refer to Boehringer Mannhetm kit manual) for each square centimeter of membrane. Carefully remove air bubbles and seal the fourth edge of the bag. 6. Prehybridize at 55OCfor at least 2 h in a shaking bath. Make sure the bag is submerged. 7. Cut the bag and replace prehybridization solutton with a fresh one contammg 100 ng DIG-RNA (see Note 1l), probe for each mL of solution. Reseal the bag and hybridize overnight at 55°C in a shaking bath.
Identification
of Viruses
67
8. After hybridization, cut one corner from the bag and discard the hybridization solution. Completely open the bag, remove the membrane, and place into a suitable contamer. Wash off unbound probe with 250 mL of 0.1X SSC contaimng 0.1% SDS at 65°C for 30 min. Repeat washes four times. Digest the residual unbound probe by incubation at room temperature in 2X SSC containing I pg/mL RNase A for 30 min in a designated container (A. Hadidi, National Germplasm Resources Laboratory, Beltsville, MD, personal communication, 1994). Wash membrane with 2X SSC. 9. Place membrane in a homemade plastic bag (see step 4 m this section) and wash it with a 150-mL washing buffer (refer to Boehringer Mannheim kit manual) for 5 mm at room temperature with a moderate shaking. 10. Move membrane to a new plastic bag and saturate with 25 mL blocking solution for 1 h (refer to buffer 2 in the Boehrmger Mannheim kit manual). 11. Incubate for 1 h with 25 mL of antidigoxtgenm-alkaline phosphatase (AP) Fab fragments freshly diluted 1:5000 m blocking solution (refer to Boehringer Mannheim kit manual). 12. Place membrane m a designated contamer and remove the unbound conJugate by washing twice with 150 mL of washing buffer for 15 min. Equilibrate membrane for 5 min with 50 mL of AP buffer (refer to buffer 3 m the Boehringer Mannbeim kit manual). 13. Place membrane on an horizontal plastic surface (samples side up) and distribute uniformly 4 mL of freshly prepared AMPPD substrate solution. Leave for 5-10 min m the dark (see Note 12). 14. Adsorb excesssubstrate with two sheets of Whatman 3MM paper. Do not dry membrane completely and place it betweentwo sheetsof acetate(see Note 13), elimmate bubbles by rolling with a Pasteur prpet, and close the “sandwich” in an autoradiographrc cassette. 15. Keep the cassetteat 37OCfor 10 min to activate AP, then expose mem-
braneonto an X-ray film at room temperaturefor 60 min (seeNote 14) in an autoradiographtc cassette.Develop the film and place it onto the membrane to locate infected samples.
3.2.2. Squash Blot Hybridization This method allows specific sequences of viral nucleic acid to be detected directly in squashes of tissues (plant or vector insect) without any pretreatment of the samples (IO). In our laboratory, this system was applied to detection of tomato viruses. 1. Wet a piece of nylon membrane with 50 mJ4 NaOH, 2.5 mM EDTA, and place it on a piece of Whatman 3MM paper.
68
Gallitelli
and Saldarelli
2. Cut plant stem, fruit, leaf, or flower stalks where suitable and place immediately the cut surface onto the membrane. Keep in place for few seconds. Entire tomato leaflets can be squashed onto the membrane with the aid of a light mlcroscope glass slide. Make fresh cuts for new imprints. 3. Neutralize membrane by washing twice for 5 min with 500 mA4Tris-HCl, 1.5M NaCl, 1 mM EDTA, pH 7.5. 4. Expose membrane to UV light for 5 min to link nucleic acid. 5. Perform prehybridization, hybridization, and washes as described m Section 3.2.3.
3.2.3. Northern Blot Hybridization This hybridization format gives more qualitative results than dot-blot or squash-blot do, as it allows a precise identification of the molecule recognized by the probe. TNA extracts or viral nucleic acid extracted from purified virions are suitable materials for this type of analysis. Nucleic acid samples must be subjected to electrophoresis through a fully denaturing gel (II), then transferred to the membrane by capillarity. 1. To prepare a 10 x 6 cm fblly denaturing 1.2% agarose mimgel, melt 180 mg agarose in 10.8 mL sterile distilled water, let cool to 60°C, add 1.5 mL of 10X MAE buffer and 2.7 mL of 37% formaldehyde, pour the gel into the tray placed under a &me hood, then insert the comb (see Note 15). 2. After 30 min, carefully remove comb and transfer tray to the electrophoresls tank. Cover gel with enough buffer to a depth of l-2 mm. 3. Prepare sample (10 pL): 2.25 pL nucleic acid preparation (1 mg/mL), 1 pL 1OX MAE buffer, 1.75 PL 37% formaldehyde, 5 PL deionized formamide. Incubate at 55°C for 15 mm, then place in ice. Add 2 PL gel loading buffer, load and run in 1X MAE buffer at 100 V constant voltage. 4. Stop electrophoresls when Bromophenol blue (BPB) is about 1 cm apart from the end of gel. Turn off current and caretilly transfer the gel to a standard capillarity transfer set (22,13). Blot RNA onto a nylon membrane cut to size leaving overnight at room temperature. 5. After transfer, remove tissues and filter paper and with a ballpoint pen mark the position of sample wells. Expose membrane to UV light for 5 min to link nucleic acid. 6. Place membrane into a homemade plastic bag (follow step 4 in Section 3.2.1.) and prehybridize with 150 pL of prehybridizatlon mix (6X SSPE, 5X Denhardt’s solution, 240 pg/mL 5S DNA, 50% deionized formamide) for each cm2 of membrane at 42OC for at least 1 h in a shaking bath (see Note 16).
Identification
of Viruses
69
7. Replace prehybrrdrzation mrx with a fresh hybridizatron solution (6X, SSPE, 5X Denhardt’s solution, 240 pg/mL 5s DNA, 50% deionized formamide) (follow step 7 in Section 3.2.1.) containing about 1 x 1O6cpm of [32P]-labeled riboprobe per milliliter. Hybridize overnight at 42OCunder continuous shaking (see Note 16). 8. After hybridization, carefully open the bag (follow step 8 in Section 3.2.1.) (use a perspex shield as opening the bag often causes spillage of radloacttve material) and wash membrane four times for 20 mm with 250 mL of a preheated solutton of 0.1X SSC, 0.1% SDS at 65°C (see Note 17) under continuous shaking. 9. After the last wash, wrap membrane while moist (see Note 18) into a piece of cling film and expose to X-ray film at -70°C m an autoradlographrc cassette.Develop the film. 10. If blotted samples must be reprobed, remove probe by boiling membrane in a large volume of sterile distilled water containing 0.1% SDS for 1 h. While moist, wrap with a piece of cling film and expose overnight at -7OOC against an X-ray film to be sure all the probe has been removed. 11. Prehybndize, hybrrdize, and wash with a new probe. Southern Hybridization This hybridization format can be used for identification of specific fragments of nucleic acid of DNA plant viruses (geminiviruses, caulimoviruses, badnaviruses). A native DNA preparation is first separated into discrete fragments by electrophoresis, then denatured while in the gel, and transferred by capillary blotting to a piece of nylon membrane that is then hybridized with either specific RNA or DNA probes (see Section 3.3.). 3.2.4.
1. To prepare a 10 x 6 cm 1.2% agarose mimgel, melt 180 mg agarose in 15 mL of 1X TBE buffer, let it cool to 6O”C, pour the gel into the tray, then place the comb. 2. After 30 min, carefully remove the comb and transfer tray to electrophoresis tank. Cover the gel with enough 1X TBE buffer to a depth of l-2 mm. 3. Prepare sample (12 pL): 1 I-IL DNA preparatron (1 mg/mL), 9 pL TE, 2 pL gel loading buffer. Load and run m 1X TBE buffer at 100 V constant voltage. 4. Stop electrophoresis when BPB IS about 1 cm apart from the end of gel. Turn off current and carefully transfer the gel into the DNA denaturing solution. Leave for at least 15 mm and repeat mcubation twrce with fresh solution. Replace DNA denaturing solutron with DNA neutralizing solution, leave for 30 mm, and repeat incubatron twice wrth fresh solution.
Gallitelli
and Saldarelli
5. Transfer the gel to the capillarity transfer set up to blot DNA onto nylon membrane. 6. Perform prehybrtdtzatron, hybridrzation, and washes with radiolabeled RNA probes, as described in Section 3.2.3. (see Note 19).
3.3. Nucleic
Acid Probes
Nucleic acid probes can be DNA or RNA, single- and double-stranded. We routinely use single-stranded RNA probes labeled with either [32P]
or with digoxigenin. Riboprobes can be prepared readily from segments of viral genomes cloned downstream from a promoter for bacteriophage RNA polymerase. This sequence may be already present in the plasmid used for cloning or can be inserted de IZOVOif synthetic oligonucleotides
containing it are used to synthesize double-stranded cDNA to be cloned. Unless required for specific purposes, the trend is to prepare and use RNA instead of DNA probes because: 1. The majority of plant viruses have RNA genomes; 2. Single-stranded probes have a lower possibility of self-annealing than double-stranded probes; 3. RNA:RNA hybrids are more stable than and RNA:DNA and DNA:DNA hybrids.
The third feature allows the use of highly stringent hybridization conditions, thus enhancing probe specificity and reducing background problems owing to the interference of plant sap.
There are commercial kits from several companies for each type of probe and we suggest to use these kits rather than to buy reagents separately, Buying a kit may be more expensive but the results are usually guaranteed. 3.4. Sandwich Hybridization In this type of reaction, two sequencescomplementary to two adjacent but not overlapping parts of the target nucleic acid are allowed to form hybrids in solution. The two sequenceshave different labels in order to be used as capture and probe, respectively. In particular, the capture carries an affinity tag that at the end of the hybridization in solution can be trapped by a counterpart immobilized onto a solid support (microtiter plates, coated tubes, or spheres). The trapped hybrid is then detected by the label carried by the probe (14-16). In our laboratories, this method
was adapted for detection of a virus infecting artichoke (17) to avoid nonspecific background owing to artichoke plant sap in nonradioactive
Identification
of Viruses
nucleic acid hybridization systems. The limit of detection was between 10 and 100 pg viral RNA per 100 mg of infected tissues. 3.4.1. Synthesis of the Biotinylated RNA Capture Molecule 1. Linearize the selected clone with an appropriate restrtctlon enzyme. Since the capture molecule 1sRNA, the selected molecule must be Inserted downstream a bactertophage SP6 or T7 RNA polymerase promoter sequence. 2. Perform transcription reaction (100 pL) in a 1.5&L Eppendorf tube as follows: 1 pg of linearized plasmid, 4 mM each ATP, CTP, GTP, 4 mM biotinylated UTP (Bio- 11-UTP), 1X transcription buffer (usually provided with the enzyme), 10mM DTT, 25 U HPRI (e.g.,Amersham),20 U of bacteriophage SP6 or T7 RNA polymerase, and sterile RNase-free water to 100 pL. Incubate for 2.5 h at 37°C then digest plasmid DNA with 5 U of RNase-free DNase (e.g., RQl DNase from Promega) by further incubation at 37OCfor 20 mm. 3. Separate biotinylated transcripts from unmcorporated nucleotides and enzymes by spin column chromatography (Bio-Spin 30 columns) following manufacturer’s instructions 4. Estimate capture concentration. 3.4.2. Preparation of Digoxigenin-Labeled RNA Probe Molecule 1. Linearize the selected clone with an appropriate restriction enzyme. Since the probe molecule is RNA, the selected molecule must be inserted downstream a bacteriophage SP6 or T7 RNA polymerase promoter sequence. 2. Perform transcription reaction using Boehrmger Mannheim DIG-RNA labeling kit (follow manufacturer’s instructions).
1. 2. 3. 4. 5. 6. 7.
3.4.3. Sandwich Hybridization and Collection of Hybrids Formed in Solution Cut a piece of nylon membrane. Incubate overnight at 4°C with freshly prepared 2 p@mL streptavidin in PBS. Wash twice with PBS for 10mm with gentle shaking then incubate for 15min at room temperature with 0.01% glutaraldehyde in PBS (see Note 20). Remove excess of glutaraldehyde by washing four times for 15 min with PBS contaming 0.1% Tween-20. Equilibrate the membrane twice with TN buffer for 15 min then saturate nonspecific sites with 1% blocking buffer (e.g., Boehringer Mannhelm) in TN (see Note 2 1). In a sterile mortar crush 100 mg of infected tissue (see Note 22) in 300 pL 0.5% SDS. Move 38 pL to a sterile 0.5~mL Eppendorf tube containing 82 pL of the hybrtdization solutton.
72
Gallitelli
and Saldarelli
8. Incubate at 60°C for 4 h. 9. Place streptavidm-coated membrane onto a microfiltration apparatus connected with a vacuum hne. Load each slot with a sample hybridized in solution and allow to be sucked through the membrane under gentle vacuum. 10. Incubate membrane at 37°C for 30 mm in a moist chamber (see Note 23). 11. Remove uncaptured hybrids by washing four times for 15 min at 55°C in 0.1X SSC containing 0.1% SDS with gentle shaking. 12. Detect captured hybrids according to Boehrmger Mannhelm DIG-RNA detection kit manual.
3.5. In Situ Hybridization In situ hybridization provides an excellent system to study tissue or cellular specific patterns of viral gene expression. Hybridization may be performed onto suitable sections of plant material prepared for either electron or optical microscopy. In the most simple format, in situ hybridization can be used as diagnostic method to detect the presence of specific viral nucleic acid segments associated with a particular plant tissue. We have applied this technique to detect cucumber mosaic virus (CMV) m sections of tomato fruit stalks (18). 1. 2.
3. 4. 5. 1.
2.
3.5.1. Tissue Preparation (19) Cut tomato fi-uit stalks m 4-6 mm long segments and fix in freshly prepared 10% formaldehyde, 5% glacial acetic acid, 50% ethanol in distilled water for 48 h. Dehydrate tissues with a series of graded tertiary butyl alcohol (35,50,70, 90, and 100%) for 2 h each. Transfer dehydrated tissues to a solution containing 50% Parawax (58°C melting point) m 50% tertiary butyl alcohol and leave overnight to equilibrate at 65°C. Embed in molten Parawax. Cut 10-12 pm thick cross sections and place them on microscope slides (see Note 24). Remove Parawax by soaking shdes in xylene for 48 h at room temperature. 3.5.2. Probe Linearize the selected clone with an appropriate restriction enzyme. Since the probe is RNA (see Section 3.3. for comments), the selected molecule must be Inserted downstream a bacteriophage SP6 or T7 RNA polymerase promoter sequence. Synthesize a radiolabeled riboprobe with a SP6/T7 transcription kit (e g , Boehringer Mannheim) using [35S]UTP aS with 800 Ci/mmol specific activity.
Identification
of Viruses
73
3.5.3. Hybridization 1, Place slides on the rods of a moist chamber (see Note 23) kept horizontally and careFully cover with 1 mL of PBSE containing 50 pg/mL protemase K. Incubate for 12 min at 37°C. 2. Move slides to a Coplm staining jar and remove excessof proteinase K by gently washing three times for 5 min with PBSE (do not shake). 3. Replace washing solution with 4% formaldehyde in PBS and incubate for 4 h at 4OC.Wash off excessformaldehyde twice with PBSE and twice with sterile distilled water for 2 min at 4°C. 4. Move slides back to moist chamber and prehybridize covermg each slide with 500 PL of hybridization solution. Incubate at 42OC for 1 h. Carefully pour off prehybridization solution and replace with 200 pL of hybridization solution containing 1.5 x lo6 cpm/mL of riboprobe. Hybridize at 42°C overnight. 5. Remove unbound probe by washing twice with 2X SSCE at 42°C for 30 mm, once for 15 min at 65”C, then twice at 42°C for 30 min. Perform last wash for 15 min with sterile distilled water at room temperature. 6. Dehydrate sections with graded ethanol dilutions (70, 80, 95, 100%) for 2 min. Gently dry down sections with a hair dryer.
3.5.4. Autoradiography 1. Incubate NTB2 Kodak stock emulsion at 40°C for 2 h. 2. In a darkroom equipped with a dark red safelight dilute NTB2-2 with an equal volume of warm (40°C) sterile distilled water in a Coplin staining jar. Invert the jar gently to ensure that the emulsion is properly mixed and to remove air bubbles. 3. Gently dip each slide for 20 s then withdraw and allow to drain for 2 h in the dark. Return the emulsion to the water bath every few minutes to keep it warm. 4. Place the slides in a slide box with silica gel. Wrap with aluminium foil then expose at 4°C (see Note 25). Exposure time must be determined experimentally as it can vary from a few minutes to several days. 5. Develop emulsion by dipping for 4 mm in Kodak D19 developer at 18”C, then fix for 5 min in Kodak AL. Rinse gently in running tap water.
3.5.5. Staining 1. Stain sections with Safranine fast green following standard procedures (see Notes 24 and 26). 2. Mount the coverslip with few drops of a solution of 40% Synocryl9122X in xylene. 3. Observe slides with a compound microscope.
74
Gallitelli
4.1. Dot-Blot,
and Saldarelli
4. Notes Northern Blot, and Southern
BZot
1. Nttrocellulose filters bind DNA and RNA very efficiently and the bindmg procedure is simple but as a consequence of the noncovalent binding of the nucleic acid to the filter, it tends to lose nucleic acid molecules under prolonged and repeated hybridizations at high temperature. However, the main disadvantage remains the fragility of mtrocellulose when dried and particularly when reused with a new probe after removal of the first. Nylon membranes also bind nucleic acids very efficiently because a covalent bmding can be mduced by UV irradiation. Unlike nylon, nitrocellulose membranes are flammable and cannot be exposed to UV because of the risk of fire. Because of the type of binding, nylon membranes can give a high background with some plant extracts and with some nonradioactive reporter systems.However, their main advantage is the very high physical strength that allows repeated handling and reusing with limited or no damage. Nylon+ has a positively charged surface that enhances its binding capacity for nucleic acids and does not require UV exposure when alkalidenatured samples are used. Its use is recommended for some nonradioactive reporter systems,although, background problems can arise consequent to the higher binding capacity. 2. Keep separate bottles of reagents for DNA and RNA manipulations. Aerosol produced during operations may contaminate stock solutions. 3. Procedures for the purification of most known plant viruses are now available. The objective m purification is to obtain the maximum amount of physically and chemically undamaged, biologically active virus particles, free from host plant contaminants, but because viruses differ greatly m their properties, a range of different purification procedures have been described. The main steps of plant virus purification are outlined hereafter: a. Host: The virus should multiply to high concentration in the host species selected for purification purposes. The host should be free of inhibitors and its components should be easily separable from virus particles. It is also important that the host can be grown quickly from seeds and that virus can reach its highest titer within a relatively short period of time (2 wk) from inoculation. Speciesof tobacco are very suitable hosts for a great variety of viruses. b. Extraction procedure: Whenever possible, systemically infected leaf material, freshly harvested, should be the source of choice for vu-us purification. Virus particles are extracted by crushing infected leaves in a suitable extraction medium at 4°C with a commercially available food
Identification
of Viruses
blender. Time and speed of homogenization depend from fragility of virus particles. Shorter time and low speed should be used with long, rod-shaped viruses. The extraction medium usually contains: i. l-2 vol (referred to weight of plant tissues) of buffer (potassium phosphate, pH 7-8; sodium borate, pH 7.6-8.5; sodium acetate, pH 4.5-6.2; sodium citrate, pH 6.0-7.4, Tris-HCl, 7.2-8.4) with molarity rangmg from 100-500 mM; ii. l-2 vol of solvent (n-butanol, chloroform, carbon tetrachloride) and/or l-2% detergents (Triton-X100, Tween-20); iii. 10-l 00 mM chelating agents (NazEDTA, DIECA); and iv. 0. l-l % reducing agents (ascorbic acid, sodmm sulfite, thioglycolic acid, 2-mercaptoethanol). c. Clarification of extracts and concentration of virus particles: Two cycles of differential centrifugation (low and high speed centrifugation) or PEG (polyethylene glycol, mol wt 8000) precipitation are commonly employed to remove most of plant constituent and to recover virus particles from large volumes used during purification. Pellet of vnus particles can be redissolved into a small (400 l.tL) vol of a suitable medium (buffer, sterile distilled water, 50 rnM NaCl). d. Further purification of particles: If required, virus particles can be further purified by sucrose density gradient centrifugation or by isopicnic centrifugation in strong solutions of cesium salts. Cesium chloride is widely used for viruses that are sufficiently stable in this salt, as it allows to obtain highly purified preparations of virus particles. Viruses that are unstable in cesium chloride may be stable in cesium sulfate, but the degree of purity obtainable with this salt is generally lower. e. Storage: Purified particles of most plant viruses can be stored at -2OOC in a sterile solution of 50 mA4NaCl containing 50% glycerol and trace amounts of sodium azide (sodium azide is highly toxic). 4. Avoid use of phosphate buffers to resuspend purified vnus particles, as it could precipitate SDS during nucleic acid extraction. 5. With time, RNase tends to degrade RNA even when stored at -7O”C, especially when thawed and frozen frequently. For long storage, divide sample into aliquots and keep RNA precipitated with ethanol. When necessary, simply centrifuge and resuspend pellet into the original volume of RNasefree water or TE. 6. Further purification can be achieved incubating TNA preparations overnight in ice with 2M LrCl. In the presence of this salt, high molecular weight single-stranded RNAs precipitate and can be recovered by centrifugation. Other nucleic acid species (i.e., double-stranded RNA, small
76
7.
8. 9. 10. 11.
12. 13. 14. 15.
16.
Gullitelli
and Saldarelli
RNAs, and DNA) are soluble in 2M LiCl, but can be precipitated by overnight mcubation m ice in the presence of 4MLiCl. These procedures may be very useful to fracttonate virus-specific dsRNAs, small RNAs (satellite RNAs), or to enrich preparations with certain RNA species of interest. This may be the case when primary transcripts of viral genes used to transform plants must be detected. Since this procedure can be used with plant material collected from the field, it is recommended to wash the sample while in the bag, with distilled water prior to crushing. If available, a “pasta maker” machine can be used instead of pestle. The bag containing plant leaf sample and extraction medium is passed twice between rolls of the machine. This greatly speeds up extraction procedures and overcomes the risk of breakmg plastic bags, Alkah denature RNA quickly; do not use mcubanon time longer than 5 min. Use nylon membranes with radiolabeled probes. After blotting is complete, expose membrane to UV light for 5 mm to lmk nucleic acid, then follow steps 6-l 1 m Section 3.2.3. Do not use commercially available plastic bags (i.e., for food) as they could melt if exposed at high temperatures during hybridization In our laboratories up to six different probes were used simultaneously without observing any appreciable reduction in sensitivity. This can help in identifying infected plants m a large number of samples that can be infected by different viruses. Positive samples must be reprobed singly with each probe for detection of mixed infections and proper identification of the viruses. Sensitivity will be enhanced using freshly prepared substrate. The method described allows to use only 4 mL of substrate solution instead of 10 mL, as suggested in the kit manual. A cling film could be used instead, but this will cause the filter not to be perfectly flat. This condition may affect sensitivity. Different exposure times should be tried to obtain the best signal/background ratio. RNA preparations denatured with 50% formamide at 95°C for 2 min and then run in TBE buffer are also suitable for Northern blotting. However, blotting onto the membrane a nonfully denatured RNA may reduce sensitivity. Probe specificity can be enhanced using prehybridtzation, hybridization, and washing temperatures higher than 42°C. In our experience, it was useful to perform experiments at temperatures up to 63°C in 50% formamide to distinguish between closely related vnuses. Trying different hybridization temperatures may be necessary to obtain better results.
Identification
of Viruses
17. This is a very stringent wash that could melt less stable hybrids. Determinmg stability of the hybrid at three different stringencies (i.e., 2X SSC, 1X SSC, 0.1X SSC) may be necessary. 18. Do not allow the filter to dry or it could be very difficult to remove hybrids for reprobing. 19. With radiolabeled DNA probes, use 6X SSC, 5X Denhardt’s solution, 240 pg/mL 5s DNA, and prehybridization and hybridization at 65°C. Wash as for RNA.
4.2. Sandwich
Hybridization
20. Glutaraldehyde crosslinks streptavidin to the nylon membrane very efficiently. If not linked, streptavidin may be released from the filter during washing at high temperature. 21. Calculate the time occurring for each step to be performed in order to obtain the streptavidm-coated membrane to be ready by the end of solution hybridization. Do not allow membrane to dry. 22. Collect samples when virus titer in infected plants is at its peak. 23. Prepare a moist chamber using a large rectangular plastic box with lid (e.g., a refrigerator storage box). Place several sheets of hand paper towels at the bottom of the box and wet with distilled water. On top of paper towels, place some plastic rods (diameter 0.8-l 0 mm) to support a container for the membrane. Tightly close the box with lid and place into an incubator at 37°C.
4.3. In Situ Hybridization 24. The hardness of paraffin should match the type of plant tissue. Good results in sectioning and staining require great experience that may invoke the help of someone skilled m these techniques. 25. Exposure time must be determined experimentally, as it could vary from a few minutes to several days depending on the titer of viral RNA in infected tissue. 26. Staining may not be necessary. If hybridization signal is strong enough, the silver grains produced by autoradiography can be seen easily as black areas under the light microscope. However, staining gives better contrast and allows a better identification of tissues by their different coloration.
Acknowledgment Grateful thanks are owing to G. P. Martelli for helpful suggestions and for revising the text.
78
Gallitelli
and Saldarelli
References 1 Owens, R. A and Diener, T. 0. (1981) Sensitive and rapid diagnosis of potato spindle tuber vrroid disease by nucleic acid hybridtzatron Science 213, 67M72. 2 Owens, R A. and Diener, T. 0 (1984) Spot hybridization for detection of vrroids and viruses, in Methods rn fir&a, vol 7 (Maramorosh, K. and Koprowkr, H , eds.), Academic, New York, pp 173-l 87 3. Maule, A. J., Hull, R., and Donson, J. (1983) The application of spot hybridization to the detection of DNA and RNA viruses in plant tissues. J Vzrol Meth. 6, 2 15-224 4 Thomas, P. S. (1980) Hybridization of denatured RNA and small DNA fragments transferred to mtrocellulose. Proc Natl. Acad. Scz. USA 77,5201-5205. 5. Southern, E. M. (1975) Detection of specific sequences among DNA fragments separated by gel electrophoresis. J Mol. Biol 98,503-5 17. 6 Denhardt, D. T (1966) A membrane-filter technique for the detection of complementary DNA. Biochem Bzophys Res Comm 23,641-646 7 White, J. L. and Kaper, J M (1989) A simple method for detection of viral satellite RNAs in small plant tissue samples. J Viral Meth 23,83-94 8 Saldarelh, P , Gughelmi Montano, H., and Martelli, G. P. (1994) Non-radioactrve molecular probes for the detection of three tilamentous vn-uses of the grapevme. Vltu 33, 157-160 9. Holtke, H.-J. and Kessler, K. (1990) Non-radioactive labeling of RNA transcripts in vztro with the hapten digoxrgenm (DIG); hybridization and ELISA-based detection. Nuclezc A&s Res 18(19), 5843-5851 IO. Boulton, M I. and Markham, P. G. (1986) The use of squash-blotting to detect plant pathogens m insect vectors, in Developments and Applications in Vzrus Testzngs (Jones, R. A. C and Torrance, L., eds.), Association of Applied Biologists, Wellesbourne, Warwick, UK, pp. 5H9. 11 Seed, B. (1982) Drazotizable arylamme cellulose paper for the couplmg and hybndtzatron of nucleic acrd. Nucierc And Res. 10, 179Q-1810. 12. Mathew, C. G. P. (1984) Detection of DNA sequences-the Southern t transfer, in Methods EnMolecular Bzology, vol 2, Nucleic Acids (Walker, J. M , ed.), Humana, Clifton, NJ, pp. 55-66. 13. Sambrook, J., Fritsh, E. F., and Maniatis T. (1989) Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 14. Syvanen, M. C., Laaksonen, M., and Soderlund, H (1986) Fast quantification of nucleic acid hybrids by affinity-based hybrid collection Nuclezc Acids Res. 14, 5037-5048.
15 Ranki, M , Palva, A., Vntanen, M., Laaksonen, M., and Soderlund, H. (1983) Sandwich hybridization as a convenient method for detection of nucleic acids in crude samples, Gene 21,77-85. 16. Rouhianen, L , Laaksonen, M., Karjalainen, R., and Soderlund, H. (1991) Rapid detection of a plant virus by solution hybridization using ohgonucleotrde probes. J Vlrot Meth 34,81-90.
Identification
of Viruses
17. Barbarossa, L., Grieco, F., Iosco, P., and Gallitelli, D. (1994) Use of polymerase chain reaction and sandwich-hybridizatton for detecting artichoke mottled crinkle tombusvirus in arttchoke. J Phytopathol. 140,201-208. 18. Crescenzt, A., Barbarossa, L., Cello, F., Di France, A., Vovlas, N., and Gallitelh, D. (1993) Role of cucumber mosaic vuus and Its satellite RNA m the aetiology of tomato fruit necrosis m Italy. Arch Vzrol. 131, 321-333. 19. Horns, T. and Jeske, H (1991) Locahsation of abuttlon mosaic vu-us (AbMV) DNA within leaf tissues by m situ hybridizatton. Vzrologv 181,580-588.
CHAPTER6
Improved PCR Methods for Identification of Phytopathogenic Viruses Angelantonio and Donato
Minafra Gallitelli
1. Introduction Knowledge of the nucleotide sequence of a viral genome enables the design of specific oligonucleotides for use as primers for selective amplification of a target nucleic acid from a pool of complex template by a polymerase chain reaction (PCR) driven by Taq, a thermostable DNA polymerase (1,2). The amplified fragment can be analyzed by gel electrophoresis for its presence or characterized by nucleic acid hybridization and restriction enzyme digestion for its heterogeneity. One of the major advantages of PCR is the possibility of increasing the concentration of pathogen-related sequencesthat in naturally infected hosts are below detection level, either because they occur in extremely low amounts or because they are localized in certain tissues (i.e., phloemlimited viruses) or are erratically distributed. Since Taq polymerase recognizes only DNA templates, in order for it to be applied to RNA viruses, PCR first requires a reverse transcription step (RT-PCR). In a RT-PCR protocol, antisense primers for synthesis of first-strand cDNA represent one of the most crucial factors for specific amplification. To ensure strain specificity, these primers should be selected within regions of the genome that are highly variable among From
Methods Nuclerc
w Molecular Biology, Acrd Methods Edited
Vol 50 Specres D/agnostrcs Protocols PCR and Other by J P Clapp Humana Press Inc , Totowa, NJ
81
82
Minafra
and Gallitelli
members of the same group (3). Sense primers are usually chosen in more conserved regions as the “selection” has been already made by the antisense primers for first-strand synthesis of cDNA. The sensitivity of PCR amplification can be enhanced if the template is a viral nucleic acid released from viral particles that were first trapped onto a solid support by a specific antiserum. This system, named immunocapture-PCR (TC-PCR) allows the use of sample volumes 200250 times larger than those utilized in standard PCR. The sample is placed in an enzyme-linked immunosorbent assay (ELISA)-type microtiter plate precoated with antibodies to the virus. After washing out plant sap, immunocaptured viral particles are disrupted to release nucleic acid, which is then subjected to PCR or RT-PCR amplification, depending on its nature (i.e., DNA or RNA). A recent study on plum pox virus (PPV) detection (4, reports that IC-PCR is 250-, 625-, and 5000-fold more sensitive than standard PCR, nucleic acid hybridization, and ELBA, respectively. Immunocapturing can also be carried out with monoclonal antibodies (MAbs) raised against double-stranded RNA molecules (5) with a high level of secondary structure, like some satellite RNAs and viroids. One should be aware, however, that particularly dilute templates fail to raise the number of molecules to detectable levels, since the amplification reaction terminates before the amplified product can reach a satisfactory concentration. This shortcoming has been overcome by a modified PCR procedure called transcription amplification-PCR (TASPCR) (6). A TAS-PCR protocol involves the initial generation of cDNA duplexes with primers also containing binding sequences for bacteriophage RNA polymerases. Following amplification, viral sequences may reach a level that is not related to the initial amount of RNA template and the reaction does not proceed further, even if new enzyme and deoxynucleotides are added (6). However, these products can be further amplified by transcription with RNA polymerase that recognizes promoter sequencesoriginally included in the primers and then amplified in the PCR products. In this case, the final detectable TAS product will be dsRNA. It was shown (6) that the TAS procedure yields an amplification signal lo- to 1OO-fold higher than that of standard PCR. The main disadvantage of PCR, i.e., enough of the viral sequence must be known in order to synthesize primers, can be overcome by the use of
Improved
PCR Methods
group-specific degenerate primers that allow identification of a range of more or less closely related viruses (7). The possibility of coamplifying templates of different viruses in a single reaction using a set of specific primers opens up the possibility of simultaneous detection and identification of widely separated viruses in the case of mixed infections (8).
This may be a useful approach to diagnosis of viral diseases affecting vegetatively propagated species, in which there has been an accumulation in time of a great array of viruses, as, for example, with grapevine and artichoke. 2. Materials Molecular biology or analytical grades are suggested for all chemicals. All solutions should be sterilized before use. Solutions that do not need sterilization will be marked with an asterisk (*). Whenever possible, use stock solutions to prepare working solutions. Unless otherwise stated, all solutions are stable at room temperature for several months.
2.1. IC-PCR 1, TE: 10 mM Tris-HCl, 1 mMNa*EDTA, pH 8.0. 2. Coating buffer: 15 mA4Na2C03, 35 mMNaHC03, 3 mMNaN3, pH 9.6. 3. Washing buffer: 137 mMNaQ1.5 mMKH,PO,, 8 mMNa2HP04; 2.5 mM KCl, 3 mMNaN3, 0.5 mL/L Tween-20, pH 7.4. 4. Extraction buffer: 50 mM sodium citrate, 2% polyvinylpyrrolidone (mol wt 25,000), pH 8.3, autoclave, and add diethyldithiocarbamate, sodium salt (DIECA) to 20 mJ4 only to the aliquot to be used. 1 5. Transfer buffer: 20 mA4Tris-HCl, pH 8.0, 1% Triton X-100. 6. NaOH solution*: 3MNaOH, 10 mMNa2EDTA. 7. First-strand cDNA synthesis master mix (20 pL): 4 p.L 5X reverse transcrlptase buffer (supplied with the enzyme); 5 pL 0.3M2-mercaptoethanol; 2.5 VL 10 mM (each) dATP, dCTP, dGTP, and dTTP; 1 pL RNasm (ribonuclease inhibitor) (40 U/pL, Promega, Madison, WI); 2.4 pL 100 mM dithlothreitol (DTT); 4 pL RNase-free water; and 1 pL cloned M-MLV reverse transcriptase (200 U/pL, Promega). 8. PCR master mix (final concentrations): 1X Taq polymerase buffer (e.g.,
Promega,supplied with the enzyme); 1 mM MgC12,200 @4 (each)dATP, dCTP, dGTP, and dTTP; 120 pMeach of complementary and homologous primers; 1 U of Taq polymerase. 9. For electrophoresis and hybridization techniques refer to Chapter 5 of this volume.
84
Minafra
and Gallitelli
2.2. Multiplex PCR 2.2.1. Grapevine Refer to Section 2.1. 1. 2. 3. 4. 5. 6. 7.
2.2.2. Artichoke Extraction Medium (EM): 0.1% n-lauroylsarcosme (sodmm salt), 0.1% Triton X- 100,40 n&J DTT. First-strand (complementary) primers mix (100 uL): 6-12 pmol/uL for each primer in RNase-free distilled water. Store at -20°C. Amplification (complementary + homologous) primers mix (100 pL): 2-4 pmol/uL for each first-strand primer; 7.5 pmol/uL for each secondstrand primer. Store at -20°C. PCR master mixture (78 uL): 10 pL amplification primer mix; 7.8 uL 0.8X Taq polymerase buffer (supplied with the enzyme); 300 lJ4 (each) dATP, dCTP, dGTP, and dTTP; 2.25 mMMgC1,. Agarose gel electrophoresis buffer (2X): 60 mMNa2P04, 70 mMTris-HCl, 1 mMNazEDTA, pH 7.8. Human Placental Ribonuclease Inhrbitor (HPRI). For electrophoresis and hybridization techniques refer to Chapter 5 of this volume.
3. Methods 3.1. IC-PCR IC-PCR amplification has been successfully applied to detection of grapevine trrchoviruses A (GVA) and grapevine leaf roll-associated closterovirus III (GLRaV III) in host tissues and to detection of GVA in a single mealybug (Pseudococcidue), which is its natural vector (8). 1. Coat ELISA microplate wells (see Note 1) with 200 uL of carbonate coatmg buffer containing 1 pg/mL of protein A. Seal microplates with parafilm and incubate at 37OCfor 2-3 h. 2. Wash wells three times for 3 min with 200 pL of washing buffer. 3. Coat with 200 pL of specific polyclonal antiserum appropriately diluted (best dilution to be determmed according to the antiserum titer) m 1X PBS buffer (see Note 2). Incubate at 37“C for 2 h. 4. Crush 100 mg of leaf petioles or cortical scrapings from dormant mature grapevine canes (see Notes 3 and 4) in 1 mL of ice-cold extraction buffer with sterile mortar and pestle. Add a small amount of sterile carborundum powder to help crushing. Pour the slurry into a sterile 0.5-mL Eppendorf tube and keep in ice until all samples are ready for centrimgatton.
Improved
PCR Methods
5. Centrifuge (with an Eppendorf-type centrifuge) at half speed for 5 min. Transfer supernatant to a fresh Eppendorf tube and discard pellet. 6. Wash the microplate wells coated with the antiserum (see step 3) three times with washing buffer. 7. Place 200 pL of the supernatant extracted from grapevine tissues in each well. Seal with parafilm and incubate overnight at 4°C to trap virus particles. 8. Wash wells four to SIXtimes for 2 min with 200 yL washing buffer. Do not allow wells to dry after the last wash. 9. Place 25 FL of preheated (65°C) transfer buffer in each well. Incubate the microplate in a water bath at 65OCfor 5 min. During this period shake the mlcroplate vigorously a couple of times to facilitate releasing RNA from the virions into the transfer buffer (see Note 5). 10. RapIdly transfer solution with released RNA from mlcroplates to 0.5-mL Eppendorf tubes and add 1 FL of primer (1 pg/kL) complementary to viral RNA. 11. Incubate tubes for 5 min in boiling water to denature RNA (see Note 5). Chill on ice for 2 min. Spin down the condensed water and add 6 pL of 5X reverse transcriptase buffer (see Note 6) (usually supplied with the enzyme). 12. Allow viral RNA and pnmer to anneal for 30 min to 1h at room temperature. 13. Prepare the master mixture for cDNA synthesis-containing enzyme, nucleotides, and stabihzing compounds, and add 20 PL of this solution to each tube. Mix by vortexing. 14. Perform first-strand cDNA synthesis at 42OC for 1.5 h. 15. Prepare the master mixture for PCR amphfication (see Note 7) and transfer 45-pL ahquots to a fresh 0.5-mL Eppendorf tube. Cover with a drop of mineral 011,and incubate for 10-20 min at 85OCto melt any nonspecific hybridization between primers (see Note 8). Then add at the bottom of each tube a 5-pL aliquot from the first-strand cDNA reactlon and immediately raise the temperature to 94°C. 16. Perform amplification with 30 cycles for 30 s at 94°C to denature the template, 30 s at 62°C to allow specific annealing between primers and template and 45 s at 72°C for polymerase activity. Allow a final elongation step at 72°C for 10 min. 17. Visualize PCR-amplified DNA products by polyacrylamide gel electrophoresis in a 6% slab gel m 1X TBE. Stain the gel with silver stain and estimate the size of DNA fragments using any suitable commercial marker ranging from 100-1000 bp. Alternatively, perform a dot-blot or slot-blot hybridization (see Note 9).
Minafra 3.2. Multiplex
and Gallitelli
PCR
Multi-primer amplification has been applied to grapevine infected by GVB and GLRaV-III (8) and to artichoke infected by artichoke mottled crinkle tombusvirus (AMCV), artichoke Italian latent nepovirus (AILV), and artichoke latent potyvirus (ALV) (F. Grieco and D. Gallitelli, unpublished results). 3.2.1. Grapevine 1. Weigh 100 mg grapevine tissues (see Note 10) (leaf petioles or cortical scrapings from dormant mature canes) and store in a refrigerator or on ice wrapped with alummum for1 to prevent dehydration until processing, 2. Grind with mortar and pestle, prechilled in an ice bath, with 1 mL cold extraction buffer and some carborundum. 3. Pour in an Eppendorf tube and centrifuge at half speed with an Eppendorf centrifuge for 5 min. 4. Discard the pellet and save supernatant in a clean tube. Place in ice. 5. Dilute (see Note 11) l-50 yL of clarified extracts to 100 pL with RNasefree sterile water. Add 5 pL of the dilutions to 1 pL of complementary primers of GVB and GLRaV-III (0.5 PL each from 1 l.tg/uL stock solution) (81. Bring the volume to 24 pL with RNase-free sterile water. 6. Boil for 5 min at 100°C to denature RNAs (see Note 12). Chill immediately on Ice. 7. Spin briefly and then add 6 pL of 5X reverse transcriptase buffer. 8. Anneal primers to RNA templates incubating for 30 min at room temperature. 9. Add 20 pL of first-strand cDNA synthesis master mixture to each tube (see Section 3.1., step 13). 10. Perform cDNA synthesis at 42°C for I .5 h. 1I. Prepare master mixture for PCR amplification (see Section 3.1.) step 15). Put tubes into thermocycler apparatus only when temperature is over the melting point of primers (85-86’C). 12. Perform amplification and detect amplified fragments as described in Section 3.1., steps 16 and 17 (see Note 13). 3.2.2. Artichoke 1. Crush 100 mg of artichoke leaf tissue (see Note 14) in 300 pL of EM. Transfer to a 1.5~mL Eppendorftube and centrifuge briefly to pellet debris. 2. Prepare IO-fold dilutions of the supernatant in 10 nU4 DTT (see Note 15) and add 2 uL of each dilution to 7 pL of RNase-free distilled water. Add 2.5 uL of first-strand primer mix (see Note 16).
Improved
PCR Methods
3. Incubate samples at 90°C for 5 min to denature RNAs. Chill on ice for 2 min. Spin down the condensed water and add 4 PL of 5X reverse transcriptase buffer (usually supplied with the enzyme). 4. Allow viral RNA and primers to anneal at room temperature for 15-30 min. 5. Add m sequence to each tube: 2 pL 100 mM DTT, 1 pL dNTPs mix, 1 PL HPRI, and 1 pL M-MLV reverse transcriptase (200 U/pL). 6. Perform first-strand cDNA synthesis at 37OC for 1.5 h. 7. Prepare a master mixture for PCR amplification and add 78 pL to each tube. Place tubes into the thermocycler and raise temperature to 94°C. Incubate for 5 mm. 8. Shake each tube by hand to bring down condensed water and add 2 PL of Tuq polymerase (1 U/pL). Cover solution with one drop of mineral oil and perform 35 cycles of amplification for 1 min at 94”C, 1 min at 52”C, and 1 min at 72°C. Perform the final elongation step at 72OC for 10 min. 9. Remove mineral oil by vortexing in the presence of 150 PL chloroform. Spm down briefly and recover (upper) aqueous phase. 10. Precipitate amplified products at -7OOC for 30 min in the presence of 2.5 vol of absolute ethanol and 300 mM sodium acetate, pH 5.2. 11. Centrifuge (maximum speed for 10 min with an Eppendorf type centrifuge) to collect precipitate. Discard supernatant, and dry down the pellet under vacuum for 2-3 min (see Note 17). Resuspend pellet in 20 pL TE buffer and analyze 2 pL through 1.8% agarose gel electrophoresis m Tris-phosphate buffer (see Note 18). 12. Visualize bands by staining with ethidium bromide or perform Southern transfer (see Section 3.2.4. in Chapter 5 of this volume) to hybridize amplified products with selected probes.
4. Notes 4.1. IC-PCR 1. All steps of this procedure can also be carried out in 0.5-mL sterile Eppendorf tubes. This avoids transfer of solution containing released virions from microplate wells to the tubes (see Section 3.1.) step 10). However, handling a single microplate containing all samples instead of several tubes in the first steps of the procedure may be convenient. 2. MAbs (concentration estimated by dilution endpoint in Das-ELISA 1:32,000) to GVA diluted 1:lOO have been also successfully used to immunocapture GVA from grapevine and mealybugs. Therefore, use of single or mixed MAbs can be suggested.
88
Minafra
and Gallitelli
3. This procedure can also be applied to GVA detection in mealybugs. The choice of mealybugs to be analyzed represents a most critical step. Two species of mealybugs (Pseudococcus Zongispinus or Planococcus jkus) were reared on infected grapevine plants to acquire virus and on healthy potato sprouts (control). In all instances, plants and Insects were maintained at 28°C with relattve humidity higher than 80%. The acquisition time was up to 30 d, but crawlers were usually collected 8-10 d after transferrmg onto infected grapevines. Before extraction, mealybugs can be stored at 4°C m 50% ethanol for several weeks. 4. Use of liquid nitrogen to grind plant samples to a dry powder can be convenient. 5. The decapsidation and denaturation stepsmay not be compulsory. Nolasco et al. (9) demonstrated the possibihty to synthesize cDNA from immunocaptured virions without additional treatments. 6. We prefer to add a Mg2+ containing buffer for reverse transcription reaction after the boiling denaturation step, since Mg2’ ions have a catalyttc activity on RNAs that is enhanced at high temperature. 7. MgC12 and primer concentration greatly influence the rate of amplification for each specific cDNA. With higher concentration, presence of spurious bands can be expected, whereas at lower concentratton, no amplification at all can occur. In our hands, the optimal final concentration was 1 mM MgC12 and 120 pmol for each primer. Therefore, the use of a Mg2+ free amplification buffer to which desired amounts of MgC12 can be added is suggested. 8. Amplifying total nucleic acid rich in endogenous DNA could increase mispriming on nontarget molecules and, consequently, the background of spurious amphfied bands. Since our primers were chosen with a T, around 85°C to prevent mispriming, we found it useful to perform a “hot start step” before adding cDNA (10). 9. Transfer 15-pL altquots of PCR products to a fresh 0.5-mL Eppendorf tube (carefully wipe off any drops of mineral oil from the pipet tip), and denature with 1.5 pL of NaOH solution for 1 h at 60°C. Cool on ice, then neutralize adding 4.5 pL of 20X SSC. Prewet for a few mmutes in 2X SSC a nylon membrane and two sheets of 3MM filter paper and, after assembling a manifold water vacuum apparatus (e.g., Amersham, Arlington Heights, IL or BtoRad, Richmond, CA), spot all the volume and wash the wells with 200 pL of 2X SSC. Crosslink DNA to the membrane by exposing for 5 min to a UV source. Hybridize, wash, and detect with a chemiluminescent DNA probe according to the manufacturer’s suggestions.
Improved
PCR Methods
89
4.2. Multiplex PCR 4.2.1. Grapevine 10. We prefer to use, when available, leaf petioles and midribs instead of cortical scrapings. If analyzed in silver-stained gels, products obtamed from phloem scrapings can be partially masked by a heavy smear of brown compounds. This happens frequently with less diluted samples (see Section 3.2-l.) step 5). Nevertheless, mature canes of grapevines contain the highest concentration of phloem-limited viruses and are the samples of choice for obtaining unambiguous results but need to be appropriately diluted. I 1. Dilution conditions can vary for each sample, depending on virus concentration, source of samples (leaf or phloem), and consequent inhibitory effects of extracted polyphenolic compounds on cDNA synthesis. To set reactions, we suggest to use a dilution of clarified sap in final 50-uL cDNA synthesis reaction, ranging from 1:20-l : 1000 with an optimal average around 1:50-l :200. At low diluttons, inhibition on enzymatic reactions is complete. At dilutions >I : 1000, vtral detection is reduced because of its low concentration m infected tissues. When we tested purified viral RNAs diluted (1:200) m healthy grapevine extracts, the minimal amount detected was 1 and 0.5 pg of GVA and GVB viral RNAs, respectively. 12. We have observed that the decapsldation step at 65°C for 5 mm (see Section 3.1., step 9) can be omitted without any loss of amphfication efficiency. The boiling step degrades virions and denatures viral RNAs. Soluble viral dsRNAs in clartfied extracts offer a further source of template. 13. It is always a good practice to introduce, among PCR samples, a “water control” tube with 5 pL of sterile water in place of cDNA to be sure, using the same master mtxture, that contamination of carried-over amplified bands does not occur any time during the experiment. Aerosol-free tips can be helpful to avoid such a type of contamination while handlmg different samples and controls.
4.2.2. Artichoke 14. Collect young leaves of artichoke plants when the virus titer IS at its htghest in the infected plants. Use fresh samples, do not freeze. For unknown reasons, freezing may inhibit PCR. 15. As for other species rich m polyphenoltc compounds, dilution represents a crucial step in a RT-PCR amplification. With artichoke plant sap the best results were obtained with 1: 1000 dilution. Lower dilutions may work well but they must be tested because the result can be influenced by time of the year chosen for sampling, tissue storage conditions, artichoke variety, and so on.
Minafra
and Gallitelli
16. Primers for first-strand cDNA synthesis and amplification reactions must be selected carefully. First, specificity of each couple of primers for a desired template must be checked, i.e., by trying amplificatton of heterologous templates with each pair of primers. If there 1scross-hybridization, new primers must be selected. Second, the relative concentration of each pair of primers must be balanced to avoid premature saturation with only one type of amplificatton product to the expense of the others, which would remain at a subdetectable level. This may be partially overcome by selecting primers with similar Z’,, although most of the reaction also depends on denaturation of template. In spite of several attempts carried out so far, we failed to find the “best conditions” for simultaneous amphflcation of AILV, AMCV, and ALV. AILV was amplified to a detectable level only when its concentration in the sample was lo-fold that of ALV and AMCV. However, with this multiplex reaction limits of detection were 400 fg for AMCV and ALV and 4 pg for AILV. 17. Do not overdry DNA, because it may not be possible to resuspend it. Incompletely resuspended DNA usually floats when loaded in wells of agarose or polyacrylamide gel even in the presence of gel loading buffer. If this happens, incubate DNA preparation at 37°C for 15-20 mm, to facilitate resuspension. 18. DNA preparations can be electrophoresed thorough agarose gels n-t TBE or Tris-phosphate buffers. In our expertence, the latter allows a better separation of small size fragments (i.e.,
Acknowledgments The authors thank G. P. Martelli for helpful suggestions and for revising the text. References 1. Satki,R. K., Scharf, S.,Faloona,F., Mulhs, K. B., Horn, G. T., Erlich, H. A., and Harnheim, N. (1985) Enzymaticamplification of j3-globin genomtcsequencesand restriction site analystsfor diagnosisof sickle cell anemia.Sczence230, 1350. 2. Saiki, R. K., Gelfand, D. H., Stoffel, S., Schraf, S. J., Higuchi, R., Horn, G T , Mullis, K. B., andErlich, H A. (1988) Primer-dtrectedenzymaticamplification of DNA with thermostableDNA polymerase.Science 239,487. 3. Frenkel, M. J., Jilka, J. M., Shukla,D D , and Ward, C W. (1992) Dlfferenttation of potyviruses and their strainsby hybridization with the 3’ non-coding region of the viral genome. J. Vwol Methods 36, 5 l-62
4. Wetzel,T., Candresse,T , Macquaire,G., Ravelonandro, M., andDunez,J. (1992) A highly sensttive irnmunocapturepolymerase chain reaction method for plum pox potyvirus detectton.J. Viral Methods 39, 27-37
Improved
PCR Methods
5. Hadtdt, A and Yang, X (1990) Detection of pome fruit viroids by enzymatic cDNA ampltfication J Viral. Methods 30,261-270. 6. Rosner, A , Stem, A., and Levy, S. (1992) Transcrtptron ampltficatton of polymerase cham reaction products of bean yellow mosaic virus RNA extracted from gladtoll corms. Ann. AppZ Blol. 121,269-276 7 Pappu, S. S., Brand, R., Pappu, H. R., Rybrckt, E. P., Gough, K. H , Frenkel, M. J., and Niblett, C. L. (1993) A polymerase chain reaction method adapted for selecttve amphficatton and cloning of 3’ sequences of potyviral genomes. applicatton to dasheen mosaic virus J Virol. Methods 41,9-20 8. Mmafra, A. and Hadidi, A. (1994) Sensitive detection of grapevine virus A, B, or leafroll assoctated III from viruliferous mealybugs and infected tissue by cDNA amplification. J Vzrol Methods 47, 175-188 9. Nolasco, G., Blas de, C Tort-es, V , and Ponz, F (1993) A method combining immunocapture and PCR amplification m a microtiter plate for the detectton of plant viruses and subviral pathogens. J Vwol. Methods 45,20 l-2 18. 10. Chou, Q., Russel, M., Birch, D. E , Raymond, J., and Bloch, W. (1992) Prevention of pre-PCR and primers dimerization improves low-copy number amphticatton. Nucleic Azds Res 20, 17 17-l 723
CHAPTER7
PCR Detection
of HIV
1. Introduction The human immunodeficiency viruses type 1 and 2 (HIV-l, HIV-2) are members of the lentivirus subfamily of the retroviruses. As typical for all retroviruses, viral RNA replication requires the synthesis of a DNA intermediate, which is stably integrated into the host cell DNA (termed provirus). HIV can induce, after a long clinically silent period, the acquired immune deficiency syndrome (AIDS). In the case of HIV-l infections, the majority of individuals will finally suffer from this late disease; whereas HIV-2 infections appear to exhibit a lower frequency of progression to AIDS. The viral and immune pathogeneses of HIV infection have been reviewed extensively (1,2), hence, only a brief overview of those virological findings that are relevant for diagnosis is provided. Primary infection with HIV- 1 is followed by an eclipse phase of days to weeks in which no virus can be demonstrated. Usually, 3-6 wk after primary infection an acute disease, resembling infectious mononucleosis, is observed in a majority of infections. This phase is accompanied by massive virus replication and dissemination of virus to the lymphoid organs. Provirus is found mainly in CD4+ T-lymphocytes and the frequency of infected cells can be as high as 1 in 100 PBMC. During this phase, viral mRNA levels in PBMC are high. Free virus (determined as virus particle associated RNA) can reach peak levels of up to 2 x 107/mL plasma and viral core antigen p24 can easily be detected. Free virus, From,
Methods Nut/e/c
m Molecular Biology, AC/d Methods Edlted
Voi 50, Species D/agnost/cs Protocols. PCR and Other by J P Clapp Humana Press Inc , Totowa, NJ
93
PBMC-associated viral mRNA levels, and core antigen p24 then rapidly decline by about two orders of magnitude. Simultanously, cellular and humoral immune responses become detectable. These changes may or may not be accompanied by a decrease in the frequency of infected PBMC. The reduction in virus titer indicates the beginning of a period of clinical latency, characterized by a continuing slow decrease of CD4+ T-lymphocytes and progressing immune dysfunction. Vn-us in blood generally remains detectable at low levels as provirus, free virus, and cell-associated mRNA, but not as viral core antigen ~24. In lymph nodes the viral load is approximately one order of magnitude higher. Preceeding the onset of clinical illness the viral load in blood increases and in patients suffering from AIDS the frequencies of infected cells and levels of free virus may again reach those occurring during the acute infection. Infections with HIV-2 are similar to those with HIV- 1, but are characterized by a lower load of cell-associated and free virus (3). Virus may not be detectable in blood during the clinical latent phase. However, with progressing immune dysfunction and decreasing CD4+ T-cell numbers, HIV-2 can be detected as efficiently as HIV- 1. The aim of HIV detection by polymerase chain reaction (PCR) is to identify infected individuals by demonstrating the presence of viral nucleic acids in the analyzed specimen, at the highest possible sensitivity and specificity. This allows early treatment intervention and avoids contamination of blood products by HIV. Although all viral nucleic acids can serve as a substrate for PCR, for diagnostic purposes the detection of PBMC-associated proviral DNA and plasma viral RNA (virus particle-associated RNA) are the least demanding and have proven reliable. The determination of levels of intracellular viral mRNA or free virus RNA, and the frequency of infected cells are of prognostic value, but require quantitative PCR techniques and, hence, are not dealt with here. The main factor that results in reduced specificity is contamination of samples with target sequences, mainly by carryover of amplified DNA but also by cross contamination from other specimens. Precautionary measures (see Section 3.) help to keep the specificity close to 100%.
PCR Detection of HIV Maximal sensitivity is limited by sample size and by sequence variation. The detection limit of the PCR is a single DNA molecule. However, 1 pg of genomic DNA, which contains the DNA of approx 150,000 cells, corresponds to the number of PBMC contained in only about 75 PL of blood. Consequently, even with a detection limit of 1 provirus/pg DNA, roughly 70,000 infected cells must be present in 5000 mL of blood for PCR analysis to be positive. Because of the Poisson distribution at very low copy numbers and the resulting reactions without any copy of HIV provirus DNA, a detection limit of 10 copies/reaction is a reasonable goal to achieve. Similarly, the sensitivity for the detection of particleassociated HIV-RNA is limited, in addition to the efficiency of the reverse transcription step, by the volume of analyzed plasma (usually the equivalent of KO.2 mL). Further loss of sensitivity stems from the sequence divergence of HIV1 and HIV-2 and from the extensive sequence variation of HIV. Attempts to develop a unique pair of primers that allows PCR amplificatron from all HIV isolates have so far failed. Hence, in order to achieve a high sensitivity several pairs of primers are required, if both HIV types and all different subtypes need to be detected. The application of PCR to the detection of HIV at the screening level is currently precluded by the low level of automation, the lack of a pair of primers with the capability to amplify DNA from all HIV isolates, and frequencies of infected cells below the detection limit in some individuals. PCR is very helpful in those instances in which serology fails to provide an answer. This applies in particular to specimens with borderline reactivity in screening assays or incomplete patterns on confirmatory Western blots, and to specimens from individuals with suspected acute phase disease and neonates of HIV-infected mothers. Finally, before starting, a word of caution. Always be aware that working with biological material means handling infectious material. Always work with special lab coats and gloves in a sterile work bench that is specifically designed for this kind of work. Avoid the use of glass or any other materials that might break and could inflict skin lesions. For centrifugation of biological materials, use aerosol-resistant containers or centrifuges that can prevent laboratory contamination in case of vessel breakage or any other reason of spillage.
96
Biini 2. Materials 2.1. Preparation of Plasma and PBMC from Anticoagulated Whole Blood
I. Sterile 1X phosphate-buffered saline (PBS): 136mMNaC1,3 mMKCI,8 mM Na2HP04, 1.5 mM KH,P04 (e.g., from Gibco-BRL, Gaithersburg, MD). 2. Ficoll: Ready to use solution (e.g., Ficoll-Paque, Pharmacia [Uppsala, Sweden], Lymphoprep, Nycomed [Oslo, Norway]). 3. 15-mL Polypropylene centrifuge tube (e.g., Falcon, Becton Dickinson [Mountain View, CA], Nunc [Roskrlder, Denmark]) (see Note 1). 4. Tabletop centrifuge with aerosol-resistant containers accommodating 15-mL centrifuge tubes
2.2. Preparation
of DNA from PBMC
(see Note 2)
1. Lysis buffer: 50 mA4 KCl, 10 mM Tris-HCI, pH 8.3, 1.O mA4 Na,-EDTA, 0.45% Nonidet P-40,0.45% Tween-20. Store at room temperature. 2. Proteinase K stock solution: 20 mg/mL proteinase K m 10 tn&! Tris-HCl, pH 8.0,5 mMNa2-EDTA, and 0.5% SDS. Store frozen at -2OOC(seeNote 3). 3. Water bath or dry heatblock to accommodate 1.5-mL reaction tubes.
2.3. Amplification
by PCR (see Note 2)
1. 1OX PCR buffer: 500 mM KCI, 100 mM Tris-HCl, pH 8.3, 12 mM MgC12, 0.0 1% gelatin, or 1.6 mg/mL bovine serum albumin (BSA, molecular biology grade). Store frozen at -20°C. 2. 2 mM Deoxynucleotide triphosphate (dNTP) mixture (dATP, dCTP, dGTP, TTP). Store frozen at -20°C. 3. 10 p&! PCR primers: 5’-AGTGGGGGGACATCAAGCAGCCATGCAAAT-3’ (SKI 45) and 5’-CTGCTATGTCACTTCCCCTTGGTTCTCT-3’ (HIV-G9). Store frozen at -20°C (see Note 4). 4. Tuq DNA polymerase at 5 U/uL. 5. Mineral oil. 6. Thermal cycling machine.
2.4. Preparation of Viral Particles for Detection of RNA (see Note 5) 1. 1X PBS as in Section 2.1. 2. Virus resuspension buffer: 50 & KCl, 25 r&f Tris-HCl, pH 7.5, 0.25 mM Na*EDTA, 5 mM dithiothreitol (DTT), 50% glycerol. Store at -8OOC for up to 3 mo (DTT). 3. Ultracentrifuge, rotor, and tubes (see Note 6).
PCR Detection
2.5. Detection 1. 2. 3. 4. 5. 6. 7.
of HN
of Virus Particle
Associated
HIV-RNA
2.51. Synthesis of cDNA (see Note 7) 10X Reverse transcriptase (RT) buffer: 0.5M KCI, 80 mM MgCl,, 0.5M Tris-HCl, pH 8.3, 1.2 mg/mL BSA (molecular biology grade), 100 m&Y DTT. Store frozen m tightly sealed tubes at -80°C for up to 3 mo (DTT). 2 mA4 dNTP Mixture (dATP, dGTP, dCTP, TTP). Store frozen at -2OOC. 10% Trtton X-100. RNase inhibitor (e.g., RNasin, Promega [Madison, WI]). Murme leukemia virus RT (MuLV RT, Gibco-BRL) (see Note 8). 100 $4 Random hexamer primers. Store frozen at -20°C. Mineral 011.
2.52. Amplification by PCR 1. 10X Differential amplificatron buffer: 100 mA4Tris-HCl, pH 8.3,375 mM KCI, 0.0 1% gelatin. Store frozen at -20°C. 2. 25 mMNa2-EDTA. 3. 10 @4PCR primers, Tag DNA polymerase, and thermal cyclmg machine as described.
2.6. Detection 1. 2. 3. 4. 5. 6.
of Amplified
DNA by ELBA
2.6.1. Preparation of Microtiter Plate for ELISA 96-Well flat bottom microtiter plate (e.g., Immulon-2, Dynatech [Chantilly, VA] or Nunc). Coating buffer: 100 mM Tris-HCl, pH 7.4, 200 mM NaCl. 10 mg/mL Avidin: Dissolve avidin in PBS at 20 mg/mL, then add an identical volume of glycerol and mix completely. Store at -20°C. Blocking buffer: Coating buffer containing 0.05% Tween-20, 5% BSA, and 20% heat-inactivated serum (see Note 9). Wash solution: Coating buffer containing 0.3% Tween-20. Microplate shaker.
2.6.2. Detection of Amplified DNA Products 1. 5’-Labeled oligonucleotrde probes: 5’-biotin-GAGACCATCAATGAGGA AGCTGCAGAATGGGAT-3’ (SKl02-BIO) at 0.3 pJ4and 5’-digoxigeninCAGGGCCTATTGCACCAGGCCAGC-3’ (HIV-G1 3-DIG) at 1.O w. Store frozen at -20°C (see Note 10). 2. 100 mMNa,-EDTA, pH 8.0. 3. Anti-drgoxigenin Fab fragments, peroxidase labeled, 150 U/mL (from Boehringer Mannheim, Mannheim, Germany).
4. 3,3’,5,5’-tetramethylbenzidine (TMB) substrate (Dynatech, Boehringer Mannhelm). 5. 1M Phosphortc acid. 6. Microplate reader at 450 nm. 7. 1OX PCR buffer, mineral oil, blocking buffer, wash buffer, and mrcroplate shaker as described.
3. Methods 3.1. Preparation of Plasma and PBMC from Anticoagulated Whole Blood 1. Add 5 mL of EDTA-anttcoagulated whole blood to a 15-mL centrifuge tube and spin the tubes m safety containers with IOOOgat room temperature for 10 mm. 2. Remove the plasma carefully with a pipet (leaving the white blood cells behind) and transfer it to a microcentrimge tube. 3. Spin down the platelets and residual cells in a microcentrifuge at full speed for 2 min and store the plasma frozen in a new tube at -20°C for further use. 4. Add an equal volume of 1X PBS to the remainder of the blood. 5. Add 3 mL of Ficoll to a 15-mL centrifuge tube and carefully overlay it with the diluted blood. 6. Spin the tubes at room temperature with 1OOOgfor 20 mm. 7. Collect the cells, which are visible as a white band, wrth a pipet in a maximal vol of 2 mL, transfer them to a new tube that contains 10 mL PBS, and mix well. 8. Take out an ahquot and count the cells (see Note 11). 9. Spm down the cells at 200g for 5-10 mm and remove the supernatant by aspiration. 10. Resuspend the cells m 1mL PBS, transfer them to a microcentrifuge tube, and spin down for 30 s at full speed. 11. Remove the supernatant and use the cell pellet immediately for DNA preparation or keep frozen at -20°C (see Note 12).
3.2. Preparation
of DNA from PBMC
1. Add 0.5 pL of proteinase K stock solution to every 100 pL of lysts buffer Immediately before use and mix (final concentration of protease is 100 pg/mL). 2. Lyse frozen cells by adding 65 pL of lysis buffer with proteinase K for each 1O6cells and mix with pipet. 3. Incubate tube at 55OCfor 60-90 min.
PCR Detection of HIV 4. Heat treat tube at 95OCfor 15 min in order to inactivate protemase K and to denature DNA (the solution will lose its high viscosity). 5. Keep DNA frozen until PCR amplification. The concentration of the DNA is approx 100 ng/pL (see Note 13).
3.3. Amplification
by PCR (see Note 14)
1. For each reaction prepare the following mixture (see Note 15): 65 pL water, 10 pL 10X PCR buffer, 10 pL 2 mMdNTP mixture, 2.5 pL of each primer, and 0.5 pL Tug DNA polymerase. 2. Add 90 pL of the master mixture to a 0.5-mL reactton tube and overlay with 50-75 pL mineral oil. 3, Add 10 yL of deproteinized DNA (containing 1 pg of DNA) through the 011. 4. Amplify the DNA for 35 cycles with a cycle profile of 94°C for 1 mm, 55°C for 2 min, and 72OCfor 2.5 min (see Note 16).
3.4. Preparation
of Viral Particles for Detection (see Note 5)
of RNA
1. Transfer 1.1 mL of blood plasma to a microfuge tube and spin down aggregates m a microfuge at full speed for 2 min. 2. Add 1.O mL of the plasma to an ultracentrifuge tube containmg 1.O mL PBS and mix. 3. Spin down virus in the ultracentrifuge at 4OCwith 70,OOOgfor 90 min. 4. Remove supernatant completely without disturbing the (often mvisible) virus pellet (see Note 17). 5. Add 30 pL of vu-us resuspension buffer to the tube, vortex repeatedly, and transfer the resuspended virus to a microcentrifuge tube. 6. Store sample at -80°C.
3.5. Detection
of Virus Particle-Associated (see Note 18) 3.5.1. Synthesis of cDNA
HN-RNA
1. Mix on ice for each reaction (see Note 19): RNase free water, 2.5 pL 1OX RT buffer, 12.5 pL 2 mM dNTP mixture, 1.0 pL of 100 pA4 random hexamer primers, 0.75 pL 10% Triton X-100, RNase inhibitor to 1 U/pL, 20 U of MuLV RT (see Note 20). 2. Add 25 IJL of this reaction mixture to a 0.5-mL reaction tube and overlay with 50 pL of mineral oil. 3. Add 3 pL of virus suspension to each tube. 4. Incubate at 37OCfor 60-90 min. 5. Heat inactivate the RT at 68°C for 10 min. 6. Proceed directly to the amplification step or store the tubes frozen at -20°C.
100
Biini
3.5.2. Amplification by PCR 1. Mix for each reaction (see Note 15): 57.1 pL water, 10.0 pL IOX differential amplification buffer, 2.5 pL PCR primers (25 pmol each), 2.4 pL 25 mM Na,-EDTA. (see Note 21), and 0.5 pL Taq DNA polymerase. 2. Add 75 pL of this mixture to each tube and spin the tubes briefly in a microcentrifuge. 3. Amplrfy for 35 cycles as described.
3.6. Detection 1. 2. 3. 4.
1.
2. 3. 4. 5. 6. 7. 8. 9. 10. 11.
of-Amplified
DNA by ELISA
(see Note 22)
3.6.1. Preparation of Microtiter Plate for ELISA Prepare coating solution by adding 5 uL of 10 mg/mL avidin to each milliliter of coating buffer required (final concentration 50 pg/mL). Add 50 pL of coating solution per well, stir briefly on a microplate shaker, and Incubate at 4OCovernight. (see Note 23). Aspirate coating solution, add 200 uL of blockmg buffer, stir briefly on microplate shaker, and incubate at 37°C for at least 1 h. Before adding the hybridized DNA, remove blocking buffer and wash wells once with 200 pL of wash buffer. 3.6.2. Detection of Amplified DNA Products Prepare the hybridization mixture by adding for each analysis (see Note 24): 1.OpL 10X PCR buffer, 1.O pL of each labeled oligonucleotide probe (corresponding to 0.3 pmol of SKI 02-BIO and 1 pmol of HIV-G 13-DIG) (see Note 25), and 7.0 pL 0. 1M Na,-EDTA. Add 25 pL of amplified DNA in a 0.5-mL reaction tube (see Note 26). Add IO uL of the hybridization mixture and overlay with 25 pL of mineral oil. Denature DNA at 95OC for 5 min and hybridize on thermal cycler at 45°C for 15 to 30 mm (see Note 27). Transfer the contents of the tube to a well of the coated and blocked mtcrotiter plate (see Note 28). Allow binding of the hybrids on a microplate shaker at room temperature for 15-30 min (see Note 27). Aspirate the contents and wash the wells twice with 200 pL of wash buffer. Dilute the peroxidase-labeled antidigoxigenin Fab fragments 1: 1000 in blocking buffer and add 100 pWwel1. Stir briefly on the microplate shaker and incubate at 37°C for 30 min (see Note 27). Aspirate the antibody and wash wells four times with 200 pL of wash buffer. Flick plate inversely on a dry towel to remove all residual drops of wash buffer.
PCR Detection of HN
101
12. Add 50 pL of TMB substrate, stir briefly on microplate shaker, and incubate m the dark at room temperature for 30 min. 13. To stop the reaction add 50 pL of 1Mphosphoric acid, stir on microplate shaker, and read absorbance with a microplate reader at 450 nm (see Note 29).
4. Notes 1. Do not use glass, polystyrene, or any other tube that might break during centrimgation. 2. All reagents used for PCR must be free of any contaminating HIV-DNA and RNA. To avoid accidental contamination set up at least two different rooms for work with materials before and after PCR. Use different sets of equipment, chemicals, and disposables. If possible, avotd the use of pH probes and spatula. If glassware is used, do not have them washed in a central facility (where it can get contaminated) but wash and bake it (at 240°C for 5 h) yourself. It may be a good idea to have a friend at a different location (where no work with HIV is carried out) who can prepare solutions for you. Use only positive displacement pipets or pipet tips with tilters especially for PCR. The published recommendations are useful (4). 3. After freezing, SDS will precipitate but will completely dissolve again after warming up. As an alternative, proteinase K, which can be stored at 4”C, is commercially available (Boehringer Mannheim). 4. These primers amplify in the p24 coding region of the gag gene. They can detect gag sequences from all subtypes of HIV-l, except subtype 0, and some isolates of HIV-2. Other primers can be used (which may also include degenerate posttions), but the amplification conditions must be optimized (MgCl,, primer, and dNTP concentration, amount of Tuq DNA polymerase, annealing temperature, and cycle number). 5. Virus particles from blood plasma are concentrated by ultracentrifugation. Carry out ultracentrimgations only if you are familiar with this technique or if you have been carefully instructed how to do it. Take any precaution to avoid a laboratory disaster because of mishandling or a mishappening (e.g., breakage of a tube). 6. Use an ultracentrifuge that is equipped with a sterile filter connected to the vacuum pump and that allows decontamination of the chamber by gas before the chamber has to be opened. Use a fixed-angle rotor and thickwalled centrifuge tubes with screwcaps and O-rings. Make sure they can withstand the applied g-forces, even if they are only partially filled. After collecting the virus pellet, decontaminate the tubes, caps, and O-rings with a suitable disinfectant (e.g., sodium hypochloride) before washing them.
102 7, All solutions required for cDNA synthesis must fulfill the requirements for solutions used for PCR (see Note 13b) and must, in addition, be free of RNase. If all solutions are prepared with RNAse-free water m disposable plastics and no contact with RNase-contaminated spatula or pH probes occurred, the solutions need not be treated any further. Otherwise, to decontaminate the solutions add dlethyl pyrocarbonate (DEPC, Sigma, St. Louis, MO) to the solution to a final concentration of 0. l%, shake, let sit overnight with loosened caps, and then autoclave for 15 mm. Note that DEPC might be carcinogemc and that solutrons containing Tris cannot be decontaminated with DEPC but must be prepared with special caution to prevent any RNase contammation. 8. RT from avian myeloblastosts vu-us (AMV) can also be used. The optimal temperature for this enzyme is at 42°C. However, at this elevated temperature, hexamer primers do not anneal as efficiently as at 37°C. Specific oligonucleotide priming is therefore required. 9. Prepare the solution fresh each time or store aliquots frozen at -20°C. As serum for blocking nonspecific binding sites, normal goat or lamb serum can be used. Check out several batches of serum and chose the one with the best signal-to-background ratlo. 10. The two ohgonucleotide probes provided have been successfully used wrth the primers indicated earlier for the detection of HIV-l (.5j, but not of HIV-2. If you want to design your own probes, the following criterra have to be met: They must hybridize to the same strand, they must not overlap with each other or with primer sequences, and they must not hybridize with primers or with each other. The T,,, of the two probes should be similar, i.e., preferentially not more than 5°C apart (see also Note 27). 11. Cells can be counted manually in a counting chamber after mixing them with an equal volume of trypan blue solution (e.g., Trypan blue stain 0.4%, Gibco-BRL). Multiply the number of cells in the field by 2 x lo4 and the total volume m microliters in order to obtam the total cell number. Alternatively, the cells can be counted with a machme according to the manufacturer’s instructions. For the DNA preparation, assume 100% recovery of cells. 12. If cells have to be shipped before they are analyzed, the cell pellet can be resuspended in 1 mL of chilled freezing buffer, consrstmg of 1X PBS, 20% fetal calf serum, and 10% DMSO. The cells are stored at -8OOC. Before DNA is prepared, the thawed cells are added to 10 mL of cold 1X PBS and pelleted at 500g for 10 min. 13. If the cell pellet was contaminated with erythrocytes, the hemoglobin present in the DNA can inhibit PCR. There are several possibrlites to eliminate hemoglobin from your material.
PCR Detection of HIV
103
a. If erythrocyte contamination is only low and blood is fresh (cl2 h after collection), erythrocytes can be lysed with NH&l. Before freezing the cell pellet, resupend the cells in 1 mL of cold erythrocyte lysis buffer (155rnA4NH,Cl, 1 mMKHCO,, 0.01 mMNa,-EDTA, 1.1 mMNaOH, pH 7.4), let sit on ice for 10 min, and pellet the remaining white blood cells in the microfuge at half maximal speed for 1 min. Remove the erythrocyte lysis buffer and wash the cells once m 1X PBS (the lysis buffer mhibtts the PCR) before freezing. b. If blood was standing for more than 12 h, nuclei can be prepared from white blood cells. Before freezing the cell pellet, resupend the cells carefully in 0.5 mL of sucrose contaming lys~sbuffer (0.32Msucrose, 5 mMMgCl,, Tris-HCl, pH 7.5, 1% Triton X-100). After 2-3 min, pellet the nuclei in a microcentrifuge at half maximal speed for 1 min. Remove the lysis buffer and store the nuclei frozen, c. Alcohol precipitation after proteinase K digestton IS an alternative to both methods described in a and b. Before denaturation of the DNA, bring NaCl to 150 mM, add an equal volume of isopropanol, and mix. Let the tube stand at room temperature for 60 min and spin down the DNA for 30 mm. Remove the isopropanol and wash the DNA once with 80% ethanol. Remove the ethanol completely and dissolve the DNA in TE buffer, pH 8.0, at 37°C for about 2 h. Then denature the DNA at 95°C for 15 min. To standardize the amount of DNA added to an ampliticatton reaction, determine the concentration of DNA. d. If erythrocyte contamination of your cell pellet 1sextensive or if small pieces of clotted blot are present, extract the DNA at the end of the proteinase K digestion once, or if necessary repeatedly, with phenolchloroform 1:l and proceed through precipitation as described rn c. Phenol-chloroform 1:l is prepared by mixing equal parts of neutralized phenol (mix water saturated phenol [molecular btology grade] repeatedly with an equal volume of 100 mM Tris-HCl, pH 7.4, 10 mM Na2-EDTA, and separate the two phases, until the pH is in the neutral range) with chloroform (mix 24 parts of chloroform with 1 part of isopentyl alcohol). 14. PCR requires constant monitoring to assure the quality of the entire detection procedure. For monitoring, negative and positive controls must be included for each step of the procedure (i.e., sample preparatton, PCR, detection of amplified product). To rule out false negatives, each individual DNA must be tested for the presence or absence of inhibitors. A simple way is the amplification of P-globin sequences (6) with primers PC03 (5’-ACACAACTGTGTTCAC TAGC-3’) and PC04 (S-CAACTTCATCCACGTTCACC-3’) followed by
B&i
15. 16.
17. 18.
agarose gel analysis.However, becauseof the high number of target sequences present m the reaction (ca., 300,000 m 1 pg DNA for a single copy gene), fewer cycles must be carried out (20 and 25 cycles). Otherwise, saturation levels are reached, which could lead to underestimation of inhibition. There is no simple way to rule out false positives. In order to avoid false positives by product carryover, the PCR sterilization technique (7) can be used. Replace TTP by dUTP in your dNTP mix (it may be necessary to increase the concentration of dUTP m order to get equivalent amphfication). Add 0.5 U of uracyl-N-glycosylase (UNG) to your reaction and incubate the complete mixture at 50°C for 10 min before startmg PCR. The amplified DNA contams uridine bases, which are cleaved off the deoxyribose by UNG if it is carried over to a new reaction and, therefore, cannot be amphfied. However, be aware that this technique will not ehmmate any HIV DNA that is contained m plasmid, phage, or cellular DNA. If false positives cannot be prevented completely, multiple PCR analyseswith several pan-s of primers in conjunction with stringent criteria for a positive diagnosis may help to eliminate false positive interpretations (but may miss some mfections with low frequencies of infected cells) and the inclusion of appropriate controls in significant numbers (at least one-fourth to one-thud of all samples) is helpful m establishing the frequency of false positrves. This mixture, without Tuq DNA polymerase, can be prepared in advance and stored at -80°C for at least 6 mo. Tug DNA polymerase is added immediately before dispensing. The holding times of this cycle profile are not optimized, but can be shortened. They work well with a thermal cycler that uses internal temperature control. Optimal holding times are dependent on the type of temperature (external or internal thermal probes) and time control (the clock usually starts below or above the holdmg temperature and the exact temperature difference varies between different models of the thermal cyclmg machines). If the pellets are invisible, mark the tubes before the centrifugation on the outside where the pellet is to be expected. The prmciples of momtormg outlined for detectton of HIV DNA (see Note 14) also apply to the detection of RNA. The exclusion of mhibitors m the vnus suspension is tested by performing RNA-PCR on an exogenously added RNA with corresponding primers. Similarly, negative and positive controls for each step have to be included m the procedure. However, the described procedure does not allow one to apply the sterilization technique to the detection of HIV-RNA.
PCR Detection of HIV
105
19. This mixture, without the RNase inhibitor and the RT, can be prepared in advance and stored at -80°C for at least 3 mo. 20. Up to 200 U of MuLV RT can be used with random hexamer primers, but the optimal activity of RT to be added to your reaction should be determined. Some enzymes work excellently for cDNA synthesis but are strongly inhibiting when combined with PCR. Reducing the amount of enzyme can help one to succeed. 2 1. The addition of Na2-EDTA reduces free Mg*+ and was found to be optimal for the pair of prrmers described. Other primers may exhibit optimal amplification at different concentrations of free Mg*+. 22. Specifically, amplified DNA is identified by solution hybrrdlzatron of two nonisotopically labeled oligonucleotides to one strand of the amplified DNA, followed by bmding of the hybrtd to a solid phase and detection by enzyme-labeled specific antibodies. The described procedure was evaluated for the primers and oligonucleotrde probes provided m this text (5). Because only one strand IS used for detection, the other one IS washed off and constitutes the main source of laboratory contaminatron and carryover. Take precautrons to avoid the spread of these molecules to other rooms (e.g., work in a chemical fume hood, decontaminate used wash buffer with acid or sodium hypochloride, etc.). 23, Wells can also be coated at 37OCfor 1 h. 24, Thus mixture can be prepared in advance and stored frozen at -20°C. 25. If you need to establish the analysis with your own oligonucleotide probes, you have to optimize the amount of each probe, because biotin bindmg sateson the solid phase are limited and the digoxigenm-labeled probe can contribute significantly to background absorbance. One prcomole of each oligonucleotide probe is a good starting point. 26. Denaturation and hybridization can also be carrred out in heat-resistant microtiter plates on corresponding dry heat blocks or thermal cycling machines. This increases the capacity of reactrons that can be analyzed and allows easy transfer of samplesafter hybridization with a multichannel pipet. 27. When applying your own probes you have to optrmrze the hybridization temperature (dependent on the T,,, of the two oligonucleotrde probes), the hybridization time (dependent on the actual concentration of each oligonucleotide probe used in a reaction), the time for bindmg of the hybrid to the solid phase (the extent of nonspectfic signal is mainly dependent on the nonspecific binding of the digoxigenin-labeled probe, which, m turn, is dependent on its sequence and its concentration), the antibody dilution, and the incubation time with the antibody. 28. The aqueous phase can be transferred together wrth the mineral 011.The or1 does not interfere with binding if you carry out binding on a microplate shaker.
106
Biini
29. In case you encounter a low signal-to-background ratio in your analysts the followmg hints may help to solve problems. A high background absorbance can occur if either individual reaction components (digoxigenin-labeled probe or the antibody) strck nonspecifically to the solid phase or if some kind of interaction between the two oligonucleotide probes occurs. Determine first which mechanism is responsible by excluding mdividual components from the reaction mixture. In case of nonspecrfic binding, increase first the time for blockmg the soled phase. Also try different batches of serum. Nonspecific binding of oltgonucleotides can be reduced by addition of about 1 pg of DNA (e.g., salmon sperm DNA or random oligonucleotides) to the hybridization reactron. If all attempts fail, design a different oligonucleottde probe. Interactions between the two oligonucleottde probes occur if your probes exhibit extensive sequence complementarity (design a new probe), one or several of your solutions were contaminated with amplified DNA (make new solutions), or your amplification reaction produces some byproducts (check on an agarose gel) with which both of your probes can interact. In this case optrmize your amplification conditions. A low spectfic signal can occur if (m sequential order) the hybrid 1snot formed, binding of the hybrid or of the antibody is insufficient, or by inacttvation of one of the functional components. Begin with the last step to localize and solve the problem. Horseradish peroxidase is inactivated by sodium-azide (NaN,). Hence, do not include NaN3 m any of the buffers used in conlunction with the enzyme. Too low salt in the wash buffer disrupts the solid phase bound hybrid and removes the drgoxigenin-labeled probe. Insufficient specific binding of the hybrid can result from incomplete biotm-labeling of the probe (use only probes that are purified by HPLC or by polyacrylamide gel electrophoresls) or from a too high concentration of biotm-labeled probe (the number of binding sites is limited and excess free biotin-labeled probe will outcompete the hybrid). Low specific antibody bmding can be the result of incomplete digoxigenm-labeling of the probe (see above) or a too low concentration of the digoxigenin-labeled probe. Finally, it should be noted that some sera interfere with antibody bindmg and must simply be replaced. Insufficient formation of the hybrid is the least likely of all possible reasons. It is the result of incomplete denaturation (control the temperature and allow sufficient ttme for denaturation) or of competition by side products from the amplification process (check on an agarose gel),
PCR Detection of HN
107 References
1. Levy, J. A. (1993) Pathogenesis of human immunodeficlency virus mfectlon. Microblol. Rev. 57, 183-287 2. Pantaleo, G., Grazlosi, C., and Fauci, A S. (1993) The lmmunpathogenesis of human immunodeficiency virus infection. N. Engl. J. Med 328, 321-335. 3. Simon, F., Matheron, S., Tamalet, C., Loussert-Ajaka, I., Bartczak, S., PCpm, J. M., Dhiver, C., Gamba, E , Elblm, C., Gastaut, J A., and Brun-V&net, F (1993) Cellular and plasma viral load in patients infected with HIV-2. AIDS 7, 141 l-141 7, 4. Kwok, S. and Higuchi, R. (1989) Avoiding false positives with PCR. Nature 339, 237,238. 5. Bbm, J. and Schupbach, J. (1993) Sensitive and quantitative detection of PCRamplified DNA products by an enzyme linked immunoassay following solution hybridization with two differently labeled oligonucleotlde probes Mol. Ceil Probes 7,361-311 6. Saiki, R. K , Scharf, S., Faloona, F., et al. (1985) Enzymatic ampllficatlon of P-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230, 1350-I 354. 7 Longo, M. C., Beminger, M. S., and Harley, J. L (1990) Use of uracyl DNA glycosylase to control carryover contamination in polymerase chain reaction. Gene 93, 125-128.
CHAPTER8
The Use of Consensus PCR and Direct Sequence Analysis for the Identification of HPV Henk
L. &nits
1. Introduction The human papillomaviruses (HPVs) form a large group of small double-stranded DNA viruses of about 7900 bp. The viruses infect mucosal and cutaneous epithelia and are associated with a number of benign and malignant lesions (I-4) HPVs originally have been described to be present in skin warts. Strong evidence provided by molecular biological and epidemiological studies has shown that some HPV types are involved in the etiology of ano-genital warts and cancers. In addition, evidence suggests that these viruses are involved in the pathogenesis of skin cancers of immunosuppressed individuals with the rare heritable disease epidermodysplasia verruciformis (EV), in the development of lesions of the aerodigestive tract such as juvenile laryngeal papillomas and with some lesions of the ocular tract. Recent evidence indicates that particular HPV types belonging to the EV-related subgroup of viruses also are involved in the development of skin cancers of renal transplant recipients (5,6,,. Distinct clinical manifestations are caused by different HPV types. For instance, whereas the mucosal HPV types which infect the lower genital tract types 6, 11, 13,42, and 44 are associated wrth benign condylomatas, types 16, 18, 3 1, 33, 35, 39, 45, 51, 52, 56, and 58 are associated with premalignant cervical lesions (cervical intraepithelial neoplasia; CIN) and cervical cancers (7-Z 0). Sensitive HPV DNA detecFrom
Methods in Molecular B/ology, Nucle/cAod Methods Edlted
Vol 50 Species D/agnost/cs Protocols PCR and Other by J P Clapp Humana Press Inc , Totowa, NJ
109
110
Smits
tion methods have been very useful for studying the pathogenesis of lesions caused by infections with HPV and the epidemiology of these viruses. Potentially an HPV DNA detection assay suitable for the detection of genital HPV types involved in the pathogenesis of cervical cancer could be used clinically for the screening of women at risk for the development of high grade cervical premalignant lesions and of cancer. Presently about 70 HPV types have been described and the complete nucleotide sequence of 21 types has been published. Although the genomes of each of the HPV types are unique, regions of sufficient homology between different types have been identified to select primers that allow the amplification of groups of related HPV types. Regions of relative homology have been identified mostly in the early El and the late Ll open reading frames. To minimize the number of mismatches with each of the HPV types of interest and thus to ensure optimal amplification of each of the individual types, primers must be degenerated at a number of positions. Most efforts to develop such consensus primer sets have been aimed at the detection of groups of genital HPV types. Two primer sets, one pair (CPI and CPIIG) for the specific amplification of the genital HPV types, and one pair (CPI and CPIIS) for the detection of a number of cutaneous HPV types (11) were recently designed. These primers are located in the El open reading frame and utilize one common 3’ primer (CPI) and two distinct 5’ primers (CPIIG and CPIIS) located 188 bp upstream. When tested on cloned RPV plasmid DNAs these primer pairs allow the efficient amplification of different but overlapping panels of genital and cutaneous HPV types. However, not all HPV types can be detected with these two primer sets and especially the detection of oncogenic cutaneous HPV types will need the use of additional primer set(s) (5,12). Nevertheless, the strong tissue tropism of the different HPV types allows the use of these PCR primers in the specific detection of genital and cutaneous HPV types in a variety of clinical samples. The strength of the CPKPIIG primer combination resides in the superior sensitivity of this primer pair in detecting most important genital HPV types associated with cervical cancer. Applied on fresh cervical smears this primer pair detects HPV in almost 100% of the abnormal smears containing severe dysplastic or cancerous cells and in over 70% of the smears containing mild or moderate dysplastic cells. Moreover, the amplification product of most positive
Identification
of HPV
111
samples can be viewed directly under UV illumination by electrophoresis of 10 PL of the PCR product on an ethidium bromide gel, without the need for hybridization. Here the author describes the use of the CPWPIIG consensus primer pair in the detection of genital HPV infection in a variety of clinical samples. As the proper preparation of DNA from the clinical specimens is of critical importance for the efficiency of the PCR assay, the author also describes appropriate DNA extraction protocols for the three most important types of clinical specimens, fresh cervical smears, snap frozen tissue specimens, and paraffin-embedded tissue blocks. Finally, the author describes a direct sequencing protocol for the type identification of the detected HPV DNA (13). The sequencing reaction utilizes either of the two PCR primers, and is readily adaptable to any primer pair. 2. Materials 2.1. Preparation of DNA jkom Fresh Cervical Smears 1. 15mL Centrifuge tubes. 2. Phosphate-bufferedsaline (PBS) contains0.05% merthiolate. 3. Phenol/chloroform/isoamyl alcohol (25/24/l [v/v/v]) stored under TE (1O:l) at 4OC. 4. Chloroform/isoamyl alcohol (24/l [v/v]) storedat 4OC. 5. 2.5MNa acetatepH 5.2. 6. 96% Ethanol storedat -20°C. 7. 70% Ethanol storedat -20°C. 8. TE (1O:l): 10 mMTris-HCl, pH 8.0, 1 WEDTA. 2.2. Extraction of DNA porn Snap-Frozen Tissue Samples 1. 95% Ethanol. 2. 20 mg/mL ProteinaseK (Sigma, St. Louis, MO) stored at -2OOC. 3. DNA extraction buffer: 50 mM Tris-HCl, pH 8.9, 1 mM EDTA. 2.3. Extraction of DNA from Parafin-Embedded Tissue 1. 70% Ethanol. 2. Tween-80 DNA extraction buffer: 10mM Tris-HCl, pH 8.9, 50 mM KCl, 2.5 mM MgC12,and 0.5% Tween-80. 3. 20 mg/mL ProteinaseK storedat -2OOC.
112 2.4. The Detection of HPV DNA by PCR Using the -CPI/IIG Consensus Primer Pair 1. 2. 3. 4. 5. 6. 7.
8. 9. 10. 11. 12. 13.
Sterile H,O. 1MKCI (Sterilized). 1.5M Tns-HCI, pH 8.8 (sterilized) 1M MgCl, (sterilized). 20 mg/mL bovine serum albumin (BSA) (Boehrmger, Mannheim, Germany) stored at -20°C. 0.45- and 0.20~pm Filters (Schleiger and Schuell). 1OX PCR stock solution (see Table 1). Sterile solutions of KCl, Tris buffer, MgCl,, and water are mixed, filtered through O-45- and 0.2~pm filters, and finally BSA is added. The 1OX PCR stock solution is dispensed in 0 5-mL portions and stored refrigerated at 4’C. Amplitaq DNA polymerase (Perkm-Elmer-Cetus, Norwalk, CT) stored at -2OOC. 150 ng/pL 5’ PCR primer (CPIIG; S’ATG TTA AT(A/T) (G/C)AG CC(A/T) CCA AAA TT) stored at -2OOC. 150 ng/pL 3’ PCR primer (CPI; S’TTA TCA (T/A)AT GCC CA(T/C) TGT ACC AT) stored at -20°C. 100 mJ4 Solutions of dATP, dTTP, dCTP, and dGTP (Pharmacia, Uppsala, Sweden) stored at -20°C. 10 mM dNTP stock solution prepared by mixing 250 pL of 100 mJ4 solutions of each dATP, dTTP, dCTP, and dGTP with 1.5~mLH,O. Store at-20°C. Paraffin liquid (Merck, Darmstadt, Germany).
2.5. The Detection of the 188 bp PCR Product by Electrophoresis Through an Ethidium Bromide Stained Agarose Gel 1. 2. 3. 4. 5.
Agarose. 10X TAE gel electrophoresisbuffer: 400 mA4Ttls-acetate,10 mMEDTA (14). 10 mg/mL Ethidium bromide stock. 100 bp Ladder marker (Boehringer, Mannhelm, Germany). Layer mix: 0.05% orange G, 30% glycerol in Hz0 (sterilized).
2.6. The Detection of PCR Products by Southern Blot Hybridization 1. 2. 3. 4.
Zeta probe membrane filter (BioRad, Richmond, CA). Blotting solution: 0.5M NaOH, 0.6M NaCl. 20X SSC (1X SSC 1s0.15MNaCl plus O.O15MNa-citrate). IM Na2HP04.
Identification
of HPV
113
Table 1 PCR Stock Solution Preparation Compound KC1 Tns-HCl, pH 8.0 WC12 H2O
BSA
Stock solution
Concentration 1OX PCR buffer
To make up 10 mL 10X PCR buffer
1M 1.5M lh4 20 mg/mL
0.5M 0.M 36mM 1 mg/mL
5mL 0 667 mL 0.36 mL 3.473 mL 0.5 mL
5. 1M NaH2P04. 6. 1M Na-phosphate buffer pH 7.4. 7. 20% SDS. 8. 0.5M EDTA, pH 8.0. 9. Prehybridization buffer and hybridization buffer: 0.5M Na-phosphate, pH 7.4,7% SDS, 1 mMEDTA. 10. PhenoVchlorofonMsoamyl alcohol (25/24/l [v/v/v]) stored under TE at f 4OC 11. Chloroform/rsoamyl alcohol (24/l [v/v]) stored at 4°C. 12. 2.5MNa-acetate pH 5.2. 13. 96% Ethanol (-20°C). 14. 70% Ethanol (-20°C). 15. Random primed labeling kit (Boehringer) stored at -20°C. 16. a[32P]-dCTP (3000 Ci/mmol) stored at -20°C. 17. Klenow enzyme (Boehringer) stored at -20°C. 18. X-ray film.
2.7. The Purification of the PCR Product for Sequence Analysis 1. 2. 3. 4. 5. 6. 7. 8. 9.
Phenol/chloroform/isoamyl alcohol (25/24/l [v/v/v]) stored under TE at 4°C. 2.5MNa-acetate pH 5.2. 96% Ethanol (-20°C). 70% Ethanol (-2OOC). TE (10: 1): 10 mM Tris-HCl, pH 7.6, 1 miI4 EDTA. Agarose. TAE gel electrophorests buffer. 10 mg/mL Ethidium bromide stored dark at 4OC. L2: The L2 solution consists of 5.25M guanidinium isothrocyanate m 50 rnMTrrs-HCl, pH 6.4 and IS prepared by dlssolvmg 120 g guanidinium isothiocyanate in 100 mL O.lMTris-HCl, pH 6.4 (store dark) (see Note 1).
114
Smits
10. L6: L6 conststs of 5.25Mguanidmium isothiocyanate (Fluka, Buchs, Swrtzerland), 50 mM Tris-HCl, pH 6.4, 1.3% Triton X- 100, and 20 mA4EDTA, and is prepared by the addition of 22 mL 0.2M EDTA plus 2.6 g Triton X- 100 to 200 mL L2 solution (store dark) (see Note I). 0.2M EDTA is prepared by dissolving 37.2 g EDTA and 4.4 g NaOH in a final volume of 500 mL. 11. L7T: The L7T solutton IS prepared by the addition of 1 mL casem (Sigma) stock solutton (50 mg casem/mL L6) to 50 mL L6 (store dark) (see Note 1). 12. Silica: Activated silica is prepared as follows: 60 g silica particles (Srgma) IS suspended m a total volume of 500 mL H20. The particles are left to sediment at umt gravity for 24 h. After removal of 430 mL of the supernatant, 500 mL H,O is added again. Upon sedimentation, 440 mL of the supernatant ISremoved. Fmally 600 PL 32% HCl is added, and the sihca IS suspended, drspensed m 4-mL porttons, and autoclaved to destroy contaminating nucleic acids. 13. 70% Ethanol (room temperature). 14. Acetone.
2.8. Materials
Required for the Direct Sequence Analysis of the Purified PCR Product
1. 5X Sequenasereaction buffer: 200 mMTrrs-HCI, pH 7.5, 100 mMMgC12, 250 mA4NaCl (store at -20°C). 2. Dimethyl sulfoxide. 3. 150 ng/mL PCR primer (5’ or 3’; store at -2OOC). 4. 5X Labeling mix (USB; store at -20°C). 5. Sequenase version 2.0 (USB; store at -20°C). 6. 0. IM DTT. 7. [“?S] dATP (1000 Ci/mmol; store at -20°C). 8. ddG, ddA, ddT, and ddC terminatron mixtures (USB; store at -2O’C). 9. Stop solution: 95% formamide (see Note 2), 20 nnI4 EDTA, 0.05% Bromophenol blue and 0.05% Xylene cyan01 (store at -2O’C). 10. Dimethyldichlorosilane (see Note 2). 11. Bind silane. 12. Bind silane working solution: 25 mL 96% ethanol, 30 p,L bind silane, and 750 pL acetic acid (prepare fresh). 13, 10% Acetic acid. 14. 95% Ethanol (room temperature). 15. Urea. 16. Acrylamide. 17. N,N’-Methylenebisacrylamide. 18. 38% Acrylamide, 2% bisacrylamide in Hz0 (see Note 2; store at 4’C). 19. 1OX TBE: 0.89M Tris, 0.89M bortc acrd, and 0.02M EDTA.
Identification
of HPV
115
20. N,iV,N’,N’-Tetramethylethylenedtamine(TEMED; seeNote 2). 2 1. 30% Ammoniumpersulfate (storefrozen). 22. X-ray film. 23. 1NKOH. 24. 10% Acetic acid. 3. Methods The extreme sensitivity of the PCR detection method may cause serious contamination problems resulting in false positive findings. Main sources of contamination are plasmids and bacteria containing HPV DNA, clinical samples containing high HPV copy numbers, and, perhaps most notorious, the amplified PCR products. These contaminants may be spread easily by laboratory personnel, laboratory equipment, aerosols formed during handling of DNA specimens, and PCR products (centrifugation, vortexing, and pipeting) of specimens. To minimize the risk of contamination different physically separated laboratories should be equipped for: 1. Preparationof stock solutions; 2. Assemblmg of PCR mixes; 3. Preparationof DNA from clmical specimens;and 4. Analysis of PCR products. Only authorized personnel should work in the first three laboratories and these labs should not be entered after working at the laboratory designated for the analysis of PCR products. Stock solutions should be dispensed in small amounts and pipetting of solutions containing DNA should be done with pipets specially designated for this work and using plugged pipet tips. Only disposables should be used and equipment, benches, and floors should be cleaned regularly using a 1% sodiumhypochlorite solution. Disposable labcoats should be worn. 3.1. Preparation 3.1.1. Preparation
of DNA
fi-om Clinical Specimens of DNA from Fresh Cervical Smears
1. Collect cervical scrapein 15mL centrifuge tubesin 2 mL PBS containing 0.05% merthiolate and place at 4°C. Preferably the samples should be frozen down at -20°C the sameday. 2. Transferthe samplesto a laboratorydesignatedfor the preparationof PCR gradeDNA. Thaw samplesat room temperatureand vortex vigorously to suspendthe cells. Carefully avoidmg cross-contamination(see Note 3), open tubesand transfer 200 uL of the suspensionto an Eppendorf tube.
116
Smits
3. Extract with phenol-chloroform extract by adding 200 pL phenohchloroformlrsoamyl ethanol and brief vortexmg. After a 2-mm centrrfugatlon step, the upper aqueous phase is transferred to a fresh Eppendorf tube. The 200 pL chloroform!lsoamyl ethanol IS added and the extraction procedure is repeated. 4. Add 20 PL 2SMNa acetate pH 5.2 and 0.5 mL ice-cold ethanol to the aqueous phase, vortex, and leave at -70°C for 2 h. Pellet DNA precipitate by centrrfugation for 20 mm at 4”C, remove ethanol, and wash pellet with 0.5 mL me-cold 70% ethanol. After centrifugation remove ethanol and dry pellet under vacuum (see Note 4). Finally, dissolve the pellet m 100 pL TE and use 10 PL m a 100 PL PCR reaction. 5. Store DNA at -2OOC. 3.1.2. Extraction of DNA from Snap-Frozen Tissue Samples 1. Depending on the size of the snap-frozen tissue specimen cut one or a few lo-pm tissue sections in a thoroughly cleaned cryotome and place m prechilled Eppendorf tube using clean, cold forceps. Sections can be stored at -70°C or directly used for the extraction of DNA. Before cutting a different tissue specimen, the knife of the cryotome should be cleaned with ethanol. 2. Extraction of DNA IS performed in a laboratory specially designated for the preparation of PCR grade DNA. To extract DNA add 200 yL DNA extraction buffer and 1 pL 20 mg/mL proteinase K to the frozen samples and incubate for 4 h at 56’C (or overnight at 37’C). 3. After completion of the digestion of the tissue, the proteinase K is heatinactivated by incubation at 95°C for 10 min. 4. Finally, any remaining cell debris is pelleted by a lo-min centrifugation step. Use 10 pL of the supernatant in a IOO-pL PCR reaction. 5. Store DNA at -20°C. 3.1.3. Extraction of DNA from Paraffin-Embedded Tissue 1. Usmg a thoroughly cleaned microtome, cut alternating 1O-pm sections for PCR analysis and histology (see Note 5). Place sections for PCR amplification on a piece of paper in plastic bacterial culture dish. The paper will prevent the tissue section from sticking to the culture dish. To prevent contamination by the knife of the microtome the knife should be cleaned with 70% ethanol before proceeding with the next paraffin block, and paraffin blocks without tissue should be cut between the samples. The paraffin sections without tissue may serve as negative controls for the DNA extraction procedure.
Identification
of HPV
117
2. In a laboratory exclusively used for the extraction of PCR grade DNA up to three (depending on the size of the tissue specimen) paraffin sections are placed in a 1.5-mL Eppendorf tube using plastic dtsposable forceps. Sections are then overlaid wtth 300 pL Tween-80 containing DNA extraction buffer. To dtgest the tissue 2 pL 20 mg/mL proteinase K (stored at -20°C in a 20-yL ahquot) is added and the sample incubated overnight at 56OC. 3. After digestion the Eppendorf tubes are centrifuged for 10 min to remove cell-debris and the aqueous phase is transferred to a fresh tube carefully avoiding the paraffin slurry. Next the proteinase K is inactivated by incubation at 95°C for 10 min. Ten microliters of the DNA preparation usually is sufficient for PCR amplification in a 100~pL reaction. 4. Store DNA at -20°C.
3.2. Detection Using the CPIIIIG
of HPV DNA by PCR Consensus Primer Pair
1. Prepare a PCR master mixture in a DNA-free PCR laboratory according to the following scheme (see Note 6): 837 pL sterile HzO, 100 PL 10X PCR stock solution, 20 pL 10 mA4 dNTP stock, 20 pL CPI (150 ng/pL), 20 p,L CPIIG (150 ng/pL). Mtx by vortexing and add: 3 FL ampli Taq DNA polymerase (5 U/pL). Mix PCR mixture well by gently tapping (see Notes 7 and 8). 2. Dispense 90-pL ahquots of the PCR master mixture mto PCR tubes, and overlay the solution with 1 or 2 drops of paraffin oil. The tubes are then transferred to the laboratory used for the preparation of PCR grade DNA. 3. Add 10 pL of the thawed DNA samples to the PCR tubes and the tubes are then centrifuged for a few seconds to mix the PCR mixture and the DNA. 4. For optimal amplification, 40 cycles are performed in a step cycle file after an initial 5-min denaturation period at 95°C. Each step cycle should consist of a I-min denaturation step at 95”C, a I-min annealing step at 55”C, and a 2-min elongation step at 72°C. After the final cycle, a lo-min elongation step (72°C) is programmed after which the tubes are cooled to 4°C and finally the temperature is allowed to rise to room temperature (see Note 9). 5. Store PCR products at -20°C. 6. Perform sufficient control reactions including a blank reaction containing PCR master mix only, a positive control contaming 10 pg plasmid HPV DNA or 1 pg purified SiHA DNA (see Note 10) and controls to monitor for cross-contammatton during the DNA extractton procedure.
118 3.3. Detection of HPV Positive Samples by Ethidium Bromide Staining of an Agarose Gel and by Southern Blot Hybridization 3.3.1. Detection of the 188 bp PCR Product by Electrophoresis on an Ethidium Bromide Stained Agarose Gel 1. MIX 10 PL of the PCR product wrth 2.5 PL layer mix (see Note 11). 2. Transfer the PCR product to the gel slots and the gel (2% agarose m TAE buffer contaimng 10 ng ethtdmm bromide per microhter; see Note 12) is run at 100 V until the dye has migrated 2 to 3 cm. A size marker (100 bp ladder marker, Pharmacia) may be run along with the samples. 3. Vtew the gel by UV illummation and photographed for documentation (see Note 13). The positive control should give a distinct 188 bp band.
1.
2. 3. 4. 5.
6.
3.3.2. Detection of the PCR Product by Southern Blot Hybridization (see Note 14) Uneven edges and the slots of the ethidium bromide stained gel (see Section 3.3.1.) are removed and the DNA is transferred by capillary blottmg (14) m 0.4NNaOH and 0.6M NaCl to a premarked, prewetted (H*O) zeta probe membrane filter. After overnight blotting the membrane is rinsed for 5 min in 3X SSC, placed between sheets of Whatman (Maidstone, UK) 1MM filter paper, and baked for 2 h at 80°C. The filters are prehybridized m 0.5M phosphate buffer, pH 7.4, 7% SDS, and 1 mMEDTA for 30 min at 55OC Filters are hybridized at 55°C in the same solution for 18 h, after addition of a mixture of HPV specific probes (see steps 5 and 6). A HPV specific probe mixture is prepared by random-primed labeling of the CPI/CPIIG PCR amplification products of HPV6, -16, -18, -33, -45, and -58. For the preparation of these HPV DNA fragments 5 p.L of glycerol stocks of bacteria containing cloned HPV plasmids (or 10 ng of purified HPV plasmid DNA) of each of these HPV types IS amplitied m a 200 pL PCR mixture using the CPI/IIG primer combination. The PCR product is purified by a phenol/chloroform extraction, concentrated by alcohol precipitation, and the 188 bp PCR product is separated by agarose gel electrophoresis on a TAE gel. Finally, the DNA is extracted from the agarose by the guamdimum isothiocyanate-silica method as described in Section 3.4.1. for the preparation of PCR product for dtrect sequence analysis. For each of the HPV types (6, - 16, -18, -33, -45, -58) a [32P]-labeled probe is prepared by usmg the random-primed labeling kit. Probes are prepared
Identification
of HPV
119
in 20 uL using 100 ng HPV DNA according to the following scheme: 1 yL DNA (100 ng/pL), 3 JJL dATP, 3 pL dTTP, 3 uL dGTP, 2 p.L randomprimed labeling buffer and primers, 0.5 pL [32P]-dCTP (3000 Ci/mmol), 6.5 pL H20, 1 pL Klenow enzyme. Incubate at 37OCfor 1 h. 7. For hybridization in 100-mL hybridization fluid, 2.5 l.tL of each probe is used (see Note 14). Before additton of the probes to the hybridizatron solution containing the filters, the probes are mixed with 1 mL hybridization solution and denatured by heating at 95°C for 5 min. Then the samples are cooled on ice. 8. After hybridization, the blots are washed two times for 10 min m 2X SSC, 0.1% SDS at 55OC. 9. The washed blots are wrapped in Saran wrapTM and exposed overmght to a Fuji RX X-ray film.
by Direct
3.4. Typing of the Detected HPV Sequence Analysis of the PCR Product 3.4.1. Purification of the PCR Product for Sequence Analysis (see Note 16)
1. Transfer the remaining DNA of the PCR product (90 FL) of positive samples to an Eppendorf tube carefully avoiding the overlaying paraffin. The DNA is then extracted wtth 100 pL phenol/chloroform/isoamyl ethanol. After mixing and centrifugation, the upper aqueous phase is transferred to a fresh tube and precipitated with ethanol by the addition of 10 yL 2.5M Na acetate and 0.5 mL ice-cold 100% ethanol and allowed to precipitate overnight (see also Note 16) at -2OOC. 2. After centrifugation for 20 mm at 4°C and washing of the pellet with ethanol, 70% the DNA pellet is briefly dried under vacuum. The DNA pellet is dissolved in 10 yL TE (10 mMTris-HCl pH 7.6, 1MEDTA) and run on a 2% ethidium bromide stained agarose TAE gel (see Note 17). The gel is run for 3-4 cm. 3. Excise the 188 bp DNA band (see Note 18) under UV illumination (the volume of the slice should not exceed 300 yL) and the DNA IS extracted from the agarose usmg a modification of silica-guanidinmm isothiocyanate method (15; see Section 2.). a. Place gel slice in Eppendorf tube. b. Add 900 uL L7T solution and 2.5 pL silica (see Notes 1 and 19) to the gel slice,vortex, and incubate for 40 mm at 37°C. Vortex for 10 s every 10 min. c. Centrifuge for 15 s at 12,000g and remove supernatant by suction. d. Wash the pelleted DNA-silica complex twice with 700 pL L2 solution, twice with 70% ethanol, and once with acetone. Washing is performed by thorough mixing (10 s) followed by brief centrifugation (15 s) and removal of the supematant.
Smits e. Dry the DNA-sthca pellet by mcubatton at 56°C for 5 min with the lid of the tube open. f. Add 12 PL TE to the silica, vortex, and elute DNA by incubation at 56°C (10 mm), then centrifuge for 10 mm and transfer supernatant to a fresh tube, carefully avoiding the silica pellet. g. Store DNA at -20°C. 3.4.2. Direct Sequence Analysis of the Purified PCR Product The protocol given includes the analysis of all four nucleotides. For the identification of all known genital HPV types, performance of the sequence analysis for only two nucleotides (e.g., G and A tracks), has proven to be sufficient. Analysis of only two tracks reduces workload and costs. The following protocol is for the sequence analysis of five PCR products/samples. 1. Take 5 pL purified PCR product and mix the following reagents m marked Eppendorf tubes: 2 pL 5X sequenase reaction buffer (200 mA4 Tris-HCl, pH 7.5, 100 mM MgC12, 250 mM NaCl, stored frozen), 2 uL dimethyl sulfoxide, 1 pL (150 ng/pL) 5’ or 3’ PCR primer (stored frozen), and 2 pL H20. 2. Close caps tightly, boil for 5 mm to denature the DNA and snap freeze at -70°C. Samples can be snap frozen by quickly placing the samples m a mixture of dry ice and 96% ethanol, or by quick transfer to a-70°C freezer. 3. For live reactions dilute 2.5 PL 5X labeling mix (USB) m 10 PL H20. Also dilute 2 PL sequenase version 2.0 (USB) in 14 PL H,O. Keep diluted sequenase on ice and sequenase stock in -20°C at all times (see Note 20). In a laboratory equipped for work with radioactive materials, assemble the followmg labelmg reaction mrxture (keep on ice) (see Note 20): 12 PL diluted labeling mix, 6 uL 0.1 M DTT, 12 PL diluted sequenase 2.0, and 3 yL [35S]-dATP (1000 Ci/mmol). 4. Performance of the sequencing reactton: a. Centrifuge the still frozen, denatured DNA preparation (see Section 3.4.1.) step 3g) for 10 s and place on ice. b. The labeling reaction ts initiated by the addition of 5.5 pL labeling reaction mixture to number one of the denatured DNA samples. The ingredients are mixed by pipeting and then 4 l,tL of the mixture 1s quickly transferred to each of four vials contammg the termination mixtures (termination mixtures are prpeted well in advance to 5 x 4 appropriate labeled tubes): vial #l, 2.5 PL ddG termmation mrx; vial #2, 2.5 PL ddA termination mix; vial #3,2.5 PL ddT termination mix; and vial #4, 2.5 PL ddC termmation mix.
Identification
5. 6. 7. 8.
of HPV
121
c. Incubate at room temperature. d. Then proceed by adding 5.5 uL reaction mixture to the second DNA sample, again transferring 4 uL of this mixture to each of the four vials containing the termination mixtures. Place at room temperature. e. When the termination reactions of all five DNAs are started, the 5 x 4 tubes are immediately transferred to a water bath at 48OCand incubated for 5 min. f. Stop the reaction by the addition of 4 uL stop solution (95% formamide, 20 mM EDTA, 0.05% Bromophenol blue, and 0.05% Xylene cyan01 FF) (see Note 2). Store samples at -20°C until the sequence gel is run. Denature samples by incubation for 4 min at 80°C prior to loading the samples (4.5 uL) onto the sequencing gel. Run the gel at 50 W for 2-3 h or until the first dye has migrated to approx 10 cm from the bottom of the gel. A sequencing gel is prepared as follows (24). a. Clean large (front) and small (back) glass plates with soap, water, and 70% ethanol. b. Dry plates, transfer to a fume hood, and treat small plate with 5-l 0 mL repel-silane (dimethyldichlorosilan; see Note 2) and the large plate with bind-silane working solution (25 mL 96% ethanol, 30 pL bmd-silan, and 750 uL 10% acetic acid), and rub the plates till dry. The small plate should feel slippery and the large plate rough. c. Place clean spacers (0.4 mm) in between plates and tape well. d. Dissolve in a fume hood 42 g urea in 15 mL 38% acrylamide-2% N,N’-methylenebisacrylamide solution (see Note 2), 10 mL 1OX TBE, and 42 mL H20. Stir until all urea is dissolved, add 100 yL TEMED (N,N,N:N’-tetramethylethylenediamine) and 117 pL 30% ammoniumpersulfate, stir, and immediately pour gel. Pour gel using a 60-mL syringe without mteruption holding the gel at an angle of 45” to 60” carefully avoiding trapping air bubbles. e. Place a sharks tooth comb with flat side down, parallel to the edge of the gel plate on top of the gel. Place gel in an almost horizontal position with heavy weights (5-10 kg) on top and leave polymerizing for 3060 min. The flat side of the combs should be stuck in between the glassplates such that after polymerization the combs can be replaced with the teeth sticking into the gel for l-2 mm, leaving just enough space between the teeth above the small glass plate to apply the samples. f. Disassemble the gel taking care that the gel sticks to the larger glass plate and incubate the glass plate and gel for 15 min in 10% acetic acid and subsequently for 15 min m water. Remove excessive liquid with
122
Smits paper towels and dry the gel for l-2 h in an oven at 80°C. Discard electrophoresis buffer as radioactive waste. g. Expose the dried gel to a FuJi RX X-ray film overmght. h. Identify HPV type by comparison with the appropriate fragment of the published HPV nucleottde sequences. i. The dried gel can be removed from the plate by soaking m IN KOH. A sequencing gel is presented m Fig. 1
4. Notes 1. Addition of acids to solutions containing thiocyanate may cause the formation of toxic HCN! Therefore waste and spills should be treated with a alkali and properly disposed off. 2. Formamide, demethyldichlorosilane, acrylamide, and TEMED are extremely toxic and should be pipeted m a fume hood. 3. To avoid cross-contamination, vials are opened using small pieces of paper tissue covering the caps of the tubes and gloves should be changed regularly. Sufficient negative controls should be carried through the complete procedure to monitor contammation. 4. DNA pellets can be dried m Eppendorf vials sealed with a pierced cap of a second vial. 5. The examination of adjacent sections by PCR and histology is advisable m order to correlate the HPV findings with those of the pathologists. 6. PCR master mixes should be assembled from batches of stock solutions that have been tested for contammation. Primers, nucleottdes, and Tuq polymerase should be stored at -20°C and the 10X PCR stock solution at 4°C. 7 Vigorous vortexing of the enzyme should be avoided to prevent loss of activity. 8. Owmg to the relative small size of the amplified PCR product, the concentration of the primers in the PCR reaction is presumably the hmttmg factor m the final cycle of the amplification reaction. Adjustment of the concentration may be required when using different batches of primers. 9. The PCR condittons have been selected such that a broad range of HPV types can be detected at a high sensitivity. To allow the detection of a relative wide spectrum of HPV types degenerated primers at relatively conserved sites of the genome were selected. To ensure primer binding to HPV types that do not completely match the primer binding site a relative high Mg2+ concentration is used To minimize background formation owing to nonspecific annealmg of the primers a relatively high annealing temperature is used. 10. Positive controls are added at the laboratory designated for the analysts of the PCR products.
Identification 51
of HPV 45
35
123 33
31
18
16
11
6
Fig. 1. A sequencing gel containing the G (left) and A (right) lanes of a number of genital HPV types. 11. The paraffin overlay of the PCR reaction is a potent sourceof contamination. Paraffin drops transferred by pipeting may spreadover the surface of the buffer compartment of the electrophoresisequipment. Paraffin drops
Smits
12. 13. 14. 15. 16.
17. 18. 19.
20.
adhering to ptpet tips used to pipet the PCR products thus should be cleaned with a tissue paper before transferring the PCR solution to the gel. Ethidium bromide is a potent mutagen. Appropriate preventive measures should be taken to avoid direct contact with the skin. Eyes should be protected from the UV light. Appropriate precautions should be taken while working with radioactive materials. Higher concentrations of probe m the hybridization may cause increased background formation and in general does not improve the sensitivity of the method. For optimal results, the 188 bp PCR product should be purified and sequenced directly. For short periods the DNA can be stored either as ethanol precipitate after phenol/chloroform extraction of the crude PCR product (Section 3.4.1.) step 1) or in TE after gel electrophoresis and extraction from the gel (Section 3.4.1.) step 3g). Running the sample in a TBE gel might result m a loss of recovery. Incidentally, nonspecific PCR product of about 100-160 bp is produced in the PCR. This band should be avoided when excismg the 188 bp band. Inclusion of casein m the extraction procedure improves the sequencing reaction. Presumably, the improvement of the sequencing reaction is the result of a direct effect of casem on the activity of the sequenase enzyme. The possibility of improvmg the sequencing reaction by the addition of casein to the sequencmg reaction is however not yet fully explored. Sequenase appears to be extremely sensitive to temperature fluctuations. The enzyme therefore should be pipeted while leaving the vial at -20°C.
Acknowledgments Steven P. Tjong-A-Hung’s dedicated technical assistance is greatly appreciated. Maarten F. Jebbink is kindly acknowledged for useful suggestions concerning the sequencing protocol, R. Boom for advice on the use of casein in the DNA purification procedure, and Wirn van Est for photography. Part of this work was reproduced by kind permission of Oxford University Press from a publication entitled: “Detection and characterization of human papillomavirus infections in clinical samples by the PCR,” by H. L. Smits and J. ter Schegget, in Modern Methods in Pathology: PCR Applications in Pathology (Latchman, D. S., ed.), copyright 0 1994 by permission of Oxford University Press. This work was supported by the Dutch Cancer Foundation (IRA 90-O 1).
Identification
of HPV
125 References
1. Vilhers, E. M. (1989) Heterogeneity of the human papillomavirus
group. J Viral.
63,489W903 2. Von Knebel-Doeberitz,
M. (1992) Papillomavirus in human disease: part I. Pathogenesis and epidemiology of human papillomavnus infections. EJM 1,4 15-423. 3. Zur Hausen, H. (1991) Viruses m human cancers. Sczence 254, 1167-l 173. 4. Zur Hausen, H. (1991) Human papillomavirus in the pathogenesis of anogenital cancer Virology 184,9-13. 5. Berkhout, R. J. M , Tieben, L. M., Smits, H. L., Bouwes Bavmck, J. N., and ter Schegget, J (1995) Nested PCR approach for detectton and typmg of epidermodysplasia verrucifotrms-associated human papillomavnus types m cutaneous cancers from renal transplant recipients. J Clin. Microblol 33,690-695. 6. Tieben, L M., Berkhout, R. J. M., Smits, H. L., Bouwes Bavinck, J N., Vermeer, B. J., van der Woude, F. J , and ter Schegget, J. (1995) High prevalence of epidermodysplasia verruciformis-associated human papillomavirus m malignant and premalignant skin lesions from renal transplant recipients. J Invest Dermatol (in press) 7. Cornelissen, M T E , Bots, T., Briet, M A, Jebbink, M F , Struyk, A P H B , van den Tweel, J. G , Greer, C. E , Smits, H. L., and ter Schegget, J (1992) Detection of human papillomavirus types by the polymerase chain reaction and the dtfferentiation between high-nsk and low-rusk cervical lesions VzrchowsArch B Cell Pathol 62, 167-171 8. Lormcz A. T , Reid, R., Jenson, A. B., Greenberg, M. D., Lancaster, W , and Kurman, R. J (1992) Human papillomavnus infections of the cervix: relative risk associated of 15 common anogemtal types. Obstet. Gynecol 79,328-337. 9. Lungu, O., Sun, X. W , Felix, J., Richart, R. M., Silverstein, S., and Wreight, T. C (1992) Relationship of human papillomavirus type to grade of cervical mtraepithelial neoplasia JAMA 267,2493-2496. 10. van Bommel, P. J., van den Brule, A. J., Helmerhorst, T. J., Gallee, M. P., Gaarenstroom, K. N., Walboomers, J. M., Metjer, C. J., and Kenemans, P. (1993) HPV DNA presence and HPV genotypes as prognostic factors in low-stage squamous cell cervical cancer. Gynecol Oncol 48,333-337. I1 Tieben, L. M., ter Schegget, J., Minnaar, R. P., Bouwes Bavinck, J. N., Berkhout, R. J M., Vermeer, B. J., Jebbink, M. F., and Smits, H. L. (1993) Detection of cutaneous and genital HPV types in clmtcal samples by PCR using consensus primers. J Vu-01.Methods, 42,265-280. 12. Tieben, L. M., Berkhout, R J. M , Smits, H. L., Bouwes Bavinck, J. N., Vermeer, B. J., Bruyn, J. A., van der Woude, F. J., and ter Schegget, J (1994) Detection of epidermodysplasia verruciformis-like human papillomavirus types in malignant and premalignant skin lesions of renal transplant recipients. Br J. Dermatol 131,226-230 13. Smits, H. L., Tieben, L. M., Tjong-A-Hung, S. P., Jebbink, M. F., Minnaar, R. P., Jansen, C. L., and ter Schegget, J. (1992) Detections and typing of human papillomaviruses present m fixed and stained archival cervical smears by a consensus
126
Smits
polymerase chain reaction and direct sequence analysis allow the tdenttfication of a broad spectrum of human papillomavnus types. J Gen Vzrol 73,3263-3268 14 Sambrook, J., Frttsch, E. F., and Mamatts, T. (1989) A4ofecuZarClonzng A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 15. Boom, R., Sol, C. J. A., Sahmans, M. M. M , Jansen, C. L , Wertheim-van Dtllen, P M. E , and van der Noordaa, J. (1990) Raptd and sample method for the puritication of nucleic acids. J Clin. Mzcrobzoioay 18,495-503,
CHAPTER9
The Identification of Dengue Virus Using PCR Kouichi
Morita
1. Introduction Dengue virus is a member of the family Flavzviridae with a singlestranded positive sense RNA genome. The virus particle consists of a lipid bilayer with envelope (E) and membrane (M) proteins surrounding a spherical nucleocapsid composed of a genome RNA and capsid (C) proteins. The virion structure is easily destroyed by treatment with nonionic detergent (see Fig. 1) or low osmotic shock. Four antigenically related but distinct serotypes of dengue virus (DEN1 , DEN2, DEN3, and DEN4) are circulating in tropical countries and cause dengue fever and dengue hemorrhagic fever, both of which are highly prevalent. The identification and typing of dengue virus from field-caught mosquitoes and from patients, which are essential for epidemiological and clinical investigations, have been performed by immunological methods, such as hemagglutination inhibition test, virus neutralization test, complement fixation test, and, most recently, immunostaining with typespecific dengue virus monoclonal antibodies. Although these immunological virus identification methods are reliable, polymerase chain reaction (PCR) identification possessesseveral advantages over conventional immunological procedures. For example, single nucleic acid base sequencemutations can alter an amino acid on an epitope and results in a lack of reactivity with the monoclonal antibody (MAb) for the epitope, whereas a couple of nucleotide variations do not strongly affect From
Methods m Molecular Biology, Vol 50 Speoes Dagnostlcs Protocols. PCR and Other Nuclerc Acrd Methods Edtted by J P. Clapp Humana Press Inc , Totowa, NJ
127
Morita
128
(a) Purified virions of DEN2
(b) After NP-40 treatment (X58000)
(X58000)
Fig. 1. The effect of Nonidet P-40 treatment on dengue virus morphology. Dengue type-‘:! virus was purified by linear sucrosedensity gradient ultracentrifugation, negatively stained, and observed by electronmicroscopy. Purified virions were treated with NP-40 for 1 min. the PCR results. Actually, type-specific MAb escape variants are sometime observed (I). Furthermore, PCR identification can be completed faster than MAb staining. The PCR procedure described in this section is a direct rapid reverse transcription (RT) PCR procedure enabling simultaneous identification and typing within 3 h.
2. Materials 1. Virus sources: Dengue virus-infected mosquito cell culture fluids (2,3), acute phasepatients’ sera,and plasma can be used as a virus source. Any flavivirus source should be stored below -70°C until use. Storage in an ordinary type freezer (-20°C) should be avoided, becausethe virus particles are quickly destroyed in these conditions and the samples are no longer suitable for either PCR or virus isolation. Let the material thaw just before PCR and standit on ice during the procedure.Avoid repeatedfreezing and thawing. It is recommendedthat the material be aliquoted in small volumes before storage.
Identification
of Dengue Virus
129
Table 1 Nucleotide Sequences of the Dengue Primers Codea D 1S D 1C D2S D2C D3S D3C D4S D4C
Sequence GGACTGCGTATGGAGTTTTG ATGGGTTGTGGCCTAATCAT GTTCCTCTGCAAACACTCCA GTGTTATTTTGATTTCCTTG GTGCTTACACAGCCCTATTT TCCATTCTCCCAAGCGCCTG CCATTATGGCTGTGTTGTTT CTTCATCCTGCTTCACTTCT
Target sue, bp 490 230 320 398
“D1-4, dengue type 14, S, sense primer, C, complementary primer
Table 2
Nucleotrde Sequencesof the Dengue Probes
Codea Dl P D2P D3P D4P
Sequence GGATTCTGCTGACATGGCTAGGATTAAACTCAAGG GTGACCTGTGCTATGTTTACATGCAAAAAGAACAT ATTGCGATAGGAATCATTACACTCTATCTGGGGGT GGTGGCAGGAGGCTTACTTCTGGCGGCTTACATGA
aD1-4, denguetype 1-4, P, ohgo-probe
2. Primers and probes: Dengue serotype-specific primer pairs and synthetic oligo-probes are listed in Tables 1 and 2, respectively. These primers exhibit no farlure of amplification with dengue viruses Isolated in southeast Asia (1,4,5). 3. Phosphate-buffered saline (PBS): Dissolve 8 g NaCI, 0.2 g KCl, 2.9 g NazHP04.12Hz0, 0.2 g KH2P04 in 1 L of ultrapure water. Store at room temperature after autoclaving. 4. RT-PCR Buffer: 10 mM Tris-HCl, pH 8.9, 1.5 m&I MgC12, 80 mM KCl, 0.5 mg/mL BSA, 0.1% sodium cholate, 0.1% Trtton X- 100. Prepare 1OX concentrated buffer and store at -20°C. 5. Detergent mixture: 1% Nonidet-P 40 (NP-40) in PBS with 100 U of human placental RNase inhibitor (RNasein) (see Note 1). Make fresh just before use.
130
Mori ta
6. RT-PCRmixture. MIX 10 PL of 1OX RT-PCRbuffer, 1 yL of 20 rr&! dNTP, 10 U RNasein, 10U reverse transcriptase, 5 U Tth DNA polymerase, 1 pL of 100 pMlpL each primer (DlS, DlC, D2S, D2C, D3S, D3C, D4S, and D4C), brmging the total volume to 90 PL with pure water (see Notes 2 and 3). 7. Dye solution: Saturated bromophenol blue and xylene cyanol, 1% sodium dodecyl sulfate (SDS), and 5% sucrose m water. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10.
3. Method MIX 5 pL of specimen with an equal volume of detergent mix m a 500~pL Eppendorf type tube (see Note 4). Incubate the tube at room temperature for 1 mm (see Note 5). Add 90 pL of RT-PCR mixture. Vortex and overlay one drop of mineral oil, then tighten the cap. Set the tube on a PCR machine and incubate at 53°C for 10 mm (see Note 6). Start the PCR amplification with 3MO cycles (94°C for 60 s, 53°C for 60 s, 72°C for 60 s) (see Note 7). Pour 5 pL of dye solution into the tube and mix Electrophorese 5-10 yL of the sample on a 3% of agarose gel. Stain the gel with ethidium bromide for 5 min and observe under UV light. Determine the serotype according to the length of the product (Fig. 2).
A result of RT-PCR is shown in Fig 2. Each dengue virus is detected, and the serotype determined according to the amplified DNA size. Thus, detection of each virus and determination of the serotype are carried out
simultaneously. 1.
2.
3. 4.
4. Notes RNase inhibitor is an indispensable reagent. When virus infected-fluid is used as a virus source, 10 U of inhibitor m the detergent mixture is enough, However, when serum or plasma is used as a virus source, at least 100 U of inhibitor is necessary because of rich RNase contamination in the serum specimen. One of the important factors in direct RT-PCR procedure is the selection of DNA polymerase. I recommend the use of Tth DNA polymerase rather than Tag DNA polymerase, because of the higher heat stability and heparm resistance. The concentration of each primer is quite critical in the mixed primer system. An overly high concentration of primers strongly mhibits sensitivity. As mentioned in the introduction, dengue virus particles are easily disrupted by noniomc detergent treatment (see Fig. 1). However, this does not affect RT-PCR enzymic activity, which enables direct RT-PCR without the RNA extraction procedure.
Identification
131
of Dengue Virus
-
-
A
-
926 bps 489 267 80
Products
Fig. 2. >Photographof an agarosegel stainedwith ethidium bromide containing RT-PCR products (A). DEN1-4: dengue type l-4. m: DNA size marker (Hind111and HaeIII digest of pHY300PLK plasmid). (B) Slot blot hybridization of the above products with type-specific oligonucleotide probes (Table 2), which were labeled with digoxygenin 3’-end labeling kit (Boehringer Mannheim, Mannheim, Germany) according to the manufacturer’s instructions. 5. Sample incubation time with the detergentmixture is not critical. Usually, the virus particle is immediately disrupted by the treatment. One minute incubation is enough and no further incubations are necessary. 6. The reaction temperatureof RT (53°C) is higher than the optimum temperature of reversetranscriptase(42OC).The higher temperatureof RT reduces nonspecific band production while not reducing the RT-PCR sensitivity. 7. Incubation time of ,eachtemperaturein PCR amplification dependson the PCR machine. These conditions are for an oil bath type PCR machine. If an ordinary type, i.e., block type PCR machine is used, the following conditions might give better amplification efficiencies: 94°C for 60 s, 53°C for 90 s, 72°C for 120 s. 8. Although a very general caution in RNA manipulation, the use of plastic disposable gloves is strongly recommendedto prevent any RNase contamination from the examiner’s hands and fingers.
Mori ta
132
Acknowledgment The author thanks Mamoru Iwami for his excellent electron microscopy technique. References 1 Maneekarn, N , Morita, K., Tanaka, M., Igarashi, A , Usawattanakul, W , Sirisanthana, V., Inms, B. L., Sittrsombut, N., Nrsalak, A., and Nrmmamtya, S (1993) Applmattons of polymerase chain reaction for identrficatton of dengue vtruses isolated from pattent sera. Mzcrobzol Immunol 37(l), 4 l-47. 2. Igarashi, A., Fujita, N , Okuno, Y., Oda, T., Funahara, Y., Shnahata, A., Ikeuchi, H , Hotta, S., Wiharta, A. S , and Sujudi (1982) Isolation of dengue vtruses from patients with dengue hemorrhagtc fever (DHF) and those wtth fever of unknown origm (FUO) m Jakarta, Indonesia, m the years of 198 1 and 1982 ZCMR Annuls 2,7-l 7 3. Tesh, R B. (1979) A method for the isolation and tdentificatton of dengue viruses, using mosqutto cell cultures. Am J Trop. hIed Hyg 28, 1053-1059 4 Morita, K., Tanaka, M., and Igarashi, A. (1991) Rapid identificatton of dengue vuus serotypes by using polymerase chain reaction. J Clzn Mzcrobzol 29(10), 2107-2110 5. Morrta, K., Maemoto, T., Honnda, S., Omshr, K., Murata, M , Tanaka, M., and Igarashi, A (1994) Raptd detection of virus genome from imported dengue fever and dengue hemorrhagic fever pattents by direct polymerase chain reaction J Med Vzrol., 44,54-58
CHAPTER10
The Design and Application of Ribosomal RNA-Targeted, Fluorescent Oligonucleotide Probes for the Identification of Endosymbionts in Protozoa Nina
Springer, Rudolf Amann, and Wolfgang Ludwig
1. Introduction Species identification in microbiology has long been hampered by the limits of pure culture techniques. This is most evident in cases where morphologically conspicuous microorganisms have so far resisted all attempts of enrichment and cultivation like for many of the numerous endosymbionts of protozoa. Examples are the endonuclear symbionts in ciliates that have been known for more than a century (1). Cells of the genus Holospora multiply in the macro- or micronucleus of Paramecium caudatum. The characteristically elongated (infective) cell forms occurring during the developmental cycle are easily visualized by light microscopy. Also certain anaerobic ciliates live in close association with a variety of endo- and ectosymbionts (2), many of which were presumably classified as methanogens by the characteristic blue fluorescence of the coenzyme F420(3). This list could be considerably enlarged reflecting the common strategy of the unicellular protozoa to subsidize certain tasks to endosymbiotic microorganisms. From
Methods Nuclew
in Molecular Acid Methods
Bology, Edtted
Vol 50 Speaes by J P Clapp
133
Dlagnosbcs Protocols PCR and Other Humana Press Inc , Totowa, NJ
134
Springer, Amann, and Ludwig
With the advent of molecular biology, the situation has changed and isolation in pure culture is no longer a prerequisite for the characterization of endosymbionts. With the so-called rRNA approach microorganisms can be phylogenetically analyzed, and identified in situ without a need for prior cultivation. The approach is based on the work of Carl Woese and colleagues who have shown that the phylogenetic affiliation of microorganisms can be reconstructed from comparative analyses of rRNA sequences (4). With a molecular procedure encompassing the isolation of nucleic acids, an optional PCR step and the singularization of the rRNA genes (rDNA) by cloning it was possible to determine rRNA sequences from complex samples (5-7). For PCR and sequencing, conserved regions within the rRNA genes can be used as generic target sites for complementary oligonucleotide primers. A retrieved sequence is placed in an alignment of rRNA sequences and its phylogenetic affiliation as well as unique sequenceidiosyncrasies can be determined. In order to close the cycle the determined genotype has to be assigned to a defined morphotype (e.g., an endosymbiotic microorganism) by hybridization with fluorescently labeled, rRNA-targeted oligonucleotide probes complementary to the unique sequence regions (8,). The rRNA molecules are exceptionally well-suited as target molecules for nucleic acid probes owing to their natural amplification. An individual microbial cell contains between lo3 and lo5 ribosomes and as many copies of the 5S, 16S, and 23s rRNA. Therefore, even relatively insensitive short monolabeled oligonucleotide probes confer sufficient fluorescence to a cell to readily detect it in an epifluorescence microscope (8). The same is much more difficult (and hardly achieved with fluorescent oligonucleotides) for target nucleic acids with a lower abundance, e.g., plasmids or chromosomal genes. The combination of rRNA sequence retrieval and fluorescent oligonucleotide probing was first applied to the symbiotic bacteria of the genus Holospora that live in the nuclei of paramecia (9). H. elegans and H. undulata infect micronuclei of Paramecium caudatum, whereas H. obtusa infects the macronucleus in other strains of the same host species. The situation was complicated by the fact that these ciliates also feed on bacteria so that bacterial rRNA can not only be detected in the nuclei but also, e.g., in the food vacuoles of the host. After amplification, cloning, and sequencing of rDNA gene fragments 16s and 23s rRNA-targeted oligonucleotide probes were used to unambiguously assign the newly
Endosymbionts
in Protozoa
135
retrieved sequences to the intranuclear symbionts of P. caudatum. Consequently, the phylogenetic position of H. obtusa and H. elegans and not just of “sequences retrieved from infected paramecia” could be determined. The genus Holospora group in the alpha-subclass of Proteobacteria is showing moderate relationships to the Rickettsiales. Later it was revealed that Caedibacter caryophila, another nuclear symbiont of P. caudatum, is currently the closest relative of the genus Holospora (10). This bacterium is like the other members of the genus Caedibacter toxic for susceptible strains of paramecia and thereby confers a killer trait to its host. Other examples for identification of hitherto uncultured prokaryotes are the methanogenic symbionts of anaerobic ciliates. By 16s rRNA analyses, the polymorphic cells in the host Metopus contortus were shown to contain identical rRNAs, closely related to the archaeon Methanocorpusculum parvum (I 1). This endosymbiotic species is intriguing in showing a morphological transformation accompanied by a partial cell wall loss. The resulting enlarged cells attach to host organelles which generate hydrogen (hydrogenosomes). In similar studies, the phylogenetic positions of the methanogenic endosymbionts of M. palaeoformis and Trimyema sp., two other anaerobic ciliates;‘were analyzed (12,13). Other recent applications of the rRNA approach have yielded evidence that symbiotic life is not restricted to the alpha-subclass of Proteobacteria or methanogens. Sarcobium lyticum, an obligate intracellular parasite of small amoebae, phylogenetically has to be regarded as a Legionella species (14) belonging to the gamma-subclass of Proteobacteria. Polynucleobacter necessarius, a gram-negative obligate symbiont in the cytoplasma of the ciliate Euplotes aediculatus (15,,, was demonstrated to be affiliated with the beta-subclass of Proteobacteria, most closely related to Alcaligenes eutrophus (16). 2.1. Synthesis
2. Materials of Fluorescent
Oligonucleotides
2.1.1. Coupling the Fluorescent Dye to the Oligonucleotide 1. Carbonate buffer: 1M sodium carbonate buffer, pH 9.0 2. Dye solution: 5 mg/mL carboxyfluorescein-N-hydroxysuccmlmidyl ester (Boehrmger Mannheim, Mannheim, Germany) m dimethylformamide; freshly prepared from powdered dye.
136
Springer,
Amann,
and Ludwig
2.1.2. Purification of Fluorescent Oligonucleotides 1. Sucroseloading buffer: 20% sucrose,0.01% Bromophenol blue, 1mA4EDTA. 2. 1X TBE-buffer: 0.14M Tris base, 0.045M boric actd, 0.003M EDTA. 3. TE buffer: 10 mA4 Trts-HCl, 1 mM EDTA, pH 7.4.
2.2. Cell Fixation and Immobilization on GZass SZides 1. 2. 3. 4. 5.
6. 7. 8.
2.2.1. Cell Fixation 1X Phosphate buffered salme (PBS): 130 mM sodmm chloride, 10 nu’t4 sodium phosphate buffer, pH 7.2. 3X PBS: 390 n#sodnun chloride, 30 mMsodmm phosphate buffer, pH 7.2. 2MNaOH. 2MHCl. 4% Paraformaldehyde (Sigma, St LOUIS,MO) a. Heat 65 mL of HZ0 to 60°C. b. Add 4 g of paraformaldehyde. c. Add one drop of 2MNaOH solution and stir rapidly until the solutton has nearly clarified (should take only l-2 min). d. Remove from heat source and add 33 mL of 3X PBS, e. Adjust pH to 7.2 with HCl. f Remove remaining crystals by sterile filtration. g. Quickly cool down to 4°C and store m the refrigerator. 50% Ethanol (Sigma). 80% Ethanol. 96% Ethanol.
2.2.2. Gelatin-Coated Slides 1. Glass slides (Paul Martenfelder KG, Bad Mergenthetm, Germany) with six “wmdows” separated by a hydrophobic coating that prevents mtxmg of probes applied to adJacent spots on the slide. 2. Gelatin solutton: 0.1% gelatin (Baker Chemtcal Co., Philipsburg, NJ), 0.01% chromium potassium sulfate (Aldrich Chemical Corp., Milwaukee, WI).
2.3. Whole Cell Hybridization 1. 50 mL Polypropylene screwtop tube. 2. Whatman (Maidstone, UK) 3MM paper. 3. Hybrtdtzation buffer: 0.9M sodium chloride, 0.01% sodium dodecylsulfate, 20 mMTrts-HCl, pH 7.2.
Endosymbionts
in Protozoa
137
3. Methods 3.1. Synthesis of FZuorescent Oligonucleotides Oligonucleotides (average length of 15-25 nucleotides) are chemically synthesized (MWG Biotech, Ebersberg, Germany) (see Note 1). In the last coupling cycle an aminohexylphosphate-linker (i.e., Aminolink 2, Applied Biosystems) is attached to the 5’ end of the oligonucleotide. After cleavage from the column with ammonia (32%, Merck, Darmstadt, Germany) the resulting primary amino-group can be coupled with various activated substrates. Labeling reagents include biotin, digoxigenin, enzymes (alkaline phosphatase,horseradish-peroxidase), and fluorescent dyes (e.g., fluorescem, tetramethylrhodamine, Texas red). Biotin, digoxigenin, and fluorescent dyes are mostly available as isothiocyanates or N-hydroxysuccinimidyl esters. Since ammonia will compete in the coupling reaction, free ammonia must first be completely removed from the crude 5’-amino-linked oligodeoxynucleotide by two cycles of drying in a vacuum centrifuge and redissolving in double-distilled water or alternatively by an ethanol precipitation. 3.1.1. Coupling the Fluorescent Dye to the Oligonucleotide 1. Add, in order, to a 1S-mL Eppendorf tube: 100 pg aminolinked oligonucleotide dissolved in 175 pL H20, 50 yL sodium carbonate buffer (lM, pH 9.0), 25 PL carboxyfluorescein-NHS-ester (Boehringer) dissolved in dimethylformamlde. 2. Mix and incubate in the dark at room temperature for 8-16 h.
3.12. Purification
1.
2. 3. 4.
of Fluorescent Oligonucleotides Separate the oligonucleotide-dye conjugate from the bulk of unreacted dye by passing the reaction mixture through a NAP-5 Sephadex G25 column (Pharmacia, Uppsala, Sweden) equilibrated with ddHzO. The oligonucleotide (labeled as well as unlabeled) will elute from the column after approx 1 mL of ddH20. The eluate is fractionated and OD,,, is monitored. Unreacted dye does not elute m the first 2 mL. Pool appropriate fractions. Concentrate pooled fractions to about 50 pL m the Speed-Vat. Add 50 pL of sucrose loadmg buffer and load on a 1.5 mm 15% nondenaturating polyacrylamide gel (20 x 20 cm). Separate by electrophoresis in 1X NNB at about 300 V (15 V/cm) for 2-3 h. Remove the gel from the apparatus and place on a plastic-film wrapped thin layer plate impregnated with a UV indicator (Analtech Inc., Newark, DE). Visualize nucleic acids by shadowing the plate by illummation with a
138
5. 6. 7. 8. 9.
10.
Springer, Amann,
and Ludwig
short wave (254 mn) hand-held lamp. The higher molecular weight dyeoligonucleotide-conjugate (migrating slower than unreacted ohgonucleotrde) and unreacted fluorescent dye can be selectively visualized by long-wave UV illumination (366 nm). Excise and crush the region of the gel containing the fluorescent oligonucleotide. Elute the probe m TE buffer. Pass the eluated conjugate through a NENsorb20-column (DuPont, Wilmmgton, DE) for final purificatton and concentration as recommended by the manufacturer (17). Dry the eluate (Speed-Vat) and redissolve m about 100 pL H20. Lyophyhze aliquots for long-term storage. Determine the concentration spectrophotometrically. The ratio of absorbance at 260 nm (maximum for nucleic acids) and the peak absorbance of the fluorescent dye (fluorescein 490 nm, tetramethylrhodamine 550 nm) provide an estimate of probe “quality.” The 260 nm/490 run or 260 nm/ 550 nm ratios should be about three for monolabeled 20-mer. Final recovery of the fluorescent conjugate usually ranges between 10 and 25% of the starting material. Dilute fluorescent probes to a concentration of 25 ng/uL with Hz0 and store frozen in aliquots at -20°C. 3.2. Cell Fixation and Immobilization on Glass Slides (see Note 2)
3.2.1, Cell Fixation 1. Add 3 vol of paraformaldehyde fixative to 1 vol of sample (e.g., dense suspensions of protozoa or bacteria) and hold for l-3 h at 4°C. 2. Pellet fixed cells by centrifugation (5000g) and remove fixative. 3. Wash cells in 1X PBS and then resuspended in 1X PBS to a final vol of 1OS1 O9cells/ml. 4. Add 1 vol of ice-cold 96% ethanol and mix. 5. Fixed cells may now be spotted on glass slides or may be stored in the freezer (-20°C) for several months with little decline of ribosomes.
3.2.2. Immobilization of Fixed Cells on Glass Slides 3.2.2.1. PREPARATION OF GELATIN-COATED SLIDES I. Clean shde surface by soaking m a warm detergent solution for 1 h, rinse thoroughly with dH20, and air dry. 2. Coat clean slides with gelatin by dipping them m a warm (7OOC)gelatin solution. 3. Allow to air dry in a vertical posttion.
Endosymbionts
in Protozoa
139
3.2.2.2. APPLICATION OF CELLS TO THE MICROSCOPE SLIDE 1. Spread approx 3 pL of the fixed cell suspension on a gelatin-coated slide over an area about 5 mm in diameter. 2. Allow the smears to air dry. 3. Dehydrate the cells by successive passagesthrough 50, 80, and 96% ethanol washes (3 min each). 4. Slides can be stored dry at room temperature for several months. 3.3. Whole Cell Hybridization Hybridization must be carried out in a properly sealed moisture chamber to prevent evaporative loss of hybridization solution. Significant evaporation results in nonspecific binding of the fluorescent probe to the cells. A 50-rnL, polypropylene screwtop tube (Corning Glass Works, Corning, NY) serves as a convenient and portable hybridization chamber. 1. Soak a slip of Whatman 3MM paper in hybridization buffer and place in tube. 2. Allow the chamber to equilibrate for several minutes at the hybridization temperature (see Note 3). 3. For each spot to be hybridized mix 8 pL of hybridization buffer with 1 pL of fluorescent probe. 4. Spread 9 pL of hybrtdizatton buffer/probe mix on each spot of fixed cells. 5. Quickly transfer slide to the prewarmed moisture chamber and hybridtze for 2 h. 6. Remove slide from moisture chamber and immediately stop hybridrzatron by rinsing the probe from the slides with hybrrdizatron buffer prewarmed to hybridization temperature. 7. Wash the slide in hybridization buffer for 20 min at hybridization temperature. 8. Remove salts by shortly dipping slide in ddHzO, shake away excesswater, and air dry. 9. Mount slides in a glycerol/PBS mountant with a pH > 8.5 (e.g., CitifluorAFl, Citifluor Ltd., Canterbury, UK) and view with an epifluorescence microscope equipped with suitable filter sets, e.g., Zeiss filter sets nos. 09 for fluorescein, 15 for tetramethylrhodamine, and 00 for Texas red (see Notes 4 and 5). 4. Notes 1. The principles of hybridization and probe design have recently been described in detail (28). Here is just a short list that summarizes theoretical points and practical experiences of the authors while designing oligonucleotide probes: a. Any probe will only be as reliable as the sequence database and alignment used for its construction. Most important is, of course, the correct determination of the target sequence.
140
Springer, Amann,
and Ludwig
b. A prerequisite for successful probe design is a thorough knowledge of the phylogeny of the organism(s) of interest; it will not be possible to find a target region on the rRNA molecules that distinguishes a polyphyletic assemblage like the “pseudomonads” from “nonpseudomonads.” c. Number, position, and quality of the mismatch(es) are of prime importance for the practical value of a probe. One centrally located mismatch m an 18-mer ohgonucleotide can be sufficient for discrimmation. d. Care should be taken that a probe is not self-complementary. This could severely influence its performance m the hybridization. e. Inaccessibilities of certain target sites m whole cell hybridization experiments have been reported (18). These are likely caused by higher order structures, e.g., protein.rRNA interactions in the fixed ribosomes. A probe specifically bmdmg to extracted, purified rRNA does not necessarily yield good signal strength from whole fixed cells. If possible, probe target sites should be selected that have been used successfully m other whole cell hybridization experiments. Based on a good rRNA sequence database the probe selection should be performed in a computer-assisted way usmg appropriate software. The selected target region should be compared to available rRNA sequences in regular time intervals to implement new sequences.At the Department of Microbiology of the Technical University Munchen, Wolfgang Ludwig and coworkers are currently developmg a program package that includes all necessary tools. The ARB program package for handling and analyzing rRNA sequence data has been designed for UNIX systems.Aligned rRNA sequences together with higher order structure mformation, documentation, and a phylogenetic tree are stored in a central database. The tree stored in the database can be shown on the screen and can be used for selecting groups of sequences for further analysis by the PROBE tool. The PROBE tool searches potential target sites for sequence-specific probes and evaluates them by comparison with the complete database. Length, G + C content, position, and quahty of mismatches are taken into account. The potential target sites are further analyzed with respect to self-complementarity and occurrence in homologous and nonhomologous regions of nontarget sequences. A tool for consensus analysis to find group-spectfic signatures is under development. Additionally, the probes should be further tested by dot-blot hybridtzation against nucleic actds of multiple reference organisms (“phylogrid analysis” [19,20]). Thereby additional target strains and, e.g., closely related nontarget species for which rRNA sequences are not yet available can be quite rapidly examined. One has to be aware that probe
Endosymbionts
in Protozoa
141
specifities and sensitivities are strongly dependent on the exact hybridization conditions (for a detailed review see ref. 18). Parameters like hybridization and washing temperatures, concentrations of monovalent cations, and denaturing agents (e.g., formamtde) have to be carefully optimized. Only if a probe works reliably with known reference organisms tt can be applied with good confidence to complex environments. However, as long as the real microbtal diversity m a certain sample is unknown, rRNA-targeted probes should be regarded as tools being subject to refinement. 2. During hybridization the specimen is exposed to elevated temperature, detergents, and osmotic gradients. Thus, fixation of the protozoa is essential for mamtainmg the morphological integrity. Autofluorescence is minimized by fixation in fresh formaldehyde solutions. In order to immobilize large protozoa (e.g., ciliates like P. caudutum) on glass slides we found the following modtftcatton of the standard fixatron protocol very helpful: PBS washed protozoa are resuspended in a solution of agarose (0.05%) m 1X PBS, spotted on uncoated glass slides and immobilized by air-drying. Subsequently, the immobilized protozoa were fixed by submerging the glass slides in 4% paraformaldehyde (1 h); briefly washed m 1X PBS; and dehydrated m 50, 80, and 96% ethanol (3 min each). 3. The temperature of hybridization depends on the dissociation temperature (Td) of the oligonucleotide and must be empirically optimized. We have successfully used probes ranging from 15-25 nucleotides in length and hybridization temperatures ranging from 37-55°C. Higher temperatures damage the fixed cells. If a higher stringency is required, formamide (up to 50%) can be added to the hybridization solution. 4. It has proven useful to distinguish between casesm which cell peripheries limit dtffuston of rRNA-targeted probes into whole fixed cells and those cases in which higher order structures in the ribosomes prevent probe hybridization, The former will hinder bmding of any probe targeted to an intracellular target. The phenomenon is best understood as an exclusion of a certain size class of molecules. It is likely caused by the cell wall since membranes are expected to be readily permeable after the obligatory cell fixation. If this problem is observed, modifications of the fixation procedure should be evaluated. It is important to achieve a good compromise between sufficient cell permeabilization for efficient hybridization and good preservation of morphological detail. Without going mto detail we want to remind the reader that fixatives fall mto two general classes,precipitants like ethanol or methanol and crosslinking agents like the aldehydes (for review see ref. 21).
142
Springer,
Amann,
and Ludwig
Less predictable is the zn situ accessibility of defined target sites on either 16s or 23s rRNA molecules. We are routinely evaluating whole fixed cells with probes that have proven to result in bright hybridization signals with a wide array of microorganisms, e.g., the probes UNIV1392 (22) or EUB338 (23) that are complementary to regions of the 16s rRNA molecules of all sequenced microorganisms or all bacteria, respectively. Strong fluorescence of a cell preparation is taken as an mdication for both a sufficient cellular rRNA content and a good permeabilrzation of the cell wall. Nevertheless, newly designed probes may fail to give similarly bright fluorescence signals with the same cells. First factors like noncomplementartty of probe and target, meffective probe labeling, or nonoptimal hybridization conditions (e.g., hybridization at a temperature above the temperature of dissociation [Td] of the probe target hybrid) must be avoided. After ruling out an error on this level, for example, by successful hybridization of the same probe against isolated rRNA, everything points toward an in sztu inaccessibility of the probe target site. Since the rRNA target molecules remain m the ribosomes of the whole fixed cells, probe hybridization is much more influenced by RNA:RNA or RNA:protein interactions. Though the higher order structure of the ribosome 1s well known, the comigurational effects of fixation can hardly be predicted. In situ accessibility can sometimes be improved by addition of formamide to the hybridization buffer. 5. Currently, the standard probes are rRNA-targeted oligonucleotides with a single fluorescent dye molecule attached to the 5’ end. The most frequently used dyes are fluorescein (Ex 490 mn, Em 520 run), tetramethylrhodamine (Ex 550 nm, 575 nm), and Texas red (Ex 578 nm, Em 600 nm). Fluorescently monolabeled probes might fail to detect cells with low numbers of ribosomes. Probes can be made more sensitive by one or a combination of the followmg approaches: a. Indirect labeling (24); b. The use of alternative (25), more sensitive labels; or c. Multiple labeling (26). Depending on the cell type and the environment, one particular approach will be more sensitive than another.
Acknowledgments This work was supported by grants of the Deutsche Forschungsgemeinschaft (Am 73/2-2) and the Commission of the European Communities (BIOT-CT91-0294). The excellent technical assistance of Sibylle Schadhauser and Ingrid Pomper is acknowledged.
Endosymbionts
in Protozoa
143
References 1. Gortz, H.-D. (1986) Endonucleobiosis in ciliates. ht. Rev. Cytol 102, 169-2 13. 2. Fenchel, T., Perry, T., and Thane, A. (1977) Anaerobrosis and symbiosis with bacteria of free-living crhates. J Protozool. 24, 154-l 63 3. Van Bruggen, J J. A , Stumm, C. K., and Vogels, G. D. (1983) Symbtosis of methanogenic bacteria and sapropehc protozoa. Arch Mzkrobzol 136, 89-95 4 Woese, C R. (1987) Bacterial evolution. Mzcrobiol. Rev. 51,22 1-27 1. 5. Ward, D. M., Weller, R., and Bateson, M. M. (1990) 16s r-RNA sequences reveal numerous uncultured microorganisms m a natural community. Nature 345,63-65. 6. Giovannoni, S. J , Britschgi, T. B., Moyer, C. L., and Field, K. G. (1990) Genetrc diversity in Sargasso Sea bacterioplankton. Nature 345,60-63. 7. Schmidt, T. M , DeLong, E. F., and Pace, N R (1991) Analysts of a marme picoplankton cornmumty by 16s rRNA gene cloning and sequencing J Bacterlol 173,4371-4378.
8 DeLong, E. F , W&ham, G. S., and Pace, N. R. (1989) Phylogenetic stains ribosomal RNA-based probes for the rdenttfication of single microbial cells Sczence 243,1360-1363.
9. Amann, R., Springer, N., Ludwig, W., Gdrtz, H.-D., and Schleifer, K.-H (1991) Identrficatton zn situ and phylogeny of uncultured bacterial endosymbionts Nature 351, 161-164.
10. Springer, N., Ludwig, W , Amann, R., Schmidt, H. J., Gortz, H.-D , and Schleifer, K.-H. (1993) Occurrence of fragmented 16s rRNA in an obligate bacterial endosymbtont of Paramecium caudatum. Proc. Natl. Acad. Sci. USA 90,9892-9895 11. Embley, T M., Finlay, B. J , and Brown, S (1992) RNA sequence analysis shows that the symbionts in the ciltate Metopus contortus are polymorphs of a single methanogen species. FEMSMlcrobiol. Lett 97,57-62. 12. Embley, T M., Fmlay, B. J., Thomas, R. H., and Dyal, P. L. (1992) The use of rRNA sequences and fluorescent probes to investigate the phylogenettc positions of the anaerobtc cthate Metopus palaeformis and its archaeobacterial endosymbiont. J. Gen. Mcroblol. 138, 1479-1487. 13. Finlay, B J., Embley, T. M., and Fenchel, T. (1993) A new polymorphic methanogen, closely related to Methanocorpusculumparvum, living in stable symbiosis withm the anaerobic ciliate Trimyema sp. J, Gen. Mlcroblol. 139,37 l-378. 14. Springer, N., Ludwig, W., Drozanski, V , Amann, R., and Schlerfer, K.-H. (1992) The phylogenetic status of Sarcobium Zyticum, an obligate mtracellular bacterial parasite of small amoebae. FEMS Mlcroblol Lett 96, 199-202. 15. Heckmann, K. and Schmidt, H. J. (1987) Polynucleobacter necessanus gen. nov., sp. nov., an obligately endosymbiotic bacterium living m the cytoplasm ofEuplotes aediculatus. Int. J. System. Bacterial. 37,456,457. 16. Springer, N. (1992) Phylogenie und in-situ Nachwezs nzcht-kultlvierbarer bakteriellerEndosymbzonten PhD thesis, Tecbnische Umversrtat Munchen, Germany. 17. Johnson, M. T., Read, B. A., Manko, A M., Pappas, G., and Johnson, B. A (1986) A convenient new method for desalting, deprotemmng, and concentrating DNA and RNA Blotechniques 4,64-70.
144
Springer, Amann, and Ludwig
18 Stahl, D. A and Amann, R (1991) Development and application of nucleic acid probes in bacterial systematics, in Sequencing and Hybridization Techniques zn Bacterial Systematzcs (Stackebrandt, E and Goodfellow, M., eds ), Wiley, Chichester, UK, pp 205-248. 19 Manz, W., Amann, R., Ludwig, W., Wagner, M., and Schleifer, K.-H. (1992) Phylogenetic oligodeoxynucleotide probes for the maJor subclasses of proteobacteria problems and solutions. System Appl Microbial 15,593-600 20 Devereux, R., Kane, M D , Winfrey, J., and Stahl, D. A. (1992) Genus- and groupspecific hybridization probes for determinative and environmental studies of sulfate-reducing bacteria. Syst. Appl Microbiot 15,601-609. 21. Haase, A., Brahic, M., Stowrmg, L , and Blum, H. (1984) Detection of viral nucleic acids by in sztu hybridization, m Methods in virology, vol. 7 (Hamorosch, K and Koprowski, H., eds.), Academic, New York, pp 189-226 22 Stahl, D. A., Flesher, B., Mansfield, H. R., and Montgomery, L (1988) Use of phylogenetically based hybridization probes for studies of rummal microbial ecology Appl Envzron Mzcrobiol 54, 1079-1084. 23 Stahl, D. A, Devereux, R , Amann, R I., Flesher, B , Lm, C., and Stromley, J. (1989) Ribosomal RNA based studies of natural microbial diversity and ecology, in Recent Advances in Microbial Ecology (Hattori, T., Ishida, Y , Maruyama, Y , Morita, R , and Uchida, A , eds ), Japan Scientific Societies Press, Tokyo, Japan, pp. 669-673. 24. Zarda, B., Amann, R., Wallner, G., and Schleifer, K. H. (1991) Identification of single bacterial cells using digoxigenm-labelled, rRNA-targeted ohgonucleotides J Gen Mlcrobrol 137,2823-2830. 25. Amann, R., Zarda, B., Stahl, D A., and Schleifer, K.-H. (1992) Identification of individual prokatyotic cells by using enzyme-labeled, rRNA-targeted ohgonucleotide probes. Appl. Environ. Mlcroblol 58, 3007-3011, 26. Trebesius, K., Amann, R , Ludwig, W , Muhlegger, K., and Schleifer, K. H. (1994) Identification of whole fixed bacterial cells with nonradioactive rRNA-targeted transcript probes Appl. Environ. Mlcroblol 60,322&3235.
CHAPTER11
Subtraction for the Isolation Rhixobium Anthony
J. Bjourson
Hybridization of Strain-Specific DNA Probes and
James
E. Cooper
1. Introduction The principle of subtraction hybridization protocols is the removal from one cell type of nucleic acid sequences that are shared with other cell types (sources of subtracter sequences), to leave only sequences unique to the cell type or organism in question. Subtracter sequences may be from one or several related organisms and can be modified in a variety of ways to permit separation of unwanted hybrids from the cell-specific sequencesin the hybridization mixture. These include immobilization on solid supports to facilitate removal from the mobile phase by centrifugation (1,2) and biotinylation to allow capture of hybrids by affinity chromatography with streptavidin (I), by binding to avidin-coated beads ($4) or by streptavidin-phenol-chloroform extraction (5). These techniques are limited in their capacities to generate a pool of highly enriched cell-specific sequences, either by reliance on a single, partially efficient subtraction/separation system, or by an inability to amplify the small quantities of cell-specific nucleic acid generated by each round of subtraction. We describe here a combined subtraction hybridization and polymerase chain reaction (PCR) amplification procedure that overcomes these problems. It was originally designed to isolate unique DNA sequences from Rhizobium spp. (6), but is applicable to any group of bacteria to generate species- or strain-specific DNA probes. From
Methods Nucleic
m Molecular Acid Methods
Biology, Edited
Vol 50 Sperms by J P Clapp
145
D/agnostrcs Protocols PCff and Other Humana Press Inc , Totowa, NJ
146
Bjourson and Cooper
1.1. Outline of Procedure A combination of four distinct separation strategies is used to isolate umque DNA sequencesfrom the genome of cell type “A” after its hybridization with total genomic DNA from related cell types, “B.” The steps involved are shown diagramatically m Fig. 1. Cell type “A” in this scheme is the organism for which a DNA probe IS to be constructed and cell type “B” refers to a group of related strains or species of bacteria that collectively provide the source of subtracter DNA. Sau3A-digested DNA from cell type “A” is ligated to a linker, denatured to single-stranded form and hybridized in solution with a vast excess of subtracter DNA from cell type “B,” which has been restricted, ligated to a subtracter-specific brotinylated linker, amplified by PCR to incorporate dUTP and has similarly been denatured. Subtracter DNA and “A-B” hybrids are then removed by phenol-chloroform extraction of a streptavidin-biotin-DNA complex. NENSORB chromatography of the sequencesremaining in the aqueous layer captures biotinylated subtracter DNA that may have escaped removal by the phenol-chloroform treatment (NENSORB matrix irreversibly binds protein). Traces of contaminating subtracter DNA are removed by digestion with uracil DNA glycosylase. Finally, remaining sequences are amplified by PCR with the type “A’‘-specific primer, labeled and tested for specificity in dot blot hybridizations against total genomic target DNA from cell type “B.” Removal of cross-hybridizing sequences is normally achieved after one or two rounds of subtraction/amplification. The information given in the following is generally applicable to probe generation in bacteria. The organism for which a probe is required is termed the probe strain and the group of related organisms, which share some DNA homology with the probe strain, are termed subtracter strains. 2. Materials 1, TE buffer: 10mA4Tris-HCl, 1 mJ4 EDTA, pH 8.0. 2. Resuspensionbuffer: 25% sucrose,1 mg/mL lysosyme, 10 mMTris-HCl, pH 8.0 (freshly prepared). 3. Lysis solution: 5 miI4 guanidine isothiocyanate,100 mM EDTA, pH 7.0 (storedrefrigerated,heatedto 37°C prior to use). 4. Phenol: molecular biology grade(Sigma, St. Louts, MO). 5. Chloroform/isoamyl alcohol: 24: 1 (v/v). 6. 7.5M Ammonium acetate(sterilized by autoclaving).
Isolation
of Rhizobium
DNA Probes
147
Sau3A-digested DNA from cell type(s) B (srbtracter DNA)
Sau3A-digested DNA from)cell type A
ligate to linker B
ligate to linker A
+
+
PCR amplify using biotinylated type B-specific primer and substituting dUTP for dTTP
PCR amplify using type A-specific primer
HYBRIDIZE
with excess subtracter
DNA
4 * 1 Add streptavidin, phenol-chloroform and ethanol precipitate *2 “$4
extract,
4 NENSORB ch;omatography
treat with uracil DNA g$osylase using type -specific USE AS A PROBE OR FO
and amplify by PCR primer
FURTHER GENETIC ANALYSIS
Fig. 1. Scheme for isolating umque nucleic acid sequences from cell type “A” by combined subtraction hybridization and PCR amplification, showing the four (*) separation strategtes employed. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16.
3M Sodium acetate, pH 5.5. 2-Propanol. 70% Ethanol (store in a spark-proof freezer at -2OOC). Restriction endonuclease Suu3A (Pharmacia, Uppsala, Sweden). DNA ligase (Pharmacia). Ohgonucleottdes (purified by HPLC or PAGE, synthesis and purification available commercially). PREP-A-GENE matrix (BioRad, Hemel, Hempstead, UK). Alternatives such as Wizard DNA clean-up columns (Promega, Dublin, Ireland) or equivalent DNA micropurification systemsare also acceptable. Phase lock gel (CP laboratories, Bishops, Stortford, UK). Centricon 30 microconcentrators (Amicon Ltd., Stonehouse, UK). Taq polymerase, uracil DNA glycosylase, and all PCR reagents available from Perkin Elmer (Warrington, UK).
148
Bjourson and Cooper
17. NuSteve agarose, SeaKem agarose (FMC BioProducts, Sittingbourne, UK). 18. Hybridization solution: 50 mA4 HEPES, pH 7.5, 500 mM NaCI, 1 nQI4 EDTA, and 0.1% SDS. 19. NENSORB 20 purification cartridges (DuPont Ltd., Stevenage, UK). 20. 20X SSC (20X SSC is 3M sodium chloride, 300 mMsodium citrate): Sterilize by autoclaving. 2 1. Extraction buffer: 500 mM’NaC1, 1 mM EDTA, and 50 mA4 HEPES. 22. Streptavidin (Boehringer Mannhelm, Lewes, UK). 23. Chromatography columns (push columns, Stratagene Ltd., Cambridge, UK). 24. Denaturing buffer: 1.5M NaCl, 500 rnA4 NaOH. 25. Neutrahzmg solutton: 1SMNaCl, 500 mMTns-HCl, pH 7.2, 1mMEDTA. 26. Hybond-N+ membranes (Amersham plc, Little Chalfont, UK). 27. Prehybridlzation solution: 4X SSC, 10X Denhardt’s solution, 100 pg/mL sonicateddenatured salmon sperm DNA, 10mMTris-HCI, pH 80,O. 1% SDS
3. Methods 3.1. Isolation of DNA 1. Pure cultures of bacteria are grown in 50-mL conical flasks containing 25 mL of appropriate growth medium. 2. Pellet 5 mL of each broth culture m a bench centrifuge and then resuspend the pellets m 50 p.L of fresh medium. 3. Transfer to a 1.5-mL centrifuge tube and repellet, followed by washmg three times with 500~uL TE buffer. The final pellet is resuspended in 100 pL of resuspension buffer and incubated at 37°C for 15 min. 4. Add 200 p,L of lysts solutton to lyse the cells. 5. MIX gently with 150 pL of 7.5M ammomum acetate and extract with 500 uL of chloroforrmisoamyl alcohol by mixing and centrifuging m a microcentrifuge for 10 mm. 6. Transfer the aqueous layer to a clean 1.5-mL centrifuge tube and precipitate the DNA by the addition of 0.54 vol of 2-propanol. 7. Collect the DNA by centrifugatron and wash twice in 100 pL of 70% ethanol. Then resuspend m 20 uL of TE buffer. 8. The DNA concentration is estimated by gel electrophorests of 5-pL vol. Approximately 1 ug DNA from each strain is digested with restriction endonuclease Sau3A, and the restriction fragments are purrfied with PREP-A-GENE matrix (alternatives such as Wizard DNA clean-up columns or equivalent DNA micropurificatron systems can also be used) as described by the manufacturer and resuspended in 20 uL of TE buffer
Isolation
of Rhizobium
DNA Probes
149
3.2. Synthesis of Oligonucleotides and Preparation of Linkers Oligonucleotides with the following base sequences are synthesized (see Note 1): TB7006 TB7007 TB7008 TB7009
5’ HO-AGCGGATAACAATTTCACACAGGA-OH 3’ 5’ BIOTIN-CGCCAGGGUUUUCCCAGUCACGAC -OH 3’ 5’ P-GATCTCCTGTGTGAAATTGTTATCCGCT-OH 3’ 5’ P-GAUCGUCGUGACUGGGAAAACCCUGGCG-OH 3’
1. Resuspend the oligonucieotides in sterile TE buffer at a final concentration of 200 p.M and store in aliquots at -20°C. 2. Pairs of oligonucleotides (5 pg each) are combined to produce the linkers L-P (TB7006 and TB7008) and L-S (TB7007 and TB7009). 3. Heat the mixtures to 65°C and cool slowly at room temperature to produce double-stranded linkers containing 5’-phosphorylated Suu3A-compatible overhangs at one end. 4. Ligate linker L-P to Suu3A-digested probe strain DNA and linker L-S to similarly digested subtracter DNA (see Note 2). In each case Sau3A-digested DNA (200 ng) is mixed with 600 ng of the appropriate linker and the mixture is ligated with DNA ligase (see Note 1). 5. Remove excess linkers with PREP-A-GENE matrix by procedures described by the manufacturer and elute the linked DNA in 20 pL of TE buffer at 5OOC.
3.3. Preparation
of Probe Strain
DNA
Probe strain DNA (1 pg) modified by ligation to linker L-P is amplified with 45 cycles of PCR (see Note 3). Each cycle consists of denaturation at 94°C (80 s), annealing at 55°C (1 min), and DNA polymerization at 72°C (2 min) in an automated thermal cycler (e.g., Perkin Elmer Cetus, model 480). Reactions are performed in sterile 0.5-mL tubes with 100 PL final reaction volumes containing 10 mA4 Tris-HCl, pH 8.3, 50 nG’14KCl, 1.5 mit4MgC12, gelatin, 0.01% (w/v), dNTPs, 200 @4, primer TB7006, 1 PM, 0.5 U of AmpliTaq DNA polymerase (Perkin Elmer Cetus). Evaporation from the tubes is prevented by addition of a 100 pL mineral oil overlay (alternatively, oil-free PCR tubes can be used and removal of oil by chloroform extraction is avoided).
150
1.
2. 3. 4. 5.
Bjourson and Cooper 3.4. Preparation of Subtracter DNA Subtracter DNA from the required number of subtracter strains, modtfied by ligation to linker L-S, IS amplified by PCR as indrvidual stram DNA according to the amphficatron condmons descrtbed for probe strain DNA, except that primer TB7007 IS used instead of TB7006 and dUTP IS substituted for dTTP to give a final dUTP concentratron of 300 @I. Examme the efficiency of amplification by submittmg 10 pL vol of each reaction to electrophoresrs m compostte gels (3% NuSieve agarose, 1% SeaKem agarose [w/v]). Pool the subtracter DNA PCR products and remove the mineral oil by extractton with an equal volume of chloroform!rsoamyl alcohol (if oil-free PCR tubes are employed this extractton can be omrtted). Transfer the aqueous phase to a Centrrcon 30 mrcroconcentrator and concentrate by spin dialysis to yield a final volume of 25-50 pL. Make the volume up to 2 mL with 1mM EDTA and repeat the spin dtalysts step until the residual volume of the mixture IS approx 25 p-L. Thts step IS repeated with another 2 mL of 1 mM EDTA.
3.5. Subtraction Hybridization 1. MIX PCR-amplified probe strain DNA (l-5 ng) and approx 20 pg subtracter DNA in a 0.5 mL microcentrrfuge tube contaming hybrrdrzation solution to give a total volume of 10-20 pL. The DNA is initially dlssolved in a small volume of water and the remamder of the components are added from concentrated stocks (see Note 4). 2. Overlay the mrxture with 50 pL mineral 011and denature the DNA at 99°C for 10 min, cool rapidly on ice, and incubate at 64OC for 48 h to allow subtraction hybridization to take place (see Note 5).
of Probe Strain-Specific DNA Sequences from the Subtraction Mixture Add 100 pL extraction buffer and briefly centrifuge the mixture. Remove excessmineral or1and add 10 pg of streptavrdin. Mix the tube gently at room temperature for 5 mm and add a further 20 pg of streptavidm. Extract the mixture with an equal vol of phenol/chloroform (50:50 [v/v]) and centrifuge m a mtcrocentrifuge for 10 min at 15,OOOg(see Note 6). Transfer the aqueous phase to a fresh tube, add SDS to O.l%, and extract the mixture twice more with phenol/chloroform and once with chloroform. Preciprtate the DNA remaming m the aqueous phase after the addition of 3M sodmm acetate (0.1 vol) and 2 ~0199% ethanol. The pellet, which may not be visible, 1s washed with 100 pL 70% ethanol and redissolved in 20 FL TE buffer, pH 8.0.
3.6. Isolation 1. 2. 3. 4. 5.
Isolation
of Rhizobium DNA Probes
151
6. Desalt the deproteinized DNA with a NENSORB 20 purification cartridge as described by the manufacturers, and finally resuspend in 10 pL TE buffer. This subtracted DNA (5 pL), enriched for probe strain-specific sequences, is used for another subtraction cycle and I pL of the remaining 5 pL IS used to prepare logarithmic dilutions in 9 pL aliquots of TE buffer. 7. Ten microliters of each dilution is mixed with PCR reagents (10 mA4 Tris-HCl, pH 8.3, 50 rnil4 KCl, 1.5 mM MgCl*, gelatin, 0.01% [w/v], dNTPs, 200 @I) containing 15 U of uracil DNA glycosylase and incubated at 37°C for l-4 h to destroy all traces of dUTP-containing subtracter DNA. 8. Primer TB7006 (5 pL of 200 &I& probe strain-specific) and 0.5 U of Taq polymerase are added to a final volume of 100 pL and the reaction mix is amplified for 45 cycles under the temperature conditions described in Section 3.3. to prepare probe strain DNA. PCR products are detected by electrophoresis of 10 pL volumes of each PCR mix in composite gels.
3.7. [92P]-Labeling of Subtracted Probe Strain DNA Radiolabel the subtracted and PCR-amplified probe strain DNA (5 pL) with three cycles of amplification. Each cycle consists of denaturation at 95°C (2 min), renaturation at 55°C (2 min), and polymerization at 72°C (10 min). Reactions are performed in 100 pL final volumes containing 10 mA4 Tris-HCl, pH 8.3, 50 mM KCl, 1.5 miI4 MgC&, 0.01% gelatin, (w/v), dATP, dTTP, dGTP, 200 weach, 5 pL [32P]dCTP (400 CilmM), primer TB7006, 1 pJ4 and 0.5 U of AmpliTaq DNA polymerase. Unincorporated nucleotides are removed by push column chromatography as described by the manufacturer. 3.8. Preparation of DNA Dot Blots 1. Denature total genomic target DNA (1 pg) from each subtracter strain at 100°C for 10 min, snapcool on ice, and add 1 volume of 20X SSC. 2. Manually spot samples on to Hybond-N+ membranes in 5-pL aliquots. 3. Place membranes on filter paper soaked in denaturing solution for 5 min and transfer to another filter paper containing neutralizing solution for 1 min. 4. Fix the DNA to the membranes by placing them on filter paper soaked in 0.4A4 NaOH (20 min), immersing briefly in 6X SSC followed by air drying. Membranes are stored at 4OCuntil used.
3.9. Filter
Hybridizations
1. Prehybridize filters for 5 h at 68°C in bags containing prehybridization solution. Hybridization is performed at the same temperature with 2.5 x lo6 cpm/mL of [32P]-labeled subtracted DNA probe for 18 h.
152
Bjourson and Cooper
A
B
C
1 2 3 4 5 6 7 8 Fig 2. Specificity of DNA sequencesfrom Rhizobium leguminosarum bv. trifolii strain 1 generatedby subtraction hybridization. DNA from strain 1 was submitted to zero (A), one (B), or two (C) rounds of subtraction/amplification against DNA from seven other strains from the same species(2-S). At each stage [32P]-labeledstrain 1 sequenceswere hybridized in duplicate to 1 pg of total genomic DNA from the homologous and subtracter strains. 2. Wash filters in 1X SSC, 0.5% SDS for 1 h (4 x 15 min), and in 0.1X SSC, 0.5% SDS at 68°C for 1 h (4 x15 min). 3. Subject filters to autoradiography (I). An example of probe specificity is shown in Fig. 2; two rounds of subtraction/amplification have removed from Rhizobium Zeguminosarumbv. trifolii strain 1, nucleic acid sequences that crosshybridize with total genomictarget DNA from sevenother strains of the samespecies(2-8). Thesestrainswere the sourceof subtracterDNA in this experiment (seeNote 7).
4. Notes 1. It is important to have a large molar excessof linker over Sau3A digested ‘fragmentsto prevent the latter ligating to each other. For example, if a unique DNA fragment becomes ligated to a nonunique fragment, the unique sequence will be inadvertently subtracted together with the nonunique sequence.To negatethis problem, the cohesivetermini are partially filled-in by one base that renders the termini of the digested DNA incompatible. Linkers are designed to be compatible with the partially
Isolation
of Rhizobium
DNA Probes
153
filled-in termim. This modificatron will also prevent self ligation of lmkers, making their removal after ligation less critical. Different primers and lmkers should be designed for each separate subtractton experiment to eliminate the build up of potential contaminating sequences. 2. Modification of probe and subtracter DNA, by the addition of specific lmkers, permits the unbiased ampltfication of fragments in the 100-2500 bp size range and it 1s important that the restriction enzyme chosen for the DNA digestion ytelds fragments within this size range. 3. At all stagesof the subtraction process, but m particular after subtraction 1s complete, rt IS vital that the subtracted material does not become contamrnated by unsubtracted probe sequences.Even a small amount of contamtnation from this source will be subsequently amplified by PCR. Although contammatton with subtracter DNA can be eliminated by uractl glycosylase treatment prior to amplification, contamination involving unsubtracted probe sequencescan only be removed by additional subtraction cycles. For this reason, PCR reagents and master mixes must be prepared in a sequestered laboratory Separate ptpets should be reserved for this purpose or at least filtered sterile pipet tips should be used. Control PCR reactions devoid of template should be employed to check for contammatton of reagents at all PCR amplificatton steps. Mtcrocentrifuges and centrifugal evaporators should be kept clean. Tubes should not be left open during centrimgal evaporation. Instead, pierce the tube lid with a sterile hypodermic needle. This practice will prevent contammatton of the evaporator bowl by the sample and vice versa. 4. Despite the need for the large molar excessof subtracter over probe strain DNA, the actual amount required for each round of subtraction is m the 10-20 pg range. Additionally, the subtracter DNA is m an easily replenishable form and this feature would assume special srgnificance for organisms that are difficult to grow or whose DNA is difficult to extract. 5. The stringency at which the subtraction is performed IS an important factor when considering the intended use of the final sequences. Low stringency conditions will remove some probe strain sequencesthat have a relatively low base sequence homology with the subtracter DNA, whereas high strmgency subtraction will remove only perfectly matched sequences. 6. The efficiency of the phenol/chloroform extractions can be greatly improved by the use of phase lock gel (CP Laboratories, UK), which forms a barrier between the organic and aqueous phases.This permits total recovery of the aqueous phase without contaminatton from the interface. Although other methods for removing brotmylated nucleic acids are avatlable, such as streptavidin-coated magnetic beads, the procedure described here appears to be the most efficient.
154
Bjourson and Cooper
7. This method permits the reliable and rapid isolation of strain- or species-specific bacterial DNA sequences.The isolated fragments can be used directly as probes m colony or dot blot hybridizations with unknown target DNA, or they can be cloned and further characterized by sequencing or restriction mapping. It is advisable to clone the products for long-term use and to avoid the risk of contamination.
References 1. BJourson,A. J and Cooper, J. E. (1988) Isolation of Rhzzobzum lotz strain-specific DNA sequences by subtraction hybridization. Appl Envzron Mzcrobzol 53, 1705-1707. 2. Scott, M. R. D., Westphal, K.-W,, and Rigby, P. W. C. (1983) Activation of mouse genes m transformed cells Cell 34,557-567. 3. Straus, D. and Ausubel, F. M (1990) Genomic subtraction for clonmg DNA corresponding to deletion mutants, Proc Natl. Acad Scz USA 87, 1889-l 892 4. Sun, T.-P , Goodman, H M , and Ausubel, F. M. (1992) Cloning of the Arabzdopszs GA1 locus by genomic subtraction Plant Cell 4, 119-128 5 Sive, H. L. and St John, T (1988) A simple subtractive hybridization technique employing photoactive biotm and phenol extraction. Nuclezc Acids Res 16,10,937 6. BJourson, A J , Stone, C. E , and Cooper, J. E. (1992) Combined subtraction hybridization and polymerase chain reaction amplification procedure for the isolation of strain specific Rhzzobium DNA sequences. Appl Envzron. Mzcrobiol. 58, 2296-2301
CHAPTER12
The Use of WD for Generating Specific DNA Probes for Microorganisms 2Marco Bazxicalupo
and Renato
Fani
1. Introduction The problem of accurate definition and characterization of bacterial species and strains is of great relevance in microbial ecology, in the determination of taxonomic identity, and in clinical diagnosis and food analysis. The identification of bacteria, for many purposes, is carried out most frequently by conventional microbiological techniques that rely on the ability of bacteria to grow on selective media or on biochemical assays. These methods, however, are not discriminating, especially for the identification of strains belonging to the same or closely related species. Moreover, some bacteria are difficult or impossible to grow in laboratory conditions (I) and in many cases the results take a considerable time to obtain or are not completely reliable. In recent years, major breakthroughs in bacterial identification came with the introduction of molecular biology techniques aimed directly at DNA molecules rather than at the phenotype of the cells. In this context the availability of specific molecular probes contributed to the development of powerful identification techniques. Unfortunately, probes are in some cases difficult to obtain, in particular when bacteria that are little known at the molecular level are considered. The nucleotide sequencesthat can be chosen as probe can be roughly differentiated into probes containing highly conserved sequences (e.g., From
Methods Nude/c
in Molecular Acrd Methods
Bology, Echted
Vol 50. Specres Dagnostrcs Protocols PCR and Other by J P Clapp Humana Press Inc , Totowa, NJ
155
156
Bazzicalupo
and Fani
rDNA sequences) or less conserved ones. A third type of probe is represented by randomly cloned sequences(anonymous probes). 1.1. rRNA Gene The most common application of this technique to microbial systematics takes advantage of the high conservation of rRNA genes. Restriction patterns can be obtained by hybridizing Southern-blotted DNA fragments with labeled 16s and 23s rRNA from Escherichia coli (2). This method, called ribotyping, has been shown to have both taxonomic and epidemiological value (2-5). Particular rRNA sequencesthat are species or group specific have been also exploited to construct oligonucleotides that have been used as probes for in situ detection of bacteria or as primers for selective amplification of diagnostic rRNA sequencesvia PCR. 1.2. Other Genes Cloned fragments of the cholera toxin gene (or homologous sequences from E. coli LT toxin gene) have been used to distinguish between Vibrio cholerae isolates. A cloned fragment from the exotoxin gene has been used to type Pseudomonas aeruginosa (6); the use of RFLP of the insertion sequence IS61 10 as an epidemiological marker in tuberculosis as also been suggested (7,8). The use of other genes, such as the genes involved in nodulation (nod), in nitrogen fixation (n$, or m the biosynthesis of histidine (his), has permitted discrimination among strains of the genus Azospirillum (9). Genes whose sequences are specific for a given species have been used for detection with hybridization or PCR. 1.3. Anonymous Probes The use of randomly cloned DNA fragments as probes was described by Tompkins et al. (10). These probes are referred to as “anonymous probes” since their function, nucleotide sequence, and/or restriction map are unknown. The sensitivity of this method is either the same as or higher than that of rRNA patterns. Recently, this method has been used for the determination of the DNA fingerprinting of Chlamydia trachomatis strains (I I). Any of these probes present advantages and drawbacks whose discussion is beyond the scope of this presentation, we only emphasize that in many cases the probes mentioned earlier must be used on laboratory isolated strains and cannot be applied to bacteria that are difficult to grow.
RAPD for DNA Probe Generation
157
In a search for a strategy to generate specific probes for bacterial identification, as an alternative to the already described sequences, we exploited the ability of random amplified polymorphic DNA (RAPD) (12-14) to generate markers specific for a given genome (14,15). We propose to use these diagnostic markers as probes to specifically hybridize DNA from unknown samples amplified with the same random primer. Depending on the type of primer used and on the conditions of the reaction, random amplification of bacterial genomes can generate DNA fragments that are diagnostic for a genus, for a species, or for a strain. The strategy we propose first aims at identifying the diagnostic RAPD marker and to subsequently use it as a probe to hybridize DNA from unknown samples amplified with the same random primer. The procedure (Fig. 1) involves the selection of strains of interest from a particular environment; the DNA of these strains is then amplified with a random primer and the products analyzed for “identifying” fragments that are different in size among the strains. Diagnostic fragments are selected for each strain and tested as probes vs all the other strains. These probes could be conveniently used to detect particular strains in environmental samples; DNA from the environmental sample can be extracted without previous isolation of the bacteria, amplified with the same primer used for generating the probe, and hybridized to the probe; a positive signal indicates the occurrence of the corresponding strain. We have tested this strategy with strains of the nitrogen-fixing soil bacterium Azospirillum demonstrating that RAPD can provide DNA probes diagnostic for a genus, for a species, or for a particular strain. In the following sections the experimental procedures to accomplishing the different steps of the strategy sketched out in Fig. 1 are described. 2. Materials 2.1. DNA Extraction 1, TE: 10 mM Tris-HCl pH 8.0, 1 mM EDTA. 2. CTAB (hexadecyltrimethylarnmoniumbromide): CTAB is preparedas a 10% solution and should be kept at 65°C for 10 min before its use as the solution is very viscous. 3. SDS (sodium dodecyl sulfate): Preparedas a 10% solution with sterile water and kept at room temperature. 4. ProteinaseK: Dissolveat20 mg/mL in sterilewater andstorefrozen at-20°C. 5. 5MNaCl.
A
0
EXTRACTION OF GENOMIC DNA FROM INDIVIDUAL BACTERIAL CULTURES
C
1
1 5
-
5’
-3 -
3’-
S
-
3’-
EXTRACTION OF TOTAL DNA FROM ENVIRONMENTAL SAMPLES -3 5’
AMPLIFICATION WITH ARANDOM PRIMER 1
ABC AMPLIFICATION WITH A RANDOM PRIMER AND LABELLING ELECTROPHORETIC SEPARATION OF RAPD. IDENTIFICATION OF SPECIFIC RAPD MARKERS
__)
A
REAMPLIFICATION. PURIFICATION
B
C
HYBRIDIZATION TO THE PROBE
ABC LABELLING HYBRIDIZATION TO THE PC!4 PRODUCTS
l-7
4J
Fig 1. Overall strategy for generating specific DNA probes for microorgamsms.
159
RAPD for DNA Probe Generation
6. Chloroform (chloroform-isoamyl alcohol 24: 1) and phenol-chloroform (phenol saturated in Tris-HCl pH 8.0:chloroform:isoamyl alcohol, 25:24: 1). 7. RNase: Dissolve 10 mg/mL of RNase A in sterile water boiling for 5 min and store at -20°C. 8. Isopropanol.
2.2. PCR 1. Instrument: We have used with successthe Perkin Elmer (Norwalk, CT) thermal cycler model 9600, but any PCR thermal cycler is probably suited for the procedures described herein; it is, however, advisable to carry out all the experiments with the same instrument, as RAPD is very sensitive to any variation in experimental conditions. 2. Enzyme: There are many commercially available Tuq polymerases, we have used the Perkin Elmer AmpliTuq, and we have data indicating that Taq polymerase from Boehringer Mannheim (Mannheim, Germany) is also suitable for this work. We suggest that the reproducibility of results should be tested when trying a new Tuq polymerase because there are enzymes that are good for regular PCR but which give it-reproducible results with RAPD. 3. Buffer: Always use the buffer purchased with the enzyme, adjust the Mg2” concentration in the mixture for RAPD using a 15 mJ4 solution prepared in redistilled water and filter sterilized. 4. Primers: The primers are synthesized by standard phosphoramidite chemistry, deprotected, dried, dissolved in TE at 250 ng/pL, and used without further purification.
2.3. Agarose
Gel Electrophoresis
1. Ethidium bromide is prepared in sterile water at 10 mg/mL. Ethidium bromide is a mutagen, never mouth pipet, and always use disposable gloves. 2. Agarose: Multipurpose agarose from Boehringer Mannheim or any equivalent agarose is used at 0.6% (2% when analyzing PCR products) in TAE buffer. 3. TAE buffer (50X solution): 242 g Tris base, 57.1 mL glacial acetic acid, 100 mL 0.5M EDTA, pH 8.0, distilled Hz0 to 1 L.
2.4. Reamplification TE: 10 rniV Tris-HCl Sections 2.2. and 2.3.
2.5. Purification
of RAPD Bands
pH 7.5,O. 1 rmJ4 EDTA. For other materials see
of RAPD Markers
Materials are described in Section 2.3.
from Gel
160
Bazzicalupo and Fani 2.6. Labeling
All necessary materials are included in the labeling kit (Boehringer Mannheim), except: 1. 0.2M EDTA, pH 8.0. 2. 4A4 LrCl in redistilled water and filter sterilized. 1. 2. 3. 4.
2.7. Hybridization Denaturing solution: 1SMNaCl, 0.5MNaOH. Renaturing solutton: I .5MNaCl, 0.5M Tris-HCl, pH 7.2, 1 mM EDTA. SSC: The 1X solution IS 0.15MNaC1, 0.015MNa3 citrate. Prehybrrdization solution: 5X SSC, 50% formamide, 0.1% N-laurylsarcosrnate, 0.02% SDS, 5% Boehrmger
Mannheim
blockmg
reagent.
5. Hybridization solution: The same as prehybrrdtzation with the addition of 25 ng of probe previously denatured at 95°C for 10 mm. 6. 0.1% SDS m distilled water. 2.8. DNA from Soil Sample 1. 120 mMPhosphate buffer, pH 8.0: 94.5 mL of 120 mMNa2HP04 + 5.5 mL of 120 mM NaH2P04. 2. Lysis solution: 0.15M NaCI, 0.M EDTA, pH 8, lysozyme 15 mg/mL
addedjust beforeuse. 3. “Freeze and thaw” solutron: 0. IMNaCl, 0.5M Trts-HCl, pH 8, 10% SDS. 4. Phenol saturated wrth O.lM Trts-HCI, pH 8.0. 5. RNase A: See Section 2.1.7. 6. Polyvinylpyrrohdone (PVP).
7. Agarose,low melting temperature.For TAE buffer, see Section 2.3. 3. Methods 3.1. Growth of Bacterial
Strains
The bacterial strains for which the probes are to be produced should be isolated first and then total DNA should be extracted. A very low amount of DNA 1srequired for obtaining RAPD; for this reason DNA is extracted from l-3 mL cultures. The growth medium should be chosen according to the bacterial species; it is, however, advantageous to try to use complete media where bacteria grow faster and to higher cell density. Whenever possible, bacteria should be inoculated from a fresh colony and grown Just up to the end of log phase in order to avoid accumulation of secondary metabolism products, mcluding nucleases, that tend to interfere with DNA purification.
RAPD for DNA Probe Generation
161
3.2. DNA Extraction 1. Centrifuge 1.5 mL of the culture in a microcentrifuge for 2 min at 10,000 rpm. (Note: Every time a microcentrifuge is used, rpm values are given, because all models have the same rotor radius and it is easier to set rpm than g.) If the culture density is not sufficient after removing the medium, a second 1 5-mL aliquot can be centrifuged in the same tube. 2. Suspend the cell pellet m 567 p.1of TE and 30 uL of 10% SDS (up to 0.5% final concentration) and add 3 pL of 20 mg/mL proteinase K (100 pg/mL final concentration). MIX the tube gently by inversion and incubate at 37°C for 1 h. During this time cells are usually lysed. 3. Add 100 pL of 5MNaCl and vortex the tube for few seconds.Add 80 pL of 10% CTAB, mix the tube contents well, and incubate for 10 mm at 65°C. 4. Add an equal volume (about 800 pL) of chloroform (chloroform-isoamyl alcohol 24: l), vortex the mixture for a few seconds,and centrifuge for 5 mm at 11,000 rpm. Collect the aqueous upper phase mto a fresh tube and add an equal volume of phenol-chloroform, vortex to mix, and centrifuge for 5 min at 11,000 rpm. 5. Recover the upper phase, then add 2 uL of 10 mg/mL RNAse (approx 30 pg/mL final concentration) and incubate for 30 min at 37OC. 6. Add an equal volume (approx 0.6 mL) of isopropanol to precipitate the DNA. Keep the tube at room temperature for 5 min, then centrifuge for 5 min at 11,000 rpm. Discard the supernatant and wash the pelleted DNA with 70% ethanol. Centrifuge again for 5 min at 11,000 rpm. 7. Dry the pellet and dissolve in 10-30 uL of sterile TE.
DNA can be quantified by comparing its fluorescence on an ethidium bromide stained agarose gel with standard DNA of known concentration, or by other methods available, like the fluorimetric or spectrophotometric methods or “quick DNA” sticks by Invitrogen (San Diego, CA). 3.3. Amplification Protocol for RAPD with Different Primers Amplification reactions are performed in a 25 yL final volume containing: 14.9 l.tL H20, 2.5 PL 10X buffer (Perkin Elmer), 2.5 uL 15 mA4 MgC12 (the Perkin Elmer buffer contains 1.5 mA4 MgC12, so the final Mg2+ concentration is 3.0 rr&!), 2.0 ltL primer (250 ng/uL), 2.0 l,tL dNTP (Perkin Elmer, 100 pA4 each), 0.1 PL Taq (Amplitaq, Perkin Elmer, 5 U/uL), and 1.O uL DNA (1 ng/uL). The operator must comply strictly with the volumes indicated and must be as precise as possible using the most accurate pipets available.
Bazzicalupo
162
and Fani
The reaction is made up as follows: 1. Add DNA to 0.1 -mL PCR tubes. 2. Prepare a master mixture for all the samples with H,O, 10X buffer, MgCI,, primer, and dNTP (e.g., for 20 samples the mixture ~111contain [in uL]: Hz0 = 298 buffer 1OX = 50,15 mMMgCl* = 50, primer = 40, dNTP = 40). 3. Heat the mixture at 90°C for 2 mm. 4. Cool the mixture on ice. 5. Add Taq to the mixture (2 0 uL for 20 samples) and mix. 6. Distribute the mixture m the tubes kept in ice (24 uL each). 7. Insert the tubes in the thermal cycler when block temperature is already 90°C. 8. Start the following thermal program: a. 90°C, 1 min b. 95°C 1 min 30 s. c. 95”C, 30 s
d. 36”C, 1 mm.* e. 75°C 2 min. Repeat steps c-e, 45 times. f. 75°C 10 min. g. 60°C 10 min. h. Store at 4°C.
Amplification reaction can also be carried out changing some of the reaction condition (see Notes l-4). During this stage of the procedure the choice of the primer for the amplification is a critical step (seeNotes 5-9). 3.4. Analysis of the Amplification Products by Agarose Gel Electrophoresis Five microliters of each amplification mixture is loaded onto a 2% agarose gel in TAE buffer containing 0.5 pg/rnL of ethidium bromide and electrophoresed at 10 V/cm for 2 h. The R4PD gels can be photographed or imaged with a videocamera and recorded or saved on a computer file. Figure 2 reports the amplification patterns of genomic DNA from 13 strains of the nitrogen fixing bacterium Azospirillum obtained with the 17-merprimer 5’ ACATGCTGGAGCAGCTG. The analysis of the electrophorogram shows that each strain possessesa unique and distinctive amplification pattern. Differences among patterns include both the number (ranging from 2-l 1) and the size (ranging from 300-2000 bp) of the amplified DNA fragments, which depend from the different param*For primers longer than 17 nt, the annealmg step must be 45°C for 1 min
RAPD for DNA Probe Generation
163
Fig. 2. Genomicfingerprintsof 13Azospirihm strainsobtainedwith the RAPD methodusingthe primer 5’ ACATGCTGGAGCAGCTG.Lanes1-13: Azospirillum strainsDSM2287,DSM2298,DSMl859,SP7,SPF94,ATCC29707, ATCC29731, ATCC29708,Y2, F, W03, SpBr17,Sp242;lane 14:molecular weight marker(ladder1 kb). eters of the RAPD reaction (seeNotes). The presenceof monomorphic bands (bands common to two or more samples)and polymorphic bands (bandsvisible only in a single pattern) is also evident (seeNote 10). of the RAPD Marker(s) The selection of the marker to be used as probe is one of the more critical step in the overall strategy, and deservesa detailed discussion (seeNote 11). 3.6. Reamplification of RAPD Bands Bands that have been selectedas putative probes are visualized with low-intensity ultraviolet light and excised from the gel by cutting the agarosewith a scalpel. DNA from the gel slice is then reamplified as follows: 1. Placetheagaroseplug(s)containingtheDNA in a 1.5-mLmicrocentrifuge tubewith 100FL of TE, pH 7.5. 2. Heatthe sampleat 94°C for 15min (mixing by inversionevery3-4 min) to dissolvethe agarose. 3.5. Selection
164
Bazzicalupo
and Fani
3. Dilute the sample (1:5; 1: 10; 1:50 in redistilled water) and reamphfy 1-pL aliquots of the dilutions under standard conditions (see Section 3.3 .) with the same primer that was employed to generate the band. The dilution series is used to reduce the probability of finding contammatmg bands that will be amplified together with the probe. 4. Analyze the amplification products of each dilution on an agarose gel (2%) to identify pure samples containing only the desired band.
In most cases we obtained the reamplification of the chosen marker, without contaminating bands. The reamplified band can be used without further purification for restriction digestion and for determination of its nucleotide sequence via PCR (see Note 12). It can be also labeled and used as a probe, but m this case the contaminating band(s), which might not have been revealed by the electrophoretic analysis must be absolutely avoided. After labeling, contaminating bands if present can give rise to false-positive signals during hybridization. It is more convenient for this purpose to purify the band as described in Section 3.7.; in some particular instances the RAPD markers can also be cloned before further use (see Note 13). of RAPD Markers from Agarose Gel The reamplification of a RAPD band by PCR permits a relatively pure DNA sequence to be obtained. But, in spite of this, one cannot be completely certain that during the reamplification some contaminating 3.7. Purification
DNA molecules might be amplified. In this case it is necessary to purify
the reamplified band from the agarose gel. We have used different methods, described in molecular biology experimental books, for the purification of DNA fragments from agarose gels, none of them, however, gave high yield. However, we found that the GENECLEAN II Kit (Bio 101, La Jolla, CA) works well and is easy to perform. (Kits available from other companies, in all probability are equally effective.) The PCR products are electrophoresed in agarose gel (normally 2.0% of agarose in TAE buffer with 0.5 ug/mL of ethidium bromide) for 2 h at 10 V/cm. The DNA band, containing 2-3 ug of DNA, is visualized using a longwave UV lamp and rapidly excised from the gel
with a scalpel. The gel slice, whose volume should be less than 400 pL, is processed following the protocol included in the instruction manual of the GENECLEAN 11 Kit.
RAPD for DNA Probe Generation
165
3.8. Labeling of the RAPD Markers DNA extracted from the gel and purified can be labeled with any of the described methodologies or more conveniently with one of the kits available from molecular biology products companies. We recommend the use of nonradioactive labeling as it is safer, the labeled probes last longer (often more than 1 yr) allowing use of the same preparation for a whole set of experiments. Moreover, as high sensitivity is not usually required in these experiments low efficiency probes perform quite well. In the following section we describe the protocol for labeling DNA with digoxigenin-dUTP based on the random primer technique following the instructions of the supplier of the kit (Boehringer Mannheim). 1. DNA (all that IS obtained from agarose gel purificatron, from 100 ng to 3 ug in 5-l 0 pL) is denatured at 95°C for 10 mm and immediately put in me. 2. Add 2 uL of hexanucleotides and 2 uL of dNTP labeling mix (which includes digoxtgenm-dUTP). 3. Bring the volume up to 19 l.tL wtth sterile water and add 1 uL of DNA polymerase (Klenow fragment). 4. Incubate at 37OCfor l-20 h 5. Stop the reaction by adding 2 l.tL of 0.2M EDTA, pH 8 6. Add 2 uL of 4M LiCl and 60 l,tL of cold ethanol to precipitate DNA, mix well, and keep at -70°C for 30 min. 7. Centrifuge at 12,000 rpm for 15 min, wash the pellet with 70% ethanol, dry the pellet, and resuspend m 25 uL of TE.
The labeled DNA could be visualized and the amount determined by comparison with a standard labeled DNA included in the kit. Colorimetric or chemiluminescent detection could be performed on digoxigenin labeled probes, both methods can be carried out easily by the use of the appropriate kit purchased from Boehringer Mannheim together with complete instruction manuals. Calorimetric detection is more rapid and less laborious to perform than chemiluminescent detection; the latter is, however, more sensitive and tends to give clearer pictures. 3.9. Hybridization of the RAPD Marker with RAPD Products Products of RAPD amplification of DNA from an unknown sample can be analyzed for the presenceof one or more marker bands by hybridization with the labeled markers. Moreover, hybridization of the probe with ampli-
166
Bazzicalupo
and Fani
fied DNA from different bacteria living in the environment under study is also required in order to evaluate the specificity of the probe. These hybridizations can be accomplished by either Southern or slot-blotting. 3.9.1. Southern Blot Southern blotting has been described in many different publications; any other modification of the Southern blot, such as vacuum blotting or electroblotting, also works well and can be adopted following the instructions of the manufacturer of the apparatus. We follow the procedure described by Sambrook et al. (16) using a nylon membrane with the modification suggested by the manufacturer of the membrane (Amersham, Arlington Heights, IL). During all the manipulations, the gel and the membrane should never be touched with hands; operators must always wear disposable gloves and use forceps. 1. Cut the gel after the run with a scalpel to eliminate parts that do not contam DNA (like the area above the wells). The upper right corner of the gel is cut off to orientate samples. 2. Wash the gel by gently shaking m a small tank with distilled water for 5 mm at room temperature; then replace the water with denaturmg solution using about 150 mL for a 100 cm2 gel, slowly rotating the tank for 30 mm at room temperature. Discard the denaturmg solution and wash the gel quickly with water; add about 150 mL of renaturmg solution. After 15 min of gentle shaking at room temperature replace the renaturmg solution with a fresh one and keep the tank at room temperature for 15 min. At this stage, the gel is ready to transfer the DNA to the membrane. 3. The apparatus for the transfer is quite simple: Two tanks are filled with 20X SSC and put on either side of a stand on which a glass plate large enough to accommodate the gel is situated; three sheets of Whatman (Maidstone, UK) 3MM paper as wide as the gel are placed over the glass plate with their ends m the 20X SSC reservoirs. 4. Turn the gel upside down and put onto the paper; bubbles are ehmmated by rolling a disposable plastic pipet on it. Place strips of Parafilm on the paper along the four sides of the gel; place the nylon membrane, cut to the exact size of the gel, over the gel and again eliminate air bubbles with a plastic pipet. Put three sheets of Whatman paper of the same size of the gel, wetted m 20X SSC, over the membrane and on top of these, blotting papers of the same size are piled up to about 5 cm. Compress the papers with a glass plate and a 500 g weight.
RAPD for DNA Probe Generation 5. After blotting overnight the apparatus is dismantled and the membrane is washed in a small tray of 2X SSC for 10 mm at room temperature. 6. Dry the membrane on a blotting paper at room temperature or m an oven at 50°C and finally fix the DNA under UV light. We usually fix the membrane with the DNA side (the side that was in contact with the gel) on a UV transilluminator for 3 min. After fixing, the membrane can be kept for several months before hybridization.
3.9.2. Hybridization Hybridization
is carried out as follows:
1. Insert the membrane into a plastic bag (or in a hybridization bottle when using special hybridization apparatus) and add 20 mL (volumes refer to 100 cm2 membrane) of prehybridization solution, Incubate the membrane for 1 h at 42°C. 2. Replace the prehybridization solution with 2.5 mL of hybridization solution. 3. Finally incubate the membrane at 42°C overnight. 4. At the end of the hybridization wash the membrane twice at room temperature with 50 mL of 2X SSC plus SDS 0.1%; then carry out an additional two washes for 15 mm each at 65OCwith 0.1X SSC plus 0.1% SDS. At this point the membrane is ready for the detection procedure. 3.9.3. Hybridization by Slot Blot Slot blotting is carried out using a device that allows simultaneous filtering of many DNA samples on a single membrane. The operation of
the device should be carried out according to the instructions of the manufacturer. These usually consist of washing the wells with 10X SSC and
loading DNA samples after denaturation. After blotting, the membrane should be treated exactly as the Southern blot membrane. 3.10. Extraction of DNA from Environmental Samples Total DNA can be extracted from any kind of environmental sample and several methods have been described that successfully apply to particular environments. The successof the procedure depends on the nature of the sample, solid samples are in fact often more difficult to deal with than liquid ones. In addition solid samples often contain inhibiting compounds that can be carried through during purification and can interfere with further enzymatic treatment of DNA.
168
Bazzicalupo
In the following section extraction and purification is described according to published protocols (I 7).
and Fani
of DNA from soil
1. Add 10 mL of phosphate buffer to 5 g of sol1 m a centrltige tube, and keeping the tube horizontal, shake at 150 rpm for 15 mm. 2. Centritige the tube at 6000g for 10 mm at room temperature. Discard the supernatant and add 10 mL of phosphate buffer. The washing IS repeated as before. 3. Add 10 mL of lysis solution to the pellet then keep the mixture at 37°C with gentle shaking, inverting the tube infrequently for 2 h. 4. Add 10 mL of “freeze and thaw “ solution and freeze (at -75OC) and thaw (at 65°C) the mixture three times. 5 Add 10 mL of phenol and vortex the tube for 20-40 s. Centrifuge the tube for 10 mm at 6000g and transfer about 15 mL of the upper phase to a fresh tube. Add 7.5 mL of phenol plus 7.5 mL of chloroform (chloroformisoamyl alcohol 24: 1) and vortex the mixture again for half a minute. Centrifuge the tube for 10 mm at 6000g and transfer 12.5 mL of the upper phase to a fresh tube where 12.5 mL of chloroform 1sadded, the mixture vortexed, and centrifuged for 10 mm at 6000g. 6. Transfer 10 mL of the supematant to a fresh tube and add 10 mL of cold isopropanol; mix the tube by mverslon and leave overnight at -20°C. Centrifuge the tube at 10,OOOgfor 20 min at 4OC,discard the supematant and leave the pellet to dry at room temperature. 7. Resuspend the dry pellet in 0.5 mL of TE with 0.2 pg/pL RNase A and incubate at 37°C for 2 h. DNA from soil samples are usually heavily contaminated with extraneous material, particularly humic acids, that inhibit enzymatic treatments of DNA like restriction digestion and PCR. For this reason, further purification steps are required before amplification. We suggest the following technique, where DNA is purified on agarose gel with PVP. 1. Add 4 g (2%) of PVP to 200 mL of TAE buffer and dissolve at 75°C. After PVP is completely dissolved, add 2.5 g (1.25%) of low melting temperature agarose and allow to melt at 75°C. Pour the gel on an appropriate tray and allow to cool. 2. Load the DNA to be purified mto the wells of the gel and run the electrophoresis overnight at 30-50 V m a cold room. 3. After the run, stain the gel m 0.1% ethidmm bromide for 30 mm, wash m water for 10 mm, and then visualize the DNA under UV light. Slice por-
RMD
for DNA Probe Generation
tions of agarose containing the majority of DNA from the gel and put in Eppendorf tubes. 4. Extract the DNA from the agarose by freezmg m dry ice-ethanol (-75OC) and thawing at 55°C. Repeat the freezing and thawing four to five times. Centrifuge the agarose m a microcentrifuge at 14,000 rpm for 10 min and store the supernatant containing DNA at 4°C. 3.11. Amplification and Hybridization of DNA Extracted porn Environmental Samples DNA extracted and purified from environmental samples can be treated as “regular” DNA and amplified with the same primer used for producing the probe and hybridized to the same probe as described in Sections 3.3. and 3.9. (see Note 14). 4. Notes 4.1. Amplification Under Different Reaction Conditions 1. We recommend that amplification reactions are performed under the conditions described in Section 3.3. which we have found to give highly reproducible patterns of bands. In fact, the results of an arbitrarily premed amplification depend on several parameters (12,28), including the reaction conditions and the primer used. Thus, once a RAPD pattern has been obtained under certain reaction conditions, changing these could alter the results of the experiment. In general, those conditions that must be kept constant are the temperature profile and the concentrations of the primer and the nucleotides. The other reaction conditions, such as the type of Tag polymerase, the MgC12 concentration, and the DNA template concentration, must be stringently controlled when RAPD is used for fingerprintmg bacterial strains; however, in the present chapter, when this technique is used to identify RAPD probes, little variations do not affect the outcome of the reaction. 2. Taq polymerase: The use of different Taq polymerases usually results m different amplification patterns on the same target genome. This fact must be taken into account when the RAPD methodology is used to fingerprint different bacterial strains, however, this is not usually a problem when the RAPD technique is used to identify RAPD probes. This is because the sharpest bands tend to remain constant in replicate RAPD patterns of the same genome, even when different Taq polymerase are employed. 3. Concentration of MgCl*: We found that increasing the MgCl, concentration up to 4-5 mM resulted in a higher number of amplified bands with a
170
Bazzicalupo
and Fani
consequent higher mformation content. Although this circumstance could be useful in the differentiating strictly correlated strains, the increase in the number of bands could increase the dtfficulty of choosmg diagnostic ones. 4. Concentration of template DNA: We usually perform the amplification reactions using 1 ng of genomic DNA (see Section 3.3.). Although RAPD patterns can change when using very small amounts or an excessof template DNA, we found that if the RAPD probe is chosen from among the sharpest bands, it gives a hybridization signal when the RAPD amplification IS carrted out using a concentration of template DNA ranging from 0.001 pg to 500 ng.
4.2. Choice of the Primer 5. The choice of the primer to be employed in the generation of RAPD patterns is one of the most important parameters to be taken mto account. In general, an tdeal primer should give highly reproducible patterns, contaming both monomorphic and polymorphic bands, whose number should be high enough to permit the choice of markers with different specrfictty. The nucleotide sequence of each primer is generated randomly, but some shrewdness must be applied m its choice. 6. Length of the primer: Most of the primers used m RAPD fingerprinting are IO-bases long. Nevertheless, we found that much longer primers (20-24 nucleotides) work as well as shorter ones. 7. GC content: It has been demonstrated (18) that to support DNA amplification under standard conditions, a lo-mer primer must contain at least four G + C bases. Moreover, lo-mer primers with high GC content (60-80%) gave good and more reproducible patterns than those with low GC content (40-50%) independently from the GC content of the target genome and from the length of the primer. Thus, it is advisable to choose a primer containing at least 60% G + C. 8. Sequence: The primers should not contain palindromes longer than six bases nor complemetarity at the 3’ end, in order to avoid the formation of primer dimer molecules, which could interfere with the generation of correct patterns. Some tri- or tetranucleotides could be extremely rare in a given bacterial genome. For instance, the triplet AAA or the quartet TTTT are very rare in genomes with high G + C content, such that ofAzospirillum or Streptomyces. These stretches must be avoided in the design of the primer, even if the remaining bases are G or C that render the total G + C content of a 10-mer primer 70 and 60%, respectively. 9. Presence of an inserted restriction site: The msertton of an internal restrtctton site mto the primer depends on the aim of the experiment. When a cloning step 1srequired, its presence could be very useful. The restriction site should be in this case located at the 3’ end of the molecule.
RAPD for DNA Probe Generation It is always necessary to test a few of the tentatively chosen primers with the target genomes and compare the different patterns obtained before proceeding with the selection of a marker band. 4.3. Analysis
of the Amplification
Products
10. It is noteworthy that many bands (both monomorphic and polymorphic) show different intensities; some of them also being sharper than others. This fact must be accurately taken into account for the choice of RAPD markers (see Section 3.5. and Note 11). Care should also be taken when considering very short (4 50 bp) bands that are in some instances artifacts of the RAPD amplification, not corresponding to amplified genomic DNA.
4.4. Selection
of the Marker
11. Although very little is known about the site of annealing of RAPD primers in the target genome (18), it is reasonable to assume that the efficiency of annealing is determined by the degree of complementarity between the primer and the target sequence(s); this in turn influences the efficiency of the amplification, resulting in bands with high intensity when they lie between two strong annealing sites. In our experience bands with high intensity have higher probability of being found m amplification patterns obtained with the same DNA under different reaction conditions. For the selection of the RAPD marker to be used as a probe, we recommend, therefore, to choose it from among those bands with the highest intensity. Concerning the length of the marker to be chosen, we have used with good results RAPD fragments ranging from 250-l 500 bp. It is advisable, however, to select long marker, especially if probes longer than 20 nucleotides (nt) are employed. In fact in the RAPD, any amplified fragment contains the same tails, i.e., the primer sequences;thus, the use as probe of short RAPD markers (about 200 bp or so) amplified with long primers (20-25-mer) could result in cross-hybridization to unrelated markers. Concerning the specificity of the probe it depends on the aim of the work, in fact it is possible to choose particular DNA fragments that can be
more or less specific. As a general rule highly polymorphic bands, i.e., present in a single pattern, are also highly specific probes. The specificity of a probe must, however, be assessedexperimentally by hybridization with amplified DNA from a different source.
4.5. Sequencing
of the RAPD Marker
12. The sequencing of RAPD marker is an optional step in the overall strategy, since the lack of knowledge of the genetic information carried by the marker does not invalidate its use as molecular probe. It can be of general
172
Bazzicalupo and Fani
interest, however, to know what are the sequences or the genes that are able to generate polymorphism inside a bacterial population. The sequencmg of a RAPD marker can be performed on cloned probes (see Note 13), with standard techniques hke that of Sanger et al. (29), or dnectly on the amplification products via PCR (20). This second method is more precise than the first one, since PCR-generated errors present in a single cloned sequence are avotded because only a negligible fraction of misincorporated nucleotides occur at each position in the pool of amphfied molecules. Nevertheless, sequencing of a RAPD marker can be directly performed on the amplification product only when two different primers were used to obtain the marker. When a single oligonucleotide is used, as is the case described m this chapter, it is impossible to sequence directly the RAPD band. This is owing to the presence at both the ends of the DNA fragment of the same sequence, the primer sequence. The problem can be solved by digestmg the RAPD band with different restriction endonucleases m order to find an enzyme that recognrzes a single site inside the fragment. In this way two fragments are generated, each containing one single annealmg site for the primer. The sequencing strategy IS carried out as follows. a. The restriction reactions are performed by digesting 2-uL aliquots of the reamphlied RAPD marker (see Section 3.6.) with 3 U of three or four restriction endonucleases, chosen among those recognizing 4 bp sites, in a 25-pL reaction volume. b. The products of digestion are loaded on 1.2% low meltmg temperature agarose gel and electrophoresed at 10 V/cm for 2 h. c. After a short analysis under a longwave UV light, two small agarose slices, containing the digestion products of one of the enzymes that cut the marker only once are excised from the gel. d. The agarose is placed in a 1.5-mL tube, frozen at -2OOC for 5 mm, and centrifuged for 10 min at 12,000 rpm. Eight mtcrohters of the supernatant, which usually contains at least 30 ng of DNA, is used as such in the sequencing reactions (20). The nucleotide sequencing of the fragments is carried out via PCR usmg the same primer used for the generation of the RAPD pattern. The reactions are performed for 25 cycles according to the instruction manual of the CncumVentTM DNA sequencing kit with the VentRTM(exe-) DNA polymerase (New England Btolabs Inc., Beverly, MA). The annealing temperature (T,) is 50°C for 17-mer or longer primers, whereas a 25°C T, IS used for lo-mer primers. We have found that the Biolabs kit generate reliable sequencesfrom small amount of template DNA, however, other products that are available from molecular biology companies also work well.
RAPD for DNA Probe Generation
173
After the first sequencehas been obtained, it is necessaryto design a new specific oligonucleotide primer for direct sequencing of the remaining part of the marker that can be carried out on the undigested DNA fragment.
4.6. Cloning
of the RAPD
Marker
13. Clomng of a RAPD marker can be of great advantage when the band to be used as probe is very short (200 bp or less) and when the employed primer is long (for instance, 20 or more nucleotides). In this case, the primer molecules, which correspond to both the ends of the RAPD band, represent about 25% of the total length. Thus the use of the entire fragment as probe could give cross-hybridization between different RAPD bands, owmg to the hybridization between the primer sequenceson different RAPD bands. In this case, it is recommended to design the primer to be employed for the generation of RAPD patterns with an internal restriction endonuclease site. This site (6 bp long) should be located at the 3’ end of the primer molecule. In this way, cleavage with an appropriate restriction endonuclease (RE) results m the complete elimination (at both the ends of the RAPD band) of the primer sequence. The cloning procedure is represented by the following sequential steps. a. Reamplify the selected RAPD band(s) as described in Section 3.6. b. Purify of the RAPD band from agarose gel (see Section 3.7.). c. Digest at least 200 ng of the purified DNA for 3 h with 5 U of the restriction enzyme in 20 pL volume. d. Precipitate the DNA by adding 28 uL of TE, 2 uL of NaCl 5M, and 100 pL of 95% ethanol, keep at O°C for 30 mm, centrifuge at 4°C for 30 min at 12,000 rpm, dry the pellet, and resuspend in 7 p.L of TE. e. Add 1 uL (100 ng) of a plasmid vector cleaved in the polycloning site by the same RE (or with a different RE, but one generating compatible ends), I pL of 1OX ligation buffer, and 1 pL (1 U) of T4 DNA ligase. f. Incubate at the optimal temperature (depending on the presence of sticky [ 16-2O”C] or flush ends [4”C] in the ligation mixture) for 6 h. g. Transform Escherzchia colz competent cells of strain DH5a or X11-blue via electroporation (any other protocol that gives high efficiency of transformation can be used), selecting for transformants harboring recombinant plasmids (white-blue screening). h. Purify recombinant plasmids from a few transformants, check for the presence of an insert, and determine its size. Note that the size of the insert could be smaller than the origmal fragment. This is because of the possible presence of additional restrtction sites mside the original fragment. This fact does not have any negative effect on the final results of this methodology
Bazzicalupo
174 4.7. Amplification fbom Environmental
and Fani
of DNA Samples
14. Sometimes DNA purified from environmental samples still contams contaminating compounds that might inhibit its amplification by PCR. Usually, by diluting the DNA sample, it is possible to get rid of the mhibitmg compounds. We suggest therefore that the preliminary amplifications are carried out with three IO-fold dilutions of the DNA extracted from dirty samples; this will help to find the highest concentration that does not contam contaminants that inhibit the amplification. It 1s in fact advisable to amplify as much DNA as possible m order to also include the genomes of bacteria that are poorly represented in the sample.
References 1. Roszak, D. B. and Colwell, R. R. (1987) Survival strategies of bacteria m natural environment. Mzcrobzol Rev. 51, 36%379 2. Grrmont, F and Grimont, P A. D. (1986) Ribosomal ribonucleic acid gene restriction patterns as potential taxonomical tools. Ann Inst. PasteWMicrobzoi 137B, 165-175 3. Altwegg, M. and Mayer, L. W (1989) Bacterial molecular epidemiology based on a nonradroactive probe complementary to ribosomal RNA Res. Mzcrobzol. 140, 325-333. 4 Moyer, N. P., Martinetti Luccini, G., Holcomb, L A., Hall, N. H., and Altwegg, M.
(1992) Application of ribotyping for differentiation aeromonads isolate from chtncal and environmental sources. Appl Environ. Microbzol 58, 1940-1944. 5. Martinetti, G. and Atlwegg, M. (1990) rRNA gene restriction patterns and plasmid analysis as a tool for typing Salmonella enteritidis. Rex Microbial. 141,115 l-l 162. 6. Ogle, J W., Janda, J. M., Woods, D , and Vasil, M. L. (1987) J Infect Dzs 155, 119-126 7. Otal, I , Martin, C , Vincent-Levy-Frebault, V , Threrry, D., and Gicquel, B (1991) Restriction fragment length polymorphrsm analysis using IS6 110 as epidemiological marker in tubercolosis. J Clzn Mzcrobiol 29, 1252-1254 8. Mendiola, M. V., Martin, C , Otal, I , and Gicquel, B. (1992) Analysis of the regron responsible for IS6 110 RFLP in a single Mycobacterium tubercolosis strain Res Microbzol 143, 767-772 9. Fani, R., Bazzicalupo, M., Gallon, E., Giovannetti, L., Ventura, S., and Polsmelh, M (1991) Restriction fragment length polymorphism of Azospzrzllum strains. FEMSMzcrobiol Lett 83,225-230. 10. Tompkins, L. S., Troup, N., Labigne-Roussel, A., and Cohen, M. L. (1986) J Infect. Dzs. 154, 156-162 Il. Screux, C., Gnmont, F., Regnault, B., and Gnmont, P. A. D. (1992) DNA tingerprinting of Chlamydza trachomatzs by use of rrbosomal RNA, ohgonucleotide and randomly cloned DNA probes. Res. Mzcrobzol. 143,755-765
RAPD for DNA Probe Generation
175
12. Welsh, J. and McClelland, M (1990) Fingerprmtmg genomes using PCR with arbitrary primers. Nuclezc Aced Res 18, 72 13-72 18. 13. Williams, J G. K., Kubehk, A R., Ltvak, K J., Rafalski, J A., and Tingey, S. V. (1990) DNA polymorphtsms amplified by arbitrary primers are useful as genetic markers Nucleic Acid Res 18,653 l-6535. 14 Hadrys, H., Bahck, M., and Schierwater, B. (1992) Apphcations of random amphtied polymorphic DNA (RAPD) in molecular ecology A401 Ecol 1,55-63. 15. Fani, R., Damiani, G., Dt Servo, C., Gallori, E., Grtfoni, A., and Bazzicalupo, M (1993) Use of random amplified polimorphic DNA (RAPD) for generating specific DNA probes for mtcroorgamsms. Mol. Ecol. 2,243-250. 16. Sambrook, J., Fritsch, E F., and Mamatis, T. (1989) Molecular Clonzng A Laboratory Manual, 2nd ed Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York 17. Tsar, Y L and Olson, B H. (1991) Rapid method for direct extraction of DNA from soils sand sediments, Appl. Environ ikkrobiol 57, 1070-1074. 18. Williams, J. G. K., Rafalski, J A., and Tingey, S. V (1993) Genetic analysts usmg RAPD markers. Methods Enzymol. 218,70&740. 19. Sanger, F , Ntcklen, S., and Coulson, A.R. (1977) DNA sequencmg with chain terminating mhibttors. Proc. Nat1 Acad SCL USA 74, 5463-5466 20. Bandr, C., Damtani, G., Magrassi, L., Grigolo, A., Fam, R., and Saccht, L. (1994). Flavobacteria as intracellular symbionts in cockroaches. Proc R Sot (part B), 257,4w8
CHAPTER13 ITS-RFLP Matching for Identification of Fungi Monique
Gardes
and Thomas
D. Bruns
1. Introduction Fungi are an incredibly diverse and nearly ubiquitous group of eukaryotes. Estimates put their numbers higher than 1.6 million species (1). They have been identified traditionally by morphological differences in their sexual or asexual reproductive structures. However, such structures are often not produced at times and places in which one might want to identify a particular fungus. This combination of diversity, ommpresence, small size, and missing structures makes the fungi ideal candidates for polymerase chain reaction (PCR)-based identification methods. The method described herein is a general method that can be used to identify most fungi to the level of species or species group. As with several other methods in this volume, it is based on the internal transcribed spacer region (ITS) of the nuclear ribosomal unit. This region lies between the 18s and 25s rRNA genes and contains two variable noncoding spacers and the 5.8s rRNA gene (2). This identification scheme is based on amplification of the region, digestion with restriction enzymes, electrophoretic separation of the fragments, and side-by-side comparison of the resulting RFLP patterns to those produced from DNAs of known species. Samples of known DNA may be derived from either cultures or herbarium specimens (3,4). The enzymes used should have four- or five-base recognition sequencesto ensure that sites are present within the region, Two single enzyme comparisons generally separate most species. From
Methods m Molecular Rology, Vol 50’ Speoes D/agnostics Protocols PCR and Other Nuclem Acd Methods Edlted by J P Clapp Humana Press Inc , Totowa, NJ
177
178
Gardes and Bruns
This approach is fast, simple, relatively inexpensive, and easily adapted to new groups of f&gi, but one should be aware of several important limitations. 1, The matching approach requires that one has some likely suspectsm mind; it is very effective at eliminating possible ldentlfications, but the lack of a positive match tells one nothing about the identity of the unknown (2). 2. Some closely related species do not differ enough wlthin the ITS region to be dlfferentlated with this approach (e.g., Laccaria bicolor and L. laccata [5/). Therefore, species that need to be discriminated should be surveyed for RFLPs within the ITS region. Other regions such as the intergemc region (IGR) might be more useful than the ITS to discriminate closely related species (68). 3. Some fungi exhibit significant intraspecific variation within the ITS region. Therefore, one could miss a species match because the isolates chosen do not match even though they belong to the same species (5). In our expenence with ectomycorrhizal basldlomycetes, this problem IS much less common than a lack of RFLP difference between closely related species (i.e., problem 2), but because intraspecific variation does exist it 1sworthwhile using local isolates for matching. The entire ITS region, which is generally 650-750 bp in fungi, can be reliably amplified from most basidiomycetes and ascomycetes with universal primers, ITS1 and ITS4 or ITS5 and ITS4 (9). The universal primers also work with many other eukaryotes, but they have not been extensively tested with zygomycetes or chytrids. In general, the universal primers work well with DNA extracted from cultures or large sporo-
carps, but they should be used with caution when amplification from plant or mixed environmental samples is required. In the later situation the fungal specific primer ITS 1-F can be substituted for ITS 1; this will preferentially amplify fungal ITS sequencesfrom infected plant material (2). Similarly, most basidiomycetes can be preferentially amplified directly from infected plants or ascomycetes with the combination of the ITS 1-F and ITS4-B primers (2). Certain groups of rust fungi, primarily those with pedicellate teliospores, do not amplify efficiently with the the ITS 1-F/4-B combination, but will amplify with the degenerate primers ITS 1-R/4-R listed in Table 1. The restriction digest is set up by making a master mix of restriction enzyme diluted into 2X restriction enzyme buffer and combining aliquots of this mix with equal volumes of unpurified PCR products. The dilution
ITS-RFLP Matching Ohgonucleotlde Primer nameb ITS1 ITSl-F ITSl-Rd ITS5 ITS-4 ITS4-B ITS4-Rd
179 Table 1 Pnmer Sequence for Amphficatlon SequenceC
TCCGTAGGTGAACCTGCGC CTTGGTCATTTTAGAGGAAGTAA (TA) TGGT (CT) (AGT) (TC) (TC) TAGAGGAAGTAA GGAAGTAAAAGTCGTAACAAGG TCCTCCGCTTATTGATATGC CAGGAGACTTGTACACGGTCCAG CAGACTT (GA) TA (CT) ATGGTCCAG
of Fungal ITS’ Location
References
18s 18s 18s 18s 28s 285 28s
9 2 This chapter 9 9 2 This chapter
GSeveral primers are avarlable to amphfy part of the ITS or the en&e region. With the development of an ITS sequence database, addItIona primers could potentially be designed with other levels of specificity b The protocols for amphficatlon can be found m the references or listed ‘ Sequences are wntten 5’-3’ All odd-numbered primers mdlcate primers that extend m the downstream direction, even numbers to primers that extend m the upstream direction dThese are degenerate primers deslgned to amphfy rnst ITS region Their concentration need to be Increased four- to fivefold compared to nondegenerate primers m PCR amphficatlon reactions
of the enzyme saves money and prevents glycerol concentration from inhibiting the reactions. The use of unpurified PCR products makes this approach very fast and easy, but it also results in suboptimal buffer conditions for the restriction enzymes because the final reaction contains 0.5X PCR buffer plus 1X normal restriction enzyme buffer. For most enzymes we have tested, including all those recommended herein, this fast approach works well in spite of the suboptimal buffer conditions. However, for some other enzymes, notably Sau3A, these conditions result in nonspecific digestions of the the DNA. If problems are encountered with enzyme activity, we suggest removing the PCR buffer prior to digestion. This can be done either by ethanol precipitation or with various column filtration methods.
2. Materials 1. 10X PCR buffer: 0.5MKCl,O.lMTris-HCl, pH 8.3,25 mMMgC12, 1 mg/mL gelatin. Autoclave for 15 min and store buffer at -2OOC (see Note 1). 2. 1OX PCR dNTP stock solution: 2 mM dATP, 2 m44 dCTP, 2 m44 dGTP, 2 mM dTTP. Distribute solution into 0.5-mL aliquots and store them at -20°C (see Note 2). 3. Amplified ITS region from known and unknown fungi: Approx 8 pL from a PCR reaction is required for each digest. This assumesthat the PCR
180
4.
5. 6. 7. 8.
9.
10.
1I. 12. 13. 14. 15. 16.
Gardes and Bruns reaction resulted in a single bright fragment. Reactions resultmg m multiple or weak fragments should not be used. Restriction enzyme: Of the enzymes we have used, we recommend the following: AZuI, Hi&I, MboI, RsaI, and TuqI. Different manufacturers supply enzymes at different concentrations; the protocol that follows is based on stocks of 8-l 0 U/pL. Restriction enzymes are unstable; store them at -20°C and keep stock solutions on ice when they are out of storage. Restriction enzyme buffer 10X stock. The appropriate buffer is usually provided with the restriction enzyme when obtained from commercial supplier Store at -20°C. Stertle deionized water. Blue stop-load dye solutton: 5-l 0% glycerol, 20 mM EDTA, 1% sarkosyl (or SDS can be substituted), 0.02% Bromophenol blue (see Note 3). Molecular weight markers: Several markers are available that cover the appropriate range of molecular weights; we use a combination of 2 smgle digests of pUC19 DNA cleaved with SaQA and Tag I, or PhiX174 DNA cleaved with HaeIII. Store at 4°C after addition of blue stop-load dye solution. 1OX TAE: 1M Tris-HCl, pH 8.1, 125 mM Na acetate, 10 mM EDTA. This will be diluted to 1X for agarose gel electrophoresis. Approx 500 mL of 1X IS needed for the mmigel eqmpment described herem. This buffer can be reused several times before bemg exhausted but needs to be mixed up before each electrophorests run. Agarose mixture for gels: This can be made several weeks before use and stored in small ahquots. We use 250 mL glass serum bottles for storage. Agarose mixture can be melted and gelled several times without any ill effects. We use a composite mixture of 2% NuSieve GTG Agarose (FMC BioProducts, Rockland, ME) with 1% nonmodified agarose (e.g., Ultrapure agarose, BRL Gibco, Gaithersburg, MD) in 1X TAE (diluted from 10X TAE) (see Note 4). Horizontal electrophoresis apparatus (e.g., Owl Scientific Plastics, Model B2: 12 cm W x 14 cm L, or similar) and power supply. Kodakglasspro~ector slide cover glasses(Cat 140 2130): 10.2 x 8.3 x 0.1 cm: This will be used as a casting tray for a very thin gel. Ethtdmm bromide stock solution: 10 mg/mL in deiomzed water. Caution: Ethidium bromide is mutagenic; gloves should be used at all times when handling solutions. Store solution at 4OC in brown bottle. UV transilluminator with Polaroid camera system and UV Blocking Face Shield. Ethidium Bromide Filter Kit (e.g., Fotodyne Inc., New Berlin, WI) Polaroid Instant Image films type 665 or 667 (IS0 3000). A set of micropipetors dedicated for the amplified products (see Note 5).
ITS-RFLP
Matching
181
3. Methods 3.1. PCR Amplification 1. Make a PCR mix containing buffer, nucleotide triphosphates, primers, and Taq polymerase. This mix will make up half the volume of the PCR reaction so that the components are twice as concentrated as needed. The final concentrations of the components m the reaction are 50 mA4 KCl; 10 n~I4 Tris, pH 8.3; 2.5 mA4 MgCl,; 0.1 mg/mL gelatin; 1 pMof each of the two primers; 200 PMeach of dATP, dCTP, dGTP, and dTTP; and 0.5-0.7 U of Taq polymerase/25-pL reaction. An example of a PCR mix for ten 100-pL reactions is indicated in the following: PCR water (Milhpore [Bedford, MA] filtered dH,O) 280 pL 1OX PCR buffer 100 pL 100 pL 1OX dNTPs 1OpL Primer 1 (50 p&I) 10 pL Primer 2 (50 pfI4) Taq polymerase (5 U/pL) 5 PL Total volume (-Taq polymerase) 500 pL Add the components in the order given above, mtx well, and distribute 50-pL aliquots of this mix into sterile 0.5-mL Eppendorf tubes under a transfer hood (see Note 6). 2. Add an equal volume of diluted DNAs into each of the tubes, and overlay with mineral oil (Sigma [St. Louis, MO] M-3516 Mineral Oil) if required with your temperature cycling device. Spin down the contents of the tubes for a few seconds. A negative control (PCR water blank, no DNA template) is used in every experiment to test for the presence of DNA contamination of reagents and reaction mixtures (see Note 7). 3. Run the reactions using an automated temperature cycling device. Cycling parameters are: an initial denaturation step of 94OC for 1 min and 25 s followed by 35 amplification cycles of denaturation, annealing, and extension. The temperature and times for these steps in the first 13 cycles are 95OC for 35 s, 55OC for 55 s, and 72°C for 45 s. Cycles 14-26 and 27-35 used the same parameters except that the extension steps were lengthened to 2 and 3 min, respectively. After the 35 cycles are completed, the samples are incubated an additional 10 min at 72°C. Store the tubes at -2OOC once the reactions are completed, or use immediately.
3.2. Enzyme
Digestion
1, Using standard lab micropipetors, dilute the restriction enzyme of choice by adding in order the following components into a 1.5-mL Eppendorf tube which is chilled on me:
Gardes and Bruns
182 H2O
2. 3. 4. 5.
7.0 x NPL 1.5 x NpL
1OX restriction enzyme buffer Mix thoroughly then add: 0.3 x N/AL Enzyme (8-l 0 U/uL) (Unequals the total number of restriction enzyme digests for each enzyme.) Mix by finger tapping. Usmg PCR product-dedicated micropipetors distribute 8 pL of each PCR product into separately labeled centrifuge tubes (see Note 8). To each of the above add 7 yL of dilute enzyme mix from step 1. Mix well by finger tappmg the tube or pipeting up and down two to three times. Spm down the contents for a few seconds m a microcentrifuge. Incubate the tubes at recommended temperature for 1 to 2 h, in a heat black, a water bath, or an incubator (see Note 9). Load the samples directly on agarose gel or store them overnight m the tubes at 4°C or longer at -20°C.
3.3. Gel Electrophoresis This section describes the production of a 2-3-mm thick, 8.3 x 10.2 cm (i.e., 25 mL) agarose gel, which is poured onto a glass projector slide (Kodak projector slide cover glass, cat. 1402130). Surface tension alone prevents the agarose from running off the plate. The thin gel that results uses the minimum amount of agarose and it facilitates short run times. We use these in conjunction with an Owl Scientific Plastics, Model B2
(12 x 14 cm) tank. The quantities of buffer used, the current, and the run times should be adjusted for other gel systems. 1. Melt the previously prepared agarose mixture in a microwave or autoclave. When the agarose has completely dissolved, swirl gently to ensure it is uniformly distributed. 2. Pour approx 20-25 mL onto the glass projector slide using a 25-mL pipet. The glass plate should be oriented such that the comb can be placed parallel to and approx 1 cm from one of the longest (10.2 cm) sides. The gel formed should be a uniform layer that just reaches but does not run off the edges of the glass plate. If plastic gel casting molds are used instead of glass, then allow the agarose to cool to approx 55OCbefore pouring. 3. Immediately after pouring the agarose, carefully place the well-forming comb approx 1 cm from the top of gel (see Note 10). 4. Let the gel harden for about 5-10 min; as the gel cools, it turns opaque. When the gel is cool to the touch, gently remove the comb. 5. Place the gel, still on its glass plate, mto the electrophoresis tank. To prevent any movement of the glass plate during electrophoresis, tighten it
ITS-RFLP
Matching
against the tank by wedging a cut plastic disposable pipet tip on one side; this is necessary because the tank is 12-cm wide, whereas the plate is only 10.2-cm wide. 6. Fill the tank with 1X TAE buffer up to the point at which the gel is just contacted on all sides by the buffer, but not so high that the wells are flooded by buffer (see Note 11). 7. Carefully load each sample into separate wells using the PCR product micropipet with a new pipet tip each time. Contact between the pipet tip and the bottom of the well should be avoided, as this can damage the well and lead to losing the sample. To keep track of the samples, we load -0.5 pL of blue-stop dye solution into every fifth well. If the reaction contents do not fill up the well, add a small amount of 1X TAE to fill up each well. 8. Run the gel at high speeduntil the blue dye has moved into the gel (3-5 mm) then, switch off the power, and add enough 1X TAE to just cover the entire gel, turn the power back on and run the gel at approx 180 mA (see Note 12). 9. Run the electrophoresis until the blue dye has migrated to about 0.5-l cm from the bottom of gel (about 75 min). 10. Remove the gel and glass plate, place them in a small tray, submerge them m water, and stain the gel by adding one drop of ethidium bromide stock solution to the water (-0.5 pL/mL final volume ethidium bromrde). Shake the gel gently for about 15 min. The gel will come loose from the glass plate during this step. If it does not, loosen it with a gloved hand or else it will not stain quickly and uniformly. 11. Pour off the stain mto a storage container (safe disposal), rinse the gel with water, flood it with additional water, and continue to shake it for 20 min to wash out excess stain (see Note 13). 12. Place the gel on a UV transilluminator. Illummate with UV light. DNA stained with ethidium bromtde fluoresces orange under UV light. Caution: Exposure to UV light is damaging to eyes and may cause skin cancers. Wear protective eyewear while using UV light source. 13. Photograph with a Polaroid camera using Polaroid film type 665 or 667 and an ethidium bromide filter.
3.4. Restriction
Fragment
Analysis
1. Number and size of fragments can be compared between samples on different gels, but to confirm pattern identity, putatively identical patterns should be run side-by-side on the same gel. In our experience with mycorrhizal fungi a match with two different single enzyme digests generally corresponds to a species or species group. 2. The size of a DNA fragment can be calculated from standard curves where the migration distances of marker fragments of known sizes are plotted
184
Gardes and Bruns against then basepan numbers. One simple way to do it IS to plot the distance migrated by the marker fragments against then correspondmg size on a semilog graph paper The size of the unknown fragments can be estimated by mterpolation from the graph (see Note 14). Another way to estimate fragment sizesIS by using the software NCSA GelReader 2.0 for Macintosh developed by the NCSA’s Software Tool Group (STG). This is free software available from anonymous ftp at ftp.ncsa.uiuc.edu (see Chapter 4, Section 2.2.).
4. Notes 1, The main components of the buffer are very stable and unhkely to go bad. Buffers used for PCR could vary in significant ways. The most significant components are the (Mg2’) and the stabilizers of the enzyme. Many 10X commercial buffers have (Mg2’) of 10 mM; this is often too low for optimal amplification. In theory, (Mg2’) should be optimized for each primer/ template combmation. In practice, this is seldom done. Higher (Mg2’) will generally results m higher yield, but may also reduce specificity. 2. Nucleotide triphosphates (dNTPs) are unstable. Keep the 0.5-mL stock solution altquot on ice when thawed and do not freeze and thaw repeatedly. 3. If a standard wet loading method is used (see Note 1l), the concentration of glycerol m the blue-stop load dye solution needs to be increased to 30% to increase the density of the samples. 4. The mtgration of charged DNA molecules through the gel matrix depends almost entirely on their size; smaller molecules have higher mobtlmes. The type and concentration of agarose must be chosen to suit the size range of the molecules to be separated. Very large molecules are virtually mnnobile in high concentration gels, whereas small fragments will all move at the same rate m dilute gels. Gels made with NuSieve agarose have a greater resolving power for small fragments (1 O-500 bp) than gels made wtth normal agarose. 5. Cross contamination of PCR products is a serious problem because of the sensitivity of PCR amphficattons (10). To help prevent this tt IS worthwhile dedicating one set of micropipetors to handlmg amplified products Micropipetors used for general lab work should not be used for handling amplified products. 6. To prevent carryover contammation with previously amplified products, the followmg steps should be respected. a. Use a dedicated set of micropipetors to prepare stock solutions and set up reactions; b. Set up reactions on tube racks free of prevtously amplified productsthese racks should never be removed from the transfer hood; and
ITS-RFLP
Matching
c. Stock solutions of primers, dNTPs, buffer, PCR water, and Tag polymerase should only be touched with positive displacement pipetors or ordinary laboratory microprpetors using aerosol resistant tips under the hood. 7. For screening freshly extracted DNA, run 25 uL reactions. Use 12.5 PL of PCR mix and 12.5 uL of diluted DNA (make several dilutions of the original DNA extract, e.g., I/IO, l/100, l/1000). Use 0.25 pL of each primer (50 p&!) and 0.125 u-L of Taq polymerase for each 25-uL reaction. 8. To draw an ahquot from a PCR-reaction that contams mineral 011overlay, smoothly and quickly insert the ptpet tip beneath the surface of the oil in the solution. This process is easier with a light mineral 011,e.g., Stgma M-3516 Mineral Oil 9. Most restriction enzymes have an optimum of 37OC, with some exceptions; e.g., TaqI has an optimum of 65°C. 10. Well-forming combs are available with varymg numbers and sizes of sample wells. The procedure as described usesan Owl 24-place comb (only 20 wells are formed on the glass shde). The mdividual teeth have a crosssectional area of 3 x 1 mm and the wells formed by them have about a 20-pL volume capacity. For larger wells more DNA may be necessary to adequately visualize the restriction fragments. 11. We use a dry loading method because it is faster than a wet loading method. However, if the latter is preferred, add 1-2 pL of blue stop-load dye solution (see Note 3) to each 15-uL digest, fill the tank with enough 1X TAE to cover the entire gel, and load your samples. 12. The rate of movement of DNA molecules through gels varies with the strength of the electric field (i.e., the voltage and the temperature at which the gels are run). If the temperature of the gel is too warm, the DNA will diffuse into broad bands. If the gel is cool to the touch, you can increase the voltage to speed up the electrophoresis run. Follow the mstructrons of your commercial gel apparatus for the appropriate voltage range. We routinely run the electrophoresis at about 70-100 V for 60-90 mm. 13. Ethidium bromide bmds to the DNA by mtercalation between basepairs.DNA fragments are made visible by the fluorescence of ethidnun bromide under UV. Background fluorescence is usually caused by unbound ethidmm bromide. Washing in water will eliminate this background, but do not prolong this step too much, or weak bands will disappear. Caution: For environmental and safety concerns, ethidium bromide should not be poured into the sink; follow the recommendation of your institution for EtBr waste disposal. 14. Migration distance is approx inversely proportional to the logarithm of the molecular weight of the fragments. However, this function becomes nonlinear at the higher and lower molecular weights.
186
Gardes and Bruns
Acknowledgments We thank Jane Marks and Det Vogler for their comments on the manuscript. Financial support was provided by NSF grants DEB-922 1472 and DEB-9307150 to T. D. Bruns. References 1 Hawksworth, D L. (1991) The fungal dimension of biodiversity: magnitude, signrticance, and conservation. Mycol. Res. 95,641-655. 2. Gardes, M. and Bruns, T. D. (1993) ITS primers with enhanced spectficrty for basidiomycetes-application to the tdenttflcatron of mycorrhtzae and rusts. Mol Ecol 2,113-l 18 3. Bruns, T D., Fogel, R , and Taylor, J W. (1990) Amphticatton and sequencmg of DNA from fungal herbarium specimens. Mycologza 82, 175-l 84 4. Taylor, J W and Swarm, E C (1994) DNA from herbarium specimens, in Anczent DNA (Herrmann, B. and Hummel, S., eds.), Springer-Verlag, New York, pp. 166-18 1. 5. Gardes, M., White, T. J., Fortin, J. A , Bruns, T. D., and Taylor, J W. (1991) Identification of indigenous and introduced symbiotic fungi m ectomycorrhizae by amplification of nuclear and mitochondrial ribosomal DNA. Can J Bot 69, 180-190. 6. Anderson, J. B. and Stasovskt, E. (1992) Molecular phylogeny of Northern Hemisphere species of Armlllaria. Mycologla 84,505-5 16. 7. Henrion, B., LeTacon, F., and Martin, F. (1992) Rapid identification of genetic variation of ectomycorrhizal fungi by amplification of nbosomal RNA genes. New Phytol 122,289-298 8. Erland, S , Hermon, B., Martin, F., Glover, L. A., and Alexander, I. J. (1994) Identification of the ectomycorrhrzal bastdtomycete Tylosporafibnllosa Donk by RFLP analysis of the PCR-amplified ITS and IGS regions of rtbosomal DNA. New PhytoZ 126,525-532.
9. White, T. J., Bruns, T., Lee, S., and Taylor, J. (1990) Analysts of phylogenetic relationships by amplification and direct sequencing of ribosomal RNA genes, in PCR Protocols: A Guide to Methods and Apphcations (Innis, M. A., Gelfand, D H., Sninsky, J. J., and White, T J , eds ), Academic, New York, pp. 3 15-322 10. Kwok, S. and Higuchi, R. (1989) Avoidmg false positives with PCR. Nature 339, 237,238.
CHAPTER14
Specific PCR Primers for the Identification of Endomycorrhizal Fungi
Luc Simon 1. Introduction The sensitivity of the polymerase chain reaction (PCR) (1,2), coupled to the specificity afforded by taxon-specific primers allows the analysis of a variety of samples, like minute amounts of cultured organisms (3,4), or even endosymbionts like the endomycorrhizal fungi present in the roots of field collected plants (5-S). The method presented here is based on the specific amplificatron of portions of the nuclear genes coding for the ribosomal small subunit rRNA, sometimes referred to as the 18s or SSU gene. The VANS1 primer was shown to be capable, in conjunction with a suitable downstream primer, of directing the amplification of only the ribosomal genes of Glomalean fungi (6), the group of fungi responsible for the arbuscular endomycorrhizal symbioses. 2. Materials 2.1. DNA Extraction 1. Chelex (BioRad, Richmond, CA), prepared as 20% suspension in sterile water. 2. RNase. 3. Liquid nitrogen. 4. Plastic pestles, to fit mlcrocentrlfuge tubes. From
Methods Nut/e/c
m Molecular Acd Methods
Bology, Vol 50 Speoes Edlted by J P Clapp
187
Diagnosbcs Protocols PCR and Other Humana Press Inc , Totowa, NJ
Simon
188
2.2. PCR 1. Thermal cycler with appropriate tubes and mineral oil. 2. 10X PCR buffer, optimized for Taq or VentRTM(exo-). 3. Taq polymerase, VentRTM (exo-) polymerase (New-England Biolabs, Beverly, MA). 4. Primers, preferably 50 @4 ahquoted in small amounts. 5. 1OX dNTP, containing 1 mM of each deoxynucleottde triphosphate. 6. 10 mg/mL Ethidium bromide. 7. Gel electrophoresis equipment.
3. Methods 3.1. Extraction of Nucleic
Acids
Depending of the nature of the starting material used for the extraction of nucleic acids (AM spores, soil, roots), the basic extraction protocol presented here might require some modifications. Remember that very little DNA is required for PCR analyzes, and very crude preparations are often usable, especially if used immediately and not stored for any length of trme. 1. 2. 3. 4.
5.
3.1.1. Crude Preparation from AM Fungal Spores Collect 20-l 00 spores of endomycorrhizal fungi. Transfer the spores to a microfuge tube with 50-l 00 PL of sterile distilled water. Crush the spores with a plastic pestle specially designed to grind small samples in a microfuge tube. Immedtately add 25-50 PL of Chelex 20% and vortex briefly. Let it stand at room temperature until all samples are similarly processed. Place all samples in boiling water for 3 min (tubes must be securely capped) A plastic floating rack is useful for this and subsequent mampulations. Move the tubes to a liquid nitrogen bath and let the sample freeze for about 2 min. An ethanol/dry ice bath may also be used. Thaw the samples by returmng the rack to the boiling water bath for 3-5 min and repeat to complete three freeze-thaw cycles. Add 1 pL of DNase-free RNase and incubate 15-30 min at room temperature.
Proceed immediately with PCR. The crude extract should be stored at -80°C if not used immediately, but it might not remain suitable for very long.
Identification
of Endoniycorrhizal
189
Fungi
VANS1
++
VAGLO VAGIGA VAACAU VALETC
NS2 is
2 zii
VANSkGTCTAGTATAATCGTIATACAGG
NS21:AATATACGCTAlXiGGAGCTGG
NS2:GCCTGCTGGCACCAGAClTGC
NS41:CCCGTGTTGAGTCAAATTA
NSQ:C’ITCCGTCAA
NS61:TCAGTGTAGCGCGCGTGCGGC
ITCCTITAAG
NS6:GCATCACAGACffG’lTAlTGCCTC
VALETC:ATCACCAAGGTRAG?TGGTTGC
NSB:TCCGCAGG-l-CCACCTACGGA
VAGLO:CAAGGGAATCGGTCCCGAT
v~~c~u:TGA~c~cc,4ATGGGk4.4cccc VAGIG~TCACCAAGGGAAACCCGAAGG SS1492’:GCGGCCGCTACGGMWACCTTGTTACGACTT
Fig. 1. Diagram of the relative location of the SSU primers (4,6,8,9) Locations of some useful umversal primers and taxon specific primers (bold) are shown on a schematic representation of the nuclear gene coding for the small subumt ribosomal RNA (SSU). Thin lines represent flanking intergenic spacers. 3.2. Specific Amplification of 185 rRNA from Endomycorrhizal Fungi
Genes
Make a master mix containing all the components needed for the PCR, except the template. It is convenient to prepare the master mix at 2X concentration, aliquot the required number of assays in separate microtubes designed to fit the thermal cycler to be used, and add an equal volume of template solution to each tube. Primer VANS1 should be used in conjunction with an appropriate downstream universal primer to direct the specific amplification of a portion of, or the nearly complete SSU. Figure 1 depicts the relative position of primers useful in the amplification of AM fungal SSUs. 1. Dilute the crude extracts with sterile distilled water. Usually, three IO-fold dilutions are tested for each sample, l/10, l/100, and l/1000. 2. Prepare enough PCR master mix for the number of PCR assays to be performed (see Note l), plus 10% for security (plpeting inaccuracies).
190
3
4.
5.
6.
Simon Assays are usually performed m total volumes of 25-50 pL. Composltlon of the master mix: for 100 pL of 2X master mix, add 55 I.LLsterile distilled water, 20 FL of 10X PCR buffer, 20 p.L of 10X dNTPs (see Note 2), 2 PL of 50 @4 VANS 1 primer, 2 PL of 50 @4NS2 1 primer (see Note 3), 1PL of Tuq polymerase (5 U/pL) Mix well and distribute m the required number of assay tubes. Add equal volumes of diluted crude extract to each assay tube. Overlay with a drop of light mineral 011.Cap each tube carefully and immediately label each tube, on the cap, with a water-resistant marker. Wnte down the description of each assay with its corresponding label. Quick-spin the tubes for a few seconds to bring down any droplets. Place in the thermal cycler and start the PCR. The cycler should be programmed to perform 30 cycles of 1 min at 95”C, 45 s at 5O”C, 90 s at 72”C, and then hold 72°C for 10 min. Assay tubes should be kept at 4°C until analyzed, but can withstand room temperature for a few hours. Prepare an agarose gel (2% NuSieve/l% genetic grade agarose m TAE or TBE buffer) with enough wells to analyze the PCR assays.Plpet an aliquot of amplified mixture (see Note 4), add 1 pL of gel loading buffer (see Note 5), and carefully dispense mto first well. Repeat for all samples, including a size standard, note the content of each well, run the electrophoresls until the Bromophenol blue migrates 2/3 of the gel. Immerse the gel in an ethidlum bromide stainmg solution for 15 min, rinse m water for 5 min, visualize on a transilluminator, and take a picture!
3.3. Analysis of 185 rRNA Genes Using Family-Specific Primers The amplified AM fungal SSU fragments can be characterized by PCR assays using family-specific primers. Four primers have been described and conditions of the assays have been optimized for specificity (8) Proper care should be taken to verify that the results are reliable. Always include positive and negative controls, design the experiments so that samples to be compared are analyzed using the same batch of reagents, repeat the analyses at least twice. 1. Dilute the fragments previously amplified with primers VANS 1 and NS2 1 at least a 1OOO-fold. 2. Prepare a master mix that contains the VentRTM(exo-) polymerase mstead of Taq polymerase, and the appropriate 10X buffer provided by the enzyme supplier, and only the VANS1 primer. Mix well, separate m four tubes, and add one of the family-specific primer to each tube. Aliquot in PCR assay tubes.
Identification
of Endomycorrhizal
Fungi
191
3. Add an equal volume of the 1OOO-folddiluted fragments, a drop of mineral oil, and proceed with PCR. The cycler should be programmed to perform 30 cycles of 1 mm at 95°C 45 s at 5O”C, 90 s at 72”C, and then hold 72°C for 10 min. 4. Proceed to the post-PCR area. Analyze by agarose electrophoresis as previously described.
4. Notes 1. The components of the master mix should be added m the followmg order: water, 10X PCR buffer, 10X dNTP solution, primer 1, primer 2, and Taq polymerase. 2. The 1OX dNTP solution should not be thawed repeatedly, it 1sbest to prepare it from ultrapure nucleotides triphosphate solutions and store the mixture in 50-100 PL aliquots at -20°C. 3. Primers can be diluted with ultrapure water at 50 @U, and stored in 50-pL aliquots at -20°C. Once thawed, unused primers can be kept at 4°C for many weeks. 4. Post-PCR manipulations should be performed m an area physically isolated from where the pre-PCR manipulations are performed (2). It is imperative to use a specially designated pipetor to be used only with amplified material, never with sample or reagent preparation. 5. Tip to collect amplified samples and mix with gel loading buffer: Spot many 1 PL droplets of loading buffer on a piece of parafilm. Carefully pipet 7 pL of amplified mixture through the oil, mix it with a droplet of loading buffer by pipetmg in and out on the parafilm, and load in a well of the agarose gel.
Acknowledgments I thank many colleagues for their support and assistance during my doctoral project: G. Becard, S. Chabot, J. Morton, M. Gray, T. Szaro, J. Simard, L. Bernier, J. Bousquet, Y. PichC, T. Bruns, M. Lalonde, and R. C. LCvesque.
References 1. Innis, M. A., Gelfand, D. H., Smnsky, J. J., and White, T. J. (1990) PCR ProtocolsA Guide to Methods and Applications, Academic, San Diego, CA. 2. Mulhs, K. B. and Faloona, F. A. (1987) Specific synthesis of DNA m vitro via a polymerase catalysed chain reaction. Methods Enzymol. 155,335-350. 3. Bruns, T. D , Fogel, R., and Taylor, J. W. (1990) Ampliflcatton and sequencing of DNA from fungal herbarium specimens. Mycologza 82, 175-l 84. 4. White, T. J., Brims, T., Lee, S., and Taylor, J. (1990) Amplification and dnect sequencing of fungal ribosomal RNA genes for phylogenetics, in PCR Protocols.
192
Simon A Guide to Methods and Applzcatzons (Inms, M. A., Gelfand, D. H., Snmsky, J. J ,
and White, T. J., eds.), Academtc, San Diego, CA, pp. 315-322. 5. Simon, L., Bousquet, J., Levesque, R C , and Lalonde, M. (1993) Origm and dtversification of endomycorrhizal fungi and coincidence with vascular land plants. Nature 363 (6 May), 67-69. 6. Simon, L , Lalonde, M., and Bruns, T. D (1992) Specific amplification of 185 fungal ribosomal genes from vesicular-arbuscular endomycorrhizal fungi colomzmg roots. Appl Environ Mtcroblol 58(l), 291-295. 7. Simon, L., Ltvesque, R. C , and Lalonde, M. (1992) Rapid quantitation by PCR of endomycorrhizal fungi colomzmg roots, PCR Methods Appl. 2,76-80 8. Simon, L., Levesque, R C., and Lalonde, M. (1993) Identification of endomycorrhizal fimgi colomzing roots usmg fluorescent SSCP-PCR. Appl Envzron Mlcroblol 59( 12), 42 1 l-42 15 9 Bousquet, J , Simon, L , and Lalonde, M. (1990) DNA amplification from vegetative and sexual tissues of trees using polymerase chain reaction Can J. Forestry
Res 20(2), 254-257
CHAPTER15
Single-Strand Conformational Polymorphism (SSCP) for the Identification of Endomycorrhizal Fungi Luc Simon 1. Introduction Among the different methods devised to detect genetic polymorphisms, the analysis of single-strand conformation is simple and yet exquisitely sensitive (r-5). It has been reported that even single base substitution can be detected between DNA fragments ranging in size from 100-450 bp (3). Coupled with PCR amplification, SSCP analysis can be used to rapidly identify variants of a defined DNA segment, without relying on prior knowledge of their DNA sequences. Because very high resolution polyacrylamide gel electrophoresis is required to detect the small differences in migration rate between homologous fragments, minimal amounts of sample have to be analyzed, and a sensitive method has to be used to visualize the bands, like silver staining, autoradiography of radiolabeled fragments, or laser-induced fluorescence of fluorescently labeled fragments. This latter method can readily be performed using an automated sequencer. For identifying endomycorrhizal fungi, the taxon-specific primers described in Chapter 14 can be used, as well as more generic primers targeting a highly variable region of the same 18s gene. These latest primers could also be used to amplify this 18s fragment from other fungi and possibly many other eukaryotes. From
Methods Nut/e/c
/n Molecular AC/d Methods
Bfology, Edlted
Vol 50 Specres Diagnosbcs Protocols PCR and Other by J P Clapp Humana Press Inc , Totowa, NJ
193
194
Simon
2. Materials 2.1. PCR 1. 2. 3. 4.
Thermal cycler with appropriate tubes and mineral oil. 1OX PCR buffer (usually supplied with enzyme). Taq polymerase (several suppliers). Fluorochrome-labeled primers, preferably 50 @! allquoted m small amounts (see Note 1). 5. 10X dNTP, containing 1 mM of each deoxynucleotide triphosphate, ahquoted m small amounts.
2.2. SSCP 1. Automated sequencer (A.L.F., Pharmacia [Uppsala, Sweden] or 373A, Perkin-Elmer/ABI [Norwalk, CT]) (see Notes 2 and 3). 2. Fluorescent size standards (see Note 4). 3. 5X MDE solution (JT Baker, Philhpsburg, NJ). 4. Fragment Manager (Pharmacia) or GeneScan Analysis (Perkm-Elmer/ABI) software.
3. Methods 3.1. Amplification of 185 rRNA Genes fi-om Endomycorrhixal Fungi Since I am describing a procedure to identify endomycorrhizal fungi, the first step is to obtain an 18s fragment, that will be further characterized by SSCP. To this end, primer pair VANS 1 and NS2 1 is used to specifically amplify a fragment of about 550 bp, VANS 1 being Glomales-specific (6-@. 1. Obtain DNA from the specimen to be analyzed, for example from AM fungal spores or from colonized roots. Detailed methods are presented m Chapter 14 of this book. 2. Perform PCR, as described in Section 3.2., Chapter 14. 3. Verify by agarose gel electrophoresis that the correct size fragment has been amplified. Dilute the amplified fragment at least a lOOO-fold.
3.2. Single-Strand Conformation Analysis Using Family-Specific Primers Depending on the automated sequencer that will be used for the SSCP analysis, different fluorescently labeled primers can used: fluorescein or FAM with A.L.F.; FAM, HEX, ROX, JOE, or TAMRA with the 373A (see Fig. 1).
Identification
of Endomycorrhixal
Fungi
195
Ns32
VANS1
VAGLO VAGIGA VAACALJ
VANSl:GTCTAGTATAATCG?TATACAGG
NS21:AATATACGCTA’lTGGAGCTGG
NSZZ:TAAACACTCTAAITl-ITTCAA
NS32:AAGClTGTAGlTGAAmCGG
VAGLO:CAAGGGAATCGGTTGCCCGAT
VAACAUtTGA-lTCACCAATGGGAAACCCC
VAGIGAzTCACCAAGGGAAACCCGAAGG
Fig. 1. Diagram of the relative location of the SSU primers. Locations of generic primers and taxon-specific primers (bold) used for the SSCP analysis of endomycorrhizal fungi, on a schematic representation of part of the nuclear gene coding for the small subunit ribosomal RNA (SSU). Thin line represents flanking mtergemc spacer. 1. Using the diluted VANS I-NS2 1 fragment previously amplified as template, perform PCR with VANS1 and one of the family-specific primer VAGLO, VAACAU, or VAGIGA (9). Store the labeled amplified fragment at 4°C until needed for SSCP analysis. 2. Prepare a 0.35mm thick polyacrylamide gel for the automated sequencer. Since a nondenaturmg gel is needed, simply omit the urea from the standard sequencing gel recipe. A ready-made concentrated gel solution specially formulated for this purpose is commercially available: 5X MDE solutton (JT Baker), used to prepare a 0.5X MDE gel. The gels can be reused a few times with no apparent loss in resolution. Set up the automated sequencer, using 0.6X TBE runnmg buffer, no pre-electrophoresis is necessary. 3. Dilute the fluorescently labeled PCR products 5- to IO-fold m 95% formamide- 10 mM NaOH. Mix a small amount of internal size standard to each sample. Denature for 5 min at 85°C. Place on ice. Immediately load 3-p.L samples in the wells of the gel. 4. Run the electrophoresis at 1200 V for about 4 h. Fragment Manager software on the A.L.F. or GeneScan 672 software on the 373A are used to standardize lane-to-lane migratton and compare the corrected traces (see Note 5).
196
Simon 3.3. Single-Strand Conformation Using Generic Primers
Analysis
1 Using the diluted VANS l-NS2 1 fragment previously amplified as template, perform PCR with VANS22-VANS32. Depending on the instrument available, one or both primers should be fluorescently labeled. Check by agarose electrophoresis that a fragment of the expected size (about 150 bp) has been obtained. Store the labeled amplified fragment at 4°C until needed for SSCP analysis. 2. Prepare a 0.35mm thick polyacrylamide gel for the automated sequencer. Set up the automated sequencer usmg 0.6X TBE running buffer, no preelectrophoresis is necessary.If the instrument permits, set the gel temperature at 30°C 3. Dilute the fluorescently labeled PCR products 5- to lo-fold m 95% formamide- 0 miJ4NaOH. Mix a small amount of internal size standard to each sample. Denature for 5 mm at 85OC.Place on ice. Immedtately load 3-pL samples in the wells of the gel. 4. Run the electrophorests at 600 V for about 10 h. Fragment Manager software on the A.L.F or GeneScan 672 software on the 373A are used to standardize lane-to-lane mtgration and compare the corrected traces (see Note 5). 4. Notes 1. The labeled primers can be obtained either by synthesizing an amino-modified primer, which can then be reacted with the fluorochrome-NHS ester (IO), or by direct coupling of the fluorochrome during synthesis using the appropriate phosphoramidtte reagent. Most commercial suppliers of oligonucleotides can provtde the required fluorescently labeled primers. 2. If using A.L.F., it is preferable to use only one labeled primer so that only one strand of the amplified product will be labeled, making the SSCP pattern more simple and its interpretation straightforward. 3. Although not a standard feature, it is possible to modify the instrument so that the gel temperature can be controlled. If the instrument has been so modified, set the gel temperature at 30°C. 4. ABI has ROX labeled size standards that can be used on then instrument. Custom standards can be made by PCR using fluorescently labeled prtmers. The requirement is that each lane contain at least two standard bands, preferably migrating close to the sample bands, in order to accurately compare the migration m the different lanes of the gel. Bands differing by less than half the distance that represent a 1 bp difference on a sequencing gel can then be accurately scored as polymorphic
Identification
of Endomycorrhizal
Fungi
197
5. When comparmg two DNA fragments by SSCP, the mrgratlon difference is sometimes much larger depending on which strand is analyzed. If run on a 373A and both primers are labeled with different fluorochromes, the two strands of the amplified fragment can be scored simultaneously and unambiguously.
Acknowledgments This work was conducted in M. Lalonde’s and R. C. Levesque’s laboratories, and supported in part by an operating grant from the Natural
Sciences and Engineering Research Council of Canada to M. Lalonde (No. A-2920). Work in R.C. Levesque’s laboratory was funded by the MRC and the Canadian Bacterial Diseases Network via the Centers of Excellence. France Couture and Pierre Chretien were very helpful with the A.L.F. and Fragment Manager software. References 1 Ainsworth, P J., Surh, L C , and Coulter-Mackie, M B (199 1) Dtagnosttc single strand conformational polymorphism, (SSCP): a simplified non-radioisotopic method as applied to a Tay-Sachs B 1 variant. Nuclezc Acids Res 19(2), 405,406. 2 Dockhom-Dwomiczak, B , Dwomtczak, B., Brommelkamp, L., Bulles, J., Horst, J., and Backer, W. W. (199 1) Non-isotopic detectton of single strand conformation polymorphism (PCR-SSCP): a rapid and sensitive technique in diagnosis of phenylketonuria Nuclezc Acids Res 19(9), 2500. 3. Hayasht, K. (1991) PCR-SSCP: A simple and sensitive method for detection of mutations m the genomtc DNA. PCR Methods Appl 1,34-38. 4. Makino, R., Yazyu, H., Kishimoto, Y , Sekiya, T., and Hayashi, K. (1992) F-SSCP: Fluorescence-based polymerase cham reactton-single-strand conformation polymorphism (PCR-SSCP) analysis. PCR Methods Appl 2(l), 10-13. 5. Orita, M., Iwahana, H , Kanazawa, H., Hayashi, K., and Sektya, T (1989) Detection of polymorphisms of human DNA by gel electrophoresis as single-strand conformation polymorphism. Proc Natl. Acad. of Sci. USA 86,2766-2770 6. Simon, L , Bousquet, J., Levesque, R. C., and Lalonde, M. (1993) Origin and diversification of endomycorrhizal fungt and coincidence with vascular land plants. Nature 363 (6 May), 67-69. 7. Simon, L., Lalonde, M., and Bruns, T. D. (1992) Specific amplification of 18s fimgal ribosomal genes from vesicular-arbuscular endomycorrhtzal t?mgi colonizing roots. Appl. Enwon Mlcrobiol. 58(l), 291-295. 8. Simon, L., Ltvesque, R. C., and Lalonde, M. (1992) Rapid quantitation by PCR of endomycorrhizal fungi colonizing roots. PCR Methods Appl 2,76-80. 9. Simon, L., Levesque, R. C., and Lalonde, M. (1993) Identification of endomycorrhizal fungi colonizing roots using fluorescent SSCP-PCR Appl Environ. MzcrobloZ. 59(12), 42 1 l-42 15. 10. Giusti, W. G. and Adnano, T. (1993) Synthesis and characterizatton of 5’-fluorescent-dye-labelledoligonucleotides.PCR Methods Appl. 2,223-227.
CHAPTER16
The Use of RAPD for Isolate Identification of Arbuscular Mycorrhizal Peter
Fungi
Wyss
1. Introduction The basic polymerase chain reaction (PCR) (I), which consists of the exponential amplification of DNA fragments between terminal sequencesrecognized by specific oligonucleotide primers, is a very powerful method but does not satisfy all wishes. The need for sequence information from the DNA template, in order to create the primers, limits the applicability of the method to a few organisms or to highly conserved genomic DNA regions. This is a handicap if highly variable regions need to be analyzed, as is normally the case for the identification of organisms at the strain or isolate level. To circumvent this problem, the basic PCR method has been modified. Instead of long oligonucleotide (20-30 mer) primers, short (9-13 mer) oligonucleotides of arbitrary sequence can be used. They bind to complementary sequences occurring more or less frequently in the genome. A DNA amplification product is generated for each genomic region that happens to be flanked by a pair of priming sites that are within 3000 bp of each other and in the appropriate orientation (Fig. 1). Variation between nearly related individuals in the banding pattern of amplification products after electrophoresis is produced either by polymorphisms in the sequence recognized by the primer, which results in the absence of an amplification product, or by length polymorphisms From
Methods m Molecular Biology, Vol. 50 Species Dagnosbcs Protocols PCR and Other Nuclewz Acrd Methods Ed&d by J P Clapp Humana Press Inc , Totowa, NJ
199
200
wyss
Fig. 1. Amplification of genomlc DNA with short arbitrary primers. Fragments, which are flanked by a pan of priming sites wtthm 3000 basepans m the appropriate orientatton (A), are amplified exponenttally (A’). Fragments wtth one priming site (B) or with more than 3000 bp within a pan of priming sites (C) are not amplified exponentially (B’, Cl). between the primer sequences, which gives rise to amplified fragments of different lengths. In this way, the use of short oligonucleotides can detect polymorphisms in the absence of specific nucleotide sequence information. The DNA fragments originated by this method are called random amplified polymorphic DNA (RAPD) markers (see Note 1) (2). By using this method, we have successfully identified isolates of arbuscular mycorrhizal (AM) fungi (3). These soilborne fungi, a small
Identification
of AM Fungi
201
group belonging to the Glomales @ygomycetes), form a mutualistic symbiosis with plant roots. It is the most widespread plant-microorganism symbiosis occuring in all types of soil and including over 80% of all vascular plants as hosts (4). AM fungi are obligate biotrophs. They do not grow axenically and are dependent on the host for their growth and morphogenesis (5). Furthermore, they do not reproduce sexually and it can be very difficult to distinguish closely related species, or isolates within the same species, based on the morphology of the vegetative and symbiotic structures. They produce putative chlamydospores, which can reach sizes between 30 and 500 p in diameter (6) and contain several thousand nuclei (7,s). Such spores, single or pooled, are a good source of DNA for RAPD experiments. They are grown in open pot cultures or collected in the field. Depending on the DNA-primer combination, between 1 and 14 DNA segments have been amplified, ranging in size from 0.3-3 kb (3). 2. Materials 2.1. Equipment 1. Spore preparation:Sterile filter paper (Whatman, Maidstone, UK), sterile Petri dishes, dissecting microscope, ultrasonic water bath 2. Template preparation: Sterile forceps, microcentrimge, vortex, sterrle bench. 3. PCR: Thermal cycler, autoclaved Eppendorf tubes, a separate set of micropipets, tips, latex gloves. 4. Nucleic acid electrophoresis: Microwave oven or boiling water bath, Parafilm, agarose gel electrophoresis eqmpment, electrophoresls power supply, UV transilluminator, Polaroid camera.
2.2. Reagents 1. Chelex 100 ion-exchange resin, biotechnology grade for PCR sample preparation (BioRad, Richmond, CA). 2. H20: Sterile deionized bidrstillated water. 3. Super Taq DNA polymerase, SU/pL in 50 nuI4 Tris-HCl, pH 8.0, 1 mA4 DTT, 1 rruI4 EDTA, 50% (v/v) glycerol (P. H. Stehelin and Cie AG, Basel, Switzerland). 4. 10X Polymerization buffer: 100 mA4Tris-HCl, pH 9.0,500 mMKC1, 0.1% (w/v) gelatin, 1% Trrton X- 100 (supplied with the DNA polymerase). 5. MgCl* solution 1.OM(Molecular biology products, Sigma, St. Louis, MO). 6. dNTPs ultrapure solutron (Pharmacra, Uppsala, Sweden). 7. IO-mer Oligonucleotides 30 yg/mL (Operon, Alameda, CA).
wyss
202 8. 9. 10. 11.
Light mineral oil (Molecular biology products, Sigma). Nucleic acid electrophoresis: DNA grade or low -mr agarose powder. 5X TBE buffer: 0.445MTris borate, pH -8.3, O.OlM EDTA (autoclaved). DNA sample buffer: 48% glycerol, 0.5X TBE buffer, 0.18M EDTA, 0.4% SDS, Bromophenol blue powder (spatula tip, -150 pg/mL). 12. Ethidium bromide tablets (BroRad).
3. Methods 3.1. Spore
Preparation
All kinds of living spores originating from sterile or open pot cultures or from the field can be used. 1. Collect spores by wet sieving (60 or 100 pm mesh, depending on spore size) and decanting, The supernatant is filtered through Whatman filter paper (9). 2. Pick the spores indrvrdually, under a dissecting microsocope, from the filter paper with forceps and transfer to a 1.5-mL Eppendorf tube containing 500 pL sterile H20. They can be stored at this stage for several weeks at 4OC. 3. Sonicate the spores four to five times for 15 s. This step releases soil debris and bacteria from the spore walls. 4. Vortex the tubes for a few seconds and centrifuge for 2 mm at 5000g. The water is discarded by ptpeting. 5. Wash the spores three to four times wtth 500 p.L sterile H20. After the last washing step, the spores are transferred with a sterile tip onto sterilized filter paper in a sterrle plastic Petri dish.
of Template The template is prepared from one single spore or from several spores. A single spore provides enough DNA for 30 (Glomus versiforme) to 120 (Gigaspora margarita) amplification reactions. 3.2. Preparation
3.2.1. Single Spore Preparation 1. Using a dissecting mtcroscope situated in a sterile fume hood, pick up a single spore with a flamed and retooled pair of forceps, and transfer rt to a sterile 0.5-mL tube with 15-pL sterile H20. The forceps holding the spore are plunged into the water. By gentle pressure the spore IS crushed before being releasing from the forceps. 2. Add 15 PL of 20% (w/v) Chelex 100, using a 20-PL micropipet with a sterile tip. The tip is cut at the end to make this operation easier. After pipeting, shake the tube gently to disperse the Chelex 100 beads,
Identification
of AM Fungi
203
3.2.2. Preparation of Pooled Spores 1. Five to ten spores are picked up one by one with a sterile forceps, transferred to a OS-mL Eppendorf tube containing 150 )..tLHzO, and crushed between the forceps as described in Section 3.2, step 1. Alternatively, spores are picked up, transferred onto a drop of Hz0 on a sterile mrcroscope slide, and crushedunder a sterile cover glass. The extract is then transferredwith a pipet to a OS-mL tube. To get a maximum yield, resus-
pendthe residueon the microscopeslide in Hz0 anothertwo to threetimes. The final volume should not exceed 150 pL. 2. Add 50 p.L of 20% (w/v) Chelex 100, and shake the tube as described in Section 3.2.1.
3. Vortex the crude extracts for a few seconds,centrifuge for 10 s at 5OOOg, sonicate for 15 s, freeze/thaw four times (the fastest way: liquid Nz and a water bath), heat for 15 min to 95OC,and centrifuge for 5 s at 5000g. These preparations are used as stock DNA solution, and they can be stored for several weeks at -20°C. 4. The optimal concentratton of templates IS determined in a first PCR experiment (see Note 2). The stock DNA solution is centrifuged for 5 min at SOOOg,and a serial dilution (1OX, 50X, and 500X) from 3-4 pL supernatant is prepared. Amplificatton with two or three different primers should be tested. The dilution giving the best amplification results is chosen for subsequent experiments. The diluted stock solutions can be stored at 4°C for several days. For longer periods, they should be stored at -20°C. Outside the refrigerator, DNA samples always should be kept on me.
3.3. PCR The reagentsused for the amplification reaction are comparable to those for ordinary PCR, with the exception of the primers. To amplify a specific DNA fragment by conventional PCR, two different primer-ach one complementary to one of the 3’ end of the strands-are necessary. To generate RAPD markers, one single primer is always used. Prepare at least two reaction tubes for each sample and run the amplification in parallel, If the amplification experiment only includes a few samples, the reaction mixture can be prepared by prediluting the DNA polymerase with 1X reaction buffer. This step avoids errors due to pipeting too small volumes of enzyme solution. All reagents of the reaction mixture can be stored at -20°C for several months.
1. Mix the followmg: 4.52 pL H20, 1.5 pL 10X polymerization buffer, 1.2 pL 25 mM MgC12, 1.2 pL dNTPs (a mixture of all four at 2.5 n&Y each), 0.5 ltL primer 30 ng/l.tL, 0.08 PL super Taq-polymerase 5 U/pL, 6 PL template, diluted stock solution, 15 PL total volume. 2. Cover with 20 pL mmeral oil. 3. Forty-five cycles of amplification are performed using a thermal cycler. A cycle is 30 s at 92°C 1 mm at 36°C and 2 mm at 72°C. The first cycle includes an mitral 5-mm denaturation step and the last cycle a final 3 mm extension time.
3.4. Analysis
of Amplification
Products
1 Load about 6 pL of the reaction mixture onto a 1.4% agarose gel in 0.5X TBE buffer. Run at 5 V/cm for 1 h in parallel with a suttable marker (e.g., EcoRIIHzndIII-cut hDNA) (see Note 3). 2. Shake the gel 30 min in ethidmm bromide solution (3.7 pg/mL). 3. The amplified DNA fragments are visualized as bands on a UV transillummator and photographed (Ftlm: Polaroid 667). 4. The similarity of banding patterns is calculated as the ratio between shared fragments and the total number of fragments (20) (see Note 4): S%*a = [(2 x number of shared fragments)/ (number of fragments A + number of fragments B)] x 100 (1) The level of polymorphrsm detected IS given by: P%Aa = 100% - S%*u
(2)
4. Notes 1. A comment on RAPD markers in general: To generate RAPD markers, one must observe the same rules that are valid for ordmary PCR. The power of the method must be kept m mind, and hence any source of contammation should be avoided (ZI). This is especially true for amplification reactions wtth short primers, which can find complementary binding sites m any organisms. With regard to AM fungal spores, no DNA preparation is probably free of foreign DNA, originating from bacteria or other fungi, which associate with the spore wall, or from bacteria-like organisms (BLOs), which have been frequently observed in the spore cytoplasm (12). In spite of this fact, banding patterns were found to be highly reproducible, even between samples of the same isolate grown m different laboratories for over 12yr (3). This lack of sensitivity to contaminations may be explained by the theory of Michelmore et al. (13), who suggested that a specific DNA template cannot be revealed if it represents only a small proportion of the
Identification
of AM
Fungi
205
S1234567S
Fig. 2. Amplification products of pooled spore preparations of Gigusporu margarita and Scutellospora greguria with primer Operon A- 15 (S’TTCCGA ACCC3’). The sporepreparationswere mixed prior to amplification in various ratios: G. margarita/S. gregaria: l/O (lane 1); 9/l (lane 2); 3/l (lane 3); l/l (lane 4); l/3 (lane 5); l/9 (lane 6); O/l (lane 7). Lane S, fragment size marker @DNA digested with &OR IIHindIII). total DNA template present in the amplification mixture. Experiments where DNA templates of two AM fungal species were mixed, showed clearly that no DNA fragments were amplified from a template that occurred lessthan 10% of the total DNA content in the amplification mixture (Fig. 2). RAPD markers can also be produced using more than one primer in the sameamplification mixture, In this case,the banding patterns can be totally different from thoseproducedby the sameprimers used separately (14). The use of more than one primer in the samereaction mixture may be a valid tool when a limited numberof different primers areavailable. 2. RAPD markers of AM fungal spore DNA: Optimal concentration of AM fungal spore DNA as template for amplification has been found in the 15-20 pg range. This amount is 1OO-to 500-fold lower than the one used for amplification of genomic DNA from other organisms (3). A possible explanation is that the DNA extracts, which are quite crude preparations, may contain componentsthat inhibit the polymerase activity. By diluting the extracts, the inhibitory effects of these compounds, like phenols for example, would be greatly reduced,thus explaining the low optimal DNA concentration.
206
wyss
Inhibitory effects would also explain the high amount of DNA polymerase required even at optimal DNA concentration. It is l&fold the amount compared to phenol/chloroform-extracted DNA of ascomycetous fungi (15). In our experience, the SuperTaq worked well for this kind of amplification and is a highly active enzyme. Enzymes from other suppliers may produce comparable results, but the appropriate concentration for the reaction must be determined. 3. Separation and detection of PCR products: When many samples are to be analyzed, it is convenient to mix DNA sample buffer and amplification products on a sheet of Parafilm. First, 2 pL of DNA sample buffer are pipeted for each sample onto a sheet of Parafilm and to each drop 6 pL of the reaction mixture from all samples. The gel is then loaded usmg the same tip for all samples, rinsed in water or m the electrophoresis buffer between samples. Alternative procedures can be followed to visualize the amplification products on the agarose gel. Instead of staining the gel after electrophoresis,etlndmm bromide can be added either drectly to the agarose solution, or to the samples before loading. In the first case, the agarose powder is dissolved in the electrophoresis buffer and heated. The solution IS then cooled down to 60°C and ethidium bromide is added to a concentration of 1 pg/mL. In the latter case, ethidium bromide is added to the DNA sample buffer to a concentration of 50 pg/mL. The advantage of these procedures is that separation of DNA fragments can be followed directly during the electrophoresis. Agarose gels can be used several times. 4. Similarity calculation: The similarity calculation proposed is the most simple one and can be carried out without any tools but a ruler. With this method, the banding pattern similarity among isolates of different species has been found to range between 5 and 30% and between 40 and 75% among different isolates of the same species (3). The disadvantage of the calculation method proposed consists m the low resolution capacity. Two samples only are compared at a time and it becomes difficult and very time consuming to determine the amounts of common bands among three samples or more in all possible variations. If an extended analysis of this type is needed, videosystems can be used that are on lme with a personal computer equipped with an image analyzing software. In the long run, this type of equipment may well be lessexpensivethan polaroid films (see also Chapter 4).
Acknowledgments The author thanks Paola Bonfante for support and encouragement, Patricia Millner and Luisa Lanfranco for expert assistance, and Silvia Perotto for comments on the manuscript. Funding was provided by the CNR special project RAISA, subproject 2, LN.833 Italy.
Identification
of AM Fungi
207
References 1. Erhch, H. A. (ed.) (1989) PCR Technology* Princzples and Applications for DNA Amplljkations. Stockton Press, New York. 2. Williams, J. G. K., Kubelik, A R., Livak, K J., Rafalsky, L. A., and Tmgey, S. V (1990) DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. N/rcleic Acids Res 18,653 l-6535. 3. Wyss, P and Bonfante, P (1993) Amplification of genomic DNA of arbuscularmycorrhizal (AM) fungi by PCR using short arbitrary primers MycoZ Res 97, 1351-1357. 4. Morton, J. B. and Benny, G. L.( 1990) Revised classtticatton of arbuscular mycorrhizal fungi (Zygomycetes): a new order, Glomales, two new suborders, Glomineae and Gigasporineae, and two new families, Acaulosporaceae and Gigasporaceae, with an emendation of Glomaceae. Mycotaxon 37,47 l-49 1. 5. Harley, J L and Smith, S. E (1983) Mycorrhizal Symbzosis Academic, London 6. Morton, J. B. (1988) Taxonomy of VA mycorrhizal fungi: classification, nomenclature, and identrficatron. Mycotaxon 32,267-324 7. Cooke, J. C., Gemma, J. N., and Koske, R. E. (1987) Observations of nuclei in vesicular-arbuscular mycorrhizal fungi Mycologza 79,33 l-333 8. Becard, G. and Pfeffer, P E. (1993) Status of nuclear divisron in arbuscular mycorrhizal fungi during m vitro development. Protoplasma 174,62-68. 9. Gerdemann, J. W. and Ntcolson, T. W. (1963) Spores of mycorrhizal Endogone species extracted from soil by wet siecing and decanting. Trans Br. Mycol. Sot. 46,235-244.
10. Nei, M. and Li, W. H. (1979) Mathematical model for study genetic variation in terms of restriction endonucleases. Proc Natl. Acad. Sci. USA 74,5267-5273. 11. Innis, M. A , Gelfand, D. H., Snmsky, J. J , and White, T. J (1990) PCR Protocols+ A Guide to Methods and Appkcations. Academic, London. 12. Scannermi, S. and Bonfante, P. (1991) Bacteria and bacteria-like objects in endomycorrhizal fungi (Glomaceae), in Symbtosu as a Source of Evolutionary Innovation * Speczatzon and Morphogenesis (Margulis, L. and Fester, R., eds.), MIT Press, Cambridge, UK, pp. 273-283. 13. Michelmore, R. W., Paran, I., and Kesseli, R. V. (1991) Identification of markers linked to disease-resistance genes by bulked segregant analysis: a rapid method to detect markers in specific genomic regions by using segregating populations. Proc. Natl. Acad. SCZ USA S&9828-9832. 14. Welsh, J. and McClelland, M. (1991) Genomic fingerprintmg using arbitrarily primed PCR and a matrix of pairwise combmations of primers. Nucleic Acids Res. 19,5275-5279.
15 Lanfranco, L., Wyss, P., Marzachi, C., and Bonfante, P (1993) DNA probes for identification of the ectomycorrhtzal fungus Tuber magna&m FEMS Mwroblol Lett. 114,245-252.
CHAPTER17
Establishing Relationships Between Closely Related Species Using Total Genomic DNA as a Probe Kesara AnamthawatJhsson and J. S. (Pat) Heslop-Harrison 1. Introduction Questions regarding species identification, differentiation, and relationships often emerge in biological investigations. One may need to examine the extent of genetic relationships between closely related species for the purposes of resource management or assessment of biodiversity. It may also be important to verify the identity of commercial clones and cultivars used in agriculture and forestry, to detect pathological diseases, or to evaluate evolutionary changes at the molecular and organismic levels. Since interspecific and intergeneric hybridization forms an important part of evolution in many plant species,it is often necessaryto determine the ancestors of polyploids, or the origin of alien chromosomes or chromosome segments in natural and cultivated hybrid derivatives. Total genomic DNA can be used as a molecular probe to differentiate related species and to establish relationships between them. The method described here, referred to as genomic probing, is based on experiments with plant species in the tribe Triticeae, which includes cereal crop species like wheat, rye, and barley (J-6). The method has been used successfully with a wide range of plant species, for example Brassica, Crocus, Citrus, potato, tobacco, and birch and willow tree species (7). Other From
Methods m Molecular /Vuc/ewz AC/d Methods
Bology, Edited
Vol 50 Species by J P Clapp
209
Diagnostics Protocols PCR and Other Humana Press Inc , Totowa, NJ
210
Anamthawat-
Jhsson
and Heslop-Harrison
applications of genomic hybridization include distinguishing bacterial strains (8) and screening infected farm animal tissue for a bacterial disease (9). The application of total genomic DNA was first developed to distinguish human chromosomes in Chinese hamster cells by in situ hybridization of human genomic DNA (10). After the development of pools of probes to paint specific human chromosomes, the method became less widely used, but a development of the method is becoming extremely important in cancer cytogenetics: comparative genomic hybridization (11). In principle, the use of total genomic DNA as a probe is not limited to particular groups of species. Total genomic DNA from closely related species consists of DNA sequences that are common between the species and sequencesthat have diverged evolutionarily and often become species-specific. The proportion of the common and species-specific sequences in a genome, however, differs between groups of species, and this determines the effectiveness of the genomic probing method. The power of the method also depends on the nature of species-specific DNA sequences (12,13). Among cereal species, these sequences are distributed throughout the genome, consisting of dispersed and localized sequences, of low and high copy number, so the genomic probing is informative and quantifiable for discriminating between closely related species. In other genera (e.g., Citrus and Brassica), species-specific sequences tend to be mainly localized, tandemly repeated, satellite sequences and provide insights into specific molecular events that may have occurred during genome evolution. Genomic probing is a method to examine many different components of the DNA in a genome simultaneously. Some 90% of the nuclear DNA of many plant and animal species is nontranscribed, and a high proportion of this DNA may belong to a small number of sequence families. The nontranscribed DNA may evolve and disperse throughout the genome relatively rapidly, and hence analysis of these sequences provides a valuable method to examine changes in genomes during evolution. Here we describe two protocols for genomic probing which have been used successfully with Triticeae species: Southern genomic hybridization for analysis of isolated total genomic DNA, and genomic in situ hybridization for analysis of DNA on chromosomes.
Relationships
Between
Species
211
2. Materials 2.1. Southern Genomic Hybridization 1. Target DNA: Total genomic DNA from a group of taxonomically related species, l-10 pg from each species. The example shown in Fig. 1 includes DNA from Hordeum chilense (wild barley), Se&e afrlcanum (wild rye), and interspecific hybrid H chilense x S. afrlcanum (see Note 1). 2. Probe DNA: Total genomic DNA from one of the target species, for example DNA from H, chilense is used as probe for Fig. 1. The probe DNA should be sheared to the size of 3-10 kb, by drawing the DNA solution about 100 times through a 1-mL syringe fitted with a tine needle, or by sonication. The amount of probe depends on blot size, normally 5 rig/cm*, and it should contain 10 ng/pL of probe DNA and 2 ng/pL of linearized lambda DNA for probing the size marker. Either radioactive or nonradioactive hybridization systemscan be used (see Note 2). 3. Blocking DNA: Total genomic DNA from a species not used as probe, normally a species that has much DNA in common with the probe species. In Fig. 1, S. africanum is used as blocking DNA. Blocking DNA consists of unlabeled, short DNA fragments added in excess amount to a Southern blot to competitively block cross-hybridization between the closely related DNA sequencespresent in both probe and target. The DNA used for blocking needs to be fragmented to about 100-200 bp, for example by autoclaving for 5 mm at 15psi. The amount of blocking DNA is varied, from O-500 times the probe amount (see Note 3). 4. Restriction enzymes: Commonly used restriction endonucleases such as BamHI, DraI, EcoRI, and HzndIII, preferably enzymesthat cleave throughout the whole genome, detect most polymorphism and are methylation insensitive. 5. Southern blot(s) containing 1 pg/lane of restricted and electrophoretically fractionated genomic target DNA, using 0.8% agarose gel in TAE buffer (40 miWTris-HCl, 1rnMEDTA, pH 8). A lane of 100 ng lambda DNA size marker (e.g., Hind111 digest) should also be included. Southern blotting according to nonradioactive ECL method (Amersham, Arlington Heights, IL) requires the following: a. Nylon transfer membrane (e.g., HybondN+, Amersham). b. Depurination solution: 0.25M HCl. c. Alkali transfer buffer: 0.4MNaOH, freshly prepared. d. 2X SSC: 1OX dilution of the stock 20X SSC (3MNaCl,0.3M trisodium citrate, pH 7 adjusted with 1MHCl).
212
Anamthawat-Jcinsson
and Heslop-Harrison
Fig. 1. Southern hybridization of H. chiknse total genomic DNA probe to a target blot containing DraI restricted and fractionated total genomic DNA digests from H chilense (lane 3), S. africanurn (lanes 1,9), hybrid H. chilense
Relationships
Between Species
213
6. Probe labeling, Southern hybridization, and detection by ECL method: Use ECL kit that contains probe labeling reagents, hybrtdtzation buffer, and detection reagents. 7. Hybridization buffer, 0.2 mL/cm2: Add NaCl to the ECL hybridtzatlon buffer for stringency control, 0.1-0.5M final concentration (see Note 4 for estimation of stringency). 8. Stringent wash buffer, 2 x 2 mL/cm2: 6Murea, 0.4% (w/v) SDS (sodium dodecyl sulfate), 0.1X to 0.5X SSC (see Note 4). 9. X-ray film, exposure cassette,and standard film developing chemicals.
2.2. Genomic
In Situ Hybridization
1. Target DNA: Chromosome preparations from dividing cells contammg chromosomes originating from more than one parental or ancestral species, such as interspecific sexual hybrids, materials containing ahen chromosome transfers, somatic hybrids by protoplast fusion, hybrid cell lines, or polyploid species. The example shown in Fig. 2 is a derivative of a sexual hybrid Triticum aestivum (bread wheat) x Leymus arenarzus (lymegrass) (see Note 5). 2. Probe DNA: Total genomic DNA from one of the species present m the chromosome preparations, for example DNA from L. arenarius is used as probe for Fig. 2. The probe DNA is sheared the same way as m step 2 of Southern genomic hybridization. The amount of labeled probe used per slide is 100-300 ng.
x S. ufvicanum (lane 2), and mixtures of DNA digests H. chzlense*S afrzcanum by lO:l, 5:1, l:l, 1:5, and 1:lO (lanes 4-8). (A) Ethrdmm bromide stained gel showing simtlar amount of DNA loading, 1 pg/lane. (B) Lummograph of the Southern genomic probing without blocking DNA, using 82% hybridtzatron stringency and a 3-min exposure on film. (C) Luminograph of the same blot after reprobing using the same hybridization stringency and exposure time as in B, but this time receiving unlabeled blocking DNA from S. afrzcanum, 550 times the probe amount. The luminographs show that genomic probing is able to differentiate the two related species (H, chilense and S. afncanum) based on strength of probe hybridization signal--strongest signal on H. chilense and least on S. afrzcanum lanes, whereas the hybrid lane shows intermediate srgnal strength. Species identification is confirmed with the ladder-like H chilense specific bands of about 350-bp intervals. The effect of blockmg IS demonstrated in Table 1, where the amount of probe hybrtdtzation m all lanes corresponds to the expected amount of probe DNA in the target.
214
Anamthawat-Jo’nsson
and l&slop-Harrison
Fig. 2. Fluorescent photomicrograph showing chromosomesfrom a root tip cell of a hybrid derivative T. aestivum x L. arenarius, after genomic in situ hybridization using digoxigenin-labeled total genomic DNA from L. arenarius as probe and unlabeled total genomic DNA from T. aestivum as block, 5x the probe amount. Chromosomesoriginating from the probe species(L. arenarius) are seenhere with bright fluorescenceof probe hybridization, whereaschromosomesfrom T. aestivum show an insignificant amount of probe hybridization and hence stained by propidium iodide (seenas darker chromosomes). 3. Blocking DNA: Total genomic DNA from a related species which is not used as probe. In the case of Fig. 2, the blocking DNA comes from T. aestivum. Blocking DNA is fragmented the same way as in step 3 of Southerngenomic hybridization; and usedat a concentrationup to 50 times the probe amount (seeNote 6). 4. Probe labeling with digoxigenin by nick translation (see Note 7): All reagentsin the following can be stored at -20°C: a. Mixture of digoxigenin- 11-dUTP (Boehringer Mamiheim, Mannheim, Germany, 1 Wstock) and dTTP to the final concentration of 0.35 and 0.65 mM, respectively. b. Unlabeled nucleotide mixture (10X): Prepare a mixture containing dATP, dCTP, and dGTP, 0.5 Weach, in 100 mMTris-HCl, pH 7.5.
Relationships
Between Species
215
c. Nick translation buffer (10X): Prepare a buffer containing 0.5M TrisHCl, pH 7.5, 0.05MMgC12 and 0.5 mg/mL nuclease free bovme serum albumin (BSA). Filter sterilize. d. DTT (1,4-dithiothrertol), 100 m&f. e. Labeling enzyme mixture (1OX): Use DNA polymerase I and DNase I mixture for nick translation from Gibco-BRL (Gaithersburg, MD). 5. Hybridization chamber: A box with lid, in which slides can be placed above pads of tissue paper soaked with 2X SSC. This chamber is used for both denaturation and hybridization, e.g., floating in water bath. Here we use a modified programmable temperature controller (e.g., from Hybaid UK). The program is set to perform combined (probe and target) DNA denaturation for 10 min at 87-89°C (depending on species; older slides need higher temperature), then dropping of temperature to 40°C in five steps with 10°C intervals and maintaining the temperature at each step for 1 min, and finally, holding the temperature at 37°C for hybridization for 8-16 h. 6. In situ hybridization: a. 20X SSC and 2X SSC. b. RNase solution, 0.1 mg/mL: Dilute the 10 mg/mL RNase A stock solution with 2X SSC, prepare fresh. The stock solution prepared m 10 r&l4 Trts-HCl, pH 8, 15 mM NaCl, and boil for 15 min to inactivate residual DNase c. Paraformaldehyde 4% (w/v): Add 4 g m 80 mL distilled water, in a fume hood, heat to 70-80°C for 10 mm, add 1 or 2 drops of 1MNaOH to clear the solution, and adjust the volume to 100 mL. Prepare fresh. d. Ethanol series: Prepare 70, 90, and 99% ethanol. Keep at -20°C. e. Formamide: Use high grade formamide (e.g., Sigma [St. Louis, MO] F7508 or Merck [Darmstadt, Germany] 9684). Make aliquots and store at -2O’C. The formamide concentration in hybridization buffer is between 55 and 60% (see Note 8 for stringency). f. Dextran sulfate, 50% (w/v): Dissolve dextran sulfate in distilled water, heat to 70°C to help dissolvmg. Filter sterilize. g. 10% (w/v) SDS. Filter sterilize. 7. Washing and detection: a. 2X SSC. b. Stringent wash solution: 50% (v/v) formamide, 2X SSC. Prepare fresh (see Note 8). c. 4X SSC, 2% (v/v) Tween-20. d. BSA, immunoglobin free, 5% (w/v): Prepare fresh in 2X SSC, use about 150 pL/slide.
216
Anamthawat-Jbnsson
and Heslop-Harrison
e. Antidigoxigenin-FITC in 5% BSA. Dilute the stock antidigoxigeninFITC (antibody raised m sheep, Boehringer Mannheim, 200 pg/uL) according to batch recommendation. Usually, 1:9 dilution gives good results. Use 50 uL/shde, prepare fresh, and keep away from light. f. Propidium iodide, 2 ug/mL: Dilute 100 pg/mL stock in 4X SSC. Prepare fresh and use about 100 pL/slide. g. Antifade mountant: For example, Vectashield (Vector Laboratories, Burlmgame, CA). 8. Fluorescence photomicroscope with filter block for green excitatton (excitation 450-490 run; emisston), and fluorescence objectives 25 and 100x 011. 9. Photographic 35-mm print film: FUJI Super G 400 or Kodak Ektar 1000.
3. Methods 3.1. Southern Genomic Hybridization 1. Southern transfer: a. Depurmate the restricted and electrophoretically fractionated DNA m agarose gel for 25 mm at room temperature (RT) and rinse three times with distilled water. b. Transfer the DNA onto nylon membrane usmg the alkali transfer buffer for at least 4 h (see Chapter 24 for more detatls of Southern transfer). Rinse the Southern blot m 2X SSC. 2. Prehybridizatton and genomic DNA blocking: a. Incubate the blot in the hybridization buffer, m a box or sealed bag, at 42°C for 30 mm, in a shaking water bath with a speed of 60 strokes/mm. b. Denature the unlabeled blockmg DNA by boiling for 7 mm, followed by cooling on ice for 5 min and centrifuge briefly. c. Add the denatured blocking DNA to the blot by mixing the DNA well into the hybridization buffer. Allow the prehybridization to continue for another 30 mm. 3. Probe labeling: a. Denature the probe DNA by boiling for 7 mm and cooling on ice for 5 min and centrifuge briefly. b. Label the denatured probe according to the ECL mstruction, which takes about 10 min at 37°C. 4 Hybridization: a. Add the labeled probe to the prehybridtzed blot by mixing the probe into the buffer containing the blocking DNA. b. Seal the bag agam and allow the hybridization to carry on in the shakmg water bath at 42°C overnight or at least 8 h.
Relationships
Between Species
217
5. Washing: Wash the blot in the stringent wash buffer twice, 20 min each, at 42°C in a shaking water bath. Rinse in 2X SSC twice, 5 min each, at RT. 6. Detection and exposure on film: According to the ECL instruction. We normally make several exposures on film, between 1 and 10 min, to get luminographs of different signal intensity, from underexposed signal to saturation. 7. Reprobing: a Wash an exposed blot for about 1 h at 37--42”C, in a stringent wash buffer that gives higher stringency than previously. b. Rinse in 2X SSC and the blot is now ready for the next hybridizatton (see Note 9) 8. Signal quantification: Lummographs wtth short exposure time (where the most intense areas on film are not quite black) can be measured quantitatively with a computerized image scanning instrument. Here it is important that all lanes in the gel contain similar amounts of target DNA and that the blot includes DNA from the probe species, the block species, and an unrelated species as a negative control. 3.2. Genomic In Situ Hybridization 1. Probe labeling with dtgoxigenin by nick translation. a. Prepare 50 PL of probe labeling reaction m a microfuge tube, using 1 pg of sheared total genomic DNA probe, 1 ltL of digoxigenin- 1ldUTP/dTTP, 5 pL of 10X unlabeled nucleotide mixture, 5 p.L of 10X nick translation buffer, 1 pL of DTT, sterile water to make 45 PL vol, and after mixing all ingredients add 5 PL of the labeling enzyme mixture. b. Incubate the reaction mixture at 15OCfor 1.5 h. c. Stop the reaction with 5 pL of 0.3M EDTA. d. Precipitate the DNA by standard ethanol precipitation method and resuspend the DNA pellet in 10 pL 1X TE buffer pH 8 (see Note 10 for probe test). 2. RNase treatment of chromosome preparations. a. Apply 200 pL of RNase solution on each slide, place coverslip, and incubate in a humid chamber for 1 h at 37OC. b. Remove coverslips and wash the slides in 2X SSC in Coplin jar for 5 min twice (if glass coverslip is used, allow the slide to stand in the 2X SSC buffer for few minutes until the coverslips fall off). 3. Paraformaldehyde fixation. a. Transfer slides from the last 2X SSC buffer to the paraformaldehyde solution in Coplin Jar and incubate for IO min at RT in a fume hood. b. Rinse the slides briefly in 2X SSC at RT.
218
4.
5.
6.
7.
Anamthawat-Jbnsson
and Heslop-Harrison
c. Dehydrate the slides by sequentially replacing the 2X SSC solution with cold 70% ethanol, then with 90 and 99%, 2 mm each. Air dry the shdes. Hybridization. a, In a microfuge tube, prepare 30 pL of probe hybridrzatron mtxture per slide, using 100-300 ng of labeled probe, concentrated blocking DNA (up to 50 times the probe amount), 18-20 FL of formamrde (57-60%), 6 pL of 50% dextran sulfate, 3 pL of 20X SSC, 1 pL of 10% SDS, and sterile water if needed to make up the volume. Mix the components of the probe mixture well, centrifuge briefly, and keep on ice. b. Apply the probe mix onto each slide and place coverslip gently without trapping air bubbles. c. Place the slides m the preheated humid chamber m the temperature controller and run the mstrument to perform the combmed denaturation for 10 mm at 89°C (for Fig. 2) and hybridization at 37°C overnight. Washing. a. Place the slides in 2X SSC, in Coplin jar, to allow the coverslips to fall off and wash them further in 2X SSC for 3 mm at 37°C. b. Wash m the stringent formamide buffer for 10 min at 37°C. Agitate regularly. c. Wash in 2X SSC for 5 mm at 37”C, then twice m 4X SSC with Tween, 5 min each, also at 37°C. Detection and counterstaming. a. Apply 100 pL of 5% BSA to each slide and incubate for 5 minutes at RT. b. Tip off the BSA solution and apply 50 PL of antidigoxigenm-FITC to each slide. Place covershp. Incubate in a humid chamber for 1h at 37°C. c. Wash in 4X SSC with Tween, in Coplin jar, twice for 5 min each at 37”C, then bring to RT. d. Apply 100 PL of propidium iodide onto each slide and, after 1 mm at RT, rinse briefly with distilled water and allow to air dry for about 10 min. e. Place a drop of antifade onto the chromosome preparation, place on a glass coverslip, and squeeze out an bubbles if needed. Visualization and photography: Examine the slides in the fluorescence microscope, using objective 25x to scan the cells and 100x to view the fluorescent stgnal and to make photographs. Fluorescem FITC and the counterstain propidmm iodide are examined under the same wavelength. Exposure trme for photography depends on signal mtensity and film speed: 20-45 s for high-speed films,
Relationships
Between
Semiquantitation DNA digests
Species
219
Table 1 of Southern Genomic Hybridization
Percent signal/ unblocked Hc
Unblocked lanes (Fig 1B) Sa 27 HcxSa 64 Hc 100 Hc:Sa = 10: 1 90 Hc:Sa = 5:l 94 Hc:Sa = I:1 71 Hc:Sa = l-5 40 Hc:Sa = 1.10 27 Sa 25 Lanes blocked with Sa (Fig. 1C) Sa 5 Hc x Sa 28 Hc 61 Hc.Sa = 10.1 54 Hc:Sa = 5:l 59 Hc:Sa = 1:l 33 HcSa = 1 5 11 Hc:Sa = 1:lO 5 Sa 3
in Fig. la
Percent signal/ blocked Hc
Percent signal expected
8 46 100 88 97 54 18 8 5
0 42 100
90 80 50 10
5 0
aThe amount of hybrtdtzatton of H chzlense genomtcprobewasmeasured wrth a computerbasedimagedtgmzmgsystemandcalculatedrelativeto the hybridrzattonto the unblocked(Fig 1E3) andblocked(Fig lC-3) H chzlense lanes.Hc. H chzlense, Sa. S ufrzccznum, Hc x Sa: hybrid betweenthetwo species,andHc , Sarepresents a mixture of genomtcdigestsby the ratio of DNA amountasindicated The expectedamountof hybrrdtzattonwasestimatedbasedon genomesize
3.3. Interpretation
of Data
3.3.1. Genomic Probing
Examples of genomic probing are shown in Fig. 1, by Southern hybridization with a semiquantitative analysis (Table 1) and Fig. 2, genomic in situ hybridization where chromosomes of different species origin are identified. In Fig. 1, H. chilense and 5’. africanurn are differentiated clearly after genomic probing with high stringency (B), by probe hybridization intensity and the ladder-like characteristic of H. chdense. With blocking (C),
220
Anamthawat-Jdnsson
and Heslop-Harrison
the differentiation IS enhanced, although it may seem insignificant because the overall probe hybridization intensity is reduced. This blockmg effect is verified in Table 1, where the signal intensity after blocking corresponds very closely to the expected amount of hybridization based on genome size. In addition, the interspecific hybrid shows the expected intermediate intensity of probe hybridization and species-specificcharacters. In Fig. 2, the genomic probing, with blocking, distinguished between chromosomes of different species origin in this wheat hybrid derivative by probe hybridization intensity. The uniform labeling of the Leymus chromosomes indicated that the genomic DNA probe hybridized to sequences that are dispersed throughout the whole genome, and these sequences consist of repetitive and nonrepetitive DNA families. The interpretation agrees with the results from the Southern hybridization experiment (Fig. l), where the genomic probe hybridized both to highly repeated DNA families, which appear as bands on the membrane, and to less repetitive sequences, which gave rise to smear of restriction fragment lengths. The use of unlabeled total genomic DNA to block sequences shared between related species increased the specificity of genomic probing, by both Southern and in situ hybridization (Figs. 1 and 2). These common (blocked) sequences appeared to be distributed throughout the whole genome also. When blocking DNA was added to Southern blot, the level of smear reduced its intensity of hybridization and species-specific bands became more visible (cf Fig. 1A, B). On chromosomes of the hybrid H. vulgare x H. bulbosum (6), genomic probing without block could not distinguish chromosomes of different species origin on the basis of probe hybridization alone, but with blocking DNA the differentiation became apparent. There, the common sequences were shown to be dispersed in the genome. The main effect of blocking may be due to hybridization between: the probe and the target DNA, the block and the target, or the combination of both. Steric hindrance may also enhance the blocking effect, especially on Southern blots where the blocking begins during the prehybridization. Although not a focus of this chapter, the technique of comparative genomic hybridization (II) used in analysis of human cancers is important to discuss. It is well known that loss or amplification of whole chromosomes, chromosome arms, or segments is common in cancers (14). Depending on the changes, there may be a different prognosis and pro-
Relationships
Between Species
221
gression of the disease, and treatment may be different. However, it is difficult to make high-quality chromosome preparations from solid tumors, and single metaphases may not be representative of the chromosomal constitution of the whole tumor. Therefore, a modified genomic in situ hybridization system is used following extraction and differential labeling (e.g., with red and green fluorochromes) of DNA from the tumor and from normal human cells. The two probes are then hybridized to standard metaphase spreadsmade from lymphocyte cultures, and regions of amplification and deletion stand out by labeling either red or green, compared to the brown color of chromosomes or chromosome segments present equally in normal and tumor cells. Currently, many analytical techniques are being applied to analysis of these results, and novel data about chromosome regions implicated in cancers is being produced.
3.3.2. Applications and Limitations Genomic probing is particularly useful for differentiating closely related species, detecting introgression of chromosome and chromosome segments, and examining ancestors of hybrid species. The method is also valuable when no specific probes are available or when dealing with species that have limited prior knowledge of their molecular characteristics. The amount of probe hybridization can be used to determine the extent of introgression or species relationships, after dot-blot analysis or Southern hybridization (I-3). Particular types of DNA sequencesthat involve in the genomic probing can also be examined and isolated, and the resulting species-specific clones are useful as probes for further characterization of species relationships (13). Genomic in situ hybridization is very effective for species discrimination and provides fi.&her knowledge about genome organization and relationships (I-4); can reveal important chromosomal changes such as translocations, amplifications, or losses (6,151; and can test for interspecific hybrid origin in plant breeding programs or the incorporation of alien chromosomes or chromosome segments carrying desirable traits (5). Chromosome preparations for in situ hybridization are quite straightforward (16) and the in situ hybridization procedures can now be automated. To establish relationships between closely related species, the genomic probing can be used together with repetitive DNA probes (13,I7). Many eukaryotic species have relatively large genome size and most of their DNA is repetitive, noncoding, and polymorphic. Dispersed repetitive
222
Anamthawat-Jdnsson
and Heslop-Harrison
DNA probes, for example satellite sequences or retrotransposon-like sequences, may be used for cladistic analysis based on differences in base sequence and copy number. Intergenic noncoding regions in ribosoma1 gene repeats have already been used extensively for constructing phylogenetic relationships between taxonomically related species. The genomic probing also has limitations: Species-specific sequences may be restricted to only particular types, such as localized and tandemly repeated DNA, rather than comprising of diverse types and distributed over the whole genome. Although this is useful for evaluating species relationships based on molecular evolution at specific chromosomal regions, they can not represent the whole genome nor can be used for detecting unknown chromosome transfers and translocation breakpoints. The method may not be sensitive enough if the closely related species are barely diverged or the species hybridize extensively. In such situations, genomic probing can be used to identify species-specific DNA sequences, which can then be isolated and used as probes for species characterization without the cross hybridization (13).
4. Notes 1. RNA free total genomic DNA can be isolated by standard methods. We use phenol-chloroform or CTAB isolation protocols without further purtfication with cesium chloride. The number of related species may be as many as can possibly be loaded on the same gel. 2. We get the same results from using the standard [32P]isotopic method and the nonradioactive chemiluminescence method (ECL, Amersham) for Southern genomic probing. However, here we use the ECL method because it can yield different exposures amenable to quantitative analysis of results. The ECL method mvolves rapid labeling of heat-denatured DNA probe with a modified horseradish peroxidase by glutaraldehyde crosslinkmg, hybridization in urea-saturated buffer containing a varying concentration of salt for stringency control, and detection by chemiluminescence of luminol oxidation catalyzed by the horseradish peroxidase at the hybridization sites, where the emitted light of 428 nm can be captured on X-ray film within 1 h of emission. 3. For the first use of genomic probing, the amount of blocking DNA required can be estimated experimentally by dot-blot analysis. In the cereal group, to differentiate between speciesbelonging to the same genus, 300-600X blocking DNA has been used, whereas 0-300X of blocking DNA is sufficient to differentiate between species of different genera.
Relationships
Between Species
223
4. Strmgency control is very important m genomic probing. In some situations, e.g., to distinguish between genera in the cereal group or between taxonomic secttons within a genus, the control of stringency alone is often effective without blocking DNA, because the DNA sequences are sufficiently nonhomologous that the amount of probe hybridization to the species is different. And where the blocking DNA is required, the correct control of stringency increases the dtfferentiation significantly (Fig. 1). Stringency refers to the degree to which reaction conditions favor the disassociatton of nucleic acid duplexes and may be enhanced, i.e., by increasing temperature, decreasing salt concentration, and increasing formamide or urea concentration-duplexes with high homology withstand high stringency conditions better than duplexes with low homology. The ECL method, which uses saturated urea and low temperature, can be adjusted to provide a desired stringency by varying salt concentration (Na+ in NaCl or SSC). For cereals, estimated stringency of hybridization for the ECL method is: 78,80,82,85, and 90% for 0.5,0.4,0.3,0.2, and O.lMNaCl in the hybridizatton buffer. And the washing stringency is 86,89,9 1,94, and 97% from the wash buffer containing 0.5X, 0.4X, 0.3X, 0.2X, and 0.1X SSC, respectively. These stringencies are calculated, using 45.5% G + C nucleotides of cereals, 500-bp long ECL-labeled probe and an equivalent of 50% formamide for 6M urea (18). We use washing stringency higher than that of the hybridization and find that simple formula as 0.5M NaCl/ 0.5X SSC, or 0.4MNaC1/0.4X SSC and so on, works well with genomtc probing, and this formula provides about 8% higher stringency during the washing than the hybridization. 5. Chromosomes are prepared by enzymatic method (16), using root tips pretreated for 24 h in ice water to arrest metaphases, and digested with cellulase and pectinase to remove most of the cell walls and cytoplasm. 6. The blocking is essentially more effective on chromosomes than on Southern blots, probably because the target DNA originating from different species is located on different chromosomes or chromosome segments,whereas on Southern blot the target DNA is sorted out by fragment lengths, and common and species-specific sequencescould be mixed. Hence, m the cereal group, the blocking applied is not as much as used in Southern experiments. The amount of blocking DNA depends on species involved-much less is required to distmguish between chromosomes of different genera (e.g., 5X in Fig. 2) than between chromosomes of specieswithin a genus, e.g., 36X (6). 7. Total genomic DNA probe can be labeled m different ways-isotopic or nonradioactive methods, by nick translation, random priming, or polymerase chain reaction (PCR), using reporter molecules such as biotin and digoxlgenin or direct labeling with fluorochrome conjugated nucleotides. Methods
224
Anamthawat-Jcinsson
and Heslop-Harrison
VI Molecular Biology, vol. 28 (19-21) describes several protocols for nonradioactive methods of probe labeling and in sztu hybndlzatlon. 8. The stringency of genomic zn situ hybridization is often higher than that used for in situ hybridization of cloned DNA probes, aiming to reduce cross-hybridlzatlon between related DNA sequences. Using the same formula for stringency estimation (Z4), see Note 4, the hybrldlzatlon condltlons here allow sequences that have homology of about 80% or higher to form stable DNA hybrid duplexes. The washing condltlon provides simllar degree of stringency as the hybridization. 9. It 1san advantage if the exposed blot can be reprobed several times, using the same or different probes, with or without blocking DNA, and also for reverse probing (where probe and block species are reversed), because it can provide more detailed molecular information about the relationships between the closely related species.It 1soften useful to reprobe with cloned repetitive sequences mcludmg rDNA to give more information about the genome. 10. The labeled probe can be examined for the incorporation of digoxlgemn nucleotldes by dot-blot analysis (18), most conveniently using the DigDNA detection reagents from Boehrmger.
Acknowledgments We thank T. Schwarzacher and A. R. Leitch for their significant contribution and experience with the genomic probing method. We also thank B. S. Gill for the plant material used m Fig. 2 and M. Orgaard for the labeled Leymus genomic probe.
References 1 Schwarzacher, T., Leltch, A R., Bennett, M D., and Heslop-Harrison, J S (1989) In situ iocalizatlon of parental genomes m a wide hybrid. Ann Bot 64,3 15-324 2 Anamthawat-Jbnsson, K , Schwarzacher, T , Leltch, A. R., Bennett, M D., and Heslop-Harrison, J S. (1990) Dlscrlminatlon between closely related Trzticeae specles using genomic DNA as a probe. Theor Appl. Genet 79,721-728. 3. Heslop-Hanson, J S., Leitch, A. R., Schwarzacher, T , and Anamthawat-Jbnsson, K (1990) Detection and characterization of lB/lR translocations m hexaplold wheat Heredity 65,385-392. 4. Leitch, A. R., Schwarzacher, T., Mosgoller, W., Bennett, M D , and HeslopHarrison, J. S (1991) Parental genomes are separated throughout the cell cycle m a plant hybrid. Chromosoma 101,206-2 13. 5. Schwarzacher, T., Anamthawat-Jbnsson, K , Harrison, G. E , Islam, A K. M. R., Jia, J 2 , Kmg, I. P., Leltch, A R., Miller, T. E., Reader, S M., Rogers, W. J., Shi, M , and Heslop-Harnson, J S. (1992) Genomic m sztu hybndrzation to identify ahen chromosomes and chromosome segments in wheat Theor Appl Genet 84,778-786 6 AnamthawatJbnsson, K,, Schwarzacher, T , and Heslop-Harrison, J S (1993)
Behavior of parental genomesin the hybrid Hordeum vulgare x H bulbosum J Heredity 84,78-82.
Relationships
Between Species
225
7 Heslop-Harrison, J. S. and Schwarzacher, T. (1993) Molecular cytogenetrcs-biology and applications in plant breedmg, m Chromosomes Today, vol 11 (Sumner, A. T and Chandley, A C , eds.), Chapman and Hall, London, pp. 191-198. 8. Yap, K W., Thompson, R C A, and Pawlowski, I. D (1989) The development of nonradioactive total genomrc probes for the strain and egg differentiation m taeniid cestodes. Am J Trop Med Hyg 39,472-477. 9. Hopper, B. R., Sanborn, M. R , and Bantle, J A (1989) Detection of Brucella abortus in mammalian tissue, usmg biotinylated, whole genomic DNA as a molecular probe. Am J Vet Res. 50,2064-2068 10. Pinkel, D., Straume, T., and Gray, J W. ( 1986) Cytogenetic analysts usmg quantttative, high-sensittvtty, fluorescence hybndizatron Proc Nat1 Acad Scz. USA 83,2934-2938. 11. Kalltomemi, A , Kalhomerm, 0 P , Sudar, D., Rutovitz, D., Gray, J W., Waldman, F., and Pmkel, D. (1992) Comparative genomic hybrtdization for molecular cytogenetic analysis of sohd tumors Science 258, 8 18-82 1. 12. Anamthawat-Jonsson, K. and Heslop-Harrison, J. S. (1992) Species specific DNA sequences m the Trztzceae Heredztas 116,49--54 13 Anamthawat-Jonsson, K and Heslop-Harrison, J S. (1993) Isolation and characterization of genome-specific DNA sequences in Trztzceae species. Mol Gen. Genet 240,151-158 14. Eyfjord, J E , Thorlacms, S., Stemarsdottu-, M., Valgarosdottir, R., Ogmundsdottir, H. M., and Anamthawat-Jonsson, K (1994) P53 abnormalities and genomic mstability m primary human breast carcinomas Cancer Res 55, 646-65 1 15 IZlrgaard, M. and Heslop-Harrison, J S (1994) Investigations of genome relationships between Leymus, Psathyrostachys, and Hordeum inferred by genomic DNA:DNA zn sztu hybridization. Ann Bot 73, 195-203. 16 Schwarzacher, T and Lettch, A. R. (1994) Enzymatic treatment of plant material to spread chromosomes for znsztu hybndtzatton, m Methods zn Molecular Bzologv, Vol 28 Protocols for Nuclezc Acid Analysis by Nonradioactzve Probes (Isaac, P. G., ed.), Humana, Totowa, NJ, pp 153-160. 17. IZlrgaard, M and Heslop-Harrison, J. S (1994) Relationships between species of Leymus, Psathyrostachys, and Hordeum (Poaceae, Trzticeae) inferred from Southem hybridization of genomic and cloned DNA probes. Plant Syst. Evol 189,2 17-23 1. 18. Memkoth, J. and Wahl, G (1984) Hybrtdtzation of nucleic actds mnnobilrzed on solid supports. Anal. Bzochem. 138,267-284. 19. Karp, A. (1994) Use of biotm-labeled probes on plant chromosomes, in Methods in Molecular Bzology, Vol 28. Protocols for Nuclezc Aczd Analyszs by Nonradzoactzve Probes (Isaac, P. G., ed ), Humana, Totowa, NJ, pp 161-166. 20. Schwarzacher, T. and Heslop-Harrison, J. S. (1994) Dtrect fluorochrome-labeled DNA probes for direct fluorescent zn sztu hybridization to chromosomes, m Methods zn Molecular Bzology, Vol 28, Protocols for Nuclezc Acid Analysis by Nonradioactive Probes (Isaac, P G., ed.), Humana, Totowa, NJ, pp. 167-l 76. 2 1. Leitch, I. J. and Heslop-Harrison, J S (1994) Detection of digoxigemn-labeled DNA probes hybridized to plant chromosomes in situ, m Methods zn Molecular Bzologv, Vol. 28. Protocols for Nuclezc Aczd Analysis by Nonradzoactive Probes (Isaac, P. G., ed.), Humana, Totowa, NJ, pp. 177-185.
CHAPTER18
Detection and Characterization of Leishmania Parasites by DNA-Based Methods Southern Blotting
and PCR
Guillaume J. J. M. Van Eys and Stefanie E. 0. Meredith 1. Introduction Leishmaniasis is a parasitic disease that is difficult to diagnose. This IS owing to the low number of parasites observed in clinical samples and the similarity of parasites that cause different clinical symptoms. Previously, culturing was necessary to identify the parasites with techniques such as isoenzyme analysis. DNA-based techniques have been tested for detection and identification of leishmaniasis. Southern blot analysis, dot-, spot-, or squash-blot, in situ hybridization and polymerase chain reaction (PCR) all have contributed to a better identification and/or detection of Leishmania parasites (I). As a first step in the application of DNA-based technology for detection and characterization of Leishmania parasites, total DNA probes have been employed in dot-blot and in situ hybridization (1,2). Because of their lack of specificity, such probes are no longer used. Dot/slot/squashblot and in situ hybridization are still used in applying kinetoplast minicircle DNA @DNA) probes, but in the near future they will be replaced by PCR (3-5). Eventually, Southern blotting analysis with genomic or kDNA From Methods PCR and Other Nuclerc
m Molecular Biology, Aad Methods E&ted
Vol 50 Specres Dagnostlcs Protocols by J P Clapp Humana Press Inc , Totowa,
227
NJ
228
Van Eys and Meredith
probes will be used as a reference technique to characterize Leishmania
strains and PCR will be used for detection and primary identification. The other methods will only be employed to answer specific questions. 1.1. Identification by Southern Blotting Analysis In principle, the characterization of leishmaniases has been based on the clinical symptoms caused by the parasites. Manifestations of infections with Leishmania parasites can vary depending on such factors as
immunity of the host and nutritional state. However, the major factor in the developing pathology is the parasite itself. Presently, four complexes of Lezshmania are distinguished: 1. L donovani,
L. Infanturn, and L chagasz, the etlological
agents of visceral
leishmaniasis; 2. L
troplca,
L
aethloplca,
and L
major
of Old
World
cutaneous
leishmamasis, 3. The L brazilzenszs complex, cause of cutaneous and mucocutaneous dis-
ease m Central and South America; and mexicana and L mexlcana amazonensw, parasites causing cutaneous leishmamasis in the Americas.
4 L mexicana
Based on distinctive characteristics, different
species and strains are
described within each complex. Methods that have been applied to come to a classification of Leishmania include isoenzyme analysis, serotypmg, buoyant density of nuclear and kinetoplast DNA, restriction analysis of kDNA, karyotyping, and Southern analysis with kDNA and nuclear DNA probes. Of these methods, isoenzyme analysis has been the method of choice over the past decade, and is now gradually complemented or replaced by DNA-based characterization. Isoenzyme analysis has been used frequently to type Leishmaniu strains and a classification based on zymodemes has been developed. At present, the method screens for a considerable number of isoenzymes and more than 100 different zymodemes have been described. This has advantages for epidemiological studies, since it allows a precise determination of a particular strain and accurate monitoring of the dynamics of parasite populations. However, the technique has become inefficient for clinical characterization of Leishmania and has drawbacks for the classification of new zymodemes. Therefore, a number of DNA probes have been tested for identification of Leishmania isolates (68). Analysis of kDNA has shown considerable intrataxon variations in minicircle sequence and conse-
Detection of Leishmania
229
quently in restriction patterns and hybridization efficienctes (.5,9-II). Thus, application of kDNA largely will have the advantages and disadvantages of isoenzyme typing. Like rsoenzyme analysis, methods such as kDNA restriction analysis and karyotyping, stressdissimilarities rather than compile Leishmania isolates in biologically distinct groups. For Southern blotting, the level of diversification can be controlled by the choice of the probe DNA. Nuclear DNA contains sequences of various levels of conservation. Selection of sequences shared by strains belonging to a particular taxon or displaying a specific clinical manifestation has produced probes for characterization of Leishmania isolates. Some sequenceshave been demonstrated to be taxon specific (6). Others are more conserved and have revealed restriction fragment polymorphisms (RFLPs) useful for classification at taxon and species level, or (with rRNA probes) at subspecies level (Van Eys, unpublished results). Classification obtained by Southern blotting analysis has been demonstrated to be largely in agreement with that derived from isosenzyme analysis (6-8). 1.2. Detection of Leishmania Parasites As for isoenzyme typing, culturing is necessary for Southern analysis. Therefore, methods have been tested to combine clinicallly relevant characterization with a sensitive detection assay. With the advent of the PCR, this has come within reach. PCR has been demonstrated to provide higher sensitivity (and specificity) than other methods used for diagnosis of infectious diseases (4,12-I@. The technique has several advantages over other detection methods, especially in the field situation. The execution of the technique is rather simple, only small samples of target material are needed, no diagnostic probes, expensive labels, or culturing are used, and the assay can be performed within a few hours. However, PCR depends on the generation of specific primers. The sensitivity of the PCR assay can be increased by the use of primers that are based on DNA sequences that have more than one copy per cell. For Leishmania, those sequencescomprise kinetoplast minicircle DNA, repeats, and multicopy gene families. Several groups have published primer sequences for the different Leishmania complexes, taxa, and strains (4,12,16,17). Sequence data in kinetoplast minicircle have allowed the selection of primers from the conserved part of the minicircle, reacting with all Leishmanias, as well
Van Eys and Meredith as primer specific for Leishmania isolated of a particular taxon and geographical origin. There are reports of kDNA primer sets that are taxon specific, but their specificity has not been confirmed. Our group has generated several sets of kDNA-derived primers that showed a geographical rather than a species specificity (unpublished results). Leishmania nuclear DNA sequencesare difficult to apply in routine assays if derived from single copy genes. Of the sequences belonging to the multicopy group the sequence of the small subunit ribosomal RNA (SSUrRNA) or 16s rRNA is one of the most studied. The gene has been sequenced for over hundred species, among which are all Leishmania taxa, Trypanosoma brucei, Trypanosoma cruzi, and Critidia fasciculata (1618-24). Comparison of the published sequences of the gene in human (host), arthropods (vector), and Kinetoplastidae (parasites) indicated that only about 800 bases in the central part of the gene show considerable heterology (18). This central part of the SSUrRNA gene was selected as target for a PCR assay. In addition to about 100 copies of the rRNA genes in the DNA, more than 10,000 SSUrRNA molecules are present as target for a reverse transcriptase PCR. 2. Materials 2.1. Southern Blotting Analysis 1. TE buffer: 10 mMTrn+HCl, pH 7.5, 1 mA4EDTA. 2. Lysis buffer: 50 mMNaC1, 10 mJ4 EDTA, 50 mMTris-HCl, pH 7.4. 3. Phenol (buffered) I: This buffer can be used for RNA and DNA. If you start with ultrapure phenol,you can omit recrystahzing. Heat the phenol until it melts, then add the other components. Mix well, let stand until the phases are separated, and store at -20°C: 100 g phenol, 25 mL 2M TrisHCl, pH 8.0, 32 mL ultrapure water, 250 pL 14M beta-mercaptoethanol, 125 mg 8-hydroxy quinoline, 6 mL m-cresol. 4. Electrophoresis buffer (TAE buffer 50X): 2.OM Tris-HCl, pH 8.0, O.lM Na EDTA, 1.OM Na-acetate. 5. Loading solutions: a. Solution I (5X): 20% Ficoll type 400,0.25% Bromophenol blue (0.25% xylene cyanol). b. Solution II (5X): 40% sucrose (w/v), 0.25% Bromophenol blue (0.25% xylene cyanol). 6. Ethidmm bromide stock: Usually made up at a concentration of 10 mg/mL in milli-Q, stored at 4”C, and protected from light.
Detection of Leishmania
231
7. Blotting buffers: a. Depurination buffer: 0.25M HCl. b. Denaturation buffer: 0.5M NaOH, 1.OM NaCI. c. Neutralization buffer: 1.OM Tris-HCl, pH 8.0, 0.6MNaCl. 8. Sonicated salmon sperm DNA (sssDNA): Dissolve 1 g of salmon sperm (or herring sperm) DNA in 100 mL 20 mM Tris-HCl, pH 7.5. Let stand overnight at 4OC. Sonicate on ice until the solution has the consistency of milk. Denature the sheared DNA in a boiling water bath for 15 min. Quench on ice for 5-10 mm. An extraction with phenol/chloroform is advised, followed by ethanol precipitation. The sssDNA should then be checked spectrophotometrically for concentration and on an agarose gel for its size. Average size should be between 500 and 700 bases. 9. Sodium phosphate buffer (0.5M, pH 6.5): Prepare the following stock solutions: a. Solution A: 69 g/L NaH2P04.H20 (0.5A4). b. Solution B: 134 g/L Na2HP04s7H20 (0.5M). Mix 68.5 mL solutton A with 3 1.5 mL solution B. 10. Hybridization mixture: 7% SDS, 1% BSA, 2 mil4 EDTA, pH 8.0, 0.5M NaHP04, pH 7.0. Adjust pH of the lMNaHP0, stock solution with 85% phosphoric acid to pH 7.0. Aliquot the solution and store at -20°C. 11, SSC 20X: 0.3M Na citrate, pH 7.0, 3.OMNaCl. 2.2. PCR 1, Phenol (buffered) II: This buffer works particularly well for cytoplasmic RNA. The way of preparation 1sidentical to that of buffer I: 100 g phenol, 5 mL lMTris-HCl, pH 8.0,5 mL 5MNaC1, 250 pL 14Mbeta-mercaptoethanol, 100 uL 0.5MEDTA, 250 pL SDS 20%, 38 mL ultrapure water. 2. PCR buffer (10X): 500 mMKC1, 100 mMTris-HCl, pH 8.3,40 mA4MgC12, 1% gelatin (see Note 13). 3. SSUrRNA primers used for detection of Leishmania parasites: Primer Seauence5’>3’ Sneciticitv with primer GGTTCCTTTCCTGATTTACG Leishmania R333R R221F R333R R222F TATTGGAGATTATGGAGCTG Kmetoplastldae Lewhmania R331R R223F TCCCATCGCAACCTCGGTT R251F TGACTAAAGCAGTCATTC L. braz&ensls R333R R429F GGTTTAGTGCGTCCGGTA L donovanl R781R R360F TGGAGCTGTGCGACAAGTC L mexicana R333R R331R GGCCTGAGTTGAAAAGGGCG Letshmanla R223F R333R AAAGCGGGCGCGGTGCTG Lelshmanla R221F R781R TAGAAAAGATACGTAAGG L. donovani R429F
232
Van Eys and Meredith
3. Methods For more background information on the methods described in the following, refer to manuals such as the one by Sambrook and coworkers (25).
1 2. 3. 4. 5. 6.
7. 8. 9. 10. 11.
3.1. Southern Blotting Analysis 3.1.1. Preparation of Chromosomal DNA Centrifuge Leishmania cultures at 6000g for 30 mm at 4°C. Wash the pellets twice in phosphate buffered saline (PBS), pH 7.4 Centrifuge and resuspend in lysis buffer. Add sodium dodecyl sulfate (SDS) and pronase (Sigma, St. Louis, MO) to final concentrations of 0.5% and 100 pg/mL, respectively. Incubate for 2 h at 60°C. Add proteinase K to a concentration of 20 pg/mL and continue the protem digestion for another 2 h at 37°C. Add 1 vol of buffered phenol to the DNA solution, and mix gently for 10 mm at room temperature. Centrifuge the mix for 15 min at 6OOOg, and transfer the waterphase to a fresh tube. Avoid transferring the white interface. Repeat this step. Add 1 vol of chloroform, mix gently, centrifuge for 10 min at 6OOOg,and transfer waterphase to a fresh tube. Add 0.1 vol of 3M sodium acetate and mix gently. Add 2 vol of ethanol (100%) and let the DNA precipitate for 30-60 mm Collect the DNA by centrifugation or spooling with a glass rod. Wash twice with 70% ethanol. Remove asmuch as possible of the ethanol and allow the DNAs dry (not too much, otherwise it will be difftcult to redissolve). Resuspend in ultrapure water or TE buffer, 3.1.2. Endonuclease
Digestion
and Electrophoresis
3.1.2.1. DIGESTION PROCEDURE 1. Mix the followmg m a 1.5mL microfuge tube: 10X buffer, 10% of final volume (see Note 1); 10 mg/mL BSA, 5% of final volume; DNA, X% of final volume (see Note 2), restriction enzyme, Y% of final volume (see Note 3); and ultrapure water, (85-X-Y)% of final volume. 2. Mix gently. Close the tubes tightly and incubate at 37°C for at least 4 h. Digestion mixtures of genomic DNA should be mixed very gently to prevent shearing. 3. If the digest will be subjected to electrophoresis, add the appropriate volume of loading buffer. For other purposes the enzyme can be mactivated by heating the mix for 5-l 0 mm to 65°C or by phenol/chloroform extraction. The digested DNA can then be stored in the freezer.
Detection of Leishmania 3.1.2.2.
ELECTROPHORESIS
233 PROCEDURE
1. Make enough 1X TAE electrophoresls buffer for the particular electrophoresis set. 2. Add agarose to a concentration of 0.7% to the 1X electrophoresis buffer. Dissolve the agarose in a boiling water bath or a microwave oven and let it cool in a water bath to about 60°C. After cooling add ethidium bromide to a fmal concentration of 0.5 pg/mL, and pour the gel (see Notes 4 and 5). 3. Give the gel ample time to solidify, remove the comb, place the gel in the electrophoresis tank, and immerse the gel in 1X electrophoresis buffer 4. Load the samples and start the electrophoresis. DNA will migrate to the positive pole. Run the electrophoresis as fast as conditions permit (at 50-100 mV). Big gels should be run overmght. 5. Photograph the gel using UV hght.
3.1.3. Southern Blotting Wear gloves throughout this procedure. The volumes of buffers given
are for gels of about 300 mL. Volumes should be adapted for smaller gels. Never handle nitrocellulose membranes with your bare hands. Always wear gloves. Oil from your hands will ruin the membranes. 3.1.3.1.
DAY
1
1. Stain the gel in ethidmm bromide (5 pg/mL) and photograph using UV light. 2. Trim and mark the gel for orientation by cutting off a comer with a razor blade. 3 Always usmg a glass plate as support, transfer the gel into 500 mL of depurination buffer for 15 mm. Rinse briefly m water and then repeat (see Note 6). 4. Transfer gel into 500 mL of denaturation buffer for 15 min. Rinse briefly in water then repeat. 5. Transfer gel into 500 mL of neutralization buffer for 30 min. Rinse briefly in water then repeat (see Note 7). 6. Prepare the blotting setup as follows: cut eight pieces of Whatman (Maidstone, UK) 3MM paper or its equivalent, one piece of nitrocellulose membrane (Schletcher and Schuell [Dassel, Germany], BA85, or its equivalent), and an 8-lo-cm stack of absorbent paper towels cut to the exact size of the gel. Float the mtrocellulose membrane first on distilled water at room temperature for 20 min, then immerse the membrane for another 10 min. If the membrane retains any dry areas, bring the water to a boil and then slowly cool down. Soak the membrane next in 5X SSC for 10 mm and subsequently m 10X SSC for at least 5 mm more.
234
Van Eys and Meredith
7. In a glass dash or plexiglass box place a sponge. Immerse the sponge in 10X SSC and carefully squeeze the air out of it. When the sponge is saturated with SSC, layer four sheetsof Whatman 3MM paper, soaked m 1OX SSC on top of the sponge (sheets should be about 2 cm longer and wider than the gel). Make sure no air bubbles are trapped. (An alternative is to put a glass or plastic plate over the dish contaimng 10X SSC and layer soaked wicks of Whatman 3MM paper on this plate such that two sides hang in the 10X SSC.) 8. Place the gel on the Whatman papers and carefully position the precut nitrocellulose membrane (step 4) on top of the gel. DNA transfer begins immediately, so do not move the membrane once it has been placed on the gel. With a gloved hand, smooth out all air spaces and excess liquid between gel and membrane. If the placement is not satisfactory, remove and discard the membrane and try again with a new membrane prepared as in step 4. In the meantime the gel, wrapped in Saran wrap, can be stored m a refrigerator. 9. Place the remaining four sheets of Whatman 3MM paper on top of the membrane. Wet the sheets with 10X SSC, but use just enough to saturate the paper. With a gloved hand, smooth out all the air spaces between the paper sheets. 10. Position the precut stack of absorbent paper on top of the Whatman 3MM paper. Place a glass plate large enough to cover the towels on top of the stack. Place l/2 kg weight/500 cm on the glass plate (see Note 8). 11, Blot at room temperature overnight. 3.1.3.2. DAY 2 12. Remove the weight, towels, and 3MM paper from on top of the gel. Carefully remove the mtrocellulose membrane. Check the filter for the presence of little pieces of agarose and if there, remove by rubbing the filter carefully with a gloved hand. 13. Rinse the filter in 500 mL 5X SSC on a shaker for 10-20 min. 14. Place the filter on a sheet of Whatman 3MM paper and allow to dry on the air (see Note 9). 15. Place it between two sheets of 3MM paper and bake at 80°C for 2 h in a vacuum oven. An alternative is irradiation by UV light m an apparatus, such as Stratagene’s (La Jolla, CA) Stratalinker (see Note 10). 16. Allow the membrane to cool slowly to room temperature. Prehybridize and hybridize as described in Section 3.1.4. or store the membrane between two sheets of 3MM paper m a cool, dry place.
Detection
of Leishmania
235
3.1.4. Hybridization
Prehybridization and hybridization in phosphate/SDS is an alternative for the hybridization procedure that uses components such as formamide, Denhardt’s solution, and dextran sulfate. The method can be applied on nitrocellulose as well as nylon filters with good sensitivity and specificity. The method avoids the use of formamide (a teratocarcinogen) and shortens the time for prehybridization to about 10 min. Also, the same solution can be used for prehybridization and for hybridization. 1. Add 1 mL sssDNA to 9 mL hybridization mixture. 2. Pour mixture into a bag or container with the filters, remove the air bubbles, and prehybridize for 10 min at 60°C. 3. Add the [32P]-labeled probe. (Labeling can be done by mck-translation, random priming, or end-labeling. For all three methods, kits can be purchased from several manufacturers.) 4. Hybridize overnight at 60-68OC, depending on the desu-ed stringency. 5. Open the bag or container and carefully remove the radio active hybridization mixture into a tube. (This mixture might be used again after another round of heating. When single-strand probes [like M 131are used, heating can be omitted.) 6. Add 5 mL 3X SSC to rinse the filter from most of the sticking hybridization liquid. Remove the liquid and add 2X SSC solution. Wash for 30 min at 60-68”C. A second wash is performed with 1X SSC, 0.1% SDS for 30 min at 60-68”C. The final wash is done with 0.1X SSC, 0.1% SDS for 30 min (or longer) at 60-68”C (see Note 11). 7. Let the filter air dry, but not too much. Wrap the filter m plastic wrap. This will prevent the film from sticking to the slightly humid membranes during autoradiography. (Filters, handled in this way, can be used several times. Probes can be washed off in water or TE buffer at 95°C.) 8. Insert into a cassette with X-ray film (with or without screens), store the cassette (at -7O”C), and develop after sufficient exposure time. 3.2. PCR 3.2.1. PCR Procedure 1. Prepare target DNA. Methods for preparation are given in the following. To save enzyme activity, it is advisable to heat denature the template DNA before adding it to the reaction mix (10 min/95”C). 2. In a sterile 1.5-mL screwcap microfuge tube mix in the followmg order: 10 pL 1OX PCR buffer, 1 pL dNTP mix (25 &each), 1 pL primer A (150 pMIpL), 1 PL primer B (150 pMIpL), up to 2 pg template DNA and ultrapure H20 to a final volume of 99 yL. Vortex briefly.
236
Van Eys and Meredith
3. After addition of 1 U of Tuq polymerase, cover the mix with parafin or mmeral oil. (This prevents evaporation during the cycles of heating and coolmg. Evaporation changes the concentration of the ions. This will result in the synthesis of primer dimers, unspecific products, and eventually to a 50% or more inhibition of the enzyme.) 4. Carry out a number of amplification cycles. In general, 25-32 cycles will give a millionfold amplification, after which the synthesis reaches a stationary phase. Temperatures and times given in the following give good results with the ribosomal primers: a Denaturation of the template DNA, 94”C/l min. b. Annealing of the primers, 60°C/l mm. c. Synthesis of the new strands, 72”C/2 min. d. After the last cycle, 72°C 10 mm. The temperature and time of the steps depends on a number of factors (see Notes 12-l 7). 5. Analyze the amplified sample on a 1.5-2.0% agarose gel, followed by Southern hybridization or DNA sequencing. If necessary, the oil on top of the reaction mixture can be removed by extraction with an equal volume of chloroform. If a PCR assay has to be done routmely and contammatton with the amphficatton product interferes with the assay,one can use the followmg protocol: For one 50-uL sample mix 5.00 yL buffer (10X), 0.50 yL dNTP (25 rnM each), 0.25 uL dUTP (100 mM) (see Note 18), 0.50 uL uracyl-N-glycosylase (1 U/pL) (see Note 18), 1.OOuL primer (150 pM/pL), 1.OOuL primer (150 pM/pL), 1 U Taq polymerase, x PL DNA, and ultrapure water to a final volume of 50 uL. 3.2.2. Sample Collection 1. Blood: a. EDTA blood (3-5 mL). Keep frozen after collection until the assaywill be performed. b. Dry blood. Drops of about 50 uL are collected on Whatman filter paper no. 2. The filter can be stored at 4°C or at room temperature. 2. Serum: Serum has to be kept frozen after collection until the PCR assay is performed. 3. Biopsies: a. Skin or spleen biopsies can be submerged in TE buffer and stored frozen. b. Impression smears on Whatman filter paper no. 2 can be stored at 4’C or at room temperature. Also, lymph node and bone marrow aspirates can be applied on Whatman paper and stored in refrigerator or at room temperature.
Detection of Leishmania
237
3.2.3. DNA Extraction from EDTA Blood 1. Transfer 2 mL EDTA blood to a polypropylene tube. 2. Add 4 mL lysis buffer with Triton X- 100 and protemase K to final concentrations of 1% and 100 pg/mL, respectively. 3. Incubate overnight at 60°C. 4. Add 6 mL phenol and shake gently for 10 min. 5. Centrifuge 15 mm at 3000g. 6. Transfer the water phase containing the DNA to a new tube. Avoid as much as possible to transfer interphase material. 7. Add 6 mL phenol/chloroform (1:l) and shake gently for 10 mm. Repeat steps 5 and 6. 8. Add 6 mL chloroform/tsoamyl alcohol (24: 1) and shake gently for 10 mm. Repeat steps 5 and 6. 9. Add 660 pL 3MNa-acetate to the 6 mL water phase and mix thoroughly. 10. Add 2 vol of absolute ethanol. Mix well and leave tubes overnight at -20°C. 11. Centrifuge tubes for 60 min at 3000g. 12. Pour off the supernatant and wash the pellet with 5 mL 70% ethanol. 13. Reconstitute the DNA m 250 pL TE buffer. 3.2.4. Isolation of RNA for SSUrRNA-PCR 1. Collect cells by centrtfugation. 2. Resuspending the cells m lysis buffer. 3 Add 1 vol of phenol II. Mix by vortexmg and centrifuge. Transfer waterphase to a fresh tube. 4. Add 1 vol of chloroform. Mix by vortexmg and centrifuge. Transfer waterphase to a fresh tube. 5. Add 0.1 vol of 3M sodium acetate and vortex. Add 2 vol of ethanol (100%) and let the RNA precipitate for 3 h or overnight at -20°C. 6. Centrifuge for 30 min at 0°C. Wash with 0.5 vol of 70% ethanol, centrifuge, dry, and redissolve m RNase free water. RNA is ready to be submitted to PCR. 3.2.5. Reverse Transcriptase Reaction In general, total RNA preparations can be used to generate a particular DNA fragment. Only if this does not work should poly A+ selection be carried out. 1. Mix: 25 pg total RNA, 5 pL 10X buffer at room temperature (see Note 19), 1 ltL 3’primer (25 pA4), and ultrapure water up to 39 yL. 2. Denature RNA for 5 mm at 70°C and quench on ice. 3. Add: 2 pL dNTP (25 mM each), 1 PL RNasin (Promega) (see Note 20), 5 pL DTT, 3 pL reverse transcriptase (M-MuLV, New England Brolabs,
Beverly, MA) (seeNote 20).
Van Eys and Meredith 4. MIX well and incubate the mixture for 90 min at 37°C. 5. Transfer 10 pL of the mix to a fresh microfuge tube for PCR.
4. Notes 4.1. Southern Blotting 1. The buffer solutions for the different enzymes are provided most of the time by the company that produces the enzymes. If not, the composition can be found in catalogs of several companies. 2. If too much DNA is added to the mixture the digestion will be hampered or will not work at all. The more complex the DNA the larger the volume of the digestion mixture should be. In general, no more than 10 pg/l 00 I.~Lfor genomic DNA. If the digestion does not work, the DNA may be cleaned up by an extra round of phenol/chloroform followed by ethanol precipitation or by dialysis. 3. As a rule of thumb for genomic DNA use 4 U enzyme/pg DNA. Sometimes it is necessary to use more enzyme. However, the concentration of glycerol should not exceed 5%, since this will inhibit the digestion. 4. When one wants to isolate DNA fragments from a gel, running the DNA m an ethidium bromide containing gel and buffer should be avoided. In such casesthe gel or part of the gel should be stained after the run by immersing the gel m a 0.5-l .Oyg/mL ethidium bromide solution for 30+5 min. 5. Detection of very small amounts of DNA will be facilitated by destaining m a 1 mM MgS04 solution for 1 h. 6. It is important not to let the hydrolysis reaction proceed too far, otherwise the DNA might be cleaved into fragments that are too short to bmd efficiently to the filter. An alternative is UV radiation. Short wave UV radiation of ethidium bromide containing DNA for 5-10 mm allows efficient transfer of DNA up to at least 20 kb. 7. When nylon filters are used neutralization of the gel can be omitted. With nylon membranes, blotting is performed in 0.5M NaOH/l.5M NaCl solution and instead the filter is neutraltzed in the neutralization buffer for 10 mm directly after the blotting procedure. Membranes from different companies may require slightly different conditions. Insufficient neutralization of the gel will affect the structure of the nitrocellulose membrane resulting m fragile membranes and increased background hybridization. 8. A suitable weight is a flask contaming l/2 L of water. Make sure that there is no direct contact between the stack of absorbing paper and the 20X SSC If necessaryput Pasteurpipets, Saranwrap, or parafilm m between. Short-circuitmg between paper and sponge will result in incomplete and uneven blotting.
Detection of Leishmania
239
9. To assessthe efficiency of DNA transfer, the blotted gel can be stained again with ethidium bromide (5 pg/mL) for 30 min and compared with the picture of the preblotted gel. Keep in mind that the DNA is denatured and therefore will show a reduced intensity of fluorescence. Alternatively, the membrane can be checked by UV radiation for the presence of DNA. 10. Do not overbake the mtrocellulose filters. This will make the filters brittle and will increase the background hybridizatton. Over irradiation of nylon membranesalso increasesbackground, becauseof the reduction of the specific signal. 11. Wash times and/or temperature may be increased if the background is unacceptable. Even after exposure for a prolonged period, the filter can be subjected to more extensive or more strmgent washes. However, it is essential to keep the filters damp. Completely drying of the filters will make it rather dtfficult to remove probe material.
4.2. PCR 12. There is a certain lag time after a temperature shift. The length of the lag IS influenced by the equipment used, the temperature differential between the successive steps, the type of tubes, and the volume of the reaction mixture. The lag time, in general between 30 and 60 s, should not be included in the reaction time. 13. The annealing temperature has to be determined for each set of primers. The lower the temperature the more efficient the annealing and the lower the specificity. At higher temperature the specificity of the primer annealing is increased but the overall efficiency reduced. It is a good strategy to start with relatively low annealing temperature (42°C) and increase the temperature stepwise, 3-5OC/step. Another way, to manipulate the specificity of the annealing is by varying the concentration of Mg 2+. The concentration given for the PCR buffer in the Materials section has a rather low stringency and has to be considered as a starting concentration. Higher specificity can be achieved by lowering the Mg2+ concentration to 30,20, or even 10 n#. 14. The Tuq polymerase synthestzesthe new strand most efficiently at 72°C. The synthesis time depends theoretically only on the distance between the two primers. At 72”C, the Taq polymerase has an extension rate of about 60 nucleotides per second. However, it 1s advisable to give l-3 mm depending on the size of the fragment. If a decrease of activity of the enzyme is expected, a stepwise increase of the synthesis time (for instance, 3 s/cycle) can be considered. 15. Length and temperature of the denaturation step should be as short as possible to reduce inactivation of the Tag polymerase. A 1 mm/94”C denaturation step is sufficient for most template DNA.
Van Eys and Meredith 16. The last synthesis step should be extended up to 10 min. This to make sure that all DNA IS double stranded at the end of the amplification. This will result in well-defined bands on agarose gels. 17. The optimal temperature for Tuq polymerase activity is 72°C. However, some primers will not anneal stably to the template under these conditions. Fortunately, the Taq polymerase works also at lower temperature, although with lower efficiency. So, during the annealing step the enzyme will already elongate the primer. By the time the temperature is shifted to 72’C the extended primer will be long enough to form a stable duplex at that temperature. In some cases an intermediate step between annealing and synthesis may increase the efficiency of the PCR. One to two minutes at a temperature between the annealing temperature and 72°C ~111work. This option might be considered when the annealing temperature 1slow (<4O”C). 18. The dUTP/UNG combination is used as a precaution to eliminate carryover of PCR product. The first two steps in the thermocyclmg program are to activate the UNG followed by the destruction of UNG. 19. The buffer is in general provided with the reverse transcriptase enzyme. If this is not the case the composition can be found m one of the manuals (8) or the catalog of the manufacturer. 20. Other manufacturers such as Stratagene, BRL (Gaithersburg, MD), and Boehringer Mannheim (Mannheim, Germany), provide similar products. If those are used quantities have to be adapted. 4.3. General Notes 21. For PCR on samples containing intact promastigotes, infected Phlebotomus, or patient material, with primers complementary to kDNA, digestion by proteinase K, and/or treatment with detergent 1s not necessary. The kDNA is far less embedded m a protein structure and therefore more accessible for enzymes. 22. Characterization by Southern blotting is rather laborious and time consummg. Nevertheless, if parasites can be cultured, Southern blotting will be the method of choice for characterization of the parasites, since it provides two parameters: hybridization efficiency and pattern. With the set of genomic probes that are available, identification can be accurately performed. However, it is clear that PCR will be the future method for detection and identification of Lezshmama parasites. Application of SSUrRNA primers is a first step for a general approach. The sensitivity of this assayis high. Less than 10 parasites can be detected. The method allows differentiation according to complex. This is sufficient for most clinical questions. For more precise identification, kDNA primers may be applied. However, kDNA derived primers may only react with a limited number of strains. With the advent of more
241
Detection of Leishmania
kinetoplast-derived primers, PCR may also be used for epidemlological studies. However, to avoid false negatives, kDNA primers may be used in combmatlon with Leishmania-specific ribosomal primers.
Acknowledgments The authors thank Gerard Schoone and Nel Kroon of The Royal Tropical Institute in Amsterdam for their cooperation. References 1 Barker, R H. (1990) DNA probe diagnosis m parasmc mfections. Exp Parasztol. 70,494-499. 2. Van Eys, G. J. J. M., Schoone, G J., Ltgthart, G. S , Laarman, J. J , and Terpstra, W J (1987) Detectton of Leishmanza parasttes by DNA in situ hybrtdization with non-radioactive probes. Parasitol Res. 73, 199-202. 3. Ready, P D., Smith, D. F., and Ktllick-Kendrick, R. (1988) DNA hybridization on squash-blotted sandflies to identtfy both insect vector and infecting Leuhmanza. Med. Vet Entomol. 2, 109-l 16. 4 Rogers, M R , Popper, S. J , and Wirth, D. F (1990) Amplification of kinetoplast DNA as a tool m the detection and diagnosis of Lershmanla. Exp Parasltol 71,267-275.
5. Smith, D. F., Searle, S., Ready, P. D., Gramiccia, M., and Ben-Ismael, R. (1990) A kinetoplast DNA probe diagnostic for Leishmanza major. sequence homologies between regtons of Leishmama minicircles Mol. Blochem Parasltol 37,2 13-224 6. Howard, M. K , Kelly, J. M., Lane, R P , and Miles, A M (1990) A sensmve repetitive DNA probe that IS specific to the Lezshmanta donovani complex and its use as an epidemiological and dtagnostic reagent. Mol Biochem. Parasltol 44,63-72. 7. Van Eys, G. J. J. M., Schoone, G. J., Ligthart, G. S., Alvar, J., Evans, D. A., and Terpstra, W. J (I 989) Identificatton of “old world” Leishmanza by DNA recombinant probes. Mol Blochem Parasltol 34,53-62 8. Van Eys, G. J. J. M., Guizam, I., Ligthart,G. S , and Dellagi, K. (1991) A nuclear DNA probe for identification of strains within the Leishmania donovum complex. Exp Parasitol. 72,459-463. 9. Kennedy, W. P. K. (1984) Novel identification of differences m the kinetoplast DNA of Lezshmania isolates by recombinant DNA techniques and in situ hybridization. Mol. Blochem. Parasitol. 12,3 13-325. 10. Ray, D S. (1989) Conserved sequence blocks in kmetoplast mimcircles from diverse species of Trypanosomes. Mol Cell BloE 9, 1365-1367 11. Rogers, M. R and Wuth, D. F. (1988) Generation of sequence diversity m kmetoplast DNA minicircles of Lewhmanza mexxana amazonensw Mol Bzochem Parasitol. 30, l-8. 12. Meredith, S. E. O., Zijlstra, E. E., Schoone, G J., Kroon, C C M., Van Eys, G. J. J. M., Schaeffer, K. U., and El-Hassan, A. M (1994) Development and application of the polymerase cham reaction for the detection and identification of Lezshmanza parasites in clinical material. Archs. Znst Pasteur (Tunis) 70,4 19-43 1,
242
Van Eys and Meredith
13. Shibata, D. K., Arnheim, N., and Martin, W. J. (1988) Detection of human papilloma vuus in paraffin-embedded tissue using polymerase chain reaction J Exp. Med 161,225230
14. Starnbach, M N., Falkow, S , and Tomkin, L S (1989) Species specific detection of Legionella pneumophzla in water by DNA amplification and hybridization J Clzn Mzcrobzol 27, 1257-126 1. 15. Sturm, N. R., Degrave, W., Morel, C , and Simpson, L. (1989) Sensitive detection and schizodeme classification of Tzypanosoma cruzz cells by amphfication of kmetoplast mmicncle DNA sequences use m diagnosis of Chagas’ disease. Mol Bzochem Parasztol
33,205-214.
16. Van Eys, G. J. J M , Schoone, G. J , Kroon, N. C. M , and Ebelmg, S B (1992) Sequence analysis of small subunit ribosomal RNA genes and its use for detection and identification ofLezshmanza parasites. Mol Bzochem Parasztol 51, 133-142 17 De BrmJn, M H L. and Barker, D. C (1992) Diagnosis of New World leishmamasis: specific detection of species of the Leishmanza brazzlienszs complex by amphtication of kinetoplast DNA Acta Trop 52,45-58. 18. Dams, E., Hendriks, L., Van de Peer, Y., Neefs, J-M , Smits, G., Vandenbempt, I., and De Wachter, R (1988) Compilation of small ribosomal subunit RNA sequences. Nucleic Aczds Res. 16, 87r-173r. 19. Hernandez, R., Rios, P., Valdes, A. M., and Pmero, D (1990) Primary structure of Trypanosoma cruzz small-subumt ribosomal RNA coding region: comparison with other trypanosomatids. Mol Biochem. Parasitol 41,207-2 12 20. Looker, D., Miller, L. A., Elwood, H J , Stickel, S., and Sogin, M. L (1988) Primary structure of Lezshmania donovanz small subunit ribosomal RNA coding region. Nuclezc Aczds Res 16,7 198. 2 1. Schnare, M. R., Collmgs, J. C., and Gray, M. W (1986) Structure and evolution of the small subunit rtbosomal RNA gene of Crzthzdza fasciculata. Curr Genet 10,405~10 22. Sogm, M. L., Elwood, H. J., and Gunderson, J. H. (1986) Evolutionary diversity of eukaryotic small-subunit rRNA genes. Proc Natl. Acad. Scz USA 83,1383-1387. 23. Uhana, S R. B., Affonso, M. H. T., Camargo, E. P., and Floeter-Winter, L M (1991) Lezshmanza genus identification based on a specific sequence of the 18s ribosomal RNA sequence. Exp Parasztol 72, 157-l 63 24 Ramnez, J L. and Guevarra, P (1987) The ribosomal gene spacer as a tool for taxonomy of Leishmanza Mol Biochem Parasitol 22, 177-l 83. 25 Sambrook, J., Fritsch, E. F , and Maniatis, T. (1989) Molecular Clonzng A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Sprmg Harbor, NY
CHAPTER19
The Molecular Identification of Trypanosomes Geoff
Hide
1. Introduction Many protozoan organisms can be difficult to identify because of morphological similarities between strains or species. This is particularly true in the case of the African trypanosomes (T~~anosoma spp.). These trypanosomes are important medical and veterinary protozoan parasites that are transmitted between hosts by the tsetse fly. Correct identification is essential for the control and treatment of the diseases they cause (sleeping sickness in humans; “nagana” in cattle). The taxonomy of the African Trypanosoma spp. is complex but the most economically important species are T. congolense, T. vivax, and the T. brucei “complex” (1). All three species infect domestic cattle, whereas two subspecies of T. brucei (T. b. rhodesiense and T. b. gambiense) infect humans. The two human infective subspecies are morphologically identical, differing in geographical locality and symptoms caused, and, in addition, both are morphologically identical to the subspecies that infects cattle (7’. b. brucei). Two levels of identification are necessary: the distinction of species and the identification of strains within a species (2,3). In the former case, the practical applications of identification include determining the presence or absence of infection and the trypanosome species responsible for the disease (diagnosis). In the latter case, identification of strains can play an important role in understanding the epidemiology of the disease. From
Methods m Molecular Nuc/e/cAcrd Methods
Biology, Edited
Vol 50 Specres LJ/agnost/cs Protocols PCR and Other by J P. Clapp Humana Press Inc , Totowa, NJ
243
244
Hide
In molecular terms these two levels of distinction can be made in a relatively straightforward way. In the first case, DNA sequencesthat are present in one species, while absent in another can be used as a probe on Southern blots of trypanosome DNA. In the second case, Southern blotting can be used to detect restriction fragment length polymorphisms (RFLPs) that provide a method of distinguishing trypanosome strains. The sensitivity of this latter approach can be enhanced by using repetitive DNA sequence probes that detect much larger numbers of RFLPs than single copy genes. These lU?LPs are observed as ladders of bands on an autoradiograph. The banding patterns assigned to each trypanosome stock can be used as a “molecular fingerprint” to identify individual stocks (4). A comparison of the levels of similarity m banding patterns between trypanosome stocks can be used, mathematically, to estimate the degree of relatedness of the stocks to each other. Using these measures of similarity, trypanosome stocks can then be grouped together. This approach has been used in a study of the epidemiology of human sleeping sickness during a recent epidemic m southeast Uganda (.5,6). An analysis was carried out on a collection of trypanosome stocks isolated from humans and domestic cattle living in a cluster of neighboring villages in the Tororo District of southeast Uganda. Two distinct groups of strains were identified: strains isolated from humans (T b. rhodesiense) and strains isolated from cattle (T b. brucei). The trypansome strains that had molecular fingerprints characteristic of human infective strains were also found in the domestic cattle, thus implicating these animals as a potential reservoir for strains capable of causing human sleeping sickness. The technique described here makes use of three different repetitive DNA probes to generate a “molecular fingerprint” that contains a total of some 60-80 bands per trypanosome stock. A mathematical analysis is applied to the banding patterns to determine epidemiological relationships between the stocks. The three probes used are: 1. h104, a lambda bacteriophagewith a 7.5kb insert containing the coding region of the 18s and 28s ribosomal RNA genesof T. bmcez; 2. X109, a lambda bacteriophage
with a lo-kb insert containing
the nontran-
scribed spacerregion of the ribosomal RNA genes;and 3. pBE2, a plasmid containing from T. brucez (4).
a repetitive
DNA sequence randomly
isolated
Identification
245
of Trypanosomes
The three probes are hybridized to Hind111 digested genomic DNA and h 109 is hybridized, additionally, to X/z01 digested DNA. In T. brucei, the result is the generation of four sets of banding patterns. In other
Trypanosoma species, the results present a different picture. AlO4 hybridizes with DNA isolated from T. congolense, T. vivax, and T brucei, whereas h 109 and pBE2 hybridized only to T. brucei (4,. Thus, h 109 and pBE2 can be used as diagnostic probes for distinguishing T. brucei from T. vivax and T. congolense. A selection of other probes are also available for diagnostic purposes (see Note 1). Molecular fingerprinting of trypanosome stocks has proved to be a very sensitive method for distinguishing
individual
strains. Very few of
the trypanosome stocks examined have banding patterns that are identical to each other (see Note 2). The procedure consists of five steps: 1. Extraction of trypanosome DNA; 2. Digestion of trypanosome DNA with restriction endonucleases; 3. Separation of restriction enzyme fragments by agarose gel electrophoresis and transfer of DNA fragments to nylon filters (Southern blotting) (7); 4. Hybridization to [32P]-labeled probes and autoradiography; and 5. Mathematical analysis of banding patterns.
Figure 1 shows a typical autoradiograph depicting the banding patterns generated, using pBE2 as a probe, with Hind111 digested trypanosome DNA. Figure 2 (on pages 248 and 249) shows the outcome of the mathematical analysis, using banding pattern data from all probes, for a collection of isolates from southeast Uganda (6). Individual trypanosome stocks are clustered on the basis of similarity of banding patterns and the generation of groups of stocks clearly can be seen. The molecular fingerprinting technique could be applied to a wide range of organisms. Most eukaryotic organisms have a common structural organization of ribosomal RNA genes consisting of 18s and 28s coding sequences interspersed by nontranscribed spacer sequences (8). Thus probes equivalent to h104 and h109 could be isolated from almost any organism. Similarly many organisms possess repetitive DNA from which probes like pBE2 could be isolated. This technique could, therefore, have universal application and, with further development, could be extended to a PCR-based approach that would increase the applicability of this approach to large-scale field analyses.
Hide
246
12 345
6 7 89lOll12
Fig. 1. An example of an autoradiographshowing banding patterns in a variety of trypanosome stocks. These stockswere isolated from a collection of villages in the Tororo District of southeast Uganda. Trypanosome DNA was digestedwith restriction enzymeHindIII, Southernblotted, hybridized to pBE2, and autoradiographed. The trypanosome stocks illustrated are as follows: 1, BUTEBA25; 2, KATEREMA 3 11; 3, KATEREMA 4 1; 4, KATEREMA 116; 5, MELA 65; 6, MP2; 7, MAP; 8, PAPOL33; 9, U89/8; 10, U89/2; 11, UGM; 12, PAPOL 278. The designationsof the stocks refer to either the name of the village from which samples isolated from domestic cattle were taken (e.g., KATEREMA) or a code (or patient’s initials) for stocks isolated from humans (e.g., MAP or U89/8). Full details of these stocks are provided elsewhere (6). (Figure reproduced from Hide et al. [6] with the permission of Cambridge University Press.)
Identification
of Trypanosomes
247
2. Materials 2.1. DNA Extraction and Restriction Enzyme Digestion All solutions are stored at room temperature unless otherwise stated. 1. 10 mM Trts-HCl, pH 8.0, 0.25M EDTA, 100 mM NaCl (sterilize by autoclaving). 2. 10 mg/mL Pronase (Pronase E, Sigma, St. Louis, MO). Pretreat as described in Note 4. Store as frozen aliquots at -20°C. 3. 10% Sarkosyl (sterilize by autoclaving). 4. Chloroform/isoamyl alcohol (24: 1 [v/v]). 5. 10 mIt4 Tris-HCl, pH 8.0, 100 mA4NaCl (sterilize by autoclaving). 6. 2 mg/mL Ribonuclease (Ribonuclease A, lyophilized powder, Sigma). Pretreat as follows: Make up the RNase to a concentration of 2 mg/mL in 10 WTris-HCl, pH 7.5, 15 mA4NaCl. Boil for 15 min, allow to cool slowly to room temperature, and dispense as aliquots and store at -20°C. 7. 3M Sodium acetate (pH 5.2) (sterilize by autoclavmg). 8. 100% Ethanol, precooled to -20°C. 9. 70% Ethanol in water. 10. TE 7.6: 10 mM Tris-HCl, pH 7.6, 1 mM EDTA (sterilize by autoclaving). 11. 10 mM Tris-HCl, pH 8.0, 100 mM NaCl, 1 mM EDTA (sterilize by autoclaving). 12. Distilled or deionized water (sterilize by autoclavmg). 13. 10 mM Tris-HCl, pH 7.5, 10 mMNaC1 (sterilize by autoclavmg). 14. Hind111 Restriction enzyme. Available from a number of sources (e.g., Gibco/BRL, Gaithersburg, MD or Boehringer Mannheim, Mannhelm, Germany). Supplied with appropriate buffer. 15. XhoI Restriction enzyme. Available from a number of sources (e.g., Gibco/ BRL or Boehringer Mannheim). Supplied with appropriate buffer.
2.2. Southern
BLotting
and Hybridization
1. 10% SDS. 2. 20X SSC: To 800 mL of distilled water, add 175.3 g NaCl and 88.2 g of sodium citrate. Adjust the pH to 7.0 with NaOH and make up to 1 L with water. 3. Denaturing solution: l.SMNaCl, 0.5MNaOH. 4. Neutralizing solution: 1M Tris-HCl, pH 7.4, 1.5M NaCl. 5. TAE buffer: 0.04A4 Tris-acetate, O.OOlMEDTA.
248
.
r
r
GUP 1052 GUP 1301 UTRo4 CUP 1075 ix! ?APoL
28.5
nR.462 %z0b2” KA?EREhJA
116
2% PAPOL 278 URl PAPOL 1@3 h4FLA66 UCF (88) UCH 1881
Group10
%Slmllar1ty 1@0
90
80
70
60
w 30
Frg. 2. The dendrogram shows the output of a mathematical clustermg of trypanosome stocks on the basis of banding patterns. The stockswere all isolated from a collection of small villages in the Tororo Distrrct of southeast Uganda. Full details are published elsewhere (6). The stocks that cluster together to form group 10 are all human infective (T b rhodesiense) while the other stocks are nonhuman infective and fall mto a wide range of groups. (Figure reproduced from Hide et al. [6/ with the penmssion of Cambridge University Press.)
6. Agarose (Sigma, type 1, or Gibco BRL Ultrapure Electrophoresis grade). 7. 10 mg/mL Ethidmm bromide in water. Store m a light proof bottle at room temperature. 8. 6X DNA gel loading buffer: 0.25% Bromophenol blue, 0.25% xylene cyan01 FF, 15% Ficoll (type 400, Pharmacia, Uppsala, Sweden) m water. Store at room temperature. 9. 1 kb Ladder DNA markers (Gibco BRL). 10. 7% SDS, 0.5Mphosphate buffer (pH 7.2). Make up as a 14% solutton of SDS and 1M phosphate buffer (approx 684 mL 1M Na2HP04 to 3 16 mL lMNaHzPOd--adjust to the correct pH by titration) and mix equal volumes of the 14% SDS and 1Mphosphate buffer to make the final hybridization solution. If a large batch is to be made and stored for some ttme, then this solution should be sterilized by autoclaving. 11. Random primed DNA labeling kitTM (Boehrmger Mannheim). 12. [32P]-labeled dCTP (3000 Ci/mmol) (DuPont, Wilmington, DE).
3. Methods 3.1. Isolation of Trypanosorne
DNA
1. Resuspend 0.2 mL of packed trypanosomes (see Note 3) in 0.42 mL of sterile 10 mA4 Tris-HCl, pH 8.0, 0.25M EDTA, 100 mM NaCl per sterile Eppendorf tube. 2. Add 0.12 mL of 5X Pronase (pretreated, see Note 4) to make a final concentration of 2 mg/mL and add 0.06 mL 10% Sarkosyl, mix, and mcubate at room temperature for 17 h. 3. Add 0.7 mL of chloroform/isoamyl alcohol (24: 1) to each tube. Rotate the tubes for 20 min. 4. Spm the tubes for 10 mm in a microfuge and remove the upper aqueous phase using a wide bore tip to a fresh tube contaming 0.7 mL chloroform/ isoamyl alcohol (see Note 5). 5. Repeat the chloroform/isoamyl alcohol extraction process (steps 3 and 4) three times, taking care not to remove any of the interface material on the second and third extractions. 6. Centrifuge the collected upper aqueous phase for 2 h at 12,OOOgto remove the kinetoplast DNA (see Note 6) and recover the supernatant and dispense 0.35 mL per sterile Eppendorf tube. 7. Add 0.35 mL 10 mA4Tris-HCl, pH 8.0,lOO mMNaC1 and then add 35 PL pretreated rlbonuclease (RNAse) (2 mg/mL) and incubate for 1 h at 37’C. 8. Add 0.7 mL of chloroform/isoamyl alcohol (24: 1) and remove protein as described m steps 3-5. 9. Recover the upper aqueous phases and dialyze against 3X loo-fold vol of Tris-HCl, pH 8.0, 100 mMNaC1, 1 mA4 EDTA for 4 h (see Note 7).
Identification
of Trypanosomes
251
10. Recover the dialyzed sample and dispense in 0.4-mL aliquots to sterile Eppendorf tubes and add 40 p,L of 3M sodmm acetate to each tube. Ethanol precipitate by adding 0.8 mL ice cold ethanol to each tube, mtx well, and leave on ice for 2 h. 11. Spm the precipitated DNA down by centrifugation m a microfuge for 15 min at 12,000g. 12. Remove the supernatant and add 1 mL of 70% ethanol to the pellet. Do not resuspend the pellet. 13. Spin for 15 min at 12,000g. Carefully remove as much of the supernatant as possible without disturbing the pellet. There is no need to dry the pellet down (see Note 8). 14. Dissolve the pellet m 50 pL of sterile 10 mM Tris-HCl, pH 7.6, 1 mA4 EDTA (TE 7.6) (see Note 9). 3.2. Restriction Endonuclease Digestion 1. Measure the concentration of DNA by spectrophotometric absorbance measurement (at a wavelength of 260 nm) of 1 uL of the DNA diluted to an appropriate volume to till a quartz cuvet (see Note 10). 2. Digest 5-l 0 ug of trypanosome DNA with either Hind111 or XhoI as follows. Typical reaction mixture: 2 uL appropriate restriction enzyme buffer (supplied with the enzyme), 15 uL of DNA, 1 uL of pretreated 2 mg/mL RNase, and 2 uL (20 U) of restriction enzyme. 3. Incubate at 37°C for at least 4 h. 4. Add 4 uL of 6X DNA gel loadmg buffer and heat at 65°C for 5 mm. 3.3. Southern Blotting 1. Set up a 20X 25 cm submarine 0.6% agarose gel as follows: Add 1.5 g of agarose to 250 mL of TAE buffer containing 0.5 pg/mL of ethtdium bromide. Dissolve the agarose by boiling the solution m a water bath or microwave oven. Allow to cool to 45-50°C and pour mto a gel tray containing a 20-well comb and allow to set. Submerge the gel m an electrophoresis tank containing the same buffer including 0.5 ug/mL ethidium bromide. 2. Load the DNA samples and electrophorese at 40 V overnight until the Bromophenol blue dye front (purple) has migrated 17 cm from the wells. Markers and “standard” DNA samples should be loaded (see Note 11). 3. Remove the gel, visualize, and photograph the gel using a transilluminator and Polaroid camera (see Note 12). The gel can be returned to the gel tank if further running is required. Include a ruler m the photograph of the gel such that measurements of the migration of markers can be made. Slice off the parts of the gel above the wells. 4. Soak the gel in denaturing solution for 1 h at room temperature with gentle rocking and a change of buffer at half time.
252
Hide
5. Repeat step 4 using neutralizing solution m place of denaturing solution. 6. Set up a capillary transfer system by placing the gel on a piece of Whatman (Maidstone, UK) 3MM paper that is dipped m a tank of 20X SSC and acts as a wick. Lay a sheet of nylon filter (Amersham [Arlington Heights, IL], Hybond-NTM), cut exactly to the size of the gel, on top of the gel. On top of this place three layers of 3MM paper and a 5.0-cm high stack of absorbent paper towels (see Note 13). Place a weight (150 g maximum) on top of the towels. The orientation of the filter should be marked to enable its subsequent orientation with respect to the autoradiograph. 7. Allow the DNA to transfer overnight, remove the nylon filter, and place DNA side down on a sheet of Saran wrap on top of a UV transillummator. Expose to long wave UV light for 7 mm to fix the DNA m place (see Note 14). The nylon filter can then be stored mdetimtely at room temperature by wrapping m Saran wrap and tin foil to keep the filter light proof. 1
2.
3. 4. 5. 6. 7. 8. 9.
3.4. Hybridization to Radiolabeled DNA Probes The concentration of the DNA probe (see Note 15) should be adjusted to 2.5 ng/yL m either water or TE 7.6 buffer and boiled for 15 min. The probe can be stored m this form at -20°C mdetinitely. Prior to each labeling reaction the probe DNA should be boiled for 5 min. Using the Random Primed DNA Labeling KitTM (Boehringer Mannheim, Mannhelm, Germany), add 10 pL (25 ng) of freshly boiled probe DNA, 4 pL of 10X reaction mix, 6 pL of deoxynucleotides (1: 1.1 mixture of dTTP, dGTP, and dATP), 13 pL of sterile water, 5 yL of [32P]-labeled dCTP (3000 Ci/mmol) and 2 p.L of Klenow enzyme. Incubate for 30 mm at 37°C (see Note 16). Stop the labeling reaction by addition of 200 pL of 7% SDS, 0.5M phosphate buffer, pH 7.2. Immerse the nylon filter contammg transferred DNA m 50-100 mL of prehybridization buffer (7% SDS, O.SMphosphatebuffer, pH 7.2.) and rotate m a hybridization oven at 65OCto prepare the filter for hybridization (see Note 17). Boil the radiolabeled probe, prepared in step 4, for 5 mm in a water bath (see Note 18) Add the boiled probe to 7 mL of 7% SDS, O.SMphosphate buffer, pH 7.2., pour off the prehybridization buffer from the nylon filter and replace it with the 7 mL of hybridization buffer containing the radiolabeled probe. Hybridize by rotation overnight at 65°C. Pour off the hybridtzation buffer and wash once with 200 mL of 2X SSC, 0.1% SDS at room temperature and pour off the wash buffer mrmedtately (see Note 19).
Identification
of Trypanosomes
253
10. Wash for 15 min in 2X SSC, 0.1% SDS for 15 mm at 65°C in the hybridization oven. 11, Repeat step 10 twice more. 12. Using a bag sealer, seal the washed filter m a plastic bag without allowing the filter to dry out (see Note 20). Expose to X-OMAT-S autoradiography film for l-2 d or as long as necessary. 13. Followmg autoradiography, the filter can be prepared for reuse (The filter must not be allowed to dry out if reuseis required.) Immerse the filter m 750 mL of 0.1% SDS in water. Place in a microwave oven for 15 mm at full power. 14. Replace the 0.1% SDS solution with 750 mL of fresh solution and repeat the microwave treatment as in step 13. 15. The effectiveness of this stripping procedure can be checked by subjecting the stripped filter to autoradiography for l-2 d prior to rehybridization. (Remember to keep the filter wet during autoradiography.) It is usually only necessary to do this the first couple of times either to ensure that the microwaving procedure is working correctly or if very faint bands requiring long exposures are expected. 16. Place the filter m prehybridization solution as described m step 5 and repeat the hybridization process with another probe Filters can usually be reused four to five times without loss of quality. 3.5. Analysis of Banding Patterns 1. Calibrate the sizes of the bands on the autoradiograph by measuring the migration of the molecular size markers the markers visualized on the Polaroid photograph (see Note 2 1). 2. Draw a standard curve, plotting the logic of the molecular size of the markers (in kilobases), on the y-axis, against the migration of the markers (m milhmeters) from the wells (origin) on the x-axis 3. On the autoradiograph measure the migration of each trypanosome derived band from the origin and derive its molecular size from the standard curve. On each gel include several tracks of DNA samples from reference trypanosome stocks to act as internal standards. This assistswith the consistency of mterpretation of band sizes (see Note 22). 4. Once a number of stocks have been analyzed, the positions of all possible bands can be tabulated. Then, for each unknown stock, the presence or absence of each band can be scored in the table. Figure 3 shows the complete set of banding sizes,generated using k 104, hlO9, and pBE2 as probes, and the individual patterns observed for a selection of reference stocks. 5. Having established the profile of bands for each unknown stock, the bands are coded in a binary form for use with computer analysis programs. The
254
Hide
A 1 10 9.5 8.0 7.5 6.0 5.7 5.5 5.0 4.6 4.5 4.2 3.9 3.6 3.5 3.0 1.5
10.4 10.0 8.9 8.4 7.7 7.5 7.2 6.5 6.2 5.7 5.5 5.1 4.5 4.1 3.8 3.5 3.3
-
C 1 12.0 10.3 10.0 9.9 9.5 9.4 8.7 8.1 7.8 7.3 7.1 6.7 6.2 5.9 5.5 5.2 4.6 4.5 4.3 3.2 2.9 2.5 1.6
2 W M -
3
--
W -
-w --
W --
---
4 13.5 12.3 11.2 10.4 9.7 8.9 8.7 7.8 7.5 7.2 6.7 6.0 5.7 5.0 4.9 4.4 4.1 3.5 3.2 2.8 2.4
1 -mm
2
Identification
255
of Trypanosomes
TREU869 1111101001110100 11110010100110100 00001001100010110110001 110100111110010011001
GUP2540 1111101101001010 11110011000010100 01101001101110110110001 111110000101110110111
ELL4NE 1110100000000010 11110011000110000 11100101000110111101001 110100110110010011100
UGF 1111101000000101 11110011000110111 00001001100010110110001 110100100111010011100
Fig. 4. Binary codes for four reference stocks TREU 869, ELIANE, GUP2540, and UGF are illustrated. Each of the four lines of code is derived from the banding patterns shown in Fig. 3. For example, the first code line in TREU869 is derived from Fig. 3, panel A, lane 1; the second line from panel B lane 1, and so on. presence of a band scores as 1, whereas the absence scores as 0. Examples of these binary codes are shown for the reference stocks in Fig. 4. For use in the cluster analysis programs, data must be entered on the computer in a “text only” format utilizing the correct spacing between characters (see Note 23 for an example of input data format). 6. The programs SIM or BIGSIM (see Note 24) can be used to construct a pairwise similarity matrix between all pairs of input banding patterns. Various similarity coefficients can be used in this program, although Jaccards Coefficient is the one most suitable for this analysis (see Note 25). Figure 5 shows a typical output file from SIM. 7. The output file from SIM or BIGSIM (a similarity matrix) can be used as the input file for the program 4M. 4M constructs a dendrogram of relatedness between stocks based on the pairwise combinations of Jaccards Coefficients. A number of statistical approaches can be used to construct the dendrogram (see Note 26), however, the Group Average or UPGMA method (14) appears to be the most suitable method for this analysis. Selection of the “MEAN” option on the 4M program carries out this analysis. Fig. 3, (previous page) Complete banding patterns for each of the four probe/ restriction enzyme systems:HzndIII, probe h104 (panel A); Hznd III, probe h109 (panel B); HindIII, probe pBE2 (panel C); 201, probe h109 (panel D). The banding patterns for four reference stocksare illustrated in lane 1 (TREU869), lane 2 (ELIANE), lane 3 (GUP2540), and lane 4 (UGF). Sizesof fragments in kilobases are indicated.
Hide
256 Reference 4s TREU869 ELL4NE GUF2540 UGF
trypanosome 1 000 0 551 0 549 0736
0 551 I 000 0 535 0595
strams 0 549 0 535 I 000 0597
0 736 0 595 0 597 1000
Fig. 5. This shows an example output from the similarity program, SIM, for the four reference stocks illustrated in Figs. 3 and 4. 8. The output from 4M consists of a dendrogram from which groups of stmtlar stocks can be tdentified (see Note 27). Since the output from 4M gives a dendrogram with nonlinear scaling it 1sbetter to redraw the dendrogram using the similartty figures given m the output, on a linear scale An example is shown m Fig. 2.
4. Notes 1. A wide range of probes has been identified from various laboratortes that could be used to discriminate between species of African Trypanosomes. These are reviewed comprehenstvely elsewhere (2). Table 1 illustrates a summary of a selection of probes and their orrgms that could be of use as diagnostic reagents. 2. In general, an individual trypanosome strain will have an individual banding pattern. However, m some situations a number of isolates may have identical patterns and this may be owing to strains, derived from a common strain, that have spread through a region as part of an epidemtc. The occurrence of identical stocks m a collection of isolates can be an important epidemiological indicator of the epidemic expansion of a single strain within a locality. 3. The usual procedure for obtaining pure trypanosomes for molecular or biochemical analysis 1s as follows. First, a blood sample is taken from an infected mdividual or animal (this 1stermed an “isolate”). This isolate 1s probably a mixture of “strains” (a collection of mdividual variettes) of trypanosomes. Mtxtures of trypanosome strains cannot be analyzed for RFLPs in repetitive sequences,as the banding patterns produced become too complex. It 1sthen not possible to assign individual bands to any given component strain within the mixture. Therefore, clones are made from each isolate such that each clone is derived from a single trypanosome. These isogemc clones are amplified by growth m laboratory rodents or m culture. The term “stock” 1s used to describe all trypanosome samples derived from these clones. Procedures for the handling, growth, cloning, and isolation of trypanosomes are described comprehensively elsewhere (9).
Identification
of Trypanosomes
257
Table 1 Selection of Probes and Their Ongins” Trypanosome species T T. T. T T. T T
brucet brucei brucei rhodesiense brucel gamblense evansl equlperdum congolense vwax
1104 * * * * * * *
1109 * * * * *
pBE2 * * * * h
A 1.8 * * * * *
177bp * * * * *
A 1.1 * *
L2
* * *
aA selection of available probes that can be used for a presence/absence hybrldlzatlon assay for the ldentlfkatlon of different species and subspecles of African trypanosomes (*) Hybndlzatlon of the given probe with the given species or subspecies Details of the orlgms of probes can be found elsewhere: h104,h109, and pBE2 (4). A 1 1 and A 1 8 (IS), 177bp (19), and L2 (20)
4. Pronase should be pretreated pnor to use to remove DNAses and RNAses as follows: Dissolve the powdered Pronase m 10 mM Tris-HCl, pH 7.5, 10 mMNaC1 to a concentration of 10 mg/mL and incubate for 1 h at 37OC. Store in frozen aliquots at -20°C. 5. Sometimes the upper aqueous phase is very viscous, owing to the high concentration of DNA, and it 1svery easy to take up some of the white
interface material with the aqueous phase. This does not matter too much on the first extraction but care should be taken not to remove any of the interface on the second and third extractions. A wide bore tip helps to overcome the difficulty of removing the viscous upper phase. 6. Trypanosomes belong to the protozoan order Kinetoplastida and are characterized by having a large network of concatenatedcircles of DNA called the kinetoplast DNA &DNA). This DNA represents,almost exclusively, mitochondrial DNA and is usually removed when preparing nuclear DNA. Becausethe network is a single concatemerit can be removed relatively easily by centritigation. Care must be taken not to subject the DNA preparation to undue sheering in the stepsprior to removal of the kDNA. It is largely the kDNA that is responsible for the viscous nature of the upper aqueous phases in steps 4 and 5.
7. Dialysis tubing 1sprepared by submersion in distilled or delomzed water followed by autoclaving using a standard sterilization cycle. Dialysis 1s required to remove the EDTA from the DNA solution as this will coprecipitate with the DNA during the ethanol precipitation. 8. It used to be thought that the DNA pellet should be dried down under vacuum following ethanol precipitation. This has found to be unnecessary and IS, in fact, detrimental as it makes the pellet less easy to resuspend and may denature the DNA
9. Take care to wash the sides of the Eppendorf tube with TE buffer as some of the DNA sticks to the side rather than the bottom of the tube. 10. Take 1 pL (or more if necessary) of the redissolved DNA pellet and dilute into 500 pL of TE7.6 buffer. The spectrophotometer reading, at 260 nm, should be adjusted to zero using 0.5 mL of TE7.6 buffer in a quartz cuvet. Absorbance of the DNA sample should then be measured against the TE7.6 buffer. Usmg the known dtlutton factor, calculate the opttcal density for the equivalent of 1 mL of DNA and estimate the concentration. (1 OD U is equivalent to a concentration of 50 ug/mL of double-stranded DNA). 11. When the final autoradiograph is developed it is necessary to be able to identify individual bands on the film. This is considerably easier if two or three reference DNA samples are included. Usually this would be DNA from trypanosome stocks for which the banding patterns are well characterized and that, between them, contain as many of the different bands as possible. Marker DNA should also be mcluded. Radioactive markers could also be used. These would have the advantage of being directly visualized on the final autoradiograph. 12. In order to determme the sizesof bands, it is necessary to include a ruler m the photograph. Using the ruler as a scale, the migration of the markers can be measured and these measurements used to plot the positions of the markers on the final autoradiograph. 13. It is important that the transfer buffer is not allowed to bypass the gel and nylon filter. This can be prevented by waterproof tape (e.g., autoclave tape) stuck around the edges of the gel so that any overlapping towels are prevented from making contact with the wick below. Do not place too heavy a weight on the towels as this can distort the gel. 14. The time quoted here is adequate for crosslmkmg using a standard transilluminator. The power or efficiency of such machines may vary. If using other pieces of apparatus (e.g., crosslinking machines), the crosslinking exposure time may need to be determined experimentally. (Try following the manufacturer’s mstructions first!) 15. The usual way to prepare the DNA probe is to digest the probe DNA with a restriction enzyme that excises the insert. The resulting fragments are then electrophoresed on a low melting point agarose gel. The band representing the insert can be excised from the gel and dissolved in water prior to boiling (as described m step 1). The amount of DNA, in the cut out gel slice, can be estimated by knowing the amount of DNA loaded onto the gel and estimatmg the proportron of insert to vector DNA based on the relative sizes of each fragment. The volume of the gel slice can be estimated by weighing the gel slice and assuming its density to be 1 g/mL. Thus an estimate of the concentration of the DNA in the gel slice can be calculated.
Identification
of Trypanosomes
259
16. Incubation for longer than 30 min causes a reduction in the efficiency of labeling. 17. The length of the prehybridization step is not critical, although 15-30 min seems adequate. It is usually convenient to start this step once the Random Primed Labeling reaction has commenced. The filter can be prehybridized in a plastic bag and sealed usmg a bag sealer, if no hybridization oven is available. The bag can be incubated by submersion in a water bath. 18. It is not necessary to remove the unincorporated radioactive deoxynucleotides from the labeled probe prior to hybridization when using 7% SDS, 0.5Mphosphate buffer as the hybridization buffer. However, if other protocols are used the unincorporated radioactive nucleotides should be removed. The hybridization reaction can be carried out m a sealed bag if a specialized oven is not available (see Note 17). 19. The purpose of the “cold” wash is to quickly remove excess radioactivity as the hybridization mixture also contains unincorporated nucleotides. This wash should be a quack rinse step m contrast to the 15-min washes at 65°C. 20. If the filter is to be reused, it is very important not to allow the filter to dry out, otherwise very high background signal is experienced on subsequent hybridizations. 2 1. Various methods can be used for calibrating the sizesof bands on an autoradiograph. The most usual way is to photograph the ethidmm bromide stained gel under UV lighting, while including a ruler in the photograph. The ruler can then be used as a scale from which to measure the migration of the molecular weight markers. Another approach is to load radioactive markers on to the gel and they will appear on the final autoradiograph. The drawback with this approach 1sthat all the stages prior to the hybridization also require the handling of radioactivity. 22. Although desirable, the analysis of banding patterns does not require great accuracy of measurement of band sizes as long as banding patterns from reference trypanosome stocks can be directly compared with unknown stocks on the same autoradiograph. The inclusion of three or four reference stocks (whose complete banding patterns have been established) greatly facilitates the analysis of banding patterns. It also gives greater confidence when establishing whether bands appearing in two stocks are the same or different bands. The bands observed are often not of equal intensity. This is especially true for the bands generated by the ribosomal RNA gene probes. For the purposes of the mathematical analysis, differences in band intensity are ignored and only the presence or absence of a band is considered. It is usually necessaryto do a series of exposures of the autoradiograph to ensure that both faint and strong bands can be clearly identified. Large and small molecular size bands (>14 kb and X1.5 kb) are
excluded from the analysis as the mterpretation of sizes (especially the large fragments) can be very unclear. 23. An example of the input data format for the program SIM is as follows: Trypanosome stocks from Uganda. UG17 .1111101000010100.11110011000110111. UG13 .1101100100100110.11111011100011101. The first line is a title lme and must not exceed 40 characters. The second and subsequent lmes are the input data. A single lme refers to an individual stock. The name of the stock starts the line. This is followed by a full stop (period) at posmon 9 to indicate the start of the DNA banding patterns. Each set of patterns is separated by a period and the posmonmg of numbers verttcally defines presence or absence of a band at that given positron m each respective stock. Input data should be inserted m a “text only” format via a word processor and should use a fixed spacmg font (e.g., Courier). All word processing functtons, such asJustificatron, should be switched off. 24. The similarity program (SIM) was kindly provided by Dr. Richard Cibulskis at the Liverpool School of Tropical Medicme (20,Z I). BIGSIM 1sa modification of SIM that is capable of handling more data. Many other programs are available for both mainframe and personal computers that do the same job. The only requirements are that they should be able to calculate a Jaccards Coefficient and be able to handle a binary data input. 25. Jaccards Coeffictent (12) is defined as the ratto of the number of bands present m both stocks (a) to the sum of the bands exclusive to stocks 1 (b) and 2 (c) plus the number of bands present m both stocks (a) as shown in the formula: S( 1,2) = a/(a + b + c) Other stmilarny coeffictents score the absence of bands at a given position as an mdicatton of identity. This IS not appropriate for the analysis used here. One assumption made in this analysis is that bands of a similar size, in different stocks, are homologous bands. This assumptton largely will be true for most pans of bands. However, a small proportron of bands may be of similar size but have different genetic orrgms. The effects of this srtuanon will be mmrmized when these bands are included alongside the large number of bands that do conform to the assumptton. An analogy can be made with a classic example in taxonomy* the classification of birds and bats. If identity were based solely on possession of wings then both would be classified together but when large numbers of characters are considered a different interpretation emerges.
Identification
of Trypanosomes
261
26. The construction of a dendrogram using hierarchical cluster analysis techniques can be carried out using a number of approaches (13). Different clustering algorithms have different properties. Cluster analysis can be considered to be analogous to producing a map proJection m which a threedimensional land surface 1s portrayed as a two-dlmenslonal map. In all map projections, some level of distortion occurs and an appropriate choice of proJection 1sreqmred. Slmllarly, some cluster analysis techniques are better for certam sets of data than others. This can really only be determined empirically The Group Average or UPGMA technique (14) is considered to perform well on a variety of data sets (15,16). A comparison of the performance of two cluster analysis methods (Group Average and Complete Linkage methods), using a set of banding patterns from a collection of trypanosome stocks,showed that both methods produced final dendrograms that were broadly m agreement with each other (17). It was, therefore, considered that the Group Average Method would be appropnate for use in this analysis. 27. There 1sno formal mathematical description of what constitutes a group when using hierarchical cluster analysis techniques. The criteria used here for determining the identities of groups are based on the homogeneity wlthm a putative group (which should be high) and the level of similarity with a neighboring group (which should be low). Figure 2 shows an example dendrogram that clearly shows the group 10 stocks to be distinct from other groups. When a high level of diversity of bandmg patterns 1sfound withm a putative group, it is difficult to decide whether it constitutes a group or a collection of individuals.
Acknowledgments I thank the Wellcome Trust for financial support and Cambridge University Press for permission to use figures from a previous publication. I acknowledge the contributions of Andy Talt (University of Glasgow), Sue Welburn, and Ian Maudlin (University of Bristol) to the development and uses of the techniques described here. Thanks are due to Richard Cibulskis (University of Liverpool) who developed and provided the computer programs for the analysis of banding patterns. References 1. Hoare, C A. (1972) The Tvpanosomes of Mammals, Blackwell Sclentlfic Pubhcations,Oxford, UK. 2. Hide, G. andTait, A (1991) The molecular epidemiology of parasites.Experientza 47, 128-142.
Hide 3. Hide, G. (1994) The molecular epidemiology of parasites, m Principles of Medical Bzology (Bittar, E. and Btttar, N., eds ), JAI, Greenwich, CT, m press. 4. Hide, G., Cattand, P., Le Ray, D., Barry, J D , and Tan, A (1990) The tdentiflcation of Trypanosoma brucez subspecies using repetmve DNA sequences Mel Blochem Parasltol
39,2 13-226
5 Hide, G , Buchanan, N , Welburn, S C , Maudlin, I., Barry, J. D , and Tan, A (199 1) Ttypanosoma brucez rhodeszense charactertsatton of stocks from Zambia, Kenya and Uganda using repetittve DNA probes Exp Parasztol 72,430-439. 6 Hide, G , Welburn, S C , Tait, A , and Maudlin, I. (1994) Epidemtologtcal relationships of Trypanosoma brucei stocks from South East Uganda- evidence for different populatton structures m human infective and non-human infective isolates. Parasztologv 109,95--l 11. 7. Southern, E. M. (1975) Detection of spectfic DNA sequences among DNA fragments separated by gel electrophoresis J Mel Bzol 98, 503-5 17 8 Long E 0 and Dawtd, I. B. (1980) Repeated genes m eukaryotes Ann Rev Biochem 49,727-764
9 Lumsden, W H R , Herbert, W J., and McNetllage G J. C. (1973) Technzques with Trypanosomes, Churchill-Ltvmgstone, London, UK. 10. Le Blancq, S. M., Ctbulskts, R. E., and Peters, W. (1986) Leishmanza m the Old World: 5. Numerical analysts of tsoenzyme data. Trans Roy Sot Trop Med Hyg 80,5 17-524. 11 Stevens, J. R. and Ctbulskts, R. E. (1990) Analysmg isoenzyme band patterns using stmdartty coeflictents: a personal computer program. Comp. Meth. Progr. Boomed 33,205-2 I2 12. Jaccard, P. (1908) Nouvelles recherches sur la distribution florale. Btdletm de la Socltte Vaudolse des Sciences Naturelles
44,223-270
13. Dunn, G and Ever&, B. S. (1982) An Zntroductzon to Mathematical Taxonomy Cambridge University Press, Cambrtdge, UK. 14. Sneath, P. H. A. and Sokal, R. R. (1973) Numerical Taxonomy Freeman, London. 15 Cunnmgham, K M. and Ogtlvie, J. C. (1972) Evaluation of hierarchical grouping techniques. A preliminary study. Comp J 15,209-2 13. 16. Kmper, F K. and Fisher, L. (1975) A Monte Carlo comparison of six clustering procedures. Biometrics 31,777-783 17 Hide, G. (1988) Variation rn Repetitive DNA in African Trypanosomes, PhD Thesis, University of Edinburgh. 18. Paindavoine, P., Pays, E , Laurent, M., Geltmeyer, Y., Le Ray, D , Mehhtz, D., and Steinert, M (1986) The use of DNA hybrtdisation and numerical taxonomy in determining relationshtps between T. brucei stocks and subspectes. Parasttology 92,3 l-50. 19. Gibson, W. C., Dukes, P , and Gashumba, J. K. (1988) Species spectfic DNA probes for the tdenttfication of African trypanosomes m tsetse flies. Parasztology 97,63-73. 20 Barnes, D A., Mottram, J., Selkirk, M., and Agabtan, N. (1989) Two variant surface glycoprotem genes distmgutsh between different substrams of Trypanosoma brucez gambiense
Mel Blochem Parasrtol
34, 135-146.
CHAPTER20
Detection and Identification of the Four Malaria Parasite Species Infecting Humans by PCR Amplification Georges
Snounou
1. Introduction The detection and identification of the four Plasmodium species that infect humans in samples obtained from the human or the insect hosts, are central for all the studies aimed at understanding the biology, immunology, pathology, and epidemiology of the malaria parasite. Knowledge of these areas underpins the instigation and implementation of measures aimed at controlling a disease that has afflicted, and continues to afflict a major portion of humanity with far-reaching social and economic consequences. The use of microscopy to detect malaria parasites in stained blood smears was introduced shortly after the discovery of these organisms in 1880, and remains today the most practical and reliable means by which parasites are detected in blood samples. The advantages of microscopy are numerous. The method is comparatively cheap and can be used under practically any field conditions, adequate training being quickly and effectively imparted to personnel of all educational levels. With experience, detection and identification of parasites can be achieved with a high level of accuracy. The relatively minor disadvantage of the method is the amount of time required to detect parasites in persons with low level of parasitemias, or who are infected with two or more species of PZasmodium, in particular when one species predominates numerically. From
Methods Nuclerc
m Molecular Aod Methods
Biology, Edlted
Vol 50 Specres Dlagnosbcs frotoco/s PCR and Other by J P Clapp Humana Press Inc , Totowa, NJ
263
264
Snounou
Nonetheless, for the purposes of clinical diagnosis, rt IS unlikely that the universal status of mrcroscopy will alter in the future, especially with the introductron of novel staining techniques that allow for faster parasite detection (1,2). Although microscopy IS adequate for the purposes of most epidemiological surveys, the number of samples involved, as well as the desirability for high sensitivity of detection and accurate identification, have spurred researchers to seek alternative methods. Protocols based on the detection of circulating antibodies to the parasites as well as its antigens in the human and mosquito host, have been successfully devised and improved since the 1950s (3,4), culminating in the highly practical albeit expensive ParasrghtTM test for P. falciparum (5). Higher levels of sensitivity and accuracy have also been obtained through the detection of parasite nucleic acids by hybridization with radioactive and nonradioactive DNA probes (6). The exploitation of molecular biological techniques has culminated in the use of the polymerase chain reaction (PCR) (7), which representspotentially the most sensitive method for the specific detection of a particular DNA sequencein a given sample, since theoretically only one copy of the target sequenceneeds to be present in the sample for successful amplification. The limitation of this technique would, therefore, reside solely in the amount of the sample that can be screened. A number of efficient PCR-based protocols have been devised and validated using field samples (8-11). The method presented here remains to date the only protocol which will establish with a high degree of reliability the presence, in any sample, of fewer than 10 parasites from the four human malaria species: P. falciparum, P. wax, P. malariae, and P. wale (12). The detection of the amplification product is achieved solely through ethidium bromrde staining following electrophoresis in an agarose gel. The target of the PCR amplification is the gene coding for the small subunit ribosomal RNA, ssrRNA. These genes consrst of regions whose sequence is conserved among the different species, interspersed with regions containing sequencesspecific to each of the species (13-Z 6). These differences have been exploited to design genus- and species-specific oligonucleotide primers suitable for PCR analysis. The use of so-called nested PCR has been adopted in order to obtain the desired level of sensitivity. Consequently, five pairs of oligonucleotide primers are required.
Identificafon
of Malaria
Parasites
265
Briefly, in an initial amplification reaction (Nest I), DNA purified from the sample to be analyzed, is used as a template for the amplification of a large portion of the plasmodial ssrRNA genes, should the sample contain a Plasmodium parasite. The ohgonucleotide primer pairs used for this reaction are genus-specific and will, therefore, amplify the target from the four species. In order to determine which of the parasite species is present m the sample, four separate amplification reactions (Nest 2) must be performed for the detection of each of the four species. The template for these reactions is a small proportion of the amplification product obtained following the Nest 1 reaction. The sequence, specifkity, and the expected size of the amphfication products obtained using all the oligonucleotide primer pairs is given in Table 1. Thus, in order to establish the presence or absence of the four human malaria species in a sample, five separate PCR amplifications are required. However, only one aliquot from the genomic DNA template prepared from the sample is required (Fig. 1).
In the following sections a detailed description is given for the procedures required for the collection of samples, the preparation of DNA template, setting up the nested PCR, and the analysis of the amplification product. 2. Materials 2.1. Designated
Areas
Ideally the following procedures should be carried out m physically separated rooms: 1. 2. 3. 4. 5.
DNA template preparation from samples and their storage; Storage, preparation and aliquotmg of PCR reagents; Addrtton of DNA template to amplification reaction tubes; Addition of template from the Nest 1 to the Nest 2 reactions; and Analysis and storage of PCR product (see Notes 1 and 2). 2.2. Equipment
The following equipment (see Note 3) is required to carry out the procedures: 1. Sterile lancets or needles, ethanol, and glass shdes for blood smears. 2. Filters for collection of blood, or 1.5-mL Eppendorf tubes containing 1 mL of transport medium (see Section 2.3.). 3. Microfuge for the centrlfugation of 1.5 mL of Eppendorf tubes.
Table 1 Oligonucleofide Primers Sequence
Product size
Specificitylreactlon
Name
Plasmodium genus Nest 1
rPLU5 rPLU6
5’-CTT GTT GTT GCC TTA AAC TTC-3’ 5’-TTA AAA TTG TTG CAG TTA AAA CG-3’
-1 2kb
P falclparum Nest 2
rFAL 1 rFAL2
5’-TTA AAC TGG TTT GGG AAA ACC AAA TAT ATT-3’ 5’-ACA CAA TGA ACT CAA TCA TGA CTA CCC GTC-3’
205 bp
P. vivax Nest 2
rVIV1 rVIV2
5’-CGC TTC TAG CTT AAT CCA CAT AAC TGA TAC-3’ 5’-ACT TCC AAG CCG AAG CAA AGA AAG TCC TTA-3’
P. malariae Nest 2
rMAL1 rMAL2
5’-ATA ACA TAG TTG TAC GTT AAG AAT AAC CGC-3’ 5’-AAA ATT CCC ATG CAT AAA AAA TTA TAC AAA-3’
144 bp
P. ovale Nest 2
rOVA1 rOVA2
5’-ATC TCT TTT GCT ATT TTT TAG TAT TGG AGA3’ 5’-GGA AAA GGA CAC ATT AAT TGT ATC CTA GTGJ’
-800 bp
120 bp
Plasmodium rPLU6-
- Specific -
fPLU5
( ca. 1200
bp
P falciparum tXI
S&l-L--L
I? vivax
rFAL2
I? ova/e
F? malariae ML,
-L-L
rMAL2
OVA1
a
-
OVA2
Fig. 1. Schematic representation of the specific amplification from the ssrRNA gene of the four human Plasmodium species through the use of nested PCR. The approximate position of the oligonucleotide primer pairs used as well as the size of the specific product is also given. Dark hatched areas represent regions of the genes that are specific to each of the parasite species, whereas lightly hatched areas represent sequencesthat are highly conserved among the species.
268 4. 5. 6. 7. 8.
Snounou Micropipetors and tips Water vacuum and trap Thermal cycler. Apparatus for agarose gel electrophoresis. Photographic equtpment and UV transtllummator.
2.3. Reagents The solutrons required for the PCR analysis are the following (see Note 4): 1. Transport medium: RPM1 1640 with L-glutamme. This is usually supplied in sachets sufficient for 1 L total vol. In addition to the RPM1 powder, dissolve the followmg in a total vol of 1 L with water: 2.300 g NaHC03, 5 957 g HEPES, 0.025 g gentamycm, 0.050 g hypoxanthme, 2.000 g glucose, and, finally, heparm 1sadded to a final concentration of 10 U/mL. Make fresh and store at 4°C or -2O’C. 2. 10% (w/v) saponin solution m water. Add sodium azrde to a final concentration of 0.01% to prevent yeast growth. Sodium azide IS highly toxic, therefore, care must be taken m handling this chemical and the saponm solution. Store at 4°C 3. Physiological saline. All blood isotonic solutions are adequate, Krebs glucose salme (KGS) or phosphate buffered salme (PBS) for example. Store at 4°C. 4. Lysts buffer: 40 mM Trrs-HCl, pH 8.0, 80 mM EDTA pH 8.0, 2% SDS. Store at room temperature. The pronase E stock (25 mg/mL m water, stored at -2O’C) is thawed and added to a final concentration of 2 mg/mL immediately before use. Although pronase E could be omitted, tt 1spreferable to use it. 5. Phenol and phenol/chloroform/tsoamyl alcohol (50:48:2), both solutions equilibrated in Tris-HCl, pH 8.0. Store m the dark at 4°C. 6. 3M Sodium acetate with the pH adjusted to approx 5.0 with glacial acetic acid. Store at room temperature. 7. Absolute ethanol and a 70% ethanol solutton m water. Store at -20°C. 8. TE buffer: 10 mMTris-HCl, pH 8.0,O.l mMEDTA, pH 8.0. Store at room temperature. 9. PCR buffer, the composition of the 10X stock is* 500 mM KCl, 100 mM Tris-HCl, pH 8.3,20 mMMgCl*, and 1mg/mL gelatin. Store at 4°C or-20°C. 10. A stock solution with a concentratton of 5 mM for each of the four dNTPs: dATP, dCTP, dGTP, and dTTP. Store at -20°C. 11. A 2.5 @4 stock of each ollgonucleottde primer (see Note 5). 12. Amphtaq polymerase (Cetus, Norwalk, CT). 13. Mmeral oil.
Identification
of Malaria
Parasites
269
14. Loading buffer, the composttion of the 5X stock is: 50 mA4 Trts-HCl, pH 8.0, 75 n&J EDTA, pH 8.0, 0.5% SDS, 30% (w/v) sucrose, 10% (w/v) Ficoll (average mol wt 400,000), and 0.25% (w/v) approx of Orange G dye. If Ficoll is not available, use 40% sucrose. Store at room temperature. 15. TBE buffer, the composition of the 10X stock is: 1M Tris-HCl, 1M boric acid, 50 mJ4 EDTA. A pH of approx 8.3 should be obtained without any adjustment. Store at room temperature 16. SeaKem agarose or equivalent, and NuSieve agarose are both available from FMC Bioproducts (Rockland, ME). 17. Ethidmm bromide solution containing 10 mg/mL of water. Extreme care should be taken when handling this solution, as this chemical is highly carcinogenic. Store m the dark at 4°C.
3. Methods 3.1. Collection of Samples Blood for malaria PCR analysis is most easily obtained by finger prick. Samples from venepuncture are treated in a similar fashion. Samples from mosquito midgut or salivary glands are obtained by dissection. The aim of the collection procedure is to safeguard the parasite material, and in particular the DNA, from degradation and cross-contamination. The way in which the blood is collected depends on the availability of cold storage. The ideal would be to have access to ice, a freezer, or dry ice. Such cold storage conditions are rare under field conditions, particularly for trips of more than 24 h duration. In many cases, the storage and transport of the sample will have to be done at ambient temperature and humidity. A number of methods have been devised for this purpose. Collection on paper or glass filters allows for long-term storage of the sample before processing (I 7). Collection in transport medium will permit storage for 12-24 h at ambient temperature, but the sample must be further treated should a longer period of storage be required (12). Samples obtained from mosquitoes can also be processed in order to obtain template suitable for PCR analysis. It must be borne in mind that should parasites be present in the last blood meal before capture, a positive PCR result will be obtained. Therefore, if the presence of sexual stages of the parasite needs to be ascertained, it is important to keep the mosquito in captivity for a few days, in order to allow full digestion of the ingested blood. Dissection of the mosquito to obtain the midgut or salivary glands will allow further precision in determining the insect’s
Snounou parasite load. The whole insect (without the legs and wings), or the dissected organs can be placed in lysis buffer (25 uL), and the DNA template purified by phenol extraction as described later for parasites obtained from blood. It should be noted that DNA obtained from whole mosquitoes has resulted in the detection of Plasmodium by amplification, however, some inhibition of the reaction was observed (28). In studies where DNA from isolated P. falciparum oocysts was used as a PCR template, some alteration of the extraction and amplification protocols were found to improve the yield of the PCR product (19). The presence of host cells in the sample is not generally detrimental to the PCR analysis, provided it is not excessive. It could even be considered advantageoussince it would allow the existence of a variety of genetic traits of the human host to be established, such as hemoglobinopathies or HLA profiles, mosquito vector.
and might be used to determine the species of the
3.1.1. Collection on Glass or Paper Filters This method is highly practical under field conditions, but with respect to PCR analysis suffers from some disadvantages (see Note 6). The collection of blood samples on filter papers is performed as follows: 1. Clean the finger with alcohol before pricking with a sterile lancet or needle. 2. Make thm and thick smears, which are labeled immediately. 3. Collect drop of blood on the filter and label immediately, ensuring that no cross-contammatron occurs between samples. 4. Allow to dry fully, taking care that the blood spot ISprotected from msects. This step might be problematic under conditions of high humidity. 5. Store the samples in sealed bags under absolutely dry conditions.
3.1.2. Collection in Transport Medium This method has the advantage of allowing the isolation of DNA tem-
plate in relatively concentrated solutions, from the large volumes of blood that can be collected (50-500 uL). The processing that is required following the 12-24-h storage period at ambient temperature immediately following collection can be performed under field conditions provided centrifugation of tubes at approx 5000g for a few minutes can*be performed. The protocols for DNA purrtication presented later are based on this method of blood collection.
Identification
of Malaria
Parasites
271
Before blood collection, prepare the following: labeled slides for thin and thick blood smears and sterile and PCR clean Eppendorf tubes containing 1 mL of transport medium that has been aliquoted under sterile and PCR clean conditions (see Note 7). The tubes are labeled, preferably before embarking on the collection trip (see Note 8). The collection procedure is carried out as follows: 1. Clean a finger with alcohol before pricking with a sterile lancet or needle.
2. Make thin and thick smearswith the first drop of blood. 3. Collect the next drop(s) of blood (50-500 pL) into the Eppendorf tube
4. 5.
6. 7.
prepared as just described. The easiest way is to place the finger over the lip of the tube and allow the blood to flow inside the tube. Trial and error with the particular type of tubes available will soon give the best method. The most important aspect of the collection is to have all the blood inside the tube, and none on the outside, so as to minimize contamination. Ensure that the lids are tightly closed immediately followmg collection. Mix the blood thoroughly with the transport medium. Check that the tube label corresponds to the labels on the smears and the epldemiological record sheets.Once a particular label has been assigned to a person/sample, it is strongly advised to retam that designation for all material derived from this sample, as this will minimize possible confusion. Place the sample tubes m a new box, and in exactly the same order as they were collected. The samples can be kept at ambient temperature, but not in direct sunlight for up to 24 h. Avoid temperatures above 37OC during this period, as parasites tend to die rapidly at higher temperatures, and thus their DNA will
start to degrade.During storageit 1sadvisable to mix the contentsof the tubes every few hours, as the parasites will be growing. Parasite growth ultimately could be of advantage,particularly for P.falciparum, since ring stage parasites will go through to the late trophozoite stages in which the
DNA content is higher, as the chromosomesare replicated in preparation for schizogony. 8. Upon returning to the laboratory, either process the samples immediately, or store the samples at -20 or -7OOC where they can be kept for many months.
3.2. DNA Template Preparation The aim of sample processing is to obtain DNA of sufficient quality to serve as a template for PCR amplification. It is important to choose a method that is reliable and consistent. The two most important consider-
272
Snounou
ations when preparing DNA template are: The avoidance of DNA degradation, and the removal of PCR inhibitors. The presence of endogenous (parasite) and exogenous (host as well as contaminating bacteria or yeast) nucleases are solely responsible for the degradation of the DNA in a sample. Nucleases can be inactivated by boiling, or by the total removal of Mg2+, which is essential for the catalytic activity of practically all the enzymes mvolved in nucleic acid metabolism. A number of substances present in blood, such as the heme moiety (presumably because of the iron), and some anticoagulants, such as heparin, have been shown to inhibit amplification. Obviously, as the purity of the DNA increases, the likelihood of PCR inhibition decreases. Thus, given the constraints of time, efforts should be made to obtain DNA of the highest possible purity from the samples. The advantagesof pure DNA by far outweigh the slight inconvenience of a more cumbersome purification protocol. A flowchart of the procedure described herein is given in Fig. 2. 3.2.1. Concentration
of the Parasites
The samples can be processed for PCR template purification immediately following collection. If the samples had been stored in the freezer, allow to thaw on ice before proceeding. Throughout the processing, it is very important to avoid cross-contamination between samples, and completely prevent contamination with PCR product. Thus, all the equipment and solutions used must be PCR clean, and used in a PCR clean environment. Avoid having two sample tubes open simultaneously whenever possible. The parasite material constitutes a very minor portion of the sample. It is therefore desirable to remove all the serum, and most of the red cell membranes and cytoplasmic contents before purification of the DNA template is initiated. Clearly, this is advantageous, since most of the potential PCR inhibitors that might be present in the sample, are likely to be completely removed. Concentrating the parasites in blood samples can be achieved, simply by lysing the red blood cells and thus releasing the parasites, which can then be recovered by centrifugation. White blood cells, or their nuclei, are also usually recovered with the parasites. 1. Frozen samples should be thawed on ice, which can take a consxderable
time. The samplescanbe taken out of the freezerand left at room temperature m order to defrost faster, however, once thawed they should be placed on ice immediately. The steps performed before the addltlon of lysls buffer addition should be performed as quickly as possible.
1 ml Transport Blood from fingerptick 5Opl- 5OOFl
Can be kept up to 24 hr at or below 37 “C
/I
I
Extract with
foK%‘by phenol/chloroform
Can be stored at ambient temperature for Ion periods 7days) Lyse with saponin and recover parasites and white blood cells
Should be kept at 4%
Medium
Discard supernate and resuspend in Lysis Buffer
Recover the DNA by ethanol precipitation
DNA can be stored dry or in solution for long periods (years)
Fig. 2. Flowchart detailing the steps required for the collection of blood samples and the subsequent purification of the DNA template.
274
Snounou
2. Add saponin to a final concentration of approx 0.05% using a new pipet tip for each sample. Five mtcrohters of a 10% saponm stock solution should be enough for each sample. Keep the tubes on ice until all the samples have been supplemented with saponin. 3. Once saponm has been added to all the samples, mix the contents of the tube by vortexmg, and place at room temperature, since breakdown of the red blood cell membrane by sapomn is achieved faster at ambient temperature. This step is considered to have taken place when the solutron loses turbidity and the color of the solution turns bright red. 4. Replace the tubes on ice nnmedlately after observing the breakdown of the red blood cells. 5. Parasites and white blood cells are recovered by centrifugation, with a 5-mm spin at 5OO@-SOOOg being sufficient. This step can be done at ambient temperature, provided the samples are placed on ice immediately after centrtfugation. It 1sstrongly advisable to orrent the tubes m the centrifuge, in such a way that the position of the pellet is known, this is important for reducing the risk of accidentally sucking off the pellet, which is usually reddish brown and very small in stze.In caseswhere the saponin-induced breakdown of the red blood cells proves to be mcomplete, m other words, red blood cells are observed m the pellet, steps 3-5 can be repeated by adding 1 mL of cold saline to which saponin to a final concentration of 0.05% has been added, mixmg by vortexing, and recovermg the parasite and white blood cell pellet by centrifugation. 6. Using a drawn-out glass Pasteur pipet, or fine pipet tip, attached to a water vacuum pump and a liquid trap, remove as much of the supematant as possible without disturbing the pellet, a process much helped by knowing the position of the pellet in the tube A layer of red blood cell ghosts, which can be discarded, is sometimes observed above the pellet, especially when the blood volume is large. There is no necessity to remove all the liquid. However, ensure that the final volume does not exceed 75 pL. Store each tube unmediately on ice, once the supematant has been discarded. When large numbers of samples are processed, the same Pasteur pipet can be used to remove the supematant provtded the following steps are followed assiduously: a. Minimize irnmerston of the pipet tip in the sample; and b. Wash the pipet by immersion in PCR clean water and allow a few mtlliliters to be sucked off, after removing the supematant from each sample, and before reuse of the pipet. 7. Although the obtained pellets can be stored frozen, it is strongly advised to proceed immediately with DNA template purification, or at least its first step, namely resuspension of the pellet in lysis buffer.
Identification
of Malaria
Parasites
275
3.2.2. DNA Extraction Simple boiling of the parasite pellet has been used successfully (12,20), and provides a very rapid method for obtaining a PCR template. The parasites are resuspended in a small volume of buffer, PCR buffer being adequate, overlaid with mineral oil, and boiled for 10 min. Following a brief centrifugation, an aliquot of the supernatant can be used for initiation of the amplification. However, the boiled mixture is rich m nutrients and thus any bacteria or fungus that might contaminate the sample will be able to grow very quickly, resulting in DNA degradation. Therefore, aliquoting from these tubes must be performed under sterile conditions, and using sterile tips. Once a tube has been opened after boiling, or an aliquot has been removed from the boiled sample, storage in a freezer is very strongly recommended. The danger of DNA template degradation and the consequent requirements for extensive precautions, are the major disadvantages of this method. Phenol extraction followed by ethanol precipitation is the preferred method and should be used whenever possible. The purity of the DNA obtained is very high and, as a consequence, PCR inhibition is minimized and very long-term storage of the DNA sample, either in solution at low temperatures, or dry at room temperature is possible. Protocols to recover DNA from dried blood spots by boiling with Chelex are described elsewhere (17). In order to phenol extract DNA from dried blood spots, immerse the blood spot in water, vortex briefly, and leave for a few minutes, thus allowing lysis of the red cells and leaching of their cytoplasmic contents. The tube is then centrifuged and the supernatant discarded. Twenty-five microliters of lysis buffer are then added, and the volume made up to 100 PL with water. Should a larger amount of water be required to immerse the filter, the volumes in the following procedure will have to be amended proportionally. The procedure for the extraction of DNA from the parasite pellet is as follows: 1. Resuspendthe pellet by adding 25 pL of lysis buffer and vortexing. Following the addition of the lysis buffer, the samples are stable at room temperature for l-2 wk, and indefinitely at 4 or -20°C. If samples are to be stored for a long time, or are to be mailed or transported, wrap the top of tube in Paratilm to ensurethat no leakage or cross-contamination occurs.
276
Snounou
2. Add distilled water to a final volume of 100 pL. This step is optional, since m many cases the volume of the pellet is close to 75 uL. It ts, however, practical to have equal volumes for all the samples Since accuracy IS not of paramount tmportance at this stage, estimation of the volume by eye is sufficient. Mtx by vortexing to ensure that the pellet is fully resuspended The resultmg solution is frequently very viscous, therefore, care must be taken not to lose any material on the pipet ttp used to resuspend the pellet. A new pipet tip must be used for each sample. Leave the mixture at 3&37”C for 4-l 5 h. 3. Followmg incubation, add another 300 pL of disttlled water and mix. This step is cructal for the resultmg quahty of the DNA and must not be omitted. The lysate IS frequently quite vtscous and the mixture might require incubation for a few mm at room temperature with frequent vortexing to obtain a relatively homogeneous solution. 4. Add an equal volume (approx 500 pL) of Trts-equihbrated phenol, pH 8.0. Vortex or shake vtgorously by hand m order to mix the phases thoroughly. Care must be taken to close the caps of the tubes tightly. The aqueous phase, which will be the top one, 1s separated from the phenol phase by centrifugation at room temperature, 13,000-l 5,000g for 10 mm. 5. Recover the top aqueous phase, using a new pipet tip for each sample. Ensure that all the aqueous phase including the interphase 1s collected is removed for the next step. This is important as frequently the solution IS viscous and that an appreciable amount of DNA is present at the Interface. It is ill-advised to discard any of the material at this stage, as it is always possible to repurify the DNA at a later date. Transfer the aqueous phase to a new prelabeled tube. 6. Add an equal volume of phenol-chloroform, vortex or mix by hand, and recover the aqueous phase by centrifugation as m step 4, which is then placed in a new prelabeled tube to which 45 pL of a 3.OA4 sodtum acetate solutton, pH approx 5.0, have been added. 7. Mix by gentle vortexing, before addmg approx 2 vol, m this case 1 0 mL, of cold (-20°C) absolute ethanol. Mix the contents thoroughly by vortexmg or by frequent and rapid inversions of the tube Although a precipitate IS sometimes seen at this stage, m the malortty of the cases where only small volumes of blood are processed, no precipitate IS visible. When DNA is prepared from mosqmto samples, precipitation with isopropanol (final concentration of 60%) has been found to give better results (19). 8. Place the tubes at -20 or -70°C overnight. Storage for shorter times, especially at -70°C is adequate. 9. The DNA 1s recovered by centrtfugation at room temperature, 15,00018,OOOg for 10 mm. It 1s advisable to place the tubes in the centrifuge m
Identification
of Malaria
Parasites
277
such a manner that the position of the pellet is known. Remove the supernatant very carefully with a drawn-out Pasteur pipet or a fine plastic pipet tip. The pellet is sometimes so small as to be Invisible, therefore, special care must be taken to avoid disturbing the pellet, usually by leaving a small volume (50 pL) of liqutd in the tube. It should be pointed out that depending on the angle of the tube in the centrifuge, the DNA is sometimes deposited high up on the tube wall, rather than at the bottom. It is therefore, advisable to examine carefully the side of the tube on which the pellet should be before removing the supernatant. The drawn-out Pasteur pipet can be reused, provided the precautions just described for the removal of the supernatant from the lysed blood are assiduously followed. 10. The DNA pellet is washed by adding 0.8-l .OmL of 70% ethanol. Although this ethanol solution is usually stored in the cold, there is no harm in allowmg the washed pellet to remam at room temperature for a short time. Recover pellet by centrifugation at room temperature, 15,000-l 8,000g for 10 mm. Remove the supernatant as in step 9. Followmg the 70% ethanol wash, the pellet sometimes becomes loosely attached to the tube wall. 11. Dry the pellet at room temperature, or by briefly placmg the tubes in vacuum chamber. In both cases the tubes are kept with the lid open but with a strip of Parafilm tightly wrapped across the mouth of the tube, and punctured with a needle. 12. When dry, the DNA can be stored indefinitely at room temperature, provided it is kept in a sealed tube, and protected from humidity. Otherwise, resuspend with TE buffer. The volume of TE buffer usually added is such that 1 uL of DNA solution corresponds to 5 pL of the blood sample. Smaller amounts of TE buffer can be used, although the vrscosity of the solution might become a problem. Store at 4°C for short-term storage (a few weeks), or frozen for long-term storage.
3.3. The Nested PCR The type of amplification used for the oligonucleotides presented here is known as nested PCR, the product being obtained following a double amplification. The product of the first reaction (Nest 1) is used as the DNA template for a second amplification reaction (Nest 2), in which the oligonucleotide primers used recognize sequences contained within the DNA product of the Nest 1 reaction. The advantages of this method are a substantially increased detection resolution and a decreased sensitivity to minor variations in the amplification conditions and DNA template quality. The disadvantages are that more time and materials are required as well as an increased risk of contamination. However, the fact that about
278
Snounou
one parasite genome can be regularly detected outweighs these disadvantages. Contamination can be avoided provided the precautions and methodology described in the following are assiduously followed. 3.3.1. Setting
Up the Amplification
Reaction
For all the PCR amplifications, the volume used for each reaction is 20 PL. A master mix containing all the reagents, except for the DNA, is prepared and aliquoted into the reaction tubes (see Notes 9-l l), and overlaid with mineral oil (see Note 12). It is worth making sure that the reagents are fully thawed out and vortexed before being used to prepare the master mix (see Note 13). The DNA template is always added last. In order to minimize contamination, all template addition is made after
the aliquoted reaction mixtures have been overlaid with 011.Reaction mixtures for Nest 1 and Nest 2, as well as the template addition for
Nest 1, can be made and aliquoted in the same room. However, template addition for the Nest 2 reaction must be performed in a separate room.
Product analysis must be done in a third room, in which none of the reagents used for PCR should ever be opened or, preferably, stored. 1. Remove the PCR buffer and ohgonucleotide primers from the freezer and allow to thaw. The PCR buffer is stable indefinitely at room temperature, whereas the oligonucleotide prtmers will not suffer from being placed repeatedly at ambient temperature for a few min at a time.
2. Add in the following order the appropriate volumes of reagents to the labeled master mix tube. water, PCR buffer, oligonucleotide primers. The final MgCl* concentration is 2 mJ4, variations m the MgC12 (l-3 mM) have not been found to affect the efficiency of the amplification. Each ohgonucleotide primer is used at a final concentration of 250 I&& and, although lower amounts of oligonucleotide primers (125 nk!) have been successfully employed, decreased efficiency of amplification might result. The oligonucleotides pairs used in the Nest 1 and Nest 2 reactions are given m Table 1, 3. Remove the dNTP ahquot from the freezer, thaw, add appropriate amount to the master mix tube, and replace immediately in the freezer. The final concentration of the dNTPs is 125 ~JV. 4. Remove the Tag polymerase from the freezer, add the appropriate amount to the master mix tube, and replace immediately m the freezer. A total of 0.4 U of enzyme is used for each 20-pL reaction (2 U/100 pL). 5. Mix the contents of the master mix tube thoroughly by vortexmg (see Note 14).
Identification
of Malaria
Parasites
279
6. Aliquot 20 pL of the master mix to each tube. Remember to open only one experimental tube at a time, closmg it as soon as the master mix is aliquoted. The same ttp can be used for all the tubes. 7. Add 50 pL of mineral oil to each tube, taking care to avoid splashes by adding the oil on the side of the wall at the top of the tube and allowing gravity to do the rest. It is very important that the same volume of oil is added to each tube. The same tip can be used for all the tubes. 8. DNA template addition must be made last, and only after overlaying the master mix with mineral oil, so as to ensure a minimum risk of contamination. The appropriate amount of DNA template (usually 1 pL) is added by immersing the micropipet tip znto the oil, preferably in the middle of the oil layer. The droplet will sink in the oil and merge with the master mix. This procedure will prevent aerosols escaping and avoid contaminating other tubes. 9. When ahquoting the product of the Nest 1 reaction as a DNA template for the Nest 2 reaction, the following procedure must be used. Remove the DNA template aliquot from the Nest 1 tube from under the oil, taking care that it is the product and not the oil that is removed! This is achieved by placing the tip of the micropipet in the middle of the aqueous layer, just below the oil and without touching the tube walls. Check that it is indeed the DNA template that is added to the Nest 2 tube, by observing the droplet as it is added to the oil layer in the Nest 2 tube. This procedure will prevent aerosols escaping and avoid contaminating other tubes. With practice, aliquoting from one Nest 1 tube to several Nest 2 tubes could be achieved without contamination using one tip. If in doubt, however, use a new tip for each manipulation. 10. Do not mix the contents by vortexuzg the tubes, as this will result in an increased risk of contamination, and will necessitate a centrifugation step. The cycling parameters for the PCR amplification are as follows (see Notes 15-l 7): Nest 1 Step 1 95°C for 5 min Initial denaturation Step 2 58°C for 2 min Annealing Extension Step 3 72°C for 2 mm Step 4 94°C for 1 min Denaturation Step 5 Repeat steps 2-4 a total of 25 times. Step 6 58OCfor 2 min Final annealing Step 7 72°C for 5 min Final extension Step 8 The reaction is completed by reducing the temperature to 20°C (see Note 18). Nest 2 is performed as NEST 1, except that in step 5, steps 2-4 of the cycle are repeated 30 times.
280
Snounou
11111111111111111 I? vivax
I
I I? malariae
III
llrllllllllllll f? ova/e
Fig. 3. Examples of the PCR analysis of the DNA contained in a 5-pL blood sampleobtained from patientsattending a malaria clinic in Thailand. The amplification product was electrophoresedon a 2% agarose:NuSieveagarose(3: 1) in TBE buffer, and visualized under UV light following ethidium bromide staining. The numbers above the panels representthe patient numbers, whereas the lanes marked (+) and (-) are the positive and negative controls.
3.4. Analysis
of the PCR Product
3.4.1. Electrophoresis
As a result of the very high sensitivity of the nested PCR methodology, the amount of amplification product obtained from one parasite is sufficient for visualization by ethidium bromide staining following electrophoresis. The DNA products expected from all the different amplification reactions, fall in the size range of -800-120 bp (Fig. 3). The NuSieve agarose/agarose provedto be an ideal mediumbecauseof the easeof utilization, and the fact that a gel can be reusedfor a large number of times (seeNotes 19 and 20). This is a particularly useful property since both types of agaroseare relatively expensive.Although the suppliers of NuSieve agarose(FMC Bioproducts, Rockland, ME) recommend a 3%
Identification
of Malaria
Parasites
281
(w/v) gel with a 3: 1 ratio of NuSieve agarose:agarose,equally successful resolution of product can be obtained with gels in which a cheaper ratio is used, namely a 2% (w/v) gel with a 1:3 ratio of NuSieve agarose to normal agarose. The gels are made and electrophoresed in TBE buffer. Following boiling and pouring the agarose mix into the gel cast, allow the gel to set for at least 30 min before removing the combs and using. In order to prepare the PCR product for electrophoresis add 5 p.L of loading buffer to the tubes at the end of the Nest 2 amplification. A brief centrifugation will bring the loading buffer under the oil layer. It is very important to mix the PCR reaction with the loading buffer before loading onto the gel. This is best done not by vortexing, which will require a further centrifugation step, but by repeatedup-and-down pipetinglust prior to loading onto the gel. The positive controls for the PCR amplification will be sufficient as a size marker. It is advisable and sufficient to use 12.5-15 pL from the total of 25 yL when analyzing the PCR product, and to store the remainder, until the results have been interpreted and recorded correctly. The tracking dye, Orange G, migrates below the level of the smallest PCR product expected, thus electrophoresis is carried out until the Orange G reaches the end of the gel (10 cm of migration is sufficient). DNA is visualized under ultraviolet (UV) illumination, following staining by ethidium bromide. Ethidium bromide is a very carcinogenic chemical. Consequently, ethidium bromide is neither added to the gel nor to the TBE buffer. The gel is better stained following electrophoresis, by immersion in TBE buffer contaming ethidium bromide (0.5-l .O pg/mL) for a period of 30 min. It is then destained by placing in TBE buffer for a minimum of 10 min. Destaining times of up to 3 h are unlikely to result in appreciable loss of the DNA product bands. 3.4.2. Interpretation The specificity of the oligonucleotide primer pairs used to detect and identify the Plasmodium species is very high, and the amplification products from the four reactions have diagnostic sizes (12). The efficiency of amplification by nested PCR is such that the amount of product obtained does not alter with a large range of parasite DNA in the original sample (12). The observation of specific PCR product of varying intensity is an indication that the amplification reaction is not functioning at full efficiency, this is most commonly observed when PCR inhibitors are still present in the DNA template (IS). When the amount of parasite material
282
Snounou
present in the sample under analysis is very low, mconsistency in the amplification might be observed. In other words, repeated amplification from the same sample could result in the detection of product in some cases but not others. This is owing to the very high sensitivity of the PCR analysis presented here, in which only a few parasite genomes are required to give a positive result. Thus, if the concentration of DNA template in the aliquot used for the analysis is equivalent to less than one parasite, the result of the amplification will depend on the probability of picking the target DNA in this aliquot. A DNA product of -1.2 kb in size, which represents the product from the Nest 1 reaction, is sometimes observed, particularly when the number of parasites m the samples is high. The relatively large size of the specific PCR product obtained for P. ovale necessitates longer electrophoresis in order to improve the size resolution of the DNA bands. Two types of ssrRNA genes, differing in their sequence and size, are known to be present in Plasmodium, one expressed in the asexual stages and the other in the sexual stages (13-16). Although the oligonucleotide primers used for the PCR analysis are designed to recognize only one of the two ssrRNA gene types, amplification from the other gene type is thought to occur when large quantities of parasite DNA are present in the sample. As a result, a specific band of slightly higher molecular size is frequently observed for samples that originally contain a large number of parasites (Fig. 3). 4. Notes 4.1. Designated Areas 1. There are two major problems encountered with the use of PCR. The first is the reduction of the amplification efficiency, which is easily detectable through the use of appropriate controls and that, in addition to human error, is mainly owing to problems with the equipment, or the quality of the reagents or the DNA template. The second is contammation, which invariably is the result of human error. Two types of contammation are possible. In the first, parasite material is transferred between samples (cross-contamination), or between the samples and the PCR reagents. In the second, PCR product from either of the two nested amplification reactions, comes mto contact with the samples, the reagents, or the equipment. The second type of contammation is by far the more serious, and unfortunately the easiest to achieve. The extent of the precautions to be taken ultimately depends on the particular situation of each laboratory, and consequently
Identification
of Malaria
Parasites
283
compromises will almost always have to be made. What must be paramount in the mind of the researcher, is the adoption of procedures in which the probability of contact between the PCR template and the PCR reagents and equipment is minimized, and the PCR product never comes into contact with the samples, the DNA template, the PCR reagents, or the equipment used for their handling. Thus, physically separated areas for the equipment and reagents, must be assigned to the different procedures. 2. When space is at a premium, the first three areas could be combined, provided that care is taken to prevent cross-contammation between tubes. The addition of template for the Nest 2 reaction, however, must be performed in a separate room, and handling of the PCR product requires yet another room. It must be stressed that the setting up of PCR amplifications does not need to be performed under sterile conditions. Ultimately, only one room is required to be dedicated for PCR analysis, namely the room m which the PCR product IS handled. Only access to two other rooms, one for procedures (l-3) and one for (4), will be needed. Since these procedures are relatively short in duration, this should pose little problem even in overcrowded laboratories. The rooms in which procedures (l-3) are carried out are considered as PCR clean, whereas those in which procedures (4) and (5) are performed are PCR dirty. The risk of contamination in the room assigned to procedure (5) is a certainty, whereas in the room where procedure (4) is carried out the risk of contamination is quite small provided good technique is used (see Notes 3,10, and 12). It should be noted that any room can be considered as an absolutely PCR clean room for malaria work, provided the target of the amplification reaction, such as malaria cultures, samples, and especially PCR product, have never been handled within this room.
4.2. Equipment 3. All the equipment (tubes, pipet tips, and containers) to be used for the PCR analysis should be purchased new and dedicated to a specific procedure, and therefore, the appropriate room. Ideally, three sets of micropipets should be purchased, one for sample handling and DNA template preparation, one for PCR reagents handling, and, finally, one for PCR product handling. When using nested PCR, an additional micropipet must obtained and dedicated for DNA template addition from the Nest 1 to the Nest 2 reaction. Positive displacement micropipets, which reduce the risk of contamination, are only advisable for handling solutions that contain DNA template. Expensive filtered tips which might, for example, be considered for the DNA template addition from the Nest 1 to the Nest 2 reaction, are not essential to obtain contamination-free amplification.
284
Snounou The most efficient method to decontammate equipment, should it be suspected of being a source of target DNA, is to soak tt for a few hours m a 0.1-0.2M of HCI, should thts be possible. The acid depurmates DNA, and thus renders it refractive to PCR amplification. Autoclavmg, although of some use, is not as efficient at degrading DNA.
4.3. Reagents 4. All the chemicals to be used for the procedure must be obtained before Initiating the project, and dedicated to PCR work. They must only be opened in an absolutely PCR clean room. Aliquotmg, weighmg, pH adjustments, and storage must be done with absolutely PCR clean materials. Durmg storage, a Paraftlm strip should be used as an extra seal around the closed lid of the bottles. Ahquotmg from the stocks to obtam working solutions must be done under sterile and PCR clean condttions. The hierarchy of stocks and their backup should be considered carefully. It is strongly advisable to divide all chemicals and soluttons, once acqutred, into at least two, preferably three, aliquots The first ahquot is used as the working stock, and the second ahquot should be considered as the backup stock, and only used when the working stock runs out, or becomes “suspect.” Finally, a reference stock should be considered. This stock hopefully should never have to be used, but should provide a backup should a disaster befall the laboratory, consequently, it should be stored m a separate laboratory/building. Contamination of any one of the chemicals or stocks will render the results of the analysis totally mvahd. Once a stock is made, it should be divided up immediately, and the working stock aliquot tested. 4.4. Collection of Samples 5. The calculations used to obtain the concentration of the oligonucleotides have been performed assummg that 330 g 1sthe average molecular weight of each base, and an optical density (ODZbOnm= 1.O) for a 1-cm path m a quartz cuvet is equivalent to a solution containing 20 yg of oligonucleotide primer per milhltter of water. The sequences and names of the ohgonucleotide primers are given m Table 1, 6. The volume of blood that can be collected on a small surface IS relatively little (20-50 yL). Purificatton of the DNA template can only be achieved by either phenol extraction or by boiling with Chelex (17) Both these methods require a number of centrifugation steps. Furthermore, with the boiling method the size of the filter spots is important. A large filter area will require splittmg of the sample m two or more tubes, thus making the processing time consuming and increasing the risks of cross-contamina-
Identification
of Malaria
Parasites
285
tion. Fmally, as a result of the template isolation procedure, the DNA puritied from the sample is obtained as a dilute solution, consequently, only a small proportion of the sample can be analyzed in a given amplification reaction. This is a serious dtsadvantage since the value of the exquisitely sensitive PCR method lies precisely m its ability to detect parasites at very low levels, which can only be achieved by the screening of a larger volume of blood than that examined by microscopy. 7. Sterility will ensure that fungi and bacteria will not grow durmg storage and transport to and from the collection site. The transport medium is usually supplemented with an anticoagulant such as heparm. The pH of the RPM1 changes with storage, thus it is preferable to use fresh RPMI. Tubes ready for sample collection can be prepared long in advance and stored at 4 or -20°C for long periods. Storage for a few days at ambient temperature, when it cannot be avoided, is unlikely to be detrimental. 8. Correct, consistent, and clear labelmg is of the utmost importance. Labeling of the tubes must be done with waterproof indelible ink. The best method is to write clearly on a sticky label that is then wrapped completely around the pertphery of the tube. Labels stick much better to themselves than to plastic, thus the wrappmg is quite important, as is the quality of the glue and paper. Trial and error usmg the available material is advisable. It should be borne in mmd that the labels might get wet or peel off, as might the writing, if storage on me, or m a freezer is considered. Keeping the tubes dry before and after freezing prolongs the life of the label. Another label on the top of the tube, though desirable is not always practical.
4.5. The Nested PCR 9. PCR reactions do not need to be set up under sterile conditions. The tubes and pipet tips do not require autoclavmg, although they must be PCR clean. It should be noted that autoclavmg does not destroy DNA totally, and cannot therefore, be used to “clean up” reagents and materials. Smce the reagents are stored at -20°C sterthty is unnecessary. Moreover, once the reaction is initiated, the temperature does not fall below 58°C and is often at 94”C, conditions hardly suitable for bacterial growth or endonuclease activity. 10. Despite what is written m most manuals, tt 1s strongly recommended to avozd the use of gloves when setting up PCR. Most types of gloves generate a large amount of static electricity, which will trap any aerosols that mtght be formed around the fingers, and promote the dissemmation of these possible contammants. In addition, gloves are not only uncomfortable but also very expensive.
286
Snounou
11. It 1sdetimtely preferable to have PCR tubes with a flat lid on which the label can be written. It is also very wise to place the tubes m racks, in the sameorder asthat of the samples,with thts order being kept throughout the PCR analysis. 12. The use of mineral oil 1scrucial when performing nested PCR, in which more than one tube is used for the two amplification reactions, since it provides an excellent barrier against cross-contamination. Furthermore, the addition of DNA template mto the oil layer reduces drasttcally the risks of aerosol formation and therefore, contamination with DNA template or the Nest 1 PCR product. 13. Provided the freezer where the reagents are stored is close by, and that the scheme described is followed, the requirement for ice during the setting up of the PCR can be avoided. 14. The master mix is stable at room temperature for several hours without loss of efficiency. 15. The opttmizatton of the parameters has performed usmg a PTC- 100 thermal cycler (MJ Research Inc., Watertown, MA), and with the AmpliTaq enzyme/PCR buffer combination described. It is quite possible that changes to cycle number, step ttmes, annealing temperature, and even ohgonucleotide and dNTP concentrations, could be made without altermg the sensitivity and the resolution of the technique. If a different thermal cycler, or another enzyme/buffer combination are used, the reaction conditions described might have to be altered. 16. The heating and cooling rates and the accuracy of the temperature calibration are two parameters that can affect the efficiency of the amplification. The fit of the tube mto the machme 1sextremely important as it affects the rate of heat transfer. The use of a drop of oil in the “holes” of the heating block in the thermal cycler is strongly advised. Tube thickness varies between different suppliers, and will also affect the rate of heat transfer, thus the use of different types of tubes should be avoided. The tube content volume will also alter the rate of heat transfer, thus it is important to keep the volume of the mineral oil overlay constant. 17. The efficiency of amplification can be monitored by including a positive control, to which the template added represents the minimum quantity of DNA required for the detection of the PCR product, namely, that obtained from l-10 parasites. Another positive control to which lOOO-fold more template is added will monitor the quality of the amplification reagents. A muumum of one negative control (no DNA template or human DNA) must be performed each time a reaction is performed. In order to confirm that insignificant levels of contamination arise when performing the PCR analysis, a run of alternate positive and negative samples should be subjected to the nested PCR protocol on a regular basis (21,22).
Identification
of Malaria 4.6. Analysis
Parasites
287
of the PCR Product
18. Once the reaction is complete, the DNA product is quite stable, since any potential contaminating nucleases will have been destroyed by the lengthy incubation at high temperatures. Consequently, the use of a soak temperature lower than 20°C at step 8 is unnecessary, and actually will only result in the thermal cycler working unnecessarily. In fact, m tropical countries where the humidity might be high, temperatures lower than 25°C will result in considerable water condensation on and around the heating block. 19. Following use, gels can be stored indefinitely at room temperature, provided they are submerged in TBE buffer. It is advisable to change the TBE buffer once or twice in the first few days of storage, as ethidium bromide and the Orange G dye diffuse out of the gels. 20. In order to reuse a gel, break it into small pieces and reboil it, making sure that all the agarose has dissolved. The use of a microwave is by far the most rapid and practical way to remelt a gel. Despite frequent reuse, up to 30 times in my experience, the resolving power and integrity of the gel is retained. The only problems likely to be encountered are reduction in the gel volume by loss of fragment or evaporation during frequent reboiling, this might alter the agarose concentration (but is easily remedied by the addition of distilled water), and the accumulation of dust and other dirt particles in the gel. The amount of money saved when large numbers of gels are required is substantial. An important point to bear in mind, is that reused gels will always contain small amounts of ethidium bromide and should, therefore, be handled with care.
4.7. Conclusion 21. The method presented here 1s aimed primarily for use in scientific and experimental investigations aimed at understanding the biology of human Plasmodium species, where it has already been shown to provide novel insights into the epidemiology and pathology of the malaria parasites (11,18,23). The extension of the sensitivity of parasite detection through the use of PCR, as compared to that obtained by microscopy, is illustrated in Fig. 4. Numerically, only 1O-l 00 times less parasites can be detected by PCR as compared to microscopy, the limitation to further improvement being the quantity of sample that can be analyzed. However, unlike microscopic examination, in which the probability of finding a parasite decreases with parasitemia, and where species identification at low parasite levels is somewhat uncertain, PCR analysis should result in the detection and correct identification of the parasites, provided that some are present in the aliquot analyzed.
Parasites 1013 1%
IO'* 3 10"
-
1o'O 0.01% log 0.0001% 0.00001%
-
IO8 10'
Microscopy
PCR
IO6 0.000001%
lo5
-
lo4
i i
:
:
lo3 lo* 1
:
10 1 Parasite
j
b
Time Fig. 4. Parasitemia curve of a possible human infection initiated with a single malaria parasite sporozoite. The parasitemia is expressed as the total number of parasites present in the whole organism, assuming a total blood volume of 5 L with 5 x lo6 erythrocytes/pL. The corresponding percentage parasitemia is also given for some infection levels. The limits of detection by microscopy and PCR are indicated by the shaded bars.
Identification
of Malaria
Parasites
289
Nonetheless, the relative technical complexity of the method requires the availabllity of highly tramed personnel, expensive equipment, as well as accessto a freezer to store the reagents, and a stable source of electricity for the proper functioning of thermal cycler. In addition to the high costs of the enzyme required for PCR amphfication, the method further necessltates careful and lengthy sample preparation, with the results being obtained at best within 14 h once the DNA template is purified, and this for a limited number of samples (depending on the capacity of the thermal cycler) and for the detection of one of the four malaria parasite species only. A further serious disadvantage of PCR technology for routine mvestigatlons, 1s the high potential for contammatlon and the exacting nature of the measures that need to be implemented to prevent it. Therefore, unless the methodology and technology can be drastlcally improved with respect to cost and time consumption, it is unlikely and ill-advised to consider the use of the PCR analysis presented for routme diagnostic purposes or m large scale epldemlologlcal surveys. Acknowledgments The oligonucleotide primers and the methodology for their use have been developed as part of a project funded by The Commission of European Communities EC-Asian Scientific and Technical Cooperation Contract number Cl *0634/UK/SMA. The author would like to express gratitude and thanks to K. Neil Brown, Sodsri Thaithong, Suganya Viriyakosol, William Jarra, Xin Pin Zhu, and Napaporn Siripoon for their generous advice, patient discussions, and substantial contributions to the
elaboration of the protocol presented. The author would also like to thank Chartchai Palanant, Dokrak Thongkong, and the staff of Malaria Region 5 and the Malaria Clinic in Borai (Trad Province, Thailand), as well as Virgilio E. do Rosario and his staff at the Instituto de Higlene e Medicina Tropicais, Centro de Malaria e Outras Doeqas Tropicais (Lisbon, Portugal), for their hospitality and their generosity in providing many of the field samples used to establish the efficacy of the PCR analysis. References 1. Spielman, A, Perrone, J. B , Teklehaimanot, A, Balcha, F , Wardlaw, S C., and Levine, R. A (1988) Malaria diagnosis by direct observation of centrifuged samples of blood. Am. J Trop Med. Hyg 39,337-342 2. Kawamoto, F. (1991) Rapid diagnosis of malaria by fluorescence microscopy. Lancet 337,624,625
Snounou 3. Beter, J C , Perkins, P V., Wntz, R A, Whitmire, R. E., Mugambt, M , and Hockmeyer, W. T (1987) Field evaluatton of an enzyme-linked mnnunosorbent assay (ELISA) for Plasmodtum falctparum sporozolte detection m anophelme mosquitoes from Kenya. Am. J Trop Med. Hyg 36,459468. 4 Taylor, D W and Voller, A. (1993) The development and validation of a simple antigen detection ELISA for Plasmodtum falctparum malaria. Trans R Sot Trop Med. Hyg 87,293 1 5. Shtff, C. J., PremJt, Z., and MmJas, J N. (1993) The raped manual ParaSight@-F test A new diagnostic tool for Plasmodtum falctparum infection Trans R Sot Trap Med. Hyg 87,646-648.
6. Barker, R. H. J (1990) DNA probe diagnosis of parasmc mfecttons. Exp Parastto1 70,494-499. 7 Satkt, R. K , Gelfand, D. H., Stoffel, S., Sharf, S. J., Htguchr, R , Horn, G T , Mullis, K B., and Erhch, H A (1988) Primer-directed enzymatic amphficatton of DNA with a thermostable DNA polymerase. Science 239,48749 1 8 Tirasophon, W., Ponglikitmongkol, M , Wtlairat, P., Boonsaeng, V , and Panytm, S (199 1) A novel detection of a single Plasmodtum falctparum m infected blood Btochem Btophys Res Commun 175, 179-I 84 9 Barker, R. H. J , Banchongaksorn, T , Courval, J M , Suwonkerd, W , Rtmwungtragoon, K., and Wirth, D F. (1992) A sample method to detect Plasmodrum falctparum directly from blood samples using the polymerase chain reaction. Am J Trap. Med. Hyg 46,416-426
10 Brown, A. E., Kain, K. C , Ptptthkul, J., and Webster, H K. (1992) Demonstratron by the polymerase chain reaction of mixed Plasmodium falctparum and P vivax mfecttons undetected by conventtonal microscopy. Trans R Sot Trap. Med. Hyg 86,609-612. 11. Snounou, G., Viriyakosol, S , Jarra, W., Thaithong, S , and Brown, K. N (1993) Identification of the four human malaria species m field samples by the polymerase chain reaction and detection of a high prevalence of mixed mfections. Mol Btochem Parasttol
58,283-292
12. Snounou, G., Vmyakosol, S., Zhu, X. P., Jarra, W , Pmheiro, L., Rosarto, V. E d., Thaithong, S., and Brown, K N. (1993) High sensitivity of detection of human malaria parasites by the use of nested polymerase chain reaction. Mol Bzochem Parasttol 61, 3 15-320. 13. McCutchan, T. F., Cruz, V. F. D. L., Lal, A., Gunderson, J. H., Elwood, H J., and Sogin, M. L. (1988) Primary sequence of two small rtbosomal RNA genes from Plasmodwm
falciparum.
Mol. Btochem Parasttol
28,63-68.
14. Waters, A. P. and McCutchan, T. F. (1989) Rapid, sensitive diagnosis of malaria based on ribosomal RNA. Lancet i, 1343-l 346. 15. Waters, A. P. and McCutchan, T. F. (1989) Partial sequence of the asexually expressed SU rRNA gene of Plasmodtum vtvax. Nucletc Acids Res 17,2 135 16. Goman, M., Mons, B , and Scatfe, J. (1991) The complete sequence of a PZasmodtum malanae SSU rRNA gene and its compartson to other plasmodtal SSU rRNA genes MOE Biochem Parasitol 45,28 l-288
Identification
of Malaria
Parasites
291
17. Kam, K C. and Lanar, D. E. (1991) Determination of genetic variation within Plasmodium falclparum by enzymatically amplified DNA from filter paper drsks impregnated with whole blood. J. Clin Mxrobiol 29, 117 l-l 174. 18. Snounou, G., Pinheno, L., Goncalves, A , Fonseca, L., Dias, F , Brown, K N., and Rosario, V E. d. (1993) The importance of sensitive detection of malaria parasites in the human and mosqurto hosts m eprdemrologrcal studies, as shown by the analysis of field samples from Guinea Bissau. Trans. R. Sot Trop Med Hyg 87,64%53 19 Ranford-Cartwnght, L C , Balfe, P., Carter, R , and Walhker, D. (1991) Genetic hybrids of Plasmodrum falciparum rdenttfied by amplificatron of genomtc DNA from single oocysts. Mol. Blochem Parasltol. 49,239-244. 20 Foley, M , Ranford-Cartwrtght, L. C , and Babrker, H A (1992) Rapid and simple method for isolating malaria DNA from finger prick samples of blood. Mol. Blochem Parasltol. 53, 241-244. 2 1 Wilson, S. M. (1994) Detection of malaria parasites by PCR. Trans R Sot Trop. Med. Hyg. 88,363.
22. Snounou, G , Brown, K. N , and Rosario, V. E d (1994) Detection of malaria parasites by PCR. a reply. Trans. R. Sot Trop Med Hyg. 88,363 23. Black, J , Hommel, M., Snounou, G., and Pmder, M (1994) Mixed mfectlons with Plasmodium falclparum and P malarrae and fever m malaria Lancet 343, 1095
CHAPTER21 The Use of Degenerate Primers in Conjunction with Strain and Species Oligonucleotides to Classify Onchocerca volvulus Thomas
R. Unnasch
and Stefanie
E. 0. Meredith
1. Introduction Onchocerca voZvulus is a filarial parasite that is the causative agent of onchocerciasis, or river blindness. Onchocerciasis is one of the leading causes of infectious blindness worldwide (I), and is believed to be one of the most significant causesof social and economic disruption of the rural communities in West Africa (2). Because of the importance of the disease, there have been and continue to be a number of major programs whose goal is the control or elimination of blinding onchocerciasis. The largest of these programs is the Onchocerciasis Control Programme in West Africa (OCP), a multinational effort that encompasses parts of 11 West African nations (3). In order to efficiently allocate the resources of onchocerciasis control programs, and to assist in measuring their impact, it is necessary to develop ways to accurately measure both the prevalence and annual transmission potential (ATP) for blinding onchocerciasis. The annual transmission potential is a measure of the number of infective larvae that a person who resides in an 0. voZvulus endemic area is exposed to in a year. This is calculated from estimations of the number of black fly bites a person will receive in a given year, the prevalence of infected flies in the vector population, and the average number of larvae carried by an infected fly. From
Methods in Molecular Biology, Vol 50 Species D/agnosbcs Protocols PCR and Other Ah/e/c Aod Methods Edlted by J P Clapp Humana Press Inc , Totowa, NJ
293
294
Unnasch and Meredith
Obtaining data necessary to calculate prevalence and ATP for 0. volvulus is complicated by two factors. First, other parasites of the genus Onchocerca are sympatric with 0 volvulus throughout much of Africa (4). Many of these animal parasites are transmitted by the same species of black flies that serve as the vector for 0. volvulus (4,. Furthermore, the larval forms of these parasites are often difficult or impossible to distinguish morphologically from 0. volvulus (5). Thus, it is possible to misidentify animal parasites carried by the black fly vector of 0. volvulus as the human parasite, leading to an overestimation of the ATP for 0. volvulus. A second complication arises from the existence of a nonblinding strain of 0. volvulus in the rain forest bioclimes of West Africa
(6). The blinding
and nonblinding
strains of 0. voZvufus are lmpos-
sible to distinguish by morphologrcal means. The presence of parasites of the nonblinding strain of 0. volvulus in areaswhere the blinding strain is also found can result in an overestimation of the prevalence and ATP for blinding onchocerciasis. Because of the need to positively identify blinding strain 0. VO~~U~US, much effort has been expended in the past several years to develop molecular-based methods to identify these parasites. This work has resulted in the identification of a number of different DNA probes. Probes have been identified that are specific for parasites of the genus Onchocerca (7), which are specific for 0. volvulus (8,9), and which are specific for the blinding and nonblinding strains of 0. volvulus (10, II). All of these probes have been found to be members of a highly repeated DNA sequence family present in the genome of Onchocerca parasites, which has a unit length of roughly 150 bp (9). This family has been designated O-150 (12). This finding has resulted in the development of a PCR-based assay capable of classifying parasites of the genus Onchocerca, based on amplification of the O-l 50 repeat family using degenerate primers, followed by characterization of the resulting PCR products by hybridization to a number of species and strain specific oligonucleotide probes (12,13). The use of degenerate primers has several advantages for the use of PCR amplification conditions that are specific for blinding strain 0. volvulus. First, the amplification using degenerate primers results in a PCR product population from any sample containing DNA from Onchocerca parasites. This provides a useful internal control to monitor the success of DNA isolation from an individual parasite sample. Sec-
The Use of Degenerate Primers ond, the degenerate PCR products can be easily subdivided for simultaneous analysis by a number of different oligonucleotide probes. This allows the investigator to approach questions such as that of the existence of mixed strain infections in areas where the blinding and nonblinding strain of the parasite are sympatric (14). Finally, since the degenerate PCR products are representative of the 0- 150 population as a whole (15), the DNA sequence of the product population can be used to study the organization of the O-150 repeat family without resorting to tedious genomic cloning procedures. The DNA sequence data obtained in this manner may be used to rationally design new 0- 150 based probes (12). The data may also be used as a phylogenetic tool to examine molecular evolution within the repeat family, and to deduce the relationships among different parasite populations (IS). The protocols described in the following provide the procedures necessary to successfully apply the degenerate PCR-based assay in combination with strain and species-specific oligonucleotide probes to classify parasites from any lifecycle stage. This assay has been successfully used by the OCP DNA probe laboratory in Bouake, Cote d’Iviore to classify essentially all parasite samples collected by the OCP since 1992 (14). Because of the need to apply this technology in laboratories in developing countries, sample preparation and storage has been designed to be as simple as possible. In addition, the use of hazardous reagents has been kept to a minimum. 2. Materials 2.1. Supplies 1. Disposablecervical scrapers. 2. Glass microhomogenizers: The homogenizers should be soaked in O.lM HCl overnight at room temperatureand thoroughly rinsed with distilled water prior to use (seeNote 1). 3. Glass micropipets, 50 uL size. 4. Immunolon 2 microtiter trays (Dynatech Laboratories,Chantilly, VA). 2.2. Reagents All solutions except those to be used in the PCR are prepared from distilled or deionized water. Autoclaving is usually not necessary. PCR solutions should be prepared from sterile distilled or deionized water (see Note 2). Unless specified, all reagents used have been obtained from Sigma (St. Louis, MO).
Unnasch 2.2.1. Isolation
of Parasite
Material
and Meredith
and DNA Extraction
1. NET: 100 mM NaCl, 10 mA4 Tris-HCl, pH 8.0, 1 mM EDTA. Store at room temperature. 2. TE: 10 mMTris-HCl, pH 8.0, 1 mMEDTA. Store at room temperature. 3. Protemase K (Amresco, Solon, OH): Prepare a stock solution at 1 mg/mL m TE. Aliquot and store at -20°C. 4. IM Dtthiothreitol (DTT): Store at -2OOC. 5. Herring sperm DNA: 1 mg/mL (w/v) m TE. Store at 4°C. 6. Glass slurry: Acid-washed glass slurry 1sprepared accordmg to Vogelstem and Gtllespie (16). Alternatively, this reagent is available from Blo 101 (La Jolla, CA). Store at 4°C. 7. Sodium iodide solution: Dissolve 90.3g of NaI and 1 5 g of NaS03 m a minimal amount of water (see Note 3), adJust the volume to 100 mL. Filter the solutron through Whatman (Maidstone, UK) #l filter paper. Collect the filtrate, and add an additional 0.5 g of NaSOs. Store the solution m an opaque bottle at 4°C. 8. Ethanol wash solution: 10 rnA4 Tris-HCl, pH 7.5, 100 mA4 NaCl, 1 mM EDTA, 50% (v/v) ethanol. Store at -20°C. 2.2.2. O-150 Polymerase
Chain Reaction
(PCR)
1. 1OX PCR buffer: 100 mMTris-HCl, pH 8.3, 500 rnA4 KCl, 60 mA4MgCl,, 0.1% gelatin. After preparmg the buffer, aliquot into ten 1-mL aliquots and store at -20°C. 2. Nucleotide solution containing 2 mM each of dATP, dCTP, dGTP, and dTTP. Premade stock solutions (100 mM) may be obtamed from Boehringer-Mannheim (Indianapolis, IN). Store at -20°C. 3. Primers for PCR: The sequence of the primers used in the PCR are as follows (R = A or G; Y = C or T; and X = A, G, C, or T): a. 5’-GATTYTTCCGRCGAAXARCGC-3’. b. 5’-GCXRTRTAAATXTGXAAATTC-3’. Primers are available from Oligos, Etc. (Wilsonvtlle, OR). Prepare 20 PM stock solutions of each primer by resuspendmg the lyophilized preparation m an appropriate amount of PCR water. Ahquot and store at -20°C. 4. Taq DNA polymerase (Roche Brosystems, Branchburg, NJ). Store at -20°C. 5. Light mineral oil. 2.2.3. ELISA-Based Classification of O-150 PCR Products 1. Coating buffer: Stock solution A: 1M NaHCO,; store at 4’C. Stock solution B: 1M Na2C03, store at 4OC. Prepare the coating buffer fresh from
The Use of Degenerate Primers
297
the stock solutions immediately prior to use. Coatmg buffer: 22.65-mL stock solution A, 9.1 -mL stock solution B, 468-mL distilled water. Adjust pH to 9.6 with HCl if necessary. 2. Streptavidin (Jackson Immunoresearch Laboratories, West Grove, PA). Reconstitute to a final concentration of 300 pg/mL in coating buffer. Store at 4°C. 3 TBS: 0.5M Tris-HCl, pH 7.5, 1.5MNaCl. Store at room temperature. 4. TBST: TBS containing 0.05% (v/v) Tween-20. Store at room temperature. 5. TBS/BSA: TBS contammg 0.1% (w/v) bovine serum albumin (BSA). Store at -20°C. 6. 20X SSPE: 3MNaC1, 0.2MNaH2P04, 20 rnM EDTA. Store at room temperature. 7. 100X Denhardt’s solution: 2% (w/v) Ficoll 500, 2% (w/v) polyvinylpyrrolidone, 2% (w/v) BSA. Store at -20°C (see Note 4). 8. Hybridization buffer: 6X SSPE,0.1% SDS, 5X Denhardt’s solution, 0.1% sodium sarcosine. Store at -2OOC. 9 1NNaOH. Store at room temperature. 10. 0. volvulus species specific oligonucleotide (OVS2-FL): The DNA sequence of this oligonucleotide ts 5’ AATCTCAAAAAACGGGTAC ATAX 3’, where X = a 3’ fluorescein tag. The oligonucleotide was obtained from Ohgos Etc. Prepare a stock solution at a concentration of 200 pg/mL. Split the stock solution into small ahquots, and store m the dark at -20°C. 11. 0. volvulus nonblmdmg strain specific oligonucleotide (OVF-FL): The DNA sequence of this ohgonucleotide is 5’ AATTCCTAATTTCAAGAA GCX 3’, where X = a 3’ fluorescein tag. The oligonucleotide was obtained from Oligos Etc. Prepare a stock solution at a concentratron of 200 ng/pL. Split the stock solution into small aliquots, and store in the dark at -20°C. 12. Alkaline phosphatase labeled antifluorescein FAB fragment. Store at 4°C. 3. Methods 3.1. Collection and Storage of Parasite Material Adult parasites are collected by nodulectomy from infected individuals. Nodules are placed in isopropanol, and stored at room temperature, or at 4°C (see Note 5). Skm snips containing microfilariae can be collected directly into isopropanol or 50 mM EDTA, and stored at room temperature. Alternatively, skin snips may be incubated overnight in tissue culture medium, allowing the microfilariae to be counted, following standard procedures (17). Following the determination of the number of microfilariae, EDTA should be added to the sample to a final concentration of 50 mM. The sample may then be stored at room temperature until needed.
Unnasch
298
and Meredith
Black flies infected with 0. voEvulus infective larvae (L3) may be collected into isopropanol and stored at room temperature. Alternatively, the L3 may be dissected from the fly, and the isolated L3 stored in isopropanol at room temperature. Materials for PCR 3.2.1. Adult Parasites Place the nodule m a dish containing 10 mL of NET. Cut the nodule m half, and use a cervical scraper or similar blunt end tool to remove the parasite material from the capsule. Transfer the parasite material to a 15-mL polypropylene centrifuge tube by sucking it up with a disposable transfer pipet. Centrifuge the solution at 165Ogat 4OCfor 10 min. Discard the supernatant, and resuspend the pellet m 5 mL NET. Centrifuge as in the previous step, and discard the supernatant. Resuspend the pellet m 1.OmL of NET. Transfer the solution to a disposable microhomogenizer, and grind the material. Transfer the material to a microcentrifuge tube. Centrifuge the sample for 1 min in a standard microcentrifuge (approx 13,OOOg).Remove and save the supernatant, and discard the pellet fraction. The supernatant is suitable for use directly in the PCR. 3.2. Preparation
1. 2.
3. 4. 5.
1.
2. 3,
4.
of Parasite
3.2.2. Microfilariae and Infective Larvae If working with microfilariae, place the culture medium containing the microfilariae or the preserved skm snip in a microcentrifuge tube containing 100 pL TE. Centrifuge the parasite material for 5 mm m a standard microcentrifuge, and discard the supernatant. Resuspend the parasite material in 100 pL of TE, and repeat the centrifugation. Discard the supernatant, and resuspend the parasite material in 100 pL of TE containing 100 pg/mL proteinase K. If working with isolated infective larvae, collect the larvae using a micropipet. Expel the larvae mto a tube containing 100 pL of TE containing 100 pg/mL proteinase K. If you are beginning with an intact mfected fly or head capsule, transfer the fly material to a glass microhomogenizer, and add 100 pL TE containing 100 pg/mL proteinase K. Homogenize the sample until the fly tissue is disrupted. Incubate the parasite samples (either microfilariae, infective larvae, or homogenized infected fly material) at 55OCfor 1 h.
The Use of Degenerate Primers
299
5. 6. 7. 8.
Add 2 uL of 1M DTT, and heat to 100°C for 30 mm. Freeze-thaw the sample three times. Add 1 p.L of 1 mg/mL salmon sperm DNA prepared in TE. Add 300 pL of sodium iodide solution, and 5 pL of glass slurry. Incubate at 4OCfor 15 min 9. Centrifuge the solution for 1 min in the microcentrifuge, and discard the supematant. Resuspend the pellet in 300 pL of ethanol wash solution, and centrifuge in the microcentrifuge for 1 min. 10. Repeat the washing procedure using the ethanol wash solution for a total of three washes. Dry the final washed pellet briefly at room temperature, and resuspend in 50 uL TE. 11. Incubate at 55°C for 5 min. Centrifuge the solution for 1 min at room temperature m the microcentrifuge. Remove and save the supematant, and discard the pellet. The supernatant may serve directly as a substrate in the PCR. 3.3. PCR Amplification
of the O-150 Repeat
Family
1. Prepare the PCR reactions (see Note 6). Each reaction will require: 5 uL 1OX PCR buffer, 5 pL dNTP mix, 1.25 pL primer 1, 1.25 uL primer 2, 10 uL genomic DNA, 0.25 pL (1.25 U) Tuq DNA polymerase, and 37 uL PCR water. Multiply the amounts shown by the number of reactions that you will be doing. Include two extra reactions for positive and negative controls. 2. Combine all reagents except the genomic DNA to produce a master mix. Vortex, spin in the microcentrifuge for a second to pellet the droplets, and ahquot the master mix into the tubes for the reaction. 3. Add the genomic DNA and vortex. The negative control reaction should not receive any genomic DNA. The positive control should contain 0- 150 DNA that is known to serve as an efficient substrate for the 0- 150 PCR. Such DNAs include PCR products from a previously successful reaction diluted l/1000 m PCR water, previously amplified genomic DNA samples, or 10 ng the plasmid pOVS 134. pOVS 134 contains an insert consisting of 12 tandem copies of the O-150 repeat. (pOVS134 may be obtained from Thomas R. Unnasch.) 4. Spin the samples in the microcentrifuge to pellet any droplets. Add 75 pL of mineral oil to each tube. 5. Run 25 cycles of: 1 min at 94°C 2 min at 37°C and 30 s at 72°C. 6. Remove the samplesfrom the PCR machine, aspirate the sample from underneath the mineral oil, and store at -20°C until ready for further analysis.
300
Unnasch
and Meredith
3.4. Classification of PCR Products by Hybridization to Strain and Species Oligonucleotides Two methods have been developed to classify products produced by the degenerate PCR by hybridization to strain and species-specific oligonucleotide probes. The original method involved separation of the products by agarose gel electrophoresis, followed by Southern blot transfer of the products, and analysis by standard membrane hybridization procedures (12). Recently, a method has been reported for the detection of O-150 PCR products using an ELISA-based assay (IS). This method is quicker, less expensive, and yields more quantitative results than those that are provided by the standard Southern blot protocol. The ELISAbased method for classifying the O-l 50 PCR amplification products outlined in the following section is a modification of the one originally described by Nutman and coworkers (18). The modifications ensure that the oligonucleotldes will hybridize specifically to PCR products generated from 0. volvulus DNA, and not to PCR products produced from other species of Onchocerca. 1.
2. 3.
4.
5. 6. 7.
3.4.1. ELISA-Based Classification of PCR Products Coat the required number of wells of an Immobllon 2-microtiter tray with streptavidin, by adding 50 pL of a working solution of 1 pg/mL streptavldm m coating buffer to each well. Incubate the plate at room temperature for a minimum of 2 h prior to use. Empty the plate mto the sink. Rinse the wells SIX times with TBST at room temperature. Invert the tray on to a paper towel to remove the residual fluid. Add 1.5pL of hybridization solution to each coated well, and mix. Add 5 pL of each PCR product to the appropriate wells. Incubate the tray at room temperature for 30 min. During the incubation period, prepare working solutions of the oligonucleotlde probes. The working stock of the OVS2-FL probe 1s 50 ng/mL in hybrldlzatlon buffer, and the working stock of the OVF-FL probe 1s 400 ng/mL in hybridization buffer. Following the incubation with the PCR product, wash the wells six times with TBST at room temperature. Add 100 pL 1M NaOH to each well, and incubate for l-2 mm at room temperature. Wash the wells six times with TBST at room temperature. Add 50 pL of the working solution of the ohgonucleotlde to be used and incubate at 37°C for 30 mm.
The Use of Degenerate Primers
301
8. During this mcubatton, warm two squnt bottles, one containing 1X SSPE, 0.1% SDS, and the second containing TBST, to the appropriate wash temperature for the oligonucleotide being used to probe the PCR products. For OVS2-FL the wash temperature is 56°C and for OVF-FL, the wash temperature is 40°C. 9. Following the incubation with the oligonucleottde probe, wash the wells six times with TBST at room temperature to remove the unbound probe. 10. Add 100 pL of 1X SSPE, 0.1% SDS warmed to the appropriate wash temperature to each well. Incubate the tray at the wash temperature appropriate for the probe being used (56°C for OVS2-FL and 40°C for OVF-FL) for 5 min. 11. Wash the wells six times with TBST warmed to the wash temperature appropriate for the probe being used. 12. Prepare a working solution of the alkaline phosphatase-conjugated antifluorescein FAB fragment, by diluting it l/10,000 in TBSBSA. Add 50 pL of the working solution to each well Incubate the tray at 37’C for 30 min. 13. Wash the wells SIXtimes wtth TBST at room temperature. 14. Detect bound alkaline phosphatase using a commercial alkaline phosphatase detection system following the manufacturer’s mstructtons (see Note 7).
3.42. Interpretation
of
Results
Samples should be classified according to a two-step protocol. Samples producing PCR products recognized by OVS2-FL may be considered as having contained 0. volvuZus. Samples positive with OVS2-FL may be f$+ther classified on the basis of results produced by hybridization to OVF-FL. Those that are OVS-2-FL+/OVF-FL+ may be classified as belonging to the nonblinding strain of 0. volvulus. Those which are OVS2-FL+/OVF-FL- may be classified as belonging to the blinding strain of 0. volvulus. Multiple tests using OVS2-FL from around the world have suggested that it is 100% sensitive and 100% specific for detecting 0. volvulus (12,14,18). The sequence on which OVF-FL is based has been shown to classify 0 volvulus isolates collected throughout the OCP area in West Africa into the blinding and nonblinding strain with a sensitivity of 95% and a specificity of 93% (19). This probe has not been extensively tested on 0. volvulus isolates obtained from areas outside the OCP.
302
Unnasch
and Meredith
4. Notes 1. This is a precaution against contaminatton by DNA; a 4% solution of commerctal bleach or 0.25M NaOH could also be used. 2. In situations where there may be difficulties in procurmg sterile distilled or deionized, water-suitable bottled water for PCR soluttons is available from J. T. Baker (Phillipsburg, NJ). 3. Note that not all of the NaS03 will dissolve. This reagent is also available premade from Bto 101. 4. The solution will need to be filtered; prefilter using a 0.45pm filter overlaying a 0.2~pm filter. Ahquot in 25-50 mL lots and store at -20°C. 5. Storage at 4°C has the advantage that it lessenstissue decomposition in the material surrounding the nodule, making the samples more pleasant to work with. 6. As with any PCR-based assay,the 0- 150 PCR is susceptible to false-positive reactions resultmg from contamination of the PCR reagents by DNA containing amplifiable 0- 150 sequences.To minimize the risk of such contamination, PCR reagents should be stored and handled in an area that is kept separate from the area where the post-PCR samples are processed It is advisable to maintain a separate set of pipeting devises devoted exclusively to use in the PCR. 7. The most sensitive and rapid detection system in our hands has proven to be the ELISA amplification system produced by Gtbco/BRL (Gaithersburg, MD). The disadvantages to this system are that the product is relatively expensive, and has a rather short shelf life. Alternatively, a para-nitrophenylphosphate based system such as that produced by Kirkegaard and Perry (Gaithersburg, MD) may be used. This is less expensive than the BRL system but has the disadvantage that it appears to be somewhat less sensitive, and the signal takes longer to develop than the BRL system.
References 1, Thylefors, B. (1978) Ocular onchocerciasis.Bull WHO 56,63-72. 2. Duke, B. 0. L. (1990) Human onchocerciasis-an overview of the disease.Acta Leldensla 59,9-24.
3 LeBerre, R., Walsh, J. F., Phillippon, B., Poudiougo, P., Henderickx, J. E. E., Guillet, P., Seketeli,A., Quillevere, D., Grunewald, J., and Cheke, R A. (1990) The WHO OnchocerciasisControl Programme:retrospectand prospects.Phzlos. Trans Roy. Sot , London B328,72 l-729. 4. Duke, B. 0. L. (1967) Infective filanal larvae other than Onchocerca volvulus in Simulium damnosum
Ann Trop. Med Parasztol. 61,2OO-205
The Use of Degenerate Primers 5. McCall, P. J., Townson, H., and Trees, A. J. (1992) Morphometrtc differentiation of Onchocerca volvulus and 0. ochengi infective larvae. Trans Roy Sot Trop. Med. Hyg. 86,63-65
6. Duke, B. 0. L. (1981) Geographtcal aspects of onchocerctasis Ann Belg Sot Trop. Med. 61, 179-l 86 7. Shah, J. S., Karam, M., Ptessens, W. F., and Wnth, D. F. (1987) Characterrzation of an Onchocerca-specific DNA clone from Onchocerca voZvulus Am J Trop. Med Hyg 37,376384.
8. Harnett, W., Chambers, A E., Renz, A , and Parkhouse, R. M. E (1989) An oligonucleotide probe specific for Onchocerca volvulus. Mol Btochem Parasttol. 35, 119-126. 9. Meredith, S. E. O., Unnasch, T. R., Karam, M., Ptessens, W F., and Wnth, D. F (1989) Cloning and characterization of an Onchocerca VOZVUZUSspecific DNA sequence. Mol Btochem Parasitol 36, l-10. 10. Erttmann, K D , Unnasch, T. R., Greene, B. M., Albiez, E. J., Boateng, J., Denke, A. M., Ferrarom, J J., Karam, M., Schulz-Key, H., and Williams, P. N. (1987) A DNA sequence specttic for forest form Onchocerca volvulus Nature 327,415417. 11. Erttmann, K D , Meredith, S. E. O., Greene, B M , and Unnasch, T R. (1990) Isolation and characterization of form specific DNA sequences of 0 volvulus. Acta Lerdensia 59,253-260
12. Zimmerman, P A., Toe, L., and Unnasch, T R (1993) Design of Onchocerca DNA probes based upon analysis of a repeated sequence family. Mol Btochem Parasitol.
58,259269
13. Meredith, S. E O., Lando, G., Gbakima, A A., Zmrmerman, P. A., and Unnasch, T R. (1991) Onchocerca volvulus* application of the polymerase chain reaction to identification and strain differentiation of the parasite. Exp. Parasrtol. 73,335-344. 14 Toe, L., Menweather, A , and Unnasch, T. R. (1994) DNA probe based classificanon of Simulium damnosum s.1. borne and human derived filarial parasites in the Onchocerciasis Control Programme area. Am. J, Trop Med. Hyg , 51,676-683. 15. Zimmerman, P. A., Katholi, C. R., Wooten, M. C , Lang-Unnasch, N., and Unnasch, T. R. (1994) Recent evolutionary htstory of Amencan Onchocerca voZvulus, based on analysis of a tandemly repeated DNA sequence family. Mol. Bzol. Evol 11,384--392. 16. Vogelstein, B. and Gillespie, D (1979) Preparative and analytical purification of DNA from agarose. Proc. Nat1 Acad. Sci USA 76,615-619. 17. Remme, J , Ba, 0 , Dadzie, K. Y., and Karam, M. (1986) A force-of infection model for onchocerctasis and its applicattons m the epidemiological evaluation of the Onchocerciasis Control Programme m the Volta river basin area Bull WHO 64,667-68 1. 18. Nutman, T. B., Zimmerman, P. A., Kubofctk, J., and Kostyu, D. D. (1994) A universally applicable diagnostic approach to filartal and other infecttons. Parasztol. Today 10,239-243
19. Zimmerman, P. A., Dadzte, K Y., DeSole, G., Remme, J., Alley, E. S., and Unnasch, T. R. (1992) Onchocerca volvulus DNA probe classification correlates with epidemiologtcal patterns of blindness. J Infect Du. 165,964--968
CHAPTER22 The Use of Synthetic DNA Probes for the Field Identification of Members of the Anopheles gambiae Complex Susannah
M. Hill
and
Julian
M. Crampton
1. Introduction Mosquitoes of the Anopheles gambiae complex include the major vectors of malaria in tropical Africa. Six different sibling species within the complex have been identified on the basis of mating incompatibility (J-3). None of them can be distinguished using morphological characteristics. An. gambiae sensu strict0 and An. arabiensis are the two most efficient vectors within the complex and are widespread throughout tropical Africa being sympatric over much of their range. An. merus and An. melas, two saltwater-associated forms, are vectors in coastal regions of East and West Africa, respectively, whereas An. bwambae is a vector confined to the Semliki forest in Uganda. An. quadriannulatus is mainly zoophilic and therefore not considered to be a vector of malaria; it is found in limited locations in East and South Africa and Ethiopia. The different species in the complex exhibit markedly different behavior, ecology, and vector capacity, and respond differently to control measures. As two or three species are commonly found together in a given area, identification of the individual species is very important (4). A number of methods are currently available for species identification, including polytene chromosome banding patterns (5-81, isoenzyme analysis @II), cuticular hydrocarbon determination (12,13), and polymerase chain reaction (1415). These techniques all require some experFrom
Methods Nucle/c
m Molecular Acrd Methods
Biology, Edlted
Vol 50 Speoes by J P Clapp
305
Dlagnosbcs Protocols PCR and Other Humana Press Inc , Totowa, NJ
306
Hill and Crampton Table 1 A DNA Probe Key to the Anqheles
Species
An An An An An An An An
gamblaess arablenszs arablensrs melas merus merus quadrrannulatus quadrlannulatus
Sex M&F F M M&F F M F M
gambzaeComplex0
pAna
pAnm14
pAngsI
+++ + +++ +++ -
+ + + +++ +++ +++ + +
++ ++ ++ ++ ++ ++ ++ ++
PAW
+ +++ +++ +++ +++
pAngss
++ ++ + ++ + ++
u (-) No detectable signal, (+) a weakly posltlve slgnal, (++) a strong positive slgnal, (+++) a very strong positive signal
tise and expensive equipment to perform or are limited by the life stage or means of preservation of specimens. They are, therefore, not entirely suitable for widespread field identification of large numbers of specimens. The use of DNA probes offers an attractive alternative to these techniques as protocols may be cheap, simple, and quick to use and suitable for simultaneous identification of large numbers of specimens. In addition, DNA probes work on all insect stages and on alcohol preserved and dried material in addition to fresh and frozen mosquitoes. A series of cloned DNA probes have been isolated from cloned genomic DNA libraries by differential screening that allows identification of five of the six species in the An. gambiae complex (1619). An. bwambae was not included m the work owing to its extremely localized distribution and lack of available material. The DNA probes are not ideal in that each probe does not uniquely distinguish a single species. Different degrees of hybridization are seen between each probe and the different species of the complex. These differences are consistent and allow specimens to be identified with the DNA probes using a key (Table 1). The DNA probes have been used successfully in the laboratory for a number of years. However, in order for the DNA probes to be suitable for use in the field, several modifications have been made to their use. The major logistical problems for field use of DNA probes are the preparation of specimens, hybridization of the probe, and the requirement for radiolabel and subsequent associated hazards. These have been solved to a great extent by the use of mosquito squash-blots and nonradioactive
Identification
of Anopheles gambiae Complex
307
oligonucleotide probes (20,21), in conjunction with a simplified protocol requiring a minimum of equipment and expertise (22). The series of cloned DNA probes were sequencedin order to define the repetitive sequencesthat are species specific. Sequencesof 20-30 bases in length which appeared to be invariant within each species were used to prepare synthetic oligonucleotide probes to replace the cloned DNA probes (Table 2) (19,20). These oligonucleotide probes demonstrate the same hybridization characteristics as the original cloned DNA probes. The oligonucleotides were labeled with the enzyme alkaline phosphatase using the E-link plus kit (Cambridge Research Biochemicals, Cheshire, UK). Oligonucleotides were first modified by incorporation of an N-TFA C6amino modifier (Cruachem, Sterling, VA) as the final stage of synthesis. One-tenth of the 0.2~pA4product (100 pL) was conjugated with lyophilized, activated alkaline phosphatase and purified using the reagents, columns, and instructions supplied with the kit. The alkaline phosphatase label could then be involved in a light emitting chemiluminescent or a calorimetric detection reaction (Fig. 1). DNA probes have been isolated and used successfully in the laboratory for the identification of specimens of a number of important insect vector species, including An. dir-us (23), An. farauti (24,25), An. quadrimaculatus (26), Simulium damnosum (27,28), and Phlebotomus papatasi (29). It is possible that any species-specific probes such as these could be developed for use in the field as nonradioactively labeled oligonucleotide probes with the simplified protocol. In addition, extra probes may be used in conjunction with vector species-specific probes to detect the presence of infecting parasites (29-32). It is anticipated that part of the body, such as the head, may be used for DNA probe identification purposes, leaving the remainder free for alternative analyses; for example, enzyme-linked immunosorbent assay (ELISA) analysis of the thorax for origin of the mosquito bloodmeal (33), or presence of sporozoites (34) and cytogenetic analyses using the abdomen (35). 2. Materials 2.1. Stock Solutions 1. 2. 3. 4.
10% SDS. 1MNaOH. 3MNaCl. lit4 Tris-HCl, pH 7.5.
for the Identificatton
Probe PAngss pAngs1 pAnaI pAmnl4 PAN
Species origin
An An. An. An. An.
gamblae ss gamblae ss arablensls melas quadrzannulatus
Table 2 Synthetic DNA Probes of Anopheles gambrae Complex Mosquitoes
Nature of tandem repeats
Length of repeats, bases
Sequence of oligonucleottde
Direct Direct Interspersed Direct Direct
68 92 41 163 30
5’-‘TAGA(T/G)TGTTTGTATGAACCTTGGz3-3’ 5’-‘TATCGTTGTTACGGCCATGTT*‘-3’ 5’-‘TGTTCAGAGTGAAGATATCTT*‘-3’ 5’-1CTAGGTATGTGCCCGTTCGTGACTAT26-3’ 5’-1GCGACCGAA(C/A)A(C/A)TTTGCGACCAA23-:
Identification
of Anopheles gambiae Complex
309
pAngss probe
pAmI probe
(positive = An. gambiae KS.)
(positive = An. arabiensis)
pAngs1probe
Specimen identification
(positive = An. gambiae ~1.) An. An. gam I am
An. I gam
AIL gam An. am All. b-m An. gam = An. gambiae S.S. An. am = An. nrabiemis
Fig. 1. Identification of mosquito specimensusing chemiluminescent detection of alkaline phosphatase-labeledpAngss, pAna1, and pAngsi oligonucleotide probe hybridization to replica squash-blots of male mosquito heads. Chemiluminescent exposure time was 3 h. The diagram indicates the resulting speciesof each specimen.
310
Hill and Crampton
5. 6. 7. 8.
20X SSC. 3MNaC1, 0.3Msodium citrate. 1M Tris-HCl, pH 9.5. 100 mM MgQ. 5-Bromo4-chloro-3-indolyl phosphate (BCIP; toluidme salt: 50 mg/mL) in dimethyl formamide (DMF). 9. Nitroblue tetrazolium salt (NBT): 75 mg/mL in 70% DMF.
All solutions for squash-blots and nonradioactive DNA probe hybridizations may be made from the aforementioned stocks. Stock solutions l-7 are made with general laboratory reagents from any lab suppliers (i.e., BDH [Poole, UK], Sigma [St. Louis, MO], Fisons [Leicester, UK]), and dissolved in double distilled water. These stocks and any solutions derived from them may be stored for long periods at room temperature. BCIP and NBT are supplied by Boehringer Mannheim (Mannheim, Germany) as solids; solutions are stored at 4°C in the dark. 1. 2. 3. 4. 5. 6. 7. 8. 9. 1. 2. 3. 4. 5.
2.2. Preparation of Squash-Blots Whatman (Maidstone, UK) 3MM paper. Hybond N+ nylon membrane (Amersham, Bucks, UK). Small glass plate. Oven at 80°C. Tissue preparation: 10% SDS. DNA denaturation: 0.5MNaOH, 1.5M NaCl. Filter neutralization: 0.5M Tris-HCl, pH 7.5, 1.5MNaCl. DNA fixation: 0.4MNaOH, 5X SSC. Removal of debris: 0. 1M NaOH. 2.3. Hybridization of Filters Plastic bag sealer and plastic sheeting. Filter wetting solution: 1X SSC. Prehybridization solution: 5X SSC, 0.5% SDS, 2% skimmed milk powder (may be any commercial brand, i.e., Marvel; Premier Brands UK Ltd, London, UK). Make solution up fresh as required. Hybridization solution: Prehybrtdization solution containing 1.O nA4 labeled probe. Nonradioactive oligonucleotide probes: Synthesized with sequences as published (19,21) with an NTFA C6amino modifier (Cruachem) at the 5’ terminus, and labeled using the E-Link plus’” system(Cambridge Research Biochemicals). Long-term storage of probes at -20°C in aliquots; do not refreeze thawed aliquots. The labeled probes are also stable at 4°C for at least 6 mo.
Identification
of Anopheles gambiae Complex
311
6. Wash solution 1: 0.5X SSC, 0.5% SDS. 7. Wash solution 2: 0.1X SSC, 0.5% SDS. 8. Wash solution 3: 1X SSC.
of Hybridization 2.4.1. Chemiluminescent Detection
2.4. Detection 1. 2. 3. 4.
X-ray film (i.e., Fuji RX medical). X-ray cassette (no intensifying screens). Acetate sheets for overhead projector. Lumiphos substrate (Cambridge Research Biochemlcals). Store at 4°C in dark. Avoid inhalation and skin contact; use in a fume cupboard.
2.4.2. Calorimetric
Detection
1. Plastic bag sealer and plastic sheeting. 2. Color reaction buffer: 100 mMNaC1, 1mMMgClz, 50 mMTris-HCl, pH 9.5. 3. Color development buffer: 10 mL color reaction buffer, 33 PL NBT stock, and 25 PL BCIP stock. Make up fresh immediately before use.
3. Methods 3.1. Squash-Blot
Preparation
Mosquito squash-blots provide a practical and simple method of preparing DNA from specimens for hybridization. Whole mosquitoes or individual portions, i.e., head, thorax, or abdomen, can be applied directly to the nylon filter and lysed in situ. The recovery of DNA is very high and is comparable to that obtained by conventional extraction methods. The presence of impurities in the DNA does not affect hybridization with the alkaline phosphatase labeled probes but causes background problems with some other nonradioactive systems. The following method is derived from that of Tchen et al. (36). 1. With a pencil, draw a l-cm grid on nylon filter (Hybond N”) allowing a single square for each specimen to be tested (see Note 1). Cut the filter to the exact size required. Cut a second filter slightly larger than the first (see Note 2). 2. Lay the nylon filters on Whatman 3MM paper saturated with 10% SDS (see Note 3). 3. If individual portions of the mosquitoes are to be tested, dissect specimens with a clean scalpel, wiping the blade with tissue following each dissection to prevent contamination of the subsequent sample (see Notes 4-6).
312
Hill and Crampton
4. Arrange the specimens on the surface of the first filter assignmg one square of the grid to each sample (see Note 7). Leave for 10 mm for specimens to soak up the 10% SDS. The SDS softens the mosqutto tissue. 5. To squash specimens, transfer the first filter face-up to a dry piece of Whatman 3MM and place the second filter on top (see Note 8). Place a glass plate onto the filter sandwich and squash the specimens by “thumping” the glass plate. The plate with the filters still attached may be turned over and any specimens still intact, squashed with the end of a glass rod. 6. Peel the filters apart with forceps to produce duplicate squash-blots (see Notes 9 and 10). 7. Lay the filters face upward onto Whatman 3MM soaked m OSM NaOH/ 1.5MNaCl for 5 mm to denature the DNA (see Notes 10 and 11). 8 Transfer the filters onto 3MM soaked in 0.5MTrrs-HCl, pH 7.5/l .SMNaCl for 5 min to neutralize the pH of the alkaline filter and DNA. During this procedure, remove chltmous body parts from the filter using forceps. Wipe the forceps with tissue after each specimen to prevent crosscontamination. 9. Place the filters on Whatman soaked m 0.4M NaOH for 20 mm to tmmobilize the DNA on to the filter (see Note 12), then rmse filters by immersion in 5X SSC for 30 s. Alternatively (and preferably) allow the filters to dry at room temperature then bake at 80°C for 2 h to fix the DNA. 10. Wash the filter in O.lMNaOH for 30 min with gentle agitation then rub with gloved hands to remove any remaining maternal from the filter. Rinse the filter in distilled water. At this stage the filter may be drred and stored indefinitely or used directly.
3.2. Nonradioactive
Hybridization
The following section describes the simplified protocol designed specifically for use in the field. Unlike other hybridization protocols, a complex hybridization solution and controlled or elevated temperatures are not needed, eliminating the need for expensive reagents and sophisti-
cated laboratory equipment. 1. Make up the prehybrrdrzation solution fresh as required by the addition of water and 20X SSC to milk powder and shakmg to create a cloudy suspension with no solid lumps of milk powder. Finally, the 10% SDS is added and mixed gently (see Note 13). 2. Prewet the filter m filter wetting solutron. From this point on the filter should remam wet (see Notes 14 and 15).
Identification
313
of Anopheles gambiae Complex
3. Prehybridize the filter in prehybridizatlon solution at room temperature for at least 2 h, with shaking if possible (see Notes 16-18; for volumes see Note 13). Prehybridization blocks nonspecific binding of the probe DNA to the filter and DNA samples. 4. Transfer the filter to hybridization solution (see Notes 16-19; for volumes see Note 13). Hybridize for 20 min at room temperature with shaking to allow binding of the single-stranded DNA probe to filter bound homologous DNA. 5. Transfer the filter from hybridization solution to washing solutions to remove unbound probe DNA. Perform the following washes at room temperature with shaking: two 5-mm lower stringency washes in wash solution 1 (see Notes 20 and 2 1) and two, 10-min higher stringency washes m wash solution 2 (see Notes 20 and 21). 6. Finally, wash the filter for 5 min in wash solution 3 at room temperature to remove SDS from the solutions still present on the filter (see Note 22). The filter may now be used m chemtlummescent (see SectIon 3.3.1,) or colorimetric (see Section 3.3 2.) detection reactions. 3.3. Detection of Hybridization
Hybridization of alkaline phosphatase labeled DNA probes can be detected using one of two techniques. Positive results with chemiluminescent detection are observed owing to blackening
of X-ray
film,
whereas calorimetric detection results in the formation of a purple precipitate adhering to the filter at sites of hybridization.
The chemilumi-
nescent reaction is based on the removal of a phosphate group from “lumiphos”
or AMPPD to form an unstable dioxetane intermediate. This
then decays with the emission of light, detected by X-ray film. Colorimetric detection of hybridization is based on the action of the alkaline phosphatase enzyme on the colorless, soluble BCIP and yellow, soluble NBT used as substrates. BCIP is oxidized to insoluble indigo following release of a phosphoryl group, whereas NBT is reduced to diformazan, forming a purple precipitate. 3.3.1. Chemiluminescent
Detection
1. Place the filter face-up on a clean acetatesheet tn a fume cupboard and spray with lumiphos (see Note 23). 2. Remove the filter and place it face-up on a second acetate sheet. Place another acetate sheet on top so that the filter IS sandwiched between the sheets, then place face-up m an X-ray cassette. Wipe away any lumiphos leaking out from between the acetate sheets with a tissue.
314
Hill
and Crampton
3 In the dark or under a safe light, place an X-ray film on top of the filter. 4. Incubate the X-ray cassette at 37OC for l-2 h before development of the X-ray film and analysis of the results (see Note 24-27). 3.3.2. Calorimetric Detection 1. Make color development buffer by adding BCIP and NBT to color reaction buffer immediately prior to calorimetric detection. 2. Place the filter in color development buffer in a heat sealable plastic bag or universal bottle and wrap in foil to exclude light. 3. Incubate at 37°C for the appropriate length of time (see Note 25). Colorimetric results are directly visible so that the progress of the reaction may be monitored at intervals and stopped when necessary by washing the filter m water for 10 min (see Notes 26 and 27).
4. Notes 1. Always handle nylon filter with gloved hands or with blunt-ended forceps, never with bare hands, as this may cause background problems. 2. The second filter should be cut slightly larger than the first (i.e., about 0.51 cm longer and wider) to allow for some error in placement of the second filter directly on top of the first, prior to squashing. 3. All stages utihzmg Whatman 3MM soaked in treatment solutions can be conveniently performed in plastic trays. The 3MM paper should be soaked but not swimming in solutton, as thts can lead to smearmg of the hybrtdtzatton results. When laying nylon filters on 3MM saturated with the treatment solutions, ensure no air bubbles form between the paper and the nylon filter so the filter wets evenly. This ensures each specimen on the nylon filter becomes thoroughly exposed to each solution in turn. 4. In addition to adult mosquitoes, individual larvae or pupae may also be squashed for testing, even the spermathecae of insemmated females have been squashed and used for the deduction of species identification from identity of the sperm DNA (18). 5. It is not essential for specimens to be dissected before squashing. Sometimes the whole specimen may be necessary for a good result tf spermathecae or early stage larvae are used or adult spectmens of inferior quality. 6. In our experience, when mosquitoes are dissected mto head, thorax, and abdomen samples, squashed heads give the best results. This fortuitously allows alternative assayssuch as blood meal or cytogenetm analyses to be performed on the same specimens. 7. If possible, include control specimens from laboratory colonies of different An. gambiae species with identities confirmed by an alternative technique, such as cytotaxonomy.
Identification
of Anopheles gambiae Complex
315
8. Pick up filters with two pairs of forceps from the center of two opposite edges allowing the filter to bow slightly to prevent samples falling off. 9. It is important to note that the second squash-blot is a mirror image of the first. The second filter, known as the “duplicate,” is recognizable as not being marked with a grid. It 1sbeneficial to make a pencil mark on each of the filters at this stage as a reminder of the alignment of specimens on the first filter and its mirror image on the duplicate. 10. Do not be alarmed if following squashing or during denaturation or neutralization, leakage of a large amount of greenish (from mosquito bodies) or reddish brown (from mosquito heads) pigment is observed surrounding the specimens. This pigment does not appear to affect subsequent results. 11. Double-stranded DNA is made single-stranded during alkali denaturation. This allows the probe DNA with a complementary sequence to bind with the single-stranded target DNA to reform a double-stranded DNA molecule. 12. The nylon filter possessesa positive charge that binds the DNA owing to an electrostatic interaction; treatment with sodium hydroxide should render this binding irreversible. Sodium hydroxide treatment may vary from 2-30 min; 20 min is utilized for routme convenience. Although there appears to be little difference m efficiency of DNA fixation by alkali treatment or baking with Southern or DNA dot-blots, with squash-blots baking is far superior. It is recommended therefore that if a baking oven is available, this alternative method is utilized. 13. When making up prehybridization solution, the suspension should not be shaken once SDS is added as frothing occurs, this will create problems if plastic bags are used for prehybridizations. The volume of solution required for the prehybridization and hybridization steps depends on the size of the filter. For prehybridization, 0.5-l mL/cm2 of nylon is sufficient; for hybridization, 250-500 pL/cm2 may be used. For filters of average size (e.g., 10 cm2, which allows for 100 samples), 20 mL of prehybridization solution is commonly made up in 20-mL graduated universal bottles. To 0.4 g of milk powder, 5 mL of 20X SSC and 14 mL of distilled water are added using the graduations marked on the side of the bottle. Vigorous shaking (with a secured lid!) creates a cloudy suspension to which 1 mL of 10% SDS may be added. Ten milliliters of this solution may be used for prehybridization, whereas the remaining 10 mL is retained for two 5-mL hybridization volumes. 14. Filter wetting and subsequent washing 1s best performed in approx 100-200 mL of solution (depending on the size of the filter and container) in small plastic sandwich boxes.
316
Hill and Crampton
15. Drying out of the filter creates background problems following detection and care should therefore be taken transferring the filter between containers and solutrons. In addmon, serious background problems occur if the filter is not prewetted m 1X SSC. 16. Prehybridization and hybridization are performed preferably m heat sealable plastic bags though universal bottles, capped centrifuge tubes, or sandwich boxes may be used. Use of sandwtch boxes usually increases the amount of probe needed for each hybridization, which substantially increases the cost of the procedure. 17. Ensure that filters are completely wetted by the prehybridization and hybridrzation solutions. It is possible to treat more than one filter at once m the same solution by placing them apart and/or back-to-back. Care must be taken to ensure multiple filters do not stick together. When using heat sealable plastic bags it 1simportant that large an bubbles are removed to ensure an even coatmg of solution and prevent spotty backgrounds. Shaking is desirable also to reduce this effect. If using bottles or tubes the filter should be rolled up inside and the tube frequently rotated if the solution does not cover the filter. 18. Prehybndization can be carried out overnight if more convenient. This allows more time the subsequent day for hybridization, washing, and detection. 19. Care must be taken when handlmg the DNA probes to avoid nuclease contamination that will rapidly destroy probe activity. Use of gloved hands and sterilized pipet tips generally avoids this, although aliquotmg of probe stocks and sequential use of mdividual ahquots wrll prevent loss of a large amount of probe DNA if nuclease contamination occurs. 20. Stringency of washing determines the degree of homology required for probe DNA to remam hybridized and may be altered by a change m temperature or salt concentration of the wash solution. Increasing the strmgency (an increase m temperature and/or a decrease in salt concentration) of washes increases the required homology. As washes here are performed at room temperature, a change of salt concentration is utilized to control stringency. 2 1. The washing stringencies have been determined as those most suitable for use with the probes for identification ofAn. gambiae complex mosquitoes. If this system is utilized with alternative ohgonucleotide probes for other identification purposes, different washing conditions may need to be determined. 22. The presence of SDS mhibits the activity of the alkaline phosphatase enzyme attached to the probe. Activity of the enzyme is requn-ed for both chemiluminescent and calorimetric detection reactions. 23. Lumiphos for chemilummescent detection should be used as sparingly as possible. Usually one or two “sprays” are sufficient for a filter of 100 speci-
Identification
24.
25.
26.
27.
of Anopheles gambiae Complex
317
mens. Using a pair of forceps the filter may be picked up and turned over to “mop up” any excess lumiphos spray on the acetate. Care must be taken to ensure the lumiphos is not inhaled or brought into contact with skm, therefore, a fume cupboard should be used if available; tf not, a mask may suffice. Chemiluminescent detection reactions may need different times of exposure varying from as little as 10min to as long as 5-6 h. If exposure time is found to be insufficient or too long following development of the X-ray film, the filter may be re-exposed. Re-exposure is possible up to several days after the detection reaction as the light-emitting reaction is prolonged and still detectable after 1wk. Over exposure results in an increase in background in relation to positives. Chemiluminescent and colortmetric reactions may be incubated at room temperature if a 37°C incubator is not available or a long exposure is required. An overnight incubation at room temperature is equivalent to 2 or 3 h at 37OC.This is because the alkaline phosphatase enzyme reactton is temperature dependent. Two or more probes may be needed to identify an individual specimen conclusively. The duplicate filter may be used for hybridtzatton of a second probe, if a third hybridization is required the filters may be stripped using 1% SDS at 80°C for 20-30 min and then reprobed. For filters used m calorimetric detection the color must first be removed by incubation in DMF at 60°C until all the color has been removed from the filter. Once the extent of different probe hybridizations with a mosquito specimen have been scored, the species may be deduced from the identification key shown (Table 1). It is important when using the key to compare degrees of hybridization with a standard for each set of samples. This is because results have been observed to vary considerably depending on factors such as amount of specimen used for identification purposes, the method and duration of storage. The complex-specific oligonucleotide, pAngs1, in addition to determining that samples collected belong to the An. gambiae complex, provides a rapid assessment of the quantity of DNA from each specimen available for identification. This 1sbecause pAngs1 effectively hybridizes with equal intensity to DNA from all species in the An. gambiae complex tested.
Acknowledgments This investigation received financial support from the UNDP/World Bank/WHO Special Programrne for Research and Training in Tropical Diseases, the Overseas Development Administration, and the Wolfson Foundation. J. M. Crampton is a Wellcome Trust Senior Research Fellow in Basic Biomedical Sciences.
318
Hill and Crampton References
1 Davidson, G (1964) Anopheles gamblae, a complex of species. Bull World Health Organlsatlon 31, 62S634 2. Davidson, G. and Hunt, R H. (1973) The crossmg and chromosome characteristics of a new, sixth species m the Anopheles gambrae complex Parawtologla 15, 121-128 3. Davidson, G , Paterson, H. E., Coluzzi, M., Mason, G. F., and Mtcks, D. W. (1967) The Anopheles gamblae complex, in Gene&s oflnsect Vectors ofDisease (Wright, J. W. and Pal, R., eds.), Elsevier, Amsterdam, pp. 21 l-250 4 Service, M W (1982) Importance of vector ecology m vector disease control m Africa Bull Sot Vector Ecol 7, 1-13 5 Coluzzt, M and Sabatmt, A (1967) Cytogenetic observations on species A and B of the Anopheles gambrae complex Parassltologla 9,7348 6. Coluzzl, M and Sabatmi, A (1968) Cytogenetic observations on species C of the Anopheles gamblae complex. Parassltologra 10, 155-165 7 Coluzzt, M and Sabatmt, A (1969) Cytogenetic observations on the saltwater specles Anopheles merus and Anopheles melas of the Anopheles gambzae complex. Parassztologla 11, 177-187. 8 Green, C. A. (1972) Cytological maps for the identification of females of the three freshwater species of the Anopheles gambrae complex. Ann Trop Med Parasltol 66, 143-147 9. Mahon, R J , Green, C. A., and Hunt, R. H. (1976) Diagnostic allozymes for the routme identification of adults of the Anopheles gambiae complex (Diptera, Culicidae). Bull Entomol Res 66,25-3 1 10. Miles, S. J. (1978) Enzyme variation in the Anopheles gambzae Giles group of species (Diptera: culicidae). Bull Entomol Res 68, 85-96 11. Miles, S. J. (1979) The Anopheles gamblae complex. a btochemtcal key. J Med Entomol 15,297-299 12. Carlson, D. A and Service, M W (1979) Differentiation between species of the Anopheles gambzae complex (Diptera: cuhcidae) by analysis of cuticular hydrocarbons. Annal. Trop Med Parasltol 73,589-592 13. Hamilton, R. J. and Service, M. W. (1983) Value of cuticular and internal hydrocarbons for the tdenttfication of larvae of Anopheles gamblae Gales, Anopheles arablensls Patton and Anopheles melas Theobald. Annal. Trop Med Parasltol 77,203-2 10. 14. Paskewitz, S. M. and Collins, F. H. (1990) Use ofpolymerase chain reaction to identify mosquito species of the Anopheles gamblae complex. Med Vet Entomol 4,367-373 15. Paskewitz, S. M., Ng, K., Coetzee, M., and Hunt, R. H (1993) Evaluation of the polymerase cham reaction method for identifying members of the Anopheles gambzae (Dlptera: Cuhcidae) complex in South Africa. J. Med. Entomol. 30,953957. 16. Gale, K. R. and Crampton, J. M. (1987) DNA probes for species identification of mosquitoes m the Anopheles gamblae complex. Med. Vet Ent 1, 127-136 17 Gale, K R and Crampton, J. M. (1987) A DNA probe to distingutsh the spectes Anopheles quadriannulatus from other species of the Anopheles gamblae complex Trans Roy Sot Trop Med Hyg 81,842-846.
Identification
of Anopheles gambiae Complex
319
18. Gale, K R. and Crampton, J. M. (1988) Use of a male spectfic DNA probe to distinguish female mosquitoes of the Anopheles gambtae complex. Med Vet. Ent 2,77-79 19 Hill, S. M. and Crampton, J M ( 1994) Synthetic DNA probes to identify members of the Anopheles gambtae complex and to dtstmguish the two maJor vectors of malarta wtthm the complex, An. gambiae ss and An. arabtensu. Am J Trop Med Hyg. 50,312-321. 20. Hill, S. M., Urwm, R., Knapp, T. F., and Crampton, J M. (1991) Synthetic DNA probes for the identification of sibling species within the Anopheles gambtae complex. Med Vet Entomol. 5,455-463. 2 1. Hill, S. M., Urwin, R., and Crampton, J M. (1991) A comparison of non-radioactive labeling and detection systems with synthetic oligonucleotlde probes for the species identification of mosquitoes in the Anopheles gambtae complex Am. J Trop Med Hyg. 44,609-622.
22. Hill, S. M., Urwin, R., and Crampton, J M (1992) A simplified, non-radioactive DNA probe protocol for the field identification of Insect vector specimens. Trans. Roy. Sot. Trop. Med Hyg 86,2 13-2 15 23. Panytm, S., Yasothomsnkul, S., Tungpradubkul, S., Balmal, V., Rosenberg, R., Andre, R G , and Green, C. A (1988) Identification of isomorphic malaria vectors using a DNA probe Am J Trop Med Hyg. 38,47-49 24. Booth, D R., Mahon, R J , and Sriprakash, K. S. (1991) DNA probes to identify the members of the Anopheles farautt complex. Med. Vet Entomol 5,447-454. 25. Hartas, J., Whelan, P , Srtprakash, K. S., and Booth, D. (1992) Oligonucleottde probes to identify three sibling species of the Anopheles farautt laveran (Diptera: Cuhcidae) complex. Trans. Roy Sot Trop Med. Hyg. 86,21&212. 26. Cockbum, A. F , Tarrant, C. A., and Mitchell, S. (1988) Use of DNA probes to distinguish sibling species of the Anopheles quadrtmaculatus complex (contrib) Flo Entomol
J Rep 71,299302.
27. Post, R. J. and Crampton, J. M. (1988) The taxonomic use of a variation m repetitive DNA sequences m the Stmulium damnosum complex, in Btosystemattcs of Haematophagous Insects (Service, M. W., ed.), Clarendon, Oxford, UK, pp 245-256. 28. Post, R. J. and Flook, P (1992) DNA probes for the identification of members of the Stmultum damnosum complex (Diptera: Simulidae) Med Vet Entomol. 6, 379-384. 29. Ready, P. D., Smith, D. F., and Killick-Kendrrck, R (1988) DNA hybridtsations on squash blotted sandflies to detect both Phlebotomus papatast and mfectmg Letshmania major. Med Vet Entomol. 2, 109-l 16. 30. Delves, C. J., Goman, M., Rtdley, R. G., Matile, H., Lensen, T. H. W., Ponnudarai, T., and Scaife, J. G. (1989) Identification of Plasmodium falciparum infected mosquitoes using a probe containing repetmve DNA. Mol Btochem. Parasitol. 32, 105-l 12. 3 1. Dissanayake, S. and Piessens, W. F. (1992) Identification of filartal larvae in vectors by DNA hybndtsation Parasttol Today 8,67-69 32. Gibson, W. C., Dukes, P., and Gashumba, J. K. (1988) Species-specttic DNA probes for identification of African trypanosomes in tsetse flies. Parasttology 97,63-73.
Hill
and Crampton
33. Beter, J C , Perkins, P. V., Wntz, R A., Koros, J., Diggs, D., Gargan, T. P., and Koech, D. K (1988) Bloodmeal tdenttftcation by direct enzyme-lurked mununosorbent assay (ELISA) tested on AnopheZes (Dtptera. Cuhctdae) m Kenya. J. Med. Entomol. 25,9-16 34. Wirtz, R A., Burkot, T R., Graves, P. M., and Andre, R. G (1987) Field evaluation of enzyme-lurked tmmunosorbent assays (ELISAs) for Plasmodzum falczparum and Plasmodzum vzvax sporozoites m mosquitoes (Diptera. Cuhctdae) from Papua New Guinea J Med Entomol 24,433-437. 35. Graztost, C., Sakai, R K , Romans, P., Mtller, L. H., and Wellems, T. E. (1990) Method for in sztu hybrldizatton to polytene chromosomes from ovarian nurse cells of Anopheles gambzae J Med Entomol 27,905-9 12. 36. Tchen, P , Anxolabehere, D , Nouaud, D., and Penquet, G (1985). Hybridisation on squashed flies: a method to detect gene sequences m individual Drosophzla. Anal
Bzochem
150,4 15-420
CHAPTER23
PCR of the Ribosomal DNA Intergenic Spacer Regions as a Method for Identifying Mosquitoes in the Anopheles gambiae Complex Anthony
J. Cornel
and
Frank
H. Collins
1. Introduction Six morphologically indistinguishable but genetically and behaviorally distinct mosquito species comprise the Anopheles gambiae Giles complex (1,2). All occur in Africa and in some localities three and possibly even four of these species occur in sympatry. The two most widespread species, A. gambiae and A. arabiensis, both of which are found throughout most of sub-Saharan Africa, are major vectors of human malaria parasites. The species A. melas and A. merus are locally significant vectors on the east and west coasts of Africa, respectively, where each breeds primarily in brackish coastal waters. A. quadriannulatus, which is abundant in southern Africa and also reported from Zanzibar and Sudan, feeds almost exclusively on domestic and wild animals and thus is not a malaria vector. The sixth and most recently described member of this complex, the halophilic A. bwambae, has a very restricted distribution, occurring only within a 20-km radius of the Barunga hot springs in the Bwamba county of Uganda, where it may be a locally important vector of malaria. Some species in the A. gambiae complex, particularly A. gambiae and A. arabiensis, have also been shown to be vectors of the filarial worm Wuchereria bancrofti in tropical Africa (3). From
Methods Nucle/c
m Molecular Aod Methods
Biology, Edlted
Vol 50* Species by J P Clapp
321
Dlagnosbcs Protocols PCR and Other Humana Press Inc , Totowa, NJ
322
Cornel and Collins
A number of techniques have been developed for identifying individual specimens of each of the sibling species in this complex, including polytene chromosome analysis (I), allozyme electrophoresis (4), ribosomal DNA RFLP analysis (5), species-specific DNA probes (6,7), and cuticular hydrocarbon analysis (s). More recently, diagnostic assays based on the polymerase chain reaction (PCR) have been developed (9, IO). When the PCR assay described in this chapter was developed, all species in the complex except A. bwambae were available. Subsequent to the original report, Townson and Onapa (II) showed that the assay also will distinguish A. bwambae from the other five. In addition, the assay will identify hybrids involving all species except A. bwambae, which have not yet been tested. This rDNA-PCR assay is based on a PCR reaction that contains five PCR primers, one plus strand primer designed from a conserved 28s gene sequence and four different minus strand primers derived from the intergenic spacer (IGS) regions of the rDNA. The rDNA in mosquitoes of the A. gambiae complex is comprised of a long tandem array of approx 500 copies of the transcribed region that encodes the 18S, 5.8S, and 28s rRNA separated by nontranscribed, IGS (12). The four minus strand primers provide the species specificity, and they have been designed so that each primer anneals perfectly with the rDNA of only those species it was designed to amplify. The fragments generated for each of the species are different m size and thus diagnostic for the rDNA of that species. The species-specific fragment sizes are as follows: 153 bp for A. quadriannulatus, 3 15 bp for A. arabiensis, 390 bp for A. gambiae, two bands of 390 bp and 690 bp for A. bwambae, 464 bp for A. melas, and 466 bp for A. merus. The rDNA of the latter two species are amplified by the same minus strand primer. Because these two species are allopatric in distribution, A. melas being found only in coastal west Africa and A. merus being only in coastal east and southern Africa, there is no need to distinguish between them by this assay. The rDNA loci of A. gambzae and A. arabiensis are in the centromerit heterochromatin of the X chromosome. A. merus, A. melas, and A. quadriannulatus, have a second rDNA locus, probably located on the Y chromosome (12). Nothing is yet known about the physical location of rDNA in A. bwambae. For hybrid females of all species and hybrid males with a Y chromosome from A. merus, A. melas, and A. quadriannulatus,
Mosquitoes
and the Anopheles gambiae Complex
323
two bands are amplified, with each band representing the size fragment of the parent. Hybrid males with a Y chromosome from A. gambiae or A. arabiensis show only the species diagnostic band of the female parent, since these two species have only the X chromosome rDNA locus. Because the ribosomal RNA genes are present in hundreds of tandem copies per cell nucleus, only very small quantities of template DNA are required. A small amount of tissue, such as a fragment of a leg or a few scales, is usually sufficient. The assay has 100% specificity and sensitivity can approach 100% with good quality extracted DNA or fresh tissue. This same basic approach has been used to develop species-specific PCR assays for other cryptic mosquito speciescomplexes (13,14), and it should be suitable for developing species diagnostic assaysfor other cryptic species groups.
2. Materials 2.1. Preparation of Template
DNA
If fresh, frozen, or desiccated specimens are available, a small fragment of tissue such as a leg, wing, or a few scales may be added directly to the PCR reaction mix and assay sensitivity exceeding 90% can gen-
erally be achieved. When the specimen has been stored in alcohol or a fixative or stored in a manner that may have resulted in significant DNA degradation, we recommend the use of extracted DNA, as follows (15): 1. Mosquito DNA or tissue. Specimens preserved in 100% alcohol (ethanol or isopropanol), modified Carnoy’s fixative (1:3 glacial acetic acid: 100% ethanol), desiccated, or frozen will generally contain sufficient DNA for this assay. 2. Grind buffer: Final Concentration &kl 1.6 mL 5M NaCl 0.08M NaCl 5.48 g sucrose 0.16A4 sucrose 12 mL 0.5M EDTA, pH 8.0 0.06M EDTA 10 mL 1M Tris-HCl, pH 9.0 O.lM Tris-HCI 2.5 mL 20% SDS 0.05% SDS Sterile water to 100 mL Filter sterilize through a 0.2~urn filter unit and heat buffer to 70°C to inactivate DNA-degradmg enzymes. Refrigerate at 4°C for short-term storage; store for longer periods at -20°C. An SDS precipitate will form on refrigeration or freezing and must be redissolved by warming before use. Just before use, add proteinase K to a final concentration of 25 ug/mL.
Cornel and Collins
324 3. 4. 5. 6.
Potassium acetate (8.OM). Stable for long periods at room temperature. Ethanol (100%). Stored refrigerated or at -20°C. Ethanol (70%). Stored refrigerated or at -20°C. Equipment includes 1.5-mL mrcrofuge tubes and pestles fitted to the tube (e.g., handheld plastic pestle, Kontes, Vineland NJ).
2.2. PCR Reaction We have optimized this procedure using reagents from Perkin-Elmer Cetus (PEC) (Norwalk, CT). Although less expensive and equally surtable reagents can probably be used, we suggest that alternatives be tested initially against the PEC products. 1. Primers. The sequence for each primer (5’ to 3’) IS as follows: a. Umversal20-mer primer (UN) (GTG TGC CCC TTC CTC GAT GT); b. A gambiae primer (GA) (CTG GTT TGG TCG GCA CGT TT); c. A. met-usandA. melasprimer (ME) (TGA CCA ACC CAC TCC CTT GA); d. A. arubzenszsprimer (AR) (AAG TGT CCT TCT CCA TCC TA); e. A quadriannulatus primer (QD) (CAG ACC AAG ATG GTT AGT AT); f. Alternative A. quadrrannulatus primer (QDA) (CAT AAT GAG TGC ACA GCA TA) (see Sectton 3.4.). 2. 1OX PCR reaction buffer with 15 rmI4 MgC12 (PEC). Stable at -20°C. 3. 25 mM MgC12 m sterile, deionized water. Stable at -2OOC. 4. 10 m&I dNTPs (N = adenme, cytosine, guanine, and thymme) (PEC). Stable at -2OOC. 5. Sterile, deionized water. 6. Amplitaq polymerase (5 U/pL) (PEC). Store at -20°C and handle on ice when out of the freezer. 7. Mineral oil. 8. Tns-borate-EDTA buffer, pH = 8 6 (TBE). Can be prepared as a 5X stock solution that has a shelf life at room temperature of several months tf kept sterile (26) 5X TBE = 54 g Trrs base, 27.5 g boric acid, 20 mL 0.05M EDTA (pH = 8.0), and sterile water to 1 L. 9. Equipment includes suitably sized capped tubes for use m the thermal cycler (0.5~pL mtcrocentrtmge tubes for most models). 2.3. Electrophoresis 1. Agarose. 2. Ethidium bromide: Prepare a 10 mg/mL (m water) solution and store in dark container at 4OC. This is a mutagen and should always be handled with care. We recommend that tt be stored m a break-proof vessel such as plastic.
Mosquitoes
and the Anopheles gambiae Complex
325
3. Loadmg dye solution (6X) (16): 0.25% Bromophenol blue; 0.25% Xylene cyan01 FF; 15% Ficoll (Type 400 Pharmacia, Uppsala, Sweden) m water. Stable for several months at room temperature. 4. Appropriate molecular weight marker. Use and store as recommended by manufacturer. In our laboratory, a 1-kb ladder supplied by Gibco BRL (Gaithersburg, MD; cat no. 15615-016) is often used. The standard 1susually prepared as a 600~pL working solution at a concentration of 1 ltg standard per 10 ltL as follows: 60 pg DNA standard; 100 ~.JLof 6X loading dye; 440 l.tL of TE buffer (10 mA4 Tris-HCl, 1 rmJ4EDTA, pH 8.0) (16). Store at -2OOC. 3. Methods
3.1. Preparation
of Template
DNA
3.1.1. Extraction of DNA from Single Mosquitoes 1. Place mosqutto or mosquito tissue into a 1.5-mL microcentrifuge tube containing 50 l,tL of grind buffer and grind with a sterile pestle until no recognizable mosquito parts remain, Thereafter rinse material on the pestle into the microfuge tube with an additional 50 pL of grind buffer (see Note 1). 2. Incubate the homogenized mosquito immediately after trituration at 65°C for 30 min to denature nucleases. 3. Add 13 pL of 8M potassium acetate and mix well. 4. Incubate on ice for 30 min to precipitate the mosquito parts, other insolubles, and denatured proteins. 5. Spin in cold (4°C) microfuge at 14,000 rpm for 15 mm. 6. Immediately after spinning, transfer the supernatant to new 1.5-mL microcentrifuge tube. 7. Add 200 PL of cold 100% ethanol, mix well, and leave at room temperature for at least 5 min. The ethanol DNA precipitates can be stored for long-term storage at -8O”C, but sufficient nucleases remain m this quick DNA preparation to slowly degrade DNA stored at -20°C or warmer. 8. Microfuge (4°C) for 20 min to pellet the DNA which will often have a purple hue owing to coprecipitation of eye pigments. 9. Remove the ethanol, being careful not to dislodge the pellet. 10. Rinse the pellet with 200 PL of 70% ethanol, and then remove the ethanol. Take care not to pour out the pellet. We find it safer to remove the ethanol carefully with a pipet. 11. The pellet can be air-dried at this step or dried with a vacuum dryer. Drying time can be significantly decreased by following step 9 with a rinse with 200 ltL of 100% ethanol.
Cornel
326
and Collins
12. Dissolve the pellet m sterile deionized water and keep frozen at -80°C (we typically dissolve the DNA extracted from a whole mosquito in 500 l.tL of sterile water and then use 1 pL of thts DNA solution for the PCR assay) (see Note 2). 3.1.2. Mosquito Tissue as Template DNA Tissue from a mosquito whose DNA is expected to be relatively intact (e.g., freshly killed, fi-ozen, or carefUlly desiccated) can be used as template (see Notes 3 and 4). We recommend using a rather small portion of tissue, such as part of a leg or an entire early instar larva. The tissue need not be carefully triturated. If the mosquito has been preserved in a fixative or other solution that could inhibit the PCR reaction, we recommend using extracted DNA.
3.2. PCR Reaction
(for a Single
25-w
Reaction)
1. For a single 25-pL reaction, add the following ingredients to the approprtate PCR tube on wet ice (typically a 0.5~l.tL microfuge tube) (see Note 5): a. 2.5 pL of 1OX reaction buffer with 15 mM MgC12 (see Note 6); b. 0.5 pL each 10 mM dNTP (final concentration 200 pMof each dNTP); c. 1 ltL of 25 mM MgC12 (final MgClz concentration, including that contamed in the reaction buffer, will be 2.5 mA4); d. Diagnostic primers (concentrations are approximate): 12.5 ng of primer UN (2 pmol final concentration); 6.25 ng of primer GA (1 pmol final concentratron); 12.5 ng of primer ME (2 pmol final concentration); 18.75 ng of primer AR (3 pmol final concentration); 25 ng of primer QD (4 pmol final concentration); e. 0.625 U of ampliTaq polymerase; f. Template DNA (l-4 ng of extracted DNA); and g. Sterile deionized water to final volume of 25 pL. 2. Overlay the 25 PL PCR reaction with one drop (-25 pL) of mineral 011to prevent evaporation (see Note 7). 3. Conduct PCR reaction in thermocycler programmed for 30 cycles at a denaturation temperature of 94°C for 30 s, an annealing temperature of 50°C for 30 s, and an extension temperature of 72°C for 30 s. 4. After completion of the PCR reaction, keep mixture at 4OC until loaded onto agarose gel. 5. For PCR of a large number of samples, we make a master mix of all reagents except the test DNA, with the concentration of the master mix being designed to reach the final working concentration when the test DNA 1sadded. Test DNA is added to each reaction tube, the master mix is then prepared, adding the ampliTaq last, and the appropriate amount of master mix is then added to each reaction tube.
Mosquitoes and the Anopheles gambiae Complex
327
3.3. Electrophoresis 1. Prepare a 2.5% agarose gel in 0.5X TBE at least 45 mm before loading the PCR products. The gel should contain approx 5 pL of ethidium bromide stock solution per 100 mL of gel. Note that the gel and chamber buffer should be handled with care because ethidium bromide is a mutagen. 2. Remove most of the 25 PL PCR reaction from under the mineral oil and mix with 5 PL of loading dye and load (10 PL of this mixture IS usually sufficient for the diagnostic PCR). Alternatively, with care, you can pipet the loading dye under the oil, mix gently, and then withdraw 10 FL of sample for loadtng on the gel. 3. Load 1 pg of DNA standard (we usually flank every 10-15 test lanes with DNA standards). 4. Run the gel for 30-45 min at 5-10 V/cm for sufficrent separation of PCR products. 5. View the gel under ultraviolet hght.
3.4. Interpretation
of the PCR Products
This rDNA PCR assay has been routinely used now in several different laboratories as a standard technique for the identification of field col1ectedA. gambiae complex specimens. The PCR conditions as described earlier were optimized for Perkin-Elmer Cetus reagents and equipment. Significantly different conditions may be optimal when using reagents from different sources and using different thermocyclers. Typical results are depicted in Figs. 1 and 2. Scott et al. (10) mentioned that PCR of A. merus specimens or DNA sometimes resulted in the amplificatron of two bands, one bright band corresponding to a fragment size diagnostic for A. merus and a second fainter band identical in size to that expected for A. quadriannulatus. This result rarely compromised specificity, since the A. merus diagnostic band was usually much brighter. However, we have found one wild population of A. merus from a natural hot spring known as Mafayeni in the Kruger National Park of the Republic of South Africa whose specimens consistently amplify the A. quadriannulatus diagnostic fragment in an equal or sometimes greater amount than the A. merus diagnostic band Fig. 1, lanes 3 and 4. Because A. quadriannulatus is also found in this area, identification of specimens by PCR can be difficult. We speculate that in this and possibly other A. merus populations found in sympatry with A. quadriannulatus, there may have been some introgression of rDNA.
328
Cornel and Collins
Fig. 1. Photograph of an ethidium bromide stained 2.5% agarosegel under ultraviolet light illumination showing the rDNA bands amplified by PCR from individual mosquito DNA extractions for the various members of the A. gambiae complex and from mixtures of DNA from pairs of speciesto simulate hybrids. The samplesare as follows: 1 = 1 kb DNA ladder standard; 2 = A. gambiae (390 bp); 3 = A. arabiensis (3 15 bp); 4 and 5 = A. merus, illustrating specimensfrom which the A. quadriannulatus-rDNA fragment also amplifies (466 and 153 bp); 6 = A. melas (464 bp); 7 = A. quadriannulatus (153 bp); 8 = A. arabiensis + A. gambiae; 9 = A. gambiae + A. melas; 10 = A. gambiae + A. quadriannulatus; 11 = A. arabiensis + A. merus; 12 = A. quadriannulatus + A. merus. Each lane represents15 )JL of the completed 25 pL PCR reaction and all reactions were done on 1/500th of a whole mosquito DNA extraction. To circumvent this problem, we recommendthe use of an alternative A. quadriannulatus-specific primer for studies in localities where A. quadriannulatus, andA. merus may be found sympatrically. This primer,
known as QDA (in Section 3.1.1., step 6), should be used in the following alternative rDNA-PCR assaythat will unambiguously differentiate among specimensof A. merus, A. quadriannulatus, and A. arabiensis, the only three speciesthat may be presentin areaswhereA. merus and A. quadriannulatus are sympatric (Fig. 2). If this alternative A. quadriannulatus primer is used, the PCR reaction mixture should be modified as follows: Replace the original (QD) primer with 37.5 ng (approx 6 pmol final concentration)of the alternativeA. quadriannulatus primer (QDA), and excludethe A. gambiae primer. The amountsof other reagentsremain the same,except for the quantity of water that needsto be increased slightly to obtain a final reaction volume of 25 uL. The
Mosquitoes
and the Anopheles gambiae Complex
329
Fig. 2. Photograph of an ethidium bromide stained 2.5% agarosegel showing rDNA-PCR products amplified from four membersof the A. gambiae complex using the alternative A. quadriannulatus primer. Each lane contains 15 PL of a 25 yL PCR volume. The samplesare as follows: 1 = 1 kb ladder standard; 2 = A. melas (464 bp); 3 = A. merus (466 bp); 4 = A. arabiensis (315 bp); 5 = A. quadriannulatus (415 bp).
diagnostic bands should have the following sizes:A. merus = 466 bp, A. quadriannulatus = 415 bp, and A. arabiensis = 3 15 bp. We have not yet validated this alternativeprimer and theseconditions as suitable for identification of hybrids. The A. gambiae complex rDNA-PCR assayjust described has been extensively evaluatedand comparedwith other available techniquesused to identify specimensin A. gambiae complex. The rDNA-PCR assayhas the distinct advantageover most other techniques of being absolutely specific, highly sensitive,andrelatively rapid. It is more expensive,however, than either the widely used cytological method of identification or the species-specificprobesusedin a squashblot format (I, 6,7). For quick surveys of a vector population where high sensitivity and/or specificity are not important, one of these latter techniquesmay be more suitable. We recommendthe use of this PCR assayin support of malaria transmission researchand control programs where high levels of sensitivity and specificity are important.
330
Cornel and Collins 4. Notes
1. Owing to the sensitivity of the assay, which detects an rDNA target
2.
3.
4.
5.
sequence present m at least 500 copies per cell, specimens can be preserved in variety of different ways. The easiest in terms of field application is probably 100% isopropanol. If possible to avoid contamination, multiple specimens should not be preserved in the same container. If pestles are to be reused for grinding of mosquitoes, we recommend a careful cleaning that includes a brief exposure to 1N HCl to destroy any attached DNA. The technique for extracting DNA from individual mosquitoes generally yields between 1 and 2 g of total DNA per mosquito. We usually obtain good results when between l/lOOOth and 1/5OOthportion of this DNA is used for PCR (about 14 ng). The use of more than 10 ng of purified DNA tends to result in the production of nonspecific PCR artifacts. One of the major advantages of using a PCR-based species diagnostic assay is that mosquito tissue can be used directly as the DNA template. This leaves other parts of the mosquito available for other studies, and even allows the identification of a living specimen from which a few scales or a leg segment has been removed. Scott et al. (Z0) reported slightly lower sensitivity when PCR reactions were done with tissue rather than purified DNA. Our experience and that of other laboratories that have used this technique is that the slight loss in sensitivity when using tissue vs extracted DNA is more than offset by the significant reduction in labor. Specimens for testing should be stored individually if possible, because a small amount of contaminating tissue can lead to incorrect identification. This is a problem parttcularly when small tissue fragments like a wmg or leg are used for identification. When DNA is extracted from an entire specimen, contamination with a small amount of DNA from a different specimen is generally not a problem because of the large ratio of correct to contaminating DNA. Owing to the sensitivity of PCR assays it is recommended that a careful laboratory protocol be adapted so as to avoid contammation of the PCR reagentsand test DNA. We recommend that PCR reagents and PCR products be handled in a separate area from that of the test DNA (or test tissue), and that each area have its own reagents, supplies, and pipets. The most troublesome contamination occurs when the PCR reagents or primers are contamtnated with small amounts of DNA either from a sample or from a PCR product. A further precautronary measure against contammation of the PCR reagents is to aliquot all the stock and working reagents, especially the PCR primers, into small amounts. Always include a no template DNA control. In the event of contamination. onlv a small amount of the reagents
Mosquitoes and the Anopheles gambiae Complex
331
then need to be discarded. Ahquotmg chemicals into smaller amounts also prevents degradation of the reagents caused by many freeze-thaw cycles. 6. Although the 10X PCR buffer already contains MgClz we recommend a final working concentration of 2-3 mM MgCl,. 7. The mineral oil layer on top of the reaction mixture serves to prevent evaporation, but it is not required for some of the more efficient thermocyclers now available on the market.
References 1. Coluzzi, M., Sabatmi, A., Petrarca, V., and Di Deco, M. A. (1979) Chromosomal differentiation and adaptation to human environments m the Anopheles gambiae complex. Trans R Sot Trop Med. Hyg. 73,483-497 2. Service, M. W. (1985) Anopheles gambiae: Africa’s principal malaria vector, 1902-1984. Bull Entomol Sot Am 31,8-12. 3. Gillies, M. T. and Coetzee, M. (1987). A Supplement to the Anophelinae of Africa South of the Sahara The South African Institute for Medical Research, Johannesburg. 4 Miles, S. J. (1979) A biochemical key to adult members of the Anopheles gambiae group of species (Diptera:Culicidae). J. Med. Entomol. 15,297-299. 5. Collms, F H., Fmnerty, V., and Petrarca, V. (1988) Ribosomal DNA probes differentiate five cryptic species m the Anopheles gamblae complex. Parassltologza 30,23 l-240. 6 Hill, S. M and Crampton, J M. (1994) DNA-based methods for the identification
of insect vectors. Ann Trop Med Parasitol 88,227-250 7. Hill, S. M. and Crampton, J. M. (1994) Synthetic DNA probes to identify members of the Anopheles gambiae complex and to distmguish the two major vectors of malaria within the complex, An. gambiae S.S. and An arablensis. Am J Trop Med. Hyg. 50,3 12-32 1 8. Carlson, D. A. and Service, M. W. (1980) Identification of mosquitoes of the Anopheles gambrae species complex A and B by analysis of cuticular components Sczence 207, 1089-l 09 1. 9. Paskewitz, S. M. and Collins, F H. (1990) Use of polymerase chain reaction to identify mosquito species of the Anophelesgamblae complex Med. Vet. Entomol. 4,367-373. 10. Scott, J. A., Brogdon, W. G., and Collins, F. H. (1993) Identification of single specimens of the Anopheles gambiae complex by the polymerase chain reaction. Am. J Trop Med Hyg. 49,52O-529 Il. Townson, H. and Onapa, A. W. (1994) Identification by rDNA-PCR of Anopheles bwambae, a geothermal spring species of the An. gamblae complex. Insect Mol. Blol. 3,279-282. 12. Collins, F. H., Paskewitz, S. M., and Finnerty V. (1989) Ribosomal RNA genes of the Anopheles gambiae complex. Adv. Dis. Vect. Res. 6, l-28. 13. Porter, C. H. and Collins, F. H. (1991) Species diagnostic differences in a ribosoma1 DNA internal transcribed spacer from the sibling species Anopheles freeborni and Anopheles hermsi. Am J Trop Med Hyg. 45,271-279
Cornet? and Collins 14. Cornel, A. J., Porter, C. H., and Collins, F. H. An rDNA PCR spectes-dragnosttc assay for members of the Anopheles quadrunaculatus cryptic species complex (Dtptera: Cuhctdae) J. Med Entomol , m press 15. Ltvak, K. (1984) Orgamzatton and mappmg of a sequence on the Drosophila melanogaster X and Y chromosomes that is transcribed during spermatogenests Genetics 107,6 1 l-634 16 Sambrook, J., Fritsch, E. F., and Maniatts, T (1989) Molecular Cloning. A Laboratory Manual, 2nd ed , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
CHAPTER
Restriction Polymorphism Distinguishing
24
Fragment Length (RFLP) Analyses
African
and European Honey Bees
H. Glenn Hall 1. Introduction 1.1. Restriction
Fragment Length (RFLPs)
Polymorphisms
With the discovery of bacterial “restriction endonucleases” (I), it became possible to fractionate the long DNA molecule, so that specific regions could be analyzed. These enzymes cut DNA at specific short sequences, commonly consisting of four to six nucleotides (2). DNA fragments of discrete lengths are generated, which can be separated by electrophoresis through a gel matrix. In fragmenting DNA, restriction enzymes can be used as a reflection of the nucleotide sequences that they recognize, allowmg genetic distinction based on a small percentage of the genome, without having to sequence the DNA (3). If a sequence recognized by a restriction enzyme is altered by a substitution of any of the nucleotides, it would not be cleaved. Likewise, nucleotide changes may create new sites. Such differences, resulting from genetic divergence, would be manifested in the length of fragments generated by the enzymes and separated by electrophoresis. Fragments generated by other enzymes would reflect positions of different restriction sites along the same region of DNA and would reveal changes in From
Methods m Molecular Nuc/e/cAcrd Methods
Biology, Edlted
Vol 50 Specres Dagnostrcs Protocols. PCR and Other by J P Clapp Humana Press Inc., Totowa, NJ
333
the additional sets of nucleotides. Changes in restriction fragment patterns result not only from point mutations but also from deletions, insertions, or duplications that alter the length of fragments (M). In the nuclear genome, polymorphisms also reflect different locations of the same sequence (repetitive or transposable DNA), owing to different flanking DNA (7,8). DNA polymorphisms are not limited to sequences expressed as proteins, and their presence in noncoding sequencesmay not be as subject to the same evolutionary pressures as those on coding sequences. Because differences in restriction enzyme sites do not necessarily result in, nor does their detection depend on, functional changes, this analysis potentially can provide many genetic markers. Restriction fragments of nuclear DNA show codominant expression (3,9), enabling identification of heterozygotes and parental analyses. RFLP analyses can be performed on DNA that is isolated, cloned, amplified, or visualized by probes. Use of radioactively labeled, cloned probes is the primary means to analyze RFLPs of eukaryotic nuclear DNA (3,9,10). When an entire nuclear genome is digested with restriction enzymes, thousands of different size fragments are generated. These can be separated by gel electrophoresis but cannot be resolved. A probe enables visualization of only a small portion of the genome at a time and allows comparison of similar sequences, representing one or more loci, from one individual to the next. After electrophoretic separation, the DNA fragments are denatured into single strands and then transferred by capillary action, through the face of the gel, to become immobilized in the same relative positions on a membrane. The membrane is soaked for a period of time with a solution containing the labeled probe. The probe will attach only to fragments on the membrane to which it is complementary, binding through base pairing, i.e., through molecular hybridization. The fragments that bind the probe are detected by exposure to X-ray film. This procedure is known as “Southern” analysis (10). The longer the probe DNA, the more potential restriction sites it can overlap and therefore detect. Ideal probes would detect as many electrophoretically separated fragments as possible with none superimposed. The number of fragments also depends on the restriction enzyme used to digest the sample DNA. Restriction sites with the fewest nucleotides (four) are found at the highest frequency.
RFLP Analyses DNA probes representing single or low copy number sequences will reveal the discrete bands needed for restriction fragment analysis. The genomic location of a contiguous section of DNA, present as a single copy, can be viewed as a locus. Substitutions at a single nucleotide position are allelic in the strictest sense. However, polymorphisms at different positions, within the region defined by the probe, can also be considered alleles, analogous to amino acid substitutions at different points along a protein molecule. To distinguish species and subspecies, allele distinction is sought at loci scattered throughout and generally representative of the genome. With a library of different clones used as probes, many homologous regions of the nuclear genome can be compared. Clones to anonymous and noncoding regions (4), as well as to specific genes, are useful for this purpose. The probability that a probe will carry repetitive DNA along with unique sequences increases with the length of the probe and depends on the distribution of repetitive DNA m the genome. Middle repetitive elements are present in either a short (e.g., Xenopus Zaevis, Musca domestica, Homo sapiens) or long (e.g., Drosophila melanogaster, Apis meZZi&a) interspersion pattern (11-14). Repetitive segments scattered throughout the genome have different flanking DNA such that, after enzyme digestion, they are present in many different size fragments. Probes representing abundant repetitive sequencesoften reveal too many bands to be distinguished. However, when two or more restriction enzyme sites exist entirely within the repetitive sequence, the multiple copies are reduced to the same size fragments. In tandemly arranged repetitive DNA, a single restriction site, or more, within the sequence can also generate the same size fragments (8). Upon electrophoresis, discrete bands are formed, containing an amount of DNA proportional to the number of copies, as much as several thousand times greater than in bands from unique DNA. Some repetitive sequencesare highly variable, existing as tandem arrays of different lengths at a limited number of scattered genomic locations, which are known as minisatellites (61.5). Probes to these sequences will sometimes reveal a discernable pattern of bands unique to an individual and, thereby, serve as a genetic fingerprint (I 6,17). Usually, this variability is too great to distinguish groups of individuals such as species or subspecies. (This introduction is a modified excerpt from ref. 18, by permission of Westview Press, Boulder, CO.)
336
Hall
Application
1.2. The African of DNA RFLP
Honey Bee: Analyses to a Problem
Several European subspecies, or races, of the honey bee,Apis mellijkra L., have been imported to the Americas since the time of colonization (19-21). The European bees established feral populations in temperate regions but not in the neotropics, where they remained largely confined to apiaries. Because African bees were better adapted to tropical environments, A.m. scutellata (22) queens were imported from South Africa to Brazil in the late 1950s with the hope of improving commercial honey production (23,24). Swarms of African bees that escaped from apiaries established large feral populations that, within 37 yr, expanded throughout most of the tropical and subtropical regions of the Americas (2.5,26), most recently into Texas and Arizona of the Umted States. Through African paternal introgression, European bees in neotropical apiaries were quickly replaced by Africanized offspring (2.5,26).As African bees entered temperate regions of South America, where European bees are superiorly adapted, their advance apparently has been halted and an African-European hybrid zone formed (27,28). A similar hybrid zone is expected to form at the subtropical-temperate boundary in the United States (29). African bees are difficult to manage because of a number of characteristics, most notably then extremely defensive stinging (2.5). Consequently, in many neotropical countries, beekeeping industries collapsed after African bee invasion (3&32). African and European bees are difficult to distinguish by both phenotype (morphology) and genotype (33). Among protein polymorphisms reported previously, only four have significant frequency differences between African and European honey bee populations (33). None of the alleles is subspecies specific. Limited protein polymorphism is generally characteristic of Hymenopteran insects (bees, ants, and wasps), probably owing to the low population sizes of reproductives (34) and possibly owing to selection against haploid males (35). Over the last several years, DNA RFLP analyses have begun to overcome the deficiency of genetic markers. Consequently, processes involved in the spread of the African bee have become better understood (18,36). Both maternal and paternal gene flow, between the feral African bees and the resident European bees in apiaries, were found to be
RFLP Analyses
337
asymmetric m favor of the African genotype. Using mitochondrial DNA (mtDNA), New World African bee expansion was shown to occur primarily through feral swarms, representing unbroken African matrilines (37-39). The absence of European mtDNA showed that European matrilines do not contribute to the feral population (i.e., as swarms from apairies), even after becoming strongly Africanized from mating with feral African drones. In neotropical apiaries, European matrilines eventually disappear (3 7-39), probably through attrition. African maternal gene flow into apiaries occurs as a consequence of beekeepers replacing lost colonies with African swarms and through colony usurpation by swarms (2.5). With nuclear DNA markers, the effect of African paternal introgression into European apairies was observed (40). A low level of European paternal gene flow into the front of the African population, as it expands into regions occupied by European bees, was detected (40). Lower frequencies of European nuclear DNA markers further behind the front were found (40), which suggests that hybrids initially formed do not persist in the feral African population as it becomes established. Environmental selection may be primarily responsible for the limited hybridization seen in the neotropical feral population. Hybrids are expected to persist in hybrid zones where African and European bees are equally adapted (27-29). Other factors, that may or may not be a function of the environment, may limit hybrid formation or survival, for example, reduced metabolic capacity (41). Selective mechanisms may be manifested in genotype distributions in the hybrid zones (42). DNA markers will enhance recognition of genotypes and characterization of hybrid zone population structure. In one of the early mtDNA RPLP studies cited, an isolated preparation of mtDNA was used as a radioactive probe (37), whereas, in another, mtDNA was isolated from each sample, then digested and end-labeled (‘38). A later mtDNA study employed RPLP analysis of DNA amplified by the polymerase chain reaction (PCR) (39). The nuclear DNA study just cited used plasmid clones of random, honey bee DNA fragments as radioactive probes to detect distinguishing polymorphisms (40). Efforts are currently in progress to isolate and analyze the nuclear polymorphic regions detected with probes, so that they can be amplified by PCR, as has been done with mtDNA.
of Random
1.3. Plasmid Clones Honey Bee Nuclear DNA Fragments
Detailed methods to obtain and select clones are beyond the scope of the chapter (see ref. 43 for details of molecular clonmg methods), but a brief general description is provided here. In constructing the first clones used to detect RFLPs in honey bees (441, European bee nuclear DNA was digested with the restriction enzyme PstI. The random fragments generated were ligated into the PstI site of plasmid pBR322, and competent E coli bacteria were transformed. Using replica plates, bacterial colonies were selected that had tetracycline resistance (thus had incorporated the plasmid) but had lost ampicillin resistance (had an insert in the PstI site). A collection of these bacterial clones was stored frozen. Before using the clones for RFLP analyses, they were further characterized to identify those with repetitive DNA and to estimate the size of the insert (44). Replicates of the clones were grown and lysed on an membrane, releasing their DNA and causing it to bind to the membrane (45). Using the procedures described in this chapter, the membrane was hybridized to total honey bee DNA, labeled by nick translation, and exposed to X-ray film. Because only repetitive sequences were at an adequate concentration in the labeled total DNA, only clones carrying repetitive DNA exhibited significant hybridization. Additional amounts of the cloned bacteria were grown, from which plasmids were isolated (the boiling method was used first, but later the alkaline lysis method was found to be the easiest and most reliable-both methods described in ref. 43). Other procedures described in this chapter were used to estimate the insert size. The plasmids were digested with &I to release the insert, and the products were separated by electrophoresis and stained with ethidium bromide (EtBr). The honey bee contains about 10% DNA that is moderately or highly repetitive, arranged in a long interspersion pattern (13,14). Thus, cloned inserts were commonly obtained that were 3-l 1 kbp in length, without significant amounts of repetitive DNA. Such inserts may tend to be much shorter in organisms that have repetitive DNA comprising a greater proportion of their genome and/or present m a short interspersion pattern, In such organisms, this selection process for clones may be more important than for organisms such as the honey bee.
339
RFLP Analyses
Since the original honey bee clones were constructed, more versatile plasmid vectors, e.g., the pUC and pGEM series (Gibco-BRL [Gaithersburg, MD], Boehringer Mannheim [Indianapolis, IN], Promega [Madison, WI]), have become available and have been used in more recent bee DNA cloning (46). These plasmids carry an ampicillin resistant gene and, at another region, a multicloning site, which enables cloning of fragments cut with a larger selection of restriction enzymes. An insert at this site disrupts a P-galactosidase gene (LacZ). Colonies are selected from plates containing ampicillin and X-gal, a calorimetric substrate of LacZ. Colonies that have an insert are white, and those that do not are blue. 1.4. Chapter
Content In this chapter, one set of procedures is described to conduct RFLP analyses using radioactive probes. Alternatives available for several of the steps are not covered. The procedures selected for the chapter are well-established and result in reliable outcomes. Most have been developed and previously described by others (particularly ref. 43). Slight modifications are included, some of which involve extended times to increase consistency and quality. Emphasis here will be on details, largely in the Notes section, not described elsewhere. 2. Materials Reference 43 provides further details for making many of the solutions listed here. These details are most important for the solutions marked with an asterisk (*). Unless indicated otherwise, twice distilled or deionized plus distilled Hz0 is used in making the solutions, and solutions are kept at room temperature. For blot wash solutions, once distilled or deionized Hz0 can be used. Other items and equipment that are of a specific type or less common are listed. 2.1. Solutions Used for Several Procedures 1. 0.5M EDTA, pH 8.0: For a total of 1 L, dissolve 186.1g of disodium ethylene-diamine-tetraacetatewith about 10 g of NaOH, then add approx another 10 g to pH 8.0. Autoclave. 2. 20% SDS: Separatestocks of electrophoresls/molecularbiology gradeand standardgrade(the latter only for blot wash solutions). 3. 1M DTT; 20 mA4DTT: Storeas I-mL ahquotsat -20°C.
4. 50 mg/mL BSA: Bovine serum albumm, molecular biology grade as provided by manufacturer (e.g., Gibco-BRL). Store at -20°C.
2.2. DNA Isolation 1. STM: 0.32Msucrose, 50 mMTrr+HCl, 10 mMMgCl*, 0.5% (v/v) nonidet P-40, pH 7.5. Store at 4°C. 2. STE: 75 mMNaC1, 10 mA4Trrs-HCl, 25 mM EDTA, pH 7.8. Autoclave. 3. 20 mg/mL Protease K: Store as 100~pL aliquots at -20°C. Mix well after thawing. 4. Tris-saturated phenol *: Distilled and neutralized (Boehrmger Mannhelm). Add 0.1% hydroxyqumoline and l/3 vol of O.lM Tris-HCl, pH 8.0. Divide mto 50-n& fractions in polypropylene tubes, and store at -20°C. Keep one working fraction at 4°C. 5. CIA: Chloroform, isoamyl alcohol (24: 1 by volume). 6. TE* 10 mMTris-HCl, 1 mMEDTA, pH 8.0. Autoclave. 7. ST: 15 mMNaC1, 10 mMTris-HCl, pH 7.5. Autoclave. 8. 10 mg/mL RNase A: Pancreatic RNase. Dissolve m ST, boil for 10 min, cool slowly to room temperature, and store at -20°C. 9. 25 mA4 Citric acid, pH 2.5: Store at 4°C. 10. Conical pestle: Pellet pestle, reusable, 1.5 mL (Kontes, available from Fisher, Pittsburgh, PA). 11. Teflon pestle homogenizer: Potter-Elvehjem tissue grinder with PTFE pestle, 2 mL (Wheaton, available from Fisher). 12. Stirring motor: (StedFast, available from Fisher). 13. Rotator: Multipurpose rotator, model 151 (Scientific Industries, available from Fisher). 14. Microfuge tube rack: Water bath rack, rectangular, with screw-down hd, for 24 1.5-mL microfuge tubes (USA Scientific Plastics, Ocala, FL). 15. Tissumizer: With 1OOENshaft (Tekmar, Cincinnati, OH).
2.3. Restriction
Endonuclease
Digestion
of DNA
1. Restriction endonucleases: As provided by manufacturers (e.g., GibcoBRL, New England Biolabs [Beverly, MA], Boehringer Mannhelm). Store most at -20°C. 2. 1OX Digestion buffers: Buffer solutions designed for each enzyme as provided by manufacturers. Store at -20°C. 3. Digestion formula: 10 pL of 10X drgestion buffer, 5 pL of 20 mA4 DTT, 2.5 pL of 50 mg/mL BSA, 1 pL of restriction enzyme (10 U), 61.5 PL of HzO, 20 pL of DNA sample (30 ltg dissolved in TE). Make fresh.
RFLP Analyses
341 2.4. Electrophoresis
1. 50X TAE gel running buffer: 242 g of Tris base, 57.1 mL of glacial acetic acid, 100 mL of 0.5M EDTA-pH 8.0 in 1 L. Autoclave. 2. Agarose: 1 or 2% in 1X TAE. Electrophoresis/molecular biology grade. 3. BB stock: 0.5% bromophenol blue. 4. GBBE: 50% glycerol, 0.1% bromophenol blue, 75 mM EDTA. 5. Molecular size standards: 5 pg each of bacteriophages lambda and @X174 digested separately with Hind111 and HaeIII, respectively. Each provided as a 0.25-0.8 mg/mL stock by the manufacturer (e.g., Gibco-BRL). Mix 6-20 pL of each (depending on actual concentrations) with HZ0 for a total of 20 p.L, and digest according to digestion formula (Section 2.3., item 3). Add 5 pL of 0.5M EDTA-pH 8.0 to each after digestion. Store at 4°C. 6. Molecular size standards for maxi-gels: Combine 100 pL each of digested bacteriophage lambda and @X174, 300 pL of GBBE, and 1.5 mL of 50 mMNaC1, 50 mMTris-HCl, 10 mMMgC12, pH 8.0. 7. Ethidium bromide (EtBr) stock solution: 1% ethidium bromide. Keep bottle covered with alummum foil and store at 4°C. Ethidmm bromide is a potent mutagen. Disposable gloves always should be worn when handling this chemical. A respiratory mask should be worn when making the stock solution. Solutions and washes containing stain are considered hazardous waste and should be disposed accordingly. For institutions without a hazardous waste removal program, several procedures are available for destroying the dye before it is discarded (43). 8. EtBr staining solution: 0.0001% ethidium bromide. Make fresh. 9. Leveling table (BioRad, Hercules, CA). 10. Camera: Polaroid MP-40 copy stand, 135 mm lens, or Fisher Biotech Photo-Documentation, 105~mm lens (both available from Fisher). 11. Film: Polaroid type 57 (single sheets,high speed), 55 (single sheets,positive/negative), 667 (pack film, high speed). 12. UV filter: Wratten 22A; orange UV filter (Tiffen, available from Fisher). 1, 2. 3. 4. 5. 6.
2.5. Blotting Blotting solution: 0.4N NaOH, 0.6MNaCl. Neutralizing solution: lMNaCl,0.5M Tris-HCl, pH 7.0. Autoclave. 3MM filter paper (Whatman, available from Fisher). BR filter paper: Gel dryer filter paper backing 35 x 45 cm (BioRad). GSP membranes: Gene Screen Plus hybridization transfer membranes (NEN Research Products/Dupont, Wilmington, DE). Capillary blotting stone: (Altek Plastics, Boston, MA).
342
Hall
2.6. Nick
Translation
1. 10X Nick translation buffer: 0.5M Tns-HCl, O.lM MgS04, 1 mM DTT, 0.5 mg/mL BSA, pH 7.5. Store at -20°C. 2. Nucleotide stocks*: 10 mM each of thymidme 5’ trlphosphate (TTP), 2’ deoxyadenosine 5’ triphosphate (dATP), 2’ deoxyguanosine 5’ triphosphate (dGTP)-sodmm salts (e.g., Sigma, St. Louis, MO). Adjust to pH 7.0 with 1M Trls base, pass through 0.2~pm syringe filter, store as 0.5-mL aliquots at -70°C. 3. 5X TAG: 500 PL of 1OX nick translation buffer, 10 PL each of 10 mA4TTP, dATP, and dGTP stocks,25 pL of 20 mMD’IT, 445 PL of HzO.Store at-20°C 4. [32P]dCTP: [cz-~~P]2’ deoxycytrdme 5’ tnphosphate, ~3000 Ci/mmol (10 mCi/mL) m Trlcme buffer, as provided by the manufacturer (Amersham, Arlington Heights, IL; NEN Research Products/Dupont). Store at -20°C. [32P] is a high energy /3 emitter. While handling this radlolsotope, wear a lab coat, disposable gloves, and a radiation badge, so that exposure can be monitored by the mstltution’s health and safety department. As much as possible, work with the radioisotope should be done and viewed behind a clear plexiglass/luclte shield, at least l-cm thick. When the nick translation reaction is placed m a cool water bath, the water provides sufficient shielding. 5. DNA Pol I - DNaseI: DNA polymerase I (0.4 U/pL)/ DNaseI (40 pg/mL), combined, as provided by manufacturer (Gibco-BRL). Store at -20°C. 6. Diluted bacteriophage DNA: 1 yL each of 0.5 mg/mL stock solutions of bacteriophages lambda and @X 174, 198 pL H,O. 7. Nick translation reaction mixture: 10 pL of 5X TAG, 26-20 PL of Hz0 (depending on the amount of [32P]dCTP), 5 PL DNA probe [3-5 pg], 50 PCi of [32P]dCTP (4-l 0 pL, depending on activity), 5 PL of DNA Polymerase I-DNaseI, 50 FL total. Add m this order. Make fresh. 8. Column trackmg dye: 0.3 mg/mL phenol red, sodnun salt (Sigma), 20 mg/mL blue dextran (Sigma), 10% glycerol. 9. Radiation shields (Amersham, Fisher). 10. 0.2~pm Syringe filter (Gelman, available from Fisher). 11. Sephadex G-50 (medium)*: Hydrated in TE. Store at 4’C.
2.7. Prehybridization,
Hybridization,
and Washes
1. 20X SSPE: 3.0MNaC1, 0.2MNaH2P04, 20 mMEDTA, pH 7.4. Autoclave. 2. 50X Denhardt’s: 1% each of ficoll type 400, polyvinylpyrrolldone 40,000 mol wt, BSA fraction V (all from Sigma). Dissolve together and pass through a 0.2~pm sterlhzatlon filter.
343
RFLP Analyses
3. 10 mg/mL Salmon sperm DNA*: Needle-sheared, denatured by boiling. Store as 1-mL aliquots at -20°C. 4. Hybridization solution: 6X SSPE, 0.2 mg/mL salmon sperm DNA, 1X Denhardt’s, 1% SDS. Bring 30 mL of 20X SSPE and 53 mL of HZ0 to a boil. While still warm, add 2 mL of 10 mg/mL salmon sperm DNA (prevrously denatured for 10 min in a boiling water bath), 10 mL of 50X Denhardt’s, and 5 mL of 20% SDS. Make fresh. 5, 20X SSC: 3M NaCl, 0.3M Na Citrate (trisodmm salt), adjust to pH 7.0 with a few drops concentrated HCl. Autoclave. 6. Wash solution A: 2X SSC, 0.1% SDS (standard grade). 7. Wash solution B: 0.1X SSC, 0.5% SDS (standard grade). 8. Plastic pans with hds (22 x 22 x 7 cm) (Tupperware, Orlando, FL). 9. Sterilization filter: 0.2 pm, 115 mL capacity (Nalgene, available from Fisher). 10. Incubator shaker: Orbit environ-shaker (Lab-Line, available from Baxter Scientific Products, McGaw Park, IL); incubator shaker (New Brunswick, available from Fisher). 11. Beaker racks: Beaker buddy, round, with screw-down lid, for 1.5-mL microfuge tubes (USA Scientific Plastics). 12. Hybridization oven: Hybridization oven/incubator (Robbins [Sunnyvale, CA], Appligene [Pleasanton, CA], Techne, available from Fisher). 13. Heat sealable bags: Seal-a-Meal, 10 in. wide, 20 ft long rolls (Dazey, Industrial Airport, KS). 14. Heat sealer: Poly heat bag sealer/impulse heater (TEW, available from PGC Scientific, Gaithersburg, MD).
2.8. Film
Exposures
1, Cassettesand intensifying screens: 35 x 43 cm; Autoradiography cassettes, AC series (Fisher); Quanta III screens without blockers (NEN Research Products/Dupont); hypercassettesand hyperscreens (Amersham). 2. X-ray film: X-Omat 8 x 10 in (Kodak). 3, Developing chemicals: X-ray film developer, 1% acetic acid stop solution, X-ray film fixer (Kodak).
2.9. Stripping 1, Alkaline stripping solution: 0.4N NaOH. 2. Neutralizing solution: 0.1X SSC, 0.5% SDS, 0.2MTris-HCl, 3. Wash solution B: 0.1X SSC, 0.5% SDS (standard grade).
pH 7.5.
344
1.
2.
3, 4. 5. 6. 7
Hall 3. Methods 3.1. Collecting and Preserving Samples (40,471 (see Note 1) 3.1.1. Alcohol Preservation To collect uncapped worker larvae, hold the brood comb over a pan, and direct a pressurized stream of water mto the comb cells. With a tea strainer, remove the larvae from the water To collect pupae, manually extract them from the comb with forceps, after removing the cell caps. Add about 10 mL of worker larvae or pupae, or about 30 (m number) drone larvae or pupae, to a 100-mL disposable, plastic, tissue culture flask. Add at least 30 mL of 95% ethanol chilled to 4°C. Spread the brood over the flat bottom of the flask by gentle shaking to maximize their surface exposure to the ethanol. Keep the flask at 4°C and agitate several times a day. Change the ethanol twice after each 12-l 6 h and again 24 h later (seeNote 2). For transport, transfer the preserved larvae or pupae to smaller plastic vials, and top with fresh 95% ethanol. Place a label inside each vial, as well as an adhesive label on the outside, both written m pencil. If possible, transport the samples on ice, but preserved samples can be transported or mailed at ambient temperatures. Store the samples at -20°C. Follow a similar procedure for adults. It is adequate to place them m bottles, rather than flasks, and to change the alcohol only once.
3.1.2. Frozen Samples 1. If samples are collected m the vlcmity of the lab, or dry ice shippmg is available, cut secttons of comb contammg brood from the hive, and place in sealed plastic bags. Collect adults m bags or vials. 2. Store at -20 or -70°C. Storage at the higher temperature is adequate, but a manual defrost freezer is recommended. The bags with the combs should be kept inside a tightly closed, plastic, storage box, with the bottom layered with water-soaked paper towels (see Note 3). Adult bees fragment easily after being frozen at -70°C. 3.2. DNA Isolation (40) 3.2.1. Isolation from Larvae or Pupae 1. For samples in ethanol, equilibrate m STM overnight at 4”C, with gentle agitation. Thereafter, the procedure is the same for frozen or alcohol-preserved samples 2 Homogenize each larva or pupa m STM at 4°C (0.5 ml/drone; 0.3 mL/ worker). Use a 2-mL glass tissue grmder with a teflon pestle or, prefer-
RFLP Analyses
3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14.
ably, a microfuge tube with a matching conical pestle. Use a stirrmg motor to turn the pestles at 100 rpm. Rinse the grinder with an equal volume of STM, add the rinse to the homogenate, and mix. Keep the samples on ice as much as possible. Centrifuge the homogenate at 6500 rpm for 5 min (microfuge) at 4°C. Discard the supernatant and resuspend the pellet in STE (0.5 ml/drone; 0.3 ml/worker, at room temperature). Add 20% SDS, 0.5M EDTA-pH 8.0 (each: 30 pL/drone; 15 pL/worker), and 20 mg/mL protease K (15 PLWdrone;7.5 pL/worker). Incubate the mixture at 60°C for 1 h followed by 42OC for 12-16 h. Centrifuge the suspension at 13,000 rpm for 10 min and transfer the supematant to 1.5~mL microtige tubes (each drone sample divided into two tubes). Add one-half volume of phenol and one-half volume of CIA (about 150 PL each) and mix for 15 mm on a tilted rotator, set at 60 rpm (see Note 4). Centrifuge at 13,000 rpm for 10 mm (microfuge) to separate the phases (see Note 5). Transfer the upper aqueous supematant to another tube and extract again with an equal volume of CIA. After centrifugation, collect the upper aqueous phase, and precipitate the DNA with 2 vol of 95% ethanol at -20°C overnight. Centrifuge the DNA at 13,000 rpm for 10 min, at 4”C, discard the ethanol supematant, and air-dry the pellet about 30 mm (see Note 6). Dissolve the DNA pellet in 60 PWtube of TE containing 100 pg/mL pancreatic RNase. The DNA can be dissolved gradually overnight at 4°C or for about 1 h at 60°C (see Note 7). Incubate the sample at 37°C for 30 min and store at 4°C (see Note 8). 3.2.2. Isolation
from Adult
Thoracic
Muscle
1. With a razor blade, cut the thorax in half (frozen or alcohol-preserved), remove the thoractc muscle, and suspend in cold STE (500 pL/drone; 250 pL/worker). Allow to equilibrate overnight at 4°C. 2. Homogenize the muscle as described for brood in Section 3.2.1.) step 2, but do not add extra solution used to rinse the pestle. Continue the procedure as described for brood, starting at step 5 (Section 3.2.1.), but dissolve the final ethanol-precipitated DNA in smaller volumes of TE (40 pL/drone; 20 pL/worker) (see Note 9). 3.2.3. Isolation
from Whole Adults
1. Mince an adult bee with a razor blade, and suspend the pieces in 2 mL of 25 mM citric acid (48), at 4’C, in a 15-mL polypropylene test tube.
346
Hall
2. Homogenize the bee further with a Tissumizer (48) wtth 5-6 15-s bursts, at number 7 thyrister setting, keeping the sample on ice (see Note 10). 3. Centrifuge the homogenate at 3500 rpm, and contmue the procedure as described for brood, starting at step 4 (Section 3.2.1.).
3.3. Restriction
Endonuclease
Digestions
(43) (see Note II) 1. Prepare the digestion mixture in bulk (formula in Materials section). Excluding the sample volume, combine a volume of each ingredient that is about 1.1 times the number of samples times the volume in the formula. Use a volume of enzyme solution containing 10 U/sample, and adjust the volume of HZ0 accordingly. 2. Add 80 pL of the bulk digestion mixture to each DNA sample (about 30 pg) in 20 pL of TE in separate tubes (see Note 12). 3. Incubate the reaction mixture at 37°C (seeNote 13) overnight (see Note 14) 4. Store the reaction mixture at 4°C. After the digestions are assessed by electrophoresis (Section 3.4.), add 5 pL of 0.5M EDTA (see Note 15).
3.4. Electrophoretic 1. 2. 3. 4. 5. 6.
7. 8.
Separations
(10,43,49)
3.4.1. Assessing Digestions on a Minigel Apparatus Select a small gel apparatus, with a tray for about a IO(w) x 8(l) x 0,7(d) cm gel (see Note 16). Prepare the tray for casting the gel, by taping the open ends and leveling (see Note 17). Prepare about 50 mL of a 1 or 2% agarose gel solution in 1X TAE gel running buffer (see Note 18). Dissolve the agarose by boiling, and allow the solutton to cool to about 50°C (see Notes 19 and 20). Pour the gel (see Note 21). Use a comb for 20 small wells, that each hold about 10 pL (see Note 22). After the agarose has thoroughly hardened, remove the tape and combs (seeNote 23). Keep the gel at room temperature. Place the tray holding the gel in the electrophoresis device, and add 1X TAE gel runnmg buffer to fill the reservoirs on each side and to cover the gel to a depth of about 5 mm. In a microfuge tube, mix 6 pL of each of the molecular size standards (bacteriophages lambda, digested with HindIII, and @Xl 74, digested with HaeIII) with 4 pL of GBBE. Deposit 8 l.tL of the mixture to each of the outer two lanes. In a microfuge tube, mix 5 uL of the digestion reaction with 2 pL of GBBE. Deposit these mixtures from each reaction mto separate gel wells. Run the DNA toward the cathode, at 60 mA constant current, for about 1.5-2 h, until the dye front has migrated 6 cm (see Note 24).
RFLP Analyses
347
9. After the electrophoresis run is complete, slide the gel from the tray into a plastic pan, approx 15 x 20 cm, with a snap-shut top. 10. Add about 200 mL of EtBr staining solution, cover and place the pan on a rotating or oscillating platform, set at about 30 rpm, for 20 min. 11. Pour out the staining solution, and rinse the gel with water (see note in Materials section regarding the handling and disposal of EtBr). 12. Destain the gel in about 200 mL of water for 20 min on the rotating platform. 13. Discard the wash, and rinse the gel again. 3.4.2. Photographing Stained Gels 1. Place the stained gel on a UV transilluminator (see Note 25). 2. Photograph the gel with a Polaroid camera usmg a UV filter. Use either a hand-held camera (Fisher Bioteck Photo-documentation) with high speed type 667 pack film, or a copy-stand camera with type 667 pack film, high speed type 57 sheet film (about f 5.6 for 0.5-l s exposure), or positive/ negative type 55 sheetfilm (about f 4.5 for 15-30 s exposure) (see Note 26). 3. Evaluate the images (see Note 27). 3.4.3. Electrophoresis of the Samples on a Maxigel 1. Select a large gel apparatus, with a tray for about a 18.5(w) x 20(l) x 0.8(d) cm gel (see Note 16) and with a separate cooling reservoir located below the tray position. Run cold antifreeze solution through this reservoir from a refrigerated circulating water bath set at 4°C. It is recommended that the electrophoresis also be done m a cold room or, preferably, a glass door refrigerator or chromatography chamber. In the latter, the electrical leads and the coolmg hoses are run through a porthole to the power supply and water bath, respectively, outside the refrigerator (see Note 28). 2. Prepare the tray for casting the gel, by taping the open ends and leveling (see Note 17). 3. Prepare about 350 mL of a 1 or 2% agarose gel solution in 1X TAE gel running buffer (see Note 18). Dissolve the agarose by boiling, and allow the solution to cool to about 50°C (see Notes 19 and 20). 4. Pour the gel (see Note 2 1). Use a comb for 20 large wells, 3-mm thick, that each hold about 110 PL (see Note 22). After the agarose has thoroughly hardened, remove the tape, and combs (see Note 23), and place the gel in a refrigerator for 1 h or more before loading the samples. 5. Place the tray holding the gel in the electrophoresis device, and add 1X TAE running buffer, 4”C, to fill the reservoirs on each side and to cover the gel to a depth of about 1 cm (see Note 29). 6. In each of the two outside wells, add 100 pL of molecular size standards (digested bacteriophages lambda and @X174) prepared for maxigels (in Materials section).
Hall 7. To the remammg volume of each digestion reaction, add 15 pL of GBBE, mix, and add the entire amount to separate gel wells. 8. Allow the gel to run at 90 mA constant current, approx 100 V at the start (see Note 29), for about 14 h, until the dye front migrates 16 cm toward the cathode. 3.5. BZotting 3.5.1.
Preparation
(10,43,49)
of the Blotting
Apparatus
1. Prepare the blotting apparatus prior to electrophorests of the DNA samples. 2. Select a large plastic pan, about 28 x 40 cm and approx 10 cm deep, preferably with a cover for when not m use. 3. Set up a glass plate platform, about 25 x 25 cm, on plastic blocks, approx 6 cm from the bottom of the pan. 4. Drape and center a piece of BR filter paper, 25 x 40 cm, over the glass platform, so that the longer edges hang over the opposite sides, down to the bottom of the pan. This paper serves as a wick during the blotting. In lieu of a glass platform, a flat capillary blotting stone,about 25 x 25 x 2.5 cm, can be used. This stone eliminates the need for a wick and allows for a more even transfer of liquid across the face of the gel (see Note 30). 5. Place another piece of BR filter paper, 25 x 25 cm, on top of the wick, centered over the platform or stone. 6. Place a sheet of polypropylene, about 45 x 60 cm, wrth a 20 x 20-cm square hole cut in the center, over the entire apparatus (without the lid). This sheet serves as a mask to prevent accidental contact of the blotting solution with the paper towels to be added later. The edges of this sheet are clamped onto the side of the large plastic pan. Trimmmg, cutting out squares from the corners, and so on, are necessary to get this sheet to tit properly, so that the edges of the square hole lay flat against the filter paper. Cut openings m this sheet between the platform (or stone) and the edge of the pan so that blotting solution can dram and be added. 7. Add blotting solution to a level lust under the platform. 8. The prepared blotting apparatus, if kept covered, can be used for 4-6 mo. 9. In preparation for later steps,unfold and stack mdustrtal type paper towels. Cut extra squares of both BR and 3MM filter paper of both sizes,22 x 22 cm and 20 x 20 cm. 3.5.2.
Blotting
the Gel
1. After electrophoresis, cut from the gel the wells, the bottom edge (see Note 3 l), and a small part of the lower left-hand corner to keep track of the gel’s orientatron.
RFLP Analyses 2. Slide the gel from the tray into a 22 x 22 x 7-cm plastic pan (see Note 32). 3. Denature the DNA m the gel by soaking the gel m about 200 mL of blotting solution (enough to cover the gel) on a rotating platform, set at about 30 rpm, for about 30 min. 4. Prepare a 20 x 20-cm piece of GSP membrane (handle with gloves). Cut off a small piece of one corner to keep track of the membrane orientation, whtch then becomes the lower left hand corner, and cut notches along the bottom edge to identify the blot (see Note 33). 5. Soak the membrane m a pan containing blotting solution. Wet one side of the membrane m advance of the other to allow the solutton to fill the membrane pores (lay the face of the membrane on top of the surface of the solution, before mnnersmg the membrane). If both sides are wet simultaneously, air may become trapped within the membrane. 6. Soak a 22 x 22-cm piece of BR filter paper m blotting solution and place it on the blotting apparatus, so that it is centered over the square hole m the plastic sheet, with the edges overlapping the edges of the plastic. 7. Soak a 22 x 22-cm piece of 3MM filter paper in blotting solutton, and position it on top of the BR filter. The 3MM paper tends to pucker and tear easily when wet. 8. Place the gel upside down and centered on the 3MM paper, taking care not to trap air bubbles m between (see Note 34). 9. Place four strips of polypropylene sheets, about 25 x 3 cm, around the edge of the gel, on top of the filter paper that 1sstill exposed. These strips prevent accidental contact with the paper towels to be added later, which would allow the blotting solution to bypass the gel, 10. Turn the soaked GSP membrane upside down and place on top of the gel, oriented so that the cut corner corresponds to the cut corner of the gel and the edge with the identifying notches is positioned along the lower edge of the gel (still marked by the bromophenol blue tracking dye). Here, even greater care must be taken not to trap air bubbles (see Note 35). 11. Place a 20 x 20-cm piece of 3MM paper, soaked in transfer solution, on top of the membrane, followed by a 20 x 20-cm piece of BR paper. Add about a 3-cm stack of unfolded paper towels on top, followed by a thick 25 x 25-cm glass plate, and then about 4 kg of weight (see Note 36). 12. Remove and discard paper towels that have become wet, and add new towels three times every 2-3 h and once again after about 6-8 h, for a total of 18-20 h (see Note 37). A larger stack of towels 1sadded for the longer periods. When the towels are changed, add blotting solution as needed to the blotting apparatus reservon. After the blotting is complete, discard the towels and 3MM filter papers (the BR papers can be reused a few times).
350
Hall
13. Place the blot (the membrane with the transferred DNA) in a pan with 100 mL of neutrahzing solution for 5-l 0 mm. 14. Place the blot on a dry paper towel to absorb excess solution, then transfer the blot to another dry towel, and allow the blot to dry for 24 h (see Note 38). 15. On the dried blot, the lanes of DNA appear as dark streaks when viewed m the darkroom with a hand-held, short wavelength, UV lamp.
1. 2.
3. 4. 5. 6.
1. 2. 3. 4.
3.6. Nick Translation (43,50) 3.6.1. Nick Translation Reaction Before labeling the probe DNA, pretreat the blot with hybridization solution as described in Section 3.7.1. For each blot, set up a 5OqL nick translation reaction m a OS-mL microfuge tube, according to the formula given m the Materials section. Add the components in the same order. For each reaction, 3-5 pg of probe DNA (plasmid DNA carrying the insert) is labeled. Add 50 $1 of [32P]dCTP per reaction. Increase the volume as necessary to compensate for radioactive decay (half-life = 14.3 d), to a maximum of 10 pL, with a corresponding decrease in the amount of H20. Chill the reaction mixture on ice before adding the DNA Pol I/DNase I. Note the comments in the Materials section regarding radioisotope use. Cap and place the tube m a water bath, set at 16°C for 50 min. Add 2 PL of diluted bacteriophage marker DNA (lambda and @X 174) to the reaction. After an additional 10 min, stop the reaction by adding 5 pL of 0.5M EDTA, pH 8.0. Add 50 pL of column tracking dye solution, and put the reaction tube on ice. 3.6.2. Column Separation of Labeled Probe DNA from Unincorporated Nucleotides In advance of the nick translation reaction (Section 3.6.1.), prepare 5 mL disposable pipets to be used as columns (see Note 39). While the nick translation reaction is in progress, set up the pipet as a column (see Note 40). Degas the Sephadex G-50 suspension (see Note 41) and fill the pipet column to about 4 cm from the top (see Note 42). After the nick translation reaction 1s complete, add the nick translation reaction/column tracking dye mixture to the column, and elute with TE at a flow rate of one drop, or less, per second (see Note 43). As the blue and red dyes separate, monitor with a Geiger counter the levels of radtoactivity in each peak. The radioactivity in the leading peak of labeled probe DNA, coinciding with the blue dye, should be at least l/3 to l/2 that in the trailing peak of unincorporated nucleotide.
RFLP Analyses 5. When the blue dye comes to within about 2 cm of the tip of the column, begin to collect the eluate in a separate tube. Monitor the flow also with the Geiger counter. Collect until all the blue dye, marking the first radioactive peak, elutes from the column, about 1 mL. Transfer the labeled DNA fraction to a capped microfuge tube. Put the tube on ice or store in the refrigerator at 4OC. Because radioactive decay breaks the DNA molecule, rt is best that the labeled probe be used for hybridizations within a few hours. If the probe is to be used after a longer time, store at -2OOC. 6. Remove the screw-clamp from the bottom of the column, and allow the column to drain dry into another tube. Discard the solution that has eluted and the entire column into radioactive waste. 7. Just before the hybridizations (Sections 3.7.2. and 3.7.3.), denature the radioactive probe DNA. Put the capped microfuge tube contaming the probe in a beaker rack, with a screw-down lid, and put the rack into a beaker of boiling water (level about 3/4 up the side of the tube and containing some boiling chips) for 5 min. Put the tube with the probe on ice. The salmon sperm DNA used in the hybridization solution (Sections 3.7.2. and 3.7.3.) can be denatured at the same time as the probe.
3.7. Prehybridizations,
Hybridizations, and Washes (10,43,49) 3.7.1. Pretreatment of the Blots
1. The dried blots are pretreated to block nonspecific binding of the probe to the membrane. 2. In a plastic pan, add the blot to 100 mL of freshly prepared hybridization solution, so that one side becomes wet in advance of the other side, to avoid trapping air within the membrane. 3. Cover the pan tightly, and place it in an incubator shaker set at about 50 rpm, heated at 68°C for 12 h (see Note 44). 4. Alternatively, if a heat-sealed bag is to be used for the hybridization step (Section 3.7.2.), soak the blot in hybridization solution, then seal the blot and the hybridization solution in a bag (see Note 45). With a bag, both the pretreatment and hybridization can be done m a shaking hot water bath rather than an Incubator shaker. 5. As a third alternative, if a specialized hybridization oven with plastic canisters is to be used for the hybridization step (Section 3.7.3.) (see Note 46), add the hybridization solution to a canister. Place the soaked blot so that it wraps around and adheres to the inside surface of the canister, with the face onto which the DNA was blotted away from the canister surface. Keep air bubbles from being trapped in between (see Note 47). Close the
Hall
352
canister, and place it horizontally m the hybridization oven. Set the rotation speed at 4-10 rpm and the temperature at 68°C (see Note 48). 3.7.2. Hybridization
in Bags
1. If the blots had been pretreated m a plastic pan, transfer it to a bag (see Note 45). If pretreated m a bag, cut open the seal at the outer edge of the chimney, made when sealmg the bag, and pour and squeezeout the hybrtdization solution used in the pretreatment. 2 Prepare 20 mL of hybridization solutton for each blot. After the hybridization solution cools to 68°C add the denatured probe solution and mix 3. With a disposable pipet, add the hybridizatton/probe solution through the chimney of the bag with the blot. Remove the air bubbles, and seal the chimney closed (see Note 49). 4. Trim the edges of the bags outside the seals (mcludmg Just inside the perforations of the bag manufacturer’s seal) and rmse the outside of the bag with water, starting around the chimney. 5. Tape the bag, containing the blot and hybridization solutron, tightly to a larger thick plate of glass, about 25 x 25 cm, tape until the bag is stretched taut at the comers and the sides. Tape plastic strips at two opposite edges to allow plates with attached bags to be stacked. Stacked plates need to be taped together tightly on both stdes of all four corners to prevent the stack from coming apart. 6. Allow the blots to hybridize in an incubator shaker, at 120 r-pm, or m a shaking water bath heated to 68°C for 16-20 h. 7. After hybrtdtzattons, cut off one corner of the bag containing the blot, and pour out the radioactive solution into radtoactive waste. 8. Cut open the bag and quickly transfer the blot to a plastic pan containing about 100 mL of wash solutton A (see Note 50). 1. 2.
3. 4.
3.7.3. Hybridizations in Canisters If the blot had been pretreated in a pan, transfer it to a canister (see Note 47). If pretreated m a camster, pour out the hybrtdtzatton solution used m the pretreatment Prepare 20 mL of hybridization solutton for each blot. After the solution has cooled to 68OC, add it to the canister. Pipet the denatured radioactive probe solution mto the center of the hybridtzatton solution at the bottom of the canister, and quickly mix the two solutions by gentle swirling. Close the canister, and place it hortzontally m the hybrtdization oven (see Note 48). Set the rotation speed at 4-10 rpm and the temperature at 68°C. Allow the blots to hybridize for 16-20 h.
RFLP Analyses
353
5. At the end of the hybridization period, open the canisters and pour the radioactive solution into radioactive waste. 6. Add about 50 mL of wash solution A to the canister, close, and then rotate the canister horizontally by hand to wash the entire surface of the blot, Discard the wash solution mto radioactive waste, and repeat the process. 7. With two forceps at the upper corners, pry the blot from the canister surface, fold it into a roll, and remove it from the canister. Place the blot in a pan with about 100 mL of wash solution A.
3.7.4. Washes 1. Discard the wash solution in which the blots were first placed, and add 200 mL of wash solution A. Cover the pan and place on a rotating platform set at about 80 rpm, at room temperature, for 30 min. 2. Discard the wash solution A, and add 300 mL of wash solution B, preheated to 68°C. Wash the blot in an incubator shaker, set at about 80 rpm, heated to 68”C, for 3 h. 3. Repeat the wash, with 300 mL of fresh, preheated, solutton B, for about 1 h 4. Rinse the blot m 100 mL of wash solution B.
3.8. X-Ray Film
Exposures
1. Seal the blots within bags, removing as much of the wash solution as possible (see Note 5 1). 2. Trim as close as possible excessbag material outside the heat seals. Wash the surface of the bags and the edges beyond the seals with water, and dry the bags thoroughly. 3. Write the blot number, the probe, and date of hybridization at the top of the bag. Make marks to indicate the lower left corner and to coincide with the notches on the blot. These marks help identify the blot and its code in the darkroom. 4. Place the bag with the blot in a film cassette,35 x 43 cm, with intensifying screens. Two bags can fit side by side with slight overlappmg (depending on how close they are sealed and trimmed). With a short length of green or black labeling tape, stick the top of each of the two bags to the lower intensifying screen (see Note 52). 5. Continue the followmg steps in the darkroom (see Note 53). 6. Use two sheets of 8 x 10 m X-ray film for each blot. Cut off the lower left corners (one of the short sidesas the bottom), and cut notches mto the bottom edges correspondmg to the identifying notches on the blot (see Note 54). 7. Insert and position one sheet of film under the bag, in the same orientation as the blot, with the top of the film pushed up against the tape holding the bag. Tape all four corners of the film to the screen.
8. Smooth the bag over the film and tape all four comers to the film and/or screen. 9. Position the other sheet of film over the bag, in the same orientation as the blot, and attach to the lower screen by one piece of tape at the top. 10. Close the cassette. 11. Place label tape identifying the blot on the outside of the cassettelid, over each blot (see Note 55), and a label identifying both blots along one of the short edges of the cassette,so that it can be seen at the top when cassettes are stacked on edge in the freezer. 12. Expose the film to the blot 1-4 d at -70°C (see Note 56). 13. Allow the cassettesto warm to room temperature, and wipe off any condensation. 14. Open the cassette,remove the top film carefully without detaching the bag and underlying film, and close the cassette. 15. Develop the upper film, followmg standard procedures: 2 min in developer, 30 s in stop solution, 5-10 min in fixer, wash in Hz0 for 2&30 min (see Note 57). 16. Decide whether to develop the lower film or to add another top film (see Note 58).
3.9. Stripping (Amersham Technical
Note)
1. Strip the radioactive probe from the blot by washing it in 300 mL of alkaline stripping solution, in an incubator shaker set at 80 rpm, heated to 45OC, for 20 min. 2. Discard the stripping solution and rmse the blot m 50 mL of neutralizing solution. 3. Discard the rmse, and wash the blot in 100 mL of neutralizing solution in an incubator shaker set at 80 rpm, heated to 45OC,for 30 mm. 4. Wash the blot in 100 mL of wash solution B for 10 min. 5. Seal the blot wet, with approx 6 mL of wash solution B, in a plastic bag (see Note 51) and store at -2OOC. 5. If the blots are to be used within 2 wk, they may be placed in a film cassette for 2 d with a small square of test film to check the effectiveness of probe removal (see Note 59).
4. Notes 1. DNA can be Isolated from all life stages of the honey bee, but larvae and pupae are preferred for most applications. Adults can drift among hives, whereas the colony orlgm of brood is certain (barring comb exchange by beekeepers). Soft larval and pupal tissue facilitates DNA isolation. However, to obtain brood, the hive must be opened, and it is not always avail-
RFLP Analyses able, for example, during winter months, in periods of dearth, or from swarms in transit. Drone (male) brood tends to be present only during periods of food abundance. Drones are haploid, parthenogenetic progeny of the queen and are particularly valuable in deciphering complex DNA patterns, determining the allelic relationships of restriction fragments, and establishing the queen’s genotype. Worker (nonfertile females) are progeny of the queen mated to a dozen or more drones from distant colonies. Drones from one colony essentially represent only one genotype, that of the queen, whereas workers represent a broader samphng of the population. Worker and drone brood samples are collected from the smaller “worker” and larger “drone” size cells in which they are reared. Larvae and pupae come from uncapped and capped cells, respectively. With pupae, the sex can be determined by more apparent morphologrcal features. 2. After proper alcohol preservation, the larvae are contracted and hardened and appear chalk-like. 3. It is difficult to remove a few larvae and pupae frozen in the comb without some thawing of all the brood. Therefore, small sections of comb can be broken off and thawed. 4. For the extraction of many samples, the microfuge tubes are placed in water bath racks with screw-down lids. For the rotator, a flat alummum disk, about 25 cm in diameter, can be constructed by a shop, as a substitute for the smaller one from the manufacturer. The rotator is tilted at about a 45” angle. Two racks with tubes are positioned across from each other, with their sides against the disk. Large rubber bands hold the racks m place. 5. Centrifugation speeds are high and times are long to remove translucent particles containing a-amylase-sensitive material (presumably glycogen), more abundant in larvae. 6. Air circulation in a fume hood facilitates drying. The pellets are dry when they appear translucent rather than white. 7. Sufficient DNA can be obtained from a single drone pupa for six to eight separate restriction endonuclease digests (approx 200 ug) and from a single worker larva for three to four digests (approx 100 ug). 8. Freezing causesshearing of genomic DNA and is not recommended. 9. DNA isolated from thoracic muscle is enriched for mitochondrial DNA. The total amount of nuclear DNA obtained from a worker thorax is estimated to be 15-20 ug, approx 20% that obtained from a larva or pupa. This DNA is sufficient for one digestion reaction with a restriction enzyme (Section 3.3.). With more DNA obtainable from individual brood, more is used for each digest (see Note 12). Using only the thoracic muscle eliminates the difficulty of homogenizing adult cuticle (Section 3.2.3.; see Note 10) and facihtates isolations from many samples.
10. One problem using the Tissumizer is that pieces of the sample enter the bore of the shaft and become trapped around the spacers inside. To avoid contammation, the shaft must be disassembled and cleaned between each sample. 11. Restriction endonucleases that recognize sites with the fewest nucleotides cut DNA more frequently and, thus, are more likely to reveal polymorphisms. For our research, rune enzymes are routmely used that recognize four and five base sites: MspI, S&961, AM, HueIII, HhaI, NciI, MboI, Hz&I, and DdeI. These enzymes were selected also because they are some of the least expensive. In screening for polymorphisms, aliquots from two DNA samples, one from an African colony and the other from a European colony, each representmg pooled worker siblings, are digested separately with the nme enzymes. With the two samples and nine enzymes, the 18
12.
13. 14.
15. 16. 17.
digests can be convemently separated by electrophoresis on a standard 20-well agarose gel, with molecular size standards on each side. Later, more DNA samples are digested with the enzyme that reveals a polymorphism in the initial screening. The amount of DNA, 30 pg, is about three times that suggested for standard reactions. The larger amount of DNA results m intense signals from bands of fragments hybridized to the probe and enhances viewing of small fragments. This amount of DNA can result m partial digestions, although seldom has it been a problem under the conditions described here. For most of the enzymesavailable, including those listed earlier, the optimal digestion temperature is 37°C but some other enzymeshave different opttma. Because of the large amount of DNA to be digested m each reaction mixture, digestions are routmely allowed to run overnight. However, many enzymes lose their activity rapidly, some withm an hour or two. Some manufacturers’ catalogs provide a table with the activity loss over time. If necessary, additional aliquots of enzyme can be added every few hours to ensure complete dtgestion, but later additions are usually not necessary for the enzymes listed in Note 11. Before stopping the reaction, assessthe digestion by electrophoresis to determine that it does not require additional enzyme and time. In the meantime, the reactions are kept at 4°C. A horizontal agarose gel electrophorests device is selected of an appropriate size, depending on the number of samples, the volume of the samples, and the extent to which the fragments need to be separated. Typically, the flat, plastic, gel tray has two elevated, plastic sides. Close the other two open sides temporarily, using black, plastic, electrical tape. Place the tray on a counter and level with paper or thm cardboard shims as necessary, or use a leveling table.
RFLP Analyses 18. In separating fragments generated by four or six base enzymes, use 2 or 1% agarose, respectively. In an Erlenmeyer flask with twice the gel volume capacity, mix either 1 or 2 g of agarose/lOO mL of 1X TAE gel running buffer. 19. Heat the agarose suspension for several min until boiling in a microwave oven, or for more time on a hot plate. During heatmg, the flask should be removed several times from the oven and swirled to suspend the agarose particles. In handling the agarose solution, thermal gloves should be worn and caution exercised, particularly at high agarose concentrations. Severe burns can result from unexpected bouncing of the solution. 20. Allow the solution to cool slowly at room temperature but with regular swirling to prevent hardening of the agarose on the sides of the flask. With an Erlenmeyer flask covered with alummum foil, rather than a beaker, enough heat is retained above the solution to keep a film from hardening at the surface. Cooling of the solution is necessary to reduce heat warping of the gel tray. Cooling can be accelerated in an ice water bath, but constant rapid swirling is necessary. At 50°C, the bottom of the flask is just cool enough so that it can be held comfortably in a bare hand. 2 1. Quickly pour the agarose solution into the gel tray. If swirling has introduced bubbles, these can be removed by drawing the edge of a tissue paper across the surface of the gel, pulling a small amount of agarose solution along with the bubbles over the taped edge (may need to be repeated). 22. To form wells for the samples, suspend the teflon or polystyrene comb from the plastic sides of the tray (usually placed in a notch) parallel and approx 1 cm from one of the taped open ends. The teeth that form the wells point down toward the tray surface into the agarose solution. In some devices, the height of the teeth over the tray is adjustable. About a l-mm clearance is recommended for large gels. 23. To facilitate removal of the comb, a finger rubbed on the surface of the gel, alongside the row of teeth, as tension is placed on the comb to pull it up, will help break the vacuum. 24. The gel can be run either at constant current or constant voltage. 25. UV protective goggles must be worn. If the gel is to be examined for more than l&15 s, full face UV shields are recommended, 26. The hand-held camera comes with different size hoods that have the UV filter attached, as well as an adjusting lens that keeps the gel m focus when the edge of the hood is in contact with the transilluminator surface around the gel. The room is darkened, but complete darkness is not necessary. This camera is economical for routine documentation of stamed gels, but photographs taken with this camera and type 667 film are not of high quality. Photographs taken with a copy stand camera and type 57 or type 55
27.
28. 29.
30. 31.
32.
film are of better quality. Type 55 film is used when a negative is needed. The negatives are cleaned in an 18% sodium sulfite solution according to the manufacturer’s instructions. After digestion, electrophoretic separation, and staining, the genomic DNA will appear as a fluorescent smear. The minigel only provides an mdicanon that the restriction enzyme digests are successful but cannot reveal if the digestions are complete. The different enzymes, tendmg to cut more or less frequently, will result m the smear displaced toward the bottom or top of the gel, respectively. DNA that has failed to be digested will remain as a concentrated band that has migrated a short distance from the well (wtth some trailing owing to nonspecific degradation). If samples have not been adequately digested, the digestion can be repeated by adding another aliquot of enzyme, perhaps from a different stock. Some enzymes will cut the genomic DNA so that repetitive sequencesare reduced to the same length. Within the fluorescent smear are faint, or sometimes even prominent, indications of discrete bands. A good indicator of complete digestion by these enzymes is if such banding can be discerned. Because of the thickness of the gel and the volume of the samples, the steps to provide cooling help reduce distortion caused by heat generated during the run. Before loading the samples into the gel, the initial running voltage is adjusted to help ensure consistency in the timing of the run. The electrical leads are connected to the apparatus from the power supply that is set at 90 mA constant current. Buffer is then added or removed as necessary to raise or lower the voltage, respectively, to 100 V To avoid electrocution, it is recommended that the power supply be turned off and leads disconnected when the buffer changes are made. The voltage will change somewhat after loading the samples and wtll decrease over the period of the run. If a blotting stone is used, also keep a filter paper wick across it just in case, during the blotting, the blotting solution falls below the bottom of the stone. Before removing the gel from the tray, first slide the gel so that 0.5 cm of the bottom of the gel protrudes past the tray and trim it off with a razor blade. Then slide the gel in the other direction so that the wells protrude just past the tray, and trim off this part. This trimming removes the hardened elevated ridges formed from the memscus of the gel solution. These ridges can interfere with flat gel contact to the lower filter paper used m the blottmg process. Trim off any small spurs at the bottom of plastic pans, sometimes left after manufacturing, that can cut the gel. Tupperware brand pans, 22 x 22 x 7 cm, are recommended. These can be purchased through local representatives, usually without the obligation of a Tupperware party.
359
RFLP Analyses HEAT SEAL #4 (for pre-treatment) HEAT SEAL #5 (for hybridization)
HEAT SEAL #3
HEAT SEAL #I
HEAT SEAL #2
SIDE NOTCH CUT CORNER
BO-iTOM CODE NOTCHES
Fig. 1. Diagram of a blot placed in a plastic Seal-a-Meal bag. The heat seals are shown’that are made to enclosethe blot for pretreatment and hybridization with the radioactive probe, as described in the text. 33. Across the bottom of the membrane,a series of notches are cut, 0 to 5, in each of three regions, the right, the center, and the left, to provide a unique code (215 blots starting with one notch) that identifies the blot. Special cutters made to notch the ears of livestock are recommended.To code for additional blots, an extra deepnotch for eachgroup of 2 15 is put on the left side, near the bottom (Fig. 1). 34. To invert the gel and place it on the blotting apparatus,first pour off the blotting solution used for equilibration, and place a 20 x 20-cm glassplate on top of the gel. While holding the plate against the gel, invert the pan, gel, and plate together over a sink, and carefully lift off the pan, with the gel remaining upside down on the plate. On the upper filter paper positioned in the blotting apparatus,pour blotting solution to form a standing puddle, just before placing on the gel. With the plate held centeredjust over the filter paper and angled slightly downward, slide one edge of the gel just past the edge of the plate, and position it in contact with the paper, parallel, centered,and about 1 cm inside an edge of the filter paper. Continue to slide the gel off the glassplate onto the filter paper, while simulta-
360
35.
36. 37. 38.
39. 40.
41.
Hall neously wtthdrawmg the plate. With the standing puddle of blotting solution, a meniscus fills between the filter and the gel, and air bubbles tend to follow the edge of the plate as it is withdrawn, but care must be taken not to trap air bubbles in between. Pouring some blotting solution at the gel edge at the top of the plate provides a source of liquid that flows alongside and under the gel as it is removed from the plate.. Hopefully, the gel will end up reasonably well-centered over the filter paper. The gel cannot be repositioned while on the paper-it needs to be slid back onto the glass plate, and the process repeated. To keep bubbles out from between the gel and the membrane, pour a standmg puddle of blotting solution onto the gel. Hold the membrane from two edges, and slowly bring the hanging center in contact with the center axis of the gel, and gradually lower the rest of the membrane onto the gel, with the region of contact spreading from the center to the edges. With sufticient light, one can see slightly through the membrane to make sure that no bubbles are being trapped, as it is being lowered onto the gel. By simply allowing the membrane to drop too fast, bubbles will be formed. After the membrane is on the gel, it can be repositioned slightly. A l-gal jug of water is a convenient weight. Most of the DNA is transferred within a few hours, so the time of this step can be shortened if desired. Drying can be hastened m a drying oven, with temperatures from 40-80°C. With GSP membranes, a vacuum drying oven IS not necessary as with mtrocellulose membranes. UV crosslmking of the DNA to the membrane is not necessary as with some other nylon-based membranes. In 5-mL disposable glass pipets (about 30 cm long), insert a small wad of polyester fiber (aquarium filter floss) into the pipet from the top end and push it down to the tapered end. Autoclave the column. Push a 2-cm piece of narrow tygon tubing onto the point of the pipet column. Loosely attach a screw-clamp in the middle of the tubing. Mount the pipet vertically with two clamps onto the rod of a rectangular support stand. Set the height of the column so that there is approx l-cm clearance from the bottom of the tubing to the top of disposable tubes in a test tube rack. Add approx 2 mL of TE into the open top of the pipet. As the TE passes through the polyester plug and fills the tubing, clamp the tubing closed Add TE to about the 1-mL mark on the pipet. Resuspend the settled, hydrated, Sephadex G-50 beads (m about an equal volume of extra TE) and pour about 20 mL in a lOO-mL side arm vacuum flask. Add an additional 20 mL of TE. Plug the top of the flask with a rubber stopper, connect the flask to an aspirator vacuum line (with a larger flask as a trap in between), and allow the suspension to come to room
RFLP Analyses
42.
43,
44. 45.
temperature under vacuum. Periodically, knock the bottom of the flask sharply on the bench top to release dissolved gas. While swirling the flask to keep the Sephadex particles suspended, draw out and fill the pipet column with the Sephadex slurry. Pipet out the slurry so that it flows down one side of the column, without trapping pockets of air. Turn the screw-clamp at the bottom of the pipet column so that the TE flows out about one drop per second (need to open further as the column becomes filled). As the level of slurry drops every 1 mL, till with additional slurry. As the packed bed of the column comes to wrthin about 6 cm of the top of the column, begin to add TE instead of slurry. After all the Sephadex parttcles have settled, allow the TE to dram to about 0.5 cm above the top of the bed, and clamp off the bottom of the column. Drain the TE in the column down to the level of the packed bed, and clamp the column closed. Add the nick translatron reaction/column tracking dye mixture, open the column, and allow the mixture to dram down to the level of the bed. Rinse out the reaction tube with 50 PL of TE, add the rinse to the top of the bed, and allow it to drain into the bed. Rinse the inside of the column near the bed with about 0.2 mL of TE and allow the wash to drain into the bed. Fill the column with TE. As the reaction mixture is being eluted, add TE to the top of the column as the level drops. Do not allow the level to drop below the bed. At too hrgh a rotation speed, the blot can ride up the side of the pan and can become stuck outstde of the solution. Seal-a-meal bags are cut as sections from a 1O-m. wide roll that is already sealed closed wrth perforated margins at both sides. Cut a section approx 28 cm wade (about 6 cm wider than the blot). Roll the blot from top to bottom, and insert rt into the bag. Line up the bottom of the blot with, and closely apposed to, one of the presealed margins of the bag, about 2 cm from one of the cut edges. Unroll the blot inside the plastic bag. Lay the bag with the blot flat on a bench with a lab bench paper cushion, Run a smooth, straight-edged, metal bar, about the size of a ruler, across the surface of the bag, squeezing it as flat as possible. The blots will have been positioned off-center in the bags (Fig. 1). Along the side closest to the blot, heat-seal the bag approx 1 cm from the blot (heat seal #l, Fig. 1). Seal the remaining open side, with the extra width of bag material, approx 1 cm from the blot but with an opening, approx I cm wide, left at one end (heat seal #2, Frg. I). Starting from the end point of this seal, make another perpendicular short seal extendmg to the edge of the bag (heat seal #3, Fig. 1). An open chrmney is thus formed that facilitates addition of hybrrdization solution and the removal of air bubbles. After adding hybridization solutton for the pretreatment, seal the chimney closed, near the open end
Hall
46.
47.
48.
49.
50.
5 1.
(heat seal #4, Fig. 1). When removing the solution used m the pretreatment, cut off the seal leaving most of the chimney, pour out the solution, and squeeze out as much as possible with the metal bar. Hybridization in canisters is particularly effective. As the canister ISturned, the solution washes over the blot, allowing uniform distribution of a small volume without trapping air bubbles. Large canisters are about 7.5 cm in diameter x 22 cm long. For smaller canisters, the volume for hybridrzations can be reduced to less than the 20 mL suggested here. The canisters also provide shielding from radioactivity and facilitate removal of the radroactive probe solution. Trapping air bubbles can avoided by tilting the canister so that hybridization solution is under the blot as it IS unrolled against the sides of the canmster. Only large bubbles are of concern that can cause the membrane to rise above the hybridization solutton. Preferably, only one blot is placed m a canister, although several can be laid on top of each other. Hybridization ovens have different designs. Some use a Ferris wheel device to turn the canisters, where an odd number of canisters sometrmes requires use of an empty one for balance. In other hybridization ovens, each canister turns on it own axis. Place the bag on a bench so that the corner with the chimney is elevated slightly. By rubbing the metal bar across the bag, work the an bubbles toward and through the chimney. Blot any radioactive liquid that escapes. After the air bubbles have been worked through the chimney, pinch the end closed, and heat-seal the base (heat seal #5, Fig. 1). The blots are removed from the bags by cutting off the seals on three sides with a razor blade and folding back the top side of the bag. Pinnmg or anchoring the bottom corners helps prevent the sides of the bag from suddenly curling over the blot and flinging drops of radioactive solution. During this time it is important to work quickly. The blot can dry quickly, resulting in irreversible nonspecific binding of the probe. Blots that have been hybridized are kept wet in bags during film exposure, so that the probe can be removed later, and the blot reused with another probe. Bags used for exposures, and for storage of blots later, are cut 26 cm wide. Place blots in the bag as described for hybrtdizatrons (see Note 45) but centered within the bag. Seal both open ends of the bag a few millimeters from the edge of the blot. Place the bags flat on the bench. Punch a pinhole in one of the far corners of the bag. Starting from the opposite comer, across the surface of the bag, use the metal bar to squeeze as much remaining liquid and air through the small hole. Then, seal off the comer of the bag with the hole.
RFLP Analyses 52. Green or black tape is recommendedbecauseit can best be seenunderthe
safelight to work with andto avoid being left accidently stuck to the screen 53. 54. 55. 56. 57. 58.
59.
later. To facilitate work in the dark, cut in advance nine pieces of tape, about 2 cm long, per blot. When preparing the blots for exposure in the darkroom, safelights can be used. However, they do slowly expose X-ray film, and, so, it is important to work with the film quickly and to keep it covered whenever possible. Cut the notches over a pan to prevent small film pieces, unnoticed in the dark, ending up between the blot and film. For labels on the outside of the cassette,use any color tape except green, so that the markings can be seen in the dark. The exposure time is chosen somewhat by trial and error and will depend on the amount of DNA on the blot and the effectiveness of probe labeling, i.e., the amount and specific activity. Developing can be done in flat trays, but vertical stainless steel tanks and 8 x 10 in film holders are recommended. The intensity of the exposure will determine whether the lower film should be developed or returned to the freezer for a longer exposure (if necessary, the film can be exposed effectively for up to 1mo) or if another film should be added to the top for a shorter exposure. If a radioactive probe cannot be removed completely, it may be necessary to store the blot and wait for the radioactivity to decay, before using the blot with another probe.
Acknowledgments The author thanks Margaret McMichael and Raquel McTieman for their help with the manuscript. The author’s research is supported by the United States Department of Agriculture, National Research Initiative Competitive Grants Program. This is Florida Experiment Station Journal Series No. R-04577. References 1. Meselson,M. and Yuan, R. (1968) DNA restriction enzymefrom E. colz Nature 217,1110-1114.
2. Roberts,R. J. andMacelis,D. (1992) Restrictionenzymesandtheir isoschizomers. Nucleic Acids Res 20,2 167-2 180.
3. Kan, Y. W. and Dozy, A. M. (1978) Polymorphismof DNA sequenceadjacentto humanl3-globm structuralgene: relationship to sicklemutation.Proc. Natl. Acad Sci. USA 75,563 l-5635.
4. Wyman, A. R. andWhite, R. (1980) A highly polymorphic locusin human DNA. Proc. Nat1 Acad. SCL USA 77,6754-6758.
5. Bell, G I., Selby, M. J., and Rutter, W. J (1982) The highly polymorphic region near the human msulm gene 1scomposed of simple tandemly repeating sequences. Nature 295,3 l-35 6. Goodbourn, S E. Y., Higgs, D. R., Clegg, J. B., and Weatherall, D. J. (1983) Molecular basis of length polymorphism in the human <-globin gene complex. Proc Nat1 Acad Sci USA 80,5022-5026 7 Dowsett, A P. (1983) Closely related species of Drosophzla can contain different libraries of middle repetitive DNA sequences Chromosoma 88, 104108. 8 Kiyama, R., Matsm, H., and Otshi, M. (1986) A repetitive DNA family (Sau3A family) m human chromosomes extrachromosomal DNA and DNA polymorphism. Proc. Nat1 Acad Set USA 83,4665-4669. 9 Gusella, J. F., Tanzr, R E , Anderson, M. A., Hobbs, W., Gibbons, K., Raschtchian, R., Gilliam, T. C., Wallace, M. R , Wexler, N. S., and Conneally, P. M. (1984) DNA markers for nervous system diseases. Nature 225, 132&1326. 10. Southern, E. M. (1975) Detection of specific sequences among DNA fragments separated by gel electrophoresis J A401 Bzol. 98,503-5 17 11 Davidson, E H , Galau, G A., Angerer, R. C., and Brrtten, R. J (1975) Comparative aspects of DNA organization in metazoa. Chromosoma 51,253-259. 12. Schmid, C. W. and Deininger, P. L (1975) Sequence orgamzation of the human genome. Cell 6,345-358 13. Cram, W. R., Davidson, E H., and Britten, R J (1976) Contrastmg patterns of DNA sequence arrangement m Apes melltfera (honey bee) and Musca domesttca (housefly) Chromosoma 59, l-12. 14. Jordan, R. A. and Brosemer, R W. (1974) Characterisation of DNA from three bee species J Insect Physiol 20,25 13-2520 15 Jeffreys, A J , Wilson, V., and Them, S L (1985) Hypervariable “mnnsatelhte” regions in human DNA. Nature 314,67-73 16. Gill, P., Jeffreys, A J., and Werrett, D J (1985) Forensrc application of DNA “fingerprmts ” Nature 318,577-579. 17. Georges, M., Lequarre, A.-S , Castelh, M , Hanset, R., and Vassart, G. (1988) DNA fingerprinting in domestic animals using four different mimsatellite probes Cytogenet. Cell. Genet. 4‘7, 127-13 1. 18. Hall, H. G. (1991) Genetic characterization of honey bees through DNA analysis, in The “African” Honey Bee (Spivak, M., Breed, M., and Fletcher, D. J. C., eds.), Westview Press, Boulder, CO, pp 45-73 19. Pellett, F C. (1938) Hzstoly ofAmerzcan Beekeepzng Collegiate Press, Ames, IA, pp l-5,67-69. 20. Oertel, E. (1976) Bicentennial bees. Early records of honey bees in the eastern United States. Am Bee J 116,70,71, 114, 128, 156, 157,214,215,260,261,290 2 1. Sheppard, W. S. (1989) A history of the mtroduction of honey bee races mto the United States. Am. Bee J 129,617-6 19,664-667 22. Ruttner, F. (1988) Btogeography and Taxonomy of Honey Bees, Sprmger, Berlin, Germany. 23. Kerr, W E. (1967) The history of the introductron of African bees to Brazil. South African Bee J 39,3-5
RFLP Analyses 24. Woyke, J (1969) African honey bees in Brazil. Am Bee J 9,342-344 25. Michener, C. D. (1975) The Brazilian bee problem. Ann Rev Entomol 20,399-416. 26. Taylor, 0. R. (1977) The past and possible future spread of Afrtcanized honey bees in the Americas. Bee World 58, 19-30. 27. Lobo, J. A., Lama, M. A., and Mestriner, M. A (1989) Populatron differentiation and racial admtxture in the Africanized honey bee (Apu mellifera L.). Evolutzon 43,794-802. 28. Sheppard, W. S., Rmderer, T. E., Mazzoli, J. A., Stelzer, J. A., and Shrmanuki, H.
(1991) Gene flow between African and European-derived honey bee populations m Argentina. Nature 349,782-784. 29. Taylor, 0 R. and Spivak, M. (1984) Climatic limits of tropical African honey bees in the Americas. Bee World 65,38-47. 30. Mwhener, C. D., Allred, J , Esch, H. E., Gary, N E., Hubbell, S. P., Rothenbuhler, W. C., Smith, M. V., Townsend, G. F , and Zozaya, J. A. (1972) Fwzal Report Committee on the Afrzcan Honey Bee. National Academy of Science USA, Washington, DC. 3 1. Rinderer, T. E. (1986) Africanized bees: An overvrew. Am Bee J 126,98-100. 32. Caron, D. M. and Gray, B. (1991) The Impact of the Afrrcamzed bee on beekeeping m Panama. Bee Scz 1, 139-143. 33. Daly, H V (1991) Systemattcs and tdenttticatton of Afrrcanized honey bees, m The “African” Honey Bee (Sptvak, M., Breed, M., and Fletcher, D J. C , eds ), Westvrew Press, Boulder, CO, pp. 13-44 34 Graur, D. (1985) Gene diversity in Hymenoptera. Evolutron 39, 190-199 35 Crozrer, R. H. (1977) Evolutionary genetics of the Hymenoptera. Ann Rev Entomol. 22,263-268 36 Hall, H G. (1992) Processes of New World African honey bee spread revealed by DNA studies Florida Entomol 75, 5 l-59. 37. Hall, H. G. and Muralidharan, K (1989) Evidence from mitochondrial DNA that African honey bees spread as continuous maternal lineages Nature 339,2 1l-2 13. 38 Smith, D. R., Taylor, 0. R., and Brown, W. W. (1989) Neotroptcal Africanized honey bees have African mrtochondrial DNA Nature 339,2 13-2 15. 39. Hall, H. G. and Smith, D. R. (1991) Dtstmgutshing African and European honey bee matrilines with amplified mttochondrial DNA. Proc Nat1 Acad. Scz USA 88, 4874-4877. 40. Hall, H. G. (1990) Parental analysts of introgresstve hybridization
between African and European honey bees using nuclear DNA RFLPs. Genetzcs 125,6 11-62 1 4 1. Harrison, J. F. and Hall, H G. (1993) African-European honey bee hybrids have low non-intermediate metabolic capacities. Nature 363,258-260. 42. Barton, N. H. and Hewitt, G. M (1989) Adaptton, speciation and hybrid zones. Nature 341,497-503. 43. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Clonwg. A Laboratoly Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 44. Hall, H. G. (1986) DNA drfferences found between Afrtcamzed and European honey bees. Proc Nat1 Acad Sci USA 83,4874-4877
366
Hall
45. Grunstem, M. and Hogness, D (1975) Colony hybridizatton A method for the isolation of cloned DNAs that contain a specific gene. Proc Nut1 Acad Scz. USA 72,3961-3965. 46. Hall, H. G. (1992) Further characterization of nuclear DNA RFLP markers that distinguish Afrrcan and European honey bees. Arch Insect Bzochem. Physzol. 19,
163-175. 47 Hall, H. G. and McMichael, M. A. (1992) European honey bee (Aprs mellzjkra L ) (Hymenoptera: Apidae) colonies at htgh elevations in Costa Rica tested for African DNA markers. Bee Scz 2,25-32. 48. Taylor, C W., Yeoman, L. C., and Busch, H. (1975) The rsolatron of nuclei wtth citric acid and the analyses of proteins by two-dtmensronal polyacrylamide gel electrophorests. Methods Cell Bzol 9,349--376. 49. Southern, E. (1980) Gel electrophoresls of restrtctron fragments. Methods Enzymol 68, 152-176. 50. Rtgby, P. W. J., Dieckmann, M , Rhodes, C., and Berg, P (1977) Labeling deoxyribonuclerc acid to high specific activity in vztro by nick translation wtth DNA polymerase. J Mol. Bzol 113,237-25 1.
CHJ~PTER25
Differential Screening for the Isolation of Species-Specific Sequences in the Anopheles farauti Complex Kadaba
S. Sriprakash
1. Introduction Anupheles furauti complex has been shown to be composed of several species, numbered A. farauti no. 1 through A. furauti no. 6 (I-4). Members of this complex are regarded as potential vectors for malarial parasites (5). These species are morphologically indistinguishable. Three methods based on biological, cytological, and biochemical differences are available to identify these species. * The hybrids produced by mating between the species are sterile, yielding a method for identification (6,7). However, as this method is time consuming and separate colonies of species need to be maintained, it is not practicable for routine application. The banding patterns of polytene chromosomes (1,2) and differences in the electrophoretic mobility of isoenzymes (8,9) are both powerful means of identification, but need fresh or freezer-stored materials and hence are impractical for large-scale field work. Recently, species-specific DNA probes have been designed (1042) and successfully used in identifying the wild-caught and stored specimens of mosquitoes belonging to A. farauti complex (10,13). The probes were isolated by differential hybridization. Restricted A. farauti genomic DNA was ligated into a plasmid vector at an appropriate site and transformed into Escherichia coli. The transformants were colony-lifted and From*
Methods iVuc/e/c
m Molecular Aod Methods
Wology, Edlted
Vol 50. Speoes by J P Clapp
367
D/agnosbcs Protocols PCR and Other Humana Press Inc , Totowa, NJ
Sriprakash
368
replicas of the lifts were probed with labeled total genomic DNA from homologous or heterologous A. fara& species. The colonies that give signals with homologous DNA but not with heterologous DNA were chosen and further characterized. This method often yields probes for high copy number sequences in the genomic DNA. For the probes to be useful, their target sequences should not have a high level of variation in the copy number over time, between sexes, and among the isolates from different geographical locations. It may also be useful if the probes could identify members of the A. farad complex using larval and pupal material. Tests for such characteristics form an integral part of isolation of the species-specific probes for A. farauti complex. 2. Materials 2.1. Bacterial
Culture
and
Cloning
Vectors
E. coli strain JM 107 and the clonmg vector pUC 12 were used in the study reported in Booth et al. (10). In this system, the white colonies that contain recombinant plasmid can be distinguished with ease from blue colonies that contain the vector alone. Any host-vector system that provides a convenient selection is suitable. 2.2. A. farauti Two types of A. farauti collections are recommended. First, specimens from a colony of homogeneous species reared in a laboratory and species identified by a biological, cytological, or biochemical method. These materials are essential for isolation and evaluation of probes under controlled conditions. Larvae and pupae are also collected from the colonies. For the methods described in this chapter, colony-reared mosquitoes were used. However, for extensive evaluation of the usefulness of the probes to the wild-caught mosquitoes, light-CO, traps may be set up at different geographical locations and during different seasons. 2.3. Solutions
and Reagents
1. Phenol-chloroform-isoamyl alcohol: Equilibrate 25:24:1 mixture by volume of phenol, chloroform, and isoamyl alcohol with 100 mM Tris-HCl, pH 7.5 by extracting with the buffer severaltimes. Storethe organic phase under 10 mM of the samebuffer in a dark bottle.
Screening in the Anopheles farauti Complex
369
2. 20X SSC. 1X SSC = 0.15M NaCl + 0.015M sodium citrate. Dissolve 175.3 g NaCl and 88.2 g Na-citrate in 800 mL distilled water. Adjust pH to 7.0 with 1ONNaOH and make up to 1 L. Filter if necessary. For long-term storage, sterilize by autoclaving. 3. 0.5M EDTA: Mix 186.1 g NazEDTA and 700 mL water, stir, and add 1OM NaOH until pH 8.0. Make up to 1 L. Autoclave. 4. SDS 20%: Dissolve in warm water 200 g of sodium dodecyl sulfate in a final volume of 1 L. Adjust pH to 7.0 if necessary. May precipitate on storing. If so, warm before using. 5. 1.OM Tris-HCl, pH 7.5 and 9.0: To 121.1 g of Tris base in 800 mL water, add concentrated HCl until the desired pH is obtained. Make the final volume to 1 L. Autoclave. 6. 5MNaCl: Dissolve 292.2 g of NaCl in a final volume of 1 L. 7. 8M K-acetate: 78.5 g potassium acetate m 100 mL of the solution. 8. Tris-EDTA (TE): 10 mMTrts-HCl, pH 7.5, 1 mMEDTA. 9. DNA extraction solutton I: 10 mM Tris-HCl, pH 7.5,60 mMNaC1, 10 mA4 EDTA, 5% sucrose. 10. DNA extraction solution II: 1.25% SDS, 0.3M Tris-HCl, pH 9.0, O.lM EDTA, 5% sucrose. 11. Plasmid DNA extraction solutions: FlexiPrep Kit by Pharmacia P-L Biochemicals (Uppsala, Sweden) provide all the soluttons necessary for plasmid DNA extraction and purification. The compositions of the solutions as described by the manufacturer are as follows: a. Resuspenston buffer: 100 nuJ4 Tris-HCl, pH 7.5,10 mM EDTA, 400 ug/mL RNaseI. b. Lysrs buffer: Freshly made 0.2MNaOH, 1% SDS. c. Neutralization buffer: To 60 mL of 5M potassium acetate add 11.5 mL glacial acetic acid and 28.5 mL water. d. Ethanolic wash buffer: 10 mM Tris-HCl, pH 7.5, 2 mM cyclohexanediaminetetraacetic acid, 200 mMNaC1. Before use add ethanol to 60%. e. Sephaglas: This is a glass matrix from Pharmacia. DNA binds to this matrix under the conditions described. 12. Ethanol: Store at 4°C. 13. Xgal: 20 mg 5-Bromo-4-chloro-3-indolyl-p-o-galactoside m 1 mL dimethylformamide (DMF). DMF should be handled in a fume hood. Store at -20°C. 14. IPTG: Isopropyl-p-o-thtogalactoside (2 g) in 10 mL water. Store at-20°C. 15. 1M CaClz: 28.8 g CaC12* 2H20 in 200 mL of deionized water. Falter sterilize. Store at 4°C.
Sriprakash
370
16. Colony hft solutions: a. Lysis solutton: 0.5M NaOH, 0.5MNaCl. b. Neutralization solutton: 1.5MNaC1, IM Tris-HCl, pH 7.5. c. Wash solution: 2X SSC. 17. Hybridization solutions: a. Long probe: 2X SSPE containing 1% SDS, 0.5% blotto, 0.5 mg/mL herring sperm DNA, 10% dextran sulfate. b. Oligonucleotide probe: 5X SSPE containing 1% SDS, 0.5% blotto, 0.5 mg/mL herring sperm DNA, 5% Dextran sulfate 5X SSPE: 0.9M NaCl, 50 mMNaH2P04 * 2H20, 5 nnI4 EDTA Blotto: Stock solution is 10% nonfat milk powder, 0.2% sodium azide. Sodium azide in powder form should be handled in a fume hood. Store at -2OOC. 18. Posthybrtdtzatron washes: a. Long probes:‘O.lX SSC, 0.1% SDS. b. Ohgonucleotide probes: 2X SSC, 0.5% SDS. 19. [a-32P]dATP (>3000 Cl/mmol). 20 Sephadex G 50 column: Plug 1 mL blue tip lightly with a small piece of glass fiber filter (GFQ fill with presoaked Sephadex G50 in TE to the top. Wash and run with TE. 2 1. DNA hexamers, restriction enzymes, DNA modificatton enzymes, DNA polymerases, and plasmid vectors can be obtained from any supplier of molecular biology reagents. 22. X-ray film: Kodak X-omat.
2.4. Buffers Restriction enzyme digests and other enzymatic reactions may be performed in the buffers provided by the manufacturers or in the buffers described in Sambrook et al. (14). The author used One-Phor-All (plus) buffer supplied by Pharmacia as specified by the manufacturer. This buffer offers convenience as it is compatible with many restriction enzymes and many DNA modification enzymes, such as alkaline phosphatase, DNA polymerase (Klenow), and DNA ligase. Other workers (IS) have successfully used 33 mM Tris-acetate, pH 7.9; 66 mM potassium acetate, 10 rnM magnesium acetate, 0.5 rnA4 dithiothreitol; 0.1 mg/mL bovine serum albumin as a universal buffer for similar operations. The buffers may be stored at -20°C in small aliquot. Unless otherwise stated, it is implicit that all the enzyme reactions mentioned in this chapter may be performed in the One-Phor-All (plus) buffer.
Screening
in the Anopheles farauti
Complex
371
2.5. Bacteriological Medium The bacterial culture medium (2X YT) contains 1% yeast extract, 1.6% tryptone, and 0.5% NaCl. The plates contain 1.5% bacto-agar (Difco, Detroit, MI). Ampicillin (a final concentration of 100 ug/mL) is added to the sterilized medium when necessary.For the agar plates, the antibiotic is added to the molten medium cooled to 50°C. Plates containing the antibiotic may be stored at 4°C for 1 wk. X-gal and IPTG (40 and 100 I.&~-L final concentrations, respectively) may also be addedto the agar-containing medium at the time of addition of the antibiotic for blue/white selection. 3. Methods 3.1. Preparation of DNA 3.1.1. Genomic DNA from A. farauti The protocol is essentially according to Coen et al. (16). 1. Homogenize about 5-l 0 laboratory-reared and identified mosquitoes in a 1.5-mL microfuge tube containing 100 PL of DNA extraction solution I. 2. Add 100 p.L DNA extraction solutron II to the homogenate and incubate 30 min at 65°C at the end of which add 30 pL of 8Mpotassmm acetate. 3. Incubate for 45 mm on ice, and centrifuge the mix to remove the precipitate. 4. Precipitatethe DNA (approx 20 pg, seeNote 1) from the supernatantwith 2 vol of ethanol. Rinse the pellet with 70% ethanol, dry, and dissolve in 20 JJLof TE. 3.1.2. Plasmid
DNA
Plasmid DNA was prepared as per the modifications of the alkaline cell lysis procedure (14) using the FlexiPrep Kit (Pharmacia). 1. Thoroughly resuspend the cell pellet from a 1.5-mL overnight cell culture m a 200 PL resuspension buffer and add 200 PL of lysis solution. 2. Incubate for 5 min at room temperature, then add 200 FL of neutralization solution. Mix gently and let stand for 5 min on ice. 3. Spin for 10 min to clarify and precipitate the DNA with 0.7 vol of isopropanol at room temperature. Dram the supernatant well and purify the DNA if necessary, using Sephaglas according to the manufacturer’s (Pharmacia) recommendations. 4. Briefly, resuspend the DNA pellet in 150 pL of Sephaglas slurry and vortex. 5. Centrifuge, remove the supernatant, and wash the pellet with 200 PL of ethanolic wash buffer and with 300 pL of 70% ethanol. 6. Air dry the pellet and elute DNA from the solid support with 50 pL of TE at room temperature.
372
Sriprakash
3.2. Restriction
Digestion
of DNA
3.2.1. Digestion of the Genomic DNA Digest 5-10 pg of DNA with Sau3a using 1 U of the enzyme for 30 min at 37°C in a final volume of 50 PL (see Note 2). 3.2.2. Digestion of Plasmid DNA and Removal of 5’ Phosphate from Linearized DNA 1. Cut pUC 12 (l-2 pg) with BamHI (5 U) for 30 min in a 50-pL reaction, 2. Heat inactivate BamHI at 85°C for 30 min and cool to room temperature. 3. Treat with 0.1 U of calf intestine alkaline phosphatase for 30 mm to remove the 5’ phosphates of the linearized DNA. Inactivate the alkaline phosphatase by incubating the reaction mix at 85°C for 15 min (see Note 3).
3.3. Construction
of Genomic
Library
1. Mix the Sau3a-cut genomic DNA (0.5-l pg), the phosphatased vector DNA (1O-20 ng), ATP (1 rnA4), T4 DNA ligase (l-2 U), and buffer in a final volume of 20 pL. 2. Incubate at 4°C overnight, then heat inactivate the ligase at 65°C for 10 min. 3. Transform competent E. colz JM107 obtained by the calcium chloride method (14) with 5-10 pL of the ligase reaction mix. 4. Plate the transformants on 2X YT containing ampicillm, X-gal, and IPTG. The total yield of transformants is approx 5000-20,000, with less than 20% blue colonies if the phosphatase step was successful (see Note 4). 5. Incubate the plates until small colonies are vistble (approx 16 h). Colony density of about 3OO/plate(of 85-mm diameter) is ideal.
3.4. Screening
for Potentially
Usefil
Clones
3.4.1. Colony Lifts 1. Cool the plates with recombinant colonies for l-2 h. This precooling helps in decreasing the nonspecific background signals and also accentuates the blue color owing to the chromogenic product formed from X-gal by the nonrecombinant plasmid vector. 2. Place a circular nitrocellulose filter on the cooled plates taking care not to move the filter once it is on the plate and avoid air bubbles. Air bubbles may be avoided by holding the filter with two tweezers and bending the filter slightly so that contact with the plate is made in the center first and slowly extending the contact outward. 3. Place orientation marks on the filters and the plate by making asymmetric stab marks with a needle and India ink.
Screening in the Anopheles farauti Complex
373
4. After 5 mm at room temperature, lift the filters carefully and treat sequentially for 5 mm each, by placing them with colony side up on Whatman (Maidstone, UK) blotting paper soaked in 10% SDS, lysls solution, neutralization solution, and 2X SSC (see Note 5). 5. Blot dry the filters by placing them between folds of dry Whatman No. 3 blotting paper, and bake in a vacuum oven at 70-80°C for 1 h. 6. Incubate the master plates further for the colonies to regrow. If necessary, replicas of colony lifts may be made from the plates after 6-8 h regrowth each time. However, for differential screening with only two or three species, it is convenient to reuse the same colony lift filters after regeneration (see Note 6 for regeneration procedure). 3.4.2. Preparation of Probes 1. Label 100 ng of genomic DNA from each species of A. farauti separately with [cL-~~P]~ATP(100 pCi, 3000 Ci/mmol) in a 50-p.L reaction buffer containing 5 pg random hexamers, 20 pM each of dCTP, dGTP, and TTP,
and 5 U of Klenow DNA polymerase.Incubate at 37°C for 30 min. 2. Stop the reaction with 2 uL of 0.5MEDTA and by heating at 65°C for 10 mm. 3. Remove the unmcorporated radioactivity by passing the reactton mix through a small column of Sephadex G50 made in a 1-mL blue pipet tip. 4. Elute with 1X TE and collect 100-pL fractions. 5. Pool the radioactive fractions in the void volume. The specific radioactivity of the labeled DNA is usually between lo* and lo9 cpm/pg DNA. Denature the probes by heating in a boiling water bath for 5 mm immediately prior to hybridization.
3.4.3. Hybridization 1. Soak the colony 1iRfilters in 2X SSC + 1% SDS (10 n&/filter) for 1 h at 65OC and then gently scrapethe colony debris by rubbing between gloved fingers. 2. Rinse the filters in the same solution once again and place the filter in a plastic bag. 3. Add 5 mL of hybridization solution (for long probes) and seal on all four sides. Place the assembly in a water bath at 65°C for 2 h. 4. Cut open the assembly at a corner, add labeled denatured genomic DNA (1 O6cpm/filter) from homologous species. After hybridization overnight at 65OC,cut open the bag to recover the filter. 5. Place the filter in a plastic box (ordinary lunch box) containing 100-200 mL 0.1X SSC and 0.1% SDS at 60°C. 6. Incubate with gentle rocking for 30 min. Discard the washing (follow the local regulations on the disposal of radioactive waste) and repeat the operation twice more.
374
Sriprakash
7. Blot dry the filters m folds of Whatman No. 3 paper, seal the filter m plastic film, and expose to an X-ray film for 16-24 h at -70°C. Autoradiography should reveal many recombinants but the intensity of signal between clones may vary. The blue colonies (which have no inserts) may give a low, background level of signal. Rephcas of the filters may stmultaneously be hybridized with the genomtc probes from heterologous species. Identify the colonies that reacted well with homologous DNA but dtd not react with the heterologous DNA by aligning autoradiograms to the orientation marks.
3.5. Selection from Potentially
of Probes Useful CZones
1. Isolate DNA from several such clones according to Sambrook et al. (14). 2. Label 10 ng of DNA from a subset of these clones that gave high signal-tonoise ratio in the differential hybridizations and hybridize to the dot-blots
containing 0.1 pg of DNAs from species of the A. farauti complex. 3. Apply denatured DNA samples to several replicate nylon membrane filters using a dot-blot apparatus (BioRad, La Jolla, CA) such that each filter has the dots of DNA from each of the species. 4. Carry out hybridizatton (as described) with labeled probes to confirm the species specificity. Figure 1 shows one such experiment with A. furauti species (A. furautz nos. 1, 2, and 3) known to be present in the Northern Territory
of Austraha.
The sensitivity of detection between the DNA probes varies depending on the number of repeats in the target sequences. Therefore, it is important to determine the sensitivity to each of the probes by hybridizing to a blot containing serial dilutions of the A. farauti DNA. Prepare a serial dilution of known and same quantity (e.g., 100 ng) of homologous and heterologous genomic DNA from A. farauti in TE, denature by boiling, and spot each dilution onto a membrane filter using a dot-blot apparatus. After baking, carry out hybridization with probes to determine the sensitivity. With [32P]-labeled probes l-10 ng of homologous DNA could be detected. An excellent example of this experiment can be found in a recent publication by Beebe et al. (12). The sensitivity depends on the number of copies of the target sequence present in the genome.
3.6. Improvement
of Specificity
Occasionally, the probes may exhibit overlapping species specificity. For instance, probe 1 detected bothA.farauti no. 1 and A.farauti no. 3, but the intensity of signals were different. To eliminate this crossreaction, the
sequence of probe 1 was determined and several oligonucleotides corre-
Screening in the Anopheles farauti Complex
375
Fig. 1.Recombinant probesford.farauti nos.1,2, and3 (isolatedby differential screening)hybridizedto dot-blotsof DNA fromA.faruuti nos. 192, and3, Columns1,2, and3 containDNA fromA. farauti nos.1,2, and3, respectively. PanelsA, B, andC representthreefilters that werehybridizedto recombinant probesford.farauti nos.1,2, and3, respectively.Notethatprobe2 is specificto its target(A. farauti no. 2), whereasprobes1 and3 arenot. Probe1 hybridizes stronglyto A. farauti no. 1 andweakly to A. farauti no. 3. Probe3 hybridizes stronglyto A. furauti no. 3 andweaklyto A. farauti no. 1 andA. furauti no. 2. spondingto the probe 1 sequencewere synthesizedand testedin a dot-blot assay.One oligonucleotidespecifically detectedA. faruuti no. 1. For determination of DNA sequence,follow Sambrooket al. (14,. Designthe oligonucleotidesbasedon the sequenceinformation.Many commercialsuppliers of oligonucleotidesareavailable.Obtaindeprotectedoligonucleotides.Label the oligonucleotidesusing [Y-~~P]ATPand polynucleotide kinase.To 2050 ng of oligonucleotide,add50 PCi of [y-32P]ATP(specific activity >2000 Ci/mmol), 5-l 0 U of polynucleotidekinaseandbuffer in a total volume of 50 PL.’After 30 min at 37”C, inactivate the kinaseby heating at 65°C for 15min. Collect the radiolabeledoligonucleotidesby ethanolprecipitation. Each set of dot-blots contains the DNA dots from different speciesof A. farauti on nylon membranefilters. Block the filter (25 cm2) by incubating with 5 mL prehybridization solution (oligonucleotide probe) at 60°C for 2 h. Then add approx 1OScpm of the labeledprobe and incubate for an additional 8 h. Wash the filter three times with wash solution (oligonucleotide probes) at 50°C, blot dry, and expose to an X-ray film as described. Figure 2 shows improved speciesspecificity obtained using oligonucleotide probes.
376
Sriprakash
A
B
C
m
f m
f m
I
f
Fig. 2. Oligonucleotide probes for A. firauti nos. 1, 2, and 3 (derived from recombinant probes) hybridized to dot-blots of DNA from male (m) and female (f) specimensA. faruuti nos. 1,2, and 3. Columns 1,2, and 3 contain DNA from A. furauti nos. 1, 2, and 3, respectively. Panels A, B, and C correspond to sequential hybridization of the filter (after regeneration) to the oligonucleotide probes for A. faruuti nos. 1,2, and 3, respectively. Note the improved specificity over the recombinant probes (Fig. 1).
3.7. Further Characterization of the Putative Probes It is important that the selectedprobes should havethe following characteristics: 1. Although identification of the females may be the main goal of this exercise (becauseof their importance in transmitting malaria), it is useful to be able to identify both sexesofA. farauti speciesand their larvae and pupae for ecological survey. The results in Fig. 2 demonstratethat both the male and female mosquitoesgave similar signalswith the oligonucleotide probes. 2. Give similar hybridization signals for the wild-caught mosquitoes (see Notes 7 and 8).
Screening in the Anopheles farauti Complex
377
3. Give consistent signals over a period of time (i.e., relatively stable targetsequence number over time). 4. Show little variatton m the hybridization signals for mosquitoes hatching in different seasons.
These qualities may be tested by hybridization to wild-caught mosquitoes of both sexes collected during different seasons over a period of time (see Note 8). 4. Notes 1. DNA source: It is advisable to obtain genomlc DNA for library from fresh mosquitoes. With stored samples, the yield of DNA 1slow and the quality of DNA may not be suitable for construction of a genomic library. The yield of DNA from one mosquito is approx 1 pg using this protocol. 2. Partial vs complete dlgestlon with Sau3a: There 1sno advantage m generating partial digestlons. In fact at times it may be a disadvantage. The long DNA inserts may not show strict species specificity. Genomic library may be constructed with other restrictlon enzymes and appropriately cut vector DNA (12). 3. Inactivation of alkalme phosphatase-potential problems: It is important to inactivate the alkaline phosphatase completely. If more than the necessary amount of enzyme is used, mactlvatlon may be mcomplete, resulting m a drastic reduction in the yield of recombmants. 4. Yield of transformants: Numerous methods of transformation are available. Calcium chloride induced competence 1s a simple procedure that yields about 1O6transformants per 1 pg of the vector DNA. My experience (10) and those of others (21) suggest that screening of about 1000 recombinants is sufficient to ldentifj a useful A. farauti probe by differential hybridization. Therefore the transformation efficiency by the CaCl, method is adequate. 5. The treatment with 10% SDS is optional. The general background is low and the hybridization signal is sharp when the filters are treated with SDS. 6. Regeneration of membrane filters for reuse with probes from another specres may be achieved by pouring 100-200 mL of boiling 0.5% SDS on the filter. After three such washes, blot-dry the filters. The filters are now ready for hybridization with DNA from another species. 7. The mosquitoes of A. farauti species caught by the light-CO, traps are almost exclusively females. 8. High variation in the signals for the wild-caught samples ofA farautz might be symptomatic of possible copy number variation of the target sequences. This might limit the usefulness of the probes. Therefore, a periodic check
Sriprakash
378
againstothermethodsis recommended.A trivial explanation for the variation in the signals is the differencesin the amount of filter-bound DNA on the membranes.This may be monitored by hybridization to the probesfor ribosomal DNA as describedby Booth et al. (20). Acknowledgments I thank my colleagues, Jon Hartas and Garry Myers, for critical reading of the manuscript. Jon Hartas made many constructive suggestions and was responsible for assembling the figures. References 1. Bryan, J. H. and Coluzz~, M. (197 1) Cytogenetic observations on Anopheles furuutz Laveran. Bull WHO 45,266,267. 2 Mahon, R. J. (1983) Identification of the three siblmg species ofAnopheles furautz Laveran by the banding pattern of their polytene chromosomes. J Australian Entomol. Sot. 22, 3 l-34. 3. Foley D. H., Paru R., Dagoro, H , and Bryan, J. H. (1993) Allozyme analysis reveals six species within the Anophelespunctulatus complex of mosquitoes m Papua New Guinea. Med. Vet. Entomol 7, 37-48. 4. Foley, D. H. and Bryan, J. H. (1993) Electrophoretic keys to identify members of the Anopheles punctulatus complex of vector mosquitoes in Papua New Guinea. Med. Vet. Entomol. 7,49-53. 5. Bryan, J. H. and Russell, R. C (1983) Australian malaria vectors. Trans R Sot Trop Med. Hyg. 77,278,279. 6. Bryan, J. H. (1973) Studies on the Anopheles punctulatus complex. 3. Mating behaviour of the Fl hybrid adults from crosses between Anopheles farauti no. 1 and Anopheles farautt no. 2 Trans. R. Sot. Trop. Med. Hyg. 67, 85-9 1. 7. Mahon, R. J. and Miethke, P. M. (1982) Anopheles farautt no. 3, a hitherto unrecognised biological species of mosquito wtthm the taxon An. faruuti Laveran (Diptera: Culicidae) Trans R. Sot Trop Med. Hyg 76,812 8. Mahon, R. J. (1984) The status and means of identifying the members of the Anophelesfarautt Laveran complex of sibling species, in Malaria. Proceedtngs of a Conference to Honour Robert H. Black. Commonwealth Department of Health, Australian Government Public Service, Canberra, pp. 152-156. 9. Foley, D. H., Whelan, P. I., and Bryan, J. H. (1991) A study oftwo sibling species of Anopheles farautz Laveran (Diptera, Culicidae) at Darwin, Northern Territory. J. Australian Entomol. Sot. 30,269-277. 10. Booth, D. R , Mahon R. J., and Sriprakash K. S. (199 1) DNA probes to identify the members of the Anopheles farautt complex. Med Vet Entomol 5,447-454. 11. Cooper, L., Cooper, R. D., and Burkot, T. R. (1992) The Anophelespunctulatus Complex: DNA probes for identifymg the Australian species using isotopic, chromogenic and chemiluminescence detection systems Exp. Parasitol 73, 27-35.
Screening in the Anopheles farauti Complex
379
12. Beebe, N. W., Foley D H., Saul, A., Cooper, L., Bryan, J. H., and Burkot, T. R. (1994) DNA probes for identifying the members of the Anophelespunctulatus complex m Papua New Guinea. Am J. Trop A4ed Hyg 50,229-234. 13. Hartas, J., Whelan, P. I., Sriprakash, K S., and Booth, D. (1992) Oligonucleotide probes to identify three sibling species of the Anopheles farauti Laveran complex (Diptera, Cuhcidae). Trans. R Sot. Trop. Med Hyg. 86,2 10-2 12. 14. Sambrook, J., Fritch, E F., and Maniatis, T. (1989) A4olecuZur Clonzng: A Laboratory Manual 2nd ed. Cold Sprmg Harbor Laboratory Press, Cold Sprmg Harbor, NY 15 Monaco, A. P., Larin, Z., and Lehrach, H. (1992) Construction of yeast artificial chromosome libraries by pulsed-field gel electrophoresis. Methods A401 Biol. 12, 225-234.
16. Coen, E. S., Thoday, J. M , and Dover, G. (1982) Rate of turnover of structural variants in the rDNA gene famtly of Drosophila melanogaster Nature 295,564-568.
CHAPTER26 RAPD-PCR
with Richard
Parasitic
Hymenoptera
L. Roehrdanx
1. Introduction The parasitic Hymenoptera represent a group of insects that is both taxonomically and biologically poorly defined, despite the fact that members of the group are the premier agents in successful programs for the biological control of phytophagous insect pests. The vast majority of Hymenoptera utilize a parasitic lifestyle. Most Hymenoptera families contain parasitoid species, but some of the same families also include nonparasitoids. Although more than 100,000 species of Hymenoptera have been described, it has been estimated that more than 75% of the parasitic species have not been identified (1,2). Contributing factors to this lack of knowledge of parasitic Hymenoptera species are their diminutive size and their relative rarity under most conditions. The insects generally are slender with individuals of many species less than 5 mm long. At least one species of Trichogrammatid has an adult size of about 0.2 mm, which could be the world’s smallest insect (2). Parasitic Hymenoptera have the capability to respond quickly to an outbreak of their phytophagous hosts, however, under stable equilibrium conditions the population density of the parasites may be very low (1). There are substantial economic and environmental benefits for an expanded effort in understanding taxonomic relationships, identifying species, and delineating intraspecific genetic diversity. Estimates of genetic variation in Hymenoptera measured by allozyme polymorphisms consistently have indicated less variability than in other insect groups. From
Methods Nuclerc
m Molecular AC/d Methods
Bology, Edlted
Vol 50. Speoes by J P Clapp
381
D/agnosbcs Protocols PCR and Other Humana Press Inc , Totowa, NJ
Roehrdanz
382
Models to account for the lack of variation invoke a stable early developmental environment (e.g., inside the host) or some aspect of the haplodiploid reproductive cycle. Most parasitic Hymenoptera are arrhenotokous, females are derived from fertilized eggs and are diploid, whereas males are the products of unfertilized eggs and are haploid (3). RAPD markers reveal genetic variability, previously inaccessible, and have the potential to help solve some of the problems associated with studying the parasitic Hymenoptera. RAPD patterns can be used to identify species (4+. Some of these species-specific RAPD bands can be recognized in an extract of an infected host before the adults emerge (4). To the extent the parasite bands can be distinguished from host band variation, a practical method of identifying preadult insects can be developed. Variation within species has also been detected both across geographic distance (5) and among geographically diverse collections that have undergone the genetic bottleneck of colonization (6) (see Note 1). Because of the easeof obtaining information, analysis of RAPD markers should become a useful tool in future research designed to tap the biological control capabilities of the parasitic wasps. 2. Materials 2.1. Equipment and Supplies 1. 2. 3. 4. 5. 6. 7. 8. 9. 10.
Thermal cycler. Pipeters and sterile plugged tips. Sterile homogenizers. Agarose gel electrophoresis equipment. UV light. UV transilluminator and photodocumentation system. Microcentrifuge. Heating block or water bath. Mtcrofuge tubes.. Insects, live or fresh-frozen (see Note 2).
2.2. Chemicals,
Buff&s
and Solutions
1, TIK homogenization buffer: 10 mM Tris-HCl, pH 8, 1 mM EDTA, 1% Nonidet, 100 pg/mL proteinase K, aliquot to 1.5~mLtubes,and store at-20°C. 2. CTAB buffer: 0.1 MTris-HCl, pH 8, 1.4MNaCl,O.O2 MEDTA, 2% CTAB (hexadecyltrimethylammonium bromide), 0.2% 2-mercaptoethanol, store at -4°C. Over several months the mercaptoethanol can break down. The buffer can be rejuvenated two times by adding additional mercaptoethanol.
RAPD-PCR
with Parasitic
Hymenoptera
383
3. 10X (lo-fold concentrated stock) TBE buffer: 0.9M Tris-base, 0.9M boric acid, 25 mM EDTA, store at room temperature. This can precipitate if not used up in less than 1 mo. 5X TBE has a longer shelf-life and may be preferred. 4. 10X PCR buffer: 500 mMKC1, 100 mMTrn+HCl, pH 8.3. Store at-20’C. Suitable 10X PCR buffer is usually supplied by the vendors of Tag polymerase. 5. 25 mMMgC1, sterile solution, store at-20°C. Polymerase vendors usually supply this also. 6. Nucleotide solutions 10 mM (dATP, dCTP, dGTP, dTTP) store at -20°C. 7. Tag polymerase, store at -20°C. 8. Ethidium bromide: 10 mg/mL stock solution. Store at 4OC. Caution: Potential carcinogen. 9. Sterile deionized water, aliquots frozen in mrcrofuge tubes. A 30-mL syringe fitted with a sterilizing filter is convenient for dispensing into 1.5-mL sterilized microtubes. 10. Chloroform (or chlorofornnisoamyl alcohol, 24: l), mineral oil, agarose. 11. Isopropanol and 70% ethanol, store small bottles at -20°C. 12. Oligonucleotide primers, 10 bases in length. 13. TE buffer: 10 mMTris-HCl, 1 mMEDTA, pH 7.5.
3. Methods 3.1. Preparation of DNA from Very Small Insects (or from Small Pieces of Larger Ones) 1. 2. 3. 4. 5. 6. 7. 8.
Place insect in sterile 1.5-n& microtube. Add 30 uL of TIK homogenization buffer (see Note 3). Crush the insect with a sterile pestle (see Note 4). Wash off homogenizer with 30 yL of sterile water. Vortex briefly. Centrifuge briefly in microcentrifuge to return liquid to bottom of tube. Incubate at 95°C for 10 min. Repeat step 6. Extracts that appear to have a lot of suspended cellular debris and cuticle parts may be centrifuged longer to pellet that material. 9. Store refrigerated until use. May be frozen for long-term storage.
3.2. Preparation 1. 2. 3. 4.
of DNA from Larger
Insects
Place insect in sterile 1.5-mL microtube. Add 500 PL of CTAB buffer and homogenize (see Notes 3 and 4). Vortex to mix the fragments with the buffer. Incubate at 65°C for 45-60 min. Vortex again to mix the fragments with the buffer one or two times midway in the incubation.
Roehrdanz
384
5. Centrifuge m microfuge for 2 mm at maximum speed. 6. Remove the supernatant liquid to a new microfuge tube on ice, trying not to transfer the debris (a pipeter usually works better than decanting). If too much debris remains suspended, centrifuge for a longer time (step 5). 7. Add 200 pL CTAB to the pelleted debris and mix vigorously. 8. Incubate at 65OC for an additional 20-30 mm. 9. Centrifuge step 8 for 5 mm (more if needed) to pellet the debris. 10. Add the supernatant liquid from step 9 to that from step 6. 11. Add an equal volume (600-700 pL) of chloroformisoamyl alcohol (24: 1) to the combined liquid and mix well. (In most cases, satrsfactory results can be obtained using chloroform alone.) 12. Centrifuge in a microfuge for 10-15 min to facilitate clean separation of the layers. 13. Pipet off the aqueous (top) layer mto another microtube. (The total volume 1susually about 600 p,L.) Avoid transferring any chloroform or material at the interface. 14 Add 2/3 vol (-400 uL) of cold isopropanol and mix gently 15. Place at 4°C for at least 30 mm. It may be left overnight at this temperature. 16. Centrifuge for 1 h in a micromge at 4°C maximum speed. 17. Carefully remove the supernatant and wash the pellet m -700 pL cold 70% ethanol (equal volume to the amount of CTAB buffer used). Hand vortex until the pellet comes free and is suspended. 18. Centrifuge at 4°C for at least 20 min at maximum speed. 19. Carefully remove the supernatant and air dry the pellet. (The pellet can also be vacuum dried if equipment is available.) 20. Add 50 uL sterile water or TE buffer to pellet and let it resuspend overnight (see Note 5). 21. Store at 4OCwhile working with it or for long-term storage, place ma freezer.
3.3. PCR Reaction
Setup
1. PCR reactions were carried out m 50-uL reaction volumes m sterile 0.5-mL PCR mtcrotubes. The amount of ptpeting and attendant errors or risk of contamination is greatly reduced by making a larger batch of the reaction mix minus the template or primer (or both if both are varying frequently) and ahquoting it to the individual PCR reactton tubes. Pipeting of components should be performed using pipet tips with filters to reduce the possibility of aerosol contamination by extraneous DNA m the pipet cylinder. As m all PCR-related operations, gloves should always be worn and care should be taken to avoid contammation of all extracts, components, and products. A number of different factors can influence the final
RAPD-PCR
with Parasitic
Hymenoptera
product of RAPD reactions (7,8), therefore consistency and reproducibility of results is essential. 2 One 5OqL reactton mix consists of: 5 PL of 1OX PCR buffer, 6 uL 25 mM MgC12 (3 mMfina1 concentration) (see Note 6), 1 pL each of dATP, dCTP, dTTP, dGTP from 10 mM stock (final concentration 200 @4), 0.5 uL Tuq polymerase (2.5 U), 35 uL sterile deionized water, 0.5-1.0 uL (= 0.0750.15 pg) of primer (see Note 7), 0.5-5.0 uL template (DNA extract) (see Note 8). 3. Include a negative control (i.e., all components except template DNA) for each primer m a PCR run. If extracts of infected hosts are to be used to detect the parasite, it is also important to do the appropriate controls with uninfected hosts to ensure that host generated bands are not confused with those from the parasite. 4 Overlay each reaction with one drop of mineral 011.
3.4. Thermal Amplifications
Cycler Program
are carried out in a programmable
thermal cycler.
1. 92°C for 30 s. 2. 35°C for I mm.
3. 5-Min ramp to 72°C (see Note 9). 4. 72OC for 2 min. 5. Cycle steps l-4, 45 times. 6. 72°C for 7 min. 7. Hold at 5°C unttl samples are retrieved.
3.5. Examination
of Products
of PCR Reaction
1. 10 yL of PCR product 1s electrophoresed on a 1.5% agarose gel in 0.51.0X TBE at 40-50 V for about 6 h. Typical gels are l&20 cm long. If the bands are not too close together and reproducibly strong for a particular primer, 0.8-l .O% agarose mmigels can also be used. 2. Bands are visualized by staining with ethidium bromide. Adding 5 uL of a 10 mg/mL stock solution to 1 L of running buffer permits monitoring the progress of the run. 3. Methods for analyzing banding pattern data for RAPD are presented in Chapter 4 in this volume. 4. Notes 1. When sampling very small or immature insects, it is not always easy to determine the sex of an individual. Therefore, some apparent species or population specific bands could be sex-specific bands instead. Hymenoptera males are haplotd, arising from unferttlized eggs. This factor ehmt-
Roehrdanz
386
1
2
3
4
5
6
7
6 910111213141516
Fig 1. Male and female Diaeretiella rapae comparedwith different primers. Lanes l-4 = primer OPC-13; lanes 5-8 = primer OPC-14; lanes 9-12 = primer OPC-1.5;lanes 13-l 6 = primer OPC-16. Each set of four lanes consists of two females followed by two males. Primers produced by Operon Technologies. nates the primary source of sex-specific DNA, sex chromosome dimorphism. Four individuals (two male, two female, Diaeretiaella rapae) were tested with 19 different 10-mer primers. Some individual variation was noted but no sex-specific bands were observed (Fig. 1). As expected, sex-specific bands should not be major contributors to banding patterns. Vigilance is warranted, however, because apparent male-specific and female-specific RAPD bands have been observed from Microplitis croceipes (Roehrdanz and Steiner, unpublished). The origin of RAPDs recovered from haploid males but not found in the diploid females is the object of speculation. 2. The best material for obtaining RAPDs is either live or fresh-frozen. The frozen insects are thawed at the time of homogenization. Repeated freeze-thaw cycles should be avoided. There are numerous literature reports of preserved or ancient DNA being used as template for specific PCR amplification and sequencing. Since DNA degradesover time, the size of the specific amplified fragments is often limited to 100-300 bp. Many RAPDs from intact DNA are much larger than 300 bp. A comparison of RAPD bands from Lepidoptera that were frozen vs preserved in 70% isopropanol for 1 mo revealed that bands in the 200-600 bp range
RAPD-PCR
with Parasitic
Hymenoptera
387
were virtually identical, but the alcohol preserved samples were missing strong bands 600-1500 bp in length. The alcohol preserved samples also produced new bands ~200 bp in length (unpublished observation). Use of preserved specimens should be attempted only with great caution and adequate controls to ensure that the presence or absence of bands is not an artifact of the mode of preservation or the age of the preserved samples. 3. Parasitic Hymenoptera can vary in length from less than 0.2 mm to 5 cm. Therefore, two different DNA extraction procedures are included. The TIK protocol volumes can be scaled up or down by a factor of two or more to accommodate a size range of insects. Its advantage is its simplicity. The CTAB protocol (modified from refs. 9 and 10) can be effectively used with insects approx 7 mm long or larger (11). Other methods of DNA preparation have been used to obtain RAPDs from Hymenoptera (5) and it is likely that many procedural variants that produce DNA suitable for specific PCR would also work for RAPDs (see Chapter 2). 4. Homogenizers that fit a 1.5-mL microfuge tube are available commercially in Teflon-coated steelor “disposable” plastic. The Teflon ones require careful cleaning and an acid wash (HCl) between extracts.The plastic homogenizers can be autoclaved repeatedly and are inexpensive enough to allow use of a fresh homogenizer for each insect. Wooden toothpicks can be autoclaved and used for small msects and in smaller microfuge tubes. Then disadvantage is a tendency to soak up buffer that can be a noticeable fraction of the 30 yL homogenization volume. Plastic toothpicks that can be autoclaved without melting or sterilized in some other fashion would be suitable. Homemade homogenizers can be fabricated by pouring a small amount of liquid plastic or epoxy (such as those used to prepare tissue blocks for electron microscopy) mto the appropriate size microtube, mserting a small stick or metal rod, letting it harden, and cutting away the tube. 5. Normally, the CTAB extract at this point can be used directly in PCR reactions. However, sometimes it may be beneficial to remove the RNA from the suspension. This may be done by incubating the sample with RNase, increasing the volume to at least 200 pL, extracting with phenol/chloroform, precipitating with ammonium acetate and ethanol, and resuspending in about 50 pL volume. 6. It is well-known that the concentration of magnesium chloride can affect PCR reactions. The optimal concentration depends in part on the primer sequence and can be different for each primer template combination, In a survey experiment, it may not be practical to find the optimal concentration for each primer and extract. The concentration described here is an empirical average determined by varying the MgCl* concentration for several primers, using extracts of Aphidiidae species (6). Figure 2 shows
388
Roehrdanz
1
2
3
4
5
6
7
8
910111213
Fig 2. Individual Diaeretiellu v-apaeextract amplified with different primers and varying magnesium concentrations. Lanes l-4, primer OPC-12. Lanes 5-8, primer OPC-09. Lanes 9-12, primer OPC-20. Lane 13,l kb marker ladder. Lanes 1, 5, and 9 used 0.5 uL of template extract; all other lanes used 1.OpL. Amount of 25 mMMgC12 addedto 50-pL reaction volumes: Lanes 1,2,5,6,9, 10 = 4 pL; lanes 3,7, 11 = 8 pL; lanes4,8, 12 = 12 pL. Primers were obtained from Operon Technologies. the effect with three different primers and demonstratesthat not all primers exhibit the same sensitivity. Therefore, the concentration stated here should serve as a guide and not an absolute. 7. The efficiency of DNA extractions, especially with the very small insects, can be inconsistent. Template samplesthat fail to yield RAPD patterns or produce smearedor faint patternswhen using -1 pL per reaction should be titrated using both greater and lesser amounts of template per reaction. Some extracts will remain unsatisfactory and cannot be used. 8. Ten-base oligonucleotide primers can be synthesized or purchased commercially. The amount of primer used here (0.075-o. 15 pg) is about 10 times that suggestedby a major commercial supplier in the United States (Operon Technologies, Alameda, CA). The higher concentration seemsto give more consistent results with insect material. The optimal concentration of primer that yields good quality reproducible bands may vary. The number of primers required dependson the goal of the experiment. A very small number of primers may be adequatefor identifying species-specific diagnostic patterns. Finding a RAPD marker that is tightly linked to a specific genetic trait might require testing hundreds of different primers.
RAPD-PCR
with Parasitic
Hymenoptera
389
1234567 Fig 3. Diaeretiella rapae individual extract amplified with primer OPC-20. Lanes l-3,35--72” ramp at maximum speed.Lanes 4-6,35-72” ramp extended to 5 min. Lane 7, kb ladder. Primer OPC-20 from Operon Technologies. 9. There is a divergence of opinion regarding the efficacy of using a slow ramp from the annealing temperature(35°C) to the extension temperature (72OC)as described here, vs making that transition as quickly as the thermal cycling machine will permit. Both approacheshave been used successfully (4--@. Figure 3 shows the results obtained by using the same primers and DNA extracts with and without the slow ramp. In this case, the slow ramp clearly produced more bands, i.e., more information from a single primer. The slow ramp doubles the total time for the PCR reaction, which could be a disadvantage in some situations. It is also possible to obtain too many bands in a pattern. When that happens,the bands are often weaker in intensity and poorly resolved on agarosegels. Other PCR program modifications said to improve the yield of RAPDs have been reported (12) and could be worth trying with parasitic Hymenoptera.
390
Roehrdanz
10. Mention of a trademark or proprietary product does not constitute a guarantee or warranty of the product by the US Dept. of Agriculture and does not imply its approval to the exclusion of other products that may also be suitable.
Acknowledgments Technical assistance provided by I. Brewer and C. Mueller. The author is grateful to W. Black IV, J. Gerst, P. Olson, R. Reiss, and W. Steiner for helpful comments. References 1. LaSalle, J. (1993) Parasitic Hymenoptera, biological control and biodlversity, in Hymenoptera and Eiodzverszty (LaSalle, J. and Gauld, I. D., eds.), CAB International, Wallinford, UK, pp. 197-2 15. 2. LaSalle, J. and Gauld, I. D. (1993) Hymenoptera.
their diversity, and their impact
on the diversity of other organisms, in Hymenoptera and Bzodzverszty (LaSalle, J. and Gauld, I. D., eds.), CAB International, Wallinford, UK, pp l-26. 3. Unruh, T. R. and Messing, R. H. (1993) Intraspecific blodlversity m Hymenoptera. lmplicatlons for conservation and biological control, m Hymenoptera and Bzodzversity (LaSalle, J. and Gauld, I. D., eds.), CAB International, Wallmford, UK, pp 27-52. 4 Black, W C , IV, DuTeau, N. M., Puterka, G. J., Nechols, J. R., and Pettonm, J. M. (1992) Use of random amplified polymorphic DNA polykerase chain reaction (RAPD-PCR) to detect DNA polymorphisms m aphids. Bull Entomol Res 82, 151-159 5. Landry, B. S., Dextraze, L., and Boivm, G. (1993) Random amplified polymorphic DNA markers for DNA fingerprinting and genetic variability assessment of minute parasite wasp species (Hymenoptera: Mymaridae and Trichogrammatidae) used in biological control programs of phytopahgous insects. Genome 36,580-587. 6 Roehrdanz, R. L., Reed, D. K., and Burton, R. L. (1993) Use of polymerase chain reaction (PCR) and arbitrary primers to distmguish laboratory raised colonies of parasitic hymenoptera. Biol. Cont 3, 199-206. 7. Black, W. C., IV (1993) PCR with arbitrary primers: approach with care. Insect Mel Bzoi. 2, l-6. 8. Ellsworth, D. L., Rittenhouse, K. D., and Honeycutt, R. L. (1993) Artifactual variation in randomly amplified polymorphic DNA banding patterns. Biotechnzques 14,2 142 17. 9. Boyce, T. M., Schick, M. E., and Aquadro, C. F. (1989) Mitochondrial DNA m the pine weevil: size, structure and heteroplasmy. Genetzcs 123,825-836. 10. Doyle, J. (199 1) DNA protocols for plants, in Molecular Techniques zn Taxonomy (Hewitt, G. M., Johnston, A. W. B., and Young, J. P. W., eds.), NATO Advanced Studies Institute, H57, Springer Verlag, Berlin, pp 329-355 11, Roehrdanz, R. L. and Flanders, R. V. (1993) Detection of DNA polymorphisms m predatory Coccinellids using polymerase chain reaction and arbitrary primers (RAPD-PCR). Entomophaga 38,47M9 1. 12. Yu, K., and Pauls, K. P (1992) Optimization of the PCR program for RAPD analysis. Nucleic Aczds Res 20,2606.
CHAPTER27 The Use of Selective Enrichment for the Isolation of Species-Specific DNA Probes for Insects Justin
P. Clapp
1. Introduction The identification of insects and other invertebrates is often extremely difficult if not impossible to achieve when attempted by traditional methods. There are several reasons why these difficulties are encountered. They may be owing to the presence of species complexes where individuals of several closely related species are morphologically indistinguishable. The species may be too small to identify easily without slide mounting or internal examination, thereby making identification extremely time consuming and labor intensive, or it may be that immature stages including eggs need to be identified. In this latter instance very few identification keys exist for juveniles and therefore often the only course is to attempt to rear the juvenile to the adult stage. Occasions also may arise where large numbers of individuals need to be screened, and, should difficulty in identification be experienced, the work may be rendered impracticable. In recent years the use of molecular methods for the identification of difficult species has begun to succeed where traditional methods have failed or been considered too cumbersome to attempt. Biochemical approaches used have included immunological methods and the electrophoretic analysis of allozymes but now the current and preferred molecule for a definitive species identification is DNA. The use of DNA has From.
Methods Nuclew
in Molecular Aad Methods
Wology, Edlted
Vol 50. Species Diagnostics Protocols PCR and Other by J P Clapp Humana Press Inc , Totowa, NJ
391
several significant advantages over other biochemical methods of identification. The base sequenceof DNA is the fundamental source of biological variation, therefore any detectable protein or morphological variation detected by conventional methods is likely to be represented by DNA sequencedifferences. As much of the eukaryotic genome is not expressed, an ability to utilize DNA for species identification is likely to reveal a vast and largely untappedsourceof biological variation that can be exploited for species determination. The majority of methods currently used for isolating species-specific DNA sequences involve the production and screening of genomic libraries Q-3). The techniques involved are well established but the process can be time consuming and labor Intensive: Genomic libraries are screened by colony hybridization using duplicate filters probed with homologous and heterologous whole genomic DNA to reveal species-specific fragments (& screening) ($5). Frequently, several thousand colonies have to be screened before a single species-specific fragment can be identified (6). This is particularly true of sibling species, where the level of DNA homology is very high. The method described in this chapter actively enriches for DNA sequences that are specific to one species or group (7). Variations of this technique have been used for the isolation of species-specific DNA sequences in prokaryotes @-IO), including Rhizobium (see Chapter 11) and in several eukaryotic systems to enrich for sequencesnot shared between cDNA libraries (II13) or deleted from particular human chromosomes (14). Straus and Ausubel (IS) used selective enrichment to isolate DNA that is absent in yeast deletion mutants and a similar genomic subtraction method has been used to isolate the missing regions of Arabidopsis deletion mutants (I 6). The technique of selective enrichment relies on homologous (and therefore unwanted) DNA sequences between species forming stable complexes and the removal of these sequences from the reaction. This requires the biotinylation of driver (the terms nontarget or subtracter are also used) DNA and the ligation of adapter molecules to target DNA. These adapter molecules act as primer sites for the amplification of the target DNA remaining at the end of the selective enrichment procedure. Driver and target DNAs are mixed and hybridized, allowing the formation of five classes of molecules: unannealed target sequences, reannealed target sequences, reannealed driver sequences, hybrid DNA complexes between the target and the driver species, and unannealed driver DNA. The latter three groups have at least one strand of the duplex
Isolation
of DNA Probes
393
biotinylated and can therefore be removed by incubation with streptavidin and phenol extraction, leaving only unbiotinylated (target) molecules in solution (I 7). Subtractive hybridization and streptavidm phenol extraction is repeated two more times. Thus, following the cycles of subtraction, only target-derived DNA remains in the reaction. Removal of the majority of complementary sequences leaves very little target DNA and this is amplified by the polymerase chain reaction (PCR). Subsequently, the amplified products of the enrichment are cloned by conventional methods and recombinant colonies selected. The inserted fragments being carried by these colonies are directly amplified by PCR and screened by dot-blotting and probing with genomic DNA. Species of the genus Drosophila were chosen as models for this approach owing to the accessibility of the sibling speciesD simulans and D. melanogaster. An ability to rapidly isolate DNA sequences that are specific within sibling species has important implications to research and diagnostics in medical parasitology and entomology. 2. Materials 2.1. DNA Extraction 2.1.1. Extraction from Small Numbers of Flies (18) 1. Liquid nitrogen. (Care should be exercised with this material.) 2. Glass or plastic centrifuge tubes (resistance to phenol is required). 3. Homogenization buffer: 60 mM NaCl, 10 mA4 Tris-HCl, pH 7.5, 10 mM EDTA, 0.15 mA4 spermine, 0.15 mM spermldine, 5% (w/v) sucrose, 0.1 mg/mL RNaseA, pH 7.5. 4. Lysis buffer: 50 mMEDTA, 100 rr&fTris-HCl, pH 7.5, 1% SDS (sodium dodecyl sulfate), 2 mg/mL proteinase K. 5. 65°C Water bath. 6. Sterile distilled or deionized water. 7. Phenol/chloroform (1: 1 [v/v]). This is toxic by inhalation and contact. In the case of skin contamination by phenol the area should be copiously bathed with glycerol or polyethylene glycol. 8. Chloroform/isoamyl alcohol (24: 1 [v/v]), 9. Absolute ethanol. 10. 3M sodium acetate. 11. 70% Ethanol. 12. TE buffer: 10 mM Trrs-HCl, pH 7.5, 1 mMEDTA. 13. Agarose andelectrophoresis equrpmentincludingaccessto a transilluminator. 14. Ethidium bromide. (Caution: This is a mutagen! Gloves should be worn at all times.)
394
1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16.
2.1.2. Nuclei Extraction Method for Larger Quantities of Material (19) Liquid nitrogen. (Care should be exercised with this material.) Centrifuge tubes capable of withstanding phenol. Muslin. Primary extraction buffer (PE buffer): 10 mA4 Tris-HCl, pH 7.4, 25 mM EDTA, 10 mMNaC1,0.5% Triton-X 100. Secondary extraction buffer (SE buffer): 10 mMTrn+HCl, pH 7.4,25 mM EDTA, 10 mMNaC1. Proteinase K. 5MNaCl. 10% SDS. 37°C Water bath. Centrifuge capable of taking 50-mL tubes. Phenol/chloroform (1: 1 [v/v]). This is toxic by inhalation and contact. In the case of skin contammation by phenol, the area should be bathed copiously with glycerol or polyethylene glycol. ChlorofornGsoamyl alcohol (24: 1 [v/v]). 3M Sodium acetate. Absolute ethanol. 70% Ethanol. TE buffer: 10 mM Tris-HCl, pH 7.5, 1 mMEDTA.
2.2. Preparation
of Driver
DNA
1. Approximately 30 pg DNA from the driver species. 2. Eppendorf tubes, 0.5- and 1.5-mL capacity. 3. Sonicatton buffer: 20 mM Tris-HCl, pH 8.0, 1 mM EDTA, 5 mA4 p-met-captoethanol. 4. Sonicator, such as Labsomc 2000 (Braun, Aylesbury, UK). 5. Benchtop centrifuge. 6. Absolute ethanol. 7. 3M Sodium acetate. 8. 70% Ethanol. 9. 0.1 mM EDTA, pH 8. 10. Agarose and electrophoresis equipment including accessto a transilluminator. 11. Ethidium bromide. (Caution: This is a mutagen! Gloves should be worn at all times.) 12. Photobiotin: Photoprobe biotin TM(Vector Laboratories, Burlmgame, CA) reconstituted according to the manufacturer’s mstructions. 13. UV sun lamp or mercury vapor lamp (Watkins and Doncaster, Hawkhurst, Kent, UK).
Isolation
395
of DNA Probes
14. 0.1 mMTris-HCl, pH 9.5. 15. Water-saturated butan-2-01. This is saturated simply by overlaymg the butanol with water and shaking vigorously. The water saturated butanol can then be taken off through the water overlay.
2.3. Preparation 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19.
of Target
DNA
2.0 pg of DNA from the target species. Absolute ethanol. 3M Sodium acetate. 70% Ethanol. TE buffer: 10 mA4 Tris-HCl, pH 7.5, 1 rnA&EDTA. Restriction enzyme Sau3AI. Buffer provided by the manufacturer. 37°C Water bath. Agarose and electrophoresis equipment includmg access to a transilluminator. Ethidium bromide. (Caution: This is a mutagen! Gloves should be worn at all times.) Phenol/chloroform/isoamyl alcohol (25:24: 1 [v/v/v]). Adapter molecules (see Note 1). In this case, two oligonucleotides 24 and 26 bp in length. Polynucleotide kinase 3’-phosphate free, supplied buffers (Boehringer Mannheim, Mannheim, Germany). 100 mMATP (see Note 2). 0.1 mA4EDTA T4 DNA ligase (buffers are normally supplied with the enzyme). Sterile distilled or deionized water. Paraffin oil (molecular biology grade). 15OCWater bath. Spin columns (see Note 3).
2.4. Subtractive
Hybridization
1. 0.5 pg Sau3AI restricted target DNA with ligated adapters. 2. 10 pg biotinylated and sonicated driver DNA. 3. Subtractive hybridization buffer 1 (SHBl): 50 mA4HEPES, 2 mM EDTA, 0.2% SDS, pH 7.6. 4. 5MNaCl. 5. Paraffin oil (molecular biology grade). 6. 65°C Water bath. 7. Subtractive hybridization buffer 2 (SHB2): 50 mMHEPES, 2 mM EDTA, 500 mMNaC1, pH 7.6. 8. Streptavidin (Life Technologies, Paisley, UK).
396 9. Phenol/chloroform/isoamyl alcohol (25:24: 1 [v/v/v]). 10. Chloroform/isoamyl alcohol (24: 1 [v/v]). 11. Spm columns (see Note 3).
2.5. PCB Amplification of Subtracted Products 1. Thermocycler for PCR. 2. Taq DNA polymerase: 10X buffer and MgClz supplted (Promega, Madison, WI). 3. Mixed nucleotide stock solution: 4 mMof each dATP, dTTP, dCTP, dGTP. 4. PCR primer: 24 bp oligonucleotide (same as that used to form the adapter, see Note 1). 5. Spm columns (see Note 3).
2.6. CZoning 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16.
17. 18. 19. 20. 2 1.
Restriction enzyme Sau3AI. 37°C Water bath. Spm columns (see Note 3). Plasmid vector, pUC 18 (see Note 4). Restriction enzyme BamHl (buffers are normally supplied with the enzyme). Sterile distilled water. TE buffer: 10 rml4 Tris-HCl, pH 7.5, 1 nnV EDTA. Agarose and electrophorests equipment including access to a transilluminator. Ethidmm bromide. (Caution: This is a mutagen! Gloves should be worn at all times.) Absolute ethanol. 3M Sodium acetate. 70% Ethanol. Luria Broth (LB): tryptone (10 g/L), yeast extract (5 g/L), NaCl(5 g/L). BufferRFl: 100rnA4KCl,50mMMnC12,30mMKacetate, lOmMCaC&, 15% glycerol (w/v), pH to 5.8 with glacial acetic acid and filter sterilize. Buffer RF2: 10 mMMOPS, 10mMKCl,75 mMCaC&, 15% glycerol (w/v). pH to 6.8 with NaOH and filter sterthze. Escherzchia co/i strain compatible with vector (e.g., JM83). Ice. Centrifuge capable of spinning 50 mL capacity tubes at 3200g. Dry ice/absolute ethanol bath or liquid nitrogen. SOB medium: 2% tryptone, 0.5% yeast extract, 10 mMNaCl,2.5 mM KCl. 2M Mg2+: 1M MgC12, 1M MgS04.
Isolation
of DNA Probes
397
22. 2M Glucose.
23. SOC medium: Add 10 uL of 2M Mg2+ and 10 pL glucose (20 mM) to 980 PL SOB immediately prior to use. 24. LB/X-Gal/IPTG/ampicillin agar plates. For 200 mL: 4 g agar, 1 g yeast extract, 2 g NaCI, 2 g tryptone, 0.004% X-gal (5-bromo-4-chloro-3-indoylp-o-galactopyranoside), 0.5 rnA4 IPTG (Isopropyl P-o-thiogalactopyranoside), 100 pg/mL of ampicillin stock (50 mg/mL).
2.7. PCR Amplification of Recombinant Colonies 1. 2. 3. 4.
Thermocycler for PCR. Tuq DNA polymerase. Buffer and MgC12 supplied (Promega). Mixed nucleotide stocksolution : 4 mMof each dATP, dTTP, dCTP, and dGTP. Forward and reverse PCR primers for pUCl8: ‘CACACAGGAAACAG CTATG and 5’TTGTAAAACGACGGCCAGT, respectively. 5. Bunsen burner. 6. Inoculation loop. 7. Spin columns (see Note 3).
2.8. Dot-BZotting 1. Dot-blotting manifold such as BioRad (Richmond, CA) mtcrofiltration apparatus. 2. Nylon membrane, i.e., Hybond-N+ (Amersham International, Arlington Heights, IL). 3. TE buffer: 10 mA4 Tris-HCl, pH 7.5, 1 mM EDTA. 4. Vacuum source. 5. Denaturing solution: 1.5MNaCl,0.5MNaOH. 6. Neutralizing solution: 1.5M NaCl, 0.5M Tris-HCl, pH 7.2, 1 mM EDTA. 7. Saran wrapTMa 8. UV transilluminator.
2.9. Labeling of Probes 2.9.1. Radiolabeling and Filter Preparation 1. 2. 3. 4. 5. 6. 7. 8.
Geiger counter. Random primer labeling kit TM(Boehringer Mannheim). Radioisotope: 32Por 33P(Amersham). 37°C Water bath. Absolute ethanol. 3M Sodium acetate. 70% Ethanol. Liquid scintillation counter.
398 9. 6X SSC (20X stock: 3M NaCl, 3.33M Na citrate in 1 L sterile distilled water, pH 7). 10. Hybridization buffer: 1% BSA, 1mA4EDTA, 0.5A4NaH2P04,pH 7.2,7% SDS. 11. Hybridization oven. 12. Wash buffer 1: 2X SSC, 0.1% SDS. 13. Wash buffer 2: 0.1X SSC, 0.1% SDS. 14. Hyperfilm-MPTM (Amersham). 15. Film cassette. 16. Developer and fixer for autoradiography film (Kodak). 1. 2. 3. 4. 5. 6. 7.
2.9.2. ECL Labeling ECLTM Direct Nucleic Acid Labeling and Detection System (Amersham). Solid NaCl. Hybridization oven or water bath. 10% SDS stock. 20X SSC stock (see Section 2.9.1.) item 9). Primary wash buffer: 36 g urea, 4 mL 10% SDS, 0.5 mL 20X SSC. Make up to 100 mL with sterile distilled water. Secondary wash buffer: 0.5 mL 20X SSC. Make up to 100 mL with sterile distilled water.
3. Methods 3.1. DNA Extraction There are numerous successful methods for the isolation of DNA from insects. Several very well tested and reliable methods are given in Chapter 2.
1, 2. 3. 4. 5. 6.
3.1.1, Extraction of DNA from Small Numbers of Flies Precool a pestle and mortar with liquid nitrogen. Thoroughly grind flies to a fine powder (see Note 5). Quickly brush or scrape the frozen material mto a prechilled glass tube and add 5 mL of homogenization buffer. Resuspend the powdered insects and then add 5 mL of lysis buffer. Incubate the mixture at 65°C for 1 h with periodic agttation. Increase the volume to 20 mL with sterile distilled water. Add 1 vol of phenol/chloroform, gently invert the tube for several minutes then centrifuge at 3000g for 5 min to facilitate phase separation. Take off supernatant without disturbing the interface. Repeat two or three times (see Note 6).
Isolation
of DNA Probes
7. Add 1 vol of chloroform/isoamyl alcohol and gently invert as before. Centrifuge and remove final supernatant. 8. Add 2.5 vol of absolute ethanol and 0.1 vol of 3M sodium acetate. 9. Leave at 4°C for 30 min, then centrifuge at 13,OOOgfor 10 min. 10. Without disturbing the pelleted nucleic acid, carefully pour off the ethanol (see Note 7). 11. Add 50 pL 70% ethanol and incubate at room temperature for 5 mm. Pour off as before. 12. Allow the pellet to air dry for several minutes (the exact time is dependent on how much liquid is still present) (see Note 8). 13. Resuspend the pellet in 20-50 uL TE buffer. 14. Run an aliquot on an agarose gel to check that the DNA is high molecular weight. 15. Obtain an idea of quantity by spectrophotometric analysis or known h standards (see Note 9).
3.1.2. Nuclei Extraction
Method
1. Precool a pestle and mortar with liquid nitrogen. Thoroughly grind flies to a tine powder (see Note 5). 2. Quickly brush or scrape the frozen material into a prechilled polyallomer centrifuge tube. 3. Add 25 mL PE buffer and gently resuspend the powdered msects. 4. Filter the mixture through 10 layers of muslin (presoaked in PE buffer). Do not squeeze the sedimented remains. 5. Centrifuge the filtrate at 5OOOgfor 5 mm. Pour off the buffer and resuspend the pellet in fresh PE buffer. Repeat this step once more. 6. Finally resuspend the pellet in 10 mL of SE buffer. Add proteinase K to a concentration of 1 mg/mL and SDS to 1%. 7. Incubate the solution for 4 h at 37°C with gentle agitation. 8, Add 1 mL of 5M NaCl and then an equal volume of phenol/chloroform. Invert the tube gently for 15 min and centrifuge at 2000g to facthtate phase separation. 9. Transfer the aqueous phase (using a cutoff PlOOOGilson [Parts] tip) and re-extract with chloroform/isoamyl alcohol. 10. Ethanol precipitate the nucleic acids as described in Section 3.1.1.) steps8-l 2. 11. Resuspend the pellet of nucleic acid in 50-l 00 pL of TE buffer. 12. Run an aliquot on an agarose gel to check that the DNA is high molecular weight. 13. Obtain an idea of quantity by spectrophotometric analysis or known h standards (see Note 9).
400
Cb-w
3.2. Preparation
of Driver
DNA (see Note 10)
I. Ethanol precipitate (Section 3.1.1.) steps 8-12) 30 ug of driver DNA in a 1S-mL Eppendorf tube and resuspend the pellet in 800 uL of somcation buffer. 2. Once the DNA has resuspended, place on ice. Using the fine probe of the sonicator, expose the DNA to 35 kHz for 15 s. 3. Remove an aliquot of the sheared DNA and check for the efficacy of this step using agarose gel electrophoresls (0.8% gel). 4. Ethanol precipitate the sheared DNA and resuspend the pellet in 100 uL of 0.1 mM EDTA. 5. Divide the DNA between four 1.5~mLEppendorftubes and add 2 vol(50 uL) of reconstituted photoprobe biotm. Mix the contents and then embed in ice. 6. Angle the tube toward the light of the UV lamp and open the lids for 20 min at a distance of 10 cm from the light source. 7. Increase the volume to 500 p,L by the addition of 125 uL of 0.1 rmJ4 Tris-HCl (pH 9.5) and 250 p.L of water saturated butan-2-01. 8. Shake the tubes and centrifuge to facilitate phase separation. Remove and discard the upper phase (colored orange). Add a further 250 mL of water saturated butan-2-01 and repeat. 9. Ethanol precipitate the DNA m each tube resuspending the pellet m 25 JJL 0.1 mM EDTA. Add 2 vol of photobiotin and repeat the procedure from steps 6-8. 10. Finally, ethanol precipitate the btotmylated DNA but do not pour off the ethanol. Leave this over the pellet and store at -20°C until required (see Note 11).
3.3. Preparation 1.
2. 3. 4. 5.
of Target DNA
3.3.1. Preparation of Adapter Molecules Incubate 10 uL of the 26 mer oligonucleotide (500 ug/mL) with 2 uL 10X polynucleotide buffer and 20 U of the enzyme polynucleotide kinase 3’-phosphate free (Boehringer Mannheim), for 1 h at 37°C (seeNote 12) m a 0.5-mL Eppendorf tube. ATP should be added to a concentration of 25 nM prior to the mcubation. Increase the volume to 130 uL with 0.1 mM EDTA and extract with 1 vol of phenol/chloroform/isoamyl alcohol followed by a similar extraction with chloroform/isoamyl alcohol. Ethanol precipitate the oligonucleotrde as normal but add 10 ug of glycogen (molecular biology grade, Boehringer Mannheim) to increase the efficiency. Resuspend the pellet in 10 uL 0.1 mM EDTA and add 10 uL of the 24 mer primer (500 pg/mL). Mix the contents of the tube, boil for 2 min and allow to cool to room temperature in a 200-mL water bath.
Isolation
of DNA Probes
6. The adapter molecules thus prepared should be aliquoted and stored at -20°C until reqmred. 3.3.2. Preparation of Target DNA and Ligation of Adapter Molecules (see Note 13) 1. Combine 2 ltg of target DNA in TE buffer, with 4 U of the restriction enzyme Sau 3AI and 3 PL of 10X restriction buffer (supplied with the enzyme). Add sterile distilled water to a final volume of 30 lt.L (see Note 14). Incubate for 1 h at 37°C. 2. Confirm that restriction has gone to completion by agarose gel electrophoresis. 3. Ethanol precipitate the digested target DNA and resuspend m 0.1 mM EDTA at a concentration of 100 pg/mL. 4. Combine 1 pg of digested target DNA (10 pL) with 1 pg (2 l.tL) of adapter molecules. Add 2 pL of 1OX T4 DNA ligase buffer and 5 pL (5 U) of T4 DNA ligase. Make up to 20 PL with sterile distilled water. Overlay the ligation with paraffin oil and incubate at 15°C for 24-48 h (see Notes 15 and 16). 5. Unligated adapters after this period are removed by passagethrough a spm column such as Wizard PCR-Preps columns, following the instructions of the manufacturer. Other columns will work equally well. 3.4. Subtractive Hybridizai’ion 1. Combine 0.5 pg of target DNA plus adapters with 10 l.tg of biotinylated driver DNA. 2. Ethanol precipitate the combined DNAs and resuspend in 13.5 PL of buffer SHBl. When the DNA has fully resuspended, add 1.5 yL of 5M NaCl. Mix and overlay with paraffin oil. 3. Heat the combined DNAs to 95°C for two minutes and incubate at 65°C for 24-48 h. 4. Remove the aqueous phase from beneath the paraffin, add 85 mL of SHB2 and extract once with chloroform. 5. Add 5 l,tg of streptavidin (2.5 pg/mL) to the supernatant. Mix and spin briefly, then incubate at room temperature for 2 min. 6. Remove the double-stranded molecules that are complexed with streptavidin by extraction with 100 PL of phenol/chloroform/isoamyl alcohol. Separate the phases by centrifuging at top speed in a benchtop centrifuge for 10 min. 7. Remove the supernatant and repeat from step 5 two more times, then extract once with chloroform to remove any traces of phenol. 8. Add a further 10 pg of biotinylated driver DNA and repeat the procedure from step 2, two more times (see Note 17).
402 3.5. PCB Amplification End Products The end products of the enrichment are amplified using the following PCR reaction mix: 1. 5 pL 10X Taq buffer, 0.5 pL (2.5 U) Taq DNA polymerase, 6 pL (3 mM) MgC12, 5 pL of the mixed nucleotide stock solution, 1 nmol of the 24-mer primer and 1 PL of solution from the end of the subtractton (see Note 18). 2. Place the PCR tubes in the thermocycler and run the following program: denaturation, 98OCfor 30 s; anneal, 55OCfor 30 s; extension, 72°C for 3 mm for 29 cycles then: denaturation, 98°C for 30 s; anneal, 55OC for 30 s; extension, 72°C for 10 min for one cycle. 3. Clean the amplified products through spin columns (see Note 3). 3.6. Cloning of Subtracted Products
of Subtraction
3.6.1. Ligation into Vector 1. Restrict 1 pg the vector (pUC 18) with Barn H 1 (see Note 19) in a manner similar to that described in Section 3.3.2., step 1, but using only 2 U of enzyme. 2. Confum that the digestion has been successfulby agarosegel electrophoresis. 3. Remove the adapter molecules from the amplified products by a restriction digest with Sau3AI and pass through a spin column to remove the cleaved adapters and elute in 50 pL TE. 4. Ligate the amplified end products of subtraction into the cleaved vector m a similar manner as that described in Section 3.3.2., step 4. 5. Store putative recombinant plasmids for screening at -20°C. 3.6.2. Production of Competent Cells 1. Inoculate 100 mL of LB with E. coli and grow to midlog phase. 2. Chill the cells on ice for 10-15 min then transfer to 50 mL centrifuge tubes and centrifuge in a prechilled rotor at 3200g. 3. Remove the supematant and resuspend the cells in 33 mL of RF1 at 4°C. 4. Chill the cells on ice for a further 15 min and pellet cells as before. 5. Resuspend m 6 mL of RF2 at 4OC. 6. Chill on ice for a further 15 min then use immediately or flash freeze in 200~yL ahquots m a dry ice/ethanol bath and store at -7OOC(use within 1mo). 3.6.3. Transformation of Competent Cells
with Putative Recombinant Plasmids 1. Thaw a tube of competent cells on ice. 2. Add 0.5 pg of the putative recombined plasmids (20 pL or less) and mix thoroughly.
Isolation
of DNA Probes
3. Keep on ice for lo-60 min, then place in a 42°C water bath for 90 s. 4. Transfer to ice and add 800 pL of SOC media. 5. Incubate at 37°C for 30-60 min and spread 50-pL aliquots onto LB/X-Gal/ IPTG/ampicillm plates. 6. Incubate the plates overnight at 37°C (see Note 20).
3.7. PCR Amplification
of Cloned Products
1. Prepare a PCR mix as follows: 5 pL 10X Tag buffer, 0.5 pL (2.5 U) Tag DNA polymerase, 6 pL (3 mM) MgC12, 5 pL of the mixed nucleotide stock solution, 400 pmol of each primer, sufficient sterile water to make the final volume of 50 pL. Multiply these volumes by the number of PCR reactions to be carried out (forming a master mix). Aliquot this mix into the required number of PCR tubes. 2. Using a flamed sterile inoculating loop, take a small piece from a white colony. Twist the loop violently in the PCR tube to release the bacterial cells. Flame the loop, allow to cool, and repeat with the desired number of white colonies. Include a blue colony m this amplification (see Note 21). 3. Place the PCR tubes m the thermocycler and run the followmg program: denaturation, 98OCfor 20 s; anneal, 53’C for 30 s; extension, 72°C for 2 min for 24 cycles then: denaturation, 98’C for 20 s; anneal, 55’C for 30 s; extension, 72°C for 10 min for one cycle. 4. Run an ahquot of the PCR reactions on a 1% agarose gel to confirm that amplification has occurred. 5. Clean the amplified products through spin columns (see Note 3).
3.8. Dot-Blotting 1. Cut one piece of nylon membrane for each species in the experiment to the minimum size that will allow all the amplified products to be blotted. This will maximize probe concentration. Cut the top left-hand corner off the filter in order that the correct orientation is maintained. 2. Follow the manufacturer’s instructions to apply the amplified products to the membrane (see Note 22). Also spot 1 ng of genomic DNA from each species onto the membrane to act as controls. Once completed, allow the filter to air dry. 3. Immerse the filter in denaturing solution for 1 min, followed by a further minute in neutralizing solution, then allow to dry. 4. Wrap the filter in Saran wrapTM and place face down on a UV transilluminator for 3 min to facilitate binding of DNA by UV crosslmking.
404 3.9. Labeling of Probes 3.9.1. Radiolabeling and Filter Preparation 1. Take 1 ug of target DNA and 1 pg of (each) driver DNA and digest to completion with Suu3AI as described in Section 3.3.2., step 1. Confirm that the restriction has succeeded by agarose gel electrophoresis. Ethanol precipitate the restricted DNAs and resuspend in 30 PL TE. 2. Take 100 ng of each digested DNA and label with 32Por 33P(see Note 23), using the random primer method, followmg the mstructions provided with the kit. 3. Remove unincorporated nucleotides by ethanol precipitation (20). 4. Wash pellet in 70% ethanol as usual and resuspend in 100 PL TE. 5. Assessthe specific activity of the probe using a liquid scmtillation counter, followmg the instructtons applicable to the apparatus (see Note 24). 6. Soak the nylon filters containing the amplified end products in 6X SSC for 5 min and place in a hybridization tube or heat sealable plastic bag. Add enough hybridization buffer to cover the filter. Do not add too much as this will dilute the probe. 7. Premcubate the filters for about 5 h at 68”C, in order to block the membrane and reduce nonspecific background. 8. Boil the labeled probes for 5 min and add to each filter. Hybridize overnight at 65OC. 9. When the incubation is complete, carefully remove the membranes from the hybridization buffer. Wash for 1min in wash buffer 1 at room temperature, decant the wash buffer, and repeat for 15 min with agitation. 10. Carry out a further two washes at 37°C with agitation then wash the filters for 30 min at 68°C m wash buffer 2. 11. Wrap the filters in Saran wrapTM and tape into an autoradiography cassette, DNA side up. 12. Place a piece of preflashed (see Note 25) autoradiography film over the filters (under red light!!) and allow to expose for 2-3 h depending on the activity of the probe. It may be necessary to lay down a further film. 13. After this period place the film in developer for 6 min, briefly wash it in water, and fix for a further 6 min before the light is turned on and the results are seen (see Note 26). Then wash the film in water and allow to dry.
3.9.2. ECL Labeling and Filter Preparation 1. Take 1 pg of target DNA and 1 pg of (each) driver DNA and digest to completion with Suu3AI as described in Section 3.3.2., step 1. Confirm that the restriction has succeeded by agarose gel electrophoresis. Ethanol precipitate the restricted DNAs and resuspend in 30 pL TE.
Isolation
of DNA Probes
2. Take 50 ng of each probe DNA and label, following the instructions provided with the ECL kit. 3. Prehybridize the filters (prepared exactly as for radiolabeling) in the hybridization buffer supplied with the kit, for at least 1 h at 42°C (see Note 27). 4. Remove 400 uL of hybridization buffer from each filter and add to the respective labeled probe. Mix and add to the filter, avoiding direct application to the membrane. 5. Incubate with agitation overnight at 42OC. 6. Wash the filters in primary wash buffer at 42°C for 20 min with agitation. Repeat once. 7. Then wash with secondary wash buffer for 5 min with agitation at room temperature. Repeat once. 8. Follow the signal detection conditions indicated in the kit mstructions. Wrap the filters quickly in Saran wrapTM and expose to ECL film cut to the size of the filters. Several rapid exposures will be necessary to optimize the quality of the result (see Note 28). 9. Develop the film in the same manner as for autoradiography.
4. Notes 1. The adapter molecules used in this example of selective enrichment are the same as those used by Straus and Ausubel (25). Adapter molecules are composed of two oligonucleotides that are complementary in sequence, in this instance 5’GACACTCTCGAGACATCACCGTCC3’ and 5’GATCG GACGGTGATGTCTCGAGAGTG3’. They are designed such that there is an overhang on one end that is complementary to the termini generated by restriction of the target DNA. The other end is designed such that adapters cannot concatemerize. Although cloning vectors are available that allow the direct cloning of amplified products (it is a peculiarity of PCR in that all products generated have single A overhangs), it is often desirable to clone without the adapter sequencesin order to avoid possible nonspecific hybridization problems during screening. The overhang on the adapter must also be compatible with a cloning site in the chosen vector, The SauSAI recognition site is within that of BarnHI. 2. Dissolve 60 mg of ATP in 800 pL of sterile distilled water. Adjust the pH to 7 with NaOH and make up to 1 mL. The stock should then be aliquoted and stored at -70°C. 3. The spin columns used in this work were Wizard PCR-Preps columns (Promega). They provide a rapid means of removing unligated adapter molecules. However, any spin column capable of sorting DNA fragments smaller than 50 bp away from the sample should be adequate.
406 4. The cloning vector pUC 18 is used in this case, however, any blue/white vector system with a BamH 1 site in the polyclonmg site can be used. This system is of great use because any disruption of the gene for P-galactosidase, caused by an inserted fragment, will cause white colonies to grow that can easily be differentiated from blue colomes carrying no inserts. 5. It is useful to precool the pestle and mortar with liquid nitrogen when embedded in an ice bucket covered m tin foil. This helps to prevent the build up of frozen condensation on the outside of the pestle. 6. The number of phenol/chloroform extractions needed varies depending on the amount of protein present. As a general rule, extractions should continue until there is little or no residue at the interface after centrifugation. 7. It is easiest if the tube is first rotated such that the pellet is uppermost. The ethanol can then be poured off without disturbing the pellet. 8. Whereas any remammg ethanol wrll not affect subsequent manipulations of the DNA, because most involve incubation steps of various descriptions, 70% ethanol remaining in the sample can rum agarose gel loading. Ethanol is lighter than the TBE/TAE buffers used in electrophoresis and the sample can float straight out of the well. 9. Double-stranded DNA has an absorbency at 260 nm of 1when present at a concentration of 50 mg/mL. If accessto a spectrophotometer is not available, it is possible to serially dtlute known concentrations of h DNA and to run these alongside a sample. A direct estimation of DNA concentration can then be made by comparing the intensity of ethidium bromide stamed h DNA with the DNA from the extraction. 10. It should be possible to use more than one species of driver DNA in this protocol (see Chapter 11). 11. It is a good idea to confirm that biotmylation has been successful. This can be carried out usmg standard reagents for visualizing biotinylated probes (Boehrmger Mannheim). An aliquot of btotinylated DNA is spotted onto a nylon membrane and bound to the filter by exposing to a transilluminator for 3 min. 12. The removal of the phosphate from the oligonucleotide is carried out in order to prevent adapter concatemerization during the ligation reaction. 13. The optimal timing of the ligation of the adapter molecules is directly related to the desired level of complexity of the probe to be isolated. Ligation of adapter molecules before the start of an enrichment experiment ensures that all molecules are capable of being amplified by PCR, and this is particularly important if the probes to be isolated are to be composed of repetitive DNA. The alternative, ligation of adapters when the end products of the enrichment are available, favors the exception of repetitive sequences.This is because repetitive DNA tends to be distributed through-
Isolation
of DNA Probes
407
out a genome in varying amounts and in sequences of varying length. As such repetitive DNA wtll tend to reanneal so that the majority of double strands ~111be composed of different lengths with long single-stranded overhangs. The implication is that there would be very few molecules of a repetttive DNA origin capable of ligating to the Sau3AI termmi of the adapter molecules. 14. In order to obtain the DNA concentration to make a 30-pL reaction it may first be necessary to ethanol precipitate the target DNA resuspendmg it in a smaller volume of TE. 15. A minimum of lo-fold molar excess of adapter ends is required for this ligation (i.e., on average 250 ng of adapter for 1 ug of Sau3AI fragments), assuming an average fragment size of 2 kb. 16. It is advisable to confirm these stages by parallel control experiments. It is not possible to use actual template DNA as defined products cannot be visualized. I have used Sau3AI digested pUC 18 DNA in place of template as a control. It is then possible to confirm the correct functioning of enzymes such as Sau3AI and T4 DNA ligase In the first instance, a predictable restriction pattern should be seen. When adapters have been ligated successfully, the same pattern is seen but shifted to higher sizes owing to the addition of the adapter molecules at each end of the pUC fragments. These plasmid fragments can then be used to optimize the later PCR stages of the protocol. 17. It may be possible to carry out fewer rounds of enrichment but the number must be tailored to mdividual requirements. If lower copy number sequences are to be isolated, more cycles may be required. 18. The author does not mention the overlaying of paraffin oil here. This is because some machines have heated lids and therefore do not require it. However, if yours does not, then a paraffin oil overlay must be included. 19. It is not necessary to carry out this step if a “T-vector” system IS used. A quirk of PCR is that single A overhangs are produced on each amplified product. These can be exploited by the T-vector series. Here precleaved vectors with single T overhangs are able to ligate PCR products directly without any subsequent manipulations. 20. After 12-18 h incubation on these plates, blue and white colonies should appear. The white colonies will contain plasmids with inserted fragments of target DNA that have a high chance of species specificity and often are a little slower to appear. It 1spossible to treat the cleaved plasmids, prior to ligation of fragments with alkaline phosphatase. This will ensure that there is no religation of plasmid DNA without an insert, Although this can be useful, the presence of blue colonies acts like an internal positive control. Normally there will be upward of 80 white colonies after this step.
408 2 1, The mclusion of a blue colony is important. The site where the end products are cloned is within the polylinker site of the pUC 18 plasmid, the primer sites are outside it. Therefore, an amplified product should be seen even when there IS no insert. It 1suseful to know where this product IS on the gel when looking at true Inserts. 22. Ideally, dot-blots should satisfy the followmg conditions: a. Dot-blots should contam identical amounts of DNA. b. Probes used should be at the same concentration and have the same specific activity. c. Hybridization times and conditions should be identical. d. Washes should be carried out at the same level of stringency. e. Exposure time for autoradiography should be identical (even though autoradiography is not strictly quantitative). f. Evaluatron of relative intensities between blots should take place before saturation of the film, all other parameters being equal. 23, Radioisotopes are, of course, hazardous to handle. Appropriate trammg, protection, and knowledge of waste disposal practices should be acquired before use. [33P]has advantages over [32P]in that it has a longer half-life and lower beta emissions. It would also be advantageous to become familiar with the “10 Golden Rules” section of the Amersham International catalogue for handling and using radioisotopes. Do not order Isotopes from the supplier until you are almost ready to use them. This ensures that they are at their peak of activity. It is useful to know the weekly delivery dates for this purpose. 24. Probes with activity in the order of 4 x 1O7dpm should routinely be achieved. 25. Preflashmg increases the senstivity of the film by increasing the energy states of the silver ions such that a smgle strike with a radioactive particle will cause a visible (but microscopic) black spot. Placmg a cassette in a freezer helps by decreasing the speed that silver ions with increased energy levels, owing to strikes, decay before becoming permanent. For most purposes, if preflashing has been carried out, use of a freezer is not necessary. For a more scientific explanation, see ref. 22. 26. The results should be a series of dots. For a two species experiment one is looking for positive signals from subtraction products that appear only on the filter probed with target DNA. These will be htgh copy number targetspecific probes. It should also be noted that a number of products will not give a signal. This IS because they are derived from sequences with a copy number that is too low for sufficient probe hybridization to occur. It does not, however, mean that they are not species-specific sequences.Nonetheless, they will not be useful for species identification as their sensitivity ~111be too low. If they are used as probes themselves, against genomic DNA dot-blots, then specificity may become apparent.
Isolation
of DNA Probes
27. When preparing the hybridization buffer, tt 1s beneficial to increase the available stringency of the hybridization by reducing the salt concentration. The optimum concentration should be determined empirically. 28. It is frequently possible to see the dots of light coming from the filter with the naked eye. In such a case, the exposure time is extremely short. Care must be taken not to move the film over the filter as small adjustments m the posttioning can cause “creeping” positive signals and even signals m inappropriate parts of the filter. It 1simportant to maximize the strmgency of all stages as much as possible if one intends to screen the end products of subtraction with ECL. The author has found that target-specific fragments with no cross-hybrtdization under stringent condition with [32P]labeled probes, sometimes give signals from both driver and target with ECL. Higher stringency is possible with radiolabels than with ECL and this is presumably the cause of the cross-hybridization m this case. However, if the exposure time is kept low, an experienced ECL user should be able to detect to which blotted DNA the probe has the greatest degree of similarity by the fact that a signal tends to appear sooner at that dot. [32P] is on balance the method of choice for the initial stagesof screening and ECL for subsequent application of the isolated probes.
Acknowledgments The author thanks Rob Slater, Ray McKee, and John Hopley for their valuable help and discussion. The work was funded by the SERC.
References 1. Post,R. J. (1985) DNA probes for vector identification. Parasztol Today 1,89,90. 2. Jacobs-Lorena,M., Doman, M., and Mahowald, A. (1988) Identification of species-specificDNA sequencesin North American blackflies Trop Med Paraslt. 39,3 l-34 3. Booth, D. R., Mahon, R. J., and Sriprakash,K. S. (1991) DNA probes to identify membersof the Anopheles farauti complex.Med. Vet. Ent 5,447-454
4. Grunstein, M. and Hogness,D. S. (1975) Colony hybridisation: a method for the isolation of cloned DNAs that contain a specific gene Proc Nat1 Acad. Scr USA 72,3961-3965. 5. Hanahan, D. and Meselson,M. (1980) Plasmidscreeningat high colony density
Gene10,63-67. 6. Panyim, S., Yasothomsrikul, S., Tungpradubkul, S., Bairnal, V., Rosenberg,R., Andre, R G., andGreen C. A. (1988) Identification of isomorphic malaria vectors using a DNA probe Am J Trop Med Hyg 38,47-49. 7. Clapp, J. P. , McKee, R. A., Allen-Williams, L., Hopley, J. G., and Slater, R. J. Genomic subtractive hybridisation to isolate species-specificDNA sequencesin insects.Insect MOE Blol l(3), 133-138
8. BJourson, A. J , Stone, C. E., and Cooper, J. E. (1992) Combined subtractton hybridisatton and polymerase chain reaction amplification procedure for isolation of strain-specific Rhzzobzum DNA sequences. Appl Env. Microbzol. 57(7), 2296-2301. 9. McKee, R A., Gooding, C. M., Garrett, S. D., Powell, A A., Lund, B. M., and Knox, M. (199 1) DNA probes and the detection of food-borne pathogens using the polymerase cham reactton. Biochem Sot Trans. 19,698701. 10. Welcher, A. A , Torres, A. R , and Ward, D. C (1986) Selective enrtchment of specific DNA, cDNA and RNA sequences usmg biotmylated probes, avidin and copper-chelate agarose. Nucleic Aczds Res 14, 10,027-10,044 11 Duguid, J. R., Rohwer, R. G., and Seed, B. (1988) Isolation of cDNAs of scrapiemodulated RNAs by subtractive hybrtdisatton of a cDNA library. Proc. Natl. Acad Scz USA 85,5738-5742.
12. Duguid, J R. and Dinauer, M. C (1990) Library subtraction m zn vztro cDNA libraries to identify differentially expressed genes in scrapie infection. Nuclezc Aczds Res. l&2789-2792.
13. Lebeau, M-C., Alvarez-Bolado, G., Wahli, W., and Catstcas, S. (1991) PCR driven DNA-DNA competittve hybridisation a new method for sensmve differential cloning. Nucleic Acids Rex 19,4778 14. Kunkel, L M., Monaco, A. P., Middlesworth, W., Ochs, H. D., and Latt, S. A. (1985) Specific cloning of DNA fragments absent from the DNA of a male patient with an X chromosome deletion. Proc. Natl Acad Scz USA 82,4778-4782 15 Straus D. and Ausubel, F. M. ( 1990) Genomtc subtraction for cloning DNA corresponding to deletion mutations. Proc Natl. Acad. Scz. USA 87, 1889-l 893. 16 Sun, T , Goodman, H M., and Ausubel, F. M. (1992) Cloning the Arabidopszs GA1 locus by genomic subtraction Plant Cell 4, 199-228 17 Stve, H L. and St. John, T. (1988) A simple subtractive hybrtdtsation technique employmg photoactivatable biotin and phenol extraction. Nuclezc Aczds Res 16,10,937. 18. Henry, J. M., Rama, A. K , and Ridgeway, R. L. (1990) Isolation of htgh-molecular weight DNA from insects. Anal Bzochem 185, 147-150. 19. Ashburner, M (1989) Drosophda. A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 20. Cunningham, M. W , Harris, D. W , and Mundy, C. R. (1990) In vitro labelling, m Radzozsotopes zn Bzologv A Practzcal Approach (Slater, R. J., ed.), IRL, Oxford, UK, pp. 135-190. 21. Slater, R. J. (ed.) (1990) Radioisotopes zn Biology A Practical Approach, IRL, Oxford, UK.