Telomeres and Telomerase in Cancer

Telomeres and Telomerase in Cancer

Keiko Hiyama Editor

Telomeres and Telomerase in Cancer

Editor Keiko Hiyama Hiroshima University Dept. Translational Cancer Research 1-2-3 Kasumi Hiroshima Minami-Ku 734-8551 Japan [email protected]

ISBN 978-1-60327-306-0 e-ISBN 978-1-60327-879-9 DOI: 10.1007/978-1-60327-879-9 Library of Congress Control Number: 2008940944 # Humana Press, a part of Springer Science + Business Media, LLC 2009 All rights reserved. This work may not be translated or copied in whole or in part without the written permission of the publisher (Springer Science + Business Media, LLC, 233 Spring Street, New York, NY 10013, USA), except for brief excerpts in connection with reviews or scholarly analysis. Use in connection with any form of information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed is forbidden. The use in this publication of trade names, trademarks, service marks and similar terms, even if they are not identified as such, is not to be taken as an expression of opinion as to whether or not they are subject to proprietary rights. Cover design was arranged from a fluorescence in situ hibrydization (FISH) photo of a pancreatic tumor with intratumoral heterogeneity in telomere lenghts and an illustration provided by Dr. Y. Hashimoto, Dr. E. Hiyama, and Ms. Y. Hiyama. Printed on acid-free paper. springer.com

Preface

Telomerase, an enzyme that elongates telomeres and endows eukaryotic cells with immortality, was first discovered in Tetrahymena in 1985 and studied among basic scientists in the 1980s. In the 1990s, it was proven that this enzyme also plays a key role in the development of human cancers and many clinical researchers became involved in this field, and in the twenty-first century, telomeres and telomerase are becoming key factors in “stem cell” research including cancer stem cells, regenerative medicine, and congenital diseases with “stem cell dysfunction.” Since telomeres/telomerase biology on ciliates, yeasts, and model mice were studied ahead of humans by basic researchers, existing monographs on telomeres and telomerase have devoted much space to biology in such well-studied species, fundamentally important but somewhat different from humans. They are very informative but sometimes confusing for clinical doctors. Now clinical trials and molecular diagnosis targeting telomeres and telomerase in cancer have been started, and all medical oncologists and medical students are required to have knowledge of telomeres and telomerase biology in humans. So, this book focuses on the telomeres and telomerase in human cancers and may provide a basic understanding of up-todate topics of these unique and fascinating molecules. I have been enamored with the scientific mystery of telomeres and telomerase along with my husband Eiso since 1990, and been supported by Dr. Jerry W. Shay and my colleagues and friends, many of them kindly contributed to this book as chapter authors. Our study has been encouraged by the Radiation Effects Research Foundation, Hiroshima University Graduate School of Biomedical Sciences, and Hiroshima University 21st Century COE Program-Radiation Casualty Medical Research Center. I would like to express my sincere gratitude to all contributors in this book, Ms. Rachel R. Warren and Mr. Michael Taylor for editorial support, and Dr. Mieczyslaw A. Piatyszek and all my colleagues, friends, and staff for their valuable suggestions and assistance. This book is dedicated with gratitude to my family, for their love and encouragement. Hiroshima Japan

Keiko Hiyama

v

Contents

Part I: Basic Background 1

Telomeres and Telomerase in Humans . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3 Keiko Hiyama, Eiso Hiyama, and Jerry W. Shay

2

Telomere-Binding Proteins in Humans . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23 Nadya Dimitrova

3

Regulation of Telomerase Through Transcriptional and Posttranslational Mechanisms . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47 Amy N. Depcrynski, Patrick C. Sachs, Lynne W. Elmore, and Shawn E. Holt

4

Telomere Dysfunction and the DNA Damage Response . . . . . . . . . . . . . . . . . 87 Malissa C. Diehl, Lynne W. Elmore, and Shawn E. Holt

5

Alternative Lengthening of Telomeres in Human Cells . . . . . . . . . . . . . . . 127 Hilda A. Pickett and Roger R. Reddel

6

Mouse Model: Telomeres and Telomerase in Stem Cell and Cancer . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 149 Xin Huang and Zhenyu Ju

Part II: Telomeres and Telomerase in Human Cancers 7

Role of Telomeres and Telomerase in Cancer . . . . . . . . . . . . . . . . . . . . . . . . . . 171 Keiko Hiyama, Eiso Hiyama, Keiji Tanimoto, and Masahiko Nishiyama

8

Diagnostic Value I: Solid Tumors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 181 Eiso Hiyama and Keiko Hiyama

vii

viii

Contents

9

Diagnostic Value II: Hematopoietic Malignancies . . . . . . . . . . . . . . . . . . . . 211 Junko H. Ohyashiki and Kazuma Ohyashiki

10

Therapeutic Targets and Drugs I: Telomerase and Telomerase Inhibitors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 225 Brittney-Shea Herbert and Erin M. Goldblatt

11

Therapeutic Targets and Drugs II: G-Quadruplex and G-Quadruplex Inhibitors . . . . . . . . . . . . . . . . . . . . . . . . . 251 Chandanamali Punchihewa and Danzhou Yang

12

Therapeutic Targets and Drugs III: Tankyrase 1, Telomere-Binding Proteins, and Inhibitors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 281 Hiroyuki Seimiya and Takashi Tsuruo

13

Therapeutic Targets and Drugs IV: Telomerase-Specific Gene and Vector-Based Therapies for Human Cancer . . . . . . . . . . . . . . . . . . . . . 293 Toshiyoshi Fujiwara, Yasuo Urata, and Noriaki Tanaka

Part III: Experimental Protocols 14

Protocol I: Telomerase Activity and Telomerase Expression . . . . . . . . 315 Eiso Hiyama

15

Protocol II: Importance and Methods of Telomere G-Tail Length Quantification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 337 Akira Shimamoto, Eriko Aoki, Angie M. Sera, and Hidetoshi Tahara

16

Protocol III: Detection of Alternative Lengthening of Telomeres . . . 351 Wei-Qin Jiang, Jeremy D. Henson, Axel A. Neumann, and Roger R. Reddel

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 365

Contributors

Eriko Aoki Department of Cellular and Molecular Biology, Division of Integrated Medical Science, Program for Biomedical Research, Graduate School of Biomedical Sciences, Hiroshima University, Hiroshima, Japan Amy N. Depcrynski Department of Human Genetics, Medical College of Virginia at Virginia Commonwealth University, Richmond, VA, USA Malissa C. Diehl Department of Human Genetics, Medical College of Virginia at Virginia Commonwealth University, Richmond, VA, USA Nadya Dimitrova The Rockefeller University, New York, NY, USA Lynne W. Elmore Department of Pathology and Massey Cancer Center, Medical College of Virginia at Virginia Commonwealth University, Richmond, VA, USA Toshiyoshi Fujiwara Center for Gene and Cell Therapy, Okayama University Hospital, Okayama, Japan Division of Surgical Oncology, Department of Surgery, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama, Japan Erin M. Goldblatt Department of Medical and Molecular Genetics, Indiana University Melvin and Bren Simon Cancer Center, Indiana University School of Medicine, Indianapolis, IN, USA Jeremy D. Henson Children’s Medical Research Institute and University of Sydney, Sydney, NSW, Australia

ix

x

Contributors

Brittney-Shea Herbert Department of Medical and Molecular Genetics, Indiana University Melvin and Bren Simon Cancer Center, Indiana University School of Medicine, Indianapolis, IN, USA Eiso Hiyama Natural Science Center for Basic Research and Development, Hiroshima University, Hiroshima, Japan Keiko Hiyama Department of Translational Cancer Research, Research Institute for Radiation Biology and Medicine, Hiroshima University, Hiroshima, Japan Shawn E. Holt Department of Human Genetics, Department of Pathology, Department of Pharmacology and Toxicology, Massey Cancer Center, Medical College of Virginia at Virginia Commonwealth University, Richmond, VA, USA Xin Huang Institute of Laboratory Animal Sciences, Max Planck Partner Group Program on Stem Cell and Aging, Chinese Academy of Medical Sciences, Beijing, China Wei-Qin Jiang Children’s Medical Research Institute and University of Sydney, Sydney, NSW, Australia Zhenyu Ju Institute of Laboratory Animal Sciences, Max Planck Partner Group Program on Stem Cell and Aging, Chinese Academy of Medical Sciences, Beijing, China Axel A. Neumann Children’s Medical Research Institute and University of Sydney, Sydney, NSW, Australia Masahiko Nishiyama Saitama Medical University International Medical Center, Saitama, Japan Junko H. Ohyashiki Intractable Diseases Research Center, Tokyo Medical University, Tokyo, Japan Kazuma Ohyashiki First Department of Internal Medicine, Tokyo Medical University, Tokyo, Japan Hilda A. Pickett Children’s Medical Research Institute and University of Sydney, Sydney, NSW, Australia

Contributors

xi

Chandanamali Punchihewa College of Pharmacy, The University of Arizona, Tucson, AZ, USA Roger R. Reddel Children’s Medical Research Institute and University of Sydney, Sydney, NSW, Australia Patrick C. Sachs Department of Human Genetics, Medical College of Virginia at Virginia Commonwealth University, Richmond, VA, USA Hiroyuki Seimiya Division of Molecular Biotherapy, Cancer Chemotherapy Center, Japanese Foundation for Cancer Research, Tokyo, Japan Angie M. Sera Department of Cellular and Molecular Biology, Division of Integrated Medical Science, Program for Biomedical Research, Graduate School of Biomedical Sciences, Hiroshima University, Hiroshima, Japan Jerry W. Shay Department of Cell Biology, University of Texas Southwestern Medical Center at Dallas, Dallas, TX, USA Akira Shimamoto Department of Cellular and Molecular Biology, Division of Integrated Medical Science, Program for Biomedical Research, Graduate School of Biomedical Sciences, Hiroshima University, Hiroshima, Japan Hidetoshi Tahara Department of Cellular and Molecular Biology, Division of Integrated Medical Science, Program for Biomedical Research, Graduate School of Biomedical Sciences, Hiroshima University, Hiroshima, Japan Noriaki Tanaka Division of Surgical Oncology, Department of Surgery, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama, Japan Keiji Tanimoto Department of Translational Cancer Research, Research Institute for Radiation Biology and Medicine, Hiroshima University, Hiroshima, Japan Takashi Tsuruo Cancer Chemotherapy Center, Japanese Foundation for Cancer Research, Tokyo, Japan

xii

Yasuo Urata Oncolys BioPharma, Inc., Tokyo, Japan Danzhou Yang College of Pharmacy, The University of Arizona, Tucson, AZ, USA and Arizona Cancer Center, Tucson, AZ, USA and BIO5 Institute, The University of Arizona, Tucson, AZ, USA

Contributors

Chapter 1

Telomeres and Telomerase in Humans Keiko Hiyama, Eiso Hiyama, and Jerry W. Shay

Abstract Telomerase can compensate for telomere shortening and helps prevent cellular senescence in eukaryotic cells. In humans, only specific germline cells and the vast majority of cancer cells have sufficient activity for indefinite proliferation. Lymphocytes and stem/progenitor cells in self-renewal tissues have weak activity for extension of their lifespan, but they still undergo replicative senescence. In contrast, most somatic cells do not have telomerase activity and display a finite replicative lifespan. Heterozygous mutations in either of principal telomerase components, TERT or TERC, cause telomere dysfunction and unexpectedly early senescence to stem cells of renewal tissues. Thus, restoration of telomere function in regenerative medicine via telomerase expression and inhibition of telomerase as an anticancer strategy is a double-edged sword of telomeres and telomerase in clinical medicine. Keywords: Telomere, Telomerase, Germline cell, Cancer cell, Stem cell, Cellular immortalization, Telomere dysfunction, End-replication problem, Mortality stage, Hayflick limit, TERT, TERC.

1.1

Introduction

Somatic cells explanted into tissue culture do not divide indefinitely (1) because of lack or low levels of telomerase and by progressive telomere shortening each time a cell divides. In contrast, some cells, such as male germline cells, have a greatly extended capacity to divide because of expression of the ribonucleoprotein enzyme telomerase, the sole cellular enzyme that can elongates telomeres (Fig. 1.1). DNA sequences of human daughter cells are not completely identical with those of their parent cell: During DNA synthesis prior to cell division, both ends of each chromosome, ‘‘telomeres’’, are not replicated completely because of the ‘‘end-replication problem’’ (2, 3), oxidative damage, and other poorly defined end processing events. K. Hiyama(*) Department of Translational Cancer Research, Research Institute for Radiation Biology and Medicine, Hiroshima University, 1-2-3 Kasumi, Minami-ku, Hiroshima, 734-8551 Japan, e-mail: [email protected]

K. Hiyama (ed.), Telomeres and Telomerase in Cancer. DOI: 10.1007/978-1-60327-879-9_1, # Humana Press, a part of Springer Science + Business Media, LLC 2009 3

4

K. Hiyama et al.

Germline cell (telomerase ++)

Somatic cell (telomerase − / + ) senescence apoptosis

Immortal cancer cells (telomerase activation or ALT)

Fig. 1.1 Telomere, telomerase, and cellular lifespan. Telomerase, or much less commonly alternative lengthening telomeres (ALT) mechanism, can compensate telomere shortening and prevent cellular senescence

This progressive telomere shortening is the cellular fate of eukaryotes that have linear chromosomes. The research on telomeres and telomerase was started by a small group of basic researchers in the 1980s, but many clinical researchers and pathologists came in this field after development of the telomerase detection ‘‘TRAP’’ assay in 1994, which enabled scientists to detect telomerase activity in clinical materials. Now we are in the era when the biology of telomeres and telomerase are required knowledge for clinicians, especially for medical oncologists. To encourage newcomers in the field who are not familiar with the milestone discoveries on telomeres and telomerase, we list them in Table 1.1, especially focusing on human research. In addition, we provide a brief overview of some of the key historical findings. We apologize for any major contributions omitted from this table.

1.2

Telomere Structure

Both ends of all chromosomes, ‘‘telomeres’’, end with G-rich repeats in 50 –30 strand in every eukaryotes (4, 8, 10). Every vertebrate has (TTAGGG)n repeats, while other species have different G-rich sequences, e.g., Tetrahymena has (TTGGGG)n and Schizosaccharomyces pombe has GGTTAC(A)(C)(G0-6). In humans, (TTAGGG)n repeats are about 15–20 kb in length at birth and about 810 kb in adults, but the length varies among individuals, organs, cells, and even among chromosomes. The extreme end of each telomere is not blunt (Chap. 15): the 30 single-strand overhang is about 200 nucleotides and loops back with some of the double-stranded telomeric DNA to make a telomere loop called ‘‘T loop’’ (66), so

1 Telomeres and Telomerase in Humans

5

Table 1.1 Milestones of telomeres and telomerase research focusing on human 1961.12. Hayflick L and Moorhead PS (1) proposed a limitation of replicative lifespan of human diploid cells 1971.12. Olovnikov AM (2); 1972.10. Watson JD (3) proposed ‘‘End-replication problem’’ hypothesis 1978.3. Blackburn EH and Gall JG (4) identified telomeric repeats in Tetrahymena 1981.5. Klobutcher LA et al. (5) found 30 single-stranded overhang of the G-rich strand in ciliates 1984.2. Ide T et al. (6) showed lifespan elongation by SV40 mediated transformation in normal human diploid cells 1985.12. Greider C and Blackburn EH (7) identified telomerase activity in Tetrahymena 1986. Cooke HJ and Smith BA (8) showed longer telomeres in germ cells than in somatic cells 1988.8. Pereira-Smith OM and Smith JR (9) proposed 4 genes that regulate cellular immortalization of human cells 1988.9. Moyzis RK et al. (10) determined human telomeric repeat sequences as ‘‘TTAGGG’’ 1989.1. Greider C and Blackburn EH (11) cloned telomerase RNA component in Tetrahymena 1989.6. Allshire RC et al. (12) identified 3 types of repeat at subtelomeres and found TTAGGG repeats longer in sperm than in blood 1989.7. Wright WE et al. (13) proposed ‘‘two-stage model’’ for the escape from human cellular senescence 1989.11. Morin GB (14) identified telomerase activity in human cells (HeLa) 1990.2. de Lange T et al. (15) demonstrated structure of human chromosome ends and telomere shortening in tumors 1990.5. Harley CB et al. (16) demonstrated shortening of telomeres during ageing in cultured human fibroblasts 1990.8. Hastie ND et al. (17) found shortening of telomeres in colorectal cancers and with aging 1991.4. Zahler AM et al. (18) found that telomeric G-quartet structure is a negative regulator of elongation by telomerase in Oxytricha 1991.11. Harley CB (19) proposed ‘‘Telomere hypothesis’’ as mitotic clock 1992.2. Hiyama E et al. (20) proposed clinical association of telomere length in neuroblastoma 1992.5. Counter CM et al. (21) demonstrated experimental evidence of ‘‘Telomere hypothesis’’ 1994.7. Shirotani Y et al. (22) proposed clinical association of telomere length in lung cancer 1994.12. Kim NW et al. (23) developed ‘‘TRAP assay’’ and demonstrated telomerase activity in all cancer cell lines and 90% of cancerous tissues examined as well as the first evidence for the alternative lengthening of telomeres (ALT) pathway 1995.3. Hiyama E et al. (24) proposed association of telomerase activity with pathogenesis and prognosis of neuroblastoma 1995.3. Piatyszek MA et al. (25) showed telomerase activity in peripheral blood mononuclear cells 1995. 5. Counter CM et al. (26) showed upregulation of telomerase activity in leukemia cells 1995.6. Hiyama K et al. (27) proposed a clonal selection model of telomerase positive cancer cells in lung cancer development 1995.6. Collins K et al. (28) cloned telomerase protein components ‘‘p80’’ and ‘‘p95’’ in Tetrahymena 1995.6. Chadeneau C et al. (29) found telomerase activity in colorectal carcinoma but not in adenomatous polyps 1995.7. Tahara H et al. (30) showed telomerase activity in hepatitis and cirrhotic tissues in addition to hepatocellular carcinomas 1995.8. Hiyama E et al. (31) found associations of telomerase activity with stage, prognosis, telomere length alteration, and aneuploidy in gastric cancer 1995.9. Bryan TM et al. (32) identified alternative lengthening of telomeres (ALT) in human cultured immortal cells (continued)

6

K. Hiyama et al.

Table 1.1 (continued) 1995. 9. Feng J et al. (33) cloned human telomerase RNA component’’TERC (hTR)’’ 1995. 9. Lingner J et al. (34) proposed ‘‘leading strand problem’’ instead of ‘‘ragging strand problem’’ as ‘‘end-replication problem’’ 1995.10. Ohmura H et al. (35); 1998.10. Tanaka H, et al. (36) proposed existence of telomerase repressor gene in human chromosome 3 1995.10. Hiyama K et al. (37) identified activation of telomerase upon proliferation in normal human lymphocytes and hematopoietic progenitor cells 1995.11. Langford LA et al. (38) found telomerase activity in a distinct subgroup of brain tumors and reported telomerase correlated with the stage of disease 1995.12. Sharma HW et al. (39) showed downregulation of telomerase activity upon differentiation of immortal leukemia cells 1995.12. Chong L et al. (40) cloned human telomere binding protein ‘‘hTRF1’’ 1996.1. Hiyama E et al. (41) proposed a diagnostic usefulness of detecting telomerase activity in cytologic specimens of breast cancer 1996.1. Holt SE et al. (42) found that telomerase is active throughout the cell cycle but repressed in G0 1996.4. Taylor RS et al. (43) detected telomerase activity in normal epidermis and inflammatory skin lesions 1996.9. Hiyama E et al. (44) detected telomerase activity in normal human intestinal crypts 1996.10. Bodnar AG et al. (45) found that increase in telomerase activity during T cell activation is transient and does not prevent telomere shortening in long-term culture 1996.11. Tatematsu K et al. (46) developed ‘‘Stretch PCR’’ for quantitative evaluation of telomerase activity 1997.2. Kyo S et al. (47) detected telomerase activity in human proliferative-phase endometrium 1997.2. Harrington L et al. (48) cloned human telomerase-associated protein ‘‘hTEP1 (TP1)’’ 1997.2. van Steensel B and de Lange T (49) identified control of telomere length by TRF1 1997.4. Sun D et al. (50) demonstrated inhibition of human telomerase by a synthetic G-quadruplex interactive compound. 1997.6. Ohyashiki K et al. (51) developed ‘‘in situ TRAP assay’’ 1997.8. Nakamura TM et al. (52); 1997.8. Meyerson M et al. (53) cloned human telomerase reverse transcriptase ‘‘hTERT (hEST2)’’ 1997.10. Blasco MA et al. (54) developed mTR/ mice and found viable up to 6th generation 1997.10. Broccoli D et al. (55); 1997.10. Bilaud T et al. (56) cloned telomere binding protein ‘‘hTRF2’’ 1997.12. Weinrich SL et al. (57) showed reconstitution of in vitro telomerase activity only by TERC (hTR) and TERT (hTRT) 1997.11. Bryan TM et al. (58) identified alternative lengthening of telomeres (ALT) in human tumors (1771) 1998.1. Bodnar AG et al. (59) showed extension of cellular life-span by expression of hTERT in normal human cells 1998.2. van Steensel B et al. (60) identified protection of human telomere end-to-end fusion by TRF2 1998.4. Lee HW et al. (61) found telomere dysfunction in highly proliferative organs in lategeneration mTR‐/‐ mice 1998.9. Ulaner GA et al. (62) found alternate splicing of hTERT 1999.1. Cong YS et al. (63); 1991.2. Takakura M et al. (64) cloned and characterized hTERT promoter region 1999.1. Morales CP et al. (65) showed immortalization without malignant transformation of normal human fibroblasts by expression of hTERT (continued)

1 Telomeres and Telomerase in Humans

7

Table 1.1 (continued) 1999.5. Griffith JD et al. (66) found that mammalian telomeres end in a large duplex loop, ‘‘T-loop’’ 1999.7. Hahn WC et al. (67) created human tumor cells with defined genetic elements: TERT, SV40 large-T, and oncogenic H-ras 1999.9. Yeager TR et al. (68) found a novel type of PML body in ALT cells. 1999.10. Hahn WC et al. (69) showed that dominant negative form of hTERT inhibits telomerase activity and tumorigenicity of immortal cancer cells 1999.12. Kim SH et al. (70) identified TIN2 as a new regulator of telomere length. 1999.12. Herbert B et al. (71) showed that PNA and 20 -O-MeRNA oligomers reversibly inhibit telomerase activity and induce telomere shortening 1999.12. Mitchell JR et al. (72) found dysfunction of telomerase in X-linked dyskeratosis congenita with mutations in dyskerin 2000.1. Thomas M et al. (73) demonstrated elongation of bovine adrenocortical cell function with hTERT expression in experimental xenotransplantation 2000.10. Hooijberg E et al. (74) established immortal CD8 + T cell clones by hTERT expression 2000.12. Dunham MA et al. (75) demonstrated that ALT occurs by means of homologous recombination and copy switching 2001.2. Shin-ya K et al. (76); 2002. 3. Kim MY et al. (77) demonstrated the effects of telomestatin as a telomerase inhibitor 2001.6. Baur JA et al. (78) demonstrated telomere position effect in human cells 2001.7. Hemann MT et al. (79) found that telomere dysfunction is recognized at the onset of meiosis and triggers germ cell apoptosis in mice 2001.9. Vulliamy T et al. (80) found mutations in hTR in autosomal dominant DKC 2002.6. Vulliamy T et al. (81) found mutations in hTR in aplastic anemia 2002.7. Yatabe N et al. (82) demonstrated the effects of 2–5A antisense therapy directed against hTR in cervical cancer cells 2002.7. Seimiya H et al. (83) demonstrated the effects of telomerase inhibitors MST-312, -295, and -1991 in human cancer cells 2002.10. Stewart SA et al. (84) demonstrated that telomerase contributes to tumorigenesis by a telomere length-independent mechanism 2002.11. Seger YR et al. (85) transformed a normal human cell by adenovirus E1A, Ha-RasV12, and MDM2 expression without telomerase activation 2003.3. Hakin-Smith V et al. (86) found that ALT phenotype is a good prognosis indicator in glioblastoma multiform 2003.4. Zhang A et al. (87) found deletion of hTERT and haploinsufficiency of telomere maintenance in Cri du chat syndrome 2003.4. Stewart SA et al. (88) proposed that erosion of single-strand telomeric overhang, rather than overall telomere length, serves to trigger replicative senescence 2003.4. Ulaner GA et al. (89) found that telomerase activation and ALT are comparably poor prognosis indicators in osteosarcoma 2003.5. Colqin LM et al. (90) proposed that human POT1 protein can act as a telomerasedependent positive regulator of telomere length 2003.6. Loayza D and de Lange T (91) proposed that POT1 interacts with TRF1 complex and transmits information of telomere length to the telomere terminus 2003.6. Lin SY et al. (92) proposed 3 tumor suppressor pathways involved in hTERT repression: Mad1/c-Myc, SIP1, and Menin 2003.7. Masutomi K et al. (93) proposed that hTERT is expressed even in normal human somatic cells maintaining telomere structure such as 30 single-stranded overhang 2003.7. Asai A et al. (94) developed a telomerase template antagonist GRN163 and demonstrated its anticancer effects in vitro and in xenograft model (continued)

8

K. Hiyama et al.

Table 1.1 (continued) 2003.8. Tauchi T et al. (95) demonstrated effects of G-quadruplex-interactive telomerase inhibitor telomestatin (SOT-095) in leukemia cells 2004.2. der-Sarkissian H et al. (96) proposed that the chromosomes with shortest telomeres are the first to become unstable in telomerase-negative-transformed cells 2004.5. Preto A et al. (97) demonstrated that telomere erosion triggers growth arrest in thyroid cancer cells with wild p53 while it cause crisis by abrogation of p53 2005.1. Seimiya H et al. (98) demonstrated that tankyrase 1 inhibition enhances telomere shortening by telomerase inhibitor 2005.4. Fasching CL et al. (99); Marciniak RA et al. (100); 2005.11. Cerone MA, et al. (101) proposed that ALT-associated promyelocytic leukemia bodies (APBs) are not always essential for ALT-mediated telomere maintenance 2005.5. Yamaguchi H et al. (102) found mutations in TERT in aplastic anemia 2005.6. Sun B et al. (103) demonstrated a minimal set of genetic alterations required for fibroblast transformation 2005.7. Nakamura M et al. (104) demonstrated that hTERT KO by siRNAs sensitizes cervical cancer cells to ionizing radiation and chemotherapy 2005.8. Herbert BS et al. (105) demonstrated a superiority of lipid modification of GRN163 (GRN163L) in telomerase inhibition 2005.8. Zaug AJ et al. (106) found that human POT1 disrupts telomeric G-quadruplexes allowing telomerase extension 2005.8. Flores I et al. (107) found that mobilization of stem cells out of their niche was inhibited by telomere shortening and promoted by Tert overexpression in mice 2005.9. de Lange T (108) proposed a concept of ‘‘Shelterin’’ as telomere binding proteins consisting of TRF1, TRF2, POT1, TIN2, TPP1, and RAP1 2005.11. Djojosubroto MW et al. (109) demonstrated in vitro and in vivo effects of hTR antagonist GRN163 and GRN163L on hepatoma cells 2005.11. Armaninos M et al. (110); Goldman F et al. (111) demonstrated TERC haploinsufficiency on the inheritance of telomere length in autosomal dominant dyskeratosis congenital 2005.11. Verdun RE et al. (112) found that telomeres of telomerase-negative cells recruit Mre11, phosphorylated NBS1, and ATM in every G2 phase of the cell cycle 2005.12. Horikawa I et al. (113) found that a GC-box within the hTERT promoter is responsible for the human-specific TERT repression 2006.1. Anderson CJ et al. (114) found that hypoxia induces the transcriptional activity of both hTR and hTERT gene promoters and increase of active hTERT splice variant 2006.2. Compton SA et al. (115) found NOS-dependent telomere shortening and apoptosis of prostate cancer cells by inhibition of Hsp90 2006.2. Chai W et al. (116) demonstrated different overhang sizes at leading versus lagging strands of human telomeres 2006.3. Tahara H et al. (117) found that telomestatin induces loss of 30 telomeric overhang through TRF2 protein dissociation from telomeres in cancer cells 2006.3. Gellert GC et al. (118); 2006.5. Hochreiter AE et al. (119) demonstrated in vitro and in vivo effects of hTR antagonist GRN163L on breast cancer cells 2006.5. Trapp S et al. (120) demonstrated tumor-promoting effects of vTR in a chicken natural virus-host infection model 2006.5. Ambrus A et al. (121) proposed ‘‘mixed parallel/antiparallel G-strands’’ as intact telomeric G-quadruplex structure 2007.2. Xin H et al. (122); 2007.2. Wang F et al. (123) proposed POT1-TPP1 complex as a processivity factor for telomerase 2007.3. Cohen SB et al. (124) showed that human telomerase exists as a complex of two molecules each of hTERT, hTR, and dyskerin (continued)

1 Telomeres and Telomerase in Humans

9

Table 1.1 (continued) 2007.3. Armanios MY et al. (125); 2007.5. Tsakiri KD et al (126) identified mutations in TERT/ TERC and short telomeres as etiology of familial and/or adult-onset pulmonary fibrosis 2007.7. Jiang WO et al. (127) identified 8 candidate ALT genes as PML, TRF1, TRF2, TIN2, RAP1, MRE11, RAD50, and NBS1 2007.10. Xu L and Blackburn EH (128) proposed ‘‘T-stumps’’ in immortal cancer cells as the minimal telomeric unit that can be protected by telomere binding proteins 2007.11. Azzalin CM et al. (129); 2008. 2. Schoeftner S et al. (130) identified active transcription of human telomeres into ‘‘telomeric repeat-containing RNA (TERRA or TelRNAs)’’ that regulate telomerase activity 2007.11. Takahashi K et al. (131) found that human iPS cells derived from fibroblasts activated intrinsic telomerase 2008.3. Venteicher AS et al. (132) found that additional enzymes (ATPases pontin and reptin) are required for telomerase assembly 2008.3. Stadtfeld M et al. (133) demonstrated that activation of endogenous telomerase is one of late events during fibroblast reprogramming to iPS cells in mouse

that the chromosome end is distinguished from bona fide dsDNA breaks and protected from exposure to DNA repair system (Chap. 4).

1.3

Why do Telomeres Gradually Shortened?

Until the early 1960s, cultured normal human cells were believed to be able to replicate indefinitely as long as good culture conditions were maintained. In 1961, Hayflick reversed this concept and demonstrated convincingly that normal human cells have a limit in the number of possible cell divisions: lung fibroblast 55 times, heart 26, kidney 40, and skin 43 (1). So, this phenomenon of replicative senescence in normal cells is often called the ‘‘Hayflick limit’’. In 1971 and 1972, Olovnikov and Watson reported the mechanism of this limit in Russian and English, respectively, as an ‘‘end-replication problem’’. When they originally proposed this problem, ‘‘lagging (discontinuous) strand’’ was considered to be responsible for telomere shortening, because DNA polymerase replicates only in the 50 –30 direction, and requires an RNA primer in starting DNA replication and a complementary strand for replication. Then, after removal of the RNA primer, the 50 end of the lagging strand locates inside of the extreme 30 end of the complement strand, i.e., ‘‘lagging strand problem’’ (134). However, considering the structure of 30 telomere overhang at the end of telomeres, the ‘‘end-replication problem’’ mechanism was then proposed as a ‘‘leading strand problem’’, i.e., inability of leading strand DNA synthesis to produce the 30 overhang (Fig. 1.2), and then ‘‘lagging strand problem’’ may occur in the next round of replication (34). The ‘‘end-replication problem’’ and resulting limit of cellular lifespan exists in all eukaryotes that have linear chromosomes but not in prokaryotes that have circular chromosomes without chromosomal ‘‘ends’’.

10 3′

3′

3′

K. Hiyama et al. 5′

5′

5′

5′ 3′ 5′

(2) (1)

ing lagg lead in (1) g

(3)

lagging leading

lea(1) ding

3′

5′

3′

g ggin (3)

la (1)

Parent chromosome

(2)

leading lagging

Okazaki fragment

5′ 3′

RNA primer 5′

3′

shortened 3′

5′ 3′

5′ 5′

3′ 5′

Daughter chromosomes

3′

shortened

Fig. 1.2 Renewed ‘‘end-replication problem.’’ Incomplete replication of leading strand due to formation of 30 overhang, as well as that of lagging strand due to RNA primer as a prerequisite for DNA synthesis, is responsible for telomere shortening

1.4

Functions of Telomeres and Telomerase

Telomeres consist of noncoding TTAGGG repeats (but the reader should be aware that it was recently reported that telomeric repeats are transcribed and this telomeric RNA may regulate telomerase activity (129)). Telomeres protect chromosome ends from DNA degradation, DNA repair mechanisms, and fusion. Uncapped telomeres activate the DNA damage response and cause end-to-end fusions resulting in cellular senescence, apoptosis, and further chromosomal instability (Table 1.2). Since genes near telomeres may be reversibly silenced in a telomere lengthdependent manner by telomere position effect (TPE) (78), telomere shortening may result in restoration of expression of such silenced genes. Moreover, telomeres appear to play an important role in ‘‘bouquet’’ formation at the beginning of meiosis, and telomere dysfunction results in germ cell death (79). The well known function of telomerase is elongation of telomeres, so that cells can increase their replicative capacity, sometimes indefinitely (Table 1.3). However, it may be that even in some normal fibroblasts, telomerase is expressed at low levels. However, this amount of telomerase cannot maintain telomere length but during each S phase may play a role in maintaining chromosomal structure (93).

1 Telomeres and Telomerase in Humans

11

Table 1.2 Function of telomeres and dysfunction due to telomere shortening Function Consequence of telomere shortening/dysfunction Prevention of erosion of genes in Cellular senescence, cell death, and/or carcinogenesis subtelomeres Telomere position effects (TPE) Reactivation of the silenced genes near telomeres Protection of chromosomal Chromosome fusion, anaphase bridge end-to-end fusion T-loop formation and Disruption of T-loop inducing p53 mediated cellular chromosome stability senescence and apoptosis, chromosome fusion ‘‘Bouquet’’ formation at the Impaired meiosis and germ cell apoptosis beginning of meiosis

Table 1.3 Function of telomerase and consequence of its activation Function Consequence examples of telomerase activation Elongation of telomeres Elongation of cellular lifespan or immortalization Maintenance of chromosomal Telomerase is transiently expressed in each S phase structure in normal cells Addition of malignant potential Tumor formation with nontumorigenic ALT cells Promotion of stem cell e.g., increased hair growth proliferation DNA repair? Required to form DNA damage foci following irradiation Self-renewal capacity? Required to reprogram fibroblasts to iPS cells

Telomerase may also have roles in stem cell proliferation (107), and reprogramming of iPS cells (131, 133). The mechanisms of these functions of telomerase may or may not be related to maintenance of telomere length.

1.5

Two Mortality Stage Mechanisms and Telomere Hypothesis

Two mortality stage mechanisms, ‘‘M1’’ and ‘‘M2’’, must be overcome for normal cells to escape from cellular senescence and become immortal (13, 19). Normal cells stop dividing at the ‘‘Hayflick limit,’’ i.e., mortality stage 1 (M1), where p16/pRb and TP53 recognize perhaps a single uncapped telomere as broken or damage DNA. To bypass this potent tumor suppressor mechanism, cells can divide beyond M1 and continue replication by inactivating these tumor suppressor genes (termed extended lifespan). However, the cells again stop dividing at the mortality stage 2 (M2), also called ‘‘crisis’’. At this stage, many telomeres are critically shortened, end-end fusions occur, and cells stop dividing. The escape from M2 in human cells is extremely rare and almost universally involves the upregulation or reactivation of telomerase as a telomere-maintenance mechanism (19). Much less commonly other telomere maintenance mechanisms such as alternative lengthening telomeres (ALT, See Chap. 5) (58) are engaged. The cells that have activated telomerase can overcome the M2, and become immortal (Fig. 1.3).

12

K. Hiyama et al. kb

germline cells : Telomerase ++

~15 st

em

/p

no

ge

rm

ni

al so

to

rc

: Telomerase −

el

m ic at

ls

: transform

cancer stem cells?

lls

ce

Telomere length

: Telomerase +

ro

: stop dividing M1: mortality stage 1 (Hayflick limit) M2: mortality stage 2 (crisis)

~5 transformed cells ~2 M1

M2

< ~60 < ~100

immortal cancer cells cancer stem cells? Number of cell division

Fig. 1.3 Telomere hypothesis and two independent mortality mechanisms controlling cellular senescence and immortalization. Normal stem cells have elongated lifespan but are not immortal. Cancer stem cells may arise from cells that have bypassed M2 as well as from normal stem cells. The origin of cancer stem cells is still an hypothesis and it is possible that they may have the same, shorter, or longer telomeres compared to the bulk population of tumor cells

Thus both M1 and M2 may be thought of as initial anti-cancer protection mechanisms and only when both have been bypassed are cells immortal and then can progress to advanced malignancies. Thus some preneoplastic lesions may be arrested at M1, some early stage clinical cancers may have overcome M1, but not M2 (transformed but mortal cancer cells), while advanced cancers probably have overcome M2 (transformed and immortal cancer cells). All cancer cell lines and ‘‘cancer stem cells’’ have likely overcome both M1 and M2. Meanwhile, normal lymphocytes and stem/progenitor cells in self-renewal tissues have highly regulated telomerase activity, but gradually senesce and thus while telomerase may partially extend their lifespan, the cells are mortal, since they have not overcome M1 nor M2 (Fig. 1.3, Table 1.2) (37, 43, 44, 47).

1.6

Telomerase is a Conserved Reverse-Transcriptase

Human telomerase is a ribonucleoprotein enzyme composed of catalytic component TERT, telomerase reverse-transcriptase (52, 53), and RNA template TERC (or hTR), telomerase RNA component (or human telomerase RNA) (33). Telomerase can elongate the G-rich 30 telomere overhang using the TERC as template. Since telomeric DNA is synthesized according to the complementary RNA sequence, telomerase is a reverse-transcriptase. The catalytic component gene TERT is evolutionally conserved (52), and has been alternatively called as hTERT (meaning

1 Telomeres and Telomerase in Humans

13

‘‘human TERT’’), hTRT (52), hEST2 (53), hTCS1 (135), or TP2 (136) by researchers who independently cloned this gene in 1997. In vivo, Cohen SB et al. purified the catalytically active human telomerase complex (650–670 kD) and proposed that telomerase may exist as a dimer consisting of two molecules each of hTERT (127 kD), hTR (153 kD), and dyskerin (57 kD) (124). The telomerase core enzyme may complex with additional telomerase binding proteins (Chap. 2), and its function is regulated transcriptionally and posttranscriptionally (Chap. 3).

1.7

Telomerase Activity and Cellular Immortalization

Expression of TERT is a prerequisite but not always sufficient for cellular immortalization in most human cells (especially when the cell culture conditions are not optimized). Among the core components of telomerase, TERC is constitutively expressed in most cells regardless of their telomerase activity level, and TERT expression levels determine the telomerase activity qualitatively and quantitatively. Ectopic expression of TERT induces telomerase activity in telomerase-negative somatic cells in vitro (57), but cellular immortalization is still a relatively rare event with many clones expressing telomerase potentially remaining mortal with or without elongation of lifespan (59, 65). Thus, activation of telomerase is a prerequisite, except for rare ALT cells, but not necessarily a sufficient condition for cellular immortalization.

1.8

Telomerase is Activated in >80% of Human Malignancies

Every type of human malignancy examined to the present time has evidence of telomerase activation with the average being detected in >80% of overall cancer tissues (137) (Chap. 8). In general, the incidence and level of telomerase activation are higher in advanced stages than early stages, in metastatic lesions than primary lesions, in poor prognosis cases than good prognosis cases, and in malignant lesions than in precancerous lesions, indicating that continuous progression of cancers may ultimately depend on telomerase in all human malignancies. Thus, telomerase components and associated proteins are becoming not only a diagnostic marker of cancer but also the molecular targets of anticancer strategies and some of them are under clinical trials (see Part II).

1.9

Telomerase Activity in Normal Somatic Cells and Stem Cells

In most human normal somatic cells, telomerase activity is undetectable. However, lymphocytes and most, but not all, stem/progenitor cells in self-renewal tissues can express telomerase upon mitogenic stimulation (37). These cells have elongated lifespan so that humans can retain immune reactivity to each antigen and maintain

14

K. Hiyama et al.

Table 1.4 Telomere length, telomerase expression, and cellular lifespan in human cells Telomere length Telomerase expression (detectable level by usual analysis)a (cellular lifespan) +  Stable (immortal)

Germline cells, immortal cancer cells

Slowly shortened (mortal with elongated lifespan)

Part of in vitro immortalized cellsb, a few cancers (e.g. part of sarcoma)a Mesenchymal stem cells

Lymphocytes (activated), renewing stem/progenitor cells (e.g. hematopoietic, intestinal, epidermal, hair follicle), endometrial cells (proliferative) Shortened (mortal) Stem cells in progeria, stem cells Most somatic cells, part of with dysfunction (e.g. a part of cancer cells aplastic anemia, dyskeratosis congenital, IPF c) a At very low levels, telomerase is expressed during each S phase even in normal somatic cells (93) b ALT (alternative lengthening of telomeres) cells c IPF idiopathic pulmonary fibrosis

the function of important organs, such as the bone marrow, intestine, skin, etc. However, when these cells stop dividing and/or are differentiated, telomerase activity disappears. Thus, normal somatic cells never become immortal in vivo, even those with regulated telomerase activation (Table 1.4) unless there is loss of tumor suppressor genes or activation of oncogenes. In contrast, human mesenchymal stem cells (hMSCs) may have very low or no detectable telomerase activity (138–140), whereas they can maintain longer telomeres than those in usual somatic cells. hMSCs lack characteristics of ALT cells such as PML bodies and may have unique telomere maintaining mechanism (141). In the mouse, telomerase activity is detectable in normal somatic cells in addition to stem cells, and telomere length is around fivefold longer than human (50 kb vs. 10 kb). Since their lifespan is much shorter than human, telomeres in murine cells are not shortened to reach the Hayflick limit within a lifetime even without telomerase, and mTR/ (telomerase RNA knockout) mice can survive until the sixth generation (54). At this late generation, telomere dysfunction is manifested as stem cell dysfunction and infertility in mTR/ mice (Chap. 6).

1.10

Telomere-Binding Proteins

In addition to the core telomere-binding proteins ‘‘Shelterin’’ (TRF1, TRF2, POT1, TIN2, TPP1, and RAP1), DNA repair proteins are also involved in telomere maintenance: Ku complex, MRN complex (MRE11, RAD50, NBS1), XPF/ ERCC1, ATM, BLM/WRN, RAD51D, and RAD54 (108). Mutations or absence of these genes cause short telomeres, end-to-end chromosomal fusions, premature aging phenotypes, and/or cancer predisposition (Chap. 2).

1 Telomeres and Telomerase in Humans

1.11

15

Telomere Dysfunction and Human Diseases

Mutations in telomerase component genes, TERT and TERC, cause stem cell dysfunction, resulting in dyskeratosis congenita (80), aplastic anemia (81), and idiopathic pulmonary fibrosis (125, 126). This suggests that individuals with heterozygous mutations in TERT or TERC have reduced telomerase activity in their stem cells and suffer accelerated telomere shortening possibly due to haploinsufficiency, except for mutations in the template domain of TERC, which can show dominant negative effects (142). Stem cell dysfunction due to accelerated telomere shortening is caused also by mutations in telomerase binding proteins, such as dyskerin (72). This suggests that telomerase is not in excess (e.g., individuals need long telomeres for a full lifespan). Importantly these telomere-associated genetic diseases suggest that inhibition of only 50% of telomerase in human cancer may be sufficient to drive cancer cells with short telomeres into apoptotic cell death leading to durable cancer responses prior to affecting normal stem cells.

1.12

Concluding Remarks

Telomeres and telomerase dysfunction causes unexpected early senescence to stem cells in renewal tissues or graft tissues, while maintenance of telomeres via activation of telomerase is the critical offender for the indefinite proliferation of immortal cancer cells. Restoration of telomere function in regenerative medicine and inhibition of telomerase (e.g., induction of telomere dysfunction) as an anticancer strategy, respectively, is the double-edged sword in clinical medicine.

References 1. Hayflick L, Moorhead PS. The serial cultivation of human diploid cell strains. Exp Cell Res 1961;25:585–621. 2. Olovnikov AM. Principle of marginotomy in template synthesis of polynucleotides (Russian). Dokl Akad Nauk Sssr 1971;201:1496–9. 3. Watson JD. Origin of concatemeric T7 DNA. Nat New Biol 1972;239:197–201. 4. Blackburn EH, Gall JG. A tandemly repeated sequence at the termini of the extrachromosomal ribosomal RNA genes in Tetrahymena. J Mol Biol 1978;120:33–53. 5. Klobutcher LA, Swanton MT, Donini P, et al. All gene-sized DNA molecules in four species of hypotrichs have the same terminal sequence and an unusual 30 terminus. Proc Natl Acad Sci USA 1981;78:3015–9. 6. Ide T, Tsuji Y, Nakashima T, et al. Progress of aging in human diploid cells transformed with a tsA mutant of simian virus 40. Exp Cell Res 1984;150:321–8. 7. Greider CW, Blackburn EH. Identification of a specific telomere terminal transferase activity in Tetrahymena extracts. Cell 1985;43:405–13. 8. Cooke HJ, Smith BA. Variability at the telomeres of the human X/Y pseudoautosomal region. Cold Spring Harb Symp Quant Biol 1986;51 Pt 1:213–9.

16

K. Hiyama et al.

9. Pereira-Smith OM, Smith JR. Genetic analysis of indefinite division in human cells: identification of four complementation groups. Proc Natl Acad Sci USA 1988;85:6042–6. 10. Moyzis RK, Buckingham JM, Cram LS, et al. A highly conserved repetitive DNA sequence, (TTAGGG)n, present at the telomeres of human chromosomes. Proc Natl Acad Sci USA 1988;85:6622–6. 11. Greider CW, Blackburn EH. A telomeric sequence in the RNA of Tetrahymena telomerase required for telomere repeat synthesis. Nature 1989;337:331–7. 12. Allshire RC, Dempster M, Hastie ND. Human telomeres contain at least three types of G-rich repeat distributed non-randomly. Nucleic Acids Res 1989;17:4611–27. 13. Wright WE, Pereira-Smith OM, Shay JW. Reversible cellular senescence: implications for immortalization of normal human diploid fibroblasts. Mol Cell Biol 1989;9:3088–92. 14. Morin GB. The human telomere terminal transferase enzyme is a ribonucleoprotein that synthesizes TTAGGG repeats. Cell 1989;59:521–9. 15. de Lange T, Shiue L, Myers RM, et al. Structure and variability of human chromosome ends. Mol Cell Biol 1990;10:518–27. 16. Harley CB, Futcher AB, Greider CW. Telomeres shorten during ageing of human fibroblasts. Nature 1990;345:458–60. 17. Hastie ND, Dempster M, Dunlop MG, et al. Telomere reduction in human colorectal carcinoma and with ageing. Nature 1990;346:866–8. 18. Zahler AM, Williamson JR, Cech TR, et al. Inhibition of telomerase by G-quartet DNA structures. Nature 1991;350:718–20. 19. Harley CB. Telomere loss: mitotic clock or genetic time bomb? Mutat Res 1991;256:271–82. 20. Hiyama E, Hiyama K, Yokoyama T, et al. Length of telomeric repeats in neuroblastoma: correlation with prognosis and other biological characteristics. Jpn J Cancer Res 1992;83:159–64. 21. Counter CM, Avilion AA, LeFeuvre CE, et al. Telomere shortening associated with chromosome instability is arrested in immortal cells which express telomerase activity. Embo J 1992;11:1921–9. 22. Shirotani Y, Hiyama K, Ishioka S, et al. Alteration in length of telomeric repeats in lung cancer. Lung Cancer 1994;11:29–41. 23. Kim NW, Piatyszek MA, Prowse KR, et al. Specific association of human telomerase activity with immortal cells and cancer. Science 1994;266:2011–5. 24. Hiyama E, Hiyama K, Yokoyama T, et al. Correlating telomerase activity levels with human neuroblastoma outcomes. Nat Med 1995;1:249–55. 25. Piatyszek MA, Kim NW, Weinrich SL, et al. Detection of telomerase activity in human cells and tumors by a telomeric repeat amplification protocol (TRAP). Methods Cell Sci 1995;17:1–15. 26. Counter CM, Gupta J, Harley CB, et al. Telomerase activity in normal leukocytes and in hematologic malignancies. Blood 1995;85:2315–20. 27. Hiyama K, Hiyama E, Ishioka S, et al. Telomerase activity in small-cell and non-small-cell lung cancers. J Natl Cancer Inst 1995;87:895–902. 28. Collins K, Kobayashi R, Greider CW. Purification of Tetrahymena telomerase and cloning of genes encoding the two protein components of the enzyme. Cell 1995;81:677–86. 29. Chadeneau C, Hay K, Hirte HW, et al. Telomerase activity associated with acquisition of malignancy in human colorectal cancer. Cancer Res 1995;55:2533–6. 30. Tahara H, Nakanishi T, Kitamoto M, et al. Telomerase activity in human liver tissues: comparison between chronic liver disease and hepatocellular carcinomas. Cancer Res 1995;55:2734–6. 31. Hiyama E, Yokoyama T, Tatsumoto N, et al. Telomerase activity in gastric cancer. Cancer Res 1995;55:3258–62. 32. Bryan TM, Englezou A, Gupta J, et al. Telomere elongation in immortal human cells without detectable telomerase activity. Embo J 1995;14:4240–8.

1 Telomeres and Telomerase in Humans

17

33. Feng J, Funk WD, Wang SS, et al. The RNA component of human telomerase. Science 1995;269:1236–41. 34. Lingner J, Cooper JP, Cech TR. Telomerase and DNA end replication: no longer a lagging strand problem? Science 1995;269:1533–4. 35. Ohmura H, Tahara H, Suzuki M, et al. Restoration of the cellular senescence program and repression of telomerase by human chromosome 3. Jpn J Cancer Res 1995;86:899–904. 36. Tanaka H, Shimizu M, Horikawa I, et al. Evidence for a putative telomerase repressor gene in the 3p14.2-p21.1 region. Genes Chromosomes Cancer 1998;23:123–33. 37. Hiyama K, Hirai Y, Kyoizumi S, et al. Activation of telomerase in human lymphocytes and hematopoietic progenitor cells. J Immunol 1995;155:3711–5. 38. Langford LA, Piatyszek MA, Xu R, et al. Telomerase activity in human brain tumours. Lancet 1995;346:1267–8. 39. Sharma HW, Sokoloski JA, Perez JR, et al. Differentiation of immortal cells inhibits telomerase activity. Proc Natl Acad Sci USA 1995;92:12343–6. 40. Chong L, van Steensel B, Broccoli D, et al. A human telomeric protein. Science 1995;270:1663–7. 41. Hiyama E, Gollahon L, Kataoka T, et al. Telomerase activity in human breast tumors. J Natl Cancer Inst 1996;88:116–22. 42. Holt SE, Wright WE, Shay JW. Regulation of telomerase activity in immortal cell lines. Mol Cell Biol 1996;16:2932–9. 43. Taylor RS, Ramirez RD, Ogoshi M, et al. Detection of telomerase activity in malignant and nonmalignant skin conditions. J Invest Dermatol 1996;106:759–65. 44. Hiyama E, Hiyama K, Tatsumoto N, et al. Telomerase activity in human intestine. Int J Oncol 1996;9:453–8. 45. Bodnar AG, Kim NW, Effros RB, et al. Mechanism of telomerase induction during T cell activation. Exp Cell Res 1996;228:58–64. 46. Tatematsu K, Nakayama J, Danbara M, et al. A novel quantitative ‘stretch PCR assay’, that detects a dramatic increase in telomerase activity during the progression of myeloid leukemias. Oncogene 1996;13:2265–74. 47. Kyo S, Takakura M, Kohama T, et al. Telomerase activity in human endometrium. Cancer Res 1997;57:610–4. 48. Harrington L, McPhail T, Mar V, et al. A mammalian telomerase-associated protein. Science 1997;275:973–7. 49. van Steensel B, de Lange T. Control of telomere length by the human telomeric protein TRF1. Nature 1997;385:740–3. 50. Sun D, Thompson BD, Cathers BE, et al. Inhibition of human telomerase by a G-quadruplexinteractive compound. J Med Chem 1997;40:2113–6. 51. Ohyashiki K, Ohyashiki JH, Nishimaki J, et al. Cytological detection of telomerase activity using an in situ telomeric repeat amplification protocol assay. Cancer Res 1997;57:2100–3. 52. Nakamura TM, Morin GB, Chapman KB, et al. Telomerase catalytic subunit homologs from fission yeast and human. Science 1997;277:955–9. 53. Meyerson M, Counter CM, Eaton EN, et al. hEST2, the putative human telomerase catalytic subunit gene, is up-regulated in tumor cells and during immortalization. Cell 1997;90:785– 95. 54. Blasco MA, Lee HW, Hande MP, et al. Telomere shortening and tumor formation by mouse cells lacking telomerase RNA. Cell 1997;91:25–34. 55. Broccoli D, Smogorzewska A, Chong L, et al. Human telomeres contain two distinct Mybrelated proteins, TRF1 and TRF2. Nat Genet 1997;17:231–5. 56. Bilaud T, Brun C, Ancelin K, et al. Telomeric localization of TRF2, a novel human telobox protein. Nat Genet 1997;17:236–9. 57. Weinrich SL, Pruzan R, Ma L, et al. Reconstitution of human telomerase with the template RNA component hTR and the catalytic protein subunit hTRT. Nat Genet 1997;17:498–502.

18

K. Hiyama et al.

58. Bryan TM, Englezou A, Dalla-Pozza L, et al. Evidence for an alternative mechanism for maintaining telomere length in human tumors and tumor-derived cell lines. Nat Med 1997;3:1271–4. 59. Bodnar AG, Ouellette M, Frolkis M, et al. Extension of life-span by introduction of telomerase into normal human cells. Science 1998;279:349–52. 60. van Steensel B, Smogorzewska A, de Lange T. TRF2 protects human telomeres from end-toend fusions. Cell 1998;92:401–13. 61. Lee HW, Blasco MA, Gottlieb GJ, et al. Essential role of mouse telomerase in highly proliferative organs. Nature 1998;392:569–74. 62. Ulaner GA, Hu JF, Vu TH, et al. Telomerase activity in human development is regulated by human telomerase reverse transcriptase (hTERT) transcription and by alternate splicing of hTERT transcripts. Cancer Res 1998;58:4168–72. 63. Cong YS, Wen J, Bacchetti S. The human telomerase catalytic subunit hTERT: organization of the gene and characterization of the promoter. Hum Mol Genet 1999;8:137–42. 64. Takakura M, Kyo S, Kanaya T, et al. Cloning of human telomerase catalytic subunit (hTERT) gene promoter and identification of proximal core promoter sequences essential for transcriptional activation in immortalized and cancer cells. Cancer Res 1999;59:551–7. 65. Morales CP, Holt SE, Ouellette M, et al. Absence of cancer-associated changes in human fibroblasts immortalized with telomerase. Nat Genet 1999;21:115–8. 66. Griffith JD, Comeau L, Rosenfield S, et al. Mammalian telomeres end in a large duplex loop. Cell 1999;97:503–14. 67. Hahn WC, Counter CM, Lundberg AS, et al. Creation of human tumour cells with defined genetic elements. Nature 1999;400:464–8. 68. Yeager TR, Neumann AA, Englezou A, et al. Telomerase-negative immortalized human cells contain a novel type of promyelocytic leukemia (PML) body. Cancer Res 1999;59:4175–9. 69. Hahn WC, Stewart SA, Brooks MW, et al. Inhibition of telomerase limits the growth of human cancer cells. Nat Med 1999;5:1164–70. 70. Kim SH, Kaminker P, Campisi J. TIN2, a new regulator of telomere length in human cells. Nat Genet 1999;23:405–12. 71. Herbert B, Pitts AE, Baker SI, et al. Inhibition of human telomerase in immortal human cells leads to progressive telomere shortening and cell death. Proc Natl Acad Sci USA 1999;96:14276–81. 72. Mitchell JR, Wood E, Collins K. A telomerase component is defective in the human disease dyskeratosis congenita. Nature 1999;402:551–5. 73. Thomas M, Yang L, Hornsby PJ. Formation of functional tissue from transplanted adrenocortical cells expressing telomerase reverse transcriptase. Nat Biotechnol 2000;18:39–42. 74. Hooijberg E, Ruizendaal JJ, Snijders PJ, et al. Immortalization of human CD8 + T cell clones by ectopic expression of telomerase reverse transcriptase. J Immunol 2000;165:4239–45. 75. Dunham MA, Neumann AA, Fasching CL, et al. Telomere maintenance by recombination in human cells. Nat Genet 2000;26:447–50. 76. Shin-ya K, Wierzba K, Matsuo K, et al. Telomestatin, a novel telomerase inhibitor from Streptomyces anulatus. J Am Chem Soc 2001;123:1262–3. 77. Kim MY, Vankayalapati H, Shin-Ya K, et al. Telomestatin, a potent telomerase inhibitor that interacts quite specifically with the human telomeric intramolecular g-quadruplex. J Am Chem Soc 2002;124:2098–9. 78. Baur JA, Zou Y, Shay JW, et al. Telomere position effect in human cells. Science 2001;292:2075–7. 79. Hemann MT, Rudolph KL, Strong MA, et al. Telomere dysfunction triggers developmentally regulated germ cell apoptosis. Mol Biol Cell 2001;12:2023–30. 80. Vulliamy T, Marrone A, Goldman F, et al. The RNA component of telomerase is mutated in autosomal dominant dyskeratosis congenita. Nature 2001;413:432–5.

1 Telomeres and Telomerase in Humans

19

81. Vulliamy T, Marrone A, Dokal I, et al. Association between aplastic anaemia and mutations in telomerase RNA. Lancet 2002;359:2168–70. 82. Yatabe N, Kyo S, Kondo S, et al. 2–5A antisense therapy directed against human telomerase RNA inhibits telomerase activity and induces apoptosis without telomere impairment in cervical cancer cells. Cancer Gene Ther 2002;9:624–30. 83. Seimiya H, Oh-hara T, Suzuki T, et al. Telomere shortening and growth inhibition of human cancer cells by novel synthetic telomerase inhibitors MST-312, MST-295, and MST-1991. Mol Cancer Ther 2002;1:657–65. 84. Stewart SA, Hahn WC, O’Connor BF, et al. Telomerase contributes to tumorigenesis by a telomere length-independent mechanism. Proc Natl Acad Sci USA 2002;99:12606–11. 85. Seger YR, Garcia-Cao M, Piccinin S, et al. Transformation of normal human cells in the absence of telomerase activation. Cancer Cell 2002;2:401–13. 86. Hakin-Smith V, Jellinek DA, Levy D, et al. Alternative lengthening of telomeres and survival in patients with glioblastoma multiforme. Lancet 2003;361:836–8. 87. Zhang A, Zheng C, Hou M, et al. Deletion of the telomerase reverse transcriptase gene and haploinsufficiency of telomere maintenance in Cri du chat syndrome. Am J Hum Genet 2003;72:940–8. 88. Stewart SA, Ben-Porath I, Carey VJ, et al. Erosion of the telomeric single-strand overhang at replicative senescence. Nat Genet 2003;33:492–6. 89. Ulaner GA, Huang HY, Otero J, et al. Absence of a telomere maintenance mechanism as a favorable prognostic factor in patients with osteosarcoma. Cancer Res 2003;63:1759–63. 90. Colgin LM, Baran K, Baumann P, et al. Human POT1 facilitates telomere elongation by telomerase. Curr Biol 2003;13:942–6. 91. Loayza D, De Lange T. POT1 as a terminal transducer of TRF1 telomere length control. Nature 2003;423:1013–8. 92. Lin SY, Elledge SJ. Multiple tumor suppressor pathways negatively regulate telomerase. Cell 2003;113:881–9. 93. Masutomi K, Yu EY, Khurts S, et al. Telomerase maintains telomere structure in normal human cells. Cell 2003;114:241–53. 94. Asai A, Oshima Y, Yamamoto Y, et al. A novel telomerase template antagonist (GRN163) as a potential anticancer agent. Cancer Res 2003;63:3931–9. 95. Tauchi T, Shin-Ya K, Sashida G, et al. Activity of a novel G-quadruplex-interactive telomerase inhibitor, telomestatin (SOT-095), against human leukemia cells: involvement of ATM-dependent DNA damage response pathways. Oncogene 2003;22:5338–47. 96. der-Sarkissian H, Bacchetti S, Cazes L, et al. The shortest telomeres drive karyotype evolution in transformed cells. Oncogene 2004;23:1221–8. 97. Preto A, Singhrao SK, Haughton MF, et al. Telomere erosion triggers growth arrest but not cell death in human cancer cells retaining wild-type p53: implications for antitelomerase therapy. Oncogene 2004;23:4136–45. 98. Seimiya H, Muramatsu Y, Ohishi T, et al. Tankyrase 1 as a target for telomere-directed molecular cancer therapeutics. Cancer Cell 2005;7:25–37. 99. Fasching CL, Bower K, Reddel RR. Telomerase-independent telomere length maintenance in the absence of alternative lengthening of telomeres-associated promyelocytic leukemia bodies. Cancer Res 2005;65:2722–9. 100. Marciniak RA, Johnson FB, Guarente L. Dyskeratosis congenita, telomeres and human ageing. Trends Genet 2000;16:193–5. 101. Cerone MA, Autexier C, Londono-Vallejo JA, et al. A human cell line that maintains telomeres in the absence of telomerase and of key markers of ALT. Oncogene 2005;24:7893–901. 102. Yamaguchi H, Calado RT, Ly H, et al. Mutations in TERT, the gene for telomerase reverse transcriptase, in aplastic anemia. N Engl J Med 2005;352:1413–24.

20

K. Hiyama et al.

103. Sun B, Chen M, Hawks CL, et al. The minimal set of genetic alterations required for conversion of primary human fibroblasts to cancer cells in the subrenal capsule assay. Neoplasia 2005;7:585–93. 104. Nakamura M, Masutomi K, Kyo S, et al. Efficient inhibition of human telomerase reverse transcriptase expression by RNA interference sensitizes cancer cells to ionizing radiation and chemotherapy. Hum Gene Ther 2005;16:859–68. 105. Herbert BS, Gellert GC, Hochreiter A, et al. Lipid modification of GRN163, an N30 – > P50 thio-phosphoramidate oligonucleotide, enhances the potency of telomerase inhibition. Oncogene 2005;24:5262–8. 106. Zaug AJ, Podell ER, Cech TR. Human POT1 disrupts telomeric G-quadruplexes allowing telomerase extension in vitro. Proc Natl Acad Sci USA 2005;102:10864–9. 107. Flores I, Cayuela ML, Blasco MA. Effects of telomerase and telomere length on epidermal stem cell behavior. Science 2005;309:1253–6. 108. de Lange T. Shelterin: the protein complex that shapes and safeguards human telomeres. Genes Dev 2005;19:2100–10. 109. Djojosubroto MW, Chin AC, Go N, et al. Telomerase antagonists GRN163 and GRN163L inhibit tumor growth and increase chemosensitivity of human hepatoma. Hepatology 2005;42:1127–36. 110. Armanios M, Chen JL, Chang YP, et al. Haploinsufficiency of telomerase reverse transcriptase leads to anticipation in autosomal dominant dyskeratosis congenita. Proc Natl Acad Sci USA 2005;102:15960–4. 111. Goldman F, Bouarich R, Kulkarni S, et al. The effect of TERC haploinsufficiency on the inheritance of telomere length. Proc Natl Acad Sci USA 2005;102:17119–24. 112. Verdun RE, Crabbe L, Haggblom C, et al. Functional human telomeres are recognized as DNA damage in G2 of the cell cycle. Mol Cell 2005;20:551–61. 113. Horikawa I, Chiang YJ, Patterson T, et al. Differential cis-regulation of human versus mouse TERT gene expression in vivo: identification of a human-specific repressive element. Proc Natl Acad Sci USA 2005;102:18437–42. 114. Anderson CJ, Hoare SF, Ashcroft M, et al. Hypoxic regulation of telomerase gene expression by transcriptional and post-transcriptional mechanisms. Oncogene 2006;25:61–9. 115. Compton SA, Elmore LW, Haydu K, et al. Induction of nitric oxide synthase-dependent telomere shortening after functional inhibition of Hsp90 in human tumor cells. Mol Cell Biol 2006;26:1452–62. 116. Chai W, Du Q, Shay JW, et al. Human telomeres have different overhang sizes at leading versus lagging strands. Mol Cell 2006;21:427–35. 117. Tahara H, Shin-Ya K, Seimiya H, et al. G-Quadruplex stabilization by telomestatin induces TRF2 protein dissociation from telomeres and anaphase bridge formation accompanied by loss of the 30 telomeric overhang in cancer cells. Oncogene 2006;25:1955–66. 118. Gellert GC, Dikmen ZG, Wright WE, et al. Effects of a novel telomerase inhibitor, GRN163L, in human breast cancer. Breast Cancer Res Treat 2006;96:73–81. 119. Hochreiter AE, Xiao H, Goldblatt EM, et al. Telomerase template antagonist GRN163L disrupts telomere maintenance, tumor growth, and metastasis of breast cancer. Clin Cancer Res 2006;12:3184–92. 120. Trapp S, Parcells MS, Kamil JP, et al. A virus-encoded telomerase RNA promotes malignant T cell lymphomagenesis. J Exp Med 2006;203:1307–17. 121. Ambrus A, Chen D, Dai J, et al. Human telomeric sequence forms a hybrid-type intramolecular G-quadruplex structure with mixed parallel/antiparallel strands in potassium solution. Nucleic Acids Res 2006;34:2723–35. 122. Xin H, Liu D, Wan M, et al. TPP1 is a homologue of ciliate TEBP-beta and interacts with POT1 to recruit telomerase. Nature 2007;445:559–62. 123. Wang F, Podell ER, Zaug AJ, et al. The POT1-TPP1 telomere complex is a telomerase processivity factor. Nature 2007;445:506–10.

1 Telomeres and Telomerase in Humans

21

124. Cohen SB, Graham ME, Lovrecz GO, et al. Protein composition of catalytically active human telomerase from immortal cells. Science 2007;315:1850–3. 125. Armanios MY, Chen JJ, Cogan JD, et al. Telomerase mutations in families with idiopathic pulmonary fibrosis. N Engl J Med 2007;356:1317–26. 126. Tsakiri KD, Cronkhite JT, Kuan PJ, et al. Adult-onset pulmonary fibrosis caused by mutations in telomerase. Proc Natl Acad Sci U S A 2007;104:7552–7. 127. Jiang WQ, Zhong ZH, Henson JD, et al. Identification of candidate alternative lengthening of telomeres genes by methionine restriction and RNA interference. Oncogene 2007;26:4635–47. 128. Xu L, Blackburn EH. Human cancer cells harbor T-stumps, a distinct class of extremely short telomeres. Mol Cell 2007;28:315–27. 129. Azzalin CM, Reichenbach P, Khoriauli L, et al. Telomeric repeat containing RNA and RNA surveillance factors at mammalian chromosome ends. Science 2007;318:798–801. 130. Schoeftner S, Blasco MA. Developmentally regulated transcription of mammalian telomeres by DNA-dependent RNA polymerase II. Nat Cell Biol 2008;10:228–36. 131. Takahashi K, Tanabe K, Ohnuki M, et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 2007;131:861–72. 132. Venteicher AS, Meng Z, Mason PJ, et al. Identification of ATPases pontin and reptin as telomerase components essential for holoenzyme assembly. Cell 2008;132:945–57. 133. Stadtfeld M, Maherali N, Breault DT, et al. Defining molecular cornerstones during fibroblast to iPS cell reprogramming in mouse. Cell Stem Cell 2008;2:230–40. 134. Levy MZ, Allsopp RC, Futcher AB, et al. Telomere end-replication problem and cell aging. J Mol Biol 1992;225:951–60. 135. Kilian A, Bowtell DD, Abud HE, et al. Isolation of a candidate human telomerase catalytic subunit gene, which reveals complex splicing patterns in different cell types. Hum Mol Genet 1997;6:2011–9. 136. Harrington L, Zhou W, McPhail T, et al. Human telomerase contains evolutionarily conserved catalytic and structural subunits. Genes Dev 1997;11:3109–15. 137. Shay JW, Bacchetti S. A survey of telomerase activity in human cancer. Eur J Cancer 1997;33:787–91. 138. Hiyama E, Hiyama K. Telomere and telomerase in stem cells. Br J Cancer 2007;96:1020–4. 139. Yanada S, Ochi M, Kojima K, et al. Possibility of selection of chondrogenic progenitor cells by telomere length in FGF-2-expanded mesenchymal stromal cells. Cell Prolif 2006;39:575–84. 140. Zimmermann S, Voss M, Kaiser S, et al. Lack of telomerase activity in human mesenchymal stem cells. Leukemia 2003;17:1146–9. 141. Zhao YM, Li JY, Lan JP, et al. Cell cycle dependent telomere regulation by telomerase in human bone marrow mesenchymal stem cells. Biochem Biophys Res Commun 2008;369:1114–9. 142. Garcia CK, Wright WE, Shay JW. Human diseases of telomerase dysfunction: insights into tissue aging. Nucleic Acids Res 2007;35:7406–16.

Chapter 2

Telomere-Binding Proteins in Humans Nadya Dimitrova

Abstract Shelterin, the telomere-secific protein complex, is essential for genome stability and cell viability. Shelterin accumulates at telomeres and transforms chromosome ends into specialized structures that evade recognition by the DNA damage signaling and repair machineries and are maintained through consecutive cell divisions. Shelterin accomplishes these tasks through its ability to remodel the telomeric DNA into a protected structure and to locally inhibit the activation of the DNA damage response. Furthermore, shelterin plays an essential role in controlling telomere length homeostasis by suppressing excessive nuclease activity at the chromosome terminus and by regulating telomerase. The capacities of the telomere-binding proteins to prevent genome instability and to influence telomere length make shelterin an essential factor in both normal cell growth and tumorigenesis. Keywords: Shelterin, T-loop, ATM, ATR, NHEJ, HR.

2.1

Introduction

In the 1940s, the special qualities of ‘‘natural’’ ends of linear chromosomes were first recognized. Barbara McClintock observed that in contrast to ‘‘broken’’ ends, which tended to fuse and create dicentric chromosomes, ‘‘natural’’ chromosome ends were stably maintained (1). We now know that chromosome ends are stable because they are capped by telomeres, dynamic and complex nucleoprotein machineries that protect the integrity of chromosomes and are essential for cellular survival. The telomeric DNA is composed of a long array of double-stranded TTAGGG repeats that extend into a single-stranded overhang on the G-rich strand (2, 3). The repetitive and highly defined sequence of human telomeres prompted the search for factors that bind specifically to the telomeric repeats and could give an insight into how telomeres protect chromosome integrity. TRF1 (TTAGGG-repeat binding factor 1) was the first protein to be found due to its specific association with duplex N. Dimitrova The Rockefeller University, Box 159, New York, NY 10065, e‐mail: [email protected] K. Hiyama (ed.), Telomeres and Telomerase in Cancer. DOI: 10.1007/978-1-60327-879-9_2, # Humana Press, a part of Springer Science + Business Media, LLC 2009 23

24

N. Dimitrova

TTAGGG repeats in HeLa cell nuclear extract (4). Since then, five more telomere binding proteins have been identified – TRF2, POT1, RAP1, TIN2, and TPP1. Together, these six factors form the shelterin complex, which coats specifically the telomeric DNA and is essential for the prevention of detrimental genome instability (5). It is thought that shelterin has the ability to remodel the telomeric DNA into a protected structure and to locally inhibit the activation of the DNA damage response machinery. Furthermore, shelterin plays an essential role in determining telomere length by suppressing excessive nuclease activity at the chromosome terminus and by regulating telomerase, the enzyme that elongates telomeres by adding TTAGGG repeats to the 30 end (reviewed in (5)) (Fig. 2.1). In addition to maintaining chromosome integrity at the cellular level, telomeres have been proposed to play an important role as a tumor suppressor mechanism that limits the replicative lifespan of human somatic cells (reviewed in (6)). The

Fig. 2.1 Overview of the multiple roles of shelterin at human telomeres. (a) Shelterin protects chromosome ends. Telomeric DNA consists of 2–30 Kb double-stranded TTAGGG repeats that extent into 50–300 nt single-stranded TTAGGG overhang on the 30 strand. Shelterin complex specifically coats both the double-stranded portion of the telomere and the single-stranded extension. The presence of shelterin at telomeres promotes the formation of a protective structure at chromosome ends and also suppresses the activation of DNA damage signaling and repair pathways. (b) Shelterin regulates telomere length. Telomere ends are subject to degradation by unknown 50 –30 nuclease(s) that resects the 50 -strand to generate the telomere overhang. Shelterin regulates the activity and/or recruitment of this nuclease and thereby prevents excessive nuclease degradation and telomere shortening. At the same time, telomerase can elongate telomeres by adding TTAGGG repeats to the 30 end, an activity that is positively and negatively regulated by shelterin

2 Telomere-Binding Proteins in Humans

25

chromosome terminus is shortened each cell division by two additive processes. First, the DNA replication machinery requires a primer to initiate 50 –30 replication. Therefore, in each round of DNA replication, as the primer is removed, the newly synthesized strand lacks the first 10–15 base pairs at the 50 end. This is known as the end-replication problem (7, 8). Second, chromosome ends are also shortened by nuclease activity that generates the telomeric overhang (3, 9). The generation of a single-stranded 30 extension is a structural requirement for the telomere-mediated protection of the chromosome terminus from further degradation. As a result, telomeres shorten at an average of 100 base pairs at each cell division (10, 11). This is a regulated process and when telomeres become critically short, cells enter a terminal growth arrest state called senescence (12). Experimentally, the limited replicative potential of human cells was first described as the Hayflick limit and came from the observation that human somatic cells could only be maintained in culture for about 50 cell divisions before they stopped dividing (13). In the context of the organism, this limit to cellular proliferation is predicted to be a powerful tumor suppressor mechanism. The evidence that exogenous introduction of telomerase could overcome that barrier and extend the replicative lifespan indefinitely, quickly put telomeres and in particular telomerase, in the spotlight of the cancer biology field (14, 15). Indeed, more than 80% of human tumors have inappropriate reactivation of telomerase and virtually all tumor cells have established telomere maintenance mechanisms that allow for unlimited proliferation (16). In contrast to telomerase, the role of shelterin in the tumor suppressor function of telomeres has been more difficult to define. Disruption of the shelterin complex impairs both its telomere length regulation and telomere protection functions, leading to acute genome instability and cell cycle arrest (reviewed in (5)). However, it is conceivable that subtle alterations of one or more of the shelterin components could deregulate the telomere length homeostasis or, alternatively, cause transient genome instability that in the absence of functional p53 and Rb pathways would accelerate carcinogenesis (17). In this chapter, each shelterin member is described individually and in the context of the shelterin complex. I will then discuss insights gained from different experimental model systems on how shelterin functions to preserve telomere integrity and regulate telomere length.

2.2

Telomere-Binding Proteins in Human Cells

2.2.1

Shelterin

2.2.1.1

TRF1 and TRF2

The shelterin complex consists of six members (5) (Fig. 2.2). The first two factors, TRF1 and TRF2, bind to the double-stranded portion of the telomere and are essential for the recruitment and stabilization of the other shelterin members

26

N. Dimitrova

Fig. 2.2 The shelterin complex consists of six subunits. TRF1 and TRF2 are dimers that specifically recognize and bind to double-stranded telomeric DNA with their Myb domains. The binding site for each TRF1 or TRF2 dimer can be overlapping or separate sequences as indicated. RAP1 is a TRF2-binding partner. TIN2, on the other hand, interacts with both TRF1 and TRF2 and in turn recruits TPP1 and POT1 to the double-stranded portion of the telomere. The ability of TIN2 to bind to both TRF1 and TRF2, independently or simultaneously, creates the possibility for different shelterin subcomplexes as shown. The TRF1/TIN2, TRF2/TIN2, and TRF1/TRF2/TIN2 shelterin subcomplexes could all potentially play roles in the enrichment of TPP1/POT1 at single-stranded DNA. The POT1 binding sequence at single stranded DNA can be located at an internal site or at the 30 end as indicated

(4, 18, 19). The high specificity and affinity of TRF1 and TRF2 for telomeric DNA is achieved by two complementary mechanisms. First, both proteins contain homologous carboxy-terminal DNA-binding (SANT/Myb-type) domains that recognize 50 -YTAGGGTTR-30 sequence in double-stranded DNA with high specificity (20–22). In addition, both TRF1 and TRF2 contain structurally similar dimerization (TRFH) domains and exist as homodimers in solution, with TRF2 having a propensity to form higher-order oligomers (19, 23, 24). In the case of TRF1, it has been shown that upon dimerization, the simultaneous binding of two Myb domains increases its affinity for DNA approximately tenfold (20). Both TRF1 and TRF2 are essential for cell viability, and deletion of TRF1 and TRF2 genes leads to early lethality in mouse development (25–27). 2.2.1.2

TIN2

Interestingly, TRF1 and TRF2 are bridged by another shelterin factor, TIN2. TIN2 can interact simultaneously with TRF1 and TRF2 through its central region and amino-terminal half, respectively, and in turn recruits to the telomere two other shelterin components, TPP1 and its binding partner POT1 (28–32). TIN2 plays a core role in the sheltering complex. First, TIN2 protects TRF1 from the factor tankyrase 1, which has the ability to PARsylate TRF1 in human cells, a modification that strongly reduces its binding to DNA (33, 34). Second, TIN2 promotes the stable association of TRF2 at telomeres by tethering it to TRF1 (29, 31, 32). In vivo data indicate that upon downregulation of TRF1 or TIN2 by RNAi, the localization of TRF2 at telomeres is significantly diminished (29, 31). Finally, TIN2 is essential for the recruitment of POT1 to double-stranded telomeric DNA and, therefore,

2 Telomere-Binding Proteins in Humans

27

plays a crucial role in the loading of POT1 onto the single-stranded telomeric DNA (see later). Thus, TIN2 is necessary both for the stabilization of the TRF1/TRF2 scaffold on the double-stranded DNA and for the coating of the single-stranded DNA with POT1 (Fig. 2.2).

2.2.1.3

TPP1 and POT1

The main function of TPP1, the most recently identified shelterin component, is to link TIN2 and POT1 (30, 32, 35) (Fig. 2.2). In the absence of TPP1, POT1 is not recruited to chromosome ends and the phenotypes mirror POT1 loss. At first glance, it is surprising that the association of POT1 with telomeres is not dependent on its ability to bind DNA. POT1 contains two oligonucleotide/oligosaccharide-binding (OB) folds that are highly specific for single-stranded 50 -(T)TAGGGTTAG-30 sequence, both when the sequence is located at an internal site and when it is at a 30 terminus (36–39). Instead, the recruitment and stabilization of POT1 at telomeres relies on the bridge that links POT1 through TPP1 and TIN2 to TRF1/TRF2 bound at the double-stranded repeat array (30, 35, 40, 41). This is supported by chromatin immunoprecipitation data showing that longer telomeres recruit more POT1, although the length of the single-stranded telomeric DNA is not significantly altered. In addition, POT1 truncation mutants that lack the DNA-binding OB folds still localize efficiently at telomeres (37). The model that has emerged argues that the local enrichment of POT1 molecules in the vicinity of the chromosome terminus complements the high specificity of POT1 for single-stranded telomeric DNA and promotes more efficient loading. Human cells express two forms of POT1 from alternatively spliced mRNAs. The abundance of the short form, POT1–55, which lacks the first OB-fold required for DNA binding, is approximately tenfold lower than the abundance of full-length POT1 (42). The function of the truncated protein remains to be established. Interestingly, mouse cells have two POT1 genes, POT1a and POT1b (43, 44). Both proteins associate with telomeres and share similar sequences and domain structures. However, they are not functionally redundant. POT1a is an essential gene, as its deletion leads to early embryonic lethality, while POT1b deficient mice are viable (43). The roles of the two mouse POT1 proteins are discussed below. Studies of the functionally divergent POT1s in rodents have provided interesting implications for their human counterpart.

2.2.1.4

RAP1

The sixth shelterin component, RAP1 is a binding partner of TRF2 (45). The interaction between the two factors is required for the recruitment of RAP1 to telomeric DNA and is essential for the stability of RAP1 protein levels (45). The exact function of RAP1 remains to be determined but mice lacking RAP1 are not viable suggesting that it plays an important role in telomere protection

28

N. Dimitrova

(van Overbeek M. and de Lange T., unpublished data). Although there are not any known direct binding partners of RAP1, it is likely that its BRCT and Myb domains are involved in protein–protein interactions of functional importance.

2.2.1.5

Perspective

Taken as a whole, the intricate interconnections between the different members of shelterin ensure that the complex has high affinity and specificity for telomeric DNA. Indeed, shelterin is highly abundant exclusively at telomeres and its known functions are restricted to telomere maintenance. At the same time, the redundancy of some of the recruitment mechanisms allows for flexibility. It remains to be determined whether different shelterin subcomplexes might be required to execute diverse functions and whether plasticity in the shelterin complex might be essential for structural remodeling of the telomeric DNA as cells progress through the cell cycle.

2.2.2

Telomere-Associated Proteins in Human Cells

In addition to shelterin, a number of other proteins have been detected at human telomeres. Most of these factors are DNA damage signaling and repair molecules that have been implicated to associate transiently with telomeres and to perform essential accessory functions in telomere maintenance. However, all of these proteins have primary functions that are independent from telomere biology. Examples of such factors include the Mre11 complex (46), which is thought to sense the presence of double-strand breaks and to participate in the homologous recombination pathway of DNA repair; XPF/ERCC1 (47), a component of the nucleotide-excision repair pathway; Apollo (48, 49), a putative 50 exonuclease; DNA-PKcs (50, 51), the PIKK kinase involved the nonhomologous end-joining (NHEJ) pathway; Ku70/80 (50, 52, 53), also involved at the first step of the NHEJ pathway; BLM and WRN RecQ helicases (54–57), implicated in branch migration of recombination structures; Rad51D (58), a factor with a potential role in homologous recombination; and others. Deficiency in some of these factors leads to telomere phenotypes and has also been independently implicated in human diseases. For example, Apollo knockdown leads to extensive DNA damage signaling at chromosome ends and aberrant telomere structures (48, 49). DNA-PKcs and Rad51D deficiencies, on the other hand, result in mild fusion phenotypes (58, 59). In the case of WRN helicase, its deficiency causes loss of lagging-strand telomeres (54), while mutations in the protein have been associated with Werner’s syndrome (reviewed in (60)). Similarly, BLM helicase is mutated in Bloom’s syndrome patients. Whether or not some of the symptoms in Werner’s and Bloom’s patients are caused by telomere dysfunction has not been conclusively determined. As described below, the main protective function of shelterin is to mask the chromosome ends from recognition by the DNA damage signaling and repair

2 Telomere-Binding Proteins in Humans

29

machineries. Therefore, it seems paradoxical that factors involved in these pathways are specifically recruited to telomeres. It is possible that their function is tailored in the context of shelterin to service telomeres without activating their respective signaling and repair pathways.

2.3

Shelterin Shapes Telomeric DNA into a Protected Structure

To maintain genome integrity, cells have evolved extensive mechanisms for immediate detection and repair of DNA damage. Double-strand breaks (DSBs), in particular, are highly toxic lesions. A single unrepaired or incorrectly repaired DSB can lead to significant loss of genetic information as a portion of the chromosome is detached from the centromere and might be missegregated in the following round of cell divisions. This can cause cell death, mutations, and chromosomal translocations, and can lead to diseases such as cancer. Unavoidably, in all eukaryotic cells, chromosome ends resemble DSBs and need to be masked to prevent recognition by the DNA damage signaling and repair machineries. Hiding chromosome ends into protected and veiled structures is the essential function of shelterin (5). This is achieved in several steps, which closely resemble the initial reactions of DNA repair mediated by the homologous recombination (HR) pathway. Normally, the HR machinery is involved in the error-free repair of DSBs. The first step in HR is the nucleolytic generation of a 30 overhang, which then strand invades a homologous region on the sister chromatid. In the following step, a Holliday junction intermediate is formed as a result of branch migration. Finally, upon completion of the repair reaction, the Holliday junction is resolved by resolvases to separate the two sister chromatids.

2.3.1

The Role of Shelterin in Generation of the 30 Overhang

An important requirement for telomere protection is the generation of a 30 overhang (Fig. 2.3a). Upon completion of DNA replication, the chromosome ends are either blunt or have a short 10–15 base pairs 30 extension on the lagging-strand chromosome. In most human cells, the average length of the telomeric overhang is 50–300 nucleotides (10, 61). This long single-stranded extension is generated by the action of an unknown nuclease(s) that resects the 50 strand (3, 9). Recent data suggest that the activity of the nuclease(s) might be regulated by POT1 (Fig. 2.3b). Human telomeres terminate precisely on CCAATC-50 on the resected strand but the exact end is randomized upon downregulation of POT1 protein levels by RNAi (42, 62). It is not known whether human POT1 interacts directly with the nuclease(s) to control its processivity or prevents excessive resection by binding to the DNA. One piece of evidence in favor of the second

30

N. Dimitrova

Fig. 2.3 Shelterin remodels chromosome ends into a protective structure. (a) The generation of the 30 telomere overhang is nuclease-dependent. Upon completion of DNA replication, chromosome ends are either blunt (leading-strand chromosome, bottom) or have a short 10–15 nt 30 extension due to the end-replication problem (lagging-strand chromosome, top). Unknown nuclease(s) resects the 50 strand to generate the overhang. (b) Regulation of nuclease activity by POT1. POT1 determines the precise CCAATC-50 end of human telomeres and regulates overhang length. As the preferred binding site of POT1 is located only 2 nt away from the precise 50 end, it is possible that POT1 determines the extent of 50 strand degradation by binding to the single-stranded DNA and directly inhibiting nuclease activity. (c) TRF1 and TRF2 mediate the stand invasion event, when the single-stranded overhang invades the double-stranded portion of the telomere and base pairs with the complimentary strand to generate the t-loop. (d) T-loop. The t-loop configuration is a protective structure, in which the 30 end of the chromosome is tucked away, possibly as a mechanism to evade recognition by the DNA damage signaling and repair machineries. The t-loop most likely recruits shelterin as shown. The displaced strand (D loop) is presumably coated with POT1, recruited by TRF1/TRF2 shelterin complexes bound to the double-stranded portions of the t-loop

2 Telomere-Binding Proteins in Humans

31

model is that the preferred POT1 DNA-binding site is located only 2 nucleotides away from the 50 end (39). Strikingly, deletion of mouse POT1b, one of the two POT1 genes in rodents, leads to extreme overhang elongation (43). This is seen both in mouse embryonic fibroblasts (MEFs) isolated from POT1b-deficient embryos and in liver samples taken from adult POT1b-deficient mice. The increase in single-stranded TTAGGG repeats is attributed to excessive 50 –30 nucleolytic activity and the resulting degradation of the C-rich 50 strand. Although POT1b-deficient mice are viable, the excessive loss at the 50 strand leads to progressive telomere shortening. Upon prolonged culture of POT1b-deficient MEFs, as telomere length erodes to a critical level, there is also evidence for significant genome instability and chromosome endto-end fusions (63). It is not known yet whether human POT1, which sets the 50 end sequence, has a similar role in preventing excessive nucleolytic degradation at the telomere terminus. On the contrary, experimental evidence suggests that downregulation of POT1 in human cells by RNAi leads to a slight but reproducible overhang loss (42). However, this result could be an artifact of incomplete knockdown of POT1 protein levels and the discrepancy can only be addressed in complete absence of human POT1. Theoretically, if human POT1 played a role in regulating the nucleolytic generation of the telomere overhang, then mutations in human POT1 that prevent control over the nuclease(s) would lead to progressive telomere erosion. The existence of such POT1 mutations would have profound implications for genome instability and tumorigenesis.

2.3.2

T-Loop Formation

Once the overhang is generated, the next step in telomere protection is thought to be the formation of a lariat structure at the chromosome terminus, referred to as telomeric loop (t-loop). In the t-loop configuration, the single-stranded telomeric DNA invades the double-stranded portion of the telomere, displaces the G-rich strand, and base pairs with the complementary strand (Fig. 2.3c, d). The predicted role of t-loops is to effectively shield the chromosome end from nucleolytic attack and from recognition by DNA damage factors (reviewed in (64) ). T-loops of purified human telomeres, which have been cross-linked to maintain structure integrity, can be directly visualized by electron microscopy (65). Analysis of the structural features confirms a strand invasion event, including the presence of single-stranded G-rich strand, which forms a displacement loop (D loop). The size range of t-loops is heterogeneous and roughly correlates with the total telomere length, suggesting that the strand invasion takes place at a random site along the telomere duplex array (65). Recently, electron microscopy analysis of whole telomere chromatin isolated from chicken erythrocytes and mouse splenocytes further revealed the presence of intact nucleosome arrays along the t-loop structures (66).

32

N. Dimitrova

So far, no assay has been developed to test for the presence of t-loops in vivo in human cells. The current model argues that t-loops are probably present at all chromosome ends, throughout the cell cycle, except perhaps temporarily during S-phase when the passage of the replication machinery would release the invading strand, thereby revealing a naked or POT1-bound single-stranded DNA end. Both TRF1 and TRF2 have been implicated to play roles in t-loop formation. In vitro data suggest that TRF2 has the ability to remodel DNA. To begin with, when recombinant TRF2 is incubated with a duplex TTAGGG repeat array containing a 30 single-stranded overhang, 10–15% of the resulting complexes resemble t-looplike structures generated by a strand invasion event (65, 67). Biochemical analysis further suggests that TRF2 has the ability to modify DNA topology and more specifically, to induce untwisting of neighboring DNA, thereby promoting strand invasion (68). TRF1 also has in vitro DNA remodeling capacity including ability to bend, loop, and pair distant regions containing telomeric repeats (20, 23, 24). The versatility of TRF1 in modifying telomeric DNA topology is attributed to the structural flexibility of the region between its dimerization domain and DNAbinding domain, which allows two TRF1 molecules to bind to spatially distant telomeric repeats while maintaining a dimerized core (20). It is also likely that some of the telomere-associated factors described above may also participate in t-loop assembly. In particular, the Mre11 complex and BLM helicase have the functional requirements to promote t-loop formation and/or resolution but experimental evidence in support of this hypothesis is lacking.

2.3.3

Prevention of Inappropriate T-Loop Deletion

The final product of t-loop formation is a structure that closely resembles an HR intermediate. On the basis of the predicted structure, the t-loop contains a Holliday junction-like configurations. If resolved, the result would be the circularization of the t-loop and significant shortening of the remaining telomere (69). This phenotype is similar to the telomere rapid depletion (TRD) events observed in yeast (70). Evidence strongly argues that TRF2 is involved in preventing inappropriate resolution of the t-loop. Overexpression of a mutant allele of TRF2 lacking the aminoterminal basic domain (TRF2DB) leads to excessive telomere loss and increased appearance of telomere sequence-containing circles that are approximately the size of t-loops (71). The telomere loss phenotype, referred to as t-loop HR, is abrogated in XRCC3 and NBS1-deficient cells, implicating the involvement of the HR pathway (71). It remains to be established why introduction of TRF2DB leads to t-loop deletion. One possibility is that the overexpressed protein titrates a factor that plays a role in maintaining t-loops. Another possibility is that the basic domain of TRF2 is directly involved. This model is strongly supported by biochemical experiments demonstrating that TRF2 but not TRF2DB binds to replication forks

2 Telomere-Binding Proteins in Humans

33

and four-way junctions in vitro in a structure-specific although sequence-independent manner (72). These data predict that TRF2 robustly interacts with a t-loopspecific structure and either stabilizes it to prevent branch migration or spatially prevents the access of a resolvase. T-loop deletion involves inappropriate processing of the chromosome terminus that can lead to significant telomere loss. Interestingly, telomeric circles have also been detected at low frequency in a variety of human cells, suggesting that they can occur spontaneously (71). It remains to be determined whether sporadic t-loop deletion contributes to stochastic shortening of human telomeres. If t-loop deletion led to complete telomere erosion, such events, even if extremely rare, would significantly promote genome instability. In addition, increased presence of telomere circles has been detected in alternative lengthening of telomeres (ALT) cells (71, 73). The recombination-based ALT pathway is active in many tumor cell lines that have undetectable telomerase activity and is an alternative mechanism for maintaining telomere length (reviewed in (74)).

2.4

Suppression of the ATR and ATM DNA Damage Response Pathways

In summary, the t-loop effectively solves the problem of having an exposed DNA end at the chromosome terminus by masking it into a circular structure. However, t-loops still contain features that would be recognized by the DNA damage surveillance machinery – the single-stranded DNA on the D loop and several regions with single-stranded double-stranded transitions. Again, the shelterin complex is responsible for suppressing the activation of the DNA damage surveillance machinery at those sites.

2.4.1

Suppression of ATR Pathway

Stretches of single-stranded DNA are recognized as sites of damage by the ATR pathway. The ATRIP/ATR complex is recruited to RPA-coated single-stranded DNA (75). The ATR kinase induces cell cycle arrest through the phosphorylation and activation of the downstream checkpoint kinase Chk1 (76). The ATR pathway responds primarily to single-stranded breaks such as generated by replication fork stalling or UV-induced damage. Telomeres also contain stretches of single-stranded DNA even when the 30 overhang is base-paired as in the t-loop configuration, because the D loop is exposed and can potentially recruit RPA and activate the ATR pathway (65). Recent data on mouse and human cells suggest that POT1 is the shelterin component that prevents the activation of the ATR pathway at telomeres (77) (Fig. 2.4). Conditional deletion of POT1a or knockdown of its recruiter, TPP1, in

34

N. Dimitrova

Fig. 2.4 Shelterin protects chromosome ends from recognition by the DNA damage signaling and repair machineries. TRF2 complex inhibits the activation of the ATM pathway and prevents nonhomologous end-joining (NHEJ) of telomeres (left). In the absence of TRF2, ATM is activated and phosphorylates Chk2 kinase, which in turn promotes the p53/p21 pathway, leading to senescence or apoptosis, depending on the cell type. Active ATM kinase also leads to the accumulation of multiple DNA damage response factors, including g-H2AX and MDC1, at chromosome ends, which can promote the NHEJ pathway at telomeres (middle panel). The overhang is cleaved in a reaction dependent on the XPF/ERCC1 endonuclease, the Ku70/80 complex is loaded on the resulting ends and DNA ligase IV executes the fusion reaction. Chromosome end-to-end fusions can be deleterious as they lead to the formation of dicentric chromosomes that cannot segregate properly during mitosis. On the other hand, POT1 (bound along the overhang or on the D loop) suppresses the ATR signaling pathway (right). Upon loss of POT1, ATR is activated and phosphorylates and activates the downstream Chk1 kinase. In the absence of TRF2, ATM, and POT1 in mouse cells, ATR activation also promotes the NHEJ pathway

2 Telomere-Binding Proteins in Humans

35

MEFs leads to acute activation of the DNA damage response at chromosome termini (40, 43, 44). This involves the recruitment of the DNA damage response factors g-H2AX and 53BP1 to telomeres. In addition, Chk1 is phosphorylated suggesting that the downstream signaling pathway is triggered. The activation of the DNA damage pathway in response to TPP1/POT1a loss is dependent on the ATR kinase (77). When ATR protein levels are downregulated by RNAi, the damage response is abrogated. One possibility is that POT1 prevents the activation of damage signaling by competing with RPA for the binding to the single-stranded telomeric DNA. The high specificity of POT1 for telomeric sequence combined with its high abundance at the chromosome end might be important factors that allow POT1 to efficiently coat the single-stranded DNA on the D loop or along the overhang. Human POT1 plays a similar role in preventing ATR activation as mouse POT1a. On the other hand, human cells that overexpress mutant POT1, which lacks the first OB-fold required for DNA binding, POT1DOB, proliferate normally (37). This contradicts the model that POT1 coats single-stranded DNA to mask it from recognition by the DNA damage machinery and competes directly with RPA for binding at those sites. However, the presence of endogenous POT1 in these experiments might be enough to suppress ATR activation.

2.4.2

Suppression of ATM Pathway

TRF2 is responsible for the suppression of the ATM pathway (77) (Fig. 2.4). ATM kinase, in contrast to ATR, responds primarily to the presence of DSBs and its principal downstream effector is the Chk2 kinase (78). In TRF2-deficient MEFs, telomeres activate the ATM-dependent pathway, including the recruitment of a number of DNA damage response factors, such as g-H2AX, MDC1, 53BP1 and the Mre11 complex, to chromosome ends (27). Loss of TRF2 also leads to the autophosphorylation of the ATM kinase, which in turn phosphorylates and activates Chk2. Telomere dysfunction can also be induced in human cells, when the function of human TRF2 is suppressed as a result of the overexpression of a dominant negative allele of TRF2, which lacks the amino-terminal basic and the carboxy-terminal Myb domains (TRF2DBDM) (79). The dominant negative allele dimerizes with the endogenous protein but since it lacks the DNA-binding domain, the resulting heterodimer does not localize to telomeres. In addition to activating the canonical ATM pathway (80), as described above, exogenous introduction of TRF2DBDM results in p53-dependent cell cycle arrest or apoptosis, depending on the cell type (81, 82). There are several models as to how TRF2 prevents the activation of ATM kinase at functional telomeres. First, TRF2 might be required to maintain the terminal structure, which in trun may repress DNA damage signaling by preventing the binding of the sensor in the ATM pathway. It is likely that the role of TRF2 in promoting t-loop formation may be required to prevent activation of the ATM

36

N. Dimitrova

pathway. A complementary model suggests that TRF2 directly inhibits the activation of ATM kinase. TRF2 binds weakly to ATM in a region that contains the residue Serine 1981, one of the autophosphorylation sites that promote ATM activation (85). Furthermore, overexpression of TRF2 reduces the ATM-dependent response to irradiation-induced damage. As a result, both the activation of downstream effectors and the induction of cell cycle arrest are significantly diminished (85). Presumably, since TRF2 is exclusively enriched at chromosome termini and not elsewhere in the cell, ATM activation would be specifically dampened in the vicinity of telomeres. Therefore, even if telomeres present DNA structures that would normally signal to the ATM pathway, TRF2 locally suppresses any downstream propagation.

2.5

Prevention of Inappropriate NHEJ and HR Repair at Chromosome Ends

In addition to suppressing the activation of ATR and ATM signaling, shelterin efficiently prevents inappropriate repair reactions at chromosome ends (Fig. 2.4). The consequences of aberrant repair processing of telomeres in human cells can be deleterious. In particular, fused chromosomes, which have been joined end-to-end, are dicentric and cannot properly segregate in mitosis. Instead, they propagate the bridge-breakage-fusion cycle (86), which can lead to extensive genomic instability as chromosomes are broken and rejoined at random places each cell division. The role of shelterin in suppressing inappropriate repair at telomeres can be best appreciated in the setting when loss of TRF2 function leads to uncapping of chromosome ends. Upon inhibition of TRF2 – both in the TRF2 conditional knockout MEFs and upon exogenous overexpression of the TRF2DBDM allele in human cell – telomere-mediated protection is lost and chromosome ends undergo extensive processing (27, 79). The consequences are striking. Metaphase spreads collected five days after deletion of TRF2 reveal that virtually all chromosomes have fused to one another, creating long trains, with the telomeric DNA retained at the sites of fusion (27). Evidence for the involvement of the NHEJ pathway came from genetic experiments, which showed that Ku70 and DNA ligase IV are essential factors executing the end-joining of dysfunctional telomeres (27, 83, 84). In addition, the 30 telomere overhangs are removed by the XPF/ERCC1 endonuclease promoting the NHEJ reaction (47). Interestingly, in mouse cells overhang cleavage and end-joining are coupled, while in human cells the two processes can occur independently (27, 87). As overhang loss is a prerequisite for the execution of the NHEJ reaction, it is possible that TRF2 prevents inappropriate repair by hiding the overhang into the t-loop structure. Furthermore, the circular configuration of t-loops would prevent the first step of NHEJ – loading of the Ku70/80 complex on a free double-stranded DNA end. In addition, the binding partner of TRF2, RAP1 may be directly involved

2 Telomere-Binding Proteins in Humans

37

in preventing end-joining of short telomere arrays in an in vitro reconstituted system, even in the absence of t-loop formation (88). It has not been established yet whether RAP1 inhibits the NHEJ pathway in vivo. Finally, it is possible that TRF2 prevents the activation of repair in part by suppressing ATM-mediated DNA damage signaling. Although DNA damage signaling and repair have been viewed as largely separate processes but recent data suggest that they are intrinsically connected. More specifically, phosphorylation of H2AX by ATM kinase and recruitment of MDC1 to g-H2AX-coated chromatin at TRF2-depleted telomeres significantly accelerates NHEJ (87). In the absence of H2AX and MDC1, the joining of dysfunctional telomeres is notably delayed. Therefore, TRF2 might partially suppress repair by preventing activation of the ATM pathway. In support, TRF2- and ATM-deficient MEFs, which fail to activate the telomere damage response, also do not contain telomere end-to-end fusions (77). On the other hand, NHEJ is not a consequence of POT1 loss, despite the activation of DNA damage signaling at telomeres, suggesting that the presence of functional TRF2 is crucial for the repression of inappropriate repair (42, 43, 77). There is evidence that telomere fusions can also occur naturally, as cells approach senescence. Recent study documents fusions of critically short telomeres in a fibroblast population that is ongoing cell divisions past the senescence setpoint (89), underscoring the importance of understanding the role of shelterin in suppressing inappropriate repair processes. Interestingly, TRF2 plays a role in the repression of the HR pathway as well. As described above, dysfunctional telomeres resulting from TRF2 loss are repaired primarily through the NHEJ pathway. However, in the absence of Ku70 and a functional NHEJ pathway, deletion of TRF2 does not lead to overhang loss and does not result in telomere fusions. Instead, extensive HR between sister telomeres takes place, leading to numerous telomeric sister-chromatid exchanges (T-SCEs) (84). One interpretation of this data is that a TRF2 and Ku-dependent mechanism exists that suppresses T-SCEs to prevent drastic telomere length changes that would be an inevitable consequence of unequal exchanges.

2.6 2.6.1

Telomere Length Regulation by the Shelterin Complex Shelterin-Mediated Control of Telomerase

Telomerase is active in the germ line and inappropriately activated in the majority of human cancers. In those cases, telomerase functions to counteract telomere shortening and to maintain a stable telomere length setting. It has been firmly established that telomerase is regulated by a negative feedback loop that involves shelterin (reviewed in (90)) (Fig. 2.5). In short, addition of more telomeric repeats by telomerase leads to the recruitment of more shelterin, which in turn has the ability to inhibit telomerase recruitment and/or activity.

38

N. Dimitrova

Fig. 2.5 Shelterin regulates telomere length homeostasis. Long telomeres contain more shelterin (top panel). The increased amount of shelterin bound at the double-stranded portion of the telomere increases the chance that POT1/ TPP1 will be loaded at the 30 terminus and block the access of telomerase to its substrate. Short telomeres or inhibition of shelterin (bottom panel) results in inefficient loading of POT1/ TPP1 on the overhang or leads to loading of POT1/ TPP1 at an internal site. POT1/ TPP1 complex that is not located at the 30 terminus might have a positive effect on telomerase recruitment and/or processivity, thus promoting elongation of short telomeres

2.6.1.1

TRF1

TRF1 was the first shelterin component implicated in telomere length homeostasis in human cells. Two initial experiments suggested that TRF1 is a negative regulator of telomerase (91). On the one hand, long-term overexpression of TRF1 resulted in gradual and progressive telomere shortening, even in the presence of telomerase. On the other hand, significant telomere elongation was induced when the binding of endogenous TRF1 to telomeric repeats was prevented. Next, it was shown that more TRF1 is recruited to longer telomeres (37, 92) and that TRF1 exercises its inhibitory effect on telomerase only in cis (93). Taken together, these experiments led to the conclusion that TRF1 plays a role in a ‘‘protein counting’’ mechanism, which presumes that the length of the telomeric array is translated into number of TRF1 molecules bound to telomere repeats (91, 94).

2.6.1.2

POT1 and TPP1

In turn, TRF1 transmits the signal through TIN2 and TPP1 to the terminal effector, POT1 (37). POT1 binds to single-stranded DNA, the site where telomerase acts, and therefore, has the potential to negatively affect the recruitment of the enzyme.

2 Telomere-Binding Proteins in Humans

39

Evidence in support of this model came from experiments in which POT1DOB, a mutant allele of POT1, which lacks the crucial domain for DNA binding, is introduced into telomerase-positive cells (37). The outcome is rapid and extensive telomere elongation that occurs in the absence of any other significant alterations to the shelterin complex. The interpretation of these experiments is that POT1 has the ability to convey the ‘‘protein counting’’ signal from TRF1 to the telomere terminus, where, by binding to the single-stranded DNA end, POT1 directly inhibits the access of telomerase to its substrate (95, 96). Recent structural data further suggested that the POT1–TPP1 complex is conserved and analogous to the ciliate TEBPa/b complex, which is responsible for overhang protection (41, 97). This correlation led to the intriguing possibility that POT1–TPP1 might act as a unit to regulate telomere length homeostasis. Strikingly, POT1 and TPP1 complexed with telomeric DNA demonstrated an ability to significantly increase the activity and processivity of the human telomerase core enzyme (97). In addition, although TPP1 enhanced the binding of POT1 to single-stranded DNA, thereby inhibiting the access of telomerase to its substrate, TPP1 also directly interacted with telomerase, possibly playing a role in its recruitment to chromosome ends (41). Therefore, it is conceivable that POT1–TPP1 complex acts both as a negative and as a positive regulator of telomerase (41). The current model argues that POT1–TPP1 complex switches from inhibiting the access of telomerase to the telomere to serving as a processivity factor for telomerase during telomere extension (97). It remains to be determined what circumstances promote one state vs. the other.

2.6.1.3

TRF2 and RAP1

Other shelterin factors are also involved in the regulation of telomere length. Overexpression of TRF2 leads to telomere shortening (98), while expression of RAP1 mutants affects the heterogeneity of telomere length (99). Although the role of these two factors in telomere length homeostasis is less well defined, they might affect indirectly the TRF1-TPP1-POT1 axis within the context of the shelterin complex. It is also possible that TRF2 and RAP1 function independently by recruiting an unknown factor(s) involved in telomerase regulation.

2.6.1.4

Tankylase 1

Another level of telomere length control is exercised through an enzyme called tankyrase 1, which modifies TRF1 (33). Tankyrase 1 is one of the telomere-associated proteins that are recruited to telomeres but whose abundance is much less compared with that of the shelterin subunits. Tankyrase 1 is of particular interest because in human cells it has the ability to add poly-ADP-ribose

40

N. Dimitrova

(PAR) chains to a motif located in the amino-terminal part of TRF1. As a consequence of this modification (referred to as PARsylation), TRF1 detaches from telomeric DNA (33). Thus, when tankyrase 1 is overexpressed, telomeres undergo progressive elongation (100). This is explained by decreased recruitment of TRF1 to telomeres and the resulting relief of negative regulation on telomerase activity. Conversely, when tankyrase 1 is inhibited, telomeres shorten, consistent with a situation when in the absence of tankyrase the binding of TRF1 to telomeres is promoted (101, 102). Interestingly, TIN2 is also involved in this pathway and has the capacity to protect TRF1 from tankyrase 1-dependent modification (34). As tankyrase 1 has additional roles in other cellular processes, including mitosis (103), it would be interesting to dissect the pathway that regulates its activity at telomeres.

2.6.1.5

Perspective

Most of the studies in the past have focused on the negative regulation exerted by shelterin on telomerase activity. However, a recent report demonstrated that the protein levels of telomerase within the nucleus are very limited (around 20 molecules per cell) (104). An independent study provided evidence that limiting telomerase levels are, in fact, required for the maintenance of stable telomere length (105). These new concepts opened the possibility that telomerase might need help from shelterin to localize to chromosome ends that require elongation. The data that POT1–TPP1 complex plays a role in positively regulating the processivity of the telomerase enzyme and may promote its recruitment to telomeres fit with that model (41, 97).

2.6.2

Telomere Length Homeostasis in the Absence of Telomerase

Telomerase is not active in most human somatic cells. Therefore, in the absence of telomere elongation, the length homeostasis in these cells depends primarily on the rate of telomere shortening. As mentioned earlier, telomeres erode as a result of the end-replication problem and as a consequence of nucleolytic degradation each cell division. In the absence of telomerase, shelterin controls the extent of the nuclease activity and thereby is the main factor involved in telomere length regulation. As telomeres gradually shorten to a critical length, the progressively diminishing levels of shelterin at telomeres remain the primary factor maintaining chromosome ends. This is supported by evidence that even though overexpression of TRF2 in primary human cells increases the rate of telomere shortening, the telomere length at senescence, defined as senescence setpoint, is reduced from 7 to 4 kilobases (98). In this setting, overexpressed TRF2 is capable of protecting critically short telomeres and preventing chromosome end fusions. Thus, senescence is induced by a

2 Telomere-Binding Proteins in Humans

41

change in the protected status of shortened telomeres rather than by a complete loss of telomeric DNA and increased presence of shelterin can delay this event (98). Conversely, reduced shelterin levels might have the opposite effect and induce senescence earlier, even in the presence of relatively long telomeres. Recently, it was determined that the minimum telomere array detected in human presenescent cells spans between 7 and 14 TTAGGG repeats (89). Telomeres that have eroded beyond that level may no longer recruit sufficient shelterin to maintain integrity and are likely to activate the DNA damage machinery and become fusogenic (106–108). As a consequence of excessive telomere shortening, their genomes may become highly unstable. It is precisely at that moment that inappropriate activation of telomerase would significantly promote tumorigenesis by stabilizing the telomere length of cells that have already acquired genomic alterations (reviewed in (109)). Under normal circumstances, this is avoided by the activation of the senescence program, which leads to permanent cell cycle arrest (reviewed in (110)). It would be of particular significance to determine whether shelterin participates in this process. For example if, as described above, shelterin plays a dual role in the regulation of telomerase – then the absence of shelterin at eroded telomeres might also preclude inappropriate telomerase activity at those chromosome ends. Alternatively, elevated levels of shelterin, TRF2 in particular, might prevent chromosome instability even when telomeres have become critically short. This would be especially important in situations when additional mutations in the DNA damage signaling pathway delay or compromise the execution of the senescence program. Dissecting how and at what point cycling cells with a functional shelterin complex at telomeres transition to senescence is essential for our understanding of tumorigenesis.

2.7

Concluding Remarks

The role of shelterin at human telomeres is multifaceted and intricate. It is truly amazing that a single complex can accomplish such a variety of different tasks – from structural remodeling of the chromosome terminus, to suppression of the DNA damage signaling and repair machineries, to regulation of telomere-length homeostasis. In all of these cases, however, it seems that shelterin has to carry out seemingly contradictory functions. For example, shelterin allows for plasticity as cells progress through the cell cycle and chromosome termini undergo DNA replication, but at all times shelterin maintains its robust protective function. As discussed, a failure of shelterin to shield telomeres would have deleterious consequences for the cell as chromosome ends are recognized as sites of DNA damage and activate checkpoint signaling. In addition, shelterin prevents inappropriate signaling and repair but at the same time recruits various DNA damage signaling and repair factors to chromosome ends. It remains to be established how the activities of these factors are regulated at functional telomeres. Finally, shelterin seems to simultaneously promote and inhibit telomerase activity. It is crucial to

42

N. Dimitrova

comprehend the contrasting roles of shelterin in telomerase regulation, as defects in telomere-length maintenance can lead to severe disorders at the level of the organism. Dyskeratosis congenita is an example of a syndrome resulting from significant telomere loss, while the opposite, inappropriate maintenance of telomere length, is a hallmark of cancer. Therefore, a deeper understanding of shelterin will not only expand our knowledge of cell biology, but will also provide crucial implications for human health.

References 1. Mcclintock B, The stability of broken ends of chromosomes in zea mays. Genetics 1941; 26:234–82. 2. Moyzis RK, Buckingham J, Cram L et al. A highly conserved repetitive DNA sequence, (TTAGGG)n, present at the telomeres of human chromosomes. Proc Natl Acad Sci USA 1988; 85:6622–26. 3. Makarov VL, Hirose Y, Langmore JP. Long g tails at both ends of human chromosomes suggest a c strand degradation mechanism for telomere shortening. Cell 1997; 88:657–66. 4. Zhong Z, Shiue L, Kaplan S, De Lange T. A mammalian factor that binds telomeric ttaggg repeats in vitro. Mol Cell Biol 1992; 12:4834–43. 5. De Lange T. Shelterin: The protein complex that shapes and safeguards human telomeres. Genes Dev 2005; 19:2100–10. 6. Harley CB. Telomere loss: Mitotic clock or genetic time bomb? Mutat Res 1991; 256:271–82. 7. Watson JD. Origin of concatemeric t7 DNA. Nat New Biol 1972; 239:197–201. 8. Olovnikov AM. A theory of marginotomy. The incomplete copying of template margin in enzymic synthesis of polynucleotides and biological significance of the phenomenon. J Theor Biol 1973; 41:181–90. 9. Hemann MT, Greider CW. G-strand overhangs on telomeres in telomerase-deficient mouse cells. Nucleic Acids Res 1999; 27:3964–69. 10. Huffman KE, Levene SD, Tesmer VM, Shay JW, Wright WE. Telomere shortening is proportional to the size of the g-rich telomeric 30 -overhang. J Biol Chem 2000; 275:19719–22. 11. Levy MZ, Allsopp RC, Futcher AB, Greider CW, Harley CB. Telomere end-replication problem and cell aging. J Mol Biol 1992; 225:951–60. 12. Harley CB, Futcher AB, Greider CW. Telomeres shorten during ageing of human fibroblasts. Nature 1990; 345:458–60. 13. Hayflick L. The limited in vitro lifetime of human diploid cell strains. Exp Cell Res 1965; 37:614–36. 14. Bodnar AG, Ouellette M, Frolkis M et al. Extension of life-span by introduction of telomerase into normal human cells. Science 1998; 279:349–52. 15. Morales CP, Holt SE, Ouellette M et al. Absence of cancer-associated changes in human fibroblasts immortalized with telomerase. Nat Genet 1999; 21:115–18. 16. Kim NW, Piatyszek MA, Prowse KR et al. Specific association of human telomerase activity with immortal cells and cancer. Science 1994; 266:2011–15. 17. Shay JW, Pereira-Smith OM, Wright WE. A role for both rb and p53 in the regulation of human cellular senescence. Exp Cell Res 1991; 196:33–39. 18. Bilaud T, Brun C, Ancelin K, Koering CE, Laroche T, Gilson E. Telomeric localization of trf2, a novel human telobox protein. Nat Genet 1997; 17:236–39.

2 Telomere-Binding Proteins in Humans

43

19. Broccoli D, Smogorzewska A, Chong L, De Lange T. Human telomeres contain two distinct myb-related proteins, trf1 and trf2. Nat Genet 1997; 17:231–35. 20. Bianchi A, Stansel RM, Fairall L, Griffith JD, Rhodes D, De Lange T. Trf1 binds a bipartite telomeric site with extreme spatial flexibility. Embo J 1999; 18:5735–44. 21. Court R, Chapman L, Fairall L, Rhodes D. How the human telomeric proteins trf1 and trf2 recognize telomeric DNA: A view from high-resolution crystal structures. EMBO Rep 2005; 6:39–45. 22. Hanaoka S, Nagadoi A, Nishimura Y. Comparison between trf2 and trf1 of their telomeric DNA-bound structures and DNA-binding activities. Protein Sci 2005; 14:119–30. 23. Bianchi A, Smith S, Chong L, Elias P, De Lange T. Trf1 is a dimer and bends telomeric DNA. Embo J 1997; 16:1785–94. 24. Griffith J, Bianchi A, De Lange T. Trf1 promotes parallel pairing of telomeric tracts in vitro. J Mol Biol 1998; 278:79–88. 25. Karlseder J, Kachatrian L, Takai H et al. Targeted deletion reveals an essential function for the telomere length regulator trf1. Mol Cell Biol 2003; 23:6533–41. 26. Iwano T, Tachibana M, Reth M, Shinkai Y. Importance of trf1 for functional telomere structure. J Biol Chem 2004; 279:1442–48. 27. Celli G, De Lange T. DNA processing not required for atm-mediated telomere damage response after trf2 deletion. Nat Cell Biol 2005; 7:712–18. 28. Kim SH, Kaminker P, Campisi J. Tin2, a new regulator of telomere length in human cells. Nat Genet 1999; 23:405–12. 29. Ye JZ, Donigian JR, Van Overbeek M et al. Tin2 binds trf1 and trf2 simultaneously and stabilizes the trf2 complex on telomeres. J Biol Chem 2004; 279:47264–71. 30. Ye JZ, Hockemeyer D, Krutchinsky AN et al. Pot1-interacting protein pip1: A telomere length regulator that recruits pot1 to the tin2/trf1 complex. Genes Dev 2004; 18:1649–54. 31. Kim SH, Beausejour C, Davalos AR, Kaminker P, Heo SJ, Campisi J. Tin2 mediates functions of trf2 at human telomeres. J Biol Chem 2004; 279:43799–804. 32. Houghtaling BR, Cuttonaro L, Chang W, Smith S. A dynamic molecular link between the telomere length regulator trf1 and the chromosome end protector trf2. Curr Biol 2004; 14:1621–31. 33. Smith S, Giriat I, Schmitt A, De Lange T. Tankyrase, a poly(adp-ribose) polymerase at human telomeres. Science 1998; 282:1484–87. 34. Ye JZ, De Lange T. Tin2 is a tankyrase 1 parp modulator in the trf1 telomere length control complex. Nat Genet 2004; 36:618–23. 35. Liu D, Safari A, O’connor MS et al. Ptop interacts with pot1 and regulates its localization to telomeres. Nat Cell Biol 2004; 6:673–80. 36. Baumann P, Cech TR. Pot1, the putative telomere end-binding protein in fission yeast and humans. Science 2001; 292:1171–75. 37. Loayza D, De Lange T. Pot1 as a terminal transducer of trf1 telomere length control. Nature 2003; 424:1013–18. 38. Lei M, Podell ER, Cech TR. Structure of human pot1 bound to telomeric single-stranded DNA provides a model for chromosome end-protection. Nat Struct Mol Biol 2004; 11: 1223–29. 39. Loayza D, Parsons H, Donigian J, Hoke K, De Lange T. DNA binding features of human pot1: A nonamer 50 -tagggttag-30 minimal binding site, sequence specificity, and internal binding to multimeric sites. J Biol Chem 2004; 279:13241–48. 40. Hockemeyer D, Palm W, Else T et al. Telomere protection by mammalian pot1 requires interaction with tpp1. Nat Struct Mol Biol 2007; 14:754–61. 41. Xin H, Liu D, Wan M et al. Tpp1 is a homologue of ciliate tebp-beta and interacts with pot1 to recruit telomerase. Nature 2007; 445:559–62. 42. Hockemeyer D, Sfeir A, Shay J, Wright WE, De Lange T. Pot1 protects telomeres from a transient DNA damage response and determines how human chromosomes end. EMBO J. 2005; 24:2667–78.

44

N. Dimitrova

43. Hockemeyer D, Daniels J, Takai H, De Lange T. Recent expansion of the telomeric complex in rodents: Two distinct pot1 proteins protect mouse telomeres. Cell 2006; 126:63–77. 44. Wu L, Multani A, He H et al. Pot1 deficiency initiates DNA damage checkpoint activation and aberrant homologous recombination at telomeres. Cell 2006; 126:49–62. 45. Li B, Oestreich S, De Lange T. Identification of human rap1: Implications for telomere evolution. Cell 2000; 101:471–83. 46. Zhu XD, Kuster B, Mann M, Petrini JH, De Lange T. Cell-cycle-regulated association of rad50/mre11/nbs1 with trf2 and human telomeres. Nat Genet 2000; 25:347–52. 47. Zhu XD, Niedernhofer L, Kuster B, Mann M, Hoeijmakers JH, De Lange T. Ercc1/xpf removes the 30 overhang from uncapped telomeres and represses formation of telomeric DNA-containing double minute chromosomes. Mol Cell 2003; 12:1489–98. 48. Van Overbeek M, De Lange T. Apollo, an artemis-related nuclease, interacts with trf2 and protects human telomeres in s phase. Curr Biol 2006; 16:1295–302. 49. Lenain C, Bauwens S, Amiard S, Brunori M, Giraud-Panis MJ, Gilson E. The apollo 50 exonuclease functions together with trf2 to protect telomeres from DNA repair. Curr Biol 2006; 16:1303–10. 50. Hsu HL, Gilley D, Blackburn EH, Chen DJ. Ku is associated with the telomere in mammals. Proc Natl Acad Sci USA 1999; 96:12454–58. 51. D’adda Di Fagagna F, Hande MP, Tong WM et al. Effects of DNA nonhomologous endjoining factors on telomere length and chromosomal stability in mammalian cells. Curr Biol 2001; 11:1192–96. 52. O’connor MS, Safari A, Liu D, Qin J, Songyang Z. The human rap1 protein complex and modulation of telomere length. J Biol Chem 2004; 279:28585–91. 53. Song K, Jung D, Jung Y, Lee SG, Lee I. Interaction of human ku70 with trf2. FEBS Lett 2000; 481:81–85. 54. Crabbe L, Verdun RE, Haggblom CI, Karlseder J. Defective telomere lagging strand synthesis in cells lacking wrn helicase activity. Science 2004; 306:1951–53. 55. Lillard-Wetherell K, Machwe A, Langland GT et al. Association and regulation of the blm helicase by the telomere proteins trf1 and trf2. Hum Mol Genet 2004; 13:1919–32. 56. Machwe A, Xiao L, Orren DK. Trf2 recruits the werner syndrome (wrn) exonuclease for processing of telomeric DNA. Oncogene 2004; 23:149–56. 57. Opresko PL, Von Kobbe C, Laine JP, Harrigan J, Hickson ID, Bohr VA. Telomere binding protein trf2 binds to and stimulates the werner and bloom syndrome helicases. J Biol Chem 2002; 277:41110–19. 58. Tarsounas M, Munoz P, Claas A et al. Telomere maintenance requires the rad51d recombination/repair protein. Cell 2004; 117:337–47. 59. Bailey SM, Meyne J, Chen DJ et al. DNA double-strand break repair proteins are required to cap the ends of mammalian chromosomes. Proc Natl Acad Sci USA 1999; 96:14899–904. 60. Ozgenc A, Loeb LA. Current advances in unraveling the function of the werner syndrome protein. Mutat Res 2005; 577:237–51. 61. Wright WE, Tesmer VM, Huffman K, Levene SD, Shay JW. Normal human chromosomes have long g-rich telomeric overhangs at one end. Genes Dev 1997; 11:2801–09. 62. Sfeir A, Chai W, Shay JW, Wright WE. Telomere-end processing the terminal nucleotides of human chromosomes. Mol Cell 2005; 18:131–38. 63. Hockemeyer D, Palm W, Wang RC, Couto SS, De Lange T. Engineered telomere degradation models dyskeratosis congenita. Genes Dev 2008; 22:1773–85. 64. De Lange T. T-loops and the origin of telomeres. Nature Rev Mol Cell Biol 2004; 5:323–29. 65. Griffith JD, Comeau L, Rosenfield S et al. Mammalian telomeres end in a large duplex loop. Cell 1999; 97:503–14. 66. Nikitina T, Woodcock CL. Closed chromatin loops at the ends of chromosomes. J Cell Biol 2004; 166:161–65. 67. Stansel RM, De Lange T, Griffith J. T-loop assembly in vitro involves binding of trf2 near the 30 telomeric overhang. EMBO J 2001; 20:5532–40.

2 Telomere-Binding Proteins in Humans

45

68. Amiard S, Doudeau M, Pinte S et al. A topological mechanism for trf2-enhanced strand invasion. Nat Struct Mol Biol 2007; 14:147–54. 69. Haber J. Telomeres thrown for a loop. Mol Cell 2004; 16:502–03. 70. Bucholc M, Park Y, Lustig AJ. Intrachromatid excision of telomeric DNA as a mechanism for telomere size control in saccharomyces cerevisiae. Mol Cell Biol 2001; 21:6559–73. 71. Wang RC, Smogorzewska A, De Lange T. Homologous recombination generates t-loopsized deletions at human telomeres. Cell 2004; 119:355–68. 72. Fouche N, Cesare AJ, Willcox S, Ozgur S, Compton S, Griffith J. The basic domain of trf2 directs binding to DNA junctions irrespective of the presence of ttaggg repeats. J Biol Chem 2006; 281:37486–95. 73. Cesare AJ, Griffith JD. Telomeric DNA in alt cells is characterized by free telomeric circles and heterogeneous t-loops. Mol Cell Biol 2004; 24:9948–57. 74. Reddel RR. Alternative lengthening of telomeres, telomerase, and cancer. Cancer Lett 2003; 194:155–62. 75. Zou L, Elledge SJ. Sensing DNA damage through atrip recognition of rpa-ssdna complexes. Science 2003; 300:1542–48. 76. Liu Q, Guntuku S, Cui XS et al. Chk1 is an essential kinase that is regulated by atr and required for the g(2)/m DNA damage checkpoint. Genes Dev 2000; 14:1448–59. 77. Lazzerini Denchi E, De Lange T. Protection of telomeres through independent control of atm and atr by trf2 and pot1. Nature 2007; 448:1068–71. 78. Chaturvedi P, Eng WK, Zhu Y et al. Mammalian chk2 is a downstream effector of the atmdependent DNA damage checkpoint pathway. Oncogene 1999; 18:4047–54. 79. Van Steensel B, Smogorzewska A, De Lange T. Trf2 protects human telomeres from end-toend fusions. Cell 1998; 92:401–13. 80. Takai H, Smogorzewska A, De Lange T. DNA damage foci at dysfunctional telomeres. Curr Biol 2003; 13:1549–56. 81. Karlseder J, Broccoli D, Dai Y, Hardy S, De Lange T. P53- and atm-dependent apoptosis induced by telomeres lacking trf2. Science 1999; 283:1321–25. 82. Smogorzewska A, De Lange T. Different telomere damage signaling pathways in human and mouse cells. Embo J 2002; 21:4338–48. 83. Smogorzewska A, Karlseder J, Holtgreve-Grez H, Jauch A, De Lange T. DNA ligase ivdependent nhej of deprotected mammalian telomeres in g1 and g2. Curr Biol 2002; 12:1635. 84. Celli G, Lazzerini Denchi E, De Lange T. Ku70 stimulates fusion of dysfunctional telomeres yet protects chromosome ends from homologous recombination. Nat Cell Biol 2006; 8: 885–90. 85. Karlseder J, Hoke K, Mirzoeva OK et al. The telomeric protein trf2 binds the atm kinase and can inhibit the atm-dependent DNA damage response. PLoS Biol 2004; 2:E240. 86. McClintock B, in The fusion of broken ends of sister half-chromatids following chromatid breakage at meiotic anaphase, Ed. (Garland Publishing, Inc, New York and London, 1938), pp. 1–48. 87. Dimitrova N, De Lange T. Mdc1 accelerates nonhomologous end-joining of dysfunctional telomeres. Genes Dev 2006; 20:3238–43. 88. Bae N, Baumann P. A rap1/trf2 complex inhibits nonhomologous end-joining at human telomeric DNA ends. Mol Cell 2007; 26:323–34. 89. Capper R, Britt-Compton B, Tankimanova M et al. The nature of telomere fusion and a definition of the critical telomere length in human cells. Genes Dev 2007; 21:2495–508. 90. Smogorzewska A, De Lange T. Regulation of telomerase by telomeric proteins. Ann Rev Biochem 2004; 73:177–208. 91. Van Steensel B, De Lange T. Control of telomere length by the human telomeric protein trf1. Nature 1997; 385:740–43. 92. Smogorzewska A, Van Steensel B, Bianchi A et al. Control of human telomere length by trf1 and trf2. Mol Cell Biol 2000; 20:1659–68.

46

N. Dimitrova

93. Ancelin K, Brunori M, Bauwens S et al. Targeting assay to study the cis functions of human telomeric proteins: Evidence for inhibition of telomerase by trf1 and for activation of telomere degradation by trf2. Mol Cell Biol 2002; 22:3474–87. 94. Marcand S, Gilson E, Shore D. A protein-counting mechanism for telomere length regulation in yeast. Science 1997; 275:986–90. 95. Kelleher C, Kurth I, Lingner J. Human protection of telomeres 1 (pot1) is a negative regulator of telomerase activity in vitro. Mol Cell Biol 2005; 25:808–18. 96. Lei M, Zaug AJ, Podell ER, Cech TR. Switching human telomerase on and off with hpot1 protein in vitro. J Biol Chem 2005; 280:20449–56. 97. Wang F, Podell E, Zaug AJ et al. The pot1-tpp1 telomere complex is a telomerase processivity factor. Nature 2007; 445:506–10. 98. Karlseder J, Smogorzewska A, De Lange T. Senescence induced by altered telomere state, not telomere loss. Science 2002; 295:2446–49. 99. Li B, De Lange T. Rap1 affects the length and heterogeneity of human telomeres. Mol Biol Cell 2003; 14:5060–68. 100. Smith S, De Lange T. Tankyrase promotes telomere elongation in human cells. Curr Biol 2000; 10:1299–302. 101. Seimiya H, Muramatsu Y, Smith S, Tsuruo T. Functional subdomain in the ankyrin domain of tankyrase 1 required for poly(adp-ribosyl)ation of trf1 and telomere elongation. Mol Cell Biol 2004; 24:1944–55. 102. Donigian J, De Lange T. The role of the poly(adp-ribose) polymerase tankyrase1 in telomere length control by the trf1 component of the shelterin complex. J Biol Chem 2007; 282:22662–67. 103. Dynek JN, Smith S. Resolution of sister telomere association is required for progression through mitosis. Science 2004; 304:97–100. 104. Cohen S, Me G, Lovrecz G, Bache N, Robinson P, Reddel RR. Protein composition of catalytically active human telomerase from immortal cells. Science 2007; 315:1850–53. 105. Cristofari G, Lingner J. Telomere length homeostasis requires that telomerase levels are limiting. EMBO J 2006; 25:565–74. 106. Bakkenist CJ, Drissi R, Wu J, Kastan MB, Dome JS. Disappearance of the telomere dysfunction-induced stress response in fully senescent cells. Cancer Res 2004; 64:3748–52. 107. D’adda Di Fagagna F, Reaper PM, Clay-Farrace L et al. A DNA damage checkpoint response in telomere-initiated senescence. Nature 2003; 426:194–98. 108. Herbig U, Jobling WA, Chen BP, Chen DJ, Sedivy JM. Telomere shortening triggers senescence of human cells through a pathway involving atm, p53, and p21(cip1), but not p16(ink4a). Mol Cell 2004; 14:501–13. 109. Artandi SE, Depinho RA. A critical role for telomeres in suppressing and facilitating carcinogenesis. Curr Opin Genet Dev 2000; 10:39–46. 110. Campisi J. Cellular senescence as a tumor-suppressor mechanism. Trends Cell Biol 2001; 11:S27–31.

Chapter 3

Regulation of Telomerase Through Transcriptional and Posttranslational Mechanisms Amy N. Depcrynski, Patrick C. Sachs, Lynne W. Elmore, and Shawn E. Holt

Abstract The enzyme telomerase is associated with nearly 90% of human cancers. To better understand telomerase at the molecular level, a number of proteins involved in its regulation, either directly or indirectly, have been identified. This chapter aims to give a broad overview of both transcriptional and posttranslational telomeraseregulating proteins. Telomerase is transcriptionally repressed and activated by proteins acting on the promoter region, such as the Mad/Max heterodimer, c-Myc, p53, and Rb. Various kinases and ubiquitin ligases interact with telomerase, suggesting that phosphorylation and ubiquitination play important roles in inhibiting and activating the enzyme. Also included in this chapter are proteins that regulate localization of hTERT, assembly of hTERT, hTR regulators, and telomere-binding proteins that associate with telomerase. By gaining a better understanding of how telomerase is regulated, we can identify ways to block the enzyme in cancer cells or to activate the enzyme in normal cells as a means of modifying the cellular aging process. Keywords: Telomerase, Aging, Chemotherapeutics, Transcription, Telomere.

3.1

Introduction

In normal human cells, DNA polymerases are unable to replicate the very end of the chromosome, resulting in an inability to maintain telomeres. This phenomenon is known as the ‘‘end-replication problem,’’ which is characterized by cell division and gradual telomere shortening, ultimately leading to the growth-arrest state known as senescence. In cells with unlimited proliferative capacity, the enzyme telomerase maintains chromosome lengths by providing a template and a catalytic subunit to add telomeric sequences. Telomerase is associated with almost 90% of human cancers and nearly 99% of advanced malignancies, making it an obvious S.E. Holt(*) Department of Pathology, at Virginia Commonwealth University, Richmond, VA 23298-0662, e-mail: [email protected]

K. Hiyama (ed.), Telomeres and Telomerase in Cancer. DOI: 10.1007/978-1-60327-879-9_3, # Humana Press, a part of Springer Science + Business Media, LLC 2009 47

48

A.N. Depcrynski et al.

diagnostic and therapeutic target (1). Most normal human cells lack expression of the catalytic subunit of telomerase, hTERT. Therefore, understanding the regulation of telomerase at the molecular level is critical for defining alternatives to blocking the enzyme in tumor cells to treat or prevent cancer, or activating it in normal cells to provide alternatives to cellular aging. In this chapter, we focus on telomerase-regulating proteins in humans, to provide a broad overview of the proteins whose functions, through either direct or indirect interactions with telomerase, have implications in the fields of oncology and aging.

3.2

Transcriptional Regulators

In 1999, the cloning and characterization of the hTERT promoter structure was published (2–5). Regulation of the hTERT subunit seems to be extremely important for carcinogenesis, as the RNA subunit (hTR) is constitutively expressed in most cells (6, 7), while the catalytic subunit (hTERT) is suppressed in normal somatic cells but expressed in tumor cell types (8–10). Ectopic expression of hTERT results in functional telomerase, telomere elongation, and extension of lifespan in a variety of cell types (11). Since then, many groups have undertaken the task of elucidating the genes involved in hTERT activation and regulation to provide a better understanding of telomerase’s role in tumorigenesis and extension of cellular life span. This field of research has led to the discovery of many promising transcription factors; however, none of the proposed factors alone have proven to be clear on/off switches for hTERT expression. The confounding problem is mainly due to the intrinsically complicated regulation of the hTERT gene. The transcriptional regulators discussed here, both positive and negative, include a variety of proteins that could potentially serve as chemotherapeutic targets, as many are oncogenes or involved in tumor suppressor pathways. The fact that so many of the proteins that participate in hTERT also participate tumor formation (or suppression) further implicates telomerase in tumor pathogenesis. The GC-rich hTERT promoter, unlike most promoters, lacks TATA or CCAAT boxes. There is an initiator-like sequence (CCTCTCC), which aids in RNA polymerase II locating the transcription start site in the absence of the TATA box. The promoter also contains Sp1 binding sites, two c-Myc binding sites (E boxes, at nucleotide numbers
34 and
242), AP binding sites (at nucleotide numbers
718 and
1,655), and a CCAC box (Fig. 3.1) (2–5). These binding sites interact with a variety of regulatory genes, which will be discussed later.

3.2.1

Negative Transcriptional Regulators

3.2.1.1

Mad/Max

The most extensively studied repressor is the Mad/Max heterodimer, which binds to the E-box domains of the hTERT core promoter region. The binding of

3 Transcriptional Regulators

49

Fig. 3.1 Structure and regulation of the hTERT promoter. Proteins that activate hTERT are located above the line, repressors are located below the line. Proteins that bind directly to the promoter are indicated on the line, in approximate locations as they occur along the promoter. Those proteins labeled in boxes above and below the line indicate proteins found at the promoter, acting indirectly through interactions with proteins binding directly to the promoter (See Color Insert)

the Mad/Max complex to the hTERT promoter prevents Myc/Max complex formation, which prevents the subsequent binding and activation at the E-boxes, thus repressing hTERT’s activity (12). The dynamic interactions between Myc/Max and Mad/Max have been implicated in many different cellular tissues as one of the most critical regulators for telomerase. The deregulation and overexpression of c-Myc that occur in cancer progression often correlates with the upregulation of hTERT activity (13–16), suggesting hTERT as a target for c-Myc regulation (discussed in detail later). Binding of Myc/Max and Mad/Max complexes to the hTERT promoter was initially discovered through the downregulation of hTERT mRNA by drug-induced differentiation of U937 cells, which resulted in decreased transcription of hTERT

50

A.N. Depcrynski et al.

through reduced promoter activity. By examining the transcription factors present, Mad was found to bind as a repressor (17). Ectopic expression of c-Myc counteracted the Mad-mediated repression of hTERT, leading to the conclusion that Mad is a direct negative regulator of hTERT and can be inhibited by the presence of c-Myc (18). Mad transcriptionally regulates hTERT through an interaction with c-Myc in hTERT-positive cells (bladder cancer cells) and normal cells (19). Mad/Max may be in a ‘‘switched’’ role where the functions of Myc/Max are in competition for the Mad/Max complex to regulate telomerase activity. This function has direct implications for both tumorigenesis and regulation of cellular differentiation (12). Specifically, in proliferating cells, c-Myc is bound to hTERT at the E boxes, whereas in differentiated cells, Mad is bound at the promoter. This switch may be the key to the on/off regulation of telomerase in somatic cells (20). 3.2.1.2

Other Repressors Targeting c-Myc-Dependent Telomerase Activation

Further studies revealed that there is a full gamut of proteins capable of downstream targeting c-Myc-dependent telomerase activation. Receptor Ck, one such signaling protein, represses hTERT through the transcriptional repression of c-Myc, a function thought to be mediated by the inhibition of Protein Kinase C (21). Other regulatory genes involved with repression of c-Myc, and therefore repression of hTERT, include the HTLV-1 oncogene Tax, which downregulates the activity of telomerase directly through inhibition of hTERT transcription. The repression of hTERT is related to the competitive binding of Tax at the E-boxes domains in the core promoter region, which inhibits the binding of the c-Myc activator, thus preventing the transcription of hTERT. To date, Tax expression has only been reported during adult T cell leukemia/lymphoma (ATLL) pre-leukemic cell proliferation coupled with p53 inactivation (22). This disruption of telomere elongation appears to allow for the dividing cells to undergo fusions and subsequent ploidy changes that are associated with the process of leukemia progression (22). Because this is a cell type-specific regulation, it suggests a direct therapeutic target specifically for ATLL leukemia cells. 3.2.1.3

BRCA1

In breast cancer-related studies, a complex of the tumor suppressor BRCA1, Nmi (N-Myc and c-Myc interacting protein), and c-Myc inhibit the activation of the hTERT promoter activity through c-Myc. Co-expression of mutant Nmi with wild type BRCA1 blocked the hTERT activity, while expression of Nmi and mutated BRCA1 failed to inhibit c-Myc induction. The interaction of Nmi in vivo and in vitro with BRCA1 and c-Myc results in negative regulation of hTERT (23). Further, Nmi acts as an adaptor and recruiter of BRCA1 attachments to c-Myc. Therefore, BRCA1 and Nmi may be regulating c-Myc’s ability to induce tumorigenesis, while BRCA1 may act as a tumor suppressor by targeting c-Myc’s transcriptional

3 Transcriptional Regulators

51

activation of hTERT (23). Additionally, in cultured breast cancer cells, the interaction between BRCA1 and c-Myc inhibited activation of hTERT (24). Although indirect, the regulation of hTERT through BRCA1 (already a promising candidate for the development of targeted chemotherapy) may provide an additional target for adjuvant breast cancer therapy. Alternatively, inhibition of BRCA1 may result in an off-target effect of inhibiting telomerase, thereby providing an additional mode of action from a single drug directed against BRCA1.

3.2.1.4

p53

p53 is a potent tumor suppressor, which would naturally correlate with its interaction in hTERT regulation. Expression of ectopic p53 inhibits cancer cell growth and induces apoptosis or G1 arrest, which results in complete inhibition of telomerase activity in cancer cell lines. Pancreatic cells with mutant p53 showed high telomerase activity while ectopic p53 gene expression caused a decline in hTERT mRNA expression. These results suggest p53 as a negative transcriptional regulator of telomerase (25). In a cervical carcinoma cell line, p53 expression also repressed telomerase activity, presumably through p53’s interaction with multiple Sp1 binding sites on the hTERT promoter (although other factors may also be involved) (26). When p53 interacts with Sp1, a known activator of transcription, Sp1 loses its ability to activate hTERT expression (26). This interaction occurs through formation of an Sp1–p53 complex that is unable to bind the promoter (27). hTERT regulation by p53 also occurs in other tumor-derived cell lines, including those from prostate and uterine malignancies (26). Expression of wild type p53 in immortalized fibroblasts and lung cancer cells also causes a downregulation of telomerase activity (28, 29). However, in immortalized endothelial cells, p53 had no affect on hTERT activity (30), suggesting that p53’s effect on telomerase is celltype specific. In fact, the p53 target, p21waf1, when expressed in pancreatic cancer cell lines, also had no effect on telomerase, yet like p53, p21waf1 expression resulted in cell growth arrest and apoptosis (25). p53 is able to maintain its cellular functions while simultaneously inhibiting telomerase in certain cell types (25).Through the negative regulation of telomerase, p53 maintains its role as a tumor suppressor, but may only function through telomerase in a cell-type specific manner.

3.2.1.5

Rb

Another tumor suppressor protein, the retinoblastoma (Rb) protein, is able to induce senescence of tumor cells and inhibit telomerase activity, a function that is independent of p53. Certainly, the artificial in vitro setting does not closely recapitulate what occurs in a clinical setting; nonetheless, telomerase regulation through Rb without wild type p53 dependency suggests a role in inhibiting tumor growth and immortalization (31). In a squamous cell carcinoma line, reduction of telomerase activity correlated with an increase in Rb protein levels in the G0 and S phases of

52

A.N. Depcrynski et al.

the cell cycle. Full length Rb, when overexpressed, caused a significant decrease in telomerase activity, further implicating its role in the regulation of telomerase activation in cancer cells (32). However, this does not necessarily implicate Rb as a direct regulator of telomerase transcriptional regulation. When Rb is overexpressed in carcinoma cells, it alone is sufficient to downregulate telomerase promoter activity, which can then be rescued by cdk2 and cdk4 expression. This implicates Rb in regulation of hTERT but does not characterize the exact mode of the regulation; whether it is directly acting on the hTERT promoter or acting secondarily to some other primary pathway still needs to be resolved (33). 3.2.1.6

IRF1 and p27Kip1

Interferon-g/interferon regulatory factor-1 (IRF1) signaling has previously been implicated in the downregulation of hTERT expression (34). Downstream of Interferon-g/IRF1 is the tumor suppressor protein, p27kip1, whose upregulation is dependent of IRF1. p27kip1 itself is able to inhibit transcriptional activation of hTERT. It has been hypothesized that p27kip1 acts by inhibiting the ability of the HPV E7 protein to upregulate the hTERT promoter activity, because Human Papillomavirus (HPV) E7 increases hTERT-promoter activity (35). p27kip1 is also a regulator of cyclin/CDK complexes and the cell cycle, and may be acting via a different pathway, through interactions with Rb or E2F, for example. The purported relationship between HPV E7, p27kip1, and hTERT seems to be far-reaching and may be better explained through interactions more closely related to cell cycle regulators, although this needs to be examined further. 3.2.1.7

TGFb, Smad3, and SIP1

TGFb decreases the activity of hTERT (36) with Smad3 and SIP1 contributing to its regulation (37–39). SIP1 (Smad interacting protein 1) is a downstream target of TGFb (40) and is required for TGFb to repress hTERT, although SIP1 alone does not regulate hTERT in vitro (39). Upon the activation of TGFb, an increase in Smad3 promotes binding to its own sequence adjacent in the hTERT promoter to the E-box/c-Myc binding site (at nucleotide numbers
262 and
284) (Fig. 3.1), which appears to be the main effect of TGFb inhibition on hTERT expression (38). 3.2.1.8

AP1

Binding sites for activator protein 1 (AP1), a heterodimeric complex of the Jun and Fos families, as well as sites for AP2 and AP4, have been identified within the hTERT promoter (2–5). AP1 over-expression studies in HeLa cells suggest that these binding sites do indeed have a suppressive effect on telomerase activity. This suppression mainly depends on the binding regions found between
2,000 and
378 on the hTERT promoter (Fig. 3.1); mutations of these sites resulted in a derepressive effect and elevated hTERT transactivation (41).

3 Transcriptional Regulators

3.2.1.9

53

WT1

Wilms’ tumor 1 (WT1) is one of the least studied binding sites on the hTERT promoter. This binding element is found on the fringe of the core promoter region at
352 (Fig. 3.1). WT1 has the ability to repress the activity of hTERT in 293T cells but not in HeLa cells, suggesting that WT1’s repressive effects are cell-type specific (e.g., those expressing endogenous WT1) (42). Although WT1 appears to be a repressor of telomerase, its limited actions may only allow for targeted therapy in certain tumor types.

3.2.1.10

Other Tumor Suppressors

A genetic screen identified a number of other tumor suppressors implicated in hTERT repression. This screen involved expression of a GFP reporter driven by the hTERT promoter in HeLa cells, with negative regulators of hTERT expression being identified through enhanced retroviral mutagens (ERM) (39). Candidate negative transcriptional regulators of hTERT included hSir2 and the cell signaling regulators Rak and BRCT-repeat inhibitor (BRIT1). Although RAK and BRIT1 are potential tumor suppressors identified in this screen, their direct roles in the regulation of telomerase have not been determined (39). Menin, a tumor suppressor, physically associates with the hTERT promoter region to inhibit transactivation. The primary study of the repression of hTERT via Menin cursorily examined possible repressive elements using the same general genetic screen (39). A transcriptional silencer of the hTERT promoter was identified in a variety of cervical and prostate cancer cell lines, and the inhibitory effects were enhanced with cellular differentiation. An homology search resulted in the identification of binding motifs for the myeloid-specific zinc finger protein 2 (MZF-2), Table 3.1 Negative transcriptional regulators Protein Regulatory role Mad1 Repressor, E-box binding Max heterodimer Receptor Ck Repressor, through protein kinase C Tax Repressor, E-box binding BRCA1/Nmi Repressor, c-Myc binding p53 Repressor, Sp1 binding Rb Repressor Repressor, with IRF1 p27kip1 MZF2 Repressor, direct promoter binding AP1 Repressor, direct promoter binding WT1 Repressor, direct promoter binding TGFb Repressor, with Smad3 BRIT/RAK Repressor, unknown mode of action Menin Repressor, direct promoter binding

Reference (12, 17–20) (21) (22) (23, 24) (25–30) (31, 32) (34, 35) (43) (2–5, 41) (42) (36–39) (39) (39)

54

A.N. Depcrynski et al.

which when mutated, resulted in activation of hTERT transcription (43). Gel shift assays showed that MZF-2 associates at specific hTERT promoter binding sites at nucleotides
514,
543,
620, and
696, and when MZF-2 is overexpressed, it results in downregulation of hTERT and telomerase activity, suggesting MZF-2 is a negative regulator of hTERT (43). Unfortunately, these general screening techniques provide little insight into the mechanisms of repression (Table 3.1).

3.2.1.11

Perspective

A number of the repressors discussed here act directly at the hTERT promoter to suppress its activation. Those that act indirectly, such as the c-Myc and p27kip1 examples described above, warrant further study. Determining how both direct and indirect acting repressors inhibit telomerase will likely provide new targets in the treatment of cancer. Alternatively, repressing the negative regulators may provide means to extend lifespan in normal human cells.

3.2.2

Positive Transcriptional Regulators

3.2.2.1

c-Myc

The protooncogene c-Myc has been implicated in the activation of telomerase in a variety of normal human cells (12, 42, 44) and is one of the most well-studied hTERT regulatory components. As discussed in the previous sections, inhibiting c-Myc’s ability to bind to the hTERT promoter is a major mechanism of many hTERT repressors. c-Myc transcriptionally transactivates the catalytic subunit hTERT in normal human mammary epithelial cells. c-Myc activation overlaps with telomerase expression in normal tissues, which may implicate telomerase in tumors where c-Myc is activated. This may mean one of two things: (1) telomerase activity reflects oncogene activation (i.e., correlative but not mechanistically related) or (2) telomerase activation by oncogenes contributes to the formation of the tumor (13). In cervical cancer lines, further correlation was drawn between c-Myc expression and telomerase activity: hTERT and c-Myc expression were concordant in most malignant samples, although there was no correlation between histopathology or prognosis (14). c-Myc’s role in transcriptional activation of hTERT and increased expression of telomerase may be a key factor in c-Myc’s ability to immortalize and transform cells. Activation of hTERT transcription by c-Myc is a direct effect. The hTERT promoter contains two primary E-box-binding sites at positions
34 and
242, (Fig. 3.1) both of which are related to c-Myc binding (15). Although c-Myc induces hTERT in rat embryo fibroblast cells, hTERT cannot induce c-Myc’s transformation abilities, a result that does not exclude the possibility that the interaction helps to maintain immortalization in tumorigenic cells (16). The interaction between c-Myc

3 Transcriptional Regulators

55

and telomerase is likely to be important in tumorigenesis, yet, it may not be a direct result of c-Myc’s oncogenic activities.

3.2.2.2

Survivin

Survivin, a member of the apoptosis inhibitor family, upregulates hTERT expression, therefore positively regulating telomerase activity. By observing its effects on Sp1 and c-Myc, Survivin increases the DNA-binding abilities of the two proteins to the hTERT promoter and increased their phosphorylation. It was concluded that Survivin also increases Sp1- and c-Myc-dependent hTERT transcription (45). Through an indirect action on the hTERT promoter, Survivin is able to enhance the transcriptional activation of hTERT through Sp1 and c-Myc.

3.2.2.3

hALP

A cDNA library derived from HeLa cells was screened for hTERT transcriptional regulators using an hTERT promoter-based yeast one-hybrid assay (46). This genetic screen resulted in the identification of a clone that resembled a GNAT family protein (N-acetyltransferase domain) and was named hALP (human Nacetyltransferase-like protein). Because it is able to specifically acetylate free histones in vitro, it was hypothesized that hALP regulates the activity of histone acetylation, which involves transcriptional regulation of hTERT. It is also thought that hALP may interact with Sp1, which may also contribute to its regulation of hTERT, but this remains to be experimentally determined (46).

3.2.2.4

TEIF

Another novel gene named telomerase transcriptional elements-interacting factor (TEIF) was found to interact with the hTERT promoter at nucleotide number
2 (Fig. 3.1) (47). When transfected into HeLa cells, TEIF caused transactivation of the hTERT promoter together with elevated telomerase activity. Antisense expression of TEIF downregulated telomerase activity in HeLa cells and suppressed tumor formation in nude mice (47). Together, these data suggest a role for TEIF as a positive regulator of hTERT transcription.

3.2.2.5

JNK Pathway

In ovarian epithelial cells, the transcription factor c-Jun activated hTERT transcription via the JNK pathway. JNK, a downstream target of PI3K, likely activates transcription of the hTERT promoter through phosphorylation and activation of cJun, whereby c-Jun can functionally bind the AP1 sites in the hTERT promoter

56

A.N. Depcrynski et al.

(48). However, this is in stark contrast to studies done with distal AP1 sites, which showed a repressive effect when c-Jun is bound to the hTERT promoter (41). When JNK was expressed in telomerase-negative cells, it induced telomerase activity. This was further supported by the introduction of the JNK antagonist JIP (JNK inhibitor protein), which when expressed in the same cells with JNK suppressed the activation of telomerase by JNK. Even though the authors concluded that c-Jun is a downstream target for hTERT activation, it seems likely that this effect is also mediated by another JNK-activated transcriptional protein (48). This effect may also be cell type-specific, as AKT (another kinase in the PI3 Kinase pathway) has been found to posttranslationally regulate hTERT in a number of systems, which will be discussed in more detail below.

3.2.2.6

HPV 16 E6

One of the major effects of HPV Type 16 E6 infection on cells is immortalization via hTERT activity (49–51). To accomplish this, the E6 oncoprotein was shown to bind to an associated protein E6-AP, which forms the E3 ubiquitin ligase. This ligase then binds and targets p53 for proteasome degradation, while increasing the expression of the catalytic component of telomerase (52–55). To define the mechanism of the E6-mediated telomerase increase, a yeast-two hybrid screen identified the protein NFX1. There are two isoforms of NFX1: NFX1-123, which coactivates hTERT with c-Myc, and NFX1-91, which may potentially act as a destabilized repressor (49). This finding was further supported by a synergistic assay of both knockdown and overexpression of the NFX1 activating protein, correlating with a respective decrease or increase in hTERT activity (56).

3.2.2.7

STAT3

STAT3 was first examined as a possible marker of tumor immortalization (57). Downregulation of STAT3 by siRNA in telomerase-expressing tumor cells results in a decrease in hTERT expression independent of c-Myc function. Stimulation of STAT3 with growth factor PDGF and cytokine IL-6 both have a positive effect on STAT3 and hTERT’s expression. STAT3 directly binds to the hTERT promoter at two locations (
1,587 and
3,308) to regulate its expression in a positive manner (Fig. 3.1) (58).

3.2.2.8

EWS-ETS

Another specific regulator of hTERT was found in Ewing’s Sarcoma through the EWS-ETS oncoproteins, which were shown to activate hTERT (59). hTERT is highly expressed in Ewing’s Sarcoma tissue and the hTERT promoter was found to be directly activated by the Ewing’s Sarcoma-associated fusion protein, EWS-ETS

3 Transcriptional Regulators

57

(EWS-ER81) at
23 (Fig. 3.1) (59). This regulator, although specific to hTERT, is also specific to Ewing’s Sarcoma patients, and therefore will be limited in its therapeutic implications.

3.2.2.9

HIF1a

Hypoxia inducible factor 1 (HIF1a) regulates oxygen homeostasis in cells (60) and is linked to tumor development in cells that are exposed to a hypoxic microenvironment (61–63). An examination of the cellular response to hypoxic conditions of the human placenta during the first trimester suggests HIF1a is involved in activation of hTERT, predominantly via HIF-1a binding directly to two putative responsive elements in the hTERT promoter (at nucleotide numbers +44 and
165) (Fig. 3.1) (64). Implicated in response to trophoblast growth, HIF1a could also be associated with resistance to chemotherapeutic treatment when a hypoxic condition exists in cancer cells. A choriocarcinoma cell line grown under hypoxic conditions resulted in high HIF1a levels, correlating with an upregulation of hTERT (65). In cervical cancer cells, hypoxia activates telomerase, again, correlating with an increase in HIF1a protein (64). HIF1a is a key factor in tumor progression; its role in the activation of hTERT further implicates telomerase in the tumorigenesis pathway and provides an additional therapeutic target, although to date the data are predominantly corollary (Table 3.2).

3.2.3

Both Positive and Negative Regulators

3.2.3.1

E2F

Some binding elements, such as E2F, both activate and repress hTERT activity. E2F-1 was implicated in the repression of the hTERT promoter through the identification and mutation of putative E2F-1 binding sites proximal to the transcriptional start site of the hTERT promoter (at
68,
98,
174, and
251) (Fig. 3.1). Also, overexpression of E2F-1 repressed hTERT promoter activity in a Table 3.2 Positive transcriptional regulators Protein Regulatory role c-Myc Activator, E-box binding, Max heterodimer Survivin Activator, Sp1/c-Myc binding hALP Activator, direct promoter interaction TEIF Activator, direct promoter interaction c-Jun Activator, direct promoter interaction E6/NFX1 Activator, p53 degradation/promoter interaction STAT3 Activator, direct promoter interaction EWS-ETS Activator, direct promoter interaction HIF1a Activator, direct promoter interaction

Reference (12–16, 42, 44) (45) (46) (47) (41, 48) (49–56) (58) (59) (64, 65)

58

A.N. Depcrynski et al.

variety of human tumor and immortalized cell lines. In carcinoma cells, E2F-1 can rescue the downregulation of hTERT caused by Rb, enhanced by cyclin-dependent kinases (33). E2F-1 could be inhibiting the binding and activation of hTERT though direct competition for binding with Sp1, a known activator. In normal somatic cells, however, E2F-1 was found to activate hTERT transcription through a noncanonical E2F site present in the hTERT promoter. Additional E2F proteins (E2F2 and 3) repressed hTERT activity in 293, HeLa, and U2OS tumor cell lines, while E2F4 and E2F5 did not. Yet all were found to activate the hTERT promoter in normal human somatic cells (IMR90, HFF, and WI38) (66). E2F-1 can promote and inhibit tumorigenesis, activating and repressing gene targets, respectively, similar to its role in hTERT expression, the regulation of which may provide an explanation of E2F-1’s regulation of other genes (67, 68). 3.2.3.2

Sp1

Another protein implicated in the dual regulation of hTERT is Sp1. Interactions with specific accessory factors guide Sp1’s regulatory effect on hTERT (12, 26, 45, 46, 69–72). The Sp1 transcription factor positively regulates hTERT transcription by binding two canonical and three degenerate sites located between the two E-boxes, 110 bp upstream of the transcription start site in the hTERT promoter (at
82,
112,
132,
161,
179, and
950) (Fig. 3.1). Sp1 interacts with c-Myc to activate hTERT. The E-box of the core promoter of hTERT that binds Myc/Max and the GC-box, which binds Sp1, are required for transactivation. When Sp1 sites were mutated, Myc/Max had little effect on transactivation, indicating that there is a positive correlation between c-Myc and Sp1’s effect on the transcriptional regulation of hTERT (12). In addition, Sp1 positively regulates hTERT in the latency-associated nuclear antigen of Kaposi’s sarcoma-associated herpes virus (LANA-KSHV). hTERT promoter activity is upregulated in KSHV by an interaction of Sp1 with LANA. LANA acts as an oncoprotein in part because it interacts with Sp1 and aids in cellular immortalization (69). When bound to Sp3, Sp1 negatively regulates hTERT expression by binding tightly to the hTERT promoter and interacting with histone deacetylase (HDAC) (70). This hetero-dimerization functions as a recruitment method of HDAC to the hTERT promoter, which results in histone deacetylation, chromatin condensation, and transcriptional silencing of the hTERT gene. Analysis of deletion constructs suggests a region of the hTERT promoter that uses HDAC-mediated transcriptional repression in IMR90, WI38, and HFF cells. Proteins Sp1 and Sp3 bind to this repressive element and subsequent mutations of their binding sites results in an increase in hTERT promoter activity (70). 3.2.3.3

USF1 and USF2

The upstream stimulatory factor (USF) 1 and 2 proteins are yet another set of proteins found to regulate hTERT, but through different mechanisms (73, 74). They associate with the two E-boxes located in the hTERT core promoter (Fig. 3.1);

3 Transcriptional Regulators

59

however, their regulatory actions are highly cell‐type specific. In immortalized 293T cells, USF1 and USF2 activate the hTERT promoter, where expression of both proteins enhances hTERT promoter activity, possibly acting as a heterodimer. In immortalized ovarian cancer cells, USF1 and USF2 have stronger binding affinity than Myc/Max. Further testing in additional immortalized and nonimmortalized cell lines indicates that USF1 and USF2 bind the hTERT E-boxes regardless of cell line and bind the upstream and downstream E-boxes both in vitro and in vivo (73). However, USF1 and USF2 only activate hTERT transcription in immortalized cells. This difference may indicate that USF1 and USF2 are basal repressors of hTERT expression in normal somatic cells by physically blocking c-Myc access to the E-boxes (73). USF1 and USF2 are negative transcriptional repressors of hTERT in oral cancer cells, similarly through binding of the E-box rather than direct interaction with c-Myc or Mad (74). USF is expressed at lower levels in cancer cells than in normal cells, suggesting that its involvement in telomerase regulation is less in tumorigenic cells, thereby potentially contributing to elevated telomerase activity in cancer cells.

3.2.3.4

p73

The p73 protein is similar to p53 in its ability to suppress both tumor formation and hTERT transactivation through direct interaction with Sp1 (71, 72). However, one conflicting study identified an interesting relationship between p53 and p73. The coexpression of both a and b isoforms of p73, with p53, relieves p53’s repressive ability, allowing for activation of hTERT. This p53 suppression requires p73’s DNA-binding ability and p73’s activation of the E3 ligase, HDM2 (75). In breast tumor cells, p73 inhibition leads to decreased hTERT expression and telomerase activity. It is possible that p73 acts to abrogate p53’s activity and therefore regulates hTERT expression (75). Unfortunately, this study is largely corollary with little direct experimental evidence for p73 involvement in hTERT gene regulation (Table 3.3).

Table 3.3 Both positive and negative transcription regulators Protein Regulatory role E2F1 Repressor, GC-box binding (cancer) Activator, non-canonical binding (normal) Sp1 Repressor, heterodimerize with Sp3 Activator, GC-box binding/LANA interaction USF1/2 Repressor, E-box binding (normal) Activator, E-box binding (cancer) p73 Repressor, Sp1 interaction Activator, p73b expression

Reference (33, 66–68) (12, 69, 70) (73, 74) (71, 72, 75)

60

A.N. Depcrynski et al.

3.2.3.5

Perspective

The identification of transcriptional regulators of telomerase provides numerous potential targets for chemotherapeutic and anti-aging interventions. The ability to activate or silence hTERT expression suggests that a key component of cellular immortalization can be controlled. In parallel, many of the genes found to regulate hTERT have other major cellular targets, making the inhibition or activation of these genes nearly impossible, while maintaining normal cellular function. Clearly, understanding the transcriptional regulation of telomerase will yield more appropriate targets for blocking telomerase in cancer cells (inhibit an activator or activate a repressor) and/or turning on telomerase in normal cells (inhibit a repressor or activate an activator).

3.3

Posttranslational Regulators

Although many of the proteins that regulate telomerase affect its transcriptional expression, there are a number of proteins that act posttranscriptionally or posttranslationally on telomerase. These proteins act through modifications, such as phosphorylation or ubiquitination, complex assembly (with hTR and TP1), allowance of telomere access, or altered subcellular localization. The posttranscriptional regulators may allow telomerase to be reversibly regulated: inactive in normal somatic cells but activated in cancer or immortalized cells. These mechanisms may be in response to DNA damage, genetic instability, or induced by a variety of responses to the tumor microenvironment (including hypoxia and vascularization). Much remains to be elucidated about the mechanisms for regulation of telomerase, but the regulators discussed here give initial clues. One of the proteins found to specifically interact with the hTR component is TP1, which was initially thought to eventually provide a direct means of inhibition by blocking its interaction with hTR (76). However, to date, no regulatory function has been identified for TP1. The proteins discussed in the remainder of this chapter provide other means for regulating telomerase which, although indirect, may prove effective.

3.3.1

Kinases

3.3.1.1

PP2A and Akt

As is the case with most proteins, hTERT is subject to both positive and negative regulation through phosphorylation. Through the discovery of a number of proteins involved in phosphorylation and dephosphorylation of telomerase, many pathways involved in the activation of telomerase have been identified, such as the Akt/PI3 Kinase-mediated signaling pathway. Initially, protein phosphatase 2A (PP2A) was

3 Transcriptional Regulators

61

found to inhibit telomerase activity in the nuclear fraction of human cancer cells, which was reversed by endogenous protein kinases, suggesting that telomerase phosphorylation and dephosphorylation may act as a switch to regulate telomerase activity in the nucleus of cancer cells (77). Putative Akt kinase consensus sequences (at nucleotides 220–229 and 817–826) are located in hTERT (at amino acids 220– 229 and 817–826). Treatment of a melanoma cell line with okadaic acid (a PP2A inhibitor) or growth factor deprivation resulted in activation of Akt and enhanced telomerase activity, suggesting that Akt kinase activates, either directly or indirectly, hTERT through phosphorylation. Treatment with wortmannin, a PI3KAkt kinase inhibitor, resulted in downregulation of hTERT phosphorylation and telomerase activity (78). The PI3K pathway (i.e., involving Akt-regulating telomerase activity) has been identified as a regulatory factor in other cell lines as well (79, 80). In a human multiple-myeloma cell line, cytokines such as interleukin-6 (IL-6) and IGF-1 upregulate telomerase activity without altering the hTERT expression, likely as a result of P13k/Akt/NFkB signaling where NFkB regulates transcription and Akt regulates posttranscriptional phosphorylation to protect against apoptosis (81). Akt may also influence other telomerase regulatory proteins including the association of the chaperone protein hsp90 with Akt and hTERT, suggesting that the complex formation of hTERT and hsp90 (82) includes Akt. Inactivation of telomerase by the hsp90 inhibitor novobiocin also disrupted the Akt/hsp90 interaction, causing inactivation of Akt and telomerase (83). The same Akt effect was not observed with treatment of geldanamycin, which binds the N-terminal ATPase domain of hsp90, inhibiting its chaperone function (84), although telomerase activity is inhibited (82). The explanation for the difference between novobiocin and geldanamycin may be as simple as cell-type differences or more likely, that the C-terminal hsp90 binding by novobiocin disrupts the Akt/Hsp90 interactions while the N-terminal geldanamycin binding does not.

3.3.1.2

PKC

The PKC inhibitors bisindolylmaleimide I and H7 inhibit telomerase activity through an action specific to PKCa, b, g, d, e, and z, thereby implicating PKCs in the negative regulation of telomerase activity (85–88). PKCa interacts with both the hTEP1 peptide and hTERT. When dephosphorylated by PP2A, hTEP1 was rephosphorylated by PKCa, and the hTERT interaction with hTEP1 increased, suggesting that PKC also mediates the phosphorylation of hTERT through hTEP1 (89). However, because of the indirect nature of these findings, these results warrant further examination. If real, they, along with the evidence from Akt interactions, suggest that telomerase exists in two forms: phosphorylated and dephosphorylated, relating to its active and inactive form, respectively. PKCy, in human T lymphocytes, acts through the NFkB pathway to activate hTERT expression (90). This pathway has been linked to hTERT regulation through TNFa (discussed later), as well as other protein kinase pathways (e.g., the c-Jun pathway discussed earlier).

62

3.3.1.3

A.N. Depcrynski et al.

c-Abl and KIP

The c-Abl protein tyrosine kinase, which is activated by DNA double strand breaks, associates directly with hTERT (91). Exposure to ionizing radiation resulted in increased tyrosine phosphorylation of hTERT through a c-Abl-dependent mechanism in MCF-7 breast cancer cells, whereas cells expressing a kinase inactive form of c-Abl had no effect on hTERT phosphorylation. Telomerase function was inhibited in MEF cells expressing functional c-Abl, with a significant increase in telomerase activity in inactive c-Abl cells (91). This finding points to DNA damage signals regulating telomerase activity. KIP (kinase interacting protein), a DNAPKcs-interacting protein that binds to the upstream kinase domain of DNA-PKcs (92), interacts with hTERT in vitro and in vivo. Presently, it is unknown whether KIP acts directly or indirectly to regulate hTERT, but it appears that KIP stimulates telomerase activity and telomere-length maintenance (93). 3.3.1.4

MAPK

In solid tumors, Hypoxia, a classic characteristic of solid tumor microenvironment, upregulates telomerase activity in a serum and pH-dependent manner. This upregulation correlates with activation of MAPK expression (94). Hypoxia has also been identified as a factor in the regulation of hTERT transcription through HIF1a (as discussed earlier) (64, 65). The involvement of the MAPK cascade in hypoxia and the subsequent upregulation of telomerase suggest that there are multiple factors within the hypoxic environment of solid tumors that regulate telomerase activity (Table 3.4). 3.3.1.5

Perspective

It is clear that in a variety of cell types, the phosphorylation and status of hTERT regulates telomerase activity both directly and indirectly. As described here, a variety of different kinases physically associate with hTERT, some of which cause phosphorylation. Unfortunately, not all the kinases that bind hTERT result in phosphorylation. Understanding the mechanisms of how kinases regulate hTERT

Table 3.4 Posttranslational regulators of telomerase: kinases Protein Regulatory role PP2A Repressor, dephosphorylation PKC Activator, phosphorylation, different isoforms Akt Activator, phosphorylation, through PI3K pathway c-Abl Repressor, dephosphorylation KIP Activator c-Jun Activator, through JNK pathway MAPK Activator, response to hypoxia

Reference (77) (85–90) (78–81, 83) (91) (93) (41, 48) (94)

3 Transcriptional Regulators

63

function will be critical in identifying important telomerase inhibitory pathways relevant to phosphorylation.

3.3.2

Ligases

3.3.2.1

MKRN1 and Smurf2

Ubiquitin ligases including MKRN1 and Smurf2 are negative regulators of hTERT. The Makorin RING finger protein 1 (MKRN1) binds hTERT and mediates the ubiquitination of hTERT, acting as an E3 ligase (95). When the hTERT and hsp90 complex is altered (as with the treatment of geldanamycin), hTERT is ubiquitinated and degraded in a proteasome-mediated manner. MKRN1 enhances hTERT ubiquitination in the absence of geldanamycin treatment, suggesting that MKRN1 functions as an E3 ligase to aid in ubiquitination of hTERT in the nucleus when hsp90 is intact. MKRN1 may also regulate hTERT by causing changes in its expression and activity. For example, continued expression of MKRN1 decreased the expression of telomerase (95). Smurf2 is also an E3 ubiquitin ligase, which has previously been implicated in ubiquitination of Smad-mediated TGF-b signaling (96) that, when upregulated, produces a telomere-dependent senescence phenotype. In fibroblasts, Smurf2 is upregulated by telomere shortening that occurs as cells enter replicative senescence, When Smurf 2 is overexpressed at similar levels observed during replicative senescence, hTERT immortalization of fibroblasts is reversed. Smurf2 induces senescence in early passage fibroblasts, not by its E3 ligase activity, but by a novel protein–protein interaction with one or more proteins (not explored in this study), acting through either the p53 or pRb pathway (97).

3.3.2.2

E6/E6AP

The induction of the hTERT promoter requires both E6 and the E6AP ubiquitin ligase proteins, which may reflect a need for the ubiquitination of other associated proteins in the core promoter region of hTERT (98). The role of E6AP at the hTERT promoter is presently unknown, but it is hypothesized that it cooperates with E6 and directs specific proteins to be ubiquitinated (49, 98). As mentioned earlier, E6AP ubiquitin ligase represses telomerase through an interaction with NFX1-123 and is required for transactivation of the hTERT promoter through an interaction with NFX1-91 (49). NFX1-123 is coactivated with c-Myc at the hTERT promoter while NFX1-91 represses the hTERT promoter. The fact that NFX1-91 acts as a repressor of hTERT by binding the proximal promoter led to the examination of whether E6 targets NFX1-91 for degradation to relieve repression of hTERT. It was subsequently shown that derepression of hTERT transcription was

64

A.N. Depcrynski et al.

Table 3.5 Posttranslational regulators of telomerase: ligases Protein Regulatory role Smurf2 Repressor, through telomere shortening MKRN1 Repressor, ubiquitination E6/E6AP Repressor with NFX1-91, Activator with NFX1-123

Reference (97) (95) (49, 98)

stimulated by the ability of E6 to target NFX1-91 to the ubiquitin pathway. NFX191 stability was significantly decreased in the presence of E6, with the reduction of NFX1-91 protein levels being proteasome-dependent. NFX1-123 remained stable in the presence of E6, suggesting a preferential binding and destabilization of NFX1-91 by E6. NFX1-91 was highly ubiquitinated in the presence of E6 whereas NFX1-123 was not. In primary human epithelial cells, E6/E6AP mediated ubiquitination and subsequent degradation of NFX1-91 induced hTERT expression and delay of senescence (49) (Table 3.5).

3.3.2.3

Perspective

It is likely that there is a dynamic interaction of telomerase-specific degradation pathways, including the E3 ligases described here. Because of its specific association with the hsp90 chaperone complex, hTERT ubiquitination and subsequent degradation is mediated by Hsp90 and could be an important mechanism for inhibiting telomerase function. In fact, activation of proteasomal pathways directed at telomerase may be critical for reprogramming cellular senescence or inducing apoptosis in cancer cells.

3.3.3

Polymerases

The family of poly (ADP-ribose) polymerases, or PARPs, negatively regulate telomerase and telomere extension through interaction with TRF1, TRF2, Tankyrase1, Tankyrase2, PARP1 and PARP2. Particularly PARP1 and PARP2, catalyze poly(ADP-ribosyl)ation as a result of DNA strand breaks from ionizing radiation, oxidative stress, and alkylating agents. Along with this, PARP1, PARP2, and the tankyrases TANK1 and TANK2 are involved in telomere regulation (100). These four members of the PARP family associate with telomeric DNA and poly (ADP-ribosyl)ate telomeric-associated proteins TRF1 and TRF2 and block their DNA-binding ability (99–102). This regulates the ability of telomerase to control telomere extension. Through its poly(ADP-ribosyl)ation activity, Tankyrase1 and Tankyrase2 are able to release TRF1 from the telomere, possibly resulting in allowance of telomerase to access the telomere (99, 100). PARP1 and PARP2 both functionally interact with TRF2 and aid in maintaining TRF2’s function at the telomere. PARP2 interacts with TRF2 and regulates its function at the telomere

3 Transcriptional Regulators

65

through poly(ADP-ribosyl)ation (101). PARP1 specifically localizes with TRF2 to damaged telomeric DNA, most often correlating with critically short telomeres. Once there, PARP poly(ADP-ribosyl)ates TRF2, dissociating it from the telomere so that DNA damage repair proteins can repair the telomeric DNA (102). The association of PARP1 and PARP2 with TRF2 protects the dysfunctional telomeres by maintaining TRF2’s function at the t-loop, allowing DNA damage repair proteins to fix the telomeric DNA and likely preventing access by telomerase. Although specific studies of telomerase and PARP have not been conducted, the action of TRF2 in preventing telomerase access can be extrapolated to PARP’s additional protection at the telomere.

3.4

Regulators of Assembly

The high molecular weight of telomerase suggests that it is composed of not only the hTERT and hTR components, but also additional proteins that may contribute to its functionality (103). Although TP1 has been shown to interact with hTERT, there is no indication that it plays any role in the function of telomerase. However, it has been found that telomerase requires a number of molecular chaperones, or heat shock proteins, to complex with the catalytic component of telomerase to be functionally active (82, 104, 105). Heat shock proteins, associate with numerous client proteins, including protein kinases and steroid hormone receptors, and play roles in folding, assembly, stabilization, and even degradation (106). An interaction between hsp90, the co-chaperone p23, and hTERT was defined initially in vitro (82) and then validated in human cell lysates (82). This interaction appears independent of the template RNA, hTR, but directs the proper assembly of the catalytic hTERT subunit with the hTR component of telomerase. Blocking hsp90 pharmacologically results in inhibition of the assembly of telomerase, further indicating an important role for hsp90 and p23 in the formation of the telomerase holoenzyme. Elevated hsp90-associated chaperone levels (including hsp70, hsp40, p23, hsp27, and hsf-1) were observed in tumor tissue in parallel with telomerase regulation during cancer cell transformation and progression suggesting that chaperones may aid in assembly of telomerase and may also stabilize and prevent degradation of telomerase in cancer cells (107). Interestingly, hsp70 associates only with inactive hTERT in the absence of hTR, dissociating from hTERT in its active form, while hsp90 and p23 remained associated (104). Our original model for the assembly of active telomerase (104) has been modified and is shown in Fig. 3.2. In this revised model, the template subunit hTR and the catalytic subunit hTERT are not bound together. hTERT is bound to hsp90, p23, hsp70, hsp40, and HOP. Through an ATP-dependent reaction, hsp70, hsp40, and HOP dissociate from hTERT and hTERT is then bound to hTR. hsp90 and p23 remain bound to hTERT in the functional telomerase holoenzyme. The dependence of telomerase on hsp90 provides a possible target for cancer therapy. There are inhibitors of hsp90 already in use or in clinical trials as possible therapies for breast cancer and multiple myeloma, including geldanamycin

66

A.N. Depcrynski et al.

Fig. 3.2 Proposed model for assembly of functional telomerase. Telomerase is assembled in an ATP-dependent manner through interactions with several chaperone proteins. Inactive hTERT binds hsp90 and its co-chaperone p23, along with hsp70, hsp40, and HOP. hsp70, hsp40, and HOP associate transiently and are removed when hTR and hTERT assemble, forming the active telomerase complex. hsp90 and p23 remain associated with the functional complex (See Color Insert)

Table 3.6 Posttranslational regulators of telomerase: chaperones Protein Regulatory role Hsp90 Required for telomerase assembly Hsp70 Transient association with hTERT Hsp40/ydj Transient association with hTERT HOP Transient association with hTERT p23 Required for telomerase assembly

Reference (82, 104, 107) (82, 104, 107) (82, 104, 107) (82, 104, 107) (82, 104, 107)

and radicicol (reviewed in: 108). Inhibition of hsp90 interferes with the assembly of functional telomerase by preventing proper protein folding. Geldanamycin prevents p23’s association with hsp90 by binding in the ATP pocket rendering hsp90 nonfunctional (84). Treatment of cancers in which telomerase is upregulated (virtually all cancers) may benefit from disruption of the hsp90/hTERT interaction (Table 3.6).

3 Transcriptional Regulators

3.5

67

Additional Regulators

3.5.1

Telomere-Binding Proteins

3.5.1.1

Shelterin and Associated Proteins

Telomerase must be able to access the telomere ends to promote elongation and provide unlimited proliferative potential to germ, stem, and cancer cells. The telomere is bound by a number of proteins critical for protecting the telomere ends from being recognized as a double strand breaks, and some of the same telomere binding proteins also regulate telomerase access in tumor cells. These proteins include the Shelterin complex: TRF1, TRF2, hPOT1, hRAP1, TPP1, TIN2, (109) and also Tankyrase1, Tankyrase2, Ku 70/80, Ku86, and the MRE11 complex, some of which are thought to have a regulatory effect on telomerase at the telomere (99, 100, 110–113). Proteins such as TRF1 and TRF2 specifically interact with the telomere, by coating the telomere and sequestering the ends in a t-loop formation (114–116). Others interact with TRF1 and TRF2 by blocking telomere elongation (Tankyrase1 and Tankyrase2), inhibiting telomerase (PINX1), or altering telomere structure (hRAP1, hPOT1), (Fig. 3.3) (reviewed in: 109 and 117).

3.5.1.2

PINX1

PINX1 is a negative regulator of hTERT, binding to both hTERT and TRF1 (114, 118). In vitro, PINX1 binds directly to the hTERT protein subunit, mostly at the hTR-binding domain, but also with the hTR subunit, suggesting that this regulation is not through competitive binding. In cells, the association of PINX1 and hTR is dependent on hTERT, resulting in telomerase repression (119). PINX1 binds hTERT through its TID domain. Overexpression of PINX1 or TID inhibits telomerase and induces crisis, while depletion of endogenous PINX1 elongates the telomeres and enhances telomerase activity (118). PINX1, when depleted, has also been shown to increase tumorigenicity in nude mice leading to the conclusion that not only is PINX1 a negative regulator of telomerase, but it is also a potential tumor suppressor (118).

3.5.1.3

TopoIIa

Topoisomerase IIa has been described as a telomerase-associated protein, although a functional consequence of this interaction is unknown. TopoIIa associates with telomeres and cleaves telomeric sequences in its normal function during DNA unwinding. The interaction is not mediated by DNA binding and may act to allow the t-loop to unwind so that telomerase may access the end of the telomere (Aisner and White, UT Southwestern – Dallas, personal communication).

68

A.N. Depcrynski et al.

Fig. 3.3 Structure of the telomere and t-loop. (a) Proteins associated with the telomere and telomerase. Most of the proteins found at the telomere bind to telomeric DNA or interact directly with proteins that bind telomeric DNA. Most make up the Shelterin complex, including TRF1, TRF2, Rap1, POT1, TPP1, and TIN2. Also found at the telomere are the DNA damage‐associated proteins, MRE11, RAD50 and NBS1. The telomere-binding proteins function to protect the telomere from telomerase access but do not physically associate with telomerase. Proteins that interact directly with telomerase include Tankyrase1, Tankyrase2, Ku 70/80 and Ku 86, PINX1, and TOPOII (which has also been suggested to bind at the telomere). (b) The t-loop structure and inhibition of telomerase. The t-loop allows sequestration of the end of the telomere, preventing the end from being recognized as damaged DNA. It also prevents telomerase from acting at the telomere and adding telomeric repeats. TRF2 has a major role in forming the t-loop, as it allows the 30 overhang to invade the duplex DNA and create the t-loop structure (See Color Insert)

3.5.1.4

HP1

Overexpression of heterochromatin protein 1 (HP1) and the isoforms HP1HSa and HP1HSb results in decreased association of hTERT with the telomere because of an alteration in the telomeric chromatin. Under these conditions, telomerase is no longer able to access the telomere, resulting in a negative effect on the binding of other proteins and reduced cell growth (120).

3 Transcriptional Regulators

3.5.1.5

69

Perspective

Clearly, access to the telomere is crucial for telomerase to function properly in the cell, and critical interactions between telomerase and telomeric proteins may provide new targets for chemotherapeutics. A better understanding of telomere binding proteins may also provide insight into cellular aging: as the cell loses telomeric bases and, therefore, substrate for the binding of telomeric proteins, the accessibility of telomerase to the telomere should increase, along with cellular proliferation. Unfortunately, the ability for telomerase to access the telomere ends without regulation is also what results in the uncontrolled proliferation seen in tumor cells. A complete understanding of the mechanisms of telomeric proteins and their interactions with telomerase is imperative for understanding, and controlling tumor growth.

3.5.2

Localization

The localization of telomerase is a major factor in its regulation. For telomerase to elongate telomeres, it must be recruited to telomeric DNA. In normal cells, a large portion of telomerase colocalizes with nucleoli, but there is an intranuclear redistribution of telomerase in a cell cycle-dependent manner, likely coinciding with telomere elongation (121). Transformed cells express increased telomerase over a longer time, which may allow telomerase to act on telomeres in an environment where telomeres are critically short or there is a limit to telomerase activation, allowing for stabilization of genomic breaks or escape from crisis (121). hTR and hTERT colocalize to the nucleolus (hTERT (122, 123); hTR (124–126)), where the components likely assemble to form the active telomerase complex, which is then translocated to the nucleoplasm to act on the telomere (123). 3.5.2.1

Nucleolin

Nucleolin, a nucleolar phosphoprotein, interacts with telomerase and modifies its subcellular localization (127). Nucleolin binds hTERT in both the nucleolus and the nucleoplasm in an hTR-dependent manner at two distinct regions on nucleolin. The interaction with nucleolin did not inhibit telomerase activity but it caused hTERT and hTR to localize to the nucleoplasm and may aid in assembly of telomerase and to maintain telomerase in the nucleoplasm to be translocated to the telomere (127). There appear to be multiple ways telomerase can translocate to the nucleus, some of which will be discussed later.

3.5.2.2

TNFa

Telomerase was identified as a downstream target of NFkB (81), and hTERT interacts directly with the NFkB p65 protein (128). TNFa, a member of the NFkB pathway, can induce nuclear translocation of the hTERT-p65 complex (128). TNFa induces telomerase activity in the cytoplasm and translocates

70

A.N. Depcrynski et al.

activated telomerase to the nucleus. Through treatment with NFkB translocation inhibitors and PI3K inhibitors, TNFa’s ability to translocate telomerase to the nucleus and induce telomerase activity was blocked, suggesting that both the activation and translocation of telomerase are regulated by PI3K/Akt/NFkB signaling pathways through TNFa (129). 3.5.2.3

14-3-3 Family

The family of 14-3-3 signaling proteins, specifically 14-3-3s (130), has been identified as hTERT-binding partners (131), and it appears that binding is required for the accumulation of hTERT in the nucleus. Ectopic expression of a dominant negative 14-3-3 resulted in hTERT accumulating predominantly in the cytoplasm instead of the nucleus. A mutant hTERT-3A that could not bind 14-3-3 also was localized to the cytoplasm. 14-3-3 facilitates hTERT nuclear localization, while CRM1/exportin-1 mediates nuclear export, which when disrupted, the localization of hTERT to the cytoplasm was impaired. The 14-3-3 interaction had no effect on telomerase activity in vitro or in cells. Other mechanisms for 14-3-3-mediated telomerase regulation (i.e., affecting telomerase’s ability to bind the telomere or facilitating the binding of other 14-3-3 binding proteins to telomerase) have been postulated but no data have been generated to support such telomerase regulation (131). 3.5.2.4

PINX1

PINX1, previously mentioned as a telomere-binding protein, has recently been identified as having an effect on the localization of hTERT (132). PINX1 cotransfected with GFP-hTERT into cancer cells resulted in a dramatic nucleolar localization of the fusion protein (as opposed to the typical diffuse pattern throughout the nucleoplasm) and colocalization of hTERT with PINX1. Importantly, nucleolar colocalization was found with endogenous hTERT, suggesting PINX1 aids in localization of hTERT. When a mutant form of PINX1, found in a large number of hepatocarcinoma patients, was coexpressed with GFP-hTERT, it no longer sequestered hTERT in the nucleolus of cancer cells. Both the wild type and the cancer-associated mutant form of PINX1 were found to cause a modest decrease in telomerase activity, suggesting the sequestering of hTERT and the inhibition on telomerase may be two distinct functions of PINX1 (132).

3.5.3

Viral Proteins

3.5.3.1

HPV E6 and E2

The HPV proteins, particularly the E6 and E7 oncoproteins, have been associated with certain anogenital cancers including cervical carcinomas. These genes in high risk HPVs (such as types 16 and 18) are necessary and sufficient to immortalize many normal cell types through suppression of p53 and Rb pathways (133, 134). In

3 Transcriptional Regulators

71

HPV-16, E6’s ability to induce telomerase activity occurs through its upregulation of the hTERT promoter. As discussed earlier, E6, along with the E6AP E3 ligase, has been implicated in the activation of hTERT expression, although the exact mechanism is currently unknown (49, 50). Independent studies (135–137) have explored the mechanism of activation of the hTERT gene by HPV-16 E6 oncoprotein. A 251bp promoter region of hTERT is essential for E6 to activate its transcription without altering c-Myc or Mad protein expression (135). c-Myc and Sp1 were initially thought to be necessary for the activation of hTERT by E6 (136), yet subsequent evidence shows that the E boxes in the hTERT promoter, and not c-Myc, are required for E6 activation (137). This does not necessarily mean that c-Myc is not involved in some way, but that E6 may make the promoter more accessible to c-Myc (138). Mutation of hTERT’s E box, which is bound specifically by c-Myc, USF1, and USF2 also leads to decreased activation of hTERT by E6, possibly through USF1 and USF2 blocking E6’s ability to bind to the E box. E6 allows c-Myc to replace these factors and activate hTERT (55). The HPV E2 protein also has been implicated in repression of hTERT transcription through SP1 binding sites at the hTERT promoter (139). 3.5.3.2

LMP2A

The latent membrane protein (LMP)2A is encoded by the Epstein Barr Virus (EBV) and is thought to be involved in EBV-mediated tumorigenesis (reviewed in: 140). In carcinoma cells expressing (LMP)2A, a constant reduction of hTERT mRNA coincided with decreased telomerase activity (141). Activating the (LMP)2A pathway to regulate hTERT may aid in the control of EBV‐induced malignancy. Further studies need to be conducted on endogenous hTERT to ensure the findings are biologically relevant (141).

3.5.3.3

LANA and E1A

As mentioned previously, LANA of Kaposi’s Sarcoma-associated Herpes virus targets the Sp1 binding sites of the hTERT promoter to positively regulate transcription, resulting in enhanced telomerase activity (69, 142). Another viral protein that interacts with the Sp1 sites on hTERT’s promoter is the adenoviral protein, E1A, which may have an effect on activation of the hTERT promoter, possibly through the Sp1 sites or through chromatin modification of the corepressor CtBP (143, 144). 3.5.3.4

HBV

The Hepatitis B virus (HBV) genome can integrate into the promoter region of hTERT in hepatocellular carcinoma cell lines (145–147), resulting in activation of hTERT. In vitro, the Hepatitis B virus X (HBX) gene induced hTERT transcription

72

A.N. Depcrynski et al.

(148), while in cancer cells, there was a correlation between HBX and hTERT expression (suggesting HBX upregulated the expression and activity of telomerase) (149). This suggests a preferential integration site in the genome for HBV, possibly resulting in an induction in tumorigenesis through the activation of hTERT. 3.5.3.5

Perspective

The induction of hTERT in response to viral infection gives a clue as to the mechanism of oncogenesis associated with these viruses. There are few viruses that give rise to cancer, and findings that HPV and HBV also regulate telomerase activation explain, at least in part, how telomerase can contribute to viral-induced cancer.

3.5.4

Hormone Receptors

In cancers, particularly breast and prostate, the function of the hormones estrogen, androgen, and progesterone often have an impact on the development and subsequent treatment of cancer. Telomerase is also upregulated in these cancers, and although the increase in telomerase and hormone may only be correlative, it may also be suggestive that there is some interaction between telomerase and hormones. 3.5.4.1

ER

Estrogen activates telomerase, acting directly and indirectly on the hTERT promoter at nucleotide numbers
940 and
2,754 (Fig. 3.1), with a putative estrogen response element (ERE) in the promoter and an Sp1/ER site (through c-Myc) having less of an effect (150). In the endometrium, telomerase activity switches from a weakly active form to being highly upregulated during the menstrual cycle, suggesting estrogen may be the key regulator for telomerase in this cycle, as well as having a role in endometrial cancer (151). hTERT expression is activated through hormone treatment of telomerase-negative human ovarian epithelium cells, indicating a direct physiological stimulus to activate telomerase in normal cells (150). Estrogen acts in an Akt/PI3K-dependent pathway to phosphorylate telomerase through the estrogen receptor. In ovarian cancer cells, which express estrogen receptors (as in MCF-7 breast cancer cells), Akt is involved in the estradiol (E2) induction of hTERT expression (152).

3.5.4.2

PR

Alternatively, progesterone, which normally acts as an antagonist to estrogen’s actions in the reproductive organs, induces hTERT expression in a time-dependent manner: at 3 h after exposure to progesterone, hTERT expression in breast and endometrial cancer cell lines was induced and peaked at 12 h and then decreased rapidly (153).

3 Transcriptional Regulators

73

Over a 72-h period, however, progesterone inhibited estrogen’s induction of hTERT expression at the transcriptional level through a p21Waf1/Cip1-mediated pathway. Progesterone’s rapid induction of hTERT seems to be related to the MAPK cascade, although further study is necessary (153). 3.5.4.3

AR

The androgen receptor (AR) is a major target for therapy in prostate cancer. When AR is mutated, it loses its role as a protective agent, with reduced levels found in men with prostate cancer (154). Wild‐type AR blocks hTERT expression by inhibiting transactivation with endogenous wild‐type AR being recruited to the promoter in vivo. In a mutant AR cell line, hTERT is no longer repressed (155), providing yet another mode of action for chemotherapeutics directed at telomerase in prostate cancer.

3.5.5

hTR Binders

3.5.5.1

pRb and Small Nucleolar RNA-Binding Proteins

hTR, the RNA template component of the telomerase complex, interacts with pRB (156) and a number of small nucleolar RNA-binding proteins, including dyskerin (125), GAR1 (157), NHP2, and NOP10 (158). However, the effects of these interactions on telomerase regulation have yet to be elucidated. Other hTR binding proteins and their effects on telomerase and its activity are discussed below. 3.5.5.2

NF-Y and MDM2

The hTR promoter has four Sp1 sites and a CCAAT box (159). Nuclear factor Y (NF-Y) is a regulator of the hTR promoter (156) through binding at the CCAAT box, as is Sp1 and Sp3 which depend on NF-Y (160). MDM2 also binds at the promoter and may repress activation by Sp1 or pRb or NF‐Y interactions, although further studies into its direct action must be conducted (161). The hTR promoter has not been studied as extensively as the hTERT promoter and fewer proteins have been identified as regulators, mostly because hTR is ubiquitously expressed in most normal and cancer cells. 3.5.5.3

hnRNPs

The heterogeneous nuclear ribonucleoproteins (hnRNPs) are implicated in positive regulation of telomerase and telomere length. hnRNPs bind telomeric repeats and the hTR component of telomerase, and include hnRNP A1, C1/C2 and D, E, and K (162). hnRNP C1 and C2 associate with hTR and binding of C1/C2 correlates with telomerase’s access at the telomere (163–166), presumably through C1/C2’s ability

74

A.N. Depcrynski et al.

to interact with the telomeres. This may occur through interactions with TRF1 and TRF2, or through protein–protein interaction with other hnRNPs at the telomeric DNA. hnRNP A1 is implicated in binding to the telomeric repeats in vitro, thereby preventing extension by telomerase, and it appears to act as a telomere end-binding protein that maintains the 30 overhang (167). A model proposed by Ford et al. (162) suggests how telomerase is recruited to the telomere through both telomerase and telomere-associated hnRNP proteins. The single strand-displaced region of the t-loop, known as the d-loop, associates with hnRNP A1 and may also associate with A2-B1, D, and E. Telomerase is proposed to be recruited to the telomere by a multimeric complex of hnRNPs based on whether the d-loop or hnRNPs bind directly to the 30 G-rich overhang. A model system that does not express hTR and hTERT was tested with expressed variants of hTR and hTERT that specifically affect hnRNP binding sites, further implicating these hnRNPs in regulation of telomerase (168). hnRNP A2 binds both the first 71 nucleotides of hTR and hnRNP A1, which ultimately associates with the telomeric DNA repeat sequence in vivo to aid in telomeric maintenance, along with the telomere-binding proteins TRF1 and TRF2 (169). It was proposed that hnRNP A1 simultaneously binds hTR and telomeric DNA sequence repeats, which allows for recruitment of telomerase to the telomere (170). This may also occur with hnRNP A2, though the mechanisms appear different and remain to be explored, as hnRNP A2 binds preferentially to TRF2 rather than telomerase RNA or telomeric DNA (169). hnRNP A1, when depleted in human embryonic kidney cell extracts, results in reduced telomerase activity in addition to disrupting the structure of the telomere ends. This activity was recovered after addition of hnRNP A1 and A2. hnRNP A1 and A2 are not required for assembly, as the chaperones hsp90 and p23 are, though they are required for telomerase activity. Nor are they required for recruiting telomerase to the telomere, as was suggested earlier, but rather for elongation (171). Further study of the mechanisms of hTR targeting may lead to a better understanding of telomere elongation and maintenance (Tables 3.7–3.11).

3.6

Concluding Remarks

The telomerase regulating proteins discussed in this review represent potential targets for inhibiting telomerase in the treatment of cancer. Aberrant expression of oncoproteins, tumor suppressors, and mediators of cell survival have long been implicated in tumorigenesis. However, their interactions and/or effects on telomerase provide novel telomerase inhibition strategies while simultaneously blocking additional regulatory pathways essential for cancer cell growth and survival. The dependency of the telomerase holoenzyme on the hsp90 complex also allows for targeting telomerase via chaperone inhibition, as is proving useful in on-going clinical trials. Although the activation of telomerase is a critical step in providing cancer cells with unlimited proliferative potential, expression of telomerase in normal cells

3 Transcriptional Regulators

75

Table 3.7 Posttranslational regulators of telomerase: telomere associated proteins Protein Regulatory role Reference TRF2 Repressor, prevent telomerase access to telomere, (115, 172, 173) sequesters T-loop TRF1 Repressor, prevent telomerase access to telomere (114, 172–174) hPOT1 Repressor, telomere elongation (175, 176) hRAP1 Repressor, telomere elongation (177) TPP1 Repressor, binds telomeric proteins (178–181) TIN2 Repressor, telomere elongation (182, 183) Tankyrase1/2 Repressor, regulates telomerase access at telomere (99, 100, 184) Ku70/80 Activator, interacts with hTR and hTERT (113, 185) Ku86 Repressor, telomere elongation (111, 112) MRE11 Telomere protection/capping (185, 186) complex PINX1 Repressor, interacts with hTERT (118, 119) PARP1/2 Repressor, interacts with TRF1/2 (187) TOPOIIa Repressor, interacts with hTERT Aisner and White, personal comm. HP1HSa/b Repressor, chromatin remodeling (120) Rad51D/54 Telomere capping (188, 189) ATM Telomere protection (190)

Table 3.8 Posttranscriptional regulators of telomerase: localization Protein Regulatory role nucleolin Alters telomerase subcellular localization PINX1 Repressor, sequesters hTERT 14-3-3 family CRM1/exportin-1 TNFa

Activator, enhances nuclear localization Mediates hTERT nuclear export Activator, translocates telomerase to nucleus, with NFkB-p65

Table 3.9 Regulators of telomerase: viral proteins Protein Regulatory role KHSV-LANA Activator, transcriptional, binds Sp1on hTERT promoter E1A Activator, through SP1 sites and CtBP LMP2A Repressor, transcriptional HPV E6 Activator, transcriptional HPV E2 Repressor, transcriptional HBV Activator HBX Activator

Reference (127) (118, 119, 132, 191) (130, 131) (131) (128, 129)

Reference (69, 142) (143, 144) (141) (49, 50, 55, 133–139) (139) (145–147) (148, 149)

76

A.N. Depcrynski et al.

Table 3.10 Regulators of telomerase: hormone receptors Protein Regulatory role ER Activator, direct and indirect, transcriptional AR Repressor, transcriptional PR Activator and repressor, time-dependent

Table 3.11 Posttranslational regulators of telomerase: hTR-binding proteins Protein Regulatory role NF-Y Regulator at hTR promoter dyskerin Interacts with hTR GAR1 Interacts with hTR NHP2 Interacts with hTR NOP10 Interacts with hTR pRb Interacts with hTR MDM2 Repressor at hTR promoter hnRNP A1 Repressor, binds telomere, prevents access hnRNP A2 hnRNPC1/2

Repressor, binds hnRNPA1 and telomere, prevents access Repressor, associate with hTR

hnRNP B1,D,E,K

Repressor, binds telomere, prevents access

Reference (150–152) (155) (153)

Reference (156, 160) (125) (157) (158) (158) (156) (161) (167, 168, 170, 171) (165, 169) (163, 164, 166, 168) (162)

prevents cellular senescence. Therefore, induction of telomerase activators or conversely inhibition of repressors in normal cells could prevent cellular aging. Additional studies are now necessary to gain a better understanding of the transcriptional and posttranscriptional pathways regulating telomerase, which will ultimately allow for the development of novel targeted therapies in the treatment of cancer and other age-associated diseases.

References 1. Shay JW and Bacchetti S. A survey of telomerase activity in human cancer. Eur J Cancer 1997; 33:787–91. 2. Wick M, Zubov D, and Hagen G. 1999. Genomic organization and promoter characterization of the gene encoding the human telomerase reverse transcriptase (hTERT). Gene 1999; 232:97–106. 3. Horikawa I, Cable PL, Afshari C, and Barrett JC. Cloning and characterization of the promoter region of human telomerase reverse transcriptase gene. Cancer Res 1999; 59:826–30. 4. Cong YS, Wen J, and Bacchetti S. The human telomerase catalytic subunit hTERT: organization of the gene and characterization of the promoter. Hum Mol Genet 1999; 8:137–42. 5. Takakura M, Kyo S, Kanaya T, et al. Cloning of human telomerase catalytic subunit (hTERT) gene promoter and identification of proximal core promoter sequences essential for transcription actication in immortalized and cancer cells. Cancer Res 1999; 248:551–7.

3 Transcriptional Regulators

77

6. Feng J, Funk WD, Wang SS, et al. The RNA component of human telomerase. Science 1995; 269:1236–41. 7. Avilion AA, Piatyszek MA, Gupta J, Shay JW, Bacchetti S, and Greider CW. Human telomerase RNA and telomerase activity in immortal cell lines and tumor tissues. Cancer Res 1996; 56:645–50. 8. Kilian A, Bowtell DD, Abud HE, et al. Isolation of a candidate human telomerase catalytic subunit gene, which reveals complex splicing patterns in different cell types. Hum Mol Genet 1997; 6:2011–9. 9. Meyerson M, Counter CM, Eaton EN, et al. hEST2, the putative human telomerase catalytic subunit gene, is up-regulated in tumor cells and during immortalization. Cell 1997; 90:785–95. 10. Nakamura TM, Morin GB, Chapman KB, et al. Telomerase catalytic subunit homologs from fission yeast and human. Science 1997; 277:955–9. 11. Bodnar AG, Ouellette M, Frolkis M, et al. Extension of life-span by introduction of telomerase into normal human cells. Science 1998; 279:349–52. 12. Kyo S, Takakura M, Taira T, et al. Sp1 cooperates with c-Myc to activate transcription of the human telomerase reverse transcriptase gene (hTERT). Nucleic Acids Res 2000; 28:669–77. 13. Wang JL, Xie Y, Allan S, Beach D, and Hannon GJ. Myc activates telomerase. Genes Dev 1998; 12:1769–74. 14. Sagawa Y, Nishi H, Isaka K, Fujito A, and Takayama M. The correlation of TERT expression with c-myc expression in cervical cancer. Cancer Lett 2001; 168:45–50. 15. Wu KJ, Grandori C, Amacker M, Simon-Vermot N, Polack A, Lingner J, and Dalla-Favera R. Direct activation of TERT transcription by c-MYC. Nat Genet 1999; 21:220–4. 16. Greenberg RA, O’Hagan RC, Deng H, et al. Telomerase reverse transcriptase gene is a direct target of c-Myc but is not functionally equivalent in cellular transformation. Oncogene 1999; 18:1219–26. 17. Gunes C, Lichtsteiner S, Vasserot AP, and Englert C. Expression of the hTERT gene is regulated at the level of transcriptional initiation and repressed by Mad1. Cancer Res 2000; 60:2116–21. 18. Oh S, Song YH, Yim J, and Kim TK. Identification of Mad as a repressor of the human telomerase (hTERT ) gene. Oncogene 2000; 19:1485–90. 19. Zou L, Zhang PH, Luo CL, and Tu ZG. Transcript regulation of human telomerase reverse transcriptase by c-myc and mad1. Acta Biochim Biophys Sin (Shanghai) 2005; 37:32–8. 20. Xu D, Popov N, Hou M, et al. Switch from Myc/Max to Mad1/Max binding and decrease in histone acetylation at the telomerase reverse transcriptase promoter during differentiation of HL60 cells. Proc Natl Acad Sci USA 2001; 98:3826–31. 21. Sikand K, Kaul D, and Varma N. Receptor Ck-dependent signaling regulates hTERT gene transcription. BMC Cell Biol 2006; 7:2. 22. Gabet AS, Mortreux F, Charneau P, et al. Inactivation of hTERT transcription by Tax. Oncogene 2003; 22:3734–41. 23. Li H, Lee TH, and Avraham H. A novel tricomplex of BRCA1, Nmi, and c-Myc inhibits c-Myc-induced human telomerase reverse transcriptase gene (hTERT ) promoter activity in breast cancer. J Biol Chem 2002; 277:20965–73. 24. Xiong J, Fan S, Meng Q, et al. BRCA1 inhibition of telomerase activity in cultured cells. Mol Cell Biol 2003; 23:8668–90. 25. Kusumoto M, Ogawa T, Mizumoto K, et al. Adenovirus-mediated p53 gene transduction inhibits telomerase activity independent of its effects on cell cycle arrest and apoptosis in human pancreatic cancer cells. Clin Cancer Res 1999; 5:2140–7. 26. Kanaya T, Kyo S, Hamada K, et al. Adenoviral expression of p53 represses telomerase activity through down-regulation of human telomerase reverse transcriptase transcription. Clin Cancer Res 2000; 6:1239–47. 27. Xu D, Wang Q, Gruber A, et al. Downregulation of telomerase reverse transcriptase mRNA expression by wild type p53 in human tumor cells. Oncogene 2000; 19:5123–33.

78

A.N. Depcrynski et al.

28. Gollahon LS, Kraus E, Wu TA, et al. Telomerase activity during spontaneous immortalization of Li-Fraumeni syndrome skin fibroblasts. Oncogene 1998; 17:709–17. 29. Maxwell SA, Capp D, and Acosta SA. Telomerase activity in immortalized endothelial cells undergoing p53-mediated apoptosis. Biochem Biophys Res Commun 1997; 241:642–5. 30. Mukhopadhyay T, Multani AS, Roth JA, and Pathak S. Reduced telomeric signals and increased telomeric associations in human lung cancer cell lines undergoing p53-mediated apoptosis. Oncogene 1998; 17:901–6. 31. Xu HJ, Zhou Y, Ji W, et al. Reexpression of the retinoblastoma protein in tumor cells induces senescence and telomerase inhibition. Oncogene 1997; 15:2589–96. 32. Nguyen DC and Crowe DL. Intact functional domains of the retinoblastoma gene product (pRb) are required for downregulation of telomerase activity. Biochim Biophys Acta 1999; 1445:207–15. 33. Crowe DL and Nguyen DC. Rb and E2F-1 regulate telomerase activity in human cancer cells. Biochim Biophys Acta 2001; 1518:1–6. 34. Lee SH, Kim JW, Lee HW, et al. Interferon regulatory factor-1 (IRF-1) is a mediator for interferon-gamma induced attenuation of telomerase activity and human telomerase reverse transcriptase (hTERT) expression. Oncogene 2003; 22:381–91. 35. Lee SH, Kim JW, Oh SH, et al. IFN-gamma/IRF-1-induced p27kip1 down-regulates telomerase activity and human telomerase reverse transcriptase expression in human cervical cancer. FEBS Lett 2005; 579:1027–33. 36. Yang H, Kyo S, Takatura M, and Sun L. Autocrine transforming growth factor beta suppresses telomerase activity and transcription of human telomerase reverse transcriptase in human cancer cells. Cell Growth Differ 2001; 12:119–27. 37. Lacerte A, Korah J, Roy M, Yang XJ, Lemay S, and Lebrun JJ. Transforming growth factorbeta inhibits telomerase through SMAD3 and E2F transcription factors. Cell Signal 2008; 20:50–9. 38. Li H, Xu D, Li J, Berndt MC, and Liu JP. Transforming growth factor beta suppresses human telomerase reverse transcriptase (hTERT) by Smad3 interactions with c-Myc and the hTERT gene. J Biol Chem 2006; 281:25588–600. 39. Lin SY and Elledge SJ. Multiple tumor suppressor pathways negatively regulate telomerase. Cell 2003; 113:881–9. 40. Comijn J, Berx G, Vermassen P, et al. The two-handed E box binding zinc finger protein SIP1 downregulates E-cadherin and induces invasion. Mol Cell 2001; 7:1267–78. 41. Takakura M, Kyo S, Inoue M, Wright WE, and Shay JW. Function of AP-1 in transcription of the telomerase reverse transcriptase gene (TERT) in human and mouse cells. Mol Cell Biol 2005; 25:8037–43. 42. Oh S, Song Y, Yim J, and Kim TK. The Wilms’ tumor 1 tumor suppressor gene represses transcription of the human telomerase reverse transcriptase gene. J Biol Chem 1999; 274:37473–8. 43. Fujimoto K, Kyo S, Takakura M, et al. Identification and characterization of negative regulatory elements of the human telomerase catalytic subunit (hTERT ) gene promoter: possible role of MZF-2 in transcriptional repression of hTERT. Nucleic Acids Res 2000; 28:2557–62. 44. Drissi, R, Zindy, F, Roussel, MF, and Cleveland, JL. c-Myc-mediated regulation of telomerase activity is disabled in immortalized cells. J Biol Chem 2001; 276:29994–30001. 45. Endoh, T, Tsuji, N, Asanuma, K, Yagihashi A, and Watanabe, N. Survivin enhances telomerase activity via up-regulation of specificity protein 1- and c-Myc-mediated human telomerase reverse transcriptase gene transcription. Exp Cell Res 2005; 305:300–11. 46. Lv J, Liu H, Wang Q, Tang Z, Hou L, and Zhang B. Molecular cloning of a novel human gene encoding histone acetyltransferase-like protein involved in transcriptional activation of hTERT. Biochem Biophys Res Commun 2003; 311:506–13.

3 Transcriptional Regulators

79

47. Tang Z, Zhao Y, Mei F, et al. Molecular cloning and characterization of a human gene involved in transcriptional regulation of hTERT. Biochem Biophys Res Commun 2004; 324:1324–32. 48. Alfonso-De Matte MY, Yang H, Evans MS, Cheng JQ, and Kruk PA. Telomerase is regulated by c-Jun NH2-terminal kinase in ovarian surface epithelial cells. Cancer Res 2002; 62:4575–8. 49. Gewin L, Myers H, Kiyono T, and Galloway DA. Identification of a novel telomerase repressor that interacts with the human papillomavirus type-16 E6/E6-AP complex. Genes Dev 2004; 18:2269–82. 50. Horikawa I and Barrett JC. Transcriptional regulation of the telomerase hTERT gene as a target for cellular and viral oncogenic mechanisms. Carcinogenesis 2003; 24:1167–76. 51. McMurray HR and McCance DJ. Human papillomavirus type 16 E6 activates TERT gene transcription through induction of c-Myc and release of USF-mediated repression. J Virol 2003; 77:9852–61. 52. Scheffner M, Werness BA, Huibregtse JM, Levine AJ, and Howley PM. The E6 oncoprotein encoded by human papillomavirus types 16 and 18 promotes the degradation of p53. Cell 1990; 63:1129–36. 53. Werness BA, Levine AJ, and Hawley PM. Association of human papillomavirus types 16 and 18 E6 proteins with p53. Science 1990; 248:76–9. 54. Huibregtse JM, Scheffner M, and Howley PM. A cellular protein mediates association of p53 with the E6 oncoprotein of human papillomavirus types 16 or 18. EMBO J 10:4129–35. 55. McMurray HR and McCance DJ. 2004. Degradation of p53, not telomerase activation, by E6 is required for bypass of crisis and immortalization by human papillomavirus type 16 E6/E7. J Virol 1991; 78:5698–706. 56. Katzenellenbogen RA, Egelkrout EM, Vliet-Gregg P, Gewin LC, Gafken PR, and Galloway DA. NFX1-123 and poly(A) binding proteins synergistically augment activation of telomerase in human papillomavirus type 16 E6-expressing cells. J Virol 2007; 81:3786–96. 57. Bromberg JF and Darnell JE Jr. Potential roles of Stat1 and Stat3 in cellular transformation. Cold Spring Harb Symp Quant Biol 1999; 64:425–8. 58. Konnikova L, Simeone MC, Kruger MM, Kotecki M, and Cochran BH. Signal transducer and activator of transcription 3 (STAT3) regulates human telomerase reverse transcriptase (hTERT) expression in human cancer and primary cells. Cancer Res 2005; 65:6516–20. 59. Fuchs B, Inwards C, Scully SP, and Janknecht R. hTERT is highly expressed in Ewing’s sarcoma and activated by EWS-ETS oncoproteins. Clin Orthop Relat Res 2004; 426:64–8. 60. Semenza GL. Hypoxia-inducible factor 1: master regulator of O2 homeostasis. Curr Opin Genet Dev 1998; 8:588–94. 61. Birner P, Schindl M, Obermair A, Breitenecker G, and Oberhuber G. Expression of hypoxiainducible factor 1alpha in epithelial ovarian tumors: its impact on prognosis and on response to chemotherapy. Clin Cancer Res 2001; 7:1661–8. 62. Schindl M, Schoppmann SF, Samonigg H, et al. Overexpression of hypoxia-inducible factor 1alpha is associated with an unfavorable prognosis in lymph node-positive breast cancer. Clin Cancer Res 2002; 8:1831–7. 63. Sivridis E, Giatromanolaki A, Gatter KC, Harris AL, and Koukourakis MI. Association of hypoxia-inducible factors 1alpha and 2alpha with activated angiogenic pathways and prognosis in patients with endometrial carcinoma. Cancer 2002; 95:1055–63. 64. Yatabe N, Kyo S, Maida Y, et al. HIF-1-mediated activation of telomerase in cervical cancer cells. Oncogene 2004; 23:3708–15. 65. Nishi H, Nakada T, Kyo S, Inoue M, Shay JW, and Isaka K. Hypoxia-inducible factor 1 mediates upregulation of telomerase (hTERT). Mol Cell Biol 2004; 24:6076–83. 66. Won J, Yim J, and Kim TK. Opposing regulatory roles of E2F in human telomerase reverse transcriptase (hTERT) gene expression in human tumor and normal somatic cells. Faseb J 2002; 16:1943–5. 67. Dyson N. The regulation of E2F by pRB-family proteins. Genes Dev 1998; 12:2245–62.

80

A.N. Depcrynski et al.

68. Johnson DG. The paradox of E2F1: oncogene and tumor suppressor gene. Mol Carcinog 2000; 27:151–7. 69. Verma SC, Borah S, and Robertson ES. Latency-associated nuclear antigen of Kaposi’s sarcoma-associated herpesvirus up-regulates transcription of human telomerase reverse transcriptase promoter through interaction with transcription factor Sp1. J Virol 2004; 78:10348–59. 70. Won J, Yim J, and Kim TK. Sp1 and Sp3 recruit histone deacetylase to repress transcription of human telomerase reverse transcriptase (hTERT) promoter in normal human somatic cells. J Biol Chem 2002; 277:38230–8. 71. Racek, T, Mise, N, Li, Z, Stoll, A, and Putzer, BM. C-terminal p73 isoforms repress transcriptional activity of the human telomerase reverse transcriptase (hTERT) promoter. J Biol Chem 2005; 280:40402–5. 72. Beitzinger M, Oswald M, Beinoraviciute-Kellner R, and Stiewe T. Regulation of telomerase activity by the p53 family member p73. Oncogene 2006; 25:813–26. 73. Goueli BS and Janknecht R. Regulation of telomerase reverse transcriptase gene activity by upstream stimulatory factor. Oncogene 2003; 22:8042–7. 74. Chang JT, Yang HT, Wang TC and Cheng AJ. Upstream stimulatory factor (USF) as a transcriptional suppressor of human telomerase reverse transcriptase (hTERT) in oral cancer cells. Mol Carcinog 2005; 44:183–92. 75. Toh WH, Kyo S, and Sabapathy K. Relief of p53-mediated telomerase suppression by p73. J Biol Chem 2005; 280:17329–38. 76. Harrington L, McPhail T, Mar V, et al. A mammalian telomerase-associated protein. Science 1997; 275:973–7. 77. Li H, Zhao LL, Funder JW, and Liu JP. Protein phosphatase 2A inhibits nuclear telomerase activity in human breast cancer cells. J Biol Chem 1997; 272:16729–32. 78. Kang SS, Kwon T, Kwon DY, and Do SI. Akt protein kinase enhances human telomerase activity through phosphorylation of telomerase reverse transcriptase subunit. J Biol Chem 1999; 274:13085–90. 79. Igarashi H and Sakaguchi N. Telomerase activity is induced in human peripheral B lymphocytes by the stimulation to antigen receptor. Blood 1997; 89:1299–307. 80. Breitschopf K, Zeiher AM, and Dimmeler S. Pro-atherogenic factors induce telomerase inactivation in endothelial cells through an Akt-dependent mechanism. FEBS Lett 2001; 493:21–5. 81. Akiyama M, Hideshima T, Hayashi T, et al. Cytokines modulate telomerase activity in a human multiple myeloma cell line. Cancer Res 2002; 62:3876–82. 82. Holt SE, Aisner DL, Baur J, et al. Functional requirement of p23 and Hsp90 in telomerase complexes. Genes Dev 1999; 13:817–26. 83. Haendeler J, Hoffmann J, Rahman S, Zeiher AM, and Dimmeler S. Regulation of telomerase activity and anti-apoptotic function by protein-protein interaction and phosphorylation. FEBS Lett 2003; 536:180–6. 84. Roe SM, Prodromou C, O’Brien R, Ladbury JE, Piper PW, and Pearl LH. Structural basis for inhibition of the Hsp90 molecular chaperone by the antitumor antibiotics radici col and geldanamycin. J Med Chem 1999; 42:260–6. 85. Ku WC, Cheng AJ, and Wang TC. Inhibition of telomerase activity by PKC inhibitors in human nasopharyngeal cancer cells in culture. Biochem Biophys Res Commun 1997; 241:730–6. 86. Kim YW, Hur SY, Kim TE, Lee JM, Namkoong SE, Ki IK, and Kim JW. Protein kinase C modulates telomerase activity in human cervical cancer cells. Exp Mol Med 2001; 33:156–63. 87. Yu CC, Lo SC, and Wang TC. Telomerase is regulated by protein kinase C-zeta in human nasopharyngeal cancer cells. Biochem J 2001; 355:459–64. 88. Sheng WY, Chien YL, and Wang TC. The dual role of protein kinase C in the regulation of telomerase activity in human lymphocytes. FEBS Lett 2003; 540:91–5.

3 Transcriptional Regulators

81

89. Li H, Zhao L, Yang Z, Funder JW, and Liu JP. Telomerase is controlled by protein kinase C alpha in human breast cancer cells. J Biol Chem 1998; 273:33436–42. 90. Sheng WY, Chen YR, and Wang TC. A major role of PKC theta and NFkappaB in the regulation of hTERT in human T lymphocytes. FEBS Lett 2006; 580:6819–24. 91. Kharbanda S, Kumar V, Dhar S, et al. Regulation of the hTERT telomerase catalytic subunit by the c-Abl tyrosine kinase. Curr Biol 2000; 10:568–75. 92. Wu X and Lieber MR. Interaction between DNA-dependent protein kinase and a novel protein, KIP. Mutat Res 1997; 385:13–20. 93. Lee GE, Yu EY, Cho CH, Lee J, Muller MT, and Chung IK. DNA-protein kinase catalytic subunit-interacting protein KIP binds telomerase by interacting with human telomerase reverse transcriptase. J Biol Chem 2004; 279:34750–5. 94. Seimiya H, Tanji M, Oh-hara T, Tomida A, Naasani I, and Tsuruo T. Hypoxia up-regulates telomerase activity via mitogen-activated protein kinase signaling in human solid tumor cells. Biochem Biophys Res Commun 1999; 260:365–70. 95. Kim JH, Park SM, Kang MR, et al. Ubiquitin ligase MKRN1 modulates telomere length homeostasis through a proteolysis of hTERT. Genes Dev 2005; 19:776–81 96. Zhang Y, Chang C, Gehling DJ, Hemmati-Brivanlou A, Derynck R. Regulation of Smad degradation and activity by Smurf2, an E3 ubiquitin ligase. Proc Natl Acad Sci USA 2001; 98:974–9. 97. Zhang H and Cohen SN. Smurf2 up-regulation activates telomere-dependent senescence. Genes Dev 2004; 18:3028–40. 98. Liu X, Yuan H, Fu B, et al. The E6AP ubiquitin ligase is required for transactivation of the hTERT promoter by the human papillomavirus E6 oncoprotein. J Biol Chem 2005; 280:10807–16. 99. Smith S and de Lange T. Tankyrase promotes telomere elongation in human cells. Curr Biol 2000; 10:1299–302. 100. Cook BD, Dynek JN, Chang W, Shostak G, and Smith S. Role for the related poly(ADPRibose) polymerases tankyrase 1 and 2 at human telomeres. Mol Cell Biol 2002; 22:332–42. 101. Dantzer F, Giraud-Panis MJ, Jaco I, et al. Functional interaction between poly(ADP-Ribose) polymerase 2 (PARP-2) and TRF2: PARP activity negatively regulates TRF2. Mol Cell Biol 2004; 24:1595–607. 102. Gomez M, Wu J, Schreiber V, et al. PARP1 is a TRF2-associated poly(ADP-ribose)polymerase and protects eroded telomeres. Mol Biol Cell 2006; 17:1686–96. 103. Cohen SB, Graham ME, Lovrecz GO, Bache N, Robinson PJ, and Reddel RR. Protein composition of catalytically active human telomerase from immortal cells. Science 2007; 315:1850–3. 104. Forsythe HL, Jarvis JL, Turner JW, Elmore LW, and Holt SE. Stable association of hsp90 and p23, but Not hsp70, with active human telomerase. J Biol Chem 2001; 276:15571–4. 105. Compton SA, Elmore LW, Haydu K, Jackson-Cook CK, Holt SE. Induction of nitric oxide synthase-dependent telomere shortening after functional inhibition of Hsp90 in human tumor cells. Mol Cell Biol 2006; 26:1452–62. 106. Pearl LH and Prodromou C. Structure and mechanism of the Hsp90 molecular chaperone machinery. Annu Rev Biochem 2006; 75:271–94. 107. Akalin A, Elmore LW, Forsythe HL, et al. A novel mechanism for chaperone-mediated telomerase regulation during prostate cancer progression. Cancer Res 2001; 61:4791–6. 108. Sharp S. and Workman P. Inhibitors of the HSP90 molecular chaperone: current status. Adv Cancer Res 2006; 95:323–48. 109. de Lange T. Shelterin: the protein complex that shapes and safeguards human telomeres. Genes Dev 2005; 19:2100–10. 110. Chai W, Ford LP, Lenertz L, Wright WE, and Shay JW. Human Ku70/80 associates physically with telomerase through interaction with hTERT. J Biol Chem 2002; 277:47242–7.

82

A.N. Depcrynski et al.

111. Espejel S, Franco S, Rodrı´guez-Perales S, Bouffler SD, Cigudosa JC, and Blasco MA. Mammalian Ku86 mediates chromosomal fusions and apoptosis caused by critically short telomeres. EMBO J 2002; 21:2207–19. 112. Jaco I, Mun˜oz P, and Blasco MA. Role of human Ku86 in telomere length maintenance and telomere capping. Cancer Res 2004; 64:7271–8. 113. Ting NS, Yu Y, Pohorelic B, Lees-Miller SP, and Beattie TL. Human Ku70/80 interacts directly with hTR, the RNA component of human telomerase. Nucleic Acids Res 2005; 33:2090–8. 114. van Steensel B and de Lange T. Control of telomere length by the human telomeric protein TRF1. Nature 1997; 385:740–3. 115. van Steensel B, Smogorzewska A, and de Lange T. TRF2 protects human telomeres from end-to-end fusions. Cell 1998; 92:401–13. 116. Griffith JD, Comeau L, Rosenfield S, et al. Mammalian telomeres end in a large duplex loop. Cell 1999; 97:503–14. 117. Blasco MA. Telomeres and human disease: ageing, cancer and beyond. Nat Rev Genet 2005; 6:611–22. 118. Zhou XZ and Lu KP. The Pin2/TRF1-interacting protein PinX1 is a potent telomerase inhibitor. Cell 2001; 107:347–59. 119. Banik SS and Counter CM. Characterization of interactions between PinX1 and human telomerase subunits hTERT and hTR. J Biol Chem 2004; 279:51745–8. 120. Sharma GG, Hwang KK, Pandita RK, et al. Human heterochromatin protein 1 isoforms HP1 (Hsalpha) and HP1(Hsbeta) interfere with hTERT-telomere interactions and correlate with changes in cell growth and response to ionizing radiation. Mol Cell Biol 2003; 23:8363–76. 121. Wong JM, Kusdra L, and Collins K. Subnuclear shuttling of human telomerase induced by transformation and DNA damage. Nat Cell Biol 2002; 4:731–6. 122. Etheridge KT, Banik SS, Armbruster BN, et al. The nucleolar localization domain of the catalytic subunit of human telomerase. J Biol Chem 2002; 277:24764–70. 123. Yang Y, Chen Y, Zhang C, Huang H, and Weissman SM. Nucleolar localization of hTERT protein is associated with telomerase function. Exp Cell Res 2002; 277:201–9. 124. Narayanan A, Lukowiak A, Ja´dy BE, et al. Nucleolar localization signals of box H/ACA small nucleolar RNAs. EMBO J 1999; 18:5120–30. 125. Mitchell JR, Cheng J, and Collins K. A box H/ACA small nucleolar RNA-like domain at the human telomerase RNA 30 end. Mol Cell Biol 1999; 19:567–76. 126. Lukowiak AA, Narayanan A, Li ZH, Terns RM, and Terns MP. The snoRNA domain of vertebrate telomerase RNA functions to localize the RNA within the nucleus. RNA 2001; 7:1833–44. 127. Khurts S, Masutomi K, Delgermaa L, et al. Nucleolin interacts with telomerase. J Biol Chem 2004; 279:51508–15. 128. Akiyama M, Hideshima T, Hayashi T, et al. Nuclear factor-kappaB p65 mediates tumor necrosis factor alpha-induced nuclear translocation of telomerase reverse transcriptase protein. Cancer Res 2003; 63:18–21. 129. Akiyama M, Yamada O, Hideshima T, et al. TNFalpha induces rapid activation and nuclear translocation of telomerase in human lymphocytes. Biochem Biophys Res Commun 2004; 316:528–32. 130. Dellambra E, Golisano O, Bondanza S, et al. Downregulation of 14-3-3sigma prevents clonal evolution and leads to immortalization of primary human keratinocytes. J Cell Biol 2000; 149:1117–30. 131. Seimiya H, Sawada H, Muramatsu Y, et al. Involvement of 14-3-3 proteins in nuclear localization of telomerase. EMBO J 2000; 19:2652–61. 132. Lin J, Jin R, Zhang B, et al. Characterization of a novel effect of hPinX1 on hTERT nucleolar localization. Biochem Biophys Res Commun 2007; 353:946–52. 133. Hawley-Nelson P, Vousden KH, Hubbert NL, Lowy DR, and Schiller JT. HPV16 E6 and E7 proteins cooperate to immortalize human foreskin keratinocytes. EMBO J 1989; 8:3905–10.

3 Transcriptional Regulators

83

134. Mu¨nger K, Werness BA, Dyson N, Phelps WC, Harlow E, and Howley PM. Complex formation of human papillomavirus E7 proteins with the retinoblastoma tumor suppressor gene product. EMBO J 1989; 8:4099–105. 135. Veldman T, Horikawa I, Barrett JC, and Schlegel R. Transcriptional activation of the telomerase hTERT gene by human papillomavirus type 16 E6 oncoprotein. J Virol 2001; 75:4467–72. 136. Oh ST, Kyo S, and Laimins LA. Telomerase activation by human papillomavirus type 16 E6 protein: induction of human telomerase reverse transcriptase expression through Myc and GC-rich Sp1 binding sites. J Virol 2001; 75:5559–66. 137. Gewin L and Galloway DA. E box-dependent activation of telomerase by human papillomavirus type 16 E6 does not require induction of c-myc. J Virol 2001; 75:7198–201. 138. Veldman T, Liu X, Yuan H, and Schlegel R. Human papillomavirus E6 and Myc proteins associate in vivo and bind to and cooperatively activate the telomerase reverse transcriptase promoter. Proc Natl Acad Sci USA 2003; 100:8211–6. 139. Lee D, Kim HZ, Jeong KW, et al. Human papillomavirus E2 down-regulates the human telomerase reverse transcriptase promoter. J Biol Chem 2002; 277:27748–56. 140. Portis T, Cooper L, Dennis P, Longnecker R. The LMP2A signalosome–a therapeutic target for Epstein-Barr virus latency and associated disease. Front Biosci 2002; 7:d414–26. 141. Chen F, Liu C, Lindvall C, Xu D, and Ernberg I. Epstein-Barr virus latent membrane 2A (LMP2A) down-regulates telomerase reverse transcriptase (hTERT) in epithelial cell lines. Int J Cancer 2005; 113:284–9. 142. Knight JS, Cotter MA II, and Robertson ES. The latency-associated nuclear antigen of Kaposi’s sarcoma-associated herpesvirus transactivates the telomerase reverse transcriptase promoter. J Biol Chem 2001; 276:22971–8. 143. Glasspool RM, Burns S, Hoare SF, Svensson C, and Keith NW. The hTERT and hTERC telomerase gene promoters are activated by the second exon of the adenoviral protein, E1A, identifying the transcriptional corepressor CtBP as a potential repressor of both genes. Neoplasia 2005; 7:614–22. 144. Kirch HC, Ruschen S, Brockmann D, et al. Tumor-specific activation of hTERT-derived promoters by tumor suppressive E1A-mutants involves recruitment of p300/CBP/HAT and suppression of HDAC-1 and defines a combined tumor targeting and suppression system. Oncogene 2002; 21:7991–8000. 145. Horikawa I and Barrett JC. cis-Activation of the human telomerase gene (hTERT) by the hepatitis B virus genome. J Natl Cancer Inst 2001; 93: 1171–3. 146. Paterlini-Bre´chot P, Saigo K, Murakami Y, et al. Hepatitis B virus-related insertional mutagenesis occurs frequently in human liver cancers and recurrently targets human telomerase gene. Oncogene 2003; 22:3911–6. 147. Ferber MJ, Montoya DP, Yu C, et al. Integrations of the hepatitis B virus (HBV) and human papillomavirus (HPV) into the human telomerase reverse transcriptase (hTERT) gene in liver and cervical cancers. Oncogene 2003; 22:3813–20. 148. Zou SQ, Qu ZL, Li ZF, and Wang X. Hepatitis B virus X gene induces human telomerase reverse transcriptase mRNA expression in cultured normal human cholangiocytes. World J Gastroenterol 2004; 10:2259–62. 149. Zhang X, Dong N, Zhang H, You J, Wang H, and Ye L. Effects of hepatitis B virus X protein on human telomerase reverse transcriptase expression and activity in hepatoma cells. J Lab Clin Med 2005; 145:98–104. 150. Misiti S, Nanni S, Fontemaggi G, et al. Induction of hTERT expression and telomerase activity by estrogens in human ovary epithelium cells. Mol Cell Biol 2000; 20:3764–71. 151. Kyo S, Takakura M, Kanaya T, et al. Estrogen activates telomerase. Cancer Res 1999; 59:5917–21. 152. Kimura A, Ohmichi M, Kawagoe J, et al. Induction of hTERT expression and phosphorylation by estrogen via Akt cascade in human ovarian cancer cell lines. Oncogene 2004; 23:4505–15.

84

A.N. Depcrynski et al.

153. Wang Z, Kyo S, Takakura M, et al. Progesterone regulates human telomerase reverse transcriptase gene expression via activation of mitogen-activated protein kinase signaling pathway. Cancer Res 2000; 60:5376–81. 154. Dai WS, Kuller LH, LaPorte RE, Gutai JP, Falvo-Gerard L, and Caggiula A. The epidemiology of plasma testosterone levels in middle-aged men. Am J Epidemiol 1981; 114:804–16. 155. Moehren U, Papaioannou M, Reeb CA, et al. Wild-type but not mutant androgen receptor inhibits expression of the hTERT telomerase subunit: a novel role of AR mutation for prostate cancer development. FASEB J 2008; 22:1258–67. 156. Zhao JQ, Glasspool RM, Hoare SF, Bilsland A, Szatmari I, and Keith WN. Activation of telomerase RNA gene promoter activity by NF-Y, Sp1, and the retinoblastoma protein and repression by Sp3. Neoplasia 2000; 2:531–539. 157. Dragon F, Pogacic´ V, and Filipowicz W. In vitro assembly of human H/ACA small nucleolar RNPs reveals unique features of U17 and telomerase RNAs. Mol Cell Biol 2000; 20:3037–48. 158. Dez C, Henras A, Faucon B, Lafontaine D, Caizergues-Ferrer M, and Henry Y. Stable expression in yeast of the mature form of human telomerase RNA depends on its association with the box H/ACA small nucleolar RNP proteins Cbf5p, Nhp2p and Nop10p. Nucleic Acids Res 2001; 29:598–603. 159. Zhao JQ, Hoare SF, McFarlane R, et al. Cloning and characterization of human and mouse telomerase RNA gene promoter sequences. Oncogene 1998; 16:1345–50. 160. Zhao J, Bilsland A, Hoare SF, and Keith WN. Involvement of NF-Y and Sp1 binding sequences in basal transcription of the human telomerase RNA gene. FEBS Lett 2003; 536:111–9. 161. Zhao J, Bilsland A, Jackson K, and Keith WN. MDM2 negatively regulates the human telomerase RNA gene promoter. BMC Cancer 2005; 5:6. 162. Ford LP, Suh JM, Wright WE, and Shay JW. Heterogeneous nuclear ribonucleoproteins C1 and C2 associate with the RNA component of human telomerase. Mol Cell Biol 2000; 20:9084–91. 163. Eversole A and Maizels N. In vitro properties of the conserved mammalian protein hnRNP D suggest a role in telomere maintenance. Mol Cell Biol 2000; 20:5425–32. 164. Bandiera A, Tell G, Marsich E, et al. Cytosine-block telomeric type DNA-binding activity of hnRNP proteins from human cell lines. Arch Biochem Biophys 2003; 409:305–14. 165. Ishikawa F, Matunis MJ, Dreyfuss G, and Cech TR. Nuclear proteins that bind the premRNA 30 splice site sequence r(UUAG/G) and the human telomeric DNA sequence d (TTAGGG)n. Mol Cell Biol 1993; 13:4301–10. 166. Lacroix L, Lie´nard H, Labourier E, et al. Identification of two human nuclear proteins that recognise the cytosine-rich strand of human telomeres in vitro. Nucleic Acids Res 2000; 28:1564–75. 167. Dallaire F, Dupuis S, Fiset S, and Chabot B. Heterogeneous nuclear ribonucleoprotein A1 and UP1 protect mammalian telomeric repeats and modulate telomere replication in vitro. J Biol Chem 2000; 275:14509–16. 168. Ford LP, Wright WE, and Shay JW. A model for heterogeneous nuclear ribonucleoproteins in telomere and telomerase regulation. Oncogene 2002; 21:580–3. 169. Moran-Jones K, Wayman L, Kennedy DD, et al. hn RNP A2, a potential ssDNA/RNA molecular adapter at the telomere.. Nucleic Acids Res 2005; 33(2):486–96. 170. Fiset S and Chabot B. hnRNP A1 may interact simultaneously with telomeric DNA and the human telomerase RNA in vitro. Nucleic Acids Res 2001; 29:2268–75. 171. Zhang QS, Manche L, Xu RM, and Krainer AR. hnRNP A1 associates with telomere ends and stimulates telomerase activity. RNA 2006; 12:1116–28. 172. Chong L, van Steensel B, Broccoli D, et al. A human telomeric protein. Science 1995; 270:1663–7. 173. Smogorzewska A, van Steensel B, Bianchi A, et al. Control of human telomere length by TRF1 and TRF2. Mol Cell Biol 2000; 20:1659–68.

3 Transcriptional Regulators

85

174. Iwano T, Tachibana M, Reth M, and Shinkai Y. Importance of TRF1 for functional telomere structure. J Biol Chem 2004; 279:1442–8. 175. Loayza D and De Lange T. POT1 as a terminal transducer of TRF1 telomere length control. Nature 2003; 423:1013–8. 176. Lei M, Podell ER, and Cech TR. Structure of human POT1 bound to telomeric singlestranded DNA provides a model for chromosome end-protection. Nat Struct Mol Biol 2004; 11:1223–9. 177. Li B and de Lange T. Rap1 affects the length and heterogeneity of human telomeres. Mol Biol Cell 2003; 14:5060–8. 178. Ye JZ, Hockemeyer D, Krutchinsky AN, et al. POT1-interacting protein PIP1: a telomere length regulator that recruits POT1 to the TIN2/TRF1 complex. Genes Dev 2004; 18:1649–54. 179. Liu D, Safari A, O’Connor MS, Chan DW, Laegeler A, Qin J, and Songyang Z. PTOP interacts with POT1 and regulates its localization to telomeres. Nat Cell Biol 2004; 6:673–80. 180. O’Connor MS, Safari A, Xin H, Liu D, and Songyang Z. A critical role for TPP1 and TIN2 interaction in high-order telomeric complex assembly. Proc Natl Acad Sci USA 2006;103:11874–9. 181. Xin H, Liu D, Wan M, et al. TPP1 is a homologue of ciliate TEBP-beta and interacts with POT1 to recruit telomerase. Nature 2007; 445:559–62. 182. Kim SH, Beausejour C, Davalos AR, Kaminker P, Heo SJ, and Campisi J. TIN2 mediates functions of TRF2 at human telomeres. J Biol Chem 2004; 270:43799–804. 183. Chiang YJ, Kim SH, Tessarollo L, Campisi J, and Hodes RJ. Telomere-associated protein TIN2 is essential for early embryonic development through a telomerase independent pathway. Mol Cell Biol. 2004; 24:6631–4. 184. Smith S, Giriat I, Schmitt A, and de Lange T. Tankyrase, a poly(ADP-ribose) polymerase at human telomeres. Science 1998; 282:1484–7. 185. Chai W, Sfeir AJ, Hoshiyama H, Shay JW, and Wright WE. The involvement of the Mre11/ Rad50/Nbs1 complex in the generation of G-overhangs at human telomeres. EMBO Rep 2006; 7:225–30. 186. Wu Y, Xiao S, and Zhu XD. MRE11-RAD50-NBS1 and ATM function as co-mediators of TRF1 in telomere length control. Nat Struct Mol Biol 2007; 14:832–40. 187. Bu¨rkle A, Brabeck C, Diefenbach J, and Beneke S. The emerging role of poly(ADP-ribose) polymerase-1 in longevity. Int J Biochem Cell Biol 2005; 37:1043–53. 188. Jaco I, Mun˜oz P, Goytisolo F, et al. Role of mammalian Rad54 in telomere length maintenance. Mol Cell Biol 2003; 23:5572–80. 189. Tarsounas M, Mun˜oz P, Claas A, et al. Telomere maintenance requires the RAD51D recombination/repair protein. Cell 2004; 117:337–47. 190. Chan SW and Blackburn EH. Telomerase and ATM/Tel1p protect telomeres from nonhomologous end joining. Mol Cell 2003; 11:1379–87. 191. Lin J and Blackburn EH. Nucleolar protein PinX1p regulates telomerase by sequestering its protein catalytic subunit in an inactive complex lacking telomerase RNA. Genes Dev 2004; 18: 387–96.

Chapter 4

Telomere Dysfunction and the DNA Damage Response Malissa C. Diehl, Lynne W. Elmore, and Shawn E. Holt

Abstract In the absence of a protective state at telomeres, chromosome ends become dysfunctional and may ultimately contribute to genomic instability. To avoid the disruption of telomere function, a host of telomere-binding and associated proteins are critically involved in maintaining structure and preventing subsequent activation of a DNA damage response. In addition to these factors, a multitude of DNA damage response proteins also normally localize to the telomere, without triggering a repair response or cell cycle arrest. Their involvement suggests that telomere maintenance and the damage response are highly interdependent for ensuring genomic integrity. In this regard, a paradigm emerges in which telomeres may actually act as sentinels for monitoring damaged DNA and mediating repair. The close cooperativity between telomere-binding proteins and DNA damage proteins is extremely important, since a compromised DNA damage response in the context of damaged telomeres leads to significant clinical manifestations, including normal aging, genome instability and premature aging syndromes, neurodegenerative diseases, and cancer. Therapeutic possibilities that have been developed for these diseases target telomeres, telomerase, or DNA damage response mediators. The interdependence of telomere maintenance and DNA damage signaling pathways is clearly evident since both entities converge toward a common goal of maintaining genomic integrity. Keywords: Telomere-binding proteins, Telomere maintenance, Dysfunction, DNA damage, Genomic instability.

S.E. Holt(*) Departments of Pathology, at Virginia Commonwealth University, 1101 E. Marshall Street, Richmond, VA 23298-0662, USA, e-mail: [email protected]

K. Hiyama (ed.), Telomeres and Telomerase in Cancer. DOI: 10.1007/978-1-60327-879-9_4, # Humana Press, a part of Springer Science + Business Media, LLC 2009 87

88

4.1

M.C. Diehl et al.

Introduction

From initial work with yeast and Tetrahymena to the more modern day trend of studying mammalian telomeres, a wealth of information has been amassed on telomere biology and function. The protection provided by chromosome ends is essential for maintaining chromosomal and genomic stability. In the absence of such protective mechanisms, molecular and cellular responses trigger the activation of DNA surveillance and repair programs. To this end, the coexistence of DNA damage factors and telomere-binding proteins at the telomere may superficially appear as a paradox. However, further inspection suggests that this localization is more than mere coincidence. Proper telomere structure, including the presence of telomere-binding proteins, is crucial for avoiding dysfunction. Since DNA damage response proteins are also associated with the telomere, a complete discussion of telomere dysfunction necessitates their inclusion. The close interplay between the seemingly separate entities, telomere-binding proteins and DNA damage proteins, is extremely important, since a compromised DNA damage response in the context of damaged telomeres has significant clinical implications. Many cancers, premature aging and genome instability syndromes, and neurodegenerative diseases reflect deficiencies in telomerebased and DNA damage proteins. Because of this connection, it may be possible to develop and utilize specifically targeted therapies as treatment. The list of novel telomere-associated proteins will continue to expand and the definitive role of each protein must be elucidated accordingly. Although the players may vary, it is nevertheless evident that telomere maintenance and DNA damage signaling pathways converge toward a common goal of maintaining genomic integrity. The interdependence of telomere function and the DNA damage response remains a source of intense scrutiny as the layers of complexity begin to be appreciated.

4.2 4.2.1

Telomeres Structure, Function, and Telomere-Associated Proteins

Telomeres are specialized structures found at the ends of linear chromosomes that are distinct from the remainder of the genomic chromatin in many ways, both structurally and functionally. These nucleoprotein complexes contain noncoding DNA distinguished by the highly conserved 50 -d(TTAGGG)-30 sequence in humans. The presence of multiple guanine residues allows the telomere to inherently form G-quadruplex structures under physiological conditions (1). The telomeric region consists of an area of double-stranded DNA followed by a stretch of single-stranded DNA to produce a G0 -overhang at the 30 end. Telomeres exist in variable lengths among different organisms or cells of different origins. For instance, the average length ranges from 3 to 20 kb in humans, while inbred strains of mice have been shown to have telomeres as long as 150 kb (2).

4 Telomere Dysfunction and the DNA Damage Response

89

As dynamic structures, the primary function of telomeres is to provide a capping mechanism, and to this end, telomeres fulfill three roles (3). First, intact telomeres protect natural DNA ends from being recognized as double-stranded breaks and consequently activating a DNA damage response (4). In other words, telomeres assure that the ends of normal linear chromosomes are not subjected to unwarranted mechanisms of repair. Second, telomeres provide protection from inappropriate exonuclease degradation and third, from end-to-end fusions (4, 5). Normal cells without a capping mechanism are also vulnerable to recombination due to their highly repetitive sequence (3). Other downstream chromosomal instabilities including translocations, nondisjunction, and aneuploidy may occur at later rounds of cell division, which likely contribute to tumorigenesis (6). Thus, maintaining telomere integrity and avoiding dysfunction are critical for genomic stability. A host of telomere-binding proteins assure that telomeres do not trigger a DNA damage response, since an unfolded telomere could be sensed as a double-strand DNA break (Fig. 4.1). Some of these capping proteins include telomeric repeat binding protein factor 1 and 2 (TRF1 and 2), TIN2 (TRF1-interacting nuclear factor 2), POT1 (protection of telomeres), RAP1 (repressor/activator protein), MRE11 complex, Ku, PTOP/PIP1, and tankyrase 1/2 (7). These proteins cooperatively establish TRF2 Interactors: Mre11 / Rad50/NBS1 RAD51 WRN BLM PARP Ku70 XRCC1/ XPF Apollo

Others: ATM RAD51 Ku86 DNA-PKcs tankyrase

hRAP1 TRF1

TRF1

TRF2

TIN2

TRF2

TRF2

TRF1 interactors: Ku70 Ku 80

TPP1 TRF1 POT1

TRF1

POT1

5’ TRF2 POT1

5’

TRF2

3’

nucleosomes D-loop

3’

Others: telomerase

Fig. 4.1 Proteins localized to the human telomere. Formation of the T-loop and D-loop require the assistance of several telomere-binding proteins. Of these, the shelterin complex, consisting of TRF1, TRF2, TIN2, TPP1, RAP1, and POT1, collectively contains five DNA-binding domains (two each in TRF1 and TRF2 and one in POT1), thus making it uniquely suited to recognize telomeric DNA. The role of other telomere-associated proteins in homologous recombination or nonhomologous end joining implicates DNA damage sensing and repair to be intimately connected to telomere biology. The absence or deficiency in telomere-based or DNA damage and repair proteins may lead to telomere dysfunction and ultimately, genomic instability (See Color Insert)

90

M.C. Diehl et al.

the telomere loop, or T-loop, in which the single-stranded 30 overhang folds back and invades duplex DNA (8, 9). The region of double-strand invasion is referred to as the displacement loop or D-loop (8, 10). The existence of apparently evolutionarily conserved T-loops supports the presence of higher-order structure in telomeres (1, 10). Of these telomere-binding proteins, six integral proteins, TRF1, TRF2, TIN2, RAP1, TPP1, and POT1, constitute the Shelterin complex (8). Unlike other telomere-associated proteins, this complex is abundant only at chromosome ends and remains associated at the telomere throughout the cell cycle (8). Two of the shelterin components, TRF1 and TRF2, contain DNA-binding domains that recognize the double-stranded portion of telomeric DNA, and thus are necessary for the proper formation and stabilization of the T/D-loop (1). TRF2 is also found at the junction of duplex DNA invasion, around the D-loop (11). These proteins bind as preformed homodimers and are able to form higher order oligomers (8). Homodimerization of TRF1 and TRF2 is essential to their proper functioning since loss of this ability results in a failure to localize to the telomere (1). Although TRF1 and TRF2 localize to the same region of the telomere, they serve different functions. TRF1 mainly acts as a negative regulator of telomere length, partially through inhibition of telomerase. Overexpression of TRF1 results in gradual telomere shortening, while dominant-negative TRF1 causes elongation in the presence of telomerase (2). In contrast, TRF2 has emerged as the major protective factor at chromosome ends, acting as a positive regulator of telomere length (6). In support of this role, overexpression of TRF2 results in increased telomere shortening, without an associated increase in replicative senescence rate (12). This finding indicates that TRF2 acts to stabilize and protect shortened telomeres and prevents the induction of senescence. Functional inactivation of TRF2 via a dominant-negative mutant results in a loss of T-loop formation, leading to the production of nonhomologous end joining (NHEJ)-mediated end-to-end fusions. These fusions presumably arise from the cell’s inability to distinguish natural ends and broken DNA (6, 13). Additionally, recent data indicate that TRF2 may assume other (nontelomeric) cellular roles. For instance, TRF2 has been implicated in sensing and responding to irradiation-induced nontelomeric interstitial DNA damage (14). In this context, the interaction of TRF2 with numerous mediators of DNA repair implicates this protein in serving multifunctional roles. Other factors involved in telomere capping include TIN2 and tankyrase (a poly (ADP-ribose) polymerase), which act as negative and positive regulators of telomere length, respectively (10). TIN2 is believed to provide a scaffolding unit for other proteins to dock and modulate TRF1 function (2). Tankyrase is required for resolution and complete separation of sister telomeres during mitosis. Tankyrase is recruited by TRF1 to the telomere where it interacts with the acidic N-terminal domain of TRF1 (9, 15). Human RAP1 indirectly binds to the telomere via TRF2 and has been reported to have both negative and positive roles (2, 10). POT1 specifically binds single-stranded telomeric sequences of both the 30 overhang portion of the telomere and internally displaced regions in order to regulate telomere elongation (8, 16). Loss of POT1 results in loss of telomeric sequences

4 Telomere Dysfunction and the DNA Damage Response

91

and the appearance of fusions that may solicit a damage response. TPP1 negatively regulates length by interacting with POT1 and TIN2 using different domains (2) and in doing so, it holds all the components of the shelterin complex together (8). In addition to members of the shelterin complex, the lariat T-loop structure is also associated with proteins involved in DNA repair, DNA processing, and proteins that specifically bind single-stranded DNA, which will be discussed later (2). Taken together, information about both linear and three-dimensional structure and associated proteins has provided valuable insight into telomere biology and function. The plethora of mediators that aid in preserving this function and the complexity of the telomeric structure indicate that telomere dysfunction is intolerable and must be prevented. Therefore, ensuring the presence of a protected state at chromosome ends is necessary for upholding chromosomal and genomic integrity.

4.2.2

Telomerase and Telomere Maintenance

During normal replication, the discontinuous property of lagging-strand synthesis produces a stretch of unreplicated DNA between the final RNA priming event and the terminus due to DNA polymerase inaccessibility. This phenomenon, termed the end replication problem, effectively shortens telomeres by 20–200 bases with each round of cell division until a critically short length is reached (10). The progressive accumulation of short telomeres directs cells with functional tumor suppressors into senescence, characterized as an irreversible G1 growth arrested state (17, 18). To counteract the end replication problem in an attempt to avoid telomere dysfunction, the processive ribonucleoprotein enzyme, telomerase, extends these continuously shortened ends. First identified in Tetrahymena by Greider and Blackburn (19), telomerase consists of an internal RNA template (hTR in humans) that recognizes the single stranded overhang produced as a result of DNA replication and a catalytic reverse transcriptase (hTERT in humans) that uses the template to add on telomeric DNA (20, 21). Access of telomerase to the telomere may be regulated by telomeric structure as determined by the presence of telomere-binding proteins (22). Proper telomerase assembly requires the association of various proteins including the heat shock protein 90 multichaperone complex, consisting of Hsp90, p23, Hsp70, p60, and Hsp40/ydj. However, only Hsp90 and p23 have been shown to stably associate with active enzyme (23). Many client proteins, such as kinases, transcription factors, hormone receptors, and telomerase, undergo posttranslational maturation via the Hsp90 chaperone cycle to determine their cellular fate (24, 25). Because Hsp90 expression is increased in many human malignancies, Hsp90 inhibition has become a promising approach for cancer therapy since many client proteins can be simultaneously targeted and disrupted (25, 26). Although issues of drug specificity exist, Hsp90 in cancer cells have been found predominantly in a form that is bound to its client proteins, while most normal cells have uncomplexed Hsp90. This heightened formation of multiclient complexes is therefore not due to increased levels of Hsp90 itself, but rather an increased association with Hsp90

92

M.C. Diehl et al.

(27). Furthermore, Hsp90 in cancer cells have a higher affinity for anti-Hsp90 compounds compared to that in normal cells, thus providing tumor selectivity via, as yet, an unknown manner (27). In addition to higher levels of Hsp90 multiclient complexes, tumor, stem, and germ cells also activate telomerase during late S phase (10). Unlike what occurs in normal somatic cells, telomerase maintains telomeres in these cells, thus providing an unlimited proliferative potential (7, 28). However, despite high levels of telomerase activity in cancer cells, telomeres are nevertheless maintained at a relatively short length. In fact, telomere length abnormalities occur early in the initiation of epithelial carcinogenesis (29), for example, in ductal carcinoma in situ (DCIS) of the breast (30). Since its activity has been detected in more than 85% of all malignant human cancers, telomerase is a logical therapeutic target and molecular marker as a measure for human tumorigenic conversion.

4.2.3

Telomere Dysfunction and Genomic Instability

The role of structure in terms of both telomeric DNA and associated proteins, as well as its inherent capping function, support the notion that maintaining telomere integrity is critical for genomic stability (5, 31). Based on the seminal work of McClintock and Muller in the 1930s and 1940s, it is clear now that broken or damaged chromosome ends are unstable and may predispose a cell to genomic rearrangements (32, 33). Since those early studies, telomeres have been identified as highly specialized structures that provide stability to DNA ends (34). Maintenance of telomere length homeostasis is essential for cell viability, without which, telomere dysfunction inevitably ensues. Telomeric DNA is maintained at a defined equilibrium, although repeats vary in number between different chromosomes and so telomeric length is quite heterogeneous. In mammalian cells, telomere-binding proteins establish this equilibrium (34). Telomere dysfunction is induced by three main mechanisms, all of which share the common theme of deregulation or displacement of telomere-binding proteins. In the first mechanism, inactivation of telomere-binding proteins disrupts telomere function and leads to telomere length deregulation, as previously discussed. In this unprotected state, chromosome ends are sensed as double-strand breaks and processed accordingly, resulting in dysfunctional telomeres (34). In the second mechanism, alterations in the telomeric sequence also induce dysfunction, since changes in the repetitive tracts render these regions incapable of recruiting telomere-binding proteins (34). This is supported by studies with Tetrahymena thermophila in which the telomerase RNA component was mutated such that abnormal telomere repeats were synthesized (35). Although telomere elongation was able to occur, these mutants displayed abnormal cell morphology, reduced cell division due to blockage during anaphase, and induction of senescence (35, 36). Similarly, yeast telomerase RNA template mutants also show aberrant telomere length maintenance due to essentially the removal of RAP1-binding sites on the telomere (37). Telomeres in these mutants either were elongated, but poorly regulated in length, or shortened until senescence was reached (37). In this scenario,

4 Telomere Dysfunction and the DNA Damage Response

93

alterations in the telomeric sequence effectively act in the same manner as inactivating telomere-binding proteins. In the third mechanism, telomere erosion leads to telomere dysfunction. The binding of telomere-associated proteins is a dynamic process in which the availability of any one binding site is a central concern (34). If proteins bind independently of each other, fewer numbers of repeats leave fewer binding sites, and thus, less protein is able to bind. On the other hand, cooperative binding would mean that the presence of fewer available tracts makes it less likely that any telomeric repeat would be bound (34). In either situation, telomeric DNA contains such few bases that telomere-binding proteins cannot associate. Yeast without normal telomerase activity undergoes progressive telomere shortening and loss of viability in the form of senescence, albeit as a delayed response (38). Mice with defective telomerase activity also share this phenotype, as well as delayed apoptosis and chromosome instability (39). These findings indicate that loss of telomerase is not the major driving factor in cell fate, but rather the resulting loss of telomere length. In accordance with the delayed phenotypes, telomere length must reach a certain critically short threshold before dysfunction ensues (34). Collectively, these mechanisms of telomere dysfunction share the property of loss of telomere-binding proteins as the underlying mechanistic cause. When checkpoint mechanisms are intact, cells respond to dysfunction by undergoing senescence or apoptosis. In the absence of such checkpoints, cells continue to proliferate leading to increased genomic instability (40). One form of instability is the end-to-end joining of chromosome ends via NHEJ, which produces circular chromosomes or dicentric chromosomes and contribute to extensive genomic instability due to breakage–fusion–bridge cycles (41). Alternatively, homologous recombination may occur between telomeric or subtelomeric regions as a secondary mechanism of telomere maintenance. In yeast, type I recombination involves amplification of subtelomeric regions and requires the assistance of Rad 54, 51, 55/57, 52, and Exo1 (5). Type II recombination involves telomeric repeat amplification and is associated with many regulators of DNA damage and repair responses, such as Mre11, Rad50, Xrs2, ATM, and human Werner’s (WRN) and Bloom’s (BLM) syndromes helicase orthologs (5). Given that telomere dysfunction ultimately leads to chromosomal and genomic instability, it is not surprising that deleterious deletions and amplifications also drive carcinogenesis (41). As a corollary, it has been shown that both telomere shortening and cancer incidence increase over time (17). Thus, telomere dysfunction is likely associated with many cellular consequences due to the fact that chromosome ends essentially maintain chromosomal integrity in the form of DNA damage protection.

4.3

DNA Damage Response

Proper cellular functioning and survival assurance depend on the ability to detect and correct DNA errors by the DNA damage response. Although straightforward in theory, in reality, it is a highly conserved complex process involving the

94

M.C. Diehl et al.

coordination of many factors involved in a variety of signaling pathways to ensure integrity of the genome. DNA is under constant attack by genotoxic agents, some of which include ultraviolet light, ionizing radiation, environmental mutagens, and endogenous reactive oxygen species (ROS) (42). These ROS species preferentially target guanine residues, and since telomeres have abundant guanine bases, chromosome ends tend to be attacked resulting in DNA breaks and telomere shortening (43, 44). In this way, ROS-induced telomere shortening may contribute to the suspension of DNA polymerases during the cell cycle and elicit a similar damage response as double-strand breaks (43). Regardless of the source of damage, replication of DNA is not always completely faithful. Without a mechanism in place to counteract these insults, any part of normal DNA replication or transcription may be blocked; mutagenesis may occur; and cells may succumb to cytotoxicity in the form of death, senescence, or malignant transformation. In accordance with this, defects in this process are extremely detrimental to the cell, resulting in mutations and chromosomal aberrations, which may contribute to malignant transformation (41).

4.3.1

Components of the Response and Signaling Pathways

In its most basic format, the DNA damage response pathway consists of three main components: sensors, transducers, and effectors (42). Upon sensing DNA damage, signal transduction of the damage signal to a variety of pathways occurs, including those involved in cell cycle checkpoints, DNA repair, apoptosis, and telomere maintenance (41). Two types of kinases, phosphoinositide-3-kinase-related kinases (PIKKs) and checkpoint kinases, act to mediate signal transduction (42). These serine-threonine kinases sense DNA damage or stalled replication forks and initiate a signaling cascade by phosphorylating factors in cell cycle control and DNA repair (45). PIKKs can be further categorized into ATM (ataxia telangiectasia mutated protein or Sc and Sp Tel1), ATR (ATM and Rad3-related protein or Sc Mec1 and Sp Rad3) (42, 46), and DNA-PK (involved in nonhomologous end joining DNA repair). ATM primarily responds to ionizing radiation, which produces doublestrand breaks that modify chromatin structure (Fig. 4.2) (47). Once these lesions are sensed, ATM is activated via phosphorylation at Ser1981, Ser367, and Ser1893, and initiates a damage signal (42, 48, 49). ATM then phosphorylates Chk2 proteins localized to the area around the lesion and p53, releasing it from MDM2 (48). The multifunctional MRN complex, consisting of Mre11, Rad50, and Nbs1, is also phosphorylated by ATM. However, this complex may also play an earlier role as a sensor since it binds damaged DNA via Rad50 independently of ATM (42, 49). In this scenario, MRN and ATM may associate via protein–protein interactions, followed by recruitment to sites of double-strand breaks (50). Also, cells deficient in MRN have reduced ATM autophosphorylation (51), since interaction between these two factors is thought to stimulate a conformational change that activates ATM. The second major player, ATR, mainly responds to ultraviolet light exposure, single-stranded DNA, and stalled replication forks (46). ATR is found to be stably

4 Telomere Dysfunction and the DNA Damage Response

95

Telomere Shortening Loss of Telomerebinding proteins Alteration of telomeric sequence

Ultraviolet light Irradiation Reactive Oxygen Species

Telomere Dysfunction

ATM

P

ATR

P

ATRIP RPA

P BRCA1

p53

P

P Chk2

MRN

P Chk1

P

p21

CyclinE/cdk2 CyclinE/cdk2 CyclinA/cdk2

CyclinB/cdc2

Cell Cycle Arrest

DNA Repair

Replicative Senescence

Apoptosis

Fig. 4.2 Telomere dysfunction activates the DNA damage response. A variety of DNA insults can attack chromosome ends, leading to telomere dysfunction. These damaged ends are then recognized as DNA damage and processed accordingly. Intact checkpoint mechanisms activate a cascade of responses mediated by DNA damage proteins. The culmination of these activities contributes to cell cycle arrest followed by resolution of the damage via DNA repair or other cellular fates, including senescence and apoptosis. Replicative senescence may have evolved as part of an antitumor protective mechanism, whereby bypassing this checkpoint may lead to neoplastic transformation. Apoptosis may have evolved as a mechanism of ensuring survival of only undamaged cells and thus maintaining genomic integrity (See Color Insert)

associated with ATR interacting protein (ATRIP), which interacts with replication protein A (RPA) with high affinity (42). This is supported by observations in which RPA and the ATR–ATRIP complex colocalize to nuclear foci upon DNA damage (52). Since RPA binds single-stranded DNA, the recruitment of ATR–ATRIP signifies that these regions of DNA are sensed as damaged sites. Before effectors are activated, mediators and adaptors of the DNA damage response act as signal amplifiers by promoting the interaction between transducing kinases and effector kinases, which are especially important when low levels of DNA damage are detected (42). In terms of the MRN–ATM complex, recruitment to double-strand breaks induces phosphorylation of histone H2AX, which serves as a docking site for the Mdc1 adapter protein. This in turn quickly modifies the DSB-flanking chromatin, facilitating H2AX phosphorylation (50).

96

M.C. Diehl et al.

The collective outcome of stimulation of sensors, signal transducers, and effectors is to assure an effective cellular response to DNA damage. Early acting components not only activate cell cycle checkpoints, such that DNA replication and transcription are obstructed, but also trigger DNA repair and induction of apoptotic mechanisms. Cells that arrest in the G1 phase respond to elevated levels of p53 by upregulating p21Waf1/Cip1, a cyclin-dependent kinase inhibitor that acts to suppress the kinase activity of cyclinE/cdk2 (53). A functional G1 checkpoint ensures that damaged DNA is not replicated, whereas S phase checkpoints generally monitor cell cycle progression. ATM-phosphorylated Chk2 acts upon Cdc25A phosphatase by targeting it for ubiquitin-mediated degradation. The normal Cdc25A substrates, cyclinE/cdk2 and cyclinA/cdk2, then remain inactive (54). Additionally, ATM also phosphorylates Nbs1, as well as the breast cancer susceptibility gene product, BRCA1, and SMC1. The combination of these events halts S phase progression such that DNA synthesis is delayed. Finally, damage in the G2 phase results in ATR-mediated activation of Chk1, which acts upon both Cdc25A and Cdc25C phosphatases. Phosphorylation of Cdc25C results in sequestration by the 14-3-3 protein, effectively preventing Cdc25C from activating cyclinB1/cdc2 (55). Once checkpoints have been successfully activated, cell cycle progression halts until mechanisms to relieve these obstructions are resolved. Functional checkpoints ensure cellular integrity by allowing time for the damaged DNA to be repaired. Assuming DNA repair is successful, cells may either undergo checkpoint recovery or undergo adaptation (50). In recovery, progression into the M phase is associated with inactivation of Chk1 via the ubiquitin/proteasome-mediated degradation of Claspin and Wee1, a mitosis inhibiting kinase (50), which is closely followed by accumulation of Cdc25A, subsequent activation of Cdc25C, and entry into mitosis. Recovery may be mediated by the removal or dephosphorylation of gH2AX, a phosphorylated histone tightly associated with DNA damage-induced foci (56). Adaptation, on the other hand, involves entering mitosis even in the presence of unaddressed checkpoints and unrepaired DNA damage (57). This mechanism is not completely understood and may entail elimination of damaged cells via mitotic catastrophe (58). Regardless of the final cellular outcome, it is evident that cell cycle checkpoints ensure that appropriate signals are elicited and transduced in response to DNA damage.

4.3.2

Mechanisms of DNA Repair

Cell cycle checkpoints in and of themselves are essential in detecting damage and initiating an appropriate response. Although this cellular defense mechanism is indispensable, repair programs must also be available and functional to correct these DNA lesions. Abnormal or loss of DNA repair results in the accumulation of mutations and chromosomal rearrangements and instability. The significance of such repair mechanisms is extremely relevant to normal cellular functioning since defects in these pathways are associated with malignancy or other human diseases characterized by DNA damage protein deficiencies. DNA repair in its broadest sense encompasses direct

4 Telomere Dysfunction and the DNA Damage Response

a

HR

b

5’ 3’ MRN

NHEJ

97

5’ 3’ MRN

DSB resection

RPA

RAD52

Ku70 / 8 0

RAD51 Single Strand Annealing

DSB resection

DNA PKcs

Artemis

Strand Invasion P 5’ 3’

5’ 3’ 3’ Tail digestion DNA Polymerase Ligation

RAD54, RAD51B / C /D

OH

PNK

XRCC2, BRCA1/2 LigaseIV, XRCC4

5’ 3’

5’ 3’ DNA pol

Ligase 5’ 3’ 5’ 3’

Fig. 4.3 Mechanisms of DNA repair implicated at the telomere. Telomere dysfunction is associated with the involvement of two major mechanisms of repair, homologous recombination (HR) and nonhomologous end joining (NHEJ). (a) Homologous recombination is error free and requires a homologous template. In the case of repetitive sequences, such as that found at telomeres, singlestrand annealing may occur in which these sequences on each strand anneal to each other. Alternatively, RAD51-mediated strand invasion may produce recombined products upon DNA synthesis, ligation, and resolution of junctions. Blue strand: strand containing DSB. Red strand: homologous template. (b) Nonhomologous end joining is usually error prone and does not necessarily involve ligation of homologous chromosomes. The annealing of nonhomologous chromosomes contributes to a cell’s mutagenic potential, as translocations are a frequent finding in cancer. Blue and red strands represent different chromosomes. See text for detailed explanation (See Color Insert)

reversal, nucleotide excision repair (NER), base excision repair (BER), mismatch repair (MMR), single-strand annealing (SSA), homologous recombination (HR), and nonhomologous end joining (NHEJ) (59, 60). For the purposes of this chapter, only the latter two mechanisms (HR and NHEJ) will be considered since they are integral components of a cell’s response to telomere dysfunction.

4.3.2.1

Homologous Recombination

Unlike yeast, both HR and NHEJ are equally important for double-strand break correction in mammals (Fig. 4.3) (61). These repair pathways are evolutionarily conserved, since homologues of the relevant genes can be found in various species

98

M.C. Diehl et al.

from yeast to humans (62). A complete understanding of HR requires a discussion of the role of each protein in the repair machinery. HR in mammals requires replication protein A (RPA), DNA polymerases, and the RAD52 gene family, which includes RAD50, RAD51, RAD52, RAD54, RAD54B, NBS, and MRE11 (60, 63). Additionally, a family of RAD51-related genes exists and can further be subdivided into XRCC2, XRCC3, RAD51B, RAD51C, and RAD51D genes (60, 63). As seen in cells with the DSB repair‐defective disease Nijmegen break syndrome, there is a complete lack of Rad50 foci, implying that loss of this protein is associated with a lack of cell cycle checkpoint activation and therefore has a direct role in DNA repair (64). Human Rad51 has pairing and strand exchange activities, which are stimulated by the addition of RPA and Rad52 (65). In studies with mice, a deficiency in Rad51 is associated with chromosome loss and radiation sensitivity, highlighting its importance in normal repair processing (66). Human Rad52 directly binds DSBs, protecting exposed ends and promoting reparative ligation (60). Similar to Rad51 deficiency, defects in Rad52 confer sensitivity to ionizing radiation and are linked to abnormal meiotic recombination (60). Furthermore, Rad54, XRCC2, and XRCC3 defects lead to reduced recombinatorial rates, supporting the involvement of these proteins in HR (67, 68). Interestingly, the association of the breast cancer susceptibility gene products BRCA1 and BRCA2 with Rad51 also facilitates HR (69, 70). BRCA1 defective cells likewise show reduced recombination, suggesting that a connection between altered recombination and tumorigenesis may exist (71). Based on the collective evidence presented here, it is clear that these proteins respond to DNA damage and are essential for mediating properly timed and legitimate repair and for preventing malignant transformation. The evolutionary conservation of key regulators of the DNA damage response underscores the significance of their roles in repair. Repair of DSBs via HR, as its name suggests, requires the presence of a homologous DNA template, which makes HR a very conservative, essentially error-free process (72). Briefly, the donor template sequence is copied into the region to be repaired, thus creating an exact copy of the undamaged sequence (Fig. 4.3). The initial step is to process DSBs by a 50 to 30 exonuclease, possibly mediated by the MRN complex, such that single-stranded 30 overhangs are produced at each break (73). Following this preparatory phase, RAD52 and RPA then coat the 30 single-stranded region (74, 75). At this point, two different scenarios of DSB correction can ensue. For repetitive sequences, such as those found at the telomere, single-strand annealing is a frequent occurrence in which the overhang regions are displaced as repeat tracts from each strand anneal (76). Alternatively, strand invasion ensues in which RPA is displaced by RAD51, and single-stranded regions are subsequently coated with RAD51 to form a nucleoprotein complex (77). RAD51-mediated initiation of homology search, strand pairing, and strand exchange may be aided by RAD51B, RAD51C, RAD51D, XRCC2, and BRCA2 (65, 78, 79). In addition to these proteins, RAD54 also helps in strand invasion (80). The ends are then elongated by DNA polymerase until sufficiently long to base pair with the remaining end and joined by ligases to produce a fully repaired double strand with no or minimal errors (72).

4 Telomere Dysfunction and the DNA Damage Response

4.3.2.2

99

Nonhomologous End Joining

In contrast to HR, NHEJ does not utilize a homologous template, occurs quickly, and produces deletions, and thus is normally error prone (Fig. 4.3) (72). Like its role in HR, the MRN complex may be involved initially to prepare or clean up DSBs for further processing (59, 81). The ends of the double-strand break are recognized and bound by a heterodimer of Ku70 and Ku80, which has high affinity for exposed ends and aligns the broken DNA (60). Binding of this heterodimer in the form of a ring around the damaged DNA provides structural support during repair (82). DNAdependent protein kinase catalytic subunit (DNA-PKcs), which may act as a sensor, is then recruited to this heterodimer and establishes a synapse within the double-strand break to facilitate rejoining of the two DNA ends (83). DNA-PKcs phosphorylates DNA-binding proteins that modulate cellular responses to damage (60). The interaction of Artemis, which has endonuclease activity, with DNA-PKcs allows inaccessible structures like hairpins to be opened and further processes the ends (84). Nucleases remove, insert, or substitute a few bases at the double-strand break to make the region more amenable for ligation by the complex of ligase IV and its associated protein XRCC4 (60, 61, 85). In order for efficient ligation to occur, 30 OH and 50 -phosphate entities are added to aligned ends by polynucleotide kinase (PNK) (86). Although NHEJ usually rejoins segments of the same chromosome, ligation of broken ends from different chromosomes is also possible. This results in translocation and when combined with the alteration of bases, contributes to the cell’s mutagenic potential (61) since it could lead to activation of oncogenes or loss of tumor suppressor genes (60). The selective utilization of either mechanism may be related to when in the cell cycle the damage occurs. For instance, HR may be favored in late S and G2 phases when sister chromatids are in close proximity, while NHEJ is more prominent during the G1 phase when homologous chromosomes are farther apart (87). Thus, although HR and NHEJ operate through distinct mechanisms and differ temporally, they have an overlapping role in repair of DSBs and share a common goal. 4.3.2.3

Perspective

The ability to distinguish damaged DNA from natural ends and to faithfully replicate the entire genome is an extraordinary task. The DNA damage surveillance and repair responses are essential for detecting errors and combating insults to the genome to maintain fidelity. The coordinated actions of damage sensors, checkpoint systems, and repair mechanisms are closely intertwined as indicated by a number of common mediators, some of which exhibit interdependence. It is apparent that regulation of DNA damage and modulation of a response is a highly orchestrated process that has serious repercussions on cellular survival when defects in any of the mediators are present. Future studies on both established and novel factors in sensing, transducing, and effecting responses will only contribute to furthering the global understanding of their functions and interactions.

100

M.C. Diehl et al.

4.4

Linking DNA Damage Response and Telomere Dysfunction

4.4.1

DNA Damage and Telomere-Binding Proteins: A Role in Telomere Maintenance

Based on the previous discussion of mediators of the DNA damage and repair response, it is evident that a multitude of proteins with various functions acting at different stages are required. Not only do these proteins localize to double-strand breaks, but some are also found either directly bound to or indirectly associated with the telomere. Such telomere-based DNA repair proteins include ATM, DNA-PKcs, RAD51, Ku70, Ku86, and the RAD50-MRE11-NBS1 complex (2). Furthermore, DNA processing enzymes that interact at the telomere include WRN, BLM, ERCC1-XPF1, and Apollo (2). Interestingly, the normal localization of these DNA damage and repair proteins does not trigger a DNA damage response or cell cycle arrest (6). The fact that these DNA damage response proteins and telomerebinding proteins reside at chromosome ends and their involvement in both telomere maintenance and the damage response suggests interdependency for ensuring genomic integrity (88, 89). Loss of any telomere binding or telomere-localized proteins could lead to compromised structure, function, and protective failure. Given that most of these proteins participate in repair mechanisms, the convergence of the coexistence of the DNA damage response and telomere homeostasis has been a subject of great interest. As a dynamic structure, unfolding of the T-loop is required for passing of the replication fork. At this point, the telomere may share similarities with a doublestrand break since it is in an unprotected state due to exposure of chromosome ends (2). Loss of the protective capping function leads to a variety of DNA attacks, including nucleolytic or enzymatic degradation, oxidative metabolism, and interaction with other chromosomal segments (88). In 1996, two separate groups observed that cells of patients with ataxia telangiectasia (AT), in which the ATM gene is mutated, as well as yeast cells with a disrupted open reading frame in Ku80, displayed a telomere dysfunction phenotype, including accelerated telomere shortening and increased frequency of end fusions (90, 91). Since then, major headway has been made in further elucidating the role of DNA damage and repair mediators in telomere biology, but this task is far from complete. Nevertheless, a global picture is emerging that intrinsically implicates repair mechanisms as contributors of telomere maintenance. Since telomere homeostasis is such an integral part of normal cell functioning, mechanisms that maintain appropriate length are indispensable. As previously discussed, telomere dysfunction may be brought about by disruption of telomerebinding proteins, alteration of telomere sequence, or telomere erosion. One method to counteract this dysfunction is via the reactivation of telomerase. However, telomerase is tightly regulated, expressed during development and in stem and germ cells but repressed in most normal somatic cells. Also, telomerase simply

4 Telomere Dysfunction and the DNA Damage Response

101

elongates chromosome ends without dictating or maintaining a certain telomere length (34). Survival and proliferation in the absence of telomerase suggests that there must be telomerase-independent mechanisms that act to maintain telomere integrity (92). Since the two main mechanisms of DNA repair in mammalian cells are NHEJ and HR, it is not surprising that there is a functional linkage between telomere integrity and this subclass of DNA damage response proteins. Specifically, DNAPKcs plays an important role in NHEJ but is also essential for proper telomere capping (93). Severe combined immunodeficiency (SCID) mice that have mutant DNA-PKcs exhibit end-to-end chromosome fusions and elongated telomeres (94). Likewise, the NHEJ-acting Ku70/Ku80 heterodimer affects telomere capping via its interaction with TRF1 and/or TRF2 (95, 96). Although telomere shortening has been reported in Ku86-deficient mouse models and human cell lines (97, 98), telomere elongation has been seen in Arabidopsis plants and mouse models with deletion of both telomerase and Ku70 or Ku86, respectively, suggesting that Ku acts as a negative regulator of telomere length by preventing access of telomerase to the telomeres (99, 100). Despite these differences, it is apparent that this protein plays a role in modulating telomere capping and length deregulation. Furthermore, Ku70 is believed to interact with heterochromatin protein 1a (HP1a), which is associated with heterochromatin as well as telomeres (101). This may implicate Ku70 in modulating a telomere position effect in subtelomeric regions. Besides DNA-PKcs and Ku, other NHEJ proteins such as ligase IV are associated with telomere maintenance but to a lesser degree. Ligase IV deficiency produces telomeric fusions, since it is involved in joining double-strand breaks, without signs of telomere length abnormalities (97). Also, overexpression of TRF2 and its direct interaction with ATM has been shown to effectively inactivate this kinase and abrogate an ATM-dependent damage response (102). Finally, the MRN complex, which participates in both NHEJ and HR, associates with TRF2 such that loss of this complex results in accelerated telomere shortening, as seen in patients with Nijmegen break syndrome (103). This suggests that MRN is not simply a mediator of the DNA damage response, but is also involved in maintaining a protected state at the telomere along with TRF2. Although HR is another main form of double-strand break repair in response to replication fork stalling or DNA damaging agents, it may also be an alternative mechanism of mammalian telomere maintenance (92, 104). In terms of protein expression, the colocalization of the HR protein RAD51 and TRF2 to the telomere can be visualized via immunofluorescence, where it is believed to play a role in preventing telomere dysfunction (105). A deficiency in RAD51, as well as another HR protein RAD54, in mice is associated with radiation sensitivity and poor double-strand break repair, as well as telomere shortening and increased frequency of end-to-end chromosome fusions (92, 106). In the context of HR, telomere elongation would proceed following one of the two scenarios. In the first mechanism, intertelomere HR, the 30 single-stranded end of one telomere pairs with and invades the duplex region of another telomere aided by RAD51, RAD52, and RPA. This action produces a D-loop-like structure that is stabilized by RAD54

102

M.C. Diehl et al.

and undergoes branch migration and subsequent replication by DNA polymerase (92, 107). Alternatively in the second mechanism, intratelomere HR involves invasion of the 30 overhang end into the duplex region of the same telomere, forming a T-loop structure (92). Both methods use the same proteins and polymerase to catalyze invasion and elongate telomeres, respectively, but intratelomere HR may also provide a capping function through the formation of the T-loop. Evidence in support of HR in elongation and protection of telomeres is provided by the existence of an alternative lengthening of telomeres (ALT) pathway in immortalized human cell lines, approximately 10% of human tumors, and telomerase-null mouse cell lines (108–110). ALT cells display telomere dynamics in which telomeres with various critically short lengths are targeted and elongated to various lengths, which is suggestive of a more intertelomeric recombination method in mammalian cells (111). Recombinatorial proteins characteristically found in cells with undetectable telomerase activity, but exhibiting ALT activity, include RAD51, RAD52, MRN, RPA, WRN, and BLM (111). Additionally, poly (ADP-ribose) polymerase (PARP), which binds single- and double-stranded breaks and interacts with p53 to modulate BER, may also be involved in ALT since loss of PARP induces an ALT-like telomere phenotype (112). Moreover, PARP binds with high affinity to TRF2, making the telomere connection to DNA repair even more sound (10). PARP-deficient cells display increased numbers of chromosomes with undetectable telomeric signal, thus implicating this protein in telomere maintenance (113). The presence of these proteins at the telomere suggests that the ALT pathway is another form of telomere dysfunction. Although ALT is more of a secondary pathway of telomere maintenance, it nevertheless needs to be considered as a potential alternative DNA damage response. In addition to proteins involved in NHEJ and HR, other repair proteins are implicated in telomere function. ATM-defective cells exhibit telomere dysfunction in the form of extrachromosomal telomeric fragments and accelerated telomere shortening (114). TRF2 also interacts with the ERCC1-XPF endonuclease, which processes the 30 overhang during nucleotide excision repair and recombination (115). Mutations in XPF are associated with UV sensitivity and ERCC1-XPF deficient cells show increased levels of telomeric DNA-containing double-minute chromosomes (TDMs), a relatively new marker for telomere dysfunction (116). Additionally, TRF2 interacts with the Apollo 50 -to-30 exonuclease that aids in telomere protection (117). Although the list of relevant proteins discussed herein is not exhaustive, it nevertheless provides indisputable data on the linkage between telomere biology and the DNA damage response.

4.4.2

Resolution of the Paradox

Telomere-binding proteins and DNA damage proteins both reside at telomeric DNA, but the exact purpose of this coexistence is unclear. It is possible that mechanisms of repair act in two different capacities: first, to repair DSBs at internal

4 Telomere Dysfunction and the DNA Damage Response

103

chromosome sites, and second, to repair at telomeres. However, it seems more likely that repair mechanisms, its associated proteins, and telomere-binding proteins act cooperatively to establish a balance in chromosomal integrity. This could involve a competition between repair proteins and, for example, telomerase action at the telomere (89, 118). In this manner, telomerase elongates telomeres as a way to ‘‘heal’’ shortened or ‘‘broken’’ DNA ends. Unregulated telomerase activity could lead to karyotypic instability, since it may respond to internal DSBs as shortened telomeres. At this point, repair proteins are signaled to restrict telomerase action to chromosome ends (89). In support of DNA damage and telomere maintenance linkage, TRF2 has been shown to translocate to sites of double-strand breaks and act in a telomereindependent fashion (14). This finding suggests that TRF2, as perhaps other telomere-binding proteins may by a part of a global cellular response to damage. Additionally, unlike mammalian cells, Drosophila telomeres are not maintained by telomerase and do not contain structures such as T-loops. Rather, Drosophila utilizes DNA damage proteins in order to maintain telomeres, many of which have orthologs in mammalian systems, such as Ku, ATM, and the MRN complex (119). Finally, mice with defective TERT present with dysfunctional telomeres, are sensitive to ionizing radiation, and repair double-strand breaks with slower kinetics (120). In a similar fashion, telomere dysfunction in cells of cancer patients may predispose these individuals to sensitivity to DNA damaging agents (121). Although the primary function of telomeres is to provide protection for chromosome ends, it has been suggested that telomeres may actually act as sentinels for monitoring damaged DNA and mediating repair (122). It may be possible that telomeres endure the majority of induced damage so that the remainder of the genome maintains fidelity. Taken together, a relationship between telomere maintenance and the DNA damage and repair response emerges that serves dual purposes. In one capacity, this relationship ensures the formation of a functional telomere structure, which is dependent on the presence of elements of the DNA repair machinery. In this manner, damage-associated proteins are required for telomere protection and legitimate replication. In a second capacity, this interrelationship reflects a surveillance system in which dysfunctional telomeres are recognized by the DNA damage response and subsequently processed in the same manner as double-strand breaks (123). Collectively, these observations support an integrative model of telomere function and DNA repair in which telomere maintenance is intimately connected with components of the DNA checkpoint and damage machinery to ensure genomic integrity (124).

4.4.3

Cellular Fates

Aside from deficient telomere-binding or associated proteins, normal cell cycling can also lead to telomere erosion and subsequent instigation of a damage response. The cooperation of telomere structure and function and the DNA damage response have significant implications for growth arrest, senescence, and apoptosis. Progressive

104

M.C. Diehl et al.

telomere shortening destabilizes the T-loop structure and predisposes the chromosome to deleterious uncapping events and dysfunction (125). Although other forms of senescence exist, loss of protection from telomeres can lead to replicative senescence in which cell growth is irreversibly arrested, after a certain amount of population doublings, i.e., once the cell has reached the Hayflick limit (126–129). This supports the thought that cellular senescence may have evolved as part of an antitumor protective mechanism, and that bypassing this checkpoint leads to neoplastic transformation (130). In addition to telomere-dependent growth arrest, stress-induced senescence is triggered by DNA damaging agents, such as irradiation, chemicals, and oxidative stress, all generating double-strand breaks, some of which occur at the telomere (131–133). In this way, DNA damage responders can sense aberrations in telomeres and halt proliferation to avoid the accumulation of detrimental mutations (134). Activation of the DNA damage response via either growth arrest-inducing mechanism triggers a cascade of signals mediated by ATM, ATR, and DNAPKcs (as discussed above). These kinases also phosphorylate histone gH2AX on Ser139 at the site of DNA damage, followed by the recruitment of 53BP1, the damage checkpoint protein MDC1/NFBD1, and NBS1 to the locus of damage (129). Collectively, these molecules assemble into DNA damage-induced foci that initiate senescence (129). In support of this, the fibroblastic cell strains MRC5 and BJ display increased staining of gH2AX and 53BP1 as cells enter a senescent state, while those same cells immortalized by hTERT show relatively low signal intensity (135). In addition to these two markers of DNA damage, MDC1 and NBS1 are also detectable and phosphorylation of p53, Chk1, and Chk2 were observed (135). ATM-activated p53 acts to induce cell cycle arrest in response to senescence‐associated DNA damage foci. The level of p21, a cyclin-dependent kinase inhibitor, also increases upon senescence and may contribute to cell cycle arrest (Fig. 4.2) (129). Given that DNA damage foci accumulate at double-strand breaks, it is necessary to address whether these foci also localize to dysfunctional telomeres. The creation of a fibrosarcoma cells using the dominant negative TRF2DBDM allele produces uncapped telomeres that induce growth arrest (136). Telomeric DNA, as well as TRF1, was bound to gH2AX, 53BP1, and NBS1, suggesting that unprotected telomeres may activate a DNA damage response without actual chromosomal breakage (135, 137). However, DNA damage-induced foci, as measured by gH2AX, did not colocalize with TRF2 (138), which is in agreement with a model in which loss of TRF2 produces uncapped telomeres and the subsequent formation of damage-induced foci at chromosome ends (139). While illegitimate telomere exposure is necessary for assembly of these foci, the mechanism by which short telomeres induce foci formation is less clear. It is possible that telomeric overhangs are first processed into blunt ends before DNA damage/senescence signaling occurs. Alternatively, telomeric overhang processing could be a consequence of the DNA damage/senescence response (129, 140). Whichever the case, these data nevertheless indicate that production of DNA damage-induced foci at uncapped or dysfunctional telomeres trigger the replicative senescence response.

4 Telomere Dysfunction and the DNA Damage Response

105

As an alternative to senescence, short unprotected telomeres may also trigger apoptosis, depending on signaling by the p53-induced DNA damage cascade (2, 123). p53-dependent apoptosis is mediated by cell cycle checkpoints and the transcriptional activation of DNA repair factors and proapoptotic proteins, such as Apaf1 and Bcl-2 (141). On the other hand, p53-independent mechanisms of apoptosis also exist. The transcription of the p53 family member, p73, is stimulated by the transcription factor, E2F1, which is implicated in inducing cell death in the absence of p53 (142). In support of the role of p73 in apoptosis, high levels of this protein are found in cells with inactivated pRb (or unrepressed E2F1) and undergoing malignant transformation (143). Furthermore, reactivation of telomerase or inactivation of p53 and pRb (or aberrant expression of p16) allows continued proliferation by bypassing senescence (6, 144). In this scenario, cells continue to divide beyond their normal replicative capacity, producing telomeres that completely lack protective DNA. At this point, the cell enters a crisis stage marked by severe chromosomal instability and cell death (123, 134). Cells that achieve immortalization, most likely via reactivation of telomerase, also display properties of transformation, regardless of whether telomerase is activated (145). The decision to follow the apoptotic route has most likely evolved as a way to preserve genomic integrity via selective killing of damaged cells (141). In summary, cellular responses to DNA damage are triggered by various signals, but ultimately contribute to cell cycle arrest, repair, and replicative senescence or apoptosis (Fig. 4.2).

4.5

Clinical Implications

From model organisms to humans, defects in the DNA damage/repair response and telomere maintenance are associated with significant clinical defects (40). In addition to normal aging, genome instability and premature aging syndromes, neurodegenerative diseases, and especially cancer all share defects in components of the DNA damage response (Table 4.1). These disorders also exhibit a significant relationship to telomere function since dysfunctional telomeres are not an uncommon finding. Although the culpable genes or proteins have been identified in these diseases, more research is necessary to translate these findings to a clinical therapeutic setting. Table 4.1 Summary of human syndromes with direct or indirect telomere involvement Disease Defect Cellular outcome Reference AT ATM IR sensitivity, chr. fusions (40, 146, 147) ATLD Mre11 Defective MRN complex (148, 149) NBS NBS1 Defective MRN complex (40, 150) BS BLM Hyper recombination as SCEs (151, 152) WS WRN Illegitimate recombination (153–155) HGPS HA(?) Defective DNA repair (156, 157) DC Dyskerin Deficient telomerase activity (158, 159) hTR (160) AD b-amyloid Decreased mental capacity (161, 162)

106

4.5.1

M.C. Diehl et al.

Aging

Life expectancy has increased remarkably in developed nations, but still remains a serious concern, and as such, continues to be an area of intense interest (163). Although damage to DNA has long been attributed to the aging process, recently more emphasis is being placed on telomere shortening as an adjunct component (164, 165). As such, telomere length may be used as a marker of aging and to assess the accumulation of age-related DNA damage (166). For instance, UV exposure induces DNA repair at damaged telomeres, the rate and the efficiency of which declines with age (165). Furthermore, since telomerase maintains telomeres in immortal and cancer cells, its absence in normal cells has been related to cellular aging (167, 168). The role of telomerase in maintaining proliferative capacity is evident in somatic cells transfected with telomerase, since these cells remain youthful and proliferate indefinitely without undergoing malignant transformation (167, 169–171). These data highlight the presence of a strong relationship between aging, telomeres, and telomerase (164). Even with the identification of telomerase as a promising regulator of cellular aging, defining the molecular mechanisms underlying the aging process is still in its infancy and likely involves both genetic and environmental factors.

4.5.2

Genome Instability and Premature Aging Syndromes

In addition to the normal aging process, premature aging and genomic instability syndromes also involve deficient DNA damage repair with disruption of telomere length or function. These rare syndromes, as its name suggests, are characterized by the onset of age-associated symptoms much earlier than in the nonaffected individual (172). Additionally, other age-related diseases, such as cancer, diabetes, and cardiovascular disease, are found in these patients. Although there is a multitude of genome instability syndromes with defects in DNA repair, only those with specific implications for telomere-binding or associated proteins will be discussed. Specifically, Ataxia Telangiectasia (AT), Ataxia Telangiectasia-like disorder (ATLD), Nijmegen break syndrome (NBS), Bloom syndrome (BS), Werner syndrome (WS), and Hutchinson–Guilford progeria syndrome (HGPS) all present with alterations in the aging process and are associated either directly or indirectly with telomere biology (40, 164).

4.5.2.1

Ataxia Telangiectasia and Ataxia Telangiectasia-Like Disorder

Patients with AT and ATLD display premature aging, short stature, neuronal degeneration in the form of upper and lower limb ataxia, and extreme sensitivity to ionizing radiation (146, 173). Although ATLD individuals share clinical features that are indistinguishable from AT, ATLD is considered a milder subset of AT, with

4 Telomere Dysfunction and the DNA Damage Response

107

symptoms appearing later and disease progressing slower (174). Genomic instability is prevalent on the molecular level as chromosomal translocations, mostly involving breakpoints in the T cell receptor and immunoglobulin genes (only in AT cases), and compromised cell cycle checkpoints (40, 175, 176). Since sensitivity to IR is a major feature observed in AT patients, it was found that the IR-responsive gene, ATM, is defective in AT cells. Without ATM, p53 cannot be appropriately regulated and HR is disrupted due to ineffective recruitment of RAD51 and RAD52 to sites of repair (147, 177). AT cells show lack of telomere maintenance in the form of high levels of ROS and end-to-end fusions, mostly arising from translocation events and likely contributing to the development of lymphomas and leukemias (40, 91, 173, 176). These phenomena are all linked to telomere-associated proteins, suggesting that ATM may provide protection at telomeres by preventing accelerated telomere shortening (91). In contrast to AT, ATLD arises due to a mutated Mre11 gene, in which the Mre11 protein transcript is degraded (148, 178). It is noteworthy that the levels of Nbs1 and Rad50 proteins are also reduced in ATLD cells, indicating that MRN complex assembly is affected by Mre11 deficiency (149). The localization of this complex to sites of DNA damage is important for repair since ATLD cells fail to form irradiation-induced foci (174, 179). Unlike in AT, it is not clear whether there is a predisposition to cancer in ATLD, since so few patients have been identified (174). Nevertheless, Mre11 is indispensable in the formation of a properly functioning MRN complex that elicits cellular responses to DNA damage.

4.5.2.2

Nijmegen Break Syndrome

On a cellular level, NBS shares similarities with AT and ATLD since NBS is also associated with a high frequency of translocations and characteristic impairment of response to double-strand breaks (173). A deficiency of the NBS1 gene product, nibrin, results in a failure to assemble IR-induced complex with Mre11 and Rad50 (40, 150, 180). This deficiency may affect telomere maintenance since fibroblasts from NBS individuals show accelerated telomere shortening that cannot be rescued by the introduction of telomerase (150). Furthermore, NBS1 colocalizes with TRF2 and promyelocytic leukemia (PML) bodies, which are found in telomerase-negative ALT cells (139, 181). NBS1 deficiency also results in an increase in telomere associations, in which telomeres of the same or different chromosomes are found in close proximity in metaphase spreads (182). Collectively, these data suggest a role for NBS1 in modulating telomere length to maintain chromosomal stability.

4.5.2.3

Bloom and Werner Syndromes

Both Bloom and Werner syndromes are well characterized disorders of genomic instability and premature aging, characterized by growth retardation without mental

108

M.C. Diehl et al.

retardation, diabetes, and a predisposition to cancer (sarcomas in the case of WS) (183, 184). WS patients also display other age-related clinical indicators, including premature cataract, skin wrinkling, osteoporosis, and atherosclerotic heart disease, which appear in adolescence, thus decreasing maximum lifespan to less than 50 years (153, 164, 185–187). BS patients typically exhibit sensitivity to chemical agents and UV sunlight manifesting as pigmentation changes in the skin and immunodeficiency (188, 189). Both BLM and WRN have sequence similarity to the highly conserved RecQ family of ATP-dependent DNA helicases (151, 153, 154, 190). These helicases preferentially unwind G-quadruplex DNA that forms in G-rich regions like telomeric DNA (191, 192). As such, BLM and WRN bind to and colocalize with TRF2, supporting the finding that BLM is found in the nucleus as both discrete foci and in diffuse distribution, and that WRN cells show defective repair at telomeres (165, 193, 194). Although BLM is found localized to telomeric sequences, it has not been shown to actively affect telomere length (194). In contrast, WS cells also show accelerated telomere shortening with reduced doubling times and fewer cell divisions, leading to a shortened lifespan (195–197). Since telomerase is able to rescue this shortening (without fully correcting chromosomal instability), WRN could act in a protective manner by mediating the onset of senescence triggered by exposed ends, or by mediating telomerase access (40, 153, 198). While BLM and WRN additionally interact with RPA to stimulate its activity, they also associate with RAD51 and Ku70/80, respectively (10, 199–201). As such, BS cells display hyper‐recombination between homologous chromosomes and telomere associations, while WS cells show inefficient recombinatorial repair of DNA crosslinks (152, 153, 188, 190, 202–205). These aberrations lead to chromosomal instability, such as translocations and rearrangements (155). Taken together, it is evident that BLM and WRN have multifunctional roles in mediating recombination and maintaining chromosomal integrity (203).

4.5.2.4

Hutchinson–Guilford Progeria Syndrome

Premature aging is not evident outright in HGPS syndrome, but develops by the first 2 years of life (164, 206). Although the exact pathophysiology is unknown, it is thought that excessive hyaluronic acid (HA) excretion from the bladder or defective DNA repair may contribute to the disorder (156, 157, 207, 208). On a cellular level, accumulation of senescent cells has been proposed in the acceleration of the aging process in these individuals (209). As such, telomere length maintenance and telomerase activity have been implicated as regulatory factors in the pathogenesis of HGPS. In support of this, fibroblasts derived from HGPS patients are shorter than those from age-matched controls (210). Despite the uncertainty in the causative mechanisms of premature aging in HGPS, telomere maintenance is nevertheless a relevant component of cellular lifespan and must be considered in the pathogenesis of this disease.

4 Telomere Dysfunction and the DNA Damage Response

4.5.3

109

Dyskeratosis Congenita

Although Dyskeratosis Congenita (DC) may share features with premature aging syndromes, it is mainly a disorder of telomere maintenance (211). Since this disease affects highly regenerative cells, it is characterized by skin lesions and bone marrow failure (158, 212). Three forms of the disease exist: X-linked, autosomal dominant, and autosomal recessive, with the autosomal dominant form being surprisingly less severe (158). The culpable gene, DKC1, of the X-linked form encodes for dyskerin, a highly conserved nucleolar protein that is involved in rRNA synthesis, ribosomal subunit assembly, and centromere or microtubule binding (158, 159, 213). Dyskerin has been shown to be a component of the telomerase complex (214). In support of this role, DC fibroblasts display reduced telomerase RNA and activity with a concordant decrease in telomere lengths (215). The autosomal dominant form of DC most likely involves a defect in the hTR gene, which causes improper secondary structure formation of hTR (160, 216, 217). The observation that both forms of DC are caused by defects in telomerase strongly indicates that defective telomere maintenance is the underlying basis (158). Although the culpable gene has not yet been identified in the autosomal recessive form of DC, evidence based on the other two forms suggests that it likely is also involved in telomerase assembly or activity (158). Taken together, the existence of a disease of dysfunctional telomerase highlights the significance of telomere biology in cellular homeostasis.

4.5.4

Cancer

Cancer in its vast array of forms is predominantly a disease linked with advancing age (4). Over time, the effect of accumulation of DNA damage produces extremely complex cytogenetic profiles, with especially high frequencies of translocations (4). Continual chromosomal and genomic instability are amenable environments for increased mutagenesis in oncogenes and tumor suppressor genes, allowing tumorigenesis to proceed unhindered (17, 40). Since telomerase is elevated in the majority of cancers, including breast, colorectal, and nonsmall cell lung cancer, its activity is a good indicator of overall survival, and may be used as confirmation of malignancy (218–221). Defects in DNA damage response components, such as p53, ATM/ATR, and BRCA1/2, contribute to cell cycle checkpoint malfunction and continued proliferation in the context of unrepaired DNA (53). For example, deficiencies in HR and NHEJ are associated with an increase in chromosomal aberrations, instability, and a predisposition to malignant transformation (68, 222–224). Also, ATM- and p53mediated formation of DNA damage foci appear at shortened or dysfunctional telomeres, targeting them for DNA repair (13, 137).

110

M.C. Diehl et al.

Furthermore, highly complex abnormal karyotypes tend to be associated with shorter telomeres (225). Based on this observation, it is important to address whether telomere shortening and subsequent dysfunction directly cause instability, rather than being simply the result of excessive proliferation. Evidence in support of the former role shows that in pancreatic tumor cells, telomere attrition is the earliest detectable change (226). However, this does not exclude the possibility of a high proliferative rate as the source of shortened telomeres. Furthermore, cells that escape senescence continue to shorten their telomeres resulting in massive chromosomal instability, especially the appearance of chromosomal fusions (227). Aberrant resolution of these fusions can lead to deletion of tumor suppressor genes or amplification of oncogenes, all contributing to malignancy (4). For instance, p53 null mice that lack checkpoint control and thus enter senescence have dysfunctional telomeres and are more likely to possess an unstable genome (228). Although the exact mechanisms of tumorigenesis are variable and require further clarification, dysfunctional telomeres are nevertheless key players in contributing to genomic instability (229).

4.5.5

Neurodegenerative Diseases

Although the role of telomeres in cancer and aging has been intensively studied, telomere function in postmitotic neuronal cells is less clear. Nondividing neurons only constitute 10% of brain cells, but a disruption in telomere homeostasis has significant pathologic consequences, including mental retardation, developmental delay, and neurological disorders such as Alzheimer’s disease (AD) and dementia (161, 230–233). Similar to adult somatic cells, differentiated neurons do not normally express telomerase activity. However, upon oxidative or hypoxic stress, or excess neurotransmitter receptor stimulation, telomerase is reactivated in neurons (234, 235). Specifically, lymphocytes of AD patients have telomere shortening and aberrant telomerase activity, such that hTERT may impart some protection from amyloid b-peptide accumulation and DNA damaging agents (162, 236). These observations suggest that telomerase may be a mediator of DNA repair, ensuring cell survival upon cytotoxic stress (237). Furthermore, mutations in the RNA template component hTR leads to telomere dysfunction and is associated with reduced proliferation in adult neural stem cells (238). In addition to an association with telomerase, overexpression of a dominant negative form of TRF2 results in activation of ATM and gH2AX in both mitotic astrocytes and postmitotic neurons, but only mitotic cells undergo senescence upon p53 stabilization (239). Developing neuronal cells may recruit TRF2 to sites of damage to aid in repair and to relieve any telomere position effect on telomere-proximal genes involved in neurogenesis (240). Collectively, these findings indicate a role for telomere maintenance in neuronal survival.

4 Telomere Dysfunction and the DNA Damage Response

4.6 4.6.1

111

Therapeutic Possibilities Telomerase and Telomere-Based Therapies

Most studies on the development of drug targeting and therapeutics for disease involving telomerase inhibition is most often with special emphasis on implications for cancer treatment. Telomerase inhibition should be effective and specific, while normal cells lacking telomerase should not be significantly affected by anti-telomerase therapy. Since telomerase expression in cancer cells can be used as a novel marker for screening, early detection, and prognosis, clinical trials are already underway to assess this potential (241, 242). Inhibition of telomerase may either be direct by targeting the essential components required for assembly or activity, or be indirect via targeting of its telomeric DNA substrate (Table 4.2). Targeting of the RNA template and nontemplate regions would restrict hTERT accessibility and prevent telomerase assembly, inducing telomere shortening and limiting proliferation (245, 253). Most strategies rely on antisense oligonucleotides, hammerhead ribozymes, or small molecule inhibitors to modulate telomerase expression or activity (254). Modifications in the sugar phosphosdiester backbone of short DNA/RNA antisense molecules aimed at hTR allow these agents to have high penetration, binding affinity and specificity, and resistance to nuclease degradation (254). Such molecules include peptide nucleic acids (PNA); DNA oligomers with phosphorothiate (PS-DNA) and phosphoramidite (PN-DNA) linkages; RNA oligomers with methyl-substituted (2-OMe RNA) and methoxyethyl-substituted (2-MOE RNA) ribose rings; and variations thereof (253, 255–258). For instance, GRN163L is a lipidated PN-DNA oligonucleotide that is complementary to hTR (243, 244). The potency of this inhibitor has been demonstrated in rodent xenograph models of lung cancer, hepatoma, and glioblastoma, in which administration of GRN163L inhibited tumor progression and shortened telomeres (243, 259, 260). The efficacy of GRN163L in preclinical studies has prompted phase I/II clinical trials for chronic lymphocytic leukemia (4).

Table 4.2 Telomere and telomerase targeting compounds Target Compound Direct hTR GRN163L hTERT AZT TDG-TP BIBR1532 Indirect G-quadruplex 9-anilino proflavine triazine fluoroquinophenoxazine telomestatin pentacyclic acridines

Reference (243, 244) (245) (246) (247) (248) (249) (250) (251) (252)

112

M.C. Diehl et al.

Although hTR-directed ribozymes have been shown to reduce telomerase activity, the effect is more pronounced when targeted against hTERT. Nucleoside analogs inhibiting reverse transcriptase activity, such as 30 -azido-30 -deoxythymidine (AZT) and 6-thio-20 -deoxyguanosine 50 -triphosphate (TDG-TP), significantly reduce telomerase activity but only transiently affect telomere length (245, 246). On the other hand, 2-((E)-3-naphtalen-2-yl-but-2-enolyamino)-benzoic acid (BIBR1532) leads to telomere shortening and senescence in cancer cells (247). A main consideration of telomerase-directed therapy is the persistence of telomerase in stem cell-like normal cells. Inhibition of telomerase in these cells may elicit adverse physiological effects upon long-term treatment. Despite these drawbacks, there is great potential in their utilization and further investigation is warranted. Indirect targeting of telomerase via disruption of telomere structure takes advantage of the presence of repetitive sequences and secondary structure found in the T-loop (261). Disruption in telomere maintenance can also be achieved by targeting tankyrase. As a positive regulator of telomere length, tankyrase catalyzes the inhibition of TRF1 binding to or the dissociation of TRF1 from telomeres, thus disassembling the T-loop and allowing an opportunity for elongation (15, 261). In addition to T-loop disruption, the formation of G-quadruplexes sequesters telomeric DNA ends into intramolecular structures of G-tetrads and shields it from telomerase activity (262). The presence of G-quadruplex interacting compounds, such as 9-anilino proflavine, triazine, fluoroquinophenoxazine, telomestatin, and pentacyclic acridines, interferes with telomere structure to effectively inhibit telomerase access, causing telomere shortening and senescence (248–252). Regardless of the mechanism of action of these agents or specific targets, they all negatively affect telomere integrity. It is important to note that telomerase inhibition is not immediately effective since significant telomere shortening only occurs after many cell divisions. In the meantime, the cancer could considerably heighten in clinical complications. Also, telomerase-positive cells, such as germ and other proliferative cells, may be adversely affected by telomerase inhibition (263). However, these cells naturally have longer telomeres and are often in a quiescent state, so the effect will not be immediate as renewal of stem cells occurs transiently (242). Another consideration is the activation of alternative methods of telomere elongation, such as the ALT pathway. Thus, telomerase- and telomere-based therapies will likely be most useful when used as adjuvant therapy in conjunction with traditional cancer treatments, such as resection, radiation, and chemotherapy (242).

4.6.2

Targeting DNA Damage Response and Repair

Inhibition of DNA damage proteins or repair mechanisms has been widely studied in the context of anticancer applications. Most radio- and chemotherapeutic compounds can be directed to produce a broad range of DNA damage, and therefore address the involvement of multiple pathways in repair of lesions. As a method of

4 Telomere Dysfunction and the DNA Damage Response

113

Table 4.3 DNA damage and repair-based compounds Target Compound Reference DNA-PKcs NU7026 (264) Nu7441 (265) IC87102 (266) IC87361 (267) Wortmannin (268) OK-1035 (269) LY294002 (270) PARP NU1025 (271) ATM KU-0055933 (272)

sensitization to existing therapies, DNA repair proteins can be inhibited by small molecules targeting various key players to elicit a more effective cytotoxic response (Table 4.3). Cells deficient in DNA-PKcs show hypersensitivity to ionizing radiation due to defective DNA repair (273). Since inhibition of DNA-PKcs is hypothesized to induce the same response, NU7026 has recently been developed as a DNA-PKcs inhibitor, selectively acting on DNA-PKcs-containing cells to potentiate cytotoxicity (264, 274). Additional DNA-PKcs inhibitors, such as Nu7441 (265), IC87102 (266), IC87361 (267), wortmannin (268), OK-1035 (269), and LY294002 (270), are all potent radiosensitizers. Furthermore, PARP inhibitors like NU1025 and ATM kinase inhibitors like KU-0055933, which blocks phosphorylation of ATM targets, are also associated with increased cytotoxicity and chemo- and radiosensitization (271–273). Finally, the direct involvement of WRN and BLM helicases in HRmediated repair and their interaction with the MRN complex provides a strong incentive for developing targeted therapies against these proteins (275). Components of other repair pathways also exist as targets for drug inhibition and may be implicated in cancer therapy. An exhaustive compilation of all these targets is beyond the scope of this chapter, but suffice is to say that the number of potential targets continues to grow. The fact that many of these proteins are localized or associated at the telomere suggests that their inhibition may be an indirect method of telomere disruption.

4.7

Concluding Remarks

The field of telomere biology has seen significant advances in understanding telomere function and interaction on a global scale. Gone is the simplistic view of telomeres as simply noncoding disposable DNA. It is now apparent that telomeres are highly regulated and complex structures that play important roles in assuring genomic fidelity. Although the roles of all the players in this process are not fully understood, current data nevertheless provide a multifaceted representation of

114

M.C. Diehl et al.

normal telomere behavior. It is especially apparent that telomere maintenance and the DNA damage response are interdependent, and one cannot fully explain either process without mentioning the other with respect to telomeres. As the knowledge base increases with each new study, the potential for development of treatments for diseases including, but not limited to, cancer will simultaneously grow. Although much progress has been made toward elucidating telomere dysfunction and the DNA damage response, many areas still need to be explored. The future will surely see exciting advances in understanding telomere biology and its potential application into clinical settings.

References 1. Rhodes D. The structural biology of telomeres. In: de Lange T, Lundblad V, Blackburn E, eds. Telomeres, 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 2006:317–43. 2. Matulic´ M, Sopta M, Rubelj I. Telomere dynamics: the means to an end. Cell Prolif 2007;40:462–74. 3. Baykal A, Rosen D, Zhou C, Liu J, Sahin AA. Telomerase in breast cancer. Adv Anat Pathol 2004;11:262–8. 4. Deng Y and Chang S. Role of telomeres and telomerase in genomic instability, senescence, and cancer. Lab Invest 2007;87:1071–6. 5. Bhattacharyya MK and Lustig AJ. Telomere dynamics in genome stability. Trends Biochem Sci 2006;31:114–22. 6. Karlseder J. Telomere repeat binding factors: keeping the ends in check. Cancer Lett 2003;194:189–97. 7. Shay JW and Bacchetti S. A survey of telomerase activity in human cancer. Eur J Cancer 1997;33:787–91. 8. de Lange T. Shelterin: the protein complex that shapes and safeguards human telomeres. Genes Dev 2005;19:2100–10. 9. Kanoh J and Ishikawa F. Composition and conservation of the telomeric complex. Cell Mol Life Sci 2003;60:2295–302. 10. Neidle S and Parkinson GN. The structure of telomeric DNA. Curr Opin Struct Biol 2003;13:275–83. 11. Wai LK. Telomeres, telomerase, and tumorigenesis – A review. Med Gen Med 2004;6:19. 12. Karlseder J, Smogorsewska A, de Lange T. Senescence induced by altered telomere state, not telomere loss. Science 2002;295:2446–9. 13. Karlseder J, Broccoli D, Dai Y, Hardy S, de Lange T. p53- and ATM-dependent apoptosis induced by telomeres lacking TRF2. Science 1999;283:1321–5. 14. Bradshaw PS, Stavropoulous DJ, Meyn MS. Human telomeric protein TRF2 associates with genomic double-strand breaks as an early response to DNA damage. Nat Genet 2005;37:193–7. 15. Hsiao SJ and Smith S. Tankyrase function at telomeres, spindle poles, and beyond. Biochimie 2008;90:83–92. 16. Loayza D and de Lange T. POT1 as a terminal transducer of TRF1 telomere length control. Nature 2003;423:1013–8. 17. Feldser DM, Hackett JA, Greider CW. Telomere dysfunction and the initiation of genome instability. Nat Rev Cancer 2003;3:4–6. 18. Shay JW, Pereira-Smith OM, Wright WE. A role for both RB and p53 in the regulation of human cellular senescence. Exp Cell Res 1991;196:33–9.

4 Telomere Dysfunction and the DNA Damage Response

115

19. Greider CW and Blackburn EH. Identification of a specific telomere terminal transferase activity in Tetrahymena extracts. Cell 1985;43:405–13. 20. Holt SE, Aisner DL, Baur J, et al. Functional requirement of p23 and Hsp90 in telomerase complexes. Genes Dev 1999;13:817–26. 21. Lin KW and Yan J. The telomere length dynamic and methods of its assessment. J Cell Mol Med 2005;9:977–89. 22. Lei M, Zaug AJ, Podell ER, Cech TR. Switching human telomerase on and off with hPOT1 protein in vitro. J Biol Chem 2005;280:20449–56. 23. Forsythe HL, Jarvis JL, Turner JW, Elmore LW, Holt SE. Stable association of hsp90 and p23, but not hsp70, with active human telomerase. J Biol Chem 2001;276:15571–4. 24. Csermely P, Schnaider T, Soti C, Prohaszka Z, Nardai G. The 90-kDa molecular chaperone family structure: function, and clinical applications. A comprehensive review. Pharmacol Ther 1998;79:129–68. 25. Sharp S and Workman P. Inhibitors of the HSP90 molecular chaperone: current status. Adv Cancer Res 2006;95:323–48. 26. Goetz MP, Toft DO, Ames MM, Erlichman C. The Hsp90 chaperone complex as a novel target for cancer therapy. Ann Oncol 2003;14:1169–6. 27. Kamal A, Thao L, Sensintaffar J, et al. A high-affinity conformation of Hsp90 confers tumour selectivity on Hsp90 inhibitors. Nature 2003;425:407–10. 28. Holt SE and Shay JW. Role of telomerase in cellular proliferation and cancer. J Cell Physiol 1999;180:10–8. 29. Meeker AK, Hicks JL, Iacobuzio-Donahue CA, et al. Telomere length abnormalities occur early in the initiation of epithelial carcinogenesis. Clin Cancer Res 2004;10:3317–26. 30. Meeker AK, Hicks JL, Gabrielson E, Strauss WM, De Marzo AM, Argani P. Telomere shortening occurs in subsets of normal breast epithelium as well as in situ and invasive carcinoma. Am J Path 2004;164:925–35. 31. Chaib H, Rubin MA, Mucci NR, et al. Activated in prostate cancer: a PDZ domain-containing protein highly expressed in human primary prostate tumors. Cancer Res 2001;61:2390–4. 32. McClintock B. The fusion of broken ends of chromosomes following nuclear fusion. Proc Natl Acad Sci USA 1942;28:458–63. 33. Muller HJ. The remaking of chromosomes. Collect Net 1938;13:181. 34. Hemann MT, Hackett J, Ijpma A, Greider CW. Telomere length, telomere-binding proteins, and DNA damage signaling. Cold Spring Harbor Symp Quant Biol 2000;65:275–9. 35. Yu GL, Bradley JD, Attardi LD, Blackburn EH. In vivo alteration of telomere sequences and senescence caused by mutated Tetrahymena telomerase RNAs. Nature 1990;344:126–32. 36. Kirk KE, Harmon BP, Reichardt IK, Sedat JW, Blackburn EH. Block in anaphase chromosome separation caused by a telomerase template mutation. Science 1997;275:1478–81. 37. Prescott JC and Blackburn EH. Telomerase RNA template mutations reveal sequencespecific requirements for the activation and repression of telomerase action at telomeres. Mol Cell Biol 2000;20:2941–8. 38. Lundblad V and Szostak JW. A mutant with a defect in telomere elongation leads to senescence in yeast. Cell 1989;57:633–43. 39. Blasco MA, Lee HW, Hande MP, et al. Telomere shortening and tumor formation by mouse cells lacking telomerase RNA. Cell 1997;91:25–34. 40. Calle´n E and Surralle´s J. Telomere dysfunction in genome instability syndromes. Mutat Res 2004;567:85–104. 41. Gollin SM. Mechanisms leading to chromosomal instability. Semin Cancer Biol 2005;15:33–42. 42. McGowan CH and Russell P. The DNA damage response: sensing and signaling. Curr Opin Cell Biol 2004;6:629–33. 43. McChesney PA, Elmore LW, Holt SE. Aging and oxidative damage: are telomeres the target? Comments Theor Biol 2002;7:295–313. 44. von Zglinicki T. Oxidative stress shortens telomeres. Trends Biochem Sci 2002;27:339–44.

116

M.C. Diehl et al.

45. Abraham RT. Cell cycle checkpoint signaling through the ATM and ATR kinases. Genes Dev 2001;15:2177–96. 46. Hurley PJ and Bunz F. ATM and ATR: components of an integrated circuit. Cell Cycle 2007;6:414–7. 47. Lavin MF and Kozlov S. ATM activation and DNA damage response. Cell Cycle 2007;6:931–42. 48. Bakkenist CJ and Kastan MB. DNA damage activates ATM through intermolecular autophosphorylation and dimer dissociation. Nature 2003;421:499–506. 49. Petrini JH and Stracker TH. The cellular response to DNA double-strand breaks: defining the sensors and mediators. Trends Cell Biol 2003;13:458–62. 50. Bartek J and Lukas J. DNA damage checkpoints: from initiation to recovery or adaptation. Curr Opin Cell Biol 2007;19:1–8. 51. Uziel T, Lerenthal Y, Moyal L, Andegeko Y, Mittelman L, Shiloh Y. Requirement of the MRN complex for ATM activation by DNA damage. EMBO J 2003;22:5612–21. 52. Zou L and Elledge SJ. Sensing DNA damage through ATRIP recognition of RPA-ssDNA complexes. Science 2003;300:1542–8. 53. Bartek J and Lukas J. Mammalian G1- and S-phase checkpoints in response to DNA damage. Curr Opin Cell Biol 2001;13:738–47. 54. Falck J, Mailand N, Syljuasen RG, Bartek J, Lukas J. The ATM-Chk2-Cdc25A checkpoint pathway guards against radioresistant DNA synthesis. Nature 2001;410:842–7. 55. Peng CY, Graves PR, Thoma RS, Wu Z, Shaw AS, Piwnica-Worms H. Mitotic and G2 checkpoint control: regulation of 14-3-3 protein binding by phosphorylation of Cdc25C on serine-216. Science 1997;277:1501–5. 56. Keogh MC, Kim JA, Downey M, et al. A phosphatase complex that dephosphorylates gH2AX regulates DNA damage checkpoint recovery. Nature 2006;439:497–501. 57. Harrison JC and Haber JE. Surviving the breakup: the DNA damage checkpoint. Annu Rev Genet 2006;40:209–35. 58. Castedo M, Perfettini J, Roumier T, Andreau K, Medema R, Kroemer G. Cell death by mitotic catastrophe: a molecular definition. Oncogene 2004;23:2825–37. 59. Kanaar R, Hoeijmakers JHJ, van Gent DC. Molecular mechanisms of DNA double strand break repair. Trends Cell Biol 1998;8:483–9. 60. Pastink A, Eeken JCJ, Lohman PHM. Genomic integrity and the repair of double-strand DNA breaks. Mutat Res 2001;480–481:37–50. 61. Pfeiffer P, Goedecke W, Gu¨nter O. Mechanisms of DNA double-strand break repair and their potential to induce chromosomal aberrations. Mutagenesis 2000;15:289–302. 62. Johnson RD and Jasin M. Double-strand-break-induced homologous recombination in mammalian cells. Biochem Soc Trans 2001;29:196–201. 63. Jasin M. Double-strand break repair and homologous recombination in mammalian cells. In: Nickoloff JA, Hoekstra MF, eds. DNA Damage and Repair. Totowa, NJ: Humana Press, 2001:207–36. 64. Carney JP, Maser RS, Olivares H, et al. The hMre11/hRad50 protein complex and Nijmegen breakage syndrome: linkage of double-strand break repair to the cellular DNA damage response. Cell 1998;93:477–86. 65. Baumann P, Benson FE, West SC. Human Rad51 protein promotes ATP-dependent homologous pairing and strand transfer reactions in vitro. Cell 1996;87:757–66. 66. Lim DS and Hasty P. A mutation in mouse rad51 results in an early embryonic lethal that is suppressed by a mutation in p53. Mol Cell Biol 1996;16:7133–43. 67. Dronkert ML, Beverloo HB, Johnson RD, Hoeijmakers JH, Jasin M, Kanaar R. Mouse RAD54 affects DNA double-strand break repair and sister chromatid exchange. Mol Cell Biol 2000;20:3147–56. 68. Pierce AJ, Johnson RD, Thompson LH, Jasin M. XRCC3 promotes homology-directed repair of DNA damage in mammalian cells. Genes Dev 1999;13:2633–8.

4 Telomere Dysfunction and the DNA Damage Response

117

69. Chen J, Silver DP, Walpita D, et al. Stable interaction between the products of the BRCA1 and BRCA2 tumor suppressor genes in mitotic and meiotic cells. Mol Cell 1998;2:317–28. 70. Scully R, Chen J, Plug A, et al. Association of BRCA1 with Rad51 in mitotic and meiotic cells. Cell 1997;88:265–75. 71. Moynahan ME, Chiu JW, Koller BH, Jasin M. BRCA1 controls homology-directed DNA repair. Mol Cell 1999;4:511–8. 72. Helleday T. Pathways for mitotic homologous recombination in mammalian cells. Mutat Res 2003;532:103–15. 73. Tauchi H, Kobayashi J, Morishima K, et al. NBS1 is essential for DNA repair by homologous recombination in higher vertebrate cells. Nature 2002;420:93–8. 74. Van Dyck E, Stasiak AZ, Stasiak A, West SC. Binding of double-strand breaks in DNA by human Rad52 protein. Nature 1999;398:728–31. 75. Wold MS. Replication protein A: a heterotrimeric, single-stranded DNA-binding protein required for eukaryotic DNA metabolism. Annu Rev Biochem 1997;66:61–92. 76. Liang F, Han M, Romanienko PJ, Jasin M. Homology-directed repair is a major doublestrand break repair pathway in mammalian cells. Proc Natl Acad Sci USA 1998;95:5172–7. 77. Ogawa T, Yu X, Shinohara A, Egelman EH. Similarity of the yeast RAD51 filament to the bacterial RecA filament. Science 1993;259:1896–9. 78. Masson JY, Tarsounas MC, Stasiak AZ, et al. Identification and purification of two distinct complexes containing the five RAD51 paralogs. Genes Dev 2001;15:3296–307. 79. Powell SN, Willers H, Xia F. BRCA2 keeps Rad51 in line. High-fidelity homologous recombination prevents breast and ovarian cancer? Mol Cell 2002;10:1262–3. 80. Petukhova G, Stratton S, Sung P. Catalysis of homologous DNA pairing by yeast Rad51 and Rad54 proteins. Nature 1998;393:91–4. 81. D’Amours D and Jackson SP. The Mre11 complex: at the crossroads of DNA repair and checkpoint signaling. Nat Rev Mol Cell Biol 2002;3:317–27. 82. Walker JR, Corpina RA, Goldberg J. Structure of the Ku heterodimer bound to DNA and its implications for double-strand break repair. Nature 2001;412:607–14. 83. Jeggo PA. DNA-PK: at the cross-roads of biochemistry and genetics. Mutat Res 1997;384: 1–14. 84. Ma Y, Pannicke U, Schwarz K, Lieber MR. Hairpin opening and overhang processing by an Artmeis/DNA-dependent protein kinase complex in nonhomologous end joining and V(D)J recombination. Cell 2002;108:781–94. 85. Grawunder U, Wilm M, Wu X, et al. Activity of DNA ligase IV stimulated by complex formation with XRCC4 protein in mammalian cells. Nature 1997;388:492–5. 86. Chappell C, Hanakahi LA, Karimi-Busheri F, Weinfeld M, West SC. Involvement of human polynucleotide kinase in double-strand break repair by non-homologous end joining. EMBO J 2002;21:2827–32. 87. Hendrickson EA. Cell-cycle regulation of mammalian DNA double-strand-break repair. Am J Hum Genet 1997;61:795–800. 88. Slijepcevic P. The role of DNA damage response proteins at telomeres-an “integrative” model. DNA Repair 2006;5:1299–306. 89. Slijepcevic P and Al-Wahiby S. Telomere biology: integrating chromosomal end protection with DNA damage response. Chromosoma 2005;114:275–85. 90. Boulton SJ and Jackson SP. Identification of a Saccharomyces cerevisiae Ku80 homologue: roles in DNA double strand break rejoining and in telomeric maintenance. Nucleic Acids Res 1996;24:4639–48. 91. Metcalfe JA, Parkhill J, Campbell L, et al. Accelerated telomere shortening in ataxia telangiectasia. Nat Genet 1996;13:350–3. 92. Tarsounas M and West SC. Recombination at mammalian telomeres: an alternative mechanism for telomere protection and elongation. Cell Cycle 2005;4:672–4. 93. Gilley D, Tanaka H, Hande MP, et al. DNA-PKcs is critical for telomere capping. Proc Natl Acad Sci USA 2001;98:15084–8.

118

M.C. Diehl et al.

94. Hande P, Slijepcevic P, Silver A, et al. Elongated telomeres in SCID mice. Genomics 1999;56:221–3. 95. Hsu HL, Gilley D, Galande SA, Hande MP, Allen B, Kim SH. Ku acts in a unique way at the mammalian telomere to prevent end joining. Genes Dev 2000;14:2807–12. 96. Song K, Jung D, Jung Y, Lee SG, Lee I. Interaction of human Ku70 with TRF2. FEBS Lett 2000;481:81–5. 97. d’ Adda di Fagagna F, Hande MP, Tong WM, et al. Effects of DNA nonhomologous endjoining factors on telomere length and chromosomal stability in mammalian cells. Curr Biol 2001;11:1192–6. 98. Jaco I, Munoz P, Blasco MA. Role of human Ku86 in telomere length maintenance and telomere capping. Cancer Res 2004;64:7271–8. 99. Espejel S, Franco S, Rodriguez-Perales S, Bouffler SD, Cigudosa JC, Blasco MA. Mammalian Ku86 mediates chromosomal fusions and apoptosis caused by critically short telomeres. EMBO J 2002;21:2207–19. 100. Riha K, Watson JM, Parkey J, Shippen DE. Telomere length deregulation and enhanced sensitivity to genotoxic stress in Arabidopsis mutant deficient in Ku70. EMBO J 2002;21:2819–26. 101. Song K, Jung Y, Jung D, Lee I. Human Ku70 interacts with heterochromatin protein 1a. J Biol Chem 2001;276:8321–27. 102. Karlseder J, Hoke K, Mirzoeva OK, et al. The telomeric protein TRF2 binds the ATM kinase and can inhibit the ATM-dependent DNA damage response. PLoS Biol 2004;2: 1150–6. 103. Zhu XD, Kuster B, Mann M, Petrini JH, de Lange T. Cell-cycle-regulated association of RAD50/MRE11/NBS1 with TRF2 and human telomeres. Nat Genet 2000;25:347–52. 104. Wang SS and Zakian VA. Telomere–telomere recombination provides an express pathway for telomere elongation. Nature 1990;345:456–8. 105. Tarsounas M, Mun˜oz P, Claas A, et al. Telomere maintenance requires the RAD51D recombination/repair protein. Cell 2004;117:337–47. 106. Jaco I, Munoz P, Goytisolo F, et al. Role of mammalian RAD54 in telomere length maintenance. Mol Cell Biol 2003;23:5572–80. 107. Tan TLR, Kanaar R, Wyman C. RAD54, a jack of all trades in homologous recombination. DNA Repair 2003;2:787–94. 108. Bryan TM, Englezou A, Dalla-Pozza L, Dunham MA, Reddel RR. Evidence for an alternative mechanism for maintaining telomere length in human tumors and tumor-derived cell lines. Nat Med 1997;3:1271–4. 109. Niida H, Shinkai Y, Hande MP, et al. Telomere maintenance in telomerase-deficient mouse embryonic stem cells: characterization of an amplified telomeric DNA. Mol Cell Biol 2000;20:4115–27. 110. Reddel RR and Bryan TM. Alternative lengthening of telomeres: dangerous road less travelled. Lancet 2003;361:1840–1. 111. Henson JD, Neumann AA, Yeager TR, Reddel RR. Alternative lengthening of telomeres in mammalian cells. Oncogene 2002;21:598–610. 112. Tong WM, Hande MP, Lansdorp PM, Wang ZQ. DNA strand break-sensing molecule poly (ADP-Ribose) polymerase cooperates with p53 in telomere function, chromosome stability, and tumor suppression. Mol Cell Biol 2001;21:4046–54. 113. Dantzer F, Giraud-Panis MJ, Jaco I, et al. Functional interaction between poly(ADP-ribose) polymerase 2 (PARP2) and TRF2: PARP activity negatively regulates TRF2. Mol Cell Biol 2004;24:1595–607. 114. Hande P, Balajee AS, Tchirkov A, Wynshaw-Boris A, Lansdorp PM. Extra-chromosomal telomeric DNA in cells from Atm(–/–) mice and patients with ataxia-telangiectasia. Hum Mol Genet 2001;10:519–28. 115. de Laat WL, Appeldoorn E, Jaspers NG, Hoeijmakers JH. DNA structural elements required for ERCC1-XPF endonuclease activity. J Biol Chem 1998;273:7835–42.

4 Telomere Dysfunction and the DNA Damage Response

119

116. Zhu XD, Niedernhofer L, Kuster B, Mann M, Hoeijmakers JH, de Lange T. ERCC1/XPF removes the 3´overhang from uncapped telomeres and represses formation of telomeric DNA-containing double minute chromosomes. Mol Cell 2003;12:1489–98. 117. Lenain C, Bauwens S, Amiard S, Brunori M, Giraud-Panis MJ, Gilson E. The Apollo 5´ exonuclease functions together with TRF2 to protect telomeres from DNA repair. Curr Biol 2006;16:1303–10. 118. Chan SW and Blackburn EH. New ways not to make ends meet: telomerase, DNA damage proteins and heterochromatin. Oncogene 2002;21:553–63. 119. Cenci G, Ciapponi L, Gatti M. The mechanism of telomere protection: a comparison between Drosophila and humans. Chromosoma 2005;114:135–45. 120. Wong KK, Chang S, Weiler SR, et al. Telomere dysfunction impairs DNA repair and enhances sensitivity to ionizing radiation. Nat Genet 2000;26:85–8. 121. Wu X, Amos CI, Zhu Y, et al. Telomere dysfunction: a potential cancer predisposition factor. J Natl Cancer Inst 2003;95:1211–8. 122. von Zglinicki T, Burkle A, Kirkwood TB. Stress, DNA damage, and ageing – An integrative approach. Exp Gerontol 2001;36:1049–62. 123. Verdun RE and Karlseder J. Replication and protection of telomeres. Nature 2007;447: 924–31. 124. Bertuch AA and Lundblad V. The maintenance and masking of chromosome termini. Curr Opin Cell Biol 2006;18:247–53. 125. Griffith JD, Comeau L, Rosenfield S, et al. Mammalian telomeres end in a large duplex loop. Cell 1999;97:503–14. 126. Hayflick L and Moorhead PS. The serial cultivation of human diploid cell strains. Exp Cell Res 1961;25:585–621. 127. Hayflick L. The illusion of cell immortality. Br J Cancer 2000;83:841–6. 128. Shay JW and Roninson IB. Hallmarks of senescence in carcinogenesis and cancer therapy. Oncogene 2004;23:2919–33. 129. von Zglinicki T, Saretzki G, Ladhoff J, d’Adda di Fagagna F, Jackson SP. Human cell senescence as a DNA damage response. MechAgeing Dev 2005;126:111–7. 130. Wright WE and Shay JW. The two-stage mechanism controlling cellular senescence and immortalization. Exp Gerontol 1992;27:383–9. 131. Herskind C and Rodemann HP. Spontaneous and radiation-induced differentiation of fibroblasts. Exp Gerontol 2000;35:747–55. 132. Robles SJ and Adami GR. Agents that cause DNA double strand breaks lead to p16INK4a enrichment and the premature senescence of normal fibroblasts. Oncogene 1998;16:1113–23. 133. von Zglinicki T, Saretzki G, Do¨cke W, Lotze C. Mild hyperoxia shortens telomeres and inhibits proliferation of fibroblasts: a model for senescence? Exp Cell Res 1995;220:186–93. 134. Artandi SE and Attardi LD. Pathways connecting telomeres and p53 in senescence, apoptosis, and cancer. Biochem Biophys Res Commun 2005;331:881–90. 135. d’ Adda di Fagagna F, Reaper PM, Clay-Farrace L, et al. A DNA damage checkpoint response in telomere-initiated senescence. Nature 2003;426:194–8. 136. van Steensel B, Smogorzewska A, de Lange T. TRF2 protects human telomeres from end-toend fusions. Cell 1998;92:401–13. 137. Takai H, Smogorzewska A, de Lange T. DNA damage foci at dysfunctional telomeres. Curr Biol 2003;13:1549–56. 138. Herbig U, Jobling WA, Chen BP, Chen DJ, Sedivy JM. Telomere shortening triggers senescence of human cells through a pathway involving ATM, p53, and p21(CIP1), but not p16(INK4a). Mol Cell 2004;14:501–13. 139. de Lange T. Protection of mammalian telomeres. Oncogene 2002;21:532–40. 140. Stewart SA, Ben-Porath I, Carey VJ, O’Connor BF, Hahn WC, Weinberg RA. Erosion of the telomeric single-strand overhang at replicative senescence. Nat Genet 2003;33:492–6.

120

M.C. Diehl et al.

141. Su TT. Cellular responses to DNA damage: one signal, multiple choices. Annu Rev Genet 2006;40:187–208. 142. Irwin M, Marin MC, Phillips AC, et al. Role for the p53 homologue p73 in E2F-1-induced apoptosis. Nature 2000;407:645–8. 143. Kaelin WG. The emerging p53 gene family. J Natl Cancer Inst 1999;91:594–8. 144. Narita M, Nu˜nez S, Heard E, et al. Rb-mediated heterochromatin formation and silencing of E2F target genes during cellular senescence. Cell 2003;113:703–16. 145. Seger YR, Garcı´a-Cao M, Piccinin S, et al. Transformation of normal human cells in the absence of telomerase activation. Cancer Cell 2002;2:401–13. 146. Sedgwick RP and Boder E. Ataxia telangiectasia. In: Vinken PJ, Bruyn GW, de Jong V, eds. Hereditary Neuropathies and Spinocerebellar Atrophies (Handbook of Clinical Neurology), 16th ed. Amsterdam: Elsevier, 1991:347. 147. Cox R. A cellular description of the repair defect in ataxia telangiectasia. In: Bridges BA, Harnden DG, eds. Ataxia Telangiectasia: Cell and Molecular link between Cancer, Neuropathology and Immune Deficiency. Chichester: Wiley, 1982:141–53. 148. Stewart GS, Maser RS, Stankovic T, et al. The DNA double-strand break repair gene hMRE11 is mutated in individuals with an ataxia-telangiectasia-like disorder. Cell 1999;99:577–87. 149. Desai-Mehta A, Cerosaletti KM, Concannon P. Distinct functional domains of nibrin mediate Mre11 binding, focus formation, and nuclear localization. Mol Cell Biol 2001;21:2184–91. 150. Zhang Y, Zhou J, Lim CU. The role of NBS1 in DNA double strand break repair, telomere stability, and cell cycle checkpoint control. Cell Res 2006;16:45–54. 151. Straughen J, Ciocci S, Ye TZ, et al. Physical mapping of the Bloom syndrome region by the identification of YAC and P1 clones from human chromosome 15 band q26.1. Genomics 1996;35:118–28. 152. Chaganti RS, Schonberg S, German J. A manyfold increase in sister chromatid exchanges in Bloom’s syndrome lymphocytes. Proc Natl Acad Sci USA 1974;71:4508–12. 153. Bohr VA, Souza Pinto N, Nyaga SG, et al. DNA repair and mutagenesis in Werner syndrome. Environ Mol Mutagen 2001;38:227–34. 154. Thomas W, Rubenstein M, Goto M, Drayna D. A genetic analysis of the Werner syndrome region on human chromosome 8p. Genomics 1993;16:685–90. 155. Fukuchi K, Martin GM, Monnat RJ Jr. Mutator phenotype of Werner syndrome is characterized by extensive deletions. Proc Natl Acad Sci USA 1989;86:5893–7. 156. Wang SM, Nishigori C, Yagi T, Takebe H. Reduced DNA repair in progeria cells and effects of gamma-ray irradiation on UV-induced unscheduled DNA synthesis in normal and progeria cells. Mutat Res 1991;256:59–66. 157. Zebrower M, Kieras FJ, Brown WT. Urinary hyaluronic acid elevation in Hutchinson– Gilford progeria syndrome. Mech Ageing Dev 1986;35:39–46. 158. Marrone A and Mason PJ. Human genome and disease: review, dyskeratosis congenital. Cell Mol Life Sci 2003;60:507–17. 159. Heiss NS, Knight SW, Vulliamy TJ, et al. X-linked dyskeratosis congenita is caused by mutations in a highly conserved gene with putative nucleolar functions. Nat Genet 1998;19:32–8. 160. Vulliamy T, Marrone A, Goldman F, et al. The RNA component of telomerase is mutated in autosomal dominant dyskeratosis congenita. Nature 2001;413:432–5. 161. Zhang P, Dilley C, Mattson MP. DNA damage responses in neural cells: focus on the telomere. Neurosci 2007;145:1439–48. 162. Zhu H, Fu W, Mattson MP. The catalytic subunit of telomerase protects neurons against amyloid beta-peptide-induced apoptosis. J Neurochem 2000;75:117–24. 163. National Center for Health Statistics. Health, United States: With Chartbook on Trends in the Health of Americans. Hyattsville, MD, 2007:192.

4 Telomere Dysfunction and the DNA Damage Response

121

164. Ahmed A and Tollefsbol T. Telomeres and telomerase: basic science implications for aging. Geriatr Biosci 2001;49:1105–9. 165. Kruk PA, Rampino NJ, Bohr VA. DNA damage and repair in telomeres: relation to aging. Proc Natl Acad Sci USA 1995;92:258–62. 166. Harley CB, Futcher AB, Greider CW. Telomeres shorten during ageing of human fibroblasts. Nature 1990;345:458–60. 167. Bodnar AG, Ouellette M, Frolkis M, et al. Extension of life-span by introduction of telomerase into normal human cells. Science 1998;279:349–52. 168. Wright WE, Brasiskyte D, Piatyszek MA, Shay JW. Experimental elongation of telomeres extends the lifespan of immortal  normal cell hybrids. EMBO J 1996;15:1734–41. 169. Jiang XR, Jimenez G, Chang E, et al. Telomerase expression in human somatic cells does not induce changes associated with a transformed phenotype. Nat Genet 1999;21:111–4. 170. Morales CP, Holt SE, Ouellette M, et al. Absence of cancer-associated changes in human fibroblasts immortalized with telomerase. Nat Genet 1999;21:115–8. 171. Vaziri H and Benchimol S. Reconstitution of telomerase activity in normal human cells leads to elongation of telomeres and extended replicative life span. Curr Biol 1998;8: 279–82. 172. Bohr VA. Human premature aging syndromes and genomic instability. Mech Ageing Dev 2002;123:987–93. 173. Taylor AMR. Chromosome instability syndromes. Best Pract Res Clin Haematol 2001;14:631–44. 174. Taylor AMR, Groom A, Byrd PJ. Ataxia-telangiectasia-like disorder (ATLD) – Its clinical presentation and molecular basis. DNA Repair 2004;3:1219–25. 175. Butterworth SV and Taylor AMR. A subpopulation of t(2;14)(p11;q32) cells in ataxia telangiectasia B lymphocytes. Hum Genet 1986;73:346–9. 176. Taylor AM, Metcalfe JA, Thick J, Mak YF. Leukemia and lymphoma in ataxia telangiectasia. Blood 1996;87:423–38. 177. Chen G, Yuan SS, Liu W, et al. Radiation-induced assembly of Rad51 and Rad52 recombination complex requires ATM and c-Abl. J Biol Chem 1999;274:12748–52. 178. Pitts SA, Kullar HS, Stankovic T, et al. hMRE11: genomic structure and a null mutation identified in a transcript protected from nonsense-mediated mRNA decay. Hum Mol Genet 2001;10:1155–62. 179. Nelms BE, Maser RS, MacKay JF, Lagally MG, Petrini JH. In situ visualization of DNA double-strand break repair in human fibroblasts. Science 1998;280:590–2. 180. Varon R, Vissinga C, Platzer M, et al. Nibrin, a novel DNA double-strand break repair protein, is mutated in Nijmegen breakage syndrome. Cell 1998;93:467–76. 181. Kass-Eisler A and Greider CW. Recombination in telomere-length maintenance. Trends Biochem Sci 2000;25:200–4. 182. Zhang Y, Lim CU, Williams ES, et al. NBS1 knockdown by small interfering RNA increases ionizing radiation mutagenesis and telomere association in human cells. Cancer Res 2005;65:5544–53. 183. Bloom D. Congenital telangiectatic erythema resembling lupus erythematosus in dwarfs; probably a syndrome entity. AMA Am J Dis Child 1954;88:754–8. 184. Goto M, Miller RW, Ishikawa Y, Sugano H. Excess of rare cancers in Werner syndrome (adult progeria). Cancer Epidemiol Biomarkers Prev 1996;5:239–46. 185. Duvic M and Lemak NA. Werner’s syndrome. Dermatol Clin 1995;13:163–8. 186. Nehlin JO, Skovgaard GL, Bohr VA. The Werner syndrome. A model for the study of human aging. Ann N Y Acad Sci 2000;908:167–79. 187. Salk D. Werner’s syndrome: a review of recent research with an analysis of connective tissue metabolism, growth control of cultured cells, and chromosomal aberrations. Hum Genet 1982;62:1–5. 188. German J. Bloom’s syndrome. Dermatol Clin 1995;13:7–18.

122

M.C. Diehl et al.

189. Heddle JA, Krepinsky AB, Marshall RR. Cellular sensitivity to mutagens and carcinogens in the chromosome-breakage and other cancer-prone syndromes. In: German J, ed. Chromosome Mutation and Neoplasia. New York, NY: Alan R. Liss, 1983:203–34. 190. Hickson ID. RecQ helicases: caretakers of the genome. Nat Rev Cancer 2003;3:169–78. 191. Sun H, Karow JK, Hickson ID, Maizels N. The Bloom’s syndrome helicase unwinds G4 DNA. J Biol Chem 1998;273:27587–92. 192. Williamson JR. G-quartet structures in telomeric DNA. Annu Rev Biophys Biomol Struct 1994;23:703–30. 193. Opresko PL, von Kobbe C, Laine JP, Harrigan J, Hikson ID, Bohr VA. Telomere-binding protein TRF2 binds to and stimulates the Werner and Bloom syndrome helicases. J Biol Chem 2002;277:41110–9. 194. Yankiwski V, Marciniak RA, Guarente L, Neff NF. Nuclear structure in normal and Bloom syndrome cells. Proc Natl Acad Sci USA 2000;97:5214–9. 195. Kipling D and Faragher RG. Progeroid syndromes: probing the molecular basis of aging? Mol Pathol 1997;50:234–41. 196. Oshima J. The Werner syndrome protein: an update. Bioessays 2000;22:894–901. 197. Schulz VP, Zakian VA, Ogburn CE, et al. Accelerated loss of telomeric repeats may not explain accelerated replicative decline of Werner syndrome cells. Hum Genet 1996;97:750–4. 198. Wyllie FS, Jones CJ, Skinner JW, et al. Telomerase prevents the accelerated cell ageing of Werner syndrome fibroblasts. Nat Genet 2000;24:16–7. 199. Brosh RM Jr, Orren DK, Nehlin JO, et al. Functional and physical interaction between WRN helicase and human replication protein A. J Biol Chem 1999;274:18341–50. 200. Cooper MP, Machwe A, Orren DK, Brosh RM, Ramsden D, Bohr VA. Ku complex interacts with and stimulates the Werner protein. Genes Dev 2000;14:907–12. 201. Li B and Comai L. Functional interaction between Ku and the Werner syndrome protein in DNA end processing. J Biol Chem 2000;275:28349–52. 202. Brosh RM Jr, Li JL, Kenny MK, et al. Replication protein A physically interacts with the Bloom’s syndrome protein and stimulates its helicase activity. J Biol Chem 2000;275:23500–8. 203. Cheok CF, Bachrati CZ, Chan KL, Ralf C, Wu L, Hickson ID. Roles of the Bloom’s syndrome helicase in the maintenance of genome stability. Biochem Soc Trans 2005;33:1456–9. 204. Poot M, Hoehn H, Ru¨nger TM, Martin GM. Impaired S-phase transit of Werner syndrome cells expressed in lymphoblastoid cell lines. Exp Cell Res 1992;202:267–73. 205. Wu L, Davies SL, Levitt NC, Hickson ID. Potential role for the BLM helicase in recombinational repair via a conserved interaction with RAD51. J Biol Chem 2001;276:19375–81. 206. Sarker PK and Shinton RA. Hutchinson–Guilford progeria syndrome. Postgrad Med J 2001;77:312–7. 207. Sweeney KJ and Weiss AS. Hyaluronic acid in progeria and the aged phenotype? Gerontology 1992;38:139–52. 208. Tokunaga M, Wakamatsu E, Sato K, et al. Hyaluronuria in a case of progeria. (Hutchinson– Gilford syndrome). J Am Geriatr Soc 1978;26:296–302. 209. Faragher RG. Cell senescence and human aging: where’s the link? Biochem Soc Trans 2000;28:221–6. 210. Allsopp RC, Vaziri H, Patterson C, et al. Telomere length predicts replicative capacity of human fibroblasts. Proc Natl Acad Sci USA 1992;89:10114–8. 211. Marciniak RA, Johnson FB, Guarente L. Dyskeratosis congenita, telomeres and human ageing. Trends Genet 2000;16:193–5. 212. Dokal I. Dyskeratosis congenita in all its forms. Br J Haematol 2000;110:768–79. 213. Arngrimsson R, Dokal I, Luzzatto L, Connor JM. Dyskeratosis congenita: three additional families show linkage to a locus in Xq28. J Med Genet 1993;30:618–9.

4 Telomere Dysfunction and the DNA Damage Response

123

214. Mitchell JR, Wood E, Collins K. A telomerase component is defective in the human disease dyskeratosis congenita. Nature 1999;402:551–5. 215. Vulliamy TJ, Knight SW, Mason PJ, Dokal I. Very short telomeres in the peripheral blood of patients with X-linked and autosomal dyskeratosis congenita. Blood Cells Mol Dis 2001;27:353–7. 216. Chen JL, Blasco MA, Greider CW. Secondary structure of vertebrate telomerase RNA. Cell 2000;100:503–14. 217. Soder AI, Hoare SF, Muir S, Going JJ, Parkinson EK, Keith WN. Amplification, increased dosage and in situ expression of the telomerase RNA gene in human cancer. Oncogene 1997;14:1013–21. 218. Clark GM, Osborne CK, Levitt D, Wu F, Kim NW. Telomerase activity and survival of patients with node-positive breast cancer. J Natl Cancer Inst 1997;89:1874–81. 219. Hiyama E, Saeki T, Hiyama K, et al. Telomerase activity as a marker of breast carcinoma in fine-needle aspirated samples. Cancer 2000;90:235–8. 220. Marchetti A, Bertacca G, Buttitta F, et al. Telomerase activity as a prognostic indicator in stage I non-small cell lung cancer. Clin Cancer Res 1999;5:2077–81. 221. Tatsumoto N, Hiyama E, Murakami Y, et al. High telomerase activity is an independent prognostic indicator of poor outcome in colorectal cancer. Clin Cancer Res 2000;6:2696– 2701. 222. Difilippantonio MJ, Zhu J, Chen HT, et al. DNA repair protein Ku80 suppresses chromosomal aberrations and malignant transformation. Nature 2000;404:510–4. 223. Gao Y, Ferguson DO, Xie W, et al. Interplay of p53 and DNA-repair protein XRCC4 in tumorigenesis, genomic stability and development. Nature 2000;404:897–900. 224. McCabe N, Turner NC, Lord CJ, et al. Deficiency in the repair of DNA damage by homologous recombination and sensitivity to poly(ADP-ribose) polymerase inhibition. Cancer Res 2006;66:8109–15. 225. Gisselsson D, Jonson T, Peterse´n A, et al. Telomere dysfunction triggers extensive DNA fragmentation and evolution of complex chromosomal abnormalities in human malignant tumors. Proc Natl Acad Sci USA 2001;98:12683–8. 226. van Heek NT, Meeker AK, Kern SE, et al. Telomere shortening is nearly universal in pancreatic intraepithelial neoplasia. Am J Pathol 2002;61:1541–7. 227. Counter CM, Avilion AA, LeFeuvre CE, et al. Telomere shortening associated with chromosome instability is arrested in immortal cells which express telomerase activity. EMBO J 1992;11:1921–9. 228. Chin L, Artandi SE, Shen Q, et al. p53 deficiency rescues the adverse effects of telomere loss and cooperates with telomere dysfunction to accelerate carcinogenesis. Cell 1999; 97:527–38. 229. Shin JS, Hong A, Solomon MJ, Lee CS. The role of telomeres and telomerase in the pathology of human cancer and aging. Pathology 2006;38:103–13. 230. Honig LS, Schupf N, Lee JH, Tang MX, Mayeux R. Shorter telomeres are associated with mortality in those with APOE epsilon4 and dementia. Ann Neurol 2006;60:181–7. 231. Opresko PL, Cheng WH, von Kobbe C, Harrigan J, Bohr VA. Werner syndrome and the function of the Werner protein: what they can teach us about the molecular aging process. Carcinogenesis 2003;24:791–802. 232. Sogaard M, Tumer Z, Hjalgrim H, et al. Subtelomeric study of 132 patients with mental retardation reveals 9 chromosomal anomalies and contributes to the delineation of submicroscopic deletions of 1pter, 2qter, 4pter, 5qter, and 9qter. BMC Med Genet 2005;6:21–31. 233. Yao G, Chen XN, Flores-Sarnat L, et al. Deletion of chromosome 21 disturbs human brain morphogenesis. Genet Med 2006;8:1–7. 234. Baek S, Bu Y, Kim H, Kim H. Telomerase induction in astrocytes of Sprague–Dawley rat after ischemic brain injury. Neurosci Lett 2004;363:94–6. 235. Fu W, Lee J, Guo Z, Mattson MP. Seizures and tissue injury induce telomerase in hippocampal microglial cells. Exp Neurol 2002;178:294–300.

124

M.C. Diehl et al.

236. Panossian LA, Porter VR, Valenzuela HF, et al. Telomere shortening in T cells correlates with Alzheimer’s disease status. Neurobiol Aging 2003;24:77–84. 237. Mattson MP, Fu W, Zhang P. Emerging roles for telomerase in regulating cell differentiation and survival: a neuroscientist’s perspective. Mech Ageing Dev 2001;122:659–71. 238. Caporaso GL, Lim DA, Alvarez-Buylla A, Chao MV. Telomerase activity in the subventricular zone of adult mice. Mol Cell Neurosci 2003;23:693–702. 239. Zhang P, Furukawa K, Opresko PL, Xu X, Bohr VA, Mattson MP. TRF2 dysfunction elicits DNA damage responses associated with senescence in proliferating neural cells and differentiation of neurons. J Neurochem 2006;97:567–81. 240. Ai W, Bertram PG, Tsang CK, Chan TF, Zheng XF. Regulation of subtelomeric silencing during stress response. Mol Cell 2002;10:1295–1305. 241. Shay JW and Wright WE. Telomerase therapeutics for cancer: challenges and new directions. Nat Rev Drug Discov 2006;5:577–84. 242. Shay JW and Wright WE. Hallmarks of telomeres in ageing research. J Pathol 2007;211:114–23. 243. Dikmen ZG, Gellert GC, Jackson S, et al. In vivo inhibition of lung cancer by GRN163L: a novel human telomerase inhibitor. Cancer Res 2005;65:7866–73. 244. Herbert BS, Gellert GC, Hochreiter A, et al. Lipid modification of GRN163, an N30 – > P50 thio-phosphoramidate oligonucleotide, enhances the potency of telomerase inhibition. Oncogene 2005;24:5262–8. 245. Stewart SA and Hahn WC. Prospects for anti-neoplastic therapies based on telomere biology. Curr Cancer Drug Targets 2002;2:1–17. 246. Fletcher TM, Cathers BE, Ravikumar KS, Mamiya BM, Kerwin SM. Inhibition of human telomerase by 7-deaza-20 -deoxyguanosine nucleoside triphosphate analogs: potent inhibition by 6-thio-7-deaza-20 -deoxyguanosine 50 -triphosphate. Bioorg Chem 2001;29:36–55. 247. Damm K, Hemmann U, Garin-Chesa P, et al. A highly selective telomerase inhibitor limiting human cancer cell proliferation. EMBO J 2001;20:6958–68. 248. Read M, Harrison RJ, Romagnoli B, et al. Structure-based design of selective and potent G quadruplex-mediated telomerase inhibitors. Proc Natl Acad Sci USA 2001;98:4844–9. 249. Riou JF, Guittat L, Mailliet P, et al. Cell senescence and telomere shortening induced by a new series of specific G-quadruplex DNA ligands. Proc Natl Acad Sci USA 2002;99:2672–7. 250. Duan W, Rangan A, Vankayalapati H, et al. Design and synthesis of fluoroquinophenoxazines that interact with human telomeric G-quadruplexes and their biological effects. Mol Cancer Ther 2001;1:103–20. 251. Kim MY, Vankayalapati H, Shin-Ya K, Wierzba K, Hurley LH. Telomestatin, a potent telomerase inhibitor that interacts quite specifically with the human telomeric intramolecular G-quadruplex. J Am Chem Soc 2002;124:2098–99. 252. Gowan SM, Heald R, Stevens MF, Kelland LR. Potent inhibition of telomerase by smallmolecule pentacyclic acridines capable of interacting with G-quadruplexes. Mol Pharmacol 2001;60:981–8. 253. Elayadi AN, Demieville A, Wancewicz EV, Monia BP, Corey DR. Inhibition of telomerase by 20 -O-(2-methoxyethyl) RNA oligomers: effect of length, phosphorothioate substitution and time inside cells. Nucleic Acids Res 2001;29:1683–9. 254. Rezler EV, Bearss DJ, Hurley LH. Telomere inhibition and telomere disruption as processes for drug targeting. Annu Rev Pharmacol Toxicol 2003;43:359–79. 255. Braasch DA and Corey DR. Locked nucleic acid (LNA): fine-tuning the recognition of DNA and RNA. Chem Biol 2001;8:1–7. 256. Gryaznov S, Pongracz K, Matray T, et al. Telomerase inhibitors–oligonucleotide phosphoramidates as potential therapeutic agents. Nucleosides Nucleotides Nucleic Acids 2001;20:401–10. 257. Norton JC, Piatyszek MA, Wright WE, Shay JW, Corey DR. Inhibition of human telomerase activity by peptide nucleic acids. Nat Biotechnol 1996;14:615–9.

4 Telomere Dysfunction and the DNA Damage Response

125

258. Pitts AE and Corey DR. Inhibition of human telomerase by 20 -O-methyl-RNA. Proc Natl Acad Sci USA 1998;95:11549–54. 259. Djojosubroto MW, Chin AC, Go N, et al. Telomerase antagonists GRN163 and GRN163L inhibit tumor growth and increase chemosensitivity of human hepatoma. Hepatology 2005;42:1127–36. 260. Ozawa T, Gryaznov SM, Hu LJ, et al. Antitumor effects of specific telomerase inhibitor GRN163 in human glioblastoma xenografts. Neuro Oncol 2004;6:218–26. 261. Bearss DJ, Hurley LH, Von Hoff DD. Telomere maintenance mechanisms as a target for drug development. Oncogene 2000;19:6632–41. 262. Zahler AM, Williamson JR, Cech TR, Prescott DM. Inhibition of telomerase by G-quartet DNA structures. Nature 1991;350:718–20. 263. Shay JW. Telomerase in cancer: diagnostic, prognostic, and therapeutic implications. Cancer J Sci Am 1998;4(Suppl 1): S26–34. 264. Veuger SJ, Curtin NJ, Richardson CJ, Smith GC, Durkacz BW. Radiosensitization and DNA repair inhibition by the combined use of novel inhibitors of DNA-dependent protein kinase and poly(ADP-ribose) polymerase-1. Cancer Res 2003;63:6008–15. 265. Zhao Y, Thomas HD, Batey MA, et al. Preclinical evaluation of a potent novel DNAdependent protein kinase inhibitor NU7441. Cancer Res 2006;66:5354–62. 266. Kashishian A, Douanqpanya H, Clark D, et al. DNA-dependent protein kinase inhibitors as drug candidates for the treatment of cancer. Mol Cancer Ther 2003;2:1257–64. 267. Shinohara ET, Geng L, Tan J, et al. DNA-dependent protein kinase is a molecular target for the development of noncytotoxic radiation-sensitizing drugs. Cancer Res 2005;65:4987–92. 268. Ortiz T, Lopez S, Burguillos MA, Edreira A, Pin˜ero J. Radiosensitizer effect of wortmannin in radioresistant bladder tumoral cell lines. Int J Oncol 2004;24:169–75. 269. Stockley M, Clegg W, Fontana G, et al. Synthesis, crystal structure determination, and biological properties of the DNA-dependent protein kinase (DNA-PK) inhibitor 3-cyano6-hydrazonomethyl-5-(4-pyridyl)pyrid-[1H]-2-one (OK-1035). Bioorg Med Chem Lett 2001;11:2837–41. 270. Gupta AK, Cerniglia GJ, Mick R, et al. Radiation sensitization of human cancer cells in vivo by inhibiting the activity of PI3K using LY294002. Int J Radiat Oncol Biol Phys 2003;56:846–53. 271. Bowman KJ, White A, Golding BT, Griffin RJ, Curtin NJ. Potentiation of anti-cancer agent cytotoxicity by the potent poly (ADP-ribose) polymerase inhibitors NU1025 and NU1064. Br J Cancer 1998;78:1269–77. 272. Hickson I, Zhao Y, Richardson CJ, et al. Identification and characterization of a novel and specific inhibitor of the ataxia-telangiectasia mutated kinase ATM. Cancer Res 2004;64:9152–9. 273. Madhusudan S and Hickson ID. DNA repair inhibition: a selective tumour targeting strategy. Trends Mol Med 2005;11:503–11. 274. Willmore E, de Caux S, Sunter NJ, et al. A novel DNA-dependent protein kinase inhibitor, NU7026, potentiates the cytotoxicity of topoisomerase II poisons used in the treatment of leukemia. Blood 2004;103:4659–65. 275. Gupta R and Brosh RM, Jr. DNA repair helicases as targets for anti-cancer therapy. Curr Med Chem 2007;14:503–17.

Chapter 5

Alternative Lengthening of Telomeres in Human Cells Hilda A. Pickett and Roger R. Reddel

Abstract Telomere renewal is a prerequisite for cellular immortalisation. Some cells maintain their telomeres by a telomerase-independent alternative lengthening of telomeres (ALT) mechanism. Characteristic features of most ALT-positive human cells include highly heterogeneous telomere lengths, PML nuclear bodies containing telomeric DNA and telomere-binding proteins, a high frequency of telomeric exchange events, and the presence of extrachromosomal telomeric DNA circles. Numerous proteins involved in DNA recombination, repair and replication also associate with APBs, and proteins involved in homologous recombination are necessary for ALT. These and other data indicate that the mechanism of telomere lengthening in ALT-positive cells may involve recombinationmediated replication of telomeric sequences. Keywords: Telomere, Telomere maintenance mechanism, Alternative lengthening of telomeres, Homologous recombination, ALT-associated PML bodies.

5.1

Introduction

Telomeric DNA is cumulatively lost from the ends of linear chromosomes with each round of cell division due to the end replication problem, ultimately resulting in a limitation of cell proliferative capacity (1). In order to circumvent this limitation, immortal cells with unlimited proliferative potential (including immortal cell lines and tumour cells) require an active telomere maintenance mechanism (TMM). The majority of immortal cells, as well as germline and stem cells, activate the ribonucleoprotein holoenzyme complex telomerase, which comprises the RNA subunit hTR, the reverse transcriptase hTERT and dyskerin (2). Approximately 10 –15% of human tumours utilise a telomerase-independent TMM known as alternative lengthening of telomeres (ALT) (3–5). R.R. Reddel(*) Children’s Medical Research Institute, 214 Hawkesbury Road, Westmead, NSW 2145, and University of Sydney, NSW 2006, Australia, e-mail: [email protected]

K. Hiyama (ed.), Telomeres and Telomerase in Cancer. DOI: 10.1007/978-1-60327-879-9_5, # Humana Press, a part of Springer Science + Business Media, LLC 2009 127

128

H.A. Pickett, R.R. Reddel

The existence of ALT in human cells was deduced from the observation that telomerase-negative cell lines were able to maintain the length of their telomeres for many hundreds of population doublings (3, 5, 6). ALT can occur in many types of cancers, but is particularly prevalent in tumours of mesenchymal origin, such as sarcomas and astrocytomas (7). Further molecular characteristics of the ALT mechanism have since been identified, consistent with a homologous recombination (HR)-dependent repair mechanism. Nevertheless, many of the molecular details of ALT remain elusive. This chapter will describe the characteristics of ALT cells, and what is currently known about the mechanisms responsible for telomerase-independent telomere length maintenance.

5.2

Telomere Length Phenotype

Telomere lengths in the human germline are normally maintained by telomerase at around 15 kb (8, 9). The telomeres of cultured normal human somatic cells shorten at a rate of 40–200 bp per cell division (1). Cells eventually reach a state known as cellular senescence, during which the cells remain metabolically active but cease to divide, and at which point terminal restriction fragment (TRF) lengths are typically between 5 and 8 kb in length (10–12). Telomere shortening and the onset of cellular senescence is thought to be a major barrier to tumorigenesis. Cells which bypass cellular senescence and are ultimately immortal have an active TMM, be it telomerase or ALT. Most of the immortal cell populations utilising an ALT TMM that have been characterised to date show a heterogeneous telomere length phenotype by TRF length analysis (Fig. 5.1), with telomere lengths distributed from very short (<3 kb) to very long (>50 kb) (3, 4, 13–15), in contrast to the much more homogeneous telomere lengths of <10 kb typically displayed by telomerase-positive immortal cells (9, 16, 17). Telomere length heterogeneity can also be visualised by fluorescence in situ hybridisation (FISH) using a fluorochrome-labelled telomere-repeat specific probe (18, 19). ALT cells typically show heterogeneous telomere FISH signals ranging from undetectable to very large (Fig. 5.2), which contrasts with the more homogenous signal intensities seen in telomerase-positive cells (19). The rate at which this heterogeneity is generated was studied by Southern blot analysis, using a plasmid-tagged telomere in clonal populations of a human ALT cell line (13). The type of telomere length changes varied from gradual, with telomeres shortening at a rate comparable to that seen during normal cell telomere erosion, to rapid, involving highly heterogeneous increases in telomere length of both critically short and long telomeres. The rate of telomere length fluctuation has also been assessed by calculating the ratio of p-arm and q-arm telomere fluorescence signal intensities from a marker chromosome in individual metaphases within a clonal population. This produces a characteristic telomere length fluctuation profile that clearly distinguishes ALT-positive and telomerase-positive cell lines (19).

5 Alternative Lengthening of Telomeres in Human Cells Fig. 5.1 Telomere length heterogeneity in ALT cells. Terminal restriction fragment (TRF) length analysis of an ALT cell line (six lanes derived from the same individual) and a telomerasepositive cell line (six lanes derived from the same individual), demonstrating the characteristic telomere lengths of the two telomere maintenance mechanisms. TRF analysis was carried out by digesting genomic DNA with restriction enzymes that do not recognise the telomeric sequence, separating by pulsed field gel electrophoresis and hybridising with a radioactively labelled probe complementary to the telomeric sequence

48kb

12kb

6kb

3kb

ALT

a

129

telomerase

bb

Fig. 5.2 Telomere length phenotype of ALT cells. Fluorescence in situ hybridisation (FISH) using a telomere-specific probe on metaphase chromosomes of (a) ALT and (b) telomerasepositive cells (See Color Insert)

130

5.3

H.A. Pickett, R.R. Reddel

ALT-Associated PML Bodies

Promyelocytic leukaemia protein nuclear bodies (PML-NBs) are discrete nuclear foci that are present in the majority of mammalian cells (20, 21). They are functionally heterogeneous, dynamic, ring-like protein structures, consisting of PML protein and other constitutively or transiently associated proteins (20). PML-NBs are found predominantly in the nucleus and associate with genomic regions that are particularly rich in genes and are transcriptionally active (22). The positional integrity of PML-NBs relative to the nuclear matrix is maintained through extensive protein-based contacts with chromatin fibres (23). PML-NBs change significantly in number, size, position, and biochemical composition during cell cycle progression from G0 to G1, as well as in response to cellular stress. They increase in size in senescent fibroblasts (21). They may also be influenced by the expression, alternative splicing and post-translational modification of PML, for instance by SUMOylation, but so far have eluded biochemical purification. PML-NBs appear to be multi-purpose platforms for numerous cellular processes, having been implicated in the regulation of transcriptional regulation, the induction of apoptosis and cellular senescence, the DNA damage response, cell cycle regulation, tumour suppression, immune and inflammatory responses, antigen presentation, protein refolding and degradation, differentiation, transcriptional regulation and chromatin modification, viral replication and neoangiogenesis (20, 21, 24–31). All of these processes are thought to be facilitated by sequestering and releasing proteins, protein localisation and facilitating protein–protein interactions. ALT-associated PML bodies (APBs) represent a subset of PML-NBs that are specific to ALT cells, and distinguished from other PML-NBs by containing telomeric DNA and telomere-binding proteins (32). They are most reliably detected by immunostaining for PML protein and either TRF1 or TRF2 together with FISH using a telomere-specific probe (see Chap. 16) (Fig. 5.3). Because telomeric DNA and telomere-binding proteins are also colocated at telomeres, the first studies of APBs concentrated on the telomeric DNA/telomere-binding protein aggregates that are much larger than the telomeres within the same cell and thus can be distinguished unambiguously from telomeres. Improvements in microscopy have allowed smaller telomere-sized foci that colocalise with smaller PML bodies to be detected. These small APBs have been characterised by confocal microscopy and are present in a larger proportion of ALT cells (33). APBs also contain proteins involved in DNA recombination, repair and replication, including RAD51, RAD52, replication protein A, RAD51D, MRE11, RAD50, NBS1, BLM, WRN, BRCA1, PARP2, ERCC1, XPF, RAD1, RAD9, RAD17, HUS1 and RIF1 (32, 34–43). APBs were detected in 17/17 ALT cell lines, 0/20 telomerase-positive cell lines and 0/5 mortal cell strains (32). Subsequently, a few exceptions have been noted, including a Werner Syndrome cell line that had large nuclear aggregates containing telomeric DNA and many of the other components of APBs, but not PML (44, 45). In an in vitro model of immortalisation, there was a temporal correlation between the occurrence of APBs and activation of the ALT mechanism (32). APBs can be

5 Alternative Lengthening of Telomeres in Human Cells

131

Fig. 5.3 ALT-associated PML bodies (APBs). Identified by colocalisation of TRF2 (red ) and PML protein (green) and detected by immunostaining of interphase nuclei. Colocalisations are indicated by arrows (See Color Insert)

detected in human tumour specimens, including fine needle aspirates, frozen sections and paraffin-embedded blocks, even after storage for many years (7, 32, 46, 47). There is excellent agreement between the presence of APBs in tumours and the pattern of telomere length heterogeneity that is characteristic of ALT detected by TRF Southern analysis, with concordance being found in 62 of 62 tumours in one study (7) and 75 of 92 tumours in another (47). It has not yet been resolved whether the telomeric DNA detected in APBs is predominantly extrachromosomal or still attached to the chromosome ends. The presence of circular and linear extrachromosomal telomeric repeat (ECTR) DNA is characteristic of ALT cells (48–50) and at least some of the telomeric DNA associated with APBs is extrachromosomal (33). Furthermore, partial enrichment of APBs on sucrose/percoll gradients followed by analysis of their DNA content by two-dimensional gel electrophoresis indicated that APBs preferentially contain the linear form of ECTR DNA (33). DNA damaging agents, hydrogen peroxide and N-methyl-N0 -nitro-N-nitroguanidine, resulted in an ALT-specific induction of linear and circular ECTR and an increase in the proportion of cells containing APBs. These observations suggested the hypothesis that a function of APBs is to sequester linear telomeric DNA and thereby prevent the DNA damage response that would otherwise be elicited by the presence of so many DNA double strand breaks (33). But fluorescence microscopy has revealed that telomeric DNA in ALT cells is able to associate dynamically with other telomeric DNA and also with PML-NBs (51), raising the intriguing possibility that telomeres become located in APBs, at

132

H.A. Pickett, R.R. Reddel

least transiently, as part of the process of ALT-mediated telomere length maintenance. Perhaps APBs act as storage depots for proteins and telomeric DNA involved in the ALT pathway, and as a macromolecular platform that facilitates the process. Approximately 5–10% of asynchronously dividing ALT cell populations contain large APBs (14, 32, 35), suggesting that expression of APBs might be cell cycle related. Indeed, evidence has been presented that APBs are expressed in late S, G2 and M phases of the cell cycle (14, 35). It has subsequently been shown that APBs can be expressed in cells arrested in G1 (52), so their relationship to the cell cycle requires further analysis. Suppression of APB formation was shown following sequestration of the MRE11/RAD50/NBS1 (MRN) DNA repair and recombination protein complex through overexpression of Sp100, despite other PML-NBs remaining unaffected (53). APB suppression was accompanied by repression of the ALT mechanism, as revealed by loss of the characteristic rapid telomere length changes associated with ALT and by progressive telomere shortening at the rate seen in telomerase-negative normal cells (53). The involvement of the MRN complex in APB formation had previously been indicated by a study in which overexpressed dominant-negative NBS1 proteins showed that NBS1, which regulates the response and localisation of the MRN complex to sites of DNA damage, is required for recruitment of a subgroup of proteins into APBs (40). Transient knockdown of any individual component of the MRN complex using small interfering RNAs repressed APB formation (52). The importance of the MRN complex in cells utilising ALT was further demonstrated by a long-term knockdown study (54). Depletion of NBS1 resulted in inhibition of the ALT mechanism, manifested by decreased numbers of APBs and decreased telomere lengths. Knockdown of RAD50 and MRE11, both of which also caused cellular depletion of NBS1, also inhibited ALT (54). As might be expected, PML protein was found to be required for APB formation, as also were the telomere-binding proteins TRF1, TRF2, TIN2, and RAP1 (52). The remaining members of the shelterin complex, POT1 and TPP1, were not examined because of technical problems confirming that knockdown of those proteins had occurred. Intriguingly, Sp100 which, like PML, is a core constituent of PML-NBs was not found to be required for APB formation (52, 53), nor was the DNA damage response protein, 53BP1 (52). These data suggested that APBs are formed by telomeric DNA binding to the MRN complex via a telomere-binding protein such as RAP1, and being translocated to PML-NBs to form APBs. Removal of any component from this cascade chain formed by the TRF1/TIN2/TRF2/RAP1 complex and MRN can block the assembly of APBs, and removal of PML can abolish all forms of PML-NBs including APBs (52). Further insights into the assembly of APBs have been provided by a study of SUMOylation, the process by which the ubiquitin-like protein SUMO is covalently attached to proteins, changing protein–protein interactions. SUMOylation regulates numerous cellular processes including the recruitment of several proteins to PML bodies which is dependent on the SUMO-binding motif of PML (55). The structural

5 Alternative Lengthening of Telomeres in Human Cells

133

maintenance of chromosomes (SMC) 5/6 complex, which is required for efficient repair of DNA damage consists of the SMC5–SMC6 heterodimer and contains the small ubiquitin-like modifier (SUMO) ligase MMS21/NSE1. It was shown that the SUMO ligase of the SMC5/6 complex localises to PML bodies in ALT cells, SUMOylates multiple telomere-binding proteins including TRF1 and TRF2 and that inhibition of their SUMOylation prevents APB formation. Consequently, depletion of SMC5/6 subunits also inhibits APB formation, resulting in ALT repression and implicating a role for SMC5/6-mediated SUMOylation of telomere-binding proteins in telomere length maintenance by ALT (56).

5.4

Telomere Exchange Events in ALT Cells

Another characteristic of ALT cells is the high frequency at which post-replicative telomeric exchanges occur in relation to telomerase-positive cells. Chromosome orientation fluorescence in situ hybridisation (CO-FISH) is a strand-specific hybridisation technique that can be used to identify telomeric exchange events (57–59) (Fig. 5.4). CO-FISH involves the incorporation of BrdU into the newly synthesised DNA strand, which can then be degraded. Hybridisation of a telomere-specific single-stranded probe to metaphase spreads will result in one signal per extremity of a sister chromatid pair unless a telomeric repeat exchange has occurred, in which instance double signals will occur (59). It is important to note, however, that this technique is unable to distinguish between telomere-sister chromatid exchanges (TSCEs), exchanges that occur between telomeres on different chromosomes, or exchanges involving ECTRs. An extensive study of a panel of mortal cell strains, in vitro-immortalised cell lines and cancer-derived cell lines showed that post-replicative telomere-repeat exchanges occurred frequently in ALT cells, but very rarely or never in non-ALT cells (59). The exchange events were specific to telomeric regions and both sister chromatid exchanges (SCEs) and HR events between nontelomeric sequences occurred at a similar frequency in telomerase-positive and ALT cells (59, 60). Telomeric exchange events were not increased in cells derived from Bloom syndrome patients, which have 10- to 12-fold higher levels of SCEs than normal cells (59), indicating the specificity of telomeric repeat exchanges to the ALT mechanism.

5.5

Telomeric Recombination in ALT Cells

The first indication that ALT may involve recombination came from a study of individual telomere lengths in a telomerase-negative human cell line, which found that telomere lengths changed rapidly, consistent with the occurrence of recombination events (13). The first experimental evidence that ALT involves

134

H.A. Pickett, R.R. Reddel BrdU incorporation during S-phase

CCTAACCCTAA GGGATTGGGATT CCTAACCCTAA GGGATTGGGATT

Normal replication CCTAACCCTAA GGGATTGGGATT CCTAACCCTAA GGGATTGGGATT

TTAGGGTTAGGG AATCCCAATCC TTAGGGTTAGGG AATCCCAATCC

Replication with telomeric exchange

Replication with internal sister chromatid exchange

TTAGGGTTAGGG CCTAACCCTAA AATCCCAATCC GGGATTGGGATT

CCTAACCCTAA TTAGGGTTAGGG AATCCCAATCC GGGATTGGGATT

TTAGGGTTAGGG AATCCCAATCC

TTAGGGTTAGGG AATCCCAATCC

TTAGGGTTAGGG AATCCCAATCC

TTAGGGTTAGGG AATCCCAATCC

CCTAACCCTAA GGGATTGGGATT

CCTAACCCTAA GGGATTGGGATT

Nick and digest newly synthesized strands

CCTAACCCTAA

TTAGGGTTAGGG

CCTAACCCTAA

CCTAACCCTAA

AATCCCAATCC TTAGGGTTAGGG

GGGATTGGGATT

AATCCCAATCC

GGGATTGGGATT

GGGATTGGGATT

TTAGGG AATCCC TTAGGG AATCCC

Hybridisation with strand-specific telomere probe

CCTAACCCTAA GGGATTGGGATT CCTAACCCTAA GGGATTGGGATT

TTAGGGTTAGGG CCTAACCCTAA AATCCCAATCC GGGATTGGGATT

TTAGGGTTAGGG CCTAACCCTAA AATCCCAATCC GGGATTGGGATT

TTAGGGTTAGGG AATCCCAATCC

TTAGGGTTAGGG AATCCCAATCC

TTAGGGTTAGGG CCTAACCCTAA AATCCCAATCC GGGATTGGGATT

TTAGGGTTAGGG AATCCCAATCC

CCTAACCCTAA GGGATTGGGATT

Signals in trans-configuration Signals in cis-configuration

Double signals on both chromatids

Fig. 5.4 Detection of postreplicative telomeric exchange events by chromosome orientation FISH (CO-FISH). DNA replication in the presence of BrdU allows degradation of the newly synthesised daughter strands. Hybridisation with telomere-specific single-stranded probes to the G-rich strand (green) and the C-rich strand (red) produces a single red and a single green chromatid signal at each chromosome end. This results in a two-signal hybridisation pattern for each probe, either in trans-configuration following normal replication, or in cis-configuration following replication with an internal sister chromatid exchange. Replication followed by a telomeric exchange results in double signals on both chromatids at one chromosome end (See Color Insert)

recombination-mediated DNA replication was provided by a study in which it was demonstrated that a plasmid DNA tag inserted within the telomere was copied on to other telomeres in cells that use ALT, but not in telomerase-positive cells (61). Copying of the tag on to other telomeres was not observed in ALT cells in which the tag had been inserted subtelomerically (61). The process of inter-telomeric copying was further characterised by telomere variant repeat mapping of the proximal ends of telomeres, which contain degenerate as well as canonical telomere repeats. In ALT cells, a class of complex telomere mutations was identified in clonal cell populations, defined by the replacement of the progenitor telomere, at a discrete fusion point, with a different telomere

5 Alternative Lengthening of Telomeres in Human Cells

135

repeat array (62). In one clone, the fusion point was mapped to within 36 bp of the start of the telomere repeat array and indicates that telomere invasion and copying events can occur anywhere within the telomere including in degenerate variant repeats (62). Little is understood of the requirements a telomere must meet to become a substrate for such recombinational events. Although these events are not restricted to short telomeres (13), it seems likely that deprotection of chromosome ends, either due to a protein-capping defect or due to critically short telomere lengths, may allow recognition by protein repair components necessary for ALT-specific telomeric exchanges. Yeast cells lacking functional telomerase may survive by a recombination-based mechanism of telomere maintenance that appears to be analogous to human ALT (63). In the budding yeast, Saccharomyces cerevisiae, at least two survivor pathways have been identified. Type I survivors have tandem duplications of Y0 subtelomeric elements together with telomeric DNA, whereas type II survivors lack subtelomeric amplification and are characterised by long heterogeneous telomeric repeat extensions (63, 64). Both type I and type II survivors are dependent on RAD52 expression, an essential component of the HR pathway (65). Similarities between the mechanism used by type II survivors, which are also dependent on the RAD50 gene, and the human ALT mechanism further implicate the role of HR in ALT.

5.6

T-Loops and T-Circles

Electron microscopy has revealed that telomeres can exist in loop structures known as t-loops (66), which provide a structural solution to chromosome end protection. T-loops form following invasion by the telomeric single-stranded 30 -overhang into the intra-telomeric duplex DNA, causing a small displacement- or D-loop at the loop–tail junction (66). The size of t-loops closely correlates with the length of the telomere repeat array and in most molecules the loop is very large, sometimes encompassing the whole telomere (66). It is currently unclear whether all telomeres, or just a subset, form t-loops at any one time, and whether these structures persist throughout the cell cycle or form transiently, possibly as intermediates of telomere rapid deletion events (67, 68). Although it is likely that t-loops sequester chromosome ends, preventing them from being recognised by the DNA repair machinery (66, 69), it has also been suggested that they facilitate telomere elongation in ALT cells by forming a ready-made template for extension by DNA replication (70). The telomeres in ALT cells are commonly arranged into t-loops ranging from 0.5 to 70 kb in length (50) (Fig. 5.5a). In addition, the nuclei of human ALT cells contain numerous free DNA circles composed of telomeric repeat DNA, which are called telomeric- or t-circles (50, 68) (Fig. 5.5b). Examination of telomere-enriched cellular fractions by electron microscopy and two-dimensional pulsed field gel electrophoresis (2D PFGE) identified t-circles of up to 57 kb in length in ALT

136

H.A. Pickett, R.R. Reddel

a

b

Fig. 5.5 T-loops and t-circles in ALT cells. Electron microscope (EM) images of (a) a t-loop and (b) an extrachromosomal telomeric DNA circle in telomere-enriched fractions from ALT cells. DNA was prepared for EM by surface spreading with cytochrome c and rotary shadowcasting, with images shown in negative contrast (courtesy of Anthony Cesare and Jack Griffith)

cells (50). The very low abundance of t-circles in telomerase-positive or normal cells makes their presence in ALT cells another marker of the ALT phenotype (33, 50, 68). The close correlation between the size of t-circles and the size of t-loops within ALT cells that was revealed by electron microscopy (50) suggests that t-circles are derived from t-loops, possibly by an HR resolution event. Support for this concept was provided by a study in which expression of a mutant form of TRF2, that presumably causes a telomere capping defect, induced massive and rapid deletions of telomeric DNA, creating t-circles and linear ECTR. This process was dependent on XRCC3, a protein involved in HR, which implicates t-loops as substrates for HR (68). More recently, knockdown of XRCC3 or NBS1 has shown that both of these

5 Alternative Lengthening of Telomeres in Human Cells

137

HR proteins are required for the production of t-circles in human ALT cells (71). Together, these data suggest that t-loops can be resolved into t-circles if normal protective mechanisms are disrupted and that in ALT cells the state of telomere capping is such that t-circle generation occurs at an abnormally high rate. In addition to being a marker for ALT, it has also been suggested that t-circles could be an important part of the ALT mechanism by serving as a template for recombination-mediated telomere lengthening (61). This notion is supported by the roll-and-spread mechanism of telomere maintenance identified in Kluyveromyces lactis, in which small ECTR circles are utilised as a template for rolling circle replication, resulting in extension of telomeres (72, 73). It is interesting to observe that ALT cells are able to continue to proliferate in the absence of detectable t-circles, suggesting that although the occurrence of t-circles correlates with the ALT phenotype, they may not be functional requirements for the mechanism (71). A possible explanation for this could be that ALT may be able to use a wide variety of substrates for HR-mediated DNA replication (Fig. 5.6), including not only both linear and circular ECTR DNA, but also chromosomal telomeric DNA via t-loop formation or inter-telomeric recombination (70). Furthermore, linear ECTR DNA could potentially extend telomeres by end-joining.

5.7

Minisatellite Instability Associated with ALT

The human minisatellite MS32 (D1S8) shows extraordinarily high levels of somatic instability in ALT cell lines compared to normal or telomerase-expressing cell lines, and this also occurs in a significant proportion of ALT-positive soft tissue sarcomas (74). Interestingly, this destabilising effect does not extend to all minisatellites and at this stage has only been identified at MS32 and cannot be explained by sequence similarity to the telomeric repeats. The mutational mechanism responsible is not known, but results from minisatellite variant repeat mapping of MS32 suggest that there may be a dominance of complex inter-allelic exchange events, and have led to the proposal that there may be an overlap between the underlying processes of the ALT pathway and the MS32 instability. An alternative explanation may be that the ALT mechanism itself somehow causes destabilisation of this particular minisatellite.

5.8

Proteins Involved in the ALT Mechanism and its Repression

As discussed above, it has been shown that some of the proteins found in APBs could participate in the ALT mechanism. These include the MRN complex and the SUMOylation complex SMC5/6, depletion of which inhibits ALT (53, 54, 56). Conversely proteins involved in telomere capping and in the response to uncapping, may have an important role in repressing ALT in normal cells. Many of the

138

H.A. Pickett, R.R. Reddel Inter-telomeric //

// Intra-telomeric (t-loop)

// ECTR (circlular)

//

ECTR (linear) //

Fig. 5.6 Homologous recombination dependent replication of telomeres. The 30 telomeric end invades a homologous telomeric repeat array forming a D-loop. The template sequence can be inter-telomeric, intra-telomeric in the form of a t-loop, extrachromosomal circular telomeric repeats or extrachromosomal linear telomeric repeats. It is then proposed that extension of the invading strand occurs by DNA replication. Extension of the other strand may occur in several ways including by lagging strand DNA synthesis using the D-loop as the template. The structure formed may be resolved by branch migration, or alternatively by recombination proteins as a crossover event Modified figure reprinted with permission from Henson et al. (70)

known in vitro-immortalised human ALT cell lines express the simian virus 40 (SV40) large T antigen, which inactivates the p53 and Rb pathways that are vital for the cellular response to telomere uncapping (75). This may result in an increased accessibility of the telomeres to a variety of proteins and in an increased probability of activating ALT. Dysfunctional telomeres may cause the chromosome ends to be identified as double strand breaks, thus recruiting repair by HR.

5 Alternative Lengthening of Telomeres in Human Cells

139

Normal telomere function is facilitated by the shelterin complex comprising six proteins (TRF1, TRF2 and POT1, which directly bind to the telomeric repeat sequence, and the telomere-associated proteins TIN2, TPP1 and RAP1), which have been proposed to form an essential, dynamic complex at human telomeres, protecting the telomeres from being recognised and inappropriately processed by DNA damage machinery (76). Shelterin is capable of DNA remodelling, consequently determining the structure of the telomere terminus (76). It is involved in the formation and stabilisation of the t-loop structure and also in the control of telomere length. The amount of shelterin bound to a telomere is roughly proportional to the length of the TTAGGG repeat array. It seems likely that binding of shelterin to the length of the telomere would provide adequate telomere capping to prevent access by ALT-associated proteins, for instance HR or DNA repair proteins. This is supported by the recent finding that TRF2 and POT1 act independently to repress the ATM and ATR DNA damage response pathways, respectively (77). Since the abundance of shelterin at telomeres is dependent on the length of the duplex telomeric repeat array, short telomeres which contain less TRF2 and POT1 will ultimately lead to cell cycle arrest and inappropriate DNA repair at telomeres, mediated by the ATM and the ATR kinases (77). Shelterin could also potentially maintain the integrity of the t-loop, preventing rolling circle replication and the formation of t-circles or linear ECTR DNA. In ALT cells, the majority of the telomere is commonly not included in the t-loop structure, leaving exposed telomeric DNA (50). If these regions are not stabilised by the shelterin complex, they could become substrates for recombination.

5.9

Does More than One ALT Mechanism Exist?

In some types of telomerase-negative human tumours, especially glioblastoma multiforme and various subtypes of soft tissue sarcoma, characteristic features of the ALT mechanism are often lacking (46, 47, 78). Because of the known existence of inhibitors of the TRAP assay used to detect telomerase activity, it is possible that some of these tumours are actually telomerase positive. However, the possibility that some tumours do not require a TMM, or that there is more than one telomeraseindependent TMM, must also be considered (79). Demonstrating the existence of one or more additional ALT mechanisms in human cells will require proof that telomere length is maintained in the absence of telomerase, and this will be most readily achieved using cell lines in vitro. There are several examples of cell lines that lack one or more of the usual hallmarks of ALT. The SV40 immortalised fibroblast cell line AG11395 has no detectable telomerase activity, and has heterogeneous telomere lengths and extrachromosomal telomeric DNA, and an intra-telomeric DNA tag was copied on to other telomeres as in other ALT-positive cells. Nevertheless, AG11395 cells lack APBs, in contradistinction to most other known ALT cell lines (44, 45). These cells do, however, contain extensive amounts of SV40 sequence, including the SV40 origin of replication, integrated into their telomeric DNA, and it is possible that large T antigen binds to

140

H.A. Pickett, R.R. Reddel

this sequence and directs its accumulation into nuclear aggregates that do not contain PML protein. It therefore remains an open question whether this cell line utilises a variant ALT mechanism. Another very interesting example is the immortalised human cell line C3-cl6 which was derived from a well-known ALT cell line, WI38-VA13/2RA, by transducing it with expression vectors for the telomerase RNA, hTR, and a mutant version of the catalytic subunit of telomerase, hTERT, that retains catalytic activity in vitro but is thought to be incapable of accessing the telomere in vivo. These cells retain an elevated rate of telomeric exchange, but maintain short homogeneous telomere lengths, and lack APBs and ECTR DNA (80). The difficulty in assessing whether cell lines such as this utilise a novel ALT mechanism is that it is currently not known whether any of the markers of ALT are essential for the ALT mechanism. It is therefore at least possible that some of the characteristic features of ALT can be suppressed, without a detrimental effect on the cells. As mentioned above, t-circle formation can be prevented by knockdown of the recombination proteins XRCC3 and NBS1, without significant effect on either cellular growth or, in most cases, telomere length (71). It therefore remains unclear whether a single ALT mechanism exists in human cells, with some of the characteristic telomere-related phenotypic features being dispensible, or whether several mechanisms exist with different genetic dependencies, analogous to the situation in telomerase-negative yeast survivor cells. In order to develop effective TMM-directed anticancer treatments, it will be important to remain aware, firstly of the existence of tumours lacking characteristic features of ALT that nevertheless may possibly be utilising an ALT mechanism, and secondly that treatments which suppress some of the key features of ALT, including APBs, telomere length heterogeneity and t-circles, may either be ineffective in inhibiting the underlying ALT mechanism or possibly induce survivors that use a different ALT mechanism.

5.10

Telomere Maintenance in Normal Mammalian Biology

The hereditary syndrome, dyskeratosis congenita (DC), which is associated with shorter than normal telomeres in somatic tissues, and which may result from mutations in any of the genes encoding components of the core active enzyme complex, has revealed the effects of telomerase deficiency in humans (81). The syndrome predominantly affects tissues with high cellular turnover and which contain cell types that are known to express low levels of telomerase, and it results in mucocutaneous abnormalities, pulmonary fibrosis, gastrointestinal problems, and bone marrow failure (82, 83). It therefore seems that telomerase is required at low levels in highly proliferative tissues to slow down, but not completely prevent, telomere shortening and thereby permit the number of cell divisions required for normal longevity, and that deficiency of telomerase results in premature proliferative exhaustion in one or more of these tissues.

5 Alternative Lengthening of Telomeres in Human Cells

141

It has been proposed that t-loop-primed ALT is the ancestral TMM in eukaryotes, and that it has subsequently been displaced by telomerase (84). However, although there is no published evidence, it remains an interesting possibility that, like telomerase, ALT may also be required for normal human tissue homeostasis. In this view, the levels of ALT activity that occur in tumours and in immortalised cell lines are abnormal and represent the dysregulation of a normal mechanism. This is similar to the situation in telomerase-positive tumours: telomerase is kept under very stringent control in normal cells, but becomes dysregulated during the process of oncogenesis. It seems very likely that at least some of the phenotypic characteristics of ALT found in ALT-positive cell lines, such as extreme telomere length heterogeneity, will not be found in normal cells that utilise the putative regulated version of the ALT mechanism. This means that definitive evidence for ALT in normal cells would most likely require some form of activity assay.

5.11

Repression of Telomerase in ALT-Positive Cell Lines

The notion that a cryptic version of ALT persists in at least some normal human cells is supported by the observation that ALT is activated in human cell lines and in specific types of tumours. Interestingly, in ALT-positive cell lines telomerase is usually absent and this may be due to lack of hTERT expression and in some cases also a lack of hTR. This results from hTERT and hTR promoter methylation (85, 86) or chromatin remodelling of the hTR and hTERT promoters by reduced levels of acetylated histones H3 and H4 and acetylated lysine 9 of H3 (87). In addition, it was found that methylation of Lys20 histone H4 was not linked to gene expression, but was specific to the hTR and hTERT promoters of ALT cells. The significance of this association is not known; however, methylation of Lys20 H4 has been implicated in DNA damage response pathways (88). In the meantime, this finding represents another marker for the ALT phenotype. Forced chromatin remodelling in ALT cells by treatment with 5-azadeoxycytidine in combination with Trichostatin A resulted in the reactivation of hTR and hTERT expression (87). This raises the possibility that chromatin remodelling of the hTR and the hTERT promoters is responsible for their transcriptional state and that some cell types, for instance those of mesenchymal origin, which predominantly use ALT, tightly repress chromatin remodelling processes, thus repressing telomerase activation in favour of ALT activation.

5.12

Coexistence of ALT and Telomerase in the Same Cells

There is no clear example of spontaneous activation of both TMMs within the same cell, although ALT and telomerase activity are able to coexist in human cells. A number of studies have shown that expression of exogenous telomerase in ALT

142

H.A. Pickett, R.R. Reddel

cells is compatible with continued ALT activity. Exogenous hTERT expression in ALT cells that express hTR induces telomerase activity, whereas hTR-negative cells required reintroduction of both hTR and hTERT to induce telomerase activity indicating that sufficient levels of other essential telomerase components are present in these ALT cells (89). It was later shown that expression of exogenous hTERT, or hTR and hTERT, in ALT cells resulted in lengthening of the shortest telomeres, despite the persistence of rapid telomere length fluctuations and APBs, indicating that ALT cells are able to utilise both TMMs without effects on their growth and viability (19, 90–92). In rare clones, expression of telomerase suppresses the phenotypic characteristics of ALT (91). In contrast hybrid clones, created by the fusion of an ALT cell line with telomerase positive tumour cell lines, continued to proliferate without detectable telomerase activity with telomere lengths characteristic of the ALT phenotype (93). In an independent study, telomerase/ALT cell hybrids repressed the ALT phenotype (19). These clones, formed by the fusion of an ALT cell line with two different telomerase positive cell lines were telomerase positive, APB negative and initially showed rapidly decreasing telomere lengths, followed by rates of telomere erosion comparable with normal cells and finally telomere length maintenance (19). ALT/normal hybrids formed by fusion of an ALT cell line with normal fibroblasts underwent a rapid reduction in telomeric DNA before entering a senescent-like state (94). These data indicate that normal cells and many telomerase-positive cells contain a factor or factors that repress the ALT mechanism and that ALT can only be active in cells that lack these repressive elements (19, 94). Expression of exogenous telomerase in ALT cells, in which the ALT mechanism has been established and presumably any repressive elements have been lost, allows for coexistence of the two TMMs. However, as yet, no ALT repressors have been identified.

5.13

ALT in Human Tumours

All immortalised cell lines analysed to date utilise a single TMM, be it ALT or telomerase. In tumours, however, the situation is more complex. Despite approximately 85% of tumours having telomerase activity (95), it cannot be presumed that the other 15% use ALT. In fact, it is not clear whether activation of a TMM and immortalisation are necessary for all tumours. Further complications in TMM classification arise from the detection of both ALT and telomerase activity in some tumours (4, 7, 78, 96). It is not known if this reflects intra-tumoural heterogeneity with some areas of the tumour being telomerase positive and other areas using ALT, or whether these two mechanisms are coexisting within the same tumour cells. ALT has been described in osteosarcoma, soft tissue sarcoma, glioblastoma multiforme, renal cell carcinoma, adrenocortical carcinoma, breast carcinoma, nonsmall cell carcinoma of the lung and ovarian carcinoma (97), and appears to be

5 Alternative Lengthening of Telomeres in Human Cells

143

most common in tumours of mesenchymal origin, such as soft tissue sarcomas and osteosarcomas (7). ALT also occurs frequently in Li–Fraumeni syndrome (LFS) immortal cell lines (4). LFS patients inherit a mutant allele of the p53 tumour suppressor gene, which is involved in HR and the cellular response to telomere uncapping (75). Interestingly, sarcomas feature in the tumour spectrum presented by LFS patients and it has been suggested that the slower cellular turnover and accompanying low rate of telomere shortening in mesenchymal compartments may produce tighter repression of telomerase, consequently resulting in a higher probability of ALT activation (70).

5.14

Concluding Remarks

The prevalence of ALT in tumours derived from tissues of mesenchymal origin as well as its detection in numerous other cancers, combined with the persistent concern that treatment of cancers with telomerase inhibitors may provoke ALT activation, highlight the necessity for a comprehensive understanding of this TMM. Telomere length heterogeneity (detected by TRF analysis or telomere FISH), and the presence of APBs are the phenotypic features used most often to identify cells that are ALT-positive. Other features characteristic of ALT include an increased frequency of telomeric exchanges, rapid fluctuation of telomere length, the presence of abundant extrachromosomal telomeric DNA (including t-circles), and instability of the minisatellite MS32. Despite the existence of so many markers for ALT, however, at present the only definitive method for demonstrating that cells use an ALT mechanism is to show that the length of their telomeres is maintained over many population doublings in the absence of telomerase. There is a need for a rapid assay of ALT activity that can be used for purposes that include testing candidate genes and screening for molecules that inhibit ALT. This chapter describes the current understanding of ALT. In particular, ALT is suppressed by sequestration or knockdown of the MRN recombination complex, and modification of the telomere-binding proteins TRF1 and TRF2 by SUMOylation is required for APB formation and ALT activity. APBs sequester linear telomeric DNA and are also able to associate dynamically with other telomeric DNA. Accumulating experimental data suggest that APBs may have a role in the ALT mechanism, and APBs contain molecules that are known or predicted to be required for ALT, including telomeric DNA, and DNA repair proteins including proteins involved in recombination. Although details of what is required for ALT activity are starting to come into view, what remains elusive is how the mechanism is repressed in normal cells and activated in a subset of cancers. Increased knowledge of the mechanism and how it is controlled will widen the scope for finding appropriate drug targets that will enable development of ALT inhibitors for cancer therapy.

144

H.A. Pickett, R.R. Reddel

Acknowledgements Work in the authors’ laboratory is supported by a Fellowship from Promina to HAP, a Fellowship from the National Health and Medical Research Council of Australia to RR, and a Program Grant from the Cancer Council New South Wales. The authors thank L. Colgin, A. Cesare, A. Neumann, J. Henson and E. Collins for their comments on the manuscript and assistance in its preparation.

References 1. Harley CB, Futcher AB, Greider CW. Telomeres shorten during ageing of human fibroblasts. Nature 1990;345:458–460. 2. Cohen SB, Graham ME, Lovrecz GO, Bache N, Robinson PJ, Reddel RR. Protein composition of catalytically active human telomerase from immortal cells. Science 2007;315:1850–1853. 3. Bryan TM, Englezou A, Gupta J, Bacchetti S, Reddel RR. Telomere elongation in immortal human cells without detectable telomerase activity. EMBO J 1995;14:4240–4248. 4. Bryan TM, Englezou A, Dalla-Pozza L, Dunham MA, Reddel RR. Evidence for an alternative mechanism for maintaining telomere length in human tumors and tumor-derived cell lines. Nat Med 1997;3:1271–1274. 5. Bryan TM, Reddel RR. Telomere dynamics and telomerase activity in in vitro immortalised human cells. Eur J Cancer 1997;33:767–773. 6. Rogan EM, Bryan TM, Hukku B, Maclean K, Chang ACM, Moy EL, et al. Alterations in p53 and p16INK4 expression and telomere length during spontaneous immortalization of Li-Fraumeni syndrome fibroblasts. Mol Cell Biol 1995;15:4745–4753. 7. Henson JD, Hannay JA, McCarthy SW, Royds JA, Yeager TR, Robinson RA, et al. A robust assay for alternative lengthening of telomeres (ALT) in tumors demonstrates the significance of ALT in sarcomas and astrocytomas. Clin Cancer Res 2005;11:217–225. 8. Allshire RC, Dempster M, Hastie ND. Human telomeres contain at least three types of G-rich repeat distributed non-randomly. Nucleic Acids Res 1989;17:4611–4627. 9. de Lange T, Shiue L, Myers RM, Cox DR, Naylor SL, Killery AM, et al. Structure and variability of human chromosome ends. Mol Cell Biol 1990;10:518–527. 10. Harley CB. Human ageing and telomeres. Ciba Found Symp 1997;211:129–144. 11. Martens UM, Chavez EA, Poon SS, Schmoor C, Lansdorp PM. Accumulation of short telomeres in human fibroblasts prior to replicative senescence. Exp Cell Res 2000;256:291–299. 12. Wright WE, Tesmer VM, Huffman KE, Levene SD, Shay JW. Normal human chromosomes have long G-rich telomeric overhangs at one end. Genes Dev 1997;11:2801–2809. 13. Murnane JP, Sabatier L, Marder BA, Morgan WF. Telomere dynamics in an immortal human cell line. EMBO J 1994;13:4953–4962. 14. Grobelny JV, Godwin AK, Broccoli D. ALT-associated PML bodies are present in viable cells and are enriched in cells in the G2/M phase of the cell cycle. J Cell Sci 2000;113:4577– 4585. 15. Opitz OG, Suliman Y, Hahn WC, Harada H, Blum HE, Rustgi AK. Cyclin D1 overexpression and p53 inactivation immortalize primary oral keratinocytes by a telomerase-independent mechanism. J Clin Invest 2001;108:725–732. 16. Hastie ND, Dempster M, Dunlop MG, Thompson AM, Green DK, Allshire RC. Telomere reduction in human colorectal carcinoma and with ageing. Nature 1990;346:866–868. 17. Counter CM, Avilion AA, LeFeuvre CE, Stewart NG, Greider CW, Harley CB, et al. Telomere shortening associated with chromosome instability is arrested in immortal cells which express telomerase activity. EMBO J 1992;11:1921–1929.

5 Alternative Lengthening of Telomeres in Human Cells

145

18. Lansdorp PM, Poon S, Chavez E, Dragowska V, Zijlmans M, Bryan T, et al. Telomeres in the hematopoietic system. In: Chadwick DJ, Cardew G, editors. Telomeres and Telomerase. West Sussex: Wiley, 1997:209–218. 19. Perrem K, Colgin LM, Neumann AA, Yeager TR, Reddel RR. Coexistence of alternative lengthening of telomeres and telomerase in hTERT-transfected GM847 cells. Mol Cell Biol 2001;21:3862–3875. 20. Bernardi R, Pandolfi PP. Structure, dynamics and functions of promyelocytic leukaemia nuclear bodies. Nat Rev Mol Cell Biol 2007;8:1006–1016. 21. Jiang WQ, Ringertz N. Altered distribution of the promyelocytic leukemia-associated protein is associated with cellular senescence. Cell Growth Differ 1997;8:513–522. 22. Wang J, Shiels C, Sasieni P, Wu PJ, Islam SA, Freemont PS, et al. Promyelocytic leukemia nuclear bodies associate with transcriptionally active genomic regions. J Cell Biol 2004;164:515–526. 23. Eskiw CH, Dellaire G, Bazett-Jones DP. Chromatin contributes to structural integrity of PML bodies through a SUMO-1-independent mechanism. J Biol Chem 2004;279:9577– 9585. 24. Zhong S, Salomoni P, Pandolfi PP. The transcriptional role of PML and the nuclear body. Nat Cell Biol 2000;2:E85–E90. 25. Dellaire G, Bazett-Jones DP. PML nuclear bodies: dynamic sensors of DNA damage and cellular stress. BioEssays 2004;26:963–977. 26. Bernardi R, Pandolfi PP. Role of PML and the PML-nuclear body in the control of programmed cell death. Oncogene 2003;22:9048–9057. 27. Ferbeyre G. PML a target of translocations in APL is a regulator of cellular senescence. Leukemia 2002;16:1918–1926. 28. Narita M, Nunez S, Heard E, Narita M, Lin AW, Hearn SA, et al. Rb-mediated heterochromatin formation and silencing of E2F target genes during cellular senescence. Cell 2003;113:703–716. 29. Bischof O, Kirsh O, Pearson M, Itahana K, Pelicci PG, Dejean A. Deconstructing PMLinduced premature senescence. EMBO J 2002;21:3358–3369. 30. Dellaire G, Ching RW, Ahmed K, Jalali F, Tse KC, Bristow RG, et al. Promyelocytic leukemia nuclear bodies behave as DNA damage sensors whose response to DNA doublestrand breaks is regulated by NBS1 and the kinases ATM, Chk2, and ATR. J Cell Biol 2006;175:55–66. 31. Kim JM, Nakao K, Nakamura K, Saito I, Katsuki M, Arai KI, et al. Inactivation of Cdc7 kinase in mouse ES cells results in S-phase arrest and p53-dependent cell death. EMBO J 2002;21:2168–2179. 32. Yeager TR, Neumann AA, Englezou A, Huschtscha LI, Noble JR, Reddel RR. Telomerasenegative immortalized human cells contain a novel type of promyelocytic leukemia (PML) body. Cancer Res 1999;59:4175–4179. 33. Fasching CL, Neumann AA, Muntoni A, Yeager TR, Reddel RR. DNA damage induces alternative lengthening of telomeres (ALT) associated promyelocytic leukemia bodies that preferentially associate with linear telomeric DNA. Cancer Res 2007;67:7072–7077. 34. Tarsounas M, Munoz P, Claas A, Smiraldo PG, Pittman DL, Blasco MA, et al. Telomere maintenance requires the RAD51D recombination/repair protein. Cell 2004;117: 337–347. 35. Wu G, Lee WH, Chen PL. NBS1 and TRF1 colocalize at promyelocytic leukemia bodies during late S/G2 phrases in immortalized telomerase-negative cells. Implication of NBS1 in alternative lengthening of telomeres. J Biol Chem 2000;275:30618–30622. 36. Zhu XD, Kuster B, Mann M, Petrini JH, de Lange T. Cell-cycle-regulated association of RAD50/MRE11/NBS1 with TRF2 and human telomeres. Nat Genet 2000;25:347–352. 37. Yankiwski V, Marciniak RA, Guarente L, Neff NF. Nuclear structure in normal and Bloom syndrome cells. Proc Natl Acad Sci USA 2000;97:5214–5219.

146

H.A. Pickett, R.R. Reddel

38. Stavropoulos DJ, Bradshaw PS, Li X, Pasic I, Truong K, Ikura M, et al. The Bloom syndrome helicase BLM interacts with TRF2 in ALT cells and promotes telomeric DNA synthesis. Hum Mol Genet 2002;11:3135–3144. 39. Johnson FB, Marciniak RA, McVey M, Stewart SA, Hahn WC, Guarente L. The Saccharomyces cerevisiae WRN homolog Sgs1p participates in telomere maintenance in cells lacking telomerase. EMBO J 2001;20:905–913. 40. Wu G, Jiang X, Lee WH, Chen PL. Assembly of functional ALT-associated promyelocytic leukemia bodies requires Nijmegen breakage syndrome 1. Cancer Res 2003;63:2589–2595. 41. Dantzer F, Giraud-Panis MJ, Jaco I, Ame JC, Schultz I, Blasco M, et al. Functional interaction between poly(ADP-Ribose) polymerase 2 (PARP-2) and TRF2: PARP activity negatively regulates TRF2. Mol Cell Biol 2004;24:1595–1607. 42. Nabetani A, Yokoyama O, Ishikawa F. Localization of hRad9, hHus1, hRad1 and hRad17, and caffeine-sensitive DNA replication at ALT (alternative lengthening of telomeres)associated promyelocytic leukemia body. J Biol Chem 2004;279:25849–25857. 43. Silverman J, Takai H, Buonomo SB, Eisenhaber F, de Lange T. Human Rif1, ortholog of a yeast telomeric protein, is regulated by ATM and 53BP1 and functions in the S-phase checkpoint. Genes Dev 2004;18:2108–2119. 44. Fasching CL, Bower K, Reddel RR. Telomerase-independent telomere length maintenance in the absence of ALT-associated PML bodies. Cancer Res 2005;65:2722–2729. 45. Marciniak RA, Cavazos D, Montellano R, Chen Q, Guarente L, Johnson FB. A novel telomere structure in human alternative lengthening of telomeres cell line. Cancer Res 2005;65:2730–2737. 46. Johnson JE, Varkonyi RJ, Schwalm J, Cragle R, Klein-Szanto A, Patchefsky A, et al. Multiple mechanisms of telomere maintenance exist in liposarcomas. Clin Cancer Res 2005;11:5347–5355. 47. Costa A, Daidone MG, Daprai L, Villa R, Cantu S, Pilotti S, et al. Telomere maintenance mechanisms in liposarcomas: association with histologic subtypes and disease progression. Cancer Res 2006;66:8918–8924. 48. Tokutake Y, Matsumoto T, Watanabe T, Maeda S, Tahara H, Sakamoto S, et al. Extrachromosome telomere repeat DNA in telomerase-negative immortalized cell lines. Biochem Biophys Res Commun 1998;247:765–772. 49. Ogino H, Nakabayashi K, Suzuki M, Takahashi EI, Fujii M, Suzuki T, et al. Release of telomeric DNA from chromosomes in immortal human cells lacking telomerase activity. Biochem Biophys Res Commun 1998;248:223–227. 50. Cesare AJ, Griffith JD. Telomeric DNA in ALT cells is characterized by free telomeric circles and heterogeneous T-loops. Mol Cell Biol 2004;24:9948–9957. 51. Molenaar C, Wiesmeijer K, Verwoerd NP, Khazen S, Eils R, Tanke HJ, et al. Visualizing telomere dynamics in living mammalian cells using PNA probes. EMBO J 2003;22:6631– 6641. 52. Jiang WQ, Zhong ZH, Henson JD, Reddel RR. Identification of candidate alternative lengthening of telomeres genes by methionine restriction and RNA interference. Oncogene 2007;26:4635–4647. 53. Jiang WQ, Zhong ZH, Henson JD, Neumann AA, Chang AC, Reddel RR. Suppression of alternative lengthening of telomeres by Sp100-mediated sequestration of MRE11/RAD50/ NBS1 complex. Mol Cell Biol 2005;25:2708–2721. 54. Zhong ZH, Jiang WQ, Cesare AJ, Neumann AA, Wadhwa R, Reddel RR. Disruption of telomere maintenance by depletion of the MRE11/RAD50/NBS1 complex in cells that use alternative lengthening of telomeres. J Biol Chem 2007;282:29314–29322. 55. Lin DY, Huang YS, Jeng JC, Kuo HY, Chang CC, Chao TT, et al. Role of SUMO-interacting motif in Daxx SUMO modification, subnuclear localization, and repression of sumoylated transcription factors. Mol Cell 2006;24:341–354. 56. Potts PR, Yu H. The SMC5/6 complex maintains telomere length in ALT cancer cells through SUMOylation of telomere-binding proteins. Nat Struct Mol Biol 2007;14:581–590.

5 Alternative Lengthening of Telomeres in Human Cells

147

57. Meyne J, Goodwin EH, Moyzis RK. Chromosome localization and orientation of the simple sequence repeat of human satellite I DNA. Chromosoma 1994;103:99–103. 58. Bailey SM, Goodwin EH, Cornforth MN. Strand-specific fluorescence in situ hybridization: the CO-FISH family. Cytogenet Genome Res 2004;107:14–17. 59. Londono-Vallejo JA, Der-Sarkissian H, Cazes L, Bacchetti S, Reddel RR. Alternative lengthening of telomeres is characterized by high rates of telomeric exchange. Cancer Res 2004;64:2324–2327. 60. Bechter OE, Zou Y, Shay JW, Wright WE. Homologous recombination in human telomerase-positive and ALT cells occurs with the same frequency. EMBO Rep 2003;4:1138–1143. 61. Dunham MA, Neumann AA, Fasching CL, Reddel RR. Telomere maintenance by recombination in human cells. Nat Genet 2000;26:447–450. 62. Varley H, Pickett HA, Foxon JL, Reddel RR, Royle NJ. Molecular characterization of intertelomere and intra-telomere mutations in human ALT cells. Nat Genet 2002;30:301–305. 63. Lundblad V, Blackburn EH. An alternative pathway for yeast telomere maintenance rescues est1 senescence. Cell 1993;73:347–360. 64. Chen Q, Ijpma A, Greider CW. Two survivor pathways that allow growth in the absence of telomerase are generated by distinct telomere recombination events. Mol Cell Biol 2001;21:1819–1827. 65. Teng SC, Zakian VA. Telomere-telomere recombination is an efficient bypass pathway for telomere maintenance in Saccharomyces cerevisiae. Mol Cell Biol 1999;19:8083–8093. 66. Griffith JD, Comeau L, Rosenfield S, Stansel RM, Bianchi A, Moss H, et al. Mammalian telomeres end in a large duplex loop. Cell 1999;97:503–514. 67. Lustig AJ. Clues to catastrophic telomere loss in mammals from yeast telomere rapid deletion. Nat Rev Cancer 2003;4:916–923. 68. Wang RC, Smogorzewska A, de Lange T. Homologous recombination generates T-loopsized deletions at human telomeres. Cell 2004;119:355–368. 69. Stansel RM, de Lange T, Griffith JD. T-loop assembly in vitro involves binding of TRF2 near the 30 telomeric overhang. EMBO J 2001;20:5532–5540. 70. Henson JD, Neumann AA, Yeager TR, Reddel RR. Alternative lengthening of telomeres in mammalian cells. Oncogene 2002;21:598–610. 71. Compton SA, Choi JH, Cesare AJ, Ozgur S, Griffith JD. Xrcc3 and Nbs1 are required for the production of extrachromosomal telomeric circles in human alternative lengthening of telomere cells. Cancer Res 2007;67:1513–1519. 72. Natarajan S, Groff-Vindman C, McEachern MJ. Factors influencing the recombinational expansion and spread of telomeric tandem arrays in Kluyveromyces lactis. Eukaryot Cell 2003;2:1115–1127. 73. Natarajan S, McEachern MJ. Recombinational telomere elongation promoted by DNA circles. Mol Cell Biol 2002;22:4512–4521. 74. Jeyapalan JN, Varley H, Foxon JL, Pollock RE, Jeffreys AJ, Henson JD, et al. Activation of the ALT pathway for telomere maintenance can affect other sequences in the human genome. Hum Mol Genet 2005;14:1785–1794. 75. Smogorzewska A, de Lange T. Different telomere damage signaling pathways in human and mouse cells. EMBO J 2002;21:4338–4348. 76. de Lange T. Shelterin: the protein complex that shapes and safeguards human telomeres. Genes Dev 2005;19:2100–2110. 77. Denchi EL, de Lange T. Protection of telomeres through independent control of ATM and ATR by TRF2 and POT1. Nature 2007;448:1068–1071. 78. Hakin-Smith V, Jellinek DA, Levy D, Carroll T, Teo M, Timperley WR, et al. Alternative lengthening of telomeres and survival in patients with glioblastoma multiforme. Lancet 2003;361:836–838. 79. Reddel RR. The role of senescence and immortalization in carcinogenesis. Carcinogenesis 2000;21:477–484.

148

H.A. Pickett, R.R. Reddel

80. Cerone MA, Autexier C, Londono-Vallejo JA, Bacchetti S. A human cell line that maintains telomeres in the absence of telomerase and of key markers of ALT. Oncogene 2005;24:7893–78901. 81. Collins K, Mitchell JR. Telomerase in the human organism. Oncogene 2002;21:564–579. 82. Marrone A, Stevens D, Vulliamy T, Dokal I, Mason PJ. Heterozygous telomerase RNA mutations found in dyskeratosis congenita and aplastic anemia reduce telomerase activity via haploinsufficiency. Blood 2004;104:3936–3942. 83. Marrone A, Walne A, Tamary H, Masunari Y, Kirwan M, Beswick R, et al. Telomerase reverse transcriptase homozygous mutations in autosomal recessive dyskeratosis congenita and Hoyeraal–Hreidarsson syndrome. Blood 2007;110:4198–4205. 84. de Lange T. T-loops and the origin of telomeres. Nat Rev Mol Cell Biol 2004;5(4):323–329. 85. Dessain SK, Yu H, Reddel RR, Beijersbergen RL, Weinberg RA. Methylation of the human telomerase gene CpG island. Cancer Res 2000;60:537–541. 86. Hoare SF, Bryce LA, Wisman GB, Burns S, Going JJ, van der Zee AG, et al. Lack of telomerase RNA gene hTERC expression in alternative lengthening of telomeres cells is associated with methylation of the hTERC promoter. Cancer Res 2001;61:27–32. 87. Atkinson SP, Hoare SF, Glasspool RM, Keith WN. Lack of telomerase gene expression in alternative lengthening of telomere cells is associated with chromatin remodeling of the hTR and hTERT gene promoters. Cancer Res 2005;65:7585–7590. 88. Sanders SL, Portoso M, Mata J, Bahler J, Allshire RC, Kouzarides T. Methylation of histone H4 lysine 20 controls recruitment of Crb2 to sites of DNA damage. Cell 2004;119:603–614. 89. Wen J, Cong YS, Bacchetti S. Reconstitution of wild-type or mutant telomerase activity in telomerase negative immortal human cells. Hum Mol Genet 1998;7:1137–1141. 90. Cerone MA, Londono-Vallejo JA, Bacchetti S. Telomere maintenance by telomerase and by recombination can coexist in human cells. Hum Mol Genet 2001;10:1945–1952. 91. Ford LP, Zou Y, Pongracz K, Gryaznov SM, Shay JW, Wright WE. Telomerase can inhibit the recombination-based pathway of telomere maintenance in human cells. J Biol Chem 2001;276:32198–32203. 92. Grobelny JV, Kulp-McEliece M, Broccoli D. Effects of reconstitution of telomerase activity on telomere maintenance by the alternative lengthening of telomeres (ALT) pathway. Hum Mol Genet 2001;10:1953–1961. 93. Katoh M, Katoh M, Kameyama M, Kugoh H, Shimizu M, Oshimura M. A repressor function for telomerase activity in telomerase-negative immortal cells. Mol Carcinog 1998;21:17–25. 94. Perrem K, Bryan TM, Englezou A, Hackl T, Moy EL, Reddel RR. Repression of an alternative mechanism for lengthening of telomeres in somatic cell hybrids. Oncogene 1999; 18:3383–3390. 95. Shay JW, Bacchetti S. A survey of telomerase activity in human cancer. Eur J Cancer 1997;33:787–791. 96. Ulaner GA, Huang HY, Otero J, Zhao Z, Ben-Porat L, Satagopan JM, et al. Absence of a telomere maintenance mechanism as a favorable prognostic factor in patients with osteosarcoma. Cancer Res 2003;63:1759–1763. 97. Reddel RR. Alternative lengthening of telomeres, telomerase, and cancer. Cancer Lett 2003;194:155–162.

Chapter 6

Mouse Model: Telomeres and Telomerase in Stem Cell and Cancer Xin Huang and Zhenyu Ju

Abstract Ageing is characterized by declines of adult stem cell function and regenerative reserves. The telomere has been regarded as a mitotic clock that controls cellular ageing. Telomeres are nucleoprotein complexes that consist of simple DNA repeats and associated binding proteins. In the absence of telomerase activity, telomere shortening occurs with each round of cell division. Critically short telomeres (dysfunctional telomeres) can be detected as DNA double strand breaks, thus activating DNA damage pathway and lead to cell cycle arrest, or, in some cases, apoptosis. Independent lines of evidence indicate that telomere dysfunction induces both cell intrinsic checkpoint and cell extrinsic checkpoint leading to an age-associated stem cell dysfunction. Genetically modified mice lacking telomerase activity proved an invaluable model for probing the in vivo consequences of replicative senescence and telomere-based stem cell ageing. Disturbing genes that regulate DNA damage checkpoints in response to telomere dysfunction partially rescued the degenerative phenotypes and ageing of adult stem cells, but in some cases increased tumorigenesis. Emerging evidence indicates that fine-tuning DNA damage checkpoints in response to telomere dysfunction could improve adult stem cell function, and meanwhile keep the tumor suppression mechanisms intact. Therefore, understanding the in vivo function of genes regulating telomere dysfunction during ageing could have important implication for regenerative medicine and cancer therapies. Keywords: Telomere, Stem cell, Cancer.

Z. Ju(*) Institute of Laboratory Animal Sciences and Max-Planck-Partner-Group-Program on Stem Cell and Aging, Chinese Academy of Medical Sciences, Chaoyang District, Panjiayuan Nanli 5, Beijing 100021, Peoples’ Republic of China, e‐mail: [email protected] K. Hiyama (ed.), Telomeres and Telomerase in Cancer. DOI: 10.1007/978-1-60327-879-9_6, # Humana Press, a part of Springer Science + Business Media, LLC 2009 149

150

6.1 6.1.1

X. Huang, Z. Ju

Introduction Telomeres and Telomerase

Each end of a chromosome is capped by a special nucleoprotein complex, termed as telomere, consisting of noncoding TTAGGG double strand repeats, a 30 single strand overhang, and associated telomere-binding proteins (1). Without the capping of telomeres, the opened chromosome ends can be recognized as double-strand DNA breaks (DSB), leading to nuclease degradation, DNA repair activities, and chromosome fusion (2). To maintain the chromosome integrity and genetic stability, telomere form a structure that physically hides the 30 -overhang. The current model of telomere structure is that the 30 -overhang folds back and invades the double-stranded telomeric DNA to form a T-loop and a D-loop (3). This specialized structure protects telomeric DNA from inappropriate nonhomologous end joining (NHEJ) - and homologous recombination (HR)-mediated DNA repair processes. The length of the double-stranded TTAGGG track varies from about 10 kb at human telomeres to more than 40 kb in some mouse inbreed strains (4). In primary human cells, telomeres shorten with each round of cell division (5), which is due to the end-replication problem of DNA polymerase (6), postreplication processing of telomere ends (7), and additional factors including reactive oxygen species (ROS) (8). In vitro, critically short telomeres activate DNA damage responses including a permanent cell cycle arrest termed ‘‘replicative senescence’’ (9). The most upstream response at dysfunctional telomere is the formation of DNA-damage foci, which activate ATM/ATR signaling (10), through a central component – p53 (11), and its downstream target p21 initiates cellular senescence or apoptosis (12). To counter the telomere attrition a reverse transcriptase enzyme called telomerase is required, which adds TTAGGG repeats onto the existing telomeres (13). Telomerase comprises two essential subunits: the catalytic protein subunit – telomerase reverse transcriptase gene (TERT) and the RNA subunit (TERC) that serves as the template for telomere addition (14, 15). As a main regulator of telomere length in mammalian cells, telomerase activity is tightly regulated, displaying a strict developmental and tissue-specific pattern. Telomerase is active during embryogenesis and suppressed in most tissues after birth (16). Ectopic expression of human TERT (hTERT) in cultured primary fibroblasts reconstitutes telomerase activity and allows immortal cell growth (17). In contrast to somatic cells, most human stem and progenitor cells show low levels of telomerase activity (18). The telomerase activity in stem cells might be required to fulfill this challenge of constant cell turnover during their lifetime. However, the low level of telomerase activity seems to be insufficient to maintain the telomere length during ageing and extensive cell replication (19–21).

6.1.2

Telomeres and Telomerase in Stem Cell

Given the importance of adult stem cells in regenerating tissues over the lifespan, the overall decline of regenerative potential with age might be attributed to the functional decline of ageing stem cells (22). Mounting evidence suggests that adult stem cells

6 Mouse Model: Telomeres and Telomerase in Stem Cell and Cancer

151

do age and telomere shortening represents one of the causes in this process, especially in highly proliferative organs (23, 24). As a model system, hematopoietic stem cells (HSCs) showed telomere shortening during replicative aging in vivo despite the readily detectable levels of telomerase in these cells (21, 25). Serial transplantation, as one of the gold standards for assessing the self-renewal capacity of HSCs, revealed that telomere shortening plays a causal role in limiting the self-renewal ability of HSCs. Wild-type mice HSCs could be serially transplanted for at least four rounds, whereas telomerase-deficient HSCs could be serially transplanted for only two rounds (26). The rate of telomere shortening of telomerase-deficient HSCs was increased approximately twofold during serial transplantation compared to wild-type HSCs (26). These findings were in line with the hypothesis that one role for telomerase in the HSCs is to partially counter the rate of telomere shortening during division of HSCs, thereby preventing premature loss of telomere function and providing added replicative capacity. However, overexpression of telomerase could stabilize the telomere attrition during the serial transplantation but could not extend the transplantation above four rounds suggesting other mechanisms limit HSCs self-renewal capacity (27). Another key aspect of adult stem cells in organ homeostasis is their ability to mobilize out of the niches and enter the cell cycle under condition of stress or tissue regeneration. Mouse experiments indicate that telomere shortening inhibited mobilization of stem cells out of their niche, impaired hair growth, and resulted in suppression of stem cell proliferative capacity in vitro (28). Furthermore, Tert overexpression in the absence of changes in telomere length promoted stem cell mobilization and stem cell proliferation indicating that the catalytic component of telomerase mobilized epidermal stem cells out of their niche independent of its role in maintaining telomere length (28). In somatic cells, low levels of telomere dysfunction induce p53-dependent senescence checkpoint, whereas high levels of telomere dysfunction induce p53independent apoptosis (29). Whether stem cells also use this two-stage checkpoint model has not been clearly demonstrated. Deletion of p53 rescues germ cell apoptosis in telomere dysfunctional mice (11). However, embryonic stem cells are more resistant to DNA damage and activate different checkpoints as compared with somatic cells (30, 31). Therefore, it seems possible that different checkpoint responses might exist between somatic cells and stem cells in response to telomere dysfunction. Telomerase activity differs in various developmental stages of different types of stem cells. For example, in the developmental characteristics, telomerase activity associates most consistently with self-renewal potential rather than the cell cycle distribution or differentiation state (32). Furthermore, in human mesenchymal stem cells telomerase activity is not detectable (33), which is different from other adult stem cell compartments such as skin, gut, and hematopoietic systems. Telomere shortening triggers DNA damage response pathways including cell cycle arrest or apoptosis, to control the proliferation or eliminate the cells with severe telomere dysfunction. The consequences of this process for stem cells can be either depletion of stem cell reserves or altered gene expression profiles, which push the stem cell into premature differentiation or malignant transformation. It has been proposed that the quiescent status of stem cells results in attenuation of

152

X. Huang, Z. Ju

checkpoint control and DNA damage responses for repair or apoptosis, and thus permits DNA damage accumulation during ageing (34). When aged stem cells with dysfunctional telomeres are called into cell cycle under conditions of stress or tissue regeneration, the DNA damage responses will be activated and severely affect their self-renewal capacity. Suppressing the proliferation of damaged stem cells represents a fundamental tumor inhibition mechanism. However, the cytoprotection afforded by stem cell quiescence in stress-free, steady-state conditions allows the accumulation of dangerous lesions, and permits the transformation of aged stem cells into cancer stem cells upon loss of DNA damage checkpoint controls.

6.1.3

Telomeres and Telomerase in Cancer Stem Cell

Telomere shortening appears to be a two-edged sword in cancer formation. First, telomere shortening induces chromosomal instability that plays a critical role in tumor initiation. Second, telomere shortening induces replicative senescence that represents one of the major tumor suppression mechanisms. The dual role of telomere shortening interconnects with telomerase activation, which is required for further tumor progression next to the initiation of microscopic tumor (35). Activation of telomerase is to stabilize telomere attrition caused by rampant tumor proliferation, thus preventing massive chromosomal instability the so-called telomere-induced crisis (36). This model explains the coexistence of telomere shortening and telomerase activation in the vast majority of human cancers, including hematological malignancies. Growing evidence suggest that hematological malignancies are clonally expanded stem cell disorders (stem cell cancer) which derive from transformed HSCs (cancer stem cells) (37). Given the important role of telomere and telomerase in stem cell and cancer, it is conceivable that the dual role model of telomere shortening and telomerase activation in tumorigenesis might also apply to stem cell cancer. Emerging evidence support the existence of the cancer stem cell (38–41). Since the telomere dynamics represent the mitotic history of highly proliferating organs, analyzing the telomere length, telomerase activity, and cytogenetic profiles in defined cancer stem cell population could be helpful in understanding the origin of tumorinitiating cells and trace the development history of cancer stem cells. The in vivo function of telomeres and telomerase in stem cell cancer need to be studied in purified normal stem cells and cancer stem cells. To directly dissect the self-renewal capacity of these cells, serial transplantation experiments might be required to address the consequences of telomere dysfunction and telomerase activation.

6.2

Mouse Model

Since the activation of DNA damage pathway in response to telomere dysfunction provokes ageing, it is of importance to delineate these checkpoint responses in vivo and dissect the effects of these checkpoints on stem cell function. Inbred laboratory

6 Mouse Model: Telomeres and Telomerase in Stem Cell and Cancer

153

mice have relatively long telomeres (25–40 kb) and short lifespan in contrast to humans (10 kb) (4), thus telomere-based replicative senescence appears not to be the major cause of ageing and stem cell exhaustion in many strains of Mus musculus. Telomerase knockout mice provide a unique experimental model to study the in vivo consequences of telomere dysfunction (42). Serial intercrossing of Terc/ mice reduced the murine telomere length to a ‘‘humanized’’ length. In this experimental setting, telomere length becomes shorter with each additional generation until it reaches the critically short length that induces dramatic degenerative phenotypes (43). Late generation of telomerase-deficient mice showed reduced longevity and impaired organ homeostasis including neural degeneration, hypogonadism, infertility, immunosenescence, intestinal atrophy, alopecia, hair graying, hearing dysfunction, kidney dysfunction, hypertension, and bone marrow dysfunction (23, 42–46). Disturbing different DNA damage checkpoints yields distinct in vivo consequences regarding the organ homeostasis, tissue regeneration capacity, and longevity in telomere dysfunctional mice. The altered lifespan of telomere dysfunctional mice were concomitant with the changes in stem cell function and the onset of carcinogenesis, indicating that telomere dysfunction induced checkpoint responses that contribute to organism longevity by the fine-tuning of ageing and cancer. The fundamental question of how DNA damage checkpoints contribute to the fate decision of stem cells to become senescent stem cells or cancer stem cells in the setting of telomere dysfunction is not clear. In the following sections, we summarize the experimental evidence in genetically modified mice model.

6.2.1

Terc-Deficient Mouse Model

The first telomerase-deficient mouse model was generated by deletion of the gene encoding for the murine Terc gene (Terc/ mice) (42). The mating of Terc/ mice on a mixed C57BL6/129Sv background was fertile up to the sixth generation. On C57BL6 genetic background Terc/ are fertile only up to the third generation due to the relatively short telomeres in this mouse stain (25 kb in C57BL6 vs. 40 kb in C57BL6/129Sv). In line with this observation, the late generation Terc/ mice show testicular atrophy and a depletion of germ line cells. In addition, there was a progressive decrease in litter size with each successive generation of Terc/ mice, which is due to the male and female infertility as well as the increased embryonic death as a consequence of the neural tube closure defect (45). The first generation of Terc/ (G1) showed normal lifespan and normal gross phenotype with age because these mice still have long telomeres. Second generation of Terc/ (G2) mice was generated by intercrossing of G1 telomerase knockout mice, and G2 mice were then intercrossed to generate G3 mice. Following this crossing scheme, telomere length becomes shorter with each successive generation. The onset of telomere dysfunction correlates with the presence of critically

154

X. Huang, Z. Ju

shortened chromosome ends, rather than short average telomere lengths per se (47) and depends on the initial telomere length in individual mouse strains. Mouse strains with relatively short telomeres reach a critically short length in earlier generations compared to mouse strains with longer telomeres (43, 44).

6.2.1.1

Terc–/– Mouse Model and Cancer

The dual role of telomere shortening in tumorigenesis has been thoroughly studied in ageing cohorts of Terc/ mice. Loss of telomere function in a cancer-prone mouse model possessing intact DNA damage responses reduces, but does not prevent, tumor formation (48). In fact, telomere dysfunction was associated with a significant increase in the number of early stage neoplastic lesions and a reciprocal decline in the occurrence of high-grade malignancies. In successive generations of ApcMinTerc/ mice, progressive telomere dysfunction led to an increase in initiated lesions (microscopic adenomas), but a significant decline in the multiplicity and size of macroscopic adenomas. Data are consistent with a model in which telomere dysfunction promotes the chromosomal instability that drives early carcinogenesis, while telomerase activation restores genomic stability to a level permissive for tumor progression (35). Using three mechanistically distinct liver cancer-prone model systems (urokinase plasminogen activator transgenic mice, carbon tetrachloride exposure, and diethylnistrosamine treatment) in the context of successive generations of telomerase-deficient mice null for Terc, researchers found that telomere dysfunction suppressed both the initiation and the growth of human hepatocellular carcinoma (HCC) lesions, a trend that mirrored the level of intratumoral proliferative arrest and apoptosis, indicating that telomere dysfunction exerts an opposing role in the initiation vs. progression of HCC (49). Telomere dysfunction and associated fusion-breakage in the mouse encourages epithelial carcinogenesis. Compared to tumors arising in mice with intact telomeres, tumors with telomere dysfunction possessed higher levels of genomic instability and showed numerous amplifications and deletions in regions syntenic to human cancer hotspots. These observations suggest that telomere-based crisis provides a mechanism of chromosomal instability, including regional amplifications and deletions, that drive carcinogenesis (50). Nevertheless, the genomic instability initiated cancer requires further alterations to bypass the barrier that short telomeres imposed on proliferation. In line with this view, significant reductions in tumor formation in vivo and oncogenic potential in vitro were observed in late generations of telomerase deficiency, coincident with severe telomere shortening and associated dysfunction (42). The explanation of these different observations could be that different cell types vary in their sensitivity to short telomere dysfunction induced chromosomal instability, for instance, late generation Terc/ mice showed increased incidence of spontaneous lymphoma but reduced resistance to skin tumorigenesis (51).

6 Mouse Model: Telomeres and Telomerase in Stem Cell and Cancer

6.2.1.2

155

Terc–/–Mouse Model and Tissue Specific Stem Cells

Studies in Terc/ mice showed telomere shortening affects on stem cell function in different organ systems (24), especially on the organs with high-turnover rate (23). Telomere dysfunction severely affected functional reserves of HSCs during ageing, leading to a loss of long-term self-renewal stem cells by increased apoptosis and/or premature differentiation (52). In other stem cell compartments, telomere shortening abrogated intestinal stem cells (52), epidermal stem cells (28), and neural stem cells (53). Recent experimental evidence suggests that ageing associated systemic factors alterations can modulate the function of tissue-specific stem cells (54). In Terc/ mice, telomere dysfunction induces cell-extrinsic defects restraining stem or progenitor cell function in addition to activating cell-intrinsic checkpoints (55). Telomere dysfunction induces age-dependent stem cell extrinsic alterations including stem cell niche defects and systemic environment changes. The cellular niche of HSCs formed by bone marrow mesenchymal cells prevents stem cell exhaustion by controlling the balance between HSCs self-renewal and differentiation. FACS analysis on nonendothelial stromal cells revealed an age-dependent reduction of boneassociated stromal cells (so-called endosteal niche), which correlated with the accelerated telomere shortening in this cellular compartment. The decreased number of stromal cells was associated with the impaired proliferation capacity of mesenchymal stem cells indicated by the reduction of their potential to develop fibroblast-like colony-forming units in vitro. In addition to the number reduction of stromal cells, the function of stromal cell to maintain HSCs also impaired in aged Terc/ mice (55). In line with previous report that senescent fibroblasts produced a secretary phenotype promoting ageing and carcinogenesis of surrounding cells (56), late generation Terc/ mice exhibited an aged-dependent cytokine profile of various upregulated growth factors. Among them, elevated granulocyte stimulating factor (G-CSF) plays a functional role in mobilizing long-term HSCs out of niche and preferentially differentiating to myeloid cells (55). Thus, the consequences of this highly proliferative microenvironment inhibit the quiescent status of long-term HSCs and thus eventually lead to exhaustion of the stem cell pool during ageing.

6.2.2

Tert-Deficient Mouse Model

In unicellular organisms that constitutively express telomerase activity, such as fungi and protozoa, loss of either RNA component or catalytic subunit of telomerase leads to cell cycle arrest (2). In mice, Terc is constitutively expressed; the strict regulation of telomerase activity is instead controlled by the expression of Tert (57). Although telomere length is the major cause of the ageing phenotype even in the presence of low telomerase activity (58), Tert appears to have an additional relevance to ageing and stem cell function in dependent of its role in telomere

156

X. Huang, Z. Ju

maintenance (see above). To understand the long-term in vivo consequences of partial or complete disruption of the telomerase activity, Tert/ mice have been generated (59). Similar to Terc/ mice, Tert/ mice showed normal gross phenotype in the early generation. Further experiment showed a haploinsufficiency, and a dose effect of maintaining telomere length in Tert+/ mice, indicating that Tert+/ can be used as a model for studying the consequences of low levels of telomerase activity in stem cell function and cancer (60), as well as for assessing the in vivo efficacy and/or potential toxicity of therapeutic inhibitors of telomerase (60). However, the ageing phenotypes of Tert/ mice have not been thoroughly assessed in successive generations.

6.2.3

Super-Tert Mouse Model

To determine the in vivo consequences of enforced high-level telomerase activity in ageing and cancer, Tert transgenic mice have been generated (61–65). Tert transgenic mice under the promoter of b-actin conferred increased telomerase enzymatic activity in several tissues, including mammary gland, splenocytes, and cultured mouse embryonic fibroblasts (61). Tert overexpression extended telomere lengths in mouse embryonic fibroblasts but did not prevent culture-induced senescence (61). This observation reinforced the notion that murine cells with long telomeres do not use telomere-based replicative senescence but rather use oxidative stressinduced premature senescence. The enhanced Tert overexpression did not change the proliferation of hematopoietic cells and did not modify the cancer-prone phenotype of Ink4a/Arf-deficient mice, but increased the spontaneous development of breast cancer and mammary intraepithelial neoplasia in a significant proportion of aged females, indicating that Tert plays a role in promoting spontaneous cancer formation in mice with long telomere reserves (61). Interestingly, conditional overexpression of Tert induced proliferation of quiescent, long-term stem cells in the hair follicle bulge region. This function of Tert did not require Terc component but rather took place in a telomere-length independent manner (62). Tissue-specific telomerase overexpression mouse model (K5-Tert) has been generated using the bovine keratin 5 promoter (63). The K5-Tert transgenic mice are viable and show normal stratified epithelia with high levels of telomerase activity and normal telomere length. Constitutive telomerase expression endows increased proliferation of basal keratinocytes upon mitotic stimuli, and a faster wound-healing rate compared to wild-type littermates. When exposed to chemical carcinogens, K5-Tert mice are more susceptible to develop epithelial tumors (63). Although these mice showed increased mortality in the first year of life due to a higher incidence of spontaneous tumor, the maximum lifespan of these mice had been extended owing to lower incidence of age-related degenerative diseases (64). Another transgenic mouse has been generated under Lck promoter, which possessed a constitutive expression of Tert in T lymphocytes (65). The Lck-Tert mice showed increased T-cell lymphomas progression and dissemination, affecting both lymphoid and nonlymphoid tissues (65).

6 Mouse Model: Telomeres and Telomerase in Stem Cell and Cancer

157

Together, these data indicate that telomerase activation may have two roles in tumorigenesis: one is to stabilize short telomeres and prevent tumor cells entering into crisis stage; the other role is to directly promote tumorigenesis independent of telomere maintenance. In addition to directly analyzing the impact of ectopic telomerase expression in tumorigenesis and aging, Super-Tert mice also constitute a new animal model system to evaluate the potential consequences of using telomerase for gene therapy of age-related diseases, as well as to study the efficacy of antitelomerase therapies.

6.2.4

Atm in Telomere Dysfunctional Mice

The ataxia telangiectasia mutated gene (Atm) was found in a rare autosomal recessive disease, ataxia telangiectasia (AT). AT patients are characterized by impaired organ homeostasis including neurodegeneration, immunodeficiency, and predisposition to malignancy, clinical radiosensitivity, and incomplete sexual maturation. The molecular basis of AT has been demonstrated as accelerated telomere loss and genomic instability (66). Atm encodes for a kinase that phosphorylates a number of substrates in the DNA damage pathways. In addition to its role in maintaining the length and proper function of telomeres (67–70), Atm also contributes to the initiation of DNA damage signals in response to telomere dysfunction (10, 12, 71). The in vivo function of Atm in the setting of short telomeres has been studied in the mouse double knockout for Atm and Terc. Deletion of Atm did not reduce telomere dysfunction signaling in Terc/ mice, indicating that Atm independent pathways mediate the activation of DNA damage signals in telomere dysfunctional mice. In agreement with its role in maintaining telomere function, Atm deficiency accelerated telomere shortening and aggravated the degenerative phenotype in late generation Terc/ mice. The double mutant mice showed reduced lifespan, a general proliferation defect in stem and progenitor cells including neuronal stem cells (72). In line with the notion that telomere shortening suppresses macroscopic tumors (35, 42, 48, 51), the double mutant mice showed a substantial elimination of T-cell lymphoma compared to Atm-deficient mice. Importantly, deletion of Atm gene in mice possessing short telomeres induces similar phenotype mimic human ataxia telangiectasia (72), which was not shown in Terc+/+Atm/ mice. In Terc+/+ Atm/ mice, Atm deficiency led to bone marrow failure and compromised repopulating capacity of HSCs due to the increased ROS and derepression of p16Ink4a (73).

6.2.5

p53 and Telomere Dysfunction in Mice

Transform-related protein p53 (Trp53) plays a central role in the DNA damage signaling pathway. Inhibiting p53 prevented the induction of senescence checkpoints and extended the life span of primary human cells in culture (74, 75). Cells

158

X. Huang, Z. Ju

bypassed senescence checkpoints can continually grow until they encounter p53 independent crisis-checkpoint, which is characterized by massive chromosomal instability and cell death (36). In late generation Terc/ mice, telomere dysfunction activates p53 dependent cellular senescence, thus accelerates organismal aging (43, 44) and meanwhile suppresses tumor formation (76). To dissect the in vivo role of p53 activation induced by telomere dysfunction, mice double knockout for Terc and p53 have been generated (11). Deletion of p53 rescued germ cell apoptosis and testis atrophy in late generation Terc/ mice (11). In the mixed background, double mutant mice can be mated up to the eighth generation whereas Terc/ mice are infertile at the sixth generation. However, p53 deletion did not prolong the lifespan of telomere dysfunctional mice, but rather increased the early death of telomere dysfunctional mice due to early tumor development (50). The tumors in Terc/p53/ mice showed massive chromosomal instability (11, 50). Interestingly, Terc/, p53+/ exhibits a shift in the tumor spectrum toward epithelial cancer which is not usually seen in mice but rather often observed in human cancers (50). A possible explanation is that when telomeres of Terc/ mice are shortened to a critical length that resembles to human telomeres, loss of p53 dependent cell cycle control leads to continually progression of transformed epithelial cells, eventually, the cells with dramatic chromosomal instability form full-fledged cancer. In Terc+/+ mice, p53 seems to have a dose effect on organism ageing and stem cell function. Mice with a hypermorphic form of p53 showed reduced longevity, osteoporosis, generalized organ atrophy, and impaired stress tolerance (77). The overactive p53 impaired the number and function of HSCs, whereas heterozygous deletion of p53 increased the proliferation of HSCs during mouse ageing (78). In contrast, mice containing an extra copy of intact p53 gene (super-p53) did not show increased tissue atrophy (79). Similar to observations in Terc/ mice that activation of p53 contributes to accelerated ageing, the super-p53 Terc/ mice exhibited an enhanced response to telomere dysfunction. This observation reinforces the concept that p53 is a sensor of telomere damage. However, the increased sensing of telomere dysfunction in super-p53 Terc/ mice did not lead to a further decrease of lifespan compared to Terc/ mice (80). In fact, the increased p53 expression correlates with a reduced presence of damaged cells in highly proliferative organs accompanied by increased apoptosis. One plausible explanation is that, in Terc/ mice an extra level of p53 preferentially eliminates the cells harboring telomere-derived damage.

6.2.6

Deletion of p21 in Terc–/–Mice

Cyclin dependant kinase inhibitor (Cdkn1a), also called p21, mediates a p53 dependent cell cycle arrest (81, 82). The in vivo consequences of p53 deletion did not rescue the survival of telomere dysfunctional mice due to the early onset of tumors, which did not allow ageing study in this mouse model (11). As one of the

6 Mouse Model: Telomeres and Telomerase in Stem Cell and Cancer

159

downstream effectors of p53, p21 seems to be more responsible for the senescent effect of p53. To directly address the importance of telomere dysfunction induced senescent checkpoints in organismal ageing, Terc/p21/ mice have been generated (52). Notably, p21 deletion significantly increased the longevity of late generation Terc/ mice without promoting cancer. The increased lifespan of Terc/p21/ mice associated with an overall improved organ homeostasis, including rescued lymphopenia and improved maintenance of intestinal epithelia (52). Further analysis revealed that p21 deletion improved the proliferation of intestinal stem and progenitor cells as well as the self-renewal capacity of HSCs. Unlike p53 deletion, deficiency of p21 did not further increase chromosomal instability or cancer formation in aging mice with dysfunctional telomeres (52). Together with the evidence that p21 mutations are rarely seen in human cancer, these data suggest that p21 may not be a crucial tumor suppressor in the setting of telomere shortening. The underlying mechanism of this observation could be that p21 independent apoptosis checkpoints controlled by p53 prevented the transformation of cells that have bypassed the p21-dependent checkpoints in response to telomere dysfunction. In contrast to the findings that the inhibition of p21 improved HSCs maintenance in Terc/ mice, the deletion of p21 caused the exhaustion of HSCs reserves in Terc+/+ mice. In wild type mice with long telomere reserves, p21 plays a protective role in keeping the major population of long-term stem cells in a quiescent status to prevent the exhaustion of HSCs when exposed to chemotherapy or underreplicative stress (83) or the depletion of neuronal stem cell after ischemic injury (84). These findings suggest that p21 has a dual role in stem cell aging: on one hand presence of p21 maintains stem cell quiescence to prevent exhaustion under acute stresses; on the other hand p21 upregulation promotes ageing in the context of telomere dysfunction (85).

6.2.7

p16Ink4a/p19Arf in Terc–/–Mice

The Ink4a/Arf locus encodes two various splicing proteins ( p16Ink4a and p19Arf), which are upregulated in both senescent human fibroblasts and ageing tissues in mammals (86, 87). In Terc+/+ mice, p16 upregulation caused an age-dependent decline in the regenerative capacity of different stem cell compartments including HSCs (88), neural stem cells (89), and pancreatic stem cells (90). Further experimental evidence suggests that p16 can activate p53-independent checkpoints in response to an artificial telomere dysfunction, which induced by deletion of Trf 2 – a telomere-binding protein that is necessary for telomere capping function (91). In vivo, deletion of Ink4a/Arf does not change the degenerative phenotypes or tumor spectrum of the Terc/ mice, indicating that Ink4a/Arf is dispensable for signaling dysfunctional telomeres (92). Upon carcinogen treatment, Terc/Ink4a/Arf / mice showed a decreased cancer formation (48), which is due to an intact telomere checkpoint in tumorigenesis independent of p16Ink4a and p19Arf.

160

6.2.8

X. Huang, Z. Ju

PKcs in Terc–/–Mice

NHEJ is the principal DNA repair mechanism in mammalian cells. One of the key components of the NHEJ machinery is the DNA-PK complex, formed by the Ku86/ 70 heterodimer, the DNA-PK catalytic subunit (DNA-PKcs), and the XRCC4/ ligase4 complex (93). Knockout mice deficient for any of the three components of the DNA-PK complex show accelerated telomere shortening, severe immunodeficiency, thymic lymphomas, and an earlier onset of age-related pathologies (94, 95). Experimental data in Ku86- and DNA-PKcs-deficient mice indicate that DNAPK complex are essential for the capping function of the telomeres (96–98). In the absence of telomerase activity, DNA-PKcs abrogation accelerates the rate of telomere loss (98). Terc/ DNA-PKcs/ mice showed an earlier loss of fertility and viability than the corresponding telomerase-deficient controls (97). However, this loss of viability was not mediated by a further increase in end-to-end fusions or in apoptosis, indicating that DNA-PKcs is essential for the signaling of apoptosis and for the fusion of short telomeres. Analysis of the innate immune response in the DNA-PKcs-deficient mice with short dysfunctional telomeres revealed high basal serum levels of tumor necrosis factor alpha and hyperactive cytokine responses upon challenge with polyinosinic polycytidylic acid (99).

6.2.9

Wrn and Blm in Terc–/–Mice

Werner and Bloom syndromes are caused by loss-of-function mutations in RecQ family DNA helicases WRN and BLM, respectively. Persons with Werner syndrome displays premature aging features and increased cancers accompanied by genome instability. Accumulating evidence indicates that WRN and BLM play a direct role in telomere metabolism. WRN has been suggested to play a functional interaction with several telomere-binding proteins, including TRF1, TRF2, and POT1 (100). Wrn knockout mice with long telomere reserves did not display typical cellular or clinical phenotypes of human WS (101). In late generation Terc/ mice, deletion of Wrn accelerated the overall attrition of telomere length, resulting in the phenotypes resembling human WS, including early onset of age-related disorders, increased incidence of mesenchymal cancers, and premature death (102, 103). The underlying mechanism is that telomere dysfunction appears to cooperate with Wrn and Blm deficiency to activate the DNA-damage response and subsequent enter replicative senescence. Notably, the phenotype observed in the Terc/ Wrn/ double mutant is not simply a worsening of aging phenotypes observed in Terc/ mice, but a recapitulation of specific phenotypes encountered in WS patients that are not observed in late generation Terc/ mice.

6 Mouse Model: Telomeres and Telomerase in Stem Cell and Cancer

161

6.2.10 Exo-1 in Terc–/–Mice Exonuclease-1 (Exo-1), a 50 -30 exonuclease, has a role in processing dysfunctional telomeres to generate chromosomal translocation in telomere dysfunctional yeast (104). Deletion of Exo-1 rescued the induction of senescence in yeast strains indicating that Exo-1 plays a role in sensing telomere dysfunction (105). Exo-1 can also mediate survival of telomere-dysfunctional yeast strains by increasing HR at dysfunctional telomeres (106). Knockout mice carrying a deletion mutation of the nuclease domain of Exo-1 are viable, but show defects in DNA mismatch repair, accompanied by slightly increased cancer susceptibility at advanced age (107). Recent mouse experiments showed that Exo-1 deletion significantly prolongs the lifespan of mice with dysfunctional telomeres without accelerating tumor formation. The increased lifespan was associated with improved organ homeostasis of high-turnover organs and overall fitness (108). Exo-1 deletion prevents the induction of checkpoint responses and confers resistance of mammalian cells and organs to g-IR, telomere dysfunction, and 6-thioguanine treatment (108). The formation of ssDNA is one mechanism by which Exo-1 amplifies the generation of DNA damage signals at DNA breaks (108). The nuclease domain of Exo-1 participates in the formation of ssDNA, RPA recruitment, and ATR activation at DNA double-strand breaks and in response to telomere dysfunction in mammalian cells. This mechanism likely contributes to aggravate phenotypes of telomere dysfunction in Terc/ mice. However, Exo-1 deletion did not result in rescue cell survival in response to Hydroxy urea (HU) treatment. A possible explanation is that HU induces ssDNA-dependent signaling independent of Exo-1 processing, since HU induces single-stranded DNA damage by itself (108). Exo-1 deletion did not increase cancer formation in telomere dysfunctional mice. Exo-1 deletion reduced anaphase bridges in telomere dysfunctional mice (50). These data suggest that deletion of Exo-1 prevents fusion–bridge–breakage cycles and reduced the evolution of chromosomal instability which is the cause of increased tumor initiation in telomere dysfunctional mice (108). Taken together, Exo-1 is a critical component for inducing DNA damage signals, cell cycle arrest, and apoptosis in telomere-dysfunctional mice and in response to DNA double-strand breaks. In addition, Exo-1 deletion prevents the accumulation of DNA damage and can prolong organismal survival in the context of telomere dysfunction without accelerating chromosomal instability and cancer formation (108).

6.2.11 Terc–/–and PMS2–/– DNA mismatch repair (MMR) plays an important role in meiotic and mitotic recombination, DNA damage signaling, and various aspects of DNA metabolism. That MMR plays role at telomeres has been suggested from experiments in

162

X. Huang, Z. Ju

telomerase-deficient yeast strains (105). In telomere dysfunctional mice, mismatch repair protein PMS2 deficiency rescued the degenerative pathologies and extended the lifespan of Terc/ mice. This rescue of survival was not dependent on changes in telomere length and microsatellite instability, but due to the role of MMR in mediating the cellular response to dysfunctional telomeres in vivo (109). Further analysis showed that PMS2 deficiency did not rescue the apoptosis defect in Terc/ mice, but rather improved the cell proliferation by attenuating p21 induction in response to short telomeres. In agreement with the observation on Terc/p21/ mice, the proliferative advantage conferred to telomere dysfunctional mice by the abrogation of PMS2 did not increase tumor incidence. In agreement with the tumor suppressor role of short telomeres, Terc/PMS2/ mice showed a reduced tumor incidence compared with PMS2/ mice (109).

6.3

Concluding Remarks

In summary, telomerase-deficient mouse has provided invaluable insights into basic questions pertaining to consequences of telomere dysfunction in stem cell function, organism aging, and carcinogenesis in humans. Independent line of evidence indicates that manifestation of the diverse ageing associated pathophysiological phenotypes observed in humans requires the presence of dysfunctional telomeres as well as other genetic mutations. Studies in these mouse models have demonstrated that telomere dysfunction leads to genomic instability and activation of the DNA damage response pathways where p53 plays a key role. Furthermore, telomere maintenance, DNA repair, and DNA metabolism pathways are intertwined and function either to suppress or to provoke aging and cancer phenotypes, depending upon the status of the DNA damage checkpoints. Given the fact that we grow old because of our stem cells growing old, fine-tuning of the DNA damage responses induced by telomere dysfunction is crucial to the fate decision of ageing stem cell to undergo functional exhaustion or become cancer stem cells. Therefore, further studies pertaining to the genetic regulation of stem cell ageing in the setting of telomere dysfunction is one of the important aspects in understanding the fundamental molecular mechanisms of human cancer and degenerative disorders.

References 1. Blackburn EH. Telomeres. Trends Biochem Sci 1991;16:378–81. 2. Blackburn EH. Switching and signaling at the telomere. Cell 2001;106:661–73. 3. Griffith JD, Comeau L, Rosenfield S, et al. Mammalian telomeres end in a large duplex loop. Cell 1999;97:503–14. 4. Zijlmans JM, Martens UM, Poon SS, et al. Telomeres in the mouse have large interchromosomal variations in the number of T2AG3 repeats. Proc Natl Acad Sci USA 1997;94:7423–8.

6 Mouse Model: Telomeres and Telomerase in Stem Cell and Cancer

163

5. Harley CB, Futcher AB, Greider CW. Telomeres shorten during ageing of human fibroblasts. Nature 1990;345:458–60. 6. Shay JW, Wright WE. Hayflick, his limit, and cellular ageing. Nat Rev Mol Cell Biol 2000;1:72–6. 7. Sfeir AJ, Chai W, Shay JW, Wright WE. Telomere-end processing the terminal nucleotides of human chromosomes. Mol Cell 2005;18:131–8. 8. von Zglinicki T. Oxidative stress shortens telomeres. Trends Biochem Sci 2002;27:339–44. 9. Chiu CP, Harley CB. Replicative senescence and cell immortality: the role of telomeres and telomerase. Proc Soc Exp Biol Med 1997;214:99–106. 10. d’Adda di Fagagna F, Reaper PM, Clay-Farrace L, et al. A DNA damage checkpoint response in telomere-initiated senescence. Nature 2003;426:194–8. 11. Chin L, Artandi SE, Shen Q, et al. p53 deficiency rescues the adverse effects of telomere loss and cooperates with telomere dysfunction to accelerate carcinogenesis. Cell 1999;97:527–38. 12. Herbig U, Jobling WA, Chen BP, Chen DJ, Sedivy JM. Telomere shortening triggers senescence of human cells through a pathway involving ATM, p53, and p21(CIP1), but not p16(INK4a). Mol Cell 2004;14:501–13. 13. Greider CW. Telomere length regulation. Annu Rev Biochem 1996;65:337–65. 14. Meyerson M, Counter CM, Eaton EN, et al. hEST2, the putative human telomerase catalytic subunit gene, is up-regulated in tumor cells and during immortalization. Cell 1997;90:785–95. 15. Lingner J, Hughes TR, Shevchenko A, Mann M, Lundblad V, Cech TR. Reverse transcriptase motifs in the catalytic subunit of telomerase. Science 1997;276:561–7. 16. Kim NW, Piatyszek MA, Prowse KR, et al. Specific association of human telomerase activity with immortal cells and cancer. Science 1994;266:2011–5. 17. Bodnar AG, Ouellette M, Frolkis M, et al. Extension of life-span by introduction of telomerase into normal human cells. Science 1998;279:349–52. 18. Ju Z, Rudolph KL. Telomeres and telomerase in cancer stem cells. Eur J Cancer 2006;42:1197–203. 19. Zimmermann S, Martens UM. Telomere dynamics in hematopoietic stem cells. Curr Mol Med 2005;5:179–85. 20. Martens UM, Brass V, Engelhardt M, et al. Measurement of telomere length in haematopoietic cells using in situ hybridization techniques. Biochem Soc Trans 2000;28:245–50. 21. Vaziri H, Dragowska W, Allsopp RC, Thomas TE, Harley CB, Lansdorp PM. Evidence for a mitotic clock in human hematopoietic stem cells: loss of telomeric DNA with age. Proc Natl Acad Sci USA 1994;91:9857–60. 22. Van Zant G, Liang Y. The role of stem cells in aging. Exp Hematol 2003;31:659–72. 23. Lee HW, Blasco MA, Gottlieb GJ, Horner JW, 2nd, Greider CW, DePinho RA. Essential role of mouse telomerase in highly proliferative organs. Nature 1998;392:569–74. 24. Ju Z, Rudolph L. Telomere dysfunction and stem cell ageing. Biochimie 2007;90:24–32. 25. Counter CM, Gupta J, Harley CB, Leber B, Bacchetti S. Telomerase activity in normal leukocytes and in hematologic malignancies. Blood 1995;85:2315–20. 26. Allsopp RC, Morin GB, DePinho R, Harley CB, Weissman IL. Telomerase is required to slow telomere shortening and extend replicative lifespan of HSCs during serial transplantation. Blood 2003;102:517–20. 27. Allsopp RC, Morin GB, Horner JW, DePinho R, Harley CB, Weissman IL. Effect of TERT over-expression on the long-term transplantation capacity of hematopoietic stem cells. Nat Med 2003;9:369–71. 28. Flores I, Cayuela ML, Blasco MA. Effects of telomerase and telomere length on epidermal stem cell behavior. Science 2005;309:1253–6. 29. Lechel A, Satyanarayana A, Ju Z, et al. The cellular level of telomere dysfunction determines induction of senescence or apoptosis in vivo. EMBO Rep 2005;6:275–81.

164

X. Huang, Z. Ju

30. Aladjem MI, Spike BT, Rodewald LW, et al. ES cells do not activate p53-dependent stress responses and undergo p53-independent apoptosis in response to DNA damage. Curr Biol 1998;8:145–55. 31. Hong Y, Stambrook PJ. Restoration of an absent G1 arrest and protection from apoptosis in embryonic stem cells after ionizing radiation. Proc Natl Acad Sci USA 2004;101:14443–8. 32. Morrison SJ, Prowse KR, Ho P, Weissman IL. Telomerase activity in hematopoietic cells is associated with self-renewal potential. Immunity 1996;5:207–16. 33. Zimmermann S, Voss M, Kaiser S, Kapp U, Waller CF, Martens UM. Lack of telomerase activity in human mesenchymal stem cells. Leukemia 2003;17:1146–9. 34. Rossi DJ, Bryder D, Seita J, Nussenzweig A, Hoeijmakers J, Weissman IL. Deficiencies in DNA damage repair limit the function of haematopoietic stem cells with age. Nature 2007;447:725–9. 35. Rudolph KL, Millard M, Bosenberg MW, DePinho RA. Telomere dysfunction and evolution of intestinal carcinoma in mice and humans. Nat Genet 2001;28:155–9. 36. Wright WE, Shay JW. The two-stage mechanism controlling cellular senescence and immortalization. Exp Gerontol 1992;27:383–9. 37. Lapidot T, Sirard C, Vormoor J, et al. A cell initiating human acute myeloid leukaemia after transplantation into SCID mice. Nature 1994;367:645–8. 38. Singh SK, Clarke ID, Terasaki M, et al. Identification of a cancer stem cell in human brain tumors. Cancer Res 2003;63:5821–8. 39. Al-Hajj M, Clarke MF. Self-renewal and solid tumor stem cells. Oncogene 2004;23:7274– 82. 40. O’Brien CA, Pollett A, Gallinger S, Dick JE. A human colon cancer cell capable of initiating tumour growth in immunodeficient mice. Nature 2007;445(7123):106–10. 41. Ricci-Vitiani L, Lombardi DG, Pilozzi E, Biffoni M, Todaro M, Peschle C, De Maria R. Identification and expansion of human colon-cancer-initiating cells. Nature 2007;445 (7123):111–5. 42. Blasco MA, Lee HW, Hande MP, et al. Telomere shortening and tumor formation by mouse cells lacking telomerase RNA. Cell 1997;91:25–34. 43. Rudolph KL, Chang S, Lee HW, et al. Longevity, stress response, and cancer in aging telomerase-deficient mice. Cell 1999;96:701–12. 44. Herrera E, Samper E, Martin-Caballero J, Flores JM, Lee HW, Blasco MA. Disease states associated with telomerase deficiency appear earlier in mice with short telomeres. EMBO J 1999;18:2950–60. 45. Herrera E, Samper E, Blasco MA. Telomere shortening in mTR /; embryos is associated with failure to close the neural tube. EMBO J 1999;18:1172–81. 46. Leri A, Franco S, Zacheo A, et al. Ablation of telomerase and telomere loss leads to cardiac dilatation and heart failure associated with p53 upregulation. EMBO J 2003;22:131–9. 47. Hemann MT, Strong MA, Hao LY, Greider CW. The shortest telomere, not average telomere length, is critical for cell viability and chromosome stability. Cell 2001;107:67–77. 48. Greenberg RA, Chin L, Femino A, et al. Short dysfunctional telomeres impair tumorigenesis in the INK4a(delta2/3) cancer-prone mouse. Cell 1999;97:515–25. 49. Farazi PA, Glickman J, Jiang S, Yu A, Rudolph KL, DePinho RA. Differential impact of telomere dysfunction on initiation and progression of hepatocellular carcinoma. Cancer Res 2003;63:5021–7. 50. Artandi SE, Chang S, Lee SL, et al. Telomere dysfunction promotes non-reciprocal translocations and epithelial cancers in mice. Nature 2000;406:641–5. 51. Gonzalez-Suarez E, Samper E, Flores JM, Blasco MA. Telomerase-deficient mice with short telomeres are resistant to skin tumorigenesis. Nat Genet 2000;26:114–7. 52. Choudhury AR, Ju Z, Djojosubroto MW, et al. Cdkn1a deletion improves stem cell function and lifespan of mice with dysfunctional telomeres without accelerating cancer formation. Nat Genet 2007;39:99–105.

6 Mouse Model: Telomeres and Telomerase in Stem Cell and Cancer

165

53. Harrison DE, Astle CM. Loss of stem cell repopulating ability upon transplantation. Effects of donor age, cell number, and transplantation procedure. J Exp Med 1982;156:1767–79. 54. Conboy IM, Conboy MJ, Wagers AJ, Girma ER, Weissman IL, Rando TA. Rejuvenation of aged progenitor cells by exposure to a young systemic environment. Nature 2005;433:760–4. 55. Ju Z, Jiang H, Jaworski M, et al. Telomere dysfunction induces environmental alterations limiting hematopoietic stem cell function and engraftment. Nat Med 2007;13:742–7. 56. Campisi J. Senescent cells, tumor suppression, and organismal aging: good citizens, bad neighbors. Cell 2005;120:513–22. 57. Greenberg RA, Allsopp RC, Chin L, Morin GB, DePinho RA. Expression of mouse telomerase reverse transcriptase during development, differentiation and proliferation. Oncogene 1998;16:1723–30. 58. Hao LY, Armanios M, Strong MA, et al. Short telomeres, even in the presence of telomerase, limit tissue renewal capacity. Cell 2005;123:1121–31. 59. Yuan X, Ishibashi S, Hatakeyama S, et al. Presence of telomeric G-strand tails in the telomerase catalytic subunit TERT knockout mice. Genes Cells 1999;4:563–72. 60. Erdmann N, Liu Y, Harrington L. Distinct dosage requirements for the maintenance of long and short telomeres in mTert heterozygous mice. Proc Natl Acad Sci USA 2004;101:6080–5. 61. Artandi SE, Alson S, Tietze MK, et al. Constitutive telomerase expression promotes mammary carcinomas in aging mice. Proc Natl Acad Sci USA 2002;99:8191–6. 62. Sarin KY, Cheung P, Gilison D, et al. Conditional telomerase induction causes proliferation of hair follicle stem cells. Nature 2005;436:1048–52. 63. Gonzalez-Suarez E, Samper E, Ramirez A, et al. Increased epidermal tumors and increased skin wound healing in transgenic mice overexpressing the catalytic subunit of telomerase, mTERT, in basal keratinocytes. EMBO J 2001;20:2619–30. 64. Gonzalez-Suarez E, Geserick C, Flores JM, Blasco MA. Antagonistic effects of telomerase on cancer and aging in K5-mTert transgenic mice. Oncogene 2005;24:2256–70. 65. Canela A, Martin-Caballero J, Flores JM, Blasco MA. Constitutive expression of tert in thymocytes leads to increased incidence and dissemination of T-cell lymphoma in Lck-Tert mice. Mol Cell Biol 2004;24:4275–93. 66. McKinnon PJ. ATM and ataxia telangiectasia. EMBO Rep 2004;5:772–6. 67. Vaziri H, West MD, Allsopp RC, et al. ATM-dependent telomere loss in aging human diploid fibroblasts and DNA damage lead to the post-translational activation of p53 protein involving poly (ADP-ribose) polymerase. EMBO J 1997;16:6018–33. 68. Hande MP, Balajee AS, Tchirkov A, Wynshaw-Boris A, Lansdorp PM. Extra-chromosomal telomeric DNA in cells from Atm(/) mice and patients with ataxia-telangiectasia. Hum Mol Genet 2001;10:519–28. 69. Greenwell PW, Kronmal SL, Porter SE, Gassenhuber J, Obermaier B, Petes TD. TEL1, a gene involved in controlling telomere length in S. cerevisiae, is homologous to the human ataxia telangiectasia gene. Cell 1995;82:823–9. 70. Naito T, Matsuura A, Ishikawa F. Circular chromosome formation in a fission yeast mutant defective in two ATM homologues. Nat Genet 1998;20:203–6. 71. Takai H, Smogorzewska A, de Lange T. DNA damage foci at dysfunctional telomeres. Curr Biol 2003;13:1549–56. 72. Wong KK, Maser RS, Bachoo RM, et al. Telomere dysfunction and Atm deficiency compromises organ homeostasis and accelerates ageing. Nature 2003;421:643–8. 73. Ito K, Hirao A, Arai F, et al. Regulation of oxidative stress by ATM is required for selfrenewal of haematopoietic stem cells. Nature 2004;431:997–1002. 74. Hara E, Tsurui H, Shinozaki A, Nakada S, Oda K. Cooperative effect of antisense-Rb and antisense-p53 oligomers on the extension of life span in human diploid fibroblasts, TIG-1. Biochem Biophys Res Commun 1991;179:528–34. 75. Bond JA, Wyllie FS, Wynford-Thomas D. Escape from senescence in human diploid fibroblasts induced directly by mutant p53. Oncogene 1994;9:1885–9.

166

X. Huang, Z. Ju

76. Cosme-Blanco W, Shen MF, Lazar AJ, et al. Telomere dysfunction suppresses spontaneous tumorigenesis in vivo by initiating p53-dependent cellular senescence. EMBO Rep 2007;8:497–503. 77. Tyner SD, Venkatachalam S, Choi J, et al. p53 mutant mice that display early ageingassociated phenotypes. Nature 2002;415:45–53. 78. Dumble M, Moore L, Chambers SM, et al. The impact of altered p53 dosage on hematopoietic stem cell dynamics during aging. Blood 2007;109:1736–42. 79. Garcia-Cao I, Garcia-Cao M, Martin-Caballero J, et al. “Super p53” mice exhibit enhanced DNA damage response, are tumor resistant and age normally. EMBO J 2002;21:6225–35. 80. Garcia-Cao I, Garcia-Cao M, Tomas-Loba A, et al. Increased p53 activity does not accelerate telomere-driven ageing. EMBO Rep 2006;7:546–52. 81. el-Deiry WS, Tokino T, Velculescu VE, et al. WAF1, a potential mediator of p53 tumor suppression. Cell 1993;75:817–25. 82. Brown JP, Wei W, Sedivy JM. Bypass of senescence after disruption of p21CIP1/WAF1 gene in normal diploid human fibroblasts. Science 1997;277:831–4. 83. Cheng T, Rodrigues N, Shen H, et al. Hematopoietic stem cell quiescence maintained by p21cip1/waf1. Science 2000;287:1804–8. 84. Qiu J, Takagi Y, Harada J, et al. Regenerative response in ischemic brain restricted by p21cip1/waf1. J Exp Med 2004;199:937–45. 85. Ju Z, Choudhury AR, Rudolph KL. A dual role of p21 in stem cell aging. Ann N Y Acad Sci 2007;1100:333–44. 86. Krishnamurthy J, Torrice C, Ramsey MR, et al. Ink4a/Arf expression is a biomarker of aging. J Clin Invest 2004;114:1299–307. 87. Alcorta DA, Xiong Y, Phelps D, Hannon G, Beach D, Barrett JC. Involvement of the cyclindependent kinase inhibitor p16 (INK4a) in replicative senescence of normal human fibroblasts. Proc Natl Acad Sci USA 1996;93:13742–7. 88. Janzen V, Forkert R, Fleming HE, et al. Stem-cell ageing modified by the cyclin-dependent kinase inhibitor p16INK4a. Nature 2006;443:421–6. 89. Molofsky AV, Slutsky SG, Joseph NM, et al. Increasing p16INK4a expression decreases forebrain progenitors and neurogenesis during ageing. Nature 2006;443:448–52. 90. Krishnamurthy J, Ramsey MR, Ligon KL, et al. p16INK4a induces an age-dependent decline in islet regenerative potential. Nature 2006;443:453–7. 91. Smogorzewska A, de Lange T. Different telomere damage signaling pathways in human and mouse cells. EMBO J 2002;21:4338–48. 92. Khoo CM, Carrasco DR, Bosenberg MW, Paik JH, Depinho RA. Ink4a/Arf tumor suppressor does not modulate the degenerative conditions or tumor spectrum of the telomerase-deficient mouse. Proc Natl Acad Sci USA 2007;104:3931–6. 93. Khanna KK, Jackson SP. DNA double-strand breaks: signaling, repair and the cancer connection. Nat Genet 2001;27:247–54. 94. Espejel S, Martin M, Klatt P, Martin-Caballero J, Flores JM, Blasco MA. Shorter telomeres, accelerated ageing and increased lymphoma in DNA-PKcs-deficient mice. EMBO Rep 2004;5:503–9. 95. Nussenzweig A, Chen C, da Costa Soares V, et al. Requirement for Ku80 in growth and immunoglobulin V(D)J recombination. Nature 1996;382:551–5. 96. Bailey SM, Meyne J, Chen DJ, et al. DNA double-strand break repair proteins are required to cap the ends of mammalian chromosomes. Proc Natl Acad Sci USA 1999;96:14899–904. 97. Espejel S, Klatt P, Menissier-de Murcia J, et al. Impact of telomerase ablation on organismal viability, aging, and tumorigenesis in mice lacking the DNA repair proteins PARP-1, Ku86, or DNA-PKcs. J Cell Biol 2004;167:627–38. 98. Espejel S, Franco S, Sgura A, et al. Functional interaction between DNA-PKcs and telomerase in telomere length maintenance. EMBO J 2002;21:6275–87. 99. Wong KK, Maser RS, Sahin E, et al. Diminished lifespan and acute stress-induced death in DNA-PKcs-deficient mice with limiting telomeres. Oncogene 2007;26:2815–21.

6 Mouse Model: Telomeres and Telomerase in Stem Cell and Cancer

167

100. Asha S. M, Sandy Chang. WRN at telomeres: implications for aging and cancer. J Cell Sci 2007;120:713–21. 101. Lombard DB, Beard C, Johnson B, et al. Mutations in the WRN gene in mice accelerate mortality in a p53-null background. Mol Cell Biol 2000;20:3286–91. 102. Chang S, Multani AS, Cabrera NG, et al. Essential role of limiting telomeres in the pathogenesis of Werner syndrome. Nat Genet 2004;36:877–82. 103. Du X, Shen J, Kugan N, et al. Telomere shortening exposes functions for the mouse Werner and Bloom syndrome genes. Mol Cell Biol 2004;24:8437–46. 104. Hackett JA, Greider CW. End resection initiates genomic instability in the absence of telomerase. Mol Cell Biol 2003;23:8450–61. 105. Maringele L, Lydall D. EXO1-dependent single-stranded DNA at telomeres activates subsets of DNA damage and spindle checkpoint pathways in budding yeast yku70Delta mutants. Genes Dev 2002;16:1919–33. 106. Maringele L, Lydall D. EXO1 plays a role in generating type I and type II survivors in budding yeast. Genetics 2004;166:1641–9. 107. Wei K, Clark AB, Wong E, et al. Inactivation of Exonuclease 1 in mice results in DNA mismatch repair defects, increased cancer susceptibility, and male and female sterility. Genes Dev 2003;17:603–14. 108. Schaetzlein S, Kodandaramireddy NR, Ju Z, et al. Exonuclease-1 deletion impairs DNA damage signaling and prolongs lifespan of telomere-dysfunctional mice. Cell 2007;130:863–77. 109. Siegl-Cachedenier I, Munoz P, Flores JM, Klatt P, Blasco MA. Deficient mismatch repair improves organismal fitness and survival of mice with dysfunctional telomeres. Genes Dev 2007;21:2234–47.

Chapter 7

Role of Telomeres and Telomerase in Cancer Keiko Hiyama, Eiso Hiyama, Keiji Tanimoto, and Masahiko Nishiyama

Abstract Cancer cells are distinguished from normal cells by two major characteristics: lack of regulation and limitation in their proliferation. The former is essential and represented as ‘‘transformed’’ with anchorage independency and invasive capabilities, while the latter is not a prerequisite but highly associated and represented as ‘‘immortal’’ concomitant with activation of telomerase. Telomerase is activated in around 80% of human cancers but not in usual somatic cells, and it is responsible for the indefinite proliferation capacity of cancer cells. Therefore, it is natural for physicians to expect telomerase to be useful as a diagnostic and therapeutic target in human cancers. In this chapter, we will overview the characteristics of telomeres and telomerase in human cancers. Keywords: Telomere shortening, Telomerase activation, Cancer cell, Cancer stem cell.

7.1

Introduction

Telomerase is activated in around 80% of human cancers (1) (see Chap. 8) but not in usual somatic cells, and it is responsible for the indefinite proliferation capacity of cancer cells. The original convincing explanation of telomere dynamics in cancer cells according to ‘‘two mortality stage mechanisms’’ (2) and ‘‘telomere hypothesis’’ (3) (see Chap. 1) is as follows: when normal somatic cells are transformed and obtain extended lifespan at ‘‘mortality stage 1 (M1)’’ or earlier by inactivation of tumor suppressors p16/Rb and p53 [reviewed in (4)], and/or activation of oncogenes and mitogenic signaling pathways, they do not have telomerase activity yet. Since cancer cells proliferate more rapidly than normal cells in general, their telomeres become shorter than those in adjacent normal cells of same origin (5). When telomere length is critically shortened at ‘‘mortality stage 2 (M2)’’ after K. Hiyama(*) Department of Translational Cancer Research, Research Institute for Radiation Biology and Medicine, Hiroshima University, 1-2-3 Kasumi, Minami-ku, Hiroshima, 734-8551, Japan, e-mail: khiyama@ hiroshima-u.ac.jp

K. Hiyama (ed.), Telomeres and Telomerase in Cancer. DOI: 10.1007/978-1-60327-879-9_7, # Humana Press, a part of Springer Science + Business Media, LLC 2009 171

172

K. Hiyama et al.

Fig. 7.1 Telomere length and telomerase activity in lung cancer tissues (left) and cell lines (right). In all histology, including that of both tissues and cell lines, telomere lengths vary more widely in cancer cells with high telomerase activity than in those with nil or low telomerase activity. SCLC: small cell lung cancer. The hatched area is the range of mean
SD of telomere length in adjacent noncancerous bronchial epithelia

subsequent cell proliferation, most transformed cells die. Only some populations that have eventually activated telomerase can survive this ‘‘crisis’’, and now they can proliferate indefinitely as immortal cancer cells. Telomerase activation event in cancer cells is usually irreversible, and their telomere length is maintained indefinitely. However, the telomere length is various, shortened to elongated, possibly by the balance of telomere binding proteins rather than telomerase activity level [reviewed in (6), see Chap. 2]. Meanwhile, telomere lengths in cancer cells before activating telomerase, i.e., before acquiring immortality, are considered to be determined by the number of cell divisions they have experienced and are comparable or shortened than those in normal cells. In fact, telomere lengths in cancer tissues with nil/low telomerase activity are usually slightly shortened than those in normal tissues; remaining are a few cases with apparently shortened telomeres (Fig. 7.1). On the contrary, telomeres in cancers with high telomerase activity, typically in human carcinoma-derived cell lines that are always associated with high telomerase activity, show various lengths, and only a small population shows comparable length with normal cells. However, exceptional pathways have been found: telomerase can be activated in normal somatic cells by external stimuli before transformation, and such cells are susceptible to cancer development (7). Furthermore, recent advances in stem cell research in solid tumors have provided another pathway of acquiring telomerase activity and immortality in cancer cells: if a cancer stem cell has originated from a normal stem cell that innately has telomerase activation capacity (Fig. 7.2), the cancer stem cell and the descendent cancer cells do not necessarily experience the M1 and M2 stages, and they innately have a capacity for immortalization, since activation of telomerase in cancer cells is usually an irreversible event. In fact, we found that almost all cancer cells that originated from telomerase-positive cells showed telomerase expression (7).

7 Role of Telomeres and Telomerase in Cancer

Germ cell

Blastula

173

Telomerase Activity Competent High None Low

Germ cell

Next generation

Cancer cell Telomere (immortal) stabilized

(Embryonic stem cell)

(immortal)

Progenitor cell

Cell Growth

Telomere shortening (mortal) Cancer cell (mortal)

Cancer stem cell Stem cell Sperm Ovum Soma

fertilization

Fetus

apoptosis

Soma

After Birth

senescence

Age

Fig. 7.2 Telomeres and telomerase dynamics in human cells [modified from (8)]. Telomerase activity is high in rapid proliferating germ cells, diminished in nonproliferating sperms and ova, and again highly activated after fertilization and maintained in germ cells for the next generation. In the developing fetus, telomerase activity gradually decreases and diminishes in most somatic cells after birth. In adult stem cells, the level of telomerase activity is low or undetectable but upregulated in committed progenitor cells. It is likely that a telomerase-positive normal stem cell would be transformed to a telomerase-positive cancer stem cell that can initiate cancer development, but it has not been proven yet whether a telomerase-negative normal somatic cell can be transformed to a telomerase-positive cancer stem cell, or can develop a cancer directly without intervening cancer stem cells. It is considered that normal stem cells are mortal and finally senesce by telomere shortening, while cancer stem cells are immortal maintaining stable telomere length

Thus, we now consider that the mechanism of acquiring immortality in cancer cells can be divided roughly into two pathways: one is from telomerase-negative normal cells through original two mortality stage mechanisms (9, 10) (Fig. 7.3, upper), and another is from telomerase-positive normal cells, typically from normal stem cells through cancer stem cells (Fig. 7.3, lower). The consequent cancers in the former mechanism show a gradual increase of telomerase activity according to cell divisions and clonal selection of telomerase-positive cancer cells, while those in the latter show high telomerase activity from the early stage. However, while hematopoietic malignancies show evidence that either of hematopoietic stem cells, multipotent progenitors, common myeloid progenitors, and granulocyte/macrophage progenitors can potentially become leukemic stem cells (11, 12) (see Chap. 9), which among normal stem cells, committed progenitor cells, or differentiated telomerase-negative somatic cells can become cancer stem cells and develop solid tumors still remains to be elucidated.

174

K. Hiyama et al. Primary lesion

Metastatic lesion

metastasis rare

: telomerase negative cancer cell : telomerase positive cancer cell

Apoptosis

rare

various length

Normal somatic cell

various length

Telomere

+

+

Clonal selection various length

Telomerase activated somatic cell Indefinite proliferation Normal stem cell

Telomere

Cancer stem cell various telomere length various length

various length

various length various length

Fig. 7.3 Hypothetical model of telomeres and telomerase in primary and metastatic lesions of human cancer. Human cancers may be developed from telomerase-negative normal cells (upper) and telomerase-positive normal cells, typically from normal stem cells through cancer stem cells (lower). In the former mechanism, the population of cancer cells that have activated telomerase in mutational manner increases according to tumor development through clonal selections, while in the latter, cancer cells have high telomerase activity from an early stage

7.2

Telomerase in Carcinogenesis and Cellular Immortalization

In vivo, from normal cells to cancer cells, there are many pathways involving many responsible genes, such as oncogenes, tumor suppressor genes, and signal transduction promoting genes. Therefore, if one of these genes were used as a molecular target of anticancer strategy, it would work on only a small population of cancer patients. However, in view of the high positivity of telomerase expression in all kinds of human cancers, the pathway from mortal to immortal cancer cells may be straight in which telomerase is the most responsible factor; remaining are rare exceptions such as the ALT (alternative lengthening of telomeres, see Chap. 5) mechanism in sarcomas (Fig. 7.4). In early stages of carcinogenesis, cancer cells do not necessarily require telomerase activity until their telomere lengths become critically shortened, since carcinogenesis and cellular immortalization are independent events. However, in advanced stages, most cancer cells have experienced several clonal selections, especially those in metastatic lesions since metastasis itself adds at least one clonal selection, and subsequently many cell divisions. At these stages, most cancer cells depend on telomerase to continue their proliferation. Moreover, activation of telomerase itself likely provides more malignant potential, such as metastasis. Then, telomerase activity is higher in metastatic lesions than in primary lesions, in advanced tumors than in early-stage tumors, and in poor prognosis patients than in good prognosis patients, in general (see Chap. 8). In vitro, disruption of the p53 and Rb pathways by large-T, oncogenic ras, i.e., mutated H-ras or K-ras, and telomerase in normal human fibroblasts, embryonic

Anchorage dependent

7 Role of Telomeres and Telomerase in Cancer

175

finite telomerase activation Normal somatic cell

Elongated lifespan

never immortalized in vivo

(Stem cell/lymphocyte)

Anchorage independent

various genetic changes irreversible telomerase activation Immortal cancer cell

Mortal cancer cell ALT Mortal

Immortal

Fig. 7.4 Carcinogenesis and immortalization of human cells in vivo. Normal somatic cells, even stem cells or lymphocytes that have a capacity of telomerase activation upon proliferation, cannot be immortalized in vivo. On the contrary, once telomerase activation occurs in cancer cells, it is usually irreversible and such cancer cells are easily immortalized. Whereas key genes responsible for cellular transformation are heterogenous among the individuals, those for cellular immortalization are considered to be relatively monotonous, mostly ‘‘telomerase’’ except for ALT (alternative lengthening of telomeres) or other rare events

kidney cells (13), or breast epithelial cells (14) suffices to create a human tumor cell (Fig. 7.5). However, a combination of four genetic alterations, overexpression of TERT, bypassing p16 (by cdk4 overexpression) and p53 (by siRNA knockdown) pathways, and mutant K-ras(V12) or mutant EGFR, was still not sufficient for human bronchial epithelial cells (HBECs) to completely transform to cancer (15). It is likely that although cdk4 overexpression can compensate SV40ER to immortalize normal epithelial cells, e.g., skin keratinocytes (16) and bronchial epithelial cells (17), in combination with TERT overexpression, the cdk4 is not sufficient to make tumorigenic cancer cells in combination with TERT and oncogenic ras. Immortal nontumorigenic epithelial cells can be produced by SV40 early region (ER) + TERT, cdk4 + TERT (16), or organ-specific TERT + BRCA2 mutation in mammary epithelial cells (18). On the contrary, immortal nontumorigenic mesenchymal cells, fibroblasts (19), and endothelial cells (20) can be produced by TERT only, although at low frequency. We previously reported that differentially expressed genes during cellular immortalization of noncancerous cells are quite different from those expressed in immortal cancer cells (21). Although it is an established fact that telomerase is the critical factor for cellular immortalization both for noncancerous and cancer cells, the additional molecules required for cellular immortalization may be different between noncancerous cells and cancer cells, or even among noncancerous cells according to their origin.

176

K. Hiyama et al.

Nomal fibroblast

Nomal epithelial cell

lifespan elongated, TERT sometimes immortalized

SV40 ER

Transformed and lifespan elongated

No elongation of lifespan

TERT SV40 ER

Transformed but fall into apoptosis

Immortalized without tumorigenicity

lifespan elongated or immortalized without tumorigenicity Activated ras Immortal and tumorigenic (= Immortal cancer cell in vivo)

Fig. 7.5 Transformation and immortalization of human cells in vitro. TERT alone transfection sometimes immortalizes normal fibroblasts but not normal epithelial cells. SV40 early region (SV40ER) immortalizes neither. Although cotransfection of TERT and SV40ER can immortalize both, they do not have tumorigenicity. Addition of oncogenic ras, mutated H-ras or K-ras, makes them genuine immortal cancer cells with tumorigenicity (13)

7.3

Additional Roles of Telomerase in Tumorigenesis

The key role of telomerase is undoubtedly compensation of the telomere degradation due to end-replication problem (22, 23). However, it is revealed to have some additional roles that predispose the cells to tumorigenesis and metastasis as follows: ALT cells can maintain long telomeres without telomerase activity. Therefore theoretically, induction of telomerase in ALT cells provides no biological advantage in maintaining telomeres. However, ectopic expression of TERT in these cells imparted a tumorigenic phenotype, and this outcome was also observed after introduction of a mutant TERT that retained catalytic activity but was incapable of maintaining telomere length (24). Another evidence has shown that transformed mTerc/ cells derived from a telomerase RNA knockout mouse without telomerase activity lacked the capacity to form lung metastases in immunocompromised mice after tail-vein injection, whereas mTerc reconstitution alone conferred robust metastatic activity (25). Knockdown of hTR by siRNA or overexpression of mutant hTR rapidly inhibited growth of human cancer cells independently of p53 or telomere length (26). We have shown human evidence in vivo that histologically ‘‘normal’’ bronchial epithelia in smokers may unphysiologically express telomerase as a field, and such epithelia are likely susceptible to develop lung cancer (7). These studies indicate that telomerase confers an additional function that promotes tumorigenesis and increase of malignant potential independent with its ability to maintain telomeres.

7 Role of Telomeres and Telomerase in Cancer

7.4

177

Telomeres and Telomerase in Cancer Stem Cells

‘‘Stem cell’’ is a cell that has two principal abilities: one is to reproduce itself for long periods (self-renewal capacity throughout the lifetime) and another is to differentiate into multiple cell types (multipotency), by asymmetric and symmetric cell divisions (27) (see Chap. 6). ‘‘Cancer stem cell’’ is a ‘‘cancer-initiating cell’’ with stem cell properties, i.e., the ability to self-renew and differentiate into heterogenous lineages of cancer cells, but it does not necessarily have the multipotency. The reported cancer stem cell markers are organ-specific, such as CD34 + CD38-Thy1-Lin- for hematopoietic, CD133 for brain, colon, hepatocellular, lung, and prostate, CD44 for breast, pancreas, and prostate, and CD20 for melanoma [reviewed in (28, 29)], but a common feature is telomerase expression. All cancer stem cells are considered to have the capacity for telomerase expression; nevertheless in normal stem cells, mesenchymal stem cells are known to be exceptionally telomerase undetectable or detectable at very low levels possibly with an unique mechanism of minimizing the telomere shortening [(30), reviewed in (8)]. It was reported that also in induced pluripotent stem (iPS) cells, their reprogramming step was always accompanied by telomerase activation (31, 32). However, since the purification of cancer stem cells has not been successful yet, especially in solid tumors, whether telomerase expression is the prerequisite for ‘‘stemness,’’ stem cell phenotype, is unproven yet.

7.5

Application to Anticancer Strategy

An ideal anticancer drug should be effective in all cancers without influence on normal cells. Telomerase is (1) expressed in all kinds of human cancers (overall around 80% of clinical tumors), (2) not expressed in most of normal somatic cells (exceptionally lymphocytes and stem/progenitor cells in renewal tissues have telomerase expression at low levels), (3) involved not only in maintaining telomeres, which is a prerequisite ability for indefinite proliferation, but also in promoting tumorigenesis and acquiring more malignant potential such as metastasis, and (4) fatally expressed in cancer stem cells possibly playing a role in maintaining self-renewal capacity. Considering that normal stem cells may have longer telomeres than cancer stem cells, telomerase may be one of the most ideal molecular targets in anticancer therapy [reviewed in (33)]. Then, many strategies targeting telomeres and telomerase have been proposed [reviewed in (34), see Chaps. 10–13]: (1) telomerase inhibitors, (2) G-quadruplex stabilizing molecules targeting telomeres, (3) antisense oligo targeting hTR, (4) TERT peptide for immunotherapy, (5) telomere binding protein inhibitors, and (6) gene therapy using TERT or hTR promoter-driven cell toxicity. Historically, early experimental studies on human telomerase used telomerase inhibitors, such as a nucleoside analog ddG, a known inhibitor of retroviral reverse transcriptases

178

K. Hiyama et al.

azidothymidine (AZT) (35), and hammerhead ribozymes (36). They could repress human telomerase activity in cell-free system, but showed less effects on telomere shortening and growth inhibition of cell lines. Now, the most clinically expected telomerase inhibitor is GRN163L (37), a lipidated antisense oligo against hTR, and its phase I and II clinical trials for both solid tumors and leukemia are going on (see Chap. 10). Another promising strategy is immunotherapy targeting TERT peptides, such as GV1001 (38–40), and several phase I to phase III clinical trials have been completed or are going on (see Chap. 10). Also, TERT promoter-driven oncolytic virus Telomelysin (41) is in clinical trial (see Chap. 13). These immunotherapy targeting TERT epitopes and telomerase promoter-driven gene therapy, as well as G-quadruplex stabilizer targeting telomeres (see Chap. 11), are expected to show rapid killing of cancer cells, since telomerase inhibitors theoretically require duration of anticancer effects until telomeres in cancer cells are critically shortened. However, this disadvantage of telomerase inhibitor may be covered by combined use with conventional therapy, e.g., with paclitaxel and carboplatin for nonsmall cell lung cancer (NCT00510445), hyperthermia and radiotherapy (42), or tankylase I (see Chap. 12). Moreover, inhibition of ‘‘an additional unknown function of telomerase’’ that promotes tumorigenesis and increase of malignant potential independent with its ability to maintain telomeres (see earlier point 3) may be another factor that would make the effects of telomerase inhibitors to be manifested earlier than the critical shortening of telomeres. Until now, no significant toxicity to normal tissues has been reported in any clinical trials targeting telomerase and certain effects on cancer toxicity have been observed. Still, many new compounds targeting telomeres and telomerase are sitting on the lab bench. We expect these drugs to be integrated in the standard therapies of various cancers, especially targeting cancer stem cells, in the near future.

References 1. Shay JW, Bacchetti S. A survey of telomerase activity in human cancer. Eur J Cancer 1997;33:787–91. 2. Shay JW, Pereira-Smith OM, Wright WE. A role for both RB and p53 in the regulation of human cellular senescence. Exp Cell Res 1991;196:33–9. 3. HarleyCB. Telomere loss: mitotic clock or genetic time bomb? Mutat Res 1991;256:271–82. 4. Shay JW, Wright WE. Senescence and immortalization: role of telomeres and telomerase. Carcinogenesis 2005;26:867–74. 5. Hastie ND, Dempster M, Dunlop MG, et al. Telomere reduction in human colorectal carcinoma and with ageing. Nature 1990;346:866–8. 6. de Lange T. Shelterin: the protein complex that shapes and safeguards human telomeres. Genes Dev 2005;19:2100–10. 7. Miyazu YM, Miyazawa T, Hiyama K, et al. Telomerase expression in noncancerous bronchial epithelia is a possible marker of early development of lung cancer. Cancer Res 2005;65:9623–7.

7 Role of Telomeres and Telomerase in Cancer

179

8. Hiyama E, Hiyama K. Telomere and telomerase in stem cells. Br J Cancer 2007;96:1020–4. 9. Hiyama E, Hiyama K, Yokoyama T, et al. Correlating telomerase activity levels with human neuroblastoma outcomes. Nat Med 1995;1:249–55. 10. Hiyama K, Hiyama E, Ishioka S, et al. Telomerase activity in small-cell and non-small-cell lung cancers. J Natl Cancer Inst 1995;87:895–902. 11. Chumsri S, Matsui W, Burger AM. Therapeutic implications of leukemic stem cell pathways. Clin Cancer Res 2007;13:6549–54. 12. Cozzio A, Passegue E, Ayton PM, et al. Similar MLL-associated leukemias arising from selfrenewing stem cells and short-lived myeloid progenitors. Genes Dev 2003;17:3029–35. 13. Hahn WC, Counter CM, Lundberg AS, et al. Creation of human tumour cells with defined genetic elements. Nature 1999;400:464–8. 14. Ince TA, Richardson AL, Bell GW, et al. Transformation of different human breast epithelial cell types leads to distinct tumor phenotypes. Cancer Cell 2007;12:160–70. 15. Sato M, Vaughan MB, Girard L, et al. Multiple oncogenic changes (K-RAS(V12), p53 knockdown, mutant EGFRs, p16 bypass, telomerase) are not sufficient to confer a full malignant phenotype on human bronchial epithelial cells. Cancer Res 2006;66:2116–28. 16. Ramirez RD, Herbert BS, Vaughan MB, et al. Bypass of telomere-dependent replicative senescence (M1) upon overexpression of Cdk4 in normal human epithelial cells. Oncogene 2003;22:433–44. 17. Ramirez RD, Sheridan S, Girard L, et al. Immortalization of human bronchial epithelial cells in the absence of viral oncoproteins. Cancer Res 2004;64:9027–34. 18. Lewis CM, Herbert BS, Bu D, et al. Telomerase immortalization of human mammary epithelial cells derived from a BRCA2 mutation carrier. Breast Cancer Res Treat 2006;99:103–15. 19. Morales CP, Holt SE, Ouellette M, et al. Absence of cancer-associated changes in human fibroblasts immortalized with telomerase. Nat Genet 1999;21:115–18. 20. Venetsanakos E, Mirza A, Fanton C, et al. Induction of tubulogenesis in telomerase-immortalized human microvascular endothelial cells by glioblastoma cells. Exp Cell Res 2002;273:21–33. 21. Hiyama K, Otani K, Ohtaki M, et al. Differentially expressed genes throughout the cellular immortalization processes are quite different between normal human fibroblasts and endothelial cells. Int J Oncol 2005;27:87–95. 22. Olovnikov AM. Principle of marginotomy in template synthesis of polynucleotides (Russian). Dokl Akad Nauk SSSR 1971;201:1496–9. 23. Watson JD. Origin of concatemeric T7 DNA. Nat New Biol 1972;239:197–201. 24. Stewart SA, Hahn WC, O’Connor BF, et al. Telomerase contributes to tumorigenesis by a telomere length-independent mechanism. Proc Natl Acad Sci USA 2002;99:12606–11. 25. Chang S, Khoo CM, Naylor ML, et al. Telomere-based crisis: functional differences between telomerase activation and ALT in tumor progression. Genes Dev 2003;17:88–100. 26. Li S, Rosenberg JE, Donjacour AA, et al. Rapid inhibition of cancer cell growth induced by lentiviral delivery and expression of mutant-template telomerase RNA and anti-telomerase short-interfering RNA. Cancer Res 2004;64:4833–40. 27. Morrison SJ, Kimble J. Asymmetric and symmetric stem-cell divisions in development and cancer. Nature 2006;441:1068–74. 28. Li F, Tiede B, Massague J, et al. Beyond tumorigenesis: cancer stem cells in metastasis. Cell Res 2007;17:3–14. 29. Vermeulen L, Sprick MR, Kemper K, et al. Cancer stem cells – old concepts, new insights. Cell Death Differ 2008;15:947–58. 30. Zhao YM, Li JY, Lan JP, et al. Cell cycle dependent telomere regulation by telomerase in human bone marrow mesenchymal stem cells. Biochem Biophys Res Commun 2008;369:1114–19. 31. Takahashi K, Tanabe K, Ohnuki M, et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 2007;131:861–72.

180

K. Hiyama et al.

32. Stadtfeld M, Maherali N, Breault DT, et al. Defining molecular cornerstones during fibroblast to iPS cell reprogramming in mouse. Cell Stem Cell 2008;2:230–40. 33. Shay JW, Keith WN. Targeting telomerase for cancer therapeutics. Br J Cancer 2008;98:677–83. 34. Harley CB. Telomerase and cancer therapeutics. Nat Rev Cancer 2008;8:167–79. 35. Strahl C, Blackburn EH. Effects of reverse transcriptase inhibitors on telomere length and telomerase activity in two immortalized human cell lines. Mol Cell Biol 1996;16:53–65. 36. Kanazawa Y, Ohkawa K, Ueda K, et al. Hammerhead ribozyme-mediated inhibition of telomerase activity in extracts of human hepatocellular carcinoma cells. Biochem Biophys Res Commun 1996;225:570–6. 37. Herbert BS, Gellert GC, Hochreiter A, et al. Lipid modification of GRN163, an N30 !P50 thiophosphoramidate oligonucleotide, enhances the potency of telomerase inhibition. Oncogene 2005;24:5262–8. 38. Brunsvig PF, Aamdal S, Gjertsen MK, et al. Telomerase peptide vaccination: a phase I/II study in patients with non-small cell lung cancer. Cancer Immunol Immunother 2006;55:1553–64. 39. Bernhardt SL, Gjertsen MK, Trachsel S, et al. Telomerase peptide vaccination of patients with non-resectable pancreatic cancer: a dose escalating phase I/II study. Br J Cancer 2006;95:1474–82. 40. Kokhaei P, Palma M, Hansson L, et al. Telomerase (hTERT 611-626) serves as a tumor antigen in B-cell chronic lymphocytic leukemia and generates spontaneously antileukemic, cytotoxic T cells. Exp Hematol 2007;35:297–304. 41. Taki M, Kagawa S, Nishizaki M, et al. Enhanced oncolysis by a tropism-modified telomerasespecific replication-selective adenoviral agent OBP-405 (‘Telomelysin-RGD’). Oncogene 2005;24:3130–40. 42. Agarwal M, Pandita S, Hunt CR, et al. Inhibition of telomerase activity enhances hyperthermia-mediated radiosensitization. Cancer Res 2008;68:3370–8.

Chapter 8

Diagnostic Value I: Solid Tumors Eiso Hiyama and Keiko Hiyama

Abstract Telomerase, a critical enzyme responsible for continuous cell growth, is usually repressed in somatic cells except for lymphocytes and self-renewal progenitor cells but is activated in approximately 80% of human cancers and sarcoma tissues. Among the two essential components of human telomerase, human telomerase reverse transcriptase (TERT) and human telomerase RNA (hTR), TERT is a catalytic component and hTR component is a template for telomerase-mediated telomere elongation. In the past decade, many studies have been undertaken to examine telomerase activity and TERT expression in various human cancers and related lesions. In malignant tumors in which telomerase activation occurs at the early stages of the disease, telomerase activity and TERT expression are useful markers for the detection of cancer cells. In tumors in which telomerase is upregulated in the precancerous lesions, they become useful indicators for the screening of high-risk groups. In other cancers in which telomerase becomes upregulated upon tumor progression, they are useful as prognostic indicators. However, careful attention should be paid to false-negative results caused by the instability of telomerase or TERT mRNA and the presence of PCR inhibitors as well as to false-positive results caused by the presence of alternatively spliced TERT mRNA and normal cells with telomerase activity. Recently, methods for the in situ detection of the TERT expression have been developed. These methods would facilitate the unequivocal detection of cancer cells, even in tissues containing a background of normal telomerase-positive cells. Keywords: Telomerase, Human telomerase reverse transcriptase (TERT), Fine needle aspiration, Cytology, Telomeric repeat amplification protocol (TRAP), Diagnosis, Prognosis, In situ hybridization (ISH), Immunohistochemistry (IHC).

E. Hiyama(*) Natural Science Center for Basic Research and Development, Hiroshima University, 1-2-3 Kasumi, Minami-ku, Hiroshima 734-8551, Japan, e-mail: [email protected]

K. Hiyama (ed.), Telomeres and Telomerase in Cancer. DOI: 10.1007/978-1-60327-879-9_8, # Humana Press, a part of Springer Science + Business Media, LLC 2009 181

182

8.1

E. Hiyama, K. Hiyama

Introduction

Malignant tumors including carcinoma and sarcoma are diseases characterized by uncontrolled proliferation and invasion into surrounding tissues or distant organs. Most somatic human cells lack telomerase activity, have a limited lifespan, and require the activation of telomerase for extended lifespan. Although telomerase activation is not always concomitant with carcinogenesis, its presence is in 78% of more than 8,000 tumor samples analyzed (Table 8.1). Among them, more than 80% of 7,000 adult cancer specimens excluding brain tumors, sarcomas, and childhood tumors exhibited telomerase activation, suggesting that telomerase activity is one of the most universal tumor markers of human cancers (136–138). Some reports revealed that telomerase activity is upregulated during mouse tumorigenesis in spite of the fact that mice have very long telomeres (139, 140). The SV40 large T antigen was introduced into human cells to allow them to bypass senescence. Telomerase and oncogenic ras (H-rasV12) were then sequentially added to these senescence-overcoming cells in rapid succession. Cells that expressed all three genes were capable of anchorage-independent growth in vitro and growth in nude mice (141). These observations have suggested that telomerase may promote tumorigenesis independently of telomere length. By stabilizing telomeres and supporting the indefinite growth of most cancer cells, telomerase most certainly plays a crucial role in the progression and maintenance of tumors. Telomerase is considered to be activated in various steps during the multistep process of carcinogenesis. In some instances, telomerase may already be ubiquitously expressed at the preneoplastic or in situ stage, while in other instances, the enzyme may be activated gradually with cancer progression (135, 142, 143). This difference may affect the clinical utility of telomerase as a tumor marker, and it is especially crucial in dictating whether telomerase might be clinically useful for screening of high-risk patients, early diagnosis, or prognostic purposes. Although most somatic human cells lack telomerase activity, some tissues contain specialized cells, including germ cells, lymphocytes, stem or its progenitor cells, or certain epithelial cells, that display weak levels of telomerase activity, which can be upregulated concomitantly with growth signals. In the tissues containing such cells, in situ detection of telomerase is needed to determine whether telomerase expression is derived from normal telomerase-positive cells or from malignant cells. The present article reviews the use of human telomerase and TERT as a cancer diagnostic marker for early detection and as a prognostic one for predicting the outcome for individual patients. Human telomerase activity is associated with the expression of two major components: human telomerase RNA (hTR) (144) and human telomerase reverse transcriptase (TERT) (145). Recent studies have focused on the expression of these two components as surrogates for telomerase activity and discussed their value as tumor markers. Since hTR is expressed at low levels in all cells, including cells that lack telomerase activity (146), detection of the TERT mRNA is considered to be a more reliable marker of the presence of cancer cells in clinical samples. In situ

8 Diagnostic Value I: Solid Tumors

183

Table 8.1 A survey for telomerase activity in human tumors Organs/tumors Positive ratio for telomerase activity (positive/total number) Normal/adjacent Nonmalignant Malignant tissue lesion tumor Brain Glioblastoma Astrocytoma Oligodendroglioma Meningioma

0% (0/9)

75% (45/60) 10% (2/20) 100% (19/19) 50% (26/52)

References

(1)

Head and neck Oral

7.7% (3/39)

54.3% (25/46)

Thyroid

9% (9/100)

29.2% (26/89)

Parathyroid Breast

2.6% (1/38) 4% (4/100)

4.2% (2/47) 14.8% (11/74)

Lung Nonsmall cell carcinoma Small cell carcinoma

4.4% (3/68)

6.6% (10/152)

86.2% (112/130) 55.3% (73/132) 80% (12/15) 87.3% (502/575) 72.0% (956/1328) 92.3% (48/52)

(2–6) (7–9) (10–13)

(14–17)

Digestive organs Esophagus

72.7% (216/297)

Barrett’s esophagus Stomach

68.8% (22/32) 15.7% (64/408)

44.7% (21/47) 95.5% (85/89)

Colon

22.8% (69/302)

27.6% (37/134)

Liver

12.3% (19/154)

51.9% (40/77)

Hepatocellular carcinoma Hepatoblastomaa Biliary duct Pancreas Duct cell carcinoma

9.8% (4/41) 5.3% (5/95)

94.4% (270/286)

31.0% (53/171) 0% (0/25) 3.6% (2/55)

85.2% (595/698) 87.3% (331/379)

(18–21) (22) (23–35) (36–41)

87.0% (537/617) 66.7% (26/39) 65.2% (30/46)

(42–53) (54) (55, 56) (57–62)

84.0% (142/169)

Endocrine organs Pancreas Endocrine carcinoma Adrenal gland Adrenocortical Phenochromocytoma Genitourinary organs Kidney Renal cell carcinoma

15% (6/40)

(63, 64)

15.6% (17/109) 6.5% (2/31)

67.6% (25/37) 62.5% (5/8)

(65–69)

7.1% (1/14)

76.9% (409/532)

0% (0/62)

2.1% (8/386) (70–79) (continued )

184 Table 8.1 (continued) Organs/tumors

Nephroblastomaa Bladder Prostate Testis Ovary Uterus/endmetrial Uterus/cervical Skin Squamous cell carcinoma Basal cell carcinoma Melanoma Sarcoma Malignant histiocytoma Liposarcoma Rhabdomyosarcoma Osteosarcoma Leiomyosarcoma Childhood tumor Retinoblastoma Neuroblastoma

E. Hiyama, K. Hiyama

Positive ratio for telomerase activity (positive/total number) Normal/adjacent Nonmalignant Malignant tissue lesion tumor 79.3% (69/87) 9.8% (9/92) 36.2% (21/58) 84.4% (552/654) 7.4% (5/68) 20.5% (34/166) 87.3% (254/291) 100% (7/7) 100% (1/46) 100% (82/82) 38.0% (11/29) 45.5% (15/33) 68.5% (100/146) 57.0% (77/135) 76% (19/25) 96.0% (143/149) 6.2% (12/193) 60.8% (110/181) 89.5% (350/391) 24% (6/25) 28.6% (12/42) 60% (18/30)

0% (0/12)

6.7% (6/89)

(0/14)

92.2% (83/90) 71.8% (28/39) 52.9% (312/590) (1/12)

References

(80) (81–92) (93–100) (101, 102) (103) (103–108) (109–117)

(118)

(119–129)

(1/5) (0/1) (20/47) (2/6)

46.5% (20/43) (130) 61.0% (131–134) (178/292) Germ cell tumor 25% (1/4) 100% (27/27) (101) These percentages were calculated from the review paper (135) and subsequent numerous reports in addition to our unpublished data a Childhood malignancy 0% (0/13)

0% (0/6)

analysis for detection of TERT is very useful for evaluation of the source of telomerase activity in the tissue samples. However, the existence of splicing variants of the TERT mRNA that fail to produce, or even negatively suppress telomerase activity (147) can also be problematic for the use of the TERT mRNA as a surrogate for telomerase activity. On the other hand, immunohistochemical (IHC) detection of TERT is applicable for formalin-fixed tissues and does not require specialized equipment for detection; TERT IHC is predicted to become a powerful new technology for cancer detection.

8 Diagnostic Value I: Solid Tumors

8.2

185

Detecting Human Telomerase/TERT in Clinical Materials of Human Malignant Tumors

Telomerase can be measured by a PCR-based assay called telomeric repeat amplification protocol (TRAP) (148), which is quite sensitive and can detect as few as ten telomerase-positive cells (149). A number of modified TRAP assays or related telomerase detection assays have been developed (see Chap. 14). With the high sensitivity of these assays, telomerase activity can also be detected in certain normal somatic tissues, especially in proliferative progenitor cells and/or stem cells of self-renewing tissues (such as intestinal epithelium) and activated lymphocytes (150–152). Moreover, the low level of telomerase activity is also detected in some benign tumors such as fibroadenomas of the breast (153), hyperplastic nodule/adenomas of the thyroid (154), and colon adenomas (151). Generally, telomerase activity in normal somatic cells tends to be much lower in comparison to that detected in malignant cells. In clinical cancer tissues containing viable cancer cells, the levels of telomerase activity are significantly higher than those of matched control tissues but some cancer cells do not show telomerase activation (135). Although the ratios of telomerase-positive tumors are wide-ranging, the overall ratio of cancers with telomerase activity is approximately 80% (Table 8.1). The survey of telomerase activity in human sarcoma revealed that telomerase-activated tumors are less frequent than in cancer, partially due to the alternative lengthening of telomeres (ALT) mechanism that maintains long telomeres in some part of sarcoma. Thus, the presence of telomerase activity has been detected in the majority of cases but the frequency of tumors with detectable telomerase is variable. The data obtained by the modified semiquantitative TRAP assay revealed that the levels of telomerase activity are low in normal somatic cells; however, those of activated lymphocytes showed high activity, which is sometimes equivalent to that of cancer cells (150). Accordingly, when cell samples are examined, we recommend using a 1,000-cell-equivalent cell lysate per assay to avoid false-positive results due to contamination with lymphocytes, as proteins extracted from 1,000 adult lymphocytes do not produce detectable telomerase activity (150, 155). Moreover, to avoid false-negative results, careful attention should be paid to the degradation of telomerase and the presence of PCR inhibitors when examining clinical specimens (see Chap. 14). The survey of the malignant tumors is listed in Table 8.1. Recent studies have targeted the detection of the TERT mRNA or TERT expression as a tumor marker for cancer diagnosis. The existence of splicing variants of the TERT mRNA is problematic for the use of RT-PCR for the TERT mRNA detection. Moreover, when using RT-PCR or the TRAP assay to detect the TERT mRNA or telomerase activity, the presence of normal telomerase-positive cells, such as lymphocytes or basal epithelial cells, can cause false-positive results. Methodology for the in situ detection of telomerase in individual cells would be expected to solve this problem. An in situ TRAP assay was previously developed to detect the telomerase activity, but this methodology could only be used on fresh

186

E. Hiyama, K. Hiyama

viable cells (156). The use of in situ hybridization (ISH) to detect components of the telomerase complex (hTR and TERT mRNA), on the other hand, would be applicable to fixed tissues. However, hTR is also present at low levels in most cells lacking telomerase activity, and its level does not always correlate with telomerase activity. A better target for ISH detection would be the TERT mRNA, whose levels appear to be closely parallel to those of telomerase activity (157, 158). In situ IHC for detection of TERT is very useful and easy for evaluation of the source of telomerase expression in a wide variety of clinical samples, including archival paraffin-embedded specimens (158–160). Thus, we have a good reason to use these markers: telomerase activity and TERT detection. The TERT protein can now be detected in paraffin-embedded samples and core biopsies with the use of polyclonal or monoclonal antibodies in conjunction with appropriate antigen retrieval (Fig. 8.1) and/or the highly sensitive tyramide-based method of signal amplification (161). Since IHC does not require specialized equipment for detection, TERT IHC is expected to become a powerful new technology for cancer detection.

a

b

Fig. 8.1 Immunohistochemical detection of TERT in cancer samples. An anti-TERT sera (EST21-ATM, Alpha Diagnostic Int. Co., San Antonio, TX) was employed to reveal the presence of the TERT protein in a tissue sample of a pancreatic duct adenocarcinoma (a) and in a brushing sample derived from an adenocarcinoma of the same patient (b). Tumor cells are distinguished by the presence of brown pigments in the nucleus of TERT-positive cells. Staining with 3,30 diaminobenzidine (DAB) was preformed as described previously (57, 159). The cells obtained from the brushing sample were formalin-fixed and paraffin-embedded. For both samples, heatbased antigen retrieval was performed using a citrate buffer (See Color Insert)

8 Diagnostic Value I: Solid Tumors

8.3

187

Telomerase/TERT as Biomarkers for Human Malignant Tumors

Usually, acquiring immortalization by telomere stabilization with telomerase activation was seen as an independent event to carcinogenesis. Although telomerase activation may be one of the critical factors for in vitro transformation, telomerase activation/TERT expression may occur in various stages of tumorigenesis in vivo (Fig. 8.2). By the variability of reported telomerase activity levels in human malignant tumors, the wide variety of studies on the potential use of telomerase as a cancer biomarker have endorsed it as becoming a routine clinical application.

8.3.1

Telomerase in the Screening for High-Risk Premalignant Lesions

In the tumors whose telomerase activation occurs in premalignant lesions, detection of telomerase/TERT is useful as screening for high-risk premalignant lesions and follow-up monitoring of such patients. Histologically ‘‘normal’’ bronchial epithelia

Screening of high risk regions

Telomerase activity hTERT expression

Early detection

Early detection / Prognosis marker

Ad van c Me ed st tas a tas ge is

Car Ear cinom ly s a tag in sit ec anc u er

Dys pla sia

sia erp la Hyp

No rma l

Prognostic marker

Fig. 8.2 Scheme of telomerase activation for cancer diagnosis. Telomerase is activated in various stages of the tumor progression. In the tumors whose telomerase is activated in premalignant lesions, telomerase/TERT detection is useful for the screening of high-risk patients. In the tumors whose telomerase is activated concomitant with carcinogenesis, telomerase/TERT detection is useful for the early detection of cancer. When the levels of telomerase activity gradually increase with tumor progression or telomerase is activated in advanced stages of tumors, telomerase/TERT detection becomes a prognostic marker

188

E. Hiyama, K. Hiyama

in smokers may unphysiologically express telomerase as a field, and such epithelia are likely susceptible to developing lung cancer. Ectopic expression of telomerase in bronchial epithelia may precede transformation in human lung cancer development, and that detection of TERT in noncancerous bronchial epithelia will become a useful marker in detecting high-risk patients for lung cancer development (162). It indicated that chronic carcinogenic insults with tobacco may result in the process of field immortalization (162) such as field cancerization where multiple independent malignant and premalignant foci develop (163). The detection of telomerase in premalignant or normal bronchial mucosa might be an important marker for screening of high-risk lesions. Similarly, glandular dysplasia in Barrett’s esophagus may regress spontaneously but can also progress to cancer in some cases. Telomerase activation merits evaluation as a candidate biomarker for increased risk of persistent dysplasia and cancer progression in Barrett’s esophagus (22). Oral dysplasia revealed the same manner because the telomerase/TERT expression was detectable at the stage of precancerous oral epithelial changes (164). Moreover, TERT mRNA assessment showed high sensitivity for high-grade dysplasia in the cervix (165, 166) and for high-grade lesion (HGPIN) in the prostate. These data may present telomerase or TERT expression in these tissues as an appropriate target/marker for chemoprevention (167).

8.3.2

Telomerase/TERT as a Diagnostic Marker

Recently, there has been an increasing amount of experimental data on the detection of telomerase activity and/or TERT expression in clinical materials as a diagnostic tool for various cancers. In a type of cancer in which telomerase is activated in early stage cancer or in situ carcinoma, it is a most appropriate marker for the early detection of cancer. In other types of cancer in which telomerase is activated during tumor progression, it might be a marker better suited for prognostic/malignant grade. Thus, the diagnostic accuracy mainly depends on the frequency of the tumors with telomerase activation (Table 8.1) as well as the feasibility of the sampling of target tissues. The feasibility and problems of clinical application as a diagnostic marker for each kind of cancer/sarcoma are as follows (detection ratios are summarized in Table 8.2).

8.3.2.1

Head, Neck Tumors, and Esophageal Tumors

Several reports demonstrated telomerase activation in a high percentage (78–95%) of head and neck cancer patients (169–171) (Table 8.1). Although the cells derived from oral washings are not so viable, high telomerase activity is often detected in them in patients with oral malignancy (169, 172). In such specimens, it is difficult to avoid contamination by substances that interfere with PCR, such as necrotic tissue, leukocytes, erythrocytes, dental plaque, and bacteria. The presence of these substances in cancer samples can lead to false-negative results. Thus, the accuracy for

8 Diagnostic Value I: Solid Tumors

189

Table 8.2 Telomerase/TERT mRNA as a diagnostic marker Organs/Samples Telomerase activity Cancer Noncancerous Positive (%) Positive (%) Head and neck

TERT mRNA Cancer Noncancerous Positive (%) Positive (%)

Oral/washing Oral/biopsy

110/195 (56) 25/26 (96)

70/321 (22) 9/41 (22)

21/26 (81) 47/58 (81)

9/39 (23) 11/13 (85)

64/96 (67) 210/265 (79)

23/155 (15) 40/355 (11)

44/57 (77)

15/52 (29)

15/42 (36) 123/188 (65) 86/128 (67)

0/10 (0) 16/211 (8) 0/10 (0)

175/205 (85)

20/155 (13)

10/16 (63) 14/15 (93)

18/71 (25) 6/15 (40)

52/54 (96) 23/29 (79) 20/34 (59) 110/126 (87) 53/86 (62) 4/37 (11) 20/26 (77) 59/72 (82) 18/18 (100) 102/141 (72)

33/48 (69) 10/28 (36) 0/20 (0) 57/148 (39) 17/58 (29) 0/25 (0) 0/10 (0) 2/51 (4)

88/101 (87)

62/192 (32)

32/32 (100) 21/23 (91) 10/20 (50) 6/10 (60) 15/17 (88)

17/49 (35) 17/63 (27) 0/14 (0) 0/6 (0) 2/19 (11)

374/637 (59) 229/302 (76) 46/54 (85) 21/33 (64) 130/166 (78) 105/273 (38) 138/164 (84)

44/488 (9) 6/153 (4) 30/56 (54) 1/21 (5) 19/136 (14) 37/233 (16) 58/158 (37)

159/179 (89) 125/168 (74)

6/169 (4) 19/165 (12)

14/17 (82) 83/104 (80)

11/44 (25) 1/8 (13)

Thyroid and breast Thyroid/FNA Breast/FNA Chest Lung/sputum Lung/brushing, BAL Lung/biopsy Mediastinal LN/FNA Pleural effusion Digestive organs Esophagus/biopsy Stomach/biopsy Colon/washing Colon/biopsy Liver/biopsy Biliary duct/bile Biliary duct/biopsy Pancreas/pancreatic juice Pancreas/FNA Peritoneal lavage

5/117 (4)

Genitourinary organs Bladder/voiding urine Bladder/washing urine Bladder/biopsy Prostate/voiding urinea Prostate/biopsy Uterus/cervical scraping Uterus/biopsy Others Skin/biopsy 130/159 (82) 11/109 (10) Blood/serum 59/95 (62) 0/80 (0) 4/16 (25) 0/23 (0) These percentages were calculated from the review papers (136, 142, 143, 168) and recent numerous reports in addition to our unpublished data BAL bronchoalveolar lavage, FNA fine needle aspirates a Voided urine after prostate massage

190

E. Hiyama, K. Hiyama

cancer diagnosis in these lesions is higher in the samples obtained by scraping or biopsy. In tumor biopsies, telomerase activity and the TERT mRNA are almost always detected at high levels. Since low levels of telomerase activity are detected in the normal epithelia and in approximately 20% of noncancerous biopsy samples, a quantitative TRAP assay may be required for cancer diagnosis when scraping or biopsy samples are examined. Moreover, some reports revealed a rather high frequency of telomerase activation in precancerous/benign tissue specimens and the adjacent normal tissue specimens (170, 171, 173). The detection of telomerase in premalignant or normal mucosa might be an important marker for screening of high-risk lesions.

8.3.2.2

Thyroid and Breast Tumors

Because thyroid and breast lesions are easily palpable, fine needle aspiration (FNA) is widely used as a diagnostic tool for cancer detection in these lesions. For tumors of the thyroid gland, differential diagnosis between follicular adenoma and adenocarcinoma is difficult by morphological FNA cytology alone. The detection of telomerase activity and/or TERT mRNA has been found to be a useful tool for this differential diagnosis, as cancers gave positive signals while adenomas were negative for telomerase expression (174, 175). However, thyroid tissues often contain lymphocytes, so that telomerase activity and TERT mRNA derived from these inflammatory cells may also be detectable in certain benign diseases, such as Hashimoto thyroiditis (176). Thus, detection of telomerase and TERT mRNA in FNA samples showed high sensitivity but low specificity (2, 177). Thus, to distinguish the origin of telomerase, TERT detection in smear or cytospin samples, is feasible and useful for cancer diagnosis. The detection of TERT expression can be used to distinguish between benign and malignant follicular lesions of the thyroid; however, the detection of TERT in FNA samples cannot be used to definitively diagnose follicular tumors of the thyroid because of lymphocyte contamination (178). In breast lesions, normal mammary tissue does not show detectable telomerase activity, while the activity/TERT expression is detected in 80–90% of ductal carcinoma in situ (DCIS) lesions and 90% of invasive breast cancers (10, 153). TERT mRNA is detected at high frequency in breast cancers, where its levels are relatively high (179). Recently, TERT mRNA levels were reported to be higher in patients who had recurrent disease or died from breast cancer, indicating that the levels of TERT expression may be a prognostic marker (11, 180) and a monitoring marker of treatment in breast cancer. When we use telomerase as a biomarker for breast cancer detection, one of the most common problems is the presence of telomerase activity in benign fibroadenomas. Approximately 40% of fibroadenoma tissues display low-level telomerase activity and TERT mRNA expression (153, 181–183). In combination with cytology, the screening of FNA samples for telomerase/TERT expression with careful attention to benign diseases is likely to become a powerful tool for the detection of breast cancers (159, 181, 184–186). Our previous results revealed that some patients whose breast showed suspicious

8 Diagnostic Value I: Solid Tumors

191

lesions by telomerase activity in FNA samples were followed up and later diagnosed as having cancers in these lesions (143). Thus, telomerase/TERT expression is one of the useful diagnostic markers in breast cancer.

8.3.2.3

Lung

Activation of telomerase likely represents early events in lung carcinogenesis in heavy smokers (187); sputum, bronchoalveolar lavage (BAL), bronchial brushing, and bronchial washing samples were examined for telomerase activity and feasibilities for the detection of lung cancer cells were compared (188). The sensitivity of the telomerase assay in sputum was unsatisfactory for the detection of cancer cells because sputum contains an abundance of mucus, which interferes with PCR and other enzyme reactions (188). On the other hand, in brushing or BAL samples, telomerase activity showed a relatively high sensitivity for the detection of lung cancer cells, especially in squamous cell carcinoma. However, BAL samples can contain activated lymphocytes, which can give false-positive results in benign diseases. The clonal expansion of lymphocytes, in particular, can produce strong telomerase activity (189), which may instead reflect the aggressiveness of autoimmunity in certain benign diseases (190). To distinguish the origin for telomerase activity, TERT detection by IHC is useful.

8.3.2.4

Digestive Organs

Endoscopic examination is the usual diagnostic tool for cancers of the digestive organs. In biopsies of the esophagus, stomach, and colon, telomerase activity was present in almost all cancers. In the stomach, adenomas did not show telomerase activation but most gastric cancers did (23). Similarly, in inflammatory bowel diseases associated with cancers, while telomere length was gradually shortened by inflammation, high levels of telomerase activity were detected only in cancerous lesions (191). However, telomerase activity was also detectable at low levels in more than half of noncancerous tissues, where the telomerase/TERT expression can be found in the normal basal cells of crypts (151). Thus, the sensitivity of telomerase activity/TERT expression for detecting cancerous lesions was high but a more precise measurement of the level of telomerase activity in biopsy samples of the gut may be necessary for the diagnosis of cancers because of the false-positive results due to the low telomerase activity of normal basal cells. Cells derived from colon luminal washing can also be subjected to the TRAP assay for cancer diagnosis. Because washing samples rarely contain basal crypt cells, the specificity of the TRAP assay for colon washing samples was remarkable but the sensitivity was found to be relatively low (192). The liver has a remarkable capability to restore its functional capacity following liver injury. Therefore, in the context of liver regeneration, telomerase activation might be a cellular mechanism to confer an extended lifespan to replicating hepatocytes and

192

E. Hiyama, K. Hiyama

hepatic progenitor cells. On the other hand, high levels of telomerase activity are a hallmark of cancer, including hepatocellular carcinoma, albeit low-level expression of these markers was also reported in noncancerous tissues (42). In hepatoblastoma, the prognosis of the patients with high TERT mRNA expression or high telomerase activity was significantly worse than that of others, indicating that telomerase activation is a prognostic factor in this childhood cancer (54). In the pancreas, detection of telomerase activity or TERT mRNA in biopsy samples also displayed a high sensitivity for cancer diagnosis. In patients with pancreatic ductal adenocarcinomas, the pancreatic juice contains freshly exfoliated ductal cells that carry very high levels of telomerase activity. Because of its high sensitivity and specificity, the detection of telomerase activity and/or TERT mRNA in pancreatic juice has become a promising new application of cancer diagnosis (155, 193–195). Moreover, detection of telomerase activity in pancreatic juice was additionally useful for the differential diagnosis of benign and malignant intraductal papillary mucinous neoplasms (IPMN) of the pancreas, which is difficult to diagnose preoperatively (196, 197). In IPMN, progressive telomere shortening occurs in premalignant lesions and then telomerase activation occurs concomitantly with carcinogenesis (198). In the pancreas, IHC detection of TERT protein in cells derived from pancreatic juice provides a potent method for cancer diagnosis (57). With the exception of pancreatic juice, the sensitivity of telomerase/TERT detection is low for excretion and secretion samples, such as bile (55, 199). The detection of telomerase as a biomarker of bile duct cancers remains problematic (200).

8.3.2.5

Pleural Effusion and Peritoneal Lavage

Several attempts to detect telomerase activity or TERT mRNA in pleural effusion and peritoneal lavage samples have been reported (201–204). Because carcinomas from almost any tumor sites can metastasize to the pleura or the peritoneum, pleural effusions or ascites may contain cancer cells originating from various organs such as the breast, ovary, or gastrointestinal tract. In malignant pleural effusions diagnosed by either fluid cytology or pleural biopsy, Yang et al. (204) detected telomerase activity in 91% of cases with a specificity of 94%, indicating that the measurement of telomerase activity is a useful adjunct to cytology for detecting cancer cells. Because peritoneal dissemination usually occurs in advanced stages of digestive cancers, telomerase activity in peritoneal lavage samples also showed a high specificity for cancer cell detection. Tangkijvanich et al. measured telomerase activity in nonmalignant and malignancy-related ascites associated with hepatocellular carcinoma and peritoneal carcinomatosis (205). Both the sensitivity and specificity of the telomerase assay were higher than those of cytology for diagnosis of the malignancy, except for only a few false-positive samples such as from patients with tuberculosis or lymphocytic contamination. Duggan et al. also found telomerase activity to be more sensitive than cytology in ascitic samples obtained from patients with ovarian cancer (206). Thus, in pleural effusions and ascitic

8 Diagnostic Value I: Solid Tumors

193

samples, the sensitivity of the telomerase assay for detecting cancer cells is relatively high.

8.3.2.6

Genitourinary Organs

Among exfoliated materials, voided urine is the easiest material to be tested for bladder cancer screening. For the detection of bladder cancer using voided urine samples obtained from bladder cancer patients and controls, the TRAP assay showed the highest sensitivity (67%) and specificity (99%) among screening methods (207). Since the viability of cells in voided urine samples varies, the sensitivity of telomerase activity for cancer diagnosis was lower than the specificity. As an alternative, high sensitivity could be obtained in urine samples by the detection of TERT mRNA with RT-PCR (208, 209) or real-time RT-PCR (210). Although both telomerase activity and TERT mRNA might be useful for the detection of bladder cancers in bladder washing samples, detection of the TERT mRNA may be preferable for the screening of voided urine (81, 208). Using the biopsy samples, evaluating both telomerase activity and/or TERT gene expression levels could be used as a marker of malignant progression, useful in the early diagnosis and follow-up of bladder carcinomas (82). In voided urine samples obtained after prostate massage, the sensitivity of telomerase activity was higher than that of cytologic examination for the detection of prostate cancer (211). As a surrogate for unstable telomerase, TERT mRNA was an even more reliable marker. Some investigators reported that one of the clinical benefits resulting from the use of this new assay using prostate massage would be to refine the biopsy indication and to avoid for several patients without the unnecessary cost and the complications of prostate biopsy (212). The needle biopsy (SNB) specimens from the prostate glands showed higher sensitivity and specificity (93, 213). As a potential biomarker of cervical dysplasia, telomerase has also been the focus of intense investigations. In cervical cancers, whether telomerase is activated in premalignant lesions remains controversial. According to several studies published on cervical biopsies (214–217), telomerase activity is abnormally present in a remarkably high proportion of high-grade squamous intraepithelial lesions (HSILs), indicating that the activation of telomerase is an early event in the malignant progression of cervical lesions. Frost et al. have observed changes in the tissue distribution of the TERT protein in cervical cancers (161). Although the TERT protein was limited to the lower suprabasal cells in normal cervix, it was present at all levels of the regional cells in moderate to severe dysplasia. These may be the causes for the controversial results for cervical cancers. Neither detection of telomerase activity or its components, nor detection of high-risk human papillomavirus (HPV) seem suitable for the triage of women with borderline, mild, and moderate cytological dyskaryosis (218). In radical hysterectomy samples of cervix, telomerase activity was associated with the presence of histologic malignancy but there was no association between the telomerase activity and the presence of HPV (217).

194

8.3.2.7

E. Hiyama, K. Hiyama

Skin

Skin is a surface organ from which biopsy specimens are easily prepared. Investigations of telomerase activity as a marker of skin cancer showed that epidermal basal cells had low levels of telomerase activity and that telomerase was not activated in the vast majority of squamous cell carcinoma but that most cutaneous malignant melanomas displayed high-levels of telomerase activity (118). Telomerase expression was reported to be correlated to critical parameters of malignant melanoma (219), while not in another paper, although telomerase activity was weaker in Spitz nevi (220). To elucidate the correlation between carcinogenesis and telomerase activation in the skin, further studies on skin cancers and related lesions should be done. 8.3.2.8

Detecting Circulating Cancer Cells

Irrespective of the tumor type, the blood in patients with cancer is likely to contain circulating cancer cells that could potentially be detected using the telomerase assay (221). The detection of these rare cancer cells in whole blood samples would be predicted to be masked by the potential presence of activated lymphocytes expressing high levels of telomerase activity (150, 189). To detect circulating carcinoma cells using the telomerase assay, immunomagnetic separation can first be used to isolate epithelial cells from peripheral blood mononuclear cells, after which the harvested cells can be tested for telomerase activity. In one report, the harvested circulating epithelial cells showed telomerase activity in 70–80% of patients with advanced lung, colon, or breast cancers, suggesting that telomerase activity may become a useful clinical marker of circulating epithelial cancer cells (221). One of the most routinely collected bodily fluids is blood serum, which can easily be prepared by centrifugation of whole blood. If tumor cells undergo necrosis and release their contents, some tumor-specific molecules might be present in serum that could be detected. Serum TERT mRNA could be detected in the serum samples derived from breast cancer patients and showed higher values in patients with HCC than those with chronic liver diseases, indicating that serum TERT mRNA is a novel and available marker for cancer diagnosis and follow-up (222–224). 8.3.2.9

Sarcoma

In soft tissue tumors, the positive ratios of detectable telomerase were approximately 20–70%, which were less than those reported in carcinomas (119–123, 225). Telomerase activity correlated with the grade of malignancy (124). More aggressive malignant histology subtypes showed upregulation of telomerase activity. Telomerase activity is a potential prognostic factor in malignant soft tissue tumors. The ALT pathway (see Chap. 5) is more commonly activated in tumors of mesenchymal origin, although the mechanisms involved in the decision for a cell to activate either telomerase or ALT are unknown at present (226).

8 Diagnostic Value I: Solid Tumors

8.3.3

195

Telomerase/TERT Expression in Prediction of Prognosis and Grading of Malignant Tumors

In certain types of cancers, telomerase activity is upregulated during tumor progression, so that the level of telomerase activity can be used to evaluate the malignancy grade of tumors and predict patient prognosis (Table 8.3). In certain cancers of adults, the activation of telomerase correlates with advanced disease and poor prognosis, as in the cases of nonsmall cell lung cancer, gastric cancer, colorectal cancer, and soft tissue sarcomas (14, 36, 239, 257, 264). Most representative tumors whose malignant grades correlate with telomerase activation are brain tumors and childhood malignant tumors.

8.3.3.1

Brain Tumors

Brain tumors are sharply distinguished from other tumors because their origin is so lethal, even if their histology is benign. Telomerase activity can also predict the outcome of patients with gliomas, brain tumors that are consistently difficult to be designated as either benign or malignant. Studies have shown that telomerase activity is present in most cases of malignant gliomas except for grade I gliomas, making it a useful indicator of the malignant grade of gliomas (265, 266). In brain tumors, the elevated expression of TERT and Ki-67 in vitro provides a potential prognostic tool for early detection of their progression (267). In intracranial ependymonas, TERT expression was the strongest predictor of outcome and was independent of other clinical and pathologic prognostic markers (268). In malignant brain gliomas and astrocytoma, there was strong evidence of the involvement of telomerase in tumor angiogenesis (269, 270). These results suggest that telomerase activation represents a simple and reliable biologic prognostic factor for intracranial tumors and will stimulate research on antitelomerase drugs for treatment of malignant brain tumors. Collectively, these findings demonstrate that telomerase activity and TERT expression are markers that can be used successfully to predict the outcome of cancer patients and take decisions on the appropriate treatments.

8.3.3.2

Childhood Malignant Tumors

Over the last decade, the telomere biology of pediatric cancers has begun to be elucidated. Most pediatric solid tumors activate the enzyme telomerase, as do the adult cancers. In general, tumors showing high levels of telomerase expression are associated with an unfavorable outcome, although results vary according to the tumor type. Some pediatric tumors, including osteosarcoma and glioblastoma multiforme, lack telomerase activity and maintain telomeres via ALT. Telomerase is a highly attractive therapeutic target for pediatric cancer because the enzyme

196

E. Hiyama, K. Hiyama

Table 8.3 Telomerase Activity/TERT mRNA as a prognostic marker Organs Tumor type Correlated with Correlated with other markers prognosis Brain Central nervous Telomerase (227) system malignant lymphoma Pituitary tumor Telomerase (228) Head and Oral cavity and Telomerase (229) neck oropharynx Head and neck Telomerase (230) cancer Lung Nonsmall cell Telomerase (14, TERT and dysplasia in smokers (235) carcinoma 231–233), TERT (234) Breast Invasive duct cell Telomerase and proliferative index carcinoma (236) or relapse-free period (179) Node-positive Telomerase breast cancer (237)a Thyroid Papillary carcinoma Telomerase and extrathyroidal extension (238) Stomach Adenocarcinoma Telomerase (239–242) Colon Adenocarcinoma Telomerase (36) Telomerase (243, 244) or TERT (245–247) and advanced stages; telomerase and risk for metastasis (39) Hepatic metastasis TERT (248) of colorectal cancer Liver Hepatocellular Telomerase (51, Telomerase and recurrence risk (251) carcinoma 249, 250) Pancreas Endocrine tumors Telomerase (252) Urogenital Renal cell Telomerase and Tumor grade (253) or carcinoma advanced stage (77) Transitional cell TERT (254, 255) Telomerase and tumor relapse (88) carcinoma Prostate Prostate cancer Telomerase/TERT and advanced stage (125) Uterus Endometrial Telomerase and recurrence risk (256) carcinoma Soft tissue Osteosarcoma Telomerase (129) Telomerase and response to chemotherapy (257) Soft tissue sarcoma Telomerase (258, Telomerase/TERT and recurrence and 259) metastasis (124) Liposarcomas TERT (258) Childhood Neuroblastoma Telomerase (131, Telomerase and cytogenetic tumor 260, 261), abnormalities (260, 261, 263) TERT (262) Wilms tumor TERT and recurrent risk (80) Hepatoblastoma Telomerase/ TERT (54) Telomerase telomerase activity, TERT TERT mRNA a There are some controversial reports

8 Diagnostic Value I: Solid Tumors

197

plays a key role in conferring cellular immortality, is present in most tumors, and is relatively specific for cancer cells. Telomerase inhibitors have been evaluated in clinical and preclinical models of adult cancers (see Chap. 10), but few studies have been conducted on pediatric cancers. Further research is required to define how telomere biology can be used to clinical advantage in malignancies of childhood. Neuroblastomas are pediatric tumors that display a well-documented relationship between tumor biology and patient outcome. In these tumors, poor prognosis is associated with high levels of telomerase activity and full-length TERT mRNA expression (131–133, 260–262). Interestingly, in stage 4S neuroblastoma, which represents a unique entity characterized by a high frequency of spontaneous regression, telomeres were shortened and telomerase activity was undetectable (260, 261). Telomerase activity can also predict the outcomes of patients with hepatoblasotma (54). In pediatric ependymoma and soft tissue sarcoma, high telomerase expression is a strong predictor of outcome, which was independent of other clinicopathological markers (268, 271). These findings revealed that telomerase activation/TERT expression predicts progression and survival in most pediatric malignant tumors.

8.3.3.3

Prognostic Marker for Other Cancers

The prognostic values of telomerase in other cancers are summarized in Table 8.3. In patients with colorectal cancer (36), including those undergoing curative resection of liver metastases (248), both telomerase activity and TERT mRNA expression could be used as independent prognostic factors. In a retrospective study of a large number of breast cancers, the levels of telomerase activity significantly correlated with clinical outcomes and several aggressive tumor phenotypes (237). In tumors of the thyroid gland, telomerase activity may be useful to distinguish benign from malignant tumors and might provide a useful indicator of prognosis (176, 272). In pituitary adenoma, detection of telomerase expression may also correlate with biological aggressiveness and potential for regrowth (228). These findings suggest that telomerase activity is a useful indicator for identifying patients who would benefit from postoperative adjuvant chemotherapy.

8.4

Concluding Remarks

In conclusion, measurement of telomerase activity and/or TERT expression has several clinical utilities (Fig. 8.2): for the screening of high-risk regions (in tumors that acquire telomerase activity at the premalignant stages), the early detection of cancer cells (in tumors that acquire telomerase activity at the early stages), as a prognostic indicator (in tumors that acquire telomerase activity upon progression), as a marker that can distinguish malignancies from benign tumors, and as a marker for detecting circulating cancer cells in the blood. ISH and the IHC detection of

198

E. Hiyama, K. Hiyama

TERT can now be used to identify telomerase-positive cancer cells in a background of noncancerous cells. In the near future, methods for the in situ detection of TERT are likely to become of common use in clinics for both the diagnosis of cancers and the grading of malignancies.

References 1. Kondo Y, Tanaka Y, Shields JA, Kondo S. Association between telomerase activity and basic fibroblast growth factor up-regulation in retinoblastomas. Anticancer Res 2001;21:3765–72. 2. Trulsson LM, Velin AK, Herder A, Soderkvist P, Ruter A, Smeds S. Telomerase activity in surgical specimens and fine-needle aspiration biopsies from hyperplastic and neoplastic human thyroid tissues. Am J Surg 2003;186:83–8. 3. Straight AM, Patel A, Fenton C, Dinauer C, Tuttle RM, Francis GL. Thyroid carcinomas that express telomerase follow a more aggressive clinical course in children and adolescents. J Endocrinol Invest 2002;25:302–8. 4. Kammori M, Takubo K, Nakamura K, et al. Telomerase activity and telomere length in benign and malignant human thyroid tissues. Cancer Lett 2000;159:175–81. 5. Lo CY, Lam KY, Chan KT, Luk JM. Telomerase activity in thyroid malignancy. Thyroid 1999;9:1215–20. 6. Aogi K, Kitahara K, Buley I, et al. Telomerase activity in lesions of the thyroid: application to diagnosis of clinical samples including fine-needle aspirates. Clin Cancer Res 1998;4:1965–70. 7. Velin AK, Herder A, Johansson KJ, Trulsson LM, Smeds S. Telomerase is not activated in human hyperplastic and adenomatous parathyroid tissue. Eur J Endocrinol 2001;145:161–4. 8. Kammori M, Nakamura K, Kanauchi H, et al. Consistent decrease in telomere length in parathyroid tumors but alteration in telomerase activity limited to malignancies: preliminary report. World J Surg 2002;26:1083–7. 9. Aogi K, Kitahara K, Urquidi V, Tarin D, Goodison S. Comparison of telomerase and CD44 expression as diagnostic tumor markers in lesions of the thyroid. Clin Cancer Res 1999;5:2790–7. 10. Umbricht CB, Sherman ME, Dome J, et al. Telomerase activity in ductal carcinoma in situ and invasive breast cancer. Oncogene 1999;18:3407–14. 11. Kammori M, Izumiyama N, Hashimoto M, et al. Expression of human telomerase reverse transcriptase gene and protein, and of estrogen and progesterone receptors, in breast tumors: preliminary data from neo-adjuvant chemotherapy. Int J Oncol 2005;27:1257–63. 12. Kalogeraki A, Kafousi M, Ieromonachou P, et al. Telomerase activity as a marker of invasive ductal breast carcinomas on FNABs and relationship to other prognostic variables. Anticancer Res 2005;25:1927–30. 13. Mokbell K, Parris CN, Ghilchik M, Newbold RF. Telomerase activity in the human breast. Breast 1999;8:208–11. 14. Marchetti A, Bertacca G, Buttitta F, et al. Telomerase activity as a prognostic indicator in stage I non-small cell lung cancer. Clin Cancer Res 1999;5:2077–81. 15. Chen KY, Lee LN, Yu CJ, Lee YC, Kuo SH, Yang PC. Elevation of telomerase activity positively correlates to poor prognosis of patients with non-small cell lung cancer. Cancer Lett 2006;240:148–56. 16. Ohmura Y, Aoe M, Andou A, Shimizu N. Telomerase activity and Bcl-2 expression in nonsmall cell lung cancer. Clin Cancer Res 2000;6:2980–7. 17. Wu X, Kemp B, Amos CI, et al. Associations among telomerase activity, p53 protein overexpression, and genetic instability in lung cancer. Br J Cancer 1999;80:453–7.

8 Diagnostic Value I: Solid Tumors

199

18. Ikeguchi M, Unate H, Maeta M, Kaibara N. Detection of telomerase activity in esophageal squamous cell carcinoma and normal esophageal epithelium. Langenbecks Arch Surg 1999;384:550–5. 19. Kubota M, Yamana H, Sueyoshi S, Fujita H, Shirouzu K. The significance of telomerase activity in cancer lesions and the noncancerous epithelium of the esophagus. Int J Clin Oncol 2002;7:32–7. 20. van den Heever WM, Pretorius GH, Smit SJ. Telomerase activity and survival of late-stage South African esophageal carcinoma patients. Dis Esophagus 2004;17:251–6. 21. Yu HP, Xu SQ, Lu WH, et al. Telomerase activity and expression of telomerase genes in squamous dysplasia and squamous cell carcinoma of the esophagus. J Surg Oncol 2004;86:99–104. 22. Going JJ, Fletcher-Monaghan AJ, Neilson L, et al. Zoning of mucosal phenotype, dysplasia, and telomerase activity measured by telomerase repeat assay protocol in Barrett’s esophagus. Neoplasia 2004;6:85–92. 23. Yang SM, Fang DC, Luo YH, Lu R, Battle PD, Liu WW. Alterations of telomerase activity and terminal restriction fragment in gastric cancer and its premalignant lesions. J Gastroenterol Hepatol 2001;16:876–82. 24. Li W, Li L, Liu Z, et al. Expression of the full-length telomerase reverse transcriptase (hTERT) transcript in both malignant and normal gastric tissues. Cancer Lett 2008;260:28–36. 25. Gumus-Akay G, Unal AE, Bayar S, et al. Telomerase activity could be used as a marker for neoplastic transformation in gastric adenocarcinoma: but it does not have a prognostic significance. Genet Mol Res 2007;6:41–9. 26. Wong SC, Yu H, So JB. Detection of telomerase activity in gastric lavage fluid: a novel method to detect gastric cancer. J Surg Res 2006;131:252–5. 27. Chen F, Hu L, Li Y, Wang L. Expression of telomerase subunits in gastric cancer. J Huazhong Univ Sci Technol Med Sci 2005;25:741–3. 28. Shao JC, Wu JF, Wang DB, Qin R, Zhang H. Relationship between the expression of human telomerase reverse transcriptase gene and cell cycle regulators in gastric cancer and its significance. World J Gastroenterol 2003;9:427–31. 29. Yoo J, Park SY, Kang SJ, Kim BK, Shim SI, Kang CS. Expression of telomerase activity, human telomerase RNA, and telomerase reverse transcriptase in gastric adenocarcinomas. Mod Pathol 2003;16:700–7. 30. Miyachi K, Fujita M, Tanaka N, Sasaki K, Sunagawa M. Correlation between telomerase activity and telomeric-repeat binding factors in gastric cancer. J Exp Clin Cancer Res 2002;21:269–75. 31. Yao XX, Yin L, Sun ZC. The expression of hTERT mRNA and cellular immunity in gastric cancer and precancerosis. World J Gastroenterol 2002;8:586–90. 32. Furugori E, Hirayama R, Nakamura KI, Kammori M, Esaki Y, Takubo K. Telomere shortening in gastric carcinoma with aging despite telomerase activation. J Cancer Res Clin Oncol 2000;126:481–5. 33. Katayama S, Shiota G, Oshimura M, Kawasaki H. Clinical usefulness of telomerase activity and telomere length in the preoperative diagnosis of gastric and colorectal cancer. J Cancer Res Clin Oncol 1999;125:405–10. 34. Zhan WH, Ma JP, Peng JS, et al. Telomerase activity in gastric cancer and its clinical implications. World J Gastroenterol 1999;5:316–19. 35. Ahn MJ, Noh YH, Lee YS, et al. Telomerase activity and its clinicopathological significance in gastric cancer. Eur J Cancer 1997;33:1309–13. 36. Tatsumoto N, Hiyama E, Murakami Y, et al. High telomerase activity is an independent prognostic indicator of poor outcome in colorectal cancer. Clin Cancer Res 2000;6:2696–701. 37. Myung SJ, Yang SK, Chang HS, et al. Clinical usefulness of telomerase for the detection of colon cancer in ulcerative colitis patients. J Gastroenterol Hepatol 2005;20:1578–83.

200

E. Hiyama, K. Hiyama

38. Abe N, Watanabe T, Nakashima M, et al. Quantitative analysis of telomerase activity: a potential diagnostic tool for colorectal carcinoma. Hepatogastroenterology 2001;48:692–5. 39. Shoji Y, Yoshinaga K, Inoue A, Iwasaki A, Sugihara K. Quantification of telomerase activity in sporadic colorectal carcinoma: association with tumor growth and venous invasion. Cancer 2000;88:1304–9. 40. Fang DC, Young J, Luo YH, Lu R, Jass J. Detection of telomerase activity in biopsy samples of colorectal cancer. J Gastroenterol Hepatol 1999;14:328–32. 41. Ma J, Zhan W, Peng J, et al. Telomerase activity and homozygous deletions of the p16 gene in liver metastases of colorectal carcinoma. Chin Med J 2001;114:1068–72. 42. Nagao K, Tomimatsu M, Endo H, Hisatomi H, Hikiji K. Telomerase reverse transcriptase mRNA expression and telomerase activity in hepatocellular carcinoma. J Gastroenterol 1999;34:83–7. 43. Shan YS, Hsieh YH, Lin PW. Telomerase activity in tumor and remnant liver as predictor of recurrence and survival in hepatocellular carcinoma after resection. World J Surg 2007;31:1121–8. 44. Liu YC, Chen CJ, Wu HS, et al. Telomerase and c-myc expression in hepatocellular carcinomas. Eur J Surg Oncol 2004;30:384–90. 45. Youssef N, Paradis V, Ferlicot S, Bedossa P. In situ detection of telomerase enzymatic activity in human hepatocellular carcinogenesis. J Pathol 2001;194:459–65. 46. Yeh TS, Chen TC, Chen MF. Dedifferentiation of human hepatocellular carcinoma upregulates telomerase and Ki-67 expression. Arch Surg 2000;135:1334–9. 47. Tatsuma T, Goto S, Kitano S, Lin YC, Lee CM, Chen CL. Telomerase activity in peripheral blood for diagnosis of hepatoma. J Gastroenterol Hepatol 2000;15:1064–70. 48. Hsieh HF, Harn HJ, Chiu SC, Liu YC, Lui WY, Ho LI. Telomerase activity correlates with cell cycle regulators in human hepatocellular carcinoma. Liver 2000;20:143–51. 49. Ferlicot S, Paradis V, Dargere D, Monges G, Bedossa P. Detection of telomerase in hepatocellular carcinomas using a PCR ELISA assay: comparison with hTR expression. J Clin Pathol 1999;52:725–9. 50. Kanamaru T, Yamamoto M, Morita Y, Itoh T, Kuroda Y, Hisatomi H. Clinical implications of telomerase activity in resected hepatocellular carcinoma. Int J Mol Med 1999;4:267–71. 51. Kishimoto K, Fujimoto J, Takeuchi M, Yamamoto H, Ueki T, Okamoto E. Telomerase activity in hepatocellular carcinoma and adjacent liver tissues. J Surg Oncol 1998;69:119–24. 52. Kojima H, Yokosuka O, Imazeki F, Saisho H, Omata M. Telomerase activity and telomere length in hepatocellular carcinoma and chronic liver disease. Gastroenterology 1997;112:493–500. 53. Ohta K, Kanamaru T, Morita Y, Hayashi Y, Ito H, Yamamoto M. Telomerase activity in hepatocellular carcinoma as a predictor of postoperative recurrence. J Gastroenterol 1997;32:791–6. 54. Hiyama E, Yamaoka H, Matsunaga T, et al. High expression of telomerase is an independent prognostic indicator of poor outcome in hepatoblastoma. Br J Cancer 2004;91:972–9. 55. Itoi T, Shinohara Y, Takeda K, et al. Detection of telomerase reverse transcriptase mRNA in biopsy specimens and bile for diagnosis of biliary tract cancers. Int J Mol Med 2001;7:281–7. 56. Itoi T, Shinohara Y, Takeda K, et al. Detection of telomerase activity in biopsy specimens for diagnosis of biliary tract cancers. Gastrointest Endosc 2000;52:380–6. 57. Hashimoto Y, Murakami Y, Uemura K, et al. Detection of human telomerase reverse transcriptase (hTERT) expression in tissue and pancreatic juice from pancreatic cancer. Surgery 2008;143:113–25. 58. Mizumoto K, Suehara N, Muta T, et al. Semi-quantitative analysis of telomerase in pancreatic ductal adenocarcinoma. J Gastroenterol 1996;31:894–7. 59. Suehara N, Mizumoto K, Muta T, et al. Telomerase elevation in pancreatic ductal carcinoma compared to nonmalignant pathological states. Clin Cancer Res 1997;3:993–8.

8 Diagnostic Value I: Solid Tumors

201

60. Tsutsumi M, Tsujiuchi T, Ishikawa O, et al. Increased telomerase activities in human pancreatic duct adenocarcinomas. Jpn J Cancer Res 1997;88:971–6. 61. Buchler P, Conejo-Garcia JR, Lehmann G, et al. Real-time quantitative PCR of telomerase mRNA is useful for the differentiation of benign and malignant pancreatic disorders. Pancreas 2001;22:331–40. 62. Mishra G, Zhao Y, Sweeney J, et al. Determination of qualitative telomerase activity as an adjunct to the diagnosis of pancreatic adenocarcinoma by EUS-guided fine-needle aspiration. Gastrointest Endosc 2006;63:648–54. 63. Lam KY, Lo CY, Fan ST, Luk JM. Telomerase activity in pancreatic endocrine tumours: a potential marker for malignancy. Mol Pathol 2000;53:133–6. 64. Tang SJ, Dumot JA, Wang L, et al. Telomerase activity in pancreatic endocrine tumors. Am J Gastroenterol 2002;97:1022–30. 65. Hirano Y, Fujita K, Suzuki K, Ushiyama T, Ohtawara Y, Tsuda F. Telomerase activity as an indicator of potentially malignant adrenal tumors. Cancer 1998;83:772–6. 66. Teng L, Tucker O, Malchoff C, Vaughan ED Jr, Jacobson J, Fahey TJ III. Telomerase activity in the differentiation of benign and malignant adrenal tumors. Surgery 1998;124:1123–7. 67. Bamberger CM, Else T, Bamberger AM, et al. Telomerase activity in benign and malignant adrenal tumors. Exp Clin Endocrinol Diabetes 1999;107:272–5. 68. Sticchi D, Fassina A, Ganzaroli C, et al. Expression of telomerase (hTERT) in aldosteroneproducing adrenocortical tumors. Int J Mol Med 2006;17:469–74. 69. Else T, Giordano TJ, Hammer GD. Evaluation of telomere length maintenance mechanisms in adrenocortical carcinoma. J Clin Endocrinol Metab 2008;93:1442–9. 70. Rohde V, Sattler HP, Oehlenschlager B, et al. Genetic changes and telomerase activity in human renal cell carcinoma. Clin Cancer Res 1998;4:197–202. 71. Yoshida K, Sakamoto S, Sumi S, Higashi Y, Kitahara S. Telomerase activity in renal cell carcinoma. Cancer 1998;83:760–6. 72. Kanaya T, Kyo S, Takakura M, Ito H, Namiki M, Inoue M. hTERT is a critical determinant of telomerase activity in renal-cell carcinoma. Int J Cancer 1998;78:539–43. 73. Muller M, Heicappell R, Krause H, Sachsinger J, Porsche C, Miller K. Telomerase activity in malignant and benign renal tumors. Eur Urol 1999;35:249–55. 74. Sugimura K, Yoshida N, Hisatomi H, Nakatani T, Ikemoto S. Telomerase activity in human renal cell carcinoma. BJU Int 1999;83:693–7. 75. Schlichter A, Fiedler W, Junker K, Dahse R, Claussen U, Schubert J. Determination of telomerase activity in multifocal renal cell carcinoma. Int J Oncol 1999;15:577–81. 76. Fujioka T, Hasegawa M, Suzuki Y, et al. Telomerase activity in human renal cell carcinoma. Int J Urol 2000;7:16–21. 77. Paradis V, Bieche I, Dargere D, et al. hTERT expression in sporadic renal cell carcinomas. J Pathol 2001;195:209–17. 78. Segawa N, Gohji K, Azuma H, Iwamoto Y, Ohnishi K, Katsuoka Y. Telomerase activity in renal cell carcinoma by modified telomeric repeat amplification protocol assay. Int J Urol 2003;10:153–9. 79. Mekhail TM, Kawanishi-Tabata R, Tubbs R, et al. Renal cell carcinoma (RCC) and telomerase activity: relationship to stage. Urol Oncol 2003;21:424–30. 80. Dome JS, Chung S, Bergemann T, et al. High telomerase reverse transcriptase (hTERT) messenger RNA level correlates with tumor recurrence in patients with favorable histology Wilms’ tumor. Cancer Res 1999;59:4301–7. 81. Lee DH, Yang SC, Hong SJ, Chung BH, Kim IY. Telomerase: a potential marker of bladder transitional cell carcinoma in bladder washes. Clin Cancer Res 1998;4:535–8. 82. Longchampt E, Lebret T, Molinie V, Bieche I, Botto H, Lidereau R. Detection of telomerase status by semiquantitative and in situ assays, and by real-time reverse transcription-polymerase chain reaction (telomerase reverse transcriptase) assay in bladder carcinomas. BJU Int 2003;91:567–72.

202

E. Hiyama, K. Hiyama

83. Kinoshita H, Ogawa O, Kakehi Y, et al. Detection of telomerase activity in exfoliated cells in urine from patients with bladder cancer. J Natl Cancer Inst 1997;89:724–30. 84. Linn JF, Lango M, Halachmi S, Schoenberg MP, Sidransky D. Microsatellite analysis and telomerase activity in archived tissue and urine samples of bladder cancer patients. Int J Cancer 1997;74:625–9. 85. Kavaler E, Landman J, Chang Y, Droller MJ, Liu BC. Detecting human bladder carcinoma cells in voided urine samples by assaying for the presence of telomerase activity. Cancer 1998;82:708–14. 86. Heine B, Hummel M, Mualler M, Helcappell R, Milller K, Stein H. Non-radioactive measurement of telomerase acitivity in human bladder cancer, bladder washings, and in urine. J Pathol 1998;184:71–6. 87. Yokota K, Kanda K, Inoue Y, Kanayama H, Kagawa S. Semi-quantitative analysis of telomerase activity in exfoliated human urothelial cells and bladder transitional cell carcinoma. Br J Urol 1998;82:727–32. 88. Lancelin F, Anidjar M, Villette JM, et al. Telomerase activity as a potential marker in preneoplastic bladder lesions. BJU Int 2000;85:526–31. 89. Abdel-Salam IM, Khaled HM, Gaballah HE, Mansour OM, Kassem HA, Metwaly AM. Telomerase activity in bilharzial bladder cancer Prognostic implications. Urol Oncol 2001;6:149–53. 90. Junker K, Kania K, Fiedler W, Hartmann A, Schubert J, Werner W. Molecular genetic evaluation of fluorescence diagnosis in bladder cancer. Int J Oncol 2002;20:647–53. 91. Wu WJ, Liu LT, Huang CH, Chang SF, Chang LL. Telomerase activity in human bladder tumors and bladder washing specimens. Kaohsiung J Med Sci 2001;17:602–9. 92. Bhuiyan J, Akhter J, O’Kane DJ. Performance characteristics of multiple urinary tumor markers and sample collection techniques in the detection of transitional cell carcinoma of the bladder. Clin Chim Acta 2003;331:69–77. 93. Wang Z, Ramin SA, Tsai C, et al. Telomerase activity in prostate sextant needle cores from radical prostatectomy specimens. Urol Oncol 2001;6:57–62. 94. Kallakury BV, Brien TP, Lowry CV, et al. Telomerase activity in human benign prostate tissue and prostatic adenocarcinomas. Diagn Mol Pathol 1997;6:192–8. 95. Zhang W, Kapusta LR, Slingerland JM, Klotz LH. Telomerase activity in prostate cancer, prostatic intraepithelial neoplasia, and benign prostatic epithelium. Cancer Res 1998;58:619–21. 96. Lin Y, Uemura H, Fujinami K, et al. Detection of telomerase activity in prostate needlebiopsy samples. Prostate 1998;36:121–8. 97. Koeneman KS, Pan CX, Jin JK, et al. Telomerase activity, telomere length, and DNA ploidy in prostatic intraepithelial neoplasia (PIN). J Urol 1998;160:1533–9. 98. Wullich B, Rohde V, Oehlenschlager B, et al. Focal intratumoral heterogeneity for telomerase activity in human prostate cancer. J Urol 1999;161:1997–2001. 99. Wymenga LF, Wisman GB, Veenstra R, Ruiters MH, Mensink HJ. Telomerase activity in needle biopsies from prostate cancer and benign prostates. Eur J Clin Invest 2000;30:330–5. 100. Caldarera E, Crooks NH, Muir GH, Pavone-Macaluso M, Carmichael PL. An appraisal of telomerase activity in benign prostatic hyperplasia. Prostate 2000;45:267–70. 101. Albanell J, Bosl GJ, Reuter VE, et al. Telomerase activity in germ cell cancers and mature teratomas. J Natl Cancer Inst 1999;91:1321–6. 102. Schrader M, Burger AM, Muller M, et al. Quantification of human telomerase reverse transcriptase mRNA in testicular germ cell tumors by quantitative fluorescence real-time RT-PCR. Oncol Rep 2002;9:1097–105. 103. Gorham H, Yoshida K, Sugino T, et al. Telomerase activity in human gynaecological malignancies. J Clin Pathol 1997;50:501–4. 104. Yokoyama Y, Takahashi Y, Shinohara A, Lian Z, Tamaya T. Telomerase activity in the female reproductive tract and neoplasms. Gynecol Oncol 1998;68:145–9.

8 Diagnostic Value I: Solid Tumors

203

105. Datar RH, Naritoku WY, Li P, et al. Analysis of telomerase activity in ovarian cystadenomas, low-malignant-potential tumors, and invasive carcinomas. Gynecol Oncol 1999;74:338–45. 106. Dowdy SC, O’Kane DJ, Keeney GL, Boyd J, Podratz KC. Telomerase activity in sex cordstromal tumors of the ovary. Gynecol Oncol 2001;82:257–60. 107. Saito T, Schneider A, Martel N, et al. Proliferation-associated regulation of telomerase activity in human endometrium and its potential implication in early cancer diagnosis. Biochem Biophys Res Commun 1997;231:610–14. 108. Oshita T, Nagai N, Ohama K. Expression of telomerase reverse transcriptase mRNA and its quantitative analysis in human endometrial cancer. Int J Oncol 2000;17:1225–30. 109. Pao CC, Tseng CJ, Lin CY, et al. Differential expression of telomerase activity in human cervical cancer and cervical intraepithelial neoplasia lesions. J Clin Oncol 1997;15:1932–7. 110. Anderson S, Shera K, Ihle J, et al. Telomerase activation in cervical cancer. Am J Pathol 1997;151:25–31. 111. Takakura M, Kyo S, Kanaya T, Tanaka M, Inoue M. Expression of human telomerase subunits and correlation with telomerase activity in cervical cancer. Cancer Res 1998;58:1558–61. 112. Nagai N, Oshita T, Murakami J, Ohama K. Semiquantitative analysis of telomerase activity in cervical cancer and precancerous lesions. Oncol Rep 1999;6:325–8. 113. Zhang DK, Ngan HY, Cheng RY, Cheung AN, Liu SS, Tsao SW. Clinical significance of telomerase activation and telomeric restriction fragment (TRF) in cervical cancer. Eur J Cancer 1999;35:154–60. 114. Wisman GB, Knol AJ, Helder MN, et al. Telomerase in relation to clinicopathologic prognostic factors and survival in cervical cancer. Int J Cancer 2001;91:658–64. 115. Reddy VG, Khanna N, Jain SK, Das BC, Singh N. Telomerase-A molecular marker for cervical cancer screening. Int J Gynecol Cancer 2001;11:100–6. 116. Kailash U, Soundararajan CC, Lakshmy R, Arora R, Vivekanandhan S, Das BC. Telomerase activity as an adjunct to high-risk human papillomavirus types 16 and 18 and cytology screening in cervical cancer. Br J Cancer 2006;95:1250–7. 117. Wang PH, Ko JL. Implication of human telomerase reverse transcriptase in cervical carcinogenesis and cancer recurrence. Int J Gynecol Cancer 2006;16:1873–9. 118. Parris CN, Jezzard S, Silver A, MacKie R, McGregor JM, Newbold RF. Telomerase activity in melanoma and non-melanoma skin cancer. Br J Cancer 1999;79:47–53. 119. Schneider-Stock R, Rys J, Jaeger V, et al. Prognostic significance of telomerase activity in soft tissue sarcomas. Int J Oncol 1999;15:775–80. 120. Sabah M, Cummins R, Leader M, Kay E. Immunohistochemical detection of hTERT protein in soft tissue sarcomas: correlation with tumor grade. Appl Immunohistochem Mol Morphol 2006;14:198–202. 121. Terasaki T, Kyo S, Takakura M, et al. Analysis of telomerase activity and telomere length in bone and soft tissue tumors. Oncol Rep 2004;11:1307–11. 122. Yan P, Benhattar J, Coindre JM, Guillou L. Telomerase activity and hTERT mRNA expression can be heterogeneous and does not correlate with telomere length in soft tissue sarcomas. Int J Cancer 2002;98:851–6. 123. Umehara N, Ozaki T, Sugihara S, et al. Influence of telomerase activity on bone and soft tissue tumors. J Cancer Res Clin Oncol 2004;130:411–16. 124. Tomoda R, Seto M, Tsumuki H, et al. Telomerase activity and human telomerase reverse transcriptase mRNA expression are correlated with clinical aggressiveness in soft tissue tumors. Cancer 2002;95:1127–33. 125. Engelhardt M, Albanell J, Drullinsky P, et al. Relative contribution of normal and neoplastic cells determines telomerase activity and telomere length in primary cancers of the prostate, colon, and sarcoma. Clin Cancer Res 1997;3:1849–57. 126. Yoo J, Robinson RA. Expression of telomerase activity and telomerase RNA in human soft tissue sarcomas. Arch Pathol Lab Med 2000;124:393–7.

204

E. Hiyama, K. Hiyama

127. Yan P, Coindre JM, Benhattar J, Bosman FT, Guillou L. Telomerase activity and human telomerase reverse transcriptase mRNA expression in soft tissue tumors: correlation with grade, histology, and proliferative activity. Cancer Res 1999;59:3166–70. 128. Aogi K, Woodman A, Urquidi V, Mangham DC, Tarin D, Goodison S. Telomerase activity in soft-tissue and bone sarcomas. Clin Cancer Res 2000;6:4776–81. 129. Sangiorgi L, Gobbi GA, Lucarelli E, et al. Presence of telomerase activity in different musculoskeletal tumor histotypes and correlation with aggressiveness. Int J Cancer 2001;95:156–61. 130. Gupta J, Han LP, Wang P, Gallie BL, Bacchetti S. Development of retinoblastoma in the absence of telomerase activity. J Natl Cancer Inst 1996;88:1152–7. 131. Poremba C, Willenbring H, Hero B, et al. Telomerase activity distinguishes between neuroblastomas with good and poor prognosis. Ann Oncol 1999;10:715–21. 132. Streutker CJ, Thorner P, Fabricius N, Weitzman S, Zielenska M. Telomerase activity as a prognostic factor in neuroblastomas. Pediatr Dev Pathol 2001;4:62–7. 133. Nozaki C, Horibe K, Iwata H, Ishiguro Y, Hamaguchi M, Takahashi M. Prognostic impact of telomerase activity in patients with neuroblastoma. Int J Oncol 2000;17:341–5. 134. Isobe K, Yashiro T, Omura S, et al. Expression of the human telomerase reverse transcriptase in pheochromocytoma and neuroblastoma tissues. Endocr J 2004;51:47–52. 135. Shay JW, Bacchetti S. A survey of telomerase activity in human cancer. Eur J Cancer 1997;33:787–91. 136. Dhaene K, Van Marck E, Parwaresch R. Telomeres, telomerase and cancer: an up-date. Virchows Arch 2000;437:1–16. 137. Kim NW. Clinical implications of telomerase in cancer. Eur J Cancer 1997;33:781–6. 138. Shay JW, Gazdar AF. Telomerase in the early detection of cancer. J Clin Pathol 1997;50:106–9. 139. Blasco MA, Rizen M, Greider CW, Hanahan D. Differential regulation of telomerase activity and telomerase RNA during multi-stage tumorigenesis. Nat Genet 1996;12:200–4. 140. Broccoli D, Godley LA, Donehower LA, Varmus HE, de Lange T. Telomerase activation in mouse mammary tumors: lack of detectable telomere shortening and evidence for regulation of telomerase RNA with cell proliferation. Mol Cell Biol 1996;16:3765–72. 141. Hahn WC, Stewart SA, Brooks MW, et al. Inhibition of telomerase limits the growth of human cancer cells. Nat Med 1999;5:1164–70. 142. Hiyama E, Hiyama K. Telomerase as tumor marker. Cancer Lett 2003;194:221–33. 143. Hiyama E, Hiyama K. Clinical utility of telomerase in cancer. Oncogene 2002;21:643–9. 144. Feng J, Funk WD, Wang S-S, et al. The RNA component of human telomerase. Science 1995;269:1236–41. 145. Nakamura TM, Morin GB, Chapman KB, et al. Telomerase catalytic subunit homologs from fission yeast and human. Science 1997;277:955–9. 146. Koyanagi K, Ozawa S, Ando N, et al. Telomerase activity as an indicator of malignant potential in iodine nonreactive lesions of the esophagus. Cancer 2000;88:1524–9. 147. Ulaner GA, Hu JF, Vu TH, Giudice LC, Hoffman AR. Telomerase activity in human development is regulated by human telomerase reverse transcriptase (hTERT) transcription and by alternate splicing of hTERT transcripts. Cancer Res 1998;58:4168–72. 148. Kim NW, Piatyszek MA, Prowse KR, et al. Specific association of human telomerase activity with immortal cells and cancer. Science 1994;266:2011–15. 149. Wright WE, Shay JW. Time, telomeres and tumours: is cellular senescence more than an anticancer mechanism? Trends Cell Biol 1995;5:293–7. 150. Hiyama K, Hirai Y, Kyoizumi S, et al. Activation of telomerase in human lymphocytes and hematopoietic progenitor cells. J Immunol 1995;155:3711–15. 151. Hiyama E, Hiyama K, Tatsumoto N, Kodama T, Shay JW, Yokoyama T. Telomerase activity in human intestine. Int J Oncol 1996;9:453–8. 152. Wright WE, Piatyszek MA, Rainey WE, Byrd W, Shay JW. Telomerase activity in human germline and embryonic tissues and cells. Dev Genet 1996;18:173–9.

8 Diagnostic Value I: Solid Tumors

205

153. Hiyama E, Gollahan L, Kataoka T, et al. Telomerase activity in human breast tumors. J Natl Cancer Inst 1996;88:116–22. 154. Mathew P, Valentine MB, Bowman LC, et al. Detection of MYCN gene amplification in neuroblastoma by fluorescence in situ hybridization: a pediatric oncology group study. Neoplasia 2001;3:105–9. 155. Iwao T, Hiyama E, Yokoyama T, et al. Telomerase activity for the preoperative diagnosis of pancreatic cancer. J Natl Cancer Inst 1997;89:1621–3. 156. Ohyashiki K, Ohyashiki JH, Nishimaki J, et al. Cytological detection of telomerase activity using an in situ telomeric repeat amplification protocol assay. Cancer Res 1997;57:2100–3. 157. Chou SJ, Chen CM, Harn HJ, Chen CJ, Liu YC. In situ detection of hTERT mRNA relates to Ki-67 labeling index in papillary thyroid carcinoma. J Surg Res 2001;99:75–83. 158. Kumaki F, Kawai T, Hiroi S, et al. Telomerase activity and expression of human telomerase RNA component and human telomerase reverse transcriptase in lung carcinomas. Hum Pathol 2001;32:188–95. 159. Hiyama E, Hiyama K, Shay JW, Yokoyama T. Immunhistochemical detection of telomerase (hTERT) protein in human cancer tissues and a subset of cells in normal tissues. Neoplasia 2001;3:17–26. 160. Kumaki F, Takeda K, Yu ZX, Moss J, Ferrans VJ. Expression of human telomerase reverse transcriptase in lymphangioleiomyomatosis. Am J Respir Crit Care Med 2002;166:187–91. 161. Frost M, Bobak JB, Gianani R, et al. Localization of telomerase hTERT protein and hTR in benign mucosa, dysplasia, and squamous cell carcinoma of the cervix. Am J Clin Pathol 2000;114:726–34. 162. Miyazu YM, Miyazawa T, Hiyama K, et al. Telomerase expression in noncancerous bronchial epithelia is a possible marker of early development of lung cancer. Cancer Res 2005;65:9623–7. 163. Slaughter DP, Southwick HW, Smejkal W. Field cancerization in oral stratified squamous epithelium: clinical implications of multicentric origin. Cancer 1953;6:963–8. 164. Luzar B, Poljak M, Marin IJ, Eberlinc A, Klopcic U, Gale N. Human telomerase catalytic subunit gene re-expression is an early event in oral carcinogenesis. Histopathology 2004;45:13–19. 165. Oikonomou P, Mademtzis I, Messinis I, Tsezou A. Quantitative determination of human telomerase reverse transcriptase messenger RNA expression in premalignant cervical lesions and correlation with human papillomavirus load. Hum Pathol 2006;37:135–42. 166. Sen S, Reddy VG, Guleria R, Jain SK, Kapila K, Singh N. Telomerase – a potential molecular marker of lung and cervical cancer. Clin Chem Lab Med 2002;40:994–1001. 167. Sakr WA, Partin AW. Histological markers of risk and the role of high-grade prostatic intraepithelial neoplasia. Urology 2001;57:115–20. 168. Orlando C, Gelmini S, Selli C, Pazzagli M. Telomerase in urological malignancy. J Urol 2001;166:666–73. 169. Sumida T, Sogawa K, Hamakawa H, Sugita A, Tanioka H, Ueda N. Detection of telomerase activity in oral lesions. J Oral pathol Med 1998;27:111–15. 170. Mao L, El-Naggar AK, Fan YH, et al. Telomerase activity in head and neck squamous cell carcinoma and adjacent tissues. Cancer Res 1996;56:5600–4. 171. Sumida T, Hamakawa H, Sogawa K, Sugita A, Tanioka H, Ueda N. Telomerase components as a diagnostic tool in human oral lesions. Int J Cancer 1999;80:1–4. 172. Califano J, Ahrendt SA, Meininger G, Westra WH, Koch WH, Sidransky G. Detection of telomerase activity in oral renses from head and neck squamous cell carcinoma. Cancer Res 1998;56:5720–2. 173. Zhang S, Dong M, Teng X, Chen T. Quantitative assay of telomerase activity in head and neck squamous cell carcinoma and other tissues. Arch Otolaryngol Head Neck Surg 2001;127:581–5.

206

E. Hiyama, K. Hiyama

174. Umbricht CB, Saji M, Westra WH, Udelsman R, Zeiger MA, Sukumar S. Telomerase activity: a marker to distinguish follicular thyroid adenoma from carcinoma. Cancer Res 1997;57:2144–7. 175. Zeiger MA, Smallridge RC, Clark DP, et al. Human telomerase reverse transcriptase (hTERT) gene expression in FNA samples from thyroid neoplasms. Surgery 1999; 126:1195–8; discussion 8–9. 176. Haugen BR, Nawaz S, Markham N, et al. Telomerase activity in benign and malignant thyroid tumors. Thyroid 1997;7:337–42. 177. Mora J, Lerma E. Telomerase activity in thyroid fine needle aspirates. Acta Cytol 2004;48:818–24. 178. Kammori M, Nakamura K, Hashimoto M, Ogawa T, Kaminishi M, Takubo K. Clinical application of human telomerase reverse transcriptase gene expression in thyroid follicular tumors by fine-needle aspirations using in situ hybridization. Int J Oncol 2003;22:985–91. 179. Bieche I, Nogues C, Paradis V, et al. Quantitation of hTERT gene expression in sporadic breast tumors with a real-time reverse transcription-polymerase chain reaction assay. Clin Cancer Res 2000;6:452–9. 180. Elkak A, Mokbel R, Wilson C, Jiang WG, Newbold RF, Mokbel K. hTERT mRNA expression is associated with a poor clinical outcome in human breast cancer. Anticancer Res 2006;26:4901–4. 181. Pearson AS, Gollahon LS, O’Neal NC, Saboorian H, Shay JW, Fahey TR. Detection of telomerase activity in breast masses by fine-needle aspiration. Ann Surg Oncol 1998; 5:186–93. 182. Kirkpatrick KL, Ogunkolade W, Elkak AE, et al. hTERT expression in human breast cancer and non-cancerous breast tissue: correlation with tumour stage and c-Myc expression. Breast Cancer Res Treat 2003;77:277–84. 183. Hines WC, Fajardo AM, Joste NE, Bisoffi M, Griffith JK. Quantitative and spatial measurements of telomerase reverse transcriptase expression within normal and malignant human breast tissues. Mol Cancer Res 2005;3:503–9. 184. Hiyama E, Saeki T, Hiyama K, et al. Telomerase activity as a marker of breast cancer in fine needle aspirated samples. Cancer Cytopathol 2000;90:235–8. 185. Mokbel K, Williams NJ, Leris AC, Kouriefs C. Telomerase activity in fine-needle aspirates of breast lesions. J Clin Oncol 1999;17:3856–60. 186. Poremba C, Shroyer KR, Frost M, et al. Telomerase is a highly sensitive and specific molecular marker in fine-needle aspirates in breast lesions. J Clin Oncol 1999;17:2020–6. 187. Capkova L, Kalinova M, Krskova L, et al. Loss of heterozygosity and human telomerase reverse transcriptase (hTERT) expression in bronchial mucosa of heavy smokers. Cancer 2007;109:2299–307. 188. Sen S, Reddy VG, Khanna N, Guleria R, Kapila K, Singh N. A comparative study of telomerase activity in sputum, bronchial washing and biopsy specimens of lung cancer. Lung Cancer 2001;33:41–9. 189. Haruta Y, Hiyama K, Ishioka S, Hozawa S, Hiroaki M, Yamakido M. Activation of telomerase is induced by a natural antigen in allergen-specific memory T lymphocytes in broncheal asthma. Biochem Biophys Res Commun 1999;259:617–23. 190. Hiyama K, Ishioka S, Shay JW, et al. Telomerase activity as a novel marker of lung cancer and immune-associated lung diseases. Int J Mol Med 1998;1:545–9. 191. Kleideiter E, Friedrich U, Mohring A, et al. Telomerase activity in chronic inflammatory bowel disease. Dig Dis Sci 2003;48:2328–32. 192. Yoshida K, Sugino T, Goodison S, et al. Detection of telomerase activity in exfoliated cancer cells in colonic luminal washings and its related clinical implications. Br J Cancer 1997;75:548–53. 193. Hiyama E, Kodama T, Sinbara K, et al. Telomerase activity is detected in pancreatic cancer but not in benign tumors. Cancer Res 1997;57:326–31.

8 Diagnostic Value I: Solid Tumors

207

194. Morales CP, Burdick JS, Saboorian MH, Wright WE, Shay JW. In situ hybridization for telomerase RNA in routine cytologic brushings for the diagnosis of pancreaticobiliary malignancies. Gastrointest Endosc 1998;48:402–5. 195. Suehara N, Mizumoto K, Tanaka M, et al. Telomerase activity in pancreatic juice differentiates ductal carcinoma from adenoma and pancreatitis. Clin Cancer Res 1997;3:2479–83. 196. Inoue H, Tsuchida A, Kawasaki Y, Fujimoto Y, Yamasaki S, Kajiyama G. Preoperative diagnosis of intraductal papillary-mucinous tumors of the pancreas with attention to telomerase activity. Cancer 2001;91:35–41. 197. Uemura K, Hiyama E, Murakami Y, et al. Comparative analysis of K-ras point mutation, telomerase activity, and p53 overexpression in pancreatic tumours. Oncol Rep 2003; 10:277–83. 198. Hashimoto Y, Murakami Y, Uemura K, et al. Telomere shortening and telomerase expression during multistage carcinogenesis of intraductal papillary mucinous neoplasms of the pancreas. J Gastrointest Surg 2008;12:17–28. 199. Itoi T, Ohyashiki K, Yahata N, et al. Detection of telomerase activity in exfoliated cancer cells obtained from bile. Int J Oncol 1999;15:1061–7. 200. Shukla VK, Chauhan VS, Kumar M. Telomerase activation – one step on the road to carcinoma of the gall bladder. Anticancer Res 2006;26:4761–6. 201. Braunschweig R, Yan P, Guilleret I, et al. Detection of malignant effusions: comparison of a telomerase assay and cytologic examination. Diagn Cytopathol 2001;24:174–80. 202. Dejmek A, Yahata N, Ohyashiki K, et al. In situ telomerase activity in pleural effusions: a promising marker for malignancy. Diagn Cytopathol 2001;24:11–15. 203. Wallace MB, Block M, Hoffman BJ, et al. Detection of telomerase expression in mediastinal lymph nodes of patients with lung cancer. Am J Respir Crit Care Med 2003;167:1670–5. 204. Yang CT, Lee MH, Lan RS, Chen JK. Telomerase activity in pleural effusions: diagnostic significance. J Clin Oncol 1998;16:567–73. 205. Tangkijvanich P, Tresukosol D, Sampatanukul P, et al. Telomerase assay for differentiating between malignancy-related and nonmalignant ascites. Clin Cancer Res 1999;5:2470–5. 206. Duggan BD, Wan M, Yu MC, et al. Detection of ovarian cancer cells: comparison of a telomerase assay and cytologic examination. J Natl Cancer Inst 1998;90:238–42. 207. Ramakumar S, Bhuiyan J, Besse JA, et al. Comparison of screening methods in the detection of bladder cancer. J Urol 1999;161:388–94. 208. Fukui T, Nonomura N, Tokizane T, et al. Clinical evaluation of human telomerase catalytic subunit in bladder washings from patients with bladder cancer. Mol Urol 2001;5:19–23. 209. Ito H, Kyo S, Kanaya T, et al. Detection of human telomerase reverse transcriptase messenger RNA in voided urine samples as a useful diagnostic tool for bladder cancer. Clin Cancer Res 1998;4:2807–10. 210. Eissa S, Swellam M, Ali-Labib R, Mansour A, El-Malt O, Tash FM. Detection of telomerase in urine by 3 methods: evaluation of diagnostic accuracy for bladder cancer. J Urol 2007;178:1068–72. 211. Meid FH, Gygi CM, Leisinger HJ, Bosman FT, Benhattar J. The use of telomerase activity for the detection of prostatic cancer cells after prostatic massage. J Urol 2001;165:1802–5. 212. Vicentini C, Gravina GL, Angelucci A, et al. Detection of telomerase activity in prostate massage samples improves differentiating prostate cancer from benign prostatic hyperplasia. J Cancer Res Clin Oncol 2004;130:217–21. 213. Wang Z, Ramin SA, Tsai C, et al. Evaluation of PCR-ELISA for determination of telomerase activity in prostate needle biopsy and prostatic fluid specimens. Urol Oncol 2002;7:199–205. 214. Jarboe EA, Liaw KL, Thompson LC, et al. Analysis of telomerase as a diagnostic biomarker of cervical dysplasia and carcinoma. Oncogene 2002;21:664–73. 215. Wisman GB, Hollema H, de jong S, et al. Telomerase activity as a biomarker for (pre) neoplastic cervical disease in scrapings and frozen sections from patients with abnormal cervical smear. J Clin Oncol 1998;16:2238–45.

208

E. Hiyama, K. Hiyama

216. Zheng PS, Iwasaka T, Zhang ZM, Pater A, Sugimori H. Telomerase activity in Papanicolaou smear-negative exfoliated cervical cells and its association with lesions and oncogenic human papillomaviruses. Gynecol Oncol 2000;77:394–8. 217. Triginelli SA, Silva-Filho AL, Traiman P, et al. Telomerase activity in the vaginal margins of radical hysterectomy in patients with carcinoma of the cervix: correlation with histology and human papillomavirus. Int J Gynecol Cancer 2006;16:1283–8. 218. Reesink-Peters N, Helder MN, Wisman GB, et al. Detection of telomerase, its components, and human papillomavirus in cervical scrapings as a tool for triage in women with cervical dysplasia. J Clin Pathol 2003;56:31–5. 219. Zygouris P, Tsiambas E, Tiniakos D, et al. Evaluation of combined h-TERT, bcl-2, and caspases 3 and 8 expression in cutaneous malignant melanoma based on tissue microarrays and computerized image analysis. J BUON 2007;12:513–19. 220. Fullen DR, Zhu W, Thomas D, Su LD. hTERT expression in melanocytic lesions: an immunohistochemical study on paraffin-embedded tissue. J Cutan Pathol 2005;32:680–4. 221. Gauthier LR, Granotier C, Soria JC, et al. Detection of circulating carcinoma cells by telomerase activity. Br J Cancer 2001;84:631–5. 222. Chen XQ, Bonnefoi H, Pelte MF, et al. Telomerase RNA as a detection marker in the serum of breast cancer patients. Clin Cancer Res 2000;6:3823–6. 223. Miura N, Maeda Y, Kanbe T, et al. Serum human telomerase reverse transcriptase messenger RNA as a novel tumor marker for hepatocellular carcinoma. Clin Cancer Res 2005; 11:3205–9. 224. Miura N, Maruyama S, Oyama K, et al. Development of a novel assay to quantify serum human telomerase reverse transcriptase messenger RNA and its significance as a tumor marker for hepatocellular carcinoma. Oncology 2007;72 Suppl 1:45–51. 225. Guilleret I, Yan P, Guillou L, Braunschweig R, Coindre JM, Benhattar J. The human telomerase RNA gene (hTERC) is regulated during carcinogenesis but is not dependent on DNA methylation. Carcinogenesis 2002;23:2025–30. 226. Cairney CJ, Hoare SF, Daidone MG, Zaffaroni N, Keith WN. High level of telomerase RNA gene expression is associated with chromatin modification, the ALT phenotype and poor prognosis in liposarcoma. Br J Cancer 2008;98:1467–74. 227. Harada K, Kurisu K, Arita K, et al. Telomerase activity in central nervous system malignant lymphoma. Cancer 1999;86:1050–5. 228. Yoshino A, Katayama Y, Fukushima T, et al. Telomerase activity in pituitary adenomas: significance of telomerase expression in predicting pituitary adenoma recurrence. J Neurooncol 2003;63:155–62. 229. Ogawa Y, Nishioka A, Hamada N, et al. Changes in telomerase activity of advanced cancers of oral cavity and oropharynx during radiation therapy: correlation with clinical outcome. Int J Mol Med 1998;2:301–7. 230. Patel MM, Parekh LJ, Jha FP, et al. Clinical usefulness of telomerase activation and telomere length in head and neck cancer. Head Neck 2002;24:1060–7. 231. Gonzalez-Quevedo R, Iniesta P, Moran A, et al. Cooperative role of telomerase activity and p16 expression in the prognosis of non-small-cell lung cancer. J Clin Oncol 2002;20:254–62. 232. Hirashima T, Komiya T, Nitta T, et al. Prognostic significance of telomeric repeat length alterations in pathological stage I-IIIA non-small cell lung cancer. Anticancer Res 2000;20:2181–7. 233. Taga S, Osaki T, Ohgami A, Imoto H, Yasumoto K. Prognostic impact of telomerase activity in non-small cell lung cancers. Ann Surg 1999;230:715–20. 234. Hara H, Yamashita K, Shinada J, Yoshimura H, Kameya T. Clinicopathologic significance of telomerase activity and hTERT mRNA expression in non-small cell lung cancer. Lung Cancer 2001;34:219–26. 235. Soria JC, Moon C, Wang L, et al. Effects of N-(4-hydroxyphenyl)retinamide on hTERT expression in the bronchial epithelium of cigarette smokers. J Natl Cancer Inst 2001; 93:1257–63.

8 Diagnostic Value I: Solid Tumors

209

236. Carey LA, Kim NW, Goodman S, et al. Telomerase activity and prognosis in primary breast cancers. J Clin Oncol 1999;17:3075–81. 237. Clark GM, Osborne CK, Levitt D, Wu F, Kim NW. Telomerase activity and survival of patients with node-positive breast cancer. J Natl Cancer Inst 1997;89:1874–81. 238. Okayasu I, Osakabe T, Fujiwara M, Fukuda H, Kato M, Oshimura M. Significant correlation of telomerase activity in thyroid papillary carcinomas with cell differentiation, proliferation and extrathyroidal extension. Jpn J Cancer Res 1997;88:965–70. 239. Hiyama E, Yokoyama T, Tatsumoto N, et al. Telomerase activity in gastric cancer. Cancer Res 1995;55:3258–62. 240. Ito M, Liu Y, Yang Z, et al. Stem cells in the hair follicle bulge contribute to wound repair but not to homeostasis of the epidermis. Nat Med 2005;11:1351–4. 241. Kakeji Y, Maehara Y, Koga T, et al. Gastric cancer with high telomerase activity shows rapid development and invasiveness. Oncol Rep 2001;8:107–10. 242. Usselmann B, Newbold M, Morris AG, Nwokolo CU. Telomerase activity and patient survival after surgery for gastric and oesophageal cancer. Eur J Gastroenterol Hepatol 2001;13:903–8. 243. Okayasu I, Mitomi H, Yamashita K, et al. Telomerase activity significantly correlates with cell differentiation, proliferation and lymph node metastasis in colorectal carcinomas. J Cancer Res Clin Oncol 1998;124:444–9. 244. Yoshida R, Kiyozuka Y, Ichiyoshi H, et al. Change in telomerase activity during human colorectal carcinogenesis. Anticancer Res 1999;19:2167–72. 245. Boldrini L, Faviana P, Gisfredi S, et al. Evaluation of telomerase mRNA (hTERT) in colon cancer. Int J Oncol 2002;21:493–7. 246. Naito Y, Takagi T, Handa O, et al. Telomerase activity and expression of telomerase RNA component and catalytic subunits in precancerous and cancerous colorectal lesions. Tumour Biol 2001;22:374–82. 247. Niiyama H, Mizumoto K, Sato N, et al. Quantitative analysis of hTERT mRNA expression in colorectal cancer. Am J Gastroenterol 2001;96:1895–900. 248. Smith DL, Soria JC, Morat L, et al. Human telomerase reverse transcriptase (hTERT) and Ki-67 are better predictors of survival than established clinical indicators in patients undergoing curative hepatic resection for colorectal metastases. Ann Surg Oncol 2004;11:45–51. 249. Hisatomi H, Nagao K, Kanamaru T, Endo H, Tomimatsu M, Hikiji K. Levels of telomerase catalytic subunit mRNA as a predictor of potential malignancy. Int J Oncol 1999;14:727–32. 250. Shimada M, Hasegawa H, Gion T, et al. The role of telomerase activity in hepatocellular carcinoma. Am J Gastroenterol 2000;95:748–52. 251. Suda T, Isokawa O, Aoyagi Y, et al. Quantitation of telomerase activity in hepatocellular carcinoma: a possible aid for a prediction of recurrent diseases in the remnant liver. Hepatology 1998;27:402–6. 252. Pearson AS, Chiao P, Zhang L, et al. The detection of telomerase activity in patients with adenocarcinoma of the pancreas by fine needle aspiration. Int J Oncol 2000;17:381–5. 253. Hara T, Noma T, Yamashiro Y, Naito K, Nakazawa A. Quantitative analysis of telomerase activity and telomerase reverse transcriptase expression in renal cell carcinoma. Urol Res 2001;29:1–6. 254. De Kok JB, Schalken JA, Aalders TW, Ruers TJ, Willems HL, Swinkels DW. Quantitative measurement of telomerase reverse transcriptase (hTERT) mRNA in urothelial cell carcinomas. Int J Cancer 2000;87:217–20. 255. Nakanishi K, Kawai T, Hiroi S, et al. Expression of telomerase mRNA component (hTR) in transitional cell carcinoma of the upper urinary tract. Cancer 1999;86:2109–16. 256. Bonatz G, Frahm SO, Klapper W, et al. High telomerase activity is associated with cell cycle deregulation and rapid progression in endometrioid adenocarcinoma of the uterus. Hum Pathol 2001;32:605–14.

210

E. Hiyama, K. Hiyama

257. Kido A, Schneider-Stock R, Hauptmann K, Roessner A. Telomerase activity in juxtacortical and conventional high-grade osteosarcomas: correlation with grade, proliferative activity and clinical response to chemotherapy. Cancer Lett 2003;196:109–15. 258. Schneider-Stock R, Jaeger V, Rys J, Epplen JT, Roessner A. High telomerase activity and high HTRT mRNA expression differentiate pure myxoid and myxoid/round-cell liposarcomas. Int J Cancer 2000;89:63–8. 259. Wurl P, Kappler M, Meye A, et al. Co-expression of survivin and TERT and risk of tumourrelated death in patients with soft-tissue sarcoma. Lancet 2002;359:943–5. 260. Hiyama E, Hiyama K, Ohtsu K, et al Telomerase activity in neuroblastoma: is it a prognostic indicator of clinical behavior? Eur J Cancer 1997;33:1932–6. 261. Hiyama E, Hiyama K, Yokoyama T, Matsuura Y, Piatyszek MA, Shay JW. Correlating telomerase activity levels with human neuroblastoma outcomes. Nat Med 1995;1:249–55. 262. Krams M, Hero B, Berthold F, Parwaresch R, Harms D, Rudolph P. Full-length telomerase reverse transcriptase messenger RNA is an independent prognostic factor in neuroblastoma. Am J Pathol 2003;162:1019–26. 263. Brinkschmidt C, Poremba C, Christiansen H, et al. Comparative genomic hybridization and telomerase activity analysis identify two biologically different groups of 4s neuroblastomas. Br J Cancer 1998;77:2223–9. 264. Chadeneau C, Hay K, Hirte HW, Gallinger S, Bacchetti S. Telomerase activity associated with acquisition of malignancy in human colorectal cancer. Cancer Res 1995;55:2533–6. 265. Huang F, Kanno H, Yamamoto I, Lin Y, Kubota Y. Correlation of clinical features and telomerase activity in human gliomas. J Neurooncol 1999;43:137–42. 266. Nakatani K, Yoshimi N, Mori H, et al. The significant role of telomerase activity in human brain tumors. Cancer 1997;80:471–6. 267. Maes L, Kalala JP, Cornelissen M, de Ridder L. Progression of astrocytomas and meningiomas: an evaluation in vitro. Cell Prolif 2007;40:14–23. 268. Tabori U, Ma J, Carter M, et al. Human telomere reverse transcriptase expression predicts progression and survival in pediatric intracranial ependymoma. J Clin Oncol 2006; 24:1522–8. 269. Falchetti ML, Pierconti F, Casalbore P, et al. Glioblastoma induces vascular endothelial cells to express telomerase in vitro. Cancer Res 2003;63:3750–4. 270. Pallini R, Pierconti F, Falchetti ML, et al. Evidence for telomerase involvement in the angiogenesis of astrocytic tumors: expression of human telomerase reverse transcriptase messenger RNA by vascular endothelial cells. J Neurosurg 2001;94:961–71. 271. Kleideiter E, Schwab M, Friedrich U, Koscielniak E, Schafer BW, Klotz U. Telomerase activity in cell lines of pediatric soft tissue sarcomas. Pediatr Res 2003;54:718–23. 272. Saji M, Westra WH, Chen H, et al. Telomerase activity in the differential diagnosis of papillary carcinoma of the thyroid. Surgery 1997;122:1137–40.

Chapter 9

Diagnostic Value II: Hematopoietic Malignancies Junko H. Ohyashiki and Kazuma Ohyashiki

Abstract Telomerase activity has been suggested to play a critical role in hematopoietic stem cell (HSC) maintenance. The most primitive HSCs, long-term HSCs, present in specific niches where they can remain mitotically quiescent for long periods of time, exhibiting a low level of telomerase activity. Short-term HSCs undergo asymmetric cell divisions with upregulated telomerase activity. Leukemic stem cells (LSCs) have shortened telomeres with high telomerase activity, and the downstream rapidly cycling blasts have more shortened telomeres with higher telomerase activity. This indicates that telomerase activity, hTERT expression, or both are valuable for diagnostic and prognostic factor in treating leukemia patients. Telomere biology in chronic myeloid leukemia model also suggests that telomere length may be a good parameter to measure response to anticancer therapy. To prove the validity and efficacy of LSC-directed chemotherapy regimens, further study is required on the basis of telomere biology in normal and LSCs. Keywords: Telomeres, Hematopoietic stem cells, Leukemic stem cells.

9.1

Introduction

An emerging concept in cancer biology is that a rare population of cancer stem cells exists among the heterogeneous cell mass that constitutes a tumor (1–3). Hematopoietic stem cells (HSCs) are perhaps the best-described stem cell population in humans (4). Recent studies have demonstrated the developmental characteristics of HSCs and their niche, a microenvironment that supports stem cells. Normal and malignant HSC functions are defined by a common set of critical ‘‘stemness’’ that

J.H. Ohyashiki(*) Intractable Diseases Research, Tokyo Medical University, 7-1, 6-chome, Nishishinjuku, Shinjuku-ku, Tokyo 160-0023, Japan, e-mail: [email protected]

K. Hiyama (ed.), Telomeres and Telomerase in Cancer. DOI: 10.1007/978-1-60327-879-9_9, # Humana Press, a part of Springer Science + Business Media, LLC 2009 211

212

J.H. Ohyashiki, K. Ohyashiki

regulates self-renewal and differentiation (5). Telomerase, a ribonucleoprotein enzyme, is now considered to be a marker of stemness, since difference in telomere length and telomerase activity reflects the stage of stem cell (6). The existence of leukemic stem cells (LSCs) was proposed more than three decades ago, following the development of clonogenic growth assays with the capacity for clonal growth of leukemia in vitro (7). There was no definitive proof of LSCs, until conclusive evidence for the existence of LSCs came from the identification of a very rare population of human SCID leukemia-initiating cells that were capable of propagating acute myeloid leukemia (AML) in a xenograft transplant system (8, 9). The engraftment of nonobese diabetic/severe combined immunodeficient (NOD/SCID) mice with primary AML samples could only be evaluated using cells that were phenotypically similar to normal HSCs by CD34 expression and lacking markers of lineage commitment such as CD38 (10). Comparison of the LSC gene expression to that in normal HSC revealed that 34% of the modulated genes were shared by both LSC and HSC, suggesting that the LSC originated within the HSC progenitors (11). While it is now known that leukemias arise from LSC, there are few studies that have directly addressed telomere biology at the LSC level: the majority of them have used unselected leukemia cell populations. This is mainly due to the conventional Southern blot-based methodology using cell lysate, i.e., terminal restriction fragment (TRF) analysis, to measure the average telomere length. This obstacle was overcome by fluorescence in situ hybridization (FISH) with peptide nucleic acid (PNA) probes and the flow cytometry (flow-FISH) method, which made it possible to analyze telomere length and thus the replication history of different cell types of cells sorted by FACS (12). Recent advances of quantitative-FISH (Q-FISH) with a telomerespecific PNA probe also made it possible to investigate the uneven distribution of telomere length on individual chromosome ends (13, 14). This review will summarize the current understanding of telomere/telomerase regulation in normal and leukemic HSC, and then discuss about its diagnostic value in human leukemias.

9.2

Stem Cell, Niche, and Quiescence

Stem cells have been identified as a source of virtually all highly differentiated cells that are replenished during their life time. The critical balance between stem and differentiated cell populations is critical for the long-term maintenance of functional tissue types. It is important to understand the stem cell dynamics when discussing telomere/ telomerease regulation in normal and leukemic hematopoetic stem cells. Stem cells remain in specific niches where they can remain mitotically quiescent for long period of time. They expand their numbers as they self-renew by symmetric division. They can also maintain their numbers and produce rapidly dividing progenitors by asymmetric division. The most important property of stem cells is that of self-renewal. Tumors may often originate from the transformation of normal stem cells, and similar signaling pathways may regulate self-renewal in stem cells and cancer stem cells (1).

9 Diagnostic Value II: Hematopoietic Malignancies

213

HSCs can be functionally defined as either long-term (LT-HSCs) or short-term (ST-HSCs) repopulating stem cells according to their capacity to provide life-long or transient hemopoiesis (1, 15) (Fig. 9.1). LT-HSCs primarily reside in bone marrow niches, whereas ST-HSCs may be mobilized. The hallmarks of HSC are classically defined in terms of ability to self-renewal and differentiation, and HSCs include a wide variety of progenitors based on the results obtained from colony-forming assay, thus creating some confusion. Recent criteria assigned as requirements in defining an HSC include (1) multipotency and asymmetric cell division as means to give rise to multiple cell types, (2) quiescence and slow self-renewal allowing for long life span, (3) niche dependence and the ability to maintain an undifferentiated state in the presence of such a niche, (4) long-term repopulation and the ability to engraft in vivo and reconstitute the tissue upon transplantation (15). Although not all criteria can be met for all classes of HSC, all criteria can be met for LT-HSC, which may represent a minor fraction of the CD34+ D38 cells.

Progenitors

a

low telomerase enhanced telomerase high telomerase

Common myeloid progenitors

Platelets

Megakaryocyte/ erythriod

Erythrocyte

Niche

Granulocyte Multipotent progenitors

Granulocyte/ macrophage Monocyte

Long-term HSC

Macrophage/ dendritic cell

Short-term HSC

Dendritic cell

T cell

b

Common lymphoid progenitors

resting

activated

B cell

Telomerase activation Leukemic stem cell

Fig. 9.1 Regulation of telomerase in the hierarchy of the normal and leukemic hematopoietic stem cell. (a) The most primitive HSCs (long-term HSCs) are present in specific niches where they can remain mitotically quiescent for long periods of time. LT-HSCs exhibit a low level of telomerase activity. ST-HSCs undergo asymmetric cell divisions and produce mitotically active daughter cells also called progenitors: telomerase activity is upregulated in their immediate progeny and may help to slow down the rate of telomere erosion. (b) LT-HSCs, ST-HSCs, multipotent progenitors, and common myeloid progenitors can potentially become leukemic stem cells (LSCs) with self-renewl activity. LSCs can differentiate into multiple types of leukemia

214

9.3

J.H. Ohyashiki, K. Ohyashiki

Regulation on Telomere/Telomerase in Normal HSC

Normal hematopoietic cells and their progeny express varying levels of telomerase activity according to their state of differentiation and activation (16–20) (Fig. 9.1). The strict balance between self renewal and differentiation of HSC is a tightly regulated process, and telomerase activity has been suggested to play a critical role in HSC maintenance. The level of telomerase activity in human HSCs and their differentiated progeny have been studied extensively (21–24). These studies were predominantly based on measurement of telomerase activity on phenotypically defined CD34+ or CD34+ CD38 cells by using the TRAP assay, although these studies did not directly link hTERT expression and telomerase activity to any functionally distinct subpopulation of CD34+ cells. Recently, Fan and colleagues have reported living cord blood CD34+ cells with upregulated hTERT expression by using an hTERT-reporting adenoviral vector encoding destabilized GFP driven by the hTERT promoter (25). They functionally characterized them in comparison with control vector-transduced CD34+ cells expressing GFP. They found that cord blood CD34+ cells with upregulated hTERT expression contain actively cycling short-term multipotent repopulation cells and committed colony-forming progenitor cells (25). Although LT-HSCs have not been isolated or functionally characterized in the context of telomerase activity, LT-HSCs are likely to be usually quiescent and therefore exhibit a low level of telomerase activity. Upon stimulation to proliferate, telomerase activity appears to be upregulated in their immediate progeny and may help to slow down the rate of telomere erosion. The more mature cells then become quiescent again and downregulate telomerase activity. The telomeres of HSCs shorten, probably due to inadequate levels of telomerase activity that slow but do not completely prevent telomere erosion (21, 26). Initial studies on hematopoietic cells demonstrated that the mean TRFs of total nucleated cells from adult bone marrow were shorter than TRFs of the same type of cells isolated from fetal liver and cord blood (23, 27). Short TRFs were found for purified primitive CD34 + CD38 low cells from adult bone marrow compared with those from fetal liver. In peripheral blood cells, telomere shortening and telomerase activity progressively decreased with aging (16, 23, 28). Flow-FISH analysis also revealed that telomeres in bone marrow CD34+ CD38 are longer than those of CD34+ CD38+ cells in the same donor (29). These findings support the idea that telomeres are also shortened in HSCs during normal replicative aging. Both T cells and B cells in peripheral blood also had low telomerase activity, which was elevated when either cell type was cultured with mitogen (16, 30–32). The highest in vivo telomerase expression in normal T cells is present in the thymus, followed by T cells in the tonsils (33, 34). The germinal center B cells also show high telomerase activity (30, 35). Thus, telomerase may play a gatekeeping role in T-cell- and B-cell development and in determining the capacity of lymphoid cells for cell division and clonal expansion, such as virus-related diseases. The telomeres in the CD8+ T-cell compartment are shortened on average, because there is a larger

9 Diagnostic Value II: Hematopoietic Malignancies

215

proportion of activated CD8+ cells in HIV-1-infected individuals, while telomere lengths are not reduced in CD4+ T cells (36). CD8+ EBV-specific T cells in patients with acute infectious mononucleosis maintain their telomere length relative to CD8 + T cells in normal individuals and relative to CD4+ T cells within the patients themselves, and this is associated with the induction of the enzyme telomerase (37).

9.4

Telomere Biology in the Transplanted HSC Population

There has also been great progress in stem cell biology regarding the development of stem cell transplantation. Several lines of evidence suggest that recipients of stem cell transplantation have shorter telomeres than do their donors (38–41). Rufer et al. demonstrated that posttransplant telomere loss has been shown to be restricted to the first year of regeneration after stem cell transplantation, followed by a more gradual loss thereafter (42). This observation does not simply rule out the possibility that telomere loss after stem cell transplantation affects the incidence and/or time of onset of age-related secondary malignancy (43–45). Indeed, nonmyeloablative conditioning does not prevent telomere shortening after allogeneic stem cell transplantation (46). We also found a marked fluctuation of telomere length in peripheral blood leukocytes during chronic graft-versus-host disease (GvHD) after allogeneic stem cell transplantation (47). The different kinetics of restoration of hematopoiesis and the probable ongoing process of graft-versus-leukemia (GvL) in the bone marrow do not prevent telomere attrition. It is noteworthy that the markably longer telomeres observed in the allogeneic umbilical cord blood HSC transplant recipients than in the allogeneic peripheral blood HSC transplant recipients may be indicative of a replicative advantage inherent in the use of umbilical cord blood HSC for transplantation (48). It would appear reasonable to consider whether we can experimentally elongate the telomeres ex vivo in normal hematopoietic cells before transplantations. In wild-type mice serially transplanted with transgenic mTERT-expressing bone marrow or HSC, no telomere shortening was observed after four serial transplantations, although it was impossible to transplant beyond the fourth attempt (49). Overexpression of hTERT in CD4+ T cells provides a proliferative advantage independent of the average telomere length but does not prevent eventual genetic instability and replicative senescence (50). Taken together, to extend the limited life span of HSC, while not immortalizing them, use of hTERT-overexpressed HSCs after ex vivo cell expansion might still be a hopeful approach for tissue engineering.

9.5

Telomeres and Telomerase in Human Leukemia Cells

Whether the mechanism of telomerase positivity in leukemia is expansion of preexisting telomerase-competent clone or upregulation of telomerase-negative cells remains controversial (51–53). The accumulating evidence that telomerase is already present in stem cells and need not be reactivated implies that the former

216

J.H. Ohyashiki, K. Ohyashiki

hypothesis may be more attractive. Only a few studies have been published regarding telomere biology at the LSC level. The majority of studies have used unselected leukemia cells, thus containing heterogenous cells at various stages of maturation. The following section summarizes the studies on telomere dynamics in human leukemias. Chronic myeloid leukemia (CML) is a clonal myeloproliferative disorder characterized by the Philadelphia chromosome (Ph) that creates the p210BCR/ABL chimeric protein. Currently CML is considered to be a model disorder to study the telomere biology and disease progression in LSC (54) (Fig. 9.2). First, LSC defined by p210BCR/ABL is characterized by an increased cellular turnover. Second, the disease is characterized clinically by a relatively stable chronic phase, followed by an acute blastic phase. Earlier studies using unseparated blood cells demonstrated changes of telomere length and telomerase activity between the chronic phase (CP) and the blastic phase (BP) (55–57). In the chronic phase, TRFs are generally shorter, and the level of telomerase activity is slightly elevated but not enough to maintain telomere length in the CP, thereby TRFs may reflect a history of the proliferation of leukemia cells closely related to disease severity (55–58). The subfractionation experiment by flow-FISH confirmed that telomeres in Ph-positive cells were indeed significantly shorter than in Ph-negative T lymphocytes (59). In addition, telomeres in BCR-ABL-positive CD34+ CML cells were significantly ed

anc

adv

Bcr-Abl

Additional genetic changes

Normal

Chronic

Differentiation Cell cycle Apoptosis

Blastic

Imatinib 20Kb

Telomere length 5kb

20Kb

20Kb

5kb

5kb

Peak telomer length

Fig. 9.2 Telomere biology in CML model: Biological properties of CML cells in three hematologically different stages (normal, chronic phase, and blastic phase) are shown in the triangle. The peak telomere lengths in each stage are shown in the lower part of the figure, showing the telomere attrition and disease progression in LSC. Restoration of telomere length could be seen after imatinib treatment

9 Diagnostic Value II: Hematopoietic Malignancies

217

shorter than those in BCR-ABL-negative CD34+ cells obtained from non-CML individuals (54). In line with these findings, cytogenetic and molecular responses after either imatinib or interferon therapy are correlated with an increase of mean telomere length (56, 60). In the blastic phase, further reduction of TRFs is observed as a result of rapidly cycling cells; however, whether telomerase activity is upregulated or not is controversial (54, 58). It is likely that upregulation of telomerase confers a selective growth advantage to the subclone, which predominantly proliferates in the blastic phase. Drummond et al. found that telomerase activity in the blastic phase is not elevated on a cell-to-cell basis, after correction for cell cycle status (54). These findings suggest that telomere length rather than telomerase activity may be both a diagnostic marker and a prognostic marker. Normalization of telomere length after imatinib therapy would be a parameter of restoration of normal HSC (Fig. 9.2). An association between telomerase elevation and disease progression requires further investigation. Acute leukemia is subdivided according to morphologic, immunophenotypic, and cytogenetic characteristics of leukemia cells. Unlike solid tumors, distinct subtypes of acute leukemia are characterized by reciprocal translocation, i.e., t(8;21), t(15;17), and t(9;22), resulting in a chimeric protein that may play a central role in the pathogenesis of such leukemias. Cytogenetic results are therefore considered to be the most reliable prognostic factors. Importantly, reciprocal translocation may not result from telomere dysfunction, while numerical changes might result from end-toend chromosomal fusion. Swiggers et al. have recently demonstrated that AML with multiple chromosome aberrations that may result from telomere dysfunction is invariably characterized by critically short telomeres (14). A number of studies have investigated telomere length, telomerase activity, and/ or hTERT expression in patients with acute leukemia; however, wide variation has been reported, possibly due to the heterogeneity of blasts (19, 21, 61–64). Theoretically, it would be logical to compare the telomere-related parameters in leukemic cells and those in normal cells at the similar differentiation stages; however, in practical terms, this is difficult. It is likely that the leukemia-derived stem cells express increasing levels of telomerase activity with an increasing fraction of cycling leukemia cells. The level of telomerase activity decreases to normal levels at the remission state (Fig. 9.3) and tends to be higher at the relapse phase (21, 61). Patients with high levels of telomerase activity show significantly poorer prognosis than those with low telomerase activity (21), indicating that telomerase activity may be a prognostic factor in acute leukemias. Of note is that, despite high copy numbers of full-length hTERT mRNA, telomerase activity was low in some cases with low copy numbers of hTERC, raising the possibility that alteration of the hTERC:hTERT ratio may affect functionally active telomerase activity in vivo (65). Similary, dysregulated expression of the major telomerase components was found in CML cells (54). Taken together, these findings suggest that telomere homeostasis may be disrupted in a subset of leukemia cells. Since little is known about the telomere length regulatory system by telomere binding proteins (66), further studies are required. An understanding of the com-

218

J.H. Ohyashiki, K. Ohyashiki

hTERT

Low telomerase activity (HSCs in niche)

3’

LT-HSC

5’ hTERT

Normal

3’

ST-HSC

5’

hTERT

High telomerase activity

3’

LSC

5’

Leukemia hTERT

3’

Blasts

Rapidly cycling blasts

5’ hTERT

Remission

Normal counterparts

3’ 5’

low

high Telomerase

Fig. 9.3 Telomere and telomerase status in normal and leukemic hematopoietic cells: LSCs are distinct from LT-HSCs and ST-HSCs. LT-HSCs have long telomeres with low telomerase activity. ST-HSCs have long telomeres with upregulated telomerase. LSCs have shortened telomeres with high telomerase activity, and the downstream rapidly cycling blasts have more shortened telomeres with higher telomerase activity. In the remission state, telomere/telomerase status can be normalized in accordance with restoration of normal counterparts

plexities of telomerase gene regulation in biologically heterogeneous leukemia cells may offer new therapeutic approaches to the treatment of acute leukemia.

9.6

Genomic Instability and Telomere Attrition in Leukemia and Bone Marrow Failure Syndromes

More than 10 years ago, we demonstrated for the first time a possible association between telomere dysfunction and genomic instability in myelodysplastic syndrome (MDS), which is a subtype of bone marrow failure syndrome (67). MDS is characterized by dysplastic features in blood cells, and approximately 30% of patients show progression to AML (68). Unlike acute leukemia, numerical chromosomal changes rather than reciprocal translocation are frequently seen in patients with MDS. Since shortened telomere length appears to be related to complex cytogenetic

9 Diagnostic Value II: Hematopoietic Malignancies

219

abnormalities, indicating genomic instability and poor prognosis (67), there is increasing interest in telomere length rather than in telomerase activity in relation to MDS prognosis. Indeed, a high level of telomerase activity is not common in MDS, although the level of telomerase activity increases in MDS in comparison with that in normal bone marrow (69–71). In contrast, variable telomere lengths have been observed in bone marrow samples with MDS, regardless of the percentage of blasts (67). Flow-FISH analysis demonstrates that the telomeres of granulocytes in patients with bone marrow failure syndromes are shorter than those in the age-matched controls, perhaps as a result of the rapid stem cell turnover (72). The major difficulties in estimating telomere attrition in MDS are that MDS cells are composed of a heterogenous myeloid cell population. We investigated digital images of metaphases by Q-FISH, and then compared the results with results obtained by the standard method of determining TRF length (73). We found no linear correlation between TRF length and telomere fluorescence signals in MDS; most MDS patients showed weak telomere fluorescence signals, corresponding to short telomeres, with a narrow range compared with normal subjects. This indicates that telomere fluorescence signals by Q-FISH reflected only marrow metaphases corresponding to MDS-derived cells (73). These findings show that telomere dynamics in MDS are rather complicated; therefore, telomere signals in MDSderived cells by Q-FISH would be more reliable prognostic and diagnostic markers in treating MDS patients. Identification of the genes or genetic events for inherited marrow failure syndromes, such as dyskeratosis congenita (DC), Fanconi anemia, and Diamond– Blackfan anemia, and Shwachman–Diamond syndrome, suggests that these rare diseases offer important insights into the general mechanism governing hematopoesis and cancer development (Fig. 9.4) (74). For instance, haploid insufficiency due to telomerase components, such as TERC and TERT, is a major cause of telomere dysfunction in autosomal dominant DC (75). Mutations of TERC and TERT were also found in a subset of acquired bone marrow failure syndromes, mainly patients with aplastic anemia (76, 77); however, the low frequency of such mutations indicates that the telomere dysfunction of most acquired bone marrow failure syndromes is different from that in DC (78–80). It is also important to consider the effect of the hematopoietic environment, since telomere dysfunction induces alteration of the niche, which can have implications for aging and cell transplantation therapies (81).

9.7

Concluding Remarks

While there is still a long way to go before we can translate these fundamental advances into clinical understandings of human leukemias, telomeres/telomerase are likely to have many applications for diagnosis and treatment in leukemia and its related disorders. We conclude that the level of telomerase activity in leukemia is associated with highly proliferative cell fractions, thereby related to disease

220

J.H. Ohyashiki, K. Ohyashiki

Inherited X-linked Recessive DC: DKC1*

Acquired Myelodysplastic syndrome

Autosomal Dominant DC: TERT, TERC*

Telomere dysfunction Acquired Aplastic anemia

Apoptosis

p53 Uncapped telomere

Cell death Inherited Fanconi anemia: [FANCA, -B, -C, -D, -E, F, -G, -I, -J, -L, and, -M]*

DB Anemia: RPS19*

BFB cycle Genomic instability

SD Syndrome: SBDS* Fig. 9.4 Telomere dysfunction in bone marrow failure syndromes: Telomere dysfunction in acquired myelodysplasitc syndrome and aplastic anemia partially shares genetic events that are seen in inherited bone marrow failure syndrome. Uncapped telomeres are recognized as doublestrand DNA breaks. Genomic instability caused by telomere attrition leads to be breakage–fusion– bridge (BFB) cycle. DC dyskeratosis congenita, DB anemia Diamond–Blackfan anemia, SD syndrome Shwachman–Diamond syndrome. Asterisks indicate the mutation of causative genes

progression and poor prognosis. Telomere length could also be a good parameter to estimate disease severity (how far the disease has progressed) and response to anticancer therapy. Shortening of telomeres as a result of telomere dysfunction is closely related to genomic instability in leukemia and bone marrow failure syndrome. To prove the validity and efficacy of LSC-directed chemotherapy regimens, further studies concerning telomere biology in normal and LSCs are needed. Acknowledgment The authors are indebted to Prof. J. Patrick Barron of the International Medical Communications Center of Tokyo Medical University for his review of this manuscript.

References 1. Reya T, Morrison SJ, Clarke MF, et al. Stem cells, cancer, and cancer stem cells. Nature 2001;414:105–11. 2. Armanios M and Greider CW. Telomerase and Cancer stem cells. In: Cold Spring Harbor Symposia on Quantitative Biology, Vol. LXX. Cold Spring Harbor Laboratory Press, Woodbury, NY, 2005:205–208. 3. Hiyama E and Hiyama K. Telomere and telomerase in stem cells. Br J Cancer 2007;96:1020–4.

9 Diagnostic Value II: Hematopoietic Malignancies

221

4. Wu AM, Till JE, Siminovitch, et al. A cytological study of the capacity for differentiation of normal hemopoietic colony-forming cells. J Cell Physiol 1967;69:177–84. 5. Martinez-Agosto JA, Mikkiola HK, Hartenstein V, et al. The hematopoietic stem cell and its niche: a comparative review. Genes Dev 2007;21:3044–60. 6. Chumsri S, Matsui W, and Burger AM. Therapeutic implication of leukemic stem cell pathways. Clin Cancer Res 2007;13:6549–53. 7. McCulloch E. Stem cells in normal and leukemic hemopoiesis (Henry Stratton Lecture, 1982). Blood 1983;62:1–3. 8. Kamel-Reid S and Dick JE. Engraftment of immune-deficient mice with human hematopoietic stem cells. Science 1988;242:2706–9. 9. Lapidot, Sirard C, Vormoor J, et al. A cell initiating human acute myeloid leukaemia after transplantation into SCID mice. Nature 1994;367:645–8. 10. Hope KJ, Jin L, and Dick JE. Acute myeloid leukemia originate from a hierarchy of leukemic stem cell classes that differ in self-renewal capacity. Nat Immunol 2004;5:738–43. 11. Gal H, Amariglo N, Trakhtenbrot L, et al. Gene expression profiles of AML derived stem cells; similarity to hematopoietic stem cells. Leukemia 2006;20:2147–54. 12. Rufer N, Dragowska W, Thornbury G, et al. Telomere length dynamics in human lymphocyte subpopulations measured by flow cytometry. Nat Biotechnol 1998;16:743–7. 13. Martens UM, Zijlmans JM, Poon SS, et al. Short telomeres on human chromosome 17p. Nat Genet 1998;18:76–80. 14. Swiggers SJ, Kuijpers MA, de Cort MJ, et al. Critically short telomeres in acute myeloid leukemia with loss or gain of parts of chromosomes. Genes Chromosomes Cancer 2006;45:247–56. 15. Ho AD. Kinetics and symmetry of division of hematopoietic stem cells. Exp Hematol 2005;33:1–8. 16. Hiyama K, Hirai Y, Koizumi S, et al. Activation of telomerase in human lymphocytes and hematopoietic progenitor cells. J Immunol 1995;155:3711–15. 17. Counter CM, Gupta J, Harley CB, et al. Telomerase activity in normal leukocytes and in hematologic malignancies. Blood 1995;85:2315–20. 18. Chiu CP, Dragowska W, and Kim NW. Differential expression of telomerase activity in hematopoietic progenitors from adult human bone marrow. Stem Cells 1996;14:239–48. 19. Zhang W, Pietyszek MA, Kobayashi T, et al. Telomerase activity in human acute myelogenous leukemia: inhibition of telomerase activity by differentiation-inducing agents. Clin Cancer Res 1996;2:799–803. 20. Xu D, Gruber A, Bjorkholm M, et al. Suppression of telomerase reverse transcriptase (hTERT) expression in differentiated HL-60 cells: regulatory mechanisms. Br J Cancer 1999;80:1156–61. 21. Ohyashiki JH, Sashida G, Tauchi T, et al. Telomeres and telomerase in hematologic neoplasia. Oncogene 2002;21:680–7. 22. Sakabe H, Yahata N, Kimura T, et al. Human cord blood-derived primitive progenitors are enriched in CD34+ c-kit cells: correlation between long-term culture-initiating cells and telomerase expression. Leukemia 1998;12:728–34. 23. Yui J, Chiu CP, and Lansdorp PM. Telomerase activity in candidate stem cells from fetal liver and adult bone marrow. Blood 1998;91:3255–62. 24. Gammaitoni L, Weisel KC, Gunetti M, et al. Elevated telomerase activity and minimal telomere loss in cord blood long-term cultures with extensive stem cell replication. Blood 2004;103:4440–8. 25. Ja¨ra˚s M, Edqvist A, Rebetz J, et al. Human short-term repopulating cells have enhanced telomerase reverse transcriptase expression. Blood 2006;108:1084–91. 26. Shay JW, Werbin H, and Wright WE. Telomeres and telomerase in human leukemias. Leukemia 1996;10:1255–61.

222

J.H. Ohyashiki, K. Ohyashiki

27. Vaziri H, Dragowska W, Allosopp RC, et al. Evidence for a mitotic clock in human hematopoietic stem cells: loss of telomeric DNA with age. Proc Natl Acad Sci USA 1994;91:9857–60. 28. Iwama H, Ohyashiki K, Ohyashiki JH, et al. Telomeric length and telomerase activity vary with age in peripheral blood cells obtained from normal individuals. Hum Genet 1998;102:397–402. 29. Te Van Ziffle JA, Baerlocher GM, and Lansdorp PM. Telomere length in subpopulations of human hematopoietic cells. Stem Cells 2003;21:654–60. 30. Norrback K-F, Dahlenborg K, Carlsson R, et al. Telomerase activation in normal B lymphocytes and non-Hodgkin’s lymphomas. Blood 1996;88:222–9. 31. Igarashi H and Sakaguchi N. Telomerase activity is induced by the stimulation to antigen receptor in human peripheral lymphocytes. Biochem Biophys Res Commun 1996;219: 649–55. 32. Igarashi H and Sakaguchi N. Telomerase activity is induced in human peripheral B lymphocytes by the stimulation to antigen receptor. Blood 1997;89:1299–307. 33. Weng N-P, Levine BL, June CH, et al. Regulated expression of telomerase activity in human T lymphocyte development and activation. J Exp Med 1996;183:2471–9. 34. Pan C, Xue BH, Ellis TM, et al. Changes in telomerase activity and telomere length during human T lymphocyte senescence. Exp Cell Res 1997;231:346–53. 35. Norrback KF and Roos G. Telomeres and telomerase in normal and malignant haematopoietic cells. Eur J Cancer 1997;33:774–80. 36. Ribeiro RM, Mohri H, Ho DD, et al. In vivo dynamics of T cell activation, proliferation, and death in HIV-1 infection: why are CD4+ but not CD8+ T cells depleted? Proc Natl Acad Sci USA 2002;99:15572–7. 37. Plunkett FJ, Soares MV, Annels N, et al. The flow cytometric analysis of telomere length in antigen-specific CD8+ T cells during acute Epstein–Barr virus infection. Blood 2001;97:700–7. 38. Notaro R, Cimmino A, Tabarini D, et al. In vivo telomere dynamics of human hematopoietic stem cells. Proc Natl Acad Sci USA 1997;94:13782–5. 39. Wynn RF, Cross MA, Hatton C, et al. Accelerated telomere shortening in young recipients of allogeneic bone-marrow transplants. Lancet 1998;351:178–81. 40. Lee J, Kook H, Chung I, et al. Telomere length changes in patients undergoing hematopoietic stem cell transplantation. Bone Marrow Transplant 1999;24:411–15. 41. Akiyama M, Hoshi Y, Sakurai H, et al. Shortening of telomeres in recipients of both autologous and allogeneic hematopoietic stem cell transplantation. Bone Marrow Transplant 1998;21:167–71. 42. Rufer N, Brummendorf TH, Chpuis B, et al. Accelerated telomere shortening in hematological lineages is limited to the first year following stem cell transplantation. Blood 2001;97:575–7. 43. Rocci A, Ricca I, Dellacasa C, et al. Long-term lymphoma survivors following high-dose chemotherapy and autograft: evidence of permanent telomere shortening in myeloid cells, associated with marked reduction of bone marrow hematopoietic stem cell reservoir. Exp Hematol 2007;35:673–81. 44. Bhatia R, Van Heijzen K, Palmer A, et al. Longitudinal assessment of hematopoietic abnormalities after autologous hematopoietic cell transplantation for lymphoma. J Clin Oncol 2005;23:699–711. 45. Widmann T, Kneer H, Ko¨nig J, et al. Sustained telomere erosion due to increased stem cell turnover during triple autologous hematopoietic stem cell transplantation. Exp Hematol 2008;36:104–10. 46. Lahav M, Uziel O, Kestenbaum MF, et al. Nonmyeloablative conditioning does not prevent telomere shortening after allogeneic stem cell transplantation. Transplantation 2005;80: 969–76.

9 Diagnostic Value II: Hematopoietic Malignancies

223

47. Sashida G, Ohyashiki JH, Kubota N, et al. Marked telomere fluctuation of leukocytes during graft-versus-host disease in allogeneic stem cell transplantation. Int J Mol Med 2005;16:883–8. 48. Pipes BL, Tsang T, Peng SX, et al. Telomere length changes after umbilical cord blood transplant. Transfusion 2006;46:1038–43. 49. Allsopp RC, Morin GB, Homer JW, et al. Effect of TERT over-expression on the long-term transplantation capacity of hematopoetic stem cells. Nat Med 2003;9:369–71. 50. Ro¨th A, Baerlocher GM, et al. Telomere loss, senescence, and genetic instability in CD4+ T lymphocytes overexpressing hTERT. Blood 2005;106:43–50. 51. Greaves M. Is telomerase activity in cancer due to selection of stem cells and differentiation arrest? Trends Genet 1996;12:127–8. 52. Shay JW and Wright WE. The reactivation of telomerase activity in cancer progression. Trends Genet 1996;12:129–131. 53. Drummond MW, Balabanov S, Holyoake TL, et al. Concise review: telomere biology in normal and leukemic hematopoietic stem cells. Stem Cells 2007;25:1853–61. 54. Drummond M, Hoare SF, Monaqhan A, et al. Dysregulated expression of the major telomerase components in leukaemic stem cells. Leukemia 2005;19:381–9. 55. Ohyashiki K, Ohyashiki JH, Iwama H, et al. Telomerase activity and cytogenetic changes in chronic myeloid leukemia with disease progression. Leukemia 1997;11:190–4. 56. Iwama H, Ohyashiki K, Ohyashiki JH, et al. The relationship between telomere length and therapy-associated cytogenetic responses in patients with chronic myeloid leukemia. Cancer 1997;79:1552–60. 57. Ohyashiki K, Iwama H, Tauchi T, et al. Telomere dynamics and genetic instability in disease progression of chronic myeloid leukemia. Leuk Lymphoma 2000;40:49–56. 58. Boultwood J, Peniket A, and Watkins F. Telomere length shortening in chronic myelogenous leukemia is associated with reduced time to accelerated phase. Blood 2000;96(1):358–61. 59. Brummendorf TH, Holyake TL, Rufer N, et al. Prognostic implications of differences in telomere length between normal and malignant cells from patients with chronic myeloid leukemia measured by flow cytometry. Blood 2000;95:1883–90. 60. Bru¨mmendorf TH, Erso¨z I, Hartmann U, et al. Telomere length in peripheral blood granulocytes reflects response to treatment with imatinib in patients with chronic myeloid leukemia. Blood 2003;101:375–6. 61. Ohyashiki JH, Ohyashiki K, Iwama H, et al. Telomere length and hTERT expression in patients with acute myeloid leukemia correlates with chromosomal abnormalities. Clin Cancer Res 1997,3:619–25. 62. Xu D, Gruber A, Peterson C, et al. Telomerase activity and the expression of telomerase components in acute myelogenous leukaemia. Br J Haematol 1998;102:1367–75. 63. Engelhardt M, Mackebzie K, Drullinsky P, et al. Telomerase activity and telomere length in acute and chronic leukemia, pre- and post-ex vivo culture. Cancer Res 2000;60:610–17. 64. Hartmann U and Brummendorf TH. Telomere length and hTERT expression in patients with acute myeloid leukemia correlates with chromosomal abnormalities. Haematologica 2005;90:307–16. 65. Ohyashiki JH, Hisatomi H, Nagao K, et al. Quantitative relationship between functionally active telomerase and major telomerase components (hTERT and hTR) in acute leukaemia cells. Br J Cancer 2005;92:1942–7. 66. Ohyashiki JH, Hayashi S, Yahata N, et al. Impaired telomere regulation mechanism by TRF1 (telomere-binding protein), but not TRF2 expression, in acute leukemia cells. Int J Oncol 2001;18:593–8. 67. Ohyashiki JH, Ohyashiki K, Fujimura T, et al. Telomere shortening associated with disease evolution patterns in myelodysplastic syndromes. Cancer Res 1994;54:3557–60. 68. Greenberg P, Cox C, LeBeau MM, et al. International scoring system for evaluating prognosis in myelodysplastic syndromes. Blood 1997;89:2079–88.

224

J.H. Ohyashiki, K. Ohyashiki

69. Ohyashiki JH, Iwama H, Yahata N, et al. Telomere stability is frequently impaired in highrisk groups of patients with myelodysplastic syndromes. Clin Cancer Res 1999;5:1155–60. 70. Li B, Yang J, Andrews C, et al. Telomerase activity in preleukemia and acute myelogenous leukemia. Leuk Lymphoma 2000;36:579–87. 71. Ohyashiki K, Iwama H, Yahata N, et al. Telomere dynamics in myelodysplastic syndromes and acute leukemic transformation. Leuk Lymphoma 2001;42:291–9. 72. Bru¨mmendorf TH, Maciejewski JP, Mak J, et al. Telomere length in leukocyte subpopulations of patients with aplastic anemia. Blood 2001;97:895–900. 73. Sashida G, Ohyashiki JH, Nakajima A, et al. Telomere dynamics in myelodysplastic syndrome determined by telomere measurement of marrow metaphases. Clin Cancer Res 2003;9:1489–96. 74. Shimamura A. Inherited bone marrow failure syndromes: molecular features. Hematol Am Soc Hematol Educ Program 2006;63–71. 75. MIM 127550 – Dyskeratosis congenital, autosomal dominant (http://www.ncbi.nlm.nih.gov/ entrez/dispomim.cgi?id=127550). 76. Yamaguchi H, Baerlocher GM, Lansdorp PM, et al. Mutations of the human telomerase RNA gene (TERC) in aplastic anemia and myelodysplastic syndrome. Blood 2003;102:916–18. 77. Yamaguchi H, Calado RT, Ly H, et al. Mutations in TERT, the gene for telomerase reverse transcriptase, in aplastic anemia. N Engl J Med 2005;352:1413–24. 78. Ohyashiki K, Shay JW, and Ohyashiki JH. Lack of mutations of the human telomerase RNA gene (hTERC) in myelodysplastic syndrome. Haematologica 2005;90:691. 79. Field JJ, Mason PJ, An P, et al. Low frequency of telomerase RNA mutations among children with aplastic anemia or myelodysplastic syndrome. J Pediatr Hematol Oncol 2006;28:450–3. 80. Takeuchi J, Ly H, Yamaguchi H, et al. Identification and functional characterization of novel telomerase variant alleles in Japanese patients with bone-marrow failure syndromes. Blood Cells Mol Dis 2008;40:185–191. 81. Rossi DJ, Bryder D, Seita J, et al. Deficiencies in DNA damage repair limit the function of haematopoietic stem cells with age. Nature 2007;447:725–9.

Chapter 10

Therapeutic Targets and Drugs I: Telomerase and Telomerase Inhibitors Brittney-Shea Herbert and Erin M. Goldblatt

Abstract Telomerase activity has been found in 85–90% of human cancers; therefore, telomerase has been proposed as a potential anticancer therapeutic target. In this chapter, we discuss the various methods to target telomerase activity and agents shown to act as specific telomerase inhibitors. First, we will introduce the hypothesis of inhibiting telomerase as a mode of cancer therapy and the original findings supporting this hypothesis. Next, the known and most actively tested targets for telomerase inhibition, including telomerase-associated proteins and telomerase’s accessibility to telomeres, will be discussed. Finally, we will discuss the current status of telomerase inhibitors in the clinic. Keywords: Telomerase, hTERT, hTERC, Telomerase activity, Telomerase inhibitors, Telomeres, Oligonucleotides, Telomerase-associated proteins, Cancer, Clinical trials.

10.1

Introduction

The human telomerase ribonucleoprotein enzyme complex aids in maintaining telomere length and consists of the two core components hTERT and hTERC, also known as hTR or hTER (1). Telomeres, consisting of 5–12 kb of repeated hexameric TTAGGG sequences in humans, are specialized structures at the end of chromosomes that are essential for cell survival. Telomeres, and their associated proteins, have been shown to be important for protecting the chromosomes from degradation, end fusion events, and being recognized as damaged DNA needing repair (2). It is no wonder that disruption of the ability to maintain telomeres (e.g., by telomerase inhibition) could cause havoc to cell survival.

B.‐S. Herbert(*) Department of Medical and Molecular Genetics, Indiana University Melvin and Bren Simon Cancer Center, Indiana University School of Medicine, Indianapolis, IN 46202, USA, e-mail: [email protected]

K. Hiyama (ed.), Telomeres and Telomerase in Cancer. DOI: 10.1007/978-1-60327-879-9_10, # Humana Press, a part of Springer Science + Business Media, LLC 2009 225

226

B.-S. Herbert, E.M. Goldblatt

The telomerase component hTERT contains a reverse transcriptase that can synthesize telomeric (TTAGGG)n DNA repeats de novo onto the 30 -overhang end using a region of the hTERC RNA as a template for extension (3–7). Recent studies suggest that the complex consists of two molecules of each of the core components, which supports earlier in vitro reconstitution experiments demonstrating that telomerase functions as a dimer (1, 8–10). At least thirty-two other proteins have been implicated to be associated with telomerase (1), suggesting a complex regulation of telomerase assembly, stability, and activity. For example, telomerase-associated proteins include hTEP1 (vault protein), HSP90/p23 (chaperones), heterogeneous nuclear ribonucleoproteins (hnRNPs A1, C1, C2), the autoantigen La, and snoRNA binding proteins such as hGAR1 and dyskerin. Dyskerin is a type of RNA binding protein that guides hTERC stability and hTERT catalytic activity (3, 11, 12). Mutations in hTERT, hTERC, and dyskerin have been shown to result in aplastic anemia, pulmonary fibrosis, and dyskeratosis congenita, further implicating the essential role of telomerase in cell and organismal survival; for review see (12–14). In humans, hTERT is expressed during embryonic development but is repressed in adult tissues (15, 16). On the other hand, the RNA component of telomerase, hTERC, is ubiquitously expressed in all cells. In most normal human somatic cells, telomerase activity is absent or is at insufficient levels to maintain telomeres. However, stem cells and germ cells exhibit telomerase activity. Interestingly, telomerase-proficient stem cells still exhibit telomere shortening (17). In cells with intact cellular checkpoint controls (e.g., p53/Rb), short or dysfunctional telomeres induce a DNA damage repair signal that instructs the cells to undergo replicative senescence, or an irreversible growth arrest (18, 19). Replicative senescence is thought to be an anticancer mechanism in that it can limit the number of times a cell will divide, therefore, limiting the chance of acquiring genomic mutations (one mutation for every 20–40 divisions) that may trigger cancer progression (19). On the other hand, a hallmark of cancer is the unlimited proliferative capacity of cells or bypass of senescence (20). The unlimited proliferative capacity is supported by the continual maintenance of telomeres via telomerase activity (3, 21). Maintenance of telomeres by telomerase is essential for the survival of tumor growth and metastasis (20). The exact mechanism of how telomerase becomes reactivated in cancer is not completely understood; however, there have been insights into the negative and positive transcriptional or translational regulation of telomerase (22). In rare instances, cells without telomerase activity, by lack of hTERT and/or hTERC gene expression, maintain their telomeres via an alternative lengthening of telomeres (ALT) mechanism (23). Finally, the capping structure of telomeres, where the 30 -overhangs loop around to form a t loop, as well as telomere-associated proteins have been suggested to be important not only in protecting the telomere, but also in assisting regulation of telomerase accessibility and activity on telomeres (24).

10.2

Telomerase as a Cancer Therapeutic Target: Original Hypotheses and Proof-of-Principle Studies

Ideal cancer therapeutic targets are those that are specifically expressed in tumors and are critical for maintaining malignancy (25). A role for telomerase in the unlimited proliferative potential of cells has been demonstrated by the immortalization of

10 Therapeutic Targets and Drugs I: Telomerase and Telomerase Inhibitors

227

normal human cells with ectopic expression of hTERT (26, 27). Additionally, hTERT in combination with Ras and knockdown of p53/Rb pathways can transform normal cells into tumorigenic cells (28). Telomerase is active in 85–90% of human tumors, making this enzyme an attractive target for cancer therapy (18, 19, 29, 30). Indeed, the absence of telomerase activity in pediatric neuroblastomas is strongly correlated with a favorable outcome of overall patient survival during treatment, whereas those that are telomerase positive have a poor prognosis (31). The effect of reversing the immortal phenotype of cancer by telomerase inhibition is predicted to be relatively specific to cancer cells with few side effects for somatic cells and stem cells, since tumor cells (particularly those with continued proliferative capacity) typically have shorter telomeres than normal tissue (18, 19, 25, 32–34). The original investigations on targeting telomerase activity in cells utilized genetic models and direct reverse transcriptase inhibitors. In the mid-1990s, Strahl and Blackburn provided one of the original proof-of-principle studies of directly inhibiting telomerase within an organism (the ciliate Tetrahymena) by using reverse transcriptase inhibitors to target telomerase activity (35, 36). Further investigation into the importance of telomerase activity in cancer came from the telomerase knockout mouse model. The Terc/ mouse provided the in vivo foundation that loss of one of the telomerase components resulted in lack of telomerase activity and telomere shortening (37). However, these mice did not exhibit an anticancer potential phenotype until the sixth generation (G6) indicating that a lag time is needed before an effect is seen by telomerase inhibition. Indeed, late generation Terc/ mice displayed defects in normal cellular function such as in spermatogenesis and in the bone marrow. On the other hand, these G6 mice were less prone to develop skin cancers when subjected to chemical carcinogens (38). The mouse model was further supported by using a variety of human cancer cells to exogenously express a dominant-negative mutant of hTERT (DN-hTERT), in which the catalytically dead hTERT mutants were dominant over wild-type hTERT in terms of telomerase function. The expression of DN-hTERT resulted in loss of telomerase activity, subsequent progressive telomere shortening, and cell death (39, 40). The original criteria for telomerase inhibitors that were then established were that these inhibitors did not induce initial cytotoxicity when shutting down telomerase activity and that the continuous telomerase inhibition in cells results in the progressive loss of telomeric DNA, leading to crisis, and eventually apoptosis or senescence (3, 18, 41, 42). The original hypotheses for targeting telomerase in cancer and the proof-ofprinciple genetic studies for telomerase inhibition have been supported by a vast amount of work showing that various methods of targeting telomerase can inhibit enzyme activity, shorten telomeres, and induce growth arrest or apoptosis of cancer cells (18). The targets of the telomerase complex that are currently undergoing intense research are listed in Table 10.1. Telomerase inhibitors are chemically diverse and include modified oligonucleotides as well as small molecules of natural and synthetic origins. It is possible to directly or indirectly target telomerase activity by inhibiting hTERT/hTERC expression or function, or by targeting how telomerase interacts with the telomere. Additionally, taking advantage of hTERT reactivation in cancer cells enables the use of vaccines that signal the immune system to destroy cells expressing hTERT antigens (18, 43–46). Oncolytic viruses

228

B.-S. Herbert, E.M. Goldblatt

Table 10.1 Known telomerase inhibitors and their targets within the telomerase complex Target Description Inhibitors hTERT Catalytic subunit DN-hTERT, siRNA, AZT, BIBR1532, EGCG, MST-312 hTERT-associated proteins HSP90 Heat shock protein – 90 kDa Geldanamycin (GA), 17-AAG, 17DMAG p23 Cochaperone of HSP90 Radiciol, novobiocin, siRNA hTERC

RNA component and template

Telomerase accessibility to telomeres G-quadruplex Secondary structure at end of telomeres POT1

Oligonucleotides (e.g., 20 -O-meRNA, MOEs, 2-5A ODNs, GRN163L), mutant template hTer (MT-hTer) G-quadruplex ligands; e.g., telomestatin, BRACO19, RHPS4 Various G-quadruplex ligands

Protection of telomeres-1; telomere-end-binding protein Tankyrase TRF-1-interacting ankyrin3-Aminobenzamide related ADP-ribose (3AB), PJ-34 polymerase (PARP) DN-hTERT dominant negative mutant for hTERT, EGCG epigallocatechin gallate, MOEs 20 -Omethoxyethyl RNAs, 2-5A ODNs 20 , 50 -oligoadenylate antisense oligonucleotides

that utilize the hTERT promoter to drive expression of apoptosis genes have also shown potential to kill cancer cells (18, 32, 46–49). In the following sections, the different methods of directly inhibiting telomerase activity for cancer therapy and their most recent advances will be discussed. As stated in Table 10.1, telomerase inhibitors that are the most actively investigated include those that target hTERT, hTERC, telomerase-associated proteins, and the accessibility of active telomerase to telomeres. A more complete description of other modes of targeting telomeres and telomerase in general, such as G-quadruplex inhibitors, telomere binding proteins, immunotherapy, and gene-directed therapy, can be found in subsequent chapters.

10.3

10.3.1

Telomerase as a Cancer Therapeutic Target: Molecular Targets Targeting hTERT

The reverse transcriptase component of telomerase (hTERT), containing the catalytic activity for the complex, makes for an interesting target for cancer therapy. hTERT is expressed in immortal cells but not in most somatic cells and is the

10 Therapeutic Targets and Drugs I: Telomerase and Telomerase Inhibitors

229

rate-limiting factor for telomerase activity on telomeres; therefore, targeting hTERT should be specific for cancer cells (25, 46, 50). The proof-of-principle studies for the inhibition of telomerase activity in cancer cells were performed using dominant negative mutants of the catalytic domains of hTERT (DN-hTERT) as described earlier [(39, 40); Table 10.1]. The ectopic expression of DN-hTERT in a variety of cancer cell lines resulted in loss of telomerase activity, progressive telomere shortening with each cell division, and subsequent cell growth inhibition and death due to the presence of critically short telomeres (39, 40). The induction of cell growth arrest or apoptosis depended on the initial telomere length (39, 40). Genetic knockdown of hTERT expression by RNA interference (RNAi) has also been utilized to target telomerase function and activity (51, 52). In addition, Nakamura et al. showed that hTERT suppression by small/short interfering RNA (siRNA) increased the sensitivity of cervical carcinoma cells to irradiation and chemotherapeutic agents such as doxorubicin, bleomycin, and etoposide but not to paclitaxel or cisplatin (53). Finally, an alternate splicing variant of hTERT (the 36-bp alpha site deletion within one of the reverse transcriptase motifs) has also been shown to act as a dominant negative inhibitor of telomerase activity and induce telomere shortening and cell death when ectopically expressed in cancer cells (54). While these genetic approaches may provide important scientific insight into the role of telomerase in telomere and cancer biology, delivery of these molecules into the patient do not translate readily to clinical applications.

10.3.1.1

Nucleoside Analog

The hTERT catalytic component of telomerase provides a straightforward approach for the development of small molecules as telomerase inhibitors. The nucleoside analog and reverse transcriptase inhibitor azidothymidine (AZT) was among the first drug to be tested for its ability to inhibit hTERT telomerase activity [Table 10.1; (25, 35, 36, 55)]. Targeting the active site of hTERT with AZT has been shown to weakly decrease telomerase activity and induce a very mild decrease in cell proliferation; however, these effects are not specific for telomerase over other polymerases. It also takes high doses (>100 mM) of these compounds to induce a senescence-like phenotype, despite telomere shortening (25, 36, 46, 50, 56). However, little data have been recently reported on the use of nucleoside analogs as telomerase inhibitors, as these original findings on the nonspecific inhibition of other polymerases and general cytotoxicity proved troublesome for cancer therapeutic development (Table 10.2).

10.3.1.2

Nonnucleoside Agents

A variety of nonnucleoside agents have also been shown to have antitelomerase activity, result in decreased proliferation, and induce a senescence-like phenotype

hTERT vaccine

hTERT epitopes on cancer cells; cancer remission/ prevention of relapse

Breast (NCT00573495)

Prostate, AML (NCT00510133)

Yes

Yes

NSCLC: combination with paclitaxel and carboplatin (NCT00510445)

Yes

Good tolerability, favorable pharmacokinetics, no measurable change in telomerase activity or telomere length due to short treatment times, beneficial outcome on tumor growth Ongoing; well-tolerated, no dose-limiting toxicities or adverse side effects Early stages of recruitment; determine the safety and maximum tolerated dose when given in combination with a standard paclitaxel/ carboplatin regimen Ongoing; in the tumor microenvironment, infiltration of T cells and widespread tumor necrosis, longer median overall survival Ongoing; telomerasespecific immune responses, no significant toxicity, clearance of circulating cancer cells, prolonged PSA doubling times

Chronic lymphocytic leukemia (NCT00124189); multiple myeloma

Solid tumors (NCT00310895)

Current status/results

Cancer type

Yes

Table 10.2 Status of telomerase inhibitors in the clinic Agent Target/expected Therapies in trial? outcome hTR/hTERC Telomerase template Yes oligonucleotides antagonist, (GRN163L) competitive enzyme inhibitor, progressive telomere shortening

Johannes Vieweg, Duke University Medical Center (http://www. mc.duke.edu/) and Geron Corporation (http://www.geron. com/)

Robert Vonderheide, University of Penn Medical (http://www. med.upenn.edu/)

Geron Corporation (http://www.geron. com/) Geron Corporation (http://www.geron. com/)

Developer, investigators Geron Corporation (http://www.geron. com/)

230 B.-S. Herbert, E.M. Goldblatt

Telomeres/telomerase accessibility to telomeres; cell death due to telomere uncapping, dysfunction hTERT inhibition; Reverse transcriptase inhibitor, used in HIV infection treatment hTERT inhibition No

Not specifically for targeting telomerase

No

hTERT/hTERC Inhibit hTERT No (trials exist for inhibitors expression or HSP90 assembly, inhibitors) (siRNA, synthesize MT-hTer, mutant telomeres hammerhead ribozymes, HSP90 inhibitors) With clinicaltrials.gov ID, not including gene therapy trials

Nonnucleoside compounds (BIBR1532)

Nucleoside analog (AZT)

G-Quadruplex stabilizers (Telomestatin, BRACO19, RHPS4)

Yes

Multiple

Multiple

Multiple

Pancreatic (NCT00425360), lung (NCT00509457), melanoma (NCT00021164) Multiple

Preclinical testing

Preclinical testing

None

Ongoing; no adverse side effects, no autoimmune response, no effect on bone marrow stem cells, immune responserelated benefit Preclinical testing

Gustav Gaudernack, Norwegian Radium Hospital (http://www. radium.no/), Cell Genesis (http://www. cellgenesys.com/)

10 Therapeutic Targets and Drugs I: Telomerase and Telomerase Inhibitors 231

232

B.-S. Herbert, E.M. Goldblatt

after long-term treatment [Table 10.1; (25, 50, 55)]. Green tea epicatechin derivatives (EGCG) and synthetic compounds with EGCG-related moieties (MST-312, MST-295, and MST-199) have been demonstrated as effective hTERT inhibitors via biochemical or genetic/epigenetic mechanisms not completely understood (57– 59). The most widely studied compound of this class targeting hTERT is BIBR1532 (2-[(E)-3-naphthalen-2-yl-but-2-enoylamino]-benzoic acid), a highly specific, noncompetitive catalytic inhibitor that is mechanistically similar to inhibitors of HIV reverse transcriptase (46, 60). This compound has a high specificity for telomerase and has been shown to inhibit telomerase in a multiple number of tumor cell types with effective concentrations to inhibit 50% of activity (EC50) in the nanomolar (nM) range (61). In vivo studies have shown that long-term treatment with this compound can significantly decrease tumor growth. The long lag phase associated with this type of inhibition, taking up to 100 days of treatment prior to seeing the beneficial effects of telomerase inhibition, is expected for a classical telomerase inhibitor but may not be clinically relevant for effective cancer treatment (25, 46, 50, 60, 61). However, telomerase inhibition by BIBR1532 can sensitize drugresistant cancer cells, as well as drug-sensitive cancer cells, to other chemotherapeutics (62). Currently, none of these hTERT inhibitors are under clinical investigation, although preclinical testing is ongoing (Table 10.2).

10.3.1.3

Other Direct and Indirect Methods

As the regulation of telomerase is multifaceted and complex, so are the opportunities to target telomerase. Other direct and indirect methods for inhibiting hTERT have been reported, and the reader is directed to recent reviews on other potential telomerase inhibitors not described in this chapter (46, 55). Agents such as ceramides, irradiation, chemotherapy, Gleevec, tamoxifen, retinoids, epicatechins (e.g., epigallocatechin gallate or EGCG), and protein kinase C (PKC) inhibitors have been shown to affect hTERT expression, phosphorylation status, or cellular localization (18, 46, 55). hTERT can be also prone to degradation by ubiquitin ligases. For example, overexpression of the recently reported ubiquitin ligase MKRN1 in H1299 lung carcinoma cells promotes the degradation of hTERT and decreases telomerase activity (63). Many of the mechanisms for these agents on telomerase inhibition remain unclear, may be nonspecific, or be due to cytoxocity, which itself reduces telomerase activity. Furthermore, understanding the mechanisms of hTERT inhibitors can be complicated by the recent suggestion that hTERT may exhibit other activities beside the maintenance of telomeres (51, 64). For instance, Masutomi et al. suggested that the stable expression of retroviral vectors encoding hTERT-specific short hairpin RNA (shRNA) renders normal human BJ foreskin fibroblasts cells sensitive to DNA damage (52). The state of various histones in cell extracts was measured biochemically, and the loss of hTERT was reported to alter the overall chromatin state, but not the short-term telomere integrity (52). However, there is no clear evidence of whether any of the small molecule hTERT inhibitors also affect normal cellular function and hence extracurricular activities of telomerase.

10 Therapeutic Targets and Drugs I: Telomerase and Telomerase Inhibitors

10.3.2

Targeting hTERC (hTR or hTER)

10.3.2.1

Antisense Oligonucleotides

233

Telomerase requires its RNA component hTERC for its reverse transcriptase function. In 1995, using an antisense RNA to hTERC, Feng et al. provided one of the first reports demonstrating that the RNA component of telomerase could be effectively targeted in human cancer cells, resulting in inhibition of telomerase activity, progressive telomere shortening, and subsequent cell death (6). Standard antisense oligonucleotides (ODNs) contain DNA bases that form DNA–RNA hybrids with their target mRNA. RNase H then recognizes these hybrids and cleaves them, resulting in reduced protein expression. However, telomerase is not a typical antisense target because RNase H cleavage of hTERC is not necessary. In addition, hTERC is a good target for oligonucleotide-based mechanisms for several other reasons (65). First, for telomerase to function, the template region of hTERC must be able to pair with the telomere by Watson–Crick base pairing and thus can be exposed to oligonucleotides. Second, the known sequence of the 11-nucleotidelong hTERC template region (50 -CUAACCCUAAC-30 ) simplifies the design of oligonucleotide-based inhibitors. Many of the oligonucleotides analyzed contain sequences that are complementary to a 13-nucleotide-long region, which partially overlaps and extends by four nucleotides beyond the 50 -boundary of the template region of hTERC. Third, oligonucleotides that contain mismatch or scrambled bases allow for intrinsic experimental controls. Finally, oligonucleotides already have supportive evidence for being applicable within the clinic, and certain ODNs can be spontaneously taken up by some animal and human tissues (65). Unlike traditional antisense ODNs that inhibit translation by binding to mRNA, ODNs complementary to the hTERC template region actually act as competitive enzyme inhibitors (or template antagonists) because these agents block the active site of hTERT reverse transcriptase (i.e., hTERC is not translated into peptides). The early investigations into targeting the hTERC component using traditional antisense ODNs validated it as a good target; however, unmodified ODNs are readily degraded by nucleases and are unstable. Therefore, investigators have focused on the development of modified ODNs to improve the use of oligonucleotide-based targeting of hTERC (Table 10.1). This includes ODNs composed of chemically modified bases, as opposed to DNA bases, since RNase H cleavage is not necessary for telomerase inhibition.

10.3.2.2

Chemically Modified Oligonucleotides

Peptide nucleic acids (PNAs) were among the first chemically modified oligonucleotides targeting hTERC to be reported as effective in inhibiting telomerase activity with EC50s in the pico- to nanomolar range (66). PNAs are DNA mimics with a neutral amide backbone, but are not well distributed in vivo (65, 67). Therefore, subsequent investigations have utilized well-characterized chemistries

234

B.-S. Herbert, E.M. Goldblatt

that could be optimal for translational research in vivo (i.e., in animals and humans). This led to research in the development of 20 -O-alkyl RNAs, such as 20 -O-methyl RNA (20 -O-MeRNA) and 20 -O-methoxyethyl RNA (MOE RNA), as effective telomerase inhibitors with high affinity for hTERC binding (41, 68–70). Indeed, the study by Herbert et al. using a 13-mer 20 -O-MeRNA targeting the hTERC template region was one of the first reports to support the rationale for targeting telomerase in cancer by demonstrating telomere shortening and cell growth inhibition after telomerase inhibition in human cancer cell lines (39–41). ODNs tagged with 20 ,50 -oligoadenylate (2-5A) have also been shown to inhibit telomerase activity and induce apoptosis in many different types of cancer cells in vitro and in vivo (71–77). However, these effects were seen within 3–6 days, without telomere shortening, and may be due to a mechanism of action of degrading hTERC by RNase L (78) or one that is not specific to telomerase inhibition and progressive telomere erosion (42). Recent studies using 2-5A ODNs have suggested that 2-5A can act synergistically with conventional radiation- and chemotherapies in inhibiting glioma cancer cell growth in vitro and in vivo (79).

10.3.2.3

PS-, NP-, and NPS-ODNs

Additional development of oligonucleotides as telomerase template antagonists has involved phosphorothioate (PS), N30 -P50 phosphoramidate, and N30 -P50 thiophosphoramidate DNA (46, 65, 80–83). DNA oligonucleotides containing PS linkages between the bases have enhanced stability against nuclease digestion as well as enhanced binding to proteins (65). This latter property may result in cellular phenotypes unrelated to the effect on the target RNAs when these PS-ODNs are introduced into cells. N30 -P50 phosphoramidates (NP) designed to be complementary to the template region of hTERC provided further optimization of telomerase template oligonucleotide antagonists compared with a mismatch control (80, 81). Finally, N30 -P50 thio-phosphoramidates (NPS) take advantage of the PS and NP oligonucleotide properties (65, 82, 83). NPS ODNs targeting the telomerase template region (e.g., GRN163) have been shown to be effective telomerase inhibitors and anticancer agents through the shortening of telomeres to a critical length for cancer cell survival (82, 84–87). The 13-mer, lipid-conjugated NPS telomerase template antagonist GRN163L represents one of the latest generation of modified oligonucleotides targeting hTERC (Table 10.1). GRN163L contains a lipophilic, palmitoyl tail at the 50 terminal end of its sequence (50 -Palm-TAGGGTTAGACAA-30 ), which allows for efficient cellular uptake in vitro and in vivo without the use of transfection reagents (e.g., lipid carriers) or electroporation (88). The lipid modification of GRN163L enhances the stability and potency of telomerase inhibition (EC50 in subnanomolar concentrations) and inhibition of cell growth compared with that of GRN163, a nonconjugated NP with the same sequence, without the use of transfection reagents (88). This potency was not due to the palmitoyl moiety alone, as a lipid-modified mismatch NPS had no effect on telomerase inhibition and cell growth at the same

10 Therapeutic Targets and Drugs I: Telomerase and Telomerase Inhibitors

235

concentration. GRN163L has been extensively studied in many cancer cell types in vitro and in preclinical in vivo xenograft models with encouraging results, all of which have provided support for the use of these antagonists as targeted cancer therapeutics (89–94). Interestingly, recent reports suggest dramatic effects of GRN163L in cancer cell growth inhibition well before the bulk of the telomeres within a population of cells have reached critical shortening (90–92, 94). Jackson et al. reported that when cancer cells were given GRN163L before they were allowed to attach to culture dishes, GRN163L prevented the cells from adhering to the dishes (94). These effects were shown to be correlated to the sequence (i.e., mismatch controls did not have an antiadhesive effect), length, backbone chemistry, and lipid modification of the oligonucleotide; however, GRN163L also had the same effect on immortalized cells that use the ALT pathway and are telomerase deficient (94). These findings may help explain the in vivo observations where GRN163L inhibited tumor growth and metastasis of human cancer cells within a month of treatment (one to three times per week at pharmacological doses). Research into the mechanisms of action for GRN163L is ongoing and should be useful for further preclinical and clinical testing. As described in more detail later in this chapter, these telomerase template antagonists are the first telomerase inhibitors to be translated to the clinic and are currently undergoing testing in Phase I/II clinical trials in different cancer types.

10.3.2.4

RNAi, Ribozymes, and Mutant hTERCs

It has also been shown that depleting the endogenous wild-type hTERC in cells through the use of RNA interference, ribozymes, or mutant hTERCs can lead to reduced telomerase activity (Table 10.1). For instance, hTERC-targeting siRNAs have been shown to decrease telomerase activity and can inhibit xenograft tumor formation without the shortening of the overall telomere population (46, 95–97). The second technique for depleting wild-type hTERC uses a mutated template hTERC (mutant template hTer or MT-hTer; Table 10.1) to allow for synthesis and incorporation of ‘‘mutant’’ telomeric DNA, which can subsequently affect the binding of protective telomere-associated proteins and telomere structure (6, 98– 102). Goldkorn and Blackburn showed that the effects of MT-hTer/hTERC siRNA required a functional and catalytically active telomerase (102). The MT-hTer has also been shown to decrease cell viability and increase apoptosis independently of initial telomere length. In addition, MT-hTer inhibited tumorigenesis in mice (50, 101, 102). The use of lentiviral vectors for the delivery of MT-hTer and hTERC siRNA has been shown to rapidly inhibit cancer cell growth within days, well before the predicted lag phase seen with other classical hTERC telomerase inhibitors (101). More recently, MT-hTer was reported to increase the sensitivity of cancer cells to chemotherapeutic agents without requiring global telomere shortening (103).

236

10.3.2.5

B.-S. Herbert, E.M. Goldblatt

Summary

Taken together, targeting the hTERC component of telomerase has received a great amount of attention in terms of cancer therapeutic potential. Approaches targeting hTERC can provide an advantage over targeting hTERT, particularly if more evidence comes forward regarding other roles for hTERT in normal cell survival, since the expression levels of the proteins/RNA within the telomerase complex are not specifically altered (except when using 2-5A oligonucleotides or siRNA). Using these applications for targeting telomerase may provide not only potential clinical benefit, but also scientific insight into the role of telomerase in telomere and cancer biology.

10.3.3

Targeting Telomerase-Associated Proteins

In vitro, hTERC and hTERT are enough to reconstitute telomerase activity (1, 6, 8–10, 104, 105). However, a multitude of other proteins have been implicated to be associated with telomerase in vivo (1). Of this long list of proteins, dyskerin, hTEP1, and the chaperones HSP90/p23 have been shown to play a major role in telomerase assembly, stability, and catalytic activity since defects in these proteins can have negative effects on these properties. As described earlier, mutations or defects in dyskerin have been shown to cause bone marrow diseases such as anemia and dyskeratosis congenita. The role of hTEP1 in telomerase function remains unclear, but poly(ADP-ribose) polymerase (PARP) inhibitors have been shown to downregulate hTEP1 expression and telomerase activity in leukemia cells (46, 106, 107). Chaperone inhibitors, particularly for HSP90, have been the most extensively studied within the class of telomerase-associated protein inhibitors, which is the focus of discussion for the rest of this section [Table 10.1; (108) for review]. In general, the heat shock protein (HSP) HSP90 is a chaperone protein that plays a central role in the stability and proper folding of a select number of other proteins such as HER2, androgen and estrogen steroid receptors, AKT/PKB, C-RAF, CDK4, survivin, HIF-1a, mutant TP53, and BCR/ABL [see (109) for review]. The critical role of HSP90 in the stability of these proteins, which are typically active in cancer, has led to the rationale for the development of HSP90 inhibitors as anticancer agents. Furthermore, cancer cells may have a high-affinity, activated form HSP90 compared with an inactive form in normal cells (108, 110). Blocking HSP90 activity has been achieved through the use of pharmacological inhibitors such as geldanamycin (GA) and the geldanamycin analog 17-allylamino-17demethoxy-geldanamycin (17-AAG). Further studies of 17-AAG analogs, such as 17-DMAG [see (109) for a more complete review], have shown continued improvement in the metabolism and antiproliferative capability of these HSP90 inhibitors.

10 Therapeutic Targets and Drugs I: Telomerase and Telomerase Inhibitors

237

HSP90 has also been shown to associate with functional human telomerase (111). In addition, the cochaperone p23 has been shown to associate with active telomerase, while another chaperone, HSP70, associates with hTERT in a transient fashion (111, 112). The role of chaperones in telomerase assembly and function is not completely understood and may be more complex than previously expected (113); however, it has been suggested that chaperones may aid in the reverse transcriptase process of telomerase (112). As hTERT generates de novo hexameric telomeric repeats, it must translocate to the next available position for further processing, changing its conformation during telomere processing. Although the assembly of telomerase occurs in the cytoplasm with the aid of most of the available chaperones, the few molecules of available nuclear HSP90/p23 may aid in adjusting telomerase conformation while functioning on the telomere (112). Studies on the ability of HSP90 inhibitors to affect telomerase activity have resulted in novel approaches toward targeting telomerase (Table 10.1). Downregulation of HSP90 in various cancer cells by ODNs resulted in inhibition of telomerase activity (114). Pharmacological HSP90 agents (such as GA, 17-AAG, and novobiocin) have been shown to block the assembly of active telomerase as well as the association of p23 to the telomerase complex in vitro as well as in vivo (111, 113, 115). Furthermore, Harvey et al. reported that chronic treatment of prostate cancer cells with subtoxic concentrations of another HSP90 pharmacological inhibitor, radiciol, resulted in blocking telomerase assembly and telomerase activity (116). The concentrations used in all of these studies (100 ng/ml or 0.3 mM) were not cytotoxic. Villa et al. also reported that the basal level of telomerase in cancer cells may influence the sensitivity to HSP90 inhibitors (115). Compton et al. demonstrated that long-term treatment (60 days) with HSP90 inhibitors, by either pharmacological (e.g., radiciol) or genetic (siRNA knockdown) approaches resulted in dramatic telomere shortening and cell death via nitric oxide synthase (NOS)-induced free radical production (117). However, the low concentration of radiciol used in this study (0.3 mM) only transiently reduced telomerase activity (<1 week). The authors speculate that these results may indicate a telomeraseindependent mechanism for the observed telomere erosion. Alternatively, the sensitivity of the PCR-based telomerase activity assay (TRAP) may be insufficient to analyze the subtle changes in the levels of telomerically functional telomerase (117). Although these chaperone inhibitors have been shown to inhibit telomerase or cause dysfunctional telomeres in cell culture experiments, preclinical and clinical trials specifically investigating the antitelomerase potential in vivo have not been reported and await further investigation. HSP90 inhibitors have been shown to be effective in inhibiting cancer growth in general, but the mechanisms underlying HSP90 inhibition of telomerase activity may be complex or possibly indirect. As stated earlier, HSP90 plays a major role in the function of many proteins involved in cancer cell signaling. These proteins can also regulate telomerase expression (22). For example, novobiocin has been shown to not only disrupt HSP90 function, but also inhibit the AKT cascade; therefore, this mode of treatment can lead to an indirect reduction of telomerase activity (118). Furthermore, HSP90 inhibition by

238

B.-S. Herbert, E.M. Goldblatt

GA in H1299 lung carcinoma cells results in ubiquitination and proteosomemediated degradation of hTERT (63, 113). These indirect effects on telomerase activity must, therefore, be carefully examined, as HSP inhibitors are proposed as telomerase-targeting anticancer agents.

10.3.4

Targeting Telomerase Activity and Accessibility to Telomeres

Telomere structure and telomere-associated proteins not only provide a protective cap for the ends of chromosomes, but also function in allowing telomerase access to telomeres (25, 55). Telomere-associated proteins shown to play a role in telomerase’s accessibility to telomeres include the telomeric repeat binding factors 1 and 2 (TRF1 and TRF2), TRF-1 interacting protein 2 (TIN2), POT1 (protection of telomeres 1), and tankyrase 1 [TRF-1 inactivating ankyrin-related adenosine diphosphate (ADP)-ribose polymerase 1], which is a telomeric member of the PARP family of proteins (119–123). The importance of telomere maintenance in cell survival has led to the development of agents that can target telomeres. While a more complete description of these telomere-targeting agents (TTAs) will be offered in subsequent chapters, this section focuses on the potential for these agents to inhibit telomerase activity (Table 10.1).

10.3.4.1

G-Quadruplex Interacting Agents

The 30 G-rich single-stranded overhangs of telomeres form secondary structures that are important for telomere function (50, 124–126). These secondary structures (G-quadruplexes) can hinder telomerase from elongating the 30 ‐overhang, which makes the stabilization of these secondary structures a promising target for inhibiting telomerase activity and/or processivity (126). In 1991, Zahler et al. demonstrated that stabilization of the G-quadruplex (G-quartets) inhibited primer extension and telomere elongation by telomerase in vitro (127). The first report demonstrating telomerase inhibition by a synthetic G-quadruplex interacting agent (128) has led to a number of compounds being developed and tested by using the standard telomerase activity (TRAP) assay (25, 55, 129, 130). For instance, these ligands include acridines (trisubsituted BRACO19 and pentacyclic RHPS4), cationic porphyrins (TMPyP4), perylenes (PIPER), ethidium derivatives, 2,4,6-triamino-1,3,5-triazine derivatives (e.g., 12459), and a natural product (telomestatin), which is actually the most potent of these agents for quadruplex formation, stabilization, and telomerase inhibition (46, 126). The use of G-quadruplex stabilizing ligands has been tested in multiple cancer types, resulting in a relatively rapid loss of hTERT expression in addition to telomere shortening, cancer cell growth inhibition, and apoptosis (50, 125, 131–136). There is evidence that these compounds

10 Therapeutic Targets and Drugs I: Telomerase and Telomerase Inhibitors

239

induce senescence or apoptosis through changes in telomere capping, which helps to explain rapid responses to these agents (131, 137). G-quadruplex ligands have been shown to not only prevent hTERT from accessing and acting on the telomere, but also displace telomere-associated proteins, which are then translocated to the cytoplasm and degraded by ubiquitin and proteases (55, 126). For example, telomestatin and BRACO19 have been shown to inhibit the association of POT1 to the telomere, which resulted in the inhibition of telomerase activity [reviewed in (55); Table 10.1]. Although these compounds are not yet in clinical testing as of 2007, preclinical results are promising, particularly for telomestatin. Since TTAs attack both telomere capping function (resulting in a rapid response on cell growth) and telomerase activity (typically associated with a lag time before an antiproliferative effect), these agents may actually hold the key to being effective for targeted molecular anticancer therapy without the long lag time as expected for traditional telomerase inhibitors. However, it has been recently reported that lung carcinoma cell lines selected for resistance to the G-quadruplex ligand 12459 also displayed increased hTERT expression, longer telomeres, and cross-resistance to other types of Gquadruplex ligands (138). Furthermore, recent reevaluation of G-quadruplex ligands as telomerase inhibitors using the direct primer extension assay for telomerase activity, compared with the widely used standard PCR-based TRAP assay, has led to a reconsideration of how efficient these agents are in actually inhibiting telomerase activity (139). Careful evaluation is thus warranted when newly synthesized agents of this class are screened as potential telomerase inhibitors. In addition, agents that target telomeres in general need to be carefully examined in order to demonstrate a differential effect on proliferating normal cells versus cancer cells. Nevertheless, recent studies on this class of agents have suggested specificity toward cancers cells; therefore, the mechanisms of action of these agents could be due to an inactivation of telomerase through processes that are not completely understood.

10.3.4.2

Tankyrase Inhibitors

Tankyrase inhibitors have also been implicated as anticancer agents that can target telomerase activity and function [(140); Table 10.1]. Tankyrase 1 poly (ADP-ribosyl)ates TRF1 and releases it from the telomere, rendering the telomere accessible to telomerase (120). Therefore, tankyrase inhibitors can act as telomerase inhibitors by not allowing TRF1 to disassociate from the telomere so that telomere is not accessible to telomerase and its activity. Furthermore, tankyrase 1 overexpression can have a negative effect not only on telomerase function, but also on the efficiency of telomerase inhibitors. Tankyrase 1 inhibition by 3-aminobenzamide (3AB) and PJ-34 has been shown to aid in preventing cellular resistance to the telomerase inhibitor MST-312 (141). In addition, combination of tankyrase inhibitors with telomerase inhibitors results in a more rapid negative effect on telomere length and cancer cell growth (141, 142). Two broad-spectrum PARP

240

B.-S. Herbert, E.M. Goldblatt

inhibitors developed by Abbott Laboratories (ABT-888; Abbott Park, IL, USA) and Pfizer (AG14361; Cambridge, MA, USA and the University of Newcastle, UK) are currently undergoing clinical investigation and may also target tankyrase and telomerase activity (126, 143, 144).

10.4

Telomerase Inhibitors in Clinical Trials

There are several different methods of inhibiting telomerase that are currently undergoing clinical or preclinical investigation (Table 10.2). In this section, the focus is on the telomerase inhibitor therapies that have reached clinical trials as of 2007 (http://www.clinicaltrials.gov). Clinical trials utilizing direct inhibition of telomerase activity are compared briefly with clinical trials using another mode of telomerase as a target, telomerase immunotherapy. A more complete discussion of targeting telomerase via gene therapy is provided in Chap. 13.

10.4.1

GRN163L

The first class of telomerase inhibitors that have reached clinical trials is the N30 -P50 thio-phosphoramidate that targets hTERC (GRN163L). This type of oligonucleotide forms stable duplexes with single-stranded RNA, is resistant to degradation, has both high affinity and specificity for targets, and acts as a competitive enzyme inhibitor or template antagonist. Furthermore, GRN163L has been extensively studied in vitro and is effective in inhibiting telomerase activity, shortening telomeres, and inhibiting cancer cell growth (18, 32). GRN163L has been in Phase I/II clinical trials for patients with chronic lymphocytic leukemia (CLL) since 2005 and for solid tumor malignancies since 2006 (http://www.clinicaltrials.gov). Preclinical studies using human xenograft models have suggested that intermittent intravenous dosing of GRN163L should achieve therapeutic tissue levels in cancer patients (18). As seen in the Phase I trials, GRN163L administered weekly via infusion is well tolerated by patients with no dose-limiting toxicities or serious adverse side effects reported yet (Table 10.2). More importantly, there has been a beneficial effect of treatment in multiple patients with CLL, with stable disease and tumor lysis syndrome both being reported (Table 10.2). Additionally, clinical testing of the use of GRN163L in combination with paclitaxel and carboplatin in nonsmall cell lung cancer (NSCLC) has recently begun (Table 10.2). This study is still in early stages of recruitment and results are pending. One potential problem with using small molecule inhibitors of telomerase is that many of them may require long treatment times to effectively shorten telomeres, and response time may be dependent on initial telomere lengths (25, 46, 50). Although this means that telomerase inhibitors may not be used as solo therapy, there have been numerous reports that

10 Therapeutic Targets and Drugs I: Telomerase and Telomerase Inhibitors

241

telomerase inhibition can sensitize cells to chemotherapy or irradiation (25, 32, 46, 62, 70, 89, 93, 103, 144–147). Furthermore, recent studies have shown that GRN163L has potent antimetastatic potential in vivo as well as potential as an agent that can target cancer stem cells [(90, 91); http://www.geron.com]. Based on these recent observations on cancer stem cells, a fourth clinical trial for GRN163L has been initiated in late 2007 for multiple myeloma patients (Table 10.2).

10.4.2

Immunotherapy: TERT Vaccine

In comparison to directly targeting the telomerase complex, activity, and maintenance of telomeres, another mode of therapy utilizing telomerase that has reached clinical trials is through the use of immunotherapy or vaccines. Cancer cells with reactivated telomerase express hTERT epitopes, whereas normal cells do not. Unlike many tumor-associated antigens, hTERT is associated with tumor growth and development, as the expression of hTERT contributes to cellular transformation. This makes the use of vaccines against telomerase a potential cancer therapy (16, 32, 148). Clinical trials have revealed that patients treated with an hTERT vaccine have induced hTERT-specific cytotoxic T-lymphocyte production without serious side effects (148). In a study involving patients with advanced/metastatic lung cancer being treated with an hTERT vaccine along with granulocytemacrophage colony stimulating factor (GM-CSF) to recruit antigen presenting cells, 11 out of 24 patients had an immune response to the vaccine during the primary regimen (149). In the same study, an additional two patients had an immune response after booster injections; therefore, a total of 54% of patients responded to vaccination. In patients with pancreatic cancer, studies showed that the dose of vaccine can play a role in the immune response, with a significant increase in survival times at higher treatment doses (150). A third clinical trial is ongoing in which patients with advanced breast or prostate cancer receive vaccination with an (HLA)-A2-restricted hTERT peptide. In this study, hTERT-specific T cells were again produced with no major side effects (42, 146, 151–153). An immune response was observed, as well as tumor necrosis (148). Using ex vivo stimulated antigen-presenting dendritic cells, the trials demonstrated that 95% of patients with metastatic prostate cancer had a strong telomerase-specific immune response with no side effects (148, 151). In addition, there was a reduction in prostate-specific antigens, suggesting a decrease in tumor growth. Importantly, there has been no documented effect on telomerase-positive hematopoietic progenitor cells or activated T lymphocytes in vitro (148, 151, 154). The use of antitelomerase immunotherapy is also being studied in NSCLC, acute myeloid leukemia (AML), chronic myeloid leukemia (CML), gastrointestinal tumors, and central nervous system (CNS)/brain tumors as stated in the Geron Corporation and Cell Genesys company websites. Updates on the potential of this mode of cancer therapy are anticipated.

242

10.5

B.-S. Herbert, E.M. Goldblatt

Summary and Perspectives

Since the discovery of telomerase in 1985 and its inception as a target for cancer therapy, there have been significant advances in the understanding of its role in the cell as well as in the development of optimal inhibitors. As described in this chapter, inhibition of telomerase activity has been achieved by targeting hTERT, hTERC, telomerase-associated proteins, and telomerase’s accessibility to telomeres. At the present time, agents that target hTERC (e.g., GRN163L) have been the only specific telomerase inhibitors to reach the clinic. Although the original criteria for telomerase inhibitors stipulated a lag phase before critical telomere shortening and cell growth inhibition, there has been more evidence recently that telomerase inhibitors may target cancer cell growth more efficiently that previously expected. This may provide a better window of therapeutic opportunity in order to limit the amount of toxicity in normal cells. However, concerns for telomerase inhibitors still exist such as whether resistance to these agents will emerge, whether an alternative pathway for telomere maintenance or cell survival will arise, or whether there will be harmful effects on normal cells (i.e., does telomerase have other roles in the cell or are there unwanted, off-target effects of these inhibitors?). Nevertheless, telomerase inhibitors have always been proposed as being part of a therapeutic regimen as agents to prevent residual disease and outgrowth of metastasis after surgery or primary therapy, as well as in combination with other standard chemo- or radiation therapy. The preclinical and clinical experiments have been positive for the use of telomerase inhibitors as cancer therapeutics. In addition, recent evidence suggests the potential of telomerase inhibitors to target cancer stem cells, which usually display resistance to other cancer therapeutic drugs. Therefore, more research in telomerase biology, the mechanisms of telomerase inhibitors, and well-designed clinical trials is necessary to provide further insight for the potential of telomerase as a mode of targeted cancer therapy.

Acknowledgments We apologize to authors whose work could not be thoroughly described due to space limitations. The authors would like to acknowledge the Indiana University Melvin and Bren Simon Cancer Center and the Indiana Genomics Initiative (INGEN) for their support. INGEN of Indiana University is supported in part by Lilly Endowment, Inc.

References 1. Cohen SB, Graham ME, Lovrecz GO, Bache N, Robinson PJ, Reddel RR. Protein composition of catalytically active human telomerase from immortal cells. Science 2007;315:1850–3. 2. Finkel T, Serrano M, Blasco MA. The common biology of cancer and ageing. Nature 2007;448:767–74. 3. Shay JW, Zou Y, Hiyama E, et al. Telomerase and cancer. Hum Mol Genet 2001;10:677–85.

10 Therapeutic Targets and Drugs I: Telomerase and Telomerase Inhibitors

243

4. Hahn W, Role of telomeres and telomerase in the pathogenesis of human cancer. J Clin Oncol 2003;21:2034–43. 5. McEachern MJ, Krauskopf A, Blackburn EH. Telomeres and their control. Annu Rev Genet 2000;34:331–58. 6. Feng J, Funk WD, Wang SS, et al. The RNA component of human telomerase. Science 1995;269:1236–41. 7. Harrington L, Zhou W, McPhail T, et al. Human telomerase contains evolutionarily conserved catalytic and structural subunits. Genes Dev 1997;11:3109–15. 8. Arai K, Masutomi K, Khurts S, Kaneko S, Kobayashi K, Murakami S. Two independent regions of human telomerase reverse transcriptase are important for its oligomerization and telomerase activity. J Biol Chem 2002;277:8538–44. 9. Beattie TL, Zhou W, Robinson MO, Harrington L. Functional multimerization of the human telomerase reverse transcriptase. Mol Cell Biol 2001;21:6151–60. 10. Wenz C, Enenkel B, Amacker M, Kelleher C, Damm K, Lingner J. Human telomerase contains two cooperating telomerase RNA molecules. EMBO J 2001;20:3526–34. 11. Heiss NS, Knight SW, Vulliamy TJ, et al. X-linked dyskeratosis congenita is caused by mutations in a highly conserved gene with putative nucleolar functions. Nat Genet 1998;19:32–8. 12. Collins K. The biogenesis and regulation of telomerase holoenzymes. Nat Rev Mol Cell Biol 2006;7:484–94. 13. Garcia CK, Wright WE, Shay JW. Human diseases of telomerase dysfunction: Insights into tissue aging. Nucleic Acids Res 2007;35:7406–7416. 14. Vulliamy TJ, Dokal I. Dyskeratosis congenita: The diverse clinical presentation of mutations in the telomerase complex. Biochimie 2008;90:122–30. 15. Wright WE, Piatyszek MA, Rainey WE, Byrd W, Shay JW. Telomerase activity in human germline and embryonic tissues and cells. Dev Genet 1996;18:173–9. 16. Forsyth NR, Wright WE, Shay JW. Telomerase and differentiation in multicellular organisms: Turn it off, turn it on, and turn it off again. Differentiation 2002;69:188–97. 17. Lansdorp PM. Role of telomerase in hematopoietic stem cells. Ann N Y Acad Sci 2005;1044:220–7. 18. Shay JW, Wright WE. Telomerase therapeutics for cancer: Challenges and new directions. Nat Rev Drug Discov 2006;5:577–84. 19. Shay JW, Wright WE. Hallmarks of telomeres in ageing research. J Pathol 2007;211:114–23. 20. Hanahan D, Weinberg RA. The hallmarks of cancer. Cell 2000;100:57–70. 21. Kim S-H, Kaminker P, Campisi J. Telomeres, aging and cancer: In search of a happy ending. Oncogene 2002;21:503–11. 22. Cong YS, Wright W, Shay JW. Human telomerase and its regulation. Microbiol Mol Biol Rev 2002;66:407–25. 23. Henson JD, Neumann AA, Yeager TR, Reddel RR. Alternative lengthening of telomeres in mammalian cells. Oncogene 2002;21:598–610. 24. Smogorzewska A, de Lange T. Regulation of telomerase by telomeric proteins. Annu Rev Biochem 2004;73:177–208. 25. Kelland LR. Overcoming the immortality of tumor cells by telomere and telomerase based cancer therapeutics – current status and future prospects. Eur J Cancer 2005;41:971–9. 26. Counter CM, Meyerson M, Eaton EN, et al. Telomerase activity is restored in human cells by ectopic expression of hTERT (hEST2), the catalytic subunit of telomerase. Oncogene 1998;16:1217–22. 27. Bodnar AG, Ouellette M, Frolkis M, et al. Extension of life-span by introduction of telomerase into normal human cells. Science 1998;279:349–52. 28. Hahn WC, Counter CM, Lundbert AS, et al. Creation of human tumor cells with defined genetic elements. Nature 1999;400:464–8. 29. Kim NW, Piatyszek MA, Prowse KR, et al. Specific association of human telomerase activity with immortal cells and cancer. Science 1994;266:2011–15.

244

B.-S. Herbert, E.M. Goldblatt

30. Keith WN, Thomson CM, Howcroft J, et al. Seeding drug discovery: Integrating telomerase cancer biology and cellular senescence to uncover new therapeutic opportunities in targeting cancer stem cells. Drug Discov Today 2007;12:611–21. 31. Poremba C, Scheel C, Hero B, et al. Telomerase activity and telomerase subunits gene expression patterns in neuroblastoma: A molecular and immunohistochemical study establishing prognostic tools for fresh-frozen and paraffin-embedded tissues. J Clin Oncol 2000;18:2582–92. 32. Gellert GC, Jackson SR, Dikmen ZG, et al. Telomerase as a therapeutic target in cancer. Drug Discov Today Dis Mech 2005;2:159–64. 33. Blasco MA. Telomere length, stem cells and aging. Nat Chem Biol 2007;3:640–9. 34. Meeker AK, Hicks JL, Gabrielson E, et al. Telomere shortening occurs in subsets of normal breast epithelium as well as in situ and invasive carcinoma. Am J Pathol 2004;164:925–35. 35. Strahl C, EH Blackburn. The effects of nucleoside analogs on telomerase and telomeres in tetrahymena. Nucleic Acids Res 1994;22:893–900. 36. Strahl C, EH Blackburn. Effects of reverse transcriptase inhibitors on telomere length and telomerase activity in two immortalized human cell lines. Mol Cell Biol 1996;16:53–65. 37. Blasco MA, Lee HW, Hande MP, Samper E, Lansdorp PM, DePinho RA, Greider CW. Telomere shortening and tumor formation by mouse cells lacking telomerase RNA. Cell 1997;91:25–34. 38. Gonzalez-Suarez E, Samper E, Flores JM, Blasco MA. Telomerase-deficient mice with short telomeres are resistant to skin tumorigenesis. Nat Genet 2000;26:114–17. 39. Hahn WC, Stewart SA, Brooks MW, et al. Inhibition of telomerase limits the growth of human cancer cells. Nat Med 1999;5:1164–70. 40. Zhang X, Mar V, Zhou W, Harrington L, Robinson MO. Telomere shortening and apoptosis in telomerase-inhibited human tumor cells. Genes Dev 1999;13:2388–99. 41. Herbert B, Pitts AE, Baker SI, et al. Inhibition of human telomerase in immortal human cells leads to progressive telomere shortening and cell death. Proc Natl Acad Sci USA 1999;96:14276–81. 42. White LK, Wright WE, Shay JW. Telomerase inhibitors. Trends Biotechnol 2001;19: 114–20. 43. Vonderheide RH, Hahn WC, Schultze JL, et al. The telomerase catalytic subunit is a widely expressed tumor-associated antigen recognized by cytotoxic T lymphocytes. Immunity 1999;10:673–9. 44. Nair SK, Heiser A, Boczkowski D, et al. Induction of cytotoxic T cell responses and tumor immunity against unrelated tumors using telomerase reverse transcriptase RNA transfected dendritic cells. Nat Med 2000;6:1011–17. 45. Vonderheide RH. Telomerase as a universal tumor-associated antigen for cancer immunotherapy. Oncogene 2002;21:674–9. 46. Zimmerman S, UM Martens. Telomeres and telomerase as targets for cancer therapy. Cell Mol Life Sci 2007;64:906–21. 47. Shay JW. Meeting Report: The Role of Telomeres and Telomerase in Cancer. Cancer Research 2005;65:3513–17. 48. Gu J, Kagawa S, Takakura M, et al. Tumor-specific transgene expression from the human telomerase reverse transcriptase promoter enables targeting of the therapeutic effects of the Bax gene to cancers. Cancer Res 2000;60:5359–64. 49. Koga S, Hirohata S, Kondo Y, et al. A novel telomerase-specific gene therapy: Gene transfer of caspase-8 utilizing the human telomerase catalytic subunit gene promoter. Hum Gene Ther 2000;11:1397–406. 50. Saretzki G. Telomerase inhibition as cancer therapy. Cancer Lett 2003;194:209–19. 51. Masutomi K, Yu EY, Khurts S, et al. Telomerase maintains telomere structure in normal human cells. Cell 2003;114:241–53.

10 Therapeutic Targets and Drugs I: Telomerase and Telomerase Inhibitors

245

52. Masutomi K, Possemato R, Wong JM, et al. The telomerase reverse transcriptase regulates chromatin state and DNA damage responses. Proc Natl Acad Sci USA 2005;102:8222–7. 53. Nakamura M, Masutomi K, Kyo S, et al. Efficient inhibition of human telomerase reverse transcriptase expression by RNA interference sensitizes cancer cells to ionizing radiation and chemotherapy. Hum Gene Ther 2005;16:859–68. 54. Yi X, White DM, Aisner DL, Baur JA, Wright WE, Shay JW. An alternate splicing variant of the human telomerase catalytic subunit inhibits telomerase activity. Neoplasia 2000;2:433– 40. 55. De Cian A, Lacroix L, Douarre C, et al. Targeting telomeres and telomerase. Biochimie 2008;90:131–55. 56. Melana SM, Holland JF, Pogo B. Inhibition of cell growth and telomerase activity of breast cancer cells in vitro by 30 -azido-30 -deoxythymidine. Clin Cancer Res 1998;4:693–6. 57. Naasani I, Seimiya H, Tsuruo T. Telomerase inhibition, telomere shortening, and senescence of cancer cells by tea catechins. Biochem Biophys Res Commun 1998;249:391–6. 58. Seimiya H, Oh-hara T, Suzuki T, et al. Telomere shortening and growth inhibition of human cancer cells by novel synthetic telomerase inhibitors MST-312, MST-295, and MST-1991. Mol Cancer Ther 2002;1:657–65. 59. Berletch JB, Liu C, Love WK, Andrews LG, Katiyar SK, Tollefsbol TO. Epigenetic and genetic mechanisms contribute to telomerase inhibition by EGCG. J Cell Biochem 2008;103:509–19. 60. Pascolo E, Wenz C, Lingner J, et al. Mechanism of human telomerase inhibition by BIBR1532, a synthetic, non-nucleosidic drug candidate. J Biol Chem 2002;277:15566–72. 61. Damm K, Hemmann U, Garin-Chesa P, et al. A highly selective telomerase inhibitor limiting human cancer cell proliferation. EMBO J 2001;20:6958–68. 62. Ward RJ, Autexier C. Pharmacological telomerase inhibition can sensitize drug-resistant and drug-sensitive cells to chemotherapeutic treatment. Mol Pharmacol 2005;68:779–86. 63. Kim JH, Park SM, Kang MR, et al. Ubiquitin ligase MKRN1 modulates telomere length homeostasis through a proteolysis of hTERT. Genes Dev 2005;19:776–81. 64. Chang S, DePinho RA. Telomerase extracurricular activities. Proc Natl Acad Sci USA 2002;99:12520–2. 65. Corey DR. Telomerase inhibition, oligonucleotides, and clinical trials. Oncogene 2002;21:631–7. 66. Norton JC, Piatyszek MA, Wright WE, Shay JW, Corey DR. Inhibition of human telomerase activity by peptide nucleic acids. Nat Biotechnol 1996;14:615–19. 67. Rusckowski M, Qu T, Chang F, Hnatowich DJ. Pretargeting using peptide nucleic acid. Cancer 1997;80:2699–705. 68. Pitts AE, Corey DR. Inhibition of human telomerase by 20 -O-methyl-RNA. Proc Natl Acad Sci USA 1998;95:11549–54. 69. Elayadi AN, Demieville A, Wancewicz EV, Monia BP, Corey DR. Inhibition of telomerase by 2´-O-(2-methoxyethyl) RNA oligomers: Effect of length, phosphorothioate substitution and time inside cells. Nucleic Acids Res 2001;29:1683–9. 70. Chen Z, Koeneman KS, Corey DR. Consequences of telomerase inhibition and combination treatments for the proliferation of cancer cells. Cancer Res 2003;63:5917–25. 71. Kondo S, Kondo Y, Li G, Silverman RH, Cowell JK. Targeted therapy of human malignant glioma in a mouse model by 2-5A antisense directed against telomerase RNA. Oncogene 1998;16:3323–30. 72. Mukai S, Kondo Y, Koga S, Komata T, Barna BP, Kondo S. 2-5A antisense telomerase RNA therapy for intracranial malignant gliomas. Cancer Res 2000;60:4461–7. 73. Kushner DM, Paranjape JM, Bandyopadhyay B, et al. 2-5A antisense directed against telomerase RNA produces apoptosis in ovarian cancer cells. Gynecol Oncol 2000;76: 183–92.

246

B.-S. Herbert, E.M. Goldblatt

74. Koga S, Kondo Y, Komata T, Kondo S. Treatment of bladder cancer cells in vitro and in vivo with 2-5A antisense telomerase RNA. Gene Ther 2001;8:654–8. 75. Yatabe N, Kyo S, Kondo S, et al. 2-5A antisense therapy directed against human telomerase RNA inhibits telomerase activity and induces apoptosis without telomere impairment in cervical cancer cells. Cancer Gene Ther 2002;9:624–30. 76. Wong SC, Yu H, Moochhala SM, So JB. Antisense telomerase induced cell growth inhibition, cell cycle arrest and telomerase activity down-regulation in gastric and colon cancer cells. Anticancer Res 2003;23:465–9. 77. Paranjape JM, Xu D, Kushner DM, et al. Human telomerase RNA degradation by 20 -50 linked oligoadenylate antisense chimeras in a cell-free system, cultured tumor cells, and murine xenograft models. Oligonucleotides 2006;16:225–38. 78. Adah SA, Bayly SF, Cramer H, Silverman RH, Torrence PF. Chemistry and biochemistry of 20 ,50 -oligoadenylate-based antisense strategy. Curr Med Chem 2001;8:1189–212. 79. Iwado E, Daido S, Kondo Y, Kondo S. Combined effect of 2-5A-linked antisense against telomerase RNA and conventional therapies on human malignant glioma cells in vitro and in vivo. Int J Oncol 2007;31:1087–95. 80. Gryaznov S, Pongracz K, Matray T, Schultz R, Pruzan R, Aimi J, Chin A, Harley C, SheaHerbert B, Shay J, Oshima Y, Asai A, Yamashita Y. Telomerase inhibitors – oligonucleotide phosphoramidates as potential therapeutic agents. Nucleosides Nucleotides Nucleic Acids 2001;20(4–7):401–10. 81. Pruzan R, Pongracz K, Gietzen K, Wallweber G, Gryaznov S. Allosteric inhibitors of telomerase: Oligonucleotide N30 P50 phosphoramidates. Nucleic Acids Res 2002;30 (2):559–68. 82. Herbert BS, Pongracz K, Shay JW, Gryaznov SM. Oligonucleotide N3´ P5´ phosphoramidates as efficient telomerase inhibitors. Oncogene 2002;21:638–42. 83. Gryaznov S, Asai A, Oshima Y, et al. Oligonucleotide N3´-P5´ thio-phosphoramidate telomerase template antagonists as potential anticancer agents. Nucleosides Nucleotides Nucleic Acids 2003;22:577–81. 84. Asai A, Oshima Y, Yamamoto Y, et al. A novel telomerase template antagonist (GRN163) as a potential anticancer agent. Cancer Res 2003;63:3931–9. 85. Akiyama M, Hideshima T, Shammas MA, et al. Effects of oligonucleotide N30 P50 thiophosphoramidate (GRN163) targeting telomerase RNA in human multiple myeloma cells. Cancer Res 2003;63:6187–94. 86. Ozawa T, Gryaznov SM, Hu LJ, et al. Antitumor effects of specific telomerase inhibitor GRN163 in human glioblastoma xenografts. Neuro Oncol 2004;6:218–226. 87. Wang ES, Wu K, Chin AC, et al. Telomerase inhibition with an oligonucleotide telomerase template antagonist: In vitro and in vivo studies in multiple myeloma and lymphoma. Blood 2004;103:258–66. 88. Herbert BS, Gellert GC, Hochreiter A, et al. Lipid modification of GRN163, an N3´ P5´ thiophosphoramidate oligonucleotide, enhances the potency of telomerase inhibition. Oncogene 2005;24:5262–8. 89. Djojosubroto MW, Chin AC, Go N, et al. Telomerase antagonists GRN163 and GRN163L inhibit tumor growth and increase chemosensitivity of human hepatoma. Hepatology 2005;42:1127–36. 90. Dikmen ZG, Gellert GC, Jackson S, et al. In vivo inhibition of lung cancer by GRN163L: A novel human telomerase inhibitor. Cancer Res 2005;65:7866–73. 91. Hochreiter AE, Xiao H, Goldblatt EM, et al. The telomerase template antagonist GRN163L disrupts telomere maintenance, tumor growth and metastasis of breast cancer. Clin Cancer Res 2006;12:3184–92. 92. Gellert GC, Dikmen ZG, Wright WE, et al. Effects of a novel telomerase inhibitor, GRN163L, in human breast cancer. Breast Cancer Res Treat 2006;96:73–81.

10 Therapeutic Targets and Drugs I: Telomerase and Telomerase Inhibitors

247

93. Gomez-Millan J, Goldblatt EM, Gryaznov SM, et al. Specific telomere dysfunction induced by GRN163L increases radiation sensitivity in breast cancer cells. Int J Radiat Oncol Biol Phys 2007;67:897–905. 94. Jackson SR, Zhu CH, Paulson V, et al. Antiadhesive effects of GRN163L – An oligonucleotide N30 P50 thio-phosphoramidate targeting telomerase. Cancer Res 2007;67:1121–9. 95. Li S, Crothers J, Haqq CM, Blackburn EH. Cellular and gene expression responses involved in the rapid growth inhibition of human cancer cells by RNA interference-mediated depletion of telomerase RNA. J Biol Chem 2005;280:23709–17. 96. Shammas MA, Koley H, Batchu RB, et al. Telomerase inhibition by siRNA causes senescence and apoptosis in Barrett’s adenocarcinoma cells: Mechanism and therapeutic potential. Mol Cancer 2005;4:24. 97. Gandellini P, Folini M, Bandiera R, et al. Down-regulation of human telomerase reverse transcriptase through specific activation of RNAi pathway quickly results in cancer cell growth impairment. Biochem Pharmacol 2007;73:1703–14. 98. Marusic L, Anton M, Tidy A, Wang P, Villeponteau B, Bacchetti S. Reprogramming of telomerase by expression of mutant telomerase RNA template in human cells leads to altered telomeres that correlate with reduced cell viability. Mol Cell Biol 1997;17:6394–401. 99. Guiducci C, Cerone MA, Bacchetti S. Expression of mutant telomerase in immortal telomerase-negative human cells results in cell cycle deregulation, nuclear and chromosomal abnormalities and rapid loss of viability. Oncogene 2001;20:714–25. 100. Li S, Rosenberg JE, Donjacour AA, et al. Rapid inhibition of cancer cell growth induced by lentiviral delivery of mutant-template telomerase RNA and anti-telomerase short-interfering RNA. Cancer Res 2004;64:4833–40. 101. Kim MM, Rivera MA, Botchkina IL, Shalaby R, Thor AD, Blackburn EH. A low threshold level of expression of mutant-template telomerase RNA inhibits human tumor cell proliferation. Proc Natl Acad Sci USA 2001;98:7982–7. 102. Goldkorn A, Blackburn EH. Assembly of mutant-template telomerase RNA into catalytically active telomerase ribonucleoprotein that can act on telomeres is required for apoptosis and cell cycle arrest in human cancer cells. Cancer Res 2006;66:5763–71. 103. Cerone MA, Londono-Vallejo JA, Autexier C. Mutated telomeres sensitize tumor cells to anticancer drugs independently of telomere shortening and mechanisms of telomere maintenance. Oncogene 2006;25:7411–20. 104. Nakamura TM, Morin GB, Chapman KB, et al. Telomerase catalytic subunit homologs from fission yeast and human. Science 1997;277:955–9. 105. Prescott J, Blackburn EH. Functionally interacting telomerase RNAs in the yeast telomerase complex. Genes Dev 1997;11:2790–800. 106. Ghosh U, Bhattacharyya NP. Benzamide and 4-amino 1,8 naphthalimide treatment inhibit telomerase activity by down-regulating the expression of telomerase associated protein and inhibiting the poly(ADP-ribosyl)ation of telomerase reverse transcriptase in cultured cells. FEBS J 2005;272:4237–48. 107. Ghosh U, Das N, Bhattacharyya NP. Inhibition of telomerase activity by reduction of poly (ADP-ribosyl)ation of TERT and TEP1/TP1 expression in HeLa cells with knocked down poly(ADP-ribose) polymerase-1 (PARP-1) gene. Mutat Res 2007;615:66–74. 108. Burger AM. Highlights in experimental therapeutics. Cancer Lett 2007;245:11–21. 109. Powers MV, Workman P. Targeting of multiple signaling pathways by heat shock protein 90 molecular chaperone inhibitors. Endocr Relat Cancer 2006;13 Suppl 1:S125–S135. 110. Kamal A, Thao L, Sensintaffar J, et al. A high-affinity conformation of Hsp90 confers tumour selectivity on Hsp90 inhibitors. Nature 2003;425:407–10. 111. Holt SE, Aisner DL, Baur J, et al. Functional requirement of p23 and Hsp90 in telomerase complexes. Genes Dev 1999;13:817–26. 112. Forsythe HL, Jarvis JL, Turner JW, Elmore LW, Holt SE. Stable association of hsp90 and p23, but Not hsp70, with active human telomerase. J Biol Chem 2001;276:15571–4.

248

B.-S. Herbert, E.M. Goldblatt

113. Keppler BR, Grady AT, Jarstfer MB. The biochemical role of the heat shock protein 90 chaperone complex in establishing human telomerase activity. J Biol Chem 2006;281:19840–8. 114. Chang JT, Chen YL, Yang HT, Chen CY, Cheng AJ. Differential regulation of telomerase activity by six telomerase subunits. Eur J Biochem 2002;269:3442–50. 115. Villa R, Folini M, Porta CD, Valentini A, Pennati M, Daidone MG, Zaffaroni N. Inhibition of telomerase activity by geldanamycin and 17-allylamino, 17-demethoxygeldanamycin in human melanoma cells. Carcinogenesis 2003;24:851–9. 116. Harvey SA, Jensen KO, Elmore LW, Holt SE. Pharmacological approaches to defining the role of chaperones in aging and prostate cancer progression. Cell Stress Chaperones 2002;7:230–4. 117. Compton SA, Elmore LW, Haydu K, Jackson-Cook CK, Holt SE. Induction of nitric oxide synthase-dependent telomere shortening after functional inhibition of Hsp90 in human tumor cells. Mol Cell Biol 2006;26:1452–62. 118. Haendeler J, Hoffmann J, Rahman S, Zeiher AM, Dimmeler S. Regulation of telomerase activity and anti-apoptotic function by protein–protein interaction and phosphorylation. FEBS Lett 2003;536:180–6. 119. van Steensel B, de Lange T. Control of telomere length by the human telomeric protein TRF1. Nature 1997;385:740–3. 120. Smith S, Giriat I, Schmitt A, de Lange T. Tankyrase, a poly(ADP-ribose) polymerase at human telomeres. Science 1998;282:1484–7. 121. Karlseder J, Broccoli D, Dai Y, Hardy S, de Lange T. p53- and ATM-dependent apoptosis induced by telomeres lacking TRF2. Science 1999;283:1321–5. 122. Xin H, Liu D, Wan M, et al. TPP1 is a homologue of ciliate TEBP-beta and interacts with POT1 to recruit telomerase. Nature 2007;445:559–62. 123. Wang F, Podell ER, Zaug AJ, et al. The POT1-TPP1 telomere complex is a telomerase processivity factor. Nature 2007;445:506–10. 124. Liu Z, Lee A, Gilbert W. Gene Disruption of a G4-DNA-dependent nuclease in yeast leads to cellular senescence and telomere shortening. Proc Natl Acad Sci USA 1995;92:6002–6. 125. Gowan SM, Heald H, Stevens MF, et al. Potent inhibition of telomerase by small-molecule pentacyclic acridines capable of interacting with G-quadruplexes. Mol Pharmacol 2001;60:981–8. 126. Phatak P, Burger AM. Telomerase and its potential for therapeutic intervention. Br J Pharmacol 2007;152:1003–11. 127. Zahler AM, Williamson JR, Cech TR, Prescott DM. Inhibition of telomerase by G-quartet DNA structures. Nature 1991;350: 718–20. 128. Sun D, Thompson B, Cathers BE, et al. Inhibition of human telomerase by a G-quadruplexinteractive compound. J Med Chem 1997;40:2113–16. 129. Mergny JL, Helene C. G-quadruplex DNA: A target for drug design. Nat Med 1998;4: 1366–7. 130. Rezler EM, Bearss DJ, Hurley LH. Telomere inhibition and telomere disruption as processes for drug targeting. Annu Rev Pharmacol Toxicol 2003;43:359–79. 131. Burger AM, Dai F, Schultes CM, et al. The G-quadruplex-interactive molecule BRACO-19 inhibits tumor growth, consistent with telomere targeting and interference with telomerase function. Cancer Res 2005;65:1489–96. 132. Gomez D, Lemarteleur T, Lacroix L, Mailliet P, Mergny JL, Riou JF. Telomerase downregulation induced by the G-quadruplex ligand 12459 in A549 cells is mediated by hTERT RNA alternative splicing. Nucleic Acids Res 2004;32:371–9. 133. Gomez D, Paterski R, Lemarteleur T, Shin-Ya K, Mergny JL, Riou JF. Interaction of telomestatin with the telomeric single-strand overhang. J Biol Chem 2004;279:41487–94. 134. Tauchi T, Shin-Ya K, Sashida G, et al. Activity of a novel G-quadruplex-interactive telomerase inhibitor, telomestatin (SOT-095), against human leukemia cells: Involvement of ATM-dependent DNA damage response pathways. Oncogene 2003;22:5338–47.

10 Therapeutic Targets and Drugs I: Telomerase and Telomerase Inhibitors

249

135. Phatak P, Cookson JC, Dai F, et al. Telomere uncapping by the G-quadruplex ligand RHPS4 inhibits clonogenic tumour cell growth in vitro and in vivo consistent with a cancer stem cell targeting mechanism. Br J Cancer 2007;96:1223–33. 136. Salvati E, Leonetti C, Rizzo A, et al. Telomere damage induced by the G-quadruplex ligand RHPS4 has an antitumor effect. J Clin Invest 2007;117:3236–47. 137. Kelland L. Targeting the limitless replicative potential of cancer: The telomerase/telomere pathway. Clin Cancer Res 2007;13:4960–3. 138. Gomez D, Aouali N, Londono-Vallejo A, et al. Resistance to the short term antiproliferative activity of the G-quadruplex ligand 12459 is associated with telomerase overexpression and telomere capping alteration. J Biol Chem 2003;278:50554–62. 139. De Cian A, Cristofari G, Reichenbach P, et al. Reevaluation of telomerase inhibition by quadruplex ligands and their mechanisms of action. Proc Natl Acad Sci USA 2007;104:17347–52. 140. Seimiya H. The telomeric PARP, tankyrases, as targets for cancer therapy. Br J Cancer 2006;94:341–5. 141. Seimiya H, Muramatsu Y, Ohishi T, Tsuruo T. Tankyrase 1 as a target for telomere-directed molecular cancer therapeutics. Cancer Cell 2005;7:25–37. 142. Shay JW, Wright WE. Mechanism-based combination telomerase inhibition therapy. Cancer Cell 2005;7:1–2. 143. Donawho CK, Luo Y, Penning TD, et al. ABT-888, an orally active poly(ADP-ribose) polymerase inhibitor that potentiates DNA-damaging agents in preclinical tumor models. Clin Cancer Res 2007;13:2728–37. 144. Albert JM, Cao C, Kim KW, et al. Inhibition of poly(ADP-ribose) polymerase enhances cell death and improves tumor growth delay in irradiated lung cancer models. Clin Cancer Res 2007;13:3033–42. 145. Sumi, M, Tauchi T, Sashida G, et al. A G-quadruplex-interactive agent, telomestatin (SOT095), induces telomere shortening with apoptosis and enhances chemosensitivity in acute myeloid leukemia. Int J Oncol 2004;24:1481–7. 146. Cerone MA, Londono-Vallejo JA, Autexier C. Telomerase inhibition enhances the response to anticancer drug treatment in human breast cancer cells. Mol Cancer Ther 2006;5:1669–75. 147. Gonzalez-Suarez E, Goytisolo FA, Flores JM, Blasco MA. Telomere dysfunction results in enhanced organismal sensitivity to the alkylating agent N-methyl-N-nitrosourea. Cancer Res 2003;63:7047–50. 148. Vonderheide RH. Prospects and challenges of building a cancer vaccine targeting telomerase. Biochimie 2008;90:173–80. 149. Brunsvig PF, Aamdal S, Gjertsen MK, et al. Telomerase peptide vaccination: A phase I/II study in patients with non-small cell lung cancer. Cancer Immunol Immunother 2006:5:1553–64. 150. Bernhardt SL, Gjertsen MK, Trachsel S, et al. Telomerase peptide vaccination of patients with non-resectable pancreatic cancer: A dose escalating phase I/II study. Br J Cancer 2006;95:1474–82. 151. Su Z, Dannull J, Yang BK, et al. Telomerase mRNA-transfected dendritic cells stimulate antigen-specific CD8+ and CD4+ T cell responses in patients with metastatic prostate cancer. J Immunol 2005;174:3798–807. 152. Vonderheide RH, Domchek SM, Schultze JL, et al. Vaccination of cancer patients against telomerase induces functional antitumor CD8+ T lympocytes. Clin Cancer Res 2004;10:828–39. 153. Domchek SM, Recio A, Mick R, et al. Telomerase-specific T-cell immunity in breast cancer: Effect of vaccination of tumor immunosurveillance. Cancer Res 2007;67:10546–55. 154. Minev B, Hipp J, Firat H, et al. Cytotoxic T cell immunity against telomerase reverse transcriptase in humans. Proc Natl Acad Sci USA 2000;97:4796–801.

Chapter 11

Therapeutic Targets and Drugs II: G-Quadruplex and G-Quadruplex Inhibitors Chandanamali Punchihewa and Danzhou Yang

Abstract Human telomeric DNA consists of tandem repeats of the sequence d(TTAGGG) and can form G-quadruplex DNA secondary structures. Compounds that can stabilize the intramolecular DNA G-quadruplexes formed in the human telomeric sequence have been shown to inhibit the activity of telomerase and telomere maintenance, thus the telomeric DNA G-quadruplex has been considered as an attractive target for cancer therapeutic intervention. This review will give an overview of the current understanding of structures and biology of G-quadruplex secondary structures formed in human telomere, and of the current progress in the development of anticancer drugs targeting the telomeric G-quadruplexes. Keywords: Human telomere, G-quadruplex, Anticancer drug target, G-quadruplex ligands, Telomeric G-quadruplex structure polymorphism.

11.1

Introduction

G-quadruplex DNA secondary structures (Fig. 11.1a), formed in specific G-rich sequences, have recently emerged as a new class of cancer-specific molecular targets for anticancer drugs. G-quadruplexes are four-stranded DNA secondary structures that deviate from the normal duplex form of DNA. They consist of stacked stable G-tetrad planes connected by a network of Hoogsteen hydrogen bonds instead of the Watson–Crick hydrogen bonds in the B-DNA duplex. G-quadruplexes can be formed with one, two, or four G-rich strands, and the G-quadruplex formation is stabilized by monovalent cations such as K+ and Na+ (Fig. 11.1a). The precise location of cations between tetrads depends on the nature of the ions: Na+ ions are observed in a range of geometries whereas K+ ions are always equidistant between each tetrad plane (1). D. Yang(*) College of Pharmacy, The University of Arizona, 1703 E. Mabel St, Tucson, AZ 85721, USA, e-mail: [email protected]

K. Hiyama (ed.), Telomeres and Telomerase in Cancer. DOI: 10.1007/978-1-60327-879-9_11, # Humana Press, a part of Springer Science + Business Media, LLC 2009 251

252

C. Punchihewa, D. Yang

a

G-tetrad H N

H

R

N

N H

N

H

O N

H N H

H

N

R

M+ N

N

N H N

O

O

N H

R

N N

H N H

H N

N

H O N H

N

H N

b

R

Tetramer

H

hTR AAUCCCAAUC

5' 3'

Dimer

Monomer G-quadruplex

5' 3'

TTAG hTERT

Telomerase-ON

G-quadruplextargeting agent

Telomerase-OFF

c human telomere

Critical Telomere Shortening delayed e.g.direct telomerase inhibitors Unprotected Telomere G-quadruplextargeting agent e.g. disruption of telomere capping

cell senescence

rapid

Fig. 11.1 (a) A tetrameric, dimeric, and monomeric G-quadruplex composed of three G-tetrads. Cations (K+ or Na+) needed to stabilize G-quadruplexes are shown as blue balls. A G-tetrad with H1–H1 and H1–H8 connectivity patterns detectable in NOESY experiments is also shown. (b) Mechanism of telomerase inhibition by G-quadruplex-targeting compounds. (c) Two different mechanisms of drug-mediated inhibition of telomere capping and function by G-quadruplextargeting compounds (See Color Insert)

Although the unusual ability of guanine-rich DNA solutions to form gelatinous aggregates was first noted in 1910, their exact nature was not discovered until 1962, when Gellert and coworkers proposed that these gels form planar guanine tetramers that stack into cyclic arrangements (2). Their hypothesis was confirmed by subsequent studies with polyguanylic acid and polyinosinic acid molecules (3, 4). The first biologically relevant G-quadruplex formation was identified for oligonucleotides corresponding to telomeric DNA. This was based on the observed association of guanine–guanine base-paired hairpin structures in single-stranded telomeric terminal sequences of several organisms (5), which was further characterized in telomeric DNA of Tetrahymena (6). The importance of monovalent cations in the induction and stabilization of these structures was revealed by Williamson, who proposed that cations bind in the cavity formed by the guanines in each tetrad (7). Intramolecular G-quadruplexes formed by single-stranded DNA are a current research interest because they may form in telomeres, oncogene promoter sequences, and other biologically relevant regions of the genome, such as immunoglobulin switch regions, ribosomal DNA, and RNA (8–11). Human and vertebrate telomeres consist of tandem repeats of the hexanucleotide d(TTAGGG)n 5–10 kb in length 50 to 30 toward the chromosome end, which terminate in a single-stranded 30 overhang of 100–200 bases (12–18). The G-rich sequence of human telomeric DNA has a strong propensity to form the DNA G-quadruplex secondary structure, which

11 Therapeutic Targets and Drugs II: G-Quadruplex and G-Quadruplex Inhibitors

253

is known to inhibit the activity of telomerase (19); the G-quadruplex formation seems to contribute to the highly conserved nature of vertebrate telomeric DNA (20, 21). As described in Chap. 2, telomeres are specialized DNA–protein complexes that cap the ends of linear chromosomes and provide protection against gene erosion at cell divisions, chromosomal nonhomologous end joinings, and nuclease attacks (22–24). Telomeric DNA is extensively associated with various proteins such as Pot1 (protection-of-telomeres 1), TRF1 (telomeric-repeat-binding factor 1), and TRF2, as well as TIN2, Rap1, and TPP1 (25–28). Pot1, for example, is a highly conserved telomeric protein that binds to the 30 end of single-stranded telomeric DNA and plays an important role in telomere end-capping and protection (29–31). The structure and stability of telomeres are closely related with cancer (20, 32–34), aging (35, 36), and genetic stability (24, 37, 38). In normal cells, each cell replication results in a 50- to 200-base loss of the telomere. After a critical shortening of the telomeric DNA is reached, the cell undergoes apoptosis (39). However, telomeres of cancer cells do not shorten on replication, because of the activation of a reverse transcriptase telomerase that extends the telomeric sequence at the chromosome ends (40). Telomerase is activated in 80–85% of human cancer cells (41), and has been suggested to play a key role in maintaining the malignant phenotype by stabilizing telomere length and integrity (42). G-quadruplex-targeting compounds have been shown to inhibit telomerase activity, thereby making the intramolecular human telomeric DNA G-quadruplex an attractive target for cancer therapeutic intervention (20, 32, 34, 43–45) (Fig. 11.1b). More recently, it has been shown that loss of normal telomere capping leads to cell death by apoptosis in the absence of telomere shortening (22, 29, 46, 47). As telomeric DNA is extensively associated with various proteins, disruption of telomere capping and maintenance, such as disruption of TRF2 and Pot1, can be sensed as DNA damage, which in turn rapidly activates the apoptotic pathways (29, 46, 48, 49). Interestingly, G-quadruplex-targeting compounds have been shown to disrupt telomere capping and maintenance and induce rapid apoptosis (20, 50) (Fig. 11.1c). Furthermore, G-quadruplex-targeting compounds have also been shown to inhibit the alternative lengthening of telomeres (ALT) pathway (51–53), which maintains telomere stability in a telomerase-independent manner in cancer cells (15%), wherein telomerase is not activated (54). In contrast to parallel-stranded tetramolecular quadruplexes, intramolecular structures form quickly and are more complex, exhibiting great conformational diversity such as folding topologies, loop conformations, and capping structures (55–59). Not only can different sequences adopt distinct structures, but also a given sequence can fold into various conformations, depending on the flanking sequences and the specific cations present in the system, as in the case of the human telomeric DNA sequence (described in detail in Sect. 3). This structural diversity suggests that different DNA G-quadruplexes may be differentially recognized by different proteins or ligands, but the presence of G-quadruplexes in different regions of the genome may provide a design challenge for targeted drug development.

254

C. Punchihewa, D. Yang

11.2

Biological Evidence of DNA G-Quadruplexes in Telomeres

There are several compelling in vitro and in vivo evidences of the formation of G-quadruplex structures in telomeres. The most direct evidence of the in vivo existence of G-quadruplexes was established by using specific antibodies against parallel and antiparallel G-quadruplexes formed in telomeric DNA of the ciliate Stylonychia lemnae (60). The antibody specific for the antiparallel G-quadruplex was detected in macronuclei but not in corresponding micronuclei of ciliates, and the signal was cell cycle dependent and absent during replication (60). More recently, using the same antibody in ciliates, it was shown in vivo that the telomere end-binding proteins TEBPa and TEBPb are required to control G-quadruplex formation and that TEBPb phosphorylation is needed to resolve G-quadruplex structures during replication (61). Additional evidence for G-quadruplex formation in vivo was provided by detection of G-quadruplex formation at human chromosomal ends by using the radiolabeled G-quadruplex ligand 360A (2,6-N,N0 -methylquinolinio-3-yl-pyridine dicarboxamide) (62) or the fluorescent G-quadruplex ligand BMVC (3,6-bis(1-methyl-4-vinylpyridinium) carbazole diiodide) (Fig. 11.2) (63). The formation of G-quadruplex structures in vivo within plasmid genomes transcribed in Escherichia coli cells was detected by electron microscopy I I N

360A

N

I N

O N

N H I N

N H

O

N

N

N

N H

N

O

NH2

N

N

N

N N

O

O N

N O

O

N

NH

O

O N H

N

N H

N N H

N

N

N N

N

N H

12459

BRACO19

Telomestatin N

N

F N NH

F

HN

O

N

N

O

O

N N

N

TMPyP4

O

N

N

N N

I N

O

O

S

O

N N H

307A

N H

BMVC

I O

RHPS4

PIPER

Fig. 11.2 Structures of some small-molecule compounds that target telomeric G-quadruplexes

11 Therapeutic Targets and Drugs II: G-Quadruplex and G-Quadruplex Inhibitors

255

and verified by G-quadruplex-specific nuclease GQN1 and the high-affinity Gquadruplex binding protein nucleolin (64). Indirect evidence for the in vivo existence of G-quadruplex structures in telomeres comes from the highly conserved nature of G-rich DNA in the telomeres of almost all eukaryotes, as well as the growing list of proteins that have been identified to bind to, induce, resolve, or cleave the DNA G-quadruplex structures (9–11). Among these, a number of telomeric proteins have been found to specifically interact with telomeric G-quadruplexes, which strongly points to the existence of such DNA secondary structures in vivo at chromosome telomeres. For example, both the b subunit of the Oxytricha nova telomere-binding protein TBP (65) and the Saccharomyces cerevisiae repressor activator protein 1 (RAP1) (66), which are essential for telomere maintenance, promote G-quadruplex formation. Human topoisomerase I (Topo I) also promotes the formation of G-quadruplexes and binds to preformed G-quadruplexes (67), whereas the binding of G-quadruplexes inhibits the DNA-cleaving activity of Topo I (68). The mammalian nucleolar protein nucleolin binds with high affinity to G-quadruplex structures (69). The TEBPb protein in S. lemnae promotes the in vivo formation of antiparallel G-quadruplexes, whereas TEBPb phosphorylation in the S-phase dissociates the binding of protein to DNA and unfolds the G-quadruplex structures (61). In contrast, human Pot1, a highly conserved telomeric end-capping protein (29), disrupts telomeric G-quadruplex structures to restore the activity of telomerase (30, 70). Pot1 also stimulates the activity of WRN/BLM helicases to unwind telomeric DNA (71). Replication protein A (RPA), another highly conserved eukaryotic protein essential for telomere maintenance (72–74), also unfolds telomeric G-quadruplexes (75). Also, several single-strand binding proteins of the heterogeneous nuclear ribonucleoprotein (hnRNP) family, including hnRNP A1 (76), its derivative UP1 (77), and hnRNP D (78), resolve telomeric G-quadruplexes. The G-quadruplex-resolving functions of these single-stranded DNA-binding proteins are presumably mediated by trapping the single-stranded form of telomeric DNA. In addition to noncatalytic G-quadruplex-resolving proteins, the RecQ family of helicases, such as Sgs1 and Cdc13p in S. cerevisiae, Werner’s syndrome protein (WRN) and Bloom’s syndrome protein (BLM) helicases in human cells, preferentially binds and disrupts DNA G-quadruplex structures and are suggested to participate in telomere maintenance by facilitating replication or recombination at telomeric ends (37, 79–89). The lack of RecQ helicases is associated with genomic instability, premature senescence, and accelerated telomere erosion. RecQ helicases catalytically unwind DNA G-quadruplex structures with a single-stranded 30 tail, which requires energy from ATP hydrolysis and the presence of Mg2+. It is important to note that G-quadruplex-interactive agents inhibit telomerase activity and the unwinding of G-quadruplex structures by Sgs1 and WRN/BLM helicases (79, 90). Also G-quadruplex processing is likely aided by G-quadruplex-specific nucleases such as yeast KEM1/SEP1 (91), human GQN1 (92), and yeast Mre11p (93), which cleave single-stranded DNA that neighbors G-quartets. Supporting their requirement for G-quadruplex maintenance is the fact that neither

256

C. Punchihewa, D. Yang

a. Telomere capping

b. ALT pathway

3'

3' 5'

5'

3' 5'

5'

5' 3'

c. t-loop invasion structure

d. Recombination 3' 5'

ALT-ON

3'

ALT-OFF

e. Meiotic synapsis 5' 5'

3'

5' 5'

5' 3' TRF2

5'

Duplex SS binding proteins Binding Proteins

Fig. 11.3 Possible involvements of G-quadruplex structures in human telomeres

KEM1/SEP1 nor GQN1 can cleave duplex DNA and that Mre11p has much higher affinity for G-quadruplex DNA than for single- or double-stranded DNA. In addition to capping the telomere end, which most likely involves intramolecular G-quadruplex structures, intermolecular G-quadruplex formation may also be involved in the T-loop invasion complex (94–96) and in meiotic chromosome synapsis and homologous recombination (6, 97–100) (Fig. 11.3). The recombination process of the ALT pathway is likely to involve G-quadruplex formation, as many G-quadruplex-targeting compounds inhibit the ALT pathway in ALT-positive cells.

11.3

Human Telomeric G-Quadruplex Structures and Polymorphism

While the intramolecular human telomeric DNA G-quadruplex is a promising drug target, the evaluation of its potential as a cancer therapeutic target and subsequent drug design depend on an understanding of the human telomeric G-quadruplex structure under physiologically relevant conditions. The minimal requirement for an intramolecular telomeric G-quadruplex is a four G-tract human telomeric sequence 50 -GGG(TTAGGG)3 (wtTel21, Fig. 11.4a). Because the K+ structure is considered biologically more relevant as there is a high intracellular concentration of K+, it has been the subject of intense investigation (101–114), although the Na+ structure was reported more than a decade ago by using a 22-nt human telomeric sequence 50 -AGGG(TTAGGG)3 (wtTel22, Fig. 11.4) (115). The intramolecular telomeric G-quadruplex in Na+ solution is a basket-type, mixed

11 Therapeutic Targets and Drugs II: G-Quadruplex and G-Quadruplex Inhibitors

A

Major Conformation TTAGGGTTAGGGTTAGGGTTAGGGTTA (hybrid-2) TTAGGGTTAGGGTTAGGGTTAGGGTT (hybrid-2) TAGGGTTAGGGTTAGGGTTAGGGTT (hybrid-2) AGGGTTAGGGTTAGGGTTAGGGTT (hybrid-2) TTAGGGTTAGGGTTAGGGTTAGGGT (hybrid-2) TAGGGTTAGGGTTAGGGTTAGGGT (hybrid-2/1) AGGGTTAGGGTTAGGGTTAGGGT (hybrid-2) TTAGGGTTAGGGTTAGGGTTAGGG (hybrid-1) TAGGGTTAGGGTTAGGGTTAGGG (hybrid-1) AGGGTTAGGGTTAGGGTTAGGG GGGTTAGGGTTAGGGTTAGGG 1 2 3 4 5 6 7 8 9 10 11 12 13 1415 16 17 18 19 2021 22 23 24 25 26

wtTel27 wtTel26 wtTel25b wtTel24b wtTel25a wtTel24a wtTel23a wtTel24 wtTel23 wtTel22 wtTel21

B

1 2 3 4 5 6 7 8 9 10 11 12 13 1415 16 17 18 19 2021 22 23 24 25 26

wtTel26 TTAGGGTTAGGGTTAGGGTTAGGGTT Tel26 AAAGGGTTAGGGTTAGGGTTAGGGAA wtTel22 AGGGTTAGGGTTAGGGTTAGGG

C

257

(hybrid-2) (hybrid-1)

a. wtTel22-K+

b. wtTel26-K+

5

4,12 23 24 10 17 22 16 11 6 18 23,22 5

c. Tel26-K+

11

10

18

16 4

12

17

6

24

d. Tel26-K+ overnight

+ e. Tel26-K 1hr

12.0

11.5 ppm

11.0

10.5

Fig. 11.4 (A) Four-G-tract native human telomeric sequences with different flanking sequences. The numbering system is shown above wtTel27. (B) Four-G-tract human telomeric DNA sequences used for structure determination. The numbering system is shown above wtTel26. (C) The imino proton region of the 1D 1H NMR of wtTel22 (a), wtTel26 with assignment (b), Tel26 after 1 week in K+ solution with assignment (c), and Tel 26 after 1 h (d) and overnight (e) in K+ solution

antiparallel–parallel stranded structure with three G-tetrads connected with one diagonal and two lateral (edgewise) TTA loops (Fig. 11.5c). In 2002, using the same 22-nt human telomeric sequence, a crystal structure in the presence of K+ was

258 Fig. 11.5 Schematic drawing of the folding topologies of the hybrid-1 (major conformation in Tel26) (a) and hybrid-2 (major conformation in wtTel26) (b) intramolecular telomeric G-quadruplexes in K+ solution. Yellow box: (anti) guanine; red box: (syn) guanine; red ball: guanine; green ball: adenine; blue ball: thymine. (c) Folding topology of the basket-type intramolecular G-quadruplex formed by wtTel22 in Na+ solution as determined by NMR. (d) Folding topology of the propeller-type parallelstranded intramolecular G-quadruplex formed by wtTel22 in the presence of K+ in crystalline state. The numbering system is based on wtTel26 (See Color Insert)

C. Punchihewa, D. Yang

a.

Hybrid-1 (Tel26)

A1

A21

A3

T19

G22

G4

G18

anti G23

G16 T8

A15

G24 4

G17

G11

A26

G18

G17

G24

G11 G6

G10

T8

K+- solution

T8

d. Parallel (wtTel22)

A9

A3

T7

G22

G10

G6

G23

G11

G5

G24

G16

G12

G4 A3 T14

T7

A9

A21

A15

G5

T26

c. Basket (wtTel22) T20

G12

anti

T25

T13 T14

T19

A3 G4

G23

G6

G12

T2

G22 T13

G18 A25

T1

T14

syn

G5

T7

syn

G16

A15

A9 G10

Hybrid-2 (wtTel26)

A2

T20

G17

b.

G22

G16

G17

G18

G23

G24

G4

G10 G5

G11 G6

G12

T13

Na+- solution

K+- crystal

reported (116), which was distinctly different from the Na+ solution structure. The K+ crystal structure is a parallel-stranded structure consisting of three G-tetrads connected with three symmetrical propeller (double-chain-reversal) TTA side loops (Fig. 11.5d). However, when examined in K+ solution by NMR, the wtTel22 sequence does not form a single G-quadruplex structure (117) (Fig. 11.4C-a). Recent results have shown that the hybrid-type intramolecular G-quadruplex structures (Fig. 11.5a, b), distinct from the Na+ solution structure (Fig. 11.5c) and the K+ crystal structure (Fig. 11.5d), appear to be the major conformations formed in fourG-tract human telomeric sequences in K+ solution (58, 59, 117–121), even in the copresence of high concentrations of Na+ (117). The hybrid-type structures are always in dynamic equilibrium between two distinct yet closely related hybrid-1 and hybrid-2 conformations, with a low energy barrier between them. The distinct capping structures appear to determine which hybrid-type conformation is favored and may provide specific binding sites for drug targeting. The hybrid-type G-quadruplex structures suggest a straightforward means for multimer formation with effective packing in the human telomeric sequence and provide important implications for drug targeting of G-quadruplexes in human telomeres. It is important to note that the structure polymorphism appears to be intrinsic to the highly

11 Therapeutic Targets and Drugs II: G-Quadruplex and G-Quadruplex Inhibitors

259

conserved human telomeric sequence, and that this structure polymorphism can be exploited in biological systems (for a recent review, see (122)).

11.3.1

The Hybrid-1 Type Intramolecular Human Telomere G-Quadruplex Structures Formed in K+ Solution by the Modified 26-nt Human Telomeric Sequence Tel26

A large number of variant four G-tract sequences containing the core four G-tract 22-nt human telomeric sequence wtTel22 with different flanking segments have been screened, and the 30 -flanking segment has been found to be critical for the formation of a stable G-quadruplex structure in K+ solution (117). 1H NMR has identified that a few sequences form one stable major G-quadruplex in K+ solution (Fig. 11.4C-c), including the 26-nt sequence Tel26, which contains the core wtTel22 sequence with modified flanking segments (Fig. 11.4b). The folding topology (117) and the molecular structure (PDB ID 2HY9) (58) of the intramolecular G-quadruplex formed by Tel26 in K+ solution have been determined by NMR. Tel26 adopts a hybrid-1 type intramolecular G-quadruplex consisting of three G-tetrads in K+ solution (Fig. 11.5a). The NMR structures of the hybrid-1 telomeric G-quadruplex formed by Tel26 are very well defined (Fig. 11.6a), including the two flanking sequences at the 50 and 30 ends and the three TTA loops.

11.3.2

The Hybrid-2 Type Intramolecular Human Telomere G-Quadruplex Structures Formed in K+ Solution by the Wild-Type 26-nt Human Telomeric Sequence wtTel26

It was found that Tel26 forms two stable G-quadruplex conformations when freshly dissolved in K+ solution, as indicated by two sets of well-defined guanine imino peaks. One conformation (40%) slowly converts to the other (60%) overnight, and the complete conversion takes about a day (Fig. 11.4C-d, C-e). This observation led to the careful examination of the native 26-nt human telomeric sequence wtTel26, (TTAGGG)4TT (Fig. 11.4B) (59). The 1D 1H NMR spectrum of the wtTel26 sequence in K+ solution shows a major intramolecular G-quadruplex structure (Fig. 11.4C-b) accounting for 70% of the total population. Although it is a more challenging process, the folding topology (Fig. 11.5b) and molecular structure (Fig. 11.6b, PDB ID 2JPZ) of the major G-quadruplex formed by wtTel26 in K+ solution have also been determined by NMR (59). WtTel26 adopts a hybrid2 type intramolecular G-quadruplex consisting of three G-tetrads in K+ solution (Fig. 11.5b); however, this hybrid-type structure is different from the hybrid-1 structure (Fig. 11.5a) (see Sect. 11.3.3). Like the hybrid-1 human telomeric G-quadruplex structure, the hybrid-2 telomeric G-quadruplex structure is also very well defined.

260

C. Punchihewa, D. Yang

a

A1

A1

A3 A21

A9

A21

G17

G5 G6

b

G17

G5 G6

G16 A25

A3

A9

T14

G16 A25

T14

A26

A26

T1

T1

A3

A3 G12

G12

G23

G23 G10

G10 A9

T7

G24

T25

T7 T8

T8 T26

c

A9 T25

G24

T26

d A3 T8 A9

A9

T25

A21

Fig. 11.6 (a) Stereo view of the representative model of the NMR-refined structure of (a) hybrid1 telomeric G-quadruplex formed by Tel26 in K+ solution and (b) hybrid-2 telomeric G-quadruplex formed by wtTel26 in K+ solution. (c) Top view of the adenine triple (red) capping the top G-tetrad (cyan) of the hybrid-1 telomeric G-quadruplex shown in (a). (d) The bottom view of the T:A:T triple capping the bottom G-tetrad (blue) of the hybrid-2 telomeric G-quadruplex shown in (b), with the potential hydrogen bonds shown as dashed lines. The loop adenines are in red, and the loop thymines are in green. The top G-tetrad (as in Fig. 11.2a) is in cyan, the middle G-tetrad is in magenta, and the bottom G-tetrad is in blue (See Color Insert)

11 Therapeutic Targets and Drugs II: G-Quadruplex and G-Quadruplex Inhibitors

11.3.3

261

The Hybrid-1 and Hybrid-2 Human Telomeric G-Quadruplexes are Closely Related Yet Distinct in Their Folding and Structures

While both hybrid-type structures contain three G-tetrads linked with mixed parallel/antiparallel G-strands, they differ in loop arrangements, strand orientations, G-tetrad arrangements, and capping structures (Figs. 11.5a, b and 11.6). The hybrid-1 structure has sequential side–lateral–lateral loops with the first TTA loop adopting the double-chain-reversal conformation, whereas the hybrid-2 structure has lateral–lateral–side loops with the last TTA loop adopting the doublechain-reversal conformation. Both hybrid-type structures contain three parallel G-strands and one antiparallel G-strand: in hybrid-1 the third G-strand is antiparallel whereas in hybrid-2 it is the second G-strand that is antiparallel. Both hybridtype structures contain five syn guanines and mixed asymmetrical G-arrangements. The first and second G-tetrads (from the 50 end) have reversed G-arrangements and the second and third G-tetrads have the same G-arrangements: for the hybrid-1 structure the first G-tetrad is (syn:syn:anti:syn) and the bottom two are (anti:anti: syn:anti), whereas for the hybrid-2 structure the first G-tetrad is (syn:anti:syn:syn) and the bottom two are (anti:syn:anti:anti).

11.3.4

Capping Structures Determine the Selective Formation of Hybrid-1 or Hybrid-2 Telomeric G-Quadruplex Structure

The native 26-nt human telomeric sequence wtTel26 and the modified 26-nt sequence Tel26 contain the same core four G-tract 22-nt human telomeric sequence wtTel22, with Tel26 containing the modified 50 - and 30 -flanking AA instead of the native TT (Fig. 11.4b). However, in K+ solution, wtTel26 forms a major hybrid-2 structure whereas Tel26 forms a predominant hybrid-1 structure (Fig. 11.5a, b) (58, 59). The molecular structures of the two hybrid-type human telomeric G-quadruplexes indicate that specific capping structures selectively stabilize the specific hybrid-type telomeric G-quadruplex. The molecular structure of the hybrid-2 G-quadruplex formed by wtTel26 in K+ shows a T:A:T triple capping structure specific to the hybrid-2 type human telomeric G-quadruplex (Fig. 11.6d). The well-defined T:A:T triple platform forms with T8 and A9 of the first TTA lateral loop and T25 of the 30 -flanking segment, capping the bottom end of the hybrid-2 human telomeric G-quadruplex (Fig. 11.5b) (59). The importance of the T:A:T capping structure in stabilizing the hybrid-2 human telomeric G-quadruplex structure has been demonstrated by mutational analysis of wtTel26 with single A-to-T and T-to-U substitutions (59). This T:A:T triple capping structure formed by T8, A9, and T25 can only be formed

262

C. Punchihewa, D. Yang

in the hybrid-2 folding (Fig. 11.5b) but not in the hybrid-1 folding (Fig. 11.5a). In the modified Tel26 sequence (Fig. 11.4b), T25 is mutated to A25 and the T8:A9: T25 triple can no longer form (Fig. 11.5a), hence the hybrid-2 folding is no longer favored. Rather, Tel26 forms a hybrid-1 G-quadruplex structure in K+, in which two capping platforms specific to the hybrid-1 folding (Fig. 11.5a) are observed: a naturally occurring adenine triple capping structure of A21, A3, and A9 at the top end (Fig. 11.6c) and an A:T base-pair capping structure at the bottom end of the G-quadruplex (Fig. 11.6a) (58). The A:T base-pair capping structure involves the mutated A25 and may explain our observation of the 3-flanking T-to-A mutation selectively stabilizing the hybrid-1 type structure in K+ solution (117).

11.3.5

Human Telomeric Sequences Form a Mixture of Hybrid-1 and Hybrid-2 Structures with a Low Energy Barrier; the Population of Two Forms Largely Depends on the 30 -Flanking Sequences

As human telomeric sequences can form two different intramolecular hybrid-type G-quadruplex conformations in K+ solution, we have systematically examined various extended four-G-tract human telomeric sequences (59). Interestingly, in all four-G-tract human telomeric sequences we examined, both hybrid-1 and hybrid-2 forms appear to form and coexist in K+ solution (59). For extended human telomeric sequences (such as wtTel26 and wtTel27), the hybrid-2 form appears to be the major conformation in K+ solution, accounting for approximately 70% in wtTel26 and less than 65% in wtTel27, but the hybrid-1 form can also be detected in both sequences (Fig. 11.4a). In contrast, for human telomeric sequences with no 3-flanking segment (wtTel23 and wtTel24), the hybrid-1 structure appears to be the major conformation, as the telomeric sequences lacking the 3-flanking T are unable to form the T:A:T capping (Fig. 11.6d) and in turn unable to form a stable hybrid-2 structure. The energy difference between the two hybrid-type telomeric G-quadruplex conformations appears to be rather small, as the equilibrium of hybrid-1 and hybrid-2 structures can be readily shifted by minor changes such as the lengths or minor modifications of the flanking sequences (59). Thus, the in vivo equilibrium of the two forms with a low energy barrier may be affected and readily shifted by factors such as body temperature, ion concentration, and protein binding. However, the kinetics of the interconversion between the two conformations appears to be slow on the NMR timescale, as very few exchange peaks were observed in NOESY experiments (58, 59, 117).

11.3.6

Insights into the G-Quadruplex Loop Conformations

The hybrid-type human telomeric G-quadruplexes contain a 3-nt double-chainreversal loop, which is the first TTA segment in the hybrid-1 structure and the

11 Therapeutic Targets and Drugs II: G-Quadruplex and G-Quadruplex Inhibitors

c-Myc(a) c-Myc(b) VEGF HIF-1a bcl-2 hTel-1 hTel-2

5'5'5'5'5'5'5'-

GGG T GGG GA GGG A GGG TGGGGA GGG C GGG CCGG GGG A GGG AGAGG GGG CGC GGG AGGAAGG GGG TTA GGG TTA GGG TTA GGG TTA

GGG T GGG GGG T GGG GGG C GGG GGG C GGG GGG C GGG GGG TTA GGG GGG TTA GGG

263

-3' -3' -3' -3' -3' -3' -3'

Fig. 11.7 Comparison of G-quadruplex-forming sequences. Loops colored in red have been shown to adopt parallel-stranded double-chain-reversal side loops (see text for more details) (See Color Insert)

third TTA segment in the hybrid-2 structure, respectively (58, 117) (Fig. 11.5a, b). Such double-chain-reversal loop conformations are favored by short loop sizes of 1 and 2 nt, as shown in other G-quadruplex structures (55, 56, 117, 123–126) (Fig. 11.7). A loop longer than 2 nt is in general not as favored for the double-chain-reversal loop conformation, likely due to unfavored base–solvent interactions of groovepositioned loop residues whose stacking interactions are lacking. Interestingly, however, in the molecular structures of the two hybrid-type human telomeric G-quadruplexes, the adenines of the TTA double-chain-reversal loops adopt a similar conformation, which is positioned above and partially stacked with the top G-tetrad. In particular, the A9 residue of the first TTA double-chain-reversal loop of the hybrid-1 structure is positioned partially above the top tetrad and participates in the adenine triple capping structure (Fig. 11.6a), while A21 of the third TTA double-chain-reversal loop of the hybrid-2 structure is also positioned partially above the top G-tetrad (Fig. 11.6b). This specific conformation essentially makes the 3-nt TTA double-chain-reversal loop equivalent to a 2-nt loop in the groove, as only the two thymine residues are positioned in the groove region. This may explain why a 3-nt double-chain-reversal loop can be present in the hybridtype human telomeric G-quadruplexes and may contribute to their structural flexibility and polymorphism.

11.3.7

Hybrid-Type Structures are the Predominant Conformations for wtTel26 and Tel26 in K+ Solution, Even in the Copresence of a High Concentration of Na+

Hybrid-type structures (Fig. 11.5a, b) appear to be the more stable and thus the predominant conformation for wtTel26 and Tel26 in K+ solution, even in the copresence of a high concentration of Na+. Addition of K+ to the Na+ solution readily converts the preformed basket-type Na+ structure to the hybrid-type K+ structure (117) (Fig. 11.8a). In contrast, addition of Na+ to a 50 mM K+ solution, even to a concentration of 200 mM, does not change the hybrid-type K+ structure to

264

C. Punchihewa, D. Yang

a.

800 0 mM K+

700

600

1 mM K+

600

3

700

10 mM K+

500

50 mM K+ 100 mM K+

400 300 200 100 0 200 -100

220

240

260

280

300

320

molar ellipticity [θ ] X10 (degXcm2Xdmol-1)

molar ellipticity [θ ] X103 (degXcm2Xdmol-1)

800

Wavelength (nm)

-200

0 mM Na+ 1 mM Na+ 10 mM Na+ 50 mM Na+ 100 mM Na+

500 400 300 200 100 0 200 -100

220

260

280

300

320

Wavelength (nm)

-200

Na_to_K

240

K_to_Na

-300

-300

b. Tel26 (Hybrid-1) G4 G5

G6

A1

T20 T8

A21

T20

A3 T19

G4

syn anti

G18

T19

T20

A9

A21 G22

G10

G23

G11

G24

G12

T19

T8

A21

A9

T7

G22

G10

K+

Na+

G10A9 G5

G18

T8 G17

G11

G16

G12 A26

G18

G10

G6

G23

G17

G6

G23

G18

G11

G5

G24

G11

A9

T7

G22

G12

T7 G6

A15

T19

T8

A21

T7

A2

T20

G17

G17

G16

G5

G24

G16

T13

G4

T13 A15

T14

G12

Na+ K+

G16

G4 T13 A15

T14

T13 A15

T14

T14

multiple conformations

wtTel22 (Hybrid-1)

G4 G5

T20

A21

G6

T19

T7

G4

syn anti G23

G18

T8

T20

G10A9 G5 T8 G11

T19

T20

A9

A21 G22

G10

G23

G11

G24

G12

T19

T8

A21

T20

A9

T7

G22

G10

T7

Na+

K+

T19

T8

A21

A9

T7

G22

G10

G6 G18

G18

G6

G23

G18 G11

G6

G23

G11

G12 G17 T13

A15

G17

G5

G24

G12

T14 G16

G16

G4

multiple conformations

T14

G5

G24

G16

A15

T14

G12

G4 A3

T13

T13 A15

Na+ K+

G17

A15

T13

T14

Fig. 11.8 (a) Titration experiments of K+ in the presence of 150 mM Na+ for Tel26 (left), and titration experiments of Na+ in the presence of 100 mM K+ for Tel26 (right), monitored by CD spectroscopy. (b) Schematic diagram of the possible mechanism of interconversion between the basket-type (Na+) and the hybrid-type (K+) forms of telomeric G-quadruplexes. The hybrid-1 structure is used for illustration. The hybrid-type G-quadruplex structure is the most stable and thus the predominant form in the presence of K+, regardless of the presence or absence of Na+. The interconversion rate is much slower for the extended four repeat telomeric sequence Tel26 (top) than for the truncated four repeat telomeric sequence wtTel22 (bottom)

the basket-type Na+ structure (Fig. 11.8a). The same results are also observed for the truncated 22-nt wtTel22 sequence. Full conversion of the Na+ structure to its K+ structure of the extended 26-nt sequences takes several hours to an overnight incubation, depending on the K+ concentration, whereas conversion of the Na+ structure of wtTel22 to its K+ structure is faster than can be detected by either CD or

11 Therapeutic Targets and Drugs II: G-Quadruplex and G-Quadruplex Inhibitors

265

NMR (117). A possible model through a strand-reorientation mechanism was proposed for interconversion of the hybrid-type and basket-type structures (117) (Fig. 11.8b). The 50 G-strand of the basket-type G-quadruplex may dissociate from the structure and swing back to the other side of the second G-stand to form a parallel-stranded structural motif with a double-chain-reversal loop. The first two G-tetrad planes do not need to be completely melted for the new conformation as the other six guanines still keep the same relative positions and glycosidic sugar conformations, while the bottom G-tetrad is likely to be melted and dissociated to rearrange the guanine conformation. This suggested partial melting is consistent with recent reports showing a multistep melting transition of telomeric G-quadruplexes (127, 128). In contrast to the wtTel22 sequence that forms a single welldefined basket-type G-quadruplex in Na+ solution (115), the extended sequences wtTel26 and Tel26 do not form a single well-defined G-quadruplex conformation in Na+ solution (59, 117). This is likely due to steric interference between the diagonal loop and the two extended flanking segments of wtTel26 and Tel26 in the baskettype structure, as they are all positioned on the same end of the basket-type G-quadruplex (Fig. 11.5c).

11.3.8

Structure Polymorphism of Human Telomeric G-Quadruplexes May be Related with the Highly Conserved Asymmetric Human Telomeric DNA Sequence

The human telomeric sequence is highly conserved. Both hybrid-type human telomeric G-quadruplexes are asymmetric structures (Fig. 11.5a, b), which are related with the intrinsic asymmetric residue distribution of the tandem TTA loops in the human telomeric DNA sequence. It is this structural asymmetry that determines the possibility of the formation of the two very closely related but distinct intramolecular G-quadruplexes, the hybrid-1 and hybrid-2 structures. Unlike the G-rich sequences in gene promoter regions (55, 56, 123–126, 129– 132), the telomeric DNA sequence is unique in that it contains the same tandem repeats with the same linker segments. Thus, in a telomeric sequence, all four-Gtract regions have the same potential of forming an intramolecular G-quadruplex structure. The linker segment in the human (and vertebrate) telomeric sequence is TTA, whereas linker segments in the telomeric sequences of most of the lower organisms contain thymines only. The presence of adenine in the TTA loops adds an asymmetry in human telomeric sequences, thereby providing a more selective basis for different capping structures and thus different G-quadruplex conformations. For example, the T:A:T triple capping with T8, A9, and T25 can be formed in the hybrid-2 structure only, whereas the adenine triple capping with A3, A9, and A21 can be formed in the hybrid-1 structure only (Figs. 11.5a, b and 11.6).

266

11.3.9

C. Punchihewa, D. Yang

Potential of the Hybrid-Type Human Telomeric G-Quadruplexes to Form Higher-Order Multimers

Human telomeric DNA terminates with a 30 single-stranded overhang of 100–200 nt. Significantly, both the hybrid-type human telomeric G-quadruplexes structures provide an efficient scaffold for a compact-stacking structure of multimers in human telomeric DNA (Fig. 11.9). The 50 and 30 ends of the hybrid-type G-quadruplex structure point in opposite directions, allowing the hybrid-type G-quadruplex to be readily folded and stacked end to end in the elongated linear telomeric DNA strand. Note that the two hybrid-type forms can co-exist in the multimer structures in the extended telomeric DNA. Intriguingly, the capping structures (adenine triple in the hybrid-1 structure and the T:A:T triple in hybrid2 structure) can provide not only stacking interactions between the two adjacent telomeric G-quadruplexes but also specific binding sites for small-molecule ligands to target G-quadruplexes in human telomeres (Fig. 11.9). As the energy barrier between the two hybrid type structures is low, it can be easily surpassed by binding of a specific ligand, thus changing the G-quadruplex conformation. Consequently, the changed G-quadruplex structure may disrupt existing protein interactions and introduce new protein recognitions. The structural polymorphism and dynamic equilibrium of the human telomeric sequence, which appear to be intrinsic to its sequence, may be important for the biology of human telomeres. Nature may have chosen this specific sequence with its asymmetry and the low energy barrier

Fig. 11.9 A model showing DNA secondary structure composed of compactstacking multimers of hybridtype G-quadruplexes in human telomeres, with an equilibrium between hybrid-1 and hybrid-2 forms in K+ solution. The hybrid-1 and hybrid-2 forms could co-exist in the multimer structures. The hybrid-1 and hybrid2 telomeric G-quadruplexes have distinct molecular structures, as shown by the representative NMR structures (guanine: yellow; adenine: red; thymine: blue) (See Color Insert)

Hybrid-1

3' 5'

5' 3'

5'

5' 3'

3'

Hybrid-2

Human Telomere

11 Therapeutic Targets and Drugs II: G-Quadruplex and G-Quadruplex Inhibitors

267

between different forms, which may provide a means to affect its protein recognition and control the biology of human telomeres.

11.4

Ligands Targeting the Telomeric G-Quadruplexes and Their Biological Effects

The first target-based telomeric G-quadruplex ligand BSU1051 was developed in 1997 and was shown to inhibit telomerase by G-quadruplex stabilization (133). The subsequent discovery of the perylene derivative PIPER, which drove the formation of G-quadruplexes (134) and inhibited Sgs1-mediated G-quadruplex unwinding (79) laid the foundation for the existence of a broader mechanism for G-quadruplex ligands. Since then, diverse families of small-molecule compounds with improved specificity and affinity have been identified or developed, and the search for better telomeric G-quadruplex inhibitors is ongoing. Approaches include in silico and conventional screening methods as well as rational structure-based drug design (20). A common feature among the G-quadruplex-targeting ligands is the presence of a fused ring system that is capable of stacking interactions with the terminal Gtetrads (Fig. 11.2). Many of these ligands also contain side-chain substituents with cationic charges that have the propensity to interact with G-quadruplex grooves. G-quadruplex inhibitors themselves have contributed immensely to understanding G-quadruplexes as a therapeutic target. The first G-quadruplex inhibitors were developed for inhibiting telomerases, following the observation that G-quadruplex formation in the presence of K+ inhibits telomerase activity (19) (Fig 11.1B). Stabilization of G-quadruplexes by ligands was expected to inhibit telomeres and lead to cell senescence following telomere attrition. Subsequently, G-quadruplex ligands were shown to result in cell apoptosis by a different mechanism that is related to telomere dysfunction. Stabilization of G-quadruplexes disrupts telomere structure and maintenance, which activates DNA damage checkpoints and results in rapid cell apoptosis, in contrast to the slower process of senescence induced by telomerase inhibition (Fig 11.1C). The notion of dysfunctional human telomeres activating the DNA damage response pathway came to light with the finding that inhibition of TRF2–DNA interaction results in activation of the ATM kinase pathway and subsequent p53/p21-mediated cell cycle arrest (46). The involvement of DNA damage response in the cellular reaction to telomere dysfunction was further substantiated by subsequent studies wherein DNA damage response factors such as 53BP1, H2AX, Rad17, ATM, and Mre11 were shown to associate with uncapped, dysfunctional telomeres, as well as induce an ATM-independent damage response pathway (135). These cells also had activated forms of the DNA damage checkpoint kinases CHK1 and CHK2 (136). The inhibition of other telomeric proteins such as TIN2 and POT1 has also been shown to induce DNA damage checkpoints (137, 138). The telomere dysfunction induced by G-quadruplex-targeting ligands is corroborated by studies with G-quadruplex ligands such as telomes-

268

C. Punchihewa, D. Yang

tatin, BRACO-19, and RHPS4. For example, treatment of human leukemia cells with telomestatin causes telomere dysfunction and activates the ATM-dependent DNA damage response (139). Telomestatin also causes the rapid dissociation of POT1 (140) and TRF2 (141) from telomeres and induces anaphase bridge formation, similar to the effect of dominant-negative TRF2. Similarly BRACO-19 and RHPS4 cause telomere-capping alterations (Fig 11.3A), resulting in telomeric fusions and telophase bridges and leading to activation of cell cycle checkpoints (53, 142). In addition, many G-quadruplex ligands are effective in both telomerasepositive and -negative cells with an ALT phenotype, indicating that the ALT pathway is also blocked by G-quadruplex ligands and is thus likely to involve G-quadruplexes as well (51–53) (Fig 11.3B). The most selective and active telomeric G-quadruplex-targeting ligands are discussed next in further detail. Despite the attractiveness of G-quadruplex ligands as inducers of telomere dysfunction, it should be noted that unlike telomerase, telomere capping is present in all cells, including normal noncancerous cells. However, the dynamic capping/ uncapping characteristic of telomeres targeted by such ligands can be pronouncedly different in normal and cancer cells, since cancer cells are likely to have frequent changes in DNA conformation due to continuous cell proliferation. In this respect, it is noteworthy that telomere alteration is a hallmark of cancer cells.

11.4.1

Telomestatin

A natural product isolated from Streptomyces anulatus 3533-SV4, telomestatin, is the most potent small-molecule inhibitor of telomerase identified so far, with an IC50 value of 5 nM (143) (Fig. 11.2). Based on the structural similarity between telomestatin and a G-quartet, its propensity to be a G-quadruplex ligand was subsequently recognized and confirmed by experimental data and molecular modeling studies (144). The value of telomestatin as a G-quadruplex-targeting agent was much appreciated subsequent to the finding that telomestatin interacts preferentially with intramolecular vs. intermolecular G-quadruplex structures and has a 70-fold selectivity for intramolecular G-quadruplex structures over duplex DNA (145). Telomestatin is an important drug candidate because of its effect on human cancer cells. Treatment of different multiple myeloma cell lines with telomestatin for 3–5 weeks at the minimal effective concentration inhibited telomerase activity, reduced telomere length, and caused apoptotic cell death (146). Telomestatin treatment of primary and established acute leukemia cell lines resulted in telomere shortening and apoptosis (147, 148) and increased chemosensitivity of these cells (148). In xenograft studies, tumor tissue from telomestatin-treated animals exhibited marked apoptosis, and, more importantly, none of the mice displayed any signs of toxicity (149). The promising data obtained on the anticancer activity of telomestatin have led to more studies to better understand its mechanism of action. Telomestatin can

11 Therapeutic Targets and Drugs II: G-Quadruplex and G-Quadruplex Inhibitors

269

induce telomere dysfunction and impair chromosome integrity. Specifically, it induces the activation of ATM and Chk2, and subsequently increases the expression of p21 (CIP1) and p27 (KIP1), probably by inducing the ATM-dependent DNA damage response (139). This response is probably at least in part due to the inhibition of DNA binding of POT1 and TRF2 and to the erosion of G-tails, as a consequence of G-quadruplex induction and stabilization by telomestatin (140, 141). The exceptional potency and the encouraging data available on its activity and mechanism make telomestatin one of the most promising G-quadruplex-targeting drugs.

11.4.2

BRACO19

BRACO19 is a rationally designed trisubstituted acridine derivative that appears to directly target telomeres (Fig. 11.2). It is a member of a series of potent inhibitors that were designed by computer modeling, exploiting the unique structural features of quadruplex DNA (150). Specifically, these were developed to interact with three grooves of G-quadruplexes in addition to stacking on the terminal G-quartet. Thus, a disubstituted acridine molecule that was known to bind with quadruplexes was used as a starting model and different substitutions were carried out at the third position. This led to the identification of BRACO19, a compound that had an outstandingly low cytotoxicity but a much higher G-quadruplex-binding and telomerase-inhibitory activity than the parent compound. Subsequently, BRACO19 was shown to inhibit the catalytic function of telomerase in human cancer cells and also destabilize the telomere capping complex (53). This was based on the observation that it inhibited cell growth in DU145 prostate cancer cells more rapidly than would be expected solely by the inhibition of the catalytic function of telomerase, and that senescence is accompanied by an initial upregulation of the cyclin-dependent kinase inhibitor p21, with subsequent increases in p16 (INK4a) expression. BRACO19 also induced extensive end-to-end chromosomal fusions, consistent with telomere uncapping. The exposure of 21NT human breast cancer cells to nonacute cytotoxic concentrations of BRACO19 (2 mM) resulted in a marked reduction in cell growth after only 15 days (151). BRACO19 shows high in vivo activity against different types of cancers. In a xenograft model established from UXF1138L uterus carcinoma cells, BRACO-19 inhibited growth by 96% compared with controls. Analysis of tumor tissues indicated that this response was paralleled by loss of nuclear hTERT protein expression and an increase in atypical mitosis indicative of telomere dysfunction (152). A distinct difference between BRACO19 and direct hTERT inhibitors that result in gradual telomere loss is that the former produces antitumor effects soon after treatment. BRACO19 induced significant tumor regression within 7–10 days of the initiation of treatment in a DU145 prostate cancer xenograft (153). It also represents the first of a ‘‘second generation’’ of G-quadruplex-mediated telomere-interactive compounds, since it displayed antitumor activity in vivo when administered postpaclitaxel to mice

270

C. Punchihewa, D. Yang

bearing human vulval carcinoma xenografts (151). Despite all its favorable characteristics, the major limitation of BRACO19 is its lack of membrane permeability, which has to be addressed before it can be developed into an effective clinical agent (154).

11.4.3

RHPS4

The five-ring acridine RHPS4 (Fig. 11.2) was selected from a small series of analogs that were proposed to inhibit telomerase enzymes because of their structural similarities to previously identified G-quadruplex interactive telomerase inhibitors (52). In initial studies, it was identified to be a potent submicromolarlevel inhibitor of telomerase in the telomeric repeat amplification protocol (TRAP) assay, but with acute cytotoxicity only at concentrations significantly greater than these levels. Long-term exposure of 21NT breast cancer or A431 vulval cancer cells to nonacute cytotoxic concentrations of RHPS4 resulted in a decrease in cell growth after 15 days (52) as well as a marked reduction in cellular telomerase activity and cell cycle changes. An interesting observation is the lack of reduction in telomere length during this period. However, RHPS4 was not active against SKOV-3 cells, which contain long telomeres; in contrast, it had a growth-inhibitory effect on GM847 ALT cells. Further studies conducted to understand this confusing behavior showed that the short-term biological activity of RHPS4 was not caused by telomere shortening but by telomere dysfunction, based on the presence of telomeric fusions, polynucleated cells, and typical images of telophase bridges in treated cells (142). Structural studies indicate that RHPS4 interacts with quadruplexes by stacking at the end, similar to other G-quadruplex ligands (142). The efficacy of RHPS4 as part of a combination therapy has also been studied. The combination of RHPS4 with other drugs such as paclitaxol (or taxol), doxorubicin (or adriamycin), and the experimental therapeutic agent 17-(allylamino)-17demethoxygeldanamycin conferred enhanced sensitivity to RHPS4-treated MCF-7 cells (155). In another study, the combination of RHPS4 with the mitotic spindle poison taxol caused tumor remissions and further enhancement of telomere dysfunction (156). RHPS4 is one of the most promising G-quadruplex ligands in preclinical development and it is anticipated to enter the clinic in the near future (157).

11.4.4

TMPyP4

TMPyP4 (Fig. 11.2) is the product of a structure-based drug design attempt, selected based on its physical properties such as the presence of a fused planar ring system, positive charge, and the appropriate size to stack with the G-tetrads (158). As expected, it stabilized G-quadruplexes and effectively inhibited human

11 Therapeutic Targets and Drugs II: G-Quadruplex and G-Quadruplex Inhibitors

271

telomerase in HeLa cell extracts (158). TMPyP4 exhibited significant selectivity for quadruplex DNA over duplex DNA, stacking externally with the G-tetrad. The selectivity of TMPyP4 was further substantiated in comparison with its close analog TMPyP2, which is a poor G-quadruplex-interactive compound and has much reduced telomerase-inhibitory activity (159). In vivo data consistent with these in vitro data have also been obtained, wherein unlike TMPyP2, TMPyP4 decreased the rate of proliferation of sea urchin embryos and trapped the cells in mitosis. It generated anaphase bridges and displayed a chromosome-destabilization-mediated antiproliferative effect (160). Recent elucidation of the mechanism of TMPyP4 has revealed that it interacts with the G-quadruplex formed in the promoter region of c-Myc gene (161). Consequently, TMPyP4 downregulates c-MYC, and this may contribute to the observed effects on telomerase by lowering hTERT, a downstream target of c-Myc (162). hTERT is an integral part of telomerase, and owing to this TMPyP4 is still being pursued as a telomere/telomerase inhibitor. However, a major hurdle in its development as a G-quadruplex target agent is its ability to bind to duplex DNA (163), RNA, and RNA–DNA hybrids (164), and triplex DNA (165). Thus, attempts have been made to generate second-generation cationic porphyrins with high selectivity for G-quadruplexes (166).

11.4.5

12459

Triazines are a new series of G-quadruplex compounds that exhibit potent and specific antitelomerase activity with an IC50 in the nanomolar range (51). 12459 (Fig. 11.2) and another triazine, 115404, were initially selected based on the delayed growth arrest they induced on long-term treatment of tumor cells at subapoptotic dosages (51). Initial studies on the activity of 115404 in telomerasenegative ALT cells indicated a mechanism different from telomerase inhibition for these compounds. Subsequently, multiple studies have been carried out with 12459, including those with dominant-negative hTERT, indicating that telomerase activity is not the main target for 12459 but hTERT functions are likely to contribute to a resistance phenotype (167). In addition to senescence, 12459 also induces apoptosis on short-term treatment of the human lung adenocarcinoma A549 cell line (51). There is a rapid degradation of the telomeric G-overhang that parallels the apoptotic induction by 12459 (168). Furthermore, the apoptosis is mediated at least in part by Bcl-2, which is not a critical determinant of the long-term senescence induced by 12459 (168). Interestingly, 12459 also works by a mechanism not described thus far for any other G-quadruplex ligand – it impairs the splicing machinery of hTERT by stabilizing quadruplexes located in the hTERT intron 6 (169).

272

11.4.6

C. Punchihewa, D. Yang

307A

307A is a 2,6-pyridin-dicarboxamide derivative (Fig. 11.2) identified based on its high selectivity for quadruplex-forming oligonucleotides compared to mutated ones that cannot form quadruplexes (170). The same study showed 307A to be equipotent against c-myc and telomeric quadruplex-forming sequences, and indicated that it may also be potentially used to inhibit c-myc gene transcription in tumor cells. 307A and other members of this series inhibited cell proliferation at very low concentrations and induced massive apoptosis within a few days in a dose-dependent manner in cultures of telomerase-positive glioma cell lines. They also had antiproliferative effects in SAOS-2, a cell line in which telomere maintenance involves the ALT mechanism. The apoptosis induced by these compounds was preceded by multiple alterations of the cell cycle, and those effects were not associated with telomere shortening but directly related to telomere instability involving telomere end fusion and anaphase bridge formation (171). In a more recent study, the role of 307A and its close analog 360A in G-quadruplex stabilization were further substantiated, wherein incubation of oligomers with these compounds resulted in extensive formation of G-quadruplexes in vitro. Using 360A, it was also shown that in addition to binding to and locking into preformed quadruplexes, it also acts as a chaperone for tetramolecular complexes (172).

11.4.7

Other Compounds

Numerous other G-quadruplex-interacting pharmacophores including diamidoanthraquinones such as BSU1051 (173), perylenes such as PIPER (134) (Fig. 11.2), and fluoroquinophenoxazines such as QQ58 (174) have shown telomerase-inhibitory activity and various levels of selectivity and potency in binding to G-quadruplexes. Many such compounds are currently in various stages of preclinical testing and some of them will possibly enter the clinic in the near future.

References 1. Hud NV, Plavec J. The role of cations in determining quadruplex structure and stability. In: Neidle S, ed. Quadruplex Nucleic Acids: Royal Society of Chemistry, RSCPublishing, Cambridge, 2006:100–30. 2. Gellert M, Lipsett MN, Davies DR. Helix formation by guanylic acid. Proc Natl Acad Sci USA 1962; 48:2013–8. 3. Arnott S, Chandrasekaran R, Marttila CM. Structures for polyinosinic acid and polyguanylic acid. Biochem J 1974; 141:537–43. 4. Zimmerman SB, Cohen GH, Davies DR. X-ray fiber diffraction and model-building study of polyguanylic acid and polyinosinic acid. J Mol Biol 1975; 92:181–92.

11 Therapeutic Targets and Drugs II: G-Quadruplex and G-Quadruplex Inhibitors

273

5. Henderson E, Hardin CC, Walk SK, Tinoco I, Jr., Blackburn EH. Telomeric DNA oligonucleotides form novel intramolecular structures containing guanine–guanine base pairs. Cell 1987; 51:899–908. 6. Sundquist WI, Klug A. Telomeric DNA dimerizes by formation of guanine tetrads between hairpin loops. Nature 1989; 342:825–9. 7. Williamson JR, Raghuraman MK, Cech TR. Monovalent cation-induced structure of telomeric DNA: The G-quartet model. Cell 1989; 59:871–80. 8. Dexheimer TS, Sun D, Fry M, Hurley LH. DNA quadruplexes and gene regulation. In: Neidle S, ed. Quadruplex Nucleic Acids: Royal Society of Chemistry, RSCPublishing, Cambridge, 2006:180–207. 9. Maizels N. Dynamic roles for G4 DNA in the biology of eukaryotic cells. Nat Struct Mol Biol 2006; 13:1055–9. 10. Fry M. Tetraplex DNA and its interacting proteins. Front Biosci 2007; 12:4336–51. 11. Oganesian L, Bryan TM. Physiological relevance of telomeric G-quadruplex formation: A potential drug target. Bioessays 2007; 29:155–65. 12. Blackburn EH, Gall JG. A tandemly repeated sequence at the termini of extrachromosomal ribosomal RNA genes in Tetrahymena. J Mol Biol 1978; 120:33–53. 13. Allshire RC, Dempster M, Hastie ND. Human telomeres contain at least 3 types of G-Rich repeat distributed non-randomly. Nucleic Acids Res 1989; 17:4611–27. 14. de Lange T, Shiue L, Myers RM, et al. Structure and variability of human chromosome ends. Mol Cell Biol 1990; 10:518–27. 15. Moyzis RK, Buckingham JM, Cram LS, et al. A highly conserved repetitive DNA sequence, (TTAGGG)n, present at the telomeres of human chromosomes. Proc Natl Acad Sci USA 1988; 85:6622–6. 16. Makarov VL, Hirose Y, Langmore JP. Long G tails at both ends of human chromosomes suggest a C strand degradation mechanism for telomere shortening. Cell 1997; 88:657–66. 17. Wright WE, Tesmer VM, Huffman KE, Levene SD, Shay JW. Normal human chromosomes have long G-rich telomeric overhangs at one end. Genes Dev 1997; 11:28019. 18. Colgin LM, Reddel RR. Telomere maintenance mechanisms and cellular immortalization. Curr Opinion Genet Dev 1999; 9:97–103. 19. Zahler AM, Williamson JR, Cech TR, Prescott DM. Inhibition of telomerase by G-quartet DNA structures. Nature 1991; 350:718–20. 20. Neidle S, Parkinson G. Telomere maintenance as a target for anticancer drug discovery. Nat Rev Drug Discov 2002; 1:383–93. 21. Salazar M, Thompson BD, Kerwin SM, Hurley LH. Thermally induced DNA:RNA hybrid to G-quadruplex transitions: Possible implications for telomere synthesis by telomerase. Biochemistry 1996; 35:16110–5. 22. Blackburn EH. Telomere states and cell fates. Nature 2000; 408:53–6. 23. van Steensel B, Smogorzewska A, de Lange T. TRF2 protects human telomeres from end-toend fusions. Cell 1998; 92:401–3. 24. Hackett JA, Feldser DM, Greider CW. Telomere dysfunction increases mutation rate and genomic instability. Cell 2001; 106:275–86. 25. de Lange T. Shelterin: The protein complex that shapes and safeguards human telomeres. Genes Dev 2005; 19:2100–10. 26. Court R, Chapman L, Fairall L, Rhodes D. How the human telomeric proteins TRF1 and TRF2 recognize telomeric DNA: A view from high-resolution crystal structures. EMBO Rep 2005; 6:39–45. 27. Xin H, Liu D, Wan M, et al. TPP1 is a homologue of ciliate TEBP-beta and interacts with POT1 to recruit telomerase. Nature 2007; 445:559–62. 28. Wang F, Podell ER, Zaug AJ, et al. The POT1–TPP1 telomere complex is a telomerase processivity factor. Nature 2007; 445:506–10. 29. Baumann P, Cech TR. Pot1, the putative telomere end-binding protein in fission yeast and humans. Science 2001; 292:1171–5.

274

C. Punchihewa, D. Yang

30. Lei M, Podell ER, Baumann P, Cech TR. DNA self-recognition in the structure of Pot1 bound to telomeric single-stranded DNA. Nature 2003; 426:198–203. 31. Lei M, Podell ER, Cech TR. Structure of human POT1 bound to telomeric single-stranded DNA provides a model for chromosome end-protection. Nat Struct Mol Biol 2004; 11:1223–9. 32. Mergny JL, Helene C. G-quadruplex DNA: A target for drug design. Nat Med 1998; 4: 1366–7. 33. Sun DY, Hurley LH. Targeting telomeres and telomerase. In: Chaires JB, Waring MJ, eds. Methods in Enzymology, Drug–Nucleic Acid Interactions (vol. 340), Academic, San Diego, CA, 2001:573–92. 34. Hurley LH. DNA and its associated processes as targets for cancer therapy. Nat Rev Cancer 2002; 2:188–200. 35. Bodnar AG, Ouellette M, Frolkis M, et al. Extension of life-span by introduction of telomerase into normal human cells. Science 1998; 279:349–52. 36. Harley CB. Telomere loss: Mitotic clock or genetic time bomb? Mutat Res 1991; 256: 271–82. 37. Sun H, Karow JK, Hickson ID, Maizels N. The Bloom’s Syndrome helicase unwinds G4 DNA. J. Biol. Chem. 1998; 273:27587–92. 38. Sun H, Bennett RJ, Maizels N. The Saccharomyces cerevisiae Sgs1 helicase efficiently unwinds G-G paired DNAs. Nucleic Acids Res 1999; 27:1978–84. 39. Harley CB, Futcher AB, Greider CW. Telomeres shorten during ageing of human fibroblasts. Nature 1990; 345:458–60. 40. Greider CW, Blackburn EH. Identification of a specific telomere terminal transferase activity in Tetrahymena extracts. Cell 1985; 43:405–13. 41. Kim NW, Piatyszek MA, Prowse KR, et al. Specific association of human telomerase activity with immortal cells and cancer. Science 1994; 266:2011–5. 42. Hanahan D, Weinberg RA. The hallmarks of cancer. Cell 2000; 100:57–70. 43. Hurley LH. Secondary DNA structures as molecular targets for cancer therapeutics. Biochem Soc Trans 2001; 29:692–6. 44. Hurley LH, Wheelhouse RT, Sun D, et al. G-quadruplexes as targets for drug design. Pharmacol Ther 2000; 85:141–58. 45. Neidle S, Read MA. G-quadruplexes as therapeutic targets. Biopolymers 2000; 56:195–208. 46. Karlseder J, Smogorzewska A, de Lange T. Senescence induced by altered telomere state, not telomere loss. Science 2002; 295:2446–9. 47. Blackburn EH. Switching and signaling at the telomere. Cell 2001; 106:661–73. 48. Karlseder J, Broccoli D, Dai Y, Hardy S, de Lange T. p53- and ATM-dependent apoptosis induced by telomeres lacking TRF2. Science 1999; 283:1321–5. 49. Guiducci C, Cerone MA, Bacchetti S. Expression of mutant telomerase in immortal telomerase-negative human cells results in cell cycle deregulation, nuclear and chromosomal abnormalities and rapid loss of viability. Oncogene 2001; 20:714–25. 50. De Cian A, Lacroix L, Douarre C, et al. Targeting telomeres and telomerase. Biochimie 2007. 51. Riou JF, Guittat L, Mailliet P, et al. Cell senescence and telomere shortening induced by a new series of specific G-quadruplex DNA ligands. Proc Natl Acad Sci USA 2002; 99:2672–7. 52. Gowan SM, Heald R, Stevens MF, Kelland LR. Potent inhibition of telomerase by smallmolecule pentacyclic acridines capable of interacting with G-quadruplexes. Mol Pharmacol 2001; 60:981–8. 53. Incles CM, Schultes CM, Kempski H, Koehler H, Kelland LR, Neidle S. A G-quadruplex telomere targeting agent produces p16-associated senescence and chromosomal fusions in human prostate cancer cells. Mol Cancer Ther 2004; 3:1201–6. 54. Bryan TM, Englezou A, Gupta J, Bacchetti S, Reddel RR. Telomere elongation in immortal human cells without detectable telomerase activity. EMBO J 1995; 14:4240–8. 55. Ambrus A, Chen D, Dai JX, Jones RA, Yang DZ. Solution structure of the biologically relevant g-quadruplex element in the human c-MYC promoter. Implications for g-quadruplex stabilization. Biochemistry 2005; 44:2048–58.

11 Therapeutic Targets and Drugs II: G-Quadruplex and G-Quadruplex Inhibitors

275

56. Dai J, Dexheimer TS, Chen D, et al. An intramolecular G-quadruplex structure with mixed parallel/antiparallel G-strands formed in the human BCL-2 promoter region in solution. J Am Chem Soc 2006; 128:1096–8. 57. Dai JX, Chen D, Jones RA, Hurley LH, Yang DZ. NMR solution structure of the major Gquadruplex structure formed in the human BCL2 promoter region. Nucleic Acids Res 2006; 34:5133–44. 58. Dai JX, Punchihewa C, Ambrus A, Chen D, Jones RA, Yang DZ. Structure of the intramolecular human telomeric G-quadruplex in potassium solution: A novel adenine triple formation. Nucleic Acids Res 2007; 35:2440–50. 59. Dai JX, Carver M, Punchihewa C, Jones RA, Yang DZ. Structure of the hybrid-2 type intramolecular human telomeric G-quadruplex in K+ solution: Insights into structure polymorphism of the human telomeric sequence. Nucleic Acids Res 2007; 35:4927–40. 60. Schaffitzel C, Berger I, Postberg J, Hanes J, Lipps HJ, Pluckthun A. In vitro generated antibodies specific for telomeric guanine-quadruplex DNA react with Stylonychia lemnae macronuclei. Proc Natl Acad Sci USA 2001; 98:8572–7. 61. Paeschke K, Simonsson T, Postberg J, Rhodes D, Lipps HJ. Telomere end-binding proteins control the formation of G-quadruplex DNA structures in vivo. Nat Struct Mol Biol 2005; 12:847–54. 62. Granotier C, Pennarun G, Riou L, et al. Preferential binding of a G-quadruplex ligand to human chromosome ends. Nucleic Acids Res 2005; 33:4182–90. 63. Chang CC, Kuo IC, Ling IF, et al. Detection of quadruplex DNA structures in human telomeres by a fluorescent carbazole derivative. Anal Chem 2004; 76:4490–4. 64. Duquette ML, Handa P, Vincent JA, Taylor AF, Maizels N. Intracellular transcription of G-rich DNAs induces formation of G-loops, novel structures containing G4 DNA. Genes Dev 2004; 18:1618–29. 65. Fang GW, Cech TR. The beta-subunit of oxytricha telomere-binding protein promotes G-quartet formation by telomeric DNA. Cell 1993; 74:875–85. 66. Giraldo R, Rhodes D. The yeast telomere-binding protein RAP1 binds to and promotes the formation of DNA quadruplexes in telomeric DNA. EMBO J 1994; 13:2411–20. 67. Arimondo PB, Riou JF, Mergny JL, et al. Interaction of human DNA topoisomerase I with G-quartet structures. Nucleic Acids Res 2000; 28:4832–8. 68. Marchand C, Pourquier P, Laco GS, Jing N, Pommier Y. Interaction of human nuclear topoisomerase I with guanosine quartet-forming and guanosine-rich single-stranded DNA and RNA oligonucleotides. J Biol Chem 2002; 277:8906–11. 69. Hanakahi LA, Sun H, Maizels N. High affinity interactions of nucleolin with G–G-paired rDNA. J Biol Chem 1999; 274:15908–12. 70. Zaug AJ, Podell ER, Cech TR. Human POT1 disrupts telomeric G-quadruplexes allowing telomerase extension in vitro. Proc Natl Acad Sci USA 2005; 102:10864–9. 71. Opresko PL, Mason PA, Podell ER, et al. POT1 stimulates RecQ helicases WRN and BLM to unwind telomeric DNA substrates. J Biol Chem 2005; 280:32069–80. 72. Smith J, Zou H, Rothstein R. Characterization of genetic interactions with RFA1: The role of RPA in DNA replication and telomere maintenance. Biochimie 2000; 82:71–8. 73. Schramke V, Luciano P, Brevet V, et al. RPA regulates telomerase action by providing Est1p access to chromosome ends. Nat Genet 2004; 36:46–54. 74. Cohen S, Jacob E, Manor H. Effects of single-stranded DNA binding proteins on primer extension by telomerase. Biochim Biophys Acta 2004; 1679:129–40. 75. Salas TR, Petruseva I, Lavrik O, et al. Human replication protein A unfolds telomeric G-quadruplexes. Nucleic Acids Res 2006; 34:4857–65. 76. Zhang QS, Manche L, Xu RM, Krainer AR. hnRNP A1 associates with telomere ends and stimulates telomerase activity. RNA 2006; 12:1116–28. 77. Fukuda H, Katahira M, Tsuchiya N, et al. Unfolding of quadruplex structure in the G-rich strand of the minisatellite repeat by the binding protein UP1. Proc Natl Acad Sci USA 2002; 99:12685–90.

276

C. Punchihewa, D. Yang

78. Enokizono Y, Konishi Y, Nagata K, et al. Structure of hnRNP D complexed with singlestranded telomere DNA and unfolding of the quadruplex by heterogeneous nuclear ribonucleoprotein D. J Biol Chem 2005; 280:18862–70. 79. Han HY, Bennett RJ, Hurley LH. Inhibition of unwinding of G-quadruplex structures by Sgs1 helicase in the presence of N,N0 -bis[2-(1-piperidino)ethyl]-3,4,9,10-perylenetetracarboxylic diimide, a G-quadruplex-interactive ligand. Biochemistry 2000; 39:9311–6. 80. Johnson FB, Marciniak RA, McVey M, Stewart SA, Hahn WC, Guarente L. The Saccharomyces cerevisiae WRN homolog Sgs1p participates in telomere maintenance in cells lacking telomerase. EMBO J 2001; 20:905–13. 81. Cohen H, Sinclair DA. Recombination-mediated lengthening of terminal telomeric repeats requires the Sgs1 DNA helicase. Proc Natl Acad Sci USA 2001; 98:3174–9. 82. Huang PH, Pryde FE, Lester D, et al. SGS1 is required for telomere elongation in the absence of telomerase. Curr Biol 2001; 11:125–9. 83. Lin Y-C, Shih J-W, Hsu C-L, Lin J-J. Binding and partial denaturing of G-quartet DNA by Cdc13p of Saccharomyces cerevisiae. J Biol Chem 2002; 276:47671–4. 84. Ellis NA, Groden J, Ye TZ, et al. The Bloom’s syndrome gene product is homologous to RecQ helicases. Cell 1995; 83:655–66. 85. Karow JK, Chakraverty RK, Hickson ID. The Bloom’s syndrome gene product is a 30 –50 DNA helicase. J Biol Chem 1997; 272:30611–4. 86. Yu CE, Oshima J, Fu YH, et al. Positional cloning of the Werner’s syndrome gene. Science 1996; 272:258–62. 87. Suzuki N, Shimamoto A, Imamura O, et al. DNA helicase activity in Werner’s syndrome gene product synthesized in a baculovirus system. Nucleic Acids Res 1997; 25:2973–8. 88. Orren DK, Theodore S, Machwe A. The Werner syndrome helicase/exonuclease (WRN) disrupts and degrades D-loops in vitro. Biochemistry 2002; 41:13483–8. 89. Opresko PL, von Kobbe C, Laine JP, Harrigan J, Hickson ID, Bohr VA. Telomere-binding protein TRF2 binds to and stimulates the Werner and Bloom syndrome helicases. J Biol Chem 2002; 277:41110–9. 90. Li JL, Harrison RJ, Reszka AP, et al. Inhibition of the Bloom’s and Werner’s syndrome helicases by G-quadruplex interacting ligands. Biochemistry 2001; 40:15194–202. 91. Liu Z, Frantz JD, Gilbert W, Tye BK. Identification and characterization of a nuclease activity specific for G4 tetrastranded DNA. Proc Natl Acad Sci USA 1993; 90:3157–61. 92. Sun H, Yabuki A, Maizels N. A human nuclease specific for G4 DNA. Proc Natl Acad Sci USA 2001; 98:12444–9. 93. Ghosal G, Muniyappa K. Saccharomyces cerevisiae Mre11 is a high-affinity G4 DNAbinding protein and a G-rich DNA-specific endonuclease: Implications for replication of telomeric DNA. Nucleic Acids Res 2005; 33:4692–703. 94. Griffith JD, Comeau L, Rosenfield S, et al. Mammalian telomeres end in a large duplex loop. Cell 1999; 97:503–14. 95. Stansel RM, de Lange T, Griffith JD. T-loop assembly in vitro involves binding of TRF2 near the 30 telomeric overhang. EMBO J 2001; 20:5532–40. 96. Han H, Hurley LH. G-quadruplex DNA: A potential target for anti-cancer drug design. Trends Pharmacol Sci 2000; 21:136–42. 97. Sen D, Gilbert W. Formation of parallel four-stranded complexes by guanine-rich motifs in DNA and its implications for meiosis. Nature 1988; 334:364–6. 98. Muniyappa K, Anuradha S, Byers B. Yeast meiosis-specific protein Hop1 binds to G4 DNA and promotes its formation. Mol Cell Biol 2000; 20:1361–9. 99. Anuradha S, Muniyappa K. Molecular aspects of meiotic chromosome synapsis and recombination. Prog Nucleic Acid Res Mol Biol 2005; 79:49–132. 100. Shukla AK, Roy KB. Rec A-independent homologous recombination induced by a putative fold-back tetraplex DNA. Biol Chem 2006; 387:251–6. 101. Balagurumoorthy P, Brahmachari SK. Structure and stability of human telomeric sequence. J Biol Chem 1994; 269:21858–69.

11 Therapeutic Targets and Drugs II: G-Quadruplex and G-Quadruplex Inhibitors

277

102. Ying LM, Green JJ, Li HT, Klenerman D, Balasubramanian S. Studies on the structure and dynamics of the human telomeric G quadruplex by single-molecule fluorescence resonance energy transfer. Proc Natl Acad Sci USA 2003; 100:14629–34. 103. Redon S, Bombard S, Elizondo-Riojas MA, Chottard JC. Platinum cross-linking of adenines and guanines on the quadruplex structures of the AG3(T2AG3)3 and (T2AG3)4 human telomere sequences in Na+ and K+ solutions. Nucleic Acids Res 2003; 31:1605–13. 104. Phan AT, Patel DJ. Two-repeat human telomeric d(TAGGGTTAGGGT) sequence forms interconverting parallel and antiparallel G-quadruplexes in solution: Distinct topologies, thermodynamic properties, and folding/unfolding kinetics. J Am Chem Soc 2003; 125: 15021–7. 105. He YJ, Neumann RD, Panyutin IG. Intramolecular quadruplex conformation of human telomeric DNA assessed with I-125-radioprobing. Nucleic Acids Res 2004; 32:5359–67. 106. Rezler EM, Seenisamy J, Bashyam S, et al. Telomestatin and diseleno sapphyrin bind selectively to two different forms of the human telomeric G-quadruplex structure. J Am Chem Soc 2005; 127:9439–47. 107. Li J, Correia JJ, Wang L, Trent JO, Chaires JB. Not so crystal clear: The structure of the human telomere G-quadruplex in solution differs from that present in a crystal. Nucleic Acids Res 2005; 33:4649–59. 108. Wlodarczyk A, Grzybowski P, Patkowski A, Dobek A. Effect of ions on the polymorphism, effective charge, and stability of human telomeric DNA. Photon correlation spectroscopy and circular dichroism studies. J Phys Chem B 2005; 109:3594–605. 109. Qi JY, Shafer RH. Covalent ligation studies on the human telomere quadruplex. Nucleic Acids Res 2005; 33:3185–92. 110. Vorlickova M, Chladkova J, Kejnovska I, Fialova M, Kypr J. Guanine tetraplex topology of human telomere DNA is governed by the number of (TTAGGG) repeats. Nucleic Acids Res 2005; 33:5851–60. 111. Rujan IN, Meleney JC, Bolton PH. Vertebrate telomere repeat DNAs favor external loop propeller quadruplex structures in the presence of high concentrations of potassium. Nucleic Acids Res 2005; 33:2022–31. 112. Risitano A, Fox KR. Inosine substitutions demonstrate that intramolecular DNA quadruplexes adopt different conformations in the presence of sodium and potassium. Bioorg Med Chem Lett 2005; 15:2047–50. 113. Ourliac-Garnier I, Elizondo-Riojas MA, Redon S, Farrell NP, Bombard S. Cross-links of quadruplex structures from human telomeric DNA by dinuclear platinum complexes show the flexibility of both structures. Biochemistry 2005; 44:10620–34. 114. Lee JY, Okumus B, Kim DS, Ha TJ. Extreme conformational diversity in human telomeric DNA. Proc Natl Acad Sci USA 2005; 102:18938–43. 115. Wang Y, Patel DJ. Solution structure of the human telomeric repeat d[AG3(T2AG3)3] Gtetraplex. Structure 1993; 1:263–82. 116. Parkinson GN, Lee MPH, Neidle S. Crystal structure of parallel quadruplexes from human telomeric DNA. Nature 2002; 417:876–80. 117. Ambrus A, Chen D, Dai JX, Bialis T, Jones RA, Yang DZ. Human telomeric sequence forms a hybrid-type intramolecular G-quadruplex structure with mixed parallel/antiparallel strands in potassium solution. Nucleic Acids Res 2006; 34:2723–35. 118. Xu Y, Noguchi Y, Sugiyama H. The new models of the human telomere d[AGGG (TTAGGG)(3)] in K+ solution. Bioorg Med Chem 2006; 14:5584–91. 119. Luu KN, Phan AT, Kuryavyi V, Lacroix L, Patel DJ. Structure of the human telomere in K+ solution: An intramolecular (3 + 1) G-quadruplex scaffold. J Am Chem Soc 2006; 128:9963–70. 120. Phan AT, Luu KN, Patel DJ. Different loop arrangements of intramolecular human telomeric (3 + 1) G-quadruplexes in K+ solution. Nucleic Acids Res 2006; 34:5715–9. 121. Phan AT, Kuryavyi V, Luu KN, Patel DJ. Structure of two intramolecular G-quadruplexes formed by natural human telomere sequences in K+ solution. Nucleic Acids Res 2007; 35:6517–25.

278

C. Punchihewa, D. Yang

122. Dai J, Carver M, Yang D. Polymorphism of human telomere quadruplex structures. Biochimie Special Issue ‘‘Targeting DNA’’ 2008; 90:1172–83. 123. Seenisamy J, Rezler EM, Powell TJ, et al. The dynamic character of the G-quadruplex element in the c-MYC promoter and modification by TMPyP4. J Am Chem Soc 2004; 126:8702–9. 124. Phan AT, Modi YS, Patel DJ. Propeller-type parallel-stranded G-quadruplexes in the human c-myc promoter. J Am Chem Soc 2004; 126:8710–6. 125. Sun DY, Guo KX, Rusche JJ, Hurley LH. Facilitation of a structural transition in the polypurine/polypyrimidine tract within the proximal promoter region of the human VEGF gene by the presence of potassium and G-quadruplex-interactive agents. Nucleic Acids Res 2005; 33:6070–80. 126. Phan AT, Kuryavyi V, Burge S, Neidle S, Patel DJ. Structure of an unprecedented G-quadruplex scaffold in the human c-kit promoter. J Am Chem Soc. 2007; 129:4386–92. Epub 2007 Mar 16. 127. Antonacci C, Chaires JB, Sheardy RD. Biophysical characterization of the human telomeric (TTAGGG)(4) repeat in a potassium solution. Biochemistry 2007; 46:4654–60. 128. Li J, Trent JO, Bishop GR, Chaires JB. Uncovering the Energetic Basis of G-Quadruplex Stability, First International Meeting on Quadruplex DNA, Louiville, KY, USA, 2007. 129. De Armond R, Wood S, Sun DY, Hurley LH, Ebbinghaus SW. Evidence for the presence of a guanine quadruplex forming region within a polypurine tract of the hypoxia inducible factor 1 alpha promoter. Biochemistry 2005; 44:16341–50. 130. Rankin S, Reszka AP, Huppert J, et al. Putative DNA quadruplex formation within the human c-kit oncogene. J Am Chem Soc 2005; 127:10584–9. 131. Hurley LH, Von Hoff DD, Siddiqui-Jain A, Yang DZ. Drug targeting of the c-MYC promoter to repress gene expression via a G-quadruplex silencer element. Semin Oncol 2006; 33:498–512. 132. Yang DZ, Hurley LH. Structure of the biologically relevant G-quadruplex in the c-MYC promoter. Nucleosides Nucleotides Nucleic Acids 2006; 25:951–68. 133. Sun D, Thompson B, Cathers BE, Salazar M, Kerwin SM, Trent JO, Jenkins T, Neidle S, Hurley LH. Inhibition of human telomerase by a G-quadruplex-interactive compound. J Med Chem 1997; 40:2113–6. 134. Han HY, Cliff CL, Hurley LH. Accelerated assembly of G-quadruplex structures by a small molecule. Biochemistry 1999; 38:6981–6. 135. Takai H, Smogorzewska A, de Lange T. DNA damage foci at dysfunctional telomeres. Curr Biol 2003; 13:1549–56. 136. d’Adda di Fagagna F, Reaper PM, Clay-Farrace L, et al. A DNA damage checkpoint response in telomere-initiated senescence. Nature 2003; 426:194–8. 137. Kim SH, Beausejour C, Davalos AR, Kaminker P, Heo SJ, Campisi J. TIN2 mediates functions of TRF2 at human telomeres. J Biol Chem 2004; 279:43799–804. 138. Hockemeyer D, Sfeir AJ, Shay JW, Wright WE, de Lange T. POT1 protects telomeres from a transient DNA damage response and determines how human chromosomes end. EMBO J 2005; 24:2667–78. 139. Tauchi T, Shin-ya K, Sashida G, et al. Activity of a novel G-quadruplex-interactive telomerase inhibitor, telomestatin (SOT-095), against human leukemia cells: Involvement of ATMdependent DNA damage response pathways. Oncogene 2003; 22:5338–47. 140. Gomez D, O’Donohue MF, Wenner T, et al. The G-quadruplex ligand telomestatin inhibits POT1 binding to telomeric sequences in vitro and induces GFP-POT1 dissociation from telomeres in human cells. Cancer Res 2006; 66:6908–12. 141. Tahara H, Shin-Ya K, Seimiya H, Yamada H, Tsuruo T, Ide T. G-Quadruplex stabilization by telomestatin induces TRF2 protein dissociation from telomeres and anaphase bridge formation accompanied by loss of the 30 telomeric overhang in cancer cells. Oncogene 2006; 25:1955–66.

11 Therapeutic Targets and Drugs II: G-Quadruplex and G-Quadruplex Inhibitors

279

142. Leonetti C, Amodei S, D’Angelo C, et al. Biological activity of the G-quadruplex ligand RHPS4 (3,11-difluoro-6,8,13-trimethyl-8H-quino[4,3,2-kl]acridinium methosulfate) is associated with telomere capping alteration. Mol Pharmacol 2004; 66:1138–46. 143. Shin-ya K, Wierzba K, Matsuo K, et al. Telomestatin, a novel telomerase inhibitor from Streptomyces anulatus. J Am Chem Soc 2001; 123:1262–3. 144. Kim MY, Vankayalapati H, Shin-Ya K, Wierzba K, Hurley LH. Telomestatin, a potent telomerase inhibitor that interacts quite specifically with the human telomeric intramolecular G-quadruplex. J Am Chem Soc 2002; 124:2098–9. 145. Kim MY, Gleason-Guzman M, Izbicka E, Nishioka D, Hurley LH. The different biological effects of telomestatin and TMPyP4 can be attributed to their selectivity for interaction with intramolecular or intermolecular G-quadruplex structures. Cancer Res 2003; 63:3247–56. 146. Shammas MA, Reis RJS, Li C, et al. Telomerase inhibition and cell growth arrest after telomestatin treatment in multiple myeloma. Clin Cancer Res 2004; 10:770–6. 147. Nakajima A, Tauchi T, Sashida G, et al. Telomerase inhibition enhances apoptosis in human acute leukemia cells: Possibility of antitelomerase therapy. Leukemia 2003; 17:560–7. 148. Sumi M, Tauchi T, Sashida G, et al. A G-quadruplex-interactive agent, telomestatin (SOT095), induces telomere shortening with apoptosis and enhances chemosensitivity in acute myeloid leukemia. Int J Oncol 2004; 24:1481–7. 149. Tauchi T, Shin-ya K, Sashida G, et al. Telomerase inhibition with a novel G-quadruplexinteractive agent, telomestatin: In vitro and in vivo studies in acute leukemia. Oncogene 2006; 25:5719–25. 150. Read M, Cuesta J, Basra I, et al. Rational design approaches to increase the potency of G-quadruplex-mediated telomerase inhibitors. Clin Cancer Res 2001; 7:3797S. 151. Gowan SM, Harrison JR, Patterson L, et al. A G-quadruplex-interactive potent smallmolecule inhibitor of telomerase exhibiting in vitro and in vivo antitumor activity. Mol Pharmacol 2002; 61:1154–62. 152. Burger AM, Dai FP, Schultes CM, et al. The G-quadruplex-interactive molecule BRACO-19 inhibits tumor growth, consistent with telomere targeting and interference with telomerase function. Cancer Res 2005; 65:1489–96. 153. Kelland LR. Overcoming the immortality of tumour cells by telomere and telomerase based cancer therapeutics – current status and future prospects. Eur J Cancer 2005; 41:9719. 154. Taetz S, Baldes C, Murdter TE, et al. Biopharmaceutical characterization of the telomerase inhibitor BRACO19. Pharm Res 2006; 23:1031–7. 155. Cookson JC, Dai F, Smith V, et al. Pharmacodynamics of the G-quadruplex-stabilizing telomerase inhibitor 3,11-difluoro-6,8,13-trimethyl-8H-quino[4,3,2-kl]acridinium methosulfate (RHPS4) in vitro: Activity in human tumor cells correlates with telomere length and can be enhanced, or antagonized, with cytotoxic agents. Mol Pharmacol 2005; 68:1551–8. 156. Phatak P, Cookson JC, Dai F, et al. Telomere uncapping by the G-quadruplex ligand RHPS4 inhibits clonogenic tumour cell growth in vitro and in vivo consistent with a cancer stem cell targeting mechanism. Br J Cancer 2007; 96:1223–33. 157. Kelland L. Targeting the limitless replicative potential of cancer: The telomerase/telomere pathway. Clin Cancer Res 2007; 13:4960–3. 158. Wheelhouse RT, Han FX, Han H, Sun D, Hurley LH. The interaction of telomeraseinhibitory porphyrins with G-quadruplex DNA. Proc Am Assoc Cancer Res 1998; 39:430. 159. Han FXG, Wheelhouse RT, Hurley LH. Interactions of TMPyP4 and TMPyP2 with quadruplex DNA. Structural basis for the differential effects on telomerase inhibition. J Am Chem Soc 1999; 121:3561–70. 160. Izbicka E, Nishioka D, Marcell V, et al. Telomere-interactive agents affect proliferation rates and induce chromosomal destabilization in sea urchin embryos. Anti-Cancer Drug Design 1999; 14:355–65. 161. Siddiqui-Jain A, Grand CL, Bearss DJ, Hurley LH. Direct evidence for a G-quadruplex in a promoter region and its targeting with a small molecule to repress c-MYC transcription. Proc Natl Acad Sci USA 2002; 99:11593–8.

280

C. Punchihewa, D. Yang

162. Grand CL, Han H, Munoz RM, et al. The cationic porphyrin TMPyP4 down-regulates c-MYC and human telomerase reverse transcriptase expression and inhibits tumor growth in vivo. Mol Cancer Ther 2002; 1:565–73. 163. Guliaev AB, Leontis NB. Cationic 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl)porphyrin fully intercalates at 50 -CG-30 steps of duplex DNA in solution. Biochemistry 1999; 38:15425–37. 164. Uno T, Hamasaki K, Tanigawa M, Shimabayashi S. Binding of meso-Tetrakis(N-methylpyridinium-4-yl)porphyrin to Double Helical RNA and DNA·RNA Hybrids. Inorg Chem 1997; 36:1676–83. 165. Lee YA, Kim JO, Cho TS, Song R, Kim SK. Binding of meso-Tetrakis(N-methylpyridium4-yl)porphyrin to triplex oligonucleotides: Evidence for the porphyrin stacking in the major groove. J Am Chem Soc 2003; 125:8106–7. 166. Dixon IM, Lopez F, Tejera AM, et al. A G-quadruplex ligand with 10000-fold selectivity over duplex DNA. J Am Chem Soc 2007; 129:1502–3. 167. Gomez D, Aouali N, Londono-Vallejo A, et al. Resistance to the short term antiproliferative activity of the G-quadruplex ligand 12459 is associated with telomerase overexpression and telomere capping alteration. J Biol Chem 2003; 278:50554–62. 168. Douarre C, Gomez D, Morjani H, et al. Overexpression of Bcl-2 is associated with apoptotic resistance to the G-quadruplex ligand 12459 but is not sufficient to confer resistance to longterm senescence. Nucleic Acids Res 2005; 33:2192–203. 169. Gomez D, Lemarteleur T, Lacroix L, Mailliet P, Mergny J-L, Riou J-F. Telomerase downregulation induced by the G-quadruplex ligand 12459 in A549 cells is mediated by hTERT RNA alternative splicing. Nucleic Acids Res 2004; 32:371–79. 170. Lemarteleur T, Gomez D, Paterski R, Mandine E, Mailliet P, Riou J-F. Stabilization of the c-myc gene promoter quadruplex by specific ligands’ inhibitors of telomerase. Biochem Biophys Res Commun 2004; 323:802–8. 171. Pennarun G, Granotier C, Gauthier LR, Gomez D, Boussin FD. Apoptosis related to telomere instability and cell cycle alterations in human glioma cells treated by new highly selective G-quadruplex ligands. Oncogene 2005; 24:2917–28. 172. De Cian A, Mergny JL. Quadruplex ligands may act as molecular chaperones for tetramolecular quadruplex formation. Nucleic Acids Res 2007; 35:2483–93. 173. Sun D, Thompson B, Cathers BE, et al. Inhibition of human telomerase by a G-quadruplexinteractive compound. J Med Chem 1997; 40:2113–16. 174. Duan WH, Rangan A, Vankayalapati H, et al. Design and synthesis of fluoroquinophenoxazines that interact with human telomeric G-quadruplexes and their biological effects. Mol Cancer Ther 2001; 1:103–20.

Chapter 12

Therapeutic Targets and Drugs III: Tankyrase 1, Telomere-Binding Proteins, and Inhibitors Hiroyuki Seimiya and Takashi Tsuruo

Abstract Telomere maintenance by telomerase enables cancer cells to proliferate indefinitely. Telomerase inhibitors resume the end replication problem and gradually shorten telomeres in telomerase-positive cancer cells. Critically shortened telomeres elicit a DNA damage response and induce senescence, apoptosis, or both. Accordingly, telomerase inhibition is one of the rational strategies for cancer therapy. Meanwhile, there are increasing numbers of telomere-binding proteins that maintain telomere integrity. Among them, tankyrase 1, a telomeric poly(ADP-ribose) polymerase, is one of the most druggable targets, whose enzymatic inhibition enhances the anticancer impact of telomerase inhibitors. Telomere capping is accomplished by sufficient lengths of double- and single-stranded telomeric DNA and their association with shelterin, which consists of TRF1, TRF2, TIN2, Rap1, TPP1, and POT1. Disruption of shelterin function leads to prompt telomere decapping, followed by DNA damage response and growth inhibition. In this chapter, we review telomere length regulation by tankyrase 1 and telomere protection by TRF2 and POT1, as potential target events for telomere-directed molecular cancer therapeutics. Keywords: Tankyrase 1, TRF1, Poly(ADP-ribosyl)ation, 30 -Overhang, Shelterin, TRF2, POT1.

12.1

Introduction: Molecular Targeting Therapy of Cancer

Anticancer drugs are given for various types of advanced cancers, including invasive and metastatic tumors, and they are also employed as a pre- and postoperative adjuvant chemotherapy (1). Historically, anticancer drugs were developed according to the idea that more potent cytotoxicity might lead to a better anticancer effect. As a result, most classical anticancer drugs function against DNA, microtubules, H. Seimiya(*) Division of Molecular Biotherapy, Cancer Chemotherapy Center, Japanese Foundation for Cancer Research, 3-10-6 Ariake, Koto-ku, Tokyo 135-8550, Japan, e-mail: [email protected]

K. Hiyama (ed.), Telomeres and Telomerase in Cancer. DOI: 10.1007/978-1-60327-879-9_12, # Humana Press, a part of Springer Science + Business Media, LLC 2009 281

282

H. Seimiya, T. Tsuruo

and enzymes that are involved in metabolism of nucleic acids. These intracellular molecules are essential for cell proliferation and are the Achilles’ heel of most cancer cells, which exhibit robust proliferating potential. Since all of these molecular targets commonly exist in normal cells, cells in highly proliferative tissues could also suffer cytotoxicity as a result of these drugs. Thus, risk of undesirable side effects largely limits the application of conventional anticancer drugs. In early 1990s, there emerged a new concept – molecular targeting therapy. This concept is based on our accumulating knowledge of the molecular mechanisms of carcinogenesis and malignant progression of cancer. Ideally, molecular targeting drugs discriminate among molecular alterations (e.g., constitutively activated oncogenes) that are observed in cancer but not in normal cells or tissues. According to this concept, one can expect much higher pharmacological specificity of the drugs targeted to cancer cells than to normal cells. To date, we have various types of molecular targeting drugs, such as an epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor, gefitinib (2), a bcr-abl tyrosine kinase inhibitor, imatinib (3), and anti-HER2/erbB2 humanized monoclonal antibody, trastuzumab (4). These drugs have achieved clinical success in treating cancer patients. Still, efficacy of these molecular targeting drugs has been restricted to a subpopulation of the wide range of cancer patients. Also, even in case of patients who experience benefit from those drugs, relapse of the drug-resistant cancers with a poor prognosis has been seen as a serious problem. Based on this background, it is very important to identify new therapeutic molecular targets and to develop methods that allow us to manipulate the functions of those targets. In this chapter, we review several telomere-related proteins, such as tankyrase 1 and shelterin components, as potential targets for telomere-directed cancer therapy. The basic details of telomere-binding proteins are covered in Chap. 2.

12.2

Telomerase Inhibition as an Anticancer Strategy

Because the classical replication machinery cannot replicate the very ends of linear chromosome DNA (end replication problem) (5), the telomeres would gradually shorten after each cell cycle (6, 7). In 80–90% of cancer cells, average telomere length is stabilized by the balance between telomerase-mediated telomere synthesis (8–10) and in cis inhibition of telomere access to telomerase by telomeric repeatbinding factor 1 (TRF1) and associated shelterin components (Fig. 12.1) (11). Since the absence of telomerase would allow the end replication problem to resume, telomere synthesis by telomerase is the Achilles’ heel of cancer cell immortality. Continuous treatment of cancer cells with nontoxic doses of telomerase inhibitory drugs shortens telomeres (12–15). Eventually, critically shortened telomeres are recognized as DNA double-strand breaks (16) and induce cellular senescence, apoptosis, or both. Thus, telomerase inhibitors have the potential to benefit cancer patients as novel anticancer drugs (17). Details about telomerase inhibitors are reviewed in Chap. 10.

12 Therapeutic Targets and Drugs III

283

Fig. 12.1 Resistance to telomerase inhibitors by telomere shortening. While telomerase synthesizes telomeric DNA de novo, telomere length of a telomerase-positive cell is usually stabilized at a constant average value. This is due to in cis inhibition of telomerase by a telomeric protein TRF1 (and associated shelterin components; see text and Fig. 12.2). Thus, longer telomeres contain larger amounts of TRF1 and are less accessible to telomerase. In contrast, shorter telomeres have less TRF1 and allow easier access to telomerase. Telomerase inhibitory drugs shorten telomeres, and coincidentally, reduce TRF1 loading on a chromosome end. This situation enhances access of residual telomerase activity to the shortened telomeres. If the drug-induced telomere shortening is saturated at a certain length before it gets critically short, the cell becomes resistant to the drug

One concern with this anticancer therapeutic strategy is that telomere shortening per se could compromise the effect of telomerase inhibitors, since shorter telomeres have fewer TRF1, which limits the telomere access to telomerase (18). Thus, chromosome ends with shorter telomeres allow easier access to residual telomerase activity, which in turn maintains minimal but sufficient telomere length to protect the chromosome ends (Fig. 12.1). This phenomenon results from incomplete shutdown of telomerase activity by telomerase inhibitors. Another issue is that to achieve the anticancer effect of a telomerase inhibitor, telomeres must shorten sufficiently to disrupt their capping function. This implies that telomerase inhibitors need to be continuously treated for a long duration. To solve these problems, one could manipulate the function of other telomere-related proteins that modulate the telomeric function of telomerase.

12.3

Telomere Length Regulation by TRF1 and Tankyrase 1

In addition to the enzyme activity, accessibility to telomeres could be a rational target for telomerase inhibition. As described earlier, TRF1 represses telomere access to telomerase. TRF1 binds its partner, TIN2 (TRF1-interacting nuclear

284

H. Seimiya, T. Tsuruo

protein 1) (19), which in turn binds to another protein called TPP1 (formerly named TINT1, PTOP, or PIP1 by three independent laboratories) (20–22). TPP1 then recruits the single-strand telomere binding protein, POT1 (protection of telomere 1) (23, 24), to the 30 -overhang (also called the G-tail) of telomeric DNA. These TRF1-TIN2-TPP1-POT1 complexes, which are a part of shelterin (see Chap. 2) (25), render the telomeric heterochromatin closed and lessen its elongation by telomerase (Fig. 12.2a). Tankyrase 1 is an enzyme that directly downregulates telomere binding of TRF1 (26). This 142-kDa protein, mainly consisting of a long stretch of ligand-binding ankyrin (ANK) repeats and a C-terminal catalytic domain, is a member of the poly (ADP-ribose) polymerase (PARP) family. By using NAD as a substrate, tankyrase 1 poly (ADP-ribosyl) ates (PARsylates) TRF1. This posttranslational modification of TRF1 gives a drastic negative charge to TRF1 and eliminates its ability to bind telomeric DNA (26–28). Thus, PARsylated TRF1 dissociates from telomeres and is subjected to subsequent degradation by the ubiquitin-proteasome pathway (29). The resulting telomeres have fewer numbers of TRF1 (and shelterin) and exhibit higher accessibility to telomerase (Fig. 12.2b). In fact, ectopic overexpression of tankyrase 1 increases the telomere size (28, 30) whereas its knockdown by RNA a

Telomere DNA TIN2 TPP1 POT1

CAAUCCCAAUC

3’

TRF1 Tankyrase 1

Tankyrase 1

TRF1 PARsylation by tankyrase 1

3’-overhang (G-tail)

Telomerase inhibitors

5’

Telomerase

Tankyrase 1 inhibition by chemical compounds (e.g., PARP inhibitors)

b Telomere elongation by telomerase CAAUCCCAAUC

3’

5’

Telomerase inhibitors

PARsylated TRF1

Fig. 12.2 Tankyrase 1 inhibition enhances the effect of telomerase inhibitors. Telomere elongation by telomerase not only requires its enzyme activity but also its access to telomeres. (a) The TRF1-containing shelterin complex binds to the telomeres and represses telomere access to telomerase. (b) Tankyrase 1 PARsylates TRF1, which leads to dissociation of the TRF1-containing shelterin from telomeres and enhances the association between telomeres and telomerase. Simultaneous blockade of telomerase and tankyrase 1 improves the efficiency of telomere shortening and hastens telomere crisis in cancer cells (a). In contrast, tankyrase 1 upregulation lessens the effect of telomerase inhibitors by enhancing telomere access to residual telomerase activity (b)

12 Therapeutic Targets and Drugs III

285

interference shortens telomeres in telomerase-positive cancer cells (31). These observations establish tankyrase 1 as a positive regulator for telomere length in telomerase-positive cells.

12.4

Tankyrase 1 Inhibition Enhances the Anticancer Impact of Telomerase Inhibitors

Tankyrase 1 could be a molecular target for telomere-directed cancer therapeutics, since it modulates the impact of telomerase inhibitors on human cancer cells (18, 32). First, tankyrase 1 overexpression, which represses TRF1 and thereby enhances telomere access to residual telomerase activity, confers resistance to telomerase inhibitors (Fig. 12.2b). For example, the synthetic telomerase inhibitor MST-312 induces progressive shortening of telomeres and subsequent senescence and apoptosis in telomerase-positive cancer cells (14). If tankyrase 1 is overexpressed in the cells, telomere access to residual telomerase activity is enhanced and telomere shortening by MST-312 is not observed (18). PARP inhibitors, such as 3aminobenzamide (3AB) and PJ-34, effectively inhibit tankyrase 1 PARP activity in intact cells (18). These PARP inhibitors reverse tankyrase 1-mediated resistance to MST-312 (18). Second, even in cells that do not overexpress exogenous tankyrase1 (but do express endogenous tankyrase-1) these PARP inhibitors enhance telomere shortening by means of telomerase inhibitors. Accordingly, the cells undergo earlier crisis with shorter drug treatment duration (Fig. 12.2a) (18). 3AB also reverses the earlier described telomerase inhibitor resistance, which is caused by telomere shortening per se (Fig. 12.1) (18). Meanwhile, 3AB does not accelerate telomere shortening in normal human fibroblasts. These observations suggest that tankyrase 1 could be a novel anticancer molecular target, the blockade of which improves the pharmacological efficacy of telomerase inhibitors against cancer cells. Since presently available PARP inhibitors are effective against essentially all PARP members (33), development of tankyrase 1-specific inhibitors would be the next challenging issue for clinical applications of this strategy. Blocking TRF1 binding to ANK domain of tankyrase 1 (34, 35) could be a candidate to specifically inhibit telomeric function of tankyrase 1.

12.5

Tankyrase 1 Expression and Nontelomeric Function

Whether function of tankyrase 1 is enhanced in cancer cells or not is still an open question. Tankyrase 1 expression is ubiquitously observed in normal tissues, among which testis and ovary exhibit the highest expression (26, 30). Tankyrase 1 has a closely related homologue, tankyrase 2, which also exhibits ubiquitous expression (30). Functional redundancy and specificity of tankyrase 1 and 2 remain unknown.

286

H. Seimiya, T. Tsuruo

Pathologically, tankyrase 1 gene expression is elevated in some tumors but not in others. Xu et al. have reported that tankyrase 1 gene expression is upregulated concomitant with telomerase activation in multiple myeloma and plasma cell leukemia (36), whereas Gelmini et al. have demonstrated that the levels of tankyrase 1 expression in breast cancers are significantly higher than those in normal tissue (37). By contrast, Yamada et al. reported that tankyrase 1 gene expression is not upregulated in gastric cancers (38). At a cellular level, tankyrase 1 is not only present at the telomeres but also at the Golgi apparatus, mitotic centrosomes, and nuclear pore complexes (27, 39). Since telomere elongation by tankyrase 1 is only seen when it is located in the nucleus (not in the cytoplasm) (18, 28), monitoring its intracellular localization might be preferable to determine the difference in tankyrase 1 behavior between normal and cancer cells. Interestingly, tankyrase 1 knockdown by siRNA induces mitotic arrest at anaphase, where sister chromatids remain attached only at the telomeres (40). This telomere cohesion is resolved by knocking down both TRF1 and TIN2 or by knocking down the SA1 ortholog of the cohesin Scc3 subunit (41). Another report has shown that tankyrase 1 knockdown leads to abnormalities in assembly and structure of the mitotic spindles (42). These observations indicate a functional involvement of tankyrase 1 in mitosis. There is cross-species difference in telomeric function of tankyrase 1. As described earlier, telomere elongation by tankyrase 1 requires PARsylation of TRF1. Human and several other mammalian TRF1 have a canonical tankyrase 1-binding motif, RXX(P/A)DG (43). Mouse TRF1 has no such motif and thereby is not PARsylated by tankyrase 1 (31, 44). Accordingly, mouse TRF1 is resistant to tankyrase 1-mediated release from telomeres. Since mice have much higher telomerase activity in their somatic tissues and much longer telomeres than do other mammals, mice might have evolved to resign tankyrase 1-mediated telomere maintenance system. Using the mouse system as a therapeutic model would require attention to this cross-species difference in the property of tankyrase 1.

12.6

Telomere Integrity Maintenance by the 30 -Overhang and the T-Loop Structure

In addition to telomeric DNA length, status of the ultimate ends of telomeres is important to maintain chromosome integrity. Functionally intact telomeres can form a potentially protective structure, t loop, in which the single-stranded 30 overhang folds back and invades the double-stranded region (45). In other words, t-loop formation depends on the presence of the 30 -overhang. The 30 -overhang, as well as the double-stranded telomeric DNA, is eroded at replicative senescence (46). Loss of the 30 -overhang leads to prompt telomere decapping, even if they are not critically short (47, 48). Thus, telomeres that lack the 30 -overhang form endto-end fusion of chromosomes and induce cellular senescence or ATM- and

12 Therapeutic Targets and Drugs III Shelterin complex TPP1 TPP1 TIN2 TIN2

POT1 POT1

287 ATM

ATR TPP1 TIN2 TIN2 TPP1

POT1 POT1 5’ TTAGGGTTAGGGTT 3’ TRF2 TRF2 TRF1 TRF2 GGGTTAGGGTTAGGG TRF2AGGGTTAGGGTTAGGGTTA TRF1 3’ AATCCCAATCCCAAT CCCAATCCCAATCCCAATC 5’

T-loop formation

Rap1 Rap1

Rap1 Rap1

Shelterin inhibition by chemical compounds (e.g., G-quadruplex ligands) ATM TPP1 TPP1 TIN2 TIN2

ATR

POT1 POT1

5’ TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG 3’ TRF1 TRF1 5’ 3’ AATCCCAATCCCAATCCCAATCCCAATCCCAATC

DNA damage response

G-tail processing by TRF2 dissociation TPP1 TPP1 TIN2 TIN2

POT1 POT1

5’ TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAG 3’ TRF1 TRF1 5’ 3’ AATCCCAATCCCAATCCCAATCCCAATCCCAATC

NHEJ

Fig. 12.3 Shelterin inhibition induces prompt telomere decapping. The TRF2-containing shelterin complex mediates telomere capping by maintaining the 30 -overhang (G-tail) and the t-loop structure. Loss of TRF2 derepresses ATM and elicits DNA damage signaling. TRF2 dissociation from telomeres also induces G-tail processing, which in turn leads to nonhomologous end joining (NHEJ). Loss of POT1 or TPP1, which is required for telomere protection by POT1, reactivates the ATR DNA damage signaling at telomeres, presumably because the POT1-free G-tail allows RPA to bind. Some chemical compounds, such as telomestatin, dissociate both TRF2 and POT1 from telomeres, resulting in acute telomere dysfunction

p53-dependent apoptosis. Accordingly, agents that modulate the status of the 30 -overhang may be utilized for prompt cell growth inhibition, even in the case of cells that have long telomeres. The vertebrate telomeric sequence is (TTAGGG)n, and its 30 -overhang can form a guanine quadruplex structure (G-quadruplex). Some telomerase inhibitors, such as telomestatin, stabilize the G-quadruplex and block telomere extension by telomerase (49). Notably, this type of telomerase inhibitor promptly induces telomere decapping, presumably by disrupting the 30 -overhang integrity and the t-loop structure (Fig. 12.3). For example, telomestatin decreases the size of the 30 -overhang and exhibits a very rapid antiproliferative effect on cancer cells (50–53). The G-quadruplex and agents that target it are extensively described in Chap. 11.

12.7

Shelterin Components as Candidates for Anticancer Molecular Targets

Telomere integrity requires shelterin, a complex of specific telomere-binding proteins that include TRF1, TRF2, TIN2, Rap1, TPP1, and POT1 (25). Among these shelterin components, TRF2 (telomeric repeat-binding factor 2) and POT1

288

H. Seimiya, T. Tsuruo

play a central role for telomere capping. TRF2 directly binds the double-stranded telomeric DNA whereas POT1 binds the 30 -overhang. Furthermore, TRF2 forms a proteinous shelterin complex with POT1 via the linking proteins TIN2 and TPP1. TPP1 is required for telomere protection by POT1 (54). TRF2 and POT1 protect telomeres from DNA damage response by repressing the ATM and the ATR kinase signaling pathways, respectively (55). Loss-of-function of TRF2 or POT1, either by overexpression of dominant negative alleles or by gene disruption, promptly elicits DNA damage response at telomeres and induces senescence or apoptosis (Fig. 12.3) (47, 48, 55–59). These observations suggest that blocking telomere binding of TRF2 or POT1 could be another anticancer therapeutic strategy. For example, telomestatin reduces telomere binding of TRF2 and POT1 and shortens the 30 overhang, resulting in prompt telomere decapping (50–53). The TRF2 gene is expressed at higher levels in 60% of gastric cancers than in normal mucosa, suggesting a role of TRF2 in cancer (60). Intriguingly, mice that overexpress TRF2 in the skin show critically short telomeres and are susceptible to UV-induced carcinogenesis (61). Moreover, in the absence of telomerase, TRF2 acts as a very potent oncogene to accelerate epithelial cancers with an alternative lengthening of telomeres (ALT) phenotype (62). Details about ALT are reviewed in Chap. 5. Because telomerase inhibition could induce a resistant fraction of cancer cells with ALT activation, targeting TRF2 might be the second strategy to treat such refractory tumors. Still, whether inhibition of TRF2 function specifically inhibits cancer cell growth remains unknown, because TRF2 is an essential component of telomere protection in normal cells as well. According to the report by Kondo et al., POT1 mRNA expression is associated with tumor stage in gastric cancers (63). The authors have shown that downregulation of POT1 expression is frequently observed in stage I/II tumors whereas its upregulation is seen more often in stage III/IV. Humans have a single POT1 gene, but mice have two orthologs, POT1a and POT1b. Although POT1a blocks a DNA damage signal at the telomeres, POT1b regulates the length of the 30 -overhang (58, 59). Genetic disruption of POT1a elicits telomeric DNA damage response and p53dependent senescence. Similarly, telomestatin reduces POT1 binding to telomeres and exhibits an anticancer effect. Since POT1, as well as TRF2, is an essential component of telomere capping, the effect of POT1 inhibition on normal cells should be carefully studied.

12.8

Conclusion and Perspective

Paradoxically, telomere shortening by telomerase inhibitors would induce resistance to telomerase inhibitors by enhancing telomere access to residual telomerase activity. Tankyrase 1 inhibition by PARP inhibitors reduces the telomere access to telomerase and increases the efficiency of telomere shortening by telomerase inhibitors. Since the PARP family consists of at least 17 members (64), development of tankyrase 1-selective inhibitors may be required for better clinical

12 Therapeutic Targets and Drugs III

289

outcome. Among six components of the shelterin complex, TRF2 and POT1 could be the therapeutic targets because their inhibition induces prompt telomere decapping. However, since these proteins are widely distributed in normal cells, potential adverse effects should be carefully evaluated. Because maintaining telomere integrity involves DNA damage response factors, manipulating telomere-binding proteins may also render cancer cells more sensitive to DNA damage-inducing anticancer drugs and to irradiation.

References 1. Chabner BA, Roberts TG, Jr. Timeline: Chemotherapy and the war on cancer. Nat Rev Cancer 2005;5:65–72. 2. Ono M, Kuwano M. Molecular mechanisms of epidermal growth factor receptor (EGFR) activation and response to gefitinib and other EGFR-targeting drugs. Clin Cancer Res 2006;12:7242–51. 3. Hunter T. Treatment for chronic myelogenous leukemia: The long road to imatinib. J Clin Invest 2007;117:2036–43. 4. Nahta R, Esteva FJ. Trastuzumab: Triumphs and tribulations. Oncogene 2007;26:3637–43. 5. Ohki R, Tsurimoto T, Ishikawa F. In vitro reconstitution of the end replication problem. Mol Cell Biol 2001;21:5753–66. 6. Harley CB, Futcher AB, Greider CW. Telomeres shorten during ageing of human fibroblasts. Nature 1990;345:458–60. 7. Hastie ND, Dempster M, Dunlop MG, Thompson AM, Green DK, Allshire RC. Telomere reduction in human colorectal carcinoma and with ageing. Nature 1990;346:866–8. 8. Kim NW, Piatyszek MA, Prowse KR, et al. Specific association of human telomerase activity with immortal cells and cancer. Science 1994;266:2011–15. 9. Shay JW, Bacchetti S. A survey of telomerase activity in human cancer. Eur J Cancer 1997;33:787–91. 10. Hiyama E, Hiyama K. Telomerase as tumor marker. Cancer Lett 2003;194:221–33. 11. Smogorzewska A, de Lange T. Regulation of telomerase by telomeric proteins. Annu Rev Biochem 2004;73:177–208. 12. Damm K, Hemmann U, Garin-Chesa P, et al. A highly selective telomerase inhibitor limiting human cancer cell proliferation. EMBO J 2001;20:6958–68. 13. White LK, Wright WE, Shay JW. Telomerase inhibitors. Trends Biotechnol 2001;19: 114–20. 14. Seimiya H, Oh-hara T, Suzuki T, et al. Telomere shortening and growth inhibition of human cancer cells by novel synthetic telomerase inhibitors, MST-312, MST-295, and MST-199. Mol Cancer Ther 2002;1:657–65. 15. Dikmen ZG, Gellert GC, Jackson S, et al. In vivo inhibition of lung cancer by GRN163L: A novel human telomerase inhibitor. Cancer Res 2005;65:7866–73. 16. d’Adda di Fagagna F, Reaper PM, Clay-Farrace L, et al. A DNA damage checkpoint response in telomere-initiated senescence. Nature 2003;426:194–8. 17. Shay JW, Wright WE. Telomerase: A target for cancer therapeutics. Cancer Cell 2002;2:257–65. 18. Seimiya H, Muramatsu Y, Ohishi T, Tsuruo T. Tankyrase 1 as a target for telomere-directed molecular cancer therapeutics. Cancer Cell 2005;7:25–37. 19. Kim SH, Kaminker P, Campisi J. TIN2, a new regulator of telomere length in human cells. Nat Genet 1999;23:405–12.

290

H. Seimiya, T. Tsuruo

20. Liu D, Safari A, O’Connor MS, et al. PTOP interacts with POT1 and regulates its localization to telomeres. Nat Cell Biol 2004;6:673–80. 21. Ye JZ, Hockemeyer D, Krutchinsky AN, et al. POT1-interacting protein PIP1: A telomere length regulator that recruits POT1 to the TIN2/TRF1 complex. Genes Dev 2004;18: 1649–54. 22. Houghtaling BR, Cuttonaro L, Chang W, Smith S. A dynamic molecular link between the telomere length regulator TRF1 and the chromosome end protector TRF2. Curr Biol 2004;14:1621–31. 23. Baumann P, Cech TR. Pot1, the putative telomere end-binding protein in fission yeast and humans. Science 2001;292:1171–5. 24. Loayza D, de Lange T. POT1 as a terminal transducer of TRF1 telomere length control. Nature 2003;423:1013–18. 25. de Lange T. Shelterin: The protein complex that shapes and safeguards human telomeres. Genes Dev 2005;19:2100–10. 26. Smith S, Giriat I, Schmitt A, de Lange T. Tankyrase, a poly(ADP-ribose) polymerase at human telomeres. Science 1998;282:1484–7. 27. Smith S, de Lange T. Cell cycle dependent localization of the telomeric PARP, tankyrase, to nuclear pore complexes and centrosomes. J Cell Sci 1999;112:3649–56. 28. Smith S, de Lange T. Tankyrase promotes telomere elongation in human cells. Curr Biol 2000;10:1299–302. 29. Chang W, Dynek JN, Smith S. TRF1 is degraded by ubiquitin-mediated proteolysis after release from telomeres. Genes Dev 2003;17:1328–33. 30. Cook BD, Dynek JN, Chang W, Shostak D, Smith S. A role for the related poly(ADP-ribose) polymerases tankyrase 1 and 2 at human telomeres. Mol Cell Biol 2002;22:332–42. 31. Donigian JR, de Lange T. The role of the poly(ADP-ribose) polymerase tankyrase1 in telomere length control by the TRF1 component of the shelterin complex. J Biol Chem 2007;282:22662–7. 32. Seimiya H. The telomeric PARP, tankyrases, as targets for cancer therapy. Br J Cancer 2006;94:341–5. 33. Jagtap P, Szabo C. Poly(ADP-ribose) polymerase and the therapeutic effects of its inhibitors. Nat Rev Drug Discov 2005;4:421–40. 34. Seimiya H, Smith S. The telomeric poly(ADP-ribose) polymerase, tankyrase 1, contains multiple binding sites for telomeric repeat binding factor 1 (TRF1) and a novel acceptor, 182-kDa tankyrase-binding protein (TAB182). J Biol Chem 2002;277:14116–26. 35. Seimiya H, Muramatsu Y, Smith S, Tsuruo T. Functional subdomain in the ankyrin domain of tankyrase 1 required for poly(ADP-ribosyl)ation of TRF1 and telomere elongation. Mol Cell Biol 2004;24:1944–55. 36. Xu D, Zheng C, Bergenbrant S, et al. Telomerase activity in plasma cell dyscrasias. Br J Cancer 2001;84:621–5. 37. Gelmini S, Poggesi M, Distante V, et al. Tankyrase, a positive regulator of telomere elongation, is over expressed in human breast cancer. Cancer Lett 2004;216:81–7. 38. Yamada M, Tsuji N, Nakamura M, et al. Down-regulation of TRF1, TRF2 and TIN2 genes is important to maintain telomeric DNA for gastric cancers. Anticancer Res 2002;22:3303–7. 39. Chi N.-W., Lodish HF. Tankyrase is a Golgi-associated mitogen-activated protein kinase substrate that interacts with IRAP in GLUT4 vesicles. J Biol Chem 2000;275:38437–44. 40. Dynek JN, Smith S. Resolution of sister telomere association is required for progression through mitosis. Science 2004;304:97–100. 41. Canudas S, Houghtaling BR, Kim JY, Dynek JN, Chang WG, Smith S. Protein requirements for sister telomere association in human cells. EMBO J 2007;26:4867–78. 42. Chang P, Coughlin M, Mitchison TJ. Tankyrase-1 polymerization of poly(ADP-ribose) is required for spindle structure and function. Nat Cell Biol 2005;7:1133–9.

12 Therapeutic Targets and Drugs III

291

43. Sbodio JI, Chi N.-W. Identification of a tankyrase-binding motif shared by IRAP, TAB182, and human TRF1 but not mouse TRF1. NuMA contains this RXXPDG motif and is a novel tankyrase partner. J Biol Chem 2002;277:31887–92. 44. Muramatsu Y, Ohishi T, Sakamoto M, Tsuruo T, Seimiya H. Cross-species difference in telomeric function of tankyrase 1. Cancer Sci 2007;98:850–7. 45. Griffith JD, Comeau L, Rosenfield S, et al. Mammalian telomeres end in a large duplex loop. Cell 1999;97:503–14. 46. Stewart SA, Ben-Porath I, Carey VJ, O’Connor BF, Hahn WC, Weinberg RA. Erosion of the telomeric single-strand overhang at replicative senescence. Nat Genet 2003;33:492–6. 47. Karlseder J, Broccoli D, Dai Y, Hardy S, de Lange T. p53- and ATM-dependent apoptosis induced by telomeres lacking TRF2. Science 1999;283:1321–5. 48. van Steensel B, Smogorzewska A, de Lange T. TRF2 protects human telomeres from end-toend fusions. Cell 1998;92:401–13. 49. Shin-ya K, Wierzba K, Matsuo K, et al. Telomestatin, a novel telomerase inhibitor from Streptomyces anulatus. J Am Chem Soc 2001;123:1262–3. 50. Tahara H, Shin-Ya K, Seimiya H, Yamada H, Tsuruo T, Ide T. G-quadruplex stabilization by telomestatin induces TRF2 protein dissociation from telomeres and anaphase bridge formation accompanied by loss of the 30 telomeric overhang in cancer cells. Oncogene 2006;25:1955–66. 51. Gomez D, Wenner T, Brassart B, et al. Telomestatin-induced telomere uncapping is modulated by POT1 through G-overhang extension in HT1080 human tumor cells. J Biol Chem 2006;281:38721–9. 52. Gomez D, O’Donohue MF, Wenner T, et al. The G-quadruplex ligand telomestatin inhibits POT1 binding to telomeric sequences in vitro and induces GFP-POT1 dissociation from telomeres in human cells. Cancer Res 2006;66:6908–12. 53. Tauchi T, Shin-ya K, Sashida G, et al. Telomerase inhibition with a novel G-quadruplexinteractive agent, telomestatin: In vitro and in vivo studies in acute leukemia. Oncogene 2006;25:5719–25. 54. Hockemeyer D, Palm W, Else T, et al. Telomere protection by mammalian Pot1 requires interaction with Tpp1. Nat Struct Mol Biol 2007;14:754–61. 55. Denchi EL, de Lange T. Protection of telomeres through independent control of ATM and ATR by TRF2 and POT1. Nature 2007;448:1068–71. 56. Celli GB, de Lange T. DNA processing is not required for ATM-mediated telomere damage response after TRF2 deletion. Nat Cell Biol 2005;7:712–18. 57. He H, Multani AS, Cosme-Blanco W, et al. POT1b protects telomeres from end-to-end chromosomal fusions and aberrant homologous recombination. EMBO J 2006;25:5180–90. 58. Wu L, Multani AS, He H, et al. Pot1 deficiency initiates DNA damage checkpoint activation and aberrant homologous recombination at telomeres. Cell 2006;126:49–62. 59. Hockemeyer D, Daniels JP, Takai H, de Lange T. Recent expansion of the telomeric complex in rodents: Two distinct POT1 proteins protect mouse telomeres. Cell 2006;126:63–77. 60. Matsutani N, Yokozaki H, Tahara E, et al. Expression of telomeric repeat binding factor 1 and 2 and TRF1-interacting nuclear protein 2 in human gastric carcinomas. Int J Oncol 2001;19:507–12. 61. Munoz P, Blanco R, Flores JM, Blasco MA. XPF nuclease-dependent telomere loss and increased DNA damage in mice overexpressing TRF2 result in premature aging and cancer. Nat Genet 2005;37:1063–71. 62. Blanco R, Munoz P, Flores JM, Klatt P, Blasco MA. Telomerase abrogation dramatically accelerates TRF2-induced epithelial carcinogenesis. Genes Dev 2007;21:206–20. 63. Kondo T, Oue N, Yoshida K, et al. Expression of POT1 is associated with tumor stage and telomere length in gastric carcinoma. Cancer Res 2004;64:523–9. 64. Schreiber V, Dantzer F, Ame JC, de Murcia G. Poly(ADP-ribose): Novel functions for an old molecule. Nat Rev Mol Cell Biol 2006;7:517–28.

Chapter 13

Therapeutic Targets and Drugs IV: Telomerase-Specific Gene and Vector-Based Therapies for Human Cancer Toshiyoshi Fujiwara, Yasuo Urata, and Noriaki Tanaka

Abstract Recent advances in genetic engineering technology have opened a new avenue of gene- and vector-based therapies for human cancer. For targeting cancer cells, there is a need for tissue- or cell-specific promoters that can express in diverse tumor types but are silent in normal cells. Genetic approaches fostered remarkable insights into the molecular basis of neoplasm, and a number of oncotropic vectors have been thus generated with exceptional properties regarding tumor-restricted specificity. Human telomerase is highly active in more than 85% of primary cancers, regardless of their tissue origins, and its activity correlates closely with human telomerase reverse transcriptase (hTERT) expression. Since only tumor cells that express telomerase activity would activate this promoter, the hTERT proximal promoter allows for preferential expression of therapeutic genes in tumor cells. Moreover, oncolytic viruses that combine the specificity of hTERT promoterbased expression systems with the lytic efficacy of replicative viruses are being developed as novel anticancer therapeutics and are currently undergoing the clinical trial. Although these strategies need further refinement to succeed clinically, the hTERT promoter confers competence for selective replication of virus in human cancer, an outcome that has important implications for the treatment of human cancers. This article reviews recent findings in this rapidly evolving field: cancer therapeutic and cancer diagnostic approaches using the hTERT promoter. Keywords: Telomerase, hTERT, Adenovirus, GFP, Imaging.

T. Fujiwara(*) Center for Gene and Cell Therapy, Okayama University Hospital, 2-5-1 Shikata-cho, Okayama 700-8558, Japan, e-mail: [email protected] K. Hiyama (ed.), Telomeres and Telomerase in Cancer. DOI: 10.1007/978-1-60327-879-9_13, # Humana Press, a part of Springer Science + Business Media, LLC 2009 293

294

13.1

T. Fujiwara et al.

Introduction

Human gene therapy has become a reality with the development of effective techniques for delivering the gene to the target cells. The two major in vitro methods for the introduction of foreign genes are physical and virus-mediated methods. Viruses are the simplest form of life that carry genetic materials and are capable of entering host cells efficiently. Because of this property, many viruses have been adapted as gene transfer vectors (1–7). Adenoviruses have been studied extensively and are well characterized. Adenoviruses are large, double-stranded DNA viruses with tropism for many human tissues such as bronchial epithelia, hepatocytes, and neurons. Furthermore, they are capable of transducing nonreplicating cells and can be grown to high titers in vitro, which allows for their potential use clinically. High titers of replication-defective adenoviruses can be produced and have been successfully used in eukaryotic gene expression (1, 8, 9). Numerous studies using in vitro and animal models have tested a wide variety of adenoviral gene therapy agents and reported potential beneficial effects for different target diseases, including their tolerability and safety (CR10_13–13). Gene therapy for cancer encompasses a wide range of treatment types that use genetic material to modify cancer cells and/or surrounding tissues to exhibit antitumor properties. One of the most common approaches to emerge from the concept of gene therapy is the introduction of foreign therapeutic genes into target cells. A number of genes of interest with different functions such as tumor suppressor genes (14, 15), proapoptotic genes (16, 17), suicide genes that cause cellular death with prodrugs (13, 18), and genes that inhibit angiogenesis (19) have been proposed for this type of therapy. In fact, others and we have completed clinical trials of a replication-deficient adenoviral vector that delivers normally functioning p53 tumor suppressor gene to cancer cells (Ad5CMV-p53, Advexin). It has been reported that multiple courses of intratumoral injection of Ad5CMV-p53 are feasible and well tolerated in patients with advanced head and neck squamous cell carcinoma and nonsmall cell lung cancers and appear to provide clinical benefits (20–24). Another rapidly growing area of gene therapy for cancer is the use of oncolytic vectors for selective tumor cell destruction. Since viruses infect cells and then induce cell lysis through their propagation, they can be used as anticancer agents by genetic engineering to replicate selectively in cancer cells while remaining innocuous to normal tissues (25). The optimal treatment of human cancer including cancer gene therapy requires improvement of the therapeutic ratio to increase the cytotoxic efficacy on tumor cells and decrease that on normal cells. This may not be an easy task because the majority of normal cells surrounding tumors are sensitive to cytotoxic agents. Thus, to establish reliable therapeutic strategies for human cancer, it is important to seek genetic and epigenetic targets present only in cancer cells. One of the targeting strategies has involved the use of tissue-specific promoters to restrict gene expression or viral replication in specific tissues. In this context, promoters from tissuespecific genes such as prostate-specific antigen (PSA) (26), MUC1 (27), osteocalcin

13 Therapeutic Targets and Drugs IV

295

(28), L-plastin (29), midkine (30), and E2F-1 (31) have been used in preclinical or clinical studies. These promoters can be activated preferentially in tumor cells that express each targeted tumor marker; their therapeutic window, however, is relatively narrow because only part of the tumor is positive for each tumor marker. Telomerase is a ribonucleoprotein complex responsible for the addition of TTAGGG repeats to the telomeric ends of chromosomes, and it contains three components: the RNA subunit (known as hTR, hTER, or hTERC) (32), the telomerase-associated protein (hTEP1) (33), and the catalytic subunit (hTERT, human telomerase reverse transcriptase) (34, 35). Both hTR and hTERT are required for the reconstitution of telomerase activity in vitro (36) and, therefore, represent the minimal catalytic core of telomerase in humans (37). However, while hTR is widely expressed in embryonic and somatic tissues, hTERT is tightly regulated and is not detectable in most somatic cells. The hTERT proximal promoter can be used as a molecular switch for the selective expression of target genes in tumor cells, since almost all advanced human cancer cells express telomerase whereas most normal cells do not (38, 39). This review looks at recent developments in this rapidly evolving field, cancer therapeutic and cancer diagnostic approaches using the hTERT promoter, and highlights some very promising advances in adenoviral drug design.

13.2

Regulation of hTERT Transcription

Recent studies have provided mechanistic insight into how the hTERT promoter can be stimulated or suppressed by oncogenic activation as well as by inactivation of tumor suppressors. Various laboratories have identified transcription factors that are involved in upregulation or downregulation of hTERT transcriptional activity. These reports proposed a variety of potential mechanisms of the transcriptional control of hTERT, which may help us design telomerase- or hTERT-based cancer therapies. The hTERT promoter contains two E-boxes (CACGTG) that are binding sites for the Myc/Max/Mad network of transcriptional factors (38–41). The oncoprotein c-Myc forms a complex with the Max protein that binds as a heterodimer to activate hTERT transcription. In contrast, heterodimers with Mad1 and Max proteins result in repression of hTERT expression (42, 43). The relative levels of c-Myc and Mad1 correlate directly with activation and repression of hTERT expression. The transcriptional factor Sp1 has been reported to cooperate with c-Myc to induce the hTERT promoter, depending on the cell type, suggesting a reliance on Sp1 for full activity of c-Myc (44). Other transcriptional factors such as ETS proteins and viral proteins also contribute to hTERT upregulation. Since epidermal growth factor (EGF) receptor and its homolog, the HER2/Neu proto-oncoprotein, stimulate phosphorylation of MAP kinases (45), which in turn activate ETS1/ETS2 (46), stimulation by EGF can lead to hTERT upregulation. The human papilloma virus (HPV) type 16 E6 protein can also associate with c-Myc and thereby activate the hTERT promoter (47–49).

296

T. Fujiwara et al.

In addition to Mad1, several dominant repressors that mediate hTERT downregulation have been identified. For example, the Wilm’s tumor suppressor 1 (WT1) and myeloid-specific zinc finger protein 2 (MZF-2) interact with the hTERT promoter to suppress hTERT transcription (50, 51). Based on the preferential expression of WT1 in kidney, gonads, and spleen and that of MZF-2 in myeloid cells, WT1 and MZF-2-mediated repression of hTERT seems tissue-specific. Other transcriptional factors, E2F-1, E2F-2, and E2F-3, also repress hTERT transcription by binding to the hTERT promoter (52, 53). The hTERT transcription is also regulated by nuclear hormones as well as drugs that involve gene expression. Estrogen increases hTERT mRNA levels through the estrogen receptor (ER), which interacts with the two estrogen response elements (EREs) in the hTERT promoter (54, 55). Progesterone and androgen also stimulate telomerase activity through hTERT expression, although this response is likely to be indirect (56). Furthermore, histone deacetylase (HDAC) inhibitors activate the transcription of certain genes by altering the acetylation status of nucleosomal histones. It has been reported that treatment with HDAC inhibitor, tricostatin A (TSA), could induce significant activation of hTERT mRNA expression and telomerase activity in normal cells through the TSA-responsive element localized in the hTERT proximal promoter (57). In contrast, nonsteroidal anti-inflammatory drugs (NSAIDs) such as aspirin, indomethacin, and cyclooxygenase (COX)-2 inhibitors have been recently shown to inhibit telomerase activity at the hTERT transcriptional level in colon cancer cells (58). Cis-response elements to NSAIDs have been identified in the hTERT promoter region. Furthermore, some nuclear hormone receptors including vitamin D receptor and retinoic acid receptor can repress hTERT expression (59, 60). The earlier information gained from the study of hTERT transcriptional regulation suggests that the tight specificity of expression imparted by the hTERT promoter should reduce the likelihood of toxicity, which is otherwise encountered with the use of constitutively active promoters, and help in the development of tumor-specific gene and vector-based therapies of a broad array of cancer types.

13.3

hTERT Promoter for Therapeutic Transgene Expression

The hTERT promoter for targeted cancer gene therapy has been tested by many groups based on its high tumor specificity and broad applicability. Preliminary experiments using a replication-deficient adenovirus vector expressing the LacZ gene driven by the hTERT promoter demonstrated that the hTERT promoter activity is significantly higher in cancer cells than in normal cells (by more than 100-fold), including normal human CD34+ progenitor cells and mesenchymal stem cells (61, 62). Based on this tumor specificity of the hTERT promoter, many therapeutic genes, such as Bax (61), caspase 8 (63), caspase 6 (64), Fas-associated protein with death domain (FADD) (63), tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) (65, 66), and p53-upregulated modulator of

13 Therapeutic Targets and Drugs IV

297

apoptosis (PUMA) (67), have been used under the control of the hTERT promoter to selectively kill tumor cells. Adenovirus-mediated telomerase-specific expression of these genes exhibited profound antitumor effects in vitro and in vivo against many types of human cancer such as malignant gliomas, nonsmall cell lung cancer, and pancreatic cancer. These findings suggest that the hTERT-promoter system is a promising tool with potential application in targeted cancer gene therapy irrespective of the type of therapeutic gene. When the therapeutic genes are highly toxic, the construction of adenovirus vectors is frequently problematic because of the death of packaging cells. To overcome this obstacle, Gu et al. (61) developed a unique inducible binary adenoviral system consisting of two adenovirus vectors, Ad/hTERT-GV16 and Ad/GTBax, with the hTERT promoter-driven synthetic transactivator and a human BAX gene under the control of a minimal synthetic promoter, respectively. Coinfection of Ad/hTERT-GV16 and Ad/GT-Bax efficiently induced tumor-specific apoptosis in vitro and in vivo in a variety of human and murine cancer cells. Moreover, to prepare a vector suitable for clinical application, a recent study described the construction of a single bicistronic adenoviral vector that produced the green fluorescent protein (GFP)-Bax fusion protein using the tetracycline controllable system (68). The virus propagated in packaging cells because tetracycline blocks GFP-Bax expression and protects cells from Bax-mediated cell death. Lin et al. (69) also constructed a single bicistronic adenoviral vector with the hTERT promoterdriven synthetic transactivator and the GFP-TRAIL fusion protein gene under the control of a minimal synthetic promoter. These telomerase-specific adenoviral agents may be potent therapeutic agents for the treatment of human cancer, although none of them has been clinically used yet.

13.4 13.4.1

hTERT Promoter for Oncolytic Virotherapy Construction of Telomerase-Specific Oncolytic Adenovirus

The use of modified adenoviruses that replicate and complete their lytic cycle preferentially in cancer cells is a promising strategy for treatment of cancer (Fig. 13.1). One approach to achieve tumor specificity of viral replication is based on the transcriptional control of genes that are critical for virus replication such as E1A or E4. As described earlier, telomerase, especially its catalytic subunit hTERT, is expressed in the majority of human cancers, and the hTERT promoter is preferentially activated in human cancer cells (70). Thus, the broadly applicable hTERT promoter might be a suitable regulator of adenoviral replication. Indeed, it has been reported previously that the transcriptional control of E1A expression via the hTERT promoter could restrict adenoviral replication to telomerase-positive tumor cells and efficiently lyse tumor cells (71–74). Furthermore, Kuppuswamy et al. have recently developed a novel oncolytic adenovirus (VRX-011), in which

298

T. Fujiwara et al.

E1-deleted replication-deficient adenovirus vector

Wild-type adenovirus type 5

Tumor-specific oncolytic adenovirus

Virus infection

Infected cell death by 100% of tumor cells could not therapeutic gene expression be transduced by the vector

Virus infection

Virus infection

Non-specific replication and virus spread

Whole cell lysis

Tumor-specific replication and virus spread

Cancer cell lysis

Fig. 13.1 Schematic of tumor-specific viral replication and cell killing. A replication-selective viral agent can replicate in and kill tumor cells specifically, leaving healthy cells unharmed (See Color Insert)

the replication of the vector targets cancer cells by replacing adenovirus E4 promoter with the hTERT promoter (75). VRX-011 could also overexpress the adenovirus death protein (ADP) (also known as E3-11.6K), which is required for efficient cell lysis and release of virions from cells at late stages of infection. The adenovirus E1B gene is expressed early in viral infection and its gene product inhibits E1A-induced p53-dependent apoptosis, which in turn promotes the cytoplasmic accumulation of late viral mRNA, leading to a shut down of hostcell protein synthesis. In most vectors that replicate under the transcriptional control of the E1A gene including hTERT-specific oncolytic adenoviruses, the E1B gene is driven by the endogenous adenovirus E1B promoter. However, Li et al. (76) have demonstrated that transcriptional control of both E1A and E1B genes by the a-fetoprotein (AFP) promoter with the use of IRES significantly improved the specificity and the therapeutic index in hepatocellular carcinoma cells. On the basis of the aforementioned information, we developed Telomelysin (OBP-301), in which the tumor-specific hTERT promoter regulates both the E1A and E1B genes. Telomelysin controls viral replication more stringently, thereby providing better therapeutic effects in tumor cells as well as attenuated toxicity in normal tissues (77) (Fig. 13.2).

13.4.2

Preclinical Studies of Telomelysin

The majority of human cancer cells acquire immortality and unregulated proliferation by expression of the hTERT (70) and, therefore theoretically, hTERT-specific

13 Therapeutic Targets and Drugs IV

299

Telomelysin (OBP-301) ITR

ITR hTERT-p

Ad-E1A

IRES

Ad-E1B

TelomeScan (OBP-401) CMV-p

GFP

poly-A

ITR

ITR hTERT-p

Ad-E1A

IRES

Ad-E1B

ΔE3

Telomelysin-RGD (OBP-405) CDCRGDCFC

ITR hTERT-p

Ad-E1A

IRES

ITR

Ad-E1B

Fiber coding region

Fig. 13.2 Structures of telomerase-specific oncolytic viruses. Telomelysin (OBP-301), in which the hTERT promoter element drives the expression of E1A and E1B genes linked with an IRES. TelomeScan (OBP-401) is a telomerase-specific replication-competent adenovirus variant, in which GFP gene is inserted under CMV promoter into E3 region for monitoring viral replication. Telomelysin-RGD (OBP-405) has mutant fiber containing the RGD peptide, CDCRGDCFC, in the HI loop of the fiber knob (See Color Insert)

Telomelysin can possess a broad-spectrum antineoplastic activity against a variety of human tumors. Telomelysin induced selective E1A and E1B expression in cancer cells, which resulted in viral replication at 5–6 logs by 3 days after infection; on the other hand, Telomelysin replication was attenuated up to 2 logs in cultured normal cells (77, 78). In vitro cytotoxicity assays demonstrated that Telomelysin could efficiently kill various types of human cancer cell lines including head and neck cancer, lung cancer, esophageal cancer, gastric cancer, colorectal cancer, breast cancer, pancreas cancer, hepatic cancer, prostate cancer, cervical cancer, melanoma, sarcoma, and mesothelioma in a dose-dependent manner (79). The dose of Telomelysin that caused 50% reduction in cell viability in monolayer cultures (defined as ID50) was less than 20 multiplicity of infections (MOIs) in almost all tumor cell lines examined in our study. These data clearly demonstrate that Telomelysin exhibits desirable features for use as an oncolytic therapeutic agent, as the proportion of cancers potentially treatable by Telomelysin is extremely high. The in vivo antitumor effect of Telomelysin was also investigated by using athymic mice carrying xenografts. Intratumoral injection of Telomelysin into human tumor xenografts resulted in a significant inhibition of tumor growth and enhancement of survival (77, 78). Macroscopically, massive ulceration was noted on the tumor surface after injection of high-dose Telomelysin, indicating that Telomelysin induced intratumoral necrosis due to direct lysis of tumor cells by virus replication in vivo. For effective treatment of distant metastatic tumors, intravenously infused chemotherapeutic drugs must distribute in sufficient

300

T. Fujiwara et al.

concentrations into the tumor sites; oncolytic viruses, however, could still replicate in the tumor, cause oncolysis, and then release virus particles that could reach the distant metastatic lesions. Therefore, intratumoral administration that causes the release of newly formed virus from infected tumor cells is theoretically suitable for oncolytic virus rather than systemic administration. Indeed, previous studies confirmed that, following intratumoral injection of Telomelysin, it replicated within tumors, spread into the bloodstream, and then replicated in distant tumor sites (77, 78). The biodistribution of Telomelysin as assessed by PCR amplification targeting for the viral E1A provides evidence that viral replication is highly specific for tumors despite its presence in the circulation. No significant elevation of liver enzymes was observed in mice intratumorally injected with Telomelysin. In addition, histopathological analysis of liver sections demonstrated absence of apoptotic hepatocytes and other histological signs of hepatocellular damage (78). Chemotherapeutic drugs kill tumor cells mainly by inducing apoptosis, which is characterized by chromosome condensation and nuclear shrinkage and fragmentation. The nuclear morphology of cells infected with Telomelysin, however, is distinct from apoptosis. Apoptosis in mammalian cells is mediated by a family of cysteine proteases known as caspases, which are the executioners of apoptosis and essential for the disassembly of the cell. In contrast, cells infected with Telomelysin showed no changes in procaspase-3 levels and no expression of cleaved form of caspase-3, suggesting that oncolytic cells are distinct from apoptotic cells. Moreover, flow cytometric analysis demonstrated that Telomelysin infection does not modulate cell cycle distribution (80, 81). Recently, Ito et al. (82) have reported that hTERT-specific oncolytic adenovirus causes autophagic cell death, which is another type of programmed cell death different from apoptosis, in malignant glioma cells via inhibition of the mTOR signal. We also identified the partial involvement of autophagy in the cell death machinery triggered by Telomelysin infection (83). Dendritic cells (DCs) are the most potent antigen-presenting cells and acquire cellular antigens and danger signals from dying cells to initiate antitumor immune responses via direct cell-to-cell interaction and cytokine production. The optimal forms of tumor cell death for priming DCs to release danger signals are not fully understood. We have demonstrated that Telomelysin replication produced uric acid, an endogenous danger signaling molecule, by infected human tumor cells, which in turn stimulated DCs to produce interferon g (IFN-g) and interleukin 12 (IL-12). Subsequently, IFN-g release upregulated the endogenous expression of PA28, a proteasome activator in tumor cells, and resulted in the induction of cytotoxic T-lymphocytes (CTL) (83). These results suggest that virus-mediated oncolysis might be an effective stimulus for immature DCs to induce specific activity against human cancer cells (Fig. 13.3).

13.4.3

Multidisciplinary Therapy with Telomelysin

The development of Telomelysin as a monotherapy is currently underway clinically based on the promising results of preclinical studies; multimodal strategies to

13 Therapeutic Targets and Drugs IV

301

Intratumoral injection

Direct oncolytic effect Telomelysin

Viral replication and increase of cellular uric acid

Cancer cell destruction and uptake by DCs

Dendritic cells (DC)

Cancer cell Uric acid as “a danger signal”

Virus particle

Indirect immunological effect

Cytotoxic T-lymphocytes (CTL)

Fig. 13.3 Antitumor mechanisms of Telomelysin. Telomelysin exhibits antitumor effect not only as a direct cytotoxic drug but also as an immunostimulatory agent that induces specific cytotoxic T lymphocytes (CTL) (See Color Insert)

enhance antitumor efficacy in vivo, however, are essential for successful clinical outcome. In fact, most of the clinical trials for oncolytic viruses have been conducted in combination with chemotherapy or radiotherapy (84–87). Disappointingly, a clinical trial of ONYX-015 showed no clinical benefit in the majority of patients, despite the encouraging biological activity (88). Tumor progression was rapid in most patients, even though substantial necrosis was noted in the tumors after treatment (89, 90). Therefore, multidisciplinary therapy composed of oncolytic virotherapy combined with low-dose chemotherapeutic agent is required to enhance the antitumor efficacy. Moreover, the combination of two agents may allow the use of reduced dosage of each agent and lessen the likelihood of adverse effects. Infection with Telomelysin (GFP-expressing Telomelysin, TelomeScan, was used as an alternative to Telomelysin in some experiments) alone or followed by treatment with docetaxel (Taxotere), a chemotherapeutic agent, resulted in a profound in vitro cytotoxicity in various human cancer cell lines originating from different organs (lung, colon, esophagus, stomach, liver, and prostate), although the magnitude of the antitumor effect varied among the cell types (81). Other chemotherapeutic agents such as vinorelbine (Navelbine) and SN38 (the potent active metabolite of irinotecan) combined with Telomelysin also inhibited the growth of human cancer cells (81). Quantitative real-time PCR analysis demonstrated that docetaxel did not affect viral replication. For in vivo evaluation, mice xenografted with human lung tumor received intratumoral injection of Telomelysin and intraperitoneal administration of docetaxel. Analysis of growth of implanted tumors showed a significant, therapeutic synergism, while each treatment alone showed modest inhibition of tumor growth (81). The antitumor effect of the combination therapy was likely additive in vitro; there might be, however, some particular

302

T. Fujiwara et al.

interactions between Telomelysin and docetaxel to produce a synergistic effect in vivo. It has been reported that metronomic chemotherapy, which refers to long-term administration of comparatively low doses of cytotoxic drugs at close, regular intervals, has an antiangiogenic basis (91). Like our approach, the potent antiangiogenic properties of drugs administered in a metronomic fashion find favor in a number of in vivo preclinical studies; to prove this efficacy by in vitro experiments is, however, technically difficult. There are some possible explanations for the superior in vivo antitumor activity in our experiments. Systemically administered docetaxel may attack the vascular endothelial cells at the tumor site, which in turn can block the escape of locally injected Telomelysin into the peripheral circulation. Another possibility is that Telomelysin itself may inhibit the vascular supply by killing endothelial cells. FR901228 (depsipeptide, FK228) is a novel anticancer agent isolated from the fermentation broth of Chromobacterium violaceum. FR901228 has been identified as a potent HDAC inhibitor. Histone deacetylation is an important component of transcriptional control, and FR901228 increases Coxsackie adenovirus receptor (CAR) gene expression in various cancer cell lines (92–95). Moreover, FR901228 is known to increase viral and transgene expression following adenovirus infection (92). Indeed, FR901228 treatment upregulated CAR levels on target tumor cells, which in turn increased the amount of cellular Telomelysin replication, thereby promoting a synergistic antitumor effect (80). These data indicate that FR901228 may be an appropriate partner for Telomelysin because it does not affect the virus life cycle. Delineating specific virus/drug combinations tailored to be particularly effective in human cancer could potentially improve the already encouraging results seen in the field of oncolytic virotherapy.

13.4.4 Clinical Application of Telomelysin Preclinical models suggested that Telomelysin could selectively kill a variety of human cancer cells in vitro and in vivo via intracellular viral replication regulated by the hTERT transcriptional activity. Pharmacological and toxicological studies in mice and cotton rats demonstrated that none of the animals treated with Telomelysin showed signs of viral distress (e.g., ruffled fur, weight loss, lethargy, or agitation) or extensive histopathological changes in any organs at autopsy. These promising data led us to design a phase I clinical trial of Telomelysin as a monotherapy. The protocol ‘‘A phase I dose-escalation study of intratumoral injection with telomerase-specific replication-competent oncolytic adenovirus, Telomelysin (OBP-301) for various solid tumors’’ sponsored by Oncolys BioPharma, Inc. is an open-label, phase I, three cohort dose-escalation study. The trial commenced following approval of the US Food and Drug Administration (FDA) in October 2006. The study is still currently underway and we plan to assess the safety, tolerability, and feasibility of intratumoral injection of the agent in patients with

13 Therapeutic Targets and Drugs IV

303

advanced cancer. We will also analyze the humoral immune response to Telomelysin, and take tissue biopsies to evaluate the pharmacokinetics and pharmacodynamics of Telomelysin in the injected tumor. The therapeutic response will be assessed by measuring changes in tumor dimensions, comparative analysis of tumor biopsies, and cytokine and/or viral measurements. Patients selected for this trial have histologically or cytologically proven nonresectable solid tumors and have failed to respond to conventional therapies such as primary external beam radiation or systemic chemotherapy. All patients have a disease that is measurable and accessible to direct injection of Telomelysin. The doses of Telomelysin will be escalated from low to high virus particles (VP) in one log increment. Patients will be treated with a single-dose intratumoral injection of Telomelysin and then monitored over 1 month. The data of pharmacokinetics and biodistribution of Telomelysin will be of interest. Clinical trials of intratumoral and intravenous administration of CG7870, a replication-selective oncolytic adenovirus genetically engineered to replicate preferentially in prostate tissue, demonstrated a second peak of the virus genome in the plasma (96, 97), suggesting active viral replication and shedding into the bloodstream. Therefore, it is anticipated that intratumorally administered Telomelysin can spread into the lymphatic vessels as well as the blood circulation, and potentially kill metastatic tumor cells in regional lymph nodes and distant organ tissues. Theoretically, Telomelysin can replicate continuously in the injected tumors and release virus particles unless all tumor cells are completely eliminated, indicating that a single intratumoral injection should be sufficient to induce antitumor effect. Our preclinical study, however, showed that multiple injections of Telomelysin resulted in a profound inhibition of tumor growth in xenograft models (77, 78, 81). Thus, once the safety of a single administration is confirmed, the feasibility of the multicycle treatment with Telomelysin will be assessed in human.

13.5

hTERT Promoter for Cancer Diagnostics

13.5.1 Imaging of Tumor Cells Using Telomerase-Specific Oncolytic Adenovirus A variety of imaging technologies are investigated as tools for cancer diagnosis, detection, and treatment monitoring. Improvements in methods of external imaging such as computed tomography (CT), magnetic resonance imaging (MRI), and ultrasound techniques have increased the sensitivity for visualizing tumors and metastases in the body (98). A limiting factor in structural and anatomical imaging, however, is the inability to specifically identify malignant tissues. Positron emission tomography (PET) using the glucose analogue 18F-2-deoxy-D-glucose (FDG) is the first molecular imaging technique that is widely applied for cancer imaging in

304

T. Fujiwara et al.

clinical settings (99). Although FDG-PET has high detection sensitivity, it has some limitations such as difficulty in distinguishing between proliferating tumor cells and inflammation, and its unsuitability for real-time detection of tumor tissues. Therefore, tumor-specific imaging is of considerable value in the treatment of human cancer because it can define the location and area of tumors without microscopic analysis. In particular, if tumors too small for direct visual detection and therefore not detectable by direct inspection could be imaged in situ, surgeons could precisely excise tumors with appropriate surgical margins. This paradigm requires an appropriate ‘‘marker’’ that can facilitate visualization of physiological or molecular events that occur in tumor cells but not in normal cells. The green fluorescent protein (GFP), which was originally obtained from the jellyfish Aequorea Victoria, is an attractive molecular marker for imaging of live tissues because of the relatively noninvasive nature of the fluorescent (100). A new approach developed in our laboratories to specifically visualize human tumor cells involves the use of Telomelysin and a replication-deficient adenovirus expressing the GFP gene (Ad-GFP). Telomelysin infection could complement E1 gene functions and facilitate replication of E1-deleted Ad-GFP selectively in coinfected tumor cells (101). When the human cancer cell lines were infected with Ad-GFP at low MOI, GFP expression could not be detected; in the presence of Telomelysin, however, Ad-GFP replicated in these tumor cells and showed strong green signals. In contrast, coinfection of Telomelysin and Ad-GFP did not show any fluorescence in normal cells such as fibroblasts and vascular endothelial cells because of the low levels of hTERT activity. This strategy was also applied successfully in vivo; intrathoracic administration of Telomelysin and Ad-GFP clearly labeled disseminated human lung tumor nodules in mice under the cooled charged-coupled device (CCD) camera. These data indicate that locoregional injection of Telomelysin plus Ad-GFP in combination with the highly sensitive CCD imaging system might be a useful diagnostic tool for real-time visualization of macroscopically invisible tumor tissues. The advantage of coinfection of an E1-deleted replication-deficient adenoviral vector and Telomelysin is that transgene expression can be amplified in target cells. Furthermore, many vectors previously constructed can be used to express genes of interest. However, the requirement for both viruses to infect the same cell for the amplified transgene expression is a significant limitation of this dual virus vector system. The degree of transgene expression has been shown to vary depending on the copy numbers of the viruses that initially infected the cells. To label efficiently and uniformly target tumor cells with green fluorescence, we modified Telomelysin to contain the GFP gene driven by the cytomegalovirus (CMV) promoter in the E3deleted region. The resultant adenovirus was termed TelomeScan or OBP-401 ((80, 81) (Fig. 13.2). Similar to Telomelysin, TelomeScan replicated 5–6 logs by 3 days after infection in human cancer cell lines and coordinately induced GFP expression; TelomeScan replication, however, was attenuated up to 2 logs in normal human fibroblasts without GFP expression. Subcutaneous human tumor xenografts could be visualized after intratumoral injection of TelomeScan. All tumor sections

13 Therapeutic Targets and Drugs IV

305

showed GFP expression, suggesting in vivo viral replication and spread throughout the tumors.

13.5.2 In Vivo Imaging of Micrometastasis with TelomeScan Metastatic spread of tumor cells plays a major role in the morbidity and mortality of human cancer. Although there are few life-prolonging treatments in the majority of patients with distant sites of metastasis, early detection of occult metastasis and early therapeutic interventions may decrease the rate of metastatic spread and prolong survival. Lymphatic invasion is one of the major routes for cancer metastasis, and adequate resection of locoregional lymph nodes is required for curative treatment in patients with advanced malignancies. Although the risk of lymph node metastasis can be partially predicted by clinical data such as tumor stage, serum tumor marker level, and medical images, there are no noninvasive approaches to accurately predict the presence of lymph node metastasis, in particular, microscopic metastasis. Although molecular analysis based on detection of genetic markers of cancer cells is clinically relevant in some patients, the procurement of sufficient tissue to confirm the diagnosis can be associated with significant morbidity and cost depending on the size and location of the lesion. Therefore, the utility of TelomeScan that can be used for real-time imaging of tumor tissues in vivo offers a practical, safe, and cost-effective alternative to the traditional, cumbersome procedures of histopathological examination. Following intratumoral injection of TelomeScan into human colorectal tumors orthotopically implanted into the rectum in mice, para-aortic lymph node metastasis could be visualized at laparotomy under a CCD camera. Histopathological analysis confirmed the presence of metastatic adenocarcinoma cells in the lymph nodes with fluorescence emission, whereas GFP-negative lymph nodes contained no tumor cells. Of interest, metastatic lymph nodes were imaged in spots with GFP fluorescence, which was in agreement with histologically confirmed micrometastasis. The sensitivity and specificity of this imaging technique are 92.3 and 86.6%, respectively, which are sufficiently reliable to support the concept of this approach (102). These data indicate that TelomeScan causes viral spread into the regional lymphatic area and selectively replicates in neoplastic lesions, resulting in GFP expression in metastatic lymph nodes. This experiment mimics the clinical scenario where patients with gastrointestinal malignancies and lymph node metastasis undergo surgery, and the data suggest that the surgeon can identify metastatic lymph nodes by illuminating the abdominal cavity with a Xenon lamp. Administration of TelomeScan offers an additional advantage in cancer therapy. TelomeScan, similar to Telomelysin, is an oncolytic virus, and selectively kills human tumor cells by viral replication; the process of cell death by TelomeScan, however, is relatively slow compared with apoptosis-inducing chemotherapeutic drugs, because the virus needs time for replication. Therefore, tumor cells infected with TelomeScan express GFP fluorescence, followed by loss of viability, allowing

306

T. Fujiwara et al.

the timing of detection. Thus, TelomeScan can spread into the regional lymph nodes after intratumoral injection, express GFP signals in tumor cells by virus replication, and finally kill tumor cells even if the surgeon failed to remove all nodes containing micrometastasis.

13.6

Conclusions and Perspectives

There have been very impressive advances in our understanding of the molecular aspects of human cancer and in the development of technologies for genetic modification of viral genomes. Nevertheless, many ethical and technical hurdles remain to be tackled and must be solved before virotherapy, including virusmediated gene therapy, ever reaches routine clinical application. The safety considerations in the virus manufacture and clinical protocols are among the most important issues to be studied. Another important issue is to find ways to selectively deliver viruses into a high percentage of malignant cells in an existing tumor mass. The use of tissue- or cell-type specific promoters could perhaps achieve specificity of virus-mediated antitumor effect. The hTERT promoter-based transcriptional targeting in adenoviral constructs is a powerful tool for cancer diagnosis and therapy. In particular, the hTERT-specific oncolytic adenovirus achieves a more strict targeting potential due to the amplified effect by viral replication, and is a promising therapeutic alternative to replication-deficient gene therapy vectors. Several independent studies that used different regions of the hTERT promoter and different sites of adenoviral genome responsible for viral replication have shown that the hTERT promoter allows adenoviral replication as a molecular switch and induces selective cytopathic effect in a variety of human tumor cells (71–73, 77). Among these viral constructs, to the best of our knowledge, Telomelysin seems to be the first hTERT-dependent oncolytic adenovirus that will be used in a clinical trial based on preclinical pharmacological and toxicological studies. Although Telomelysin showed a broad and profound antitumor effect in human cancer originating from various organs, one weakness of Telomelysin is that virus infection efficiency depends on CAR expression, which is not highly expressed on the cell surface of some types of human cancer cells. Thus, tumors that lost CAR expression may be refractory to infection with Telomelysin. Since modification of fiber protein is an attractive strategy for overcoming the limitations imposed by the CAR dependence of Telomelysin infection, we modified the fiber of Telomelysin to contain RGD (Arg-Gly-Asp) peptide, which binds with high affinity to integrins (avb3 and avb5) on the cell surface, on the HI loop of the fiber protein. The resultant adenovirus, termed Telomelysin-RGD or OBP-405 (Fig. 13.2), mediated not only CAR-dependent virus entry but also CAR-independent, RGD-integrindependent virus entry (78). Telomelysin-RGD had an apparent oncolytic effect on human cancer cell lines with low CAR expression. Intratumoral injection of Telomelysin-RGD into CAR-negative tumor xenografts in mice resulted in significant inhibition of tumor growth and long-term survival. These data suggest that

13 Therapeutic Targets and Drugs IV

307

fiber-modified Telomelysin-RGD exhibits a broad target range by increasing infection efficiency, although one needs to be cautious about increased toxicity since hematopoietic cell population such as dendritic cells can be efficiently infected with RGD-modified adenovirus (103). A possible future direction for Telomelysin includes combination therapy with conventional therapies such as chemotherapy, radiotherapy, surgery, immunotherapy, and new modalities such as antiangiogenic therapy. Since clinical activities observed by intratumoral injection of Telomelysin suggest that even partial elimination of the tumor could be clinically beneficial, the combination approaches may lead to the development of more advanced biological therapy for human cancer. The combination of systemic chemotherapy and local injection of Telomelysin has been shown to be effective as described earlier (81). In addition, we found that oncolysis induced by Telomelysin infection could be the most effective stimulus for immature DCs to induce specific activity against human cancer cells (83). Therefore, Telomelysin can be effective not only as a direct cytotoxic drug but also as an immunostimulatory agent that induces specific CTL for the remaining antigen-bearing tumor cells (Fig. 13.3). Peri- or postoperative administration of Telomelysin may be also valuable as adjuvant therapy in areas of microscopic residual disease at tumor margins to prevent recurrence or regrowth of tumors. The field of telomerase-specific gene and vector-based therapies is progressing considerably and is rapidly gaining medical and scientific acceptance. Although many technical and conceptual problems await to be solved, ongoing and future clinical studies will no doubt continue to provide important clues that may allow substantial progress in human cancer therapy.

References 1. Kaplan JM. Adenovirus-based cancer gene therapy. Curr Gene Ther 2005; 5(6):595–605. 2. Dalba C, Klatzmann D, Logg CR, Kasahara N. Beyond oncolytic virotherapy: replicationcompetent retrovirus vectors for selective and stable transduction of tumors. Curr Gene Ther 2005; 5(6):655–667. 3. Le BC, Douar AM. Gene therapy progress and prospects – vectorology: design and production of expression cassettes in AAV vectors. Gene Ther 2006; 13(10):805–813. 4. Hu YC. Baculovirus vectors for gene therapy. Adv Virus Res 2006; 68:287–320. 5. Berges BK, Wolfe JH, Fraser NW. Transduction of brain by herpes simplex virus vectors. Mol Ther 2007; 15(1):20–29. 6. Philpott NJ, Thrasher AJ. Use of nonintegrating lentiviral vectors for gene therapy. Hum Gene Ther 2007; 18(6):483–489. 7. Yonemitsu Y, Kitson C, Ferrari S et al. Efficient gene transfer to airway epithelium using recombinant Sendai virus. Nat Biotechnol 2000; 18(9):970–973. 8. Mizuguchi H, Kay MA. Efficient construction of a recombinant adenovirus vector by an improved in vitro ligation method. Hum Gene Ther 1998; 9(17):2577–2583. 9. Stone D, Lieber A. New serotypes of adenoviral vectors. Curr Opin Mol Ther 2006; 8(5):423–431.

308

T. Fujiwara et al.

10. Wilson JM, Engelhardt JF, Grossman M, Simon RH, Yang Y. Gene therapy of cystic fibrosis lung disease using E1 deleted adenoviruses: a phase I trial. Hum Gene Ther 1994; 5(4):501–519. 11. Crystal RG, McElvaney NG, Rosenfeld MA et al. Administration of an adenovirus containing the human CFTR cDNA to the respiratory tract of individuals with cystic fibrosis. Nat Genet 1994; 8(1):42–51. 12. Crystal RG, Hirschowitz E, Lieberman M et al. Phase I study of direct administration of a replication deficient adenovirus vector containing the E. coli cytosine deaminase gene to metastatic colon carcinoma of the liver in association with the oral administration of the prodrug 5-fluorocytosine. Hum Gene Ther 1997; 8(8):985–1001. 13. Sterman DH, Treat J, Litzky LA et al. Adenovirus-mediated herpes simplex virus thymidine kinase/ganciclovir gene therapy in patients with localized malignancy: results of a phase I clinical trial in malignant mesothelioma. Hum Gene Ther 1998; 9(7):1083–1092. 14. Fujiwara T, Grimm EA, Mukhopadhyay T, Zhang WW, Owen-Schaub LB, Roth JA. Induction of chemosensitivity in human lung cancer cells in vivo by adenovirus-mediated transfer of the wild-type p53 gene. Cancer Res 1994; 54(9):2287–2291. 15. Fujiwara T, Cai DW, Georges RN, Mukhopadhyay T, Grimm EA, Roth JA. Therapeutic effect of a retroviral wild-type p53 expression vector in an orthotopic lung cancer model. J Natl Cancer Inst 1994; 86(19):1458–1462. 16. Kagawa S, Gu J, Swisher SG et al. Antitumor effect of adenovirus-mediated Bax gene transfer on p53-sensitive and p53-resistant cancer lines. Cancer Res 2000; 60(5):1157–1161. 17. Tsunemitsu Y, Kagawa S, Tokunaga N et al. Molecular therapy for peritoneal dissemination of xenotransplanted human MKN-45 gastric cancer cells with adenovirus mediated Bax gene transfer. Gut 2004; 53(4):554–560. 18. Chen SH, Shine HD, Goodman JC, Grossman RG, Woo SL. Gene therapy for brain tumors: regression of experimental gliomas by adenovirus-mediated gene transfer in vivo. Proc Natl Acad Sci USA 1994; 91(8):3054–3057. 19. Feldman AL, Restifo NP, Alexander HR et al. Antiangiogenic gene therapy of cancer utilizing a recombinant adenovirus to elevate systemic endostatin levels in mice. Cancer Res 2000; 60(6):1503–1506. 20. Clayman GL, el-Naggar AK, Lippman SM et al. Adenovirus-mediated p53 gene transfer in patients with advanced recurrent head and neck squamous cell carcinoma. J Clin Oncol 1998; 16(6):2221–2232. 21. Swisher SG, Roth JA, Nemunaitis J et al. Adenovirus-mediated p53 gene transfer in advanced non-small-cell lung cancer. J Natl Cancer Inst 1999; 91(9):763–771. 22. Nemunaitis J, Swisher SG, Timmons T et al. Adenovirus-mediated p53 gene transfer in sequence with cisplatin to tumors of patients with non-small-cell lung cancer. J Clin Oncol 2000; 18(3):609–622. 23. Swisher SG, Roth JA, Komaki R et al. Induction of p53-regulated genes and tumor regression in lung cancer patients after intratumoral delivery of adenoviral p53 (INGN 201) and radiation therapy. Clin Cancer Res 2003; 9(1):93–101. 24. Fujiwara T, Tanaka N, Kanazawa S et al. Multicenter phase I study of repeated intratumoral delivery of adenoviral p53 in patients with advanced non-small-cell lung cancer. J Clin Oncol 2006; 24(11):1689–1699. 25. Hawkins LK, Lemoine NR, Kirn D. Oncolytic biotherapy: a novel therapeutic platform. Lancet Oncol 2002; 3(1):17–26. 26. Rodriguez R, Schuur ER, Lim HY, Henderson GA, Simons JW, Henderson DR. Prostate attenuated replication competent adenovirus (ARCA) CN706: a selective cytotoxic for prostate-specific antigen-positive prostate cancer cells. Cancer Res 1997; 57(13):2559–2563. 27. Kurihara T, Brough DE, Kovesdi I, Kufe DW. Selectivity of a replication-competent adenovirus for human breast carcinoma cells expressing the MUC1 antigen. J Clin Invest 2000; 106(6):763–771.

13 Therapeutic Targets and Drugs IV

309

28. Matsubara S, Wada Y, Gardner TA et al . A conditional replication-competent adenoviral vector, Ad-OC-E1a, to cotarget prostate cancer and bone stroma in an experimental model of androgen-independent prostate cancer bone metastasis. Cancer Res 2001; 61(16):6012– 6019. 29. Peng XY, Won JH, Rutherford T et al. The use of the L-plastin promoter for adenoviralmediated, tumor-specific gene expression in ovarian and bladder cancer cell lines. Cancer Res 2001; 61(11):4405–4413. 30. Adachi Y, Reynolds PN, Yamamoto M et al. A midkine promoter-based conditionally replicative adenovirus for treatment of pediatric solid tumors and bone marrow tumor purging. Cancer Res 2001; 61(21):7882–7888. 31. Tsukuda K, Wiewrodt R, Molnar-Kimber K, Jovanovic VP, Amin KM. An E2F-responsive replication-selective adenovirus targeted to the defective cell cycle in cancer cells: potent antitumoral efficacy but no toxicity to normal cell. Cancer Res 2002; 62(12):3438–3447. 32. Feng J, Funk WD, Wang SS et al. The RNA component of human telomerase. Science 1995; 269(5228):1236–1241. 33. Harrington L, McPhail T, Mar V et al. A mammalian telomerase-associated protein. Science 1997; 275(5302):973–977. 34. Meyerson M, Counter CM, Eaton EN et al. hEST2, the putative human telomerase catalytic subunit gene, is up-regulated in tumor cells and during immortalization. Cell 1997; 90 (4):785–795. 35. Nakamura TM, Morin GB, Chapman KB et al. Telomerase catalytic subunit homologs from fission yeast and human. Science 1997; 277(5328):955–959. 36. Nakayama J, Tahara H, Tahara E et al. Telomerase activation by hTRT in human normal fibroblasts and hepatocellular carcinomas. Nat Genet 1998; 18(1):65–68. 37. Beattie TL, Zhou W, Robinson MO, Harrington L. Reconstitution of human telomerase activity in vitro. Curr Biol 1998; 8(3):177–180. 38. Takakura M, Kyo S, Kanaya T et al. Cloning of human telomerase catalytic subunit (hTERT) gene promoter and identification of proximal core promoter sequences essential for transcriptional activation in immortalized and cancer cells. Cancer Res 1999; 59(3):551–557. 39. Horikawa I, Cable PL, Afshari C, Barrett JC. Cloning and characterization of the promoter region of human telomerase reverse transcriptase gene. Cancer Res 1999; 59(4):826–830. 40. Greenberg RA, O’Hagan RC, Deng H et al. Telomerase reverse transcriptase gene is a direct target of c-Myc but is not functionally equivalent in cellular transformation. Oncogene 1999; 18(5):1219–1226. 41. Wu KJ, Grandori C, Amacker M et al. Direct activation of TERT transcription by c-MYC. Nat Genet 1999; 21(2):220–224. 42. Gunes C, Lichtsteiner S, Vasserot AP, Englert C. Expression of the hTERT gene is regulated at the level of transcriptional initiation and repressed by Mad1. Cancer Res 2000; 60 (8):2116–2121. 43. Oh S, Song YH, Yim J, Kim TK. Identification of Mad as a repressor of the human telomerase (hTERT ) gene. Oncogene 2000; 19(11):1485–1490. 44. Kyo S, Takakura M, Taira T et al. Sp1 cooperates with c-Myc to activate transcription of the human telomerase reverse transcriptase gene (hTERT ). Nucleic Acids Res 2000; 28 (3):669–677. 45. Yarden Y, Sliwkowski MX. Untangling the ErbB signalling network. Nat Rev Mol Cell Biol 2001; 2(2):127–137. 46. Sharrocks AD. The ETS-domain transcription factor family. Nat Rev Mol Cell Biol 2001; 2 (11):827–837. 47. Veldman T, Horikawa I, Barrett JC, Schlegel R. Transcriptional activation of the telomerase hTERT gene by human papillomavirus type 16 E6 oncoprotein. J Virol 2001; 75(9):4467– 4472.

310

T. Fujiwara et al.

48. Oh ST, Kyo S, Laimins LA. Telomerase activation by human papillomavirus type 16 E6 protein: induction of human telomerase reverse transcriptase expression through Myc and GC-rich Sp1 binding sites. J Virol 2001; 75(12):5559–5566. 49. Gewin L, Galloway DA. E box-dependent activation of telomerase by human papillomavirus type 16 E6 does not require induction of c-myc. J Virol 2001; 75(15):7198–7201. 50. Oh S, Song Y, Yim J, Kim TK. The Wilms’ tumor 1 tumor suppressor gene represses transcription of the human telomerase reverse transcriptase gene. J Biol Chem 1999; 274 (52):37473–37478. 51. Fujimoto K, Kyo S, Takakura M et al. Identification and characterization of negative regulatory elements of the human telomerase catalytic subunit (hTERT) gene promoter: possible role of MZF-2 in transcriptional repression of hTERT. Nucleic Acids Res 2000; 28 (13):2557–2562. 52. Crowe DL, Nguyen DC, Tsang KJ, Kyo S. E2F-1 represses transcription of the human telomerase reverse transcriptase gene. Nucleic Acids Res 2001; 29(13):2789–2794. 53. Won J, Yim J, Kim TK. Opposing regulatory roles of E2F in human telomerase reverse transcriptase (hTERT) gene expression in human tumor and normal somatic cells. FASEB J 2002; 16(14):1943–1945. 54. Kyo S, Takakura M, Kanaya T et al. Estrogen activates telomerase. Cancer Res 1999; 59 (23):5917–5921. 55. Misiti S, Nanni S, Fontemaggi G et al. Induction of hTERT expression and telomerase activity by estrogens in human ovary epithelium cells. Mol Cell Biol 2000; 20(11):3764– 3771. 56. Wang Z, Kyo S, Takakura M et al. Progesterone regulates human telomerase reverse transcriptase gene expression via activation of mitogen-activated protein kinase signaling pathway. Cancer Res 2000; 60(19):5376–5381. 57. Takakura M, Kyo S, Sowa Y et al. Telomerase activation by histone deacetylase inhibitor in normal cells. Nucleic Acids Res 2001; 29(14):3006–3011. 58. He H, Xia HH, Wang JD et al. Inhibition of human telomerase reverse transcriptase by nonsteroidal antiinflammatory drugs in colon carcinoma. Cancer 2006; 106(6):1243–1249. 59. Ikeda N, Uemura H, Ishiguro H et al. Combination treatment with 1alpha,25-dihydroxyvitamin D3 and 9-cis-retinoic acid directly inhibits human telomerase reverse transcriptase transcription in prostate cancer cells. Mol Cancer Ther 2003; 2(8):739–746. 60. Pendino F, Dudognon C, Delhommeau F et al. Retinoic acid receptor alpha and retinoid-X receptor-specific agonists synergistically target telomerase expression and induce tumor cell death. Oncogene 2003; 22(57):9142–9150. 61. Gu J, Kagawa S, Takakura M et al. Tumor-specific transgene expression from the human telomerase reverse transcriptase promoter enables targeting of the therapeutic effects of the Bax gene to cancers. Cancer Res 2000; 60(19):5359–5364. 62. Gu J, Fang B. Telomerase promoter-driven cancer gene therapy. Cancer Biol Ther 2003; 2(4 Suppl 1):S64–S70. 63. Koga S, Hirohata S, Kondo Y et al. FADD gene therapy using the human telomerase catalytic subunit (hTERT) gene promoter to restrict induction of apoptosis to tumors in vitro and in vivo. Anticancer Res 2001; 21(3B):1937–1943. 64. Komata T, Kondo Y, Kanzawa T et al. Treatment of malignant glioma cells with the transfer of constitutively active caspase-6 using the human telomerase catalytic subunit (human telomerase reverse transcriptase) gene promoter. Cancer Res 2001; 61(15):5796–5802. 65. Lin T, Huang X, Gu J et al. Long-term tumor-free survival from treatment with the GFPTRAIL fusion gene expressed from the hTERT promoter in breast cancer cells. Oncogene 2002; 21(52):8020–8028. 66. Jacob D, Davis J, Zhu H et al. Suppressing orthotopic pancreatic tumor growth with a fibermodified adenovector expressing the TRAIL gene from the human telomerase reverse transcriptase promoter. Clin Cancer Res 2004; 10(10):3535–3541.

13 Therapeutic Targets and Drugs IV

311

67. Ito H, Kanzawa T, Miyoshi T et al. Therapeutic efficacy of PUMA for malignant glioma cells regardless of p53 status. Hum Gene Ther 2005; 16(6):685–698. 68. Gu J, Zhang L, Huang X et al. A novel single tetracycline-regulative adenoviral vector for tumor-specific Bax gene expression and cell killing in vitro and in vivo. Oncogene 2002; 21 (31):4757–4764. 69. Lin T, Huang X, Gu J et al. Long-term tumor-free survival from treatment with the GFPTRAIL fusion gene expressed from the hTERT promoter in breast cancer cells. Oncogene 2002; 21(52):8020–8028. 70. Shay JW, Bacchetti S. A survey of telomerase activity in human cancer. Eur J Cancer 1997; 33(5):787–791. 71. Wirth T, Zender L, Schulte B et al. A telomerase-dependent conditionally replicating adenovirus for selective treatment of cancer. Cancer Res 2003; 63(12):3181–3188. 72. Lanson NA, Jr, Friedlander PL, Schwarzenberger P, Kolls JK, Wang G. Replication of an adenoviral vector controlled by the human telomerase reverse transcriptase promoter causes tumor-selective tumor lysis. Cancer Res 2003; 63(22):7936–7941. 73. Irving J, Wang Z, Powell S et al. Conditionally replicative adenovirus driven by the human telomerase promoter provides broad-spectrum antitumor activity without liver toxicity. Cancer Gene Ther 2004; 11(3):174–185. 74. Kim E, Kim JH, Shin HY et al. Ad-mTERT-delta19, a conditional replication-competent adenovirus driven by the human telomerase promoter, selectively replicates in and elicits cytopathic effect in a cancer cell-specific manner. Hum Gene Ther 2003; 14(15):1415–1428. 75. Kuppuswamy M, Spencer JF, Doronin K, Tollefson AE, Wold WS, Toth K. Oncolytic adenovirus that overproduces ADP and replicates selectively in tumors due to hTERT promoter-regulated E4 gene expression. Gene Ther 2005; 12(22):1608–1617. 76. Li Y, Yu DC, Chen Y et al. A hepatocellular carcinoma-specific adenovirus variant, CV890, eliminates distant human liver tumors in combination with doxorubicin. Cancer Res 2001; 61 (17):6428–6436. 77. Kawashima T, Kagawa S, Kobayashi N et al. Telomerase-specific replication-selective virotherapy for human cancer. Clin Cancer Res 2004; 10(1, Part 1):285–292. 78. Taki M, Kagawa S, Nishizaki M et al. Enhanced oncolysis by a tropism-modified telomerase-specific replication-selective adenoviral agent OBP-405 (‘Telomelysin-RGD’). Oncogene 2005; 24(19):3130–3140. 79. Hashimoto Y, Watanabe Y, Shirakiya Y et al. Establishment of biological and pharmacokinetic assays of telomerase-specificreplication-selective adenovirus (TRAD). Cancer Sci 2008; 99(2):385–390. 80. Watanabe T, Hioki M, Fujiwara T et al. Histone deacetylase inhibitor FR901228 enhances the antitumor effect of telomerase-specific replication-selective adenoviral agent OBP-301 in human lung cancer cells. Exp Cell Res 2006; 312(3):256–265. 81. Fujiwara T, Kagawa S, Kishimoto H et al. Enhanced antitumor efficacy of telomeraseselective oncolytic adenoviral agent OBP-401 with docetaxel: preclinical evaluation of chemovirotherapy. Int J Cancer 2006; 119(2):432–440. 82. Ito H, Aoki H, Kuhnel F et al. Autophagic cell death of malignant glioma cells induced by a conditionally replicating adenovirus. J Natl Cancer Inst 2006; 98(9):625–636. 83. Endo Y, Sakai R, Ouchi M et al. Virus-mediated oncolysis induces danger signal and stimulates cytotoxic T-lymphocyte activity via proteasome activator upregulation. Oncogene 2008; 27:2375. 84. Khuri FR, Nemunaitis J, Ganly I et al. A controlled trial of intratumoral ONYX-015, a selectively-replicating adenovirus, in combination with cisplatin and 5-fluorouracil in patients with recurrent head and neck cancer. Nat Med 2000; 6(8):879–885. 85. Reid T, Galanis E, Abbruzzese J et al. Hepatic arterial infusion of a replication-selective oncolytic adenovirus (dl1520): phase II viral, immunologic, and clinical endpoints. Cancer Res 2002; 62(21):6070–6079.

312

T. Fujiwara et al.

86. Hecht JR, Bedford R, Abbruzzese JL et al. A phase I/II trial of intratumoral endoscopic ultrasound injection of ONYX-015 with intravenous gemcitabine in unresectable pancreatic carcinoma. Clin Cancer Res 2003; 9(2):555–561. 87. Galanis E, Okuno SH, Nascimento AG et al. Phase I-II trial of ONYX-015 in combination with MAP chemotherapy in patients with advanced sarcomas. Gene Ther 2005; 12(5):437– 445. 88. Nemunaitis J, Ganly I, Khuri F et al. Selective replication and oncolysis in p53 mutant tumors with ONYX-015, an E1B-55kD gene-deleted adenovirus, in patients with advanced head and neck cancer: a phase II trial. Cancer Res 2000; 60(22):6359–6366. 89. Jacobs C, Lyman G, Velez-Garcia E et al. A phase III randomized study comparing cisplatin and fluorouracil as single agents and in combination for advanced squamous cell carcinoma of the head and neck. J Clin Oncol 1992; 10(2):257–263. 90. Vokes EE. Chemotherapy and integrated treatment approaches in head and neck cancer. Curr Opin Oncol 1991; 3(3):529–534. 91. Shaked Y, Emmenegger U, Francia G et al. Low-dose metronomic combined with intermittent bolus-dose cyclophosphamide is an effective long-term chemotherapy treatment strategy. Cancer Res 2005; 65(16):7045–7051. 92. Kitazono M, Goldsmith ME, Aikou T, Bates S, Fojo T. Enhanced adenovirus transgene expression in malignant cells treated with the histone deacetylase inhibitor FR901228. Cancer Res 2001; 61(17):6328–6330. 93. Goldsmith ME, Kitazono M, Fok P, Aikou T, Bates S, Fojo T. The histone deacetylase inhibitor FK228 preferentially enhances adenovirus transgene expression in malignant cells. Clin Cancer Res 2003; 9(14):5394–5401. 94. Pong RC, Lai YJ, Chen H et al. Epigenetic regulation of coxsackie and adenovirus receptor (CAR) gene promoter in urogenital cancer cells. Cancer Res 2003; 63(24):8680–8686. 95. Hemminki A, Kanerva A, Liu B et al. Modulation of coxsackie-adenovirus receptor expression for increased adenoviral transgene expression. Cancer Res 2003; 63(4):847–853. 96. DeWeese TL, van der PH, Li S et al. A phase I trial of CV706, a replication-competent, PSA selective oncolytic adenovirus, for the treatment of locally recurrent prostate cancer following radiation therapy. Cancer Res 2001; 61(20):7464–7472. 97. Small EJ, Carducci MA, Burke JM et al. A phase I trial of intravenous CG7870, a replicationselective, prostate-specific antigen-targeted oncolytic adenovirus, for the treatment of hormone-refractory, metastatic prostate cancer. Mol Ther 2006; 14(1):107–117. 98. Tearney GJ, Brezinski ME, Bouma BE et al. In vivo endoscopic optical biopsy with optical coherence tomography. Science 1997; 276(5321):2037–2039. 99. Kelloff GJ, Hoffman JM, Johnson B et al. Progress and promise of FDG-PET imaging for cancer patient management and oncologic drug development. Clin Cancer Res 2005; 11 (8):2785–2808. 100. Hoffman RM. The multiple uses of fluorescent proteins to visualize cancer in vivo. Nat Rev Cancer 2005; 5(10):796–806. 101. Umeoka T, Kawashima T, Kagawa S et al. Visualization of intrathoracically disseminated solid tumors in mice with optical imaging by telomerase-specific amplification of a transferred green fluorescent protein gene. Cancer Res 2004; 64(17):6259–6265. 102. Kishimoto H, Kojima T, Watanabe Y et al. In vivo imaging of lymph node metastasis with telomerase-specific replication-selective adenovirus. Nat Med 2006; 12(10):1213–1219. 103. ’Okada N, Tsukada Y, Nakagawa S et al. Efficient gene delivery into dendritic cells by fibermutant adenovirus vectors. Biochem Biophys Res Commun 2001; 282(1):173–179.

Chapter 14

Protocol I: Telomerase Activity and Telomerase Expression Eiso Hiyama

Abstract The expression of telomerase in as much as 85% of malignant tumors provides an excellent tool for the diagnosis, prognosis, and treatment of cancer. The telomeric repeat amplification protocol (TRAP) assay has been the standard assay in the detection of telomerase activity and many variations of this technique have been reported. Recent advances in the application of the TRAP assay and the incorporation of techniques that provide a quantitative and qualitative estimate of telomerase activity are assessed in this chapter. Alternatively, among the components of telomerase, detection of the catalytic subunit TERT and the RNA template TERC are frequently used representing telomerase expression. The methods involved in the detection of TERT and TERC as a biomarker of cellular transformation are also reviewed. Keywords: TRAP, Telomerase, TERT, TERC, In situ detection techniques.

14.1

Introduction

Telomerase is an RNA-containing ribonucleoprotein enzyme that synthesizes TTAGGG telomeric DNA repeats onto the ends of chromosomes (1). Telomerase was first described as the novel telomere terminal transferase in ciliated protozoans, Tetrahymena (2) and maintains telomere length during cell division (3). In humans, telomerase is expressed in most cancer tissues and immortalized cell lines (4, 5) and contains several protein components and an RNA subunit. Among them, two main subunits, the rate-limiting catalytic subunit, human telomerase reverse transcriptase (TERT), and the integral RNA template, human telomerase RNA component (TERC) (2, 6–8), are necessary to reconstitute the activity.

E. Hiyama Natural Science Center for Basic Research and Development, Hiroshima University, 1-2-3 Kasumi, Minami-ku, Hiroshima, 734-8551, Hiroshima, Japan, e-mail: [email protected]

K. Hiyama (ed.), Telomeres and Telomerase in Cancer. DOI:10.1007/978-1-60327-879-9_14, #Humana Press, a part of Springer Science + Business Media, LLC 2009 315

316

E. Hiyama

Several techniques to assess telomerase activity and the expression of telomerase components have been developed. These techniques have been modified to meet the challenges of detection of telomerase activity and telomerase components from different sources of tumor samples, which include whole cells, fixed tissues, cell lysates, and mixed populations of cells. The telomeric repeat amplification protocol (TRAP) assay has been the standard method of choice in detection of telomerase activity (4, 9, 10). With the TRAP assay as the foundation, several quantitative methods for detecting telomerase activity have been developed. Moreover, the methods for the detection of telomerase components, especially TERT and TERC, have been also developed. In this review, the methodologies for the detection of telomerase and telomerase components are summarized.

14.2

Telomeric Repeat Amplification Protocol Assay

The TRAP assay was developed as a highly sensitive in vitro assay for detection of telomerase activity in clinical specimens (4), and is still most convenient for detection of telomerase activity with a little modification. This method is divided into three main steps that consist of the extension by telomerase, amplification by polymerase chain reaction (PCR), and the detection of telomerase products (Figs. 14.1 and 14.2). The improved version allows for the elimination of the need for a wax barrier hot start, reduction of amplification artifacts, and better estimation of telomerase processivity by using a modified reverse primer sequence. Then, these steps have been modified, giving rise to TRAP-dependent (e.g., TP-TRAP) or independent (e.g., TMA/HPA) assays (Tables 14.1 and 14.2). In the extension Extension Step TS primer

5’ AATCCGTCGAGCAGAGTT 3’ + dNTPs

TS primer cell extract

Telomerase

GGTTAG GGTTAG

3’

5’

CX primer wax (Original TRAP assay only)

PCR Amplification M

M

M: Mismatch

M

AATCCCATTCCCATTCCCATTCCC

Reverse primer (CX primer)

TS primer

Detection Radioactive:

PAGE (Densitometry)

Nonradioactive: Colorimetric Chemiluminescence/Luminescence

TRAP, TP-TRAP, TRAP-SPA ELISA-TRAP, RTQ-TRAP HPA, LHA

Fig. 14.1 Summary of original TRAP assay. This assay consists of three steps: telomerasemediated extension, PCR amplification, and detection steps

14 Protocol I: Telomerase Activity and Telomerase Expression a

b

Original TRAP assay 1000

0

A

B

N Pr Pr N Pr - - + - -

1000 : Activity level by dilution F

1000 A

Control cells

1/ 10 1 /1000

N Pr Pr 1 /100 - - - - - +

– 10

100 1000

- -

-

-

Heat

317 TRAP-eze™

0 B

1 C

10 D

100 E

Control Cell TSR8

1000 F

N Pr Pr N Pr N Pr N Pr N Pr N Pr Pr - - + - - - - - - - - - - +

– -

Ly 10 100 1

-

-

-

2

- -

62 bp 56 bp 50 bp 46 bp 40 bp

10% PAGE

36 bp Internal control

12.5% PAGE

Fig. 14.2 Telomerase activity in lung cancer tissues (cases A-F) using original TRAP assay (a) and TRAPezeTM kit (b). Relative telomerase activity level using TRAPezeTM kit is expressed as the ‘‘Total Product Generated (TPG),’’ calculated by the following formula: TPG (units) = {(x
xo)/c}/{(r
ro)/cR}  100, x: signal intensity of 6-bp ladders in a sample, xo: that in heattreated sample, r: that in TSR8 control, ro: that in lysis buffer, c: signal intensity of 36-bp internal control in the sample, cR: that in TSR8 control. Activity level determined by serial dilution in original TRAP assay well correlates with that determined using the TRAPezeTM kit

step, telomerase in the cell extract adds telomeric repeat to the substrate (TS), a nontelomeric oligonucleotide. The extension products are amplified about a million fold by the PCR (Tables 14.1 and 14.2) using specific primers, and in most cases the amplified products are analyzed by electrophoresis. However, the accuracy of detection depends on the amplification cycles and the primers used (22). Dimers, by-products that arise from primer–primer interactions, are a frequent occurrence in PCR step, which would generate false-positive results. Several primers have been designed to minimize the dimers (12, 15). Usually, tumor tissues consist of cancerous tissues with surrounding normal tissues and contaminated inflammatory cells. Therefore, the wide detection range of the TRAP renders it applicable to detecting minute amounts of telomerase in a mixed population of cells. Despite the many advantages, the assay cannot evaluate the origin of this activity in the tissues, unless evaluated in situ. Thus, when the activate lymphocytes with telomerase activity exist in the cancer tissue, the results of TRAP assay become positive regardless the existence of telomerase activity in cancer cells.

14.2.1

Original TRAP Assay

The sequences of primers used in various versions of TRAP assay are listed in Table 14.2 and reagents are in Table 14.3. Since telomerase contains RNA component (TERC), all reagents until PCR step should be free of RNase, using diethyl pyrocarbonate (DEPC)-treated water (however, remnant of DEPC inhibits the next

10 min 2h 2h 10 min 20 min 30 min 30 min

30 min

TS TS TS TS TS TS b-TS

Promoter primer (PP) b-TS

mTRAP (15) TRAP-PAGE (10) TRAP-ELISA (10) SPA-TRAP (16) RTQ-TRAP (17) MBRA-TRAP (18) Immunomagnetic separation-TRAP (19) TMA/HPA (20)

LHA (21)

40 min

30 C

20 C

Reverse primer (RP) ACX

CXa/CX-ext ND ND b-CX ACX CX RP

RP/RPC3g

30 C RT RT RT 37 C 25 C RT 30 C

ACX, ACT CX, CX-ext RP/RPC3g

30 C 30 C 30 C

PCR conditions

No PCR amplification

94 C 30 s, 55 C 30 s

94 C 30 s,50 C 30 s, 72 C 1.5 min 94 C 30 s, 60 C 30 s 94 C 30 s, 50 C 30 s, 72 C 30 s (94 C 30 s, 55 C 60 s, 72 C 90 s)b (94 C 30 s, 63 C 30 s, 72 C 30 s)b (94 C 30 s, 55 C 60 s, 72 C 90 s)b (94 C 30 s, 63 C 30 s, 72 C 30 s)b 94 C 30 min, 50 C 30 min, 73 C 30 min 94 C 30 s, 60 C 30 s, 72 C 15 s 94 C 30 s, 50 C 30 s, 72 C 90 s ND 95 C 20 s, 50 C 30 s, 72 C 90 s

Reaction

ND

27 24–30 1–2 3–29 1–2 3–29 30 30 32 31 40 31 33

27

Cycles

94 C 30 s, 62 C 25 s, 72 C 25 10 min TRAP, telomeric repeat amplification protocol; mTRAP, modification TARP assay; TP, two-primer; SPA, scintillation proximity assay; HPA, hybridization protection assay; TMA, transcription-mediated amplification; MBRA, magnetic bead retrieval assay; LHA, luminometric hybridization assay; TS, telomerase substrate; RTQ, real-time quantitative; ELISA, enzyme-linked immunosorbent assay; b-TS, biotinylated TS; ND, not defined a Sequences of the primers used in these assays are listed in Table 14.2 b In TP-TRAP, PCR condition is different between the first and the second cycles and the subsequent 27 cycles (i.e., from 3rd to 29th)

30 min

GTS

TP-TRAP (13)

10 min 10 min 30 min

TS TS MTS

mTRAP (11) mTRAP (12) TP-TRAP (13, 14)

Table 14.1 PCR conditions in various detection methods based on TRAP assay Assay Forward primersa Initial incubation Reverse primersa Amplification Time Temperature process TRAP (4) TS 10 min 23 C CX

318 E. Hiyama

14 Protocol I: Telomerase Activity and Telomerase Expression

319

Table 14.2 Sequences for the forward and reverse primers used in the TRAP assay Primer name Sequence TS (telomerase substrate) 50 AATCCGTCGAGCAGAGTT-30 (4, 10, 12, 13, 15–18) Reverse primer CX (4, 12, 13) ACXa (11, 15, 17) ACTa (11, 15, 17) CX-ext (12) CXa (15)

50 -(CCCTTA)3CCCTAA-30 50 -GCGCGG(CTTACC)3CTAACC-30 50 -GCGCGG(CTAACC)3-30 50 -GTG(CCCTTA)3CCCTAA-30 50 -GTG(TAACCC)3-30

Combined reverse primers RPb,c (13, 14) RPC3b (13, 14) RPC3gc (13, 14)

50 -TAGAGCACAGCCTGTCCGTG-30 50 -TAGAGCACAGCCTGTCCGTG(CTAACC)3-30 50 -TAGAGCACAGCCTGTCCGTG(CTAACC)3GG-30

Forward primer MTSd (13) 50 AGCATCCGTCGAGCAGAGTT-30 d GTS (13) 50 -GGTGGGGCGAGCAGAGTT-30 a PCR artifact formation is reduced in the absence of hot start conditions with the forward primer TS. ACX is the better of the two primers b Use of the two reverse primers (RP and RPC3) reduces artifacts and dimer formation c Use of the two reverse primers (RP and RPC3g) shows no artifact nor dimer formation d Longer telomerase products are obtained with the GTS than the MTS primer

PCR step) or RNase-free water, and gloves and sterilized tips and tubes should be used. Aerosol-resistant tips are recommended to avoid contamination. The protein extraction process is a crucial step as the extraction efficiency of telomerase from cells or tissues directly affects the quantitative estimation of enzyme activity. Therefore, reagents that effectively extract telomerase and keep it stable in the lysate qualify as suitable lysing agents. The original method developed by Kim et al. (4), referred to as the TRAP assay, uses physical cell disruption to improve the sensitivity of the method in addition to minimizing experimental variabilities so as fewer cells (10–10,000 cells) can be evaluated (4, 9). The original TRAP assay has the potential of detecting telomerase activity even in a single cell (24). When the surface of tissue samples is contaminated, these samples should be washed in ice-cold washing buffer (PBS or lysis buffer) of sufficient quantity for the whole tissue to be flooded. The tissue should be minced with a scalpel if the tissue samples are too hard to be homogenized by a pestle. For cell samples, this step is eliminated. A 50–100 mg fresh or frozen (
80 C) tissue sample is put in a sterile 1.5-mL microcentrifuge tube containing 200 mL ice-cold CHAPS lysis buffer and homogenized by using a tube-matched pestle on ice. For cell samples, 5  106–107 cells are homogenized in 100–200 mL ice-cold lysis buffer by pipetting. Incubate the tube for 25 min on ice, centrifuge it for 20 min at 16,000  g, 4 C. Collect the upper 80% of the supernatant in a fresh tube so that the precipitation is not mixed. Rapidly freeze the collected supernatant in liquid nitrogen. Measure the concentration of protein in the lysate using a BCA protein assay kit, and an aliquot of the

320

E. Hiyama

Table 14.3 Reagents for original TRAP assay (9, 22, 23) Reagents Contents Lysis buffer stock 10 mM Tris-HCl (pH7.5), 1 mM MgCl2, 1 mM EGTA (ethylene glycol-bis(b-aminoethyl ether)N,N,N0 ,N0 -tetraacetic acid, pH 8.0), 0.5% CHAPS (3-[(3-cholamidopropyl)-dimethyl-ammonio]-1propanesulfonate, Pierce, Rockford, IL), and 10% glycerol in diethyl pyrocarbonate (DEPC)-treated water. Stored at room temperature b-mercaptoethanol (14.4 M) Stored at 4 C and 3.5 mL is added to 10-mL lysis buffer (final 5 mM) just prior to extraction AEBSF (4-(2-aminoethyl)-benzenesulfonyl fluoride hydrochlorine, ICN, Costa Mesa, CA). Stored at
20 C in small aliquots (~300 mL) and 10 mL is added to 10 mL lysis buffer (final 0.1 mM) just prior to extraction (Pierce, Rockford, IL) Determination of protein BCA Protein Assay ReagentTM concentration. Stored at room temperature Spectrophotometer Available for measuring absorbance at 562 nm (Molecular BioProducts San Diego, CA), Stored at HotStart 50TM PCR tube room temperature CX primer (50 ng/ml, see Table 14.2). Synthesized, purified by HPLC, and dissolved in TE (10 mM Tris-HCl, 1 mM EDTA). Stored at
20 C in small aliquots TS primer (50 ng/ml, see Table 14.2): Synthesized, purified by HPLC, and dissolved in TE (10 mM Tris-HCl, 1 mM EDTA). Stored at
20 C in small aliquots 10  PCR buffer 200 mM Tris-HCl (pH 8.3), 15 mM MgCl2, 680 mM KCl, 0.5% Tween 20, 10 mM EGTA (pH 8.0) in DEPC-treated water. Stored at
20 C in small aliquots 2.5 mM each dNTP 200 mM Tris-HCl (pH 8.3), 15 mM MgCl2, 680 mM KCl, 0.5% Tween 20, 10 mM EGTA (pH 8.0) in DEPC-treated water. Stored at
20 C in small aliquots T4gene32protein (2 mg/mL, Applied Biosytems, Foster City, CA), Stored at
80 C Taq DNA polymerase (5 u/mL, Takara, Tokyo, Japan). Stored at
20 C TM 32 110 TBq/mmol (GE Healthcare, Buckinghamshire, Redivue [a- P]dCTP UK). Stored at 4 C. (RedivueTM [g-32P]ATP110 TBq/mmol (GE Healthcare, Buckinghamshire, UK) is applicable when the CX primer was end-labeled)

extract containing 1–6 mg of protein will be used for each TRAP assay. For cell samples, protein assay is not needed, because the amount of extract used in one assay is determined by cell numbers derived from, 10,000–100,000 cells, rather than the amount of protein. Negative controls must be included in each experiment.

14 Protocol I: Telomerase Activity and Telomerase Expression

321

One control is lysis buffer instead of protein extract. Another control is RNase (add 0.5 mL of RNase to 5 mL aliquot of protein extract and incubate at 37 C for 20 min) or heat (incubate protein extract at 85 C for 10 min)-treated protein extract. Then the PCR mix is made: For 1 assay, 5 mL of 10 PCR buffer (final 1), 1 mL of 2.5 mM each 4 dNTP (final 50 mM each), 2 mL of 50 ng/mL TS primer (final 344 nM), 0.2 mL of 5 mg/mL T4gene32protein (Boehringer Mannheim, Indianapolis, IN, final 0.5 mM), 0.4 mL of 5 u/mL Taq polymerase (Takara, final 2 unit/assay), 0.4 mL of [a-32P]dCTP (3,000 Ci/mmol, final 4 mCi/assay), and 39 mL of DEPC-water are mixed. Into the HotStart tubes with the sealed CX primer and 48 mL each of the PCR mix, up to 2 mL of CHAPS extract containing 1–6 mg of protein or derived from 10,000–100,000 cells is added and incubated at 30 C for 30 min for extension of TS primer (Fig. 14.1). Then each tube is subjected to PCR: after 3 min at 90 C for, 31 cycles at 94 C for 40 s, 50 C for 40 s, and 72 C for 45 s, followed by 72 C for 3 min and 4 C until electrophoresis. The PCR number of amplification cycles and temperatures for denaturation, annealing, and extension vary depending on the type of method and the characteristics of the enzyme used in the PCR step. Since acrylamide is a potent neurotoxin and is absorbed through the skin, it should be handled with gloves. For polyacrylamide gel electrophoresis, 10% polyacrylamide gel and appropriate volume of 0.5 TBE buffer are prepared. Then 4 mL of loading buffer is added to 16 mL of each PCR product and subjected to electrophoresis. When BPB comes to the bottom of the gel, the gel is removed from the glass plate and subjected to autoradiography at
80 C overnight or on an imaging plate at room temperature for 1 h.

14.2.2

Modified TRAP Assay

The TRAP-eze telomerase detection kit was developed by Oncor Inc. and is now supplied by Millipore (Billerica, MA). Essentially both the original TRAP assay and the TRAP-eze kit follow similar procedures. However, the original TRAP assay has an additional step of preparing the HotStart tubes to seal CX primer during the extension of TS by telomerase (22). The TRAP-eze detection system is much more cost effective as the sampling time is less than half that of the original TRAP assay (22). The modifications of the original TRAP assay based on the primers used are listed in Table 14.2. During the polymerase chain reaction, the second step of the TRAP assay, a problem of byproduct formation exists. The use of a set of reverse primers (RP, RPC3, and RPC3g) is more beneficial not only in the reduction of primer-dimer formation but also in detecting the enzyme processivity. The primers ACX, CX-ext, and CXa also help in decreasing dimer formation. With regard to the choice of primers in the TRAP assay, the reverse primers are more specific than the original CX primer in annealing to the telomerase substrate, which helps prevent dimer formation. Products formed using these primers are a direct reflection of the

322

E. Hiyama

number of repeats originally extended by telomerase in the extract, and therefore are a true estimate of telomerase activity.

14.2.3

Internal Standard and Quantification in TRAP Assay

Internal standard enables distinguishing false negative result due to assay inhibitors in samples and normalization of the telomerase activity, allowing a comparative assessment between samples (22, 25). In the detection step, each lane is analyzed separately, and the activity is measured as a ratio of the telomerase products to the internal standard and plotted as a logarithmic curve (9, 22). A logarithmic curve gives a better linearity, especially when activity is measured for fewer cell numbers (9, 22). Tissue extracts sometimes contain inhibitors for the TRAP assay. These inhibitors mainly affect the PCR step rather than the step of telomerase-mediated extension of the TS primer. Then, when the existence of inhibitors is suspected by the disappearance of both internal control and telomerase signals, they should be removed before the PCR step (described in next section). The original TRAP assay utilizes a 150-bp ITAS (internal telomerase assay standard) while the TRAP-eze kit utilizes a short standard of 36 bp (9, 18, 22). In comparison to the 150-bp ITAS, the 36-bp standard is uniformly amplified, but tends to be overamplified in samples with low telomerase activity (22), because the 36 bp is shorter than the telomerase signal ladders and a shorter fragment is more effectively amplified by Taq polymerase in competitive PCR. For the same reason, the ITAS is more sensitive to inhibitors than the short internal standard of 36 bp (18, 22), because the 36 bp can be amplified even under the existence of some amount of inhibiters that inhibit the amplification of telomerase signal ladders (22). Therefore, appearance of the 36-bp internal standard without telomerase ladder signal cannot deny false negative due to inhibitors, and thus this short standard may not be suitable in the analysis of telomerase activity in tumor tissues. The longer internal standards such as ITAS are amplified by the same primers that recognize the extended telomerase substrate and longer than the main telomerase substrate, meaning more sensitivity to PCR inhibitors than the telomerase ladder signals. Thus any inhibitors in the sample that affect the amplification of the telomerase products may be detected by a longer standard. The primers used for the amplification of internal standards can also be replaced by amplifluors that are labeled with dyes that emit fluorescence at a wavelength different from that of the telomerase products, allowing the simultaneous detection of telomerase products and the internal standard (26). These methods described thus far have utilized radioactive isotopes (Fig. 14.2) in the detection of end products generated by TRAP. This makes the assay tedious

14 Protocol I: Telomerase Activity and Telomerase Expression

323

and cumbersome and could be replaced by nonradioactive staining. The use of staining dyes such as ethidium bromide or SYBR green I allow detection by gelbased analysis. In these cases, telomerase activity can be quantified by densitometric analysis but may not provide an accurate estimate of enzyme activity. Recent developments in PCR techniques have enabled the use of fluorescent moieties, luminescence reactions, or chromogenic substrates for PCR product quantification, which is an essential part of most modified TRAP assays. These sensitive assays, such as TRAPeze XL Telomerase Detection Kit (Millipore), have practically replaced the radioactive detection of the generated TRAP products. Following detection, telomerase activity can be calculated from the amount of the products generated from the test sample, heat or RNase-inactivated test sample, internal control of the test sample, lysis buffer only, standard, and internal control of the standard. On the basis of the mode of quantification, e.g., radioactive counts, densitometric intensities, or fluorescence, the total products generated by telomerase in the sample extract may be calculated as shown in Fig. 14.2.

14.2.4

Method for Removal of PCR Inhibitors

Most inhibitors affect the PCR amplification step during TRAP assay as they inhibit Taq polymerase activity. The heme-containing compounds derived from blood contamination have been found to be inhibitory (22). When inhibitors exist, removal of them is necessary to quantify the telomerase activity. To remove TRAP assay inhibitors before PCR, the primer extension step is carried out in a 1.5 mL microcentrifuge tube instead of a HotStart tube (classical TRAP assay) or PCR tube (modified assay). For 1 assay, 40 mL of DEPC-water, 5 mL of 10 PCR buffer (final 1), 1 mL of 2.5 mM 4 dNTP (final 50 mM), 2 mL of 50 ng/mL TS primer (final 344 nM), and 2 mL of the CHAPS extract are mixed and incubated at 30 C for 30 min (extension of the TS primer). After incubation, 5 mL (1/10 volume) of 5 M NaCl and 25 mL (1/2 volume) each of phenol and CIAA (chloroform/ isoamylalchohol = 24:1) are added, mixed well, and centrifuged at 10,000 rpm for 10 min at room temperature. The supernatant is transferred to a new microcentrifuge tube, 125 mL (2.5-fold volume) of ethanol is added, mixed well, stored at
20 C for overnight or
80 C for 20 min, and centrifuged at 12,000 rpm for 20 min at 4 C. After the supernatant is removed, the pellet is rinsed with 70% ethanol, centrifuged at 12,000 rpm for 10 min, and again the supernatant is removed. The pellet is briefly dried, dissolved with 5 mL of DDW, and subjected to the PCR step.

324

E. Hiyama

14.2.5

Advanced Techniques of TRAP Assay

14.2.5.1

Two-Primer-TRAP

Two-primer-TRAP (TP-TRAP) utilizes two reverse primers instead of one (13, 14), which leads to more sensitive and accurate detection of telomerase activity (13, 14). For the analysis of telomerase activity in the original or other modified TRAP assays, the total products generated are resolved by electrophoresis and quantified by densitometric methods for the elimination of by-products of primer dimmers. The TP-TRAP does not need the electrophoretic analysis of the total products generated, replacing it with radioactive quantification of telomerase activity. The method entails the extension of the forward primer, MTS (Table 14.2), by telomerase, which is amplified in the presence of two reverse primers [RP, 20-mer; RPC3, 38-mer (Table 14.2)] and tritiated thymidine nucleotides (3H-TTP) (13, 14). The assay permits the detection of slight quantitative differences in telomerase activity among samples and can be applied to the screening and characterization of telomerase inhibitors (13, 14). An advantage of assessing enzyme processivity with TPTRAP is that the original size of the telomerase products is not altered, and the measurement is directly visualized as a specific band size on the gel if electrophoresed. A major disadvantage of this method is the higher number of PCR cycles required than other assays. This can alter the quantitation of the generated.

14.2.5.2

Scintillation Proximity Assay

For the requirement of speed and accuracy in telomerase assay to be used in high through-put screening, the SPA (scintillation proximity assay)-TRAP was developed (16, 27). SPA-TRAP utilizes substrate oligonucleotides that are biotinylated at the 50 end and PCR amplification of the extended products is carried out in the presence of tritiated (3H) thymidine. The biotinylated 3H-labeled products are isolated by binding to streptavidin-coated fluoromicrospheres which contain a scintillant (b-emitter) that is stimulated only in the presence of tritium. Thus, TRAP products that incorporate the 3H-labeled nucleotides will stimulate the scintillant, producing a signal. Although the sensitivity of SPA-TRAP is relatively low, a large number of samples can be assessed, making SPA-TRAP potentially useful for high through-put screening (16).

14.2.5.3

Real-Time Quantitative TRAP Assay

Qualitative and semiquantitative measurements of telomerase activity have shown that telomerase activity levels correlate with tumor progression, indicating that tumors expressing this enzyme possess clinically aggressive behavior (5, 28).

14 Protocol I: Telomerase Activity and Telomerase Expression

325

Amplification of telomerase products by PCR is often quantitatively inaccurate because the amplified amount at end point of the amplification process does not linearly represent the applied amount. Real-time PCR is a clinically transferable method and the advancement of real-time measurements of telomerase will facilitate moving telomerase activity and technologies toward clinical validation. Realtime TRAP is more accurate than original TRAP assay as it relies on threshold cycle (Ct) values determined at low concentrations of telomeric repeats before PCR saturation (29). A comparative assessment of real-time TRAP with the original TRAP assay reveals that the original TRAP assay tends to overestimate telomerase activity. Another problem with the original TRAP assay is that the result may be evaluated at higher PCR cycles where some samples might have reached a plateau, inhibiting the detection of minute differences in telomerase activity among samples. Real-time TRAP seems to be the method of choice in terms of reliability, speed, reproducibility, and accuracy. Primer-dimers are generally augmented later in the PCR amplification program (35–39 cycles), while the end point of the assay is approximately 28 cycles (17), thereby the influence of primer-dimers can be reduced. In addition, signals generated by primer-dimers differ from the real amplification products and are not likely to interfere with the results. Because of these advantages, the real-time TRAP is applicable to large-scale evaluation of telomerase activity and evaluation of the efficacy of inhibitors for anti-telomerase therapy. A simple real-time TRAP with the use of SYBR Green has been described (30). However, the internal control that would monitor the PCR in the same test-tube (to eliminate false-negative results and to normalize results) is missing in this arrangement. This problem is avoided by adapting the TRAPeze XL kit for use in real-time quantitative TRAP (29, 31). The real-time mode gives an opportunity to evaluate telomerase activity and to recognize false-positive results directly from reaction kinetics, thus avoiding time-consuming post-amplification analysis. Further, when considering the recent expansion of availability of real-time instruments, the realtime TRAP seems to be a good choice for research and clinical applications.

14.2.5.4

TRAP-Enzyme-Linked Immunosorbent Assay

The TRAP-ELISA is similar in many respects to that of the original TRAP assay except that the generated products are detected colorimetrically, which provides a qualitative and semiquantitative estimate of telomerase activity (10), as is the fluorometric TRAP assay such as TRAPeze XL. The lack of an internal control makes it unreliable in accurately distinguishing telomerase-positive and telomerase-negative samples, and therefore, it should be used in multiple sample analysis for laboratory purposes.

326

14.2.5.5

E. Hiyama

Magnetic Bead Retrieval Assay and TRAP

In the environment of large fluid volumes and telomerase-negative cells, detection of telomerase activity in a small population of telomerase-positive cells may be difficult. A solution to such a problem has been overcome by implementing the magnetic bead retrieval method in association with the original TRAP assay (18). The magnetic bead retrieval-TRAP assay consists of three main parts: extension of the substrate oligonucleotide by telomerase, isolation of the extended products by magnetic beads, and PCR amplification.

14.2.5.6

Hybridization Protection Assay (HPA)-TRAP

In the HPA-TRAP assay, the telomerase extended products are amplified as in the original TRAP assay but the detection of the generated products is carried out with the use of hybridization protection assay. The HPA is a nonradioactive and nonelectrophoretic method for the detection of the amplified products that utilizes an acridinium ester-labeled probe (20). The assay is sensitive with regard to detection. However, variances affecting PCR are likely to be reflected in the end product affecting the signal generated, and PCR amplification can be eliminated, when HPA is used in conjunction with transcription-mediated amplification, as below.

14.2.5.7

Transcription-Mediated Amplification and Hybridization Protection Assay

Transcription-mediated amplification was the first method developed that amplified telomerase extended products without PCR (20), unlike the ELISA and PCR-gelbased assays that are more time consuming. The sensitivity of the method enables the detection of telomerase activity with a linear range of 1–1,000 cells in a sample. However, single-stranded RNAs produced in some steps of the reaction, e.g. RNAs transcribed by T7 RNA polymerase, can be degraded if RNases are present. As a result, the RNA amplicons generated may be reduced, resulting in underestimation of telomerase activity levels. Therefore, samples need to be handled carefully to prevent contamination with degrading enzymes.

14.2.5.8

In Situ TRAP Assay

Since the TRAP assay is a solution-phase technique in which the resulting activity represents the average value for all extracted cells, information on the cell type with telomerase activity is lost. For example, it is not possible to find out whether the activity comes from tumor cells or from other cells present in the sample, such as activated lymphocytes. To overcome this limitation, the in situ version of the TRAP

14 Protocol I: Telomerase Activity and Telomerase Expression

327

assay was developed using both substrate and reverse primers labeled by FITC, but this methodology could only be used on fresh viable cells (32). In this technique, cell suspension samples are first cytospun onto nonfluorescent silane-coated slides and dried with cold air. Then reagents for the TRAP reaction and the fluorescentlylabeled substrate primer are added to a chamber frame that has been placed over each specimen slide to hold the reaction solutions. After incubation (extension of substrate primer), the FITC-labeled reverse primer is added, telomerase is heatdenatured and in situ PCR is performed. After PCR, the slides are rinsed, sealed with a cover glass, and examined with a fluorescence microscope. Then the slides can be stained conventionally after evaluation of the location of fluorescence and reexamined for identification of cell types. Finally, the fluorescence intensity and localization (nuclear, cytoplasmic, or both) are evaluated for each of the cell types found. This method is useful to evaluate the telomerase activity in each cell and crucial to obtain good results.

14.3

Detection of Two Main Subunits of Human Telomerase: TERT (Human Telomerase Reverse Transcriptase) and TERC (Telomerase RNA Component)

Although the determination of telomerase activity using TRAP assay is a powerful tool in the diagnosis of cancer, it is unsuitable to detect the source or origin of this activity. The expression of TERT is a direct reflection of the physical association and functional activity of telomerase. In normal somatic cells, TERC is constitutively expressed but TERT is absent. However, in most tumors, overexpression of TERC is accompanied by an increase of telomerase activity. And recently, the dysregulation of TERC expression was revealed to be the cause of some diseases including dyskeratosis (33, 34). Since the detection of TERT and TERC are expected to be promising biomarkers of cancer diagnosis and prognosis, the focus of this review is on detection of the catalytic subunit of telomerase, TERT, and telomerase RNA component, TERC.

14.3.1 Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR): Detection of TERT and TERC Three main steps are involved in RT-PCR: (a) extraction or isolation of RNA, (b) cDNA synthesis, and (c) amplification of the cDNA. Total RNA can be isolated from tissue samples or tumors by the usual extraction protocols including guanidium isothiocyanate extraction (35), or by tri-reagent protocol (36).The isolated RNA is treated with DNase, if necessary, and a fraction (0.1–10 mg of total RNA) is reverse transcribed into cDNA (37). Since TERC has no poly A tail, cDNA reverse-

328

E. Hiyama

transcribed using oligo dT is unsuitable for the detection of TERC. Finally, the synthesized cDNA is amplified using specific primers either in standard PCR (37) or in real time-PCR (38, 39). The choice of primer sets and reaction conditions depend upon the TERT region to be amplified because several splicing variants of TERT exist (40, 41). The primer setting should be selected for enabling detection of full-length TERT. Our primer set for detection of full-length TERT is designed to target exons 6–8 as follows: Forward primer, 50 -CACGTCCGCAAGGCCTTCAA-30 Reverse primer, 50 -AGCGTAGGAAGACGTCGAA-30 TaqMan probe, 50 -FAM-TCATCGAGCAGAGCTCCTCCCTGAA-30

14.3.2

In Situ Detection of TERT and TERC

When TERT mRNA expression or telomerase activity are examined by using RTPCR or the TRAP assay, the presence of normal telomerase-positive cells, such as lymphocytes or basal epithelial cells, can cause false positive results. Methodology for the in situ detection of telomerase in individual cells would be expected to solve this problem. An in situ TRAP assay had previously been developed to detect the telomerase activity, but this methodology could only be used on fresh viable cells (32). The use of in situ hybridization (ISH) to detect components of the telomerase complex (TERC and TERT mRNA), on the other hand, would be applicable to fixed tissues. However, TERC is also present at low levels in most cells lacking telomerase activity, and its level does not always correlate with telomerase activity. A better target for ISH detection would be the TERT mRNA, whose levels appear to closely parallel those of telomerase activity. The presence of TERT in tissue samples and cell lines may be useful in identifying the stages and grades of the tumor. Depending upon the test sample (i.e., fixed tissue, whole cells, or tissue lysate), TERT and TERC can be detected by ISH (42), immunofluorescence-based flow cytometry (43), or RT-PCR. TERT can also be detected by immunohistochemistry (IHC). In some instances a combination of two of these methods can be employed in the detection (Fig. 14.3).

14.3.2.1

In Situ Hybridization for TERC and TERT mRNA

In situ hybridization allows the direct assessment of distribution patterns of the specific mRNA without affecting cellular integrity. Probes that hybridize to the mRNA of interest may be synthetic DNA oligonucleotides, peptide nucleic acids (PNAs), or riboprobes. Of the several probes available, the synthetic oligonucleotides (which are about 40–50 nucleotides in length) are the most suitable. Such probes are small and can easily enter the cell for hybridization. Moreover, the

14 Protocol I: Telomerase Activity and Telomerase Expression

a TERC-ISH

329

c TERC + TERT

b TERT-IHC

Fig. 14.3 In situ detection of TERC and TERT of testis. (a) In the section of human testis, TERC expression was detected in almost all cells by in situ hybridization (ISH). (b) Immunohistochemistry (IHC) of TERT revealed that the expression of TERT protein was detected in spermatocytes but not in quiescent spermatogonia and mature spermatozoa. (c) For double staining, TERC ISH was performed first and then TERT IHC was developed on the same slides. Double labeling revealed that the expression of TERC was detected in most cells of the seminiferous tubules whereas TERT signals were detected in only a subset of spermatocytes and maturing spermatids. There were no cells with TERT signals without TERC expression (See Color Insert)

oligonucleotide sequences can be designed to anneal specifically to the mRNA of interest and thus prevent nonspecific hybridization. The probes can also be designed with a high GC content to increase the strength of bonding in hybridization. The DNA oligonucleotides are also resistant to RNases and therefore require no special treatment while handling. Riboprobes form stable hybrids with RNA and thus become resistant to RNase after the hybridization step. This allows the posthybridization analysis of the hybrids where unbound RNA is degraded by RNases. The probes are end-labeled either with digoxigenin, biotin, or radioactive isotopes. Digoxigenin-labeled probes are better suited to the detection of TERT or TERT mRNA since digoxigenin (a compound derived from plants) is not present in human cells, which facilitates detection with a low background signal. Briefly, our protocol is as follows: sections were deparaffinized and rehydrated through ascending grades of alcohol to buffered saline (TBS or PBS, pH 7.4). After heat-based antigen retrieval, sections were treated with 0.005% pepsin in 0.2 N HCl or proteinase K in 0.05 M Trsi-HCl for 20 min and then hybridized overnight with a

330

E. Hiyama

fluorescein isothiocyanate (FITC)-labeled probe. The sections were washed stringently and immersed in 3% H2O2, and then sections were treated with anti-FITC antibody horseradish peroxidase (HRP) conjugate for 30 min. To magnify the signals, the sections are treated with fluorescyl tyramide reagent for 15 min. When the [35S]-UTP-labeled single strand RNA probes were used, the sections should be washed thoroughly at 50 C, dehydrated and dipped in Kodak NTB-2 nuclear track emulsion and exposed in a light tight box (44). Digoxigenin (DIG)labeled riboprobes are also available. To detect TERT mRNA expression, its probe should be designed carefully because of the presence of TERT splice variants (45). While it is necessary to target sequences specific to the full-length mRNA, e.g. a region in motif 3, to avoid false positive results derived from nonactive or dominant-negative splice variants, the ISH detection of the TERT mRNA is expected to become a powerful tool for cancer detection. In situ studies for the detection of TERT mRNA as well as TERT protein have been applied by various groups to many different tissue types (42, 46–48). In some tissues, two types of distribution pattern in TERT expression were observed, diffuse and focal (42). In others, a perinuclear and/or a cytoplasmic staining pattern was observed (46). Tissues with diffuse TERT distribution pattern consisted of a majority of telomerase-positive cells. TERT-positive cells were scattered among viable or necrotic TERT-negative neoplastic cells. Similar distribution patterns are seen in breast, colon, and cervical cancers (49–51). The focal distribution is seen in both telomerase-positive and telomerase-negative tumors. The TERT-positive cells with diffuse distribution tend to have a higher proliferative index and tend to be more frequently observed in tumors of smaller size compared with the cells with focal distribution. TERT-positive cells with focal distribution had a shorter survival time. The type of TERT distribution in some cases correlates well with the clinicopathological parameters, while in others there is no relationship between the TERT expression and the proliferative index, grade, or stage of the tumor. Although TERT subunit expression appears to be a useful indicator for the prognosis of the disease, it still remains to be ascertained whether it has prognostic potential.

14.3.2.2

In Situ Detection of the TERT Protein

For evaluating TERT expression, several investigators have reported successful use of TERT mRNA ISH (52, 53). For this purpose, immunohistochemistry (IHC) can also be used. This method can evaluate the presence of TERT protein in a wide variety of clinical samples, including archival paraffin-embedded specimens (47, 53, 54). In spite of its very low concentration, the TERT protein can now be detected in paraffin-embedded samples and core biopsies with the use of polyclonal or monoclonal antibodies in conjunction with appropriate antigen retrieval (Fig. 14.4) and/or the highly sensitive tyramide-based method of signal amplification (55). Since IHC does not require specialized equipment for detection, TERT IHC is expected to become a powerful new technology for cancer detection. In most cancer tissues, the TERT protein expression is heterogeneously distributed and, in

14 Protocol I: Telomerase Activity and Telomerase Expression

a

c

b

d

331

Fig. 14.4 In situ detection of TERC and TERT in tissue and cell samples. (a) TERC expression in a primary neuroblastoma sample by in situ hybridization. Almost all samples were positive. (b) TERT protein expression in a primary neuroblastoma sample detected by immunohistochemistry. Most tumor cells showed positive signals but some tumors did not. (c) Immunohistochemistry for pancreatic brushing cells: almost all dysplastic cells showed TERT protein expression. This case was diagnosed as a ductal adenocarcinoma of the pancreas after surgery. (d) Immunohistochemistry for pancreatic brushing cells: Normal pancreatic epithelial cells showed no TERT protein expression (See Color Insert)

some cases, is found to be regionally different. In most cancer specimens, the signal intensity of individual TERT-positive cells did not differ substantially between tumors with high and low telomerase activity in their tissue extracts, indicating that the level of telomerase activity in tissue extracts was mainly dependent on the percentage of cells with TERT expression rather than the activity level in each cell (47, 56, 57). This heterogeneity in telomerase expression appears to be an important factor dictating the overall levels of telomerase activity in tumors. With the availability of TERT IHC, telomerase-positive cancer cells can now be evaluated in tissues containing a background of normal telomerase-positive cells. For example, we have clearly observed changes in the TERT protein expression according to multistep carcinogenesis in pancreatic tissues: the TERT protein was undetectable in normal pancreatic tissue cells except for lymphocytes, while it was present at low levels in the regional epithelium with moderate to severe dysplasia and at high levels in carcinoma in situ (56, 57).

332

E. Hiyama

Briefly the protocol for detection of TERT is as follows: An affinity-purified polyclonal rabbit antibody against TERT (EST21A, Alpha Diagnostic International, San Antonio, TX) was raised against a 16 amino acid peptide sequence that maps to the middle of TERT. The validity of the antibodies used here was discussed in previous reports for Western blotting and immunostaining (47). Tissue sections were deparaffinized and rehydrated through ascending grades of alcohol to Trisbuffered saline (TBS), pH 7.4. Heat-based antigen retrieval was performed as follows: sections were treated for 15 min in 0.01 M citric acid buffer, pH 6.0 in 2 atm and 120 C using an autoclave. Endogenous peroxidase was quenched in 3% H2O2. After washing three times for 5–10 min in TBS, nonspecific antibody binding was blocked by incubating the sections in protein blocking solution (Dako, Carpinteria, CA) for 30–60 min. Sections were then incubated with primary TERT antibody at a dilution of 5–10 mg/mL at 4 C overnight. Following subsequent incubations, the sections were thoroughly washed and incubated in the labeled streptavidin biotin polymer (Envision Plus, Dako), followed by 0.05% 3,3-diaminobenzidine (DAB) or 3% 3-amino-9-ethyl carbazole (AEC) in TBS with H2O2 as a substrate for TERT immunohistochemical staining. Sections were lightly counterstained with Mayer’s hematoxylin, and then mounted. Negative controls consisted of an omission of the primary antibody. Analysis of telomerase activity in tissue lysate measures its average level of all cell types present in the tissue sample. Utilizing this in situ technique, the cell types expressing TERT can be determined.

14.4

Concluding Remarks

Telomerase reactivation has been implicated in the mechanisms of tumor formation, progression, migration, and invasion. The use of sensitive techniques (Fig. 14.1 and Table 14.1) has enabled the detection of telomerase activity from a variety of sources such as tissue effluents, pleural effluents, juices (pancreas or bile), washings, blood, serum, fine needle aspirations, fresh-frozen and paraffinembedded tissues, and exfoliations. On the basis of extensive surveys conducted on different tissues, a strong relationship between tumor development and telomerase activity exists. Therefore, telomerase serves as a universal marker and tool for the diagnosis and prognosis of many cancers. Overall, TRAP assay is very sensitive in detecting the telomerase activity in the extract derived from the cells or tissue samples, while the detection of TERT by in situ and IHC enables the detection of the protein in a subpopulation of cells without disturbing the integrity of the cells. Therefore, combined evaluation of TERT expression and telomerase activity is informative and strongly advised.

14 Protocol I: Telomerase Activity and Telomerase Expression

333

References 1. Morin GB. The human telomere terminal transferase enzyme is a ribonucleoprotein that synthesizes TTAGGG repeats. Cell 1989;59:521–9. 2. Greider CW, Blackburn EH. Identification of a specific telomere terminal transferase activity in Tetrahymena extracts. Cell 1985;43:405–13. 3. Shay JW. Aging and cancer: are telomeres and telomerase the connection? Mol Med Today 1995;1:378–84. 4. Kim NW, Piatyszek MA, Prowse KR, et al. Specific association of human telomerase activity with immortal cells and cancer. Science 1994;266:2011–5. 5. Hiyama E, Hiyama K. Clinical utility of telomerase in cancer. Oncogene 2002;21:643–9. 6. Shippen-Lentz D, Blackburn EH. Functional evidence for an RNA template in telomerase. Science 1990;247:546–52. 7. Nakamura TM, Morin GB, Chapman KB, et al. Telomerase catalytic subunit homologs from fission yeast and human. Science 1997;277:955–9. 8. Feng J, Funk WD, Wang S-S, et al. The RNA component of human telomerase. Science 1995;269:1236–41. 9. Piatyszek MA, Kim NW, Weinrich SL, et al. Detection of telomerase activity in human cells and tumors by a telomeric repeat amplification protocol (TRAP). Meth Cell Sci 1995;17:1–15. 10. Wu YY, Hruszkewycz AM, Delgado RM, et al. Limitations on the quantitative determination of telomerase activity by the electrophoretic and ELISA based TRAP assays. Clin Chim Acta 2000;293:199–212. 11. Kim NW, Wu F. Advances in quantification and characterization of telomerase activity by the telomeric repeat amplification protocol (TRAP). Nucleic Acids Res 1997;25:2595–7. 12. Krupp G, Kuhne K, Tamm S, et al. Molecular basis of artifacts in the detection of telomerase activity and a modified primer for a more robust ‘TRAP’ assay. Nucleic Acids Res 1997;25:919–21. 13. Szatmari I, Aradi J. Telomeric repeat amplification, without shortening or lengthening of the telomerase products: a method to analyze the processivity of telomerase enzyme. Nucleic Acids Res 2001;29:E3. 14. Szatmari I, Tokes S, Dunn CB, Bardos TJ, Aradi J. Modified telomeric repeat amplification protocol: a quantitative radioactive assay for telomerase without using electrophoresis. Anal Biochem 2000;282:80–8. 15. Falchetti ML, Levi A, Molinari P, Verna R, D’Ambrosio E. Increased sensitivity and reproducibility of TRAP assay by avoiding direct primers interaction. Nucleic Acids Res 1998;26:862–3. 16. Savoysky E, Akamatsu K, Tsuchiya M, Yamazaki T. Detection of telomerase activity by combination of TRAP method and scintillation proximity assay (SPA). Nucleic Acids Res 1996;24:1175–6. 17. Hou M, Xu D, Bjorkholm M, Gruber A. Real-time quantitative telomeric repeat amplification protocol assay for the detection of telomerase activity. Clin Chem 2001;47:519–24. 18. Gollahon LS, Holt SE. Alternative methods of extracting telomerase activity from human tumor samples. Cancer Lett 2000;159:141–9. 19. Gauthier LR, Granotier C, Soria JC, et al. Detection of circulating carcinoma cells by telomerase activity. Br J Cancer 2001;84:631–5. 20. Hirose M, Abe-Hashimoto J, Tahara H, Ide T, Yoshimura T. New method to measure telomerase activity by transcription-mediated amplification and hybridization protection assay. Clin Chem 1998;44:2446–52. 21. Kolioliou M, Talieri M, Lianidou ES. Development of a quantitative luminometric hybridization assay for the determination of telomerase activity. Clin Biochem 2001;34:277–84.

334

E. Hiyama

22. Holt SE, Norton WE, Wright WE, Shay JW. Comparison of the telomeric repeat amplification protocol (TRAP) to the new TRAP-eze telomerase detection kit. Meth Cell Sci 1996;18:237– 48. 23. Kim TM, Benedict WF, Xu H-J, et al. Loss of heterozygosity on chromosome 13 is common only in the biologically more aggressive subtypes of ovarian epithelial tumors and is associated with normal retinoblastoma gene expression. Cancer Res 1994;54:605–9. 24. Holt SE, Wright WE, Shay JW. Regulation of telomerase activity in immortal cell lines. Mol Cell Biol 1996;16:2932–9. 25. Wright WE, Shay JW, Piatyszek MA. Modification of a telomeric repeat amplification protocol (TRAP) result in increased reliability, linearity and sensitivity. Nucleic Acid Res 1995;23:3794–5. 26. Uehara H, Nardone G, Nazarenko I, Hohman RJ. Detection of telomerase activity utilizing energy transfer primers: comparison with gel- and ELISA-based detection. Biotechniques 1999;26:552–8. 27. Bosworth N, Towers P. Scintillation proximity assay. Nature 1989;341:167–8. 28. Hiyama E, Hiyama K. Telomerase as tumor marker. Cancer Lett 2003;194:221–33. 29. Elmore LW, Forsythe HL, Ferreira-Gonzalez A, Garrett CT, Clark GM, Holt SE. Real-time quantitative analysis of telomerase activity in breast tumor specimens using a highly specific and sensitive fluorescent-based assay. Diagn Mol Pathol 2002;11:177–85. 30. Wege H, Chui MS, Le HT, Tran JM, Zern MA. SYBR Green real-time telomeric repeat amplification protocol for the rapid quantification of telomerase activity. Nucleic Acids Res 2003;31:E3–3. 31. Fajkus J, Koppova K, Kunicka Z. Dual-color real-time telomeric repeat amplification protocol. Biotechniques 2003;35:912–4. 32. Ohyashiki K, Ohyashiki JH, Nishimaki J, et al. Cytological detection of telomerase activity using an in situ telomeric repeat amplification protocol assay. Cancer Res 1997;57:2100–3. 33. Mitchell JR, Wood E, Collins K. A telomerase component is defective in the human disease dyskeratosis congenita. Nature 1999;402:551–5. 34. Vulliamy T, Marrone A, Goldman F, et al. The RNA component of telomerase is mutated in autosomal dominant dyskeratosis congenita. Nature 2001;413:432–5. 35. Chromczynski P, Sacchi N. Singel-step method of RNA isolation by acid guanidinium thiocyanate-phenol -chloroform extraction. Anal Biochem 1987;162:156–9. 36. Dome JS, Chung S, Bergemann T, et al. High telomerase reverse transcriptase (hTERT) messenger RNA level correlates with tumor recurrence in patients with favorable histology Wilms’ tumor. Cancer Res 1999;59:4301–7. 37. Tesmer VM, Ford LP, Holt SE, et al. Two inactive fragments of the integral RNA cooperate to assemble active telomerase with the human protein catalytic subunit (hTERT) in vitro. Mol Cell Biol 1999;19:6207–16. 38. Buchler P, Conejo-Garcia JR, Lehmann G, et al. Real-time quantitative PCR of telomerase mRNA is useful for the differentiation of benign and malignant pancreatic disorders. Pancreas 2001;22:331–40. 39. Emrich T, Chang SY, Karl G, Panzinger B, Santini C. Quantitative detection of telomerase components by real-time, online RT-PCR analysis with the LightCycler. Methods Mol Biol 2002;191:99–108. 40. Ulaner GA, Hu JF, Vu TH, Giudice LC, Hoffman AR. Telomerase activity in human development is regulated by human telomerase reverse transcriptase (hTERT) transcription and by alternate splicing of hTERT transcripts. Cancer Res 1998;58:4168–72. 41. Mazurek U, Witek A, Olejek A, Paul M, Skalba P, Wilczok T. Expression of telomerase genes as potential marker of neoplastic changes. Folia Histochem Cytobiol 2001;39 Suppl 2:183–4. 42. Falchetti ML, Pallini R, D’Ambrosio E, et al. In situ detection of telomerase catalytic subunit mRNA in glioblastoma multiforme. Int J Cancer 2000;88:895–901. 43. Ali AS, Chopra R, Robertson J, Testa NG. Detection of hTERT protein by flow cytometry. Leukemia 2000;14:2176–81.

14 Protocol I: Telomerase Activity and Telomerase Expression

335

44. Yashima K, Piatyszek MA, Saboorian HM, et al. Telomerase activity and in situ telomerase RNA expression in malignant and non-malignant lymph nodes. J Clin Pathol 1997;50:110–7. 45. Kotoula V, Hytiroglou P, Pyrpasopoulou A, Saxena R, Thung SN, Papadimitriou CS. Expression of human telomerase reverse transcriptase in regenerative and precancerous lesions of cirrhotic livers. Liver 2002;22:57–69. 46. Harada K, Yasoshima M, Ozaki S, Sanzen T, Nakanuma Y. PCR and in situ hybridization studies of telomerase subunits in human non-neoplastic livers. J Pathol 2001;193:210–7. 47. Hiyama E, Hiyama K, Shay JW, Yokoyama T. Immunhistochemical detection of telomerase (hTERT) protein in human cancer tissues and a subset of cells in normal tissues. Neoplasia 2001;3:17–26. 48. Wu YL, Dudognon C, Nguyen E, et al. Immunodetection of human telomerase reversetranscriptase (hTERT) re-appraised: nucleolin and telomerase cross paths. J Cell Sci 2006;119:2797–806. 49. Kolquist KA, Ellisen LW, Counter CM, Meyerson M, Tan LK. Expression of TERT in early premalignant lesions and a subset of cells in normal tissues. Nature Genetics 1998;19:182–6. 50. Liu K, Schoonmaker MM, Levine BL, June CH, Hodes RJ, Weng NP. Constitutive and regulated expression of telomerase reverse transcriptase (hTERT) in human lymphocytes. Proc Natl Acad Sci USA 1999;96:5147–52. 51. Nakano K, Watney E, McDougall JK. Telomerase activity and expression of telomerase RNA component and telomerase catalytic subunit gene in cervical cancer. Am J Pathol 1998;153:857–64. 52. Chou SJ, Chen CM, Harn HJ, Chen CJ, Liu YC. In situ detection of hTERT mRNA relates to Ki-67 labeling index in papillary thyroid carcinoma. J Surg Res 2001;99:75–83. 53. Kumaki F, Kawai T, Hiroi S, et al. Telomerase activity and expression of human telomerase RNA component and human telomerase reverse transcriptase in lung carcinomas. Hum Pathol 2001;32:188–95. 54. Kumaki F, Takeda K, Yu ZX, Moss J, Ferrans VJ. Expression of human telomerase reverse transcriptase in lymphangioleiomyomatosis. Am J Respir Crit Care Med 2002;166:187–91. 55. Frost M, Bobak JB, Gianani R, et al. Localization of telomerase hTERT protein and hTR in benign mucosa, dysplasia, and squamous cell carcinoma of the cervix. Am J Clin Pathol 2000;114:726–34. 56. Hashimoto Y, Murakami Y, Uemura K, et al. Telomere Shortening and Telomerase Expression during Multistage Carcinogenesis of Intraductal Papillary Mucinous Neoplasms of the Pancreas. J Gastrointest Surg 2008;12:17–28. 57. Hashimoto Y, Murakami Y, Uemura K, et al. Mixed ductal-endocrine carcinoma derived from intraductal papillary mucinous neoplasm (IPMN) of the pancreas identified by human telomerase reverse transcriptase (hTERT) expression. J Surg Oncol 2008;97:469–75.

Chapter 15

Protocol II: Importance and Methods of Telomere G-Tail Length Quantification Akira Shimamoto, Eriko Aoki, Angie M. Sera, and Hidetoshi Tahara

Abstract All eukaryotic chromosome DNA ends have telomere DNA consisting of double-stranded telomere DNA repeats, which terminate in single-stranded 30 overhangs called G-tails. Unprotected and exposed G-tails may be recognized by DNA damage signaling, inducing apoptotic signals that may cause dysfunction of tissues or initiation of carcinogenesis. Although G-tail length is essential for telomere end protection mechanism, the involvement of G-tail length in diseases is poorly understood. In this review, we introduce the importance of G-tail length and various protocols for G-tail measurement. Keywords: Telomere length, G-tail, G-tail telomere HPA, Telomere singlestranded 30 -overhang, Shelterin, Telomere-binding protein, DNA damage, Apoptosis, PENT, T-OLA, Premature aging syndrome, Age-related disease.

15.1

Telomere G-Tail Generation and Telomere End-Protection

Telomeres are special structures located at chromosomal termini that are composed of tandem telomeric DNA repeats and various telomere-binding proteins (1). In humans, this region contains 50 -TTAGGG-30 /30 -AATCCC-50 noncoding duplex DNA (2, 3). Although most of the telomere DNA is double-stranded, a singlestranded overhang of telomeric repeats extends from the 30 terminus called the G-tail because of its high guanine content (Fig. 15.1). The length of G-tails is regulated by either elongation of the G-strand by telomerase or by degradation of the C-strand by exonuclease activity (4). Telomerase expression is essential to telomere length maintenance as it adds telomere DNA to the ends of G-tails.

H. Tahara(*) Department of Cellular and Molecular Biology, Division of Integrated Medical Science, Program for Biomedical Research, Graduate School of Biomedical Sciences, Hiroshima University, 1-2-3 Kasumi Minami-ku, Hiroshima, 734-8553, Japan, e-mail: [email protected]

K. Hiyama (ed.), Telomeres and Telomerase in Cancer. DOI: 10.1007/978-1-60327-879-9_15, # Humana Press, a part of Springer Science + Business Media, LLC 2009 337

338

A. Shimamoto et al.

Fig. 15.1 G-tails invade into double-stranded telomere DNA to form t-loop end-capping strucutures

Fig. 15.2 G-tails and the shelterin complex

However, the presence of G-tails in telomerase deficient mice suggests the involvement of a telomerase-independent mechanism in G-tail generation (5). Although telomerase is not required for G-tail overhang formation (5–7), it, nevertheless, is sufficient for G-tail elongation as overexpression of its catalytic subunit, hTERT (human telomerase reverse transcriptase), was shown to induce G-tail elongation in HUVECs (8). As is, this region of single-stranded telomeric DNA may be targeted by DNA damage responses. Therefore, to mask the telomere G-tails from DNA damage surveillance, telomeres construct an end protection structure called the t-loop, where the G-tail loops around and invades into double-stranded telomere DNA. Sufficient length is therefore a critical requirement for G-tails to invade into duplex telomeric DNA and form the t-loop telomere capping structure (Fig. 15.2). T-loop formation seems to be necessary for sequestering the chromosome ends to prevent them from

15 Protocol II: Importance and Methods of Telomere G-Tail Length Quantification

339

being recognized as double-stranded breaks by DNA damage machinery. Various telomere-binding proteins have been cloned and shown to participate in t-loop formation and telomere length regulation. Recently, the telomere-specific protein complex has been termed ‘‘shelterin’’ by de Lange (1). Shelterin consists of the six core proteins, TRF1, TRF2, POT1, TIN2, TPP1, and Rap1 (Fig. 15.2).

15.2

Telomere Length, G-Tail Length, and Diseases

Telomere length is thought to be important for age-related disease such as cancer and aging. The average telomere length in human somatic tissues decreases by about 30–60 bp per year, reflecting the gradual loss of telomere DNA sequences as a result of incomplete replication by the 50 –30 DNA polymerase (the end replication problem) (9). Though average telomere length is similar between identical twins, there is variation between individuals (10). These results suggest that genetic factors may play a major role in the regulation of telomere length in humans. In in vitro cell culture systems, telomere reduction was also observed in telomerase negative (or weak) normal cells including fibroblasts, epithelial cells, lymphocytes, and other cells. The gradual attrition of telomere length in somatic tissues correlates with increasing age. In Hutching-Gilford progeria, a premature aging disorder, accelerated telomere reduction was observed compared with normal individuals (11). Accelerated telomere reduction also characterizes patients of Werner syndrome, Bloom syndrome, ataxia telangiectasia (AT), and dyskeratosis congenita (DC) (12). Consistent results were obtained from in vitro culture systems. Interestingly, dynamic telomere changes, such as abnormal telomere reduction and elongation, were observed during passage of B lymphocytes from Werner patients, while those from normal individuals only experienced gradual loss of telomere length upon cell division (13). The exact mechanism of the telomere dynamics in Werner syndrome is unclear, but the WRN gene shows similarity to a RecQ type helicase, which unwinds DNA (14–16). In fact, RecQ helicase WRN was shown to be stimulated by the telomere single-strand binding protein, POT1, to unwind telomeric DNA substrates (17). Therefore, the abnormal telomere dynamics of Werner patients may be attributed to unwound states of chromosomal DNA because of dysfunction in the helicase activity of WRN. Of further interest is the association of other genes responsible in premature aging disorders, such as BLM, NBS1, and ATM, with the shelterin protein, TRF2 (18–21). These observations suggest that senescence-associated genes may also regulate telomere stability and DNA damage signaling at telomeres. In contrast to telomere length regulation in normal and age-related disease cell lines, the average telomere length in germ line cells is maintained by the action of telomerase, a ribonucleoprotein enzyme that adds telomere sequences to chromosome ends. Most cancer cells also express telomerase and maintain telomere length, though the mean telomere length varies among different types of cancer. However,

340

A. Shimamoto et al.

the high expression levels of telomerase in cancer cells do not necessarily correlate with net elongation of telomere length because of its unlimited and rapid proliferation. In fact, reduction of telomere length is reported in various clinical cancer tissue and blood samples from patients (22). This suggests that cancers arise from a small subset of hyper proliferative cells that experience telomere attrition-induced dysfunction and genetic instability, and that the proliferative potential of these cancer cells are subsequently maintained through the continued activation of telomerase. Accordingly, it has recently been postulated that some tumors arise from small population of cancer stem cells that self-renew and have the potential to differentiate into different types of cancer cells (23–25). Characterized by the potential for continuous self-renewal and extensive proliferation, stem cells regulate tissue homeostasis by maintaining a constant pool of undifferentiated stem cells. Both embryonic and adult stem cells retain the capacity for self-renewal and differentiation (26). Normal somatic stem cells arise from embryonic precursors during fetal development (26). Normal fetal stem cells self-renew to make daughter stem cells, and often give rise to adult stem cells. Though embryonic stem cells exhibit sufficient levels of telomerase activity to maintain telomere length, normal adult stem cells show low levels or no activity (27), leading to the loss of telomere DNA with age. However, absence or low levels of telomerase in normal stem cells is a requirement for normal cell functions outside of telomere length maintenance, as evidenced in a study using TERC (telomerase RNA component) deficient mice. TERT activation in these cells lacking the RNA template component necessary for telomere elongation induced proliferation in stem cells (28), suggesting that weak TERT expression may be a requirement for maintenance of normal stem cell functions. In fact, low levels of telomerase activity have been found in skin, hair follicle, intestinal crypt, neuronal, and liver epithelial cells. In addition, hematopoietic and mesenchymal stem cells express low levels of telomerase activity that is insufficient for maintaining telomere length. Telomere end protection and G-tail length changes during repeated cell division remain an elusive aspect of stem cell biology. Although G-tail length in stem cell is not well characterized, it is presumed that G-tail length is maintained in embryonic stem cells but gradually shortened in hematopoietic stem cells, implicating G-tail length homeostasis, namely attrition, in stem cell functions. In addition to the aforementioned correlation of telomere length and human malignancies, telomere length may also play a part in the immune system, of which all cells are derived from hematopoietic stem cells that can divide and differentiate throughout their lifespan. Therefore, telomere length maintenance by activation of telomerase, and telomere end protection by telomerebinding proteins and G-tail length are essential for cells pertaining to the immune system. Although telomere length in aging and various diseases has been well examined, the association with the length of the single-stranded G-tail overhangs is poorly understood. One reason the association of G-tail length and human diseases remains in the dark is that an appropriate technique to accurately measure G-tail length had not yet been established. Previously, nondenature Southern blotting or in-gel

15 Protocol II: Importance and Methods of Telomere G-Tail Length Quantification

341

hybridization with 32P-labeled telomere oligonucleotides was used for measuring G-tail length (5). However, in these gel electrophoresis based methods, quantification of G-tails is difficult because the G-tail signal intensity was either too weak or smeared compared with total telomere length, and the G-tail length was too short for accurate quantification. Though quantification of G-tail length remained a difficult obstacle to overcome, what was certain was the critical role of G-tail quantification in understanding telomere dysfunction and chromosomal stability in cells, and thereby in gauging the risk of diseases such as cancer and aging. This is because insufficient G-tail length interferes with the overhang’s ability to participate in the capping structure that requires partial strand invasion into duplex telomeric DNA. When this t-loop structure is abrogated due to DNA damage or critical shortening of telomere length, signs of genomic instability appear, such as chromosomal fusions and anaphase bridge formation. In addition, rising evidence implicates the crucial role of various telomere-binding proteins in t-loop formation and genomic stability. Treatment of cells with the telomere-binding compound, telomestatin, which binds G-tails and stabilizes G-quadruplex structures, induces tloop destruction through TRF2 dissociation from telomeres and G-tail attrition (29). Disruption of this protective end capping structure, due to the compounding effects of G-tail length reduction and interference of telomere-binding proteins, is therefore detrimental to normal cellular functions, leading to DNA damage response signaling, cell growth arrest, apoptosis, or tumorigenesis. Hence, the accurate quantification of G-tail length may pave the way to a novel approach to characterizing various cancers and age-related malignancies.

15.3

Methods of Measuring Telomere G-Tail Length

The strong correlation between telomere attrition and various senescence-related diseases has been established from widespread analysis of clinical samples, and recently, G-tail length has also been implicated in many such diseases. Abrogation of t-loop formation resulting from inadequate G-tail length causes telomere dysfunction, and is thought to be a major factor implicated in the initial stages of tumorigenesis. However, the majority of data supporting this hypothesis as of yet are from cell culture-based in vitro experiments, and analysis of clinical samples is lacking. This shortage of in vivo evidence for the role of telomere dysfunction in tumorigenesis can be attributed to the lack of a simple and accurate method for measuring G-tail length. Though there are various methods to measure G-tail length, such as T-OLA (telomeric-oligonucleotide ligation assay) (30), PENT (primer extension-nick translation) (4), and 30 overhang protection assay (31), these procedures require the use of gel electrophoresis, radioisotopes, and over two days to complete, rendering them impractical for high-throughput application for analyzing clinical samples (Table 15.1). In contrast, a simple, newly developed single-tube based G-tail telomere HPA (hybridization protection assay) overcomes these problems, and takes only about 40 min to measure G-tail length (See section 3d for details).

Table 15.1 Advantage of G-tail telomere HPA for measurement of G-tail length. While other methods require radioisotope and electrophoresis, and take at least two days for detection of G-tail signals, G-tail telomere HPA can detect G-tail length only 40 minutes and do not require radioisotope and electrophoresis. In addition, G-tail telomere HPA can be used not only purified genomic DNA but also crude extracts. G-tail telomere HPA is a simple three step assay in a single tube, thus it can be apply for high throughput screening Method Detection range Detection Radioisotope Assay in crude Electrophoresis High throughput Determination of (nt) time extracts G-tail size distribution T-OLA 24–650 2d Required Not possible Required Not possible Possible PENT 130–210 2d Required Not possible Required Not possible Possible Electron microscopy 225–650 2d Required Not possible Required Not possible Possible 45–384 2d Required Not possible Required Not possible Not possible 30 overhang protection assay Not possible Gt-telomere HPA 20–20,000< 40 min Not required Possible Not required Possiblea a 96-well plate screening is available

342 A. Shimamoto et al.

15 Protocol II: Importance and Methods of Telomere G-Tail Length Quantification

15.3.1

343

T-OLA (Telomeric-Oligonucleotide Ligation Assay) (30)

Figure 15.3 describes the schematic for the semiquantitative T-OLA assay for measuring G-tail overhang length. For the T-OLA method of measuring G-tail length, total genomic DNA is incubated with radioactively-labeled oligonucleotides containing the C-rich telomere repeat sequence (CCCTAA)4. The G-tail overhang is accessible to these labeled probes, thus hybridization occurs with the single-stranded G-tail region. Addition of a ligase results in ligation of adjacent oligonucleotides that have hybridized to various positions on the G-tail. This produces a collection of DNA fragments of different sizes, varying by increments of 24 nt. These fragments are then denatured and separated on a denaturing polyacrylamide gel. A population of telomeres consisting of a longer average telomeric overhang length is expected to produce a stronger overall T-OLA signal and a greater maximal product length.

Fig. 15.3 T-OLA (telomeric-oligo-nucleotide ligation assay)

344

A. Shimamoto et al.

However, the requirement of radioisotopes and gel electrophoresis in the analysis of G-tail length in the T-OLA method makes it difficult to apply in highthroughput analysis that would be necessary to fully study the role of G-tail length as it relates to various cancers and senescence-related diseases.

15.3.2

PENT (Primer Extension-Nick Translation) (4)

PENT is a method to detect 30 overhangs of telomere, based on primer-extension/ nick translation reaction (Fig. 15.4). The C-rich oligonucleotide primers are hybridized to telomere G-rich tails and extended using Taq DNA polymerase, which has 50 –30 exonuclease activity. If several molecules of C-rich primer are hybridized to the overhang, all but the last one will be degraded by the exonuclease activity during the reaction. The polymerase fills the gap between the primer and 50 -end of the C-rich strand, and the nick moves in the 30 direction. When the reaction products are electrophoresed on a denaturing alkaline agarose gel and probed with the G-rich telomeric sequence, they should appear as in the schematic of Fig. 15.4.

a

b

c

d

Fig. 15.4 PENT (primer extension-nick translation)

15 Protocol II: Importance and Methods of Telomere G-Tail Length Quantification

345

Though this method allows for determination of G-tail size distribution, it may be difficult to be applied in high-throughput studies of clinical samples, as the use of radioisotopes and electrophoresis is required.

15.3.3

30 Overhang Protection Assay (31)

In the 30 overhang protection assay, total genomic DNA is incubated with T4 gp32 and GST-UP1 proteins, which bind to the G-tail single-stranded region (Fig. 15.5). Once these proteins are cross-linked to the single-stranded telomeric DNA, unbound and unprotected double-stranded DNA is removed with DNase I digestion. DNase I activity is halted with heat inactivation, and cross-linking is reversed through protein digestion by protease K. The exposed, unprotected overhang regions are now available for hybridization to 32P-labeled C-rich probes. Overhangs are then size fractionated and run on a native polyacrylamide gel for analysis. Though this is a relatively simple method of quantifying G-tail length, the detection time for this method is at least 2 days, and requires the use of radioisotopes and electrophoresis. In addition, determination of G-tail size distribution is not possible with this method, nor is assay possible in crude extracts. Therefore, 30 overhang protection assay is not suitable for application in high-throughput

Fig. 15.5 30 overhang protection assay

346

A. Shimamoto et al.

analysis of large scale clinical samples to study the role of G-tail length in various human malignancies.

15.3.4

G-Tail Telomere HPA (Hybridization Protection Assay)

In response, we recently developed a novel telomere 30 overhang assay, G-tail telomere hybridization protection assay (HPA) to combat these difficulties (9) (Fig. 15.6). This G-tail telomere HPA method utilizes a 29 mer telomere oligonucleotide-labeled with acridinium ester as an HPA probe. Undenatured genomic DNA is placed in a tube and hybridized to the telomere HPA probe in the presence of a hybridization buffer for 20 min at 60 C. Free, unhybridized probes are then hydrolyzed at 60 C for 10 min to deactivate the acridinium ester, and a luminometer is used to measure the amount of luminescence that corresponds to the G-tail length. This method takes advantage of the acridinium ester, which intercalates when the HPA probe is bound to the telomere DNA, rendering it immune to inactivation during the hydrolysis step. Moreover, this three stepped, single-tube based assay is capable of measuring 10 bp differences in G-tails of over 20 bp in length, in a total assay time of merely 40 min. In addition, this simple method allows for many samples to be assayed at once from genomic DNA as well as whole cell extracts. The simple, rapid, sensitive quantification of G-tail length and, particularly, the high-throughput capacity of the G-tail telomere HPA method makes it a powerful tool for illuminating the relationship between G-tail length and various human malignancies.

Fig. 15.6 G-tail telomere HPA

15 Protocol II: Importance and Methods of Telomere G-Tail Length Quantification

15.4

347

Protocol for G-Tail Telomere HPA (9)

This method is based on an HPA format that uses oligonucleotide probes labeled with a highly chemiluminescent acridinium ester (AE). G-tail telomere HPA is developed to measure single-stranded telomeric overhangs in humans, and is a very simple single tube-based assay using AE-labeled C-rich probe. Briefly, 5 mg of human genomic DNA prepared by phenol/chroloform extraction is incubated with a highly chemiluminescent AE-labeled, 29-mer HPA probes at 60 C for 20 min. For measuring total telomere length, or double-stranded telomere regions including G-tails, 1 mg of heat-denatured DNA is used. The AE of unhybridized and mishybridized probes are hydrolyzed by adding the hydrolysis buffer and incubating at 60 C for 10 min. During this step, AE of hybridized probes are protected from hydrolysis. Chemiluminescence of unhydrolyzed AE is measured for 2 s per tube with a luminometer. RNA free genomic DNA used in this assay should be prepared by phenol/chloroform extraction.

15.4.1 Reagents 1. Hybridization buffer: 0.1 M succinic acid, 0.23 M lithium hydroxide monohydrate, 2% lithium lauryl sulfate, 1.2 M lithium chloride, 20 mM EDTA·2Na, 20 mM EGTA, 15 mM 2,20 -dithiodipyridine, adjusted to pH 4.7 with HCl 2. Hydrolysis buffer: 0.6 M boric acid, 182 mM NaOH, 1% Triton X-100, adjusted to pH 8.5 with NaOH 3. Synthesized human telomere oligonucleotide: e.g. 84 mer, 50 -(TTAGGG)14-30 4. Acridinium ester (AE)-labeled telomere probe: 50 -CCCTAACCCTAACC* CTAACCCTAACCCTA-30 [*AE position, 8  107 rlu/pmol probe DNA, custom ordered from Fujirebio Inc., (Tokyo, Japan)] 5. AE-labeled Alu probe: 50 -TGTAATCCCA*GCACTTTGGGAGGC-30 [*AE position, 8  107 rlu/pmol probe DNA, custom ordered from Fujirebio Inc.]

15.4.2 Protocol 1. Make a dilution series of synthesized human telomere oligonucleotide as a standard for the assay: 1.0, 0.5, 0.1, 0.05, 0.01, and 0.005 mM. 2. Transfer 10 mL of each dilution of the oligonucleotide to 5 mL polypropylene tubes (Falcon, 352053), and add 90 mL of sterilized water. Make a duplicate for each dilution, and a pair of blanks without oligonucleotide. 3. If the data are to be normalized by the amount of genomic DNA, prepare 400 mL of 50 ng/mL nondenatured human genomic DNA with sterilized water or TE

348

4.

5.

6.

7. 8.

9. 10. 11. 12. 13.

A. Shimamoto et al.

buffer. If the data are to be normalized by the chemiluminescent values (rlu) of Alu, prepare 480 mL of 50 ng/mL nondenatured human genomic DNA. For detection of telomere 30 overhangs (G-tails) in genomic DNA, 5 mg of nondenatured human genomic DNA is typically used for each assay. Transfer 100 mL of the genomic DNA to 5 mL polypropylene tubes (Falcon, 352053). Make a triplicate for each sample. Denature 80 mL of remaining genomic DNA at 99 C or above for 10 min, and immediately transfer on ice and leave for 2 min. To normalize data with Alu value, 160 mL of the genomic DNA is needed. For detection of double-stranded telomere regions with G-tails (total telomere) in genomic DNA, 1 mg denatured human genomic DNA is typically used. Transfer 20 mL of the genomic DNA to a 5 mL polypropylene tube (Falcon, 352053), and add 80 mL of sterilized water. Make a triplicate for each sample. If necessary, prepare another triplicate to normalize data with Alu value. Dilute AE-labeled telomere probe to 3  107 rlu (relative light units)/mL. For detection of Alu, dilute AE-labeled Alu probe. Add 100 mL of telomere probe to each tube for detecting standard, G-tails, and total telomere. If you normalize the data with Alu value, add 100 mL of Alu probe to each tube containing heat-denatured genomic DNA for Alu detection. Vortex at maximum speed for 5 s. Incubate all the tubes simultaneously in water bath at 60 C for 20 min. Remove all tubes to room temperature and leave for 10 min. Add 100 mL of hydrolysis buffer, and vortex at maximum speed for 5 s. Incubate all the tubes simultaneously in water bath at 60 C for 10 min. Transfer all tubes to ice and cool for over 1 min. Measure chemiluminescence for 2 s per tube with a luminometer (Leader I, Gen-Probe, Inc., San Diego, CA).

15.4.3

Data Analysis

A standard curve is obtained by plotting luminescent level vs. amount of the telomere oligonucleotide. If a linear increase in luminescent level with increasing oligonucleotide amount across the range of 0.05–10 fmol is observed, the assay is reliable. For reference, Fig. 15.7 shows a linear response over a range of 1–20 mg of nondenatured human genomic DNA. To normalize the data by the amount of genomic DNA, the concentration of the remaining 20 mL of nondenatured genomic DNA should be reassessed by NanoDrop. These data should be shown as relative luminescence unit (rlu) per mg of genomic DNA. Otherwise, these data can be normalized by chemiluminescent values (rlu) of Alu by showing as % Alu, but Alu signals per cell may vary in individuals.

15 Protocol II: Importance and Methods of Telomere G-Tail Length Quantification

349

Fig. 15.7 Standard curve of G-tail telomere HPA using human genomic DNA

Acknowledgments This work was founded in part by a Grant-in-Aid for Scientific Research from the Ministory of Education, Culture, Sports, Science and Technology, Japan, and Japan Science and Technology Agency, Japan.

References 1. de Lange T. Shelterin: the protein complex that shapes and safeguards human telomeres. Genes Dev 2005;19:2100–10. 2. Moyzis RK, Buckingham JM, Cram LS, et al. A highly conserved repetitive DNA sequence, (TTAGGG)n, present at the telomeres of human chromosomes. Proc Natl Acad Sci USA 1988;85:6622–6. 3. Meyne J, Ratliff RL, Moyzis RK. Conservation of the human telomere sequence (TTAGGG)n among vertebrates. Proc Natl Acad Sci USA 1989;86:7049–53. 4. Makarov VL, Hirose Y, Langmore JP. Long G tails at both ends of human chromosomes suggest a C strand degradation mechanism for telomere shortening. Cell 1997;88:657–66. 5. Hemann MT, Greider CW. G-strand overhangs on telomeres in telomerase-deficient mouse cells. Nucleic Acids Res 1999;27:3964–9. 6. Huffman KE, Levene SD, Tesmer VM, Shay JW, Wright WE. Telomere shortening is proportional to the size of the G-rich telomeric 30 -overhang. J Biol Chem 2000;275:19719–22. 7. Dionne I, Wellinger RJ. Cell cycle-regulated generation of single-stranded G-rich DNA in the absence of telomerase. Proc Natl Acad Sci USA 1996;93:13902–7. 8. Anno K, Hayashi A, Takahashi T, Masui Y, Ide T, Tahara H. Telomerase activation induces elongation of the telomeric single-stranded overhang, but does not prevent chromosome

350

9. 10. 11. 12. 13.

14. 15. 16. 17. 18. 19. 20.

21.

22. 23. 24. 25. 26. 27. 28. 29.

30.

31.

A. Shimamoto et al. aberrations in human vascular endothelial cells. Biochem Biophys Res Commun 2007;353:926–32. Tahara H, Kusunoki M, Yamanaka Y, Matsumura S, Ide T. G-tail telomere HPA: simple measurement of human single-stranded telomeric overhangs. Nat Meth 2005;2:829–31. Slagboom PE, Droog S, Boomsma DI. Genetic determination of telomere size in humans: a twin study of three age groups. Am J Hum Genet 1994;55:876–82. Allsopp RC, Vaziri H, Patterson C, et al. Telomere length predicts replicative capacity of human fibroblasts. Proc Natl Acad Sci USA 1992;89:10114–8. Walne AJ, Marrone A, Dokal I. Dyskeratosis congenita: a disorder of defective telomere maintenance? Int J Hematol 2005;82:184–9. Tahara H, Tokutake Y, Maeda S, et al. Abnormal telomere dynamics of B-lymphoblastoid cell strains from Werner’s syndrome patients transformed by Epstein-Barr virus. Oncogene 1997;15:1911–20. Cobb JA, Bjergbaek L. RecQ helicases: lessons from model organisms. Nucleic Acids Res 2006;34:4106–14. Brosh RM, Jr., Waheed J, Sommers JA. Biochemical characterization of the DNA substrate specificity of Werner syndrome helicase. J Biol Chem 2002;277:23236–45. Karow JK, Chakraverty RK, Hickson ID. The Bloom’s syndrome gene product is a 30 –5prime; DNA helicase. J Biol Chem 1997;272:30611–4. Opresko PL, Mason PA, Podell ER, et al. POT1 stimulates RecQ helicases WRN and BLM to unwind telomeric DNA substrates. J Biol Chem 2005;280:32069–80. Callen E, Surralles J. Telomere dysfunction in genome instability syndromes. Mutat Res 2004;567:85–104. Lillard-Wetherell K, Machwe A, Langland GT, et al. Association and regulation of the BLM helicase by the telomere proteins TRF1 and TRF2. Hum Mol Genet 2004;13:1919–32. Opresko PL, von Kobbe C, Laine JP, Harrigan J, Hickson ID, Bohr VA. Telomere-binding protein TRF2 binds to and stimulates the Werner and Bloom syndrome helicases. J Biol Chem 2002;277:41110–9. Stavropoulos DJ, Bradshaw PS, Li X, et al. The Bloom syndrome helicase BLM interacts with TRF2 in ALT cells and promotes telomeric DNA synthesis. Hum Mol Genet 2002;11:3135– 44. Meeker AK, Hicks JL, Iacobuzio-Donahue CA, et al. Telomere length abnormalities occur early in the initiation of epithelial carcinogenesis. Clin Cancer Res 2004;10:3317–26. Singh SK, Clarke ID, Terasaki M, et al. Identification of a cancer stem cell in human brain tumors. Cancer Res 2003;63:5821–8. O’Brien CA, Pollett A, Gallinger S, Dick JE. A human colon cancer cell capable of initiating tumour growth in immunodeficient mice. Nature 2007;445:106–10. Al-Hajj M, Wicha MS, Benito-Hernandez A, Morrison SJ, Clarke MF. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci USA 2003;100:3983–8. Khanna KK, Jackson SP. DNA double-strand breaks: signaling, repair and the cancer connection. Nat Genet 2001;27:247–54. Park Y, Gerson SL. DNA repair defects in stem cell function and aging. Annu Rev Med 2005;56:495–508. Sarin KY, Cheung P, Gilison D, et al. Conditional telomerase induction causes proliferation of hair follicle stem cells. Nature 2005;436:1048–52. Tahara H, Shin-Ya K, Seimiya H, Yamada H, Tsuruo T, Ide T. G-Quadruplex stabilization by telomestatin induces TRF2 protein dissociation from telomeres and anaphase bridge formation accompanied by loss of the 30 telomeric overhang in cancer cells. Oncogene 2006;25:1955–66. Cimino-Reale G, Pascale E, Battiloro E, Starace G, Verna R, D’Ambrosio E. The length of telomeric G-rich strand 30 -overhang measured by oligonucleotide ligation assay. Nucleic Acids Res 2001;29:E35. Chai W, Shay JW, Wright WE. Human telomeres maintain their overhang length at senescence. Mol Cell Biol 2005;25:2158–68.

Chapter 16

Protocol III: Detection of Alternative Lengthening of Telomeres Wei-Qin Jiang, Jeremy D. Henson, Axel A. Neumann, and Roger R. Reddel

Abstract Approximately 10% of cancers overall use alternative lengthening of telomeres (ALT) instead of telomerase to prevent telomere shortening, and ALT is especially common in astrocytomas and various types of sarcomas. In this regard, easy and accurate detection of ALT in tumour cells is important both for clinical applications and cancer biology research. The hallmarks of ALT in telomerase-negative cancer cells include a characteristic pattern of telomere length heterogeneity, rapid changes in individual telomere lengths and the presence of ALT-associated PML bodies (APBs) containing telomeric DNA and proteins involved in telomere binding, DNA replication and recombination. The methods currently used for analysing these phenotypes include Southern-based terminal restriction fragment (TRF) analysis, APB-staining and fluorescence in situ hybridisation (FISH)-based telomere length fluctuation analysis. Details of these three methods, together with a screen for candidate ALT genes, are described in this review. Keywords: Telomeres, Alternative lengthening of telomeres (ALT), ALTassociated PML bodies (APBs), PML, method.

16.1

Introduction

The telomeres of human cells contain a linear tandem array of TTAGGG repeats bound by telomere-associated proteins, and are essential for chromosome stability and genomic integrity (1). The progressive erosion of telomeres in normal cells during DNA replication leads eventually to the state of replicative senescence, features of which include permanent withdrawal from the cell cycle. Most cancer

R.R. Reddel(*) Children’s Medical Research Institute, Westmead, NSW 2145, and University of Sydney, NSW 2006, Australia, e-mail: [email protected]

K. Hiyama (ed.), Telomeres and Telomerase in Cancer. DOI: 10.1007/978-1-60327-879-9_16, # Humana Press, a part of Springer Science + Business Media, LLC 2009 351

352

W.‐Q. Jiang et al.

cells escape from the limitation on proliferation that normal telomere shortening imposes by activating a telomere maintenance mechanism, either telomerase (2) or alternative lengthening of telomeres (ALT) (3). Telomerase is active in approximately 85% of cancers (4) and an ALT mechanism is active in many telomerasenegative tumours (5), especially sarcomas and astrocytomas (6–9). Although details of the molecular mechanism of ALT are largely unknown, previous studies have shown that ALT in human cells involves telomere–telomere recombination (10, 11). With a few exceptions (12–15), the hallmarks of human ALT cells examined to date include an unique pattern of telomere length heterogeneity, with telomeres that range from very short to greater than 50 kb long (3), which is in striking contrast to the more homogeneous telomere length distribution observed in telomerasepositive cells (Fig. 16.1a, b). This heterogeneity is generated by a combination of steady telomere attrition at the rate seen in normal telomerase-negative cells and rapid lengthening and shortening events (10, 16). An additional hallmark of ALT is the presence of ALT-associated PML nuclear bodies (APBs) containing (TTAGGG)n DNA and telomere-specific binding proteins (17) (Fig. 16.1c). APBs are a subset of PML bodies that are present only in ALT cells, and are not found in mortal cells or telomerase-positive cells (17), even though PML bodies are found in most somatic cells. In addition to telomeric DNA and telomere-associated proteins such as TRF1, TRF2, TIN2, and RAP1 (17–19), APBs also contain other proteins involved in DNA replication, recombination, and repair including RAD51, RAD52, and RPA (17), RAD51D (20), BLM (21, 22), WRN (23), RAP1 and BRCA1 (18), MRE11, RAD50, and NBS1 (24, 25), ERCC1 and XPF (26), hRAD1, hRAD9, hRAD17, and hHUS1 (27), RIF1 (28) and hnRNP A2 (29). Formation of APBs requires NBS1, which recruits MRE11, RAD50, and BRCA1 into these structures (18, 30). Using a novel screen that combines RNA interference with methionine restriction, we have extended the list of proteins required for APB formation to PML, TRF1, TRF2, TIN2, RAP1, MRE11, and RAD50 (19). Three of them, NBS1, MRE11, and RAD50 were shown to be required for the ALT mechanism (30, 31). A recent report (32) shows that the structural maintenance of chromosomes SMC5/6 complex localises to APBs in ALT cells and SUMOylates TRF1 and TRF2. Inhibition of TRF1 or TRF2 SUMOylation prevents APB formation, indicating that the SMC5/6 complex is required for targeting telomeric DNA to APBs. It has long been suggested that APBs may have an integral role in the ALT mechanism (17, 18, 25, 33, 34) and, consistent with this suggestion, inhibition of ALT in some somatic cell hybrids formed by fusion of ALT and telomerasepositive cell lines resulted in a substantial decrease in APBs (16). Our recent study showed that inhibition of ALT is accompanied by suppression of APBs, providing evidence for a direct link between APBs and ALT activity (30). This close correlation justifies the use of APBs as a marker of ALT activity, although the possibility that APBs are a byproduct of the ALT process and not an integral part of the mechanism has not been excluded completely. APBs have proved to be a reliable marker for detecting ALT in cultured cells (17, 19), as well as for clinical

16 Protocol III: Detection of Alternative Lengthening of Telomeres

353

Fig. 16.1 Hallmarks of human ALT cancer cells. (a) Southern-based TRF analysis on ALTpositive (ALT+) GM847 cells and telomerase-positive (TEL+) Hela cells, showing the more heterogeneous and, on average, longer telomere lengths in ALT cells. (b) Telomere FISH analysis on metaphase chromosomes from ALT-positive IIICF/c cells, revealing heterogeneity of telomere signals from undetectable ones indicated by arrows to highly intensive ones indicated by arrowheads. (c) Detection of APBs in IIICF/c cells by immunostaining of TRF1 and PML. The enlarged view of APBs from the inset reveals the localisation of bright TRF1 foci within PML bodies (See Color Insert)

applications to identify ALT-positive cancers (9, 35, 36). However, to avoid false positives and false negatives, it is sometimes necessary to complement detection of APBs with Southern-based terminal restriction fragment (TRF) analysis (35). In this chapter, we will present three methods that are currently employed to detect ALT in cultured cells and tumours: (1) Southern-based TRF analysis, (2) APB-staining, and (3) fluorescence in situ hybridisation (FISH)-based telomere length fluctuation analysis, which have been demonstrated by us to correlate very well with each other for detecting ALT (16, 30). We will also describe a novel APB-screening method to identify candidate genes for ALT.

354

16.2

W.‐Q. Jiang et al.

Southern-Based Terminal Restriction Fragment (TRF) Analysis

Southern analysis of TRF length is widely used to determine telomere length (37). Genomic DNA is digested with restriction enzymes (Hinf I and RsaI, in the protocol described here) that cut frequently within bulk genomic DNA including subtelomeric regions, but do not recognise the canonical telomere sequence. The restriction fragments are separated by pulsed-field electrophoresis and hybridised to a labelled telomere-specific probe, (TTAGGG)n. The TRF smear that this generates reflects the distribution of telomere lengths within the cell population. For ALT cells, the TRF pattern is highly characteristic, with lengths distributed from very small to >50 kB, in contrast to the much more homogeneous telomere lengths in normal and telomerase-positive cells (Fig. 16.1a).

16.2.1

Buffers and Solutions

1. CHAPS (3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulphonate) lysis buffer: 10 mM Tris-HCl pH 7.5, 1 mM MgCl2, 1 mM EGTA, 0.5% (v/v) CHAPS, 10% (v/v) glycerol, 5 mM beta-mercaptoethanol, 0.1 mM 4-(2-aminoethyl)-benzenesulphonyl fluoride hydrochloride (AEBSF). 2. 50
Denhardt’s solution: 1% (w/v) Ficoll-400, 1% (w/v) BSA (fraction V), 1% (w/v) polyvinylpyrrolidone 40 (PVP-40). 3. DNA lysis solution: 50 mM Tris-HCl pH 8.0, 20 mM EDTA, 2% sodium dodecylsulphate (SDS). 4. 20
SSC buffer: 3 M NaCl, 0.3 M tri-sodium citrate. 5. 10
TBE buffer: 0.9 M Tris-HCl pH 8.0, 0.9 M borate acid, 20 mM EDTA. 6. TE buffer: 10 mM Tris-HCl pH 8.0, 1 mM EDTA.

16.2.2

DNA Isolation

For tumour samples, approximately 100 mg of frozen tissue is homogenised at 4 C in 200 mL of CHAPS lysis buffer, incubated on ice for 20 min and centrifuged at 18,000
g at 4 C for 20 min (with CHAPS lysis buffer, both DNA and protein can be collected from the same sample). Genomic DNA is extracted from the pellet by homogenising lightly in 5.5 mL of DNA lysis solution containing 100 mg/mL Pronase protease (Sigma) and incubating for 16 h at 37 C with occasional gentle inversion. For cultured cells, DNA are isolated from cell pellets, as described for tumour samples, except that the homogenisation steps are replaced by gentle mixing by pipetting. Lysates for genomic DNA extraction from tumour and cell culture samples are cooled on ice for 5 min, 2 mL of saturated NaCl is added and the mixture is incubated at 4 C for 8–16 h. The precipitate is removed by repeated centrifugation (2,000
g at 4 C for 15 min)

16 Protocol III: Detection of Alternative Lengthening of Telomeres

355

and the supernatant is transferred to a clean 15 mL centrifuge tube. The DNA is precipitated by adding 2.5 volumes of 100% ethanol and storing at 20 C for at least 12 h. When the genomic DNA is required for further analyses, the sample is centrifuged at 2,000
g, 4 C for 15 min, washed with 70% ethanol, resuspended in 50 mL of TE buffer and stored at 4 C.

16.2.3 Southern Analysis of TRF Lengths TRFs are generated from genomic DNA by digesting for 12–16 h at 37 C with 4 U/mg each of Hinf I and RsaI restriction enzymes (Roche) and 25 ng/mg RNAse (DNAse free; Roche), then heat inactivating at 80 C for 20 min and storing at 4 C. The digested DNA is quantitated in a fluorescence spectrophotometer. The digested genomic DNA samples (1.5 mg/well) are loaded onto a 1% agarose gel in 0.5
TBE buffer and TRFs separated by pulsed-field gel electrophoresis using a CHEF-DR II apparatus (BioRad), in recirculating 0.5
TBE buffer at 14 C and with a ramped pulse speed of 1–6 s at 200 V for 14 h. An appropriate DNA molecular weight marker such as Low Range PFG Marker (New England BioLabs) is included in each gel. The gel is then stained in 0.5 mg/mL ethidium bromide for 30 min and photographed on a UV transilluminator to confirm equal loading and record marker positions. The gel is dried under a vacuum at 65 C until it is approximately 0.5 mm thick and has just turned translucent, washed in denaturing solution (0.5 M NaOH, 1.5 M NaCl) for 45 min, then washed in neutralising solution (1 M Tris-Cl pH 8.0, 1.5 M NaCl) for 45 min. The gel is prehybridised in 30 mL containing 5
SSC, 5
Denhardt’s solution, 0.5 mM tetrasodium pyrophosphate, and 10 mM disodium hydrogen orthophosphate at 37 C for 2–6 h. An oligonucleotide (TTAGGG)3 probe (150 ng; Sigma) is 50 end-labelled with 50 mCi of [g32P]-dATP (3,000 Ci/mmol; New England Nuclear, Dupont) and 10U T4 kinase (Promega) in a volume of 10 mL at 37 C for 30 min. The probe is purified by ethanol precipitation and resuspended in 30 mL of TE. 3
106 counts per minute (cpm) of probe is added directly to the prehybridising gel, and incubated at 37 C overnight in a rotating oven (Hybaid). The gel is then washed three times in 0.1
SSC for 7 min at 37 C, exposed to a phosphor screen and scanned with a STORM 860 optical scanner with ImageQuant software (Molecular Dynamics). Molecular weights of telomeric bands are determined by constructing a standard curve from the DNA markers run on the same gel.

16.3

Detection of APBs by Immunostaining and Telomere Fluorescence in Situ Hybridisation (FISH)

APB-staining is a well-established assay specific for differentiating ALT cancer cells from non-ALT cells by the presence of APBs, a unique hallmark of ALT. This assay is based on immunofluorescence/telomere FISH to detect APBs–colocalisation

356

W.‐Q. Jiang et al.

of PML protein with one of the telomere-binding proteins such as TRF2 or telomeric DNA in a bright nuclear focus of characteristic morphology. This is a relatively rapid and easy assay when compared with the TRF analysis, and thus quite suitable for clinical diagnostic application.

16.3.1 Buffers and Solutions 1. Antifade mounting medium: 90% glycerol buffered with 20 mM Tris-HCl pH 8.0, 2.33% (w/v) 1,4-diazabicyclo[2.2.2]octane (DABCO). 2. Blocking solution: 2% (w/v) BSA (fraction V), 0.2% (v/v) Tween 20, 5% (v/v) glycerol in PBS. 3. Hybridisation buffer: 70% formamide (deionised), 10 mM Tris-HCl pH 7.5, 1% Blocking Reagent (Roche), 5% MgCl2 buffer (82 mM Na2HPO4, 9 mM citric acid, 25 mM MgCl2). 4. Washing solution A: 70% formamide, 10 mM Tris-HCl pH 7.2, 0.1% BSA. 5. Washing solution B: 0.05 M Tris-HCl pH 7.5, 0.15 M NaCl, 0.05% Tween 20.

16.3.2 APBs in Cell Culture Monolayers Cells grown in four-well or two-well chamber slides (Nunc) are washed twice with PBS and fixed for 15 min in 2% paraformaldehyde at room temperature (RT), followed by two washes with PBS, and then permeated with methanol/acetone (1:1) at 20 C for 15 min. The fixed cells are washed and rehydrated in PBS for >30 min, and then incubated with primary antibodies either for 1 h at RT or overnight at 4 C, followed by the incubation of fluorescently conjugated secondary antibodies at RT for 30–40 min. Both primary and secondary antibodies are diluted in the blocking solution. To visualise DNA, slides are incubated for 3 min in PBS with 20 mg/mL of 4,6 diamidino-2-phenylindole (DAPI). Three washes after each staining step are carried out by agitating in PBS. Finally, the preparations are mounted in the antifade mounting medium. Primary antibodies used preferentially for detection of APBs in monolayers are anti-TRF2 mouse antibody (1:200 dilution; Upstate Biotechnology) and anti-PML rabbit antibody (1:500 dilution; Chemicon). Other primary antibodies used for detecting APBs are anti-TRF1 rabbit antibody (1:400 dilution; (30)) and antiPML mouse antibody (1:200 dilution; Santa Cruz). The secondary antibodies used are as follows: FITC- or Texas Red-conjugated goat anti-mouse and goat anti-rabbit (Jackson ImmunoResearch).

16 Protocol III: Detection of Alternative Lengthening of Telomeres

16.3.3

APBs in Tumour Specimens

16.3.3.1

Preparation of Tumour Sections

357

Frozen sections are cut 5–7 mm thick and fixed in 1:1 methanol/acetone at 20 C for 12 min. After air drying, slides are rehydrated in PBS and stained immediately. For paraffin-embedded specimens, sections are cut 8-mm thick, and are then baked on Superfrost1 Plus microscope slides (Menzel-Glaser) at 65 C for 20 min and dewaxed in xylene for 5 min. Surface decalcification is needed for some osteosarcoma paraffin sections, in which case the paraffin-embedded specimen is pretreated with RDO Rapid Decalcifier, according to the manufacturer’s instructions (Apex Engineering Products Corporation). Slides are rehydrated and prepared for immunofluorescence and FISH by microwave heating to 120 C in 90% glycerol (1 mM EDTA) buffered with 10 mM Tris at pH 10.5, and maintained at 110–120 C for 15 min. The slides are cooled and rinsed in PBS before immunostaining/FISH. The staining procedures used for frozen and paraffin sections are identical. 16.3.3.2

Staining Procedures for Tumour Sections

For detection of APBs with double immunofluorescence, the staining procedure is essentially the same as that for the monolayer cultured cells (described in Sect. 16.3.2). Briefly, mouse anti-TRF2 and rabbit anti-PML antibodies are incubated for 1 h at RT or overnight at 4 C, followed by the incubation of Texas Red-conjugated goat anti-mouse and FITC-conjugated goat anti-rabbit FITC for 30–40 min at RT. The preparations are mounted in the antifade mounting medium. Detection of APBs in tissue samples, especially in paraffin-embedded specimens, is usually achieved by a combination of telomere FISH and immunostaining for PML protein (Fig. 16.2). Immunofluorescence is performed with anti-PML rabbit antibody (Chemicon) and anti-rabbit FITC goat antibody (Sigma). Sections are then cross-linked with 4% formaldehyde for 10 min and dehydrated with increasing concentrations of ethanol for telomere FISH with a 50 -labelled Cy3(50 -CCCTAA-30 )3 peptide nucleic acid (PNA) probe (Panagene). 0.5 mg/mL PNA probe in hybridisation buffer is applied to the slides, which are then denatured at 80 C for 3 min. After a 3 h hybridisation in the dark at RT, slides are washed in washing solution A for 10 min, counterstained with DAPI in washing solution B for 5–10 min and mounted in the antifade mounting medium. The slides are examined on a Leica DMLB epifluorescence microscope with a cooled charge-coupled device camera (SPOT2; Diagnostic Instruments). 16.3.3.3

APB-Counting for Tumour Specimens

A set of criteria is used to determine the APB status of tumour sections (9). Briefly, an APB is considered to be present if a focus of telomeric DNA is localised within (not adjacent or overlapping) a PML focus in the nucleus. To avoid false positives, the

358

W.‐Q. Jiang et al.

Fig. 16.2 APB assay in soft tissue sarcomas (STS). Examples of combined PML immunofluorescence and telomere FISH in (a) frozen and (b) paraffin-embedded STS tissue sections. Indirect immunofluorescence with fluorescein (FITC) label was used for PML bodies and telomere FISH was performed using a Cy3-conjugated telomeric peptide nucleic acid (PNA) probe (See Color Insert)

telomeric DNA component of the APB must have a more intense fluorescence than the telomeres on that slide (for practical purposes, the working criterion used with the Cy3 conjugated telomeric probe is to require that with the appropriate camera exposure for the telomeric DNA component of the APB, the telomeres are not visible). The section is scored as positive for APBs if they are detected in 10 or more nuclei and in 0.5% or more of the cells in the section (Fig. 16.2a). To avoid artefacts, a cell is not considered to contain APBs if more than 25% of the colocalised foci occur outside nuclei (correcting for ratio of nuclear area to nonnuclear area). Slides are not scored as negative unless >2,000 tumour cell nuclei are examined.

16.3.4

Identification of ALT Genes by APB-Screening Assay

APBs are usually found in <5% of cells within asynchronously growing ALT cell populations. We found, however, that restriction of methionine, an essential amino acid, can induce APB formation in 50–60% of cells within an ALTþ population (19). By combining RNA interference with methionine restriction, we have developed a novel method to identify genes that are involved in formation of APBs and

16 Protocol III: Detection of Alternative Lengthening of Telomeres

359

thus are candidate ALT mechanism genes (19). The principle of this assay is that expression of the gene of interest is modulated prior to methionine restriction to determine whether its encoded protein is needed for APB formation. 16.3.4.1

Methionine Restriction

For methionine restriction, cells are seeded in normal medium and grown to about 50% confluency. Cells are washed once with methionine-free medium before changing to this medium. After four days cells are either fixed for immunostaining, or harvested for isolation of protein. Methionine-deficient medium is reconstituted from methionine and cystine-deficient DMEM (GIBCO) by adding L-cystine (48 mg/L, Sigma).

16.3.4.2

APB Screening by RNA Interference and Methionine Starvation

Cells are seeded into four-well chamber slides (Nunc) one day before transfection of siRNAs. 10 nM siRNA is transfected into cells using HiPerFect transfection reagent according to the manufacturer’s instruction (Qiagen), and 48 h later cells are methionine restricted, and subjected to the second siRNA transfection. Four days later, cells are fixed and immunostained for the target protein and APBs (colocalisation of TRF1, TRF2 or telomeric DNA with PML bodies). Quantitation is carried out by scoring APB-positivity in cells shown by immunostaining to be depleted of the protein of interest. When knockdown results in a significant decrease in the proportion of APB-positive cells, it is concluded that the protein is involved in formation or maintenance of APBs.

16.4

Telomere Length Fluctuation Analysis

Telomere length fluctuation analysis is an assay for detecting ALT activity by measuring the ratios of the p-arm to q-arm telomere fluorescence intensities of an unique identifiable chromosome in a clonal cell population (16). Quantitive telomere FISH (Q-FISH) shows only the heterogeneity of telomere lengths of individual chromosomes in ALT cells (Fig. 16.1b), while the telomere fluctuation assay reveals the rapid changes in telomere lengths of one individual chromosome.

16.4.1

Buffers and Solutions

1. Antifade mounting medium: 90% glycerol buffered with 20 mM Tris-HCl pH 8.0, 2.33% (w/v) 1,4-Diazabicyclo[2.2.2]octane (DABCO).

360

W.‐Q. Jiang et al.

2. Hybridisation buffer: 70% formamide (deionised), 10 mM Tris-HCl pH 7.5, 1% Blocking Reagent (Roche), 5% MgCl2 buffer (82 mM Na2HPO4, 9 mM citric acid, 25 mM MgCl2). 3. Hypotonic buffer: 0.2% NaCitrate, 0.2% KCl. 4. 20
SSC buffer: 3 M NaCl, 0.3 M tri-sodium citrate. 5. Washing solution A: 70% formamide, 10 mM Tris-HCl pH 7.2, 0.1% BSA. 6. Washing solution B:. 0.05 M Tris-HCl pH 7.5, 0.15 M NaCl, 0.05% Tween 20.

16.4.2 Isolation of Metaphase Chromosomes Chromosomes are harvested from 70% confluent cell cultures after arresting the cells with 0.1 mg/mL colcemid (Roche) for 1 h. The cells in metaphase are collected and treated with a hypotonic buffer (0.2% NaCitrate/0.2% KCl) for 10 min depending on the cell types. They are fixed with methanol/acetic acid (3:1) for 20 min on ice and washed twice with the methanol/acetic acid. The metaphase suspensions are stored at 20 C until use. Metaphase spreads are ‘‘dropped’’ onto precleaned, cold wet slides, and heated until the slides are dry.

16.4.3 Telomere FISH The slides containing metaphase spreads are treated with RNase A (100 mg/mL in 2
SSC) at 37 C for 60 min, rinsed in 2
SSC, equilibrated in 10 mM HCl (pH 2.0), and digested with pepsin (0.01% [wt/vol] in 10 mM HCl) at 37 C for 10 min. This is followed by three washes with phosphate-buffered saline (PBS) and postfixation in 1% formaldehyde–PBS for 10 min at RT. The slides are dehydrated in 70, 90, and 100% ethanol series, and then denatured with 0.3 mg/mL Cy3conjugated (CCCTAA)3-PNA probe in hybridisation buffer at 80 C for 3 min on a heating block, and hybridised at RT for 2 h in dark. After hybridisation, slides are washed at RT with washing solution A for 10 min, and washing solution B for 10 min. Slides are counterstained with 0.6 mg/mL of DAPI and mounted with the antifade-mounting medium. Metaphases are evaluated on a Leica DMLB fluorescence microscope with appropriate filter sets for DAPI and Cy3.

16.4.4 Telomere Fluorescence Histogram Analysis The telomeric DNA is visualised on metaphase spreads as described above. The telomeres of a single unpaired distinctive marker chromosome characteristic of the cell line are then subjected to analysis. DAPI and Cy3 images are captured separately as

16 Protocol III: Detection of Alternative Lengthening of Telomeres

361

Fig. 16.3 Telomere length fluctuation assay. (a) A schematic diagram shows the principle underlying the assay. AOI, area of interest where telomere FISH signals are measured. (b) Ratios of p-arm to q-arm telomere FISH signals on an unique chromosome, here the Y chromosome, from 20 metaphase spreads for GM847 (ALT+) and GM639 (TEL+) cells were measured and plotted as described in Sect. 16.4.4. Each bar represents the ratio for an individual Y chromosome. Part b) is reproduced from Perrem et al. (16) with permission from American Society of Microbiology

monochromatic 12-bit images with a cooled charge-coupled device (CCD) camera (SPOT2; Diagnostic Instruments, Sterling Heights, MI). Measurements of fluorescence intensities are carried out as described in Fig. 16.3a. Quantitative histogram analysis is performed with ImagePro Plus 4.0 software (MediaCybernetics, Silver Spring, MD) on the unmodified, non-merged 12-bit monochromatic images captured with exposure times between 0.5 and 2 s with no gamma adjustment. Image bitmap pixel values range from 0 (empty scale = black) to 4,095 (full scale = white) following a linear function of a measured intensity with increasing exposure time. Typically, values for the maximum intensities of the short (p) and the long (q) arm of a consistently present and identifiable marker chromosome are recorded for 20 randomly selected metaphase spreads. The maximal values (<4,095) for p and q-arm telomere FISH intensities of this marker chromosome are corrected for average intensity values of background fluorescence, and the ratios of the p-arm to q-arm fluorescence intensities are plotted in a bar chart (Fig. 16.3b).

16.5

Concluding Remarks

ALT cancers employ a recombination-based telomere maintenance mechanism, which is strikingly different from the mechanism utilised by telomerase-positive cancers. This difference could affect prognosis for certain types of cancers, and the outcome of chemotherapy regimens, especially in the case of any future treatment involving telomerase inhibitors, which are unlikely to be effective against ALTpositive tumours. Given that ~10% of total cancers utilise the ALT mechanism (in some types of cancers such as osteosarcomas, ALT occurs in approximately 50% of

362

W.‐Q. Jiang et al.

total cases), successful telomere-directed therapy will require development of therapeutic agents targeting the ALT mechanism. Although the techniques described here are suitable for research purposes, and APB-staining can be used in histopathology departments, more work is required to develop methods suitable for higher throughput and automation. Acknowledgements We thank Ze-Huai Zhong and Tracy Bryan for advice. This work was supported by a project grant and a program grant from the Cancer Council New South Wales.

References 1. de Lange T. Protection of mammalian telomeres. Oncogene 2002; 21:532–540. 2. Greider CW, Blackburn EH. Identification of a specific telomere terminal transferase activity in Tetrahymena extracts. Cell 1985; 43:405–413. 3. Bryan TM, Englezou A, Gupta J, Bacchetti S, Reddel RR. Telomere elongation in immortal human cells without detectable telomerase activity. EMBO J 1995; 14:4240–4248. 4. Shay JW, Bacchetti S. A survey of telomerase activity in human cancer. Eur J Cancer 1997; 33:787–791. 5. Bryan TM, Englezou A, Dalla-Pozza L, Dunham MA, Reddel RR. Evidence for an alternative mechanism for maintaining telomere length in human tumors and tumor-derived cell lines. Nat Med 1997; 3:1271–1274. 6. Guilleret I, Yan P, Guillou L, Braunschweig R, Coindre JM, Benhattar J. The human telomerase RNA gene (hTERC) is regulated during carcinogenesis but is not dependent on DNA methylation. Carcinogenesis 2002; 23:2025–2030. 7. Hakin-Smith V, Jellinek DA, Levy D, Carroll T, Teo M, Timperley WR et al. Alternative lengthening of telomeres and survival in patients with glioblastoma multiforme. Lancet 2003; 361:836–838. 8. Ulaner GA, Huang HY, Otero J, Zhao Z, Ben-Porat L, Satagopan JM et al. Absence of a telomere maintenance mechanism as a favorable prognostic factor in patients with osteosarcoma. Cancer Res 2003; 63:1759–1763. 9. Henson JD, Hannay JA, McCarthy SW, Royds JA, Yeager TR, Robinson RA et al. A robust assay for alternative lengthening of telomeres (ALT) in tumors demonstrates the significance of ALT in sarcomas and astrocytomas. Clin Cancer Res 2005; 11:217–225. 10. Murnane JP, Sabatier L, Marder BA, Morgan WF. Telomere dynamics in an immortal human cell line. EMBO J 1994; 13:4953–4962. 11. Dunham MA, Neumann AA, Fasching CL, Reddel RR. Telomere maintenance by recombination in human cells. Nat Genet 2000; 26:447–450. 12. Fasching CL, Bower K, Reddel RR. Telomerase-independent telomere length maintenance in the absence of ALT-associated PML bodies. Cancer Res 2005; 65:2722–2729. 13. Marciniak RA, Cavazos D, Montellano R, Chen Q, Guarente L, Johnson FB. A novel telomere structure in human alternative lengthening of telomeres cell line. Cancer Res 2005; 65:2730– 2737. 14. Brachner A, Sasgary S, Pirker C, Rodgarkia C, Mikula M, Mikulits W et al. Telomerase- and alternative telomere lengthening-independent telomere stabilization in a metastasis-derived human non-small cell lung cancer cell line: effect of ectopic hTERT. Cancer Res 2006; 66:3584–3592. 15. Cerone MA, Autexier C, Londono-Vallejo JA, Bacchetti S. A human cell line that maintains telomeres in the absence of telomerase and of key markers of ALT. Oncogene 2005; 24:7893– 78901.

16 Protocol III: Detection of Alternative Lengthening of Telomeres

363

16. Perrem K, Colgin LM, Neumann AA, Yeager TR, Reddel RR. Coexistence of alternative lengthening of telomeres and telomerase in hTERT-transfected GM847 cells. Mol Cell Biol 2001; 21:3862–3875. 17. Yeager TR, Neumann AA, Englezou A, Huschtscha LI, Noble JR, Reddel RR. Telomerasenegative immortalized human cells contain a novel type of promyelocytic leukemia (PML) body. Cancer Res 1999; 59:4175–4179. 18. Wu G, Jiang X, Lee WH, Chen PL. Assembly of functional ALT-associated promyelocytic leukemia bodies requires Nijmegen breakage syndrome 1. Cancer Res 2003; 63:2589–2595. 19. Jiang WQ, Zhong ZH, Henson JD, Reddel RR. Identification of candidate alternative lengthening of telomeres genes by methionine restriction and RNA interference. Oncogene 2007; 26:4635–4647. 20. Tarsounas M, Munoz P, Claas A, Smiraldo PG, Pittman DL, Blasco MA et al. Telomere maintenance requires the RAD51D recombination/repair protein. Cell 2004; 117: 337– 347. 21. Yankiwski V, Marciniak RA, Guarente L, Neff NF. Nuclear structure in normal and Bloom syndrome cells. Proc Natl Acad Sci USA 2000; 97:5214–5219. 22. Stavropoulos DJ, Bradshaw PS, Li X, Pasic I, Truong K, Ikura M et al. The Bloom syndrome helicase BLM interacts with TRF2 in ALT cells and promotes telomeric DNA synthesis. Hum Mol Genet 2002; 11:3135–3144. 23. Johnson FB, Marciniak RA, McVey M, Stewart SA, Hahn WC, Guarente L. The Saccharomyces cerevisiae WRN homolog Sgs1p participates in telomere maintenance in cells lacking telomerase. EMBO J 2001; 20:905–913. 24. Zhu XD, Kuster B, Mann M, Petrini JH, de Lange T. Cell-cycle-regulated association of RAD50/MRE11/NBS1 with TRF2 and human telomeres. Nat Genet 2000; 25:347–352. 25. Wu G, Lee WH, Chen PL. NBS1 and TRF1 colocalize at promyelocytic leukemia bodies during late S/G2 phrases in immortalized telomerase-negative cells. Implication of NBS1 in alternative lengthening of telomeres. J Biol Chem 2000; 275:30618–30622. 26. Zhu XD, Niedernhofer L, Kuster B, Mann M, Hoeijmakers JH, de Lange T. ERCC1/XPF removes the 30 overhang from uncapped telomeres and represses formation of telomeric DNAcontaining double minute chromosomes. Mol Cell 2003; 12:1489–1498. 27. Nabetani A, Yokoyama O, Ishikawa F. Localization of hRad9, hHus1, hRad1 and hRad17, and caffeine-sensitive DNA replication at ALT (alternative lengthening of telomeres)-associated promyelocytic leukemia body. J Biol Chem 2004; 279:25849–25857. 28. Silverman J, Takai H, Buonomo SB, Eisenhaber F, de Lange T. Human Rif1, ortholog of a yeast telomeric protein, is regulated by ATM and 53BP1 and functions in the S-phase checkpoint. Genes Dev 2004; 18:2108–2119. 29. Moran-Jones K, Wayman L, Kennedy DD, Reddel RR, Sara S, Snee MJ et al. hnRNP A2, a potential ssDNA/RNA molecular adapter at the telomere. Nucleic Acids Res 2005; 33:486– 496. 30. Jiang WQ, Zhong ZH, Henson JD, Neumann AA, Chang AC, Reddel RR. Suppression of alternative lengthening of telomeres by Sp100-mediated sequestration of MRE11/RAD50/ NBS1 complex. Mol Cell Biol 2005; 25:2708–2721. 31. Zhong ZH, Jiang WQ, Cesare AJ, Neumann AA, Wadhwa R, Reddel RR. Disruption of telomere maintenance by depletion of the MRE11/RAD50/NBS1 complex in cells that use alternative lengthening of telomeres. J Biol Chem 2007; 282:29314–29322. 32. Potts PR, Yu H. The SMC5/6 complex maintains telomere length in ALT cancer cells through SUMOylation of telomere-binding proteins. Nat Struct Mol Biol 2007; 14:581–590. 33. Grobelny JV, Godwin AK, Broccoli D. ALT-associated PML bodies are present in viable cells and are enriched in cells in the G2 /M phase of the cell cycle. J Cell Sci 2000; 113:4577–4585. 34. Molenaar C, Wiesmeijer K, Verwoerd NP, Khazen S, Eils R, Tanke HJ et al. Visualizing telomere dynamics in living mammalian cells using PNA probes. EMBO J 2003; 22:6631–6641.

364

W.‐Q. Jiang et al.

35. Costa A, Daidone MG, Daprai L, Villa R, Cantu S, Pilotti S et al. Telomere maintenance mechanisms in liposarcomas: association with histologic subtypes and disease progression. Cancer Res 2006; 66:8918–8924. 36. Chen YJ, Hakin-Smith V, Teo M, Xinarianos GE, Jellinek DA, Carroll T et al. Association of mutant TP53 with alternative lengthening of telomeres and favorable prognosis in glioma. Cancer Res 2006; 66:6473–6476. 37. de Lange T, Shiue L, Myers RM, Cox DR, Naylor SL, Killery AM et al. Structure and variability of human chromosome ends. Mol Cell Biol 1990; 10:518–527.

Index

A ABT-888, 240 Activator protein 1 (AP1), 52 Acute myeloid leukemia (AML), 212 Adenovirus death protein (ADP), 298 Adenoviruses, 294 AG14361, 240 Aging, 106 Azidothymidine (AZT), 229 Akt, 61 17-Allylamino-17-demethoxygeldanamycin (17-AAG), 236 ALT-associated PML bodies (APBs), 130, 352 Alternative lengthening of telomeres (ALT), 127, 351 Alternative maintenance mechanism (AMM), 127 Alzheimer’s disease (AD), 110 3-Aminobenzamide (3AB), 239, 285 Androgen receptor (AR), 73 Anticancer drug, 177 Antisense oligonucleotides (ODNs), 233 2-5A ODNs, 234 Aoki, E., 337 APB-screening assay, 358–359 Aplastic anemia, 15 Astrocytoma, 195 Asymmetric division, 212 Ataxia telangiectasia (AT), 106–107 Ataxia telangiectasia-like disorder (ATLD), 106–107 Ataxia telangiectasia mutated (ATM), 94, 157

ATM and Rad3-related protein (ATR), 94 ATM pathway, 35–36 ATR interacting protein (ATRIP), 95 ATR pathway, 33–34

B BAL, 189, see bronchoalveolar lavage BCR-ABL, 217 BIBR1532, 232 Bile duct cancers, 192 Biomarkers, 187 diagnostic marker, 188 screening, 187 Bladder cancer, 193 Blm, 160 Bloom syndrome (BLM), 107–108, 160 Bone marrow failure syndrome aplastic anemia, 219 Diamond–Blackfan anemia, 219 dyskeratosis congenita (DC), 109, 219 Fanconi anemia, 219 myelodysplastic syndrome (MDS), 218 Shwachman–Diamond syndrome, 219 BRACO19, 238, 269 Brain tumors, 195 astrocytoma, 195 glioma, 195 BRCA1, 50, 98 BRCA2, 98 Breast tumors, 190 Bronchoalveolar lavage (BAL), 189 BSU1051, 272

365

366

C c-Abl protein, 62 Cancer, 13, 109–110 cell, 173 initiating cell, 177 stem cells, 12, 152, 173, 177 Cancer diagnostics, 303 imaging, 303 Ad-GFP, 304 green fluorescent protein (GFP), 304 TelomeScan (OBP-401), 304 micrometastasis, 305 Carcinogenesis, 174 CCAAT box, 73 CD34, 212 CD38, 212 cdk, 175 Cellular immortalization, 13, 174 Cervical cancer, 193 CG7870, 303 Chaperone inhibitors, 236 Chaperones, 65 Childhood malignant tumors, 195–197 Chromosome orientation fluorescence in situ hybridization (CO-FISH), 133 Chronic myeloid leukemia (CML), 216 Clinical trials, 240 c-Myc, 54–55 Colon, 191 Coxsackie adenovirus receptor (CAR) gene, 302 Crisis, 11. See also Mortality stage 2 (M2) Crypts, 191 Cytology, 190 Cytotoxic T-lymphocytes (CTL), 300

D Danger signals, 300 DCIS, see ductal carcinoma in situ, 190 Depcrynski, A.N., 47 Diagnosis, 187 Diagnostic marker, 188 Diamond–Blackfan anemia, 219 Diehl, M.C., 87 Digestive organs, 191 bile duct cancers, 192

Index

gastric cancers, 191 hepatoblastoma, 192 hepatocellular carcinomas, 192 intraductal papillary mucinous neoplasms (IPMN), 192 pancreatic ductal adenocarcinomas, 192 Dimitrova, N., 23 D-loop, 89 DNA damage response, 93–94 mismatch repair (MMR), 161–162 repair, 96–97 DNA-dependent protein kinase catalytic subunit (DNA-PKcs), 99, 160 Dominant-negative mutant of hTERT (DN-hTERT), 227 Double strand break (DSB), 29, 89 Drosophila, 103 Ductal carcinoma in situ (DCIS), 190 Dyskeratosis congenita (DC), 15, 109

E E1A, 71, 298 E1B, 298 E-box, 48 E6/E6AP, 63–64 E2F, 57–58 Elmore, L.W., 47, 87 End-replication problem, 9 Epigallocatechin gallate (EGCG), 232 Esophageal tumors, 188–190 Estrogen receptor (ER), 72 Estrogen response element (ERE), 72 EWS-ETS, 56–57 Exonuclease-1 (Exo-1), 161 Extra chromosomal telomeric repeat (ECTR), 131

F 14-3-3 family, 70 Fibroadenoma, 190 Fine needle aspirates (FNA), 189 Fluorescence in situ hybridization (FISH), 128, 355

Index

FR901228, 302 Fujiwara, T., 293

G Gastric cancers, 191 Geldanamycin (GA), 236 Gene therapy, 294 Genitourinary organs, 193 bladder cancer, 193 cervical cancer, 193 prostate cancer, 193 Genomic instability, 92 syndromes, 106 Germ cells, 173 Germline cells, 3 Glioma, 195 Goldblatt, E.M., 225 GQN1, 255 G-quadruplex, 251 inhibitors 12459, 271 307A, 272 BRACO19, 269 BSU1051, 272 PIPER, 272 QQ58, 272 RHPS4, 270 telomestatin, 268–269 TMPyP4, 270–271 ligands, 267 Green fluorescent protein (GFP), 306 GRN163, 234 GRN163L, 230, 234, 240 G-tail, 337 G-tail telomere hybridization protection assay (HPA), 346

H hALP, 55 Haploinsufficiency, 15 Hayflick limit, 9, 11. See also Mortality stage 1 (M1) Head and neck tumors, 188–190 Heat shock proteins, 65–66 Hematopoietic malignancies, 211

367

Acute myeloid leukemia (AML), 212 BCR-ABL, 217 Chronic myeloid leukemia (CML), 216 myelodysplastic syndrome (MDS), 218 leukemia cells, 215 niche, 212 self-renewal, 212 stemness, 211 Hematopoietic stem cells (HSCs), 211 Henson, J.D., 351 Hepatitis B virus (HBV), 71–72 Hepatoblastoma, 192 Hepatocellular carcinoma, 192 Herbert, B.S., 225 Heterochromatin protein 1 (HP1), 68–69 Heterogenous nuclear ribonucleoproteins (hnRNPs), 73–74 Histone acetyl transferase (hALP), 55 Hiyama, E., 3, 171, 181, 315 Hiyama, K., 3, 171, 181 Holt, S.E., 47, 87 Homologous recombination (HR), 36–37, 97–98 HPV E6 and E2, 70 HPV proteins, 70 hsp90, 65 hTER, See TERC hTERC, See TERC hTERT, See TERT hTR. See TERC Huang, X., 149 Human mesanchymal stem cells (hMSCs), 14 Human papilloma virus (HPV) 16 E6, 56 E6 and E2, 70–71 Human telomerase reverse transcriptase (hTERT), 12, 182, 327. See TERT promoter, 295 Human telomerase RNA (hTR), 182. See TERC Hutchinson-Guilford progeria syndrome (HGPS), 108 Hybridization protection assay (HPA), 346 Hybridization protection assay (HPA)-TRAP, 326 Hypoxia inducible factor 1 (HIF1a), 57

368

I Idiopathic pulmonary fibrosis (IPF), 15 Immortalization. See Cellular immortalization Immunofluorescence/telomere FISH, 355 Immunohistochemistry (IHC), 186, 330 Immunomagnetic separation, 194 Induced pluripotent stem (iPS) cells, 177 In situ hybridization (ISH), 186, 328 In situ TRAP assay, 326–327 Interferon g (IFN-g), 300 Interferon-g/interferon regulatory factor-1 (IRF1), 52 Internal telomerase assay standard (ITAS), 322 Intraductal papillary mucinous neoplasms (IPMN), 192

J Jiang, W.Q., 351 Jun N-terminal kinase (JNK) pathway, 55–56 Ju, Z., 149

K Kinases, 60 Kinase inhibotor protein (KIP), 62 Ku70, 99 Ku80, 99

L Large-T, 174 Lagging strand problem, 9 Latency-associated nuclear antigen (LANA) protein, 71 Latent membrane protein (LMP) 2A, 71 Leading strand problem, 9 Leukemia cells BCR-ABL, 217 chronic myeloid leukemia (CML), 216 Leukemic stem cells (LSCs), 212 Li-Fraumeni syndrome (LFS), 143

Index

Ligases, 63 Long-term HSCs (LT-HSCs), 213 Lung cancer, 191 Lymphocytes, 13

M Magnetic bead retrieval-TRAP assay, 326 Makorin RING finger protein 1 (MKRN1), 63 Malignant melanomas, 194 MDM2, 73 Mesenchymal stem cells, 177 Metastatic lesions, 174 Micrometastasis, 307 Minisatellite instability, 137 Mitogen activated protein kinase (MAPK), 62 Modified TRAP assay, 321 Mortality stage 1 (M1), 11, 171 Mortality stage 2 (M2), 11, 171 Mortality stage mechanisms, 11–12 Mouse model, 152–153 MRN, 94 MS32, 137 MST-312, 232 mTR
/
, 14. See Terc
/
Multipotency, 177 Mutant template hTer (MT-hTer), 235 Myc/Max, 49 Myelodysplastic syndrome (MDS), 218

N Neck tumors, 188–190 Negative transcriptional regulators, 48 activator protein (AP1), 52 breast cancer 1 (BRCA1), 50–51 human telomerase reverse transcriptase (hTERT)-promoter, 48 IRF1, p27kip1, TGFb, Smad3, SIPI, 52 Mad/Max, 48–50 p53, 51 Rb protein, 51–52 Wilms’ tumor 1 (WT1), 53 Neumann, A.A., 351

Index

Neuroblastoma, 197 Neurodegenerative diseases, 110 NHEJ, 36–37, 99. See Non homologous end joining Niche, 151, 212 Nijmegen break syndrome (NBS), 107 Nishiyama, M., 171 Nmi, 50 Nonhomologous end joining (NHEJ), 36–37, 99 N30 ‐P50 thio-phosphoramidates (NPS), 234 Nuclear factor g (NF-g), 73 Nucleolin, 69, 255 Nucleoside analog, 229

O OBP-301, See Telomelysin OBP-401, See TelomeScan OBP-405, See Telomelysin-RGD Ohyashiki, J.H., 211 Ohyashiki, K., 211 20 -O-methoxyethyl RNA (MOE RNA), 234 20 -O-methyl RNA (20 -O-MeRNA), 234 Oncolytic vectors, 294 Oncolytic virotherapy, 297 adenovirus death protein (ADP), 298 CG7870, 303 coxsackie adenovirus receptor (CAR) gene, 302 cytotoxic T-lymphocytes (CTL), 300 danger signals, 300 EIA gene, 298 EIB gene, 298 FR901228, 302 Interferon g (IFN-g), 300 ONYX-015, 301 Telomelysin (OBP-301), 298 VRX-011, 298 30 overhang, 29–30, 286 30 overhang protection assay, 345–346

P p23, 65 Pancreatic ductal adenocarcinomas, 192 Peptide nucleic acids (PNAs), 233

369

Peritoneal lavage, 192 Phosphoinositide-3-kinase-related kinases (PIKKs), 94 Pickett, H.A., 127 p16Ink4a/p19Arf, 159 PINX1, 67, 70 PIPER, 238, 272 PJ-34, 239, 285 p27kip1, 52 Pleural effusion, 192 PML bodies, 352 PMS2, 161 Poly (ADP-ribose) polymerases (PARPs), 64–65, 236, 284 Positive transcriptional regulators, 54 c-Myc, 54–55 EWS-ETS, 56–57 HPV 16 E6, STAT3, 56 hypoxia inducible factor 1 (HIF1a), 57 JNK pathway, 55–56 survivin, hALP, TEIF, 55 Posttranslational regulators, 60 Akt, 60 c-Abl, 62 E6/E6AP, 63–64 Kinase inhibitor protein (KIP), 62 Makorin RING finger protein 1 (MKRN1), 63 mitogen activated protein kinase (MAPK), 62–63 poly (ADP-ribose) polymerases (PARPs), 64–65, 284 protein kinase (PKC), 61 protein phosphatase 2A (PP2A), 60–61 Smurf2, 63 p16 protein, 159, 175 p21 protein, 158–159 p23 protein, 65 p53 protein, 157–158, 174 p73 protein, 59 Premalignant lesions, 187 Premature aging syndromes, 105 Primary lesions, 174 Primer extension-nick translation (PENT), 344–345 Progesterone receptor (PR), 72–73 Prognosis, 195 Prognostic marker, 187

370

Promyelocytic leukaemia protein nuclear bodies (PML-NBs), 130, 352 Prostate cancer, 193 Protein kinase (PKC), 61, 160 Protein phosphatase 2A (PP2A), 60–61 Punchihewa, C., 251

Q QQ58, 272 Quantitive telomere FISH (Q-FISH), 359

R Rad51, 98 Rad52, 98 Rad54, 98 RAP1, 27, 39 ras, 174 Rb, 51 Rb pathways, 174 Reactive oxygen species (ROS), 94 Real-time Quantitative TRAP assay, 324–325 RecQ helicases, 255 Reddel, R.R., 127, 351 Replication-defective adenoviruses, 294 Replicative senescence, 9 Reverse transcriptase-polymerase chain reaction (RT-PCR), 327 RHPS4, 238, 270 Ribozymes, 235

Index

TIN2, 26–27 TPP1, 27 TRF1, 25–26, 283 TRF2, 25–26, 287 Shimamoto, A., 337 Short-term HSCs (ST-HSCs), 213 Shwachman–Diamond syndrome, 219 30 single-strand overhang, 4, 286–287 SIP1, 52 Sister chromatid exchanges (SCEs), 133 Skin cancer, 194 Smad3, 52 Smurf2, 63 Soft tissue tumors, 194 Solid tumors, 181 Somatic cells, 3, 13, 173 Southern-based terminal restriction fragment (TRF) analysis, 354–355 Sp1, 58 Specific accessory factors 1 (Sp1), 58 STAT3, 56 Stem cells, 12, 150, 173, 177 cancer stem cell, 12, 152, 173, 177 dysfunction, 149 hematopoietic stem cells (HSCs), 151, 211 Stemness, 177, 211 Stem/progenitor cells, 13 Super-Tert mouse model, 156–157 Survivin, 55 SV40, 175 Symmetric division, 212

T S Sachs, P.C., 47 Scintillation proximity assay (SPA)-TRAP, 324 Seimiya, H., 281 Self-renewal capacity, 151, 177 Self-renewal tissues, 13 Sera, A.M., 337 Shay, J.W., 3 Shelterins, 14, 24, 287 POT1, 27, 287 Rap1, 27–28

Tahara, H., 337 Tanaka, N., 293 Tanimoto, K., 171 Tankyrase 1, 39–40, 283 Tankyrase inhibitors ABT-888, 240 AG14361, 240 3-aminobenzamide (3AB), 239 PJ-34, 239 T-circles, 135 TEIF, 55 Telomelysin (OBP301), 298

Index

Telomelysin-RGD (OBP-405), 308 Telomerase, 12, 225 activation, 172 activity, 189, 315 human telomerase reverse transcriptase (hTERT), 12, 327. See TERT hybridization, 328–330 hybridization protection assay (HPA)TRAP, 326 immunohistochemistry (IHC), 330 internal telomerase assay standard (ITAS), 322 magnetic bead retrieval-TRAP assay, 325 modified TRAP assay, 321 real-time quantitative TRAP assay, 324–325 reverse transcriptase-polymerase chain reaction (RT-PCR), 327 scintillation proximity assay (SPA)-TRAP, 324 telomerase RNA component (TERC), 12, 327 telomeric repeat amplification protocol (TRAP) assay, 316 TRAP assay, 316 TRAP-ELISA, 325 two-primer-TRAP (TP-TRAP), 323 expression, 315 functions, 10 reverse-transcriptase, 12 RNA component, 12, 327 telomerase reverse-transcriptase, 12, 327 Telomerase inhibitor, 225 clinical trials, 240 G-quadruplex interacting agents, 238, 251, 267 BRACO19, 238, 269 cationic porphyrin, TMPyP4, 238, 270–271 PIPER, 238, 272 RHPS4, 238, 270 telomestatin, 238, 268–269 hTERC (TERC, hTR or hTER), 233 2-5A ODNs, 234 GRN163, 234 GRN163L, 234

371

GRN163L, clinical trials, 240–241 mutant template hTer (MT-hTer), 235 N30 ‐P50 thio-phosphoramidates (NPS), 234 20 ‐O‐methoxyethyl RNA (MOE RNA), 234 20 ‐O‐methyl RNA (20 ‐O‐MeRNA), 234 peptide nucleic acids (PNAs), 234 ribozymes, 235 hTERT (TERT), 228 BIBR1532, 232 dominant-negative mutant of hTERT (DN-hTERT), 227 epigallocatechin gallate (EGCG), 232 MST-312, 232 nucleaoside analog, 229 TERT vaccine (immunotherapy), 241 tankyrase inhibitors, 239 ABT-888, 240 AG14361, 240 3-aminobenzamide (3AB), 239, 285 PJ-34, 239, 285 telomerase-associated proteins, 236 17-allylamino-17-demethoxygeldanamycin (17-AAG), 236 chaperone inhibitors, 236 17-DMAG, 236 geldanamycin (GA), 236 HSP90 inhibitors, 236 novobiocin, 237 poly (ADP-ribose) polymerase (PARP) inhibitors, 236 radiciol, 237 Telomerase regulation, 47 hTERT promoter, 48 negative transcriptional regulators, 48 activator protein (AP1), 52 BRCA1, 50–51 IRF1, p27kip1, TGFb, Smad3, SIPI, 52 Mad/Max, 48–50 p53, 51 Rb, 51–52 Wilms’ tumor 1 (WT1), 53 positive transcriptional regulators, 54 c-Myc, 54–55 EWS-ETS, 56–57

372

HPV 16 E6, STAT3, 56 hypoxia inducible factor 1 (HIF1a), 57 JNK pathway, 55–56 survivin, hALP, TEIF, 55 Telomerase reverse-transcriptase (TERT), 12, 182, 327 Telomerase RNA component (TERC), 182, 233, 327 Telomere-associated proteins, 28, 88, 236 Telomere-binding proteins, 14, 23, 90 shelterin, 14, 25, 287 POT1, 27, 287 Rap1, 27–28 TIN2, 26–27 TPP1, 27 TRF1, 25–26, 283 TRF2, 25–26, 287 Telomere position effect (TPE), 10 Telomere, 4, 88, 351 bouquet formation, 10 dysfunction, 15, 92–93 fluorescence in situ hybridization (FISH), 128, 355 function, 10 G-tail length, 341 G-tail telomere HPA (hybridization protection assay), 346 30 overhang protection assay, 345–346 primer extension-nick translation (PENT), 344–345 telomeric-oligonucleotide ligation assay (T-OLA), 343–344 hypothesis, 11, 171 lagging and leading strand problem, 9 length, 339 POT1 and TPP1, 39 tankyrase 1, 39–40 TRF1, 38 TRF2 and Rap1, 39 length fluctuation analysis, 359 length regulation, 37, 283 30 ‐overhang, 29–30, 286–287 poly (ADP-ribose) polymerase (PARP), 284 POT1, 27, 287 shelterin, 24, 287–288

Index

tankylase 1, 283 telomeric repeat-binding factor 1 (TRF1), 25–26, 283 telomeric repeat-binding factor 2 (TRF2), 287 maintenance, 91–92, 127 position effect (TPE), 10 shortening, 4, 173 30 single-strand overhang, 4 structure, 4, 23 telomere-associated proteins double-stranded breaks, 89 T-loop and D-loop, 89 Telomeric-oligonucleotide ligation assay (T-OLA), 343–344 Telomeric recombination, 133–135 Telomeric repeat amplification protocol (TRAP), 185, 316 HPA-TRAP, 326 in situ TRAP assay, 326 magnetic bead retrieval assay, 326 real-time quantitative TRAP assay, 324 SPA-TRAP, 324 TP-TRAP, 324 Transcription-mediated amplification/ HPA, 326 TRAP-ELISA, 325 Telomeric repeat-binding factor 1 (TRF1), 25–26, 38, 283 Telomeric repeat-binding factor 2 (TRF2), 25–26, 39, 287 TelomeScan (OBP-401), 304 Telomestatin, 238, 268–269 TelRNAs, 9 TERC, 12, 182, 233, 327. See Telomerase RNA component Terc
/
mice, 153, 156, 227 Terminal restriction fragment (TRF) lengths, 128, 354 TERRA, 9 TERT, 12, 182, 327. See Telomerase reverse-transcriptase TERT mRNA, 189 TERT vaccine, 241 TGFb, 52 Thyroid tumors, 190 TIN2, 26–27

Index

Tissue specific stem cells, 155 T-loop formation, 31–32 T-loops, 4, 30, 89, 135–137 TMPyP4, 238, 270–271 Topoisomerase IIa, 67–68 TPE. See Telomere position effect TPP1, 27, 38 Transcriptional elements-interacting factor (TEIF), 55 Transcription-mediated amplification and hybridization protection assay (TMA/HPA), 326 Transformation, 176 TRAP-ELISA, 325 TRF1, 25–26, 38, 283. See Telomeric repeat-binding factor 1 TRF2, 25–26, 39, 287. See Telomeric repeat-binding factor 2 T-stumps, 9 Tsuruo, T., 281 Tumor growth factor (TGFb), 52 Tumorigenesis, 176 Tumor necrosis factor-a (TNFa), 69–70 Two mortality stage mechanisms, 11, 171 Two-primer TRAP (TP-TRAP), 324

373

U Upstream stimulatory factor (USF) 1 and 2, 58–59 Urata, Y., 293

V VRX-011, 298

W Werner syndrome (WRN), 107, 160. Wilms’ tumor 1 (WT1), 53 Wrn, 98

X XRCC2, 98 XRCC3, 98

Y Yang, D., 251